USF Libraries
USF Digital Collections

Pacap and vip modulation of neuroexcitability in rat intracardiac neurons

MISSING IMAGE

Material Information

Title:
Pacap and vip modulation of neuroexcitability in rat intracardiac neurons
Physical Description:
Book
Language:
English
Creator:
DeHaven, Wayne I
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
Intracardiac ganglia
Pacap
Vip
Vpac2
Pac1
Calcium
Dissertations, Academic -- Pharmacology and Therapeutics -- Doctoral -- USF   ( lcsh )
Genre:
government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Autonomic control of cardiac function depends on the coordinated activity generated by neurons within the intracardiac ganglia, and intrinsic feedback loops within the ganglia provide precise control of cardiac function. Both pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP) are important regulators of cell-to-cell signaling within the intracardiac ganglia, and PACAP and VIP action on these ganglia, mediated through associated receptors, play an important role in the regulation of coronary blood flow, cardiac contraction, relaxation, and heart rate. Results reported here using PACAP and VIP provide direct evidence of some of the complex signaling which occurs in neurons of the rat intracardiac ganglia.
Thesis:
Thesis (Ph.D.)--University of South Florida, 2005.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Wayne I. DeHaven.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 205 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001681075
oclc - 62745557
usfldc doi - E14-SFE0001042
usfldc handle - e14.1042
System ID:
SFS0025363:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001681075
003 fts
005 20060215071214.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 051227s2005 flu sbm s000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001042
035
(OCoLC)62745557
SFE0001042
040
FHM
c FHM
049
FHMM
090
RM101 (Online)
1 100
DeHaven, Wayne I.
0 245
Pacap and vip modulation of neuroexcitability in rat intracardiac neurons
h [electronic resource] /
by Wayne I. DeHaven.
260
[Tampa, Fla.] :
b University of South Florida,
2005.
502
Thesis (Ph.D.)--University of South Florida, 2005.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 205 pages.
Includes vita.
3 520
ABSTRACT: Autonomic control of cardiac function depends on the coordinated activity generated by neurons within the intracardiac ganglia, and intrinsic feedback loops within the ganglia provide precise control of cardiac function. Both pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP) are important regulators of cell-to-cell signaling within the intracardiac ganglia, and PACAP and VIP action on these ganglia, mediated through associated receptors, play an important role in the regulation of coronary blood flow, cardiac contraction, relaxation, and heart rate. Results reported here using PACAP and VIP provide direct evidence of some of the complex signaling which occurs in neurons of the rat intracardiac ganglia.
590
Adviser: Javier Cuevas.
653
Intracardiac ganglia.
Pacap.
Vip.
Vpac2.
Pac1.
Calcium.
690
Dissertations, Academic
z USF
x Pharmacology and Therapeutics
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1042



PAGE 1

PACAP and VIP Modulation of Neuroexcitability in Rat Intracardiac Neurons by Wayne I. DeHaven A dissertation submitted in partial fulfillment of the requirement s for the degree of Doctor of Philosophy Department of Pharmacology and Therapeutics College of Medicine University of South Florida Major Professor: Javier Cuevas, Ph.D. David Morgan, Ph.D. Paul E. Gottschall, Ph.D. Eric S. Bennett, Ph.D. Keith R. Pennypacker, Ph.D. Date of Approval: February 22, 2005 Keywords: Intracardiac ganglia, PACAP, VIP, VPAC2, PAC1, Calcium Copyright 2005, Wayne I. DeHaven

PAGE 2

ACKNOWLEDGEMENTS This dissertation would not have been completed without the love and support from my family. I would like to gi ve special thanks to my wife, Courtney, for always supporting me in my scientific career, and reminding me of life outside of the laboratory. I woul d like to thank my daughter, Eve, for always putting a smile on my face. I would like to thank Mom and Dad for giving me the opportunity to succeed. I would also lik e to thank my in-laws, Tom and Dennie Masterson, for always lend ing a helping hand. I would like to thank my mentor, Dr Javier Cuevas, for giving me the appropriate environment to gr ow as a scientist. I would also like to thank Hongling Zhang for her scientific hel p and knowledge, and Crystal Reed and Yolmari Cruz for maintaining the laborat ory, and for putting up with sports radio all of the time. I would like to thank my external reviewer, Dr. Rodney L. Parsons, for taking the time to chair my dissertation committee. Finally, I would like to thank the other mem bers of my committee: Drs. David Morgan, Paul E. Gottschall, Eric S. Bennett and Keith R. Pennypacker for their excellent scientific advice.

PAGE 3

i TABLE OF CONTENTS List of Tables …………………………………………………………………… v List of Figures …………………………………………………………………. vi Abstract ………………………………………………………………………….. xi Chapter 1 Background and Si gnificance ………………………………….. 1 Mammalian Intracardiac Ganglia ……………………………………… 1 PACAP and VIP effects on the Heart ………………………………….4 PACAP and VIP receptors ……………………………………………...6 PACAP and VIP relevance to cardiac function ………………………. 7 Chapter 2 Heterogeneity of PACAP and VIP receptors in rat intrinsic cardiac neurons …………………………………………………. 12 Introduction ……………………………………………………………… 12 Methods ………………………………………………………………….. 15 Cell culture ………………………………………………………… 15 RT-PCR ……………………………………………………………. 16 Cytoplasm harvest of indi vidual neurons ………………………. 17

PAGE 4

ii Results …………………………………………………………………… 18 PAC1 receptor mRNA isoforms detect ed in cardiac tissue …... 18 PAC1 mRNA expression in isolated rat intracardiac neurons … 19 VPAC1 and VPAC2 receptor transcripts detected in cardiac tissue ……………………………………………………………….. 20 VPAC mRNA expression in isolated ra t intracardiac neurons .. 21 Individual intracardiac neuron expression pattern of PAC1 and VPAC mRNA ………………………………………………………. 22 Discussion ……………………………………………………………….. 31 Chapter 3 VPAC receptor modulation of neuroexcitability in intracardiac neurons: dependence on intracellular Ca2+ mobilization and synergistic enhancement by PAC1 receptor activation ……… 33 Introduction ……………………………………………………………….33 Methods ………………………………………………………………….. 37 Microfluorometric measurements ……………………………….. 37 Electrophysiology …………………………………………………. 38 Reagents and statistical analysis ……………………………….. 40 Results …………………………………………………………………… 41 PACAP and VIP direct ly increase free [Ca2+]i …………………... 41 Increases in free [Ca2+]i evoked by PACAP and VIP are mediated by a VPAC receptor …………………………………... 42 PACAP and VIP mobilize Ca2+ from intracellular stores and evoke Ca2+ entry through the plasma membrane ……………... 44 PACAP induces mobilization of [Ca2+]i from caffeineand ryanodine-sensitive stores ……………………………………….. 46 PACAP and VIP Induced Excitabi lity in Rat Intracardiac Neurons ……………………………………………………………. 49

PAGE 5

iii Increases in neuroexcitability evoked by PACAP and VIP are in part mediated by a VPAC receptor ……………………………… 52 Effects of Ca2+-free extracellular conditions on PACAP-induced intracardiac neuroexcitability …………………………………….. 54 Effects of Ryanodine on PAC AP-induced intracardiac neuroexcitability …………………………………………………… 56 Discussion ……………………………………………………………….. 80 Chapter 4 Repetitive VPAC2 receptor-mediated calcium elevations in intracardiac neurons is dependent on Ca2+, cADPR and storeoperated calcium (SOC) entry …………………………………. 87 Introduction ……………………………………………………………….87 Methods ………………………………………………………………….. 92 Cell culture ………………………………………………………….92 Microfluorometric measurements ……………………………….. 92 Reagents and statistical analysis ……………………………….. 93 Results …………………………………………………………………… 95 VPAC2 receptors mediate PACAP-induced elevations in free [Ca2+]i. ……………………………………………………………….. 95 Forskolin does not increase [Ca2+]i in intracardiac neurons ….. 96 Role for cADP-ribose in the PACAP-elicited signal transduction cascade ……………………………………………………………..96 Effects of menthol and capsaicin on [Ca2+]i ……………………...98 La3+ blocks VPAC2 mediated Ca2+ elevations and TRPC channels in intracardiac neurons ………………………………... 99 PACAP evoked Ca2+ influx through store-operated channels (SOC) ………………………………………………………………. 101

PAGE 6

iv The SOC channel component of the PACAP-induced Ca2+ response is blocked by 2-APB …………………………………... 103 2-APB blocks VPAC2 receptor mediated repetitive Ca2+ responses ………………………………………………………….. 104 Discussion ……………………………………………………………….. 125 Chapter 5 Canonical transient re ceptor potential (TRPC) channels regulate neuroexcitability in rat intracardiac neurons ……….. 132 Introduction ……………………………………………………………….132 Methods ………………………………………………………………….. 135 Electrophysiology …………………………………………………. 135 Reagents and statistical analysis ……………………………….. 136 Results …………………………………………………………………… 138 2-APB decreases action potential (AP) firing in rat intracardiac neurons …………………………………………………………….. 138 2-APB evoked changes in the single action potential waveform.. 139 Membrane currents underlying the 2-APB-elicited changes in action potential properties ……………………………………….. 141 Discussion ……………………………………………………………….. 151 Chapter 6 Summary …………………………………………………………. 155 Conclusion ……………………………………………………….. 167 Works Cited ……………………………………………………………………... 170 About the author ………………………………………………………… End Page

PAGE 7

v LIST OF TABLES Table 2.1 Sequences of oligonuc leotide primers to detect PAC1 isoforms, as well as VPAC receptor transcripts in rat intracardiac neurons ………………………………………... 25 Table 3.1 Effects of extracellular Ca2+ conditions and various inhibitors on the PACAP-induced changes in neuroexcitability in response to a 150 pA current pulse ...79

PAGE 8

vi LIST OF FIGURES Figure 1.1 Schematic r epresentation of the connectivity among various neurons involved in maintaining cardiac homeostasis ……... 9 Figure 1.2 Morphologically distinct intrinsic cardiac neurons identified in vitro …………………………………………………………........ 10 Figure 1.3 Schematic r epresentation of the tw o neuropeptides, PACAP and VIP, binding to their asso ciated G-protein coupled PAC1, VPAC1 and VPAC2 receptors ……………………………..…... 11 Figure 2.1 Expression of PAC1 receptor isoforms in cardiac tissue ……. 26 Figure 2.2 Detection of PAC1 receptor isoforms in single intracardiac neurons ……………………………………………………..….... 27 Figure 2.3 Expression of VPAC1 and VPAC2 receptor isoforms in cardiac tissue ………………………………………………………….….. 28 Figure 2.4 Detection of VPAC receptor transcripts in single intracardiac neurons ……………………………………………………..….... 29 Figure 2.5 Expression pattern of PAC1 isoforms and VPAC transcripts in intracardiac neurons ………………………………………...…..30

PAGE 9

vii Figure 3.1 PACAP and VIP, but not maxadilan, reversibly increase [Ca2+]i in rat intracardiac neurons …………………………………...... 59 Figure 3.2 PACAP-induced mobilization of [Ca2+]i in intracardiac neurons is via VPAC receptor activation ………………………..…….... 61 Figure 3.3 The transient, but not t he sustained, component of the PACAP-induced increase in [Ca2+]i is dependent on extracellular Ca2+ …………………………………...…………... 63 Figure 3.4 PACAP evokes a rapid transient elevation of [Ca2+]i in intracardiac neurons by releasing Ca2+ from caffeine/ryanodine-sensitive inte rnal stores ………...……….. 65 Figure 3.5 The sustained, but not the transient, component of the PACAP-induced increase in [Ca2+]i is blocked by 2-APB …... 67 Figure 3.6 PACAP increases neuroexcitabi lity in neonatal rat intracardiac neurons ………………………………………………………….. 69 Figure 3.7 VIP-induced changes in neur oexcitability within neonatal rat intracardiac neurons ………………………………………...….. 71

PAGE 10

viii Figure 3.8 PACAP-evoked changes in in tracardiac neuroexcitability are inhibited by the VPAC antagonist [N-Ac-Tyr1, D-Phe2]-GRF (1-29) …………………………………………………………... 73 Figure 3.9 PACAP-induced changes in intracardiac neuroexcitability are blocked by the removal of extracellular Ca2+ and depletion of internal stores …………………………………... 75 Figure 3.10 PACAP-induced changes in intracardiac neuron excitability are blocked by ryanodine …………………………………….. 77 Figure 4.1 PACAP-evoked mobilization of [Ca2+]i in rat intracardiac neurons is via VPAC2 receptor activation ………………….. 108 Figure 4.2 Forskolin does not increas e free cytosolic calcium concentrations in rat intracardiac neurons …………………. 110 Figure 4.3 The putative ryanodine receptor activator, cADP ribose, is involved in the PACAP-elicited signal transduction cascade.. 112 Figure 4.4 Neither menthol nor capsaicin increase free intracellular Ca2+ concentrations in isolated rat intracardiac neurons …. 114

PAGE 11

ix Figure 4.5 La3+ blocks VPAC2 mediated Ca2+ elevations in intracardiac neurons and the sustained comp onent of the caffeineand muscarine-induced increase in [Ca2+]i …………………….... 116 Figure 4.6 The TRPC agonist, 1-oleoyl-2-acetyl-sn-glycerol (OAG), does not increase [Ca2+]i in neonatal rat intracardiac neurons ……………………………………………………….... 118 Figure 4.7 Internal store depletion by PACAP or caffeine activates store-operated Ca2+ (SOC) entry in intracardiac neurons ... 120 Figure 4.8 SOC channel activation by PACAP is inhibited by 2-APB .. 122 Figure 4.9 Repetitive elevations of [Ca2+]i mediated by VPAC2 receptor activations are blocked by 2-APB …………………………... 124 Figure 5.1 2-APB effects on action potential firing in isolated intrinsic cardiac neurons ……………………………………………….. 144 Figure 5.2 The effects of 2-APB on the single action potential waveform parameters …………………………………………………….. 146 Figure 5.3 Effects of the Ca2+-activated K+ inhibitors TEA, paxilline and apamin, and the Ca2+ channel blocker Cd2+ on the action potential and afterhyperpolarization ………………………… 148

PAGE 12

x Figure 5.4 Inhibition of peak K+ channel currents in rat intracardiac neurons by the TRP channel antagonist, 2-APB ………….. 150 Figure 6.1 Schematic representation of the expression pattern of PAC1 receptor isoforms and VPAC transcripts in individual intracardiac neurons ………………………………………….. 164 Figure 6.2 Schematic diagram showing the effects of PACAP and VIP on intracardiac neurons ……………………………………….166

PAGE 13

xi PACAP and VIP Modulation of Neuroexcitability in Rat Intracardiac Neurons Wayne I. DeHaven ABSTRACT Autonomic control of cardiac func tion depends on the coordinated activity generated by neurons within the intrac ardiac ganglia, and intrinsic feedback loops within the ganglia provide precise cont rol of cardiac function. Both pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP) are impor tant regulators of cell-to -cell signaling within the intracardiac ganglia, and PACAP and VIP action on these ganglia, mediated through associated receptors, play an import ant role in the regulation of coronary blood flow, cardiac contraction, relaxati on, and heart rate. Results reported here using PACAP and VIP provide direct eviden ce of some of t he complex signaling which occurs in neurons of the rat intracardiac ganglia. The expression of PACAP and VIP re ceptors was investigated using single-cell RT-PCR. Individual neurons were shown to express multiple isoforms of the PACAP-selective receptor, PAC1, including the short -HOP1 and -HOP2 variants. These splice variants affect ligand binding, G-protein coupling and

PAGE 14

xii selectivity. Intracardiac neurons also express the non-selective receptors, VPAC1 and VPAC2, with VPAC2 being found in greater pr oportion of cells. These results demonstrate heterogeneity of PAC1 and VPAC receptors expressed in intracardiac neurons, which has significant implications on the effects of PACAP and VIP on cellular function. Calcium imaging and electrophysiol ogy were used to examine the physiological effects of PACAP and VIP on isolated intracardiac neurons. Both neuropeptides, through the activation of VPAC2 receptors, evoked rapid increases in cytosolic calcium concentrations ([Ca2+]i) that exhibited both transient and sustained co mponents. The transient increases in [Ca2+]i were mediated through the activation of ryanodine receptors, whereas the sustained [Ca2+]i elevations were dependent on extracellular Ca2+ and pharmacologically resembled canonical transient receptor potential (TRPC) channels. PACAP and VIP also depolarized intracardiac neurons, and PACAP was further shown to augment action potential fi ring in these cells. The depolarization was dependent on activation of VPAC2 receptors and the concomitant increases in [Ca2+]i, while PAC1 receptor stimulati on potentiated the VPAC2 receptorinduced depolarizations. Pharmacolo gical evidence suggest TRPC channels mediate this link between neuropeptide evoked changes in membrane properties and [Ca2+]i. Thus, these results give insi ght into the complex PACAP and VIP signaling which occurs in the intracardiac ganglia.

PAGE 15

1 CHAPTER 1 BACKGROUND AND SIGNIFICANCE Mammalian Intracardiac Ganglia Parasympathetic influences on cardiac function are mediated through the vagus nerve (CN X), and stimulation of th is nerve results in multiple cardiac effects, including bradycardia, atriov entricular (AV) block, and reduced myocardial contractility. Intracardi ac ganglia form the final pathway for autonomic modulation of cardiac functi on, and in the classical view of parasympathetic innervation of the heart, in tracardiac neurons are considered exclusively postganglionic e fferent neurons. However, an increasing body of data has supported the hypothesis that neur ons within the intracardiac ganglia do not serve as simple relays between t he central nervous system (CNS) and heart (Gray et al., 2004); but, instead, indivi dual cardiac ganglia serve as complex integrative centers within which processing of autonomic signals can occur. These data have resulted in the proposal of the organization of the intrinsic cardiac nervous system which includes parasympathetic efferent neurons, sensory afferent neurons, intragangli onic and interganglionic neurons,

PAGE 16

2 sympathetic neurons, as well as the terminal s of cardiac neurons projecting from higher centers (Gray et al., 2004; Arde ll, 1994; Armour, 1994) (Fig 1.1). Mammalian intracardiac ganglia are anatomically located in various fat pads associated with the heart, and eac h distinct cluster of neurons predominantly innervates different regions of the heart. For example, the sinoatrial (SA) ganglion, located in a fat pad near the junction of the right atrium and the superior vena cava, mediates a negative chronotropic effect (King and Coakley, 1958; Gatti et al., 1995; Massari et al., 1996; Massari et al., 1994). Similarly, the atrioventricular (AV) ganglion, found in a fat pad between the left atrium and the inferior v ena cava, potently reduces the AV conduction rate (Gatti et al., 1995; Massari et al., 1995; Massari et al., 1996). The cranioventricular (CV) ganglion, located at t he cranial margin of the le ft ventricle, has been found to contain neurons that selectively medi ate negative inotropic effects on the left ventricle, without influencing cardiac rate or AV conduction (Dickerson et al., 1998; Gatti et al., 1997). In additi on, there are numerous ganglia found throughout the heart for which no functiona l roles have been described (Ardell, 1994; Armour, 1994; Calaresu et al 1967; Johnson et al., 2004). Morphologically, at least three distin ct functional types of neurons exist within these intrinsic cardiac ganglia. The first group of neurons is the parasympathetic efferent postganglionic neurons (Jacobowitz et al, 1967, Xi-Moy et al, 1993), innervating the coronary vasculatu re, cardiac myocytes, SA and AV nodes. The second group of neurons is interneurons (Jacobowitz et al, 1967;

PAGE 17

3 Armour and Hopkins, 1990; Randall and Wu rster, 1994), which regulate the other neurons of the ganglia. T he third group of neurons is the small intensely fluorescent cells (SIF cells), so named based on their high glyoxylate fluorescence indicative of catecholami nes (Seabrook et al., 1990). SIF cells do not have processes; rather, SIF cells ar e small oval shaped cells which may have paracrine function. Previous morphol ogical studies describe principle parasympathetic neurons as being monopolar or multipolar with long axons, whereas interneurons display a dipolar or pseudodipolar arrangement (Edwards et al, 1995). The axons of the inter neurons appear to be shorter, with small branches that terminate near other ganglion cells. Intracardiac neurons are also morphologically differentiated on the basis of soma diameter with interneurons > principle parasympathetic neur ons >> SIF cells (Edwards et al., 1995; Allen and Burnstock, 1990; Seabrook et al., 1990). In our is olated neuron preparation we are able to identify various neuron ty pes, including unipolar, bipolar and multipolar neurons that correspond well to observations in intrinsic cardiac neurons in situ (Edwards et al., 1995) (Fig 1.2) Though some of the neuroanat omical and functional characteristics of these intracardiac neurons ar e identified, little is known about how neural activity is generated and coordinated within the in trinsic cardiac nervous system. Along with the structural complexity of t he intracardiac ganglia, a neurochemical complexity exists which allows for a wide range of responses and ultimately maintains cardiac homeostasis. Alt hough acetylcholine is the primary

PAGE 18

4 neurotransmitter in the mammalian heart, an expanded view of intracardiac neurotransmission has evolved to include in stances where substances other than acetylcholine are localized and releas ed and function as cotransmitters, neuromodulators, or primary neurotransmitters themselves (Rubino et al, 1996). Two such neurotransmitters with potent cardiovascular effects are pituitary adenylate-cyclase activating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP). PACAP and VIP effects on the Heart PACAP and VIP are pleiotropic n europeptides that belong to the secretin/glucagon/growth hormone-releasing factor family of peptides (Warren et al, 1991; Ishizuka et al, 1992; Basler et al 1995; Champion et al, 1996; Cardell et al, 1997). These neuropeptides have a broad spectrum of effects in both the central nervous system (CNS) and peripher al nervous system (PNS), including the autonomic nervous system (Vaudry et al., 2000; Arimura, 1998). For example, in the CNS, PACAP is involved in oxytocin and vasopressin release (Murase et al., 1993; Seki et al., 1995), rhythmicity of melatonin production in the pineal gland (Fukuhara et al., 1998), control of appetite and feeding behavior (Christophe, 1998), inhibition of cell deat h and promotion of neurite outgrowth during ontogenesis (Gonzalez et al., 1997; Cavallaro et al., 1996), synaptic plasticity and learning in mice (Hashimoto et al., 2002) and mobilization of Ca2+ in astroglial cells (Tatsuno and Arimur a, 1994). In the PNS, PACAP and VIP

PAGE 19

5 appear to play a major role in the aut onomic regulation of the cardiovascular system, and the neuropeptides have been i mmunocytochemically identified in nerve fibers and cell bodies within t he heart, coronary vessels and cardiac parasympathetic ganglia (Della et al., 1983; Weihe et al., 1984; Seabrook et al., 1990; Gulbenkian et al., 1993; Braas et al., 1998; Horackova et al., 2000). PACAP and VIP are extremely effect ive in dilating vascular beds, including the coronary vessels that s upply the heart (Fahrenkrug, 1993; Nillson, 1994). The vasodilatory effects of VIP on arteries are much greater than those on veins because of the greater density of VIP receptors in arterial vessels (Luu et al, 1993). Low concentrations of VIP can increase epicardial coronary artery cross-sectional area by 27%, decrease coronary vascular resistance by 46%, and increase coronary artery blood flow by 200% (Brum et al, 1986; Popma et al, 1990). PACAP has similar effects on coronary vasculature, except PACAP is more efficacious than VIP as a vasodi lator (Nillson, 1994). PACAP has also been shown to modulate neuronal activity in canine intrinsic cardiac neurons in situ and alter heart rate (Armour et al, 1993). These in situ experiments on canine neurons suggest that not only do these neuropeptides enhance neuronal activity, but also in some neurons, PAC AP and VIP stimulation actually depress neuronal activity. These neuropeptides have also been shown to increase sinus rate and cardiac output (Karasawa et al, 1990; Poth et al, 1997; Sreedharan et al, 1995), to initiate positive inotropi c effects (Franco-Cereceda et al, 1987; Henning et al, 2000), and to increase card iac contractility (Henning, 1992). It is

PAGE 20

6 our theory that this variability in re sponse is the result of heterogeneity of VIP/PACAP receptors in in tracardiac ganglia. PACAP and VIP receptors The cellular effects of PACAP and VIP are mediated through G-protein coupled receptors, and two main cl asses of PACAP and VIP receptors have been categorized based on binding and in vitro functional data (Christophe, 1993; Shivers et al, 1991). The PAC1 receptors bind PACAP-27 and PACAP-38 with equal high affinity, but VIP with much lower affinity (Gourle t et al, 1995) (Fig 1.3). Thus, PAC1 receptors are known as PACA P-selective receptors. VIP (VPAC1 and VPAC2) receptors recognize PACAP-27, PACAP-38 and VIP with similar high affinity, and these are know n as the non-selective VIP receptors. At least seven isoforms of the PAC1 receptor exist due to alternative splicing of the mRNA (PAC1short, very short -HIP, -HOP1, -H OP2, -HIPHOP, and TM4). Based on cloning ex periments, the two majo r forms in mammals are the normal ( short ) PACAP receptor and the -HOP1 PACAP receptor, which contains a cassette insert in the th ird cytoplasmic loop (Spengler et al, 1993; Svoboda, 1993). The original VPAC receptor was cloned from rat lung (Isihara et al, 1992) and from human colon cells (Sre edharan et al, 1993). Presently known as the VPAC1 receptor, this peptide may be considered the classical VIP receptor described in lung, intesti ne, pancreas, and liver. A second VPAC

PAGE 21

7 receptor was cloned from rat brain ( Lutz et al, 1993) and was called the VPAC2 receptor. No splice variants of VPAC1 and VPAC2 are presently known to exist. PACAP and VIP relevance to cardiac function The intrinsic cardiac nerve plexus acts as much more than a simple relay center for parasympathetic innervation to the heart. Rather, it functions as a local integrative neural network capable of modulating extrin sic inputs to the heart and in mediating local cardiac re flexes. The neuropeptides, PACAP and VIP are important regulators of cell-to -cell signaling within the intracardial ganglia, and PACAP and VIP action on these ganglia, mediated through the associated receptors, play an important neuromodulatory ro le in the regulation of coronary blood flow, cardiac contraction, relaxation, and heart rate. Even more interesting are the possible roles these peptides play in different pathological states. Despite many of the advances made in the research of PACAP and VIP effects on the mammalian hear t, the physiological and pat hological roles of these neuropeptides remain unclear and incomple te. The studies proposed here will use novel approaches to give insight into the actions of PACAP and VIP in intracardiac ganglia. Ultimately, this knowledge may contribute to the discovery of new clinical tools used for diagnosing and treating diseased states such as congestive heart failure (CHF), arrh ythmias, hypertens ion and ischemic conditions. The present study attempts to further the under standing of PACAP and VIP regulation of intrac ardiac neurons. Considerin g this primary objective,

PAGE 22

8 four specific aims were estab lished: (1) Investigate whether individual rat intracardiac ganglion neurons express the PAC1, VPAC1 and/or VPAC2 receptors using the single-cell RT-PCR method. (2) Use whole-cell patch-clamp techniques to determine both the passive and active membrane properties of isolated intracardiac neurons in the absence and presence of PAC1, VPAC1 and/or VPAC2 stimulation. (3) Determine wh ether PACAP and/or VIP increase [Ca2+]i in intracardiac neurons by using microfluorometric fura-2 Ca2+-imaging techniques. (4) Characterize which Ca2+-activated ion channels are linked to PACAP and/or VIP receptors. The following chapters of this dissertat ion were written in manuscript form and each chapter addresses a specific topi c which relates to the aims of the dissertation proposal.

PAGE 23

9 FIGURE 1.1: Schematic representation of the connectivity among various neurons involved in maintaining cardiac homeostasis. DRG, dorsal root ganglia; MCG, middle cervical ganglia; SCG, superio r cervical ganglia; ICG, intracardiac ganglia; 1, adrenergic receptors; M1, muscarinic receptors (adapted from Armour et al., 1998).

PAGE 24

10 FIGURE 1.2 : Morphologically distinct intrinsic ca rdiac neurons identified in vitro. Unipolar (A), multipolar (B) and dipol ar (C) neurons isolated from neonatal rat intracardiac ganglia and cultured for 48 hr. Note that in addition to the difference in the number of processes, the unipolar neuron (A) has a smaller soma than the multipolar and dipolar neurons (B,C). (A) and (B) represent principle parasympathetic neurons, whereas (C) is an interneuron. SIF cells, with an average soma diameter of ~10 m (All en and Burnstock, 1987; Seabrook et al, 1990), are also observed in our preparation. Scale bars = 50 m.

PAGE 25

11 FIGURE 1.3: Schematic representation of the two neuropeptides, PACAP and VIP, binding to their asso ciated G-protein coupled PAC1, VPAC1 and VPAC2 receptors. While PA CAP has similar affinities to both PAC1 and VPAC receptors, VIP only binds to VPAC receptors with high affinity.

PAGE 26

12 CHAPTER 2 HETEROGENEITY OF PACAP AND VIP RECEPTORS IN RAT INTRINSIC CARDIAC NEURONS INTRODUCTION Mammalian intracardiac ganglia serv e as integration centers for parasympathetic, sympathetic and affer ent signaling pathways in the heart (Ardell, 1994). The structural complexi ty of the ganglia is complemented by a neurochemical diversity that permits sophisticated processing of signals, and ultimately allows proper control of cardia c function. While acetylcholine is the primary parasympathetic neurotransmitte r mediating intrinsic and extrinsic innervation of the heart, other non-cholinergic, nonadrenergic neurotransmitters have been found in cell bodies and nerve fibers within the ganglia (Weihe et al., 1984; Rigel, 1998). These endogenous neur otransmitters often regulate neuronal excitability, and thus facilitate t he processing of information provided by the diverse inputs. Two such neurom odulators are pituitary adenylate cyclaseactivating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP), both of which have been identifi ed by immunocytochemistry in nerve fibers innervating

PAGE 27

13 the heart, coronary vasculature and cardiac parasympathetic ganglia (Della et al, 1983; Braas et al., 1998; Seabrook et al ., 1990; Weihe et al., 1984). PACAP and VIP have been shown to modulate neuronal activity in canine intrinsic cardiac neurons in situ and alter hear t rate (Armour et al., 1993). These neuropeptides have also been shown to incr ease sinus rate, cardiac contractility and cardiac output (Henning, 1992; Rigel, 1 998; Karasawa et al., 1990; RossAscuitto et al., 1993), and to induce vasodilation in coronary arteries (Feliciano and Henning, 1998; Ross-Ascuitto et al., 1993). VIP and PACAP can directly affect cardiac muscle and coronary blood vessels (Hirose et al., 1997; Warren et al., 1984); however, there appears to be a significant neural component to the cardio vascular effects of these neuropeptides (Hirose et al., 1997). T he cellular mechanisms by which PACAP and VIP modulate cell-to-cell signaling in intrac ardiac ganglia and cardiac function are poorly understood. Furthermore, conflicting data exists as to the subtype(s) of PACAP and VIP receptors present in ma mmalian intracardiac neurons and cardiac muscle. For example, in the adult guinea pig intracardiac neurons, only the PAC1 receptor has been detected (B raas et al., 1998). The PAC1 receptor is selective for PACAP and binds VIP with lo w affinity (Gourlet et al., 1995). However, electrophysiological experim ents on neonatal rat intrinsic cardiac neurons suggest the presence of VPAC1 and/or VPAC2 receptors, both of which bind PACAP and VIP with similar high a ffinities (Cuevas and Adams, 1996; Gourlet et al., 1995). The PACAP/VIP rec eptors in intracardiac neurons from

PAGE 28

14 these two species also appear to coupl e distinct signal transduction cascades and modulate different effect or targets. We have pr eviously shown that PACAP and VIP potentiate ACh-evok ed currents in neonatal rat intracardiac neurons (Cuevas and Adams, 1996; Liu et al., 2000) ; whereas in guinea pig intracardiac neurons, PACAP has been shown to m odulate neuronal excitability and depolarize the cells (B raas et al., 1998). Some of these discrepancies may re flect the complex nature of the receptors of the PACAP/VIP family. Fo r example, seven isoforms of the PAC1 receptor have been reported (PAC1very short short -HOP1, -HOP2, -HIPHOP, -HIP, and TM4). These splice variat ions have been shown to affect ligand binding, as well as G-protein coupling an d selectivity. It has also been suggested that mammalian intracardiac ganglia express multiple PAC1 isoforms (Braas et al., 1998), but it remains to be determined if these receptors are exclusively on neurons or on support cells and what PACAP/ VIP receptor types are expressed by individual neurons. Identification of the receptor types involved in PACAP and VIP neurotransmission is t he first step in elucidat ing the signal transduction cascade that ultimately results in neurom odulation in intracardiac ganglia and regulation of cardiac function.

PAGE 29

15 METHODS Cell Culture Receptor transcripts were invest igated in isolat ed parasympathetic neurons of the rat intracardiac ganglia. As previously described (Fieber and Adams, 1991), rats were killed by decapitation and the heart was carefully removed and placed in a physiological saline solution (PSS) containing (mM): 140 NaCl, 3 KCl, 2.5 CaCl2, 0.6 MgCl2, 7.7 glucose and 10 histidine; pH to 7.2 with HCl. Next, the atria was removed and incubated for 1 h at 37C in saline solution containing collagenase type 2 (1 mg/ml; Worthington Biomedical Corp., Freehold, NJ, USA). After treatment wit h collagenase, clusters of ganglia were dissected away from the remaining atri al tissue and transferred to a sterile culture dish containing hi gh-glucose culture media (D ulbecco’s Modified Eagle Medium, DMEM), 10% (v/v) fetal calf serum, 100 U/ml penicillin and 0.1 mg/ml streptomycin, and triturated using a finebore Pasteur pipette. The dissociated neurons were finally plated onto polylysine (K) 18 mm glass coverslips and incubated at 37C for 36-72 h under a 95% air, 5% CO2 environment.

PAGE 30

16 RT-PCR The expression of PAC1, VPAC1, and VPAC2 receptors was studied in cardiac tissues from neonatal rats (3-7 days old). Total RNA was isolated from intracardiac ganglia and associated tissue, atria, ventricles and pituitary gland (positive control) (RNeasy, Qiagen, Hil den, Germany). The RNA was reverse transcribed and the resultant cDNA amp lified using PCR techniques. PCR products were resolved using agarose gel (1.5%) electrophoresis with ethidium bromide as the label, and visualized us ing UV illumination. In all PCR experiments from tissue ex tracts, RT-negative controls were conducted to screen for contaminants. RNA wa s reverse-transcribed in a 20 l reaction volume using the SuperScript FirstStrand Synthesis System for RT-PCR (Invitrogen Co., San Diego, CA, USA). As a negative contro l, a PCR reaction with only water was conducted to eliminate the possibility of false positives due to contaminating cDNA. Primer pairs specific for PAC1, VPAC1 and VPAC2 receptor transcripts (Table 2.1) were designed to span an intron in order to discriminate between genomic DNA and cDNA. PCR reactions were conducted using the SuperScript System with Plat inum Taq DNA polymerase (Invitrogen Co.). The cycling parameters were one cycl e of 94C for 2 min; 30 cycles of 94C for 30 s, 61C for 45 s, and 72C for 1 min; and one cycle of 72 C for 5 min.

PAGE 31

17 Cytoplasm harvest of individual neurons For single cell RT-PCR experiment s, intracardiac neurons were dissociated, and cytoplasm extracted fr om isolated neurons as previously described (Poth et al., 1997). The intracellu lar contents of individual intracardiac neurons were harvested by applying suction on a patch pipette in the dialyzing whole-cell recording configuration. The pipettes were filled with 3 L of 1X Superscript One-Step RT-PCR Reaction Mix (Invitrogen Co.) containing 1 U/L RNAsin (Promega Co., Madison, WI, USA) After cytoplas m extraction, the contents of the pipette were expelled in to a microfuge tube and frozen on dry ice. Immediately following extractions, si ngle cell RT-PCR experiments were conducted using Superscrip t One-Step RT-PCR with Plat inum Taq (Invitrogen Co.). Negative controls were obtained by suctioning extracellular solution near the location of the harve sted neuron into a separate bor icillate pipette. This control was carried out to exclude cont amination with cytoplasm from nearby cells or by contamination with VIP/PACAP receptor containing plasmids routinely used in the laboratory. The cyc ling parameters were one cycle of 50 C for 30 min and 95C for 2 min; 40 cycles of 94C for 30 s, 61C for 45 s, and 72C for 1 min; and one cycle of 72 C for 5 min. RT-PCR products were gel purified us ing a QIAEX II Gel Purification kit (QIAGEN) and sequenced by the Molecular Biology Core Facility at the H. Lee Moffitt Cancer Center and Research Institute.

PAGE 32

18 RESULTS PAC1 receptor mRNA isoforms detected in cardiac tissue Experiments were conducted to det ermine the distribution of PAC1 receptor transcripts in cardiac tissue of neonatal rats. The tissues examined were intracardiac ganglia and associated tissue (e.g. cardiac myocytes, Schwann cells, vascular smooth muscle, endothelial ce lls, and fibroblasts), the auricles of the atria, and the apex of the ventricles Whole tissue RNA extracts were probed for PAC1 receptor isoforms using the PAC1-1 and PAC1-2 oligonucleotide primers (table 2.1), designed to differentiate between splice variations in the third cytoplasmic loop, which is essential for G-protein interaction and influences Gprotein specificity, and t he amino terminus of the PAC1 receptor (Fig 2.1A). RTPCR amplification of t he extracts using PAC1-1 primers demonstrated that multiple PAC1 receptor isoforms are expressed in intracardiac neurons and associated tissues, atria and ventricles of neonatal rats (Fig 2. 1B). Products of the predicted sizes for PAC1short and/or -very short -HIP and/or -HOP, and HIPHOP were detected in all extracts. The oligonucleot ide primers (PAC1-1) designed to distinguish between splice variations in the third cytoplasmic loop of the PAC1 receptor do not

PAGE 33

19 discriminate between the PAC1short or PAC1very short variations. This splicing occurs within the domains encoding the am ino terminus of the receptor, and is significant in ligand binding affinities. Therefore, PAC1-2 primers were developed to amplify PAC1 cDNA associated with the extracel lular, N-terminus (Fig 2.1A). The resultant bands following RT-PCR sug gest that neonatal rat cardiac tissues only express the short s equence variant of the PAC1 receptor (Fig 2.1C). PAC1 mRNA expression in isolated rat intracardiac neurons The presence of PAC1 receptor transcripts in non-neuronal tissues of the heart necessitated the use of single-cell PCR to determine if individual neurons express PAC1 receptors and the specific isoform(s) present. Figure 2.2A shows RT-PCR reaction results for five isolated neurons using the PAC1-1 primers. Similar to the whole tissue samples, i ndividual rat intracardiac neurons express one or more splice variations in the regi on encoding the third cytoplasmic loop of the PAC1 receptor. The amino terminus r egion was also investigated at the single-neuron level to distinguish between short and very short transcript presence within such neurons (Fig 2.2B). RT-PCR reaction results, following two rounds of PCR, for two is olated neurons using the PAC1-2 oligonucleotide primers indicate only the presence of the short variant. PCR products from both sets of primers were gel purified and cloned using the pGEM-T Easy Vector System (Promega). As expected, sequences and translation of the 493 bp si ze RT-PCR product (PAC1-2) from two individual

PAGE 34

20 neurons aligned perfectly wit h the sequence of the PAC1short (PAC1-s; Z23279). None aligned with the PAC1very short sequence (PAC1-vs). Sequences and translation of the 303 bp si ze RT-PCR product (PAC1-1) from two individual neurons also aligned wit h the sequence of the PAC1short receptor, further proving the presence of only PAC1short splicing within the N-terminus of neonatal rat intracardiac neurons. S equences and translation of the 384/387 bp size RT-PCR products (PAC1-1) from five individual neurons aligned with the sequences for PAC1short PAC1-HOP1 (Z23274) and PAC1-HOP2 (Z23275). Although experiments seemed to indicate the presence of -HIPHOP transcripts (468/471 bp products) within these neurons and cardiac tissue, no PAC1HIPHOP sequences were elucidated. T hus, rat intracardiac neurons express PAC1 transcripts lacking a cassette insert in the third cytoplasmic loop and transcripts containing eit her the -HOP1 or -HOP2 cassette. No transcripts containing the -HIP or -HIPHOP insert were detected. Single-cell RT-PCR studies confirm that neonate rat in tracardiac neurons only express PAC1short isoform. VPAC1 and VPAC2 receptor transcripts detected in cardiac tissue Related to the PAC1 receptor, the VIP (VPAC) re ceptor is also a member of the secretin/glucagon receptor family Two subtypes of the VIP receptors (VPAC1 and VPAC2) have been cloned and sequenced, and there is fifty percent homology between VPAC1 and VPAC2 (Rubino et al., 1996). Unlike the PAC1

PAGE 35

21 receptor, VPAC1 and VPAC2 bind both PACAP and VIP with similar affinity (Gourlet et al., 1995). Also, no splice variations of VPAC1 and VPAC2 are known to exist. To investigate the presence of VPAC1 and VPAC2 receptor transcripts in the intracardiac neurons of neonatal rats, specific oligonucleot ide primers were developed to amplify non-homol ogous regions of the rec eptor transcripts (Fig 2.3A,C). Whole tissue RNA extracts fr om the indicated tissues were reverse transcribed and amplified via PCR us ing these primer s. Both VPAC1 and VPAC2 transcripts were detected in cardiac a ssociated tissues (Fig 2.3A,C). Among these tissues, it was obvious that VPAC2 was the predominant messenger RNA transcribed. Restriction digests of the resultant bands for both VPAC1 (Nde I) and VPAC2 (Van91I) support the data that these receptor transcripts are present in cardiac associated tissues (Fig 2.3B,D). VPAC mRNA expression in isolated rat intracardiac neurons To complete the investigation of VPAC1 and VPAC2 receptor transcripts, neonatal rat intracardiac neurons were studi ed using single-cell RT-PCR. Figure 2.4A shows the reaction results for five isolated neurons using the VPAC1 F4R4 primers. RT-PCR reac tion results for five isolated neurons using the VPAC2 F4R4 primers are shown in figure 2.4B. The two single-cell RT-PCR gels clearly demonstrate that VPAC2 is the most abundant VIP receptor transcript within these single neurons. Sequences of RT -PCR products from two individual neurons identically matched wit h the sequence of the VPAC2 receptor (Z25885).

PAGE 36

22 Unlike in the adult guinea pig, neonatal rat intracardiac neurons and/or associated tissue do express the PACAPand VIPassociated receptors VPAC1 and VPAC2, with VPAC2 being the predominant species. This supports previous electrophysiological findings suggesting t he presence of a receptor that binds with high affinity to the lig and VIP (Liu et al., 2000). Individual intracardiac neuron expression pattern of PAC1 and VPAC mRNA Splice variation of the neonatal rat PAC1 receptor was further scrutinized by relating the data discovered in the two previous figures (Fig 2.5A,B,C). The first bar graph depicts the percent of intracardiac neurons expressing the indicated combinations of PAC1 receptor variants (Fig 2.5A). Neurons exhibit three distinct expression patterns of PAC1 isoforms: 1)PAC1short, 2)PAC1-HOP, and 3)PAC1short and PAC1-HOP. No PAC1very short PAC1-HIP, or PAC1HIPHOP transcripts were detected. T he second bar graph indicates the percent of neurons expressi ng either the PAC1-short or the PAC1-HOP (alone or with other isoforms), and -HOP1 versus -HOP2 transcripts (cloned sequences) (Fig 2.5B). Of all of the neur ons studied, the majority ex pressed the -HOP variant and nearly half of the neurons expressed the short variant. Of the PAC1-HOP isoforms, the HOP1 was expressed pr edominantly. The last bar graph depicts the optical density of PAC1-HOP1 and PAC1short receptor transcripts in cells expressing both sequence variants (Fig 2. 5C). Optical density of individual

PAGE 37

23 bands was determined using a GS 700 Im aging Densitometer (BIO-RAD) and Multi-Analyst (BIO-RAD) software. Figur e 2.5C shows that in neurons which expressed both PAC1-HOP and PAC1short transcripts, PAC1-HOP1 was the predominant species. Thus, three distinct expression patterns of PAC1 receptor isoforms were observed in isolated intracardiac neurons. The PAC1-HOP1 receptor isoform is the most common sequenc e variant present in rat intracardiac neurons and is expressed at higher levels than the PAC1short variant.

PAGE 38

24 TABLE 2.1: Table showing the sequence of olig onucleotide primers used in this study and the predicted size for the individual products. a All PAC1 splice variants containing a cassette in sert in the third cytoplasmic loop (PAC1HIP, -HOP, and –HIPHOP) have the short insert in the amino terminus regi on, and thus their RT-PCR products will be indistinguishable from the PAC1short when the PAC1-2 primers are used.

PAGE 39

25 Receptor Primer Sequence (5’ to 3’) Variant Size (bp) Very short 303 Short 303 HIP 387 FWD: CTTGTACAGAAGCTGCAGTCCCCAGACATG HOP1 387 HOP2 384 HIPHOP1 471 PAC1-1 REV: CCCGTGCTTGAAGTCCATAGTGAAGTAACGGTTCACCTT HIPHOP2 468 FWD: TGTAAGCTGCCCTGAGGTCT Very short 430 PAC1 PAC1-2 REV: CACCACGCAGTAGTGGAAGA Shorta 493 FWD: TCTTCAACAGCGGGGAGATAGACCACTGC VPAC1 VPAC1-1 REV: GAAACCCTGGAAAGAGCCCACGACAAGTTC __ 554 FWD: ATCCTTCCTCCCAGCAGGTGTTTCC VPAC2 VPAC2-1 REV: GTATCTGTAGGGCGCTTTCTGAGCCATTCC __ 565

PAGE 40

26 FIGURE 2.1: Expression of PAC1 receptor isoforms in cardiac tissue. (A) Schematic represent ation of the PAC1 receptor indicating the regions amplified by the PAC1-1 and PAC1-2 primer pairs. The locations of the cassette inserts that contribute to the different PAC1 isoforms are also shown. RT-PCR results for RNA extracts from the indica ted tissues using the primers PAC1-1 (B) and PAC1-2 (C). STDS, 100 bp ladder standards; PIT, pituitary gland; IC, intracardiac ganglia; VENT, ventricles. Arrows indica te predicted sizes for different splice variants of the PAC1 receptor. *See note in Table 2.1.

PAGE 41

27 FIGURE 2.2: Detection of PAC1 receptor isoforms in single intracardiac neurons. (A) RT-PCR results obtained from indivi dual intracardiac neurons using the PAC1-1 (A) and PAC1-2 (B) primers. Arrows i ndicate the predicted sizes for different splice variants of the PAC1 receptor (see Table 2.1); STDS, 100 bp ladder standards.

PAGE 42

28 FIGURE 2.3: Expression of VPAC1 and VPAC2 receptor isoforms in cardiac tissue. Schematic repr esentations of the VPAC1 and VPAC2 receptors indicating the regions amplified by the VPAC1 F4R4 primers (A) and VPAC2 F4R4 primers (C), as well as RT-PCR results for RNA ex tracts from the indicated tissues using these oligonucleotide primer sets, res pectively. Restriction digests of the resultant bands for VPAC1 (Nde I) (B) and VPAC2 (Van91I) (D), supporting the data that these receptor transcripts are present in cardiac associated tissues. Arrows indicate the predicted sizes for VPAC1 and VPAC2 (see Table 2.1).

PAGE 43

29 FIGURE 2.4: Detection of VPAC receptor tran scripts in single intracardiac neurons. RT-PCR results obtain ed from individual intrac ardiac neurons using the VPAC1 F4R4 (A) and VPAC2 F4R4 (B) oligonucleotide primers. Arrows indicate the predicted sizes for VPAC1 and VPAC2 (see Table 2.1). (C) Sequences of the 565 bp size RT-PCR product from two i ndividual neurons aligned with the sequence of the VPAC2 receptor (GI: 414188). PCR products were gel purified (Qiagen) and cloned using the pGEM-T Easy Vector System (Promega).

PAGE 44

30 FIGURE 2.5: Expression pattern of PAC1 isoforms and VPAC transcripts in intrinsic cardiac neurons. (A) Compar ison of the number of cells expressing either PAC1short -HOP1 or –HOP2 transcripts (n = 34), VPAC1 (n = 32) or VPAC2 (n = 30). (B) Percentage of intrac ardiac neurons expressing the indicated combinations of PAC1 receptor variants (n = 28). (C) Optical density of the PAC1short and PAC1-HOP1 receptor transcripts in cells expressing both sequence variants (n = 10). Asterisk denotes significant difference (p < 0.05).

PAGE 45

31 DISCUSSION PACAP and VIP peptides have a wide ra nge of neuromodulatory roles in the peripheral nervous system, pot entially through the receptors PAC1, VPAC1, or VPAC2. Expression of all three recept ors within intracardial neurons was investigated using RT-PCR. Initially, whole tissue RNA extracts of cardiac associated tissue were reverse tran scribed, and the resultant cDNA was amplified using specific primers for each of the three receptors. But because the primary interest was intracardiac neur ons, further examination needed to be completed to prove that these receptor tr anscripts are present in these neurons. Therefore, single-cell RT-PCR was initiated to verify PAC1, VPAC1, and VPAC2 transcripts within the intracardiac neurons. We conclude that over 90% of rat intracardiac ganglion neurons express transcripts encoding the PAC AP selective receptor PAC1. This finding is consistent with electrophysiological ex periments previously conducted. Individual neurons express one or more isoforms of the PAC1 receptor. The sequence variations occur in the domain encoding the third cytoplasmic loop, which is responsible for G-protein regulat ion, selectivity and coupling. Neurons exhibit three distinct expression patterns of PAC1 isoforms: 1)PAC1short,

PAGE 46

322)PAC1-HOP, and 3)PAC1short and PAC1-HOP. No PAC1very short PAC1HIP, or PAC1-HIPHOP transcripts were detect ed. Rat intracardiac neurons primarily express the PAC1-HOP1 receptor isoform, in contrast to guinea pig intracardiac neurons where the PAC1-very short is the most abundant sequence variant. In addition to PAC1, intracardiac neurons express VPAC1 and VPAC2 transcripts, with the latter being found in gr eater proportion of the neurons. This observation is consistent with the cellular effects of VIP in in tracardiac neurons. The relationship between these receptors, signal transduction and down stream effector targets rema in to be determined.

PAGE 47

33 CHAPTER 3 VPAC RECEPTOR MODULATION OF NEUROEXCITABILITY IN INTRACARDIAC NEURONS: DEPENDENC E ON INTRACELLULAR CALCIUM MOBILIZATION AND SYNERGISTI C ENHANCEMENT BY PAC1 RECEPTOR ACTIVATION INTRODUCTION Pituitary adenylate-cyclase activating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP) are pleiotropic neuropeptides that belong to the glucagon/secretin/growth hormone-re leasing factor family of peptides (Warren et al., 1991; Ishizuka et al., 1992; Basler et al., 1995; Cardell et al., 1997). These neuropeptides have pronounced effects on the central nervous system, as well as on neurons and effect or targets of t he autonomic nervous system. For example, in the central nervous system, PACAP has been shown to be involved in hippocampal synaptic plasti city and associative learning in mice (Hashimoto et al., 2002), while VIP has been shown to regulate intrathalamic rhythm activity and may modulate information transfer through the thalamocortical circuit (Lee and Cox, 2003) In the peripheral nervous system, PACAP and VIP appear to play a major role in autonomic regulation of the cardiovascular system. VIP has been show n to cause positive chronotropic and

PAGE 48

34inotropic effects (Rigel et al., 1989; Karasawa et al., 1990; Yonezawa et al., 1996). In contrast, PACAP has been show n to cause a transient increase in sinus rate and atrial contractility that is followed by negative chronotropic and inotropic responses in isolated canine at ria (Hirose et al., 1997). Also, both PACAP and VIP are potent dilators of coronary arteries (Huang et al., 1993; Kawasaki et al., 1997). While these neurope ptides can directly influence cardiac tissues, the effects of PACAP and VIP on the heart are in part due to neuroregulatory effects on par asympathetic intracardiac ganglia (Yonezawa et al., 1996; Hirose et al., 1997; Seebeck et al., 1996; Armour et al., 1993). Mammalian intracardiac ganglia play a major role in neuronal control of the heart and are believed to be c apable of independently monitoring and influencing cardiac function. A variety of neurotransmitters and neuromodulators, including PACAP and VIP, appear to be in volved in the relaying of information within intracardiac ganglia and onto effe ctor targets such as cardiac valves, coronary arteries and cardiomyocytes PACAP and VIP have been detected by immunocytochemistry in nerve fibers in the heart, coronary vasculature and cardiac parasympathetic ganglia (Della et al., 1983; Weihe et al., 1984; Seabrook et al., 1990; Gulbenkian et al., 1993; Braas et al., 1998; Horackova et al., 2000). Although extrinsic fibers may be one sour ce of these neuropept ides in the heart (Calupca et al., 2000), PACAP and VIP are also found in cell bodies and nerve fibers of intrinsic cardiac neurons (De lla et al., 1983; Weihe et al., 1984; Seabrook et al., 1990; Gulbenkian et al., 1993; Braas et al., 1998; Horackova et

PAGE 49

35al., 2000). Despite the fact that data clearly demonstrate that these endogenous neuropeptides are potent regul ators of the cardiovascu lar system, the cellular mechanisms mediating their effects remain poorly understood. There are also conflicting reports in the lit erature concerning the me chanisms by which PACAP and VIP regulate the function of intrinsic cardiac neurons. For example, it has been suggested that PACAP and VIP modulate neurotra nsmission in rat cardiac ganglia by potentiating nicotinic acetyl choline receptors (Cuevas and Adams, 1996; Liu et al., 2000), whereas studies on guinea pig intracardiac neurons indicate that PACAP, but not VIP, regulates the excitab ility of intrinsic cardiac neurons, possibly by influencing the K+ conductance, IA (Miura, A. et al., 2001; Braas et al., 1998). PACAP and VIP evoke their effects via t he activation of specific G-protein coupled receptors (Christophe, 1993; Shivers et al., 1991). The PAC1, or PACAP-selective receptors, bind both active forms of PACAP, PACAP-27 and PACAP-38, with equally high affinities, but VIP with much lower affinity (Gourlet, et al., 1995); whereas, non-selective VPAC (VPAC1 and VPAC2) receptors recognize PACAP-27, PACAP-38 and VIP with similar high affinities (Gottschall et al., 1990; Gottschall et al, 1991; Cauvin et al., 1990; Cauvin et al, 1991; Lam et al., 1990; Robberecht et al., 1992; Suda et al., 1992). At least seven isoforms of the PAC1 receptor exist due to alternative splicing of the mRNA, while no splice variants of VPAC1 or VPAC2 are presently known to exist. These different PAC1 isoforms and VPAC receptor types are known to couple to distinct second

PAGE 50

36messenger pathways (Spengler et al., 1993; Pant aloni et al., 1996; Chatterjee et al., 1996). Rat intrinsic cardiac neurons express several isoforms of the PAC1 (PAC1short PAC1-HOP1, PAC1-HOP2), as well as both VPAC receptors (DeHaven and Cuevas, 2002). The functional consequences of the PAC1/VPAC receptor heterogeneity, which is also observed in other neuron types, such as mammalian cortical neurons, remain to be fully elucidated. The pr esent study examined the ability of PACAP and VIP to regulate the electrical properti es of intrinsic cardiac neurons from neonatal rats, and to modulate [Ca2+]i in these cells. Both PACAP and VIP depolarize intracardiac neurons and increase [Ca2+]i by evoking Ca2+ release from ryanodine-sensitive intracel lular stores and promoting Ca2+ entry through the plasma membrane. PACAP, but not VIP, also increased the number of action potentials fired by neurons in response to depolarizing current pulses. The changes in neuroexcitability evoked by PACAP and VIP were blocked by inhibiting the [Ca2+]i elevations produced by the neuropeptides.

PAGE 51

37 METHODS Membrane currents and [Ca2+]i were investigated in isolated intracardiac ganglion neurons of neonatal rats (4-7 days old). The preparation and culture of isolated intrinsic cardiac neurons has been previously described (Fieber and Adams, 1991). Dissociated neurons were plated onto poly-L-lysine coated glass coverslips and incubated at 37C fo r 36-72 h under a 95% air, 5% CO2 environment prior to the experiments. Microfluorometric measurements The calcium sensitive dye fura-2 ac etoxymethylester (fura-2-AM) was used for measuring intracellular free calcium concentrations ([Ca2+]i) in intracardiac neurons at room temperature, as previous ly described (Smith and Adams, 1999). Cells plated on coverslips were then incubated for 1 hour at room temperature in physiological saline so lution (PSS) consisting of (in mM): 140 NaCl, 3 KCl, 2.5 CaCl2, 1.2 MgCl2, 7.7 glucose and 10 HEPES (pH to 7.2 with NaOH), which also contained 1 M fura-2-AM and 0.1 % dimethyl sulfoxide (DMSO). The coverslips were then was hed in PSS (fura-2-AM free) prior to the

PAGE 52

38experiments being carried out. All solutions were applied via a rapid application system identical to that previously described (Cuevas and Berg, 1998). A Sutter DG-4 high-speed wavelength s witcher (Sutter Instruments Co., Novato, CA) was used to apply alternating excitation with 340 nM and 380 nM ultraviolet light. Fluorescent emissi on at 510 nm was captured using a Cooke Sensicam digital CCD camera (Cook e Corporation, Auburn Hills, MI) and recorded with Slidebook 3.0 software (I ntelligent Imaging Innovations, Denver, CO) on a Pentium IV comput er. Changes in [Ca2+]i were calculated using the Slidebook software (Intelli gent Imaging Innovations, Denver, CO) from the intensity of the emitted fluorescenc e following excitation with 340 and 380 nm light, respectively, using the equation: [Ca2+]i = Kd Q (R-Rmin)/(Rmax-R) where R represents the fluorescence intensity ratio (F340/F380) as determined during experiments, Q is the ratio of Fmin to Fmax at 380 nm, and Kd is the Ca2+ dissociation constant for fu ra-2. Calibration of t he system was performed using the Molecular Probes (Eugene, OR) Fura-2 Calcium Imaging Calibration Kit and values were determined to be: Fmin/Fmax (23.04), Rmin (0.31), Rmax (8.87). Electrophysiology Coverslips plated with t he dissociated neurons were transferred to a 0.5 ml recording chamber mounted on a phasecontrast microscope (400X). The extracellular recording solu tion was identical to the Ca2+ imaging PSS. The Ca2+-

PAGE 53

39free PSS contained no CaCl2 and included 1 mM et hylene glycol-bis(2aminoethylether)-N,N,N',N'-tetraacetic acid (EGTA). All drugs were bath applied in PSS. In some electrophysiological and Ca2+ imaging experiments the order of drug administration was reversed, that is PACAP was given in the presence of other drugs (or in Ca2+-free media) prior to being give n alone as a control. This alteration in the protocol was done to ensure that any change in response was not due to rundown. Currents were amp lified and filtered (5 kHz) using an Axoclamp-200B Amplifier, digitized with a 1322A DigiData digitizer (20kHz), and collected on a Pentium IV computer using the Clampex 8 program (Axon Instruments, Inc., Foster City, CA, USA) Data analysis was conducted using the pClamp 8 program, Clampfit. The whole-cell perforated-patch variat ion of the patch-clamp recording technique was used as previously descri bed (Rae et al., 1991; Xu and Adams, 1992). This configuration preserves intrac ellular integrity, preventing the loss of cytoplasmic components and subsequent altera tion of functional responses of these neurons (Cuevas and Adams, 1996; C uevas et al., 1997). The pipette solution contained (mM): 75 K2SO4, 55 KCl, 5 MgSO4, 10 HEPES, 198 g/ml amphotericin B, and 0.4% DMSO. All electrophysiological recordings were performed at room temperature. Membrane potential responses to hy perpolarizing and depolarizing current pulses (-100 pA to +200 pA) were determined in the absence and presence of VIP/PACAP receptor ligands. The mean re sting membrane potential, latency for

PAGE 54

40action potential firing, action pot ential duration, amplitude of afterhyperpolarization and t he number of action potentials elicited by depolarizing current pulses were determined in the absence and presence of PAC1 and VPAC receptor ligands. Membrane input resist ance was also determined as described previously (Xu and Adams, 1992). Reagents and statistical analysis All chemicals used in this investigat ion were of analytic grade. The following drugs were used: amphotericin B, DMSO, mecamylamine, caffeine, 2aminoethoxydiphenyl borate (2-APB) (Sigma-Aldrich, St. Louis, MO); PACAP-27, PACAP-38, L-8-K (VIP receptor binding inhibitor), [N-Ac-Tyr1, D-Phe2]-GRF (129) and VIP (American Peptide Co., Sunnyva le, CA); tetrodotoxin (TTX), ryanodine, thapsigargin and forskolin (Alom one Labs, Jerusalem, Israel); barium chloride (Fisher Scientific, Hampton, NH2), and fura-2-AM (Molecular Probes, Eugene, OR). Recombinant maxadilan and M65 were generous gifts from E. A. Lerner (Massachusetts General Hospital, Harvard Medical School). All data are presented as the mean SEM of the number of observations indicated. Statistical analysis was conducted using SigmaPlot 8 (SPSS, Chicago, IL) and paired and unpaired t -tests were used for within group and between group comparisons, respectively.

PAGE 55

41 RESULTS PACAP and VIP directly increase free [Ca2+]i The most abundant PAC1 receptor isoform expr essed in neonatal rat intrinsic cardiac neurons, PAC1-HOP, has been shown to elicit elevations in intracellular calcium in cortical neurons (Grimaldi and Cavallaro, 2000). However, the relationship between PAC AP and intracellular calcium has not been investigated in the autonomic neur ons. The effect of PACAP on Ca2+ handling in intracardiac neurons was studied using fura-2 Ca2+-imaging techniques. Figure 3.1A shows a repr esentative trace of change in [Ca2+]i ( [Ca2+]i) as a function of time recor ded from a neuron bef ore, during and following 2 minute applicatio n of 100 nM PACAP-27 (black trace). Intracellular Ca2+ concentrations increased by >400 nM when PACAP-27 wa s applied, and returned to near control levels upon was hout of drug. In similar experiments PACAP-27 significantly increased intrac ellular calcium by ~400%, from a baseline of 65.3 5.5 nM to a peak value of 335.1 65.4 nM (n=23) (Fig 3.1B). In all cells responding to PAC AP, the elevations in [Ca2+]i were reversed when PACAP was removed from t he bath, and subsequent applications of PACAP to the same cell produced [Ca2+]i increases of similar magnitude.

PAGE 56

42In a series of experiments, the PAC1 receptor-selective agonist, maxadilan, and VPAC receptor-selective ago nist, VIP, were used to determine if the PACAP-induced elevations in [Ca2+]i are mediated exclusively by activation of PAC1 receptors, or if VPAC receptors c ontribute to this phenomenon. Figure 3.1A also shows representative traces of change in [Ca2+]i recorded from two neurons as a function of time before, dur ing and following 2 minute application of maxadilan (10 nM, dotted tr ace) and VIP (100 nM, gray trace), respectively. Maxadilan, at a concentration (10 nM) specific for PAC1 (Moro and Lerner, 1997), failed to elicit a change in [Ca2+]i. In contrast, VIP, at a concentration (100 nM) that preferentially activates VPAC rec eptors (Gourlet et al., 1995), reversibly increased [Ca2+]i by > 225 nM in this neuron. In 14 similar experiments 100 nM VIP significantly increased mean peak [Ca2+]i by more than 225%, from 73.2 12.1 nM to 239.1 27.4 nM, which is an increase comparable to that observed when PACAP-27 was used as the agonist (F ig 3.1B). Maxa dilan (10 nM-100 nM), however, did not elicit any detectable changes in [Ca2+]i in any of the cells tested (Fig 3.1B; n = 7), which suggests that the PAC1 receptor is not responsible for the PACAP-induced increases in [Ca2+]i observed in these cells. Increases in free [Ca2+]i evoked by PACAP and VIP are mediated by a VPAC receptor To confirm that activation of VPAC receptors is responsible for the PACAP-induced elevations in [Ca2+]i, the PAC1 receptor-specific antagonist M65,

PAGE 57

43and VPAC receptor-specific ant agonists L-8-K and [N-Ac-Tyr1, D-Phe2]-GRF (129), were used. Figure 3.2 shows r epresentative traces of change in [Ca2+]i as a function of time during application of 100 nM PACAP-27 alone (black traces Fig 3.2A-C) or when the neuropept ide was co-applied with 100 nM M65 (Fig 3.2A, gray trace), 5 M L-8-K (Fig 3.2B, gray tr ace) or 100 nM [N-Ac-Tyr1, D-Phe2]GRF (1-29) (YF-GRF) (Fig 3.2C, gray trac e). Only the VPAC receptor antagonists were shown to block the effects of PACAP on [Ca2+]i. A bar graph of results obtained in similar experiments is shown in Figure 3.2D, and reveals that application of either L-8K (n = 9) or [N-Ac-Tyr1, D-Phe2]-GRF (1-29) (YF-GRF, n = 5) significantly attenuated PAC AP-evoked elevations in [Ca2+]i in isolated intracardiac neurons, while M65 (n = 5) had no effects on the neuropeptideinduced changes in [Ca2+]i. These data further support the conclusion that the PACAP and VIP evoked increases in [Ca2+]i are mediated by VPAC receptors and not PAC1 receptors in these cells. PACAP and VIP are known to modulate nicotinic acetylcholine receptors (nAChRs) in intrinsic cardiac neurons (Liu et al., 2000). This raises the possibility that the observed PACAPand VI P-induced elevations in [Ca2+]i may be due to regulation of presynaptic or postsynaptic nAChRs by the neuropeptides. Thus, to verify that the effect of exoge nously applied PACAP an d VIP on [Ca2+]i are not indirectly caused by nAChR modulation, the Na+ channel blocker TTX (400 nM) and ganglionic nAChR blocker mecamylamine (25 M) and were used to block nicotinic neurotransmission preand post-sy naptically, respectively. Neither the

PAGE 58

44application of TTX (n=4) nor mecamyla mine (n=3) prevented the PACAP-induced rise in [Ca2+]i in rat intracardiac neurons (data not shown). The application of PACAP-27 (100 nM) in the pr esence of TTX significantly (p<0.01) elevated [Ca2+]i from 107.1 13.8 nM to 286.8 25.1 nM, values comparable to the calcium elevations seen in the absence of TTX. Similarly, PACAP-27 increase in [Ca2+]i was unaffected by the applicat ion of mecamylamine (65.4 9.5 nM to 236.6 31.2 nM ), a 265% increase in intr acellular calcium (data not shown). These results suggest that the ob served PACAP-induced rise in [Ca2+]i is not dependent on neurotransmission. PACAP and VIP mobilize Ca2+ from intracellular stores and evoke Ca2+ entry through the plasma membrane. PAC1 and VPAC receptors hav e been linked to both Ca2+ entry through the plasma membrane via the activati on of L-type calcium channels (Chatterjee et al., 1996; Tanaka et al., 1998) and Ca2+ release from intracellular stores (MacKenzie et al., 2001). Experiments we re conducted to determine the source of Ca2+ responsible for the VPAC mediated increase in [Ca2+]i. Application of PACAP-27 produced an increase in [Ca2+]i that exhibited both a transient and a sustained component (Fig 3.3A, black trac e). Similar results were observed when VIP was used as the agonist (dat a not shown). However, when PACAP was applied in Ca2+-free PSS, the initial transient increase in [Ca2+]i was observed, but the sustained component wa s abolished (Fig 3.3A, gray trace).

PAGE 59

45Figure 3.3B shows a bar graph of mean peak and sustained [Ca2+]i recorded under normal and Ca2+-free conditions from 12 isolated intracardiac neurons. Even though the magnitude of the transient peak [Ca2+]i remained unchanged (normal PSS: 179.2 17.6 nM; Ca2+-free PSS: 173.4 17.8 nM), the sustained component significantly decreased from 103.6 11.5 nM to 45.7 6.7 nM following removal of extracellular Ca2+. This latter [Ca2+]i value was equivalent to control baseline [Ca2+]i. Thus, the sustained component is dependent on extracellular Ca2+ and is likely due to Ca2+ flux through the plasmalemma. The presence of a PACAP-induced transient elevation in [Ca2+]i in the absence of extracellular calcium suggest ed that activation of VPAC receptors mobilized Ca2+ from intracellular stores in thes e neurons. In order to test this hypothesis, we used the endoplasmic reticulum (ER) Ca2+-ATPase inhibitor, thapsigargin, which s pecifically blocks Ca2+ reuptake leading to depletion of the ER Ca2+ stores (Lytton et al., 1991). Pr ior to the experiments, dissociated intracardiac neurons were incubated for 1 hr in 20 M thapsigargin (in PSS, 37 C). Experiments were then conducted to determine if PACAP increased [Ca2+]i under these conditions. Untreated neurons collected from either the same neonatal rat or animals from the same li tter were used as a positive control to determine if the neurons responded to PAC AP. Figure 3.3C shows traces of change in [Ca2+]i recorded from two neuron s preincubated in 20 M thapsigargin and exposed to either 100 nM PACAP-27 or 500 M acetylcholine (ACh). PACAP failed to elicit a change in [Ca2+]i in these neurons, but ACh, which

PAGE 60

46promotes Ca2+ entry via plasma membrane nicoti nic acetylcholine receptors in intracardiac neurons (Beker et al ., 2003), produced a pronounced transient elevation in [Ca2+]i. In similar experiments, thapsigargin-pretreatment significantly decreased the peak PACAP response from 370.3 40.9 nM to 105.0 8.3 nM (n = 6; Fig 3.3D ), with the latter value being indistinguishable from the baseline [Ca2+]i measured in this group of cells (104.4 16.5 nM). In contrast, thapsigargin preincubation had no effect on the peak [Ca2+]i elevations produced by rapid focal application of 500 M ACh (Fig 3.3D). Thapsigargin also eliminated the rise in [Ca2+]i elicited by bath applicati on of 5 mM caffeine (Fig 3.3D), which has been shown to evoke release of Ca2+ from intracellular stores in these cells (Beker et al., 2003). Ther efore, depleting intracellular Ca2+ stores via thapsigargin pretreatment abolished both the transi ent and sustained PACAPinduced changes in [Ca2+]i. PACAP induces mobilization of [Ca2+]i from caffeineand ryanodinesensitive stores Previous studies have demonstrated t hat rat intrinsic cardiac neurons have two distinct ER Ca2+ stores, one that is sens itive to inositol 1,4,5trisphosphate (IP3) and a second that is sensitive to ryanodine and caffeine (Smith and Adams, 1999; Beker et al., 2003). The PACAP/VIP receptors have been shown to mobilize Ca2+ from both IP3and ryanodine/caffeine-sensitive stores in other cell types (Grimaldi and Ca vallaro, 2000; Tanaka et al., 1998). To

PAGE 61

47determine if PACAP evokes release of Ca2+ from ryanodine/caffeine-sensitive stores we used two approaches: 1) depl eting the ryanodine/ca ffeine-sensitive stores of Ca2+ by bath applying 5 mM caffeine and 2) blocking the release of Ca2+ from these stores by bath applying 10 M ryanodine. Figure 3.4 shows representative traces of change in [Ca2+]i in response to 5 mM caffeine (Fig 3.4A) or 10 M ryanodine (Fig 3.4C) recorded from two neurons (gray traces), and to PACAP-27 (100 nM) in the absence (black traces) and presence (dotted traces) of these drugs (Figs 3.4A and 3.4C, re spectively). Both the transient and sustained PACAP-evoked elevations in [Ca2+]i were suppressed by pretreatment with caffeine or ryanodine. In 6 identical experiments, caffeine significantly decreased peak [Ca2+]i increase from 139.3 32.5 nM to 21.3 4.6 nM (Fig 3.4B). Similarly, ryanodine depressed the peak elevation in [Ca2+]i from 162.2 27.0 nM to 32.7 10.9 nM (Fig 3.4D). The initia l application of caffeine produced an increase in [Ca2+]i (236.8 34.1 nM) similar to that elicited by PACAP, but, unlike PACAP, was often associated with Ca2+ oscillations (see Fig 3.4A). Ryanodine, however, did not promote calciu m release in any of the cells tested, which is consistent with t he drug acting as an inhibitor of the ryanodine receptor at this concentration (Chu et al., 1990). Our experiments with ryanodine, however cannot rule out the possibility that neuropeptide-stimulated IP3 production evokes small, local changes in [Ca2+]i that initiate the release of Ca2+ from the caffeine/ryanodine stores. The IP3-receptor antagonist 2-APB (Maruyama et al., 1997) was used to determine if

PAGE 62

48IP3-mediated Ca2+-induced-Ca2+ release is responsible fo r the transient elevation in [Ca2+]i observed following VPAC receptor stimulation. Figure 3.5A shows [Ca2+]i traces elicited by focal application of PACAP in intracardiac neurons in the absence and presence of 2-APB (50 M). 2-APB does not block the transient elevation in [Ca2+]i produced by either PACAP or caffe ine (Fig 3.5B). In contrast, 2-APB attenuated the increase in [Ca2+]i evoked by bath application of muscarine (5 M, Fig 3.5C), which is primarily due to release of Ca2+ from IP3-sensitive stores (Beker et al., 2003). Figure 3.5D shows a bar graph of the mean peak increase in [Ca2+]i evoked by PACAP, caffeine and muscarine in the absence and presence of 2-APB. Wher eas 2-APB significantly depressed the peak increases in [Ca2+]i evoked by muscarine from 107 25 nM to 31 8 nM, it had no effect on those elicited by PACAP or caffeine. Whereas the transient component of the PACAP-induced elevation in [Ca2+]i was unaffected by 2-APB, the sustai ned component was depressed in the presence of the drug (Fig 3.5A). In 6 identical experiments the PACAP-induced sustained increase in [Ca2+]i decreased from 66 7 nM to 30 6 nM (Fig 3.5E). Similarly, the sustained elevations in [Ca2+]i observed following application of caffeine or muscarine were also att enuated by 2-ABP (Figs 3.5E). At the concentration used here (50 M), 2-APB also directly blocks several subtypes of transient receptor potent ial (TRP) ion channels (Clapham et al., 2001). Therefore, these data s uggest that capacitative Ca2+ entry through transient

PAGE 63

49receptor potential channels contributes to the sustained elevation in [Ca2+]i evoked by VPAC receptor activation. PACAP and VIP Induced Excitability in Rat Intracardiac Neurons Earlier studies in intracardiac neurons from adult guinea pigs suggest that PACAP, but not VIP, modulates neuroexcitability in these cells (Braas et al., 1998). However, no such changes have been reported in neonatal rat intracardiac neurons (Cuevas and Adams, 1996; Liu et al., 2000). Data suggest that intracardiac neurons of these tw o species express different PACAP and VIP receptor subtypes (Braas et al., 1998; DeHaven and Cuevas, 2002), and thus the neuropeptides may have distinct cellular effe cts. For example, in contrast to observations reported here, application of PACAP has not been shown to effect [Ca2+]i in guinea pig intracardiac neurons. Thus, it seemed prudent to further investigate the effect of PACAP and VI P on the electrical properties of rat intrinsic cardiac neurons. Figure 3.6A s hows a family of r epresentative voltage responses elicited by 500 ms, 150 pA depolarizing current pulses from an isolated intracardiac neur on held under current-clamp mode using the whole-cell perforated patch method. Membrane responses were recorded in the absence (Control) and presence of bath appli ed PACAP-27 (100 n M), and following washout of the neuropeptide (Wash). A pplication of PACAP depolarized the neuron and increased the number of action potentials elicited by the current pulse. The PACAP evoked membrane depola rization was observed in a majority

PAGE 64

50of the cells tested (54 of 73 cells) (Fig 3.6B). The resting membrane potential (RMP) measured in intracardiac neurons was -52.0 0.6 mV under control conditions and depolarized to -47.7 0.7 mV in the presence of PACAP-27. The effect of PACAP on the RM P of these neurons was reve rsible upon washout of drug (-51.3 0.6). This difference was statis tically significant (p < 0.01). In most neurons tested the depolarizing current pulses evoked short, adapting trains of action potentials (46 of 73 neurons), whereas 15 neurons fired single action potentials and 12 neurons exhi bited tonic firing when challenged with similar current pulses. In a populat ion of neurons (42 of 73), the number of action potentials elicited was increased by 115%, from 3.2 0.3 to 6.9 0.5, by 100 nM PACAP-27 (Fig 3.6C). Fo llowing a 15 minute washout of the neuropeptide, the number of action potentials induced by the current pulses returned to near control levels (3.9 0.5). The increase in action potentials observed in the presence of PACAP was st atistically significant when compared to either control or washout. The population of neurons exhibiting augmented action potential firing included phasic adapting and tonic neurons. Thus, the effect of PACAP was not associated with a cell type with distinct active membrane properties. Examining the acti on potential characteristics of neurons that showed increased firing revealed that PACAP significantly decreased the action potential latency period from 6.0 0.7 ms to 4.7 0.5 ms (n = 7; p < 0.01) and increased the afterhyper polarization from -13.3 6.1 mV to -21.4 6 mV (n = 7; p < 0.05). However, other param eters including action potential duration and

PAGE 65

51overshoot were not altered (data not shown). It is important to note that the membrane depolarization and increase in action potential firing were not correlated, and only 30 of 73 cells s howed both a depolarization and increased action potential firing. This observation suggests that two distinct mechanisms are mediating these membrane responses. The effects of PACAP were in part mi micked by the related neuropeptide, VIP (Fig 3.7). Bath application of VI P depolarized a populatio n of neurons (8 of 13) from -47.3 1.7 to -44.5 1.5 (Fig 3.7B). This depolarization was of lesser magnitude than the PACAP-i nduced depolarization, but was statistically significant, and reversed upon washout of the peptide (-45.9 1.6). VIP affected a population of neurons simila r to PACAP (~60%). However, unlike PACAP, VIP had no effects on action potential firing in t hese cells (Fig 3.7C). The number of action potentials fired in response to 150 pA depolarizing current pulses before, during and after washout of 100 nM VIP were 2.8 0.5, 3.2 0.6 and 3.4 0.6, respectively. Membrane input resistance was inve stigated to determine whether the neuropeptide-induced changes in excitabili ty were associated with opening and/or closing of ion channel( s). Current pulses (-100 pA) were applied to elicit hyperpolarizations before, during and afte r PACAP or VIP (100 nM) application. The amplitude of the sustained hyperpolar ization was used to determine input resistances. Neither PACAP nor VIP signifi cantly altered the input resistance. This observation suggests that the neuropep tides are likely exerting their effects

PAGE 66

52by simultaneously opening and closing multip le membrane channels resulting in no net change in input resistance. Like wise, there was no correlation between changes in input resistance and PACAP-i nduced modulation of neuroexcitability in guinea pig intrinsic cardiac neurons (Braas et al., 1998). Increases in neuroexcitability evoked by PACAP and VIP are in part mediated by a VPAC receptor In order to substantiate that VPAC receptors contribute to the PACAP and VIP induced changes in intrinsic cardiac neuron excitability, the VPAC receptor antagonist [N-Ac-Tyr1, D-Phe2]-GRF (1-29) was used. Figure 3.8A shows representative action potentials evoked fr om a single neuron in response to a depolarizing current pulse (300 ms, 150 pA) in the absence and presence of 100 nM PACAP-27 and/or 100 nM [N-Ac-Tyr1, D-Phe2]-GRF (1-29). Whereas, PACAP depolarized the cell by 3.6 mV and in creased action potential firing in the cell when administered alone, PACAP fa iled to change the resting membrane potential when co-applied with [N-Ac-Tyr1, D-Phe2]-GRF (1-29) (PACAP-27 + YFGRF). Bath application of [N-Ac-Tyr1, D-Phe2]-GRF (1-29) alone (YF-GRF) had no direct effects on the active or passive membrane properties of the cell. In similar experiments, coapplication of [N-Ac-Tyr1, D-Phe2]-GRF (1-29) blocked PACAP-induced depolarizations in cells that were shown to significantly respond to the neuropeptide (Fig 3.8B). Figure 3. 8C shows a bar graph of the number of action potentials elicited by identical depo larizing current pulses in cells exposed

PAGE 67

53to PACAP prior to or followin g incubation in [N-Ac-Tyr1, D-Phe2]-GRF (1-29). While PACAP increased firing from 2.7 0.3 to 6.3 1.5 action potentials under control conditions, the neuropeptide had no effect on action potential firing following application of [N-Ac-Tyr1, D-Phe2]-GRF (1-29). Although VIP in part mimicked the depolarizing effects of PACAP, the magnitude of the VIP-induced depolarization was only ~60% of that elicited by PACAP. Also, VIP had no effects on action potential firing in these cells. This observation suggests that PAC1 receptors may also contribute to the PACAPinduced changes in the electrical properties of intracardiac neurons. To examine this hypothesis the PAC1-selective antagonist, M65, was used in a series of experiments to determine if inhibition of PAC1 receptors alters the PACAPevoked increase in excitability. Coapplication of M65 (10 nM) depressed both the PACAP-induced depolarizat ion and increase in action potential firing in neurons shown to respond to 100 nM PACAP-27 (Table 3.1). Surprisingly, bath application of maxadilan ( 10-100 nM) failed to produce depolarizations in these neurons (Table 3.1). Taken together these dat a suggest that stimulation of VPAC receptors increases neur oexcitability in intrinsic cardiac neurons, and that this increase in neuroexcit ability is enhanced by concu rrent activation of PAC1 receptors.

PAGE 68

54Effects of Ca2+-free extracellular conditions on PACAP-induced intracardiac neuroexcitability Our observation that stimulation of VPAC receptors evokes elevations in [Ca2+]i raises the possibility that this change in [Ca2+]i may contribute to the observed enhancement in neuroexcitability evoked by PACAP. This hypothesis is further supported by the noted associatio n of increases in the amplitude of the [Ca2+]i-dependent action potential afterhyperpol arization with augmented action potential firing in the cells. To det ermine the role of PACAP-induced Ca2+ mobilization in intracardiac neuroexcit ability, whole-cell perforated patch experiments were conducted in current-clamp mode under Ca2+-free extracellular conditions. In rat intracardiac neurons, removal of extracellular Ca2+ over a short period of time (minutes) not only prevents Ca2+ conductance through the plasma membrane, but also results in depletion of Ca2+ from internal stores (unpublished observation). Thus, PACAP-induced [Ca2+]i mobilization is blocked by washing the intracardiac neurons with Ca2+-free PSS. Figure 3.9A shows representative action potentials evoked from a neuron by depolarizing current pulses (300 ms, 150 pA) in the absence and presence of PACAP-27 (100 nM) under control conditions (2.5 mM Ca2+) and in Ca2+-free conditions (0 Ca2+, 1 mM EGTA). In the presence of external Ca2+, PACAP depolarized the neur on from -51.5 mV to 47.8 mV and increased the number of action potentials fired in response to the current pulse. However, PACAP failed to produce either of these changes when extracellular Ca2+ was removed. In similar experiments, Ca2+-free conditions

PAGE 69

55inhibited the ability of PACAP to alter the resting membrane potential (Fig 3.9B) and the action potential firing properties (Fig 3.9C) of neurons shown to respond to the neuropeptide under control conditi ons. In normal extracellular Ca2+ (2.5 mM), PACAP-27 (100 nM) depolariz ed the cells from -51.1 1.6 mV to -46.8 1.9 mV, whereas in Ca2+-free PSS the resting membr ane potential was -50.9 1.0 mV and -51.9 1.8 mV in the absence and pr esence of PACAP, respectively (n=6). Similarly, in 5 neurons that exhi bited increased action potential firing when PACAP was bath applied in PSS containing normal Ca2+ (2.5 mM), removal of extracellular Ca2+ abolished the neuropeptide-mediated effects (Fig 3.9C). Thus, PACAP-evoked changes in excitabili ty are dependent on the neuropeptideelicited elevation in [Ca2+]i. In order to confirm that in the absence of extracellular Ca2+ intracardiac neurons were capable of firing mult iple action potentials, 1 mM Ba2+ was bath applied in Ca2+-free PSS. Barium (1 mM) has previously been shown to block membrane K+ channels and to increase neuroexcit ability in intracardiac neurons (Xu, Z.J. and Adams, D. J., 1992). Under these Ca-free conditions barium significantly depolarized (p<0.01) t he intracardiac neurons from -51.1 1.9 mV to -43.8 1.5 mV and increased acti on potential firing (p<0.01) from a mean of 1.8 0.3 to 5.8 0.5 action potentials (n = 5) (data not shown) These effects were reversible upon washout of Ba2+. Thus, removal of extracellular Ca2+ does not prevent intracardiac neurons from ex hibiting increased neuroexcitability.

PAGE 70

56Effects of Ryanodine on PACAP-induced intracardiac neuroexcitability Electrophysiological experiments conducted under Ca2+-free conditions suggested that PACAP-induced changes in exci tability were at least in part due to the effect of the neuropeptide on [Ca2+]i. Further experiments were conducted to determine if PACAP-induced mobilization of Ca2+ from ryanodine-sensitive intracellular stores contributed to the in creased neuroexcitability observed in the presence of the neuropeptide. Figur e 3.10A shows representative action potentials evoked in response to a depolarizing current pulse (300 ms, 150 pA) during bath application of 100 nM PACAP27 before and after pr etreatment with ryanodine (10 M). Whereas, PACAP increased acti on potential firing in this cell under control conditions, preincubati on in ryanodine eliminated the PACAPinduced changes in firing characteristics. Moreover, preincubation in ryanodine also prevented PACAP from depolarizing the cell, since PACAP depolarized the cell by 3.7 mV under control conditions but failed to alter the resting membrane potential in the presence of ryanodine. In similar expe riments, preincubation in ryanodine blocked PACAP-induced depolarizations in cells that were shown to depolarize in the presence of the neuropeptide (Fig 3.10B). Figure 3.10C shows a bar graph of the number of action potentials ( SEM) elicited by identical depolarizing current pulses in cells ex posed to PACAP prior to and following incubation in ryanodine. Although PACAP increased firing from 1.7 0.3 to 5.3 0.9 action potentials under control c onditions, PACAP had no effects on action potential firing following application of ryanodine. This observation further

PAGE 71

57establishes elevations in [Ca2+]i as a obligatory component in the PACAP/VIP enhancement of excitability in these cells.

PAGE 72

58 FIGURE 3.1: PACAP and VIP, but not maxadil an, reversibly increase [Ca2+]i in neonatal rat intracardiac neurons. (A) Graph of change in [Ca2+]i ( [Ca2+]i), defined as peak [Ca2+]i minus baseline [Ca2+]i, as a function of time for single intracardiac neurons recorded before during and following 2 minute bath application of 100 nM PACAP-27 (black trace), 100 nM VIP (gray trace) and the PAC1-selective agonist maxadilan (10 nM) (dotted trace). The solid line above the traces indicates peptide application times. Individual images were captured at 0.5 Hz. (B) Bar graph of mean peak [Ca2+]i ( SEM) recorded before (baseline), during (drug) and following (wash) PACAP-27 (n=23), VIP (n=14) and maxadilan (n=7) application in different pr eparations. Asterisks denote significant difference (p<0.01) from respective baseline [Ca2+]i values. No significant difference exists between the PA CAP-27 and VIP induced responses.

PAGE 73

59

PAGE 74

60 FIGURE 3.2: PACAP-induced mobilization of [Ca2+]i in rat intracardiac neurons is via VPAC receptor activation. Representative traces of [Ca2+]i as a function of time recor ded from 3 neurons (A-C, respecti vely) in response to 100 nM PACAP-27 application in the absence (black traces) and pres ence (gray traces) of the PAC1 receptor antagonist, M65 (A, 100 nM), or the VPAC receptor antagonists L-8-K (B, 5 M) or [N-Ac-Tyr1, D-Phe2]-GRF (1-29) (C, YF-GRF, 100 nM). The solid line above the traces indicates PACAP-27 bath applicat ion times. All antagonists were pre-applied for 5 min prior to and during the administration of PACAP. (D) Bar graph of mean peak [Ca2+]i ( SEM) before (Baseline), during (Drug) and following washout (Wash) of PACAP or PACAP and the indicated PAC1/VPAC antagonists. Asterisk denotes significant difference (p<0.01) from the baseline [Ca2+]i recorded for each experimental condition; PACAP-27 (n = 19); M65 + PACAP-27 (n = 5), L-8-K + PACAP-27 (n=9), YF-GRF + PACAP-27 (n=5).

PAGE 75

61

PAGE 76

62FIGURE 3.3: The sustained, but not the transient, com ponent of the PACAP-induced increase in [Ca2+]i is dependent on extracellular Ca2+. (A) Typical traces of [Ca2+]i recorded from a single neuron in respon se to 2 min bath application of PACAP-27 (100 nM) in normal physi ological extracellular Ca2+ (Control, black trace) and Ca2+-free conditions (0 Ca2+, gray trace). Cells were exposed to the Ca2+-free PSS only during the PACAP applicat ion to prevent depletion of Ca2+ from intracellular stores. (B) Bar graph of mean peak [Ca2+]i ( SEM) before (Baseline), during (Drug) and following washout (Wash) of PACAP re corded in normal and Ca-free conditions (n=12) Asterisks denote significant difference (p<0.01) from baseline [Ca2+]i, and # denotes significant di fference from sustained [Ca2+]i evoked by PACAP in normal extracellular Ca2+. (C) Representative [Ca2+]i traces recorded in response to 1. 5 second application (arrow) of 500 M acetylcholine (ACh, gray trace) a nd 100 nM PACAP (black trace) from two ne urons preincubated in thapsigargin (20 M, 1 hr, 37 C). (D), Bar graph of m ean baseline and mean peak [Ca2+]i ( SEM) following addition (1.5 s) of acetylcholine (500 M), PACAP-27 (100 nM) and caffeine (5 mM ) in control neurons and neurons pretr eated for 1 hr in thapsigargin. Asterisks denote significant difference (p<0.01) from baseline [Ca2+]i. The # symbols denote significant difference (p<0.01) from control PAC AP and caffeine responses.

PAGE 77

63

PAGE 78

64 FIGURE 3.4: PACAP evokes a rapid trans ient elevation of [Ca2+]i in intracardiac neurons by releasing Ca2+ from caffeine/ryanodine-sensitive internal stor es. (A) Typical time courses of [Ca2+]i recorded in response to PACAP-27 (100 nM) application before (black trace) and af ter (dotted trace) preinc ubation in 5 mM caffeine (g ray trace). Caffeine was applied until [Ca2+]i baseline stabilized (~10 min) and continued through the PAC AP application (PACAP-27 + Caffeine) (B) Bar graph of mean [Ca2+]i ( SEM) evoked by 100 nM PACAP, 5 mM caffeine or 100 nM PACAP following 5 mM caffeine preincubation (n=6). Asteri sk denotes significant difference (p<0. 01) from the PACAP control. (C) Representative [Ca2+]i trace recorded in response to applicat ion of PACAP-27 (100 nM), ryanodine (10 M) or PACAP following ryanodine preincubation. PACAP wa s bath applied for 2 min, while ryanodine was applied for ~10 min. (D) Bar graph of mean [Ca2+]i ( SEM) recorded under t he same conditions as (C); n = 9 for each conditio n. Asterisk denotes significant difference (p<0. 01) from PACAP control peak [Ca2+]i.

PAGE 79

65

PAGE 80

66 FIGURE 3.5: The sustained, but not the transient, co mponent of the PACAP-induced increase in [Ca2+]i is blocked by 2APB. Shown are typical time courses of [Ca2+]i recorded in response to 100 nM PACAP -27 (A), 5 mM caffeine (B), or 5 M muscarine (C) before (Control, black trace) and after preincubation in 50 M 2-APB (+2-APB, gray trace). Each panel represents recordings obtained from a si ngle cell. 2-APB was applied for 10 min an d continued through the application of drug (PACAP, caffeine, or muscarine). Shown are bar graphs of mean peak [Ca2+]i ( S.E.M.) (D) and mean sustained [Ca2+]i ( S.E.M) (E) evoked by 100 nM PACAP-27 (n = 6), 5 mM caffeine (n = 7), or 5 M muscarine (n = 6) in the absence (Control) and presence of 50 M 2-APB (+2-APB). The asterisks denote signific ant difference (p < 0.01) from the corresponding control.

PAGE 81

67

PAGE 82

68 FIGURE 3.6: PACAP increases neuroexcitability in neonatal rat intracardiac neurons. (A ) Action potentials elicited from a single current-clamped neuron in response to 150 pA depolarizing current pulses in the absence (Control) and presence of 100 nM PACAP-27 (PACAP -27), and following washout of drug (Wash). (B) Scatter plot of mean resting membrane potential ( SEM) recorded under identical conditions as in (A) from 54 neurons. (C) Bar graph of the mean number of action potentials ( SEM) elicited by depolarizing current pulse (500 ms 150 pA) from neurons (n = 42) in the absence (Control) and presence of 100 nM PACAP ( PACAP) and following washout of the neuropeptide (Wash). Asterisks denote significant difference (p<0.01).

PAGE 83

69

PAGE 84

70 FIGURE 3.7: VIP-induced changes in neuroexcit ability within neonatal rat intracardi ac neurons. (A) Action potentials elicited form a single current-clamped neuron in response to 150 pA depolarizing current pulses in the absence (Control) and presence of 100 nM VIP (VIP), and following washout of drug (Wash). (B) Scatter plot of mean resting membrane potential ( SEM) recorded under identical conditions as in (A) from 8 neurons. (C) Bar graph of the mean number of action potentials elicited by depolarizing current pulse (300 ms 150 pA) from neurons (n = 8) in the absence (Control) and presence of 100 nM VIP (VIP) and following washout of the neuropeptide (Wash). As terisk denotes significant difference (p<0.01).

PAGE 85

71

PAGE 86

72 FIGURE 3.8: PACAP-induced changes in intracardiac neuroexcitability are inhibited by the VPAC antagonist [N-Ac-Tyr1, D-Phe2]-GRF (1-29). (A) Action pot entials evoked from a single intracardiac neuron by depolarizing current pulse (300 ms, 150 pA) in the absence (Control) and presence of 100 nM PACAP-27 (PACAP), 100 nM [N-Ac-Tyr1, D-Phe2]-GRF (129) (YF-GRF), or 100 nM [N-Ac-Tyr1, D-Phe2]-GRF (1-29) and 100 nM PACAP-27 (PAC AP-27 + YF-GRF). (B) Scatter plot of mean resting membrane potential (RMP) ( SEM) and (C ) bar graph of the average numb er of action potentials ( SEM) elicited by depolarizing current pulse (300 ms, 150 pA) for neurons (n = 7) studied under the same conditions as described above in (A), and following washout of the peptides (Wash). Asterisks denot e significant difference from control (p<0.01).

PAGE 87

73

PAGE 88

74 FIGURE 3.9: PACAP-induced changes in intracardiac neuroexcitability are blocked by removal of extracellular Ca2+ and depletion of internal Ca2+ stores. (A) Action potentials evoked in respons e to a depolarizing current pulse (300 ms, 150 pA) from a single intracardiac neur on in the absence and presence of 100 nM PACAP in normal PSS (Control; PACAP 100 nM) or in Ca2+-free PSS (Ca2+ 0 mM, EGTA 1 mM; Ca2+ 0 mM, EGTA 1 mM, PACAP), respectively. Cells were exposed to Ca2+-free PSS for ~10 min prior to the Ca2+-free experiments. (B) Scatter plot of mean resting membrane potential (RMP) ( SEM) recorded fr om 6 neurons under control and Ca2+-free conditions (0 Ca2+) in the absence (Control, Wash) and presence of bath appl ied PACAP-27 (100 nM; PACAP) (C) Bar graph of the average number of action potentials ( SEM) elicited by depolarizing current pulse (300 ms, 150 pA) in intracardiac ne urons studied under the same conditions as described for panel (B). Asterisks denote significant difference from control (p<0.01).

PAGE 89

75

PAGE 90

76 FIGURE 3.10: PACAP induced changes in intracardiac neuron exci tability are blocked by ryanodine. (A) Action potentials recorded from a single intracar diac neurons in response to a depolarizing current pulse (300 ms, 150 pA) in the absence (Control) and presence of 100 nM PACAP-27 (PACAP 100 nM) or fo llowing pretreated with ryanodine (10 M) for 10 min in the absence (Ryanodine) and presence (Ryanodine and PACAP) of bath applie d PACAP-27 (100 nM), and following washout of drugs (Wash). (B) Scatter plot of mean rest ing membrane potential (RMP) ( SEM) from 5 neurons using the same conditions as described in panel (A), with t he addition of the value obtained following washout of drugs (Wash). (C) Bar graph of the mean number of action potentials ( SEM) elicited by depolarizing current pulse (300 ms, 150 pA) on single intracardiac neurons (n = 3) using identical conditions as in panel (B). Asterisks denote significant difference from control (p<0.01).

PAGE 91

77

PAGE 92

78 TABLE 3.1: Effects of extracellular Ca2+ conditions and various inhibitors on th e PACAP-induced changes in membrane potential and action potential firing in response to a 150 pA current pulse. All neurons recorded under Ca2+-free, ryanodine, [N-Ac-Tyr1, D-Phe2]-GRF (1-29) (YF-GRF), and M65 conditions we re first shown to respond to PACAP-27 alone (data not shown), and control condition s shown indicate steady-state recordi ngs after pretreating the cells under each condition, respectively. Error Bars represent SEM for the number of cells shown in parentheses. Asterisks denote significant difference (p<0.01).

PAGE 93

79Treatment Membrane Potential (mV) Action Potential Firing PACAP Control Drug (n) Control Drug (n) 2.5 mM Ca2+ -52.0 0.6 -47.7 0.7* 54 3.2 0.3 6.9 0.5* 42 Ca2+-free -50.9 1.0 -51.9 1.8 6 3.6 0.6 3.7 1.1 4 Ryanodine -51.4 1.3 -52.3 1.3 5 2.0 0.6 2.3 0.9 3 M65 -52.2 2.7 -52.8 2.3 7 2.0 0.6 1.7 0.3 3 YF-GRF -50.8 1.7 -51.0 1.5 3 3.0 0.6 3.3 0.3 3 VIP -47.3 1.7 -44.5 1.5* 8 2.8 0.5 3.2 0.6 8 Maxadilan -50.9 1.9 -51.9 1.7 4 3.5 1.2 3.8 1.1 3 Caffeine -55.3 2.1 -55.9 2.0 4 3.5 1.0 3.5 1.2 4

PAGE 94

80 DISCUSSION The major finding reported here is t hat activation of VPAC receptors increases neuroexcitability in intrin sic cardiac neurons, and that concurrent activation of VPAC and PAC1 receptors results in a sy nergistic augmentation of neuroexcitability. Furthermore, t he PACAP and VIP mediated increase in excitability is dependent on VPAC receptor induced Ca2+ release from caffeineand ryanodine-sensitive in tracellular stores. Our studies show that bath applicat ion of VIP or PACAP evokes an elevation in intr acellular free-Ca2+ that is completely blocked by the VPAC receptor antagonists L-8-K and [N-Ac-Tyr1, D-Phe2]-GRF (1-29). Furthermore, the effects of PACAP and VIP we re not mimicked by the PAC1 selective agonist maxadilan. Taken together these data suggest that the effects of PACAP and VIP on [Ca2+]i are mediated by activation of VPAC receptors in these cells. Previous studies have shown that rat intracardiac neurons express three PAC1 receptor isoforms (PAC1short PAC1-HOP1, and PAC1-HOP2), as well as VPAC1 and VPAC2 receptors (DeHaven and C uevas, 2002). The predominant PAC1 receptor, PAC1-HOP, has been shown to evoke release of calcium from intracellular stores via both cAMP and IP3 pathways in various cell types including neuroepithelial cells, chromaffi n cells, astrocytes, and cortical neurons

PAGE 95

81(Grimaldi and Cavallaro, 2000; Zhou et al., 2001; Payet et al., 2003). However, our data indicate that stimulation of PAC1 has no direct effect on [Ca2+]i in neonatal rat intracardiac neurons. Ear lier studies using single-cell RT-PCR detected VPAC1 receptor transcripts in < 20% of neonatal rat intracardiac neurons, whereas VPAC2 receptor transcripts were expressed in > 90% the cells (DeHaven and Cuevas, 2002). In light of the fact that PACAP increase [Ca2+]i in over > 95% of the cells tested, VPAC2 receptors are likely to be mediating these increases. In contrast to PAC1 receptors, there is limited information concerning VPAC receptor mediat ed regulation of [Ca2+]i, and to date, there have been no reports of VPAC receptors ev oking elevations of [Ca2+]i in neurons. Stimulation of VPAC receptors with low concentrations of VIP (1 nM) has been shown to evoke calcium oscillations in pancreatic acinar cells (Kase et al., 1991). In contrast to our observations, however, hi gher concentrations of VIP (100 nM) failed to elicit elevations in [Ca2+]i and had an inhibitory effect on ACh-evoked [Ca2+]i responses in acinar cells (Kase et al., 1991). VPAC-mediated increases in [Ca2+]i have also been reported in the lymphoblastic MOLT4 and SUPT1 cells (Anton et al., 1993; Xia et al., 1996). Exogenously expressed VPAC1 and VPAC2 receptors have also been shown to stimulate [Ca2+]i in COS7 cells and chinese hamster ovary (CHO) cells (MacKenzie et al., 2001; Langer et al., 2001). The VPAC evoked increases in [Ca2+]i exhibited both a transient and a sustained component. The transient com ponent was observed in the absence of

PAGE 96

82extracellular Ca2+, but was blocked by ryanodine (10 M) or depletion of the Ca2+ stores by caffeine or thapsigargin. T hese results suggest that the transient component is due to VPAC mobilization of intracellular Ca2+, and more specifically, due to Ca2+ release from ryanodine-sensitive Ca2+ stores. In pancreatic and submandibular gland cells, VPAC receptor activation promotes Ca2+ oscillations via a phospholipase C (PLC)/IP3 cascade (Luo et al., 1999). Thus, in those secretory cells, VIP is likely increasing [Ca2+]i by evoking Ca2+ release from IP3-sensitive Ca2+ stores. Although rat intracardiac neurons also contain IP3-sensitive stores (Beker et al., 2003), our results with ryanodine and 2APB suggest that a PLC-IP3-IP3-receptor pathway is not involved in the VPAC receptor-induced increases in [Ca2+]i seen in these cells. Unlike the transient component, the VPAC-mediated sustained elevations in [Ca2+]i were abolished by removal of extracellular Ca2+, suggesting that they are due to calcium entry through the plas ma membrane. In various cell types, including T3-1 gonadotrophs (Rawlings et al., 1995) and HIT-T15 insulinoma cells (Leech et al., 1995), VPAC2 receptor activation has been reported to increase [Ca2+]i by enhancing Ca2+ entry through plasma membrane voltagegated Ca2+ channels. However, previous st udies have shown that VIP does not alter the biophysical properties of highvoltage-activated calcium channels in intracardiac neurons (Cuevas and Adam s, 1996). Furthermore, VPAC-mediated modulation of voltage-gated Ca2+ channels appears to involve a cAMP/PKA dependent mechanism (Rawlings et al., 1995; Leech et al., 1995), but in intrinsic

PAGE 97

83cardiac neurons the activator of adenylate cyclase, forskolin (100 M), failed to mimic the effects of PACAP and VIP on [Ca2+]i. Thus, the influx of Ca2+ observed following VPAC receptor stimulation is unlikely to be mediated by Ca2+ entry through voltage-gated Ca2+ channels. Given that the sustained component is only observed following Ca2+ release from the ryanodi ne-sensitive stores, and that it may also be produc ed by depletion of these stor es by caffeine (data not shown), it is likely mediated by storeoperated channels. This conclusion is supported by our observation that the sustained elevation in [Ca2+]i produced by PACAP is blocked by the TRP channel antagonist 2-APB. Depletion of caffeine/ryanodine-sensitive Ca2+ stores has previously been shown to evoke capacitative Ca2+ entry in both excitable and non-ex citable cells (Weigl et al., 2003; Xue et al., 2000). We have now shown that, in addition to increasing [Ca2+]i, VIP and PACAP enhance neuronal excitability in intr insic cardiac neurons. However, the effects on excitability produced by these neuropeptides are not identical. These differences may shed light into possible dist inct roles for the two neuropeptides in the regulation of intracardiac neurons, and thus of the cardiovascular system. Bath application of PACAP or VIP results in a depolarization of intrinsic cardiac neurons. While PACAP has previously been shown to depolarize guinea pig intracardiac neurons, VIP had no effect on the excitability of those cells (Braas et al., 1998). The observation that VIP depolar izes intracardiac neurons and that VPAC-specific antagonists block PACAP-induced depolarizations suggests that

PAGE 98

84VPAC receptors directly influence neuroexcit ability in rat intracardiac neurons. VPAC receptor activation has been show n to depolarize thalamic relay and medial pontine reticular formation neur ons by 2-3 mV (Lee and Cox, 2003; Kohlmeier and Reiner, 1999), which is sim ilar to the VIP-induced depolarizations reported here (2.4 0.4 mV). The observation that maxadilan, a PAC1 receptor specific agonist (Moro and Lerner, 1997), does not evoke a depolarizat ion of intracardiac neurons or increase action potential fi ring suggests that PAC1 receptors do not have a direct effect on neuroexcitability in these cells. PAC1 receptor activation, however, potentiates VPAC receptor-induced depolarizations. Evidence for this conclusion is provided by two observations report ed here: 1) PACAP depolarizes neurons to a greater extent t han VIP, and 2) the PAC1 receptor antagonist, M65, depressed PACAP induced depolarizations. Furthermore increases in action potential firing in response to depolarizing current pulse s were only observed under conditions in which both PAC1 and VPAC receptors were stim ulated, that is, when PACAP was used as the agonist and neither PAC1 nor VPAC receptor-specific antagonists were applied. Thus, simultaneous PAC1 and VPAC receptor stimulation elicits a syner gistic enhancement of neuroexcitability and produces changes in the active membrane properties that are not seen wit h stimulation of either receptor alone. The VPAC-mediated increases in [Ca2+]i appear to be critical for the enhanced neuroexcitability of intracardiac neurons by PACAP. PACAP failed to

PAGE 99

85depolarize intracardiac neurons and to increase action potential firing when applied in the presence of ryanodine, when t he intracellular stores were depleted with caffeine, or in the absence of extracellular Ca2+. It is interesting to note that caffeine had no direct effects on neuroexc itability (Table 3.1), and thus Ca2+ release from intracellular stores is nec essary, but not sufficient to promote enhanced neuroexcitability. Muscarinic re ceptor activation has been shown to depolarize intracardiac neurons and to augment action potential firing in these cells (Xu and Adams, 1992). Recent studies have shown that muscarinic receptor activation mobilizes Ca2+ from intracellular stores in intracardiac neurons (Beker et al., 2003). Even though inhibition of the K+ conductance, IM, appears to be a major factor contributing to muscari nic-receptor induced neuroexcitability in these neurons (Xu and Adams, 1992), it w ould be of interest to determine if muscarine-induced increases in [Ca2+]i also play a role in the enhanced neuroexcitability, and thus if mobilization of intracellular [Ca2+]i is a mechanism by which various excitatory neurotransmitters regulate the electrical properties of intrinsic cardiac neurons. In conclusion, the pres ent study demonstrates t he first evidence of VPAC receptor-mediated regulation of intracellular Ca2+ in neurons, and shows that by increasing [Ca2+]i, VPAC receptors enhance neuroexcitability. Furthermore, our results demonstrate that the heterogeneity in PAC1 and VPAC receptors observed in intracardiac neurons has signific ant implications for the effects of the neuropeptides on cellular function. T he ability of PACAP to depolarize the

PAGE 100

86neurons and increase action potential fi ring is dependent on PACAP stimulation of both PAC1 and VPAC receptors. VIP, by acting exclusively on VPAC receptors, evokes a depolar ization of lesser magnit ude than PACAP and fails to increase action potential firing. The abili ty of PACAP and VIP to differentially influence the electrical activity of intr acardiac neurons may also help explain why these related neuropeptides have distinct effects on the cardiovascular system. While both PACAP and VIP have been shown to dilate coronary arteries and to produce positive chronotropic effects (Karas awa et al., 1990; Hirose et al., 1997; Champion et al., 1996), PACAP, but not VIP, evokes pronounced negative chronotropic and negative inotropic effect s that are mediated by activation of intrinsic cardiac neurons (Hirose et al., 1997).

PAGE 101

87 CHAPTER 4 REPETITIVE VPAC2 RECEPTOR-MEDIATED CALCIUM ELEVATIONS IN INTRACARDIAC NEURONS IS DEPENDENT ON Ca2+, cADPR AND STOREOPERATED CALCIUM (SOC) ENTRY INTRODUCTION The intracardiac ganglion is capab le of independently regulating the mammalian heart, and the pituitary adenyla te cyclase activating polypeptide (PACAP) and vasoactive intestinal polypep tide (VIP) have signi ficant effects on the cardiovascular system. Experiments in our laboratory and by Parsons and colleagues (Braas et al., 1998; Merriam et al., 2004; Braas et al., 2004) have given insight into how these neuropeptides may be regulating cardiac function via the modulation of intrinsic cardiac neur ons. Our studies have recently shown that activation of the PACAP (PAC1) and VIP (VPAC) receptors in neonatal rat intracardiac neurons increases neuroexci tability in these cells, and that simultaneous activation of VPAC and PAC1 receptors results in a synergistic enhancement of excitability (DeHaven and Cuevas, 2004). Importantly, it seems the neuropeptide mediated increase in excitability is dependent on VPAC receptor induced elevations in intracellular calcium ([Ca2+]i) that arise from both

PAGE 102

88release of Ca2+ from ryanodineand caffeine-sensit ive stores, and calcium entry through the plasma membrane. While our studies showed that VPAC receptors mediate this effect, neither the specif ic VPAC receptor in volved nor the signal transduction system coupling the VPAC recept or to the ryanodine receptor have been identified. Furthermore, t he ion channel facilitating Ca2+ through the membrane has not been unequivocally determined. Similar to intracardiac neurons, activation of PACAP receptors in bovine adrenal medullary cells has been shown to release Ca2+ from ryanodineand caffeine-sensitive intracellu lar stores independent of IP3 receptor activation (Tanaka et al., 1998). Interestingly, the PACAP-evoked release from the internal stores was found to be mediated by a Na2+-influx-dependent membrane depolarization (Tanaka et al., 1996). Furt hermore, the depolarizing effects of PACAP were shown to be independent of Ca2+. However, the PACAP-induced changes in neuroexcitability in intr acardiac neurons appear dependent on the release of Ca2+ from these intracellular st ores (DeHaven and Cuevas, 2004). Thus, it seems unlikely that PACAP is regulating the ryanodine receptors in intracardiac neurons the same way as the peptide does in bovine adrenal medullary cells. Ryanodine receptors are regulated by num erous factors, including the physiological agents Ca2+, ATP, Mg2+ and cyclic ADP-ribose (cADPR), as well as various cellular processes, including phosphorylation (Fill and Copello, 2002). Both Ca2+ and cADPR have been suggested as the endogenous ligands of neuronal ryanodine rec eptors (Sitsapesan et al., 1995;

PAGE 103

89Thomas et al., 2001; Li et al., 2001), and the data presented here suggest that Ca2+ and cADPR are both crucial elements in the regulation of ryanodine receptors in isolated rat intracardiac neurons by VPAC2 receptors. Pharmacological studies with 2-APB suggest the plasma membrane component of the PAC AP and VIP elicited Ca2+ response is through transient receptor potential (TRP) channels. TRP ch annels are a member of a large family of non-selective cation channels expre ssed in neurons, skeletal and smooth muscle, and in non-excitable cells (Clapham 2003). In excitable cells such as neurons, the opening of TRP channels has tw o significant effects, depolarization of the cell, and sustai ned elevation of [Ca2+]i. The TRP family of ion channels is divided into several branches, incl uding the TRPC (canonical), TRPM (melastatin) and TRPV (vanilloid) subfam ilies, as well as the distant TRP channels, TRPP, TRPA and TRPML. So me members of the TRPC channel subtype appear to be activated directly by diacylglycerol (Clapham, 2003). However, significant controversy exists as to the mechanisms regulating TRPC activity. For example, TRPC3 has been shown to directly couple to IP3 receptors in order to activate the channel (Z hang et al., 2001). Conversely, in IP3 knockout cells, muscarinic receptor activation of PLC and DAG signaling activated TRPC3, independent of IP3 receptors (Venkatachalam et al ., 2001). Furthermore, some members of the TRPC channel family are bel ieved to be activated as a result of elevations in intracellular free Ca2+ or by depletion of intracellular Ca2+ stores (Clapham, 2003).

PAGE 104

90Earlier studies in intracardiac neurons suggested that a TRP-like channel is activated following VPAC receptor-induced Ca2+ release from ryanodine/ caffeine-sensitive stores. This channel was not activated when VPAC receptors were stimulated but Ca2+ mobilization was inhibited (DeHaven and Cuevas, 2004). Thus, TRP channels in intracardi ac neurons appear to be regulated by either elevations of [Ca2+]i and/or by depletion of the ryanodine/caffeine-sensitive stores. In many non-neuronal and neuronal cell types, the depletion of intracellular Ca2+ stores causes activation of plasma membrane store-operated (SOC) channels (Putney, 1986; Berridge, 1995; Parekh and Penner, 1997). The physiological functions of the store-operated Ca2+ channels include the maintenance of proper Ca2+ levels in the intracellular stores, and the generation of prolonged Ca2+ signals beyond those provided by the intracellular messengers inositol (1,4,5)-trisphosphate (IP3) and cyclic ADP ribose (cADPR) (Putney, 2004). The most widely studied current involved in this capacitative Ca2+ entry is the Ca2+-release-activated Ca2+ current (ICRAC) (Hoth and Penner, 1992). However, unlike TRP channels, ICRAC is a divalent cation-selective channel that is characteristically found in hematopoietic cells and not neurons. Furthermore, the currents activated by Ca2+-store depletion in other ce ll types maintain different electrophysiological properties compared to the ICRAC. Data presented here show PACA P elevates intracellular Ca2+ in these intracardiac neurons through the activation of VPAC2 receptors, and that mobilization of intracellular calcium from ryanodineand caffeinesensitive

PAGE 105

91internal stores by VPAC2 is dependent on Ca2+ and cADPR, and not adenylyl cyclase activity. The sustained component of the PACAP-evoked elevations in [Ca2+]i are, indeed, through SO C channels, and further pharmacological evidence suggests TRPC channels are the underlyi ng channels mediating the capacitative Ca2+ entry. Finally, 2-APB inhibit ed these neurons from repetitive VPAC2 mediated increases in [Ca2+]i, suggesting a role for TRP channels in VPAC2 receptor-elicited changes in neuroexcitability seen in ra t intracardiac neurons.

PAGE 106

92 METHODS Cell culture The preparation and culture of isolated intrinsic cardiac neurons has been previously described (Fieber and Adam s, 1991). Dissociated neurons were plated onto poly-L-lysine coated glass coverslips and incubated at 37C for 36-72 h under a 95% air, 5% CO2 environment prior to the experiments. Microfluorometric measurements The calcium sensitive dye fura-2 acetoxymethylester (fura-2-AM) was used for measuring intracellular free calcium concentrations ([Ca2+]i) in intracardiac neurons at room temperature, as previous ly described (Smith and Adams, 1999). Briefly, a 1 mM fura-2 -AM stock was made using DMSO as the solvent. Cells plated on coverslips we re then incubated for 1 hour at room temperature in physiological saline so lution (PSS) consisting of (in mM): 140 NaCl, 3 KCl, 2.5 CaCl2, 1.2 MgCl2, 7.7 glucose and 10 HEPES (pH to 7.2 with NaOH), which also contained 1 M fura-2-AM and 0.1 % dimethyl sulfoxide (DMSO). The coverslips were then was hed in PSS (fura-2-AM free) prior to the experiments being carried out. All solutions were applied via a rapid application system identical to that previous ly described (Cuevas and Berg, 1998).

PAGE 107

93A Sutter DG-4 high-speed wavelength s witcher (Sutter Instruments Co., Novato, CA) was used to apply alternating excitation with 340 nM and 380 nM ultraviolet light via a liqui d light guide. Fluorescent emission at 510 nm was captured using a Cooke Sensicam digi tal CCD camera (Cooke Corporation, Auburn Hills, MI) and recorded with Slide book 3.0 software (Intelligent Imaging Innovations, Denver, CO) on a Pentiu m IV computer. Changes in [Ca2+]i were calculated using the Slide book software (Intelligent Im aging Innovations, Denver, CO) from the intensity of the emitted fluorescence following excitation with 340 and 380 nm light, respectively, using the equation: [Ca2+]i = Kd Q (R-Rmin)/(Rmax-R) where R represents the fluorescence intensity ratio (F340/F380) as determined during experiments, Q is the ratio of Fmin to Fmax at 380 nm, and Kd is the Ca2+ dissociation constant for fu ra-2. Calibration of t he system was performed using the Molecular Probes (Eugene, OR) Fura-2 Calcium Imaging Calibration Kit and values were determined to be: Fmin/Fmax (23.04), Rmin (0.31), Rmax (8.87). Reagents and statistical analysis All chemicals used in this investigati on were of analytic grade. The following drugs were used: Dimethyl sulfoxide (DMSO), 2-aminoethoxyd iphenylborate (2APB), 8-bromo-cyclic adenosine diphosphat e ribose (8-Br-cADPR), lanthanum chloride, 1-oleoyl-2-acetyl-sn-glycerol (OAG), menthol, capsaicin and caffeine (Sigma-Aldrich, St. Louis, MO); PACA P-27, PACAP(6-38) (American Peptide

PAGE 108

94Co., Sunnyvale, CA); forskolin (Alomone Lab s, Jerusalem, Israel); and fura-2-AM (Molecular Probes, Eugene, OR). All dat a are presented as the mean SEM of the number of observations indicated. Statistical analysis was conducted using SigmaPlot 8 (SPSS, Chicago, IL) and paired t -tests were used for within group comparisons.

PAGE 109

95 RESULTS VPAC2 receptors mediate PACAP-induc ed elevations in free [Ca2+]i Our laboratory recently discovered that in neonatal rat intracardiac neurons, PACAP and VIP significantly elevates intracellular calcium levels, and furthermore, these increases in free [Ca2+]i are mediated through VPAC receptors and not PAC1 (DeHaven and Cuevas, 2004). Earlier studies using single-cell RT-PCR detected both VPAC1 and VPAC2 receptor transcripts in rat intracardiac neurons (DeHaven and Cuev as, 2000). To determine the specific VPAC receptor subtype medi ating these effects, PAC AP(6-38), a truncated form of PACAP-38 which selectively inhibits VPAC2 at the concentrations used here (100 nM) was applied simultaneously with PACAP-27. Changes in [Ca2+]i were then measured using fura-2 mediated Ca2+-imaging. Figure 4.1A shows representative traces of change in [Ca2+]i ( [Ca2+]i) as a function of time for a single intracardiac neuron in response to 2 minute PACAP-27 (100 nM) in the absence (black trace) and presence (gra y trace) of 100 nM PACAP(6-38). PACAP(6-38) pretreatment in this ce ll reduced the PACAP-m ediated elevations in [Ca2+]i. In six similar experiments, PAC AP(6-38) significantly decreased elevations in [Ca2+]i evoked by PACAP from 410.9 72.9 nM to 219.4 23.0 nM,

PAGE 110

96a 44.4% peak decrease (Fig 4.1B). Thus, VPAC2 receptors mediate the PACAP and VIP induced elevations in [Ca2+]i in rat intracardiac neurons. Forskolin does not increase [Ca2+]i in intracardiac neurons As the name implies, the pituitar y adenylyl cyclase-activating polypeptide (PACAP) was originally discovered to incr ease the activity of adenylyl cyclase in the pituitary gland, and thus elevate cAMP levels (Miyata et al., 1989). Thus, involvement of the AC-cAMP-PKA cascade in the VPAC2 receptor-mediated [Ca2+]i increases in intracardiac neurons was tested by directly activating adenylyl cyclase with forskolin (10 M). Figure 4.2A depicts typical traces of [Ca2+]i as a function of time for a single intracardiac neuron in response to 6 minute caffeine (5 mM) (black trace) or forskolin (10 M) (gray trace) app lications. In all intracardiac neurons tested (n = 15) forskolin failed to elevate [Ca2+]i, yet these same neurons did respond to caffeine (posit ive control) (Fig 4.2B). Forskolin application times were varied (2 min to 16 min) to ensure enough time to activate the AC-cAMP-PKA cascade. These dat a suggest that intracardiac neuron elevations in [Ca2+]i through caffeineand ryanodine-sensitive stores are independent of the AC-cAMP-PKA cascade. Role for cADP-ribose in the PACAPelicited signal transduction cascade In addition to cAMP, t he intracellular second messenger, cADPR, has been shown to mobilize Ca2+ from ryanodine sensitive st ores. To date, neither

PAGE 111

97PAC1 nor VPAC receptors have been linked to the production of cADPR. However, it seemed prudent to determine if this Ca2+-releasing signal metabolite is involved in the VPAC2-ryanodine receptor pathway. For these experiments, the cell permeable cADPR ant agonist, 8-Br-cADPR (1 M), was used. Figures 4.3A and 4.3C show representat ive traces of change in [Ca2+]i as a function of time recorded from different isolated intr acardiac neurons in response to 100 nM PACAP-27 (A) or 5 mM caffeine (C) applicat ions in the absence and presence of 8-Br-cADPR (1 M). While 8-Br-cADPR alone had no effect on [Ca2+]i, it did inhibit the PACAP-induced mobilization of [Ca2+]i in this neuron (Figure 4.3A). However, on a different intracardiac neuron, 1 M 8-Br-cADPR had no effect on a caffeine mediated increase in [Ca2+]i (Figure 4.3C), as predi cted from results in other studies (Prakash et al., 2000). In 7 similar experiments, 8-Br-cADPR significantly inhibited the PACAP-m ediated mean peak increases in [Ca2+]i, from 260.7 31.6 nM to 144.1 14.8 nM, a 45% decrease in peak Ca2+ influx (Figure 4.3B). Nonetheless, figure 4.3D show s no effect of the cell permeable 8-BrcADPR on caffeine-induced increases in [Ca2+]i (caffeine alone: 336.9 34.4 nM; + 8-Br-cADPR: 371.2 34.7 nM) (n=9). T hese data suggest that in intracardiac neurons VPAC2 receptors couple to ryanodine re ceptors via a cADPR dependent pathway. However, the binding site s for cADPR and caffeine on the neuronal ryanodine receptors appear to be different. These data support previous findings which suggest a different binding site for caffeine and cADPR on the ryanodine receptor (Walseth and Lee, 1993; Prakash et al., 2000).

PAGE 112

98 Effects of Menthol and Capsaicin on [Ca2+]i As previously mentioned, severa l subfamilies of TRP channels exist, including TRPC, TRPM and TRPV. While TRPC channels are the most widely implicated TRP channel s in store-operated Ca2+ entry, TRPV and TRPM activation may elevate [Ca2+]i in intracardiac neurons. Ca2+ imaging experiments were performed using menthol and caps aicin in order to determine if the activation of certain TRPV or TRPM receptors increase [Ca2+]i in rat intracardiac neurons. Menthol has been shown to acti vate the TRPM8 channels (Hu et al, 2004; Tsuzuki et al., 2004), and capsaicin has been shown to activate TRPV1 channels (Hu et al, 2004; Krause et al., 2005). Figure 4.4A shows changes in [Ca2+]i traces elicited by 6 minute applications of menthol (10 M) or capsaicin (1 M) onto different isolated intracardiac neurons. Neither menthol nor capsaicin elevated [Ca2+]i in intracardiac neurons (Fig 4.4B), suggesting that TRPM8 and TRPV1 do not play a role in the sustained phase of the Ca2+ response in these cells. Furthermore, 2-APB is a common activator of TRPV1, TRPV2 and TRPV3 (Hu et al, 2004), and activation of t hese receptors by 2-APB elevates [Ca2+]i. However, 2-APB alone had no effects on the cytosolic Ca2+ concentration in neonatal rat intracardiac neurons. Ta ken together, these data suggest that TRPV1, TRPV2, TRPV3 and TRPM8 channels do not play a role in the sustained phase of the VPAC2 receptor-evoked Ca2+ response in neonatal rat intracardiac neurons. Since a considerable number of studies have implicated each of the

PAGE 113

99TRPC channels as store-operated channe ls, and because 2-APB, menthol, and capsaicin elicited no changes in cytosolic free Ca2+ levels, we propose that TRPC channels are the likely candidate for the sustained component of the [Ca2+]i elevations seen in neonatal rat intracardiac neurons. La3+ blocks VPAC2 mediated Ca2+ responses and TRPC channels in intracardiac neurons. Lanthanum was used to investigate both the ryanodine receptors and the TRPC channels in rat intracardiac neurons. The regulation of ryanodine receptors directly by Ca2+ has been widely established in the literature (Fill and Copello, 2002). However, in isolated intracardiac neurons, VPAC2 receptor activation induces an initial, transient mobilization of [Ca2+]i from caffeineand ryanodine-sensitive stores which appears to be regulated by cADPR, and not Ca2+. Nonetheless, experiments were per formed with lanthanum in order to determine the intracardiac neuronal r egulation of ryanodine receptors by Ca2+. Furthermore, lanthanum (La3+), a trivalent cation that inhibits all membrane Ca2+ channels, including volt age-gated, store-operated Ca2+ and TRPC channels (Aussel et al., 1996; Halaszovich et al., 2000; Beedle et al., 2002) will provide insight to the sustai ned elevation of [Ca2+]i which appears to be mediated by activation of TRPC channels. The concentration of La3+ used (100 M) in these experiments was selected because this is the concentration shown previously to maximally inhibit TRPC channels (Takai et al., 2004). Figures 4.5A, B and C

PAGE 114

100show changes in [Ca2+]i traces elicited by 2 minut e application of PACAP-27 (100 nM), caffeine (5 mM) or muscarine (5 M) onto different isolated intracardiac neurons in the absence and presence of La3+ (100 M). Lanthanum alone produced no significant m easurable changes in [Ca2+]i, and did not block the transient elevation in [Ca2+]i produced by caffeine (Fig 4.5C) or muscarine (Fig 4.5B). However, 100 M La3+ significantly reduced the peak change in [Ca2+]i ( [Ca2+]i) mediated by PACAP receptor activa tion in this neuron, from 139.5 nM to 16.2 nM (Fig 4.5A). Figure 4. 5D shows a bar graph of the mean peak increase in [Ca2+]i evoked by PACAP, caffeine and muscarine in the absence and presence of La3+. While La3+ significantly inhibited the peak Ca2+ response to PACAP (n = 7; 137.7 17.9 nM to 24.5 8.0 nM), La3+ had no effect on the peak increases in [Ca2+]i evoked by caffeine (n = 11) or muscarine (n = 4) (caffeine: 330.1 60.9 nM to 285.9 38.6 nM; muscarine: 88.7 23.2 nM to 95.7 22.4 nM). Thus, it seems likely that while IP3 receptor-mediated elevations in Ca2+ in intracardiac neurons are not directly dependent on Ca2+, ryanodine receptorevoked Ca2+ elevations are dependent on Ca2+ regulation. Furthermore, caffeine-mediated increases in Ca2+, by directly acting on the ryanodine receptors and sensit izing them to Ca2+, do not directly depend on Ca2+ influx through La3+-sensitive plasma membrane channels. Also, because La3+ had no effect on the peak increases in [Ca2+]i evoked by caffeine, La3+ does not enter the cell and alter ryanodine receptors directly.

PAGE 115

101 Because the transient component of the PACAP-induced elevation in [Ca2+]i was blocked by La3+, the sustained component was also significantly abolished (Figure 4.5A,E). Therefore, La3+ would give us li ttle insight to the sustained component of the Ca2+ responses in neonatal rat intracardiac neurons. However, the transient component of the caffeine-and muscarine-evoked elevation in [Ca2+]i was unaffected by La3+, and therefore would allow us to determine whether the su stained component of Ca2+ responses in these cells are mediated through La3+ (and 2-APB) sensitive TRPC channels. Figures 4.5B and C show that unlike the peak Ca2+ responses, the sustained Ca2+ increases mediated by caffeine and muscarine in these cells are largely reduced by application of 100 M La3+. While the caffeine-mediated sustained increase in [Ca2+]i decreased from 92.6 11.8 nM to 15.7 5.4 nM, the muscarine-evoked sustained Ca2+ response decreased from 31.1 1.8 nM to 3.2 4.8 nM (Fig 4.5E). These data further support the obser vation that TRPC channels contribute to the sustained elevation in [Ca2+]i evoked by VPAC2 receptor activation. PACAP evoked Ca2+ influx through store-operated channels (SOC) While TRPC receptors are implic ated as the channels underlying storeoperated Ca2+ entry, the link between receptor activation and channel gating is undetermined. Many of the TRPC c hannels that have be en implicated in capacitative Ca2+ entry have also been shown to be activated by the intracellular messenger sn -1,2-diacylglycerol (DAG) (Hu et al, 2004; Venkatachalam et al.,

PAGE 116

1022003). Thus, we wanted to see the effect s of the cell permeable analog of DAG, 1-oleoyl-2-acetyl-sn-glycerol (OAG), on intracellular Ca2+ levels in isolated intracardiac neurons. Figure 4.6A shows the change in [Ca2+]i elicited by a 6 minute bath application of 100 M OAG. In all neuron s tested (n=23), OAG failed to elevate [Ca2+]i (Fig 4.6B), suggesting that TRPC channels in neonatal rat intracardiac neurons are not regulated by DAG. The paradigm that we used to dem onstrate that the TRPC channels mediating the sustaine d component of the Ca2+ response are store-operated Ca2+ (SOC) channels is based on a depletio n of internal stores with drug (PACAP-27 or caffeine) under Ca2+ free conditions (+1 mM EGTA). After store depletion, application of extracellular Ca2+ results in Ca2+ influx through the plasma membrane store-operated channels. Figure 4.7A shows typical traces of change in [Ca2+]i ( [Ca2+]i) as a function of time for 2 minute applications of 100 nM PACAP-27 (PACAP), 5 mM caffei ne (Caffeine) and no drug (PSS) under Ca2+ free conditions (solid line above traces), followed by the introduction of 2.5 mM Ca2+ (dashed line above traces). Bo th PACAP and caffeine released Ca2+ from intracellular stores under Ca2+ free conditions (+ 1 mM EGTA), and the introduction of 2.5 mM Ca2+ in the external medium elevated [Ca2+]i above control levels (PSS alone) under both conditions. In six similar experiments, PACAPand caffeine-mediated release of Ca2+ from intracellular stores under Ca2+ free conditions caused significant increases in Ca2+ influx through the plasma membrane after Ca2+ was introduced to the medium, when compared to PSS

PAGE 117

103alone (Figure 4.7B). Under 0 Ca2+ (+ 1 mM EGTA), 100 nM PACAP increased [Ca2+]i from 68.3 4.1 nM to 210.2 46.4 nM, a 210% increase. The application of 2.5 mM Ca2+ to the extracellular medium of neurons treated with PACAP increased the [Ca2+]i to 122.5 12.3 nM. Th us, the peak store-operated component of the VPAC2 elicited Ca2+ elevations was 58% of the peak elevations in [Ca2+]i caused by internal store release. Similar percentages were seen for caffeine. Figure 4.7C shows a bar graph of change in [Ca2+]i ( [Ca2+]i) measured for PACAP, caffeine and PSS alone, under calcium free (0 Ca2+) or 2.5 mM Ca2+ conditions. Thus, the TRPC component of VPAC2 receptor-evoked elevations in [Ca2+]i is dependent on extracellular Ca2+ and is activated by the internal store depletion in intracardiac neurons. The SOC channel component of the PACAP-induced Ca2+ response is blocked by 2-APB We previously showed that the sustained component of the Ca2+ response in these isolated intracardiac neurons is completely abolished by the TRPC channel antagonists, 2-APB and La3+. Furthermore, figure 4.7 showed the depletion of internal stores by PACAP under Ca2+-free conditions activates SOC channels located in the plasma memb rane. However, the question remains whether the SOC channels are the sa me as the 2-APB-sensitive TRPC channels. Figure 4.8 shows that the PACAP-mediated Ca2+ response through SOC channels is significantly inhi bited by the pretreatment with 50 M 2-APB.

PAGE 118

104PACAP-27 (100 nM) was applied to isol ated intracardiac neurons under Ca2+ free conditions (1 mM EGTA) for ~5 min to ensure comp lete store depletion from PACAP–sensitive pools, and t he return to baseline Ca2+ levels. The reintroduction of Ca2+ (2.5 mM) to the extrac ellular solution evoked a Ca2+ influx through SOC channels, similar to what was s hown in figure 4.7. However, in the presence of 50 M 2-APB, the influx of Ca2+ through these SOC channels was significantly blocked. Figures 4.8A and B depict typical traces of changes in [Ca2+]i as a function of time for 100 nM PACAP(Fig 4.8A) and 5 mM caffeine(Fig 4.8B) mediated activation of SOC c hannels, before (black traces) and after (gray traces) application of 2-APB. In 6 similar recordings, pretreatment with 2APB significantly reduced the VPAC2 receptor-mediated influx of Ca2+ through SOC channels by more than 80%, from 102.4 12.2 nM to 18.9 1.4 nM (Fig 4.8C). Similarly, caffeine-mediated SO C channel activation was also significantly blocked by the application of 2-APB (~75% decrease) (n = 7). Thus, the storeoperated component is the same as the 2-APB-sensitive co mponent of the Ca2+ response in neonatal rat intracardiac neurons. 2-APB blocks VPAC2 receptor mediated repetitive Ca2+ responses Store-operated calcium entry (SOC), also known as capacitative calcium entry, plays an essential role in calciu m signaling, where it can generate signals directly or serve to replenish the inter nal stores in order to generate repetitive calcium increases. Several models have been established to describe how

PAGE 119

105internal stores regulate SOC through the plasma membrane, including the existence of diffusible messengers, or through a direct protein-to-protein interaction (Putney et al.,2001; Berridge, 1995). We wanted to investigate the role of SOC in generating repetitive Ca2+ increases in our isolated intracardiac neurons. Figure 4.9 depicts repet itive elevations of [Ca2+]i mediated by VPAC2 receptor activations or caffeine, block ed by the TRP channel antagonist, 2-APB. This figure shows representative traces of change in [Ca2+]i ( [Ca2+]i) as a function of time recorded from single neurons in response to 100 nM PACAP-27 (Fig 4.9Ai) or 5 mM caffeine (Figur e 4.9Aii) application, in the absence and presence of 2-APB (50 M). Figure 4.9B shows a bar graph of mean peak [Ca2+]i for the first and second bath applications of caffeine or PACAP, before (Control) or during (+ 2-APB) 2-APB applicat ion. Importantly, under the presence of 2-APB, neither PACAP nor caffei ne were capable of eliciting a Ca2+ response after the initial peak response occurred. While the initial peak response to PACAP was 107.2 20.3 nM under 2APB conditions, the repetitive 2nd application of PACAP only increased [Ca2+]i to 22.2 5.5 nM, a 80% decrease in the peak [Ca2+]i. Identical to what was previously published (DeHaven and Cuevas, 2004), figure 4.9C depicts a bar graph of mean sustained [Ca2+]i detailing that in these intracardiac neur ons, 2-APB significantly inhibits the sustained component of the VPAC2 receptor mediated elevations in intracellular calcium. Thus, the SOC is essent ial in replenishing the internal Ca2+ stores of

PAGE 120

106intracardiac neurons, and as a result, r egulates repetitive elevations of [Ca2+]i in mammalian intracardiac neurons.

PAGE 121

107 FIGURE 4.1: PACAP-induced mobilization of [Ca2+]i in rat intracardiac neurons is via VPAC2 receptor activation. (A) Repres entative traces of change in [Ca2+]i ( [Ca2+]i), defined as peak [Ca2+]i minus baseline [Ca2+]i, as a function of time recorded from a single neuron in response to 100 nM PACAP-27 application in the absence (black trace) and pres ence (gray trace) of the PAC1 and VPAC2 receptor antagonist, PACAP(6-38) (100 nM). The solid line above the traces indicates PACAP-27 bath application times. All antagonists were pre-applied for 5 min prior to and during the administrat ion of PACAP. (B) Bar graph of mean peak [Ca2+]i ( SEM) before (Baseline), during (Drug) and following washout (Wash) of PACAP or PACAP and PACAP(6-38) (n = 7). Asterisks denote significant difference (p<0.01) from the baseline [Ca2+]i recorded for each experimental condition; # symbol denotes significant di fference (p<0.01) from control PACAP responses.

PAGE 122

108

PAGE 123

109 FIGURE 4.2: Forskolin does not increase free cytosolic calcium concentrations in isolated rat intracardiac neurons. (A) Representative traces of change in [Ca2+]i ( [Ca2+]i) as a function of time recorded from a single neuron in response to 5 mM caffeine (black trace) application and 10 M forskolin (gray trace). The solid line above the traces indicates ca ffeine and forskolin bath application times for this cell (6 min). In other similar experiments, fo rskolin was bath applied in a time range from 2 to 16 min, and similar results were seen under all conditions. (B) Bar graph of mean peak [Ca2+]i ( SEM) before (Baselin e), during (Drug) and following washout (Wash) of forskolin (white) or caffeine (black) (n = 15). Asterisk denotes significant differenc e (p<0.01) from the baseline [Ca2+]i recorded.

PAGE 124

110

PAGE 125

111 FIGURE 4.3: The putative ryanodine receptor activator, cADP ri bose, is involved in the PACAP-elicited signal transduction cascade. (A) Typical time courses of [Ca2+]i recorded in response to PACAP-27 (100 nM) application before (black trace) and after (gra y trace) preincubation in 1 M 8 Br-cADP ribose. 8 Br-cADP ribose was applied for ~10 min prior to and continued through the PACAP application (8 Br-cADP ribose + PACAP). (B ) Bar graph of peak [Ca2+]i ( SEM) evoked by 100 nM PACAP or 100 nM PACAP following 1 M 8 Br-cADP ribose preinc ubation (n=7). Asterisks denote significant differences (p<0.01) from baseline, and # sign denotes significant differ ence from PACAP control peak [Ca2+]i. (C) Representative [Ca2+]i trace recorded in response to application of caffeine (5 mM) or caffeine following 1 M 8 Br-cADP ribose preincubation. Caffeine was applied for 1 mi n, while 8 Br-cADP ribose wa s applied for ~10 min. (D) Bar graph of peak [Ca2+]i ( SEM) recorded under the same conditions as (C ); n = 9 for each condition. Asterisks denote significant differences (p<0.01) from respective baselines.

PAGE 126

112

PAGE 127

113 FIGURE 4.4: Neither capsaicin nor menthol elicit any changes in [Ca2+]i in neonatal rat intracardiac neurons. (A) R epresentative traces of change in [Ca2+]i ( [Ca2+]i) as a function of time recorded from two different neurons in response to either 1 M capsaicin (black trace) or 10 M menthol (gray trace). The solid line above the traces indicates bath applicati on times. (B) Bar graph of mean peak [Ca2+]i ( SEM) before (Baseline), during (Drug) and following washout (Wash) of capsaicin (n=16) or menthol (n = 16).

PAGE 128

114

PAGE 129

115 FIGURE 4.5 : La3+ blocks VPAC2 receptor mediated Ca2+ responses and the sustained component of the Ca2+ responses in neonatal rat intracardiac neurons. Typical time courses of [Ca2+]i recorded in response to 100 nM PACAP-27 (A), 5 mM caffeine (B), or 5 M muscarine (C ) before (Control, bla ck trace) and after preincubation in 100 M La3+ (+La3+, gray trace). Each panel represents record ings obtained from a single cell. La3+ was applied for 10 min and continued through the application of drug (PACAP, caffeine or muscarine). Bar graph of mean peak [Ca2+]i ( SEM) (D) or mean sustained [Ca2+]i ( SEM) (E) evoked by 100 nM PACAP-27 (n = 7), 5 mM caffeine (n = 11), or 5 M muscarine (n = 4) in the absence (Control) and presence of 100 M La3+ (+ La3+). Asterisks denote significant difference (p<0.01) from the corresponding control.

PAGE 130

116

PAGE 131

117 FIGURE 4.6: The TRPC agonist, 1-oleoyl-2-acet yl-sn-glycerol (OAG), does not increase [Ca2+]i in neonatal rat intracardiac neurons. (A) Representative traces of change in [Ca2+]i ( [Ca2+]i) as a function of time re corded from two different neurons in response to 100 M OAG (black trace). The so lid line above the trace indicates bath application times. (B) Bar graph of mean peak [Ca2+]i ( SEM) before (Baseline), during (Drug) and follo wing washout (Wash) of OAG (n=23).

PAGE 132

118

PAGE 133

119 FIGURE 4.7: Internal store depletion by PACAP or caffeine activates SOC channels. (A) Representativ e traces of change in [Ca2+]i ( [Ca2+]i) as a function of time recorded from a si ngle neuron in response to 2 minute bath application of 100 nM PACAP-27 (black trace), 5 mM caffei ne (gray trace) or nothing (dotted trace), in the absence (+1 mM EGTA) and presence of 2.5 mM Ca2+. The solid line above the traces indicates Ca2+ free conditions, while the dashed line indicates introduction of 2.5 mM Ca2+ in the bath solution. (B) Bar graph of mean peak [Ca2+]i ( SEM) under control (Baseline), 0 Ca2+ (0 Ca2+ Peak), and physiological Ca2+ (2.5 mM Ca2+ Peak) conditions, in the presence of 100 nM PACAP(black), 5 mM caffeine (gray) or no drug (PSS) (n = 6). Asterisks denote significant difference (p<0.01) from the baseline [Ca2+]i recorded for each experimental condition; # symbol denotes si gnificant difference (p<0.01) from the PSS response. (C) Bar graph ( SEM) of peak change in [Ca2+]i ( [Ca2+]i) for application of PACAP, caffeine and no drug (PSS) under no extracellular Ca2+ (0 Ca2+) and physiological extracellular Ca2+ (2.5 mM Ca2+) conditions (n = 6). Data was collected from the same cells as shown in (B), and # denotes significant difference from PSS alone condition.

PAGE 134

120

PAGE 135

121 FIGURE 4.8: SOC channel activation by PACAP is inhibited by 2APB. (A) Representative traces of change in [Ca2+]i ( [Ca2+]i) as a function of time recor ded from a single neuron in respons e to bath application of 2.5 mM Ca2+ before (black trace) and after (gray trac e) the treatment with 50 M 2-APB. PACAP-sensitive internal Ca2+ stores were depleted by 100 nM PACAP-27 application under Ca2+ free conditions (+1 mM EGTA ) (~5 min). Recordings st arted (time = 0 min) after cytosolic free Ca2+ levels returned to baseline following PACAP or caffein e application. The solid line above the traces indicates PACAP application under Ca2+ free conditions, while the dashed line indicates introduction of 2.5 mM Ca2+ in the bath solution. (B) Same as (A), except 5 mM caffeine in the place of PACAP in or der to deplete caffeine-sensitive internal Ca2+ stores. (C) Bar graph of mean peak change in [Ca2+]i (Peak [Ca2+]i), before (black) and after (gray) 2-APB treatment, evoked by the application of 2.5 mM Ca2+ after the internal store depletion by PACAP (n = 6) and caffeine (n = 7). Asterisks denote significant difference (p<0.01) from cont rol responses recorded for each experimental condition.

PAGE 136

122

PAGE 137

123 FIGURE 4.9: Repetitive elevations of [Ca2+]i mediated by VPAC2 receptor activations are blocked by 2-APB. Representative trace of change in [Ca2+]i ( [Ca2+]i) as a function of time recorded from a single neuron in response to 5 mM caffeine (i) or 100 nM PACAP-27 (ii) applicat ions in the absence and presence of 2-APB (50 M). The solid lines above the trace indicate 2 minute caffe ine or PACAP bath application times, and the dashed line indicates 2-APB application times. (B) Ba r graph of mean peak [Ca2+]i ( SEM) for the first and second bat h applications of caffeine or PACAP, before (Control) or during (+ 2APB) 2-APB application. Aste risks denote significant difference (p<0.01) from the first application and # symbol denotes signifi cant difference (p<0.01) from control responses. (C) Bar graph of mean sustained [Ca2+]i ( SEM) for the first and second bath applications of ca ffeine or PACAP, before (Control) or during (+ 2APB) 2-APB application. Asteris ks denote significant difference (p<0.01) from t he first application. (caffeine: n=5; PACAP: n=6).

PAGE 138

124

PAGE 139

125 DISCUSSION The major finding reported here is t hat PACAP-induced elevations in [Ca2+]i in intrinsic cardiac neurons are mediated by the activation of VPAC2 receptors that couple to ryanodine-sensitive Ca2+ stores via a signal transduction cascade involving Ca2+ and cADPR. Furthermore, we show pharmacological evidence that VPAC2 receptor activation results in the opening of TRP channels, most probably TRPC. These channels open in response to depletion of Ca2+ evoked mobilization of Ca2+ from intracellular stores, and are thus functioning as store-operated channels that m ediate capacitative calcium entry. In c ontrast to previous reports on some native TRPC receptors (Venkatachalam et al, 2003; Grimaldi et al., 2003; Hu et al., 2004), TRPC channels mediat ing the sustained Ca2+ response in intracardiac neurons are not activated by DAG. Our laboratory has previously shown that rat intracardiac neurons express three PAC1 receptor isoforms (PAC1-short, PAC1-HOP1, and PAC1-HOP2), as well as VPAC1 and VPAC2 receptors (DeHaven and Cuevas, 2002), and activation of VPAC receptors mediates PACAPand VIP-elicited elevations in [Ca2+]i (DeHaven and Cuevas, 2004), as well as influences the electrical properties of the cell. These dat a are the first to show that VPAC2 receptors

PAGE 140

126mediate the PACAPand VIP-induc ed increases in cytosolic Ca2+ concentrations in neonatal rat intracardiac neurons. Our results are supported by the fact that VPAC1 receptor transcripts were detec ted in less than 20% of neonatal rat intracardiac neurons, whereas VPAC2 receptor transcripts were expressed in > 90% the cells (DeHaven and Cuevas, 2002). While VPAC1 receptors can couple to AC (Ishihara, T. et al., 1992), VPAC2 receptors can additionally activate the PLC -IP3-PKC cascade (Lutz et al., 1993; Inagaki et al., 1994). Moreover, PACAP-mediated increases in [Ca2+]i have been linked to both AC and PLC activation (Payet et al., 2003; Tanaka et al., 1996; Grimaldi an d Cavallaro, 2000); however, neither of these pathways appears to be critical in the VPAC2 receptor mediated increases in [Ca2+]i in neonatal rat intracardiac neurons. The activation of VPAC2 receptors and subsequent increase in [Ca2+]i in rat intracardiac neurons is not directly a ssociated with increased levels of cAMP. The mechanisms by which PACAP and VIP increase [Ca2+]i appears to differ from cell-type to cell-type. For example, in five main cell-types of the rat anterior pituitary, PACAP raises [Ca2+]i three different ways: vi a cAMP, phospholipase C (PLC) and a third unknown novel mec hanism (Alarcon and Garcia-Sancho, 2000). In fetal human chromaffin cells, PACAP elevates [Ca2+]i through caffeineand ryanodine-sensitive internal stores and forskolin causes an identical elevation in [Ca2+]i to PACAP (Payet et al., 2003). Pharmacological evidence with specific PKA antagonists showed t hat the PACAP-induced release of Ca2+ from caffeineand ryanodine-sensitive stores occurs through the AC-cAMP-PKA

PAGE 141

127cascade in fetal human chromaffin cells. However, in neonatal rat intracardiac neurons, the AC-cAMP-PKA cascade does not play a direct role in the VPAC2 receptor-mediated elevations in [Ca2+]i. Although the AC-cAMP-PKA intracellular signal pathway does not directly increase [Ca2+]i in these intracardiac neurons, our experiments do not rule out the possib ility that cAMP may have a different role in PACAP modulation of neuroexci tability seen in these cells. PAC1 activation in isolated guinea pig intracardiac neurons has been shown to enhance the cAMP-regulated, hyperpolarizati on-activated nonselective cationic conductance, Ih (Merriam et al., 2004). Ih has previously been demonstrated in neonatal rat intracardiac neurons by elec trophysiology techniques (Cuevas et al., 1997). Cyclic ADP-ribose (cADPR) was first shown to elevate [Ca2+]i in sea-urchin eggs (Clapper et al., 1987), and it has since been shown to mobilize Ca2+ from intracellular stores in a wide variety of cell types (Lee, 2001), including canine and murine autonomic neurons (Smyth et al., 2004). Convincing pharmacological evidence sugges ts that cADPR may be an endogenous modulator of the ryanodine receptor (RYR) (Perez et al, 1998; Locuta et al, 1998). For instance, the elev ations of intracellular Ca2+ mediated by cADPR have been shown to be blocked by specific RYR inhibitors and enhanced by caffeine (Galione et al, 1991; Lee, 1993; Lee et al, 1995). Both the synthesis (ADP-ribosyl cyclase activity) and the degradat ion (cADPR-hydrolase activity) of cADPR are mediated by the orphan rec eptor, CD38 (Takasawa et al., 1993;

PAGE 142

128Zocchi et al., 1993). However, a paradox exists because of the extracellular production of cADPR by CD38, and few data are available to explain the transport of extracellular cADPR into the cell (Franco et al., 1998). This paradox can partially be solved by the fact t hat experimental evidence has shown CD38like activity away from the plasma membrane and associated with several intracellular organelles, including the mitochondria (Liang et al., 1999) and endoplasmic reticulum (Bacher et al., 2004) Our data shown here suggests that in isolated intracardiac neurons, VPAC2 receptor mobilization of Ca2+ through caffeineand ryanodine-sensitive internal stores is dependent on the production of cADPR. However, caffeine was una ffected by the bath application of the antagonist, 8-Br-cADPR. These data suppo rt previous findings which suggest a different binding site for caffeine and cA DPR on the ryanodine receptor (Walseth and Lee, 1993; Prakash et al., 2000). Lanthanum experiments performed here show that the VPAC2 receptor mobilization of Ca2+ through caffeineand ryanodine-se nsitive internal stores is dependent on a small Ca2+ influx through the plasma membrane. However, the channel underlying these e ffects is yet to be dete rmined. Furthermore, the effects of La3+ on membrane Ca2+ channels appears to be faster than the exchange of Ca2+ in bathing solution, since experiments performed under Ca2+ free conditions failed to block the VPAC2 receptor-evoked release of Ca2+ from ryanodine-sensitive internal stores (see Fig 3.3). All three known ryanodine receptor types (RYR1, RYR2 and RYR3 ) have been shown to be regulated by

PAGE 143

129Ca2+, both on the cytosolic and luminal surfac es of the receptors (Meissner, G., 2004). While RYRs are activated by high-affinity, Ca2+ specific binding sites, these receptors are also inhibited by the binding of Ca2+ to low affinity, less specific sites, giving rise to the characteristic bimodal Ca2+ dependence of channel activity (Meissner, 2004). Howeve r, micromolar concentrations of Ca2+ are required to fully activate the RYR; t herefore, it seems unlikely to be the only essential regulator of RYRs in neurons. More likely, several key players, such as Ca2+, cADPR, ATP and calmodulin are requ ired to activate RYRs. Experiments shown here with La3+ and 8-Br-cADPR support this hypothesis. Our earlier studies failed to show any intracellular Ca2+ events that preceded the release of [Ca2+] from the ryanodine/caffeine-sensitive st ores. Thus, it seems likely that La3+ is not inhibiting a PACAP-induced me mbrane influx, but rather blocking a Ca2+ leak channel that maintains [Ca2+]i at levels which permit cADPR activation of the RYR. Given that 2-APB did not block PACAP-induced activation of the RYR, this leak channel is a distinct mo lecular entity from the TRPC channel. However, we cannot exclude the possibi lity that PACAP is promoting a Ca2+ influx that is below our threshold for det ection. Further, we can not exclude the possibility that 100 M La3+ directly blocks PACAP binding to the VPAC2 receptors, leading to the inhibition of VPAC2 receptor-mediated Ca2+ responses under the presence of La3+. Capacitative calcium ent ry through store-operated Ca2+ channels plays an essential role in Ca2+ signaling. We show here t hat the PACAP activation of

PAGE 144

130VPAC2 receptors in rat intracar diac neurons stimulates Ca2+ influx through TRP channel antagonist-sensitiv e store-operated channels; however, the mechanisms underlying the link between the intracellular stores and the TRP channels remains to be determined. A number of models have been proposed to explain how internal stores can regulate SOC c hannels in the plasma membrane. Some models suggest the existence of diffusi ble messengers, whereas others consider that information may be transferred more directly through a protein-protein interaction (Putney et al.,2001; Berridge, 1995). Many of the TRPC channels that have been implicated in capacitative Ca2+ entry have also been shown to be activated by the intracellular messenger sn -1,2-diacylglycerol (DAG) (Hu et al, 2004; Venkatachalam et al., 2003). However, application of 100 M 1-oleoyl-2acetyl-sn-glycerol (OAG) failed to increase [Ca2+]i in these intracardiac neurons, suggesting that in intrinsic cardiac neurons these ion channels primarily function as store-operated channels. While the mechanisms linking store-operated calcium channels to intracellular Ca2+ stores remain elusive, the ph ysiological roles for capacitative Ca2+ entry is more clearly defined. Store-operated Ca2+ channels maintain proper Ca2+ levels in the endoplasmic reticulum and generate prolonged Ca2+ responses (Putney, 2004). However, the ma jority of literature on physiological functions of the SOC channels comes fr om studies on muscle and non-excitable cells, not neurons. These data show that the SOC channels present in these rat intracardiac neurons, indeed, function to replenish the intracellular Ca2+ stores,

PAGE 145

131and that activation of these channels is necessary to preserve functional responses to PACAP. Given that TR PC channels are also activated upon Ca2+ release from intracellular stores elicited by muscarinic receptor activation, TRPC channels are likely to be important in preserving responses to other neurotransmitters as well. In conclusion, the pres ent study demonstrates t he first evidence of VPAC2 receptor mediated regula tion of intracellular Ca2+ in neurons, and shows that Ca2+ and cADPR play a part in the signal transduction cascade mediating these effects. Furthermore the store-operated Ca2+ channels present in these neurons pharmacologically resemble TRPC channe ls, and these channels are crucial in the ability of the cells to replenish intracellular Ca2+ stores.

PAGE 146

132 CHAPTER 5 CANONICAL TRANSIENT RECEPTOR POTENTIAL (TRPC) CHANNELS REGULATE NEUROEXCITABILITY IN RAT INTRACARDIAC NEURONS INTRODUCTION The modulation of excitability of intracardiac neurons by PACAP and VIP is in part dependent on elevations of intracellular calcium (Ca2+). These elevations in calcium result from both mobilization of Ca2+ from ryanodineand caffeine-sensitive intracellu lar stores and capacitative Ca2+ entry through the plasma membrane. While inhibition of Ca2+ release from intracellular stores has been shown to abolish the enhancement of neuroexcitability induced by these neuropeptides, less is known about t he role of the capacitative Ca2+ entry on the electrical properties of these neurons Furthermore, the store-operated Ca2+ (SOC) channels mediating this phenomenon have not been fully characterized. Given the importance of intrinsic cardiac neurons in the regul ation of the heart, understanding mechanisms regulating the ex citability of these cells is of significant interest. Moreover, th e relationship between SOC channels and neuroexcitability in peripheral and c entral neurons remans poorly understood,

PAGE 147

133and thus insight into how these io n channels influence passive and active membrane properties of intracardiac neurons may have broad implications. Previously, our laboratory showed that the SOC channe ls present in intracardiac neurons pharmacologically resemble short transient receptor potential (TRPC) channels, inhibited by both 2-aminoethoxydiphenylborate (2APB) and lanthanum (La3+). Interestingly, inhibiti on of these TRPC channels block the ability of the intracardiac neurons to sequentially elevate free intracellular calcium concentrations ([Ca2+]i) mediated by VPAC2 receptor activation. VPAC2 receptor regulation of TRPC channels may underlie the changes in the resting me mbrane potential (RMP) and neur oexcitability seen in the presence of PACAP in these cells. TRP channels are a large family of non-selective cation channels expressed in neurons and other non-excitable cells. Originally discovered as the Drosophila photoreceptor channels (Montell and Rubin, 1989; Wong et al, 1989; Phillips et al., 1992; Xu et al., 2000), TRP channels are composed of tetrameric assemblies of six transmembrane spanning un its. Three main subfamilies exist based on sequence homology: canonical TRP (TRPC), melastatin TRP (TRPM) and vanilloid TRP (TRPV) channels, and heteromers can be formed by members of each same subfamily. While the Ca2+ permeability makes them transducers leading to elevations in [Ca2+]i, the non-selective cationic nature of TRP channels makes them depolarizing channels.

PAGE 148

134 The ionic mechanisms underlying the PACAPand VIP-evoked changes in the resting membrane potential (RMP) and neuroexcitability remain unclear. TRPC channels, thought to be the store-operated component of the Ca2+ response in intracardiac neurons, ma y in part explain the increased neuroexcitability and depolarizations s een in the presence of PACAP. The present study examined the effects of the TRPC channel antagonist, 2APB, on neuroexcitability of neonatal rat intracar diac neurons. These data show that 2APB decreases the number of action potentia ls elicited by small depolarizing current pulses. The reduction of acti on potentials occurs because of a 2-APBmediated hyperpolarization of the re sting membrane potential (RMP) and significant decrease in the action potent ial afterhyperpolarization (AHP) in intracardiac neurons. While the effects of 2-APB on the RMP suggests a direct role for TRPC channels on intracardiac neuroexcitability, the effects of 2-APB on the AHP suggests TRPC regulation of Ca2+ activated K+ channels in intracardiac neurons. Outward membrane currents under lying these effects produced by 2APB indeed support the indirect inhibition of such a Ca2+ activated K+ conductance. These data support our hy pothesis that the store-operated phase of the PACAP-evoked increase in [Ca2+]i, through TRPC channels, in part leads to the changes in neuroexcitability seen with PACAP administration in neonatal rat intracardiac neurons.

PAGE 149

135 METHODS Electrophysiology The 2-APB effects on neuroe xcitability were investigated in isolated intracardiac ganglion neurons of neonatal ra ts (4-7 day old), as previously described (Fieber and Adams, 1991). Co verslips containing the dissociated neurons were transferred to a 0.5 mL recording chamber mounted on a phasecontrast microscope (400X). The ex tracellular recording solution was physiological saline solution (PSS) consis ting of (in mM): 140 NaCl, 3 KCl, 2.5 CaCl2, 1.2 MgCl2, 7.7 glucose and 10 HEPES (pH to 7.2 with NaOH). All drugs were bath applied in PSS. Ca2+-sensitive and -insensitive K+ channel currents were isolated by adding tetrodotoxin (TTX, 400 nM) to the PSS to inhibit voltage activated Na+ channel currents. Ac tion potentials and currents were amplified and filtered (5 kHz) using an Axoclamp200B Amplifier, digitized with a 1322A DigiData digitizer (20kHz), and collected on a Pentium IV computer using the Clampex 8 program (Axon Instruments, Inc., Foster City, CA, USA). Data analysis was conducted using the pClamp 8 program, Clampfit. The whole-cell perforated-patch variat ion of the patch-clamp recording technique was used, as previously describ ed (Horn and Marty, 1988; Rae et al.,

PAGE 150

1361991; Xu and Adams, 1992). This configurat ion preserves intracellular integrity, preventing the loss of cytoplasmic components and subsequent alteration of functional responses of these neurons (Cuevas and Adams, 1996; Cuevas et al., 1997). The pipette solution contained (mM): 75 K2SO4, 55 KCl, 5 MgSO4, 10 HEPES, 198 g/ml amphotericin B, and 0.4% DMSO. Final patch pipette resistance was 1.0 to 1.3 M to permit maximal electrical access under the present recording configuration. Membrane potential responses to a depolar izing current pulse (-150 pA) were determined in the absence and presence of various drugs. The mean resting membrane potential, peak am plitude (overshoot), ri se and decay slope, and amplitude of afterhyperpol arization (AHP) were determined in the absence and presence of 2-APB. Membrane currents were elicited by step depolarization from -60 mV to +120 mV, or an applied voltage ramp from -120 mV to +50 mV. Reagents and statistical analysis All chemicals used in this investigati on were of analytic grade. The following drugs were used: Dimethyl sulfoxide (DMSO), tetraethylammonium salt (TEA), tetrodotoxin (TTX), 2-aminoethoxydiphe nylborate (2-APB), lanthanum chloride, and cadmium chloride (Sigma-Aldrich, St. Louis, MO); and paxilline, apamin, charybdotoxin, iberiotoxin, slotoxin (Alom one Labs, Jerusalem, Is rael). All data are presented as the mean SEM of the number of obse rvations indicated.

PAGE 151

137Statistical analysis was conducted using SigmaPlot 8 (SPSS, Chicago, IL) and paired t -tests were used for within group comparisons.

PAGE 152

138 RESULTS 2-APB decreases action potential (AP) firing in rat intracardiac neurons Earlier experiments (see Figure 3. 5) showed that 2-APB effectively blocked the store-operated channel, TRPC, activated by VPAC2 receptors in intracardiac neurons. Therefore, this drug was used to determine the role of TRPC in the active and passive membr ane properties of intr acardiac neurons. The effects of 2-APB on action potential firi ng in rat intracardiac neurons were investigated using the whole-cell perfo rated patch technique under current clamp mode. Figure 5.1A shows a family of voltage responses elicited by 800 msec depolarizing current pulses (150 pA) fr om an isolated intracardiac neuron. Voltages were recorded in the absence (Control) and presence of 50 M 2-APB (2-APB), and following washout of the drug (Wash). Application of 2-APB reduced the number of action potentials fire d in this neuron from 19 under control conditions to 8 during bath application of 2-APB, and this effect was completely reversible. In 9 neurons studied, the depolarizing current pulses evoked accommodating trains of action potent ials in 4 cells (adapting neurons), sustained firing of action potentials in 3 cells (tonic neurons), and a single action potential in 2 cells. These data coincide with previously published reports on the

PAGE 153

139firing properties of neonatal rat intr acardiac neurons (DeHaven and Cuevas, 2004). While 2-APB did not inhibit firing in neurons firing single action potentials, this drug reduced the number of action potentials elicit ed by depolarizing current pulses in both accommodating (adapting) and tonic neurons. In neurons firing multiple action potentials (adapting and tonic), 2-APB significantly reduced the number of action potentials by ~50%, from 12.4 2.4 to 6.1 1.0 action potentials fired (Fig 5.1B). 2-APB-evoked changes in the si ngle action potential waveform To gain insight into the underlying cause of the reduction in action potential firing evoked by bath application of 2-APB, current clamp experiments were performed to look at the single action potential wave form parameters. Figure 5.2A shows single action potentials elicited from brief depolarizing pulses (100 pA) before (Control), during (2-APB) and after (Wash) bath application of 50 M 2-APB. 2-APB hyperpolarized the intrac ardiac neuron from -55.9 mV to -61.1 mV, and reduced the afterhyperpolarization (A HP) by ~10 mV, from -17.9 mV to 4.6 mV. Along with the significant re sting membrane potential (RMP) and AHP changes evoked by 2-APB, the TRP channel antagonist was also shown to alter the rise and decay slope of the single action potential, with the latter being a significant change (-14.2 3.3 mV/sec to -12.8 3.5 mV/sec). The effects of 2APB on the action potential waveform conf iguration are summarized in Figure 5.2B. Similar findings on RMP, AHP and rise and decay slope were made with

PAGE 154

140100 M La3+ (Data not shown), which inhibi ts voltage gated ion channels and TRP channels (Aussel et al., 1996; Halaszovi ch et al., 2000; Beed le et al., 2002). The effects of 2-APB on the action potential AHP suggests a role for TRP channel regulat ion of Ca2+ activated K+ channels in rat intracardiac neurons (Franciolini et al., 2001). The effects of various direct acting (charybdotoxin, paxilline, iberiotoxin, slotoxin, apamin, TEA) and indirect acting (Ca2+ free PSS, La3+, Cd2+) Ca2+ activated K+ channel blockers on action potential waveform and AHP were investigated in isolated rat in tracardiac neurons. Using the perforatedpatch whole-cell recording technique, neurons were held at -50 mV under current clamp conditions, and single action potentials were evoked by 100 pA depolarizing current pulses for 100 msec. In terestingly, neither of the specific BK channel toxins, charybdotoxin (100 nM, n= 5) and paxilline (200 nM, n=5), or the SK channel toxin, apamin (100 nM, n=4) e licited any changes in rat intracardiac neuron waveform parameters, including the relative AH P (Fig 5.3C,D,E). Iberiotoxin (10 nM) and slotoxin (10 nM) also had no effects on relative AHP (Data not shown). Conversely, TEA ( 500 M), which has been shown to inhibit BK channels in rat intracardiac neurons (F ranciolini, F. et al., 2001), increased the action potential duration by decr easing the decay slope; however, no significant change in the relative AHP wa s seen (Fig 5.3A,E). Furthermore, the indirect acting Ca2+ activated K+ channel blockers Cd2+ (100 M) and La3+ (10100 M), and the replacement of extracellular Ca2+ with Mg2+ (Ca2+-free PSS), significantly reduced the relative AHP in intracardiac neurons by 30%, 58% and

PAGE 155

14139%, respectively (Fig 5.3B,E). T hus, these data show 2-APB significantly reduces the decay slope and AHP in rat intracardiac neurons, as well as hyperpolarizes these cells. These effects are in part mimicked by La3+, Ca2+-free PSS, TEA and Cd2+; yet, none of the specific toxins for Ca2+ activated K+ channels alter the action potential waveform parameters. Therefore, the identity of the channel mediating the AHP remains to be determined. Membrane currents underlying the 2APB-elicited changes in action potential properties To analyze the effects of 2-APB on intracardiac neuron membrane K+ currents, outward currents evoked by 20 mV steps from -60 mV to +120 mV were recorded before (Control), dur ing (2-APB) and after (not shown) bath application of 50 M 2-APB (Fig 5.4A). The net 2APB sensitive current (2-APB Sensitive) was determined by subtracting the curr ent remaining after 2-APB application from that observed under c ontrol conditions (Control) (F ig 5.4A, bottom). The 2APB-sensitive current, and thus the TRPC channel regulated K+ current in these neurons, exhibits pronounced time-dependent inactivation at positive potentials, but such inactivation was not observed at negative potentials. Figure 5.4B shows the current-voltage relationship of both the mean peak 2-APB-sensitive current ( ) and the mean sustained 2APB-sensitive current ( ), determined at the location of the arrows shown in figure 5.4A, for 4 neurons. The 2-APBsensitive current activated at potent ials positive to -60 mV, and maximal

PAGE 156

142activation occurs near +100 mV. T he 2-APB-sensitive peak and sustained current densities at +120 mV were 106.4 37.2 mV and 20.2 12.9 mV, respectively.

PAGE 157

143 FIGURE 5.1: 2-APB induced changes in the number of action potentials fi red in neonatal rat intracardiac neurons. (A) Action potentials elicited from a single current-clamped neuron in response to 150 pA depolarizing current pulses (800 msec) in the absence (Control) and presence of 50 M 2-APB (2-APB), and following wa shout of drug (Wash). (B) Bar graph of the mean number of action potentials SEM recorded from 9 neur ons under identical conditions as in (A). Dashed lines indicate 0 mV. The asterisk denotes significant difference (p<0.05)

PAGE 158

144

PAGE 159

145 FIGURE 5.2: 2-APB-evoked changes in the single action potential waveform. (A) Single action potentials elicited by br ief depolarizing current pulses (100 ms, 150 pA) on a single intracardiac neuron befor e (Control, black trace), during (2APB, red trace) and following (Wash, gray trace) bath applied 2-APB (50 M). Dashed line indicates 0 mV. (B) Effects of 2APB on the resting membrane potential (RMP) and action potential wave form parameters. Action potentials were evoked by 100 pA current injecti ons for 100 msec. 2-APB was bath applied and the data are shown as the mean S.E.M. for 4 cells. Asterisks denote significant difference from control (p<0.05).

PAGE 160

146 CONTROL 2-APB (50 M) WASH RMP (mV) -52.9 2.4 -56.1 2.9* -52.5 0.8 PEAK AMPLITUDE (mV) 20.3 1.5 20.2 3.3 19.8 0.7 RISE SLOPE (mV/sec) 33.4 9.1 40.4 12.1 38.5 9.2 DECAY SLOPE (mV/sec) -14.2 3.3 -12.8 3.5* -16.1 3.3 AHP (mV) -17.4 2.7 -8.2 3.5* -20.1 1.9

PAGE 161

147 FIGURE 5.3: Effects of various dire ctand indirect-acting Ca2+-activated K+ inhibitors on the action potential waveform and afte rhyperpolarization (AHP) in rat intracardiac neurons. Resting membrane potential (RMP) was held at -50 mV under current clamp conditions and action potentials were elicited by brief depolarizing current pulses (150 pA, 100 ms ec). Action potentials were obtained in the absence (Control) and presence of bath applied (A) 500 M TEA, (B) 100 M Cd2+, (C) 200 nM paxilline, or (D) 100 nM apamin. Dashed lines indicate 0 mV. (E) Bar graph depicting the relative afterhyperpolarzations (AHP), defined as the AHP under the presence of dr ug divided by the control AHP, of intracardiac neurons under the presence of the direct acting (charybdotoxin, paxilline, apamin, TEA) and indirect acting (Ca2+ free, La3+, Cd2+) Ca2+ activated K+ channel blockers ( SEM). Asterisks denote a significant decrease in AHP (p<0.05).

PAGE 162

148

PAGE 163

149 FIGURE 5.4: Inhibition of outward currents in rat intracardiac neurons by the TRP channel antagonist, 2-APB. (A) Membrane currents evoked by depolarizing st eps between -60 mV to +120 mV from a holding potential of -60 mV in normal physiological saline solution (PSS) before (Control) and during (2-APB) bath applied 2-APB (50 M). The net 2APB sensitive current (2-APB Se nsitive) was determined by subtracting t he current remaining after 2-APB application from that observed under cont rol conditions (Control). (B) Current-voltage relationship of both the peak 2-APB-sensitive current (-) and the sustained 2-APBsensitive current (-), determined at the location of the arrows shown in (A) bottom (n=4). Error bars indicate S.E.M.

PAGE 164

150

PAGE 165

151 DISCUSSION The major finding reported here is that TRP channels, most probably TRPC, in intrinsic cardiac neurons regul ate the active and passive membrane properties of these cells. Inhibition of TRPC channels with 2-APB or La3+ hyperpolarized intracardiac neurons, depr essed repetitive firing and eliminated the action potential afterhyperpolarization (A HP) in these cells. The effects of 2APB and La3+ on AHP were in part mimicked by Cd2+ and Ca2+-free conditions, suggesting that the AHP is mediated by a Ca2+-activated current that can be regulated by TRPC. Furthermore, curr ents mediated by TRPC channels were recorded at voltages near the resting memb rane potential of thes e cells (circ. -50 mV), and exhibited little or no time-dependent inactivation at negative potentials. However, at positive potentials the TRPC channels showed pronounced timedependent inactivation. These data furt her support that 2-APB mediates its affects through: (1) the i nhibition of non-selective TR PC channels, and (2) either the direct inhibition of Ca2+-activated K+ channels, or more probable, the indirect inhibition of Ca2+-activated K+ channels due to TRPC inhibition. Our studies show that bath applicat ion of 50 M 2-APB hyperpolarizes intracardiac neurons by ~3 mV, and in neurons which fire tonic or

PAGE 166

152accommodating (adapting) action potentials in response to depolarizing current pulses, 2-APB reduces the number of action potentials fired significantly. The hyperpolarizing affects of 2-APB are m ediated through the inhibition of the depolarizing, non-selective TRPC channels in these intracardiac neurons. Furthermore, the effects of 2-APB on the single action potential waveform properties of intracardiac neurons show ed a significant decrease in the peak afterhyperpolarization (AHP) when compar ed to control conditions, as well as a change in the decay slope, meaning the acti on potential duratio n increased. The effects of 2-APB on AHP suggest a role for TRPC channel regulation of Ca2+activated K+ channels. Thus, TRPC channels directly, and TRPC regulation of Ca2+ activated K+ channels, play a role in the r egulation of neuroe xcitability in intracardiac neurons. Import antly, 2-APB does not block Ca2+ activated Clchannels in Xenopus oocytes (Chorna-Ornan et al., 2001). However, 2-APB may block other membrane chloride channels unde termined to date. Interestingly, the PACAP-evoked increase in action potential firing in these cells was associated with an increase in AHP (DeHaven and Cuevas, 2004). Ca2+ activated K+ channels are known to alter excitability in autonomic neurons (Franciolini et al., 2001), and it pr eviously has been shown that both IP3 (Hoesch et al., 2004) and ryanodine (Moore et al., 1998; Jobling et al., 1993; Kawai and Watanabe, 1989, 1991 ) receptor-evoked Ca2+ release activates a K+ conductance which alters the AHP properti es of neurons. However, these studies focused directly on the IP3 and ryanodine receptor intracellular Ca2+

PAGE 167

153stores activating the Ca2+ activated K+ channels, and failed to mention the common denominator between these tw o stores, the store-operated Ca2+ channels. These studies show that while ch arybdotoxin, paxilline, iberiotoxin, slotoxin and apamin have no effects on t he AHP of rat intracardiac neurons, the replacement of extracellular Ca2+ with Mg2+, or the addition of the voltage-gated Ca2+ channel blocker, Cd2+, significantly reduced the relative AHP. These data suggest the role of toxin insensitive, Ca2+ activated conductances in the regulation of the AHP in t hese cells. Furthermore, La3+, which inhibits voltage gated and store-operated Ca2+ channels, as well as TRP channels (Aussel et al., 1996; Halaszovich et al., 2000; Beedle et al., 2002), was shown to have nearly identical effects to 2-APB on the acti on potential properties, including the RMP and AHP. This finding is important because 2-APB is known to inhibit IP3 receptors along with plasma membr ane SOC channels. The fact that La3+ showed similar effects on the intracardi ac neuroexcitability and action potential waveform properties suggests the 2-APB e ffects on action potential firing are not mediated by the inhibition of IP3 receptors, but instead inhibition of TRP channels in the plasma membrane. To our knowledg e, these are the first data showing the regulation of plasma membrane ion channel s important in the production of the AHP by the TRP channel antagonists, 2-APB and La3+. Finally, we find a reversible inhibiti on of an outward current elicited by voltage steps from -60 mV to +120 mV before and after 2-APB bath application.

PAGE 168

154Two phases of the outward currents were investigated, the initial peak K+ current and the sustained K+ current. While the peak K+ current is generally thought to be mediated by BK and IA currents, the sustained conductance is through delayed rectifier K+ channels (Wang et al., 2002; Sun et al., 2003). BK channels are present in these neurons (F ranciolini et al., 2001), but IA has yet to be identified. These data show that the majority of the 2-APB sensitive outward current in rat intracardiac neurons is t he peak, transient current; however, a very small inhibition of the sustained current was noted. Thus, 2-APB blocks a peak transient outward current in rat intrac ardiac neurons which resembles BK or IA. However, these effects are probably also due to actions on the TRPC channels themselves. To date, very little is know n about the regulation of excitability by TRPC channels. Thus, further experim ents must be performed in order to determine (1) the direct effects of SOC channels (TRPC) on membrane currents and (2) the regulation of other Ca2+ activated ion channels, such as K+ channels, by these SOC channels in rat intracardiac neurons. These studies will give further insight to the Ca2+ dependent regulation of neur oexcitability seen with the neuropeptides, PACAP and VIP, in rat intracardiac neurons. In conclusion, the Ca2+ dependent regulation of neuroexcitability in rat intracardiac neurons by PACAP and VI P can in part be explained by the activation of 2-APBand La3+-sensitive SOC channels in the plasma membrane, indirectly associated with the regulation of other Ca2+ activated ion channels, most notably the Ca2+ activated K+ channels.

PAGE 169

155 CHAPTER 6 SUMMARY Results reported here usi ng PACAP and VIP provide direct evidence of some of the complex signaling which occurs in neurons of the mammalian intracardiac ganglia (Fig 6.2), and this st udy provides the first description of modulation of intracardiac neuron excitability through the VPAC2 receptormediated regulation of intracellular Ca2+. Furthermore, these data describe, in general, a novel method in which neurons can increase excitability through G protein regulated changes in Ca2+ handling, and these results can be related to various mammalian cells. The expression of PACAP and VIP recept ors were investigated in isolated intracardiac neurons of neonatal rat intrac ardiac ganglia using single-cell reverse transcription-polymerase chain reaction (RT-PCR). Individual intracardiac neurons were shown to express various isoforms of the PAC1 receptor, including the PAC1short -HOP1 and -HOP2 variants, whic h differ in the region encoding the G protein-binding dom ain. Neither the PAC1very short -HIP, nor –HIPHOP variants were detected. The PAC1-HOP1 was expressed at higher levels and in a greater number of cells than other PAC1 variants. VPAC1 and VPAC2

PAGE 170

156transcripts were also detected in intracardiac neurons, with VPAC2 being found in nearly all of the neurons (Fig 6.1). These data support previous cloning experiments which suggest the two ma jor forms in mammals are the PAC1short and -HOP1 receptors (Spengler et al, 1993; Svoboda, 1993). In contrast, in isolated adult guinea pig intracardi ac neurons, the expression of PAC1very short and PAC1-HOP2 isoforms predominate (B raas et al., 1998), and no VPAC receptor isoforms have been reported. The present findings underlie the complex effects of PACAP and VIP on neuroexcitability and Ca2+ handling in the intracardiac ganglia. The effects of PACAP and VIP on neonatal rat intracardiac neuroexcitability were investigated us ing the whole cell perforated patch technique under current clamp mode. PACAP and VIP have been shown to modulate the activity of various neuronal populations. For instance, in the CNS, administration of PACAP in the hypothalamus increased the firing rate activity and caused membrane depolarization (Uchim ura et al., 1996; Shibuya, et al., 1998). Likewise, in the PNS, applicatio n of PACAP on isolat ed adult guinea pig intracardiac neurons also depolarized the cells and changed the action potential firing frequencies (Braas et al., 1998; Pars ons et al., 2000). The present results show both PACAP and VIP enha nced neuronal excitability in isolated neurons of rat intracardiac ganglia. Interestingly, the effects on excitability produced by these neuropeptides were not identical. While bath application of PACAP or VIP resulted in a depolarization of intrac ardiac neurons, PACAP depolarized the

PAGE 171

157neurons to a greater extent than VI P. However, maxadilan, a PAC1 receptor specific agonist, did not evoke a depolar ization of intracardiac neurons or increase action potential firing, suggesting that PAC1 receptors do not have a direct effect on neuroexcitability in these cells. Nonetheless, the PAC1 receptor antagonist, M65, depressed PACAP induced depolarizations. Furthermore, increases in action potential firing in response to depolarizing current pulses were only observed under conditions in which both PAC1 and VPAC receptors were stimulated, that is, when PACAP was used as the agonist and neither PAC1 nor VPAC receptor-specific antagonists were applied. Thus, simultaneous PAC1 and VPAC receptor stimulation elic its a synergistic enhancement of neuroexcitability and produces changes in t he active membrane properties that are not seen with stimulation of either receptor alone. The effects of PACAP and VIP on Ca2+ handling in intracardiac neurons was investigated using fura-2 Ca2+ imaging techniques. While PACAP and VIP increased [Ca2+]i in isolated intracardiac neurons, maxadilan, a PAC1-selective agonist, failed to elicit a response. Furt hermore, the VPAC-selective antagonists, L-8-K and [N-Ac-Tyr1, D-Phe2]-GRF (1-29), significantly blocked the neuropeptide-evoked Ca2+ elevations, while M65, the PAC1-selective antagonist failed to inhibit the response. Lastly, application of PACAP(6-38) significantly inhibited the PACAP-induced elevations in [Ca2+]i. Taken with the fact that neonatal rat intracardiac neurons predominantly express the VPAC2 receptor

PAGE 172

158(>90%), these results show that activation of VPAC2 receptors mediates the Ca2+ responses in these cells. PACAP and VIP are known to modulate nicotinic acetylcholine receptors (nAChRs) in isolated rat intracardiac neurons (Liu et al., 2000). However, blocking neurotrans mission with the Na2+ channel blocker, tetr ototoxin (TTX), and the ganglionic nAChR blocker, meca mylamine, had no effect on the VPAC2 receptor-elicited changes in [Ca2+]i in rat intracardiac neurons. Thus, the observed rise in [Ca2+]i is not dependent on neurotransmission. VPAC2 receptor-elicited changes in [Ca2+]i in rat intracardiac neurons exhibited both a transient and sustai ned component. VPAC re ceptors have been linked to both Ca2+ entry through the plasma membrane via the activation of Ltype Ca2+ channels (Chatterjee et al., 1996; Tanaka et al., 1998) and Ca2+ release from intracellular stores. Two distinct ER intracellular Ca2+ stores exist in intracardiac neurons, one that is sensit ive to inositol 1,4,5-trisphosphate (IP3) and another sensitive to ryanodine and caffeine. Under Ca2+-free conditions, PACAP and VIP still elicited a Ca2+ response in these neurons. However, the sustained, plateau component of the Ca2+ response was lost. Conversely, VPAC2 receptorinduced increases in [Ca2+]i were completely blocked by the application of ryanodine, or depletion of the intracellular Ca2+ stores by caffeine or thapsigargin. Furthermore, 2-APB, an IP3 receptor and TRP channel antagonist, only blocked the sustained component of the PACAP-elicited elevations in [Ca2+]i. These data suggest VPAC2 receptor activation in intracardiac neurons leads to an elevation

PAGE 173

159in [Ca2+]i which initially comes from ryanodineand caffeine-sensitive intracellular pools, followed by the influx of Ca2+ through the plasma membrane. Moreover, the plasma membrane component appears to be through some unknown, 2-APB sensitive TRP channel. While our studies showed that VPAC2 receptors mediate a Ca2+ response in isolated intracardiac neurons in itially through the release of Ca2+ from caffeineand ryanodine-sensitive intracellular pools, followed by the activation of 2-APB sensitive plasma membrane channels, the signal transduction system coupling the VPAC2 receptor to the ryanodine rec eptor had not been identified. Furthermore, the 2-APB sensit ive channel facilitating Ca2+ through the plasma membrane had not been determined. Fura-2 mediated Ca2+ imaging experiments were performed in order to elucidate some of the factors in the VPAC2 receptor regulation of ryanodine receptors and plasma membrane TRP channels in isolated rat intracardiac neurons. The activation of VPAC2 receptors and subsequent increase in [Ca2+]i in rat intracardiac neurons was not directly associated with increased levels of cAMP. Forskolin, an adenylyl cyclase activator, failed to elevate [Ca2+]i in these isolated neonatal rat intracardiac neurons. However, 8-Br cADPR significantly reduced the VPAC2-evoked Ca2+ elevations, suggesting that ryanodine rec eptor activation is dependent on the production of cADPR in neonatal rat intr acardiac neurons. Furthermore, the binding site of caffeine and cADPR to the ryanodine receptor is different, because caffeine was unaffected by the bath application of 8-Br cADPR.

PAGE 174

160Lanthanum experiments performed here showed that the VPAC2 receptor mobilization of Ca2+ through caffeineand ryanodine-se nsitive internal stores is dependent on a small Ca2+ influx through the plasma membrane. However, the channel underlying these effects is yet to be determined. In terestingly, the inhibition of membrane channels by La3+ appears to be faster than the exchange of Ca2+ in the bathing solution, sinc e experiments performed under Ca2+ free conditions failed to block the VPAC2-evoked release of Ca2+ from ryanodinesensitive internal stores. Conversely this paradoxical effect mediated by La3+ might be explained by the direct inhi bition of PACAP binding to the VPAC2 receptor. Nonetheless, several ke y factors, including cADPR and Ca2+ are required to activate ryanodine receptor s in neonatal rat intracardiac neurons. The inhibition of the VPAC2 receptor-mediated influx of Ca2+ through the plasma membrane by 2-APB suggested TRP channels mediates this effect. The inhibition of the sustai ned component of the Ca2+ response by La3+ in these neurons further supported that TRP channe ls underlie the response. However, several subfamilies of TRP channels exist, including TRPC, TRPM and TRPV. While TRPC channels are the most wi dely implicated in store-operated Ca2+ entry, TRPV and TRPM needed to be ruled out. Fura-2 mediated Ca2+ imaging experiments showed that neither m enthol, nor capsaicin increased [Ca2+]i in isolated neonatal rat intracardiac neurons While menthol has been shown to activate TRPM8 channels (Hu et al., 2004; Tsuzuki et al., 2004), capsaicin has been shown to activate TRPV1 channels (H u et al., 2004; Krause et al., 2005).

PAGE 175

161Thus, these data suggest TRPM8 and TRPV1 do not play a role in the sustained phase of the Ca2+ response in these neurons. Furthermore, 2-APB is a common activator of TRPV1, TRPV2 and TRPV3 (Hu et al., 2004). However, 2-APB alone had no effects on the [Ca2+]i in intracardiac neurons. Taken together, these data suggest TRPV and TRPM do not play a role in the sustained phase of the VPAC2 receptor-evoked Ca2+ response in neonatal rat intracardiac neurons. Thus, TRPC channels are the likely candidate for this effect. TRPC channels have been impl icated in store-operated Ca2+ entry, as well been shown to be activated by the intrac ellular messenger DAG (Hu et al., 2004; Venkatachalam et al., 2003). However, application of OAG failed to increase [Ca2+]i in these intracardiac neurons, sugges ting that these ion channels primarily function as store-operated channels in t hese cells. This was supported by the fact that store depl etion by PACAP under Ca2+ free conditions evoked a store dependent influx of Ca2+ across the plasma membr ane, and that influx was significantly blocked by bath applicati on of 2-APB. Thus, TRPC channels are regulated by store depletion in neonat al rat intracardiac neurons. Store-operated Ca2+ channels maintain proper intracellular store Ca2+ levels, as well as generate prolonged Ca2+ responses (Putney, 2004). These data showed that 2-APB significantly inhibited the ability of the neuron to repetitively increase [Ca2+]i. Thus, TRPC channels r egulated by store depletion function to replenish the intracellular Ca2+ stores, and activation of these channels is essential to preserve functional responses to PACAP.

PAGE 176

162Experiments using electrophysiologica l techniques showed that the modulation of excitability of intr acardiac neurons by PACAP and VIP is dependent on elevations of [Ca2+]i. Bath application of ryanodine, and the removal of extracellular Ca2+ significantly reduc ed the depolarization and increases in action potential firing induc ed by application of PACAP. Thus, the inhibition of the Ca2+ release from ryanodine-sensitive has been shown to abolish the enhancement of neuroexcitability i nduced by PACAP in these intracardiac neurons. However, little is known about the role of store-operated Ca2+ entry on the electrical properties of these neur ons. Store-operated TRPC channels may in part underlie the changes in neuroexcita bility seen in the presence of PACAP and VIP in intracardiac neurons. While the Ca2+ permeability of TRPC channels makes them candidates for store-operated Ca2+ channels, the non-selective cationic nature of TRPC channels makes them depolarizing agents. Thus, electrophysiological experiments were performed to investigate the ionic mechanisms underlying the PACAP and VIP evoked changes in resting membrane potential (RMP) and neuroexcitabi lity seen in isolated neonatal rat intracardiac neurons. Data presented here showed that 2-APB decreased the number of action potentials elicited by small depolarizing current pulses. The reduction of action potentials occurred because of a 2-APB mediated hyperpolarization of the resting me mbrane potential (RMP) and significant decrease in the action potential afterhyperpol arization (AHP) in these intracardiac neurons. The effects of 2-APB on the RM P suggests a direct role for TRP

PAGE 177

163channels on the regulation of intracardi ac neuron passive and active membrane properties. However, the effects of 2-APB on the AHP suggests TRPC channels regulate Ca2+ activated K+ channels in intracardiac neurons. These data were supported by the fact that 2-APB inhibited transient outward currents that resembled Ca2+ activated K+ currents. While these results discussed give insight to the Ca2+-dependent changes in neuroexcitability evoked by VPAC2 receptor activation in isolated intracardiac neurons, the PAC1 receptor mediated effects have yet to be determined. Although the AC-cAMP-PKA intracellula r signal pathway does not directly increase [Ca2+]i in these cells, our experiments do not rule out the possibility that cAMP may have a different role in PACAP modulation of neuroexcitability seen in intracardiac neurons. PAC1 activation in guinea pig intracardiac neurons has been shown to enhance the cAMP-regulat ed, hyperpolarization-activated nonselective cation conductance, Ih (Merriam et al., 2004). Ih has previously been demonstrated in neonatal rat intracar diac neurons by electrophysiological techniques (Cuevas et al., 1997).

PAGE 178

164 FIGURE 6.1: Schematic representation of the expression pattern of PAC1 and VPAC2 receptors in individual intracar diac neurons. The percentages (%) located inside the cells indicate the predi cted percent of i ndividual neonatal rat intracardiac neurons that express the various PAC1 receptor isoforms, as well as VPAC2 receptors. Data are interpreted fr om experiments performed using singlecell RT-PCR (Chapter 2). In or der to avoid confusion, VPAC1 receptors were left out of the diagram However, VPAC1 receptor transcripts were detected in a small proportion of isol ated neonatal rat intracardiac neurons (>20%).

PAGE 179

165FIGURE 6.2: Schematic representation of the pathways mediating the PACAPand VI P-induced elevations in [Ca2+]i and enhancement of neuroexcitability seen in isolated rat intracardiac neurons. PAC AP and VIP increase [Ca2+]i in intracardiac neurons through the acti vation of G-protein coupled VPAC2 receptors, and this mobilization of Ca2+ exhibits both a transient and sustained componen t. The transient component is in part due to mobilization of Ca2+ from caffeine/ryanodine-sensitive stores, and the signal transduction is Ca2+ and cADPR-dependent. Ca2+ release from these stores regulates the entry of Ca2+ through the plasma membrane, and pharma cological evidence suggests TRPC channels mediate this effect. TRPC is critical in these intr acardiac neurons abilities to repe titively elevate intracellular Ca2+ levels and replenish internal Ca2+ stores. PACAP-induced changes in Ca2+ handling by intracardiac neurons is linked to the neuroexcitability produced by the neuropeptide in these cells, and simultaneous activation of VPAC2 and PAC1 receptors results in a synergistic amplif ication of excitability. Pharmacological evidence sugg ests inhibition of TRPC decreases action potential firing in intracardiac neurons through changes in resting membrane potential (RMP), suggesting a direct role for TRPC in the regulation of neuroexcitability. Furthermore 2-APB effects on the action potential afterhyperpolarizations (AHP) and outward currents suggest TRPC channels regulate Ca2+ activated K+ channels. However, PAC1 receptor mediated effects have yet to be elucidated.

PAGE 180

166

PAGE 181

167 CONCLUSION Autonomic control of cardiac func tion depends on the coordinated activity generated by neurons within the intrac ardiac ganglia, and intrinsic feedback loops within the ganglia provide precise cont rol of cardiac function. Interestingly, the progressive development of heart di sease is associated with a remodeling of this intrinsic cardiac ganglion, and an adaptation of the control mechanisms which regulate these intrinsic cardiac neur ons. Such a remodeling process likely involves both afferent and efferent neur ons, hormones, receptors, and signal transduction pathways within the intracardi ac neurons. Although recent studies have identified some of the anatomical and functional characteristics of the intracardiac ganglia, we are just beginn ing to understand how interactions among the network of neurons act to regulate cardiac function. Understanding the intracardiac ganglia in normal physiological conditions, as well as the remodeling that occurs in diseased states, will lead to novel approaches to the development of therapy to treat heart disease. Results reported here us ing PACAP and VIP provide direct evidence of some of the complex signaling which occu rs in neurons of the rat intracardiac ganglia. The physiological effects of VPAC2 receptor activation on intracardiac

PAGE 182

168neurons have clinical implications. In terestingly, VIP has been shown by both in vivo and in vitro experiments to act as a positive inotropic (Unverferth et al., 1986; Bell and McDermott, 1994) and chronot ropic agent (Christophe et al., 1984; Smitherman et al., 1989; Rigel and Lanthrop, 1990) Moreover, VIP has been shown to be elevated in patients su ffering from early heart failure, while decreased concentrations of VIP are relat ed to the progressive worsening of the disease (Lucia et al., 2003). Furthermo re, it has been suggested that some of the beneficial effects seen with angiotens in converting enzyme (ACE) inhibitor therapy in heart failure patients may be caused by VIP (Duggan and Ye, 1998). ACE inhibitors result in an increase in cardiac output without an increase in heart rate, suggesting a positive inotropic effect. However, this cannot be explained by a reduction in angiotensin II and bradyki nin concentrations. It has been suggested that the angiotensin conver ting enzyme may metabolize VIP (Duggan and Ye, 1998), and the increased concentrations of VIP that would result from ACE inhibitor therapy would explain the positive inotropi c effects seen. However, several studies have now shown that the angiotensin converting enzyme does not metabolize VIP (Farmer and Togo, 1990; Duggan and Ye, 1998). Nonetheless, VIP concentrations do incr ease during ACE inhibitor therapy, and these changes probably contribute to t he improvement in cardiac function following therapy with these agents (Duggan and Ye, 1998). In conclusion, the mammalian intracardi ac ganglion exerts intrinsic regulation over cardiac performance, and is thus a potential pharmacological target for

PAGE 183

169treating disease. Experiments performed here give insight into some of the complex signaling which occurs in neur ons of the mammalian intracardiac ganglia, and these results support the hypothes is that the intrinsic cardiac nerve plexus acts as much more than a si mple relay center for parasympathetic innervation to the heart. PACAP and VIP are important regulators of neuronal signaling within the intracardiac ganglia, and VPAC2 and PAC1 receptor activation plays an important neuromodulator y role in the regulation of cardiac homeostasis. Even more interesting is t he possible roles these peptides play in various diseases associated with the heart. Despite the progress made in intracardiac ganglion research, much of the physiological and pathological roles of these ganglia remain incomplete. Furt her investigations of the intracardiac ganglia will shed light on the intrinsic beat-to-beat regulation of the mammalian heart. For instance, the molecular identitie s of many of the membrane proteins associated with intracardiac neuroexc itability have yet to be determined. Furthermore, the electrophysiological proper ties of intrinsic cardiac neurons have not been completely established (Adams and Cuevas, 2004). To my knowledge, data shown here are the first to indicate the importance of TRPC activity on the resting membrane potential (RMP) in intracardiac neurons, as well as the regulation of Ca2+ activated K+ channels. Nonetheless, progress is being made in the understanding of intracardiac neuronal control of the mammalian heart.

PAGE 184

170 WORKS CITED Adams, D.J. and Cuevas, J. (2004) Elec trophysiological properties of intrinsic cardiac neurons in Basic and Clinical Neurocardiology. Edited by Armour, J.A. and Ardell, J.L. Oxford Un iversity Press, New York. Adams P.R., Constanti, A. Brown, D.A., and Clark, R. B. (1982) Intracellular Ca2+ activates a fast voltage-sensitive K+ current in vertebrat e sympathetic neurons. Nature 296 746-749. Alarcon, P., and Garcia-Sancho, J. (2000) Differential calcium responses to the pituitary adenylate cyclase-activating poly peptide (PACAP) in the five main cell types of rat anterior pituitary. European J Physiol. 440 685-91. Allen, T.G., Burnstock, G. (1987) Intracellular studies of the electrophysiological properties of cultured intracardi ac neurones of the guinea-pig. J. Physiol. 388 349-66. Anton, P.A., Shanahan, F., Sun, X.P., Diehl, D., Kodner, A., and Mayer, E.A. (1993) VIP modulates intracellular calc ium oscillations in human lymphoblasts. Immunopharmacol. Immunotoxicol. 15 429-446. Ardell, J.L. (1994) Struct ure and function of mammalian intrinsic cardiac neurons. In: Neurocardiology edited by Armour JA and Ardell JL. New York: Oxford Univ. Press, p. 95–114. Ardell, J.L. (1994) Struct ure and function of mammalian intrinsic cardiac neurons. In: J.A. Armour and J. L. Ardell, Editors, Neurocardiology Oxford University Press, Oxford, 95–114. Arimura A. (1998) Perspectives on pituitary adenylate cyclase activating polypeptide (PACAP) in the neuroendocri ne, endocrine, and ne rvous systems. Jpn J Physiol 48 301-31. Armour, J.A. (1999) Myocardial isc haemia and the cardia c nervous system. Cardiovasc Res 41, 41–54.

PAGE 185

171Armour, J.A., Collier, K., Kember, G., and J. L. Ardell (1998) Differential selectivity of cardiacneurons in separate intrathoracic autonomic ganglia. American J. Physiol. 274 939-49. Armour, J.A., Hopkins, D.A. (1990) Acti vity of in vivo canine ventricular neurons American J. Physiol. 258 326-36. Armour, J.A., Huang, M.H. and Smith, F. M. (1993) Peptider gic modulation of in situ canine intrinsic cardiac neurons. Peptides. 14 191-202. Aussel, C., Marhaba, R., Pelassy, C., Brei ttmayer, J.P. (1996) Submicromolar La3+ concentrations block the calcium release-activated channel, and impair CD69 and CD25 expression in CD3or thapsigargin-activated Jurkat cells. Biochem J. 313 909-13. Barritt, G.J. (1999) Receptor-activated Ca2 in flow in animal cells: a variety of pathways tailored to meet different intracellular Ca2+ signalling requirements. Biochem. J. 337 153–169. Basler, I., Kuhn, M., Mulle r, W., and Forssmann, W.G. (1995) Pituitary adenylate cyclase-activating polypeptide stimulates ca rdiodilatin/atrial natriuretic peptide (CDD/ANP-(99-126)) secreti on from cultured neonatal rat myocardiocytes. Eur J Pharmacol 291 335-342. Beaudet, M.M, Parsons, R.L., Braas, K. M., and May, V. (2000) Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons. J. Neurosci. 20 7353-7361. Beedle, A.M., Hamid, J., Zamponi, G. W. (2002) Inhibiti on of transiently expressed lowand high-volt age-activated calcium channels by trivalent metal cations. J Membr Biol 187 ,225-38. Beker, F., Weber, M., Fi nk, R.H., and Adams, D.J. (2003) Muscarinic and nicotinic ACh receptor activa tion differentially mobilize Ca2+ in rat intracardiac ganglion neurons. J. Neurophysiol. 90 1956-1964. Bell, D., McDermott, B.J. (1994) Secretin and vasoactive intestinal peptide are potent stimulants of cellula r contraction and accumulation of cyclic AMP in rat ventricular cardiomyocytes. J Cardiovasc Pharmacol 23 959-969. Berridge, M.J. (1995) Capacitative calcium entry. Biochem. J 312 1–11.

PAGE 186

172Braas, K.M. and V. May (1999) Pitu itary adenylate cyclase-activating polypeptides directly stimulate sym pathetic neuron neuropeptide Y release through PAC(1) receptor isoform activati on of specific intracellular signaling pathways. J. Biol. Chem. 274 27702–27710. Braas, K.M., May, V., Haraka ll, S.A., Hardwick, J.C. and Parsons, R.L. (1998) Pituitary adenylate cyclase-activating pol ypeptide expression and modulation of neuronal excitability in guinea pig cardiac ganglia. J. Neurosci 18 9766-9779. Braas, K.M., Rossignol, T.M ., Girard, B.M., May, V. Parsons, R.L. (2004) Pituitary adenylate cyclase activating polypeptide (PACAP) decreases neuronal somatostatin immunoreactivity in cult ured guinea-pig parasym pathetic cardiac ganglia. Neuroscience. 126 335-46. Brum, J.M., Bove, A.A., Sufan, Q., Reil ly, W., Go, V.L. (1986) Action and localization of vasoactive intestinal pept ide in the coronary circulation: evidence for nonadrenergic, noncholinergi c coronary regulation. J Am Col Cardiol 7 406413. Burnstock, G. (1972) Purinergic nerves. Pharmacol. Rev 24 509-560. Calaresu, F.R. and St. Louis A.J. (1967) Topography and numerical distributions of intracardiac ganglion cells in the cat. J Comp Neurol 131 55–66. Calupca, M.A., Vizzard, M. A., and Parsons, R.L. (2000) Origin of pituitary adenylate cyclase-activating polypept ide (PACAP)-immunoreactive fibers innervating guinea pig parasym pathetic cardiac ganglia. J. Comp. Neurol. 423 26-39. Cardell, L.O., Hjert, O., and Uddman, R. (1997) The in duction of nitric oxide mediated relaxation of human isolat ed pulmonary arteries by PACAP. Br J Pharmacol 120 1096-1100. Cauvin, A., Buscail, L., Gourlet, P., De N eef, P., Gossen, D., Arimura, A., Miyata, A., Coy, D.H., Robberecht, P., and Christ ophe, J. (1990) The novel VIP-like hypothalamic polypeptide PACAP interacts with high affinity receptors in the human neuroblastoma cell line NB-OK. Peptides. 11 773-777. Cauvin, A., Robberecht, P., De Nee f, P., Gourlet, P., Vandermeers, A., Vandermeers-Piret, M.C., and Ch ristophe, J. (1991) Properti es and distribution of receptors for pituitary adenylate cyclase activating peptide (PACAP) in rat brain and spinal cord. Reg. Peptides. 35 161-173.

PAGE 187

173Cavallaro, S., Copani, A., D’Agata, V., Musco, S., Petralia, S., Ventra, C., Stivala, F., Travali, S. and Canonico, P.L. ( 1996) Pituitary adenylate cyclase-activating polypeptide prevents apoptosis in cultured cerebellar granule neurons. Mol Pharmacol 50 60–66. Champion, H.C., Santiago, JA., Garrison, E.A.., Cheng, D.Y., Coy, D.H., Murphy, W.A., Ascuitto, R.J., Ross-Ascuitto, N. T., McNamara, D.B., and Kadowitz, P.J. (1996) Analysis of cardiovascular responses to PACAP-27, PACAP-38, and vasoactive intestinal polypeptide. Ann. N. Y. Acad. Sci. 805 429-441. Chatterjee, T.K., Sharma, R.V., and Fis her, R.A. (1996) Molecular cloning of a novel variant of the pituitary adenylat e cyclase-activating polypeptide (PACAP) receptor that stimulates calcium influx by activation of L-type calcium channels. J. Biol. Chem. 271 32226-32232. Chorna-Ornan, I., Joel-Almagor, T., Beni -Ami, H.C. et al (2001) A common mechanism underlies vertebrate calc ium signaling and Drosophila phototransduction. J Neurosci 21 2622-2629. Christophe, J. (1998) Is ther e appetite after GLP-1 and PACAP? Ann N Y Acad Sci 865, 323–335. Christophe, J. (1993) Type I receptor s for PACAP (a neuropeptide even more important than VIP?). Biochim. Biophys. Acta 1154 ,183-199. Christophe, J., Waelbroeck, M., Chatel ain, P., Robberecht, P. (1984) Heart receptors for VIP, PHI and secretin are able to activate adenylate cyclase and to mediate inotropic and ch ronotropic effects. S pecies variations and physiopathology. Peptides 5 341-353. Chu, A., Diaz-Munoz, M., Hawkes, M.J., Brush, K., and Ham ilton, S.L. (1990) Ryanodine as a probe for the functional st ate of the skeletal muscle sarcoplasmic reticulum calcium release channel. Mol. Pharmacol. 37 735-741 Clapham, D.E., Runnels, L. W., and Strubing, C. ( 2001). The TRP ion channel family. Nat. Rev. Neurosci. 2 387-396. Clapham, D.E. (2003) TRP c hannels as cellular sensors. Nature 426 517-24. Clapper, D.L., Walseth, T.F. Dargie, P.J., Lee, H.C. (1987) Pyridine nucleotide metabolites stimulate calcium releas e from sea urchin egg microsomes desensitized to inositol trisphosphate. J. Biol. Chem. 262 9561 68

PAGE 188

174Cuevas, J. and Adams, D.J. (1996) Vasoacti ve intestinal polypeptide modulation of nicotinic ACh receptor channels in rat intracardiac neurones. J. Physiol. 493 503-515. Cuevas, J. and Berg, D.K. (1998). Mammalian nicotinic receptors with 7 subunits that slowly desensit ize and rapidly recover from -bungarotoxin blockade. J. Neurosci. 18 10335-10344 Cuevas, J., Harper, A.A., Trequattrini, C ., and Adams, D.J. (1997) Passive and active membrane properties of isolated ra t intracardiac neurons: regulation by Hand M-currents. J. Neurophysiol. 78 1890-1902 DeHaven, W.I. and Cuevas, J. (2002) Heterogeneity of pituitary adenylate cyclase-activating polypeptide and vasoactive intestinal polypeptide receptors in rat intrinsic cardiac neurons. Neurosci. Lett. 328 45-49 DeHaven, W.I. and Cuevas, J. ( 2004) VPAC receptor modulation of neuroexcitability in intracardiac neurons: dependence on intracellular calcium mobilization and synergistic enhancement by PAC1 receptor activation. J. Biol. Chem. 279 40609-21. Della, N.G., Papka, R.E., Furness, J. B. and Costa, M. (1983) Vasoactive intestinal peptide-like immunoreacti vity in nerves associated with the cardiovascular system of guinea pigs. J. Neurosci. 9 605-619. Dickerson, L.W., Rodak, D.J., Fleming, T. J., Gatti, P.J., Massa ri, V.J., McKenzie, J.C., and Gillis, R.A. (1997) Parasympat hetic neurons in the cranial medial ventricular fat pad on the dog heart select ively decrease ventricular contractility without effect on sinus rate or A-V conduction. Soc Neurosci Abstr 23 1516. Diochot, S., Schweitz, H., Beress, L., Lazdunski, M. (1998) Sea anemone peptides with a specific blocking activity against the fast inactivating potassium channel Kv3.4. J. Biol Chem. 273 6744-9. Duggan, K.A., Ye, V.Z. (1998) Effects of enalapril on vasoactive intestinal peptide metabolism and tissue levels. Eur J Pharmacol 358 25-30. Edwards, F.R., Hirst, G.D.S., Klemm, M.F., and Steele, P.A. (1995) Different types of ganglion cell in the ca rdiac plexus of guinea-pigs. J. Physiol. 486.2 453-471. Fahrenkrug, J. (1993) Transmitter role of vasoactive intestinal peptide. Pharmacology & Toxicology. 72 354-63.

PAGE 189

175Farmer, S.G., Togo, J. (1990) Effects of epithelium removal on relaxation of airway smooth muscle induced by vasoacti ve intestinal peptide and electrical field stimulation. Br J Pharmacol 100 73-78. Feliciano, L. and Henning, R. J. (1998) Vagal nerve st imulation during muscarinic and beta-adrenergic blockade causes signifi cant coronary artery dilation. J. Auton. Nerv. Sys 68 78-88. Fieber, L.A. and Adams, D.J. (1991) Acetylcholine-ev oked currents in cultured neurons dissociated from rat par asympathetic cardiac ganglia. J. Physiol. 434 215-237. Fill, M., Copello, J.A. (2002) Ryanodine receptor calcium release channels. Physiol Rev 82, 893-922. Franciolini, F., Hogg, R., Ca tacuzzeno, L., Petris, A., Trequattrini, C., Adams, D.J. (2001) Large-conductance calciu m-activated potassium channels in neonatal rat intracardiac ganglion neurons. Eur. J. Physiol. 441 629-638. Franco-Cereceda, A., Bengtsson, L., and Lundber g, J.M. (1987) Inotropic effects of calcitonin gene-related peptide, vas oactive intestinal polypeptide and somatostatin on the human right atrium in vitro. Eur. J. Pharmacol 134 69-76. Fukuhara, C., Inouye, S.I., Matsumoto, Y. Tsujimoto, G., Aoki K. and Masuo, Y. (1998) Pituitary adenylate cyclase-activating polypeptide rhythm in the rat pineal gland. Neurosci Lett 241 115–119. Galione, A., Lee, H.C., Busa, W.B. (1991) Ca2+-induced Ca2+ release in sea urchin egg homogenates: modulation by cyclic ADP-ribose. Science 253 1143 46. Gatti, P.J., Johnson, T.A., McKenzie, J.C., Lauenstein, J.M., Gray, A.L., and Massari, V.J. (1997) Vagal control of left ventricular contractility is selectively mediated by a cranioventricular in tracardiac ganglion in the cat. J Auton Nerv Syst 66 138–144. Gatti, P.J., Johnson, T.A., Phan, P., Jor dan, I.K., Coleman, W., and Massari, V.J. (1995) The physiological and anatomical de monstration of functionally selective parasympathetic ganglia located in discr ete fat pads on the feline myocardium. J Auton Nerv Syst 51 255–259. Gonzalez, B.J., Basille, M., Vaudry, D., Fournier, A. and Vaudry, H. (1997) Pituitary adenylate cyclase-activating polypeptide promotes cell survival and neurite outgrowth in rat cerebellar neuroblasts. Neuroscience 78 419–430.

PAGE 190

176 Gottschall, P.E., Tatsuno, I., and Arimur a, A. (1991) Hypothal amic binding sites for pituitary adenylate cyclase activating polypeptide: characterization and molecular identification. FASEB J. 5 194-199. Gottschall, P.E., Tatsuno, I., Miyata, A., and Arimura, A. (1990) Characterization and distribution of binding sites for the hy pothalamic peptide, pituitary adenylate cyclase-activating polypeptide. Endocrinology. 127 272-277. Gourlet, P., Vandermeers, A., VandermeersPiret, M-C., Rathe, J., De Neef, P., & Robberecht, P. (1995) Fragments of pituitary adenylate cyclase polypeptide discriminate between type I and type II recombinant receptors. Eur. J. Pharm 287 7-11. Gray, A.L., Johnson, T.A., Ardell, J.L., massari, V. J. (2004) Parasympathetic control of the heart. II. A novel intergangli onic intrinsic cardiac circuit mediates neural control of heart rate. J Appl Physiol 96 2273–2278. Grimaldi, M. and Cavallaro, S. (2000) Expression and coupling of PACAP/VIP receptors in cortical neurons and type I astrocytes. Ann. N. Y. Acad. Sci. 921 312-316 Grimaldi M Maratos M Verma A. (2003) Transient receptor potential channel activation causes a novel form of [Ca2+]i oscillations and is not involved in capacitative Ca2+ entry in glial cells. J Neurosci 23 473747 45 Gulbenkian, S., Saetrum Opgaard, O., Ek man, R., Costa Andr ade, N., Wharton, J., Polak, J.M., Queiroz e Melo, J., and Edvinsson, L. (1993) Peptidergic innervation of human epica rdial coronary arteries. Circ. Res. 73 579-588. Halaszovich, C.R., Zitt, C. Jungling, E., Luckhoff, A. (2000) Inhibition of TRP3 channels by lanthanides. Block from the cyt osolic side of the plasma membrane. J Biol Chem. 275 37423-8. Hashimoto, H., Shintani, N., and Baba, A. (2002) Higher brain functions of PACAP and a homologous Drosophila me mory gene amnesiac: insights from knockouts and mutants. Biochem. Biophys. Res. Commun. 297 427-431. Henning, R.J. (1992) Vagal stimulation during muscarinic and beta-adrenergic blockade increases atrial contractility and heart rate. J. Auton. Nerv. Sys 40 121-129. Henning, R.J., and Sawmiller D.R. (2000) Vasoactive intestinal peptide: cardiovascular effects. Cardiovascular Research 49 27-37.

PAGE 191

177 Hille, B. (1992) G protein-coupled mechanisms and nervous signaling. Neuron 9 187-195. Hirose, M., Furukawa, Y., Nagashima, Y., Lak he, M., Miyashita, Y., and Chiba, S. (1997) PACAP-27 causes negative and pos itive dromotropic effects in anesthetized dogs. Eur. J. Pharmacol. 338 35-42. Hirose, M., Y. Furukawa, Y. Nagashima M. Lakhe and S. Chiba (1997) Pituitary adenylate cyclase-activating polypeptide27 causes a biphasic chronotropic effect and atrial fibrillation in autonom ically decentralized, anesthetized dogs. J. Pharmacol. Exp. Ther. 283 478–487. Hoesch, R.E., Weinreich, D., Kao, J.P.Y. (2004) Localized IP3-Evoked Ca2+ Release Activates a K+ Current in Primary V agal Sensory Neurons. J Neurophysiol 91 2344-2352. Horackova, M., Slavikova, J., and Byczko Z. (2000) Postnatal development of the rat intrinsic cardiac nervous system: a confocal laser scanning microscopy study in whole-mount atria. Tissue Cell. 32 377-388. Horn R Marty A (1988) Muscarinic activation of ionic currents measured by a new whole-cell recording method. J Gen Physiol 92 1451 59. Hoth, M. and Penner, R. (1992) Depletion of intracellular calcium stores activates a calcium current in mast cells. Nature 355 353–355. Hu, H.Z., Gu, Q., Wang, C. Colton, C.K., Tang, J., Kinoshita-Kawada, M., Lee, L.Y., Wood, J.D., Zhu, M. X. (2004) 2-ami noethoxydiphenyl borate is a common activator of TRPV1, TRPV2, and TRPV3. J Biol Chem. 279 35741-8. Huang, M., Shirahase, H., and Rorstad, O.P. (1993) Compar ative study of vascular relaxation and receptor binding by PACAP and VIP. Peptides. 14 755762 Ingram, S.L. and Williams J.T. (1 994). Opioid inhibition of Ih via adenylyl cyclase. Neuron 13 179-186 Ishihara, T., Shigemoto, R., Mori, K ., Takahashi, K., Nagata, S. (1992) Functional expression and tissue distribution of a novel receptor for vasoactive intestinal polypeptide. Neuron. 8 811-819.

PAGE 192

178Ishizuka, Y., Kashimoto, K., Mochizuk I.T., Sato, K., Ohshima, K., and Yanaihara, N. (1992) Cardiovascular and respiratory actions of pituitary adenylate cyclase-activating polypeptides. Regul. Pept 40 29-39. Itoh, N., Obata, K.-I., Yanaihara, N., and Okamoto, H. (1983) Human preprovasoactive intestinal polypeptide contains a novel PHI-27-like peptide, PHM-27. Nature (Lond.) 304 547-549. Jacobowitz, D., Cooper, T., & Barner, H. B. (1967) Histochem ical and chemical studies of the localization of adrener gic and cholinergic nerves in normal and denervated cat hearts. Circulation Research. 20 289-298. Jobling, P., Mclachlan, E. M., and S ah, P. (1993) Calcium induced calcium release is involved in the afterhyper polarization in one class of guinea pig sympathetic neuron. J. Auton. Nerv. Syst. 42 251–258. Johnson, T.A., Gray, A.L., Lauenstein, JM., Newton, S.S., and Massari, V.J. (2004) Parasympathetic contro l of the heart. I. An inte rventriculo-septal ganglion is the major source of the vagal intr acardiac innervation of the ventricles. J Appl Physiol 96 2265–2272. Jung, S., Muhle, A., Schaefer, M., Strotm ann, R., Schultz, G., Plant, T.D. (2002) Lanthanides potentiate TRPC5 cu rrents by an action at extracellular sites close to the pore mouth. J Biol Chem. 278 3562-3571. Karasawa, Y., Furukawa, Y., Ren, L., Ta kei, M., Murakami, M., Narita, M., and Chiba, S. (1990) Cardiac responses to VIP and VIP-ergic-cho linergic interaction in isolated dog heart preparations. Eur. J. Pharmacol 187 9-17. Kase, H., Wakui, M., and Petersen, O.H. (1991) Stimulatory and inhibitory actions of VIP and cyclic AMP on cytoplasmic Ca2+ signal generation in pancreatic acinar cells. Pflugers Arch. Eur. J. Physiol. 419 668-670. Kawai, T. and Watanabe, M. (1989) E ffects of ryanodine on the spike afterhyperpolarization in sympathetic neurones of the rat superior cervical ganglion. Eur. J. Physiol. 413 470–475. Kawai, T. and Watanabe, M. (1991) Ryanodine suppresses the frequencydependent component of the spike after-hyp erpolarization in the rat superior ganglion. Jpn. J. Pharmacol. 55 367–374. Kawasaki, J., Kobayashi, S., Miyagi, Y., Nishimura, J., Fujishima, M., and Kanaide, H. (1997) The mechanisms of the relaxation induced by vasoactive intestinal peptide in t he porcine coronary artery. Br. J. Pharmacol. 121 977-985.

PAGE 193

179 Kawatani, M., Rutigliano, M., de Gr oat, W.C. (1985) Depolarization and muscarinic excitation induced in a sympathet ic ganglion by vasoactive intestinal polypeptide. Science 229 879-881. King, T-S., and Coakley, J.B. (1958) The intrinsic nerve cells of the cardiac atria of mammals and man. J Anatomy. 92 353-379. Kohlmeier, K.A. and Reiner, P.B. (1999) Vasoactive inte stinal polypeptide excites medial pontine reticular fo rmation neurons in the brai nstem rapid eye movement sleep-induction zone. J. Neurosci 19 4073-4081. Krause, J.E., Chenard, B.L., Cortright, D. N. (2005) Transient receptor potential ion channels as targets for the di scovery of pain therapeutics. Curr Opin Investig Drugs 6, 48-57. Lam, H.C., Takahashi, K., Ghatei, M.A., K anse, S.M., Polak, J.M., and Bloom, S.R. (1990) Binding sites of a novel neuropeptide pituitary-adenylate-cyclaseactivating polypeptide in the rat brain and lung. Eur. J. Biochem. 193 725-729 Langer, I., Perret, J., Vertongen, P., Waelbr oeck, M., and Robberecht, P. (2001) Vasoactive intestinal pept ide (VIP) stimulates [Ca2+]i and cyclic AMP in CHO cells expressing Galpha16. Cell Calcium 30 229-234. Lee, H.C., Aarhus, R., Graeff, R.M. (1995) Sensitization of calcium-induced calcium release by cyclic ADP-ribose and calmodulin. J. Biol. Chem. 270 9060 66 Lee, H.C. (1993) Potentiation of calciu mand caffeine-induced calcium release by cyclic ADP-ribose. J. Biol. Chem. 268 293 99 Lee, H.C. (2001) Physiologi cal functions of cyclic ADP-ribose and NAADP as calcium messengers. Annu. Rev. Pharmacol. Toxicol. 41 317-45 Lee, S.H. and Cox, C.L. (2003) Vasoactive intestinal peptide selectively depolarizes thalamic relay neurons and attenuat es intrathalamic rhythmic activity. J. Neurophysiol. 90 1224-1234. Leech, C.A., Holz, G.G., and Habener, J. F. (1995) Pituitary adenylate cyclaseactivating polypeptide induces the vo ltage-independent activation of inward membrane currents and elevat ion of intracellular calc ium in HIT-T15 insulinoma cells. Endocrinology. 136, 1530-1536

PAGE 194

180Li, P-L., Tang, W-X., Valdivia, H-H., Z ou, A-P, and Campbell, W.B. (2001) cADPribose activates reconstituted ryanodine re ceptors from coronary arterial smooth muscle. Am J Physiol Heart Circ Physiol 280 208-215. Liang, M., Chini, E.N., C heng, J., Dousa, T.P. (1999) Synthesis of NAADP and cADPR in mitochondria. Arch Biochem Biophys 371 317-25. Liu, D-M., Cuevas, J., and Adams, D.J. (2000) VIP and PACAP potentiation of nicotinic ACh-evoked currents in rat par asympathetic neurons is mediated by Gprotein activation. Eur. J. Neurosci 12 2243-2251. Lokuta, A.J., Darszon, A., Beltran, C ., Valdivia, H.H. (1998) Detection and functional characterization of ryanodi ne receptors from sea urchin eggs. J. Physiol. 510 .1, 155 64 Lucia, P., Caiola, S., Coppola A., Manetti, L.L., Marocc ia, E., Buongiorno, A.M., De Martinis, C. (2003) Vasoactive intest inal peptide (VIP): a new neuroendocrine marker of clinical progression in chronic heart failure? Clin Endocrinol 59 723727. Lundberg, J.M. (1981) Evidence for coex istence of vasoactive intestinal polypeptide (VIP) and acetylcholine in neurons of cat exocrine glands. Acta. Physiol. Scand. 496 (suppl. 112), 1-57. Lundberg, J.M. (1996) Pharmacology of cotransmission in the autonomic nervous system: integrative aspec ts on amines, neuropeptides, adenosine triphosphate, amino acids and nitric oxide. Pharmacol Rev. 48 113-178. Lundberg, J.M., and Tatemoto, K. (1982) Pancreatic polypeptide family (APP, BPP, NPY, and PYY)in relation to sympathet ic vasoconstriction resistant to alpha-adrenoceptor blockade. Acta. Physiol. Scand 116 393-402. Luo, X., Zeng, W., Xu, X., Popov, S., Da vignon, I., Wilkie, T.M., Mumby, S.M., and Muallem S. (1999) Alternat e coupling of receptors to Gs and Gi in pancreatic and submandibular gland cells. J. Biol. Chem 274 17684-17690. Lutz, E.M., Sheward, W.J., West, K.M., Morrow, J.A., Fink, G., Harmar, A.J. (1993) The VIP2 receptor: molecular c haracterisation of a cDNA encoding a novel receptor for vasoacti ve intestinal peptide. FEBS Letters. 334 3-8. Luu, T.N., Dashwood, M.R., Chester, A. H., Tadjkarimi, S., and Yacoub, M.H. (1993) Action of vasoactive intestinal pept ide and distribution of its binding sites in vessels used for coronar y artery bypass grafts. Am J Cardiol. 71 1278-1282.

PAGE 195

181Lytton, J., Westlin, M., and Hanley, M. R. (1991) Thapsigargin inhibits the sarcoplasmic or endoplasmic reticulum Ca-ATPase family of calcium pumps. J. Biol. Chem. 266 17067-17071 MacKenzie, C.J., Lutz, E.M., Johnson, M. S., Robertson, D.N., Holland, P.J., and Mitchell, R. (2001) Mechanisms of phosphol ipase C activation by the vasoactive intestinal polypeptide/pituitary adenyla te cyclase-activating polypeptide type 2 receptor. Endocrinology. 142 1209-1217. Maruyama, T., Kanaji, T., Nakade, S., K anno, T., Mikoshiba, K. (1997). 2APB, 2aminoethoxydiphenyl borate, a membrane-penetrable modul ator of Ins(1,4,5)P3induced Ca2+ release. J. Biochem. (Tokyo) 122 498-505. Massari, V.J., Johnson, T.A., and Gatti, P.J. (1995) Cardiotopic organization of the nucleus ambiguus? An anatomical and physiological analysis of neurons regulating atrio-vent ricular conduction. Brain Res 679 227–240. Massari, V.J., Johnson, T.A., Gillis, R.A. and Gatti, P.J. (199 6) What are the roles of substance P and neurokinin-1 receptors in the control of negative chronotropic and negative dr omotropic vagal motoneurons? A physiological and ultrastructural analysis. Brain Res 693 133–147. Massari, V.J., Johnson, T.A., Llewelly n-Smith, I.J., and Gatti, P.J. (1994) Substance P neurons synaps e upon negative chronotropic vagal motoneurons. Brain Res 660 275–287. McCulloch, D.A., Lutz, E.M., Johnson, M.S.,Robertson, D.N., MacKenzie, C.J., Holland, P.J. and Mitchell, R. (2001) ADP-ribosylation factor-dependent phospholipase D activation by VPAC re ceptors and a PAC(1) receptor splice variant. Mol. Pharmacol. 59 1523–1532. Merriam, L.A., Barstow, K.L., Parsons, R.L. (2004) Pituitary adenylate cyclaseactivating polypeptide enhances the hyper polarization-activated nonselective cationic conductance, Ih, in dissociated guinea pig intracardiac neurons. regulatory Peptides 123 123-133. Meissner, G. (2004) Molecular regulati on of cardiac ryanodine receptor ion channel. Cell Calcium 35, 621-8. Miura, A., Kawatani, M., de Groat, W.C. (2001) Effe cts of pituitary adenylate cyclase activating polypeptide on lumbos acral preganglionic neurons in the neonatal rat spinal cord. Brain Res. 895 223–232

PAGE 196

182Miyata, A., Arimura, A., D ahl, R.R., Minamino, N., Ueha ra, A., Jiang, L., Culler, M.D., Coy, D.H. (1989) Is olation of a novel 38 residue-hypothalamic polypeptide which stimulates adenylate cyclase in pituitary cells. Biochem Biophys Res Commun 164 567-574. Montell, C., Rubin, G.M. (1989) Molecular characteriza tion of the Drosophila TRP locus: a putative integral membrane pr otein required for phototransduction. Neuron 2 1313-1323. Moore, K.A., Cohen, A.S., Kao, J.P., and Weinreich, D. (1998) Ca2+-induced Ca2+ release mediates a slow post-spike hyper polarization in rabbi t vagal afferent neurons. J Neurophysiol 79 688-694. Moravec, J. and Moravec, M. (1987) Intrinsic nerve plexus of mammalian heart: Morphological basis of cardiac rhythmical activity? Internat. Rev. Cytology. 106 89-147. Moro, O. and Lerner, E.A. (1997) Maxadilan, the vasodilato r from sand flies, is a specific pituitary adenylate cyclase acti vating peptide type I receptor agonist. J. Biol. Chem. 272 966-970. Muraki, K., Imaizumi, Y., Bolton, T.B., Watanabe, M. (1998) Comparative study of effects of isoproterenol and vasoac tive intestinal polypeptide on voltage dependent Ca2+ and Ca2+-activated K+ currents in porcine tracheal smooth muscle cells. General Pharm. 30 115-9. Murase, T., Kondo, K., Otake, K. and Oiso Y. (1993) Pituitary adenylate cyclase activating polypeptide stimulates arginine vasopressin release in conscious rats. Neuroendocrinology 57, 1092–1096. Mutt, V., and Said, S.I. (1974) Structur e of the porcine vasoactive intestinal octacosapeptide. The amino-acid s equence. Use of kallikrein in its determination. Eur. J. Biochem 42 581-589. Nicoll, R.A. (1988) The coupl ing of neurotransmitter rec eptors to ion channels in the brain. Science 241, 545–551. Nilsson, S.F.E. (1994) PACAP-27 and PACAP-38: vascular effects in the eye and some other tissues in the rabbit. Eur. J. Pharmacol 253 17-25. Nussdorfer, G.G., and Malendowicz, L.K. (1998) Role of VIP, PACAP, and related peptides in the r egulation of the hypothalamopituitary-adrenal axis. Peptides 19 1443-1467.

PAGE 197

183Ogi, K., Kimura, C., Onda, H., Arimura, A., Fujino, M. (1990) Molecular cloning and characterization of cDNA for the prec ursor of rat pituitary adenylate cyclase activating polypeptide (PACAP). Biochem Biophys Res Commun 173 1271-1279 Ohkubo, S., Kimura, C., Ogi, K., Okazaki, K., Hosoya, M., O nda, H., Miyata, A., Arimura, A., Fujino, M. (1992) Primar y structure and characterization of the precursor to human pituitary adenyla te cyclase activating polypeptide. DNA Cell Biol 11 21-30 Okazaki, K., Itoh, Y., Ogi, K., Ohkubo, S., Onda, H. (1995) Characterization of murine PACAP mRNA. Peptides 16 1295-1299 Pantaloni, C., Brabet, P., B ilanges, B., Dumuis, A., Ho ussami, S., Spengler, D., Bockaert, J., and Journot, L. (1996) Alte rnative splicing in the N-terminal extracellular domain of the pituitar y adenylate cyclase-activating polypeptide (PACAP) receptor modulates receptor se lectivity and relative potencies of PACAP-27 and PACAP-38 in phos pholipase C activation. J. Biol. Chem. 271 22146-22151 Parekh, A.B. and Penner, R. (1997) Store depletion and calcium influx. Physiol. Rev 77 901–930. Parsons, R.L., Rossignol, T.M., Calupca, M.A., Hardwick, J.C., Brass, K.M. (2000) PACAP peptides modulate gui nea pig cardiac neuron membrane excitability and neuropept ide expression. Ann N Y Acad Sci 921 202-210. Payet, M.D., Bilodeau, L., Breault, L., F ournier, A., Yon, L., Vaudry, H., and Gallo-Payet, N. (2003) PAC1 receptor activation by PACAP-38 mediates Ca2+ release from a cAMP-dependent pool in human fetal adrenal gland chromaffin cells. J. Biol. Chem. 278 1663-70 Pedarzani, P., Kulik, A., Mulle r, M., Ballanyi, K., Stocker, M. (2000) Molecular determinants of Ca2+-dependent K+ channel function in rat dorsal vagal neurons. J. Physiol 527.2 283-290. Perez, C.F., Marengo, J.J. Bull, R., Hidalgo, C. (1998) Cyclic ADP-ribose activates caffeine-sensitive calcium channels from sea urchin egg microsomes. Am. J. Physiol. 274 430 39 Phillips, A.M., Bull, A., Ke lly, L.E. (1992) Identificat ion of a Drosophila gene encoding a calmodulin binding protein with homology to the trp phototransduction gene. Neuron 8, 631-642.

PAGE 198

184Phillips, A.M., Bull, A., Kelly, L.E. (1992) Identification of a Drosophila gene encoding a calmodulin binding protein with homology to the trp phototransduction gene. Neuron 8, 631-642. Popma, J.J., Smitherman, T.C., Bedotto J.B., Eichhorn, E.J., Said, S.I. and Dehmer, G.J. (1990) Dir ect coronary vasodilation induced by intracoronary vasoactive intestinal peptide. J Cardiovasc Pharmacol 16 1000-1006. Poth, K. Nutter, T.J. Cuevas, J., Parker M.J. Adams, D.J. Luetje, C.W. (1997) Heterogeneity of nicotinic receptor class and subunit mRNA expression among individual parasympathetic neurons fr om rat intracardiac ganglia. J of Neurosci. 17 586-96. Prakash, Y.S., Prakash YS, Kannan MS Walseth TF, Sieck GC. (2000) cADP ribose and [Ca(2+)](i) regulation in rat cardiac myocytes. Am J Physiol Heart Circ Physiol 279 1482-1489. Putney, J.W. Jr (1986) A model for receptor-regulated calcium entry. Cell Calcium 7 1–12. Putney, J.W. Jr (2004) The enigmatic TRPCs: multifunctional cation channels. TRENDS in Cell Biol. 14 282-286. Putney, J.W. Jr, Broad, L.M. Braun, F-J., Lievremont, J-P ., Bird, G. St. J. (2001) Mechanisms of capacitative calcium entry. J. Cell Science 114 2223-2229. Rae, J., Cooper, K., Gates, P. and Wa tsky, M. (1991) Low access resistance perforated patch recordings using amphotericin B. J. Neurosci. Methods. 37 1526. Randall, W.C. and Wurster, R.D. (1994) Peripheral innervation of the heart. Vagal Control of the Heart: Experiment al Basis and Clinical Implications. Futura, New York. Rawlings, S.R., Piuz, I., Schlegel, W ., Bockaert, J., and J ournot, L. (1995) Differential expression of pitu itary adenylate cyclase-activating polypeptide/vasoactive intestinal polypepti de receptor subtypes in clonal pituitary somatotrophs and gonadotrophs. Endocrinology. 136 2088-2098 Richardson, R.J., Grkovic, I., Anderson, C.R. (2003) Immunohistochemical analysis of intracardiac ganglia of the rat heart. Cell Tissue Res. 314 337-50. Rigel, D.F. (1998) Effect s of neuropeptides on heart ra tes of dogs: Comparison of VIP, PHI, NPY, CGRP, and NT. Am. J. Physiol 255 311-317.

PAGE 199

185 Rigel, D.F., Lathrop, D.A. (1990) Vasoactive intesti nal polypeptide facilitates atrioventricular nodal conduction and shortens atrial and ventricular refractory periods in conscious and anesthetized dogs. Circ Res 67 1323-1333. Rigel, D.F., Grupp, I.L., Ba lasubramaniam, A., and Grupp, G. (1989) Contractile effects of cardiac neuropeptides in isolat ed canine atrial and ventricular muscles. American J. Physiol. 257 1082-1087 Robberecht, P., Gourlet, P. De Neef, P., WoussenColle, M.C., VandermeersPiret, M.C., Vandermeers, A., and Christophe J. (1992) Structural requirements for the occupancy of pituitary adenyla te-cyclase-activating-peptide (PACAP) receptors and adenylate cyclase activa tion in human neuroblastoma NB-OK-1 cell membranes. Discovery of PACA P(6-38) as a potent antagonist. Eur. J. Biochem. 207 239-246 Ross-Ascuitto, N.T., Ascuitto, R.J., Ram age, D., Kydon, D.W., Coy, D.H. and Kadowitz, P.J. (1993) Pituitary adenyla te cyclase activating polypeptide: a neuropeptide with potent inotr opic and coronary vasodilatory effects in neonatal pig hearts. Pediatr. Res. 34 323–328. Rubino, A., Hassall, C.J.S. and Burnstock, G. (1996) Autonomic control of the myocardium: Non-adrenergic non-cho linergic (NANC) mechanisms. In Shepherd, J.T. & Va tner, S.F. (eds) Nervous Control of the Heart Harwood Academic Publishers, T he Netherlands. 139-171. Sah, P. and Louise Faber, E.S. (2002) Channels underlying neuronal calciumactivated potassium currents. Prog Neurobiol 66 345-53. Sah, P. and Mclachlan, E. M. (1992) Potassium curre nts contributing to action potential repolarization and t he afterhyperpolarization in rat vagal moto-neurons. J. Neurophysiol. 68 1834–1841. Sah, P. and Mclachlan, E.M. (1991) Ca2+-activated K+ currents underlying the afterhyperpolarization in guinea pig vagal neurons: a role for Ca2+activated Ca2+ release. Neuron 7, 257–264. Said, S.I., and Mutt, V. (1970) Potent peripheral and splanchnic vasodilator peptide from normal gut. Nature (Lond). 225 863-864. Sawmiller, D.R., Henning, R.J., Cuevas, J. DeHaven, W.I., Vesely, D.L. (2004) Coronary vascular effects of vasoactive in testinal peptide in the isolated perfused rat heart. Neuropeptides 38 289-297.

PAGE 200

186Seabrook, G.R., Fieber, L.A., and Adams, D.J. (1990) N eurotransmission in neonatal rat cardiac ganglion in situ. Am J Physiol 259 H997-H1005. Seebeck, J., Schmidt, W.E., Kilbinger H., Neumann, J., Zimmermann, N., and Herzig, S. (1996) PACAP induces bradycardia in guinea-pig heart by stimulation of atrial cholinergic neurones. Naunyn-Schmiedebergs Arch. Pharmacol. 354 424-430 Seki, Y., Suzuki, Y., Baska ya, M.K., Saito, K., Taka yasu, M., Shibuya, M. and Sugita, K. (1995) Central cardiovascular e ffects induced by intracisternal PACAP in dogs. Am J Physiol 269 135–139. Shao, L.R., Halvorsrud, R., Borg-Graham, L., and Storm, J.F. (1999) The role of BK-type Ca2+-dependent K+ channels in spike broadening during repetitive firing in rat hippocampal pyramidal cells. J Physiol 521 135-146. Shibuya, I., Kabashima, N., Tanaka, K., Setiadji, V.S., Noguchi, J., Harayama, N., Ueta, Y., Yamashita, H. (1998) Patch-clamp anal ysis of the mechanism of PACAP-induced excitation in rat supraoptic neurones. J Neuroendocrinol 10 759-768. Shivers, B.D., Gorcs, T.J. Gottschall, P.E. and Arim ura, A. (1991) Two high affinity binding sites for pituitary adenyla te cyclase-activating polypeptide have different tissue distributions. Endocrinology 128 3055. Sitsapesan, R., McGarry, S.J., Williams, A.J. (1995) Cyclic ADP-ribose, the ryanodine receptor and Ca2+ release. Trends Pharmacol Sci 16 386-91. Smith, A.B. and Adams, D.J. (1999) Met-enkephalin-induced mobilization of intracellular Ca2+ in rat intracardiac ganglion neurones. Neurosci. Lett. 264 105108 Smitherman, T.C., Popma, J.J., Said, S.I., Krejs, G.J., Dehmer, G.J. (1989) Coronary hemodynamic effects of intravenou s vasoactive intestinal peptide in humans. Am J Physiol 257 1254-1262 Smyth, L.M., Bobalova, J., Mendoza, M.G., Lew, C., Muta fova-Yambolieva, V.N. (2004) Release of beta-nicotinamide adenine dinucleotide upon stimulation of postganglionic nerve terminals in bl ood vessels and urinary bladder. J Biol Chem 279 48893-903. Spengler, D., Waeber, C., Pantaloni, C., Holsboer, F., Bokaert, J., Seeburg, P.H. and Journot, L. (1993) Differ ential signal transduction by five splice variants of the PACAP receptor. Nature 365 170–175.

PAGE 201

187 Sreedharan, S.P., Patel, D.R., Huang, J.X ., and Goetzl, E.J. (1993) Cloning and functional expression of a human neuroendocrine vasoacti ve intestinal peptide receptor. Biochem. Biophys. Res. Commun 193 546-553. Storm, J.F. (1987) Action potent ial repolarization and a fast afterhyperpolarization in rat hippocampal pyramidal cells. J. Physiol. 385, 733– 759. Storm, J.F. (1990) Potassium curr ents in hippocampal pyramidal cells. Prog. Brain Res. 83 161–187. Suda, K., Smith, D.M., Ghat ei, M.A., and Bloom, S.R. (1 992) Investigation of the interaction of VIP binding sites with VIP and PACAP in human brain. Neurosci. Lett. 137 19-23. Sun, X., Gu, X.Q., Haddad, G.G. (2003) Ca lcium influx via L-and N-type calcium channels activates a transient large-conductance Ca2+-activated K+ current in mouse neocortical pyramidal cells. J. Neurosci 23 3639-3648. Svoboda, M., Tastenoy, M., Ciccarelli, E ., Stievenart, M., and Christophe, J. (1993) Cloning of a splice variant of t he pituitary adenylate cyclase-activating polypeptide (PACAP) type I receptor. Biochem. Biophys. Res. Commun 195 881. Takai, Y., Sugawara, R., Ohinata, H., Takai, A. (2004) Two types of nonselective cation channel opened by musca rinic stimulation with carbachol in bovine ciliary muscle cells. J. Physiol. 559.3 899-922. Takasawa, S., Tohgo, A., Noguchi, N., Koguma, T., Nata, K., Sugimoto, T., Yonekura, H., Okamoto, H. (1993) Synthes is and hydrolysis of cyclic ADP-ribose by human leukocyte antigen CD38 and inhi bition of the hydrolysis by ATP. J Biol Chem. 268 26052-4. Tanaka, K., Shibuya, I., Nagatomo, T., Ya mashita, H., Kanno, T. (1996) Pituitary adenylate cyclase-activating polypeptide causes rapid Ca2+ release from intracellular stores and long lasting Ca2+ influx mediated by Na+ influx-dependent membrane depolarization in bov ine adrenal chromaffin cells. Endocrinology 137 956-966.

PAGE 202

188Tanaka, K., Shibuya, I., Uezono, Y., Ue ta, Y., Toyohira, Y ., Yanagihara, N., Izumi, F., Kanno, T., and Yamashita, H. (1998) Pituitary adenylate cyclaseactivating polypeptide causes Ca2+ release from ryanodine/caffeine stores through a novel pathway independent of both inositol trisphosphates and cyclic AMP in bovine adrenal medullary cells. J. Neurochem. 70 1652-1661. Tatsuno, I. and Arimura, A. (1994) Pituitary adenylate cyclase-activating polypeptide (PACAP) mobilizes intracellu lar free calcium in cultured type-2, but not type-1, astrocytes. Brain Res 662 1–10. Thomas, J.M., Masgrau, R., Churchill, G.C., Galione, A. (2001) Pharmacological characterization of the putative cADP-ribose receptor. Biochem J. 359 451-7. Tsuzuki, K., Xing, H., Ling, J., Gu, J.G. (2004) Menthol-induced Ca2+ release from presynaptic Ca2+ stores potentiates sensory synaptic transmission. J. Neurosci. 24 762-771. Thureson-Klein, A., and Kl ein, R.L. (1990) Exocyt osis from neuronal large dense-cored vesicles. Int. Rev. Cytol 121 67-126. Uchimura, D., Katafuchi, T., Hori, T., Y anaihara, N. (1996) Fac ilitatory effects of pituitary adenylate cyclase activating polypeptide (PACAP) on neurons in the magnocellular portion of the rat hypothalam ic paraventricular nucleus (PVN) in vitro. J Neuroendocrinol 8 137-143. Unverferth, D.V., O'Dorisio, T.M., Miller, M.M., Uretsk y, B.F., Magorien, R.D., Leier, C.V., Thompson, M.E. Hamlin, R.L. (1986) Human and canine ventricular vasoactive intestinal polypeptide: decrease with heart failure. J Lab Clin Med 108 11-16. Vaudry D Gonzalez B J Basille M Yon L Fournier A Vaudry H. (2000) Pituitary adenylate cyclase-activating polypeptide and its re ceptors: from structure to functions. Pharmacol Rev 52 269-324 Venkatachalam, K., Ma, H.T., Ford, D.L. Gill, D.L. (2001) Expression of functional receptor-coupled TRPC3 channels in DT40 triple receptor InsP3 knockout cells. J Biol Chem 276 33980-33985. Venkatachalam, K., Zheng, F., Gill, D.L. (2003) Regulation of canonical transient receptor potential (TRPC) channel functi on by diacylglycerol and protein kinase C. J Biol Chem 278 29031-40 Walseth, T.F., Lee, H.C. (1993) Synthesis and characterization of antagonists of cyclic-ADP-ribose-induced Ca2+ release. Biochim Biophys Acta 1178 235-42.

PAGE 203

189 Wang, Y., Deshpande, M., Payne, R. (2002) 2-Ami noethoxydiphenyl borate inhibits phototransduction and blocks voltage-gated potassium channels in Limulus ventral photoreceptors. Cell Calcium. 32 209-216. Warren, J.B., Donnelly, L.E., Cullen, S., Robertson, B.E., Ghat ei, M.A., Bloom, S.R., and MacDermot, J. (1991) Pitu itary adenylate cyclase-activating polypeptide: a novel, long-lasting, endothelium-independent vasorelaxant. Eur J Pharm 197 131-134. Weigl, L., Zidar, A., Gsc heidlinger, R., Karel, A., and Hohenegger, M. (2003) Store operated Ca2+ influx by selective depletion of ryanodine sensitive Ca2+ pools in primary human skeletal muscle cells. Naunyn-Schmiedeberg’s Arch. Pharmacol. 367 353-363. Weihe, E., Reinecke, M., and Forssmann, W .G. (1984) Distribution of vasoactive intestinal polypeptide-like immunoreacti vity in the mammalian heart. Interrelation with neurotensinand substance Plike immunoreactive nerves. Cell Tissue Res. 236 527-540 Willmott, N.J., Galione, A., Smith, P.A. (1995) A cADP-ribose antagonist does not inhibit secretagogue-, caffeineand ni tric oxide-induced Ca2+ responses in rat pancreatic beta-cells. Cell Calcium 18 411-419. Wong, F., Schaefer, E.L., Roop, B.C ., LaMendola, J.N., Johnson-Seaton, D., Shao, D. (1989) Proper func tion of the Drosophila trp gene product during pupal development is important for normal vi sual transduction in the adult. [Journal Article] Neuron. 3 81-94. Xia, M., Sreedharan, S.P., and Goetzl, E.J. (1996) Pr edominant expression of type II vasoactive intestinal peptide re ceptors by human T lymphoblastoma cells: transduction of both Ca2+ and cyclic AMP signals. J. Clin. Immunol. 16 21-30 Xi-Moy, S-X, Randall, W.C., & Wurster, R.D. (1993) Nicotinic and muscarinic synaptic transmission in canine intracardiac ganglion cells innervating the sinoatrial node. J Auton Nerv Syst. 47 69-74. Xu, X.Z., Chien, F., Butler, A., Salko ff, L., Montell, C. (2000) TRPgamma, a drosophila TRP-related subunit, forms a regulated cation channel with TRPL. Neuron 26 647-57. Xu, Z.J. and Adams, D.J. (1992) Voltage-dependent sodium and calcium currents in cultured parasym pathetic neurones from ra t intracardiac ganglia. J. Physiol. 456 425-441.

PAGE 204

190 Xue, H.H., Zhao, D.M., Suda, T., Uchida, C., Oda, T., Chida, K., Ichiyama, A., and Nakamura, H. (2000). Store deplet ion by caffeine/ryanodine activates capacitative Ca(2+) entry in nonexcitable A549 cells. J. Biochem. 128 329-336. Yonezawa, T., Furukawa, Y., Lajhe, M., N agashima, Y., Hirose, M., & Chiba, S. (1996) PACAP-38 activates parasympathetic nerves in isolated, blood-perfused dog atria. Euro J Pharmacol 315 289-296. Zhang, Z., Tang, J., Tikunova, S., Johnson, J.D., Chen, Z., Qin, N., Dietrich, A., Stefani, E., Birnbaumer, L. and Zhu, M.X. (2001) Activation of Trp3 by inositol 1,4,5-trisphosphate receptors through displacement of i nhibitory calmodulin from a common binding domain. Proc Natl Acad Sci USA. 98 3168 3173. Zhou, C.J., Yada, T., Kohno, D., Kikuya ma, S., Suzuki, R., Mizushima, H., and Shioda, S. (2001) PACAP activates PKA, PKC and Ca(2+) signaling cascades in rat neuroepithelial cells. Peptides. 22 1111-1117 Zocchi, E., Franco, L., Gui da, L., Benatti, U., Bargelle si, A., Malavasi, F., Lee, H.C., De Flora, A. (1993) A single protein immunologi cally identified as CD38 displays NAD+ glycohydrolase, ADP -ribosyl cyclase and cyclic ADP-ribose hydrolase activities at the outer surface of human erythrocytes. Biochem Biophys Res Commun 196 1459-65.

PAGE 205

ABOUT THE AUTHOR Wayne Isley DeHaven was born in S t. Petersburg, Florida on April 8, 1976, to Eugene W. and Kathy I. DeHaven. He received his elementary education at Bear Creek and Azalea Middl e Schools. In 1994, Wayne graduated Boca Ciega High School in Gulfport, Florida. Wayne earned his bachelor’s degree in Entomology from the University of Florida in 1998. Two years later, Wayne earned his Master’s degree in Biomedi cal Sciences from Barry University in Miami, Florida. In 2000, Wayne enter ed the Ph.D. program at the University of South Florida College of M edicine to pursue further education and training in science. Wayne completed his studies at the University of South Florida Pharmacology and Therapeutics Depar tment in the Spring of 2005.