USF Libraries
USF Digital Collections

The role and regulation of argininosuccinate synthase in endothelial function

MISSING IMAGE

Material Information

Title:
The role and regulation of argininosuccinate synthase in endothelial function
Physical Description:
Book
Language:
English
Creator:
Goodwin, Bonnie L
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Nitric oxide
Enos
Endothelial
Apoptosis
tnf-alpha
ppar-gamma
Dissertations, Academic -- Biochemistry and Molecular Biology -- Doctoral -- USF
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: While cellular levels of arginine greatly exceed the apparent Km for endothelial nitric oxide synthase (eNOS), nitric oxide (NO) production is limited by availability of arginine. Results from this work have provided a unique understanding of endothelial NO production, showing that arginine regeneration, that is the recycling of citrulline back to arginine by argininosuccinate synthase (AS) and argininosuccinate lyase (AL), defines the essential source of arginine for NO production. Using RNA interference analysis, selective reduction of AS expression was shown to directly correspond with a diminished capacity of endothelial cells to produce NO, despite saturating levels of arginine in the medium. In addition, the viability of AS siRNA-treated endothelial cells was compromised due to apoptotic cell death.AS expression was also investigated in response to two major vascular effectors. Tumor necrosis factor (TNF)-alpha; which is known to impair endothelial NO production, was shown to provoke a dose-dependent reduction of AS expression that corresponded to a decrease in NO production. Furthermore, TNF-alpha was shown to suppress AS expression through a NFkappaB mediated pathway, which involves three essential Sp1 elements in the proximal AS gene promoter. On the other hand, peroxisome proliferator-activated receptor gamma (PPARgamma) agonists, troglitazone and ciglitazone, which are known to elicit a vascular protective response against TNF-alpha effects, were shown to coordinately induce NO production and AS expression via a PPARgamma response element in the distal AS gene promoter. Importantly, these PPARgamma agonists were shown to restore AS expression and NO production following down-regulation by TNF-alpha, consistent with their vascular protective properties.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2005.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Bonnie L. Goodwin.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 254 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001912743
oclc - 174043608
usfldc doi - E14-SFE0001368
usfldc handle - e14.1368
System ID:
SFS0025688:00001


This item is only available as the following downloads:


Full Text

PAGE 1

The Role and Regulation of Argininosucci nate Synthase in Endothelial Function by Bonnie L. Goodwin A dissertation submitted in partial fulfillment of the requirement s for the degree of Doctor of Philosophy Department of Biochemist ry and Molecular Biology College of Medicine University of South Florida Major Professor: Duane C. Eichler, Ph.D. Larry P. Solomonson, Ph.D. Denise Cooper, Ph.D. Huntington Potter, Ph.D. Ken Wright, Ph.D. Date of Approval: November 7, 2005 Keywords: nitric oxide, enos, endothelia l, apoptosis, tnf-alpha, ppar-gamma Copyright 2005, Bonnie L. Goodwin

PAGE 2

ACKNOWLEDGEMENTS I would like to thank Dr. Duane Eichler fo r being the best mentor I could ask for. Your dedication and support provided a terri fic environment for me to grow and excel scientifically. In addition, Dr. Lar ry Solomonson was a second mentor to me. Your door was always open and you provided me with essential advice and direction. I am so grateful for the opportu nity to work in both your laboratories. Special thanks to my committee members as well. I really admired everyone on my committee for excelling in their respec tive fields. Each provided an essential component to my dissertation. Thanks to Dr. Denise Cooper, Dr Ken Wright and Dr. Hunt Potter for being there for me throughout my graduate studies. Then there are those who kept me sane and made science fun. Special thanks to Laura Pendleton for being there for me al l these years. Thank you for the many hours of conversation, science-related and not. Without your outstanding knowledge of all things cloni ng, real time, etc. I wouldn’t have made it as far as I did. You have been my friend, my conf idant and my traveling companion. I have also been fortunate to work with the most wonderful undergraduate students. Thank you to Christina Gomez, Tatiana Toumbeva and Monique Levy for

PAGE 3

keeping me laughing, keeping me young and keeping science fun. I also need to thank Rossitza Chichkova, M.D., Am iee Weiser, Audrey Shor and Samuel Falsetti for their friendship, c onversation and scientific input. I also have to mention my friends with the Greater Tampa Community Emergency Response Team. Without t he support and friendship of Michael Gonzalez, Ph.D., Jodi Pecoraro, Bette McCullough and Bri an Pisaneschi, I wouldn’t have been as successful in all my volunteer endeavors, while completing my doctoral studies. You gave me the confidence to speak in public and taught me to always be prepared. Thanks always to Mom and Jim, Dad and Grace, and Mandy for their unconditional love and support. Finally, but most importantly, I cannot express how much I owe Tom for his years of s upport, love and friendship. Thank you for allowing me to follow my dreams and achieve my goals. I couldn’t have done it without you.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES iii LIST OF FIGURES iv ABSTRACT vi INTRODUCTION 1 Nitric oxide 1 Endothelial NO 2 Sources of arginine 3 Argininosuccinate synthase 4 PPAR agonists affect the citrulline-NO cycle 4 TNFaffects the citrulline-NO cycle 7 Recovery of TNFsuppression of the citrulline-NO cycle by PPAR activators 8 The AS promoter 10 Specific aims 10 Paper I: Argininosuccinate synthase ex pression is required to maintain nitric oxide production and cell vi ability in aortic endothelial cells 30 Paper II: Tumor necrosis factorreduces substrate availability for nitric oxide production via down-regulation of argininosuccinate synthase 78 Paper III: PPAR agonists simulate the citrulline-NO cycle through coordinate up-regulation of ar gininosuccinate synthase and endothelial nitric oxide synthase 124

PAGE 5

ii DISCUSSION 168 APPENDIX A – Previous Publications 188 ABOUT THE AUTHOR END PAGE

PAGE 6

iii LIST OF TABLES Paper I: Table 1 Effect of AS siRNA transfect ion on endothelial NO Production 51 Table 2 Effect of AS siRNA transfection on AS Activity 52

PAGE 7

iv LIST OF FIGURES Paper I. Figure 1. Specific reduction of AS protein and mRNA by siRNA transfection 54 Figure 2. Loss of AS in BAEC di minishes cell viability 56 Figure 3. Effect of partial AS sile ncing on necrotic cell death measured by LDH release 58 Figure 4. Reduced Bcl-2 protein levels in partially AS depleted endothelial cells 60 Figure 5. Apoptosis induction in BAEC transfected with AS siRNA 62 Figure 6. Prevention of AS siRNA-induced apoptosis with an NO donor 64 Figure 7. Mechanism of NO suppression of apoptosis 66 Paper II. Figure 1. Specific reduction of AS protein and mRNA by TNF100 Figure 2. TNFreduces endothelial NO production 102 Figure 3. TNFreduces AS proximal promoter activity 104 Figure 4. Characterization of the AS promoter 106 Figure 5. TNFdown-regulates AS promoter activity via Sp1 site 3 108 Figure 6. TNFreduces binding to Sp1 sites 110 Figure 7. The NF B inhibitor BAY-7082 blocks the effect of TNFon AS expression and promoter activity 112 Figure 8. The Citrulline-NO Cycle 114

PAGE 8

v Paper III. Figure 1. PPARagonists stimulate endothelial NO production 144 Figure 2. Troglitazone and ciglitazone stimulate AS pr otein expression 146 Figure 3. Troglitazone and ciglitazone induce transcription of AS mRNA 148 Figure 4. PPAR agonists induce a distal elem ent in the AS promoter 150 Figure 5. PPAR agonists increase binding to the AS PPRE 152 Figure 6. Troglitazone and ciglit azone block the effect of TNFon AS expression 154 Figure 7. Troglitazone inhibits TNF-mediated suppression of NO production 156

PAGE 9

vi The Role and Regulation of Argininosucci nate Synthase in Endothelial Function Bonnie L. Goodwin ABSTRACT While cellular levels of argini ne greatly exceed the apparent Km for endothelial nitric oxide synthase (eNOS), nitric oxide (NO) production is limited by availability of arginine. Results from this work have provided a unique understanding of endothelial NO production, s howing that arginine r egeneration, that is the recycling of citrulline back to arginine by argininosuccinate synthase (AS) and argininosuccinate lyase (AL), defines t he essential source of arginine for NO production. Using RNA interference anal ysis, selective reduction of AS expression was shown to directly co rrespond with a diminished capacity of endothelial cells to produce NO, despite sa turating levels of arginine in the medium. In addition, the viability of AS siRNA-treated end othelial cells was compromised due to apoptotic cell death. AS expression was also investigated in re sponse to two major vascular effectors. Tumor necrosis factor (TNF)which is known to impair endothelial NO production, was shown to provoke a dos e-dependent reduction of AS expression that corresponded to a decrease in NO production. Furthermore, TNFwas shown to suppress AS expression through a NF B mediated pathway, which

PAGE 10

vii involves three essential Sp1 elements in the proximal AS gene promoter. On the other hand, peroxisome pr oliferator-activated receptor gamma (PPAR ) agonists, troglitazone and ciglitazone, which are k nown to elicit a vascular protective response against TNFeffects, were shown to coordinately induce NO production and AS expression via a PPAR response element in the distal AS gene promoter. Impor tantly, these PPAR agonists were shown to restore AS expression and NO production fo llowing down-regu lation by TNF, consistent with their vascular protective properties.

PAGE 11

1 INTRODUCTION Nitric oxide Nitric oxide (NO) is an im portant modulator for a wide range of functions including vascular regulation, immune f unction, angiogenesis, neurotransmission, gene regulation and apoptosis (1-3 ). Moreover, NO has a dual role in cell viability depending on the tissue type and concentration. Either very high or very low concentrations of NO may induce cell de ath, while basal concentrations may inhibit apoptosis (4-7). Pr evious work has shown that NO protects against serumstarvation(8), H 2 O 2 (9), TNF(10) and oxidized low-density lipoproteininduced apoptosis (11, 12) in endothelial cells. NO is synthesized by three NO syn thase (NOS) isoforms; neuronal NOS (nNOS), endothelial NOS (eNOS) and inducible NOS (iNOS). nNOS has been localized to the brain, cardiac and skele tal muscle, epithelia l cells, pancreatic islets and kidney macula densa cells. iNOS expression has been detected in macrophages, vascular smooth muscle, hepatocytes, endothelial cells and mesangial cells. eNOS is expressed in the endothelium as well as in skeletal and cardiac muscles and kidney tubules. iNOS activation is transcriptionally regulated by cytokines and endotoxins while bot h eNOS and nNOS are classically

PAGE 12

2 considered to be Ca 2+ dependent. Endothelial NO production by eNOS is regulated by the associati on of required cofactors, phosphorylation of the enzyme, protein:protein interactions cellular localizat ion and substrate availability (13). Endothelial NO eNOS-derived NO is an important regul ator of vascular function and blood pressure. NO is produced in the endothelium in response to signaling by circulating effectors such as bradykini n. It then diffuses into the smooth muscle layer and induces relaxation of the vessel wall. Endothelial dysfunction often precedes a diagnosis of atherosclerosis and is defined by an impaired release of NO by the endothelium (14). E ndothelial NO is a potent vas odilator (15) that also maintains endothelial function by inhibiting platelet aggregation (16), modulating leukocyte adhesion to blood vessels (17) and protecti ng against apoptosis (18). Decreased NO production in the endothelium can signifi cantly interfere in the regulation of vascular tone and result in vascular abnormalities such as smooth muscle cell proliferat ion, leukocyte adhesion to t he vascular wall and increased vascular permeability. In fact, loss of endothelium-derived NO is associated with the prothrombotic and hy perproliferative states present in hypertensive, diabetic and atherosclerotic states.

PAGE 13

3 Sources of arginine Arginine is a precursor for urea, polyamine creatine, ornithin e, NO and protein synthesis (19). Arginine synthesized during the urea cycle in the liver is rapidly utilized by arginase in the production of urea and ornith ine. Arginine in the blood circulation comes from the kidney, where it is produced from the conversion of citrulline. Transport of arginine and other cationic amino acids into cells occurs via the CAT family of trans porters (20). Although the intracellular concentration of arginine, which has been estima ted to be betw een 100 and 800 mol/l (21), greatly exceeds the apparent K m for eNOS (5 mol/l), NO production is limited by availability of arginine (22-29). Th is phenomenon, known as the arginine paradox suggests that there is an intracellular pool of arginine specifically directed to NO production. Thus, the source of argini ne required to sustain NO production in endothelial cells has been in vestigated and debated. Part of this debate seemed to be resolved when the CAT1 transporter the major transporter for arginine for endothelial cells, was co-l ocalized with eNOS in caveolae (30). Nevertheless, other evi dence persisted, demonstrati ng that endothelial NO production was limited by the capacity to regenerate arginine from citrulline (2228, 31). Recently, DNA microarray anal ysis of shear stress-induced NO production demonstrated that up-regulation of AS wa s coordinated with an increase in NO production (32), supporting an important role for AS in endothelial NO production.

PAGE 14

4 Argininosuccinate synthase Argininosuccinate synthase ( AS) was first cloned from human carcinoma cells in 1981 (33). A rare genetic disorder, known as citrullinemia, occurs when AS is deficient in humans (34). AS is a 45 kD a protein that forms a homotetramer composed of identical 412 amino acid subunits. The sequence is highly conserved between human ( 35), bovine (36), rat (37) and mouse (38). AS, the rate-limiting step (23) in the regeneration of arginine fr om citrulline, catalyzes the conversion of citrulline, ATP and aspar tate to arginino succinate, AMP and inorganic pyrophosphate. Argininosuccinat e is then cleaved by argininosuccinate lyase (AL) to produce L-arginine and fumara te. In liver, where AS expression is high, AS and AL function toget her as components of the urea cycle, ultimately to form arginine from citrulline. These enzym es are also expressed in proximal tubules of the kidney and in the testis as well as at lower levels in most mammalian tissues. It was the discovery of arginine-derived NO, catalyzed by nitric oxide synthases (NOSs), that revealed a second role for AS and AL (1-3). Together with NOS, they function as par t of a citrulline-NO cycle, where AS and AL convert citrulline to arginine, which is then oxidized to form NO and citrulline by NOS. PPAR agonists affect the citrulline-NO cycle Peroxisome proliferator-a ctivated receptor (PPAR) is a member of the nuclear receptor superfamily of ligand-activated transcription factors involved in the transcription of genes implicat ed in lipid metabolism ( 39-42), differentiation (39,

PAGE 15

5 42) and cell growth (43). PPAR is required for adipose, kidney and placental development and knockout results in embryonic lethality (44). PPAR can be activated by a number of naturally occu rring fatty acid metabolites including oxidized linoleic acid (9 and 13-HODE) and 15-deoxy12,14 prostaglandin J 2 (15d-PGJ 2 ) (45-47). Thiazolidinediones (TZDs) are synthetic PPAR agonists developed as antidiabetic agents that enhance insulin-stimulated glucose uptake, lower blood glucose, triglyceride levels and blood pressure in insulin-resistant humans and animals (48). TZDs are believed to induce insulin sensitization by altering gene expression via st imulation of PPAR However, in several si tuations, such as in skeletal muscle, TZDs have also been shown to act through PPAR -independent effects (49). For example, PPAR can indirectly repress transcription by binding the transcription factor Sp1 in smooth muscl e cells and inhibiti ng binding of Sp1 to the thromboxane A2 gene promoter (50). Also, PPAR -independent regulation of the vascular endothelial growth fa ctor receptor 2 (KDR) by 15d-PGJ 2 and pioglitazone are mediated vi a interaction with both Sp1 and Sp3 (51). In addition, PPAR -independent effects have been shown to be mediated by 15d-PGJ 2 in endothelial cells, through the down -regulation of Sp1 (52). Cardiovascular benefits of TZDs have been described to include improved flowmediated vasodilation and decrease vascula r smooth muscle cell activation (53).

PAGE 16

6 Additional cardioprotective properties described include the reduction of blood pressure in mammalian models (54-56) and diabetic patients (57). In addition, TZDs reduce lesion formation in animal mo dels of atherosclerosis (58-61). This occurs, in part, by stimulating NO production by vascular endothelial cells in a process that does not induce eNOS protein expression ( 62, 63). Troglitazone is a TZD that was used as an anti-diabetic co mpound prior to being removed from the market due to liver toxicity. Troglitazone increases NO production in aortic endothelial cells through two independent signaling pathways that have been proposed for the increase in NO production by PPAR ligands (62). The first is PPAR -dependent phosphorylat ion of eNOS at Ser1179. The second pathway is described as a PPAR -independent dephosphorylation of eNOS-Ser116 (64). A recent report provides additi onal evidence regarding an additional mode by which PPAR agonists augment endothe lial NO production (65). This was found to occur via reduction in superoxide thr ough the suppression of NADPH oxidase and induction of superoxide di smutase, resulting in an enhanced bioavailability of endothelial NO (65). An additio nal mechanism by which PPAR agonists could increase endothelial NO produc tion is through the up-regul ation of AS expression and thus an increase in the regeneration of arginine by AS and AL. Since it has been shown in many disease st ates that arginine availability for NO production becomes limiting, the following study examines whether PPAR agonists may promote arginine rege neration and relieve, in part, impairment of NO production. In addition, these anti-diabetic compounds are also known to counter the effects

PAGE 17

7 of the inflammatory response related to elevated serum levels of tumor necrosis factor alpha (TNF), which contribute to endothel ial dysfunction (66, 67). TNFaffects the citrulline-NO cycle TNFis a multifunctional cytokine involved in the regulation of important physiological functions including the dev elopment of tissues, the coordinate activation of immune responses, and in t he onset and progressi on of pathological conditions (68, 69). Treatment of endothelial cells with TNFreduces eNOS mRNA expression (70) and pre-treatment before s hear stress or insulin stimulation profoundly decreases NO synt hesis (71). This pro-inflammatory cytokine has been implicated in the path ogenesis of cardiovascular diseases such as congestive heart failure, acute my ocardial infarction, myocarditis and dilated cardiomyopathy (72, 73). Serum TNFlevels are elevated in patients with congestive heart failure and TNF recept ors have been identifi ed in the failing human heart (74, 75). TNFhas been linked to insulin resistance (76) by directly inhibiting insulin signa ling (77-80) and is known to contribute to endothelial dysfunction in type 2 diabetes (81), obes ity (82) and heart failure (83, 84). Clinical studies have also shown that elevated levels of plasma TNFin patients with type I diabetes were associated wit h cardiological risk factors (85). Monocyte binding to the endothelium, a factor in the development of atherogenesis, is induced by TNF -dependent decreases in NO synthesis (86).

PAGE 18

8 Transfection of eNOS is able to prevent the increase in monocyte binding by increasing NO production (86). Recovery of TNFsuppression of the ct rulline-NO cycle by PPAR activators Inflammatory cytokines such as TNFhave been linked to the insulin-resistant states associated with obesity and type II diabetes (reviewed in (87)). PPAR activation can inhibit a number of infl ammatory responses (88) and block inhibition of the insu lin pathway by TNF(89). There are several examples in the literatur e where PPAR agonists interrupt TNFsignaling outside of the insulin signaling pathw ay. For instance, PPAR activators can actually inhibit cardiac expression of TNFby targeting NF B activity (90). 15d-PGJ 2 inhibits NF B signaling in a PPAR -independent manner by modifying I B-Kinase and NF B subunits (91). In further support of the role of NF B in TZD signaling, troglitazone decreases NF B expression and DNA binding in human mononuclear cells, while increasing the NF B inhibitor I B expression (92). In brown adipocytes, rosiglitazone treatment impairs TNF-induced activation of p38 and p42/44 MAPK, restori ng insulin signaling and leading to normalization of glucose uptake (93). In addition, troglitazone inhibits TNF-induced plasminogen activator inhibitor type 1 (PAI-1) production through both ERKand NF B-dependent pathways (94). While migration of VSMCs toward TNF is MAPK dependent, TZDs can block migration, but cannot attenuate TNFinduced MAPK activation, indicating that the action of the troglitazone lies

PAGE 19

9 downstream of MAPK in this system (95). On the other hand, in adipocytes, troglitazone does not impair TNF-induced NF B activation, but rather antagonizes the transcriptional regulatory activity of NF B (96). In another system, troglitazone and ci glitazone can inhibit VEGF-induced AKT activation (phosphorylation) in endothelia l cells (97). All of these studies lead to the hypothesis that the PPAR agonists may prevent TNFinhibition of the citrulline-NO cycle at the level of NF B, through the MAP Kinase pathway or through AKT activation. Strategies for preventing TNFactivity include neutraliz ation of the cytokine via either anti-TNFantibodies, soluble receptors, or receptor fusion proteins; suppression of TNFsynthesis via drugs such as cyclosporine A, glucocorticoids, or IL-10; reduction of responsiveness to TNFvia repeated low dose stimulation; and lastly, by inhibition of secondary m ediators such as IL-1, IL6, or NO (98). Pharmaceutical companies such as Peptech Limited have developed different antibodies to TNF, some of which inhibit various TNFfunctions and others which do not affect pr otein activity. For instance, Remicade (TM) is a chimeric Igk monoclonal anti-TNFantibody manufactured by Centocor which has been used to treat Crohn's disease, which is a chronic inflammatory disease of the intestines (Contocor, 2000). Soluble TNF receptor will also neutralize TNFbefore it can bind to its target cell receptor. Another drug, Enbrel (TM), developed by Immunex Corporation, is a fusion of two soluble

PAGE 20

10 TNFreceptors and a human immunoglobulin (Immunex Corpor ation, Nov. 1999). It has been approved for tr eatment of rheumatoid ar thritis. Additionally, Chloroquine inhibits transcription of t he protein in macrophage (99). My research shows that TZDs can effectively reverse the effects of TNF on NO production, in part, due to the coordinate e ffects on eNOS and AS expression. The AS promoter Although AS is considered a ubiquitously express ed enzyme, a number of hormones, nutrients and cytokines are able to regulate AS expression (100). Since the critical role of AS in NO production becomes increasingly apparent, there has been a renewed interest in regul ation of its expression. However, the promoter region for this g ene still remains onl y partially characte rized (38, 101, 102). Three of six i dentified GC boxes have been shown to synergistically activate the promoter through Sp1-DNA bi nding. Recently, stimulation of Caco-2 cells with IL-1 was shown to activate expression of AS through NF B activation (103). Specific aims Our work and the work from other laboratories has developed a strong evidential case supporting the proposal that substr ate availability, governed by arginineregeneration as part of the citrulline-nitric oxide cyc le, plays a key role in NO production thus affecting vascular endothelium function and viability (18, 22, 23, 25). If AS is essential for endothelial NO production, then even in the presence of

PAGE 21

11 excess arginine, depletion of AS shoul d decrease the capacity of endothelial cells to produce NO. The first paper in th is dissertation tests this hypothesis using RNA interference analysis to knoc k down AS in bovine aortic endothelial cells (BAEC). The work demonstrates a significant and dose-dependent reduction of AS protein following siRNA tr ansfection. I also show a concomitant decrease in enzyme activity corresponding to a decrease in stimulated and unstimulated NO production in endothelial cells with reduced AS expression, in spite of excess arginine in t he media. In addition, I dem onstrate that the viability of endothelial cells grown in excess ar ginine and treated with AS siRNA was significantly diminished compared to control cells. Having defined the important role AS plays in both endot helial NO production and in endothelial cell viability, the next ai m of this dissertation investigates the regulation of the enzyme by two major effectors of vascular function. The second paper confirms the import ant elements of the AS pr omoter and further demonstrates that TNF, which represses NO production in endothelial cells, does so not only by down-regulating eNOS expression, but also by suppressing the availability of arginine. Evidence is provided that the mechanism by which TNFtranscriptionally represses eNOS ex pression is mimicked in the downregulation of AS expression through similar transcription factors. Since it has been shown in many disease stat es that arginine availability for NO production becomes limiting, I examined in the third paper the role that PPAR

PAGE 22

12 agonists may have in promoting arginine r egeneration and relieving, in part, impairment of NO producti on. The transcriptional regu lation is investigated and includes the identif ication of a PPAR -response element (PPR E). In addition, the use of TZDs to improve vascular function via the reversal of TNFeffects is also implicated.

PAGE 23

13 REFERENCES 1. Bredt, D. S., and Snyder, S. H. (1994) Nitric oxide: a physiologic messenger molecule. Annu Rev Biochem 63, 175-195 2. Vallance, P., and Chan, N. (2001) Endothelial function and nitric oxide: clinical relevance. Heart 85, 342-350 3. Gow, A. J., and Ischiropoulos, H. ( 2001) Nitric oxide chemistry and cellular signaling. J Cell Physiol 187, 277-282 4. Melino, G., Catani, M. V ., Corazzari, M., Guerrieri, P., and Bernassola, F. (2000) Nitric oxide can inhibit apoptosis or switch it into necrosis. Cell Mol Life Sci 57, 612-622 5. Dimmeler, S., and Zeiher, A. M. (1997) Nitric oxide and apoptosis: another paradigm for the double-edged ro le of nitric oxide. Nitric Oxide 1, 275-281 6. Haendeler, J., Zeiher, A. M., and Dimmeler, S. (1999) Nitric oxide and apoptosis. Vitamins & Hormones 57, 49-77 7. Shen, Y. H., Wang, X. L., and Wilck en, D. E. (1998) Nitric oxide induces and inhibits apoptosis through different pathways. FEBS Letters 433, 125131

PAGE 24

14 8. Kwon, Y. G., Min, J. K., Kim, K. M., Lee, D. J., Billia r, T. R., and Kim, Y. M. (2001) Sphingosine 1-phosphate prot ects human umbilical vein endothelial cells from seru m-deprived apoptosis by nitric oxide production. J Biol Chem 276, 10627-10633 9. Hermann, C., Zeiher, A. M., and Dimmele r, S. (1997) Shear stress inhibits H 2 O 2 -induced apoptosis of human endothelial cells by modulation of the glutathione redox cycle and nitric oxide synthase. Arterioscler Thromb Vasc Biol 17, 3588-3592 10. Estrada, C., Gomez, C., Martin, C ., Moncada, S., and Gonzalez, C. (1992) Nitric oxide mediates tumor necrosis factor-alpha cytotoxicity in endothelial cells. Biochem Biophys Res Commun 186, 475-482 11. Kotamraju, S., Hogg, N ., Joseph, J., Keefer, L. K., and Kalyanaraman, B. (2001) Inhibition of oxidized low-dens ity lipoprotein-induced apoptosis in endothelial cells by nitric oxide. Peroxyl radical scavenging as an antiapoptotic mechanism. J Biol Chem 276, 17316-17323 12. Dimmeler, S., Hermann, C., Ga lle, J., and Zeiher, A. M. (1999) Upregulation of superoxi de dismutase and nitric ox ide synthase mediates the apoptosis-suppressive effects of shear stress on endothelial cells. Arteriosclerosis, Thrombosis & Vascular Biology 19, 656-664 13. Govers, R., and Rabelink, T. J. (2001) Cellular regul ation of endothelial nitric oxide synthase. Am J Physiol Renal Physiol 280, F193-206

PAGE 25

15 14. Harrison, D. G. (1989) From isolated vessels to the catheterization laboratory. Studies of endothelial function in the coronary circulation of humans. Circulation 80, 703-706 15. Palmer, R. M., Ferrige, A. G., and Moncada, S. ( 1987) Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature 327, 524-526 16. Garg, U. C., and Hassid, A. (1989) Nitric oxide-generating vasodilators and 8-bromo-cyclic guanos ine monophosphate inhibit mitogenesis and proliferation of cultured ra t vascular smooth muscle cells. J Clin Invest 83, 1774-1777 17. Kubes, P., Suzuki, M., and Granger, D. N. (1991) Nitric oxide: an endogenous modulator of leukocyte adhesion. Proc Natl Acad Sci U S A 88, 4651-4655 18. Goodwin, B. L., Solomonson, L. P., and Eichler, D. C. (2004) Argininosuccinate synthase expression is required to maintain nitric oxide production and cell viability in aortic endothelial cells. J Biol Chem 279, 18353-18360 19. Wu, G., and Morris, S. M., Jr. (1998) Arginine metabolism: nitric oxide and beyond. Biochem J 336 ( Pt 1), 1-17 20. Deves, R., and Boyd, C. A. (1998) Tr ansporters for cationic amino acids in animal cells: discovery, structure, and function. Physiol Rev 78, 487-545 21. Harrison, D. G. (1997) Cellular and molecular mechanisms of endothelial cell dysfunction. J Clin Invest 100, 2153-2157

PAGE 26

16 22. Xie, L., Hattori, Y., Tume, N., and Gross, S. S. ( 2000) The preferred source of arginine for high-output nitric oxide synthesis in blood vessels. Semin Perinatol 24, 42-45 23. Xie, L., and Gross, S. S. (1997) Argininosuccinate synthetase overexpression in vascular sm ooth muscle cells potentiates immunostimulant-induced NO production. J Biol Chem 272, 16624-16630 24. Sessa, W. C., Hecker, M., Mitchell, J. A., and Vane, J. R. (1990) The metabolism of L-arginine and its significance for the biosynthesis of endothelium-derived rela xing factor: L-glutamine inhibits the generation of L-arginine by cultured endothelial cells. Proc Natl Acad Sci USA 87, 86078611 25. Hattori, Y., Campbell, E. B., and Gr oss, S. S. (1994) Argininosuccinate synthetase mRNA and activity ar e induced by immunostimulants in vascular smooth muscle. Role in the regeneration or arginine for nitric oxide synthesis. J Biol Chem 269, 9405-9408 26. Su, Y., and Block, E. R. (1995) Hypoxia in hibits L-arginine synthesis from L-citrulline in porcine pulmonary artery endothelial cells. Am J Physiol 269, L581-587 27. Flam, B. R., Hartmann, P. J., Harr ell-Booth, M., Solo monson, L. P., and Eichler, D. C. (2001) Caveolar localization of ar ginine regeneration enzymes, argininosuccinate synthase, and lyase, with endothelial nitric oxide synthase. Nitric Oxide 5, 187-197

PAGE 27

17 28. Shuttleworth, C. W., Burns, A. J. Ward, S. M., O'Br ien, W. E., and Sanders, K. M. (1995) Re cycling of L-citrulline to sustain nitric oxidedependent enteric neurotransmission. Neuroscience 68, 1295-1304 29. Solomonson, L. P., Flam, B. R., Pendleton, L. C., Goodwin, B. L., and Eichler, D. C. (2003) The caveolar nitric oxide synthase/arginine regeneration system for NO production in endothelial cells. Journal of Experimental Biology 206, 2083-2087 30. McDonald, K. K., Zharikov, S., Block, E. R., and Kilberg, M. S. (1997) A caveolar complex between the cati onic amino acid transporter 1 and endothelial nitric-oxide synthase may explain the "arginine paradox". J Biol Chem 272, 31213-31216 31. Nussler, A. K., Billiar, T. R., Liu, Z. Z., and Morris, S. M., Jr. (1994) Coinduction of nitric oxide synthase and argininosuccinate synthetase in a murine macrophage cell line. Implications for regulation of nitric oxide production. Journal of Biological Chemistry 269, 1257-1261 32. McCormick, S. M., Eskin, S. G., McIn tire, L. V., Teng, C. L., Lu, C. M., Russell, C. G., and Chittur, K. K. (2001) DNA microarray reveals changes in gene expression of shear stressed human umbilical vein endothelial cells. Proc Natl Acad Sci USA 98, 8955-8960 33. Su, T. S., Bock, H. G., O'Brien, W. E., and B eaudet, A. L. (1981) Cloning of cDNA for argininosuccinate synthetase mRNA and study of enzyme overproduction in a human cell line. J Biol Chem 256, 11826-11831

PAGE 28

18 34. Beaudet, A. L., O'Brien, W. E., Bock, H. G., Freytag, S. O., and Su, T. S. (1986) The human argininosuccinate synthetase locus and citrullinemia. Adv Hum Genet 15, 161-196, 291-162 35. Bock, H. G., Su, T. S., O'Bri en, W. E., and Beaudet, A. L. (1983) Sequence for human argininosuccinate synthetase cDNA. Nucleic Acids Res 11, 6505-6512 36. Dennis, J. A., Healy, P. J., Beaudet, A. L., and O'Brien, W. E. (1989) Molecular definition of bovine argini nosuccinate synthetase deficiency. Proc Natl Acad Sci U S A 86, 7947-7951 37. Surh, L. C., Morris, S. M., O'Br ien, W. E., and Be audet, A. L. (1988) Nucleotide sequence of the cDNA encoding the rat argininosuccinate synthetase. Nucleic Acids Res 16, 9352 38. Surh, L. C., Beaudet, A. L., and O'Brien, W. E. (1991) Molecular characterization of the murine argi ninosuccinate synthetase locus. Gene 99, 181-189 39. Kliewer, S. A., Sundseth, S. S., J ones, S. A., Brown, P. J., Wisely, G. B., Koble, C. S., Devchand, P., Wahli, W ., Willson, T. M., Lenhard, J. M., and Lehmann, J. M. (1997) Fatty acids and eicosanoids regulate gene expression through direct interacti ons with peroxisome proliferatoractivated receptors alpha and gamma. Proc Natl Acad Sci U S A 94, 4318-4323

PAGE 29

19 40. Schoonjans, K., Peina do-Onsurbe, J., Lefebvre, A. M., Heyman, R. A., Briggs, M., Deeb, S., Staels, B., and Auwerx, J. (1996) PPARalpha and PPARgamma activators direct a dist inct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. Embo J 15, 53365348 41. Braissant, O., Foufelle, F., Scotto C., Dauca, M., and Wahli, W. (1996) Differential expression of peroxisom e proliferator-activated receptors (PPARs): tissue distribution of PPAR-a lpha, -beta, and -gamma in the adult rat. Endocrinology 137, 354-366 42. Brun, R. P., Tontonoz, P., Forman, B. M., Ellis, R., Chen, J., Evans, R. M., and Spiegelman, B. M. ( 1996) Differential activa tion of adipogenesis by multiple PPAR isoforms. Genes Dev 10, 974-984 43. Rosen, E. D., and Spiegelman, B. M. (2001) PPARgamma : a nuclear regulator of metabolism, di fferentiation, and cell growth. J Biol Chem 276, 37731-37734 44. Barak, Y., Nelson, M. C., Ong, E. S., Jones, Y. Z., Ruiz-Lozano, P., Chien, K. R., Koder, A., and Evans, R. M. (1999) PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell 4, 585-595 45. Kliewer, S. A., Lenhard, J. M., Willson, T. M., Patel, I. Morris, D. C., and Lehmann, J. M. (1995) A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma and promotes adipocyte differentiation. Cell 83, 813-819

PAGE 30

20 46. Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M. (1995) 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell 83, 803812 47. Kliewer, S. A., Forman, B. M., Blum berg, B., Ong, E. S., Borgmeyer, U., Mangelsdorf, D. J., Umesono, K., and Evans, R. M. (1994) Differential expression and activation of a family of murine peroxisome proliferatoractivated receptors. Proc Natl Acad Sci U S A 91, 7355-7359 48. Saltiel, A. R., and Olefsky, J. M. (1996) Thiazolidinediones in the treatment of insulin resistance and type II diabetes. Diabetes 45, 16611669 49. Brunmair, B., Gras, F., Neschen, S., Roden, M., Wagner, L., Waldhausl, W., and Furnsinn, C. (2001) Direct thia zolidinedione action on isolated rat skeletal muscle fuel handling is in dependent of peroxisom e proliferatoractivated receptor-gamma-mediated changes in gene expression. Diabetes 50, 2309-2315 50. Sugawara, A., Uruno, A ., Kudo, M., Ikeda, Y., Sato K., Taniyama, Y., Ito, S., and Takeuchi, K. (2002) Transcr iption suppression of thromboxane receptor gene by peroxisom e proliferator-activated receptor-gamma via an interaction with Sp1 in vascular smooth muscle cells. J Biol Chem 277, 9676-9683

PAGE 31

21 51. Sassa, Y., Hata, Y., Aiello, L. P., Taniguchi, Y., Kohno, K., and Ishibashi, T. (2004) Bifunctional properties of peroxisome proliferator-activated receptor gamma1 in KDR gene regulation mediated via interaction with both Sp1 and Sp3. Diabetes 53, 1222-1229 52. Zhang, J., Fu, M., Zhao, L., and Chen, Y. E. (2002) 15-Deoxyprostaglandin J(2) inhibits PDGF-A and -B chain expression in human vascular endothelial cells independent of PPAR gamma. Biochem Biophys Res Commun 298, 128-132 53. Fujishima, S., Ohya, Y., Nakamura, Y., Onaka, U., Abe, I., and Fujishima, M. (1998) Troglitazon e, an insulin sensitizer, increases forearm blood flow in humans. Am J Hypertens 11, 1134-1137 54. Majithiya, J. B., Paramar, A. N., a nd Balaraman, R. (2005) Pioglitazone, a PPARgamma agonist, restores endot helial function in aorta of streptozotocin-induced diabetic rats. Cardiovasc Res 66, 150-161 55. Kosegawa, I., Chen, S., Awata, T., Negishi, K., and Katayama, S. (1999) Troglitazone and metformin, but not glibenclamide, decrease blood pressure in Otsuka Long Evans Tokushima Fatty rats. Clin Exp Hypertens 21, 199-211 56. Saku, K., Zhang, B., Ohta, T., and Arak awa, K. (1997) Troglitazone lowers blood pressure and enhances insulin s ensitivity in Watanabe heritable hyperlipidemic rabbits. Am J Hypertens 10, 1027-1033

PAGE 32

22 57. Ogihara, T., Rakugi, H., Ikegami, H., Mikami, H., and Masuo, K. (1995) Enhancement of insulin sensitivity by troglitazone lowers blood pressure in diabetic hypertensives. Am J Hypertens 8, 316-320 58. Olefsky, J. M. (2000) Treatment of insulin resistance with peroxisome proliferator-activated receptor gamma agonists. J Clin Invest 106, 467-472 59. Shinohara, E., Kihara, S., Ouch i, N., Funahashi, T., Nakamura, T., Yamashita, S., Kameda-Takemura, K., and Matsuzawa, Y. (1998) Troglitazone suppresses intimal fo rmation following balloon injury in insulin-resistant Zucker fatty rats. Atherosclerosis 136, 275-279 60. Chen, C. C., Wang, H. J., Shih, H. C., Sheen, L. Y., Chang, C. T., Chen, R. H., and Wang, T. Y. (2001) Compar ison of the metabolic effects of metformin and troglitazone on fructose-induced insulin resistance in male Sprague-Dawley rats. J Formos Med Assoc 100, 176-180 61. Collins, A. R., Meehan, W. P., Ki ntscher, U., Jackson, S., Wakino, S., Noh, G., Palinski, W., Hsueh, W. A ., and Law, R. E. (2001) Troglitazone inhibits formation of early athero sclerotic lesions in diabetic and nondiabetic low density lipoprotein receptor-deficient mice. Arterioscler Thromb Vasc Biol 21, 365-371

PAGE 33

23 62. Cho, D. H., Choi, Y. J., Jo, S. A., and Jo, I. (2004) Nitric oxide production and regulation of endothelial nitric -oxide synthase phosphorylation by prolonged treatment with troglitazone: evidence for involvement of peroxisome proliferator-activated receptor (PPAR) gamma-dependent and PPARgamma-independent si gnaling pathways. J Biol Chem 279, 24992506 63. Calnek, D. S., Mazzella, L., Roser, S., Roman, J., and Ha rt, C. M. (2003) Peroxisome proliferator-activated receptor gamma ligands increase release of nitric oxide from endothelial cells. Arterioscler Thromb Vasc Biol 23, 52-57 64. Cho, D.-H., Choi, Y. J., Jo, S. A., and Jo, I. (2003) Nitric oxide production and regulation of endothelial nitric oxide synthase phosphorylation by prolonged treatment with troglitazone: Evidence for involvement of PPARgamma-dependent and PPARgamma-independent signaling pathways. J. Biol. Chem. M309451200 65. Hwang, J., Kleinhenz, D. J., Lassegue, B., Griendli ng, K. K., Dikalov, S., and Hart, C. M. (2005) Peroxisome proliferator-activated receptor-gamma ligands regulate endothelial memb rane superoxide production. Am J Physiol Cell Physiol 288, C899-905 66. Ruan, H., Zarnowski, M. J., Cushm an, S. W., and Lodish, H. F. (2003) Standard isolation of primary adipose cells from mouse epididymal fat pads induces inflammatory mediators and down-regulates adipocyte genes. J Biol Chem 278, 47585-47593

PAGE 34

24 67. Kurebayashi, S., Xu, X., Ishii, S., Shiraishi, M., Kouhara, H., and Kasayama, S. (2005) A novel thiazo lidinedione MCC-5 55 down-regulates tumor necrosis factor-alpha-induced expression of vascular cell adhesion molecule-1 in vascular endothelial cells. Atherosclerosis 182, 71-77 68. MacEwan, D. J. (2002) TNF recept or subtype signalling: Differences and cellular consequences. Cell Signal 14, 477-492 69. MacEwan, D. J. (2002) TNF ligands and receptors a matter of life and death. Br J Pharmacol 135, 855-875 70. Alonso, J., Sanchez de Miguel, L ., Monton, M., Cas ado, S., and LopezFarre, A. (1997) Endothelial cytosolic pr oteins bind to the 3' untranslated region of endothelial nitric oxide syn thase mRNA: regulation by tumor necrosis factor alpha. Mol Cell Biol 17, 5719-5726 71. Kim, F., Gallis, B., and Corson, M. A. (2001) TNF-alpha inhibits flow and insulin signaling leading to NO production in aortic endothelial cells. Am J Physiol Cell Physiol 280, C1057-1065 72. Neumann, F. J., Ott, I., Gawaz, M., Richardt, G., Holz apfel, H., Jochum, M., and Schomig, A. (1995) Cardiac rel ease of cytokines and inflammatory responses in acute myocardial infarction. Circulation 92, 748-755 73. Matsumori, A., Yamada, T., Suzu ki, H., Matoba, Y ., and Sasayama, S. (1994) Increased circulating cytokines in patients with myocarditis and cardiomyopathy. Br Heart J 72, 561-566

PAGE 35

25 74. Levine, B., Kalman, J., Mayer, L., Fillit, H. M., and Packer, M. (1990) Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med 323, 236-241 75. Torre-Amione, G., Kapadia, S., Lee, J., Durand, J. B., Bies, R. D., Young, J. B., and Mann, D. L. (1996) Tumor necrosis factor-alpha and tumor necrosis factor receptors in the failing human heart. Circulation 93, 704711 76. Hotamisligil, G. S. (1999) Mec hanisms of TNF-alpha-induced insulin resistance. Exp Clin Endocrinol Diabetes 107, 119-125 77. Feinstein, R., Kanety, H., Papa, M. Z., Lunenfeld, B., and Karasik, A. (1993) Tumor necrosis factor-alpha suppresses insulin-induced tyrosine phosphorylation of insulin re ceptor and its substrates. J Biol Chem 268, 26055-26058 78. Liu, L. S., Spellek en, M., Rohrig, K., Hauner, H., and Eckel, J. (1998) Tumor necrosis factor-alpha acutely in hibits insulin signaling in human adipocytes: implication of the p80 tumor necrosis factor receptor. Diabetes 47, 515-522 79. Hotamisligil, G. S., Budavari, A ., Murray, D., and Spiegelman, B. M. (1994) Reduced tyrosine kinase activity of the insulin receptor in obesitydiabetes. Central role of tumor necrosis factor-alpha. J Clin Invest 94, 1543-1549

PAGE 36

26 80. Hotamisligil, G. S., Murray, D. L. Choy, L. N., and Spiegelman, B. M. (1994) Tumor necrosis factor alpha i nhibits signaling from the insulin receptor. Proc Natl Acad Sci U S A 91, 4854-4858 81. Pfeiffer, A., Janott, J., Mohlig, M. Ristow, M., Rochlitz, H., Busch, K., Schatz, H., and Schifferdecker, E. ( 1997) Circulating tumor necrosis factor alpha is elevated in male but not in female patients with type II diabetes mellitus. Horm Metab Res 29, 111-114 82. Winkler, G., Lakatos, P., Salamon, F., Nagy, Z., Speer, G., Kovacs, M., Harmos, G., Dworak, O., and Cseh, K. (1999) Elevated serum TNF-alpha level as a link between endothelial dysfunction and insulin resistance in normotensive obese patients. Diabet Med 16, 207-211 83. Fichtlscherer, S., Rossig, L., Br euer, S., Vasa, M., Dimmeler, S., and Zeiher, A. M. (2001) Tumor necrosi s factor antagonism with etanercept improves systemic endothelial vasoreactivity in patients with advanced heart failure. Circulation 104, 3023-3025 84. Agnoletti, L., Curello, S ., Bachetti, T., Malacarne, F., Gaia, G., Comini, L., Volterrani, M., Bonetti, P., Parrinello, G., Cadei, M., Grigolato, P. G., and Ferrari, R. (1999) Serum from pat ients with severe heart failure downregulates eNOS and is proapoptotic: role of tumor necrosis factoralpha. Circulation 100, 1983-1991 85. Lechleitner, M., Koch, T., Hero ld, M., and Hoppichler, F. (1999) Relationship of tumor necrosis factor-alpha plasma levels to metabolic control in type 1 diabetes. Diabetes Care 22, 1749

PAGE 37

27 86. Niebauer, J., Dulak, J., Chan, J. R ., Tsao, P. S., and Cooke, J. P. (1999) Gene transfer of nitric oxide synth ase: effects on endothelial biology. J Am Coll Cardiol 34, 1201-1207 87. Dandona, P., Aljada, A., and Bandyopad hyay, A. (2004) Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol 25, 4-7 88. Daynes, R. A., and Jones, D. C. (2002) Emerging roles of PPARs in inflammation and immunity. Nat Rev Immunol 2, 748-759 89. Peraldi, P., Xu, M., and Spiegelm an, B. M. (1997) Thiazolidinediones block tumor necrosis factor-alpha-induc ed inhibition of in sulin signaling. J Clin Invest 100, 1863-1869 90. Takano, H., Nagai, T., Asakawa, M. Toyozaki, T., Oka, T., Komuro, I., Saito, T., and Masuda, Y. (2000) Peroxisome proliferator-activated receptor activators inhibit lipopolysaccharide-induced tumor necrosis factor-alpha expression in neonatal rat cardiac myocytes. Circ Res 87, 596-602 91. Straus, D. S., Pascual, G., Li, M., Welch, J. S., Ricote, M., Hsiang, C. H., Sengchanthalangsy, L. L., Ghosh, G. and Glass, C. K. (2000) 15-deoxydelta 12,14-prostaglandin J2 inhibits multiple steps in the NF-kappa B signaling pathway. Proc Natl Acad Sci U S A 97, 4844-4849

PAGE 38

28 92. Ghanim, H., Garg, R., Aljada, A., Mohanty, P., Ku mbkarni, Y., Assian, E., Hamouda, W., and Dandona, P. (2001) Suppression of nuclear factorkappaB and stimulation of inhibitor kappaB by troglitazone: evidence for an anti-inflammatory effect and a potential antiatheroscl erotic effect in the obese. J Clin Endocrinol Metab 86, 1306-1312 93. Hernandez, R., Teruel, T., de Al varo, C., and Lorenzo, M. (2004) Rosiglitazone ameliorates insulin resist ance in brown adipocytes of Wistar rats by impairing TNF-alpha induction of p38 and p42/p44 mitogenactivated protein kinases. Diabetologia 47, 1615-1624 94. Hamaguchi, E., Takamura, T., Shimiz u, A., and Nagai, Y. (2003) Tumor necrosis factor-alpha and troglitazone regulate plasminogen activator inhibitor type 1 production through ex tracellular signal-regulated kinaseand nuclear factor-kappaB-depen dent pathways in cultured human umbilical vein endothelial cells. J Pharmacol Exp Ther 307, 987-994 95. Goetze, S., Xi, X. P., Kawano, Y., Kawano, H., Fleck, E., Hsueh, W. A., and Law, R. E. (1999) TNF-alpha-induced migrat ion of vascular smooth muscle cells is MAPK dependent. Hypertension 33, 183-189 96. Ruan, H., Pownall, H. J., and Lodish, H. F. ( 2003) Troglitazone antagonizes tumor necrosis factor-alpha-induced reprogramming of adipocyte gene expression by inhibiting the transcriptional regulatory functions of NF-kappaB. J Biol Chem 278, 28181-28192

PAGE 39

29 97. Goetze, S., Eilers, F., Bungensto ck, A., Kintscher, U., Stawowy, P., Blaschke, F., Graf, K., Law R. E., Fleck, E., and Grafe, M. (2002) PPAR activators inhibit endothelial cell migration by targeting Akt. Biochem Biophys Res Commun 293, 1431-1437 98. Tracey, K. J., and Cerami, A. (1994) Tumor necrosis factor: a pleiotropic cytokine and therapeutic target. Annu Rev Med 45, 491-503 99. Zhu, X., Ertel, W., Ayala, A., Morr ison, M. H., Perrin, M. M., and Chaudry, I. H. (1993) Chloroquine inhibits macrophage tumour necrosis factor-alpha mRNA transcription. Immunology 80, 122-126 100. Husson, A., Brasse-Lagnel, C., Fair and, A., Renouf, S., and Lavoinne, A. (2003) Argininosuccinate synthetase fr om the urea cycle to the citrullineNO cycle. Eur J Biochem 270, 1887-1899 101. Jinno, Y., Matuo, S. Nomiyama, H., Shimada, K., and Matsuda, I. (1985) Novel structure of t he 5' end region of the human argininosuccinate synthetase gene. J Biochem (Tokyo) 98, 1395-1403 102. Anderson, G. M., and Freytag, S. O. (1991) Synergistic activation of a human promoter in vivo by transcription factor Sp1. Mol Cell Biol 11, 19351943 103. Brasse-Lagnel, C., Lavoinne, A., Fa irand, A., Vavasseur, K., and Husson, A. (2005) IL-1beta stimulates argininosuccinate synthetase gene expression through NF-kappaB in Caco-2 cells. Biochimie 87, 403-409

PAGE 40

30 Paper I: Argininosuccinate synthase expression is required to maintain nitric oxide production and cell viability in aortic endothelial cells Bonnie L. Goodwin, Larry P. Solomonson and Duane C. Eichler Department of Biochemistry and Molecular Biology and University of South Flori da, College of Medicine Tampa, FL 33647 Published in: Journal of Biological Chemistry 2004 Apr 30; 279(18): 18353-60 Corresponding Author: Dr. Duane Eich ler, Department of Biochemistry and Molecular Biology, University of South Florida, 12901 Bruce B. Downs Blvd., MDC7, Tampa, FL 33612 tel. (813) 974-9716, fax (813) 974-7357, email: deichler@hsc.usf.edu

PAGE 41

31 SUMMARY While cellular levels of argini ne greatly exceed the apparent K m for endothelial nitric oxide synthase (eNOS), current ev idence suggests that the bulk of this arginine may not be available for nitric oxide (NO) production. We propose that arginine regeneration, that is the recycling of citrulline back to arginine, defines the essential source of arginine for NO production. To support this proposal, RNA interference analysis was used to se lectively reduce expression of argininosuccinate synthase (AS), since t he only known metabolic role for AS in endothelial cells is in the regener ation of L-arginine from L-citrulline. Western blot analysis demonstrated a significant and dose dependent reduction of AS protein as a result of AS siRNA treatment, wit h a corresponding diminished capacity to produce basal or stimulated leve ls of NO, despite saturating levels of arginine in the medium. Unanticipated, however, was the finding that the viability of AS siRNA-treated endothelial cell s was significantly decr eased when compared to control cells. Trypan blue exclusion analys is suggested that loss of viability was not due to necrosis. Two indicators, reduc ed expression of Bcl-2 and an increase in caspase activity, which correlated directly with reduced expression of AS, suggested that loss of viabilit y was due to apoptosis. Exposure of cells to an NO donor prevented apoptosis as sociated with reduced AS expression. Overall, these results demonstrate the essential ro le of AS for endothelial NO production and cell viability.

PAGE 42

32 INTRODUCTION Nitric oxide (NO) is an im portant modulator for a wide range of functions including vasodilation of blood vessels immune system function, angiogenesis, inhibition of leukocyte adhesion and pl atelet aggregation, gene regulation and apoptosis (1-3). Moreover, NO has a dual role in cell viabi lity depending on the tissue type and concentration. Either very high or very low conc entrations of NO may induce cell death, while basal concentrations may inhibit apoptosis (4-7). Previous work has shown that NO prot ects against serum-starvation(8), H 2 O 2 (9), TNF(10) and oxidized low-density lipopr oteininduced apoptosis (11, 12) in endothelial cells. Argininosuccinate synt hase (AS), the rate-limiting st ep (13) in the regeneration of arginine from citrulline, catalyzes the synthesis of argini nosuccinate, AMP and inorganic pyrophosphate from citrulline, ATP and aspartate. Argininosuccinate is then cleaved by argininosuccinate lyas e (AL) to produce L-arginine and fumarate. In liver, AS and AL function t ogether as components of the urea cycle, ultimately to form arginine from citrulline. While the expression of AS and AL in liver is high, both enzymes are found in most mammalian tissues, although at significantly lower levels. The discovery of arginine-derived NO, catalyzed by nitric oxide synthases (N OSs), revealed a second ro le for AS and AL (1-3). Together with NOS, they function as par t of a citrulline-NO cycle, where AS and AL convert citrulline to arginine, which is then oxidized to form NO and citrulline by NOS.

PAGE 43

33 Although both extracellular and intracellu lar concentrations of arginine are much higher than the reported K m of arginine for endothelial nitric oxide synthase (eNOS), NO production still appears to be limited by the availa bility of arginine (13-20). Recently, DNA microarray analysis of shear stress-induced NO production demonstrated t hat upregulation of AS was coordinated with an increase in NO production (21), supporting an important role for AS in endothelial NO production. If AS is essential for endot helial NO production, then even in the presence of excess arginine, depletion of AS should decrease the capacity of endothelial cells to produce NO. To test this hypothesis, RNA interference analysis was carried out using AS-specif ic RNA duplexes in bovine aortic endothelial cells (BAEC). In this report, we demonstrate a sign ificant and dosedependent reduction of AS protein following s iRNA transfection. We also show a concomitant decrease in enzyme activi ty corresponding to a decrease in stimulated and unstimulated NO production in endothelial cells with reduced AS expression, in spite of exce ss arginine in t he media. In additi on, we demonstrate that the viability of endothe lial cells grown in excess arginine and treated with AS siRNA was significantly diminished compared to control cells. EXPERIMENTAL PROCEDURES Cell Culture: Bovine aortic endothelial cells (BAEC) were propagated in Dulbeccos modified Eagle s medium (1 g/L glucose, Mediatech) supplemented with 10% fetal bovine serum (Hyclone Laboratories), 100 units ml -1 penicillin and 100 g ml -1 streptomycin (Mediatech) at 37 C and 5% CO 2 Twenty-four hours

PAGE 44

34 prior to transfection, BAEC were seeded in a 24-well plate at 5 X 10 4 cells per well. Transfection of siRNA was carri ed out with TransIT-TKO (Mirus) as described by the manufacturer. For eac h well, 0.1-10 nM siRNA duplex was combined with 3 l liposome in serum free DMEM and applied to cells at 50-70% confluency. Cells were assay ed after 24-48 h transfection. RNA duplex preparation: Ambions Silencer TM siRNA Construction Kit was used to synthesize 21-nucleoti de RNA duplexes. Target sequences were chosen following the guidelines described by Tuschl et al. (22, 23). The siRNA sequence specific to AS corresponded to bp 73-93 relative to the fi rst nucleotide of the start codon: GGAGCAAGGCUAUGACGUCtt. A control siRNA was designed by scrambling the bases of the AS s iRNA: UAGAUGGAGAGGCACUCGCtt. Both sequences were subjected to BLAST search to rule out homology to known proteins. Cell lysate preparation and immunoblotting: BAEC were trypsinized and then washed in ice-cold phosphate-buffered saline (PBS) and resuspended in RIPA buffer (1% NP-40, 0.5% sodi um deoxycholate, 0.1% SDS, 1X protease inhibitors in PBS) by vigorous pipetting followed by brief vortexing. The lysate was incubated on ice for 30 minutes and the pr otein concentration was determined by BCA assay (Pierce). Equal amounts (5-10 g) of protein were resolved on 4-15% polyacrylamide gels (Bio-Rad) and blott ed onto Immobilon-P PVDF membranes. Western blotting was performed as prev iously described (24). Briefly,

PAGE 45

35 membranes were blocked for 1 h in 5% non-fat dry milk (NFDM) in TBS-T and subsequently washed. Membranes were incubated with primar y antibody (1:2500 anti-AS (BD Transduction Labs), 1:1000 Bcl-2 (Santa Cruz) and 1:7500 anti-actin (Sigma)) in 5% NFDM for 1 h. Followi ng washing, membranes were incubated with secondary antibody in 5% NFDM fo r 1 h. Signal was visualized by chemiluminescence using ECL reagent (Ame rsham Biosciences) and exposed to film. Band intensities were quantita ted using ImageQuant software (Molecular Dynamics). RNA isolation and quantitative RT-PCR: Total RNA was isolated from transfected BAEC using a commerciall y available kit according to the manufacturers protocol (Ambion). RNA was treated with DNase (Ambion DNasefree) and quantitated prior to reverse transcription, which was performed as described previously (24). Real time quantitative PCR was performed using AS specific primers ASL228 and ASR278 (2 4). Results were normalized to 18S rRNA. Argininosuccinate synt hase activity assay: To assay AS activity in intact cells, BAEC were transfected with AS and c ontrol siRNA as described above. After incubation for 24 hours, cells were depleted of arginine by incubation in synthetic DMEM containing 500 M citrulline and no arginine. Cells were incubated for 30 minutes in this m edium and then stimulated with sodium orthovanadate (50 M) and A23187 calcium ionophore (0.25 M) (25) for 30

PAGE 46

36 minutes. Nitric oxide production was measured as described below. Cells were counted by trypan blue exclusion foll owing assay completion and data was normalized as nitrite pr oduced per hour per 1 x 10 6 cells. In a separate experiment, in vitro AS activity was assayed by measuring conversion of [ 3 H]aspartate to [ 3 H]argininosuccinate in cell lysate s as described by OBrien (26) with the exception that [ 3 H]aspartate (500 M, 39 Ci/mmol) was used. Whole cell lysates were prepared by lysing the cells in 10 mM TrisHCl containing protease inhibitors, 0.5 mM citrulline and 0.5 mM aspartate followed by three cycles of freeze-thaw in a dry ice ethanol bat h. Equal amounts of protein (50 g) for AS siRNA and control siRNA samples was ad ded to each reaction which contained citrulline (5mM), Tris-HCl (10 mM, pH 7.5), ATP (0.1 mM), MgCl 2 (6 mM), KCl 920 mM), phosphoenolpyruvate (1.5 mM), pyruva te kinase (4.5 units), myokinase (4 units), and pyrophosphatase (0.2 units) in a final volume of 150 l. Reactions were run for 90 minutes at 37 C. At the end of the reaction period, 50 l of 1M acetic acid was added and the tubes were heated to 90 C for 30 min. Samples were brought up to 1 ml with water and applied to AG 1-X8 resin (200-400 mesh, Bio-Rad) in 0.05M acetic ac id. An additional 2 x 1 ml of 0.05 M acetic acid was applied to the columns. Radioactivity in the 3 ml of column flow-through ([ 3 H]argininosuccinate) was quantif ied by liquid scintillation counting in CytoScint (MP Biomedical). Cell viability: Twenty-four hours after transfecti on, cells were trypsinized and counted by trypan blue exclusion. Briefly, 20 l of cell suspension was combined

PAGE 47

37 with 180 l trypan blue (Gibco) and cell counts were performed using a hemacytometer. Cell number was determined by averaging the cells in four squares, multiplying by the dilution fa ctor (10), multiplying by 10,000 and adjusting for cell volume to determine cells/ well. Viability was also detected using a colorimetric assay that measures te trazolium dye reduction as follows (27). siRNA transfections were carried out in 96-well plate format. AS knockdown and control BAEC were incubated with 20 l/well (5 mg/ml stock) MTT [3(4,5dimethylthiazol-2-yl) 2,5-diphenyltetrazo lium bromide] (Sigma) for 4 hours under normal culture conditions. The medium was removed without disturbing the formazan crystals, and 100 l/well DMSO (Sigma) was used to resuspend the product. The plate was read on a Quant spectrophotometer (Bio-tek instruments) at 570 nm. Ne crotic cell death was m easured using a commercially available cytotoxicity ki t (Promega). Lactate dehydrogenase (LDH) activity was measured in cell culture supernatants from AS knockdown and control cells using a FLUOstar Galaxy spectrofluorom eter (BMB Labtechnologies) with 544 nm excitation and 590 nm emi ssion. Results were present ed as percent of maximum LDH release, which was determined by complete lysis of cells. Apoptosis detection: Caspase 3/7 activity was measured using Apo-ONE TM Homogenous Caspase-3/7 A ssay (Promega). Cells were transfected in 96-well plates with AS and control siRNA as des cribed above. Cells were lysed and caspase 3/7 activity was measured by cleavage of the casp ase-3/7 substrate rhodamine 110 [bis-(N-CNZ-L-as partyl-L-glutamyl-L-valyl-L-aspartic acid amide)]

PAGE 48

38 (Z-DEVD-R110). Samples were meas ured on a FLUOstar Galaxy spectrofluorometer (BMB Labtechnologie s) with 492 nm excitation and 520 nm emission. For analysis of the effect an NO donor had on AS siRNA-induced apoptosis, BAEC were transfected with siRNA as described above. Four hours after transfection, media was replac ed with DMEM contai ning Glyco-SNAP-2 (Calbiochem) and incubated for 48 h prior to Caspase 3/7 detection. Nitric oxide assay: Twenty-four hours after transfe ction with siRNA, BAEC were stimulated with sodium orthovanadate (50 M) and A23187 calcium ionophore (0.25 M) (25). Nitrite was measured in the m edium as an indicator of cellular NO using a fluorometric method (28). Samples were read on a Jasco Spectrofluorometer exci ting at 365 nm and detect ing emission at 409 nm. Following stimulation, cells were counted by trypan blue exclusion and data is presented as nitrite produced per 1 x 10 6 cells. Statistical Analyses: Experimental data is expr essed as the mean +/SEM. Each experiment was performed indepen dently at least three times. RESULTS Silencing of AS by siRNA transfection AS is known to catalyze the rate-limiting step (13) in arginine synthesis from ci trulline and aspartate. Argininosuccinate lyase (AL) is also required for this conv ersion (29). In order to further elucidate the function of AS in endothelial cells, particu larly with respect to its role in NO

PAGE 49

39 production, we utilized the recently dev eloped technique of siRNA to selectively reduce AS expression. A 21 nt RNA du plex specific to AS sequence was identified as outlined by Tuschl and colleagues (23, 30) and compared to known sequences using BLAST search to e liminate any sequences homologous to other genes. The AS s iRNA was transcribed in vitro using the Silencer TM siRNA Construction Kit (Ambion). A control siRN A was synthesized containing the same base composition as the AS siRNA, but in a scrambled s equence. BAEC were transfected with 10 nM AS or control si RNA (except where indicated in the figures) for 24 h. AS protein levels were monitored by immunoblot analysis and as shown in Figure 1A, AS siRNA treatment specifica lly reduced cellular AS protein levels to less than 50% of control levels. To determine whether reduction of AS prot ein correlated to the reduction of AS mRNA, total RNA was isolated and AS me ssage quantitated by real-time RTPCR. As shown in Figure 1B, AS siRNA tr eatment resulted in a reduction of AS mRNA that correlated with t he reduction of AS protein. Argininosuccinate synthase activity is reduced in AS siRNA treated cells Previously we have demonstrated that ci trulline was sufficient to sustain NO production in the absence of arginine, based on the presence of the recycling enzymes AS and AL. To confirm that the functional activity of AS was decreased in intact cells, corresponding to the obs erved decrease in protein expression, cells were equilibrated in argi nine-free medium containing 500 M citrulline for 30 minutes and then stimulated with sodi um orthovanadate and A23187 to give

PAGE 50

40 maximal NO production (25). Nitric oxi de production was m easured as nitrite using the DAN assay (28). In the endothelial cells with reduced AS expression, nitric oxide production per cell was decreased by more than 80%, indicating a significant reduction in activity of the enzyme (Table I). For a direct measure of in vitro AS activity, conversion of [ 3 H]aspartate to [ 3 H]argininosuccinate in lysates from siRNA treated cells wa s assayed (26). Activity in control cells was 2.9 pmol/min/mg, while activity in AS siRNA treated cells was only 0.8 pmol/min/mg, confirming that expression and activity of AS protein was reduced as a result of AS siRNA treatment. Reduction of stimulated NO production in AS-depleted BAEC If production of arginine from citrulline, catalyzed by the enzymes AS and AL, provided an essential source of arginine for NO produc tion in endothelial ce lls, reduction of AS protein expression should result in a decrease in the amount of NO produced upon stimulation (13-17), in sp ite of saturating levels of extracellular arginine. To test whether AS is essential for endothel ial NO production, AS siRNA treated BAEC were stimulated with sodium orthovanadate and ca lcium ionophore in the presence of excess extracellular arginine (~500 M) and NO release was determined. As shown in Table I, reducti on in AS expression resulted in a 56% decrease in stimulated NO produced as compared to cont rol. Since nitrite levels were normalized to the number of cells counted by trypan blue exclusion, the decrease in NO detected could be attri buted to a decrease in production per viable cell as opposed to any effect on cell viability. These results demonstrate

PAGE 51

41 that sufficient levels of AS must be expressed in order to maintain NO production, and that arginine regeneration pl ays an essential role in stimulated NO production in endothelial cells, even in the presence of excess arginine. AS silencing results in a reduced basal level of NO production The significant effect of AS silencing on stimulated NO production in endothelial cells led us to investigate whether basal (unstimulated) levels of NO producti on in BAEC were also reduced by AS siRNA tr eatment. Twenty-four hour s after transfection with AS and control siRNAs, media was replac ed with fresh media (containing excess arginine and no phenol r ed indicator) and samples were collected after 24 h for nitrite determination. Cell number wa s assessed by trypan blue exclusion analysis and results are presented as nitrite produced per hour per 1 x 10 6 cells. As shown in Table I, significant reducti on (70%) in basal production of NO was observed in BAEC where AS expre ssion had been decreased by siRNA transfection. Thus, AS expression is also required to sustain unstimulated levels of NO produced by endothelial cells even in the pres ence of excess levels of extracellular arginine. Decrease in cell surviv al in AS depleted BAEC Interestingly, AS siRNA treatment of endothelial ce lls resulted in a noticeab le and unexpected decrease in cell viability over control cells. To confirm this observation, AS siRNA treated cells were evaluated for viabi lity by trypan blue exclusion. As shown in Figure 2A, a 46% decrease in cell survival was obser ved compared to control. To further

PAGE 52

42 substantiate this observation, cellular re spiration was measured as a marker of viability using the MTT assay 24 h after AS siRNA transfection. MTT assay also showed a 40% decrease in ce ll survival in AS depleted endothelial cells (Figure 2B). Reduction of AS prot ein beyond the levels achieved in this study was not possible due to extensive cell deat h associated with further increased concentrations of the AS siRNA. LDH release in AS-transfected BAEC During necrosis, cells become permeable, allowing leakage of proteins into the media. A marker used to detect this phenomenon is release of lactate dehydrogenase (LDH) into the culture medium (31). After treatment with AS and control siRNA, cell cultures were assayed for LDH activity in the m edia. Although treatment with AS siRNA resulted in a loss of cell viability, t here was no significant difference in LDH activity detected in the media in AS-s iRNA transfected cells as compared to control (Figure 3). These resu lts suggested that the loss of cell viability resulting from partial AS depletion was not necrosis. Reduction in Bcl-2 levels in cells with reduced AS expression Since trypan blue exclusion analysis, as well as the absen ce of LDH release, suggested that necrosis was not the pathway directing cell death in cells with reduced AS expression, the possible involvement of apoptosis was investigated. Bcl-2 is known to be an important protein expr essed in many cell types, including endothelial cells, that protects against apoptosis (32). To determine whether

PAGE 53

43 apoptosis accounted for the loss of viability in AS knockdown cells, lysates from cells transfected with AS and contro l siRNAs were prepared and Bcl-2 expression was determined by standard we stern blotting analysis. As shown in Figure 4, a significant decrease in Bc l-2 protein was detected in AS-depleted cells as compared to control, consist ent with the suggestion that the observed loss of cell viability results fr om the induction of apoptosis. Apoptosis-inducing factor is unaffected by depletion of AS In a recently described pathway in endothe lial cells, apoptosis-induc ing factor (AIF) was identified as an import ant regulator of apoptosis that circumvents the requirement for caspase 3 activation in the induction of apoptosis (33). To examine whether increased levels of AIF re sult from AS siRNA treatmen t, cell lysates from AS and control siRNA treated cells were subject ed to western blot analysis to monitor changes in AIF protein expression. As shown in Figure 5A, there was no significant effect on AIF levels result ing from AS siRNA tr eatment that would account for the loss of cell viabilit y induced by an apoptotic response. Increase in caspase-3/7 activa tion in BAEC depleted of AS Due to the observed degradation of Bcl2 protein and the lack of e ffect on AIF protein, the effect of AS silencing on caspase activation was investigated. Caspase-3 is a cysteine protease that on activation of t he apoptotic cascade is proteolytically cleaved from an inactive, procaspase form, to an active caspase. Following partial AS depletion, t here was over a 3-fold increase in caspase 3/7 activity

PAGE 54

44 compared to control cells (Figure 5B). This finding strongly supports the proposal that reduction of AS expression re sults in induction of apoptosis. Treatment of AS siRNA tr ansfected BAEC with an NO donor prevents apoptosis Basal NO production in endothelial cells has been suggested to prevent induction of apoptosis (34); first by dec reasing mRNA stabilit y of MAP kinase phosphatase-3 (MPK-3)(35), and second, by directly inactivating caspase-3 via S-nitrosylation of its active site thiol (36)(see Figure 7). To determine whether a reduction in basal NO production caused by AS knockdown correlated with the observed increase in apoptosis, BAE C were treated with Glyco-SNAP-2 (Calbiochem), an NO donor with a half-life of 27.4 h. Glyco-SNAP-2 (25-400 M) was added to the media immediately fo llowing the transfection with AS siRNA. Forty-eight hours after transfection, ca spase 3/7 activity was determined to quantitate the level of the apoptotic response. As shown in Figure 6, AS siRNAinduced apoptosis in treat ed endothelial cells was decr eased proportionately by the concentration of exog enous NO donor added. This correlation suggests that induction of apoptosis may be due, in part, to the reduction in basal NO production that results from AS knockdown, although a more direct effect of AS protein on apoptosis can not be excluded. DISCUSSION NO production appears to be lim ited by the availability of arginine, despite extracellular and intracellular concentra tions that are much higher than the

PAGE 55

45 reported K m for eNOS (13-19); thus, the source of arginine required to sustain NO production in endothelial cells has been investigated and debated. Part of this debate seemed to be resolved with the finding that the CAT1 transporter, the major transporter of argi nine for endothelial cells, co-localizes with eNOS in caveolae (37). Thus, it was suggest ed that endothelial NO production was maintained through extracellular trans port of arginine (37). This was a reasonable proposal since serum arginine levels normally vary from 80 to 90 M, well above the K m for eNOS. Nevertheless, other evidence persisted, demonstrating that endothel ial NO production was limited by the capacity to regenerate arginine from citrulline (13-19). For example, our laboratory has shown previously that extracellular citrulline was as effective as arginine in stimulati ng NO production (18) even in media containing saturating levels of arginine (~ 500 M). Because extracellular citrulline levels had no effect on intr acellular arginine levels, these results suggested that citrulline enhancement of NO production was mediated through regeneration of arginine directed to NO production, and therefore could be observed despite saturating levels of extracellu lar arginine. Similarly, Wu et al. (38) showed that synthesis of arginine from citrulline was stimulated by addition of exogenous citrulline. In this case, the authors spec ulated that the func tion of citrulline recycling was to salvage the carbon backb one in order to maintain sufficient Larginine to sustain prolonged NO synthesis.

PAGE 56

46 Other lines of evidence that supported the requirement of arginine regeneration for NO production include the over expr ession of AS in vascular smooth muscle cells (13). As a result of AS over ex pression there was a dramatic enhancement in the ability of the trans fected smooth muscle cells to produce NO over that of untransfected cells, again in spite of satura ting levels of extracellular arginine. Thus, Xie et al. (13, 14) concluded t hat the capacity to recycle citrulline back to arginine is rate-limiting to NO production. Su et al. (17) arrived at a similar conclusion showing that hypoxia in pulmonary artery endothelial cells (PAEC) inhibited induction of AS by endotoxin. As a consequenc e, the production of NO, independent of sufficient ex tracellular arginine levels, was significantly impaired. While our studies focused on the role of recycling for endothelial NO production by eNOS, previous studies have demons trated the importanc e of recycling for NO production by both iNOS and nNOS For example, AS and iNOS are coinduced in immunostimulat ed macrophages (39, 40) as well as in stimulated RPE-J cells where the citrulline-NO cycle is shown to be functioning (41). In addition, coinduction of iNOS, CAT-2 and AS in rat microglial cells indicates that both arginine transport by CAT-2 and citru lline-arginine recycling are important in the production of large amounts of NO in activated microglial cells (42). In neurons, colocalization of nNOS, AS an d AL was identified in the canine gastrointestinal tract providing morphologi cal evidence of a citrulline-NO cycle (43). Finally, in the rat gastric fundus, functional evidence of recycling is supported by colocalization of AS, AL and nNOS (44).

PAGE 57

47 Gene expression studies, using DNA mi croarray analyses, demonstrated that a significant and coordinate upregulation of AS gene expression occurred in response to fluid shear stress stimulatio n of NO production by human umbilical vein endothelial cells (21). Since extracellu lar arginine was again not limiting in these studies, the authors c oncluded that a prerequisite for shear-stress induced NO production, in the absenc e of synthesis of additional eNOS, was an increase in arginine regeneration vi a increased AS expression (21). In other words, increased expression of AS resulted in the increased capacity to provide the necessary substrate to sustain elevat ed NO production associated with the shear-stress response. Our results provide further evidence supporting the necessity for the regeneration of arginine for NO production. Specifica lly, AS expression was demonstrated to be necessary and sufficient to maintain bot h stimulated and rest ing levels of NO synthesis in endothelial cells. Howeve r, the finding that reduction of AS expression in endothelial cells resulted in a decreas e in cell viability was unexpected. Initially, we speculated that cell death may be a consequence of superoxide toxicity which can result when eNOS is deprived of arginine (45). However, superoxide production was unaffe cted by partial AS depletion (data not shown). Moreover, since trypan blue exclus ion and LDH release did not indicate that necrosis was the mechanism of cell d eath, we investigated the possibility that these AS depleted endot helial cells were being driven to apoptosis.

PAGE 58

48 NO has a bi-functional role in cell death it can either st imulate or inhibit cytotoxicity. The level of NO produced and the type of cell involved determines the effect NO has on cell viability (5, 6). High concentrations of NO have been shown to induce cell death via apoptosis In a more complex pathway, NO can switch apoptosis to necrosis (4-7). In contrast, lower concentrations of NO have been shown to protect cells such as endothel ial cells (34), thym ocytes (46) and lymphocytes (47) from apoptosis. In endothelial cells, induction of NO by sphingosine-1-phosphate protects endothelial cell s from serum-deprived apoptosis (8). There are several mechanisms that hav e been elucidated in the anti-apoptotic effects of NO (see Figure 7). Caspase-3 ac tivation is inhibited by S-nitroslyation of the enzyme by NO (36, 48). In addition, Bcl-2 cleavage is i nhibited by NO as well as subsequent release of cytochrome c (5, 47). Furthermore, MAP kinase phosphatase-3 (MKP-3) RNA is downr egulated via an NO-dependent mechanism, maintaining active ERK1/2 and thus protecting the cell from the apoptotic cascade (35). Finally, NO can induce apoptosis by directly inhibiting cytochrome c oxidase, thus causing a decrease in the membrane potential of the mitochondria and release of cytochrome c (49). In our study, AS siRNA-induced apoptosis was modulated by the addition of an NO donor. This finding suggests that basal levels of NO in endothelial cells, sustained by the recycling of citrulline back to arginine, may provide protection against apoptosis. We recognize

PAGE 59

49 however, that AS may be performing another function in the cell which is preventing apoptosis. The recent characteri zation of AS as a Jak-2 interacting protein (50), the regulation of AS by c-Myc (51) and t he repression of AS expression by the anti-prolif erative drug FAP48 (52) warr ant investigation into an alternative role of the enzyme in maintaining cell viability. The maintenance of endothelial cell viabi lity through basal NO production has important clinical implicat ions. In atherosclerotic lesions there are regions characterized by reduced shear stress, which correlate with reduced NO synthesis (53, 54). High endot helial cell turn-over due to induction of apoptotic signaling pathways also characterize these regions (55). Importantly, NO production by endothelial cells may play a preventive role in atherosclerosis where cultured endothelial cell apoptosis is inhibited by increased endothelial NO production (56). All these studies, however, demonstrate a protection from induction of apoptosis, not simply maint enance of viability as we demonstrate in the current study. Basal leve ls of NO may provide maintenance of viability by keeping the proteins involved in cell cycle versus cell death in check, thus maintaining viability. A decrease in endothelial NO production associated with endothelial dysfunction, is a common feature in medical conditi ons such as hypertension, diabetes mellitus and atherosclerosis. Supplementation with arginine in humans has produced conflicting results. In some st udies, dietary arginine supplementation

PAGE 60

50 results in improved vascular function by providing substrate for eNOS and improving NO production (5759). Other studies have not seen an improvement in condition and harmful effects may occur (60-63). We demonstrate in this study that a functional citrulline-NO cycle is essential for endothelial NO production; therefore, targeting an increase in AS activity in endothelial cells may provide a pharmaceutical alternative for im proving endothelial dysfunction. In summary, NO production by endothelial cells plays an important role in the function of the endothelium and modulates cell survival signaling pathways such as Bcl-2 expression and caspase activity This report supports our hypothesis that endothelial NO synthesis is dependent on the availability of a specific pool of arginine maintained through the conversion of citrulline to arginine by the enzymes AS and AL. AcknowledgementsWe wish to thank the Mary and Walter Traskiewicz Memorial Fund for support for this research.

PAGE 61

Table I: Effect of AS siRNA transfection on endothelial NO production BAEC were transfected with AS siRNA or with control siRNA as described in Methods. Transfected BAEC were equilibrated in synthetic DMEM that contained either no arginine and 500 M citrulline or no citrulline and 500 M arginine. Basal NO production was determined over a 24 hour period and stimulated NO production was determined over a one hour period following stimulation with 0.25 M A23187 and 20 M sodium orthovanadate. NO was measured as nitrite produced per 1x10 6 cells. (Nitrite is a stable reaction product of NO and molecular oxygen). Control rates of NO production are not directly comparable because of different cell preparations. Condition Control siRNA nmol nitrite/h/ 1x10 6 cells AS siRNA nmol nitrite/h/ 1x10 6 cells Ratio AS siRNA/ Control siRNA Stimulated, + Citrulline 0.980.20 0.140.09 0.14 Stimulated, + Arginine 5.400.96 2.380.37 0.44 Basal, + Arginine 0.350.08 0.120.01 0.34 51

PAGE 62

52 Table II: Effect of AS siRNA tran sfection on AS activity BAEC were transfected with AS or contro l siRNA and lysates were prepared as described in Methods. In vitro activity was measured as described by OBrien (26) and detailed in methods. Condition AS activity pmol/min/mg Ratio AS siRNA/ Control siRNA AS siRNA Control siRNA 0.81 0.17 2.89 0.58 0.28

PAGE 63

53 Figure 1: Specific reduction of AS protein and mRNA by siRNA transfection. BAEC were transiently trans fected with AS and control siRNA using Transit-TKO. (A) 24 h after transfect ion, cell lysates were prepared, 10 g of each sample was loaded onto an SDS polyacrylamide gel and standard western blotting performed. Anti-AS and anti -actin antibodies were used to detect the amount of protein present. (B) 24 ho urs after transfection, total RNA was isolated using RNAqueousTM Total Isolation Kit (Ambion) and reverse transcribed with Superscript II (Invitrogen). AS message wa s detected using real time quantitiative PCR. Results were normalized to 18S rRNA.

PAGE 64

54

PAGE 65

55 Figure 2: Loss of AS in BAEC dimi nishes cell viability. BAEC were transiently transfected with Transit-TKO and 10 nM siRNA. Twenty-four hours after transfection, cell viability was m easured by (A) trypan blue exclusion analysis or (B) MTT assay in siRNA transfected, non-transfected (NT) and liposome only (L) transfected cells. Result s are presented as pe rcent viability of NT cells.

PAGE 66

AB NTLASControlPercent Viability 020406080100120 NTLASControlPercent Viability 020406080100120 56

PAGE 67

57 Figure 3: Effect of partial AS silenc ing on necrotic cell death measured by LDH release. BAEC were transfected in 96-well plates wit h liposome only (L) or indicated siRNA. Twentyfour hours post-transfect ion, LDH release was measured using CytoTox-ONE TM (Promega). Samples were measured using 544 excitation and 590 emission. Results ar e presented as perce ntage of maximum LDH release (M) quantitated by lysis of non-transfected cells.

PAGE 68

LASControlMLactate Dehydrogenase Activity(Percent) 020406080100120 58

PAGE 69

59 Figure 4: Reduced Bcl-2 pr otein levels in partially AS depleted endothelial cells. Following transfection of 1-10 nM AS or control siRNA, cell lysates were prepared and standard wester n blotting was performed. Blots were probed with anti-AS (1:2500), anti-Bcl2 (1:1000) and anti-Actin (1:7500) antibodies.

PAGE 70

60

PAGE 71

61 Figure 5: Apoptosis induction in BAE C transfected with AS siRNA. (A) Following siRNA transfection in 24-well plates, total protein was prepared and analyzed by SDS-PAGE and immunoblotted with anti-AIF antibody. (B) BAEC were transfected with AS and control siRNA in 96 well plates. 24 h after transfection, caspase 3/7 activi ty was measured using Apo-ONE TM (Promega) on a Fluostar Galaxy spectrofluorometer using an excitation of 490 nm and detecting at 520 nm. Control wells were transfected with liposome only. Results are presented as fold increase in caspase activity over control wells.

PAGE 72

62

PAGE 73

63 Figure 6: Prevention of AS siRNA-induced apoptosis with an NO donor BAEC were transfected with AS siRNA in 96 well plates. Immediately following transfection increasing concentrations of the NO donor, Glyco-SNAP-2, was added to the media. Caspase 3/7 activi ty was measured as an indicator of apoptosis.

PAGE 74

Glyco-SNAP-2 (mM) 0100200300400500Percent Apoptosis 406080100120 64

PAGE 75

65 Figure 7: Mechanism of NO suppression of apoptosis Activation of map kinase phosphatase-3 (MKP-3) induces ERK 1/2 activati on. ERK 1/2 activation results in degradation of t he apoptotic protective protein Bcl-2. NO prevents cascade activation by destabilizing MKP3 RNA thus blocking the apoptotic cascade prior to cytochrome C release (35) In addition, NO can also inactivate caspase-3 through s-nitrosylation of the active cysteine (36).

PAGE 76

CytochromeC Bcl-2MKP-3 ERK 1/2 Induction Caspase-3 Other Caspases+ Mitochondria Apoptosis NO NO ApoptoticStimuli 66

PAGE 77

67 REFERENCES 1. Bredt, D. S., and Snyder, S. H. (1994) Nitric oxide: a physiologic messenger molecule. Annu Rev Biochem 63, 175-195 2. Vallance, P., and Chan, N. (2001) E ndothelial function and nitric oxide: clinical relevance. Heart 85, 342-350 3. Gow, A. J., and Ischiropoulos, H. ( 2001) Nitric oxide chemistry and cellular signaling. J Cell Physiol 187, 277-282 4. Melino, G., Catani, M. V ., Corazzari, M., Guerrieri, P., and Bernassola, F. (2000) Nitric oxide can inhibit apoptosis or switch it into necrosis. Cell Mol Life Sci 57, 612-622 5. Dimmeler, S., and Zeiher, A. M. (1997) Nitric oxide and apoptosis: another paradigm for the double-edged ro le of nitric oxide. Nitric Oxide 1, 275-281 6. Haendeler, J., Zeiher, A. M., and Dimmeler, S. (1999) Nitric oxide and apoptosis. Vitamins & Hormones 57, 49-77 7. Shen, Y. H., Wang, X. L., and Wilck en, D. E. (1998) Nitric oxide induces and inhibits apoptosis through different pathways. FEBS Letters 433, 125131

PAGE 78

68 8. Kwon, Y. G., Min, J. K., Kim, K. M., Lee, D. J., Billia r, T. R., and Kim, Y. M. (2001) Sphingosine 1-phosphate prot ects human umbilical vein endothelial cells from seru m-deprived apoptosis by nitric oxide production. J Biol Chem 276, 10627-10633 9. Hermann, C., Zeiher, A. M., and Dimmele r, S. (1997) Shear stress inhibits H 2 O 2 -induced apoptosis of human endothelial cells by modulation of the glutathione redox cycle and nitric oxide synthase. Arterioscler Thromb Vasc Biol 17, 3588-3592 10. Estrada, C., Gomez, C., Martin, C ., Moncada, S., and Gonzalez, C. (1992) Nitric oxide mediates tumor necrosis factor-alpha cytotoxicity in endothelial cells. Biochem Biophys Res Commun 186, 475-482 11. Kotamraju, S., Hogg, N ., Joseph, J., Keefer, L. K., and Kalyanaraman, B. (2001) Inhibition of oxidized low-dens ity lipoprotein-induced apoptosis in endothelial cells by nitric oxide. Peroxyl radical scavenging as an antiapoptotic mechanism. J Biol Chem 276, 17316-17323 12. Dimmeler, S., Hermann, C., Ga lle, J., and Zeiher, A. M. (1999) Upregulation of superoxi de dismutase and nitric ox ide synthase mediates the apoptosis-suppressive effects of shear stress on endothelial cells. Arteriosclerosis, Thrombosis & Vascular Biology 19, 656-664 13. Xie, L., and Gross, S. S. (1997) Argininosuccinate synthetase overexpression in vascular sm ooth muscle cells potentiates immunostimulant-induced NO production. J Biol Chem 272, 16624-16630

PAGE 79

69 14. Xie, L., Hattori, Y., Tume, N., and Gross, S. S. ( 2000) The preferred source of arginine for high-output nitric oxide synthesis in blood vessels. Semin Perinatol 24, 42-45 15. Sessa, W. C., Hecker, M., Mitchell, J. A., and Vane, J. R. (1990) The metabolism of L-arginine and its significance for the biosynthesis of endothelium-derived rela xing factor: L-glutamine inhibits the generation of L-arginine by cultured endothelial cells. Proc Natl Acad Sci USA 87, 86078611 16. Hattori, Y., Campbell, E. B., and Gr oss, S. S. (1994) Argininosuccinate synthetase mRNA and activity ar e induced by immunostimulants in vascular smooth muscle. Role in the regeneration or arginine for nitric oxide synthesis. J Biol Chem 269, 9405-9408 17. Su, Y., and Block, E. R. (1995) Hypoxia in hibits L-arginine synthesis from L-citrulline in porcine pulmonary artery endothelial cells. Am J Physiol 269, L581-587 18. Flam, B. R., Hartmann, P. J., Harr ell-Booth, M., Solo monson, L. P., and Eichler, D. C. (2001) Caveolar localization of ar ginine regeneration enzymes, argininosuccinate synthase, and lyase, with endothelial nitric oxide synthase. Nitric Oxide 5, 187-197 19. Shuttleworth, C. W., Burns, A. J. Ward, S. M., O'Br ien, W. E., and Sanders, K. M. (1995) Re cycling of L-citrulline to sustain nitric oxidedependent enteric neurotransmission. Neuroscience 68, 1295-1304

PAGE 80

70 20. Solomonson, L. P., Flam, B. R., Pendleton, L. C., Goodwin, B. L., and Eichler, D. C. (2003) The caveolar nitric oxide synthase/arginine regeneration system for NO production in endothelial cells. Journal of Experimental Biology 206, 2083-2087 21. McCormick, S. M., Eskin, S. G., McIn tire, L. V., Teng, C. L., Lu, C. M., Russell, C. G., and Chittur, K. K. (2001) DNA microarray reveals changes in gene expression of shear stressed human umbilical vein endothelial cells. Proc Natl Acad Sci USA 98, 8955-8960 22. Elbashir, S. M., Martinez, J. Patkaniowska, A., Lendeckel, W., and Tuschl, T. (2001) Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melano gaster embryo lysate. Embo Journal 20, 68776888 23. Tuschl, T., Elbashir S., Harborth J. and Weber, K. (2002) The siRNA user guide. http://www.mpibpc.gwdg.de/ abteilungen/100/105/sirna.html 24. Pendleton, L. C., Goodwin, B. L., Flam, B. R., Solomonson, L. P., and Eichler, D. C. (2002) Endothelial argininosuccinate synthase mRNA 5untranslated region diversit y. Infrastructure for tissue-specific expression. J Biol Chem 277, 25363-25369 25. Hellermann, G. R., Flam, B. R., Eichler, D. C., and Solomonson, L. P. (2000) Stimulation of receptor-medi ated nitric oxide production by vanadate. Arterioscler Thromb Vasc Biol 20, 2045-2050 26. O'Brien, W. E. (1979) Isolation and characterization of argininosuccinate synthetase from human liver. Biochemistry 18, 5353-5356

PAGE 81

71 27. Martin, A., and Clynes, M. (1993) Com parison of 5 microplate colorimetric assays for in vitro cytotoxicity te sting and cell prolif eration assays. Cytotechnology 11, 49-58 28. Misko, T. P., Schilling, R. J., Salvem ini, D., Moore, W. M., and Currie, M. G. (1993) A fluorometric assa y for the measurement of nitrite in biological samples. Anal Biochem 214, 11-16 29. Hecker, M., Sessa, W. C., Harris, H. J., Anggard, E. E., and Vane, J. R. (1990) The metabolism of L-argi nine and its significance for the biosynthesis of endothelium-derived relaxing factor: cultured endothelial cells recycle L-citrulline to L-arginine. Proc Natl Acad Sci USA 87, 86128616 30. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498 31. Korzeniewski, C., and Callewaert, D. M. (1983) An enzyme-release assay for natural cytotoxicity. Journal of Immunological Methods 64, 313-320 32. Borner, C. (2003) The Bcl-2 protein family: sensors and checkpoints for life-or-death decisions. Molecular Immunology 39, 615-647 33. Zhang, W., Shokeen, M., Li, D., and M ehta, J. L. (2003) Identification of apoptosis-inducing factor in human coronary artery endothelial cells. Biochem Biophys Res Commun 301, 147-151

PAGE 82

72 34. Dimmeler, S., Haendeler, J., N ehls, M., and Zeiher A. M. (1997) Suppression of apoptosis by nitric oxid e via inhibition of interleukin-1betaconverting enzyme (ICE)-like and cystei ne protease protein (CPP)-32-like proteases. J Exp Med 185, 601-607 35. Rossig, L., Haendeler, J., Hermann, C., Malchow, P., Ur bich, C., Zeiher, A. M., and Dimmeler, S. (2000) Nitri c oxide down-regulates MKP-3 mRNA levels: involvement in endothelial cell protection from apoptosis. J Biol Chem 275, 25502-25507 36. Rossig, L., Fichtlscherer, B., Breit schopf, K., Haendeler, J., Zeiher, A. M., Mulsch, A., and Dimmeler, S. (1999) Nit ric oxide inhibits caspase-3 by Snitrosation in vivo. Journal of Biological Chemistry 274, 6823-6826 37. McDonald, K. K., Zharikov, S., Block, E. R., and Kilberg, M. S. (1997) A caveolar complex between the cati onic amino acid transporter 1 and endothelial nitric-oxide synthase may explain the "arginine paradox". J Biol Chem 272, 31213-31216 38. Wu, G., Meininger, C. J., Knabe, D. A., Bazer, F. W., and Rhoads, J. M. (2000) Arginine nutrition in development, health and disease. Curr Opin Clin Nutr Metab Care 3, 59-66 39. Nussler, A. K., Billiar, T. R., Liu, Z. Z., and Morris, S. M., Jr. (1994) Coinduction of nitric oxide synthase and argininosuccinate synthetase in a murine macrophage cell line. Implications for regulation of nitric oxide production. Journal of Biological Chemistry 269, 1257-1261

PAGE 83

73 40. Nagasaki, A., Gotoh, T., Takeya, M. Yu, Y., Takiguchi, M., Matsuzaki, H., Takatsuki, K., and Mori, M. (1996) Coi nduction of nitric oxide synthase, argininosuccinate synthetase, and argininosuccinate lyase in lipopolysaccharide-treated rats RNA blot, immunoblot, and immunohistochemical analyses. Journal of Biological Chemistry 271, 2658-2662 41. Koga, T., Zhang, W. Y., Gotoh, T., Oyadomari, S., Tanihara, H., and Mori, M. (2003) Induction of citrulline-nitr ic oxide (NO) cycle enzymes and NO production in immunostimulated rat RPE-J cells. Experimental Eye Research 76, 15-21 42. Kawahara, K., Gotoh, T., Oyadomari, S., Kajizono, M., Kuniyasu, A., Ohsawa, K., Imai, Y., K ohsaka, S., Nakayama, H., and Mori, M. (2001) Co-induction of argininosuccinate synthetase, cationic amino acid transporter-2, and nitric oxide synthas e in activated murine microglial cells. Brain Research. Molecular Brain Research 90, 165-173 43. Daniel, E. E., Wang, Y. F., Salapatek, A. M., Mao, Y. K., and Mori, M. (2000) Arginosuccinate synthetase, arginosuccinate lyase and NOS in canine gastrointestinal tract: immunocytochemical studies. Neurogastroenterology & Motility 12, 317-334 44. Van Geldre, L. A., Timmermans, J. P., and Lefebvre, R. A. (2002) Lcitrulline recycling by argininosuccinat e synthetase and lyase in rat gastric fundus. European Journal of Pharmacology 455, 149-160

PAGE 84

74 45. Pou, S., Pou, W. S., Bredt, D. S., Snyder, S. H., and Rosen, G. M. (1992) Generation of superoxide by purifi ed brain nitric oxide synthase. Journal of Biological Chemistry 267, 24173-24176 46. Fehsel, K., Kroncke, K. D., Meyer, K. L., Huber, H., Wahn, V., and KolbBachofen, V. (1995) Nitri c oxide induces apoptosis in mouse thymocytes. J Immunol 155, 2858-2865 47. Genaro, A. M., Hortel ano, S., Alvarez, A., Mart inez, C., and Bosca, L. (1995) Splenic B lymphocyte programmed cell death is prevented by nitric oxide release through mechanisms in volving sustained Bcl-2 levels. Journal of Clinical Investigation 95, 1884-1890 48. Li, J., Billiar, T. R., Talanian, R. V., and Kim, Y. M. (1997) Nitric oxide reversibly inhibits seven member s of the caspase family via Snitrosylation. Biochem Biophys Res Commun 240, 419-424 49. Shiva, S., Brookes, P. S., Patel, R. P., Anderson, P. G., and DarleyUsmar, V. M. (2001) Nitric oxid e partitioning into mitochondrial membranes and the control of respir ation at cytochrome c oxidase. Proceedings of the Na tional Academy of Sciences of the United States of America 98, 7212-7217 50. Sarkar, S., Pollack, B. P., Lin, K. T., Kotenko, S. V., Cook, J. R., Lewis, A., and Pestka, S. (2001) hT id-1, a human DnaJ protein, modulates the interferon signaling pathway. Journal of Biological Chemistry 276, 4903449042

PAGE 85

75 51. Coller, H. A., Grandori, C., Ta mayo, P., Colbert, T., Lander, E. S., Eisenman, R. N., and Golub, T. R. (2000) Expression analysis with oligonucleotide microarrays reveals t hat MYC regulates genes involved in growth, cell cycle, signaling, and adhesion. Proceedings of the National Academy of Sciences of t he United States of America 97, 3260-3265 52. Krummrei, U., Baulieu, E. E., and Chambraud, B. (2003) The FKBPassociated protein FAP48 is an antiprolif erative molecule and a player in T cell activation that increases IL2 synthesis. Proceedings of the National Academy of Sciences of t he United States of America 100, 2444-2449 53. Dimmeler, S., Haendeler, J., Rippmann, V., Nehls, M., an d Zeiher, A. M. (1996) Shear stress inhibits apoptosis of human endothelial cells. FEBS Letters 399, 71-74 54. Noris, M., Morigi, M., Donadelli, R., Aiello, S., F oppolo, M., Todeschini, M., Orisio, S., Remuzzi, G., and Remuzzi, A. (1995) Nitric oxide synthesis by cultured endothelial cells is modulated by flow conditions. Circulation Research 76, 536-543 55. Caplan, B. A., and Schwartz, C. J. (1973) Increased endothelial cell turnover in areas of in vivo Evans Blue uptake in the pig aorta. Atherosclerosis 17, 401-417 56. Dimmeler, S., Hermann, C., and Ze iher, A. M. (1998) Apoptosis of endothelial cells. Contribution to the pathophysiology of atherosclerosis? European Cytokine Network 9, 697-698

PAGE 86

76 57. Creager, M. A., Gallagher, S. J., Girerd, X. J., Co leman, S. M., Dzau, V. J., and Cooke, J. P. (1992) L-ar ginine improves endothelium-dependent vasodilation in hypercholesterolemic humans. Journal of Clinical Investigation 90, 1248-1253 58. BodeBoger, S. M., Boger, R. H., Al fke, H., Heinzel, D., Tsikas, D., Creutzig, A., Alexander, K., and Frolic h, J. C. (1996) L-arginine induces nitric oxide-dependent vasodilation in patients with critical limb ischemia A randomized, controlled study. Circulation 93, 85-90 59. Clarkson, P., Adams, M. R., Powe, A. J., Donald, A. E., McCredie, R., Robinson, J., McCarthy, S. N., Ke ech, A., Celermajer, D. S., and Deanfield, J. E. (1996) Oral L-arginine improves endothelium-dependent dilation in hypercholesterolemic young adults. Journal of Clinical Investigation 97, 1989-1994 60. Candipan, R. C., Wang, B. Y., Buitrago, R., Tsao, P. S., and Cooke, J. P. (1996) Regression or progression Dependency on vascular nitric oxide. Arteriosclerosis Thrombosis and Vascular Biology 16, 44-50 61. Oomen, C. M., v an Erk, M. J., Feskens, E. J ., Kok, F. J., and Kromhout, D. (2000) Arginine intake and risk of coronary heart disease mortality in elderly men. Arteriosclerosis, Thrombosis & Vascular Biology 20, 21342139 62. Loscalzo, J. (2003) Adverse effe cts of supplemental L-arginine in atherosclerosis: consequences of me thylation stress in a complex catabolism? Arterioscler Thromb Vasc Biol 23, 3-5

PAGE 87

77 63. Walker, H. A., McGing, E., Fisher, I., Boger, R. H., B ode-Boger, S. M., Jackson, G., Ritter, J. M., and Cho wienczyk, P. J. (2001) Endotheliumdependent vasodilation is independent of the plasma L-arginine/ADMA ratio in men with stable angina: lack of effect of oral L-arginine on endothelial function, oxidative st ress and exercise performance. Journal of the American College of Cardiology 38, 499-505

PAGE 88

78 Paper II: Tumor necrosis factorreduces substrate availability for nitric oxide production via down-regulation of argininosuccinate synthase Bonnie L. Goodwin 1,2 Laura C. Pendleton 1 Monique M. Levy 1 Larry P. Solomonson 1 and Duane C. Eichler 1 1 Department of Biochemistry and Molecular Biology 2 Johnnie B. Byrd, Sr. Alzheimers Center and Research Institute, University of South Florida, College of Medicine, Tampa, FL 33612 Corresponding Author: Duane C. Eichler, Department of Biochemistry and Molecular Biology, University of South Florida, 12901 Bruce B. Downs Blvd., MDC7, Tampa, FL 33612, tel. 813-97 4-9716, fax. 813-974-7357, email: deichler@hsc.usf.edu

PAGE 89

79 SUMMARY Endothelial dysfunction associated with incr eased serum levels of tumor necrosis factor (TNF)observed in diabetes, obesity and congenital heart disease results, in part, from t he impaired production of endot helial nitric oxide (NO). Cellular NO production depend s absolutely on the availability of arginine, the substrate of endothelial nitric oxide synthas e (eNOS). In this report, evidence is provided demonstrating that treatment with tumor TNF(10 ng/ml) suppresses not only eNOS expression, but also the availability of ar ginine via the coordinate suppression of argininosuccinate synthas e (AS) expression in aortic endothelial cells. Western blot analysi s demonstrated a signif icant and dose dependent reduction of AS protein when treated with TNFwith a corresponding decrease in NO production. Reporter gene analysis demonstrated that the suppression of AS expression by TNFinvolves the proximal promoter, and EMSA analysis showed reduced binding to three essent ial Sp1 elements. Inhibitor studies showed that the repr ession of AS by TNFis mediated via the NF B signaling pathway. These findings demonstrate that TNFcoordinately down-regulates eNOS and AS expression, resulting in a severely impaired citrulline-NO cycle. The down-regulation of AS by TNFis an added insult to endothelial function due to its essential role in NO production and in endothelial viability.

PAGE 90

INTRODUCTION The endothelium plays a crucial role in the maintenance of vascular tone and structure. The major endothelium-derived vasoactive mediator is nitric oxide (NO) 1 which is formed from the amino acid precursor L-arginine by nitric oxide synthase (NOS). NO is involved in a wide variety of regulatory mechanisms of the cardiovascular system, including vascular tone (i.e, it is the major mediator of endothelium-dependent vasodilation), vascular structure (e.g., inhibition of smooth muscle cell proliferation), and cell-cell interactions in blood vessels (e.g., inhibition of platelet adhesion and aggregation, inhibition of monocyte adhesion) (1-3). Because of these functions, NO has been designated as an endogenous anti-atherosclerotic molecule (4-6). Dysfunction of the endothelial citrulline-NO cycle is a common mechanism by which several cardiovascular risk factors mediate their deleterious effects on the vascular wall (4-7). Among them are hypercholesterolemia, hypertension, smoking, diabetes mellitus, homocysteinemia, and vascular inflammation (4-7). In particular, the multi-functional cytokine tumor necrosis factor alpha (TNF-) has been linked to endothelial dysfunction in type 2 diabetes (8), obesity (9) and congenital heart failure (10, 11). Clinical studies have shown that elevated levels of plasma TNFin patients with type I diabetes are associated with cardiological risk factors (12). In vivo studies have also revealed that administration of TNFdepresses endothelium-dependent relaxation (13) and reduces levels of 80

PAGE 91

81 endothelial NO (14). The impairment of endothelial NO prod uction by TNFwas initially linked to the reduction in eNOS expression in bovine aortic endothelial cells (BAECs) (15-18). Therefore it is not surprising that impairment in endothelial NO production leads to endot helial dysfunction. In fact, loss of endotheliumderived NO is associated wit h the prothrombotic and hyperproliferative states present in hypertensive, diabetic and atherosclerotic states (19). Although the production of NO is directly related to the enzyme eNOS, overall production of NO by endot helial cells has been shown to be dependent on a functional citrulline-nitric oxide cycle (20-23). Both NO and citrulline are generated from arginine by eN OS. The NO is utilized in signaling, whereas, the citrulline is recycled back to arginine by two enzymes, AS and argininosuccinate lyase (AL), to complete the cycle. Argi ninosuccinate synthase (AS) catalyzes the rate-limiting step in the ar ginine regeneration side of t he citrulline-nitric oxide cycle (21), and appears to be coordinately regulat ed with eNOS activity (19, 24). DNA microarray analysis of shear stress-induced NO production has demonstrated up-regulation of AS (19, 25), supporting an important role for AS in endothelial NO production. More recent re sults from our laboratory using siRNA knockdown of AS expression demonstrated that AS is essential for both basal and stimulated endothelial NO production, even in the presence of excess arginine, as well as for maintenance of endot helial viability (20). A recent study of

PAGE 92

82 transgenic rat blood-brain barri er endothelial cells support ed our conclusions that regeneration of citrulline from intracellular arginine via AS provides the major arginine pool for stimulated NO producti on (26). Collectively, these results demonstrated the essential role of AS in endothelial NO production and endothelial cell viability. Thus, our work and the work from other laboratories has developed a strong evidential case su pporting the proposal that substrate availability, governed by arginine-regeneration as part of the citrulline-nitric oxide cycle, plays a key role in NO producti on thus affecting vascular endothelium function and viability (20-23). In this report, we demonstrate that TNF, which represses NO production in endothelial cells, does so, not only by down-regulating eNOS expression, but also by suppressing the avai lability of arginine. Moreov er, evidence is provided that the mechanism by which TNFtranscriptionally represses eNOS expression is mimicked in the down-regul ation of AS expressi on through similar transcriptional factors. Thus, TNFdepresses endothelial NO production via the coordinate down-regulati on of both eNOS and AS. EXPERIMENTAL PROCEDURES Cell Culture: Bovine aortic endothelial cells (BAEC ) were cultured in Dulbeccos modified Eagles medium (1 g/L glucose, Mediatech) containing 10% fetal bovine serum (Hyclone Laboratories), 100 units/ml penicillin and 100 g/ml streptomycin

PAGE 93

83 (Mediatech) at 37 C and 5% CO 2 For cytokine treatment, cells in control medium were treated with the indica ted concentrations of TNFfor up to 48 hours. Cell lysate preparation and immunoblotting: Following treatment, BAEC were removed from the plate with trypsin, washed in ice-cold phosphate-buffered saline (PBS) and resuspended in RIPA buffer (1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1X protease inhibitors in P BS) by vigorous pipetting followed by brief vortexing. The lysate was incubated on ice for 30 minutes and protein concentration was determined by bicinchoninic acid reagent (BCA) (Pierce). Ten g of protein were resolved on 415% polyacrylamide gels (BioRad) and blotted onto PVDF membranes (Immobilon-P). Western blotting was performed as previously described (27). Br iefly, membranes were blocked for 1 hour in 5% blocking solution (Bio-Rad) in TBS-T (20 mM Tr is-HCl, 137 mM NaCl, 0.1% Tween-20) and subsequently was hed in TBS-T. Membranes were incubated with primary ant ibody (1:2500 anti-AS (BD Transduction Labs), 1:1000 anti-GAPDH (Abcam), 1: 7500 anti-Actin (Sigma), 1:1000 anti-eNOS (Transduction Labs)) for 1 hour to overnight. Membranes were incubated with secondary antibody for 1 hour and signal was detected by chemiluminescence using ECL reagent (Amersham Bioscienc es) and exposed to film. Pre-stained protein markers were used for molecula r mass determination. Band intensities were quantitated using ImageQuant software (Molecular Dynamics).

PAGE 94

84 RNA isolation and qua ntitative RT-PCR: Total RNA was isolated using a modified guanidinium thiocyanate-phenol-c hloroform method using Tri Reagent according to the manufacturers reco mmendations (Sigma). RNA was treated with DNase (Ambion DNA-free) and quantitated prior to reverse transcription, which was performed as described previous ly (27). Real time quantitative PCR was performed using AS specific prim ers ASL228 and ASR278 (27). Results were normalized to 18S rRNA. Vector construction: Luciferase reporter construc ts were designed to include the AS promoter and 5-UTR up to the AUG start codo n cloned upstream of the luciferase gene. Left primer ASL-189 (5GCACTCGAGATCTGCAGGTGGCTGTGAA) was combined with ASRluc (5ATAGAATGGCGCCGGGCGTTTCTTTA TGTTTTTGGCGTCTTCCATCGTGACG GGTGACCAGCGGC) to amplify the AS promoter with an Xho I site on the 5 end and an Nco I site on the 3 end which were used to clone into the vector pGL3Basic (Promega) to create the plas mid p3ASP189. This strategy takes advantage of a Nco I site within the luciferase gene, close to the start codon, to allow for the AS 5-UTR to be cloned adjac ent to the start codon. For mutant constructs, mutations were made in the three Sp1 sites in the p3ASP189 construct using a three-way PCR me thod (28). Primers AS189mut1 (5CTCCAGGCGGGTTCCGGGCCCGGG-3), AS189mut2 (5CCGGGTTCGGGGTCTGTGGC-3) and AS189mut3 (5-

PAGE 95

85 ACCGGACCTGACCCCGGG-3) were combined with ASRluc to amplify fragments that contained the mutations. This PCR product was then used as a right primer and paired with ASL-189 to produce a second product. A third round of PCR was used with the second product as a template with primers ASL-189 and ASRluc to enrich for the target with the mutation in the center and the restriction sites Xho I and Nco I on either end for cloning into the pGL3Basic vector. Amplified products were purified after agarose gel electrophoresis and restriction digestion and ligated into pGL3Basic to create the mutated plasmids p3ASP189M1, p3ASP189M2 and p3ASP189M3. Al l constructs were verified by sequencing. Sp1 and Sp3 plasmids were a kind gift from Dr. Jonathan M. Horowitz at North Carolina State University. Luciferase Assay analysis: BAEC were plated at 2x10 4 cells per well in a 24 well plate twenty-four hours prior to tr ansfection. pRL-TK, a renilla expression vector, was used as an internal tran sfection control where indicated. Experimental plasmids (200 ng each) and pRL-TK (50 ng) were transiently transfected into BAEC using Transit-LT1 (Mirus) in serum free media. Media was replaced with complete media after 4 hour s and cells were cultured for 48 hours. Lysates generated with passive lysis bu ffer (Promega) were assayed for luciferase and renilla activity using a Dual-Luciferase Reporter Assay System (Promega) according to the manufactu rers recommendations. Luciferase and renilla activity were measured as relative light units using a luminometer (Turner

PAGE 96

86 Designs). Experiments were carried out th ree times in triplicate. Luciferase expression was normalized to renilla activity. Nuclear extract preparation: Nuclear extracts were prepared from BAEC as described previously (29) wit h the following modifications: Cells were plated in 10 cm dishes and treated once they reache d confluence. The culture monolayer was rinsed twice with PBS (phosphat e buffered saline), once with PBS containing 1mM Na 3 VO 4 and 5 mM NaF and once with 1X hypotonic buffer (20 mM HEPES, pH 7.9, 1 mM EDTA 1 mM EGTA, 20 mM NaF, 1 mM Na 3 VO 4 1 mM Na 4 P 2 O 7 1 mM DTT, and 1X protease inhibi tors (CalBiochem)). Cells were scraped into 1X hypotonic buffer containing 0.2% NP40 and resuspended by gentle pipetting. Samples we re centrifuged for 20 se conds at 12,000 x g at 4 C. The nuclear pellet was resuspended in high salt buffer (420 mM NaCl, 20 mM HEPES, pH 7.9, 1 mM EDTA, 1 mM EG TA, 20% glycerol, 20 mM NaF, 1 mM Na 3 VO 4 1 mM Na 4 P 2 O 7 1 mM DTT, and 1X protease inhibitors (CalBiochem)) and rotated for 30 minutes at 4 C. Samples were cent rifuged at 12,000 x g, 4 C for 20 minutes. Electrophoretic Mobility Shift Assay: Nuclear extracts were combined with or without cold competitors or specific antibodies and incubated for 20 minutes at room temperature. Probes were labe led by combining equimolar amounts of complementary oligonucleotides (2x10 -10 mols of each) which were heated to

PAGE 97

87 70 C and allowed to cool to room temperature slowly. The oligos were labeled using 10 l [ 32 P]dCTP (3000 Ci/mmol) and Klen ow enzyme and unincorporated label was removed using Nuc Away (Amb ion). The reaction mixture, composed of binding buffer (10 mM HEPES, pH 7.9, 10% glycerol, 1 mM DTT, 0.1 g/ l poly(dI:dC), 0.5 g/ l BSA and 4000 dpm/ l radiolabeled probe) and nuclear extract (5 g) in a total volume of 10 l, was incubated at 30 C for 30 minutes. Samples were loaded onto a 5% polyacrylam ide gel and run at 180 V. Gels were dried under vacuum and exposed to film. The oligonucleotides for EMSA analysis included Sp1 site 1 (5-GCTCCA GGCGGGGGCCGGGCCCGGGGGCG-3); Sp1 site 2 (5-GGCCGGGCCCGGGGGCGGGGTCT GTGGCGC-3); and Sp1 site 3 (5-CCGGTCACCGGCCCTGCCCCCGGGCCCTG-3); Nitric oxide assay: BAEC were treated wit h 10 ng/ml TNFin serum-free medium in the absence of phenol red and L-glutamine. A liquots were removed at the time points indicated and nitrite was measured in the medium as an indicator of cellular NO using a fluorometric met hod (30). Briefly, freshly prepared DAN was added to culture supernatant, mixe d immediately and incubated for 10 minutes. The reaction was stopped by add ing NaOH to a final concentration of 2.8 M. The samples were read on a BMG Fluostar Galaxy spectrofluorometer in a 96-well plate using the excitati on wavelength of 360 nm and emission wavelength of 405 nm. Cells were counted by trypan blue exclusion analysis and data is presented as quant ity of nitrite produced in pmols per 1 x 10 6 cells.

PAGE 98

88 Statistical Analyses: Experimental data is expre ssed as the mean +/SEM. Each experiment was performed indepen dently at least three times. RESULTS Coordinate reduction of AS an d eNOS expression by TNF- Previous results have indicated that the expression of AS is required for NO production and also for endothelial cell viability (20-23). Ther efore, we investigated whether AS expression was coordinately do wn-regulated with eNOS by TNFInitially, conditions were chosen that were known to suppress eNOS expression in BAEC (16, 31, 32). BAECs were treated with increasing co ncentrations of TNFand subsequently lysed and analyzed by western blotting. As shown in Figure 1A, TNF, treatment resulted in a dose-depen dent reduction of both eNOS and AS protein expression. For all subs equent experiments, 10 ng/mL of TNFwas used since at higher concentrations AS was not decreased further and cell viability was severely affected (data not shown). This concentration of TNFalso reasonably mimics serum levels foun d in the inflammatory environment of chronic disease states such as diabet es and obesity (6, 33-35). It is also important to note, that under these treatment conditions, t here was no apparent induction of iNOS (data not shown). To examine whether the decrease in AS protein that resulted from TNFtreatment correlated with a reduction in steady-state AS mRNA levels, total RNA

PAGE 99

89 was isolated and AS message quantitated by real-time RT-PCR. As shown in Figure 1B, TNFtreatment resulted in a 74% r eduction (P = 0.003) of AS mRNA that correlated with the r eduction of AS protein. Consistent with the reduction in both AS and eNOS protein expression, basal levels (unstimulated) of NO were reduc ed to 34% of controls (P = 0.01) when endothelial cells were treated with TNF(Figure 2). NO production was measured as nitrite using a fluorescent assay (30), and nitrite levels were normalized to the number of cells counted by trypan blue exclusion in order to account for cell viability. Regulation of the proxim al AS promoter by TNF To assess the effect of TNFon AS promoter activity, the reporte r construct p3ASP189 was used. Plasmid constructs were transiently transfected into BAECs and treat ed for 48 hours with increasing concentrations (0-10 ng/ml) of TNF. Luciferase expression was measured as relative luciferase units (RLU) and data presented as relative change in expression. As shown in Figure 3, TNFtreatment resulted in a dosedependent decrease in luciferase activity. Characterization of the cis-elements in the AS proximal promoter responsible for regulating AS expression Previous work characterizing the AS proximal promoter, which was shown to be repressed by TNFtreatment, was done in a

PAGE 100

90 human carcinoma cell line, RPMI2650 (36). In vitro DNase I footprinting with affinity-purified Sp1 ident ified three essential Sp1 binding sites that act synergistically to affect AS expression in a region 150 bp ups tream of the start codon (36). Further analysis of these site s by CAT assay determined that they acted independently to promote transcription in vivo (36). Ablation of the second Sp1 site led to the greatest reduction in promoter activity and was determined to be a high affinity binding site required for AS expres sion in RPMI2650 (36). To confirm these results and expand the kno wledge of regulation of the AS promoter specifically in endot helial cells, a luciferase repor ter construct containing the proximal 189 base pair r egion of the AS pr omoter which included the three identified Sp1 bind ing elements (p3ASP 189) was used. First, BAEC were cotransfected with p3ASP189 and either a control vector (pcDNA3), Sp1 or Sp3 expression plasmids and luciferase acti vity was monitored. Both Sp1 and Sp3 bind to the same element and can work together, or in opposit ion of each other on a single site (37). W hen Sp1 and Sp3 were over-e xpressed with the reporter construct, both transcription factors were ab le to activate the AS promoter to a similar extent (Figure 4A). To delineate the involvement of these Sp1/Sp3 elem ents individually in the control of AS expression in BAEC, eac h site was mutated independently. Mutation of the three Sp1 sites identified by Anderson, et al. (36) (site 1 (M1), site 2 (M2) and site 3 (M3)) resulted in a 60-94% decrease in AS promoter activity

PAGE 101

91 (Figure 4B), supporting the essential ro le of Sp1/Sp3 in AS expression. Anderson, et al. (36) identif ied a fourth Sp1 element t hat did not bind purified Sp1 by genomic footprinting. Mutation of this si te resulted in a 2-fold increase in AS promoter activity, indicating this site may also be involved in transcriptional suppression of the AS promoter in endothe lial cells (data not shown). Our results also indicated that site 3 is absolutely essential for AS expr ession in endothelial cells, in contrast to the results descri bed previously in RPMI 2650 cells (36). Regulation of the proximal AS promoter by TNF Anderson et al (16) showed that TNFmediated transcriptional suppressi on of eNOS via two Sp1-binding sites positioned in the prox imal eNOS promoter. These findings, combined with our results showing that TNFtreatment transcriptionally suppressed AS expression, led to the detailed examinat ion of the proximal region of the AS promoter to see if it was regulated similarly to the eNOS promoter to account for the apparent coordinate down-regul ation of both genes by TNF. To further define the locus regulated by the cytokine, the three S p1 sites in the proximal promoter were mutated. Mutation of tw o of the Sp1 sites (M1 and M2) restored luciferase activity to a sm all extent while mutation of Sp1 site 3 (M3) resulted in complete ablation of the TNFaffects (Figure 5). It is interesting to note that mutation of this site also reduced the pr omoter activity to less than 4% (Figure 4B). This is similar to the situation t hat has been identified in the eNOS promoter

PAGE 102

92 (16) where TNFacted to suppress promoter activity by reducing binding to an Sp1 site that is essential to basal eNOS promoter activity. TNFreduces Sp1 binding to AS promoter elements To investigate the effect of TNFon the binding of Sp factors to the basal promoter, BAEC were cultured in the presence or absence of 10 ng/ml TNFfor 15-60 minutes and nuclear extracts were isolated. Electrophoretic mobility shift analysis was carried out using labled oligonucleotides for each of the three Sp1 sequences combined with treated and untreated nuclear extracts Immunoperturbation studies using antibodies directed against Sp 1, Sp3 and Egr-1 indicat ed that Sp3 bound to all three elements while Sp1 bound to site 3 only (Figure 6 A-F). Although TNFreduced formation of the Sp1/3 complex at all three sites, it did not alter the binding pattern, indicating that a decrease in binding is responsible for the downregulation of the prom oter without a change in factor binding to that site. As shown in Figure 6, there is a significant time-dependent decrease in binding to Sp1 sites 1-3 probes in BAEC nuc lear extracts exposed to TNFtreatment (Figure 6). These results show that all three element s that bind Sp1/3 transcription factors (36) are affected by TNFtreatment. Role of NFB in signaling TNF--mediated suppression of AS TNFis known to activate the nuclear factor B (NF B) pathway in order to exert its proinflammatory effects (38). Activation of kinases known as IKKs results in the

PAGE 103

93 phosphorylation of I B, an inhibitory protein that complexes with NF B in the cytoplasm and blocks its entry into an d action within the nucleus. The phosphorylation of I B targets the protein for degradat ion (39) and results in an increased nuclear localization of NF B and subsequent gene regulation. Previous work in B AEC has demonstrated TNF-mediated, time-dependent reduction in I B reflecting degradation of the in hibitor and activation of the NF B signaling pathw ay (16). TNFhas also been shown to stimulate the translocation of NF B to the nucleus in BAEC (40). To demonstrate the involvement of NF B in signaling the TNF-dependent down-regulation of AS expression, the NF B inhibitor Bay-7082 was used in an attempt to block TNF-mediated AS expression. Endothelia l cells were treated with TNFin the presence or absence of the NF B inhibitor BAY-7082. Whole cell lysates were isolated and subjected to western blot analysis. Figure 7A-B show that NF B inhibitors blocked the down-regulat ion of AS expression by TNF. To investigate this further, BAECs were transiently tr ansfected with the vector pGL3-AS189 and treated with TNFin the presence and absence of the inhibitor. Treatment with BAY-7082 inhibited the suppression of t he AS promoter activity by TNF(Figure 7C) further supporting the role of NF B in signaling the TNFmediated transcriptional suppression of AS expression.

PAGE 104

94 DISCUSSION TNFis a multifunctional cytokine involved in the regulation of important physiological functions including the dev elopment of tissues, the coordinate activation of immune responses, and in t he onset and progressi on of pathological conditions (41, 42). TNFhas been linked to insulin resistance (19) by directly inhibiting insulin signaling and is known to contribut e to endothelial dysfunction in type 2 diabetes (8), obesity (9) and congenital heart failure (10). This proinflammatory cytokine has also been implicated in the pathogenesis of cardiovascular diseases such as c ongestive heart failure, acute myocardial infarction, myocarditis and dilated cardiomyopathy (43). Serum TNFlevels are elevated in patients with congestive heart failure (44). In fact, incubation of endothelial cells with serum from patients with congestive heart failure was shown to down-regulate eNOS expression in a TNF-dependent manner (11). Other studies have shown that TNFadministration in vivo depresses endothelium-dependent relaxati on (13) and reduces levels of endothelial NO (14). Recent reports by our laboratory and others have sparked new interest relative to the function and regulation of AS in endothelia l NO production (20, 21, 26). As reported previously by our laboratory and others (20, 21, 45), AS is essential for the regeneration of arginine required for endothelial NO production, even in the presence of excess exogenous arginine. Thus, the capacity of end othelial cells to

PAGE 105

95 sustain NO production is severely limited not only by the down-regulation of eNOS (16, 18, 31), but also by the availability of arginine provided by AS via the citrullinenitric oxide cycle. Coordinate up-regulation of AS and eNOS expression has been identified previously in a number of systems ( 19, 24). For example, AS and eNOS are coordinately induced in the aorta of diabetic rats following streptozotocin treatment (24). TGF1 induces both enzymes in human umbilical vein endothelial cells (24) In addition, sheer stre ss induces both AS and eNOS mRNA expression (19). In the pres ent study, both eNOS and AS protein expression were found to be co ordinately down-regulated by TNFin cultured bovine aortic endothelial cells. A mode l can be proposed whereby TNFreduces endothelial NO production by both a down-regulation of eNOS expression and also by reduction in subs trate availability via the down-regulation of AS expression (F igure 8). Although TNFalso has the potential to upregulate iNOS expression, previous work has shown that TNFeffects on iNOS expression in endothe lial cells under the c onditions used, is negligible (16, 32, 46, 47). AS expression was significantly reduced at levels of TNFfound in an inflammatory environment caused by chro nic disease states such as diabetes and obesity. Not surprisingly, the loss of eNOS and AS protein expression was accompanied by a dramatic decreas e in the capacity of the TNF-treated cells to produce NO. Transcriptionally, eNOS is down-regulated via reduced binding to

PAGE 106

96 two Sp1 elements which are required for basal promoter activity (16). A strikingly similar situation was identifi ed in the AS promoter. TNF-mediated suppression of the AS promoter was f ound to be through Sp1 site 3, which is required for basal AS promoter activity. Site 3 was t he most important site regulated by TNF, as is the case for eNOS. In cultured endothelial cells, NF B resides in the cytoplasm and is associated with an inhibitory protein, I B (48, 49). Inflammatory cytokines, such as TNF, activate IKKs which phosphorylate I B, targeting I B for degradation. As a result, NF B translocates to the nucleus where it transcriptionally provokes a proinflammatory response. Previous work in BAECs showed that TNFsignaled a time-dependent reduction in I B expression in endothelia l cells (16) resulting in NF B mediated inhibition of the eNOS pr omoter (16). More recently, activation of NF B by IL-1 was also shown to suppress AS expression at the transcriptional level via a functional NF B site (50). Interestingly, we did not find this NF B binding site to be necessary for the suppression of the proximal AS promoter by TNF, although binding to this element was increased by TNFtreatment as indicated by gel shift anal ysis (data not shown). Rather, we have shown that TNFregulates AS transcription through reduced binding of the transcription factors Sp1 and Sp3, consistent with the findings of Anderson et al (36) showing that Sp1/3 elem ents in the proximal prom oter are required for basal AS expression. More import antly, though, was our finding that the regulation of

PAGE 107

97 the AS promoter by TNFthrough an Sp1/3 element was similar to that reported for the TNF-mediated down-regulation of the eNOS promoter (16). Therefore, the expression of AS and eN OS, both essential component s of the citrulline-NO cycle, are coordinately down-regulated by TNFthrough decreased binding at a proximal Sp1 element that is required for basal promoter activity for both genes (16). Thus, overall, the results of this paper provide additional evidence as to how an increase in TNFwhich is associated with a number of disease states, decreases the production of NO through enzyme and substrate depletion, and as a consequence promotes endothelial dysfunct ion. Because the intracellular pool of arginine that is dire cted to NO production is main tained by the recycling of citrulline to arginine this may suggest a novel therapeutic target to improve endothelial function (51). This concept su ggests that drugs designed to reduce TNFexpression may restore endothelial func tion at two levels, one by restoring substrate availability for NO production, and two, by restoring the enzyme, eNOS, which catalyzes the production of NO. FOOTNOTES *This work was supported by the American Heart Association, Florida Affiliate Grant 0455228B.

PAGE 108

98 1 Abbreviations used include: NO, nitric oxide eNOS, endothelial nitric oxide synthase; TNF, tumor necrosis factor; AS, argininosuccinate synthetase; AS, argininosuccinate lyase; NFkB, nucle ar factor kB; BAE C, bovine aortic endothelial cell;

PAGE 109

99 Figure 1: Specific reduction of AS pr otein and mRNA by TNF. At confluence BAEC were incubated wit h 0 (lane 1), 0.1(lane 2) 1 (lane 3) or 10 (lane 4) ng/ml TNFfor 24 hours. (A) Cell lysates were prepared, 10 g of each sample was loaded onto an SDS polyac rylamide gel and standard western blotting performed. Anti-AS, anti-eNOS and anti-GAPDH antibodie s were used to detect the amount of protei n present. These results are representative of three independent experiments. (B) BAEC were untreated (U) or treated (T) with 10 ng/ml TNF. Total RNA was isolated using Tri Reagent (Sigma) and reverse transcribed with Superscript II (Invitrogen). AS message wa s detected using real time quantitative RT-PCR. Results were normalized to 18S rRNA and represent the average the standard erro r of the mean.

PAGE 110

100

PAGE 111

101 Figure 2: TNFreduces endothelial NO production. BAEC were untreated (U) or treated (T) with 10 ng/ml TNFfor 24 hours. Subsequently media was collected at time points 0 and 24 hours. NO was measured as nitrite produced/1x10 6 cells. (Nitrite is a stable reaction product of NO and molecular oxygen.) Results are expresse d as NO produced per 1x10 6 cells and error bars represent the standard error of the mean.

PAGE 112

TNF(ng/ml) UT NO produced per 106 cells (Percent of Control) 020406080100120 102

PAGE 113

103 Figure 3: TNFreduces AS proximal promoter activity. BAEC were transiently transfected wit h the AS promoter constr uct p3ASP189 and treated with increasing concentrations of TNF(0-10 ng/ml). Results are presented as relative luciferase activity and represent the average the standard error of the mean of at least four experiments conducted in triplicate.

PAGE 114

01510 Relative Luciferase Units 0.00.20.40.60.81.01.2 TNF(ng/ml) 104

PAGE 115

105 Figure 4: Characterizati on of the AS promoter. (A) BAEC were transiently cotransfected with p3ASP189 and either pcDNA3, pC MVSp1 or pCMVSp3. Luciferase activity was assayed 48 hour s after transfection. (B) p3ASP189 was mutated in three Sp1 tran scriptional elements. Vector s were transfected into BAEC and luciferase activity was det ected 48 hours later. All results are presented as fold luciferase activity rela tive to p3ASP189. Erro r bars indicate the standard error of the mean of at least th ree experiments conducted in triplicate.

PAGE 116

Relative Luciferase Units 0.00.20.40.60.81.01.2 M3M2M1WT A XXX123 Sp1 sitesB Relative Luciferase Units 0246810 Sp3Sp1pcDNA3 106

PAGE 117

107 Figure 5: TNFdown-regulates AS promoter activity via Sp1 site 3. Vectors containing mutations in the Sp1 bind ing elements (M1-M3) of p3ASP189 were transfected into BAEC and were either le ft untreated (U) or treated (T) with 10 ng/ml TNF. Results are presented as relative luciferase activity and represent the average the standard error of the mean of at leas t four experiments conducted in triplicate.

PAGE 118

UTUTUTUT Relative Luciferase Units 0.00.20.40.60.81.01.21.41.6 189M2M3M1 108

PAGE 119

109 Figure 6: TNFreduces binding to Sp1 sites. (A-F) Electrophoretic mobility shift assays were performed using nucle ar extracts prepar ed from untreated BAEC. Oligonucleotide probes contained the three Sp1 elem ents of the proximal AS promoter sequence: site 1 (A and D), site 2 (B and E), site 3 (C and F). Antibodies were used to determine the pr oteins binding to each site. For each oligonucleotide probe, extracts were incubated without antibody (N), two different Sp1 antibodies, an Sp3 antibody and an Eg r-1 antibody. Spot density for each graph is presented un derneath each radiograph (D, E, F). (G-L) Electrophoretic mobility shift assays were performed usi ng nuclear extracts prepared from BAEC treated with 10 ng/ml TNFfor 0, 15, 30, and 60 minutes. Probe only is presented in lane 1 (P). O ligonucleotide probes used contained the three Sp1 elements of the proximal AS promoter sequence: site 1 (G and J), site 2 (H and K), site 3 (I and L). Spot density fo r each graph is presented underneath each radiograph (J, K, L).

PAGE 120

110

PAGE 121

111 Figure 7: The NF B inhibitor BAY-7 082 blocks the effect of TNFon AS expression and promoter activity. (A) Confluent BAEC were cultured in complete media containing vehicle alone (DMSO) (lane 1) or 10 ng/ml TNFwith (lane 2) or without (lane 3) 10 M BAY-7082. Twenty-fo ur hours following treatment, lysates were prepared and 10 g protein was loaded onto an SDSPAGE gel. Western blot analysis was per formed as described in detail under Experimental Procedures. Spot densit y analysis is shown in (B). (C) BAEC were transfected with p3ASP189. Cells we re treated with vehi cle alone (lane 1), or 10 ng/ml TNFwith 0, 5 and 10 M BAY-7082 (lanes 2-4 respectively) for 48 hours. Cell extracts were subsequently assayed for luciferase activity. Normalized luciferase activity is presented as fold increase over control conditions. Data represents the average the standard error of the mean of assays performed in triplicate in three independent experiments.

PAGE 122

112

PAGE 123

113 Figure 8: The Citrulline NO Cycle. Circulating effectors in the serum, such as acetylcholine, serotonin, thrombin and brad ykinin, signal the pr oduction of NO via up-regulation of the citrulli ne NO cycle. NO then diffuses into the smooth muscle layer and induces relaxation of the vessel wall. In the endothelial cell, argininosuccinate synthase (AS) and argi ninosuccinate lyase (AL) catalyze the generation of arginine from citrulline and as partate. This arginine is utilized by endothelial nitric oxide synthase (eNOS) to produce NO and citrulline. TFNdown-regulates NO production by dec reasing eNOS and AS expression.

PAGE 124

114

PAGE 125

115 REFERENCES 1. Garg, U. C., and Hassid, A. (1989) Nitric oxide-generating vasodilators and 8-bromo-cyclic guanos ine monophosphate inhibit mitogenesis and proliferation of cultured ra t vascular smooth muscle cells. J Clin Invest 83, 1774-1777 2. Kubes, P., Suzuki, M., and Granger, D. N. (1991) Nitric oxide: an endogenous modulator of leukocyte adhesion. Proc Natl Acad Sci U S A 88, 4651-4655 3. Palmer, R. M., Ferrige, A. G., and Moncada, S. ( 1987) Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature 327, 524-526 4. Luscher, T. F., and Barton, M. (1997) Biology of the endothelium. Clin Cardiol 20, II-3-10 5. Kinlay, S., Libby, P., and Ganz P. (2001) Endothelial function and coronary artery disease. Curr Opin Lipidol 12, 383-389 6. Harrison, D. G. (1997) Cellular and molecular mechanisms of endothelial cell dysfunction. J Clin Invest 100, 2153-2157

PAGE 126

116 7. Vallance, P., and Chan, N. (2001) E ndothelial function and nitric oxide: clinical relevance. Heart 85, 342-350 8. Pfeiffer, A., Janott, J., Mohlig, M. Ristow, M., Rochlitz, H., Busch, K., Schatz, H., and Schifferdecker, E. ( 1997) Circulating tumor necrosis factor alpha is elevated in male but not in female patients with type II diabetes mellitus. Horm Metab Res 29, 111-114 9. Winkler, G., Lakatos, P., Salamon, F., Nagy, Z., Speer, G., Kovacs, M., Harmos, G., Dworak, O., and Cseh, K. (1999) Elevated serum TNF-alpha level as a link between endothelial dysfunction and insulin resistance in normotensive obese patients. Diabet Med 16, 207-211 10. Fichtlscherer, S., Rossig, L., Br euer, S., Vasa, M., Dimmeler, S., and Zeiher, A. M. (2001) Tumor necrosi s factor antagonism with etanercept improves systemic endothelial vasoreactivity in patients with advanced heart failure. Circulation 104, 3023-3025 11. Agnoletti, L., Curello, S ., Bachetti, T., Malacarne, F., Gaia, G., Comini, L., Volterrani, M., Bonetti, P., Parrinello, G., Cadei, M., Grigolato, P. G., and Ferrari, R. (1999) Serum from pat ients with severe heart failure downregulates eNOS and is proapoptotic: role of tumor necrosis factoralpha. Circulation 100, 1983-1991 12. Lechleitner, M., Koch, T., Hero ld, M., and Hoppichler, F. (1999) Relationship of tumor necrosis factor-alpha plasma levels to metabolic control in type 1 diabetes. Diabetes Care 22, 1749

PAGE 127

117 13. Wang, P., Ba, Z. F., and Chaudry, I. H. (1994) Admini stration of tumor necrosis factor-alpha in vivo depre sses endothelium-dependent relaxation. Am J Physiol 266, H2535-2541 14. Johnson, A., Phelps, D. T., and Ferro T. J. (1994) Tumor necrosis factoralpha decreases pulmonary artery endothelial nitrovasodilator via protein kinase C. Am J Physiol 267, L318-325 15. Mohamed, F., Monge, J. C., Gordon, A., Cernac ek, P., Blais, D., and Stewart, D. J. (1995) Lack of role for nitric oxide (NO) in the selective destabilization of endothelial NO synthase mRNA by tumor necrosis factor-alpha. Arterioscler Thromb Vasc Biol 15, 52-57 16. Anderson, H. D., Rahmutula, D ., and Gardner, D. G. (2004) Tumor necrosis factor-alpha inhibits endothe lial nitric-oxide synthase gene promoter activity in bov ine aortic endothelial cells. J Biol Chem 279, 963969 17. Yoshizumi, M., Perrella, M. A., Bur nett, J. C., Jr., and Lee, M. E. (1993) Tumor necrosis factor downregulates an endothelial nitric oxide synthase mRNA by shortening its half-life. Circ Res 73, 205-209 18. Alonso, J., Sanchez de Miguel, L ., Monton, M., Cas ado, S., and LopezFarre, A. (1997) Endothelial cytosolic pr oteins bind to the 3' untranslated region of endothelial nitric oxide syn thase mRNA: regulation by tumor necrosis factor alpha. Mol Cell Biol 17, 5719-5726

PAGE 128

118 19. Chan, B. P., Reichert, W. M., and Truskey, G. A. (2004) Synergistic effect of shear stress and streptavidin-bio tin on the expression of endothelial vasodilator and cytoskeleton genes. Biotechnol Bioeng 88, 750-758 20. Goodwin, B. L., Solomonson, L. P., and Eichler, D. C. (2004) Argininosuccinate synthase expression is required to maintain nitric oxide production and cell viability in aortic endothelial cells. J Biol Chem 279, 18353-18360 21. Xie, L., and Gross, S. S. (1997) Argininosuccinate synthetase overexpression in vascular sm ooth muscle cells potentiates immunostimulant-induced NO production. J Biol Chem 272, 16624-16630 22. Xie, L., Hattori, Y., Tume, N., and Gross, S. S. ( 2000) The preferred source of arginine for high-output nitric oxide synthesis in blood vessels. Semin Perinatol 24, 42-45 23. Hattori, Y., Campbell, E. B., and Gr oss, S. S. (1994) Argininosuccinate synthetase mRNA and activity ar e induced by immunostimulants in vascular smooth muscle. Role in the regeneration or arginine for nitric oxide synthesis. J Biol Chem 269, 9405-9408 24. Oyadomari, S., Gotoh, T., Aoyagi, K ., Araki, E., Shichi ri, M., and Mori, M. (2001) Coinduction of endothelial nitric oxide synthase and arginine recycling enzymes in aorta of diabetic rats. Nitric Oxide 5, 252-260

PAGE 129

119 25. McCormick, S. M., Eskin, S. G., McIn tire, L. V., Teng, C. L., Lu, C. M., Russell, C. G., and Chittur, K. K. (2001) DNA microarray reveals changes in gene expression of shear stressed human umbilical vein endothelial cells. Proc Natl Acad Sci USA 98, 8955-8960 26. Shen, L. J., Beloussow, K., and Shen, W. C. (2005) Accessibility of endothelial and inducible nitric oxide synt hase to the intracellular citrullinearginine regeneration pathway. Biochem Pharmacol 69, 97-104 27. Pendleton, L. C., Goodwin, B. L., Flam, B. R., Solomonson, L. P., and Eichler, D. C. (2002) Endothelial argininosuccinate synthase mRNA 5untranslated region diversit y. Infrastructure for tissue-specific expression. J Biol Chem 277, 25363-25369 28. Pendleton, L. C., Goodwin, B. L., Solomonson, L. P., and Eichler, D. C. (2005) Regulation of E ndothelial Argininosuccinat e Synthase Expression and NO Production by an Upstr eam Open Reading Frame. J Biol Chem 280, 24252-24260 29. Yu, C. L., Meyer, D. J., Campbell, G. S., Larner, A. C., Carter-Su, C., Schwartz, J., and Jove, R. (1995) E nhanced DNA-binding activity of a Stat3-related protein in cells tr ansformed by the Src oncoprotein. Science 269, 81-83 30. Misko, T. P., Schilling, R. J., Salvem ini, D., Moore, W. M., and Currie, M. G. (1993) A fluorometric assa y for the measurement of nitrite in biological samples. Anal Biochem 214, 11-16

PAGE 130

120 31. Sanchez de Miguel, L., Alonso, J ., Gonzalez-Fernandez, F., de la Osada, J., Monton, M., Rodriguez-Feo, J. A., Guerra, J. I., Arriero, M. M., Rico, L., Casado, S., and Lopez-Farre, A. ( 1999) Evidence that an endothelial cytosolic protein binds to the 3-unt ranslated region of endothelial nitric oxide synthase mRNA. J Vasc Res 36, 201-208 32. Zhang, J., Patel, J. M., Li, Y. D., and Block, E. R. (1997) Proinflammatory cytokines downregulate gene expression and activity of constitutive nitric oxide synthase in porcine pulmonary artery endothelial cells. Res Commun Mol Pathol Pharmacol 96, 71-87 33. Zinman, B., Hanley, A. J., Harris, S. B., Kwan, J., and Fantus, I. G. (1999) Circulating tumor necrosis factor-alpha concentrations in a native Canadian population with high rates of type 2 diabetes mellitus. J Clin Endocrinol Metab 84, 272-278 34. Nilsson, J., Jovinge, S., Niemann, A., Reneland, R., and Lithell, H. (1998) Relation between plasma tumor necrosis factor-alpha and insulin sensitivity in elderly men with non -insulin-dependent diabetes mellitus. Arterioscler Thromb Vasc Biol 18, 1199-1202 35. Hotamisligil, G. S., Shargill, N. S., and Spiegelman, B. M. (1993) Adipose expression of tumor necrosis factor-a lpha: direct role in obesity-linked insulin resistance. Science 259, 87-91

PAGE 131

121 36. Anderson, G. M., and Freytag, S. O. (1991) Synergistic activation of a human promoter in vivo by transcription factor Sp1. Mol Cell Biol 11, 19351943 37. Suske, G. (1999) The Sp-family of transcription factors. Gene 238, 291300 38. Baud, V., and Karin, M. (2001) Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol 11, 372-377 39. Chen, Z., Hagler, J., Palombella, V. J., Melandri, F., Scherer, D., Ballard, D., and Maniatis, T. (1995) Signalinduced site-specific phosphorylation targets I kappa B alpha to the ubiquitin-proteasome pathway. Genes Dev 9, 1586-1597 40. Gonzalez-Fernandez, F., Jimenez, A., Lopez-Blaya, A., Velasco, S., Arriero, M. M., Celdran, A., Rico, L., Farre, J., Casado, S., and LopezFarre, A. (2001) Cerivastatin prevents tumor necrosis factor-alpha-induced downregulation of endothelial nitric ox ide synthase: role of endothelial cytosolic proteins. Atherosclerosis 155, 61-70 41. MacEwan, D. J. (2002) TNF recept or subtype signalling: Differences and cellular consequences. Cell Signal 14, 477-492 42. MacEwan, D. J. (2002) TNF ligands and receptors a matter of life and death. Br J Pharmacol 135, 855-875

PAGE 132

122 43. Neumann, F. J., Ott, I., Gawaz, M., Richardt, G., Holz apfel, H., Jochum, M., and Schomig, A. (1995) Cardiac rel ease of cytokines and inflammatory responses in acute myocardial infarction. Circulation 92, 748-755 44. Torre-Amione, G., Kapadia, S., Lee, J., Durand, J. B., Bies, R. D., Young, J. B., and Mann, D. L. (1996) Tumor necrosis factor-alpha and tumor necrosis factor receptors in the failing human heart. Circulation 93, 704711 45. Flam, B. R., Hartmann, P. J., Harr ell-Booth, M., Solo monson, L. P., and Eichler, D. C. (2001) Caveolar localization of ar ginine regeneration enzymes, argininosuccinate synthase, and lyase, with endothelial nitric oxide synthase. Nitric Oxide 5, 187-197 46. Wagner, A. H., Schwabe, O., and Hecker, M. (2002) Atorvastatin inhibition of cytokine-inducible nitric oxide sy nthase expression in native endothelial cells in situ. Br J Pharmacol 136, 143-149 47. Wen, J. K., and Han, M. (2000) Comparative st udy of induction of iNOS mRNA expression in vascular ce lls of different species. Biochemistry (Mosc) 65, 1376-1379 48. Barnes, P. J., and Karin, M. ( 1997) Nuclear factor-kappaB: a pivotal transcription factor in chr onic inflammatory diseases. N Engl J Med 336, 1066-1071

PAGE 133

123 49. Beg, A. A., and Baldwin, A. S. Jr. (1993) The I kappa B proteins: multifunctional regulators of Rel/ NF-kappa B transcription factors. Genes Dev 7, 2064-2070 50. Brasse-Lagnel, C., Lavoinne, A., Fa irand, A., Vavasseur, K., and Husson, A. (2005) IL-1beta stimulates argininosuccinate synthetase gene expression through NF-kappaB in Caco-2 cells. Biochimie 87, 403-409 51. Wu, G., and Meininger, C. J. (2000) Arginine nutrition and cardiovascular function. J Nutr 130, 2626-2629

PAGE 134

124 Paper III: PPAR agonists stimulate the citrullineNO cycle through coordinate upregulation of argininosuccinate synt hase and endothelial nitric oxide synthase Bonnie L. Goodwin 1,2 Monique M. Levy 1 Larry P. Solomonson 1 and Duane C. Eichler 1 1 Department of Biochemistry and Molecular Biology and 2 Johnnie B. Byrd, Sr. Alzheimers Center and Research Institute, University of South Florida, College of Medicine, Tampa, FL 33612 Corresponding Author: Duane C. Eichle r, Deptartment of Biochemistry and Molecular Biology, University of South Florida, 12901 Bruce B. Downs Blvd., MDC7, Tampa, FL 33612, Tel. (813) 974-9716; Fax. (813) 974-7357; E-mail: deichler@hsc.usf.edu

PAGE 135

125 SUMMARY Impaired NO production has been associat ed with endothelial d ysfunction in a number of disease states including diabet es, hypertension, atherosclerosis, and heart failure. Previous work in our labor atory has demonstrated that the arginine utilized in the production of endothelial NO is maintained through the recycling of citrulline by the enzymes argininosucci nate synthase (AS) and argininosuccinate lyase. In the present study we demonstrate t hat exposure of endo thelial cells to the peroxisome proliferator-a ctivated receptor gamma (PPAR agonists troglitazone and ciglitazone coordinat ely induces NO production and AS expression. An increase in AS protein was detected by western blot analysis while real time quantitative PCR demons trated a corresponding increase in AS mRNA. The increase in AS mRNA was blocked with the transcriptional inhibitor 1-D-ribofuranosylbenzimidazole (DRB), indicating that PPAR agonists act at the level of transcription. A PPAR response element was identified in the distal AS promoter. Reporter gene assays and EMSA analysis confirmed this element was responsible for the PPAR agonist-mediated increase in AS promoter activity. Interestingly, PPAR agonists were shown to re store AS expr ession and NO production following down-regulation by TNF, an inflammatory cytokine associated with endothelial dysfunction. Over all, this study defines a molecular mechanism whereby PPAR agonists improve endothelia l function by increasing the availability of arginine through the up-regulation of AS expression. This study

PAGE 136

126 also provides additional support for the essential role of arginine regeneration in maintaining endothelial NO production. INTRODUCTION Nitric oxide (NO) is produced in the endothelium in response to circulating effectors such as bradykinin. It then di ffuses into the smooth muscle layer and induces relaxation of the vessel wall. In endothelial cells the pr imary role of AS and AL is in the generation of arginine, whic h is utilized by endothelial nitric oxide synthase (eNOS) to produce NO and citrul line. Although both extracellular and intracellular concentrations of arginine are much higher than the reported K m of arginine for eNOS, NO production still appear s to be limited by the availability of arginine (1-8). Recent results from our laboratory have demonstrated the importance of argininosuccinate synthase ( AS) in the maintenance of basal and stimulated endothelial NO production via arginine regener ation as well as in the viability of the endothelial ce ll (9). Reduced levels of endothelial NO have been associated with several medical conditions such as hypertension, heart failure, atherosclerosis and diabetes (10). Thus, t he regulation of AS, as it relates to arginine regeneration and NO production in endothe lial cells has gained considerable importance. Peroxisome proliferator-act ivated receptor gamma (PPAR ) is a member of the nuclear receptor superfamily of ligand-activated transcription factors. PPAR is involved in transcription of genes invo lved in lipid metabolism (11-14),

PAGE 137

127 differentiation (11, 14) and cell growth (15) It is required for adipose, kidney and placental development, and knockout of PPAR results in embryonic lethality (16). Both naturally derived ligands, incl uding a number of fatty acid metabolites such as eicosanoid derivatives (11) and 15-deoxy12,14 -prostaglandin J 2 (15dPGJ 2 ) (17, 18), as well as synthetic ligands have been described. Thiazolidinediones (TZDs), a group of synthetic PPAR agonists, provide cardiovascular benefits in addition to their well-known insulin-sensitizing properties. Moreover, TZDs have a number of cardioprotective properties such as the reduction of blood pressure in mammalian models (19-21) and diabetic patients (22) and an improvem ent in vasodilation in hum an patients (23). In addition, TZDs reduce lesion formation in animal models of atherosclerosis (2427). These anti-diabetic compounds are also known to counter the effects of the inflammatory response related to elevated serum levels of tumor necrosis factor alpha (TNF), which contribute to endothelial dysfunction ( 28, 29). Finally, TZDs improve flow-mediated vasodilation and decrease vascular smooth muscle cell activation, in part, by stimulating endot helial NO production without inducing eNOS protein expression (30, 31). A recent report links the stimulation of endothelial NO production by PPAR agonists to a reduction in superoxide through the suppression of NADPH oxi dase and induction of super oxide dismutase, resulting in an enhanced bioav ailability of endothel ial NO (32). An additional mechanism by which PPAR agonists could increase endothelial NO production is through the up-r egulation of AS expression and thus an increase in

PAGE 138

128 the regeneration of argini ne by AS and AL. Since it has been shown in many disease states that arginine availability for NO production bec omes limiting, we examined in this report whether PPAR agonists may promote arginine regeneration and relieve, in part, impairment of NO production. EXPERIMENTAL PROCEDURES Cell Culture: Bovine aortic endothelial cells (BAEC) were cultured in complete Dulbeccos modified Eagles medium (DMEM)(1 g/L glucose, Mediatech) which contained 10% fetal bovine serum (Hyclone Laboratories), 100 un its/ml penicillin and 100 g/ml streptomycin (Mediatech) at 37 C and 5% CO 2 For TZD treatment, cells in complete DMEM were treated wit h the indicated concentrations of drug for up to 24 hour s as indicated in the figure legends. Western blot analysis: Following treatment with TZDs, TNFor both, as indicated in the figure legends, BAEC were harvested in 500 l PBS, centrifuged briefly and lysed in RIPA buffer (1% NP40, 0.5% sodium deo xycholate, 0.1% SDS, 1X protease inhibitors in PBS) by vigorous pipetting followed by brief vortexing. The cell lysate was inc ubated on ice for 30 minutes and protein concentration was determined by BCA reagent (Pierce). Ten g of protein was electrophoresed on 4-15% polyacrylamide gels (Bio-Rad) and transferred onto polyvinylidene difluoride transfer memb rane (Immobilon-P). Membranes were incubated with antibody (1 :2500 anti-AS (BD Transduction Labs)), 1:1000 antiGAPDH, 1:1000 anti-eNOS (Transduction Labs )) in 5% blocking solution (Bio-

PAGE 139

129 Rad) in TBS-T (20 mM Tris-HCl, 137 mM NaCl, 0.1% Tween-20) and subsequently washed in TBS-T. Membr anes were incubated with horseradish peroxidase-conjugated anti-rabbit or antimouse antibody for 1 h, washed with TBS-T, immersed in ECL reagent for 1 minute and then exposed to film. Prestained protein markers were used for molecular mass determination. Band intensities were quantitated using ImageQuant software (Molecular Dynamics). RNA isolation and quantitative RT-PCR: Total RNA was isolated using Tri Reagent following the manufacturers instructions (Sigma). RNA was treated with DNase (Ambion DNA-free). Five hundred ng of RNA was reverse transcribed using Superscript II as descr ibed previously (33). Real time quantitative PCR was performed using AS specific primers ASL228 and ASR278 (33). Results were normalized to 18S rRNA. Vector construction: Luciferase reporter construc ts were designed to include the AS promoter and 5-UTR up to the AUG start codo n cloned upstream of the luciferase gene. Luciferase reporte r construct p3ASP189 was described previously (9). Left primer ASL-2616, (5GCACTCGAGGAAAGTCAAAGGCCATGGTG) was combined with ASRluc (5ATAGAATGGCGCCGGGCGTTTCTTTA TGTTTTTGGCGTCTTCCATCGTGACG GGTG ACCAGCGGC) to amplif y the AS prom oter with an Xho I site on the 5 end and an Nco I site on the 3 end which were used to clone into the vector pGL3Basic (Promega) and create the vector p3ASP2616. For mutant constructs,

PAGE 140

130 mutations were made in the PPRE site s in the ASL-189 construct using a threeway PCR method (34). Primer PPREmut (5GCTGGTCTTGATCTCCTGATCTCAGGTGA) was combined with primer ASRluc to amplify a fragment that contained the mutations. This PCR product was then used as a right primer and paired wit h ASL-2616 to produce a second product. A third round of PCR was used with the sec ond product as a template with primers ASL-2616 and ASRluc to enrich for the target. Amplified products were purified after restriction digestion and agarose gel electrophoresis and ligated into pGL3Basic to create the mutated plasmi ds p3ASP2616PPREmut. All constructs were verified by sequencing. Luciferase Assay analysis: BAEC were cultured as described above and plated in a 24 well plate prior to transfection. Experimental plasmids (200 ng each) and renilla control plasmid pRL-TK (50 ng) were transiently transfected into BAEC using Transit-LT1 (Mirus) in serum free media. All results were normalized to renilla expression. After 4 hours liposomes were removed and cells were cultured for an additional 48 hr in me dia containing troglitazone or ciglitazone. Cells were lysed using passive lysis buffer (Promega). Ten l lysate was assayed for luciferase and renilla activity using a Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer s instructions. Luciferase and renilla activity were measured as relative light units (RLUs) using a luminometer (Turner Designs). Each data point is the result of at least three independent experiments performed in triplicate.

PAGE 141

131 Nuclear extract preparation: Nuclear extracts were prepared from BAEC as described previously (35, 36). Briefly, confluent m onolayers were treated with troglitazone for 6 h. The culture monolay er was rinsed twice with PBS, once with PBS containing 1mM Na 3 VO 4 and 5 mM sodium fluoride and once with 1X hypotonic buffer. Cells were scraped into 1X hypotonic buffer containing 0.2% NP40 and resuspended by g entle pipetting. Samples were centrifuged, resuspended in high salt buffer and rotated for 30 minutes at 4 C. Samples were centrifuged at 12,000xg, 4 C for 20 minutes, aliquoted and stored at -80 C. Electrophoretic Mobility Shift Assay: Nuclear extracts were combined with or without cold competitors or specific antibodies and incubated for 20 minutes at room temperature. Probes were labe led by combining equimolar amounts of complementary oligonucleotides (2x10 -10 moles of each) which were heated to 70 C and allowed to cool to room temperature slowly. The oligos were labeled using 10 l [ 32 P]dCTP (3000 Ci/mmol) and Kle now enzyme. Unincorporated label was removed using Nuc Away spin columns (Ambion). Th e reaction mixture contains binding buffer (10 mM HEPES, pH 7.9, 10% glycerol, 1 mM DTT, 0.1 g/ l poly(dI:dC), 0.5 g/ l BSA and 4000 dpm/ l radiolabeled probe) and nuclear extract (5 g) in a total volume of 10 l, which is incubated at 30 C for 30 minutes. Samples were loaded onto a 5% non-denaturing po lyacrylamide gel and run at 180 V. Gels were dried under vacuum and exposed to film. Double stranded oligonucleotides composed of t he following sequences were used for

PAGE 142

132 EMSA analysis: PPRE (5-ACCTGA GGTCAGGAGTTCAAGACC-3); PPREmut (5-ACCTGAGAACAGGAGAACAAGACC-3). Nitric oxide assay: BAEC were treated with 20 M troglitazone, ciglitazone or TNFin serum-free medium as described in the figure legends. Aliquots were removed at the time points indicated and nitrite was measured in the medium as an indicator of cellular NO using a fluor ometric method (37). Briefly, freshly prepared DAN reagent was adde d to culture supernatant, mixed immediately and incubated for 10 minutes. The reaction was stopped with a final concentration of 2.8 M NaOH and the samples were read on a BMG Fluostar Galaxy spectrofluorometer in a 96well plate using an excita tion wavelength of 360 nm and emission wavelength of 405 nm. Ce lls were counted by trypan blue exclusion analysis and data is presented as quantity of ni trite produced in pmols per 1 x 10 6 cells. Statistical Analyses: Experimental data is expressed as the mean of experiments plus or minus the standard e rror of the mean. Each experiment was performed independently at least three times. RESULTS PPAR ligands increase endothelial NO production To confirm that PPAR agonists stimulate NO production in BAEC; confluent cells were incubated with increasing concentrations of either troglitazone or cigl itazone. A dose-dependent

PAGE 143

133 increase in NO production was observ ed following treatm ent with either troglitazone or ciglitazone (Figure 1A and B). A higher level of stimulation was observed in response to ciglitazone than to troglitazone. Troglitazone and ciglit azone increase AS but not eNOS expression AS expression is necessary to provide the s ubstrate, arginine, to eNOS through the recycling of citrulline (1, 2, 7, 9) To investigate the effect of PPAR activation by TZDs on AS protein expression in BAECs confluent BAEC were treated with increasing concentrations of troglitazone and ciglitazone for 24 hours and protein expression was determined by western bl otting. Treatment with either of the TZDs resulted in a concentration-dependent in crease in AS protein levels (Figure 2A-D). Neither TZD significantly increas ed eNOS levels. In contrast, the TZD rosiglitazone, which is also noted to stimulated NO production (38), had no detectable effect on AS expression (data not shown). To investigate the effect of PPAR activation on steady-state AS mRNA expression, BAECs were allowed to grow to confluence and we re then stimulated with troglitazone for twenty four hours. RNA was prepared from treated and untreated cells and then reverse transcri bed. Real time PCR showed that stimulated cells had a 3.3-fold increase in AS mRNA expression with 20 M troglitazone (Figure 3A). This effect could be inhibited by treatment with the transcriptional inhibitor 1D-ribofuranosylbenzimidazole ( DRB), suggesting that the increase in steady state mRNA levels was due to an increase in transcription

PAGE 144

134 rather than decreased turnover of AS mRNA. Cells treated with 50 M ciglitazone showed a 1.8-fold increase in AS mRNA (F igure 3B). This was also inhibited with treatment of DRB, supporting transcriptional regulation by Ciglitazone as well. Identification of a putative PPRE in the promoter of the AS gene Since troglitazone stimulated AS protein expression through an increase in transcription, the AS promot er was examined to ident ify regions regulated by PPAR agonists. AS promoter activity was assessed us ing luciferase reporter gene constructs. Previous work by other s (39) and by our laboratory (40) has shown that the proximal AS promoter r equired for AS expression contains three Sp1/3 elements (39). Since TZDs have been shown to mediate transcriptional effects through Sp1 (41, 42) we examined whether t he proximal promoter was regulated by PPAR agonists. First, a construct containing 189 bp of the AS promoter, p3ASP189, was transfected into BAEC and stimulated with troglitazone or ciglit azone. Reporter gene assays showed no increase in promoter activity indicating that the regulation via PPAR a gonists was not through the proximal prom oter and thus another element must be involved (Figure 4A). Since the proximal promoter was not regulated by PPAR agonists, a series of constructs containing increas ing lengths of t he AS promoter we re created and transfected into BAEC. Cells transfected wit h AS promoter constructs containing up to 2088 bp showed no change in reporte r gene activity (data not shown).

PAGE 145

135 However, when a construct containi ng 2616 bp of the AS promoter was transfected into BAEC and subsequently tr eated with troglitazone or ciglitazone, a significant increase in reporter gene expr ession was detected after stimulation. (Figure 4A). The construct containing 2616 base pairs of the promoter was activated 3.8 fold by 50 M ciglitazone (p = .015 ) and 2.7 fold by 20 M troglitazone (p=.028) (Figure 4A). While 50 M ciglitazone was required to stimulate reporter gene activity, 20 M of troglitazone was sufficient to stimulate activity. Increasing the concentration of troglitazone did not further stimulate promoter activity. This comparative analysis of luciferase activity between treated and untreated transfections of the construct p3ASP2616 revealed PPAR responsiveness in the region from -2616 to -2088 bp up stream of the transcriptional start. DNA sequence analysis identified a near -consensus peroxisome proliferatoractivated receptor response element (PPR E) that occurs at bp to ( AGGTCA GG AGTTCA ) in the p3ASP2616 construct. Transient transfection assays were performed using a construct mutated in the PPRE and compared to transfection of the wild type construct. Mutation of the putative PPRE site in p3ASP2616 completely abolished the acti vating effects of ciglitazone and troglitazone on the promoter (Figure 4B). These data s uggest that this PPRE site mediates the induction of the AS pr omoter by TZDs in endothelial cells.

PAGE 146

136 PPAR binds to the AS PPRE To determine whether PPAR binds to the putative AS PPRE, gel mobility shift assa ys were performed with oligonucleotides containing the AS PPRE. Nucl ear extracts from ciglitazone, troglitazone and untreated BAEC were combined with 32 P-radiolabled AS PPRE oligonucleotides. The addition of excess unlabeled PPRE wt oligonucleotides reduced the signal (Figure 5, lane 4). In contrast, addition of the PPREmut oli gonucleotide, which should not bind to the PPAR -RXR complex, did not reduce the specific signal (lane 5), indicating the specif icity of the complex. Cigl itazone treatment mediated a 50% increase in binding to the PPRE (Figure 5 C and D) while troglitazone mediated a 260% increase in binding (Figure 5 A and B). Effect of TZDs on TNF--induced repression of AS expression Previous work has indicated that TZDs can counteract th e effects of inflammatory conditions such as TNF(43-46). To examine the dire ct effects of TZDs on TNFmediated AS repression, BAEC were cultured in m edia containing 2.5-10 ng/ml TNFwith or without trog litazone or ciglitazone in the presence of TNF(10 ng/ml) for 24 hours. As sh own in Figure 6, TNFtreatment resulted in a dosedependent decrease in AS and eNOS protein expression. When cultures were incubated with 10 ng/ml TNFin addition to troglitazo ne or ciglitazone (20 and 50 M), the ciglitazone showed a smal l increase in AS and eNOS expression while troglitazone reversed TNF-mediated reduction in AS and eNOS expression (Figure 6).

PAGE 147

137 Effect of TZDs on TNF--mediated repression of NO production Since troglitazone was able to block TNF-mediated suppression of AS expression, the ability of this TZD to block TNF-mediated repression of endothelial NO production was investigated. Confluent BAEC were un treated or treated with TNFwith or without 20 M tr oglitazone for 5 hours. NO was measured as nitrite and normalized to cell nu mber to account for differences in viability. Cells treated with TNFin the presence of troglitaz one did not show any decreased NO production (Figure 7). DISCUSSION The synthetic PPAR agonists, TZDs, provide benefit s to diabetic patients which include improved glucose tolerance, as well as decreased insulin resistance and dyslipidemia (47). Additional benefits include reduced triglycerides in the plasma, improved plasma lipid profile, lower blood pressure in hypertensive diabetics and a reversal of the proinflammatory and pr ocoagulant state (48). Altogether, this class of compounds improv es insulin sensitivity and restores metabolic homeostasis in type II diabetic patients. TZDs have also been shown to act on vascular cells directly by inhibiting gluc ose-induced proliferatio n and migration of coronary smooth muscle cells (49), inhibiting intimal hyperplasia in the rat aorta (50), inhibiting endothelial proliferation ( 51) and inhibiting TNF-induced plasminogen activator inhibitor type I se cretion (52). Additional vascular benefits

PAGE 148

138 include protection against endothelial dysfunction via the inhibition of cytokineinduced MCP-1 in human endothelial cells (53). This study focuses on the regulation of AS by the TZDs troglitazone and ciglitazone, as a functional support system for endothelial NO production. Our laboratory has provided substantial evid ence that the arginine utilized for endothelial NO production is provided by the recycling of citrulline to arginine, via the enzymes AS and argininosuccinate lyase (7, 9). If this system is impaired, reduced arginine availability can lead to a decrease in NO production and bioavailability in the endothelium. Impai red NO production and bioavailability in the endothelium is referred to as endothel ial dysfunction and is predictive of clinical cardiovascula r events (10, 54). PPAR agonists provide cardiovascular benefits by increasing endothelial NO production (31). This occurs without a significant increase in eNOS expression (Figure 1), but is rather through an increase in eNOS phosphorylation (31). In this report we provide evidence demonstrating that troglitaz one and ciglitazone also in crease the production of endothelial NO by increasing the available arginine. This occurs via an increase in expression of AS, providing increas ed arginine as a substrate for eNOS. The increase in AS expression induced by treatm ent with the PPAR agonists, troglitazone and ciglitazone (F igure 2) is asso ciated with an overall induction of NO production (Figure 1) witho ut a significant increase in eNOS expression. The increase in AS expr ession is related to an incr ease in AS mRNA. The use of

PAGE 149

139 DRB, a transcriptional inhibi tor, blocked induction of AS mRNA, indicating that the increase in AS was transcripti onally regulated. Delineation of the transcriptional element regulated via the TZ Ds involved the use of reporter gene assays and gel shift analysis. These ex periments identified a PPRE in the AS promoter that mediates t he transcriptional effects of ciglitazone and troglitazone. Interestingly, rosiglitazone, which was shown to have no effect on AS protein expression, also had no effect on the AS promoter (data not shown). To our knowledge, this is the first report of a functional PPRE identified in the AS promoter. TNFis an inflammatory cytokine imp licated in the pathogenesis of cardiovascular diseases such as c ongestive heart failure, acute myocardial infarction, atherogenesis, myocarditis and dilated cardiomyopathy. Previous work has demonstrated that TZDs can reverse the effects of TNFon a number of genes (28, 29, 55). It has been shown in endothelial cells, that the TZD MCC555, modulates TNF-induced expression via down-regulation of NF B binding to the promoter of vascular cell adh esion molecule-1 (29). Another TZD, pioglitazone, is ab le to block TNF-mediated apoptosis in human coronary artery endothelial cells (55). In addi tion, troglitazone can prevent TNF-induced and NF B-dependent and independent pathways l eading to stimulation of plasminogen activator inhibitor type 1 (PAI -1), which plays a role in development of atherosclerosis in diabet ic patients (52). Previous work in our laboratory has shown that TNFacts to decrease AS expressi on via decreased Sp1/3 binding

PAGE 150

140 to the proximal AS promoter in an NF B-dependent manner (40). The expression of AS and eNOS, both essential component s of the citrullin e-NO cycle, were shown to be coordinately down-regulated by TNFthrough decreased binding at a proximal Sp1 element that is required for basal promoter activity for both genes (40, 56). The current study demonstrates that PPAR agonists are able to block the effects of TNFon AS transcription. AS is required by endothelial cells for the production of NO and for cell viability (9), thus the down-regulation of AS by TNFseverely limits capacity of the endothelium to produce NO and to maintain viability. Therefore, TNFdecreases the production of NO through enzyme and substrate depletion, and as a consequenc e promotes endothe lial dysfunction. Because the intracellular pool of arginine that is directed to NO production is maintained by the recycling of citrullin e to arginine this may suggest a novel therapeutic target to improv e endothelial function. We present in this study two TZDs, troglitazone, and to a lesser extent ciglitazone, which were able to block the down-regulation of AS by TNFthus allowing the EC to remain functional in the presence of this damaging molecule. These results further support the essent ial role of arginine regeneration in maintaining NO production in endothelial cells and suggest the possible efficacy of TZDs or similar derivatives as a therapeutic treatment of endothelial dysfunction may be mediated, in part, thro ugh the stimulation of AS expression.

PAGE 151

141 In addition, a mechanism by which two different PPAR agonists induce NO production is presented. The results indicate that TZDs may each act through independent mechanisms to achi eve the up-regulation of AS. This is important in light of the fact that rosi glitazone (38), a cu rrently prescribed TZD, did not show any of the above benefits to endothelial f unction. In addition, troglitazone was better able to reverse the effects of TNFon AS and eNOS expression (Figure 6). It has previously been shown that wh ile several TZDs induce NO production, they do so via discrete mechanisms (38). 15d-PGJ 2 increases hsp90 expression while ciglitazone and rosiglitazone do not ha ve the same effect (38). In addition, 15d-PGJ 2 and rosiglitazone increase binding of hsp90 to eNOS while ciglitazone does not (38). Finally, both 15d-PGJ 2 and rosiglitazone, but not ciglitazone increased phosphorylation of eNOS at ser 1177 which is linked to enhanced enzyme activity (38). Here, we have s hown an additional mechanism by which select TZDs induce NO production via the up-regulation of AS expression. Thus, the mechanisms used by TZDs to up-regu late NO production are not the same for all TZDs and need to be investigated further. Future studies in our labor atory will address the differe ntial mechanisms by which these PPAR agonists act to improve endot helial function via substrate availability for NO production. These studi es will further elucidate the role of PPAR ligands in vascular health and the development of new therapeutics for the treatment of endothelia l dysfunction. The functional consequences of the observed changes in AS expression under pr oinflammatory conditions such as

PAGE 152

142 increased TNF, is a reduction in endothelial NO production due to a decrease in substrate availability. This study provides a molecular mechanism by which endothelial dysfunction, due to decreased NO bioavailability, can be reversed using a class of compounds used for treatment of type II diabetes.

PAGE 153

143 Figure 1: PPAR agonists stimulate e ndothelial NO production. BAEC were treated with increasing concentrations of ciglitazone (A) and troglitazone (B). Media was collected at 0 and 24 hours. NO wa s measured as nitrite produced/1x10 6 cells. (Nitrite is a stable reaction product of NO and molecular oxygen.) Results are ex pressed as relative NO produced per 1x10 6 cells and error bars represent the st andard error of the mean.

PAGE 154

[Troglitazone (M)] 0102050100 Fold NO production per 106 cells 01020304050 [Ciglitazone (M)] 0102050100 Fold NO production per 106 cells 020406080100120 144

PAGE 155

145 Figure 2: Troglitazone and ciglitazone stimulate AS pr otein expression. At confluence BAEC were incubated with 0, 20, 30, 50, 100 M troglitazone (A,B) or ciglitazone (C,D) for 24 hours. 10 g of whole cell lysate was loaded onto an SDS polyacrylamide gel and western blotting performed. Anti-A S (1:2500), eNOS (1:1000) and anti-GAPDH (1:10 00) antibodies were used to detect the amount of protein present. These results are r epresentative of th ree independent experiments.

PAGE 156

146

PAGE 157

147 Figure 3: Troglitazone and ciglitazone induce transcription of AS mRNA. (A) BAEC were treated with increasing concen trations of troglitazone. Total RNA was isolated using Tri Reagent and re verse transcribed. AS message was detected using real time quantitative RT-P CR. (A) BAEC were untreated (U) or treated with 20 M troglitazone in the absence (T) or presence (T+D) of DRB, an inhibitor of transcription. RNA was isolated a nd quantitated by r eal time RT-PCR. (B) BAEC were untreated (U) or treated with 50 M ciglitazone in the absence (C) or presence (C+D) of DRB, an inhibi tor of transcription. RNA was isolated and quantitated by real time RT-PCR. All results were normalized to 18S rRNA and represent the average the standard error of the mean.

PAGE 158

UTT+D Relative mRNA Expression (AS/18S) 010203040 UC C+D Relative mRNA Expression (AS/18S) 0102030405060 148

PAGE 159

149 Figure 4: PPAR agonists induce a distal el ement in the AS promoter. (A) BAEC were transiently transfected with th e AS promoter constructs p3ASP189 or p3ASP2616 and treated with 20 M troglitazone (Tr) or 50 M ciglitazone (Ci). (B) BAEC were transfected with wild type p3ASP2616 (W) or p3ASP2616PPREmut, which contains a mutation in the PPRE (M). Following transfection, cells were untreated or treated with 20 M troglitazone (Trog) or 50 M ciglitazone (Cig). All results are presented as relative luciferase activity and represent the average the standard error of the mean of at least four experiments conducted in triplicate.

PAGE 160

Fold RLU 012345 CiTrNoneCiTrNone None UntreatedTr 20 M TroglitazoneCi 50 M Ciglitazone p3ASP189p3ASP2616 Fold RLU 012345 MWMWMW W Wild Type ConstructM Mutated ConstructNoneTrogCig AB 150

PAGE 161

151 Figure 5: PPAR agonists increase binding to the AS PPRE. (A-D) Electrophoretic mobility shift assays we re performed using nuclear extracts prepared from untreated, ciglitazone tr eated (A and B) and troglitazone treated (C and D) BAEC. Extracts were combined with an oligonucleotide probe containing the putative PPR E sequence of the AS promoter and 100X cold or wildtype oligos where indicated. Spot density for each graph is presented underneath each radiograph (B and D).

PAGE 162

152

PAGE 163

153 Figure 6: Troglitazone and ciglitazone block the effect of TNFon AS expression. (A) Confluent BAEC were cultured in complete media containing vehicle alone (DMSO) (l ane 1) or 2-10 ng/ml TNFwith (lanes 2-9) in the absence or presence of 20 (+) or 50 (++) M troglitazone and 20 (+) or 50 (++) M ciglitazone. Twenty-four hours following treatment, lysates were prepared and 10 g protein was loaded onto an SDS-PAGE gel. Wester n blot analysis was performed as described in detail under Ex perimental Procedures . Spot density was analyzed for the AS (B) and eNOS (B) blots and normalized to GAPDH. Blots are representative of three experiments carried out independently.

PAGE 164

154

PAGE 165

155 Figure 7: Troglitazone inhibits TNF--mediated suppression of NO production. Confluent BAEC were cultur ed in media containing TNF(TNF) or TNFplus troglitazone (TNF+TGZ). Media was collected at time points 0 and 24 hours. NO was measured as nitrite produced/1x10 6 cells. Results are expressed as NO produced per 1x10 6 cells and error bars represent the standard error of the mean.

PAGE 166

NoneTNFTNF+TGZ Percent NO produced per 1 x 106 cells 0.00.20.40.60.81.01.2 156

PAGE 167

157 REFERENCES 1. Xie, L., and Gross, S. S. (1997) Argininosuccinate synthetase overexpression in vascular sm ooth muscle cells potentiates immunostimulant-induced NO production. J Biol Chem 272, 16624-16630 2. Xie, L., Hattori, Y., Tume, N., and Gross, S. S. ( 2000) The preferred source of arginine for high-output nitric oxide synthesis in blood vessels. Semin Perinatol 24, 42-45 3. Sessa, W. C., Hecker, M., Mitchell, J. A., and Vane, J. R. (1990) The metabolism of L-arginine and its significance for the biosynthesis of endothelium-derived rela xing factor: L-glutamine inhibits the generation of L-arginine by cultured endothelial cells. Proc Natl Acad Sci USA 87, 86078611 4. Hattori, Y., Campbell, E. B., and Gr oss, S. S. (1994) Argininosuccinate synthetase mRNA and activity ar e induced by immunostimulants in vascular smooth muscle. Role in the regeneration or arginine for nitric oxide synthesis. J Biol Chem 269, 9405-9408 5. Su, T. S., Bock, H. G., O'Brien, W. E., and B eaudet, A. L. (1981) Cloning of cDNA for argininosuccinate synthetase mRNA and study of enzyme overproduction in a human cell line. J Biol Chem 256, 11826-11831

PAGE 168

158 6. Shuttleworth, C. W., Burns, A. J. Ward, S. M., O'Br ien, W. E., and Sanders, K. M. (1995) Re cycling of L-citrulline to sustain nitric oxidedependent enteric neurotransmission. Neuroscience 68, 1295-1304 7. Flam, B. R., Hartmann, P. J., Harr ell-Booth, M., Solo monson, L. P., and Eichler, D. C. (2001) Caveolar localization of ar ginine regeneration enzymes, argininosuccinate synthase, and lyase, with endothelial nitric oxide synthase. Nitric Oxide 5, 187-197 8. Solomonson, L. P., Flam, B. R., Pendleton, L. C., Goodwin, B. L., and Eichler, D. C. (2003) The caveolar nitric oxide synthase/arginine regeneration system for NO production in endothelial cells. J Exp Biol 206, 2083-2087 9. Goodwin, B. L., Solomonson, L. P., and Eichler, D. C. (2004) Argininosuccinate synthase expression is required to maintain nitric oxide production and cell viability in aortic endothelial cells. J Biol Chem 279, 18353-18360 10. Vallance, P., and Chan, N. (2001) Endothelial function and nitric oxide: clinical relevance. Heart 85, 342-350

PAGE 169

159 11. Kliewer, S. A., Sundseth, S. S., J ones, S. A., Brown, P. J., Wisely, G. B., Koble, C. S., Devchand, P., Wahli, W ., Willson, T. M., Lenhard, J. M., and Lehmann, J. M. (1997) Fatty acids and eicosanoids regulate gene expression through direct interacti ons with peroxisome proliferatoractivated receptors alpha and gamma. Proc Natl Acad Sci U S A 94, 4318-4323 12. Schoonjans, K., Peina do-Onsurbe, J., Lefebvre, A. M., Heyman, R. A., Briggs, M., Deeb, S., Staels, B., and Auwerx, J. (1996) PPARalpha and PPARgamma activators direct a dist inct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. Embo J 15, 53365348 13. Braissant, O., Foufelle, F., Scotto C., Dauca, M., and Wahli, W. (1996) Differential expression of peroxisom e proliferator-activated receptors (PPARs): tissue distribution of PPAR-a lpha, -beta, and -gamma in the adult rat. Endocrinology 137, 354-366 14. Brun, R. P., Tontonoz, P., Forman, B. M., Ellis, R., Chen, J., Evans, R. M., and Spiegelman, B. M. ( 1996) Differential activa tion of adipogenesis by multiple PPAR isoforms. Genes Dev 10, 974-984 15. Rosen, E. D., and Spiegelman, B. M. (2001) PPARgamma : a nuclear regulator of metabolism, di fferentiation, and cell growth. J Biol Chem 276, 37731-37734

PAGE 170

160 16. Barak, Y., Nelson, M. C., Ong, E. S., Jones, Y. Z., Ruiz-Lozano, P., Chien, K. R., Koder, A., and Evans, R. M. (1999) PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell 4, 585-595 17. Kliewer, S. A., Lenhard, J. M., Willson, T. M., Patel, I. Morris, D. C., and Lehmann, J. M. (1995) A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma and promotes adipocyte differentiation. Cell 83, 813-819 18. Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M. (1995) 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell 83, 803812 19. Majithiya, J. B., Paramar, A. N., a nd Balaraman, R. (2005) Pioglitazone, a PPARgamma agonist, restores endot helial function in aorta of streptozotocin-induced diabetic rats. Cardiovasc Res 66, 150-161 20. Kosegawa, I., Chen, S., Awata, T., Negishi, K., and Katayama, S. (1999) Troglitazone and metformin, but not glibenclamide, decrease blood pressure in Otsuka Long Evans Tokushima Fatty rats. Clin Exp Hypertens 21, 199-211 21. Saku, K., Zhang, B., Ohta, T., and Ar akawa, K. (1997) Troglitazone lowers blood pressure and enhances insulin s ensitivity in Watanabe heritable hyperlipidemic rabbits. Am J Hypertens 10, 1027-1033

PAGE 171

161 22. Ogihara, T., Rakugi, H., Ikegami, H., Mikami, H., and Masuo, K. (1995) Enhancement of insulin sensitivity by troglitazone lowers blood pressure in diabetic hypertensives. Am J Hypertens 8, 316-320 23. Fujishima, S., Ohya, Y., Nakamura, Y., Onaka, U., Abe, I., and Fujishima, M. (1998) Troglitazon e, an insulin sensitizer, increases forearm blood flow in humans. Am J Hypertens 11, 1134-1137 24. Olefsky, J. M. (2000) Treatment of insulin resistance with peroxisome proliferator-activated receptor gamma agonists. J Clin Invest 106, 467-472 25. Shinohara, E., Kihara, S., Ouch i, N., Funahashi, T., Nakamura, T., Yamashita, S., Kameda-Takemura, K., and Matsuzawa, Y. (1998) Troglitazone suppresses intimal fo rmation following balloon injury in insulin-resistant Zucker fatty rats. Atherosclerosis 136, 275-279 26. Chen, C. C., Wang, H. J., Shih, H. C., Sheen, L. Y., Chang, C. T., Chen, R. H., and Wang, T. Y. (2001) Compar ison of the metabolic effects of metformin and troglitazone on fructose-induced insulin resistance in male Sprague-Dawley rats. J Formos Med Assoc 100, 176-180 27. Collins, A. R., Meehan, W. P., Ki ntscher, U., Jackson, S., Wakino, S., Noh, G., Palinski, W., Hsueh, W. A ., and Law, R. E. (2001) Troglitazone inhibits formation of early athero sclerotic lesions in diabetic and nondiabetic low density lipoprotein receptor-deficient mice. Arterioscler Thromb Vasc Biol 21, 365-371

PAGE 172

162 28. Ruan, H., Zarnowski, M. J., Cushm an, S. W., and Lodish, H. F. (2003) Standard isolation of primary adipose cells from mouse epididymal fat pads induces inflammatory mediators and down-regulates adipocyte genes. J Biol Chem 278, 47585-47593 29. Kurebayashi, S., Xu, X., Ishii, S., Shiraishi, M., Kouhara, H., and Kasayama, S. (2005) A novel thiazo lidinedione MCC-5 55 down-regulates tumor necrosis factor-alpha-induced expression of vascular cell adhesion molecule-1 in vascular endothelial cells. Atherosclerosis 182, 71-77 30. Cho, D. H., Choi, Y. J., Jo, S. A. and Jo, I. (2004) Nitri c oxide production and regulation of endothelial nitric -oxide synthase phosphorylation by prolonged treatment with troglitazone: evidence for involvement of peroxisome proliferator-activated receptor (PPAR) gamma-dependent and PPARgamma-independent si gnaling pathways. J Biol Chem 279, 24992506 31. Calnek, D. S., Mazzella, L., Roser, S., Roman, J., and Ha rt, C. M. (2003) Peroxisome proliferator-activated receptor gamma ligands increase release of nitric oxide from endothelial cells. Arterioscler Thromb Vasc Biol 23, 52-57 32. Hwang, J., Kleinhenz, D. J., Lassegue, B., Griendli ng, K. K., Dikalov, S., and Hart, C. M. (2005) Peroxisome proliferator-activated receptor-gamma ligands regulate endothelial memb rane superoxide production. Am J Physiol Cell Physiol 288, C899-905

PAGE 173

163 33. Pendleton, L. C., Goodwin, B. L., Flam, B. R., Solomonson, L. P., and Eichler, D. C. (2002) Endothelial argininosuccinate synthase mRNA 5untranslated region diversit y. Infrastructure for tissue-specific expression. J Biol Chem 277, 25363-25369 34. Pendleton, L. C., Goodwin, B. L., Solomonson, L. P., and Eichler, D. C. (2005) Regulation of E ndothelial Argininosuccinat e Synthase Expression and NO Production by an Upstr eam Open Reading Frame. J Biol Chem 280, 24252-24260 35. Goodwin BL, L., MM, Pendleton LC, Solomonson LP, Eichler DC (2005) Tumor Necrosis Factor-alpha Reduces Substrate Availability for Nitric Oxide Production Via Down -Regulation of Argininosuccinate Synthase. Submitted 36. Yu, C. L., Meyer, D. J., Campbell, G. S., Larner, A. C., Carter-Su, C., Schwartz, J., and Jove, R. (1995) E nhanced DNA-binding activity of a Stat3-related protein in cells tr ansformed by the Src oncoprotein. Science 269, 81-83 37. Misko, T. P., Schilling, R. J., Salvem ini, D., Moore, W. M., and Currie, M. G. (1993) A fluorometric assa y for the measurement of nitrite in biological samples. Anal Biochem 214, 11-16

PAGE 174

164 38. Polikandriotis, J. A., Ma zzella, L. J., Rupnow, H. L ., and Hart, C. M. (2005) Peroxisome proliferator-activated receptor gamma ligands stimulate endothelial nitric oxide production through distinct per oxisome proliferatoractivated receptor gamma-dependent mechanisms. Arterioscler Thromb Vasc Biol 25, 1810-1816 39. Anderson, G. M., and Freytag, S. O. (1991) Synergistic activation of a human promoter in vivo by transcription factor Sp1. Mol Cell Biol 11, 19351943 40. Goodwin BL, P., LP, Levy MM, Solomonson LP, Eichler DC (2005) Tumor Necrosis FactorReduces Substrate Ava ilability For Nitric Oxide Production via Down-Regulation of Argininosuccinate Synthase. Submitted 41. Sassa, Y., Hata, Y., Aiello, L. P., Taniguchi, Y., Kohno, K., and Ishibashi, T. (2004) Bifunctional properties of peroxisome proliferator-activated receptor gamma1 in KDR gene regulation mediated via interaction with both Sp1 and Sp3. Diabetes 53, 1222-1229 42. Sugawara, A., Uruno, A ., Kudo, M., Ikeda, Y., Sato K., Taniyama, Y., Ito, S., and Takeuchi, K. (2002) Transcr iption suppression of thromboxane receptor gene by peroxisom e proliferator-activated receptor-gamma via an interaction with Sp1 in vascular smooth muscle cells. J Biol Chem 277, 9676-9683

PAGE 175

165 43. Ohsumi, J., Sakakibara, S., Yam aguchi, J., Miyadai, K., Yoshioka, S., Fujiwara, T., Horikoshi, H., and Seriza wa, N. (1994) Troglitazone prevents the inhibitory effects of inflammatory cytokines on insulin-induced adipocyte differentiation in 3T3-L1 cells. Endocrinology 135, 2279-2282 44. Stephens, J. M., and Pekala, P. H. (1992) Transcriptional repression of the C/EBP-alpha and GLUT4 genes in 3T3-L1 adipocytes by tumor necrosis factor-alpha. Regulations is coordinate and independent of protein synthesis. J Biol Chem 267, 13580-13584 45. Szalkowski, D., White-Carrington, S., Berger, J., and Zhang, B. (1995) Antidiabetic thiazolidinedio nes block the inhibitory effect of tumor necrosis factor-alpha on differentiation, insulin -stimulated glucose uptake, and gene expression in 3T3-L1 cells. Endocrinology 136, 1474-1481 46. Peraldi, P., Xu, M., and Spiegelm an, B. M. (1997) Thiazolidinediones block tumor necrosis factor-alpha-induc ed inhibition of in sulin signaling. J Clin Invest 100, 1863-1869 47. Mimura, K., Umeda, F., Hiramatsu, S., Taniguchi, S., Ono, Y., Nakashima, N., Kobayashi, K., Masakado, M., Sako Y., and Nawata, H. (1994) Effects of a new oral hypoglycaemic agent (CS-045) on metabolic abnormalities and insulin resistance in type 2 diabetes. Diabet Med 11, 685-691

PAGE 176

166 48. Hauner, H. (2002) The mode of action of thiazolidinediones. Diabetes Metab Res Rev 18 Suppl 2, S10-15 49. Yasunari, K., Kohno, M., Kano, H., Yokokawa, K., Minami, M., and Yoshikawa, J. (1997) Mechanisms of action of troglitazone in the prevention of high glucose-induced migr ation and proliferat ion of cultured coronary smooth muscle cells. Circ Res 81, 953-962 50. Law, R. E., Meehan, W. P. Xi, X. P., Graf, K., Wuth rich, D. A., Coats, W., Faxon, D., and Hsueh, W. A. (1996) Troglitazone inhibits vascular smooth muscle cell growth and intimal hyperplasia. J Clin Invest 98, 1897-1905 51. Gralinski, M. R., Rowse, P. E., and Breider, M. A. (1998) Effects of troglitazone and pioglitazone on cyt okine-mediated endothelial cell proliferation in vitro. J Cardiovasc Pharmacol 31, 909-913 52. Hamaguchi, E., Takamura, T., Shimiz u, A., and Nagai, Y. (2003) Tumor necrosis factor-alpha and troglitazone regulate plasminogen activator inhibitor type 1 production through ex tracellular signal-regulated kinaseand nuclear factor-kappaB-depen dent pathways in cultured human umbilical vein endothelial cells. J Pharmacol Exp Ther 307, 987-994 53. Ohta, M. Y., Nagai, Y., Takamura T., Nohara, E., and Kobayashi, K. (2000) Inhibitory effect of troglitaz one on TNF-alpha-induced expression of monocyte chemoattractant protein1 (MCP-1) in human endothelial cells. Diabetes Res Clin Pract 48, 171-176

PAGE 177

167 54. Harrison, D. G. (1997) Cellular and molecular mechanisms of endothelial cell dysfunction. J Clin Invest 100, 2153-2157 55. Chen, J., Li, D., Zhang, X., and Mehta, J. L. (2004) Tumor necrosis factoralpha-induced apoptosis of human co ronary artery endothelial cells: modulation by the peroxisome prolif erator-activated receptor-gamma ligand pioglitazone. J Cardiovasc Pharmacol Ther 9, 35-41 56. Anderson, H. D., Rahmutula, D., and Gardner, D. G. (2004) Tumor necrosis factor-alpha inhibits endothe lial nitric-oxide synthase gene promoter activity in bov ine aortic endothelial cells. J Biol Chem 279, 963969

PAGE 178

168 DISCUSSION The arginine paradox describes a sit uation where NO production appears to be limited by the availability of arginine, despite extracellular and intracellular concentrations that are much higher than the reported K m for eNOS (1-7). A significant amount of evidence supports the proposal that the recycling of arginine by the enzymes AS and AL pr ovides the substrate for endothelial NO production. For example, our laboratory has shown previously that extracellular citrulline was as effective as arginine in stimulating NO production (6), even in the presence of saturating levels of argi nine. Extracellular citrulline levels were found to have no effect on intracellular arginine levels, suggesting that citrulline enhancement of NO production was mediat ed through regenerati on of arginine directed to NO production. In support of this study, Wu et al. (8) showed that synthesis of arginine from citrulline was stimulated by addition of exogenous citrulline. Further evidence which indicate s that arginine regener ation is required for NO production is the over expression of AS in vascular smooth muscle cells (2). Xie, et al. reported a significant in crease in NO producti on in the transfected smooth muscle cells over that of untransfected cells, again in spite of saturating levels of extracellular arginine. Thus, Xie et al. (1, 2) concluded that the capacity

PAGE 179

169 to recycle citrulline back to arginine is rate -limiting to NO pr oduction. Su et al. (5) arrived at a similar conclusion show ing that hypoxia in pulmonary artery endothelial cells (PAEC) inhibited indu ction of AS by endotoxin. As a consequence, the production of NO, independent of sufficient extracellular arginine levels, was significantly impaired. While our studies focused on the role of recycling for endothelial NO production by eNOS, previous studies have demons trated the importanc e of recycling for NO production by both iNOS and nNOS For example, AS and iNOS are coinduced in immunostimulat ed macrophages (9, 10) as well as in stimulated RPE-J cells where the citrul line-NO cycle is shown to be functioning (11). In rat aortic smooth muscle cells LPS and IFNstimulate both iNOS and AS (4). Coinduction also occurs in pancreatic -cells treated with cytokines (12). In addition, coinduction of iNOS, CAT-2 and AS in rat microglial cells indicates that both arginine transport by CAT-2 and citru lline-arginine recycling are important in the production of large amounts of NO ( 13). In neurons, colocalization of nNOS, AS and AL was identified in the canine gastrointestinal tract providing morphological evidence of a citrulline-NO cycle (14). Fi nally, in the rat gastric fundus, functional evidence of recycling is supported by coloca lization of AS, AL and nNOS (15).

PAGE 180

170 The results of my research demonstr ated the important role AS plays in endothelial function, and the re gulation of AS by relevant vascular effectors. To provide direct evidence for the essentia l role of citrulline recycling and the importance for a functional citrulline-nitric oxide cycle, I carried out a series of experiments using RNA interference to s pecifically silence AS expression in endothelial cells (16). By using this appr oach to knock down AS expression, I have shown that AS is essential for bot h basal and stimulated endothelial NO production, even in the presence of excess arginine (16). A significant and dosedependent reduction of AS pr otein and activity foll owing siRNA transfection correlated with a concomitant decrease in stimulated a nd basal NO production in endothelial cells with reduced AS expression, in spite of excess arginine in the media (16). Unexpectedly, the viabilit y of these endothelial cells was compromised compared to control cells, based on cell count and MTT viability assay. Two indicators of apoptosis, reduc ed expression of Bc l-2 and an increase in caspase activity suggested that the loss in cell viability was due to an induction of apoptosis. Exposure of the cells to an NO donor prevented this apoptosis, indicating that regeneration of argini ne may be supporting production of antiapoptotic levels of NO to maintain endothe lial cell viability. Overall, these results provide further evidence supporting the nec essity for the regeneration of arginine for NO production. Specifically, AS expression was demonstrated to be necessary and sufficient to maintain bot h stimulated and resting levels of NO synthesis in endothelial cells.

PAGE 181

171 An unexpected discovery was that r educed AS expression in endothelial cells resulted in a decrease in cell viability. NO has a bi-functiona l role in cell death it can either stimulate or inhi bit cytotoxicity. The level of NO produced and the type of cell involved determines the effect NO has on cell viability (17, 18). High concentrations of NO have been shown to induce cell death via apoptosis. In a more complex pathway, NO can switch apop tosis to necrosis (17-20). In contrast, lower concentrations of NO have been shown to protect cells such as endothelial cells (21), thymocytes (22) and lymphocytes (23) from apoptosis. In endothelial cells, induction of NO by sphingosine-1phosphate protects endot helial cells from serum-deprived apoptosis (24). While previ ous work depicted a role of NO in protection from apoptosis, the current wo rk designated NO as an important modulator in the maintenance of viability as well as protection against apoptosis. In the first paper, endothelial viability following AS si RNA-induced apoptosis was partially restored by the addi tion of an NO donor. This finding suggests that basal levels of NO in endothelial cells, sustained by the recycling of citrulline back to arginine, may provide protection aga inst apoptosis. However, AS may be performing an as-yet undescribed function in the cell which is preventing apoptosis. Recently AS was described as a Jak-2 interacting protein (25). In addition, microarray analysis identified AS as a Myc-regulated protein (26). CMyc is a protooncogene that is involved in cell prolifer ation, differentiation and apoptosis (27). Many repor ted Myc-targeted genes are involved in apoptosis,

PAGE 182

172 metabolism and cell growth (28). AS expr ession has also been shown to be repressed by the anti-prolif erative protein FAP48 (29). This preliminary evidence is merely suggestive of an alternative ro le for AS expression in maintaining cell viability, further studi es are warranted. Thus, having established the importance of AS in endothelia l cells, I went on to investigate the regulation of expression of this ge ne in response to the inflammatory cytokine TNF. TNFis a multifunctional cytokine involved in the regulation of important ph ysiological functions, including the development of tissues, the coordinate activation of immune responses, and in the onset and progression of pathological conditions (30, 31). TNFhas been implicated in the pathogenesis of cardiovascular diseases such as congestive heart failure, acute myocardial infarction, myocarditis and dilated cardiomyopathy (32). Serum TNFlevels are elevated in pat ients with congestive heart failure (33). Other studies have shown that TNFadministration in vivo depresses endothelium-dependent relaxation (34) and reduces leve ls of endothelial NO (35). TNFhas been shown to reduce NO production in endothelial cells by destabilization of eNOS mRNA (36). In addition, TNFinhibits eNOS promoter activity, through inhibition of the NF B signaling pathway and reduced binding of Sp1 to the eNOS promoter (37). In my studies, I chose conditions that mimic the inflammatory environment of chronic di sease states such as diabetes and/or

PAGE 183

173 obesity. Under these expe rimental conditions, TNFsignals the coordinate down-regulation of eNOS and AS protein expression. St eady-state levels of AS mRNA were also reduced significantly by TNF. As a consequence, the endothelial cell is severely limited in its capacity to sustain NO production. Transcriptionally, eNOS is down-regulated via reduced binding to two Sp1 elements which are required for basal promot er activity (38). A strikingly similar situation was identified in the AS promot er. Reporter gene assays indicated that TNFexerts its effects on the proximal AS promoter, which contains three Sp1/Sp3 binding sites. Specifically, TNF-mediated suppression of the AS promoter was found to be thr ough site 3, which is requ ired for basal AS promoter activity. Site 3 was the most important site regulated by TNF, as is the case for eNOS. These results indicate that an increase in inflammatory markers associated with a number of disease states can effectively inhibit the optimal functioning of the citrulli ne-NO cycle by decreasing th e level of eNOS expression and AS expression. Coordinate up-regulation of AS and eN OS expression has been identified previously in a number of systems (39, 40). For example, AS and eNOS are coordinately induced in t he aorta of diabetic rats following streptozotocin treatment (40). TGF1 induces both enzymes in human umbilical vein endothelial cells (40). In addition, sheer stress induces both AS and eNOS

PAGE 184

174 mRNA expression (39). In the pres ent study, both eNOS and AS protein expression were found to be co ordinately down-regulated by TNFin cultured bovine aortic endothelial cells. A mode l can be proposed whereby TNFmodulates endothelial NO produ ction by regulation of both eNOS expression and also by reduction in substrate availabili ty via regulation of AS expression. This model can also be extende d to the up-regulation of both AS and eNOS by PPAR agonists. Given the requirement of ar ginine regeneration by AS and AL in the production of NO (16), in the third paper I assessed the hypothesis that upregulation of AS expression by PPAR agonists supports the indu ction of endothelial NO production. A dose-dependent in crease in NO production was observed following treatment with the TZDs tr oglitazone and ciglitazone. Western blot analysis demonstrated a dose-dependent up-regulat ion of AS and eNOS protein expression using these PPAR agonists. In addition, real -time quantitative RTPCR showed a coordinate dose-response increase in steady state AS mRNA levels. This effect could be mediated by treatment with the transcriptional inhibitor 1-D-ribofuranosylbenzimidazole ( DRB), suggesting that an increase in transcription resulted in the increase in steady state mRNA levels. Since the TZDs had a transcriptional effect on AS, I went on to demonstrate the presence of a PPAR response element (PPRE) in t he human AS promoter and confirmed PPAR binding by gel shift analysis. DNA sequence analysis detected a near-

PAGE 185

175 consensus peroxisome proliferator-activat ed receptor response element (PPRE) that occurs at bp to ( AGGTCA GG AGTTCA ). Treatment with ciglitazone and troglitazone de monstrated a significant increase in promoter activity of this construct. Mutation of t he PPRE ablated the effects of the TZDs on the promoter. These reporter gene assays re vealed that the identified PPRE is likely involved in regulation of the AS promoter by troglitaz one and ciglitazone. EMSA analysis indicated increased binding to the PPRE DN A when cells were treated with troglitazone or ciglitazone. These results provide a mechanism for the PPAR agonist induction of NO production and indicate that TZDs may each act through independent mechanisms to achieve the up-regulation of AS, especially considering that rosiglitazone, a currently prescribed TZD, did not show any of the above affects. These resu lts further support the essential role of arginine regeneration in maintaining NO production in endothelial cells and suggest the possible efficacy of TZDs or similar derivatives as a therapeutic treatment of endotheli al dysfunction. They also dem onstrate the importance of identifying the mechanisms of action of the individual TZDs on endothelial function. Since PPAR activators have been shown to inhibit the TNFsignaling pathway in a number of systems, I investigated the role of the PPAR agonists troglitazone, ciglitazone and rosiglitazone in regulating NO production through the regulation of AS expression. Wester n blot analysis demonstrated that

PAGE 186

176 troglitazone and ciglitazone, but not rosiglitazone ar e able to restore AS and eNOS expression following TNFrepression. These results provide support for the use of TZDs in the treatment of endot helial dysfunction and the recovery of reduced bioavailability of NO. The delineati on of the signaling pathway utilized by each of these TZDs, may direct the derivat ion of a more specific strategy for reversing the damaging effects of TNFon the endothelium as seen in many disease states. Significance Despite the prevalence of cardiovascular disease, many of the mechanisms associated with developm ent and pathophysiology of vascular dysfunction remain undetermined. One significant mec hanism that holds par ticular promise in understanding the processes which lead to vascular dysfunction is the role of NO. NO generated by the vascular endothelium maintain s normal vascular tone, regulates leukocyte-endothelia l cell interactions, inhibi ts platelet aggregation, limits smooth muscle cell prol iferation, and may even affect myocyte function. Thus, deciphering the molecular mechanisms involved in the constitutive and stimulated production of NO by endothelial cells is critical to the understanding of vascular health and disease. The wo rk in our laboratory highlights the contribution of transcriptional regulation of AS as the rate-limiting step in the citrulline-NO cycle, introduc ing a new paradigm to NO regulation in vascular health and disease. I have developed a st rong evidential case supporting the

PAGE 187

177 proposal that substrate avail ability, governed by arginine regeneration, as part of the citrulline-nitric oxide cycle, plays a key role in NO production in vascular endothelial cells. The fact that a unique intracellular poo l of arginine is maintained by recycling citrulline suggests that citrulline or a ci trulline analog, rather than arginine, may offer a therapeutic advantage to affect va sodilation in hypertensive patients (41). This concept is particularly important in light of more recent information suggesting that arginine supplementation, rather than improving endothelial function and inhibiting atherogenesis, may in fact worsen existing vascular dysfunction and disease (42, 43). Supplem entation with arginine in humans has produced conflicting results. In some st udies, dietary arginine supplementation results in improved vascular function by providing substrate for eNOS and improving NO production (4446). Other studies have not seen an improvement in condition and harmful effects may occu r (43, 47-49). Since the intracellular pool of arginine directed to NO production is mainta ined by the recycling of citrulline to arginine through the enzymes AS and AL, AS may be a viable therapeutic target for pharmaceuticals t hat could be used in the treatment of hypertension and related cardiovascular di sease, particularly since I have shown that the regulation of t he endothelial machinery can be distinguished from the hepatic enzymes involved in urea production. Moreov er, impairment of NO production has been suggested to be an early, causative event in

PAGE 188

178 atherosclerosis, compromising endothelial cell regulation of vascular function, homeostasis, and activating cellular suicide pathways (50). My findings indicate that one deleterious effect of TNFis the coordinate suppression of eNOS and AS expression, effectively reducing eNO production by the endothelium. The complexity of responses under this deleterious environment reflected by elevated TNFlevels, such as in obesity, inflammation, diabetes and metabolic syndrome manifest an environment which promotes endothelial dysfuncti on, including reduced bioava ilability of protective levels of NO. Also intriguing are the findings demonstrating PPAR agonist induction of NO production via the appar ent coordinate up-regulation of both eNOS and AS and the recovery of these enzymes by PPAR agonists following suppression by TNF. A more complete understand ing of these findings may possibly suggest the use of TZDs, or derivatives, as a therapeutic treatment for endothelial dysfunction.

PAGE 189

179 REFERENCES 1. Xie, L., Hattori, Y., Tume, N., and Gross, S. S. ( 2000) The preferred source of arginine for high-output nitric oxide synthesis in blood vessels. Semin Perinatol 24, 42-45 2. Xie, L., and Gross, S. S. (1997) Argininosuccinate synthetase overexpression in vascular sm ooth muscle cells potentiates immunostimulant-induced NO production. J Biol Chem 272, 16624-16630 3. Sessa, W. C., Hecker, M., Mitchell, J. A., and Vane, J. R. (1990) The metabolism of L-arginine and its significance for the biosynthesis of endothelium-derived rela xing factor: L-glutamine inhibits the generation of L-arginine by cultured endothelial cells. Proc Natl Acad Sci USA 87, 86078611 4. Hattori, Y., Campbell, E. B., and Gr oss, S. S. (1994) Argininosuccinate synthetase mRNA and activity ar e induced by immunostimulants in vascular smooth muscle. Role in the regeneration or arginine for nitric oxide synthesis. J Biol Chem 269, 9405-9408 5. Su, Y., and Block, E. R. (1995) Hypoxia in hibits L-arginine synthesis from L-citrulline in porcine pulmonary artery endothelial cells. Am J Physiol 269, L581-587

PAGE 190

180 6. Flam, B. R., Hartmann, P. J., Harr ell-Booth, M., Solo monson, L. P., and Eichler, D. C. (2001) Caveolar localization of ar ginine regeneration enzymes, argininosuccinate synthase, and lyase, with endothelial nitric oxide synthase. Nitric Oxide 5, 187-197 7. Shuttleworth, C. W., Burns, A. J. Ward, S. M., O'Br ien, W. E., and Sanders, K. M. (1995) Re cycling of L-citrulline to sustain nitric oxidedependent enteric neurotransmission. Neuroscience 68, 1295-1304 8. Wu, G., Meininger, C. J., Knabe, D. A., Bazer, F. W., and Rhoads, J. M. (2000) Arginine nutrition in development, health and disease. Curr Opin Clin Nutr Metab Care 3, 59-66 9. Nussler, A. K., Billiar, T. R., Liu, Z. Z., and Morris, S. M., Jr. (1994) Coinduction of nitric oxide synthase and argininosuccinate synthetase in a murine macrophage cell line. Implications for regulation of nitric oxide production. Journal of Biological Chemistry 269, 1257-1261 10. Nagasaki, A., Gotoh, T., Takeya, M. Yu, Y., Takiguchi, M., Matsuzaki, H., Takatsuki, K., and Mori, M. (1996) Coi nduction of nitric oxide synthase, argininosuccinate synthetase, and argininosuccinate lyase in lipopolysaccharide-treated rats RNA blot, immunoblot, and immunohistochemical analyses. Journal of Biological Chemistry 271, 2658-2662

PAGE 191

181 11. Koga, T., Zhang, W. Y., Gotoh, T. Oyadomari, S., Tanihara, H., and Mori, M. (2003) Induction of citrulline-nitr ic oxide (NO) cycle enzymes and NO production in immunostimulated rat RPE-J cells. Experimental Eye Research 76, 15-21 12. Flodstrom, M., Niemann, A. Bedoya, F. J., Morris, S. M., Jr., and Eizirik, D. L. (1995) Expression of the citr ulline-nitric oxide cycle in rodent and human pancreatic beta-cells: induction of argininosuccinate synthetase by cytokines. Endocrinology 136, 3200-3206 13. Kawahara, K., Gotoh, T., Oyadomari, S., Kajizono, M., Kuniyasu, A., Ohsawa, K., Imai, Y., K ohsaka, S., Nakayama, H., and Mori, M. (2001) Co-induction of argininosuccinate synthetase, cationic amino acid transporter-2, and nitric oxide synthas e in activated murine microglial cells. Brain Research. Molecular Brain Research 90, 165-173 14. Daniel, E. E., Wang, Y. F., Salapatek, A. M., Mao, Y. K., and Mori, M. (2000) Arginosuccinate synthetase, arginosuccinate lyase and NOS in canine gastrointestinal tract: immunocytochemical studies. Neurogastroenterology & Motility 12, 317-334 15. Van Geldre, L. A., Timmermans, J. P., and Lefebvre, R. A. (2002) Lcitrulline recycling by argininosuccinat e synthetase and lyase in rat gastric fundus. European Journal of Pharmacology 455, 149-160

PAGE 192

182 16. Goodwin, B. L., Solomonson, L. P., and Eichler, D. C. (2004) Argininosuccinate synthase expression is required to maintain nitric oxide production and cell viability in aortic endothelial cells. J Biol Chem 279, 18353-18360 17. Dimmeler, S., and Zeiher, A. M. (1997) Nitric oxide and apoptosis: another paradigm for the double-edged ro le of nitric oxide. Nitric Oxide 1, 275-281 18. Haendeler, J., Zeiher, A. M., and Dimmeler, S. (1999) Nitric oxide and apoptosis. Vitamins & Hormones 57, 49-77 19. Melino, G., Catani, M. V ., Corazzari, M., Guerrieri, P., and Bernassola, F. (2000) Nitric oxide can inhibit apoptosis or switch it into necrosis. Cell Mol Life Sci 57, 612-622 20. Shen, Y. H., Wang, X. L., and Wilck en, D. E. (1998) Nitric oxide induces and inhibits apoptosis through different pathways. FEBS Letters 433, 125131 21. Dimmeler, S., Haendeler, J., N ehls, M., and Zeiher A. M. (1997) Suppression of apoptosis by nitric oxid e via inhibition of interleukin-1betaconverting enzyme (ICE)-like and cystei ne protease protein (CPP)-32-like proteases. J Exp Med 185, 601-607 22. Fehsel, K., Kroncke, K. D., Meyer, K. L., Huber, H., Wahn, V., and KolbBachofen, V. (1995) Nitri c oxide induces apoptosis in mouse thymocytes. J Immunol 155, 2858-2865

PAGE 193

183 23. Genaro, A. M., Hortel ano, S., Alvarez, A., Mart inez, C., and Bosca, L. (1995) Splenic B lymphocyte programmed cell death is prevented by nitric oxide release through mechanisms in volving sustained Bcl-2 levels. Journal of Clinical Investigation 95, 1884-1890 24. Kwon, Y. G., Min, J. K., Kim, K. M., Lee, D. J., Billia r, T. R., and Kim, Y. M. (2001) Sphingosine 1-phosphate prot ects human umbilical vein endothelial cells from seru m-deprived apoptosis by nitric oxide production. J Biol Chem 276, 10627-10633 25. Sarkar, S., Pollack, B. P., Lin, K. T., Kotenko, S. V., Cook, J. R., Lewis, A., and Pestka, S. (2001) hT id-1, a human DnaJ protein, modulates the interferon signaling pathway. Journal of Biological Chemistry 276, 4903449042 26. Coller, H. A., Grandori, C., Ta mayo, P., Colbert, T., Lander, E. S., Eisenman, R. N., and Golub, T. R. (2000) Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion. Proceedings of the National Academy of Sciences of t he United States of America 97, 3260-3265 27. Henriksson, M., and Luscher, B. ( 1996) Proteins of the Myc network: essential regulators of cell growth and differentiation. Adv Cancer Res 68, 109-182 28. Dang, C. V. (1999) c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol Cell Biol 19, 1-11

PAGE 194

184 29. Krummrei, U., Baulieu, E. E., and Chambraud, B. (2003) The FKBPassociated protein FAP48 is an antiprolif erative molecule and a player in T cell activation that increases IL2 synthesis. Proceedings of the National Academy of Sciences of t he United States of America 100, 2444-2449 30. MacEwan, D. J. (2002) TNF recept or subtype signalling: Differences and cellular consequences. Cell Signal 14, 477-492 31. MacEwan, D. J. (2002) TNF ligands and receptors a matter of life and death. Br J Pharmacol 135, 855-875 32. Neumann, F. J., Ott, I., Gawaz, M., Richardt, G., Holz apfel, H., Jochum, M., and Schomig, A. (1995) Cardiac rel ease of cytokines and inflammatory responses in acute myocardial infarction. Circulation 92, 748-755 33. Torre-Amione, G., Kapadia, S., Lee, J., Durand, J. B., Bies, R. D., Young, J. B., and Mann, D. L. (1996) Tumor necrosis factor-alpha and tumor necrosis factor receptors in the failing human heart. Circulation 93, 704711 34. Wang, P., Ba, Z. F., and Chaudry, I. H. (1994) Admini stration of tumor necrosis factor-alpha in vivo depre sses endothelium-dependent relaxation. Am J Physiol 266, H2535-2541 35. Johnson, A., Phelps, D. T., and Ferro T. J. (1994) Tumor necrosis factoralpha decreases pulmonary artery endothelial nitrovasodilator via protein kinase C. Am J Physiol 267, L318-325

PAGE 195

185 36. Sanchez de Miguel, L., Alonso, J ., Gonzalez-Fernandez, F., de la Osada, J., Monton, M., Rodriguez-Feo, J. A., Guerra, J. I., Arriero, M. M., Rico, L., Casado, S., and Lopez-Farre, A. ( 1999) Evidence that an endothelial cytosolic protein binds to the 3-unt ranslated region of endothelial nitric oxide synthase mRNA. J Vasc Res 36, 201-208 37. Anderson, H. D., Rahmutula, D., and Gardner, D. G. (2004) Tumor Necrosis Factor-{alpha} Inhibits E ndothelial Nitric-oxide Synthase Gene Promoter Activity in Bovi ne Aortic Endothelial Cells. J Biol Chem 279, 963969 38. Anderson, H. D., Rahmutula, D., and Gardner, D. G. (2004) Tumor necrosis factor-alpha inhibits endothe lial nitric-oxide synthase gene promoter activity in bov ine aortic endothelial cells. J Biol Chem 279, 963969 39. Chan, B. P., Reichert, W. M., and Truskey, G. A. (2004) Synergistic effect of shear stress and streptavidin-bio tin on the expression of endothelial vasodilator and cytoskeleton genes. Biotechnol Bioeng 88, 750-758 40. Oyadomari, S., Gotoh, T., Aoyagi, K., Araki, E., Shichi ri, M., and Mori, M. (2001) Coinduction of endothelial nitric oxide synthase and arginine recycling enzymes in aorta of diabetic rats. Nitric Oxide 5, 252-260 41. Wu, G., and Meininger, C. J. (2000) Arginine nutrition and cardiovascular function. J Nutr 130, 2626-2629

PAGE 196

186 42. Chen, J., Kuhlencordt, P., Urano, F ., Ichinose, H., Astern, J., and Huang, P. L. (2003) Effects of chronic treatment with L-ar ginine on atherosclerosis in apoE knockout and apoE/inducible NO synthase double-knockout mice. Arterioscler Thromb Vasc Biol 23, 97-103 43. Loscalzo, J. (2003) Adverse effe cts of supplemental L-arginine in atherosclerosis: consequences of me thylation stress in a complex catabolism? Arterioscler Thromb Vasc Biol 23, 3-5 44. Creager, M. A., Gallagher, S. J., Girerd, X. J., Co leman, S. M., Dzau, V. J., and Cooke, J. P. (1992) L-ar ginine improves endothelium-dependent vasodilation in hypercholesterolemic humans. Journal of Clinical Investigation 90, 1248-1253 45. BodeBoger, S. M., Boger, R. H., Al fke, H., Heinzel, D., Tsikas, D., Creutzig, A., Alexander, K., and Frolic h, J. C. (1996) L-arginine induces nitric oxide-dependent vasodilation in patients with critical limb ischemia A randomized, controlled study. Circulation 93, 85-90 46. Clarkson, P., Adams, M. R., Powe, A. J., Donald, A. E., McCredie, R., Robinson, J., McCarthy, S. N., Ke ech, A., Celermajer, D. S., and Deanfield, J. E. (1996) Oral L-arginine improves endothelium-dependent dilation in hypercholesterolemic young adults. Journal of Clinical Investigation 97, 1989-1994

PAGE 197

187 47. Candipan, R. C., Wang, B. Y., Buitrago, R., Tsao, P. S., and Cooke, J. P. (1996) Regression or progression Dependency on vascular nitric oxide. Arteriosclerosis Thrombosis and Vascular Biology 16, 44-50 48. Oomen, C. M., v an Erk, M. J., Feskens, E. J., Kok, F. J., and Kromhout, D. (2000) Arginine intake and risk of coronary heart disease mortality in elderly men. Arteriosclerosis, Thrombosis & Vascular Biology 20, 21342139 49. Walker, H. A., McGing, E., Fisher, I., Boger, R. H., B ode-Boger, S. M., Jackson, G., Ritter, J. M., and Cho wienczyk, P. J. (2001) Endotheliumdependent vasodilation is independent of the plasma L-arginine/ADMA ratio in men with stable angina: lack of effect of oral L-arginine on endothelial function, oxidative st ress and exercise performance. Journal of the American College of Cardiology 38, 499-505 50. Choy, J. C., Granville, D. J., Hunt D. W., and McManus, B. M. (2001) Endothelial cell apoptosis: biochemica l characteristics and potential implications for atherosclerosis. J Mol Cell Cardiol 33, 1673-1690

PAGE 198

Appendix A 188 APPENDIX A: Previous Publications Paper I: RNA interference and targeted knockdown of gene expression 189 Paper II: Regulation of endot helial argininosuccinate synthase expression and NO production by an upstream open reading frame 206 Paper III: The caveolar nitric ox ide synthase/argini ne regeneration system for NO production in endothelial cells 242

PAGE 199

Appendix A (Continued) 189 Journal of Clinical Ligand Assay M28204, 2005 RNA interference and targeted k nockdown of gene expression Bonnie L. Goodwin, MS and Duane C. Eichler, PhD Department of Biochemist ry and Molecular Biology University of South Flori da, College of Medicine Tampa, FL 33612 Corresponding Author: Dr. Duane Eichler, Dept. of Biochemistry and Molecular Biology, University of South Flori da, 12901 Bruce B. Downs Blvd., MDC7, Tampa, FL 33612 tel. (813) 9749716, fax (813) 97 4-7357, email: deichler@hsc.usf.edu

PAGE 200

Appendix A (Continued) 190 SUMMARY RNA interference (RNAi) is an evolut ionarily conserved process in which a double-stranded RNA (dsRNA) i nduces sequence-specific, gene silencing. The natural roles of RNAi have been suggested to include defense against viral infection and regulation of the expression of cellul ar genes. The mechanism by which dsRNA induces gene silencing invo lves a two-step process. First, the dsRNA is recognized by the ribonucleas e-III like enzyme Dicer, which cleaves the dsRNA into smaller dsRNAs of 2123 nt. These interfering RNAs are then incorporated into a multi-component complex which recognizes and targets a related sequence for either transcriptional inhibition, mRNA des truction, or mRNA translational inhibition. Although the use of these small RNAs to silence genes in vertebrate cells was only reported a few years ago, the emer ging literature now supports the view that most vertebr ate genes can be studied using this technology. This report provides a br ief introduction and discussion of the RNA interference system, the mechanisms that underlie the ability of these small RNAs to target specific silencing of m RNAs, approaches to generate interfering RNAs and deliver them to target cells, and their potential analytical and therapeutic use. KEYWORDS: small noncoding RNA, dsRNA, siRNA, miRNA, miRNP, shRNA, RISC, RNAi, RNA interference, Dicer

PAGE 201

Appendix A (Continued) 191 BACKGROUND: In the early 1990s, investigator s studying the development of a nematode worm, Caenorhabditis elegans made an unexpected discovery. They found that a mutation in a single gen e disrupted developmental timing, preventing C. elegans from passing through the first larval stage to the second. A gene search ultimately led to the identific ation of the mutat ed gene. The identity of this gene was confirmed by removing the mutation which restored the ability of C. elegans to pass through all four larval stages into mature adults (1). However, the subsequent characterization of t he gene and gene product proved to be somewhat surprising. The gene did not encode a protein, but rather a small molecular RNA. A few years later, this finding was further supported by work published on another gene encodi ng a small RNA. Mutation of this gene prevented C. elegans transition from the fourth larval stage to adulthood (2). Together, these results led investigator s to suggest that these genes which encode a small double stranded (dsRNA) (~21-23 nt), may be universal regulators of development. Consequently, genes like these were soon shown to be expressed from bacteria to man (3-6 ). Importantly, many of the genes encoding this type of small RNA were sh own to be similar in mammals, insects and worms. The discovery of a new class of genes that encode a small RNA led to their being called the biological equival ent to dark matter (7), comparing their recognition and discovery with the finding that the univ erse contains large quantities of socalled dark matter that makes up a significant portion of unaccounted mass. Similarly, the discovery of a new class of genes that encode these small noncoding RNAs, in part, seemed to hel p explain the unexpected and lower than anticipated number of genes encoded by the human genome. Functional roles for these small noncoding RNAs include de velopmental timing, cell death, cell proliferation, hematopoiesis and patterning of the nervous system (8). Computational methods estimate the total number of small noncoding RNA genes in humans to be 200-255 (9) and in C. elegans up to 123 (10). Analysis of the genomic position of 60 human small noncoding RNA s showed that 33 were localized in intergenic regions. Of the remaining small noncoding RNAs, 13 were found in sense orientation within introns of coding transcripts, 7 in sense orientation within introns of noncoding g enes, and 7 in the reverse orientation within an intronic region (5). These results suggested that small noncoding RNAs were either transcribed from their own promoters or derived from a pre-mRNA. Overall, small noncoding RNAs appeared to play an important role in two phenomena; gene inactivation and the c ontrol of gene expression during development. Two types of naturally occurring small nonc oding RNAs that mediate these processes will be discussed in the following review. Short interfering RNAs (siRNAs) are created by a mechanism that produces dsRNA by RNA polymerization of a primed singlestranded RNA template, or by

PAGE 202

Appendix A (Continued) 192 hybridization of overlapping transcrip ts. These small RNAs direct mRNA degradation and have been implic ated in chromatin modifi cation (11). MicroRNAs (miRNAs) are created from endogenous transcripts that have complementary inverted repeats that form RNA hairpins. The hairpin is processed into dsRNA and subsequently mediates translational repression. While gene inactivation seems to be implemented by siRNAs, developmental control seems to depend on miRNAs (12-14). Giv en the similarities in the two systems, parallel research efforts seeking to understand the mo lecular and genetic basis for these ostensibly separate RNAbased systems of gene regulati on ultimately provided evidence that gene inactivation and cont rol of developmental timing are interrelated (11, 15). RNA INTERFERENCE MECHANISM: SiRNAs occurring in nature are cleaved from long dsRNA by the dsRNA-specific RNase-III-type enzyme Dicer (16). Dicer cleaves the duplexes into 21to 28nucleotide siRNA du plexes which are recognized by components of the RNAi ma chinery. The RNA-induced silencing complex (RISC) incorporat es a single siRNA strand and cleaves the mRNAs that contain complementary sequence (17, 18). MiRNAs are 21to 22-nucleotide molecules processed from double-stranded hairpin precursors. Although small noncoding RNAs were initia lly distinguished as mi croRNAs (miRNAs) and short interfering RNAs (siRNA) based on their appar ently different functional roles, this distinction has become increasi ngly less clear. For example, both classes of small noncoding RNAs are deriv ed via a common pathway that is ultimately mediated by the Dicer ribonucl ease. Cleavage of dsRNA into siRNA occurs in the cytoplasm by the Dicer ribonuclease. In contrast, a single stranded RNA hairpin precursor is cleaved to produce a miRN A precursor by the endonuclease Drosha as part of a nuclear co mplex called the Microprocessor (19, 20). The miRNA precursor is then exported to the cytoplas m and further processed by Dicer (14). Both siRNA and miRNA form functional ribonucleoprotein particles (RNPs) containing only one strand of the small noncoding RN A. Although these RNP complexes may not be easily di stinguishable functional units, RISC refers to a siRNA-containing complex (17) and miRNP refers to an miRNA-containing complex (Figure 1) (21). What has become evident is that the tr anslational inhibition induced by miRNAs and the targeted mRNA degradation induced by siRNAs are not due to intrinsic differences between these classes of small RNAs, but rather result from the level of sequence homology between the small noncoding RNA and its target mRNA (reviewed in (22)). A few centrally loca ted mismatches target the mRNA to the translational inhibition pathway, whic h appears representativ e of most animal miRNAs (23-25). In contrast, perfect comp lementarity, repres ented by a siRNA, leads to targeted mRNA degradation. Thus miRNAs are most often viewed to downregulate gene expression by inhibi ting translation through imperfect or consensus complementarity to a target ed mRNA, while siRNAs are most often

PAGE 203

Appendix A (Continued) 193 viewed to downregulate gene expression by targeting t he mRNA for degradation through perfect complementar ity (Figure 1) (11). Targeted Gene Silencing: Since the discovery of RNAi in C. elegans (26), an increasing knowledge of RNAi has provided researc hers with a new and powerful tool that can be used in vitro as well as in vivo, to analyze gene function. There were, however, several potential obstacles to RNAi use in mammalian cells. Most mammalian cells harbor a potent antiviral response that is triggered by the presence of dsRNA viral replication in termediates. A key component of this response is a dsRNA-activated protein kinase, PKR, which phosphorylates and inactivates EIF-2 inducing, in turn, the generalized inhibition of translation (18, 27). In addition, dsRNA activates the 2,5-oligoadenylate polymerase/RNase L system and represses I B, resulting in progra mmed cell death (28, 29) However, Elbashir and colleagues (27, 30) found that they c ould trigger the RNA interference machinery in mammalian cells using in vitro -synthesized siRNAs (27) without inducing t he interferon response a nd consequent apoptotic response, a problem inherent in antisense RNA experiment s. To target a gene for silencing, the design of the siRNA duplex was shown to require accurate knowledge of at least a 20 nucleotide segment of the target mRNA. SiRNAs induce post-transcriptional sil encing with great spec ificity through RNARNA sequence recognition, and are optimal when they resemble the naturally active products of Dicer; which are bet ween 21 and 23 nucleot ides in length, contain 5-phosphate and 3 -hydroxyl termini and have a symmetric twonucleotide 3-overhang (typically TT). T he 3-overhang helps to ensure that the silencing ribonucleoprotein particles fo rmed have equal ratios of sense and antisense target sequence (18, 31). R egions of a targeted mRNA can be identified by selecting a DNA sequence at least 50 bases downstream of the translational start codon (27). The cDNA sequence that is typically searched for is a 23 nucleotide motif consisting of AA(N19)TT with between 30 and 50% GC content (27). A Blast search ( www.ncbi.nlm.nih.gov/BLAST ) should be conducted to ensure the uniqueness of the target ed sequence in the mRNA. The use of a scrambled siRNA, which contains the same nucleotide composition as the siRNA, but lacks significant sequence homology to t he target gene or to any other gene in the genome, is an im portant negative control. Optimization of Silencing Conditions: There are a number of design issues to be considered when planning a siRNA exper iment. The transfection conditions should be optimized dependi ng on the transfection system used. These conditions include siRNA concentration, cell density and efficiency of knockdown versus non-specific affects. There are se veral methods of siRNA silencing that can be utilized for both transient and stable gene knockdown. These include vector-based methods, PCR-based methods, in vitro translation of siRNAs and chemical synthesis of siRNAs by commercial sources.

PAGE 204

Appendix A (Continued) 194 General considerations: Since the efficiency of transfection of cells varies greatly, different transfection reagent s and conditions should be tested for each cell type. In addition, the serum content of the media should be considered since some systems require reduced serum content fo r optimal transfection. Ideally, for a new target, three to four potential siRNAs should be de signed and screened, and to maximize efficiency of siRNA deliver y, transfection param eters should also be optimized. A time course is usually established in order to define the optimal time required to effectively silence the gene. Parameters such as the relative abundance and turnover rate of the targeted mRNA can affect the optimal time for silencing to occur. Typically, effects can be seen as soon as four hours, but maximum inhibition most often is observed in 24 to 72 hours. Interestingly, the targeted mRNA can be depleted without redu ction of the encoded protein. This result may suggest that the protein is either very stable, abundant or both. siRNA Concentration: Titration of the siRNA should be used to determine the most efficient concentration that will produce effective gene silencing while minimizing potential unwanted effects such as non-specific targeting and cell death. A critical assumption of this appr oach is that the si RNA will selectively inhibit the complementary gene. However, it has been shown using expression profiling, that conventional siRNAs can, in a concentration-dependent manner, nonspecifically stimulate or repress expression of >1000 genes with protein products that are involved in diverse cellular functions (32, 33). These nonspecific effects on gene expression are not transient, and once initiated, are sustained throughout the course of siRNA treatment. Importantly, nonspecific effects do not simply result from cross-hybridization of transcripts containing regions of partial homology with the s iRNA sequence. Rather, a characteristic feature of nonspecific effects on gene ex pression is the dependence on siRNA concentration. For example, Semizarov (34) reported that nonspecific effects occurred at an siRNA concentration of 1 00 nM, but not at 20 nM. Significantly, 100 nM siRNA, a concentration often sugges ted by manufacturer s of siRNAs and siRNA-related products, is a concentrati on at which nonspecific effects were found to most often occur (32). These a nd other studies (35, 36), therefore, underscore the importance of determining t he lowest concentration that can be achieved to avoid nonspecific effects. T he most effective concentration of siRNA can be influenced by the gene to be targeted, the type of cell tran sfected, and the siRNA itself. The proper negative control is also important in the design and interpretation of the results. The negative control should have the same composition of nucleotides as the designed siRNA, thus the use of a scrambled siRNA control can ensure that effects m easured are indeed specific. In addition, a homology search should be conducted to ensure there is no homology of either the siRNA or the scrambled si RNA control to other genes.

PAGE 205

Appendix A (Continued) 195 Cell density: Optimal plating density s hould be determined by tr ansfection of cells plated at different levels of confluence. Confluen cy should be between 30 and 70%, depending on the transfection agent and the cell type used. If the cell density is too high or too low, transfe ction efficiency can be reduced. For reproducibility, cells s hould be transfected at a similar density for each experiment following a defined time period a fter trypsinization and plating. This density should be used for all future exper iments. The volume of the transfection agent should also be investigated to optimize transfection efficiency. Efficiency of knockdown: When designing s iRNA experiments, it is important to consider the issue of efficiency of knockdown versus undesired non-specific effects. For example, the turnover rate of the target protein should be taken into consideration when designi ng the experiment. Proteins with a long half-life require a longer incubation to see an effect ive knock-down at the protein level. Thus, proteins with half-lives measured in weeks would not make good targets for this technique. In addition, t he abundance of the protein should be considered. Knockdown of a highly abun dant protein would require a higher dosage of siRNA. Practicality dictates that this techni que would not be applicable for targeting essential genes where the silencing of such genes would reduce viability of the cell. Transient suppression of targeted gen e expression: There are a number of methods to produce siRNAs for use in mammalian systems. siRNAs can be produced by chemical synthesis, in vitro transcription, amplification of a PCRderived siRNA expression cassette or diges tion of long dsRNA by an RNase III family enzyme. All of these forms of siRNA can then be transfected into cells using a number of commercia lly available lipid transfect ion reagents that provide optimal siRNA transfection efficiency. A number of companies provide chemically synthesized siRNA of high quality, and there are an increas ing number of prevalidated siRNAs available. However, since several siRNAs may need to be screened to find an efficient knockdown target, chemical synthesis may be an expensive option when designi ng the initial experiment. Alternatively, siRNAs can be transcribed in vitro using oligonucleotides that have been designed to contain a RNA-polymerase recognition site (37). This method is a more cost-effective choice since the siRNAs can be produc ed quickly and used to screen multiple targeted sequences or silence multiple genes. The limitati ons of siRNAs relate to the transient nature of suppr ession and the restriction im posed by the rate of cell division. SiRNAs are not am plified, nor are they pr opagated, in mammalian cells. Another system that can be used to produce siRNAs for transient transfection involves the use of long RNAs which are transcribed in vitro and then digested with an RNase III enzyme (or Dicer) to pr oduce a population of siRNAs specific to the targeted transcript. This techniqu e overcomes the need to design and test several siRNA sequences in order to find an effective one to silence the target

PAGE 206

Appendix A (Continued) 196 gene. However, this approach also leaves open the possibility of nonspecific silencing of genes with related sequence. Finally, siRNA expression cassettes can be created by PCR usin g primers designed to contain an RNA pol III promoter, an siRNA hairpin sequence, and a RNA pol III termination site (38). It is important to consider that transi ent suppression of ta rgeted gene expression can result in a restricted analysis due to low transfection efficiencies and transient knockdown of gene expression. Typically in a transient experiment, only a fraction of the cells are expressing si RNA and therefore undergo silencing the desired gene product. Thus, while this technique is fast and straightforward, the effect is time-limited and restricted to cells which can be easily transfected. Stable suppression of targeted gene expressi on: To address the limitations of transient transfection of siRNAs, plas mid constructs have been designed to express short hairpin RNAs (shRNAs) that permit stable transfection of the siRNA (14, 39-44). The construct typically consists of a strong promoter, such as the U6 and H1 promoters, which drives the expression of a shRNA insert. The shRNA contains two inverted repeats that mimic siRNA structure separated by a short spacer region that makes up the loop. These shRNAs are processed by Dicer into siRNAs, thus producing effe ctive gene silencing (review on vector design (45)). While more time-consuming than transient transfection analyses, the stable suppression of targeted gene ex pression allows for the selection of established cell lines with persistent phe notypes (40). This technique also permits the development of st able gene knockdown in a variety of cell types, and constructs expressing shRNA are easily delivered to cells via conventional transfection methods. In addition to its role in initiating RN Ai, Dicer can also cleave 70 nt precursor stem-loop structure into single-stranded 21-23 nt RNAs (43). Interestingly, adenoviral (46, 47), adeno-associated (48, 49) and lentiv iral (50, 51) vectors have also been developed to allow the use of siRNAs in cell types which are difficult to transfect. Transgenic viruses have nearly 100% efficacy in penetration of all kinds of cells, incl uding primary, somatic and diff erentiated cells of whole organisms. Transgenic siRNA-expressi ng mice and rats developed to stably display knockdown phenotypes (52) demon strate the immens e potential of RNAi for the development of whol e animal model organisms. Therapeutic Uses: Recent developments have highlighted the enormous potential for RNAi as a t herapeutic approach(53). The use of RNAi in human cells leaves open the potential for a powerful new approach to gene therapy in human diseases (54). Vector-mediated RN Ai may lead to future therapeutic applications by persistent suppression of pathogenic proteins. The prospective use of siRNAs in a clinical setting has been strengthened by several studies targeting disease-related genes. Qin and colleagues (55) transfected human T

PAGE 207

Appendix A (Continued) 197 cells with a lentiviral c onstruct containing siRNA targeting the CCR5 gene product. Treated cells showed a significant reduction in expressi on of the CCR5 protein, as well as reduction in the rate of infection. Suppression by siRNAs directed against several regions of the HIV-1 genome, including the long-terminal repeat, and the accessory genes vif and nef reduced viral replication 30-50 fold in human cell lines and primar y lymphocytes (56). When cells were pre-treated with virusspecific siRNAs, HIV was taken-up normally, but expressed viral RNA levels were significantly reduced (56). In another study, siRNA was targeted to the BCR-ABL fusion gene product from the Philadelphia chromosome in patients with chronic myelogenous leukemia and acute lymphoblastic leukemia (57). This produced an apoptotic response in the targeted myeloid cells demonstrating that an RNAi strategy could possibly be used to specifically target tumor cells. SCA1 transgenic mice, a model for the neurodegenerative disorder spinocerebellar ataxia type 1 (SCA1)( 58), were injected in the brain with shRNAs. Expressed from an adeno-associ ated virus vector, the shRNA targeted the mutant SCA1 protein. Treatment resulted in protection from neuronal loss and improved neurological function. Overall, an important key to the therapeutic use of siRNAs will be effective delivery of vectors to the targeted tiss ue, while ensuring specificity and adequate dose. Nevertheless, whole animal studi es have shown that siRNAs can be applied by hydrodynamic delivery resulti ng in gene silencing in a variety of tissues (59, 60). Human trials deliver ing adeno-associated vi ral vectors have been used in cystic fibrosis and hemophilia B (61). Ongoing trials of delivery into the brain of Parkinson and Alzheimer pat ients may also help to assess the feasibility of this approach in humans (62). Recently, Soutschek et al. (63) reported on the intravenous delivery of a chemically modifi ed siRNA targeted against apolipoprotein B mRNA in mice This siRNA was able to silence expression of apolipo protein B in both the liver and jejunum which resulted in decreased levels of apolipopr otein B in plasma. In addition, there was also an effective reduction in to tal serum cholesterol. RNA INTERFERENCE AND HE TEROCHROMATIN SILENCING: Since RNA is able to base-pair with DNA, the potential use of RNAi to target specific DNA sequences and silence transcription has be en investigated. In yeast, small RNAs (64) and the RNA-silencing machinery have been shown to direct the formation of silent heterochromatin via methylatio n of histone H3 lysine9 (65). In another study, RNAi was targeted to CpG islands of the E-cadherin prom oter (66). This RNAi treatment resulted in silencing of expression through methylation at CpG sites, as well as methylation of histone H3 at lysine 9.

PAGE 208

Appendix A (Continued) 198 Conclusion: RNAi technology has revolutionized t he field of gene silencing in a variety of organisms. This natural phe nomenon provides a relatively new and extremely powerful tool to analyze gene func tion by specific silencing of the gene product of interest. The technology has rapidly become an invaluable tool for experimental biology in deciphering the molecular function of vast numbers of genes. Ongoing research continues to im prove and expand the applications of RNAi, both experimentally and therapeutically.

PAGE 209

Appendix A (Continued) 199 Figure 1: Proposed mechanisms for post-tr anscriptional targeted RNA interference. Long dsRNA and shRNA precur sors are processed to siRNA/miRNA duplexes by the RNase III-like DICER. The short dsRNAs are subsequently unwound and assembled into effector complexes: RISC (RNA induced silencing complex) or m iRNP. RISC mediates mRNA-targeted degradation and miRNP guides translational in hibition of targeted mRNAs. In animals, siRNAs guide cleavage of comp lementary target mRNAs, whereas miRNAs mediate translational in hibition of mRNA targets.

PAGE 210

Appendix A (Continued) 200

PAGE 211

Appendix A (Continued) 201 REFERENCES 1. Lee, R. C., Feinbaum R. L., and Ambros, V. (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843-854 2. Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A. E., Horvitz, H. R., an d Ruvkun, G. (2000) The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, 901-906 3. Lee, R. C., and Ambros, V. (2001) An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862-864 4. Lagos-Quintana, M., Rauhut, R., Lende ckel, W., and Tuschl, T. (2001) Identification of novel genes coding for small expressed RNAs. Science 294, 853-858 5. Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A., and Tuschl, T. (2003) New microRNAs from mouse and human. Rna 9, 175-179 6. Rivas, E., Klein, R. J., Jones, T. A., and Eddy, S. R. (2001) Computational identification of noncoding RNAs in E. coli by comparative genomics. Curr Biol 11, 1369-1373 7. Ruvkun, G. (2001) Molecular biolog y. Glimpses of a tiny RNA world. Science 294, 797-799 8. Ambros, V. (2004) The functions of animal microRNAs. Nature 431, 350355 9. Lim, L. P., Glasner, M. E., Yekta, S ., Burge, C. B., and Ba rtel, D. P. (2003) Vertebrate microRNA genes. Science 299, 1540 10. Lim, L. P., Lau, N. C., Weinstein, E. G., A bdelhakim, A., Yekta, S., Rhoades, M. W., Burge, C. B., and Bartel, D. P. (2003) The microRNAs of Caenorhabditis elegans. Genes Dev 17, 991-1008 11. Meister, G., and Tuschl, T. (2004) Mechanisms of gene silencing by double-stranded RNA. Nature 431, 343-349 12. Bartel, D. P. (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297 13. Carrington, J. C., and Ambros, V. ( 2003) Role of microRNAs in plant and animal development. Science 301, 336-338 14. Lee, Y., Jeon, K., Lee, J. T., Kim, S., and Kim, V. N. (2002) MicroRNA maturation: stepwise processing and subcellular localization. Embo J 21, 4663-4670 15. Mello, C. C., and Conte, D., Jr. (2004) Revealing the world of RNA interference. Nature 431, 338-342 16. Bernstein, E., Caudy, A. A., Hamm ond, S. M., and Hannon, G. J. (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363-366

PAGE 212

Appendix A (Continued) 202 17. Hammond, S. M., Bernstein, E., Beac h, D., and Hannon, G. J. (2000) An RNA-directed nuclease mediates posttranscriptional gene silencing in Drosophila cells. Nature 404, 293-296 18. Elbashir, S. M., Martinez, J. Patkaniowska, A., Lendeckel, W., and Tuschl, T. (2001) Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melano gaster embryo lysate. Embo J 20, 6877-6888 19. Denli, A. M., Tops, B. B., Plasterk, R. H., Ketting, R. F., and Hannon, G. J. (2004) Processing of primary microRNA s by the Microprocessor complex. Nature 432, 231-235 20. Gregory, R. I., Yan, K. P., Amuthan, G., Chendrimada, T., Doratotaj, B., Cooch, N., and Shiekhattar, R. (2004) The Microprocessor complex mediates the genesis of microRNAs. Nature 432, 235-240 21. Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., C harroux, B., Abel, L., Rappsilber, J., Mann, M., and Dr eyfuss, G. (2002) miRNPs: a novel class of ribonucleoproteins c ontaining numerous microRNAs. Genes Dev 16, 720-728 22. Matzke, M. A., and Birchler, J. A. (2005) RNAi-mediated pathways in the nucleus. Nat Rev Genet 6, 24-35 23. Olsen, P. H., and Ambros, V. (1999) The lin-4 regulatory RNA controls developmental timing in Caenorhabdi tis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev Biol 216, 671-680 24. Wightman, B., Ha, I., and Ruvkun, G. (1993) Pos ttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75, 855-862 25. Nelson, P. T., Hatzigeorgiou, A. G., and Mourelatos, Z. (2004) miRNP:mRNA association in polyribosomes in a human neuronal cell line. Rna 10, 387-394 26. Fire, A., Xu, S., Montgo mery, M. K., Kostas, S. A ., Driver, S. E., and Mello, C. C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811 27. Elbashir, S. M., Harbor th, J., Weber, K., and Tuschl, T. (2002) Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 26, 199-213 28. Williams, B. R. (1997) Role of the double-stranded RNA-activated protein kinase (PKR) in cell regulation. Biochem Soc Trans 25, 509-513 29. Gil, J., and Esteban, M. (2000) Induction of apoptosis by the dsRNAdependent protein kinase (PKR ): mechanism of action. Apoptosis 5, 107114 30. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498 31. Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001) RNA interference is mediated by 21and 22-nucleotide RNAs. Genes Dev 15, 188-200

PAGE 213

Appendix A (Continued) 203 32. Persengiev, S. P., Zhu, X., and Green, M. R. (2004) Nonspecific, concentration-dependent stimulation and repression of mammalian gene expression by small interfering RNAs (siRNAs). Rna 10, 12-18 33. Jackson, A. L., and Linsley, P. S. (2004) Noise amidst the silence: offtarget effects of siRNAs? Trends Genet 20, 521-524 34. Semizarov, D., Frost, L., Sarthy, A., Kroeger, P., Halbert, D. N., and Fesik, S. W. (2003) Specificity of short interfering RNA determined through gene expression signatures. Proc Natl Acad Sci U S A 100, 6347-6352 35. Bridge, A. J., Pebernard, S., Ducr aux, A., Nicoulaz, A. L., and Iggo, R. (2003) Induction of an interferon res ponse by RNAi vectors in mammalian cells. Nat Genet 34, 263-264 36. Sledz, C. A., Holko, M., de Veer, M. J., Silverman, R. H., and Williams, B. R. (2003) Activation of the interfer on system by shortinterfering RNAs. Nat Cell Biol 5, 834-839 37. Leirdal, M., and Sioud, M. (2002) G ene silencing in mammalian cells by preformed small RNA duplexes. Biochem Biophys Res Commun 295, 744-748 38. Castanotto, D., Li, H., and Rossi, J. J. (2002) Functional siRNA expression from transfected PCR products. Rna 8, 1454-1460 39. Yu, J. Y., DeRuiter, S. L., and Tur ner, D. L. (2002) RNA interference by expression of short-interfering RN As and hairpin RNAs in mammalian cells. Proc Natl Acad Sci U S A 99, 6047-6052 40. Paddison, P. J., Caudy, A. A., and Hannon, G. J. (2002) Stable suppression of gene expression by RNAi in mammalian cells. Proc Natl Acad Sci U S A 99, 1443-1448 41. Brummelkamp, T. R., Bernards, R ., and Agami, R. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550-553 42. Sui, G., Soohoo, C., Affar el, B., Ga y, F., Shi, Y., and Forrester, W. C. (2002) A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci U S A 99, 5515-5520 43. Paddison, P. J., Caudy, A. A., Bern stein, E., Hannon, G. J., and Conklin, D. S. (2002) Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 16, 948-958 44. Miyagishi, M., and Taira, K. (2002) Development and application of siRNA expression vector. Nucleic Acids Res Suppl 113-114 45. Arendt, C. W., Tang, G., and Zilberstein, A. (2003) Vector systems for the delivery of small interferi ng RNAs: managing the RISC. Chembiochem 4, 1129-1136 46. Xia, H., Mao, Q., Paulson, H. L., and Davidson, B. L. (2002) siRNAmediated gene silencing in vitro and in vivo. Nat Biotechnol 20, 1006-1010

PAGE 214

Appendix A (Continued) 204 47. Arts, G. J., Langemeijer, E., Tissingh, R., Ma, L., Pavliska, H., Dokic, K., Dooijes, R., Mesic, E., Clasen, R., Michiels, F., van der Schueren, J., Lambrecht, M., Herman, S., Brys, R., Thys, K., Hoffmann, M., Tomme, P., and van Es, H. (2003) Adenov iral vectors expressing siRNAs for discovery and validation of gene function. Genome Res 13, 2325-2332 48. Tomar, R. S., Ma tta, H., and Chaudhary, P. M. (2003) Use of adenoassociated viral vector for deliv ery of small interfering RNA. Oncogene 22, 5712-5715 49. Hommel, J. D., Sears, R. M., Georgescu, D., Simmons, D. L., and DiLeone, R. J. (2003) Local gene k nockdown in the brain using viralmediated RNA interference. Nat Med 9, 1539-1544 50. Wiznerowicz, M., and Trono, D. (2003) Conditional suppression of cellular genes: lentivirus vector-mediated dr ug-inducible RNA interference. J Virol 77, 8957-8961 51. Rubinson, D. A., Dillon, C. P., Kwiatk owski, A. V., Siev ers, C., Yang, L., Kopinja, J., Rooney, D. L., Ihrig, M. M., Mc Manus, M. T., Gertler, F. B., Scott, M. L., and Van Parijs, L. (2 003) A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet 33, 401-406 52. Hasuwa, H., Kaseda, K., Einarsdo ttir, T., and Okabe, M. (2002) Small interfering RNA and gene silencing in transgenic mice and rats. FEBS Lett 532, 227-230 53. Hannon, G. J., and Rossi, J. J. (2004) Unlocking the potential of the human genome with RNA interference. Nature 431, 371-378 54. Tuschl, T., and Borkhardt, A. ( 2002) Small interfering RNAs: a revolutionary tool for the analysis of gene function and gene therapy. Mol Interv 2, 158-167 55. Qin, X. F., An, D. S. Chen, I. S., and Baltimore, D. (2003) Inhibiting HIV-1 infection in human T cells by lent iviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci U S A 100, 183-188 56. Jacque, J. M., Triques K., and Stevenson, M. ( 2002) Modulation of HIV-1 replication by RNA interference. Nature 418, 435-438 57. Wilda, M., Fuchs, U., Wossmann, W ., and Borkhardt, A. (2002) Killing of leukemic cells with a BCR/ABL fusi on gene by RNA interference (RNAi). Oncogene 21, 5716-5724 58. Xia, H., Mao, Q., Elias on, S. L., Harper, S. Q., Ma rtins, I. H., Orr, H. T., Paulson, H. L., Yang, L., Kotin, R. M., and Davidson, B. L. (2004) RNAi suppresses polyglutamine-induced neurodegeneration in a model of spinocerebellar ataxia. Nat Med 10, 816-820 59. Lewis, D. L., Hagstrom, J. E., Loomis, A. G., Wolff, J. A., and Herweijer, H. (2002) Efficient delivery of siRNA fo r inhibition of gene expression in postnatal mice. Nat Genet 32, 107-108 60. McCaffrey, A. P., Meuse, L., Pham, T. T., Conk lin, D. S., Hannon, G. J., and Kay, M. A. (2002) RNA in terference in adult mice. Nature 418, 38-39

PAGE 215

Appendix A (Continued) 205 61. Flotte, T. R. (2004) Gene therapy progress and prospects: recombinant adeno-associated virus (rAAV) vectors. Gene Ther 11, 805-810 62. Howard, K. (2003) First Park inson gene therapy trial launches. Nat Biotechnol 21, 1117-1118 63. Soutschek, J., Akinc, A., Bramlage, B., Charisse, K., Constien, R., Donoghue, M., Elbashir, S., Geick, A. Hadwiger, P., Harborth, J., John, M., Kesavan, V., Lavine, G., Pandey, R. K., Racie, T., Rajeev, K. G., Rohl, I., Toudjarska, I., Wang, G., Wuschko S., Bumcrot, D., Koteliansky, V., Limmer, S., Manoharan, M., and Vornlo cher, H. P. ( 2004) Therapeutic silencing of an endogenous gene by system ic administration of modified siRNAs. Nature 432, 173-178 64. Reinhart, B. J., and Bartel, D. P. (2002) Small RNAs correspond to centromere heterochromatic repeats. Science 297, 1831 65. Volpe, T. A., Kidner, C., Hall, I. M., Teng, G., Grewal, S. I., and Martienssen, R. A. (2002) Regulat ion of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297, 1833-1837 66. Kawasaki, H., and Taira, K. (2004) Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature 431, 211-217

PAGE 216

Appendix A (Continued) 206 Journal of Biological Chem istry 280 (25), 24252-24260, 2005 Regulation of endothelial argininosu ccinate synthase expression and NO production by an upstream open reading frame Laura C. Pendleton, Bonnie L. Goodwin, Larry P. Solomonson and Duane C. Eichler Department of Biochemist ry and Molecular Biology University of South Flori da, College of Medicine Tampa, FL 33612 Running Title: Regulation of endothelia l AS expression and NO production Address correspondence to: Duane C. Eichle r, Department of Biochemistry and Molecular Biology, University of South Florida, 12901 Bruce B. Downs Blvd., MDC 7, Tampa, FL 33612; Tel. (813) 974-9716; Fax. (813) 974-9350; E-mail: deichler@hsc.usf.edu

PAGE 217

Appendix A (Continued) 207 SUMMARY Argininosuccinate synt hase (AS) catalyzes the ratelimiting step in the recycling of citrulline to arginine, which in endothelial cells, is tightly coupled to the production of nitric oxide (NO). In previous work, we established that endothelial AS mRNA can be initiated fr om multiple start sites, generating co-expressed mRNA variants with different 5-untranslated regions (5-UTRs). One of the 5UTRs, the shortest form, represents gr eater than 90% of the total AS mRNA. Two other extended 5-UTR forms of AS mRNA, resulting from upstream initiations, contain an out-o f-frame, upstream open-reading-frame (uORF). In this study, the function of the extended 5-UTRs of AS mRNA was investigated. Single base insertions to place the uORF in-frame, and mutations to extend the uORF, demonstrated functionality, both in vitro with AS constructs and in vivo with luciferase constructs. Over-expression of the uORF suppressed endothelial AS protein expression, while specific silencing of the uORF AS mRNAs resulted in the coordinate upregulation of AS prot ein and NO production. Expression of the full-length of the uORF was necessary to mediate a transsuppressive effect on endothelial AS expression, demonstrating that the translation product itself affects regulation. In conclusion, the uORF found in the ex tended, overlapping 5-UTR AS mRNA species suppresses end othelial AS expre ssion, providing a novel mechanism for regulating endothel ial NO production by limiting the availability of arginine. INTRODUCTION Nitric oxide (NO) synthesized from argini ne by endothelial nitric oxide synthase (eNOS) is a potent vasodila tor and a critical modulator of blood flow and blood pressure. In addition, it mediates vas oprotective actions through inhibiting smooth muscle proliferation, platelet aggregation, and l eukocyte adhesion [1-3]. Under pathophysiological conditions a ssociated with endothelial dysfunction, such as heart failure [4], hypertension, hy percholesterolemia, atherosclerosis [5], and diabetes [6], the ability to produce NO seems to be impaired. Paradoxically, NO production can be impaired by limited availability of the substrate arginine, in spite of apparently saturating levels of intracellular and extracellular arginine [710]. We have previously shown that under normal conditions, the essential arginine available for NO production is der ived from the recyclin g of citrulline to arginine, catalyzed by two enzymes, argininosuccinate synthase (AS) and argininosuccinate lyase (AL) [11, 12 ]. Although these two enzymes have been studied extensively in liver, where they par ticipate in the urea cycle [13], it was not until the discovery of NO that their function in non-hepatic tissues was clarified. In endothelial cells, AS and AL play a critical role in the operation of a citrulline-NO cycle, which supports endothelial NO production [14-17].

PAGE 218

Appendix A (Continued) 208 Because AS catalyzes the rate-limiting step in the citrulline-NO cycle [15], our initial studies have focused on the molecu lar basis for the functional role of endothelial AS. Endothelia l and hepatic AS appear to have the same primary structure [18, 19], but differ in cellular location and le vel of expression [11, 18]. Hepatic urea cycle AS and AL are associat ed with the mitochondria [20], while in endothelial cells, AS and AL co-localize with eNOS in caveolae [11]. AS expression in liver also differs from AS expression in endothelial cells as demonstrated by the diversity of co-e xpressed 5-UTR AS mRNA species in endothelial cells [18]. Three transcription in itiation sites identified in endothelial cells result in overlapping 5-UTR regi ons of 92, 66 and 43 nucleotides (nt). The longer forms make up ~7% of the total AS message, with the shortest 43 nt 5UTR AS mRNA being the pr edominant species in endot helial cells, and the only detectable form found in liver. Interestingl y, the extended 92 and 66 nt 5-UTR AS mRNAs contain an out-of-frame, upstream over lapping ORF that is terminated by a stop codon 70 nt past the in-frame start codon for the downstream ORF encoding AS. Pr eviously we reported that in vitro translation of AS mRNA containing the extended 5-U TRs was suppressed compared to the shortest and most predominant 43 nt 5 -UTR AS mRNA species [18]. Moreover, we also showed that the translational efficiency of the extended 5-UTR AS mRNA species was restored to the short form level when the uAUG was mutated to AAG, thus eliminating the uORF [18]. This suppression of expression through ciseffects was further demonstrated in vivo when the three forms of the AS 5UTR were placed in front of a lucifera se ORF and transfected into endothelial cells. Here again, the presence of the uAUG found in the extended AS 5-UTRs suppressed expression of luciferase in a cisdependent manner. Upstream ORFs can affect the translation of a downstream ORF in a variety of ways [21]. In higher eukaryotes, initiati on of translation generally occurs at the first AUG that resides in a favorable context. When the first AUG context is suboptimal, a portion of the scanning ribosom es may continue pa st the first AUG and initiate translation dow nstream at subsequent AUGs via leaky scanning [22]. Several eukaryotic mRNAs have been shown to contain one or more ORFs that affect the translational efficiency of the main, downstream ORF [21]. Depending on factors such as intercistronic length and secondary structure, scanning ribosomes, upon initiation at the uAUG, can either translate the uORF and reinitiate downstream or stall on the mRNA during elongation, thus preventing initiation at other sites [21]. In other ca ses, partial translati on of the nascent peptide prevents downstream re-initiation by interaction of the peptide with a protein or RNA in the ribosome preventing termination from proceeding efficiently [23]. However, another less co mmon event is for the uORF to be translated and for the peptide product to affect translation of the downstream cistron via a trans mechanism [24]. Based on these examples and our previous findings, we show in this report that the uORF in t he extended 5-UTR AS mRNA species is

PAGE 219

Appendix A (Continued) 209 functional and acts to limit overall AS expression as well as NO production, thus providing a novel mechanism for regulating endothelia l NO production. EXPERIMENTAL PROCEDURES Cell Culture Bovine aortic endothelial cells (BAEC) were cultured in Dulbeccos modified Eagles medium (1g/L glucos e, Mediatech) supplemented with 10% fetal bovine serum (Hyclone Lab oratories), 100 units/ml penicillin and 100 g/ml streptomycin (Mediatech) at 37 C and 5% CO 2 Preparation of AS Constructs Full-length AS cDNA was constructed to contain either the 92 nt or the 43 nt 5-UTR, shown in Fig. 1, and subcloned into the vector pPDM-2 (Epicentre Technologies) as previously described [18]. Mutations were created in the constructs by multip le rounds of PCR amplification using Pfu Turbo DNA Polymerase (Stratagene) in a reaction containing 1X Pfu reaction buffer (10 mM KCl, 10 mM (NH 4 )SO 4 20 mM Tris-HCl, pH 8.75, 2 mM MgSO 4 0.1% Triton X-100, and 0.1 mg/ml BSA), 2 00 M each dNTP, 50 pmol of each primer, 10 ng digested plasmid template and 2.5 units of Pfu Polymerase. PCR reactions consisted of 30 cycles at 95 C for 1 min, 50 C for 1 min and 72 C for 2 min. In the 92 nt construct, single base in sertions of A residues were made at positions -1 (Ins 1) and -39 (Ins 2) relative to the AS AUG (Fig. 1). These mutations placed the uAUG and the AS AUG in the same fr ame. A left primer containing the insertion in the center, either ASL11MFS (5 CAC CCG TCA CG A ATG TCC GGC AA 3) for Ins 1 or ASL-48MFS (5 AAC CCG CCC T A G CTC CGC CGA CT 3) for Ins 2 were pair ed up with ASR429 (5 GAG CGA TGA CCT TGA TCT GT 3) to amplify a section of the 92 nt 5-UTR construct (inserted bases are underlined). This PCR product was then used as a right primer and paired with ASL-92T7 [18] to produce a frag ment with the mutation in the center and the restriction sites Bam H I and Nar I on either end for cloning back into the pPDM-2 vector in place of the wild-type fragment. Because the yield of product in the second round of PCR was typically very low, a third round of PCR was performed using the second round product as template, and using the primers ASL-92T7 and ASR429 to re-amplify the ta rget fragment before restriction digestion and subcloning. Mutations were also made in the 92 and 43 nt constructs to convert two uORF stop codons to lysine residues thereby extending the product encoded by the uORF from 4.5 kDa to 21 kDa. The tw o UGA codons at posit ions +70 and +153 relative to, but out-of-frame with, t he AS AUG were change d to AAA codons. Primers ASL59MStop (5 TCC TCG TGT GGC AA A AGG AGC AAG GCT 3) and ASR168MStop (5 GGC CCC AAG CTT TT G CGC CTT CTT CC 3) were combined to amplify a fragm ent of AS that contained both of the stop mutations (mutated bases are underlined). This fragment was then used as a right primer in

PAGE 220

Appendix A (Continued) 210 the same strategy used for the inserti on mutations, followed by a third round PCR reaction using ASL-92T7 and ASR169M Stop to enrich for the target fragment. Bam H I (incorporated in ASL-92T7) and Hin d III (site marked by dashed underline in ASR168MSt op primer) restriction enzymes were used to clone the mutated fragment in to the AS 92 nt 5-UTR pl asmid. All constructs were verified by sequencing. In Vitro Transcription/Translation AS constructs were digested with Eco RV at a site past the 3-end to prevent runon transcription. Template DNAs were transcribed using T7 RNA polymer ase with the addition of Ribo m 7 G Cap Analog (Promega) following the manufacture rs protocol recommended for m 7 G cap incorporation. Transcribed RNA was DNase treated and purified using minispin G50 Sephadex (CPG) columns. The Flexi Rabbit Reticulocyte Lysate System (Promega) was used for the translation reaction following t he manufacturers protocol, with the addition of 10 Ci [ 35 S]-L-methionine (GE Healthcare) and 500 ng capped RNA. KCl conditions were optimized to 40 mM. Translated proteins were separated by sodium dodecyl su lfate polyacrylamide gel electrophoresis (SDS-PAGE) on 10% Tris-HCl Ready Gels (Bio-Rad Laboratories). Gels were fixed in 50% methanol and 10% acetic ac id for 30 min, followed by a second solution of 7% methanol, 7% acetic acid 1% glycerol for 5 min, dried on a gel dryer for 2 hr, and exposed to film. Band intensities were quantitated using a ChemiImager 4400 (Alpha Innotech). Preparation of Luciferase Constructs Luciferase reporter constructs were designed to include different sections of the AS 5-UTR cloned directly after the simian virus 40 promoter and before the start codon of the luciferase gene. One set of clones contained truncated forms of the 5-UTR, the sequence spanning the region from eit her the -66 or -92 nt positions to the uAUG at position -57 relative to the AS AUG. Left pr imers LucASL-66 (5 AGA AAG CTT ACC CGG GAT G GA AGA CGC CAA AAA CAT 3) and LucASL-92 (5 AGA AAG CTT CCC TGC CCC CCG G CC CCG AGC TTA TAA CCC GGG ATG GAA GAC GCC AAA AAC ATA 3) both contain a Hin d III site on the 5-end, AS 5-UTR sequence (underlined), and the first 17 bases of the luciferase gene after the AUG on the 3-end. These primers were combined with RTLuc1R (5 CAC CTC GAT ATG TGC ATC TG 3) to amplif y a small fragment of the luciferase gene which was then cloned into pGL3Control vector (Promega), using Hin d III and Nar I, so that the various AS 5-UTR segments replaced the luciferase 5-UTR. Another luciferase construct, described pr eviously [18], was designed to contain the entire 92 nt of t he AS 5-UTR in front of the luciferase gene. This construct was mutated, using the three round PCR method described in the preparation of AS constructs, to contain a single base inse rtion at position -39 (Ins 2 in Fig.1).

PAGE 221

Appendix A (Continued) 211 Similar to the AS Ins 2 mutation, th is mutation put the AS uAUG and the luciferase AUG in-frame. Construc ts were verified by sequencing. Luciferase Assays BAEC to be used for transfections were plated at 6 x 10 4 cells per well in a 24-well plat e, twenty-four hours prior to transfection. Control plasmids (Promega) included pGL3Control as a positive control, pGL3Basic as a promoterless negative control, and pRL-TK, a renilla expression vector, as an internal transfection control. Control, Basic, and experimental plasmids (200 ng each), and pRL-TK (50 ng) we re transiently transfected into BAEC using TransitLT1 (Mirus) in serum-free media. After 4.5 hr, media was replaced with media containing 10% serum and cells were cult ured for 48 hr. Lysates generated with Passive Lysis Buffer (Promega) were assa yed for luciferase and renilla activity using Promegas Dual-Luciferase Report er Assay System according to the manufacturers recommendations. Luciferas e and renilla activity were measured as relative light units us ing a luminometer (Turner Designs). Experiments were carried out three times in triplicate. Luciferase expression was normalized to renilla activity. Passive Lysis Buffer lysates were separated by SDS-PAGE on 10% Tris-HCl Ready Gels and blotted onto Immobilon-P PVDF membranes (Millipore). Western blotting was performed as previously described [18]. Primary antibody used was anti-luciferase (C ortex Biochem) at a 1:500 dilution. Secondary antibody used was peroxid ase-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Labs) at a 1:50,000 dilution. Blots were visualized by chemiluminescence using ECL reagent (G E Healthcare) and exposed to film. Band intensities were quantitat ed using a Ch emiImager 4400. Preparation and Transfecti on of ASuORF Contructs For transfection studies with the AS uORF, AS sequence covering the region from -92 to +70 relative to the AS AUG was cloned into pcDNA 3.1/V5His B expression vector (Invitrogen). Primers ASL-92BamHI (5 AGT C GG ATC CCC CTG CCC CCC GGC CCC GAG 3) and ASR73EcoRI (5 TGC AG A ATT CCC GCC ACA CGA GGA TGC AGG AGG 3) were used to amplify th is region. Both primers contained restriction sites inserted for cloning into the pcDNA vector and the right primer was designed to eliminate the uORF stop codon at position 72, thereby linking the uORF to the V5 and His tags in the vector (ASuORF). For a negative control, this same region was amplified from a previously described construct in which the uAUG at position -59 was mutated to AAG [18], thereby rendering the AS uORF non-functional (AAGNegC). BAEC to be used for transfections were plated at 2 x 10 5 cells per well in a 12well plate twenty-four hours prior to transfection. Experimental plasmids, ASuORF, AAGNegC, and the empty vector (0.8, 1.6 and 2.4 g each) were transiently transfect ed into BAEC using Lipofectamine 2000 (Invitrogen) in serum free Opti-MEM I (Invitrogen). After 4 hr, media was replaced with DMEM containing 10% serum and cells were cultured for 24 hr.

PAGE 222

Appendix A (Continued) 212 Additional constructs of the AS uORF were used to in vestigate the effects of sequence and/or length of the uORF rela tive to its ability to suppress AS expression. Mutations were made that deleted a residue at position -53 and inserted a residue at position +69 relative to the AS AUG in order to cause a frame-shift in the peptide sequence of the AS uORF. Primers uORFfsleft (5 ACC CCG GGA TGC GC / C CGA AAC CCG 3) and uORF fsright (5 CAG AAT TCC CGC C CA CAC GAG GAT 3) were used to amplify by PCR the mutated fragment. The deletion and insertion sites are marked by a hash mark and an underline, respectively. A Sma I site in the left primer and EcoR I site in the right primer were used to clone the fragment into the ASuORF expression vector in place of the wild-type fragm ent. Similarly, mutations we re introduced to move the AS uORF start codon downstream to positi on +1 relative to the AS start codon and to move the ASuORF stop codon upstr eam to position +1 1. Using primers uORFdnsAUG (5 GCT GGT CAC CCG TCA CGA ATG CCG GCA AAG GCT C 3) and uORFupsStop (5 GCT GGT CAC CCG TCA CGA TGT CCG GCA TAG GCT CCG TGG 3) combined with ASR73 EcoRI, the mutated fragments were amplified and cloned using the BstE II site in the forward primers and the Eco R I site in the reverse primer. The dnsAU G (downstream AUG) mutation fragment was cloned into the AAGNegC construct that was lacking the normal uAUG. The upsStop (upstream stop) fragment was cloned into the wild-type ASuORF construct. BAEC were transfected as described in the previous section. AS uORF constructs were developed whic h allowed the protein product to be easily resolved and visualized by SDS-PA GE analysis. Green fluorescent protein (GFP) was amplified from the pGreen Lantern plasmi d (Invitrogen) using the primers GFPleft (5 AGT CGG CGG CCG CCG CCA CAT GAG CAA GGG C 3) and GFPright (5 CTA GAG CGG CCG CAC TTG TAC AGC 3). The left primer contained a Not I site for cloning and deleted a base between the Not I site and the AUG to place GFP and the AS uORF in-frame. The right primer also contained a Not I site for cloning and deleted a base at the GFP stop codon to mutate out the stop codon and also to put GFP in-frame with the V5 and His tags. GFP was cloned into the ASuORF construct at the Not I site between the uORF and the V5/His tags. GFP was also cloned into the uORFfs (frame-shift) construct in the same manner. Constructs were verified by sequencing, and BAEC were transfected as described in the previous section. RNA Duplex Preparation and Transfection Ambions Silencer siRNA Construction Kit was used to synthesize 21-nucleotide RNA duplexes. Target sequences were chosen following the guidelines described by Tuschl et al. [25]. The siRNA sequence specific to AS corresponded to nt -65 to -47 (Fig. 1) relative to the first nucleotide of the AS start codon (5CCC GGG AUG CGC GCC GAA Att 3). A control siRNA was designed by scrambling the bases of the AS siRNA (5ACA GAG GGA CUC GCC CGC Gtt 3). Both sequences were subjected to BLAST search to rule out homology to mRNAs encoding known proteins.

PAGE 223

Appendix A (Continued) 213 Twenty-four hours prior to tr ansfection, BAEC were seeded in a 24-well plate at 1 x 10 5 cells per well. Transfection of s iRNA was carried out with TransIT-TKO (Mirus) as described by the manufacturer. For each well, 10-25 nM siRNA duplex was combined with 3 l liposome in serum-f ree DMEM and applied to cells at 8090% confluency. Cells were assa yed 24 hr after transfection. Cell Lysate Preparation and Immunoblotting BAEC were trypsinized and then washed in ice cold phosphate-buffered saline (PBS) and resuspended in RIPA buffer (1% NP-40, 0.5% sodi um deoxycholate, 0.1% SDS, 1X protease inhibitors (Calbiochem) in PBS) by vigorous pipetti ng followed by brief vortexing. The lysate was incubated on ice for 30 mi nutes and the protein concentration was determined by BCA assay (Pierce). Equal amounts (5-10 g) of protein were resolved on 4-15% Tris-HCl Ready Ge ls and blotted onto Immobilon-P PVDF membranes. Western blotting was per formed as previously described. Membranes were incubated with prim ary antibody, 1:2500 anti-AS (BD Transduction Labs), 1:5000 anti-V5 (Invit rogen), 1:7500 anti--Actin (Sigma Chemical Co.), or 1:2000 ant i-GAPDH (Novus Biologicals). Secondary antibody used was peroxidase-conjugated goat anti -mouse or anti-rabbit IgG (Jackson ImmunoResearch Labs) at 1: 50,000 dilution for all prim ary antibodies except Actin, where the secondary antibody dilu tion used was 1:75,000. Blots were visualized by chemiluminescence usi ng ECL reagent and exposed to film. RNA Isolation and Quantitative RT-PCR Total RNA was isolated from BAEC by the method of Chomczynski and Sacchi [26] using Tri Reagent (Molecular Research Center) according to the m anufacturers protocol. Pellet Paint CoPrecipitant (Novagen) was added to help visualize the small RNA pellets. RNA was treated with DNase using the DNA-free Kit (Ambion) and quantitated prior to reverse transcription with ol igo (dT) primers using t he Superscript First Strand cDNA Synthesis Kit (Invitr ogen) following the manufacture rs protocol. Real time quantitative PCR was performed as prev iously described using AS specific primer sets ASL228 and ASR278 for detecting all AS mRNA, and ASL-62 and ASR-12 for detecting the extended 5-UTR forms of AS mRNA [18]. Results were normalized to -Actin using primers a ctinfor (5 GAG GCA TCC TGA CCC TCA AG 3) and actinrev (5 TCC ATG TCG TCC CAG TTG GT 3). Nitric Oxide Assay Basal levels of nitrite were measured in the cell culture media twenty-four hours after transfection with si RNA as an indicator of cellular NO production using a fluorometric method [ 27]. Twenty-four hours after transfection of the AS uORF overexpres sion constructs, BAEC were stimulated with 50 M sodium orthovanadate and 0. 5 M A23187 calcium i onophore for two hours [28], and media was collected for nitrite assay. Samples were read on a BMG FLUOstar Galaxy spectrofluorometer plate reader exciting at 360 nm and detecting emission at 405 nm. Cells were counted by trypan blue exclusion, and data is presented as ni trite produced per 1 x 10 6 cells.

PAGE 224

Appendix A (Continued) 214 RESULTS Functionality of the AS uAUG in an In Vitro Transcr iption/Translation System Since the extended AS 5-U TRs, containing an uAU G, were shown to act in cis to downregulate the translation of AS mR NA [18], studies were carried out to determine whether the ciseffect was due to initia tion at the uAUG and/or translation of the uORF. To examine the functionality of the uAUG in the extended 5-UTR AS m RNAs, two different mutations were made in a full-length AS construct containing the 92 nt 5-U TR. A single nucleotide was inserted between the uAUG and the downstream AS AUG, placing the uORF in-frame with the AS ORF so that initiation at either AUG would produc e AS protein. One insertion was placed in close proximity to the AS AUG (Ins 1), while the other was placed more distal, 39 nt upstream from the AS AUG (Ins 2) as shown in Figure 1. The two different nucleotide insertions were chosen such that secondary structure (folding pattern) of the RNA was predicted to be essentially the same for mutated and wild-type ve rsions. Transcribed RNA from each construct was verified to be a single band by agarose gel electrophoresis and ethidium bromide staining (Fig. 2). All constructs were transcribed and translated in vitro in the presence of [ 35 S]-L-methionine. Translated products were separated on SDS-PAGE as shown in Figu re 2. The wild-type AS 92 nt 5-UTR construct yielded a single product of ~47 kDa, the expected size of AS [29]. Both of the insertion mutant constructs yielded doublets of ~ 47 kDa and ~49 kDa, where the 49 kDa band repr esented the calculated size of the AS protein if translation was initiated us ing the uAUG. The amount of label observed in the ~47 kD bands reflects not only the cis -negative influence of the uORF as observed in the intact 92 nt extended AS mRNA, bu t also the relative efficiency of downstream initiation observed in the case of the tw o insertion mutations. In addition, the slight decrease in the Ins 1 ~47 kDa band may indicate the influence of an inserted nucleotide within t he boundaries of the Kozak consensus sequence [30] at the downstream AUG, diminishing the efficiency of translational initiation. Western blot analysis c onfirmed that both bands represented AS sequence (data not shown). For the Ins 1 mu tation, quantitation of the two bands showed that initiation from the uAUG was 1.8 ti mes greater than from the downstream AUG. For the Ins 2 mutation, t he level of initiati on from the uAUG was 1.4 times the level of the AS AUG. When the context of the uAUG was further altered by changing nucleotides -3 to A and +4 to G relative to the uAUG to better match a consensus Kozak sequence [30], initiation of translation shifted almost entirely to the uAUG (data not shown). These results suggest that the cis effects of the uAUG in t he extended length 5 -UTR AS mRNAs resulted from its functional use, and that the low level of translation from the downstream AS AUG may result from leaky scanning [22] due to the moderately subo ptimal context of the uAUG [18].

PAGE 225

Appendix A (Continued) 215 To demonstrate that the uO RF was functional in its normal out-of-frame mode, two mutations were created in the full-l ength AS mRNA construct containing the 92 nt 5-UTR. These mutations changed the first two stop codons in the uORF to lysine residues, thus extending the trans lation product of the out-of-frame uORF from an ~4 kDa to an ~21 kDa protein that could be easily visualized on an SDSpolyacrylamide gel by [ 35 S]-L-methionine incorporation. To control for the effect of these mutations, which changed two leucin es to glutamines in the downstream ORF encoding AS protein, the same mutations were introduced into the 43 nt 5UTR AS mRNA construct. All construc ts were transcribed and translated in vitro in the presence of label, and the translated products were analyzed by SDSPAGE analysis (Fig. 3). Translation of the 43 nt 5-UTR AS mRNA construct yielded a single band of t he correct size (~47 kDa) for AS, showing that the mutations (two amino acid changes) did not affect transl ation. Translation of the 92 nt 5-UTR AS mRNA construct, however, resulted in two [ 35 S]-L-methionine labeled bands; an ~47 kDa and a second smaller protein product at ~21 kDa, demonstrating that the out-of-frame uO RF is functional. The broad darkened region at about 30 kDa was cons idered to be unrelated to the in vitro translation of the extended 92 nt 5-UTR AS mRNA species since it was most predominant in the translation of the 43 nt 5-UTR AS mRNA. These results provide further evidence that ribosomes can translate the entire uORF rather than prevent the translation of the downstream ORF encoding AS by stalling at t he uAUG [21, 30]. In Vivo Functionality of the AS uAUG W hen Placed Immediately Upstream of a Luciferase ORF To demonstrate the functionality of the AS uAUG in endothelial cells, luciferase constructs were generat ed that replaced the luciferase 5-UTR with forms of the extended AS 5-UTRs, s panning the region from either the -66 or -92 nt positions to the uAUG. As shown in Figure 4, the c onstruct containing the sequence from position -66 to -57 (the site of the uAUG) expressed luciferase activity at ~60% of control, while the 92 to -57 nt construct expressed luciferase activity at a lower level, ~36% of contro l. The fact that luciferase expression with the extended AS 5-UTRs wa s lower than that of the control may reflect differences in the influence of the normal 5-UTR versus the replacement AS 5UTRs. These results demonstrated that the uAUG is sufficient to support luciferase expression in endothelial cells. In Vivo Functionality of the AS uAUG in Relation to a Downstream Luciferase ORF To determine the in vivo functionality of the AS uA UG in the presence of a downstream ORF, a full-length luciferase ORF construct was modified to contain the 92 nt AS 5-UTR with the out-of-frame uAUG. An additional luciferase construct was generated that contained an Ins 2 mutation in the 92 nt AS 5-UTR which positioned the AS upstream AUG an d the downstream luciferase AUG inframe. As shown in Figure 5, there was no significant difference in luciferase activity levels for the control constr uct and the insertion mutation (lns 2) luciferase construct. Howeve r, the luciferase activity level for the 92 nt AS 5-

PAGE 226

Appendix A (Continued) 216 UTR luciferase construct containing an out-of-frame uAUG was approximately 20% of the control activity. Western bl ot analysis to follow luciferase protein levels showed a single band of ~61 kDa for the control construct and a barely detectable 61 kDa band for the 92nt AS 5-U TR/luciferase construct containing the out-of-frame uAUG. In contrast, the 92 nt AS 5-UTR/luciferase construct with the lns 2 mutation placing the uAUG in -frame, showed a doublet of ~61 and ~63 kDa. The 61 kDa protein co rresponded to the luciferase ORF initiated from the downstream AUG, whereas the 63 kDa pr otein corresponded to a luciferase protein initiated from the in -frame uAUG in the 92 nt AS 5-UTR Ins 2 construct. These results demonstrated that the uA UG in the extended 5-UTRs of AS mRNA can function in the presence of a functional downstream ORF in endothelial cells. The Effect of Overexpression of the AS uORF on Endothelial AS Expression and NO Production To investigate possible trans -effects of the AS uORF, AS sequence from -92 to +70, relative to the AS AUG, was cloned into pcDNA3.1 vector so that the uORF was fused to a V5/His tag (ASuORF). For a negative control construct, the uAUG at posit ion -59 was mutated to AAG, thereby rendering the AS uORF non-functional (A AGNegC). Equal am ounts of protein from endothelial cells tr ansfected with 0.8, 1.6, and 2.4 g of ASuORF, AAGNegC, and vector plasmid DNA, along with a lipofectamine-alone control, were analyzed by western blot analysis with anti-V5 and antiAS antibodies. The putative product of the uORF, approximatel y 7 kDa protein with the V5/His tag, could not be visualized by western blo tting with the V5 antibody. However, transfection of the AS uORF reduced en dogenous AS protein levels, in a dose dependent fashion when compared to tr ansfection reagent alone (Fig. 6). Transfection of the pcDNA empty vector had no effect on endogenous AS protein levels, and the AS uORF negat ive control with the uAUG mutated to AAG had, at most, only a slight effect on AS expression. These results indicate that the overexpression of t he AS uORF elicited a profound trans -suppressive effect on endothelial AS expression. This suppressi on was not due to the presence of AS uORF transfected RNA alone since overexpr ession of the mutant that deleted the uORF by converting the start codon to AAG (designed to be transcribed but not translated) had essentially no effect on AS expression. The production of arginine by AS and AL in endothelial cells provides an essential source of arginine for NO pr oduction [11, 12]. To examine whether the overexpression of the AS uORF and the accompanying decrease in AS protein had an effect on NO production, cells were stimulated twenty-fours after transfection with sodium orthovanadate a nd calcium ionophore [28]. Aliquots were removed two hours after stimulation to measure nitrite as an indicator of cellular NO production. At the highest pl asmid concentration of the ASuORF transfected, NO production was decreased to 5% of a control with lipofectamine alone (Fig. 6). Although the empty vect or and the AAG mutant showed some

PAGE 227

Appendix A (Continued) 217 negative effect relative to the lipofec tamine control, the magnitude and dose dependent decrease in NO prod uction correlated significant ly only with the loss of AS protein in AS uORF tr eated cells. These results were also in keeping with those from previous work demonstrating the essential role of AS in endothelial NO production [12], despite excessive levels of intracellular and extracellular arginine. Requirement for AS uORF Sequence and L ength for Suppression of Endothelial AS Protein Levels and NO ProductionTo investigate w hether sequence and/or length of the uORF are prerequisites for the trans -suppressive effects of the uORF on endogenous AS expression, we ex amined the overexpression of point mutation constructs with altered uORF structures. The first mutation was constructed with the initiation codon of the uORF left unchanged, but a deletion in the third codon and an insertion at the last codon caused a frame-shift in the amino acid sequence. This frame-shi ft mutation (uORFfs) yielded an ORF potentially encoding the same length peptide (44 amino acids), but where only the first two amino acids of the AS uORF were conserved. A second mutation was constructed with a new start codon for the AS uORF introduced 60 nucleotides downstream of the original, so as to potentially encode only 23 amino acids of the C-terminus of the putativ e peptide (dnsAUG). A third mutation generated a construct where the stop codon was moved upstream in order to potentially encode 23 amino acid s from the N-terminus ( upsStop) of the putative peptide. As shown in Figure 7, none of the mutated constructs showed the degree of suppression of AS expression or NO pr oduction exhibited by the wild-type AS uORF. These series of experiments demonstrated that both the sequence and the length of the AS uORF found in the extende d 5-UTR AS mRNAs are necessary to elicit negative trans -effects on endothelial AS expression and NO production. Regulation of AS Expression by the Translation Produc t of the AS uORFTo demonstrate that the transla tion product of the AS uO RF suppresses overall AS expression in endothelial cells and to faci litate detection of the translation product, the protein was tagged by clon ing green fluorescent protein (GFP) between the AS uORF and the V5/His tags of the ASuORF pcDNA3.1/V5-His B construct. An additional construct involv ed GFP cloned into the AS uORF frameshift construct (uORFfs). Equal amounts of protein from lysates of endothelial cells transfected with 0.8, 1.6, and 2.4 g of ASuORF-GFP and uORFfs-GFP, in addition to a lipofectamine al one control, were analyzed by western blot analysis. As shown in Figure 8, a dose dependent increase in the ASuORF-GFP-V5/His tag fusion protein ( ~37 kDa) directly correlated with a decrease in endogenous AS protein levels. Expression of the frame-shift uORF construct, which produced

PAGE 228

Appendix A (Continued) 218 a protein of equal size but different am ino acid content had no effect on AS protein levels. These results demonstrated that the protein encoded by the AS uORF mediates the negative trans -effects on endothelial AS expression. Effect of Silencing of the Extended 5-UTR AS mR NAs on Endothelial AS Expression To further demonstrate the trans -suppressive effect of the uORF on endothelial AS expression, an siRNA was desi gned to selectively knock down the 92 and 66 nt 5-UTR AS mRNA species. Analysis of AS mRNA in transfected endothelial cells by real-time RT-PCR demon strated that a scrambled form of the siRNA (control) had no effect on the leve ls of the extended forms of AS mRNA. In contrast, an siRNA directed against the extended 5-UTR AS mRNA species decreased both the 92 and 66 nt 5-UTR AS mRNAs to ~20% of transfection reagent alone (Fig. 9). Importantly, the le vel of total AS mRNA was essentially unaffected, consistent with the fact that the extended 5-UTR forms of AS mRNA containing the uORF r epresent less than 7% of the total message. Equal amounts of protein from the extended AS 5-UTR siRNA and from scrambled siRNA transfected endothelial ce lls were examined by western blot analysis using anti-AS antibody. AS protein leve ls, normalized to GAPDH expression, were markedly increased in response to selective silencing of the 92 and 66 nt 5-UTR AS mRNAs. An ~2.3-fold incr ease in expressed AS protein was seen compared to the scrambled si RNA at the 25 nM concentra tion of siRNA (Fig. 9). These results suggest that the trans -effects of the uORF found in the extended 5-UTR AS mRNA forms are mediated pos t-transcriptionally, and most likely at the translational level. Effect of Silencing of the Extende d 5-UTR AS mRNAs on NO Production Based on the previous results demonstrating that AS expression levels are coordinately linked to the production of NO in endothelial cells, we examined whether the knockdown of the endogenous extended 5-UTR AS mRNA species and the accompanying increase in AS protein had an effect on the NO produced in these cells. Aliquots of media were removed tw enty-four hours after transfection of 25 nM siRNA specific for the extended AS 5 -UTR or a scrambled negative control siRNA, and nitrite as an indicator of ce llular NO production was measured. As shown in Table I, an ~2.2 fold increase in basal cellular NO produced (measured as nitrite) in the extended AS 5-UTR siRNA treated cells was observed compared to the scrambled siRNA treated ce lls. This increase in NO production correlated closely with the increased ex pression of AS in response to the knockdown of extended 5-UTR AS mRNA forms (Fig. 9). DISCUSSION We previously established that the recycling of citrulline to argi nine is essential to provide the substrate arginine for NO production, even in the presence of saturating levels of intraand extracellula r arginine [11, 12]. We demonstrate in

PAGE 229

Appendix A (Continued) 219 this study that expression of the ext ended 5-UTR forms of AS mRNA, containing an uORF, mediates a trans -effect, suppressing overall endothelial AS expression and causing a corresponding suppression of endothelial NO production. This suppression of AS expression requires a functional, out-of-frame, uORF represented in the 5-UTR regions of the co-expressed extended forms of endothelial AS mRNA [18]. The uORF AUG was shown to be functional both in vitro and in vivo When the uAUG was put in-fra me with the downstream AUG by inserting a nucleotide, two in vitro translated [ 35 S]-labeled products were evidenced by electrophoret ic SDS-polyacrylamide ge l analysis. The larger AS species (~49 kDa) was initiated from the uAUG, while the smaller (~47 kDa) species represented the translation product initiated from the normal, downstream reading frame encoding AS. Intere stingly, the ratio of products in this case favored use of the uAUG. Mo reover, when the cont ext of this uAUG was altered to better match the Kozak consensus initiation sequence [22], translation significantly improved from t he uAUG. To demonstrate that this uORF, when positioned out-of-frame, was still tr anslated, two putative stop codons for the uORF were mutated to allow production of a larger, more easily identifiable translation product (~21 kDa). Although the difference in methionine content did not permit a quantitative comparison by [ 35 S]-labeling, the results clearly demonstrated a 21 kDa product, confirming t he functionality of the uORF in its natural context. With the support of in vitro results, we then assessed the in vivo functionality of the uORF in endothelial cells using a luci ferase reporter assay. Expression of luciferase from the uAUG demonstrated that the context of the uAUG is sufficient to support initiation of translation. Mor eover, when the AS uAUG start codon was positioned in-frame, in the context of the entire 5-UTR and preceding the normal start codon for a luciferase gene, our re sults again demonstrated functionality. In this case, two luciferase products were identified by western blot analysis consistent with the interpretation t hat both the uAUG and the downstream luciferase AUG are recognized in endothelial cells. Previous work from our laboratory suggested that AS mRNA species containing the uORF in the extended 5 -UTR sequence do not ex press AS well, either in vitro or in vivo due to cis -effects of the uORF [18]. In this paper, we have clarified not only the functionality of the uORF, but also its trans -mediated effects, showing that overexpression of this uORF resulted in a dramatic decrease in AS expression in endothelial ce lls. This result suggested that the co-expression of the extended 5-UTR forms of AS mRNA, containing an out-o f-frame uORF, may play a role in suppressing the overall ex pression of endothelia l AS. Additionally we showed that NO producti on is significantly reduced when the AS uORF is overexpressed, further linking the requirement for AS expression to NO production in endothelial cells. The fact that AS expression was not suppressed when the uORF was rendered non-functional, via loss of an operational start

PAGE 230

Appendix A (Continued) 220 codon, or by overexpression of ASuORF co ntaining either a frame-shift mutation, or altered start or stop codons, demonstrated that the entire sequence of the uORF is required to mediate the trans -effects that decrease endothelial AS expression and NO production. Furthermore, a direct effect was observed that related expression of the translationa l product encoded by the uORF to the suppression of endothelial AS expression. When expression of the end othelial extended 5-UTR AS mRNA species were specifically silenced by siRNA tr eatment, expression of AS increased dramatically (~2-fold), despite the fact that these species represent less than 7% of the total AS mRNA. Consistent with the rate-limiting role of AS in recycling citrulline to arginine and in maintaining the essential arginine for NO production, knockdown of the extended 5-UTR AS m RNA species containing this uORF resulted in an increased capac ity of endothelial cells to produce NO. Thus, the overall results suggest that the uORF found in the extended 5-UTR forms of endothelial AS mRNA is functional, and as such expresses a protein product that acts to suppress expression of the pr edominant short form of the AS mRNA. In summary, a small protein produced th rough expression of the uORF of the extended 5-UTRs of two minor forms of AS mRNA, unique to endothelial cells, suppresses AS expression. The overal l effect of this suppression of AS expression is to decrease NO production in endothelial cells by limiting the availability of the substrat e arginine. These results pr ovide evidence for a novel mechanism for the regulation of endothelial AS protein expression and further support the essential role of the citrulli ne-NO cycle in endothelial NO production. ACKNOWLEDGMENTS This work was supported by the USF Research Foundation Mary and Walter Traskiewicz Memorial Fund and the Americ an Heart Association, Florida Affiliate Grant 0455228B. We thank Brenda Flam for her advice and assistance in the preparation of this manuscript and Natasha Pettifor, a University of South Florida Honors undergraduate student, for her participation in the research.

PAGE 231

Appendix A (Continued) 221 Table I Effect of Silencing of the Extended 5-UTR AS mRNAs on NO Production Condition Relative NO Produced 25 nM scrambled siRNA 1.0 25 nM siRNA 2.2 0.33 BAEC were transiently transfected with siRNA specific for the 92 and 66 nt 5-UTR species of AS mRNA and a scrambled negative control siRNA. Basal NO production was determined over a twenty-four hour period. NO was measured as nitrite produced per 1 x 10 6 cells and normalized to scrambled siRNA levels.

PAGE 232

Appendix A (Continued) 222 Fig. 1. Diverse 5leader sequence of endothelial AS mRNA. The three endothelial AS transcription star t sites are indicated by arrows and labeled. The AS AUG and the upstream out -of-frame AUG are in bol d type. The upstream AUG and the uORF are under lined. Insertion mutation sites are marked by arrows and labeled Ins 1 and Ins 2. Th e site of the RNA duplex designed to knock down the extended 5-UTR forms of AS mRNA is un derlined by a dashed line.

PAGE 233

Appendix A (Continued) 223

PAGE 234

Appendix A (Continued) 224 Fig. 2 Mutational analysis to determine th e functionality of the AS uAUG by in vitro transcription/translation. AS constructs containing the 92 nt 5-UTR (92 nt) and two single base insertion muta tions (Ins 1 and Ins 2) that put the AS AUG and the uAUG in-frame we re transcribed and translated in vitro Transcribed RNA was verified by agar ose gel electrophores is (panel A top). Translated [ 35 S]-L-methionine labeled proteins were separated by SDS-PAGE, and gels were dried and exposed to film (p anel A bottom). The q uantitation of the bands is shown in panel B. Expression leve ls are normalized to the 92 nt band.

PAGE 235

Appendix A (Continued) 225

PAGE 236

Appendix A (Continued) 226 Fig. 3. Visualization of AS uORF expression in vitro by mutagenesis of uORF stop codons. AS constructs containing the 92 nt and 43 nt 5-UTRs were mutated to extend the uORF from 4 to 21 kDa. Translated [ 35 S]-L-methionine labeled proteins were separated by SDS-PAGE, and gels were dried and exposed to film (panel A) The panel B schematic shows the uORF stop codons, marked by X, that were mutated to lysine residues and the location of the new uORF stop codon.

PAGE 237

Appendix A (Continued) 227

PAGE 238

Appendix A (Continued) 228 Fig. 4. In vivo functionality of the AS uAUG when placed immediately upstream of a luciferase ORF. In order to direct expression of luciferase from the AS uAUG, AS 5-UTR seque nce spanning the region from either the 66 or 92 nt positions to the uAUG were cloned in front of luciferase in the pGL3 control vector to replace the luci ferase 5-UTR, (panel A). C onstructs were transfected into BAEC. pGL3 Basic (Basic) was tr ansfected as a negative control, pGL3 Control (Control) as a pos itive control and pRL-TK (Renilla) was co-transfected as an internal control. Luc iferase activity (panel B) was assayed 48 hr after transfection, and results were normalized to renilla activity. Error bars indicate the standard error of the m ean from nine experiments.

PAGE 239

Appendix A (Continued) 229

PAGE 240

Appendix A (Continued) 230 Fig. 5. In vivo functionality of the AS uAUG in relation to a downstream luciferase ORF. A luciferase construct containi ng the entire 92nt AS 5-UTR in place of the luciferase 5-UTR in pGL3 Control vector (92nt) was constructed and mutated by inserting a single nucleotide at position -39 relative to the luciferase AUG (Ins 2) in order to put the uAUG and the luciferase AUG in-frame. Constructs were transfected into BAEC. pGL3 Basic (Basic) was transfected as a negative control, pGL3 Contro l (Control) as a positive control and pRL-TK (Renilla) was co-transfected as an internal control. Luciferase activity (panel A) was assayed 48 hr after transfection, and results were normalized to renilla activity. Error bars indicate the st andard error of t he mean from nine experiments. Equal amounts of cell lysa te protein were separated by SDS-PAGE and standard western blotting was performed using anti-luciferase antibody (panel B).

PAGE 241

Appendix A (Continued) 231

PAGE 242

Appendix A (Continued) 232 Fig. 6. The effect of overexpression of the AS uORF on endothelial AS expression and NO production. The AS upstream open-reading-frame (ASuORF) was cloned into pcDNA3.1V 5/His and transfected into BAEC. The ASuORF was compared to the AAGNegC c onstruct where the uAUG is mutated to AAG, the empty vector (Vector) and a lipofectamine alone control (Lipo). Twenty-four hours after transfection, equal amounts of protein were separated by SDS-PAGE and standard western blotting wa s performed using anti-AS and anti-Actin antibodies (panel A) Quantitation of AS protein expression from three separate experiments, normalized to -Actin, is indicated as a fraction of the lipofectamine alone control (panel B). Twenty-four hours after transfection, NO production was determined 2 hours after stimulation with 0.5 M calcium ionophore and 50 M sodium orthovanadate (panel C). NO was measured as nitrite produced per 1 x 10 6 cells and normalized to lipofectamine alone levels.

PAGE 243

Appendix A (Continued) 233

PAGE 244

Appendix A (Continued) 234 Fig. 7. Requirement for AS uORF sequen ce and length for suppression of endothelial AS protein levels and NO production. Additional ASuORF pcDNA3.1V5/His constructs, transfected into BAEC were compared to the AS upstream open-reading-frame (ASuORF) construct and lipofectamine alone (Lipo) control. The uORFfs construct wa s engineered to frame-shift the entire sequence of the uORF so that only the fi rst two amino acids were conserved, but the sequence length of 44 amino acids remained the same. The dnsAUG and upsStop constructs were designed to contain the C-terminal 23 amino acids and N-terminal 23 amino acids of the AS uORF, respectively. Twenty-four hours after transfection, equal amounts of protein were separ ated by SDS-PAGE and standard western blotting was performe d using anti-AS and anti--Actin antibodies (panel A). Quantit ation of AS protein expre ssion from three separate experiments, normalized to -Actin, is in dicated as a fraction of the lipofectamine alone control (panel B). Tw enty-four hours after transfection, NO production was determined 2 hours after stimulation with 0.5 M calcium ionophore and 50 M sodium orthovanadate (panel C). NO wa s measured as nitr ite produced per 1 x 10 6 cells and normalized to lipofectamine alone levels.

PAGE 245

Appendix A (Continued) 235

PAGE 246

Appendix A (Continued) 236 Fig. 8. Regulation of AS expression by the translation product of the AS uORF. An AS uORF construct was prepared in which green fluorescent protein (GFP) was cloned into the ASuORF pcDN A3.1V5/His construct in between and in-frame with the AS uORF and the V5/His tags (ASu ORF-GFP). GFP was also inserted into the uORFfs (frame-shi ft) construct (uORFfs-GFP). The GFP constructs were transfected into BAEC and compared to a lipofectamine alone control (Lipo). Twenty-four hours after transfection, equal am ounts of protein were separated by SDSPAGE and standard we stern blotting was performed using anti-V5, anti-AS, and anti--Actin antibodies (panel A). Q uantitation of AS protein expression, normalized to -Acti n, is indicated as a fraction of the lipofectamine alone control (panel B).

PAGE 247

Appendix A (Continued) 237

PAGE 248

Appendix A (Continued) 238 Fig. 9. Effect of silencing of the extended 5-UTR AS mRNAs on endothelial AS expression. BAEC were transiently transfecte d with siRNA specific for the 92 and 66 nt 5-UTR s pecies of AS mRNA ( ) and a scrambled negative control siRNA ( ). Total RNA was isolated and AS mR NA was detected by real time RT-PCR. Primer sets were designed to s pecifically amplify the 66 and 92 nt 5UTR species (panel A), or total AS mess age (Panel B). Equal amounts of protein were separated by SDSPAGE and standard we stern blotting was performed using anti-AS and anti-GAPDH antibodies. Quantitation of AS pr otein expression from four separate experiment s, normalized to GAPDH, is indicated as a fraction of the transfection reagent alone (panel C).

PAGE 249

Appendix A (Continued) 239

PAGE 250

Appendix A (Continued) 240 REFERENCES 1. Bredt, D.S. and Snyder, S.H., (1994) Annu Rev Biochem 63, 175-195. 2. Gow, A.J. and Ischiropoulos, H., (2001) J Cell Physiol 187 277-282. 3. Vallance, P. and Chan, N., (2001) Heart 85, 342-350. 4. Sharma, R. and Da vidoff, M.N., (2002) Congestive Heart Failure 8 165172. 5. Maxwell, A.J., (2002) Nitric Oxide 6 101-124. 6. Goligorsky, M.S. and Gross, S.S., (2001) Drug News Perspect 14 133142. 7. Aisaka, K., Gross, S.S., Gri ffith, O.W., and Levi, R., (1989) Biochem Biophys Res Commun. 163 710-717. 8. Cooke, J.P., Andon, N.A., Girerd X.J., Hirsch, A.T., and Creager, M.A., (1991) Circulation 83, 1057-1062. 9. Rossitch, E., Jr., Alexander, E., 3rd, Black, P.M., and Cooke, J.P., (1991) J Clin Invest. 87, 1295-1299. 10. Eddahibi, S., Adnot, S., Carville, C ., Blouquit, Y., and Raffestin, B., (1992) Am J Physiol 263 L194-200. 11. Flam, B.R., Hartmann, P.J., Harre ll-Booth, M., Solomonson, L.P., and Eichler, D.C., (2001) Nitric Oxide 5 187-197. 12. Goodwin, B.L., Solomonson, L.P., and Eichler, D.C., (2004) J Biol Chem 279 18353-18360. 13. Morris, S.M., Jr., (1992) Annual Review of Nutrition 12, 81-101. 14. Sessa, W.C., Hecker, M., Mitchell, J.A., and Vane, J.R., (1990) Proc Natl Acad Sci USA 87, 8607-8611. 15. Xie, L. and Gross, S.S., (1997) J Biol Chem 272 16624-16630. 16. Xie, L., Hattori, Y., Tu me, N., and Gross, S.S., (2000) Semin Perinatol 24, 42-45. 17. Su, Y. and Block, E.R., (1995) Am J Physiol 269 L581-587. 18. Pendleton, L.C., Goodwin, B.L ., Flam, B.R., Solomonson, L.P., and Eichler, D.C., (2002) J Biol Chem 277 25363-25369. 19. Freytag, S.O., Bock, H.G., Beaude t, A.L., and O'Brien, W.E., (1984) J Biol Chem 259 3160-3166. 20. Cohen, N.S. and Kuda, A., (1996) J Cell Biochem 60, 334-340. 21. Morris, D.R. and Geballe, A.P., (2000) Mol Cell Biol 20, 8635-8642. 22. Kozak, M., (1999) Gene 234 187-208. 23. Gaba, A., Wang, Z., Krishnamoorthy, T., Hinnebusch, A.G., and Sachs, M.S., (2001) Embo J 20, 6453-6463. 24. Parola, A.L. and Kobilka, B.K., (1994) J Biol Chem 269 4497-4505. 25. Tuschl, T., Elbashir S., Ha rborth J. and Weber, K., (2002) http://www.mpibpc.gwdg.de/abt eilungen/100/105/sirna.html 26. Chomczynski, P., (1993) Biotechniques 15, 532-534, 536-537. 27. Misko, T.P., Schilling, R.J., Salvemin i, D., Moore, W.M. and Currie, M.G., (1993) Anal Biochem 214 11-16.

PAGE 251

Appendix A (Continued) 241 28. Hellermann, G.R., Flam, B.R., Ei chler, D.C., and Solomonson, L.P., (2000) Arterioscler Thromb Vasc Biol 20, 2045-2050. 29. Dennis, J.A., Healy, P.J., B eaudet, A.L., and O'Brien, W.E., (1989) Proc Natl Acad Sci U S A 86, 7947-7951. 30. Kozak, M., (1991) J Biol Chem 266 19867-1987

PAGE 252

Appendix A (Continued) 242 Journal of Experimental Biology 206, 2083-2087, 2003 The caveolar nitric oxide synthase/arginine regeneration system for NO production in endothelial cells Larry P. Solomonson Brenda R. Flam, Laura C. Pendleton, Bonnie L. Goodwin, and Duane C. Eichler Department of Biochemist ry and Molecular Biology University of South Florida College of Medicine Tampa, FL 33612 USA Author for correspondence (e-mail: lsolomon@hsc.usf.edu ) Accepted 6 March 2003

PAGE 253

Appendix A (Continued) 243 SUMMARY The enzyme endothelial nitric oxide synthas e (eNOS) catalyzes the conversion of arginine, O 2 and NADPH to NO and citrulline. Previous results from our laboratory, and others, suggested an effi cient, compartmentalized system for recycling of citrulline to arginine utilized for NO production. In support of this hypothesis, we found that the recyclin g enzymes, argininosuccinate synthase (AS) and lyase (AL), colocalize with eNOS in caveolae, a subcompartment of the plasma membrane. Under basal (unsti mulated) conditions the degree of recycling was minimal. Upon stimulati on of NO production by bradykinin, however, recycling was co-stimulated to an extent that more than 80% of the citrulline produced was recycled to arginine. These results suggest an efficient caveolar recycling complex that supports the receptor-mediated stimulation of endothelial NO production. To investigate the molecular basis for the unique location and function of endothelial AS and AL, we compared endothelial AS mRNA with liver AS mRNA. No differenc es were found in the coding region of the mRNA species, but significant differ ences were found in the 5-untranslated region (5-UTR). The results of these studies suggested that sequence in the endothelial AS gene represented by position to nt from the translation start site in the extended AS mRNA 5-UTRs plays an important role in differential and tissue-specific expression. Overall, we have developed a strong evidential case supporting the proposal t hat arginine availability, governed by a caveolar-localized arginine-regeneration system, plays a key role in receptormediated endothelial NO production. INTRODUCTION Endothelial nitric oxide synthase (e NOS), the enzyme that catalyzes the production of NO from the amino acid arginine in endothelial cells, plays a key role in vasoregulation as well as other important physiological processes such as angiog enesis. Impaired producti on of endothelial NO has been associated with hy pertension, heart failure, hypercholesterolemia, atherosclerosis and diabetes (Govers and Rabelink, 2001; Valence and Chan, 2001; Maxwell, 2002). Circulating effectors, such as bradykinin (bk), bind to receptors on the lumenal surface of endothelial cells signaling the transient release of NO to the adjacent smooth muscle layer, resulting in re laxation of the vessel wall. The signal for eNOS activation is a trans ient increase in intracellular calcium, which activates the enzyme through bind ing of a calcium-calmodulin complex (Ca-Cam). Endothelial NOS activation also occurs in response to shear stress (Govers and Rabelink, 2001; Maxwell, 2002) Consistent with the important physiological roles of eNOS, the enzyme ap pears to be subject to multiple modes of regulation, in addition to primary regulation through reversible Ca-Cam binding and activation. These include reversib le phosphorylation and palmitoylation, substrate and cofactor availability, dime rization of enzyme subunits, intracellular

PAGE 254

Appendix A (Continued) 244 translocation, and protein-protein inte ractions (Govers and Rabelink, 2001). Several of these potential modes of regulation appear to be interrelated. As a component of caveolae, which serve to sequester proteins involved in cell signaling, eNOS may transiently interact with several different caveolar components. Previous work from several different laboratories, including our own, has suggested that a number of diffe rent proteins may be transiently and functionally associated with eNOS, includi ng calmodulin, caveolin-1, bradykinin B2 receptor (Bk-B2), heat shock protei n-90 (hsp90), argininosuccinate synthase (AS), argininosuccinate lyase (AL), Raf1, Akt, ERK, and unide ntified tyrosinephosphorylated proteins (Hellermann et al ., 2000; Govers and Rabelink, 2001; Maxwell, 2002). A potential limiting fa ctor for endothelial NO production is the availability of the substrate, arginine. Intracellular levels of arginine have been estimated to range from 100 to 800 M, which is well above the K m value of 5 M for eNOS (Harrison, 1997). Endothelial NO producti on can, nonetheless, be stimulated by exogenous arginine (Valence and Chan, 2001). This phenomenon, termed the arginine paradox, suggests the existence of a separate pool of arginine directed to endothelial NO synthesis. As illustrated in Fig. 1, arginine has a number of metabolic roles in addition to NO pr oduction, including production of major metabolites such as urea, polyamines, creatine, ornithine and methylarginine derivatives. The segregation of the production of NO from these other metabolic processes would allow the c ontrolled availability of arginine for NO production. One possible site of control is at t he level of arginine uptake. McDonald et al. (1997) showed that the CAT1 transporter, responsible for 60-80% of total carrier mediated arginine transport into endothel ial cells, colocaliz es with eNOS in caveolae, a subcompartment of the plas ma membrane. They proposed that the arginine utilized by eNOS, at least in part, might be maintained by the CAT1 transporter. Another important mechani sm for controlling the availability of arginine directed to NO production may be the regeneration of arginine from the other product of the eNOS-catalyz ed reaction, citrulline. Hecker et al. (1990) initially demonstrated that citrulline, produced in the conversion of arginine to NO, can be recycled to arginine. A possi ble linkage between NO production and arginine regeneration from citrulline wa s subsequently established for other cell types (Nussler et al. 1994; Shuttleworth et al ., 1995). This regeneration is catalyzed by the enzymes argini nosuccinate synthase (AS) and argininosuccinate lyase (AL), both of which al so play an essential role in the urea cycle in liver. The potential importance of this regeneration system for endothelial NO production was supported by a report of two infants, with a deficiency of AL, who were s hown to be hypertensive (Fakler et al ., 1995). Upon infusion of arginine, the bloo d pressure of these infant s decreased to near normal levels, suggesting a critical role for ar ginine regeneration in the regulation of systemic blood pressure. More recent evidence from DNA microarray analysis

PAGE 255

Appendix A (Continued) 245 suggests an important role for the ar ginine regeneration system by clearly demonstrating significant and coordinate upregul ation of AS gene expression in response to shear stress stimulation of endothelial NO production (McCormick et al., 2001). It was concluded that availa ble arginine is a prerequisite for NO production and that in the abs ence of synthesis of additional eNOS, shear stressinduced increases in NO synthesis depend on an increase in synthesis of arginine from citrulline through increased AS expression. Recent work from our laboratory, described herein, further supports the hypothesis that the arginine regenerat ion system, comprised of a caveolar complex that includes eNOS, AS, and AL, plays an important, and possibly essential, role in the receptor-mediat ed production of NO by vascular endothelial cells. Effects of Exogenous Arginine and Citrulline on Endothelial NO Production Endothelial NOS is localized in plasmale mmal caveolae. The localization of eNOS in this signaling subcompartment of the plasma membrane may have important implications wit h regard to the regulation and catalytic efficiency of eNOS (Everson and Smart, 2001; Shaul, 2002). We have recently found evidence for an efficient cycling of citrulline to arginine, ra ising the possibility of a channeling complex of eNOS and the enzym es of the citrulline-arginine cycle (AS and AL) localized in caveolae. Our initial re search effort that led to this finding was designed to test the hypothesis that an intracellular pathway exists for the generation of methylarginines to regulate NO production in nitric oxide producing tissues. The goal of this initial wo rk was to determine the physiological significance of intracellular methylarginine s as regulators of NOS activity. To examine the levels of endogenous methylarginines, we developed methods that allowed for the rapid and quant itative analysis (by HPLC) of arginine, citrulline and the methylarginines from endothelial ce ll extracts. There was no apparent change in levels of methylarginines follo wing stimulation of endothelial cells with either bradykinin or the calcium ionop hore, A23187. In an attempt to raise intracellular methylarginine levels, and further test our hypothesis, we added citrulline, which we expected to inhibit dimethylarginine dimethylaminohydrolase, the enzyme that converts N G -methylarginine or N G ,N G -dimethylarginine to citrulline and monomethylamine or dime thylamine. The objective was to determine whether inhibiti on of the degr adation of methylarginines would increase their intracellular concentrations and thereby inhibit NO production. To our surprise, stimulation of NO production by bradykinin was increased by the addition of 3 mM citrulline, rather than decreased and there was no apparent change in methylarginine levels. To furt her examine the molecular basis for the stimulation of NO production by citrulline, we compared the effect of exogenous citrulline with the effect of exogenous arginine on NO production and levels of intracellular arginine followin g bradykinin activation. Su rprisingly, added arginine did not cause as great an increase in endothelial NO production as added

PAGE 256

Appendix A (Continued) 246 citrulline. In addition, there was a much la rger increase in intracellular arginine in response to exogenous arginine compar ed with exogenous citrulline. Added citrulline caused only a modest increase in intracellular arginine, while added arginine caused a substantial increase. Thus, there appeared to be no correlation between total intracellula r arginine levels and endothelial NO production. To the best of our knowledge, this represents the first attempt to correlate NO production with the levels of intracellular arginine Furthermore, the effects of arginine and citrulline on NO production appeared to be synergistic since a combination of arginine and citrulline stimul ated endothelial NO production more than either arginine or citrulline alone (Flam et al., 2001). Since arginine has a number of potential metabolic fates, while citrulline has only one known metabolic fate (Fig. 1), the effi ciency of NO production could be enhanced if a separate pool of arginine is mainta ined by endothelial cells. Recycling the product of the NOS-catalyzed reaction, citrulline, back to arginine via the enzymes of the arginine regeneration system, AS and AL would maintain this separate pool. The pool of arginine used for NO synthesis would be essentially isolated from the bulk of intracellular argi nine through the efficient operation of an arginine regeneration system. The apparent efficiency of the process suggests a possible channeling of intermediates and a compartm entalized complex of eNOS and enzymes of the arginine regeneration system. Our initial results supported a model in which eNOS is localized t ogether with this arginine regenerating system, and regulatory components, to ensure optimal efficiency of NO production and regulation, wit hout affecting other ar ginine-dependent cellular processes. Caveolar Localization of Arginine Regeneration Enzymes with eNOS Endothelial NOS is targeted by acylation to caveolae, where it interacts with caveolin-1 (Everson and Smart, 2001; Shaul, 2002). In liver ce lls, the arginine generating enzymes, AS and AL, are asso ciated with the outer mitochondrial membrane, reflecting the functional role of these enzymes in the production of urea (Cohen and Kuda, 1996). To test our model for a colocalization of AS and AL with eNOS, we used two different fracti onation protocols for the purification of caveolae (Smart et al., 1995; Song et al., 1996). Both protocols generated a caveolar membrane fraction that was high ly enriched in caveolin-1, eNOS, AS, and AL (Flam et al., 2001). These result s support the proposal that a separate pool of arginine, directed to NO synthesis, is effectively separated from the bulk of intracellular arginine through the functional localizat ion of arginine regeneration enzymes and eNOS with pl asmalemmal caveolae. A possible consequence of this functional asso ciation would be the channeling of intermediates through AS, AL, and eNOS su ch that intermediates of the complex would not equilibrate with bulk intracellular arginine.

PAGE 257

Appendix A (Continued) 247 Degree of Recycling Cellular activity of eNOS has been es timated by measuring the rate of conversion of [ 3 H]-arginine to [ 3 H]-citrulline (Hardy and May, 2002). Based on our results, we would predict that this measurement woul d underestimate the cellular activity of eNOS due to the effici ent recycling of citrulline to arginine. Estimating cellular activity of eNOS by measuring rate of production of NO (as the degradation product nitrite), on the other hand, s hould give a be tter estimate of cellular activity of eNOS activity. To test this hypothesis, and to estimate the degree of recycling of citrulline to ar ginine, we simultaneously measured the apparent rate of arginine to citrulline conversion and the rate of production of NO under basal (unstimulated) conditions and under stimulated (addition of bradykinin) conditions. The ratio of thes e activities was close to one under basal conditions, but the apparent degree of recycling was costimulated with NO production as indicated by an increase in t he ratio of NO produced to citrulline produced to approximately eight upon expos ure of endothelial cells to agonist (Flam et al., unpublished). These prelim inary results suggest an efficient caveolar complex for the regeneration of arginine directed to receptor-mediated production of NO in endothelia l cells. Our initial results suggest an efficiency of greater than 80% for the recyclin g of citrulline to arginine. Molecular Basis for Functional Role and Location of Endothelial AS In liver tissue AS plays an essential role in urea synthesis and appears to be loosely associated with the outer mi tochondrial membrane (Cohen and Kuda, 1996). In contrast, endothelial AS appears to be the rate limiting enzyme in the recycling of citrulline to arginine used for NO synthesis and is localized in caveolae. Immunoblotting experiments s uggested small differences in subunit molecular weights and isoe lectric points of endothelial AS compared to liver AS (Flam et al., unpublished). We speculated that these differences could be due to a splice variant, but analysis of the coding sequence of AS m RNA indicated no differences between the mRNA from endothe lial cells and liver (Pendleton et al., 2002). Because upstream and downstream untranslat ed regions (UTRs) of mRNA can influence regulation of gene ex pression, we carried out both 5-RACE (rapid amplification of cDNA ends) and 3 -RACE analysis to investigate possible differences in the UTRs. We found three different 5-UTR AS mRNA species in endothelial cells (shown below). Only one of these products, the shortest 5'-UTR of 43 nucleotides (nt), was quantitatively expressed in liver. No significant variation was found in the 3-UTR. Th e 5-RACE analysis i dentified endothelial AS mRNA species with extended 5-UTRs of 66 nt and 92 nt, in addition to a major 43 nt 5-UTR AS mRNA. Compositio nal analysis revealed that all three AS mRNA 5-UTRs were enriched in G + C content (~76%), and were likely to form complex and stable secondar y structures. An upstream open reading frame (uORF) was detected in the 66 nt and 92 nt 5-UTRs that was out-of-frame with the AS mRNA AUG start codon. RNase protection analysis (RPA) and real-time reverse transcriptase-PCR verified and quantitated the differential expression of

PAGE 258

Appendix A (Continued) 248 the extended 5-UTR species relative to the major 43 nt 5-UTR AS mRNA. Estimates from RPA of the am ount of the 92 nt and 66 nt species, relative to the 43 nt species, were approximately 15% and 13%, respectively. Features of mRNA UTRs, specifically uORFs, ar e regarded as important determinants of translati onal efficiency and may have important biological implications on the regulatio n of translation. We t herefore designed experiments to determine to what extent the va rious 5-UTRs of AS mRNA influenced translation. Translational efficiencie s for the 66nt and 92 nt AS 5-UTR constructs were 70% and 25%, respectively of the translational efficiency for the 43 nt 5-UTR AS mRNA. Sequential deletion s, starting with the 5-terminus of the 92 nt 5-UTR construct, resulted in a corresponding increase in translational efficiency, but the most pronounced effect resulted fr om mutation of the uORF, which restored translational efficiency to that observed with the 43 nt species. When the different AS mRNA 5-UTRs, cloned in front of a luciferase reporter gene, were transfected into endothelial cells, the pattern of luciferase expression was nearly identical to that observed for the different 5-UTR AS mRNAs in endothelial cells. These results suggest that a complex transcriptional/translational infrastructure operates to coordinate AS and NO production that is reflected in AS mRNA struct ure and function (Pendleton et al., 2002). Model for Coupling of Arginine Rege neration to Endothelial NO Production A model depicting our view of the coupling of argi nine regeneration to endothelial NO production through the compartmentalized complex of AS, AL, and eNOS is shown in Fig. 2. Th is coupling is apparently disengaged under basal (unstimulated) conditions and is engaged and tightly coupled in response to agonists such as bradykinin. The mo lecular determinants and mechanisms involved in this coupling are not fully understood at this time. Based on our studies, and evidence from other labs, we believe the coupl ing of arginine regeneration to endothelial NO production is important for the overall regulation of endothelial NO production and may be essential for agonist-stimulated endothelium-dependent vasorelaxation. ACKNOWLEDGEMENT The work described here was supported by the American Heart Association National Grant 9750222N and American Heart Association Florida Affiliate Grant 9950864V.

PAGE 259

Appendix A (Continued) 249 Fig. 1. Metabolic roles and fates of arginine. In addition to incorporation into protein, arginine serves as a metabolic precursor for several important metabolites as indicated by the arrows. Also indicated is the two step conversion of citrulline to arginine.

PAGE 260

Appendix A (Continued) 250 Fig. 2. Novel 5' untranslated regions (UTRs) of endothelial argininosuccinate synthase mRNA.

PAGE 261

Appendix A (Continued) 251 Fig. 3. Model for the coupling of endothelial NO production to the regeneration of the substrate arginine from the product citrulline. Shown is the CAT1 transporter involved in arginine transport and complex of the coupling enzymes argininosuccinate synthase and argininosuccinate lyase with endothelial nitric oxide synthase.

PAGE 262

Appendix A (Continued) 252 REFERENCES Cohen, N. S. and Kuda, A. (1996). Argininosuccinate synthetase and argininosuccinate lyase are lo calized around mitochondria: an immunocytochemical study. J. Cellular Biochem. 60, 334-340. Everson, W. V. and Smart, E. J. (2001). Influence of caveolin, cholesterol, and lipoproteins on nitric oxide synthase: Implications for vascular disease. Trends Cardiovasc. Med. 11, 246-250. Fakler, C. R. (1995). Two cases suggesting a role for the L-arginine nitric oxide pathway in neonatal blood pressure regulation. Acta Paediatr. 84, 460-462. Flam, B. R., Hartmann, P. J., Harrell-Boot h, M., Solomonson, L. P. and Eichler, D. C. (2001). Caveolar localization of arginine regeneration enzymes, argininosuccinate synthase, and lyase, with endothelial nitric oxide synthase. Nitric Oxide 5,187-197. Govers, R. and Rabelink, T. J. (2001). Ce llular regulation of endothelial nitric oxide synthase. Am. J. Physiol. Renal Physiol. 280, F193-F206. Hardy, T. A. and May, J. M. (2002) Coor dinate regulation of L-arginine uptake and nitric oxide synthase activi ty in cultured endothelial cells. Free Radic. Biol. Med. 32, 121-131. Harrison, D. G. (1997). Cellular and mo lecular mechanisms of endothelial cell dysfunction. J. Clin. Invest. 100, 2153-2157. Hecker, M., Sessa, W. C., Harris, H. J., Anggard, E. E. and Vane, J. R. (1990). The metabolism of L-arginine and its significance for the biosynthesis of endothelium-derived relaxing fa ctor: cultured endot helial cells recycle L-citrulline to L-arginine. Proc. Natl. Acad. Sci. USA 87, 8612-8616. Hellermann, G. R., Flam, B. R., Eichler, D. C. and Solomonson, L. P. (2000). Stimulation of receptor-mediated nitr ic oxide production by vanadate. Arterioscler. Thromb. Vasc. Biol. 20, 2045-2050. Maxwell, A. J. (2002). Mec hanisms of dysfunction of the nitric oxide pathway in vascular diseases. Nitric Oxide 6, 101-124. McCormick, S. M., Eskin, S. G., McIntire, L. V., Teng, C. L., Lu, C. M., Russell, C. G. and Chittur, K. K. (2001). DNA microarray reveals changes in gene expression of shear stressed hum an umbilical vein endothelial cells. Proc. Natl. Acad. Sci. USA 98, 8955-8960.

PAGE 263

Appendix A (Continued) 253 McDonald, K. K., Zharikov, S., Block, E. R. and Kilberg, M. S. (1997). A caveolar complex between the cationic amino acid transporter 1 and endothelial nitricoxide synthase may explain the "arginine paradox". J. Biol. Chem. 272, 3121331216. Nussler, A. K., Biliar, T. R., Liu, Z. Z. and Morris, S. M. (1994). Coinduction of nitric oxide synthase and argininosuccinate synthase in a murine macrophage cell line> Implications for regulat ion of nitric oxide production. J. Biol. Chem. 269, 1257-1261. Pendleton, L. C., Goodwin, B. L., Flam, B. R., Solomonson, L. P. and Eichler DC. (2002). Endothelial argininosuccinate synthase mRNA 5'-UTR diversity: Infrastructure for tissue specific expression. J. Biol. Chem. 277, 25363-25369. Shaul, P. W. (2002). Regulation of endothelial nitr ic oxide synthase: location, location, location. Annu. Rev. Physiol. 64, 749-774. Shuttleworth, C. W., Burns, A. J., Ward, S. M., O'Brien, W. E. and Sanders, K. M. (1995). Recycling of L-citrulline to sustain nitric oxide-dependent enteric neurotransmission. Neuroscience 68, 1295-1304. Smart, E. J., Ying, Y. S., Mineo, C. and Anderson, R. G. (1995). A detergent-free method for purifying caveolae memb rane from tissue culture cells. Proc. Natl. Acad. Sci. USA 92, 10104-10108. Song, K. S., Li, S., Okamoto, T., Quilliam, L. A., Sarg iacomo, M. and Lisanti, M. P. (1996). Co-purification and direct interaction of Ras with caveolin, an integral membrane protein of caveolae microdomai ns. Detergent-free purification of caveolae microdomains. J. Biol. Chem. 271, 9690-9697. Vallance, P. and Chan, N. (2001). Endothelial function and nitric ox ide: clinical relevance. Heart 85, 342-350.

PAGE 264

Appendix A (Continued) 254 ABOUT THE AUTHOR Bonnie Goodwin was born in Massachusetts, although she spent the majority of her life in Maryland. She received her Ba chelors degree in Biology from St. Marys College of Maryland, graduating with honors in 1994. While working as a research assistant, Bonnie attended the Univ ersity of Maryland, Baltimore where she earned her Masters Degree in Bioche mistry in 1999. Bonnie then received her doctoral degree from the University of South Florida, College of Medicine, Department of Biochemistry and Molecula r Biology in 2005. She expects to receive her MPH in Epidemiology in 2006 from the University of South Florida, College of Public Health. In the community Bonnie is an active volunteer. She serves as the coordinator of the Greater Tampa Community Emergency Response Team and is a member of the Hillsborough County Citizen Corps Council.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001912743
003 fts
005 20071011133633.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 071011s2005 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001368
040
FHM
c FHM
035
(OCoLC)174043608
049
FHMM
090
QD415 (ONLINE)
1 100
Goodwin, Bonnie L.
4 245
The role and regulation of argininosuccinate synthase in endothelial function
h [electronic resource] /
by Bonnie L. Goodwin.
260
[Tampa, Fla] :
b University of South Florida,
2005.
3 520
ABSTRACT: While cellular levels of arginine greatly exceed the apparent Km for endothelial nitric oxide synthase (eNOS), nitric oxide (NO) production is limited by availability of arginine. Results from this work have provided a unique understanding of endothelial NO production, showing that arginine regeneration, that is the recycling of citrulline back to arginine by argininosuccinate synthase (AS) and argininosuccinate lyase (AL), defines the essential source of arginine for NO production. Using RNA interference analysis, selective reduction of AS expression was shown to directly correspond with a diminished capacity of endothelial cells to produce NO, despite saturating levels of arginine in the medium. In addition, the viability of AS siRNA-treated endothelial cells was compromised due to apoptotic cell death.AS expression was also investigated in response to two major vascular effectors. Tumor necrosis factor (TNF)-alpha; which is known to impair endothelial NO production, was shown to provoke a dose-dependent reduction of AS expression that corresponded to a decrease in NO production. Furthermore, TNF-alpha was shown to suppress AS expression through a NFkappaB mediated pathway, which involves three essential Sp1 elements in the proximal AS gene promoter. On the other hand, peroxisome proliferator-activated receptor gamma (PPARgamma) agonists, troglitazone and ciglitazone, which are known to elicit a vascular protective response against TNF-alpha effects, were shown to coordinately induce NO production and AS expression via a PPARgamma response element in the distal AS gene promoter. Importantly, these PPARgamma agonists were shown to restore AS expression and NO production following down-regulation by TNF-alpha, consistent with their vascular protective properties.
502
Dissertation (Ph.D.)--University of South Florida, 2005.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 254 pages.
Includes vita.
590
Adviser: Duane C. Eichler, Ph.D.
653
Nitric oxide.
Enos.
Endothelial.
Apoptosis.
tnf-alpha.
ppar-gamma.
690
Dissertations, Academic
z USF
x Biochemistry and Molecular Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
0 856
u http://digital.lib.usf.edu/?e14.1368