USF Libraries
USF Digital Collections

Development of a dna vaccine against _streptococcus mutans_

MISSING IMAGE

Material Information

Title:
Development of a dna vaccine against _streptococcus mutans_ a novel approach to immunization against dental caries
Physical Description:
Book
Language:
English
Creator:
Han, Thomas
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
Mutans streptococcus
Prime-boost
Saliva
Secretory iga
Wapa
Dissertations, Academic -- Biology -- Doctoral -- USF   ( lcsh )
Genre:
government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Streptococcus mutans is the main causative agent of dental caries, which is a widespread infectious disease. A number of surface molecules are involved in the pathogenicity of this organism, including adherence and aggregation factors. The wall-associated protein A (WapA) of Streptococcus mutans GS-5 was previously demonstrated to be a sucrose-dependent adherence and aggregation factor, and is a larger precursor to extracellular antigen A (AgA), a candidate antigen for a dental caries vaccine.The full-length wapA gene and a C-terminal truncated version agA encoding the AgA were cloned into the mammalian expression vector pcDNA 3.1/V5/His-TOPO. The above constructs were mixed with a cationic lipid and used to transfect Chinese hamster ovary (CHO) cells. Transient expression of the wapA and agA genes was observed at 24 h post-transfection, as shown by Western immunoblot analysis.In CHO, cells WapA containing the membrane and wall-spanning region was found in apoptotic bodies, whereas the soluble AgA, which lacked the hydrophobic region, was found in extracellular medium. A higher salivary IgA level was observed in mice immunized with the pcDNA-wapA vaccine as compared to those immunized with the pcDNA-agA vaccine. Furthermore, the anti-WapA antibody inhibited S. mutans sucrose-dependent adherence, suggesting potential protection of the tooth against S. mutans colonization, while anti-AgA had no significant effect. Indeed, prediction and analysis of protein epitopes showed that WapA contains highly promiscuous MHC-II binding motifs that are absent from AgA. Immunodot assay confirmed that WapA bound biotin-labeled dextran, whereas AgA did not.
Thesis:
Thesis (Ph.D.)--University of South Florida, 2005.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Thomas Han.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 134 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001681160
usfldc doi - E14-SFE0001068
usfldc handle - e14.1068
System ID:
SFS0025389:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Development of a DNA Vaccine Against Streptococcus mutans : a Novel Approach to Immunization Against Dental Caries by Thomas K. Han A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Biology College of Arts and Sciences University of South Florida Major Professor: My Lien Dao, Ph.D. Daniel V. Lim, Ph.D. Kenneth E. Ugen, Ph.D. Valerie J. Harwood, Ph.D. Date of Approval: March 31, 2005 Keywords: mutans streptococcus, prim e-boost, saliva, secretory IgA, wapA Copyright 2005, Thomas K. Han

PAGE 2

Acknowledgements Above all, I would like to express my d eepest thanks and respect to my major professor, Dr. My Lien Dao, for her mentorship and support. I am deeply indebted to the members of my committee: Dr. Daniel Li m, Dr. Valerie Harwood, Dr. Kenneth Ugen, and Dr. Andrew Cannons, who have been extr emely supportive and helpful in every way. Without their support this disserta tion would not have been written. I extend many thanks to my colleagues a nd friends in Dr. Daos lab for their friendship and support. Thanks to my wife, Sandy Han, for her love, understanding, and patience. I am grateful to my four children, Catherine, Chris tina, Claudia, and Christian. They have been my greatest source of inspira tion. Finally, I would like to take the opportunity to thank my parents for their immense support and encouragement over the years.

PAGE 3

i Table of Contents List of Tables v List of Figures vi Abstract ix Introduction 1 Background of Dental Caries1 Virulence factors of S. mutans and Approaches for Development of Anti-caries Vaccine 3 AgI/II 4 Glucosyltransferases (GTF) 5 Glucan-binding proteins (GBP) 5 Antigen A (AgA) 6 Wall-associated protein A 6 Passive immunization 11 Advantages and Risks of DNA-based Immunization 11 Mechanism of DNA vaccines 13 Mucosal Immune System and Salivar y Immunity in the Oral Cavity 14 Caries Vaccine Route to Mucosal Immune Response 16 Materials and Methods 18 Structural Analysis of the Wall-associated Protein A Gene ( wap A) 18 Antigenicity prediction algorithms of the WapA protein 18 Prediction and analysis of MHC Class II binding regions 18 Analysis of wap A DNA sequence for glycosylation 19 Kozak sequences on the 5 untranslated region (UTR) of the mRNA transcript 19 Codon usage 19 Identification and characterizati on of Collagen Binding Properties by the WapA 20 Bacterial strains and growth conditions 20 Specificity and localization of collagen binding domain 20 Structure prediction of Collagen Binding Domain in WapA 21 Cloning expression and purification of recombinant collagen binding domain (rCBD) of WapA 21 Biotin Labeling 22

PAGE 4

ii Dot Blot Collagen binding assay 22 Solid Phase Binding Assay 23 Construction of DNA vaccines 24 Cloning of the wap A and agA genes into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO 24 PCR 27 DNA sequencing 28 Optimization of wap A and agA DNA vaccine production and quality control 28 Purification of DNA vaccine 28 Plasmid DNA preparation for immunization study 29 Expression of S. mutans wall-associated protein A gene in Chinese Hamster Ovary Cells 30 Cell culture 30 Plasmids 30 Propagation and isolation of Plasmid DNA vector pcDNA3.1/ V5-His TOPO 30 Transfection of CHO cells 31 Adsorption of antiserum 31 Dot immunobinding assay 32 Western immunoblot analysis of transfected CHO cells 32 Immunochemical staining of transfected C HO cells 33 Differential immunogenicity of a DNA vaccine containing the S. mutans wall-associated protein A gene versus that containing a truncated de rivative antigen A lacking in the hydrophobic carboxyterminal terminal region 33 Animals 33 Bacterial strains and cell line 34 DNA vaccine 34 Transfection of pcDNAwap A in Hela cells 34 Immunization of mi ce by the intranasal i nhalation technique 35 Immunization of mice 35 Collection of saliva and blood samples 36 Dot immunobinding assay 36 Enzyme linked immunosorbent assay (ELISA) 37 Assay of antibodies to recombinant AgA 38 Assay of antibodies to S. mutans WapA 38 In vitro Adherence inhibition assa y 38 Dextran binding Assay 40 Statistical analysis 40 Efficacy of DNA versus Protein Vaccin e; Relative induction of mucosal IgA response to S. mutans Wall Associated Protein A 40 Experimental animals 40 Cell lines 41 Bacterial strains, plasmids, and media 41

PAGE 5

iii Cloning of murine IL-5 cytokine gene into the mammalian expression vector 41 Cloning of the cholera toxin B-subunit ( ctb ) gene into the mammalian expression vector 42 Cloning of the ctb gene into pGEX expression vector 42 DNA sequencing 44 Expression and Purification of WapA and AgA from E. coli recombinant clones 45 Measurement of GST Activity by CDNB Assay 46 Production of protein vaccine s and DNA vaccines against S. mutans WapA and AgA 47 Immunogenicity of the fusion proteins 47 Preparation of rabbit polyc lonal antibody against WapA 47 Absorption of anti-E.coli and anti-GST antibody from rabbit serum 48 Purification of IgG antibody against WapA 49 Induction of WapA in presence of sucrose 49 Immunization protocols 50 Collection of saliva 50 Immunodot analysis 50 Enzyme-linked immunosorbent assay 50 Results 51 B cell epitope prediction of the WapA protein 51 Detection of MHC class II binding regions 53 Identification of Nor O-glyc osylation sites in WapA sequence 56 Glycosylation of the anti-WapA DNA vaccine candidates 57 Codon optimization 58 Comparative sequence analysis of th e putative collagen binding domain in WapA 64 Structure analysis of putative collagen binding domain in WapA 66 Expression of recombinant co llagen binding domain 67 Collagen binding properties of the AgA 68 Quantitative analysis of collagen binding property of WapA 69 Cloning of truncated wap A genes into pcDNA3.1/V5/His-TOPO 70 Quality control of plasmid production for immunization 73 Expression of WapA and AgA by dot immunobinding assay 75 Western immunoblot analysis of WapA and AgA expressed in transfected CHO cells 75 In situ immunochemical staining of transfected C HO cells 76 Optimization of pcDNA-lipid complex 79 Dot immunbinding assay 79 Humoral immune responses induced by DNA vaccines 80 Western immunoblot analysis of anti body response against AgA 81 Induction of S. mutans WapA expression 82 Western immunoblot analysis of antibody respon se against WapA 83

PAGE 6

iv Sucrose-dependent adherence inhibition assay 84 Dextran-binding properties 84 Cloning and sequencing of il-5 and ctb recombinant genes 85 Western immunoblot analysis of th e purified GST-CTB fusion protein 86 Expression of recombinant WapA or AgA 87 Production of DNA vaccine 89 Production of Protein vaccine 89 Immunodot analysis 90 Immunomodulatory effect on humoral immunity 90 Discussion 93 References 102 About the Author End Page

PAGE 7

v List of Tables Table 1 Consensus antigenic determinants within the WapA sequence 53 Table 2. Codon optimization of wap A gene. 63 Table 2. Effect of salivary IgA produ ced in response to immunization on bacterial adherence 84

PAGE 8

vi List of Figures Figure 1. Virulence factors of Streptococcus mutans during colonization and accumulation in dental biofilms 4 Figure 2. Construction of Truncated wap A 10 Figure 3. Genetic immunization: Mech anisms of antigen presentation 14 Figure 4. PCR-generated wap A-E and wap A-G genes 26 Figure 5. Map of pcDNA3.1/V5-His-TOPO with wap A insert 27 Figure 6. Map of pCR2.1-TOPO plasmid vector. 43 Figure 7. Map of prokaryotic expression vector pGEX-6p-1 44 Figure 8. Absorption of immune serum 49 Figure 9. B cell epitope pred iction by four algorithms 52 Figure 10. Detection of MHC-II prom iscuous binding motifs in WapA. 55 Figure 11. Prediction of N-glycosyl ation sites in WapA sequence. 56 Figure 12. Predicted O-glycosyla tion sites in WapA sequence 57 Figure 13. Comparison of codon usage for each amino acid used by S. mutans and H. sap iens genes 60 Figure 14. Codon usage of wap A gene compared with the H. sapiens genes for each amino acid 61 Figure 15. Analysis of codon usage pattern of wap A to the common codon usage of H. sapiens at each position of the gene 62 Figure 16. Alignment of deduced amino acid sequences of WapA with conserved domain databases 65

PAGE 9

vii Figure 17. The predicted secondary stru cture for putative collagen binding domain in WapA 67 Figure 18. Expression and pur ification of recombinant collagen binding domain 68 Figure 19. Collagen binding Assay 69 Figure 20. Binding of recombinant putative CBD of WapA protein to native type I collagen used at di fferent concentrations 70 Figure 21. Insertion of wap A-E and wap A-G fragments containing an initiation codon into the pcDNA3.1 eukaryotic expression vector 71 Figure 22. Nucleotide sequence of the recombinant wap A ( wap A-E) cloned into a eukaryotic expression vector, pcDNA3.1 72 Figure 23. Nucleotide sequence of the recombinant agA ( wap A-G) cloned into a eukaryotic expression vector, pcDNA3.1 73 Figure 24. Agarose gel electrophoresis a nd restriction enzyme digestion of pcDNA3.1wap A or pcDNA3.1ag A for assuring the quality of DNA vaccines 74 Figure 25. Immunodot analysis 75 Figure 26. Western immunoblot analysis of wap A-E and wap A-G gene expression using rabbit antiserum to S. mutans cell wall antigens in CHO cells at 24 h post-transfection 76 Figure 27. In situ expression of WapA and AgA at 24 hours post-transfection 78 Figure 28. Optimization of DMRIE-C Reag ent and pcDNA ratio for transfection 79 Figure 29. Immunodot analysis of anti-Wa pA and AgA salivary IgA production 80 Figure 30. Salivary IgA and serum IgG responses in mice 81 Figure 31. Western immunoblot analysis of salivary S-IgA Abs to wap A and agA DNA vaccines 82 Figure 32. Expression of WapA in presence of sucrose 83 Figure 33. Western bl ot analysis of S. mutans WapA using polyclonal antiserum raised against AgA or WapA. 83 Figure 34. Dextranbinding assay 85

PAGE 10

viii Figure 35. Nucleotide sequence of il -5 or ctb gene insert 86 Figure 36. Western immunoblot analysis of purified GST-CTB fusion protein 87 Figure 37. SDS-PAGE analysis of the GSTwap A fusion protein expression 88 Figure 38. Expression of wap A and agA genes as GST fusions 88 Figure 39. Immunodot analysis 90 Figure 40. WapA-specific sIgA antibody response in the saliva of mice immunized with DNA or protein vaccine 92

PAGE 11

ix Development of a DNA Vaccine Against Streptococcus mutans : a Novel Approach to Immunization Against Dental Caries Thomas K. Han ABSTRACT Streptococcus mutans is the main causative agent of dental caries, which is a widespread infectious disease. A number of surface molecules are involved in the pathogenicity of this organism, including a dherence and aggregation factors. The wallassociated protein A (WapA) of Streptococcus mutans GS-5 was previously demonstrated to be a sucrose-dependent adhere nce and aggregation fact or, and is a larger precursor to extracellular antigen A (AgA), a candidate antigen for a dental caries vaccine. The full-length wap A gene and a C-terminal truncated version agA encoding the AgA were cloned into the mammalian expres sion vector pcDNA 3.1/V5/His-TOPO. The above constructs were mixed with a cationic lipid and used to transfect Chinese hamster ovary (CHO) cells. Tran sient expression of the wap A and ag A genes was observed at 24 h post-transfection, as shown by Western immunoblot analysis. In CHO, cells WapA containing the membrane and wall-spanning region was found in apoptotic bodies, whereas the soluble AgA, which lacked the hydrophobic region, was found in extracellular medium. A higher salivary IgA level was observed in mice immunized with the pcDNA-

PAGE 12

x wap A vaccine as compared to those immunized with the pcDNAagA vaccine. Furthermore, the anti-WapA antibody inhibited S. mutans sucrose-dependent adherence, suggesting potential protection of the tooth against S. mutans colonization, while antiAgA had no significant effect Indeed, prediction and an alysis of protein epitopes showed that WapA contains highly promisc uous MHC-II binding motifs that are absent from AgA. Immunodot assay confirmed that WapA bound biotin-labeled dextran, whereas AgA did not. These data indicated th at full-length wall-associated WapA is a better candidate vaccine antigen than the soluble AgA. In co-immunization studies pcDNActb was preferable to pcDNAil-5 as genetic adjuvant. A comparable secondary respons e was obtained by priming with either pcDNAwap A or WapA followed by a WapA boo st, thus demonstrating the pcDNAwap A as a valid contender primary vaccine. The successful utiliza tion of the caries DNA-based vaccine protocol would represent a highly significant new approach to this important worldwide health problem.

PAGE 13

1 INTRODUCTION Background of Dental Caries Dental caries is one of the most prevalent and costly chronic inf ectious diseases in humans. Despite improvement in dental hygiene and advances in caries research over the past decades, dental caries ha s been experienced by over 90 pe rcent of all adults in the U.S. and over 80 percent of children by age 17, re sulting in billion of dollars in health expenditures per year (53, 79, 140). In recen t years, caries prevalence and distribution has shifted from being circulated evenly among the population, to disproportionately affecting individuals in economically-challe nged populations with more severe forms of caries (20, 108). The incidence of dental cari es is high in industri alized countries and on the rise in developing countries (4, 71). The risk of severe dental caries is increased in elderly people who are showing root-surface ca ries and in other specific groups such as those who suffer from hypo-salivation due to dr ug-induced side effects, systemic disease such as Sjogrens Syndrome, and tumor patie nts receiving irradia tion therapy (2, 3, 13, 128). The etiologic role of mutans streptococci (MS) in dental caries was established in Keyes experiment in 1960, showing direct ev idence that these organisms are the primary etiologic agents. MS has been divided in to eight serotypes designated a-h based on differences of carbohydrates in the cell wall (9, 11, 97). DNA homology analysis further clarified MS into seven di stinct species known as Streptococcus mutans (serotypes c,e

PAGE 14

2 and f), S. rattus (serotype b), S. cricetus (serotype a), S. sobrinus (serotypes d and g), S. ferus (serotype C), and S macacae (serotype c) and S. downei (serotype H) (8, 17, 18, 138). These organisms have the ability to colonize the tooth surface, build up dental plaque by aggregating homologous and hetero logous bacteria, and produce lactic acid which attacks the enamel. Of these species, S. mutans has been implicated as the major and most common of the two main etiologi cal agents of human dental caries (37, 73, 135), the other being called S. sobrinus S. mutans was first described by Clarke in 1924 after he isolated an organism that he felt to be from the initial carious lesions in humans (15). Clarke named S. mutans based on his observation th at the organism formed different colony morphology with th e change of growth media. As with a large number of infectious di seases, dental caries is preventable by immunization. This was demonstrated in an imal studies, but the prospect for a human dental caries vaccine using whol e organisms or components of S. mutans has been hampered by the presence of antigens that ar e cross-reactive with proteins in human cardiac tissue (46). Consequently, much effort has been focused on developing recombinant vaccine antigens. Through this process, heart reactive antigens can be avoided or modified to eliminate the heart cross-reactive epitopes. With decades of research on S. mutans by dedicated researchers around th e world, a number of proteins involved in colonization have been studied as important candidate dental vaccine antigens. One concern is how to make them affordable to large populations, especially since most of the populations at risk are from developi ng countries, or from low socioeconomic groups in i ndustrialized nations.

PAGE 15

3 Virulence Factors of S. mutans and Approaches for Development of Anti-caries Vaccine A number of surface molecules contribut e to the pathogenicity of the MS organism including adherence and aggregat ion factors (37). With recombinant DNA technology and advances in mucosal i mmunology, a number of virulence factors involved in S. mutans, a principal causative agent of dental caries, have been characterized, cloned and tested for the abil ity to induce a protec tive response through induction of mucosal immunity and production of specific salivary secretory IgA (sIgA). Today, much progress has been made in the fi eld of dental caries vaccines based on the virulence factors involved in the S. mutans colonization of the tooth and build-up of dental plaque (Fig. 1). The factors tested to reduce dental caries in an animal model include: (1) A 190 kDa salivary a dhesin called AgI/II ; (2) Glucosyltransferase (GTF); (3) A glucan binding protein (GBP), (4) A 29 kDa extracellular antigen A (AgA), also known as antigen III; and (5) Wall-associated protein A (WapA), a precursor to the extracellular AgA (59, 64). These receptors could be blocked by vaccine-induced antibodies, thus preventing the S. mutans from colonizing or accumulating in the oral cavity. Recombinant DNA technology has been a pplied to clone the genes encoding the above virulence factors for the production of recombinant antigen and peptide vaccines, as well as avirulent recombinant organi sms expressing the target antigen.

PAGE 16

FIG. 1. Virulence factors of Streptococcus mutans during colonization and accumulation in dental biofilms. AgI/II A 190 kDa major cell-surface protein antigen of S. mutans has been variously known as AgI/II, P1 (33), Pac (93), and AgB (110) while designated as SpaA or PAg (55) in S. sobrinus. AgI/II is involved in the initial bacterial adherence to tooth surfaces (28, 109). The AgI/II contains two internal repeating amino acid regions: 1) A-region with an alanine-rich tandem repeat at N-terminal domain that can bind salivary components such as sIgA, 2-microglobulin, histidine-rich polypeptides, a 60 kDa glycoprotein, high molecular mass glycoproteins, lysozyme, lactoferrine, and 2) a P-region with a proline-rich repeat in the center of the molecule where an adhesion epitope resides (19, 68, 87). 4

PAGE 17

5 Antibody to intact AgI/II (38, 54, 69) or pe ptides containing sa livary-binding domain epitopes (131) induced partial protection agains t dental caries in rodents, primates, and humans. Passive immunization with the an ti AgI/II antibody have shown reduced tooth colonization with S. mutans (75, 76). Glucosyltransferases (GTF) Glucosyltransferases (GTF) in S. mutans are involved in the synthesis of extracellular glucans, and its role in sucr ose-enhanced cariogenic ity was obtained from the comparative insertional inactivation study of GTF genes (86, 144). Three gtf genes encoding GtfB, GtfC and GtfD are re sponsible for glucan systhesis in S. mutans : GtfB (118) synthesizes an -1,3-linked insoluble glucan, while GtfD (44) is involved in the formation of a soluble -1,6 linked glucan. GtfC (100) synthesizes both insoluble and soluble glucans. All GTF molecules contai n a glucan-binding domain (GLU) on the Cterminal end and a sucrose-binding catalytic region (CAT) on the N-terminal part (84). Salivary and serum antibodies to GTF were detected and significant protection from dental caries was obtained by oral immunization with GTF in an animal model (126, 127). Synthetic peptides from the catalytic or glucan-binding domains of GTF have been shown to induce protection against experi mental dental caries (132). The newly formulated GTF peptide vaccine containing bot h the catalytic (CAT) and glucan-binding (GLU) regions induced significantly enhanced levels of antibody to GTF than either a CAT or GLU construct or coim munization with CAT/GLU (133). Glucan-binding proteins (GBP) The S. mutans glucan-binding protein (GBP), which mediates binding of the

PAGE 18

6 organisms to glucans synthesized by GTFs, is a virulence component in the development of dental plaque, and a candidate for a human caries vaccine (72). S. mutans synthesizes three glucan-binding proteins: GBP-A ( 110), GBP-B (123), and GBP-C (116). The predominant S. mutans GBP-A with a molcular mass of 74 kDa was purified (112), cloned, and sequenced (5). A S. mutans mutant insertionally inactivated in the gbpA was analyzed in vitro to demonstrate the role of gbp in colonization (6). Both the mutant and the parental type colonized smooth surfaces when grown in the presence of sucrose, suggesting that S. mutans may involve more than one protein in glucan binding. GBP-B secreted by S. mutans having a molecular mass of 59 kDa has been purified (123) and compared structurally and antigenically to other GBP-A in S. mutans and to the glucan-binding region of S. mutans glucosyltransferases. The GBP-B was shown to be antigenically distinct from the GBP-A and induced significantly higher salivary immune response in humans (123). GBP-C has an estimated molecular mass of 64 kDa and has no sequence similarities to GBP-A or GTF, but shows significant sequence matching to the surface pr otein adhesion AgI/II (77, 125). Antigen A (AgA) One candidate vaccine antigen ag ainst dental caries is the S. mutans antigen A (47, 110, 111), a proteolytic cleavage product of the large precursor wall-associated protein A (WapA) (23, 113). Immunization wi th AgA-induced protection against caries has been performed on cynomolgus monke ys (111) and mice (47) and has been recognized as an anti-caries vaccine. Wall-associated protein A The gene encoding the wall-associated prot ein A (WapA), a precursor to the AgA,

PAGE 19

7 was cloned and sequenced and proven to be involved in S. mutans sucrose-dependent adherence and aggregation (23, 30). Insertional inac tivation of the wap A gene resulted in a significantly reduced sucrose-dependent adherence and aggregation, 40 and 52%, respectively, of the wap A mutant (101). These findings suggest that th e antibody to the WapA or AgA may prevent dental caries by blocking both the colonization of the tooth and the build-up of dental plaque by S. mutans A genomic library of S. mutans strain GS5 was constructed in our laboratory via the shuttle vector Streptoccus-E. coli pSA3, and one clone was found to express the AgA and its precursor, the WapA, by Western im munoblot analysis using a monoclonal antibody against AgA (22). Subsequent sequence analysis of the gene showed that AgA was derived from WapA by proteolytic cl eavage. AgA previously shown by Russell (110) was a good candidate dental vaccine antig en (47, 111). Immunization of rats and monkeys conferred protection in these animals, with a reduction in carious lesions upon infection of these animals with the S. mutans and feeding a cariogenic diet rich in sucrose content. Since WapA has been observed to have binding affinity for dextran, this protein may be involved in glucan-mediated adhere nce and aggregation. Indeed, insertional inactivation of wap A in S. mutans caused a significant decrease in sucrose-dependent adherence and aggregation, by 40% and 50% resp ectively, as compared to the wild type tested in parallel (101). The role of WapA in sucrose-dependent adherence and aggregation was further de monstrated by cloning the wap A gene into S. gordonii a heterologous organism known to produce GT F but devoid of WapA. Expression of WapA conferred to this organism the ability to attach to a culture dish and to aggregate

PAGE 20

8 when grown in BHI containing 4% sucrose. These observations provided an expl anation of the protection obtained by immunization with AgA (111). Perhaps the antibody raised against AgA blocked S. mutans adherence and aggregat ion through binding to WapA. Through comparative sequence analysis between the S. mutans strain GS5 and the S. mutans strain, Ingbritt showed that the wap A gene was virtually identical in th ese strains, with the exception of a 24 base pair deletion in the GS-5 strain. This is in agreement with the immunological cross-reactivity of both strains with a rabbit anti-WapA antibody. Isolation of WapA from the original E. coli recombinant clone designated 4B2 was not efficient; therefore, production of v accine using this clone is not practical for large scale immunization studies. To increase the expression of WapA and to facilitate its isolation twelve wap A truncations were prepared by PCR amplification using primers designed to delete va rious regions of the wap A gene. The truncated wap A genes, designated wap A-A to wap A-L were cloned into the TA cloning vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA). Then they were excised by digestion with EcoRI and cloned into the expression pGEX-6P-1 glutathione S-transferase (GST) fusion vector (Pharmacia, Pittacaway, NJ). Cloning of a series of truncations of the wap A gene at the N-terminal and C-terminal ends into the e xpression fusion vector pGEX-6P-1 glutathione S-transferase (GST) demonstrat ed that the WapA and AgA reacted most strongly with a rabbit antibody to the S. mutans WapA (146). The resulting plasmids were used separately to transform E. coli BL21, a protease-deficient host strain for optimal expression of recombinant proteins (Pharmacia). PGEX-6P-1 contains a tac promoter fo r inducible high-le vel intracellular

PAGE 21

9 expression, an internal lac I q repressor for induction with isopropyl beta-Dthiogalactoside (IPTG), a PreScission TM protease cleavage site for removal of the GST by the PreScission protease enzyme, and an ampi cillin resistance gene for selection of recombinants. Of the 12 truncated wap A constructs, eight truncated wap A were found to express proteins reacting with a rabbit anti-WapA. These included wap A-D to wap A-K. The twelve wap A constructs are presented in Fig 2.

PAGE 22

FIG. 2. Construction of truncated wapA. Numbers on the top of the line represent amino acid positions. P is the promoter; SP is the signal peptide; PC is the protease cleavage site; W is the Cell wall domain; and M is the Membrane-spanning domain. Two of the clones constructed are of interest to the present study since they expressed proteins corresponding to the wild type full-length WapA (clone WapA-E), and a proteolytic cleavage site corresponding to the wild type extracellular AgA (clone 10

PAGE 23

11 WapA-G) (146). Passive immunization Passive immunization has also been consid ered as a safe way to administer a dental vaccine. Specific polyclonal and m onoclonal antibodies prevent colonization of the teeth by S. mutans. Lehner et al. (67) obtained a d ecrease in colonization by repeated application of a monoclonal antibody to S. mutans AgI/II onto the teeth of Rhesus monkeys. Passive immunization by oral ad ministration of antibody to GTF-generated protection was performed against S. mutans in the rat model (124). Other studies demonstrated a more convenient means of passive immunization with immunized cows milk. Application to mice showed a significant decrease in caries activity as compared to animals receiving milk from unimmunized cows (91). Hatta and Michalek (42) showed that a mouth rinse containing egg yolk Ig Y from chicken immunized with whole S. mutans prevented the in vitro attachment of the S. mutans to saliva-coated hydroxyapatite and reduced plaque formation in human volunteers. Ma et al. (76) ingeniously used a tobacco plant as a means to mass produce m onoclonal sIgA. Application of the plantderived antibody to human volunteers reduced plaque formation. Advantages and disadvantages are associ ated with each type of vaccine. Longterm protection is obtained with active im munization using recombinant proteins or peptides, but the response is variable between individuals. Rapid and dependable protection is obtained with pa ssive immunization; however, th is protection is of limited duration and frequent booster applica tions of antibodies may be required. Advantages and Risks of DNA-based Immunization DNA vaccines possess many of the most attr active aspects of modern vaccination

PAGE 24

12 strategies and, therefore, offer potential solutions for other diseases for which conventional vaccines have not yielded pr eventive measures. In comparison with traditional vaccines, DNA-based vacccines offer a major advantage in terms of the ease with which they can be constructed, modi fied, and purified. DNA vaccines are much more stable and can be manu factured inexpensively on a large scale at high levels of purity, which make them ideal prophylactic ag ents for use in developing countries (24, 129 ). Moreover, many different antigens from the same or different pathogens can be cloned into a single vector. Therefore, making multivalent vaccines against pathogens will decrease the number of vaccinations necessary, especially in children (27, 82). Since DNA vaccines utilize the host cells transcriptional and translational machinery to produce conformationally-specific antigens, the native conformation of epitopes is conserved. An appropriate tertia ry structure of protein conserved following administration of a DNA vaccine is essent ial for the induction of conformationally specific antibodies and protec tive immunity (36, 117). DNA vaccines can initiate both cellular and humoral immune responses that are long lasting (24, 61, 103). To date, DNA vaccines have not shown any of the possible adverse effects that have been previously discussed as potentia l safety issues associated with DNA-based immunization, which include th e integration of the plas mid DNA into the host genome (88, 141), leading to insertional mutation, induction of tumor formation by activation of oncogenes, or auto-immune disease due to the induction of anti-DNA antibodies (66, 143). The safety of DNA vaccines in humans has been demonstrated in clinical trials against several diseases and specific pathogens including cystic fibrosis, the hepatitis B virus, herpes simplex virus, HIV, malaria, and cancer (26, 78, 136).

PAGE 25

13 Mechanism of DNA Vaccines The cellular and molecular mechanisms by which DNA-based immunizations stimulate different types of T-cells have not b een fully elucidated (64). The type of cells transfected may vary depending on the rout e and method of DNA delivery (61). After administration of antigen-encoding plasmid DN A, the vaccinees cells take up the DNA molecules and transport them to the nucleus fo r transcription, with eventual export of the transcribed messenger RNA to the cytoplasm for protein synthesis. In the nucleus, the plasmid DNA is retained in an extra-chromo somal location and thus an expression of the DNA is not influenced by surrounding chromosomal elements (39). After translation at the ribosome, the antigens expressed intracellularly are processed and presented to T cells in the c ontext of antigen presenting cells (APC) MHC class I or II molecules, depending on whether the antig en is processed through an exogenous or endogenous pathway (106). An antibody response is induced by secretion of expressed whole antigen or antigen peptides processed and presented to CD4+ T cells on the cell surface with host MHC class II by antigen-presenting cells. Transfected APC can also process the antigen to peptides which bind to an MHC class I molecule in the ER. This complex moves via the golgi apparatus to the cell surface where it can stimulate the cellular T cell response by activation of CD 8+ cytotoxic T lyphocytes (CTL), which directly lyse infect ed target cells (104) (Fig. 3).

PAGE 26

FIG. 3. Genetic immunization: Mechanisms of antigen presentation. Mucosal Immune System and Salivary Immunity in the Oral Cavity The mucosal surfaces provide the principal immune defense against most human pathogenic organisms. Mucosal immunity to a variety of antigens has been successfully induced by immunization with protein or DNA vaccine through mucosal routes including oral, nasal, and genito-rectal mucosa (134). The major antibody isotype found in external secretions is sIgA, which can traverse epithelial membranes and help provide specific immunity against pathogens, including cariogenic S. mutans (37). All the mucosal routes 14

PAGE 27

15 tested induced the production of secretory IgA in the immunized area, as well as at distant mucosal surfaces (84, 90). One major function of the mucosal immune system is to develop salivary IgA antibodies in newborn infants (34). In mucosal immune systems, antigens or microorganisms are taken up by specialized epith elial cells termed M cells which overlie organized lymphoid follicles in tonsils and adenoids (Waldeyers ring) and on intestinal Peyers patches. After uptak e and transcellular transport by the M cells, the antigenic materials are processed by underlying APCs, wh ich present them to T helper cells. B cells are stimulated by both T-cell activation and specific cytokines. B cells then, differentiate into precursors of IgA-secreting plasma cells. Following activation of B and T cells, the IgA-producing cells migrate to various mucosal effector sites in the mucosal tissues including the stroma of the salivary glands, where terminal differentiation of the B lym phoblasts into IgA-secreting plasma cells occurs under the regulation of cytokines secreted by the T cells and epithelial cells. The resulting polymeric IgA secreted in the sali vary glands is taken up by a polymeric Ig receptor on the basolateral surface of glandular epithelial cells and rele ased into the saliva with a bound secretory component to form sa livary sIgA (81, 84, 90). Secreted salivary IgA, in turn, interferes with S. mutans binding to tooth surfac es via both sucroseindependent and sucrose-dependent mechanisms (122). Immunoglobulins derived from circulation pass through the gingival crevice into the oral cavity. These Igs, which include IgM, IgG, and IgA, are proportionally lower than sIgA in saliva compared to relative proportions in blood plasma (37).

PAGE 28

16 Caries Vaccine Route to Mucosal Immune Response Depending on the route of immunization a nd the type of adjuvants utilized, development of systemic and/or mucosal immun ity can be favored. Induction of specific mucosal immunity with production of specific salivary IgA is the goal of a dental vaccine (37, 122). In mucosal system, the delivery of vaccine at any mucosal route results in the induction of secretory IgA anti body at the delivery site as we ll as in the distant mucosal sites (90). Oral immunization induces muco sal immune response in the gut-associated lymphoid tissues (GALT), one of the principa l inductive sites of sIgA antibody response, which consist of the Peyers patches, the appendix, and solitary lymph nodes in the gastrointestinal tract (83). One drawback of the oral route for immunization is the damaging effects of stomach acidity on the antigen. Thus, for oral immunization, the DNA vaccine has to be encapsulated in enteric-coated tablets, or deli vered by intra-oral Jet in the cheek, which is also the case with protein vaccines (74). Rectal immunization is also an effective inductive method for a mucosal immune response. Inductive potential of the rectal route for salivary IgA responses was considered as an alternative route to mutans streptococcal antigens (65). Of all the mucosal routes tested, intr a-nasal application of protein or DNA vaccines has gained much popularity because it is not invasive (32, 38, 51, 92). This route is especially convenient for the immunization of young children, who cannot yet swallow enteric-coated tablets. Furthermore, unlike oral vaccine, a nasal vaccine does not need to be encapsulated into enteric-coated tablets and consequently costs less to prepare.

PAGE 29

17 Intranasal immunization with a S. mutans glucan-binding region of glucosyltransferase (51) and a S. mutans -enriched fimbrial prep aration (32) elicited specific salivary IgA production and protective immunity. Intranasal immunization with a DNA vaccine mixed with cationic lipids has been shown to be immunogenic. Immunization of animals with a luciferase gene-DNA construct complexed with cationic proteins resulted in the expres sion of luciferase in nasal tissue and an induction of a systemic and humoral response after a single dose of the vaccine (58). A number of adjuvants have been identif ied as stimulating a mucosal response to protein or DNA vaccines. Adjuvants used in protein or peptide vacc ines include cholera toxin CT, cholera toxin B subunit (CTB ), and a detoxified heat labile E. coli toxin (LT R292G) (25, 142). Adjuvants used in DNA vaccines include liposome and various cationic lipids (57, 58, 89, 98). Further st imulation of the immune response may be obtained by co-immunization with genetic ad juvants consisting of plasmids encoding cytokines, for example IL-4 or IL-10, to i nduce a Th2 type response, or IL-12 and/or a granulocyte/macrophages colony s timulating factor to obtain a Th1 type of response (27, 92, 102, 139).

PAGE 30

18 MATERIALS AND METHODS Structural Analysis of the Wal l-associated Protein A Gene ( wap A) Antigenicity prediction algorith ms of the WapA protein The identification of B cell epitopes within a WapA protein sequence was analyzed using four different predicti on algorithms: Hopp-Woods, Parker, Welling, and Kolaskar and Tongaonkar. The hydropathic profile of the WapA was calculated using the Hopp-Woods algorithm (45), which is a ssumes that antigenic sites are primarily hydrophilic at the surface of th e protein. The Parker method (96) of prediction uses an experimentally-determined hydrophilic scal e of polypeptides derived from highperformance liquid chromatography (HPLC) para meters for the antigenic determinants. Prediction of antigenic regions using the method of Welling (137) is based on the amino acid composition in known antigenic peptides. A semi-empirical algorithm of Kolaskar and Tongaonkar (60) uses data from both experimentally-determined epitopes and physicochemical properties of amino acids for the prediction of antigenic determinants. Prediction and analysis of MH C Class II binding regions Potential T cell epitopes within AgA or WapA were identified using a matrixbased quantitative algorithm, publicly available on line at http://www.imtech.res.in/raghava/propred/. The promiscuous binding regions were located and quantified by a virtual matrix for 51 known MHC class II alleles. Binding probabilities were set at a 3% th reshold representing th e 3% best scoring natural peptides.

PAGE 31

19 Analysis of wapA DNA se quence for glycosylation Inappropriate glycosylation of bacterial proteins that result s in conformational change, thus causing alteration or loss of immunogenicity, has been of concern in DNA vaccine preparation (48, 50). Potential glyc osylation sites of th e WapA protein were evaluated. Prediction analysis of the N-glycosylation or Oglycosylation sites in WapA based on the amino acid sequence was performed using NetNGlyc ( 35) or a NetOGlyc prediction server (40, 41) available from URL: http://www.cbs.dtu.dk/services/. Kozak sequences on the 5 untranslated region (UTR) of the mRNA transcript Initiation of translation is regulated by two fundamentally different mechanisms in prokaryotes versus eukaryot es. In prokaryotes, the ribos ome binding site (RBS), also called the Shine-Dalgarno sequence, is e ngaged in its recognition by ribosome for efficient and accurate translation of mRNA. In eukaryotes, however, a 40S ribosomal subunit locates the initia tor AUG codon by scanning the mRNA from the capped 5 end for the first AUG codon. It has been prove n that a specific translational initiating sequence called the Kozak consensus sequen ce is required for efficient translation initiation in higher eukaryotes (62). Prokaryotes and some eukaryotes do not have a Kozak sequence in their genes. To improve the translation efficiency of an expressed wap A gene in mammalian hosts, the Kozak sequence ANNATGG was incorporated into the wap A or agA forward primer in the process of caries DNA vaccine construction. Codon usage Codon usage was another topic of concern in bacterial DNA vaccine development. There is a significant variati on of codon usage bias in all organisms and even between different genes. The differe nce in the codon usage can seriously limit the

PAGE 32

20 gene expression efficiency in a hetero logous system. Codon optimization may be considered in case the expression of the cloned gene is hampered due to the codon bias. In such case, the alteration of rare codons of the foreign gene to make codon usage match the available tRNA pool within the host ce ll may benefit by improving the expression rate of heterologous genes. Commonly used codons for S. mutans serotype c or wap A were determined from the Codon Usage database located at www.k azusa.org.jp/codon/ and analyzed against that of Homo sapiens or Mus musculus using the graphical codon usage analyzer available at www.gcua.de. To lo cate cumulative low codon usage from wap A, each codon position of wap A sequence was analyzed agai nst the codon usage table of Homo sapiens or Mus musculus using the codon usage analyzer. Codons were optimized according to the codon usage tabulated from GenBank. Identification and Characterization of Collagen Binding Properties by the WapA Bacterial strains and growth conditions The S. mutans strain used for cloning and expression was GS-5 (serotype c) (our laboratory stock). S. mutans were grown in brain heart infusion (BHI) (Fisher Chemical Co., Cincinnati, OH) broth at 37 C without agitation, or on BHI agar containing 1.5% agar at 37 C in the presence of 10% CO 2 Specificity and localization of collagen binding domain The nucleotide sequence and the deduced amino acid sequence of wap A indicated that it contained a sequence sp ecific collagen binding domai n. Further analysis on the specificity and localization of the collagen binding domain of th e WapA was performed with different functional domain algorith ms including the NCBI Conserved Domain

PAGE 33

21 Database (CDD) (80) and Protein Families (Pfa m) Applications (7) of these programs. Structure prediction of collage n binding domain in WapA In order to investigate th e biochemical function of th e putative collagen binding domain, secondary structure analysis was carried out with the 3D-PSSM program (31, 56) using the amino acid sequence of the putative collagen binding domain in the WapA. The predicted secondary structure was matched against the 3D-PSSM fold library (http://www.sbg.bio.ic.ac.uk/~3dpssm/), which cont ains solved crystal structures. The protein sequence was also scanned against the SCOP (Structural Classification of Proteins) database, where protein domains ar e classified into four levels: family, superfamily, fold, and class (72). Cloning, expression and purification of recombin ant collagen binding domain (rCBD) of WapA A C-terminal truncated version of wap A ( wap A-G) encoding the AgA was used as a clone for a putative r ecombinant collagen binding domain (rCBD). A 885 bp DNA fragment of wap A lacking the promoter, the si gnal sequence, and the hydrophobic Cterminal region was cloned into the pGEX-6 P-1 glutathione S-transferase (GST) fusion vector and hosted in E. coli BL21 (DE3). rCBD was ove rexpressed by in oculating 500 mL of 2x YTA medium with 5 ml of overnig ht culture. The culture was continuously grown at 37 C until the A 600 reached around 1. IPTG was added to a final concentration of 1 mM to induce the expr ession of the cloned gene. At 6 h post incubation, the cells were ha rvested by centrifugati on at 7,700 x g for 10 min at 4 C, and washed with 250 ml cold PBS containing 1 mM Phenylmethylsulphonylfluoride (PMSF), fo llowed by 1 min sonication on ice and

PAGE 34

22 centrifugation at 12,000 x g for 30 min. Solubilization of the fusion protein was aided by mixing 20% Triton X-100 for 30 min. After centrifugation at 12,000 x g for 10 min at 4 C, the supernatant was incubated on a rocker for 30 min at room temperature with 2 ml of the 50% slurry of Glutathione Sepharose 4B (Pharmacia). The mixture was transferred onto the Se pharose column, and the column was washed with 15 ml of PBS. After the colu mn was washed with 2.5 ml of PreScission cleavage buffer (50 mM Tris-HCl, 150 mM Na Cl, 1 mM EDTA, 1 mM dithiothreitol, pH 7.0), the PreScission Protease mix containing 20 l of PreScission Protease with 230 l of PreScission cleavage buffer was loaded onto the column and incubated on a rocker at 5 C for 4 h to cleave off the GST tag. The unbound rCBD protein was eluted with 800 l of PreScission cleavage buffer. Eluted fractio ns containing rCBD pr otein were analyzed by SDS-PAGE. Biotin Labeling Biotin labeling of the purified rCBD was pe rformed with Sulfo-NHS-LC-Biotin reagents (Pierce, Rockford, IL) as follows. rCBD in an amine-free elution buffer (pH 7.2) was mixed with a 10-fold molar excess of 10 mM sulfo-NHS-biotin reagent solution with the protein, and the mixture was incubated at r oom temperature for 1 h. To remove free biotin, the reaction solution was dialyzed ag ainst 3 changes (4 L each) of PBS (pH 7.3) overnight using dialysis tubi ng with a nominal Molecular Weight Cut Off 's (MWCO) 12,000 14,000. Dot Blot Collagen binding assay To test the ability of WapA to bind to colla gen, a soluble native type I collagen (Sigma, St. Louis, MO) was diluted in PBS to 5 g/ml and was dotted (10 l per dot) onto a piece

PAGE 35

23 of nitrocellulose membrane. The membrane was blocked by incubation with 5% skim milk in PBS to which biotin-labeled rCBD was added, and incubated for 1 h at room temperature. After extensive washes with PBST (PBS with 0.05% Tween 20), the bound protein was detected by alkali ne phosphatase-conjugated stre ptavidin (AP-streptavidin) (Sigma) diluted 1:1,000 which was incubated in PBS for 1 h at room temperature. After a final wash in PBS-T, the membrane was st ained with a chromogenic substrate (25 mg o-dianisidine tetrazotized, 25 mg Naphthyl acid phosphate in sodium borate buffer, pH 9.7 contaiing MgSO 4 -7H 2 O added at 1.2 mg per ml). Bovine Serum Albumin (BSA) on the dot was tested in paralle l as a negative control. Solid Phase Binding Assay To further evaluate the binding abilities of WapA to an immobilized native type I collagen, an ELISA assay was carried out as a function of collagen concentration. Native type I collagen (Sigma, St. Louis, MO) was diluted in PBS at a concentration of 5 g/ml, and coated onto 96 well microtiter plates (Immobilon IV from Dynex, Chantilly, VA) overnight at 4 C. After rinsing of the plat e with PBS-T, the wells were blocked with 200 l of 10% skim milk in PBS containing 0.02% s odium azide, for 1 h at room temperature. 100 l of various dilutions (1 g to 12 g) of biotin-labeled, purified rCBD without a GST tag was added separately to the wells and the plate was incubated at 37 C for 1 h. The wells were washed with PBS-T and incubated with AP-streptavidin diluted 1:20,000 in PBS for 1 h at room temperature. The absorbance at 405 nm of each well was recorded using an ELISA reader against a PBS-coated well used as a blank. Wells coated with BSA served as a control for nonspecific binding. Bindi ng properties were calculated and plotted as a function of the dose of protein rCBD.

PAGE 36

24 Construction of DNA vaccines Cloning of the wapA and agA genes into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO The wap A and agA were obtained by PCR amplification of a previously constructed (145) plasmi d pGEX-6P-GST containing wap A-E and wap A-G gene encoding WapA and AgA, respectively, usi ng the following two sets of primers: wap A: Forward: 5-ACC ATG GAC CAA GTC ACA AAT TAT ACA-3 Reverse: 5-TTA TTA GCA TTA TTA TCA ATG TTA-3 agA: Forward: 5 -ACC ATG GAC CAA GTC ACA AAT TAT ACA-3 Reverse: 5 -TTA GTA GCC TGT TTG ATT GGA-3 The initiation codon ATG was included in each forward primer to ensure expression in eukaryotic cells. The PCR was performed as described below. The Kozak consensus sequence ANNATGG was also inserted into wap A or agA forward primer to increase the expression level of the genes. The plasmid used for cloning was engineered to contain the pUC origin for replication and an ampicillin resistance gene for propagation in the E. coli cells. To obtain the expression of the cloned gene in mammalian cells the plasmid was constructed so that the cloned gene was unde r the control of a st rong viral promoter, while the stability of the mRNA was pr ovided by sequences downstream from the polylinker consisting of a polyadenylation signa l and transcription termination sequences from the bovine growth hormone gene. The PCR products (Fig. 4) were ligated

PAGE 37

25 separately to pcDNA3.1/V5/His-TOPO empl oying the human cytomegalovirus (CMV) immediate-early promot er/enhancer (Fig. 5). The resulting DNA constructs were transferred into E. coli Top 10 cells by the heat shock method as described by the manuf acturer (Invitrogen). The transformed cells were plated on LB agar contai ning ampicillin, and the result ant colonies were cultured and screened by plasmid DNA isolation, followed by digestion with BstXI and analysis by agarose gel electrophoresis. The PCR am plification, using vector sequence as a forward or a reverse primer (specific to the T7 sequence or BGH Reverse primer site, respectively), and the insert sequence (forward or reverse primer listed above), was performed to test the correct orientation of the cloned gene in relation to the vector.

PAGE 38

FIGURE. 4. PCR-generated wapA-E and wapA-G genes. The wapA was amplified by PCR. The location of the terminal amino acid positions and the letter designation of the corresponding constructs are indicated. 26

PAGE 39

FIGURE. 5. Map of pcDNA3.1/V5-His-TOPO with wapA insert. The wapA-E and wapA-G were inserted into this vector at the TA cloning site and transformed into E. coli Top10. PCR PCR was performed for each sample with a 50-l reaction mixture containing 1.5 mM MgCl 2 0.125 mM dNTP mixture, 1 U of Taq DNA polymerase, 50 pmol of each primer, and 100 ng of template DNA. The PCR reaction was carried out in a gene cycler (Bio-Rad, Hercules, CA) programmed for an initial denaturation step of 3 min at 95C and 30 cycles each of 30 s at 95 C, 45 s at 54 C, and 1 min at 72 C, with a final extension of 10 min at 72 C. The PCR products were visualized on 1% low melting 27

PAGE 40

28 point agarose gel containing ethidium bromide. DNA sequencing After construction, the plasmids were s ubjected to sequencing. Plasmids were purified to sequencing grade using the al kaline lysis method described below and sequences were determined by DNA seque nce analysis conducted at the DNA sequencing core facility of the H. Lee Mo ffitt Cancer Center & Research Institute (Tampa, FL). The primer sets for sequencing were T7 forward primer: 5 -TAA TAC GAC TCA CTA TAG GG-3 and BGH Reverse primer: 5 -TAG AAG GCA CAG TCG AGG-3 Optimization of wap A and agA DNA vaccine production and quality control Chloramphenicol Amplification of Plasmid DNA containing agA Observation of overnight cultures of the recombinant E. coli indicated a striking difference in plasmid yield between clones harboring the wap A and agA DNA construct, agA clones being much less productive for plasmid isolation. Clones with the agA plasmid construct had the tendency to ly se, therefore decreasing overall plasmid production. To increase the yield of GST-AgA plasmid, chloramphenicol amplification of E. coli derived plasmids was used. 250 ml culture of LB medium containing 100 g/ml ampicillin was grown and when the culture reached an O.D. of 0.4 at 600 nm, chloramphenicol was added to a final concen tration of 170 mg/L and incubated further for 12 to 16 h at 37 C with vigorous shak ing. Plasmid production from a 250 ml culture without chloramphenicol treatm ent was performed in paralle l with the above condition for comparison.

PAGE 41

29 Purification of DNA vaccine Plasmid DNA was isolated from E. coli TOP-10 containing pcDNAwap A or pcDNAag A by a modified alkaline lysis method using the Qiagen HiSpeed TM Plasmid Maxi Kit (Valencia, CA) and following th e manufacturers instruction. Briefly, transformed E. coli TOP-10 was grown in batches of a 250 mL LB medium containing 100 g/ml ampicillin. Following over night (16 h) incubation at 37 o C, cells were collected by centrif ugation at 6,000 x g for 15 min at 4 o C. The cells were resuspended with the resuspension buffer containing 50 mM Tris Cl (pH 8.0), 10 mM EDTA, and 100 ug/ml RNase A and were followed by lysis wi th the cell lysis buffer containing of 200 mM NaOH and 1% SDS (w/v) for 5 min at room temperature. After neutralization using the neutralization buffer (3.0 M potassium acetate, pH 5.5), the lysate was filtered and washed w ith wash buffer containing 1.0 M NaCl, 50 mM MOPS, 15% isopropanol (v/v). Plasmid DNA fr om the filtered lysate was then purified using a pre-equilibrat ed HiSpeed Tip and eluted in the elution buffer containing 1.0 M NaCl, 50 mM MOPS, 15% isopr opanol (v/v). Plasmid DNA was concentrated and desalted by isopropanol precipita tion and eluted in TE buffer. Purity and concentration of DNA was determined by optical density ( OD) reading in UV spect rophotometer at 260 and 280 nm. DNA measured larger than 1.7 in the ratio of OD260/OD280 was used in this study. 1 OD is equal to 50 g/mL of DNA. Plasmid DNA preparation for immunization study Plasmid in TE solution was then concentr ated by precipitation with 0.7 volume of isopropanol in the presence of 1:10 volume of 3 M Na Acetate (pH 3.0). The DNA was collected by centrifugation at 17,210 g in SS-34 rotor for 10 min at 4 C, washed with

PAGE 42

30 70% ethanol, and centrifuged again for 10 min. The pellet was dried and resuspended in sterile PBS to reach a concentrati on of 2 mg/ml. DNA purity was assessed spectrophotometrically and the ratio of OD 260nm /OD 280nm was calculated. DNA preparation with a minimum absorbance ratio of 1.7 was used in the present study. For quality control, DNA vaccine constructs were confirmed by BstXI digestions and agarose gel electrophoresis, and by DNA sequence an alysis conducted at the DNA sequencing Core Facility of the H. Lee Moffitt Cancer Center & Research Institute (Tampa, FL). Expression of S. mutans Wall-associated Protein A Gene in Chinese Hamster Ovary Cells Cell culture Chinese hamster ovary (CHO) cells were obtained from M. Kimble (Department of Biology, University of South Florida, Tampa, FL). The CHO cells were cultured in DMEM supplemented with 10% FBS, 200 mM L-glutamine, 100 mM sodium pyruvate, and antibiotics/antimycotic (penicillin 0.5 m g/ml, streptomycin 1 m g/ml, and 0.25 m g of amphotericin B/ml of 0.85% sali ne) at 37C in 5% CO2. The E. coli Top 10 cells were cultured in Luria-Bertani (LB) broth or on an LB plate containing 1.5% agar. Ampicillin was added at 10 g/ml for the culture of recombinant E. coli Plasmids A gene encoding WapA or AgA was isol ated from the plasmid pGEX-6P-GST containing wap A-E or wap A-G, respectively, and cloned in to the mammalian expression vector pcDNA3.1/V5/His-TOPO as described pr eviously. For isolation and purification of plasmid DNA, Qiagen HiSpeed TM Plasmid Maxi Kit (Valencia, CA) was used.

PAGE 43

31 Propagation and isolation of Plasmid DNA vector pcDNA3.1/V5-His TOPO Propagation of the vector pcDNA3.1/ V5-His-TOPO was carried out by transformation of E. coli TOP10 using the heat shock method. When the 50 l frozen competent cells were just beginning to thaw, 100 ng plasmid DNA was added and incubated on ice for 30 min. The cells were heatshock treated by placing them in a 37 C water bath for 1 min and then returned to ice. After 2 to 3 min on ice, 650 l LB medium was added and the cells were incubated at 37 C for 1 h in a shaker at 15 rpm. Then, 25 to 100 l of the suspension were aliquoted into the middle of an LB agar plate containing 100 g/ml ampicillin and evenly spread over the plate using a spreader. The plates were incubated at 37 C overnight. The insert ed plasmid DNA vector was isolated by a modified alkaline lysis me thod as described above. Transfection of CHO cells Transient transfection was performed usi ng the cationic lipid pfx-8 according to the manufacturer (Invitrogen). Briefly, CHO cel ls were seeded in a 12-well microtiter plate at a density of 5 X 10 4 /well and incubated overnight to approximately 50% confluency. The cells were washed by aspi ration with sterile PBS, and a transfection solution (1 g of DNA mixed with lipid solution at a 1:6 ratio [v:v]) was added (1.0 ml per well). After 4 h of in cubation, the transfec tion solution was aspirated and replaced with an equal volume of complete medium, and the incubation was continued for another 24 h. On the following day, the cells were de tached by scraping, and the cell suspension was collected. Adsorption of antiserum To avoid nonspecific binding of the antis erum to CHO cells, the antiserum was

PAGE 44

32 incubated for 1 h at room temperature and then overnight at 4C with a piece of nitrocellulose filter on which CHO cells were immobilized, and the free surface was blocked with 10% skim milk in PBS. The nonbinding fraction was tested by a dot immunobinding assay. Dot immunobinding assay To investigate the expression of wap A and agA in transfected CHO cells, a sonic extract (prepared as described below) of each sample was dotted (10 l per dot) onto a piece of nitrocellulose membrane, which was next blocked by incubation with 10% heatinactivated horse serum in PBS. The filter wa s incubated for 1 h with the adsorbed rabbit antiS. mutans cell wall (1:200 dilution in PBS), fo llowed by extensive washing in PBS containing Tween 20 added at 0.05% (PBS-T) and a 1-h incubation with a horseradish peroxidase-conjugated goat anti-rabb it immunoglobulin diluted 1:1000 in PBS. Following an extensive wash in PBS-T, the peroxidase activity was identified using a chemiluminescent substrate (ECL for HRP from Pharmacia). A piece of X-ray film (Kodak) was next exposed to the filter fo r 1 min and developed in a Kodak M35A XOMAT processor. Western immunoblot analysis of transfected CHO cells Expression of WapA and AgA in transf ected CHO cells was investigated by Western blot analysis as fo llows. A sonic extract of the transfected CHO cells was prepared using two pulses of 30 sec each in a Vibra Cell TM (Sonics & Materials, Inc., Danbury, CT) set at 50 Hz. As controls, untra nsfected CHO cells and cells treated with the lipid alone were similarly processed. The sonic extract was incubated with the cracking buffer (0.019 M Tris, 0.5% SDS, 0.35 M 2-mercaptoethanol, 7.5% glycerol,

PAGE 45

33 0.05% bromophenol blue) for 3 min in a boi ling water bath. The particulate was sedimented by a 15-sec centrifugation at 6000 rp m, and the supernatant liquid from each sample was separated by elec trophoresis in a 10% SDS-polyacr ylamide gel. The protein bands were electrophoretically transferred to a piece of nitrocellulose membrane, which was then blocked by incubation with 10% horse serum in PBS for 1 h at room temperature. The membrane was processe d for immunochemical staining as described above for dot immunobinding assay. Immunochemical staining of transfected CHO cells A 100l sample of each cell suspension was tran sferred to a microscope slide, let dry, and fixed with ice-cold acetone. The s lide was next blocked with 10% nonfat dry milk for 1 h at room temperature with gentle rocking. The cells were incubated at room temperature for 1 h with a rabbit antiS. mutans cell wall diluted 1:200 in PBS. The slide was next incubated with PBS containing 10 mM EDTA to inactivat e endogenous alkaline phosphatase, as described by Dao (21), gently washed three times with PBS-T, then immediately incubated for 1 h with an alka line phosphate-conjugated goat anti-rabbit immunoglobulin diluted 1:30,000 in PBS. Afte r incubation, the slide was washed three times with PBS-T and stained with a Fast Red RC solution prepared as described by Sigma. After color development, the slide wa s rinsed three times with deionized water, observed on the light microscope, and photogr aphed using an Olympus digital camera Model 3030Z (Olympus America Inc, Melville, NY). Differential immunogenicity of a DNA vaccine containing the S. mutans wallassociated protein A gene versus that co ntaining a truncated derivative antigen A lacking in the hydrophobic carboxyterminal terminal region

PAGE 46

34 Animals Six-to-eight-week-old female Balb/c mice were purchased from the National Cancer Institute (Frederick, MD), and maintained in the controll ed animal facilities of the University of South Florida Medical School. All protocols using mice were approved by the Institutional Animal Care and Use Committ ee at the University of South Florida. The University program and facilities for an imal care and use are fully accredited by the Association for Assessment a nd Accreditation of Laboratory Animal Care International (AAALAC). Bacterial strains and cell line E. coli TOP10 cell (Invitrogen, Carlsba d, CA) clones harboring pcDNAwap A or pcDNAag A were prepared in a previous study as described above. The recombinant E. coli strain BL21 (DE3) transformed with the expression plasmid pG EX 6.1 Glutathione S-Transferase (GST), containing wap A or agA gene and expressing WapA or AgA as a GST fusion protein, were prepared previously and used in the present study as a source of recombinant antigens. HeLa cells were obtai ned from American Type Culture Collection (ATCC) (Manassas, VA) for use in in vitro transfection experiments. DNA Vaccine The eukaryotic expression vect or pcDNA3.1/V5-His-TOPO (Invitrogen, Carlsbad, CA) containing the full length wap A gene (previously wap A-E) or truncated agA gene (previously wap A-G), encoding WapA and AgA, respectively, were cloned into the E.coli TOP 10 in a previous study and are re ferred to in the present report as pcDNAwap A and pcDNAagA vaccine, respectively.

PAGE 47

35 Transfection of pcDNA-wapA in HeLa cells To determine the optimal transfection c onditions, HeLa cells were transfected with pcDNA3.1/V5-His-TOPO containing the -galactosidase gene (pcDNAgal ) mixed with the cationic lipid DMRIE-C at va rious ratios. Briefly, HeLa cell cultures were seeded with 5 x 10 4 cells in a 24-well microtiter plat e and grown overnight at 37 C in a CO 2 incubator until approximately 80% confluence. The cells were washed in a serum-free medium and incubated with a transfection solution consisting of 2 g of pcDNAgal mixed with 2-24 g of DMRIE-C in a serum-free medium. After 4 h of incubation, a growth medium containing 20% fetal bovine serum (FBS) was added, and the incubation was continued for another 24 h. On the following day, the cells were solubilized with M-PER Mamma lian Protein Extraction Reagent (Pierce, Rockford, IL), and centrifuged, and the cell suspension was collected for -galactosidase assay. 50 l of cell lysate was added into the 96-well plate, mixed with 50 l of 2X Assay Buffer (Promega, Madison, WI) that contained the substrate ONPG (O-nitrophenyl-Dgalactopyranoside). -galactosidase activ ity was measured at 420 nm with a spectrophotometer.. Immunization of mice by the in tranasal inhalation technique To investigate the diffusion of 100 l of vaccine solution when administered by the intra-nasal drop technique, 100l of st erile PBS containing 1/10 volume India ink were delivered slowly as droplets at the opening of the nostrils of the non-anaesthetized mouse held tightly by hand. Hand pressure wa s applied to the lower mandible of the mouse in order to reduce swallowing of the in stilled material during administration. This procedure was performed on four mice, which were then sacrificed immediately and 30

PAGE 48

36 min later. The mice tissues including nasal and oral cavities, l ung tissue, esophagus, and trachea were inspected for any trace of the Indi a ink as an indicator of vaccine diffusion. Immunization of mice Female BALB/c mice were distributed into five groups of three each and were immunized intra-nasally with one of the following: 50 g pcDNAwap A (Group 1) or pcDNAag A (Group 2) combined with 150 g of the cationic liposome carrier DMRIE-C (1:3, w/w). The negative control mice were not immunized (Group 3) or administered with empty plasmid vector mixed with DMRIEC at the same ratio (Group 4), or with PBS mixed with DMRIE-C (Group 5). Two dos es were administered at three-week intervals. Collection of saliva and blood samples Saliva and blood samples were collecte d prior to immunization, and 3 and 6 weeks after boost immunization. Briefly, sali va samples were collected after intraperitoneal injection of 100 l of 1 mg/ml pilocarpine (Sigma, St. Louis, MO) in PBS to stimulate saliva secretion. Saliva was immediately centrifuged at 735 g for 30 min. The supernatant was collected, the protease inhibitor Phenylmet hyl sulfonyl fluoride (PMSF, 100 mM) was added at 1% (v/v), and the samp le was stored at C until use. Blood was collected from the tail vein, allowed to cl ot at room temperatur e for 1 h and stored 30 min at 4 C. Serum was then separated fr om the clot by centrifugation at 3,210 g for 30 min and stored at C. Saliva samples from the mice in each group were pooled for analysis. Serum samples were co llected and tested individually. Dot immunobinding assay To investigate the presence of specific Ig A in the saliva of the immunized mice, a

PAGE 49

37 piece of 96 well-embossed nitrocellulose membrane was dotted with 10 l per dot of 5 g/ml of purified GST-AgA fusion protein and allowed to dry at room temperature. After 10 min of incubation in the cold, the filter was bl ocked by incubation with PBS containing 2% Tween 20, at room temperature for 1 h. Next, small NTC pieces containing antigen dots were cut out and inc ubated individually overnight at 4 C with the diluted (1:2) saliva samples to be tested. The pieces of NTC were washed six times with in PBS-T, and then incubated for 1 h with a HRP-conjugated goat anti-mouse IgA diluted to 1:10,000. After a final wash in PB S-T, the membrane was incubated with a HRP chemiluminescent substrate (obtained from Amersham Pharmacia Biotech, Piscataway, NJ) for 1 min and exposed to an X-ray film (Kodak) for development. Enzyme linked immunosorbent assay (ELISA) Saliva and serum samples were assayed for anti-WapA salivary sIgA and serum IgG using enzyme-linked immunosorbent assay (ELISA). The purified GST-AgA fusion protein was used as the coating antigen ( 146). Immunolon IV 96-we ll microtiter plates (Dynex, Chantilly, VA) were coated overnight at 4 C with 100 l per well of 5 g/ml solution of antigen in coating buffer (50 mM carbonate/bicarbonate buffer, pH 9.6). The wells were blocked with 200 l of 10% skim milk in PBS for 1 h and washed four times with PBS containing 0.05% Tween 20 (PBS-T). Saliva was diluted 1:2 and serum at 1:16 in PBS, each sample was added in serial 2fold dilution to the wells, and the plate was incubated at 4 C overnight. After three washes with PBS-T, 100 l of horseradish peroxidase (HRP)-conjugated goat anti-mouse IgA diluted to 1:1,000 in PBS-T was used. The plates were incubated for 1 h at room temperature. Following extensive washes in PBS-T, 100 l of QuantaBlue Fluorogenic pe roxidase substrate (Pierce, Rockford, IL)

PAGE 50

38 was added to each well and incubated for 30 mi nutes at room temperature. Peroxidase activity was detected on the fluorometer by r eading the excitation a nd emission at 325 nm and 420 nm, respectively. The end point t iters antigen-specific IgG and IgA were determined in triplicate and e xpressed as the reciprocal of the highest dilution giving an OD corresponding to 3 X the standard devi ation above the mean of the background control sample. Assay of antibodies to recombinant AgA Pooled saliva from each group of mice was extensively absorbed with E. coli BL 21 homogenate immobilized on nitrocellulose in order to remove unwanted antibodies. The E. coli recombinant clone expressing AgA and the negative control E. coli transformed with the vector pGEX-6P-1 alone were sonicated and centrifuged at 12,000 x g for 30 min. The soluble fraction wa s loaded in triplicate lanes (2 g/line) and separated by SDS-PAGE followed by electro-transfer of the protein bands onto a piece of nitrocellulose. The protein bands were in cubated with purified anti-WapA or AgA antibodies and subsequent steps were as described previously for the dot immunobinding assay. Assay of antibodies to S. mutans WapA Cultures of S. mutans were grown in BHI supplemen ted with 2% sucrose for 16 h at 37 C. Cultures were sonicated and an e qual volume of sonic extract was loaded in 4 sets of duplicate lanes (2 g/lane). SDS-PAGE separated protein bands were transferred to 0.2 m nitrocellulose membrane at 100V for 1 h. Differential immunoreactivity of anti-WapA or AgA antibodies to WapA wa s tested by incubating the membranes with each antiserum and following steps for the We stern blot analysis as described above.

PAGE 51

39 In vitro Adherence inhibition assay The influence of salivary IgA on the sucrose-dependent adherence of S. mutans GS-5 was assayed in vitro and quantified as described by Olson et al (94) with some modifications. At 6 weeks post-booster i mmunization, saliva samples collected from immunized or control mice, and the antigen -specific sIgA level was measured using ELISA. Saliva samples with equivalent levels of specific sIgA were sterilized by mixing with 1/10 volume of chloroform and the a queous layer, separated by centrifugation for 2 min at 16,000 g, was diluted to 1:2 in PBS. 200 l of saliva diluted in PBS was added into 24 well cell culture plates containing 200 l of BHI medium prepared at two times the standard concentration and supplemented with 2% filter-sterili zed (Millipore Corp.; 0.45 m pore size) sucrose. A saturated overnight culture of S. mutans was diluted to 1:100 in BHI medium and 10 l of the diluted suspension was added in to each well. Binding assay was carried out by incubation of the plate at 37 C for 20 h. Saliva samples from pre-immunized or non-immunized mice were used as controls, a nd assayed as described above for the test samples. After incubation, non-adherent S. mutans were removed by aspiration of the medium, and the wells were washed three times with 0.5 ml of 0.9% saline. The washes were pooled. For quantitative analysis, the bacteria were detached from the wells by washing four times with 0.5 ml volumes of 0.5 N NaOH, and the washes were pooled. S. mutans were collected from the washes by centri fugation at 6,000 g for 1 min, the supernatant was discarded, and the cell pellet was resuspended with 400 l of 0.5 N sodium hydroxide. The optical density (OD) of the suspensions was measured at a wavelength of

PAGE 52

40 540 nm and the mean adherence level was de termined and expressed as percent OD of the total cells (non-adherent cells in the cu lture medium plus adhe rent cells detached from the well by NaOH). Dextran binding Assay Dextran-binding properties were investigated for GS T-WapA or GST-AgA fusion proteins using a Biotin-conjugated de xtran (Sigma, St. Louis, MO) by dot immunobinding assay as follows. GST-WapA and GST-AgA fusion proteins were obtained from the corresponding recombinant E. coli BL 21 after induc tion with IPTG and the recombinant proteins purified by chromatopgraphy on a glutathione-conjugated Sepharose column following the manufacturer protocol (Amersham, Piscataway, NJ) Next, 10 l of 5 g/ml of the purified protein was dotted onto a piece of 96 wellembossed nitrocellulose membrane and pr ocessed as described above for the dot immunobinding assay. The membrane was incubated with biotin-conjugated dextran for 1 h at room temperature, and the dextran-bi nding protein was iden tified by incubation with AP-Streptavidin solution at room temperature for one hour, followed by in situ staining of AP activity (21). Statistical analysis Data for serum or saliva antibody titers were logarithmically transformed and statistical differences were determined by us ing the nonparametric MannWhitney U-test. Data obtained from the adherence inhibiti on assay were also analyzed with the nonparametric MannWhitney U-test for the difference in the median values among the groups.

PAGE 53

41 Efficacy of DNA versus Protein Vaccine: Relative induction of mucosal IgA response to S. mutans Wall Associated Protein A Experimental animals Balb/c female mice, 6-8 weeks old, were purchased from Charles River Laboratories (Wilmington, MA) and were maintain ed in the animal facilities of the USF medical school. Cell lines HeLa cells were purchased from ATCC (Manassas, VA) and maintained in Dulbecco-modified Eagle medium supplemented with 10% fetal calf serum at 37 C in 5% CO2. Bacterial strains, plasmids, and media The three clones needed for this study we re obtained previously and included the following: Clone 1 consisted of recombinant E. coli TOP10 clone containing the wap A gene cloned into the mammalian expressi on vector pcDNA3.1/V5/His-TOPO. The clones were used to propag ate the plasmid containing wap A-pDNA. The DNA plasmid, namely pcDNAwap A which encodes the S. mutans WapA, was described previously. Clones 2 and 3 consisted of recombinant E. coli BL21 containing the wap A gene or agA gene cloned into the prokaryot ic high expression fusion vect or pGEX 6-1 GST. These clones, designated BL21-WapA and BL21AgA, expressed the WapA and AgA, respectively, as a fusion protein with GS T. The WapA or AgA expression plasmid, designated GST-WapA or A gA, respectively, was also described previously. Cloning of murine IL-5 cytokine gene into the mammalian expression vector To investigate the effect of IL-5 on salivary IgA production in the immunized

PAGE 54

42 mice, recombinant E. coli HB101 containing IL-5 cDNA clone d into vector pBR322 was obtained from ATCC. PCR am plification was performed using primers for IL-5, which was designed based on the IL-5 DNA sequen ce found in Genebank (Accession No. NM_010558). The primers used were as follows: Forward, 5 -ACC ATG AGA AGG ATG CTT CTG CAC-3 and Reverse, 5 -TCA GCC TTC CAT TGC CCA-3 The resulting fragment of 402 bp was cloned downstream of the CMV promoter into pcDNA3.1 vector. PCR and cl oning protocols used were described previously. Cloning of the cholera toxin B-subunit ( ctb ) gene into the mammalian expression vector The ctb plasmid construct was prepared by cl oning a ctb gene into the mammalian expression vector pcDNA3.1/V5/His-TOPO accord ing to the protocol above. Genomic DNA of Vibrio cholera was obtai ned from ATCC. Since the ctb gene sequence was known (GenBank accession no. D30053), the genomic DNA obtained was used as a template for the amplication of the CTB gene by PCR using specific primers. The primers used were; Forward, 5 ACC ATG ACA CCT CAA AAT ATT ACT G AT T -3 and Reverse, 5 -TTA ATT TGC CAT ACT AAT TGC GG -3 Cloning of the ctb gene into a pGEX expression vector The ctb gene was cloned into prokaryotic high expression pGEX-6P-1 glutathione S-transferase (GST) fusion v ector using the manufacturer protocol (Pharmacia). PCR primers derived from the ctb gene sequence in GenBank (accession no. D30053) was used to amplify the ctb gene without signa l peptide and was subcloned into the TA cloning vector pCR2.1-TOPO (Fig. 6) The ctb gene digested with EcoRI was ligated in frame with GST-tag into the pGEX GST fusion vector (Fig. 7). The E. coli BL21 competent cells were transformed with the lig ation mixtures, the tr ansformant containing

PAGE 55

pGEX-ctb was grown at 37 C, and expression was induced with 1mM IPTG as described previously. After induction, cells were lysed by sonication and were purified by the Glutathione Sepharose 4B protocol. The purity and identity of the protein was confirmed by 10% SDS-PAGE followed by Western blot analysis. FIG. 6. Map of pCR2.1-TOPO plasmid vector. ctb gene was cloned into pCR2.1-TOPO. 43

PAGE 56

FIG. 7. Map of prokaryotic expression vector pGEX-6p-1. The pCR2.1-TOPO clone containing ctb gene was excised and subsequently cloned via the EcoR1 restriction enzyme site into pGEX-6p-1 plasmid from which proteins can be expressed as fusion proteins with glutathione S-transferase (GST). DNA sequencing After construction, the plasmids were sequenced to confirm the orientation and sequence. Plasmids were purified to sequencing grade using the alkaline lysis method described below and Sequences were determined by DNA sequence analysis conducted at the DNA sequencing core facility of the H. Lee Moffitt Cancer Center & Research Institute (Tampa, FL). The primer sets for sequencing were T7 forward primer: 5-TAA TAC GAC TCA CTA TAG GG-3 and BGH Reverse primer: 5-TAG AAG GCA CAG TCG AGG-3. 44

PAGE 57

45 Expression and Purification of WapA and AgA from E. coli recombinant clones To obtain enough proteins for the immuni zation study and for the preparation of rabbit antibodies, isolation of these proteins was scaled up. Both WapA and AgA were obtained from the corresponding recombinant E. coli BL21 (DE3) clones. The clones expressing GST-WapA and GST-AgA were cult ured at 37 C in an incubator shaker overnight in batches of 500 ml 2x YTA medium containing 100 g/ml ampicillin. The following day, the overnight culture was d iluted 1:100 into fresh pre-warmed 2x YTA medium, and incubation was continued at 37 C until the A 600 reached about 1. Induction of protein expression and prep aration of the protein lysate was followed in the same manner as described above. The protein lysate was incubated on a ro cker for 30 min at room temperature, after 0.5 ml of glutathione-linked Sepharose 4B (Pharmacia) in a 50% slurry was added. The mixture was transferred onto a chromat ographic column, and washed by adding 50 ml of PBS/1 mM PMSF. The fusion protein was eluted by 10 mM reduced glutatione in five aliquots of 300 l each. Cleavage of GST tag was carried out by incubation with PreScission protease as descri bed previously. The quantity of the AgA was determined by OD reading at 280 nm. 1 OD 280 equals 0.5 mg/ml, the formula based on the extinction coefficient of free GST. The purity and so lubility of the AgA was analyzed by SDSPAGE. The amount of recombinant proteins w ithout GST tags was determined by the bincinchonic acid method using reagents and protocols obtained from Sigma. Briefly, 0.1 ml of the sample was mixed with 2 ml of protein determination reagent (1 part Copper sulfate pentahydrate 4% solution adde d to 50 parts of Bicinchonic acid solution).

PAGE 58

46 The mixture was mixed by vortex followed by incubation at 37 C for 30 min. After cooling of the tube to room temperature, th e absorbance was recorded at 562 nm, and the concentration of protein determined from a st andard curve established with solutions of bovine serum albumin (20, 40, 60, 80, 100 g/ml) assayed in parallel. Measurement of GST Activity by CDNB Assay Rapid enzymatic detection assay usi ng the GST substrate 1-chloro-2,4dinitrobenzene (CDNB) was used to optimize c onditions for expression or to quantify the level of expression of GST fusion protein. High affinity between the GST and 1-chloro2,4-dinitrobenzene (CDNB) resulte d in a CDNB-glutathione w ith a strong absorbance at 340 nm. When a sample containing a GST fusion protein was incubated in a CDNB assay solution containing CDNB and glutathion e, the relative or ab solute amount of GST fusion protein in the sample could be calcu lated by comparing a standard curve of A 340 /min versus fusion protein amount. Briefl y, the total volume of 1000 l CDNB assay solution (100 mM CDNB, 100 mM reduced glut atione, 10X reaction buffer and distilled waterl) was mixed and transferred into two UV-transparent cuvettes with 500 ml volume each. The soluble (post-sonicate) fraction of the fusion protein or the GST-WapA purified soluble protein was added into the sa mple cuvette to be a ssayed. To the other cuvette (blank cuvette), a volum e of 1X reaction buffer in an amount equal to the sample was added. Measurements were conducted at 340 nm in a UV spectrophotomer at oneminute intervals for 5 minutes. Blanking th e spectrophotometer with the blank cuvette was done before each reading of the sample cuvette. Recorded absorbance readings were used to calculate A 340 /min/ml values which could be us ed as a relative comparison of

PAGE 59

47 GST fusion protein content between samples. Production of protein vaccines and DNA va ccines against S. mutans WapA and AgA The plasmid DNA containing wap A or agA gene and the corresponding recombinant WapA and AgA were isolated and an average yield was calculated as a function of culture volume for comparison. Plasmid DNA containing wap A or agA was prepared from E. coli TOP-10 by a modified alkaline lysis method using a Qiagen HiSpeed TM Plasmid Maxi Kit (Valencia, CA), as described previously. The goal was to optimize the isolation of these antigens as r ecombinant proteins or as genes separately inserted into a eukaryotic expression plas mid vector, and to compare the yield between the two target antigens. The purified reco mbinant protein and DNA vaccines were used in the immunization study. Immunogenicity of the fusion proteins Considering that fusion proteins can e licit a strong and specific antibody response to the target antigens, it is hypothesized that the presence of GST did not interfere with the immunogenicity of the target protein. Indeed, the antigenici ty of WapA-GST and AgA-GST was demonstrated by immunodot anal ysis using a rabbit antibody to the wild type WapA and AgA. Considering the advantage of skipping the cleavage of GST from the fusion proteins in term of time and m oney, this step was omitted from our production of protein vaccines. Preparation of rabbit pol yclonal antibody against WapA Rabbit polyclonal antibody against WapA wa s prepared for the identification and immunochemical analysis of WapA and Ag A in the present study. Briefly, six 4 kg female albino rabbits from the New Zeala nd strains were immunized intramuscularly

PAGE 60

48 with 100 l of 1mg/ml of WapA mixed with Tite rMax Gold (Sigma) adjuvant Freund complete adjuvant (v:v). Booster injections were administered with WapA or AgA mixed with the TiterMax Gold adjuvant (v:v) at threeweek intervals. Bloo d was collected before immunization and one week af ter each booster injection. The serum was separated by centrifugation and decomplemented by heating at 55 o C in a water bath for 30 min. The serum was sterilized by ad ding 1/10 vol of chloroform, mixing, and centrifugation to obt ain the aqueous upper layer co ntaining the antibody. Dot immunobinding assay and ELISA were performed to test the serum for the presence of a specific IgG antibody, as described previously. Larger volumes of blood were obtained when a dilution of the antibody at 1:500 in PBS gave a po sitive reaction in immunodot analysis. Absorption of anti-E. coli and antiGST antibody from rabbit serum Nonspecific binding of the antiserum to WapA was removed by extensive absorption of serum against E. coli and GST. Anti-E. coli absorption was completed as described previously. For the absorption of anti-GST antibodies, Glutathione Sepharose 4B attached with GST was packed onto a gr avity-flow column. Serum was loaded on a column and incubated for 1 h at room temperat ure. Incubation was continued for 1 h at 4 C, and the absorbed serum flow-through was collected. Fractions were tested for antibody activity using dot im munobinding assay (Fig. 8).

PAGE 61

FIG. 8. Absorption of immune serum. To remove non-specific binding of antiserum to WapA, anti-E. coli and GST activity was absorbed from serum against sonicated E. coli fraction and purified GST dotted on a nitrocellular membrane. A1 (anti-WapA), A2 (anti-GST) or A3 (anti-E. coli) shows its antibody activity reacting on purified GST-WapA, GST, or E. coli fraction, respectively, before absorption. B1, B2, and B3 are corresponding antibody activity after absorption. Purification of IgG antibody against WapA WapA or AgA specific antibodies from post-immune rabbit serum were purified using the Melon Gel IgG Purification Kit, by the procedure specified by the manufacturer. Serum was diluted by 1:10 with melon gel purification buffer and loaded on a gravity-flow column. The specific antibodies were eluted with Melon Gel Purification Buffer, and the absorbance of the antibody fractions were measured at 280 nm. Induction of WapA in presence of sucrose Cultures of S. mutans were grown in BHI or BHI supplemented with 2% sucrose for 16 h at 37 C. Cultures were sonicated and an equal volume of sonic extract was loaded in 4 sets of duplicate lanes (2 g/lane). SDS-PAGE separated protein bands were 49

PAGE 62

50 transferred to 0.2 m nitrocellulose membrane at 100V for 1 h. Expression of WapA in the presence of sucrose was evaluated by pr obing membranes with anti-WapA antibodies. Immunization protocols The mice were divided into 3 groups as follows: Group 1 mice were intra-nasally immunized with pcDNAwap A alone, or with pcDNAil-5 encoding IL-5 or with pcDNActb encoding the cholera toxin B subunit (CTB). Group 2 mice were immunized with WapA and CTB. Group 3 mice were primed with pcDNAwap A and boosted with WapA. Collection of saliva Mice were injected by i.p. 100 l pilocarpin (1 mg/ml) to induce salivary flow. Saliva was collected by aspiration from th e cheek pouch. Phenyl methyl sulfonyl fluoride (PMSF) was added at 1mM as a protease inhibitor and the saliva was stored at 70 C until use, at which time the sample was centrifuged and the supernatant used in immunochemical assays. Immunodot analysis The presence of specific sIgA expressed in the saliva of immunized animals was detected by immunodot analysis of the in situ staining for alkaline phosphatase. A purple coloration was indicative of the presence of salivary sIgA against WapA. Saliva from unimmunized mice served as negative controls. Enzyme-linked immunosorbent assay To follow the production of specific saliv ary IgA over time, ELISA was used to determine the salivary IgA titre. Production of salivary IgA (mean titer from 6 animals and standard deviation) was calculated and plotted as a f unction of time post-imunization.

PAGE 63

51 RESULTS B cell epitope prediction of the WapA protein Identification of B cell epitopes on th e WapA was made using different parameters for prediction of antigen ic determinants, including hydrophilicity, accessibility and flexibility, experimental antigenic determinant data, and physicochemical properties of amino acids (Fig 9). Consensus epitopes were identified based on predicted epitopes and their frequenc y within different algorithms. Table 1 shows the consensus antigenic determinan ts in the WapA sequence, indicating 11 strongly antigenic sites within AgA and 4 sites around the membrane-spanning domain.

PAGE 64

FIG. 9. B cell epitope prediction by four algorithms; Hopp and Woods (A), Parker (B), Welling (C), and Kolaskar and Tongaonkar algorithm (D). Values greater than 0 are predicted antigenic sites and are likely to be exposed on the surface of a folded protein (A, B, and C). Kolaskar and Tongaonkar algorithm (D) gives sites that ares potentially antigenic a value above 1.0. 52

PAGE 65

53 TABLE 1. Consensus antigenic determin ants within the WapA sequence. n Start Position Sequence End Position 1 5 RKLLSLVSVLTILLGAFWVTKIVKA 29 2 53 PSKAVNYWEPLSF 65 3 71 FPDEVSI 77 4 83 LTIKLPEQLQFTT 95 5 119 GEVTVTF 125 6 152 SIPGVVN 158 7 161 YNNVAYSSYVKD 172 8 175 ITPISPDVNKVGY 187 9 192 NPGLIHWKVLI 202 10 213 TLTDVVG 219 11 222 QEIVKDSLVAARLQY 236 12 284 NAIFISYTT 292 13 401 TSKQVTK 407 14 409 KAKFVLP 415 15 420 QAGLLLTTVGLVIVAVAGVYF 440 Detection of MHC class II binding regions The amino acid sequences of AgA and its larger precursor WapA were analyzed using virtual matrices algorithms by which bi nding values were compared with 51 sets of known MHC class II alleles. MHC Class II binding specificity was shown as the

PAGE 66

54 percentage of motif matches within the sets of 51 DRB alleles that cover more than 90% of MHC Class II molecules expressed on antig en presenting cells. Analysis at a 3% threshold identified 6 more promiscuous bindi ng regions in WapA, but not in AgA (Fig. 10). One of these regions, beginning at residue 400 (Fig.10), showed the highest promiscuous binding regions with over 90% promiscuousness for the predicted region of peptide against 51 know n MHC II alleles.

PAGE 67

FIG. 10. Detection of MHC-II promiscuous binding motifs in WapA. Motifs associated with 51 MHC class II alleles (listed under the graph) were identified in the sequence of WapA using a MHC class II binding motif-matching algorithm. Each peak represents percent of promiscuousness for the predicted region of peptide against 51 known MHC II alleles that cover more than 90% of MHC Class II molecules expressed on antigen presenting cells. Six distinct regions beginning at residue 294, 300, 382, 388, 394, and 400 were identified which were within the WapA and not AgA. 55

PAGE 68

Identification of Nor O-glycosylation sites in WapA sequence Asn-Xaa-Ser/Thr sequences were identified on WapA, and asparagines residues predicted to be N-glycosylated were determined based on the potential value calculated using the NetNGlyc server. Six sites were predicted to be N-glycosylated with high specificity across the WapA sequence (Fig. 11). The O-glycosylated sites were predominantly predicted to be in coil regions (Fig. 12). FIG. 11. Prediction of N-glycosylation sites in WapA sequence. The X-axis represents protein length from Nto C-terminal and the Y-axis the predicted N-glycosylation potential at that position. Values above the threshold (horizontal line at 0.5) are predicted to be N-glycosylated. 56

PAGE 69

FIG. 12. Predicted O-glycosylation sites in WapA sequence. The X-axis represents the WapA sequence position in the multiple alignments and the Y-axis the predicted O-glycosylation potential at that position. A position with a potential (vertical lines) crossing the threshold (dotted line) is regarded as O-glycosylated. Glycosylation of the anti-WapA DNA vaccine candidates The possibility of WapA or AgA glycosylation was considered in the process of selecting the anti-S. mutans DNA vaccine candidates. Cloning of a series of truncations of the wapA gene at the N-terminal and C-terminal ends into the expression vector pGEX-6P-1 glutathione S-transferase (GST) fusion vector demonstrated that only constructs GST-WapA-D, -E, -F, and G, showed a strong cross-reaction with the polyclonal WapA antibody raised in rabbit (146). Detailed descriptions of those inserts are as follows: wapA-D: 1335 b.p. fragment of wapA missing the promoter 57

PAGE 70

58 wap A-E: 1251 b.p. fragment of wap A missing the promoter and signal peptide wap A-F: 968 b.p. fragment of wap A missing the promoter and wall spanning region. wap A-G: 885 b.p. fragment of wap A missing promoter, signa l peptide, and wallspanning region The truncated wap A-E and wap A-G were selected to prevent target proteins from being glycosylated in mammalian host cells for the source of DNA vaccine construction. The wap A-E and wap A-G were truncated versions of wap A, both lacking in signal peptide sequence, therefore preventing target proteins from bei ng glycosylated in mammalian host cells. In eukaryotic cells, protei ns are synthesized in the cytoplasm or in the endoplasmic reticulum. Protein glycos ylation occurs in the RER, and RERsynthesized proteins are dis tinguished from those synthesi zed in the cytoplasm by the presence of signal peptides (13-36 residues containing 7-13-residue hydrophobic core flanked by several relatively hydrophilic residues usually with one or more basic residues near the N-terminus). Similarly, bacterial membrane proteins are also preceded by signal peptides such as in the case of WapA. To avoid glycosylation of WapA, wap A-E, and wap A-G were selected, which were truncated versions of the wapA gene that did not contain sequences encoding the S. mutans signal peptide. Taken with the lack of a eukaryotic signal sequence in the cloning vector, this meant that it was not likely that nascent protein synthesized in the cytoplasm could be translocated to the RER for furthe r elongation and glycosylation. Despite a number of potential glycosylation s ites with Thr and Ser residues in the wap A gene, glycosylation was successf ully prevented and antigenicity was conserved.

PAGE 71

59 Codon optimization The ability of the vacinee to produce the protein encoded by the DNA vaccine is often correlated with compara tive codon usage between foreign and host genes. Analysis of the S. mutans or WapA gene sequence showed the difference of the codon usage frequencies compared to those prevalent in the human genome (Fig. 13 and 14). The pattern of usage difference in the wap A position revealed 19 low-usage codons for expression in mammalian systems (Fig. 15). In order to improve the heterologous expression of wap A sequence in the mammalian system the frequency of wapA and human codon usage was determined, and optimi zed codons were suggested in Table 2.

PAGE 72

FIG. 13. Comparison of codon usage for each amino acid used by S. mutans and H. sapiens genes. Mean difference of 26.7% was calculated between two species. S. mutans codon was colored red. The black bar was used for H. sapiens codon usage. 60

PAGE 73

FIG. 14. Codon usage of wapA gene compared with the H. sapiens genes for each amino acid. Mean difference of 24.89% was calculated between two species. Codon fraction colored in red is wapA. H. sapiens was shown as the black bar. 61

PAGE 74

FIG. 15. Analysis of codon usage pattern of wapA to the common codon usage of H. sapiens at each position of the gene. Red bar indicates low usage codon with less than 10% codon match to the codon usage of H. sapiens. Grey bar shows less than 20% of codon usage match. 62

PAGE 75

63 Amino wapA Frequency Human codon Optimized Human codon frequency Acid codons wapA codon Frequency codon of the optimized codon Ala GCA 24 23 GCC 0 40 GCC 40 GCG 6 11 GCT 71 26 Arg AGA 27 20 AGG 9 20 CGA 9 11 CGC 9 19 CGG 0 21 CGG 21 CGT 45 8 Asn AAC 28 54 AAC 54 AAT 72 46 Asp GAC 13 54 GAC 54 GAT 88 46 Cys TGC 0 55 TGC 55 TGT 0 45 Gln CAA 89 26 CAG 11 74 CAG 74 Glu GAA 13 58 GAA 58 GAG 88 42 Gly GGA 33 25 GGC 4 34 GGC 34 GGG 13 25 GGT 50 16 His CAC 33 59 CAC 59 CAT 67 41 Ile ATA 8 16 ATC 20 48 ATC 48 ATT 72 35 Leu CTA 6 7 CTC 3 20 CTG 3 40 CTG 40 CTT 16 13 TTA 35 7 TTG 35 13 Lys AAA 74 42 AAG 26 58 AAG 58 Met ATG 100 100 ATG 100 Phe TTC 29 55 TTC 55 TTT 71 45 Pro CCA 57 27 CCC 7 11 CCG 36 28 CCG 28 CCT 0 33 Ser AGC 8 24 AGC 24 AGT 28 15 TCA 20 15 TCC 10 22 TCG 3 6 TCT 33 18 Thr ACA 49 28 ACC 7 36 ACC 36 ACG 8 12 ACT 35 24 Trp TGG 100 100 TGG 100 Tyr TAC 13 57 TAC 57 TAT 88 43 Val GTA 26 11 GTC 18 24 GTG 6 47 GTG 47 GTT 50 18 Table 2. Codon optimization of wap A gene. The codons and their frequency of

PAGE 76

64 occurrence in the WapA gene are compared with the codon frequencies of the most common codon usage of the human gene. Th e codon-optimized WapA gene represents the optimal codon for human codon usage. Comparative sequence analysis of the putative collagen binding domain in WapA Blasting the deduced amino acid sequence of WapA against the NCBI Conserved Domain Database (CDD) reveal ed a significant hit (E = 9e-20) for the collagen binding domain (Fig. 16A). Amino acids at pos ition 150 to 286 of WapA were aligned 100% with pfam05737 consensus residues of the collagen binding domain (Fig. 16B).

PAGE 77

FIG. 16. Alignment of deduced amino acid sequences of WapA with conserved domain databases. (A) Domain organization of S. mutans WapA. Amino acids 150-286 (putative CBD of WapA) were aligned 100% with 134 consensus residues of collagen binding domain in NCBI Conserved Domain Database (CDD). WapA signal peptide (S), proteolytic cleavage site (PC), cell wall domain containing LPSTG motif (W), and membrane-spanning domain (M) are indicated. The shaded region denotes the putative collagen binding domain (150-286) that was represented by CBD. The region of the expressed recombinant protein (rCBD) used in this study is also shown. (B) Sequence identity (E = 9e-20) to the collagen binding domain family was identified within the pfam database (pfam05737), where 33.8% identity in 134 amino acids overlap. 65

PAGE 78

66 Structure analysis of putati ve collagen binding domain in WapA Results of a secondary structure pr ediction algorithm using the 3D-PSSM program suggested that the submitted portion of WapA was a collagen binding domain. Prediction of secondary structure and its pr obable function as a collagen binding domain was matched significantly with the polypeptide chain of the collagen binding domain of the Cna protein from S. aureus with over a 95% confident h it (E = 1.68e-08) (Fig. 17). The putative collagen binding domain also has a significant hit (E = 5.3e-22) with the collagen-binding domain of S. aureus from the result of se quence searches against SCOPE, suggesting a common function and im plying a probable common evolutionary origin.

PAGE 79

FIG.17. The predicted secondary structure for the putative collagen binding domain in WapA was generated using the 3D-PSSM program, and was aligned to the significant structural match (E = 1.68e-08) of the fold library. The predicted secondary structure of the putative collagen binding domain in WapA shares structure motifs showing similar secondary structure topology with the assigned collagen binding domain of the Cna protein from S. aureus. E is extended beta strand; C is coil; and H is alpha helix. Expression of recombinant collagen binding domain A WapA gene fragment encoding the predicted collagen-binding domain was expressed in E. coli BL21 clone, and denoted rCBD. rCBD was purified and cleaved from glutathione S-transferase with the PreScission protease. The purified protein 67

PAGE 80

representing the collagen binding domain of wapA was shown as a single band of approximately 29 kDa in SDS-PAGE (Fig. 18). FIG. 18. Expression and purification of recombinant collagen binding domain. C-terminal truncated wapA-G cloned into pGEX-6P-1 was expressed in E. coli BL21. The resulting fusion proteins were purified on glutathione-Sepharose column followed by cleavage of the GST tag with PreScission protease. The purity of rCBD was evaluated on 10% SDS-PAGE gels stained with Coomassie blue. All lanes showed column pool and subsequent column passages. Collagen Binding Properties of WapA Immunodot analysis was used to detect the collagen binding properties of WapA, which contained the putative collagen binding domain. As shown in Fig. 19B, biotinlabeled rCBD was bound to native type I collagen, indicating the putative collagen binding domain. BSA, serving as the negative control (19A), did not bind native type I 68

PAGE 81

collagen, confirming specificity. FIG. 19. Collagen binding Assay. The collagen binding property was identified for the putative collagen binding domain in WapA by an adaptation of the dot immunobinding method, but using Biotin conjugated recombinant CBD protein in place of the primary antibody. A: No binding was detected with BSA used as a negative control. B: Binding of soluble native type I collagen to rCBD protein was observed. Quantitative analysis of collagen binding property of WapA The WapA protein was evaluated for its ability to bind soluble collagen immobilized onto a microtiter plate in a concentration-dependent manner. The putative rCBD in WapA bound quantitatively to the immobilized collagen type I, whereas no significant concentration-dependent binding was observed to the BSA (Fig. 20). Relative binding was measured by monitoring absorbance at 405 nm following the alkaline phosphatase reaction. Data points represent the means of OD405 nm values + standard deviation from 3 independent experiments. 69

PAGE 82

FIG. 20. Binding of recombinant putative CBD of WapA protein to native type I collagen used at different concentrations. Wells coated with BSA were used as the negative control. Serially diluted, biotin-labeled rCBD protein was added to the wells in a volume of 100 l, and the bound protein was detected by AP-streptavidin by reading the absorbance of the reaction mixture at 405 nm. Data are plotted as the mean values of three experiments. Cloning of truncated wapA genes into pcDNA3.1/V5/His-TOPO After transformation of E. coli Top 10 with the eukaryotic expression vector pcDNA3.1/V5/His-TOPO containing a truncated wapA gene, wapA-E or wapA-G, plasmid DNA was isolated from the recombinant clones and amplified by PCR using a forward primer specific to the T7 sequence of the vector upstream of the multicloning site 70

PAGE 83

and a reverse primer specific to the S. mutans gene insert. Analysis of the PCR products by agarose gel electrophoresis showed that both constructs contained a DNA insert of the correct size and in the correct orientation (Fig. 21). The complete nucleotide sequence of these fragments was confirmed (Fig.22 and Fig. 23). FIG. 21. Insertion of wapA-E and wapA-G fragments containing an initiation codon into the pcDNA3.1 eukaryotic expression vector. Confirmation of the correct orientation of the inserts. The PCR amplification of wapA-E and wapA-G DNA with different combination of primers. Lane 1, Molecular mass markers, Lanes 2 and 3, a forward T7 primer specific to the sequence of the vector upstream of the cloning site with BGH reverse for downstream of the cloning site for each truncation; Lane 4, Forward wapA-E specific primer with BGH reverse primer; Lane 5, Forward wap-G primer with BGH reverse primer; Lane 6, a forward T7 primer with wapA-E specific reverse primer; Lane 7, a forward T7 primer with wapA-G reverse primer; Lane 8, forward wapA-E primer with reverse wapA-E; Lane 9, forward wapA-G primer with reverse wapA-G. 71

PAGE 84

72 1 gagccaagct ggctagttaa gcttggtacc gagctcggat ccactagtcc 51 agtgtggtgg aattgccctt accatggacc aagtcacaaa ttataca aat 101 acggcttcta tcacaaaatc agatggtaca gcactttcta atgatccatc 151 taaggctgtt aattattggg aaccactttc tttcagtaat tctattactt 201 tcccagatga agtcagtatt aaggctgggg atactttaac cattaagttg 251 ccagagcaat tacaatttac gactgctcta actttcgatg ttatgcatac 301 caatgggcaa ttagctggta aagcaacaac tgatcctaat acaggagaag 351 taacagttac ctttactgat atttttgaaa aactgcctaa tgataaggct 401 atgacattaa attttaatgc acaattgaat cataacaata tttctattcc 451 tggtgttgta aactttaact ataataatgt tgcttatagt tcttatgtta 501 aagacaaaga tattacgcca ataagtccag atgttaacaa agtgggttat 551 caggataaaa gtaatcctgg tttgattcac tggaaagttc tcatcaacaa 601 caaacaaggt gctattgata atttgacttt gactgatgtt gtcggagaag 651 atcaagaaat cgtaaaagat tccttggttg ctgcacgctt gcagtacatt 701 gctggtgatg atgttgacag tttagatgaa gctgcttcgc gaccttatgc 751 tgaggatttt tcaaaaaatg ttacttatca aactaatgat ttaggattga 801 caacaggatt tacctataca attccaggat ccagtaacaa cgctatcttt 851 atctcttata ctactcgttt aacttcttct caatctgctg gtaaagatgt 901 cagcaacact attgctattt caggaaataa tattaattat tccaatcaaa 951 caggctacgc tcgtattgaa tccgcatatg gtagagctag ttctagagta 1001 aagaggcaag cagaaacaac aactgttact gaaacaacaa ctagtgaagc 1051 gacaacagaa acaagtagta caacaaataa taattcaact actacagaaa 1101 cagctactag cacaacagga gcttcaacaa cacaaacaaa aacgactgct 1151 tctcaaacga atgttccgac aacaacaaac ataacaacaa cttcaaaaca 1201 agtaaccaag caaaaagcga aatttgtttt accatcaaca ggtgaacaag 1251 cagggctttt gttaactact gtaggtcttg taattgttgc tgtggcaggt 1301 gt ctatttct atagaacacg tcgttaa aag ggcaattctg cagatatcca 1351 gcacagtggc ggccgctcga gtctagaggg cccgcggttc gaaggtaagc 1401 ctatccctaa ccctctcctc ggtctcgatt ctacgcgtac cggtcatcat 1451 caccatcacc attgagttta aaccc FIG. 22. Nucleotide sequence of the recombinant wap A ( wap A-E) cloned into a eukaryotic expression vector, pcDNA3.1. The underlines indicate th e regions used as primers for the amplification of the wap A. The Kozak sequence, initial Met, and terminal codon are hi ghlighted in yellow.

PAGE 85

73 1 gagccaagct ggctagttaa gcttggtacc gagctcggat ccactagtcc 51 agtgtggtgg aattgccctt accatggacc aagtcacaaa ttataca aat 101 acggcttcta tcacaaaatc agatggtaca gcactttcta atgatccatc 151 taaggctgtt aattattggg aaccactttc tttcagtaat tctattactt 201 tcccagatga agtcagtatt aaggctgggg atactttaac cattaagttg 251 ccagagcaat tacaatttac gactgctcta actttcgatg ttatgcatac 301 caatgggcaa ttagctggta aagcaacaac tgatcctaat acaggagaag 351 taacagttac ctttactgat atttttgaaa aactgcctaa tgataaggct 401 atgacattaa attttaatgc acaattgaat cataacaata tttctattcc 451 tggtgttgta aactttaact ataataatgt tgcttatagt tcttatgtta 501 aagacaaaga tattacgcca ataagtccag atgttaacaa agtgggttat 551 caggataaaa gtaatcctgg tttgattcac tggaaagttc tcatcaacaa 601 caaacaaggt gctattgata atttgacttt gactgatgtt gtcggagaag 651 atcaagaaat cgtaaaagat tccttggttg ctgcacgctt gcagtacatt 701 gctggtgatg atgttgacag tttagatgaa gctgcttcgc gaccttatgc 751 tgaggatttt tcaaaaaatg ttacttatca aactaatgat ttaggattga 801 caacaggatt tacctataca attccaggat ccagtaacaa cgctatcttt 851 atctcttata ctactcgttt aacttcttct caatctgctg gtaaagatgt 901 cagcaacact attgctattt caggaaataa tattaattat tccaatcaaa 951 caggctacta a aagggcaat tctgcagata tccagcacag tggcggccgc 1001 tcgagtctag agggcccgcg gttcgaaggt aagcctatcc ctaaccctct 1051 cctcggtctc gattctacgc gtaccggtca tcatcaccat caccattgag 1101 tttaaaccc FIG. 23. Nucleotide sequence of the recombinant agA ( wap A-G) cloned into a eukaryotic expression vector, pcDNA3.1. The underlines indicate th e regions used as primers for the amplification of the agA. Yellow highlight shows the Kozak sequence, initial Met, and terminal condon. Quality control of plasmid production for immunization The plasmid DNA production must include a good quality control process in order to assure the plasmid DNA, especially when used as a therap eutic agent including vaccination, is free of any contaminats, wh ich include proteins, RNA, endotoxins, genomic DNA of the host cell, or any com ponents used in the purification process. Purification of supercoiled plasmid without containing other isofoms such as nicked, linear, dimers or concatemers plasmids is an essential factor fo r quality control of

PAGE 86

plasmid production, as well as function as a reproducible, scalable and economical purification process. Plasmid isolation was performed using the Qiagen procedure approved to produce plasmid DNA for human clinical Phase I studies in the U.K. (14) and other European countries, as well as in the United States by the FDA (49). Supercoiled plasmid and any other isoforms were analyzed by running total plasmid DNA in 1% agarose gel electrophoresis (Fig. 24A). Plasmid DNA identity and quality were accessed through restriction analysis by BstXI digest of the parental vector and wapA or agA DNA vaccine constructs (Fig. 24B). DNA purity was assessed by using spectrophotometric analysis and calculation from its absorbance ratio of 260nm/280nm. A. B. FIG. 24. Agarose gel electrophoresis and restriction enzyme digestion of pcDNA3.1-wapA or pcDNA3.1-agA for assuring the quality of DNA vaccines. A. Lane 1, DNA-Hind III Digest. Lane 2, pcDNA3.1-wapA. Lane 3, pcDNA3.1-agA. Lane 4, pcDNA 3.1 parental vector. B. Lane 1, 100 base pair ladder. Lane 2, pcDNA3.1-agA-BstXI digest. Lane 3, pcDNA3.1-wapA-BstXI digest. Lane 4, pcDNA3.1-BstXI digest. 74

PAGE 87

Expression of WapA and AgA by dot immunobinding assay The expression of wapA and agA genes was investigated by immunodot analysis of the sonic extract of transfected CHO cells against a rabbit antiserum to the S. mutans cell wall. Chemiluminescence detection showed a high level of expression of both wapA and agA. No reaction was obtained with the negative control CHO cells (Fig. 25). A B C D E FIG. 25. Immunodot analysis. The sonic extracts were dotted onto a piece of nitrocellulose filter. Expression was detected by chemiluminescence substrate ECL for HRP. (A) A 4B2 clone sonic extract (positive control). (B) A wapA-E transfected CHO cell. (C) A wapA-G transfected CHO cell. (D) CHO cell treated with the lipid alone (negative control). (E) Untransfected CHO cells (negative control). Western immunoblot analysis of WapA and AgA expressed in transfected CHO cells To determine the molecular size of the proteins expressed in transfected CHO cells, Western immunoblot analysis was performed on aliquots of the cell sonic extract. Proteins with the anticipated molecular weights of 52,000 and 29,000 were observed with the transfected CHO cell samples, but not with the negative control untransfected CHO cells (Fig. 26). 75

PAGE 88

FIG. 26. Western immunoblot analysis of wapA-E and wapA-G gene expression using rabbit antiserum to S. mutans cell wall antigens in CHO cells at 24 h post-transfection. Lane 1, WapA-E sonic extract. Two bands of 52 and 29 kDa were obtained corresponding to WapA and AgA, respectively. Lane 2, WapA-G sonic extract. The anticipated 29-kDa band was obtained (smaller bands are probably attributable to proteolytic degradation). Lane 3, CHO cell treated with the lipid alone as a negative control. Lane 4, Untransfected CHO cells as a negative control. In situ immunochemical staining of transfected CHO cells To localize the WapA and AgA protein in transfectants, immunochemical staining was performed using a rabbit antiserum to S. mutans cell wall antigens followed by an alkaline phosphatase-conjugated goat antibody to rabbit immunoglobulins. Detection 76

PAGE 89

77 was performed using the chromogenic substrate fast red stain. The presence of antigen was identified by a red coloration. The WapA protein was found mainly associated with the CHO cell membrane and budding vesicles whereas AgA was found in transfected cells and extracellular surroundings (Fig. 27). Thus, the wap A and agA gene constructs were efficiently taken up by CHO cells thr ough lipid-mediated transf ection and expressed in these eukaryotic cells.

PAGE 90

A B C D FIG. 27. In situ expression of WapA and AgA at 24 hours post-transfection. Transfected CHO cells were fixed on a slide with cold acetone, blocked with skim milk, and immunochemically stained with antibody to S. mutans cell wall. Fast Red RC was used as a substrate for alkaline phosphatase. (A) A CHO cell treated with the lipid alone as a negative control. (B) Expression of AgA in transfected cells and extracellular medium. (C) Expression of WapA in transfected cells and budding vesicles. (D) Expression of WapA in large vesicles. (A, B and C were identified on the light microscope at X400 and photographed at X1000). 78

PAGE 91

Optimization of pcDNA-lipid complex HeLa cells were transiently transfected to determine the optimum ratio of pcDNA-lipid complex. The highest transfection efficiency was obtained with 2 g pcDNA and 10 g DMRIE-C, the ratio corresponding approximately to the ratio in molarity of 1:2 of pcDNA and DMRIE-C. Decreased -galactosidase activity was indicative of cell death (Fig. 28). 00.511.522.533.5123456789101112pDNA:DMRIE-C ratioA415 nm FIG. 28. Optimization of DMRIE-C Reagent and pcDNA ratio for transfection. In order to determine the optimal DMRIE-C formulation, different pcDNA3.1-gal DNA:DMRIE-C lipid ratios were tested in Hela cells. At 24 h post-transfection, cells were solubilizd and assayed for the -galactosidase activity at 415 nm with a spectrophotometer. Data are means and standard deviation of duplicates. Dot immunobinding assay Four weeks after the booster immunization, mice immunized with plasmid containing wapA or agA complexed with DMRIE-C showed the presence of antiAgA salivary sIgA by immunodot analysis using a HRP-conjugated anti-mouse IgA and a 79

PAGE 92

chemiluminescence substrate for HRP (Fig. 29). No reaction was detected in the saliva obtained from the control mice. FIG. 29. Immunodot analysis of anti-WapA and AgA salivary IgA production. Purified GST-AgA fusion protein was dotted onto a piece of nitrocellulose filter in line 2. Purified GST only was used as a control in line 1. The filter was incubated overnight with the saliva (1:2 dilution in PBS) of mice that were immunized with (A) PBS, (B) DMRIE-C lipid, (C) pcDNA3.1 vector with DMRIE-C, (D) WapA DNA vaccine construct with DMRIE-C, and (E) AgA DNA vaccine construct with DMRIE-C. Chemiluminescence detection showed the presence of anti-WapA and AgA salivary IgA in 2D and 2E. No reaction was obtained with the saliva of control mice. Humoral immune responses induced by DNA vaccines 80 To access the level of humoral immune response after DNA immunization, serum or saliva was collected from the control mice and the mice immunized with pcDNA-wapA or pcDNAagA at various time points after the second immunization. ELISA of the saliva obtained showed a significantly higher level (P < 0.05) of antigen-specific IgA in the immunized mice as compared to the background level in the control group (Fig.

PAGE 93

30A). Similarly, the levels of antigen-specific IgG were observed in the serum of the immunized mice as compared to that of the control animals (P < 0.05) (Fig. 30B). Both salivary IgA and serum IgG titers were higher in the samples collected from the pcDNA-wapA immunized mice as compared to those immunized with pcDNA-agA vaccine (P < 0.05) (Fig. 30). A. B. FIG. 30. Salivary IgA and serum IgG responses in mice. Following intra nasal immunization with pcDNA-wapA or pcDNA-agA, pooled saliva (A) and serum (B) samples were analyzed by ELISA using plates coated with recombinant AgA. Mice immunized with either pcDNA-wapA or pcDNA-agA showed a significantly higher signal than the background level (control mice), both in saliva and serum (P < 0.05). Western immunoblot analysis of antibody response against AgA Analysis of the saliva of the mice immunized with pcDNA-agA or with pcDNA-wapA by Western immunoblot showed the presence of sIgA binding to the GST-WapA antigen band of approximately 58 kDa (Fig. 31). 81

PAGE 94

82 FIG. 31. Western immunoblot analysis of salivary sIgA Abs to wapA and agA DNA vaccines. The results showed the anticipated antigen bands (GST-AgA fusion protein of approximately 58 kDa) with the saliva of mice immunized with agA-pDNA (Lane 3) or with wapA-pDNA (Lane 5). No band was obtained with either mouse saliva against the extract of the control E. coli harboring empty vector (lanes 4 and 6). As anticipated, no band was obtained with the saliva of the control mice (Lane 1 and 2). Induction of S. mutans WapA The WapA is involved in sucrose-dependent adherence and aggregation (101). In order to determine whether sucrose induces further the expression of WapA, S. mutans, Western blot analysis was performed on sonic extracts of each culture grown with or without sucrose presence. Expression of S. mutans WapA was strongly enhanced in presence of 2% sucrose, suggesting WapA expression is regulated by sucrose (Fig. 32).

PAGE 95

FIG. 32. Expression of WapA in presence of sucrose. Enhanced WapA expression was shown in the S. mutans culture grown in presence of 2% sucrose. Western immunoblot analysis of antibody response against WapA Reactivity against WapA was higher with the anti-WapA antibody than with the reactivity of the anti-AgA, suggesting a stronger reaction is attributable to the additional epitopes seen in WapA but not in AgA (Fig. 33). FIG. 33. Western blot analysis of S. mutans WapA using polyclonal antiserum raised against AgA or WapA. Stronger immunoreactivity was shown with anti-WapA serum that that of anti-AgA. 83

PAGE 96

84 Sucrose-dependent adherence inhibition assay Saliva of the immunized mice, with pcDNAwap A or pcDNAagA, was evaluated for the ability to inhibit the S. mutans in vitro sucrose-dependent adherence. A significantly higher inhibition of adherence (P<0.05) was obtai ned with the saliva of the mice immunized with pcDNA-wapA (21% inhibi tion) as compared to the Saliva of the mice immunized with pcDNA-agA (7% inhibition) shown in Table 3. TABLE 3. EFFECT OF SALIVARY IgA PRODUCED IN RESPONSE TO IMMUNIZATION ON BA CTERIAL ADHERENCE Immunization Group Treatment a Mean % adherent cells/total cells + SD b A pcDNA Vector only 61.11 + 1.75 B pcDNAwap A 48.53 + 1.36 C pcDNAagA 57.00 + 1.44 a Saliva collected was diluted 1:2 in PBS and added to triplicate S. mutans culture wells. b Significant inhibi tion (P<0.05) of S. mutans in vitro sucrose-dependent adherence was observed with the saliva of mice immunized with pcDNAwap A (B), and to a lesser extent with the saliva of mice immunized with pcDNAagA (C) or with pcDNA vector alone (A) Dextran-binding properties Analysis of recombinant WapA or AgA fo r the ability to bind biotin-labeled dextran showed that WapA bound dextran, but AgA did not. As anticipated, no dextranbinding activity was observed with GST us ed as a negative control (Fig. 34).

PAGE 97

FIG. 34. Dextran-binding assay. The dextran-binding property was identified on GST fusion proteins containing WapA or AgA against the Biotin-dextran conjugate using the Dot immunobinding method. The WapA showed a capacity to bind dextran (1), but the AgA did not (2). GST only was dotted as a control (3). Cloning and sequencing of il-5 and ctb recombinant genes The orientation and identity of the il-5 cDNA and ctb gene clones were confirmed by the nucleotide sequencing (Fig. 35). The cloned il-5 cDNA was 402 bp of ORF without signal peptide, and it encoded 133 amino acid residues. The sequencing of the ctb clone showed correct identity of the ctb gene insert including 312 nucleotides encoding 103 amino acids. 85

PAGE 98

86 A. TTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTGCCCTT ACCATG AGAAGGATGCT TCTGCACTTGAGTGTTCTGACTCTCAGCTGTGTCTGGGCCACTGCCATGGAGATTCCCATGAGCACAGTGG TGAAAGAGACCTTGACACAGCTGTCCGCTCACCGAGCTCTGTTGACAAGCAATGAGACGATGAGGCTTCCT GTCCCTACTCATAAAAATCACCAGCTATGCATTGGAGAAATCTTTCAGGGGCTAGACATACTGAAGAATCA AACTGTCCGTGGGGGTACTGTGGAAATGCTATTCCAAAACCTGTCATTAATAAAGAAATACATTGACCGCC AAAAAGAGAAGTGTGGCGAGGAGAGACGGAGGACGAGGCAGTTCCTGGATTACCTGCAAGAGTTCCTTGGT GTGATGAGTACAGAGTGGGCAATGGAAGGC TGA AAGGGCAATTCTGCAGATATCCAGCACAGTGGCGGCCG CTCGAGTCTAGAGGGCCCGCGGTTCGAAGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGC GTACCGGTCATCATCACCATCACCATT B. TTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTGCCCTT ACCATG ACACCTCAAAA TATTACTGATTTGTGTGCAGAATACCACAACACACAAATATATACGCTAAATGATAAGATATTTTCGTATA CAGAATCTCTAGCTGGAAAAAGAGAGATGGCTATCATTACTTTTAAGAATGGTGCAATTTTTCAAGTAGAA GTACCAGGTAGTCAACATATAGATTCACAAAAAAAAGCGATTGAAAGGATGAAGGATACCCTGAGGATTGC ATATCTTACTGAAGCTAAAGTCGAAAAGTTATGTGTATGGAATAATAAAACGCCTCATGCGATTGCCGCAA TTAGTATGGCAAAT TAAAAGGGCAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGC CCGCGGTTCGAAGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCA CCATCACCATT FIG. 35. Nucleotide sequence of il-5 or ctb gene insert. The il -5 cDNA or ctb gene subunit was cloned into the pcDNA3.1 mammalia n expression vector and sequenced. The coding regions, including the ATG start c odon, are in red, and the Kozak sequence is underlined. The primers used are indicated in blue. Western immunoblot analysis of the purified GST-CTB fusion protein The purified GST-CTB fusion protein wa s confirmed by the Western immunoblot with monoclonal antibody to Ctb. The 40-kDa band was identified on the nitrocellulose lines containing purified GST-CTB fusion protein or lysate of E. coli containing the construct. No band was shown on th e line with purified GST (Fig. 36).

PAGE 99

FIG. 36. Western immunoblot analysis of purified GST-CTB fusion protein. Specific binding of the anti-CTB monoclonal antibody to the cloned and purified GST-CTB protein (Line 2). No immunoreactivity was shown to the purified GST protein (Line 3). The molecular masses standards (lane 1) are indicated (in kilodaltons) on the left of the blot. Expression of recombinant WapA or AgA WapA and AgA are expressed as GST-fusion poteins in the E. coli recombinant clones WapAE and WapA-G, respectively. Expression of both antigens was observed (Fig. 37 and Fig. 38). 87

PAGE 100

FIG. 37. SDS-PAGE analysis of the GST-wapA fusion protein expression. A highly expressed truncated wapA-G gene as GST fusion was used as the coating antigen in an ELISA assay. Lane 1, E. coli BL 21 lysate. Lane 2, a soluble sonic extract containing GST-wapA-G. Lane 3, GST-wapA-G protein purified from the soluble fraction. Lane 4, M.W. marker. Fig. 38. Expression of wapA and agA genes as GST fusions. SDS-PAGE of purified 29 kDa GST (lane 1), 81 kDa GST-WapA (lane 2), and 58 kDa GST-AgA (lane 3) are shown on coomassie blue stained gel. Molecular weight standards were run in lane 1. 88

PAGE 101

89 Production of DNA vaccine The recombinant E. coli TOP10 containing the target DNA was cultured in an LB medium containing ampicillin added at 50 micrograms per milliliter, and plasmid DNA was isolated by the modified alkaline lysis method using a kit from Qiagen (HiSpeed Maxi Kit), Valencia, CA. The average yield of plasmid DNA containing the wap A gene (pcDNAwap A) was 2 mg/L E. coli culture, whereas that of the plasmid containing the agA gene (pcDNAagA) was only 0.92 mg/L. One reason for the low yield of pcDNAagA is the tendency of the recombinant E. coli to lyse. In order to improve the yield of pcDNAag A, the antibiotic chloramphenicol was added to the culture. As a result, the yield of plasmid copies was improved by approximately 2.5 fold (2.3 mg/L E. coli culture). Hence, we have established the conditions for the obtaining of comparable levels of production of pcDNA -wap A and pcDNA-ag A. Production of Protein vaccine The proteins WapA and AgA were obtaine d separately, each as a fusion protein with the enzyme glutathione S-transferase (GST), respectively designated as WapA-GST and AgA-GST. The yield of these proteins was determined by optical density readings at 280nm, and calculated based on the extincti on coefficient of GST (1 OD280 = 0.5 mg protein/ml). The fusion proteins were pur ified by affinity column chromatography on GST-Sepharose (Promega, Madison WI) and purity was demonstrated by SDS-PAGE, where a single protein band was obtained fo r each GST-fusion protein. Originally, the yield of AgA-GST and WapA-GST was 2.5 mg/L and 1.2 mg/L, respectively. One reason for the lower yield of Wa pA-GST was due to the insolubility of WapA, since this protein contains an extra hydrophobic membrane -binding region at the C-terminal end as

PAGE 102

compared to AgA. Sarkosyl was used to solubilize the E. coli membrane and improve the recovery of WapA-GST. The results showed a two-fold increase up to 2 mg/L. Immunodot analysis The presence of anti-WapA salivary IgA was detected by Immunodot analsis. Weak staining was shown in the saliva from the DNA vaccine immunized mice while a much stronger reaction was obtained with the protein vaccinated mice (Fig. 39). No reaction was detected from the saliva of the negative control or that of the DNA vaccine alone without cationic lipid. FIG. 39. Immunodot analysis. Saliva from immunized mice were tested for immunogenicity of specific S-IgA against WapA. Group 1 mice immunized with pcDNA-wapA alone (2), or with pcDNA-il-5 (3) or pcDNA-ctb (4) showed weak immunogenicity to WapA. Group 2 mice immunized with AgA (6) or WapA (7) showed strong reaction to WapA. Group 3 mice that is primed with pcDNA-wapA and boosted with WapA protein (5) revealed strong immunogenicity to WapA. No immunogenicity was shown for non-immunized (1) or WapA DNA vaccine only without adjuvant (8). Immunomodulatory effect on humoral immunity To investigate the influence of il-5 or ctb co-immunization on the level and duration of salivary IgA response, saliva from the control and immunized mice with or 90

PAGE 103

91 without the adjuvant was an alyzed using an ELISA assay. Co-immunization with pcDNAil-5 resulted in a significan t (P < 0.05) but temporal sIgA response after boosting with a third injection of DNA as compared to that of the control mice group (Fig. 40A). This was followed by a drop in the level of sIgA with the additional booster, indicating that the booster effect was aborted and, therefore, no me mory immune response was elicited. The level of sI gA antibody induced by pcDNActb as an adjuvant was improved more rapidly and consistently as comp ared to that of the control or pcDNAil-5 coimmunization (Fig. 40A). Mice primed with pcDNA-wap A followed by the WapA boost produced sIgA levels comparable to mice receiving 2 WapA doses (Fig. 40B). The antigen-specific antibody was not affected in the groups administered with DNA only without adjuvant and the non-immunized group (Fig. 40).

PAGE 104

A. B. FIG. 40. WapA-specific sIgA antibody response in the saliva of mice immunized with DNA or protein vaccine. Levels of the antigen-specific S-IgA was determined in the saliva of immunized mice given pcDNA-wapA alone, or with pcDNA-il-5 or pcDNA-ctb (A) or primed with pcDNA-wapA and boosted with WapA or WapA and CTB (B) by the i.n route. Each vaccine was injected biweekly, as shown by black arrows, for a total of four inoculations. Each point is the mean of triplicate values. 92

PAGE 105

93 DISCUSSION Dental caries is a significant health probl em in humans and treatment is costly due to the high prevalence in the population. Desp ite longstanding effort at the development of a caries vaccine, an efficacious vaccine protocol has not yet been developed. The establishment of an effective mucosal vaccine would be an exceptionally significant accomplishment that would greatly enhance th e ability to provide preventive vaccination for this disease. This is especially true for the groups at risk such as underserved communities which do not have access to water fluoridation and periodical preventive dental care, and children a nd adults with medical probl ems or receiving medical treatments that reduce salivary flow. Once developed, the dental vaccine should also serve as a model for the prepar ation of similar vaccines agai nst other infectious agents, particularly those infe cting the oral cavity. The overall objective of this study was to develop a novel mucosal vaccine that is safe, cost-effective and efficacious at inducing protective immunity against dental caries. A number of virulence factors have been iden tified as candidate vaccine antigens, most of which have been cloned and sequenced, and some have been tested with much promise. Since salivary immunoglobulin A (IgA) to various S. mutans adherence and aggregation factors has been showed to confer protection against S. mutans infection, induction of mucosal immunity has become the main target for dental caries vaccine development (37,

PAGE 106

94 120, 122). The target antigens used in this study were the S. mutans antigen A (AgA), a recognized candidate vaccine antigen, and its precursor the wall-associated protein A (WapA), a factor involved in colonization and build up of de ntal plaque. Previously, WapA gene and the truncated agA gene had been cloned into a high expression vector for expression as Glutathione-S-Transferase fusion proteins to improve yield and facilitate purification (146). However, considering that the costs associated wi th the extraction, purification and storag e of recombinant antigens and an tibodies can be an obstacle to mass immunization, it is necessary to explore alternative approach. With recent advances made in the co nstruction of DNA vaccines comes the hope for a more economical way to immunize against infectious disease. In the present study, genetic immunization using naked DNA vaccine was used as an alternative method of inducing mucosal immunity characterized by the induction of secretory IgA against S. mutans DNA vaccine is both potentially safer and more economical than conventional vaccines when considering the ease of isol ation of plasmid DNA, low cost of massproduction, stability at extreme temperatures, ease of admi nistration, and potential for induction of long-lasting imm unity without causing any severe side effects (1, 39). Therefore, the prospect of a DNA vaccine against dental cari es is particularly attractive due to the high incidence of this diseas e in the world, with populations of low socioeconomic status being at the highest risk. DNA vaccines induce both specific antibody and cell-mediated immune responses (27). However, their use has been main ly focused on viral infections (81). DNA vaccines against bacterial infect ions have been limited to in tracellular bacterial pathogens such as Mycobacteria spp. or Salmonella spp where cytotoxic or a Th1 type T cells

PAGE 107

95 confer protection (130). More over, induction of mucosal imm unity against extracellular bacterial infection where secretory IgA mediat es resistance has been rarely studied. The feasibility of DNA vaccine efficacy wa s demonstrated in terms of inducing specific mucosal immunity against S. mutans an extracellular bacterium, and relative immunogenicity of full-length and C-terminal truncated wap A was compared and evaluated. Further exploration was made to test th e efficacy of two forms of vaccine; Gene versus Protein in inducing specific sIgA response. The efficacy of co-immunization with genetic adjuvants at enhancing salivary IgA re sponse was also investigated. A number of cytokines have been identifie d as enhancing the mucosal IgA response to DNA vaccines, notably IL-5 in mice (102, 139). Intranasal administration of recombinant adenovirus vectors expressing IL-5 has been shown to enhance secretory IgA response to the adenovirus in the lung (102). Increased IgA response to Salmonella LPS has also been observed in mice immunized with the bacterial strain engineered to express murine IL-5 (138). IL-5 was chosen over other cytokines as it has b een found to be the primary cytokine inducing the generation of IgA producing B cells in mice. Effects of co-immunization with either gene or protein of a CTB subunit were studied. CTB is a proven adjuvant for the induction of a mucosal response to a proteinbased vaccine in mice (142). Unlike CT and CTA subunits, CTB is not toxic, and hence has been considered as a good candidate ad juvant for human use (145). Bergquist et al. (10), using recombinant CTB in intranasal immunization of humans did not observe any systemic adverse reactions, but only local irritations of short duration at high doses (1,000 g per dose) in all voluntee rs. At a lower dose (100 g), the local reaction was

PAGE 108

96 mild and tolerable, and occurred only in approximately one third of the subjects. In a study conducted by Johansson et al (52), 21 female volunteers were administered nasally 250 g of recombinant CTB using an atomizer, and no apparent side effect was reported. CTB was also found to be safe in the immunization of Israeli young adults against enterotoxigenic E. coli (16). By using pcDNActb as an adjuvant in DNA immunization, it was possible to not only compare the effi cacy of protein versus DNA vaccine, but also that of pr otein versus DNA adjuvant. The enhancement of mucosal immunity to protein conjugated with CTB was due to two functions of CTB: (1) transmucosal carrier, and (2) immuno-stimul atory molecule. In immunization with pcDNA, delivery of pcDNA across the mucosal barrier is mediated by DMRIE-C, thus any enhancement obtained by co-immunization with pcDNActb will be attributable to the strong immunogenic properties of CTB. Cloning of the truncated wap A genes, wap A-E and wap A-G, into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO was completed, and the genes were shown to be inserted in the correct or ientation. To test the expres sion of the cloned genes, CHO cells were used as hosts in transfection studi es. The cationic lipid pfx8 was used, as it has been reported by the manufacturer to work best for CHO cells. Indeed, transfection of CHO cells was successful, and the cloned gene s were expressed as anticipated. It is noteworthy that the wap A-E gene product (WapA-E), corresponding to the S. mutans WapA, was expressed in the transfected cells and budding ve sicles, probably from cells undergoing apoptosis, whereas the wap A-G gene product (WapA-G), corresponding to the S. mutans AgA, was found in both the cells and the surrounding medium. The differential expression of WapA and Ag A may be attributable to the presence

PAGE 109

97 of the hydrophobic C-terminal end of WapA, a llowing this molecule to interact with hydrophobic components in the host cell membrane. The AgA protein is truncated in this hydrophobic region and hence is more soluble an d may be released from leaky or lysed cells. Whether the genes are expressed as so luble or cell-and vesicle-associated proteins, it is reasonable to anticipate an antibody response, as previously obtained by immunization with the WapA and AgA protei ns. In fact, both cellular and humoral immune responses were obtained by immunization with DNA vaccines, indicating that in the host cells, the foreign proteins were pr ocessed both through th e endogenous pathway of antigen processing, and presented associ ated with MHC-I, or through release and uptake by antigen-presenting cells for processing by the exogenous pathway and presentation in association with MHC-II (61). The present study illustrated two ways by which foreign proteins could be released from the host cells. The immunization study showed that it was feasible to induce a mucosal response to S. mutans antigen by intranasal administration of naked DNA vaccine containing the wap A gene or its truncated derivative agA gene. Both DNA constructs i nduced antigen specific sIgA antibodies in the saliva of the immunized an imals, with a higher antibody titre observed with pcDNAwap A as compared to pcDNAag A. It was hypothesized that due to its la rger size and hydrophobicity, due to the presence of a membrane and wall-spanni ng region, WapA may be more immunogenic than its hydrophilic truncated derivati ve AgA. Data from a previous in vitro transfection study showed that WapA was found expressed in budding vesicles (presumably apoptotic bodies), whereas AgA was diffused in the extracellular medium. Such an occurrence in

PAGE 110

98 vivo should facilitate the phagocytosis a nd processing of apoptotic bodies and the presentation of antigen peptides to T help er cells by macrophages. This hypothesis was further supported by the sequence analysis of WapA and AgA using virtual matrices algorithms. The results obtained reveal ed putative binding sequences within the hydrophobic C-terminal end of WapA, along with the rest of the sequences, based on MHC binding motifs for known major histoc ompatibility complex class II binding alleles. Those predicted MHC class II ligands corresponded with promiscuous binding motifs associated with 51 MHC class II allele s; one of the most prominent promiscuous binders was located at residues 400 to 409, within the C-terminal end. Those promiscuous binding motifs allow for a large de gree of compatibility between the antigen peptide sequence and dimeric MHC II molecule (121). The resulting peptide-MHC II complexes are delivered to the membrane for detection by CD4+ T cells and induce humoral immune responses (99). Most of the peptides presented by MHC class II molecules are derived from the endocytosis and processing of extracellular proteins (99, 122). Previously, it was demonstrated by others that endogenous pr oteins produced by a DNA vaccine could be released from transfected cells and uptaken by antigen-presenting cells for processing by the exogenous pathway and pres entation in association with MHC class II. Moreover, in the host cells, endogenous antig ens enter the MHC Class II processing and presentation pathways much more efficiently than the e ndocytosis and processing of the same protein from the extracellular compartment (12, 95, 115) Another major factor affecting the antibody response is transfection efficien cy (29, 43, 114). The present study also demonstrated that transfection efficiency of HeLa cells was dependent on the ratio of

PAGE 111

99 pcDNA:DMRIE-C starting at 1:1 (w/w) and r eaching an optimal level at 1:5, then decreasing thereafter. The decrease in transfection efficacy and expression was associated with cell death due to th e toxicity of DMRIE-C at high dose. In addition to the above, the inhibition of S. mutans adherence to the culture vessel when grown in the presence of sucr ose by a salivary antibody of mice immunized with pcDNAwap A, and not by the salivary anti body of the mice immunized with pcDNAag A, further demonstrated that WapA wa s a better candidate vaccine antigen than AgA. Dot immunobinding assay where the WapA in its larger precursor form showed a glucan-binding property, but not the 29-kDa C-terminal truncated version ( wap A-G) encoding the AgA, supports this view These findings are in agreement with the previous data in an experiment wher e WapA, but not the AgA, showed a binding affinity to various dextran matr ices (23). The work presented here explores the feasibility of genetic immunization against S. mutans DNA vaccine containing the S. mutans wallassociated protein A gene ( wap A) were proven to be better immunogens than others which contained the truncated derivativ e corresponding to the antigen A gene ( agA) for the reasons described above. In the present study, we further eval uated if co-immunization with genetic adjuvant would enhance the levels of sIgA response elicited by the caries DNA vaccine containing the WapA gene. Attempts were also made to compare the efficacy of DNA versus protein in inducing the WapA-specific sIgA response. Our data shows that a DNA vaccine encoding WapA protein is less effec tive than a corresponding protein vaccine in inducing mucosal antibody response. Furthe rmore, subsequent boosts with DNA vaccine were not capable of amplifying Ab memo ry generated by the DNA vaccine prime,

PAGE 112

100 suggesting homologous DNA vaccine is not an efficient booster of immune memory. Specific salivary IgA response was transiently enhanced by co-immunization with IL-5 expressing plasmid, while comparativ ely steady increase was observed by a coimmunization with plasmid containing the CT B gene. This observa tion indicates that expressed CTB may have continuing adjuva nt activity by enhancing presentation of expressed antigen released from transfected cells and by stimulating mucosal Th2-type cytokine responses, such as IL-5, leading to increased mucosal IgA production. Antigenspecific IgA response was impr oved by the action of pcDNAil-5 expression, indicating immunomodulatory effect of the cytokine in improving isotype differentiation of B cells to mucosal IgA formation. However, the Ig A antibody response failed to be sustained, probably due to the lack of booster effect in generating co ntinuous IL-5 as seen with pcDNAwap A gene immunization. Prime-boost immunization regimen of pcDNAwap A priming, followed by boosting with a WapA protein, showed consider able enhancement on the level that sIgA produced, almost as high as protei n-protein vaccination. Thus, pcDNAwap A was shown to be a valid candidate primary vaccine and that subsequent natural exposure to S. mutans may provide the necessary boost to induce higher sI gA response. It has been reported that plasmid DNA immunization predominantly induces a Th1-type cellular immune response (104) over a Th2 type immune response that produces humoral antibodies. The lower saliv ary IgA immune response generated from a DNA vaccine might be due to the Th1-biased ch aracteristic of the vaccine. Insufficient memory response was consistently observed in other studies indi cating that boosting may not efficiently stimulate the memory B cells with the DNA vaccine (70, 107, 119).

PAGE 113

101 Indeed, the data demonstrated that intranas al immunization with a DNA vaccine followed by a boost with the corresponding protein vacci ne showes a significant enhancement of the antigen-specific salivary sIgA respons e, a key factor for protective mucosal immunity. With recent advances in the understandi ng of B and T-cell memory, prime-boost vaccination strategies appear to create a synergistic effect from the two vaccines, and the quality and longevity of T-cell memory gene rated from DNA prime can be significantly enhanced by subsequent prot ein boosting. From the experiments performed herein, we have been able to establish an altern ative, novel DNA vaccine strategy of inducing mucosal immunity against S. mutans Dental caries induc tion involves multiple S. mutans proteins, and this study should serve as a model for the preparation of other gene constructs to include in a combination dent al DNA vaccine. The resu lts obtained in this study will have an impact on future vaccine development, not only against S. mutans but also against other pathogens utilizing the mucosal lining of the respiratory, gastrointestinal, and genito-urinary tract as a route of entry into the host.

PAGE 114

102 References 1. Abdelnoor A. M. Plasmid DNA vaccines. 2001. Curr Drug Targets. Immune. Endocr. Metabol. Disord. 1: 79-92. 2. Almstahl A. and Wikstrom M. 1999. Oral microflora in subjects with reduced salivary secretion. J. Dent. Res. 78 :1410-1416. 3. Almstahl, A., Wikstrom, M., and Kroneld, U. 2001. Microflora in oral ecosystems in primary Sjogrens syndrome. J. Reumatol. 28 :1007-1013. 4. Balakrishnan, M., Simmonds, R. S., and Tagg, J. R. 2000. Dental caries is a preventable infectious disease. Aust. Dent. J. 45(4) : 235-245. 5. Banas, J. A., Russell, R. R. B., and Ferretti, J. S. 1990. Sequence analysis of the gene for the glucan-binding protein of Streptococcus mutans Ingbritt. Infect Immun. 58:667-673. 6. Banas, J. J. and Gilmore, K. S. 1991. Analysis of Streptococcus mutans and Streptococcus downei Mutans Insertionally Inactivated in the gbp and gtf S Genes. In: Genetics and Molecular Biology of Streptococci, Lactococci, and Enterococci pp. 281283. (G.M. Dunny, P.P. Cleary, and L.L. McKay, Eds.) Amer. Soc. Microbiol., Washington, D.C. 7. Bateman, A., Coin, L., Durbin, R., Finn, R. D., Hollich, V., Griffiths-Jones, S., Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E. L., Studholme, D. J., Yeats, C. and Eddy, S. R. 2004. The Pfam protein families database. Nucleic Acids Res. 32:138-141.

PAGE 115

103 8. Beighton, D., Hayday, H., Russell, R. R. B., and Whiley, R. A. 1984. Streptococcus macacae sp. nov. from dental plaque of monkeys ( Macaca fascicularis ). Int J. Syst. Bacteriol. 34 :332-335. 9. Beighton, D., Russell, R. R. B., and Hayday, H. 1981. The isolation and characterization of Streptococcus mutans serotype h from dental plaque of monkey ( Macaca fascicularis ). J. Gen. Microbiol. 124:271-279. 10. Bergquist, C., Johansson, E. L., Lagergard, T., Holmgren, J., and Rudin, A. 1997. Intranasal vaccination of humans w ith recombinant cholera toxin B subunit induces systemic and local antibody responses in the upper respiratory tract and the vagina. Infect. Immun. 65:2676-2684. 11. Bratthall D. 1970. Demonstration of five serological groups of streptococcal strains resembling Streptococcus mutans Odontol. Revy. 21:143-152. 12. Brooks A. G. and McCluskey, J. 1993. Class II-restricted presentation of a hen egg lysozyme determinant derived from endogenous antigen sequestered in the cytoplasm or endoplasmic reticulum of the antigen presenting cells. J. Immunol. 150 :3690. 13. Brown, L. R., Dreizen, S., Daly, T. E., Drane, J. B., Handler, S., Riggan, L. J., and Johnston, D. A. 1978. Interrelations of oral microorganisms, immunoglobulins, and dental caries following ra diotherapy. J. Dent. Res. 57:882-893. 14. Caplen, N. J., Gao, X., Hayes, P., Elaswarapu, R., Fisher, G.,Kinrade, E., Chakera, A., Schorr, J., Hughes, B., Dorin, J. R., Porteous, D. J., Alton, E. W. F. W., Geddes, D. M., Coutelle, C., Williamson, R., Huang, L., and Gilchrist, C. 1994. Gene therapy for cystic fibrosis in humans by liposomemediated DNA transfer: The production of resources and the re gulatory process. Gene. Ther. 1:139-147.

PAGE 116

104 15. Clarke, J.K 1924. On the bacterial factor in the aetiology of dental caries. Brit. J. Exp. Pathol. 5:141-147. 16. Cohen, D., Orr, N., Haim, M., Ashkenazi, S., Robin, G., Green, M. S., Ephros, M., Sela, T., Slepon, R., Ashkenazi, I., Tayl or, D. N., Svennerholm, A.-M., Eldad, A., and Shemer, J. 2000. Safety and Immunogenicity of Two Different Lots of the Oral, Killed Enterotoxigenic Escherichia coli -Cholera Toxin B Subunit Vaccine in Israeli Young Adults. Infect. Immun. 68:4492-4497. 17. Coykendall A. L 1971. Genetic heterogeneity in Streptococcus mutans J. Bacteriol. 106 :192-196. 18. Coykendall A. L. 1983. Streptococcus sobrinus nom. Rev. and Streptoccus ferus nom. Rev: habitat of these and other mutans streptococci. Int. J. Syst. Bacteriol. 33:883885. 19. Crowley, P. J., Brady, L. J., Piacen tini, D. A., Bleiweis, A. S. 1993. Identification of a salivary agglutinin-binding domain within cell surface adhesion P1 of Streptococcus mutans. Infect. Immun. 61:1547-1552. 20. Curzon, M. E. J. and Preston, A. J. 2004. Risk groups: Nursing bottle caries/Caries in elde rly. Caries. Res. 38:24-33. 21. DAO, M. L 1985. An improved method of antigen detection on nitrocellulose: In situ staining of alkaline phos phatase conjugated antibody. J. Immunol. Methods. 82:225-231. 22. Dao, M. L., Ferretti, J. J. 1985. Streptococcus-Escherichia coli shuttle vector pSA3 and its use in the cloning of Stre ptococcal genes. Appl. Env. Micro. 49:115-119.

PAGE 117

105 23. Dao, M. L., Chavez, C., Hirachi, Y., and Ferretti, J. J. 1989. Molecular cloning of the 24. Streptococcus mutans gene specifying antigen A. Infect. Immun. 57: 33723376. 24. Davis H. L. 1997. Plasmid DNA expression systems for the purpose of immunization. Curr. Opin. Biotechnol. 8(5) :635-646. 25. De Magistris, M. T., Pizza, M., Douce, G., Ghiara, P., Dougan, G., and Rappuoli, R. 1998. Adjuvant effect of non-toxic mutants of E. coli heat-labile enterotoxin following intranasal, oral and intravag inal immunization. Dev. Biol. Stand. 92:123-6. 26. Doolan, D. L. and Hoffman, S. L. 2001. DNA-based vaccines against malaria: status and promise of the multi-stage malaria DNA vaccine operation. Intl. J. Parasit. 31: 753-762. 27. Donnelly, J. J., Ulmer, J. B., Liu, M. A. 1997. DNA vaccines. Life. Sci. 60: 163172. 28. Douglas, C. W. and R. R. B. Russell. 1984. Effect of specific antisera upon Streptococcus mutans adherence to saliva-coated hydroxyapa tite. FEMS Microbiol. Lett. 25: 211-214. 29. D'Souza, S., Rosseels, V., Denis, O., Tanghe, A., De Smet, N., Jurion, F., Palfliet, K., Castiglioni, N, Vanonckelen, A., Wheeler, C., and Huygen, K. 2002. Improved tuberculosis DNA vaccines by formulation in cationic lipids. Infect Immun. 70(7) :36813688. 30. Ferretti, J. J., Russell, R. R., and Dao, M. L. 1989. Sequence analysis of the wallassociated protein precursor of Streptococcus mutans antigen A. Mol. Microbiol. 3:469478.

PAGE 118

106 31. Fischer, D., Barret, C., Bryson, K., Elofsso n, A., Godzik, A., Jones, D., Karplus, K. J., Kelley, L. A., Maccallum, R. M., Pawo wski, K., Rost, B., Rychlewski, L. and Sternberg, M. J. 1999. CAFASP-1: Critical Assessment of Fully Automated Structure Prediction Methods. Proteins: St ructure, Function and Genetics, Suppl 3 :209-217. 32. Fontana, M,. Dunipace A. J., Stookey, G. K., and Gregory, R. L. 1999. Intranasal immunization agains t dental caries with a Streptococcus mutans-enriched fimbrial preparation. Clin. Diagn. Lab. Immunol. 6:405-409. 33. Forester, H., Hunter, N., and Knox, K. W. 1983. Characteristics of a high molecular weight extracellular protein of Streptococcus mutans J. Gen. Microbiol. 129:2779-2788. 34. Friedman, M. G., Entin, N ., Zedaka, R., and Dagan, R. 1996. Subclasses of IgA antibodies in serum and saliva samples of newborns and infants immunized against rotavirus. Clinical & Experimental Immunology. 103:206-211. 35. Gupta, R., Birch, H., Rapacki, K., Brunak S., and Hansen J. E. 1999. OGLYCBASE version 4.0: a revi sed database of O-glycosylat ed proteins. Nucleic Acids Res. 27(1) :370-372. 36. Gurunathan, S., Klinman, D. M., and Seder, R. A. 2000. DNA Vaccines : Immunology, Application, and Optimiza tion. Annual Review of Immunology. 18 :927-974. 37. Hajishengallis, G. and Michalek, S. M. 1999. Current status of mucosal vaccine against dental caries. Or al Microbiol. Immunol. 14:1-20.

PAGE 119

107 38. Hajishengallis, G., Russell M. W., and Michalek, S. M. 1998. Comparison of an adherence domain and a structural region of Streptococcus mutans antigen I/II in protective immunity against dent al caries in rats after intr anasal immunization. Infect. Immun. 66:1740-1743. 39. Hanlon, L. and Argyle, D. J. 2001. The science of DNA vaccination. Infect. Dis. Rev. 3(1) :2-12. 40. Hansen, J. E., Lund, O., Rapacki, K., and Brunak, S. 1997. O-glycbase version 2.0 a revised database of O-glycosylat ed proteins. Nucleic Acids Research. 25:278-282. 41. Hansen, J. E., Lund, O, Tolstrup, N., Gooley, A. A., Williams, K. L., and Brunak, S. 1998. NetOglyc: prediction of mucin type O-glycosylation sites based on sequence context and surface accessibilit y. Glycoconjugate Journal. 15 :115-130. 42. Hatta, H., Tsuda, K., Ozeki, M., Kim, M., Yamamoto, T., Otake, S., Hirasawa, M., Katz, J., Childers, N. K., Michalek, S. M. 1997. Passive immunization against dental plaque formation in humans: eff ect of a mouth rins e containing egg yolk antibodies (IgY) specific to Streptococcus mutans Caries Res. 31(4) :268-274 43. Hirko, A., Tang, F., and Hughes, J. A. 2003 Cationic Lipid Vectors for Plasmid DNA Delivery Current Medicinal Chemistry, 10:1185-1193. 44. Honda, O., Kato C., and Kuramitsu, H. K. 1990. Nucleotide sequence of the Streptococcus mutans gtf D gene encoding the glucosyltr ansferase-S enzyme. J. Gen. Microbiol. 136:2099-2105. 45. Hopp, T. P. and Wood, K. R. 1981. Prediction of Protein Antigenic Determinants from Amino Acid Sequences. Proc. Natl. Acad. Sci. USA 78, 3824-3828.

PAGE 120

108 46. Hughes, M., Machardy, S. M., Sheppard, A. J., and Woods, N. C. 1980. Evidence for an immunologica l relationship between Streptococcus mutans and human cardiac tissue. Infect. Immun. 27:576-588. 47. Hughes, M., MacHardy, S., Sheppard, A., Langford, D., and Shepherd W. 1986. Experiences in the development of a dental caries vaccine. In Menaker L., Hamada S., Kiyono H., Michalek S.M., McGhee J.R. (eds). Molecular microbiology and immunology of Streptococcus mutans. pp. 349-357. Amsterdam: Elsevier Science Publishers. 48. Ishioka, G. Y., Lamont, A. G., Thomson, D., Bulbow, N., Gaeta, F. C., Sette, A., and Grey, H. M. 1992. J. Immunol. 148:2446-2451. 49. Isner, J. M., Walsh, K., Symes, J., Piecz ek, A., Takeshita, S., Lowry, J., Rossow, S., Rosenfield, K., Weir, L., Brogi, E., and Schainfeld, R. 1995. Arterial gene therapy for therapeutic angiogenesis in patients with peripheral artery disease. Circulation. 91:2687-2692. 50. Jenkins, N., Parekh, R. B., and James, D. C. 1996. Getting the glycosylation right: implications for the biotechnology industry. Nature Biotechnology. 14:975-981. 51. Jespersgaard, C., Hajishenga llis, G., Huang, Y., Russell, M. W., Smith, D. J., and Michalek, S. M. 1999. Protective immunity against Streptcoccus mutans infection in mice after intranasal immunization with the glucan-binding region of S. mutans glucosyltransferase. Infect. Immun. 67:6543-6549. 52. Johansson, E. L., Wassen, L., Holmgren, J., Jertborn, M., and Rudin, A. 2001. Nasal and vaginal vaccinations have differen tial effects on antibody responses in vaginal and cervical secretions in humans. Infect. Immun. 69:7481-7486.

PAGE 121

109 53. Kaste L., Selwitz, R., Oldakowski, R., Brunelle, J., Winn, D., and Brown, L. 1996. Coronal caries in the primary and perm anent dentition of children and adolescents 1-17 years of age: United States, 1988-1991. J. Dent. Res. 75:631-41. 54. Katz, J., Harmon, C. C., Buckner, G. P., Richardson, G. J., Russell, M. W., and Michalek, S. M. 1993. Protective salivary imm unoglobulin A responses against Streptococcus mutans infection after intranasal immuniza tion with S. mutans antigen I/II coupled to the B subunit of c holera toxin. Infect. Immun. 61 :1964-1971. 55. Kelly, C., Evans, P., Bergmeier, L., Lee S.F., Progulske-Fox A, Harris A.C., Aitken A, Bleiweis A.S., and Lehner T. 1989. Sequence analysis of the cloned streptococcal cell surface an tigen I/II. FEBS Lett. 258:127-132. 56. Kelley, L. A,, MacCallum, R. M., and Sternberg, M. J. E. 2000. Enhanced Genome Annotation using Structural Profiles in the Program 3D-PSSM. J. Mol. Biol. 299(2) :499-520. 57. Klavinskis, L.S., Barnfield, C., Gao, L., and Parker, S. 1999. Intranasal immunization with plasmid DNA-lip id complexes elicits mucosal immunity in the female genital and rectal tracts. J. Immunol. 162: 254-262. 58. Klalvinskis, L. S., Gao, L., Barnfield, C., Lehner, T., and Parker, S. 1997. Mucosal immunization with DNA-lipos ome complexes. Vaccine. 15: 818-820. 59. Koga, T., Yamashita, Y., Nakano, Y., Kawa saki, M., Oho, T., Yu, H., Nakai, M. and Okahashi, N. 1995. Surface proteins of Streptococcus mutans. Dev. Biol. Stand. 85:363-36. 60. Kolaskar, A. S. and Tongaonkar, P. 1990. A semi-empirical method for prediction of antigenic determinants on pr otein antigens, FEBS Letters. 276:172-174.

PAGE 122

110 61. Kowalczyk, D. W. and Ertl, H. C. J. 1999. Immune responses to DNA vaccines. CMLS. Cell. Mol. Life. Sci. 55:751-770. 62. Kozak M. 1986. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell. 44 :283-292. 63. Kuramitsu, H. K. 1993. Virulence factors of mutans streptococci: role of molecular genetics. Crit. Rev. Oral. Biol. Med. 1993. 4(2) :159-176. 64. Kutzler, M. A. and Weiner, D. B. 2004. Developing DNA vaccines that call to dendritic cells. J. Clin. Invest. 114(9) :1334-1342. 65. Lam, A., Smith, D., Barnes, L., Clements, J. D., Wise, D., and Taubman, M. A. 2001. Alternative routes for dental car ies vaccine delivery. J. Dent. Res. 80:124-132. 66. Ledwith, B. J., Manam, S., Troilo, P. J., Barnum, A. B., Pauley, C. J., Griffiths, T. G., Harper, L. B., Schock, H. B., Zhang, H., Faris, J. E., Way, P. A., Beare, C. M., Bagdon, W. J., and Nichols, W. W. 2000. Plasmid DNA vaccines: assay for integration into host genomic DNA. Dev. Biol. 104:33-43. 67. Lehner, T., Caldwell, J., and Smith, R. 1985. Local passive immunization by monoclonal antibodies against streptococcal an tigen I/II in the prevention of dental caries. Infect Immun 1985 50 :796. 68. Lehner, T., Ma, J. K., Munro, G., Walker, P., Childerstone, A., and Todryk, S. 1994. T-cell and B-cell epitope mapping and co nstruction of peptide vaccines. In: Molecular pathogenesis of peri odontal disease. Genco RJ, Hamada S, Lehner T, McGhee JR, Mergenhagen S, editors. Washington, DC: ASM Press, pp. 279-292.

PAGE 123

111 69. Lehner, T., Russell, M.W., Caldwell, J., and Smith, R. 1981. Immunization with purified protein antigens from Streptococcus mutans against dental caries in rhesus monkeys. Infect. Immun. 3:407-415. 70. Letvin, N. L., Montefiori, D. C., Yasu tomi, Y., Perry, H. C., Davies, M. E., Lekutis, C., Alroy, M., Freed, D. L, Lord, C.I., Handt, L. K., Liu, M. A., and Shiver, J. W. 1997. Potent, protective anti-HIV immune responses generated by bimodal HIV envelope DNA plus protein vaccina tion. Proc. Natl. Acad. Sci. USA. 94:9378-83. 71. Lewis, D. W. and Ismail, A.I. 1995. Periodic health examinatin, 1995 update 2: Prevention of dental caries. Can. Med. Assoc. J. 152:836-846. 72. Lo Conte, L., Brenner, S. E., Hubbard, T.J.P., Chothia, C., and Murzin, A. 2002. SCOP database in 2002: refinement s accommodate structural genomics. Nucl. Acid Res. 30(1) :264-267 73. Loesche, W. J. 1986. Role of Streptococcus mutans in human dental decay. Microbiol.. Rev. 50:353-380. 74. Lundholm, P., Asakura, Y., Hinkula, J., Lucht, E., and Wahren B. 1999. Induction of mucosal IgA by a novel jet delive ry technique for HIV-1 DNA. Vaccine. 17:2036-2042. 75. Ma, J.K-C., Himat, B. Y., Wycoff, K., Vine, N. D., Chargelegue, D., Yu, L., Hein, M. B., and Lehner, T. 1998. Characterization of a r ecombinant plant monoclonal secretory antibody and preventative immunot herapy in humans. Nature Medicine. 4:601606.

PAGE 124

112 76. Ma, J. K.-C. and Lehner, T 1990. Prevention of colonization of Streptococcus mutans by topical application of monoclonal antibodies in human s ubjects. Archives of Oral Biology. 35:115S-122S. 77. Ma, Y., lassiter, M. O., Banas, J. A., Galp erin, M. Y., Taylor, K. G., Doyle, R. J., 1998. Multiple glucan-binding proteins of Streptococcus sobrinus. J. Bacteriol. 1996. 178(6) :1572-7. 78. MacGregor, R. R., Boyer, J. D., Ugen, K. E., Lacy, K. E., Gluckman, S. J., Bagarazzi, M. L., Chattergoon M. A., Baine, Y., Higgins, T. J., Ciccarelli, R. B., Coney, L. R., Ginsberg, R. S., Weiner, D. B. 1998. First human trial of a DNA-based vaccine for treatment of human immunodeficiency virus type I infection: safety and host response. J. Infect. Dis. 178(1) :92-100. 79. Mandel I. D. 1993. Caries prevention a continuing need. Int. Dent. J. 43: 67-70. 80. Marchler-Bauer, A., Anderson, J. B., DeW eese-Scott, C., Fedorova, N. D., Geer, L. Y., He, S., Hurwitz, D. I., Jackson, J. D ., Jacobs, A. R., Lanczycki, C. J., Liebert, C. A., Liu, C., Madej, T., Marchler, G. H., Mazumder, R., Nikolskaya, A. N., Panchenko, A. R., Rao, B. S., Shoemaker, B. A., Simonyan, V., Song, J. S., Thiessen, P. A., Vasudevan, S., Wang, Y., Yamash ita, R. A., Yin, J. J., Bryant, S. H. 2003. CDD: a curated Entrez database of conserved domain alignments. Nucleic Acids Res. 31:383-7. 81. McCluskie, M.. and Davis, H.L. 1999. Mucosal immunization with DNA vaccines. Microbes and Infection. 1:685-698. 82. McDonnell, W.M., Askari, F.K. 1996. DNA vaccines. N. Engl. Med. 334:42-47.

PAGE 125

113 83. McGhee, J.R., Mestechy, J., Dertzbaugh, M.T., Eldridge, J.H. The mucosal immune system: from fundamental concepts to vaccine development. 1992. Vaccine. 10:75-88. 84. Mestecky, J. 1993. Saliva as a manifestation of the common mucosal system. Annals. of the New York Acad. of Sci. 694:184-194. 85. Mooser, G. and Wong, C. 1988. Isolation of a glucan-binding domain of glucosyltransferase (1,6-al pha-glucan synthase) from Streptococcus sobrinus Infect. Immun. 56 (4) :880. 86. Munro, C., Michalek, S. M., and Macrina, F. L. 1991. Cariogenicity of Streptococcus mutans V403 glucosyltransferase and fructosyltransferase mutans constructed by allelic exch ange. Infect. Immun. 59:2316-2323. 87. Nakai, M., Okhashi, N., Ohta, H., and Koga, T. 1993. Saliva-binding region of Streptococcus mutans surface protein antige n. Infect. Immun. 61:433-4349. 88. Nichols, W. W., Ledwith, B. J., Manam, S. V., and Trolio, P. J. 1995. Potential DNA vaccine integration into host genome. Ann. NY. Acad. Sci. 772:30-39. 89. Ochiya, T., Takahama, Y., Baba-Toriyam a, H., Tsukamoto, M., Yasuda, Y., Kikuchi, H., and Terada, M. 1999. Evaluation of cationic liposome suitable for transfer into pregnant animals. Biochem. Biophys. Res. Commun. 258:328-365. 90. Ogra, P. L., Faden, H., and Welliver, R. C. 2001. Vaccination strategies for mucosal immune responses. C linical Microbiology Reviews. 14(2) :430-445.

PAGE 126

114 91. Oho, T., Shimazaki, Y., Mitoma, M., Yo shimura, M., Yamashita, Y., Okano, K., Nakano, Y., Kawagoe, H., Fukuyama, M., Fujihara, N., and Koga, T. 1999. Bovine milk antibodies against cell surface protein an tigen Pac-glucosyltransferase fusion protein suppress cell adhesion and a lter glucan synthesis of Streptococcus mutans J. Nutr. 129:1836-1841. 92. Okada, E., Sasaki, S., Ishii, N., Aoki, I ., Yasuda, T., Nichioka, K., Fukushima, J., Miyazaki, J-I, Wahren, B., and Okuda, K. 1997. Intranasal immunization of a DNA vaccine with IL-12 and granulocyte-macropha ge colony-stimulating factor (GM-CSF)expressing plasmids in liposomes induces strong mucosal and cell-mediated immune responses against HIV-1 an tigens. J. Immunol. 159:3638-3647. 93. Okahashi, N., Sasakawa, C., Yoshikawa, M., Hamada, S., and Koga T. 1989. Cloning of a surface protein anti gen gene from serotype c Streptococcus mutans Mol. Microbiol. 3: 221-228. 94. Olson, G. A., Bleiweis, A. S., and Small, P. A. 1972. Adherence inhibition of Streptococcus mutans : an assay reflecting a possible ro le of antibody in dental caries prophylaxis. Infect. Immun. 5:419-427. 95. Pardoll, D. M. and Beckerleg, A. M. 1995. Exposing the immunology of naked DNAvaccines. Immunity. 3(2) :165-169. 96. Parker, J. M. R., Guo, D., and Hodges, R. S. 1986. New hydrophilicity scale derived from high-performance liquid chro matography retention data: correlation of predicted surface residues with antigenic ity and X-ray derived accessible sites. Biochemistry. 25:5425-5432.

PAGE 127

115 97. Perch, B., Kjems, E., and Ravan, T. 1974. Biochemical and serological properties of Streptococcus mutans from various human and animal sources. Acta. Pathol. Microbiol. Scand. B. 82:357-370. 98. Perrie, Y., Frederik, P. M., and Gregoriadis, G. 2001. Liposome-mediated DNA vaccination: The effect of ve sicle composition. Vaccine. 19 :3301-3310. 99. Pieters, J. 1997. MHC class II restricted antigen presentation. Curr. Opin. Immunol. 9: 89-96. 100. Pucci, M. J., Jones, K. R., Kuramits u, H. K., and Macrina, F. L. 1987. Molecular cloning and characterization of the glucosyltransferase C gene ( gtf C) from Streptococcus mutans LM7. Infect. Immun. 55:2176-2182. 101. Qian, H. and Dao, M. L. 1993. Inactivation of the Streptoccus mutans wallassociated protein A gene ( wap A) results in a decrease in sucrose-dependent adherence and aggregation. Infect. Immun. 61 :5021-5028. 102. Ramsay, A. J. and Kohonen-Corish, M. 1993. Interleukin-5 expressed by a recombinant virus vector enhances specific mucosal IgA responses in vivo. Eur. J. Immunol. 23:3141-3145. 103. Ramsay, A., Ramshaw, I. A., and Ada, G. L. 1997. DNA Immunization. Immunol. Cell. Biol. 75(4) :360-363. 104. Raz, E., Tighe, H., Sat o, Y., Corr, M., Dudler, J. A., and Roman, M. 1996. Preferential induction of a T h1 immune response and inhib ition of specific IgE antibody formation by plasmid DNA immunization. Proc. Natl. Acad. Sci. USA. 93(10) :5141-5. 105. Reyes-Sandoval, A. and Ertl, H. C. 2001. DNA vaccines. Curr. Mol. Med. 1(2) : 217-243.

PAGE 128

116 106. Robinson, H. L. and Torres, C. A. 1997. DNA vaccines. Seminars in Immunology. 9:271-283. 107. Robinson, H. L., Montefiori, D. C., Johns on, R. P., Manson, K. H., Kalish, M. L., Lifson, J. D., Rizvi, T. A., Lu S, Hu S. L., Mazzara, G. P., Panicali, D. L., Herndon, J. G., Glickman, R., Candido, M. A., Lydy, S. L., Wyand, M. S., and McClure, H. M. 1999. Neutralizing antibody independent containment of immunodeficiency virus challenges by DNA pr iming and recombinan t pox virus booster immunizations. Nat. Med. 5:526-534. 108. Rugg-gunn, A. 2001. Preventing the preventable the enigma of dental caries. Br. Dent. J. 191:478-488. 109. Russell, M. W. and Mansson-Rahemtulla, B. 1989. Interaction between surface protein antigens of Streptococcus mutans and human salivary components. Oral. Microbiol. Immunol. 4:106-111. 110. Russell, R. R. B. 1979. Wall-associated antigens of Streptococcus mutans J. Gen. Microbiol. 112 :197-201. 111. Russell, R. R. B., Beighton, D., and Cohen, B. 1982. Immunization of monkeys ( Macaca fascicularis ) with antigens purified from Streptocuccus mutans Br. Dent. 152:81-84. 112. Russell, R. R. B., Colman, D., and Dougan, G. 1985. Expression of a gene for glucan-binding proteins from Streptococcus mutans in Escherichia coli J. Gen. Microbiol. 131:295-299.

PAGE 129

113. Russell, M. W., Harrington, D. J., and Russell, R. R. B. 1995. Identity of Streptococcus mutans surface protein antigen III and wall-associated protein antigen A. Infect. Immun. 63:733-735. 114. San, H., Yang, Z.-Y., Pompili, V. J., Jaffe, M. L., Plautz, G. E., Xu, L., Felgner, J. H., Wheeler, C. J., Felgner, P., Gao, X., Huang, L., Gordon, D., Nabel, G. J., and Nabel, E. G. 1993. Safety and short-term toxicity of a novel cationic lipid formulation for human gene therapy. Human Gene Therapy. 4:781-788. 115. Sant, A. J. 1994. Endogenous antigen presentation by MHC class II molecules. Immunol. Res. 13:253-267. 116. Sato Y., Yamamoto Y., and Harutoshi K. 1997. Cloning and sequence aalysis of the GbpC gene encoding a novel glucan-binding protein of Streptococcus mutans. Infect. Immun. 65:668-675. 117. Schodel, F., Aguado, M. T.. and Lambert, P. H. 1994. Introduction: nucleic acid vaccines, WHO, Geneva. Vaccine. 12:1491-1492. 118. Shiroza, T., Ueda, S., and Kuramitsu, H. K. 1987. Sequence analysis of the gtfB gene froom Streptococcus mutans. J. Bacteriol. 169:4263-4270. 119. Shiver, J. W., Davies, M-E., Perry, H. C., Freed, D. C., and Liu, M. A. 1996 Humoral and cellular immunities elicited by HIV-1 DNA vaccination J. Pharm. Sci. 85 : 1317 1324. 120. Simmonds, R. S., Tompkins, G. R., and George, R. J. 2000. Dental caries and the microbial ecology of dental plaque: a review of recent advances. NZ. Dent. J. 96:44-49. 117

PAGE 130

118 121. Singh, H. and Raghava, G.P.S. 2001. Propred: Prediction of HLA-DR binding sites. Bioinformatics. 17(12) :1236-1237. 122. Smidth, D. J. 2002. Dental caries vaccines: pr ospects and concerns. Crit. Rev. Oral. Biol. Med. 13(4) :335-349. 123. Smith, D. J., Akita, H., Kin g, W. F., and Taubman, M. A. 1994. Purification and antigenicity of a novel glucan-binding protein of Streptococcus mutans Infect. Immun. 62:2545-2552. 124. Smith, D. J., King, W. F., and Godiska, R. 2001. Passive Transfer of Immunoglobulin Y Antibody to Streptococcus mutans Glucan Binding Protein B Can Confer Protection against Expe rimental Dental Caries. 69 :3135-3142. 125. Smith, D. J., King, W. F., Wu, C. D., Shen, B. I., and Taubman, M. A. 1998. Structural and antigenic characteristics of Streptococcus sobrinus glucan-binding proteins. Infect. Immun. 66(11) :5565-5569. 126. Smith, D. J. and Taubman, M. A. 1997. Vaccines for dental caries. In: New generation vaccines. Levi ne MM, Woodrow GC, Kaper JB, Gobon GS, editors. New York: Marcel Dekker Inc., pp. 913-930. 127. Smith, D. J., Taubman M. A., and Ebersole, J. L. 1979. Effect of oral administration of glucosyltransferase antigen s on experimental dental caries. Infect. Immun. 26: 82-89. 128. Spak, C. J., Johnson, G., and Ekstrand, J. 1994. Caries incidence, salivary flow rate and efficacy of fluoride gel treatment in irradiated patients. Caries Res. 28:388-393. 129. Srivastava, I. K. and Liu, M. A. 2003. Gene Vaccines. Anals. of Internal Medicine. 138 : 550-559.

PAGE 131

119 130. Strugnell, R. A., Drew, D., Mercieca, J., DiNatale, S., Firez, N., Dunstan, S. J., Simmons, C. P., and Vadolas, J. 1997. DNA vaccines for bacterial infections. Immunol. Cell Biol. 75(4) :364-9. 131. Takahashi, I., Okahashi, N., Matsushita, K., Tokuda, M., Kanamoto, T., and Munekata, E 1991. Immunogenicity and protective effect against oral colonization by Streptococcus mutans of synthetic peptides of a stre ptococcal surface protein antigen. J. Immunol. 146:332. 132. Taubman, M. A., Holmberg, C. J., and Smith, D. J. 1995. Immunization of rats with synthetic peptide construc ts from the glucan-binding or catalytic region of mutans streptococcal glucosyltransf erase protects against dental caries. Infect. Immun. 63:30883093. 133. Taubman, M. A., Holmberg, C. J., and Smith D. J. 2001. Diepitopic construct of functionally and epitopically complementary peptides enhances immunogenicity, reactivity with glucosyltransferase, and protection from dental carie s. Infect. Immun. 69:4210-4216. 134. Van Ginkel, F. W., Nguyen, H. H., and McGhee, J. R. 2000. Vaccines for mucosal immunity to combat emerging inf ectious diseases. Emerging Infectious Diseases. 6(2) :123-132. 135. Van Houte, J. 1994. Role of microorganisms in caries etiology. J.Dent. Res. 73:672-681. 136. Weiner, D. B. and Kennedy, R. C. 1999. Genetic vaccines. Sci. Am. 281:50-57. 137. Welling, G. W., Wiejer, W. J., Van der Zee, R., and Welling-Webster, S. (1985). Prediction of sequential antigenic re gions in proteins. FEBS. Letters, 188:215-218.

PAGE 132

120 138. Whiley, R. A., Russell, R. R. B., Hardie, J. M., and Beighton, D. 1988. Streptococcus downei sp. nov. for strains prev iously described as Streptococcus mutans serotype h. Int. J. Syst. Bacteriol. 38 :25-29. 139. Whittle, B. L., Smith, R. M., Matthaei, K. I., Young, I. G., and Verma, N. K. 1997. Enhancement of the specific mucosa l IgA response in vivo by interleukin-5 expressed by an attenuated strain of Salmone lla serotype Dublin. J Med Microbiol. 46:1029-1038. 140. Winn, D. M., Brunelle, J. A., Runelle, J. A., Selwitz, R. H., and Kaste, L. M. 1996. Coronal and root caries in the dentiti on of adults in the United States, 1988-1991. J. Dent. Res. 75:642-51. 141. Wolff, J. A., Ludtke, J. J., Acsadi, G., Williams, P., and Jani, A. 1992. Longterm persistence of plasmid DNA and foreign gene expression in mouse muscle. Hum. Mol. Gene. 1(6) :363-369. 142. Wu, H. and Russell, M. W. 1993. Induction of mucosal immunity by intranasal application of a surface prot ein with the cholera toxin B subunit. Infect. Immun. 61:314322. 143. Xiang, Z. Q., Spitalnik, S. L., Cheng., Erik son, J., Wojczyk, B., and Ertl, H. C. J. 1995. Immune responses to nucleic acid vaccines to rabies virus. Virology. 209 :569579. 144. Yamashita, Y., Bowen, W. H., Burne, R. A., and Kuramitsu, H. K. 1993. Role of Streptococcus mutans gtf genes in caries induction in the specific-pathogen-free rat model. Infect. Immun. 61 :3811-3817.

PAGE 133

121 145. Yasuda, Y., Matano, K., Asai, T., and Tochikubo, K. 1998. Affinity purification of recombinant cholera toxin B subunit oligomer expressed in Bacillus brevis for potential human use as a mucosal ad juvant. FEMS Immunology and Medical Microbiology. 20:311-318. 146. Yoder, S., Cao, C., Ugen, K. E., and Dao, M. L. 2000. High-level expression of a truncated wall-associated protein A from the dental cariogenic Streptococcus mutans DNA and Cell Biology. 19(7) :401-408.

PAGE 134

About the Author Thomas Han received his bachelors degree in genetics from Iowa State University, and a masters degree in immunology from Louisiana Tech University. During his doctoral studies at the University of South Florida, he was awarded The THARP Fellowships for 3 consecutive years. He was also selected to receive The Outstanding Poster Presentation Award at the First Annual USF Graduate Student Research conference. He was a recipient of the 2005 Corporate Activities ASM Student Travel Grant Award. He was a primary author of four published articles in various scientific journals. He made several research presentations at national and regional scientific meetings. He is one of inventor on pending patent vaccine application. His research data was used to secure funding of Innovative Grants from NIH.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001681160
003 fts
005 20060215104648.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 051012s2005 flu sbm s000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001068
035
SFE0001068
040
FHM
c FHM
090
2005
1 100
Han, Thomas.
0 245
Development of a dna vaccine against _streptococcus mutans_
h [electronic resource] :
b a novel approach to immunization against dental caries /
by Thomas Han.
260
[Tampa, Fla.] :
University of South Florida,
2005.
502
Thesis (Ph.D.)--University of South Florida, 2005.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 134 pages.
520
ABSTRACT: Streptococcus mutans is the main causative agent of dental caries, which is a widespread infectious disease. A number of surface molecules are involved in the pathogenicity of this organism, including adherence and aggregation factors. The wall-associated protein A (WapA) of Streptococcus mutans GS-5 was previously demonstrated to be a sucrose-dependent adherence and aggregation factor, and is a larger precursor to extracellular antigen A (AgA), a candidate antigen for a dental caries vaccine.The full-length wapA gene and a C-terminal truncated version agA encoding the AgA were cloned into the mammalian expression vector pcDNA 3.1/V5/His-TOPO. The above constructs were mixed with a cationic lipid and used to transfect Chinese hamster ovary (CHO) cells. Transient expression of the wapA and agA genes was observed at 24 h post-transfection, as shown by Western immunoblot analysis.In CHO, cells WapA containing the membrane and wall-spanning region was found in apoptotic bodies, whereas the soluble AgA, which lacked the hydrophobic region, was found in extracellular medium. A higher salivary IgA level was observed in mice immunized with the pcDNA-wapA vaccine as compared to those immunized with the pcDNA-agA vaccine. Furthermore, the anti-WapA antibody inhibited S. mutans sucrose-dependent adherence, suggesting potential protection of the tooth against S. mutans colonization, while anti-AgA had no significant effect. Indeed, prediction and analysis of protein epitopes showed that WapA contains highly promiscuous MHC-II binding motifs that are absent from AgA. Immunodot assay confirmed that WapA bound biotin-labeled dextran, whereas AgA did not.
590
Adviser: My Lien Dao.
Co-adviser:
653
Mutans streptococcus.
Prime-boost.
Saliva.
Secretory iga.
Wapa.
690
Dissertations, Academic
z USF
x Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1068