USF Libraries
USF Digital Collections

Cloning, expression, and sequence analysis of camelysin, a zinc metalloprotease from bacillus anthracis and b. cereus

MISSING IMAGE

Material Information

Title:
Cloning, expression, and sequence analysis of camelysin, a zinc metalloprotease from bacillus anthracis and b. cereus
Physical Description:
Book
Language:
English
Creator:
Myers, Andrew Ross
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
Metalloenzyme
Collagen
Pathogenic factor
Recombinant protein
Nosocomial infections
Dissertations, Academic -- Biology -- Doctoral -- USF   ( lcsh )
Genre:
government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Bacillus anthracis and B. cereus are well known etiological agents, which cause disease in healthy and immunocompromised individuals. Considering the abundance and lethality of these organisms it is imperative that research is performed to identify and analyze new factors that may contribute to their pathogenicity. Camelysin is a membrane bound, zinc metalloprotease isolated from B. cereus. Assays performed on purified camelysin demonstrate that the protease exhibits fibrinolytic, collagenolytic, and actin degradation activity, any of which can contribute to the organisms ability to invade host tissues and cause damage. Considering the putative role of camelysin in pathogenicity, it would be beneficial to study the effects of camelysin in tissue cultures or animal models. The goal of this study focused on the cloning and expression of camelysin from B. cereus and its homolog in B. anthracis.Expression of a fusion tagged protein may assist in the purification of camelysin as well as overcoming the native proteins extreme insolubility. Primers were designed to amplify the camelysin gene from B. cereus for cloning into the prokaryotic pBAD TOPOregistered trademark TA, pET100/D-TOPOregistered trademark, and the eukaryotic pcDNA3.1/V5-Hiscopyright TOPOregistered trademark TA expression vectors. Primers were also designed to amplify the gene from B. anthracis for cloning into the pBAD TOPOregistered trademark TA vector. The recombinant clones were induced and successful expression of the protein was confirmed by performing SDS-PAGE, Western blotting, and an azocasein protease assay. The recombinant proteins exhibited casein degradation activity which is observed with purified camelysin from B. cereus. This study successfully demonstrated the presence of the camelysin protein in B. anthracis.
Thesis:
Thesis (M.S.)--University of South Florida, 2005.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Andrew Ross Myers.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 72 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001670354
oclc - 62293904
usfldc doi - E14-SFE0001218
usfldc handle - e14.1218
System ID:
SFS0025539:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Cloning, Expression, and Sequence Analysis of Camelysin, a Zinc Metalloprotease from Bacillus anthracis and B. cereus by Andrew Ross Myers A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science Department of Biology College of Arts and Sciences University of South Florida Major Professor: My Lien Dao, Ph.D. Steven Grossman, Ph.D. Brian Livingston, Ph.D. Date of Approval: July 18, 2005 Keywords: metalloenzyme, collagen, pathogenic factor, recombinant protein, nosocomial infections Copyright 2005, Andrew Ross Myers

PAGE 2

AKNOWLEDGEMENTS I would like to express my sincere gratitude to my major professor, Dr. My Lien Dao, for her encouragement, guidance, and her expertise during both my undergraduate and graduate careers. While in her lab I have gained valuable management, research, and teaching experience because of her strong dedication to her students. I would also like to thank my committee members, Dr. Steven Grossman and Dr. Brian Livingston for their valuable advice and patience. Of course I cannot forget about the great friendships that were formed with my fellow lab occupants. I would like to thank Marios Ioannides, Valerie Carson, Thomas Han, and Justin Federico for their help, positive attitudes, wonderful personalities, and willingness to work toget her, which helped to make our lab a great place to work in. I would also like to thank Chi Zhang, Hong Yang, and Wenli Li for their advice, technical assistance, and friendliness. I would like to thank my parents, grandparents, my brother, and my sister for their confidence, financial support, and for being there when I needed them the most. Over the past seven years I have maintained my close family ties, gained many friends, and sadly some have passed on. There are no words to describe how lucky I am to have such a great family and the best group of friends anyone could ever ask for, thank you for your love and support.

PAGE 3

i TABLE OF CONTENTS LIST OF FIGURES iv LIST OF TABLES vi ABSTRACT vii INTRODUCTION 1 MATERIALS AND METHODS 10 Chemicals and Reagents 10 Bioinformatics Analysis 10 Bacterial Strains, Eukaryotic Cells, and Growth Conditions 11 Genomic DNA Isolation 12 PCR Amplification 13 Ligation into Expression Vectors and Cloning 14 Plasmid Isolation and Analysis of Recombinant Clones 16 Transfection and Expression of BCcalYpcDNA in HeLa Cells 17 Expression of BAcalY -pBAD and BCcalY -pBAD in E. coli TOP 10 Cells 18 Expression of BCcalY -pET100D in E. coli BL21 (DE3) pLysS Cells 19 SDS-PAGE 19 Western Blotting Analysis 20 Azocasein Assay 20

PAGE 4

ii Beta Galactosidase Control Assay 21 RESULTS 23 PCR Amplification of the Camelysin Gene from B. cereus and Cloning into pcDNA3.1/V5-His TOPO TA 23 Confirmation of the Construction of BCcalYpcDNA 26 Transfection into HeLa Cells and Expression of BCcalYpcDNA 28 Beta Galactosidase Assay after Expression of the pcDNA3.1/V5-HisTOPO/ lac Z Product 28 PCR Amplification of the Camelysin Gene from B. anthracis and B. cereus for Cloning into pBAD TOPO TA 29 Confirmation of the Construction of BAcalY -pBAD and BCcalY -pBAD 31 Expression of BAcalY -pBAD and BCcalY -pBAD in E. coli TOP10 Cells 33 Analysis of Gene Expression by SDS-PAGE 34 PCR Amplification of the Camelysin Gene and Cloning into pET100/D-TOPO 35 Confirmation of the Construction of BCcalY -pET100D 37 Transformation and Expression of BCcalY -pET100D in E. coli BL21 (DE3) pLysS cells 39 Analysis of Gene Expression by SDS-PAGE 40 Western Blotting Analysis of BAcalY -pBAD, BCcalY -pBAD, and BCcalY -pET100D 40 Analysis of Enzymatic Activity by Azocasein Assay 41 Sequence Analysis of calY in B. anthracis and B. cereus ATCC 14579 42 Prediction of the Putative Signal Peptide of Camelysin from B. anthracis and B. cereus ATCC 14579 using Neural Network and Hidden Markov Models 45

PAGE 5

iii Secondary Structure Prediction of Camelysin from B. anthracis and B. cereus ATCC 14579 48 DISCUSSION 51 REFERENCES 58

PAGE 6

vi LIST OF TABLES Table 1 Conditions used for PCR Amplification 14 Table 2 Primers used for PCR Amplification of the Camelysin Gene and for Confirmation of Successful Ligations 24

PAGE 7

iv LIST OF FIGURES Figure 1 PCR amplification of the camelysin gene of B. cereus for cloning into pcDNA3.1/V5-His TOPO TA 25 Figure 2 Map of the mammalian expression vector pcDNA3.1/V5-His TOPO TA containing calY 25 Figure 3 Insertion of the camelysin gene into pcDNA3.1/V5-His TOPO TA 27 Figure 4 Restriction enzyme analysis of BCcalYpcDNA 27 Figure 5 IPTG assay of the expression product obtained from pcDNA3.1/V5-His-TOPO/ lac Z 29 Figure 6 PCR amplification of the camelysin gene of B. anthracis and B. cereus for cloning into pBAD TOPO TA 30 Figure 7 Map of the prokaryotic expression vector pBAD TOPO TA containing calY 31 Figure 8 Insertion of the camelysin gene into pBAD TOPO TA 32 Figure 9 SDS-PAGE analysis of the expressed protein from BAcalY -pBAD 34 Figure 10 SDS-PAGE analysis of the expressed protein from BAcalY -pBAD 34 Figure 11 PCR amplification of the camelysin gene from B. cereus for cloning into pET100/D-TOPO 36 Figure 12 Map of the prokaryotic expression vector pET100/D-TOPO containing calY 36 Figure 13 Insertion of the camelysin gene into pET100/D-TOPO 37 Figure 14 SDS-PAGE analysis of the expressed protein from BCcalY -pET100D 40

PAGE 8

v Figure 15 Western blotting analysis of BAcalY -pBAD, BCcalY -pBAD, and BCcalY -pET100D 41 Figure 16 Degradation of azocasein by camelysin 42 Figure 17 Multiple sequence alignment of the amino acid residues for camelysin from B. anthracis and B. cereus 43 Figure 18 Multiple sequence alignment of the nucleotide residues for camelysin from B. anthracis and B. cereus 44 Figure 19 SignalP 3.0’s neural network model prediction of the camelysin protein’s signal peptide 46 Figure 20 SignalP 3.0’s hidden Markov model prediction of the camelysin protein’s signal peptide 47 Figure 21 Secondary structure comparison between camelysin from B. cereus and B. anthracis 48 Figure 22 Secondary structure prediction of camelysin from B. anthracis using PSIPRED 49 Figure 23 Secondary structure prediction of camelysin from B. cereus using PSIPRED 50

PAGE 9

vii Cloning, Expression, and Sequence Analysis of Camelysin, a Zinc Metalloprotease from Bacillus anthracis and B. cereus Andrew Ross Myers ABSTRACT Bacillus anthracis and B. cereus are well known etiological agents, which cause disease in healthy and immunocompromised individuals. Considering the abundance and lethality of these organisms it is imperative that research is performed to identify and analyze new factors that may contribute to their pathogenicity. Camelysin is a membrane bound, zinc metalloprotease isolated from B. cereus Assays performed on purified camelysin demonstrate that the protease exhibits fibrinolytic, collagenolytic and actin degradation activity, any of which can contribute to the organism’s ability to invade host tissues and cause damage. Considering the putative role of camelysin in pathogenicity, it would be beneficial to study the effects of camelysin in tissue cultures or animal models. The goal of this study focused on the cloning and expression of camelysin from B. cereus and its homolog in B. anthracis Expression of a fusion tagged protein may assist in the purification of camelysin as well as overcoming the native protein’s extreme insolubility. Primers were designed to amplify the camelysin gene from B. cereus for cloning into the prokaryotic pBAD TOPO TA, pET100/D-TOPO, and the eukaryotic pcDNA3.1/V5-His TOPO TA expression

PAGE 10

viii vectors. Primers were also designed to amplify the gene from B. anthracis for cloning into the pBAD TOPO TA vector. The recombinant clones were induced and successful expression of the protein was confirmed by performing SDSPAGE, Western blotting, and an azocasein protease assay. The recombinant proteins exhibited casein degradation activity which is observed with purified camelysin from B. cereus This study successfully demonstrated the presence of the camelysin protein in B. anthracis Furthermore, the recombinant clones obtained will be useful for purification and analysis of camelysin and delineation of its role in the pathogenicity of B. cereus and B. anthracis

PAGE 11

1 INTRODUCTION Bacillus anthracis and Bacillus cereus are known pathogens, which have various effects on the human body. Both healthy and immunocompromised individuals can become infected with these organisms and both B. anthracis and B. cereus contain many similar virulence factors (20). There have been numerous studies performed which have identified the main factors of pathogenicity in these organisms, and most have resulted in therapeutic treatments against these commonly known factors. Most of these treatments however are ineffective by the time physicians identify the presence of these pathogens, due to the fact that some are often considered clinical laboratory contaminants (10, 31). However, to this date there have been no recent studies aimed at identifying any new pathogenicity factors in these organisms that could be of therapeutic value. This study focused on the identification and expression of a zinc metalloprotease, camelysin, in B. cereus ATCC 14579 and B. anthracis which share many common factors of pathogenicity (15). B. anthracis B. cereus and B. thuringiensis are all Gram positive, rod shaped, spore forming, facultative aerobes, and most have plasmids that encode toxins. They are commonly found in the soil, and all are classified as group I bacilli, which contains most of the bacilli that cause infection, and all three organisms are indistinguishable from each other based on 16srRNA analysis (10,

PAGE 12

2 20, 31, 36, 38). All three have plasmids, some encoding toxins like the pXO1 found in B. anthracis and pBc10987 of B. cereus which is homologous to the pXO1 plasmid, but lacks the genes produci ng the lethal and edema toxins (38). The spore forms of these organisms are resistant to heat, gamma radiation, and even hospital based antimicrobial handwashes and disinfectants (22, 10). B. anthracis and B. cereus mainly affect humans, while B. thuringiensis affects insects. Due to this fact, our study concentrated on the screening and identification of the camelysin gene from B. anthracis and B. cereus ATCC 14579. The ten main infections resulting from B. cereus include local infections of burns or trauma, septicemia and bacterem ia, meningitis, respiratory infections, endocarditis, urinary tract infections, skin infection, eye infections, osteomyelitis, and food poisoning (10, 22, 23). B. cereus mainly causes gastrointestinal distress resulting from contaminated food, but is also know to cause nongastrointestinal disease in immunocompromised people such as individuals with AIDS, newborns, people recovering from su rgery, and IV drug users (10, 22). The main drug users affected by B. cereus infections are those who are heroin addicts, not just because the needles may become contaminated with pathogens, but due to the fact that B. cereus often is found as a contaminate of heroin (22). The most prevalent infection associated with B. cereus is a result of ingestion of contaminated foods such as rice, pasta, and dairy products (22). There are two types of food poisoning that affect humans: the emetic food

PAGE 13

3 poisoning, and the diarrheal food poisoning. The diarrheal food poisoning is caused by the HBL and NHE enterotoxin complexes, which induce the following symptoms: abdominal pain, cramps, rarely a fever, occasional vomiting, and diarrhea which last for 1 to 2 days (10, 22). Vomiting usually starts 10 hours after ingestion since the toxin can be preformed (10). This type of food poisoning is similar to that of Clostridium perfringens which may lead to misdiagnosis of B. cereus infections. The emetic food poisoning is caused by the heat resistant toxin, cereulide, which is a type of hemolysin (22). Symptoms of the emetic food poisoning appear similar to the food poisoning of Staphylococcus aureus and include nausea, vomiting, and occasional diarrhea (10, 22). Since the toxin is always preformed it can cause symptoms in as little as 15 minutes. Since the gastrointestinal infections are the most common result of a B. cereus infection, physicians tend to overlook cases in which B. cereus is the source of the infection. This stems from the fact that B. cereus infections are not routinely screened for in some countries because they are not listed as reportable illnesses (22). This is a strange fact, especially since B. cereus is commonly found in the hospital environment, sometimes causing nosocomial infections (2, 5, 19, 27). One patient undergoing neurosurgery developed meningitis due to linens contaminated with B. cereus (22). Another example included the misdiagnosis of B. cereus infections in two people in Louisiana (31). The first patient exhibited symptoms of pneumonia 5 days before admission into the hospital, where he was diagnosed with a lung tumor and died that same day.

PAGE 14

4 The second patient was admitted to the hospital after 3 days of symptoms, was diagnosed with tuberculosis and died 3 days later. Both were given antibiotics that should have treated the infection, however they received them too late, sepsis overtook their bodies and was late r determined to be the cause of death in both individuals (31). This is why it is important that studies be continued on B. cereus that focus on identification of new virulence factors and faster methods to detect the pathogen. B. anthracis mainly infects the respiratory tract of individuals although rare cases of gastrointestinal infections have been reported. The main factors contributing to the virulence of B. anthracis include a toxin complex, the ability of the organism to form spores that are eas ily aerosolized, as well as a capsule that is present in its virulent form which may help the organism evade the immune system (29, 34, 38). B. anthracis has two large plasmids (pXO1 and pXO2) that encodes for proteins that must be present for the organism to be fully virulent (1). pXO1 is the plasmid that contains the genes for the toxin complex. The toxin complex is made up of the edema factor, lethal factor, and protective antigen encoded by cya, lef, and pagA respectively (38). The protective antigen is a major component of the cell free vaccines on the market that are for human use (1). pXO1 is 182 kb and the pathogenicity island which contains cya, lef, and pagA is only 44.8 kb in size, the island is surrounded by two IS1627 elements thus suggesting that it may be mobile (38). Plasmid pXO2 contains the gene that encodes for the Poly-d-glutamic acid capsul e that aids in antiphagocytic activity (34). Although treatments and a vaccine are available for this organism, they are

PAGE 15

5 not as effective as treatments for simple infections such as gastroenteritis. More work needs to be done to identify new virulence factors, and this study will encompass the use of B. anthracis since sequence information has identified a putative camelysin gene in its genome. Camelysin is a membrane bound neutral zinc metalloprotease with a molecular mass of approximately 19 kDa and is found in an uncharacterized strain of B. cereus while in the logarithmic phase of growth (15, 16, 24). The camelysin protein also known as casein cleaving metalloprotease, has been studied and characterized within the last ten years. Recent studies have outlined camelysin as a possible pathogenicity factor as it has fibrinolytic, collagenolytic, and actin degradation ac tivity (15). These activities may contribute to the ability of B. cereus or any other organisms that contain the camelysin protein to invade host tissues and cause damage. Proteases are divided into two major groups; those that cleave peptide chains at the ends, and those that cleave the peptide chains towards the middle, these are exopeptidases and endopeptidases respectively (37). Next the proteases are further classified by the residues that are at their active site into serine, aspartic, cysteine, and metallo-proteases. Metalloproteases usually require divalent metal ions for activity (37). Zinc pept idases consist of 30 families and are divided into 5 major clans (25, 37). The H EXXH motif is typically found in zinc metalloproteases at the zinc-binding region and is usually contained in an alpha helical region of the protein (26).

PAGE 16

6 The first studies on camelysin were focused on establishing a number of general characteristics. The molecular weight was determined first by SDSPAGE and then by mass spectrometry. SDS-PAGE performed (under reducing conditions, beta-mercaptoethanol) showed two bands, one at 58 kDa and the other at 64 kDa (13). Under non-reducing conditions the protease exhibits selfaggregation on the top part of the gel (13, 15). Even after boiling for several minutes with SDS, the protease was able to form aggregates. This selfaggregation is possibly caused by the oligomerization of the protease, which may explain the different molecular mass obtained by mass spectrometry (indicated MW= 19 kDa) as compared to SDS-PAGE. Purified camelysin is shown to have the characteristics of an endopeptidase, which is a protease that cleaves towards the middle of the proteins, and may be involved in several pathogenicity pathways (37). Camelysin is able to cleave collagen type I, the most abundant collagen type that is found in skin, bones, and tendons (15). The protease cleaved the heterotrimer (collagen) in a similar manner to other bacterial collagenases (15). Other studies have found unidentified collagenases presen t during the log phase of growth on the outer membrane of B. cereus that may be responsible for binding to host cells. There is another hypothetical collagenase that may play a role in the degradation of collagen, which protects the lens capsule of the eye (2). B. cereus is known to cause ocular infections (endophthalmitis) by interacting with other pathogenicity factors which may play a role in these infections (15).

PAGE 17

7 Camelysin has also been shown to activate plasminogen to plasmin and also destroys 2-antiplasmin. 2-antiplasmin keeps plasmin from degrading fibrin clots by forming a complex with it, and inactivating it (15). Cleavage of actin is also catalyzed by camelysin, and this could be a possible mechanism associated with the diarrheal effects of the organism (15). Other zinc metalloproteases of different organisms have been shown to cause damage to cellular structures (7). One example is from Vibrio vulnificus, which has a protease that destroys collagen type IV, which results in the breakdown and collapse of capillary vessels (32). The destruction is due to the fact that the basal membranes surrounding the capillaries are made of collagen and laminin and once these are digested the capillaries have no structure holding them together, resulting in collapse and hemorrhaging. Venom from certain snakes may also contain zinc metalloproteas es that act in the same fashion. In multiple sclerosis patients, zinc dependant matrix metalloproteases cause the breakdown of connective tissue; under normal circumstances the collagen is resistant to proteases because of its supe rcoiled triple helices and this is not the case in MS patients (4). In some people with cancer, the concentration of matrix metalloproteases is higher in patients who are sick as compared to those who are healthy. In certain cancers the concentration of matrix metalloproteases is increased during the beginning stages of metastasis and matrix metalloprotease inhibitors are used to prevent metastasis from occurring (11, 40). Zinc metalloproteases do not always cause damage: some actually are involved in the formation of bone tissue and a variety of other useful biological materials (18).

PAGE 18

8 When it came to the purification of camelysin, solubilizat ion of the active protein was difficult. Several non-ionic detergents were experimented with (Triton X-100, Brij 35, and Octylthiogluc oside) and none were able to solubilize the protein in its active form (13). Later, Fricke et al. (13, 15) experimented with Sulfobetain SB-12 and it successfully solubiliz ed the protein in its active form. This detergent was used to form a stable complex with the protein so it remained stable outside of the cell membrane and it also protected the hydrophobic ends from hydrophilic environments. Protease activity remained for several days without the addition of phospholipids when stored at 4 C. The mechanism of the protein removal involved the detergent replacing the phospholipids molecules in the cell membrane when the detergent was in high concentration. Decreasing the detergent concentration resulted in increased activity of the protease, which shows that the absence of the phospholipids did not have an inactivating effect. Due to the high hydrophobicity of the protein, purification of the solubilizate is difficult. Mixed mi celles form during purification between phospholipids and different membrane proteins as well as between different membrane proteins and the detergent (15). The detergent is also known to cause problems column matrix, thus it must be removed or diluted before addition to the columns (13). Conventional techniques for purification such as hydrophobic interaction chromatography (Butyl sepharose and Phenyl sepharose), chromatofocusing ( PBE 94), and most forms of ion exchange chromatography cannot be used due to the hydrophobicity of the aggregated protease (15). However, in one study, ion exchange chromatography using EMD

PAGE 19

9 TMAE Fractogel resulted in the partial purification of the protein (13). The only way to elute the protein from the column matrix involved the use of high concentrations of isopropanol. Subsequent studies showed that the polar solvents caused denaturation and inactivation of camelysin. In the latest study the purified protein was obtained using a Butyl Toyopearl column without any major loss in enzyme activity, and the usage of polar solvents was omitted (15). In Grass et al., 2004, the molecular characteristics of the camelysin gene and protein were studied. Inverse PCR allowed the cloning of the gene and a gene knockout demonstrated that it was indeed camelysin that caused the protease activity in B. cereus (16). The studies also revealed that camelysin lacked the HEXXH motif commonly fo und in zinc metalloproteases and it had no conserved domains like most proteins, t hus making it very unique. Our study will focus on the identification of the secondary structure of camelysin using the sequence information obtained from Dr. Grass and will be used to clone the gene into various expression vectors. Once a suitable vector system is identified, Dr. Grass will perform mutational studies to identif y this rare zinc binding motif. This study will also identify whether or not the camelysin gene is present in B. anthracis and if so, further experiments will allow us to look at its possible role in the pathogenicity of these organisms.

PAGE 20

10 MATERIALS AND METHODS Chemicals and Reagents The Wizard Genomic DNA Purification Kit, restriction enzymes, and the PCR reagents were purchased from Promega Inc. (Madison, WI) and were used according to the manufacturer’s protocols. PCR primers were synthesized by Operon Biotechnologies (Huntsville, AL). PfuTurbo DNA polymerase was purchased from Stratagene Inc. (La Jolla, CA). The expression vectors pBAD TOPO TA, pcDNA3.1/V5-His TOPO TA, and pET100/D-TOPO were obtained from Invitrogen Life Technologies (Carlsbad, CA). All other chemicals and reagents were purchased from Fisher Sci entific (Pittsburg, PA), Sigma-Aldrich Co. (St. Louis, MO), or Bio-Rad Laboratories (Hercules, CA) unless otherwise noted. Bioinformatics Analysis The DNA sequence for the camelysin gene in B. anthracis Ames Strain and B. cereus ATCC 14579 were obtained from the National Center for Biotechnology Information (NCBI) Entrez server. Multiple sequence analysis was performed using the GAP alignment tool from the GCG Wisconsin Package software (Accelrys Inc., San Diego, CA) using nucleotide, amino acid, and

PAGE 21

11 secondary structure sequences. Predictions of the signal peptides were obtained from the SignalP 3.0 server (3). Secondary structure predictions were obtained using PSIPRED Protein Structure Prediction Server (21, 28). Bacterial Strains, Eukaryotic Cells, and Growth Conditions B. cereus ATCC 14579 was obtained from Dr. Daniel Lim (University of South Florida Biology Department, Tampa, FL) and cultured at 37C in brain heart infusion broth (Difco, Detroit, MI). HeLa cells (CCL-2) were obtained from ATCC (Manassas, VA) for eukaryotic expression and were cultured in EMEM supplemented with 10% FBS at 37C in 5% CO2. Chemically competent Escherichia coli TOP10 cells were purchased from Invitrogen and used for the cloning of all constructs, and the expression of BAcalY -pBAD and BCcalY -pBAD. E. coli BL21 Star™ (DE3)pLysS cells were purchased and used for the cloning and expression of BCcalY -pET100D. Luria-Bertani (LB) broth (Difco, Detroit, MI) supplemented with 100 g/mL ampicillin (LB-AMP) was used for culturing and expression of camelysin in the TOP10 and BL21 transformants. Conditions for expressing the pBAD and pET constructs included growth in LB-AMP broth at 30C, while conditions for mammalian cells remained the same except for the absence of 10% FBS for four and a half hours during the transfection.

PAGE 22

12 Genomic DNA Isolation Genomic DNA was isolated using the Promega Wizard genomic DNA purification kit. A 10mL overnight culture was grown in LB broth in a shaking incubator at 37C. 1mL of the culture was removed and centrifuged at 16,000 X g for 2 minutes. The cell pellet was resuspended in 480 L of 50mM EDTA and 60 L of a 10mg/mL solution of lysozyme, which was incubated at 37C for 45 minutes. The sample was centrifuged at 16,000 X g for 2 minutes and 600 L of Nuclei Lysis Solution was added to resuspend the cells. To continue the cell lysis, the sample was incubated at 80C for 5 minutes. The samples were then incubated at 37C for 45 minutes with 3 L of RNase Solution to remove any RNA present in the samples. After cooling to room temperature, 200 L of Protein Precipitation Solution was added to the sample, which was then placed on ice for 5 minutes to aid in the precipitation. The sample was then centrifuged at 16,000 X g for 3 minutes and the supernatant containing the DNA was transferred to a fresh tube that contained 600 L of isopropanol to precipitate the DNA. The DNA was pelleted by centrifugation at 16,000 X g for 2 minutes. Next, the supernatant was removed and 600 L of 70% ethanol was added to rinse the pellet. The sample containing the purified DNA was then centrifuged for another 2 minutes at 16,000 x g. The supernatant was removed and the pellet was allowed to air dry, after which 100 L DNA Rehydration Solution was added. The resulting DNA

PAGE 23

13 was analyzed on a 1% agarose gel for quality control, and the concentration and purity of the DNA was determined using the SmartSpec Plus Spectrophotometer (Bio-Rad). PCR Amplification PCR was performed on the genomic DNA for identification and cloning of the camelysin gene. The PCR products for the pBAD TOPO TA vector were amplified using the Expand Long Template PCR System (Roche Applied Science, Indianapolis, IN), in which each reaction contained 3 units of Taq and Tgo polymerases, 200 M of dNTP’s, 250ng of genomic DNA, 50 L of Buffer 3, and 0.4 M of each primer were used (Table 2). PCR products for the pcDNA3.1 TOPO TA vector were amplified using the PCR Mastermix (Promega) which contains a Taq polymerase with terminal transferase activity that adds adenosine residues onto the amplification product. For this amplification 0.625 units of Taq polymerase, 200 M of dNTP’s, 137ng of genomic DNA, and 0.4 M of each primer were used. The PCR products for the pET100/D-TOPO were amplified using the PfuTurbo DNA polymerase (Stratagene), which resulted in blunt ended PCR products. For this amplification, 2.5 units of PfuTurbo DNA polymerase, 200 M of dNTP’s, 100ng of genomic DNA, 0.4 M of each primer (Table 2), and 1x PCR reaction buffer (Stratagene) were used. The conditions of each PCR reaction are described in Table 1.

PAGE 24

14 Table 1. Conditions used for PCR Amplification of camelysin from B. anthracis and B. cereus Primer Pair PCR Conditions B. anthracis DNA: pBAD calY forward, pBAD calY reverse 95C for 2 minutes (Initial Denaturation) 95C for 30 seconds (Denaturation) 55C for 30 seconds (Annealing) 68C for 1 minute (Extension) Repeated 25 times 68C for 7 minutes (Final Extension) B. cereus DNA: pBAD calY forward, pBAD calY reverse 95C for 2 minutes (Initial Denaturation) 95C for 30 seconds (Denaturation) 55C for 30 seconds (Annealing) 68C for 1 minute (Extension) Repeated 25 times 68C for 7 minutes (Final Extension) B. cereus DNA: pcDNA calY forward, pcDNA calY reverse 96C for 2 minutes (Initial Denaturation) 96C for 30 seconds (Denaturation) 56C for 30 seconds (Annealing) 72C for 1 minute (Extension) Repeated 26 times 72C for 15 minutes (Final Extension) B. cereus DNA: pET calY forward, pET calY reverse 95C for 2 minutes (Initial Denaturation) 95C for 30 seconds (Denaturation) 53C for 30 seconds (Annealing) 72C for 1 minute (Extension) Repeated 26 times 72C for 10 minutes (Final Extension) Ligation into Expression Vectors and Cloning The PCR products amplified using the Promega Taq polymerase, and the Roche Tgo and Taq polymerases were ligated into the pcDNA3.1 TOPO TA and pBAD TOPO TA vectors respectively. Briefly, 2 L of the PCR products were added to 2 L of water, and 1 L of the appropriate linearized vector. The ligation reaction was incubated at room temperature for 5 minutes and placed on ice. Transformation was completed by taking 2 L of the ligation products and adding

PAGE 25

15 them to E. coli TOP10 cells, which were incubated on ice for 15 minutes. Next, the cells were heat shocked for 30 seconds in a 42C water bath and 250 L of S.O.C. medium (Invitrogen) was added, followed by incubation at 37C for one hour in a shaking incubator. LB-AMP plates were inoculated with 20 L and 40 L volumes of each transformation reaction and incubated overnight at 37C. Individual colonies were removed and screened for BAcalY -pBAD, BCcalY pBAD, or BCcalY -pcDNA using PCR amplification with primers (Table 2) specific for either the native plasmid or the inserted camelysin gene. Restriction enzyme digestion of BCcalY -pcDNA was also carried out using 25 units of Bst X I per 1 g of plasmid DNA and results were observed on an agarose gel. The PCR products amplified using the PfuTurbo polymerase were ligated into the pET100/D-TOPO vector. The PCR product was diluted 1:25 in nuclease free water and 3 L of this product was added to 1 L of dilute salt solution, 1 L of water, and 1 L of linearized vector. Both the ligation reaction and transformation into E. coli TOP10 cells were carried out according to the protocols listed above. Two different sets of PCR primers (Table 2) were used to identify colonies containing BCcalY -pET100D. Sequencing analysis of each recombinant plasmid was performed at SeqWright DNA Technology Services (Houston, TX) using a forward primer (Table 2) specific for the vector, and a reverse primer specific for the inserted camelysin gene.

PAGE 26

16 Plasmid Isolation and Analysis of Recombinant Clones Plasmid isolation was performed using the FastPlasmid™ Mini kit from Eppendorf (Westbury, NY). E. coli TOP10 cells containing the recombinant plasmids were grown in LB-AMP for 15 hours in a shaking incubator at 37C to an OD600 of 2.4. 1.5 L of each culture was removed and were centrifuged at 15,000 x g for 1 minute. The supernatant was removed and 400 L of the lysis solution, containing RNase A and lysozyme was added to the pellet. The pellet was resuspended by vortexing on high speed for approximately 30 seconds, followed by a 3 minute incubation at room temperature. The lysate was then transferred to a spin column assembly which was then centrifuged for 1 minute at 15,000 x g. The remaining plasmid DNA contained in the spin column matrix was washed with 400 L of diluted wash buffer and centrifuged for another minute. Filtrate remaining in the bottom of tube was removed and the spin column assembly was centrifuged fo r 1 minute to remove any excess isopropanol that was introduced with the washing buffer. Next, the spin column was placed into a collection tube and the DNA was eluted by adding 50 L of buffer containing 10mM Tris-HCl / 0.1mM EDTA, pH 8.5 followed by centrifugation at 15,000 x g for 1 minute. Plasmid DNA used for transfections was prepared using the Qiagen Plasmid Midi kit according to the manufacturer’s protocol.

PAGE 27

17 Transfection and Expression of BCcalY -pcDNA in HeLa cells Transient transfections were perfo rmed using the following constructs; BCcalY -pcDNA (pcDNA3.1 with the camelysin gene), calY -pcDNA(-) (pcDNA3.1 without any insert), and pcDNA3.1/V5-His-TOPO/lacZ (pcDNA3.1 that contained the -galactosidase control). A negative control designated HeLa1 (HeLa cells with no vector) underwent the same treatments as transfected cells to make sure the lipid had no toxic effects on the cells. Prior to transfection the HeLa cells were plated in a 12-well plate at a cell density of approximately 7.8 x 104 cells per well and were incubated overnight at 37C in 5% CO2 until mostly confluent (~90-100%). The following day, plasmid DNA obtained from the Midi preps was diluted at a ratio of 1.6 g of DNA per 100 L of Opti-MEM (Invitrogen) and the Lipofectamine™ 2000 (Invitrogen) reagent was diluted at a ratio of 4 L lipid per 100 L of Opti-MEM according to the manufacturer’s protocol. The diluted DNA/Lipid mixtures were combined and incubated at room temperature for 20 minutes. The growth medium was then removed and the entire plate was washed with PBS, t hen 1mL of EMEM without 10% FBS was added to each well. Next, 200 L DNA/Lipid mixture was added to each well and the plates were incubated for 4.5 hours at 37C in 5% CO2. The growth media then was removed and replaced with fresh EMEM containing 10% FBS and the transfection reaction was allowed to continue for 24 hours. The next day, the

PAGE 28

18 cells were detached from their respective plates using sterile cell scrapers and transferred to microcentrifuge tubes. After spinning down the cells, both the pellet and supernatant were frozen at -20C for western blotting analysis, SDSPAGE, and an azocasein enzyme assay. Expression of BAcalY -pBAD and BCcalY -pBAD and in E. coli TOP10 Cells The pBAD vector in TOP10 cells, containing either the camelysin gene from B. anthracis ( BAcalY -pBAD) or from B. cereus ( BCcalY -pBAD) were used to express the camelysin protease (35) One other construct designated calY pBAD(-) (pBAD with no insert) was also induced during the expression experiment, along with TOP10 cells containing no vector. All cultures were grown in 10mL of LB-AMP overnight at 37C in a shaking incubator. 7mL of the cultures containing BAcalY -pBAD and BCcalY -pBAD were added to 70mL of LBAMP, and 2mL of cultures containing calY -pBAD(-) and TOP10 cells were added to 20mL of LB-AMP. All cultures were grown for approximately 2 hours to an OD600 of ~0.75 and then induced with various concentrations of arabinose before a 4 hour incubation at 30C. At the end of the induction, 5 L of each sample was removed to obtain their respective OD600. Finally, the samples were centrifuged and the supernatant was transferred to a fresh tube, then both the supernatant and pellet from each culture were frozen at -20C for future analysis.

PAGE 29

19 Expression of BCcalY -pET100D in E. coli BL21 Star™ (DE3)pLysS Cells The pET vector containing the camelysin gene from B. cereus ( BCcalY pET100D) was obtained from the TOP10 cells using the plasmid miniprep kit as mentioned above. BL21 Star™ (DE3)pLysS cells were transformed with 10ng of BCcalY -pET100D in a volume of 3 L using the heat shock method described previously and the transformed bacteria, along with untransformed bacteria (as a negative control) were incubated in 10mL of LB-AMP overnight at 37C in a shaking incubator. Next, 20mL of LB-AMP was inoculated with 2mL of the overnight culture and was incubated under the same conditions as above for 1 hour and 20 minutes to an OD600 of 0.7. The cultures were then split into two tubes (10mL in each), one containing 1mM isopropyl -D thiogalactoside (IPTG), for induction of expression, and one without IPTG. At each hour, 500 L of each culture was removed. Once removed, the samples were centrifuged and the supernatant was transferred to a fresh tube, then both the supernatant and pellet from each culture was frozen at -20C for future analysis. SDS-PAGE The cell pellets were resuspended in 1X SDS-Page Sample Buffer (Invitrogen) and the mixture was boiled for 5 minutes. Next, 20 L of each sample was loaded into a 12% SDS-PAGE gel which underwent electrophoresis

PAGE 30

20 at 200V for 45 minutes using the Mini-Protean II Electrophoresis Cell (Bio-Rad). After the electrophoresis was complete, the gel was stained with 0.1% coomassie blue R-250 (in 40% MeOH / 10%HOAc) for 30 minutes. The gel was destained with several changes of 40% MeOH / 10%HOAc with a total incubation time of 2 hours. Western Blotting Analysis Following separation by SDS-PAGE, the proteins were transferred to a nitrocellulose membrane using a Mini Trans-Blot electrophoretic transfer cell (Bio-Rad) overnight at 30V/100mA. Next, the membrane was placed in a blocking solution (TBST with 5% dry milk) for 25 minutes. The primary antibody (rabbit-anticamelysin) was diluted 1:5,000 in 5mL of blocking solution and the membrane was incubated for 45 minutes at room temperature (14). The membrane was washed three times with 20mL of TBST (TBS with 0.05% Tween 20), 8 minute incubations were carried out for each wash. The secondary antibody, anti-rabbit IgG-Alkaline phosphatase (Sigma) was diluted 1:20,000 in blocking buffer and the washed membrane was incubated for 45 minutes, followed by three more washes in TBST. Next, the membrane was placed into 10mL of TBS (0.1M NaCl, 0.5M Tris, pH 7.4) for rinsing Azocasein Assay An azocasein assay was used to measure the proteolytic activity of the recombinant camelysin proteins using standard methods (30, 41). Equal

PAGE 31

21 volumes of the cell pellets were resuspended in 1mL of 50mM Tris-HCl, pH 7.4 using a pipet. After resuspension the cells were subjected to freezing and thawing in order to lyse the cells, alternating between a dry ice/ethanol bath and a 50C water bath. The lysate was then subjected to sonication at 100W, 4 times at 20 second intervals in an ice bath. Next, the lysate was centrifuged for 10 minutes at 12,000 x g and 4C for 10 minutes. The supernatant was removed and the pellets from each sample were resuspended in 400 L of 50mM Tris-HCl, pH 7.4. Then, 200 L of each sample were separately added to tubes containing 200 L of the azocasein substrate solution (5mg/mL azocasein resuspended in 50mM Tris-HCl, pH 7.4) and incubated at 37C for 16 hours. The proteolytic activity was stopped with the addition of 800 L of 10% trichloroacetic acid (TCA), which also precipitates any undigested azocasein. The samples were centrifuged at 12,000 x g for 4 minutes and 1mL of the supernatant was transferred to a cuvette. The samples were placed in a SmartSpec Plus spectrophotometer (Bio-Rad) and the OD365 for each sample was recorded. Beta Galactosidase Control Assay The HeLa cell pellets were washed twice with 1X PBS, pH 7.4 (Mg2+/Ca2+ free) and resuspended in TEN buffer (40mM Tris-HCl, pH 7.5, 1mM EDTA, pH 8.0, and 150mM NaCl). The cell suspension was centrifuged at 18,000 x g for 1 minute at 4C, resuspended in 0.25M Tris-HCl (pH 8.0), and subjected to 3 freeze thaw cycles by alternating between dry ice/ethanol and a 37C water bath. The lysate was then centrifuged at 18,000 x g for 2 minutes at 4C and the

PAGE 32

22 supernatant was assayed. A 96 well plate was loaded with 50 L samples from each transfection reaction, either diluted (1:10) or undiluted. Next, 50 L of assay buffer (200mM sodium phosphate buffer, pH 7.3, 2mM MgCl2, 100mM mercaptoethanol, 1.33mg/mL ONPG) was added to each well, mixed by pipetting, and incubated at 37C for 50 minutes. At the end of the incubation, the plate was visually observed for color change and 150 L of 1M sodium carbonate was added to each well to stop the reaction.

PAGE 33

23 RESULTS Amplification of calY by PCR and Cloning into the pcDNA3.1/V5-His TOPO TA Expression Vector Due to the fact the proteases mode of toxicity is not known, this study used the eukaryotic expression vector pc DNA3.1 first to examine if mammalian expression was possible, and secondly to observe any intracellular protease activity, like the lethal factor of B. anthracis After isolation of the genomic DNA from B. cereus camelysin gene ( calY ) was amplified by PCR. Primers were designed to amplify the 594 bp gene using the genomic DNA sequence of B. cereus ATCC 14579 obtained at the NCBI website, gene ID # 1203630 (Table 2). Due to the fact that pcDNA3.1/V5-His TOPO TA is a eukaryotic expression vector, the start codon (ATG) was incorporated into the forward primer. This allowed correct translational recognition by the mammalian cells ribosome’s (17). This vector also has a cytomegalovirus (CMV) promoter that allows for overexpression of proteins once transfe cted into mammalian cells. Agarose gel electrophoresis was performed and confirmed the successful amplification of calY (Figure 1). Next, calY was ligated into the pcDNA3.1/V5-His TOPO TA expression vector and was transformed into E. coli TOP10 cells. Ligation into TOPO TA vectors employs the use of deoxyadenosines left on the 3 ends of PCR products by Taq polymerase which allowed the amplified DNA to bind to the

PAGE 34

24 3 deoxythymidines located on the linearized vector. The vector is kept in a linearized form before the insertion of amplified DNA by topoisomerase I that cleaves one strand of the vectors DNA after the sequence 5 -CCCTT, which is located at the cloning site. The energy of this broken bond was conserved by a covalent bond between the 3 phosphate of the vector DNA and a tyrosyl residue of the topoisomerase I. The energy was released and the bond was broken when the newly inserted DNA was introduced at the cloning site, which in turn released the topoisomerase and allowed the formation of the double stranded recombinant vector (Figure 2). Table 2. PCR primers used for amplification of genomic DNA and confirmation of gene insertion. Primer name Primer sequence DNA amplified Vector used pBAD calY forward AGTCTGAAAAAGAAATTAGGTATGG GGAGT Genomic DNA from B. anthracis and B. cereus without the native GTG start codon. pBAD pcDNA calY forward ATGGTGAGTCTGAAAAAGAAATTAG GTTATGGGAGT Genomic DNA from B. cereus with ATG added for mammalian expression system. pcDNA3.1 pET calY forward CACCGTGAGTCTGAAAAAGAAATTA Genomic DNA from B. cereus containing CACC needed for insertion into vector. pET100/D pBAD forward ATGCCATAGCATTTTTATCC Vector DNA, used to confirm the insertion of calY pBAD T7 forward TAATACGACTCACTATAGGG Vector DNA, used to confirm the insertion of calY pcDNA3.1 & pET100/D Native calY reverse TTATTTTTCTTCCCCAGCTTCTTG Genomic DNA from B. cereus containing the native stop codon. pET100/D & pBAD pcDNA calY reverse TTATTTTTCTTCCCCAGCTTCTTGGT T Genomic DNA from B. cereus containing the native stop codon. pcDNA3.1 pBAD BAcalY reverse TTATTTTTCTTCTCCAGCTTCTTG Genomic DNA from B. anthracis containing the native stop codon. pBAD pBAD reverse GATTTAATCTGTATCAGG Vector DNA, used to confirm the insertion of cal Y. pBAD T7 reverse TAGTTATTGCTCAGCGGTGG Vector DNA, used to confirm the insertion of calY. pET100/D

PAGE 35

25 F igure 1. PCR amplification of the 594 bp camelysin gene (3 additional nucleotides for the mammalian start codon ATG) from B. cereus ATCC 14579 using primers pcDNA calY forward and pcDNA calY reverse. The 1% agarose gel confirms the presence of the 594 bp DNA fragment. Lane 1: 100 bp ladder and Lane 2: amplified calY from genomic DNA. Figure 2. Map of the mammalian expression vector pcDNA3.1/V5-His TOPO TA containing calY with the mammalian start codon ATG. The stop codon, TAA was used to end translation and allowed the overexpression of the native protein without any fusion tags. Ampicillin was used to screen for positive clones.

PAGE 36

26 Confirmation of the Successful Cloning into pcDNA3.1/V5-His TOPO TA Following the amplification and ligation of calY into the expression vector, the vector was used to transform E. coli TOP10 cells and was propagated. Plasmid DNA was then isolated from eight colonies and screened for correct insertion of calY into the vector by PCR analysis (Figure 3), restriction enzyme digestion with Bst X I (Figure 4), and then DNA sequencing. PCR amplification was carried out using 100ng of the calY -pcDNA as a template and the primers T7 forward / pcDNA calY reverse. The products were subjected to agarose gel electrophoresis and the 668 bp fragment confirmed that both the ligation into the vector and the insertion of calY in the correct orientation was successful. Restriction digestion was carried out on the recombinant plasmid and yielded two bands, the first representing the plasmid (6120 bp) and the second representing the insert with some excess vector nucleotides (638 bp), confirming the cloning was successful. DNA sequencing was performed at the H. Lee Moffitt Cancer Center’s Molecular Biology Core Facility. Once the sequence information was obtained a BLAST2seq (39) was performed against the original gene sequence from B. cereus ATCC 14579’s calY confirming no mutations were introduced during the cloning process.

PAGE 37

27 F igure 3. PCR amplification products on a 1% agarose gel used for identifying correct insertion of calY Lane 1: 100 bp ladder, Lane 2: 323 bp PCR control, and Lanes 3-10 are recombinant plasmid amplified using the primers T7 forward / pcDNA calY reverse to give the 668 bp product. This represented a 63% cloning efficiency. Figure 4. Restriction enzyme analysis on a 1% agarose gel using Bst X I after incubation at 50C. Lane 1: 100 bp ladder, Lane 2: Hind III ladder, Lane 3: 1hr incubation with Bst X I, Lane 4: 1hr incubation without Bst X I, Lane 5: 2hr incubation with Bst X I, Lane 6: 2hr incubation without Bst X I, Lane 7: 3hr incubation with Bst X I, Lane 8: 3hr incubation without Bst X I, Lane 9: 4hr incubation with Bst X I, Lane 10: 4hr incubation without Bst X I, Lane 11: 5hr incubation with Bst X I, Lane 12: 5 hr incubation without Bst X I. Uncut plasmid is 6120 bp in size, cut plasmid has two distinct bands, one 5482 bp and the other 638 bp.

PAGE 38

28 Transfection into HeLa cells and Expression of BCcalY -pcDNA After obtaining large amounts of the recombinant plasmid using a MidiPrep Kit, BCcalY -pcDNA (pcDNA3.1 with the camelysin gene), calY -pcDNA (-) (pcDNA3.1 without any insert), and pcDNA3.1/V5-His-TOPO/lacZ (pcDNA3.1 that contained the -galactosidase control) were transiently transfected into HeLa cells. The HeLa cells appeared to be confluent both before and after transfection in all cultures, as did a culture containing only HeLa cells that underwent the same lipid and medium treatments as transfected cells. SDS-PAGE was performed on each of the cell cultures and no differences in banding patterns were observed except for the 122 kDa band present for the -galactosidase control. Western blotting, an azocasein assay, and immunoblotting were also performed on each culture and all results were negative. To test the positive control for -galactosidase activity, a -galactosidase assay was performed and demonstrated that not only did the transfection work, but it also produced the active -galactosidase protein (Figure 5).

PAGE 39

29 F igure 5. -galactosidase Assay demonstrating the production of galactosidase. Well 1 (A,B,C): pcDNA3.1/V5-His-TOPO/lacZ, Well 2(A,B,C): pcDNA3.1/V5-His-TOPO/lacZ diluted 1:10, Well 3(A,B,C): calY -pcDNA (-), Well 4(A,B,C): calY -pcDNA (-) diluted 1:10, Well 5(A,B,C): BCcalY -pcDNA, Well 6(A,B,C): BCcalY -pcDNA diluted 1:10, Well 7(A,B,C): HeLa cells, Well 8(A,B,C): HeLa cells diluted 1:10. Amplification of calY by PCR and Cloning into the pBAD TOPO TA Expression Vector Genomic DNA containing the camelysin gene from both B. anthracis and B. cereus was amplified by PCR using the Expand Long Template PCR system for insertion into the pBAD TOPO TA vector (Figure 6) to examine if prokaryotic expression was possible without the generation of a fusio tagged protein. This system contains a mixture of two polymerases ( Taq and Tgo ) that gave a high yield of PCR product that was proofread via the Tgo polymerases 3-5 exonuclease activity. The pBAD vector is advantageous for use in expressing suspected toxic proteins as it contains the tightly regulated ara BAD promoter, which controls the level of protein expression. Another advantage to using this vector system is the fact that it contains a short N-terminal leader peptide, which improved translation of the protein and also increased its solubility (42). The vector also allows a V-5 epitope and a polyhistidine tag to be placed at the C-

PAGE 40

30 terminal end of a recombinant protein, which could prove useful for detecting a fusion protein. However, in this experiment the tags were left out since we already had the antibody for purified camelysin and the tags cannot be cleaved off once placed onto the native protein. The genomic DNA sequence for the B. anthracis camelysin gene was obtained from the NCBI website (39), protein ID # AAP25246.1. The start codon was removed from the forward primer since the vector contains its own initiation codon, and the stop codon was left to prevent formation of a fusion tagged protein. The PCR product was obtained and then ligated into the TA vector as previously described (Figure 7). Following ligation, E. coli TOP10 cells were transformed with the recombinant vector and grown in LB-AMP to propagate the plasmid. F igure 6. PCR amplification of calY from B. anthracis using primers pBAD calY forward / pBAD BAcalY reverse and from B. cereus using primers pBAD calY forward / Native calY reverse for cloning into pBAD TOPO TA. The 1% gel confirms the presence of the 591 bp camelysin gene (no start codon on primer). Lane 1: 1kb ladder, Lanes 2-3: B. anthracis calY and Lanes 4-5: B. cereus calY

PAGE 41

31 Figure 7. Map of the prokaryotic expression vector pBAD TOPO TA containing calY without its own start codon, GTG. The stop codon, TAA was used to end translation to allow expression of the native protein without any fusion tags. Ampicillin was used to screen for posi tive clones once transformed into E. coli TOP10 cells. Confirmation of the Successful Cloning into pBAD TOPO TA The products obtained by PCR amplification of calY from B. anthracis and B. cereus were ligated into the pBAD vector and used to transform TOP10 cells, recombinant plasmid was then isolated from five colonies using Mini-Preps. The recombinant plasmid was then screened for correct insertion of calY into the vector by PCR analysis (Figures 8Aand 8B), and DNA sequencing. PCR amplification was carried out using approximately 100ng of BAcalY -pBAD and BCcalY -pBAD as templates and the primers for both the camelysin gene and the vector. The products were subjected to agarose gel electrophoresis and the distinct bands at 594 bp and 773 bp confirmed that both the ligation into the vector and the insertion of calY in the correct orientation were successful.

PAGE 42

32 F igure 8A. PCR amplification products on a 1% agarose gel used for identifying the correct insertion of BAcalY and BCcalY into the pBAD vector. Lane 1: 1kb ladder, Lanes 2-6: PCR of BAcalY using pBAD calY forward / pBAD BAcalY reverse, Lane 7: Empty well, and Lanes 8-12: PCR of BAcalY using pBAD forward / pBAD BAcalY reverse. This represented a 60% cloning efficiency. Figure 8B. PCR amplification products on a 1% agarose gel used for identifying the correct insertion of BAcalY and BCcalY into the pBAD vector. Lane 1: 1kb ladder, Lanes 2-6: PCR of BCcalY using pBAD calY forward / Native calY reverse, Lane 7: 1kb ladder, Lane 8: Empty well, and Lanes 9-13: PCR of BCcalY using pBAD forward / Native calY reverse. This represented a 40% cloning efficiency.

PAGE 43

33 DNA sequencing was performed at SeqWright DNA Technologies (Houston, TX). Once the sequence information was obtained a BLAST2seq (39) was performed against the original gene sequences from both B. anthracis and B. cereus ATCC 14579’s calY confirming no mutations were introduced during the cloning process. Expression of BAcalYpBAD and BCcalYpBAD Expression of BAcalY -pBAD and BCcalY -pBAD was induced in E. coli TOP10 cells by using different concentrations of arabinose to identify the amount needed for successful expression of the protease. The induced culture was incubated at 30C in a shaking incubator for 4 hours. At the end of the 4 hours, the OD600 was recorded for each culture and the averages were 2.4 for BAcalY pBAD, 2.2 for BCcalY -pBAD, and 3.1 for E. coli TOP10 with no vector. The lower values for BAcalY -pBAD and BCcalY -pBAD indicate the possible presence of toxicity in the cells expressing camelysin. SDS-PAGE was performed on each of the samples and the 19 kDa mature camelysin protein was observed for both the B. anthracis and B. cereus constructs (Figures 9 and 10 respectively). The greatest amount of protein seemed to be produced when each induced sample had arabinose at a final concentration of 0.002%.

PAGE 44

34 F igure 9. Expression of calY from BAcalY-pBAD construct. Lane 1: MW marker, Lane 2: uninduced BAcalY-pBAD, Lanes 3-7: BAcalY-pBAD induced with 0.2%, 0.02%, 0.002%, 0.0002%, and 0.00002% arabinose respectively, Lane 8: pBAD vector with no insert induced with 0.2% arabinose, and Lane 9: E. coli TOP10 cells with no vector induced with 0.2% arabinose. The camelysin protein (~19 kDa) can be seen in lanes 3-7, however the strongest bands are in lanes 5 and 6. Figure 10. Expression of calY from BCcalY -pBAD construct. Expression of calY from BCcalY -pBAD construct. Lane 1: MW marker, Lane 2: empty well, Lane 3: uninduced BCcalY -pBAD, Lanes 4-8: BCcalY -pBAD induced with 0.2%, 0.02%, 0.002%, 0.0002%, and 0.00002% arabinose respectively, Lane 9: pBAD vector with no insert induced with 0.2% arabinose, and Lane 10: E. coli TOP10 cells with no vector induced with 0.2% arabinose. The camelysin protein (~19 kDa) can be seen in lanes 4-8, however the strongest bands are in lanes 6 and 7.

PAGE 45

35 Amplification of calY by PCR and Cloning into the pET100/D-TOPO Expression Vector DNA from B. cereus ATCC 14579 was amplified by PCR using the PfuTurbo DNA polymerase for integration into pET100/D-TOPO (Figure 11) to examine if the creation of a fusion tagged protein would effect expression levels of camelysin. The Pfu polymerase contains 3’-5’ ex onuclease activity much like the Tgo polymerase used for cloning into the pBAD system. However, the Pfu polymerase does not add any deoxyadenosin es onto the PCR product because it lacks this activity, which leaves the PCR products with blunt ends. Ligation of the PCR product into this TOPO vector required the sequence CACC to be added onto the forward primer of camelysin. The linearized vector contains a region complimentary to this sequence, thus allowing directional binding of the PCR product to the vector that is also in frame with the other genes on the vector. Primers were designed with the CACC located in the forward primer (pcDNA calY forward) without a stop codon following the sequence that allowed expression of a fusion protein containing the N-terminal polyhistidine tag and X™press epitope, while the reverse primer (Native calY reverse) contained camelysin’s native stop codon (Figure 12). Once the PCR product was obtained, it was ligated into the vector and transformed into E. coli TOP10 cells for propagation.

PAGE 46

36 Figure 11. PCR amplification of the 598 bp camelysin gene (4 additional nucleotides for the addition of CACC) from B. cereus ATCC 14579. The 1% agarose gel confirms the presence of the 598 bp DNA fragment. Lane 1: 1kb plus ladder and Lane 2: amplified calY from genomic DNA. Figure 12. Map of the prokaryotic expression vector pET100/D-TOPO containing the native calY with the addition of CACC at the 5 end. The stop codon, TAA was used to end translation and ampicillin was used to screen for positive clones once transformed into E. coli TOP10 cells.

PAGE 47

37 Confirmation of the Successful Cloning into pET100/D-TOPO Plasmid DNA from five E. coli clones were obtained and screened for the presence of the camelysin gene using PCR (Figures 13A and 13B) and DNA sequencing. The plasmid DNA containing the camelysin gene was PCR amplified using the primers sets T7 forward / Native calY reverse and pET calY forward / T7 reverse yielding fragments of 794 bp and 679 bp respectively, confirming that camelysin was inserted into the vector. F igure 13A. PCR amplification products on a 1% agarose gel used for identifying the correct insertion of BCcalY into the pET vector. Lane 1: 1kb plus ladder and Lanes 2-6: PCR of BCcalY -pET100D using T7 forward / Native calY reverse. This represented a 20% cloning efficiency.

PAGE 48

38 F igure 13B. PCR amplification products on a 1% agarose gel used for identifying the correct insertion of BCcalY into the pET vector. Lane 1: 1kb, plus ladder and Lanes 2-6: PCR of BCcalY -pET100D using pET calY forward / T7 reverse. DNA sequencing on BCcalY -pET100D was performed at SeqWright DNA Technologies (Houston, TX). Once the sequence information was obtained a BLAST2seq (39) was performed against the original gene sequences from B. cereus ATCC 14579s calY confirming no mutations were introduced during the cloning process and that the gene was inserted into the TOPO vector. The vector was then transformed into E. coli BL21 Star (DE3)pLysS for expression.

PAGE 49

39 Expression of BCcalY -pET100D The vector contains a T7 lac promoter that was induced by production of T7 RNA polymerase in the host cells and a lac operator that the lacI repressor protein (expressed in the BL21 cells) binds thus decreasing the chances of basal expression. E. coli BL21 Star™ (DE3)pLysS cells have the lambda DE3 lysogen which has the gene for the T7 RNA polymerase and is tightly regulated by the lac UV5 promoter in the cells chromosome. IPTG was used to turn on the lac UV5 promoter, which resulted in overexpression of the protein encoded by the PCR product that was inserted into the pET vectors cloning site. Since overexpression can be a problem with toxic proteins, the BL21 Star™ (DE3)pLysS strain were used to express camelysin since they also produce a T7 lysozyme that slowed expression by binding to T7 RNA polymerase and inactivating it. The BL21 cells transformed with BCcalY -pET100D were induced with IPTG for 4 hours. After each hour, samples were taken and stored for further analysis. SDS-PAGE was performed on the all of the samples (Figure 14), and no noticeable differences were apparent upon staining with Coomassie blue.

PAGE 50

40 F igure 14. Expression of BCcalY -pET100D in BL21 Star (DE3)pLysS cells. No banding pattern differences were discernable. Lanes 1 & 11: MW marker, Lane 2: Induced BL21 Star (DE3)pLysS cells, Lanes 3, 5, 7, & 9: Uninduced BL21 cells at 1, 2, 3, and 4 hours respectively, Lanes 4, 6, 8, & 10: Induced BL21 cells at 1, 2, 3, and 4 hours respectively. Western Blotting Analysis After performing SDS-PAGE on samples from each vector system, a Western blot was performed and confirmed that the protein bands that were apparent on some of the gels were indeed that of camelysin (Figure 15). Despite not seeing any noticeable bands on the SDS-PAGE performed on the BCcalY pET100D expression, two bands were apparent in the samples that were induced with IPTG for 3 hr and 4 hr. These bands were located around 65 kDa and the purple color is indicative of a positive reaction, while the brown colored bands are negative. The 19 kDa bands seen on the SDS-PAGE from the BAcalY-pBAD and BCcalY -pBAD expression were apparent on the Western blot at the same location, thus indicating successful expression in both the pET and pBAD vector systems.

PAGE 51

41 F igure 15. Western blotting analysis of camelysin expressed in the pBAD and pET vector systems. Lane 1: BCcalY -pET100D after 3 hr induction, Lane 2: BCcalY -pET100D after 4hr induction, Lane 3: BAcalY-pBAD induced with 0.002% arabinose, and Lane 4: BCcalY -pBAD induced with 0.002% arabinose. Azocasein Assay To test the proteolytic activity present in all three vector system expression experiments, an enzyme assay using azocas ein as a substrate was performed. Azocasein is made up of orange sulfanilamide groups that are covalently bound to the peptide bonds of casein. Once a protease attacks these bonds, small peptides and sometimes amino acids are released giving the solution a dark orange color. TCA was added after an overnight incubation at 37C, which precipitated the protease and any undigested azocasein. Following centrifugation, the small digested particles (giving the orange color) are contained in the supernatant and the OD365 is read (Figure 16), thus the higher the OD, the greater the amount of proteolyt ic activity present. The supernatants

PAGE 52

42 of BAcalY -pBAD, BCcalY -pBAD, and BCcalY -pET100D appear to have the highest proteolytic activity indicating the presence of camelysin. The pellets also contain some activity, but less than the supernatants. Negative controls included HeLa cells transfected with the pcDNA vector with no insert ( calY -pcDNA(-)) and E. coli TOP10 cells transformed with the pBAD vector with no insert. Proteolytic Activity of Cells 0 0.02 0.04 0.06 0.08 0.1 0.12 pBAD BA pellet pBAD BA sup pBAD BC pellet pBAD BC sup pcDNA HeLa pellet pcDNA HeLa sup pET BC pellet pET BC sup HeLa pellet HeLa sup Top10 pellet Top10 sup Cells UsedAbsorbance at 365 nm Figure 16. Degradation of azocasein by camelysin. An increase in the OD365 indicated high proteolytic activity in the supernatants of the cells that were transformed and induced with camelysin using either the pBAD or pET vectors. Top10 cells transformed with the empty pBAD vector appear to have some proteolytic activity, but is insignificant when compared to the Top10 cells that were transformed with either BAcalY -pBAD, BCcalY -pBAD, or BCcalY -pET100D. HeLa cells transfected with the empty pcDNA vector exhibited minute levels of proteolytic activity. Error bars indicate the standard deviation from the mean for each cell type used. Sequence Analysis of calY in B. anthracis and B. cereus ATCC 14579 A multiple sequence alignment was performed on both the nucleotide (Figure 18) and amino acid (Figure 17) sequences of calY from B. anthracis and B. cereus using the GAP alignment tool from the GCG Wisconsin Package

PAGE 53

43 software to check for the degree of homology between the two proteins and their genes. The results of the alignment concluded there is a 94.78% similarity between the two organism’s nucleotide sequenc es. Out of the 594 nucleotides in both camelysin genes, there were 30 differences between the two sequences (Figure 18). There are 197 amino acids in both camelysin genes; the alignment identified 9 amino acid differences be tween the two sequences and concluded there was a 95.94% similarity between the two amino acid sequences (Figure 17). Figure 17. Multiple sequence alignment of the amino acid residues for camelysin from B. anthracis and B. cereus The first amino acid sequence is that of B. anthracis and the second is that of B. cereus The amino acids that are highlighted in gray indicate a difference between the two proteins. Two dots between each residue that differs indicates a threshold of 2 for the alignment score conveying a strong similarity between the two amino acids, and one dot between each residue indicates a threshold of 1 for the alignment, conveying a similarity between the two amino acids, but not as high. A blank space between the residues indicates no similarity between the different amino acid residues.

PAGE 54

44 Figure 18. Multiple sequence alignment of the nucleotides for camelysin from B. anthracis and B. cereus The first nucleotide sequence is that of B. anthracis and the second is that of B. cereus The nucleotides that are highlighted in gray indicate a difference between the two genes.

PAGE 55

45 Prediction of the Putative Signal Peptide of Camelysin from B. anthracis and B. cereus ATCC 14579 using Neural Network and Hidden Markov Models. Both neural network and hidden Markov models were used to predict where the putative signal peptide of the camelysin protein is located using the SignalP 3.0 server (3). Due to the fa ct this protease exhibits unusual behavior and has no conserved domains it was imperative to perform several forms of sequence analysis. The signal peptide analysis allows us to view differences between the two proteins signal peptides as well as differences in their cleavage sites. The neural network model calculates where both the predicted signal peptide and the position of the signal peptidase I cleavage site are located using two separate networks. The signal peptide was predicted to contain amino acids 1-29 with a cleavage site between residues 29 and 30 for the camelysin protein of B. anthracis and B. cereus ATCC 14579 (Figures 19A and 19B). The hidden Markov model calculates whether or not a given amino acid sequence contains a signal peptide. If the sequence of interest is predicted to contain a signal peptide the location of the cleavage site, N-terminus, C-terminus, and alpha-helical segments of the signal peptide are included in the output. The Markov model predicted the signal peptide to consist of amino acid residues 1-27 with a cleavage site between residues 27 and 28 for the camelysin protein of B.

PAGE 56

46 anthracis and B. cereus ATCC 14579 (Figures 20A and 20B). The N-terminal region of the signal peptide was predicted to be comprised of residues 1-6, the alpha helical region 7-20, and the C-terminal region to be from 21-27 in the protease from both organisms. Figures 19A and 19B. SignalP 3.0’s neural network model prediction of the camelysin protein’s signal peptide. The C score corresponds to the probability that a particular residue is located at the signal peptidase I site, the S score reflects the probability that residues are part of the signal peptide, and the Y score helps to predict the cleavage site at points where the steep slopes of the C score line are located. Figure A is the sequence from B. anthracis and Figure B is the sequence from B. cereus Camelysin from both organisms are predicted to contain the same signal peptide and are predicted to be secreted.

PAGE 57

47 Figures 20A and 20B. SignalP 3.0’s hidden Markov model prediction of the camelysin protein’s signal peptide. The cleavage probability is the location where cleavage of the signal peptide is most likely to occur; the N-region, Hregion, and C-region probabilities correspond to the predicted N-terminal, alpha helical, and C-terminal regions of the signal peptide. Figure A is the sequence from B. anthracis and Figure B is the sequence from B. cereus Camelysin from both organisms are predicted to contain the same signal peptide and are predicted to be secreted.

PAGE 58

48 Secondary Structure Prediction of Camelysin from B. anthracis and B. cereus ATCC 14570 The predicted secondary structure of camelysin was obtained from the PSIPRED Protein Structure Prediction Server (21, 28). A multiple sequence alignment was performed using the GAP alignment tool from the GCG Wisconsin Package software to identify similar structural characteristics between the two peptides from B. anthracis and B. cereus ATCC 14579 (Figure 21). The alignment revealed that the secondary structure between the two proteins is 95.94% similar. The alpha helical region of the predicted signal peptide is also apparent in this secondary structure analysis, however there are also two other helical regions, possibly involved with anchoring the protein to the membrane of the cell (Figures 22 and 23). Figure 21. Secondary structure co mparison between camelysin from B. cereus and B. anthracis Out of the 197 peptides, only 4 peptides exhibited different secondary structure characteristics between the two peptide strands (gray residues). C, E, and H correspond to coil, strand, and helix respectively.

PAGE 59

49 F igure 22. Secondary structure prediction of camelysin from B. anthracis using PSIPRED. The protein is predicted to contain 4 alpha helices and 12 strands.

PAGE 60

50 F igure 23. Secondary structure prediction of camelysin from B. cereus using PSIPRED. The protein is predicted to contain 4 alpha helices and 12 strands, identical to the prediction for the proteins secondary structural characteristics for B. anthracis

PAGE 61

51 DISCUSSION The focus of this study was aimed at identifying, cloning, and expressing the active camelysin protease from B. cereus ATCC 14579 and B. anthracis Previous studies demonstrated that camelysin isolated from an uncharacterized, unsequenced strain of B. cereus may play a role in the pathogenicity of this organism, which is why B. cereus ATCC 14579 was chosen. Blastn and blastp searches revealed a putative camelysin gene may also be located in B. anthracis. These findings along with the fact that B. anthracis is such a potent pathogen were the reasons why it was chosen for this study. Identifying a suitable method for obtaining large amounts of this highly hydrophobic membrane protease was another goal of this project due to the difficulty in obtaining even minute amounts of the protease from the native organism and also due to the dangers of culturing live B. anthracis Obtaining large amounts of the camelysin protease, with or without a fusion tag will allow future studies to be performed that are focused on the delineation of camelysin’s possible role in the pathogenicity of these organisms. The camelysin gene from B. cereus ATCC 14579 was first cloned into the mammalian expression vector pcDNA3.1/V5-His TOPO TA. Several proteins are linked to pathogenicity by causing damage intracellularly, like the lethal factor of B. anthracis A mammalian expression vector was used to see if it would be

PAGE 62

52 possible to express the protease intracellularly in a mammalian cell line to observe any possible pathogenic effects of the enzyme. This would allow intracellular studies of camelysin’s involvement in pathogenicity without purification of the protease, reconstitution into liposome’s, and then adding the protein to a cell culture. PCR, restriction digestion analysis, and DNA sequencing confirmed that BCcalY was successfully inserted into the vector. Plasmid was obtained by performing large scale plasmid isolation from the transformed TOP10 cells and the DNA electrophoresis confirmed the purity of the recombinant plasmid. HeLa cells were grown to confluency and the recombinant vector was transiently transfected into the cells. Unfortunately there was no expression of the camelysin protein as indicated by SDS-PAGE, western blotting, immunoblotting analysis, and an azocasein assay. To make sure there were no errors with the transfection, the positive control pcDNA3.1/V5-His-TOPO/lacZ (pcDNA3.1 that contained the -galactosidase control) was transfected into the same HeLa cell cultures during the expr ession experiment. The IPTG assay (Figure 5) demonstrated that there was -galactosidase activity, indicating there were no problems with the transfection methodology. There are several possible explanations for the mammalian expression failure. Mammalian systems often do not process or fold heterologous proteins properly because of different translational and post-translational machinery. The mature camelysin protein exhibits self aggregation and is extremely hydrophobic most probably due to oligomerization (13). These characteristics are only exhibited in the properly folded protein; if camelysin is not properly folded it could

PAGE 63

53 be recognized by intracellular proteases which would destroy any camelysin protein produced immediately after translation. In addition, bacterial membrane proteases often need specific bacterial transport systems, like the Sec pathway for crossing and integrating into the membrane of the cells; in HeLa cells these pathways are not present. HeLa cell membranes also contain a much different phospholipid environment than the ones found in prokaryotic cell membranes. Direct membrane insertion of membrane bound proteases is often based on phospholipid composition (15). Following the expression trial in the mammalian system, the camelysin gene was cloned into the pET100/D-TOPO, vector. The pET vector has several advantages over pcDNA3.1/V5-His TOPO TA. There are two N-terminal fusion tags, a histidine tag and an X™press epitope which can be used for purification or detection of a fusion protein and both can be removed using enterokinase, due to the presence of an enterokinase cleave site located C-terminal to the tags. After successful PCR amplification the gene was inserted into the vector and transformed into the TOP10 cells. PCR and DNA sequencing confirmed that BCcalY was successfully inserted into the vector. Mini-preps were performed on the TOP10 cells and the vector was transformed into E. coli BL21 Star™ (DE3)pLysS cells. Once induced with IPTG, the cells expressed the recombinant protease in a controlled manner. SDSPAGE was unable to demonstrate the successful expression of camelysin once stained with coomassie blue. This is not unusual since previous studies have shown (13) that camelysin in its mature state forms hydrophobic aggregates that

PAGE 64

54 do not stain with coomassie blue. However, western blot analysis detected a positive result with band at 65 kDa, similar to the molecular weight obtained of aggregated camelysin on SDS-PAGE gels that were stained with colloidal gold in previous studies (15). In addition to the positive results obtained for the western blot, the protein also exhibited proteol ytic activity using an azocasein assay (Figure 16), indicative of the presence of camelysin in its active form. Next, the camelysin gene from B. anthracis and B. cereus was cloned into the pBAD TOPO TA expression vector. The camelysin gene from B. anthracis was only cloned into this vector due to the difficulty in obtaining the genomic DNA. This allowed us to examine the expression of camelysin from both organisms using an expression vector designed especially for producing toxic proteins. Additionally, this vector contains an N-terminal leader peptide that is shown to increase the solubility of recombinant proteins. The C-terminal histidine tag and V-5 epitope were purposely left out of the recombinant protein since they can not be removed from the protein after purification, and their effects on the enzymatic activity were not known at the time. Once inserted into the vector, it was transformed into TOP10 cells and confirmation of the genes correct orientation and sequence was accomplished by PCR and DNA sequencing. The recombinant clones expressed camelysin after induction using various concentrations of arabinose. SDS-PAGE confirmed the expression of the mature, non-aggregated 19 kDa protease after staining with coomassie blue. There are many possible explanations for the difference in molecular weight between expressions, the first being the presence of fusion tags on the protease

PAGE 65

55 of the pET vectors product. By adding the tags, the protease may have taken on a more native and aggregated form as seen in previous studies, which does not stain well when coomassie blue is used. The hydrophobic aggregation of this protease makes it difficult for it to travel through SDS-PAGE gels even after using reducing conditions (13). The proteins expressed in the pBAD system, lacked these fusion tags and also contained a leader peptide which increases the solubility of most the proteins that are expressed, which would explain the different results on SDS-PAGE between the pBAD and pET systems. A western blot performed on both the BAcalY -pBAD and BCcalY -pBAD recombinant proteins demonstrated a positive result which included a band at 19 kDa, backing up the SDS-PAGE analysis. An azocasein assay was performed on the two recombinant proteins following the western blot, and both demonstrated proteolytic activity, consistent with the active native protease obtained from B. cereus and the pET vectors recombinant protease. Various methods of sequence analysis were performed on the camelysin gene and protein from both B. cereus ATCC 14579 and B. anthracis Ames strain. The first analysis included a multiple sequence alignment which demonstrated the high similarity between the two sequences at both the nucleotide and amino acid level. Since camelysin from B. cereus is shown to have properties suggesting it may be involved in pathogenesis, it gave reason to clone the gene from both organisms. Signal peptide analysis using SignalP 3.0 allowed prediction of the position of the signal peptide, its cleavage site, and whether or not the peptide is soluble or insoluble. The mature protein was show to have 2

PAGE 66

56 different predicted sites of cleavage, pr obably due to the different models used, the first site was between amino acid residues 29 and 30 and the other was between amino acids 27 and 28, the latter was previously reported as the putative site in another paper (16). Secondary structure analysis was performed using PSIPRED. Results of the structure analysis further strengthene d the possibility that the signal peptide of camelysin was located within the first 30 amino acids. Previous studies on camelysin suggest this location due to the fact that signal peptides usually have basic amino acids in the N-terminus, followed by a hydrophobic section of amino acids (usually represented by helical se condary structures), and Gly residues at the C-terminus (16, 25, 30, 33). The PSIPRED prediction found two more possible alpha helices not previously described that could be involved in with the hydrophobic interactions that keep camelysin associated to the cell membrane. Grass, et al, have already demonstrated that camelysin is neither bound to the cell membrane by electrostatic interactions (camelysin was not removed from cell membrane after washing under high salt conditions and after using enzymes that cause lysis), transmembrane stretches of hydrophobic amino acids (which is only found in the N-terminal signal peptide), the modifications of lipoproteins (the recognition domain for the lipoprotein signal peptidase is not present in camelysin), or covalent linkages (molecular mass of protein matches well with predicted molecular mass from sequence) (16). The two new alpha helices seem to exhibit amphipathic properties (data not shown) from a hydrophobicity prediction performed in the Clone Manager software (Science and Educational

PAGE 67

57 Software, Inc. Cary, NC.). These amphipathic alpha helices are one possible way that the protease may bind to the cell membrane and they fall within one of the six hydrophobic domains found using the DAS transmembrane server (8) identified in previous studies (Grass 2004). This study indeed proves that the camelysin gene is found both in B. cereus and B. anthracis and that the active protease, although only weakly proteolytic, can be expressed in gram n egative prokaryotic expression systems. This will prove extremely useful in the future as this system, or newer gram positive vector systems can be used to create knock-out clones to identify the active region of the camelysin protein (9). Due to the fact that camelysin was found in B. anthracis and B. cereus and since previous studies demonstrate it contains pathogenic activity, some of the recombinant clones used in this study can be useful for large scale preparation of camelysin for cell culture and possibly animal models to examine the role it may have in the pathogenicity of these organisms.

PAGE 68

58 REFERENCES 1. Ariel, N., et al. 2002. Search for Potential Vaccine Candidate Open Reading Frames in the Bacillus anthracis Virulence Plasmid pXO1: In Silico and In Vitro Screening. Infect. Immun. 70(12): 6817-6827. 2. Beecher, D.J., Olsen, T.W., Somers,E.B., and A.C. Wong. 2000. Evidence for Contribution of Tripartite Hemolysin BL, Phosphatidylcholine Preferring Phospholipase C, and Collagenase to Virulence of Bacillus cereus endophthalmitis. Infect. Immun. 68(9): 5269-5276. 3. Bendtsen, J.D., Henrik, N., Gunnar, V.H., and S. Brunak. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol., 340:783795, 2004. 4. Borkakoti, N. 2004. Matrix me talloprotease inhibitors: design from structure. Biochem. Soc. T. 32(1): 17-20. 5. Carreto, E., Barbarini, D., Poletti, F., Marzini, F.C., Emmi, V., and P. Marone. 2000. Bacillus cereus Fatal Bactermia and Apparent Association with Nosocomial Transmission in an Int ensive Care Unit. Scan. J. Infect. Dis. 32(1): 98-100. 6. Chang, S., Su, M., and Y.W. Lee. 1997. Roles of the signal peptide and mature domains in the secretion and maturation of the neutral metalloprotease from Streptococcus cacaoi Biochem. J. 321: 29-37. 7. Chiavolini, D., Memmi, G., Maggi, T., Iannelli, F., Pozzi, G., and M.R. Oggioni. 2003. The three extra-cellular zinc metalloproteases of Streptococcus pneumoniae have a different impact on virulence in mice. BMC Microbiol. 3(14): 1-9. 8. Cserzo, M., Wallin, E., von Heijne, G.S., and A. Elofsson. 1997. Prediction of transmembrane alpha helices in prokaryotic membrane proteins: the Dense Alignment Surface Method. Prot. Eng. 10(6): 673676.

PAGE 69

59 9. Demidyuk, I.V., Zabolotskaya, M.V., Safina, D.R., and S.V. Kostrov. 2003. Molecular Mechanisms of Stabilization of Proteolytic Enzymes: A Model of Thermolysin-Like Microbial Metallopr oteases. Russ. J. Bioorg. Chem. 29(5): 461-469. 10. Drobniewski, F.A. 1993. Bacillus cereus and Related Species. Clin. Microbiol. Rev. 6(4): 324-338. 11. Duffy, M.J., Maguire, T.M., Hill, A., McDermott, E., and N. O’Higgins. 2000. Metalloproteinases: role in breast carcinogenesis, invasion and metastasis. 12. Fricke, B. 1993. Phase Separation of Nonionic Detergents by Salt Addition and Its Application to Membrane Proteins. Anal. Biochem. 212: 154-159. 13. Fricke, B., Buchmann, T., and S. Friebe. 1995. Unusual chromatographic behaviour and one-step purification of a novel membrane proteinase from Bacillus cereus J. Chromatogr. A. 715: 247-258. 14. Fricke, B., Wolfe, T., and F. Laube. 1996. The membrane proteinase from Bacillus cereus is located at the outer side of the cell envelope. Biol. Chem. Hoppe Seyler. 377: 138. 15. Fricke, B., Drler, K., Willhardt, I., Schierhorn, A., Menge, S., and P. Rcknagel. 2001. The cell envelope-bound metalloprotease (camelysin) from Bacillus cereus is a possible pathogenic factor. Biochim. Biophys. Acta. 1537: 132-146. 16. Grass, G., Shierhorn, A., Sorkau, E., Mller, H., Rcknagel, P., Nies, D.H., and B. Fricke. 2004. Infect. Immun. 72(1): 219-228. 17. Han, T.K., Yoder, S., Cao, C., Ugen, K.E., and M.L. Dao. 2001. Expression of Streptococcus mutans Wall-Associated Protein A Gene in Chinese Hamster Ovary Cells: Prospect for a Dental Caries DNA Vaccine. DNA Cell Biol. 20(9): 595-601. 18. Hooper, N.M. 1994. Families of zinc metalloproteases. Febs Lett. 354: 16. 19. Hsueh, P.R., Teng, L.J., Yang, P.C., Pan, H.L., Ho, S.W., and K.T. Luh. 1999. Nosocomial Psedoeopidemic Caused by Bacillus cereus Traced to Contaminated Ethyl Alcohol from a Liquor Factory. J. Clin. Micro. 37(7): 2280-2284.

PAGE 70

60 20. Ivanova, N., et al. 2003. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis Nature. 423: 87-91. 21. Jones, D.T. 1999. Protein secondary structure prediction based on position-specific scoring matrices. J. Mol. Biol. 292: 195-2002. 22. Kotiranta, A., Lounatmaa, K., and M. Haapasalo. 2000. Epidemiology and pathogenesis of Bacillus cereus infections. Microbes. Infect. 2: 189-198. 23. Kotiranta, A., Haapasalo, M., Kari, K., Kerosuo, E., Olsen, I., Sorsa, T., Meurman, J.H., and K. Lounatmaa. 1998. Surface Structure, Hydrophobicity, Phagocytosis, and Adherence to Matrix Proteins of Bacillus cereus Cells with and without the Crystalline Surface Protein Layer. Infect. Immun. 66(10): 4895-4902. 24. Leopold, I., and B. Fricke. 1997. Inhibition, Reactivation, and Determination of Metal Ions in Membrane Metalloproteases of Bacterial Origin Using High-Performance Liquid Chromatography Coupled On-line with Inductively Coupled Plasma Mass Spectrometry. Anal. Biochem. 252: 277-285. 25. Lewis, A.P. and P.J. Thomas. 1999. A novel clan of zinc metallopeptidases with possible intramembrane cleavage properties. Protein Sci. 8: 439-442. 26. Lipscomb, W.N., and N. Strter. 1996. Recent Advances in Zinc Enzymology. Chem. Rev. 96: 2375-2433. 27. Matsumoto, S., Suenaga, H., Naito, K., Sawazaki, M., Hiramtsu, T., and N. Agata. 2000. Management of Suspected Nosocomial Infection: An Audit of 19 Hospitalized Patients with Septicemia Caused by Bacillus Species. Jap. J. Infect. Dis. 53(5): 196-202. 28. McGuffin L.J., Bryson K., and D.T. Jones. 2000. The PSIPRED Protein Structure Prediction Server. Bioinformatics. 16, 404-405. 29. Mesnage, S., Tosi-Couture, E., Gounon, P., Mock, M., and Agns Fouet. 1998. The Capsule and S-Layer: Two Independent Yet Compatible Macromolecular Structures in Bacillus anthracis J. Bacteriol. 180(1): 5258. 30. Miedzobrodzki, J., Kaszycki, P., Bial ecka, A., and A. Kasprowicz. 2002. Proteolytic Activity of Staphylococcus aureus Strains Isolated from the Colonized Skin of Patients with Acute-Phase Atopic Dermatitis. Eur. J. Clin. Microbiol. Infect. Dis. 21: 269-276.

PAGE 71

61 31. Miller, J.M., Hair, J.G., Herbert, M., Herbert, L., and F.J. Roberts. 1997. Fulminating Bacteremia and Pneumonia Due to Bacillus cereus. J. Clin. Microbiol. 35(2) 504-507. 32. Miyoshi, S., Nakazawa, H., Kawata, K., Tomochika, K., Tobe, K., and S. Shinoda. 1998. Characterization of the Hemorrhagic Reaction Caused by Vibrio vulnificus Metalloprotease, a Member of the Thermolysin Family. Infect. Immun. 66(10): 4851-4855. 33. Navarre, W.W., and O. Schneewind. 1999. Surface Proteins of GramPositive Bacteria and Mechanisms of Their Targeting to the Cell Wall Envelope. Microbiol. Mol. Biol. R. 63(1): 174-229. 34. Okinaka, R.T., et al. 1999. Sequence and Organization of pXO1, the Large Bacillus anthracis Plasmid Harboring the Anthrax Toxin Genes. J. Bacteriol. 181(20): 6509-6515. 35. Poliakiv, A., Hubatsch, I., Shuman, C.F., Stenberg, G., and U.H. Danielson. 2002. Expression and Purification of Recombinant Full Legnth NS3 Protease-Helicase from a New Variant of Hepatitis C virus. Protein Expres. Purif. 25: 363-371. 36. Radnedge, L., Agron, P .G., Hill, K.K., Jackson, P.J., Ticknor, L.O., Keim, P., and G.L. Anderson. 2003. Genome Differences That Distinguish Bacillus anthracis from Bacillus cereus and Bacillus thuringiensis 2003. Appl. Environ. Microb. 69(5): 2755-2764. 37. Rao, M.B., Tanksale, A.M., Ghatge, M.S., and V.V. Deshpande. 1998. Molecular and Biotechnological Aspects of Microbial Proteases. Microbiol. Mol. Biol. R. 62(3): 597-635. 38. Rasko, D.A., et al. 2004. The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Res. 32(3): 977-988. 39. Tatusova, T. and T.L. Madden. 1999. Blast 2 sequences a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett. 174:247-250. 40. Wainwright, C.L. 2004. Matrix metalloproteinases, oxidative stress and acute response to acute myocardial ischaemia and reperfusion. Curr. Opin. Pharmacol. 4: 132-138.

PAGE 72

62 41. Windle, H.J.P., and D. Kelleher. 1997. Identification and Characterization of a Metalloprotease Activity from Helicobacter pylori Infect. Immun. 65(8): 3132-3137. 42. Yang, D., Wilderman, A.G., and F.J. Sharom. 2003. Overexpression, purification, and structural analysis of the hydrophobic E5 protein from human papillomavirus type 16. Protein Expres. Purif. 30: 1-10.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001670354
003 fts
005 20051216093313.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 051117s2005 flu sbm s000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001218
035
(OCoLC)62293904
SFE0001218
040
FHM
c FHM
d FHM
049
FHMM
090
QH307.2 (Online)
1 100
Myers, Andrew Ross
0 245
Cloning, expression, and sequence analysis of camelysin, a zinc metalloprotease from bacillus anthracis and b. cereus
h [electronic resource] /
by Andrew Ross Myers.
260
[Tampa, Fla.] :
b University of South Florida,
2005.
502
Thesis (M.S.)--University of South Florida, 2005.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 72 pages.
520
ABSTRACT: Bacillus anthracis and B. cereus are well known etiological agents, which cause disease in healthy and immunocompromised individuals. Considering the abundance and lethality of these organisms it is imperative that research is performed to identify and analyze new factors that may contribute to their pathogenicity. Camelysin is a membrane bound, zinc metalloprotease isolated from B. cereus. Assays performed on purified camelysin demonstrate that the protease exhibits fibrinolytic, collagenolytic, and actin degradation activity, any of which can contribute to the organisms ability to invade host tissues and cause damage. Considering the putative role of camelysin in pathogenicity, it would be beneficial to study the effects of camelysin in tissue cultures or animal models. The goal of this study focused on the cloning and expression of camelysin from B. cereus and its homolog in B. anthracis.Expression of a fusion tagged protein may assist in the purification of camelysin as well as overcoming the native proteins extreme insolubility. Primers were designed to amplify the camelysin gene from B. cereus for cloning into the prokaryotic pBAD TOPO[registered trademark] TA, pET100/D-TOPO[registered trademark], and the eukaryotic pcDNA3.1/V5-His[copyright] TOPO[registered trademark] TA expression vectors. Primers were also designed to amplify the gene from B. anthracis for cloning into the pBAD TOPO[registered trademark] TA vector. The recombinant clones were induced and successful expression of the protein was confirmed by performing SDS-PAGE, Western blotting, and an azocasein protease assay. The recombinant proteins exhibited casein degradation activity which is observed with purified camelysin from B. cereus. This study successfully demonstrated the presence of the camelysin protein in B. anthracis.
590
Adviser: My Lien Dao.
653
Metalloenzyme.
Collagen.
Pathogenic factor.
Recombinant protein.
Nosocomial infections.
690
Dissertations, Academic
z USF
x Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1218