USF Libraries
USF Digital Collections

Molecular subtyping and antibiotic resistance analysis of Salmonella species

MISSING IMAGE

Material Information

Title:
Molecular subtyping and antibiotic resistance analysis of Salmonella species
Physical Description:
Book
Language:
English
Creator:
Tatavarthy, Aparna
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Salmonella
Ribotyping
PFGE
Antibiotic resistance
Integrons
Dissertations, Academic -- Biology -- Doctoral -- USF
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: The genus Salmonella, comprised of 2400 serotypes, is one of the leading causes of foodborne illnesses in the US and has been used for the deliberate contamination of food. A rapid system for detection, isolation, typing and antibiotic susceptibility profiling is essential for diagnosis and source tracking in natural outbreaks or a bioterrorism event. Pure culture is essential for molecular typing and antibiotic resistance testing. The virulence and the resistance mechanisms of Salmonella are rapidly evolving and many are still unexplained. The first aim of the study was to rapidly detect and isolate Salmonella from intentionally contaminated food. The second aim was to build a DNA fingerprinting database for accurate identification of the subtype. The third objective was to study the antibiotic susceptibility patterns and the underlying mechanisms of resistance. A correlation between the DNA subtypes and antibiograms was hypothesized. An association between the resista nce determinants and pathogenicity genes was expected. A total of 114 isolates including environmental and clinical sources were tested. General and selective enrichments and immunomagnetic separation (IMS) were tested for rapid detection and isolation of Salmonella from eight food groups. Isolates were subtyped by pulsed field gel electrophoresis (PFGE) and automated RiboPrinter. Resistance to 31 drugs was tested by the Sensititre system and integrons were identified by PCR. The association between virulence and resistance was verified by Southern hybridization. Of the three genes tested, ompF was found to be the most reliable target for identifying Salmonella subspecies I, III and IV. Detection by real time PCR after enrichment in buffered peptone water and isolation by IMS provided the fastest results. Sixty two ribotypes and 74 pulsotypes were observed for the 100 isolates subtyped. Sixty isolates were resistant to one or more antimicrobials and 12 had class-1 integrons. In concl usion, pure culture was achieved in 25 hours by IMS. Ribotyping, a comparatively rapid technique was found to be ideal for initial identification. PFGE, which was more discriminatory, was appropriate for source tracking. Contrary to the original hypothesis, no correlation between subtyping and antibiograms was observed and no association of integrons with the virulence genes tested was demonstrated
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2005.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Aparna Tatavarthy.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 224 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001912475
oclc - 173846766
usfldc doi - E14-SFE0001307
usfldc handle - e14.1307
System ID:
SFS0025628:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001912475
003 fts
005 20071009145109.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 071009s2005 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001307
040
FHM
c FHM
035
(OCoLC)173846766
049
FHMM
090
QH307.2 (ONLINE)
1 100
Tatavarthy, Aparna.
0 245
Molecular subtyping and antibiotic resistance analysis of Salmonella species
h [electronic resource] /
by Aparna Tatavarthy.
260
[Tampa, Fla] :
b University of South Florida,
2005.
3 520
ABSTRACT: The genus Salmonella, comprised of 2400 serotypes, is one of the leading causes of foodborne illnesses in the US and has been used for the deliberate contamination of food. A rapid system for detection, isolation, typing and antibiotic susceptibility profiling is essential for diagnosis and source tracking in natural outbreaks or a bioterrorism event. Pure culture is essential for molecular typing and antibiotic resistance testing. The virulence and the resistance mechanisms of Salmonella are rapidly evolving and many are still unexplained. The first aim of the study was to rapidly detect and isolate Salmonella from intentionally contaminated food. The second aim was to build a DNA fingerprinting database for accurate identification of the subtype. The third objective was to study the antibiotic susceptibility patterns and the underlying mechanisms of resistance. A correlation between the DNA subtypes and antibiograms was hypothesized. An association between the resista nce determinants and pathogenicity genes was expected. A total of 114 isolates including environmental and clinical sources were tested. General and selective enrichments and immunomagnetic separation (IMS) were tested for rapid detection and isolation of Salmonella from eight food groups. Isolates were subtyped by pulsed field gel electrophoresis (PFGE) and automated RiboPrinter. Resistance to 31 drugs was tested by the Sensititre system and integrons were identified by PCR. The association between virulence and resistance was verified by Southern hybridization. Of the three genes tested, ompF was found to be the most reliable target for identifying Salmonella subspecies I, III and IV. Detection by real time PCR after enrichment in buffered peptone water and isolation by IMS provided the fastest results. Sixty two ribotypes and 74 pulsotypes were observed for the 100 isolates subtyped. Sixty isolates were resistant to one or more antimicrobials and 12 had class-1 integrons. In concl usion, pure culture was achieved in 25 hours by IMS. Ribotyping, a comparatively rapid technique was found to be ideal for initial identification. PFGE, which was more discriminatory, was appropriate for source tracking. Contrary to the original hypothesis, no correlation between subtyping and antibiograms was observed and no association of integrons with the virulence genes tested was demonstrated
502
Dissertation (Ph.D.)--University of South Florida, 2005.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 224 pages.
Includes vita.
590
Adviser: Daniel Lim, Ph.D.
653
Salmonella.
Ribotyping.
PFGE.
Antibiotic resistance.
Integrons.
690
Dissertations, Academic
z USF
x Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1307



PAGE 1

Molecular Subtyping and Antibio tic Resistance Analysis of Salmonella Species Aparna Tatavarthy A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Biology College of Arts and Sciences University of South Florida Co-Major Professor: Daniel Lim, Ph.D. Co-Major Professor: Andrew Cannons, Ph.D. Valarie Harwood, Ph.D. Mylein Dao, Ph.D. Date of Approval: September 1, 2005 Keywords: Salmonella Ribotyping, PFGE, Antibiotic Resistance and Integrons Copyright 2005 Aparna Tatavarthy

PAGE 2

Dedication This work is dedicated to my husband Viswanadh Tatavarthy for moral support, Encouragement and complete cooperation

PAGE 3

Acknowledgements This work was supported by U.S. Army Research, Development and Engineering Command, contract DAAD13-01-C-0043. Would like to thank Frank Reeves of Florida Department of Health, Dr. Catherine Logue of North Dakota State University and Ravi Pallipamu of Washington State Department of Health for kindly providing isolates for this study. Also would like to thank Sonia Etheridge of Florida State Department of Health, Jacksonville for serotyping the clinical isolate

PAGE 4

Table of Contents List of Tables................................................................................................................. ....iv List of Figures.....................................................................................................................v List of Abbreviations........................................................................................................vii Chapter One Introduction.................................................................................................1 The Genus Salmonella .................................................................................................................1 Salmonella Infection....................................................................................................................3 Salmonella in Foodborne Outbreaks...........................................................................................4 Food as a Bioterrorism Agent................................................................................................... ...7 Detection of Salmonella ..............................................................................................................8 Isolation of Salmonella from food.............................................................................................14 Subtyping of Salmonella Species..............................................................................................18 Comparison of Phenotypic and Genotypic Chract erization.................................................................20 Molecular Typing............................................................................................................... .................21 Molecular Typing for Epidemio logical Inves tigations........................................................................25 Pathogenicity Islands in Salmonella ..........................................................................................27 Antibiotic Resistance in Salmonella ..........................................................................................31 Plasmids as Antibiotic Resistance De terminants................................................................................. 36 Integrons as Antibiotic Resistance De terminants................................................................................ 37 Hypothesis..................................................................................................................... ............42 Aims of the Study.............................................................................................................. ........45 Chapter Two Material and Methods...............................................................................46 Bacterial Isolates............................................................................................................. ..........46 DNA Extraction................................................................................................................. ........52 ......................................................................................................52 DNA Extraction by MagNA Pure DNA Extraction by Epicenter Kit................................................................................................ ........53 Real time PCRPrimer and Probe Testing................................................................................53 Detection and Isolation of Salmonella from Artificially Contaminated Food Samples............55 Statistical Analysis........................................................................................................... .........59 Ribotyping..................................................................................................................... ............59 i

PAGE 5

Pulsed Field Gel Electrophoresis (PFGE).................................................................................60 PFGE for NonTypeable Strains................................................................................................. ........61 Antibiotic Resistance Testing.................................................................................................. ..62 Dendrogram Construction.........................................................................................................64 Integron PCR................................................................................................................... ..........67 DNA Sequencing.......................................................................................................................68 Plasmid Extraction............................................................................................................. ........69 Membrane Transfer.............................................................................................................. .....70 Hybridization of Southern Blots................................................................................................ 71 Southern Blotting with 1.0 Kb Integron Fragment..............................................................................74 Dot Blots for Southe rn Hybrid ization........................................................................................... .......75 Chapter Three Results....................................................................................................76 Primer and Probe Testing of Salmonella species by Real Time PCR.......................................76 Detection and Isolation of Salmonella species from Artificially Contaminated Food Samples84 Detection of Salmonella species..........................................................................................................84 Isolation of Salmonella species............................................................................................................89 Application of Colonies Isolated from Food for Typing and An tibiotic Susceptibility Testing..........96 .............................................................................99 rDNA Analysis by Automated RiboPrinter DNA Fingerprinting by Macrorestriction Digestion (PFGE)..................................................101 Identification of Unknown Salmonella Serotypes by Molecular Typing................................103 Discrimination of Salmonella Species by Molecular Typing and Antibiotic Susceptibility patterns....................................................................................................................... .............109 Antibiotic Susceptibility Testing.............................................................................................1 17 Resistance Determinants........................................................................................................ ..121 Location of Integrons.......................................................................................................... ...............123 Sequencing of the Integrons.................................................................................................... ..........125 Association of Salmonella Pathogenicity Island (SPI) Genes and Integrons..........................132 Chapter Four Discussion..............................................................................................138 Chapter Five Significance of the Research..................................................................154 Chapter Six Future Directions......................................................................................156 ii

PAGE 6

References.......................................................................................................................158 Appendix A.....................................................................................................................192 About the Author...................................................................................................End Page iii

PAGE 7

List of Tables Table 1. Salmonella Nomenclature .....................................................................................2 Table 2. Salmonella Subtyping .........................................................................................24 Table 3. Salmonella Pathogenicity Islands .......................................................................30 Table 4. Antibiotic Resistance Mechanisms .....................................................................35 Table 5. Isolates Used in the Study ...................................................................................48 Table 6. Primers and Probes for Real Time PCR .............................................................54 Table 7. Food Samples for Analysis .................................................................................56 Table 8. Integron Primers .................................................................................................67 Table 9. Probes for Southern Hybridization .....................................................................73 Table 10. Real Time PCR Results ....................................................................................79 Table 11. Real time PCR Results-Low Spiked .................................................................85 Table 12. Real time PCR Results-Mixed Spiked ..............................................................87 Table 13. Isolation of Salmonella from 25 gm of Spiked Food ........................................94 Table 14. Antibiotic Sus ceptibility Testing of Salmonella Isolated from Spiked Food ...98 Table 15. Identific ation of Unknown Salmonella serotypes by Molecular Typing ........108 Table 16. Antibiotic Resistance of Clinical Salmonella Isolates ....................................119 Table 17. Antibiotic Resistance of Environmental Salmonella Isolates .........................120 Table 18. Sequencing of 1.0 Kb Integron Fragments .....................................................127 Table 19. Sequencing of 1.2 Kb, 1.6 Kb Integron Fragments ........................................128 iv

PAGE 8

List of Figures Figure 1. Integron Structure ..............................................................................................38 Figure 2. Isolation and Detection of Salmonella ..............................................................58 Figure 3. Molecular Weight Standard Analysis ................................................................65 Figure 4. Dot Blots ............................................................................................................75 Figure 5. Real Time PCR ..................................................................................................76 Figure 6. Real time PCR Results-Low Spiked ..................................................................86 Figure 7. Real time PCR Results-Mixed Spiked ..............................................................88 Figure 8. Isolation of Salmonella on Selective Plates .......................................................90 Figure 9. Isolation of Salmonella from 25 gm of Spiked Food ........................................95 Figure 10. Molecular Typing on Salmonella Isolated from Food ....................................96 Figure 11. Ribotyping of Salmonella ..............................................................................100 Figure 12. PFGE of Salmonella with XbaI .....................................................................102 Figure 13. Identification of Unknow n Salmonella by Molecular Typing ......................105 Figure 14. Ribotyping of S. Newport ..............................................................................112 Figure 15. PFGE of S. Newport ......................................................................................114 Figure 16. Antibiotyping of S. Newport .........................................................................116 Figure 17. Integrons in Multidrug Resistant Isolates ......................................................122 Figure 18. Plasmid Profiling of Integron Positive Isolates .............................................123 Figure 19. Detection of Integrons in Plasmids ................................................................125 Figure 20. Alignment of 1.0 Kb of Integrons of S. Typhimurium .................................130 Figure 21. Alignment of 1.0 Integrons of S. Typhimurium and Other Serotypes ..........131 v

PAGE 9

Figure 22. PFGE Gel of Integron Positive Isolates .........................................................133 Figure 23. Southern Hybridization with sitB Probe ........................................................134 Figure 24. Southern Hybridization with magA Probe .....................................................135 Figure 25. Southern Hybridization with 1 Kb Integron Probe ........................................137 vi

PAGE 10

List of Abbreviations 1. ANAAAdvanced Nucleic Acid Analyzer 2. ATCCAmerican Type Culture Collection 3. ACSuSTampicillin, chloramphenicol, sulfomethoxizole, streptomycin and tetracycline 4. AugAmoxicillin/Clavulanic Acid 5. A/SAmpicillin/Sublactum 6. Ami-Amikacin 7. AmpAmpicillin 8. AztAztreonam 9. aadaminoglycoside adenyl transferase 10. AxoCeftriaxone 11. BTBioterrorism 12. BPWBuffered Peptone Water 13. BAMBacterial Analytical Manual 14. BLASTBasic Local Alignment Search Tool 15. BHCBlack Hole Quencher 16. CBDCenter for Biological Defense 17. CDCCenters for Disease Control and Prevention 18. CFUColony Forming Units 19. CTCholera Toxin 20. cAMP-Cyclic Adenosine Monophosphate 21. CSConserved Sequence 22. C T -Cycle Threshold 23. CepCephalothin 24. ChChloramphenicol 25. CipCiprofloxacin 26. CotTrimethoprim/Sulfamethaxazole 27. DRDirect Repeats 28. DT104Direct Phage Type 104 29. DIGDigoxygenin 30. ELISAEnzyme Linked Immunosorbent Assay 31. ERIC-PCREnterobacterial Interg enic Repetitive Consensus PCR 32. FDAUS Food and Drug Administration 33. FRETFlorescent Resonance Energy Transfer 34. FAM6carboxyfluorescein 35. FAFLPFluorescent Amplified Fragment Length Polymorphism 36. FLDOHFlorida Department of Health 37. FoxCefoxitin 38. FepCefepime 39. FopCefoperazone 40. FotCefotaxime 41. FisSulfizoxazole vii

PAGE 11

42. GGentamicin 43. HPCHeterotrophic Plate Count 44. IMSImmunomagnetic Separation 45. I-Intermediately Resistant 46. ISInsertion Sequence 47. ImiImipenem 48. KKanamycin 49. LevoLevofloxacin 50. LomeLomefloxacin 51. MLSTMultilocus Sequence Typing 52. MLVAMultiple Locus Variable Number Tandem Repeat Analysis 53. MDRMultiDrug Resistant 54. mar -Multiple Antibiotic Resistance 55. MICMinimum Inhibitory Concentration 56. NDSUNorth Dakota State University 57. NCCLSNational Committee for Clinical Lab Standards 58. NCBINational Center for Biotechnology Information 59. NalNalidixic Acid 60. ompF Outer Membrane Porin F 61. PCRPolymerase Chain Reaction 62. PFGEPulsed Field Gel Electrophoresis 63. PS ribotypingPst I and Sph I ribotyping 64. PI-Pathogenicity Island 65. PBSPhosphate Buffered Saline 66. PipPiperacillin 67. P/TPiperacillin/Tazobactum 68. QACQuaternary Ammonium Compounds 69. RVRappaport Vassiliadis 70. RAPDRandomly Amplified Polymorphic DNA 71. REP-PCRRepetitive Extragenic Pallindromic PCR 72. RFLPRestriction Fragment Length Polymorphism 73. R-Resistant 74. SISuper Integrons 75. StrStreptomycin 76. SAFLPSingle Amplified Fragment Length Polymorphism 77. SPISalmonella Pathogenicity Islands 78. sopB Salmonella outer protein B 79. spv Salmonella Virulence Plasmid 80. SGISalmonella Genomic Island 1 81. SJHSt. Josephs Hospital 82. S-Susceptible 83. SmxSulfamethoxazole 84. TTSSType Three Secretion System 85. TTTetrathionate broth viii

PAGE 12

86. TGH-Tampa General Hospital 87. TE-Tris EDTA 88. TSBTrypticase Soy Broth 89. TSATrypticase Soy Agar 90. TIGRThe Institute for Genomic Research 91. TicTicarcillin 92. TimTicarcillin/ Clavulanic Acid 93. TobTobramycin 94. TioCeftiofur 95. TazCeftazidime 96. TetTetracycline 97. UCHUniversity Community Hospital 98. WADOHWashington State De partment of Health 99. XLDXylose-Lysine Desoxycholate ix

PAGE 13

Molecular Subtyping and Antibio tic Resistance Analysis of Salmonella Species Aparna Tatavarthy ABSTRACT The genus Salmonella comprised of 2400 serotypes, is one of the leading causes of foodborne illnesses in the US a nd has been used for the deliberate contamination of food. A rapid system for detection, is olation, typing and antibiotic susceptibility profiling is essential for diagnosis and source tracking in natural outbreaks or a bioterrorism event. Pure culture is essential for molecular typi ng and antibiotic resi stance testing. The virulence and the resistance mechanisms of Salmonella are rapidly evolving and many are still unexplained. The first aim of the study was to rapidly detect and isolate Salmonella from intentionally contaminated food. The second aim was to build a DNA fingerprinting database for accurate identific ation of the subtype. The third objective was to study the antibiotic su sceptibility patterns and th e underlying mechanisms of resistance. A correlation between the DNA subtypes and antibiograms was hypothesized. An association between the resi stance determinants and pathogenicity genes was expected. A total of 114 isolates in cluding environmental and clinical sources were tested. General and selective enrich ments and immunomagnetic separation (IMS) were tested for rapid de tection and isolation of Salmonella from eight food groups. Isolates were subtyped by pulsed field gel electrophores is (PFGE) and automated RiboPrinter Resistance to 31 drugs was tested by the Sensititre system and integrons were identified by PCR. The association be tween virulence and resistance was verified by Southern hybridization. Of the three genes tested, ompF was found to be the most x

PAGE 14

reliable target for identifying Salmonella subspecies I, III and IV Detection by real time PCR after enrichment in buffered peptone water and isolation by IMS provided the fastest results. Sixty two ribot ypes and 74 pulsotypes were ob served for the 100 isolates subtyped. Sixty isolates were resistant to one or more an timicrobials and 12 had class-1 integrons. In conclusion, pure culture was achieved in 25 hours by IMS. Ribotyping, a comparatively rapid technique was found to be ideal for initial identification. PFGE, which was more discriminatory, was appropriat e for source tracking. Contrary to the original hypothesis, no co rrelation between subtyping and antibiograms was observed and no association of integrons with the virulence genes tested was demonstrated xi

PAGE 15

Chapter One Introduction The Genus Salmonella Various agents including bacteria, viruse s and parasites cause foodborne diseases. According to a FoodNet survey about 38.6 million illnesses are caused by known pathogens every year of which 36% are due to foodborne organisms (141). Bacterial infections account for approximately thirty percent of the total foodborne illnesses of which, nontyphoidal Salmonella infections contri bute to the highest percent of the mortality (141). Salmonella is a Gram negative, rod shaped, motile member of the Enterobacteriaceae The genus Salmonella is comprised of over 2400 different serotypes that infect a wide range of hosts including poultry, ca ttle, rodents and humans (20). Salmonella is divided into two species: Salmonella enterica also called Salmonella choleraesuis and Salmonella bongeri Salmonella enterica is further divided into five s ubspecies (I, II, IIIa, IIIb, IV, VI) (23). The nomenclature of Salmonella is extremely complex and tends to be confounding because of the lack of uniformity. Kauffmann and White proposed the initial nomenclature based on the O (somatic) and H (flagellar) antigens (20). Every serotype was considered as a species according to this system; however, with more than 2400 recognized serotypes this nomenclature sy stem is not feasible. Based on DNA-DNA hybridization it was observe d that all subspecies (I, II, I II, IV, VI) were closely related except for subspecies V (Salmonella bongeri ) (23). Salmonella choleraesuis is sometimes used in the place of Salmonella enterica as the first species but its usage could be 1

PAGE 16

confused with the serotype Choleraesuis. For subspecies I, the name of the serotype is used, for example Salmonella enterica serotype Typhimurium, but for the other subspecies (isolated after 1966) the antigenic formula is used. Table 1 shows the current nomenclature of the genus Salmonella and their common habitat. Table 1. Salmonella Nomenclature Salmonella species Salmonella Subspecies Habitat enterica (I) Salmonella enterica Warm blooded animals salamae (II) Cold blooded animals, environment arizonae (IIIa) Cold blooded animals, environment diarizonae (IIIb) Cold blooded animals, environment hountenae (IV) Cold blooded animals, environment indica (VI) Cold blooded animals, environment bongeri (V) Salmonella bongeri Cold blooded animals, environment The current nomenclature of Salmonella followed by the Centers for Disease Control and Prevention (CDC) (23) Ninety-nine percent of clinically signifi cant serotypes belong to subspecies I (Salmonella enterica subspecies enterica ). According to a Centers for Disease Control and Prevention (CDC) survey the most frequently reported serotypes in the year 2002, all belonging to subspecies I, were Salmonella enterica serotype Enteritidis (S. Enteritidis), S. Typhimurium, Salmonella enterica serotype Javiana (S. Javiana) and Salmonella enterica serotype Newport (S. Newport) 2

PAGE 17

( http://www.cdc.gov/ncidod/dbmd/phlisdata/salmtab/2002/ Salmonella AnnualSummary2002.pdf ). Two of these serotypes, S. Typhimurium and S. Enter itidis are the most well studied serotypes of the subspecies Salmonella enterica Salmonella enterica serotype Typhi (S. Typhi) is very host specific and infects only humans. S. Typhimurium infec tion in a mouse model is assumed to be very similar to S. T yphi infection in humans (186). Although, other studies have shown that the mechanism of infection of S. Typhi in humans and S. Typhimurium in mice are sligh tly different (204). Salmonella Infection Salmonella species cause a variety of illnesses including nausea, vomiting, abdominal cramps and diarrhea. The infective dose of Salmonella is usually about 1000 colony forming units (CFU) ( http://textbookofbacteriology.net/ Salmonella .html ) but it depends on various factors including the serotype and the pH of the stomach. If the pH of the stomach is high a low dose is sufficient to cau se infection (74). A high stomach pH can also accelerate Salmonella invasion and allow the organism to spread into the circulatory system, liver and gall bladder causing further complications. After the initial invasion of the epithelial cells, the bacter ia are engulfed by the host phagoc ytes where they replicate (188). Intracellular repl ication is important for the viru lence of S. Typhimurium in a mouse model according to Leung and Finley ( 111). It was observed in that study that replication defective mutants did not kill the mice even after 21 days whereas the control strains killed the mice in five da ys. The primary infection site of Salmonella is the distal ileum (30). The invasion and replication strategies of Salmonella depend upon the 3

PAGE 18

serotype and the nature of the host. For exam ple the invasion of S. Typhimurium in swine is rapid and is non-cell specific. The organism preferentially adheres to sites of epithelial cell extrusion (144). Many serotypes of Salmonella produce two kinds of toxins cytotoxin and enterotoxin apart from the endotoxin(196). The ente rotoxin produced by Salmonella has a similar action to the cholera toxin (CT). The Salmonella toxin (Stn) elevates the levels of cyclic adenosine monophosphate (cAMP) like CT, however structurally the two toxins are different (41) Stn is homologous to the toxins produced by Pseudomonas aeruginosa and Corynebacterium diptheriae (41). Salmonella in Foodborne Outbreaks Salmonella is one of the ancient pathogens and it s till continues to conf ound scientists. In the early twentieth century Salmonella was the only known foodborne pathogen and was thought to cause 90% of the gastroenteritis cases (88). In the past 20 years however, scientists began to recognize other bacteria including E. coli O157:H7, Listeria monocytogenes and Campylobacter species and viruses as potential foodborne agents (190). S. Typhi infections were controlled in the beginning of the twentieth century by disinfection of drinking water, sewage tr eatment and pasteurization of milk; however, infections caused by non-typhoidal serotypes of Salmonella began to increase. Eggs were implicated in several S. Enteritidis outb reaks in the 1980s. From 1985 80% of S. Enteritidis infections were due to eggs (162). Surveillance of Salmonella in eggs and improved food handling practices led to the eventual decline in the foodborne disease caused by S. Enteritidis. However, increased consumption of fresh produce in the 1990s 4

PAGE 19

compared to the 1970s led to the increased incidence of foodborne illnesses (15). Fresh produce could be contaminated at the stage of pre-harvesting due to various factors including infected irrigation water, soil or manure. Post-harvest c ontamination could be due to human handling, improper storage and packaging. Identifying the exact source of the pathogen in a foodborne outbreak is an extremely complex task because various ingredients of the food can be from several different sources and sometimes even different countries (190). Salmonella has been implicated in several foodbor ne outbreaks in the US. One of the biggest outbreaks that caught th e attention of the food regulatory agencies was the S. Typhimurium outbreak in Chicago, IL in 1985. This involved the contamination of pasteurized milk that led to 23,000 confirmed cases of S. Typhimurium. Several of the patients who were infected in this outbreak have since developed l ong term arthritis (61). Since then, Salmonella species have caused a number of outbreaks involving a variety of foods. In 1995, a S. Newport outbreak tran smitted by contaminated alfalfa sprouts affected over 100 persons in six different st ates in the US (197). Another outbreak of Salmonella enterica serotype Mbandaka leading to 89 confirmed salmonellosis cases was linked to alfalfa sprouts in Oregon in 1999 (80). The epidemiol ogical investigations traced the pathogen to two sprout growers that did not follow the U.S. Food and Drug Administrations (FDA) seed di sinfection guidelines. Commer cially packaged egg salad was implicated in a S. Typhimurium outbreak that led to 18 illnesses in Oregon and Washington states in 2003 (35). A multi state outbreak of S. Typhimurium in 5

PAGE 20

unpasteurized milk affected four states and 62 people in 2002 (32). Roma tomatoes were associated in a more recent outbreak affec ting over 400 persons in two countries and 11 states in the US and Canada in 2004 (33). In this outbreak over five serotypes were implicated including Salmonella enterica serotype Muenchen, S. Javiana, S. Typhimurium, Salmonella enterica serotype Anatum and Salmonella enterica serotype Thompson. Two of the five serotypes were traced to a supplier in Florida. Foodborne outbreaks due to Salmonella are common in other pa rts of the world. An international outbreak of Salmonella enterica serotype Oranienburg affecting Germany, Sweden and Canada caused several hospita lizations due to bloody diarrhea in 2001 (205). The organism in this outbreak was traced to c hocolates but no source was identified. Egg fried rice was implicated in the outbreak of S. Enteritidis infecti ng 31 persons in 2002 who dined at a Chinese restaurant in the U. K. (10). S. Enteritidis infection causing gastroenteritis and hospitalizations in Ta iwan in 2001 was traced to a bakery product made with eggs (126). Although there is a decline in the overall frequency of Salmonella infections since 1970s, all the above mentioned outbreaks suggest that certain food groups including fresh fruits, vegetables and ready to eat foods seem to be potential targets for Salmonella contamination. The increasing dependency of consumers on commercially prepared food could be one of the reasons for the rise in Salmonella infections in the recent past. Availability and increased consumption of fres h fruits and vegetables could also be the 6

PAGE 21

cause for the rise in the foodborne illnesses in fresh produce in the recent past. Lack of education about hygiene and food imported from countries where the regulation is not very stringent (e.g., Mexico, Guatemala) c ould also be the contributing factors. Food as a Bioterrorism Agent The deliberate use of microorganisms or toxins from living organisms to cause death or disease of humans, animals and plan ts is known as bioterrorism (BT) ( www.sciencecoalition.org/glossary/glossary_main.htm ). According to the CDC, a BT event can be distinguished from natural outbreaks by th e sudden or unusual incr ease in the illnesses including two or more unrela ted cases with unusual age distribution (34). The pathogen has to meet certain criteria for it to be used as a BT agent. Fi rst of all, it needs to produce temperature stable products that could be di spersed over a large ar ea. Secondly, it should allow aerosolization and production on a large scale. It should be difficult to diagnose and be transmitted from person to person to rapi dly spread the disease. It should allow the terrorist to escape the scene by having a high incubation pe riod. It should create panic and overwhelm the public health system (176). A number of pathogens fit one or more of the above descriptions and could be potentially used as BT agents. For example, the lethal dose of Bacillus anthracis spores is one millionth of a gram. Bacillus anthracis spores can be dispersed over a large area and affect thousands of people. The other organisms that are likely candidates are Francisella tularensis a Brucella species that is common in contaminated dairy products, Variola major that causes smallpox and is 7

PAGE 22

highly contagious and Clostridium botulinum that releases botulinum toxin that can kill a person by contact or ingestion. Though not conventional BT agents, foodborne pathogens that belong to category B agents, could be used in a small scale BT ev ent to overwhelm the publ ic health system. In fact, S. Typhimurium and Shigella dysenteriae have been used for the intentional contamination of food in the past (103, 193). S. Typhimurium was used in the intentional contamination of salad bars in Dalles, Oregon, by a religious cult group in 1985 to influence elections (193). This incident led to 751 cases of gastroenteritis and the fact that it was a BT event was not obvious at the time of the event. A similar case of intentional contamination of pastries and donuts by Shigella dysenteriae affected 12 laboratory workers who developed diarrheal disease (103 ). The use of enteric bacteria for the purpose of bioterrorism may not be discovered immediately as it is difficult to distinguish intentional contamination w ith the many natural outbreaks that occur each year around the world. Therefore, a rapid detection and ch aracterization system for identification and source tracking of the organism is crucial to control both na tural and deliberate outbreaks. Detection of Salmonella The conventional methods of identification of Salmonella including the one used by the FDA are time consuming and labor intensive. According to the Bacterial Analytical Manual (BAM) used routinely by FDA to test foods suspected to be contaminated with Salmonella the food sample is first enriched in gene ral enrichment media for 24 hours 8

PAGE 23

( http://www.cfsan.fda.gov/~ebam/bam-5.html ). The enriched sample is then selectively enriched for 24 hours and then inoculated in se lective and differential agar media for identification. Suspected Salmonella colonies are then furthe r tested with biochemical and serological methods for final identificati on. This identification process takes about 35 days. Although the conventional identification and characterization process is still the gold standard, most laboratories are adapting molecular techniques for rapid identification and characterization. Seve ral techniques includi ng polymerase chain reaction (PCR) and immunoassays are currently complementing the conventional methods for rapid identification of Salmonella in food or in clinical samples. The advantages of using DNA based assays for detection of a pathogen are many. Nucleic acid assays can provide information about the virule nce of the pathogen as well its relatedness to ot her organisms. They offer info rmation about the genome of the organisms and are very useful for epidemiol ogical investigations (13). Many studies have shown that Salmonella species can be identified rapi dly using conventional PCR. PCR was used to detect S. Enteritidis and S. Typhimurium in chicken meat samples spiked with 10 CFU/ml after 24 hour enrichme nt in chicken meat using invA primers (62). Multiplex PCR with invA gene and slt gene primers was used for detecting 10 to 10 2 CFU/ml of Salmonella in a mixture of Salmonella and E. coli after 9 hour pre-enrichment (38). Another study involved a very sensitive assay for detection of S. Typhimurium in artificially inoculated poultry samples, milk and fresh vegetables. In that study, using the hin/H2 primers 3 CFU/gm of food were successfu lly detected (1). PCR was shown to be 9

PAGE 24

more sensitive compared to conventi onal culture techniques in a study where Salmonella was found in 19% of naturally contaminated poultry sample when tested by PCR, while only 16% of the samples, were positive when tested by culture techniques (207). A combination of the two techniques provide d better results demonstrating 23% of the samples to be positive. Currently, conventional PCR is being replaced by real time PCR for identification of a pathogen. The real time PCR technique takes ad vantage of the 5 nuclease activity of the taq polymerase to generate a positive signal (91). Typically, a probe that is complementary to the target DNA and anneals to it is designed. During the PCR reaction as the primers extend, the 5 nuclease activity of the taq polymerase cleaves the probe, which produces a fluorescent signal detected by the computer. This automated version of the real time PCR has many advantages over traditional PCR technique. The new and improved version eliminates the post PCR ge l processing so that the data can be monitored in real time (98). The rapid heati ng and cooling system ensures that there is quick temperature alteration and the closed system eliminates the possible amplicon contamination. Three kinds of probes have been developed for the real time PCR system: TaqMan probes, florescent resonance energy transfer (FRET) probes and molecular beacons (183). The TaqMan probe has a reporte r dye at the 5 end and a quencher dye at the 3 end. The quencher dye suppresses the reporter dye from fluorescing when in close proximity. When the primer extends, the taq polymerase cleaves the probe separating the reporter from the quencher to gi ve a detectable signal. If the target DNA is absent the 10

PAGE 25

probe cannot bind to the DNA a nd therefore the reporter a nd the quencher dyes are in close proximity giving no signal. There are numerous applications of real time PCR in patient diagnosis and environmental sampling. It can be used for detection of virulence genes including E. coli and Vibrio cholerae (55, 75) and antibiotic resi stance genes (116). This t echnique can be used for quantification of genes, for ex ample the viral load of an immunocompromised individual can be tested. It can be applied to trace biot errorism and also check food and water safety (98). It can be applied for the detection of spores (129). The efficiency, specificity and speed of real time PCR has made it popular for clinical and environmental sample testing. A number of studies have demonstrated the worth of real time PC R for rapid bacterial detection. Belgrader et al. detected Erwinia herbicola (a surrogate for Yersinia pestis) using the portable system advanced nucleic acid analyzer (ANAA) (13). In that study, DNA from 500 cells were detected in seven mi nutes, fifty in 8 minut es and five cells were detected in 9 minutes. The molecula r beacon probe technology was used to detect two CFU of S. Typhimurium fr om pure culture DNA using the himA gene as a target (40). Several groups have detected Salmonella species from naturally and artificially contaminated food samples using various genes as targets. Knutsson et al. reported that pre-enriching the sample before DNA extract ion increases the sens itivity (102). Ten ml of sterile buffered peptone water (BPW) was i noculated with 1 CFU of S. Enteritidis and 11

PAGE 26

incubated for 36 hours in their study. Samp les were taken for DNA extraction every 4 hours and tested using primers against the invA gene. An eight hour enrichment was enough to detect one CFU of S. Enteritidis in clean broth in that study. The efficiency of real time PCR was demonstrated in detecting several Salmonella serotypes in naturally and artificially contaminated poultry samples enriched in tetrathionate (TT) broth for 18 hours at 37 C (70). Artificially contaminated Salmonellafree chicken samples with S. Enteritidis were enriched and tested after 18 hours with invA specific primers in that study. Salmonella positive flocks were successfully id entified in 30 minu tes after 18 hour enrichment compared to two days using conventional culture techniques. For the artificially contaminated samples the detecti on limit was six CFU/ml. By using real time PCR with invA gene as a target, the source of a gastroenteriti s outbreak in Texas was identified to be barbequed chicken (54). invA was used as target, in another study for the detection of 50 strains of Salmonella belonging to Salmonella subspecies I, II, III, IV and Salmonella bongeri (177). A study tested the utility of four DNA extraction kits for detection of S. Enteritidis by real time PCR using sefA primers (58). Th e detection limit was in the range of 10 8 to 10 3 CFU in that study for artificially contaminated poultry samples after 24 hours of pre-enrichment at 37 C. Heller et al. compared four commercial kits for the detection of E. coli in artificially contaminated samples and concluded that the ABI PrepMan Ultra was the easiest to use and very efficient compared to others (90). The application of real time P CR was tested on fresh fruits and vegetables that were intentionally contaminated w ith 4 CFU/gm using molecular beacon probes (122). Positive results were obtained by using real time PCR in one day after 20-hour 12

PAGE 27

enrichment compared to three to four da ys using the BAM methodology in that study. A very sensitive assay targeting the sipB and sipC genes was developed for the detection of one CFU/ml of Salmonella enterica serotype Abaetatuba in artificially spiked ready to eat meats after six hours of enrichment (67). In another study, the tetrathionate respiratory gene ( ttRA ) was targeted, and a detection limit of 10 3 CFU/ml with 70% probability and 10 5 CFU/ml with 100% confidence, was achieved in artificially inoculated chicken, fish and meat samples (133). The technique was se nsitive and could detect as low as three CFU/ml after 20 hour enrichment. The applicati on of real time PCR in clinical samples was tested in artificially i noculated stool samples with food or waterborne pathogens including S. Enteritidis, Campylobacter jejuni and Vibrio cholerae (77). They could detect 10 5 CFU/gm of stool in two hours, the se nsitivity was higher with an sample overnight enrichment. All the studies suggest that real time PCR is a very powerful technique that is easy to use compared to the conventional techniques and can be used for testing food samples as well as clinical samples. However, there are several drawbacks of PCR. PCR requires pure sample that is free of any inhibitors. It is a good tool that allows molecular identification, however, needs t echnical expertise and can be expensive. Unlike conventional methods, PCR cannot differen tiate between live and dead organisms. Most of the studies have demonstrat ed that it is possible to detect Salmonella from artificially contaminated food samples w ith longer pre-enrichment or with high inoculums. There are not many reports of a sensitive and rapid real time PCR assay that can detect very low CFU (1-10) of Salmonella species from 25 gm of food samples particularly with mixed backgrounds. 13

PAGE 28

Isolation of Salmonella from food Numerous techniques have been deve loped for the rapid detection of Salmonella species in food including biosensors, real time PC R and microarrays (99, 159, 187). However, studies on the rapid isolation of Salmonella species from mixed cultures are limited. Isolation of pure cultures of Salmonella from mixed samples or from food is equally important for further characterization includ ing serotyping, biochemical analysis and DNA based typing. Detection is important for identification of the pathogen and diagnosis, whereas subtyping by serotyping or DNA fingerprinting is essential for tracking down the source of the contaminat ion in an outbreak. Source tracking is especially relevant if the out break is food associated so that the corresponding food can be recalled to prevent furt her illnesses. Though the FDA BAM protocol is extremely sensitive and detects one CFU of Salmonella species per 25 gm of food, it is time consuming and labor intensive. Therefore there is a need for studies involving development of techniques to accelerate the isolation of Salmonella from food. A number of studies have attempted to isolate Salmonella rapidly from food using immunomagnetic separation (IMS) or shor ter selective enrichment compared to conventional techniques. Isolat ion of pure organism from fo od is a complicated process because it not only contains components including fats, starches etc. but also could contain a considerable amount of resident flora and preservatives (49). The IMS technique has been relatively successful in limiting the time required for achieving pure 14

PAGE 29

culture because it physically separates the specific bacteria targted by the assay from a complex matrix (49). IMS is based on the use of species-specifi c antibody coated beads to separate the organism of interest from a complex mixture of organisms. This technique was first applied by Luk a nd Lindberg to detect Salmonella enterica serogroup C by using a mouse monoclonal antibody (mAb) against Salmonella (128). The antibodies used in that study were specific for the O an tigen of serogoup C. Polysterene beads were precoated with the Salmonella IgG (sheep antimouse immunoglobins) antibodies. These beads were then coated with mAb. A detect ion limit of 4 CFU/ml of blood or TT broth was achieved using this technique in the study. The beads were found to be specific to Salmonella when tested against other bacteria including Pseudomonas species, Staphylococcus species and Streptococcus species. In a study involving intentionally contaminated meat and milk samples, a detection limit of 20 CFU/gm of E. coli O157:H7 was achieved after 24 hour incubation usi ng IMS (210). The advantage of IMS over conventional enrichment techniques in terms of recovery was demonstrated in a study with naturally contaminated samples using the antiSalmonella Dynabeads (49). In that study, swab samples were en riched in BPW for 16-20 hour s before employing IMS and plated on selective agar plates. They de monstrated that IMS could identify more Salmonella positive samples compared to the conve ntional selective enrichment with selenite cystine broth or rappa port vassiliadis (RV) medium. Application of IMS for the rapid detection of Salmonella in combination with enzyme linked immunosorbent assay (ELISA) in food samples was demonstrated in a study where the sensitivity was 10 7 CFU/ml in artificially contaminated e gg and chicken samples after 20 hour BPW 15

PAGE 30

enrichment (47). Another study based on spiked food samples as well as naturally contaminated samples compared six differe nt methods, including IMS, conventional and ELISA based techniques for isolation of Salmonella (84) The specificity of beads was studied by spiking Citrobacter species and Proteus species that resemble Salmonella on selective agar plating. They were able to isolate 10 3 CFU in 30 hours using IMS and found it to be most rapid compared to othe r techniques however, it was non-specific. To improve the specificity of the protocol, the IMS method was m odified in a later study by adding a post-IMS enrichment st ep in RV soy peptone broth fo r isolation of bacteria in artificially contaminated food samples ( 48). Although the process was lengthy (48 hours to obtain pure culture) and th e sensitivity (100-1000 CFU/25 gram) lower, compared to the conventional methods, the non-specificity issue was eliminated. A very large study involved the testing of environmental samples from animal feeds, cheese samples, egg products and environmental swabs from food manufacturing plants (182). The samples were incubated in pre-enrichment broth for 16 hours, were selectively enriched in TT broth or RV medium and were purified by IMS. They found a good correlation between the standard culture techniques and IMS; th e latter was 24h faster In another study, artificially inoculated liqui d eggs were tested for S. Enteritidis after 24 hour preenrichment using various techniques includi ng TT broth, RV broth, and IMS enrichment (87). BPW followed by TT broth enrichment was the best technique in terms of identifying the highest percentage of S. Enteritidis positive samples (97% to 100%) in that study. 16

PAGE 31

IMS has been used by a number of groups to concentrate samples in preparation for detection of Salmonella species by PCR or bacteriopha ge assays (72, 93, 95, 175). IMS also aids in the removal of food debris and concentrating the target bacteria to perform molecular analysis by PCR (95). An automate d version of the IMS process known as the automated immunomagnetic sepa ration (AIMS) exists. Lynch et al. tested AIMS for detection of S. Typhimurium in artificially contaminated poultry samples (130). It was shown to have a higher sensitivity for isol ation and was more ra pid in identifying Salmonella species when compared to conve ntional culture techniques. These studies suggest that IMS with antiSalmonella antibody beads is rapid and specific for isolation of certain Salmonella species from food samples. Furthermore, it is apparent that a longer pre-enrichment before IMS improves the sensitivity of the assay. Some studies suggested that a post-IMS enrichment yielded better results for isolation of Salmonella compared to direct plating after IMS (48). However, the development of rapid detection and isolation protocol for Salmonella diagnosis and source tracking is still needed. The sensitivity of the assay needs to be improved so that less than 100 CFU/25 gm of foods can be detected and isolated using shorter enrichments compared to the conventional techniques. The specificity of the assay needs to be tested on samples containing mixed backgrounds. 17

PAGE 32

Subtyping of Salmonella Species Salmonella subtyping is required for source tracking for epidemiological investigations of outbreaks and for general survei llance of the pathogen in the environment. Subtyping is also essential to distinguish outbreak strains from existing endemic strains, therefore a good subtyping technique should be very discriminatory. Salmonella can be typed based on phenotypic or genotypic methods. The common phenotypic techniques used for typing Salmonella are biochemical characterization (biotyping), serotyping, antibiotic susceptibility profiling and phage typing. Biochemical profiling involves reaction of the organism to a series of biochemical test s including hydrogen sulfide production, glucose and lactose fermentation, and lysine decarboxylation. Serotyping of Salmonella is based on somatic (O), flagellar (H) and capsular (V i) antigens (20). Phage typing relies on the ability of bacteriophages to lyse Salmonella and their host specificity to certain serotypes (31). Although routinely used for typing Salmonella phenotypic typing methods are time consuming and extremely labor intensive. Th erefore, genotyping methods that are more rapid and specific offer an a ttractive alternative to phenot ypic methods, including plasmid profiling, ribotyping, pulsed field gel elec trophoresis (PFGE), randomly amplified polymorphic DNA (RAPD), multilocus sequen ce typing (MLST), repetitive extragenic pallindromic PCR (REP-PCR) and multiple locu s variable number tandem repeat analysis (MLVA) (71, 104, 123, 147, 168, 174, 203). Plasmid profiling is based on the presence or absence of plasmids in an organism a nd their restriction digestion pattern. The disadvantage of plasmid pr ofiling is that several Salmonella strains may lack plasmids therefore this technique does not provide good discrimination (148). Therefore subtyping 18

PAGE 33

based on chromosomal DNA is a better option. Ribotyping is based on the ribosomal operons that are conserved among bacteria. It relies on the principle of Southern hybridization where the probe recognizes some combina tion of 16S, 23S and 5S ribosomal operons. The ribosomal genes show high homology in various bacteria, which allows hybridization. However, the regions flanking the genes are heterogeneous, which is the basis for fingerprinting (16). PFGE is based on restriction digestion of the whole bacterial genome. Since the fragments obtained by the macrorestriction digestion of DNA can be up to several megabases (Mb), specialized electrophoresis eq uipment is needed that can resolve large DNA fragments. In this technique an electri c field is alternately applied in several directions. Longer pulses of current are applied in the forward direction and short pulses are used in the reverse and sideways direc tion to resolve the larg e DNA fragments and to accommodate relatively smaller DNA (202). Various new techniques have been recently developed to subtype Salmonella MLST is a relatively recent technique th at is based on sequencing of genes of housekeeping, ribosomal or virulence tra its (104). MLVA compares the number of tandem repeats between isolates (168). A nu mber of PCR techniques incl uding RAPD (123), REP-PCR (203) and enterobacterial inte rgenic repetitive consensus (ERIC) PCR have been applied to fingerprint Salmonella species (27). The issue of non-typ eability that is associated with phenotyping is usually eliminated when d ealing with chromosomal DNA based typing. 19

PAGE 34

Many groups have compared molecula r typing methods with phenotypic typing techniques for subtyping Salmonella species. Before the molecular era, phage typing was the method of choice for further subtyping Salmonella serotypes. Phage typing was used to identify Salmonella and other members of Enterobacteriaceae (89). Phage typing was more discriminatory compared to serotyping and was determined to be a good tool for epidemiological investigations in a study of isolates from contaminated food, human clinical samples and naturally contaminated waters (31). However, molecular techniques including ribotyping and PFGE have a bett er discriminatory power (71, 147). Comparison of Phenotypic a nd Genotypic Chracterization As mentioned before there are various ways to characterize Salmonella based on phenotypic methods including se rotyping, biotyping, phage typing and antibiotic susceptibility testing. A number of studies have compared the phenotypic subtyping to molecular methods (73, 120, 173). One hundred tw enty environmental isolates belonging to three serotypes were characterized by ribot yping (69). It was shown in that study that ribotyping that produced 12 types was clearly more discriminatory than serotyping. In another study, 56 S. Typhimurium isolates were subtyped by biotyping, antibiotic susceptibility profiling, plasmid profiling and ribotyping (148). Ribotyping and plasmid profiling that generated nine and eight types a nd were more discriminatory than biotyping that produced only four types. In a Brazilian study of 105 S. Enteritidis isolates from clinical and environmental sources, ribotyping was shown to be more discriminatory (14 20

PAGE 35

profiles) compared to phage typing (2 type s) (73). Ribotyping that generated 22 types was demonstrated to be more discriminatory compared to phage typing that generated 10 types in characterizing 104 poul try S. Enteritidis isolates (118). The discriminatory ability of molecular typing by insertion se quence 200 (IS 200) typi ng (11 types) was evident in a study that also characterized 99 S. Typhimurium isolates also by phage typing (4 types) (96). In a study of 199 S. Typhimurium isolates, four phage types were divided into 34 ribotypes and 23 pulsotypes (1 20). Molecular typing methods including PFGE, ribotyping, amplified fragment le ngth polymorphism (AFLP) were more discriminatory compared to antibiotyping in characterizing ten outbr eak isolates of S. Havana (173). Molecular Typing As previously mentioned molecular typing methods including ribotyping and PFGE are good tools for the discrimina tion of closely related Salmonella strains. Ribotyping generated more profiles in comparison to phage typing in a study of S. Enteritidis isolates from human clinical, food and water samp les (107). Six different enzymes including Eco RI, HindIII, Sma I, Sau3AI, Hae III and Xho I were compared in a study to ribotype three Salmonella serotypes: S. Typhimurium, S. Reading and Salmonella enterica serotype Seftenburg from a variety of sources. Eco RI generated the most clear and distinctive patterns (69). Ribotyping with SphI was found to be more discriminatory than PFGE in typing S. Enteritidis strains isolat ed from clinical and poultry sources (191). Ribotyping with two enzymes used together, for example Pst I and Sph I ribotyping (PS ribotyping) was demonstrated to be more discriminatory compar ed to phage typing, 21

PAGE 36

PFGE and plasmid profiling for characterization of S. Enteritidis and S. Typhimurium in several other studies (118120, 147). Since ribotyping using Eco RI is less discriminatory compared to PS ribotyping, it is suggested that Eco RI be used for serovar level of identification and PS ribotyping for further discrimination (56). Ribotyping using the automated version was the preferred method compared to PFGE in terms of discrimination, speed and increa sed standardization in a study that involved typing of a number of organisms including E. coli Hafnia Proteus and Staphylococcus aureus (92), whereas PFGE was demonstrated to be more discriminatory compared to ribotyping, phage typing and biotyping in typing S. T yphimurium, S. Enteritidis and S. Thompson in another study (153). The discriminatory ability of PFGE compared to plasmid profiling and ribotyping was also shown in another st udy of S. Enteritidis isolates (174). The discriminatory power of PFGE was demonstrated to be better compared to several other techniques including ribotyping, phage typing, fluorescent amplified fragment length polymorphism (FAFLP), insertion sequence typing and MLST in typing Salmonella serotypes by a number of groups (71, 81, 120, 121, 160, 189). Although PFGE is considered the gold standard for typing Salmonella several studies have shown that other techniques incl uding plasmid profiling, RAPD, MLST, MLVA further resolved PFGE groups (36, 104, 108, 123, 125, 178). Application of PFGE to differentiate drug resistant Salmonella isolates from the sensitive ones was demonstrated in several studies (76, 184, 213). The abilit y of PFGE technique to separate S. 22

PAGE 37

Typhimurium direct phage type 104 (DT 104) from the non DT104 isolates was also demonstrated in another study (66). Based on the above studies it is clear that mo lecular typing techniques that are based on chromosomal DNA analysis have an adva ntage over phenotypic typing methods for subtyping Salmonella species. Molecular techniques coul d successfully type almost all serotypes of Salmonella studied so far. For certain sero types including S. Enteritidis it appears that ribotyping provides bette r discrimination than PFGE (118, 148, 191). However, for most serotypes including S. T yphimurium, S. Derby and S. Dublin, PFGE was more discriminatory compared to ribotyping (120, 121, 189). Based on the above observations it is clear that the discriminatory ability of a technique relies upon the nature of the genome of the Salmonella serotype. Therefore, an ideal typing system should include more than one technique. A comparison of the common techniques used for typing Salmonella is summarized in Table 2. 23

PAGE 38

Table 2. Salmonella Subtyping Typing Technique Principle Advantages Disadvantages Biotyping Biochemical reactions Standard identification in laboratories Time consuming, laborious, expensive Serotyping Serological reactions against Somatic (O) and Flagellar antigens (H) Well known typing system for Salmonella species Not discriminatory for epidemiological analysis Not all Salmonella species are typeable using this method Phage typing Ability of bacteriophages to lyse specific Salmonella types More discriminatory compared to serotyping Plasmid Profiling Presence or absence of plasmids Discriminatory when comparing two isolates with presence of plasmids Chances of loosing the plasmid with the lack of selective pressure are very high. Not all Salmonella species are typeable using this method Ribotyping Hybridization to rRNA operons Conserved among species allowing species identification, very rapid with automated system Not discriminatory for all Salmonella serotypes, expensive PFGE Macro restriction profiling of the entire genome Gold standard for typing Salmonella Pulsenet database established for comparison between health laboratories in the US and other countries Laborious, not discriminatory for S. Enteritidis, expensive MLST Typing based on sequence analysis of housekeeping genes Analyses conserved areas of the genome, shown to be more discriminatory than PFGE in some Time consuming, no standardized protocol for Salmonella 24

PAGE 39

Typing Technique Principle Advantages Disadvantages studies MLVA Typing based on sequencing of tandem repeats in the genome Shown to be more discriminatory than PFGE Still in the preliminary stages, needs validation and standardization Common techniques to subtype Salmonella and their advantages and disadvantages. PFGEpulsed field gel electrophoresis, MLSTmulti locus sequence typing, MLVAmultiple locus variable number tandem repeat analysis Molecular Typing for Epidem iological Investigations Subtyping with either phenotyping or geno typing could provide very valuable information regarding the epidemiology of the pathogen. This information assists in tracking down the source of the contamina tion and make needed changes and prevent further spread of the epidemic clone. A num ber of studies have shown the efficacy of molecular typing data for source tracking and general surveillance of Salmonella species. In a lengthy study of over six years, S. Enteritidis isolates collected from patients, chicken meat and chicken feces were char acterized by phage typing and PFGE analysis and the outbreak strain was tr aced to chicken meat (19). In a similar study, an identical clone of Salmonella enterica serotype Indiana was identif ied in human patients, poultry meat and pet food by PFGE typing (165). A co mmon link of S. Typhimurium infections was established between two childrens centers based on the ribotyping, PFGE and RAPD data (145). Clones of S. Newport were observed in humans and food animals in a study that characterized isolates by PFGE (213) Several other studies have determined 25

PAGE 40

the circulation of identical clones between humans, foods, food animals and their environment by molecular typing techni ques including PFGE, ribotyping, RAPD or phenotypic typing techniques including, phage typing and antibiotyping (14, 43, 82, 117, 147, 154) A number of studies have demonstrated that molecu lar typing was useful in establishing an epidemiological link betw een outbreak strains a nd their sources. For example cuttle-fish chip s were determined to be the sour ce of S. Oranienburg infections by PFGE, ERIC-PCR and in a study that invo lved isolates from patients and recalled food samples (105). An outbreak strain of S. Livingstone was traced to animal feed based on molecular typing data of animal food and human clinical isolates (68). Likewise, at times, phenotypic data was also successful in determining the source of outbreak. This was shown in a study where biotyping based on the ability of the isolates to ferment melibiose was helpful in tracking down the source of a S. Enteritidis outbreak to chicken portion of the lunch (3). Molecular typing methods also helped in de monstrating absence of an epidemiological link between different sources in several st udies (37, 79). Molecular typing methods are not only useful in source tracking bu t also valuable in surveillance of Salmonella species in a particular environment (21). All the above studies suggest th at molecular typing methods combined with phenotypic techniques are valuable in source tracking and establishing an epidemiological link, which is vital in an event of an outbreak or bioterrorism. 26

PAGE 41

Pathogenicity Islands in Salmonella Salmonella possesses five large pathogenicity islands known as Salmonella Pathogenicity Islands (SPI) and a number of smaller pa thogenicity islets (196). These large DNA fragments contain genes required for virulence mechanisms including invasion, macrophage survival, iron uptake and survival in low magnesium conditions (137). All the SPI except for the SPI-1 are inserted n ear tRNA loci (86). The SPI are horizontally acquired and have features of mobile elem ents including low G+C percentage compared to the rest of the genome, pr esence of integrases, presence of insertion sequences and direct repeats (DR) flanking on either of their sides (137, 149). SPI-1 and SPI-2 are the two islands that have been extensively studied in Salmonella The SPI-1 is a 40 Kb element located at 63 minute centisome of Salmonella Typhimurium (149) and is present in all subspecies of Salmonella (157). The major function of the SPI-1 that harbors iron uptake ge nes is to encode the proteins required for invasion into the host epithelial cells. The ir on uptake locus of SPI-1 has a different G+C content compared to the rest of the island proving that it was acquired independently of the SPI-1 (161). SPI-2, which is absent in Salmonella subspecies V is also a 40 Kb element located at 31 minute centisome near Val tRNA Normal functioning of SPI-2 has been shown to be important for expression of SPI-1 genes (59). Its functioning is important for the survival of Salmonella in macrophages and for defense against host reactive oxygen species (97, 158). The function of SPI-2 depends on various environmental cues including ion limitation an d osmomolarity and was considered to be 27

PAGE 42

regulated by the two component regulatory system phoP/phoQ Some studies in Salmonella enterica Gallinarum have shown that SPI-2 but not SPI-1 is required for virulence (97). In a recent study it was demonstrated that SP I-2 is required for virulence in the colon and cecum in a mouse model (44) These two studies emphasize the role of SPI-2 and survival in macrophages in causi ng infection in the host (44, 97). HensenWester et al. have shown that SPI-2 could be transferred into a nonSPI-2 containing species, Salmonella bongeri (85). This functional transfer led to increased colonization and secretion of effector proteins by S. bongeri However, these changes were not sufficient to cause any systemic infection, demonstrating that factors outside SPI-2 influence the virulen ce of the organism. The less well-studied SPIs of Salmonella are SPI-3, 4 and 5. SPI-3 has been found only in Salmonella suspecies, I, II, IIIb and V. It is 17 Kb long and has a mosaic structure and encodes magnesium transporters. It is important for survival in macrophages, virulence in mice and survival in low Mg ++ conditions (18). It is inserted near the selC tRNA locus and is regulated by the phoP/phoQ system. SPI-4 is also required for survival in macrophages and is 27 Kb long. SPI-5 is located near the serT tRNA locus and is unique to Salmonella species (209). It cont ains genes coding for Salmonella outer protein B (s opB ) and other putative membrane proteins required for cellular responses. The cause of insertion of most of the SPIs near tRNA loci is not clear. However, it is possible that mobile elements that are horizontally transf erred get inserted ne ar a conserved locus similar to tTNA. It is also possible that the mobile elements that are inserted near the 28

PAGE 43

conserved locus are retained in the course of evolution. Therefore, the SPIs that are inserted near tRNA loci are conserved and have been vertically transmitted, although SPI-1 that is not inserted n ear a tRNA is an exception. Both SPI-1 and SPI-2 harbor genes required for the type th ree secretion system (TTSS) (137, 146). The TTSS is responsible for produ cing the proteins essential for bacterial internalization by the host, macrophage apoptos is and the production of effector proteins that interfere with the host cellular system and cause systemic disease. TTSS genes include spiC that encodes proteins required for intramacrophage survival and sseF and sseG that encode proteins for re plication in the macrophage. sifA and sseJ which are located on SPI-2 have been implicated in viru lence and replication in macrophages (201). Knodler et al. observed an interesting phenomenon of cros s talk between various SPIs (101). They established that the SPI5 genes are regulated by the tw o large pathogenicity islands (PI), SPI-1 and SPI-2. The genes of SPI-1 are the most conserved in all the Salmonella subspecies whereas the genes of SPI2, SPI-3, SPI-4 and SPI-5 are not highly conserved, according to a microarray anal ysis (164). A study based on pathogenic isolates of Salmonella subspecies I by Southe rn blotting and restriction fragment length polymorphism (RFLP), revealed that the SP I-1, SPI-2, SPI-4 and SPI-5 have a very conserved structure but SPI-3 has a high degree of variation between serotypes (5). The structure and functions of the SPIs are summarized in Table 3. 29

PAGE 44

Table 3. Salmonella Pathogenicity Islands Size/Co-location with tRNA gene Pathogenicity Island Major role/genes SPI-1 40 kb, unknown Invasion, Iron uptake genes, sit invA 40 Kb, val tRNA SPI-2 Survival in macrophages, replication, omp 17 Kb, selC tRNA SPI-3 Magnesium uptake system, virulence genes, mgtC 27 Kb, putative tRNA genes SPI-4 Macrophage survival SPI-5 serT tRNA Salmonella outer protein gene ( sopB ), virulence Structure and major function of Salmonella pathogenicity islands (SPI) Besides the five PI, Salmonella has other virulence factors including virulence plasmids, fimbriae and flagella (196). The virulence plasmids in Salmonella are present in only six serotypes of Salmonella enterica including: S. Typhimurium, S. Enteritidis, S. Dublin, S. Pullorum, S. Choleraesuis and S. Gallinarum. These plasmids contain the spvRABCD locus. spvB is important for virulence and actin depolymerization. The spv ( Salmonella virulence plasmid) locus is chromosomal in location in other subspecies of Salmonella including subspecies II, IIIa and IV (115). Fimbriae and flagella have been shown to be required for colonization and motility respectively (196). 30

PAGE 45

Antibiotic Resistance in Salmonella The prevalence of Salmonella in animal products includ ing uncooked meat, eggs and milk is not surprising because it is endemic in food animals. To control the spread of infection in animals, antibiotics have been used in the past and are still being used. Although not proven, the increase of antibiotic resistance in Salmonella in developed countries could be mainly due to the admini stration of antibiotics in food animals for growth and treatment (192). The increase of antibiotic resistance in developing countries is due to the widespread usage of antibiotics for human treatment (45). Salmonella evolved into a pathogen by acqui ring pathogenicity determin ants through horizontal gene transfer; similarly, it devel oped antibiotic resist ance by virtue of mobile DNA elements. Salmonella is resistant to a variety of antimicrobials including ampicillin, broad-spectrum cephalosporins, aminoglycosides, quinolones, tetracycline, trimethoprim and chloramphenicol. Cabrera et al. characterized 62 Salmonella isolates causing travelers diarrhea that were collected from the Indi an subcontinent and We stern Africa during 1995-2002 (28). Overall, 45% of the isolates were resistant to at least one drug including tetracycline, ampicillin and nalidixic acid. A very high increase (60%) in resistance to nalidixic acid was observed in 2003 compared to 1991. Resistance to two or more classes of dr ugs (MDR phenotype) is becoming increasingly widespread in Salmonella species. Several studies have demonstrated the increasing prevalence of multidrug resistance in Salmonella (110). An increase in multidrug 31

PAGE 46

resistant Salmonella was observed in a 1989-1990 study ba sed on human clinical isolates in the US (110). Similar observation was made in Greece in a survey during 1990-1997 where increased resistance to tetracycline, ampicillin and piperacilin in non-typhoidal Salmonella isolates of humans, food animals a nd environment was observed (198). S. Typhimurium was found to be the most re sistant in that study. Out of 113 isolates collected from poultry slaughterhouses, 65% were found to be multiply resistant to antibiotics including tetracycline, neomycin and streptomycin in a study in Spain (29). In a similar study, 90% of the S. Enteritidis is olates collected from humans, food and poultry samples were resistant to at leas t one antimicrobial and 61% were multidrug resistant (60). Kariuki et al. observed a trend showing an increase in multiple resistance to chloramphenicol, streptomycin a nd tetracycline in human clinical Salmonella isolates collected from 1994 to 2003 (100). The prophylactic use of antibiotics in food anim als is a major contributing factor for the increase in resistance in the US and Eu rope. In 1997, the World Health Organization (WHO) reported that the se lection of antib iotic resistance in non-typhoid Salmonella is due to the use of antimicrobials in food animal s (6). The increase of antibiotic resistance in the US is mainly due to the spread of resi stant organisms in food animals. It is not due to increased antimicrobial use in humans in US or in any other c ountry (45). Numerous studies have also verified the spread of resi stance from food animals to humans. Chen at al. have observed that 82% of the isolates obtained from retail meat samples including chicken, turkey and pork were resistant to one or more drug s (39). An identical clone of 32

PAGE 47

S. Typhimurium was observed in nine isol ates collected from pork products and an outbreak of gastroenteritis in Portugal (7). This clone was pentadrug resistant to ampicillin, chloramphenicol, sulfomethoxizole streptomycin and tetracycline (ACSuST) and the resistance was plasmid encoded. A high prevalence of tetA encoding resistance to tetracycline, strA and strB encoding resistance to streptom ycin was observed in a study in Italy (163). Out of 58 multidrug resistant isol ates from swine, turkey, chicken and duck samples 84% of the isolates carried str genes and 68% harbored tetA genes. An increased resistance to quinolones and fluoroquinolones was observed in food animals in a thirteen year study in Germany (134). A number of ot her recent studies have shown an alarming increase in the resistance to fluoroquinolone s in food animals. In a lengthy study of 22 years, Salmonella isolates from patients and food sources collected from 1981-2003 were tested for the presence of nalidixic acid resistance (138). During the period of 1981-1991 0.3% of the isolates showed resistance to nalidixic acid whereas from 1992-2003, 24.8% of the isolates were resistant to nalidixic acid. Mutations in the quinolone resistance determining region of gyrA genes were seen in organisms from both food and human sources and increase in the resistance to nalid ixic acid was attributed to the use of the antibiotics in food animals. The in crease in the antibiotic resistance in Salmonella can also be attributed to the spread of MDR S. Typhimurium DT104 showing the characteristic pentadrug resistan t phenotype ACSuST. In a study of Salmonella isolated from raw foods of animal origin, animal feed and animal feces, 52% of all S. Typhimurium were found to be multiply resi stant to chloramphenicol, tetracycline, sulfonamides and -lactamases (135). This study c onfirms that food animals are 33

PAGE 48

responsible for the increased re sistance to various antibiotics in Italy. The above studies indicate that there has been an increase in multi-antimicrobial resistance over the past decade in Salmonella species especially in S. Typhimurium and S. Enteritidis. A number of factors have led to antibiotic resistance in bacteria. One of the major causes is the acquisition of resistance determinants and their retention even in the absence of antibiotics. Improper use of an timicrobials as in animal feed particularly at the subtherapeutic levels favors selection and ev entual propagation of the resistant strains. Some bacteria are intrinsically resistant to antibiotics based on their genetic and structural organization while others acquire resistance by mutations or by horizontal gene transfer. A number of mechanisms are responsible for d ecreased susceptibility in bacteria (Table 4) (166, 211). Some of them are due to chro mosomal mutations leadi ng to the low intake of the drug and increased efflux or alteration of the target. Others could be due to genes encoding for enzymes that inactivate the drug. A number of pumps or porins are involved in the uptake of antibiotics by bacteria. Mutations in the genes encoding these porins often lead to decreased permeability of the an timicrobial and hence increased resistance. For example mutations altering the expression of the genes encoding the outer membrane porins ompF and ompC result in decreased uptake of -lactams in E. coli (166) A similar situation was observed in clinical isolates of Salmonella enterica serotype Wein where absence of ompF led to imipenum resistance (9). acrAB efflux pumps have been demonstrated to be responsible for the in creased resistance of S. Typhimurium to 34

PAGE 49

penicillin, tetracycline and chlora mphenicol (156). High expression of arcB gene was observed in post therapy resistant organism co mpared to pre-therapy susceptible ones. Mutations in the gyrA gene often lead to decreased susceptibility to quinolones in Salmonella (200). A number of studies have shown that the presence of lactamase genes confer resistance to various lactams (172). Most of the resistance determinants are mobile and are usually harbored by plasmids, phages and integrons. Table 4. Antibiotic Resistance Mechanisms Antimicrobial Mode of Action Resistance Mechanisms Genes responsible bla, ampC Inhibition of enzymes required for peptidoglycan synthesis, alterations in penicillin binding proteins -lactams (penicillins, cephalosporins, carbapenums) Production of lactamases, changes causing reduced uptake of the drug and active efflux Quinolones (nalidixic acid, ciprofloxacin, levofloxacin) Inhibit DNA synthesis by acting on DNA gyrase and topoisomerase IV Mutations in genes encoding gyrase or topoisomerase, decreased permeability and active efflux tet ( A-E ), tet ( M,O,P,Q,S ) Tetracycline Prevents protein synthesis by binding reversibly to 30 S ribosomal subunit Altered permeability, active efflux or ribosome protection sul I & II Sulfonamides and Trimethoprim Inhibit conversion of p-amino benzoic acid (PABA) into dihydrofolate or Decreased permeability and overproduction 35

PAGE 50

Antimicrobial Mode of Action Resistance Mechanisms Genes responsible inhibit dihydrofolate reductase (DHFR) respectively of PABA cat genes Chloramphenicol Prevents peptide elongation by binding to 50 S ribosomal subunit Inactivation of the drug by chloramphenicol acetyl transferases aac, aad Aminoglycosides (gentamicin, amikacin, tobramycin,kanamycin,strepto -mycin, spectinomycin Inhibit protein synthesis by binding irreversibly to 30 S ribosomal subunit Decreased uptake of drug or enzymes modification Some of the common antimicrobials to which Salmonella is resistant and their mode of action (166, 211) Plasmids as Antibiotic Resistance Determinants Plasmids are one of the most common vector s of antibiotic resistance genes in Gram negative organisms. Numerous studies ba sed on conjugation experiments have shown that this resistance is transf erable from one species to anot her facilitating the spread of antibiotic determinants (42, 208). Plasmids harboring resistant genes to a number of antibiotics have been reported. A transfer able but non-conjugative plasmid carrying a bla CMY gene and conferring resistance to cephalosporins was observed in Salmonella species isolated from animals (208). Evidence of antibiotic re sistance genes on a serotype specific virulence plasmid was fi rst seen in clinical isolates of S. Choleraesuis where a smaller plasmid with drug resistance genes in tegrated into the vi rulence plasmid giving rise to a bigger plasmid (42). A very recen t study also demonstrated the propagation of 36

PAGE 51

virulence genes and antibiotic resistance genes in a plasmid (199). An integron carrying resistance genes to ampicillin, streptomyc in and kanamycin was demonstrated in a virulence plasmid on S. Typhimurium in that study. This situation is particularly alarming since it allows the dissemination of resistance and virulence determinants together and may favor selecti on. Circulation of plasmids with antibiotic re sistance genes is a common feature in Enterobacteriaceae For example a gene conferring resistance to florphenicol sequenced from MDR S. Ne wport showed 100% identity to the floR gene of R55 plasmid of Klebsiella pneumoniae (142). 96% of all S. Mba ndaka clinical isolates were found to be resistant to broad-spectrum cephalosporins encoded by plasmids in a Tunisian study (132). A plasmid conferring resistance to all -lactams and -lactam combinations, streptomycin, trimethoprim and sulfamethoxazole was observed in a clinical isolate of Salmonella Cubana (150). All the above studies show that plasmid mediated multiple drug resistance is widespread in Salmonella and is very prevalent in both human and animal isolates. Integrons as Antibiotic Resistance Determinants Integrons are mobile genetic elements cont aining antibiotic resistance genes. These integrons belong to a family of transposable elements, Tn21, and we re first described by Schmidt and Kaul in 1984 ( 181). The name integron was first proposed by Stokes and Hall in 1989 (185). Integrons are found in ch romosomal and extrachromosomal DNA in mostly in Gram negative bacteria (180). They consist of a 5 conserved sequence (CS), a middle variable region and a 3CS. The antibiotic resistance genes are generally 37

PAGE 52

incorporated into the variable region by site -specific recombinations. The integrase gene ( intI ) of the 5CS encodes enzymes essential for these recombinations. It mediates recombinations between a primary recombination sequence ( attI ) and a secondary site ( attC or 59 base element) (46). The secondary site is associated with the gene cassettes of the variable region. A ty pical integron structur e is shown in Figure 1. Figure 1. Integron Structure Variable Re g ion General structure of class-1 integron with 5 conserved sequence, 3 CS and a middle variable region with gene cassettes (112). intI -integrase gene that mediates recombination in class-1 integron, P ant anterior promoter required for expression of gene cassettes, sulI sulfonamide resistance encoding gene typically present in the 3 CS of an integron Integrons are divided into four clas ses and can be distinguished by their intI genes. The int1 gene was first described in an E. coli K12 strain in 1988 (139). The 3CS is usually associated with genes encoding resistan ce to quaternary amm onium compounds (QAC) and sulfonamides. Integrons found in Salmonella species have the standard integron structure. Brown et al. characterized integrons in S. Enteritidis by using primers targeting 38

PAGE 53

the conserved integron sequences (26). They obs erved four different integron profiles in 11 isolates proving a great degree of diversity. Class-1 integrons are the most common ones that are associated with the multidrug resistant phenotype. Guerra et al. observed that 20% of all the MDR Salmonella serotypes isolated from patients and foodborne outbreaks in Spain were positive for class1 integrons (83). In an Irish study on clinical and food isolates of Salmonella Typhimurium, 90% were seen resistant to su lfonamides and 85% of those harbored class1 integrons (52). This supports the previously known concept that sulfonamide resistance is a good marker for class-1 integrons. The fact that sul genes are good markers for the presence of class-1 integrons was recently demonstrated (8). The presence of integrons was noted in clinical as well as environmental Salmonella isolates (124). Integrons are frequently a ssociated with multidrug resistance phenotype (65, 116, 169). Class-1 integrons were detected in 38% of MDR S. Gallinarum isolated from chicken in South Korea (106). 34% of animal isolates and 71% Salmonella Typhimurium contained class-1 integrons in a study based in England and Wales (116). Class-1 and class-2 integrons were observed in a variety of serotypes that were resistant to three or more drugs including S. Emek, S. Newport, S. Stanley and S. Ohio (169). Multiplex PCR revealed the presence of class-1 integrons in 30% of 104 veterinary isolates that were MDR (65). It was also observed in the study that isolates showing resistance to tetracycline, chloramphenicol and kanamycin had a higher probability of 39

PAGE 54

harboring integrons compared to others. In a recent study integrons were detected on conjugative plasmids in S. Agona isolates from pigs that were resistant to multiple antibiotics including tetracyc line and chloramphenicol (24). In another study integrons were noted in Salmonella isolates from non-symptomatic car riers (212) Overall, these studies prove that class-1 integrons conferring multidrug resistance are ubiquitous in animal and human isolates of Salmonella A very high prevalence is observed in S. Typhimurium isolates. This could be because of the wide host range and hence increased exposure to antibiotics and it could also be because of successful clonal spread. It is unknown as to where the integrons har boring multiple gene ca ssettes originated and what their original function was. A number of scientists have speculated that they have originated from the s uper integrons (SI) of Vibrio cholerae. The SI are large elements integrated into the chromosome of V cholerae and harbor up to se venty gene cassettes (155). Magnus et al. have shown that the inte grase activity of SI and class-1 integrons is similar and also sequence similarity exists between attC and Vibrio cholerae repeats. They have also shown that SI is required for metabolic activities and is not limited to just the virulence or antibiotic resist ance functions. The fact that integrons were isolated from environmental samples further supports the theory that integrons do not have to be associated with pathogenicity or antibiotic re sistance (179). Many recent studies have described the presen ce of novel integrons or integrons carrying novel resistance genes. A novel integron with lactam and aminoglycoside resistance 40

PAGE 55

genes was reported in S. Agona isolates from human clinical sources (152). A new class2 integron was identified in S. Enteritidis isolates in another recent study (2). A new gene aacA5 encoding resistance to aminogl ycoside in a S. Kentucky stra in isolated from spices was recently described (114). Integrons can be located on pl asmids or chromosomes in Salmonella (25, 194). Class-1 integrons coupled with plasmids in clinical were noted strains of Salmonella Typhimurium (194). Many scientists have observed the chromosomal integration of integrons in the pentadrug resistant strain S. Typhimurium DT104 isolates. This strain, which is avian in origin, has caused an immense increase in the multidrug resistant of Salmonella species (208). The 10 KB resistance ge ne cluster was characterized by Briggs et al. and contains two class-1 integrons se parated by a resistance plasmid (R plasmid) (25). The characteristic two integron (1.0 Kb and 1.2 Kb) pattern of S. Typhimurium DT104 and S. Typhimurium non-DT104 isolates showing pentadrug resistance was noted in a number of studies (11, 131). Boyd et al. further characte rized the antibiotic resistance gene cluster and found it to be a part of a bigger island (22). They named this Salmonella genomic island 1 (SGI 1). SGI 1 is a 43 KB element with a different G+C ratio than the rest of the genome and it is usually flanked by DR establishing its horizontal acquisition (63). SG I 1 was later found in S. Albany, S. Paratyphi, and S. Agona with minor sequence variations ( 63, 64, 143). In a recent study, SGI 1 was identified in 46% of S. Parat yphi isolates tested (151). Levings et al. in a very recent study identified SGI in a variety of other Salmonella serotypes including S. Emek, S. 41

PAGE 56

Derby, S. Infantis and S. Kiambu (113). This widespread presence of SGI in non S. Typhimurium isolates as well as non DT104 strains suggests that SGI confers some advantage to the organism and is spreading rapidly either by horizon tal transfer or by plasmids. A third integron of 1.6 Kb carrying additional genes dfrA1 and aadA1 conferring resistance to trim ethoprim and aminoglycosides respectively was recently found in two S. Typhimurium DT104 bovine (51). Hypothesis Both the antibiotic resistance and virulen ce factors are required by the organism for survival against the host defenses. However, the correlation between antibiotic resistance and virulence in Salmonella or any other organism has ne ver been extensively studied. There have been few reports of such association in Salmonella for example the integration of both the serotype specific virulence plasmid and antibiotic resistant plasmid or integron in S. Choleraesuis, S. Typhimurium (42, 199). Similarly, Rahman et al. observed that the multidrug resistant S. Typhi caused more severe illness and prolonged fever than the suscep tible ones due to possible asso ciation of the resistance plasmid with the virulence genes (167). This kind of association is very plausible as the bacteria that are pathogenic are more likely to encounter antibiotics than the less virulent organisms. For non-typhoidal Salmonella and other foodborne pathogens this might not be entirely true because of the administrati on of antibiotics for growth and prophylaxis in food animals. The pathogen does not have to be particularly virulent to have encountered antibiotics. However, the fact th at it survives illustrates its ab ility to invade and propagate 42

PAGE 57

amidst host defenses and antibiotics. Some scientists might not agree with the above coselection concept on the basis that the presence of antibiotic genes cause target alterations and hence reduces the overall virulence of the bacteria (140). This could be true for maybe the first few growth cycles but the eventual survival and multiplication proves that the bacteria have compensatory mechanisms. In fact, it has been shown that compensatory mutations arise to support the gr owth of antibiotic resistant organisms (17). This further supports the opinion that the organisms that ha ve both antibiotic resistance and virulence thrive better in hostile conditions. A number of subtle associations between antibiotic resistance and virulence have alr eady been recognized in some studies. The occurrence of multiple antibiotic resistant operon marRAB in Salmonella subspecies I was observed by Randall and Woodward (170). The marA locus upregulates efflux pumps (example acrAB) that pump out antibiotics and marB downregulates outer membrane porin including ompF and therefore resulting in the decreased permeability of the outer membrane to antimicrobials. In addition, they found that the mar system was absent in Klebsiella Streptococcus and Staphylococcus ( mar ). In a later study, Randall and Woodward have shown that the mar mutant of S. Typhimu rium DT104 has reduced adherence and lower survival in macrophages in chickens (171). Similarly the upregulation of genes enc oding iron uptake systems ( fecA ) and antioxidant defense enzymes (sodA, soxRS ) was observed when marA was constitutively expressed in E. coli (12). The importance of iron as a virulence factor in Salmonella species and its presence on SPI-1 has already been established (94, 214). 43

PAGE 58

The fact that antibiotic resistance persists even in the absence of selective pressure implies that the resistance factors are incorporated in the genome. This is more probable if the antibiotic gene clusters are carried by an integron since they have the integrase gene that mediates site-specific recombinations The hypothesis of this study is that the antibiotic resistance determinants present on an integron are likely to be integrated into the chromosome as seen in the case of the S. Typhimurium DT104. This trend may be more common in the Salmonella serotypes that are more widespread and therefore likely exposed to antibiotics, for example S. Typhimurium, S. Enteritidis, S. Newport, and S. Agona and other common serotypes associated with food animals. The expected integration site for the integron on the Salmonella chromosome is a conserved location as seen in most horizontal gene transfers. A resistance gene cluster in PI encoding iron uptake systems has been recently found in Shigella flexneri but not in Salmonella species. Therefore the potential incorporation sites for the resistance genes in Salmonella species are SPI-1 (encodes for iron uptake proteins a nd is highly conserved), SPI-5 (encodes for Mg ++ uptake systems and putative membrane prot eins) or SPI-3 (has a mosaic structure with varying G+C content and recombinati on hot spots in addi tion to encoding Mg ++ uptake systems and putative membrane proteins ). Both PI and antibiotic gene clusters have the features of mobile elements (IS, DR and integrases) and are required for the survival of the bacterium against host defens es. Based on this and the above studies it is reasonable to hypothesize that selective pr essure would bring SPI and antibiotic resistance elements together. It is possible th at they are physically interrelated to each other and are co-expressed collectively. 44

PAGE 59

Aims of the Study The overall aims of the project are to de velop a protocol for rapid isolation of Salmonella from food, to build a molecular typing databa se and study the antibiotic resistance mechanisms of Salmonella species. The specific aims of the project are as follows: To rapidly detect and isolate Salmonella species from food, as pure culture is required for molecular typing as well as antibiotic resistance analysis To build a fingerprinting database with known serotypes and to identify unknown Salmonella species by comparing them to the database Apply the DNA fingerprinting database to se e differences in the typing patterns of the clinical and environmental Salmonella isolates To compare the discriminatory ability of PFGE and ribotyping To determine whether the DNA typing pa tterns correlate w ith the antibiotic resistance profiles as observe d in other studies (76, 184, 213) To understand the molecular basi s of antibiotic resistance in Salmonella based on DNA profiles, plasmids and integrons To determine if antibiotic resistance dete rminants and pathogenicity genes are colocated in Salmonella species as seen in Shigella flexneri (127) 45

PAGE 60

Chapter Two Material and Methods Bacterial Isolates A total of one hundred fourteen Salmonella isolates consisting of 33 serotypes and three subspecies were used in this study. One hundred wild type isolates were used of which sixty are clinical and forty are from envi ronmental sources. Thirty out of forty environmental isolates obtained from two mi dwestern turkey farms were kindly donated by Dr. Catherine Logue of North Dakota State University (NDSU); 10 were obtained from Washington State Department of Health (WADOH). Forty eight of the sixty clinical isolates were collected from various hospita ls in Tampa, FL including Tampa General Hospital (TGH), Saint Josephs Hospital (S JH) and University Community Hospital (UCH). These Tampa clinical isolates were obtained through the Florida Department of Health (FLDOH) and will be referred to as FLDOH isolates. Twelve clinical isolates were donated by the WADOH. Twelve Salmonella strains were used as controls for real time PCR, ribotyping, PFGE and the antibiotic sus ceptibility testing. Seven of the control strains were obtained from American Type Culture Collection (ATCC, Manassa, VA); six were from CDC and one was from DuP ont Qualicon (Wilmington, DE). All the isolates were characterized biochemically by API 20E panel, analyzed with the APILAB Plus Identification Program v.3.3.3/4.0 (bio Merieux, Inc., Hazelwood, MO) by Mrs. Kealy Peak. Serotyping of clinic al isolates was performed by the Salmonella reference laboratory of the FLDOH, Bureau of Laborat ories, Jacksonville, FL. Strains obtained from WADOH and Dr. Logue were serotyped by the contributors prior to inclusion in this study. E. coli Proteus mirabilis and Citrobacter freundii obtained from ATCC were 46

PAGE 61

47 used for specificity testing for the food detection and isolation. Shigella sonnei Listeria monocytogenes and Bacillus cereus were used for the specificity testing of the primers and probes for the detection by real time PCR. The isolate number, serotype and source are shown in Table 5.

PAGE 62

Table 5. Isolates Used in the Study Strain number Serotype Clinical/ Environmental Source Source Isolation Date CBD 032 S.Nima Clinical Unknown TGH 7/1/2001 CBD 033 S.Aberdeen Clinical Re ctal swab, Human TGH 9/30/2001 CBD 067 S.Newport Clinical Unknown UCH 12/20/2001 CBD 069 S.Javiana Clinical Unknown UCH 12/20/2001 CBD 213 S.Newport Clinical Stool, Human FLDOH 11/18/2002 CBD 222 S.Javiana Clinical Stool, Human FLDOH 11/26/2002 CBD 425 S.Newport Clinical Stool, Human WADOH 8/10/2001 CBD 426 S.Newport Clinical Stool, Human WADOH 2/5/2002 CBD 427 S.Newport Clinical Stool, Human WADOH 3/31/2002 CBD 428 S.Newport Clinical Stool, Human WADOH Unknown CBD 429 S.Oranienburg Environmental Bearded Dragon WADOH 7/22/2002 CBD 430 S.Apapa Environmental Lizard WADOH 2/5/2003 CBD 431 S. Saintpaul Environmenta l Alfalfa sprouts WADOH 3/14/2003 CBD 432 S arizonae Environmental Snake WADOH 2/5/2003 CBD 433 S arizonae Clinical Stool, Human WADOH 5/29/2003 CBD 434 S.Brandenburg Clinical Stool, Human WADOH Unknown CBD 435 S.Westhampton Clinical Stool, Human WADOH 6/4/2003 CBD 436 S.Paratyphi A Clinical Blood, Human WADOH 6/5/2003 CBD 437 S.Saintpaul Clinical Stool, Human WADOH 6/6/2003 CBD 438 S.Typhimurium Clinical Stool, Human WADOH 6/4/2003 CBD 439 S.Enteritidis Clinical Stool, Human WADOH 6/6/2003 CBD 440 S.Muenchen Environmental Unpa steurized OJ outbreak WADOH 6/1/1999 CBD 441 S.Muenchen Environmental Unpa steurized OJ outbreak WADOH 6/1/1999 CBD 442 S.Muenchen Environmental Unpa steurized OJ outbreak WADOH 6/1/1999 CBD 443 S.Hildgo Environmental Unpa steurized OJ outbreak WADOH 6/1/1999 CBD 444 S. Alamo Environmental Unpa steurized OJ outbreak WADOH 6/1/1999 CBD 445 S. Javiana Environmental Unpa steurized OJ outbreak WADOH 6/1/1999 CBD 446 S. Typhimurium Environmental Stool, Human WADOH Unknown CBD 569 S.Alachua Environmental Turkey Plant-2, Day-1 NDSU 2000 CBD 570 S. Anatum Environmental Turkey Plant-1, Farm-A NDSU 2000 CBD 571 S.Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 572 S.Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 573 S.Istanbul Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 574 S.Istanbul Environmental Turkey Plant-1, Farm-B NDSU 2000 48

PAGE 63

Strain number Serotype Clinical/ Environmental Source Source Isolation Date CBD 575 S.Istanbul Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 576 S.Kentucky Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 577 S.Kentucky Environmental Turkey Plant-1, Farm-A NDSU 2000 CBD 578 S. Mbandaka Environmental Turkey Plant-1, Farm-A NDSU 2000 CBD 579 S. Montvideo Environmental Turkey Plant-2, Day-2 NDSU 2000 CBD 580 S. Muenster Environmental Turkey Plant-1, Farm-C NDSU 2000 CBD 581 S.Muenchen Environmental Turkey Plant-1, Farm-C NDSU 2000 CBD 582 S. Reading Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 583 S. Reading Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 584 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 585 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 586 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 587 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 588 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 589 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 590 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 591 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 592 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 593 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 594 S. Newport Environmental Turkey Plant-2, Day-4 NDSU 2000 CBD 595 S. Newport Environmental Turkey Palnt-2, Day-5 NDSU 2000 CBD 596 S. Newport Environmental Turkey Plant-2, Day-5 NDSU 2000 CBD 597 S. Newport Environmental Turkey Plant-2, Day-6 NDSU 2000 CBD 598 S. Newport Environmental Turkey Plant-2, Day-6 NDSU 2000 CBD 603 S. Javiana Clinical Stool, Human FLDOH 8/2003 CBD 604 S. Newport Clinical Stool, Human FLDOH 8/2003 CBD 746 S. Typhimurium Clinical Stool, Human UCH 3/2004 CBD 747 Clinical Stool, Human UCH 3/2004 S. IV 50:z4,z23:-CBD 757 S. Typhimurium Clinical Stool, Human UCH 4/2004 CBD 759 S. Newport Clinical Stool, Human SJH 4/2004 CBD 775 S.Typhimurium Clinical Stool, Human SJH 3/2004 CBD 776 S. Sandiego Clinical Body Fluid from thyroid SJH 4/2004 CBD 777 S.Typhimurium Clinical Stool, Human SJH 4/2004 CBD 778 S. Typhimurium Clinical Stool, Human SJH 4/2004 CBD 779 S. Enteritidis Clinical Stool, Human SJH 4/2004 CBD 780 Clinical Stool, Human UCH 4/2004 S. IV 50:z4,z23:-CBD 781 S. Enteritidis Clinical Stool, Human UCH 4/2004 49

PAGE 64

Strain number Serotype Clinical/ Environmental Source Source Isolation Date CBD 782 S. Stanley Clinical Stool, Human UCH 4/2004 CBD 805 S. Berta Clinical Stool, Human UCH 6/2004 CBD 806 S.species Clinical Stool, Human UCH 6/2004 CBD 807 S.Javiana Clinical Rectal swab, Human SJH 6/2004 CBD 808 S.Muenchen Clinical Rectal swab, Human SJH 6/2004 CBD 809 S.Muenchen Clinical Stool, Human SJH 6/2004 CBD 810 S. Heildelberg Clinical Stool, Human SJH 6/2004 CBD 811 Clinical Rectal swab, Human SJH 6/2004 S. I 4,12:i:-CBD 813 S. Javiana Clinical Stool, Human SJH 7/2004 CBD 814 S. Anatum Clinical Stool, Human SJH 7/2004 CBD 815 S. Newport Clinical Stool, Human SJH 7/2004 CBD 816 S.Typhimurium Clinical Body fluid, Human SJH 7/2004 CBD 817 S.Typhimurium Clinical Unknown UCH 7/2004 CBD 818 S.Enteritidis Clinical Stool, Human UCH 7/2004 CBD 819 S.Javiana Clinical Stool, Human SJH 8/2004 CBD 820 S.Typhimurium Clinical Stool, Human SJH 8/2004 CBD 821 S.Sandiego Clinical Stool, Human SJH 8/2004 CBD 822 S.species Clinical Stool, Human SJH 8/2004 CBD 823 S.Typhimurium Clinical Stool, Human SJH 8/2004 CBD 824 S.Tallahassee Clinical Stool, Human SJH 8/2004 CBD 825 S.Paratyphi A Clinical Blood, Human UCH 8/2004 CBD 826 S.Javiana Clinical Unknown UCH 8/2004 CBD 827 S.Newport Clinical Stool, Human UCH 9/2004 CBD 828 S.Typhimurium Clinical Stool, Human UCH 9/2004 CBD 829 S.Newport Clinical Stool, Human SJH 9/2004 CBD 830 S.Javiana Clinical Stool, Human SJH 9/2004 CBD 831 S.Muenchen Clinical Stool, Human SJH 9/2004 CBD 832 S.Enteritidis Clinical Stool, Human UCH 10/2004 CBD 833 S. IV 50:z4,z23 :Clinical Stool, Human UCH 10/2004 CBD 020 S. Infantis Dupont Dupont 103 CBD 024 S.Enteritidis ATCC ATCC 13076 CBD 025 S.Choleraesuis ATCC ATCC 13312 CBD 026 ATCC ATCC 13314 S. arizonae CBD 027 S. Pullorum ATCC ATCC 19945 CBD 028 S. Typhimurium ATCC ATCC 23564 CBD 030 S. Newport ATCC ATCC 6962 CBD 031 S. Derby ATCC ATCC 6960 50

PAGE 65

51 Strain number Serotype Clinical/ Environmental Source Source Isolation Date CBD 236 S. Typhimurium CDC DOH-D-13 CBD 321 S. Braenderup CDC CDC H 9812 CBD 387 S. arizonae CDC CAP D-05 CBD 599 S. Typhimurium CDC CDC 61-99 CBD 600 S. Typhimurium CDC CDC 78-99 CBD 1058 S. Newport ATCC ATCC 27869 CBD 52 E. Coli ATCC ATCC 25922 CBD 553 Citrobacter freundii ATCC ATCC 8090 CBD 554 Proteus mirabilis ATCC ATCC 35659 CBD 006 Bacillus cereus ATCC ATCC 11778 CBD 009 Listeria monocytogenes ATCC ATCC 9525 CBD 002 Shigella sonnei ATCC ATCC 9290 Isolate number, serotype, source and date of isolation of bacteria used in the study. UCH-University Community Hospital, Tampa, FL, SJHSt. Josephs Hospital, Tampa, FL, TGHTampa General Hospital, WADOHWashington Department of Health, FLDOHFlorida Department of Hea lth, NDSUNorth Dakota State University, O.Jorange ju ice. The turkey carcass strains were isolated from two Plants, 1 and 2. Plant-1 isolates were fr om three different farms, A, B and C. Plant-2 isolates were collected in a course of six days. The specific days, farms and plants are indicated in the table.

PAGE 66

DNA Extraction DNA was extracted from pure cultures by using the MagNA Pure LC instrument and kit (Roche Applied Sciences, Indianapolis, IN ) or the Epicenter Masterpure DNA isolation kit (Epicenter Biotechnologies, Madison, WI). All the buffers except for Tris EDTA (TE) buffer (10mM Tris; 100mM Ethylenediamine tetraacetic acid) were provided in the kits. A 1: 20 ratio of, DNA to molecu lar biology grade water (Sigma Aldrich, St. Louis, MO) was used for all PCR reactions. DNA Extraction by MagNA Pure MagNA Pure is designed to purify DNA from bacter ia and fungi. Bacterial isolates from freshly sub-cultured plates were grown in 4 ml of trypticase soy broth (TSB, REMEL, Inc., Lenexa, KS) for 18 hours at 37 C. One ml of the TSB culture was centrifuged at 8000 X g for 10 minutes and 900 l of the supernatant was discarded. One hundred thirty l of bacterial lysis buffer was added to the remaining 100 l containing the pellet and mixed well. Twenty l of proteinase K (50mg/ml) was added and incubated at 65 C for 10 minutes and at 95 C for 10 minutes. The above 250 l of the lysed sample was loaded into the machine along with buffers and dispos ables. The buffers are subsequently added automatically into the sample by the MagNa Pure instrument. The first buffer to be added is 300 l of lysis binding buffer, which lyses the cells and releases the DNA. Then, 150 l of magnetic glass partic le is added to which DNA is bound. Four hundred fifty l 52

PAGE 67

of wash buffers I and II are then added to remove any unbound particles. One hundred l of elution buffer is finally added to elute the DNA. DNA Extraction by Epicenter Kit Bacterial colonies from freshly sub-cultured plates were grown for 18 hours in TSB. 1 ml of the above culture was cen trifuged for 5 minutes at 12,000 X g. The pellet was resuspended in 1 l of proteinase K (50 g/ l) and 150 l of 2X tissue and cell lysis solution (2 X T+C). The sample was mixed we ll by vortexing and then was incubated at 65 C for 30 minutes. The sample tubes were transferred to a 95 C heat block, incubated for 10 minutes, and then placed on ice for 5 minutes. One hundred fifty l of protein precipitation reagent provided in the kit was added and the mixture was vortexed. The samples were centrifuged at 10,000 X g fo r 10 minutes and the supernatant was transferred to a fresh mi crofuge tube. Five hundred l of 75% isopropanol was added to the pellet, tubes were inve rted 30 to 40 times and centr ifuged at 12,000 X g for 10 minutes at 4 C. The pellet containing DNA wa s rinsed twice with 75% ethanol. Finally, the pellet was resuspended in 200 l of TE. Real time PCRPrimer and Probe Testing Three primers and probe sets representing the genes Salmonella outer protein B ( sopB ), outer membrane porin F ( ompF ) and Salmonella virulence plasmid A ( spvA ) were designed. sopB is required for virulence and fluid secretion but not invasion (78). The 53

PAGE 68

main function of spvA is virulence since spvA mutants show lower virulence in mice (115). ompF is a porin, present on SPI-2 and is required for Salmonella virulence (109). The TaqMan probes were labeled with th e reporter dye, 6 carboxyfluorescein (FAM) on the 5 end and the quenche r dye, Black Hole Quencher (BHC) on the 3 end. The primer and probe sequences are listed in Table 6. Table 6. Primers and Probes for Real Time PCR Gene Primer or probe Sequence (5 to 3) sopB Forward TGGCGGCGAACCCTATAAA sopB Reverse CGCGTCAATTTCATGGGC sopB TaqMan probe TCGCACAACGCCTTGCCATGTT spvA Forward CGGTATTTGCTGGTTAATGGC spvA Reverse GAGCGTCGGCCGGAC spvA TaqMan probe TCATTAACCACCATCAGGGTGGCCA ompF Forward CCTGGCAGCGGTGATCC ompF Reverse AAATTTCTGCTGCGTTTGCG ompF TaqMan probe TGCCCTGCTGGCTGCTGCA The primer and probes sequences used for real time PCR in the study. All the above primers were designed using Primer Express Oligo design software, version 1.5 (Applied Biosystems, Foster City, CA) for this study. For the real time PCR, 50 l reaction was set up consisting of 25 l of TaqMan universal master mix (Applied Biosyste ms, Foster City, CA), 0.45 l forward primer, 0.45 l reverse primer (100 pmol/ l stock each), 0.125 l of probe (100 pmol/ l stock), 18.975 l of molecular biology grade water (S igma Aldrich, St. Louis, MO) and 5 l of the template DNA (40-50 g/ml). All the primers used in this study were purchased from 54

PAGE 69

Integrated DNA Technologies (I DT DNA, Coralville, Iowa). PCR amplification and detection was carried out using ABI Prism 7700 sequence detection system using the default parameters (Applied Biosystems, Fost er City, CA). Each sample was run in duplicate and the mean Cycle Threshold (C T ) value was calculated. C T value represents the cycle number at which the florescence of the reaction crosses the threshold (102). C T value shows the stage of the PCR reaction at which there is enough amplified product to give a positive result. Therefore, the lower the C T value the higher is the likelihood of the reaction to be positive. C T value of 40 or above was consid ered to be a negative reaction based on the criteria se t by Heller et al. (90). Detection and Isolation of Salmonella from Artificially Contaminated Food Samples Ready to eat food samples were used in this study, as they are po tential candidates for natural or intentional contamination. The f ood was from local grocery stores and was divided into 25 gm aliquots and frozen at C until needed. These foods are listed in Table 7. The background flora that is represen ted in CFU per gram of each food is also shown in the table. The media used in this study were purchased from REMEL (REMEL, Inc., Lenexa, KS). The background flora for each food was calculated by using the heterotrophic plate c ount (HPC) method as follows. Twenty five gm of food was homogenized with 225 ml of sterile phos phate buffered saline (PBS) in a stomacher (Seward Medical, London, UK) for 2 minutes at 230 RPM. The homogenized sample was serially diluted to 10 -2 -3 and 10 dilutions. Ten ml of the sample as well as the dilutions were poured onto a petri dish. Then, 12-15 ml of plate count agar (cooled to 45 55

PAGE 70

1C) was poured into the petri dish and al lowed to solidify at r oom temperature. The plates were then incubated at 37 C for 48 hours and the colony c ounts were recorded. Table 7. Food Samples for Analysis Food Sample Background (CFU/gm) Chicken cuts 15 Egg salad 500 Hamburger 5050 Sushi 100 Blueberries 420 Cheese 2550 Mayonnaise <10 Orange juice 0 Ready to eat food samples used in the st udy and their backgroun d flora calculated according to HPC protocol. The background is represented in colony forming units (CFU) per gram of food. For isolation and detection, 25 grams of each f ood sample was artificially inoculated with low spike (110 CFU of S. Enteritidis, ATCC 13076 or S. Typhimurium, ATCC 23564) or mixed spiked (1-10 CFU of Salmonella species along with 5-200 CFU E.coli Proteus mirabilis and Citrobacter freundii). The spiking amounts for each experiment and the organisms is shown in the Appendix, Table A1. The negative cont rol was unspiked. The standard spiking amount was maintained through frozen glycerol diluti on stocks kept at 80 C. One hundred l of frozen dilution stock of each organism, which was the amount used for the intentional contamination of the food samples, was plated on three TSA plates for viability count and quality control for each experiment performed. For 56

PAGE 71

Salmonella 100 l of the frozen dilution was also inoculated on three xylose lysine desoxycholate (XLD) plates. The mean viab le count from the three XLD plates was considered as the spiking amount of Salmonella for each experiment. The mean viable count from the three TSA plates wa s considered the spiking amount for E. coli and Citrobacter. For the Proteus species individual colonies we re not counted, but a lawn of growth on TSA plate was consider ed as the ideal spiking amount. The artificially contaminated food samples we re homogenized within a sterile filter bag (Interscience laboratories, Weymouth, MA ) using the stomacher (Seward medical, London, UK) for 90 seconds at 230 RPM with 225 ml of buffered peptone water (BPW, pH 7.2) containing bacto peptone. The homoge nate was incubated at 37 C for 6 hours and 100 l of the same was plated on TSA and XL D agar respectively and then incubated at 37 C for 18 hours. For ora nge juice the inoculated BPW was shaken in a jar and was not homogenized. Salmonella species can be differentiated from other enterics based on three reactions, xylose fermentation, lysi ne decarboxylation a nd hydrogen sulfide (H 2 S) production on XLD agar. Xylose is fe rmented by most enterics but not Shigella this differentiates Shigella from Salmonella Salmonella which has lysine decarboxylase enzyme, reverts the pH back to alkaline conditions after the xylose fermentation. Coliforms are lysine positive but the presence of excess sucrose and lactose prevent these from reverting to alkaline conditions. Sodium thiosulphate and ferr ic ammonium citrate lend Salmonella to produce H 2 S that turns the colony black whereas E. coli Citrobacter and Proteus produce yellow colonies. Deoxycholate is the selective agent and inhibits the growth of Gram positive organisms. 57

PAGE 72

One ml of the BPW enriched samples was se lectively enriched by IMS and tetrathionate (TT) broth. Organisms that can reduce TT su rvive and flourish in this medium while others are inhibited. Therefore, growth of f ecal organisms will be inhibited. Bile salts and sodium thiosulfate inhibit Gram positive organisms and some Enterobacteriaceae. For IMS, 1 ml of the sample was mixed with 20 l of anti Salmonella antibody beads (Dynal Biotech, Brown Deer, WI). The beads and the sample were mixed for an hour using the sample mixer (Dynal Biotech) and wash ed three times for 10 minutes in 400 l of sterile PBS (with 10% Tween). Finally the beads were suspended in 100 l of sterile PBS and 50 l was plated onto each of TSA and XLD agar plates. For TT broth enrichment, 1ml of the BPW enriched sample was mixed with 10 ml of TT broth and incubated for 4 hours, then 100 l of the sample was plated onto TSA and XLD plates. The XLD and TSA plates from IMS and TT broth enrichment were incubated for 18 hours at 37 C. The schematic of the isolati on is represented in Figure 2. Figure 2. Isolation and Detection of Salmonella 25 gm Food (spiked, mixe d spiked and unspiked) + 225 ml BPW Enriched BPW T T, 4 hrs, 370C P P Detection by RT PCR 6 h 37 oC Plate IMS Plate 58

PAGE 73

Schematic of detection and isolation protocol; BPW=buffered peptone water, TT=tetrathionate broth, IMS=immunomagnetic separation, RT PCR=real time PCR Plate counts were recorded and the morphol ogy of the colonies was determined. All colonies that were black on XL D and resembled the control plat es were considered to be Salmonella species. Each experiment was repeated for two or three times and the average was calculated. DNA was extracted by using the ABI PrepMan kit (Applied Biosystems, Foster City, CA) from one ml of each the BPW and the TT broth enriched samples. Real time PCR (ABI 7700, Applie d Biosystems, Foster City, CA) with Salmonella specific ompF gene was used to test th e DNA extracted from the food samples. Statistical Analysis Students T test was calculated by compari ng the averages of two sets of isolation. Isolation results from each enrichment technique: BPW, BPW+ IMS and BPW+TT were compared against the others to get the P va lue. The data for low and mixed spiking was analyzed separately. Ribotyping Automated ribotyping was performed on the RiboPrinter (Dupont Qualicon, Wilmington, DE) with the restriction enzyme Eco RI according to manufacturers instructions. All the reagents were supplied by the manufacturer. Briefly, 2-3 isolated 59

PAGE 74

colonies from freshly inoculated TSA plates were suspended in 200 l of sample buffer and heated to 80 o C for 15 minutes. 5 l each of lysis agent A and B were added to 30 l of the above sample and were placed in sample carrier tray. The samp le carrier tray was loaded into the RiboPrinter along with the gel cassette, membrane, purified water, restriction enzyme and other disposables incl uding probe, substrate and conjugate. All the steps are automatically performed by the RiboPrinter including the restriction digestion, separation of the DNA fragments on the ge l and transfer of the fragments onto a membrane and its subsequent hybridizati on with the rDNA probe The results were exported into the BioNumerics (Applied Math, Sint-Martens Latem, Belgium) program in QNX (text file) format. Pulsed Field Gel El ectrophoresis (PFGE) Macrorestriction digestion of genomic DNA was performed using the CDC standardized laboratory protocol for molecular subtyping of E.coli O157:H7. All reagents were obtained from Sigma (Sigma Aldrich, St. L ouis, MO) unless otherw ise specified. Briefly, Salmonella colonies from freshly in oculated TSA plates (inc ubated for 18-20 hours) were suspended in 1 ml of cell suspension buffe r (100 mM Tris: 100 mM EDTA, pH 8.0) to obtain an optical density of 11.4 ab sorbance units at 610 nm. Two hundred l of the above cell suspension, 0.2 mg of proteinase K and 200 l of 1% molten agarose (Seakem Gold, Cambrex Bio Science, Rockland, ME) were dispensed into disposable plug molds (BioRad, Hercules, CA) and allo wed to solidify for 10 minutes at 4 C. The plugs were lysed in cell lysis buffer (50 mM Tris: 50 mM EDTA, pH 8.0 and 1 % Sarcosyl) with 0.5 60

PAGE 75

mg of proteinase K for 2.5 hours at 54 C in a shaking waterbath and were then washed twice in preheated water (50 C) and four times in Tris EDTA buffer (50 C) at 10 minute intervals. Plug slices of 2 mm widt h were digested with 50 units each of Spe I and XbaI (Promega, Madison, WI) se parately for two hours. XbaI digested S. Braenderup H9812 plug slices were used as molecular we ight standards. The electrophoresis was carried out on the CHEF Mapper (BioRad, Hercul es, CA) with an initi al switch time of 2.16 seconds and final switch time of 63.8 s econds for 18 hours. The running buffer as well as the buffer used for the gel was 0.5X Tris Boric acid EDTA (TBE) (Tris 0.04M, Boric acid 0.04M, EDTA, disodi um 0.001M). The gel was stained in ethidium bromide (0.4 mg/ 400 ml of deionized water) for 20 minutes, destined twice for 10 minutes in deionized water for and visual ized by using the GelDoc (BioRad, Hercules, CA). TIFF images were exported into the BioNumerics program for analysis. PFGE for NonTypeable Strains S. Saintpaul is one of the serotypes th at is known to be untypeable by PFGE under normal conditions. This serotype requires addi tion of thiourea in the TBE running buffer. Thiourea neutralizes a nucleolytic peracid derivative of Tris th at is formed at the anode during electrophoresis. S. Sain tpaul isolates were type d by the addition of 1600 l of 10mg/ml thiourea to 2100 ml of the TBE running buffer. 61

PAGE 76

Antibiotic Resistance Testing Antibiotic resistance profiles were determined by using the Sensititre system (Trek Diagnostics, Cleveland, OH). All the reagents were provided by the manufacturer. The Sensititre system consists of a panel of precisi on dosed antibiotics at different dilutions in a 96 well plate and is equivalent to the classic macrobroth diluti on method. It provides an autoread system that utilizes fluores cence technology to detect the bacterial growth after 18 hours. The technology monitors th e activity of specific surface enzymes and hence the fluorescence substrate ge nerated is directly related to the growth of the test organism. Resistance to a total of 31 different antibiotics or antimicrobial combinations was tested using manufacturers instructions with two panels comprised of 23 and 16 antibiotics each. Briefly, 1-2 pure colonies of the bacteria were resuspended in a saline tube to obtain a 0.5 McFarland density. Ten l of this solution was placed into a Mueller Hinton broth tube. This mixture was then automatically dispensed in 50 l aliquots into the 96 well plate by the machine. Intraplate relia bility testing was done to see if the results vary based on time or day. A fresh TSA plate was inoculated with a sterile loop touching a colony of the mother plate of Salmonella enterica serotype Infantis (DuPont # 103) and incubated for 18 hours at 37 C. Five different reactions were set up us ing the same plate but touching different colonies for each. This was done five times us ing the same incubated plate but with five different saline and broth tubes. Then the broth tubes were used to automatically inoculate the 96 well plates consisting of the antibiotics. The same test was repeated 62

PAGE 77

twice on two different days using the same colony from the mother plate to inoculate a fresh plate. The isolates were tested for various antibiotics including lactams: ampicillin (Amp), piperacillin (Pip), ticarcillin (Tic); -lactam/ -lactamase inhibitor combinations: amoxicillin/clavulanic acid (Aug), ampicillin/s ublactum (A/S), piperacillin/tazobactum (P/T), ticarcillin/ clavulanic acid (Tim); Aminoglycosides : amikacin (Ami), gentamicin (G), kanamycin (K), streptomycin (Str), tobramycin (Tob); Cephams: ceftriaxone (Axo), cephalothin (Cep), cefoxitin (Fox), ceftiofur (Tio), aztreonam (Azt), cefepime (Fep), cefoperazone (Fop), cefotaxime (Fot), ceft azidime (Taz); Quinolones: nalidixic acid (Nal); fluoroquinolones: ciprofloxacin (Cip), levofloxacin (Levo), lomefloxacin (Lome); Others: chloramphenicol (Ch), tetracycline (Tet), trimethoprim/sulfamethaxazole (Cot), sulfamethoxazole (Smx), sulfizoxazole (Fis), imipenem (Imi). Results were interpreted according to the National Committee for Clin ical Laboratory Sta ndards (NCCLS, 2002) guidelines. The minimum inhibitory concentration (MIC) values in g/ml of the isolates were compared to the NACCLS breakpoints. An isolate was c onsidered to be resistant (R), intermediately resistant (I) or suscep tible (S) based on the NCCLS breakpoints. An isolate was considered to be multidrug resistant if it was R or I to two or more classes of antibiotics. E. coli (ATCC 25922) was used for quality control. 63

PAGE 78

Dendrogram Construction Tagged image file format (TIFF) images of PFGE and ribotyping a nd the MIC values of antibiotic resistance were analyzed by BioNumerics software, version 3.0 using the Dice coefficient. For PFGE, four molecular we ight standards were run on each gel for normalization and bands below 54 kilobases (Kb) were not considered for analysis. For ribotyping, the data was analyzed in two different ways. In the first method, data normalized by the RiboPrinter was exported into the BioNumerics database. In the second method TIFF images obtained from the RiboPrinter were manually analyzed using the BioNumerics software. The phylogenetic rela tionship between isolates was studied by dendrograms constructed with unwei ghted pair group method using arithmetic averages (UPGMA) with 1% position toleranc e. Strains that showed 93% or more similarity were considered identical for PFGE based on cluster analysis of molecular weight standards from various gels (Figure 3a). For the RiboPrinter comparison of molecular weight standards between gels showed 99.99% similarity therefore strains showing less than 99.99% similarity were considered different for both automated normalization as well as the TIFF based manual analysis (Figure 3b). 64

PAGE 79

Figure 3. Molecular Weight Standard Analysis Figure 3a. Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]PFGE Xba-1 100 99 98 97 96 95 94 93 PFGE Xba-1 Marker1 Marker2 Marker3 Marker4 Marker10 Marker11 Marker8 Marker7 Marker6 Marker9 Marker5 Analysis of molecular weight sta ndards of PFGE gels digested with XbaI. Eleven standards analyzed showed 93% similarity. 65

PAGE 80

Figure 3b. Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]Ribotyping-EcoR1 100 Ribotyping-EcoR1 Marker-1 034 Marker-3 034 Marker-1 044 Marker-3 044 Marker-1 060 Marker-3 060 Marker-1 071 Marker-1 179 Marker-2 179 Marker-3 179 Marker-1 182 Marker-3 182 Marker-1 186 Marker-3 186 Marker-1 211 Marker-3 211 Marker-1 216 Marker-3 216 Marker-1 225 Marker-3 225 Marker-1 229 Marker-3 229 Marker-1 238 Marker-3 238 Marker-1 239 Marker-3 239 Marker-1 306 Marker-3 306 Marker-1 311 Marker-3 311 Marker-1 321 Marker-3 321 Marker-1 322 Marker-3 322 Marker-1 327 Marker-3 327 Marker-3 335 Marker-1 367 Marker-3 367 Analysis of molecular weight standards of ribotyping with Eco RI. The standards analyzed showed 99.99% similarity. 66

PAGE 81

Integron PCR Integrons were amplified using the primers (Table 8) and conditions described by Levesque et al. (112). The primers are dire cted to amplify the entire length of the integron; therefore, the expected product size can be variable. For amplification of integrase gene (intigene ) primers were designed based on previous studies are shown in Table 8 (212). All the reagents were purchased from TaKaRa Bio Inc. (Otsu, Shiga, Japan) PCR was performed in 50 l reaction with 4 l of 10X PCR buffer, 0.8 l of deoxynucleotide triphosphate mix (2.5 mM/ l), 0.6 l each of forward (18.8 pM/ l) and reverse primer (18.5 pM/ l), 6 l of magnesium chloride (25 mM/ l), 35.6 l of molecular biology grade water, 0.4 l of Taq DNA Polymerase and 2 l of DNA template. PCR was set up using the hot start method using the Whatman Biometra thermocycler ( Horsham, PA) The initial denaturing was done at 94 C for 5 minutes followed by 34 cycles of denaturation (94 o o C, 30 seconds), annealing (55 C for 30 seconds), extension (72 o C for 2 minutes 30 seconds) a nd a final extension. Twenty l of the amplified product was electrophoresed on 1% agarose gel using the Benchtop ladder (Promega, Madison, WI) as a size standard a nd stained in ethidium bromide. The stained gel was visualized using the GelDoc (BioRad, Hercules, CA) Table 8. Integron Primers Gene Primer Sequence (5 to 3) Reference int Forward GGC ATC CAA GCA GCA AG Levesque et al. int Reverse AAG CAG ACT TGA CCT GA Levesque et al. intigene Forward GTT CGG TCA AGG TTC TG Zhang et al. intigene Reverse GCC AAC TTT CAG CAC ATG Zhang et al. 67

PAGE 82

Sequences of forward and reverse primers for integron ( int ) and integrase gene ( intigene) PCR. DNA Sequencing The amplified product was pur ified using the QIAquick gel extraction kit (Qiagen, Valencia, CA) for sequencing using manufact urers protocol. Br iefly, QG buffer was added to the fragments of interest that we re cut from the agarose gel after PCR. The sample was incubated for 10 minutes at 50 o C and vortexed. The sample was then placed in QIAquick spin column and centrifuged at 12,000 X g for 1 minute. The flowthrough was discarded and 500 l of buffer QG was added and centrifuged for 1 minute. The filtrate was discarded and 750 l of PE buffer was added and centrifuged for 1 minute. The filtrate was discarded and the sample was spun dry for 1 minute. Finally, the DNA was eluted in 50 l of molecular biology grade water (preheated to 65 o C). Five microliters of the eluted DNA was electr ophoresed on 0.7% agarose gel for calculating the concentration of DNA for sequencing. Lambda DNA HindIII marker (Promega, Madison WI) was used as the molecular weight and concentration standard. Sequencing was done using the CEQ 8000 (Beck man Coulter, Fullert on, CA) following the manufacturers protocol and reagents. A total of 20 l sequencing reaction was set up with 5 l of the DNA template, 1.5 l of primer (18.5 pM), 8 l of DTCS and 5.5 l of 68

PAGE 83

molecular biology grade water. The thermal cycling was carried out for 30 cycles at 96 C for 20 seconds, 50 C for 20 seconds and 60 C for 4 minutes. The DNA was concentrated by precipitation in 1.5 ml microfuge tubes. Four l of stop solution (equal volumes of 1.5 M NaOAc pH 5.2 and 50 mM EDTA pH 8.0) and 1 l of glycogen (20 mg/ml) was added to the cycle sequencing product. Sixty l of cold 95% ethanol was added and mixed well. The sample was then centrifuged at 12,000 X g at 4 C for 15 minutes. The supernatant was then carefully removed without distur bing the pellet. The pellet was then wa shed twice in 200 l of cold 70% ethanol by centrifuging at 12,000 X g for 10 minutes. The sample was then dried using the DNA 110 SpeedVac (Thermo Savant, Holbrook, NY) for 10 minutes. The sample was resuspended in 40 l of sample loading solution and transferred to the 96 we ll sequencing plate. One drop of mineral oil was added to each well and then the plate wa s loaded onto the sequencer. The results were analyzed using the Lasergene softwa re, version 5.6 (DNAstar Inc., Madison, WI) and compared with the National Center for Biotechnology Information database ( http://www.ncbi.nlm.nih.gov/BLAST/ ). Plasmid Extraction Plasmids were extracted using the Qiagen pl asmid midi kit (Qiagen, Valencia, CA). The isolates were first grown on TSA plates and th en an isolated colony was inoculated in 25 ml TSB broth. The 25 ml culture was pelleted down and the pellet was resuspended in 4 ml of buffer P1 and vortexed. Then, 4 ml of buffer P2 was added and mixed gently and 69

PAGE 84

incubated for 5 minutes at room temperature. Buffer P3 was then added and mixed gently and incubated on ice for 20 minutes. The samp le was then centri fuged at 10,000 X g for 30 minutes. The supernatant was filtered through a pre wet paper towel to eliminate extra debris. Four milliliters of bu ffer QBT was allowed to flow through the spin column to equilibrate the column. The supernatant was th en placed in the spin column and allowed to flow through. The DNA in the column was washed twice with buffer QC. The DNA was then eluted in a fresh tube with 5 ml of preheated (50 0 C) buffer QF. The DNA was then precipitated by adding 3.5 ml of isopropanol and centrifuged for 30 minutes at 10,000 X g. The supernatant was discarded and the pellet was wash ed twice with 70% ethanol. The pellet was air dr ied and resuspended in 50 l of TE buffer. Five microliters of the plasmid prep was electr ophoresed on a 0.7% agarose gel. Membrane Transfer DNA was fractionated according to the PFGE protocol. The gel was soaked in several volumes of depurination solution (0.2 N hydroc hloric acid) for 15 mi nutes. The gel was then soaked in denaturati on solution (1.5 M sodium chloride. 0.5 N sodium hydroxide) for 20 minutes. The gel was rinsed in deioni zed water and then soak ed in neutralization solution (1 M Tris pH 7.4, 1.5 M sodium chlo ride) for 30 minutes. The gel was again soaked in neutraliz ation solution for an additi onal 15 minutes and the DNA was transferred from the gel to the membrane by capillary action. Br iefly, a plexiglass container was wrapped in Whatmann 3 MM pa per and placed in a large baking dish. The dish was filled with transfer buffer ( 10X SSC; 175.3 gm sodium chloride, 88.2 gm 70

PAGE 85

sodium acetate per L of deionized water, pH 7.0). The gel was inverted and placed on the plexiglass support; a pr e wet membrane (Roche Applied Sciences, Indianapolis, IN) was cut similar to the dimensions of the ge l was placed on the gel. Two Whatmann filter papers were cut to match the gel size and placed on the membrane The baking dish was filled with more transfer buffer and paper towels were stacked on the arrangement. Finally, a weight of about 500 gm was placed on this and the DNA was allowed to transfer for 48 hours. The arrangement was then disassembled and the DNA was crosslinked on the membrane using the UV Strata Linker (Spectronics Corporation). Hybridization of Southern Blots The primers used to make the probe for Sout hern blotting are listed in Table 5. Probe bound to DNA fragments was detected by chemilu minescence. The probes were designed for variety of virulence and antibi otic resistance genes based on the Salmonella Typhimurium LT2 genome. sitA and sitB are iron transporter genes and are important virulence factors phoP and phoQ are part of two component regulatory system. invA is the gene encoding the invasion protein and magA is the putative magnesium transporter. fecA encodes an iron carrier protein in Shigella flexneri that is present on a pathogenicity island and is associated with multiple antibiotic resistance genes. ampC and ampH encode penicillin binding prot eins conferring resistance to lactams. bla SHV and tem1 encode resistance to lactams. aadA2 is aminoglycoside resistance gene; tetR is the gene conferring resistance to tetracycline. sul1 dfr1 and cat genes confer resistance to sulfonamides, trimethoprim and chloramphenicol respectively. All the reagents were 71

PAGE 86

purchased from Roche (Roche Applied Scienc es, Indianapolis, IN) except for the primers and SSC solution. Primers were labeled us ing the digoxygenin (DIG) 3 oligonucleotide tailing 2 nd generation kit using the manufacturers protocol to make the hybridization probe. Briefly, 1 l (100 pmol/ l) of the forward or reverse primer shown in Table 9 was added to 8 l of molecular biology grade water. This solution was then mixed with 4 l of reaction buffer, 4 l of cobalt chloride solution, 1 l of DUG-dUTP solution, 1 l of dATP solution and 1 l of U terminal transferase. The sample was then mixed well and centrifuged briefly. The solution was then inc ubated for 15 minutes at 37 C and placed on ice for 5 minutes. Finally 2 l of 0.2 M EDTA was added to stop the reaction. The labeled probe was then added to 25 ml of hybridization solution. This probe was stored at C prior to use. Hybridization was carried out us ing the CDP Star kit. The membrane was prehybridized in the pre heated DIG Easy Hyb solution for 1 hour at 35 C in a hybridization oven (VWR international, West Chester, PA). This was replaced with preheated hybridization solution contai ning the probe. The membrane was allowed to hybridize for 18 hours at 35 C. The blot was then washed twice for 5 minutes each in 2X SSC and 0.5X SSC at appropriate temperat ure (5 C less than melting temperature of the primer). The blot was then washed on a rocker in 100 ml of washing buffer for 15 minutes followed by blocking for 1 hour in 10 % blocking buffer. The blot was then incubated in 20 ml of antibody solution (1 l of anti-digoxigenin-AP Fab fragments in 20 ml of blocking buffer) for 30 minutes. The blot was then washed in washing buffer twice for 15 minutes each. The membrane was then equilibrated in 20 ml of detection buffer for 5 minutes. Finally, 2 ml of CDP star worki ng solution was spread onto the membrane and 72

PAGE 87

covered with transparency. The blot was th en visualized in the ChemiDoc (BioRad, Hercules, CA) with appropriate exposure time. The membrane was then stripped by rinsing twice in 1X strippi ng solution (10X stock; 2M sodium hydroxide, 1% sodium didocyl sulfate). The stripped membrane was vi ewed in the ChemiDoc to make sure there was no signal. The stripped membrane was reused 2-3 times. Table 9. Probes for Southern Hybridization Gene Primer Sequence (5 to 3) Reference/Gene id fecA Forward GTT GTC GTC ATA AGA GCG G Luck et al. fecA Reverse GCT CCC ATT TCG CTC GGC Luck et al. sitA Forward GTC AGC TCG ATT ACC AAA CC STM2861* sitA Reverse CGC CGA TCA GCG CTG GTT STM2861* sitB Forward GGT TCA ATC GCC GCG CTG STM2862 sitB Reverse GAG CTG TCC GGC GGG CA STM2862* phoP Forward GGT CTG CCG GAT GAA GAC G STM1231* phoP Reverse GTT CTC ATG GGG CGT CTG C STM1231* phoQ Forward GAC GCA GCG CAA CAT TCC STM1230 phoQ Reverse CGC GAG CTT GAA GAT CAT C STM1230* magA Forward GCT GGC GTC GCG CGA TC STM3763 magA Reverse CGG CGC GAT GGA TGT GCT STM3763* invA Forward GCG GAT GCC GCG CGC G STM2896* invA Reverse GGC GTG CGC CTG CCG G STM2896* ampC Forward TGG GGC TAT GCG GAC A 948669 ampC Reverse ACG CCT GGG GAT ATC G 948669 ampH Forward GCG CGC ATG TCC CGA 1246887 ampH Reverse GCG GCG GAG TCT ATT C 1246887 blaSHV Forward CA CGCTGACCGCCTG 1446571 blaSHV Reverse GGTG GACGATCGGG TC 1446571 tem1 Forward TCC CGT GTT GAC GCC G 2716540 tem1 Reverse AGC CCT CCC GTA TCG TA 2716540 aadA2 Forward CGA GCA TTG CTC AAT GAC 1450505 aadA2 Reverse GGC CTC ACG CGC AGA 1450505 tetR Forward GGT GTA GAG CAG CCT AC 1446691 TetR Reverse GCA CTC AGC GCT GTG G 1446691 Sul1 Forward GCC GGC CGA TGA GAT 1263138 Sul1 Reverse TCT CGG TGT CGC GGA 1263138 Dfr1 Forward CTG CCT TGG CAT TTG CC 933011 Dfr1 Reverse CCT ATT TCC CTG AAG AGC 933011 cat Forward GGC ATT TCA GTC AGT TGC 1251342 cat Reverse AAG GCG ACA AGG TGC TG 1251342 73

PAGE 88

Probes designed for various virulence and antibiotic resistance genes based on The Institute for Genomic Research (TIGR) or National Center for Biotechnology Information (NCBI) database. The gene id num ber is depicted; indicates that the primers were designed using TIGR website. fecA probe was designed based on Luck et al. (127) Southern Blotting with 1.0 Kb Integron Fragment For the detection of integrons in the PFGE gels in order to see the location of the antibiotic resistance de terminants in relation to pat hogenicity island genes Southern hybridization using the High Prime DNA Labe ling and Detection Starter Kit II (Roche Applied Sciences, Indianapolis, IN) was used. The protocol is essentially similar to the above described DIG oligonucleotide tailing kit except that pure DNA extracted by using the QIA Quick kit after cutting the integron band was used as a probe. Approximately 1 g of template DNA was denatured by boiling fo r 10 minutes and chilled briefly on ice. Four microliters of DIG high prime solu tion was added to the above sample was incubated for 1 hour at 37 C. The reaction was stopped by adding 2 l of 0.2 M EDTA and heated at 65 C. The sample was added to 25 ml of pre hybridization solution (Roche Applied Sciences, Indianapolis, IN) and stor ed at C before use. The hybridization was carried exactly as described above with mi nor variations. After th e hybridization, the membranes were washed twice with 2 X SSC solution at 28 C and twice with 0.5 X SSC solution at 68 C. 74

PAGE 89

Dot Blots for Southern Hybridization Dot blots were prepared to be as controls for the Southern hybrid ization. Approximately, 2 g of DNA was placed on a small piece of membrane (Roche Applied Sciences, Indianapolis, IN) and allowed to dry for 10 minutes at room temperature. After 10 minutes, 2 g of template was added again on the membrane and allowed to dry for one hour. Both the positive control (CBD 746, S. Typhimurium) and negative control (CBD 554, Proteus mirabilis ) were placed on the two corners of the membrane as shown in Figure 4. Figure 4. Dot Blots + Control Control Preparation of dot blots for positive and nega tive control. S. Typhimurium (CBD 746) was used as a positive control and Proteus mirabilis (CBD 554) was used as a negative control for integron and Salmonella virulence gene testing Whatman filter papers were cut to fit the size of the dot blots and placed in three trays. The filter paper was soaked with NaOH (0. 5M) in tray #1, Tris (1 M) in tray #2 and Tris (1 M) with NaCl (1.5 M) in tray #3. The dot blot membranes were then placed on each tray #1 for 10 minutes, tray #2 for three minut es and tray #3 for 10 minutes and allowed to dry and were crosslinked in the Stratali nker and visualized us ing the Chemidoc. 75

PAGE 90

Chapter Three Results Primer and Probe Testing of Salmonella species by Real Time PCR Three primers and probes targeting the genes sopB spvA and ompF were tested on the DNA extracted from pure culture obtained fr om the 114 isolates listed in Table 5. A mean C T value of 40 or more was considered ne gative; the results were also analyzed based on the amplification plot generated for each well. An example of the amplification plot produced by the system is given in Figur e 5. A well defined peak showing a plateau stage represents a positive reaction whereas a scattered and disorganized plot depicts the absence of amplification. In the Figure 5, wells A3, A4; A5, A6 and A7 with Salmonella species were positive whereas the negative controls including a no template control, E. coli Bacillus cereus Shigella sonnei and Listeria monocytogenes did not produce a curve. Figure 5. Real Time PCR Amplification plot showing the C T value or the cycle number at which the fluorescence of the reaction crosses the threshold. A well-defined peak indicates that that the reaction 76

PAGE 91

is positive, whereas smaller peaks indicate no reaction. The sample lanes and the graph are color-coded. A1, A2-no te mplate control, A3, A4Salmonella Pullorum, A5, A6Salmonella spp., A7, A8Salmonella spp. A9, A10Shigella sonnei A11, A12E.coli B1, B2E.coli B3, B4E.coli B5, B6E.coli B7, B8Bacillus cereus B9, B10Listeria monocytogenes Table 10 represents the C T values of the isolates for the th ree primers sets. All the isolates belonging to Salmonella enterica subspecies I were positive for the sopB gene, whereas only three out of seven isolates belonging to subspecies III and IV possessed the sopB gene. The spvA reaction was positive for only four se rotypes of subspecies I including Pullorum, Choleraesuis, Typhimurium and Enteritidis. The spvA locus was also seen in some of the isolates belonging to subspecies III and IV. Overall, four out of six S. Enteritidis isolates, 13/16 S. Typhimurium is olates and four out of eight isolates belonging to subspecies III and IV were positive for the spvA gene. The ompF gene was detected in all of the 114 Salmonella isolates belonging to all of the three subspecies I, III and IV tested. The negative controls including E. coli Shigella sonnei Listeria monocytogenes, Proteus mir abilis, Citrobacter fruendii and Bacillus cereus were negative for all the three primer sets. 77

PAGE 92

78

PAGE 93

Table 10. Real Time PCR Results sopB gene spvA gene ompF gene CBD # Genus Name Serotype/Subspecies Source CBD 0020 Salmonella Infantis ATCC +,16.06 -,40 +,19.2 CBD 0024 Salmonella Enteritidis ATCC +,17.01 +,18.79 +,18.7 CBD 0025 Salmonella Choleraesuis ATCC +,15.31 +,14.59 +,17.8 -,40 +,17.88 +,18.0 CBD 0026 arizonae, subspeciesIII ATCC Salmonella CBD 0027 Salmonella Pullorum ATCC +,16.47 +,19.57 +,20.4 CBD 0028 Salmonella Typhimurium ATCC +,15.35 +,17.30 +,18.6 CBD 0030 Salmonella Newport ATCC +,18.82 -,40 +,18.5 CBD 0031 Salmonella Derby ATCC +,16.47 -,40 +,17.1 CBD 0032 Salmonella Nima FLDOH +,17.4 -,40 +,18.4 CBD 0033 Salmonella Aberdeen FLDOH +,15.34 -,40 +,17.9 CBD 0067 Salmonella Newport FLDOH +,16.11 -,40 +,17.4 CBD 0069 Salmonella Javiana FLDOH +,15.89 -,40 +,21.9 CBD 0213 Salmonella Newport FLDOH +,15.2 -,40 +,17.10 CBD 0222 Salmonella Javiana FLDOH +,14.5 -,40 +,22.8 CBD 0236 Salmonella Typhimurium CDC +,17.34 +,17.54 +,16.45 CBD 0321 Salmonella Braenderup CDC +,16.92 -,40 +,16.9 -,40 +,17.32 +,17.34 CBD 0387 arizonae, subspeciesIII CDC Salmonella +,18.53 -,40 +,16.73 CBD 0425 Newport WADOH Salmonella +,16.74 -,40 +,16.04 CBD 0426 Newport WADOH Salmonella +,16.82 -,40 +,16.63 CBD 0427 Newport WADOH Salmonella +,18.34 -,40 +,15.96 CBD 0428 Newport WADOH Salmonella +,19.6 -,40 +,16.05 CBD 0429 Oranienburg WADOH Salmonella +,18.0 -,40 +,16.14 CBD 0430 Apapa WADOH Salmonella +,16.6 -,40 +,16.34 CBD 0431 Saintpaul WADOH Salmonella +,27.99 -,40 +,16.03 CBD 0432 arizonae, subspeciesIII WADOH Salmonella -,40 +,17.7 +,20.56 CBD 0433 arizonae. subspeciesIII WADOH Salmonella 79

PAGE 94

sopB gene spvA gene ompF gene CBD # Genus Name Serotype/Subspecies Source +,22.2 -,40 +,17.84 CBD 0434 Brandenburg WADOH Salmonella +,18.18 -,40 +,16.38 CBD 0435 Westhampton WADOH Salmonella +,24.1 -,40 +,25.22 CBD 0436 Paratyphi A WADOH Salmonella +,17.47 -,40 +,17.9 CBD 0437 Saintpaul WADOH Salmonella +,15.60 +,17.72 +,16.7 CBD 0438 Typhimurium WADOH Salmonella +,17.71 +,18.95 +,17.12 CBD 0439 Enteritidis WADOH Salmonella +,16.47 -,40 +,17.09 CBD 0440 Muenchen WADOH Salmonella +,14.98 -,40 +,18.51 CBD 0441 Muenchen WADOH Salmonella +,17.03 -,40 +,15.69 CBD 0442 Muenchen WADOH Salmonella +,18.34 -,40 +,18.19 CBD 0443 Hildgo WADOH Salmonella +,16.87 -,40 +,18.02 CBD 0444 Alamo WADOH Salmonella +,16.39 -,40 +,19.46 CBD 0445 Javiana WADOH Salmonella +,15.4 +,16.94 +,17.09 CBD 0446 Typhimurium WADOH Salmonella CBD 0569 Salmonella Alachua Turkey +,15.82 -,40 +,17.54 CBD 0570 Salmonella Anatum Turkey +,16.30 -,40 +,18.01 CBD 0571 Salmonella Newport Turkey +,15.29 -,40 +,17.48 CBD 0572 Salmonella Newport Turkey +,15.73 -,40 +,16.38 CBD 0573 Salmonella Istanbul Turkey +,17.31 -,40 +,16.68 CBD 0574 Salmonella Istanbul Turkey +,15.30 -,40 +,17.38 CBD 0575 Salmonella Istanbul Turkey +,17.11 -,40 +,16.40 CBD 0576 Salmonella Kentucky Turkey +,17.29 -,40 +,17.03 CBD 0577 Salmonella Kentucky Turkey +,17.63 -,40 +,17.10 CBD 0578 Salmonella Mbandaka Turkey +,17.06 -,40 +,16.61 CBD 0579 Salmonella Montevideo Turkey +,17.84 -,40 +,16.34 CBD 0580 Salmonella Muenster Turkey +,16.41 -,40 +,15.58 CBD 0581 Salmonella Muenster Turkey +,16.87 -,40 +,15.99 CBD 0582 Salmonella Reading Turkey +,16.95 -,40 +,27.96 CBD 0583 Salmonella Reading Turkey +,17.12 -,40 +,17.27 80

PAGE 95

sopB gene spvA gene ompF gene CBD # Genus Name Serotype/Subspecies Source CBD 0584 Salmonella Newport Turkey +,17.05 -,40 +,16.13 CBD 0585 Salmonella Newport Turkey +,17.19 -,40 +,16.68 CBD 0586 Salmonella Newport Turkey +,16.85 -,40 +,16.60 CBD 0587 Salmonella Newport Turkey +,16.67 -,40 +,16.70 CBD 0588 Salmonella Newport Turkey +,17.21 -,40 +,16.33 CBD 0589 Salmonella Newport Turkey +,16.90 -,40 +,16.77 CBD 0590 Salmonella Newport Turkey +,16.52 -,40 +,16.87 CBD 0591 Salmonella Newport Turkey +,16.88 -,40 +,16.79 CBD 0592 Salmonella Newport Turkey +,15.92 -,40 +,17.3 CBD 0593 Salmonella Newport Turkey +,16.17 -,40 +,16.96 CBD 0594 Salmonella Newport Turkey +,17.28 -,40 +,17.98 CBD 0595 Salmonella Newport Turkey +,15.96 -,40 +,18.23 CBD 0596 Salmonella Newport Turkey +,14.64 -,40 +,18.97 CBD 0597 Salmonella Newport Turkey +,16.00 -,40 +,18.19 CBD 0598 Salmonella Newport Turkey +,14.61 -,40 +,19.76 CBD 0599 Salmonella Typhimurium CDC +,16.15 +,16.90 +,18.39 CBD 0600 Salmonella Typhimurium CDC +,15.98 -,40 +,16.2 CBD 0603 Salmonella Javiana FLDOH +,15.33 -,40 +,22.15 CBD 0604 Salmonella Newport FLDOH +,15.32 -,37.95 +,17.34 CBD 0746 Salmonella Typhimurium FLDOH +,15.62 +,16.07 +,17.98 -,40 -,40 +,16.92 CBD 0747 FLDOH Salmonella IV 50:z4,z23:-CBD 0757 Salmonella Typhimurium FLDOH +,15.48 +,17.20 +,16.85 CBD 0759 Salmonella Newport FLDOH +,14.89 -,40 +,15.90 CBD 0775 Salmonella Typhimurium FLDOH +,15.79 +,17.26 +,16.78 CBD 0776 Salmonella Sandiego FLDOH +,16.15 -,40 +,16.13 CBD 0777 Salmonella Typhimurium FLDOH +,15.72 +,16.92 +,16.88 CBD 0778 Salmonella Typhimurium FLDOH +,16.31 +,17.57 +,17.13 CBD 0779 Salmonella Enteritidis FLDOH +,15.41 +,17.01 +,16.24 81

PAGE 96

sopB gene spvA gene ompF gene CBD # Genus Name Serotype/Subspecies Source +,35.5 -,40 +,16.45 CBD 0780 FLDOH Salmonella IV 50:z4,z23:-CBD 0781 Salmonella Enteritidis FLDOH +,15.73 -,40 +,16.57 CBD 0782 Salmonella Stanley FLDOH +,15.89 -,37.81 +,16.99 CBD 0805 Salmonella Berta FLDOH +,16.28 -,40 +,16.47 CBD 0806 Salmonella Species FLDOH +,16.17 -,40 +,16.87 CBD 0807 Salmonella Javiana FLDOH +,15.70 -,40 +,20.12 CBD 0808 Salmonella Muenchen FLDOH +,16.53 -,40 +,17.33 CBD 0809 Salmonella Muenchen FLDOH +,16.14 -,40 +,18.36 CBD 0810 Salmonella Heildelberg FLDOH +,16.25 -,40 +,17.13 +,15.73 +,14.95 +,15.99 CBD 0811 FLDOH Salmonella I 4,12:i:-CBD 0813 Salmonella Javiana FLDOH +,16.32 -,40 +,21.95 CBD 0814 Salmonella Anatum FLDOH +,16.04 -,40 +,16.52 CBD 0815 Salmonella Newport FLDOH +,16.67 -,40 +,17.15 CBD 0816 Salmonella Typhimurium FLDOH +,16.16 +,16.63 +,17.05 CBD 0817 Salmonella Typhimurium FLDOH +,16.51 +,16.34 +,16.83 CBD 0818 Salmonella Enteritidis FLDOH +,15.63 +,14.85 +,15.88 CBD 0819 Salmonella Javiana FLDOH +,18.58 -,40 +,20.33 CBD 0820 Salmonella Typhimurium FLDOH +,16.93 -,40 +,17.24 CBD 0821 Salmonella Sandiego FLDOH +,19.72 -,40 +,16.31 CBD 0822 Salmonella Species FLDOH +,17.5 -,40 +,17.08 CBD 0823 Salmonella Typhimurium FLDOH +,19.41 +,20.54 +,16.89 CBD 0824 Salmonella Tallahasse FLDOH +,19.34 -,40 +,16.56 +,20.05 -,40 +,16.99 CBD 0825 Paratyphi A FLDOH Salmonella CBD 0826 Salmonella Javiana FLDOH +,19.2 -,40 +,20.61 CBD 0827 Salmonella Newport FLDOH +,17.46 -,40 +,16.49 CBD 0828 Salmonella Typhimurium FLDOH +,16.68 -,40 +,16.66 CBD 0829 Salmonella Newport FLDOH +,17.36 -,40 +,18.18 CBD 0830 Salmonella Javiana FLDOH +,17.44 -,40 +,22.90 82

PAGE 97

83 CBD # Genus Name Serotype/Subspecies Source sopB gene spvA gene ompF gene CBD 0831 Salmonella Muenchen FLDOH +,17.46 -,40 +,17.24 CBD 0832 Salmonella Enteritidis FLDOH +,17.13 +,22.62 +,18.13 CBD 0833 Salmonella IV 50:z4,z23 :FLDOH +,35.15 -,40 +,17.56 CBD 0052 Escherichia Coli ATCC -,40 -,40 -,40 CBD 0553 Citrobacter Freundii ATCC -,40 -,40 -,40 CBD 0554 Proteus Mirabilis ATCC -,40 -,40 -,40 CBD 0006 Bacillus Cereus ATCC -,40 -,40 -,40 CBD 0009 Listeria Monocytogenes ATCC -,40 -,40 -,40 CBD 0002 Shigella Sonnei ATCC -,40 -,40 -,40 Mean C T values from two reactions of the isolates tested for the three primers targeting the genes, Salmonella outer protein ( sopB ), Salmonella virulence plasmid (spvA ) and outer membrane porin ( ompF ). The serotype names and sources are indicated. Indicates a negative re action and + indicates a positive PCR reaction. Dark gray cells for sopB and ompF genes specify a negative reaction; light gray cells for spvA gene indicate a positive reaction.

PAGE 98

Detection and Isolation of Salmonella species from Artificially Contaminated Food Samples Detection of Salmonella species Eight ready to eat food groups shown in Table 7 were artificially seeded with low spike (1-10 CFU of S. Typhimurium or S. Enteritidis) or mixed spiked (1-10 CFU of Salmonella species along with 5-200 CFU E. coli Proteus mirabilis and Citrobacter freundii ) as shown in Figure 2. The DNA was ex tracted after enrichment in BPW and BPW + TT broths and tested using real time PCR with primers targeting the ompF gene. The consolidated results of the PCR for the low spiked foods are s hown in Table 11 and Figure 6 and the raw data is given in the Appendix (Table A1). For sushi, mayonnaise and orange juice enrichment in BPW resulted in 100% positive results, whereas for hamburger and chicken cuts further enri chment in TT broth provided 100% positive results. None of the enrichments were 100% successful for egg salad or cheese. None of the unspiked food samples gave a positive si gnal. Overall, 19/25 reactions were positive after BPW enrichment and 18/25 were positive after BPW and TT broth enrichment showing that further enrichment in TT broth did not provide any significantly additional benefit for the detection of Salmonella species by real time PCR (P=0.5). 84

PAGE 99

Table 11. Real time PCR Results-Low Spiked No. Of positive Reactions Food (Low Spike) No. Of Reactions Broth BPW 2 Chicken Cuts 3 BPW+TT 3 BPW 3 Egg Salad 4 BPW+TT 3 BPW 2 Hamburger Meat 3 BPW+TT 3 BPW 3 Sushi 3 BPW+TT 2 BPW 2 Cheese 5 BPW+TT 3 BPW 3 Mayo 3 BPW+TT 1 BPW 3 Orange Juice 3 BPW+TT 2 BPW 1 Blueberries 1 BPW+TT 1 Real time PCR results of food samples artif icially inoculated w ith 1-10 CFU of S. Enteritidis or S. Typhimurium. The total number of experiments carried out and the number of positive reactions are shown. BP W= 6 h enrichment in buffered peptone water, BPW+TT= 6 h enrichment in BPW a nd 4 h enrichment in tetrathionate broth 85

PAGE 100

Figure 6. Real time PCR Results-Low Spiked Percentage of Positive Reactions for Low Spike67% 100% 75%75% 67% 100%100% 67% 40% 60% 100% 33% 100% 67% 100%100% 34335331 Chicken CutsEgg SaladHamburger Meat Sushi Cheese MayoOrange JuiceBlueberries BPW BPW+T Real time PCR results of food samples artif icially inoculated w ith 1-10 CFU of S. Enteritidis or S. Typhimurium. The total number of experiments performed is shown on the X-axis and the percentage of positive reactions is indicated on the top of the bars for each food group. BPW= 6 h enrichment in buffered peptone water, BPW+TT= 6 h enrichment in BPW and 4 h enri chment in tetr athionate broth The results for the mixed spiked food samples are represented in Table 12 and Figure 7. Enrichment with BPW as well BPW and TT brot hs gave 100% positive results for foods including chicken cuts, blue berries and hamburger. BPW and TT enrichment was better than BPW for egg salad and BPW was slightly better than BPW and TT enrichment for the foods including cheese and mayonnaise. On ly one test was carried out on the mixed spiked sample of sushi, and it did not provi de a positive result. On the whole, 15/20 86

PAGE 101

(75%) reactions were positive with BPW enrichment and 13/30 (65%) reactions were positive when the samples were further enriched in TT broth. These results again demonstrate that further enrichment in TT broth did not significantly increase the sensitivity (P=0.4) Table 12. Real time PCR Results-Mixed Spiked Food (Mixed Spike) No. Of Reactions Broth No. Of +Ve Reactions BPW 2 Chicken Cuts 2 BPW+TT 2 BPW 1 Egg Salad 2 BPW+TT 2 BPW 3 Hamburger Meat 3 BPW+TT 3 BPW 0 Sushi 1 BPW+TT 0 BPW 4 Cheese 5 BPW+TT 2 BPW 2 Mayo 3 BPW+TT 1 BPW 2 Orange Juice 3 BPW+TT 2 BPW 1 Blueberries 1 BPW+TT 1 Real time PCR results of food samples artif icially inoculated w ith 1-10 CFU of S. Enteritidis or S. Typhimurium along with E. coli, Proteus mirabilis and Citrobacter freundii The total number of experiments carried out and the number of positive reactions are shown. BPW= 6 h enrichment in buffered peptone water, BPW+TT= 6 h enrichment in BPW and 4 h enrichment in tetrathionate broth. 87

PAGE 102

Figure 7. Real time PCR Results-Mixed Spiked Percentage of Positive Reactions for Mixed Spike100%100% 50% 100%100%100% 0%0% 80% 40% 67% 33% 67%67% 100%100% 22315331 Chicken CutsEgg SaladHamburger Meat Sushi Cheese MayoOrange JuiceBlueberries BPW BPW+T Detection results of food samples mixed spiked with 1-10 CFU of S. Enteritidis or S. Typhimurium along with E. coli, Proteus mirabilis and Citrobacter freundii. The total number of experiments performed is shown on the X-axis and the percentage of positive reactions is indicated on the t op of the bars for each food group. BPW= 6 h enrichment in buffered peptone water, BPW+TT= 6 h enri chment in BPW and 4 h enrichment in tetrathionate broth 88

PAGE 103

Isolation of Salmonella species Ready to eat foods that were artificially seeded with Salmonella species were subjected to general enrichment in BPW and selectiv e enrichment as shown in Figure 2. The purification or selective enrichment was ca rried out by IMS and TT broth respectively to compare the two techniques. The foods were low spiked, mixed spiked or unspiked and enriched in BPW, BPW+IM S and BPW+TT. One hundred l of BPW and BPW+TT enriched samples were inoculated in both XLD and TSA plates. For the BPW+IMS technique, 50 l of the final product was plated onto TSA and XLD agar plates. The mean results of repeat isolat ion experiments are represented in Table 13 and the raw data, including each spiking amount and isolation resu lts is shown in the appendix (Table A1). The colony count on the XLD agar was us ed for analysis. To compensate for the difference in the final amounts of BPW+IMS (50 l) and the two broths (100 l) plated on the XLD agar, half the number of coloni es isolated after enriching in BPW and BPW+TT broth were considered for analysis. Figure 8a shows an example of isolation of Salmonella from unspiked, low spiked and mixed spiked foods after BPW+IMS enrich ment. The negative control, which was unspiked, had very little background flor a on TSA agar and almost none on the XLD agar. The low spiked XLD plate predominantly showed the presence of Salmonella species, whereas the mixed spiked had few colonies, possibly E. coli or Citrobacter freundii The black colonies of Salmonella species were easily distinguishable from the 89

PAGE 104

yellowish ones on the XLD plate. A comparis on of the three isolation techniques, after general enrichment in BPW and selective enri chments in TT broth and IMS is depicted in Figure 8b. No colonies were seen in the uns piked chicken cuts using any of the three enrichments on the XLD plates. The low spiked food samples had colonies using the three enrichment technique s. The highest number of Salmonella was seen in the mixed spiked sample using th e IMS technique with no E. coli or Citrobacter contamination. However, possible E. coli and Citrobacter species were seen in the mixed spiked samples after the BPW enrichment as well as the BP W+TT enrichment. This data suggests that IMS technique might offer a cleaner sample of Salmonella species in mixed cultures compared to TT broth. Figure 8. Isolation of Salmonella on Selective Plates Figure 8a Unspiked Low Spiked Mixed Spiked 90

PAGE 105

Isolation results of unspi ked, low spiked (1-10, Salmonella species) and mixed spiked ( Salmonella species with E. coli Citrobacter and Proteus ) from chicken cuts, after selective enrichment in buffered peptone water and immunomagnetic separation on trypticase soy agar and xylose lysine des oxycholate (XLD) agar. Black colonies on XLD agar represent Salmonella species; yellow colonies are possible E. coli or Citrobacter species. Figure 8b Unspiked Low spiked Mixed s p iked BPW BPW+IMS BPW+TT Isolation of Salmonella species from low spiked and mixed spiked chicken cuts with Buffered Peptone Water (BPW), imm unomagnetic separation (BPW+IMS) and 91

PAGE 106

tetrathionate broth (BPW+TT) enrichments on xylose lysine desoxycholate (XLD) agar. Black colonies represent Salmonella species. Table 13 and Figure 9 show the mean data of repeat tests fo r the isolation of Salmonella species from low and mixed foods after six hour general enrichment and selective enrichments. The raw data with results from each experiment is in the Appendix (Table A1). The unspiked samples were consistantly negative for Salmonella and therefore are not shown in the table or the graph. The numb er of colonies isolated after selective enrichment in IMS was greater than the genera l enrichment in BPW for all the low spiked food samples except cheese. However, further enrichment in TT broth for four hours did not improve isolation over the general enrichme nt for most of the low spiked foods. For cheese, all the rapid enrichment technique s provided poor recovery. An overnight incubation in BPW was required for cheese to obtain any growth on the plates. Overall, isolation by BPW+IMS was significantly better than BPW (P=0.02) and BPW+TT (P=0.01) for the food samples that were spiked with low levels of Salmonella Enrichment in BPW provided better recove ry compared to BPW+TT (P=0.03) for the low spiked samples. The isolation data for low spiked food clearly shows that BPW+IMS is the best technique compared to the gene ral enrichment in BPW or the selective TT broth enrichment. 92

PAGE 107

For mixed spiked food samples, again for mo st food types, BPW+IMS was better than the other two methods. For foods including chicken cuts, egg salad and mayonnaise BPW provided better recovery than BPW+TT and th e converse is true for the other foods. Although BPW+IMS technique facili tated the isolation of more Salmonella colonies compared to BPW+TT, the difference between the two techniques for mixed spiked food samples is not significantly different (P= 0.95). However, isolation results of BPW+IMS are significantly different compared to BPW en richment (P=0.01). On the whole, it is not surprising that both BPW+IMS and BP W+TT improved the isolation of Salmonella species from mixed cultures compared to th e general enrichment. In general BPW+IMS is the best technique for both the low and the mixed spiked food groups. 93

PAGE 108

Table 13. Isolation of Salmonella from 25 gm of Spiked Food Food(25gm)Sample Background (CFU/gm) Mean CFU BPW Mean CFU BPW+IMS Mean CFU BPW+TT # of Expts. Low Spiked 15 30 170 8 3 Mixed Spiked 66 230 282 Low Spiked 500 28 80 9.53 Mixed Spiked 45 99 20.52 Low Spiked 5050 46.5227 213 Mixed Spiked 68 165 1023 Low Spiked 100 22.5 28 143 Mixed Spiked 9 5 22.51 Low Spiked 420 15.5 98 21.55 Mixed Spiked 6.5 79 862 Low Spiked 2550 0.1 0 0 4 Mixed Spiked 020 Low Spiked 2550TNTCTNTCTNTC1 Mixed Spiked 03 1T N T C Low Spiked <10 58 11525.53 Mixed Spiked 92 25583.53 Low Spiked 0 6.5 39 4.53 Mixed Spiked 9.5 21 10.53 Orange Juice Blueberries Cheese Cheese O/N Mayonnaise Chicken Cuts Egg Salad Hamburger Sushi 4 1 Isolation of Salmonella from 25 gm of food samples lo w spiked or mixed spiked and enriched in buffered peptone water (BPW), BPW+IMS (immunomagnetic separation) or BPW+TT (tetrathionate broth). The background flora of each food group is indicated. The mean colony count on xylose lysine desoxy cholate (XLD) agar from repeat tests is shown. TNTC=too numerous to count. 94

PAGE 109

Figure 9. Isolation of Salmonella from 25 gm of spiked food Food Isolation0 50 100 150 200 250 300 350 400 450 500Low Spiked Mixed Spiked Low Spiked Mixed Spiked Low Spiked Mixed Spiked Low Spiked Mixed Spiked Low Spiked Mixed Spiked Low Spiked Mixed Spiked Low Spiked Mixed Spiked Low Spiked Mixed Spiked Low Spiked Mixed Spiked Chicken Cuts Egg SaladHamburgerSushiBlueberriesCheeseCheese O/N MayonnaiseOrange Juice Food SamplesNo. of CFU Mean CFU BPW Mean CFU BPW+IMS Mean CFU BPW+TT Isolation of Salmonella from food samples enriched in buffered peptone water (BPW), BPW+IMS (immunomagnetic separation) or BP W+TT (tetrathionate broth). The mean colony count on xylose lysine desoxycholate (XLD) agar from repeat tests is shown. For the graph, too numerous to count colonies were represented as 500 95

PAGE 110

Application of Colonies Isol ated from Food for Typing a nd Antibiotic Susceptibility Testing Salmonella colonies isolated on XLD agar after ge neral enrichment in BPW and selective enrichment in IMS and TT broth were subtyped by PFGE, ribotyping and antibiotic susceptibility profiles. S. Typhimurium with which the food samples were originally spiked was used as a positive control and was grown on a TSA plate. The organism isolated after the enrichments had identical ribotype, PFGE and antibiotic susceptibility patterns as the control (Figur e 10, Table 14). This shows that pure culture was achieved after the enrichments and there was no possibl e contamination. These results demonstrate that Salmonella colonies isolated from the selective XLD agar can be used to subtyping pure culture from a TSA plate is not required. Figure 10. Molecular Typing on Salmonella Isolated from Food 10a. 10b. M + B M BI BT M M + B M BI BT M M + B BI M + B BI 96

PAGE 111

97 Application of S. Typhimurium isolated fr om intentionally contaminated food after general and selective enrichment for molecu lar typing. The colonies isolated on xylose lysine desoxycholate (XLD) agar were us ed for typing. 10a. Ribotyping, 10b. Pulsed field gel electrophoresis; M=molecular weight standard, + = positive control, B=buffered peptone water, BI=B + immunomagnetic separation, BT=B + tetrathionate broth enrichment

PAGE 112

98 Table 14. Antibiotic Sus ceptibility Testing of Salmonella Isolated from Spiked Food AMI A/S AZT FEP FOP FOT TAZ AXO CH CIP G IMI LEVO LOM PIP P/T FIS TET TIC TIM TOB SXT + 4 S 2 S 2 S 2 S 4 S 4 S 1 S 4 S 4 S .25S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S B 4 S 2 S 2 S 2 S 4 S 4 S 1 S 4 S 4 S .25S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S BI 4 S 2 S 2 S 2 S 4 S 4 S 1 S 4 S 4 S .25S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S BT 4 S 2 S 2 S 2 S 4 S 4 S 1 S 4 S 4 S .25S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S Antibiotic susceptibility testing of S. T yphimurium isolated from artificially contamin ated food samples. AMIamikacin, A/Sampicillin/sublactum, AZTaztreonam, FE Pcefepime, FOPcefoperazone, FOTcefotaxime, TAZ-ceftazidime, AXOceftriaxone, CHchloramphenicol, CIPciprofloxacin, Ggentamicin, IMIimipenem, LEVOlevofloxacin, LOMElomefloxacin, PIPpiperacillin, P/Tpipe racillin/tazobactum, FISsulfizoxazole, TETtetracycline, TICticarcillin, TIMticarcillin/ clavulanic acid, TOBtobr amycin, SXTtrimethoprim/sulphamethoxazole. + = Positive control, B=buffered peptone water, BI=B + immunomagnetic separation, BT=B + tetr athionate broth enrich ment, S= susceptible

PAGE 113

rDNA Analysis by Automated RiboPrinter The 100 wild type Salmonella isolates and the controls strains were subjected to rDNA analysis by automated ri botyping with the enzyme Eco RI. The results were analyzed by using BioNumerics software. Figure 11a shows an example of the TIFF image obtained after the automated ribotyping. The result s are obtained in eight hours and the RiboPrinter identifies strains based on the ribot ype patterns of the organisms in its database (Figure 11b). The first strain (S. Choleraesuis) in Figure 11b was placed in a group of five with 86% similar ity, which included S. Choleraesuis. The third strain (S. Typhimurium) was placed in a group of 55 with 96% similarity, which also consisted of S. Typhimurium. The fourth strain (unknown) was put in a group of 12 with 90% similarity. The sixth strain (S. Derby) was pla ced in a group of 3 with 90% similarity that included S. Derby. The fifth strain was id entified correctly as S. Newport. The RiboPrinter database did not identify the sec ond and eighth strains (unknown). The seventh strain CBD 32 was identified as Salmonella enterica serotype Give; however this identification was incorrect based on biochemica l and serological results. Out of the eight strains analyzed, the RiboPrinter correctly identified six as Salmonella species of which, S. Newport was correctly recognized at the sero type level. Two of the eight isolates were not grouped as Salmonella species, possibly due to the absence of these types in its database. One of the serotypes (CBD 32, S. Ni ma) was mistakenly identified as S. Give. These results show that the resu lts analyzed by the RiboPrinter may be correct at the species level for Salmonella but not always at the serotype level which is expected because the criteria used by the ribotyping and the serotyping are different. Serotyping 99

PAGE 114

analyses the serological properties of the organism and ribotyping analyzes the rRNA operons, hence a correlation although possible is not always expected. Therefore, analysis and comparison of the fingerprints by crea ting a separate database is suggested. Figure 11. Ribotyping of Salmonella 11a. M 1 2 M 3 4 M 5 6 M 7 8 M Ribotyping of Salmonella species by automated RiboPrinter 1= CBD 25, S. Choleraesuis; 2=CBD 26, S. arizonae ; 3= CBD 28, S. Typhimu rium; 4= CBD 29, S. species; 5= CBD 30, S. Newport; 6= CBD 31, S. Derby; 7= CBD 32, S. species; 8=CBD 33, S. species, M= Molecular weight standard 100

PAGE 115

Figure 11b Identification of unknown Salmonella serotypes by the RiboPrinter after auto normalization. Samples 1, 3, 4, 6 were placed in groups AE, AA, AB and AF respectively by the RiboPrinter Samples 5 and 6 were identifie d as S. Newport and S. Give; samples 2 and 8 were not identified. DNA Fingerprinting by Macrorestriction Digestion (PFGE) The 100 wild type isolates were subtyped by PFGE with two enzymes, XbaI and Spe I, and were analyzed using BioNumerics software. An example of a PFGE gel containing samples digested with Xba I is shown in Figure 12. Four sta ndards were run with each gel for normalization. The four environmental S. Newport isolates in lanes 1-4 are identical whereas the clinical S. Newport in lane 10 is slightly different (Figure 12). It is also clear that the unknown Salmonella serotype (CDC isolate sent for PulseNet certification) in lane eight has an identical pattern to the mo lecular weight standard S. Braenderup. The two isolates in lanes six and seven have completely differe nt PFGE profiles although they are both of the same serotype (Typhimurium ). These results indicate that typing by 101

PAGE 116

PFGE can be used for identification of an isol ate if the strain is already present in the database. It is also clear that two isolates belonging to one se rotype can have an identical pattern or very different profiles. It is im portant to know the perc ent relatedness of the isolates belonging to the same serotype to asse ss its clonality in the event of an outbreak; therefore visual observation of the frag ments in the gel is not sufficient. Figure 12. PFGE of Salmonella with XbaI M 1 2 3 M 4 5 6 7 M 8 9 10 11 M 1135 Kb 668.9 Kb 452.7 Kb 336.5 Kb 173.4 Kb 54.7 Kb M 1 2 3 M 4 5 6 7 M 8 9 10 11 M 1135 Kb 668.9 Kb 452.7 Kb 336.5 Kb 173.4 Kb 54.7 Kb Analysis of Salmonella species by macrores triction profiling by XbaI. Lane 1= CBD 595 (S. Newport), lane 2= CBD 596 (S. Newport) lane 3= CBD 597 (S. Newport), lane 4= CBD 598 (S. Newport), lane 5= CBD 599 (S. Typhimurium), lane 6= CBD 600 (S. Typhimurium), lane 7= CBD 601 (S. species), lane 8= CBD 602 (S. species), lane 9= CBD 603 (S. Javiana), lane 10= CBD 604 (S Newport), lane 11= CBD 31 (S. Derby), 102

PAGE 117

M= molecular weight standard (CDC H 9812, S. Braenderup). The molecular weights of the bands are shown in Kb Identification of Unknown Salmonella Serotypes by Molecular Typing The rDNA and PFGE fingerpri nt database of known Salmonella serotypes created by using the BioNumerics software was used to identify the unknown Salmonella samples obtained from FLDOH. The unknow n isolates were eventually serotyped by Bureau of Laboratories, Jacksonville, FL. but the molecula r typing database was validated for initial identification. The results of ribotyping database for identification of selected unknown isolates are shown in Figure 13a and Table 15. By using the ribotyping and the PFGE database, isolates 213, 604, 759, 827 and 67 were identified as S. Newport (Figure 13b). Ribotyping gave a very close relatedness of 90 to 100%. Whereas; by PFGE, the isolates were related by 65% to S. Newport. Isolates 832, 781, 779 and 818 showed a very close similarity of more than 80% to S. En teritidis using both the ribotyping and PFGE database. All the S. Typhimurium isolates form ed a close cluster of 90 to 100% similarity with the ribotyping. However, the PFGE analys is separated the S. Typhimurium isolates into three clusters at 55 to 80% relatedness. Th e S. Javiana isolates formed a cluster with the known S. Javiana in the database with PFG E. However, they did not show any close similarity with the ribotyping database. Thes e results suggest that ribotyping patterns show a closer relatedness among serotypes, whic h could be used for in itial identif ication. PFGE patterns among serotypes sh ow more diversity and may not be appropriate for initial identification of the serotype. The re sults of both the typing techniques depend on 103

PAGE 118

the serotype as well. For example, S. Enteriti dis isolates showed very high similarity to the known S. Enteritidis strain using both the PFGE as well ribotyping. For S. Javiana, PFGE was better in identifying the serotype co mpared to the ribotyping database. These results also suggest that it is important to rely on two or more techniques for strain typing. 104

PAGE 119

Figure 13. Identification of Unknow n Salmonella by Molecular Typing Figure 13a 60 65 70 75 80 85 90 95 100 105

PAGE 120

Application of ribotyping databa se for identification of unknown Salmonella serotypes received from Florida department of health (FLDOH). The unknown isolates are compared to known serotypes obtained fr om Washington department of health (WADOH) or American Type Culture Collec tion (ATCC), Centers for Disease Control and Prevention (CDC) or envir onmental isolates from turkey carcasses. The numbers above the dendrogram represent the percent rela tedness, the red blocks indicate that the serotype is known. 106

PAGE 121

Figure 13b 40 50 60 70 80 90 100 107

PAGE 122

Application of PFGE database for identification of unknown Salmonella serotypes received from Florida department of health (FLDOH). The unknown isolates are compared to known serotypes obtained fr om Washington Department of Health (WADOH) or American Type Culture Collec tion (ATCC), Centers for Disease Control and Prevention (CDC) or envir onmental isolates from turkey carcasses. The numbers above the dendrogram represent the percent rela tedness, the red blocks indicate that the serotype is known. Table 15. Identific ation of Unknown Salmonella serotypes by Molecular Typing Isolate Numbers % Similarity by Ribotyping % Similarity by PFGE Final Id by Serotyping 213, 604, 759, 827, 829, 67 90-100% to S. Newport 65% to S. Newport S. Newport 832, 781, 779, 818 90-100% to S. Enteritidis 80-95% to S. Enteritidis S. Enteritidis 746, 823, 777 90% to S. Typhimurium 72% to S. Typhimurium S. Typhimurium 817, 828, 820, 757, 775, 778 90-100% to S. Typhimurium 55-80% to S. Typhimurium S. Typhimurium 830, 807, 819, 603, 826, 69, 222 Closest match, 60% to S. Typhimurium 60-60% to S. Javiana S. Javiana Comparison of ribotyping and PFGE patte rns of known serotypes with unknown Salmonella serotypes for initial identification. The percent similarity as shown in the dendrograms of Figure 12 is indicated and the final identification by serotyping is shown 108

PAGE 123

Discrimination of Salmonella Species by Molecular Typing and Antibiotic Susceptibility patterns The discriminatory ability of the two mol ecular typing techniques; PFGE and ribotyping, and the phenotypic method, antibiotic susceptibi lity profiling, was te sted on the 100 wild type isolates. The ribotyping results were analyzed by both manual analysis of the TIFF images as well as by importing images already normalized by the RiboPrinter For PFGE, patterns above 93% similarity were considered identical and for ribotyping, patterns that showed below 99.99% similarity were considered different based on molecular weight standard analysis of repeated gels. The results of the molecular weight standard analysis are shown in Figures 3a and 3b. For the 100 isolates, the ribotyping based on auto normalization generated 58 prof iles; whereas the manual analysis of the TIFF images obtained from the ribotypi ng produce 62 ribotypes (data shown in Appendix, Figure A1). The major difference wa s seen in the serotype Newport; 12 types were produced by the manual analysis, wher eas only eight types were seen by the automated normalization for the 28 wild type isolates analyzed. Overall, PFGE typing produced 74 profiles using the XbaI enzyme (data shown in Appendix, Figure A2) and 70 pulsotypes with the Spe I enzyme. The 100 isolates were divided into 42 profiles based on the antibiograms (data shown in Appendix, Figure A3). These results clearly demonstrate that both of the molecular fingerprinting me thods were more discriminatory than the phenotypic typing method, for the set of isolates studied. 109

PAGE 124

To study the discriminatory ability and co rrelation between th e three techniques, ribotyping, PFGE and antibiotic susceptib ility profiles, a set of 30 isolates belonging to one serotype (S. Newport) was selected for an alysis. Twenty eight wild type isolates and two ATCC S. Newport strains were analyzed. When the ribotyping results were analyzed manually, three major clusters at 74% or more similarity were seen (Figure 14a). The three clusters were further divided in to 14 unique ribotypes. Based upon 99.9% similarity, with the exception of CBD 584, th e environmental isolates grouped into the largest cluster comprising 9 of the 14 ribotyp es, whereas the clinical isolates were dispersed among the three major clusters. Four clinical isolates, CBD 604, CBD 213, CBD 829 and CBD 759, showed 100% identity with the environmental isolates. When the fragment patterns were normalized by th e RiboPrinter software, ten ribotypes at 98% or less similarity were observed usi ng the BioNumerics so ftware (Figure 14b). These ten ribotypes are essentially similar to the manually analyzed data with some exceptions. The major difference between the automated and the manual analysis was seen among the environmental isolates. Thirteen isolates that showed 100% similarity using the automated analysis were divided into 8 ribotypes using the manual analysis. Using 93% similarity as the threshold, 14 PFGE pulsotypes were observed at 93% similarity with the enzyme XbaI (Figure 15a) for the 30 S. Ne wport isolates. Similarly, 14 subtypes were seen with the enzyme Spe I (15b). The environmental isolates formed one large cluster at 84% that could be furt her divided into 3 sub-groups and 4 pulsotypes with the enzyme XbaI. The 11 clinical isolates showed greater diversity, forming 8 pulsotypes with all of the isolates from WADOH forming one clus ter. The two ATCC 110

PAGE 125

control strains were of two distinct pulsotypes. The PFGE results between the two enzymes correlated well and similar grouping was observed with XbaI and Spe I (Figure 15a and 15b). Both PFGE and ribotyping furthe r resolved groups not differentiated by the corresponding method. For example, ribotype cluster 2 (Figure 14a) was further discriminated by PFGE into two groups, B and C (Figure 15a). Likewise, PFGE cluster A (Figure 15a) was further divided into clus ters 1 and 3 by ribotyping (Figure 14a). The clinical isolates from WADOH were iden tical by both ribotyping as well as PFGE. Cluster analysis of the antimicrobial suscep tibility results showed 23 distinct profiles. Isolates resistant or intermediately resistant to six or more antibiotics formed a separate cluster clearly distinguishable from the suscep tible or less resistant isolates (Figure 16). The clinical isolates from WADOH formed a cluster at 94% or more similarity. The environmental isolates were distributed among various clusters. This data shows that for the set of S. Newport isolates studied antibiograms were more discriminatory compared to the molecular typing techniques. No correlation among the mole cular typing patterns and the antibiotic susceptibility profiles wa s apparent for the 30 S. Newport isolates studied. Both susceptible and resistant isolat es were spread among the various clusters and were not clearly distinguished by the ribotyping or the PFGE. 111

PAGE 126

Figure 14. Ribotyping of S. Newport Figure 14a Dendrogram representing the ri botypes of the S. Newport isolates with the enzyme Eco RI using the manual analysis of RiboPrinter images. The isolate number, corresponding source and resistance pattern are shown. The re latedness among the isolates is depicted by percentage similarity. Cl uster 2 depicts the group that was further divided by PFGE with XbaI; Cluster 1 and 3 refer to the PFGE group A that was subdivided by the ribotyping. S=susceptible, 1 class=R or I to only one class of an tibiotic, MDR=Multidrug resistant to 2 or more classes of drugs 112

PAGE 127

Figure 14b Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]VCA 100 95 90 85 80 75 70 65 60 VCA CBD 588, S.Newport CBD 598, S.Newport CBD 571, S.Newport CBD 585, S.Newport CBD 586, S.Newport CBD 587, S.Newport CBD 589, S.Newport CBD 590, S.Newport CBD 591, S.Newport CBD 594, S.Newport CBD 595, S.Newport CBD 596, S.Newport CBD 597, S.Newport CBD 592, S.Newport CBD 213, S.Newport CBD 572, S.Newport CBD 584, S.Newport CBD 815,S.Newport CBD 593, S.Newport CBD 604, S.Newport CBD 759, S.Newport CBD 827, S.Newport CBD 829, S.Newport CBD 67, S.Newport CBD1058, S.Newport CBD 30, S.Newport CBD 425, S.Newport CBD 426, S.Newport CBD 427, S.Newport CBD 428, S.Newport Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Human FLDOH Turkey Carcasses Turkey Carcasses Human,FLDOH Turkey Carcasses Human,FLDOH Human,FLDOH Human,FLDOH Human,FLDOH Human FLDOH A TCC A TCC Human, WADOH Human, WADOH Human, WADOH Human, WADOH . . . . . . . . . . . . . . . MDR MDR MDR MDR MDR MDR 1 Class MDR MDR 1 Class 1 Class 1 Class MDR MDR 1 Class MDR MDR 1 Class MDR MDR S S S S S S MDR MDR MDR MDR Dendrogram of the ribotypes of the S. Newport isolates with the enzyme Eco R1 using the automated normalization. The isolate numbe r, corresponding sour ce and resistance pattern are shown. The relatedness among th e isolates is depicted by percentage similarity. S=susceptible, 1 class=R or I to only one class of antibiotic, MDR=Multidrug resistant to 2 or more classes of drugs 113

PAGE 128

Figure 15. PFGE of S. Newport Figure 15a Macrorestriction profiling of S. Ne wport isolates with the enzyme XbaI. The percentage similarity between various pulsotypes is shown. The isolate number and source is specified. Cluster A was further divided by ribotyping; Cluster B and C refer to the ribotyping group 2 that was s ubdivided by PFGE. S=susceptible, 1 class=R or I to only one class of antibiotic, MD R=Multidrug resistant to 2 or more classes of drugs. 114

PAGE 129

F igure 15b endrogram of the macrorestricti on profiling with the enzyme Spe I. The percentage Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]PFGE Spe-1 100 95 90 85 80 75 70 65 60 55 50 45 40 PFGE Spe-1 CBD 604, S.Newport CBD 759, S.Newport CBD 588, S.Newport CBD 597, S.Newport CBD 584, S.Newport CBD 585, S.Newport CBD 586, S.Newport CBD 587, S.Newport CBD 589, S.Newport CBD 590, S.Newport CBD 591, S.Newport CBD 572, S.Newport CBD 571, S.Newport CBD 595, S.Newport CBD 596, S.Newport CBD 598, S.Newport CBD 592, S.Newport CBD 593, S.Newport CBD 594, S.Newport CBD 829, S.Newport CBD 815,S.Newport CBD 67, S.Newport CBD 213, S.Newport CBD1058, S.Newport CBD 30, S.Newport CBD 425, S.Newport CBD 426, S.Newport CBD 427, S.Newport CBD 428, S.Newport CBD 827, S.Newport Human,FLDOH Human,FLDOH Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Human,FLDOH Human,FLDOH Human FLDOH Human FLDOH A TCC A TCC Human, WADOH Human, WADOH Human, WADOH Human, WADOH Human,FLDOH MDR S MDR MDR MDR MDR MDR MDR 1 Class MDR MDR MDR MDR 1 Class 1 Class MDR MDR MDR 1 Class S 1 Class S 1 Class S S MDR MDR MDR MDR S D similarity between various pulsotypes is shown. The isolate number and source is specified. S=susceptible, 1 class=R or I to only one class of an tibiotic, MDR=Multidrug resistant to 2 or more classes of drugs. 115

PAGE 130

F igure 16. Antibiotyping of S. Newport endrogram showing the percentage simila rity between isolates based on their Dice (> 50%MEAN)Antibiotic resistance 100 95 90 85 80 75 70 65 60 Antibiotic resistanceAMI AUG AMP FOX TIO AXO CEP CH CIP G K NAL STR SMX TET COT A/S AZT FEP FOP FOT TAZ IMI LEVO LOM PIP P/T FIS TIC TIM TOB CBD 213, S.Newport CBD 595, S.Newport CBD 815,S.Newport CBD 589, S.Newport CBD 594, S.Newport CBD 827, S.Newport CBD 829, S.Newport CBD1058, S.Newport CBD 30, S.Newport CBD 67, S.Newport CBD 759, S.Newport CBD 596, S.Newport CBD 571, S.Newport CBD 593, S.Newport CBD 572, S.Newport CBD 587, S.Newport CBD 597, S.Newport CBD 598, S.Newport CBD 591, S.Newport CBD 584, S.Newport CBD 592, S.Newport CBD 425, S.Newport CBD 428, S.Newport CBD 426, S.Newport CBD 427, S.Newport CBD 588, S.Newport CBD 590, S.Newport CBD 586, S.Newport CBD 585, S.Newport CBD 604, S.Newport Human FLDOH Turkey Carcasses Human,FLDOH Turkey Carcasses Turkey Carcasses Human,FLDOH Human,FLDOH A TCC A TCC Human FLDOH Human,FLDOH Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Human, WADOH Human, WADOH Human, WADOH Human, WADOH Turkey Carcasses Turkey Carcasses Turkey Carcasses Turkey Carcasses Human,FLDOH 1 Class 1 Class 1 Class 1 Class 1 Class S S S S S S 1 Class MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR MDR D susceptibilities to 31 different antibiotics or antibiotic combinations. Each cell indicates the minimum inhibitory concentration (M IC) of the corresponding antimicrobial. The darker the cell, the greater the MIC value th erefore the greater the resistance to that particular drug. S=susceptible, 1 class=R or I to only one cl ass of antibiotic, MDR=Multidrug Resistant to 2 or more classes of drugs. Ampicillin (Amp), piperacillin (Pip), ticarcillin (Tic), amoxicillin/clavulan ic acid (Aug), ampicillin/sublactum (A/S), piperacillin/tazobactum (P/T), ticarcillin/ clavulanic acid (Tim), amikacin (Ami), 116

PAGE 131

gentamicin (G), kanamycin (K), streptomycin (Str), tobramycin (Tob ), ceftriaxone (Axo), cephalothin (Cep), cefoxitin (Fox), ceftiofur (Tio), aztreonam (Azt), cefepime (Fep), cefoperazone (Fop), cefotaxime (Fot), cefta zidime (Taz), nalidixic acid (Nal), ciprofloxacin (Cip), levofloxacin (Levo), lomefloxacin (Lome), chloramphenicol (Ch), tetracycline (Tet), trimethoprim/sulfamethax azole (Cot), sulfam ethoxazole (Smx), sulfizoxazole (Fis), imipenem (Imi). Antibiotic Susceptibility Testing ental isolates and some of the ATCC control strains All the 100 clinical and environm were tested for susceptibility to 32 antibiotics using two pane ls. All the isolates showed R or I to carbenicillin in cluding the ATCC strains of Salmonella Therefore, carbenicillin was not considered for further analysis. A comp lete list of the MIC values for all the 100 isolates tested with both panels is in th e Appendix (Tables A2 and A3). Isolates that showed any resistance to one or more drugs are shown in Tables 16 and 17. Of the isolates comprising of clinical sources, 24/60 were R or I to at least one drug (Table 16). A high percent (83%) of isolates obtained from WADOH were R or I. Twenty nine percent of the clinical isolat es from FLDOH were R or I to one or more antimicrobials. Twenty out of the 24 (80%) clinical isolates showed multidrug resistance to two or more classes of drugs. The four S. New port isolates, CBD 425, 426, 427 and 428 from WADOH were R or I to 17 or more drugs. Th e five S. Typhimurium isolates CBD 438, 746, 777, 816 and 823 showed pentadrug resist ance to Amp, Ch, Str, Smx and Tet, which, is a characteristic of S. Typhimuriu m DT104. These isolates also were R or I to several other antibiotics in cluding Fop, Tob and Tim. Ou t of the 40 environmental 117

PAGE 132

isolates, 36 (90%) showed R or I to one or more antibiotics (Table 16). Seventy percent of the resistant environmental isolates from WADOH were multidrug resistant to 6 or more classes of drugs and 71% of resistant FLDOH were multidrug resistant to three or more classes of drugs. The two S. Muenchen isolates have the same antibiotic resistance profile. Of the isolates obtained from turkey carcasses, 96% were R or I to one or more drugs, 86% of which were multiply resistant to two or more classes of drugs. Overall, 60/100 isolates from both clinical and environm ental sources were R or I to at least one drug of which 52 were multi resistant to two or more classes of drugs. 118

PAGE 133

T able 16. Antibiotic Resistance of Clinical Salmonella Isolates ntibiotic resistance of clinical isolates, ChChloramphenicol, AugTobramycin, NalNalidixic acid 213, S.NewportCh425, S.NewportAugAmpFoxTioAxoCepChStrSmxTetA/SAztFopFotTazPipTicTim426, S.NewportAugAmpFoxTioAxoCepChStrSmxTetA/SAztFopFotTazPipP/TTicTim427, S.NewportAugAmpFoxTioAxoCepChStrSmxTetA/SAztFopFotTazPipTimTob428, S.NewportAugAmpFoxTioAxoCepChStrSmxTetA/SFopFotTazPiptTicTim433, S. arizonae AugAmpFoxTioAxoCepChStrSmxTetA/SFopTazPipTic434, S.BrandenburgAugAmpFoxTioCepChStrSmxTetTic436, S.Paratyphi ANal437, S.SaintpaulAugAmpCepGKSmxTetA/SFopP/TTicTimTob438, S.TyphimuriumAmpChStrSmxTetA/SFopPipTicTimTob439, S.EnteritidisChStrSmxTet603, S.Javiana AmpGKSmx604, S.NewportAmpGKSmx746, S.TyphimuriumA/SFopChGPipTetTicTim747, S. houtenaeAmpChStrSmxTet777, S.TyphimuriumAmpChStrSmxTetA/SFopPipTicTim810, S. HeildelbergCh815, S.NewportFoxCep816, S.TyphimuriumAugAmpChStrSmxTetA/SFopPipTicTim817, S.TyphimuriumA/S823, S.TyphimuriumAmpChStrSmxTetA/SFopPipTicTim824, S.TallahasseeA/SFopChPipTetTicTim825, S.ParatyphiAmpChNalSmxTetA/SFopPipTicTim826, S.JavianaA/SFopChPipTetTicTim Isolate Antibiotic Resistance Profile A Amoxicillin/Clavulanic acid, AmpAmpicillin, FoxCefoxitin, TioCeftiofur, CepCephalothin, StrStreptomycin, SmxSulf amethoxazole, TetTetracycline, A/SAmpicillin/Sublactum, AztAztreonam, FopCefoperazone, FotCefotaxime, TazCeftazidime, PipPiperacillin, TicTicarcillin, TimTicarci llin, Clavulanic acid, Tob119

PAGE 134

Table 17. Antibiotic Resistance of Environmental Salmonella Isolates Isolate Antibiot ic Resistance Profile 429, S.OranienburgAugAmpFoxTioAxoCepChStrSmxTetA/SFopPipTicTim430, S.apapaAugAmpFoxTioCepChStrSmxTetA/SAxoTim431, S.SaintpaulAugAmpFoxTioAxoCepChStrSmxTetTim432, S.arizonae AugAmpFoxTioCepChStrSmxTet440, S.MuenchenA/SFopChGPipTetTicTimTob441, S.MuenchenA/SFopChGPipTetTicTimTob443, S.HildgoAmpChStrSmxTet569, S.AlachuaGSmxTetTob570, S.AnatumGSmxTetTob571, S.NewportGTetTob572, S.NewportGTetTob573, S.IstanbulStrTetGTob574, S.IstanbulStrTet575, S.IstanbulGStrSmxTet576, S.KentuckyTet577, S.KentuckyStrTet579, S.MontvideoGKStrTob580, S.MuensterAmpChGKStrSmxTetA/SPipTicTim581, S.MuensterAmpGStrSmxTetA/SGPipTicTim582, S.ReadingAmpChGKStrSmxTetA/SPipTicTob583, S.ReadingChGStrSmxTetA/SGPipTicTob584, S.NewportA/SGPipTetTicTob585, S.NewportGImi586, S.NewportGSmxTet587, S.NewportGTet588, S.NewportGTet589, S.NewportTet590, S.NewportStrSmxTet591, S.NewportAugAmpStrSmxA/SFopPipP/TTicTim592, S.NewportStrSmxTetA/SPiTicTim593, S.NewportStrGTetTob594, S.NewportAmpTet595, S.NewportCh596, S.NewportCh597, S.NewportAmpCepGKStrSmxA/SFopPipTicTim598, S.NewportAmpCepGKNalStrSmxA/SFopPipTicTim 120

PAGE 135

Antibiotic resistance of environmental isolates, ChChloramphenicol, AugAmoxicillin/Clavulanic acid, AmpAmpicilli n, FoxCefoxitin, TioCeftiofur, CepCephalothin, StrStreptomycin, SmxSulfamethoxazole, TetTetracycline, A/SAmpicillin/Sublactum, AztAztreonam, FopCefoperazone, FotCefotaxime, TazCeftazidime, PipPiperacillin, TicTicarcillin, TimTicarcillin, Clavulanic acid, TobTobramycin, NalNalidixic acid, GGe ntamicin, KKanamycin, ImiImipenem Resistance Determinants PCR was carried out with primers targeting the entire integron on all the isolates were R or I to at least one drug. The negative controls were two susceptible isolates CBD 28 and CBD 30. Twelve out of the 100 isolates s howed the presence of class-1 integrons. Eleven of the 52 multidrug resistant strains clearly showed the presence of integrons, as shown in Figure 16. The twelfth isolate, S. Paratyphi (CBD 436), which was not MDR, had a 1.6 Kb integron (data not shown). The five S. Typhi CBD 438, 746, 777, 816 and 823 showed the pres ence of two integrons (1.0 Kb and 1.2 Kb) that is a charact eristic feature of S. Typhimurium DT104 (Figure 17). S. Muenster and S. Reading had a 1 Kb fragment and a small 750 bp fragment. The two S. Newport isolates had one fragment of 1 Kb size. On the whole f our integrons prof fragments at 1.0 Kb and 1.2 Kb; 1.0 Kb and 0.75 Kb; 1 Kb; 1.6 Kb were observed among the 12 isolates. The negative controls did not show an amplification product. The other isolates when tested with PCR with primers directed against the 5 CS and 3CS of the that class-1 murium isolates iles with 121

PAGE 136

in tegrons showed multiple non specific bands or no bands at all (data not shown). These esults of the 11 outhern isolates were further tested with the class-1 integrase gene as a target; the r integrase genes PCR were similar to the integron PCR with multiple bands. The isolates in Figure 17 were considered for fu rther analysis by sequencing and S blotting. Figure 17. Integrons in Multidrug Resistant Isolates Amplification of integr ons of the MDR isolates. 438, 746, 777, 816, 823 belong to serotype Typhimurium. 580, 581S. Muenster, 583, 584 S. Reading, 597, 598 S. Newport. Mmolecular weight standard, NTCno template control M NTC 438 746 777 816 823 580 581 582583 597 598 M 1 Kb 1.2 Kb 1.2 Kb M NTC 438 746 777 816 823 580 581 582583 597 598 M 1 Kb 122

PAGE 137

Location of Integrons To determine if the integrons in the 11 isolat es are present on plasmids or chromosomes, plasmids were purified and the product was s ubjected to amplification by PCR targeting the integron. The results of the plasmid prep are shown in Figure 18. All the isolates had a plasmid at approximately 23.1 Kb. These plasmi ds were not linearize d, therefore it is ossible that there are supercoiled and relaxe d plasmids. On the whole, a total of five Figure 18. Plasmid Profiling of Integron Positive Isolates lasmids extracted from the 11 isolates in Figure 16 that had integrons. M=Molecular eight standard, lane 1=CBD 438, lane 2= CBD 746, lane 3= CBD 777, lane 4=CBD 16, lane 5= CBD 823, lane 6= CBD 580, lane 7= CBD 581, lane 8= CBD 582, lane 9= BD 583, lane 10= CBD 597, lane 11= CBD 598 p d ifferent plasmid profiles were noted. 23. 1 Kb M 1 2 3 4 5 6 7 8 9 10 11 P w 8 C 123

PAGE 138

The plasmid DNA was amplified by using primers directed against the entire integrons to identify the location of the integrons and th e results are shown in Figure 19. The plasmid prep of all the 11 isolates (data of CBD 581 not shown) was positive for the presence of integrons by PCR. These results suggest that the integrons are present on the plasmids of these isolates. However, to make sure that there is no possible chromosomal DNA contamination, real time PCR with the chromosomal marker gene, ompF was performed on the plasmid DNA. The results of the real time PCR were positive for all isolates, l DNA contamination in the plasmids extracted. Therefore the location of the integrons could not be conclusively determ demonstrating that there was a possible chromosoma ined based on these tests. 124

PAGE 139

F igure 19. Detection of Integrons in Plasmids 19a. 19b. M NTC 583 597 816 823 + M NTC 438 746 777 580 582 598 + PCR amplification of plasmid prep with int primers. The isolate numbers are given, NTC=no template control, + = po sitive c ontrol (chromosomal and plasmid DNA), M= olecular weight standard equencing of the Integrons The 1.0 Kb and 1.2 Kb fragments of the integr ons of the 11 isolates (Figure 17) were sequenced to identify the nature of the ge nes located inside the integrons. The 1.6 Kb fragment of CBD 436 was partially sequence d. Each band of each isolate was sequenced repeatedly and the consensus was compared with the NCBI database. The consolidated results of the BLAST match of the isolates are given in Tables 18 and 19. The complete sequence of each fragment is shown in the A ppendix (Figure A4). The 1.0 Kb band of all the S. Typhimurium isolates harbored the gene aadA2 conferring resistance to aminoglycosides including Str, G and K (Table 18). The 1.0 Kb integron of the M S 125

PAGE 140

environmental isolates S. Muenster, S. Read ing and S. Newport harbored genes including sul1 conferring resistance to sulfonamides. The 1.2 Kb band of the S. Typh gene pse1 encoding resistance to lactam showed 96% similarity to Salmonella en resistance to aminoglycosides. It is aadA2 gene, did not show R or I to a ny of the am aadA1 encoding resistance to aminoglycosides and imurium isolates showed the presence of ases (Table 19). The 1.6 Kb band of CBD 436 terica class-1 integron, aadA2 gene encoding interesting to note that CBD 436 though had inoglycosides tested. 126

PAGE 141

Table 18. Sequencing of 1.0 Kb Integron Fragments IsolateResistanceIntegron bands Number of bp Sequencing of the 1.0 Kb fragment of class -1 integron. The isolate names, source and their resistance patterns are shown. The act ual size of the integr on, the number of base pairs sequenced and their BLAST match is indicated. WADOH=Washington Department of Health, FLDOH= Florida Depart ment of Health. Amp=ampicillin, se q uencedS.Typhimurium, SFopPipTicTimTob integron a adA2 FLDOH to S.Typhimurium Class1 tegron aadA2 816, S. Typhimurium FLDOH AugAmpChStrSmxTe tA/SFopPipTicTim 1.0 Kb1.0Kb99% to S.Typhimurium Class1 integron aadA2 823, S. Typhimurium AmpChStrSmxTetA/ SfopPipTicTim 1.0 Kb1.0 Kb98% to S.Typhimurium Class1 integron aadA2 580, S.Muenster, Turke NCBI Blast results438, WADOH AmpChStrSmxTetA/ 1.0 Kb975bp98% to S.Typhimurium Class1 746, S.Typhimurium FLDOH A/SFopChGPipTetTi cTim 1.0 Kb1.0 Kb99% to S.Typhimurium Class1 integron a adA2 777, S.Typhimurium AmpChStrSmxTetA/ SFopPipTicTim 1.0Kb1.0Kb98% in 1.0Kb1.0Kb97% to S.Typhimurium integron aadA1 y farms AmpChGKStrSmxTet A/SPi s p TicTi m ul1 581, S.Muenster, Turkey farms AmpGStrSmxTetA/S PipTicTim 1.0Kb1.0bp98%to S.Infantis class1 integron aadA 1 582, S.Reading, Turkey farms AmpChGKStrSmxTet A/SPipTicTob 1.0Kb975 bp97%to S.Infantis class1 integron aadA1 583, S.Reading, Turkey farms ChGStrSmxTetA/SG PipTicTob 1.0Kb1.0 Kb99%to S.Infantis class1 integron aadA1 99% to S.Typhimurium sul1 gene 597, S.Newport, Turkey farms AmpCepGKStrSmxA /SFopPipTicTim 1.0Kb994bp98%to S.Infantis class1 integron aadA1 98% to S.Typhimurium sul1 gene 598, S.Newport, Turkey farms AmpCepGKNalStrSm xA/SFopPipTicTim 1.0Kb1.0 Kb98%to S.Infantis class1 integron aadA1 127

PAGE 142

Ch=chloramphenicol, Str= streptomycin, Sm x=sulfam ethoxizole, Tet= tetracycline, A/S= Sequencing of the 1.2 Kb and 1.6 fragment s of class-1 integron. The isolate names, source and their resistance patterns are shown. The actual size of the integron, the number of base pairs sequenced a nd their BLAST match is in dicated. WADOH=Washington Department of Health, FLDOH= Florida Department of Health. Amp=ampicillin, Ch=chloramphenicol, Str=st reptomycin, Smx=sulfamethoxi zole, Tet= tetracycline, ampicillin/ sublactum, Fop=cefoperazone, Pip=piperacillin, Tic= ticarcilllin, Tim= ticarcillin/clavulanic acid, G=gentamicin, K=Kanamycin, Aug=amoxicillin/clavulanic acid, Tob=tobramycin, Cep=cephalothin, Nal=nalidixic acid. aadA =aminoglycoside adenyl transferase, sul1 =sulfonamide resistance gene Table 19. Sequencing of 1.2 Kb, 1.6 Kb Integron Fragments IsolateResistanceIntegron Bands Number of bp Se q uenced NCBI Blast Results438, S. yphimurium FLDOH AmpChStrSmxTetA/ SFopPipTicTimTob1.2 Kb1.17 Kb97% to S.Typhimurium pse 1, lactamse gene, 95% to Salmonella integron dfr gene746, S.Typhimurium LDOHA/SFopChGPipTetTi cTim1.2 Kb1.2Kb98% to S.Typhimurium pse 1, lactamse gene777, S.Typhimurium LDOH AmpChStrSmxTetA/SF opPipTicTim 1.2Kb1.17Kb98% to S.Typhimurium pse 1, lactamse gene816, S. Typhimurium LDOH AugAmpChStrSmxTetA /SFopPipTicTim 1.2Kb1.2Kb98% to S.Typhimurium pse 1, lactamse gene823, S. yphoimurium, LDOH AmpChStrSmxTetA/Sfo pPipTicTim 1.2 Kb1.16 Kb98% to S.Typhimurium pse 1, lactamse gene436, S. ParatyphiA, WADOH Nal 1.6 Kb553 Kb96% to Salmonella enterica a adA2 gene TF F F T F 128

PAGE 143

A/S=ampicillin/ sublactum, Fop=cefoperazone Pip= piperacillin, Tic= ticarcilllin, Tim=ticarcillin/clavulanic acid, G=gentam icin, Aug=amoxicillin/clavulanic acid, Tob=tobramycin, Nal=nalidixic acid To see if the sequences of 1.0 Kb fragment s of all the S. Typhimurium isolates are entical, the sequences were aligned using MegAlign program of the DNAstar rag ment of all the five S. least seven differences including insertions/deletions of base pairs were seen in a small region (260 bp) shown in (Figure 21). id software. The results of the alignment of the 1.0 Kb f Typhimurium isolates is shown in Figure 20. A very high similarity is seen in the 1.0 Kb bands of all the S. Typhimurium isolates as indicated by the red bar of the alignment in the Figure 20. Likewise, the 1.2 Kb integron fragments of the S. Typhimurium strains were very similar (data not shown). When the 1.0 Kb sequences of the environmental isolates (CBD 580, 581, 582, 583, 597 and 598) were aligned, similar results were observed (data not shown). These results indi cate that all the 1.0 bands were similar between all the S. Typhimurium strains and between the environmental isolates. To see the difference between the 1.0 Kb integr on of S. Typhimurium, that harbored aadA2 gene and the 1.0 Kb integron of e nvironmental isolates that had aadA1 genes, all the 11 isolates were aligned. There were a number of differences betwee n the two genes. At 129

PAGE 144

Figure 20. Alignment of 1.0 Kb of Integrons of S. Typhimurium Alignment of the 1.0 Kb integron sequence of the 5 S. Typhimurium isolates. Sequence information from 1 bp to 840 bp is show n here. Sequences of CBD 438, 746, 777, 816 and 823 are represented here. BLAST analysis of the sequence show s 98% to 99% match to aadA 2 gene encoding resistance to aminogl ycosides. The red bar represents 100% identity of the sequences between isolates orange and green re gions represent lower similarity. 130

PAGE 145

Figure 21. Alignment of 1.0 Integrons of S. Typhimurium and Oth er Serotypes Alignment of 1.0 integron sequences of S. T yphimurium isolates with six environmental isolates including S. Muenster, S. Reading and S. Newport. Sequence information from 230 bp to 490 bp is represented. The 1.0 Kb integron of S. Typhimurium harbors aadA2 gene encoding resistance to am inoglycosides; 1.0 Kb integr on of the other isolates has aadA1 gene that also encodes resistance to aminoglycosides. Red bar indicates 100% identity between sequences and bl ue bar shows lower similarity. Others Typhimuri 131

PAGE 146

Association of Salmonella Pathogenicity Island ( SPI) Genes and Integrons The location of two islands, SPI-1 and SPIwas tested in the integron positive isolates. The five S. Typhimurium isolates have very milar macrorestriction profiling, excep t for CBD 777 (Figure 22a). The two S. uenster isolates: CBD 580 and 581 are iden tical (Figure 22b). Likewise, the two S. eading isolates (CBD 582, 583) and the two S. Newport strains (CBD 597, 598) showed entical PFGE profiles. The sitB gene, which is an iron trans porter gene that is important r the virulence of Salmonella species is part of SPI-1, and is located on the 668. 9 Kb agment of XbaI gel in S. Typhimurium and S. Read ing isolates (Figure 23a, 23b). The t operon is present on the 173 Kb fragment in S. Muenster isolates and on the 104 Kb agment in S. Newport isolates (Figure 23b). The sitB gene is absent in the negative ontrol Proteus mirabilis The magA gene, which is a magnesium transporter gene and is ted S. Reading and S. ewport are not clear in this gel. Based on these results it is clear that the integron of S. uenster (CBD 580) is present on the chromosome. Southern hybridization of PFG E gels was carried out to id entify the location of the SPI and the antibiotic resistance of the integrons 3 si M R id fo fr si fr c located in SPI-3 was seen on the 104 Kb fragment of Xba I digested DNA in all the isolates tested including serotypes Typhi murium, Muenster and Reading (Figure 24a, 24b). In S. Newport, however it was seen on the 173 Kb fragment (Figure 24b). The integrons in the S. Typhimurium isolates we re observed at a band lower than 33 Kb. In CBD 580 (S. Muenster) the integron wa s located at 167 Kb band of the XbaI digested DNA (Figure 25). The results of the other two serotypes tes N M 132

PAGE 147

Figure 22. PFGE Gel of Integron Positive Isolates Figure 22a Figure 22b Figure 22a Figure 22b XbaI digested PFGE of 11 integron positive isolates. 22a. 438, 746, 777, 816 and 823 = S. Typhimurium. 22b. 580, 581= S. Muenster, 582, 583= S. Reading, 597, 598= S. Newport, M= molecular weight standard M 580 581 582 583 597 598 1135 Kb 668.9 Kb 452.7 Kb 336.5 Kb 173.4 Kb 54.7 Kb M 438 746 777 816 823 133

PAGE 148

F igure 23. Southern Hybridization with sitB Probe Figure 23a Figure 23b M 438 746 777 668.9 Kb M 580 581 582 583 597 668.9 Kb 173.4 104 Kb Figure 23c cntrl + cntrl 134

PAGE 149

Southern blots of PFGE gel with sitB gene of Sa lmonella Pathogenicity Island 1 as a hybridized 3cdot blots, positive control= S. Typhimurium (CBD 746), Negative control= Proteus irabilis (CBD 554), M= molecular weight standard (S. Braenderup, CBD 321) igure 24. Southern Hybridization with magA Probe Figure 24a Figure 24b probe. The isolate numbers and the sizes of the fragments where the probe w ith the DNA are shown. 23aS. Typhimurium isolates, 23b Environmental isolates, 2 m F 173.4 104 104Kb M580581582583 M4387 74 6 7 7 135

PAGE 150

Figure 24c 136 l and 3 as a ro ith the DNA are shown. 24aS. Typhimurium isolates, 24b Environmental isolates, 4cdot blots, positive control= S. Typhi murium (CBD 746), negative control= Proteus irabilis (CBD 554), M= molecular weight standard (S. Braenderup, CBD 321) + cntrl cntr Southern blots of PFGE gel with magA gene of Salmonella pathogenicity Isl p be. The isolate numbers and the sizes of the fragments where the probe hybridized w 2 m

PAGE 151

F igure 25. Southern Hybridization with 1 Kb Integron Probe outhern blots of PFGE gel wi th1.0 Kb integron band of CB D 746 as a probe. The isolate umbers and the sizes of the fragments a nd the location of integron are shown. M= olecular weight standard (S. Braenderup, CBD 321), which is also a negative control r integron 167 Kb <33 M 438 746 777 823 580 S n m fo 137

PAGE 152

Chapter Four Discussion Since m the fi m the and s to exam see and this study, Salmonella species belonging to over 30 sero types, and three subspecies elective enrichment. Primers targeting sopB spvA and ompF genes were tested for rapid detection by real time PCR. The sopB gene was present in all the 106 isolates of Salmonella subspecies I tested but not in all of the isolates bel onging to subspecies III and IV. The spvA gene was olecular or phenotypic typing techniques require pure Salmonella culture, rst aim of this project was to rapidly detect and isolate Salmonella species fro artificially contaminated read y to eat foods. The second aim of the project was to build a subtyping database with two DNA based t yping techniques and a phenotypic typing technique and to see if ther e is a correlation between the two. The application of database was to identify unknown Salmonella species received from local hospitals to analyze the discriminatory ability of the three typing methods. The third aim wa ine the antibiotic susceptibility patterns of clinical and environmental Salmonella isolates and study the underlying mechanisms of resistance. The last aim was to whether there is an association between th e antibiotic resistance determinants pathogenicity island genes. In were subjected to primer an d probe testing, molecular typing and antibiotic resistance analysis. For rapid dete ction and isolation of Salmonella from food, eight food matrices were intentionally contaminated and subjected to detection by real time PCR and isolation by s 138

PAGE 153

detected in selected serotypes I (Typhimurium, Enteritidis, ullorum and Choleraesuis) tested as expected and spvA gene was also present in half of the isolates tested that bel onged to subspecies III and IV. ompF was present in all 114 isolates belonging to Salmonella subspecies I, III and IV. The fact that the sopB gene was absent in certain isolates of subspecies III and IV and ompF was present in all the subspecies tested suggests that SPI-5 is not very conserved among all Salmonella subspecies whereas SPI-2 is relatively mo re conserved. Based on this data, PCR with ompF gene primers could be us ed for identification of Salmonella subspecies I, III and IV isolates. Whether this gene is present in subs pecies II, V and VI rema ins to be tested. The sopB gene can be used for the identifica tion of strains of subspecies I, and spvA for the specific detection of selected serotypes of s ubspecies I. All three genes were specific to Salmonella because they were absent in othe r foodborne organisms tested including E. coli Shigella species, Listeria monocytogenes and Bacillus cereus A number of studies ested including 33 serotypes of subspecies I and bspecies III and IV, we suggest that it is a good alternative to invA gene for of Salmonella subspecies P have targeted invA gene for the detection of Salmonella species (54, 62, 70, 177). Some studies have used other gene targets including sipA and ttR for the detection of Salmonella species (67, 133). However, no st udy has tested the potential of ompF gene for identification of Salmonella species to our knowledge. Since ompF gene was present in all 114 Salmonella isolates t su identification of Salmonella species. Of course, more sero types of subspecies I and other subspecies need to be tested. 139

PAGE 154

Real time PCR with primers targeting the ompF gene was applied for identifying Salmonella in artificially spiked r eady-to-eat-food samples. The samples were artificially contaminated with low counts of S. Typhimuri um or S. Enteritidis (1-10 CFU) and also mixed spiked with low cell numbers of Salmonella along with other members of Enterobacteriaceae including E. coli, Citrobacter freundii and Proteus mirabilis DNA extracted from two broth enrichments, ge neral enrichment in BPW (6 hours) and selective enrichment (additional 4 hours in TT broth), was subjected to PCR. Overall, for the eight food groups tested, 34/45 reactions (75%) were positive after BPW enrichment and 31/45 (68%) were positive after the BPW and TT enrichment for the low and mixed spiked samples. This data suggests that addi tional enrichment in TT broth for four hours did not provide any additional benefit for the detection of Salmonella species in intentionally seeded food samples. A longer enrichment in TT broth might have been beneficial. Neither of the two broths te sted provided 100% positive results for the samples tested. Most of the studies that successfully detected Salmonella from BPW enrichment have either incubated for a longer time period of up to 18 hours (70) or had a very high initial inoculum (10 6 CFU) (58). Knutsson et al. detected 1 CFU of Salmonella species after 8 hours of BPW enrichment. Howe ver, sterile BPW was inoculated and food samples were not tested in that study (102). Agrawal et al. detected 3 CFU of Salmonella species in artificially inoc ulated food samples but only te n grams and not the standard 25 grams of food samples were tested in th at study (1). A study by Ellingson et al. successfully detected 1 CFU o f Salmonella species after 6 hours of BPW enrichment in rtificially seeded food samp les (67). In that study 15 ml of the enriched BPW sample a 140

PAGE 155

was used for DNA extraction, which probably led to increased sensitivity of the assay. However, they did not test the detection limit in mixed culture samples. To our knowledge, our study is the first to detect very low amounts of Salmonella species from mixed backgrounds of food matrices usi ng a very short preenrichment. Rapid isolation of S. Typhimurium and S. En teritidis from low, mixed and unspiked food samples was verified on samples enriched by general enrichment (BPW) and selective enrichments (BPW+IMS and BPW+TT). Salmonella was not recovered from any of the unspiked foods. For the low spiked foods, signi ficantly greater number of colonies were isolated after selective enrichment in IMS compared to BPW and BPW+TT. The results for the mixed spiking were slightly differe nt, where both the selective techniques IMS and TT fared well and were better than BPW en richment. However, this could be because of the isolation results after overnight in cubation of cheese, where BPW+TT isolated TNTC Salmonella but IMS isolated only 31 CFU (Table 13). If the food group cheese is not considered for the mixed spike analysis then BPW+IMS is significantly better than BPW+TT (P=0.07). However, if cheese is included in the analysis the isolation results of BPW +IMS and BPW+TT are very close with a P value of 0.9. Th e IMS technique was successful in isolation of Salmonella colonies from all the tested food groups except for cheese, which required an overnight incubation. This is possibly because of the high fat content of cheese interfering with the magnetic beads, which has been reported in other studies (95). Therefore, for foods with high fa t content, a longer en richment is suggested and IMS is not recommended, although furthe r studies are needed to prove this. 141

PAGE 156

A number of studies have employed IMS for rapid isolation of Salmonella species from artificially inoculated foods Although these studies have been rapid compared to the conventional protocol they are not very sens itive. For example Hana i et al. isolated almonella from artificially spiked f ood in 30 hours. However, the detection limit in that S study was 10 3 CFU/gm (84). Other studies involve d a long pre-enrichment of 18-20 hours prior to IMS (47, 136). In this study, we were successful in isolating numerous Salmonella colonies starting with low inoc ulum (1-10 CFU) from artificially contaminated food samples, which included f oods contaminated with other members of Enterobacteriaceae in 25 hours using the IMS techniqu e. To our knowledge this is the first report on isolation of Salmonella using a method that is both is very sensitive and rapid. This technique does not involve complex machinery and is very simple to perform. In conclusion BPW+TT did not provide any ad ditional benefit for eith er detection by real time PCR or for isolation for most of the f ood groups tested. Therefore, we suggest that the general enrichment in BPW for detection an d selective enrichment in IMS is adequate for rapid identificati on and isolation of Salmonella species from food samples. For foods with high fat content, however, further testing is needed. In this study, the application of isolated colonies directly from XLD agar plate for molecular typing and antibiotic susceptibility testing was shown. This techni que is less time consuming especially for mixed cultures, as Salmonella colonies can be easily distinguished on XLD plates from other common food organisms. 142

PAGE 157

A Salmonella fingerprinting database was created based on the ribot ypes and pulsotypes identification of a Salmonella serotype. The fact that botyping with Eco RI is appropriate for serotype level identification was demonstrated of known Salmonella serotypes obtained from ATCC, CDC, WADOH and turkey carcasses. The unknown Salmonella serotypes received from various hospitals in Tampa were typed by ribotyping and PFGE to validate the database. Based on the results of the two typing techniques (Table 15) it is clear that the ribotypi ng gives a closer match to the particular serotype compared to PFGE. The unknown S. Newport isolates demonstrated 90 to 100% similarity to S. Newport isolates in the database, wh ereas PFGE similarity was only 65% to S. Newport. Similarly, the unknown S. Typhimurium isolates were 90 100% identical to the known S. Typhimurium in the data base by ribotyping, whereas they were only 55-72% related to S. Typhimurium by PFGE clusters. This was not the case with S. Enteritidis, where both the techni ques showed a high similarity of 80 95% relatedness to the known S. Enteritidis. Th is demonstrates that S. Newport and S. Typhimurium has a very diverse genome whereas S. Enteritidis has a homogenous genome. The fact that S. Enteritidis has a homogenous genome was observed in many studies (56, 118), therefore, it is not surprising that PFGE of S. Enteritidis generated a closely related cluster. The ribotyping and PFGE data of the unknown S. Newport and S. Typhimurium suggest that PFGE is more disc riminatory compared to ribotyping for the serotypes with less well-conserved genomes. Ho wever, being more discriminatory is not necessarily an ideal feature for identification purposes, especially if the database has a limited number of known isolates. Therefore ribo typing, which is not as discriminatory as PFGE, could be used for initial ri 143

PAGE 158

(56). Since ribotyping with the automated RiboPrinter is more rapid (nine hours including sample preparation) than PFG E (26 hours), initial identification of Salmonella species by ribotyping is suggested in a foodborne outbreak situation. However, ribotyping by the RiboPrinter is more expensive and may not be appropriate for use in public health laboratories. The discriminatory power of the two molecu lar typing methods incl uding ribotyping and PFGE and the phenotypic method, antibiotic su sceptibility profiling was tested on the 100 wild type isolates from clinical a nd environmental sources. Manual ribotyping analysis by using the TIFF images was more discriminatory compared to the automated analysis by the RiboPrinter Manual analysis using BioNumerics generated 62 types for the 100 isolates whereas the automate d analysis generated 58 types; the major difference was seen in the closely related en vironmental isolates obtained from turkey farms. The manual analysis is worth consid ering for all analyses using the RiboPrinter since it does not require a signifi cantly longer time compared to the automated analysis. Macrorestriction digestion analysis with XbaI enzyme generated the highest number of profiles (74) compared to all the other typing techniques. A good correlation was seen between profiles using XbaI and Spe I enzymes; however XbaI is preferable, not only because it was slightly more discriminatory compared to Spe I but also because the bands of XbaI digested gels were spread apart and were easy to interpret compared to Spe I, bands. Dendrograms derived from antibiograms were the least discriminatory for the 100 isolates tested generating only 42 profiles. This could be because of the greater number of 144

PAGE 159

susceptible clinical isolates from FLDOH. The data in this study illu strates that PFGE is the most discriminatory compared to the other two techniques tested and this is consistent with previous studies (66, 81, 119). Ribotypi ng using a combination of enzymes has previously been shown to be more discriminatory than using one enzyme. For example, ribotyping with Pst I and Sp hI has proven to be very discriminatory for certain Salmonella rotypes including S. Enteri tidis and S. Typhimurium (118, 120). A combination of se macrorestriction patterns from PFGE, ribotypi ng and antibiotic resistance profiles will be very useful for rapi d source tracking of Salmonella strains in an outbreak situation Out of the 100 isolates, strains belonging to S. Newport represented the highest number belonging to a single serotype. Therefore, these 30 isolates were analyzed in detail to assess the discriminatory ability of the molecular typing methods and antibiotic resistance profiling. This analysis was also done to see if ther e is any correlation between the DNA fragment patterns and their respective anti biograms as observed by two studies involving S. Newport (76, 213). PFGE with XbaI as well as Spe I generated 14 pulsotypes for the 30 isolates, illustrating the consensus between the two enzymes. Likewise, ribotyping divided the isolates into four teen types, clearly demonstrating that ribotyping using the RiboPrinter can be equally discriminatory when compared to PFGE for typing S. Newport. It is interesting to note again that ribotyping using the automated RiboPrinter was more discriminatory when the fragment profiles were analyzed manually from TIFF files than when the patterns were normalized by the RiboPrinter Fourteen profiles were seen by manual analysis compared to th e ten profiles obtained by the automated 145

PAGE 160

normalization. A greater discrimination was seen in the environmental isolates using the manual analysis compared to the automated an alysis. Previous studies have shown that PFGE further resolved the ribogroups (10, 42) However, we observed that both PFGE and ribotyping further resolved groupings not differentiated by the other method. For example, ribotype cluster 2 (Figure 14a) was further discriminated by PFGE into two groups, B and C (Figure 15a). Likewise, PFGE cluster A (Figure 15a) was further divided into clusters 1 and 3 by ribotyping (Figure 14a). This is the first re port to our knowledge that ribotyping using the automated RiboPrinter with the enzyme Eco RI is as d iscriminatory as PFGE for S. Newport, when analyzed manually from TIFF files. All the environmental isolates from turkey carcasses formed a single major cluster using both the ribotyping and PFGE. Wi th ribotyping, the environmen tal isolates clustered at 92% or more similarity along with some clinical isolates (Figure 14a). With XbaI PFGE, all the environmental isolates formed a unique cluster at 88% or more relatedness (Figure 15a). Similarly, PFGE performed on the environmental isolates with Spe I generated a distinct group at 90% or more similarity (Figure 15b). This demonstrates that all the environmental isolates are very closely related and PFGE clearly distinguished the environmental isolates from the clinical isolates, as opposed to ribotyping. The PFGE and ribotyping profiles of the four clinical isolates from WADOH were identical. These four isolates were obtained from different sources (Table 5), and the fact that they have the same molecular typing patterns suggests th e possibility of an outbreak strain. 146

PAGE 161

Two isolates, CBD 571 a nd CBD 572, which were previously serotyped as Salmonella enterica serotype Bardo (S. Bardo) by conventional methods, showed very high similarity with S. Newport using molecular subtyping methods. S. Newport and S. Bardo have very similar antigenic formulas and differ by the presence or absence of O: 6 antigen. Ribotyping showed that CBD 571 was 96% similar to S. Newport (Figure 14a); PFGE with Xba-1 showed 92% similarity (Figure 15a) and the Spe I PFGE showed 95% relatedness (Figure 15b) to the S. Newport. Similarly, ribotyping of CBD 572 showed 100% identity with the S. Newport cluste r (Figure 14a) and PFGE analysis with XbaI and Spe I displayed 93% (Figure 15a) and 100% identity (Figure 15b) with the S. New port, spectively, prompting us to serotype the two putative S. Bardo isolates again. Both g & PFGE endrograms (Figure 14 and 15). Therefore, there was no clear distinction of the re strains typed as S. Newport, demonstrating that molecular techniques are not only rapid but are also very powerful tools for identifying Salmonella serotypes, prov ided the profile from the serotype is present in the database Discrimination of these S. Newport strains also confirms that molecular typing methods are very useful for outbreak investigations. The typing of the stra ins based on their antibiotic suscep tibilities, which gave rise to 23 profiles, was more discriminatory than either ribotyping or PFGE. When cluster analysis of the macrorestriction prof iles and the ribotypes were compared to the antibiotic resistance dendrograms, no correlation was observed. The susceptible isolates, the multidrug resistant strains and the isolates that were R or I to only one class of antibiotics were distributed among various clusters as shown in the both the ribotypin d 147

PAGE 162

susceptible isolates from the resistant ones with PFGE, contrary to the results observed (76, 213). Likewise, no such co rrelation was seen between the antibiotic resistance patterns and the ribotyping pattern s. A greater selection of antim icrobials was used in this study and could be a factor c ontributing to the l ack of correlation between PFGE and resistance profiles. Cluster analysis of antib iotic susceptibilities wa s more discriminatory compared to either of the molecular typing te chniques and this could be because of very high resistance in most of the S. Newport isolates tested. Of the 100 clinical and environmental isolates tested, 60% were R or I to one or more antimicrobials of which the majority were multiply resistant to antimicrobials. Forty percent of the clinical isolates were R or I, of which, 83% belonged to isolates from WADOH. The isolates from Tampa hospitals obtained through FLDOH were relatively less resistant (29%). The cause of higher resistance among the clinical isolates of WADOH compared to FLDOH is not known, but depends on the nature of the serotype nd the year of isolation. A very large number of environmental strains (90%) were R or I a to one or more antibiotics. The three envi ronmental isolates, S. Oranienburg (CBD 429), S. Apapa (CBD 430) and S. arizonae (CBD 432) that were isol ated from bearded dragon, lizard and snake respectively, showed R or I to nine or more drugs. Reptiles are not usually subjected to antibiotic treatment lik e food animals or humans and the fact that multidrug resistant Salmonella species were obtained from these sources is a cause for concern. It was not surprising that 96% of tu rkey carcass isolates comprised of eight serotypes were R or I to one or more drugs. These results imply that multiple antibiotic 148

PAGE 163

resistance in Salmonella species is a major crisis especially in poultry farms as demonstrated in several studies (29, 39, 163) The fact that the majority of the environmental isolates (75%) in this study we re obtained from two turkey plants might have affected the antibiotic resistance distribution and possibly skew ed the data. The high antibiotic resistance in poultry isolates is consista nt with other studies (29, 50). We observed that the majority of resistant clinical isolates (70%) were R or I to Ch. Sixty two percent of the clinical isolates showed R or I to extende d spectrum cephalosporins or ephams, which are a method of choice for trea ting salmonellosis in children (4). A high c incidence of resistance to Str, Amp and Tet was also observed among the clinical and the environmental isolates. On the whole 86% (5 2/60) of the resistan t isolates showed multiple drug resistant phenotype. The presence of integrons was tested by PCR to identify the basis for the high occurrence of multiple drug resistance among the resistant isolates. Integrons with four different profiles were seen in 21% of the multidrug re sistant isolates and one isolate of the nonMDR phenotype. Five S. Typhimurium isolates had two integrons (1.2 Kb and 1.0 Kb) harboring the genes pse1 and aadA2 respectively. This tw o-integron pattern is a characteristic feature of S. Typhimurium DT104 (11, 131). Whether these five isolates are DT104 is yet to be determined. The inte grons of six environmental isolates from turkey farms were identical based on the sequencing results. Similarly, sequencing revealed that the 1.0 Kb inte grons are identical and the 1.2 Kb integrons are identical among the five S. Typhimurium isolates. S. Paratyphi A (CBD 436) was R or I to only 149

PAGE 164

Nal, and was susceptible to all aminoglycosides including Str, G, K and Tob tested. However, the 1.6 Kb integron of S. Paratyphi A had the aadA2 gene encoding resistance to aminoglycosides. This suggests that the aadA2 gene in this integron cassette is not expressed. Whether this is due to the lack of promoter in the 5 region or mutation of the gene is yet to be determined. The presence of silent aadA2 or strA genes encoding resistance to streptomycin is not unusual (169, 206). aadA2 genes were seen on the 2 Kb integrons in three isolates that were suscep tible to aminoglycosides in a study by White et al. (206). It was surprising to see no integrons in the multidrug resistant isolates that were R or I to ten or more antibiotics, including the four S. Newport isolates from WADOH. It was ssumed that the integron gene cassettes ar e of several Kb and therefore were not a amplified by the primers targeting the entire integrons. Therefore, PCR with primers targeting only the integrase gene was pe rformed. However, these results were not encouraging and were similar to the ones obtained with the primers targeting the integron. So it is possible that there are no in tegrons in those isolates, and integrons are probably not as prevalent as hypothesized in multiply resistant isolates. Overall, 12% of the 100 isolates had class-1 integrons, and this finding is consistent with other studies (2, 83). However, further studies with more pr imers targeting integr ons and subsequent sequencing is needed to conclude that the re st of the 39 multidrug resistant isolates do not have integrons. Also, the presence of integr ons of other classes including class-2 and class-3 is possible and needs to be verified. 150

PAGE 165

To identify the location of the integrons, plasmid DNA was amplified with primers targeting the integrons in 11 isolates show n in Figure 17. The plasmid prep of all 11 isolates tested was positive for integrons. However, further testing of the plasmid DNA with a chromosomal marker revealed contamination of the plasmid DNA with chromosomal DNA. Southe rn hybridization of the XbaI digested PFGE gel isolates containing the 1.0 integron fragments revealed that the integrons ar e present below the 33 Kb region in the four S. Typhimurium is olates and on the 173 Kb fragment in S. uenster, CBD 580. Based on this data it is cl ear that the integron of CBD 580 is in fact M chromosomal as hypothesized. Also, chromosomal location of the integron of CBD 581, which is also a S. Muenster and appears to be a clone of CBD 580 is expected. Based on several studies and our data, it is reasonable to speculate that the integrons of the S. Typhimurium isolates are not located on plasmi ds, but are in fact on the 10 Kb band of XbaI digested gel which is a part of SGI (53, 64). The pentadrug resistance profiles (resistance to ACSuST), the two-integron patt ern and also the loca tion of the integrons suggest that the five clinical isolates S. Typhimurium (CBD 438, 746, 777, 816 and 823) are of phage type DT104. Further testing is need ed to prove this. In general, resistance to sulfonamides is a characteristic feature of the presence of class-1 integrons, as integrons have sul1 gene on the 3 end (185). However, out of 35 isolates that were R or I to Smx, only 11 had class-1 integrons. It is also possible that some of the isolates have partial integrons with only a functional 5 end. 151

PAGE 166

A ssociation of integrons with two ion transporter genes belonging to SPI-1 and SPI-3 ended for accurate identification of Salmonella ecies in food. Application of IMS for isolation of Salmonella species from foods with was verified. The integrons and the two ion transporter genes (ir on transporter gene sitB and magnesium transporter gene magA ) were located in differe nt bands showing clearly that there was no association between the two. Studies in Shigella flexneri have shown the iron transporter system is located on a pa thogenicity island and is associated with multiple antibiotic resistance genes encodi ng resistance to Tet, Ch and Amp (127, 195). This association of an tibiotic resistance genes and pathogenicity island was also observed in the high pathogenici ty island (HPI) of Yersinia It was observed by deChamps et al. that the Klebsiella isolates that were resistant to Nal and Aug were more likely to possess the Yersinia HPI (57). However, in this study any physical association of the integrons with SPI-1 and SPI-3 genes (with iron a nd magnesium transport systems) was not observed. It is possible that other antibiotic resistance genes that are not on the integrons are associated with one of the five SPI. Fu rther studies involving antibiotic resistance genes that are not associated with integrons but are chromosomal in location are needed to verify any association with SPI. In conclusion, ompF gene was shown to be the most re liable marker when compared to other genes for the rapid detection of Salmonella species by real time PCR. General enrichment in BPW is adequate for the detection for Salmonella from food by real time PCR; further enrichment in TT broth was not beneficial. Howeve r, a longer general enrichment of about 8 hours is recomm sp 152

PAGE 167

low Salmonella inoculum was demonstrated to rec over significantly greater numbers of colonies compared to TT broth enrichment. IMS was shown to be a superior enrichment for isolation of Salmonella compared to TT broth for most foods with mixed backgrounds. Since IMS takes three hours less than TT broth enrichment and provides pure colonies in 25 hours, it is the method of choice for Salmonella isolation for most food groups. As hypothesized, macrorestricti on profiling with PFGE was the most discriminatory technique for typing of clinical and environmental Salmonella isolates. However, ribotyping with EcoR I by the automated RiboPrinter that requires only 9 hours is suggested for preliminar y identification and typing of Salmonella species in case of an outbreak or a BT event. When the clinical and environmental isolates from three different geographical locations were tested for resistance to 31 antibiotics, 60% were R or I to one or more drugs and the majority showed multidrug resistant phenotype. It was interesting to observe that the clinical isolates from FL were the least resistant compared any other isolates. Class-1 integrons were noted in 12/60 (20%) re sistant isolates. The location of the integrons seems to be chromosomal for at least five of the isolates as ypothesized. Contrary to our hypothesis, no physical association between the h pathogenicity islands and the integrons was observed. 153

PAGE 168

Chapter Five Significance of the Research The gene ompF which has not been previously used as a target by any study for the detection of Salmonella by PCR, was established to be a reliable marker for the detection of Salmonella subspecies I, III and IV. Primers for the gene ompF gene were also tested for the detection of Salmonella species form artificially contaminated food samples enriched in general enrichment and selective enrichment. It was shown in this study that further enrichment in TT broth wa s not required for detection of Salmonella from artificially contaminated food sample s. A detection limit of 1-10 CFU of Salmonella in 25 gm of food was achieved in 8 hours, 75% of the time by means of the real time PCR. Pure culture of Salmonella is a prerequisite to do any bi ochemical or molecular analysis for source tracking. Isolating pure Salmonella colonies in a rapid fashion is especially important during an outbreak or a BT event when time is the rate-limiting step. However, not many studies have focused on the rapid isolation of Salmonella species from food. We have shown for the first time that isolation of pure Salmonella colonies on selective agar is possible in 25 hours starting from contaminated food samples. This accelerated isolation protocol yielded pure culture and could be applie d for molecular subtyping, ntibiotic susceptibility testing and further serological and biochemical analyses. This rotocol could be applicable to other organisms or othe r matrices including stool or lood. In this study, a DNA fingerprin ting database of more than 100 Salmonella strains as created. This database included both ri botyping and PFGE profiles of strains from linical and environmental sources. This data base will be useful for identification of a p b w c 154

PAGE 169

unknown Salmonella database could be ompared with the CDC PulseNet database in future to unravel any epidemiological links isolates received by FLDOH. The PFGE c between the Florida isolates and other isol ates. The incorrect serotyping of two S. Newport isolates was determined by using the database. The antibiotic susceptibility patterns and the resistance mechanisms of 100 isolates from three different geographical locations were studied. Difference in the suscep tibility patterns of Florida isolates and the isolates from two other lo cations was observed. A study probing the a ssociation of Salmonella virulence genes and antibiotic resi stance genes was initiated. Southern hybridization probes for various antibiotic resistance genes ( -lactamase, tetracycline, and chloramphenicol) and virulence genes including invA and phoP/Q were designed to study the association further. 155

PAGE 170

Chapter Six Future Directions Salmonella enterica isolates from subspecies II, VI, other serotypes of subspecies I and also Salmonella bongeri strains need to be tested for the presence of ompF gene to confirm that this target is applicable for the detection of all Salmonella isolates. For the detection of Salmonella species from spiked food, the samples were incubated for six hours in BPW, this resulted in positive PCR results only 75% of the time. To get 100% results, the samples need to be incubated fo r longer time. Therefore, in the future the DNA needs to be extracted and tested every two hours, after the six hour enrichment. In this study it was observed that enrichment in conventional selective broth (TT) provided a greater number of colonies co mpared to IMS for cheese. Further studies should verify if is is true for other foods with high fat content. he Salmonella isolates obtained from WADOH and turkey farms from the Midwest, owed a higher prevalence of resistance to antibiotics compared to the ones from LDOH. In future it will be inte resting to observe if this represents a trend in these states. ntibiotic susceptibility testing of isolates from various geographica l distributions will elp us understand if the isolates from FL are truly more susceptibl e compared to other gions. In this study the integrons of at least five isolates have been tentatively etermined to be present in the chromosome s; however, to prove th e precise location of e integrons, conjugation expe riments need to be performe d. If the resistance is not ansferred it can be confirmed that the in tegrons are indeed chromosomal. A vast th T sh F A h re d th tr 156

PAGE 171

majority of multidrug resist resence of integrons, it is ossible that these isolates have integrons w ith several gene cassettes and are not being ant isolates did not show the p p amplified using conventional PCR. A long PCR with primers directed against the entire integrons might elucidate the presence or abse nce of integrons. Also, it is possible that these isolates harbor other classes of in tegrons including clas s-2 or class-3. The association between integrons and SPI-1 a nd SPI-3 was verified in this study. The possible relationship between in tegrons and other SPIs, or be tween antibiotic resistance genes outside integrons and SPI needs to be tested. An alternative way to verify the association between virulence and antibiotic resistance would be to see if any of the antibiotic resistance genes are located on the Salmonella virulence plasmid as observed by Villa and Carotolli recently (199). 157

PAGE 172

References 1. Agarwal, A., A. Makker, and S. K. Goel. 2002. Application of the PCR technique for a rapid, specific and sensitive detection of Salmonella spp. in foods. Mol Cell Probes 16: 243-50. 2. Ahmed, A. M., H. Nakano, and T. Shimamoto. 2005. Molecular characterization of integrons in non-typhoid Salmonella serovars isolated in Japan: description of an unusual clas s 2 integron. J Antimicrob Chemother 55: 371-4. 3. Ahmed, R., G. Soule, W. H. Demczuk, C. Clark, R. Khakhria, S. Ratnam, S. Marshall, L. K. Ng, D. L. Woodward, W. M. Johnson, and F. G. Rodgers. 2000. Epidemiologic typing of Salmonella enterica serotype enteritidis in a Canada-wide outbreak of gastroenteritis due to contaminated cheese. J Clin Microbiol 38: 2403-6. 4. Allen, K. J., and C. Poppe. 2002. Occurrence and charac terization of resistance to extended-spectrum cephalosporins me diated by beta-lactamase CMY-2 in Salmonella isolated from food-producing an imals in Canada. Can J Vet Res 66: 137-44. 5. Amavisit, P., D. Lightfoot, G. F. Browning, and P. F. Markham. 2003. Variation between pathog enic serovars within Salmonella pathogenicity islands. J Bacteriol 185: 3624-35. 6. Angulo, F. J., V. N. Nargund, and T. C. Chiller. 2004. Evidence of an association between use of anti-microbi al agents in food animals and anti158

PAGE 173

microbial resistance among bac from humans and the human health consequences of such resistance. J Ve t Med B Infect Dis Vet Public Health 51: 374-9. 7. Antunes, P., J. Machado, J. C. Sousa, and L. Peixe. 2004. Dissemination amongst humans and food products of animal origin of a Salmonella typhimurium clone expressing an integron-borne OXA-30 beta-lactamase. J Antimicrob Chemother 54: 429-34. 8. Antunes, P., J. Machado, J. C. Sousa, and L. Peixe. 2005. Dissemination of sulfonamide resistance genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica strains and relation with integr ons. Antimicrob Agents Chemother 49: 836-9. 9. Armand-Lefevre, L., V. Leflon-Guibout, J. Bredin, F. Barguellil, A. Amor, J. M. Pages, and M. H. Nicolas-Chanoine. 2003. Imipenem resistance in Salmonella enterica serovar Wien related to porin loss and CMY-4 betalactamase production. Antimicrob Agents Chemother 47: 1165-8. 10. Badrinath, P., T. Sundkvist, H. Mahgoub, and R. Kent. 2004. An outbreak of Salmonella enteritidis phage type 34a infection associated with a Chinese restaurant in Suffolk, United Kingdom. BMC Public Health 4: 40. 11. Baggesen, D. L., D. Sandvang, and F. M. Aarestrup. 2000. Characterization of Salmonella enterica serovar typhimurium DT104 isolated from Denmark and comparison with isolates from Europe and the United States. J Clin Microbiol 38: 1581-6. teria isolated 159

PAGE 174

12. J 82: 3467-74. a, 14. tto, A. Martinez, M. Pereira, G. Algorta, M. A. to n Microbiol 42: 1155-62. 16. biol Rev 7: 31117. iotic949-53. 19. K. Kaneko, and M. Ogawa. 1998. Epidemiological analysis of Barbosa, T. M., and S. B. Levy. 2000. Differential expression of over 60 chromosomal genes in Escherichia coli by constitutive expression of MarA. Bacteriol 1 13. Belgrader, P., W. Benett, D. Hadley, J. Richards, P. Stratton, R. Mariell Jr., and F. Milanovich. 1999. PCR detection of bact eria in seven minutes. Science 284: 449-50. Betancor, L., F. Schelo Rodriguez, R. Vignoli, and J. A. Chabalgoity. 2004. Random amplified polymorphic DNA and phenotyping analysis of Salmonella enterica serovar enteritidis isolates collec ted from humans and poultr y in Uruguay from 1995 2002. J Cli 15. Beuchat, L. R., and J. H. Ryu. 1997. Produce handling and processing practices. Emerg Infect Dis 3: 459-65. Bingen, E. H., E. Denamur, and J. Elion. 1994. Use of ribotyping in epidemiological surveillance of nosoc omial outbreaks. Clin Micro 27. Bjorkman, J., D. Hughes, and D. I. Andersson. 1998. Virulence of antib resistant Salmonella typhimurium. Proc Natl Acad Sci U S A 95: 3 18. Blanc-Potard, A. B., F. Solomon, J. Kayser, and E. A. Groisman. 1999. The SPI-3 pathogenicity island of Salmonella enterica J Bacteriol 181: 998-1004. Boonmar, S., A. Bangtrakulnonth, S. Pornrunangwong, J. Terajima, H. Watanabe, 160

PAGE 175

Salmonella enteritidis isolates fr om humans and broiler chickens in Thailan phage typing and pulsed-field gel electrophoresis. J Clin Microbiol 36: 971-4. Bopp, C. A., F.W. Bren d by 20. ner, J.G. Wells, N.A. Stockbine. 1999. Escherichia Micr obiology, Washington, DC. 22. d M. R. Mulvey. 2000. Partial a Typhymurium DT104. FEMS Microbiol Lett 23. Salmonella nomenclature. J Clin Microbiol 38: 2465-7. ona 25. Shigella and Salmonella p.459-474. In P.R. Murray, E.J. Barron, M.A. Pfaller, F.C. Tenover, and R.H. Yolken (ed.), Manual of clinical microbiology, 7 th ed American Society for 21. Botteldoorn, N., L. Herman, N. Rijpens, and M. Heyndrickx. 2004. Phenotypic and molecular typing of Salmonella strains reveals different contamination sources in two commercial pig slaughterhouses. Appl Environ Microbiol 70: 5305-14. Boyd, D. A., G. A. Peters, L. Ng, an characterization of a genomic island associated with the multidrug resistance region of Salmonella enteric 189: 285-91. Brenner, F. W., R. G. Villar, F. J. Angulo, R. Tauxe, and B. Swaminathan. 2000 24. Brenner Michael, G., M. Cardoso, and S. Schwarz. 2005. Class 1 integronassociated gene cassettes in Salmonella enterica subsp. enterica serovar Ag isolated from pig carcasses in Brazil. J Antimicrob Chemother 55: 776-9. Briggs, C. E., and P. M. Fratamico. 1999. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob Agents Chemother 43: 846-9. 161

PAGE 176

26. 27. M. A. sm of g icrob Agents Chemother 48: 3934-9. h 30. and F. M. Collins. 1974. The route of enteric infection in normal 31. ornax, M. C. of a ns ortal Wkly Rep 52: 613-5. Brown, A. W., S. C. Rankin, and D. J. Platt. 2000. Detection and characterisation of integrons in Salmonella enterica serotype enteritidis. FEMS Microbiol Lett 191: 145-9. Burr, M. D., K. L. Josephson, and I. L. Pepper. 1998. An evaluation of ERIC PCR and AP PCR fingerpri nting for discriminating Salmonella serotypes. Lett Appl Microbiol 27: 24-30. 28. Cabrera, R., J. Ruiz, F. Marco, I. Oliveira, M. Arroyo, A. Aladuena, Usera, M. T. Jimenez De Anta, J. Gascon, and J. Vila. 2004. Mechani resistance to several antimicrobial agents in Salmonella Clinical isolates causin traveler's diarrhea. Antim 29. Carraminana, J. J., C. Rota, I. Agustin, and A. Herrera. 2004. Hig prevalence of multiple resistance to antibiotics in Salmonella serovars isolated from a poultry slaughterhouse in Spain. Vet Microbiol 104: 133-9. Carter, P. B. mice. J Exp Med 139: 1189-203. Castro, D., M. A. Morinigo, E. Martinez-Manzanares, R. C Balebona, A. Luque, and J. J. Borrego. 1992. Development and application new scheme of phages for typing and differentiating Salmonella strains from different sources. J Clin Microbiol 30: 1418-23. 32. 2003, CDC. Multistate outbreak of Salmonella serotype typhimurium infectio associated with drinking unpasteurized milk--Illinois, Indiana, Ohio, and Tennessee, 2002-2003. Morb M 162

PAGE 177

33. 2005, CDC. Outbreaks of Salmonella infections associated with eatin tomatoes--United States and Canada, 2004. Morb Mortal Wkly Rep 54: 325-8. 2001, CDC. Recognition of g Roma 34. illness associated wi th the intentional release of a 35. g salad-Oregon, 2003. Morb Mortal Wkly Rep 36. M. S. Serovar ous l biologic agent. Morb Mortal Wkly Rep 50: 893-7. 2004 CDC. Salmonella serotype Typhimurium outbreak associated with commercially processed eg 53: 1132-4. Chadfield, M., M. Skov, J. Christensen, M. Madsen, and M. Bisgaard. 2001 An epidemiological study of Salmonella enterica serovar 4, 12:b:in broiler chickens in Denmark. Vet Microbiol 82: 233-47. 37. Chang, C. C., Y. H. Lin, C. F. Chang, K. S. Yeh, C. H. Chiu, C. Chu, Chien, Y. M. Hsu, L. S. Tsai, and C. S. Chiou. 2005. Epidemiologic relationship between fl uoroquinolone-resistant Salmonella enterica Choleraesuis strains isolated from humans and pigs in Taiwan (1997 to 2002). J Clin Microbiol 43: 2798-804. 38. Chen, J., and M. W. Griffiths. 2001. Detection of Salmonella and simultane detection of Salmonella and Shiga-like toxin-produc ing Escherichia coli using the magnetic capture hybridization polymerase chain reaction. Lett Appl Microbio 32: 7-11. 39. Chen, S., S. Zhao, D. G. White, C. M. Schroeder, R. Lu, H. Yang, P. F. McDermott, S. Ayers, and J. Meng. 2004. Characterization of multiple163

PAGE 178

antimicrobial-resistant Salmonella serovars isolated from retail meats. Appl Environ Microbiol 70: 1-7. 40. Chen, W., G. Martinez, and A. Mulchandani. 2000. Molecular beacons: a re time polymerase chain reaction assay for detecting alSalmonella Anal Biochem 41. r ion of an enterotoxin from Salmonella typhimurium. Microb Pathog 42. al isolates of Salmonella 43. Rodgers. l and 44. B. A. Vallance, and B. B. Finlay. 2005. 45. L., and R. V. Tauxe. 1986. Drug-resistant Salmonella in the United 280: 166-72. Chopra, A. K., J. W. Peterson, P. Chary, and R. Prasad. 1994. Molecula characterizat 16: 85-98. Chu, C., C. H. Chiu, W. Y. Wu, C. H. Chu, T. P. Liu, and J. T. Ou. 2001. Large drug resistance virulence plas mids of clinic enterica serovar Choleraesuis. Antimicrob Agents Chemother 45: 2299-303. Clark, C. G., T. M. Kruk, L. Bryden, Y. Hirvi, R. Ahmed, and F. G 2003. Subtyping of Salmonella enterica serotype enteritidis strains by manua automated PstI-SphI ribo typing. J Clin Microbiol 41: 27-33. Coburn, B., Y. Li, D. Owen, Salmonella enterica serovar Typhimurium pathogenicity island 2 is necessary for complete virulence in a mouse model of infectious enterocolitis. Infect Immun 73: 3219-27. Cohen, M States: an epidemiologic perspective. Science 234: 964-9. 164

PAGE 179

46. ed by th e integron DNA integrase. J Bacteriol 47. n from foods and their detecti on using immunomagnetic particle 48. ing Dynabeads antiSalmonella and a conventional reference method. 49. ment 5. 8-11. 52. uckley, E. Power, C. O'Hare, M. Cormican, B. Cryan, P. G. ns and assessment of genetic relationships by DNA amplifi cation fingerprinting. Appl Environ Microbiol 66: 614-9. Collis, C. M., and R. M. Hall. 1992. Site-specific deleti on and rearrangement of integron insert genes catalyz 174: 1574-85. Cudjoe, K. S., T. Hagtvedt, and R. Dainty. 1995. Immunomagnetic separatio of Salmonella (IMP)-ELISA. Int J Food Microbiol 27: 11-25. Cudjoe, K. S., and R. Krona. 1997. Detection of Salmonella from raw food samples us Int J Food Microbiol 37: 55-62. Cudjoe, K. S., R. Krona, and E. Olsen. 1994. IMS: a new selective enrich technique for detection of Salmonella in foods. Int J Food Microbiol 23: 159-6 50. Cui, S., B. Ge, J. Zheng, and J. Meng. 2005. Prevalence and antimicrobial resistance of Campylobacte r spp. and Salmonella Serovars in organic chickens from Maryland retail stores. Appl Environ Microbiol 71: 410 51. Daly, M., J. Buckley, E. Power, and S. Fanning. 2004. Evidence for a chromosomally located third integron in Salmonella enterica serovar Typhimurium DT104b. Antimicrob Agents Chemother 48: 1350-2. Daly, M., J. B Wall, and S. Fanning. 2000. Molecular charac terization of Irish Salmonella enterica serotype typhimurium: detection of class I integro 165

PAGE 180

53. Daly, M., and S. Fanning. 2000. Characterization and chromosomal mapping of antimicrobial resistance genes in Salmonella enterica serotype Typhimurium Appl Environ M icrobiol 66: 4842-8. 02. ct foods fr om a gastroenteritis 55. P. T. Amuso, and J. Cattanii. 2004. Real-time 56. morphic DNA 57. C. l al. 58. Toti. NA extraction methods for use in combination with SYBR 54. Daum, L. T., W. J. Barnes, J. C. McAvin, M. S. Neidert, L. A. Cooper, W. B. Huff, L. Gaul, W. S. Riggins, S. Morris, A. Salmen, and K. L. Lohman. 20 Real-time PCR detection of Salmonella in suspe outbreak in Kerr county, Te xas. J Clin Microbiol 40: 3050-2. Davis, C. R., L. C. Heller, K. K. Peak, D. L. Wingfield, C. L. Goldstein-Hart, D. W. Bodager, A. C. Cannons PCR detection of the thermostable direct hemolysin and thermolabile hemolysin genes in a Vibrio parahaemolyticus cultured from mussels and mussel homogenate associated with a foodborne outbreak. J Food Prot 67: 1005-8. De Cesare, A., G. Manfreda, T. R. Dambaugh, M. E. Guerzoni, and A. Franchini. 2001. Automated ribotyping and ra ndom amplified poly analysis for molecular typing of Salmonella enteritidis and Salmonella typhimurium strains isolated in Italy. J Appl Microbiol 91: 780-5. De Champs, C., C. Rich, P. Chandezo n, C. Chanal, D. Sirot, and Forestier. 2004. Factors associated with anti microbial resistance among clinica isolates of Klebsiella pneumoniae: 1-year survey in a French university hospit Eur J Clin Microbiol Infect Dis 23: 456-62. De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L. 2003. Evaluation of D 166

PAGE 181

green I real-time PCR to detect Salmonella enterica serotype enteritidis in poultry. Appl Environ Microbiol 69: 3456-61. Deiwick, J., T. Nikolaus, J. E. Shea 59. C. Gleeson, D. W. Holden, and M. 60. nd A. Brandelli. 61. with dairy P. chicken cla, and 64. isabois, D. Boyd, M. R. Mulvey, E. Hensel. 1998. Mutations in Salmonella pathogenicity isla nd 2 (SPI2) genes affecting transcription of SPI1 genes and resistance to antimicrobial agents. J Bacteriol 180: 4775-80. Dias de Oliveira, S., F. Siqueira Flo res, L. R. dos Santos, a 2005. Antimicrobial resistance in Salmonella enteritidis strains isolated from broiler carcasses, food, human and poultry-related samples. Int J Food Microbiol 97: 297-305. Donnelly, C. W. 1990. Concerns of microbial pathoge ns in association foods. J Dairy Sci 73: 1656-61. 62. dos Santos, L. R., V. P. do Nascimento, S. D. de Oliveira, M. L. Flores, A Pontes, A. R. Ribeiro, C. T. Salle, and R. F. Lopes. 2001. Polymerase chain reaction (PCR) for the detection of Salmonella in artificially inoculated meat. Rev Inst Med Trop Sao Paulo 43: 247-50. 63. Doublet, B., P. Butaye, H. Imberechts, J. M. Collard, E. Chaslus-Dan A. Cloeckaert. 2004. Salmonella agona harboring genomic island 1-A. Emerg Infect Dis 10: 756-8. Doublet, B., R. Lailler, D. Meunier, A. Br Chaslus-Dancla, and A. Cloeckaert. 2003. Variant Salmonella genomic island 1 167

PAGE 182

antibiotic resistance gene cluster in Salmonella enterica serovar Albany. Em Infect Dis 9: 585-91. erg mic 67. 2004. eat m eat products. Mol Cell Probes 18: 51-7. Appl Microbiol 34: 37-41. 65. Ebner, P., K. Garner, and A. Mathew. 2004. Class 1 integrons in various Salmonella enterica serovars isolated from animal s and identification of geno island SGI1 in Salmonella enterica var. Meleagridis. J Antimicrob Chemother 53: 1004-9. 66. Ebner, P. D., and A. G. Mathew. 2001. Three molecular methods to identify Salmonella enterica serotype Typhimurium DT104: PCR fingerprinting, multiplex PCR and rapid PFGE. FEMS Microbiol Lett 205: 25-9. Ellingson, J. L., J. L. Anderson, S. A. Carlson, and V. K. Sharma. Twelve hour real-time PCR technique for the sensitive and specific detection of Salmonella in raw and ready-to68. Eriksson, J., C. Lofstrom, A. Aspan, A. Gunnarsson, I. Karlsson, E. Borch, B. de Jong, and P. Radstrom. 2005. Comparison of genotyping methods by application to Salmonella livingstone strains associated with an outbreak of human salmonellosis. Int J Food Microbiol. 69. Esteban, E., K. Snipes, D. Hird, R. Kasten, and H. Kinde. 1993. Use of ribotyping for characterization of Salmonella serotypes. J Clin Microbiol 31: 233 7. 70. Eyigor, A., K. T. Carli, and C. B. Unal. 2002. Implementation of real-time PCR to tetrathionate broth enrichment step of Salmonella detection in poultry. Lett 168

PAGE 183

71. g ry ability of pul sed-field gel electrophoresis for typing 72. Salmonella enterica serovar enteritidis in broth. Appl Environ 73. A. C. monella 74. 75. ction es in E. coli O157:H7. Mol Cell 76. typing and pulsed-fiel d gel electrophoresis for rapid identification of Fakhr, M. K., L. K. Nolan, and C. M. Logue. 2005. Multilocus sequence typin lacks the discriminato Salmonella enterica serovar Typhimurium J Clin Microbiol 43: 2215-9. Favrin, S. J., S. A. Jassim, and M. W. Griffiths. 2001. Development and optimization of a novel immunomagnetic separationbacteriophage assay for detection of Microbiol 67: 217-24. Fernandes, S. A., A. C. Ghilardi, A. T. Tavechio, A. M. Machado, and Pignatari. 2003. Phenotypic and molecu lar characterization of Sal Enteritidis strains isolated in Sao Pa ulo, Brazil. Rev Inst Med Trop Sao Paulo 45: 59-63. Finlay, B. B. 1994. Molecular and cellu lar mechanisms of Salmonella pathogenesis. Curr Top Microbiol Immunol 192:163-85. Fitzmaurice, J., M. Glennon, G. Duffy, J. J. Sheridan, C. Carroll, and M. Maher. 2004. Application of real-time PCR and RT-PCR assays for the dete and quantitation of VT 1 and VT 2 toxin gen Probes 18: 123-32. Fontana, J., A. Stout, B. Bolstorff, and R. Timperi. 2003. Automated ribo multidrug-resistant Salmonella serotype Newport. Emerg Infect Dis 9: 496-9. 169

PAGE 184

77. Fukushima, H., Y. Tsunomori, and R. Seki. 2003. Duplex real-time SYBR green PCR assays for detection of 17 species of foodor waterborne pathogen stools. J Clin Microbiol 41: 5134-46. s in blin retion a. Mol Microbiol 25: 903-12. of 80. W. E. Keene, J. C. Mohle-Boetani, J. A. Farrar, P. L. Waller, C. 82. ., H. Hardardottir, and E. Gunnarsson. 2003. Subtyping of humans 83. nce and spread of class 1 integrons among Salmonella serotypes. Antimicrob Agents Chemother 44: 2166-9. 78. Galyov, E. E., M. W. Wood, R. Rosqvist, P. B. Mullan, P. R. Watson, S. Hedges, and T. S. Wallis. 1997. A secreted effector protein of Salmonella Du is translocated into eukaryotic cells a nd mediates inflammatio n and fluid sec in infected ileal mucos 79. Gebreyes, W. A., and S. Thakur. 2005. Multidrug-resistant Salmonella enterica serovar Muenchen from pigs and humans and potential inters erovar transfer antimicrobial resistance. Antimicrob Agents Chemother 49: 503-11. Gill, C. J., G. Hahn, and P. R. Cieslak. 2003. Alfalfa seed decontamination in a Salmonella outbreak. Emerg Infect Dis 9: 474-9. 81. Gorman, R., and C. C. Adley. 2004. Characterization of Salmonella enterica serotype Typhimurium isolates from human, food, and animal sources in the Republic of Ireland. J Clin Microbiol 42: 2314-6. Gudmundsdottir, S Salmonella enterica serovar Typhimurium outbreak strains isolated from and animals in Iceland. J Clin Microbiol 41: 4833-5. Guerra, B., S. Soto, S. Cal, and M. C. Mendoza. 2000. Antimicrobial resista 170

PAGE 185

84. Hanai, K., M. Satake, H. Nakanishi, and K. Venkateswaran. 1997. Comparison of commercially available kits with standard methods for detection of Salmonella strains in foods. A ppl Env iron Microbiol 63: 775-8. sfer 86. based identification of 87. n of 88. uing problem. Postgrad Med J 80: 541-5. of er Escherichia coli by real-time 91. lymerase chain reaction product by utilizing the 5'----3' 85. Hansen-Wester, I., D. Chakravortty, and M. Hensel. 2004. Functional tran of Salmonella pathogenicity island 2 to Salmonella bongori and Escherichia coli Infect Immun 72: 2879-88. Hansen-Wester, I., and M. Hensel. 2002. Genomechromosomal regions specific for Salmonella spp. Infect Immun 70: 2351-60. Hara-Kudo, Y., S. Kumagai, T. Masuda, K. Goto, K. Ohtsuka, H. Masaki, H Tanaka, K. Tanno, M. Miyahara, and H. Konuma. 2001. Detectio Salmonella enteritidis in shell and liquid eggs using enrichment and plating. Int J Food Microbiol 64: 395-9. Hardy, A. 2004. Salmonella : a contin 89. He, X. Q., and R. N. Pan. 1992. Bacteriophage lytic patte rns for identification Salmonella e, shigellae, Escherichia coli Citrobacter freundii and Enterobact cloacae. J Clin Microbiol 30: 590-4. 90. Heller, L. C., C. R. Davis, K. K. Peak D. Wingfield, A. C. Cannons, P. T. Amuso, and J. Cattani. 2003. Comparison of methods for DNA isolation from food samples for detection of Shiga toxin-producing PCR. Appl Environ Microbiol 69: 1844-6. Holland, P. M., R. D. Abramson, R. Watson, and D. H. Gelfand. 1991. Detection of specific po 171

PAGE 186

exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl U S A 88: 7276-80. Hollis, R. J., J. L. Bruce, S. J. Fritschel, and M. A. Pfaller. 19 Acad Sci 92. 99. Comparative 34: 263-8. ation 94. tem ol 35: 1146-55. a 96. iew, and G. L. Gilbert. 2001. Practical ue 97. uires the Salmonella pathogenicity d 1 evaluation of an automated ribotyping instrument versus pulsed-field gel electrophoresis for epidemiological investigation of clinical isolates of bacteria. Diagn Microbiol Infect Dis 93. Hsih, H. Y., and H. Y. Tsen. 2001. Combination of immunomagnetic separ and polymerase chain reaction for the simultaneous detection of Listeria monocytogenes and Salmonella spp. in food samples. J Food Prot 64: 1744-50. Janakiraman, A., and J. M. Slauch. 2000. The putative iron transport sys SitABCD encoded on SPI1 is required for full virulence of Salmonella typhimurium. Mol Microbi 95. Jenikova, G., J. Pazlarova, and K. Demnerova. 2000. Detection of Salmonell in food samples by the combination of immunomagnetic separation and PCR assay. Int Microbiol 3: 225-9. Jeoffreys, N. J., G. S. James, R. Ch evaluation of molecular subtyping and phage typing in outbreaks of infection d to Salmonella enterica serotype Typhimurium. Pathology 33: 66-72. Jones, M. A., P. Wigley, K. L. Page, S. D. Hulme, and P. A. Barrow. 2001. Salmonella enterica serovar Gallinarum req island 2 type III secretion system but not the Salmonella pathogenicity islan type III secretion system for viru lence in chickens. Infect Immun 69: 5471-6. 172

PAGE 187

98. gy : 61-66. using 100. ituria, A. Munyalo, D. are separate type III secretion systems. 102. me respons es for optimization of a high-throughput 0. 103. ratory 104. Jordan, J. A. 2000. Real Time Detection of PCR Products and Microbiology. Trends in Microbiolo 99. Kakinuma, K., M. Fukushima, and R. Kawaguchi. 2003. Detection and identification of Escherichia coli, Shigella, and Salmonella by microarrays the gyrB gene. Biotechnol Bioeng 83: 721-8. Kariuki, S., G. Revathi, N. Kariuki, J. Muyodi, J. Mw Kagendo, L. Murungi, and C. Anthony Hart. 2005. Increasing prevalence of multidrug-resistant non-typhoidal Salmonella e, Kenya, 1994-2003. Int J Antimicrob Agents 25: 38-43. 101. Knodler, L. A., J. Celli, W. D. Hardt, B. A. Vallance, C. Yip, and B. B. Finlay. 2002. Salmonella effectors within a single pathogenicity island differentially expressed and translocated by Mol Microbiol 43: 1089-103. Knutsson, R., C. Lofstrom, H. Gr age, J. Hoorfar, and P. Radstrom. 2002. Modeling of 5' nuclease real-ti enrichment PCR procedure for Salmonella enterica J Clin Microbiol 40: 52-6 Kolavic, S. A., A. Kimura, S. L. Simons L. Slutsker, S. Barth, and C. E. Haley. 1997. An outbreak of Shigella dysenteriae type 2 among labo workers due to intentional food contamination. JAMA 278: 396-8. Kotetishvili, M., O. C. Stine, A. Kreger, J. G. Morris, Jr., and A. Sulakvelidze. 2002. Multilocus sequence typing for characterization of clinical and environmental Salmonella strains. J Clin Microbiol 40: 1626-35. 173

PAGE 188

105. Kumao, T., W. Ba-Thein, and H. Hayashi. 2002. Molecular subtyping metho for detection of Salmonella ente ds rica serovar Oranienburg outbreaks. J Clin 106. bution and ch aracterization of class 107. za. tiatio n of pathogenic strains of Salmonella 108. t DT104. J Clin Microbiol 42: 4843-5. ntial for the Microbiol 40: 2057-61. Kwon, H. J., T. E. Kim, S. H. Cho, J. G. Seol, B. J. Kim, J. W. Hyun, K. Y. Park, S. J. Kim, and H. S. Yoo. 2002. Distri 1 integrons in Salmonella enterica serotype Gallinarum biotype Gallinarum. Vet Microbiol 89: 303-9. Landeras, E., M. A. Gonzalez-Hevia, R. Alzugaray, and M. C. Mendo 1996. Epidemiological differen enteritidis by ribotyping. J Clin Microbiol 34: 2294-6. Lawson, A. J., J. Stanley, E. J. Threlfall, and M. Desai. 2004. Fluorescen amplified fragment length polymorphism subtyping of multiresistant Salmonella enterica serovar Typhimurium 109. Lee, A. K., C. S. Detweiler, and S. Falkow. 2000. OmpR regulates the twocomponent system SsrA-ssrB in Salmonella pathogenicity island 2. J Bacteriol 182: 771-81. 110. Lee, L. A., N. D. Puhr, E. K. Ma loney, N. H. Bean, and R. V. Tauxe. 1994 Increase in antimicrobial-resistant Salmonella infections in the United States 1989-1990. J Infect Dis 170: 128-34. 111. Leung, K. Y., and B. B. Finlay. 1991. Intracellular replicat ion is esse virulence of Salmonella Typhimurium. Proc Natl Acad Sci U S A 88: 11470-4. 174

PAGE 189

112. Levesque, C., L. Piche, C. Larose, and P. H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicro Agents Chemother 39: 1 b 85-91. c. ther S. enterica serovars. J Bacteriol 187: 4401-9. vic. de 38-41. d f gyrA mutations cyclohexane resistance, and the presence of class 117. Migura, F. A. Clifton-Hadley, E. humans in the UK. Vet Microbiol 100: 189-95. 113. Levings, R. S., D. Lightfoot, S. R. Partri dge, R. M. Hall, and S. P. Djordjevi 2005. The genomic island SGI1, containing the multiple antibiotic resistance region of Salmonella enterica serovar Typhimurium DT104 or variants of it, is widely distributed in o 114. Levings, R. S., S. R. Part ridge, D. Lightfoot, R. M. Hall, and S. P. Djordje 2005. New integron-associated gene ca ssette encoding a 3-N-aminoglycosi acetyltransferase. Antimicrob Agents Chemother 49: 12 115. Libby, S. J., M. Lesnick, P. Hasegawa, M. Kurth, C. Belcher, J. Fierer, an D. G. Guiney. 2002. Characterization of the spv locus in Salmonella enterica serovar Arizona. Infect Immun 70: 3290-4. 116. Liebana, E., C. Clouting, C. A. Cassar, L. P. Randall, R. A. Walker, E. J. Threlfall, F. A. Clifton-Hadley, A. M. Ridley, and R. H. Davies. 2002. Comparison o I integrons in Salmonella enterica from farm animals in England and Wales. J Clin Microbiol 40: 1481-6. Liebana, E., C. Clouting, L. GarciaLindsay, E. J. Threlfall, and R. H. Davies. 2004. Multiple genetic typing of Salmonella Enteritidis phage-types 4, 6, 7, 8 and 13a isolates from animals and 175

PAGE 190

118. Liebana, E., L. Garcia-Migura, M. F. Breslin, R. H. Davies, and M. J. Woodward. 2001. Diversity of strains of Salmonella enterica serotype enteriti from English poultry farms asse dis ssed by multiple genetic fingerprinting. J Clin 119. 2. ca 120. adley, E. t T 49) from animals and humans in 121. ncond Microbiol 39: 154-61. Liebana, E., L. Garcia-Migura, C. Clouting, C. A. Cassar, F. A. CliftonHadley, E. A. Lindsay, E. J. Threlfall, S. A. Chappell, and R. H. Davies. 200 Investigation of the genetic diversity among isolates of Salmonella enteri serovar Dublin from animals and hum ans from England, Wales and Ireland. J Appl Microbiol 93: 732-44. Liebana, E., L. Garcia-Migura, C. Cl outing, F. A. Clifton-H Lindsay, E. J. Threlfall, S. W. McDowell, and R. H. Davies. 2002. Multiple genetic typing of Salmonella enterica s erotype typhimurium is olates of differen phage types (DT104, U302, DT204b, and D England, Wales, and Northern Ireland. J Clin Microbiol 40: 4450-6. Liebana, E., D. Guns, L. Garcia-Migu ra, M. J. Woodward, F. A. Clifto Hadley, and R. H. Davies. 2001. Molecular typing of Salmonella serotypes prevalent in animals in England: a ssessment of methodology. J Clin Microbiol 39: 3609-16. 122. Liming, S. H., and A. A. Bhagwat. 2004. Application of a molecular bea real-time PCR technology to detect Salmonella species contaminating fruits an vegetables. Int J Food Microbiol 95: 177-87. 176

PAGE 191

123. Lin, A. W., M. A. Usera, T. J. Barrett, and R. A. Goldsby. 1996. Applic of random amplified polymorphic DNA analysis to differentiate strains of Salmonella enteritidis. J Clin Microbiol 34: 870-6. Lindstedt, B. A., E. H ation 124. eir, I. Nygard, and G. Kapperud. 2003. Characterization 125. us eats analysis of Salmonella enterica subsp. enterica 126. by kery. BMC 127. 1. ed thogenicity island carrying multiple antibiotic resistance genes. 128. oc lonal antibody-based assays. J Immunol Methods 137: 1-8. of class I integrons in clinical strains of Salmonella enterica subsp. enterica serovars Typhimurium and Enteritidi s from Norwegian hospitals. J Med Microbiol 52: 141-9. Lindstedt, B. A., T. Vardund, L. Aas, and G. Kapperud. 2004. Multiple-loc variable-number tandem-rep serovar Typhimurium using PCR mu ltiplexing and multicolor capillary electrophoresis. J Microbiol Methods 59: 163-72. Lu, P. L., I. J. Hwang, Y. L. Tung, S. J. Hwang, C. L. Lin, and L. K. Siu. 2004. Molecular and epidemiologic analysis of a county-wide outbreak caused Salmonella enterica subsp. enterica serovar Enteritidis tr aced to a ba Infect Dis 4: 48. Luck, S. N., S. A. Turner, K. Raja kumar, H. Sakellaris, and B. Adler. 200 Ferric dicitrate transport system (Fec) of Shigella flexneri 2a YSH6000 is encod on a novel pa Infect Immun 69: 6012-21. Luk, J. M., and A. A. Lindberg. 1991. Rapid and sensitive detection of Salmonella (O:6,7) by immunomagnetic mon 177

PAGE 192

129. Luna, V. A., D. King, C. Davis, T. Rycerz, M. Ewert, A. Cannons, P. Amuso, and J. Cattani. 2003. Novel sample preparation method for safe and rapid detection of Bacillus anthracis spores in environmental powders and nasal swabs. 130. apid la species in poultry environm ental samples. J Microbiol 131. ak cephalos porins. J Clin Microbiol 41: 2940-5. 134. and R. Helmuth. 1999. Incidence of quinolone rom J Clin Microbiol 41: 1252-5. Lynch, M. J., C. G. Leon-Velarde, S. McEwen, and J. A. Odumeru. 2004 Evaluation of an automated immunomagnetic separation method for the r detection of Salmonel Methods 58: 285-8. Majtan, V., L. Majtanova, and L. Kovac. 2004. Analysis of integrons in human isolates of Salmonella enterica serovar Typhimurium isolated in the Slov Republic. FEMS Microbiol Lett 239: 25-31. 132. Makanera, A., G. Arlet, V. Gautier, and M. Manai. 2003. Molecular epidemiology and characterization of plasmid-encoded beta-lactamases produced by Tunisian clinical isolates of Salmonella enterica serotype Mbandaka resistant to broad-spectrum 133. Malorny, B., E. Paccassoni, P. Fach, C. Bunge, A. Martin, and R. Helmuth. 2004. Diagnostic real-time PCR for detection of Salmonella in food. Appl Environ Microbiol 70: 7046-52. Malorny, B., A. Schroeter resistance over the period 1986 to 1998 in veterinary Salmonella isolates f Germany. Antimicrob Agents Chemother 43: 2278-82. 178

PAGE 193

135. Mammina, C., L. Cannova, S. Massa, E. Goffredo, and A. Nastasi. 2002. Drug resistances in Salmonella isolates from animal foods, italy 1998-2000. Epidemiol Infect 129: 155-61. Mansfield, L., and S. Forsyt 136. he. 1996. Collaborative ring-tri al of Dynabeads anti137. la s: big virulence in small packages. Microbes Infect 2: 145-56. n from 1981 to 2003. Antimicrob 139. 140. tegies associated n 141. tz, L. F. McCaig, J. S. Bresee, C. Shapiro, P. ted 142. Martel, and A. Cloeckaert. 2003. Florfenicol resistance in Salmonella enterica serovar Newport Salmonella for immunomagnetic separation of stressed Salmonella cells from herbs and spices. In t J Food Microbiol 29: 41-7. Marcus, S. L., J. H. Brumell, C. G. Pfeifer, and B. B. Finlay. 2000. Salmonel pathogenicity island 138. Marimon, J. M., M. Gomariz, C. Zigorraga, G. Cilla, and E. Perez-Trallero. 2004. Increasing prevalence of quinolone resistance in human nontyphoid Salmonella enterica isolates obtained in Spai Agents Chemother 48: 3789-93. Martinez, E., and F. de la Cruz. 1988. Transposon Tn21 encodes a RecAindependent site-specific integration system. Mol Gen Genet 211: 320-5. Martinez, J. L., and F. Baquero. 2002. Interactions among st ra with bacterial infection: pa thogenicity, epidemicity, and antibiotic resistance. Cli Microbiol Rev 15: 647-79. Mead, P. S., L. Slutsker, V. Die M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in the Uni States. Emerg Infect Dis 5: 607-25. Meunier, D., S. Baucheron, E. Chaslus-Dancla, J. L. 179

PAGE 194

mediated by a plasmid related to R55 fr om Klebsiella pneumoniae. J Antimicr Chemother 51: 1007-9. Meunier, D., D. Boyd, M. R. M ob 143. ulvey, S. Baucheron, C. Mammina, A. Nastasi, phi 145. F. ng Salmonella typhimurium by phenotypic and 146. A. J. phimurium bovine isolates from farm to E. Chaslus-Dancla, and A. Cloeckaert. 2002. Salmonella enterica serotype Typhimurium DT 104 antibiotic resistance ge nomic island I in se rotype paraty B. Emerg Infect Dis 8: 430-3. 144. Meyerholz, D. K., T. J. Stabel, M. R. Ac kermann, S. A. Carlson, B. D. Jones, and J. Pohlenz. 2002. Early epithelial invasion by Salmonella enterica serovar Typhimurium DT104 in the swine ileum. Vet Pathol 39: 712-20. Mhand, R. A., N. Brahimi, N. Moust aoui, N. El Mdaghri, H. Amarouch Grimont, E. Bingen, and M. Benbachir. 1999. Characterization of extendedspectrum beta-lactamase-produci genotypic typing methods. J Clin Microbiol 37: 3769-73. Miao, E. A., C. A. Scherer, R. M. Tsolis, R. A. Kingsley, L. G. Adams Baumler, and S. I. Miller. 1999. Salmonella Typhimurium leucine-rich repeat proteins are targeted to the SPI1 and SPI2 type III secretion systems. Mol Microbiol 34: 850-64. 147. Millemann, Y., S. Gaubert, D. Remy, and C. Colmin. 2000. Evaluation of IS200-PCR and comparison with other molecular markers to trace Salmonella enterica subsp. enterica serotype Ty meat. J Clin Microbiol 38: 2204-9. 180

PAGE 195

148. ng, ribotyping, and detection of IS200 for tracing avian 149. cherichi a coli K-12 chromosome. Mol Microbiol 150. l strain due to r 151. dT+, Canada. Emerg 152. nella strain harbouring a class 1 integron containing novel 153. valuation of DNA fi ngerprinting by PFGE as an epidemiologic tool for Salmonella infections. Microbiol Immunol 39: 673-6. Millemann, Y., M. C. Lesage, E. Chaslus-Dancla, and J. P. Lafont. 1995. Value of plasmid profili isolates of Salmonella typhimurium and S. ente ritidis. J Clin Microbiol 33: 173-9. Mills, D. M., V. Bajaj, and C. A. Lee. 1995. A 40 kb chromosomal fragment encoding Salmonella typhimurium invasion ge nes is absent from the corresponding region of the Es 15: 749-59. Miriagou, V., L. S. Tzouvelekis, S. Rossi ter, E. Tzelepi, F. J. Angulo, and J. M. Whichard. 2003. Imipenem resistance in a Salmonella clinica plasmid-mediated class A carbapenemase KPC-2. Antimicrob Agents Chemothe 47: 1297-300. Mulvey, M. R., D. Boyd, A. Cloeckaert, R. Ahmed, and L. K. Ng. 2004. Emergence of multidrug-resistant Salmonella Paratyphi B Infect Dis 10: 1307-10. Mulvey, M. R., D. A. Boyd, L. Baker, O. Mykytczuk, E. M. Reis, M. D. Asensi, D. P. Rodrigues, and L. K. Ng. 2004. Characterization of a Salmo enterica serovar Agona OXA-type beta-lactamase (blaOXA-53) and 6'-N-aminoglycoside acetyltransferase genes [aac(6')-I30]. J Antimicrob Chemother 54: 354-9. Murase, T., T. Okitsu, R. Suzuki, H. Morozumi, A. Matsushima, A. Nakamura, and S. Yamai. 1995. E 181

PAGE 196

154. Nesse, L. L., K. Nordby, E. Heir, B. Bergsjoe, T. Vardund, H. Nygaard, an G. Holstad. 2003. Molecular analyses of Salmonella enterica isolates from fish feed factories and fish feed ingr edients. Appl Environ Microbiol 69: 1075-81. d lasses from 156. M. Basina, V. Nguyen, and E. Y. Rosenberg. 1998. Multidrug 157. Infect Immun 64: 5410-2. i U S A 93: 7800-4. face 160. aard. 1997. g and 155. Nield, B. S., A. J. Holmes, M. R. Gillings, G. D. Recchia, B. C. Mabbutt, K. M. Nevalainen, and H. W. Stokes. 2001. Recovery of new integron c environmental DNA. FEMS Microbiol Lett 195: 59-65. Nikaido, H. efflux pump AcrAB of Salmonella typhimurium excretes only those beta-lactam antibiotics containing lipophilic side chains. J Bacteriol 180: 4686-92. Ochman, H., and E. A. Groisman. 1996. Distribution of pathogenicity islands in Salmonella spp 158. Ochman, H., F. C. Soncini, F. Solomon, and E. A. Groisman. 1996. Identification of a pathoge nicity island required for Salmonella survival in host cells. Proc Natl Acad Sc 159. Oh, B. K., Y. K. Kim, K. W. Park, W. H. Lee, and J. W. Choi. 2004. Sur plasmon resonance immunosensor for the detection of Salmonella Typhimurium. Biosens Bioelectron 19: 1497-504. Olsen, J. E., M. N. Skov, O. Angen, E. J. Threlfall, and M. Bisg Genomic relationships between selected phage types of Salmonella enterica subsp. enterica serotype typhimurium defi ned by ribotyping, IS200 typin PFGE. Microbiology 143 ( Pt 4):1471-9. 182

PAGE 197

161. Pancetti, A., and J. E. Galan. 2001. Characterization of the mutS-proximal region of the Salmonella typhimurium SPI-1 identifie s a group of pathogenicity island-associated genes. FEMS Microbiol Lett 197: 203-8. 162. Patrick, M. E., P. M. Adcock, T. M. Go mez, S. F. Altekruse, B. H. Holland, R. V. Tauxe, and D. L. Swerdlow. 2004. Salmonella Enteritidis infections, United States, 1985-1999. Emerg Infect Dis 10: 1-7. 163. Pezzella, C., A. Ricci, E. DiGiannatale, I. Luzzi, and A. Carattoli. 2004. Tetracycline and streptomycin resistance genes, transposons, and plasmids in Salmonella enterica isolates from animals in Italy. Antimicrob Agents Chemother 164. elland. 2002. Evolutionary genomics atl Acad 165. R. Ward, B. Rowe, and E. J. 166. nd Courvalin, P. 1999. Mechanisms of 48: 903-8. Porwollik, S., R. M. Wong, and M. McCl of Salmonella : gene acquisitions revealed by micr oarray analysis. Proc N Sci U S A 99: 8956-61. Punia, P., M. D. Hampton, A. M. Ridley, L Threlfall. 1998. Pulsed-field electro phoretic fingerprinting of Salmonella Indiana and its epidemiological app licability. J Appl Microbiol 84: 103-7. Quintiliani, R., Sahm, D. F JR., a Resistance to Antimicrobial Agents. In P. R. Murray, E.J. Barron, M.A. Pfaller, F.C. Tenover, and R.H. Yolken (ed.), Manual of clinical microbiology, 7 th ed American Society for Micr obiology, Washington, DC 183

PAGE 198

167. Rahman, M., A. Ahmad, and S. Shoma. 2002. Decline in epidemic of multi resistant Salmonella Typhi is not associated w ith increased incidence of antibiotic-susceptible strain in Bangladesh. Epidemiol Infec drug t 129: 29-34. ing purposes. J Clin 169. n thirty-five serotypes of Salmonella enterica isolated from humans 170. rica serovar Typhimurium DT104. Appl Environ 171. Med 172. infrom animals in Pennsylvania. J Clin Microbiol 40: 4679-84. 168. Ramisse, V., P. Houssu, E. Hernandez, F. Denoeud, V. Hilaire, O. Lisanti, F. Ramisse, J. D. Cavallo, and G. Vergnaud. 2004. Variable number of tandem repeats in Salmonella enterica subsp. enterica for typ Microbiol 42: 5722-30. Randall, L. P., S. W. Cooles, M. K. Osborn, L. J. Piddock, and M. J. Woodward. 2004. Antibiotic resistance genes, integrons and multiple antibiotic resistance i and animals in the UK. J Antimicrob Chemother 53: 208-16. Randall, L. P., and M. J. Woodward. 2001. Multiple antibiotic resistance (mar) locus in Salmonella ente Microbiol 67: 1190-7. Randall, L. P., and M. J. Woodward. 2001. Role of the mar locus in virulence of Salmonella enterica serovar Typhimurium DT104 in chickens. J Microbiol 50: 770-9. Rankin, S. C., H. Aceto, J. Cassidy, J. Holt, S. Young, B. Love, D. Tewari, D S. Munro, and C. E. Benson. 2002. Molecular characterization of cephalospor resistant Salmonella enterica serotype Newport isolates 184

PAGE 199

173. Reche, M. P., M. A. Echeita, J. E. de los Rios, M. A. Usera, P. A. Jimenez, A. M. Rojas, J. Colas, and I. Rodriguez. 2003. Comparison of phenotypic genotypic markers for characte rization of an outbreak of Salmonella serot and ype 174. of lsed. J Clin Microbiol 36: 2314-21. De 177. M. Hernandez, T. Esteve, J. Hoorfar, and M. Pla. 178. Heuzenroeder. 2005. Discrimination within 179. oncard, B. Dychinco, J. Davies, and D. Mazel. 2001. The evolutionary history of chromosomal super-integrons Havana in captive raptors. J Appl Microbiol 94: 65-72. Ridley, A. M., E. J. Th relfall, and B. Rowe. 1998. Genotypic characterization Salmonella Enteritidis phage types by plasmi d analysis, ribotyping, and pu field gel electrophoresis 175. Rijpens, N., L. Herman, F. Vereecken, G. Jannes, J. De Smedt, and L Zutter. 1999. Rapid detection of stressed Salmonella spp. in dairy and egg products using immunomagnetic separa tion and PCR. Int J Food Microbiol 46: 37-44. 176. Robinson-Dunn, B. 2002. The microbiology laboratory's role in response to bioterrorism. Arch Pathol Lab Med 126: 291-4. Rodriguez-Lazaro, D. 2003. A rapid and direct r eal time PCR-based method for identification of Salmonella spp. J Microbiol Methods 54: 381-90. Ross, I. L., and M. W phenotypically closely rela ted definitive types of Salmonella enterica serovar Typhimurium by the multiple amplificati on of phage locus typing technique. J Clin Microbiol 43: 1604-11. Rowe-Magnus, D. A., A. M. Guerout, P. Pl 185

PAGE 200

provides an ancestry for multiresistant integrons. Proc Natl Acad Sci U S A 98: 652-7. Sandvang, D., F. M. Aarestrup, and L. B. Jensen. 1998. Characterisation of integrons and antibiotic resistance genes in Danish mult 180. iresistant Salmonella 181. ella pneumoniae 182. beads nella system in the detection of Salmonella species in foods, animal 183. id-Cycle Real-Time PCR:A 184. f -enzyme amplified fragment lmonella 185. A ic gene -integration functi ons: integrons. Mol enterica Typhimurium DT104. FEMS Microbiol Lett 160: 37-41. Schmidt, F., and I. Klopfer-Kaul. 1984. Evolutionary relationship between Tn21-like elements and pBP201, a plas mid from Klebsi mediating resistance to gentamicin and eight other drugs. Mol Gen Genet 197: 109-19. Shaw, S. J., B. W. Blais, and D. C. Nundy. 1998. Performance of the Dyna antiSalmo feeds, and environmental samples. J Food Prot 61: 1507-10. Cockerill F. R. III, and T. F. Smith 2002. Rap Revolution for Clinical Microbiology. ASM News 68: 77-83. Sood, S., T. Peters, L. R. Ward, and E. J. Threlfall. 2002. Combination o pulsed-field gel electrophor esis (PFGE) and single length polymorphism (SAFLP) for differentiation of multiresistant Sa enterica serotype typhimurium. Clin Microbiol Infect 8: 154-61. Stokes, H. W., and R. M. Hall. 1989. A novel family of potentially mobile DN elements encoding site-specif Microbiol 3: 1669-83. 186

PAGE 201

186. 97. urine model of chronic Salmonella infection. Infect Immun 187. based 188. ella Am J Pathol 50: 109-36. f Salmonella gel electrophoresis. 190. 191. Pang. 1995. 192. ntimicrobial drug resistance in Salmonella : problems and perspectives in foodand water-borne infections. FEMS Microbiol Rev 26: 141-8. Sukupolvi, S., A. Edelstein, M. Rhen S. J. Normark, and J. D. Pfeifer. 19 Development of a m 65: 838-42. Taitt, C. R., Y. S. Shubin, R. Angel, and F. S. Ligler. 2004. Detection of Salmonella enterica serovar Typhimurium by using a rapid, arrayimmunosensor. Appl Environ Microbiol 70: 152-8. Takeuchi, A. 1967. Electron microscope studies of experimental Salmon infection. I. Penetration into the intestinal epithelium by Salmonella Typhimurium 189. Tamada, Y., Y. Nakaoka, K. Nishimori, A. Doi, T. Kumaki, N. Uemura, K. Tanaka, S. I. Makino, T. Sameshima, M. Akiba, M. Nakazawa, and I. Uchida. 2001. Molecular typing and epidemiological study o enterica serotype Typhimurium isolates from cattle by fluorescent amplifiedfragment length polymorphism fingerprint ing and pulsed-field J Clin Microbiol 39: 1057-66. Tauxe, R. V. 1997. Emerging foodborne diseases: an evolving public health challenge. Emerg Infect Dis 3: 425-34. Thong, K. L., Y. F. Ngeow, M. Al twegg, P. Navaratnam, and T Molecular analysis of Salmonella enteritidis by pulsed-field gel electrophoresis and ribotyping. J Clin Microbiol 33: 1070-4. Threlfall, E. J. 2002. A 187

PAGE 202

193. Torok, T. J., R. V. Tauxe, R. P. Wise, J. R. Livengood, R. Sokolow, S. Mauvais, K. A. Birkness, M. R. Sk eels, J. M. Horan, and L. R. Foster. 1997. A large com munity outbreak of salmonellosis caused by intentional 194. nd A. tibiotic resistance carried by 195. s, K. Rajakumar, and B. Adler. 2003. 196. nce 197. M. T. Kelly, V. K. Balan, W. R. Mac Kenzie, e alfalfa sprouts. JAMA 281: 158-62. ella e in Greece during 1990-97. contamination of restaurant salad bars. Jama 278: 389-95. Tosini, F., P. Visca, I. Luzzi, A. M. Dion isi, C. Pezzella, A. Petrucca, a Carattoli. 1998. Class 1 integron-borne multiple-an IncFI and IncL/M plasmids in Salmonella enterica serotype typhimurium. Antimicrob Agents Chemother 42: 3053-8. Turner, S. A., S. N. Luck, H. Sake llari Molecular epidemiology of the SRL pa thogenicity island. Antimicrob Agents Chemother 47: 727-34. van Asten, A. J., and J. E. van Dijk. 2005. Distribution of "classic" virule factors among Salmonella spp. FEMS Immunol Med Microbiol 44: 251-9. Van Beneden, C. A., W. E. Keene, R. A. Strang, D. H. Werker, A. S. King, B. Mahon, K. Hedberg, A. Bell, and D. Fleming. 1999. Multinational outbreak of Salmonella enterica serotyp Newport infections due to contaminated 198. Velonakis, E. N., A. Markogiannakis, L. Kondili, E. Varjioti, Z. Mahera, E. Dedouli, A. Karaitianou, N. Vakalis, and K. Bethimouti. 2001. Evolution of antibiotic resistan ce of non-typhoidal Salmon Euro Surveill 6: 117-20. 188

PAGE 203

199. Villa, L., and A. Carattoli. 2005. Integrons and transposons on the Salmon enterica serovar typhimurium virulence pl asmid. Antimicrob Agents Chemother 49: 1194-7. Wain, J., N. T. Hoa, N. T. Chinh, H. Vinh, M. J. Everet ella 200. t, T. S. Diep, N. P. 201. Functions and effectors of the 202. e Molecular nature of gene s. In K.T Kane (ed), Molecular 203. o un Day, T. Solomon, N. J. White, L. J. Piddock, and C. M. Parry. 1997. Quinolone-resistant Salmonella Typhi in Vietnam: mol ecular basis of resistance and clinical response to tr eatment. Clin Infect Dis 25: 1404-10. Waterman, S. R., and D. W. Holden. 2003 Salmonella pathogenicity island 2 type III secretion system. Cell Microbiol 5: 501-11. Weaver, R. F. 1999. Th Biology, 1 st ed. McGraw-Hill companies Inc. United States. Weigel, R. M., B. Qiao, B. Teferedegne, D. K. Suh, D. A. Barber, R. E. Isaacson, and B. A. White. 2004. Comparison of pulsed field gel electrophoresis and repetitive sequence polymerase chai n reaction as genotyping methods for detection of genetic diversity and inferring transmission of Salmonella Vet Microbiol 100: 205-17. 204. Weinstein, D. L., B. L. O'Neill, D. M. Hone, and E. S. Metcalf. 1998. Differential early interactions between Salmonella enterica serovar Typhi and tw other pathogenic Salmonella serovars with intestinal ep ithelial cells. Infect Imm 66: 2310-8. 189

PAGE 204

205. Werber, D., J. Dreesman, F. Feil, U. van Treeck, G. Fell, S. Ethelberg, A. M. Hauri, P. Roggentin, R. Prager, I. S. Fisher, S. C. Behnke, E. Bartelt, E. Weise, A. E llis, A. Siitonen, Y. Ander sson, H. Tschape, M. H. Kramer, and 206. 1. The isolation 207. K. Mc Gill, J. D. Collins, and E. Gormley. 2002. The prevalence pley, ther E. E. A. Ammon. 2005. International outbreak of Salmonella Oranienburg due to German chocolate. BMC Infect Dis 5: 7. White, D. G., S. Zhao, R. Sudler, S. Ayers, S. Friedman, S. Chen, P. F. McDermott, S. McDermott, D. D. Wagner, and J. Meng. 200 of antibiotic-resistant Salmonella from retail ground meats. N Engl J Med 345: 1147-54. Whyte, P., and PCR detection of Salmonella contamination in raw poultry. Vet Microbiol 89: 53-60. 208. Winokur, P. L., A. Brueggemann, D. L. DeSalvo, L. Hoffmann, M. D. A E. K. Uhlenhopp, M. A. Pfaller, and G. V. Doern. 2000. Animal and human multidrug-resistant, cephalosporin-resistant Salmonella isolates expressing a plasmid-mediated CMY-2 AmpC beta-lactamase. Antimicrob Agents Chemo 44: 2777-83. 209. Wood, M. W., M. A. Jones, P. R. Watson, S. Hedges, T. S. Wallis, and Galyov. 1998. Identification of a path ogenicity island required for Salmonella enteropathogenicity. Mol Microbiol 29: 883-91. 190

PAGE 205

210. Wright, D. J., P. A. Chapman, and C. A. Siddons. 1994. Immunomagnetic separation as a sensitiv e method for isolating Escherichia coli O157 from foo samples. Epidemiol Infect 113: 31-9. Yao, J. D. C. a. M., R.C.JR. 1999. Antimicrobial Agents. In P.R. Murray, E Barron, M.A. Pfaller, F.C. Tenover, and R d 211. .J. .H. Yolken (ed.), Manual of clinical 212. ance among Salmonella strains isolated from healthy humans in China. 213. t, T. Donkar, C. Bolin, S. Munro, E. J. Baron, and R. D. Walker. 214. Immun 67: 1974-81. microbiology, 7 th ed. American Society for Microbiology, Washington, DC Zhang, H., L. Shi, L. Li, S. Guo, X. Zh ang, S. Yamasaki, S. Miyoshi, and S. Shinoda. 2004. Identification and characterizatio n of class 1 integron resist gene cassettes Microbiol Immunol 48: 639-45. Zhao, S., S. Qaiyumi, S. Friedman, R. Sing h, S. L. Foley, D. G. White, P. F. McDermot 2003. Characterization of Salmonella enterica serotype Newport isolated from humans and food animals. J Clin Microbiol 41: 5366-71. Zhou, D., W. D. Hardt, and J. E. Galan. 1999. Salmonella typhimurium encodes a putative iron transport system within the centisome 63 pathogenicity island. Infect 191

PAGE 206

Appendix A Table A1. Detection and Isolation of Salmonella from Food Food and average PCR Number of CFU on CFU spiked Enrichments result XLD agar BPW 40, 0 BPW+IMS 0 C (Unspiked) hicken cuts BPW+TT 40, 0 BPW 39.16, -1-S BPW+IMS 0 Chicken cuts (10 CFU BPW+TT 34.77, +8-S of S.Typhimurium) BPW 35.26, +38-S BPW+IMS 17-S Chicke of S.Typhi + 159-S n cuts (264 CFU murium) BPW+TT 29.1, BPW 40, 0 BPW+IMS 0 C ( BPW+TT 40, 0 hicken cuts Unspiked) BPW 39.0, + 70-S BPW+IMS 215-S Chicken cuts (4 CFU o f S.T BPW+TT 29.8, + 27-S yphimurium) BPW 39.4, + 164-S, 3 4-NS Chicke n cuts (4 CFU o f BPW+IMS 327-S, 34-NS S.Typhimurium, 73 o CFU of E.coli and CFU f Citrobacter 74 Proteus) BPW+TT 30.03, +90-S, 20-NS BPW 40, 0 BPW+IMS 3-possible contamination C (unspiked) BPW+TT 40, 0 hicken cuts BPW 33.29, +111-S BPW+IMS 295-S C hicken cuts (5 CFU o f S.Enteritidis) BPW+TT 33.8, + 14-S BPW 35.26, +101-S, 193-NS Chicken cuts (5 CFU o f BPW+IMS 134-S, 71-NS S.Enteritidis, 99 CFU Citrobacter, 59 CFU of E.coli and Proteus) BPW+TT 33.68, +22 of 192

PAGE 207

Food and average CFU spiked Enrichments result Number of CFU on XLD agar PCR BPW 40, 0 BPW+IMS 0 Egg salad (unspiked) BPW+TT 40, 0 B 2 PW 6.52, + 82-S BPW+ IMS 91-S Egg salad (7 CFU S ) 27 + 17-S .Typhimurium BPW+TT .3, BPW 3 600-S 1.5, + BPW+ IMS 1200-S Egg salad (58 CFU 23., +525-S S.Typhimurium) BPW+TT 03 BPW 40, 0 BPW+ IMS 0 Egg salad (unspiked) 4BPW+TT 0, 0 BPW 36.71, + 42-S BPW+ IMS 130-S Egg salad (6 CFU S ) 33., +29-S .Typhimurium BPW+TT 47 BPW 3 40-S 3.42, + BPW+ IMS 270-S Egg salad (62 CFU N S.Typhimurium) BPW+TT D 181-S BPW 40, 0 BPW+ IMS 0 Egg salad (unspiked) BPW+TT 40, 0 BPW 29.4, 44-S BPW+IMS 43-S Egg salad (7 CFU yphimuriu S.Tm) TT 30.9, 13-S BPW+ + BPW 39.7, 128-S, 10-NS BPW+IMS 193-S Egg salad (7 CFU S.Ty CFU Citrobacter 167 CFU E.coli and 29.28, +37-S, 2-NS phimurium, 12 BPW+TT Proteus) BPW 40, 0 BPW+IMS 0 Egg salad (unspiked) TT 40, BPW+ 0 BPW 34 + .8, 27-S Egg salad (7 CFU S.Typhimurium) BPW+IMS 56-S 193

PAGE 208

Food and average CFU spiked PCR result Number of CFU on XLD agar Enrichments BPW+ TT 40, 3-S BPW 35 + 52-S .7, Egg salad (7 CFU BPW+IMS 0, 2-NS S.Typhimurium, 12 CFU Citrobacter 167 TT 36.8, BPW+ + 46-S CFU E.coli and Proteus) BPW 40, 0 BPW+ IMS 0 Hamburger Patty 4(unspiked) BPW+TT 0, 0 BPW 36.3, + 36-S, Low background BPW+ IMS 6-S, Low background Hamburger patty (8 30 + 56-S CFU S.Typhimurium) BPW+TT .0, BPW 32, + 133-S, Low background BPW+ IMS 57-S, Low background Hamburger Patty (8 CFU S.Typhimurium, 8 C Proteus) 33 + FU Citrobacter 82 CFU E.coli and BPW+TT .5, 1-S BPW 40, 32 NS BPW+IMS 46-NS Ha ) 3 mburger (unspiked BPW+TT 5.4, + 0 BPW 3 230-S 4.07, + BPW+IMS 800-S Hamburger (4 CFU of S.Typhimurium) 3 50-S BPW+TT 8.24, + BPW 3 212-S, 129-NS 4.04, + BPW+IMS 352-S, 71-NS H f S CF 3 12-S, 2-NS amburger (4 CFU o .Typhimurium, 74 U of Citrobacter 4 BPW+TT 38.27, + CFU of E.coli and Proteus) BPW 40, 12-NS BPW+IMS 115-NS Ha d) BPW+TT 40, 0 mburger (unspike BPW 39.72, -13-S, 97-NS BPW+IMS 46-S, 188-NS Hamburger (5 CFU S.Enteritidis) 3 50-S BPW+TT 6.2, + BPW 38.0, + 64-S, 53-NS H S.Enteritidis, 138 CFU 87-S, 68-NS amburger (5 CFU BPW+IMS 194

PAGE 209

Food and average CFU spiked PCR result Number of CFU on XLD agar Enrichments Citrobacter, 71 CFU E 36.44 +600-S, 30-NS BPW+TT .coli and Proteus ) BPW 40, High background BPW+IMS Low background Tuna sushi (unspiked) BPW+TT 40, Low background BPW 32.4, + 107-S, High background BPW+IMS 19-S, 6-NS Tuna sushi (6 CFU, 29.4, + 49-S, 0-NS S.Typhimurium) BPW+TT BPW 31.9, + 260-S, High background BPW+IMS 230-S, Low background Tuna sushi (47 CFU, S.Typhimurium) BPW+TT 28.3, + 360-S, 0-NS BPW Low background BPW+IMS Low background Tuna sushi (unspiked) BPW+TT 0 BPW 40, + 18-S, Low background BPW+ IMS 39-S Tuna sushi (6 CFU, S.Typhimurium) TT 40, BPW+ 1-S BPW 40, + 250-S, Low background BPW+IMS 560-S Tuna sushi (46 CFU, S.Typhimurium) TT 40, BPW+ + 9-S BPW 39.3, Low background BPW+IMS Low background salmon Sushi TT 40, (unspiked) BPW+ 0 BPW 34.5, + 12-S, Low background BPW+IMS 28-S Salmon sushi (7 CFU, S.Typhimurium) BPW+TT 40, + 2-S BPW 40, 18-S, Low background BPW+IMS 5-S Salmon sushi (7 CFU, Citrobacter, 45 CFU E.coli and Proteus ) 45-S S.Typhimurium, 3 CFU BPW+TT 40, BPW 40, 1-NS BPW+IMS 0 Blueberries (unspiked) TT BPW+ 40, 0 BPW 40, 19-S, Low background Blueberries (13 CFU 195

PAGE 210

Food and average CFU spiked PCR result Number of CFU on XLD agar Enrichments BPW+IMS 239-S S.Enteritidis) BPW+TT 40, 9-S BPW 40, 390-S BPW+IMS 8-S Blueberries (37 CFU S.Typhimurium) BPW+TT 40, 280-S BPW 40, 0 BPW+IMS 0 Blueberries (unspiked) BPW+TT 40, 0 BPW 40, 17-S BPW+IMS 19-S Blueberries (4 CFU S.Enteritidis) BPW+TT 40, 17-S BPW 40, 62-S BPW+IMS 162-S Blueberries (8 CFU S.Typhimurium) BPW+TT 40, 21-S BPW 40, 0 BPW+IMS 0 Blueberries (unspiked) BPW+TT 0 BPW 40, 25-S BPW+IMS 10-S Blueberries (3 CFU S.Enteritidis) BPW+TT 40, 6-S BPW 40, 60-S BPW+IMS 136-S Blueberries (3 CFU S. En U Citrobacter E.coli and Proteus ) teritidis, 2 CF 48 CFU BPW+TT 40, 19-S BPW 40, 0 BPW+IMS 0 Blueberries (unspiked) TT BPW+ 0 BPW 40, 33-S, 1-NS BPW+IMS 61-S, 1-NS Blueberries (4 CFU S.Enteritidis) BPW+TT 40, 16-S BPW 40, 26-S, 1-NS BPW+IMS 22-S, 1-NS Blueberries (4 CFU S. Citrobacter, 48 CFU Enteritidis, 3 CFU BPW+TT E.coli and Proteus ) 40, 325-S Blueberries (unspiked) BPW 40, 196

PAGE 211

Food and average CFU spiked PCR result Number of CFU on XLD agar Enrichments For PCR only BPW +TT 40, BPW + Low spiked (7 CFU of S. Typhimurium) TT BPW + + BPW + Mixed Spiked (7 CFU f S. Typhimurium, o Citrobacter, E.coli and BPW+TT + Proteus BPW 40, 0 BPW+IMS 0 Cheese (unspiked) TT 40, BPW+ 0 BPW 40, 1-S BPW+IMS 0 Cheese (12 CFU of S.Typhimurium) TT 40, BPW+ 0 BPW 38.71, +1-S, 28-NS BPW+IMS 1-S, 1-NS Cheese (12 CFU of Salmonella; 92 CFU of Citrobacter and 76 TT 40, BPW+ 0 CFU of E.coli Proteus N/A BPW 40, 0 BPW+ IMS 0 Cheese (unspiked) BPW+TT 40, 0 BPW 40, 0 BPW+ IMS 0 Cheese (8 CFU of S.Typhimurium) BPW+TT 3 8 + .7, 0 BPW 40, 5-S, 9-NS Cheese (8 CFU BPW+ IMS 4-S S.Typhimurium, 83 Proteus) 4CFU of Citrobacter 70 CFU of E.coli and BPW+TT 0, 0 BPW 40, 0 BPW+IMS 0 Cheese (unspiked) BPW+TT 40, 0 BPW 3 6.4, + 0 BPW+IMS 0 Cheese (5 CFUS.Enteritidis) BPW+TT 40, 0 BPW 37.78, +5-S, 9-NS Cheese (5CFU 197

PAGE 212

Food and average CFU spiked PCR result Number of CFU on XLD agar Enrichments BPW+IMS 4-S S TT 40, .Enteritidis, 90Citrobacter, 59E.coli and Proteus ) BPW+ 0 BPW 4 0, 0 BPW+ IMS 0 Cheese (unspiked) BPW+TT 4 0, 0 BPW 40, 0 BPW+ IMS 0 Cheese (5 CFU of 36., + S.Enteritidis) BPW+TT 73 0 BPW 38. 74, + 0 BPW+ IMS 0 Cheese (5 CFU of S.Enteritidis, 94 CFU, C f E 34 + itrobacter, 48 CFU o .coli and Proteus BPW+TT .6, 0 BPW-O/N 40, 0 BPW+ IMS 0 Cheese (unspiked) BPW+TT 3 8 .8, 0 BPW-O/N 1 TNTC-S 8.9, + BPW+IMS TNTC-S Cheese (2 CFU, S.Enteritidis) TT 16. 47, +TNTC-S BPW+ BPW-O/N 29.6, +0, high background BPW+IMS 31-S, 85-NS Cheese (2 CFU BPW+ TT-O/N 17.45, TNTC-S + S.Enteritidis, 130 CFU C S 450-S itrobacter, 67 CFU E.coli and Proteus ) BPW+TT+IM BPW 40, 0 BPW+ IMS 0 M ) 4ayonnaise (unspiked BPW+TT 0, 0 BPW 3 107-S 6.0, + BPW+IMS 121-S Mayonnaise (5 CFU S.Typhi) TT 40, 47-S murium BPW+ BPW 35.8, + 197S, 18-NS BPW+IMS 400-S, 0 Mayonnaise (5 CFU S.Typhimurium, 66 CFU Citrobacter 44 TT 228-S, 33-NS BPW+ 40, + CFU E.coli and Proteus) BPW 40, 0 Mayonnaise (unspiked) IMS BPW+ 0 198

PAGE 213

Food and average CFU spiked PCR result Number of CFU on XLD agar Enrichments BPW+TT 40, 0 BPW 3 154-S 6.6, + BPW+ IMS 206-S Mayonnaise (4 CFU S.Typhiumurium) 102-S BPW+ TT 40, BPW 35.6, + 295-S, 19-NS BPW+ IMS 339-S, 1-NS Mayonnaise (4 CFU S.Typhimurium, 79 CFU 215-S, 35-NS Citrobacter 47 CFU E.coli and Proteus) BPW+ TT 40, BPW 40, 0 BPW+IMS 0 Mayonnaise (unspiked) BPW+TT 39.7, 0 BPW 39.6, + 7-S BPW+IMS 19-S Mayonnaise (7 CFU, 39 + 5-S S.Enteritidis) BPW+TT .9, BPW 40, 18-S, 20 -NS BPW+IMS 28-S, 6-NS Mayonnaise (7 CFU S.Enteritidis, 144 CFU C E.c s ) 40, 60-S, 6-NS itrobacter, 41 CFU oli and Proteu BPW+TT BPW 40, 0 BPW+IMS 0 Orange juice (unspiked) BPW+TT 40, 0 BPW 36., + 01 24-S BPW+ IMS 106-S Orange juice (5 CFU of S.Typhimurium) 34., +14-S BPW+TT 53 BPW 38.10, +26-S, 21-NS BPW+ IMS 40-S, 13-NS Orange juice (5 CFU of S. Typhimurium, 113 C 40, 27-S, 12-NS FU of Citrobacter 59 CFU of E.coli and Proteus) BPW+TT BPW 40, 0 BPW+IMS 0 Orange Juice (unspiked) BPW+TT 40, 0 BPW 37.92, +11-S BPW+ IMS 5-S Orange juice (7 CFU of 34., +13-S S.Typhimurium) BPW+TT 68 199

PAGE 214

Food and average CFU spiked PCR result Number of CFU on XLD agar Enrichments BPW 37.3, + 28-S, 6-NS BPW+ IMS 21-S, 4-NS Orange juice (7 CFU of S. Typhimurium, 93 C Proteus) 35., + FU of Citrobacter 59 CFU of E.coli and BPW+TT 76 15-S BPW 40, 0 BPW+IMS 0 Orange juice (unspiked) 3 BPW+TT 9.5, 0 BPW 38.34, +1-S BPW+ IMS 6-S Orange juice (5 CFU of S.Enteritidis) 39 2-S BPW+TT .8. BPW 39.12, 4-S, 7-NS BPW+ IMS 3-S, 15-NS Orange juice (5 CFU of S. Enteritidis, 100 CFU o of E us) 39.5, + f Citrobacter, 50 CFU .coli and Prote BPW+TT 18-S species from artificially seeded food samples. The or s Salmonella E.coli and teus species was not determined. BPW=Buffered Peptone Water, BPW+IM PCR indte the CT values. + = positive PCR tion. XLD -Lysin ate, S= Salmonella e The PCR results for blueberries (Gray cells) were negative fo r four experiments because the samples were store over ich mve caused cell lysis and possible DNA degradation. Detection and isolation o iginal spiking count i f Salmonella s hown for each of the organism species, Citrobacter. The viable c ount for Pro S= BPW + imm unomagnetic separation, BPW+TT= BPW+ tetrathionate broth. The n umb ers for ica reaction, = negative PC on XLD agar, NS= NonR reac = Xylose e Desoxychol Salmonella TNTC= Too Num rous to Count d at o C for a mon th, wh ight ha 200

PAGE 215

Figure A1.Ribotypin g of Wild type Salmon olat dicated. The percent simila rity between isolates is represented ella Is es Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]Ribotyping-EcoR1 Ribot yping-E coR1 Ribotyping results of the 100 wild type Salmonella isolates. The serotype names and sources are in 100 95 90 85 80 75 70 65 60 55 CBD 436 S.Paratyphi A ratyphi CBD 825,S.Pa CBD 813,S.Jav CBD 445 S.Jav CBD 429 S. Or CBD 585, S.Ne iana iana anienburg wport CBD 604, S.Newport CBD 587, S.Newport CBD 592, S.Newport CB3, S.Newport CB S.Newport CB S.Newport CB S.Newport CB S.Newport CBS.Sspp1 CB S.Newport CB S.Newport CB S.Newport CB S.Newport CB S.Newport CBS.Newport CB S.Newport Newport Newport Newport atum Newport Newport Newport Newport ndiego andiego ading ading n teritidis eritidis eritidis ta CBD 437,S.Saintpaul CBD 782, S.Stanley CBD 576 S.Kentucky CBD 577 S.Kentucky CBD 578 S. Mbandaka CBD 580 S.Muenster CBD 581 S.Muenster CBD 438 S.Typhimurium CBD 820,S.Typhimurium CBD 746 S.Typhimurium CBD 427, S.Newport CBD 443 S.Hildgo CBD 434 S.Branderburg CBD 574 S.Istanbul CBD 830 S.Javiana CBD 69 S.Javiana CBD 569 S.Alachua Clinical Clinical Clinical Environmental Environmental Environmental Clinical Environmental Environmental Clinical Environmental Environmental Environmental Clinical Clinical Environmental Environmental Environmental Environmental Environmental Clinical Environmental Environmental Environmental Clinical Clinical Environmental Environmental Clinical Environmental Clinical Clinical Environmental Environmental Clinical Clinical Environmental Environmental Environmental Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Environmental Environmental Environmental Environmental Environmental Clinical Clinical Clinical Clinical Environmental Clinical Environmental Clinical Clinical Environmental 70 80 D 21 D 572, D 595, D 596, D 829, D 806, D 586, D 589, D 598, D 571, D 590, D 815, D 588, CBD 597, S. CBD 593, S. CBD 759, S. CBD 814,S.An CBD 591, S. CBD 594, S. CBD 827, S. CBD 584, S. CBD 821,S.Sa CBD776, S.S CBD 582 S.Re CBD 583 S.Re CBD 32 S.Nima CBD 831, S.Muenche CBD 440 S.Muenchen CBD 441 S.Muenchen CBD 442 S.Muenchen CBD 809,S.Muenchen CBD 822,S.subsp.1 CBD 832 S.Enteritidis CBD 781, S.Enteritidis CBD779, S.En CBD 439 S.Ent CBD 818,S.Ent CBD 805,S.Ber CBD 33 S.Aberdeen CBD 810,S.Heildelberg CBD 446 S.Typhimurium CBD 775, S.Typhimurium CBD 828 S.Tyhpimurium CBD 757 S.Typhimurium CBD 431,S.Saintpaul CBD778, S.Typhimurium CBD 811,S.I 4,12:i :CBD 816,S.Typhimurium CBD 823,S.Typhimurium CBD777, S.Typhimurium CBD 817,S.Typhimurium CBD 570 S.Anatum CBD 425, S.Newport CBD 426, S.Newport CBD 428, S.Newport CBD 444 S.Alamo CBD 435 S.Westhampton CBD 430 S.Apapa CBD 579 S.Montvideo CBD 67, S.Newport CBD 824,S.Tallahassee CBD 808,S.Muenchen CBD 575 S.Istanbul CBD 573 S.Istanbul CBD 807,S.Javiana CBD 819,S.Javiana CBD 603 S.Javiana CBD 222 S.Javiana CBD 826 S.Javiana CBD 833 S.IV 50:z4,z23:CBD 780 S.IV 50:z4,z23:CBD 747 S.IV 50:z4,z23:-CBD 432 S.arizonae CBD 433 S.arizonae Clinical Clinical Clinical Clinical Clinical Clinical Environmental Clinical Clinical Clinical Clinical Clinical Clinical Environmental Clinical Clinical Clinical Environmental Clinical Environmental Environmental Clinical Clinical Clinical Environmental Environmental Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Environmental Clinical 201

PAGE 216

Figure A2. PFGE of Wild type Salmonella Isolates Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]PFGE Xba-1 100 95 90 85 80 75 70 65 60 55 50 45 40 35 30 25 PFGE Xba-1 CBD 821,S.Sandiego CBD776, S.Sandiego CBD 582 S.Reading CBD 583 S.Reading CBD 814,S.Anatum CBD 815,S.Newport CBD 436 S.Paratyphi A CBD 825,S.Paratyphi CBD 570 S.Anatum CBD 833 S.IV 50:z4,z23:CBD 747 S.IV 50:z4,z23:-CBD 780 S.IV 50:z4,z23:CBD 432 S.arizonae CBD 437,S.Saintpaul CBD 434 S.Branderburg CBD 806,S.Sspp1 CBD 425, S.Newport CBD 426, S.Newport CBD 427, S.Newport CBD 428, S.Newport CBD 808,S.Muenchen CBD 831, S.Muenchen CBD 33 S.Aberdeen CBD 809,S.Muenchen CBD 444 S.Alamo CBD 575 S.Istanbul CBD 573 S.Istanbul CBD 574 S.Istanbul CBD 813,S.Javiana CBD 782, S.Stanley CBD 822,S.subsp.1 CBD 569 S.Alachua CBD 440 S.Muenchen CBD 441 S.Muenchen CBD 442 S.Muenchen CBD 826 S.Javiana CBD 578 S. Mbandaka CBD 604, S.Newport CBD 759, S.Newport CBD 571, S.Newport CBD 591, S.Newport CBD 590, S.Newport CBD 595, S.Newport CBD 585, S.Newport CBD 587, S.Newport CBD 592, S.Newport CBD 593, S.Newport CBD 594, S.Newport CBD 596, S.Newport CBD 584, S.Newport CBD 588, S.Newport CBD 586, S.Newport CBD 589, S.Newport CBD 597, S.Newport CBD 598, S.Newport CBD 572, S.Newport CBD 827, S.Newport CBD 67, S.Newport CBD 829, S.Newport CBD 213, S.Newport CBD 805,S.Berta CBD 429 S. Oranienburg CBD 819,S.Javiana CBD 603 S.Javiana CBD 830 S.Javiana CBD 445 S.Javiana CBD 807,S.Javiana CBD 222 S.Javiana CBD 69 S.Javiana CBD 576 S.Kentucky CBD 577 S.Kentucky CBD 580 S.Muenster CBD 581 S.Muenster CBD 579 S.Montvideo CBD 435 S.Westhampton CBD 433 S.arizonae CBD 32 S.Nima CBD 824,S.Tallahassee CBD 832 S.Enteritidis CBD779, S.Enteritidis CBD 818,S.Enteritidis CBD 439 S.Enteritidis CBD 781, S.Enteritidis CBD 817,S.Typhimurium CBD 430 S.Apapa CBD 810,S.Heildelberg CBD 431,S.Saintpaul CBD 446 S.Typhimurium CBD 757 S.Typhimurium CBD778, S.Typhimurium CBD 820,S.Typhimurium CBD 828 S.Tyhpimurium CBD 775, S.Typhimurium CBD 438 S.Typhimurium CBD 746 S.Typhimurium CBD777, S.Typhimurium CBD 823,S.Typhimurium CBD 443 S.Hildgo CBD 811,S.I 4,12:i :CBD 816,S.Typhimurium Clinical Clinical Environmental Environmental Clinical Clinical Clinical Clinical Environmental Clinical Clinical Clinical Environmental Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Environmental Environmental Environmental Environmental Clinical Clinical Clinical Environmental Environmental Environmental Environmental Clinical Environmental Clinical Clinical Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Clinical Clinical Clinical Clinical Clinical Environmental Clinical Clinical Clinical Environmental Clinical Clinical Clinical Environmental Environmental Environmental Environmental Environmental Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Environmental Clinical Environmental Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Environmental Clinical Clinical 70 80 90 Macrorestriction profiling of the 100 wild type Salmonella isolates with the enzyme XbaI. The serotype names and sources are in dicated. The percent similarity between isolates is represented 202

PAGE 217

203 Salmonella Isolates Dice (> 50%MEAN)Antibiotic resistance sources are indicated. The percent simila rity between isolates is represented Figure A3. Antibiotic Resistan ce Profiling of Wild type Antibiograms of the 100 wild type Salmonella for 31 drugs. The serotype names and 100 98 96 94 92 90 88 86 84 82 80 78 76 74 72 70 68 66 64 62 60 56 58 AM I AUG AM P FO X TIO AXO CEP CH CIP G K NAL STR SM X TET CO T A/S AZT FEP FO P FO T TAZ IM I LEVO LO M PIP P/T FIS TIC TIM TO B Antibiotic resistance 7080 CBD 587, S.Newport CBD 574 S.Istanbul CBD 589, S.Newport CBD 594, S.Newport CBD 830 S.Javiana CBD 832 S.Enteritidis CBD 807,S.Javiana CBD 814,S.Anatum CBD 435 S.Westhampton CBD 442 S.Muenchen CBD 445 S.Javiana CBD 32 S.Nima CBD 33 S.Aberdeen CBD 69 S.Javiana CBD 596, S.Newport CBD 810,S.Heildelberg CBD 820,S.Typhimurium CBD 821,S.Sandiego CBD 817,S.Typhimurium CBD 781, S.Enteritidis CBD 222 S.Javiana CBD 595, S.Newport CBD 213, S.Newport CBD 827, S.Newport CBD 828 S.Tyhpimurium CBD 829, S.Newport CBD 831, S.Muenchen CBD 833 S.IV 50:z4,z23:CBD 578 S. Mbandaka CBD 780 S.IV 50:z4,z23:CBD 782, S.Stanley CBD 805,S.Berta CBD 819,S.Javiana CBD 806,S.Sspp1 CBD 811,S.I 4,12:i :CBD 813,S.Javiana CBD 444 S.Alamo CBD 446 S.Typhimurium CBD 67, S.Newport CBD 809,S.Muenchen CBD 818,S.Enteritidis CBD 822,S.subsp.1 CBD 808,S.Muenchen CBD 757 S.Typhimurium CBD 759, S.Newport CBD 775, S.Typhimurium CBD776, S.Sandiego CBD778, S.Typhimurium CBD779, S.Enteritidis CBD 571, S.Newport CBD 593, S.Newport CBD 572, S.Newport CBD 815,S.Newport CBD 436 S.Paratyphi A CBD 579 S.Montvideo CBD 573 S.Istanbul CBD 580 S.Muenster CBD 582 S.Reading CBD 581 S.Muenster CBD 826 S.Javiana CBD 440 S.Muenchen CBD 441 S.Muenchen CBD 592, S.Newport CBD 824,S.Tallahassee CBD 584, S.Newport CBD 583 S.Reading CBD 437,S.Saintpaul CBD 597, S.Newport CBD 591, S.Newport CBD 598, S.Newport CBD 816,S.Typhimurium CBD 746 S.Typhimurium CBD 823,S.Typhimurium CBD777, S.Typhimurium CBD 438 S.Typhimurium CBD 825,S.Paratyphi CBD 569 S.Alachua CBD 586, S.Newport CBD 588, S.Newport CBD 590, S.Newport CBD 570 S.Anatum CBD 575 S.Istanbul CBD 576 S.Kentucky CBD 577 S.Kentucky CBD 585, S.Newport CBD 428, S.Newport CBD 429 S. Oranienburg CBD 425, S.Newport CBD 433 S.arizonae CBD 426, S.Newport CBD 427, S.Newport CBD 431,S.Saintpaul CBD 430 S.Apapa CBD 432 S.arizonae CBD 434 S.Branderburg CBD 603 S.Javiana CBD 604, S.Newport CBD 747 S.IV 50:z4,z23:. CBD 439 S.Enteritidis CBD 443 S.Hildgo Environmental Environmental Environmental Environmental Clinical Clinical Clinical Clinical Clinical Environmental Environmental Clinical Clinical Clinical Environmental Clinical Clinical Clinical Clinical Clinical Clinical Environmental Clinical Clinical Clinical Clinical Clinical Clinical Environmental Clinical Clinical Clinical Clinical Clinical Clinical Clinical Environmental Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Environmental Environmental Environmental Clinical Clinical Environmental Environmental Environmental Environmental Environmental Clinical Environmental Environmental Environmental Clinical Environmental Environmental Clinical Environmental Environmental Environmental Clinical Clinical Clinical Clinical Clinical Clinical Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Environmental Clinical Environmental Clinical Clinical Clinical Clinical Environmental Environmental Environmental Clinical Clinical Clinical Clinical Clinical Environmental

PAGE 218

204 AM CA FEFOFO TA A O CH CIP GE IM LEVO LO PIP/ FIS TE TITITO SX I A/S AZ T R P P T Z X L N I M P T T C M B T CBD# 32 4 S 2 SS 2 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 33 4 S 2 SS 2 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 67 4 S 4 SS 2 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 8 S 16 S 1 S 1 S CBD# 69 4 S 2 SS 2 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 213 4 S 2 SS 2 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 2 S 8 S 16 S 1 S .5 S CBD# 222 4 S 2 SS 2 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 425 4 S 16 I 16 I 64 R 2 S 32 I 32 I 16 I 32 I 16 I .25 S 1 S 1 S .12 S .5 S 64 I 8 S 256S 8 I 64 I 64 I 1 S 0.5 S CBD# 426 4 S 16 I 16 I 128 R 2 S 32 I 32 I 16 I 32 I 16 I .25 S 1 S 1 S .12 S .5 S 64I 64 I 256S 8 I 64 I 128 R 1 S .5 S CBD# 427 4 S 16 I 16 I 64 R 2 S 32 I 32 I 16 I 32 I 16 I .25 S 1 S 1 S .12 S .5 S 64I 16 S 256S 8 I 64 I 128 R 8 I .5 S CBD# 428 4 S 16 IS 8 64 R 2 S 32 I 16 I 16 I 16 I 16 I .25 S 1 S 1 S .12 S .5 S 64 I 8S 256S 8 I 64 I 64 I 1 S .5 S CBD# 429 4 S 16 IS 4 32 I 2 S 32 I 8S 2S 4 S 16 I .25 S 1 S 1 S .12 S .5 S 64 I 8 S 256S 8 I 32 I 32 I 1 S .5 S CBD# 430 4 S 16 IS 2 32 I 2 S 8S 4 S 1 S 16 I 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 32 I 1 S .5 S CBD# 431 4 S 4S S 4 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 32 I 1 S .5 S CBD# 432 4 S 2 S S 8 32 I 2 S 4 S 4 S 4 S 4 S 2 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S CBD# 433 4 S 16 IS 4 64 R 2 S 32 I 4 S 16 I 8 S 16 I .25 S 1 S 1 S .12 S .5 S 64 I 8 S 256S 8 I 64 I 16 S 1 S .5 S CBD# 434 4 S 2 S S 4 32 I 2 S 4 S 4 S 8S 4 S 16 I .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256S 2S 64 I 16S 1S .5 S CBD# 435 4 S 2 S S 2 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S I S I S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S I S .5 S CBD #436 4 S 4 S S 2 64 R 2 S 4 S 4 S 1 S 4 S 8 S .5 S 1 S I S I S 2 S 16 S 8 S 256 S 1 S 8 S 16 S 1S 1S CBD# 437 4 S 16 I 2 S 256 R 2S 32 I 4 S 1 S 4 S 8 S .5 S 8 I 1 S .25 S 2 S 64 I 64 I 256 S 8 I 64 I 128 R 8 I 1 S CBD# (438 4 S 16 I 2 S 256 R 2 S 32 I 4 S 1S 4 S 16 I .25 S 8 I 1 S .25 S .5 S 64 I 8 S 256 S 8 I 64 I 128 R 8 I .5 S CBD# 439 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 16 S 16 S 1 S 1 S

PAGE 219

205 AM I A/S AZ T CA R FE P FO P FO T TA Z A X O CH L CIP GE N IM I LEVO LO M PI P P/ T FIS TE T TI C TI M TO B SX T CBD# 440 4 S 16 I 2 S 256 R 2 S 32 I 4 S 1 S 4 S 16 I .25 S 8 I 1 S .5 S 2 S 64 I 8 S 256 S 8 I 64 I 128 R 8 I .5 S CBD# 4 S 441 16 I 2 S 256 R 2 S 32 I 4 S 1 S 4 S 16 I .25 S 8 I 1 S .5 S 2 S 64 I 8 S 256 S 8 I 64 I 128 R 8 I .5 S CBD# 442 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 443 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 444 4S 4 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CB D# 445 4 S 2 S 2 S 32 I S 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 446 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 569 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 8 I 1 S .12 S .5 S 8 S 8 S 256 S 8 I 8 S 16 S 8 I 0.5 S CBD# 570 4 S 4 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 8 I 1 S .12 S .5 S 8 S 8 S 256 S 8 I 8 S 16 S 8 I .5 S CBD# 571 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 8 I 1 S .12 S .5 S 8 S 8 S 256 S 8 I 8 S 16 S 8 I .5 S CBD # 4 S 2 S 2 S 572 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 8 I 1 .12 S .5 8 256 S S S 8S S 8 I S 8 16 S 8 I .5 S CBD # 4 S 4 S 2 S 573 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 8 I 1 .12 S .5 8 256 S S 16 S S S 8 I S 16 8 S 8 I .5 S CB D# 574 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 8 I 8 S 16 S 2 S .5 S CBD# 575 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 8 I 8 S 16 S 1 S 1 S CBD# 576 4 S 4 S 2 S 64 R S S S S S S 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 .12 S .5 16 8 256 2 8 S 16 S 1 S 1 S CBD# 577 4 S 4 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD# 578 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 8 S 16 S 2 S .5 S CBD# 579 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 4 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 8 S 16 S 8 I 2 S CBD# 4 S 580 16 I 2S 25 6 R 2 S 4 S 4 S 1 S 8 S .25 4 S S 8 I 1 .12 S .5 S S 64 I 8 6 S 25 S 8 I 64 I 32 I 4 S .5 S CBD # 4 S 581 16 I 2S 25 6 R 2 S 4 S 4 S 1 S 8 S .25 4 S S 8 I 1 .12 S .5 S S 64 I 8 S 256 S 8 I 64 I 32 I 4 S .5 S CBD # (582 4 S 16 I 2S 25 6 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 8 I 1 S .12 S .5 S 32 I 8 S 256 S 8 I 64 I 16 S 8 I .5 S

PAGE 220

206 AM I A/S AZ T CA R FE P FO P FO T TA Z A X O CH L CIP GE N IM I LEVO LO M PI P P/ T FIS TE T TI C TI M TO B SX T CBD# 583 4 S 16 I 2S 25 6 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 8 I 1 S .12 S .5 S 32 I 8 S 256 S 8 I 64 I 16 S 8 I .5 S CBD# 584 4 S 16 I 2S 25 6 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 8 I 1 S S .12 S .5 64 I 8 S 256 S 8 I 64 I 16 S 8 I .5 S CBD# 585 4 S 4 S 2 S 32 I 2S 4S 4S 1S 4S 4S .25 S 1 S 8 I .12S .5S 8S 8S 256 S 1S 16 S 16 S 1S .5S CBD# 586 4 S 4 S 2 S 32 I 2S 4S 4S 1S 4S 4S .25 S 1 S 1 S .12S .5S 8S 8S 256 S 1S 8S 16 S 1S .5S CBD# 587 4 S 4 S 2 S 32 I S 2S 4S 4S 1S 4S 4S .25 S 1 S 1 .12S .5S 8S 8S 256 S 1S 8S 16 S 1S .5S CBD# 588 4 S 4 S 2 S 32 I 2S 4S 4S 1S 4S 4S .25 S 1 S 1 S .12S .5S 8S 8S 256 S 1S 8S 16 S 1S .5S CBD# 589 4 S 4 S 2 S 32 I S 2S 4S 4S 1S 4S 4S .25 S 1 S 1 .12S .5S 8S 8S 256 S 1S 8S 16 S 1S .5S CBD# 590 4 S 4 S 2 S 32 I 2S 4S 4S 1S 4S 4S .25 S 1 S 1 S .12S .5S 8S 8S 256 S 1S 8S 16 S 1S .5S CBD# 591 4 S 16I 2S 25 6 R 2S 32 I 4 S 1S 4S 4S .25 S 1S 1S .12S .5S 64 I 64 I 256 S 1S 64I 128 R 1S .5S CBD# 592 4 S 16I 2S 25 6 R S 2S 16 4 S 1S 4S 4S .25 S 1S 1S .12S .5S 64 I 8S 256 S 1S 64 I 64 I 1S .5 S CBD# 593 4S 2S 2S 32I 2S 4S 4S 1 S 4S 4S .25 S 8 I 1S .12S .5S 8S 8S 256 S 8 I 8S 16 S 8 I .5S CBD# 594 4S 2S 2S 32I 2S 4S 4S 1 S 4S 4S .25 S 1 S 1S .12S .5S 8S 8S 256 S 8 I 8S 16 S 1S .5S CBD# 595 4S 4S 2S 64 R 2S 4S 4S 1 S 4S 16I .25 S 1 S 1S .12S .5S 16 S 8S 256 S 2S 8S 16 S 1S .1S CBD# 596 4S 2S 2S 32I 2S 4S 4S 1 S 4S 8S .25 S 1 S 1S .12S .5S 8S 8S 256 S 2S 8S 16 S 1S .5S CBD# 597 4S 16I 2S 25 6R 2S 32 I 4S 1 S 4S 8S .25 S 8 I 1S .12S .5S 64 I 16 S 256 S 1 S 64 I 64 I 4 S .5S CBD# 598 4S 16 I 2S 25 6 R 2S 32 I 4S 1 S 4S 4S .25 S 8 1 1S .12S .5S 64 I 8S 256 S 1 S 64 I 64 I 4 S .5S CBD #603 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1S 1 S .12 S .5 S 8 S 8 S 256 S 1S S 8 S 16 S 1S 0.5 CBD# 604 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1S 1 S .12 S .5 S 8 S 8 S 256 S 1S S 8 S 16 S 1S 0.5 CBD# 746 4S 16 I 2S 25 6 R 2S 32 I 4S 1 S 4S 16 I .25 S 8 1 1S .12S .5S 64 I 8S 256 S 8 I 64 I 128 R 2 S .5S CBD #747 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1S 1 S 1S 0.5 S S .12 S .5 S 16 S 8 S 256 S 1S 8 16 S CBD 4 S 2 S 2 S 32 2 S 4 S 4 S 1 S 4 4 S .25 1S 1 .12 S .5 8 8 256 1S 8 S 16 1S 0.5

PAGE 221

207 AM I A/S AZ T CA R FE P FO P FO T TA Z A X O CH L CIP GE N IM I LEVO LO M PI P P/ T FIS TE T TI C TI M TO B SX T #757 I S S S S S S S S S CBD #759 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1S 1 S 1S 0.5 S .12 S .5 S 8 S 8 S 256 S 1S 8 16 S S CBD #775 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1S 1 S 1S 0.5 S .12 S .5 S 8 S 8 S 256 S 1S 8 16 S S CBD #776 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 S 1S 0.5 S .12 S .5 S 8 S 8 S 256 S 1S 8 16 S S CBD #777 4 S 16I 2 S 25 6R 2 S 32 I 4 S 1 S 4 S 16 I .25 S 1 S 1 S .12 S .5 S 64 I 8 S 256 S 8 I 64 I 128 R 1 S .5 S CBD #778 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD #779 4 S 4 S 2 S 32I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD #780 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 8 S 16 S 1 S 1 S CBD #781 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 8 S 16 S 1 S 1 S CBD #782 4 S 4 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD #805 4 S 2 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 .5 S 16 S 8 S 256 S 1S 8S 16 S S CBD #806 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 .5 S 8S 8 S 256 S 1S 16 S 16 S S CBD #807 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 S 1S 0.5 S .12 S .5 S 8S 8 S 256 S 1S 8 16 S S CBD #808 4 S 2 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 S S .12 S .5 S 16 S 8 S 256 S 1S 8 16 S 2 S 0.5 S CBD #809 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 .5 S 8S 8 S 256 S 2S 16 S 16 S S CBD #810 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 16I .25 1S 1 S 2S 0.5 S S .12 S .5 S 8 S 8 S 256 S 2S 8 16 S S CBD #811 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 S 1S 0.5 S .12 S .5 S 8 S 8 S 256 S 1S 8 16 S S CBD #813 4 S 4 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8S .25 1S 1 1S 0.5 S S .12 S .5 S 8 S 8 S 256 S 1S 8 S 16 S S CBD #814 4 S 4 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 S .5 S 16 S 8 S 256 S 1S 8 S 16 S S CBD #815 4 S 4S 2 S 64 RR 2 S 4S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1S 8S 16 S 2 S 1 S CBD #816 4 S 16I 2 S 25 6R 2 S 32I 4 S 1 S 4 S 16I .25 S 1 S 1 S .12 S .5 S 64 I 8 S 256 S 8I 64I 128 R 1 S .5 S

PAGE 222

208 AM I A/S AZ T CA R FE P FO P FO T TA Z A X O CH L CIP GE N IM I LEVO LO M PI P P/ T FIS TE T TI C TI M TO B SX T CBD #817 4 S 16I 2 S 64 R 2 S 4 S 4 S 1 S 4 S 1 S .12 S 6 1 8 S 1 S S 4 S .25 S 1 S .5 S 16 S 8 S 25 S S 16 S 1 CBD #818 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 S .5 S 16 S 8 S 256 S 1S 8 S 16 S S CBD #819 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 S .5 S 16 S 8 S 256 S 1S 16 S 16 S S CBD #820 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 S .5 S 8S 8 S 256 S 1S 8S 16 S S CBD #821 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 S .5 S 8S 8 S 256 S 1S 8S 16 S S CBD #822 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 S .12 S .5 S 16 S 8 S 256 S 1S 8S 16 S 2S 1S CBD #823 4 S 16 I 2 S 25 6 R 2 S 32 I 4 S 1 S 4 S 16 I .25 S 1S 1 S .12 S .5 S 64 I 8 S 256 S 8I 64I 128 R 1S 0.5 S CBD #824 4 S 16 I 2 S 25 6 R 2 S 32 I 4 S 1 S 4 S 16 I .25 S 1S 1 S .12 S .5 S 64 I 8 S 256 S 8I 64I 128 R 1S 0.5 S CBD #825 4 S 16 I 2 S 25 6 R 2 S 32 I 4 S 1 S 4 S 16 I .5S 1S 1 S .5 S 2 S 64 I 8 S 256 S 8I 64I 128 R 1S 0.5 S CBD #826 4 S 16 I 2 S 25 6 R 2 S 32 I 4 S 1 S 4 S 16 I .25 S 1S 1 S .5 S 2S 64 I 8 S 256 S 8I 64I 128 R 1S 0.5 S CBD# 827 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1S 1 1S 0.5 S .12 S .5 S 8 S 8 S 256 S 1S 8 S 16 S S CBD #828 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1S 1 1S 0.5 S .12 S .5 S 8 S 8 S 256 S 1S 8 S 16 S S CBD #829 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1S 1 S 1S 0.5 S .12 S .5 S 8 S 8 S 256 S 1S 8 16 S S CBD #830 4 S 4 S 2 S 64 R 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 16 S 8 S 256 S 1 S 8 S 16 S 2 S 1 S CBD #831 4 S 4 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8 S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD #832 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 8 S .25 S 1 S 1 S .12 S .5 S 8S 8 S 256 S 1 S 8 S 16 S 1 S .5 S CBD #833 4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S 4 S .25 S 1 S 1 S .12 S .5 S 8S 8 S 256 S 1 S 8 S 16 S 1 S .5 S

PAGE 223

T able Aic sebfla ung p l. AMIAmnSmci ,ZTztnam, el Cp TefaxT-Cai mXron ranicol, CIPCiprofloxacin, EGta Levofloxacin, LOMELome racn, eillTaba um ulanic d, TOBobramy in, SXTTrimethoprimulphamoxazole. = resi st, IIntermediate ly resistant. Gray int oTvs i /. e Aitic Sus ngM-7e A2. ntib oti usc pti ility o iso tes si NF ane ikaci A/ A pi llin /Sublactum A A reo CAR Carb nici in, F EPefe ime FOPCefoperazone, FO C ot ime, AZ eft zid e, A O Ceft iax e, C HLChlo mphe G Nen m icin, IMIIm ipenem, LEVOfloxacin, PIPPipe illi P/T Pip rac in/ zo ct FISSulfizoxazole, TETTetracycline, TICTicarcillin, TIMTicarcillin/ Clav Aci T c /S eth R ant = cells dica e R r I. he alue are n g ml Tabl A3. ntib o ceptib ility T esti C V Pan l AMI AUG AMP FOX TIO XOCEP CHL CIP EN KAN NAL STR X TET A G SM COT CBD# 32 1S 1S S 1S .5S .25S 8S 01S .5S 8S 4S 32 S 64S 4S .12S 2 CBD# 33 1S 1S 1S 1S .5S 5S .01S .25S 8S 4S S 4S .2 8S 32 S 32 .12S CBD# 67 1S 5S 4S 1S 1S 2S .5S .2 2S 4S 01S .25S 8S 32S 32S 4S .12S CBD# 69 1 5S 4S S 1S 1S 4S .5S .2 2S 8S 01S .1S 8S 32S 32S 4S .12S CBD# 213 1S 5S 1S 4S 4S 1S .2 8S 16I .3S 5S 3 4S .2 8S 16S 2S 32S .12S CBD# 222 1S 5S 3 1S 2S 2S 1S .2 4S 8S 01S 1S 8S 8S 2S 16S 4S .12S CBD# 1S 425 32R 32R 1 6I 8R 16 I 32R 32R .01S .2 5S S 8S 4 64R 512R 32 R 2 .1 S CBD# 1S 426 32R 32R 1 6I 8R 32 R 32R 32R .01S .2 5S4S 8S 64R 512R 32 R 2 .1 S CBD# 1S 427 32R 32R 1 6I 8R 32 R 32R 32R .01S .2 5S4S 8S 64R 512R 32 R 2 .1 S CBD# 428 1S 32R 32R 16I 8R 16I 32R 32R .01S .25S 8S 2S 64R 512R 32R .12S 209

PAGE 224

210 AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT CBD# 2S 429 32R 32R 16I 8R 16I 32R 32R .01S .5S 8S 4S 64R 512R 32R .12S CBD# 430 1S 32R 32R 16I 8R 8S 32R 32R .01S .25S 8S 4S 64R 512R 32R .12S CBD# 431 2S 32R 32R 16I 8R 16I 32R 32R .01S 1 S 8S 4S 64R 512R 32R .12S CBD# 1S 432 32R 32R 16I 8R 8S 32R 32R .01S .5S 8S 2S 64R 512R 32R .12S CBD# 1S 433 32R 32R 16I 8R 16I 32R 32R .01S 1S 8S 2S 64R 512R 32R .12S CBD# 434 2S 32R 32R 16I 8R 8S 32R 32R .01S .5S 8S 4S 64R 512R 32R .12S CBD# 435 1S 1S 1S 4S .5S .25S 2S 8S 01S .5S 8S 4S 32S 16S 4S .12S CBD# 436 .5S 2S 2S 8S 1S .25S 8S 8S .5S .25S 8S 32R 32S 16S 4S .12S CBD# 2S 437 16I 32R 2S 1S .25S 32R 4S .01S 16R 64R 2S 32S 512R 32R .25S CBD# 2S 8S 438 32R 2S .5S .25S 2S 32R .01S 1S 8S 4S 64R 512R 32R .25S CBD# 39 1S 8S 4 32R 2S .5S .25S 2S 32R .01S .25S 8S 4S 64R 512R 16R .12S CBD# 440 1S 1S 2S 2S .5S .25S 2S 4S 01S .25S 8S 4S 32S 32S 4S .12S CBD# 441 1S 1S 2S 1S .5S .25S 8S .01S .25S 8S 4S 32S 32S 4S .25S CBD# 442 1S 1S 2S 1S .5S .25S 8S .01S .25S 8S 4S 32S 32S 4S .25S CBD# 443 2S 8S 32R 2S .5S .25S 2S 32R .01S .5S 8S 4S 64R 512R 16R .12S CBD# 444 1S 1S 1S 2S .5S .25S 2S 4S 01S .25S 8S 4S 32S 16S 4S .12S CBD# 445 1S 1S 1S 1S .5S .25S 2S 8S 01S 1S 8S 4S 32S 16S 4S .12S CBD# 446 2S 1S 1S 1S .5S .25S 2S 4S 01S 1S 8S 4S 32S 16S 4S .12S CBD# 569 1S 1S 2S 2S .5S .25S 2S 4S .01S 16R 8S 4S 32S 512R 32R .25S CBD# 570 2S 1S 1S 4S .5S .25S 2S 4S .01S 8I 8S 4S 32S 512R 32R .12S CBD# 571 2S 1S 1S 4S .5S .25S 2S 4S 01S 4S 8S 4S 32S 16S 4S .12S CBD# 1S 1S 1S 1S .5S .25S 8S .01S .5S 8S 2S 32 S 32S 4S .12S

PAGE 225

211 AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT 572 CBD# 573 2S .5S .25S .01S .25S 4S 2S 1S 1S 8S 4S 64R 32S 32R .12S CBD# 574 2S .5S .25S 8S 2S 1S 1S 4S 4S .01S .5S 64R 32S 32R .12S CBD# 575 1S 1S .25S 1S 1S 4S 2S 4S .01S 8I 8S 4S 64R 512R 32R .12S CBD# 576 4S .5S .25S 8S 4S 1S 1S 2S 2S 4S .01S .5S 32S 128S 32R .12S CBD# 577 4S .5S .25S .5S 8S 4S 1S 1S 2S 8S .01S 64R 32S 32R .12S CBD# 578 1S .5S .25S 1S 1S 4S 2S 4S 01S 1S 8S 4S 32S 16S 4S .12S CBD# 579 4S 1S 1S 4S 4S 4S .5S .25S .01S 8I 64R 4S 64R 16S 4S .12S CBD# 580 2S 4S 32R 4S .01S 1S .25S 8S 8S 16R 64R 4S 64R 512R 32R .12S CBD# 581 2S 8S 32R 8S 1S .25S 8S .01S 16R 16S 4S 64R 265R 32R .12S CBD# 582 2S 4S 32R 8S 1S .25S 8S 16I .03S 16R 64R 8S 64R 512R 32R .25S CBD# 583 2S 2S 2S 8S 1S .25S 16I .01S 16R 8S 4S 64R 265R 16R .12S CBD# 584 1S 1S 2S 1S 2S 4S .5S .25S 01S .25S 8S 4S 32S 16S 4S .25S CBD# 585 1S 1S 2S 4S 8S 1S .25S .01S 8I 8S 2S 128S 4S 32S .12S CBD# 586 2S 1S 2S 4S 8S 1S .25S .01S 16R 8S 4S 32S 265R 16R .12S CBD# 587 2S 1S 2S 4S 1S .25S 4S .01S 16R 8S 4S 32S 64S 8I .12S CBD# 588 1S 1S 4S 4S 8S .5S .25S .01S 8I 8S 2S 32S 64S 32R .25S CBD# 589 2S 1S 2S 2S .5S 8S 2S 1S .25S 8S .01S 32S 32S 16R .12S CBD# 590 1S 1S 2S 2S .01S .25S 8S 4S .5S .25S 4S 64R 256R 32R .12S CBD# 591 2S 16I 32R 4S .5S .25S 4S .01S .25S 8S 2S 64R 256R 4S .12S CBD# 592 1S 1S 2S 2S .01S .25S 8S 4S .5S .25S 4S 64R 256R 32R .25S CBD# 593 2S 2S 1S 2S .01S .25S 8S 2S .5S .25S 4S 64R 64S 4S .12S

PAGE 226

212 AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT CBD # 594 2S 2S 32R 2S .01S .5S .5S .5S 8S 8S 4S 32S 64S 8I .12S CBD# 595 1S 1S 4S 4S 4S 1S .25S 16I .03S 1S 8S 16S 32S 16S 4S .25S CBD# 596 4S 1S 4S 4S 4S 1S .25S 16I .03S .25S 8S 4S 32S 32S 4S .25S CBD# 597 1S 8S 32R 2S 1S .25S 32R 8S .03S 16R 64R 8S 64R 512R 4S .25S CBD# 598 2S 8S 32R 4S 1S .25S 16I 8S .03S 16R 64R 32R 64R 512R 4S .12S CBD# 603 1S 8S 32R 2S 8S .5S .25S 8S .01S 16R 64R 4S 32S 512R 4S .12S CBD# 604 2S 8S 32R 2S 1S .25S 8S 8S .03S 16R 64R 8S 32S 512R 4S .12S CBD# 746 2S 8S 32R 2S 1S .25S 2S 32R .015S 1S 8S 8S 64R 512R 16R .25S CBD# 747 2S 8S 32R 4S 1S .25S 4S 32R .03S 1S 8S 8S 64R 512R 16R .12S CBD# 757 1S 1S 2S 4S 015S .5S 1S 2S 2S .25S 8S 4S 32S 16S 4S .12S CBD# 759 1S .5S S 1S 1S 4S .25S 2 4S 015S .25S 8S 4S 32S 16S 4S .12S CBD# 775 1S 1S 1S 2S .5S 2S .25S 4S 015S .25S 8S 4S 32S 16S 4S .12S CBD# 776 2S 1S 1S 2S 2S 4S 015S 1S .5S .25S 8S 4S 32S 16S 4S .12S CBD# 777 1S 8S 32R 2S .5S 2S .25S 32R .015S .5S 8S 4S 64R 512R 16R .25S CBD# 778 1S 1S 1S 2S .5S 2S 4S 015S 1S .25S 8S 4S 32S 16S 4S .12S CBD# 779 1S 1S 1S 2S 1S 4S 4S .25S 015S .25S 8S 4S 32S 16S 4S .12S CBD# 780 1S 1S 1S 2S 2S 4S .5S .25S 015S .25S 8S 2S 32S 16S 4S .12S CBD# 781 1S 1S 2S 2S 1S 2S 8S .25S 03S .25S 8S 8S 32S 16S 4S .12S CBD# 782 2S 1S 1S 2S 2S 4S 015S 1S .5S .25S 8S 4S 32S 16S 4S .12S CBD# 805 2S 2S 4S 1S 1S 1S .5S .25S 01S .5S 8S 4S 32S 16S 4S .12S CBD# 806 1S 1S 1S 1S 4S 4S .5S .25S 01S .25S 8S 4S 32S 16S 4S .12S CBD# 1S 1S 1S 4S 4S 8S .01S 1S .5S .25S 8S 4S 32S 16S 4S .12S

PAGE 227

213 AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT 807 CBD# 808 2S .25S 2S 4S 4S 1S 1S 2S .5S 01S 1S 8S 4S 32S 16S .12S CBD# 809 1S 1S 1S 2S .5S 2S .25S 4S 01S .25S 8S 4S 32S 16S 4S .12S CBD# 810 1S 1S 2S 1S .5S 2S .25S 8S 01S .25S 8S 4S 32S 16S 4S .12S CBD# 811 2S .5S 4S 1S 2S 2S .25S 2S 01S 1S 8S 4S 32S 16S 4S .12S CBD# 813 1S .5S 4S 1S 1S 1S .25S 2S 01S .25S 8S 2S 32S 16S 4S .12S CBD# 814 1S 4S 8S 1S 1S 4S .5S .25S 01S .25S 8S 4S 32S 16S 4S .12S CBD# 815 .5S 1S 2S 16I 1S .25S 16I 8S .01S .25S 8S 4S 32S 16S 4S .12S CBD# 816 1S 16I 32R 2S .5S .25S 2S 32R .01S 1S 8S 4S 64R 512R 16R .12S CBD# 817 1S .5S S 1S 1S 1S .25S 8S .01S .25S 8S 4S 32 32S 4S .12S CBD# 818 1S 1S 1S 1S .5S 4S .25S .01S .25S 8S 2S 32S 32S 4S .12S CBD# 819 2S 1S 1S 2S 4S .5S .25S 01S .5S 8S 4S 32S 16S 4S .12S CBD# 820 1S 1S 2S 1S 8S .5S .25S .01S .25S 8S 2S 32S 32S 4S .25S CBD# 821 1S 1S 2S 2S 8S .5S .25S .01S .25S 8S 4S 32S 64S 4S .12S CBD# 822 1S 1S 1S 1S .5S .25S 4S .01S .25S 8S 2S 32S 16S 4S .12S CBD# 823 1S 8S 32R 2S .5S .25S 32R .01S .5S 8S 2S 64R 256R 16R .12S CBD# 824 1S 8S 8S 1S .5S .25S 16I .01S .5S 8S 2S 32S 64S 8I .12S CBD# 825 1S 4S 16I 2S .5S .25S 32R .5S .25S 8S 32R 32S 256R 16R .12S CBD# 826 1S 1S 2S 1S .5S 8S .25S 01S .5S 8S 4S 32S 32S 4S .12S CBD# 827 1S 1S 1S 2S 4S .5S .25S .01S .25S 8S 2S 32S 64S 4S .12S CBD# 828 1S 1S 1S 1S 4S .5S .25S .01S .25S 8S 4S 32S 32S 4S .12S CBD# 829 1S 1S 1S 1S .25S 2S .25S 01S .25S 8S 2S 32S 32S 4S .12S

PAGE 228

214 AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT CBD # 830 2S 1S 1S 2S .5S .25S 8S 01S 1S 8S 4S 32S 32S 4S .12S CBD# 831 1S 1S 1S 2S 4S .5S .25S .01S .25S 8S 4S 32S 32S 4S .12S CBD# 832 1S 1S 1S 2S 8S .5S .25S .01S .25S 8S 4S 32S 32S 4S .12S CBD# 833 1S 1S 1S 1S 4S .5S .25S .01S .25S 8S 2S 32S 32S 4S .12S Table A3 Antibiotic susceptibil res o 1sos C 7 el. Ik APicillin, AUGAm Cipxacin, COT-Trimethoprim/Sulfameth axazole, FOXCefoxitin, GENGentam icin, KANKanamycin, NALNalidixic thooleTRe ycn, TTec T Cefu ta= mediately resist. Gray cells indicate R or I. Cep was not tested for al cks this antibiotic. Th e valure in g/ml. ity sult f the 00 i late with MVpan AM Ami acin, M Amp oxicillin/Clavulanic Acid, AXOCeftri axone, TioCeftiofur, CEPCephalo thin, CHLChloram phenicol, CIProflo Acid, SMXSulfa me xaz S Str pt om i ETtracy line, I Oftio r. R= resis nt, I Inter tan l the isola tes as the new CMV-7 panel la es a

PAGE 229

Figure A4 Sequencing data of 1.0 Kb and 1.2 Kb Integron Fragments 438 1.0 Kb ACGCTTGTGGGTCGATGTTTGATGTTA TGCAGCAACGATGTTACGCAGC CGTCGCCCT T TCATGAGGGTAGCGGTGACCAT CAAAATTTCaGAAC TTAAGCGTCATTTGAGCGCCATCT TACGTTGC GCGGCTCCGCAGTGGATGGCGGC CTGAAGCCATACAGA TGTTACTGTGGCCGTAAAGCTTGA AACGCGGC CCTTATGGAGGCTTCGGCTTTC GAGAGCGAGACTTGAAGTCACCCTTGTCGTGCATG CCATCCCGTCAGCGCGAGCTGCAATTTGGAGA CCGCAATGAT CTTCGAGCCAGCCATGATCGAC ATTGATCTAGCTATGT ATAGCGTTGCCTTG GCGGCAGCAAC TCCTGAACAGGATCTAT TCGAGGCGCTGAGGGAAACCAC TCGCAGCCCGACTGGGC GGAGCGAAG CGTCCCGCATTTGGTACAGCGCA ATAACCGGCAAAATCGAAGGAT GCTGCCGACTGGGCAATAAAA TACCTGCCCAG TTGAAGCTAAGCAATGCTTATC TGGGACAAAAAGAATCT AGATCACTTGGAAGAATT CTTTGTGAAG AGTCAGTTGGTAAATGATGTCTA TGTTCAAG CGCGGCGGtCTTAACTCCGGCGT TAGA 438 1.2 Kb GTAATGGAGCAGCAACGTATGTTACG AGCAGTCGC GCCATATTATGGAGCCTCATGC TTTTATATAAAATGGAAAATGGGGTTACTTACATGAAGTTT TCATTTTCGTACCCGTGGTTTTTGCAAGTAGTTCAAAG TTTCAGCAAGTTGACT ATTGAAGTTTCTCTTTCTGCTCG GGTTTCCGTTCTTGATACTAGGAGAATATTGGGATTACAATG GCAATCAGCGCTTCAACTTAAAACAATAGCTTGCGCTAAA TATATGATGCGAA AGTTAATCCCAATAGTACAGTCGAGA TAGAAGCAGATATCCTGTAATAGAAAAGCAAGTAGG GCAGGCAATCACAC CGCAACTATGACTACAAGTGAT CCGGCAAATCAGGGTGGCCCCAAAGGCGTTA CTGATTTTTTAAGAA CTCGTCTAGACCGTATTGA GATTTAAATGAT GACAACTCCT ACATAGCCAGCGT ATTTGGTT CCGCGCTATCTGA AGATCAA TTTGAACAATCAAGTCACTGG GTTCTTGGCGAAACATTGCGGATCGCTCAG GTGCTGGCGGATTTGC CAGTTGTGTGGAGTGAGCA TCAAGCCCCAATTATTGTG AGCATCTATCTAGCTCAAACACAGGCTTCAATGG CAGAGCGAAATGATGCGATTGTTAAATTATTGGTCATTCAATTTTTGACGTTT GGA AAAACAAAGTAGA CA CAACTATCAGAA GGC TGGCCGTGCAT TTTA CGTATTGATTTGTG GAGCATTGCTC AATGA GCCCGCGCATA TGGCGTATCCGGTA ACTTCTGCGGGTAT CCTCTACAAAAGCAAAGAGAAC GGGGATTTTT GACCCGGT TTGAG TATGGAAC ATTAGTGCTTAGTT CGGCC GTC GTATCACCCGTCTTAC GACATTGGCC CACGCGC AGGCGAGATCATCA CCGtACCGtCGtCTACGt CCTAAAACAAAGT TA TGTACATCAATT CTTTATACAT ACAAGAGTAAGG CA CAAAT CCGTTACAGTATT TGACAGGAA CTTGTGCCATTCC TCGATGATGCGTGCTT TACATCTAGTCTTAG CAA TTGGGGACAAAGAGA AAGGTAGCCGGTGATTTGAGGGATAC TATTTAAA ATTTTAT AATTAGAGTCTGGAGG AGATGCCGGTGG GGTCTGGAGTATTAAGC AG GG A GG AA CA TG CC AA TG CG CG AC AT GA GG AT AG GT AG TC CG GC AT CG CC TA AC TT AA GC TC GTTACGCCTTTCGGGTCGATGTTTGAT CA GC GG TT AT GG TA TA GT TA T AC A A AA TA TG GC CT A AA TAATT GG TGA A ACC TACTAC 215

PAGE 230

ATACATCACAGTCGCGCTGATAAGGCTAACAAGGCCATCAAA GTTGCGGCTT TCCGTCGCTTGTTTTGTGGTTTAACGCTACGCTACCACAAAACAATCAACTC AAAGCCGCAACTTATAGGCGGCGTT AGATGCATCTAAGCACATAATTGCTG TATACT TGTCTAACAATTCGTTTCAAGCC GACGCCGCTTCGCGGCGCGGCTTAA TTAGAAGCACTAAGCACATAATTGCTCACAA T C CACATGCC 580 1.0 Kb TAGCCTTGCGGTCGATGTTTGATGT AATGGAGCAGCAACGATGTTACGCAGC AGGGCAGTCGCCCTAAAACAAAGTTAAA CATCATGAGGGAAGCGGTGATCG CCGAAGTATCGACTCAACTATCAGAGGT AGTTGGCGTCATCGAGCGCCATCT CAAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGC CTAGAAGCCACACAGTGATATTAGA TTTGCCTGGTTACGGTGACCGTAAGGC TTGATAGAAACAACGCGGC GAGCTTTGATCAACGA CCTTTTGGAAACTTCGG CTTCCCCTGGAGAGAGCGAGATTCTCCG CGCTGTAGAAGTCACCATTGGTTGT GCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTT GGAGAATGGCAGCGCAATGACATTCTTGC AGGTATCTTCAGAGCCAGCCACG ATCGACATTGATCTGGGCTATCTTTGCTTGACAA AAAGCAAGAGAACATAGC GTTGCCTTGGGTAGGTCCAGCGGCGG AGGAACTCTTTGATCCCGGTTCCTGAA CAGGATCTTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGGAACTCGCC GCCCGACTGGGCTGGCGATGAGCGAAAT GTAGTGCTTACGTTGTCCCGCATTT GGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTG GGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGA CAGGCTTATCTTGGACAAGAAGAAGAT CGCTTGGCCTCCCGCGCAGATCAGT TGGAAGAtATTTGTTCACTACGTGAA AGGCGAGATCACCAAGGTAGTCGGCA ATAA A CTCAAGCG 581 1.0 Kb AGGCTGTGAGCAATTATTG TGCTTAGATaGCATCTAACGCTTGTAGTTGAAGC CGCGCCGCGAAGCGGCGTCGGCTTG AAACGAATTGTTAGACATTATTTGCCG ACTACCTTGGTGATCTCGCCTTTCACGTAGTGAACAAATATCTTCCAACTAGA TCTGCGCGGGAGGCCAAGCGATCTTCTTCCTTGTCCAAGATAAGCCTGTCTAG CTTCAAGTATGACGGGCTGGATAC TGGGCCGGCAGGCGCTCCATTGCCCAGT CGGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTACTGCGCTGTACCAAATG CGGGACAACGTAAGCACTACATTTCGCTCATCGCCAGCCCAGTCGGGCGGCG AAGTTCCATAGCGTTAAGGTTTCATTTAAGCGCCTCAAATAGATCCTGTTCAG GAACCGGATCAAAGAGTTCCTCCGCCGCT GGACCTACCAAGGCAACGCTATG TTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTGGCTGGGC TCGAAGATCCCTGCAAGAATGTCATTGC GCTGCCATTCTCCAAATTGCAGTTC GCGCTTAGCTGGATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTG ACTTCTACAGCGCGGAGAATCTCGCT CTCTCCAGGGGA AGCCGAAGTTTCCA AAAGGTCGTTGATCAAAGCTCGCCGCG TTGTTTCATccAAGCCTTACGGTCAC CGTAACCAGCAAATCAATATCACTGTGTGGCTTCAGGCCGCCATCCACTGCG GAGCCGTACAAATGTACGGCCAGCAACGTCGGTTCGAGATGGCGCTCGATGA CGCCAACTACCTCTGATAGTTGAGTCGATACTTCGGCGATCACCGCTTCCCTC 216

PAGE 231

ATGATGTTTAACTTTGTTTT AGGGCGACTGCCCTGCTG CGTAACATACGTTGC TGCTCCATAACATCAAACATAACCCGGCAAGTGAA 582 1.0 Kb ATTATGTG CTTAGTGCATCTAACGCTTGATGTTAAtGCCGCGCCGCGAAGCGG GTCGGCTTGAACGAATGTGTTAGACATTTATTATGCCGACTACCTTGAGTGA GGGTGATGTTTGATGTTATG GAGCAGCAACGTATGTTACGCAGCA GGCAGTCGCCCTAAAACA AAGTTAAACATCATGA GGGAAGCGGTGATCGCC C ATACTCGCCATATACACAATAGATGAACAAATATCTTCCAACTGATCTGCGC GGGAGGCCAAGCGATCTTCTTCTTGTCCAGAATAAGCCTGTCTAGCTTCAAGT ATGACGGGCTGATACTGGGCCGGCAGGCGCTCCATTGCCCAGTCGGCAGCGA CATCCTTCGGCGCGATTTT GCCGGTTACTGCGCTGTACCAAATGCGGGACAAC GTAAGCACTACATTTCGCTCATCGCCAGCCCAGTCGGGCGGCGAGTTCTCAT AGCGTTAAGGTTTCATTTAGCGCCTCAAATAGATCCTGTTCAGGAACCGGATC AAAGAGTTCCTCCGCCGCTGGACCTACC AAGGCAACGCTATGTTCTCTTGCTT TTGTCAGCAAGATAGCCAGATCAATGTC GATCGTGGCTGGCTCGAAGATACC TGCAAGAATGTCATTGCGCTGCCATT CTCCAAATTGCAGTTCGCGCTTAGCTG GATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTGACTTCTACAGC GCGGAGAATCTCGCTCTCTCCAGGGG AAGCCGAAGTTTCCAAAAGGTCGTTG ATCAAAGCTCGCCGCGGTTTGTTTCAT CAAGCCTTACGGTCACCGTAACCCAG CAAATCTTAATATCACTGTGTGGCTTCTAGGCCGCCATCCACTGCGGAGCCGT TACCCACATGTACGGCCAGCAACGTCGGTTCGAGATGGCGCTCGATGACGCC AACTACCTCTGATAGTTGAGTCGATACTTCGGCGATCACCGCTTCCCTCATGC ATGTTTAACTTTGTTTTAGGGCGACTGC CCTGCTGCGTAACATCGTTGCTGCT CCATTACATCAAACATC 583 1.0 Kb GCCTTGCT G GAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCG AACCGACGTTGCTGGCCGTACATTTG TACGGCTCCGCAGTGGATGGCGGCCT GAAGCCACACAGTGATATTGATTTGCTGGTTACGGT GACCGTAAGGCTTGAT GAAACAACGCGGCGAGCTTTGATCA ACGACCTTTTGGAAACTTCGGCTTCCC CTGGAGAGAGCGAGATTCTCCGCGCT GTAGAAGTCACCATTGTTGTGCACGA CGACATCATTCCGTGGCGTTATCCA GCTAAGCGCGAACTGCAATTTGGAGAA TGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACA TTGATCTGGCTATCTTGCTGACAAAAG CAAGAGAACATAGCGTTGCCTTGGT AGGTCCAGCGGCGGGAGGAACTCTTTGAT CCGGTTCCTGAACAGGATCTATT TGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCT GGCGATGAGCGAAATGTAGTGCTTACG TTGTCCCGCATTTGGTACAGCGCAG TAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGC GCCTGCCGGCCCAGTATCAGCCCGTCAT ACTTGAAGCTAGACAGGCTTATCTT GGACAAGAAGAAGATCGCTTGGCCTCCCGCGCAGATCAGTTGGAAGATATTT GTTCACTACGTGAAAGGCGAGATCA CCAAGGTAGTCGGCAAATAATGTCTAA CAATTCGTTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAACTACAAGCGTTA GATGCACTAAGCACATAATGCTGCACAGCCTANACT 217

PAGE 232

597 1.0 Kb GGCTTGTGAGCAAT TATGTGCTTAGATGCATCTAACGCTTGAGTTAAGCCGCG CGCGAAGCGGCGTCGGCTTGAACGAATTGTTAGACATTATTTGCCGACTAC GATGTTTGATGTTA TGGAGCAGCAACGATGTTACGCAGC GGGCAGTCGCCCTAAAACAAAGTTAAA CATCATGAGGGAAGCGGTGATCG C CTTGGTGATCTCGCCTTTCACGTAGTG AACAAATTCTTCCAACTGATCTGCGC GGGAGGCCAAGCGATCTTCTTCTTGTCCAAGATAAGCCTGTCTAGCTTCAAGT ATGACGGGCTGATACTGGGCCGGCAGGCGCTCCATTGCCCAGTCGGCAGCGA CATCCTTCGGCGCGATTTT GCCGGTTACTGCGCTGTACCAAATGCGGGACAAC GTAAGCACTACATTTCGCTCATCGCCAGCCCAGTCGGGCGGCGAGTTCCATA GCGTTAAGGTTTCATTTAGCGCCTCAAATAGATCCTGTTTCAGGAACCGGATC AAAGAGTTCCTCCGCCGCTGGACCTACC AAGGCAACGCTATGTTCTCTTGCTT TTGGTCAGCAAGATAGCCCAGATCAA TGTCGATCGTGGCTGGCTCGAAGATA CCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGTTCGCGCTTAGC TGGATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTGACTTCTACA GCGCGGAGAATCTCGCTCTCTCCAGG GGAAGCCGAAGTTTCCAAAAGGTCGT TGATCAAAGCTCGCCGCGTTGTTTTATC AAGCCTTACGGTCACCGTAACCAGC AAATCAATATCACTGTGTGGCTTCTAGG CCGCCATCCACTGCGGAGCCGTAC AAATGTACGGCCAGCAACGTCGGTTTGAGATGGCGCTCGATGACGCCAACTA CCTCTGATAGTTGAGTCGATACTTCGGCGATCACCGCTTCCCTCATGATGTTT AACTTTGTTTTCAGGGCGACTG CCCTGCTGCGTAACATACGTTGCTGCTCCAT AACATCAAACATCAACCCAACAGGC 598 1.0 Kb TCAGCCTGTGGGTT A CCGAAGTATCGACTCAACTATCAGAGGT AGTTGGCGTCATCGAGCGCCATCT CGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGC CTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTG ATGAAACAACGCGGCGAGCTTTGAT CAACGACCTTTTG GAAACTTCGGCTTC CCCCTGGAGAGAGCGAGATTC TCCGCGCTGTAGAAGT CACCATTGTTGTGCA CGACGACATCATTCCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGG AGAATGGCAGCGCAATGACATTCTTGCA GGTATCTTCGAGCCAGCCACGATC GACATTGATCTGGCTATCTTGCTGAC AAAAAGCAAGAGAA CATAGCGTTGCC TTGGTAGGTCCAGCGGC GGGAGGAACTCTTTGATCC GGTTCCTGAACAGGAT CTATTTGAGGCGCTAAATGAAACCTTAACGCTTATGGAACTCGCCGCCCGACT GGGCTGGCGATGAGCGAAATGTAGTGCTT ACGTTGTCCCGCATTTGGTACAG CGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATG GAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTT ATCTTGGACAAGAAGAAGATCGCTT GGCCTCCCGCGCAGATCAGTTGGAAGA TATTTGTTCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAATG TCTAACAATTCGTTCAAGCCGACGCCG CTTCGCGGCGCGGCTTAACTTCAAGC GTTAGAGCATTAAGCACATAATGCTCACAGCCAAATA 218

PAGE 233

7 46 1.0 Kb TTtGaGCTGTGAGCAATTATGTGCTTA GTGCATCTAACGCAGGAGTTAAGCCG 46 1.2 Kb CTACGACCTTTTGCGGTCAGATGTT GTGATGTAATGGA GACAGACAACGAT ATAAGGCTAACAAG CCATCAAGTTGACGGC TTTTCCGTCGCTTGTTTTGT GGTTTAACGCTACGCT T CCGCGCGTAGCGCGGTCGGCTTGAA CGAATTGTTAGACATCATTTACCAACT GACTTGATaGATCTCGCCTTTCACAAAGCGAATAAATTCTTCCAAGTGATCTG CGCGTGAGGCCAAGTGATCTTCTTTTTGT CCCAGATAAGCTTG CTTAGCTTCA AGTAAGACGGGCTGATACTGGGCAGGTAGGCGTTTTATTGCCCAGTCGGCAG CGACATCCTTCGGCGCGATTTTGCCGGTTATTGCGCTGTACCAAATGCGGGAC AACGTAAGCACTACATTTCGCTCATCG CCGGCCCAGTCGGGCTGCGAGTTCC ATAGCTTCAAGGTTTCCCTCAGCGCCTCGAATAGATCCTGTTCAGGAACCGGG TCAAAGAATTCCTCCGCTGCCGGACCTACCAAGGCAACGCTATGTTCTCTTGC TTTTGTAAGCAGGATAGCTAGATCAATGTCGATCATGGCTGGCTCGAAGATA CCCGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGCTCGCGCTTAGC CCGGATAACGCCACGGGATGATGTCGTC ATGCACGACAAGGGTGACTTCTAT AGCGCGGAGCGTCTCGCTCTCGCCAGGGAAAGCCGAAGCCTCCATAAGGTCA TTGAGCAAaTGCTCgGCCGCGTCGTTT CtATCAAGCTTTACGGCCACAGTAACC AACAAATCttAATATCGCTGTATGGC TTCAGGCCGCCATCCACTGCGGAGCCG TACAAATGCACGGCCAGCAACGTTGAT TCCAGATGGCGCTCAATGACGCTTA GCACCTCTGATAGTTGGTTCGAAATTTCGATGGTCACCGCTACCCTCATGATG TCTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTGACATCGTTGCTGCTCCA TGTACATCTGTACATCTGACCCCA CGGCTGATGCGGTCNGTAGGTNN 7 T GTTACGACAGCCAGGGACAGTCCGCC CCTAAAACAAAGTTAGACCATTATTA TGGAGCCCTCATGACTTTTATATAAAATGTGTGACAATCAAAATTGTATGGGG TTACTTACATAGAAGcTTgTTTATTGGC ATATTCGCTTCTAATACCATCCGTGG TTTTTGCAAGTAGTTCAAAGTTTCAGCAAGT TGAACAAGACG TTAAGGCAATT GAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGA GAATATgTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTA AAACAATAGCTTGCGCTAAATTACTAT ATGATGCTGAGCAAGGAAAAGTTAA TCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTG TAATAGAAAAGCAAGTAGGG CAGGCAATCACACTC GATGATGCGTGCTTCGC AACTATGACTACAAGTGATAATACTGCGGCAaATATCATCCTAAGTGCTGTAG GTGGCCCCAAAGGCGTTACTGATTTTTT AAGACAAATTGGGGACAAAGAGAC TCGTCTAGACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGA GGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAGATTTTTATTT GGTTCCGCGCTATCTGAAATGAACCA GATAAAAATTAGAGTCTTGGATGGTG AACAATCAAGTCACTGGTAATTTACATACG TTCAGTATTGCCGGCGGGATGG AACATTGCGGATCGCTCAGGTGCTGGC GGATTTGGTGCTCGGAGTATTACAG CAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCT CAAACACAGGCTTCAATGGCAGAGCGAA ATGATGCGATTGTTATATTATTGG TCATTCAATTTTTGACGTTTATACATC ACAGTCGCGCTG G 219

PAGE 234

ACCACAA AACAATCAACTCCAAAGCCGCAACTTATAGGCGGCGTTAGATGCA CTAAGCACATAATTGCTGCACATGCCTA ACGCG AGATCACTTGGAAGTATTTATTCGCTTTGTGAAAGGCGAGATCATCAAGTCA ATGATGTCTAACAATTCGT TCAAGCCGACCGCGCTACGtCGCGGC GCTTAACTCCGGCGTTAGATGCATCTAAGCACATAATGCTgCACAGCCTANA GCAGAGCGAAATGATGCGATTGTTA TAAATTGGTCATTCAATTTTTGACGTTC T 777 1.0 Kb AAAAAAGCCCAAGACGCGTCATGCCGTGGGTCGAT GTTTGATGTAATGGAGC AGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGACATCA TGAGGGTAGCGGTGACCATCGAAATTTCGAACCAACTATCAGAGGTGCTAAG CGTCATTGAGCGCCATCT GGAATCAACGTTGCTGGCCGTGCATTTGTACGGCT CCGCAGTGGATGGCGGCCTGAAGCCA TACAGCGATATTAGATTTGTTGGTTA CTGTGGCCGTAAAGCTTGATGAAACGAC GCGGCGAGCATTGCTCAATGACCT TATGGAGGCTTCGGCTTTC CCTGGCGAGAGCGAAGAC GCTCCGCGCTATAGA AGTCACCCTTGTCGTGCATGACGACATCATCCCGTGGCGTTATCCGGCTAAGC GCGAGCTGCAATTTGGAgAATGGCAGCGCAATGACATTCTTGCGGGTATCTTC GAGCCAGCCATGATCGACATTGATCT AGCTATCCTGCTTACAAAAGCAAGAG AACATAGCGTTGCCTTGGTAGGTCCGGCAGCCGGAGGAATTCTTTGACCCGG TTCCTGAACAGGATCTATTCGAGGCG CTGAGGGAAACCTTGAAGCTATGGAA CTCGCAGCCCGACTGGGCCGGCGATG AGCGAAATGTAGTGCTTACGTTGTCC CGCATTTGGTACAGCGCAATAACCGGCAAAATCGCGCCGAAGGATGTCGCTG CCGACTGGGCAATAAAACGCCTACCC TGCCCTAGTATCTAGCCCGTCTTACTT GAAGCTAAGCAAGCTTATCTGGGACAAA AAGAAGATCACTTGGCCTC C GTTGGTAA G 777 1. 2 Kb NTAGCCTGTGGGTCGATGTTTGATGTAA TGGAGCAGCAACGTATGTTACGCA GCAGGGCAGTCGCCCTAAAACAAAGTTAGCCATATTATGGAGCCTCATGCTT TTATATAAAATGTGTGACAATCAAAATGA TGGGGTTACTTACATGAAGTTTTT ATTGGCATCTTCGCTTTTAATACCATCCG TGGTTTTTGCAAGTAGTTCAAAGTT TCAGCAAGTTGAACAAGACGTTAAGGC AATTGAAGTGTCTCTTTCTGCTCGTA TAGGTGTTTCCGTTCTTGATACTCAA AATGGAGAATATTGGGATTACAATGGC AATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATA ACTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATT AAGAAAGCAGATCTTGTGACCTATTC CCCTGTAATAGAAAAGCAAGTAGGGC AGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAA TACTGCGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACT GATTTTTTAAGACAAATTGGGGACAAAG AGACTCGTCTAGACCGTATTGAGC CTGATTTAAATGAAGGTAAGCTCGGTG ATTTGAGGGATACGACAACTCCTAA GGCAATAGCCAGTACTTTGAA TCAAATTTTTATTTGGTTCCGCGCTATCTGAA ATGAACCAGATACAAAATTAGAGTC TTGGATGGTGAACAATCAAGTCACTGG TAATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAG GTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGGAGTGAGCA TCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCACATG 220

PAGE 235

TATACATCACAGTCGCGCTGATAAGGACTAACAAGGCCATCAAGTTGACGGC TTTTCCGTCGCTTGTTTTGTGGTTTATACG C TACGCTACCACAACACCATCGA CTCCGAAGCCGCGAACTTATGGCGGCGTTAGATGCATCTAAGCACATAATG CCTATA ATTCGTTCAAGCCGACCGCGCTACGCGCGGCGGCTTAACTCCGGCGTTAGA GCACATAATGCGTCA A CTCACAAG 816 1.0 Kb GCCTTGCGGTCGATGTTTG ATGTAATaGGAGCAGC AACGATGTTACGCAGCAG GGCAGTCGCCCTAAAACAAAGTTAGACATCATGAGGGTAGCGGTGACCATCG AAATTTCGAACCAACTATCAGAGGTGCTAAGCGTCATTGAGCGCCATCTGGA ATCAACGTTGCTGGCCGTGCATTTGTA CGGCTCCGCAGTGGATGGCGGCCTG AAGCCATACAGCGATATTGATTTGTTGG TTACTGGTGGCCGTAAAGCTTGATG AAACGACGCGGCGAGCATTGCTCAA TGACCTTATGGAGGCTTCGGCTTTCCCT GGCGAGAGCGAGACGCTCCGCGCTATAGAAGTCACCCTTGTCGTGCATGACG ACATCATCCCGTGGCGTTATCCGGCTAAGCGCGAGCTGCAATTTGGAGAATG GCAGCGCAATGACATTCTTGCGGGTATCTTCGAGCCAGCCATGATCGACATT GATCTAGCTATCCTGCTTACAAAAGC AAGAGAACATAGCGTTGCCTTGGTAG GTCCGGCAGCGGAGGAATTCTTTGACCCGGTTCCTGAACAGGATCTATTTCGA GGCGCTGAGGGAAACCTTGAAGCTATG GAACTCGCAGCCCGACTGGGCCGGC GATGAGCGAAATGTAGtGCTTACGTTGTCCCGCATTTGGTACAGCGCAATAAC CGGCAAAATTCGCGGCCGGAAGGAATGTCGCTGCCGACTGGGCAATAAAAC GCCTACCTGCCCAGTATCAGCCCGTCTTACTTGAAGCTAAGCAAGCTTATCTG GGACAAAAAGAAGATCAC TTGGCCTCACGCGCAGAT CACTTGGAAGAATTTA TTCGCTTTGTGAAAGGCGAGATCATCA AGTCAGTTGGTAAATGATGTCTAAC A TGCACTAA 816 1.2 Kb TTACGCTTTTCGGGTCGATGTTTGATGT TATaGGAGCAGCAACGATGTTACGC AGCAGGGACAGTCGCCCTA AAACAAAGTTAGCCATATTATGGAGCCTCATGC TTTTATATAAAATGTGTGACAATCAAAATTATGGGGTTACTTACATGAAGTTT TTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAG TTTCAGCAAGTTGAACAAGACGTTAAGG CAATTGAAGTTTCTCTTTCTGCTCG TATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGGATTACAATG GCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAA TTACTATATGATGCTGAGCAAGGAAA AGTTAATCCCAATAGTACAGTCGAGA TTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCAAGTAGG GCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGAT AATACTGCGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTA CTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATTGA GCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCT AAGGCAATAGCCAGTACTTTGAATaG AAATTTTTATTTGGT TCCGCGCTATCT GAAATGAACCAGATCAAAATTAGAGTCT TGGATGGTGAACAATCAAGTCACT GGTAATTTACTACGTTCAGTATTGCCGG CGGGATGGAACATTGCGGATCGCTC AGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGGAGTGAG 221

PAGE 236

CATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAAT GGCAGAGCGAAATGATG CGATTGTTATTTTATTGGT CATTCAATTTTTGACGT TTATACATCACAGTCGCGCTGATAAGGCTAACAAGGCCATCAAGTTGACGGC TTTTCCGTCGCTTGTT TTGTGGTTTAACGC TACGCTACCACAACACAATCAAC CCAAAGCCGCAACTTATAGGCGGCGT TAGATGCATCTAAGCACATAATTGC CCTANA AATTTAGATGGTCACCGCTACCCTCATG TGTCTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCT ATCAACCCAAGGCT T TGCACATG 823 1.0 Kb ATATAAGGCTGTGAAGCAATAATGTGCT TAGTGCATCTAAACGCCGGAGTTA AGCCGCCGCGCGTAGCGCGGTCGGC TTGAACAAATTGTTAGACATCATTTAC CAACTGACTTGATGATCTCGCCTTTCACAAAGCGAATAAATACTTCCAAGTGA TCTGCGCGTGAGGCCAAGTGATCTTCTTTTTGTCCCAGATAAGCTTGCTTAGC TTCAAGTAAGACGGGCTGATACTGGG CATGTAGGCGTTTTATTGGCCCAGTC GGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTATTGCGCTGTACCAAATGC GGGACAACGTAAGCACTACATTTCGCTC ATCGCCGGCCCAGTCGGGCTGCGA GTTCCATAGCTTCAAGGTTTCCCTCAGCGCCTCGAAATAGATTCTGTTCAGGA ACCGGGTCAAAGAATTCCTCCGCTGCC GGACCTACCAAGGCAACGCTATGTT CTCTTGCTTTTGTAAGCAGGATAGCTAGA TCAATGTCGATCATGGCTGGCTCG AAGATACCCGCAAGAATGTCATTGCGCT GCCATTCTCCAAATTGCAGCTCGC GCTTAGCCGGATAACGCCACGGGATGATGTYGTCATGCACGACAAGGGTGAC TTCTATAGCGCGGAGCGTCTCGCTCTCGCCAGGGAAAGCCGAAGCCTCCATA AGGTCATTGAGCAATGCTCGCCGCGTC GTTTCATCAAGCTTTACGGCCACAGT AACCAACAAATCAtATATCGCTGTATGGCTTCAGGCCGCCATCCACTGCGGAG CCGTACAAATGCACGGCCAGCAACGTTGATTCCAGATGGCGCTCAATGACGC TTAGCACCTCTGATAGTTGGTTCGA A CCATTACATCAAAC 823 1. 2 Kb TTAGCCTGTCGGGTCGATGTTTGATGTAATGGAGCAGCAACGTATGTTACGCA GCAGGGCAGTCGCCCTAAAACAAAGTTAGCCATATTATGGAGCCTCATGCTT TTATATAAAATGTGTGACAATCAAAATTA TGGGGTTACTTACATGAAGTTTTT ATTGGCATTTTCGCTTTTAATACCATCCG TGGTTTTTGCAAGTAGTTCAAAGTT TCAGCAAGTTGAACAAGAC GTTAAGGCAATTGAAGTTTC TCTTTCTGCTCGTA TAGGTGTTTCCGTTCTTGATACTCAA AATGGAGAATATTGGGATTACAATGGC AATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATT ACTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCAAGATT AAGAAAGCAGATCTTGTGACCTATTC CCCTGTAATAGAAAAGCAAGTAGGGC AGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAA TACTGCGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACT GATTTTTTAAGACAAATTGGGGACAAAG AGACTCGTCTAGACCGTATTGAGC CTGATTTAAATGAAGGTAAGCTCGGTG ATTTGAGGGATACGACAAccTCCTAA GGCAATAGCCAGTACTTTGAATAAATTTTTATTTGGTTCCGCGCTATCTtGAAA TGAACCAGAACAAAATTA GAGTCTTGGATGGTGAACAATCAAGTCACTGGTA 222

PAGE 237

ATTTAAAAACGTTCTAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCA GGTGCTGGCGGATTTGGTGCTCGGAGT ATTACAGCAGTTGTGTGGAGTGAGC ATCAAGCCCCAATTATTGTGAGCATCTA TCTAGCTCAAACACAGGCTTCAATG GCAGAGCGAAATGATGCGATTGTTAAT TTATTGGTCATTCAATTTTTGACGTT TATACATCACAGTCGCGCTGATAAGGC TAACAAGGCCATCAAGTTGACGGCT TTTCCGTCGCTTGTTT TGTGGTTTAACGC TACGCTACCACAAAACAATCAACT CAAAGCCGCAACTTATAGGCGGCGTTAGATGCATCTAAGCACATAAT BD 4361.6 Kb C C TGGTGCTTAAATGCATCTAACGCCGTGTAGTTAAGCCGCCGCGCGTAGCGCG GTCGGCTTGAACGAATTGTTAGACAT CATTTACCAACTGACTTGATGATCTCG CCTTTCACAAAGCGAATAAATTCTTCCAAGTGATCTGCGCGTGAGGCCAAGT GATCTTCTTTTTGTCCCAGATA AGCTTGCTTAGCTTCAAGTAAGACGGGCTGA TACTGGGCAGGTAGGCGTTTTATTGTCCCAGTCGGCAGCGACATCCTTCGGGC GCGATTTTGCCGGTTATTGCGCTGTAC CAAATGCGGGACAACGTAAGCACTA CATTTCGCTCATCGCCGGCCCAAGTTCCGGGCTGCGTATGTTCCATAGCTTCA AGGTTTCCCTCAGCGCCTCAAATAGATCCTGTTTCAGGAACCGGGGTCAAAG AATTCCTCCCGCTGCCGGACCTACCAAA GGCAACGCTATGTCCTCTTGCTTTG TTAAGCAAGGATACCTAANATCAATGTTTCAATCATGGGCTGGCTCCAAA 223

PAGE 238

About the Author The author received her bachelors Degr ee in Biology from Mrs. Ankita Venkata Narsimha College, Visakhapatnam, India in 1995. She received Masters Degree in H uman Genetics, Andhra University in 1997. Sh e enrolled in PhD. Program in Biology epartment in the University of South Florida in Spring 2000. d 224