USF Libraries
USF Digital Collections

Role of stat3 in regulating hif-1alpha expression and tumor angiogenesis

MISSING IMAGE

Material Information

Title:
Role of stat3 in regulating hif-1alpha expression and tumor angiogenesis
Physical Description:
Book
Language:
English
Creator:
Briggs, Jon J
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
Stat
Hif
Vegf
Il-6
Angiogenesis
Hypoxia
Dissertations, Academic -- Medical Microbiology and Immunology -- Doctoral -- USF   ( lcsh )
Genre:
government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Increased vascularization (angiogenesis) is a required adaptation for sustained tumor growth, and the primary mediator of de novo blood vessel formation is vascular endothelial growth factor (VEGF). The central transcriptional activator of VEGF is hypoxia inducible factor-1 (HIF-1), a heterodimeric transcription factor composed of an inducible HIF-1alpha subunit and a constitutively expressed HIF-1beta subunit. In addition to HIF-1, it has recently been reported that signal transducer and activator of transcription 3 (Stat3) is required for VEGF production and angiogenesis. Although it is known that Stat3 is an important mediator of many of the oncogenic signaling pathways that regulate HIF-1alpha, it was not known if Stat3 regulates HIF-1alpha. To answer this important question, the effect of blocking Stat3 signaling on both HIF-1alpha and VEGF expression was examined.Treatment of cells with IL-6, a potent activator of Stat3, resulted in HIF-1alpha and VEGF induction during normoxia. By blocking protein synthesis with cycloheximide, it was determined that IL-6 induction of HIF-1alpha resulted from increased translation. When Stat3 was silenced with siRNA, both basal level expression and IL-6 induction of HIF-1alpha and VEGF were significantly reduced. Furthermore, it is likely that Stat3 is required for HIF-1alpha induction by a variety of growth signals, as both HIF-1alpha and VEGF expression resulting from EGF and heregulin were abolished when Stat3 signaling was blocked. Because we had observed that Stat3 was required for induction of HIF-1alpha by growth signals, we wanted to determine if Stat3 was also required for HIF-1a induction by hypoxia. When Stat3 was silenced and cells exposed to hypoxia, HIF-1a expression was again abolished. Furthermore, the hypoxic induction of VEGF and MMP-2 was also prevented.
Thesis:
Thesis (Ph.D.)--University of South Florida, 2005.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Jon J. Briggs.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 147 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001670361
oclc - 62299949
usfldc doi - E14-SFE0001227
usfldc handle - e14.1227
System ID:
SFS0025548:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Role of Stat3 in Regulating HIF-1alpha Expression and Tumor Angiogenesis by Jon J. Briggs A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Medical Microbiology and Immunology College of Medicine University of South Florida Co-Major Professor: Hua Yu, Ph.D. Co-Major Professor: Peter Medveczky, M.D. Burt Anderson, Ph.D. Douglas Cress, Ph.D. Richard Heller, Ph.D. Date of Approval: May 27, 2005 Keywords: STAT, HIF, VEGF, IL-6, angiogenesis, hypoxia Copyright 2005 Jon J. Briggs

PAGE 2

i TABLE OF CONTENTS LIST OF TABLES iv LIST OF FIGURES v LIST OF ABBREVIATIONS vii ABSTRACT ix INTRODUCTION 1 Tumor hypoxia and angiogenesis 1 Vascular endothelial growth factor 3 Regulation of VEGF 5 Other angiogenic factors 7 Hypoxia Inducible Factor 8 Regulation of HIF-1 by hypoxia 13 Regulation of HIF-1 by growth signals 16 Signal transducer and activator of transcription 20 Stat3 and angiogenesis 23 OBJECTIVE 26 MATERIALS AND METHODS 29 Cell lines and cell culture 29 Reagents and antibodies 30 Treatment With Src Tyrosine Kinase Inhibitors 31

PAGE 3

ii Generation of cell lines stably transfected with Stat3 siRNA 31 Generation of Stat3 knockout MEFs 31 Retrovirus infection 32 Anti-sense oligonucleotide and Stat3 siRNA transient transfections 32 Preparation of whole cell and nuclear extracts 33 Western Blotting 34 Electrophoretic Mobility Shift Assay (EMSA) 35 RNA isolation and Northern blot analysis 36 RESULTS 37 IL-6 increases levels of HIF-1 protein 37 IL-6 increases HIF-1 expression by increasing its rate of synthesis 39 Stat3 is required for IL-6 induction of HIF-1 41 Stat3 is required for HIF-1 induction by Heregulin 43 Stat3 is required for HIF-1 induction by EGF 46 Stat3 is required for HIF-1 induction by hypoxia 50 Stat3 is required for the hypoxic induction of VEGF and MMP-2 56 Stat3 is activated by hypoxia 59 DISCUSSION 65 Stat3 is required for HIF-1 induction by growth/oncogenic signals 65 Stat3 is required for VEGF induc tion by growth/oncogenic signals 67 Stat3 is required for HIF-1 induction by hypoxia 69 Stat3 is required for induction of several hypoxia inducible genes 73

PAGE 4

iii Stat3 is activated by hypoxia 74 Stat3 as an anti-angiogenic target 77 REFERENCES 80 ABOUT THE AUTHOR End Page

PAGE 5

iv LIST OF TABLES TABLE 1. Examples of HIF-1 target genes 11 TABLE 2. Regulators of HIF-1 expression or function 17

PAGE 6

v LIST OF FIGURES FIGURE 1. Overview of HIF-1 regulation 10 FIGURE 2. Structure of HIF-1 and regulation by prol yl hydroxylation. 14 FIGURE 3. Mechanism of HIF-1 regulation by growth signaling 19 FIGURE 4. Stat3 signaling pathway 21 FIGURE 5. IL-6 increases HIF-1 protein in MCF-7 br east cancer cells. 38 FIGURE 6. IL-6 does not increase HIF-1 mRNA in MCF-7 breast cancer cells 40 FIGURE 7. IL-6 induced HIF-1 levels are due to synt hesis and not cessation of degradation 42 FIGURE 8. Silencing Stat3 bloc ks IL-6 induction of HIF-1 44 FIGURE 9. Silencing Stat3 decreases AKT levels 45 FIGURE 10. Heregulin increases both Stat3 binding and HIF-1 protein in MCF-7 breast cancer cells 47 FIGURE 11. Stat3 siRNA bloc ks heregulin induced HIF-1 expression 48 FIGURE 12. EGF increases both Stat3 binding and HIF-1 protein in prostate tumor cell line DU-145 49 FIGURE 13. Stat3 is requir ed for EGF mediated HIF-1 expression 51 FIGURE 14. Stat3 is requir ed for hypoxia induced HIF-1 expression in vSrc transformed fibroblasts 53 FIGURE 15. Treatment with src inhibitors prevents HIF-1 by hypoxia 54

PAGE 7

vi FIGURE 16. Stat3 is required for HIF-1 induction by hypoxia in A2058 melanoma cells 55 FIGURE 17. HIF-1 mRNA in A2058 melanoma treated with CoCl 2 57 FIGURE 18. Stat3 is requir ed for VEGF induction by CoCl 2 in A2058 Melanoma 58 FIGURE 19. Stat3 is required for MMP-2 induction by hypoxia in Fibroblasts tansformed with v-Src 60 FIGURE 20. Stat3 is activated in human cancer cells exposed to hypoxia 61 FIGURE 21. Time course of Stat3 activation in BALB/c fibroblasts treated with hypoxia mimic 63 FIGURE 22. Hypoxia mimic activates Stat3 in DU145 human prostate cancer 64

PAGE 8

vii LIST OF ABBREVIATIONS Abl Abelson kinase AP Activator protein ASO Antisense oligonucleotide bFGF basic Fibroblast growth factor bHLH basic-Helix-loop-helix CHX Cyclohexamide ECM Extracellular matrix EGF Epidermal growth factor EGFR Epidermal gr owth factor recceptor EPO Erythropoietin ERK Extracellular regulated kinase FGF Fibroblast growth factor FIH Factor inhibiting HIF FRAP FKBP/rapamycin-associated protein gp130 glycoprotein 130 HGF Hepatocyte growth factor HIF Hypoxia inducible factor HRE Hypoxia response element hSIE high affinity Sis-Inducible Element

PAGE 9

viii IGF Insulin-like growth factor JAK Janus kinase MAPK Mitogen-activa ted protein kinase Mek MAPK/ERK kinase MMP Matrix metalloproteinase mTOR Mammalian target of rapomycin ODD Oxygen dependent degradation domain PAS Per/Arnt/Sim PDGF Platelet derived growth factor PHD Prolyl hydroxylase domain PI3K Phosphatidylinositol 3-kinase PTEN Phosphatase and tensin ho mologue deleted on chromosome 10 RTK Receptor tyrosine kinase SH2 Src homology 2 STAT Signal transducer a nd activator of transcription TK Transcription factor TNF Tumor necrosis factor VEGF Vascular endot helial growth factor VEGFR Vascular endothelial growth factor receptor VHL von Hippel-Lindau protein

PAGE 10

ix Role of Stat3 in Regulating HIF-1al pha Expression and Tumor Angiogenesis Jon Briggs ABSTRACT Increased vascularization (angiogenesis) is a required adaptation for sustained tumor growth, and the primary mediator of de novo blood vessel formation is vascular endothelial growth factor (VEGF). The central transcriptio nal activator of VEGF is hypoxia inducible factor-1 (HIF-1), a heterodime ric transcription fact or composed of an inducible HIF-1 subunit and a constitutively expressed HIF-1 subunit. In addition to HIF-1, it has recently been reported that signal transducer and activator of transcription 3 (Stat3) is required for VEGF production a nd angiogenesis. Although it is known that Stat3 is an important mediator of many of the oncogenic signaling pathways that regulate HIF-1, it was not known if Stat3 regulates HIF-1 To answer this important question, the effect of blocking St at3 signaling on both HIF-1 and VEGF expression was examined. Treatment of cells with IL-6, a potent activator of St at3, resulted in HIF-1 and VEGF induction during normoxia. By blocking protein synthesis with cycloheximide, it was determined that IL-6 induction of HIF-1 resulted from increased translation. When Stat3 was silenced with siRNA, both basal level expression and IL-6 induction of HIF-1 and VEGF were significantly reduce d. Furthermore, it is likely that Stat3 is required for HIF-1 induction by a variety of gr owth signals, as both HIF-1 and VEGF expression resulting from EGF and here gulin were abolished when Stat3 signaling

PAGE 11

x was blocked. Because we had observed that Stat3 was required for induction of HIF-1 by growth signals, we wanted to determin e if Stat3 was also required for HIF-1 induction by hypoxia. When stat3 was silenced and cells exposed to hypoxia, HIF-1 expression was again abolished. Furthermore, the hypoxic induction of VEGF and MMP2 was also prevented. These results, along with loss of basal expression of HIF-1 suggest that Stat3 is fundamentally in volved with the cellular reponse to hypoxia. This idea is reinforced by our observation that Stat3 is activated by hypoxia in several cell lines. These findings position Stat3 as an important target for antia ngiogenic therapy, not only through its direct regulation of the VEGF gene, but also because it is required for expression of the other most important transcriptional activator of VEGF.

PAGE 12

1 INTRODUCTION Tumor hypoxia and angiogenesis As solid tumors grow beyond a diameter of 1-2 millimeters, they outgrow the existing blood supply (52). As a result, areas of low oxygen (hypoxia) develop. The presence of hypoxic regions was originally hypothesized in response to the observation that necrosis increased as distance from the vasculature i ncreased (199). Confirmation of this theory, and more accurate measurements of tumor oxygen levels were achieved with oxygen electrodes. It was observed that oxygen levels in tumors were highly variable, with areas as low as 0.7% OB2B (206). For their continued growth and survival in a hypoxic environment, tumor cells encourage growth of new blood vessels from the pre-existing vasculature in a process known as angiogenesis (60). It is clear that tumors have an absolute requirement for vascularization, and in the absence of angiogenesis, sustained tumor growth cannot occur (59, 60, 87, 118). In response to hypoxia, cell signaling pathways and transcription factors are activated in the tumor cells that help them cope with the harsh tumor microenvironment (87). Activation of these pathways resu lts in changes in gene expression encouraging survival under conditions of low oxygen, low nutrients, and high acidity. There is increased need for glucose uptake and metabolism due to low oxygen and nutrients, and as a result there is increa sed expression of glucose transpo rters and glycolytic enzymes.

PAGE 13

2 Because it is a toxic environment characterized by hypoxia and acidosis, there is elevated expression of growth factors and survival pathways. Angiogenesis is facilitated by the release of soluble factors such as VEGF that bind to receptors on vascular endothelial cells and encourage their migration and growt h. Furthermore, factors are released which result in the breakdown and restructuring of the extracellular matrix, allowing endothelial cell migration. In this manner, tumors restructur e the local vasculature to fulfill their need for oxygen and nutrients. A poor clinical outcome correlates with both microvessel density (118, 216) and tumor hypoxia (93) The reason for this is that although many tumors are highly vascularized, the tumor vasculature is oft en poorly formed and inefficient (24). The tumor vascular system is characterized by leaky blood vessels, haphazard patterns of connections, loose attachment, and an abnormal basement membrane (107). These abnormalities result in a tumor environment t hat although vascularized, is characterized by hypoxia, acidosis and necrosis (107). Tumors with a high degree of hypoxia amount to a poor prognosis for patients for a variety of reasons. Cells adapted to hypoxia tend to upregulate genes associated with angiogenesis an d metastasis (171). It is clear that hypoxia exerts selective pressure for formati on of a tumor with greater resistance to apoptosis (77). Furthermore, the environment t ends to increase mutation rates (232, 233). These adaptations result in a tumor with greater potential for survival and metastasis. In addition, hypoxic tumors tend to have greater resistance to treatment with drugs and radiation (16, 45, 81). The implication is that tumor cell survival is facilitated by both encouragement of angiogenesis and adaptation to hypoxia, and therefore tumor progression correlates with bot h hypoxia and vascul arization.

PAGE 14

3 Antiangiogenic therapy was proposed due to the observation that solid tumors require vascularization for sustained growth (60). By preventing growth of new blood vessels, the tumor could be deprived of oxygen and nutrients and continued growth would be inhibited. It is clear that tumors have an absolute requirement for vascularization, and inhibition of angiogenesis can prevent tumor growth (59, 60, 86, 87, 118). Furthermore, there have been reports of successful clinical trials (115, 226). Importantly, it has been reported that an tiangiogenic therapy in conjunction with radiation and chemotherapy resulted in an improved response (75, 100, 122, 134, 146, 197). Despite these successful trials, many of the antiangiogenesis inhibitors when used alone have not been effective (12, 54). A likely e xplanation for this is that they were not effective enough, as the majority of them have only targeted an individual angiogenic factor such as VEGF, and it is known that vascularization is a complex process involving a variety of factors (54, 118). When drugs are developed with greater potency that are capable of blocking a wide variety angiogenesis inducers, it is likely that clinical trials will be more successful either alone or in conjunction with traditional radiation and chemotherapy (12, 97). Vascular Endothelial Growth Factor It had long been known that tumor cells se crete a factor capable of initiating angiogenesis, however the stimulus responsible for its production was not known (53, 61). Subsequently, it was demonstrated that macrophages exposed to a hypoxic environment were shown to secrete an angiogene sis-stimulating factor (124). Vascular

PAGE 15

4 endothelial growth factor (VEGF) was then purified, sequenced and cl oned, leading to its identification and characterization as an exceptionally potent angiogenic mitogen (117, 135). Following this, it was shown that high VEGF expression occurs close to necrotic and presumably hypoxic areas, demonstrating probable in vivo stimulation of angiogenesis by a hypoxic environment (187). VEGF is a soluble factor capable of stimulating blood vessel growth, and is important for processes such as embryogenesis and wound repair (52, 54). Furthermore, it is well established that VEGF is an important mediator of tumor angiogenesis and progression (53, 84, 151, 162, 187). Tumors with high expression of VEGF have been shown to be of increased grade and result in a poor clinical outcome (163, 203, 216). VEGF is demonstrated to be an important therapeutic target in both animal models (9, 97, 101, 103, 121-123, 221, 231) as well as patients (100, 115, 226). It is clear from these reports that VEGF is essential for tu mor angiogenesis, and inhibition of VEGF can prevent angiogenesis and tumor growth. The biologically active form of vascular endothelial growth factor is VEGF-A (54), usually referred to as VEGF, and it forms a 45 kDa homodimer (55). VEGF undergoes splice variation to form four main variants of the protein denoted by subscript numbers representing the number of amino acids: VEGFB121B, VEGFB165B, VEGFB189B, and VEGFB206 B(96, 202). These different isoforms bind with varying affinities to both the extracellular matrix and recepto rs expressed on most endothe lial cells (54). The two major VEGF RTKs are VEGF receptor 1 (VEGFR-1, Flt-1) and VEGF receptor 2 (VEGFR-2, KDR, FLK) (40, 198). Although both of these receptors are upregulated by

PAGE 16

5 hypoxia and important for angiogenesis, VEGFR-2 is the primary mediator of the growth and angiogenic properties of VEGF (54, 183). Regulation of VEGF Regulation of VEGF expression may result from transcriptional, posttranscriptional or translational mechanisms. I ncreased transcription results from hypoxia or growth signals and is facilitated by tr anscription factors such as HIF-1 and Stat3. Concerning post-transcriptional modification, prot eins binding to the 3-untranslated region of VEGF mRNA result in its st abilization in respons e to hypoxia (31, 36, 136, 190). Furthermore, VEGF may be regulated at the translational level by a mechanism dependent on the PI3K/AKT/mTOR pathway (30, 150). In addition to hypoxia (187) and acidosis (185), VEGF transcription can be induced by a variety of soluble factors such as growth factors, cytokines, and hormones. Examples of these include transforming growth factor(TGF) (63, 160), tumor necrosis factor (TNF) (63, 174), platelet-derived growth factor (PDGF) (56, 209), keratinocyte growth factor (KGF) (63), Interleukin-6 (IL-6) (33, 38), hepatocyte growth factor (HGF) (235), Interleukin-1 (IL-1 ) (139), fibroblast growth factor-2 (FGF-2) (43, 174)), epidermal growth factor (EGF) (32, 63), and insulin-like growth factor 1 IGF-1) (32, 72). Many of these signals are commonly overexpressed by tumor cells, and result in paracrine induction of VEGF which is e ssential for tumor vascularization (84). Tumor cells often produce high levels of VEGF without any external stimulation. This results from genetic changes undergone by t he tumor cells themselves, such as loss

PAGE 17

6 of tumor suppressor function and oncogene overexpression. Concerning tumor suppressors, loss of von Hippel-Lindau (VHL) gene (102), p53 (120, 154), and phosphatase and tensin homologue deleted on chromosome 10 (PTEN) (238) are associated with increased expression of VEGF. In addition to negative regulation by tumor suppressors, VEGF is upregulated by a variety of receptor and non-receptor tyrosine kinases Examples of membrane bound TKs capable of increasing VEGF production include EGFR (161) and HER2 (133, 161). Various non-receptor TKs also stimulate VEGF production, examples include c-SrcPpp60P (47, 155, 218), v-Src (109, 154), and Ras (83, 166) The best documented signaling pathways capable of stimulating VEGF production are PI3K/AKT and the Ras/Raf/MEK/ERK pathway. Many of the growth signals or genetic alterations responsib le for upregulating VEGF expression are dependent on the kinases PI3K and Akt (32, 110, 133, 209). Furthermore, loss of function of the tumor suppressor PTEN results in activation of the PI3K/ AKT pathway (85, 189, 222) and increased VEGF expression (238). Concerning the Ras/Raf/MEK/ERK cascade, VEGF is upregulated by mutant Ras (166), v-Ras (83) and v-Raf (83). Furthermore, VEGF is required for Ras-mediated tumorigenesis (84). Increased transcription of the VEGF gene results from activation of a limited set of transcription factors. The VEGF promot er contains several confirmed transcription factor binding sites, including HIF-1 (62, 137), Stat3 (159, 214), AP-1 (174), and Sp1 (56, 174, 184), and AP-2 (69, 202). Induction of VEGF by hypoxia involves HIF-1 and this process is well characterized (137, 140) Furthermore, it has been demonstrated that AP-1 becomes activated under hypoxia (173, 227) and possibly contributes to the HIF-1

PAGE 18

7 response to hypoxia (1, 35, 130). It has rec ently been reported that Stat3 and HIF-1 are both required for maximal VEGF induction by hypoxia (82). Other angiogenic factors Angiogenesis is a complex process requiri ng not only endothelial cell growth and migration, but also processes involving r eorganization of the extracellular matrix and basement membrane (94). As a result, a variety of factors in addition to VEGF are required. Several other factors facilitate ang iogenesis in a direct manner by stimulating growth of vascular endothelial cells, these include basic fibroblast growth factor (bFGF, or FGF-2) (50) and IL-8 (125). Other fact ors act in an indirect manner by increasing VEGF production, and these were described in the previous section. In addition to factors that stimulate endothelial cell growth, others have been described that regulate angiogenesis in negative manner. An important example of a negative regulator of angiogenesis is thrombospondin 1 (TSP-1), whic h functions by inhibiting endothelial cell proliferation and inducing apoptosis (112, 175) Furthermore, as with VEGF, it has been reported that many of these factors are regulated in response to hypoxia, including PDGF (126, 129), IL-8 (44, 224) and bFGF (129) In addition to endothelial cell migration and growth, angiogenesis requires breakdown of the extracellular matrix and basement membranes, allowing endothelial cells to migrate toward the source of the angiogenic stimulus. Important factors involved in this process are the matrix metalloprotei nase enzymes, in particular MMP-2 (gelatinase A) and MMP-9 (gelatinase B) (149). It has been demonstrated that MMP-2 is upregulated

PAGE 19

8 by hypoxia (128), and is important for tumor angi ogenesis (104), as well as invasion and metastasis (95, 104, 178). Hypoxia inducible factor Hypoxia inducible factor 1 (HIF-1) was originally described as a transcription factor that binds to the 3-enhancer of the erythropoietin (EPO) gene, a protein important for synthesis of haemoglobin, upregulating its pr oduction in response to hypoxia (182). It rapidly became apparent that this transcription factor was instrumental in the hypoxic regulation of cellular processes beyond haemoglobin synthesis, as the enhancer sequence was still responsive in cells incapable of producing EPO (211). Furthermore, it was discovered that a common transcriptional complex inducible by hypoxia was involved with the regulation of a variety of angiogenic factors (71, 73, 140, 181). The demonstration that HIF-1 was required for VEGF induction by hypoxia confirmed the importance of HIF-1 in the cellular response to hypoxia (62). A number of subsequent studies confirmed that HIF-1 was induced by hypoxia and fa cilitated transcription of an array of genes essential for angiogenesis (165). Hypoxia inducible factor is a heterodi meric transcription factor composed of an alpha and beta subunit (210, 212). Both subunits belong to a family of transcription factors which contain a basic-helix-loop-hel ix (bHLH) and Per/Arnt/Sim (PAS) domain (210), sequences important for dimerization and DNA binding. The HIF-1 subunit, also known as aryl hydrocarbon nuclear transporter (ARNT), di merizes with multiple members of the bHLH-PAS family of TFs (145). Although both subunits are for the most

PAGE 20

9 part continuously transcribed, HIF-1 is rapidly degraded under hypoxia and is subjected to extensive post-translational regulation. On the other hand, HIF-1 is constitutively expressed and is not subject to regulation by hypoxia (99). Following translocation to the nucleus, HIF-1 binds to promoters of genes containing hypoxia response elements and increases their transcription (180) (Figure 1). The alpha subunit exists in three isoforms, HIF-1 HIF-2 and HIF-3 The HIF-1 isoform is the best characterized and seems to be the most important in the cellular response to hypoxia (99). The HIF-2 subunit, also known as endothelial PAS domain protein 1 (EPAS 1) or HIF-related f actor (HRF), shares 48% sequence identity with HIF-1, is inducible by hypoxia and binds to the HREs of hypoxia inducible genes (49, 58, 201, 220). Although HIF-1 and HIF-2 share significant structural and functional similarities, they appear to be inducible by different stimuli (22) and have different patterns of tissue distribution (219). The third variant HIF-3, also known as inhibitory PAS domain protein (IPAS), undergoes an alternative splicing event which removes the transactivation domain, and by binding to HIF-1 rather than HIF-1 functions in a dominant negative manner (143, 144). It has been estimated that HIF-1 is capable of directly regulating approximately 60 genes (180). These genes can be categor ized into several groups based on their physiological roles, including angiogenesis, growth and apoptosis, ECM metabolism, oxygen transport and iron metabolism, and ener gy metabolism (Table 1) (177). Although expression of some of these genes, such as VEGF, are under the control of HIF-1 in a wide variety of cell types, many are regulated in a cell-type specific manner (180). As

PAGE 21

FIGURE 1. Overview of HIF-1 regulation. Under normal oxygen conditions (normoxia), HIF-1 levels are very low. This is due to the activity of tumor suppressors such as VHL and p53, which facilitate HIF-1 ubiquitination and degradation by the proteosome. When oxygen levels are low (hypoxia), interaction with the tumor suppressors is disrupted and HIF-1 rapidly accumulates. In addition to its stabilization by hypoxia, HIF-1 levels can increase due to activation of the PI3K-AKT-FRAP growth signaling pathway. HIF-1 accumulation by growth signaling results from an increased rate of synthesis. 10

PAGE 22

11 TABLE 1. Examples of HIF-1 target genes. Gene Function Reference VEGF Vascular endothelial cell growth (62) FLT-1 (VEGFR-1) VEGF receptor (68) FGFs Vascular endothelial cell growth (129) Angiogenesis PDGF Vascular endothelial cell growth (71, 129) Nip3 Growth and apoptosis Apoptosis (21) Insulin-like growth factor binding protein 1 (IGFBP-1) Binds and sequesters IGF (196) (UPAR) urokinase plasminogen activator receptor Degradation of ECM (78) Matrix metalloproteinase-2 (MMP-2) Degradation of ECM (128) ECM metabolism Collagen prolyl-4hydroxylase Collagen synthesis (194) Glucose transporter1 Glucose transport (46) 6-phosphofructo-1kinase Glucose metabolism (181) Energy metabolism Phosphoglycerate kinase 1 Glucose metabolism (57) Tr Oxygen transport and iron metabolism ansferrin Iron transport protein (172) Transferrin receptor Mediates cellular iron uptake (141, 192) Erythropoietin Haemoglobin synthesis (182) Genes in bold have confirmed HIF-1 binding sites, others are inducible by hypoxia and are suspected to have HIF-1 binding sites.

PAGE 23

12 many of these genes are important for growth and survival, they are oncogenic and their disregulation can lead to tumor development and progression. Because of this, HIF-1 is often overexpressed in a wide variety of cancer types (180). Because HIF-1 is important for the regulation of so many genes, many of which are oncogenic proteins, expression and activity of the HIF-1 subunit is tightly controlled. Although there are some reports of regulation of HIF-1 mRNA (109, 200, 210), the most frequently documented modes of HIF-1 regulation concerns abundance of the alpha subunit and HIF-1 transcripti onal activation. Regulation of HIF-1 levels, as with all proteins, is determined by the rate of its synthesis versus the rate of its degradation. It is well documented that the rate of synthesis is determined by the activity of growth signaling pathways, and the rate of degradation by the availability of oxygen. Transcriptional activation of HIF-1 is controlled by both growth signaling pathways and oxygen availability. These modes of regulation w ill be discussed in greater detail in subsequent sections. Regulation of HIF-1 levels and activity occur primarily as a result of postranslational modification, and these modifi cations include hydroxylation, acetylation, and phosphorylation Hydroxylation of multiple residues facilitates the response of HIF1 to hypoxia, and affects both the rate of degr adation and the level of transcriptional activation. This will be discussed in greater detail in the following section. It is known that HIF-1 is subject to acetylation by the ARD1 acetyltransferase, and this reportedly facilitates its degradation by increasing interaction with VHL (108) Several residues of HIF-1 are phosphorylated (152, 169), as treatm ent with a phosphatase causes the multiple bands associated with HIF-1 western blot return to the predicted size of 104

PAGE 24

13 kDa (152). The function of HIF phosphorylation is not entirely clear (11), but appears to be facilitated by MAPK and probably results in transcriptional activation by encouraging interaction with CBP/p300. Regulation of HIF-1 by hypoxia The most notable aspect of HIF biology is induction of the alpha subunit during hypoxia. Under normal oxygen conditions and without stimulation by growth/oncogenic signals, HIF-1 levels in vitro are very low and us ually undetectable. This is due to its continual and rapid destruc tion via proteosomal degradation in the presence of OB2B. Degradation of HIF-1 during normoxia is extremely rapid, and the half-life has been estimated to be less than 5 minutes (98, 210). As the level of OB2B decreases, proteosomal degradation ceases and HIF-1 protein accumulates. In this manner, HIF-1 is capable of responding rapidly to changes in OB2B concentrations without having to wait for the lengthier processes of tr anscription and translation. The destruction of HIF-1 in the presence of OB2B is facilitated by tumor suppressors such as VHL. Loss of VHL, as occurs in von Hippel-Lindau (VHL) disease, results in normoxic expression of HIF-1 and re-introduction of wildtype VHL eliminates HIF-1 expression (147). It was determi ned that VHL physically interacted with HIF-1 in a region known as the oxygen-dependent degradation domain (ODD), mediating its ubiquitination and proteosomal degradation (figure 2) (195). Although it was known that interaction of HIF-1 and VHL only occurred in the presence of OB2B, and this interaction was abolished during hypoxia or treatment with iron chelators such as

PAGE 25

FIGURE 2. Structure of HIF-1 and regulation by prolyl hydroxylation. The basic helix-loop-helix (bHLH) domain and Per-Arnt-Sim (PAS) domain are required for dimerization and DNA binding. There are two transactivation domains, an amino-terminal transactivation domain (TAD-N, or NAD) and a carboxyl-terminal transactivation domain (TAD-C, or CAD). An asparagine residue in the CAD is subjected to hydroxylation by the factor inhibiting HIF (FIH), resulting in increased transcriptional activity during hypoxia. Stability of the alpha subunit is mediated by the oxygen dependent degradation (ODD) domain. Two prolyl residues within the ODD are subjected to hydroxylation by the prolyl hydroxylase (PHD) enzymes during normoxia, which facilitate interaction with the E3 ubiquitin ligase VHL and result in HIF-1 destruction. 14

PAGE 26

15 CoClB2B, it was not known how the actual level of oxygen was sensed. The mechanism of oxygen sensing became apparent with the discovery that VHL was only able to interact with HIF-1 when several critical conserved proline residues within the ODD were in a hydroxylated state (105, 106, 229). The enzymes responsible for hydroxylation of proline residues 402 and 564 were found to belong to a group of prolyl hydroxylase domain containing (PHD) enzymes. It was subsequently determined that there were three nonheme containing iron dependent PHD enzymes that share significant homology and facilitate HIF-1 hydroxylation (145). During normoxia the proline residues in the ODD domain are fully hydroxylated, facilitating interaction with the E3 ubiquitin ligase VHL and destruction of HIF-1. As OB2B levels decrease, proline hydroxylation also decreases and the ability of VHL to interact with HIF-1 is diminished. In this manner, PHD enzymes control the rate of HIF-1 degradation in response to variations in oxygen availability. In addition to stabilization during hypoxia, it was known that HIF-1 transcriptional activity was also elevated during hypoxia (111, 164). It was eventually determined that this was dependent on the hydrox ylation state of asparagine residue 803 in the transactivation domain (TAD) of HIF-1. The enzyme responsible for its hydroxylation during hypoxia was determined to be an asparaginyl hydroxylase, also known as factor inhibiting HIF-1 (FIH-1) (132). During normoxia, the asparagine residue 803 is hydroxylated disrupting interactions between HIF-1 and the transcriptional coactivator CBP/p300 (10, 48, 90, 131, 132). During hypoxia, asparaginyl hydroxylation is diminished, and interaction with CBP /p300 is increased. In this manner, both the amount of HIF-1 protein and its transcriptional activity is elevated during hypoxia.

PAGE 27

16 Regulation of HIF-1 by growth signaling In addition to regulation by changes in oxygen levels, HIF-1 is regulated by receptor and non-receptor tyrosine kinases activity. Examples of growth signals, hormones, and cytokines capable of inducing HIF-1 are numerous, and include insulin (191, 204, 234), insulin-like growth factor-1 (IGF -1) (234), insulin-like growth factor-2 (IGF-2) (51), PDGF (170), EGF (236), HGF (193), TNF (89), IL-1 (89, 191, 200), angiotensin-2 (170) and thrombin (74, 170) (Table 2). Not only is HIF-1 induced by ligand stimulation of membrane bound receptors, multiple studies have shown that oncogene (TKs and RTKs) overexpression (or over activtity) can also elevate HIF-1 levels. Examples of these include HER2PNEU P(133), Ras (28, 148) v-Src (109). In contrast to stabilization of HIF-1 as occurs during hypoxia, its induction by growth signals has been shown to function by increa sing the rate of its synthesis. This was demonstrated through the use of the translation inhibitor cyclohexamide and pulse labeling experiments (64, 133, 204). The majority of these studies implicated members of the kinase cascade involving the tyrosine kinase PI3-kinase (PI3K) and the serinethreonine kinases AKT (protein kinase B) and FRAP (FKBP/rapamycin-associated protein, also known as mTOR, mammalian target of rapamycin), as critical for this enhanced rate of translation. The importance of these kinases was demonstrated repeatedly through the use chemical inhibi tors (64, 191, 204, 236) and dominant negative versions (236). In addition, loss of the tumor suppressor phosphatase and tensin

PAGE 28

17 TABLE 2. Regulators of HIF-1 expression or function. Pathway Effects on HIF-1 Reference Ligands of tyrosine kinase receptors EGF Increased translation (236) IGF-1 Increased translation (234) IGF-2 Increased translation (51) Insulin Increased translation (191, 204, 234) Heregulin Increased translation (133) PDGF Increased translation (170) Ligands of other receptors Thrombin Increased translation (74, 170) Angiotensin Increased translation (170) Oncogenes MAPK Increased transactivation (169) RAS Increased translation (28) v-Src Increased translation, increased transcription (109) c-Src Increased translation (116) PI3K/AKT Increased translation (64, 191, 204, 236) Tumor suppressors PTEN Decreased translation (238) VHL Increased degradation (147) P53 Increased degradation (167)

PAGE 29

18 homologue deleted on chromosome 10 (PTEN), a negative regulator of AKT, or expression of constitutively active AK T also increased levels of HIF-1 (236, 238). Furthermore, induction of HIF-1 by non-receptor tyrosine kinases such as c-Src (pp60csrc) (116), v-Src (109), and Ras (28, 148) function via increased translation which is dependent on the PI3K/AKT/FRAP pathway. The ability of the PI3K/AKT/FRAP kinase cascade to increase the rate of HIF-1 synthesis probably depends on the ability of FRAP to phosphorylate two important components of the translational machinery; eIF4E binding protein 1 (4E-BP1) and p70 S6 kinase (S6K) (11) (Figure 3). Following phosphorylation, 4E-BP1 loses the ability to inhibit eukaryotic translation initiation factor 4E (eIF-4E), resulting in increased recruitment of 40S ribosomal subunit to the 5 cap structure of the mRNA (11). In addition, phosphorylated FRAP activates S6K which enables activation of the 40S ribosomal protein S6, resulting in increas ed transcription of mRNAs with a 5 polypyrimidine tract (70, 208). The ability of the PI3K/AKT/FRAP kinase cascade to increase the rate of HIF-1 synthesis is dependent on the presence of the 5-UTR of the HIF-1 mRNA, as removal of this sequence abolished the effects of heregulin (133). In addition to HIF-1 regulation by the PI3K/Akt pathway, it has been reported that MAPK signaling is instrumental in receptor mediated activation of HIF-1 (64). Although its role in regulation of HIF-1 is not as well studied as PI3K/AKT, activation of p42/p44 MAPK seems to result in transcriptional activation of HIF-1 (152, 169, 188). Direct phosphorylation of HIF-1 by MAPK has been reported (152, 169), and the probable result of HIF-1 phosphorylation is increased transcriptional activation by

PAGE 30

FIGURE 3. Mechanism of HIF-1 regulation by growth signaling Activation of PI3K results in a kinase cascade involving AKT and mTOR. Activated mTOR phosphorylates p70 S6 kinase (S6K) which in turn phosphorylates S6, increasing transcription of mRNAs with a 5 polypyrimidine tract. Furthermore, activated mTOR phosphorylates eIF-4E binding protein 1 (4E-BP1), which consequently loses its ability to inhibit eukaryotic translation initiation factor 4E (eIF-4E). Unrepressed eIF-4E facilitates recruitment of 40S ribosomal subunit to the 5 cap structure of the mRNA. 19

PAGE 31

20 disrupting interactions with FIH, the transcriptional suppressor of HIF-1 (11). Furthermore, several groups have reported MA PK activation by hypoxia in several cell lines (34, 148, 152) so it is possible that MAPK activity enhances both signal mediated and hypoxic transcriptional activation of HIF. Signal transducer and activator of transcription Signal transducers and activators of transcription (STATs) are a group of transcription factors that in the unphosphorylat ed form exist in a latent state in the cytoplasm (138). STATs undergo tyrosine phosphorylation by a variety of tyrosine kinases, including both receptor tyrosine kina ses (RTKs) and non-receptor TKs (figure 4). Many membrane bound receptors do not have in trinsic tyrosine-k inase activity, and therefore require the assistance of the J anus Kinase (JAKs) (23). Furthermore, STAT phosphorylation can result from the activity of non-receptor tyrosine kinases such as Src and Abl (37, 228). Phosphorylation of a single tyrosine residue near the carboxy terminus results in homoor hetero-dimerization vi a interaction with the Src-homology-2 (SH2) domain of the other STAT protein (186). Furthermore, several STAT proteins undergo serine phosphorylation in t he carboxy-terminal transact ivation domain resulting in increased transcriptional activity (217). Following tyrosine phosphorylation and translocation to the nucleus, Stats bind to promoters containing the consensus sequences TT(NB4B)AA and TT(NB5B)AA (179). Stats control a variety of genes, particularly those involved with cell growth, survival, and immune function (230).

PAGE 32

FIGURE 4. Stat3 signaling pathway. Binding of growth factors or cytokines to their receptors results in activation of intrinsic receptor tyrosine kinase activity or recruitment and activation of receptor associated kinases such as janus kinase (JAK). The cytoplasmic tail of the receptor undergoes phosphorylation providing a docking site for non-phosphorylated latent Stat monomers. Recruited Stats undergo tyrosine phosphorylation, followed by dimerization and translocation to the nucleus. Phosphorylated Stat homoor hetero-dimers bind to and activate promoters of genes involved with survival, growth, immunity and angiogenesis. 21

PAGE 33

22 There are seven isoforms of Stat proteins Stat1, Stat2, Stat3, Stat4, Stat5a, Stat5b, and Stat6. Of these different isoforms, Stat1, Stat3, and Stat5 are commonly activated in a variety of cancers (23). However, because Stat1 is primarily growth suppressive, it is not likely that it contributes to oncogenesis (19). There is a w ealth of evidence to indicate that Stat3 and Stat5 are important for t umor progression. Stat5 is commonly activated in and appears to be important for various leukemias (23). On the other hand, Stat3 is activated in a wide variety of cancer types, including leukemia (76), multiple myeloma (25), breast cancer (66, 213), head and neck cancer (80), prostate cancer (157) and melanoma (158). There is an abundance of evidence defining a crit ical role for Stat3 in oncogenesis (15, 17). Transfection of cells with Stat3C, in which substitution of two residues with cysteine results in spontaneous dimeriza tion and constitutive activity, results in transformation and tumor formation in nude mice (20). Furthermore, Stat3 is necessary for cellular transformation mediated by v-Src (1 8, 205). It is well established that Stat3 signaling contributes to oncogenesis by preventing apoptosis (25, 79, 80) and blocking Stat3 signaling induces apoptosis in a variety of tumors (25, 80, 158). Inhibition of Stat3 signaling prevents expression of Bcl-xBL,B an important anti-apoptotic protein (25, 80, 158). Furthermore, it has also been demonstrated that Stat3 controls cell cycle progression by regulating D1 (20). These reports and others firmly establish Stat3 as an important facilitator of oncogenesis. Although Stat3 itself is not mutated in tumors, it is activated by and required for the transforming capabilities of many oncogenic proteins. For example, Stat3 is activated in cells transformed with v-Src and v-Abl oncogenes (37, 228) and is required for the

PAGE 34

23 transforming ability of v-Src (14, 18, 205). Furthermore, Stat3 is induced by a variety of cytokines and growth factors commonly over-expressed by cancer ce lls, including EGF, PDGF, and IL-6 (14, 25, 80, 157) These reports and others dem onstrate that Stat3 is an important facilitator for many oncogenic proteins. Stat3 and angiogenesis There is accumulating evidence that Stat3 is an important facilitator of tumor angiogenesis. Stat3 activation correlates with VEGF production in a variety of human cancers, including breast, head and neck, melanoma, and pancreatic cancer cell lines (159, 214) as well as VEGF mRNA in pancrea tic cancer specimens from patients (214). Furthermore, many of the growth/oncogenic sign aling pathways capab le of increasing VEGF production also result in activation of Stat3. For example it has been reported that activation of both EGFR and Src signaling pa thways result in increased production of VEGF (47, 155, 161, 218), and it is well documented that stimulation of these pathways results in Stat3 activation (18, 66, 67, 79, 205, 228). These data indicate that there is a strong correlation between Stat 3 activation and VEGF expression in a variety of cancers. Several publications have shown that Stat3 is required for VEGF expression in various cancer cell lines. Bl ocking constitutive Stat3 activity in tumor cells with a dominant negative version downregulates basal levels of VEGF expression (159, 214). Furthermore, it has been shown that Stat3 is necessary for VEGF induction resulting from both growth signals and tyrosine kinases. In cells transformed with v-Src there is high expression of VEGF and Stat3 activity, and bl ocking Stat3 significantly reduces VEGF

PAGE 35

24 levels (159). Induction of VEGF in by IL-6 or glycoprotein (gp) 130 (a subunit of the IL6 receptor) is dependent on Stat3 signaling (65, 215). Furthermore, Stat3 is required for VEGF induction by oncostatin-M (OSM) in an astroglioma cell line (168). Transfection with Stat3C results in constitutive Stat3 activation and induces VEGF expression in both normal fibroblas ts and B16 tumor cells (159). Furthermore, B16 cells transfected with Stat3C demons trated increased angiogenes is when placed in matrigel and inserted into C57BL/6 mice (159). A putative Stat3-responsive element (SRE) sequence spanning to successfully competed with hSIE probe (159) and itself was able to function as a probe in EMSA (214). Furthermore, VEGF promoter activation by v-Src and constitutively activ ated Stat3 was abrogated when this same sequence was mutated (159, 214). Stat3 binding to the VEGF promoter in vivo was confirmed by chromatin immunoprecipitation assays in v-Src transformed NIH3T3 cells (159). These reports establish that Stat3 increases VEGF production by directly binding to and activating its promoter. In addition to its effects on VEGF, Stat3 ha s been implicated as a facilitator of angiogenesis by other mechanisms. It has recently been demonstrated that Stat3 regulates expression of both MMP-2 and MMP-9, important facilitators of both angiogenesis and metastasis (41, 149, 223). It has also been report ed that Stat3 is necessary for signaling by receptors associated with angiogenic ligand s, including bFGFR and VEGFR (7, 42, 176). Furthermore, it has been demonstrated that Stat3 is necessary for the mitogenic effects of the angiogenic factor PDGF (14). It has also been reported that Stat3 is required for endothelial cell migration and microvascular tube formation (225). These data implicate Stat3 as a key facilitator of angiogenesis beyond regulation of VEGF.

PAGE 36

25 It has recently been report ed that there is a combined requirement for both Stat3 and HIF-1 for maximum VEGF induction by h ypoxia or Src (82). Through the use of CHIP assays, the authors show that HIF-1 and Stat3 bind simultaneously to the VEGF promoter in response to activat ed Src or the hypoxia mimic CoClB2B. They also demonstrate that both Stat3 and HIF-1 are required for maximum activity of a luciferase reporter construct under the control of the VEGF promoter. When either HIF-1 or Stat3 was blocked with a dominant negative version, th ere was an equivalent loss of reporter activity. Furthermore, they show that both HIF-1 and Stat3 coimmunoprecipitate with each other as well as the transcriptional activat or p300. It is not entirely surprising that they could form a complex on the VEGF promot er, as the HIF-1 binding site spans to and the Stat3 binding site is 86 bp downstream at to (62, 159). Although the authors demonstrate that both HIF-1 and Stat3 are required for VEGF expression, they do not show the effects of blocking Stat3 activity on HIF-1 expression.

PAGE 37

26 OBJECTIVES The overall objective of the studies conducted in this dissertation was to investigate the role of Stat3 in regulati ng tumor angiogenesis, in particular expression of HIF-1 and VEGF. It had recently been determined that Stat3 is a transcriptional activator of VEGF, and is essential for angi ogenesis (159, 214). However, the role of Stat3 in regulating HIF-1 the other main transcriptiona l regulator of VEGF, had not been examined. Results from preliminary experiments suggested that blocking Stat3 prevented both basal level expression and the hypoxic induction of HIF-1 These findings lead to the hypothesis that Stat3 is required for HIF-1 expression, and blocking Stat3 signaling could abrogate both tyrosine kinase and hypoxia i nduced HIF-1 activity and VEGF expression. In order to verify this hypothesis, the following aims were pursued. Aim I. To determine the role of Stat3 in HIF-1 expression induced by growth signals. (A) To determine the mechanism by which IL-6 induces HIF-1 expression It had been reported that stimulation of a variety of receptor tyrosine kinases results in increased HIF-1 levels during normoxia (64, 133, 204, 236). However, it had not been determined if stimulation with IL-6 resulted in elevated levels of HIF-1 Because Stat3 is an

PAGE 38

27 important facilitator of IL-6 signaling, the role of Stat3 in IL-6 induced HIF-1 expression was examined. (B) To determine if Stat3 is required for HIF-1 induction by oncogenic growth signals other than IL-6. Multiple growth signals that activate Stat3 also result in elevated expression of HIF-1 during normoxia. For example, stimulation with epidermal growth factor (EGF) incr eases both Stat3 activation and HIF-1 expression (236, 237). Because it had been observed th at Stat3 was required for HIF-1 induction by IL-6, experiments were performed to determine if Stat3 was also requ ired for increased HIF-1 expression resulting from heregulin and EGF. Aim II. To determine the role of Stat3 in the cellular response to hypoxia. (A) To determine if Stat3 is required for the hypoxic induction of HIF-1 and hypoxia inducible genes. It has been reported that inhibiting the AKT/PI3K pathway does not limit the induction of HIF-1 by hypoxia (2, 6). This suggests that expression of HIF-1 due to growth signaling and hypoxia result from separate and independent mechanisms. Because it had been observed that blocking Stat3 signaling prevented both basal HIF-1 expression and its induction by growth signals, experiments were performed to determine if the hypoxic induction of HIF-1 was also prevented. Furthermore, the role of Stat3 in the hypoxic induction of VEGF and MMP-2 was examined.

PAGE 39

28 (B) To characterize Stat3 activation by hypoxia. HIF-1 is an important regulator of the VEGF gene in response to hypoxia. Because it has been reported that Stat3 is also a transcriptional regulator of VEGF, and pr eliminary experiments in the laboratory suggested that Stat3 was necessary for HIF-1 induction by hypoxia, Stat3 activation by hypoxia was examined. Furthermore, the time-course of Stat3 activation in relation to HIF-1 and VEGF induction was studied.

PAGE 40

29 MATERIALS AND METHODS Reagents and antibodies The following reagents and antibodies were purchased from various companies as indicated: Interleukin 6 (BD Pharmin gen); heregulin (Sigma); EGF (Sigma); Cyclohexamide (Calbiochem); G418 (Cellgro); CoClB2B (sigma); Anti-VEGF monoclonal antibody (R&D); Anti-HIF-1 polyclonal antibody and Anti-actin monoclonal antibody (Santa Cruz Biotechnology); Anti-HIF-1 monoclonal antibody (NOVUS Biologicals); Anti-Phospho-Akt (Cell Si gnaling). Anti-Akt1 monoclonal antibody was a kind gift from Dr. J. Cheng (University of South Florida College of Medicine, Tampa). Cell lines and cell culture BALB/c-3T3 fibroblasts and v-Src-transformed BALB/c 3T3 fibroblasts were grown in Dulbeccos modification of Eagles medium (D MEM) with 10% calf serum (CS) and 1% antibiotic-antimycotic (Gibco). MCF-7, DU-145, and A2058 tumor cells were grown in RPMI 1640 with 10% FBS and 1% antibiotic-antimycotic. BALB/c fibroblasts were a gift from Dr. Jack Pledger (H. Lee Moffitt Cancer Center, Tampa, Florida). BALB/c fibroblasts transformed with v-Src were a gift from Dr. Richard Jove (H. Lee Moffitt Cancer Center, Tampa, Florida). A2058 human melanoma, DU145 human prostate

PAGE 41

30 cancer and MCF-7 human breast cancer cells were obtained from ATCC (Rockville, MD). For culture under hypoxia, cells were placed in a modular incubator chamber (Billups-Rothenberg). The chamber was sealed and flushed with a gas mixture containing 1% OB2B, 5% COB2B, and 94% NB2 Bfor 10-15 minutes, and then incubated at 37 C. Treatment With Src Tyrosine Kinase Inhibitors PD166285 (127) and PD180970 (127) were dissolved in 100% dimethyl sulphoxide (DMSO) and stored at -80PoPC. The stocks were diluted into the media, immediately prior to use. Generation of cell lines stably transfected with Stat3 siRNA The Stat3 siRNA oligonucleotide, AATTAAAAAAGTCAGGTTGCTGGTCAAATTCT CTTGAAATTTGACCAGCAACCTGACTTCC, was inserted into pSilencer 1.0-U6 siRNA expression vector (Ambion). To generate siRNA/Stat3 stable tumor cell clones, the pSilencer 1.0-U6 Stat3 siRNA expression vector (1ug) was co-transfected with pcDNA3 (0.1 g) into MCF-7 and A2058 cells using Lipofectamine (Invitrogen) as described below, followed by selection with hygromycin (300 g/ml). MCF-7 and A2058 clones stably transfected with the empty pSilencer/pcDNA3 were used as a control.

PAGE 42

31 Retrovirus infection The stable retrovirus-producing cell lines HEK 293T expressing Stat3D and MSCV (the control retrovirus vector) were generous gifts from Dr. D. Link (Washington University, Seattle). For retrovirus infection, supernat ant was collected from confluent retrovirusproducing cells following a 48 hour incubation. The supernatant was supplemented with 8 g/ml polybrene. BALB/c-3T3 v-Src cells were seeded at 1.5 X 10P6 Pin a 10cm plate the day prior to infection. The following day, cells were cultured in vira l supernatant for 4-8 hours, then the viral super natant was replaced with normal growth media. This was repeated up to three time s until 100% infection efficiency had been achieved, as visualized by fluorescent microscopy. Anti-sense oligonucleotide and Stat3 siRNA transient transfections For transfection with antisense oligonucleotide, human tumor cells were seeded in 6-well plates at 2.5 x 10P5P or 10cm dishes at 1.5 x 10P6P for 18-24h prior to transfection. Cells were transfected with either 1 g of plasmid DNA or 300 nM oligonucleotide using Lipofectamine and Lipofectamine plus reagents (Life Technologies), according to the manufacturers protocol. The sequence fo r Stat3 antisense oligonucleotide was 5GCTCCAGCATCTGCTGCTTC-3. The sequence for control oligonucleotide was 5 GCTCCAATACCCCGTTGCTTC-3. For transi ent transfection with Stat3 or HIF-1 (Dharmacon), cells were seeded at 2.5 x 10P5 Pper well of 6-well plates 18-24h prior to

PAGE 43

32 transfection. Cells were transfected with 10-50nM siRNA using transit TKO transfection reagent (Mirus), according to the manufacturers protocol. Preparation of whole cell and nuclear extracts For preparation of whole cell extracts, cel ls were washed 3x with ice cold phosphatebuffered saline (PBS), scraped into PBS and pelleted by centrifugation at 2500 x g for 5 min at 4C. Pellets were resuspended in RIPA triple detergent lysis buffer (50 mM Tris (pH 7.4), 5 mM EDTA, 150 mM NaCl, and 0.5% Triton-X-100, 1 mM PMSF, 2 g/ml leupeptin, 2 g/ml aprotinin, and 2 g/ml pepstatin), then incubated on ice for 30 min. Lysates were centrifuged at 15000 x g for 30 min. Supernatants were collected and protein concentration was determined using the Bradford assay. For preparation of nuclear extracts, cells were washed 3x with ice cold PBS (supplemented with 100 mM NaB3BVOB4B, 100 mM NaF), scraped into PBS and pelleted by centrifugation at 2500 x g for 5 min at 4 C. Pellets were resuspended in hypotonic buffer A (10mM Tris-HCl (pH 7.6), 1.5 mM MgClB2, B10 mM KCl, 2mM DTT, 0.4 mM PMSF, 1mM NaB3BVOB4B, 2 g/ml leupeptin, 2 g/ml aprotinin, and 2 g/ml pepstatin) then centrifuged at 2500 x g. Cells were resuspended in buffer A + 1% NP-40 then incubated on ice for 10 min. Cells were centrifuged for 10 min at 10,000 x g. The supernatant (cytoplasmic extract) was discarded, and the pellet was resuspended in hypertonic buffer C (0.42 M KCl, 20 mM Tris-HCl (pH 7.6), 20% glycerol, 1.5 mM MgClB2B, 2mM DTT, 0.4 mM PMSF, 1 mM Na3VO4, 2 g/ml leupeptin, 2 g/ml aprotinin, and 2 g/ml pepstatin). Following

PAGE 44

33 stirring for 30 min at 4 C, extracts were spun at 15,000 x g for 30 min. Supernatants were collected (nuclear extra ct) and concentration was determine d using the Bradford assay. Western Blotting Equal amounts of whole cell or nuclear extract (30-50 g of NE or 100 g of WCE) were dissolved in Laemmli SDS-PAGE sample buffer (100mM Tris-HCl (pH 6.8), 4% SDS, 0.2% Bromophenol, 20% glycerol, 2% 2-mercaptoethanol, 1mM DTT) and boiled at 100C for 5 min prior to separation by SDS-polyacrylamide gel electrophoresis. Samples were applied to 8% polyacrylamide gels fo r nuclear extracts and 12% polyacrylamide gels for whole cell extracts. Electrophores is was generally performed at 50 V for approximately 16 hours. For transfer, the Gel, PVDF membrane (Millipore), and filter papers were soaked in transfer buffer (25 mM Tris base, 192 mM glycine, 20 % Methanol) for approximately 5 min. The gel and membrane were sandwiched between the filter papers and placed in a semidry electroblotter (Owl Separation Systems). Transfer was generally performed at 200 mAmps for 4 hours (current varied depending on gel size, but never exceeded Area (cm) X 3 mAmps). Following transfer, even loading and transfer was confirmed by staining t he membrane with Ponceau S solution (Sigma). The membrane was blocked by incubation for 1 hour at room temperature in blocking buffer (PBS containing 5% non-fat dry milk and 0.1% Tween). Membranes were probed with primary antibody dissolved in blocking bu ffer at the followi ng concentrations: HIF1 rabbit polyclonal (H-206) (1:500 dilution), HIF-1 mouse monoclonal (1:1,500 dilution), B-actin mouse monoclonal (1 :5000), AKT1 mouse monoclonal (1:1,000

PAGE 45

34 dilution), phospho-AKT rabbit polyclonal (1:1,000 dilution), and VEGF mouse monoclonal antibody (1:500 dilution). Probing with primary antibodies was performed for 3 hours at room temperature or overnight at 4 C. Membranes were washed with washing buffer (PBS with 0.1% Tween) twice for 5-10 min each. Membranes were probed with secondary antibody dissolved in blocking buffer at the following concentrations for one hour: Horseradish peroxidase-conjugated sheep anti-mouse (1:2,500) and donkey anti-rabbit (1:5,000). Following incubation with secondary antibody, membranes were washed with washing buffer for 15 min three times. The signal was developed with SuperSignal West Pico Chemiluminescent Substrate (PIERCE) according to manufact urers instructions. Electrophoretic Mobility Shift Assay (EMSA) Binding reactions were carried out in a total volume of 20ul containing 4-8 g of normalized nuclear extract in (10 mM HE PES, 10% glycerol, 1 mM DTT, 0.1g/ l poly (dI:dC), 0.5 g/ul BSA, 80mM NaCl). The P32PP-radiolabeled hSIE (Stat3 and Stat1 specific high affinity Sis-Inducible El ement, 5-AGCTTCATTTCC CGTAAATCCCTA) probe was added and samples were incubated for 30 min at 30 C. Following the binding reaction, protein-DNA complexes were resolved by 5% non-denaturing polyacrylamide gel electrophoresis (PAGE). Electrophoresis was carried out at 200 V in 0.25 X Trisborate-EDTA (TBE) (1x TBE is 89 mM Tris-HCl, 89 mM boric acid, and 5 mM EDTA) for 2-3 hours. Gels were fixed with fixing buffer (10% Methanol, 10% acetic acid),

PAGE 46

35 vacuum dried at 80 C for 2 h, and autoradiographed with intensifying screens at C for 1 to 5 days RNA isolation and Northern blotting Total RNA was isolated (from 1.5 x 10P6P cells seeded in 10-cm dishes) using TRIzol reagent (Invitrogen) according to the manufacturers instructions. 15g aliquots were added to 15ul loading buffer (Sigma) and samples were denatured at 65 C for 15 min. Samples were loaded into a 1% agarose-formaldehyde gel (containing ethidium bromide) and electrophoresed at 80 volts for approximately 5 hours in 1X MOPS (10X Mops is 0.4 M Morpholinopropanesulfonic acid, 0.1 M Sodium acetate HB2BO, 10 mM EDTA-NaB2B-2 HB2BO, pH 7.2) solution. Prior to transfer, the gel was photographed under UV light to verify equal loading by visualization of the 18S and 28S rRNA bands. The gel, nylon membrane (PerkinElmer), and whatman filter paper were presoaked in 10X SSC prior to transfer. RNA was transferred to membrane in 10x standard saline citrate (SSC) by upward capillary transfer. The membrane was washed briefly in 2X SSC and ultra-violet cross-crosslinked using a UV-Stratalinker 2400 (Stratagene, La Jolla, CA, USA). For preparation of the HIF-1 probe, the entire HIF-1 cDNA (3.2 Kbp) was P32PPradiolabeled using All-in-OnePTMP random primer DNA labeling mix (-dATP) (Sigma) according to the manufacturers protocol. The radiolabeled cDNA was purified using a G-25 sephadex column (Roche) according to the manufacturers protocol. To detect the HIF-1 transcript, the membrane was first pre-hybridized at 68C for at least 5 min in hybridization buffer (Sigma). The radiolabelled cDNA was denatured by heating to

PAGE 47

36 100C for 10 min followed by placement on ice for 2 min. The denatured probe was added to the warm pre-hybridization solution, and the membrane was hybridized overnight at 42 C. The following day, the membrane was washed at least twice at 60 C with 2x SSC for 15 min, and then exposed to a phosphoimaging plate for 3 hours (Molecular Dynamics).

PAGE 48

37 RESULTS Aim I: To determine the role of Stat3 in HIF-1 expression induced by growth signals. IL-6 increases levels of HIF-1 protein Multiple studies have shown that HIF-1 expression is increased by a variety of growth/oncogenic signals. Examples of these signals include heregulin (133), EGF (236), IGF-1 (234), TNF (89), IL-1 (89, 191, 200) and others. In addition to HIF-1 many of these signals also increase expression of VEGF (32, 63, 139, 174). Although it has been reported that stimulation with IL-6 results in increased production of VEGF (33, 38), it has not been demonstrated that it increases HIF-1 expression. Here we demonstrate that stimulation of MCF-7 human breast cancer with IL-6 results in increased expression of HIF-1 protein in a dose dependent manner (Figure 5). MCF-7 cells were serum starved for 20 hours followed by stimulation with IL-6 in serum free media at the indicated concentrations for 6 hours. Nuclear extracts were collected and western blot analysis was performed. N uclear extracts are used throughout this dissertation for the detection of HIF-1 by Western blot. Although HIF-1 can be detected using whole cell extracts, levels ar e low and the bands are often weak due to the extremely short half-life of HIF-1 under normoxia. Band intensity and broadness is significantly increased through the use of nuclear extracts.

PAGE 49

FIGURE 5. IL-6 increases HIF-1 protein in MCF-7 breast cancer cells. MCF-7 cells (1.5 x 10P6P) were cultured for 20h in serum free media followed by treatment with IL-6 in serum free media at the indicated concentrations for 6h. Nuclear extracts (30ug) were analyzed by western blotting using the indicated antibodies. HIF-1 and -actin are used to verify equal loading. 38

PAGE 50

39 The vast majority of reports concerning HIF-1 regulation by growth signals and cytokines indicate that i ncreased expression of HIF-1 occurs without a concurrent increase in mRNA (11), however exceptions have been reported (200). To determine if this was true for IL-6, total RNA was co llected from MCF-7 cells following treatment with IL-6 for 6h and analyzed by Northern blotting (Figure 6). Results demonstrate that the increase in HIF-1 levels resulting from IL-6 sti mulation of MCF-7 cells cannot be accounted for by changes in levels of mRNA. IL-6 increases HIF-1 expression by increasing its rate of synthesis A majority of studies show that increased expression of HIF-1 resulting from stimulation with growth/oncogenic signals is due to an increase in the rate of its synthesis. Examples include heregulin (133), insu lin (204), and IGF-1 (64), in which the authors directly show that elevated levels of HIF-1 were the result of an increased rate of synthesis. This was demonstrated through the use of the translation inhibitor cyclohexamide (CHX) and/or pulse labeling experiments. In contrast, increased HIF-1 expression resulting from hypoxia is due to protein stabilization, or cessation of the continuous degradation that occurs during normoxia. To determine if IL-6 stimulation re sults in an increased rate of HIF-1 synthesis or in a decreased rate of degradation, cyclohexamide was utilized. If IL-6 stimulation stabilizes HIF-1 protein, the addition of cyclohexamide to halt protein synthesis

PAGE 51

FIGURE 6. IL-6 does not increase HIF-1 mRNA in MCF-7 breast cancer cells. MCF-7 cells (1.5 x 10P6P) were cultured for 20h in serum free media followed by treatment with IL-6 in serum free media at the indicated concentrations for 6h. RNA (15ug) was analyzed by Northern blotting using a HIF-1 cDNA probe. A photograph of the ethidium bromide-stained gel indicates equal loading as demonstrated by the 18S and 28S rRNA bands. 40

PAGE 52

41 following pre-treatment with IL-6 would not affect levels of HIF-1 However, if IL-6 increases the rate of HIF-1 synthesis, then the addition of CHX would counteract this and a rapid loss of HIF-1 protein would occur. To determine which of these was occurring, MCF-7 cells were treated with IL-6 for 6h followed by extraction of nuclear proteins and Western blot analysis (Figure 7). HIF-1 levels were significantly decreased as soon as 15 min following addition of CHX and returned to baseline within 1 hour, demonstrating that increased HIF-1 expression resulting from IL-6 stimulation is due to an increased rate of synthesis. Stat3 is required for IL-6 induction of HIF-1 Many of the growth/oncogenic signals that increase HIF-1 expression also result in activation of Stat3. It is well establis hed that Stat3 is activated in response to stimulation with IL-6 (237). Furthermore, it has been reported that IL-6 results in increased production of VEGF (33, 38) and Stat3 is essential for this effect (215). We have shown here that IL-6 stimulation upregulates HIF-1 expression by increasing the rate of its synthesis. Because it was know n that blocking Stat3 signaling prevented VEGF induction by IL-6 (215), as well as tu mor angiogenesis (159, 214), we wanted to determine if HIF-1 expression resulting from IL-6 stimulation was also dependent on Stat3 signaling. MCF-7 cells were stably transfected with pSilencer expressing Stat3 siRNA, or with empty pSilencer. These cells were trea ted with IL-6 for 6 hours in duplicate and both whole cell and nuclear extracts were coll ected. Western blot analysis was performed

PAGE 53

FIGURE 7. IL-6 induced HIF-1 levels are due to synthesis and not cessation of degradation. MCF-7cells (1.5 x 10P6P) were cultured for 20h in serum free media followed by treatment with IL-6 (20 ng/ml) in serum free media for 6h. Cyclohexamide (100M) was added for the indicated times. Nuclear extracts (30g) were analyzed by western blotting using the indicated antibodies. HIF-1 and -actin are used to verify equal loading. 42

PAGE 54

43 to determine the levels of HIF-1 and VEGF. Results indicate that when Stat3 is silenced in MCF-7 cells, levels of HIF-1 are significantly lower compared to the control in both untreated and IL-6 treated cells (Figure 8) Furthermore, VEGF levels are dramatically reduced both at the basal level and follo wing induction by IL-6 (Figure 8). It is well documented that induction of HIF-1 by growth/oncogenic signals is due to increased synthesis. Furthermore, this increased rate of synthesis is the result of activation of growth signaling pathways, in particular the PI3K/AKT pathway (11). It is known that stimulation with IL-6 results in PI3K/AKT activation (88). Also, through correspondence with Dr. J. Cheng (University of South Florida College of Medicine, Tampa), we learned that Stat3 is a direct transcriptional activator of the AKT-1 gene. This suggested to us the potential mechanism that Stat3 may be regulating HIF-1 induction by controlling expression of AKT-1. To determine if Stat3 regulates Akt expression in MCF-7 cells, both total levels of Akt1 and phosphorylated levels of Akt1 and Akt2 were examined in cells stably transfected with Stat3 siRNA. Treatment with IL-6 resulted in increased levels of total Akt1 and phosphorylated Akt1 and Akt2 (figure 9). Following silencing of Stat3, basal levels of Akt1 as well as its induction by IL-6 was abolished. Furthermore, phosphorylated levels of both Akt1 and Akt2 were dramatically reduced. These results suggest a potential mechanism by which Stat3 regulates HIF-1 expression.

PAGE 55

FIGURE 8. Silencing Stat3 blocks IL-6 induction of HIF-1. MCF-7 cells were stably-transfected with empty pSilencer/pcDNA3 or pSilencer/pcDNA3 with Stat3 siRNA. Cells were serum starved for 20h followed by treatment with or without IL-6 (20 ng/ml). Nuclear extracts (30g) (Top panel) and whole cell extracts (100g) (middle panel) were analyzed by Western blotting using the indicated antibodies. Stat3 DNA binding was determined by EMSA using nuclear extracts (8ug) (bottom panel). 44

PAGE 56

FIGURE 9. Silencing Stat3 decreases AKT levels. MCF-7 cells (1.5 x 10P6P), stably-transfected with empty pSilencer or pSilencer-Stat3 siRNA, were cultured in serum free media for 20h followed by treatment with IL-6 for 6h. Whole cell extracts (100g) were obtained and analyzed by Western blotting using the indicated antibodies. The antibody used for detecting phospho-Akt (pAkt) recognizes both Akt1 and Akt2. For the total Akt protein detection, the antibody is specific for Akt1. 45

PAGE 57

46 Stat3 is required for HIF-1 induction by Heregulin Many growth signals capable of activating St at3 also increase expression of HIF1. Examples of these include EGF (236, 237) and PDGF (64, 170, 207) Because we have observed that blocking Stat3 limits the ability of IL-6 to induce HIF-1 we wanted to know if induction of HIF-1 by other growth signals was also prevented when Stat3 was silenced. Comparable to published results (133), we observed a dose dependent induction of HIF-1 when MCF-7 cells were stimulated with heregulin for 6h (Figure 10). Furthermore, coordinate Stat3 activation was observed as determined by EMSA. To determine if Stat3 is required for HIF-1 induction by heregulin, MCF-7 cells expressing Stat3 siRNA were again utilized. Following stimulation with heregulin for 6h, HIF-1 was induced in control cells but not in St at3 siRNA cells (Figure 11). Furthermore, VEGF expression was increased by stimulation w ith heregulin only in control cells. As previously seen in MCF-7 cells, bas al level expression of both HIF-1 and VEGF was blocked. These data show that Stat3 is required for the induction of both HIF-1 and VEGF by heregulin in MCF-7 breast cancer cells. Stat3 is required for HIF-1 induction by EGF In addition to heregulin, it has been reported that stimulation with EGF results in both increased HIF-1 expression (236) and Stat3 activ ation (237). Because we had observed that silencing Stat3 prevented the induction of HIF-1 by Heregulin and IL-6,

PAGE 58

FIGURE 10. Heregulin increases both Stat3 binding and HIF-1 protein in MCF-7 breast cancer cells. MCF-7 cells (1.5 x 10P6P) were cultured for 20h in serum free media followed by treatment with heregulin at the indicated concentrations for 6h. Nuclear extracts (30g) were analyzed by western blotting using the indicated antibodies. Stat3 DNA binding was determined by EMSA using nuclear extracts (8ug) (bottom panel). 47

PAGE 59

FIGURE 11. Stat3 siRNA blocks heregulin induced HIF-1 expression. MCF-7 cells were stably-transfected with empty pSilencer/pcDNA3 or pSilencer/pcDNA3 containing Stat3 siRNA. Cells were serum starved for 20h followed by treatment with or without heregulin (100ng/ml). Nuclear extracts (30g) (Top panel) and whole cell extracts (100g) (middle panel) were analyzed by Western blotting using the indicated antibodies. 48

PAGE 60

FIGURE 12. EGF increases both Stat3 binding and HIF-1 protein in prostate tumor cell line DU-145. DU-145 cells (1.5 x 10P6P) were cultured for 20h in serum free media followed by treatment with EGF at the indicated concentrations for 6h. Nuclear extracts (30g) were analyzed by western blotting using the indicated antibodies. Stat3 DNA binding was determined by EMSA using nuclear extracts (8ug) (bottom panel). 49

PAGE 61

50 we wanted to know if this was also true for EGF. To verify that EGF induced both HIF1 and Stat3 expression in DU145 prostate cancer, cells were treated with various concentrations of EGF for 6h. Consistent with previous reports (236), treatment with EGF results in increased expression of HIF-1 as well as significant activation of Stat3 (Figure 12). To determine if knocking down St at3 expression could prevent induction of HIF-1 by EGF, antisense oligonucleotide was utilized. Following transfection with ASO, cells were treated with EGF for 6 hours and nuclear extracts were obtained for Western blot analysis. Results demonstrate that transfection of cells with ASO results in significantly diminished levels of HIF-1 in both nontreated and EGF treated samples. (Figure 13). These results and those describ ed in previous sections show that Stat3 signaling is necessary for both basal expression of HIF-1 and for its induction by growth signals and cytokines. Aim II. To determine the role of Stat3 in the cellular response to hypoxia. Stat3 is required for HIF-1 induction by hypoxia It is well documented that increased levels of HIF-1 resulting from growth signals are due to increased synthesis, and increased levels by hypoxia result from stabilization and therefore accumulation. It is al so reported that both hypoxic stabilization and growth signal induced tr anslation can increase HIF-1 levels in a cumulative manner. However, several studies indicate th at blocking the PI3K/AKT pathway does not limit the ability of hypoxia to increase HIF-1 levels (2, 6, 113). If silencing Stat3

PAGE 62

FIGURE 13. Stat3 is required for EGF mediated HIF-1 expression. DU-145 cells were transiently transfected with control or Stat3 ASO, serum starved for 20h followed by treatment with EGF (30ng/ml) for 6h. Nuclear extracts (30ug) were analyzed by Western blotting using the indicated antibodies. 51

PAGE 63

52 decreases HIF-1 levels only by affecting AKT, then bl ocking Stat3 signaling should not affect HIF-1 induction by hypoxia. However, if silencing Stat3 also limits HIF-1 induction by hypoxia, then there is likely some other mechanism also at work. Because we had proposed that Stat3 regulates HIF-1 via AKT, we wanted to know if blocking Stat3 signaling could prevent the induction of HIF-1 by hypoxia. Our initial experiments involving HIF-1 induction by hypoxia utilized BALB/c3T3 fibroblasts transformed by the oncoprotein v-Src. These cells have high levels of Stat3 activation as well as HIF-1 expression during normoxia (figure 14). The multiple bands associated with HIF-1 in this figure result from post-translational modifications. When they were transduced with retrovirus carrying the dominant negative Stat3D or empty vector MSCV, Stat3 DNA binding was almost completely ablated. Furthermore HIF-1 expression resulting from v-Src activity was eliminated. When these cells were treated with the hypoxia mimic CoClB2B, HIF-1 expression was strongly induced in the MSCV control cells but not in cells expressing Stat3D (Figure 14). To be certain that the effects we were witnessing in mouse cells also occurred in human cells, we examined the role of Stat3 in the hypoxic induction of HIF-1 in A2058 human melanoma cells. Stat3 is constitutively activated in these cells due to activity of cSrc (158). When A2058 cells were treated with inhibitors of c-Src, Stat3 activation as well as HIF-1 induction by hypoxia was significantly reduced (Figure 15). To determine the effects of silencing Stat3 on HIF-1 induction by hypoxia, A2058 cells stably expressing Stat3 siRNA were created. When these cells were exposed to either 1% OB2B or CoClB2B, HIF-1 induction was significantly limited in St at3 siRNA but not in control cells

PAGE 64

A B FIGURE 14. Stat3 is required for hypoxia induced HIF-1 expression in v-Src transformed Fibroblasts. BALB/c fibroblasts transformed with v-Src were stably transduced with empty vector MSCV or Stat3D. Cells were cultured for 20h in serum free media followed by treatment with the hypoxia mimic CoCLB2B (125uM) for 6h. (A) Nuclear extracts (30ug) were analyzed by Western blotting using the indicated antibodies. SP-1 and -actin are used to verify equal loading. (B) Stat3 DNA binding was determined by EMSA using nuclear extracts (8ug). 53

PAGE 65

FIGURE 15. Treatment with Src inhibitors prevents HIF-1 by hypoxia. A2058 human melanoma cells were seeded at 1.5 x 10P6P approximately 24 h prior to treatment with inhibitors. Cell were treated with Src inhibitors in serum free media for approximately 18 hours, and then incubated under hypoxia in the presence of inhibitors for 6 hours. Nuclear extracts (30g) were analyzed by Western blot using the indicated antibodies. 54

PAGE 66

FIGURE 16. Stat3 is required for HIF-1 induction by hypoxia in A2058 melanoma cells. A2058 cells were stably-transfected with empty pSilencer or pSilencer-Stat3 siRNA. Cells were serum starved for 20h followed by culture under conditions of 21% OB2B, 1% OB2B, or treatment with CoCLB2B (150uM). Nuclear extracts (30g) (Top panel) and whole cell extracts (30g) (middle panel) were analyzed by Western blotting using the indicated antibodies. 55

PAGE 67

56 (Figure 16). These data clearly indicate that inhibition of Stat3 signaling prevents HIF-1 expression by Src as well as its induction by hypoxia.Because of the possibility that Stat3 was directly acting on the HIF-1 promoter, levels of HIF-1 mRNA were examined. In BALB/c-3T3-v-Src cells, HIF-1 mRNA expression was significantly decreased following transduction with Stat3D (data not shown). However, examination of HIF-1 mRNA in A2058 human melanoma showed no difference in RNA expression, or possibly even increased levels in cells in which Stat 3 had been silenced (Figure 17). Because it has been reported that Src may regulate HIF-1 at the level of mRNA in non-human cells but not in human cells (109), and our findings seemed to corroborate these reports, we did not investigate these results further. We conclude that at least in A2058 human melanoma cells, regulation of HIF-1 protein by Stat3 cannot be accounted for by changes in mRNA. Stat3 is required for the hypoxic induction of VEGF and MMP-2 The evidence that Stat3 is an important regulator of angiogenesis is continuously increasing. Several reports have indicated that Stat3 is required for VEGF production, both at the basal level in vari ous cancer cells (159 214) as well as for its induction by IL6 (215). Furthermore, recent reports have indi cated that Stat3 regulates MMP-2 (223) and MMP-9 (41), both of which are important for the reorganization of the extracellular matrix during angiogenesis (149). The metallopr oteinase genes are potentially regulated

PAGE 68

FIGURE 17. HIF-1 mRNA in A2058 melanoma treated with CoCl2. A2058 cells were stably-transfected with empty pSilencer or pSilencer-Stat3 siRNA. Cells were serum starved for 20h followed by treatment with CoCLB2B (125uM) for the indicated times. Total RNA (15ug) was isolated and analyzed by Northern blotting using a HIF-1 cDNA probe. A photograph of the ethidium bromide-stained gel verifies equal loading as demonstrated by the 18S and 28S rRNA bands. 57

PAGE 69

FIGURE 18. Stat3 is required for VEGF induction by CoClB2B in A2058 melanoma. A2058 cells stably expressing Stat3 siRNA were exposed to CoClB2B for 48 hours in serum free media. Whole cell extracts (100ug) were analyzed by Western blotting using the indicated antibodies. 58

PAGE 70

59 by HIF-1 as they have been shown to be inducible by hypoxia (128). However, it is not known if Stat3 is required for the hypoxic induction of these genes. To examine Stat3 regulation of VEGF in response to hypoxia, A2058 cells stably transfected with Stat3 siRNA were utilized. These cells were treated with the hypoxia mimic CoClB2B for 48h prior to harvest of whole cell extracts and western blot analysis (Figure 18). The long timepoint was util ized in order to obtain maximum VEGF induction. VEGF was induced significantly in co ntrol cells, but not in cells expressing Stat3 siRNA. These results not only reinforce the importance of Stat3 in VEGF production, but also for VEGF induction by hypoxia. BALB/c-3T3 fibroblasts transformed with v-Src were used to study the role of Stat3 in the hypoxic regulation of MMP-2. These cells were treated with 0.1% OB2B or CoClB2 Bfor 24 h followed western blot analysis of whole cell extracts (Figure 19). It can be seen that both hypoxia and the hypoxia mimic resulted in induction of MMP-2 in MSCV control cells. However, in cells stably transduced with the dominant negative Stat3D, MMP-2 induction was prevented. Although it has been reported that Stat3 is necessary for MMP-2 expression, the requirement for its induction by hypoxia had not been demonstrated. Stat3 is activated by hypoxia Hypoxia results in increased expression of genes important for angiogenesis, and this increase in gene transc ription is dependent on the activ ation of a limited set of transcription factors. The best documented transcription factor to be activated by hypoxia

PAGE 71

FIGURE 19. Stat3 is required for MMP-2 induction by hypoxia in Fibroblasts transformed with v-Src. BALB/c-3T3 fibroblasts transformed with v-Src were transduced with dominant negative Stat3D or control MSCV. Cells were exposed to 0.1% OB2B or CoClB2B for 24h hours in serum free media. Whole cell extracts (100ug) were analyzed by Western blotting using the indicated antibodies. 60

PAGE 72

FIGURE 20. Stat3 is activated in human cancer cells exposed to hypoxia. DU145 cells (1.5 x 10P6P) were incubated under 21% or 1% OB2B in serum free media. Nuclear extracts (30ug) were analyzed by Western blotting using the indicated antibodies. Stat3 DNA binding was determined by EMSA using nuclear extracts (8ug) (bottom panel). 61

PAGE 73

62 is HIF-1. Very recently, there was a repor t of increased Stat3 phosphorylation following treatment with CoClB2 Bin a pancreatic and a pr ostate cancer cell line ( 82). Since it is known that Stat3 directly regulates the VEGF pr omoter as well as other hypoxia inducible genes, we wanted to determine if Stat3 was activated by hypoxia. To examine Stat3 activation by hypoxia, DU 145 prostate cancer cells were exposed to 1% OB2B for 24 hours, then nuclear extracts were collected and EMSA was performed (Figure 20). A significant increase in Stat3 DNA binding was observed. To understand this activation in more detail, we wanted to determine the time course of Stat3 activation. Because we coul d not be certain that OB2B concentrations were equal between multiple chambers, the hypoxia mimic CoClB2B was utilized instead. When BALB/c-3T3 fibroblasts were treated with CoClB2 Bfor various time points, significant Stat3 activation was seen as soon as 1 hour (Figure 21). Next we examined the time course of Stat3 activation in DU145 human prostate cancer cells. Increased Stat3 activation was seen as early as 6h, and was highest at the 24h timepoi nt (Figure 22). At 48h there was loss of Stat3 activation, however many cells had died or appeared apoptotic. Because HIF-1 is the main transcription factor to be activat ed by hypoxia and to facilitate the cellular response, we wanted to know if Stat3 activation coincided with or followed HIF-1 induction. HIF-1 levels accumulate rapidly and are already visible at the earliest timepoint of 30 minutes, indicating that HIF-1 accumulation precedes Stat3 activation (Figure 22). Since both HIF-1 and Stat3 are tr anscriptional activators of VEGF, we next examined the time course of VEGF production. VEGF accumulation correlated closely with Stat3 activation, peaking at 24h and diminishing at 48h. Conversely, HIF-1 levels were still elevated at 48h despite massive cell death and diminishing VEGF production.

PAGE 74

FIGURE 21. Time course of Stat3 activation in BALB/c fibroblasts treated with hypoxia mimic. BALB/c fibroblasts (1.5 x 10P6P) were treated with CoCLB2B (125uM) for the indicated times. Stat3 DNA binding was determined by EMSA using nuclear extracts (8ug). NIH3T3 fibroblasts expressing EGFR were stimulated with EGF and used as a marker for Stat3 and Stat1 dimers bound to labeled hSIE probe. 63

PAGE 75

FIGURE 22. Hypoxia mimic activates Stat3 in DU145 human prostate cancer. DU145 cells (1.5 x 10P6P) were treated with CoCLB2B (150uM) for the indicated times in serum-free media. Nuclear extracts (30g) (Top panel) and whole cell extracts (100g) (middle panel) were analyzed by Western blotting using the indicated antibodies. HIF-1 and -actin are used to verify equal loading. Stat3 DNA binding was determined by EMSA using nuclear extracts (8ug) (bottom panel). NIH3T3 fibroblasts expressing EGFR were stimulated with EGF and used as a marker for Stat3 and Stat1 dimers bound to labeled hSIE probe. 64

PAGE 76

65 From these data it is apparent that Stat 3 is activated by hypoxia, and this activation follows and may result from HIF-1 accumulation.

PAGE 77

66 DISCUSSION The data in this dissertation confirms and expands the role of Stat3 in angiogenesis. It is shown for the first time that Stat3 is required for HIF-1 expression resulting from a variety of growth signals in multiple cell lines. In addition, it is demonstrated that Stat3 is required for the hypoxic induction of HIF-1 and several hypoxia inducible genes. Furthermore, activation of Stat3 by hypoxia suggests importance in the cellular response to hypoxia. Overall, these data firmly establish Stat3 as an extremely important regulator of angiogenesis, through the combined regulation of both VEGF and HIF-1 Stat3 is required for HIF-1 induction by growth/oncogenic signals It is demonstrated here for the first time t hat stimulation with IL-6 results in increased expression of HIF-1 MCF-7 breast cancer cells were treated with IL-6 for six hours in serum free media, followed by west ern blot analysis of nuclear extracts. Although HIF-1 induction by IL-6 is modest when compared to its induction by hypoxia, it is significant when compared to that seen by other well documented growth signals (133) Elevated HIF-1 levels following treatment with IL-6 did not result from increased transcription as verified by Norther n blotting. These data show that IL-6 can be

PAGE 78

67 added to the long list of cytokines and grow th signals capable of increasing HIF-1 expression during normoxia. Since the majority of reports indicate that increased production of HIF-1 by growth signals results from an elevated rate of protein synthesis, we wanted to determine if this was also true for IL-6. To achieve this, cyclohexamide was added to MCF-7 cells for various times following treatment with IL-6 for 6 hours. If increased HIF-1 expression was due to cessation of degradation, the addition of cyclohexamide would have no effect as protein levels would remain high over time. If the effect of IL-6 was to increase the rate of protein synthesis it would be counteracted by the addition of cyclohexamide and HIF-1 levels would quickly return to that of baseline. Since HIF-1 levels returned to that of cells not treated with IL-6 within one hour, it was concluded that the effect of IL-6 on HIF-1 results from an increased rate of protein synthesis. Since Stat3 is an important effector of IL-6 signaling, we wanted to determine if it was required for induction of HIF-1 To achieve this, MCF-7 cells were stably transfected with Stat3 siRNA, and western blot was performed following stimulation with IL-6. There was limited induction of HIF-1 in response to IL-6 in cells expressing Stat3 siRNA when compared to control cells. This effect seemed to be applicable to HIF-1 induction by a variety of growth signals, as induction of HIF-1 by heregulin was also prevented in MCF-7 cells expressing Stat3 siRNA. Furthermore, HIF-1 induction by EGF was prevented in DU145 cells treated with Stat3 antisense oligonucleotide. These findings demonstrate that Stat3 is required for HIF-1 induction by a variety of growth signals.

PAGE 79

68 In addition to a requirement for Stat3 in the induction of HIF-1 by growth signals, we observed loss of basal level expression of HIF-1 when Stat3 was silenced. Both of these cell lines, MCF-7 breast cancer and DU-145 prostate cancer cells, have low but detectable basal levels of HIF-1 expression during normoxia. Although Stat3 activation is weak when cultured in serum fr ee media, silencing Stat3 clearly affected basal level HIF-1 expression. As constitutive HIF-1 expression often occurs in various cancers during normoxia, Stat3 is also required fo r this constitutive expression at least in these cell lines. It is well established that increased expression of HIF-1 occurs via activation of the PI3K/AKT pathway. Since it is known that the PI3K/AKT pathway is activated in response to IL-6 (88), the effects of treatment with IL-6 on HIF-1 induction were not entirely surprising. Because we were aware of the work of Dr. Chens research, we knew that there was a possible role for Stat3 in t he regulation of Akt1 at the transcriptional level. To verify that this was occurring in our system, protein levels of Akt1 were determined following silencing of Stat3 in MCF-7 cells. As was expected, total levels of Akt1 were reduced in Stat3 siRNA cells relative to the control. In addition, phosphorylated levels of Akt1 and Akt2 we re also abolished. In accordance with published data demonstrating a requirement for Akt in HIF-1 expression, we conclude that the likely mechanism for Stat3 mediated IL-6 induction of HIF-1 is through regulation of Akt.

PAGE 80

69 Stat3 is required for VEGF induction by growth/oncogenic signals In addition to its effects on HIF-1, it is shown here that blocking Stat3 signaling prevents induction of VEGF by multiple growth signals. It has previously been demonstrated that Stat3 is required for cons titutive VEGF expressi on in several cancer cell lines, and for expression resulting from transformation with the v-Src oncogene (159, 214). Furthermore, it has been shown that Stat3 is required for VEGF induction by IL-6 (215). We elaborate on these findings by presenting data showing that Stat3 is essential for VEGF induction by heregulin and EGF. Furthermore, Stat3 is necessary for basal level VEGF production in MCF-7 breast cancer cells. These results firmly establish the requirement for Stat3 in expression of VEGF in multiple cell lines, both at the basal level and for its induction by various growth factors and soluble signals. It has been reported that inhibition of Stat3 but not PI3K/Akt prevents the induction of VEGF by IL-6 (215). Since the only known mechanism of Akt regulation of VEGF is through HIF-1, this finding emphasizes the importance of Stat3 as a direct transcriptional regulator of VEGF. Alt hough it is well documented that HIF-1 is an important regulator of the VEGF gene, Stat3 is probably more important at least for some inducers. Because several reports have shown that Stat3 regulates VEGF production by directly binding to its promoter (159, 214), it is likely that the effects we are witnessing on VEGF production are both direct and indirect. First, by blocking Stat3 signaling, we are directly downregulating VEGF production by decreasing availability of one of its

PAGE 81

70 transcriptional activators. Second, we are dec reasing availability of another critical transcriptional activator, HIF-1 This idea of Stat3 as a dual regulator is consistent with the dramatic decreases in VEGF levels that we are witnessing, as levels of VEGF are entirely eliminated when Stat3 is blocked. However, in many of these same experiments HIF-1 induction is only partially prevented. So it is likely that the dramatic decreases in VEGF observed following silencing Stat3 results from the combined effect of loss of Stat3 as well as HIF-1 Stat3 is required for HIF-1 induction by hypoxia Induction of HIF-1 by hypoxia has been extensively studied and is well characterized. Under conditions of normal oxygen, HIF-1 is rapidly and continuously degraded. When OB2B becomes limiting, HIF-1 is stabilized and protein rapidly accumulates. This process occurs in dependently from the increased ra te of synthesis that occurs due to PI3K/AKT activation. Both increased synthesis and decreased degradation can coordinately increase HIF-1 levels in an additive mann er. However, there are conflicting reports concerning whether or not the PI3K/AKT pathway is required for the hypoxic induction of HIF-1 Several groups have shown that inhibition of PI3K with chemical inhibitors or dominant negative forms could prevent HIF induction by hypoxia (27, 91, 236). Furthermore, it has been repor ted that overexpression of PTEN, a negative regulator of PI3K, prevented the hypoxic induction of HIF-1 (238). However, other reports indicate that HIF-1 induction by hypoxia is not prevented by genetic inhibition of PI3K/AKT pathway or by treatment with chemical inhibitors (2, 6, 8, 113).

PAGE 82

71 Importantly, chemical inhibition of PI3K prevented AKT activation while simultaneously having no effect on the hypoxic induction of HIF-1 (2, 8). These reports make a convincing argument that AKT is not required for the induction of HIF-1 by hypoxia. Since we had observed loss of AKT expression following silencing of Stat3, we concluded that this accounts for decreased HIF-1 expression following stimulation with IL-6 or growth signals. However, decreased AKT expression should not prevent HIF-1 induction by hypoxia. Therefore, if silencing Stat3 also prevented HIF-1 induction by hypoxia, it is likely that some other mechanism is responsible. To determine if Stat3 is necessary for HIF-1 induction by hypoxia, 3T3 fibroblasts expressing v-Src were transduced with Stat3D. Following treatment with CoClB2B, HIF-1 induction was prevented in cells expressing Stat3D. We next examined HIF-1 induction in A2058 human melanoma cells, which have constitutively activated c-Src (158). When these cells were treated with Src inhibitors, the hypoxic induction of HIF-1 was prevented. These findings verify publis hed reports indicating that c-Src is necessary for HIF-1 induction by hypoxia (82). When these same cells were stably transfected with Stat3 siRNA, HIF-1 induction by hypoxia was prevented. These data demonstrate that Stat3 is required for HIF-1 induction by hypoxia in both 3T3 fibroblasts expressing v-Src and A2058 human melanoma. These findings suggest that the effect of Stat3 on HIF-1 is not entirely due to the ability of Stat3 to regulate AKT expression. Th is reasoning is underscored by the fact that we continuously witness decreased basal level expression of HIF-1 when Stat3 is silenced or blocked with Stat3D. Although St at3 clearly regulates AKT expression and

PAGE 83

72 this will affect HIF-1 induction by growth/oncogenic si gnaling pathways, it is likely that Stat3 influences HIF-1 by some additional mechanism. Two other potential ways that Stat3 could regulate HIF-1 expression are via transcrip tional control and/or control over its rate of degradation. To determine if blocking Stat3 signaling affected levels of HIF-1 mRNA, Northern blotting was performed. In Balb/c-3T3 fibroblasts transformed with v-Src, there was decreased levels of HIF-1 RNA when these cell were transduced with Stat3D. This was not entirely surprising, as it had been report ed that v-Src transformation resulted in increased HIF-1 mRNA levels in rat fibroblasts (109). However, in human cells transfected with activated c-Src there was elevated HIF-1 protein without a concurrent increase in mRNA (116). When we examined mRNA levels in A2058 human melanoma cells, silencing Stat3 did not reduce HIF-1 mRNA. Surprisingly, there appeared to be slightly elevated levels of RNA in Stat3 siRNA cells. Regardless, RNA could not account for the effects we were witnessing at the protein level in the human cells. Since these results seemed to comply with previously published findings, we concluded that mRNA regulation plays no role in Stat3 control of HIF-1 expression, at least in A2058 human melanoma. Since we had eliminated transcriptional regulation as a potential mechanism in A2058 cells, we investigated the possi bility that Stat3 regulates HIF-1 stability. Previous work in Dr. Yus lab demonstrated reciprocal regulation of p53 by Stat3. Because it has been shown that silencing p53 results in stabilization of HIF-1 during normoxia (167), we investigated this as anot her potential mechanism for Stat3 regulation

PAGE 84

73 of HIF-1 When Stat3 was silenced in A2058 melanoma cells, we observed increased p53 expression and decreased HIF-1 expression during hypoxia. If the effects of Stat3 on HIF-1 were through p53, we theorized that loss of p53 would abolish Stat3 control of HIF-1 However, when we silenced p53 in these cells we observed no change in HIF1 levels, either during normoxia or hypoxi a. Therefore, p53 was eliminated as a potential mechanism, at least in this cell line. Another potential mechanism for Stat3 regulation of HIF-1 degradation concerns PHD enzymes and prolyl hydroxylation. It has been reported that in cells transformed with v-Src and RasV12 oncogenes, there was HIF-1 stabilization during normoxia and loss of hydroxylated proline residue 564 (26). Since loss of prolyl hydroxylation should theoretically only occur as oxygen levels decrease, the authors attributed this to oncogenic downregulation of prolyl hydroxylase enzyme or activity. They also reported that transfection with a constitutively acti vated version of AKT resulted in increased HIF-1 expression without loss of hydroxylation, suggesting that this second mode of oncogenic regulation of HIF-1 occurs independently of AKT. This idea of an additional mode of oncogenic regulation of HIF-1 is consistent with our findings, and it seems likely that Stat3 influences HIF-1 levels both through increased synthesis via PI3K/AKT and by influencing hypoxia regulated degradation. Because PHD-2 is the enzyme primarily responsible for hydroxylation of HIF-1 prolyl residues (4), and results in stabilization HIF-1 when silenced, we wanted to determine if it was regulated by Stat3. The idea is that silencing St at3 will result in elevated levels of PHD-2, which in turn will increase HIF-1 degradation. However, we observed no change in

PAGE 85

74 levels of PHD-2 when Stat3 was silenced in A2058 cells or when fibroblasts were transduced with Stat3D. The authors of the original study made use of an antibody specific for the hydroxylated form of HIF-1 to which we did not have access. Through the use of this antibody it would be possibl e to further study the role of prolyl hydroxylation in Stat3 regulation of HIF-1 The requirement for Stat3 in the hypoxic induction of HIF-1 we observed occurred in cell lines expressing v-Src or th ose that had activated c-Src. However, we did not examine the hypoxic regulation of HIF-1 in other cell lines. It has recently been reported that both Stat3 and HIF-1 are required for VEGF expression in response to Src activation or hypoxia (82). They suggest th at Src, Stat3, and HIF-1 cooperatively induce VEGF expression in response to hypoxia. These findings are not entirely surprising, because Src is required for the hypoxic expr ession of both VEGF (155) and HIF-1 (82). Furthermore, Src is activated by hypoxia (47, 156) and transfection with v-Src or activated c-Src increases HIF-1 levels (109, 116) as well as activating Stat3(228). It is possible that Src is a key player in the hypoxic response and cooperatively utilizes HIF1 and Stat3 to facilitate that response. Stat3 is required for induction of several hypoxia inducible genes To further study the role of Stat3 as a facilitator of angiogenesis, we wanted to determine if Stat3 was required for the hypoxi c induction of several hypoxia inducible genes. It has been reported that Stat3 is required for oncogenic expression of VEGF (159, 214, 215). Here we demonstrate that in addition to preventing its induction by oncogenes

PAGE 86

75 and growth signals, silencing Stat3 prevents t he hypoxic induction of VEGF. This finding verifies a recently published report showing that Stat3 is required for the hypoxic induction of VEGF (82). In addition, it has been shown that Stat3 is required for production of the matrix metalloproteinase enzymes MMP-2 and MMP-9 (41, 223). These enzymes are essential for the degradation of the extracellular matrix as occurs during angiogenesis, and are inducible by hypoxia (128). We report here that in BALB/c3T3 fibroblasts transformed with th e v-Src oncogene, expression of MMP-2 is significantly reduced in cells expressing the dominant negative Stat3D. Furthermore, there is induction of MMP-2 by hypoxia in con trol MSCV cells, but this induction is abolished in cells expressing Stat3D. These data demonstrate that Stat3 is required for the hypoxic induction VEGF and MMP-2. Since it has been demonstrated that Stat3 controls both of these genes at the transcriptional level, it is likely that they are directly under its control. However, they are also und er transcriptional control by HIF-1. Since we report here that Stat3 is necessary for HIF-1 expression, blocking Stat3 likely results in their inhibition both directly and indirectly through HIF-1 Stat3 is activated by hypoxia The manner by which HIF-1 is activated by hypoxia is beginning to be well understood. Briefly, HIF-1 is hydroxylated by the PHD enzymes only in the presence of oxygen. VHL binds to hydroxylated HIF-1 and facilitates its degradation. As OB2 Blevels decrease, HIF-1 is no longer hydroxylated, interaction with VHL is impeded and degradation ceases. Although HIF-1 activation by hypoxia is well characterized,

PAGE 87

76 activation of growth signaling pathways by hypoxia is not clearly understood. It has been reported that activation of the PI3K/AKT pathway, as measured by AKT phosphorylation, occurs in some cell lines ( 2, 3, 8, 29, 238). However, hypoxic activation of AKT is not universal as with HIF-1 and was not observed in other cell lines including breast c ancers and prostate cancers (2, 1 3, 236). Furthermore, it has been reported that PI3K/AKT activation, when it did occur, followed HIF-1 activation (2). Concerning Stat3 activation by hypoxia, it has recently been reported that there are increased levels of phosphorylated Stat3 following treatment with CoClB2B. Previously, it had been shown that cardiotrophin-1 activates Stat3 via a gp130-dependent signaling pathway in response to hypoxia (92). In addi tion it has been reported that Stat5 is activated by hypoxia (114). Furthermore, it has been shown that c-Src is activated by hypoxia (47, 156), and this could account fo r increased Stat3 activation by hypoxia Because Stat3 is required for expression of HIF-1 and several hypoxia inducible genes, we decided to investigate its activation by hypoxia in more detail. In DU145 prostate cancer cells, there was significant Stat3 activation following 24h incubation in hypoxia. Because we could not measure the exact oxygen concentration in the hypoxia chamber, and were not certain that levels were equal between chambers, we could not accurately det ermine the time course of Stat3 activation using hypoxia. As an alternative, the hypoxia mimic CoClB2B was employed. In BALB/c fibroblasts, there was a significant activation of Stat3 within one hour which increased up to 4 h. Longer time points were not examined in these cells. In DU145 human prostate cancer cells, there was detectable activation of Stat3 as early as 2h, and this peaked at 24h. Stat3 activation was significantly dimi nished at 48h, coinciding with massive cell

PAGE 88

77 death. In addition to detection of Stat3 act ivation by EMSA, both nuclear extracts and whole cell extracts were analyzed by western blot to determine levels of HIF-1 and VEGF. In contrast to Stat3 activation, HIF-1 accumulation was extremely rapid with detectable protein at the earliest time point of 30 minutes. HIF-1 levels increased steadily up to the 24h timepoint. At 48h when Stat3 signaling had diminished and cells were beginning to die, HIF-1 levels remained high. Expression of VEGF closely paralleled that of Stat3 activation, with detectable levels at 6h that peaked at 24h and diminished at 48h. These data emphasize the close relationship between Stat3 activation and VEGF expression. Although we observed hypoxi c activation of Stat3 in DU145 cells, this was not observed in A2058 human melanoma cells. Therefore, similar to reports concerning AKT activation, it seems likely that Stat3 activation by hypoxia is cell type specific. Furthermore, Stat3 activ ation occurred following HIF-1 induction as reported for the hypoxic activation of AKT. The only known transcription factor r eported to increase VEGF production in response to hypoxia is HIF-1 However, it has recently been reported that hypoxic induction of VEGF occurred in the absence of HIF-1 expression (153). Furthermore, a tumor cell line expressing constitutively activated AKT but lacking HIF-1 was able to form large and well vascularized tumors (5, 142). These reports suggest that other transcription factors are able to stimulate VEGF production in response to hypoxia independently of HIF-1 Because Stat3 is also a transcr iptional activator of VEGF, and we observed Stat3 activation following incubation in hypoxia in both BALB/c fibroblasts and human prostate cancer, it should be determined if Stat3 can facilitate the hypoxic induction of VEGF independently of HIF-1 Although we had found that Stat3

PAGE 89

78 activation occurred following induction of HIF-1 it does not necessarily mean that Stat3 activation is dependent on HIF-1 It is possible that St at3 activation occurs in the absence of HIF-1 but just not as rapidly. Additional experiments should be performed to determine if Stat3 activation and increas ed VEGF production occur in response to hypoxia following silencing of HIF-1 If both Stat3 activation and VEGF production occur independently of HIF-1 further studies may be warranted. Reporter systems driven by the VEGF promoter containing mutat ed HIF-1 and Stat3 binding sites could be constructed to determine the relative impor tance of each transcription factor for the hypoxic response. Stat3 as an antiangiogenic target The data in this dissertation, along with re cently published repo rts, position Stat3 as an important target for antiangiogenic therapy. It has been demonstrated repeatedly that Stat3 is a direct regu lator of the VEGF gene, and is required for VEGF production in response to a variety of stimuli in diffe rent cell types. Furthermore, it has been shown that Stat3 is required for other important f acilitators of angiogenes is such as MMP-2 and MMP-9. Importantly, it is demonstrated here that Stat3 is essential for expression of HIF1, the best documented transcriptional activator of VEGF and a wide variety of other angiogenic and invasive genes. Therefore, blocki ng Stat3 not only directly prevents production of multiple factors essential fo r angiogenesis, but also blocks production of the best documented angiogenesis tr anscription factor. These results strongly suggest that

PAGE 90

79 targeting Stat3 could completely abrogate angiogenesis by simultaneously eliminating the activity of its two most important transcription factors. For successful antiangiogenic therapy to succeed, it is necessary to have extremely potent angiogenesis inhibitors (12). The classes of angiogenesis inhibitors have been divided into direct and indirect based on which cells they target (118). Direct inhibitors are those that inhibit growth of vascular endothelial cel ls by targeting them directly. One advantage to the us e of direct inhibitors is that endothelial cells are genetically stable, and therefore less likely to acquire drug resistance (119). Indirect angiogenesis inhibitors are those that tar get the cancer cells, generally by blocking expression of angiogenic proteins. Any inhibitor that could successfully act in a both direct and indirect manner would have grea ter potency and better likelihood for success. In addition to the requirement of Stat3 for angiogenic factor production by tumor cells, several reports have indicated that Stat3 is essential for vascular endothelial cell growth, migration, and microvascular tube formation Stat3 is activated by and necessary for signaling by both the bFGF receptor and VEGFR2 (7, 42, 176). Furthermore, Stat3 is required for endothelial cell migration and microvascular tube formation (225). Therefore, any drug targeting Stat3 would be functioning simultaneously as both a primary and secondary angiogenesis inhibitor, and would likely have greater potency because of this. Although antiangiogenic therapy has demonstrated efficacy in some clinical trials, many have had limited success (12, 54, 115, 226). The inhibitors used in these trials targeted only individual inducers of endothelial cell growth, such as VEGF, EGFR, VEGFR, and HER-2/neu (118). Since there are a variety of factors involved with

PAGE 91

80 promoting angiogenesis, targeting only one of these may not be effective. However, the activity of many of these pathways is dependent on a relatively limited set of transcription factors. Because of this, selective inactivation of a few TFs could potentially inactivate a large array of angiogenic factors (3 9). There is current work investigating the effect of targeting HIF-1 for anti-angiogenic therapy (180 ). Since we show here that Stat3 is necessary for both HIF-1 expression and endothelial cell growth, Stat3 may prove to be the better transcription factor to target for an tiangiogenic therapy. In summary, there are multple reasons why Stat3 inhibition will likely be an extremely effective antiangiogenic strategy. Stat 3 is required for the production of a variety of angiogenic factors, in resp onse to both growth/oncogenic signaling and hypoxia. Furthermore, Stat3 signaling is required for expression of HIF-1 and therefore its inhibition could potentially prevent expres sion of a large array of angiogenic and invasive factors. Also, any angiogenesis inhibitor capable of preventing endothelial cell growth in both a direct and indirect manner simultaneously would have a distinct advantage. Furthermore, it is well documented that Stat3 is an important facilitator of cell survival and growth, so blocking Stat3 could make both tumor cells and endothelial cells more prone to apoptosis. Finally, targeting transcription factors will likely prove more effective because of their role as con vergence points for a multitude of angiogenic factors. For these reasons, drugs that inhi bit Stat3 will likely be important therapeutic tools for antiangiogenic treatments.

PAGE 92

81 REFERENCES 1. Alfranca, A., M. D. Gutierrez, A. Vara, J. Aragones, F. Vidal, and M. O. Landazuri. 2002. c-Jun and hypoxia-inducible factor 1 functionally cooperate in hypoxia-induced gene transcription. Mol Cell Biol 22:12-22. 2. Alvarez-Tejado, M., A. Alfranca, J. Aragones, A. Vara, M. O. Landazuri, and L. del Peso. 2002. Lack of evidence for the involvement of the phosphoinositide 3-kinase/Akt pathway in the activation of hypoxia-inducible factors by low oxygen tension. J Biol Chem 277:13508-17. 3. Alvarez-Tejado, M., S. Naranjo-Suarez, C. Jimenez, A. C. Carrera, M. O. Landazuri, and L. del Peso. 2001. Hypoxia induces the activation of the phosphatidylinositol 3-kinase/Akt cell survival pathway in PC12 cells: protective role in apoptosis. J Biol Chem 276:22368-74.

PAGE 93

82 4. Appelhoff, R. J., Y. M. Tian, R. R. Raval, H. Turley, A. L. Harris, C. W. Pugh, P. J. Ratcliffe, and J. M. Gleadle. 2004. Differential function of the prolyl hydroxylases PHD1, PHD2, and PHD3 in the regulation of hypoxiainducible factor. J Biol Chem 279:38458-65. 5. Arsham, A. M., D. R. Plas, C. B. Thompson, and M. C. Simon. 2004. Akt and hypoxia-inducible factor-1 independ ently enhance tumor growth and angiogenesis. Cancer Res 64:3500-7. 6. Arsham, A. M., D. R. Plas, C. B. Thompson, and M. C. Simon. 2002. Phosphatidylinositol 3-kinase/Akt signaling is neither required for hypoxic stabilization of HIF-1 alpha nor suffi cient for HIF-1-dependent target gene transcription. J Biol Chem 277:15162-70. 7. Bartoli, M., D. Platt, T. Lemtalsi, X. Gu, S. E. Brooks, M. B. Marrero, and R. B. Caldwell. 2003. VEGF differentially activ ates STAT3 in microvascular endothelial cells. Faseb J 17:1562-4.

PAGE 94

83 8. Beitner-Johnson, D., R. T. Rust, T. C. Hsieh, and D. E. Millhorn. 2001. Hypoxia activates Akt and induces phosphorylation of GSK-3 in PC12 cells. Cell Signal 13:23-7. 9. Benjamin, L. E., D. Golijanin, A. Itin, D. Pode, and E. Keshet. 1999. Selective ablation of immature blood vessels in established human tumors follows vascular endothelial growth factor withdrawal. J Clin Invest 103:159-65. 10. Bhattacharya, S., C. L. Michels, M. K. Leung, Z. P. Arany, A. L. Kung, and D. M. Livingston. 1999. Functional role of p35srj, a novel p300/CBP binding protein, during transactivation by HIF-1. Genes Dev 13:64-75. 11. Bilton, R. L., and G. W. Booker. 2003. The subtle side to hypoxia inducible factor (HIFalpha) regulation. Eur J Biochem 270: 791-8. 12. Blagosklonny, M. V. 2004. Antiangiogenic therapy and tumor progression. Cancer Cell 5: 13-7.

PAGE 95

84 13. Blancher, C., J. W. Moore, N. Robertson, and A. L. Harris. 2001. Effects of ras and von Hippel-Lindau (VHL) gene mutations on hypoxia-inducible factor (HIF)-1alpha, HIF-2alpha, and vascular endothelial growth factor expression and their regulation by the phosphatidylinos itol 3'-kinase/Akt signaling pathway. Cancer Res 61:7349-55. 14. Bowman, T., M. A. Broome, D. Sinibaldi, W. Wharton, W. J. Pledger, J. M. Sedivy, R. Irby, T. Yeatman, S. A. Courtneidge, and R. Jove. 2001. Stat3mediated Myc expression is required for Src transformation and PDGF-induced mitogenesis. Proc Natl Acad Sci U S A 98:7319-24. 15. Bowman, T., R. Garcia, J. Turkson, and R. Jove. 2000. STATs in oncogenesis. Oncogene 19:2474-88. 16. Brizel, D. M., R. K. Dodge, R. W. Clough, and M. W. Dewhirst. 1999. Oxygenation of head and neck cancer: changes during radiotherapy and impact on treatment outcome. Radiother Oncol 53:113-7. 17. Bromberg, J., and J. E. Darnell, Jr. 2000. The role of STATs in transcriptional control and their impact on cellular function. Oncogene 19:2468-73.

PAGE 96

85 18. Bromberg, J. F., C. M. Horvath, D. Besser, W. W. Lathem, and J. E. Darnell, Jr. 1998. Stat3 activation is required for cellular tr ansformation by v-src. Mol Cell Biol 18: 2553-8. 19. Bromberg, J. F., C. M. Horvath, Z. Wen, R. D. Schreiber, and J. E. Darnell, Jr. 1996. Transcriptionally active Stat1 is r equired for the antipro liferative effects of both interferon alpha and interferon gamma. Proc Natl Acad Sci U S A 93:7673-8. 20. Bromberg, J. F., M. H. Wrzeszczynska, G. Devgan, Y. Zhao, R. G. Pestell, C. Albanese, and J. E. Darnell, Jr. 1999. Stat3 as an oncogene. Cell 98:295-303. 21. Bruick, R. K. 2000. Expression of the gene encoding the proapoptotic Nip3 protein is induced by hypoxia. Proc Natl Acad Sci U S A 97:9082-7. 22. Brusselmans, K., F. Bono, P. Maxwell, Y. Dor, M. Dewerchin, D. Collen, J. M. Herbert, and P. Carmeliet. 2001. Hypoxia-inducible factor-2alpha (HIF2alpha) is involved in the apoptotic re sponse to hypoglycemia but not to hypoxia. J Biol Chem 276:39192-6.

PAGE 97

86 23. Buettner, R., L. B. Mora, and R. Jove. 2002. Activated STAT signaling in human tumors provides novel molecular targ ets for therapeutic intervention. Clin Cancer Res 8: 945-54. 24. Carmeliet, P., and R. K. Jain. 2000. Angiogenesis in cancer and other diseases. Nature 407: 249-57. 25. Catlett-Falcone, R., T. H. Landowski, M. M. Oshiro, J. Turkson, A. Levitzki, R. Savino, G. Ciliberto, L. Moscinski, J. L. Fernandez-Luna, G. Nunez, W. S. Dalton, and R. Jove. 1999. Constitutive activation of Stat3 signaling confers resistance to apoptosis in hu man U266 myeloma cells. Immunity 10:105-15. 26. Chan, D. A., P. D. Sutphin, N. C. Denko, and A. J. Giaccia. 2002. Role of prolyl hydroxylation in oncogenically stabilized hypoxia-inducible factor-1alpha. J Biol Chem 277:40112-7. 27. Chandel, N. S., D. S. McClintock, C. E. Feliciano, T. M. Wood, J. A. Melendez, A. M. Rodriguez, and P. T. Schumacker. 2000. Reactive oxygen species generated at mitochondrial complex III stabilize hypoxia-inducible factor1alpha during hypoxia: a mechanism of O2 sensing. J Biol Chem 275:25130-8.

PAGE 98

87 28. Chen, C., N. Pore, A. Behrooz, F. Ismail-Beigi, and A. Maity. 2001. Regulation of glut1 mRNA by hypoxia-inducible factor-1. Interaction between Hras and hypoxia. J Biol Chem 276:9519-25. 29. Chen, E. Y., N. M. Mazure, J. A. Cooper, and A. J. Giaccia. 2001. Hypoxia activates a platelet-derived growth factor receptor/phosphatidylinositol 3kinase/Akt pathway that results in glycogen synthase kinase-3 inactivation. Cancer Res 61:2429-33. 30. Chung, J., R. E. Bachelder, E. A. Lipscomb, L. M. Shaw, and A. M. Mercurio. 2002. Integrin (alpha 6 beta 4) regul ation of eIF-4E activity and VEGF translation: a survival mechanism for carcinoma cells. J Cell Biol 158:165-74. 31. Claffey, K. P., S. C. Shih, A. Mullen, S. Dziennis, J. L. Cusick, K. R. Abrams, S. W. Lee, and M. Detmar. 1998. Identification of a human VPF/VEGF 3' untranslated region mediating hypoxia-induced mRNA stability. Mol Biol Cell 9: 469-81.

PAGE 99

88 32. Clarke, K., K. Smith, W. J. Gullick, and A. L. Harris. 2001. Mutant epidermal growth factor receptor enhances inducti on of vascular endothelial growth factor by hypoxia and insulin-like growth factor -1 via a PI3 kinase dependent pathway. Br J Cancer 84:1322-9. 33. Cohen, T., D. Nahari, L. W. Cerem, G. Neufeld, and B. Z. Levi. 1996. Interleukin 6 induces the expression of vascular endothelial growth factor. J Biol Chem 271:736-41. 34. Conrad, P. W., T. L. Freeman, D. Beitner-Johnson, and D. E. Millhorn. 1999. EPAS1 trans-activation during hypoxia requires p42/p44 MAPK. J Biol Chem 274:33709-13. 35. Damert, A., E. Ikeda, and W. Risau. 1997. Activator-protein-1 binding potentiates the hypoxia-induciblefactor-1-mediated hypoxia-induced transcriptional activation of vascular-endot helial growth factor expression in C6 glioma cells. Biochem J 327 ( Pt 2): 419-23.

PAGE 100

89 36. Damert, A., M. Machein, G. Breier, M. Q. Fujita, D. Hanahan, W. Risau, and K. H. Plate. 1997. Up-regulation of vascular endothelial growth factor expression in a rat glioma is conferred by two di stinct hypoxia-driven mechanisms. Cancer Res 57:3860-4. 37. Danial, N. N., A. Pernis, and P. B. Rothman. 1995. Jak-STAT signaling induced by the v-abl oncogene. Science 269:1875-7. 38. Dankbar, B., T. Padro, R. Leo, B. Feldmann, M. Kropff, R. M. Mesters, H. Serve, W. E. Berdel, and J. Kienast. 2000. Vascular endothelial growth factor and interleukin-6 in paracrine tumor-s tromal cell interactions in multiple myeloma. Blood 95:2630-6. 39. Darnell, J. E., Jr. 2002. Transcription factors as ta rgets for cancer therapy. Nat Rev Cancer 2: 740-9. 40. de Vries, C., J. A. Escobedo, H. Ueno, K. Houck, N. Ferrara, and L. T. Williams. 1992. The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science 255: 989-91.

PAGE 101

90 41. Dechow, T. N., L. Pedranzini, A. Leitch, K. Leslie, W. L. Gerald, I. Linkov, and J. F. Bromberg. 2004. Requirement of matrix metalloproteinase-9 for the transformation of human mammary epith elial cells by Stat3-C. Proc Natl Acad Sci U S A 101:10602-7. 42. Deo, D. D., T. W. Axelrad, E. G. Robert, V. Marcheselli, N. G. Bazan, and J. D. Hunt. 2002. Phosphorylation of STAT-3 in response to basic fibroblast growth factor occurs through a mechanism involving platelet-activating factor, JAK-2, and Src in human umbilical vein endothelial cells. Evidence for a dual kinase mechanism. J Biol Chem 277:21237-45. 43. Deroanne, C. F., A. Hajitou, C. M. Calberg-Bacq, B. V. Nusgens, and C. M. Lapiere. 1997. Angiogenesis by fibroblast growth factor 4 is mediated through an autocrine up-regulation of vascular endot helial growth factor expression. Cancer Res 57:5590-7. 44. Desbaillets, I., A. C. Diserens, N. de Tribolet, M. F. Hamou, and E. G. Van Meir. 1999. Regulation of interleukin-8 expression by reduced oxygen pressure in human glioblastoma. Oncogene 18:1447-56.

PAGE 102

91 45. Durand, R. E. 1994. The influence of microenvironmental factors during cancer therapy. In Vivo 8: 691-702. 46. Ebert, B. L., J. D. Firth, and P. J. Ratcliffe. 1995. Hypoxia and mitochondrial inhibitors regulate expression of glucose transporter-1 via distinct Cis-acting sequences. J Biol Chem 270:29083-9. 47. Ellis, L. M., C. A. Staley, W. Liu, R. Y. Fleming, N. U. Parikh, C. D. Bucana, and G. E. Gallick. 1998. Down-regulation of vascular endothelial growth factor in a human colon carcinoma cell line tr ansfected with an antisense expression vector specific for c-src. J Biol Chem 273:1052-7. 48. Ema, M., K. Hirota, J. Mimura, H. Abe, J. Yodoi, K. Sogawa, L. Poellinger, and Y. Fujii-Kuriyama. 1999. Molecular mechanisms of transcription activation by HLF and HIF1alpha in response to hypoxia: their stabilization and redox signal-induced interaction with CBP/p300. Embo J 18:1905-14.

PAGE 103

92 49. Ema, M., S. Taya, N. Yokotani, K. Sogawa, Y. Matsuda, and Y. FujiiKuriyama. 1997. A novel bHLH-PAS factor with close sequence similarity to hypoxia-inducible factor 1al pha regulates the VEGF expression and is potentially involved in lung and vascular development. Proc Natl Acad Sci U S A 94:4273-8. 50. Esch, F., A. Baird, N. Ling, N. Ueno, F. Hill, L. Denoroy, R. Klepper, D. Gospodarowicz, P. Bohlen, and R. Guillemin. 1985. Primary structure of bovine pituitary basic fibroblast growth factor (FGF) and comparison with the amino-terminal sequence of bovine brain acidic FGF. Proc Natl Acad Sci U S A 82:6507-11. 51. Feldser, D., F. Agani, N. V. Iyer, B. Pak, G. Ferreira, and G. L. Semenza. 1999. Reciprocal positive regulation of hypoxia-inducible factor 1alpha and insulin-like growth factor 2. Cancer Res 59:3915-8. 52. Ferrara, N. 2004. Vascular endothelial growth fa ctor as a target for anticancer therapy. Oncologist 9 Suppl 1: 2-10. 53. Ferrara, N. 2002. VEGF and the quest for tumour angiogenesis factors. Nat Rev Cancer 2: 795-803.

PAGE 104

93 54. Ferrara, N., H. P. Gerber, and J. LeCouter. 2003. The biology of VEGF and its receptors. Nat Med 9: 669-76. 55. Ferrara, N., and W. J. Henzel. 1989. Pituitary follicular cells secrete a novel heparin-binding growth factor specifi c for vascular endothelial cells. Biochem Biophys Res Commun 161:851-8. 56. Finkenzeller, G., A. Sparacio, A. Technau, D. Marme, and G. Siemeister. 1997. Sp1 recognition sites in the proximal promoter of the human vascular endothelial growth factor gene are essential for platelet-derived growth factorinduced gene expression. Oncogene 15:669-76. 57. Firth, J. D., B. L. Ebert, C. W. Pugh, and P. J. Ratcliffe. 1994. Oxygenregulated control elements in the pho sphoglycerate kinase 1 and lactate dehydrogenase A genes: similarities with the erythropoietin 3' enhancer. Proc Natl Acad Sci U S A 91:6496-500.

PAGE 105

94 58. Flamme, I., T. Frohlich, M. von Reutern, A. Kappel, A. Damert, and W. Risau. 1997. HRF, a putative basic helix-loop-helix-PAS-domain transcription factor is closely related to hypoxia-in ducible factor-1 alpha and developmentally expressed in blood vessels. Mech Dev 63:51-60. 59. Folkman, J. 2003. Angiogenesis and apoptosis. Semin Cancer Biol 13: 159-67. 60. Folkman, J. 1971. Tumor angiogenesis: therapeutic implications. N Engl J Med 285:1182-6. 61. Folkman, J., E. Merler, C. Abernathy, and G. Williams. 1971. Isolation of a tumor factor responsible or angiogenesis. J Exp Med 133:275-88. 62. Forsythe, J. A., B. H. Jiang, N. V. Iyer, F. Agani, S. W. Leung, R. D. Koos, and G. L. Semenza. 1996. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol 16: 4604-13. 63. Frank, S., G. Hubner, G. Breier, M. T. Longaker, D. G. Greenhalgh, and S. Werner. 1995. Regulation of vascular endothelial growth factor expression in cultured keratinocytes. Implications for normal and impaired wound healing. J Biol Chem 270:12607-13.

PAGE 106

95 64. Fukuda, R., K. Hirota, F. Fan, Y. D. Jung, L. M. Ellis, and G. L. Semenza. 2002. Insulin-like growth factor 1 induces hypoxia-inducible factor 1-mediated vascular endothelial growth factor expression, which is dependent on MAP kinase and phosphatidylinositol 3-kinase signa ling in colon cancer cells. J Biol Chem 277:38205-11. 65. Funamoto, M., Y. Fujio, K. Kunisada, S. Negoro, E. Tone, T. Osugi, H. Hirota, M. Izumi, K. Yoshizaki, K. Walsh, T. Kishimoto, and K. YamauchiTakihara. 2000. Signal transducer and activator of transcription 3 is required for glycoprotein 130-mediated induction of vascular endothelial growth factor in cardiac myocytes. J Biol Chem 275:10561-6. 66. Garcia, R., T. L. Bowman, G. Niu, H. Yu, S. Minton, C. A. Muro-Cacho, C. E. Cox, R. Falcone, R. Fairclough, S. Parsons, A. Laudano, A. Gazit, A. Levitzki, A. Kraker, and R. Jove. 2001. Constitutive activation of Stat3 by the Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cells. Oncogene 20:2499-513.

PAGE 107

96 67. Garcia, R., C. L. Yu, A. Hudnall, R. Catlett, K. L. Nelson, T. Smithgall, D. J. Fujita, S. P. Ethier, and R. Jove. 1997. Constitutive activation of Stat3 in fibroblasts transformed by diverse on coproteins and in breast carcinoma cells. Cell Growth Differ 8: 1267-76. 68. Gerber, H. P., F. Condorelli, J. Park, and N. Ferrara. 1997. Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes. Flt-1, but not Flk-1/KDR, is up-regulated by hypoxia. J Biol Chem 272:23659-67. 69. Gille, J., R. A. Swerlick, and S. W. Caughman. 1997. Transforming growth factor-alpha-induced transcrip tional activation of the vascular permeability factor (VPF/VEGF) gene requires AP-2-dependent DNA binding and transactivation. Embo J 16:750-9. 70. Gingras, A. C., B. Raught, and N. Sonenberg. 2001. Regulation of translation initiation by FRAP/mTOR. Genes Dev 15:807-26.

PAGE 108

97 71. Gleadle, J. M., B. L. Ebert, J. D. Firth, and P. J. Ratcliffe. 1995. Regulation of angiogenic growth factor expression by hypoxi a, transition metals, and chelating agents. Am J Physiol 268: C1362-8. 72. Goad, D. L., J. Rubin, H. Wang, A. H. Tashjian, Jr., and C. Patterson. 1996. Enhanced expression of vascular endothelial growth factor in human SaOS-2 osteoblast-like cells and murine osteoblasts induced by insulin-like growth factor I. Endocrinology 137:2262-8. 73. Goldberg, M. A., and T. J. Schneider. 1994. Similarities between the oxygensensing mechanisms regulating the expression of vascular endothelial growth factor and erythropoietin. J Biol Chem 269:4355-9. 74. Gorlach, A., I. Diebold, V. B. Schini-Kerth, U. Berchner-Pfannschmidt, U. Roth, R. P. Brandes, T. Kietzmann, and R. Busse. 2001. Thrombin activates the hypoxia-inducible factor-1 signaling pat hway in vascular smooth muscle cells: Role of the p22(phox)-containing NADPH oxidase. Circ Res 89:47-54.

PAGE 109

98 75. Gorski, D. H., H. J. Mauceri, R. M. Sa lloum, S. Gately, S. Hellman, M. A. Beckett, V. P. Sukhatme, G. A. Soff, D. W. Kufe, and R. R. Weichselbaum. 1998. Potentiation of the antitumor effect of ionizing radiation by brief concomitant exposures to angiostatin. Cancer Res 58:5686-9. 76. Gouilleux-Gruart, V., F. Gouilleux, C. Desaint, J. F. Claisse, J. C. Capiod, J. Delobel, R. Weber-Nordt, I. Dusanter-Fourt, F. Dreyfus, B. Groner, and L. Prin. 1996. STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients. Blood 87: 1692-7. 77. Graeber, T. G., C. Osmanian, T. Jacks, D. E. Housman, C. J. Koch, S. W. Lowe, and A. J. Giaccia. 1996. Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumours. Nature 379: 88-91. 78. Graham, C. H., T. E. Fitzpatrick, and K. R. McCrae. 1998. Hypoxia stimulates urokinase receptor expre ssion through a heme protein-dependent pathway. Blood 91:3300-7.

PAGE 110

99 79. Grandis, J. R., S. D. Drenning, A. Chakraborty, M. Y. Zhou, Q. Zeng, A. S. Pitt, and D. J. Tweardy. 1998. Requirement of Stat3 but not Stat1 activation for epidermal growth factor receptormediated cell growth In vitro. J Clin Invest 102:1385-92. 80. Grandis, J. R., S. D. Drenning, Q. Zeng, S. C. Watkins, M. F. Melhem, S. Endo, D. E. Johnson, L. Huang, Y. He, and J. D. Kim. 2000. Constitutive activation of Stat3 signaling abrogate s apoptosis in squamous cell carcinogenesis in vivo. Proc Natl Acad Sci U S A 97: 4227-32. 81. Gray, L. H., A. D. Conger, M. Ebert, S. Hornsey, and O. C. Scott. 1953. The concentration of oxygen dissolved in tissues at the time of irradiation as a factor in radiotherapy. Br J Radiol 26:638-48. 82. Gray, M. J., J. Zhang, L. M. Ellis, G. L. Semenza, D. B. Evans, S. S. Watowich, and G. E. Gallick. 2005. HIF-1alpha, STAT3, CBP/p300 and Ref1/APE are components of a transcriptional complex that regulates Src-dependent hypoxia-induced expression of VEGF in pancreatic and prostate carcinomas. Oncogene.

PAGE 111

100 83. Grugel, S., G. Finkenzeller, K. Weindel, B. Barleon, and D. Marme. 1995. Both v-Ha-Ras and v-Raf stimulate expression of the vascular endothelial growth factor in NIH 3T3 cells. J Biol Chem 270:25915-9. 84. Grunstein, J., W. G. Roberts, O. Mathieu-Costello, D. Hanahan, and R. S. Johnson. 1999. Tumor-derived expression of vas cular endothelial growth factor is a critical factor in tumor expansion and vascular function. Cancer Res 59:15928. 85. Haas-Kogan, D., N. Shalev, M. Wong, G. Mills, G. Yount, and D. Stokoe. 1998. Protein kinase B (PKB/Akt) activity is elevated in glioblastoma cells due to mutation of the tumor suppressor PTEN/MMAC. Curr Biol 8: 1195-8. 86. Hanahan, D., and J. Folkman. 1996. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 86: 353-64. 87. Harris, A. L. 2002. Hypoxia--a key regulatory factor in tumour growth. Nat Rev Cancer 2: 38-47.

PAGE 112

101 88. Heinrich, P. C., I. Behrmann, S. Haan, H. M. Hermanns, G. Muller-Newen, and F. Schaper. 2003. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J 374:1-20. 89. Hellwig-Burgel, T., K. Rutkowski, E. Metzen, J. Fandrey, and W. Jelkmann. 1999. Interleukin-1beta and tumor necrosis factor-alpha stimulate DNA binding of hypoxia-inducible factor-1. Blood 94:1561-7. 90. Hewitson, K. S., L. A. McNeill, M. V. Riordan, Y. M. Tian, A. N. Bullock, R. W. Welford, J. M. Elkins, N. J. Oldham, S. Bhattacharya, J. M. Gleadle, P. J. Ratcliffe, C. W. Pugh, and C. J. Schofield. 2002. Hypoxia-inducible factor (HIF) asparagine hydroxylase is identical to factor inhibiting HIF (FIH) and is related to the cupin structural family. J Biol Chem 277:26351-5. 91. Hirota, K., and G. L. Semenza. 2001. Rac1 activity is required for the activation of hypoxia-inducible factor 1. J Biol Chem 276:21166-72. 92. Hishinuma, S., M. Funamoto, Y. Fujio, K. Kunisada, and K. YamauchiTakihara. 1999. Hypoxic stress induces card iotrophin-1 expression in cardiac myocytes. Biochem Biophys Res Commun 264: 436-40.

PAGE 113

102 93. Hockel, M., and P. Vaupel. 2001. Tumor hypoxia: definitions and current clinical, biologic, and molecular aspects. J Natl Cancer Inst 93:266-76. 94. Hoekstra, R., F. A. Eskens, and J. Verweij. 2001. Matrix metalloproteinase inhibitors: current developments and future perspectives. Oncologist 6: 415-27. 95. Hofmann, U. B., J. R. Westphal, E. T. Waas, A. J. Zendman, I. M. Cornelissen, D. J. Ruiter, and G. N. van Muijen. 1999. Matrix metalloproteinases in human mel anoma cell lines and xenografts: increased expression of activated matrix metalloproteinase-2 (MMP-2) correlates with melanoma progression. Br J Cancer 81:774-82. 96. Houck, K. A., N. Ferrara, J. Winer, G. Cachianes, B. Li, and D. W. Leung. 1991. The vascular endothelial growth factor family: identification of a fourth molecular species and charac terization of alternative splicing of RNA. Mol Endocrinol 5: 1806-14.

PAGE 114

103 97. Huang, J., J. S. Frischer, A. Serur, A. Kadenhe, A. Yokoi, K. W. McCrudden, T. New, K. O'Toole, S. Zabski, J. S. Rudge, J. Holash, G. D. Yancopoulos, D. J. Yamashiro, and J. J. Kandel. 2003. Regression of established tumors and metastases by potent vascular endothelial growth factor blockade. Proc Natl Acad Sci U S A 100:7785-90. 98. Huang, L. E., Z. Arany, D. M. Livingston, and H. F. Bunn. 1996. Activation of hypoxia-inducible transcription fact or depends primarily upon redox-sensitive stabilization of its alpha subunit. J Biol Chem 271:32253-9. 99. Huang, L. E., and H. F. Bunn. 2003. Hypoxia-inducible factor and its biomedical relevance. J Biol Chem 278:19575-8. 100. Hurwitz, H., L. Fehrenbacher, W. Novotny, T. Cartwright, J. Hainsworth, W. Heim, J. Berlin, A. Baron, S. Griffing, E. Holmgren, N. Ferrara, G. Fyfe, B. Rogers, R. Ross, and F. Kabbinavar. 2004. Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastati c colorectal cancer. N Engl J Med 350:2335-42.

PAGE 115

104 101. Huss, W. J., R. J. Barrios, and N. M. Greenberg. 2003. SU5416 selectively impairs angiogenesis to induce prostate cancer-specific apoptosis. Mol Cancer Ther 2: 611-6. 102. Iliopoulos, O., A. P. Levy, C. Jiang, W. G. Kaelin, Jr., and M. A. Goldberg. 1996. Negative regulation of hypoxia-i nducible genes by the von Hippel-Lindau protein. Proc Natl Acad Sci U S A 93: 10595-9. 103. Inoue, M., J. H. Hager, N. Ferrara, H. P. Gerber, and D. Hanahan. 2002. VEGF-A has a critical, nonredundant role in angiogenic switching and pancreatic beta cell carcinogenesis. Cancer Cell 1: 193-202. 104. Itoh, T., M. Tanioka, H. Yoshida, T. Yoshioka, H. Nishimoto, and S. Itohara. 1998. Reduced angiogenesis and tumor progre ssion in gelatinase A-deficient mice. Cancer Res 58:1048-51. 105. Ivan, M., K. Kondo, H. Yang, W. Kim, J. Valiando, M. Ohh, A. Salic, J. M. Asara, W. S. Lane, and W. G. Kaelin, Jr. 2001. HIFalpha targeted for VHLmediated destruction by proline hydroxylati on: implications for O2 sensing. Science 292: 464-8.

PAGE 116

105 106. Jaakkola, P., D. R. Mole, Y. M. Tian, M. I. Wilson, J. Gielbert, S. J. Gaskell, A. Kriegsheim, H. F. Hebestreit, M. Mukherji, C. J. Schofield, P. H. Maxwell, C. W. Pugh, and P. J. Ratcliffe. 2001. Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 292: 468-72. 107. Jain, R. K. 2005. Normalization of tumor vasculature: an emerging concept in antiangiogenic therapy. Science 307: 58-62. 108. Jeong, J. W., M. K. Bae, M. Y. Ahn, S. H. Kim, T. K. Sohn, M. H. Bae, M. A. Yoo, E. J. Song, K. J. Lee, and K. W. Kim. 2002. Regulation and destabilization of HIF-1alpha by ARD1-mediated acetylation. Cell 111: 709-20. 109. Jiang, B. H., F. Agani, A. Passaniti, and G. L. Semenza. 1997. V-SRC induces expression of hypoxia-inducible factor 1 (HIF-1) and transcription of genes encoding vascular endothelial growth fact or and enolase 1: involvement of HIF-1 in tumor progression. Cancer Res 57: 5328-35.

PAGE 117

106 110. Jiang, B. H., J. Z. Zheng, M. Aoki, and P. K. Vogt. 2000. Phosphatidylinositol 3-kinase signaling mediates angiogenesis and expression of vascular endothelial growth factor in endothelial cells. Proc Natl Acad Sci U S A 97: 1749-53. 111. Jiang, B. H., J. Z. Zheng, S. W. Leung, R. Roe, and G. L. Semenza. 1997. Transactivation and inhibitory domains of hypoxia-inducible factor 1alpha. Modulation of transcriptional activity by oxygen tension. J Biol Chem 272:19253-60. 112. Jimenez, B., O. V. Volpert, S. E. Crawford, M. Febbraio, R. L. Silverstein, and N. Bouck. 2000. Signals leading to apoptosis-dependent inhibition of neovascularization by thrombospondin-1. Nat Med 6: 41-8. 113. Jones, A., C. Fujiyama, C. Blanche, J. W. Moore, S. Fuggle, D. Cranston, R. Bicknell, and A. L. Harris. 2001. Relation of vascular endothelial growth factor production to expression and regulation of hypoxia-inducible factor-1 alpha and hypoxia-inducible factor-2 alpha in human bladder tumors and cell lines. Clin Cancer Res 7: 1263-72.

PAGE 118

107 114. Joung, Y. H., J. H. Park, T. Park, C. S. Lee, O. H. Kim, S. K. Ye, U. M. Yang, K. J. Lee, and Y. M. Yang. 2003. Hypoxia activates signal transducers and activators of transcription 5 (STAT5) and increases its binding activity to the GAS element in mammary epithelial cells. Exp Mol Med 35: 350-7. 115. Kabbinavar, F., H. I. Hurwitz, L. Fehrenbacher, N. J. Meropol, W. F. Novotny, G. Lieberman, S. Griffing, and E. Bergsland. 2003. Phase II, randomized trial comparing bevacizumab plus fluorouracil (FU)/leucovorin (LV) with FU/LV alone in patients with metastatic colorectal cancer. J Clin Oncol 21:60-5. 116. Karni, R., Y. Dor, E. Keshet, O. Meyuhas, and A. Levitzki. 2002. Activated pp60c-Src leads to elevated hypoxia-inducible factor (HIF)-1alpha expression under normoxia. J Biol Chem 277:42919-25. 117. Keck, P. J., S. D. Hauser, G. Krivi, K. Sanzo, T. Warren, J. Feder, and D. T. Connolly. 1989. Vascular permeability factor, an endothelial cell mitogen related to PDGF. Science 246: 1309-12.

PAGE 119

108 118. Kerbel, R., and J. Folkman. 2002. Clinical translation of angiogenesis inhibitors. Nat Rev Cancer 2: 727-39. 119. Kerbel, R. S. 1997. A cancer therapy resistant to resistance. Nature 390: 335-6. 120. Kieser, A., H. A. Weich, G. Brandner, D. Marme, and W. Kolch. 1994. Mutant p53 potentiates protein kinase C induction of vascular endothelial growth factor expression. Oncogene 9: 963-9. 121. Kim, K. J., B. Li, J. Winer, M. Armanini, N. Gillett, H. S. Phillips, and N. Ferrara. 1993. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 362: 841-4. 122. Klement, G., S. Baruchel, J. Rak, S. Man, K. Clark, D. J. Hicklin, P. Bohlen, and R. S. Kerbel. 2000. Continuous low-dose th erapy with vinblastine and VEGF receptor-2 antibody induces sustai ned tumor regression without overt toxicity. J Clin Invest 105: R15-24.

PAGE 120

109 123. Klement, G., P. Huang, B. Mayer, S. K. Green, S. Man, P. Bohlen, D. Hicklin, and R. S. Kerbel. 2002. Differences in therapeutic indexes of combination metronomic chemotherapy and an anti-VEGFR2 antibody in multidrug-resistant human breast cancer xenografts. Clin Cancer Res 8: 221-32. 124. Knighton, D. R., T. K. Hunt, H. Scheuenstuhl, B. J. Halliday, Z. Werb, and M. J. Banda. 1983. Oxygen tension regulates the expression of angiogenesis factor by macrophages. Science 221: 1283-5. 125. Koch, A. E., P. J. Polverini, S. L. Kunkel, L. A. Harlow, L. A. DiPietro, V. M. Elner, S. G. Elner, and R. M. Strieter. 1992. Interleukin-8 as a macrophagederived mediator of angiogenesis. Science 258: 1798-801. 126. Kourembanas, S., R. L. Hannan, and D. V. Faller. 1990. Oxygen tension regulates the expression of the platelet -derived growth factor-B chain gene in human endothelial cells. J Clin Invest 86:670-4.

PAGE 121

110 127. Kraker, A. J., B. G. Hartl, A. M. Amar, M. R. Barvian, H. D. Showalter, and C. W. Moore. 2000. Biochemical and cellular effects of c-Src kinase-selective pyrido[2, 3-d]pyrimidine tyrosine kinase inhibitors. Biochem Pharmacol 60:88598. 128. Krishnamachary, B., S. Berg-Dixon, B. Kelly, F. Agani, D. Feldser, G. Ferreira, N. Iyer, J. LaRusch, B. Pak, P. Taghavi, and G. L. Semenza. 2003. Regulation of colon carcinoma cell invas ion by hypoxia-inducible factor 1. Cancer Res 63:1138-43. 129. Kuwabara, K., S. Ogawa, M. Matsumoto, S. Koga, M. Clauss, D. J. Pinsky, P. Lyn, J. Leavy, L. Witte, J. Joseph-Silverstein, and et al. 1995. Hypoxiamediated induction of acidic/basic fibroblast growth factor and platelet-derived growth factor in mononuclear phagocytes stimulates growth of hypoxic endothelial cells. Proc Natl Acad Sci U S A 92:4606-10.

PAGE 122

111 130. Laderoute, K. R., J. M. Calaoagan, C. Gustafson-Brown, A. M. Knapp, G. C. Li, H. L. Mendonca, H. E. Ryan, Z. Wang, and R. S. Johnson. 2002. The response of c-jun/AP-1 to chronic hypoxia is hypoxia-inducible factor 1 alpha dependent. Mol Cell Biol 22:2515-23. 131. Lando, D., D. J. Peet, J. J. Gorman, D. A. Whelan, M. L. Whitelaw, and R. K. Bruick. 2002. FIH-1 is an asparaginyl hydroxylase enzyme that regulates the transcriptional activity of hypoxiainducible factor. Genes Dev 16:1466-71. 132. Lando, D., D. J. Peet, D. A. Whelan, J. J. Gorman, and M. L. Whitelaw. 2002. Asparagine hydroxylation of the HIF transactivation domain a hypoxic switch. Science 295:858-61. 133. Laughner, E., P. Taghavi, K. Chiles, P. C. Mahon, and G. L. Semenza. 2001. HER2 (neu) signaling increases the rate of hypoxia-inducible factor 1alpha (HIF1alpha) synthesis: novel mechanism for HIF-1-mediated vascular endothelial growth factor expression. Mol Cell Biol 21:3995-4004.

PAGE 123

112 134. Lee, C. G., M. Heijn, E. di Tomaso, G. Griffon-Etienne, M. Ancukiewicz, C. Koike, K. R. Park, N. Ferrara, R. K. Jain, H. D. Suit, and Y. Boucher. 2000. Anti-Vascular endothelial growth factor treatment augments tumor radiation response under normoxic or hypoxic conditions. Cancer Res 60:5565-70. 135. Leung, D. W., G. Cachianes, W. J. Kuang, D. V. Goeddel, and N. Ferrara. 1989. Vascular endothelial growth fact or is a secreted angiogenic mitogen. Science 246: 1306-9. 136. Levy, A. P., N. S. Levy, and M. A. Goldberg. 1996. Post-transcriptional regulation of vascular endothelial growth factor by hypoxia. J Biol Chem 271:2746-53. 137. Levy, A. P., N. S. Levy, S. Wegner, and M. A. Goldberg. 1995. Transcriptional regulation of the rat vascular endothe lial growth factor gene by hypoxia. J Biol Chem 270:13333-40. 138. Levy, D. E., and J. E. Darnell, Jr. 2002. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3: 651-62.

PAGE 124

113 139. Li, J., M. A. Perrella, J. C. Tsai, S. F. Yet, C. M. Hsieh, M. Yoshizumi, C. Patterson, W. O. Endege, F. Zhou, and M. E. Lee. 1995. Induction of vascular endothelial growth factor gene expression by interleukin-1 beta in rat aortic smooth muscle cells. J Biol Chem 270:308-12. 140. Liu, Y., S. R. Cox, T. Morita, and S. Kourembanas. 1995. Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer. Circ Res 77:638-43. 141. Lok, C. N., and P. Ponka. 1999. Identification of a hypoxia response element in the transferrin receptor gene. J Biol Chem 274:24147-52. 142. Maity, A., N. Pore, J. Lee, D. Solomon, and D. M. O'Rourke. 2000. Epidermal growth factor receptor transcriptionally up-regulates vascular endothelial growth factor expression in human glioblastoma cells via a pathway involving phosphatidylinositol 3'-kinase and distinct from that induced by hypoxia. Cancer Res 60:5879-86.

PAGE 125

114 143. Makino, Y., R. Cao, K. Svensson, G. Bertilsson, M. Asman, H. Tanaka, Y. Cao, A. Berkenstam, and L. Poellinger. 2001. Inhibitory PAS domain protein is a negative regulator of hypoxia-indu cible gene expression. Nature 414: 550-4. 144. Makino, Y., A. Kanopka, W. J. Wilson, H. Tanaka, and L. Poellinger. 2002. Inhibitory PAS domain protein (IPAS) is a hypoxia-inducible splicing variant of the hypoxia-inducible factor-3alpha locus. J Biol Chem 277:32405-8. 145. Masson, N., and P. J. Ratcliffe. 2003. HIF prolyl and asparaginyl hydroxylases in the biological response to intracellular O(2) levels. J Cell Sci 116:3041-9. 146. Mauceri, H. J., N. N. Hanna, M. A. Beckett, D. H. Gorski, M. J. Staba, K. A. Stellato, K. Bigelow, R. Heimann, S. Gately, M. Dhanabal, G. A. Soff, V. P. Sukhatme, D. W. Kufe, and R. R. Weichselbaum. 1998. Combined effects of angiostatin and ionizing radiati on in antitumour therapy. Nature 394:287-91. 147. Maxwell, P. H., M. S. Wiesener, G. W. Chang, S. C. Clifford, E. C. Vaux, M. E. Cockman, C. C. Wykoff, C. W. Pugh, E. R. Maher, and P. J. Ratcliffe. 1999. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399:271-5.

PAGE 126

115 148. Mazure, N. M., E. Y. Chen, K. R. Laderoute, and A. J. Giaccia. 1997. Induction of vascular endothelial growth factor by hypoxia is modulated by a phosphatidylinositol 3-kinase/Akt signaling pathway in Ha-ras-transformed cells through a hypoxia inducible factor -1 transcriptional element. Blood 90:3322-31. 149. McCawley, L. J., and L. M. Matrisian. 2001. Matrix metalloproteinases: they're not just for matrix anymore! Curr Opin Cell Biol 13:534-40. 150. Mezquita, P., S. S. Parghi, K. A. Brandvold, and A. Ruddell. 2005. Myc regulates VEGF production in B cells by stimulating initiation of VEGF mRNA translation. Oncogene 24:889-901. 151. Millauer, B., L. K. Shawver, K. H. Plate, W. Risau, and A. Ullrich. 1994. Glioblastoma growth inhibited in vivo by a dominant-negative Flk-1 mutant. Nature 367: 576-9. 152. Minet, E., T. Arnould, G. Michel, I. Roland, D. Mottet, M. Raes, J. Remacle, and C. Michiels. 2000. ERK activation upon hypoxia: involvement in HIF-1 activation. FEBS Lett 468:53-8.

PAGE 127

116 153. Mizukami, Y., J. Li, X. Zhang, M. A. Zimmer, O. Iliopoulos, and D. C. Chung. 2004. Hypoxia-inducible factor-1-independent regulation of vascular endothelial growth factor by hypoxia in colon cancer. Cancer Res 64:1765-72. 154. Mukhopadhyay, D., L. Tsiokas, and V. P. Sukhatme. 1995. Wild-type p53 and v-Src exert opposing influences on human vascular endothelial growth factor gene expression. Cancer Res 55:6161-5. 155. Mukhopadhyay, D., L. Tsiokas, X. M. Zhou, D. Foster, J. S. Brugge, and V. P. Sukhatme. 1995. Hypoxic induction of human vascular endothelial growth factor expression through c-Src activation. Nature 375:577-81. 156. Namiki, A., E. Brogi, M. Kearney, E. A. Kim, T. Wu, T. Couffinhal, L. Varticovski, and J. M. Isner. 1995. Hypoxia induces vascular endothelial growth factor in cultured human endothelial cells. J Biol Chem 270:31189-95. 157. Ni, Z., W. Lou, E. S. Leman, and A. C. Gao. 2000. Inhibition of constitutively activated Stat3 signaling pathway suppre sses growth of prostate cancer cells. Cancer Res 60:1225-8.

PAGE 128

117 158. Niu, G., T. Bowman, M. Huang, S. Shivers, D. Reintgen, A. Daud, A. Chang, A. Kraker, R. Jove, and H. Yu. 2002. Roles of activated Src and Stat3 signaling in melanoma tumor cell growth. Oncogene 21:7001-10. 159. Niu, G., K. L. Wright, M. Huang, L. Song, E. Haura, J. Turkson, S. Zhang, T. Wang, D. Sinibaldi, D. Coppola, R. Heller, L. M. Ellis, J. Karras, J. Bromberg, D. Pardoll, R. Jove, and H. Yu. 2002. Constitutive Stat3 activity upregulates VEGF expression and tumor angiogenesis. Oncogene 21:2000-8. 160. Pertovaara, L., A. Kaipainen, T. Mustonen, A. Orpana, N. Ferrara, O. Saksela, and K. Alitalo. 1994. Vascular endothelial grow th factor is induced in response to transforming growth factor-bet a in fibroblastic and epithelial cells. J Biol Chem 269:6271-4. 161. Petit, A. M., J. Rak, M. C. Hung, P. Rockwell, N. Goldstein, B. Fendly, and R. S. Kerbel. 1997. Neutralizing antibodies against epidermal growth factor and ErbB-2/neu receptor tyrosine kinases down -regulate vascular endothelial growth factor production by tumor cells in vitro and in vivo: angiogenic implications for signal transduction therapy of solid tumors. Am J Pathol 151: 1523-30.

PAGE 129

118 162. Plate, K. H., G. Breier, H. A. Weich, and W. Risau. 1992. Vascular endothelial growth factor is a potential tumour angiogenesis factor in human gliomas in vivo. Nature 359: 845-8. 163. Poon, R. T., S. T. Fan, and J. Wong. 2001. Clinical implications of circulating angiogenic factors in cancer patients. J Clin Oncol 19:1207-25. 164. Pugh, C. W., J. F. O'Rourke, M. Nagao, J. M. Gleadle, and P. J. Ratcliffe. 1997. Activation of hypoxia-inducible factor -1; definition of regulatory domains within the alpha subunit. J Biol Chem 272:11205-14. 165. Pugh, C. W., and P. J. Ratcliffe. 2003. Regulation of angiogenesis by hypoxia: role of the HIF system. Nat Med 9: 677-84. 166. Rak, J., Y. Mitsuhashi, L. Bayko, J. Filmus, S. Shirasawa, T. Sasazuki, and R. S. Kerbel. 1995. Mutant ras oncogenes upregulate VEGF/VPF expression: implications for induction and inhibition of tumor angiogenesis. Cancer Res 55:4575-80.

PAGE 130

119 167. Ravi, R., B. Mookerjee, Z. M. Bhujwalla, C. H. Sutter, D. Artemov, Q. Zeng, L. E. Dillehay, A. Madan, G. L. Semenza, and A. Bedi. 2000. Regulation of tumor angiogenesis by p53-induced degradation of hypoxia-inducible factor 1alpha. Genes Dev 14:34-44. 168. Repovic, P., C. Y. Fears, C. L. Gladson, and E. N. Benveniste. 2003. Oncostatin-M induction of vascular endothelial growth factor expression in astroglioma cells. Oncogene 22:8117-24. 169. Richard, D. E., E. Berra, E. Gothie, D. Roux, and J. Pouyssegur. 1999. p42/p44 mitogen-activated protein kinases phosphorylate hypoxia-inducible factor 1alpha (HIF-1alpha) and enhance the transcriptional activity of HIF-1. J Biol Chem 274:32631-7. 170. Richard, D. E., E. Berra, and J. Pouyssegur. 2000. Nonhypoxic pathway mediates the induction of hypoxia-inducible factor 1alpha in vascular smooth muscle cells. J Biol Chem 275:26765-71. 171. Rofstad, E. K. 2000. Microenvironment-induced cancer metastasis. Int J Radiat Biol 76:589-605.

PAGE 131

120 172. Rolfs, A., I. Kvietikova, M. Gassmann, and R. H. Wenger. 1997. Oxygenregulated transferrin expression is mediat ed by hypoxia-inducible factor-1. J Biol Chem 272:20055-62. 173. Rupec, R. A., and P. A. Baeuerle. 1995. The genomic response of tumor cells to hypoxia and reoxygenation. Differential activa tion of transcription factors AP-1 and NF-kappa B. Eur J Biochem 234:632-40. 174. Ryuto, M., M. Ono, H. Izumi, S. Yoshida, H. A. Weich, K. Kohno, and M. Kuwano. 1996. Induction of vascular endothelial growth factor by tumor necrosis factor alpha in human glioma cells. Possible roles of SP-1. J Biol Chem 271:28220-8. 175. Sargiannidou, I., J. Zhou, and G. P. Tuszynski. 2001. The role of thrombospondin-1 in tumor progression. Exp Biol Med (Maywood) 226:726-33. 176. Scheidegger, K. J., J. Du, and P. Delafontaine. 1999. Distinct and common pathways in the regulation of insulin -like growth factor-1 receptor gene expression by angiotensin II and basic fibroblast growth factor. J Biol Chem 274:3522-30.

PAGE 132

121 177. Schofield, C. J., and P. J. Ratcliffe. 2004. Oxygen sensing by HIF hydroxylases. Nat Rev Mol Cell Biol 5: 343-54. 178. Seftor, R. E., E. A. Seftor, W. G. Stetler-Stevenson, and M. J. Hendrix. 1993. The 72 kDa type IV collagenase is modulated via differential expression of alpha v beta 3 and alpha 5 beta 1 integr ins during human melanoma cell invasion. Cancer Res 53:3411-5. 179. Seidel, H. M., L. H. Milocco, P. Lamb, J. E. Darnell, Jr., R. B. Stein, and J. Rosen. 1995. Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activator s of transcription) DNA binding and transcriptional activity. Proc Natl Acad Sci U S A 92:3041-5. 180. Semenza, G. L. 2003. Targeting HIF-1 for cancer therapy. Nat Rev Cancer 3: 721-32. 181. Semenza, G. L., P. H. Roth, H. M. Fang, and G. L. Wang. 1994. Transcriptional regulation of genes encoding glycolytic enzymes by hypoxiainducible factor 1. J Biol Chem 269: 23757-63.

PAGE 133

122 182. Semenza, G. L., and G. L. Wang. 1992. A nuclear factor induced by hypoxia via de novo protein synthesis binds to th e human erythropoietin gene enhancer at a site required for transcripti onal activation. Mol Cell Biol 12:5447-54. 183. Shalaby, F., J. Rossant, T. P. Yamaguchi, M. Gertsenstein, X. F. Wu, M. L. Breitman, and A. C. Schuh. 1995. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature 376: 62-6. 184. Shi, Q., X. Le, J. L. Abbruzzese, Z. Peng, C. N. Qian, H. Tang, Q. Xiong, B. Wang, X. C. Li, and K. Xie. 2001. Constitutive Sp1 activ ity is essential for differential constitutive expression of vascul ar endothelial growth factor in human pancreatic adenocarcinoma. Cancer Res 61:4143-54. 185. Shi, Q., X. Le, B. Wang, J. L. Abbruzzese, Q. Xiong, Y. He, and K. Xie. 2001. Regulation of vascular endothelial growth factor expression by acidosis in human cancer cells. Oncogene 20:3751-6. 186. Shuai, K., C. M. Horvath, L. H. Huang, S. A. Qureshi, D. Cowburn, and J. E. Darnell, Jr. 1994. Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell 76:821-8.

PAGE 134

123 187. Shweiki, D., A. Itin, D. Soffer, and E. Keshet. 1992. Vascular endothelial growth factor induced by hypoxia may medi ate hypoxia-initiated angiogenesis. Nature 359: 843-5. 188. Sodhi, A., S. Montaner, V. Patel, M. Zohar, C. Bais, E. A. Mesri, and J. S. Gutkind. 2000. The Kaposi's sarcoma-associated herpes virus G protein-coupled receptor up-regulates vascul ar endothelial growth fact or expression and secretion through mitogen-activated protein kinase and p38 pathways acting on hypoxiainducible factor 1alpha. Cancer Res 60:4873-80. 189. Stambolic, V., A. Suzuki, J. L. de la Pompa, G. M. Brothers, C. Mirtsos, T. Sasaki, J. Ruland, J. M. Penninger, D. P. Siderovski, and T. W. Mak. 1998. Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95:29-39. 190. Stein, I., M. Neeman, D. Shweiki, A. Itin, and E. Keshet. 1995. Stabilization of vascular endothelial growth factor mRNA by hypoxia and hypoglycemia and coregulation with other ischemia-induced genes. Mol Cell Biol 15:5363-8.

PAGE 135

124 191. Stiehl, D. P., W. Jelkmann, R. H. Wenger, and T. Hellwig-Burgel. 2002. Normoxic induction of the hypoxia-induci ble factor 1alpha by insulin and interleukin-1beta involves the phosphatidylinositol 3-kinase pathway. FEBS Lett 512:157-62. 192. Tacchini, L., L. Bianchi, A. Bernelli-Zazzera, and G. Cairo. 1999. Transferrin receptor induction by hypoxia. HIF-1-mediat ed transcriptional activation and cellspecific post-transcriptional regulation. J Biol Chem 274:24142-6. 193. Tacchini, L., P. Dansi, E. Matteucci, and M. A. Desiderio. 2001. Hepatocyte growth factor signalling stimulates hypoxia inducible factor-1 (HIF-1) activity in HepG2 hepatoma cells. Carcinogenesis 22:1363-71. 194. Takahashi, Y., S. Takahashi, Y. Shiga, T. Yoshimi, and T. Miura. 2000. Hypoxic induction of prolyl 4-hydroxylase alpha (I) in cultured cells. J Biol Chem 275:14139-46. 195. Tanimoto, K., Y. Makino, T. Pereira, and L. Poellinger. 2000. Mechanism of regulation of the hypoxia-inducible f actor-1 alpha by the von Hippel-Lindau tumor suppressor protein. Embo J 19: 4298-309.

PAGE 136

125 196. Tazuke, S. I., N. M. Mazure, J. Sugawara, G. Carland, G. H. Faessen, L. F. Suen, J. C. Irwin, D. R. Powell, A. J. Giaccia, and L. C. Giudice. 1998. Hypoxia stimulates insulin-like growth factor binding protein 1 (IGFBP-1) gene expression in HepG2 cells: a possible model for IGFBP-1 expression in fetal hypoxia. Proc Natl Acad Sci U S A 95: 10188-93. 197. Teicher, B. A., S. A. Holden, G. Ara, E. A. Sotomayor, Z. D. Huang, Y. N. Chen, and H. Brem. 1994. Potentiation of cytot oxic cancer therapies by TNP470 alone and with other antiangiogenic agents. Int J Cancer 57:920-5. 198. Terman, B. I., M. Dougher-Vermazen, M. E. Carrion, D. Dimitrov, D. C. Armellino, D. Gospodarowicz, and P. Bohlen. 1992. Identification of the KDR tyrosine kinase as a receptor for vas cular endothelial cell growth factor. Biochem Biophys Res Commun 187:1579-86. 199. Thomlinson, R. H., and L. H. Gray. 1955. The histological structure of some human lung cancers and the possible implications for radiotherapy. Br J Cancer 9: 539-49.

PAGE 137

126 200. Thornton, R. D., P. Lane, R. C. Borghaei, E. A. Pease, J. Caro, and E. Mochan. 2000. Interleukin 1 induces hypoxiainducible factor 1 in human gingival and synovial fibroblasts. Biochem J 350 Pt 1: 307-12. 201. Tian, H., S. L. McKnight, and D. W. Russell. 1997. Endothelial PAS domain protein 1 (EPAS1), a transcription fa ctor selectively expr essed in endothelial cells. Genes Dev 11:72-82. 202. Tischer, E., R. Mitchell, T. Hartman, M. Silva, D. Gospodarowicz, J. C. Fiddes, and J. A. Abraham. 1991. The human gene for vascular endothelial growth factor. Multiple protein fo rms are encoded through alternative exon splicing. J Biol Chem 266:11947-54. 203. Toi, M., T. Matsumoto, and H. Bando. 2001. Vascular endothelial growth factor: its prognostic, predictive, and t herapeutic implications. Lancet Oncol 2: 667-73.

PAGE 138

127 204. Treins, C., S. Giorgetti-Peraldi, J. Mu rdaca, G. L. Semenza, and E. Van Obberghen. 2002. Insulin stimulates hypoxia-inducible factor 1 through a phosphatidylinositol 3-kinase/target of rapamycin-dependent signaling pathway. J Biol Chem 277:27975-81. 205. Turkson, J., T. Bowman, R. Garcia, E. Caldenhoven, R. P. De Groot, and R. Jove. 1998. Stat3 activation by Src induces specific gene regulation and is required for cell transformation. Mol Cell Biol 18: 2545-52. 206. Vaupel, P., K. Schlenger, C. Knoop, and M. Hockel. 1991. Oxygenation of human tumors: evaluation of tissue oxygen distribution in breast cancers by computerized O2 tension measurements. Cancer Res 51:3316-22. 207. Vignais, M. L., H. B. Sadowski, D. Watling, N. C. Rogers, and M. Gilman. 1996. Platelet-derived growth factor induces phosphorylation of multiple JAK family kinases and STAT proteins. Mol Cell Biol 16:1759-69. 208. Vivanco, I., and C. L. Sawyers. 2002. The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2: 489-501.

PAGE 139

128 209. Wang, D., H. J. Huang, A. Kazlauskas, and W. K. Cavenee. 1999. Induction of vascular endothelial growth factor expr ession in endothelial cells by plateletderived growth factor through the activation of phosphatidylinositol 3-kinase. Cancer Res 59:1464-72. 210. Wang, G. L., B. H. Jiang, E. A. Rue, and G. L. Semenza. 1995. Hypoxiainducible factor 1 is a basic-helix-loo p-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci U S A 92: 5510-4. 211. Wang, G. L., and G. L. Semenza. 1993. General involvement of hypoxiainducible factor 1 in transcriptional response to hypoxia. Proc Natl Acad Sci U S A 90:4304-8. 212. Wang, G. L., and G. L. Semenza. 1995. Purification and characterization of hypoxia-inducible factor 1. J Biol Chem 270:1230-7. 213. Watson, C. J., and W. R. Miller. 1995. Elevated levels of members of the STAT family of transcription factors in br east carcinoma nuclear extracts. Br J Cancer 71:840-4.

PAGE 140

129 214. Wei, D., X. Le, L. Zheng, L. Wang, J. A. Frey, A. C. Gao, Z. Peng, S. Huang, H. Q. Xiong, J. L. Abbruzzese, and K. Xie. 2003. Stat3 activation regulates the expression of vascular endothelial growth factor and human pancreatic cancer angiogenesis and metastasis. Oncogene 22:319-29. 215. Wei, L. H., M. L. Kuo, C. A. Chen, C. H. Chou, K. B. Lai, C. N. Lee, and C. Y. Hsieh. 2003. Interleukin-6 promotes cervical tumor growth by VEGFdependent angiogenesis via a STAT3 pathway. Oncogene 22:1517-27. 216. Weidner, N., J. P. Semple, W. R. Welch, and J. Folkman. 1991. Tumor angiogenesis and metastasis--cor relation in invasive breast carcinoma. N Engl J Med 324:1-8. 217. Wen, Z., and J. E. Darnell, Jr. 1997. Mapping of Stat3 serine phosphorylation to a single residue (727) and evidenc e that serine phosphorylation has no influence on DNA binding of Stat1 and Stat3. Nucleic Acids Res 25:2062-7.

PAGE 141

130 218. Wiener, J. R., K. Nakano, R. P. Kruzelock, C. D. Bucana, R. C. Bast, Jr., and G. E. Gallick. 1999. Decreased Src tyrosine kinase activity inhibits malignant human ovarian cancer tumor growth in a nude mouse model. Clin Cancer Res 5: 2164-70. 219. Wiesener, M. S., J. S. Jurgensen, C. Rosenberger, C. K. Scholze, J. H. Horstrup, C. Warnecke, S. Mandriota, I. Bechmann, U. A. Frei, C. W. Pugh, P. J. Ratcliffe, S. Bachmann, P. H. Maxwell, and K. U. Eckardt. 2003. Widespread hypoxia-inducible expression of HIF-2alpha in distinct cell populations of different organs. Faseb J 17:271-3. 220. Wiesener, M. S., H. Turley, W. E. Allen, C. Willam, K. U. Eckardt, K. L. Talks, S. M. Wood, K. C. Gatter, A. L. Harris, C. W. Pugh, P. J. Ratcliffe, and P. H. Maxwell. 1998. Induction of endothelial PAS domain protein-1 by hypoxia: characterization and comparison with hypoxia-inducible factor-1alpha. Blood 92:2260-8.

PAGE 142

131 221. Wood, J. M., G. Bold, E. Buchdunger, R. Cozens, S. Ferrari, J. Frei, F. Hofmann, J. Mestan, H. Mett, T. O'Reilly, E. Persohn, J. Rosel, C. Schnell, D. Stover, A. Theuer, H. Towbin, F. Wenger, K. Woods-Cook, A. Menrad, G. Siemeister, M. Schirner, K. H. Thierauch, M. R. Schneider, J. Drevs, G. Martiny-Baron, and F. Totzke. 2000. PTK787/ZK 222584, a novel and potent inhibitor of vascular endothelial growth factor receptor tyrosine kinases, impairs vascular endothelial growth factor-induced responses and tumor growth after oral administration. Cancer Res 60:2178-89. 222. Wu, X., K. Senechal, M. S. Neshat, Y. E. Whang, and C. L. Sawyers. 1998. The PTEN/MMAC1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway. Proc Natl Acad Sci U S A 95:15587-91. 223. Xie, T. X., D. Wei, M. Liu, A. C. Gao, F. Ali-Osman, R. Sawaya, and S. Huang. 2004. Stat3 activation regulates the expression of matrix metalloproteinase-2 and tumor invasion and metastasis. Oncogene 23:3550-60.

PAGE 143

132 224. Xu, L., K. Xie, N. Mukaida, K. Matsushima, and I. J. Fidler. 1999. Hypoxiainduced elevation in interleukin-8 expression by human ovarian carcinoma cells. Cancer Res 59:5822-9. 225. Yahata, Y., Y. Shirakata, S. Tokumaru, K. Yamasaki, K. Sayama, Y. Hanakawa, M. Detmar, and K. Hashimoto. 2003. Nuclear translocation of phosphorylated STAT3 is essential for VEGF-induced human dermal microvascular endothelial cell migration and tube formation. J Biol Chem. 226. Yang, J. C., L. Haworth, R. M. Sherry, P. Hwu, D. J. Schwartzentruber, S. L. Topalian, S. M. Steinberg, H. X. Chen, and S. A. Rosenberg. 2003. A randomized trial of bevacizumab, an anti-vas cular endothelial growth factor antibody, for metastatic renal cancer. N Engl J Med 349:427-34. 227. Yao, K. S., S. Xanthoudakis, T. Curran, and P. J. O'Dwyer. 1994. Activation of AP-1 and of a nuclear redox factor, Ref-1, in the response of HT29 colon cancer cells to hypoxia. Mol Cell Biol 14:5997-6003.

PAGE 144

133 228. Yu, C. L., D. J. Meyer, G. S. Campbell, A. C. Larner, C. Carter-Su, J. Schwartz, and R. Jove. 1995. Enhanced DNA-binding activity of a Stat3-related protein in cells transformed by the Src oncoprotein. Science 269: 81-3. 229. Yu, F., S. B. White, Q. Zhao, and F. S. Lee. 2001. HIF-1alpha binding to VHL is regulated by stimulus-sensitive pro line hydroxylation. Proc Natl Acad Sci U S A 98:9630-5. 230. Yu, H., and R. Jove. 2004. The STATs of cancer--new molecular targets come of age. Nat Rev Cancer 4: 97-105. 231. Yuan, F., Y. Chen, M. Dellian, N. Safabakhsh, N. Ferrara, and R. K. Jain. 1996. Time-dependent vascular regression and permeability changes in established human tumor xenografts i nduced by an anti-vascular endothelial growth factor/vascular permeability fact or antibody. Proc Natl Acad Sci U S A 93:14765-70. 232. Yuan, J., and P. M. Glazer. 1998. Mutagenesis induced by the tumor microenvironment. Mutat Res 400:439-46.

PAGE 145

134 233. Yuan, J., L. Narayanan, S. Rockwell, and P. M. Glazer. 2000. Diminished DNA repair and elevated mutagenesis in mammalian cells exposed to hypoxia and low pH. Cancer Res 60:4372-6. 234. Zelzer, E., Y. Levy, C. Kahana, B. Z. Shilo, M. Rubinstein, and B. Cohen. 1998. Insulin induces transcription of ta rget genes through th e hypoxia-inducible factor HIF-1alpha/ARNT. Embo J 17: 5085-94. 235. Zhang, Y. W., Y. Su, O. V. Volpert, and G. F. Vande Woude. 2003. Hepatocyte growth factor/scatter fact or mediates angiogenesis through positive VEGF and negative thrombospondin 1 regulation. Proc Natl Acad Sci U S A 100:12718-23. 236. Zhong, H., K. Chiles, D. Feldser, E. Laughner, C. Hanrahan, M. M. Georgescu, J. W. Simons, and G. L. Semenza. 2000. Modulation of hypoxiainducible factor 1alpha expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: i mplications for tumor angiogenesis and therapeutics. Cancer Res 60:1541-5.

PAGE 146

135 237. Zhong, Z., Z. Wen, an d J. E. Darnell, Jr. 1994. Stat3: a STAT family member activated by tyrosine phosphorylation in re sponse to epidermal growth factor and interleukin-6. Science 264: 95-8. 238. Zundel, W., C. Schindler, D. Haas-Kogan, A. Koong, F. Kaper, E. Chen, A. R. Gottschalk, H. E. Ryan, R. S. Johnson, A. B. Jefferson, D. Stokoe, and A. J. Giaccia. 2000. Loss of PTEN facilitates HIF-1-mediated gene expression. Genes Dev 14: 391-6.

PAGE 147

About the Author Jon Briggs was born and raised in upstate New York. His initial studies were in classical guitar, and he received a Bachelor of Fine Arts degree in music performance from the University of South Florida in 1997. While teaching music as a private instructor, he finished a Bachelor of Sci ence degree in Biology in 2000. He entered the Doctor of Philosophy program in the department of Medica l Microbiology and Immunology at USF in 2000. Jon has conducted research with his mentor Dr. Hua Yu since 2001. This research was published in Oncogene in 2005.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001670361
003 fts
005 20051216093319.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 051118s2005 flu sbm s000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001227
035
(OCoLC)62299949
SFE0001227
040
FHM
c FHM
049
FHMM
090
QR46 (Online)
1 100
Briggs, Jon J.
0 245
Role of stat3 in regulating hif-1alpha expression and tumor angiogenesis
h [electronic resource] /
by Jon J. Briggs.
260
[Tampa, Fla.] :
b University of South Florida,
2005.
502
Thesis (Ph.D.)--University of South Florida, 2005.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 147 pages.
Includes vita.
520
ABSTRACT: Increased vascularization (angiogenesis) is a required adaptation for sustained tumor growth, and the primary mediator of de novo blood vessel formation is vascular endothelial growth factor (VEGF). The central transcriptional activator of VEGF is hypoxia inducible factor-1 (HIF-1), a heterodimeric transcription factor composed of an inducible HIF-1alpha subunit and a constitutively expressed HIF-1beta subunit. In addition to HIF-1, it has recently been reported that signal transducer and activator of transcription 3 (Stat3) is required for VEGF production and angiogenesis. Although it is known that Stat3 is an important mediator of many of the oncogenic signaling pathways that regulate HIF-1alpha, it was not known if Stat3 regulates HIF-1alpha. To answer this important question, the effect of blocking Stat3 signaling on both HIF-1alpha and VEGF expression was examined.Treatment of cells with IL-6, a potent activator of Stat3, resulted in HIF-1alpha and VEGF induction during normoxia. By blocking protein synthesis with cycloheximide, it was determined that IL-6 induction of HIF-1alpha resulted from increased translation. When Stat3 was silenced with siRNA, both basal level expression and IL-6 induction of HIF-1alpha and VEGF were significantly reduced. Furthermore, it is likely that Stat3 is required for HIF-1alpha induction by a variety of growth signals, as both HIF-1alpha and VEGF expression resulting from EGF and heregulin were abolished when Stat3 signaling was blocked. Because we had observed that Stat3 was required for induction of HIF-1alpha by growth signals, we wanted to determine if Stat3 was also required for HIF-1a induction by hypoxia. When Stat3 was silenced and cells exposed to hypoxia, HIF-1a expression was again abolished. Furthermore, the hypoxic induction of VEGF and MMP-2 was also prevented.
590
Adviser: Hua Yu, Ph.D.
Co-adviser: Peter Medveczky, M.D.
653
Stat.
Hif.
Vegf.
Il-6.
Angiogenesis.
Hypoxia.
690
Dissertations, Academic
z USF
x Medical Microbiology and Immunology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1227