USF Libraries
USF Digital Collections

Detection and quantification of Karenia brevis using carbon fixation gene expression analysis

MISSING IMAGE

Material Information

Title:
Detection and quantification of Karenia brevis using carbon fixation gene expression analysis
Physical Description:
Book
Language:
English
Creator:
Gray, Michael Alan, 1975-
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
rbcL
real-time PCR
red tide
harmful algal bloom
monitoring
Gulf of Mexico
Gymnodinium breve
Dissertations, Academic -- Marine Science -- Masters -- USF   ( lcsh )
Genre:
government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Karenia brevis (Davis cf. Hansen & Moestrup = Gymnodinium breve) is the non-peridinin containing dinoflagellate responsible for many harmful algal blooms (red tides) in the Gulf of Mexico. These recurrent blooms can have significant negative ecological, economic, and human health impacts including fish kills, tainting of shellfish, poisoning of marine mammals, loss of tourism revenue due to beach closures, and respiratory distress and food poisoning in humans. A method for detection of Karenia brevis was developed based upon amplification of the mRNA for the plastid-encoded gene of the carbon fixing enzyme ribulose 1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) large subunit (rbcL). Using sequence information from a primer set targeting a 554-bp region of the Karenia rbcL gene, a small (91 bp amplicon) primer and probe set was created for TaqMan(registered trademark) real time RT-PCR of K. brevis rbcL. The primer/probe set is sensitive to as little as 0.1 fg of target transcript and as little as 1 pg of total cellular K. brevis RNA extract, corresponding to less than 1 cell reaction-1. The primer/probe set did not amplify rbcL transcript from any of the non-target algae tested. Bloom samples analyzed by this method have shown the assay to be a reliable method, with effective enumeration and a linear relationship showing good correlation to the cell counts by microscopy (r2= 0.8344). The assay has been shown to be robust and perform well even in non-ideal conditions, with pre-extraction RNA from unialgal culture stable at room temperature for up to 3 days and up to a month at -80 degrees C in Stratagene's lysis buffer. The transcription of the rbcL gene demonstrated minor variation throughout the diel period, however the variation was not linked to the diel cycle or to carbon fixation, which showed a distinct diel signal. Due to the relatively constant expression of the rbcL gene, the real-time RT-PCR assay developed should be able to reliably enumerate K. brevis populations in the natural environment, as long as the sample is placed in Stratagene's lysis buffer and processed within one or two days or frozen at -80 degrees C and processed within a month.
Thesis:
Thesis (M.S.)--University of South Florida, 2004.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Michael Alan Gray.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 118 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001469348
oclc - 55520255
notis - AJR1102
usfldc doi - E14-SFE0000250
usfldc handle - e14.250
System ID:
SFS0024945:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001469348
003 fts
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 040524s2004 flua sbm s000|0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0000250
035
(OCoLC)55520255
9
AJR1102
b SE
SFE0000250
040
FHM
c FHM
090
GC11.2
1 100
Gray, Michael Alan,
d 1975-
0 245
Detection and quantification of Karenia brevis using carbon fixation gene expression analysis
h [electronic resource] /
by Michael Alan Gray.
260
[Tampa, Fla.] :
University of South Florida,
2004.
502
Thesis (M.S.)--University of South Florida, 2004.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 118 pages.
520
ABSTRACT: Karenia brevis (Davis cf. Hansen & Moestrup = Gymnodinium breve) is the non-peridinin containing dinoflagellate responsible for many harmful algal blooms (red tides) in the Gulf of Mexico. These recurrent blooms can have significant negative ecological, economic, and human health impacts including fish kills, tainting of shellfish, poisoning of marine mammals, loss of tourism revenue due to beach closures, and respiratory distress and food poisoning in humans. A method for detection of Karenia brevis was developed based upon amplification of the mRNA for the plastid-encoded gene of the carbon fixing enzyme ribulose 1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) large subunit (rbcL). Using sequence information from a primer set targeting a 554-bp region of the Karenia rbcL gene, a small (91 bp amplicon) primer and probe set was created for TaqMan(registered trademark) real time RT-PCR of K. brevis rbcL. The primer/probe set is sensitive to as little as 0.1 fg of target transcript and as little as 1 pg of total cellular K. brevis RNA extract, corresponding to less than 1 cell reaction-1. The primer/probe set did not amplify rbcL transcript from any of the non-target algae tested. Bloom samples analyzed by this method have shown the assay to be a reliable method, with effective enumeration and a linear relationship showing good correlation to the cell counts by microscopy (r2= 0.8344). The assay has been shown to be robust and perform well even in non-ideal conditions, with pre-extraction RNA from unialgal culture stable at room temperature for up to 3 days and up to a month at -80 degrees C in Stratagene's lysis buffer. The transcription of the rbcL gene demonstrated minor variation throughout the diel period, however the variation was not linked to the diel cycle or to carbon fixation, which showed a distinct diel signal. Due to the relatively constant expression of the rbcL gene, the real-time RT-PCR assay developed should be able to reliably enumerate K. brevis populations in the natural environment, as long as the sample is placed in Stratagene's lysis buffer and processed within one or two days or frozen at -80 degrees C and processed within a month.
590
Adviser: Paul, John H.
653
rbcL.
real-time PCR.
red tide.
harmful algal bloom.
monitoring.
Gulf of Mexico.
Gymnodinium breve.
690
Dissertations, Academic
z USF
x Marine Science
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.250



PAGE 1

Detection And Quantification Of Karenia Brevis By Carbon Fixation Gene Expression Analysis by Michael Alan Gray A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science College of Marine Science University of South Florida Major Professor: John H. Paul, P h D Gabriel Vargo, Ph.D David Mann, Ph.D Date of Approval: March 4, 2004 Keywords: rbcl, real-time pcr, red tide, harmful algal bloom, monitoring, gulf of mexico, gymnodinium breve Copyright 2004 Michael A. Gray

PAGE 2

i i Table of Contents List of Tables iii List of Figures iv Abstract vii Chapter One: Introduction 1 Chapter Two: Development of assay, sensitivity and specificity testing 16 Introduction 16 Methods 18 Design of Real-Time RT-PCR Primer and Probe Set 18 Culture Conditions 18 DNA extraction, amplification, cloning and sequencing 19 Sequence analysis 20 Testing of the Real Time RT-PCR Primer and Probe Set 21 Optimization of Reaction Conditions 21 Sensitivity and specificity testing 21 Results 23 Phylogenetic analysis 23 Real-time RT-PCR 30 Discussion 41 Chapter Three: Testing of the assay, field samples, diel studies and method evaluation 43 Introduction 43 Methods 45 RNA extraction and amplification from environmental samples 45 Diel Experiments 46 Cultures and culture conditions 46 Sampling schedule, cell counts and RNA extraction 46 Carbon Fixation 47 Alkalinity determination 48 Evaluation of real-time assay reagents and extraction methods 48 Room temperature and freezer (-80 C) stability of K. brevis lysates 48

PAGE 3

ii ii Alternative extraction methods 49 Results 51 Field samples 51 Diel studies 56 Room temperature stability in lysis buffer 63 Freezer stability in lysis buffer 64 Alternative extraction methods 64 Discussion 74 References 83 Appendices 90

PAGE 4

iii iii List of Tables Table 1: Percent identity of rbcL sequences from selected algal species 25 Table 2: Accession for sequences used in phylogenetic analyses 28 Table 3: Positive and negative controls for amplification by real-time RT-PCR 31 Table 4: Bloom samples counted by microscopy and inferred counts by real-time RTPCR 53

PAGE 5

iv iv List of Figures Figure 1: Theoretical amplification curves that would be generated through real-time RTPCR 11 Figure 2: The Taq nuclease assay (TNA) process 13 Figure 3: Phylogenetic tree based on rbcL amino acid sequences 27 Figure 4: An example standard curve generated using in vitro transcript 34 Figure 5: An example standard curve generated using whole cell RNA extract 36 Figure 6: Composite of all transcript standard curves 38 Figure 7: Composite of all cell standard curves 40 Figure 8: Cell counts by microscopy the real-time RT-PCR assay 55 Figure 9: Carbon fixation over the diel periods 58 Figure 10: RNA transcription over the diel periods 60 Figure 11: Average carbon fixation and average rbcL transcription for all of the diel experiments 62 Figure 12: RNA stability at room temperature A) Room temperature stability in Qiagens RLT buffer 66 B) Room temperature in Stratagenes Lysis buffer 67 Figure 13: Average percent of initial RNA signal after storage at room temperature 69 Figure 14: RNA stability in Stratagenes Lysis buffer after storage at C 71 Figure 15: Detected rbcL RNA signal following alternative extraction methods 73

PAGE 6

v v Figure 16: Cell counts by microscopy and the real-time assay A) Cell counts by microscopy and the real-time RT-PCR assay not including samples stored at C for over one month 79 B) Cell counts by microscopy and the real-time RT-PCR assay including samples stored at C for over one month 80

PAGE 7

vi vi Detection and Quantification of Karenia brevis by Carbon Fixation Gene Expression Analysis Michael Gray ABSTRACT Karenia brevis (Davis cf. Hansen & Moestrup = Gymnodinium breve ) is the nonperidinin containing dinoflagellate responsible for many harmful algal blooms (red tides) in the Gulf of Mexico. These recurrent blooms can have significant negative ecological, economic, and human health impacts including fish kills, tainting of shellfish, poisoning of marine mammals, loss of tourism revenue due to beach closures, and respiratory distress and food poisoning in humans. A method for detection of Karenia brevis was developed based upon amplification of the mRNA for the plastid-encoded gene of the carbon fixing enzyme ribulose 1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) large subunit ( rbcL ). Using sequence information from a primer set targeting a 554-bp region of the Karenia rbcL gene, a small (91 bp amplicon) primer and probe set was created for TaqMan real time RT-PCR of K. brevis rbcL The primer/probe set is sensitive to as little as 0.1 fg of target transcript and as little as 1 pg of total cellular K. brevis RNA extract,

PAGE 8

vii vii corresponding to less than 1 cell reaction -1 The primer/probe set did not amplify rbcL transcript from any of the non-target algae tested. Bloom samples analyzed by this method have shown the assay to be a reliable method, with effective enumeration and a linear relationship showing good correlation to the cell counts by microscopy (r 2 = 0.8344). The assay has been shown to be robust and perform well even in non-ideal conditions, with pre-extraction RNA from unialgal culture stable at room temperature for up to 3 days and up to a month at C in Stratagenes lysis buffer. The transcription of the rbcL gene demonstrated minor variation throughout the diel period, however the variation was not linked to the diel cycle or to carbon fixation, which showed a distinct diel signal. Due to the relatively constant expression of the rbcL gene, the real-time RT-PCR assay developed should be able to reliably enumerate K. brevis populations in the natural environment, as long as the sample is placed in Stratagenes lysis buffer and processed within one or two days or frozen at C and processed within a month.

PAGE 9

1 1 Chapter 1: Introduction all the waters that were in the river were turned to blood. And the fish that were in the river died; and the river stank, and the Egyptians could not drink of the water of the river (Exodus 7: 20-21) Throughout the world, harmful algal blooms (HABs) are chronic and often costly problems that have been a nuisance throughout history. The above quote from the Bible is believed to be the earliest written record of a HAB (22); however coastal communities from much earlier times likely encountered occasional bloom events. The Hebrew dietary rules include an injunction against consuming shellfish, perhaps partly due to their potential to carry HAB contamination. Dale and Yentsch (9) and Carson (6) note that early explorers of North America frequently found Native American tribes with taboos against eating shellfish, as well as some tribes that kept a nightly watch for bioluminescence and daily a watch for discolored water (which can be indicators of a dinoflagellate bloom) in order to avoid harvesting and consuming potentially toxic seafood. In the Gulf of Mexico, waters stained red, presumably by algal blooms, have been described as early as in the ships logs of the Spanish explorers. A massive local bloom was brought to the notice of Gunther (20) who described fish kills from north of the Dry Tortugas as far north as Boca Grande. It was estimated that as many as 50 million fish

PAGE 10

2 2 including a Goliath Grouper were killed as well as turtles. A patch of water stained yellow, once investigated revealed a large population of Gymnodinium sp. ( Karenia sp.) along with an acrid gas that escaped from the water when boiled, later to be identified as aerosolized brevetoxin. This species was initially described in detail by Davis (10) as an unarmored dinoflagellate, with a width and height ranging from 25 to 32 m, a thickness of about 12 m, containing many plastids and a nucleus placed below the girdle and slightly to the left of the sulcus and named Gymnodinium brevis The name has been changed over the years to more closely reflect evolutionary descent community of the group, with the currently accepted name of Karenia brevis in recognition of Karen Steidingers significant contribution to the knowledge about this organism. The characterization of K. brevis has been further expanded to its unusual pigment characteristics. Karenia brevis does not contain peridinin, the accessory pigment found in the plastids of most autotrophic dinoflagellates. The primary chemotaxonomic pigments are fucoxanthin, 19-hexanoyloxyfucoxanthin and 19butanyloxyfucoxanthin with smaller concentrations of the accessory pigments carotene, 19-hexanoyloxyparacentrone 3-acetate and gyroxanthin diester. The pigment complement found in K. brevis, K. mikimotoi and Karlodinium micrum are very similar and almost identical to the Haptophyte Pelagomonas calceolata (4). The unusual plastid pigment complement is due to the incorporation of a plastid from a Haptophyte through tertiary endosymbiosis (30), which it shares with other closely related dinoflagellates, such as K. mikimotoi (59). When blooming, K. brevis tends to aggregate near the surface of the water (54) and this has been attributed to a combination of positive

PAGE 11

3 3 phototaxis and negative geotaxis (31), with non-directional dispersal at night. Karenia brevis is not constrained to the surface of the water and unless there is a significant pycnocline through which it cannot swim, it has been found throughout the shallow water column. Karenia brevis is capable of swimming at a speed of ca. 1 m h -1 (55). Blooms of K. brevis in the Gulf of Mexico that typically affect the west Florida shelf initiate in the mid-shelf waters (61). Blooms of this organism are not thought to be due to an increased growth rate, but rather the concentration of the organisms through physical processes, thus the term bloom refers to the aggregation of cells, not to accelerated growth (61). Shoreward movement of water masses associated with the Loop Current can carry early bloom populations of K. brevis into nearshore waters where they may remain and become more dense, affecting the residents of the nearshore waters. Blooms may move into local estuaries as the water masses in which they are entrained are moved by wind and currents (38) Throughout the past century, K. brevis blooms have been recurrent problems, especially for the west coast of Florida. A chronology of K. brevis HAB events compiled by Mote Marine Lab indicates blooms occurring in 30 of the last 57 years and every year since 1991 (14 of 14 years). One of the events in 1952 was so severe that Clearwater Mayor Herbert Brown sought approval to fire-bomb the dead fish with napalm to prevent their arrival onshore. More than 150 tons of dead fish killed by a bloom washed ashore and had to be removed in 1967. While the most often affected animals are fish, there are occasionally other animals affected, including waterfowl (Cormorants (34) Mergansers

PAGE 12

4 4 and lesser Scaups (12)), Dolphins (15), Manatees, (7 in 1963, (36), 39 in 1982, (46) 149 in 1996, (5) and 98 in 2003 (FMRI press release)) and Sea Turtles. The effects of K. brevis on humans are dependent on the type of exposure. Most commonly this exposure occurs as a result of inhalation of aerosolized toxin, which can lead to irritation of the eyes, nose and throat, and is most likely at or near the beach/shore with an accompanying onshore breeze (48). Less frequent, but more troublesome are cases of ingestion via contaminated seafood. Filter-feeding seafood such as mussels, clams, and oysters can potentially concentrate brevetoxins to levels that are dangerous to humans. Intoxication from contaminated shellfish can result in neurotoxic effects caused by brevetoxins action on voltage sensitive sodium channels resulting in repeated uncontrolled depolarization of the cell (63). Symptoms can include chills, headache, diarrhea, weakness, muscle and joint pain, paraesthesia, trouble breathing, double vision, and trouble talking or swallowing. While it is difficult to determine the economic impact of HABs on a yearly basis for the United States of America, Hoagland et al. (27) estimated that the cost is in the range of $24 to $83 million per year, including treatment of illnesses, monitoring by state agencies, and tourism and fisheries losses. In the review, Hoagland et al. estimated an annual cost of $184,000 for monitoring and management in the state of Florida alone based on data from 1987 to 1992. As K. brevis can have such dramatic impacts on human health and the environment and economies of Florida, nearby regions of the Gulf of Mexico and the southern Atlantic coast of the United States, it is clearly important to be able to detect and

PAGE 13

5 5 quantify these organisms or their toxins from environmental or shellfish samples. The most conventional method to detect and enumerate K. brevis from the marine environment is counting by direct microscopic observation. This technique is, unfortunately, tedious, slow and while not technically difficult, requires significant expertise in order to correctly identify K. brevis and not count other, less problematic species that may have similar appearances, such as K. mikimotoi Karenia brevis identification is further complicated by natural variation of cell size and shape that has been documented at least in culture (69). Even among scientists familiar with identification of dinoflagellates, identification and enumeration by microscopy can include errors. In experiments with pictures of Dinophysis species, only 84 to 95% accuracy was returned by experts routinely involved in certain identification tasks (8) Newer direct optical detection techniques have been developed based on flow cytometry and digital imaging technologies and systems have been designed to automatically detect and enumerate certain cell types continuously in land-deployed situations (52). As the most important impact of K. brevis blooms, from a human health perspective, is the contamination of shellfish, there are many methods aimed at detection of brevetoxins in food, water and air samples. The earliest techniques involve detection of toxicity only, using a mouse bioassay. Essentially, a mouse is injected with a sample and toxicity is determined through observation of symptoms and time to death of the mouse. More advanced techniques have been developed involving chromatographic techniques (e.g. HPLC). Other techniques involve antibody immunoassays (for example, (3)) and have been extended to ELISA assays (41) for detection of brevetoxins in various

PAGE 14

6 6 sample matrices (seawater, shellfish and mammalian body fluid). Concentrations of brevetoxins in marine derived aerosols have been studied using high volume air samplers and HPLC (48). In addition to the detection of HAB organisms or their effects through toxin analysis and microscopy, methods have been developed based on photopigments to determine the presence and relative abundance of HAB species. Gyroxanthin-diester, relatively rare and very minor photopigment found in K. brevis haptophytes and other Karenia species, was targeted for an HPLC-based pigment detection approach (45) Chlorophyll anomalies in near shore waters as detected by satellites have also been used as an indication of HABs (56). In addition to methods designed to detect the toxins and pigments associated with HABs, there have been developments aimed at the detection of the HAB organisms based on their genetic sequences. One method that could increase the ability of the researcher to correctly identify HAB species ( Heterosigma akashiwo and Fibrocapsa japonica ) uses a combination of microscopy and fluorescence in-situ hybridization (FISH) with oligonucleotide probes targeting ribosomal RNA (rRNA) (64) Tyrrell et al. (64) also developed a microtiter plate-based sandwich hybridization assay as an extension of their FISH study, to eliminate the need for microscopy. There have been several assays designed around amplification and detection of specific sequences such as that of Guillou et al. (19) who targeted the rRNA large subunit for a semi-nested PCR detection method for Alexandrium, Dinophysis and Karenia This approach has several major drawbacks for the enumeration of HAB species, due to the

PAGE 15

7 7 non-quantitative nature of endpoint PCR analysis. Godhe (17) also used an approach targeting the SSU rRNA of Gymnodinium mikimotoi (recently reclassified as Karenia mikimotoi ) and the Alexandrium minutum species-group using PCR, although, as with the assay of Guillou et al. it was not a quantitative assay; rather, it indicated presence or absence only. While endpoint analysis of PCR is inherently non-quantitative, it is possible to use a PCR-based assay to determine the concentration of target nucleic acid that was originally in the sample. As the sample progresses through the PCR amplification process, the target sequence accumulates and eventually begins a logarithmic amplification. The time of entry into logarithmic amplification corresponds to the initial concentration of the target sequence. If this entry into logarithmic amplification can be detected, the PCR based assay can be quantitative. There are several approaches to this type of assay. The least technologically demanding method to accomplish quantitative PCR is to use a time-step process. Zhang and Lin (71) developed a time-step PCR procedure to detect Pfiesteria piscicida by targeting the mitochondrial cytochrome b gene. In time-step PCR, as defined in the study, 5 l of the PCR reaction was removed at intervals throughout the cycling (at 25 and 30 cycles) and after all 35 cycles had been completed, the reactions were visualized using agarose gel electrophoresis. From this information, approximate cell concentrations in the original sample could be calculated based on the dilution curve generated. This method was able to detect between 0.2 and 15,625 cells per reaction, though saturation of the signal (optical density of the band on the gel) was a significant problem and required dilution of samples or reduction of the

PAGE 16

8 8 number of amplification cycles. While this method has the potential to be quantitative, it remains a labor-intensive method, requiring careful electrophoresis and analyses at each of the time points in order to accurately and precisely quantify P. piscicida One technological step further than time-step PCR is real-time PCR using fluorescent dye such as SYBR green, which becomes highly fluorescent when bound to DNA. Amplification can then be detected as the reaction is progressing; as more DNA is produced, more SYBR green binds to the DNA, resulting in an increase in fluorescence. This approach was used by many investigators to detect and enumerate a wide variety of organisms and can be a reliably quantitative method. Another approach to quantitative, real-time PCR is to introduce a third oligonucleotide to the reaction. This oligo serves as a probe and binds to target sequences between the two primers. To this probe are bound two fluorochromes, a reporter and a quencher. When both are bound to the probe, fluorescence is quenched through resonant energy transfer. Through the use of a Taq polymerase with 5-3 exonuclease activity (which degrades the bound probe as it amplifies the target sequence) the reporter fluor is released into solution and can fluoresce upon excitation (23). This method, dubbed a Taq nuclease assay (TNA, marketed by Applied Biosystems as TaqMan PCR) has the potential to be quantitative by detection of the time of a samples entry into log phase PCR amplification (which is directly proportional to the initial concentration of the target). Figure 1 shows an example of the amplification curves that are generated in the course of a real-time RT-PCR assay with the time of a samples entry into log phase amplification through a threshold level indicative of the initial

PAGE 17

9 9 concentration of the target RNA. This method also has the potential to be more specific than standard PCR, due to the introduction of a third oligonucleotide that must also match in sequence the target. See Figure 2 for a graphical representation of the TNA process. Similar to the assay of Godhe et al., Tengs et al. (60) developed a PCR based assay to detect plastid small subunit rRNA from Gymnodinium galatheanum The critical difference in this assay is that it has the potential to be quantitative, as Tengs et al. used a Taq Nuclease assay. The study presented here represents a molecular detection and quantitation method for the Florida HAB organism K. brevis The study is presented in two chapters, the first is a description of the development of the real time RT-PCR assay, with sensitivity and specificity testing. The second chapter describes expanded testing of the assay as applied to natural bloom samples, field applicability and robustness as well as testing of the diel variability of rbcL gene expression in K. brevis

PAGE 18

10 10 Figure 1: Theoretical amplification curves that would be generated through real-time RT-PCR. Shown are curves representing ten-fold dilutions of target between each of the samples (solid curves) and the threshold level that indicates a samples entry into log phase amplification (dashed line).

PAGE 19

11 11 Time

PAGE 20

12 12 Figure 2: The Taq nuclease assay (TNA) process.

PAGE 21

13 13 Step 1, reverse transcription 5 3 5 3 3 5 Random hexamers are used as primers for reverse transcriptase or Applied Biosystems Multiscribe which makes a cDNA copy of all RNA in the reaction. The RT step takes place at 45 C for 30 minutes, followed by initial denaturation at 95 C for 10 minutes. Step 2, amplification Forward primer probe 5 3 5 3 The forward primer and probe (with its reporter (R) and quencher (Q)) bind to the target sequence. This occurs at 52C for one minute. Multiscribe 5 5 3 Amplification begins at the forward primer site where Taq DNA polymerase or Multiscribe binds and begins synthesis of new DNA. This occurs at 72 C for one minute. 5' 5 3 Amplification continues and as the Multiscribe encounters the probe, the probe is degraded by the enzymes 5, 3 exonuclease activity. This releases the reporter from the quencher, allowing it to fluoresce and report amplification. After the extension step, the cycle begins again with a 95 C denaturation for one minute. rbcL mRNA cDNA copy R Q R Q R Q

PAGE 22

14 14 The detection method chosen for this assay is real time RT-PCR using Applied Biosystems TaqMan technology. TaqMan technology has been demonstrated to be a very reliable and quantitative detection system in a wide range of applications: food microbiology and safety (2, 26), environmental monitoring (21, 43), marine ecosystem research (65), biodefence and clinical pathogen detection (7, 11, 13, 28, 51), cancer research (29, 70), genetic research (50) and others. In order to have an assay that is sensitive only to viable cells, we targeted mRNA as RNA is rapidly degraded in the environment. The rapid degradation of the RNA in the environment ensures that, if mRNA is detected, it has likely recently been transcribed and therefore the population detected is viable. DNA is a much more stable molecule and it is possible that detection of a DNA target does not reflect the viability of the population detected. The ribulose 1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) large subunit gene ( rbcL ) was chosen as the target of this assay for several reasons. RuBisCO catalyzes the rate-limiting step of photosynthetic carbon fixation and it is notoriously inefficient and slow, therefore a large quantity of enzyme must be made, so the mRNA should be abundant. In addition to catalyzing the addition of CO 2 to ribulose 1, 5bisphosphate, it can catalyze the addition of O 2 in a competing oxygenase reaction. As RuBisCO is an inefficient enzyme, the cell must maintain a sufficient pool of enzyme to survive, consequently, in land plants, as much as 50% of the nitrogen in leaves is devoted to RuBisCO (see review (53)). Therefore the cell must transcribe many copies of rbcL in

PAGE 23

15 15 order to maintain the RuBisCO pool. This high transcription rate will help to greatly increase the sensitivity of the assay as the rbcL mRNA will be in significantly higher concentrations than the DNA of the gene. The rbcL gene is encoded in the DNA of the plastid, of which K. brevis usually has many, further increasing the transcript levels in the cell and thus our limit of detection. Again due to the plastid location of the gene it is likely that K. brevis will have an rbcL gene sequence that is divergent from that of other dinoflagellates due to the unusual nature of the Haptophyte-derived plastid that K. brevis shares with very few other dinoflagellates. As rbcL is a functional gene, its evolution may be tightly constrained, however there may be portions of the gene that have more freedom to change in the second or third codon positions without yielding a nonfunctional enzyme. This high transcription rate, the potential uniqueness, the likelihood that it will not vary within the species due to the relatively recent acquisition of the Haptophyte-derived plastid and the possibility of variable regions within this gene combine to make K. brevis rbcL a promising target for a molecular detection and quantitation assay.

PAGE 24

16 16 Chapter 2: Development of assay, sensitivity and specificity testing Introduction Karenia brevis (Davis cf. Hansen & Moestrup = Gymnodinium breve ) is an unarmored, non-peridinin containing dinoflagellate that grows to ca. 20-40 m in diameter. The organism is positively phototactic, negatively geotactic (24, 32), swims at a speed of ca. 1 mh -1 (55) and is thought to be an obligate photoautotroph (1). Karenia brevis is the causative agent of the recurring red tide blooms (21 of 22 years from 19751997) observed in the Gulf of Mexico and Southeastern Atlantic Coast of the United States (61), which have been reported since the Spanish conquests (20) Lipophilic brevetoxins (37) produced by K. brevis can result in massive fish kills and have been implicated in the mortality of 700 bottlenose dolphins off the east coast of the U.S.A. in 1987 (25) and the mysterious deaths of 149 Florida manatees in 1995 and 1996 (63) In human exposure cases, brevetoxin can cause respiratory distress by inhalation and food poisoning by consumption of tainted shellfish. Current methods for the detection of K. brevis depend on microscopy or pigment analysis that are time consuming, and require a considerable amount of expertise and skill (38). Consequently, rapid molecular methods to detect K. brevis in the environment are needed. To this end, we have been investigating the ribulose-1, 5-bisphosphate

PAGE 25

17 17 carboxylase/oxygenase large subunit gene ( rbcL ) as a potential molecular marker for this organism. The molecular phylogeny of the rbcL gene in dinoflagellates is complex. Almost all eukaryotic oxygenic phototrophs contain a functional RuBisCO enzyme composed of both large and small subunits (L 8 S 8 ), known as Form I (33) (57)). A second, evolutionarily distant lineage of the enzyme (Form II) composed of large subunits only (L 2 ) is found in certain form I-containing proteobacteria (i.e. Rhodobacter and Rhodopseudomonas ; (16) (58) and interestingly in some dinoflagellates ( Amphidinium carterae, Symbiodinium sp. ; (40)). Karenia brevis and the other fucoxanthin containing dinoflagellates have a Form ID rbcL enzyme and genetic evidence suggests that they contain plastids of Haptophyte origin acquired through tertiary endosymbiosis (30) ( 59). Sequence information for the rbcL genes of many of the dinoflagellates is unavailable, however, due to the apparent ability of dinoflagellates to acquire plastids through retention of the plastids of their prey or some other endosymbiosis mechanism, it is unlikely that further sequencing of rbcL genes will elucidate the phylogenetic relationships of Dinophyceae. Evolutionary constraints on the functionality of RuBisCO (giving rise to little sequence variability) also will most likely yield little resolution of phylogenetic relationships. It would be interesting to sequence rbcL from many other groups of dinoflagellates in order to possibly determine the ancestral trophic strategies of the dinoflagellates. The presence of a form II RuBisCO in many dinoflagellates ( Amphidinium carterae and Symbiodinium sp., (68) and Gonyaulax polyedra (40) ) is interesting, especially considering that all of the species above contain chloroplasts or

PAGE 26

18 18 kleptochloroplasts. These chloroplasts may still contain a form I RuBisCO, though it is common for plastids, even if relatively recently acquired, to drastically reduce their genome to the bare minimum for functionality in their new intracellular environment (39). The function of a nuclear encoded, possibly redundant RuBisCO would be interesting to further explore, but is beyond the scope of this study. As a functional gene, rbcL is highly expressed in viable cells. Therefore we targeted the mRNA, which can be orders of magnitude higher in concentration than the DNA of the gene, in order to increase the sensitivity of our assay. As RNA is rapidly degraded in the environment, an RNA target will give an indication of a viable population, compared to DNA based methods, which would detect dead cells as well. Methods Design of Real-Time RT-PCR Primer and Probe Set Culture Conditions Cultures of K. brevis were provided courtesy of Karen Steidinger of the Florida Fish and Wildlife Conservation Commissions Florida Marine Research Institute (FMRI). Strains were isolated by her lab from the following locations around the Florida coast: Apalachicola, Charlotte Harbor, Mexico Beach, Jacksonville, and Piney Island. Strains used in this analysis were named for their isolation location and the plate well into which they were isolated. Several non-target algal strains of diverse lineage were obtained from either the Provasoli-Guillard Center for Culture of Marine Phytoplankton (West

PAGE 27

19 19 Boothbay Harbor, ME) or from the Steidinger lab (see Table 1). All strains were under a 12/12 light regime at 26 mol s -1 m -2 and were incubated at 20 C or 14 C in F/2 media (18), modified for each strains needs, according to CCMPs directions (media recipes and the requirements of each of the tested strains can be found in Appendix 1). DNA Extraction, Amplification, Cloning and Sequencing Karenia brevis cells were harvested by centrifugation (10 minutes at 5000 x G) and the DNA was extracted using a modified phenol/chloroform method (14). A previously designed PCR primer set that amplifies a 554 base pair region of Karenia s rbcL gene was used to amplify the gene fragment from K. brevis. (Forward primer: GATGATGARAAYATTAACTC; reverse primer: ATTTGTCCCGCATTGATTCCT. International Union for Pure and Applied Chemistry degeneracy symbols used.) Polymerase chain reaction (PCR) amplification was conducted with final concentrations of 1 M primers, 3 mM MgCl 2 0.4 mM each dNTP, 2.5 units of Taq polymerase (Promega Corp., Madison, WI). Cycling conditions were 40 repetitions of 95 C for 1 minute; 50 C for 1 minute; 72 C for 1.5 minutes with a final extension step at 72 C for 15 minutes. Amplification was confirmed by agarose gel electrophoresis. PCR amplicons were purified using a QiaQuick PCR purification kit (Qiagen, Valencia, CA), ligated into the pCR # II vector and TOP10 cells were transformed according to the manufacturers instructions (Invitrogen Corp., Carlsbad CA). Transformations were plated onto 2x YT plates containing 50 g/ml kanamycin and ampicillin (see Appendix 1). White colonies were screened for insert size by PCR amplification. Positive clones

PAGE 28

20 20 were grown in 2x YT broth with kanamycin and ampicillin. One milliliter of the culture was frozen at -80 C with a final concentration of 25% glycerol and from the remaining 9 ml, plasmid DNA was extracted using a Wizard Plus SV miniprep spin kit (Promega Corp., Madison, WI). These plasmid extracts were sent to the University of Floridas DNA Core Sequencing laboratory to be sequenced. Sequence Analysis Sequences were received from the UF Core laboratory via email and a BLAST search was conducted using GenBank to reveal the orientation of the sequences. The BLAST search also indicated related sequences that would be used in phylogenetic analysis, including the closely related K. mikimotoi Once the orientation was determined, the sequences were imported into the KODON software package version 1.0 (Applied Maths, Inc. Austin, Texas). The sequences were aligned in KODON, which uses a Clustal W-based alignment algorithm (62) The complete multiple sequence alignment from selected algal species covering the 554 base pair (184 amino acid) portion of the rbcL gene appears in Appendix 2. Multiple sequence alignments were exported and analyzed using the MEGA 2.0 program (35) for both the amino acid and nucleotide sequences. The sequence data from the K. brevis rbcL clones showed a short (91 bp) region that was markedly different from K. mikimotoi rbcL sequence. This portion of the rbcL gene of K. brevis was selected as the target for a primer and probe set for TaqMan Taq nuclease assay (Real Time RT-PCR). A primer set and an internal fluorogenic probe

PAGE 29

21 21 were designed to amplify the 91 bp region (Forward primer: TGAAACGTTATTGGGTCTGT; Reverse primer: AGGTACACACTTTCGTAAACTA; Internal probe: FAM TTAACCTTAGTCTCGGGTA TAMRA). Testing of the Real Time RT-PCR Primer and Probe Set Optimization of Reaction Conditions The concentration of the primers was the first parameter to be optimized. RTPCR reactions were set up with the following primer concentrations: 2000 nM, 1000 nM, 500 nM, and 250 nM. In subsequent experiments, the times of the cycle steps (denaturing, annealing and extension) as well at the temperature of the annealing step were varied to determine the optimal cycle conditions. The concentrations of the other reagents in the reaction solution were not optimized, as the one step Real Time RT-PCR master mix kit (Applied Biosystems, Valencia, CA) is pre-mixed for ease of use and increased reproducibility. Sensitivity and specificity testing One of the sequenced clones carrying the 554-bp insert from K. brevis APC6 (clone 15) was selected for use in sensitivity testing. Non-target rbcL clones from a cruise to the Mississippi River plume in the Gulf of Mexico, known to be amplifiable with other rbcL primers surrounding the same region of the gene were used to initially test specificity (See Table 3) (Wawrik, personal communication). Based on the direction of the insert, the vector was linearized by digesting the plasmid with either HinDIII or

PAGE 30

22 22 EcoRV and sense transcript was made by in vitro transcription using the T7 or SP6 promoter site. The transcripts were purified using the Qiagen RNeasy RNA extraction kit with the DNAse digestion step according to the manufacturers instructions (Qiagen, Valencia, CA). These transcripts were quantified using the Ribogreen RNA quantification kit according to the manufacturers instructions (Molecular Probes Inc., Eugene, OR), mixed 1:1 with RNA storage buffer (8 M guanidinium isothiocyanate, 80 mM Tris-HCl pH 8.5, 24 mM MgCl 2 140 mM KCl), aliquoted and frozen at C. The APC6-15 transcript was used to generate Real Time RT-PCR standard curves, while the others were used to test the specificity of the primer/probe set. RNA was extracted using the Qiagen RNeasy spin kit with the following modifications. One ml of culture was filtered onto a 0.45 m-pore-size HV polyvinylidene difluoride filter (Millipore Durapore ). The filters were placed into 2 ml screw-cap microcentrifuge tubes containing 750 l of RLT lysis buffer with 2mercaptoethanol (10 l ml -1 ). The filters were incubated for 10 minutes at room temperature and 500 l were removed into a 1.5 ml microcentrifuge tube and RNA extraction continued according to the manufacturers instructions (Qiagen, Valencia, CA). The extracted RNA was quantified using the Ribogreen RNA quantification kit according to the manufacturers instructions. All non-target algal strains were tested for amplification with the real-time primer/probe set with 10 pg of non-target RNA per reaction. Cell counts for all non-target algal strains as well as K. brevis strains were carried out by filtering an appropriate amount of diluted culture onto 0.22 m black

PAGE 31

23 23 polycarbonate Poretics filters (Osmonics Inc., Minnetonka, MN). Cells were counted using epifluorescence microscopy on an Olympus BX-60 microscope using appropriate objectives and blue excitation (filter set U-MNIB). Results Phylogenetic Analysis A 554 bp rbcL amplification product was used for the phylogenetic analysis, which indicated tight clustering of Karenia within the Haptophytes at both the protein level and at the nucleotide level (see Figure 3). All Karenia were deeply rooted within the form ID rbcL group. The K. brevis strains were quite different from K. mikimotoi ranging from 85% to 86% amino acid similarity and only 76% nucleotide similarity. K. brevis strains were very different from other Haptophytes (82% to 85% amino acid similarity), Rhodophytes (79% to 80% amino acid similarity), diatoms (72% to 74% amino acid similarity), Prochlorococcus (47% to 49% amino acid similarity) and higher plants (51% to 54% amino acid similarity to Spinach). Table 1 shows the percent identity of rbcL sequences from several selected organisms based on at both the amino acid (top) and DNA (bottom) level. Table 2 lists accession numbers for all sequences generated during the course of this study as well as those for the clones used and all other taxa used in the phylogenetic analysis.

PAGE 32

24 24 Table 1: Percent identity of selected rbcL sequences at both the amino acid (top) and nucleotide level (bottom).

PAGE 33

25 25 Appalachicola C6 Piney Island B4 Mexico Beach C5 Charlotte Harbor A2 Charlotte Harbor C2 Karenia brevis Mexico Beach B3 Karenia mikimoitoi Pleurochrysis Isochrysis Prymnesium Guillardia Porphyridium Mazzaella Gelidium Rhizosolenia Heterosigma Spinacia Prochlorococcus Appalachicola C6 98% 98% 97% 98% 97% 96% 85% 83% 82% 83% 76% 80% 79% 79% 72% 76% 51% 47% Piney Island B4 99% 100% 99% 100% 99% 98% 86% 85% 84% 84% 78% 82% 80% 80% 73% 77% 53% 48% Mexico Beach C5 99% 99% 99% 100% 99% 98% 86% 85% 84% 84% 78% 82% 80% 80% 73% 77% 53% 48% Charlotte Harbor A2 98% 99% 99% 99% 98% 97% 86% 84% 83% 84% 77% 81% 80% 80% 73% 77% 52% 48% Charlotte Harbor C2 98% 99% 99% 99% 99% 98% 86% 85% 84% 84% 78% 82% 80% 80% 73% 77% 53% 48% Karenia brevis 98% 99% 99% 99% 99% 97% 86% 85% 84% 85% 78% 82% 81% 81% 74% 78% 54% 49% Mexico Beach B3 98% 99% 99% 98% 98% 98% 85% 83% 82% 83% 76% 80% 79% 79% 72% 76% 52% 48% Karenia mikimoitoi 76% 76% 76% 76% 76% 75% 76% 83% 82% 84% 76% 78% 77% 77% 72% 75% 56% 49% Pleurochrysis 73% 73% 73% 73% 73% 73% 73% 73% 92% 92% 85% 86% 84% 84% 78% 83% 52% 50% Isochrysis 72% 73% 72% 72% 72% 72% 72% 73% 87% 88% 82% 83% 82% 83% 77% 80% 53% 50% Prymnesium 72% 73% 72% 72% 72% 72% 72% 73% 84% 85% 83% 84% 83% 83% 76% 79% 52% 50% Guillardia 68% 69% 69% 69% 69% 69% 68% 71% 76% 77% 79% 86% 83% 84% 74% 80% 50% 50% Porphyridium 73% 73% 74% 73% 73% 74% 73% 73% 78% 79% 78% 82% 85% 85% 78% 85% 52% 51% Mazzaella 74% 75% 74% 74% 74% 75% 74% 72% 74% 75% 77% 78% 80% 88% 78% 82% 51% 50% Gelidium 69% 70% 70% 70% 70% 70% 69% 71% 74% 73% 75% 77% 77% 81% 77% 82% 52% 50% Rhizosolenia 69% 70% 70% 70% 70% 70% 69% 68% 73% 74% 74% 75% 77% 75% 73% 88% 52% 49% Heterosigma 70% 71% 70% 70% 70% 71% 70% 70% 78% 77% 77% 79% 79% 77% 77% 85% 50% 50% Spinacia 57% 58% 58% 58% 58% 58% 58% 56% 58% 59% 59% 58% 60% 58% 59% 60% 59% 69% Prochlorococcus 54% 55% 55% 54% 54% 55% 55% 55% 54% 55% 58% 58% 59% 61% 59% 58% 58% 63% Nucleotide Amino Acid

PAGE 34

26 26 Figure 3: Phylogenetic tree based on rbcL amino acid sequences. The tree was obtained from Neighbor Joining analysis using a Poisson distribution of a 148 residue deduced amino acid sequence covering approximately 1/3 of the RuBisCO large subunit. The tree shows RuBisCO form ID diversity and the tight grouping of K. brevis and K. mikimotoi (both the sequence generated in this study and one from GenBank) within the Haptophyte clade. Several sequences from form IA and IB carrying organisms were used as outgroups. Bootstrap values for 1000 replicates are shown when the value is 40 or higher.

PAGE 35

27 27

PAGE 36

28 28 Table 2: Accession numbers for sequences used in phylogenetic analyses. Species Strain GenBank Accession Number Sequences generated in this study K. brevis APC6 AY154877 K. brevis CHA2 AY154878 K. brevis MBC3 AY154879 K. brevis PIB4 AY154880 K. brevis CHC2 AY154881 K. brevis PIA9 AY154882 K. brevis MBB3 AY154883 K. mikimotoi N/A AY251791 Other Sequences used Thalassia AB004897 Detonula AB018006 Thalassiosira AB018007 Asparagus AB029849 Karenia mikimotoi AB034635 Pleurochrysis AB043688 Helicosphaera AB043692 Isochrysis AB043693 Imantionia AB043696 Chrysochromulina sp AB043697 Prymnesium AB043698 Exanthemachrysis AB043701 Volvox AB076099 Rhizosolenia AF015568 Skeletonema AF015569 Pelagococcus AF015580 Chattonella AF015581 Heterococcus AF084610 Xanthonema AF084612 Aureococcus AF117906 Aureoumbra AF118136 Mazzaella AF146214 Phaeodactylum AF195952 Vaucheria AF207527 Agmenellum D13971 Dictyocha AY043280 Rhodella AY119776 Chilomonas AY119780 Chroomonas AY119781 Pyrenomonas AY119782 Pavlova AY119785 Karenia brevis AY119786 Karlodinium AY119787 Cylindrotheca M59080 Prochlorococcus D21833 Nitrobacter L22885 Synechocystis NC 000911 Spinacia NC 002202 Synechococcus sp D13539 Synechococcus U46156 Thiobacillus X70355 Cruciplacolithus AB043689 Calcidiscus AB043690 Ectocarpus X52503 Heterosigma X61918 Continued on next page.

PAGE 37

29 29 Table 2: Accession numbers for sequences used in phylogenetic analyses, continued. Species Strain GenBank Accession Number Trichodesmium AF136182 Amphidinium AF312209 ST6SY8 clone AY157473 ST8CH26 clone AY157431 ST6CH2 clone AY157408 ST4CH31 clone AY157392 ST4CH14 clone AY157388 ST3CH27 clone AY157382 ST1CH3 clone AY157369 ST5SY7 clone AY157469 ST2SY26 clone AY157446 ST2SY33 clone AY157449 ST2SY2 clone AY157444 ST8SY15 clone AY157479 ST6CH33 clone AY157412 ST1CH4 clone AY157371

PAGE 38

30 30 Real-Time RT-PCR The TaqMan probe-based RT-PCR assay (91 bp amplicon) only yielded positive results with K. brevis strains (Table 3). All other dinoflagellates (including K. mikimotoi ) and algal strains resulted in no amplification. All strains tested were present in sufficient concentration to allow for amplification based on the lowest detectable concentration of K. brevis Standard curves using in vitro transcript from APC6 clone 15 showed linear sensitivity over a range of concentrations spanning 7 orders of magnitude, ranging from 10 -1 to 10 5 fg, as shown in Figure 4. Standard curves using whole-cell extract from K. brevis culture were sensitive to as little as 1 pg of total RNA (less than 1 cell reaction -1 based on cell counts and dilution) and also showed a linear relationship from 1 cell to 2000 cells reaction -1 (highest concentration tested). Figure 5 shows an example of the cell standard curves, demonstrating linearity. In addition to showing linearity with both the transcript and whole cellular RNA within each reaction experiment, the assay was relatively consistent between assays. Figure 6 shows a composite average of the transcript standard curves, demonstrating good agreement between amplification events. The composite average of the cell standards curves appears in Figure 7, again demonstrating good agreement between experiments.

PAGE 39

31 31 Table 3: Positive and negative controls for amplification by real-time RT-PCR Species Strain/Clone Detection by Real-Time PCR Positive Controls K. brevis Apalachicola B5 + K. brevis Apalachicola C6 + K. brevis Charlotte Harbor A2 + K. brevis Charlotte arbor C2 + K. brevis Mexico Beach B3 + K. brevis Mexico Beach C5 + K. brevis Jacksonville C3 + K. brevis Piney Island A3 + K. brevis Piney Island B4 + K. brevis Wilson + Negative Controls Dinoflagellates K. mikimotoi CCMP430 Amphidinium carterae CCMP1314 Akashiwo sanguinea CCMP1321 Alexandrium tamarense CCMP1493 Glenodinium foliacrum N/A Gymnodinium catenatum CCMP1937 Gyrodinium sp. N/A Kryptoperidinium foliaceum N/A Lingulodinium polyedra CCMP1738 Prorocentrum micans N/A Scrippsiella trochoidea N/A Scrippsiella precaria N/A Diatoms Phaeodactylum tricornutum CCMP1327 Cylindrotheca sp. ST6CH2 clone Skeletonema sp. ST4CH31 clone Skeletonema sp. ST4CH14 clone Raphidophyte Heterosigma akashiwo N/A Praisinophytes Tetraselmis sp. 850001 Tetraselmis sp. CCMP961 Unidentified sp. CCMP1536 Prymnesiophytes Isochrysis sp. 3C Pavlova lutheri CCMP1325 Prymnesium parvum N/A Unidentified sp. ST8CH26 clone Unidentified sp. ST1CH3 clone Chlorophyte Chlamydomonas euryale CCMP219 Unidentified sp. ST5SY7 clone Chlamydomonas sp. ST2SY2 clone Pycnococcus sp. ST6SY8 clone Cyanophytes Synechococcus sp. CCMP836 Synechococcus sp. WH7803 Synechococcus sp. ST2SY26 clone Prochlorococcus sp. ST2SY33 clone Continued on next page.

PAGE 40

32 32 Table 3: Positive and negative controls for amplification by real-time RT-PCR, continued Species Strain/Clone Detection by Real-Time PCR Trichodesmium sp. ST8SY15 clone Trebouxiophyte Chlorella autotrophica CCMP243 Coscinodicsophyte Thalassiosira pseudonana CCMP 1335 Eustigmatophyte Nannochloropsis sp. ST3CH27 clone Nannochloropsis sp. ST1CH4 clone Xanthophyte Heterococcus sp. ST6CH33 clone

PAGE 41

33 33 Figure 4: An example standard curve generated using in vitro transcript. The curve is plotted with the trendline indicating the precision of the real-time RT-PCR assay.

PAGE 42

34 34 R 2 = 0.9991 10 15 20 25 30 35 40 1.00E-02 1.00E-01 1.00E+00 1.00E+01 1.00E+02 1.00E+03 1.00E+04 1.00E+05 1.00E+06 Quantity (fg transcript) Ct

PAGE 43

35 35 Figure 5: An example standard curve generated using whole cell RNA extract. The curve is plotted with a trendline indicating the precision of the real-time RT-PCR assay.

PAGE 44

36 36 R 2 = 0.9928 10 12 14 16 18 20 22 24 26 28 30 1 10 100 1000 10000 cells per reaction Ct

PAGE 45

37 37 Figure 6: Composite of all transcript standard curves. Error bars represent the standard deviation of the Ct values for each of the transcript concentrations (n=30).

PAGE 46

38 38 R 2 = 0.9962 10 15 20 25 30 35 40 1.00E-02 1.00E-01 1.00E+00 1.00E+01 1.00E+02 1.00E+03 1.00E+04 1.00E+05 1.00E+06 Quantity (fg transcript) Ct

PAGE 47

39 39 Figure 7: Composite of all cell standard curves. Error bars represent the standard deviation of the Ct values for each of the cell concentrations (n=10).

PAGE 48

40 40 R 2 = 0.9665 10 15 20 25 30 35 0 1 10 100 1000 10000 cells/rxn Ct

PAGE 49

41 41 Discussion A real-time RT-PCR method was developed to detect and quantify cell abundance based upon rbcL transcription in the red tide forming dinoflagellate K. brevis with good specificity and sensitivity. Using our TaqMan probe, we were able to amplify and detect a wide range of concentrations of K. brevis to the exclusion of all non-target DNA and RNA tested. The dynamic range over which this technique is effective covers the range of natural K. brevis blooms in the environment. Populations of K. brevis with <1000 cells L -1 (as determined by microscopy cell counts) is considered present but poses no risk of adverse health effects or shellfish contamination. Samples with <5000 cells L -1 are considered to have a Very Low level bloom, carrying a slight risk of respiratory irritation. When concentrations of >5000 cells L -1 occur, shellfish harvesting is closed. The highest level of a bloom has been reached when there are >1 million cells L -1 A bloom of this magnitude can result in massive fish kills, respiratory distress, discoloration of the water and may have effects on higher animals such as dolphins and manatees. These ranges are well within the range of detection ability of this assay when as little as 1-5 ml of sample water is filtered and extracted. It is essential that a probe designed to detect an important bloom forming organism not detect other closely related (or unrelated) organisms. Bloom detection and tracking relies heavily on being sure of the identity of the blooming organism. The TaqMan probe created in this study showed high specificity by only amplifying K. brevis and not amplifying any of the non-target samples tested, as listed in Table 3.

PAGE 50

42 42 This method represents the first molecular detection strategy for K. brevis and it may be well suited for detection and monitoring of red tide blooms caused by K. brevis in the Gulf of Mexico and the southern Atlantic coast of the United States. It may provide an easy and relatively rapid procedure that could be employed as an alternative to the more difficult and time-consuming methods currently used by red tide monitoring and management programs in the state of Florida and other states affected by K. brevis

PAGE 51

43 43 Chapter 3: Testing of the assay, field samples, diel studies and method evaluation Introduction The real-time RT-PCR detection and enumeration strategy outlined in the previous section performed well under preliminary testing conditions. However, an assay is only as good as its applicability to natural environmental samples. For a K. brevis detection assay to have full applicability, it has to accurately and reliably detect and enumerate populations of K. brevis from natural samples and it must be robust enough for much of the assay to be conducted in non-laboratory conditions. Specifically, the RNA purification has to be complete enough to allow for reliable detection of K. brevis regardless of the other constituents of the water sample to be analyzed, such as other phytoplankton species and organic detritus. The extraction procedure must also allow for the possible lack of adequate facilities that may be encountered either shipboard or in other field situations. At this time, unfortunately, the real-time RT-PCR step is constrained mostly to the lab due to the required instrumentation, such as the Applied Biosystems model 7700 Sequence Detection System used in this study; however there are systems that are beginning to show some field deployable capabilities. In addition to being able to reliably enumerate K. brevis from natural samples despite possible interference, the assay may be sensitive to cell phase. Dinoflagellates

PAGE 52

44 44 have been shown to exhibit diel cell cycling with certain genes and enzymes. In K. brevis, cell cycling over diel periods had been demonstrated and linked to cyclindependant kinase (66), with the dark to light transition shown to be the dominant cue. Expression of some genes in some dinoflagellates has been shown to be regulated over a diel cycle. Approximately 3% of the genes in Pyrocystis lunula were shown to be circadian regulated at the transcriptional level (44) notably several genes responsible for translation demonstrated diel regulation, but regulation of carbon fixation gene expression has so far not been shown in dinoflagellates. RuBisCO appears not to be differentially expressed at the mRNA level nor do protein levels change in the dinoflagellate Lingulodinium polyedrum over the diel cycle (44) and differences in photosynthetic capacity appear to be controlled by differential distribution of RuBisCO within the chloroplasts of Gonyaulax, with protein levels remaining constant (42). It has, however been shown that rbcL expression can exhibit great diel variability in other organisms, such as diatoms ( Phaeodactylum tricornutum ) (67), where transcript levels varied by a factor of approximately 3. It would be important to know for this assay if correction needs to be made based on time of day that the sampling was carried out, in order for the counts inferred from the real-time RT-PCR to more accurately represent the actual cell concentrations, should there be any diel variation in transcription of rbcL

PAGE 53

45 45 Methods RNA extraction and amplification from environmental samples Environmental bloom and non-bloom samples were received from Earnest Truby at the Florida Fish and Wildlife Conservation Commissions Florida Marine Research Institute (FMRI). Karenia brevis abundance in samples was determined by microscopy by FMRI personnel (Table 4). Ten to 20 ml of the samples were filtered onto sterile 0.45 m pore-size Millipore Durapore type HVLP filters and placed in lysis buffer (buffer RLT, Qiagen, Valencia CA or Lysis buffer, Stratagene, La Jolla, CA) and processed immediately if possible. If immediate processing was not possible, the tubes were frozen at C. Samples were processed using the RNA extraction kits from either Qiagen (RNeasy) or Stratagene (Absolutely RNA) according to the manufacturers instructions. From the extraction (50 l final eluent), 5 l were added to the amplification reaction and real-time RT-PCR was carried out as described in the previous section with a standard curve of transcript spanning seven orders of magnitude (0.1 to 10 5 fg of target transcript reaction -1 ) and a standard curve of whole cell extracts spanning 3-4 orders of magnitude (i.e. 1 to 1000 cells per reaction). Real-time RT-PCR data generated from these amplifications was analyzed preliminarily using the Sequence Detection software (versions 1.6 to 1.9) supplied by Applied Biosystems. Further analysis was carried out using Excel (Microsoft Corporation, Redmond, WA).

PAGE 54

46 46 Diel experiments Cultures and culture conditions For all diel experiments the same isolate, Piney Island B4 was used. The cultures were acquired from Bill Richardson at FMRI and placed in an incubator in our lab at 22 C under a 12-hour light-12-hour-dark regimen at 26 mol s -1 m -2 in F/2-Si medium (18) for at least 3 days to acclimate before any experimentation. Sampling schedule, cell counts and RNA extraction Four non-consecutive 24-hour diel studies were conducted as follows (using a new culture each time): starting at 4:00 AM, before the lights of the incubator were turned on (at 6:30 AM) and every two hours thereafter, the culture was removed from the incubator, gently swirled to homogenize the culture without lysis of the fragile K. brevis cells and approximately 30 ml of culture were poured into a 50 ml disposable centrifuge tube. All further sampling (cell counts, RNA extraction and carbon fixation) was carried out using sub-samples from this 30 ml sample. Before every removal of sub-samples from the 30 ml aliquot, the 50 ml centrifuge tube was capped and gently inverted to ensure even distribution of the cells and wide-bore pipette tips or serological pipettes were used to decrease turbulence and accidental cell rupture. Cell counts were carried out as described in the last section (briefly, filtering onto a 0.22 m pore-size black membrane and counted by epifluorescence microscopy, in triplicate). Duplicate or triplicate 1 ml culture samples were filtered onto sterile Durapore filters and placed in Qiagens RLT or Stratagenes Lysis Buffer and immediately frozen

PAGE 55

47 47 in liquid nitrogen and placed in the freezer at C for extraction and real-time RT-PCR analysis once the diel sampling period was over. These samples were extracted, amplified and analyzed as described above. Carbon fixation Two 10 ml aliquots of culture were placed into acid washed, sterile scintillation vials, one clear glass and the other covered with black electrical tape to seal out light. To each of these aliquots, 5 l of 14 C labeled HCO 3 (10 Ci) were added. Two 2 ml samples from each vial were immediately filtered onto 0.22 m pore-size Millipore type GS filters, rinsed with filtered seawater and placed in scintillation vials with 0.5 ml of 0.5 N HCl. The clear vial was placed in a lighted incubator at room temperature with 30 mol s -1 m -2 light and the taped (dark) vial was placed in a dark drawer at room temperature. The vials were incubated for 30 minutes. After the incubation, two 2 ml aliquots were again filtered from each sample, rinsed with filtered seawater and placed in scintillation vials with 0.5 ml of 0.5 N HCl. Once all of the time points had been sampled, the vials were allowed to remain at room temperature for 8 to 10 hours to allow unincorporated 14 C (as CO 2 ) to off-gas. To each of the samples, 1 ml of ethyl acetate was added and the filter was allowed to dissolve for 1 hour. Then 10 ml of Ecoscint A scintillation fluid (National Diagnostics, Atlanta, GA) was added, and the samples were placed into the scintillation counter to be counted for 0.5 minutes each. Counting efficiency was determined as follows: a Millipore GS filter was placed in 3 scintillation vials and dissolved with 1 ml ethyl acetate. Ten ml of Ecoscint A and 1

PAGE 56

48 48 ml of 0.01 N NaOH was added to each vial and mixed well. To two of these vials, 5 l of diluted 14 C was added (diluted 1:1000, 0.01 Ci, 22,200 DPM) and mixed well, the third vial served as a blank for background comparison. These vials were also counted for 0.5 minutes each. Efficiency (e) was calculated using the following equation: e=(CPM sample -CPM blank )/22,200. Counting efficiency ranged from 0.30 to 0.70. These data were analyzed either by the C14 program (Qbasic, in-house software) or using an Excel spreadsheet based on that program. Alkalinity Determination After the initial sampling, 100 ml of culture were removed and analyzed for culture alkalinity as follows. From the 100 ml sample, the temperature, salinity and pH were determined. The sample was placed on a stir-plate with a stir-bar and 25 ml of 0.01 N HCl were added and the pH was measured again. If the pH was not below 4.0, an additional 5 ml of 0.01 N HCl were added and the pH was measured. The data from these measurements were analyzed by the ALK1 program (Qbasic, in-house software) for an estimated alkalinity and amount of dissolved inorganic carbon. These data were used in the 14 C incorporation calculations. Evaluation of real-time assay reagents and extraction methods Room temperature and freezer (-80 C) stability of K. brevis RNA lysates In order to determine the field applicability, convenience and flexibility inherent in the real-time RT-PCR assay, a series of experiments were carried out based on anticipated field extraction conditions. To determine the stability of the target RNA in

PAGE 57

49 49 cases where liquid nitrogen or C freezers are not readily available, and to evaluate the performance of the guanidine thiocyanate-based lysis buffers from both Qiagen and Stratagene, two separate experiments were carried out. In the first, 20 1-ml aliquots of culture were filtered onto Durapore filters and placed in RLT buffer with 2mercaptoethanol. Two of those samples were frozen immediately at C and the rest were placed in a dark drawer at room temperature. Each day, 2 of the samples were removed from the drawer, labeled with the day and frozen. Once all 10 days worth of samples had been frozen, the samples were thawed and extracted following Qiagens instructions. The samples were then analyzed by real-time RT-PCR as described above. The second experiment was conducted as above using Stratagenes Lysis Buffer and extraction kit, but the sampling was done in quintuplicate. To evaluate the samples stability in Stratagenes Lysis buffer at C, 25 1 ml aliquots were filtered onto Durapore filters and placed into lysis buffer. Twenty of the samples were placed immediately into the C freezer, while the remaining 5 were extracted and analyzed using the real-time RT-PCR assay. At the following intervals 5 of the samples were thawed, extracted and analyzed using the real-time RT-PCR assay: 1 week, 2 weeks, 4 weeks and 6 weeks. Alternative extraction methods In order to evaluate and minimize variation due to the RNA extraction process, several approaches were tested. As the K. brevis cell is very fragile, two methods were tested to minimize breakage and subsequent loss of RNA and one method was tested to

PAGE 58

50 50 reduce sample handling and possibly lead to a more easily automated extraction protocol. In the first method, rather than filtering onto Durapore membranes, 1 ml of culture was centrifuged at 5000 rpm (2300 X g), the supernatant was removed and the cells were resuspended in 100 l of lysis buffer. Extraction was continued according to the manufacturers instructions. In the second method, rather than manipulating the cells at all, 1 ml of culture was added directly to 1.5 ml of lysis buffer and vortexed vigorously. To this mixture, 2.5 ml of 70% ethanol was added and the samples were run through the RNA extraction column either through multiple centrifugation steps or pulled through by placing the column in a centrifuge tube with the bottom cut off and placed into a rubber stopper that was placed on a vacuum manifold and light vacuum was applied (80 to 100 mm Hg). Extraction was continued according to the manufacturers instructions. The third method tested was designed to facilitate future automation of the extraction process and was carried out by filtering the K. brevis culture directly onto the silica matrix of the extraction column using a light vacuum as above. To the column, 200 l of a 1:1 mixture of lysis buffer and 70% ethanol were added, incubated for 10 minutes and removed by centrifugation. Extraction was continued according to the manufacturers instructions. The standard method using the Durapore membrane was also conducted for comparison. All culture samples were diluted so that 1000 cells were extracted into the final eluent, and extractions were performed with the Stratagene columns with five replicates of each extraction method.

PAGE 59

51 51 Results Field samples Twenty-eight field samples from FMRI were analyzed by the real time RT-PCR assay and the calculated cell counts based on the cell and transcript standard curves as well as the microscopy counts are listed in Table 4. Figure 8 shows a graphical comparison of the microscopy-based counts and the real-time RT-PCR assay, with a 1:1 line plotted for reference. The correlation (r 2 ) between microscopy counts and real-time RT-PCR counts was 0.8344, with a slope of 0.88. Samples that were negative by microscopy (limit of detection approximately 300 cells liter -1 ) often were positive by RTPCR (ranging from 0 to 12476 cells liter -1 average: 1646 cells liter -1 n= 12). The samples that were stored in the freezer for over a month (bloom dates 7/1/03 and 8/27/03) yielded dramatically lower calculated cell concentrations than expected, indicating background concentrations of K. brevis despite the microscopy counts that were in the 6,000 to 100,000 cells L -1 range as counted prior to filtering and freezing in lysis buffer

PAGE 60

52 52 Table 4: Bloom samples counted by microscopy and inferred counts by real-time RTPCR.

PAGE 61

53 53 Site ID Sampling date Cell Counts (Cells/L) Real Time PCR (Cells/L) Bin agreement Naples Pier 3/26/03 0 219 Y Clam Pass 3/26/03 12300 13752 Y Barefoot Beach 3/26/03 333000 364645 Y Naples Pier 4/2/03 190000 66540 N South Marco 4/2/03 0 1791 N 951 Launch ramp 4/2/03 0 1152 N Clam Pass 4/2/03 127000 140758 Y Good Land 4/2/03 0 3167 N Marco Pass 4/2/03 0 12476 N Howard Park 7/1/03 0 0 Y Honeymoon Island 7/1/03 6000 12 N Pier 60 7/1/03 6330 634 N Reddington Pier 7/1/03 0 2133 N Bowditch Park 8/27/03 29300 133 N Bonita Beach Park 8/27/03 0 4 Y Lover's Key 8/27/03 93300 122 N Little Hickory Island Park 8/27/03 8670 49 N Lely Barefoot Beach 10/16/03 4670 4089 Y Seagate 10/16/03 27300 32311 Y Naples Pier 10/16/03 0 0 Y Vanderbilt Beach 10/16/03 19000 22484 Y South Marco Beach 10/16/03 18300 12050 Y Naples Pier 10/27/03 3670 2295 Y Seagate 10/27/03 667 294 Y Bin Key K. brevis cells/l Present <1000 Very Low a >1000 to 5000 Very Low b 5000 to 10,000 Low a 10,000 to 50,000 Low b 50,000 to 100,000 Medium 100,000 to 1,000,000 High >1,000,000

PAGE 62

54 54 Figure 8: Cell counts microscopy and the real-time RT-PCR assay. Comparison of counts by microscopy and inferred counts by real-time RT-PCR. Plotted are both a trendline for the data (thick line) and a one-to-one line (thin line) that would indicate perfect agreement, for comparison.

PAGE 63

55 55 y = 0.8806x R 2 = 0.8344 0 100000 200000 300000 400000 500000 600000 0 50000 100000 150000 200000 250000 300000 350000 400000 cells by microscopy cells by real time

PAGE 64

56 56 Diel Studies Carbon fixation showed a typical diel pattern of increased production during the day, with a peak of production occurring around noon. Production increased rapidly after the start of the light period, beginning with the 8:00 AM sampling period for all of the diel studies, and had reached maximal activity by the noon sampling. In 2 of the 4 diel periods studied, K. brevis displayed a depression in carbon fixation at the 2:00 PM sample, but had returned to a higher production level at the 4:00 PM or 6:00 PM sampling. In the other two diel studies, the K. brevis cultures did not express this decline in production during the light period. Carbon fixation returned to nighttime levels by 8:00 PM, 1.5 hours after the start of the dark period. Figure 9 shows carbon fixation over the four non-consecutive 24-hour periods analyzed. Cell counts during the 24 hour sampling periods of the four diel studies oscillated, varying by as much as 2000 cells ml -1 most likely due to incomplete mixing of the culture before the initial sampling of the 30 ml aliquot. The cultures did not display significant growth over the 24-hour periods studied, and there was no trend to the variation in cell counts. Expression of the rbcL gene as analyzed by real-time RT-PCR showed some variability over the diel period in each of the 24-hour periods studied, however these variations do not fall at the same time periods in all of the 4 diel periods studied. Figure 10 shows the rbcL RNA signal as detected by real-time RT-PCR, corrected by cell counts at each time point, where possible. Figure 11 shows an overlay of all of the diel RNA

PAGE 65

57 57 Figure 9: Carbon fixation over one diel cycle in four experiments. Diel experiments 1 through 4 are represented by diamonds, squares, triangles and x marks, respectively.

PAGE 66

58 58 0 20 40 60 80 100 120 140 0:00 4:00 8:00 12:00 16:00 20:00 0:00 4:00 Time pg CO 2 fixed cell -1

PAGE 67

59 59 Figure 10: RNA transcription over the diel periods. Diel experiments 1 through 4 are represented by diamonds, squares, triangles and x marks, respectively.

PAGE 68

60 60 1.00 10.00 100.00 0:00 4:00 8:00 12:00 16:00 20:00 0:00 4:00 Time fg RNA target cell -1

PAGE 69

61 61 Figure 11: Average carbon fixation (squares, solid line) and average rbcL transcription (triangles, dashed line) for all of the diel experiments.

PAGE 70

62 62 -10 10 30 50 70 90 110 130 0:00 4:00 8:00 12:00 16:00 20:00 0:00 4:00 Time pg CO 2 fixed cell -1 -0.50 4.50 9.50 14.50 19.50 24.50 29.50 fg RNA target cell -1

PAGE 71

63 63 results and the carbon fixation results. The minima and maxima in RNA transcript levels did not consistently occur at any specific time in the diel cycle and ranged from 3.30 to 7.09 fg cell -1 1.64 to 10.96 fg cell -1 7.72 to 22.79 fg cell -1 and 2.43 to 7.48 fg cell -1 in each of the diel experiments, with an average range of 5.53 to 12.31 fg cell -1 and an average cellular rbcL target concentration of 7.50 fg cell -1 Room Temperature Stability in Lysis Buffer Samples retained much of their RNA when stored in lysis buffer from Stratagene when stored at room temperature in the dark for a much as 6 days, however the replicates became more variable in terms of their RNA content. On average, the RNA content did not dramatically change, however, by day seven, there were samples in which very little (two orders of magnitude less) RNA remained. Samples stored in Qiagens lysis buffer lost approximately half of the RNA after one day stored at room temperature, but remained at that lower level for 6 more days before continuing to degrade. Figure 12 shows the RNA present in samples stored at room temperature in the dark in Qiagens lysis buffer (Figure 12(a)) and Stratagenes lysis buffer (Figure 12(b)) and the stability of the target over 10 days. Figure 13 compares the change in RNA signal in the two lysis buffers, normalized as average percent change of RNA concentration from day 0.

PAGE 72

64 64 Freezer stability in lysis buffer Samples stored in Stratagenes lysis buffer at C began to lose some target RNA content after two weeks, though with less variability than was seen associated with the room temperature-stored samples after 7 days. The loss of RNA seen in the samples at three weeks did not continue as a trend and at the end of the experiment there was not a significant loss of RNA in the samples stored for as much as six weeks in the C freezer. Figure 14 shows the detected amount of RNA from samples stored at C over the course of six weeks. Alternative extraction methods Samples analyzed with the alternative extraction methods, though representing the same cell numbers, did show differences in their RNA signal. Samples that were filtered directly onto the extraction column, without prior filtration or concentration steps returned on average the most RNA of the methods tested, however the column filtration method also exhibited the most variability of RNA signal. The two methods which used a concentration mechanism (filtration onto a Durapore membrane or concentration by centrifugation) displayed very similar RNA signals, with the centrifugation method showing less variability than the filtering method. The extraction directly from the liquid culture returned the lowest RNA signal, as well as the lowest variability. The results of this experiment are presented in Figure 15.

PAGE 73

65 65 Figure 12: RNA stability at room temperature. (A) RNA stability at room temperature in Qiagens RLT buffer. Plotted are the mean values and the error bars represent the standard deviation (n=3). (B) RNA stability at room temperature in Stratagenes Lysis buffer. Plotted are the mean values and the error bars represent the standard deviation (n=5).

PAGE 74

66 66 A) 0.00E+00 5.00E+03 1.00E+04 1.50E+04 2.00E+04 2.50E+04 3.00E+04 3.50E+04 4.00E+04 0 2 4 6 8 10 12 days on bench Target quantity (fg)

PAGE 75

67 67 B) 0.00E+00 2.00E+03 4.00E+03 6.00E+03 8.00E+03 1.00E+04 1.20E+04 1.40E+04 1.60E+04 1.80E+04 0 2 4 6 8 10 days at room temperature target quantity (fg)

PAGE 76

68 68 Figure 13: Average percent of initial RNA signal after storage at room temperature. Shown are the average percents of the detected rbcL RNA signal after storage at room temperature in RLT (squares) and Lysis buffer (circles).

PAGE 77

69 69 0 20 40 60 80 100 120 140 160 180 200 0 2 4 6 8 10 12 Days at room temperature Percent initial velue

PAGE 78

70 70 Figure 14: RNA stability in Stratagenes Lysis buffer after storage at C.

PAGE 79

71 71 0.00E+00 2.00E+03 4.00E+03 6.00E+03 8.00E+03 1.00E+04 1.20E+04 1.40E+04 1.60E+04 1.80E+04 -1 0 1 2 3 4 5 6 7 weeks in freezer target quantity (fg)

PAGE 80

72 72 Figure 15: Detected rbcL RNA signal following alternative extraction methods. Plotted are the average values and the error bard represent the standard deviation (n=5 per treatment).

PAGE 81

73 73 Column Centrifuge Durapore Liquid 0.00E+00 5.00E+02 1.00E+03 1.50E+03 2.00E+03 2.50E+03 3.00E+03 3.50E+03 4.00E+03 treatment fg RNA / 1000 cells

PAGE 82

74 74 Discussion The real-time RT-PCR assay developed has performed well when applied to field samples. The assay was able to quantitate cellular abundance of Karenia brevis from natural populations without interference from other phytoplankton or other contamination inherent in natural marine samples for most of the samples analyzed. The assay was effective over a wide range of cell concentrations, ranging from below the direct microscope detection method limit of 300 cells liter -1 to the highest sample analyzed at over 3X10 5 cells liter -1 Based on the cell standard curves, it would be possible to detect as many as 10 4 cells reaction -1 which corresponds to 10 7 cells liter -1 if 20 ml is filtered, and 5 l of the 50 l column elution is used in the RT-PCR reaction. This assay, then, is able to detect and quantify the entire range of commonly seen K. brevis bloom concentrations. The variation of rbcL transcript concentration in the cells of K. brevis do not appear to drastically or regularly change over a diel cycle, in contrast with carbon fixation. It is possible that RuBisCO activity in K. brevis is controlled at the translation or post translation level, or by changes in distribution within the chloroplast rather than at the transcription level as in Gonyaulax or Lingulodinium or as in synechococcus or a prymnesiophyte (47). There were some changes in the transcript signal at different times of the day and these changes did not appear to be a strictly regulated diurnal signal, as the changes did not occur at the same times in all of the diel experiments. These changes in

PAGE 83

75 75 transcript levels could be a response to the cells need for RuBisCO, natural fluctuations of a gene that is not strictly controlled at the transcriptional level, the inherent variability of the RT-PCR assay or the uneven distribution and fragility of cells in culture. Overall, changes between time points were relatively minor and often fell within the variability between replicates, as variability between replicates was large. The variability of the rbcL transcript levels in K. brevis could lead to some error in the calculation of cell concentration from bloom samples by the real time RT-PCR assay, but the variation is minor and the assay is accurate enough to serve a useful purpose in the enumeration of K. brevis in the environment. Current guidelines use a binned system from categorization of blooms ranging from not present through very high (see Table 4). The ability of the real-time RT-PCR assay to reliably identify the category level of a bloom based on the system currently used by the FMRI is 54%. Without including the samples that were stored for a long period, this increases to 69%, indicating that long-term storage is not advisable when quantitative data are needed due to the increase of variability and potential loss of RNA as seen in Figure 14. Storage of samples should be kept to a minimum with samples processed as soon as possible. While storage at C of lysed culture samples demonstrated some level of stability, the RNA signal from bloom samples that were stored for a month or more was not detectable. The developed RT-PCR assay, while effective for the detection and enumeration of K. brevis appears to be a poor tool for analysis of gene expression due to both its variability and the variability of cell density in K. brevis culture, which may swamp the signal of transcriptional regulation. Its sensitivity is very high (as little as one copy of

PAGE 84

76 76 target (49)) compared to that of other gene expression methods, such as dot-blotting and probing, but the signal of amplification becomes saturated at fairly low concentrations of target. Hybridization type assays, such as blotting and probing, have a much lower sensitivity, but are less likely to exhibit the variability of real time RT-PCR when sufficient target is present (67) The method developed appears to be well suited to limited field use. The samples were stable at room temperature in Lysis buffer for at least 3 days, though the RNA target was not as stable in RLT. Therefore it would be preferable to use the RNA microprep extraction kit from Stratagene for the increased stability of the RNA target at room temperature as well as the decreased variability that was apparent in the room temperature stability experiment. If it is not possible to immediately extract and amplify the RNA from an environmental sample, it would be advisable to freeze them at C, rather than leave them at room temperature. The stability of the filtered samples was far greater when frozen at C than at room temperature. The samples that were frozen maintained most of their RNA throughout the experiment only losing RNA beginning at one month. Most of the RNA remained, however and even after 6 weeks, there was enough of the RNA to still detect, though quantitative representation of cell counts as inferred from real-time RT-PCR would be difficult due to the increased variability between samples. As the RNA began to degrade and the samples exhibited increased variability, it would be advisable to process samples that are to be quantitative within two weeks. If the samples have been in the freezer for more than 6 weeks, the assay may be unreliable as a quantitative method and should be only used as a presence/absence

PAGE 85

77 77 indicator, though even that may be too unreliable after samples had been frozen much longer than 6 weeks. The bloom samples that were analyzed included some samples that had been frozen for over one month. According to the freezer stability experiment, these samples quantitative ability should have been reliable, however these samples inferred counts by real-time RT-PCR did not reflect the counts by microscopy. For comparison, those samples have been removed from the calculations in Figure 15(a) with the entire data set represented for comparison in Figure 15(b). The correlation between inferred counts by RT-PCR and microscopy counts has increased (r 2 =.8873, vs. r 2 =.8344) and the slope of the linear regression trendline is closer to a slope of 1 (y=.932(x), vs. y=.881(x)) that would indicate perfect agreement. It is unclear why the bloom samples that had been stored at C did not amplify in agreement with the microscopy counts, though there may have been compounds in the samples that inhibited the guanidine thiocyanate protection of the RNA. For this reason, samples from natural waters should not be frozen for extended periods if quantitative data are needed. Experiments with the alternative extraction methods demonstrated distinct differences in target RNA content between the different methods. The increased variability of the column extraction method, despite its high yield of RNA, makes it a method that should be employed only if easier automation is required, as in a deployed system where the extra handling involved in a separate filtration or centrifugation step would be difficult to accomplish due to engineering difficulties and power requirements. Both the Durapore filtration method and the centrifugation method, with their associated

PAGE 86

78 78 Figure 16: Cell counts by microscopy and the real-time RT-PCR assay. A) Cell counts by microscopy and the real-time RT-PCR assay not including samples that had been stored at C for over one month. B) Cell counts by microscopy and the real-time RTPCR assay including samples that had been stored at C for over one month.

PAGE 87

79 79 A) y = 0.932x R 2 = 0.8873 0 50000 100000 150000 200000 250000 300000 350000 400000 0 50000 100000 150000 200000 250000 300000 350000 Cells by microscopy Cells by real-time

PAGE 88

80 80 B) y = 0.8806x R 2 = 0.8344 0 100000 200000 300000 400000 500000 600000 0 50000 100000 150000 200000 250000 300000 350000 400000 cells by microscopy cells by real time

PAGE 89

81 81 moderate variability and good RNA recovery are well suited to a procedure that would be used in the laboratory for quantitative evaluation of K. brevis abundance. Both methods have drawbacks inherent in the methods, however, when applied to natural bloom samples. For the Durapore filtration method, filtration of samples, even the relatively small amount of 20 ml, can be difficult with some estuarine samples if there is a high load of detritus or suspended sediment. With the centrifugation method the volume needed to detect bloom populations may exceed the capacity of available centrifuges, though this is not a likely scenario in a relatively well-equipped laboratory. The liquid extraction protocol is the least likely to be useful, despite demonstrating the lowest variability. While it may be valuable for comparative studies using cultures, where extracted volumes are small, it would quickly become exceedingly cumbersome and expensive with higher volumes of sample to be extracted. For example, for 20 ml of a bloom sample to be extracted, 30 ml of lysis buffer would be required, as well as 50 ml of 70% ethanol, totaling 100 ml of lysate that must be loaded onto the extraction column, either using a vacuum manifold or 200 consecutive 30 second centrifugation steps. For these reasons, unless automation is a requirement it is recommended that either the Durapore or centrifugation method be used for reproducible extraction and subsequent quantification of RNA from K. brevis These calculations indicate that when all of the recom mendations made regarding processing of the samples, the assay can be very accurate in returning concentrations of K. brevis in the marine environment. Briefly, these recommendations include: process samples as soon as possible; if immediate processing is not possible, samples may be

PAGE 90

82 82 frozen for a maximum of 3-4 weeks; if freezing is not possible, samples should be filtered, placed in Stratagenes lysis buffer and kept in the dark for a maximum of 3 days before freezing or processing. With these recommendations implemented, the assay performs very well, with a tendency to slightly overestimate cell concentrations in seawater samples. As a tool for managing and monitoring harmful algal blooms caused by K. brevis this trend of slight overestimation is preferable to underestimation and should not be cause for concern regarding the use of this method.

PAGE 91

83 83 References 1. Aldrich, D. V. 1962. Photoautotrophy in Gymnodinium breve Davis. Science 137: 988-&. 2. Arkush, K. D., M. A. Miller, C. M. Leutenegger, I. A. Gardner, A. E. Packham, A. R. Heckeroth, A. M. Tenter, B. C. Barr, and P. A. Conrad. 2003. Molecular and bioassay-based detection of Toxoplasma gondii oocyst uptake by mussels ( Mytilus galloprovincialis ). International Journal for Parasitology 33: 1087-1097. 3. Baden, D. G., T. J. Mende, J. Walling, and D. R. Schultz. 1984. Specific antibodies directed against toxins of Ptychodiscus brevis (Florida's red tide dinoflagellate). Toxicon 22: 783-789. 4. Bjornland, T., F. T. Haxo, and S. Liaaen-Jensen. 2003. Carotenoids of the Florida red tide dinoflagellate Karenia brevis Biochemical Systematics and Ecology 31: 1147-1162. 5. Bossart, G. D., D. G. Baden, R. Y. Ewing, B. Roberts, and S. D. Wright. 1998. Brevetoxicosis in manatees ( Trichechus manatus latirostris ) from the 1996 epizootic: Gross, histologic, and immunohistochemical features. Toxicologic Pathology 26: 276-282. 6. Carson, R. L. 1951. The Sea Around Us. Oxford University Press, New York. 7. Chen, Y. Z., J. Wu, A. Bharathi, and M. Manak. 2003. Quantitative detection of SARS coronavirus using a TaqMan-based RT-PCR assay. Clinical Chemistry 49: 1965-1965. 8. Culverhouse, P. F., R. Williams, B. Reguera, V. Herry, and S. Gonzalez-Gil. 2003. Do experts make mistakes? A comparison of human and machine identification of dinoflagellates. Marine Ecology-Progress Series 247: 17-25. 9. Dale, B., and C. M. Yentsch. 1978. Red Tide and Paralytic Shellfish Poisoning. Oceanus 21: 41-49.

PAGE 92

84 84 10. Davis, C. C. 1948. Gymnodinium brevis sp. nov., a cause of discolored water and animal mortality in the Gulf of Mexico. Botanical Gazette 109: 358-360. 11. Fontaine, M., and E. Guillot. 2003. Study of 18S rRNA and rDNA stability by real-time RT-PCR in heat-inactivated Cryptosporidium parvum oocysts. Fems Microbiology Letters 226: 237-243. 12. Forrester, D. J., J. M. Gaskin, F. H. White, N. P. Thompson, J. A. Quick, G. E. Henderson, J. C. Woodard, and W. D. Robertson. 1977. Epizootic of Waterfowl Associated with a Red Tide Episode in Florida. Journal of Wildlife Diseases 13: 160-167. 13. Fratamico, P. M. 2003. Comparison of culture, polymerase chain reaction (PCR), TaqMan Salmonella and Transia Card Salmonella assays for detection of Salmonella spp. in naturally-contaminated ground chicken, ground turkey, and ground beef. Molecular and Cellular Probes 17: 215-221. 14. Fuhrman, J. A., D. E. Comeau, Hagstrom, and A. M. Chan. 1998. Extraction from natural planktonic microogranisms of DNA suitable for molecular biological studies. Applied and Environmental Microbiology 54: 14261429. 15. Geraci, J. R. 1989. Clinical investigations of the 1987-1988 mass mortality of bottlenose dolphins along the U.S. central and south Atlantic coast. Ontario Veterinary College. 16. Gibson, J. L., and F. R. Tabita. 1977. Different molecular forms of D-ribulose1,5-bisphosphate carboxylase from Rhodopseudomonas sphaeroides Journal of Biological Chemistry 252: 943-949. 17. Godhe, A., S. K. Otta, A. S. Rehnstam-Holm, I. Karunasagar, and I. Karunasagar. 2001. Polymerase chain reaction in detection of Gymnodinium mikimotoi and Alexandrium minutum in field samples from southwest India. Marine Biotechnology 3: 152-162. 18. Guillard, R. R., and J. H. Ryther. 1962. Studies of marine planktonic diatoms. 1. Cyclotella nana Hustedt, and Detonula confervacea (Cleve) Gran. Canadian Journal of Microbiology 8: 229-239. 19. Guillou, L., E. Nezan, V. Cueff, E. E. L. Denn, M. A. Cambon-Bonavita, P. Gentien, and G. Barbier. 2002. Genetic diversity and molecular detection of three toxic dinoflagellate genera ( Alexandrium Dinophysis and Karenia ) from French coasts. Protist 153: 223-238.

PAGE 93

85 85 20. Gunther, G., R. H. Williams, C. C. Davis, and F. G. W. Smith. 1947. Catastrophic mass mortality of marine animals and coincident phytoplankton bloom on the west coast of Florida. Florida Ecological Monographs 18: 311-324. 21. Guy, R. A., P. Payment, U. J. Krull, and P. A. Horgen. 2003. Real-time PCR for quantification of Giardia and Cryptosporidium in environmental water samples and sewage. Applied and Environmental Microbiology 69: 5178-5185. 22. Hallegraeff, G. M. 1993. A Review of Harmful Algal Blooms and Their Apparent Global Increase. Phycologia 32: 79-99. 23. Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996. Real time quantitative PCR. Genome Research 6: 986-994. 24. Heil, C. A. 1986. Vertical Migration of Ptychodiscus brevis (Davis) Steidinger. Master of Science. University of South Florida, St. Petersburg. 25. Hersh, S. H. 1998. Why the dolphins die. Sea Frontiers July-August: 246-248. 26. Hird, H., J. Lloyd, R. Goodier, J. Brown, and P. Reece. 2003. Detection of peanut using real-time polymerase chain reaction. European Food Research and Technology 217: 265-268. 27. Hoagland, P., D. M. Anderson, Y. Kaoru, and A. W. White. 2002. The economic effects of harmful algal blooms in the United States: Estimates, assessment issues, and information needs. Estuaries 25: 819-837. 28. Ibrahim, M. S., D. A. Kulesh, S. S. Saleh, I. K. Damon, J. J. Esposito, A. L. Schmaljohn, and P. B. Jahrling. 2003. Real-time PCR assay to detect smallpox virus. Journal of Clinical Microbiology 41: 3835-3839. 29. Inokuchi, M., I. Ninomiya, K. Tsugawa, I. Terada, and K. Miwa. 2003. Quantitative evaluation of metastases in axillary lymph nodes of breast cancer. British Journal of Cancer 89: 1750-1756. 30. Ishida, K., and B. R. Green. 2002. Secondand third-hand chloroplasts in dinoflagellates: Phylogeny of oxygen-evolving enhancer 1 (PsbO) protein reveals replacement of a nuclear-encoded plastid gene by that of a haptophyte tertiary endosymbiont. Proceedings of the National Academy of Sciences of the United States of America 99: 9294-9299. 31. Kamykowski, D., E. J. Milligan, and R. E. Reed. 1998. Biochemical relationships with the orientation of the autotrophic dinoflagellate Gymnodinium breve under nutrient replete conditions. Marine Ecology-Progress Series 167: 105117.

PAGE 94

86 86 32. Kamykowski, D., E. J. Milligan, and R. E. Reed. 1998. Relationships between geotaxis/phototaxis and diel vertical migration in autotrophic dinoflagellates. Journal of Plankton Research 20: 1781-1796. 33. Knight, S., I. Andersson, and C. I. Branden. 1990. Crystallographic analysis of ribulose 1,5-bisphosphate carboxylase from spinach at 2.4 resolution subunit interactions and active-site. Journal of Molecular Biology 215: 113-160. 34. Kreuder, C., J. A. K. Mazet, G. D. Bossart, T. E. Carpenter, M. Holyoak, M. S. Elie, and S. D. Wright. 2002. Clinicopathologic features of suspected brevetoxicosis in double-crested cormorants ( Phalacrocorax auritus ) along the Florida Gulf Coast. Journal of Zoo and Wildlife Medicine 33: 8-15. 35. Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17: 1244-1245. 36. Layne, J. N. 1965. Observations on marine mammals in Florida waters. Bulletin of the Florida State Museum, Biological Sciences 9: 131-181. 37. Lee, M. S., G. W. Qin, K. Nakanishi, and M. G. Zagorski. 1989. BiosyntheticStudies of Brevetoxins, Potent Neurotoxins Produced by the Dinoflagellate Gymnodinium breve Journal of the American Chemical Society 111: 6234-6241. 38. Millie, D. F., O. M. Schofield, G. J. Kirkpatrick, G. Johnsen, P. A. Tester, and B. T. Vinyard. 1997. Detection of harmful algal blooms using photopigments and absorption signatures: A case study of the Florida red tide dinoflagellate, Gymnodinium breve Limnology and Oceanography 42: 12401251. 39. Moreira, D., and H. Philippe. 2001. Sure facts and open questions about the origin and evolution of photosynthetic plastids. Research in Microbiology 152: 771-780. 40. Morse, D. 1995. A nuclear-encoded form-II RuBisCO in dinoflagellates. Science 269: 17. 41. Naar, J., A. Bourdelais, C. Tomas, J. Kubanek, P. L. Whitney, L. Flewelling, K. Steidinger, J. Lancaster, and D. G. Baden. 2002. A competitive ELISA to detect brevetoxins from Karenia brevis (formerly Gymnodinium breve ) in seawater, shellfish, and mammalian body fluid. Environmental Health Perspectives 110: 179-185.

PAGE 95

87 87 42. Nassoury, N., L. Fritz, and D. Morse. 2001. Circadian changes in ribulose-1,5bisphosphate carboxylase/oxygenase distribution inside individual chloroplasts can account for the rhythm in dinoflagellate carbon fixation. Plant Cell 13: 923934. 43. Oberst, R. D., M. P. Hays, L. K. Bohra, R. K. Phebus, and J. M. Sargeant. 2003. Detection of Escherichia coli O157 : H7 in cattle feces using a polymerase chain reaction-based fluorogenic 5 nuclease (TaqMan (R)) detection assay after secondary enrichment. Journal of Veterinary Diagnostic Investigation 15: 543552. 44. Okamoto, O. K., and J. W. Hastings. 2003. Novel dinoflagellate clock-related genes identified through microarray analysis. Journal of Phycology 39: 519-526. 45. Ornolfsdottir, E. B., J. L. Pinckney, and P. A. Tester. 2003. Quantification of the relative abundance of the toxic dinoflagellate, Karenia brevis (Dinophyta), using unique photopigments. Journal of Phycology 39: 449-457. 46. Oshea, T. J., G. B. Rathbun, R. K. Bonde, C. D. Buergelt, and D. K. Odell. 1991. An Epizootic of Florida Manatees Associated with a Dinoflagellate Bloom. Marine Mammal Science 7: 165-179. 47. Paul, J. H., J. B. Kang, and F. R. Tabita. 2000. Diel patterns of regulation of rbcL transcription in a cyanobacterium and a prymnesiophyte. Marine Biotechnology 2: 429-436. 48. Pierce, R. H., M. S. Henry, P. C. Blum, J. Lyons, Y. S. Cheng, D. Yazzie, and Y. Zhou. 2003. Brevetoxin concentrations in marine aerosol: Human exposure levels during a Karenia brevis harmful algal bloom. Bulletin of Environmental Contamination and Toxicology 70: 161-165. 49. Rauter, H., M. Overeijnder, D. Doornbosch, and T. Schalkhammer. 2003. DegP and related genes as stress-markers for E. coli viability Ultra-sensitive RTreal-time PCR. Monatshefte Fur Chemie 134: 1489-1498. 50. Robledo, R., W. Beggs, and P. Bender. 2003. A simple and cost-effective method for rapid genotyping of insertion/deletion polymorphisms. Genomics 82: 580-582. 51. Ryu, C., K. Lee, C. Yoo, W. K. Seong, and H. B. Oh. 2003. Sensitive and rapid quantitative detection of anthrax spores isolated from soil samples by real-time PCR. Microbiology and Immunology 47: 693-699.

PAGE 96

88 88 52. Sieracki, C. K., M. E. Sieracki, and C. S. Yentsch. 1998. An imaging-in-flow system for automated analysis of marine microplankton. Marine EcologyProgress Series 168: 285-296. 53. Spreitzer, R. J., and M. E. Salvucci. 2002. Rubisco: Structure, regulatory interactions, and possibilities for a better enzyme. Annual Review of Plant Biology 53: 449-475. 54. Steidinger, K., and R. M. Ingle. 1972. Observations on 1971 Summer Red Tide in Tampa Bay, Florida. Environmental Letters 3: 271-278. 55. Steidinger, K. A., and E. A. Joyce, Jr. 1973. Florida Red Tides. State of Florida Department of Natural Resources Education Series 17: 1-26. 56. Stumpf, R. P. 2001. Applications of satellite ocean color sensors for monitoring and predicting harmful algal blooms. Human and Ecological Risk Assessment 7: 1363-U15. 57. Tabita, F. R. 1999. Microbial ribulose 1,5-bisphosphate carboxylase/oxygenase: a different perspective. Photosynthesis Research 60: 1-28. 58. Tabita, F. R., and B. A. McFadden. 1974. One-step isolation of microbial ribulose-1,5-diphosphate carboxylase. Archives of Microbiology 99: 231-240. 59. Takishita, K., K. Nakano, and A. Uchida. 2000. Origin of the plastid in the anomalously pigmented dinoflagellate Gymnodinium mikimotoi (Gymnodiniales, Dinophyta) as inferred from phylogenetic analysis based on the gene encoding the large subunit of form I-type RuBisCO. Phycological Research 48: 85-89. 60. Tengs, T., H. A. Bowers, A. P. Ziman, and D. K. Stoecker. 2001. Genetic polymorphism in Gymnodinium galatheanum chloroplast DNA sequences and development of a molecular detection assay. Molecular Ecology 10: 515-523. 61. Tester, P. A., and K. A. Steidinger. 1997. Gymnodinium breve red tide blooms: Initiation, transport, and consequences of surface circulation. Limnology and Oceanography 42: 1039-1051. 62. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Clustal-W Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Research 22: 4673-4680. 63. Trainer, V. L., and D. G. Baden. 1999. High affinity binding of red tide neurotoxins to marine mammal brain. Aquatic Toxicology 46: 139-148.

PAGE 97

89 89 64. Tyrrell, J. V., P. R. Bergquist, P. L. Bergquist, and C. A. Scholin. 2001. Detection and enumeration of Heterosigma akashiwo and Fibrocapsa japonica (Raphidophyceae) using rRNA-targeted oligonucleotide probes. Phycologia 40: 457-467. 65. Ulstrup, K. E., and M. J. H. Van Oppen. 2003. Geographic and habitat partitioning of genetically distinct zooxanthellae ( Symbiodinium ) in Acropora corals on the Great Barrier Reef. Molecular Ecology 12: 3477-3484. 66. Van Dolah, F. M., and T. A. Leighfield. 1999. Diel phasing of the cell-cycle in the Florida red tide dinoflagellate, Gymnodinium breve Journal of Phycology 35: 1404-1411. 67. Wawrik, B., J. H. Paul, and F. R. Tabita. 2002. Real-time PCR quantification of rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase) mRNA in diatoms and pelagophytes. Applied and Environmental Microbiology 68: 3771-3779. 68. Whitney, S. M., D. C. Shaw, and D. Yellowlees. 1995. Evidence That Some Dinoflagellates Contain a Ribulose-1,5-Bisphosphate Carboxylase Oxygenase Related to That of the Alpha-Proteobacteria. Proceedings of the Royal Society of London Series B-Biological Sciences 259: 271-275. 69. Wilson, W. B. 1967. Forms of Dinoflagellate Gymnodinium breve Davis in Cultures. Contributions in Marine Science 12: 120-&. 70. Zen, H., K. I. Nakashiro, S. Shintani, T. Sumida, T. Aramoto, and H. Hamakawa. 2003. Detection of circulating cancer cells in human oral squamous cell carcinoma. International Journal of Oncology 23: 605-610. 71. Zhang, H., and S. Lin. 2002. Detection and quantification of Pfiesteria piscicida by using the mitochondrial cytochrome b gene. Applied and Environmental Microbiology 68: 989-994.

PAGE 98

90 90 Appendices

PAGE 99

91 91 Appendix 1 Media Recipes: F/2 medium To 950 ml of filtered seawater, add: Quantity Compound Stock Solution (in deionized water) 1.0 ml NaNO 3 75.0 g L -1 1.0 ml NaH 2 PO 4 H 2 O 5.0 g L -1 1.0 ml Na 2 SiO 3 9H 2 O 30.0 g L -1 1.0 ml F/2 Trace Metal Solution (See Recipe Below) 0.5 ml F/2 Vitamin Solution (See Recipe Below) Adjust final volume to 1.0 L with filtered seawater, autoclave Trace Metal Solution To 950 ml deionized water, add: Quantity Compound Stock Solution (in deionized water) 3.15 g FeCl 3 6H 2 O -4.36 g Na 2 EDTA 2H 2 O -1.0 ml CuSO 4 5H 2 O 9.8 g L -1 1.0 ml Na 2 MoO 4 2H 2 O 6.3 g L -1 1.0 ml ZnSO 4 7H 2 O 22.0 g L -1 1.0 ml CoCl 2 6H 2 O 10.0 g L -1 1.0 ml MnCl 2 4H 2 O 180.0 g L -1 Adjust final volume to 1.0 L, autoclave.

PAGE 100

92 92 Appendix 1 (Continued) Vitamin Solution To 950 ml deionized water, add: Quantity Compound Stock Solution (in deionized water) 1.0 ml Vitamin B12 (Cyanocobalamin) 1.0 g L -1 10.0 ml Biotin 0.1 g L -1 200 mg Thiamine HCl -Adjust final volume to 1.0 L with deionized water. Filter sterilize into plastic vials and store in refrigerator. *Note that f/2 media is high in Silicon and should only be used for culture of diatoms. For cultures of non-diatoms, use f/2-Si (omit the Na 2 SiO 3 9H 2 O ) 2XYT to 950 ml deionized water, add: 16.0 g Tryptone 10.0 g Yeast Extract 5.0 g NaCl adjust volume to 1.0 L with deionized water and autoclave. For agar plates, add 15.0 g Bacto Agar, boil to dissolve, then autoclave. If antibiotics are needed, add 1.0 ml Kanamycin (50 mg/ml) and/or 1.0 ml Ampicillin (50 mg/ml). SN medium Quantity Compound Stock solution 2.5 ml NaNO 3 300.0 g L -1 2.6 ml K 2 HPO 4 6.1 g L -1 5.6 ml Na 2 EDTAH 2 O 1.0 g L -1 2.6 ml Na 2 CO 3 4.0 g L -1 1.0 ml Vitamin B12 1.0 mg L -1 1.0 ml Trace metal solution (see below) Add ingredients aseptically to 1 L autoclaved 75% seawater in a Teflon bottle.

PAGE 101

93 93 Appendix 1 (Continued) Trace Metal Solution Quantity Compound 6.25 g Citric acid H 2 O 6.0 g Ferric Ammonium Citrate 1.4 g MnCl 2 4H 2 O 0.39 g Na 2 MoO 4 2H 2 O 0.025 g Co(NO 3 ) 2 6H 2 O 0.222 g ZnSO 4 7H 2 O Dissolve each metal compound individually in 100 ml deionized water. Combine and mix the solutions, then bring final volume to 1.0 L with deionized water.

PAGE 102

94 94 Appendix 1 (Continued) Strains cultured and their media requirements: Organism strain media required growth temperature Dinoflagellates K. brevis various f/2 -Si 22 C K. mikimotoi CCMP430 f/2 -Si 16 C Amphidinium carterae CCMP1314 f/2 -Si 22 C Akashiwo sanguinea CCMP1321 f/2 -Si 22 C Alexandrium tamarense CCMP1493 f/2 -Si 22 C Glenodinium foliacrum N/A f/2 -Si 22 C Gymnodinium catenatum CCMP1937 f/2 -Si 22 C Gyrodinium sp. N/A f/2 -Si 22 C Kryptoperidinium foliaceum N/A f/2 -Si 22 C Lingulodinium polyedra CCMP1738 f/2 -Si 22 C Prorocentrum micans N/A f/2 -Si 22 C Scrippsiella trochoidea N/A f/2 -Si 22 C Scrippsiella precaria N/A f/2 -Si 22 C Diatom Phaeodactylum tricornutum CCMP1327 f/2 22 C Raphidophyte Heterosigma akashiwo N/A f/2 -Si 22 C Praisinophytes Tetraselmis sp. 850001 f/2 -Si 22 C Tetraselmis sp. CCMP961 f/2 -Si 22 C Unidentified sp. CCMP1536 f/2 -Si 22 C Prymnesiophytes Isochrysis sp. 3C Pavlova lutheri CCMP1325 f/2 -Si 16 C Prymnesium parvum N/A f/2 -Si 22 C Chlorophyte Clamydomonas euryale CCMP219 f/2 -Si + NH4 22 C Cyanophytes Synechococcus sp. CCMP836 SN 22 C Synechococcus sp. WH7803 SN 22 C Trebouxiophyte Chlorella autotrophica CCMP243 f/2 16 C Coscinodicsophyte Thalassiosira pseudonana CCMP 1335 f/2 16 C

PAGE 103

95 95 Appendix 2 Multiple sequence alignment of rbcL DNA sequences used in phylogenetic analysis Emiliana_huxleyi: GGTGGTCTAGACTTCCTTAAGGATGATGAGAACATTAACTCACAGCCATT ST8CH26_clone: ------------------------------------------C---CATT Isochrysis: GGTGGTCTAGACTTCCTTAAGGATGATGAGAACATTAACTCACAACCATT Calcidiscus: GGTGGTCTAGACTTCCTTAAGGATGATGAGAACATTAACTCACAACCATT Cruciplacolithus: GGTGGTCTAGACTTCCTTAAGGATGATGAGAACATTAACTCACAGCCGTT Pleurochrysis: GGTGGTCTAGATTTCCTTAAGGACGACGAGAACATTAACTCACAACCTTT Pavlova: GGTGGTCTGGACTTCCTTAAGGATGACGAAAACATCAACTCACAACCATT Exanthemachrysis: GGTGGTCTAGACTTCCTTAAGGATGACGAGAACATTAACTCACAACCATT Pyrenomonas: GGCGGTCTTGACTTCCTTAAGGATGATGAAAACATCAACTCTCAACCATT Chroomonas: GGTGGTTTAGACTTCCTTAAAGATGATGAAAACATTAACTCTCAACCATT Rhodella: GGTGGATTAGACTTCTTAAAGGATGATGAAAACATTAACTCTCAACCGTT Dictyocha: GGTGGTCTTGATTTCCTTAAAGATGATGAGAATATTAACTCACAAGCGTT ST6CH33_clone: ------------------------------------------C---CATT Heterosigma: ATTTTTTCTTAGACTGTACACTAACGTACAAAAATTAAAAAGGAGGAATA Chattonella: GGTGGTCTTGACTTCTTAAAAGATGATGAGAACATTAACTCTCAACCATT ST4CH31_clone: ------------------------------------------C---CATT ST1CH4_clone: ------------------------------------------CAACCATT ST3CH27_clone: ------------------------------------------CAAGCATT Ectocarpus: GGTGGTCTTGACTTCCTTAAAGATGATGAAAATATTAATTCACAACCATT Xanthonema: GGTGGTCTTGACTTCTTAAAAGATGATGAAAACATTAACTCTCAACCATT Vaucheria: GGTGGTTTAGATTTCTTAAAAGATGATGAGAATATTAATTCTCAACCATT Heterococcus: GATATGCGAATTCCTTTTGCTTACCTAAAAACATTCCAAGGTCCTGCAAC Aureoumbra: GGTGGTTTAGACTTTTTAAAGGATGATGAAAACATTAACTCGCAACCTTT Aureococcus: GGTGGTTTAGACTTCTTAAAGGATGATGAGAACATTAACTCACAACCATT Pelagococcus: GGTGGTTTAGACTTCTTAAAGGATGACGAGAACATTAACTCACAACCATT Cylindrotheca: GGTGGTTTAGACTTTTTAAAAGATGATGAAAACATTAACTCACAACCATT Phaeodactylum: GGTGGTTTAGACTTCTTAAAAGATGATGAGAATATTAACTCACAACCCTT ST4CH14_clone: ------------------------------------------C---CATT ST6CH2_clone: ------------------------------------------C---CATT Rhizosolenia: GGTGGTTTAGACTTCTTAAAAGATGATGAAAACATTAACTCACAACCATT Skeletonema: GGTGGTTTAGACTTCTTAAAGGATGATGAAAATATTAACTCTCAACCATT Thalassiosira: GGTGGTTTAGACTTCTTAAAAGATGATGAAAACATTAACTCTCAACCATT Detonula: CGTCGTTGTATGCCAGTAGCTTCTGGTGGTATCCACTGTGGTCAAATGCA Chilomonas: GGTGGCTTGGACTTCCTTAAGGATGATGAAAACATTAATTCTCAGCCTTT Mazzaella_membranacea: GGTGGTTTAGACTTCTTAAAAGATGATGAGAATATTAATTCTCAGCCTTT Karenia_brevis: GGGGGATTAGATTTTCTTAAAGATGATGAAAATATTAATTCGCAGCCTTT Jaxonville C3a: ---------------------GATGATGAAAATATTAACTCGCAGCCTTT Mexico_Beach_C5: ---------------------GATGATGAAAATATTAACTCGCAGCCTTT Piney_Island_A9: ---------------------GATGATGAAAATATTAACTCGCAGCCTTT Charlotte_Harbor_C2: ---------------------GATGATGAAAATATTAACTCGCAGCCTTT Charlotte_Harbor_A2: ---------------------TATGATGAAAATATTAACTCGCAGCCTTT Piney_Island_B4: ---------------------GATGATGAGAATATTAACTCGCAGCCTTT Mexico_Beach_B3: ------------------------GATGAGAACATTAACTCGCAGCCTTT Appalachicola_C6: ---------------------GATGATGAGAATATTAACTCGCAGCCTTT Karenia_mikimotoi_1: ---------------------GATGATGAGAATATTAACTCACAACCGTT Karenia_mikimotoi: GGAGGCTTGGATTTCTTAAAGGATGATGAGAACATTAACTCACAACCGTT Karlodinium: GGCGGTTTGGATTTTCTTAAAGATGATGAAAATATCAATTCTCAACCTTT Amphidinium: CTTGCTAACATGTCAAGCGAAGCCCTGTCGACGGTCTTCACCATAGGTGC ST2SY33_clone: GGTGGTCTCGATTTAACGAAGGATGACGAGAATATAAACTCTCAGCCATT Prochlorococcus: GGCGGTCTTGATTTAACGAAGGATGATGAGAATATTAATTCTCAACCATT

PAGE 104

96 96 Appendix 2 (Continued) Thiobacillus: CTACGTCAAGACCTGCGGTGGGCCACCCCACGGGATTCAGGTCGAACGCG Synechococcus_sp: GGTGGTTTGGACTTCACCAAAGATGACGAAAACATCAACTCCCAGCCTTT ST2SY26_clone: GGTGTTTTGNACTTCACCAAAGACGACGAGAACATCAACTNTCAGCCCTT Synechococcus: GTTCATCAAGAGCTGCTACGGCCCGCCGAACGGCATCCAGGTCGAGCGCG Nitrobacter: TTACGTGAAGACCTGCGGCGGCCCTCCGCATGGTATCCAGGTCGAGCGCG Synechocystis: GGTGGTTTGGACTTCACCAAAGACGACGAAAACATCAACTCCCAGCCCTT Synecchococcus_PCC7002: GGTGGTCTTGACTTCACCAAAGATGACGAAAACATCAACTCTCAGCCTTT ST8SY15_clone: GGAGGTCTAGACTTCACCAAGGATGACGAAAATATTAACTCTCAACCTTT Trichodesmium: GGAGGTCTAGACTTCACCAAGGATGACGAAAATATTAACTCTCAACCTTT ST5SY7_clone: GGTGGTTTAGATTTTACTAAGGATGACGAGAACGTAAATTCTCAACCTTT ST2SY2_clone: ------------------------GATGAGAACGTAAACTCACAACCCTT ST6SY8_clone: GGTGGTCTTGACTTCACTAAGGATGATGAGAACGTAAACTCCCAGCCTTT Volvox_carteri: GATCTTCGTATTCCACCTGCTTACGTTAAAACATTCCAAGGTCCACCACA Spinacia: GGTGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCCCAGCCGTT Asparagus: GGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCTTT Thalassia: GATTTGCGAATTCCCCCTTCCTATTCCAAAACTTTCCAAGGTCCACCTCA Prymnesium: GGTGGTCTTGATTTCCTTAAGGATGATGAGAACATTAACTCTCAACCATT Chrysochromulina_sp: GGTGGTCTTGACTTCCTAAAGGATGATGAGAACATTAACTCTCAGCCATT Imantionia: GGTGGTCTTGACTTCCTAAAGGATGACGAGAACATTAACTCGCAGCCTTT ST1CH3_clone: ------------------------------------------C---CATT Helicosphaera: GGAGGTCTAGATTTCCTTAAGGATGATGAGAACATCAACTCACAACCATT Emiliana_huxleyi: CATGCGTTACCGTGAGCGTTTCCTTTACTCAATGGAAGGTGTTAACCATG ST8CH26_clone: CATGCGTTACAGAGAGCGTTTCTTATACTCAATGNAAGGTGTTAACCACG Isochrysis: TATGCGTTACCGTGAGCGTTTCCTTTACTCAATGGAAGGTGTTAACAACG Calcidiscus: TATGCGTTACAGAGAGCGTTTCCTTTACTCAATGGAAGGTGTAAACCACG Cruciplacolithus: CATGCGTTACAGAGAGCGTTTCCTTTACTCAATGGAAGGTGTAAACCACG Pleurochrysis: CATGCGTTACCGCGAGCGTTTCCTTTACTCAATGGAAGGTGTAAACCATG Pavlova: TATGCGTTGGAGAGAGCGTTTCCTATTCTCGATGGAAGGTGTTAACCGTG Exanthemachrysis: CATGCGTTGGAGAGAGCGTTTCCTATTCTCAATGGAAGGTGTTAACCGTG Pyrenomonas: CATGAGATGGAAAGAGCGTTTCTTATTCGGTATGGAAGGTGTTAACAGAG Chroomonas: CATGAGATGGAAAGAGCGTTTCTTATTTGGTATGGAAGGTGTTAACCGTG Rhodella: TATGCGTTACAGAGAGCGTTTCTTATTCTCTATGGAAGGTGTAAACCGTG Dictyocha: CATGCGTTGGAGAGAACGTTTCCTTTACTGTCAAGAAGGTATTCAACGTG ST6CH33_clone: CATGCGTTGGAGAGAGCGTTTCTTATACGTAATGGAAGGTGTTAACCGTG Heterosigma: CATGTCTAACAACGTATACGAACGTAACCGAATCAAAAATGATCGTTATG Chattonella: CATGCGTTGGAGAGAGCGTTTCCTTTACTGTATGGAAGGTATTAATCGTG ST4CH31_clone: CATGCGTTGGAGAGAACGTTTCCTATACTGTATGGAAGGTATTAATCGTG ST1CH4_clone: CATGAGATGGCGTGAAAGATACTTATACGTTATGGAAGGAATTAACAAAG ST3CH27_clone: CATGAGATGGAGAGAAAGATTCTCTTACGTAATGGAAGGTGTTAACCGTG Ectocarpus: TATGCGTTGGAAAGAACGTTTCTTATACTGTATGGAAGGTGTTAACCGTG Xanthonema: CATGCGTTGGAGAGAACGTTTCCTTTACTGTATGGAAGGTATTAACCGTG Vaucheria: TATGCGTTGGAGAGAGCGTTTTCTTTACTGTATGGAAGGTGTTAATCGTG Heterococcus: TGGTGTTATTGTAGAAAGAGAAAGAATGGACA---AATTCGGTCGCCCTT Aureoumbra: CATGCGTTGGCGTGAGCGTTTCTTATACTGTATCGAAGGTATTAATCGTG Aureococcus: CATGCGTTGGCGTGAGCGTTTCATCTACTGTGTAGAGGGTATCAACCGTG Pelagococcus: CATGCGTTGGCGTGAGCGTTTCTTATACTGTGTAGAAGGTATTAACCGTG Cylindrotheca: TATGCGTTGGAGAGAACGTTTCTTAAACTGTATGGAAGGTATTAACCGTG Phaeodactylum: CATGCGTTGGAGAGAACGTTTCTTATACTGTATGGAAGGTATTAATCGCG ST4CH14_clone: CATGCGTTGGAGAGAGCGTTTCTTAAACTGTATGGAAGGTATCAACCGTG ST6CH2_clone: CATGCGTTGGAGAGAGCGTTTCTTATACTGTATGGAAGGTATTAACCGTG Rhizosolenia: CATGCGTTGGAGAGAACGTTTCTTATACTGTATGGAAGGTATTAACCGTG Skeletonema: CATGCGTTGGAGAGAACGTTTCTTAAACTGTATGGAAGGTATTAACCGTG Thalassiosira: TATGCGTTGGAGAGAACGTTTCTTAAACTGTTTAGAAGGTATCAACCGTG

PAGE 105

97 97 Appendix 2 (Continued) Detonula: TCAATTAATTCATTACTTAGGTGATGATGTTGTATTACAATTCGGTGGTG Chilomonas: TATGAGATGGAGAGAACGCTTCCTATTTGGGATTGAAGGAGTTAGCAGAG Mazzaella_membranacea: CATGCGTTGGAAAGAAAGATACCTATATTCAATGGAAGGTGTAAACCGTG Karenia_brevis: TATGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Jaxonville C3a: TATGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Mexico_Beach_C5: TATGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Piney_Island_A9: TATGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Charlotte_Harbor_C2: TATGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Charlotte_Harbor_A2: TATGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Piney_Island_B4: TATGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Mexico_Beach_B3: TATGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Appalachicola_C6: TACGCGGTATCGTGAACGTTTCCTATACTCTATGGAAGGTGTCAATCATG Karenia_mikimotoi_1: TATGCGTTACCGAGAACGGTTTCTTTTCTCAATGGAAGAGGTGAATCATG Karenia_mikimotoi: TATGCGTTATCGAGAACGGTTCCTTTTCTCAATGGAAGCGGTGAATCATG Karlodinium: TATGAGGTATAGAGAAAGGTTTTTATTCTCCATGGAAGGGGTGAATCATG Amphidinium: CGGTGATGCAACGCTCACCAGAGCGCACCCAGGGATAAAGGCTGGGCAGC ST2SY33_clone: CCAACGTTGGAGAGAAAGATTTGAGTTTGTTGCAGAAGCAGTTAAGCTTG Prochlorococcus: CCAACGTTGGAGAGAAAGATTTGAGTTTGTTGCAGAAGCAGTTAAGCTTG Thiobacillus: ACATCATGAACAAGTATGGTCGCCCATTGCTGGGCTGCACCATCAAACCC Synechococcus_sp: CCAACGCTGGCGCGATCGCTTCCTGTTTGTTGCTGATGCCATTCACAAAG ST2SY26_clone: CNAGCGTTGGCAGAACCGCTTCGAATTCGTTGCGGAAGCCATCAAGCTGT Synechococcus: ACCGGATGAACAAGTACGGCCGTCCCCTGCTGGGTTGCACCATCAAGCCG Nitrobacter: ACAAGCTTAACAAGTACGGCCGCCCGCTGTTGGGCTGCACCATCAAGCCG Synechocystis: CATGCGTTGGCGCGATCGTTTCCTCTTCGTTCAAGAGGCGATCGAAAAAG Synecchococcus_PCC7002: CATGCGTTGGCGCGATCGCTTCCTGTTCGTTCAAGAAGCTATCGAAAAAT ST8SY15_clone: CATGCGTTGGCGCGATCGCTTCCTATTCGTTCAAGAAGCCATTGAAAAGG Trichodesmium: CATGCGTTGGCGCGATCGCTTCCTATTCGTTCAAGAAGCCATTGAAAAGG ST5SY7_clone: TATGAGATGGAGAGATAGATTCTTATTTGTTTCTGAAGCAATTTATAAAG ST2SY2_clone: TCAGCGTTGGCGTGATCGTTTCCTATTCATTGCTGAGGCTACACACAAGT ST6SY8_clone: CATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAGGCTATTTACAAGG Volvox_carteri: CGGTATTCAGGTTGAACGTGACAAACTAAACA---AATATGGTCGTGGTC Spinacia: TATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCTCTTTATAAAG Asparagus: TATGCGTTGGCGAGACCGTTTCGTATTTTGTGCTGAAGCTCTTTATAAAG Thalassia: TGGAATCCAAGTGGAAAGAGATAGATTGAACA---AATACGGCCGCCCTC Prymnesium: CATGCGTTACAGAGAGCGTTTCCTTTATTCAATGGAAGGTGTTAACCACG Chrysochromulina_sp: CATGCGTTACAGAGAGCGTTTCCTTTACTCAATGGAAGGTGTTAACCACG Imantionia: CATGCGTTACAGAGAGCGTTTCCTTTACTCAATGGAAGGTGTTAACAACG ST1CH3_clone: TATGCGTTTCAGAGAGCGTTTCCTATACTCTATGGAAGGTGTAAACCACG Helicosphaera: CATGCGTTACAGAGAGCGTTTCCTATACTCAATGGAAGGTGTAAACCACG Emiliana_huxleyi: CAGCTTGTCTAACTGGTGAAGTTAAAGGTCACTACCTTAACACAACTGCG ST8CH26_clone: CTGCTTGTCAGACTGGTGAAGTTAAAGGTCACTACCTTAACGCAACAGCT Isochrysis: CTGCTGCAACAACTGGTGAGGTTAAGGGTCACTACCTTAACACAACTGCA Calcidiscus: CTGCTGCAACAACTGGTGAGGTTAAAGGTCACTACCTTAACGCAACAGCT Cruciplacolithus: CTGCTGCAATGTCTGGTGAAGTTAAGGGTCACTACCTTAATGCAACAGCT Pleurochrysis: CAGCGGCAGTAAGTGGGGAAGTAAAAGGGCACTACCTTAACGCAACGGCA Pavlova: CTGCAGCTGGTTCTGGAGAGGTTAAAGGTCACTACCTAAATGCAACAGCT Exanthemachrysis: CAGCGGCAGCTTCTGGAGAAGTTAAAGGTCACTACCTAAACGCTACAGCT Pyrenomonas: CTGCTGCTGGTACTGGTGAGATTAAAGGTCACTACTTCAACATTACTGCA Chroomonas: CTGCTGCTGCTGCAGGTGAAGTTAAAGGACATTACTTTAACGTTACAGCT Rhodella: CTTCTGCAAGTTCTGGTGAAGTTAAAGGTCATTACCTTAACGTCACAGCA Dictyocha: CCGCAGCAGCTACTGGTGAAGTTAAAGGTNNNTACCTTAATGGTACTGCT ST6CH33_clone: CAGCAGCTGCTTCTGGTGAAGTTAAAGGTTCTTACTTAAATGCTACTGCA Heterosigma: AATCAGGTGTAATCCCTTACGCTAAAATGGGTTATTGGGATGCTAATTAChattonella: CTTCTGCTGCTTCAGGTGAAGTTAAAGGTTCTTACTTAAACTGTACAGCT ST4CH31_clone: CTTCAGCTGCAACTGGTGAAACAAAAGGTTCATACCTAAACATTACAGCA ST1CH4_clone: CAGCAGCTAAAACTGGTGCAGTTAAAGGTTCTTACTTAAACGTAACGGCT

PAGE 106

98 98 Appendix 2 (Continued) ST3CH27_clone: CTGCTACTGCAAGTGGTGAAGTTAAAGGTTCTTACTTAAACGTAACTGCT Ectocarpus: CTGCAGCTGCAACAGGTGAAGTTAAAGGTTCTTATCTTAACATTACAGCC Xanthonema: CTGCTGCTGCAACAGGTGAAGTTAAAGGTTCTTACTTAAACGTTACAGCT Vaucheria: CAGTAGCAGCTAGTGGTGAAGTTAAAGGTTCATACCTTAATACAACTGCA Heterococcus: TATTAGGTGCAACGGTAAAACCAAAATTAGGTCTTTCAGGTAAAAACTAC Aureoumbra: CCGTTTCAGTAACAGGTGAGGTTAAGGGTTCTTACTTAAACATTACTGCT Aureococcus: CCGCTGCTGCAACTGGTGAAGTTAAAGGTTCTTACTTAAACATTACTGCT Pelagococcus: CTGCTGCTGCAACTGGTGAAGTTAAGGGTTCTTACTTAAACATGACTGCT Cylindrotheca: CTTCTGCTGCTACAGGTGAAGTTAAAGGTTCTTATTTAAACGTTACAGCT Phaeodactylum: CTTCTGCAGCTACAGGTGAAACTAAAGGTTCATACCTAAACATCACAGCT ST4CH14_clone: CTGCTGCTGCTACTGGTGAAATTAAAGGTTCTTACTTAAACATCACTGCA ST6CH2_clone: CTTCAGCAGCTACTGGTGAAGTTAAAGGTTCTTACTTAAACGTAACTGCT Rhizosolenia: CTGCTGCCGCTACTGGTGAAGTTAAAGGTTCTTACTTAAACATTACTGCT Skeletonema: CATCAGCTGCAACTGGTGAAGTTAAAGGTTCTTACTTAAACATTACTGCT Thalassiosira: CAGCTGCTGCAACTGGTGAAGTTAAAGGTTCTTACTTAAACATTACTGCT Detonula: GTACTATTGGTCACCCTGATGGTATTCAAGCTGGTGCTACAGCAAACCGT Chilomonas: CTTCTGCTTCTTCTGGTGAAGTAAAAGGTCACTACTTTAACATCACTGCG Mazzaella_membranacea: CTATTGCTGCTGCTGGTGAAACAAAGGGGCATTATTTAAATGTAACAGCA Karenia_brevis: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGGCA Jaxonville C3a: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGGCA Mexico_Beach_C5: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGGCA Piney_Island_A9: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGACA Charlotte_Harbor_C2: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGGCA Charlotte_Harbor_A2: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGGCA Piney_Island_B4: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGGCA Mexico_Beach_B3: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGGCA Appalachicola_C6: CTGCCGCAAAAACCGGTGAAATCAAAGGACATTATTTAAATGTCACGGCA Karenia_mikimotoi_1: CTGCTGCTAAGTCAGGGGAAATCAAAGGTCATTATTTAAACGTAACTGCG Karenia_mikimotoi: CTGCTGCTCAGTCAGGAGAAATAAAAGGTCATTACCTAAACATAACTGCG Karlodinium: CTTCTTGTTTAACGGGTGAGGTTAAAGGACATTATTTAAATGTTACTGGG Amphidinium: TTCGTGGCGTTCCCATGAGTATGGACGCTGCCGAACTTTTGCCCACCGCA ST2SY33_clone: CTCAGCAAGAAACTGGTGAAGTTAAAGGTCACTACCTAAACTGTACTGCC Prochlorococcus: CTCAGCGAGAAACTGGAGAAGTTAAAGGTCACTATCTAAATTGTACTGCT Thiobacillus: AAGCTGGGTTTGTCGGCCAAGAACTATGGTCGCGCTTGCTATGAGGGTCT Synechococcus_sp: CCCAGGCGGAAACCGGTGAAATCAAAGGGCACTATTTGAACGTCACCGCT ST2SY26_clone: CCGAGCAGGAGACCGGCGAGCGCAAGGGTCACTACCTCAACGTGACCGCC Synechococcus: AAGCTCGGCCTGAGCGGCAAGAACTACGGCCGTGTGGTCTATGAGTGCCT Nitrobacter: AAGCTTGGTCTGTCCGCGAAGAACTACGGCCGCGCCTGCTATGAAGCGCT Synechocystis: CCCAGGCTGAGACCAACGAAATGAAAGGTCACTACCTGAACGTCACCGCT Synecchococcus_PCC7002: CCCAAGCTGAAACCAACGAAGTTAAGGGTCACTACCTTAACGTCACCGCT ST8SY15_clone: CCCAAGCAGAAACAGGTGAAATTAAAGGTCACTACCTCAACGTAACTGCC Trichodesmium: CCCAAGCAGGAACAGGTGAAATTAAAGGTCACTACCTCAACGTAACTGCC ST5SY7_clone: CTCAAGCAGAAACAGGAGAAATTAAAGGTCATTACTTAAATGCTACTGCA ST2SY2_clone: CTCAAGCAGAGACTGGTGAGATCAAGGGTCACTACCTAAACGCTACTGCT ST6SY8_clone: CACAAGGTGAAACTGGTGAGATTAAGGGTCACTACCTTAACGCAACTGCT Volvox_carteri: TTTTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTAC Spinacia: CACAAGCCGAAACAGGCGAAATCAAAGGGCATTACTTGAATGCTACCGCG Asparagus: CACAAGCAGAAACAGGTGAAATCAAAGGCCATTACTTGAATGCAACTGCA Thalassia: TACTAGGATGTACTATTAAACCAAAATTGGGATTATCCGCGAAAAACTAT Prymnesium: CAGCAGCAATGACTGGTGAAGTTAAAGGTCACTACCTAAATGCAACGGCA Chrysochromulina_sp: CATCTGCACTAACTGGTGAAGTTAAGGGTCACTACCTAAACTCTACTGCG Imantionia: CAGCTGCTCACAGTGGTGAGGTTAAAGGTCACTACCTAAACACTACTGGT ST1CH3_clone: CAGCAGCAATGTCTGGTGAGGTTAAAGGTCACTACCTAAACACTACTGCT Helicosphaera: CAGCTGCAATGACAGGTGAAGTTAAAGGTCACTACCTTAACACAACTGCT Emiliana_huxleyi: GCAACAATGGAAGATATGTACGAACGTGCTAACTTCGCAAGAGATCTAGG ST8CH26_clone: TCAACTATGGAAGACATGTACGAGCGTTCTGAGTTCTGTTACGAATTAGG

PAGE 107

99 99 Appendix 2 (Continued) Isochrysis: GCTACAATGGAAGATATGTACGAGCGTGCTGACTTCGCTAAGGAGTTAGG Calcidiscus: GCAACAATGGAAGATATGTATGAGCGTGCAGAATTCTGTAAAGAGCTTGG Cruciplacolithus: GCAACAATGGAAGATATGTATGAGCGCGCAGAATTCTCTAAGGAGCTTGG Pleurochrysis: GCGACGATGGAAGATATGTACGAGCGTGCTGAATTCGCTAAGGATTTAGG Pavlova: TCTACTATGGAAGAAATGTATACGCGTGCTGACTACGCTAAGGAGCTAGG Exanthemachrysis: GGTACTATGGAAGACATGTACGAGCGTGCTGACTACTCTAGAGATCTAGG Pyrenomonas: GGTACAATGGAAGATATGTACGAGCGTGCTGAATTCTGTAAAGAAATCGG Chroomonas: GGTACAATGGAAGAAATGTATGCTCGTGCTGAATTCTGTTCAGATTTAGG Rhodella: GCAACTATGGAAGATATGTACGAGCGTGCTGAATTCTCTAAAGCAGTTGG Dictyocha: GGTACTATGGAAGNNGTTTACGAACGTGCTGAATATGCTAAGGAACTTGG ST6CH33_clone: GCGACTACGGAAGAAATGTACGTTCGTGCAGATTACGCTAAGTCTGTTGG Heterosigma: --TTCTGTTAAAGATACAGATTTATTAGCTTTATTCCGTCTTACACCACA Chattonella: GCTACAATGGAAGAAATGTACGAACGTGCAGAATATGCTAAGTCTGTTGG ST4CH31_clone: GCTACAATGGAAGAAGTTTACAAACGTGGTGATTATGCGAAAGCAGTTGG ST1CH4_clone: GCAACTATGGACGAAATGTATGAAAGAGCTGAATTCGCAAAAGAAGTTGG ST3CH27_clone: GGTACTATGGAGCAAATGTACGAACGTGCTGAATTCGCTAAAATCATTGG Ectocarpus: GCAACTGTAGAGCAAATGTATGAACGTGCAGAGTATGCTCATGCAATTGG Xanthonema: GGTAACATGGAAGACATGTACGAACGTGCTGAATACGCTAAAACAATTGG Vaucheria: GGTACAATGGAAGAGATGTATGAACGTGCAGAATATGCTAAAAGTATAGG Heterococcus: GGTCGTGTAGTATATGAAGGTCTTCGTGGTGGTCTTGATTTCTTAAAAGA Aureoumbra: GGTACTATGGAAGAAATGTACACACGTGCAGAGTACGCTAAGGAACTTGG Aureococcus: GCAACAATGGAAGAAATGATCATTCGTGCAGAGTACGCTAAAGAGTTAGG Pelagococcus: GGTAACAACGATGAAATGATCACTCGTGGTGAGTACGCTAAAGAGATCGG Cylindrotheca: GCTACTATGGAAGAAGTATACAAACGTTCTGAGTATGCTAAAGAAGTAGG Phaeodactylum: GGTACTATGGAAGAAGTTTACAAACGTGCAGAATATGCTAAAACAGTAGG ST4CH14_clone: GGTACAATGGAAGAAGTTTACAAACGTGCAGAATATGCTAAATCTGTAGG ST6CH2_clone: GCCACTATGGAAGAAGTTTACAAACGTGCAGAATATGCTAAACAAGTTGG Rhizosolenia: GCAACATACGAAGAAGTAGAAAAACGTGCTGACTATGCTAAAGCTGTTGG Skeletonema: GCTACAATGGAAGAAGTATACAAACGTGCTGAGTATGCTAAAGCTGTTGG Thalassiosira: GCTACTATGGAAGAAGTATACAAACGTGCTGAGTATGCTAAAGCTATTGG Detonula: GTTGCTTTAGAAGCAATGGTTTTTTCTCGTAACGAAGGTGCTGACTACTT Chilomonas: GGAACAATGGAAGACATGTATGAGAGGGCTAATTTTGCTAAAGAAATTGG Mazzaella_membranacea: GCTACAATGGAACAAATATATGAAAGAGCTGAATTTGCTAAAGAGCTTGG Karenia_brevis: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Jaxonville C3a: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Mexico_Beach_C5: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Piney_Island_A9: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Charlotte_Harbor_C2: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Charlotte_Harbor_A2: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Piney_Island_B4: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Mexico_Beach_B3: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Appalachicola_C6: GCGACGATGGAAGACATGTATGAAAGAGCGAATTTCGCTACGGAACTAGG Karenia_mikimotoi_1: GCAACAATGGAGAACATGTATGAAAGAGCAAATTTCGCTGGTGAACTTGG Karenia_mikimotoi: GCAACAATGGAGGACATGTATGAAAGAGCAGATTTCGCCGCCGAACTTGG Karlodinium: GCAACCATGGAAGATCTTTATGAACGTTCAGACCTATGTTATCAACTAGG Amphidinium: GAGAAGGGTGCGAGTTCTTCTTCTGTCGTTCTTGGATCTGTGGCCGTTGG ST2SY33_clone: AACACTCCTGAAGAACTTTACGAAAGAGCTGAATTTGCAAAAGAGCTAGA Prochlorococcus: AACACTCCTGAAGAACTCTATGAAAGAGCTGAATTTGCAAAAGAGCTCGA Thiobacillus: GCGTGGTGGACTCGACTTCACTAAAGATGACGAAAACGTCAATAGCCAGC Synechococcus_sp: CCCACCTGTGAAGAAATGTTGAAACGGGCAGAGTTCGCTAAAGA---CTG ST2SY26_clone: AACACTCCCGAAGAGATGTACGAGCGCGCTGAGTTCGCCAAGGAACTCGG Synechococcus: GCGTGGCGGTCTGGACTTCACCAAGGACGACGAGAACATCAACTCCCAGC Nitrobacter: ACGTGGCGGTCTGGACTTCACCAAGGACGACGAGAACATCAACAGCCAGC Synechocystis: GGCACCTGCGAAGAAATGATGAAACGGGCCGAGTTTGCCAAGGAAATTGG Synecchococcus_PCC7002: GGCACTTGCGAAGAAATGCTCAAGCGGGCTGAATTCGCTAAGGAAATCGG ST8SY15_clone: CCTACCTGTGAAGAAATGTTAGAGCGTGCAGATTTTGCTAAGGAAATTGG Trichodesmium: CCTACCTGTGAAGA---ATGTAGACGTGCAGTTTTTGCTAAGGAAATTGG

PAGE 108

100 100 Appendix 2 (Continued) ST5SY7_clone: GGTACTTGTGAAGAGATGTTAAAAAGAGGTGAATGTGCTAAAGAATTAGG ST2SY2_clone: GGTCACTGTGATGAGATGCTTAAGCGTGCAGCATTTGCTCGTGAGATCGG ST6SY8_clone: GGTACGAATGAGGAGATGATGAAGCGTGCTGAGTTCGCTGTTGATCTTGG Volvox_carteri: GGTCGTGCAGTTTACGAATGTTTACGTGGTGGTTTAGACTTTACTAAAGA Spinacia: GGTACATGCGAAGATATGATGAAAAGGGCTGTATTTGCCAGAGAATTGGG Asparagus: GGTACATGTGAAGAAATGATGAAAAGGGCCATATTTGCCAGAGAATTGGG Thalassia: GGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTGGATTTTACTAAAGA Prymnesium: GCTACTATGGAAGATATGTACGAACGTGCAGAGTTCTGTAAAGAGCTAGG Chrysochromulina_sp: GCTACTATGGAAGATATGTACGAACGTGCTGATTTCGCTAAAGAGCTAGG Imantionia: GCTACGATGGAAGATATGTACGAGCGTGCAAACTTCGCGAAAGATCTAGG ST1CH3_clone: TCTACAATGGAAGATATGTATGAGCGTGCTGATTTAGCATGTGAATTAGG Helicosphaera: GCAACTATGGAAGATATGTACGAGCGTGCAGATTTTGCAAAAGAACTTGG Emiliana_huxleyi: TTCAGTTATTGTAATGATTGACCTTGTAATTG---GTTATA--------C ST8CH26_clone: TTCAGTTATTGTAATGATTGACCTTGTAA---TCGGTTATA--------C Isochrysis: TTCAGTTATTGTTATGATCGACCTTGTAATCG---GTTATA--------C Calcidiscus: TTCTGTAATTGTGATGATCGACCTTGTAATTG---GTTATA--------C Cruciplacolithus: TTCAGTAATTACAATGATTGACCTTGTAATTG---GTTACA--------C Pleurochrysis: TTCAGTTATTGTTATGATTGACCTTGTGATTG---GTTATA--------C Pavlova: TTCAATCATTGTTATGATTGACCTTGTTATTGGA---TACA--------C Exanthemachrysis: TTCAATCATTGTTATGATCGACCTTGTAATCG---GATACA--------C Pyrenomonas: TACTGTTATTTGTATGATCGACCTTGTAATCGGT---TACA--------C Chroomonas: CTCTGTAATTTGTATGATCGACCTTGTAATTGGT---TATA--------C Rhodella: AAGCATCATTTGTATGATCGACCTTGTAATTGGT---TATA--------C Dictyocha: TACTATTGGTATTATGAATGACCTTGGTATGG---GTTATA--------C ST6CH33_clone: TACTATCATTATCATGATTGACCTTGTAA---TTGGTTACA--------C Heterosigma: ACCTGGAGTAGACCCTGTGGAAGCTGCAGCGGCAGTAGC--AGGTGAATC Chattonella: TTCTGTAATTATCATGATTGACCTTGTAATTG---GTTACA--------C ST4CH31_clone: ATCTGTAATTGTCATGATTGATTTAGTAA---TGGGTTACA--------C ST1CH4_clone: ATCAGTTATTATCATGATTGACTTAGTAA---TTGGTTACA--------C ST3CH27_clone: ATCTGTAATTATTATGATCGATTTAGTAA---TTGGTTATA--------C Ectocarpus: TTCAGTTATTGTTATGATCGATTTAGTTATTGGTTATAC--AGCAATTCA Xanthonema: TTCAATCATTGTTATGATCGACCTTGTAATTG---GTTACA--------C Vaucheria: CTCAATTATTGTAATGATTGACCTTGTAATTGGTTATAC--TGCTATTCA Heterococcus: TGATGAAAACATTAACTCACAACCATTCATGCGTTGGAGAG--------A Aureoumbra: TTCAATTATTGTAATGATCGATTTAGTTATCG---GTTACA--------C Aureococcus: TTCTATCATTATCATGATTGACTTAGTTATTG---GTTACA--------C Pelagococcus: TTCTGTAATCGTAATGATTGACTTAGTAATTG---GTTACA--------C Cylindrotheca: TTCTATCATTATCATGATCGATTTAGTTATGG---GTTACA--------C Phaeodactylum: TTCTATCGTTGTTATGATCGATTTAGTTATGG---GTTATA--------C ST4CH14_clone: TTCTATCATTGTAATGATCGATTTAGTTA---TGGGTTACA--------C ST6CH2_clone: TTCTGTAATTATCATGATCGATTTAGTAA---TGGGTTATA--------C Rhizosolenia: TTCTGTAGTTGTAATGATCGATTTAGTAATGG---GTTACA--------C Skeletonema: TTCTATCGTTGTTATGATCGATTTAGTAATGG---GTTACA--------C Thalassiosira: TTCTGTCCTTGTAATGATCGATTTAGTAATGGGTTACAC--TGCAATTCA Detonula: TAATAACCAAGTAGGTCCTCAAATCTTACGTGACGCAGCTAAGACATGTG Chilomonas: TAGTGTTATCTGTATGATCGATCTTGTTATTGGA---TATA--------C Mazzaella_membranacea: TAGTATCATTGTAATGATTGACCTTGTAATTG---GTTATA--------C Karenia_brevis: TTCCATAATTGTAATGATAGATCTTGTAATTGGTT---ATA--------C Jaxonville C3a: TTCCATAATTGTAATGATAGATCTTGTAA---TTGGTTATA--------C Mexico_Beach_C5: TTCCATAATTGTAATGATAGATCTTGTAA---TTGGTTATA--------C Piney_Island_A9: TTCCATAATTGTAATGATAGATCTTGTAA---TTGGTTATA--------C Charlotte_Harbor_C2: CTCCATAATTGTAATGATAGATCTTGTAA---TTGGTTATA--------C Charlotte_Harbor_A2: TTCCATAATTGTAATGATAGATCTTGTAA---TTGGTTATA--------C Piney_Island_B4: TTCCATAATTGTAATGATAGATCTTGTAA---TTGGTTATA--------C Mexico_Beach_B3: TTCCATAATTGTAATGATAGATCTTGTAA---TTGGTTATA--------C Appalachicola_C6: TTCCATAATTGTAATGATAGATCTTGTAA---TTGGTTATA--------C

PAGE 109

101 101 Appendix 2 (Continued) Karenia_mikimotoi_1: TTCAATCATTGTGATGATCGATCTTGTAA---TTGGGTATA--------C Karenia_mikimotoi: TTCGGTCATTGTGATGATCGACCTTGTAATTGGGT---ATA--------C Karlodinium: GTCGGTTATTTTAATGATTGATCTTGTTATTGGTT---ATA--------C Amphidinium: TCTTGTGGGTGCTGGTTTGCGCTCACGGAACTCGCGCTTGG--------C ST2SY33_clone: TATGCCAATCATCATGCATGATTATATAACTGGCGGTTTTA--------C Prochlorococcus: TATGCCAATCATCATGCATGATTACATAACTGGTGGTTTTA--------C Thiobacillus: CTTTCATGCGCTGGAGGCAGCGTTTCGACTTCGTCATGG--AGGCCATCC Synechococcus_sp: GAATGCCATCATCATGCACGACTTTCTCACCGCTGGCTTCA--------C ST2SY26_clone: CATGCCGATCATCATGCACGACTTCATCACCGGTGGCTTCA--------C Synechococcus: CCTTCCAGCGTTGGCAGAACCGCTTCGAATTCGTTGCGG--AAGCCATCA Nitrobacter: CCTTCATGCGCTGGCGCGATCGTTTCGATTTCGTGATGG--AGGCTGTTC Synechocystis: CACCCCCATCATCATGCATGACTTCTTCACCGGCGGTTTCA--------C Synecchococcus_PCC7002: CACTCCCATCATCATGCACGACTTCTTAACTGGTGGTTTCA--------C ST8SY15_clone: CACTCCAATCATTATGCACGACTACCTAACTGGTGGTTTTA--------C Trichodesmium: CACTCCAATCATTATGCACGACTATCTCACAGGTGGTTTTA--------C ST5SY7_clone: TGTTCCTATTATTATGCATGACTATTTAGCAGGTGGATTTA--------C ST2SY2_clone: TGCACCCATTATTATGCATGACTACCTAACAGGTGGTTTCA--------C ST6SY8_clone: TATGCCCATTATTATGCACGACTACCTTACTGGTGGTTTTA--------C Volvox_carteri: CGATGAAAACGTTAACTCACAACCATTCATGCGTTGGAGAG--------A Spinacia: CGTTCCTATTGTAATGCATGACTACTTAACAGGGGGATTCA--------C Asparagus: AGTTCCCATCGTAATGCATGACTACTTAACTGGAGGATTTA--------C Thalassia: TGATGAAAACGTAAATTCCCAGCCATTTATGCGTTGGAGAG--------A Prymnesium: TTCTGTTATCGTAATGATTGACTTAGTAATCG---GTTACA--------C Chrysochromulina_sp: TTCGATTATTGTAATGATTGACCTTGTAATTG---GTTATA--------C Imantionia: TTCAATCATTGTAATGATTGACCTTGTAATCG---GTTACA--------C ST1CH3_clone: TTCAATCATTGTAATGATTGACCTTGTAA---TCGGTTATA--------C Helicosphaera: TTCAGTTATTGTAATGATTGACCTTGTAATTG---GTTACA--------C Emiliana_huxleyi: AGCTATCCAATCAATGGGTAAGTGGTCACGTGATAACGATGTGATCCTTC ST8CH26_clone: AGCAATTCAAACAATGGGTAAGTGGTGTCGTAAGAGAGATATGATCCTTC Isochrysis: TGCTATCCAGACAATGGGTCGTTGGGCTCGTAAGTCTGATGTTATCCTTC Calcidiscus: AGCTATTCAATCAATGGCTAAATGGTCACGTAAGTATGATATGATCCTGC Cruciplacolithus: AGCTATCCAATCAATGGCTAATTGGGCACGTAAGTCTGATATGATTCTTC Pleurochrysis: AGCAATCCAATCGATGGCTATCTGGGCACGTAAGACAGATATGATTCTTC Pavlova: TGCTATTCAAACAATGGGTATCTGGGCTCGTAAGAATGATACAATTCTTC Exanthemachrysis: AGCTATTCAAAGTATGGCTAAGTGGGCTCGTAAGTACGATATGATCCTTC Pyrenomonas: AGCTATCCAAAGTATGGGTATCTGGGCTCGTAAGAACAGTATGATCTTAC Chroomonas: AGCTATCCAATCTATGGGTATTTGGGCTCGTAAGAACAGTATGATTCTTC Rhodella: TGCAATTCAAAGTATGGCTATTTGGGCTCGTAAAAACGATATGATCTTAC Dictyocha: AGCAATTCAATCAAATGCGTATTGGGCTCGTAAGAATGATATGATTCTTC ST6CH33_clone: AGCTATCCAATCTATGGCTGTTTGGGCTCGTGAAAACGATATGATTTTAC Heterosigma: TTCTACCGCTACTTGGACTGTAGTATGGACAGATTTATTAACTGCAT--Chattonella: AGCTATCCAAAGTATGGCTATCTGGTCTCGTAAAAACGACATGATTTTAC ST4CH31_clone: AGCAATTCAAAGTATTGCACTTTGGGCTCGTGAGAATGATATGCTTTTAC ST1CH4_clone: TGCTATTCAAACTATGGCATTCTGGGCTCGTAAGAATGATATGATTCTTC ST3CH27_clone: TGCAATTCAATCAATGGCTATTTGGGCTCGTAACAACGATATGATCTTAC Ectocarpus: AAGTATGGCAATCTGGGCACGAAAAGCTGAAGTGATTTTACATTTAC--Xanthonema: AGCGATCCAATCAATGGGTATTTGGGCTCGTAAAAATGACATGATTCTTC Vaucheria: ATCTATGTCAATTTGGGCTAGAAAAGCTGATATGATTTTACATTTAC--Heterococcus: ACGTTTTCTTTACTGTATGGAAGGTGTAAACCGTGCGGCTGCAGCAACTG Aureoumbra: AGCTATTCAAAGTATGGCTATTTGGGCTCGTAATAACGATATGGTTTTAC Aureococcus: AGCTATCCAAACTATGGCTATCTGGTCTCGTGAGAACGATATGCTTTTAC Pelagococcus: TGCTATCCAAACTGCTGCAATCTGGGCTCGTTCAAACGACATGATTTTAC Cylindrotheca: AGCAATTCAAAGTATGGCTTTATGGGCTCGTGAAAATGATATGCTTTTAC Phaeodactylum: TGCAATCCAATCAGCTGCGATTTGGGCGCGTGATAATGATTTAATTTTAC ST4CH14_clone: AGCTATTCAATCAATTGCAATCTGGGCACGTGAAAACGATATGCTTTTAC ST6CH2_clone: TGCGATTCAAAGTATTGCATTATGGTCTCGTGAAAACGATATGGTTTTAC

PAGE 110

102 102 Appendix 2 (Continued) Rhizosolenia: AGCGATTCAAAGTATTGCTCACTGGGCTCGTGACAACGATATGGTATTAC Skeletonema: TGCAATTCAATCAATTGCATACTGGGCTCGTGAAAACGATATGTTATTAC Thalassiosira: ATCAATTGCATACTGGGCTCGTGAAAACGATATGTTATTACATTTAC--Detonula: GTCCTTTACAAACAGCTTTAGATCTATGGAAAGATATTAGTTTCAACTAT Chilomonas: TGCCATTCAGTCTATGGCTATTTGGGCTCGTAAAAATAGTATGATATTAC Mazzaella_membranacea: AGCTATTCAATCAATGGCTGTTTGGGCTCGTAAAAATGATATGATTCTTC Karenia_brevis: AGCGATACAATCAATGGCTTACTGGGCTCGCAATAATGATACTATGCTTC Jaxonville C3a: GGCGATACAATCAATGGCTTATTGGGCTCGCAATAATGATACTATGCTTC Mexico_Beach_C5: AGCGATACAATCAATGGCTTACTGGGCTCGCAATAATGATACTATGCTTC Piney_Island_A9: AGCGATACAATCAATGGCTTACTGGGCTCGCAATAATGATACTATGCTTC Charlotte_Harbor_C2: AGCGATACAATCAATGGCTTACTGGGCTCGCAATAATGATACTATGCTTC Charlotte_Harbor_A2: AGCGATACAATCAATGGCTTACTGGGCTCGCAATAATGATACTATGCTTC Piney_Island_B4: AGCGATACAATCAATGGCTTACTGGGCTCGCAATAATGATACTATGCTTC Mexico_Beach_B3: AGCGATACAATCAATGGCTTACTGGGCTCGCAATAATGATACTATGCTTC Appalachicola_C6: AGCGATACAATCAATGGCTTACTGGGCTCGCAATAATGATACTATGCTTC Karenia_mikimotoi_1: TGCAATTCAATCAATGGCGTACTGGGCGCGACGAAATGACGTTATTCTTC Karenia_mikimotoi: TGCGATTCAATCAATGGCCTACTGGGCGCGTCGAAATGACATTCTTCTAC Karlodinium: TGCAATTCAATCAATTACACAATGGTCGAGAAAACATGATATGCTATTAC Amphidinium: AAAGAAGTCAGGCAAGCGCAGTATTGTTGCACGCAAGGCATTGGACCAGT ST2SY33_clone: TGCAAATACTGGATTAGCAAACTGGTGTCGTAAAAATGGCATGCTTCTAC Prochlorococcus: TGCAAATACTGGATTAGCTAATTGGTGTCGTAAAAATGGCATGCTTCTGC Thiobacillus: AGAAGGCCGAGGCCGAGACCGGAGAGCGTAAGGGGCACTACCTGAACGTT Synechococcus_sp: GGCCAACACCACCCTCTCGAAAGGGTGCCGTGACAACGGCATGTTGCTAC ST2SY26_clone: GGCCAACACCGGTTTGTCGAAGTGGTGCCGCAAGAACGGCATGTTGCTGC Synechococcus: AGCTGTCCGAGCAGGAGACCGGTGAGCGCAAGGGTCACTACCTCAACGTG Nitrobacter: AAAAAGCCGAACACGAGACCGGCGAGCGGAAAGGTCACTATCTCAACGTG Synechocystis: TGCCAACACCACCCTCGCTCGTTGGTGTCGGGACAACGGCATTTTGCTCC Synecchococcus_PCC7002: TGCGAATACTACCCTTGCGAAGTGGTGTCGTGATAACGGCGTTCTGCTCC ST8SY15_clone: AGCTAATACAACTTTAGCGAAATGGTGCCGTCGTAATGGTGTATTATTAC Trichodesmium: AGCTAATACAACTTTAGCGAAATGGTGCCGTCGTAATGGTGTATTATTAC ST5SY7_clone: TGCAAACACTACATTAGCTAAATACTGTAGAGATACTGGATTATTATTAC ST2SY2_clone: TGCTAACACTACGCTAGCAATGTACTCTCGTGATAACGGTCTACTTCTAC ST6SY8_clone: ATCTAACACTACTCTTTCTAACTACTGTCGTGACAACGGTCTTCTCCTCC Volvox_carteri: CCGTTTCCTTTTCGTAGCTGAAGCTATTTACAAAGCACAAGCAGAAACAG Spinacia: TGCAAATACTACCTTGTCTCATTATTGCCGAGATAATGGTCTACTTCTTC Asparagus: TGCAAATACCACTTTGGCTCATTATTGCCGCGACAATGGTCTACTTCTTC Thalassia: CCGTTTCCTATTTTGTGCCGAAGCCATTTTTAAAGCGCAAGACGAAACAG Prymnesium: AGCTATCCAGTCAATGGCTAAATGGTCACGTAAAACTGATATGATCCTTC Chrysochromulina_sp: TGCTATTCAATCAATGGCTAAGTGGTGTCGTAAGACTGATGTAATCCTTC Imantionia: TGCTATTCAGTCAATGTCTCACTGGGCGCGTGATAACGATGTGATCCTTC ST1CH3_clone: TGCTATCCAATCAATGGCTAAGTGGTCTCGTAAGAAAGATATGCTTCTTC Helicosphaera: GGCTATCCAATCAATGGGTAAATGGTCTCGTAAGTACGATGTGCTTCTTC Emiliana_huxleyi: ACCTTCACCGTGCGGGTAACTCAACTTACTCACGTCAGAAGAACCACGGT ST8CH26_clone: ACTTACACCGTGCTGGTAACTCAACTTACTCACGTCAGAAGAACCACGGT Isochrysis: ACCTTCACCGTGCAGGTAACTCAACTTACTCTCGTCAAAAGAGCCACGGT Calcidiscus: ACCTTCACCGTGCTGGTAACTCAACTTATTCTCGTCAGAAGAATCATGGT Cruciplacolithus: ACCTTCACCGTGCAGGTAACTCAACTTACTCGCGTCAAAAGAGTCACGGT Pleurochrysis: ACCTTCACCGTGCGGGTAATTCAACTTACTCACGTCAAAAGACTCATGGT Pavlova: ACCTTCACCGTGCTGGTAACTCTACTTACTCTCGTCAAAAGAACCACGGT Exanthemachrysis: ACCTTCACCGTGCTGGTAACTCAACTTACTCTCGTCAAAAGAACCACGGT Pyrenomonas: ACTTACACCGTGCTGGTAACTCTACTTACTCTCGTCAAAAGACTCACGGT Chroomonas: ACCTACACCGTGCAGGTAACTCTACATATTCCCGTCAAAAGACACATGGT Rhodella: ACTTACACCGTGCAGGAAACTCTACTTATTCTCGTCAAAAGAATCATGGT Dictyocha: ACTTACACCGTGCAGGTAACTCTACATATGCGCGTCAAAAGAACCATGGA ST6CH33_clone: ATTTACACCGTGCTGGTAACTCTACTTATGCTCGTCAAAAGAATCACGGT Heterosigma: ---------GTGATGTTTATCGTGCAAAAGCTTACCGTGTGGACCCTGTA

PAGE 111

103 103 Appendix 2 (Continued) Chattonella: ACTTACACCGTGCAGGTAACTCTACTTACGCTCGTCAAAAGAACCACGGT ST4CH31_clone: ATTTACACCGTGCAGGTAACTCTACATATGCTCGTCAAAAAAATCATGGC ST1CH4_clone: ACTTACACCGTGCTGGTAACTCTACTTACGCTAGACAAAAAGAACATGGT ST3CH27_clone: ACTTACACCGTGCTGGTAACTCTACTTATGCACGTCAAAAAAACCATGGT Ectocarpus: ------ATCGTGCTGGTAACTCTACTTATGCTCGTCAAAAAAACCATGGT Xanthonema: ACTTACACCGTGCCGGTAACTCAACTTACGCACGTCAAAAAAACCACGGT Vaucheria: ------ACCGTGCAGGTAATTCTACATATGCACGTCAAAAAAATCATGGG Heterococcus: GTGAAGTAAAAGGTTCTTACCTAAACGCTACTGCTGGAAACATGGAAGAA Aureoumbra: ACTTACACCGTGCTGGTAACTCAACATATGCACGTCAAAAGACTCATGGT Aureococcus: ATTTACACCGTGCTGGTAACTCAACTTACGCTCGTCAAAAGAGTCACGGT Pelagococcus: ATTTACACCGTGCTGGTAACTCAACTTACGCTCGTCAAAAGAACCACGGT Cylindrotheca: ATTTACACCGTGCAGGTAATTCTACTTATGCTCGTCAAAAAAATCATGGG Phaeodactylum: ATTTACACCGTGCTGGTAACTCAACTTACGCGCGTCAAAAAAATCATGGT ST4CH14_clone: ATTTACACCGTGCAGGTAACTCTACATACGCTCGTCAAAAGAACCACGGT ST6CH2_clone: ATTTACACCGTGCTGGTAACTCTACATATGCACGTCAAAAGAACCACGGT Rhizosolenia: ATTTACACCGTGCTGGTAACTCTACTTATGCTCGTCAAAAGAATCATGGT Skeletonema: ACTTACACCGTGCTGGTAACTCTACATACGCTCGTCAAAAGAATCATGGT Thalassiosira: ------ACCGTGCTGGTAACTCTACTTACGCTCGTCAAAAGAATCATGGT Detonula: ACTTCTACGGATACAGCTGATTTCGCTGAAACAGCTACTGCAAACAGATA Chilomonas: ATTTACACCGTGCTGGTAACTCCACATACTCTAGGCAAAAGATTCATGGA Mazzaella_membranacea: ATTTGCATCGTGCAGGTAACTCTACTTATTCTCGTCAAAAAATTCATGGT Karenia_brevis: ACTTGCATCGTGCCGGTAATTCTACGTATTCTCGACAAAAAAATCATGGT Jaxonville C3a: ACTTGCATCGTGCCGGTAATTCTACGTATTCTCGACAAAAAAATCATGGT Mexico_Beach_C5: ACTTGCATCGTGCCGGTAATTCTACGTATTCTCGACAAAAAAATCATGGT Piney_Island_A9: ACTTGCATCGTGCCGGTAATTCTACGTATTCTCGACAAAAAAATCATGGT Charlotte_Harbor_C2: ACTTGCATCGTGCCGGTAATTCTACGTATTCTCGACAAAAAAATCATGGT Charlotte_Harbor_A2: ACTTGCATCGTGCCGGTAATTCTACGTATTCTCGACAAAAAAATCATGGT Piney_Island_B4: ACTTGCATCGTGCCGGTAATTCTACGTATTCTCGACAAAAAAATCATGGT Mexico_Beach_B3: ACTTGCATCGTGCCAGTAATTCTACGTATTCTCGACAAAAAAATCATGGT Appalachicola_C6: ACTTGCATCGTGCCGGTAATTCTACGTATTCTCGACAAAAAAATCATGGG Karenia_mikimotoi_1: ATTTACACCGTGCAGGAAACTCCACGTACTCTCGTCAGAAAAACCACGGA Karenia_mikimotoi: ATTTACATCGTGCGGGAAACTCCACGTACTCTCGCCAGAAAAATCACGGA Karlodinium: ATTTGCATCGTGCTGGTAATTCGGCGTATGCAAGGCAAAAAGATCATGGT Amphidinium: CCAGCAGATACGCAGACCTGTCCCTCACCGAAGAGCAGCTCATCCAACAG ST2SY33_clone: ATATTCATAGAGCGATGCATGCTGTTATTGATAGACATCCAAAACACGGT Prochlorococcus: ATATTCACAGAGCTATGCATGCTGTTATTGATAGACATCCAAAGCATGGT Thiobacillus: ACCGCCCCGACTCCGGAGGAAATGTACAAGCGTGCGGAGTACGCCAAGGA Synechococcus_sp: ACATTCACCGTGCTATGCACGCCGTGATGGACCGTCAGAAAAACCACGGC ST2SY26_clone: ACATCCACCGCGCCATGCACGCGGTGATCGACCGTCACCCCAAGCACGGC Synechococcus: ACCGCCAACACTCCCGAAGAGATGTATGAGCGCGCTGAGTTCGCCAAGGA Nitrobacter: ACCGCGCCAACGCCTGAGGAAATGTACAAGCGCGCCGAGTATGCCAAGGA Synechocystis: ATATTCACCGGGCAATGCACGCCGTAGTTGACCGTCAGAAAAACCACGGG Synecchococcus_PCC7002: ACATCCACCGGGCAATGCACGCGGTAATCGACCGTCAGAAGAACCACGGT ST8SY15_clone: ACATCCACCGGGCAATGCACGCCGTTATTGACCGTCAGAAAGCCCACGGT Trichodesmium: ACATCCACCGGGCAATGCACGCCGTTATTGACCGTCAGAAAGCCCACGGT ST5SY7_clone: ATATTCATCGTGCGATGCATGCGGTTATTGATAGACAAAAAAATCATGGT ST2SY2_clone: ACATTCACCGTGCAATGCACGCGGTAATTGACCGTCAGCGTAACCACGGT ST6SY8_clone: ACATTCACCGTGCAATGCACGCGGTAATTGACCGTCAGCGTAACCACGGT Volvox_carteri: GTGAAGTAAAAGGTCATTATTTAAACGCTACAGCTGGTACATGCGAAGAA Spinacia: ACATCCACCGTGCAATGCACGCAGTTATTGATAGGCAGAAGAATCATGGT Asparagus: ACATCCACCGCGCAATGCATGCTGTTATTGATAGACAGAAAAATCATGGT Thalassia: GTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACGTGTGAAGAA Prymnesium: ACTTACACCGTGCTGGTAACTCAACTTACTCACGTCAAAAAAACCACGGT Chrysochromulina_sp: ACTTACACCGTGCAGGTAACTCAACTTACTCACGTCAGAAGAACCACGGT Imantionia: ACTTACACCGTGCAGGTAACTCAACTTATTCACGTCAGAAAAACCACGGT ST1CH3_clone: ACTTACACCGTGCAGGTAACTCAACTTACTCACGTCAGAAGAACCACGGT Helicosphaera: ACCTACACCGTGCAGGTAACTCTACTTACTCTCGTCAAAAGTCACATGGT

PAGE 112

104 104 Appendix 2 (Continued) Emiliana_huxleyi: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGTCAGGTTGTGACCA ST8CH26_clone: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGTCAGGTTGTGATCA Isochrysis: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGTCAGGTTGTGACCA Calcidiscus: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGTCAGGTGTTGACCA Cruciplacolithus: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGTCAGGTGTTGATCA Pleurochrysis: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGTCAGGTGTTGACCA Pavlova: ATGAACTTCCGTGTTATCTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Exanthemachrysis: ATGAACTTCCGTGTAATTTGTAAGTGGATGCGTATGTCAGGTGTTGACCA Pyrenomonas: ATGAACTTCCGTGTTATCTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Chroomonas: ATGAACTTCCGTGTAATTTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Rhodella: ATGAACTTCCGCGTAATCTGTAAATGGATGCGTATGGCTGGTGTTGACCA Dictyocha: ATTAACTTCCGTGTAATTTGTAAGTGGATGCGTATGGCTGGTGTTGATCA ST6CH33_clone: ATTAACTTCCGTGTAATTTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Heterosigma: CCAAGTGCAGCTGACCAGTACTTCGCATACATCGCATACGAGTGTGACCT Chattonella: ATTAACTTCCGTGTAATTTGTAAGTGGATGCGTATGGCTGGTGTTGACCA ST4CH31_clone: ATGAATTTCCGTGTAATTTGTAAGTGGATGCGTATGTCAGGAGTTGACCA ST1CH4_clone: ATTAACTTCCGTGTAATTTGTAAATGGATGCGTATGGCTGGTGTTGACCA ST3CH27_clone: ATTAACTTCCGTGTAATTTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Ectocarpus: ATTAATTTCAGAGTTATCTGTAAATGGATGCGTATGTGTGGTGTAGACCA Xanthonema: ATTAACTTCCGTGTAATTTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Vaucheria: ATCAATTTCCGTGTAATTTGTAAATGGATGCGTATGGCAGGTGTAGATCA Heterococcus: ATGTACACACGTGCTGAATACGCAAAAGAAATTGGTTCAATCATTGTGAT Aureoumbra: ATTAATTTCCGTGTAATTTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Aureococcus: ATTAACTTCCGTGTAATCTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Pelagococcus: ATCAACTTCCGTGTAATCTGTAAGTGGATGCGTATGGCTGGTGTTGATCA Cylindrotheca: ATTAACTTCCGTGTAATTTGTAAATGGATGCGTATGTCAGGTGTAGATCA Phaeodactylum: ATCAACTTCCGTGTTATTTGTAAATGGATGCGTATGTGTGGTGTGGATCA ST4CH14_clone: ATCAACTTCCGTGTTATCTGTAAATGGATGCGTATGTCTGGTGTAGATCA ST6CH2_clone: ATTAACTTCCGTGTTATCTGTAAATGGATGCGTATGTCTGGTGTAGATCA Rhizosolenia: ATTAACTTCCGTGTTATCTGTAAATGGATGCGTATGTCTGGTGTAGATCA Skeletonema: ATTAACTTCCGTGTTATCTGTAAATGGATGCGTATGTCTGGTGTAGATCA Thalassiosira: ATTAACTTCCGTGTTTTCTGTAAATGGATGCGTATGTCAGGTGTGGATCA Detonula: ATTAATTACTTTTATATATATTTAAGGAGTATTTGAATAGTGAGACTTAC Chilomonas: ATGAACTTCCGTGTCATTTGTAAGTGGATGCGCATGGCTGGTGTTGATCA Mazzaella_membranacea: ATGAATTTCCGAGTAATATGTAAATGGATGCGTATGGCAGGTGTTGATCA Karenia_brevis: ATGAATTTCCGCGTCATCTGTAAATGGATGCGAATGGCTGGTGTTGATCA Jaxonville C3a: ATGAATTTCCGCGTCATCTGTAGATGGATGCGAATGGCTGGTGTTGATCA Mexico_Beach_C5: ATGAATTTCCGCGTCATCTGTAAATGGATGCGAATGGCTGGTGTTGATCA Piney_Island_A9: ATGAATTTCCGCGTCATCTGTAAATGGATGCGAATGGCTGGTGTTGATCA Charlotte_Harbor_C2: ATGAATTTCCGCGTCATCTGTAAATGGATGCGAATGGCTGGTGTTGATCA Charlotte_Harbor_A2: ATGAATTTCCGCGTCATCTGTAAATGGATGCGAATGGCTGGTGTTGATCA Piney_Island_B4: ATGAATTTCCGCGTCATCTGTAAATGGATGCGAATGGCTGGTGTTGATCA Mexico_Beach_B3: ATGAATTTCCGCGTCATCTGTAAATGGATGCGAATGGCTGGTGTTGATCA Appalachicola_C6: ATGAATTTCCGCGTCATCTGTAAATGGATGCNAATGGCTGGNGTTGATCA Karenia_mikimotoi_1: ATGAATTTCCGTGTAATTTGTAAGTGGATGCGTATGGCAGGTGTTGATCA Karenia_mikimotoi: ATGAATTTTCGTGTAATTTGTAAGTGGATGCGTATGGCAGGCGTTGACCA Karlodinium: ATCAATTTTCGTGTAATATGTAAGTGGATGAGAATGGCGGGCGTAGACCA Amphidinium: GGTCAGCATGTGCTTGTGGCATACATCATGAAGCCAAAGGCTGGCTACGA ST2SY33_clone: ATCCATTTCAGGGTTCTAGCAAAATGTTTGAGACTCTCCGGAGGAGATCA Prochlorococcus: ATTCACTTCAGAGTTCTTGCAAAATGTTTGAGACTATCTGGAGGAGACCA Thiobacillus: AATCGGCGCACCCATCATCATGCACGATTACATCACCGGCGGCTTCTGCG Synechococcus_sp: ATCCACTTCCGTGTCTTGGCCAAATGTTTGCGGATGTCTGGCGGTGACCA ST2SY26_clone: ATTCACTTCCGCGTTCTCGCCAAGTGTCTGCGTCTGTCCGGTGGTGACCA Synechococcus: ACTCGGCATGCCGATCATCATGCACGACTTCATCACCGGTGGCTTCACGG Nitrobacter: AATCCGCGCTCCGATCATCATGCACGATTACCTCGCTGGCGGGCTTTGCG Synechocystis: ATCCACTTCCGGGTTTTGGCCAAGTGTCTGCGTCTGTCCGGCGGTGACCA

PAGE 113

105 105 Appendix 2 (Continued) Synecchococcus_PCC7002: ATTCACTTCCGCGTTCTCGCTAAGTGTCTCCGCCTCTCTGGTGGTGACCA ST8SY15_clone: ATTCACTTCCGGGTTTTAGCTAAGTGCTTGAGAATGTCTGGTGGTGACCA Trichodesmium: ATTCACTTCCGGGTTTTAGCTAAGTGCTTGAGAATGTCTGGTGGTGACCA ST5SY7_clone: ATTCACTTCCGTGTTTTAGCTAAGGCTTTACGTTTATCTGGTGGTGATCA ST2SY2_clone: ATTCACTTCCGTGTACTTGCTAAGGCTCTACGTATGTCAGGTGGTGACCA ST6SY8_clone: ATTCACTTCCGTGTTCTCGCGAAGGCTCTCCGTCTTTCTGGTGGTGACCA Volvox_carteri: ATGTTAAAACGTGCTCAATGTGCTAAAGAACTAGGTGTACCAATTATCAT Spinacia: ATGCACTTCCGTGTACTAGCGAAAGCGTTACGTCTATCTGGTGGAGATCA Asparagus: ATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCA Thalassia: ATGATCAAAAGAGCTGTATGTGCCAGAGAATTGGGAGTTCCTATCGTAAT Prymnesium: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Chrysochromulina_sp: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGGCTGGTGTTGACCA Imantionia: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGGCTGGTTGTGACCA ST1CH3_clone: ATGAACTTCCGTGTAATCTGTAAGTGGATGCGTATGGCTGGTTGTGACCA Helicosphaera: ATGAACTTCCGAGTAATTTGTAAGTGGATGCGTATGGCTGGATGTGACCA Emiliana_huxleyi: CATTCACGCAGGTACTGTAGTAGGTAAGCTAGAAGGTGATCCACTAATGA ST8CH26_clone: CATTCACGCTGGTACAGTAGTTGGTAAGCTAGAAGGTGATCCATTAATGA Isochrysis: CATTCACGCAGGTACAGTAGTTGGTAAGCTAGAAGGTGATCCTTTAATGA Calcidiscus: TATCCACGCTGGTACAGTAGTAGGTAAGCTAGAAGGTGATCCTCTAATGA Cruciplacolithus: CATTCATGCAGGTACGGTAGTAGGTAAGTTAGAAGGTGATCCTTTAATGA Pleurochrysis: CATCCACGCGGGTACAGTAGTAGGTAAGTTAGAAGGTGACCCTCTAATGA Pavlova: CATTCACGCAGGTACCGTAGTAGGTAAGCTTGAAGGGGATCCACTAATGG Exanthemachrysis: CATTCACGCTGGTACTGTTGTAGGTAAGCTTGAAGGTGATCCTCTAATGG Pyrenomonas: TATTCACGCTGGTACAGTTGTAGGTAAATTAGAGGGAGATCCTCTAATGG Chroomonas: TATCCACGCTGGTACAGTAGTTGGTAAGCTTGAAGGAGATCCTTTAATGG Rhodella: TATTCACGCTGGTACAGTAGTAGGAAAATTAGAAGGGGATCCTTTAATGA Dictyocha: TATCCATGCGGGTACAGTTGTTGGTAAATTAGAAGGTGATCCTTTAATGG ST6CH33_clone: TATCCACGCTGGTACTGTAGTAGGTAAATTAGAAGGTGATCCATTAATGG Heterosigma: TTTCGAAGAAGGTTCTTTAGCTAACATGACTGCATCTATCATTGGTAACG Chattonella: CATTCACGCAGGTACTGTTGTAGGTAAATTAGAAGGTGACCCTCTAATGG ST4CH31_clone: TATTCACGCGGGTACTGTAGTAGGTAAGCTTGAGGGTGATCCTCTAATGA ST1CH4_clone: TATCCACGCTGGTACAGTTGTAGGTAAATTAGAAGGAGATCCAAACACAG ST3CH27_clone: TATTCACGCTGGTACTGTTGTAGGTAAATTAGAAGGTGATCCATTAATGG Ectocarpus: TATCCATGCAGGTACTGTAGTTGGTAAACTAGAAGGAGATCCCTTAATGG Xanthonema: CATTCACGCAGGTACTGTTGTTGGTAAATTAGAAGGTGACCCTTTAATGG Vaucheria: CATTCATGCTGGTACTGTTGTAGGTAAATTAGAAGGTGACCCTTTAATGG Heterococcus: GATCGATT---TAGTTATTGGGTACACAGCCATTCAATCCATGGCTATTT Aureoumbra: TATCCACGCAGGTACTGTTGTAGGTAAGTTAGAAGGTGACCCATTAATGG Aureococcus: CATTCACGCTGGTACTGTTGTAGGTAAGTTAGAAGGTGATCCATTAATGG Pelagococcus: CATTCACGCTGGTACAGTTGTAGGTAAGTTAGAAGGTGATCCATTAATGA Cylindrotheca: TATTCACGCTGGTACAGTTGTAGGTAAATTAGAAGGGGATCCTTTAATGA Phaeodactylum: TATCCATGCTGGTACAGTTGTAGGTAAATTAGAAGGCGATCCTTTAATGA ST4CH14_clone: TATTCACGCTGGTACAGTTGTTGGTAAATTAGAAGGTGATCCTTTAATGA ST6CH2_clone: CATCCACGCTGGTACAGTAGTAGGTAAATTAGAAGGTGATCCTTTAATGA Rhizosolenia: TATCCACGCAGGTACAGTTGTTGGTAAATTAGAAGGTGATCCTTTAATGA Skeletonema: CATCCACGCTGGTACAGTTGTTGGTAAGTTAGAAGGTGATCCTTTAATGA Thalassiosira: TATCCATGCTGGTACAGTTGTTGGTAAATTAGAAGGTGATCCTTTAATGA Detonula: ACAAGGTTGCTTCTCTTTCTTACCTGATTTAACTGACGAACAAATTGAAA Chilomonas: CATTCATGCTGGTACTGTTGTGGGTAAATTAGAAGGCGATCCTTTGATGG Mazzaella_membranacea: TATTCATGCAGGTACTGTTGTTGGTAAACTAGAAGGCGATCCTCTAATGA Karenia_brevis: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA Jaxonville C3a: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA Mexico_Beach_C5: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA Piney_Island_A9: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA Charlotte_Harbor_C2: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA Charlotte_Harbor_A2: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA

PAGE 114

106 106 Appendix 2 (Continued) Piney_Island_B4: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA Mexico_Beach_B3: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA Appalachicola_C6: TATTCATGCCGGAACCGTTGTGGGTAAACTAGAAGGAGATCCAAAAATGA Karenia_mikimotoi_1: TATCCATGCGGGAACCGTTGTTGGTAAATTAGAAGGAGAACCTAAAATGA Karenia_mikimotoi: TATCCATGCTGGAACCGTTGTTGGTAAATTAGAAGGAGAGCCGAAAATGA Karlodinium: TTTACATGCTGGAACGGTAGTTGGAAAACTTGAGGGCGATCCTTACATGG Amphidinium: CTACCTCGCAACGGCTGCGCACTTTGCAGCTGAATCATCCACTGGTACCA ST2SY33_clone: ACTACATACTGTAACTGTTGTTGGAAAACTAGAAGGTGATCGTCAAACAA Prochlorococcus: ATTACATACTGGAACCGTGGTTGGAAAACTAGAAGGTGATCGTCAAACAA Thiobacillus: CCAACACGGGTCTGGCCAACTGGTGCCGCGACAACGGCATGCTCCTGCAC Synechococcus_sp: CATCCACACCGGTACCGTTGTTGGTAAGCTCGAAGGGGATAAAGCCGTTA ST2SY26_clone: GCTCCACACCGGCACCGTGGTCGGAAAGCTGGAAGGTGATCGTCAGACCA Synechococcus: CCAACACCGGTCTGTCGAAGTGGTGCCGCAAGAACGGCATGTTGCTGCAC Nitrobacter: CCAACGCGGGTCTGGCGAACTGGTGCCGCAACAACGGAATGCTGCTGCAC Synechocystis: CCTCCACTCCGGTACCGTGGTTGGTAAATTGGAAGGGGAACGGGGTATCA Synecchococcus_PCC7002: CCTCCACTCCGGTACGGTTGTTGGTAAGCTCGAAGGCGATCGCGCCGCCA ST8SY15_clone: CCTCCACTCTGGTACTGTGGTAGGAAAGCTCGAAGGTGAAAAAGGCATCA Trichodesmium: CCTCCACTCTGGTACTGTCGTGGGCAAGCTCGAAGGA------------ST5SY7_clone: CTTACATAGTGGTACTGTTGTAGGAAAACTAGAAGGTGATAAAGATATCA ST2SY2_clone: CCTTCACTCAGGTACTGTAGTAGGTAAGCTTGAGGGTGAGCGTGAAGTAA ST6SY8_clone: CCTTCACTCTGGTACTGTAGTAGGTAAGCTTGAGGGTGAGCGTGAAGTAA Volvox_carteri: GCACGACTACTTAACTGGTGGTTTTACAGCTAACACATCATTAGCTTCTT Spinacia: TATTCACTCTGGTACCGTAGTAGGTAAGCTTGAAGGAGAAAGAGATATTA Asparagus: TATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGA Thalassia: GCATGACTACTTAACGGGGGGATTCACTGCAAATACTAGCTTGGCTCGTT Prymnesium: TATCCACGCAGGTACTGTAGTTGGTAAGCTAGAAGGTGATCCTCTAATGA Chrysochromulina_sp: CATTCACGCTGGTACTGTAGTAGGTAAGCTAGAAGGTGATCCTCTAATGA Imantionia: CATCCACGCCGGTACTGTAGTAGGTAAGTTAGAAGGTGATCCTCTAATGA ST1CH3_clone: CATTCACGCCGGTACAGTAGTAGGTAAGCTTGAAGGTGATCCACTAATGA Helicosphaera: CATTCACGCAGGTACAGTAGTAGGAAAGTTAGAAGGTGATCCTCTAATGA Emiliana_huxleyi: TTAAAGGTTTCTACAACACTCTACTTGATACTAAGACTGAAGTTAACCTT ST8CH26_clone: TTAAAGGTTTCTACAACACTTTATTAGATACTAAGACTGATATTAACCTA Isochrysis: TCAAAGGTTTCTACAACACTCTACTAGATACTAAGACTGATATTAACCTT Calcidiscus: TTAAAGGTTTCTACAACACTCTACTAGATTTCAAGACTGATGTTAACTTA Cruciplacolithus: TTAAAGGTTTCTACAACACTCTATTAGATTTCAAGACTGATATCAATCTG Pleurochrysis: TTAAAGGTTTCTACAACACTCTACTTGACTTCAAGACTGATATTAACCTA Pavlova: TTAAAGGTTTCTATAACACTCTTCTAGAAAACAAAACTGATATCAACTTA Exanthemachrysis: TTAAAGGATTCTACAACACTCTACTTGAGAACAAGACTGACATTAACCTA Pyrenomonas: TTAAAGGTTTCTACGATACATTATTAGAAGTTAAAACAGAAGTTAACTTA Chroomonas: TTAAAGGTTTCTACAATACATTACTAGAAGCTAAGACTGATGTAAACCTT Rhodella: TTAAAGGTTTCTACAACGTTCTATTAGAAACTAGTCTTGACATCAACTTA Dictyocha: TTAAAGGTTTCTATCATACATTACTTGATGTTAAGACTGATGTTAACCTT ST6CH33_clone: TTAAAGGTTTCTACAACACATTATTAGACACTGAAAATAAGATCAACTTA Heterosigma: TATTCGGTTTCAAAGCTGTAGCTGCATTACGTTTAGAAGATATGCGTATT Chattonella: TTAAAGGTTTCTACGACACTTTACGTGAATGTGAGTTAAGTATCAACTTA ST4CH31_clone: TTAAAGGTTTCTACAATACACTTTTAGCCACAAAATCAGAGACTTCTCTG ST1CH4_clone: TTAAAGGATTCTACGATACACTATTATTACCTGCATTAAAAGAAGATCGT ST3CH27_clone: TTCGTGGTTTCTATAGAACATTATTAGATAACAGTTTATCTGTTAACTTA Ectocarpus: TTAAAGGATTCTACAACAGTTTATTATTAACTCATTTAAAAATTAATTTA Xanthonema: TTAAAGGTTTCTACAACACTTTATTACAAAGTGAATCTGAAATCAACCTT Vaucheria: TTAAAGGCTTTTATAATACATTATTATTAACGAAATTAGAAATTAATCTT Heterococcus: GGGCTCGCCAAGCAGACATGATCTTACATTTACACCGTGCAGGTAACTCT Aureoumbra: TTCAAGGTTTCTACGATACTTTATTATTAACTCACTTAAAGATTGATTTA Aureococcus: TTCAAGGTTTCTACGATACTTTATTAAAAACTAAGTTAGCAATCGATTTA Pelagococcus: TCCAAGGTTTCTACGACACATTATTAAAGACTAAGTTAGCTATCGATTTA Cylindrotheca: TTAAAGGTTTTTATCATACTTTACGGTTAACAACATTAGATGTTAACTTA

PAGE 115

107 107 Appendix 2 (Continued) Phaeodactylum: TTAAAGGTTTCTACGATACTTTATTACTAACTCATTTAAATGTTAATTTA ST4CH14_clone: TTAAAGGTTTCTACGATACTTTACGTTTAACAAACTTAGATGTTAACTTA ST6CH2_clone: TTAAAGGTTTCTACGATATTTTACGTTTAACAACATTAGATGTAAACTTA Rhizosolenia: TTAAAGGTTTCTACGATGTATTACGTTTACCAGTTTTAGACGTTAACTTA Skeletonema: TTAAAGGTTTCTACGATATCTTACGTTTAACTGAATTAGAAGTAAACTTA Thalassiosira: TTAAAGGTTTCTACGACATCTTACGTCTAACTGAATTAGAAGTTAACTTA Detonula: AACAAGTAGCTTGCGCTATGTCTAGAGGTTTAGCGATGAACGTAGAGTGG Chilomonas: TTAAAGGGTTTTATAATGTTTTACTACGAACTAAGCTTGATGTAAACCTA Mazzaella_membranacea: TCCGAGGTTTCTATAACACACTACTACTACCATATTTAGAAGTGAATTTA Karenia_brevis: TTAAAGGGTTCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Jaxonville C3a: TTAAAGGGTTCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Mexico_Beach_C5: TTAAAGGGTTCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Piney_Island_A9: TTAAAGGGTTCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Charlotte_Harbor_C2: TTAAAGGGTTCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Charlotte_Harbor_A2: TTAAAGGGTTCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Piney_Island_B4: TTAAAGGGTTCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Mexico_Beach_B3: TTAAAGGGTCCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Appalachicola_C6: TTAAAGGGTTCTATGAAACGTTATTGGGTCTGTGTACACGAATTAACCTT Karenia_mikimotoi_1: TTAAAGGGTTTTATAAGACATTACTCGATCTAACAACTAGACATGATTTT Karenia_mikimotoi: TTAAAGGATTCTATAAGACACTCCTGGATTTAACGACCGAACATGATTTC Karlodinium: TCAAAGGGTTTTATGCTACTCTTCTTACAACAAAGGCAGCAGCAAACATA Amphidinium: ACGTGAACGTGTGCACCACCGACGACTTCACCAAGTCAGTCGATGCACTG ST2SY33_clone: CTCTTGGTTACATTGACAACTTAAGAGAGTCATTTGTTCCCGAAGATAGA Prochlorococcus: CTCTTGGTTACATTGACAACTTAAGAGAGTCATTTGTTCCTGAAGATAGA Thiobacillus: ATTCACCGCGCCATGCATCGGGTGCTGGACCGCAACCCTCACCACGGCAT Synechococcus_sp: CCCTCGGCTTTGTCGATCTGCTGCGGGAAAACTACATTGAGCAGGATCGC ST2SY26_clone: CCCTCGGCTACATCGACCAGCTGCGCGAATCCTTCGTGCCCGAAGACCGC Synechococcus: ATCCACCGCGCCATGCACGCGGTGATCGACCGTCACCCCAAGCACGGCAT Nitrobacter: ATCCACCGCGCTATGCATGCGGTGATCGATCGCAACCCGCATCACGGTAT Synechocystis: CCATGGGCTTCGTTGACCTCATGCGCGAAGATTACGTTGAGGAAGATCGC Synecchococcus_PCC7002: CCCTCGGTTTCGTAGACCTGATGCGTGAAGACTACGTTGAAGAAGATCGT ST8SY15_clone: CAATGGGCTTTGTAGACTTAATGCGGGAAGACCATGTTGAGCAAGATCGC Trichodesmium: -------------------------------------------------ST5SY7_clone: CTTTAGGTTTTGTAGACTTAATGAGAGATGATTATGTCAAATTAGACCGT ST2SY2_clone: CTCTAGGTTTCGTAGATCTAATGCGTGATAACTTCATTGAGAAGGATCGT ST6SY8_clone: CTCTTGGTTTCGTAGACCTTATGCGTGACGACTTTGTTGAGAAGGATCGT Volvox_carteri: ACTGTCGTGATAATGGTCTTTTATTACACATTCACCGTGCTATGCACGCA Spinacia: CTTTAGGCTTTGTTGATTTACTACGTGATGATTATACTGAAAAAGACCGA Asparagus: CTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGA Thalassia: ATTGCCGAGACAACGGATTACTTCTTCACATTCACCGCGCAATGCATGCT Prymnesium: TTAAAGGTTTCTACAACACACTTCTAGACTTTAAATCTGAGATGTGCCTA Chrysochromulina_sp: TTAAAGGTTTCTACAACACTCTTCTTGACTTCAAGTCAGATGTTAGTCTA Imantionia: TTAAAGGTTTCTACAACACTCTTCTAAACTGTAAGACTGATGTAAACCTA ST1CH3_clone: TCAAGGGCTTCTACAACACTCTACTTGACTTCAAGACCGACGTAAACCTA Helicosphaera: TTAAAGGTTTCTACAACACGCTTCTAGACTTCAAGACAGATGTAAACTTA Emiliana_huxleyi: CCTCAAGGTTTATTCTTCGCTCAAGATTGGGCTTCACTTCGTAAGTGTGT ST8CH26_clone: CCTCAAGGTTTATTCTTCGCTCAGGATTGGGCTTCATTACGTAAGTGTAT Isochrysis: CCTCAAGGTTTATTCTTCGCTCAAGATTGGGCTTCTCTTCGTAAGTGTGT Calcidiscus: CCTCAAGGTCTATTCTTTGCACAAGATTGGGCTTCTTTACGTAAGTGTGT Cruciplacolithus: CCTCAAGGTCTATTCTTCGCGCAAGATTGGGCTTCTTTACGTAAGTGTGT Pleurochrysis: CCTCAAGGTTTATTCTTCGCACAGGATTGGGCTTCTCTACGTAAGTGTGT Pavlova: CCGGAAGGTCTATTCTTTGAGCAAGATTGGGCTTCTTTACGTAAGTGTAT Exanthemachrysis: CCAGAAGGTCTATTCTTCGAGCAAGATTGGGCTTCTCTACGTAAGTGTAT Pyrenomonas: GTTGAAGGTTTATTCTTCGCTCAAGACTGGGCTTCTTTAGCTAAGTGTAT Chroomonas: GTTCAAGGTTTATTCTTCGCTCAAGATTGGGCTTCTTTAGCTAAGTGTCT Rhodella: CCTCAAGGTATATTCTTTGCACAAGATTGGGCTTCTTTACGTAAGTGTAT

PAGE 116

108 108 Appendix 2 (Continued) Dictyocha: CCACAAGGTTTATTCTTCGCCCAAGATTGGGCTTCTCTACGTAAATGTCT ST6CH33_clone: CCTCAAGGTATCTTCTTCGATATGGACTGGGCTTCTTTACGTCGTTGTGT Heterosigma: CCTTACGCTTACTTAAAAACATTCCAAGGTCCAGC--------------Chattonella: CCACAAGGTATCTTCTTTGAAATGGATTGGGCTTCTTTACGTAAATGTTG ST4CH31_clone: CCCGAAGGCTTATTCTTCGTGCAAGACTGGGCTTCTTTACGTAAATGCGT ST1CH4_clone: ACTTTAGGATTATTCTTCGATATGGATTGGGCTTCATTACGTAAATGTAT ST3CH27_clone: CCAGAAGGTATTTTCTTCGAAATGGACTGGGCTTCTTTACGTAAAACATT Ectocarpus: GCTGAAGGCTTATTCTTTGATATGGATTGGGCATCTCTTAGAAAATGTGT Xanthonema: CCTCAAGGTATCTTCTTCGCAATGGATTGGGCTTGTTTACGTAAAACTGT Vaucheria: TCTCAAGGTGTATTTTTTGAAATGGATTGGGCAGCATTACGTAAAACTGT Heterococcus: ACATATGCGCGTCAAAAAAATCATGGTATTAACTTCCGTGTAATTTGTAA Aureoumbra: CCTAAGGGTATTTTCTTCGATATGGATTGGGCATCTTTACGTAAGTGTAT Aureococcus: CCTAAGGGTATCTTCTTCGACATGGACTGGGCTGCTTTACGTAAGTGTAT Pelagococcus: CCTAAGGGTATCTTCTTCGATATGGACTGGGCTTCTTTACGTAAGTGTTT Cylindrotheca: CCTTATGGTTTGTTCTTCGAAATGTCATGGGCTAGTTTACGTCGTTGTAT Phaeodactylum: CCATACGGTATTTTCTTCGAAATGACTTGGGCAAGTTTACGTAAATGTAT ST4CH14_clone: CCTTACGGTTTATTCTTCGAAATGGACTGGGCTAGTTTACGTAAGTGTAT ST6CH2_clone: CCATTCGGTATTTTCTTCGAAATGGATTGGGCTAGTTTACGTAAGTGTAT Rhizosolenia: CCATTCGGTATTTTCTTCGAAATGGATTGGGCTAGTTTACGTAAATGTAT Skeletonema: CCTTTCGGTATCTTCTTCGAAATGGATTGGGCTAGTTTACGTCGTTGTAT Thalassiosira: CCTTTTGGTGTGTTCTTCGAAATGGATTGGGCTAGTTTACGTCGTTGTAT Detonula: ACAGATGATCCACATCCTCGTAATAACTACTGGGAATTATGGGGTTTACC Chilomonas: CCACAAGGGTTGTTCTTTTCGCAAGATTGGGCTTCGCTTGCTAAATGTAT Mazzaella_membranacea: CCACAAGGTATATTCTTTGAACAAGATTGGGCATCTCTTAGAAAAGTTAC Karenia_brevis: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Jaxonville C3a: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Mexico_Beach_C5: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Piney_Island_A9: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Charlotte_Harbor_C2: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Charlotte_Harbor_A2: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Piney_Island_B4: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Mexico_Beach_B3: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Appalachicola_C6: AGTCTCGGGTTATTTTTTGGACAAGAATGGGCTAGTTTACGAAAGTGTGT Karenia_mikimotoi_1: GCTTTCGGTCTTTATTTTTCGCAAGAATGGGCTTCTCTCCGTAAATGCAT Karenia_mikimotoi: GCTTACGGTCTTTACTTTTCGCAAGACTGGGCTTCTCTTCGTAAATGCGT Karlodinium: AAAAATGGTTTATTTTTTCCGCAAGATTGGGCATCGTTGCGCCGATGTGT Amphidinium: GTGTACTACATCGACCCAGAGAATGAGGAGTGCAAGATCGCCTACCCAAA ST2SY33_clone: TCAAGAGGTAACTTCTTTGATCAAGATTGGGGTTCAATGCCAGGAGTATT Prochlorococcus: TCAAGAGGTAACTTCTTTGATCAAGATTGGGGTTCAATGCCCGGAGTATT Thiobacillus: CCACTTCCGTGTGCTGACCAAGATTCTCCGTCTGTCCGGCGGCGATCACC Synechococcus_sp: TCCCGTGGTATTTACTTCACCCAAGACTGGGCCTCGATGCCCGGAGTGAT ST2SY26_clone: AGCCGCGGCAACTTCTTCGATCAGGACTGGGGCTCCATGCCCGGCGTGTT Synechococcus: CCACTTCCGCGTTCTCGCGAAGTGTCTGCGTCTGTCCGGTGGTGACCAGC Nitrobacter: CCACTTCCGCGTATTGACCAAGATCTTGCGTCTGTCGGGCGGCGACCATC Synechocystis: TCCCGGGGTATTTTCTTCACCCAAGACTATGCCTCCATGCCTGGCACCAT Synecchococcus_PCC7002: TCTCGCGGTGTATTCTTCACCCAAGACTACGCTTCTCTCCCCGGCACCAT ST8SY15_clone: GAACGTGGTATTTACTTTACTCAAGATTGGGCTTCTATGCCTGGTGTAAT Trichodesmium: -------------------------------------------------ST5SY7_clone: TCAAGAGGTATCTATTTTACTCAAGACTGGGCATCAATGGGTGGTGTAAT ST2SY2_clone: TCTCGTGGTATTTACTTTACTCAGGATTGGGTATCAATGGGTGGTACAAT ST6SY8_clone: AACCGTGGTATCTACTTTACTCAGGAATGGTGTTCTATGGGTGGTACAAT Volvox_carteri: GTAATTGACCGTCAACGTAACCATGGTATTCACTTCCGTGTTCTAGCAAA Spinacia: AGTCGCGGTATTTATTTCACTCAATCTTGGGTTTCCACACCAGGTGTTCT Asparagus: AGTCGCGGTATTTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTAT Thalassia: GTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAA Prymnesium: GCAGAAGGTCTATTCTTTGCACAAGATTGGGCTTCGCTACGTAAGTGTGT Chrysochromulina_sp: CCTGAAGGTATGTTCTTCGCACAAGATTGGGCTTCTCTACGTAAGTGTGT

PAGE 117

109 109 Appendix 2 (Continued) Imantionia: CCTGAAGGTCTATTCTTTGCACAAGATTGGGCTTCTCTACGTAAGTGTGT ST1CH3_clone: CCTCAAGGTTTATTCTTTGCTCAAGATTGGGCTTCACTACGTAAGTGTGT Helicosphaera: CCTCAAGGTTTATTCTTCGCACAGGATTGGGCTTCACTACGTAAGTGTGT Emiliana_huxleyi: ACCAGTTGCTTCAGGTGGT-------ATCCACTGTGGTCAAATGCACCAG ST8CH26_clone: TCCAGTAGCTTCTGG----------------------------------Isochrysis: ACCAGTAGCTTCTGGTGGT-------ATCCACTGTGGTCAAATGCACCAA Calcidiscus: ACCAGTAGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Cruciplacolithus: ACCAGTAGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Pleurochrysis: ACCGGTAGCATCTGGCGGT-------ATCCACTGTGGTCAAATGCACCAA Pavlova: GCCAGTAGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Exanthemachrysis: GCCAGTAGCTTCTGGTGGT-------ATCCACTGTGGTCAAATGCACCAA Pyrenomonas: GCCAGTTGCTTCAGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Chroomonas: ACCAGTTGCTTCTGGTGGT-------ATCCACTGTGGTCAAATGCACCAA Rhodella: GCCTGTTGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Dictyocha: GCCAGTAGCCTCTGGTGGT-------ATTCATTGTGGTCAAATGCACCAA ST6CH33_clone: ACCTGTAGCTTCTGG----------------------------------Heterosigma: ------AACTGGTATTATT-------GTAGAACGTGAGCGTCTTGATACA Chattonella: TCCAGTTGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA ST4CH31_clone: ACCGGTAGCCTCCGG----------------------------------ST1CH4_clone: GCCAGTAG-----------------------------------------ST3CH27_clone: ACCAGTAGC----------------------------------------Ectocarpus: TCCGGTAGCTTCTGGGGGA-------ATCCATTGTGGTCAAATGCACCAA Xanthonema: ACCAGTAGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Vaucheria: ACCTGTAGCATCTGGTGGT-------ATTCACTGTGGACAATTACATCAA Heterococcus: GTGGATGCGTATGGCAGGT-------GTGGATCACATTCACGCAGGTACA Aureoumbra: GCCTGTTGCATCGGGTGGT-------ATCCATTGTGGTCAAATGCATCAA Aureococcus: GCCAGTAGCTTCTGGTGGT-------ATCCACTGTGGTCAAATGCACCAA Pelagococcus: ACCAGTAGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Cylindrotheca: GCCTGTTGCTTCTGGTGGT-------ATCCACTGTGGTCAAATGCACCAA Phaeodactylum: GCCTGTTGCTTCTGGTGGT-------ATCCACTGTGGTCAAATGCACCAA ST4CH14_clone: GCCTGTAGCTTCAGG----------------------------------ST6CH2_clone: GCCAGTAGCTTCTGG----------------------------------Rhizosolenia: GCCTGTAGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Skeletonema: GCCAGTAGCTTCTGGTGGT-------ATCCACTGTGGTCAAATGCACCAA Thalassiosira: GCCAGTAGCTTCTGGTGGT-------ATCCACTGTGGTCAAATGCACCAA Detonula: ATTATTCGACATTAAAGATCCTGCAACAGTAATGTTTGAATTAAATGAAG Chilomonas: GCCAGTTGCTTCTGGTGGT-------ATTCACTGCGGGCAGATGCATCAA Mazzaella_membranacea: GCCTGTTGCTTCTGGTGGT-------ATTCATTGTGGACAAATGCATCAA Karenia_brevis: ACCTGTCGCTAGCGGAGGA-------ATTCATGCAGGACAAATGCACTAC Jaxonville C3a: ACCTGTCGCTAGCGGAGGA-------ATCAATGCGGGACAAAT------Mexico_Beach_C5: ACCTGTCGCTAGCGGAGGA-------ATCAATGCGGGACAAAT------Piney_Island_A9: ACCTGTCGCTAGCGGAGGA-------ATCAATGCGGGACAAAT------Charlotte_Harbor_C2: ACCTGTCGCTAGCGGAGGA-------ATCAATGCGGGACAAAT------Charlotte_Harbor_A2: ACCTGTCGCTAGCGGAGGA-------ATCAATGCGGGACAAAT------Piney_Island_B4: ACCTGTCGCTAGCGGAGGA-------ATCAATGCGGGACAAAT------Mexico_Beach_B3: ACCTGTCGCTAGCGGAGGA-------ATCAATGCGGGACAAAT------Appalachicola_C6: ACCTGTCGCTAGCGGAGGA-------ATCAATGCGGGACAAAT------Karenia_mikimotoi_1: ACCAGTTGCGAGTGGAGGA-------ATCAATGCGGGACAAAT------Karenia_mikimotoi: ACCAGTTGCTAGTGGAGGA-------ATCAATGCGGGACAAATGCATTTT Karlodinium: ACCAGTAGGTTCAGGTGGT-------ATTCATTGTGGTCAAATGCATAAA Amphidinium: CTTGCTCTTTGACCGCAAC-------ATCACCGATGG------------ST2SY33_clone: TGCTGTCGCATCAGGTGGT-------ATCCATGTCTG------------Prochlorococcus: TGCAGTCGCATCGGGTGGT-------ATCCATGTTTGGCATATGCCTGCA Thiobacillus: TGCACTCGGGTACCGTGGTCGGCAAGCTCGAAGGCGACCGTGAGGCGACC Synechococcus_sp: GGCCGTGGCCTCCGGTGGG-------ATTCACGTCTGGCACATGCCTGCC ST2SY26_clone: CGCCGTTGCTTCCGGCGGT-------ATCCACGTCTG------------

PAGE 118

110 110 Appendix 2 (Continued) Synechococcus: TCCACACCGGCACCGTGGTCGGAAAGCTGGAAGGTGATCGTCAGACCACC Nitrobacter: TGCACACCGGCACCGTCGTGGGCAAGCTCGAAGGCGATCGTGCTTCCACC Synechocystis: GCCCGTAGCTTCCGGTGGT-------ATCCACGTATGGCACATGCCCGCG Synecchococcus_PCC7002: GCCTGTGGCTTCCGGTGGT-------ATCCACGTATGGCACATGCCTGCC ST8SY15_clone: GCCAGTAGCTTCTGGTGGT------------------------------Trichodesmium: -------------------------------------------------ST5SY7_clone: GCCAGTTGCTTCAGGTGGT------------------------------ST2SY2_clone: TCCTGTAGCATCAGGTGGT-------ATCCACGTCTG------------ST6SY8_clone: GCCCGTAGCATCTGGTGGT------------------------------Volvox_carteri: AGCTCTTCGTATGTCTGGT-------GGTGACCACCTTCACTCAGGTACT Spinacia: GCCTGTTGCTTCAGGCGGT-------ATTCACGTTTGGCATATGCCTGCT Asparagus: TCCCGTGGCTTCAGGGGGT-------ATTCATGTTTGGCATATGCCTGCC Thalassia: AGCATTACGTATGTCTGGT-------GGGGATCACATTCACGCTGGTACG Prymnesium: ACCAGTTGCTTCGGGTGGT-------ATCCACTGTGGTCAAATGCACCAA Chrysochromulina_sp: ACCAGTAGCATCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA Imantionia: ACCAGTTGCTTCTGGTGGT-------ATTCACTGTGGTCAAATGCACCAA ST1CH3_clone: ACCAGTAGCTTCTGG----------------------------------Helicosphaera: ACCAGTAGCTTCAGGTGGT-------ATCCACTGTGGTCAAATGCACCAA