USF Libraries
USF Digital Collections

UDP-glucuronosyltransferase (UGT) genetic variants and their potential role in carcinogenesis

MISSING IMAGE

Material Information

Title:
UDP-glucuronosyltransferase (UGT) genetic variants and their potential role in carcinogenesis
Physical Description:
Book
Language:
English
Creator:
Bendaly, Jean
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
orolaryngeal cancer
polymorphisms
colon carcinogenesis
benzo[a]pyrene
pharmacogenetics
Dissertations, Academic -- Public Health -- Doctoral -- USF   ( lcsh )
Genre:
government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Exposure to polycyclic aromatic hydrocarbons (PAHs) such as benzo(a)pyrene are important risk factors for cancer. Three UDP-glucuronosyltransferases, UGT1A9, UGT1A10, and UGT2B7, have been shown to play an important role in the phase II metabolism of carcinogenic metabolites of BaP. Because UGT1A9 and UGT2B7 are well-expressed in digestive tract tissues including liver and colon, it is possible that genetic variations in either enzyme may play an important role in colon cancer risk. However, UGT1A10 is extrahepatic and is expressed in the oral cavity and the larynx; therefore, genetic variations in this enzyme may play an important role in risk for orolaryngeal cancer. This study examined UGT1A9-, UGT1A10-, and UGT2B7-specific sequences for polymorphisms that play a role in cancer susceptibility. For the UGT1A9 gene, two missense polymorphisms at codons 167 (Val>Ala) and 183 (Cys>Gly) were identified. A previously-reported missense polymorphism was identified for the UGT2B7 gene. To assess the potential role of UGT1A10 variants as a risk factor for orolaryngeal cancer, PCR-RFLP was used to identify UGT1A10 genotypes in DNA specimens isolated from 115 African American newly-diagnosed orolaryngeal cancer cases and 115 non-cancer controls individually matched by age and race. A significantly decreased risk for orolaryngeal cancer was observed for subjects possessing one or more UGT1A10¹³⁹Lys alleles as determined by crude analysis or after logistic regression analysis adjusting for age, sex, smoking and alcohol consumption. These results strongly suggest that the UGT1A10¹³⁹Lys polymorphism may play an important protective role in risk for orolaryngeal cancer. To determine whether the change in amino acid sequence at codon 183 results in aberrant UGT1A9 enzyme activity, functional characterization of the wild-type- and variant-encoded UGT1A9 isoforms was performed in vitro. Cell homogenates were prepared from UGT1A9-transfected HK293 cells and glucuronidation assays were performed against various carcinogens/carcinogen metabolites. A significant (p<0.001) 3- to 4-fold decrease in enzyme activity, determined by HPLC analysis, was observed for the UGT1A9¹⁸³Gly variant as compared to its wild-type counterpart for all substrates analyzed. These results demonstrate that the UGT1A9 (Cys183Gly) polymorphism significantly alters UGT1A9 function and could potentially play an important role as risk modifier for digestive tract cancers.
Thesis:
Thesis (Ph.D.)--University of South Florida, 2004.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Jean Bendaly.
General Note:
Includes vita.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 109 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
oclc - 56564143
notis - AJS2494
usfldc doi - E14-SFE0000450
usfldc handle - e14.450
System ID:
SFS0025142:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 2200433Ka 4500
controlfield tag 006 m d s
007 cr mn
008 040811s2004 flua sbm s000|0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0000450
035
(OCoLC)56564143
9
AJS2494
b SE
040
FHM
c FHM
090
RA425 (ONLINE)
1 100
Bendaly, Jean.
0 245
UDP-glucuronosyltransferase (UGT) genetic variants and their potential role in carcinogenesis
h [electronic resource] /
by Jean Bendaly.
260
[Tampa, Fla.] :
University of South Florida,
2004.
502
Thesis (Ph.D.)--University of South Florida, 2004.
504
Includes bibliographical references.
500
Includes vita.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
Title from PDF of title page.
Document formatted into pages; contains 109 pages.
520
ABSTRACT: Exposure to polycyclic aromatic hydrocarbons (PAHs) such as benzo(a)pyrene are important risk factors for cancer. Three UDP-glucuronosyltransferases, UGT1A9, UGT1A10, and UGT2B7, have been shown to play an important role in the phase II metabolism of carcinogenic metabolites of BaP. Because UGT1A9 and UGT2B7 are well-expressed in digestive tract tissues including liver and colon, it is possible that genetic variations in either enzyme may play an important role in colon cancer risk. However, UGT1A10 is extrahepatic and is expressed in the oral cavity and the larynx; therefore, genetic variations in this enzyme may play an important role in risk for orolaryngeal cancer. This study examined UGT1A9-, UGT1A10-, and UGT2B7-specific sequences for polymorphisms that play a role in cancer susceptibility. For the UGT1A9 gene, two missense polymorphisms at codons 167 (Val>Ala) and 183 (Cys>Gly) were identified. A previously-reported missense polymorphism was identified for the UGT2B7 gene. To assess the potential role of UGT1A10 variants as a risk factor for orolaryngeal cancer, PCR-RFLP was used to identify UGT1A10 genotypes in DNA specimens isolated from 115 African American newly-diagnosed orolaryngeal cancer cases and 115 non-cancer controls individually matched by age and race. A significantly decreased risk for orolaryngeal cancer was observed for subjects possessing one or more UGT1A10Lys alleles as determined by crude analysis or after logistic regression analysis adjusting for age, sex, smoking and alcohol consumption. These results strongly suggest that the UGT1A10Lys polymorphism may play an important protective role in risk for orolaryngeal cancer. To determine whether the change in amino acid sequence at codon 183 results in aberrant UGT1A9 enzyme activity, functional characterization of the wild-type- and variant-encoded UGT1A9 isoforms was performed in vitro. Cell homogenates were prepared from UGT1A9-transfected HK293 cells and glucuronidation assays were performed against various carcinogens/carcinogen metabolites. A significant (p<0.001) 3- to 4-fold decrease in enzyme activity, determined by HPLC analysis, was observed for the UGT1A9Gly variant as compared to its wild-type counterpart for all substrates analyzed. These results demonstrate that the UGT1A9 (Cys183Gly) polymorphism significantly alters UGT1A9 function and could potentially play an important role as risk modifier for digestive tract cancers.
590
Adviser: Ira Richards.
653
orolaryngeal cancer.
polymorphisms.
colon carcinogenesis.
benzo[a]pyrene.
pharmacogenetics.
690
Dissertations, Academic
z USF
x Public Health
Doctoral.
773
t USF Electronic Theses and Dissertations.
949
FTS
SFERS
ETD
RA425 (ONLINE)
nkt 9/2/04
4 856
u http://digital.lib.usf.edu/?e14.450



PAGE 1

UDP-Glucuronosyltransferase (UGT) Genetic Va riants and their Potential Role in Carcinogenesis by Jean Bendaly A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Environmental and Occupational Health College of Public Health University of South Florida Major Professor: Ira Richards, Ph.D. Raymond D. Harbison, Ph.D. Jong Y. Park, Ph.D. Philip Roets, Sc.D. Date of approval: July 14, 2004 Keywords: Polymorphisms, Benzo[a]pyrene, Colon carcinogenesis, Pharmacogenetics, Orolaryngeal Cancer Copyright 2004, Jean Bendaly

PAGE 2

DEDICATION To my mom and dad who supported me throughout my years of education. I love you both very much.

PAGE 3

ACKNOWLEDGMENTS I wish to thank many people who made this dissertation possible. I would like to express my appreciation to my advisor, Dr Ira Richards for his support throughout the completion of this project. To the othe r members of my committee, Dr. Raymond D. Harbison, Dr. Jong Y. Park, and Dr. Philip Ro ets who have been very supportive and helpful and invested their time for which I am truly grateful. I also want to thank Dr. A nn C. Debaldo for her excellent job in chairing my oral defense. Many thanks to Dr. Elizabeth Gull itz, Dr. Thomas Bernard, Dr. Phil Marty, Dr. Abul Elahi, and Dr. Cherie Onkst for their help and support. Many thanks to Beverly Sanchez and to Jane t Giles for their help in getting all the paper work and format check done. From the bottom of my heart, I th ank my girlfriend “Lucky” for her understanding, help, and constant love throughout this long st ruggle and for always being there for me. I am grateful for my brother Jacques, his girlfriend Vlatka, my cousin Louis, my best friends Sammy, Reza, Gerard, and Ousa ma, and my relatives overseas for their constant support and prayers. I wish to thank my mom, Leila, and my dad, Abdallah, for always being there for me and supporting me throughout this adventure. Finally, I want to thank God for always be ing by my side at my time of need and giving me the strength to finish this work.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES iii LIST OF FIGURES iv LIST OF ABBREVIATIONS AND ACR ONYMS vi ABSTRACT vii LITERATURE REVIEW 1 From Genes to Proteins 1 Xenobiotic Metabolism and UDP-Glucuronosyltransf erases (UGTs) 10 CHAPTER ONE: DETECTION OF UGT1A10 POLYMORPHISMS AND THEIR ASSOCIATION WITH OROLARYNGEAL CA RCINOMA RISK 26 Abstract 26 Materials and Methods 27 Study Population 27 UGT1A10 Polymerase Chain Reaction Amplification Sequencing and Genotyping Analysis 28 Statistical Analyses 31 Results 33 Screening for UGT1A10 Polymorphisms 33 Prevalence of UGT1A10 Missense Polymorphisms 33 Analysis of UGT1A10 Polymorphi sms and Orolaryngeal Carcinoma Risk 37 Discussion 39 CHAPTER TWO: UGT1A9 AND UGT2B7 POLYMORPHISMS: IDENTIFICATION AND PREVALENCE IN DIFFERENT RACIAL GROUPS 43 Abstract 43 Materials and Methods 44 Tissues and Study Population for UGT2B7 and UGT1A9 44 PCR Amplifications, Sequencing and Genotyping Analysis 46 Results 49 Screening for UGT2B7 and UGT1A9 Polymorphisms 49 Prevalence of UGT2B7 and UGT1A9 Misse nse Polymorphisms 52 Discussion 58

PAGE 5

ii CHAPTER THREE: FUNC TIONAL CHARACTERIZATION OF THE UGT1A9183Gly POLYMORPHIC VARIANT 60 Abstract 60 Materials and Methods 61 Chemicals and Materials 61 RT-PCR Analysis 62 TOPO Cloning Reaction, Transformation, and Plasmid DNA Extraction 63 Site-Directed Mutagenesis 65 Transfection Using LipofectamineTM 2000, Cell Lines and Cell Homogenate Preparation 67 Western Blot Analysis 68 Glucuronidating Activity of UGT1A9 (Wild-Type/Polymorphic)Over-Expressing Cell Homogenates against NNAL 70 Glucuronidating Activity of UGT1A9 (Wild-Type/Polymorphic)Over-Expressing Cell Homogenates against BPD and Other Benzo[a]pyrene Metabolites 71 Statistical Analysis 72 Results 75 Cloning and Sequencing 75 Western Blot Analysis 79 NNAL Glucuronidation in UGT 1A9-Over-Expressing Cell Homogenates (Wild-Type vs. Polymorphic Variant) 79 BPD and other Benzo[a]pyrene Metabolites in UGT1A9Over-Expressing Cell Homogenates (Wild-Type vs. Polymorphic Variant) 79 Kinetic Analysis (Km and Vmax Study) 84 Discussion 84 REFERENCES 91 ABOUT THE AUTHOR End Page

PAGE 6

iii LIST OF TABLES Table 1. Family 1 and family 2 UGT proteins 15 Table 2. Expression of UGT1A9, UGT 1A10, and UGT2B7 19 Table 3. Description and pr evalence of UGT1A10 polymorphisms by racial group 34 Table 4. UGT1A10 genotype prevalence and risk for orolaryngeal carcinoma 38 Table 5. UGT1A9 and UGT2B7 polymorphisms 51 Table 6. UGT1A9 and UGT2B7 missense polym orphisms and allelic prevalence 57 Table 7. Rates of UGT1A9183Cys and UGT1A9183Gly variant against all substrates before and after protein normalization 83 Table 8. Affinities and rates for each of the substrates as reflected by the apparent Km and Vmax 88

PAGE 7

iv LIST OF FIGURES Figure 1. Double helix structure of DNA 2 Figure 2. Base pairing in DNA 3 Figure 3. RNA synthesis and processing 6 Figure 4. Mature RNA transcript transported to cytoplasm fo r protein synthesis 7 Figure 5. The genetic code and the cloverleaf-s haped transfer RNA strand 9 Figure 6. Primary polypeptide chain 11 Figure 7. Uridine diphosphate-glucuronic acid used as co-substrate for the formation of glucuronides in reactions utilizing UGTs 13 Figure 8. UGT1A exon 1’s and exons 2-5 16 Figure 9. UGT2B exons 1-6 18 Figure 10. Tobacco-specific nitrosamine metabolism 21 Figure 11. Simplified schematic of NNK metabolism to NNAL-Gluc and structures of NNAL and NNAL-Gluc rotamers and enantiomers 22 Figure 12. Benzo[a]pyrene metabolism 24 Figure 13. Simplified schematic of BaP metabolism to BPD glucuronides and structures of potential BPD gl ucuronide regioisomers and diastereomers 25 Figure 14. Procedural flowchart 32 Figure 15. UGT1A10 polymorphisms identified by sequencing analysis 35 Figure 16. RFLP analysis for codon 139, codon 240, and codon 244 36 Figure 17. Procedural flow chart 50 Figure 18. UGT2B7 polymorphism identified by sequencing analysis 53

PAGE 8

v Figure 19. RFLP analysis for codon 268 54 Figure 20. UGT1A9 polymorphisms identified by sequencing analysis 55 Figure 21. RFLP analysis for codon 167 and for codon 183 56 Figure 22. pcDNA3.1/V5-His-TOPO vector 64 Figure 23. Illustration of the basi c steps in a site-directed muta genesis method 66 Figure 24. Chemical structure of substrates 69 Figure 25. Procedural flowchart 73 Figure 26. RFLP analysis using restric tion enzyme DraI 76 Figure 27. RFLP analysis using restric tion enzyme ApaI 77 Figure 28. Section of the entire UGT1A9 sequence showing both the homozygous wild-type and the hom ozygous polymorphic identified by sequencing analysis 78 Figure 29. Western blot 80 Figure 30. HPLC analysis of NNAL-Gl uc formation in liver and UGT1A9over-expressing HK293 cells 81 Figure 31. HPLC analysis of BPD-Gluc formation in homogenates from UGT1A9-over-expressing HK293 ce lls 82 Figure 32. Linear regression of Li neweaver-Burk plots for both UGT1A9183Cys and UGT1A9183Gly variants using Benzo[a]pyrene-7,8-dihydrodiol as substrate 85 Figure 33. Linear regression of Li neweaver-Burk plots for both UGT1A9183Cys and UGT1A9183Gly variants using 7-OH-Benzo[a]pyrene as substrate 86 Figure 34. Linear regression of Li neweaver-Burk plots for both UGT1A9183Cys and UGT1A9183Gly variants using 1-OH-pyrene as substrate 87

PAGE 9

vi LIST OF ABBREVIATIONS AND ACRONYMS BaP Benzo[a]pyrene BCA Bicinchoninic acid BPD Benzo[a]pyrene-7,8-dihydrodiol CI Confidence interval DNA Deoxyribonucleic acid HPLC High performance liquid chromatography Km Michaelis constant NNAL 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol NNK 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone OR Odds ratio PAH Polycyclic aromatic hydrocarbons PCR Polymerase chain reaction RFLP Restriction fragment length polymorphism RNA Ribonucleic acid RT Reverse transcriptase UDP-GA Uridine diphosphate-glucuronic acid UGT UDP-glucuronosyltransferase

PAGE 10

vii UDP-Glucuronosyltransferase (UGT) Genetic Variants and their Potential Role in Carcinogenesis Jean Bendaly ABSTRACT Exposure to polycyclic aromatic hydrocar bons (PAHs) such as benzo(a)pyrene are important risk factors for cancer. Th ree UDP-glucuronosyltr ansferases, UGT1A9, UGT1A10, and UGT2B7, have been shown to play an important role in the phase II metabolism of carcinogenic metabolites of BaP. Because UGT1A9 and UGT2B7 are well-expressed in digestive tract tissues incl uding liver and colon, it is possible that genetic variations in either enzyme may play an important role in colon cancer risk. However, UGT1A10 is extrahepatic and is expr essed in the oral cav ity and the larynx; therefore, genetic variations in this enzyme may play an important role in risk for orolaryngeal cancer. This study examined UGT1A9 -, UGT1A10 -, and UGT2B7 -specific sequences for polymorphisms that play a role in cancer susceptibility. For the UGT1A9 gene, two missense polymorphisms at codons 167 (Val>Ala) and 183 (Cys>Gly) were identified. A previously-reported missens e polymorphism was identified for the UGT2B7 gene. To assess the potential role of UGT1A10 variants as a risk factor for orolaryngeal cancer, PCR-RFLP was used to identify UGT1A10 genotypes in DNA specimens isolated from 115 African Ameri can newly-diagnosed or olaryngeal cancer cases and 115 non-cancer controls individually matched by age and race. A significantly decreased risk for orolaryngeal cancer was obs erved for subjects possessing one or more UGT1A10139Lys alleles as determined by crude anal ysis or after logi stic regression analysis adjusting for age, sex, smoking and alcohol consumption. These results strongly

PAGE 11

viii suggest that the UGT1A10139Lys polymorphism may play an im portant protective role in risk for orolaryngeal cancer. To determine whether the change in amino acid sequence at codon 183 results in aberrant UGT1A9 enzy me activity, functional characterization of the wild-typeand variant-en coded UGT1A9 isoforms was performed in vitro. Cell homogenates were prepared from UGT1A9-tra nsfected HK293 cells and glucuronidation assays were performed against various carci nogens/carcinogen metabolit es. A significant (p<0.001) 3to 4-fold decrease in enzyme activity, determined by HPLC analysis, was observed for the UGT1A9183Gly variant as compared to its wild-type counterpart for all substrates analyzed. These results demonstrate that the UGT1A9 (Cys183Gly) polymorphism significantly a lters UGT1A9 function and co uld potentially play an important role as risk modifier for digestive tract cancers.

PAGE 12

1 LITERATURE REVIEW From Genes to Proteins Genes, the basic unit of inheritance, are contained in chromosomes and consist of deoxyribonucleic acid (DNA) whic h provides the genetic “blueprint” for all proteins in the body (Lebowitz et al., 1990). Thus, gene s ultimately influence all aspects of body structure and function. The human is es timated to have 50,000 to 100,000 structural genes (genes that code for proteins). An e rror or mutation in one of these genes often leads to a recognizable genetic disease (Jackson et al., 1991). The DNA molecule has three basic component s: the pentose sugar, deoxyribose; a phosphate group; and four types of nitrogenous bases. Two of these bases, cytosine and thymine, are single carbon-nitrogen ri ngs called pyrimidines. The other two bases, adenine and guanine, are double carbonnitrogen rings called purines. The four bases are commonly represented by their first le tters: C, T, A, and G (Adams et al., 1986). DNA has a double helix structur e (Figure 1), in which the sugar and phosphate components are held together by strong phosphodiester bonds, and the nitrogenous bases projecting from each side are bound to each others by relatively weak hydrogen bonds (Dickerson et al., 1983; Tr avers et al., 1989). Each DNA subunit, consisting of one deoxyribose, one phosphate group, and one ba se, is called a nucleotide (Figure 2). When referring to the orienta tion of sequences along a gene, th e 5’ direction is termed “upstream”, while the 3’ direction is termed “downstream” (Rich et al., 1984).

PAGE 13

2 Figure 1. Double helix struct ure of DNA (National Instit utes of Health, DNA, n.d.)

PAGE 14

3 Figure 2. Base pairing in DNA showing Aden ine, Thymine, Guanine, and Cytosine (represented by A, T, G, and C respectiv ely); and DNA subunit, consisting of one deoxyribose, one phosphate group, and one base, called a nucleotide (National Institutes of Health, Base pair, n.d.)

PAGE 15

4 While DNA is formed and replicated in th e cell nucleus, protein synthesis takes place in the cytoplasm. The information cont ained in DNA must then be transported to the cytoplasm and then used to dictate the composition of proteins. This involves two processes, transcripti on and translation. Transcription is the process by which an RNA sequence is formed from a DNA template. The type of RNA produced by the transcription process is termed messenger RNA (mRNA). To initiate mRNA transcri ption, one of the RNA polymerase (RNA polymerase II) binds to a promoter site on the DNA (a promoter is a nucleotide sequence that is located just upstream of a gene). The RNA polymerase then pulls a portion of the DNA strands apart from one another, exposi ng unattached DNA bases (Conaway et al., 1991; Mermelstein et al., 1989). One of the two DNA strands provides the template for the sequence of mRNA nucleotides. Since mRNA can be synthesized only in the 5’ to 3’ direction, the promoter, by specifying dire ctionality, determines which DNA strand serves as the template. RNA polymerase move s in the 3’ to 5’ direction along the DNA template strand, assembling the complementary mRNA strand from 5’ to 3’. Soon after RNA synthesis begins, the 5’ end of the growing RNA molecule is “capped” by the addition of a chemically modi fied guanine nucleotide (Simpson et al., 1990). This 5’ cap appears to help to prev ent the RNA molecule from being degraded during synthesis, and later it helps to indicate the starting position for transl ation of the mRNA molecule into protein. Transcription continues unt il a group of bases called a termination sequence is reached. Near this point, a series of 100 to 200 adenine bases are added to the 3’ end of the RNA molecu le. This structure, known as the poly-A tail, may be involved in stabilizing the mRNA molecule so that it is not degraded

PAGE 16

5 when it reaches the cytoplasm (B ernstein et al., 1989; Manley et al., 1988; Wickens et al., 1990). Finally, the DNA strands and RNA polym erase separate from the RNA strand, leaving a transcribed single mRNA strand. This mRNA molecule is termed the primary transcript (Wahle et al., 1992). The primary mRNA transcript is exactly complementary to the base sequence of the DNA template. In eukaryotes (eukaryotes are organisms that have a defined cell nucleus, as opposed to prokaryotes, which lack a defined nucleus), an important step takes place before this RNA transcript leav es the nucleus; sections of the RNA are removed by nuclear enzymes, and the remaining sections are spliced together to form the functional mRNA that will migrate to the cytoplasm (Agabian et al., 1990; Green et al., 1991; Maniatis et al., 1991). The exci sed sequences are called introns, and the sequences that are left to code for proteins are called exons (Patthy et al., 1991; Shapiro et al., 1987; Figure 3). When ge ne splicing is completed, the mature transcript moves out of the nucleus into the cytoplasm (Figure 4). Some genes contain alte rnative splice sites, which allow the same primary transcript to be spliced in different ways, therefore producing different protein pr oducts from the same gene (Guthrie et al., 1988). Proteins are composed of one or more pol ypeptides, which are in turn composed of sequences of amino acids. The body contai ns 20 different types of amino acids, and the amino acid sequences that make up polypept ides must in some way be designated by the DNA after transcription into mRNA. Individual amino acids, which compose proteins, are encoded units of three mRNA bases, termed “codons” (Fox et al., 1987; Lagerkrist et al., 1987). Of the 64 possible codons, 3 signal the end of a gene and are

PAGE 17

6 Figure 3. RNA synthesis and processing (Natio nal Institutes of He alth, RNA synthesis and processing, n.d.)

PAGE 18

7 Figure 4. Mature RNA transcript transported to cytoplasm fo r protein synthesis (National Institutes of Health, mRNA, n.d.)

PAGE 19

8 known as stop codons. The remaining 61 all spec ify amino acids; this means that most amino acids can be specified by mo re than one codon (Figure 5). Translation is the process in which mRNA provides a template for the synthesis of a polypeptide (Merrick et al., 1992). mRNA can not, however, bind directly to amino acids; instead, it interacts with transfer RNA (tRNA), a cloverleaf-shaped RNA strand of about 80 nucleotides (Burbaum et al., 1991). As Figure 5 illustrates, the tRNA molecule has a site at its 3’ end for the attachment of an amino aci d by a covalent bond. At the opposite end of the cloverleaf is a sequence of three nucleotides called the anticodon. This sequence complementary base pairs with an appropriate codon in the mRNA (Mlot et al., 1989). The cytoplasmic site of protein synthesi s is the ribosome, which consists of almost equal parts of enzymatic proteins a nd ribosomal RNA (rRNA). The function of rRNA is to help to bind mRNA and tRNA to the ribosome. During translation, the ribosome first binds to an initiation site on the mRNA sequence; the site consists of a specific codon, AUG, which specif ies the amino acid methionine (which is removed from the polypeptide before the completion of polype ptide synthesis). The ribosome then binds the tRNA to its surface so that base pairing can occur between tRNA and mRNA. The ribosome moves along the mRNA sequence, codon by codon, in the usual 5’ to 3’ direction; as each codon is processed, an ami no acid is translated by the interaction of mRNA and tRNA (Noller et al., 1991). In this process, the ribosome provides an enzyme that catalyzes the formation of covalent peptide bonds between the adjacent amino acids, resulting in a growing polypeptide. When the ribosome arrives at a stop codon on the mRNA sequence,

PAGE 20

9 Figure 5. The genetic code and the clove rleaf-shaped transfer RNA (tRNA) strand (National Institutes of Hea lth, The genetic code, n.d.)

PAGE 21

10 translation and polypeptide formation cease. The amino (NH2) terminus of the polypeptide corresponds to the 5’ end of th e mRNA strand, and the carboxyl (COOH) terminus corresponds to the 3’ end. With synthesis completed, the mRNA, ribosome, and polypeptide separate from one another; the polypeptide (Figure 6) is then released into the cytoplasm (Dahlberg et al., 1989). Before a newly synthesized polypeptide ca n begin its existen ce as functional protein, it often undergoes further processing, termed post-translational modification (Neurat et al., 1989). These modifications can ta ke a variety of forms, including cleavage into smaller polypeptide units or combination wi th other polypeptides to form proteins. Other possible modifications include the a ddition of carbohydrate side chains to the polypeptide (Yan et al., 1989). These modifica tions are needed, for example, to produce proper folding of the mature protein or to st abilize its structure (B aldwin et al., 1989; Creighton et al., 1992; Gethway et al., 1992). Xenobiotic Metabolism and UDP-Glu curonosyltransferases (UGTs) Biotransformation is important in mainta ining homeostasis during exposure of organisms to foreign substances, such as pharmaceuticals and xenobiotics. It is accomplished by a number of enzymes with broad substrate specificities. The reactions catalyzed by these enzymes are divided into two broad categories, called phase I and phase II (Williams et al., 1971). Phase I react ions include, for example, hydrolysis, reduction, and oxidation, and usually expose or introduce a functional group (e.g., -NH2, -OH, -SH or -COOH) onto the molecule ther eby increasing its hydrophi licity. Phase II reactions include, for example, glucuronida tion, sulfation, acetylation, methylation,

PAGE 22

11 Figure 6. Primary polypeptide chain (Nati onal Institutes of Health, Amino acid, n.d.)

PAGE 23

12 glutathione conjugation, and conjugation with amino acids Most phase II reactions result in a large increase in xenobiotic hydrophi licity, thus promoti ng the excretion of foreign compounds. Glucuronidation, sulfation, acetylation, and methylation involve reactions with high energy cofactors such as “acetyl coenzyme A” and “3’-phosphoadenosine-5’phosphosulfate” ( also known as PAPS), wher eas conjugation with amino acids or glutathione generally do not. Most phase II enzymes are found in the cytosol, except for the UDP-glucuronosyltransferases, which are mi crosomal enzymes. Phase II reactions generally proceed much faster than phase I r eactions (for example, those catalyzed by cytochrome P-450). Most metabolism of ingested xenobiotics occu rs in the liver. Absorbed chemicals must first pass through the liver before ente ring the general circul ation. Catalytic reactions are facilitated by one of several c onjugation reactions leadi ng to the elimination of the resultant metabolites from the cell. Detoxification of lipoph ilic xenobiotics is efficiently performed by the phase II conj ugation reactions, thus making them more water-soluble to facilitate elimin ation, primarily by the kidney. Glucuronide conjugation reactions of bot h xenobiotic and endogenous substrates is an important mechanism of detoxification and elimination (Tukey et al., 2000; Tephly et al., 1990; Gueraud et al., 1998) Glucuronide formation is catalyzed by a family of UDP-glucuronosyltransferases (UGTs) which ar e localized in the endoplasmic reticulum of liver and other tissu es, such as the kidney, intestine, skin, brain, spleen, and nasal mucosa. UGTs utilize uridine diphosphate-glucuronic acid (UDP-GA) as co-substrate for the formation of glucuronides (Figure 7).

PAGE 24

13 Functional Group Catalyzed Product N O O O O P O O P NH O O O O OH OH H OH COOH O R-OH Ar-OH R-NH2Ar-NH2R-COOH Ar-COOH + R-O-Gluc Ar-O-Gluc R-NH-Gluc Ar-NH-Gluc R-COO-Gluc Ar-COO-Gluc + UDP UGTs UDPGA Figure 7. Uridine diphosphate-g lucuronic acid (UDP-GA) used as co-substrate for the formation of glucuronides in reactions utilizing UGTs

PAGE 25

14 The UGT isoenzymes are derived from a multigene family. Based upon differences in sequence homol ogy and substrate specificity, two major families (UGT1A and UGT2B) have been identified in severa l species, each containing several highly homologous UGT genes. The UGT protein sequen ces exhibit greater th an 60% similarity within a single family. The members of the UGT1A gene family, which comprises phenoland bilirubinmetabolizing isoforms, all shar e an identical 246 amino acid carboxy terminus (Owens et al., 1995), whereas the N-terminus of the enzyme can vary. In contrast, members of the UGT2B gene family, the steroid-metabolizing isoforms, show little conservation among the different isoforms of this family (Tukey et al., 2000). The entire UGT1A family is derived from a single locus on chromosome 2 coding for nine functional proteins (Table 1). Each of the UGT1A proteins is encoded by five exons, with exons 2 to 5 conserved in all of the isoforms. The DNA sequence encoding exons 2 to 5 is located at the 3’ portion of the locus. The se quences that encode the exon 1 portions of the UGTs are composed of bloc ks of DNA that exist as cassettes and are aligned in series upstream of exon 2 (Figure 8). Each f unctional exon 1 cassette is composed of a transcriptional start site and a 5’ consensus spliceosome recognition sequence at the 3’ -end of the cassette. The cassettes are separated from each other by 15,000 to 25,000 base pairs. Flanking each casse tte in the 5’ –direc tion are functional promoter elements that are important for transcription (Tukey et al., 2000). In contrast to the UGT1A family, the UGT2B family is composed of several independent genes, coding for seven known f unctional human UGT enzymes clustered on chromosome 4 (Jin et al., 1993; Beaulieu et al ., 1997; Beaulieu et al ., 1998; Belanger et

PAGE 26

15 Isoforms of UGT1A Family Isoforms of UGT2B Family 1A1 2B4 1A3 2B7 1A4 2B10 1A5 2B15 1A6 2B17 1A7 2B28 1A8 1A9 1A10 Table 1. Family 1 and family 2 UGT proteins

PAGE 27

16 Figure 8. UGT1A exon 1’s and e xons 2-5 (Ritte r et al., 1992)

PAGE 28

17 al., 1998; Carrier et al., 2000). The UGT2 gene s are composed of six exonic sequences (Figure 9). In previous studies (Sra ssburg et al., 2000; Zheng et al., 2002), several UGTs including UGT1A9 and UGT2B7 we re shown to be expressed in liver as well as in tissues of the digestive tract including colon and esophagus (T able 2), and to play an important role in the phase II metabolism of procarcinogenic metabolites of benzo[a]pyrene (BaP) and 4-(methylnitrosami no)-1-(3-pyridyl)-1-butanone (NNK). In addition, UGT1A10 has been shown to be expre ssed in many target tissues for tobaccorelated cancers including the upper digestive an d respiratory tracts (Table 2), and to exhibit high activity against several BaP metabolites, including BaP-7,8-dihydrodiol. The nicotine derived nitrosamine, NNK, is one of the most potent and abundant procarcinogens found in tobacco and tobacco smoke (Hecht et al., 1989; Hecht et al., 1998 ) NNK levels in tobacco smoke are 315 tim es higher than that of another major potent carcinogen in tobacco smoke, benzo[a] pyrene (Adams et al., 1987). In one study, NNK induced predominantly lung adenocarci nomas in rodents independent of the route of administration (Hecht et al., 1998). Another study in the Fischer 344 rat, NNK induced pancreatic tumors (Rivenson et al., 1988) and, when applied together with the related tobacco-specific nitrosamine, N’-nitrosono rnicotine, oral cavity tumors (Hecht et al., 1986). The cumulative dose of 1.8 mg NN K/kg body weight required to produce lung tumors in rodents (Belins ky et al., 1990) is similar to th e cumulative lifetime dose of 1.6 mg NNK/kg body weight for the average Amer ican smoking two packs of cigarettes a day for 40 years (Hecht et al., 1989; Hecht et al., 1998). NNK is therefore considered to be a likely causative agent for several toba cco-related cancers in humans including those

PAGE 29

18 Figure 9. UGT2B exons 1-6 Exon I II III IV V VI

PAGE 30

19 UGT Liver Colon Lung Breast Prostate Upper Digestive & Respiratory Tracts 1A9 + + 1A10 + + 2B7 + + + + + Table 2. Expression of UGT1A9, UGT1 A10 and UGT2B7 (Zheng et al., 2002; Strassburg et al., 2000)

PAGE 31

20 of the lung, oral cavity, bl adder, and pancreas (Hecht et al., 1998; Rivenson et al., 1988 ). The major metabolic pathway of NNK in most tissues is carbonyl reduction to NNAL (Figure 10). NNK reduction to NNAL occu rs in rodents, monkeys, and humans (Hecht et al., 1998; Carmella et al., 1993; Hech t et al., 1993). It was estimated that between 39-100% of the NNK dose is converted to NNAL in smokers (Carmella et al., 1993). NNAL is activated via pathways si milar to those observed for NNK and, like NNK, is a potent lung and pancreatic carcinoge n in rodents (Hecht et al., 1998; Rivenson et al., 1988). Previous studies have show n that NNAL is also metabolized to its glucuronide conjugate, NNAL-Gluc (Hecht et al ., 1998; Carmella et al ., 1993; Hecht et al., 1993; Morse et al., 1990; Ren et al., 2000; Hecht et al., 1999). Although the formation of NNAL is not a detoxification pathway for NNK, the glucuronidation of NNAL appears to be an important mechanism for NNK detoxification. NNAL glucuronidation can occur at both the carbinol group (NNAL-O-Gluc; Hecht et al., 1998; Carmella et al., 1993; Hecht et al., 1993; Mors e et al., 1990; Ren et al., 2000; Figure 11) and the nitrogen on NNAL’s py ridine ring (NNAL-N-Glu c; Carmella et al., 2002). NNAL-O-Gluc formation in human ti ssues is well-characterized and was found to be mediated primarily by the hepatic enzymes, UGT2B7 and UGT1A9 (Ren et al., 2000). The identification of NNAL-N-Glu c in human urine has been recently reported (Carmella et al., 2002), and shown that its formation is mediated exclusively by the hepatic enzyme, UGT1A4 (Wiener et al., 2004). Benzo[a]pyrene is a much-studied polycycl ic aromatic hydrocarbon that exhibits high carcinogenicity in animals and is found wi despread in the environment including in emission exhausts, cigarette smoke, and char -broiled foods (Gelboin et al., 1980; IARC,

PAGE 32

21 Figure 10. Tobacco-specific nitrosamine metabolism (Hecht et al., 1998)

PAGE 33

22 Figure 11. Simplified schematic of NNK meta bolism to NNAL-Gluc (A) and structures of NNAL and NNAL-Gluc rotamers and enantiomers (Hecht et al., 1998)

PAGE 34

23 General remarks 1983; Dipple et al., 1990). This carcinogen is metabolized by phase I enzymes to a large number of metabolites (Figure 12) incl uding phenols, arene oxides, quinones, dihydrodiols, and diol epoxides, and is also conjugated by phase II enzymes with glutathione, sulfate, and glucuronic acid to form more water-soluble, detoxified derivatives (Gelboin et al., 1980). Although several of these metabolites contri bute to the high carcinogenicity of BaP, many studies have clearly identified the 7,8-diol-9,10-epoxide as the primary carcinogenic metabolite of Ba P, with the anti-(+)-BaP-7R,8S-dihydrodiol-9S,10Repoxide diastereomer exhibiti ng enhanced mutagenic activity in vitro and in vivo (Gelboin et al., 1980; IARC, Gene ral remarks 1983; Borgen et al., 1973; Huberman et al., 1976; Newbold et al., 1976; Sl aga et al., 1976; Yang et al., 1977). This ultimate carcinogen is formed from BaP by two P450mediated oxidations separated by a hydrolysis reaction involving epoxide hydrolas e-mediated formation of the proximate carcinogen, BPD (Figure 13).

PAGE 35

24 Figure 12. Benzo[a]pyrene meta bolism (Gelboin et al., 1980)

PAGE 36

25 Figure 13. Simplified schematic of BaP metabo lism to BPD glucuronides and structures of potential BPD glucuronide regioisomers and diastereomers (Gelboin et al., 1980)

PAGE 37

26 CHAPTER ONE DETECTION OF UGT1A10 POLYMORPHISMS AND THEIR ASSOCIATION WITH OROLARYNGEAL CARCINOMA RISK Abstract UGT1A10 has been implicated as an impor tant detoxifying enzyme for tobacco carcinogens including benzo[a]pyrene. The UGT1A10 codon 244 (Leu>Ile) and codon 139 (Glu>Lys) missense polymorphisms are presen t at a low prevalence in Caucasians but at a significantly higher prevalence in Af rican Americans. To assess the potential role of UGT1A10 variants as a risk factor for orolaryngeal cancer, PCR-RFLP was used to identify UGT1A10 genotypes in buccal cell DNA specimens isolated from 115 African American newly-diagnosed orolaryngeal can cer cases and 115 non-cancer controls individually matched by age and ra ce. The prevalence of the UGT1A10244Ile and UGT1A10139Lys polymorphisms in African American controls were 0.05 and 0.07, respectively. A significantly decreased ri sk for orolaryngeal can cer was observed for subjects possessing one or more UGT1A10139Lys alleles as determined by crude analysis or after logistic regression analysis adjusting for age, sex, smoking and alcohol consumption. No association with risk fo r orolaryngeal cancer was observed for the UGT1A10244Ile polymorphic variant. These resu lts strongly suggest that the UGT1A10139Lys polymorphism may play an important protective role in risk for orolaryngeal cancer.

PAGE 38

27 Materials and Methods Study Population This protocol was approved by the USF Institutional Review Board and collaborating institutions governing the rules concerning the use of human subjects in research. For the identification of UGT1A10 polymorphisms and the determination of prevalence in different racial groups, our s ubject population included the following: 1) 162 whites and 110 African Americans from New York City and 2) 200 whites, 79 African Americans, and 69 Asians (35 of Indian descent and 34 of East Asian descent) from Tampa, FL. These individuals were par ticipants in previous studies of genetic polymorphisms and other risk factors for aerodi gestive tract carcinoma (Richie et al., 1997; Park et al., 2000; Elahi et al., 2002), and tissues were av ailable for this study. For this study, the importance of UGT1A10 polymorphisms in the risk for orolaryngeal carcinoma was determined for 115 Af rican American cases. All cases were newly diagnosed patients (i.e., they were diagnosed within 1 year before study entry) who had histologically confirmed cancer of th e tongue (n=21), tonsil (n=11), pharynx or hypopharynx (n=9), oral cavity (n=19), mixed site s (n=3), or laryngeal (n=52) squamous cell carcinoma. Controls were recruited be tween 1996 and 2000 from Temple University Hospital (Philadelphia, PA), the New York Eye and Ear Infirmary (New York, NY), and the State University of New York at Br ooklyn (New York, NY). Controls were outpatients without cancer treate d at the ear, nose, and throat or dental clinics of participating institutions. Controls were individually matched to cases based on age (within 5 years) and conditi ons described below. To control for biases in demographics or other factors inherent in the recruitment

PAGE 39

28 of participants from institutions in different locations, controls also were matched to case patients based on the institution of case patient. Depending on the institute, eligible cases were identified either from admission rosters, surgical operating schedules, or cancer care listings. 95% of controls and 98% of cas e patients consente d to participation. A structured questionnaire that contai ned items on demographics, life-long smoking habits, and other habits was administer ed by trained interviewers as previously described (Park et al., 2000). Tobacco use was categorized into pack-years. A pack-year is defined as 1 pack of cigarettes per day for 1 year, or 4 cigars per day for 1 year, or 5 pipes per day for 1 year (Benhamou et al., 1986 ). Alcohol consumption was calculated as drinks per day. One drink was defined as 12.9 g of 43% alcohol, which is roughly equivalent to 1 oz of 86-proof liquor, or a 3.6 oz glass of wine, or a 12 oz can of beer. Study participants were define d as drinkers of alcohol if they reported drinking a minimum of 1 drink per week for a minimum of 10 years. Participants were classified as never-drinkers if they consumed 1 or fewer drin ks per week, light drinkers from 1 to less than 7 drinks per week, moderate drinkers fr om 7 to less than 28 drinks per week, and heavy drinkers 28 or more drinks per week. Buccal cell samples were collected from all pa rticipants and used for the analysis of polymorphic UGT1A10 genotypes. The same cell t ype was obtained for genotype analysis for all groups. The cells were then frozen and stored until use in liquid nitrogen. UGT1A10 Polymerase Chain Reaction Amplific ation Sequencing and Genotyping Analysis Cells were thawed and centrifuged in or der to obtain a cell pellet. DNA was

PAGE 40

29 isolated from cells by incuba ting cell pellets with proteina se K (0.1 mg/mL) in 1% sodium dodecyl sulfate overnig ht at 50 C, extracting with phenol:chloroform, and precipitating with ethanol as previously described (Park et al., 2000). Care was taken during DNA purification and isolation to preven t contamination and cross-contamination between samples during polymerase chain r eaction (PCR). The purification of DNA samples was performed in a location dist ant from the workstation where PCR amplifications were performed. All e quipment used for tissue blending and homogenization was washed in a bath of concen trated chromic acid/sulfuric acid, rinsed 3 times in autoclaved double-distilled wate r and once in 70% ethanol, air-dried, and autoclaved after each sample was processed. The family 1A locus comprises divergen t and individually regulated exon 1 sequences that transcribe for mRNAs that are spliced alternat ively onto the 5’-end of the sequence encoded by the common UGT exons 2-5 region. Therefore, UGT mRNAs consist of a unique region encoded by exon 1 and a region encoded by exons 2-5 that is common for all family 1A UGTs. To evaluate sequences that were UGT1A10 specific and that spanned the entire UGT1A10 exon 1 region, the 5’-end of the UGT1A10 exon 1 (fragment “1”, size = 657 bp) was am plified by PCR using a sense primer (1A10S1; 5’-TCCGCCTACTGTATCATAGCA3’) corresponding to nucleotides –61 through –41 relative to the tr anslation start site in UGT1A10 exon 1 (GenBank accession numbers AF297093 and HSU89508) and a UGT1A10 exon 1-specific antisense primer (1A10AS1; 5’-TCTGAGAACCCTAAGAGATCA-3’) corresponding to nucleotides 576-596 of the UGT1A10 cDNA (GenBank accession number HSU89508). The 3’-end of UGT1A10 exon 1 (fragment “2”, size =416 bp) was amplified by PCR

PAGE 41

30 using a UGT1A10 exon 1-specific sense pr imer (1A10S2; 5’-CTCTTTCCTATGTCCCC AATG-3’) corresponding to nucleotides 557-577 of the UGT1A10 cDNA and an antisense primer (1A10AS2; 5’-C TGGAAAGAAATCTGAAAT GCAACAAAC-3’) corresponding to nucleotides 54047-54074 of the UGT family 1 loci, which corresponds to nucleotides 90-117 downstream of UGT1A10 exon 1 (GenBank accession number AF297093). PCR amplifications were performed routinely in a 50-L reaction volume containing 50 ng of purified genomic DNA, 10 mM Tris-HCl (pH 8.3), 50mM KCl, 1.5 mM MgCl2, 0.2 mM of each of the deoxynucleotide tr iphosphates, 20 pmol of both sense and antisense UGT1A10 primers, and 2.5 units (U) of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN). The reaction mixtures for both fragments 1 and 2 underwent the following incubations in a Ge neAmp 9700 Thermocycler (Perkin-Elmer, Foster City, CA): 1 cycle of 94 C for 2 minut es, 41 cycles of 94 C for 30 seconds, 56 C for 30 seconds, and 72 C for 30 seconds, after wh ich a final cycle of 7 minutes at 72 C was performed. The PCR amplification inte grity of all samples was confirmed by electrophoresis in 8% polyacrylamide or 1.5% agarose gels that were stained subsequently with ethidium bromide and evaluated under ultraviolet light using a computerized photoimaging system (AlphaIm ager 2000, Alpha Innotech, San Leandro, CA). For dideoxy sequencing, PCR products were purified after el ectrophoresis in 1.5% agarose using the Qiaex II gel extracti on kit (Qiagen, Valencia, CA). Dideoxy sequencing was performed at the Molecular Bi ology Core Facility at the H. Lee Moffitt Cancer Center using the same sense and an tisense primers that were used for PCR

PAGE 42

31 amplification (see procedural flowchart in Figure 14). UGT1A10 genotypes for missense polymorphism s were assessed by restriction fragment length polymorphism (RFLP) analysis 1) to confirm polymorphic sequences in sequenced samples, 2) to screen buccal ce ll DNA specimens not initially analyzed by DNA sequencing for overall polymorphic prevalence, and 3) to screen buccal cells from orolaryngeal carcinoma cases and matched controls. UGT1A10 exon 1 sequences were PCR-amplified as described above, and RFLP analysis was performed at 37 C for 2 hours using 10-15 L of PCR product and 5 U of the appropriate restri ction enzyme (EarI for UGT1A10 codon 139, BceA I for UGT1A10 codon 240, and EcoR V for UGT1A10 codon 244; all enzymes were purchased from New England Biolabs, Beverly, MA). Statistical Analyses Statistical analysis included chi-squa re tests for differences in genotype frequencies and the Student t test for continuous variables such as cigarette consumption. The risk of orolaryngeal carcinoma in rela tion to UGT1A10 genotypes was determined by conditional logistic regre ssion to calculate odds ratios (OR) and 95% confidence intervals (CI). For all analyses, the regressi on models included gende r, age (continuous), pack-years of smoking (continuous), and alc ohol consumption (categorical). The statistical computer software SPSS (version 10.1 ) was used to perform all statistical analyses. All statistical tests were two sided.

PAGE 43

32 Buccal Cell Collection Cell Centrifugation DNA Isolation and Purification PCR Amplification Confirmation of PCR by Electrophoresis Restriction Fragment Length Polymorphism (RFLP) Confirmation of Banding by Electrophoresis Figure 14. Procedural flowchart

PAGE 44

33 Results Screening for UGT1A10 Polymorphisms Although single-nucleotide polymorphism data base searches are useful for the detection of polymorphisms in unique or non-ho mologous genes, database searches for the identification of polymorphism s in UGT family 1A exon 1 regions are less useful as a result of high nucleotide homology with othe r UGT family 1A members (Owens et al., 1995). Downstream of this region, six polymor phisms were detected by sequencing analysis (Table 3). Three were “sile nt” (codons 42, 199, and 231) and three were missense polymorphisms resulting in amino acid changes within the UGT1A10 sequence (codons 139, 240, and 244; Figure 15). The codon 139 (G > A) polymorphism resulted in a glutamic acid-to-lysine (Glu > Lys) amino acid change, the codon 240 (C > T) polymorphism resulted in a thre onine-to-methionine (Thr > Met) amino acid change, and the codon 244 (C > A) polymorphism resulted in a leucine-to-isoleucine (Leu > Ile) amino acid change, as detected by direct sequen cing in two (both black), one (white), and five (one white, four black) individuals, respectively. All thre e amino acid-changing polymorphisms were confirmed by RFLP analysis (Figure 16). Prevalence of UGT1A10 Missense Polymorphisms To assess the prevalence of UGT1A10specific missense polymorphisms in different racial/ethnic groups, RFLP analysis was used to screen each of the missense polymorphisms in healthy white, African Ameri can, and Asian individuals recruited from Tampa or New York City (Table 3). Th e codon 240 (Thr > Met) polymorphism was

PAGE 45

34 Description and Prevalence of UGT1A10 Polymorphisms by Racial Group Allelic Prevalence African Americansa Whitesb Asiansc Codon Nucleotide Substitution Amino acid Substitution NY FL Total NY FL Total East Asian Indian 42 CAG to CAA No 0.02 Not Done 0.02 Not Done Not Done Not Done 139 GAG to AAG Glu to Lys 0.05 0.03 0.04deNot detected Not detected <0.01Not detected Not detected 199 CAT to CAC No 0.04 Not Done 0.02 Not Done Not Done Not Done 231 GCC to GCT No 0.12 Not Done 0.14 Not Done Not Done Not Done 240 ACG to ATG Thr to Met Not detected 0.01 <0.01<0.01 <0.01 <0.01Not detected Not detected 244 CTC to ATC Leu to Ile 0.04 0.06 0.05fg<0.01 <0.01 <0.01Not detected Not detected a Prevalence analysis was performed by di rect sequencing and/or polymerase chain reaction-restriction fragment length polymorphism analysis for 189 black subj ects recruited from Mt. Vernon, NY ( n = 110), and Tampa, FL ( n = 79). b Prevalence analysis was performed by di rect sequencing and/or PCR-RFLP analysis for 362 white subjects recruited from Mt. Vernon, NY ( n = 162), and Tampa, FL ( n = 200). c The total number of Asian subjects examined included 35 Indian Asians and 34 subjects of East Asian descent. d Includes 11 subjects who were heterozygous and 2 subjects who were homozygous for the UGT1A10139Lys variant. e Prevalence was significantly greater ( P < 0.005 f P < 0.001, respectively) in African Americans compared with whites. g All subjects with a UGT1A10244Ile variant were heterozygous. Table 3. Description and prevalence of UGT1A10 polymorphisms by Racial Group (allelic prevalence is defined as the propor tion of a specific alle le in a population)

PAGE 46

35 Codon 139 Codon 240 Codon 244 Figure 15. UGT1A10 polymorphisms identified by sequencing analysis (homozygous is defined as cont aining two copies of the sa me allele; heterozygous is defined as containing two differe nt alleles of the same gene) Homozygous wild-type Homozygous polymorphic Homozygous wild-type Heterozygote Homozygous wild-type Heterozygote

PAGE 47

36 Codon 139 Codon 240 Codon 244 Figure 16. RFLP Analysis for codon 139 (E arI digestion), codon 240 (BceAI digestion) and codon 244 (EcorV digestion) (WT: WildType; Het: Heterozygote; and Poly: Polymorphic) DNA marker uncut WT WT Het. Pol y DNA marker uncut WT WT Het. Het. DNA marker uncut WT WT Het. Het.

PAGE 48

37 detected in 3 African Americans and 6 whites, with a resulting allelic prevalence of less than 0.01 in both groups. Although the preval ence of both the codon 139 (Glu > Lys) and codon 244 (Leu > Ile) polymorphisms was less than 0.01 in whites, the prevalence of both polymorphisms wassignificantly higher (P < 0.001 for both polymorphisms) in African Americans. The prevalence of the UGT1A10139Lys-and UGT1A10244Ile-containing alleles was 0.04 and 0.05, respectively, in the Af rican American cohort screened in the current study. Although some variation in prevalence was observed for he UGT1A10 codon 139 and 244 polymorphisms for African Amer icans recruited from Florida versus New York, these differences were not signifi cant. None of the missense polymorphisms were observed in any of the Indian or East As ian individuals screened in the current study (same Table 3). Analysis of UGT1A10 Polymorphisms and Orolaryngeal Carcinoma Risk The potential role for UGT1A10 polymorphisms in the risk for orolaryngeal carcinoma was evaluated in a case-control stud y of 115 African American patients with newly diagnosed orolaryngeal carcinoma and 115 matched controls. Seventy-two percent of cases and 62% of controls were me n. The mean age for the cases and controls was 58 years. As expected, the average pack-years of smoking was significantly higher in case patients than in control patients ( 39 vs. 9 pack-years, resp ectively, P < 0.01). Only 5% of case patients were never-smokers, co mpared with 59% of control patients. A higher percentage of case patien ts than control patients were heavy drinkers of alcohol (28 or more shots per week; 49% vs. 16%, P < 0.01). Informative PCR results were obtained for all 115 case-control pairs (230 total

PAGE 49

38 UGT1A10 Genotype Prevalence and Ri sk for Orolaryngeal Carcinoma UGT1A10 genotype Controls (%) Cases (%) Crude OR (95% CI) Adjusted OR (95% CI)a Codon 139b Glu > Glu 99 (86) 108 (95.6) 1.0 (referent) 1.0 (referent) Glu > Lysc 16 (14) 5 (4.4) 0.29 (0.10-0.81) 0.20 (0.05-0.87) Codon 244d Leu > Leu 101 (91) 105 (91.3) 1.0 (referent) 1.0 (referent) Leu > Ilec 10 (9.0) 10 (8.7) 0.96 (0.38-2.40) 0.94 (0.26-3.40) OR, odds ratio; CI, confidence interval. a Adjusted for age, gender, smoking (pack-y ears), and alcohol consumption (categoric variables). b Noninformative polymerase chain reaction an alyses were obtained in two cases for codon 139 analysis. c None of the subjects screened in th e case-control study were homozygous for the polymorphic variant for either the UGT1A10 codon 139 or 244 polymorphism. d Noninformative Polymerase chain reaction anal yses were obtained in four controls for codon 244 analysis. Table 4. UGT1A10 genotype prevalence a nd risk for orolaryngeal carcinoma

PAGE 50

39 subjects) except for the UGT1A10 codon 139 polymorphism in 2 case patients and the UGT1A10 codon 244 polymorphism in 4 control pa tients (Table 4). Among control patients, the prevalence of these polym orphisms followed the Hardy-Weinberg equilibrium and the prevalence of both polym orphisms was similar to that observed for African Americans in New York (Table 4). Th ere was no significant difference in allelic prevalence between men and women among eith er case patients or control patients. There was no significant difference (p > 0.05) in the prevalence of the UGT1A10244Ile polymorphic variant between case patie nts (allelic prevalence, 0.043) and control patients (allelic preval ence, 0.045). A significantly (p < 0.01) higher prevalence of the UGT1A10139Lys polymorphic variant was observed in control patients (allelic prevalence, 0.07) than in case pa tients (allelic prevalence, 0.0 22). As shown in Table 4, individuals with 1 or more UGT1A10139Lys polymorphic variants e xhibited a significant decrease in risk for orolaryngeal carcinoma (ORcrude, 0.29; 95% CI, 0.10-0.81; P < 0.02). This risk was not affected by adjusting fo r other factors via re gression analysis (ORadjusted, 0.20; 95% CI, 0.05-0.87). There was no association between the UGT1A10244Ile polymorphic variant and orol aryngeal carcinoma risk (ORadjusted, 0.94; 95% CI, 0.26-3.4). Discussion UGT1A10 has been implicated strongly in the glucuronida tion of several important BaP metabolites incl uding BaP-7,8-dihydrodiol, the precursor to the potent mutagen, BaP-7,8-dihydrodiol-9,10-epoxide (Fang et al., 2002). Although most family 1A UGTs are expressed in the liver, UGT1A10 is extrahepatic (Strassburg et al., 1999) and is expressed in several target areas (Str assburg et al., 1998; St rassburg et al., 1998;

PAGE 51

40 Strassburg et al., 2000) for tobacco-induced ma lignancies, including the oral cavity and the larynx (Zheng et al., 2002). Therefore, UGT 1A10 may play an important role in the detoxification of tobacco-smoke carcinogens, such as BaP, in these tissues. Previous studies have shown that few UGT family 1A missense polymorphisms have been identified in the exon 2-5 common re gion of the family 1A locus (Huang et al., 2000). In the current study, several po lymorphisms were identified in the UGT1A10 specific region ( UGT1A10 exon 1). Of these, three resu lted in amino acid changes that could potentially alter UGT1A10 protein func tion. The prevalence of all 3 missense polymorphisms was less than 1% in whites, and none of these polymorphisms were identified in a small cohort of Asian individua ls. These data suggest that coding region variations in UGT1A10 are rare and do not play a signifi cant role in cancer susceptibility in these ethnic groups. Due to their low prevalence, it was not possible to determine the risk of orolaryngeal car cinoma associated with UGT1A10 polymorphisms in these groups. A significantly decreased risk of orol aryngeal carcinoma was found to be associated with the UGT1A10 codon 139 (Glu > Lys) polymor phism but not with the codon 244 (Leu > Ile) polymorphism in African Americans. These data are consistent with the finding that the amino acid ch ange from Glu > Lys for the codon 139 polymorphism is a highly nonconservative ch ange in amino acid sequence and is therefore a more likely candidate to alter UGT1A10 function than the Leu > Ile change observed for the codon 244 polymorphism. The protective effect of the UGT1A10139Lys variant on orolaryngeal carcinoma risk observed in the current study would suggest that this variant ma y exhibit higher

PAGE 52

41 glucuronidating and, therefore, detoxifying ac tivity against tobacco carcinogens like BaP7,8-dihydrodiol. Alternatively, the codon 139 polymorphism may be in linkage disequilibrium with another marker in the UGT1 locus. The current study has two potential lim itations. The overall study sample was relatively small, which limited our ability to determine gene-environment interactions. There were only six case participants who ne ver smoked cigarettes, and consequently it was not possible to determine gene-smoking inte ractions. It should be emphasized that despite this limitation, this is the largest molecular epidemiologic case-control study of orolaryngeal carcinoma risk yet performed in African Americans. Another potential limitation of the current study is that the control patients recruited into the study were hos pital outpatients attending dental or ear, nose, and throat clinics. It could be proposed that they may not reflect the overall prevalence of UGT1A10 alleles in the general population. However, as part of the In ternational Project on Genetic Susceptibility to Environmental Carc inogens database, a large pooled analysis of more than 15,000 individuals without can cer was performed and no statistically significant differences in the overall prevalence of metabolizing enzyme polymorphisms between hospital-based and populat ion-based controls were found (Garte et al., 2002). In addition, in contrast with the relatively poor response rates of most studies that use ‘population’-based controls, the response rate of control patients in the current study was very high (> 95%), thus limiting potential re presentation biases introduced by selective control recruitment. Theref ore, although not proven, it is unlikely that the use of hospital-based outpatient controls substantially biased the fi ndings of the current study. In conclusion, polymorphisms in the UGT1A10 gene were detected and, of these,

PAGE 53

42 the codon 139 polymorphism may be an important risk factor for orolaryngeal carcinoma in African Americans. Functional studies of UGT1A10 polymorphic variants as well as studies determining UGT1A10 expression levels in various human tissue specimens will be necessary to better characterize the effects of UGT1A10 polymorphisms on patient risk for other malignancies.

PAGE 54

43 CHAPTER TWO UGT1A9 AND UGT2B7 POLYMO RPHISMS: IDENTIFICATION AND PREVALENCE IN DIFFERENT RACIAL GROUPS Abstract Exposure to polycyclic aromatic hydrocar bons (PAHs) such as benzo(a)pyrene are important risk factors for colon can cer. Two UDP-glucuronosyltransferases, UGT1A9 and UGT2B7, have been shown to play an important role in the phase II metabolism of procarcinogenic metabolites of BaP. Because both enzymes are wellexpressed in digestive tract tissu es including colon, it is possible that genetic variations in either enzyme may play an important role in colon cancer risk. Th is study examined UGT1A9 and UGT2B7 -specific sequences for polymorphism s that potentially play a role in cancer susceptibility. The UGT1A9 gene was analyzed by direct sequencing of genomic DNA isolated from buccal cell swab s from 90 healthy subjects (43 African Americans and 47 Caucasians). One silent polymorphism and two missense polymorphisms at codons 167 (Val>Ala) and 183 (Cys>Gly) were identified. The UGT2B7 gene was analyzed by direct sequencing of genomic DNA (exon 1) and RNA (exon 2-6) extracted from 39 normal liver sp ecimens from individua l subjects. In addition to seven silent polymorphisms, one previously-reported missense polymorphism was identified. The prevalence of each missense polymorphism was determined by PCR-RFLP analysis of buccal cell DNA from an additional 206 Caucasians, 121 African Americans, and 59 Asians for UGT1A9 and an additional 225 Caucasians, 128 African Americans, and 57 Asians for UGT2B7 The combined prevalence (sequencing + RFLP)

PAGE 55

44 of the UGT1A9167Ala and UGT1A9183Gly variant alleles was 0.004 and 0.025, respectively, for Caucasians, and 0.003 and 0.01, respectively, fo r African Americans. None of the missense UGT1A9 variant alleles were found in a ny of the Asian subjects. The combined prevalence (sequencing + RFLP) of the UGT2B7268Tyr variant was 0.44 for Caucasians, 0.25 for African Americans, and 0.28 fo r Asians. These data suggest that the UGT2B7 His268Tyr and UGT1A9 Cys183Gly polymorphisms may be important variables in risk for colon cancer. Materials and Methods Tissues and Study Population for UGT2B7 and UGT1A9 For screening the UGT2B7 gene for polymorphisms, matching genomic DNA and total RNA, purified from normal liver sp ecimens, were provided by the Tissue Procurement Facility at the H. Lee Moffitt Ca ncer Center from individuals (n = 39) undergoing surgery for resection of hepatoce llular carcinoma; the tissues were quickfrozen at –70 C within 2 hours post-surgery. All subjects were Caucasian, 44% were female, and the average age of these subjects was 64 years. All protocols involving the analysis of tissue specimens were approved by the institutio nal review board at the University of South Florida (USF) and collabo rating institutions, and in accordance with assurances filed with and approved by the Un ited States Department of Health and Human Services. For the determination of UGT2B7 polymorphic prevalence in different racial groups, our population included 225 whites, 128 African Americans, and 57 Asians. Healthy, cancer-free Caucasian a nd African American subjects were recruited at the

PAGE 56

45 Lifetime Cancer Screening Center at the H. Lee Moffitt Cancer Center, and Asian subjects were employed at H. Lee Moffitt Cancer Center/USF. For screening the UGT1A9 gene for polymorphisms, genomic DNA was isolated from buccal cell swabs from 90 healthy s ubjects (43 African Americans and 47 Caucasians). DNA was isolated from exfolia ted buccal cell specimens by incubating cell pellets with proteinase K (0.1 mg/mL) in 1% sodium dodecyl sulfate overnight at 50 C, extracting with phenol:chloroform, and preci pitating with ethanol as previously described. Care was take n during DNA purification and isolation to prevent contamination and cross-contamination be tween samples during polymerase chain reaction (PCR). The purification of DNA samp les was performed in a location distant from the workstation where PCR amplifications were performed. All equipment used for tissue blending and homogenization was washed in a bath of concentrated chromic acid/sulfuric acid, rinsed 3 times in autoclav ed double-distilled water and once in 70% ethanol, air-dried, and autoclaved after each tissue sample was processed as described above. For the determination of UGT1A9 polymorphic prevalence in different racial groups, our population included 206 whites, 121 African Americans, and 59 Asians. Healthy, cancer-free Caucasian a nd African American subjects were recruited at the Lifetime Cancer Screening Center at the H. Lee Moffitt Cancer Center, and Asian subjects were employed at H. Lee Moffitt Cancer Center/USF. All these subjects were participants previ ously recruited for st udies of genetic polymorphisms and other factors in risk for aerod igestive tract cancer (Elahi et al., 2002; Park et al., 2000; Rich ie et al., 1997).

PAGE 57

46 PCR Amplifications, Sequencing and Genotyping Analysis For screening of the UGT2B7 coding region for polymorphisms, a dual PCR amplification strategy was employed. The goal of this approach was to sequence all six exons of UGT2B7 with minimal effort but with high gene specificity. Exon 1-encoded sequences, which comprise nearly one-half the UGT2B7 cDNA, were individually PCRamplified using genomic DNA (purified from normal liver as described above) as template, while UGT2B7 exons 2-6 were PCR-amplifie d after single-strand cDNA synthesis of total RNA (purified from the sa me liver specimens used for genomic DNAPCR amplifications). The primers used for UGT2B7 exon 1 PCR-amplification were 2B7E1S (sense; 5’-TTAACTTCTTGGCT AATTTATCTTTGGACA-3’) corresponding to nucleotides –91 through –61 re lative to the translation st art site in UGT2B7 exon 1 (GenBank accession number NT-030640), and 2B7E1A (antisense; 5’ATCCCACTTCTT CATGTCAAATATTTC-3’) corresponding to nucl eotides +673 through +699 relative to the UGT2B7 exon 1/intron 1 splice junction, re sulting in a PCR amplimer of 721 bp. UGT2B7 exons 2-6 were amplified by RT-P CR using primers 2B7E2S (sense; 5’CTATGTGCTTTACTTTGACTTTTGGTTCG-3’) corr esponding to nucleotides +645 through +673 of the UGT2B7 cDNA (GenBank accession number BC030974), and 2B7E2A (antisense; 5’-CCAGC TTCAAATCTCAGATATAACTAATCAT-3’) corresponding to UGT2B7 cDNA nucleotides +1583 through +1613, resulting in a PCR amplimer of 870 bp. PCR amplifications of UGT2B7 exon 1 sequences were routinely performed in a 50 L reaction volume containing 50 ng of purified DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each of deoxynucleotide trisphosphates, 20 pmole

PAGE 58

47 of both sense and antisense UGT2B7 primers, and 2.5 units of Taq DNA polymerase. Incubations were performed in a GenAmp 9700 Thermocycler (Perkin-Elmer Corp., Foster City, CA) as follows: 1 cycle of 94 C for 2 min, 41 cycles of 94 C for 30 sec, 55 C for 30 sec, and 72 C for 30 sec, followe d by a final cycle of 7 min at 72 C. The amplification of UGT2B7 exons 2-6 was performed after an initial RT reaction using 3 g of total RNA and 200 units of reverse transcriptase in a 50 min incubation at 42 C, followed by PCR as desc ribed above for exon 1 sequences but using 5 L of the RT reaction at an annealing te mperature of 60 C. The integrity of all samples was confirmed by electrophoresis in 8% polyacrylamide or 1.5% agarose gels that were subsequently staine d with ethidium bromide and ex amined over UV-light using a computerized photoimaging system (AlphaImagerTM 2000, Alpha Innotech Corp., San Leandro, CA). For dideoxy sequencing, PCR products were purified after el ectrophoresis in 1.5% agarose using the QIAEX II gel extraction kit (Qiage n, Valencia, CA). Dideoxy sequencing was performed at the Department of Genetics/DNA Sequencing Facility at the Children’s Hospital at the University of Pennsylvania Medical Cent er using the same sense and antisense primers as were used for UGT2B7 amplifications. UGT2B7 genotypes for missense polymorphisms were assessed by restriction fragment length polymorphism (RFLP) analys is after PCR amplification using primers 2B7S (sense; 5’-TGCCTACACTATTCTAACC-3 ’) corresponding to nucleotides +1994 through +2012 relative to the UGT2B7 exon 1/intron 1 splice junction (GenBank accession number NT-030640), and 2B7A (a ntisense; 5’-AGTGCAGAATTTTCAGAGA -3’) corresponding to nucleotide s +2555 through +2573 relative to exon 2/intron 2 splice

PAGE 59

48 junction (GenBank accession number NT-030640), us ing an annealing temperature of 58 C to produce a PCR-amp lified product of 580 bp. RFLP analysis was performed at 37 C for 2 hours using 10-15 L of PCR product and 0.1 units of the FokI restriction en zyme. Digestions were electrophoresed on 8% PAGE gels that were subsequently staine d with ethidium bromide and examined over UV-light. The family 1A locus comprises divergen t and individually regulated exon 1 sequences that transcribe for mRNAs that are spliced alternat ively onto the 5’-end of the sequence encoded by the common UGT exon 2-5 region. Therefore, UGT mRNAs consist of a unique region encoded by exon 1 and a region encoded by exons 2-5 that is common for all family 1A UGTs. To evaluate sequences that were UGT1A9 specific and that spanned the entire UGT1A9 exon 1 region, PCR amplification strategy was employed. Exon 1-encoded sequences were in dividually PCR-amplified using genomic DNA (isolated from buccal cells as desc ribed above). The primers used for UGT1A9 exon 1 PCR-amplification were 1A9E1S (sense; 5’-CGCCCTCTATTGGGGTCAG-3’) corresponding to nucleotides –100 through –82 rela tive to the translatio n start site in UGT1A9 exon 1 (GenBank accession number AF297091), and 1A9E1A (antisense; 5’AATTTCCAAAGGTGAAGTATTCTT-3’) corr esponding to nucleotides +882 through +905 relative to the UGT1A9 exon 1/intro 1 splice junction, resulting in a PCR amplimer of 1005 bp. PCR amplifications of UGT1A9 exon 1 sequences were performed in a 50 L reaction volume containing 50 ng of purifie d DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each of deoxynucleotide trisphosphates, 20 pmole of

PAGE 60

49 both sense and antisense UGT1A9 primers, and 2.5 units of Taq DNA polymerase. Incubations were performed in a GenAmp 9700 Thermocycler (Perkin-Elmer Corp., Foster City, CA) as follows: 1 cycle of 94 C for 5 min, 40 cycles of 94 C for 30 sec, 60 C for 30 sec, and 72 C for 1 min, followed by a final cycle of 7 min at 72 C. The integrity of all samples was confirmed by el ectrophoresis in 8% pol yacrylamide or 1.5% agarose gels that were subsequently stained with ethidium bromide and examined over UV-light using a computerized photoimaging system (AlphaImagerTM 2000, Alpha Innotech Corp., San Leandro, CA). For dideoxy sequencing, PCR products were purified after el ectrophoresis in 1.5% agarose using the QIAEX II gel extraction kit (Qiage n, Valencia, CA). Dideoxy sequencing was performed at the Department of Genetics/DNA Sequencing Facility at the Children’s Hospital at the University of Pennsylvania Medical Cent er using the same sense and antisense primers as were used for UGT1A9 amplifications. UGT1A9 exon 1 sequences were PCR-amplifie d as described above, and RFLP analysis was performed at 37 C for 2 hours using 10-15 L of PCR product and 5 U of the appropriate restriction enzyme (BbsI for UGT1A9 codon 167 and NiaIV for UGT1A9 codon 183; all enzymes were purchased from New England Biolabs, Beverly, MA). Digestions were electrophoresed on 8% PAGE gels that were subsequently stained with ethidium bromide and examined over UV-light (see procedural flowchart in Figure 17). Results Screening for UGT2B7 and UGT1A9 Polymorphisms Eight polymorphisms were detected by se quencing analysis for UGT2B7 (Table

PAGE 61

50 Buccal Cell Collection Cell Centrifugation DNA Isolation and Purification PCR Amplification Confirmation of PCR by Electrophoresis Restriction Fragment Length Polymorphism (RFLP) Confirmation of Banding by Electrophoresis Figure 17. Procedural flowchart

PAGE 62

51 UGT1A9 and UGT2B7 Silent Polymorphisms UGT Location Nucleotide substitution 1A9 Codon 66 CTG to TTG 2B7 Codon 124 AGA to AGG Codon 245 ACG to ACA Codon 246 TTA to TTC Codon 267 CCT to CCA Codon 285 GCC to GCA Codon 353 CTG to CTC Codon 354 TAT to TAC UGT1A9 and UGT2B7 Missense Polymorphisms UGT Location Nucleotide substitution Amino acid substitution 1A9 Codon 167 GTC to GCC Val to Ala Codon 183 TGC to GGC Cys to Gly 2B7 Codon 268 CAT to TAT His to Tyr Table 5. UGT1A9 and UGT2B7 polymorphisms

PAGE 63

52 5). Seven of them were “silent” (codons 124, 245, 246, 267, 285, 353, and 354) and one previously-reported missense polymorphism (Ho lthe et al., 2003) resulting in an amino acid change within the UGT2B7 sequence (codon 268; Figure 18). The codon 268 (CAT > TAT) polymorphism resulted in a histidineto-tyrosine (His > Ty r) amino acid change which was confirmed by RFLP analysis (Figure 19). Three polymorphisms were detect ed by sequencing analysis for UGT1A9 (Table 5). One was “silent” (codon 66) and two were missense polymorphisms resulting in amino acid changes within the UGT1A9 sequence (codons 167 and 183; Figure 20). The codon 167 (GTC > GCC) polymorphism resulted in a valine-to-alani ne (Val > Ala) amino acid change and the codon 183 (TGC > GGC) polymorphism resulted in a cysteine-to-glycine (Cys > Gly) amino acid change. Both amino acid-changing polymorphisms were confirmed by RFLP analysis (Figure 21). Prevalence of UGT2B7 and UGT1A9 Missense Polymorphisms To assess the prevalence of UGT2B7 -specific missense polymorphism in different racial/ethnic groups, RFLP anal ysis was used to screen th e missense polymorphism in healthy white, African American, and Asian individuals recruited from Tampa or New York City (Table 6). The combined prevalence (sequencing + RFLP) of the UGT2B7268Tyr variant was 0.44 for Caucasians, 0.25 for African Americans, and 0.28 for Asians. To assess the prevalence of UGT1A9 -specific missense polymorphisms in different racial/ethnic groups, RFLP analys is was used to screen the missense polymorphisms in healthy white, African Amer ican, and Asian individuals recruited

PAGE 64

53 Homozygous Wild-Type Heteroz ygote Homozygous Polymorphic Figure 18. UGT2B7 polymorphism (Codon 268) identified by sequencing analysis (homozygous is defined as cont aining two copies of the sa me allele; heterozygous is defined as containing two differe nt alleles of the same gene)

PAGE 65

54 Codon 268 Figure 19. RFLP Analysis for codon 268 (FokI digestion) (WT: WildType; Het :Heterozygote; and Poly: Polymorphic) 711 bp 489 bp 328 bp 147 bp DNA marker uncut Het. WT Het. Het. Pol y

PAGE 66

55 Codon 167 Homozygous Wild-Type Heterozygote Codon 183 Homozygous Wild-Type Heterozygote Figure 20. UGT1A9 polymorphisms identified by sequencing analysis (homozygous is defined as cont aining two copies of the sa me allele; heterozygous is defined as containing two differe nt alleles of the same gene)

PAGE 67

56 Codon 167 Codon 183 Figure 21. RFLP Analysis for codon 167 (B bsI digestion) and for codon 183 (NiaIV digestion) (WT: WildType and Het: Heterozygote) DNA marke r uncut Het. WT 711 bp 489 bp 328 bp DNA marke r WT WT WT Het. 711 bp 489 bp 328 bp

PAGE 68

57 UGT1A9 and UGT2B7 missense polymor phisms and allelic prevalence Allelic Prevalence Codon Nucleotide Substitution Amino Acid Substitution African Americans Whites Asians UGT1A9 167 GTC to GCC Val to Ala 0.003 0.004 Not detected 183 TGC to GGC Cys to Gly0.01 0.025 Not detected UGT2B7 268 CAT to TAT His to Tyr 0.25 0.44 0.28 Table 6. UGT1A9 and UGT2B7 missense polym orphisms and allelic prevalence (allelic prevalence is defined as the propor tion of a specific alle le in a population)

PAGE 69

58 from Tampa or New York City (Table 6). The combined prevalence (sequencing + RFLP) of the UGT1A9167Ala and UGT1A9183Gly variant alleles was 0.004 and 0.025, respectively, for Caucasians, and 0.003 and 0.01, respectively, for African Americans. None of the missense UGT1A9 variant alleles were found in any of the Asian subjects. Discussion Previous studies have shown that few UGT family 1A missense polymorphisms have been identified in the exon 2-5 common re gion of the family 1A locus (Huang et al., 2000). In the current study, three new pol ymorphisms were identified by sequencing analysis in the UGT1A9 -specific region ( UGT1A9 exon 1). Of these, two resulted in amino acid changes that could potentially al ter UGT1A9 protein function. The codon 167 (GTC > GCC) and the codon 183 (TGC > GG C) polymorphisms resulted in a valine to alanine and cysteine to glycine amino acid changes, respectively. The combined prevalence (sequencing + RFLP) of the 167ala and 183gly variant alleles were 0.004 and 0.025, respectively, for Caucasians and 0.003 and 0.01, respectively, for African Americans. The prevalence of both missense pol ymorphisms was less than 1% in African Americans, and none of these polymorphisms we re identified in a sm all cohort of Asian individuals. Therefore, these data su ggest that coding re gion variations in UGT1A9 are rare and do not play a significan t role in cancer susceptibility in these ethnic groups. In addition, eight new polymorphisms were identified by sequencing analysis in the UGT2B7 gene. Of these, only 1 previously identified missense polymorphism resulted in an amino acid change that could potentially alter UGT2B7 protein function. The codon 268 (CAT > TAT) polymorphism resulte d in a histidine to tyrosine amino

PAGE 70

59 acid change. The prevalence of the 268tyr va riant allele was 0.44 for Caucasians, 0.25 for African Americans and 0.28 for Asians. In conclusion, Polymorphisms identified in the UGT1A9 gene and UGT2B7 gene resulted in amino acid changes that may potentially alter UGT1A9 and UGT2B7 protein function. Therefore, the codon 183 (Cys > Gly) polymorphism of UGT1A9 and the codon 268 (His > Tyr) polymorphism of UGT2B 7 could play a role in cancer risk.

PAGE 71

60 CHAPTER THREE FUNCTIONAL CHARACTERIZ ATION OF THE UGT1A9183Gly POLYMORPHIC VARIANT Abstract UGT1A9 is a human UDP-glucuronosyltran sferase (UGT) shown to play an important role in the phase II metabolism of procarcinogenic metabolites of benzo(a)pyrene (BaP) and 4-(methylnitrosam ino)-1-(3-pyridyl)-1-butanone (NNK), as well as colon carcinogens like 2-hydr oxyamino-1-methyl-6-phenylimidazo[4,5b]pyridine (Phip). As UGT1A9 is expressed in li ver as well as in tissu es of the digestive tract including colon and esopha gus, these enzymes may play an important role as detoxifiers of digestive tract carcinogens. A prevalent missense polymorphism has been previously identified at codon 183 of the UGT1A9 gene. To determine whether this change in amino acid sequence results in aberrant UGT1A9 enzyme activity, functional characterization of the wild-t ypeand variant-en coded UGT1A9 isoforms was performed in vitro after cloning and stable transfection of wild-type and variant UGT alleles into the non-UGT-expressing HK293 cell line. Cell hom ogenates were prepared from UGT1A9transfected cells and glucuroni dation assays were performed using equal amount of total cell protein against various car cinogens/carcinogen metabolit es including B[a]P-7,8-diol and 4-(methylnitrosamino)-1-(3-pyridyl)-1-but anol (NNAL), as well as other phenolic and steroidal compounds incl uding 1-hydroxy (OH)-pyrene, 3-OH-BaP, 7-OH-BaP, and 9-OH-BaP. Levels of UGT enzyme activity were determined in three separate experiments by HPLC analysis a nd calculated both before and after normalization for cell

PAGE 72

61 homogenate of UGT1A9 protei n levels as determined by Western blot analysis. A significant (p < 0.001) 3to 4-fold decrease in activity was observed for the UGT1A9183Gly variant as compared to its wild-t ype counterpart for all substrates analyzed. Although high levels of activ ity were observed for the wild-type UGT1A9183Cys variant against NNAL, none was de tected in assays with the UGT1A9183Gly variant. Significant (p < 0.05) de creases in UGT1A9 activity were observed prior to UGT protein normalization in assays using 9OH-BaP or BaP-7,8diolas substrate. These results demonstrate that the UGT1A9 (Cys183Gly) polymorphism significantly alters UGT1A9 functi on and could potentially play an important role as risk modifier for digestive tract cancers. Materials and Methods Chemicals and Materials 3-OH-BaP, 7-OH-BaP, 9-OHBaP, and BaP-7,8-dihydrodio l were obtained from the National Cancer Institute Chemical Carcinogen Repository (synthesized and characterized at Midwest Re search Institute, Kansas City, MO), while NNAL was obtained from Toronto Chemicals (Toronto, Canada). UDPGA, D,L-2-lysophosphatidyl choline palmital C16:0, and 1-OH-pyrene were pur chased from Sigma (St. Louis, MO). 14C-UDPGA (specific activity: 300 mCi/mmo l) was obtained from American Radiolabeled Chemicals (St. Louis, MO). Dulbecco’s modified Eagle’s medium was obtained from Mediatech (H erndon, VA) and both fetal bovine serum and geneticin (G418) were purchased from Life Te chnologies (Grand Island, NY). Taq DNA polymerase (HotMaster) was purchased from Perkin Elmer Biosystems (Foster City,

PAGE 73

62 CA), and the human UGT1A9 western blotting kit was purchased from Gentest (Woburn, MA). HPLC-grade solvents were provided by va rious suppliers and used after filtration. All other chemicals were of analytical grade and used without further purification. RT-PCR Analysis Total RNA was isolated from 108 UGT1A9-overexpressing cells by using the guanidinium isothiocyanate/cesium chloride me thod and treatment with Dnase I. Total RNA specimens were stored at –70 C in individual aliquots. RT (Reverse Transcriptase) was performed in 20 L vol umes using 3 g total RNA, 200 units Superscript II reverse transcriptase (GIBCO /BRL, Gaithersburg, MD), and 0.5 g of oligo (dT)16 primer as outlined in the manufacturer’s protocol. For PCR (50 L final volume), each reacti on was performed using 5 L of RT reaction, 0.2 mM dNTPs, 5 units Taq DNA pol ymerase (Boehringer Mannheim), and 20 pmole of sense (5’-AGTTCTCTGATGGCT TGC-3’) and antisense (5’-TTTTACCTTA TTTCCCACCC-3’) UGT1A9-specific primers. R eactions were incubated in a PerkinElmer 9600 Thermocycler (Perkin-Elmer Corp., Fo ster City, CA) for 1 cycle of 94 C for 5 min, 40 cycles of 94 C for 30 sec, 55 C for 45 sec, and 72 C for 1 min, followed by 1 cycle at 72 C for 7 min. Polyacrylamide gel (1.5%) electrophoresis was performed for the RT-PCR (10 L aliquot) reaction, and analysis and quantification of ethidi um bromide-stained products performed using a computerized photoimager system (AlphaImagerTM 2000, Alpha Innotech Corp. San Leandro, CA). Representa tive RT-PCR products were purified after electrophoresis in 1.5% agarose using the QIAEX II gel extracti on kit (Qiagen,

PAGE 74

63 Valencia, CA), and dideoxy sequencing was perf ormed (Molecular Core Facility, H. Lee Moffitt Cancer Center) using the same sense and antisense primers as were used for UGT1A9 amplification, to confirm the UGT 1A9 wild-type sequence of the RT-PCR product. TOPO Cloning Reaction, Transformati on, and Plasmid DNA Extraction The pcDNA3.1/V5-His TOPO TA Expression kit provides a highly efficient, 5 minute, one-step cloning strategy for the direct insertion of Taq polymerase-amplified PCR products into a plasmid vector (pcDNA3.1/V5-His-TOPO; Figure 22). The TOPO cloning reaction (6 L) was set up us ing 4 L of PCR product, 1 L of sterile water, and 1 L of TOPO vector. The reaction was mixed gently and incubated for 5 min at room temperature (22-23 C). It was then placed on ice to proceed to One Shot Chemical transformation. 2 L of the TOPO Cloning reaction from the previous step were added into a vial of One Shot TOP10 Chemically Competent E. coli and mixed gently. The reaction was incubated on ice for 20 min, then heat shocked for 30 sec at 42 C, and immediatel y transferred to ice. 250 L of room temperature SOC medium was added and then the tube was capped and shaken (200 rpm) at 37 C for 1 hour. 100 L from each transformation was spread on a pre-warmed selective plate (ampicillin treated) and incubated overnight at 37 C. Next day, colonies were picked from agar plates and added into a round bo ttom tube containing 2.5 ml of LB media treated with ampicillin. The tubes were put in a shaker overnight to grow at 37 C. Plasmid DNA extraction was done the following day using QIAprep Spin Plasmid Mini kit.

PAGE 75

64 Figure 22. pcDNA3.1/V5-His-TOPO vector

PAGE 76

65 RFLP analysis was performed at 37 C for 2 hours using 5 L of plasmid DNA and 5 U of the appropriate restriction enzyme (DraI) to check for right product (insert + vector) in the correct orient ation; all enzymes were pur chased from New England Biolabs, Beverly, MA). Diges tions were electrophoresed on 1.5% agarose gels that were subsequently stained with ethidium bromide and examined over UV-light. Dideoxy sequencing was performed (Molecular Core Facility, H. Lee Moffitt Cancer Center) using the T7 and BGH primers provided by the TOPO Cloning kit, to confirm the UGT1A9 wild-type sequ ence in the pcDNA3.1/V5-His-TOPO vector. Site-Directed Mutagenesis This method uses a proof-reading polym erase to read all the way around a plasmid and thus incorporates the primer as the new (mutant) sequence. Both of the mutagenic oligonucleotide primers were complimentary to each other and contained the desired mutation in order to anneal to th e same sequence on opposite strands of the plasmid (Figure 23). PCR amplifications of the plasmid (vector + insert) sequences were routinely performed in a 50 L reaction volume c ontaining 500 ng of plasmid DNA, 50 mM MgSO4, 10 mM dNTP mixture, 10X amplification buffer, 20 pmole of both sense (5’CTTGAAGAAGGTGCACAGGGCCCTGCTCCT CTTTCC-3’) and antisense (5’GGAAAGAGGAGCAG GGCCCTGTGCACCTTCTTC AAG-3’) primers, and 2.5 units of Platinum Pfx DNA polymerase. Incubations were performed in a GenAmp 9700 thermocycler (Perkin-Elmer Corp., Foster Cit y, CA) as follows: 1 cycle of 95 C for 30 sec and 12 cycles of 95 C for 30 sec, 55 C for 1 min, and 68 C for 15 min. PCR

PAGE 77

66 Figure 23. Illustration of the basic step s in a site-directed mutagenesis method

PAGE 78

67 reaction was cooled to room temperature and 2 units of restriction enzyme DpnI were added to cut the methylated DNA (the parental plasmid DNA will be cut to pieces while the nascent PCR DNA is left int act). The reaction wa s left to incubate at 37 C for 1 hour followed by transformation into competent E. coli as described above. Plasmid DNA extraction was done the following day using QIAprep Spin Plasmid Mini kit. RFLP analysis was performed at 37 C for 2 hours using 5 L of plasmid DNA and 5 U of the appropriate restriction enzyme (ApaI) to check for right product (insert + vector); all enzymes were purchased from New England Biolabs, Beverly, MA). Digestions were electrophores ed on 1.5% agarose gels that were subsequently stained with ethidium bromide and examined over UV-light. Dideoxy sequencing was performed (Molecular Core Facility, H. Lee Moffitt Cancer Center) using the T7 and BGH primers provided by the TOPO Cloning kit, to confirm the UGT1A9 polymorphic se quence in the pcDNA3.1/V5-His-TOPO vector. Transfection Using LipofectamineTM 2000, Cell Lines and Cell Homogenate Preparation HK293 (human embryonic kidney fibroblast) cells were kindly provided by Dr. Thomas Tephly (University of Iowa, Iowa C ity, IA). The cells were removed from liquid nitrogen, defrosted in a large beaker containing water at 37 C, and immediately transferred into cell culture dishes with medi a prepared earlier (for 500 ml of Modified Eagle’s medium, add 5 ml of 100 mM sodi um pyruvate soluti on, 5ml of 100X nonessential amino acids solution, 50 ml of fetal bovine serum, and 5 ml of penicillin/streptomycin). The HK293 cells we re grown to approximately 80% confluence

PAGE 79

68 and then transfected using DNA-Lipofectamine complexes (as described in the manufacturer’s protocol, LipofectamineTM 2000, Invitrogen Corp., Carlsbad, CA). For stable cell lines, the cells were passe d at a 1:20 dilution into fresh growth medium 24 hours after transfecti on. Selective medium was prep ared earlier using 500 ml of Dulbecco’s Modified Eagle’s medium s upplemented with 4.5 mM glucose, 10 mM HEPES, 10% fetal bovine serum, 100 U/ml pe nicillin, 100 g streptomycin, and 700 g geneticin, and was added the following day. Th e cells were fed with selective medium every 4 days; few weeks later, plates were in spected for colonies. All cells were grown in a humidifier incubator under an atmosphere of 5% CO2. Cells were suspended in Tris-buffered saline (25mM Tris base, 138 mM NaCl, 2.7 mM KCl; pH 7.4) and subjected to 3 rounds of freeze-thaw prior to gentle homogenization. Cell homogenate s (5-30 mg homogenate protei n/ml) were stored at -70 C in 100 L aliquots. Total cell homogenate prot ein concentrations were determined using the BCA assay (Pierce Corporation, Rockford, IL). Western Blot Analysis Levels of UGT1A9 expression in UGT1 A9-over-expressing cell lines were monitored by Western blot analysis using the anti-UGT1A9 antibody in a 1:5000 dilution as per the manufacturer’s instructions (Gen test). Determinations of glucuronide formation in wild-type versus variant UGT1A9-over-expressi ng cell lines were calculated relative to the levels of UGT expression in the respective cell lines as determined by densitometric analysis (using the AlphaImagerTM 2000 computerized photoimaging

PAGE 80

69 OH OH O H OH OH O H 1-OH-pyrene 3-OH-benzo[a]pyrene 7-OH-benzo[a]pyrene 9-OH-benzo[a]pyrene Benzo[a]pyrene-7,8-dihydrodiol N N CH3 N O OH NNAL Figure 24. Chemical stru cture of substrates

PAGE 81

70 system, Alpha Innotech Corp., San Leandro, CA) of Western blots using the antiUGT1A9 antibody. Glucuronidating Activity of UGT1A9 (Wild-Type/Polymorphic)-Over-Expressing Cell Homogenates against NNAL The rate of NNAL (Figure 24) glucuroni dation by liver microsomes and UGT1A9 (wild-type and polymorphic variant)-over-expr essing cell homogenate s was determined after a pre-incubation with D,L-2-lysophospha tidyl choline palmital C16:0 (1 mg/mg protein) for 10 minutes at 4 C as previously described. Briefly, liver microsomes (5 mg protein) and cell homogenates (3 mg protein) were incubated (100 L final volume) in 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, D,L-2-lysophosphatidyl choline palmital C16:0 (1 mg/mg protein), 4 mM 14C-UDPGA (1 Ci/100 L reaction volume), and 5 mM NNAL at 37 C for 2 hours. Reactions were terminated by the addition of 1/10 volume of 0.3 N Ba(OH)2/0.3 N ZnSO4 on ice. The precipitate wa s removed by centrifugation, and the supernatant was subj ected to solid phase extrac tion on an Oasis HLB 3 cc reverse phase cartridge (Waters, Milfor d, MA) activated with acetonitrile and equilibrated with Solvent A (0.05 M NH4AOc; pH 7.0). After loading onto the cartridge, the sample was washed with 1 ml of Solvent A and eluted with 0.5 ml acetonitrile. The acetonitrile was evaporated, the resulting sample diluted to 110 L with water, and the sample was analyzed for glucuronidated NNAL metabolites by HPLC with radioflow detection using the following sy stem: a Waters Associates dual-pump (model 510) HPLC system (Milford, MA), equipped with an au tomatic injector (WISP model 710B), a UV

PAGE 82

71 detector operated at 254 nm (model 440), and a radioactive flow detector (IN/US Systems, Fairfield, NJ). HPLC was performed using a 5 A quasil C18 column (4.6 mm X 250 mm, Thermo Hypersil-Keystone, Bellefo nte, PA) with gradient elution at 1 ml/min using the following conditions: 5 min with 100% Solvent A, a linear gradient for 10 min to 30% Solvent B (100% methanol), a subsequent lin ear gradient to 50% Solvent B for 10 min, and a final linear gradient to 100% Solvent B for 5 min. The column was washed for 10 min with 100% Solvent B and regenerated for 15 min with 100% Solvent A. 14C-NNALGluc peaks were confirmed by relative retention time, and in some cases, by sensitivity to E.coli -glucuronidase treatment as previously described. Glucuronidating Activity of UGT1A9 (Wild-Type/Polymorphic)-Over-Expressing Cell Homogenates against BPD and other Benzo[a]pyrene Metabolites The rate of B[a]P-7,8-dihydrodiol, 1hydroxy-pyrene, and phenolic BaP metabolites (3-, 7-, and 9-hydroxy-BaP) (see Figure 16 for chemical structures) was determined using 0.1-1.5 mg UGT1A9-over-exp resing cell homogenate (0.1 mg for 3OH-BaP, 0.3 mg for 1-OH-pyrene and 7and 9-OH-BaP, a nd1.5 mg for BaP-7,8dihydrodiol). Cell homogenates were incubate d (100 L final volume) with 1mM 3-, 7-, 9-OH-BaP or 1-OH-pyrene, or 2mM BaP-7,8-dihydrodiol( ), 4 mM UDPGA, 20 mM MgCl2, 50 mM Tris-HCl (pH 7.4). All reactions were initiated by the addition of UDPGA. Reactions were terminated by the add ition of an equal volume of acetonitrile. Precipitates were removed by centrifugation (5 min, 10,000 x g) and supernatants were filtered and analyzed for glucuronidated BaP metabolites by HPLC using a Beckman

PAGE 83

72 HPLC ‘Gold’ System (Fullerton, CA) consisti ng of a model 110B programmable solvent module, a model 166 UV detector operated at 254 nm, a Waters au tomatic injector (model 717 plus) and a -RAM radioisotope detector (IN/U S, Tampa, FL) equipped with a 1 ml liquid flow cell. The samples were injected onto a 201TP (4.6 X 250 mm) 5 C18 300 column (VYDAC, Hesperia, CA). Se parations were performed using the following linear gradient conditions: 0-5 mi n, 20% Solvent A; 5-25 min, 20-40% Solvent A; 25-30 min, 40-60% Solvent A; 30-35 min, 60-90% Solvent A, where Solvent A was acetonitrile and was diluted at the given percentages in Solvent B (20 mM NaH2PO4, pH 4.6). The HPLC flow rate was 1 ml/min, while the scintillation fluid flow rate was 4 ml/min. The column was routinely washed with 100% Solvent A for 15 min and equilibrated after every HP LC run with 20% Solvent A for at least 20 min (see procedural flowchart in Figure 25). Kinetic analysis for both wild-type and polymorphic UGT1A9-over-expressing cell homogenates exhibiting glucuronidating activity against 1-OH-pyrene, 7-OH-BaP, and BaP-7,8-dihydrodiol was performed as descri bed above using an in cubation time of 2 hours. The Km and Vmax for the glucuronidation of 1OH-pyrene, 7-OH-BaP, and BPD by both wild-type and polymorphic UGT1A9 va riants were calculated after linear regression analysis of Lineweaver-Burk plots. Statistical Analysis The student’s t-test (2-sided) was used for comparing rates of glucuronide formation for the UGT1A9183Cys and UGT1A9183G ly isoforms against the different substrates examined in this study.

PAGE 84

73 Total RNA Isolated from UGT1A9-overexpressing cells RT-PCR Polyacrylamide Gel Electrophoresis RT-PCR Product Purification Dideoxy Sequencing performed to c onfirm UGT1A9 Wild-Type Sequence Cloning of Wild-Type UGT1A9 Isoform into Plasmid Vector Transformation of (Vector + inse rt) into Chemically Competent E. coli Transformation product spread on plate (amp icillin-treated) and overnight incubation Colony Selection and Plasmid DNA Extraction RFLP Analysis to verify pr oduct in correct orientation Dideoxy Sequencing to confirm UGT1A9 Wild-Type sequence Figure 25. Procedural flowchart (continued next page)

PAGE 85

74 Site-directed mutagenesis usi ng proof-reading polymerase Transformation of (vector + insert) into competent E. coli Plasmid DNA extraction after colonies selection RFLP analysis performed to verify right product Dideoxy sequencing to confirm UGT1A9 polymorphic sequence HK293 cells grown and transfected usi ng DNA-Lipofectamine complexes; plate inspection for colonies Cell homogenates prepared from UGT1A9 tr ansfected cells and protein concentration determined Levels of UGT1A9 expression determ ined by Western blot analysis Glucuronidation assays performed using va rious carcinogens/carcinogen metabolites Levels of UGT enzyme activity determined by HPLC analysis and calculated before and after normalization for cell homogenate of UGT1A9 protein levels Figure 25. Procedural flowchart (continued)

PAGE 86

75 Results Cloning and Sequencing In order to obtain the whole UGT1A9 sequence, RT-PCR was performed as described above, and cloned into the plasmid vector (pcDNA3.1/V5-HisTOPO). The resulting vector (insert + plasmid) was then transformed into chemically competent E. coli, colonies were picked and plasmid DNA extracted to determine whether UGT1A9 (wild-type) had been cloned. RFLP analysis was performed using restriction enzyme DraI and the digestion results (Figure 26) show that UGT1A9 had been cloned in the correct orientation. To conf irm the UGT1A9 wild-type sequ ence in the plasmid, dideoxy sequencing was performed. The results show that no mutation (Figure 28) occurred throughout the sequence matching the orig inal UGT1A9 sequence from Genbank. In order to obtain the entire UGT1A9 sequence with only one mutation at codon 183, site-directed mutagenesis was performe d. After plasmid DNA extraction, RFLP analysis was done using restriction enzyme ApaI to check for the right insert with the mutation. ApaI cuts the polymorphic variant (UGT1A9183Gly) twice creating 2 bands on the 1% agarose gel, while it cuts the wild-type (UGT1A9183Cys) only once, creating only 1 band (Figure 27). To confirm the UGT1A9 polymorphic sequence in the plasmid, dideoxy sequencing was performed. The results show that only one mutation at codon 183 (Figure 28), changing TGC to GGC (Cystein e to Glycine), is present throughout the sequence. The rest of the sequen ce matched the wild-type sequence.

PAGE 87

76 Figure 26. RFLP analysis usi ng restriction enzyme DraI (c orrect orientation observed) (vector size = 5523 b.p.; UGT1A9 size = 1627 bp) (WT: WildType) 3384 b p 1684 b p 1128 b p 699 b p 239 b p DNA marke r WT WT DNA marke r 600 b p 200 b p 1000 b p 2000 b p 4000 b p

PAGE 88

77 Figure 27. RFLP analysis usi ng restriction enzyme ApaI (t o check for polymorphic vs. wild-type) (vector size = 5523 b.p.; UGT1A9 size = 1627 bp) (WT: WildType and Poly: Polymorphic) DNA marke r Pol y WT Pol y WT Pol y WT WT WT WT 1000 b p 6000 b p

PAGE 89

78 Homozygous wild-type Homozygous polymorphic Figure 28. Section of the entire UGT1A9 sequence showing both the homozygous wildtype (with no mutation) and the homoz ygous polymorphic identified by sequencing analysis (only one mutation at codon 183 changing TGC to GGC) (homozygous is defined as containing two copies of the same allele)

PAGE 90

79 Western Blot Analysis Levels of UGT1A9 expression in UGT1 A9-over-expressing cell lines were monitored by Western blot analysis. The leve ls of UGT1A9 expressi on in the respective cell lines (wild-type versus va riant) were determined by de nsitometric analysis using UGT1A protein as standard (Figure 29). The results indicate that the UGT1A9183Gly isoform has at least three times the leve l of expression compared to the UGT1A9183Cys. NNAL Glucuronidation in UGT1A9-Over-Exp ressing Cell Homogenates (Wild-type vs. Polymorphic Variant) Previous studies have de monstrated that UGT1A9 e xhibited glucuronidating activity against NNAL (Qing et al., 2000). To determine whether the change in amino acid sequence at codon 183 results in a change in UGT1A9 enzyme activity, glucuronidation assays were performed using equal amounts of total cell protein against NNAL. Levels of UGT enzyme activity were de termined in three separate experiments by HPLC analysis and calculated both before and after normalization for cell homogenate of UGT1A9 protein levels as determined by We stern blot analysis. Although high levels of activity were observed for the wild-type UGT1A9183Cys variant against NNAL, none was detected in assays with the UGT1A9183Gly variant (Figure 30). BPD and other Benzo[a]pyrene metabolites in UGT1A9-Over-Expressing Cell Homogenates (Wild-type vs. Polymorphic Variant) Previous studies have de monstrated that UGT1A9 e xhibited glucuronidating activity against benz o[a]pyrene-7,8-dihydrodiol, 3-, 7, 9-hydroxy-benzo[a]pyrene, and

PAGE 91

80 Figure 29. Western blot (WT: Wildtype and Poly: Polymorphic) WT WT WT Pol y Pol y Pol y Standard p rotein

PAGE 92

81 A B C Figure 30. HPLC analysis of NNAL-Gluc formation in liver and UGT1A9-overexpressing HK293 cells. A, Human liver mi crosomes were incubated using 4 mM 14CUDPGA and 5 mM NNAL as described under Materials and Methods. B, 14C-labeled metabolites from incubations using homogenates from wild-type UGT1A9-overexpressing cells. C, 14C-labeled metabolites from inc ubations using homogenates from polymorphic UGT1A9-over-expressing cells. 14C-UDPGA Retention Time (min) 14C-UDPGA Retention Time (min) 14C-UDPGA Retention Time (min)

PAGE 93

82 A B Figure 31. HPLC analysis of BPD-Gluc fo rmation in homogenates from UGT1A9-overexpressing HK293 cells. A, metabolites from incubations using homogenates from wildtype UGT1A9-over-expressing cells. B, metabolites from incubations using homogenates from polymorphic UGT1A9-over-expressing cells. UV Absorbance Retention Time (min) UV Absorbance Retention Time (min)

PAGE 94

83 Before UGT protein normalization Rate (pmol/mg/min) Glucuronides of substrates Mean (wt) Mean (poly) Two-tailed p value ( = 0.05) Ratio (poly/wt) B[a]P-7,8-diolGluc 7.76 7.36 0.0428 0.95 3-O-GlucB[a]P 82.72 70.06 0.0612 0.85 7-O-GlucB[a]P 102.52 95.73 0.0973 0.93 9-O-GlucB[a]P 26.68 24.06 0.0190 0.90 1-O-Glucpyrene 153.8 187.84 0.0052 1.22 After UGT protein normalization Rate (pmol/g/min) Glucuronides of substrates Mean (wt) Mean (poly) Two-tailed p value ( = 0.05) Ratio (poly/wt) B[a]P-7,8-diolGluc 41.55 12.62 < 0.0001 0.30 3-O-GlucB[a]P 442.87 120.16 < 0.0001 0.27 7-O-GlucB[a]P 548.88 164.18 < 0.0001 0.30 9-O-GlucB[a]P 142.84 41.26 < 0.0001 0.29 1-O-Glucpyrene 823.43 322.16 < 0.0001 0.39 Table 7. Rates of UGT1A9183Cys (wild-type) and UGT1A9183Gly (polymorphic) variant against all substrates before and after protein nor malization (WT: Wildtype and Poly: Polymorphic)

PAGE 95

84 1-hydroxy-pyrene (Fang et al., 2002). To dete rmine whether the change in amino acid sequence at codon 183 results in a change in UGT1A9 enzyme activity, glucuronidation assays were performed using equal amounts of total cell protein against each of the mentioned substrates (Figure 31). Levels of UGT enzyme activity were determined in three separate experiments by HPLC analysis and calculated both before and after normalization for cell homogenate of UGT1A9 pr otein levels as determined by Western blot analysis. Significant decreases in activity were observed for the UGT1A9183Gly variant prior to UGT protein normalization in assays usi ng 9-OH-BaP or BaP-7,8-diol (p<0.05) as substrate. After UGT protein normalization, si gnificant decreases in activity (p<0.0001) were observed for the UGT1A9183Gly variant in assays using all substrates (Table 7). Kinetic Analysis (Km and Vmax Study) The Km and Vmax for the glucuronidation of be nzo[a]pyrene-7,8-dihydrodiol, 7OHbenzo[a]pyrene, and 1-OH-pyrene were calcul ated after linear regression analysis of Lineweaver-Burk plots for both UGT1A9183Cys and UGT1A9183Gly variants (Figure 32, 33, and 34). The affinities and rates for each of the substrates as reflected by the apparent Km and Vmax were UGT1A9183Cys > UGT1A9183Gly as summarized in Table 8. Discussion This is the first study to func tionally characterize the UGT1A9183Gly polymorphic variant. The levels of UGT1A9 activity th at were determined by HPLC analysis and calculated after normalization for cell hom ogenate of UGT1A9 protein levels, as

PAGE 96

85 A (Homozygous wild-type) B (Homozygous polymorphic) Figure 32. Linear regressi on analysis of Lineweave r-Burk plots for both UGT1A9183Cys (A) and UGT1A9183Gly variants (B) using Benzo[a]pyr ene-7,8-dihydrodiol as substrate (done in triplicates using 1mM, 0.5 mM, 0.25 mM, 0.15 mM, and 0.05 mM of substrate) (Homozygous is defined as containing two copies of the same allele; V: Velocity and S: Substrate) y = 129.203x + 0.2053 R2 = 0.9891 0 0.8 1.6 2.4 3.2 0.0000 0.0050 0.0100 0.0150 0.0200 0.0250 1/[S] y = 31.316x + 0.1698 R2= 0.9928 0 0.2 0.4 0.6 0.8 1 0.0000 0.0050 0.0100 0.0150 0.0200 0.0250 1/[S] 1/[V] 1/[V]

PAGE 97

86 A (Homozygous wild-type) B (Homozygous polymorphic) Figure 33. Linear regressi on analysis of Lineweave r-Burk plots for both UGT1A9183Cys (A) and UGT1A9183Gly variants (B) using 7-OH-Benzo[ a]pyrene as substrate (done in triplicates using 0.25 mM, 0.1 mM, 0.05 mM, 0.025 mM, 0.01 mM, and 0.005 mM of substrate) (Homozygous is defined as containing two copies of the same allele; V: Velocity and S: Substrate) y = 0.6387x + 0.0065 R2= 0.993 0 0.03 0.06 0.09 0.12 0.15 0.18 0.0000 0.0500 0.1000 0.1500 0.2000 0.2500 1/[S] 1/[V] y = 0.3658x + 0.0058 R2= 0.9996 0 0.02 0.04 0.06 0.08 0.1 0.0000 0.0500 0.1000 0.1500 0.2000 0.2500 1/[S] 1/[V]

PAGE 98

87 A (Homozygous wild-type) B (Homozygous polymorphic) Figure 34. Linear regressi on analysis of Lineweave r-Burk plots for both UGT1A9183Cys (A) and UGT1A9183Gly variants (B) using 1-OH-pyrene as substrate (done in triplicates using 0.25 mM, 0.1 mM, 0.05 mM, 0.025 mM, 0.01 mM, and 0.005 mM of substrate) (Homozygous is defined as containing two copies of the same allele; V: Velocity and S: Substrate) y = 0.1239x + 0.0064 R2= 0.9919 0 0.006 0.012 0.018 0.024 0.03 0.036 0.0000 0.0500 0.1000 0.1500 0.2000 0.2500 1/[S] 1/[V] y = 0.0803x + 0.0061 R2= 0.9848 0 0.005 0.01 0.015 0.02 0.025 0.0000 0.0500 0.1000 0.1500 0.2000 0.2500 1/[S] 1/[V]

PAGE 99

88 Km values ( M) Substrate UGT1A9183Cys (wild-type) UGT1A9183Gly (polymorphic) Two-tailed p value ( = 0.05) BaP-7,8-diol 207.44 600.11 0.0012 7-OH-BaP 73.19 104.42 0.0798 1-OH-pyrene 14.0 17.81 0.1105 Vmax values Substrate UGT1A9183Cys (wild-type) UGT1A9183Gly (polymorphic) Two-tailed p value ( = 0.05) BaP-7,8-diol 6.00 4.28 0.0470 7-OH-BaP 183.87 157.40 0.1711 1-OH-pyrene 169.56 155.41 0.1842 Table 8. Affinities and rates for each of the substrates as reflected by the apparent Km and Vmax (all numbers in the table are calculate d using the average of three reactions)

PAGE 100

89 determined by Western blot analysis, show that the UGT1A9183Gly polymorphic variant exhibits a significantly lower enzyme activity (p < 0.0001) than the wild-type variant, UGT1A9183Cys, for all benzo[a]pyrene metabolites tested (BaP-7,8-dihydrodiol, 3-, 7-, and 9-OH-BaP, and 1-OH-pyrene) No activity was detected against NNAL in assays with the UGT1A9183Gly variant. These results are consistent with the Km and Vmax values calculated which show that the polymorphic variant, UGT1A9183Gly, has a higher Km value, which means lower affinity, for all substrates tested with the Km value for BaP-7,8-dihydrodiol being significantly higher for the UGT1A9183Gly variant. The Michaelis constant, Km, is associated with the affinity of enzyme for substrate; a larger Km means that the enzyme binds the substrate weakly. Thus, when the ra te of product formation is low, Km can be thought of as an inverse measure of substrat e binding strength. The results are also consistent with the Vmax values calculated which show that the polymorphic variant, UGT1A9183Gly, has a lower Vmax value, for all substrates tested with the Vmax value for BaP-7,8-dihydrodiol be ing significantly lower for the UGT1A9183Gly variant. The Vmax is defined as the maximal rate at which an en zyme catalyzes a reaction. It is expressed as the amount of product formed per minute. The Vmax is achieved when all the enzyme active sites are occupied with substrate mole cules. This condition is called substrate saturation. UGT1A9 has been shown to play an importa nt role in the phase II metabolism of procarcinogenic metabolites of benzo[a]pyrene (BaP), 4-(methylnitrosamino)-1-(3pyridyl)-1-butanone (NNK) and other carc inogens/carcinogen metabolites. As previously mentioned, Benzo[a]pyrene is a much-studied polycyclic aromatic

PAGE 101

90 hydrocarbon that exhibits high carcinogenicity in animals and is found widespread in the environment including in emission exhausts cigarette smoke, and char-broiled foods (Gelboin et al., 1980; IARC, Gene ral remarks 1983; Dipple et al ., 1990). In addition, the nicotine derived nitrosamine, NNK, is one of the most potent and abundant procarcinogens found in tobacco and tobacco smoke (Hecht et al., 1989; Hecht et al., 1998 ) Its levels in tobacco smoke are 315 times higher than that of benzo[a]pyrene (Adams et al., 1987). Therefore, the results of this study demonstrate that the UGT1A9 (Cys183Gly) polymorphism significantly a lters UGT1A9 function and co uld potentially play an important role as a risk modifier for digestive tract cancers.

PAGE 102

91 REFERENCES Adams J. D., O’Mara-Adams K. J., Hoffma nn D. Toxic and carcinogenic agents in undiluted mainstream smoke and sidestream smoke of different types of cigarettes. Carcinogenesis. 1987; 8 : 729-731. Adams R.L.P., Knowler J.T., and Leader D.P. The biochemistry of the nucleic acids. 1986; 10th ed. New York: Chapman and Hall. Agabian N. Trans splicing of nuclear pre-mRNA. Cell. 1990; 61 : 1157-60. Baldwin R.L. How does protein folding get started? Trends Biochem. Sci. 1989; 14 : 29194. Beaulieu M., Levesque E., Tchernof A., Beatty B.G., Belanger A., and Hum D.W. Chromosomal localization, structure, and re gulation of the UGT2B17 gene, encoding a C19 steroid metabolizing enzyme. DNA Cell Biol. 1997; 16 : 1143-1154. Beaulieu M., Levesque E., Hum D.W., and Belanger A. Isolat ion and characterization of a human orphan UDP-glucuronosyltransferase, UGT2B11 Biochem. Biophys. Res. Comm. 1998; 248 : 44-50. Belanger A., Hum D.W., Beaulieu M., Levesque E., Guillemette C., Tchernof A., Belanger G., Turgeon D., and Dubois S. Characterization and regulation of UDPglucuronosyltransferases in steroid target tissues. J. Steroid Biochem. Mol. Biol. 1998; 65 : 301-310. Belinsky S. A., Foley J. F., White C. M ., Anderson M. W., Maronpot R. R. Doseresponse relationship between O6-methylguanine formation in Clara cells and induction of pulmonary neoplasia in the rat by 4-(m ethylnitrosamino)-1-(3-pyridyl)-1-butanone. Cancer Res. 1990; 50 : 3772-3780. Benhamou S., Benhamou E., Flamant R. Lung cancer risk associated wi th cigar and pipe smoking. Int J Cancer. 1986; 37 : 825-829. Bernstein P., and Ross J. Poly(A), poly(A) binding proteins and the regulation of mRNA stability. Trends Biochem. Sci. 1989; 14 : 373-77. Borgen A., Davey H., Castagnoli N., Crocker T. T., Rasmussen R. E., and Wang I. Y. Metabolic conversion of benzo[a]pyrene by Sy rian hamster liver microsomes and binding of metabolites to deoxyribonucleic acid. J Mol. Chem. 1973; 16 : 502-506.

PAGE 103

92 Burbaum J.J., and Schimmel P. Structural relationships and the classification of aminoacyl-tRNA synthetases. J. Biolog. Chem. 1991; 266 : 16965-68. Carmella S. G., Akerkar S. A., Hecht S. S. Metabolites of the tobacco-specific nitrosamine 4-(methylnitrosamino)-1-(3-p yridyl)-1-butanone in smokers urine. Cancer Res. 1993; 53 : 721-724. Carmella S. G., Upadhyaya P., Hecht S. S. Analysis of N and O -glucuronides of 4(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL) in human urine. Chem. Res. Toxicol. 2002; 15 : 545-550. Carrier J.S., Turgeon D., Journault K., Hu m D.W., and Belanger A. Isolation and characterization of the hu man UGT2B7 gene. Biochem. Biophys. Res. Commun. 2000; 272: 616-621. Conaway J.W., and Conaway R.C. Initia tion of eukaryotic mRNA synthesis. J. Biolog. Chem. 1991; 266 : 17721-24. Creighton T.E. Protein folding pathways determined using disulfide bonds. Bioess. 1992; 14 : 195-99. Dahlberg A.E. The functional role of rRNA in protein synthesis. Cell. 1989; 57 : 525-29. Dickerson R.E. The DNA doubl e helix and how it’s read. Sci. Amer. 1983; 249 : 94-111. Dipple A., Cheng S. C., and Bigger C. A. Polycyclic aromatic hydrocarbon carcinogens. Prog. Clin. Biol. Res. 1990; 347 : 109-127. Elahi A., Zheng Z., Park J.Y., Eyring K., McCaffrey T., Lazarus P. The human oxoguanine glycosylase 1 (hOGG1) DNA repair enzyme and its association with orolaryngeal cancer risk. Carcinogenesis. 2002; 23 : 1229-1234. Fang J.L., Beland F.A., Doerge D.R. Charact erization of benzo[a]pyrene-7,8-dihydrodiol glucuronidation by human liver micros omes and over-expressed human UDPglucuronosyltransferase enzymes. Cancer Res. 2002; 62 : 1978-1986. Fox T.D. Natural variation in the genetic code. Ann. Rev. Genet. 1987; 21 : 67-91. Garte S., Gaspari L., Alexandrie A.K. Me tabolic gene polymorphism frequencies in control populations. Cancer Epidemiol Biomarkers Prev. 2002; 10 : 1239-1248. Gelboin, H. V. Benzo[a]pyrene metabolism, activation and carcinogenesis: role and regulation of mixed-function ox idases and related enzymes. Physiological Rev. 1980; 60 : 1107-1166.

PAGE 104

93 Gethway H.-J., and Sambrook J. Protein folding in the cell. Nature. 1992; 355 : 33-45. Green M.R. Biochemical mechanisms of constitutive and regulated pre-mRNA splicing. Ann. Rev. Cell Biol. 1991; 7 : 559-99. Gueraud F., and Paris A. Gluc uronidation: a dual control. Gen. Pharmacol. 1998; 31 : 683-688. Guthrie C., and Patterson B. Spliceosomal snRNAs. Ann. Rev. Genet. 1988; 22 : 387-419. Hecht S. S., Rivenson A., Braley J., DiBello J., Adams J. D., Hoffmann D. Induction of oral cavity tumors in F344 rats by to bacco-specific nitrosamines and snuff. Cancer Res. 1986; 46 : 4162-4166. Hecht S. S., Hoffmann D. The relevance of tobacco-specific nitrosamines to human cancer. Cancer Surv. 1989; 8 : 273-294. Hecht S. S., Trushin N., Reid-Quinn C. A., Bu rak E. S., Jones A. B., Southers J. L., Gombar C. T., Carmella S. G., Anderson L. M., Rice J. M. Metabolism of the tobaccospecific nitrosamine 4-(methylnitrosamino )-1-(3-pyridyl)-1-buta none in the Patas monkey: pharmacokinetics and character ization of glucuronide metabolites. Carcinogenesis 1993; 14 : 229-236. Hecht S. S. Biochemistry, biology, and carcinogenicity of tobacco-specific nitrosamines. Chem. Res. Toxicol. 1998; 11 : 559-603. Hecht S. S., Carmella S. G., Chen M., Koch J. F. D., Miller A. T., Murphy S. E., Jensen J. A., Zimmerman C. L., Hatsukami D. K. Quantitation of urinary metabolites of a tobacco-specific lung carci nogen after smoking cessation. Cancer Res. 1999; 59 : 590596. Holthe M., Rakvag T.N., Klepstad P., Idle J. R., Kaasa S., Krokan H.E., and Skorpen F. Sequence variations in the UDP-glucur onosyltransferase 2B7 (UGT2B7) gene: identification of 10 novel single nucleotide polymorphisms (SNP s) and analysis of their relevance to morphine glucur onidation in cancer patients. Pharmacogenetics J. 2003; 3 : 17-26. Huang C.S., Luo G.A., Hwang M.C., Yu S.C ., Yang S.S. Variation of the bilirubin uridine-diphosphogluguronosyltr ansferase 1A gene in healthy Taiwanese. Pharmacogenetics. 2000; 10 : 539-544. Huberman E., Sachs L., Yang S. K., and Ge lboin H. V. Identification of mutagenic metabolites of benzo[a]pyrene in mamma lian cells. Proc. Natl. Acad. Sci. 1976; 73 : 607611.

PAGE 105

94 Jackson D.A. Structure-function rela tionships in eukaryotic nuclei. Bioess. 1991; 13 : 110. Jin C.J., Miners J.O., Lillywhite K.J., a nd Mackenzie P.I. cDNA cloning and expression of two new members of the human liver UDP-glucuronosyltransferase 2B subfamily. Biochem. Biophys. Res. Commun. 1993; 194 : 496-503. IARC Monographs on the Evaluation of the Ca rcinogenic Risk of Chemicals to Humans. Polynuclear Aromatic Compounds Part 1, Chemical, Environmental, and Experimental Data. General Remarks. 1983; 32 : 33-91. Lagerkrist U. Unconventional methods in codon reading. Bioess. 1987; 4 : 223-26. Lebowitz J. Through the looking glass: the discovery of supercoiled DNA. Trends Biochem. Sci. 1990; 15 : 202-7. Maniatis T. Mechanisms of alternative pre-mRNA splicing. Science. 1991; 251 : 33-34. Manley J.L. Polyadenylation of mRNA precursors. Biochim. Biophys. Acta. 1988; 950 : 112. Marmelstein F.H., Flores O., and Reinberg D. Initiation of transcription by RNA polymerase II. Biochim. Biophys. Acta. 1989; 1009 : 1-10. Merrick W.C. Mechanism and regulation of eukaryotic protein synthesis. Microbial Rev. 1992; 56 ; 291-315. Mlot C. On the trail of tRNA identity. Biosci. 1989; 39 : 756-59. Morse M. A., Eklind K. I., Toussaint M., Amin S. G., Chung F. L. Characterization of a glucuronide metabolite of 4-(methylnitrosam ino)-1-(3-pyridyl)-1-butone (NNK) and its dose-dependent excretion in the urine of mice and rats. Carcinogenesis. 1990; 11 : 18191823. National Center for Biotechnology Informati on. GenBank [database online]. Available from URL: http://www.ncbi.nlm.nih.gov/Genbank/index.html [accessed November 2002]. National Institutes of Health, National Human Genom e Research Institute (NHGRI). Amino Acid. (n.d.). Available from: http://www.accessexcellence.org/AB/GG/aminoAcid.html [accessed June 2004]. National Institutes of Health, National Human Genom e Research Institute (NHGRI). DNA. (n.d.). Available from: http://www.accessexcellence.org/AB/GG/dna.html [accessed June 2004].

PAGE 106

95 National Institutes of Health, National Human Genom e Research Institute (NHGRI). The Genetic Code. (n.d.). Available from: http://www.accessexcellence .org/AB/GG/genetic.html [accessed June 2004]. National Institutes of Health, National Human Genom e Research Institute (NHGRI). mRNA. (n.d.). Available from: http://www.accessexcellence.org/AB/GG/mRNA.html [accessed June 2004]. National Institutes of Health, National Human Genom e Research Institute (NHGRI). Nucleotide. (n.d.). Available from: http://www.accessexcellence .org/AB/GG/nucleotide2.html [accessed June 2004]. National Institutes of Health, National Human Genom e Research Institute (NHGRI). RNA synthesis and processing. (n.d.). Available from: http://www.accessexcellence .org/AB/GG/rna_synth.html [accessed June 2004]. Neurat H. Proteolytic proce ssing and physiological regulation. Trends Biochem. Sci. 1989; 14 : 268-71. Newbold, R. F. and Brookes, P. Exceptional mutagenicity of a benzo[a]pyrene diol epoxide in cultured mammalian cells. Nature. 1976; 261 : 52-54. Noller H.F. Ribosomal RNA and translation. Ann. Rev. Biochem. 1991; 60 : 191-227. Owens I.S., Ritter J.K. Gene structure at the human UGT1 locus creates diversity in isozyme structure, substrate specificity, and regulation. Prog Nucleic Acid Res Mol Biol. 1995; 51 : 305-338. Park J.Y., Muscat J., Schantz S., Stern J. C., Lazarus P. Association between GSTM polymorphisms and risk for oral cancer in Afri can Americans as compared to Caucasians. Pharmacogenetics. 2000; 10 : 123-131. Patthy L. Exons – original bui lding blocks of proteins? Bioess. 1991; 13 : 187-92. Ren Q., Murphy S.E., Zheng Z., Lazarus P. O-Glucuronidation of the lung carcinogen 4(methylnitrosamino)-1-(3-pyridyl )-1-butanol (NNAL) by human UDPglucuronosyltransferases 2B7 and 1A9. Drug Metab Dispos. 2000; 28 : 1352-1360. Rich A., Nordheim A., and Wang A.H.-J. Th e chemistry and biology of left-handed ZDNA. Ann. Rev. Biochem. 1984; 53 : 791-846. Richie J.P. Jr., Carmella S.G., Muscat J.E., Scott D.G., Akerkar S.A., Hecht S.S. Differences in the urinary metabolites of the tobacco-speci fic lung carcinogen 4(methylnitrosamino)-1-(3-pyridyl)-1-buta none (NNK) in black and white smokers. Cancer Epidemiol Biomarkers Prev. 1997; 6 : 783-790.

PAGE 107

96 Rivenson A., Hoffmann D., Prokopczyk B., Amin S., Hecht S. S. Induction of lung and exocrine pancreas tumors in F344 rats by tobacco-specific and areca-derived N nitrosamines. Cancer Res. 1988; 48 : 6912-6917. Shapiro M.B., and Senapathy P. RNA splice junc tions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 1987; 15 : 7155-74. Simpson L. RNA editing – a novel genetic phenomenon? Science. 1990; 250 : 512-13. Slaga, T. J., Biaje, A., D. L., and Bracken, W. M. Identification of mutagenic metabolites of benzo[a]pyrene 4,5-, 7,8-, and 7,8-diol-9,10-epoxide and 7,8-diol. Cancer Lett. 1976; 2 : 115-122. Strassburg C.P., Manns M.P., Tukey R.H. Expression of the UDPglucuronosyltransferase 1A locu s in human colon. Identificat ion and characterization of the novel extrahepatic UGT1A8. J Biol Chem. 1998; 273 : 8719-8726. Strassburg C.P., Nguyen N., Manns M.P., T ukey R.H. Polymorphic expression of the UDP-glucuronosyltransferase UGT1A gene locus in human ga stric epithelium. Mol Pharmacol. 1998; 54 : 647-654. Strassburg C.P., Strassburg A., Nguyen N., Li Q., Manns M.P., Tukey R.H. Regulation and function of family 1 and family 2 UDP-glucuronosyltransferase genes (UGT1A, UGT2B) in human oesophagus. Biochem J. 1999; 338 : 489-498. Strassburg C.P., Kneip S., Topp J. Polymor phic gene regulation and interindividual variation of UDP-glucuronosyltransferas e activity in human small intestine. J Biol Chem. 2000; 275 : 36164-36171. Travers A.A. DNA conformation and protein binding. Ann. Rev. Biochem. 1989; 58 : 42752. Tephly T.R., and Burchell B. UDP-glucuronos yltransferases: a family of detoxifying enzymes. Trends Pharmacol. Sci. 1990; 11 : 276-279. Tukey R.H. and Strassburg C.P. Human UDP -glucuronosyltransferases: Metabolism, expression, and disease. Annual Rev. Pharmacol. Toxicol. 2000; 40 : 581-616. Tukey, R. H. and Strassburg, C. P. Genetic multiplicity of the human UDPglucuronosyltransferases and regulati on in the gastroin testinal tract. Mol. Pharmacol. 2001; 59 : 405-414. Wahle E. The end of the message: 3’-e nd processing leading to polyadenylated messenger RNA. Bioess. 1992; 14 : 113-18.

PAGE 108

97 Wickens M. How the message got its tai l: addition of Poly(A) in the nucleus. Trends Biochem. Sci. 1990; 15 : 277-81. Wiener D., Fang J-L., Doerge D., Updha yala P., Tephly T., Lazarus P. UDPglucuronosyltransferase 1A4: N -glucuronidation of the lung carcinogen 4(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL). Drug Metab. Disp. 2004; 32 : 7279. Williams R.T. Detoxification mech anisms, 2d ed. New York: Wiley, 1971 Yan S.C.B., Grinnell B.W., a nd Wold F. Post-translational modifications of proteins: some problems left to solve. Trends Biochem. Sci. 1989; 14 : 264-68. Yang S.K., McCourt D.W., Leutz J.C., and Gelboin H.V. Benzo[a]pyrene diol-epoxides I: mechanisms of enzymatic formati on and optical active intermediates. Science. 1977; 196 : 1199-1201. Zheng Z., Fang J.L., Lazarus P. Glucuronidation: an important mechanism for detoxification of benzo[a]pyrene metabol ites in aerodigestive tract tissues. Drug Metab Dispos. 2002; 30 : 397-403.

PAGE 109

98 ABOUT THE AUTHOR Jean Bendaly received a B.S. degree in Biology (1994) and a M.S. degree in Biomedical Engineering (1999) from the Univers ity of South Florida. His thesis project explored the use of a new biomedical polym er, known as Vivathane, in the development of prosthetic devices. He was a Ph.D. student in the College of Public Health at the University of South Florida from 2000-2004 a nd received a Ph.D. in Toxicology from the University of South Florida, College of Public Health on August the 7th, 2004. Mr. Bendaly did his Ph.D. research in the Divisi on of Cancer Control and Prevention at H. Lee Moffitt Cancer Center and Research Institute in Tampa, Florida.