USF Libraries
USF Digital Collections

Study of the roles of LRBA in cancer cell proliferation and SHIP-1 in NK cell function

MISSING IMAGE

Material Information

Title:
Study of the roles of LRBA in cancer cell proliferation and SHIP-1 in NK cell function
Physical Description:
Book
Language:
English
Creator:
Gamsby, Joshua John
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
p53
E2F
EGFR
RNAi
AKT
Dissertations, Academic -- Biochemistry and Molecular Biology -- Doctoral -- USF
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: LRBA (LPS Responsive Beige-like Protein Kinase A anchor) gene expression is induced by the mitogen LPS and is a member of the WBW gene family member which is comprised of genes that are involved in cellular proliferation and differentiation. This work provides evidence for the over-expression of LRBA in certain cancers, and that LRBA promoter activity and endogenous LRBA mRNA levels are negatively regulated by the tumor suppressor p53 and positively regulated by E2F transactivators. Furthermore, we demonstrate that inhibition of LRBA expression or function leads to decreased proliferation of cancer cells and that LRBA plays a role in the EGFR signal transduction pathway. In addition to the findings of LRBA's role in carcinogenesis, this work also shows evidence of the knockdown of the SH2-containing Inositol 5' Phosphatase (SHIP) in both mouse and human cells. Furthermore, we provide evidence that SHIP-1 is involved in the AKT signal transduction pathway in human Natural Killer cells.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2005.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Joshua John Gamsby.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 89 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001912526
oclc - 173963093
usfldc doi - E14-SFE0001317
usfldc handle - e14.1317
System ID:
SFS0025638:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001912526
003 fts
005 20071010094830.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 071010s2005 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001317
040
FHM
c FHM
035
(OCoLC)173963093
049
FHMM
090
QD415 (ONLINE)
1 100
Gamsby, Joshua John.
0 245
Study of the roles of LRBA in cancer cell proliferation and SHIP-1 in NK cell function
h [electronic resource] /
by Joshua John Gamsby.
260
[Tampa, Fla] :
b University of South Florida,
2005.
3 520
ABSTRACT: LRBA (LPS Responsive Beige-like Protein Kinase A anchor) gene expression is induced by the mitogen LPS and is a member of the WBW gene family member which is comprised of genes that are involved in cellular proliferation and differentiation. This work provides evidence for the over-expression of LRBA in certain cancers, and that LRBA promoter activity and endogenous LRBA mRNA levels are negatively regulated by the tumor suppressor p53 and positively regulated by E2F transactivators. Furthermore, we demonstrate that inhibition of LRBA expression or function leads to decreased proliferation of cancer cells and that LRBA plays a role in the EGFR signal transduction pathway. In addition to the findings of LRBA's role in carcinogenesis, this work also shows evidence of the knockdown of the SH2-containing Inositol 5' Phosphatase (SHIP) in both mouse and human cells. Furthermore, we provide evidence that SHIP-1 is involved in the AKT signal transduction pathway in human Natural Killer cells.
502
Dissertation (Ph.D.)--University of South Florida, 2005.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 89 pages.
Includes vita.
590
Adviser: William G. Kerr, Ph.D.
653
p53.
E2F.
EGFR.
RNAi.
AKT.
690
Dissertations, Academic
z USF
x Biochemistry and Molecular Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1317



PAGE 1

Study of the Roles of LRBA in Cancer Cell Proliferation and SHIP-1 in NK Cell Function by Joshua John Gamsby A dissertation submitted in partial fulfillment of the requirement s for the degree of Doctor of Philosophy Department of Biochemist ry and Molecular Biology College of Medicine University of South Florida Major Professor: William G. Kerr, Ph.D. Larry P. Solomonson, Ph.D. W. Douglas Cress, Ph.D. Jiandong Chen, Ph.D. Hong-Gang Wang, Ph.D. Date of Approval: October 21, 2005 Keywords: p53, E2F, EGFR, RNAi, AKT Copyright October 2005, Joshua John Gamsby

PAGE 2

This work is dedicated to my family and friends for all of their support and encouragement over the years.

PAGE 3

Acknowledgements I thank my dissertation committee for all of their input and direction throughout my studies as a graduate student. I also thank all of the collaborators who contributed to this work. I thank all of the members of t he Kerr lab for their technical support, hard work, and camarader ie. Finally, I thank my mentor William G. Kerr for his patience, guidance, and wisdom.

PAGE 4

Table of Contents List of Tables........................................................................................................iv List of Figures.......................................................................................................v ABSTRACT.........................................................................................................vii Chapter One.........................................................................................................1 Deregulated LRBA Expression Leads to Increased Cancer Cell Survival.........1 Introduction....................................................................................................1 The tumor suppressor p53.........................................................................1 The E2F family of transcription factors.......................................................4 The tumor suppressor Rb and E2F activity................................................6 The epidermal growth factor receptor pathway........................................10 Properties of the LRBA gene and protein................................................13 LRBA and the WBW gene family.............................................................13 Results........................................................................................................15 LRBA expression is upregulated in a variety of cancers..........................15 LRBA promoter activity is negatively regulated by p53 and positively regulated by E2F1...................................................................................23 Repression of LRBA mRNA expression by RNAi results in the death of human cancer cells..............................................................................33 i

PAGE 5

Inhibition of LRBA activity by a Dominant-Negative mutant also inhibits the proliferation of human cancer cells........................................39 LRBA knockdown sensitizes cancer cells to apoptosis............................42 LRBA is involved in EGFR signaling........................................................47 Discussion...................................................................................................49 Materials and Methods................................................................................54 Reagents.................................................................................................54 Cell culture...............................................................................................54 Microarray................................................................................................54 rtPCR and Real Time rtPCR....................................................................55 RACE and determination of the transcription start sites...........................56 Cloning and sequencing of the LRBA promoter.......................................56 Luciferase assays for LRBA promoter analysis.......................................57 GFP assay of p53 repression of LRBA promoter activity.........................58 siRNA knockdown of LRBA expression...................................................58 Construction of the LRBA dominant negative mutant recombinant adenovirus...............................................................................................59 Cell proliferation assays...........................................................................59 Construction of shRNA plasmids.............................................................60 Colony-forming assays............................................................................60 Western blot analysis...............................................................................61 EGF stimulation assay.............................................................................61 Statistical analysis...................................................................................62 ii

PAGE 6

Chapter Two.......................................................................................................63 RNAi Mediated Inhibition of SHIP-1 Expression in Mouse and Human Cells................................................................................................................63 Introduction..................................................................................................63 PI3 Kinase and the Akt pathways............................................................63 The SH2-containing Inositol 5 Phosphatase gene and Natural Killer cells..........................................................................................................67 Results........................................................................................................69 Generation of human and mouse SHIP-1 specific siRNAs.....................69 SHIP-1 is involved in regulating Akt activation in human NK cells...........73 Discussion...................................................................................................75 siRNA Design..........................................................................................76 Cell lines..................................................................................................77 Nuleofection of siRNAs...........................................................................77 Western Blot Analysis..............................................................................77 References.........................................................................................................79 About the Author......................................................................................End Page iii

PAGE 7

List of Tables Table 1. LRBA expression is higher in ER+ tumors then in ERtumors............21 iv

PAGE 8

List of Figures Figure 1. Downstream events of the tumor suppressor p53................................3 Figure 2. The E2F family of transcription factors.................................................6 Figure 3. The role of the Rb/E2F pathway in cellular growth and proliferation........................................................................................9 Figure 4. EGFR Activation.................................................................................12 Figure 5. Microarray analysis shows elevated LRBA expression levels in certain cancers................................................................................20 Figure 6. Real time rtPCR results shows that LRBA mRNA expression is elevated in primary cancers and cancer cell lines............................22 Figure 7. Characterization of the LRBA promoter..............................................27 Figure 8. The LRBA promoter is negatively regulated by p53..........................28 Figure 9. The LRBA promoter activity is down-regulated by p53.......................29 Figure 10. The LRBA promoter is upregulated by E2F1....................................30 Figure 11. LRBA promoter activity is up-regulated by E2F family transactivators.................................................................................31 Figure 12. Endogenous LRBA mRNA expression is down-regulated by p53 and up-regulated by E2F1...............................................................32 Figure 13. LRBA specific siRNAs inhibit cancer cell growth.............................35 v

PAGE 9

Figure 14. LRBA specific siRNAs inhibit cancer cell proliferation.....................36 Figure 15. LRBA-specific shRNA vector inhibits cancer cell proliferation..........37 Figure 16. LRBA specific shRNAs inhibits cancer cell proliferation and LRBA transcription...........................................................................38 Figure 17. Proliferation of MCF7 is inhibited by adenovirus encoding for a LRBA dominant negative mutant (AdBWGFP)................................40 Figure 18. AdBWGFP expression is controlled by doxycyline...........................41 Figure 19. LRBA protects HeLa cells from apoptosis induced by UV or staurosporine...................................................................................44 Figure 20. Staurosporine and UV treated LRBA-specific siRNA treated HeLa cells show increased PARP and Caspase 3 cleavage...........45 Figure 21. Inhibition of LRBA expression leads to an increased sensitivity to the chemotherapeutic drug cisplatin................................................46 Figure 22. LRBA is involved in the regulation of EGFR signaling......................48 Figure 23. Possible role of LRBA interaction with the EGFR pathway..............53 Figure 24. The role of PI3-K and SHIP in the activation of Akt..........................64 Figure 25. The role of Akt and BAD in cell survival............................................66 Figure 26. Knockdown of mouse SHIP-1 levels in the mouse macrophage cell line RAW264.7..........................................................................70 Figure 27. Inhibition of SHIP-1 expression in human NK cells..........................72 Figure 28. SHIP-1 influences the activation of Akt.............................................74 vi

PAGE 10

Study of the Roles of LRBA in Cancer Cell Proliferation and SHIP-1 in NK Cell Function Joshua John Gamsby ABSTRACT LRBA (LPS Responsive Beige-like Protein Kinase A anchor) gene expression is induced by the mitogen LPS and is a member of the WBW gene family member which is comprised of genes that are involved in cellular proliferation and differentiation. This work provides evidence for the over-expression of LRBA in certain cancers, and that LRBA promoter activity and endogenous LRBA mRNA levels are negatively regulated by the tumor suppressor p53 and positively regulated by E2F transactivators. Furthermore, we demonstrate that inhibition of LRBA expression or function leads to decreased proliferation of cancer cells and that LRBA plays a role in the EGFR signal transduction pathway. In addition to the findings of LRBAs role in carcinogenesis, this work also shows evidence of the knockdown of the SH2-containing Inositol 5 Phosphatase (SHIP) in both mouse and human cells. Furthermore, we provide evidence that SHIP-1 is involved in the AKT signal transduction pathway in human Natural Killer cells. vii

PAGE 11

Chapter One Deregulated LRBA Expression Leads to Increased Cancer Cell Survival Introduction The tumor suppressor p53. Transcription factors (TF) are proteins that regulate gene expression at the level of transcription through either direct or indirect interactions (such as when complexed to an adaptor protein) with a genes promoter. These proteins can either activate or repress transcription of a gene depending on the TFs specific function. In some cases, the deregulation of a gene in cancers can be attributed to a loss of function mutation that affects important transcription factors, such as p53 (Sherr & McCormick, 2002). The p53 gene is a tumor-suppressor that is mutated in most types of cancers (Vogelstein, Lane, & Levine, 2000). Tumor-suppressors are a class of genes that are involved in regulating cellular proliferation. Mutation or inactivation of a tumor suppressor can lead to uncontrolled differentiation (Sherr, 2004), which is a hallmark of a cancer cell (Hanahan & Weinberg, 2000). Furthermore, mutation of factors involved in regulating p53 activity and function are also a cause of carcinogenesis placing p53 in a group of key tumor suppressors whose function is critical in preventing tumorigenesis. The p53 1

PAGE 12

protein in particular is involved in several critical cellular processes that protect cells from becoming carcinogenic. The p53 protein is activated by post-translational modifications by either intrinsic or extrinsic cellular stress events. These modifications include phosphorylation, acetylation, deactylation, ubiquitination, methylation, and sumolation (Appella & Anderson, 2001) and occur through the activation of enzymes that detect very specific cellular insults such as DNA damage, ribosome biogenesis, hypoxia, spindle damage, temperature shock, nitric oxide, and oncogene activation (Harris & Levine, 2005). The activation of p53 by these stress events leads to initiation of DNA repair, apoptosis induction, and the inhibition of cell cycle progression (Harris & Levine, 2005; Jin & Levine, 2001). The activation of the p53 protein by these post-translational modifications affects the p53 protein by increasing the concentration of p53 in the cell and increasing the stability of the p53 protein. An example of this is the regulation of p53 activity by the murine double minute 2 (MDM2) protein. MDM2 is an E3 ubiquitin ligase which binds to p53 and ubiquitinates it, thus leading to its degradation (Bond, Hu, & Levine, 2005). During cellular stress events such as oncogene activation, the ARF protein initiates the degradation of MDM2 which leads to the accumulation of p53, and thus p53 is free to perform its functions such as inducing apoptosis. This increase in the stability and amount of cellular p53 leads to the enhanced binding to key sequences in the promoter of genes involved in cellular senescence, DNA repair, and apoptosis (Figure 1). 2

PAGE 13

Figure 1. Downstream events of the tumor suppressor p53 The tumor suppressor p53 is activated during cellular stress to induce events such as cell cycle arrest, apoptosis, DNA repair and the inhibition of metastasis and angiogenesis. 3

PAGE 14

The E2F family of transcription factors. The E2F genes are a family of TFs that are primarily known for their role in cell cycle progression from G1 to S phase (DNA replication) through the transactivation of genes involved in DNA synthesis (Dimova & Dyson, 2005; Ohtani, 1999). However, E2Fs have been shown to be involved in other cellular processes such as cell proliferation, differentiation, and apoptosis (Nevins, 2001). Furthermore, the E2F pathway has been shown to be involved in both carcinogenesis and suppression of tumor formation (Dimova & Dyson, 2005; Nevins, 2001). In mammals, the E2F family of transcription factors is comprised of seven genes that are known to be involved in both transcriptional activation and repression (Dimova & Dyson, 2005). The activation of the E2F transcription factors requires the formation of heterodimers with DP proteins of which there are two in mammals, DP1 and DP2 (C. L. Wu, Zukerberg, Ngwu, Harlow, & Lees, 1995). These proteins function in enhancing both the transactivation and the DNA binding of E2F transcriptional activators (Hitchens & Robbins, 2003). The E2F transcriptional activators are primarily comprised of three genes E2F1, E2F2, E2F3, although some activity has been associated with E2F4 (Nevins, Leone, DeGregori, & Jakoi, 1997). These genes encode for proteins which are expressed at various points in the cell cycle and are regulated by the tumor suppressor RB (Figure 2). In general, the E2F transactivators function in promoting progression of the cell cycle, while this is inhibited by E2F repressors (Dimova & Dyson, 2005). Generation of a E2F1, E2F2, and E2F3 triple knock-out mouse embryonic fibroblast cells demonstrated this conclusively as these 4

PAGE 15

cells were unable to enter the S-phase (DNA replication) of the cell cycle (L. Wu et al., 2001). E2F1 in particular is one of the most studied of the E2F family of transcription factors with over 600 articles to date available on the online research data base PubMed (http://www.ncbi.nlm.nih.gov). Findings have demonstrated that the loss of E2F-1 gene in mice leads to both an increase in tumor formation and defects in apoptosis induction (Field et al., 1996; Yamasaki et al., 1996). Additionally, fibroblasts isolated from E2F-1 null mice have been demonstrated to be resistant to Myc induced apoptosis (Leone et al., 2001). Furthermore, over-expression of the E2F1 protein in tissue culture leads to an increase in the induction of apoptosis (DeGregori, Leone, Miron, Jakoi, & Nevins, 1997) and this function is specific to the E2F1 protein and no other E2F member (Hallstrom & Nevins, 2003). Finally, it has been found that E2F1s role in apoptosis may be related to DNA damage (Wikonkal et al., 2003). Therefore, E2F1 is a diverse member of the E2F gene family with many ties to cancer related processes. 5

PAGE 16

Figure 2. The E2F family of transcription factors. The E2F family of transactivators are represented by E2F1, E2F2, and E2F3a and a regulated by the tumor suppressor Rb. The tumor suppressor Rb and E2F activity. The transcriptional activators of the E2F family are specifically regulated by the tumor-suppressor 6

PAGE 17

retinoblastoma (RB) protein. RB is a member of a family of proteins known as pocket proteins that are involved in cell cycle regulation (Cobrinik, 2005). Rb functions to inhibit the transcription of genes required for cellular proliferation through the recruitment of enzymes involved in chromatin remodeling (Nielsen et al., 2001) and through protein-protein interactions with transcription factors such as the activating E2Fs (Nevins, 2001). The latter function inhibits activating E2Fs from binding to E2F specific sequences in the promoters of genes that are involved in cellular proliferation, such as those involved in DNA synthesis (Figure 3). Rb is regulated by two mechanisms, phosphorylation and degradation. In the case of cellular proliferation, Rb is regulated primarily by phosphorylation which prevents its interaction with E2Fs thus allowing for cell cycle progression. The phosphorylation of Rb is performed by several cyclin dependent kinases (Cdks) that depend on a class of proteins known as cyclins for their activity. At the G 0 (quiescent) phase of the cell cycle, mitogenic stimuli cause an induction of several Cdks as well as cyclins and E2Fs. This in turn, leads to the phosphorylation of Rb and the eventual activation of E2Fs. The activated E2Fs then initiate the transcription of more Cdks and cyclins as well as itself, leading to an increase in the amount of inactive Rb in the cell. In addition to being regulated by kinase activity, Rb is also degraded by caspase activity upon apoptotic stimuli (Chau & Wang, 2003). Rb was the first tumor suppressor gene cloned (Classon & Harlow, 2002) and is highly mutated in several different types of cancers (Nevins, 2001). 7

PAGE 18

Furthermore, it has been suggested that the RB pathway itself may be inactivated in approximately 80% of all sporadic human tumors (Chau & Wang, 2003; Sherr, 1996; Sherr & McCormick, 2002). These mutations primarily occur in regulators of Rb function, such as p16ink4A and cyclin D1. Therefore Rb function, as well as the factors governing its function, are critical in the prevention of carcinogenesis. 8

PAGE 19

Figure 3. The role of the Rb/E2F pathway in cellular growth and proliferation. Growth stimulatory signals activate the formation of cyclin and cyclin dependent kinase (Cdk) complexes that phosphorylate the tumor suppressor Rb. This leads to an increase in activating and DNA synthesis ensues. 9

PAGE 20

The epidermal growth factor receptor pathway. The epidermal growth factor receptor (EGFR) is a Receptor Tyrosine Kinase (RTK) that is involved in several key cellular functions such as proliferation, differentiation, apoptosis, and migration (Fischer, Hart, Gschwind, & Ullrich, 2003). Ligand binding to the EGFR initiates receptor dimerization and autophosphorylation which generates protein docking sites at the phosphotyrosine residues of the C-terminus ((Figure 4, (Jorissen et al., 2003)). This then serves as binding sites for adaptor molecules that initiate downstream signal transduction pathways. In addition to the simulation of autophosphorylation by ligand binding, EGFR activity is also stimulated by oxidative stress, UV light, -radiation, mechanical stress, and hyperosmolarity (Fischer, Hart, Gschwind, & Ullrich, 2003). EGFR is a member of a family RTKs known as the HER family that includes Her2/neu, Her3, and Her4 (Zaczek, Brandt, & Bielawski, 2005). As previously mentioned, EGFR can pair with itself to form a homodimer. However, EGFR can also heterodimerize with any of the other HER family members and the ability of these receptors to interact results in an expanded amount of signal transduction pathways that can be stimulated by these receptors. These pathways include the mitogen activated protein kinase (MAPK), the phosphotidylinositol-3 kinase (PI-3K) pathways, the JAKs and STATs pathways (Wells, 1999). Three of members of the HER RTK family, EGFR, HER-2/neu, and HER3, have been implicated in carcinogenesis (Casalini, Iorio, Galmozzi, & Menard, 2004). Furthermore, over-expression of these receptors is seen in a variety of 10

PAGE 21

cancers including in the breast, prostate, head and neck, colorectal, bladder, ovarian, as well as non-small lung cancers (Mendelsohn, 2001). As a result, the HER family of RTKs is a prominent target for the development of targeted cancer therapies, such as through the development of small molecule inhibitors (Bianco, Troiani, Tortora, & Ciardiello, 2005). 11

PAGE 22

Figure 4. EGFR Activation The epidermal growth factor receptor is activated by ligand binding which induces heterodimerization followed by autophosphorylation. This creates a docking site for a variety of proteins that are involved in several signal transduction processes. 12

PAGE 23

Properties of the LRBA gene and protein. The LRBA (LPS Responsive Beige-like Protein Kinase A anchor) gene was discovered through a gene trapping method which identified genes that were simulated by the mitogen LPS (lipopolysaccharide) (Kerr, Heller, & Herzenberg, 1996). Thus, LRBA gene expression is upregulated in cells responsive to mitogen stimulation. Furthermore, LPS simulation can induce LRBA to associate with several structures in the vesicular system such as endoplasmic reticulum, Golgi, plasma membrane, and endocytosis vesicles (J. W. Wang, Howson, Haller, & Kerr, 2001). Additionally, the LRBA gene also encodes for 3 potential isoforms. However, the function of the LRBA gene and the protein it encode(s) for has yet to be determined. LRBA and the WBW gene family. LRBA is a member of a unique family of genes known as the WBW family. The WBW domain is a multidomain structure located at the C-termini of each protein (J. W. Wang, Howson, Haller, & Kerr, 2001). This unique super-domain contains three subdomains: WDL (WD-like), BEACH, and WD40. The WDL (WD-like) domain contains a potential Pleckstrin Homology (PH) domain as determined through X-ray crystallography of neurobeachin, a WBW gene family member (Jogl et al., 2002). These domains are known to be involved in the binding of the phospholipids and proteins (Blomberg, Baraldi, Nilges, & Saraste, 1999). Biochemical and structural evidence suggests that the PH domain of LRBA is unable to bind to phospholipid structures when complexed to the BEACH domain (Gebauer et al., 2004). 13

PAGE 24

However, the WDL domain alone was not considered, nor was the possibility that this association may be intrinsically regulated; therefore more investigation is needed to determine the relevance of this domain. The BEACH (Beige and CHS) domain is highly conserved across all of the WBW family members and is known to be mutated in individuals with Chediak Higashi Syndrome (CHS) (Nagle et al., 1996). This is an autosomal recessive disorder characterized by impaired vesicular trafficking (Spritz, 1998). WD40 domains are a stretch of Tryptophan and Aspartate residues that are known to be involved in protein-protein interactions (Li & Roberts, 2001). The LRBA protein also contains a potential Protein Kinase A (PKA) anchor domain (J. W. Wang, Howson, Haller, & Kerr, 2001). The presence of these domains in the LRBA protein indicates that this protein may possibly be involved in interactions with phospholipids, proteins, and PKA. Although the function of the LRBA protein has yet to be determined, WBW gene family members provide clues as to what role LRBA may be playing in the cell. Neurobeachin is a WBW family member which is primarily expressed in neural tissue (X. Wang et al., 2000) whose function is critical for neuromuscular synapse transmission (Su et al., 2004). Lvsa (large volume sphere A) in the organism Dictyostelium has been shown to be involved in cytokinesis (Kwak et al., 1999). Another orthologue of LRBA, rugose/AKAP550 has been determined to interact with several signal transduction pathways such as EGFR, Notch, and Ras through genetic studies (Shamloula et al., 2002). FAN (factor associated with neural sphingomyelinase) is associated with TNF (tumor necrosis factor) 14

PAGE 25

induced apoptosis (Segui et al., 2001). Furthermore, it has been shown that rugose/AKAP550 mutations induce apoptosis in the cone cells of the Drosophila eye (Wech & Nagel, 2005). One interesting theme that stands out with several of these genes and their protein products is that several of the processes that they are involved in are either deregulated or subverted by a cancer cell. This combined with the evidence depicting LRBA expression is stimulated by a mitogen (LPS) prompted the hypothesis that LRBA expression might be deregulated in a cancer cell. The characterization of novel genes involved in carcinogenic processes is important to the overall understanding of this disease. This includes not only determining the function of the products of these new genes, but also how their expression is regulated. Through this, new treatments and therapies are possible. This chapter characterizes the role LRBA plays in carcinogenesis. Results LRBA expression is upregulated in a variety of cancers. Microarray is a technique used to screen the expression pattern of mRNA levels across several thousand genes, and in some cases, an entire genome simultaneously (Schulze & Downward, 2001). Total RNA or mRNA is isolated from the tissue of interest and converted to cDNA by reverse transcriptase PCR. This cDNA is then labeled with a fluorescent dye and these labeled cDNAs are then hybridized to a gene chip which contains the individual cDNAs of several thousand genes of an 15

PAGE 26

organism. Fluorescence is measured and quantified and statistical programs are then used to crunch the data from the amount of signal measured. This technique was employed to screen the expression of LRBA mRNA levels in various cancers in both primary tissues and various cancer cells lines. Results show that LRBA is upregulated in renal, colorectal, pancreas, lung and CNS carcinomas as compared to normal tissue controls (Figure 5a and b). Screening of a lung cancer microarray database also showed that LRBA mRNA expression is also upregulated in adenocarcinoma, carcinoid, and small-cell lung cancers (Figure 5c, (Bhattacharjee et al., 2001)). Additional microarray analysis showed that LRBA mRNA levels were significantly higher in 27 human breast tissue samples as compared to 6 normal tissue controls. Furthermore, mRNA levels were also significantly higher in estrogen receptor (ER) positive breast cancer cells as compared to ER negative cells (Table 1). Breast cancers that are ER positive require hormone therapy to block proliferation. Therefore, it is possible that LRBA targeted therapy could possibly increase the efficacy of these treatments. Although microarray is a powerful tool to measure mRNA expression, further validation is needed to verify results garnered from this technique. To this end, we employed quantitative real time rtPCR (reverse transcriptase Polymerase Chain Reaction) to test the mRNA of LRBA in various cancers and normal tissues. Real time rtPCR is an improved reverse transcriptase PCR method that allows one to quantify the amount of product generated during the 16

PAGE 27

PCR reaction, where as with a traditional rtPCR assay, results are solely qualitative (Bustin, 2002). There are several real time PCR methods that can be used to quantify mRNA levels. In this case, the SYBR Green method was employed due to the ease of primer design and low cost as compared to others such as the Taqman method which requires expensive probes in addition to reagent and primer costs. SYBR Green is a DNA intercalating fluorescent dye which allows for the detection of double stranded DNA during the PCR reaction (Arya et al., 2005). As with microarray, total RNA is isolated from the tissues of interest and converted to cDNA by reverse transcription. However, the cDNA is then combined with primers specific for the gene of interest, SYBR Green, and rtPCR is performed using a device that not only is capable of cycling the temperature required for PCR, but of detecting fluorescence. Therefore, the amount of product produced through each cycle of amplification can be measured by the detector and therefore quantified. LRBA mRNA levels in both prostate and breast cancer cells were assayed by this method. Primary tissues were used for RNA isolation from patients with prostate and breast cancer. Normal tissue biopsied outside the area of tumor growth was used as a source for control mRNA levels. Real time PCR analysis showed a significant increase in LRBA mRNA levels in both prostate and breast cancers as compared to the normal tissue controls (Figure 6a and b). Furthermore, RNA was isolated from the breast cancer cell line MCF7 and the transformed breast epithelial cell line MCF10A. Real time rtPCR analysis also 17

PAGE 28

showed significantly higher levels of LRBA mRNA in MCF7 cells as compared to the MCF10As (Figure 6b). 18

PAGE 29

19

PAGE 30

Figure 5. Microarray analysis shows elevated LRBA expression levels in certain cancers. (a) LRBA mRNA expression is elevated in tumor tissues isolated from renal (Kidney, P = 0.0013) pancreas (Panc, P = 0.0414), colorectal (Colore, P = 0.0001, ), and lung (P < 0.0001) as compared to normal tissue isolates. Sample sizes ranged from each group from 10 to 36. (b) LRBA mRNA expression is elevated medulloblastoma (Med, P = P = 0.0001), rhabdomyosarcoma (Rha, P = 0.0058), but not in gliobastoma (gli) tumors as compared to normal tissue isolates. (c) LRBA mRNA expression is elevated in carcinoid (Carc, P < 0.0001), adenocarcinoma (Adeno, P = 0.0488), small-cell (Small, P = 0.0073), but not in squamous (Squa, P = 0.5839) lung tumors. 20

PAGE 31

Table 1. LRBA expression is higher in ER+ tumors then in ERtumors. 21

PAGE 32

Figure 6. Real time rtPCR results shows that LRBA mRNA expression is elevated in primary cancers and cancer cell lines. (a) LRBA mRNA expression is elevated in prostate cancers from patient tissues as compared to normal tissue; patient 1, P = 0.0164, patient 2, P = 0.0379. (b) LRBA mRNA levels are elevated in breast cancer cells in both patient samples (patient 3, P = 0.0164) and in the MCF7 cells as compared to MCF10As (P < 0.0001). LRBA mRNA levels were normalized to Actin levels. 22

PAGE 33

LRBA promoter activity is negatively regulated by p53 and positively regulated by E2F1. As LRBA mRNA expression is deregulated in various cancers, it was apparent that this might be due to the loss of transcriptional control of the LRBA gene. To this end, the putative LRBA promoter was identified through SMART (switching mechanism at 5 end of transcript) 5 RACE (rapid amplification of cDNA ends). This method allows for the identification of the complete 5 sequence of a cDNA of interest, thereby allowing for the identification of putative transcriptional initiation sites after sequencing. Furthermore, SMART 5 RACE is an improved form of the RACE technique that allows for the amplification of longer cDNAs with a complete 5 sequence, thus making this technique more suitable for our purposes in identifying the LRBA transcriptional initiation site (Zhu, Machleder, Chenchik, Li, & Siebert, 2001). After the 5 cDNA of LRBA was sequenced, the LRBA putative LRBA promoter was identified and a TF search was performed using the MOTIF (http://motif.genome.jp/) algorithm which identifies potential TF binding sites based on known TF binding sequences. Through this, several possible TF binding sites were identified in the LRBA promoter. However, three potential TFs stood out as being the most relevant to carcinogenesis. These included possible ER, p53, and E2F1 binding sites (Figure 7). To explore whether or not LRBA promoter activity is regulated by p53 and E2F1, reporter assays were performed. One method of detecting promoter activity is through luciferase assays. This assay is based on the properties of luciferase, an enzyme that cleaves its substrate luciferin which generates 23

PAGE 34

photons that can be detected by a luminometer. DNA plasmid constructs were made containing the LRBA promoter sequence driving the production of luciferase. In the case of p53, the LRBA luciferase reporter plasmid was co-transfected with either a p53 wild-type or p53 DNA binding mutant encoding construct into the lung adenocarcinoma cell line H1299. The H1299 cell line is deficient for p53 expression, thus this cell line is an excellent model for the reporter assay as no endogenous functional p53 is present. Therefore, the only effect observed should be from the p53 encoded by the wild-type p53 construct. Results from this assay show that wild-type p53 significantly represses LRBA promoter activity as compared to the DNA binding mutant (Figure 8). To further validate these results, a second reporter assay was performed. In this case, a green fluorescent protein (GFP) encoding LRBA promoter construct was used in place of the luciferase construct to determine LRBA promoter activity. A LRBA promoter construct driving the synthesis of GFP was co-transfected with either the wild-type p53 or p53 DNA binding mutant producing construct. GFP levels were then detected by flow cytometry. This technique utilizes the excitation of fluorochromes present either on the surface or internally, which then emit at a specific frequency that can be detected and quantified as single cells pass through a detector in a fluid stream. In this case, this method was used to detect GFP expression. Results from this experiment agreed with the previous luciferase assays in that LRBA promoter activity was significantly repressed in the presence of wild-type p53 as compared to the p53 24

PAGE 35

DNA binding mutant (Figure 9). Taken together, these data strongly suggest that LRBA promoter activity is negatively regulated by the tumor suppressor p53. As with p53, luciferase assays were performed to determine whether E2F1 influences LRBA promoter activity. In this case, the glioblastoma cell line T98G was chosen as it has functional RB which can sequester endogenous E2Fs making it as suitable model for the reporter assay. Co-transfection of either an E2F1 wild-type or DNA binding mutant producing construct with the LRBA promoter luciferase construct showed a significant increase in LRBA promoter activity (Figure 10). Furthermore, additional luciferase assays with the two other activating E2F transcription factors, E2F2 and E2F3a, showed a significant increase in LRBA promoter activity as compared to the DNA binding mutant (Figure 11). This indicates that LRBA promoter activity is positively regulated by activating E2Fs. Although reporter assays are a good way to measure the regulation of a genes promoter, we felt further work was needed to validate whether or not LRBA is truly regulated by both p53 and E2F1. In the case of p53, the wild type encoding construct or an irrelevant control plasmid (pBluescript) was transfected into the H1299 cells and quantitative real time rtPCR was performed to detect endogenous LRBA mRNA levels. Results show that LRBA mRNA levels are significantly decreased in the presence of wild-type p53 as compared the pBluescript control plasmid (Figure 12, left). A similar approach was used for E2F1 in that wild-type E2F1 encoding or pBluescript plasmid was transfected into T98G cells and quantitative real time rtPCR was used to detect endogenous 25

PAGE 36

LRBA mRNA levels. Consistent with the luciferase data, LRBA mRNA levels were significantly increased in the presence of wild-type E2F1 as compared to the pBluescript control plasmid (Figure 12, right). Taken together, these results clearly show that both LRBA promoter activity and transcription is negatively regulated by p53 and positively regulated by activating E2Fs. 26

PAGE 37

Figure 7. Characterization of the LRBA promoter. The LRBA promoter sequence with the DNA consensus binding sites for various transcription factors underlined. 27

PAGE 38

Figure 8. The LRBA promoter is negatively regulated by p53. LRBA promoter activity is down-regulated in the presence of wild-typ3 p53, but not in the presence of a DNA-binding mutant. Luciferase assay were performed in quadruplicate. P = 0.0067 (pLA-luc vs pLA-luc + p53wt). 28

PAGE 39

Figure 9. The LRBA promoter activity is down-regulated by p53. A LRBA promoter construct driving GFP expression was co-transfected with either a p53 wild-type encoding construct or a p53 DNA-binding mutant in H1299 cells. Two separate experiments are presented. 29

PAGE 40

Figure 10. The LRBA promoter is upregulated by E2F1 LRBA promoter activity is upregulated in the presence of wild-type E2F1, but not by a DNA-binding mutant. Luciferase assay were performed in quadruplicate. P < 0.0001 (pLA-Luc vs pLA-Luc + E2F1wt). 30

PAGE 41

Figure 11. LRBA promoter activity is up-regulated by E2F family transactivators. The LRBA promoter construct driving luciferase production was co-transfected with wild-type constructs encoding either E2F1, E2F2, or E2F3a in T98G cells. Luciferase assay were performed in quadruplicate. 31

PAGE 42

Figure 12. Endogenous LRBA mRNA expression is down-regulated by p53 and up-regulated by E2F1. Real time rtPCR results of H1299 cells co-transfected with wild-type p53 construct (left) show repression of LRBA promoter activity (P = 0.0013) while T98G cells co-transfected with an E2F1 (right) show activation of LRBA promoter activity (P = 0.0003) as compared to a transfection control (p-Bluescript). Results were normalized to -Actin levels and were performed in triplicate. 32

PAGE 43

Repression of LRBA mRNA expression by RNAi results in the death of human cancer cells. The finding that LRBA expression is increased in certain cancers and that LRBA promoter activity is regulated by both p53 and activating E2Fs prompted us to pursue whether the repression of LRBA expression in cancer cells could inhibit proliferation and/or survival. To this end, RNAi techniques were utilized to inhibit LRBA mRNA expression. RNA interference is a sequence specific technique utilized to inhibit mRNA expression of a target gene. This involves the delivery of either small RNA duplexes known as small inhibitory RNAs (siRNAs) or plasmid DNA encoding for small hairpin RNAs (shRNAs) (Hannon & Rossi, 2004). These small RNAs are then processed by the ribonuclease DICER and are incorporated into the RNA Induced Silencing Complex (RISC) which then degrades the target mRNA (Meister & Tuschl, 2004). This process was first discovered in plants and characterized in the organism C. elegans (Fire et al., 1998) and later utilized as a technique for gene inhibition in mammalian cells (Elbashir et al., 2001). siRNAs specific for LRBA were designed and transfected into HeLa cells. Microscopy of transfected cells show that cells transfected with LRBA specific siRNAs have a dramatic impact on the morphology of these cells as compared to non-specific scrambled control siRNAs (Figure 13a). These control siRNAs have no known specificity to any human gene, but are presumed to still obtain the ability to be loaded into the RISC complex and otherwise function as an siRNA without inhibiting gene expression. Trypan blue cell viability counts show a significant reduction in HeLa viable cells transfected with LRBA specific 33

PAGE 44

siRNAs as compared to control transfected cells, and cells treated with growth media alone (Figure 13b). To determine whether the effect on viable cell numbers is specific to cancer cells, and not to any human cell type, LRBA specific siRNAs were tested for their ability to inhibit cell viability in both a breast cancer cell line (MCF7) and a non-tumorigenic breast epithelial cell line (MCF10A). Results show a significant reduction in the numbers of viable MCF7 cells when treated with LRBA specific siRNAs as compared to both media and siRNA control treated cells. However, no such reduction of cell viability was observed in the MCF10A treated cells (Figure 14). In addition to developing LRBA specific siRNAs, shRNAs were also constructed. These shRNAs were then tested for their ability to inhibit cancer cell viability and proliferation. To determine whether the inhibition of LRBA mRNA expression has an effect on cancer cell proliferation, a colony forming assay was utilized. Results show that LRBA specific shRNA transfected HeLa cells were much less able to form colonies as compared to HeLa cells transfected with a non-specific control shRNA plasmid (Figure 15). Furthermore, validation of the siRNA approach demonstrating LRBA specific inhibition of cancer cell proliferation was also evident with the shRNA approach as seen in MCF7 cells, and rtPCR analysis confirmed the inhibition of LRBA transcription (Figure 16). 34

PAGE 45

Figure 13. LRBA specific siRNAs inhibit cancer cell growth. (a) Morphology of HeLa cells transfected with either a non-specific control siRNA or a LRBA-specific siRNA. (b) Growth of HeLa cells is inhibited by a LRBA-specific siRNA as compared to a non-specific control siRNA (P = 0.0006), or to cell treated with transfection media alone. 35

PAGE 46

Figure 14. LRBA specific siRNAs inhibit cancer cell proliferation. LRBA-specific siRNAs inhibit the growth of MCF7 cells (top), but not that of MCF10As (bottom). Two LRBA-specific siRNAs (targeting two different regions of the LRBA mRNA sequence) were transfected and compared to a non-specific control siRNA. P-values are 0.0009 (siRNA1)and 0.0005 (siRNA2). 36

PAGE 47

Figure 15. LRBA-specific shRNA vector inhibits cancer cell proliferation. Colony-forming assay shows that LRBA-specific shRNAs inhibits the colony forming ability of HeLa cells (left). Colonies were quantified (right) which shows that this decrease is statistically significant (P = 0.0186). 37

PAGE 48

Figure 16. LRBA specific shRNAs inhibits cancer cell proliferation and LRBA transcription. LRBA-specific shRNAs inhibit the proliferation of both HEK293 and MCF7 cells as compared to cells transfected with a non-specific control shRNA plasmid (top). rtPCR results show that the LRBA-specific shRNA plasmid inhibits the expression of LRBA mRNA in HeLa cells as compared to a non-specific control and -Actin levels show equal loading (bottom). 38

PAGE 49

Inhibition of LRBA activity by a Dominant-Negative mutant also inhibits the proliferation of human cancer cells. Although our data depicting inhibition of LRBA mRNA levels can lead to a dramatic decrease in proliferation and tumorgenecity of cancer cells, a second approach targeting the presumed function of LRBA was utilized to demonstrate this effect through the use of a dominant negative mutant. Adam-Klages et al. have shown that the BEACH and WD40 domain of the FAN can act as a dominant-negative mutant that inhibits its function (Adam-Klages et al., 1996). Therefore, an adenoviral plasmid construct encoding the LRBA BEACH and WD40 domain was constructed and tested for its ability to act as a dominant-negative mutant. This construct contains a promoter driving the expression of GFP and a tetracycline repressor element that, when in the presence of the antibiotic Doxycycline, inhibits gene transcription. Transfection of MCF7 cells with this construct shows a significant reduction in the ability to proliferate as determined by a 3 H thymidine uptake assay (Figure 17). In this assay, radiolabeled thymidine ( 3 H thymidine) is added to the cellular media and is subsequently incorporated into cellular DNA during each round of cellular division. Then, radioactivity is then measured with a scintillation counter. Western blot analysis showed that the construct expresses the dominant-negative mutant and that this expression is repressed in the presence of doxycycline. Furthermore, microscopy analysis of GFP levels also confirmed this finding (Figure 18). 39

PAGE 50

Figure 17. Proliferation of MCF7 is inhibited by adenovirus encoding for a LRBA dominant negative mutant (AdBWGFP). Increasing amounts of AdBWGFP virus was added to MCF-7 cells containing media with or with out doxycycline. A cell proliferation assay shows that the AdBWGFP inhibits the growth of MCF7 cells. 40

PAGE 51

Figure 18. AdBWGFP expression is controlled by doxycyline (b) AdBWGFP expression is tightly controlled by Doxycycline as demonstrated by western blot analysis. -Actin levels show equal loading of protein. (c) Fluorescence microscopy further demonstrates that BWGFP expression is controlled by doxycycline. 41

PAGE 52

LRBA knockdown sensitizes cancer cells to apoptosis. The finding that LRBA expression is important for cancer cell growth and viability led us to next question whether the inhibition of LRBA expression could sensitize cancer cells to apoptosis. To test this, LRBA specific siRNAs were again used to inhibit LRBA mRNA expression in the presence of known apoptosis inducing agents such as UV light and chemotherapeutics. HeLa cells were transfected with either control or LRBA-specific siRNAs and then treated with UV or Staurosporine, a known apoptosis inducing chemical. Cell viability counts show a significant reduction in cell numbers of LRBA-specific siRNA treated HeLa cells in which apoptosis was induced as compared to untreated siRNA transfected cells. Furthermore, cell numbers were significantly decreased in apoptosis induced cells when LRBA expression was inhibited (LRBA siRNA treated cells) as compared to control treated cells (control siRNA and H2O treated) (Figure 19). To further test whether the inhibition of LRBA expression can enhance apoptosis in cancer cells, western blot analysis was performed on siRNA treated HeLa cells (see above) to determine the effect on known players in the apoptosis signal transduction pathway. Caspase 3 is an executioner of apoptosis and a member of a family of cysteine proteases which are activated during apoptosis (Porter & Janicke, 1999). Caspase is a zymogen which is activated by cleavage during either extrinsic or intrinsic apoptosis inducing events. Poly (ADP-Ribose) Polymerase or PARP is an enzyme involved in DNA repair and is a substrate for caspase 3 (Decker & Muller, 2002). Results show a significant increase in both PARP and Caspase 3 levels after apoptosis induction, and this is further 42

PAGE 53

increased when LRBA mRNA expression is inhibited (Figure 20). Cisplatin is a conventional chemotherapeutic that induces the apoptosis. Inhibition of LRBA in addition to treatment with cisplatin showed a significant decrease in cellular proliferation as compared to cisplatin treatment alone suggesting that LRBA may be a target for future development of anti-cancer drugs (Figure 21). 43

PAGE 54

Figure 19. LRBA protects HeLa cells from apoptosis induced by UV or staurosporine. LRBA-specific siRNA transfected HeLa cells show an enhanced sensitivity to either UV or staurosporine treatment as compared to control treated HeLa cells. 44

PAGE 55

Figure 20. Staurosporine and UV treated LRBA-specific siRNA treated HeLa cells show increased PARP and Caspase 3 cleavage. HeLa cells transfected with either a LRBA-specific siRNA or a control siRNA and apoptosis was induced with UV or staurosporine. Western blot analysis shows a significant increase in cleaved PARP and Caspase 3 levels in the LRBA-specific siRNA treated cells as compared to controls. -Actin levels show equal protein loading. 45

PAGE 56

Figure 21. Inhibition of LRBA expression leads to an increased sensitivity to the chemotherapeutic drug cisplatin. HEK293 cells transfected with the LRBA-specific shRNA show an increased sensitivity to cisplatin as compared to cells transfected with a non-specific control (P = 0.0029). 46

PAGE 57

LRBA is involved in EGFR signaling. As previously mentioned, the LRBA orthologue, rugose/AKAP550, has been shown to interact with the EGFR pathway through genetic studies (Shamloula et al., 2002). Therefore, we tested whether LRBA is also involved in EGFR signaling. Additionally, we tested whether a downstream player in the EGFR signal transduction pathway, MAP Kinase (MAPK) is also influenced by LRBA. To this end, the LRBA dominant negative mutant was again used to inhibit LRBA function. HeLa cells were transfected with the dominant negative LRBA mutant with our without the presence of EGF or doxycycline. Western blot analysis showed reduced levels of activated EFGR (phosphorylated) when LRBA function was inhibited (Figure 22). Furthermore, this effect was seen with increasing concentrations of EGF and at two different time points after EGF stimulation. Activated MAPK (phosphorylated) levels were also decreased in the absence of LRBA function. However, this effect was not as immediate as with EGFR and more EGF was required to elicit a response. This is expected as activated EGFR is upstream of MAPK, and therefore a lag response in MAPK activation was anticipated. Furthermore, the requirement of more EGF may be due to the reduced levels of activated EGFR at the smaller dosage. Finally, EGFR and MAPK levels remain unchanged indicating that LRBA and -Actin levels show equal loading of protein. These results suggest that LRBA may play a role in EGFR signaling. 47

PAGE 58

Figure 22. LRBA is involved in the regulation of EGFR signaling. AdBWGFP treated HeLa cells were treated with increasing amounts of EGF in the presence or absence of doxycycline. Western blot analysis shows a decrease in activated EGFR levels in the absence of doxycycline as compared to cells treated with doxycycline. 48

PAGE 59

Discussion The results presented show that LRBA expression is upregulated in various cancers as observed through microarray analysis and levels of LRBA mRNA expression vary depending on the tumor type. Furthermore, LRBA mRNA levels are much higher in ER positive tumors as compared to ER negative tumors. This suggests that LRBAs function in certain cancers may be important and warranted further investigation. Additionally, LRBA may play a more important role in ER positive tumors which are dependent on estrogen for proliferation, thus traditional hormone therapies combined with LRBA targeted therapies could possibly increase the efficacy of these treatments. Furthermore, this suggests a possible link between LRBA function and ER stimulated proliferation providing the basis for future investigation. Characterization of the LRBA promoter sequence yielded several interesting putative transcriptional regulatory sites including a CpG island, a possible ER binding site, and several transcription factor binding sites such as E2F and p53. The presence of the potential ER binding site is of interest due to the increased amount of LRBA expression in ER+ tumors. This provides an explanation as to why LRBA levels are higher in these tumors and should be explored further. The p53 sites provided interest as this tumor suppressors function is critical in cell survival and is highly mutated in cancers (see introduction). Investigation showed that p53 negatively regulates both LRBA promoter activity 49

PAGE 60

and the expression of endogenous LRBA mRNA levels. This provides further credence to the idea that LRBA function may be critical for cancer cell survival and a reason as to why LRBA expression is deregulated in certain cancers. As previously mentioned, p53 activity is induced in cellular crisis events, such as DNA damage, and this activity leads to either cellular senescence or apoptosis. Therefore, its possible that when p53 is non-functional in a cancer cell, due to either mutation of p53 or a regulator of p53 activation, regulation of LRBA expression is lifted and is thus over-expressed. Therefore, LRBA would be free to perform its function of aiding cancer cell proliferation and survival. This provides an intriguing explanation as to why LRBA is over-expressed in such a wide variety of cancers. Additionally, this evidence also suggests that LRBA may possibly play a role in suppressing apoptosis, and therefore, p53 must inhibit LRBA expression in order for apoptosis to ensue. Furthermore, these findings provide the basis for future investigation as to the role LRBA plays in the cell during crisis events. In addition to the finding that p53 negatively regulates LRBA, our results show that both LRBA promoter activity and endogenous mRNA levels are positively regulated by the activating E2F transcription factors. As the activating E2Fs are regulated by the tumor suppressor RB, this provides another interesting explanation as to why LRBA expression is upregulated in certain cancers. As with p53, Rb, or its regulators, are highly mutated in wide range of cancers (see introduction). Since LRBA is positively regulated by activating E2Fs, one explanation for the over-expression of LRBA mRNA levels in cancer cells could 50

PAGE 61

be due to loss of Rb function causing increased E2F activity and thus increased LRBA expression. Furthermore, its possible that this increase in LRBA expression through E2F induction could facilitate cancer cell proliferation or survival. Interestingly, the E2F and p53 pathways also intersect through the tumor suppressor ARF during stress events to induce apoptosis (Bates et al., 1998). During cellular stress, E2F1 induces the expression of ARF which initiates the degradation of MDM2. This prevents the subsequent ubiquitination and degradation of p53, thus stabilizing its expression (La Thangue, 2003). Therefore, its possible that when p53 expression is stabilized by the E2F1 induction of ARF, LRBA expression would subsequently be decreased. Consequently, whatever role LRBA may play in preventing apoptosis in potential cancer cells would be alleviated. Although E2F1 upregulates LRBA expression, and in this model E2F1 activity is responsible for the stabilization of p53 expression, it is possible that p53 repression of LRBA expression supersedes that of E2F1 activation. Thus, E2F1 could play a duel role in regulating LRBA expression by directly upregulating LRBA expression during cellular proliferation and negatively regulating LRBA expression indirectly through ARF-p53 pathway during cellular stress. This connection provides interesting new venues to explore in the transcriptional regulation of LRBA. The findings that LRBA is regulated by both p53 and E2F1 combined with discovery that LRBA expression is upregulated in certain cancers prompted us to investigate whether the inhibition of both LRBA expression and function could 51

PAGE 62

impact cancer cell proliferation. Our results show that inhibiting LRBA expression leads to a decrease in cancer cell viability and proliferation. Furthermore, we observed that cancer cells demonstrated an increased sensitivity to apoptosis inducing agents and to the chemotherapeutic cisplatin. This clearly suggests that LRBA expression and function may be vital to the survival of a cancer cell and that targeting LRBA may be an effective way to aid current cancer therapies. To date, the function of the LRBA protein is unknown. Genetic results from the LRBA orthologue rugose/AKAP550 show that this gene may be involved in EGFR signaling. Therefore, we then assayed for LRBAs ability to interact with the EGFR pathway and results indicated this to be so. Since LRBA appears to be important for the survival of cancer cells, this seems like a logical signal transduction pathway for LRBAs involvement. Furthermore, through the combined findings of LRBA transcriptional regulation and EGFR signaling, an interesting model arises (Figure 23). However, more work needs to be done to determine exactly what role LRBA plays in this pathway, and how this role relates to LRBAs involvement in cancer cell survival. In summary, the results presented show that LRBA is upregulated in various cancers, and that LRBA transcription is negatively regulated by p53 and positively regulated by activating E2Fs. Furthermore, inhibition of LRBA expression and function leads to a decrease in cancer cell proliferation and sensitizes cancer cells to apoptosis inducing agents. Finally, our results show that LRBA plays a role in EGFR signaling. 52

PAGE 63

Figure 23. Possible role of LRBA interaction with the EGFR pathway. LRBA enhances EGFR signaling and leads to the activation of E2F1, which feeds back to activate the expression of LRBA. The positive feedback of the stimulation of LRBA expression by E2F1 leads to enhanced EGFR signaling, and thus cellular proliferation. p53 acts to antagonize this by repressing LRBA expression during cellular stress events. 53

PAGE 64

Materials and Methods Reagents. Restriction enzymes were purchased from New England Biolabs (Beverly, MA); PCR primers were purchased from Integrated DNA Technologies (Coralville, IA); [ 3 H]Thymidine from NEN (Boston, MA); fetal bovine serum from Invitrogen (Gaithersburg, MD) anti-GFP antibody from Santa Cruz Biotechnology (Santa Cruz, CA); staurosporine and cisplatin Sigma (St. Louis, MO); SuperSignal West Femto Kit from Pierce Biotechnology (Rockford, IL), G418 and DNA rapid ligation kit from Roche Diagnostics (Manheim, Germany); EGFR, phospho-EGFR, MAPK, phosphor-MAPK, (Thr202/Thr204), PARP, and caspase 3 antibodies from Cell Signaling Technologies (Beverly, MA). Cell culture. Cell lines were purchased from ATCC (Manassas, VA) and maintained by following culturing protocols outlined by ATCC for each cell line. Microarray. In all experiments, 5ug of total RNA was used to generate the mRNA for microarray analysis. cDNA was generated from the mRNA by rtPCR and labeled with biotin as described by Van Gelder et al. Hybridization of the biotin labeled DNA, staining, and scanning of the chips was performed by following the manufacturers instructions (Affimetrix, Santa Clara, CA) and as previously described (Warrington et al., 2000). The Affymetrix oligonucleotide array chips used were U95A and HU6800. Output files from scanned chips were 54

PAGE 65

inspected for hybridizations artifacts and analyzed by using the Affymetrix Microarray Software version 4.0. Some microarray data was provided by R Jove and G Bepler at the H. Lee Moffitt Cancer Center (Bloom et al., 2004). rtPCR and Real Time rtPCR. RNA was isolated from 5 x 10 5 cells and purified with the RNAqueos 4-PCR Kit (Ambion, Austin, TX) following the manufacturers protocol. cDNA was then generated by using oligo-dT primers and Supercript II reverse transcriptase (Invitrogen, Carlsbad, CA) following the manufacturers protocol. The synthesized cDNA mixture was then diluted at 1:10 and used (2 ml) for either PCR with the primers for LRBA: 5-TCACCCCAAAAGGATTAGATGGACC-3, and 5-GAAAGAAAGGCTCTGCGAACCTCC-3; for -actin: 5-TGACGGGGTCACCCACACTGTGCC-3 and 5-TAGAAGCATTTGCGGTGGACGATG-3, or by real-time PCR with the primers for LRBA: 5-CCAACTTCAGAGATTTGTCCAAGC-3 and 5-ATGCTGCTCTTTTTGGGTTCAG-3; for -actin: 5-ATTGCCGACAGGATGCAGAA-3 and 5-GCTGATCCACATCTGCTGGAA-3. ABI Perkin-ElmerPr ism 7700 Sequence Detection System (Applied Biosystems, Inc., FosterCit y, CA, USA) and SYBR Green Quantitect MasterMix (Qiagen, Valencia, CA, USA) were used for real time PCR following the manufacturers protocol. 55

PAGE 66

RACE and determination of the transcription start sites. Switching mechanism at 5 end of RNA transcript (SMART) rapid amplification of cDNA ends (RACE) amplification kit (Clontech, Palo Alto, CA, USA) was used to map the 5 end of LRBA gene transcripts. The 5 cDNA of LRBA gene was synthesized from 2.5 g of normal prostate or prostate tumor total RNA by reverse transcription using the PowerScript Reverse Transcriptase (Clontech) and LRBA-specific primer 5-CACACAGAGCATTGTAGCAAGCTCCTC-3. The first PCR reaction was carried out using the LRBA specific primer 5-GGGCACTGGGGAGAATTTCGAAGTAGG-3 and UPM primer provided, following the manufacturers recommendation. Primers for the secondary PCR amplification are 5-TGCAGACTTGAAGATTCCG-3 and the NUP primer provided. The Advantage polymerase mix (Clontech) was used for these PCR amplifications. The PCR products were cloned and sequenced. Cloning and sequencing of the LRBA promoter. Based on the genomic sequence in GenBank (AC011122) and our sequences from 5 RACE, we designed PCR primers to amplify a 2 kb putative promoter fragment from human genomic DNA extracted from MCF-10A cells by DNeasy tissue kit (Qiagen). The primers are: 5CGCCTCGAGCGGCTTCT GTCCACTTCTCAAGGC3 and 5-CCCAAGCTTATCTCTCTCCCCGAGGCTGACAAC-3. The amplification was carried out by using the Advantage-GC Genomic PCR Kit (Clontech) and 5 l 56

PAGE 67

GC-Met for 50 l PCR reaction, following the manufacturers recommendation. This 2 kb PCR product was cloned into the pGL2 vector or (Promega, Madison, WI, USA) to obtain the pLA-luc luciferase reporter vector or the pEGFPN1 (Clonetech) vector to obtain the LRBA-GFP vector. Sequencing of the LRBA promoter was performed by the following primers: 5-TGCGAGTGGTGAGGATG-3, 5-GACGGAAGGGTCTCTCCT-3, 5-TGCGAGTGGTGAGGATG-3, 5-CGAGCTAATCTTCACATTG-3 and 5-TTCCTCACCCAGATACTCCG-3. Luciferase assays for LRBA promoter analysis. Cells were seeded 24 h prior to transfection in a 24-well plate at a density of 1 x 10 5 cells per well. The pLA-luc vector was co-transfected with p53 or E2F gene expression vectors into H1299 orT98G cells using Lipofectamine 2000 (Invitrogen) following the manufacturers protocol. For p53 assays, the vectors pCMV-p53 or pCMV-p53 mt135 (Clontech) were used. ForE2F assays, pcDNA E2F1wt, pE2F2wt, pE2F3a and pcDNAE2F1eco132 were used. In all experimental systems, a Renillan luciferase control vector, pRL-TK, pRLCMV, or pRL-Null (Promega) was co-transfected with the pLA-luc. Luciferase assays were performed using the Dual Luciferase Reporter Assay System (Promega) following the manufacturers protocol. Luciferase activity was detected using a Lumat LB9501 luminometer (Berthold Technologies, Oak Ridge, TN, USA). The luciferase activity units were normalized to the Renillan luciferase control. 57

PAGE 68

GFP assay of p53 repression of LRBA promoter activity. The LRBA promoter vector driving GFP expression (LRBA-GFP) was transfected into H1299 cells alone, or co-transfected with either the p53 wild-type or p53 DNA-binding mutant construct as previously described (see above). 24 hours post-transfection, the cells were washed in a 24-well plate two times in 1x PBS. Cells were then lifted using 1x 0.25% Trypsin-EDTA (Gibco), pooled and washed with 1x PBS. Cells were then resuspended in staining media (PBS, 3% FBS, and 10mM HEPES) to a final concentration of 2x10 7 cells/ml. GFP levels were then determined through flow cytometry on a FACSCalibur (Beckton Dickenson) flow cytometer. siRNA knockdown of LRBA expression. LRBA siRNA oligonucleotides were synthesized and purified by Dharmacon (Lafayette, CO, USA). At 1 day before transfection, HeLa cells were seeded in a 24-well plate at 2 x 10 4 cells per well. The LRBA siRNA (siRNA1: 5-AACCAGCAAAGGUCUUGGCUA-3, siRNA2: 5-AAGGGCACUCUUUCUGUCACCUU-3) and control siRNA (luciferase: 5-AACGUACGCGGAAUACUUCGA-3, scramble siRNA: 5-CAGUCGCGUUUGCGACUGG-3) duplexes at 50 nM were transfected into HeLa cells following the previous protocol (Harborth et al., 2001). At 48 h post-transfection, cells were trypsinized to obtain a single-cell suspension and counted with a Coulter counter (Beckman coulter, Inc., Fullerton, CA, USA) or via 58

PAGE 69

Trypan blue exclusion assay. Knockdown of LRBA mRNA levels was confirmed by RTPCR using primers 5-GGTGGACCTACTGGAAAAATGTGAC-3 and 5-TAGCCAAGACCTTTGCTGGTTC-3. Construction of the LRBA dominant negative mutant recombinant adenovirus. The replication-deficient recombinant adenovirus designated AdBWGFP, which expresses GFP-tagged BW (BEACH-WD) region of mouse Lrba, was generated by Adeno-X Tet-Off Expression Systems (Clontech) following the manufacturers instructions. The recombinant adenoviral plasmid was linearized and transfected into 293 cells (Clontech) using FuGENE 6 (Roche Molecular Biochemicals), as recommended by the manufacturer. After 4 days, cell suspension was cleared by centrifugation (1500 g) for 5 minutes, and the supernatant containing ~ 10 3 viral particles were frozen at -80C. Stocks of high viral titer were prepared following the protocol outlined by He et al., 1998. Cell proliferation assays. CF-7 Tet-Off cells (Clontech) were seeded in a 96-well plate at 2 x 10 4 cells per well and cultured for 24 h. Cells were infected with different titer of the recombinant AdBWGFP adenoviruses. Doxycycline (Clontech), which represses expression of the BWGFP fusion protein, was used at 1 mg/ml. After 72 h post infection, cells were labeled with 3 H thymidine (1 Ci per well). After 18 hours, cells were harvested by trypsinization and counts per minute (CPM) measured. 59

PAGE 70

Construction of shRNA plasmids. The following oligos and their complement oligos were synthesized and PAGE purified by Invitrogen, then annealed and cloned into the pBS/U6 vector separately, following the methods described previously (Sui et al., 2002): 5-(p)GGAGTGCTGGCTAGCTATAATTCAAGAGATTATAGCTAGCCAGCACTCCCTTTTTG-3; Oligo-2 is 5-(p)GGTTGGTTGAAGTTGGAGAATTCAAGAGATTCTCC AACTTCAAC CAACCCTTTTTG-3. The murine SHIP (SH2-containing inositol phosphatase) shRNA vector[5-(p)GGGACGACTCTGCTGACTACATTTCAAGAGAATGTAGTCAGCAGAGTCGTCCCTTTTTG-3] used as a negative control was a gift from Drs John Ninos and Shih-Chang Tsai at the H Lee Moffitt Cancer Center and Research Institute. Gene sequences are in uppercase. Colony-forming assays. HeLa cells were plated in a 24-well plate at 5 x 10 5 /well 1 day before transfection. Transfections were conducted using Lipofectamine 2000 (Invitrogen) following the manufacturers protocol with some modifications. Less (0.2 l per well) Lipofectamine 2000 and more OPTI media (200 l per well) were used to reduce the toxicity. After 12 hours, 300 l of DMEM complete medium was added to each well. After another 12 hours, HeLa cells in each well were trypsinized, transferred to one 100mm plate, and 60

PAGE 71

incubated for 10 days with G418 at 400 g/ml. Colonies were stained with 0.5 ml of 0.005% Crystal Violet for 30 min to enable enumeration of colonies. Western blot analysis. For preparation of cellular protein, cells were rinsed with PBS and lysed in RIPA containing 100 g/ml phenyl-methylsulfonyl fluoride, 2 g/ml aprotinin, 2 g/ml leupeptin and 1% NP-40 (lysis buffer). Protein concentrations of cell lysates were determined by Coomassie Plus Protein Assay Kit (Pierce). Cellular protein (100 g) was loaded onto an 8% SDSPAGE gel (Invitrogen) and transferred to PVDF or nitrocellular membranes. Membranes were blocked for 1 hour at room temperature in 5% milk, washed with PBST (PBS with 0.1%Tween-20) and incubated with the indicated antibodies for 1 or 24 hours. Membranes were washed three times in PBST and HRP-conjugated secondary antibody was added at 1:2,000 to 80,000 in 5% milk for 1 hour. Membranes were washed and detected by ECL (Amersham Life Science, Piscataway, NJ, USA) or the SuperSignal West Femto Kit (Pierce, Rockford, IL, USA) and exposed to an X-ray film (Kodak, Rochester, NY, USA). In some cases, blots were stripped with Restoret Western Blot Stripping Buffer (Pierce) and probed a second time with other primary antibodies. EGF stimulation assay. HeLa cells were seeded at 1 x 10 5 /well in a24-well plate. After 24 hours, the media was removed and replaced with 200 l OPTI media containing the AdBWGFP recombinant adenovirus with or without doxycycline. After 24 h, the media was removed and replaced with 200 l OPTI 61

PAGE 72

media containing either 0.5, 1, or 10 ng/ml of EGF. The cells were then incubated at 37C for either 10 or 60 minutes and lysed with RIPA buffer. Western blot analysis was then performed as described above. Statistical analysis. Prism v3.0. was used to make all column bar graphics and calculate the statistical significance of the experimental results by using a two tailed unpaired T-test at 95% confidence intervals. P<0.05 was considered to be statistically significant and is marked with in the figures. 62

PAGE 73

Chapter Two RNAi Mediated Inhibition of SHIP-1 Expression in Mouse and Human Cells Introduction PI3 Kinase and the Akt pathways. The PI3 Kinase (PI3-K) family of enzymes regulate phosphorylation of various phospholipid species (Deane & Fruman, 2004). Through this mechanism of action, this family of enzymes regulates several critical cellular processes such as proliferation, migration, cell cycle initiation, and survival (Rauh et al., 2003). Furthermore, PI3-K is involved in several disease processes such as diabetes and cancer (Cantley, 2002). One mechanism in particular involves the conversion of PI-3,4-P (PIP-2) to PI-3,4,5-P (PIP-3) by the Class Ia PI3-Ks in higher eukaryotes. This functions to create an abundance of PIP-3 which acts to recruit proteins with Pleckstrin Homology domains to the cellular membrane. This mechanism functions to regulate several important signal transduction processes such as the activation of the kinase Akt/PKB (Figure 24). 63

PAGE 74

Figure 24. The role of PI3-K and SHIP in the activation of Akt PI3-K catalyzes the conversion of PIP-2 to PIP-3 which activates the kinase PDK1. PDK1 then activates Akt through phosphorylation. SHIP opposes the PI3-K pathway through its phosphatase activity which catalyzes the conversion of PIP-3 to PIP-2. 64

PAGE 75

Akt/PKB is a serine/threonine kinase and a member of the protein kinase A, G, and C superfamily. This protein is involved in several signal transduction pathways that govern cellular functions such as proliferation, metabolism, apoptosis, and transcriptional regulation. Furthermore, the Akt pathway has been characterized as one of the most important pathways in the regulation of cell survival (Song, Ouyang, & Bao, 2005). One of the ways that Akt influences cell survival is through the negative regulation of apoptosis. This involves the regulation of a pro-apoptotic member of the Bcl-2 family of proteins known as BAD. BAD associates anti-apoptotic members of the Bcl-2 family, such as Bcl-xl through protein-protein interaction. Akt regulates BADs function by phosphorylation of Serine residue at position 136. Once phosphorylated, BAD associates with the 14-3-3 protein and is retained in the cytoplasm, thus allowing anti-apoptotic Bcl-2 family members to prevent apoptosis (Figure 25, (Jorissen et al., 2003)). 65

PAGE 76

Figure 25. The role of Akt and BAD in cell survival Akt is activated by cell survival signals through phosphorylation. Activated Akt then phosphorylates BAD which then dissociates from Bcl-xl. BAD then binds to the 14-3-3 protein and is retained in the cytosol and Bcl-xl is free to function in cell survival related processes. 66

PAGE 77

As previously mentioned, the activation of Akt occurs after recruitment to the plasma membrane by the binding of PIP-3 in its Pleckstrin Homology (PH) domain (Andjelkovic et al., 1997). There, Akt activity is primarily regulated at two phosphorylation sites, threonine 308 which is located in the activation loop and serine 473 which is located in the C-terminal regulatory domain (Alessi et al., 1996; Bayascas & Alessi, 2005). Phosphorylation at Thr308 only partially activates Akt, and phosphorlylation of both Thr308 and Ser473 is required for complete activation. However, phosphorylation of Ser473 alone is insufficient to activate Akt. Akt is phosphorylated at the Thr308 position by phosphoinositide dependent kinase 1 (PDK1) (Figure 24), while the mechanism of phosphorylation of Ser473 remains unclear (Song, Ouyang, & Bao, 2005). The SH2-containing Inositol 5 Phosphatase gene and Natural Killer cells. The SH2-containing Inositol 5 Phosphatase (SHIP) gene, also known as SHIP-1, encodes for a 145 kDa protein that catalyzes the conversion of PI-3,4,5-P (PIP3) to PI-3,4-P (PIP2). This action functions to negatively regulate the PI3K pathway and thus Akt activation (Figure 24). There are several isoforms of the SHIP protein including SHIP-1 and SHIP-2. SHIP-1 is primarily expressed in the hematopoietic compartment while SHIP-2 is believed to be ubiquitously expressed in every other cell type (Sly, Rauh, Kalesnikoff, Buchse, & Krystal, 2003). 67

PAGE 78

Previous work has shown that SHIP-1 -/permit of engraftment allogeneic tissues, such as bone marrow. This is due to compromised rejection by SHIP -/Natural Killer (NK) cells and which is attributed to reduced Graft Versus Host Disease (GVHD) due to an expansion of myeloid suppressor cells (Ghansah et al., 2004; J. W. Wang et al., 2002). Furthermore, mouse germ line SHIP deficient mice show a significant disruption in the NK receptor repertoire of NK cells and this phenotype most likely contributes to GVHD evasion (J. W. Wang et al., 2002). Natural Killer (NK) cells are lymphocytes part of the innate immune system (Lanier, 2005). These cells are activated to kill cells in distress (such as cancer cells and virally infected cells) through the expression of a complex repertoire of receptors (Makrigiannis & Anderson, 2003). These receptors can either activate or inhibit NK cell mediated killing primarily through the presence of ITAM (immunoreceptor tyrosine activation motif) or ITIM (immunoreceptor tyrosine inhibiting motif) domains in their cytoplasmic domains (Lanier, 2005). Previous studies of the loss of SHIP-1 function relied on genetic studies in knockout mice as well as over-expression of SHIP-1 and antisense approaches in human cells. However, with the discovery of RNAi as a tool to study the loss of function in vitro, we set out design both mouse and human SHIP-1 specific siRNAs. Furthermore, human SHIP-1 specific siRNAs were used to test whether SHIP-1 regulates Akt activation NK cells. 68

PAGE 79

Results Generation of human and mouse SHIP-1 specific siRNAs. To inhibit SHIP-1 expression in mice, several siRNAs were designed targeting several locations of the SHIP-1 cDNA sequence. These siRNAs were then tested for their ability to knock-down SHIP-1 protein levels in vitro by nucleofection into the mouse macrophage cell line, RAW264.7 which is known to express SHIIP-1 at high levels as determined through western blot analysis. Results show reproducible inhibition of SHIP-1 expression for siRNA-5, 7, 8, and 9 (Figure 26). As with the mice siRNAs, human SHIP-1 specific siRNAs were designed targeting two different regions of the SHIP-1 cDNA sequence. These siRNAs were then nucleofected into the human natural killer cell line, NKL. Results show that both siRNAs h1 and h2 are effective at knocking down SHIP-1 expression as compared to NKLs nucleofected with a luciferase-specific control. However, siRNA-h1 was more effective at inhibiting SHIP-1 protein expression. Furthermore, this inhibition was significant at 24, 48, and 73 hours (Figure 23). Thus we have 2 highly effective siRNAs to use in studying the loss of SHIP-1 in human cells. 69

PAGE 80

Figure 26. Knockdown of mouse SHIP-1 levels in the mouse macrophage cell line RAW264.7. Significant knockdown of SHIP-1 protein levels is evident 48 hours after transfection of SHIP-1 specific siRNAs 5, 7, 8, and 9 as compared to a non-specific control, C. 70

PAGE 81

71

PAGE 82

Figure 27. Inhibition of SHIP-1 expression in human NK cells. Significant knockdown of SHIP-1 protein expression is evident in the human NK cell line NKL with the two SHIP-1 specific siRNAs h1 and h2 as compared to a non-specific control (top). Significant knockdown of SHIP-1 levels is evident 24 (top), 48 and 72 hours post transfection (bottom) as compared to a non-specific control, C. 72

PAGE 83

SHIP-1 is involved in regulating Akt activation in human NK cells. As previously mentioned, previous results have shown that activated Akt levels are elevated in mouse SHIP-/NK cells as compared to mouse SHIP+/+ NK cells. To determine whether SHIP-1 plays a role in the activation of AKT in human NK cells, NKL cells were nucleofected with the highly effective siRNA-h1 or control siRNAs as previously described. These cells were then lysed 48 hours after nucleofection and probed for p-Akt (Thr308), SHIP-1, and -Actin. Results show elevated levels of p-Akt (Thr308) in cells in which SHIP-1 protein expression was inhibited as compared to NKL cells transfected with non-specific control siRNAs (Figure 28). Furthermore, -Actin levels demonstrate equal protein loading. 73

PAGE 84

Figure 28. SHIP-1 influences the activation of Akt NKL cells nucleofected with SHIP-1 specific siRNAs show increased levels of activated Akt as compared with cells nucleofected with a non-specific control. Actin levels show equal loading of protein. 74

PAGE 85

Discussion RNAi is a relatively new technique utilized to study the absence of expression of a particular gene of interest in cell lines. Previously, this was limited to the tedious and time consuming process of generating knock out mice, and to antisense approaches that induced interferon responses. Therefore, we set out design SHIP-1 specific siRNAs to study the loss of SHIP-1 expression in both mouse and human cells. Our results show a significant reduction in SHIP-1 protein levels in both a mouse macrophage cell line and a human natural killer cell line. These new tools will allow for the further elucidation of the role this enzyme plays in critical immune functions. Human NK cells nucleofected with the highly effective human SHIP-1 specific siRNA-h1 showed an increase in activated Akt levels as compared to human NK cells nucleofected with a non-specific control. This finding not only confirms what was previously observed in mouse SHIP-/NK cells, but suggests that SHIP-1s role in opposing Akt activation is highly significant as the effect was observed only 48 hours after knock-down of SHIP-1 expression. These findings are also in agreement with what was observed in human T Cells (Horn et al., 2004). In this instance, SHIP-1 expression was restored in Jurkat cells, which are SHIP-1 deficient, and a significant reduction of Akt kinase activity was observed. These results provide fodder for future investigation as to what role SHIP-1 plays in the Akt pathway of human NK cells. 75

PAGE 86

Materials and Methods siRNA Design. siRNAs were designed using the siDesign feature of the Dharmacon website ( http://www.dharmacon.com/sidesign/ ). Mouse sequences used were as follows: 1. sense: 5-GAAGAUCACGUCCUGGUUUdTdT-3, antisense: 5-AAACCAGGACGACGUGAUCUUCdTdT-3 2. sense: 5-UGGUCCUGGCACUGUAGAUdTdT-3, antisense: 5-AUCUACAGUGCCAGGACCAdTdT-3, 3. sense: 5-UGAGAUGAUCAA UCCAAACdTdT-3, antisense: 5-GUUUGGAUUGAUCAUCUCAdTdT-3, 4. sense: 5-GACGACUCUGCUGACUACAdTdT-3, antisense: 5-UGU AGUCAGCAGAGUCGUCdTdT-3, 5. sense: 5-UGA AUCCAGUGGAAUGAAAdTdT, antisense: 5-UUUCAUUCCACUGGAUUCAdTdT, 6. sense: 5-AGAUGAUCAAUCCAAACUAdTdT-3, antisense: 5-UAGUUUGGAUUGAUC AUCUdTdT-3, 7. sense: 5-AGACUACCGUGACAACACAdTdT-3, antisense: 5-UGUGUUGUCACGGUAGUCUdTdT-3, 8. sense: 5UGUGUUAAGUGCUUU AUG AdTdT-3, antisense: 5-UCAUAAAGCACUUAACACAdTdT-3, 9. sense: 5-AAACCAUCGGUCUCUUAGAdTdT-3, antisense: 5-UCUAAGAGACCG AUGGUUUdTdT-3. Human sequences used were: h1. sense: 5-GGAAUUGCGUUUACACUUAdTdT-3, antisense: 5-UAAGUGUAAACG CAAUUCCdTdT-3, h2. sense: 5-AUUUGCGUUUACACUUACAdTdT-3, 76

PAGE 87

antisense: 5-UGUAAGUGUAAACGCAAUUdTdT-3. The luciferase specific control siRNA siControl #2 (Dharmacon) was used as a non-specific control. Cell lines. The mouse macrophage cell line RAW264.7 was grown in DMEM, 10% FBS, and 1% Penicillin and Streptomycin. The human natural killer cell lines NKL and NK3.3 were grown in RPMI 1640, 10% FBS, 1% Penicillin and Streptomycin, 200U/ml of Proleukin 2 (Chiron), and 5ug/ml of Plasmocin (InvivoGen). Nuleofection of siRNAs. All siRNAs were transfected using the Nucleofection system from Amaxa. For the RAW264.7 cells, 2 x 106 cells were nucleofected per siRNA with solution V kit following the manufacturers instructions at the setting T-24. 4.0ug of pmaxGFP vector (Amaxa) or 1.5ug of the corresponding siRNA was used for each individual nucleoporation. For the NK3.3 and NKL cell lines, 2x106 cells were nucleofected with solution V following the manufacturers instructions at the setting O-17. Again, 4.0ug of pmaxGFP vector (Amaxa) or 1.5ug of the corresponding siRNA was used for each individual nucleoporation. Cell were incubated for the indicated period of times and either tested for GFP expression by fluorescent microscopy or lysed for Western Blot analysis of protein levels. Western Blot Analysis. Western Blot analysis was performed as previously described (see page x). The following antibodies were used: anti77

PAGE 88

SHIP-1, P1C1 (Santa Cruz Biotechnology), anti--Actin, C-11 (Santa Cruz Biotechnology), and phopho-Akt(Thr308) (Cell Signaling Technology). A BCA protein assay (Promega) was performed following the manufacturers protocol to ensure equal loading of protein following. 78

PAGE 89

References Adam-Klages, S., Adam, D., Wiegmann, K., Struve, S., Kolanus, W., Schneider-Mergener, J., et al. (1996). FAN, a novel WD-repeat protein, couples the p55 TNF-receptor to neutral sphingomyelinase. Cell, 86(6), 937-947. Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P., et al. (1996). Mechanism of activation of protein kinase B by insulin and IGF-1. Embo J, 15(23), 6541-6551. Andjelkovic, M., Alessi, D. R., Meier, R., Fernandez, A., Lamb, N. J., Frech, M., et al. (1997). Role of translocation in the activation and function of protein kinase B. J Biol Chem, 272(50), 31515-31524. Appella, E., & Anderson, C. W. (2001). Post-translational modifications and activation of p53 by genotoxic stresses. Eur J Biochem, 268(10), 2764-2772. Arya, M., Shergill, I. S., Williamson, M., Gommersall, L., Arya, N., & Patel, H. R. (2005). Basic principles of real-time quantitative PCR. Expert Rev Mol Diagn, 5(2), 209-219. 79

PAGE 90

Bates, S., Phillips, A. C., Clark, P. A., Stott, F., Peters, G., Ludwig, R. L., et al. (1998). p14ARF links the tumour suppressors RB and p53. Nature, 395(6698), 124-125. Bayascas, J. R., & Alessi, D. R. (2005). Regulation of Akt/PKB Ser473 phosphorylation. Mol Cell, 18(2), 143-145. Bhattacharjee, A., Richards, W. G., Staunton, J., Li, C., Monti, S., Vasa, P., et al. (2001). Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc Natl Acad Sci U S A, 98(24), 13790-13795. Bianco, R., Troiani, T., Tortora, G., & Ciardiello, F. (2005). Intrinsic and acquired resistance to EGFR inhibitors in human cancer therapy. Endocr Relat Cancer, 12(Supplement_1), S159-S171. Blomberg, N., Baraldi, E., Nilges, M., & Saraste, M. (1999). The PH superfold: a structural scaffold for multiple functions. Trends Biochem Sci, 24(11), 441-445. Bond, G. L., Hu, W., & Levine, A. J. (2005). MDM2 is a central node in the p53 pathway: 12 years and counting. Curr Cancer Drug Targets, 5(1), 3-8. Bustin, S. A. (2002). Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol, 29(1), 23-39. 80

PAGE 91

Cantley, L. C. (2002). The phosphoinositide 3-kinase pathway. Science, 296(5573), 1655-1657. Casalini, P., Iorio, M. V., Galmozzi, E., & Menard, S. (2004). Role of HER receptors family in development and differentiation. J Cell Physiol, 200(3), 343-350. Chau, B. N., & Wang, J. Y. (2003). Coordinated regulation of life and death by RB. Nat Rev Cancer, 3(2), 130-138. Classon, M., & Harlow, E. (2002). The retinoblastoma tumour suppressor in development and cancer. Nat Rev Cancer, 2(12), 910-917. Cobrinik, D. (2005). Pocket proteins and cell cycle control. Oncogene, 24(17), 2796-2809. Deane, J. A., & Fruman, D. A. (2004). Phosphoinositide 3-kinase: diverse roles in immune cell activation. Annu Rev Immunol, 22, 563-598. Decker, P., & Muller, S. (2002). Modulating poly (ADP-ribose) polymerase activity: potential for the prevention and therapy of pathogenic situations involving DNA damage and oxidative stress. Curr Pharm Biotechnol, 3(3), 275-283. DeGregori, J., Leone, G., Miron, A., Jakoi, L., & Nevins, J. R. (1997). Distinct roles for E2F proteins in cell growth control and apoptosis. Proc Natl Acad Sci U S A, 94(14), 7245-7250. 81

PAGE 92

Dimova, D. K., & Dyson, N. J. (2005). The E2F transcriptional network: old acquaintances with new faces. Oncogene, 24(17), 2810-2826. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., & Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature, 411(6836), 494-498. Field, S. J., Tsai, F. Y., Kuo, F., Zubiaga, A. M., Kaelin, W. G., Jr., Livingston, D. M., et al. (1996). E2F-1 functions in mice to promote apoptosis and suppress proliferation. Cell, 85(4), 549-561. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., & Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 391(6669), 806-811. Fischer, O. M., Hart, S., Gschwind, A., & Ullrich, A. (2003). EGFR signal transactivation in cancer cells. Biochem Soc Trans, 31(Pt 6), 1203-1208. Gebauer, D., Li, J., Jogl, G., Shen, Y., Myszka, D. G., & Tong, L. (2004). Crystal structure of the PH-BEACH domains of human LRBA/BGL. Biochemistry, 43(47), 14873-14880. Ghansah, T., Paraiso, K. H., Highfill, S., Desponts, C., May, S., McIntosh, J. K., et al. (2004). Expansion of myeloid suppressor cells in SHIP-deficient mice represses allogeneic T cell responses. J Immunol, 173(12), 7324-7330. 82

PAGE 93

Hallstrom, T. C., & Nevins, J. R. (2003). Specificity in the activation and control of transcription factor E2F-dependent apoptosis. Proc Natl Acad Sci U S A, 100(19), 10848-10853. Hanahan, D., & Weinberg, R. A. (2000). The hallmarks of cancer. Cell, 100(1), 57-70. Hannon, G. J., & Rossi, J. J. (2004). Unlocking the potential of the human genome with RNA interference. Nature, 431(7006), 371-378. Harris, S. L., & Levine, A. J. (2005). The p53 pathway: positive and negative feedback loops. Oncogene, 24(17), 2899-2908. Hitchens, M. R., & Robbins, P. D. (2003). The role of the transcription factor DP in apoptosis. Apoptosis, 8(5), 461-468. Horn, S., Endl, E., Fehse, B., Weck, M. M., Mayr, G. W., & Jucker, M. (2004). Restoration of SHIP activity in a human leukemia cell line downregulates constitutively activated phosphatidylinositol 3-kinase/Akt/GSK-3beta signaling and leads to an increased transit time through the G1 phase of the cell cycle. Leukemia, 18(11), 1839-1849. Jin, S., & Levine, A. J. (2001). The p53 functional circuit. J Cell Sci, 114(Pt 23), 4139-4140. Jogl, G., Shen, Y., Gebauer, D., Li, J., Wiegmann, K., Kashkar, H., et al. (2002). Crystal structure of the BEACH domain reveals an unusual fold and 83

PAGE 94

extensive association with a novel PH domain. Embo J, 21(18), 4785-4795. Jorissen, R. N., Walker, F., Pouliot, N., Garrett, T. P., Ward, C. W., & Burgess, A. W. (2003). Epidermal growth factor receptor: mechanisms of activation and signalling. Exp Cell Res, 284(1), 31-53. Kerr, W. G., Heller, M., & Herzenberg, L. A. (1996). Analysis of lipopolysaccharide-response genes in B-lineage cells demonstrates that they can have differentiation stage-restricted expression and contain SH2 domains. Proc Natl Acad Sci U S A, 93(9), 3947-3952. Kwak, E., Gerald, N., Larochelle, D. A., Vithalani, K. K., Niswonger, M. L., Maready, M., et al. (1999). LvsA, a protein related to the mouse beige protein, is required for cytokinesis in Dictyostelium. Mol Biol Cell, 10(12), 4429-4439. La Thangue, N. B. (2003). The yin and yang of E2F-1: balancing life and death. Nat Cell Biol, 5(7), 587-589. Lanier, L. L. (2005). NK cell recognition. Annu Rev Immunol, 23, 225-274. Leone, G., Sears, R., Huang, E., Rempel, R., Nuckolls, F., Park, C. H., et al. (2001). Myc requires distinct E2F activities to induce S phase and apoptosis. Mol Cell, 8(1), 105-113. 84

PAGE 95

Li, D., & Roberts, R. (2001). WD-repeat proteins: structure characteristics, biological function, and their involvement in human diseases. Cell Mol Life Sci, 58(14), 2085-2097. Makrigiannis, A. P., & Anderson, S. K. (2003). Regulation of natural killer cell function. Cancer Biol Ther, 2(6), 610-616. Meister, G., & Tuschl, T. (2004). Mechanisms of gene silencing by double-stranded RNA. Nature, 431(7006), 343-349. Mendelsohn, J. (2001). The epidermal growth factor receptor as a target for cancer therapy. Endocr Relat Cancer, 8(1), 3-9. Nagle, D. L., Karim, M. A., Woolf, E. A., Holmgren, L., Bork, P., Misumi, D. J., et al. (1996). Identification and mutation analysis of the complete gene for Chediak-Higashi syndrome. Nat Genet, 14(3), 307-311. Nevins, J. R. (2001). The Rb/E2F pathway and cancer. Hum Mol Genet, 10(7), 699-703. Nevins, J. R., Leone, G., DeGregori, J., & Jakoi, L. (1997). Role of the Rb/E2F pathway in cell growth control. J Cell Physiol, 173(2), 233-236. Nielsen, S. J., Schneider, R., Bauer, U. M., Bannister, A. J., Morrison, A., O'Carroll, D., et al. (2001). Rb targets histone H3 methylation and HP1 to promoters. Nature, 412(6846), 561-565. 85

PAGE 96

Ohtani, K. (1999). Implication of transcription factor E2F in regulation of DNA replication. Front Biosci, 4, D793-804. Porter, A. G., & Janicke, R. U. (1999). Emerging roles of caspase-3 in apoptosis. Cell Death Differ, 6(2), 99-104. Rauh, M. J., Kalesnikoff, J., Hughes, M., Sly, L., Lam, V., & Krystal, G. (2003). Role of Src homology 2-containing-inositol 5'-phosphatase (SHIP) in mast cells and macrophages. Biochem Soc Trans, 31(Pt 1), 286-291. Schulze, A., & Downward, J. (2001). Navigating gene expression using microarrays--a technology review. Nat Cell Biol, 3(8), E190-195. Segui, B., Cuvillier, O., Adam-Klages, S., Garcia, V., Malagarie-Cazenave, S., Leveque, S., et al. (2001). Involvement of FAN in TNF-induced apoptosis. J Clin Invest, 108(1), 143-151. Shamloula, H. K., Mbogho, M. P., Pimentel, A. C., Chrzanowska-Lightowlers, Z. M., Hyatt, V., Okano, H., et al. (2002). rugose (rg), a Drosophila A kinase anchor protein, is required for retinal pattern formation and interacts genetically with multiple signaling pathways. Genetics, 161(2), 693-710. Sherr, C. J. (1996). Cancer cell cycles. Science, 274(5293), 1672-1677. Sherr, C. J. (2004). Principles of tumor suppression. Cell, 116(2), 235-246. 86

PAGE 97

Sherr, C. J., & McCormick, F. (2002). The RB and p53 pathways in cancer. Cancer Cell, 2(2), 103-112. Sly, L. M., Rauh, M. J., Kalesnikoff, J., Buchse, T., & Krystal, G. (2003). SHIP, SHIP2, and PTEN activities are regulated in vivo by modulation of their protein levels: SHIP is up-regulated in macrophages and mast cells by lipopolysaccharide. Exp Hematol, 31(12), 1170-1181. Song, G., Ouyang, G., & Bao, S. (2005). The activation of Akt/PKB signaling pathway and cell survival. J Cell Mol Med, 9(1), 59-71. Spritz, R. A. (1998). Genetic defects in Chediak-Higashi syndrome and the beige mouse. J Clin Immunol, 18(2), 97-105. Su, Y., Balice-Gordon, R. J., Hess, D. M., Landsman, D. S., Minarcik, J., Golden, J., et al. (2004). Neurobeachin is essential for neuromuscular synaptic transmission. J Neurosci, 24(14), 3627-3636. Vogelstein, B., Lane, D., & Levine, A. J. (2000). Surfing the p53 network. Nature, 408(6810), 307-310. Wang, J. W., Howson, J., Haller, E., & Kerr, W. G. (2001). Identification of a novel lipopolysaccharide-inducible gene with key features of both A kinase anchor proteins and chs1/beige proteins. J Immunol, 166(7), 4586-4595. 87

PAGE 98

Wang, J. W., Howson, J. M., Ghansah, T., Desponts, C., Ninos, J. M., May, S. L., et al. (2002). Influence of SHIP on the NK repertoire and allogeneic bone marrow transplantation. Science, 295(5562), 2094-2097. Wang, X., Herberg, F. W., Laue, M. M., Wullner, C., Hu, B., Petrasch-Parwez, E., et al. (2000). Neurobeachin: A protein kinase A-anchoring, beige/Chediak-higashi protein homolog implicated in neuronal membrane traffic. J Neurosci, 20(23), 8551-8565. Wech, I., & Nagel, A. C. (2005). Mutations in rugose promote cell type-specific apoptosis in the Drosophila eye. Cell Death Differ, 12(2), 145-152. Wells, A. (1999). EGF receptor. Int J Biochem Cell Biol, 31(6), 637-643. Wikonkal, N. M., Remenyik, E., Knezevic, D., Zhang, W., Liu, M., Zhao, H., et al. (2003). Inactivating E2f1 reverts apoptosis resistance and cancer sensitivity in Trp53-deficient mice. Nat Cell Biol, 5(7), 655-660. Wu, C. L., Zukerberg, L. R., Ngwu, C., Harlow, E., & Lees, J. A. (1995). In vivo association of E2F and DP family proteins. Mol Cell Biol, 15(5), 2536-2546. Wu, L., Timmers, C., Maiti, B., Saavedra, H. I., Sang, L., Chong, G. T., et al. (2001). The E2F1-3 transcription factors are essential for cellular proliferation. Nature, 414(6862), 457-462. 88

PAGE 99

Yamasaki, L., Jacks, T., Bronson, R., Goillot, E., Harlow, E., & Dyson, N. J. (1996). Tumor induction and tissue atrophy in mice lacking E2F-1. Cell, 85(4), 537-548. Zaczek, A., Brandt, B., & Bielawski, K. P. (2005). The diverse signaling network of EGFR, HER2, HER3 and HER4 tyrosine kinase receptors and the consequences for therapeutic approaches. Histol Histopathol, 20(3), 1005-1015. Zhu, Y. Y., Machleder, E. M., Chenchik, A., Li, R., & Siebert, P. D. (2001). Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction. Biotechniques, 30(4), 892-897. 89

PAGE 100

About the Author Joshua John Gamsby received his Bachelors of Science degree from the University of Central Florida in Molecular and Microbiology in 2001. There he participated in an undergraduate research project and received an undergraduate fellowship. Joshua began the Ph.D. program at the University of South Florida in the Biochemistry and Molecular Biology program in 2001. While at USF, he has published a co-first author publication and his data at both the local and national levels.