USF Libraries
USF Digital Collections

Differential coupling of RGS3s and RGS4 to GPCR-GIRK channel signaling complexes

MISSING IMAGE

Material Information

Title:
Differential coupling of RGS3s and RGS4 to GPCR-GIRK channel signaling complexes
Physical Description:
Book
Language:
English
Creator:
Jaén, Cristina
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Kir3
Transfection
Cho-k1 cells
Precoupling
Signaling pathway
Dissertations, Academic -- Physiology and Biophysics -- Doctoral -- USF
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: 'Regulators of G protein signaling' (RGS proteins) modulate the G proteincycle by enhancing the GTPase activity of Ga subunits. These changesaccelerate the kinetics of ion channel modulation by Gai/o-coupled receptors(GPCRs) such as the G protein-gated inward rectifier K+ (GIRK/Kir3) channel. Myexperiments indicate that a single cerebellar granule (CG) neuron, a cell type thatendogenously expresses GIRK channels is able to express a wide variety ofRGS proteins. I selected two of them, which are widely expressed andtranscriptionally regulated during pathophysiologic conditions, to compare theirfunctional properties. I originally described the differential modulatory effects oftwo RGS proteins, the RGS3 short isoform (RGS3s) and RGS4, on muscarinicm2 and serotonin 1A receptor-coupled Kir3.1/Kir3.2a channels expressed inChinese hamster ovary (CHO-K1) cells. Both RGS3s and RGS4 acceleratedGIRK activation and deactivation current kinetics in a similar way. However, onlyRGS3s si gnificantly decreased the maximal GIRK current (Imax) elicited by ACh(~45% inhibition) and significantly increased the EC50 for both GPCRs. Thehypothesis that emerged from this initial study was that the distinct RGS4 Nterminaldomain mediated a direct coupling of RGS4 to GPCR-GIRK channelsignaling complexes that was not shared by RGS3s. To test this hypothesis, Iepitope-tagged several GPCRs, the Kir3.1 subunit, RGS3s, RGS4, and severaldeletion mutants and chimeras for co-immunoprecipitation experiments. Using anepitope-tagged degradation resistant RGS4 mutant RGS4(C2V), I detected coprecipitationof different GPCR-GIRK channel complexes with RGS4 but notRGS3s.The functional impact of RGS4 coupling to the GPCR-Kir3 channelcomplex versus uncoupled RGS3s was not apparent in recordings from CHO-K1cells presumably due to a high degree of RGS collision-coupling. Controlledexpression in Xenopus oocytes revealed a 30-fold greater potency for RGS4 inthe accelerating GIRK channel gating kinetics. In summary, these findings demonstrate that one of the ways for the cellto achieve signaling pathway specificity may be through selective coupling of thedifferent GPCR-effector-RGS protein complexes.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2006.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Cristina Jaén.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 125 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001956554
oclc - 145601651
usfldc doi - E14-SFE0001533
usfldc handle - e14.1533
System ID:
SFS0025851:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Differential Coupling of RGS3s and RGS4 to GPCR-GIR K Channel Signaling Complexes by Cristina Jan A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Physiology and Biophysics College of Medicine University of South Florida Major Professor: Craig A. Doupnik, Ph.D. Eric Bennett, Ph.D. Bruce G. Lindsey, P.D. Daniel Yip, Ph.D. Bernd Sokolowski, Ph.D. Date of Approval: April 10, 2006 Keywords: kir3, transfection, cho-k1 cells, precoup ling, signaling pathway Copyright 2006 Cristina Jan

PAGE 2

DEDICATION Aquest treball est dedicat a la meva familia, espe cialment a la memria de la meva mare (Joana Peraire) i al meu pare (Joan Jan) Moltes grcies per tot el que meu ajudat al llarg de la meva vida. Veus mama, per fi he acabat els estudis, sembla men tida, no?

PAGE 3

ACKNOWLEDGEMENTS First, I would like to thank my mentor, Dr. Craig D oupnik, for his support, patience and guidance throughout my graduate studie s, without his mentorship this dissertation would not have been done. I want to express my gratitude to the Department of Physiology and Biophysics for their f inancial support. I am also thankful to each member of my dissertation committe e: Drs. Eric Bennett, Bruce Lindsey, Daniel Yip, Bernd Sokolowski for their hel p and comments that improved this dissertation. I would also like to th ank my external reviewer Dr. James Surmeier for taking the time to read my disse rtation and come to the defense. Finally, I would like to thank all my frie nds who either directly or indirectly have helped me during my studies especia lly Qingli Zhang, Jenny Gulledge, Jeanie Harper, Venkat, Lavanya Balasubram anian, Eduardo Zurek as well as the members of the “International Class” fo r their encouragement and prayers.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES..................................... ................................................... ...iv LIST OF FIGURES.................................... ................................................... ...v ABSTRACT........................................... ................................................... ......vii CHAPTER 1. INTRODUCTION AND BACKGROUND............. .......................1 GPCRs.............................................. ................................................... .....1 G proteins......................................... ................................................... .....3 RGS proteins....................................... ................................................... ...4 GIRK channels...................................... ................................................... .7 Coupling of GPCRs to G proteins and GIRK channels.. ...........................9 CHAPTER 2. GENERAL METHODS AND MATERIALS........... ....................11 Cerebellar granule neurons culture................. ........................................11 Single cell harvesting for RT-PCR analysis......... ....................................12 Design of intron-spanning gene-specific primers.... ................................13 Single cell reverse transcriptase PCR (RT-PCR) anal ysis......................14 Chinese hamster ovary (CHO-K1) cells for heterologo us expression.....17 Heterologous expression of wild type cDNAs in CHO-K 1 cells...............17 Construction of epitope-tagged expression vectors.. ..............................19 Transfection of epitope-tagged cDNAs in CHO-K1 cell s.........................21 Immunoprecipitation and co-immunoprecipitation..... ..............................22

PAGE 5

ii Western blot analysis.............................. ................................................23 Electrophysiological recordings from cerebellar gra nule neurons ..........24 Electrophysiological recordings from CHO-k1 cells.. ...............................26 Electrophysiological recordings from Xenopus oocytes..........................29 Kinetic analysis of receptor-activated GIRK/Kir3 ch annel currents.........30 Statistical analysis............................... ................................................... .30 CHAPTER 3. PROFILE OF RGS GENE EXPRESSION IN CEREBE LLAR GRANULE NEURONS.................................... .........................31 Introduction....................................... ................................................... ..........31 Results............................................ ................................................... ...........33 Measuring native GIRK channel gating properties in CG neurons...........33 Single cell RT-PCR analysis of endogenous RGS expre ssion.................36 Discussion......................................... ................................................... .........39 CHAPTER 4. NEURONAL KIR3.1/KIR3.2A CHANNELS COUPLED TO SEROTONIN 1A AND MUSCARINIC M2 RECEPTORS ARE DIFFERENTIALLY MODULATED BY THE ‘SHORT’ RGS3 ISOFORM............................................ ....................................41 Introduction....................................... ................................................... ..........41 Results............................................ ................................................... ...........44 Properties of 5-HT1A and m2 receptor coupled GIRK currents reconstituted in CHO-K1 cells..................... ..................................44 Effects of PTX pretreatment on 5-HT1A and m2 receptor coupled GIRK currents.......................................... ...............................................48 Comparison of RGS3s and RGS4 effects on muscarinic m2 receptorcoupled GIRK currents............................. .....................................48 Comparison of RGS3s and RGS4 effects on serotonin 1 A receptorcoupled GIRK currents ............................ .....................................52

PAGE 6

iii Effects of RGS3s and RGS4 on basal GIRK channel act ivity.................55 Effects of RGS3s and RGS4 on acute desensitization of GIRK currents.......................................... ...............................................57 Discussion......................................... ................................................... .........60 CHAPTER 5. RGS4 DIRECTLY ASSOCIATES WITH MULTIPLE G PCRKIR3 CHANNEL SIGNALING COMPLEXES................... ........68 Introduction....................................... ................................................... ..........68 Results............................................ ................................................... ...........71 RGS4 and RGS3s protein expression in CHO-K1 cells.. .........................71 Differential RGS interaction with m2 receptor-Kir3 channel complexes...75 Structural determinants of RGS4 binding to m2 recep tor-G a i2-Kir3 channel complexes................................. .......................................81 RGS4(C2V) associates with multiple GPCR-Kir3 channel complex es.......85 RGS4(C2V) couples to GPCRs independent of co-assembled Kir3 channels.......................................... ..............................................94 Functional impact of direct RGS4 coupling to GPCR-K ir3 channel complexes......................................... ............................................97 Discussion......................................... ................................................... .......101 CHAPTER 6. CONCLUDING REMARKS...................... ..............................106 REFERENCES......................................... ................................................... 110 ABOUT THE AUTHOR................................... ...................................End Page

PAGE 7

iv LIST OF TABLES Table 2.1 Gene specific primers for Single Cell RTPCR.........................16 Table 3.1 Effects of RGS3s and RGS4 on basal GIRK c hannel activity in CHO-K1 cells .......................... .................................56

PAGE 8

v LIST OF FIGURES Figure 2.1 Whole cell patch-clamp recording of rece ptor activated GIRK currents............................ ...............................28 Figure 3.1 Quantitative analysis of native GIRK cur rents recorded from rat cerebellar granule (CG) neurons ...............35 Figure 3.2 Separation of RT-PCR products by agarose gel electrophoresis.................................... .....................................37 Figure 3.3 Profile of RGS genes expressed in rat ce rebellar granule neurons ................................... ...................................38 Figure 4.1 Functional coupling of 5-HT1A receptors and muscarinic m2 receptors to Kir3.1/Kir3.2a channels expressed in CHO-K1 cells ......................... ............................47 Figure 4.2 Comparative effects of RGS3s versus RGS4 on muscarinic m2 receptor-coupled Kir3.1/Kir3.2a channels expressed in CHO-K1 cells ................ ......................51 Figure 4.3 Comparative effects of RGS3s versus RGS4 on serotonin 1A (5-HT1A) receptor-coupled Kir3.1/Kir3.2a channels expressed in CHO-K1 cells ................ ......................54 Figure 4.4 Acute GIRK current desensitization assoc iated with different GPCR-RGS coupling conditions ............ ...................59 Figure 5.1 RGS3s, RGS4, and the degradation resista nt RGS4(C2V) mutant are differentially expressed in CHO-K1 cells, yet similarly affect muscarinic m2 receptor-activated Kir3 channel current kinetics... ....................74 Figure 5.2 Selective association of RGS4 with musca rinic m2 receptor-Kir3 channel complexes.................... .........................78

PAGE 9

vi Figure 5.3 Effects of Gi2 co-expression on RGS coupling to muscarinic m2 receptor-Kir3 channel complexes...... ...............80 Figure 5.4 Structural determinants of RGS4 associat ion with muscarinic m2 receptor-Kir3 channel complexes...... ...............84 Figure 5.5 RGS4(C2V) associates with multiple Gi-coupled receptor-Kir3 channel complexes.................... .........................87 Figure 5.6 RGS4(C2V) associates with multiple Go-coupled receptor-Kir3 channel complexes.................... .........................90 Figure 5.7 Kir3 channels and RGS4(C2V) co-assemble with Gqcoupled receptors.................................. ...................................93 Figure 5.8 RGS4(C2V) couples to GPCRs and not the Kir3 channel............................................ ........................................96 Figure 5.9 Differential potency of RGS3s and RGS4(C2V) in accelerating the deactivation jinetics of muscarini c m2 receptor-activated Kir3 channels currents in Xenopus ocytes............................................. ........................................100 Figure 6.1 Differential coupling of RGS proteins to GPCR-GIRK channel signaling complexes........................ .........................109

PAGE 10

vii Differential Coupling of RGS3s and RGS4 to GPCR-GIR K Channel Signaling Complexes Cristina Jan ABSTRACT ‘Regulators of G protein signaling’ (RGS proteins) modulate the G protein cycle by enhancing the GTPase activity of G a subunits. These changes accelerate the kinetics of ion channel modulation b y G a i/o-coupled receptors (GPCRs) such as the G protein-gated inward rectifie r K+ (GIRK/Kir3) channel. My experiments indicate that a single cerebellar granu le (CG) neuron, a cell type that endogenously expresses GIRK channels is able to exp ress a wide variety of RGS proteins. I selected two of them, which are wid ely expressed and transcriptionally regulated during pathophysiologic conditions, to compare their functional properties. I originally described the d ifferential modulatory effects of two RGS proteins, the RGS3 short isoform (RGS3s) an d RGS4, on muscarinic m2 and serotonin 1A receptor-coupled Kir3.1/Kir3.2a channels expressed in Chinese hamster ovary (CHO-K1) cells. Both RGS3s an d RGS4 accelerated GIRK activation and deactivation current kinetics i n a similar way. However, only RGS3s significantly decreased the maximal GIRK curr ent (Imax) elicited by ACh

PAGE 11

viii (~45% inhibition) and significantly increased the E C50 for both GPCRs. The hypothesis that emerged from this initial study was that the distinct RGS4 Nterminal domain mediated a direct coupling of RGS4 to GPCR-GIRK channel signaling complexes that was not shared by RGS3s. T o test this hypothesis, I epitope-tagged several GPCRs, the Kir3.1 subunit, R GS3s, RGS4, and several deletion mutants and chimeras for co-immunoprecipit ation experiments. Using an epitope-tagged degradation resistant RGS4 mutant RG S4(C2V), I detected coprecipitation of different GPCR-GIRK channel comple xes with RGS4 but not RGS3s. The functional impact of RGS4 coupling to the GPCRKir3 channel complex versus uncoupled RGS3s was not apparent in recordings from CHO-K1 cells presumably due to a high degree of RGS collis ion-coupling. Controlled expression in Xenopus oocytes revealed a 30-fold greater potency for RGS 4 in the accelerating GIRK channel gating kinetics. In summary, these findings demonstrate that one of the ways for the cell to achieve signaling pathway specificity may be thr ough selective coupling of the different GPCR-effector-RGS protein complexes.

PAGE 12

1 CHAPTER 1 INTRODUCTION AND BACKGROUND G protein coupled receptors (GPCRS) G-protein coupled receptors (GPCRs) are transmembra ne receptors that mediate most of their intracellular actions through pathways involving activation of G-proteins. GPCRs have an extracellular N termin us, a cytoplasmic C terminus and 7 transmembrane ahelices connected by three intracellular loops and three extracellular loops. They are also called heptahelical receptors or serpentine receptors. The extracellular receptor su rface is critical for ligand binding and the intracellular surface is involved i n G-protein recognition and activation (Wess, 1997). GPCRs are some of the old est receptors devoted to signal transduction present throughout the evolutio nary process, they appear in plants, yeast, slime mold, protozoa, diploblastic m etazoa as well as vertebrates (Bockaert and Pin, 1999).The superfamily of GPCR is the largest gene family found so far, more than 1000 human genes have been identified for GPCRs, which include the m2 muscarinic receptor, the serot onin 1A receptor, the a 2 adrenergic receptor, the D2-dopaminergic receptor, the opioid receptors, the A1 adenosine receptor, the lysophosphatidic acid 1 rec eptor, and the gamma-

PAGE 13

2 aminobutyric acid type B (GABAB) receptor. GPCRs have a wide variety of ligands such as small biogenic amines (for example, 5-hydroxytryptamine (5-HT), dopamine, acetylcholine, epinephrine/norepinephrine histamine), hormones, chemokines, local mediators, the amino acid L-gluta mate, peptides, polypeptides, nucleotides, prostanoids, calcium ion s, and lipids. GPCRs also play fundamental roles in sensory systems mediating visi on, smell, and taste by responding to light, odorants, and taste stimuli (W ess, 1998). It has been estimated that about 80% of known hormones and neur otransmitters activate cellular signal transduction mechanisms through GPC Rs (Birnbaumer 1990), and GPCRs represent 30-45% of current drug targets (Dre ws et al., 2000; Hopkins and Groom, 2002). GPCRs are susceptible to post-tra nslational modifications, they can be palmitoylated, phosphorylated, and glyc osylated. All of these modifications are important for the proper channel function, mediating trafficking, desensitization, and coupling (Daaka et al., 1997; Duvernay et al., 2005; Qanbar and Bouvier, 2003). GPCRs show selective coupling to G-proteins, for ex ample, muscarinic m1, m3, and m5 couple to the Gq/G11 family of G-pr oteins whereas m2 and m4 subtypes preferentially interact with the Gi/o fami ly (Gainetdinov and Caron, 1999; Offermanns et al., 1994). Recent studies are challenging the classical idea that GPCRs act as monomers, and the stoichiometry i s one receptor and one G protein coupling. Now it seems that a stoichiometry of 2 GPCRS and 1 G protein is more correct (Bulenger et al., 2005). Not only h omo-heteromerization of

PAGE 14

3 GPCRs is important and necessary for receptor traff icking and maturation, but it seems to be important for receptor selectivity as w ell. Chemokine receptors can form homoand heterodimers. Depending on their com position they activate either Gi signaling pathway (homodimers) or Gq/11 ( heterodimers) (Mellado et al., 2001). The diversity and physiological importa nce of GPCRs are increasing due to splice isoforms from already characterized G PCRs that show differential tissue specificity (Cole and Schindler, 2000; Huan g et al., 2004; Mohler et al., 2001; Zhang et al., 2004). Guanine nucleotide-binding proteins (G proteins) Heterotrimeric guanine nucleotide-binding proteins (G proteins) are composed of a b and g subunits. They transduce extracellular signals rec eived by 7-transmembrane receptors into intracellular sig nals through effector activation (Neer, 1995). Upon GPCR activation, the a subunit of the G protein exchanges its bound GDP for GTP. This causes the bg subunit to dissociate from the G aGTP subunit, and either G aGTP or G bg or both act as downstream effectors in enhancing the receptor-mediated signal The duration of G-protein coupled signaling is controlled by the lifetime of GTP-bound G a subunit. Termination of the G protein cycle occurs when the intrinsic GTPase activity of the G a subunit hydrolyzes the GTP and G a -GDP reassociates with its G bg subunit (Sadja et al., 2003). Mammalian genes for 16 G a 5G b and 12 G g subunits have been identified, as well as many spli ce variants for these genes

PAGE 15

4 (Downes and Gautam, 1999). G proteins are divided i nto four families based on their G a subunit: Gs, Gi/o, Gq/11 and G12/13. The Gi/o group is composed of three distinct ai ( ai1, ai2 and ai3), two splice forms of a o ( aoA and aoB), two splice forms of at, agust and az (Wess, 1998). The different G a subunits are determinant for receptor coupling specificity. For example serotoni n 1A, 1B, and muscarinic m2 receptors can couple with Gi1 but not Gt, meanwhile adenosine A1 receptor can couple to both of them (Slessareva et al., 2003). The Gs subunit stimulates adenylyl cyclase (AC) increasin g the intracellular concentration of cyclic adenosine-3’, 5’-monophosphate (cAMP). Gq subunit activates phospholipase Cb (PLCb ) catalyzing hydrolysis of the phosphatidylinositol 4,5-bisphosphate (PIP2) to form second messengers, inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). The Gi/o subunits have several functions: Gt1 activates cGMP phosphodiesterase, Go modulates Ca2+ channel function, and Gi subtypes inhibits AC (Cabrera-Vera et al., 2003). Initially, G bg subunits were thought to be as passive elements ju st binding to G a subunits. Now it is known that G bg regulate several effectors such as K+ and Ca2+ channels, PLC b s, and PI3 kinase (Cabrera-Vera et al., 2003). Regulator of G protein signaling (RGS) proteins Regulators of G protein signaling (RGS) proteins sp eed up passage through the G-protein cycle by increasing the intri nsic GTPase activity of G a subunits, thereby accelerating the reassociation of the ‘inactive ’heterotrimeric

PAGE 16

5 complex G a(GDP)bg (Ross and Wilkie, 2000). RGS proteins are characte rized by a highly conserved ‘RGS domain ’of ~ 125 a.a. that co nfers direct binding to G a subunits and is flanked by less conserved Nand Cterminal domains of variable length (Tesmer et al., 1997). The first ma mmalian RGS proteins were reported about ten years ago (Druey et al., 1996; V ries et al., 1995). More than 20 mammalian RGS genes have been identified to date and are classified into six subfamilies (RZ, R4, R7, R12, RA, RL) based on sequence homology within the RGS domain (Hollinger and Hepler, 2002; Ross an d Wilkie, 2000). Alternative splice isoforms from the already charac terized RGS proteins have been described, some of them having specific f unctions (Hollinger and Hepler, 2002). Thus far, there are four RGS3 splice isoforms that differ in their Nterminal domain: C2PA-RGS3, the largest one (Kehrl et al., 2002). PDZ-RGS3, that binds through the PDZ domain to the Ephrin B r eceptor and through the RGS domain regulates the migration response of cere bellar granule cells mediated by SDF-1 chemoattractant (Lu et al., 2001) RGS3T is a truncated form of RGS3, it is localized at the nuclear level and i s involved in apoptosis (Dulin et al., 2000). And RGS3s “short” is highly expressed i n heart, brain and lungs, and inhibits chemotactic responses of B lymphocytes (Re if and Cyster, 2000). RGS proteins show distinct tissue distribution (Gol d et al., 1997; GrafsteinDunn et al., 2001), they also have specificity towa rds Ga subunits. For example RGS9 interacts with Gt, meanwhile RGS4 interacts with Gi/o and Gq. RGS2 interacts preferentially with Gq (Hollinger and Hepler, 2002).

PAGE 17

6 RGS proteins can be phosphorylated and palmitoylate d, these posttranslational modifications produce a variety o f effects including alterations in subcellular localization, protein stability and alt erations in GAP activity (Riddle et al., 2005) Originally RGS proteins were thought to be only GTP ase-activating (GAPs) proteins. However, increasing evidence is po inting to a bigger role in signal transduction. Some RGS are able to interact with other proteins via nonRGS domains, such as RGS12 that with the PDZ domain binds to IL-8 receptor and through its PTB domain is able to bind to N-typ e Ca2+ channels. PDZ-RGS3s binds via the PDZ domain the Eprin B receptor. RGS3 and RGS7 can bind 14-33 proteins when phosphorylated (Hollinger and Heple r, 2002). RGS4 appears to regulate Ga function based in recognition of receptors rather than association with Ga. In pancreatic acinar cells carbachol, bombesin, a nd cholecystokinin (CCK) activate Gq/11 pathways via specific GPCRs. D eletion of the RGS4 Nterminus eliminated the receptor selectivity and re duced the potency of the inhibition (Zeng et al., 1998). In another study, R GS1 and RGS16 also displayed receptor selectivity, whereas RGS2 displayed no pre ference among the three receptors (Xu et al., 1999). In striatum, RGS9-2 mo dulates Ca2+ channel inhibition in a GPCR specific manner (Cabrera-Vera et al., 2004). RGS proteins are emerging as attractive therapeutic targets (Hollinger and Hepler, 2002; Neubig and Siderovski, 2002; Riddle e t al., 2005; Zhong and Neubig, 2001). RGS2 appears to be linked to cardiov ascular diseases. RGS2

PAGE 18

7 knockout mice exhibit a severe cardiovascular pheno type (Heximer et al., 2003), and overexpresion of RGS2 is seen in individuals wi th Bartter’s/Gitelman’s Syndrome (Calo et al., 2004). RGS4 has been linked to schizophrenia (Chowdari et al., 2002; Mirnics et al., 2001). In addition, a n RGS9 mutation has been identified as the cause of a pathological condition where patients with mutations in either RGS9-1 or R9AP (RGS9 anchor protein) have slow photoreceptor deactivation and difficulty in adjusting to changes in light levels, as well as in seeing low-contrast moving objects (Nishiguchi et a l., 2004). G protein coupled inward rectifying potassium (GIRK ) channel G protein-gated inward rectifying potassium (GIRK) are selective K+ ion channels “opened” by a direct interaction with G bg subunits (Logothetis et al., 1987). GIRK channels belong to the K+ inward rectifier (Kir) channel family, that is divided into 6 main subfamilies (Kir1.0-kir6.0), so they can also be named Kir3 channels (Doupnik et al., 1995). This family is cha racterized for having “inward rectification” which means that these channels allo w potassium ions to flow through them more readily into the cell than out of the cell at hyperpolarized membrane potentials (Hille, 2001). GIRK channels ar e activated by GPCRs that couple to G a i/o (Dascal, 1997) and inhibited by receptors that couple to G a q (Lei et al., 2001). A large number of agonists can activ ate GIRK channels through Gi/o receptors such as acetylcholine (Dascal et al. 1993), adenosine (Leaney and Tinker, 2000), dopamine (Inanobe et al., 1999; Leaney and Tinker, 2000),

PAGE 19

8 GABA (Leaney and Tinker, 2000), serotonin (Dascal e t al., 1993; Karschin et al., 1991), norepinephrine (Lim et al., 1995; Mullner et al., 2000), somatostatin (Takano et al., 1997), and LPA (Itzhaki Van-Ham et al., 2004) The activation of these channels by PTX-sensitive G protein coupled r eceptors cause membrane hyperpolarization. The physiological role of GIRK c hannels is to maintain the resting membrane potential near the potassium equil ibrium potential, and to slow pacemaker action potential frequency and heart rate (Breitwieser and Szabo, 1985; Kurachi et al., 1986; Logothetis et al., 1987 ; Pfaffinger et al., 1985). They are also involved in the slow phase of inhibitory p ostsynaptic potentials (Doupnik et al., 1995; Luscher et al., 1997; Nichols and Lop atin, 1997; Stanfield et al., 2002). The sequestration of G bg by GDP-bound G a subunit will close the channel. The kinetics of activation and deactivatio n of GIRK channels therefore reflect the kinetics of the G protein cycle. The properties of GIRK channel gating can be modula ted by a variety of factors such as phosphatidylinositol-4,-5-biphospha te (PIP2), Na+, Mg2+, oxidation-reduction, phosphorylation, and acidifica tion (Sadja et al., 2003). Four GIRK subunits have been found in mammals (GIRK 1,2,3,4 or Kir3.1,2,3,4), another subunit GIRK5 has been chara cterized in Xenopus oocytes (Yamada et al., 1998). Furthermore, Kir3.2 has at l east three different isoforms generated by alternative splicing named Kir3.2a, Ki r3.2b, and Kir3.2c (Wei et al., 1998). Each GIRK subunit has intracellular N and C termini, two transmembrane domains and one “P-loop” that is considered the K+ channel “signature

PAGE 20

9 sequence” (Hille, 2001). Functional GIRK channels a re heterotetramers. Neuronal GIRK channels are composed of Kir3.1, Kir3 .2, Kir3.3 subunits, whereas cardiac channels are formed by Kir3.1 and K ir3.4 subunits. GIRK1/2 was found to be the dominant heterotetramer mainly detected in brain (Kofuji et al., 1995; Liao et al., 1996). Only GIRK1 and GIRK4 subunits are distributed in atrial and sinoatrial node cells of the heart (Krap ivinsky et al., 1995a), which are involved in the regulation of heart rate (Mark and Herlitze, 2000). Coupling of GPCRs to G proteins and GIRK channels This cartoon depicts the signaling pathway that cou ples GPCRs with GIRK channels. Upon GPCR activation, the ai/o subunit of the G protein exchanges its bound GDP for GTP. This causes the bg subunit to dissociate from the G aGTP subunit, and bind to the GIRK channel, opening the channel and allowing K+ to

PAGE 21

10 flow out of the cell and hyperpolarizing the membra ne potential. The duration of G protein coupled signaling is controlled by the li fetime of GTP-bound G a subunit. Termination of the G protein cycle occurs when the intrinsic GTPase activity of the G a subunit hydrolyzes the GTP, and G a -GDP reassociates with its G bg subunit. RGS proteins speed up the termination of the G protein signal by enhancing the intrinsic GTPase activity of the Ga i/o subunit, therefore accelerating the closing of the GIRK channel. Based on functional findings, a model that postulat ed the assembly of m2, RGS4, G protein and GIRK channel was proposed (Doup nik et al., 1997; Zhang et al., 2002). Recently, it has been shown that sev eral GPCRs such as dopamine 2, dopamine 4 and beta2 adrenergic receptors form s table complexes with Kir3 channels in COS-7 and HEK 293 cells and brain tissu e (Lavine et al., 2002). Some in vitro experiments indicate that RGS2 is able to bind to the third intracellular loop of the Gq/11-coupled m1 muscarin ic receptor (Bernstein et al., 2004). My work described here confirms the existence of th ese supracomplexes composed of GPCR-G protein-RGS4-GIRK channels, indi cating that indeed RGS proteins are more than simply GAPs and serve as anc horing proteins in the assembly of these signaling complexes.

PAGE 22

11 CHAPTER 2 GENERAL METHODS AND MATERIALS Cerebellar granule neuron cultures Cerebellar granule (CG) neurons from neonatal rat p ups were both amiable to enzymatic isolation and primary culture for experimental manipulations. To isolate and culture postnatal day 4–6 rat CG neurons, I used a protocol modified from (Slesinger and Lansman, 1991 ). Following ip injection of sodium pentobarbital (4 mg/100 g body weight) to in duce deep anesthesia, rat pup cerebella (2–4) were removed rapidly and placed in a 35-mm culture dish containing ice-cold calcium and magnesium-free (CMF ) Tyrode’s solution (in mM): 136.9 NaCl, 5.4 KCl, 6.0 NaHCO3 0.33 Na2HPO4 5.5 D-glucose, 5.0 HEPES, at pH 7.4 (NaOH), containing 100 U/ml penici llin and 0.1 mg/ml streptomycin. The tissue was minced, washed with CM F Tyrode’s solution, and then digested with 0.5 ml of trypsin/EDTA solution (GIBCO 25300-054) for 10 min at room temperature. The digestion was stopped by placing on ice and adding ‘‘isolation medium’’ that consisted of modif ied Eagle’s medium with Earle’s salts (GIBCO 11095-080) supplemented with 1 0% heat-inactivated horse serum, 25 mM KCl, 6 mg/ml d-glucose, 2 mM glutamine 0.5 U/ml DNase I, 0.5

PAGE 23

12 U/ml penicillin, and 0.5 g/ml streptomycin. The dig ested tissue was then triturated using a 1-ml sterile pipette, and the dispersed cel ls plated at low density on polyl-lysine-coated 35-mm Corning cell culture dishes. The cells were incubated for 5 h at 37o in a 5% CO2 atmosphere, and then the culture medium was change d to serum-free Neurobasal-A medium (GIBCO 10888-022) wi th B-27 supplement and 25 mM KCl, 2 mM glutamine, 0.5 U/ml penicillin, and 0.5 g/ml streptomycin. The cerebellar cell cultures were then maintained i n a humidified incubator at 37o with a 5% CO2 atmosphere for 24–48 h before extensive neurite ou tgrowth took place. All procedures for the use and handling of r ats were approved by our institutional animal care and used in accordance wi th NIH guidelines. Single cell harvesting for RT-PCR analysis Single rat CG neurons were harvested from culture d ishes using a micropipette (15–30 m m tip diameter) fabricated from borosilicate glass tubes (1.5 mm outside diameter, 0.86 mm inside diameter, GC150 F-10, Warner Instruments) by a programmable microelectrode pulle r (P-97, Sutter Instruments). Latex gloves were worn throughout the handling and harvesting procedure to minimize potential sources of contamin ation. The micropipette was attached to a microelectrode holder used for patchclamp recordings, allowing application of negative or positive pressure via an attached syringe. The culture dishes were first washed with a solution consisting of (mM) 145 NaCl, 5 KCl, 2 CaCl2 1 MgCl2 ,10 D-glucose, 5 HEPES, at pH 7.4 (NaOH) at room t emperature

PAGE 24

13 (~ 23oC). A single CG neuron having bipolar morphology (F ig. 3.1A) was then drawn into the micropipette by negative pressure. T he micropipettes were not filled with solution initially, but contained 5 m l of the external solution after the cell had been harvested. The contents of the micropipett e were then expelled into a PCR tube by positive pressure and the tube was plac ed on ice. For each experiment, four to six single cells were harvested and tested in parallel with negative and positive controls. Two negative contro l samples were a 5 m l sample of RNase-free H2O and a 5 m l sample of the external solution. Positive control s included poly(A)+ mRNA from neonatal rat whole brain (0.5–5.0 ng). E xperiments were generally repeated three times from separate d issections/ cultures for each RGS examined to account for animal, culture, and ce ll variability. Design of intron-spanning gene-specific primers The RT-PCR approach utilizes gene-specific primers that selectively amplify mRNA transcripts from a specific RGS gene f rom a single cell. Because all mammalian RGS genes are poly-intronic (Sierra e t al., 2002), intron-spanning primers were designed to distinguish mRNA-derived PCR products from genomic DNA-derived products (Doupnik et al., 2001) At the time of my original study, sequence information for rat RGS genes was l imiting so mouse and human RGS sequences were used as alternatives for p rimer design. The effectiveness of each RGS primer set was confirmed by positive controls using

PAGE 25

14 samples of rat brain poly(A) mRNA. A full list of t he RGS primer sequences is provided (see Table.2.1). Single cell reverse transcriptase PCR (RT-PCR) anal ysis One-step RT-PCR was carried out using the intron-sp anning gene-specific primers according to the manufacturer’s protocol (O neStep RT-PCR, Qiagen Inc.). For each 5 m l sample, 20 m l of a RT-PCR master mix was added and contained the following: forward and reverse primer s at 0.6 m M each (final concentration), dNTPs at 400 m M each (final concentration), Omni-script and Sensiscript reverse transcriptases, HotStar Taq DNA polymerase, RNase inhibitor, and a buffer solution containing Tris–Cl KCl, (NH4)2SO4 MgCl2 and dithiothreitol. Concentrations of enzymes and buffe r components were as recommended by the manufacturer (1X concentration, Qiagen, Inc.) and included the 1X ‘‘Qsolution,’’ which effectively reduced non specific bands produced by mispriming events. Each 25 m l sample was then placed in a PCR thermocycler (GeneAmp 2400, PE Biosystems, Inc.) for the followi ng temperature protocol: 50o for 30 min (reverse transcription), 95o for 15 min (activation of HotStar Taq polymerase), 45 cycles of 94o for 30s (melt), 3–4o below the primer annealing temperature for 30s, and 72o for 60–90s (extension). At the end of the cycling period, samples were held at 72o for 10 min (final extension) and the reaction was stopped by cooling to 4o. According to the manufacturer (Qiagen Inc.), this PCR cycling protocol (45–50 cycles) was expected to allow detection of mRNA

PAGE 26

15 transcripts in the general range of 10 to 100 copie s per cell. The PCR samples were then analyzed by 2% agarose gel electrophoresi s, and the products were visualized by ethidium bromide staining and UV illu mination. Gel images were captured using a digital gel-imaging system (BioIma ger, Genomic Solutions Inc.) and were scored for positive or negative expression based on visual detection of the expected gel band.

PAGE 27

16 Table 2.1 Gene Specific Primers for Single-Cell RT-PCR Genbank LocationAnnealingProduct cDNASpeciesAccession #Primer Sequence ( A TG = +1) Temp. ( o C) Size (bp) GIRK 2a mouseForward 5' CCTGCCGGGGCTGATGATGTGA 3'58339 Reverse 5' TTGGTCCTGTCTCGGCTGATGTGT 3' RGS 1 humanS59049Forward 5' TTGAGTTCTGGCTGGCTTGTG 3'+2965 2.6246 Reverse 5' CTGATTTGAGGAACCTGGGATAA 3'+541 RGS 2 mouseU67187Forward 5' GACCCGTTTGAGCTACTTCTTG 3'+126 54.6494 Reverse 5' CCGTGGTGATCTGTGGCTTTTTAC 3'+619 RGS 3L humanU27655Forward 5' TTCGCCCAGCACCCTCAAGA 3'+89459 .6473 Reverse 5' ATGCCTGGATCGCGATGTATTCA 3'+1366 RGS 3 humanU27655Forward 5' TCCCGGAAGAGAAAGAGCAAAAA 3'+10 1858.0349 Reverse 5' ATGCCTGGATCGCGATGTATTCA 3'+1366 RGS 4 ratU27767Forward 5' TGCAGGCAACAAAAGAGGTGAA 3'+36255 .5192 Reverse 5' CCCCGCAGCTGGAAGGAT 3'+553 RGS 5 mouseU67188Forward 5' AGCCGCCAGCCAAAATGTGTA 3'-1458 .3525 Reverse 5' CAAAGCGGGGCAGAGAATCCT 3'+511 RGS 6 humanNM004296Forward 5' GGGGCGGGACCAGTTTCTACGAT 3'+ 103559.1352 Reverse 5' CCCGCCAGCGACTTTCCCTTCT 3'+1386 RGS 7 ratAB024398Forward 5' ACCCATTTCTTGTACCGCCTGACC 3'+8 8157.2485 Reverse 5' TCTGCCCTTTCTCTTTGCCTGTAG 3'+1365 RGS 8 ratAB006013Forward 5' GACAAACCCAACCGCGCTCTCAAG 3'+1 0660.6288 Reverse 5' CGTGGCCTCTCGGGTCTGGAAATC 3'+393 RGS 9 ratAB019145Forward 5' TACCGGACTGGAAAGGAGAGGAAC 3'+4 9658.6579 Reverse 5' ACCCGGTGCCAGGAACAGC 3'+1074 RGS 10 humanNM002925Forward 5' GAGCCTCAAGAGCACAGCCAAATG 3' +4856.9278 Reverse 5' GCGGTTCTTCCAGGATCTTCTCGT 3'+325 RGS 11 mouseAF061934*Forward 5' TCAGTGCGGAAAACCTCA 3'+890* 56.1335 Reverse 5' CCGCAAGAATGGAAATG 3'+1224* RGS 12 ratU92280 Forward 5' ATCGAAATGTTAGAAAGACCAAAGAGGAC 3' +184759.51105 Reverse 5' ATGGAAAACCCGGACTTGACAGCA 3'+2951 RGS 13 humanAF030107Forward 5' TCAAACGGATCATAACAAAGAGGA 3' -18052.7286 Reverse 5' CAAAAGACTGGGCCCACTGTAATA 3'+106 RGS 14 ratU92279Forward 5' TCAGCGCCGAGAATGTAACTTT 3'+26657 .8181 Reverse 5' TGGGCCAGCACCTCCTCACTAA 3'+446 RGS 16 mouseU72881Forward 5' TGCCGCACCCTAGCCACCTTC 3'+459. 3369 Reverse 5' TTCGCTGCGGATGTACTCGTCAAA 3'+372 RGS 17 mouseAF191555Forward 5' GGAAACCAAAGGCCCAACAATAC 3'+ 5857.0350 (RGSZ2)Reverse 5' ATCATCCTGGCCTTTTCTTCAACA 3'+407RGS 18 mouseAF302685Forward 5' GCCAAAATCAGAGCGAAAGA 3'+109 53.6421 Reverse 5' GTGCCGTATCAAAACTGTGGAG 3'+529 RGS 19 ratAF068136Forward 5' ACGGGCCGCAGTGTATTCC 3'+29557. 9276 (GAIP)Reverse 5' CCGGTGCATGAGGGTGTAGAT 3'+570RGS 20 mouseNM021374Forward 5' AGAAGACCAGAGACCCCAAAGAGC 3' +23156.6434 (RGSZ1)Reverse 5' AGTTCATGAAGCGGGGATAGGAGT 3'+664

PAGE 28

17 Chinese hamster ovary (CHO-K1) cells for heterologo us expression Chinese hamster ovary (CHO-k1) cells are a commonly used mammalian expression system. CHO-K1 cells are very robust and easy to grow in culture conditions, they also display a high cotransfrectio n efficiency using cationic lipidbased transfection methods, a critical attribute fo r reconstituting expression of multiple protein within a single cell (Ehrengruber et al., 1998). CHO-K1 cells have a round geometry and small size making them well su ited for whole-cell patchclamp recordings (Doupnik et al., 1997; Ehrengruber et al., 1998; Jaen and Doupnik, 2005). CHO-K1 cells do not express endogen ous GIRK channel subunits, yet they do express various GPCRs (Schonb runn, 2004) and RGS proteins. The endogenous expression of RGS mRNA in CHO-K1 cells has been partially characterized (RGS1, RGS2, RGS3, RGS4, RG S10, RGS16, and RGS19) with RGS2 being significantly expressed, RGS 4 not expressed, and the others being expressed at moderate to low levels ba sed on RT-PCR analysis (Boutet-Robinet et al., 2003; Takesono et al., 1999 ). Heterologous expression of wild type cDNAS in CHO-K 1 cells CHO-K1 cells (American Type Culture Collection, Man assas, VA) were cultured in a -modified Eagle’s medium containing 5% fetal bovine serum and 0.1 mg/ml streptomycin, and maintained in a humidified 5% CO2 incubator at 37 oC. One day after low density plating in 35 mm dishes, cells were transfected with DNA-liposome complexes composed of lipofectamine (I nvitrogen, Carlsbad, CA)

PAGE 29

18 and a mixture of cDNAs cloned into the mammalian ex pression vector pcDNA3.1(+) (Invitrogen). The total DNA ( m g) to lipofectamine ( m g) ratio was kept constant at 1:5 when pre-forming the DNA-liposome c omplexes. The amount of each DNA vector in the mixture per dish was as foll ows; 0.2 m g rat Kir3.1 (GenBank accession # NM_031610 ), 0.2 m g mouse Kir3.2a (GenBank accession # NM_010606 ), 0.2 m g GPCR either human muscarinic m2 receptor (GenBank accession # NM_000739 ) or human 5-HT1A receptor (GenBank accession # NM_000524 ), with or without 1.0 m g RGS either mouse RGS3s (GenBank accession # NM_134257 ) or rat RGS4 (GenBank accession # NM_017214 ), with 0.1 m g enhanced green fluorescent protein (GFP) cDNA (pG reenlantern-1, GIBCO) included as a reporter gene (Doupnik et al., 1997; Doupnik et al., 2004). The transfected cells were incubated overnight in s erum-free OPTI-MEM media (Invitrogen). Twenty-four to thirty-six hours after transfection, single GFP-positive cells were selected for electrophysiological record ings. The RGS3s cDNA clone was generously provided by Drs Karin Reif and Jason Cyster (University of California, San Francisco) (Reif and Cyster, 2000). All other cDNA clones were as described elsewhere (Doupnik et al., 1997; Doupn ik et al., 2004). For pertussis toxin (PTX) pre-treatment experiments, tr ansfected CHO-K1 cells were incubated overnight (12-18 h) with 100 ng/ml PTX (P -7208, Sigma Chemical).

PAGE 30

19 Construction of epitope-tagged expression vectors N-terminal-tagged GPCR’s Complimentary DNA’s encoding the human muscarinic m2 receptor (Genbank Accession # NM_0007 39), human serotonin 1A receptor (Genbank Accession # NM_000524), and mo use lysophosphatidic acid (LPA1/ edg 2) receptor (Genbank Accession # NM_010336) were “t agged” at their N-termini with the hemagglutinin (HA) sequenc e (YPYDVPDYA). The HA tag was preceded by a modified influenza hemaglutin in signal sequence (MKTIIALSYIFCLVFA) for efficient membrane targeting (Guan et al., 1992). The signal sequence and HA tag sequence were introduced by annealing two complimentary oligonucleotide primers (Sigma-Genosy s) that contained a 5’ Hind III restriction site followed by a Kozak translatio n initiation sequence (GCCGCCACC), the 16 a.a. signal sequence, the 9 a.a HA sequence, and finally a 3’ Xba I restriction site. The annealed duplex was then cu t with Hind III and Xba I, and cloned into the pcDNA3.1(+) mammalian expres sion vector (Invitrogen). The complete coding region of the hum an muscarinic m2 receptor, human serotonin 1A receptor, and mouse LPA1 recepto r were then amplified by PCR and cloned in-frame at the Xba I site of the N-terminal HA-tag pcDNA3.1(+) vector. The cloning process resulted in two additio nal amino acids (SR) between the HA tag and starting methionine of the native GP CR sequence due to the Xba I sequence. The human adenosine A1 receptor (Genban k Accession # AY136746), human dopamine D2L receptor (Genbank Acc ession # NM_000795), and human muscarinic m1 receptor (Genba nk Accession #

PAGE 31

20 AF498915) were obtained from the University of Miss ouri, Rolla cDNA Resource Center (www.cdna.org) and contained N-terminal trip le (3X) HA tags, and were cloned into the pcDNA3.1(+) vector. C-terminal-tagged Kir3 channels The rat Kir3.1 channel subunit (Genbank Accession # NM_031610) was tagged at the C -terminus with the MYC epitope (EQKLISEEDL) by PCR and cloned into the pBu dCE4.1 vector (Invitrogen). The pBudCE4.1 vector is a duel expres sion vector where Kir3.1MYC expression was driven by the CMV promoter. Mous e Kir3.2a (Genbank Accession # NM_010606) was cloned into the second c loning site with expression driven by the EF-1a promoter. The Kir3.2 a subunit was not modified by epitope tagging. The resulting Kir3.1-MYC/Kir3.2 a-pBudCE4.1 construct yielded expression of both Kir3 channel subunits fr om a single DNA plasmid. C-terminal-tagged RGS proteins Rat RGS4 (Genbank Accession # NM_017214) and mouse RGS3s (Genbank Accession # NM_ 134257) were tagged at their C-termini with the FLAG epitope (DY KDDDDK) by PCR using primers that incorporated the FLAG sequence. The RG S-FLAG constructs were cloned into the pBudCE4.1 vector with expression dr iven by the CMV promoter. Enhanced green fluorescent protein, GFP(S65T) (pGreenlantern-1, GIBCO), was cloned into the second site with expression driven by the EF-1a promoter. The resulting RGS-FLAG/GFP-pBudCE4.1 plasmids provided expression of the RGSFLAG protein and the GFP reporter protein from a si ngle DNA plasmid. A pBudCE4.1 plasmid containing only GFP(S65T) was also generated for negative

PAGE 32

21 control (RGS-) experiments. All point mutations, de letion mutations, and chimeras of RGS3s-FLAG and RGS4-FLAG were construct ed by PCR and also cloned into the CMV promoter driven site of GFP-pBu dCE4.1 vector. The sequence of all epitope-tagged full-length cDNA constructs were confirmed by automated DNA sequencing (Molecular Bi ology Core Facility, Moffitt Cancer Center and Research Institute, Tampa FL). Transfection of epitope-tagged cDNAs in CHO-K1 cell s The transfection was very similar to the one previo usly described. In this case, for electrophysiological experiments, cells w ere plated at low density on 35 mm culture dishes, and for biochemical experiments, cells were plated at a similar density on 100 mm culture dishes. Cells were transfected using lipofectamine (Invitro gen) and a mixture of 34 expression vectors. The total DNA ( m g) to lipofectamine ( m g) ratio was kept constant at 1:5 when pre-forming the DNA-liposome c omplexes. The amount of each DNA vector in the mixture for each 35 mm dish was as follows; HA-GPCRpcDNA3.1 (0.2 m g), Kir3.1-MYC/Kir3.2a-pBudCE4.1 (0.2 m g), and either RGSFLAG/GFP-pBudCE4.1 or GFP-pBudCE4.1 (negative contr ol) (1.0 m g). For transfection of cells plated in 100 mm dishes, the amounts were scaled 8X. Transfected CHO-K1 cells were incubated 24-36 hr in serum-free OPTI-MEM media (Invitrogen). For some experiments, mammalian expression vectors

PAGE 33

22 containing different G a subunit cDNA’s (G a i2(C352G), G a oA(C351G), or G a q) were included (1.6 m g for 100 mm dish). Immunoprecipitation and co-immunoprecipitation Transfected CHO-K1 cells (100 mm dishes) were first washed with icecold Tris Buffered Saline (TBS pH 7.2). Three 100 m m plates were combined for each experimental condition. Cells were lysed and collected by cell scraping in 800 m l of extraction buffer at 4oC. The extraction buffer was composed of 150 mM NaCl, 50 mM Tris pH 7.5, 1 mM EDTA, 1% n-dodecyl b -D-maltoside (MP Biomedicals), and a protease inhibitor cocktail (Co mplete Mini EDTA-free, Roche). The crude cell lysate was then left end-ove r-end rotating at 4oC for 30 minutes to solubilize cell membranes. Afterwards, t he sample was spun for 10 minutes at 14,000 g to remove cellular debris. The protein concentrations of the final supernatants (cell lysates) were determined u sing a BCA assay (Pierce). Immunoprecipitations were performed using anti-HA o r anti-MYC antibodies conjugated to agarose beads (Profound IP /Co-IP kits, Pierce). Briefly, cell lysates (~750 m l or ~600 m g) were transferred to spin columns and either anti-HA or anti-MYC agarose beads added (10 m g) followed by end-over-end rotation for 4 hours at 4oC. The columns were then spun to remove the cell lysate, and the beads then washed three times with extraction buffer (500 m l each). The immunoprecipitated proteins bound to the agarose beads were then

PAGE 34

23 eluted 3X (10 m l each) with pH 2.8 elution buffer (Pierce). The ac idic protein sample was then immediately neutralized with 1.5 m l of 1M Tris, pH 9.5. Western blot analysis Western blotting was performed using standard metho dology. The eluted protein samples (~30 m l) were added to 7.5 m l of a 5X SDS loading buffer (0.3 M Tris-Cl, pH 6.8, 5% SDS, 50% glycerol, and a lane t racking dye) that also contained b -mercaptoethanol (~10%). The samples were heated fo r 5 minutes at 95oC. A portion of the denatured protein sample (~20 m l) was then separated by gel electrophoresis using 4-15% or 8-16% Tris-HCl g lycine polyacrylamide gels (BIO-RAD) and transferred to polyvinylidene difluor ide (PVDF) membranes (Immobilon-P, Millipore). PVDF membranes were first incubated for 1 hr in blo cking buffer (5% nonfat dry milk powder in TBS with 0.05% Tween 20), then incubated overnight at 4oC with the appropriate primary antibody; (1:1000) H RP-conjugated anti-HA 12CA5 antibody (Roche); (1:1000) HRP-conjugated ant i-MYC 9E10 antibody (Roche); (1:1000) HRP-conjugated anti-FLAG M2 antib ody, or 5-10 m g/ml antiFLAG M2 antibody (F-3165 Sigma-Aldrich). For anti-F LAG immunodetection using the non-HRP conjugated antibody (F-3165), mem branes were washed in blocking buffer (5X) and subsequently incubated for 1 hour with an HRPconjugated goat anti-mouse secondary antibody dilut ed 1:10,000 in blocking buffer (sc-2318 Santa Cruz). Following all antibody incubations, PVDF

PAGE 35

24 membranes were washed 4 times (15 minutes each) wit h TBS containing 0.05% Tween 20, followed by 2 times (20 minutes each) wit h TBS. HRPimmunoreactive protein bands were then resolved by enhanced chemiluminescence (Luminol, Santa Cruz), and detect ed by exposure to bluesensitive autoradiography film (Midwest Scientific) For some PVDF membranes, antibodies were stripped and re-probed with a diffe rent antibody. Electrophysiological recordings from cerebellar gra nule neurons Critical to resolving RGS modulated GIRK current ki netics in mammalian cells is establishing an electrophysiology setup ca pable of rapid solution changes for agonist application and washout during whole-ce ll voltage-clamp recording. I currently use the SF-77B Fast-Step perfusion system (Warner Instruments) that consists of a 3-barrel array made of 700 m square capillary tubes, delivering gravity-driven flow of 3 independent solutions in p arallel. Each barrel can receive input via a manifold connecting up to six different solution reservoirs to expand the solution testing capability. The movement and p osition of the barrel array is computer controlled, having a limiting step-speed o f ~240 ms though can be as fast as 120-140 ms at the highest flow rates I can generate (~75 cm column height). These solution exchange rates are comparab le to some (Breitwieser and Szabo, 1988; Bunemann et al., 1996), though somewha t slower than the 10-50 ms time constants reported by others using similar configurations (Karschin et al., 1991; Sodickson and Bean, 1996). Nonetheless, they are sufficient to

PAGE 36

25 temporally resolve the GIRK current kinetics observ ed at room temperature (2224oC) with and without RGS co-expression. Cerebellar granule neurons are selected for electrophysiological recordings using standard whole-cell tight-seal patch clamp methods (Hamill et al., 1981). Cells ar e initially washed and placed in an external solution that consists of (in mM); N aCl 145, KCl 5, CaCl2 2, MgCl2 1; glucose 10, HEPES 5 (pH = 7.4). After gigaseal f ormation and breaking into the cell for whole-cell recording, 2 min is allowed to permit equilibration of the intracellular solution. The composition of the inte rnal pipette solution is (in mM): KCl 120, NaCl 10, MgCl2 5, EGTA 1, HEPES 5, ATP 5, GTP 0.2 (pH= 7.2). Firs t after breaking into the cell, the membrane capacita nce (a direct measure of cell surface area) is determined via amplifier compensat ion, and later used to express the maximal current amplitude as a current density (pA/pF) for cell-tocell comparisons. Agonist-evoked inward K+ currents are recorded from a holding potential of -100 mV, which is sufficiently negativ e to the experimentally set K+ equilibrium potential (EK = -40 mV). Thus after establishing the whole-cell recording an d clamping the membrane potential to -100 mV, the cell is initiall y superfused with a “high K+“ solution composed of (in mM): NaCl 125, KCl 25, CaC l2 2, MgCl2 1; glucose 10, HEPES 5 (pH = 7.4). The solution is applied via one of the 700 m square capillary tubes positioned next to the cell and con nected to a 20 ml syringe reservoir where the flow rate is gravity controlled by adjusting the syringe height. After a stable baseline holding current is establis hed, the agonist is applied (in

PAGE 37

26 the high K+ solution) via the step movement of the barrel arra y so that agonist flow via the adjacent barrel is positioned in line with the recorded cell. We typically apply the agonist for 15s to minimize rec eptor desensitization, followed by agonist washout with the step movement back to t he high K+ solution barrel (see Figure 2.1B). Voltage-clamp recordings are per formed using an Axoclamp 1D amplifier (Axon Instruments). Current signals ar e sampled and digitized via a Digidata 1200B A/D board that also synchronizes dig ital output signals to the SF77B Fast-step controller. Axon pCLAMP8.0 software i s used to trigger the perfusion barrel movements along with 500 ms voltag e ramps (100 to +50 mV) evoked before and during agonist application to ass ess the voltage-dependent properties of the agonist-evoked currents. Characte ristic features of GIRK currents include steep inward rectification and K+ selectivity (i.e. a reversal potential near the EK). The analog current signals are low-pass filtered with the amplifier’s integrated 4-pole Bessel filter at a co rner frequency of 50 Hz, and then digitally sampled at 100 Hz. The time constants for GIRK current activation ( tact) and deactivation ( tdeact) are derived by fitting a single exponential funct ion to the rising or decaying portion of the current (Figure 3 .1D/E) using non-linear leastsquares curve-fitting software (Clampfit 8.0). Electrophysiological recordings from CHO-K1 cells Electrophysiological recordings from CHO-K1 cells w ere performed as explained for CG granule neurons. In this case, GFP -positive cells were identified

PAGE 38

27 by epi-fluorescence microscopy using an inverted mi croscope (Nikon Diaphot with CF N Plan Fluor Ph 20X objective) equipped wit h a mercury lamp and GFP filter set (Endow GFP, Chroma Technology Corp.). Ra pid application and washout of different agonist (ACh or 5-HT in high K+ solution) concentrations was performed using the multi-barrel perfusion system ( SF-77B, Warner Instruments) (Doupnik et al., 2004), see Figure 2.1A,B

PAGE 39

28 Figure 2.1. Whole cell patch-clamp recording of receptor activ ated GIRK currents. (A) CHO-K1 cells twenty-four hours after DNA transfection visu alized under phase-contrast (upper panel) and epifluoresce nce (lower panel) microscopy. Cells were transfected with EGFP, GIRK channel subunits (Kir3.1/Kir3.2a) and the muscarinic m2 receptor. (B ) Alignment and movement of perfusion barrels for rapid solution exchange. Uppe r panel shows the three-barrel array positioned with the patch clamped cell (see p atch electrode) being superfused with the high K+ solution (washing solution). Flow through both the middle and right barrels is continuous and gravity driven. Lower panel shows the position of the barrels following computer-controll ed movement (700 m), where the agonist barrel is now aligned with the recorded cell.

PAGE 40

29 Electrophysiological recordings from Xenopus oocytes All procedures for the use and handling of Xenopus laevis (Xenopus One, Ann Arbor, MI) were approved by the University of S outh Florida Institutional Animal Care and Use Committee in accordance with NI H guidelines. Oocytes were injected with a mixture of 5’ capped cRNA’s sy nthesized in vitro from linearized cDNA vectors (mMessage mMachine, Ambion) Experimental groups (~20 oocytes each) were injected with different cRN A mixtures (50 nl final volume) and incubated at 19oC in parallel for 48-60 hrs. All groups received cRNA’s for the human muscarinic m2 receptor (0.5 ng /oocyte), rat Kir3.1 subunit (0.5 ng/oocyte), and mouse Kir3.2a subunit (0.5 ng/ oocyte). Expression of RGS4(C2V)-FLAG and RGS3s-FLAG was varied by including differ ent amounts of cRNA (0, 0.03, 0.1, 0.3, 1.0, 3.0, 10 ng/oocyte). ACh-activated Kir3 channel currents were recorded b y two-electrode voltage clamp methods from a holding potential of 80 mV (GeneClamp 500, Axon Instruments). Oocytes were initially superfuse d with a minimal salt solution (98 mM NaCl, 1 mM MgCl2, and 5 mM HEPES at pH 7.5), then switched to an isotonic high K+ solution (20 mM KCl, 78 mM NaCl, 1 mM MgCl2, and 5 mM HEPES at pH 7.5) to resolve the kinetics of ACh-act ivated inward Kir3 channel currents. Rapid application and washout of ACh in t he high K+ solution was performed using a computer triggered superfusion sy stem (SF-77B, Warner Instruments)(Doupnik et al., 2004). To monitor inw ard rectification of IK,ACh, voltage ramps from –80 to +20 mV and 1 s in duratio n were evoked before and

PAGE 41

30 during agonist application. All recordings were per formed at room temperature (21-23oC). Kinetic analysis of receptor-activated Kir3 channel currents Time-dependent GIRK current kinetics were analyzed using nonlinear curve fitting software that fit single exponential functions to derive activation time constants ( tact) and deactivation time constants ( tdeact) (Clampfit 8.0 software, Axon Instruments). Agonist dose-response relations were analyzed by fitting peak GIRK current amplitudes with the Hill function where the effective concentration producing a 50% response (EC50) and Hill coefficient value (nH) were derived from the best fit (Origin 6.0 software OriginLab Corp.). For comparison of GIRK current amplitudes across cells, agonist-evoked currents from each cell were normalized to the measured cell membrane capacitance (Cm) determined during capacitive current compensation The normalized current amplitudes are expressed as GIRK current density (p A/pF). Statistical Analysis Pairwise statistical analysis between experimental groups was performed by one-way ANOVA (analysis of the variance) test wh ere p<0.05 was considered significant.

PAGE 42

31 CHAPTER 3 PROFILE OF RGS GENE EXPRESSION IN CEREBELLAR GRANULE NEURONS INTRODUCTION G-protein-gated inwardly rectifying potassium (GIRK ) channels are K+ selective ion channels ‘‘opened’’ by a direct inter action with G bg subunits (Logothetis et al., 1987). Physiologically, GIRK ch annels play an instrumental role in suppressing membrane excitability during th e activation of G-proteincoupled receptors (GPCRs) in neurons, cardiomyocyte s, and endocrine cells (Stanfield et al., 2002; Yamada et al., 1998). Func tional GIRK channels in mammals are now known to be heterotetramers compose d of Kir3.1, Kir3.2, Kir3.3, and Kir3.4 subunits (Stanfield et al., 2002 ; Yamada et al., 1998). Neuronal GIRK channels are more diverse than cardiac GIRK ch annels, having an overlapping expression of Kir3.1, Kir3.2, and Kir3. 3 in different regions of the brain. Kir3 subunits 1, 2, and 3 are highly express ed in the cerebellum (Karschin and Karschin, 1997). Furthemore, they are expressed in the distal part of the CG neuron’s dendrites, at the level of the glomeruli w here mossy fibers and

PAGE 43

32 cerebellar granule (CG) cells synapse (Ponce et al. 1996). It is also known that expression of RGS mRNA in brain shows a distinct re gional distribution detected by in situ hybridization (Gold et al., 1997; Grafstein-Dunn e t al., 2001). Neuronal GIRK channels have only recently been stud ied in CG neurons, prompted largely from the discovery of the mouse weaver gene that contains a point mutation in the Kir3.2 subunit that disrupts K+ selectivity causing CG cell death and phenotypic ataxia (Kofuji et al., 1996; P atil et al., 1995; Slesinger et al., 1996; Surmeier et al., 1996). The objective of this work is to discern which RGS genes are expressed in a CG neuron that are lik ely to be involved in the modulation of endogenous CG neuron’s GIRK channels.

PAGE 44

33 RESULTS Measuring native GIRK channel gating properties in CG neurons. Neonatal rat CG neurons exhibited baclofen-evoked G IRK currents that were sustained in primary culture and could be char acterized electrophysiologically (Figure 3.1). GABAB receptor-activated GIRK currents in rat CG neurons displayed rapid activation and deactivat ion kinetics (Figure 3.1F) suggesting modulation by endogenous RGS proteins.

PAGE 45

34 Fig. 3.1. Quantitative analysis of native GIRK currents reco rded from rat cerebellar granule (CG) neurons. (A) Phase-contrast image of a typical rat CG neuron maintained in primary culture and selected f or electrophysiological recordings. (B) GABAB receptor agonist baclofen (100 m M) evoke characteristic GIRK currents from CG neurons. Baclofen-activated G IRK currents display steep inward rectification (C) and rapid activation (D, F ) and deactivation kinetics (E, F). Data are means SEM. Dashed lines in F refer to ti me constants for solution exchange and represent the limit of resolving kinet ic events.

PAGE 46

35

PAGE 47

36 Single Cell RT-PCR analysis of Endogenous RGS Expre ssion To discern which RGS proteins were expressed endoge nously in rat CG neurons, single cell RT-PCR methods were developed for detecting and profiling RGS expression in primary culture neurons. CG neuro ns were abundant and could be distinguished in culture by their relative small size and simple bipolar morphology compared to other cells present in the c ulture dish. Positive Kir3.2 expression in CG neurons confirmed GIRK channel exp ression in these cells. A great diversity of RGS proteins expressed in the gr anule neurons was found. In some cases, RGS expression was very consistent thro ughout the different dissections, RGS proteins like RGS5, RGS11 and RGS9 were never detected in the granule neurons, but others like RGS2, RGS10, R GSz2 and RGS4 were almost always detected. However, the detection leve ls of others like RGS6, RGS7 and RGS8 changed greatly from experiment to ex periment, making it difficult to extrapolate any conclusion (Fig. 3.2). GIRK2a was used as both granule neuron marker and control of the efficacy o f the sampling method (91% efficiency). Results indicated that CG neurons expr essed at least 13 different RGS genes, and each RGS subfamily (R4, R7, R12, and RZ) was represented (Fig 3.3). Although a profile of protein expression was not correlated with mRNA data and relative RGS protein levels were unknown, the single cell RT-PCR results clearly indicate that numerous RGS proteins are likely to be present in these native GIRK-expressing cells.

PAGE 48

37 Figure 3.2. Separation of RT-PCR products by agarose gel elect rophoresis. RTPCR was performed on rat CG neurons as described in the text. Results using selected intron-spanning RGS-selective primer sets (Doupnik et al., 2001), as well as primer sets for GIRK2 (Kir3.2a) are shown. Negative controls included water and external solution (5 m l), and positive controls included postnatal poly(A)+ mRNA of brain (0.5–5.0 ng). The predicted molecular size for each RGS PCR product is indicated on the right of each gel. 1 2 3 4 M.W. Ladder M.W. Ladder H2O Ext. Solutionsingle CG neuronsBrain mRNA RGS3RGS4 RGS17 RGS10 RGS7 RGS2 RGS8RGS20 RGS6 GIRK2a 288bp 347 bp 494bp 192bp 485bp 353 bp 278bp 434bp 350bp 339bpRat CG neurons

PAGE 49

38 Figure 3.3. Profile of RGS expression in rat CG neurons. The pe rcentage of cells sampled and positive for RGS expression by RT-PCR a nalysis is shown for each RGS within the R4, R7, R12, and RZ subfamilies exam ined. The number of cells tested for each RGS ranges from 8 to 24 and is from at least two separate cultures.

PAGE 50

39 DISCUSSION My results were in agreement with published results obtained by in situ hybridization indicating multiple RGS’s are express ed in brain (Gold et al., 1997; Grafstein-Dunn et al., 2001). However, my data were obtained from a singular type of cell compared to the in situ experiments where the data were obtained from a wide variety of tissue. I also compared the CG results with the RGS gene pr ofile performed in rat atrial myocytes (Doupnik et al., 2001). Both native cell systems expressed RGS genes from each RGS subfamily (R4, R7, R12, and RZ) Intestingly, the profile of RGS expression in cardiac myocytes and CG neurons h ad some differences: there was more expression of RGS genes in CG neuron s, at least 13 compared to 7 in myocytes. Also, the percentage of some RGS expression differed between the two cell types, for example RGS6 had an expresson of ~95% in atrial myocytes in contrast to the ~ 30% in CG neur ons. This higher expression of RGS genes in CG neurons compared to atrial myocytes also correlated with the tdeact of native GIRK channels recorded from both cell ty pes, being faster in the CG neurons (Doupnik et al., 2004).

PAGE 51

40 My data indicate that CG neurons in culture conditi ons express endogenous and functional GIRK channels and that th e fast tdeact observed is likely due to the high expression of endogenous RGS My original goal of discerning the unique/s RGS pro teins involved in the modulation of the GIRK channels clearly was not fea sible due to the great variety of RGS proteins present in the CG neurons. For this reason, I decided to focus my studies on two RGS proteins. I chose RGS3s and R GS4 which were expressed in CG neurons and atrial myocytes, and pe rformed the rest of the experiments in an heterologous system where I could have better control of the components of the signaling pathway.

PAGE 52

41 CHAPTER 4 NEURONAL KIR3.1/KIR3.2A CHANNELS COUPLED TO SEROTON IN 1A AND MUSCARINIC M2 RECEPTORS ARE DIFFERENTIALLY MODU LATED BY THE ‘SHORT’ RGS3S ISOFORM INTRODUCTION G bg -gated inwardly rectifying K+ channels (GIRKs) are expressed predominantly in brain, heart, and endocrine tissue and suppress cell excitability during neurotransmitter and hormone activation of p ertussis toxin (PTX)-sensitive G protein-coupled receptors (GPCRs) (Stanfield et a l., 2002). Consistent with this, gene knockout of neuronal GIRK channel subuni ts promote spontaneous and pharmacologically induced seizures and hyperact ivity in mice (Blednov et al., 2001; Signorini et al., 1997).The recent discovery of neuronal GIRK channel involvement in drug-induced analgesia further highl ight the physiological role of GPCR-activated GIRK channels and their modulators i n the nervous system (Blednov et al., 2003). The temporal gating properties of receptor-activate d GIRK currents are determined by the kinetic properties of the G prote in cycle and dramatically

PAGE 53

42 accelerated by ‘regulators of G protein signaling’ (RGSs) (Breitwieser and Szabo, 1988; Doupnik et al., 1997; Saitoh et al., 1997). R GS proteins speed up passage through the G-protein cycle by increasing the intri nsic GTPase activity of G a subunits, thereby accelerating the reassociation of the ‘inactive ’heterotrimeric G a(GDP)bg complex (Ross and Wilkie, 2000). RGS proteins are characterized by a highly conserved ‘RGS domain ’of ~ 125 a.a. that co nfers direct binding to G a subunits and is flanked by less conserved Nand Cterminal domains of variable length (Tesmer et al., 1997). More than 20 mammalian RGS genes have been identified to date and are classified into six subfamilies based on sequence homology within the RGS domain (Hollinger and Heple r, 2002; Ross and Wilkie, 2000). The divergent amino terminal region of the R4 subfa mily of RGS proteins has been implicated in (1) mediating RGS selective coupling to GPCRs (Zeng et al., 1998), (2) facilitating functional a2 adrenergic receptor-GIRK channel coupling in rat sympathetic neurons (Jeong and Iked a, 2001), and (3) promoting translocation of GPCR-RGS complexes to the plasma m embrane (Roy et al., 2003; Saitoh et al., 2002). Thus the divergent RGS amino terminus may provide a means to confer selective RGS coupling to differe nt GPCR-effector signaling complexes (Hollinger and Hepler, 2002). I report here the functional properties of an alter natively spliced ‘short isoform’ of mouse RGS3 (RGS3s) (Reif and Cyster, 20 00) on neuronal GIRK channels (Kir3.1/Kir3.2a) coupled to either seroton in 1A (5-HT1A ) receptors or

PAGE 54

43 muscarinic m2 receptors in Chinese hamster ovary ce lls (CHO-K1). Mammalian RGS3 isoforms are expressed in both brain and heart (Druey et al., 1996; Koelle and Horvitz, 1996), and alternatively spliced RGS3 transcripts generate at least four different protein isoforms having different am ino terminal domains that share a common RGS domain (Kehrl et al., 2002). The uniqu e amino terminal region of mouse RGS3s is 21 amino acids long and comparable i n size to the 33 amino acid N-terminus of RGS4. Yet RGS3s lacks the two Cy steines (C2 and C12) that are conserved in some members of the R4 subfamily i ncluding RGS4 and are susceptible to plamitoylation (Druey et al., 1999; Hiol et al., 2003; Srinivasa et al., 1998). I therefore questioned whether the variant R GS3s isoform differentially affects GIRK channel gating properties compared to RGS4 (Doupnik et al., 1997). My findings demonstrate RGS3s differentially modulates GPCR-GIRK channel complexes and suggest that different RGS Ntermini may influence the agonist sensitivity and magnitude of GIRK channel a ctivation in a GPCRdependent manner.

PAGE 55

44 RESULTS Properties of 5-HT1A and m2 receptor coupled GIRK currents reconstitute d in CHO-K1 cells Co-expression of neuronal Kir3.1/Kir3.2a channels i n CHO-K1 cells with either the 5-HT1A receptor or the muscarinic m2 receptor produced ag onistevoked currents that were dose-dependent and displa yed strong inward rectification ( Fig. 4.1 ). To resolve the temporal and steady-state kinetic features of the receptor-activated GIRK currents, 5-HT and A Ch were rapidly applied and washed out using concentrations ranging from 10-9 to 10-4 M. The reversal potentials for the 5-HT and ACh-evoked currents wer e both near the experimentally preset K+ equilibrium potential (-40 mV) consistent with K+selective GIRK channels ( Fig. 4.1 B). Both the 5-HT-activated GIRK currents (IK,5HT) and Ach-activated GIRK currents (IK,ACh) displayed a similar activation and deactivation time course following agonist washout ( Fig. 4.1 A). Notably, however, the steady-state dose-dependence of 5-HT versus Ach -activated GIRK currents indicated a significantly higher potency for 5-HT v ersus ACh ( Fig. 4.1 C). The EC50 value for 5-HT was 248 nM (n=5) compared to the A ch EC50 value of 820162 nM (n=10). This difference in EC50 values indicate either a higher

PAGE 56

45 number of 5-HT1A receptors being expressed compared to m2 receptors and/or a greater efficacy in 5-HT1A receptor versus m2 receptor signaling. The maximal GIRK current density at saturating concentrations o f receptor agonist (10 m M) was comparable indicating equivalent Kir3.1/Kir3.2a channel expression with the two GPCRs; maximal IK,5-HT 90.815.4 pA/pF (n=8), maximal IK,ACh 79.28.2 pA/pF (n=11). Other than differences in agonist dos e-dependence, the temporal kinetic features of IK,5-HT and IK,ACh were indistinguishable.

PAGE 57

46 Figure 4.1. Functional coupling of 5-HT1A receptors and muscarinic m2 receptors to Kir3.1/Kir3.2a channels expressed in CHO-K1 cell s. (A) Representative wholecell recordings from two separate cells expressing human 5-HT1A receptors (upper trace) or human muscarinic m2 receptors (low er trace). Cells were voltage clamped at -100 mV during a 15 s rapid application and washout of receptor agonist (10 m M 5-HT or ACh) indicated by the horizontal bars. Vo ltage ramps from -100 to +50 mV were evoked before and during a gonist application to assess the voltage dependence of the agonist-evoked currents. (B) Inward rectification of 5-HT (open circles) and ACh-evoked GIRK currents (filled circles). Ramp currents preceding agonist application were di gitally subtracted from ramp currents evoked during agonist application as shown in (A). Both IK,5-HT and IK,ACh displayed strong inward rectification and reversal potentials near the predicted Nernst potential for potassium (-40 mV). (C) Dose-r esponse relations for 5-HT (open circles) and ACh-activated GIRK currents (fil led circles). Receptoractivated GIRK currents from varying agonist concen trations applied to the same cell were normalized to the maximal amplitude recor ded from each individual cell. Data are the meanSE from GFP-positive CHO-K1 cells co-transfected with cDNA vectors encoding rat Kir3.1, mouse Kir3.2a, an d either the human 5-HT1A receptor or the human muscarinic m2 receptor, with GFP included as a reporter. The solid curves represent Hill functions fit to th e mean data points.

PAGE 58

47 A. B. C. -100-80-60-40-20204060 -1.02000.5 IK,ACh IGIRK(nA) Vm(mV)-0.5-1.5IK,5HT [Agonist] (log M) -9 -8 -7 -6 -5 -4 0.0 0.5 1.0 Normalized IGIRKIK,AChIK,5HT 200 pA 5 s ACh10 m M 200 pA 200 pA 200 pA 5 s 5-HT 10 m M

PAGE 59

48 Effects of PTX pretreatment on 5-HT1A and m2 receptor coupled GIRK currents Both 5-HT1A receptors and m2 receptors are capable of coupling to all PTX-sensitive G a i/o subunits, and coupling in CHO-K1 cells is repor tedly limited to endogenous expression of G a i2 and G a i3 subunits where G a i2 protein levels predominate (G a i2>>G a i3 by 8:1) (Dell'Acqua et al., 1993; Raymond et al. 1993). Pretreatment of cells with PTX (100 ng/ml) c ompletely abolished the AChevoked GIRK currents (n=5) and significantly reduce d the 5-HT-evoked GIRK currents ~80% (PTX-treated 205 pA/pF, n=3; non-tre ated 9414 pA/pF, n=8). Thus endogenous PTX-sensitive G a i subunits mediate the coupling of m2 receptors and 5-HT1A receptors to GIRK channels in CHO-K1 cells, althou gh the residual 5-HT-evoked GIRK current following PTX pre treatment may reflect a small degree of ‘promiscuous’ 5-HT1A receptor coupling to PTX insensitive G proteins. Comparison of RGS3s and RGS4 effects on muscarinic m2 receptorcoupled GIRK currents I next compared the modulatory effects of RGS3s and RGS4 on m2 receptor activated Kir3.1/3.2a channels in relation to cells that were not transfected with exogenous RGS (control). Shown in Fig. 4.2 the activation and deactivation kinetics of ACh-evoked GIRK currents w ere accelerated by either RGS3s or RGS4 expression compared to the control ce lls. Kinetic analysis

PAGE 60

49 indicated RGS3s accelerated the GIRK deactivation t ime course somewhat greater than RGS4 (RGS3s tdeact=0.750.04 s, n=8; RGS4 tdeact=1.32G0.11 s, n=5), although the effects of RGS3s on the GIRK act ivation kinetics were equivalent to RGS4 ( Fig. 4.2 C). The most striking difference between RGS3s and RGS4 was a significant reduction of GIRK curren t amplitude (~45% decrease at 100 m M) and a 6-fold shift in the ACh dose-response curv e associated with RGS3s expression ( Fig. 3.2 D,E). With RGS3s, the Ach EC50 was 5.10.6 m M (n=8) compared to 0.90.2 m M (n=10) for control cells. By comparison, RGS4 did not significantly affect the m aximal GIRK current density as observed previously in Xenopus oocytes (Doupnik et al., 1997), and caused a smaller shift in the ACh EC50 value (2.00.5 m M, n=6) from the control group ( Fig. 4.2 D,E). Since the ACh dose-response curve with RGS3s expression did not demonstrate saturation ( Fig. 4.2 D), GIRK current responses to 100 m M, 1 mM, and 10 mM ACh were also compared in a separate set of cells (n=9). These experiments confirmed that 100 m M Ach was indeed a saturating concentration, as maximal GIRK responses to 1 mM (952%) and 10 mM Ach (952%) were not significantly different than 100 m M ACh (932%). Altogether these findings indicate RGS3s and RGS4 both accelerate GIRK channe l gating kinetics, but differentially affect steady-state m2 receptor-GIRK channel coupling properties.

PAGE 61

50 Figure 4.2. Comparative effects of RGS3s versus RGS4 on muscari nic m2 receptor-coupled Kir3.1/Kir3.2a channels expressed in CHO-K1 cells. (A) Representative ACh-activated GIRK currents elicited from three separate expression conditions; either without exogenous RGS expression (control traces), with exogenous RGS4 expression (RGS4 trace s), or with exogenous RGS3s expression (RGS3s traces). GIRK currents evok ed by a range of ACh concentrations for each cell are superimposed for c omparison after baseline adjustment of the holding current immediately prece ding each Ach application. ACh applications were 15 s in duration and separate d by a ~1 min washout period. (B) Deactivation kinetics of RGS-accelerate d GIRK currents. Upper panel: deactivation time constants ( tdeact) derived from control (filled bar), RGS3s (grey bar), and RGS4 (open bar) groups following 10 m M ACh-evoked GIRK currents. Lower panel: comparison of tdeact values following three different ACh concentrations with either RGS3s (grey bars) or RGS 4 (open bars) expression. Data are the meanSE where indicates P<0.05. (C) Activation kinetics of RGSaccelerated GIRK currents. Comparison of activation time constants ( tact) derived from control (filled bar), RGS3s (grey bar), and RG S4 (open bar) groups with increasing ACh concentrations. (D) ACh dose-respons e relations for control (filled squares), RGS3s (grey triangles), and RGS4 (open circles) groups. GIRK currents were normalized to cell membrane capacitan ce and expressed as a current density (pA/pF) for group comparisons. (E) Normalized ACh doseresponse curves from data presented in (D). GIRK cu rrent amplitudes were normalized to the maximal amplitude recorded from e ach cell (100 m M ACh) and fit with a Hill function to derive EC50 values and Hill coefficients.

PAGE 62

51

PAGE 63

52 Comparison of RGS3s and RGS4 effects on serotonin 1 A receptor-coupled GIRK currents I next examined the effects of RGS3s and RGS4 on 5HT1A-coupled GIRK currents to determine whether the different effects of RGS3s and RGS4 observed with m2 receptor coupling were similarly c onferred with 5-HT1A receptors. Shown in Fig. 4.3 co-expression of either RGS3s or RGS4 significantly accelerated the activation and deacti vation time course of 5-HTactivated GIRK currents. Kinetic analysis of both t he GIRK activation and deactivation time course indicated the accelerating effects of RGS3s and RGS4 were not significantly different from each other ( Fig. 4.3 B,C). Interestingly, neither RGS3s nor RGS4 affected the maximal GIRK current de nsity although both appeared to have subtle effects that were not stati stically significant ( Fig. 4.3 D). Similar to m2 receptor coupling, RGS3s significantl y shifted the 5-HT doseresponse curve yet RGS4 did not. For RGS3s, the 5-H T EC50 was 12836 nM (n=5) compared to 309 nM (n=4) for the control cel ls and 486 nM (n=9) with RGS4 expression. Thus RGS3s, in contrast to RGS4, d isplays GPCR dependence in that it dramatically reduces steady-s tate m2 receptor-activated GIRK currents but not 5-HT1A receptor-coupled currents.

PAGE 64

53 Figure 4.3. Comparative effects of RGS3s versus RGS4 on seroto nin 1A (5HT1A) receptor-coupled Kir3.1/Kir3.2a channels expresse d in CHO-K1 cells. (A) Representative 5-HT-activated GIRK currents elicite d from three separate cell conditions, either without exogenous RGS expression (control traces), with exogenous RGS4 expression (RGS4 traces), or with ex ogenous RGS3s expression (RGS3s traces). GIRK currents evoked by a range of 5-HT concentrations for each cell were superimposed for comparison after baseline adjustment of the holding current immediately prece ding each agonist application. 5-HT applications were 15 s in duratio n and separated by a ~1 min washout period. (B) Deactivation kinetics of RGS-ac celerated GIRK currents. Upper panel: deactivation time constants ( tdeact) derived from control (filled bar), RGS3s (grey bar), and RGS4 (open bar) groups follow ing 10 m M 5-HT-evoked GIRK currents. Lower panel: comparison of tdeact values following three different 5-HT concentrations with either RGS3s (grey bars) o r RGS4 (open bars) expression. Data are the meanSE where indicates P<0.05. (C) Activation kinetics of RGS-accelerated GIRK currents. Comparis on of activation time constants ( tact) derived from control (filled bar), RGS3s (grey ba r), and RGS4 (open bar) groups with increasing 5-HT concentratio ns. (D) 5-HT dose-response relations for control (filled squares), RGS3s (grey triangles), and RGS4 (open circles) groups. GIRK currents were normalized to c ell membrane capacitance and expressed as a current density (pA/pF) for grou p comparisons. (E) Normalized 5-HT dose-response curves from data pres ented in (D). GIRK current amplitudes were normalized to the maximal a mplitude recorded from each cell (10 m M 5-HT) and fit with a Hill function to derive EC50 values and Hill coefficients.

PAGE 65

54

PAGE 66

55 Effects of RGS3s and RGS4 on basal GIRK channel act ivity I also analyzed the effects of RGS3s and RGS4 on re ceptor-independent basal GIRK current amplitudes as reflected in the h olding currents in 25 mM K+ solution. Previous reports indicate RGS3 (original 519 a.a. isoform) and RGS4 cause a significant increase in basal GIRK current activity when expressed in either CHO or HEK293 cells by apparently increasing the availability of free G bg subunits via RGS sequestration of G a subunits (Bunemann and Hosey, 1998). This finding is in contrast to observations in the oocyte expression system, where RGS3 and RGS4 reduce IK,basal amplitudes by apparently shifting the equilibrium of G a subunits towards their GDP-bound state due to RGSenhanced GTP hydrolysis and effectively sequestering free G bg dimers that cause basal GIRK channel activity (Doupnik et al., 1997). In the CHO -K1 experiments reported here, expression of Kir3.1/Kir3.2a channels signifi cantly increased the IK,basal amplitude compared to nontransfected CHO-K1 cells ( Table 4.1 ), thus demonstrating a significant level of receptor-indep endent ‘basal’ GIRK channel activity in the absence of exogenous RGS expression Comparison of IK,basal amplitudes from the control groups (RGS-) with co-e xpression of either RGS3s or RGS4 did not reveal a significant difference with e ither m2 receptor or 5-HT1A receptor expression ( Table 4.1 ). Thus the effects reported by (Bunemann and Hosey, 1998) may result from significantly higher RGS protein le vels produced with their transfection methods, since expression c onditions that elevate RGS4

PAGE 67

56 levels in oocytes has also been reported to increas e basal GIRK channel activity (Keren-Raifman et al., 2001) Table 4.1 Effects of RGS3s and RGS4 on basal GIRK channel act ivity in CHOK1 cells Ik,basal (pA/pF)1 Control PTX-treated + RGS3s + RGS4 Non-transfected CHO-K1 cells -10 4 (n=6) Muscarinic m2 receptor + Kir3.1/Kir3.2a -130 17 (n=10) -91 16 (n=5) -162 26 (n=8) -135 23 (n=6) Serotonin 1A receptor + Kir3.1/Kir3.2a -84 23 (n=11) -106 21 (n=3) -120 31 (n=5) -89 10 (n=11) 1 Data are resting membrane currents in 25 mM K+ at a holding potential of -100mV divided by the cell membrane capacitance

PAGE 68

57 Effects of RGS3s and RGS4 on acute desensitization of GIRK currents In the absence of RGS co-expression, GIRK currents modestly desensitize during the short 15 s agonist applicati on period (<10% of their amplitude). Co-expression of RGS4 causes a signific ant increase in the rate of ‘acute’ desensitization which is attributable to th e accelerated rate of signal termination during sustained receptor activation (C huang et al., 1998; Doupnik et al., 1997). Shown in Fig. 4.4 comparisons of the extent of acute desensitizatio n with RGS3s versus RGS4 expression during the 15 s a gonist application period indicate equivalent effects on both IK,5-HT and IK,ACh. These findings are consistent with the rate of acute GIRK current desensitization being closely correlated with G a GTPase activity and best reflected in the GIRK dea ctivation rates (Chuang et al., 1998; Leaney et al., 2004). As shown earlier f or RGS3s and RGS4 ( Figs. 4.2 and 4.3 ), both RGS proteins accelerate GIRK deactivation r ates to a similar degree.

PAGE 69

58 Figure 4.4. Acute GIRK current desensitization associated with different GPCRRGS coupling conditions. (A) Comparative effects of RGS3s (red trace) and RGS4 (blue trace) on acute desensitization of 5-HT1A receptor-activated GIRK currents without exogenous RGS expression (control, black trace). Peak amplitudes of the superimposed recordings were norm alized for kinetic comparisons. Right panel: the percent desensitizati on was quantified by measuring the percent decline in the peak GIRK curr ent amplitude measured at the end of the 15 s application period, as denoted by the application ‘‘window’’ (dotted box in left panel). Data are the meanSE wh ere indicates a P<0.05 for comparisons between the control and RGS groups. (B) Comparative effects of RGS3s (red trace) and RGS4 (blue trace) on acute de sensitization of muscarinic m2 receptor-activated GIRK currents without exogeno us RGS expression (control, black trace). Right panel: quantification of acute GIRK desensitization was determined as described in (A).

PAGE 70

59 A. B.(11) (5) (9)* 0 5 10 15 20 25 30 ControlRGS3sRGS4GIRK Desensitization (%)(12) (8) (6)* 0 5 10 15 20 25 30 ControlRGS3sRGS4GIRK Desensitization (%)5 s ACh(10 m M) 5 s 5-HT (10 m M)

PAGE 71

60 DISCUSSION The goal of this study was to evaluate the modulato ry effects of a recently identified ‘short’ RGS3 isoform on neuronal GIRK ch annels activated by different GPCRs in a mammalian cell expression system (CHO-K1 cells). The RGS3s mRNA transcript is abundant in mouse brain and hear t (Reif and Cyster, 2000) and therefore may modulate GPCR regulation of neuro nal and cardiac cell excitability. The effects of RGS3s were assessed in comparison to the closely related and previously studied RGS4 protein (Doupni k et al., 1997; Zhang et al., 2002) that is co-expressed with RGS3 in individual neurons and atrial cardiomyocytes (Doupnik et al., 2004; Doupnik et al ., 2001). The major finding of my experiments is that RGS3s modulates GIRK channel s in a GPCR-dependent manner, whereas RGS4 modulated GIRK channels simila rly for both of the GPCRs studied. RGS3s significantly reduced GIRK cur rent amplitudes with m2 receptor coupling and shifted the steady-state agon ist dose-response relations, whereas RGS4 affected m2 receptor-activated GIRK cu rrents similar to that observed with 5-HT1A receptors. These results may indicate RGS3s has di stinct interactions with muscarinic m2 versus 5-HT1A receptor complexes, whereas RGS4 interacts similarly with both GPCR-GIRK channe l complexes. There are several possible RGS-affected cellular processes th at may contribute toward the modulatory differences that we have identified and are briefly discussed below.

PAGE 72

61 GTPase accelerating activity of RGS proteins The GTPase accelerating activity of RGS proteins is mediated by direct interactions between the RGS domain and the G a subunit (Ross and Wilkie, 2000), and differences in RGS modulation of GIRK ch annels can reflect differences in RGS-G a subunit selectivity (Doupnik et al., 1997; Zhang e t al., 2002). Although RGS3 and RGS4 both interact with G a i/o and G a q/11 subunits, RGS3 displays a higher affinity for G a 11 versus G a i3 (Dulin et al., 1999; Neill et al., 1997) and RGS4 shows preferential interactions with G a i/o subunits versus G a q (Berman et al., 1996a). So for the G a i-coupled receptors examined in my CHO-K1 experiments, these preferred RGS-G a associations would generally favor greater accelerated GIRK deactivation rates w ith RGS4 compared to RGS3s. Yet to the contrary, these kinetic differenc es were not observed and in fact RGS3s accelerated the GIRK deactivation rate s omewhat greater than RGS4. Thus differences in RGS3s versus RGS4 affinit y for G a i subunits are not apparent in the accelerated GIRK channel gating pro perties that reflect RGSenhanced GTPase accelerating activity and seem unli kely to explain my findings. RGS membrane association

PAGE 73

62 Several members of the R4 subfamily, including RGS4 enhance membrane binding through a mechanism requiring thei r short N-terminal domain. These RGS proteins (RGS2, RGS4, RGS5, RGS8, RGS16, RGS18) possess Nterminal palmitoylated cysteine residues and a cons erved basic amphipathic a helix that confers membrane association and orienta tion that enhances their GTPase activating activity (Bernstein et al., 2000; Chen et al., 1999; Heximer et al., 2001; Saitoh et al., 2001; Tu et al., 2001). T he RGS4 N-terminus also contains a ubiquitin degradation signal (Davydov an d Varshavsky, 2000). Yet for both RGS4 and RGS8, deleting the N-terminal domain does not significantly affect RGS-accelerated activation and deactivation kinetics for GPCR-activated GIRK channels expressed in Xenopus oocytes, indicat ing RGS domain-G a interactions are sufficient for these kinetic effec ts (Inanobe et al., 2001; Saitoh et al., 2001). However, deleting the RGS8 N-terminus d oes reduce acute desensitization during dopamine D2 receptor GIRK ch annel activation (Saitoh et al., 2001) which is attributable to RGS-enhanced GT Pase activity (Chuang et al., 1998). Remarkably, a ‘short’ RGS8 splice variant (R GS8s) differing only by the first 7-9 N-terminal residues shows diminished effe cts on GIRK activation and deactivation kinetics and altered selectivity for G q-coupled receptor signaling (Saitoh et al., 2002). Furthermore, overexpression of the RGS8 N-terminal domain (1-5 a.a.) in rat sympathetic neurons dramat ically accelerates a 2adrenergic receptor activation of heterologously ex pressed GIRK channels, supporting an important role of the RGS8 N-terminus in facilitating receptor-GIRK

PAGE 74

63 channel coupling (Jeong and Ikeda, 2001). In my com parison of RGS3s and RGS4 on GIRK kinetics reported here, despite their divergent N-terminal sequences, both displayed similar accelerating effe cts on GIRK activation and deactivation kinetics and equivalent effects on acu te desensitization of receptoractivated GIRK currents. Therefore, apparently, dif ferences in RGS3s and RGS4 N-terminal domains do not confer obvious kinetic di fferences in receptordependent GIRK channel gating, despite their differ ential effects on receptordependent steady-state gating properties. RGS-mediated translocation of GPCRs RGS4 is predominantly a cytosolic protein recruited to membranes by interactions with G protein subunits (Druey et al., 1998). RGS-specific translocation from the cytosol to the plasma membra ne involves direct interactions with the GPCR complex and is determine d in part by the relative affinity of the RGS-G a subunit interaction (Masuho et al., 2004; Roy et a l., 2003). It remains unclear whether cytosolic RGS proteins c an incorporate into mature GPCR-GIRK channel complexes already located at the plasma membrane, or whether they co-assemble within the GPCR-GIRK chann el complexes synthesized and assembled within the endoplasmic re ticulum and Golgi apparatus (Lavine et al., 2002). Current evidence, however, clearly indicate RGS4 facilitates trafficking and recruitment of G p roteins (Chuang et al., 1998) and m2 receptore G a i2 complexes (Roy et al., 2003) from intracellular pools to

PAGE 75

64 the plasma membrane, and thereby increases the dens ity of functional receptors at the plasma membrane. For RGS8, deletion of the N -terminal domain ( D NRGS8) prevents G protein-induced subcellular transl ocation of D N-RGS8 to the plasma membrane (Saitoh et al., 2001). Similarly, t ranslocation of the original RGS3 isoform from the cytosol to the plasma membran e also occurs but in an agonistand Ca2+-dependent manner (Dulin et al., 1999). The Ca2+dependent translocation of RGS3 was recently shown to be medi ated by Ca2+ binding to an EF-hand motif located in the N-terminus of RGS3, wh ich is not present in the shorter N-terminus of RGS3s (Tosetti et al., 2003). Together, these findings suggest RGS4 may translocate m2 receptor/G a i complexes to the plasma membrane more effectively than RGS3s, due either to a lower RGS3s-G a i affinity and/or a reduced efficacy of the RGS3s N-t erminal domain in the translocation process. The consequence in either ca se would be a lower cell surface concentration of receptors with RGS3s expre ssion, which is consistent with the reduced GIRK current responses and rightwa rd shift in the ACh dose response curve observed with RGS3s expression. What is puzzling with this working hypothesis is why the RGS3s effect on stead y-state receptor-dependent GIRK activation properties are more prominent for m 2 receptors and less so for 5-HT1A receptor complexes. Direct RGS-GPCR interactions

PAGE 76

65 Similar to my observations reported here, different R4 RGS proteins exhibit GPCR-selective modulation of Gq/11-coupled (Wang et al., 2002; Xu et al., 1999) and other Gi/o-coupled signaling pathway s (Ghavami et al., 2004). Moreover, the N-terminal domains of RGS3, RGS4, and RGS8 have been shown to affect the selective regulation among Gq/11-coup led receptors (Chatterjee et al., 1997; Saitoh et al., 2002; Zeng et al., 1998). Recently, the N-terminus of RGS2 was shown to have direct and selective interac tions with the 3rd intracellular (i3) loop of Gq/11-coupled muscarinic receptors in vitro (Bernstein et al., 2004). Full-length RGS4 also interacts with th e i3 loop of Gq/11-coupled muscarinic m1 and m5 receptors, but similar to RGS2 does not interact with the i3 loops of Gi/o-coupled m2 or m4 receptors (Bernst ein et al., 2004). Thus direct interaction of RGS4 with the m2 receptor remains to be resolved, yet apparently does not involve interactions with the i3 loop. Giv en the divergent nature of the RGS3s N-terminal domain compared to RGS4, different ial interactions of the RGS3s N-terminus with GPCRs seems plausible and cou ld thereby affect the efficacy of receptor translocation to the plasma me mbrane and/or G protein activation in a GPCR-selective manner. The intrinsi c G protein coupling properties of different GPCRs may also impact RGS i nteractions within the signaling complex. In the absence of overexpressed RGS proteins in CHO-K1 cells, GIRK channels activated by m2 receptors and 5-HT1A receptors displayed significantly different agonist potencies with 5-HT being ~30-fold more potent than Ach (cf. Fig. 3.1 ). Differences in receptor expression, cell surface density,

PAGE 77

66 and receptor translocation (i.e. 5-HT1A>m2 receptors) are all possible contributors to this observed difference as discuss ed above. The 5-HT1A receptor-coupled GIRK channels also displayed a PTX -insensitive component that may reflect promiscuous G protein coupling or coupling of residual G a i subunits (not ADP-ribosylated) due to a higher coup ling affinity. Reconstitution experiments comparing GPCR-G a i binding affinities recently found agonistbound 5-HT1A receptors to have a 12-fold higher affinity for G a i1(GDP) bg compared to agonist-bound m2 receptors (Slessareva et al., 2003), indicating agonist-activated 5-HT1A receptors have an intrinsically higher efficacy fo r G a i(GDP) bg coupling compared to muscarinic m2 receptors. GPCR differences in intrinsic G protein coupling (i.e. precoupling) and the influence of associated RGS proteins are important considerations for futur e mechanistic investigations (Shea and Linderman, 1997). From our results descri bed here, RGS3s and RGS4 could produce equivalent modulatory effects on 5-HT1A receptor-coupled GIRK channels due to a higher degree of G protein p recoupling compared to m2 receptors (Zhang et al., 2002). In summary, I compared the functional properties of the RGS3s isoform and RGS4 due to their expression in brain and heart (Kehrl et al., 2002; Reif and Cyster, 2000) and in native GIRK-expressing neurons and atrial myocytes (Doupnik et al., 2004; Doupnik et al., 2001). The G PCR dependent effects of RGS3s observed on neuronal GIRK channel function ra ise new questions regarding RGS-dependent modulation of GPCR-GIRK cha nnel complexes.

PAGE 78

67 To test if there is a selective interection among R GS-GIRK-GPCR complexes I next generated several RGS chimeras and deletion constructs, epitope tagged them, and by co-immunoprecipitation detected the possible interactions.

PAGE 79

68 CHAPTER 5 RGS4 DIRECTLY ASSOCIATES WITH MULTIPLE GPCR-KIR3 CHANNEL SIGNALING COMPLEXES INTRODUCTION RGS4, a member of the “R egulators of G protein S ignaling” gene family (Hollinger and Hepler, 2002; Ross and Wilkie, 2000) is abundantly expressed in the mammalian brain and peripheral nervous system ( Druey et al., 1996; Gold et al., 1997; Koelle and Horvitz, 1996). Functionally, RGS4 augments the GTPase activity of Gi/o and Gq/11 proteins and accelerates the termination of G proteincoupled receptor (GPCR) signaling (Berman et al., 1 996b; Hepler et al., 1997; Mukhopadhyay and Ross, 1999; Watson et al., 1996). Genetic linkage and association analysis has identified the human RGS4 gene as a major susceptibility locus (chromosome 1q21-q22) for schi zophrenia (Brzustowicz et al., 2000; Chowdari et al., 2002), where gene profi ling studies have shown RGS4 expression to be the most significantly reduced gen e in the prefrontal cortex of schizophrenic subjects (Mirnics et al., 2001). Thes e findings, together with the potential role of RGS4 in regulating several neurot ransmitter systems known to

PAGE 80

69 affect symptoms of schizophrenia (hallucinations, d elusions, and depression), implicate RGS4 in the etiology of schizophrenia (Ha rrison and Weinberger, 2005). Decreased RGS4 levels are also reported to c orrelate with the reduced cholinergic signaling found in Alzheimer’s disease (Muma et al., 2003). Aside from its potential role in neurological disea se and disorders, RGS4 is a highly regulated modulator that provides adapt ive capabilities during various levels of cell signaling (Chidiac and Roy, 2003). A t the transcriptional level, brain RGS4 mRNA levels are dynamically regulated by neuro transmitter activation of different GPCRs (Geurts et al., 2002; Geurts et al. 2003; Taymans et al., 2003), several drugs of abuse (cocaine, morphine, and amph etamines) (Bishop et al., 2002; Garnier et al., 2003; Gold et al., 2003), str ess and glucocorticoids (Ni et al., 1999), and electroconvulsive seizures (Gold et al., 2002). At the posttranslational level, RGS4 protein is rapidly degrad ed via the ubiquitin-dependent N-end rule pathway, a process initiated by arginyla tion of Cys2 by arginyltransferases (Davydov and Varshavsky, 2000; Lee et al., 2005) and tightly coupled to the oxidative environment (Hu et al., 20 05). Together these findings illustrate the multiple layers of regulation that d etermine the RGS4 protein concentration level that modulates Gi/o and Gq/11 s ignaling in the brain. One of the key effectors for Gi/o and Gq/11–coupled receptors that modulates neuronal excitability is the G protein-ga ted inwardly rectifying K+ (Kir3/GIRK) channel (Stanfield et al., 2002; Yamada et al., 1998). Kir3 channels in hippocampal neurons are localized to dendrites, dendritic spines, and the cell

PAGE 81

70 soma (Drake et al., 1997) and thus well positioned for suppressing excitation following activation by pertussis toxin (PTX)-sensi tive Gi/o-coupled receptors as evidenced in seizure-prone Kir3.2 knockout mice (Lu scher et al., 1997; Signorini et al., 1997). In contrast to activation by Gi/o–co upled receptors, Kir3 channels are inhibited by PTX-insensitive Gq/11-coupled rece ptor signaling causing enhanced neuronal excitability (Nakajima et al., 19 88). Kir3 channels can form stable macromolecular signaling complexes containin g Gi/o– or Gs-coupled receptors (Lavine et al., 2002), heterotrimeric G p roteins (Clancy et al., 2005; Huang et al., 1995; Ivanina et al., 2004; Krapivins ky et al., 1995b), and multiple kinases and phosphatases (Nikolov and Ivanova-Nikol ova, 2004). Since RGS4 significantly accelerates both the activation and d eactivation time course for Gi/ocoupled receptor-activated Kir3 channel currents wi thout compromising current amplitude (Doupnik et al., 1997), it has been quest ioned whether RGS4 directly binds to GPCR-Kir3 channel complexes as a means of efficacious modulation and targeting specificity (Zhang et al., 2002). It is shown here that RGS4 directly interacts with several GPCR-Kir3 channel complexes comprised of either Gi/o or Gq/11-coupled receptors expressed in CHO-K1 cells. RGS4 coupling is mediated through interactions with the GPCR versus the Kir3 channel, and displays specificity since a closely related RGS homolog (RG S3s) (Jaen and Doupnik, 2005; Reif and Cyster, 2000) does not interact with any of the GPCR-Kir3 channel complexes tested.

PAGE 82

71 RESULTS RGS4 and RGS3s protein expression in CHO-K1 cells. To determine whether RGS4 or RGS3s directly associa te with GPCR-Kir3 channel complexes I co-expressed N-terminal HA-tagg ed m2 receptors, Cterminal MYC-tagged Kir3.1/Kir3.2a channels, with a nd without C-terminal FLAGtagged RGS3s or RGS4, in CHO-K1 cells. The HA-m2 re ceptor or the Kir3.1MYC subunit was then immunoprecipitated and probed for co-precipitating proteins by western blot analysis. Initial western blot analysis of cell lysates reaffirmed previous findings (Krumins et al., 2004) indicating RGS4 protein levels are low and often undetectable, and significantly l ess than RGS3s (Figure 5.1A). This has been attributed to the rapid degradation o f RGS4 via the ubiquitin/proteasome-dependent N-end rule pathway i nitiated by arginylation of RGS4 at Cys2 (Davydov and Varshavsky, 2000; Lee et al., 2005). RGS3s notably lacks this N-terminal cysteine residue. I t herefore also compared protein levels of the degradation-resistant RGS4(C2V) mutant (Davydov and Varshavsky, 2000). As shown in Figure 5.1B, the level of RGS4(C2V) protein in the cell lysate was significantly greater than wildtype RGS4 and mo re comparable to the protein levels observed with RGS3s expression. Both RGS3s-F LAG (23.5 kDa) and RGS4(C2V)-FLAG (24.25 kDa) migrated near their calculated mo lecular weights

PAGE 83

72 and were often accompanied by a slightly smaller ba nd of lower intensity that may represent some degree of proteolysis or alterna tive translation initiation start site (Krumins et al., 2004). Given the similar and stable expression levels of RGS3s and RGS4(C2V), RGS4(C2V) was routinely used for immunodetection and for comparisons with RGS3s. Functional tests of co-expressed HA-tagged m2 recep tors with Kir3.1MYC/Kir3.2a channels revealed ACh-elicited inwardly rectifying K+ currents were indistinguishable from those produced by their unta gged counterparts reported previously (Jaen and Doupnik, 2005). Comparative an alysis of the modulatory effects of FLAG-tagged RGS3s, RGS4, and RGS4(C2V) on the kinetics of IK,ACh activation and deactivation indicated all three RGS proteins accelerated Kir3 channel gating properties to similar extents (Figur e 5.1D,E). This was somewhat unexpected given the large difference in protein ex pression between RGS4 and RGS4(C2V), and suggests RGS4 protein levels (significantly l ower than RGS3s and RGS4(C2V)) are saturating with regards to functional Kir3 ch annel modulation. Also consistent with my previous study (Jaen and Doupnik, 2005), RGS3s-FLAG caused a significant rightward shift in the ACh dose response relation (Figure 5.1F) and reduced peak IK,ACh amplitudes by ~50% (data not shown).

PAGE 84

73 Figure 5.1. RGS3s, RGS4, and the degradation-resistant RGS4(C2V) mutant are differentially expressed in CHO-K1 cells, yet simil arly affect muscarinic m2 receptor-activated Kir3 channel current kinetics. ( A & B) Western blot analysis of C-terminal FLAG-tagged RGS3s, RGS4, and RGS4(C2V) protein levels in transfected CHO-K1 cell lysates. Cells for each RGS group were co-transfected with the HA-tagged m2 receptor, C-terminal MYC-tagg ed Kir3.1 subunit, and the Kir3.2a subunit (see Methods for details). Sample l anes were each loaded with 20 g of total protein. (C) Whole-cell recordings of ACh-activated Kir3 channel currents from CHO-K1 cells expressing either no RGS (black traces), RGS3sFLAG (red trace), RGS4-FLAG (blue trace), or RGS4(C2V)-FLAG (green trace). The peak currents have been normalized to compare t he RGS-dependent effects on Kir3 channel gating kinetics during and after a 15 s application of 1 M ACh. The current deflections before and during ACh appli cation are responses to voltage ramps (-100 mV to +50 mV) used to monitor i nward rectification. The holding membrane potential was -100 mV in all cases (D & E) RGS3s-FLAG (red), RGS4-FLAG (blue), and RGS4(C2V)-FLAG (green) similarly accelerate the activation and deactivation time course for m2 rece ptor-activated Kir3 channel currents. Single exponential fits to the activation and deactivation time course were performed to derive the time constants, tact and tdeact, respectively. The ACh concentration-dependence of tact is shown for each RGS examined (panel F). The tdeact values are following the rapid washout of 1 M ACh. Values are the meanSEM (n=7-9). (F) ACh-dose response relations for ACh-evoked Kir3 channel currents expressing either no RGS (black sy mbols), RGS3s-FLAG (red symbols), RGS4-FLAG (blue symbols), or RGS4(C2V)-FLAG (green symbols). Mean values were fit with a Hill function (solid cu rves) to compare EC50 values for each condition.

PAGE 85

74

PAGE 86

75 Differential RGS interaction with m2 receptor-Kir3 channel complexes. HA-tagged m2 receptor was immunoprecipitated and pr obed for coprecipitating Kir3.1-MYC and RGS-FLAG by western bl ot analysis. Shown in Figure 5.2, Kir3.1-MYC readily co-precipitated with the muscarinic m2 receptor demonstrating the presence of stable m2 receptor-Ki r3 channel complexes similar to that reported for other GPCRs (Lavine et al., 2002). Interestingly though, while RGS4(C2V) readily co-precipitated with the m2 receptor-Kir3 channel complex, RGS3s did not. The apparent molecu lar weights of the immunoprecipitated proteins were consistent with pr edicted and previously reported values. The immunoprecipitated HA-m2 recep tor migrated as two major bands, one molecular weight band that closely corre sponded to the calculated molecular weight (52.81 kDa) and a higher band (7075 kDa) that corresponds to glycosylated receptors (van Koppen and Nathanson, 1 990). The co-precipitated Kir3.1-MYC subunit also migrated close to its calcu lated molecular weight (57.77 kDa). I next questioned whether the availability Gi prote ins might influence the coupling of RGS3s and RGS4 to m2 receptor-Kir3 chan nel complexes given potential limiting levels of endogenous Gi proteins present within the CHO-K1 cells. To test this, I examined the effects of co-e xpressing the G a i2 subunit on RGS co-precipitation with the m2 receptor-Kir3 chan nel complex. As shown in Figure 5.3, G a i2 expression appeared to slightly enhance wildtype RGS4 protein levels and RGS4 was now detected as a co-precipitat ing protein with the m2

PAGE 87

76 receptor-Kir3 channel complex. Yet similar to the p revious experiments without G a i2 expression, RGS3s again did not co-precipitate w ith the complex and RGS4(C2V) was readily detected (Figure 5.3). Levels of RGS3s and RGS4(C2V) protein in the cell lysates were roughly equivalent indicating the lack of RGS3s association with the complex was not attributable t o differences in protein availability. These experiments clearly demonstrate that RGS4 and RGS4(C2V) can form a stable interaction with m2 receptor-Kir3 channel complexes and that the closely related RGS3s isoform does not interact with the same complex. The m2 receptor-Kir3 channel complex could also be immunopreciptated via the Kir3.1-MYC channel subunit, where the co-pr ecipitating m2 receptor was then detected by western blot (data not shown). Yet in this configuration, coexpression of G a i2 blocked immunoprecipitation of Kir3.1-MYC. I spe culate that immunoprecipitation via the cytosolic C-terminal Ki r3.1-MYC epitope may be perturbed by cytosolic G protein interactions that map to the Kir3 C-terminus (Clancy et al., 2005).

PAGE 88

77 Figure 5.2. Selective association of RGS4 with muscarinic m2 re ceptor-Kir3 channel complexes. HA-muscarinic m2 receptors were immunopreciptated from CHO-K1 cells co-expressing Kir3.1MYC/Kir3.2a chan nels and either no RGS, RGS3s-FLAG, or RGS4(C2V)-FLAG. Coprecipitating Kir3.1-MYC and RGS-FLAG proteins were then probed by western blot analysis. Western blot of the level of RGS-FLAG protein present within each of the cell ly sates is shown in the lower panel. Note that lane one (sham), which is a negati ve control, from CHO-K1 cells transfected only with empty vector shows no unspeci fic binding of proteins in the cell lysate to the agarose beads as well as any det ection of coimmunoprecipitation. However, in the cell lysate, F LAG antibody shows some unspecific binding to proteins that are present in all conditions even those without RGS-FLAG protein expressed; those proteins have hig her molecular weight than the RGS-FLAG proteins. Nevertheless, looking at the appropriate molecular weight between 20-25 kDa, specific RGS-FLAG detecti on from the cell lysates can be observed only in the conditions that were tr ansfected with RGS-FLAG proteins.

PAGE 89

78

PAGE 90

79 Figure 5.3. Effects of Gi2 co-expression on RGS coupling to muscarinic m2 receptor-Kir3 channel complexes. A Gi2 expression vector (the PTX-insensitive Gi2(C352G) mutant) was included in the CHO-K1 cell transfecti ons as described in figure 5.2. Note both RGS4 and RGS4(C2V) coprecipitate with the muscarinic m2 receptor-Kir3 channel complex, whereas RGS3s doe s not.

PAGE 91

80

PAGE 92

81 Structural determinants of RGS4 binding to m2 recep tor-G a aa a i2-Kir3 channel complexes. RGS3s and RGS4 share a high degree of sequence homo logy within their conserved RGS domain (indeed they are nearest neigh bors at 76% similarity), yet have important differences in their N-terminal sequences (Figure 5.4A). The N-terminal domain of RGS4 (aa 1-57) contains two pa lmitoylation sites (Cys2, Cys12) (Srinivasa et al., 1998) and an amphipathic alpha-helix (a.a. 1-33) (Bernstein et al., 2000; Tu et al., 1999; Tu et al. 2001) that are both highly conserved among two other R4 RGS proteins, RGS5 and RGS16 (Chen et al., 1999; Druey et al., 1999). The amphipathic alpha-he lix of RGS4 is both necessary and sufficient for membrane association ( Bernstein et al., 2000; Srinivasa et al., 1998) and is conserved in the RGS 3s N-terminus (Figure 5.4A). Yet the RGS3s N-terminus lacks the two palmitoylati on sites (Cys2, Cys12) that help target RGS16 (and presumably RGS4 and RGS5) to cholesterol-rich membrane lipid rafts (Hiol et al., 2003) and enhanc es RGS GAP activity (Bernstein et al., 2000; Srinivasa et al., 1998; Tu et al., 1999; Tu et al., 2001). My initial hypothesis was that the RGS4 N-terminal domain was both necessary and sufficient for association of RGS4 wi th m2 receptor-G a i2-Kir3 channel complexes. To test this hypothesis, RGS4 de letion mutants and RGS3s/RGS4 chimeras (all FLAG-tagged at the C-termi nus) were individually co-expressed along with the HA-m2 receptor, the G a i2 subunit, and Kir3.1MYC/Kir3.2a channels (Figure 5.4B). The HA-m2 recep tor was then

PAGE 93

82 immunoprecipitated and co-precipitating RGS protein s probed by western blot. In support of my hypothesis, deleting the N-terminal d omain of RGS4, RGS4(58205)-FLAG, resulted in the loss of association with the m2 receptor-Kir3 channel complex (Figure 5.4C) as expected with a loss of me mbrane association (Srinivasa et al., 1998). Yet interestingly, substi tuting the RGS3s N-terminal domain (a.a. 1-62) in place of the RGS4 N-terminal domain (R3s-R4-FLAG chimera) also resulted in the complete loss of asso ciation with the m2 receptorKir3 channel complex (Figure 5.4C) suggesting palmi toylation of RGS4 Cys2 and Cys12 may also be necessary. Together these results clearly demonstrate that the RGS4 N-terminal domain is necessary for couplin g to the signaling complex. Surprisingly, however, substituting the RGS4 N-term inal domain (with or without the C2V mutation) in place of the RGS3s N-t erminal domain (R4-R3sFLAG chimera or R4(C2V)-R3s-FLAG chimera) conferred only very weak interactions with the m2 receptor-Kir3 channel comp lex, significantly less than RGS4(C2V) (Figure 5.4C). Thus the RGS4 N-terminal domain is clearly necessary for association with the m2 receptor-Kir3 channel c omplex, however the remaining RGS domain and/or C-terminus of RGS4 is a lso necessary for efficient high-affinity coupling. Note that the expression of these various RGS constructs had no effect on the level of m2 receptor-Kir3 chan nel coupling (Figure 5.4C), indicating assembly of m2 receptor-Kir3 channel com plexes is not affected by RGS association.

PAGE 94

83 Figure 5.4. Structural determinants of RGS4 association with mu scarinic m2 receptor-Kir3 channel complexes. (A) Amino acid sequence alignment of the mouse RGS3 ‘short’ isoform and rat RGS4. Asterisks denote sites of sequence identity and green residues denote the highly conse rved RGS domain. The Nterminal amphipathic alpha helical domains are boxe d and the conserved basic residues highlighted in red, and the palmitoylated RGS4 C2, C12 residues highlighted in orange. The arrowhead denotes the si te for RGS deletions and junction site for RGS chimeras. (B) Schematic diagr am illustrating C-terminal FLAG-tagged RGS proteins constructed and tested for co-precipitation with muscarinic m2 receptor-Kir3 channel complexes. RGS4 regions are in blue, RGS3s regions are in red. (C) The RGS4 N-terminal d omain (a.a. 1-57) is necessary for RGS association with muscarinic m2 re ceptor-Kir3 channel complexes. Six different RGS-FLAG constructs were i ndividually coexpressed with HA-muscarinic m2 receptors, the Gi2(C352G) subunit, and Kir3.1MYC/Kir3.2a channels in CHO-K1 cells. The HA-m2 rec eptor was then immunoprecipitated and coprecipitating Kir3.1-MYC a nd RGS-FLAG proteins detected by western blot. RGS-FLAG present in the c ell lysates are shown in the lower blot. Faint bands for RGS4(58-205)-FLAG (lane 2), the R4-R3s-FLAG (lane 5), and R4(C2V)-R3s-FLAG chimera (lane 6) could be detected, yet n one of the RGS constructs matched the level of coupling displa yed by RGS4(C2V)-FLAG.

PAGE 95

84

PAGE 96

85 RGS4(C2V) associates with multiple GPCR-Kir3 channel complex es Kir3 channels are functionally coupled to a variety of Gi/o-coupled receptors in the nervous system and heart (Stanfiel d et al., 2002; Yamada et al., 1998). To determine whether RGS3s and RGS4 selectiv ely associate with different Gi/o-coupled receptors known to activate native Kir3 channels, I examined RGS and Kir3 channel co-precipitation with several different HAtagged GPCRs (serotonin 1A, adenosine A1, dopamine D2L, and LPA1 receptors) co-expressed with either G a i2 or G a oA. With G a i2 expression, each GPCR tested (serotonin 1A, adenosine A1, and LPA1 r eceptors) co-precipitated Kir3.1-MYC/Kir3.2a channels (Figure 5.5 and Figure 5.6) and behaved just as the muscarinic m2 receptor (cf, Figure 5.3). Moreover, each GPCR-Kir3 channel complex demonstrated the same selectivity in associ ating with RGS4(C2V) but not RGS3s. Wildtype RGS4 coupling was not readily d etectable as RGS4 expression levels were significantly less than both RGS3s and RGS4(C2V).

PAGE 97

86 Figure 5.5. RGS4(C2V) associates with multiple Gi-coupled receptor-Kir3 channel complexes. Three different HA-tagged GPCRs, the ade nosine A1 receptor (3HAA1R), the serotonin 1A receptor (HA-5-HT1AR), and the lysophosphatidic acid 1 receptor (HA-LPA1R), were expressed in CHO-K1 cells with Kir3.1-MYC/ Kir3.2a channels, the Gi2(C352G) subunit, and either no RGS, RGS3s-FLAG, RGS4FLAG, or RGS4(C2V)-FLAG. Each HA-tagged GPCR was then immunoprecipitated (IP) and co-precipitating (Co-IP ) Kir3.1-MYC and RGS-FLAG proteins detected by western blot (WB). Kir3.1-MYC and RGS4(C2V)-FLAG coprecipitated with each HA-GPCR.

PAGE 98

87

PAGE 99

88 Similarly with G a oA expression, each GPCR tested (serotonin 1A, adenosine A1, dopamine D2L, and LPA1 receptor) co-p recipitated Kir3.1MYC/Kir3.2a channels and RGS4(C2V), but not RGS3s (Figure 5.6). Thus RGS3s does not directly interact with a variety of Gi/o-c oupled receptors, whereas RGS4(C2V) coupling is rather promiscuous. It is worth noting that the immunoprecipitation lev els of the different HAtagged GPCR proteins varied considerably, with m2 r eceptors and dopamine D2L receptors being markedly less than serotonin 1A adenosine A1, or LPA1 receptors (Figure 5.6). The underlying cause for th ese differences are not clear, and was not attributable to either the N-terminal H A tag (1X-HA versus 3X-HA) or the presence of the signal sequence. The difference s apparently reflect distinct coding region differences that affect GPCR protein expression levels. The level of co-precipitating RGS4(C2V) did not correlate with the level of immunoprecipitated HA-GPCR, being somewhat constant for each expression condition and indicates the fraction of associated RGS4(C2V) differed for each GPCR.

PAGE 100

89 Figure 5.6. RGS4(C2V) associates with multiple Go-coupled receptor-Kir3 channel complexes. Effects of GoA subunit expressio n on RGS coupling to different GPCR-Kir3 channel complexes. Five differe nt HA-tagged GPCRs, the muscarinic m2 receptor (HA-m2R), the serotonin 1A r eceptor (HA-5-HT1AR), the lysophosphatidic acid 1 receptor (HA-PA1R), the adenosine A1 receptor (3HAA1R), and the dopamine D2L (3HA-D2LR), were expressed in CHO-K1 cells with Kir3.1-MYC/Kir3.2a channels, the GoA(C351G) subunit, and either RGS4(C2V)FLAG (left panel) or RGS3s-FLAG (right panel). Kir3 .1-MYC and RGS4(C2V)FLAG co-precipitated with each HA-GPCR, whereas RGS 3s-FLAG did not couple to any of the GPCR-Kir3 channel complexes.

PAGE 101

90

PAGE 102

91 Since both RGS3 and RGS4 are also effective GAPs fo r G a q (Hepler et al., 1997; Scheschonka et al., 2000), I also tested whether RGS3s might associate with a GPCR known to couple selectively t o G a q subunits, namely the muscarinic m1 receptor. For these experiments I coexpressed G a q and Kir3.1MYC/Kir3.2a channels, and tested in parallel three additional GPCRs that display varying degrees of Gq coupling for comparison (LPA1, serotonin 1A, and m2 receptor). Interestingly, Kir3.1-MYC/Kir3.2a channe ls co-precipitated with the muscarinic m1 receptor indicating Gq-coupled recept ors can also form stable complexes with Kir3 channels (Figure 5.7). As obser ved with the Gi/o-coupled receptors, RGS3s again failed to couple to the m1 r eceptor-Kir3 channel complex (or any of the other GPCR-G a q-Kir3 channel complexes) whereas RGS4(C2V) directly interacted with the m1 receptor-Kir3 chann el complex (Figure 5.7). Thus despite the functional effects of RGS3s on Kir3 cha nnel gating kinetics (cf. Figure 5.1), RGS3s does not directly couple to any of the GPCR-Kir3 channel complexes tested in my experiments.

PAGE 103

92 Figure 5.7. Kir3 channels and RGS4(C2V) co-assemble with Gq-coupled receptors. Four different HA-tagged GPCRs, the musc arinic m2 receptor (HAm2R), the serotonin 1A receptor (HA-5-HT1AR), the lysophosphatidic acid 1 receptor (HA-LPA1R), the muscarinic m1 receptor (3HA-m1R), were expr essed in CHO-K1 cells with Kir3.1-MYC/Kir3.2a channels, the Gq subunit, and either RGS4(C2V)-FLAG (panel A) or RGS3s-FLAG (panel B). Each HA-ta gged GPCR was then immunoprecipitated (IP) and co-precipitati ng (Co-IP) Kir3.1-MYC and RGS-FLAG proteins detected by western blot (WB). Ki r3.1-MYC and RGS4(C2V)FLAG co-precipitated with each HA-GPCR (panel A), w hereas RGS3s-FLAG did not couple to any of the GPCR-Kir3 channel complexe s (panel B). The RGSFLAG present in each of the cell lysates is shown i n the lower blots.

PAGE 104

93

PAGE 105

94 RGS4(C2V) couples to GPCRs independent of co-assembled Kir3 channels The next question was whether RGS4(C2V) association with GPCR-Kir channel complexes was mediated via specific GPCR in teractions, by direct Kir3 channel interactions, or by interactions with both. To determine this I 1) coexpressed several GPCRs with RGS4(C2V) in the absence of Kir3 channel expression, and 2) co-expressed RGS4(C2V) with Kir3.1-MYC/Kir3.2a channels in the absence of HA-GPCR expression. As shown in Figu re 5.8A, immunoprecipitation of each HA-GPCR readily co-prec ipitated RGS4(C2V) in the absence of Kir3 channel expression. Thus the GPCR a lone is sufficient, and the Kir3 channel not necessary for RGS4(C2V) coupling to GPCR complexes. Shown in Figure 5.8B, in the absence of HA-GPCR expressio n, immunoprecipitation of Kir3.1-MYC/Kir3.2a channels failed to co-precipitat e RGS4(C2V).

PAGE 106

95 Figure 5.8. RGS4(C2V) couples to GPCRs and not the Kir3 channel. (A) Six different HA-tagged GPCRs (the muscarinic m2 recept or (HA-m2R), the serotonin 1A receptor (HA-5-HT1AR), the lysophosphatidic acid 1 receptor (HALPA1R), the adenosine A1 receptor (3HA-A1R), the dopamine D2L (3HA-D2LR), and the muscarinic m1 receptor (HAm1R), were expres sed in CHO-K1 cells with RGS4(C2V)-FLAG in the absence of Kir3.1-MYC/Kir3.2a channel expression. Immunoprecipitation (IP) of each of the HA-GPCRs co precipitated (Co-IP) RGS4(C2V)-FLAG as determined by western blot (WB) analysis. (B) Coexpression of Kir3.1-MYC/Kir3.2a channels and RGS4(C2V)-FLAG in the absence of HA-GPCR. Immunoprecipitation of Kir3.1-MYC faile d to co-precipitate RGS4(C2V)-FLAG as determined by western blot analysis.

PAGE 107

96

PAGE 108

97 Functional impact of direct RGS4 coupling to GPCR-K ir3 channel complexes RGS3s, RGS4, and RGS4(C2V) each accelerated the activation and deactivation gating kinetics of Kir3.1/Kir3.2 chann els to equivalent extents in CHO-K1 cells despite differences in their physical coupling to m2 receptor-Kir3 channel complexes (cf. Figure 5.1). Examination of the accelerating effects of each of the N-terminal deletion constructs (RGS4(58-205) and RGS3s(63-192)) and RGS chimeras (R3s-R4 chimera and R4-R3s chimera) on ACh-activated Kir3 channel currents recorded from CHO-K1 cells also fa iled to identify any functional difference that might correlate with the differences in RGS precoupling to the signaling complex (data not shown). I theref ore questioned whether direct RGS interaction with GPCR-Kir3 channel complexes in CHO-K1 cells was of no functional benefit due to saturating levels of RGS protein expression and high degree of RGS3s ‘collision coupling’. To control and vary the expression levels of RGS3s and RGS4, the Xenopus oocyte system was used because in that system prot ein expression levels can be incrementally increased by titrating the amount of injected cRNA (Zhang et al., 2002). Given the similar steady-stat e protein levels of RGS3sFLAG and the degradation-resistant RGS4(C2V)-FLAG mutant in CHO-K1 cells, those were the RGS proteins used in the oocyte syst em. Concentrationdependent modulatory effects of these two RGS prote ins on m2 receptoractivated Kir3.1/Kir3.2a channels expressed in Xenopus oocytes were examined.

PAGE 109

98 Shown in Figure 5.9, the amount of RGS3s-FLAG cRNA necessary to produce a maximal acceleration in the Kir3 channel deactivati on rate (10 ng/oocyte), was 30 times greater than the amount of RGS4(C2V)-FLAG cRNA necessary to produce an equivalent effect (0.3 ng/oocyte). The derived E C50 values similarily indicate there is a 30-fold greater potency for RGS4(C2V) (EC50, 0.12 ng cRNA/oocyte) versus RGS3s (EC50, 3.3 ng cRNA/oocyte). These results reveal the pri mary functional impact of direct RGS4 coupling is a grea ter potency in accelerating the gating kinetics of receptor-activated Kir3 channels through targeted association.

PAGE 110

99 Figure 5.9. Differential potency of RGS3s and RGS4(C2V) in accelerating the deactivation kinetics of muscarinic m2 receptor-act ivated Kir3 channel currents in Xenopus oocytes. (A) ACh-activated Kir3 channel currents re corded from oocytes expressing the muscarinic m2 receptor, Kir3 .1/Kir3.2a channel subunits, and either RGS3s-FLAG (red traces) or RGS4(C2V)-FLAG (green traces) at two different expression levels (1 and 10 ng cRNA/oocyt e). Inward Kir3 channel currents were elicited by a 25 s application of 1 M ACh, from a holding potential of -80 mV. Current amplitudes have been normalized to illustrate kinetic differences in the activation and deactivation time course. (B) Concentrationdependent effects of RGS3s-FLAG (red symbols) and R GS4(C2V)-FLAG on Kir3 channel deactivation kinetics. The deactivation tim e course following the rapid removal of 1 M ACh was fit with a single exponential function to derive deactivation time constants. Separate groups of ooc ytes injected with increasing amounts of cRNA (0.03-10 ng/oocyte) encoding RGS3sFLAG (red symbols) or RGS4(C2V)-FLAG (green symbols) were tested in parallel. Valu es represent the meanSEM (n=8) from two separate batches of oocytes Mean time constant values for RGS3s-FLAG (red symbols) and RGS4(C2V)-FLAG (green symbols) were fit with a modified Hill function to derive th e effective concentration of cRNA (ng/oocyte) producing 50% of the maximal accelerati on in current deactivation (EC50).

PAGE 111

100

PAGE 112

101 DISCUSSION RGS4(C2V) precouples to multiple GPCRs My findings reported here demonstrate a remarkable promiscuity in the association of RGS4(C2V) with several Gi/o and Gq/11-coupled receptors that assemble with Kir3 channels to form macromolecular signaling complexes. Critical to this observation was the utilization of the degradation-resistant RGS4(C2V) mutant that increased protein expression and enabl ed reliable detection of RGS4(C2V) in my co-immunoprecipitation assays. RGS4(C2V) demonstrated a strong interaction with each of the GPCRs tested, but did not directly interact with the Kir3 channel, indicating selectivity in association with different transmembrane proteins. A previous study had found recombinant GSTRGS4 fusion protein to interact in vitro with Kir3 channels expressed in HEK293 cells, suggesting a direct RGS4-Kir3 channel intera ction (Fujita et al., 2000). In light of my findings, the GST-RGS4 interactions may have been with endogenous GPCRs co-assembled with the Kir3 channels expressed in HEK293 cells. Alternatively, RGS4 may have interactions with Kir3 channels that are not detected in our co-immunoprecipitation experiments, but more apparent using the recombinant RGS4 protein. The association of RG S4(C2V) to multiple Gi/o and Gq/11-coupled receptors independent of the Kir3 channel effector, suggests

PAGE 113

102 precoupled RGS4-GPCR complexes are likely to partic ipate in the G-proteindependent modulation of several other known ion cha nnel effectors regulating neuronal excitability (e.g. Kir2 and Kir6 channels, KCNQ channels, TRP channels, and voltage-gated Ca2+ channels). Structural determinants of RGS4 coupling to GPCRs RGS4 was recently found to directly interact with t he third intracellular loop (i3L) of muscarinic m1 and m5 receptors, but not th e i3L of m2 receptors (Bernstein et al., 2004). My experiments showing RG S4(C2V) co-precipitates with muscarinic m1 receptors is therefore interpreted as a result, at least in part, of direct protein-protein interactions between RGS4(C2V) and the m1 receptor. The lack of RGS4 interactions with the i3L of m2 recept ors (Bernstein et al., 2004) suggests other m2 receptor domains may also partici pate in direct receptorRGS4 coupling, or alternatively the coupling could be mediated indirectly via interactions with precoupled G a i/o subunits or other proteins. Recent reports of RGS4 co-precipitating with m or d -opioid receptors from periaqueductal gray membranes (Garzon et al., 2005) and involving direc t interactions between RGS4 and the C-terminal domains of m or d -opioid receptors (Georgoussi et al., 2005) suggests RGS4 may also directly bind to the C -terminal domain of other GPCRs including the m2 receptor. The structural determinants of RGS4 that mediate as sociation with GPCRKir3 channel complexes support a critical role of t he RGS4 N-terminal domain,

PAGE 114

103 since deleting the N-terminus and substituting the RGS3s N-terminus (R3s/R4 chimera) resulted in decoupling from the GPCR-Kir3 channel complex. Since the RGS4 N-terminus confer membrane association (Sriniv asa et al., 1998) and contains two palmitoylation sites that are expected to facilitate targeting to membrane lipid rafts (Hiol et al., 2003) where GPCR s (Papoucheva et al., 2004), heterotrimeric G proteins (Moffett et al., 2000), a nd Kir3 channels localize (Delling et al., 2002), there are apparent cooperat ive and selective interactions involving the RGS4 N-terminus and the RGS4 RGS doma in that together mediate the high affinity coupling. My findings are consistent with the model proposed by Wilkie and colleagues (Zeng et al., 199 8), where the RGS4 Nterminus directly interacts with the GPCR and the R GS domain interacts with the precoupled G a subunit. Thus receptor-RGS4 association is expecte d to increase the degree of precoupled receptor-G protein complex es. Recent fluorescence resonance energy transfer (FRET) experiments suppo rt a stable interaction between RGS proteins (RGS7 and RGS8) and G a subunits within an agonistreceptor-G-protein quaternary complex (Benians et a l., 2005). Importantly, however, these experiments did not detect FRET betw een RGS8 and the GPCR, indicating the RGS-G a FRET signals could be potentially derived via a co llisioncoupled process. It will be important to extend our co-immunoprecipitation experiments to RGS8 and other members of the RGS pr otein family to identify RGS proteins that stably associate with different G PCRs, and identify those that do not.

PAGE 115

104 Although I found no evidence for receptor-specific association of RGS4(C2V), wildtype RGS4 coupling was low or not detectable for each of the GPCRs tested. This may be in part due to the low RG S4 protein levels caused by the rapid degradation of RGS4 via the N-end rule pa thway (Davydov and Varshavsky, 2000), or alternatively could reflect e ffects of Cys2 modifications on coupling to GPCRs. The RGS4 Cys2 residue is the tar get of palmitoylation (Srinivasa et al., 1998), arginylation (Davydov and Varshavsky, 2000), nitrosylation (Hu et al., 2005), and oxidation (Hu et al., 2005), where the RGS4(C2V) mutant would be insensitive to any negative effect s of Cys2 modifications on GPCR coupling. Future studies expl oring the role of the RGS4 Cys2 site and its modifications on the efficacy of specific GPCR coupling will be needed to resolve this fascinating possibility. Implications of RGS4 precoupling versus RGS3s colli sion-coupling My initial electrophysiological measures of RGS3sversus RGS4dependent modulation of Kir3 currents in CHO-K1 cel ls did not reveal any functional advantage for precoupled RGS4 proteins v ersus uncoupled RGS3s. Yet RGS dosage experiments in Xenopus oocytes clearly demonstrated that RGS4(C2V) precoupling provides a 30-fold greater potency in Kir3 channel modulation versus uncoupled RGS3s. These findings i llustrate the high level of RGS collision-coupling that occurs in the CHO-K1 ex pression experiments, a likely result of the high protein expression levels produced in this commonly used

PAGE 116

105 mammalian expression system. Functional assays prob ing for RGS-GPCR coupling specificity using similar assay systems ar e likely biased for ‘falsepositives’ due to the high degree of RGS collisioncoupling and the generally low selectivity of several RGS proteins towards Gi/o, G q/11, and Gz subunits. Experimental protocols implementing RGS dosage in l ive cell assays should help resolve RGS selectivity in the modulation of specif ic GPCR signaling pathways.

PAGE 117

106 CHAPTER 6 CONCLUDING REMARKS The original purpose of this study was to character ize the specific RGS proteins that modulate endogenous neuronal GIRK cha nnels. Initially I used CG neurons, a native cell type that endogenously expre sses GIRK channels. In order to determine the endogenous RGS proteins that were likely to be involved in GIRK channel modulation, a RGS expression profile w as performed. This work has shown that CG neurons can express at least 13 R GS genes. Comparison of RGS gene expression profiles from different native cell types (i.e. CG neurons vs cardiac myocytes) can give us an indication of whic h RGS proteins may be physiologically important for each cell type. It has been demonstrated that GIRK channels can for m stable signaling complexes with GPCRs (Lavine et al., 2002), and mul tiple RGS proteins are expressed within single GIRK-expressing neurons and atrial myocytes (Doupnik et al., 2004; Doupnik et al., 2001; Gold et al., 19 97). How are cells able to specifically activate a deter mined signaling pathway?

PAGE 118

107 One way of signaling pathway specificity may come t hrough selective interaction of RGS proteins with various GPCR-effec tor signaling complexes. To test this hypothesis I studied RGS3s and RGS4, t wo RGS’s whose mRNA levels are transcriptionally regulated in the nervous system during pathophysiologic conditions (Costigan et al., 2003) My findings demonstrate a tight coupling between RG S4 and several GPCRs that are central participants in normal and p athologically altered neuromodulation. Interaction among the different GP CRs-GIRK-RGS proteins seems to be very specific, since only RGS4 was able to co-immunoprecipitate with the GPCR-GIRK channel signaling complexes and RGS3s was not (Figure 6.1). My results highlight the importance that selective RGS-GPCR interactions may have physiologically. The functional impact of RGS4(C2V) precoupled to the GPCR-Kir3 channel complex was a 30-fold greater pot ency in the acceleration of Kir3 channel gating kinetics, compared to the uncou pled (or collision coupled) RGS3s. This disparity in potency observed between R GS4(C2V) and RGS3s is probably due to the coupling of RGS4(C2V) to the GPCR-GIRK signaling complex. Further experiments in the oocyte system u sing the different chimeras and deletion constucts are needed to corroborate th is hypothesis. Given the multiple mechanisms affecting RGS4 protei n levels, it will be important to determine to what extent these changes in RGS4 concentration affect coupling to different GPCR signaling pathway s. Recently, a mutation in an

PAGE 119

108 RGS protein, RGS9-1 that is involved in the rhodops in signaling complex has been shown to be the cause of a disease (bradyopsia ) in humans, a non-lethal condition characterized by an inability to resolve rapidly changing visual scenes (Nishiguchi et al., 2004). In summary, my findings demonstrate that RGS4, a hi ghly regulated modulator and susceptibility gene for schizophrenia is an integral component of multiple GPCR-Kir3 channel complexes affecting a wi de range of neurotransmitter-mediated events in the nervous sys tem. Acquired or inherited disruptions in RGS4-GPCR coupling may also be criti cal for a variety of neurological disorders that may include schizophren ia, depression, epilepsy, and drug addiction Future experiments in native tissue are needed to d etect the location and identification of the distinct RGS pro teins involved in the coupling to the different GPCR-effector signaling complexes. Al though my experiments have been performed in an heterologous system, the inter actions reported here may be physiologically important for several reasons: 1 ) RGS4 has been reported to co-immunoprecipitate with m and d -opioid receptors from periaqueductal gray membranes (Garzon et al., 2005), 2) the functional impact that precoupled RGS4 has in contrast to uncoupled RGS3s in the Xenopus oocyte experiments once the protein concentration of both RGS was reduced a nd tritated 3) The precoupling is RGS protein specific, being only RGS 4 able to associate to the different GPCR-GIRK channel complexes.

PAGE 120

109 Figure 6.1. Differential coupling of RGS proteins to GPCR-GIRK channel signaling complexes. (A) RGS4 couples to GPCR-GIRK channel signaling complexes, interacting with the GPCR and not with t he GIRK subunit. (B) RGS3s does not couple to the GPCR-GIRK channel signaling complexes.

PAGE 121

110 REFERENCES Benians A, Nobles M, Hosny S, and Tinker A (2005) R egulators of G-protein signaling form a quaternary complex with the agonis t, receptor, and Gprotein. A novel explanation for the acceleration o f signaling activation kinetics. J Biol Chem 280: 13383-94. Berman DM, Kozasa T, and Gilman AG (1996a) The GTPa se-activating protein RGS4 stabilizes the transition state for nucleotide hydrolysis. J Biol Chem 271: 27209-12. Berman DM, Wilkie TM, and Gilman AG (1996b) GAIP an d RGS4 are GTPaseactivating proteins for the Gi subfamily of G prote in alpha subunits. Cell 86: 445-52. Bernstein LS, Grillo AA, Loranger SS, and Linder ME (2000) RGS4 binds to membranes through an amphipathic alpha -helix. J Bi ol Chem 275: 185206. Bernstein LS, Ramineni S, Hague C, Cladman W, Chidi ac P, Levey AI, and Hepler JR (2004) RGS2 binds directly and selectivel y to the M1 muscarinic acetylcholine receptor third intracellul ar loop to modulate Gq/11alpha signaling. J Biol Chem 279: 21248-56. Bishop GB, Cullinan WE, Curran E, and Gutstein HB ( 2002) Abused drugs modulate RGS4 mRNA levels in rat brain: comparison between acute drug treatment and a drug challenge after chronic treatm ent. Neurobiol Dis 10: 334-43. Blednov YA, Stoffel M, Alva H, and Harris RA (2003) A pervasive mechanism for analgesia: activation of GIRK2 channels. Proc Natl Acad Sci U S A 100: 277-82. Blednov YA, Stoffel M, Chang SR, and Harris RA (200 1) GIRK2 deficient mice. Evidence for hyperactivity and reduced anxiety. Phy siol Behav 74: 109-17.

PAGE 122

111 Bockaert J, and Pin JP (1999) Molecular tinkering o f G protein-coupled receptors: an evolutionary success. Embo J 18: 1723-9. Boutet-Robinet EA, Finana F, Wurch T, Pauwels PJ, a nd De Vries L (2003) Endogenous RGS proteins facilitate dopamine D(2S) r eceptor coupling to G(alphao) proteins and Ca2+ responses in CHO-K1 cel ls. FEBS Lett 533: 67-71. Breitwieser GE, and Szabo G (1985) Uncoupling of ca rdiac muscarinic and betaadrenergic receptors from ion channels by a guanine nucleotide analogue. Nature 317: 538-40. Breitwieser GE, and Szabo G (1988) Mechanism of mus carinic receptor-induced K+ channel activation as revealed by hydrolysis-res istant GTP analogues. J Gen Physiol 91: 469-93. Brzustowicz LM, Hodgkinson KA, Chow EW, Honer WG, a nd Bassett AS (2000) Location of a major susceptibility locus for famili al schizophrenia on chromosome 1q21-q22. Science 288: 678-82. Bulenger S, Marullo S, and Bouvier M (2005) Emergin g role of homoand heterodimerization in G-protein-coupled receptor bi osynthesis and maturation. Trends in Pharmacological Sciences 26: 131-137. Bunemann M, Brandts B, and Pott L (1996) Downregula tion of muscarinic M2 receptors linked to K+ current in cultured guinea-p ig atrial myocytes. J Physiol 494 ( Pt 2): 351-62. Bunemann M, and Hosey MM (1998) Regulators of G pro tein signaling (RGS) proteins constitutively activate Gbeta gamma-gated potassium channels. J Biol Chem 273: 31186-90. Cabrera-Vera TM, Hernandez S, Earls LR, Medkova M, Sundgren-Andersson AK, Surmeier DJ, and Hamm HE (2004) RGS9-2 modulate s D2 dopamine receptor-mediated Ca2+ channel inhibition in rat st riatal cholinergic interneurons. Proc Natl Acad Sci U S A 101: 16339-44. Cabrera-Vera TM, Vanhauwe J, Thomas TO, Medkova M, Preininger A, Mazzoni MR, and Hamm HE (2003) Insights into G protein stru cture, function, and regulation. Endocr Rev 24: 765-81. Calo LA, Pagnin E, Davis PA, Sartori M, Ceolotto G, Pessina AC, and Semplicini A (2004) Increased expression of regulator of G pro tein signaling-2 (RGS-

PAGE 123

112 2) in Bartter's/Gitelman's syndrome. A role in the control of vascular tone and implication for hypertension. J Clin Endocrinol Metab 89: 4153-7. Chatterjee TK, Eapen AK, and Fisher RA (1997) A tru ncated form of RGS3 negatively regulates G protein-coupled receptor sti mulation of adenylyl cyclase and phosphoinositide phospholipase C. J Bio l Chem 272: 15481-7. Chen C, Seow KT, Guo K, Yaw LP, and Lin SC (1999) T he membrane association domain of RGS16 contains unique amphipa thic features that are conserved in RGS4 and RGS5. J Biol Chem 274: 19799-806. Chidiac P, and Roy AA (2003) Activity, regulation, and intracellular localization of RGS proteins. Receptors Channels 9: 135-47. Chowdari KV, Mirnics K, Semwal P, Wood J, Lawrence E, Bhatia T, Deshpande SN, B KT, Ferrell RE, Middleton FA, Devlin B, Levit t P, Lewis DA, and Nimgaonkar VL (2002) Association and linkage analys es of RGS4 polymorphisms in schizophrenia. Hum Mol Genet 11: 1373-80. Chuang HH, Yu M, Jan YN, and Jan LY (1998) Evidence that the nucleotide exchange and hydrolysis cycle of G proteins causes acute desensitization of G-protein gated inward rectifier K+ channels. Pr oc Natl Acad Sci U S A 95: 11727-32. Clancy SM, Fowler CE, Finley M, Suen KF, Arrabit C, Berton F, Kosaza T, Casey PJ, and Slesinger PA (2005) Pertussis-toxin-sensiti ve Galpha subunits selectively bind to C-terminal domain of neuronal G IRK channels: evidence for a heterotrimeric G-protein-channel com plex. Mol Cell Neurosci 28: 375-89. Cole SL, and Schindler M (2000) Characterisation of somatostatin sst2 receptor splice variants. Journal of Physiology-Paris 94: 217-237. Costigan M, Samad TA, Allchorne A, Lanoue C, Tate S and Woolf CJ (2003) High basal expression and injury-induced down regul ation of two regulator of G-protein signaling transcripts, RGS3 and RGS4 i n primary sensory neurons. Mol Cell Neurosci 24: 106-16. Daaka Y, Luttrell LM, and Lefkowitz RJ (1997) Switc hing of the coupling of the beta2-adrenergic receptor to different G proteins b y protein kinase A. Nature 390: 88-91. Dascal N (1997) Signalling via the G protein-activa ted K+ channels. Cell Signal 9: 551-73.

PAGE 124

113 Dascal N, Schreibmayer W, Lim NF, Wang W, Chavkin C DiMagno L, Labarca C, Kieffer BL, Gaveriaux-Ruff C, Trollinger D, and et al. (1993) Atrial G protein-activated K+ channel: expression cloning an d molecular properties. Proc Natl Acad Sci U S A 90: 10235-9. Davydov IV, and Varshavsky A (2000) RGS4 is arginyl ated and degraded by the N-end rule pathway in vitro. J Biol Chem 275: 22931-41. Dell'Acqua ML, Carroll RC, and Peralta EG (1993) Tr ansfected m2 muscarinic acetylcholine receptors couple to G alpha i2 and G alpha i3 in Chinese hamster ovary cells. Activation and desensitization of the phospholipase C signaling pathway. J Biol Chem 268: 5676-85. Delling M, Wischmeyer E, Dityatev A, Sytnyk V, Veh RW, Karschin A, and Schachner M (2002) The neural cell adhesion molecul e regulates cellsurface delivery of G-protein-activated inwardly re ctifying potassium channels via lipid rafts. J Neurosci 22: 7154-64. Doupnik CA, Davidson N, and Lester HA (1995) The in ward rectifier potassium channel family. Curr Opin Neurobiol 5: 268-77. Doupnik CA, Davidson N, Lester HA, and Kofuji P (19 97) RGS proteins reconstitute the rapid gating kinetics of gbetagamm a-activated inwardly rectifying K+ channels. Proc Natl Acad Sci U S A 94: 10461-6. Doupnik CA, Jaen C, and Zhang Q (2004) Measuring th e modulatory effects of RGS proteins on GIRK channels. Methods Enzymol 389: 131-54. Doupnik CA, Xu T, and Shinaman JM (2001) Profile of RGS expression in single rat atrial myocytes. Biochim Biophys Acta 1522: 97-107. Downes GB, and Gautam N (1999) The G protein subuni t gene families. Genomics 62: 544-52. Drake CT, Bausch SB, Milner TA, and Chavkin C (1997 ) GIRK1 immunoreactivity is present predominantly in dendrites, dendritic sp ines, and somata in the CA1 region of the hippocampus. Proc Natl Acad Sci U S A 94: 1007-12. Drews J, uuml, and rgen (2000) Drug Discovery: A Hi storical Perspective. Science 287: 1960-1964. Druey KM, Blumer KJ, Kang VH, and Kehrl JH (1996) I nhibition of G-proteinmediated MAP kinase activation by a new mammalian g ene family. Nature 379: 742-6.

PAGE 125

114 Druey KM, Sullivan BM, Brown D, Fischer ER, Watson N, Blumer KJ, Gerfen CR, Scheschonka A, and Kehrl JH (1998) Expression of GT Pase-deficient Gialpha2 results in translocation of cytoplasmic RG S4 to the plasma membrane. J Biol Chem 273: 18405-10. Druey KM, Ugur O, Caron JM, Chen CK, Backlund PS, a nd Jones TL (1999) Amino-terminal cysteine residues of RGS16 are requi red for palmitoylation and modulation of Giand Gq-mediated signaling. J Biol Chem 274: 18836-42. Dulin NO, Pratt P, Tiruppathi C, Niu J, Voyno-Yasen etskaya T, and Dunn MJ (2000) Regulator of G protein signaling RGS3T is lo calized to the nucleus and induces apoptosis. J Biol Chem 275: 21317-23. Dulin NO, Sorokin A, Reed E, Elliott S, Kehrl JH, a nd Dunn MJ (1999) RGS3 inhibits G protein-mediated signaling via transloca tion to the membrane and binding to Galpha11. Mol Cell Biol 19: 714-23. Duvernay MT, Filipeanu CM, and Wu G (2005) The regu latory mechanisms of export trafficking of G protein-coupled receptors. Cellular Signalling 17: 1457-1465. Ehrengruber MU, Lanzrein M, Xu Y, Jasek MC, Kantor DB, Schuman EM, Lester HA, and Davidson N (1998) Recombinant adenovirus-me diated expression in nervous system of genes coding for io n channels and other molecules involved in synaptic function. Methods En zymol 293: 483-503. Fujita S, Inanobe A, Chachin M, Aizawa Y, and Kurac hi Y (2000) A regulator of G protein signalling (RGS) protein confers agonist-de pendent relaxation gating to a G protein-gated K+ channel. J Physiol 526 Pt 2: 341-7. Gainetdinov RR, and Caron MG (1999) Delineating mus carinic receptor functions. Proc Natl Acad Sci U S A 96: 12222-3. Garnier M, Zaratin PF, Ficalora G, Valente M, Fonta nella L, Rhee MH, Blumer KJ, and Scheideler MA (2003) Up-regulation of regul ator of G protein signaling 4 expression in a model of neuropathic pa in and insensitivity to morphine. J Pharmacol Exp Ther 304: 1299-306. Garzon J, Rodriguez-Munoz M, and Sanchez-Blazquez P (2005) Morphine alters the selective association between mu-opioid recepto rs and specific RGS proteins in mouse periaqueductal gray matter. Neuro pharmacology 48: 853-68.

PAGE 126

115 Georgoussi Z, Leontiadis L, Mazarakou G, Merkouris M, Hyde K, and Hamm H (2005) Selective interactions between G protein sub units and RGS4 with the C-terminal domains of the muand delta-opioid receptors regulate opioid receptor signaling. Cell Signal. Geurts M, Hermans E, and Maloteaux JM (2002) Opposi te modulation of regulators of G protein signalling-2 RGS2 and RGS4 expression by dopamine receptors in the rat striatum. Neurosci Le tt 333: 146-50. Geurts M, Maloteaux JM, and Hermans E (2003) Altere d expression of regulators of G-protein signaling (RGS) mRNAs in the striatum of rats undergoing dopamine depletion. Biochem Pharmacol 66: 1163-70. Ghavami A, Hunt RA, Olsen MA, Zhang J, Smith DL, Ka lgaonkar S, Rahman Z, and Young KH (2004) Differential effects of regulat or of G protein signaling (RGS) proteins on serotonin 5-HT1A, 5-HT2 A, and dopamine D2 receptor-mediated signaling and adenylyl cyclase ac tivity. Cell Signal 16: 711-21. Gold SJ, Han MH, Herman AE, Ni YG, Pudiak CM, Aghaj anian GK, Liu RJ, Potts BW, Mumby SM, and Nestler EJ (2003) Regulation of R GS proteins by chronic morphine in rat locus coeruleus. Eur J Neur osci 17: 971-80. Gold SJ, Heifets BD, Pudiak CM, Potts BW, and Nestl er EJ (2002) Regulation of regulators of G protein signaling mRNA expression i n rat brain by acute and chronic electroconvulsive seizures. J Neurochem 82: 828-38. Gold SJ, Ni YG, Dohlman HG, and Nestler EJ (1997) R egulators of G-protein signaling (RGS) proteins: region-specific expressio n of nine subtypes in rat brain. J Neurosci 17: 8024-37. Grafstein-Dunn E, Young KH, Cockett MI, and Khawaja XZ (2001) Regional distribution of regulators of G-protein signaling ( RGS) 1, 2, 13, 14, 16, and GAIP messenger ribonucleic acids by in situ hybridi zation in rat brain. Molecular Brain Research 88: 113-123. Guan XM, Kobilka TS, and Kobilka BK (1992) Enhancem ent of membrane insertion and function in a type IIIb membrane prot ein following introduction of a cleavable signal peptide. J Biol Chem 267: 21995-8. Hamill OP, Marty A, Neher E, Sakmann B, and Sigwort h FJ (1981) Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch 391: 85-100.

PAGE 127

116 Harrison PJ, and Weinberger DR (2005) Schizophrenia genes, gene expression, and neuropathology: on the matter of their converge nce. Mol Psychiatry 10: 40-68; image 5. Hepler JR, Berman DM, Gilman AG, and Kozasa T (1997 ) RGS4 and GAIP are GTPase-activating proteins for Gq alpha and block a ctivation of phospholipase C beta by gamma-thio-GTP-Gq alpha. Pr oc Natl Acad Sci U S A 94: 428-32. Heximer SP, Knutsen RH, Sun X, Kaltenbronn KM, Rhee M-H, Peng N, Oliveirados-Santos A, Penninger JM, Muslin AJ, Steinberg TH Wyss JM, Mecham RP, and Blumer KJ (2003) Hypertension and pr olonged vasoconstrictor signaling in RGS2-deficient mice. J Clin. Invest. 111: 445452. Heximer SP, Lim H, Bernard JL, and Blumer KJ (2001) Mechanisms governing subcellular localization and function of human RGS2 J Biol Chem 276: 14195-203. Hille B (2001) Ion Channels of Excitable Membranes. Sunderland: Sinauer Associates, Inc. Hiol A, Davey PC, Osterhout JL, Waheed AA, Fischer ER, Chen CK, Milligan G, Druey KM, and Jones TL (2003) Palmitoylation regula tes regulators of Gprotein signaling (RGS) 16 function. I. Mutation of amino-terminal cysteine residues on RGS16 prevents its targeting to lipid r afts and palmitoylation of an internal cysteine residue. J Biol Chem 278: 19301-8. Hollinger S, and Hepler JR (2002) Cellular regulati on of RGS proteins: modulators and integrators of G protein signaling. Pharmacol Rev 54: 52759. Hopkins AL, and Groom CR (2002) THE DRUGGABLE GENOM E. Nature Reviews Drug Discovery 1: 727-730. Hu RG, Sheng J, Qi X, Xu Z, Takahashi TT, and Varsh avsky A (2005) The N-end rule pathway as a nitric oxide sensor controlling t he levels of multiple regulators. Nature 437: 981-6. Huang CL, Slesinger PA, Casey PJ, Jan YN, and Jan L Y (1995) Evidence that direct binding of G beta gamma to the GIRK1 G prote in-gated inwardly rectifying K+ channel is important for channel acti vation. Neuron 15: 113343.

PAGE 128

117 Huang J-S, Ramamurthy SK, Lin X, and Le Breton GC ( 2004) Cell signalling through thromboxane A2 receptors. Cellular Signalli ng 16: 521-533. Inanobe A, Fujita S, Makino Y, Matsushita K, Ishii M, Chachin M, and Kurachi Y (2001) Interaction between the RGS domain of RGS4 w ith G protein alpha subunits mediates the voltage-dependent relaxation of the G protein-gated potassium channel. J Physiol 535: 133-43. Inanobe A, Yoshimoto Y, Horio Y, Morishige KI, Hibi no H, Matsumoto S, Tokunaga Y, Maeda T, Hata Y, Takai Y, and Kurachi Y (1999) Characterization of G-protein-gated K+ channels com posed of Kir3.2 subunits in dopaminergic neurons of the substantia nigra. J Neurosci 19: 1006-17. Itzhaki Van-Ham I, Peleg S, Dascal N, Shapira H, an d Oron Y (2004) G proteinactivated K+ channels: a reporter for rapid activat ion of G proteins by lysophosphatidic acid in Xenopus oocytes. FEBS Lett 564: 157-60. Ivanina T, Varon D, Peleg S, Rishal I, Porozov Y, D essauer CW, Keren-Raifman T, and Dascal N (2004) Galphai1 and Galphai3 differ entially interact with, and regulate, the G protein-activated K+ channel. J Biol Chem 279: 172608. Jaen C, and Doupnik CA (2005) Neuronal Kir3.1/Kir3. 2a channels coupled to serotonin 1A and muscarinic m2 receptors are differ entially modulated by the "short" RGS3 isoform. Neuropharmacology 49: 465-76. Jeong SW, and Ikeda SR (2001) Differential regulati on of G protein-gated inwardly rectifying K(+) channel kinetics by distin ct domains of RGS8. J Physiol 535: 335-47. Karschin A, Ho BY, Labarca C, Elroy-Stein O, Moss B Davidson N, and Lester HA (1991) Heterologously expressed serotonin 1A rec eptors couple to muscarinic K+ channels in heart. Proc Natl Acad Sci U S A 88: 5694-8. Karschin C, and Karschin A (1997) Ontogeny of Gene Expression of Kir Channel Subunits in the Rat. Molecular and Cellular Neurosc ience 10: 131-148. Kehrl JH, Srikumar D, Harrison K, Wilson GL, and Sh i CS (2002) Additional 5' exons in the RGS3 locus generate multiple mRNA tran scripts, one of which accounts for the origin of human PDZ-RGS3. Ge nomics 79: 860-8. Keren-Raifman T, Bera AK, Zveig D, Peleg S, Withero w DS, Slepak VZ, and Dascal N (2001) Expression levels of RGS7 and RGS4 proteins determine

PAGE 129

118 the mode of regulation of the G protein-activated K (+) channel and control regulation of RGS7 by G beta 5. FEBS Lett 492: 20-8. Koelle MR, and Horvitz HR (1996) EGL-10 regulates G protein signaling in the C. elegans nervous system and shares a conserved domai n with many mammalian proteins. Cell 84: 115-25. Kofuji P, Davidson N, and Lester HA (1995) Evidence that neuronal G-proteingated inwardly rectifying K+ channels are activated by G beta gamma subunits and function as heteromultimers. Proc Natl Acad Sci U S A 92: 6542-6. Kofuji P, Hofer M, Millen KJ, Millonig JH, Davidson N, Lester HA, and Hatten ME (1996) Functional Analysis of the weaver Mutant GIR K2 K+ Channel and Rescue of weaver Granule Cells. Neuron 16: 941-952. Krapivinsky G, Gordon EA, Wickman K, Velimirovic B, Krapivinsky L, and Clapham DE (1995a) The G-protein-gated atrial K+ ch annel IKACh is a heteromultimer of two inwardly rectifying K(+)-chan nel proteins. Nature 374: 135-41. Krapivinsky G, Krapivinsky L, Wickman K, and Clapha m DE (1995b) G beta gamma binds directly to the G protein-gated K+ chan nel, IKACh. J Biol Chem 270: 29059-62. Krumins AM, Barker SA, Huang C, Sunahara RK, Yu K, Wilkie TM, Gold SJ, and Mumby SM (2004) Differentially regulated expression of endogenous RGS4 and RGS7. J Biol Chem 279: 2593-9. Kurachi Y, Nakajima T, and Sugimoto T (1986) On the mechanism of activation of muscarinic K+ channels by adenosine in isolated atrial cells: involvement of GTP-binding proteins. Pflugers Arch 407: 264-74. Lavine N, Ethier N, Oak JN, Pei L, Liu F, Trieu P, Rebois RV, Bouvier M, Hebert TE, and Van Tol HH (2002) G protein-coupled recepto rs form stable complexes with inwardly rectifying potassium channe ls and adenylyl cyclase. J Biol Chem 277: 46010-9. Leaney JL, Benians A, Brown S, Nobles M, Kelly D, a nd Tinker A (2004) Rapid desensitization of G protein-gated inwardly rectify ing K(+) currents is determined by G protein cycle. Am J Physiol Cell Ph ysiol 287: C182-91. Leaney JL, and Tinker A (2000) The role of members of the pertussis toxinsensitive family of G proteins in coupling receptor s to the activation of the

PAGE 130

119 G protein-gated inwardly rectifying potassium chann el. Proc Natl Acad Sci U S A 97: 5651-6. Lee MJ, Tasaki T, Moroi K, An JY, Kimura S, Davydov IV, and Kwon YT (2005) RGS4 and RGS5 are in vivo substrates of the N-end r ule pathway. Proc Natl Acad Sci U S A 102: 15030-5. Lei Q, Talley EM, and Bayliss DA (2001) Receptor-me diated inhibition of G protein-coupled inwardly rectifying potassium chann els involves G(alpha)q family subunits, phospholipase C, and a readily dif fusible messenger. J Biol Chem 276: 16720-30. Liao YJ, Jan YN, and Jan LY (1996) Heteromultimeriz ation of G-protein-gated inwardly rectifying K+ channel proteins GIRK1 and G IRK2 and their altered expression in weaver brain. J Neurosci 16: 7137-50. Lim NF, Dascal N, Labarca C, Davidson N, and Lester HA (1995) A G proteingated K channel is activated via beta 2-adrenergic receptors and G beta gamma subunits in Xenopus oocytes. J Gen Physiol 105: 421-39. Logothetis DE, Kurachi Y, Galper J, Neer EJ, and Cl apham DE (1987) The beta gamma subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature 325: 321-6. Lu Q, Sun EE, Klein RS, and Flanagan JG (2001) Ephr in-B reverse signaling is mediated by a novel PDZ-RGS protein and selectively inhibits G proteincoupled chemoattraction. Cell 105: 69-79. Luscher C, Jan LY, Stoffel M, Malenka RC, and Nicol l RA (1997) G proteincoupled inwardly rectifying K+ channels (GIRKs) med iate postsynaptic but not presynaptic transmitter actions in hippocampal neurons. Neuron 19: 687-95. Mark MD, and Herlitze S (2000) G-protein mediated g ating of inward-rectifier K+ channels. Eur J Biochem 267: 5830-6. Masuho I, Itoh M, Itoh H, and Saitoh O (2004) The m echanism of membranetranslocation of regulator of G-protein signaling ( RGS) 8 induced by Galpha expression. J Neurochem 88: 161-8. Mellado M, Rodriguez-Frade JM, Vila-Coro AJ, Fernan dez S, Martin de Ana A, Jones DR, Toran JL, and Martinez AC (2001) Chemokin e receptor homoor heterodimerization activates distinct signaling pathways. Embo J 20: 2497-507.

PAGE 131

120 Mirnics K, Middleton FA, Stanwood GD, Lewis DA, and Levitt P (2001) Diseasespecific changes in regulator of G-protein signalin g 4 (RGS4) expression in schizophrenia. Mol Psychiatry 6: 293-301. Moffett S, Brown DA, and Linder ME (2000) Lipid-dep endent targeting of G proteins into rafts. J Biol Chem 275: 2191-8. Mohler H, Benke D, and Fritschy JM (2001) GABAB-rec eptor isoforms: Molecular architecture and distribution. Life Sciences 68: 2297-2300. Mukhopadhyay S, and Ross EM (1999) Rapid GTP bindin g and hydrolysis by G(q) promoted by receptor and GTPase-activating pro teins. Proc Natl Acad Sci U S A 96: 9539-44. Mullner C, Vorobiov D, Bera AK, Uezono Y, Yakubovic h D, FrohnwieserSteinecker B, Dascal N, and Schreibmayer W (2000) H eterologous facilitation of G protein-activated K(+) channels b y beta-adrenergic stimulation via cAMP-dependent protein kinase. J Ge n Physiol 115: 54758. Muma NA, Mariyappa R, Williams K, and Lee JM (2003) Differences in regional and subcellular localization of G(q/11) and RGS4 pr otein levels in Alzheimer's disease: correlation with muscarinic M1 receptor binding parameters. Synapse 47: 58-65. Nakajima Y, Nakajima S, and Inoue M (1988) Pertussi s toxin-insensitive G protein mediates substance P-induced inhibition of potassium channels in brain neurons. Proc Natl Acad Sci U S A 85: 3643-7. Neer EJ (1995) Heterotrimeric C proteins: Organizer s of transmembrane signals. Cell 80: 249-257. Neill JD, Duck LW, Sellers JC, Musgrove LC, Schesch onka A, Druey KM, and Kehrl JH (1997) Potential role for a regulator of G protein signaling (RGS3) in gonadotropin-releasing hormone (GnRH) sti mulated desensitization. Endocrinology 138: 843-6. Neubig RR, and Siderovski DP (2002) Regulators of G -protein signalling as new central nervous system drug targets. Nat Rev Drug D iscov 1: 187-97. Ni YG, Gold SJ, Iredale PA, Terwilliger RZ, Duman R S, and Nestler EJ (1999) Region-specific regulation of RGS4 (Regulator of Gprotein-signaling protein type 4) in brain by stress and glucocortico ids: in vivo and in vitro studies. J Neurosci 19: 3674-80.

PAGE 132

121 Nichols CG, and Lopatin AN (1997) Inward rectifier potassium channels. Annu Rev Physiol 59: 171-91. Nikolov EN, and Ivanova-Nikolova TT (2004) Coordina tion of membrane excitability through a GIRK1 signaling complex in t he atria. J Biol Chem 279: 23630-6. Nishiguchi KM, Sandberg MA, Kooijman AC, Martemyano v KA, Pott JW, Hagstrom SA, Arshavsky VY, Berson EL, and Dryja TP (2004) Defects in RGS9 or its anchor protein R9AP in patients with sl ow photoreceptor deactivation. Nature 427: 75-8. Offermanns S, Wieland T, Homann D, Sandmann J, Bomb ien E, Spicher K, Schultz G, and Jakobs KH (1994) Transfected muscari nic acetylcholine receptors selectively couple to Gitype G proteins and Gq/11. Mol Pharmacol 45: 890-898. Papoucheva E, Dumuis A, Sebben M, Richter DW, and P onimaskin EG (2004) The 5-hydroxytryptamine(1A) receptor is stably palm itoylated, and acylation is critical for communication of receptor with Gi protein. J Biol Chem 279: 3280-91. Patil N, Cox DR, Bhat D, Faham M, Myers RM, and Pet erson AS (1995) A potassium channel mutation in weaver mice implicate s membrane excitability in granule cell differentiation. Nat G enet 11: 126-129. Pfaffinger PJ, Martin JM, Hunter DD, Nathanson NM, and Hille B (1985) GTPbinding proteins couple cardiac muscarinic receptor s to a K channel. Nature 317: 536-8. Ponce A, Bueno E, Kentros C, Vega-Saenz de Miera E, Chow A, Hillman D, Chen S, Zhu L, Wu M, Wu X, Rudy B, and Thornhill W (1996) G-proteingated inward rectifier K+ channel proteins (GIRK1) are present in the soma and dendrites as well as in nerve terminals of specific neurons in the brain. J. Neurosci. 16: 1990-2001. Qanbar R, and Bouvier M (2003) Role of palmitoylati on/depalmitoylation reactions in G-protein-coupled receptor function. P harmacol Ther 97: 1-33. Raymond JR, Olsen CL, and Gettys TW (1993) Cell-spe cific physical and functional coupling of human 5-HT1A receptors to in hibitory G protein alpha-subunits and lack of coupling to Gs alpha. Bi ochemistry 32: 1106473.

PAGE 133

122 Reif K, and Cyster JG (2000) RGS molecule expressio n in murine B lymphocytes and ability to down-regulate chemotaxis to lymphoid chemokines. J Immunol 164: 4720-9. Riddle EL, Schwartzman RA, Bond M, and Insel PA (20 05) Multi-tasking RGS proteins in the heart: the next therapeutic target? Circ Res 96: 401-11. Ross EM, and Wilkie TM (2000) GTPase-activating pro teins for heterotrimeric G proteins: regulators of G protein signaling (RGS) a nd RGS-like proteins. Annu Rev Biochem 69: 795-827. Roy AA, Lemberg KE, and Chidiac P (2003) Recruitmen t of RGS2 and RGS4 to the plasma membrane by G proteins and receptors ref lects functional interactions. Mol Pharmacol 64: 587-93. Sadja R, Alagem N, and Reuveny E (2003) Gating of G IRK Channels: Details of an Intricate, Membrane-Delimited Signaling Complex. Neuron 39: 9-12. Saitoh O, Kubo Y, Miyatani Y, Asano T, and Nakata H (1997) RGS8 accelerates G-protein-mediated modulation of K+ currents. Natur e 390: 525-9. Saitoh O, Masuho I, Terakawa I, Nomoto S, Asano T, and Kubo Y (2001) Regulator of G protein signaling 8 (RGS8) requires its NH2 terminus for subcellular localization and acute desensitization of G protein-gated K+ channels. J Biol Chem 276: 5052-8. Saitoh O, Murata Y, Odagiri M, Itoh M, Itoh H, Misa ka T, and Kubo Y (2002) Alternative splicing of RGS8 gene determines inhibi tory function of receptor type-specific Gq signaling. Proc Natl Acad Sci U S A 99: 1013843. Scheschonka A, Dessauer CW, Sinnarajah S, Chidiac P Shi CS, and Kehrl JH (2000) RGS3 is a GTPase-activating protein for g(ia lpha) and g(qalpha) and a potent inhibitor of signaling by GTPase-defic ient forms of g(qalpha) and g(11alpha). Mol Pharmacol 58: 719-28. Schonbrunn A, Steffen,D.L., (2004) The Endogenous G PCR List: http://www.tumor-gene.org/GPCR/gpcr.html Shea L, and Linderman JJ (1997) Mechanistic model o f G-protein signal transduction. Determinants of efficacy and effect o f precoupled receptors. Biochem Pharmacol 53: 519-30.

PAGE 134

123 Sierra DA, Gilbert DJ, Householder D, Grishin NV, Y u K, Ukidwe P, Barker SA, He W, Wensel TG, Otero G, Brown G, Copeland NG, Jen kins NA, and Wilkie TM (2002) Evolution of the regulators of G-p rotein signaling multigene family in mouse and human. Genomics 79: 177-85. Signorini S, Liao YJ, Duncan SA, Jan LY, and Stoffe l M (1997) Normal cerebellar development but susceptibility to seizures in mice lacking G proteincoupled, inwardly rectifying K+ channel GIRK2. Proc Natl Acad Sci U S A 94: 923-7. Slesinger PA, and Lansman JB (1991) Inactivation of calcium currents in granule cells cultured from mouse cerebellum. J Physiol 435: 101-21. Slesinger PA, Patil N, Liao YJ, Jan YN, Jan LY, and Cox DR (1996) Functional effects of the mouse weaver mutation on G protein-g ated inwardly rectifying K+ channels. Neuron 16: 321-31. Slessareva JE, Ma H, Depree KM, Flood LA, Bae H, Ca brera-Vera TM, Hamm HE, and Graber SG (2003) Closely related G-proteincoupled receptors use multiple and distinct domains on G-protein alph a-subunits for selective coupling. J Biol Chem 278: 50530-6. Sodickson DL, and Bean BP (1996) GABAB receptor-act ivated inwardly rectifying potassium current in dissociated hippoca mpal CA3 neurons. J Neurosci 16: 6374-85. Srinivasa SP, Bernstein LS, Blumer KJ, and Linder M E (1998) Plasma membrane localization is required for RGS4 function in Saccharomyces cerevisiae. PNAS 95: 5584-5589. Stanfield PR, Nakajima S, and Nakajima Y (2002) Con stitutively active and Gprotein coupled inward rectifier K+ channels: Kir2. 0 and Kir3.0. Rev Physiol Biochem Pharmacol 145: 47-179. Surmeier DJ, Mermelstein PG, and Goldowitz D (1996) The weaver mutation of GIRK2 results in a loss of inwardly rectifying K+ c urrent in cerebellar granule cells. PNAS 93: 11191-11195. Takano K, Yasufuku-Takano J, Kozasa T, Nakajima S, and Nakajima Y (1997) Different G proteins mediate somatostatin-induced i nward rectifier K+ currents in murine brain and endocrine cells. J Phy siol 502 ( Pt 3): 559-67.

PAGE 135

124 Takesono A, Zahner J, Blumer KJ, Nagao T, and Kuros e H (1999) Negative regulation of alpha2-adrenergic receptor-mediated G i signalling by a novel pathway. Biochem J 343 Pt 1: 77-85. Taymans JM, Leysen JE, and Langlois X (2003) Striat al gene expression of RGS2 and RGS4 is specifically mediated by dopamine D1 and D2 receptors: clues for RGS2 and RGS4 functions. J Neu rochem 84: 1118-27. Tesmer JJ, Berman DM, Gilman AG, and Sprang SR (199 7) Structure of RGS4 bound to AlF4--activated G(i alpha1): stabilization of the transition state for GTP hydrolysis. Cell 89: 251-61. Tosetti P, Pathak N, Jacob MH, and Dunlap K (2003) RGS3 mediates a calciumdependent termination of G protein signaling in sen sory neurons. Proc Natl Acad Sci U S A 100: 7337-42. Tu Y, Popov S, Slaughter C, and Ross EM (1999) Palm itoylation of a conserved cysteine in the regulator of G protein signaling (R GS) domain modulates the GTPase-activating activity of RGS4 and RGS10. J Biol Chem 274: 38260-7. Tu Y, Woodson J, and Ross EM (2001) Binding of regu lator of G protein signaling (RGS) proteins to phospholipid bilayers. Contribution of location and/or orientation to Gtpase-activating protein act ivity. J Biol Chem 276: 20160-6. van Koppen CJ, and Nathanson NM (1990) Site-directe d mutagenesis of the m2 muscarinic acetylcholine receptor. Analysis of the role of N-glycosylation in receptor expression and function. J Biol Chem 265: 20887-92. Vries LD, Mousli M, Wurmser A, and Farquhar MG (199 5) GAIP, a Protein that Specifically Interacts with the Trimeric G Protein G{alpha}i3, is a Member of a Protein Family with a Highly Conserved Core Do main. PNAS 92: 11916-11920. Wang Q, Liu M, Mullah B, Siderovski DP, and Neubig RR (2002) Receptorselective effects of endogenous RGS3 and RGS5 to re gulate mitogenactivated protein kinase activation in rat vascular smooth muscle cells. J Biol Chem 277: 24949-58. Watson N, Linder ME, Druey KM, Kehrl JH, and Blumer KJ (1996) RGS family members: GTPase-activating proteins for heterotrime ric G-protein alphasubunits. Nature 383: 172-5.

PAGE 136

125 Wei J, Hodes ME, Piva R, Feng Y, Wang Y, Ghetti B, and Dlouhy SR (1998) Characterization of MurineGirk2Transcript Isoforms: Structure and Differential Expression. Genomics 51: 379-390. Wess J (1997) G-protein-coupled receptors: molecula r mechanisms involved in receptor activation and selectivity of G-protein re cognition. Faseb J 11: 346-54. Wess J (1998) Molecular basis of receptor/G-protein -coupling selectivity. Pharmacol Ther 80: 231-64. Xu X, Zeng W, Popov S, Berman DM, Davignon I, Yu K, Yowe D, Offermanns S, Muallem S, and Wilkie TM (1999) RGS proteins determ ine signaling specificity of Gq-coupled receptors. J Biol Chem 274: 3549-56. Yamada M, Inanobe A, and Kurachi Y (1998) G protein regulation of potassium ion channels. Pharmacol Rev 50: 723-60. Zeng W, Xu X, Popov S, Mukhopadhyay S, Chidiac P, S wistok J, Danho W, Yagaloff KA, Fisher SL, Ross EM, Muallem S, and Wil kie TM (1998) The N-terminal domain of RGS4 confers receptor-selectiv e inhibition of G protein signaling. J Biol Chem 273: 34687-90. Zhang Q, Pacheco MA, and Doupnik CA (2002) Gating p roperties of GIRK channels activated by Galpha(o)and Galpha(i)-coup led muscarinic m2 receptors in Xenopus oocytes: the role of receptor precoupling in RGS modulation. J Physiol 545: 355-73. Zhang Y, Ji H, Elena Fabucci M, Falconetti C, Zheng W, and Sandberg K (2004) Translational control of the rat angiotensin type 1 a receptor by alternative splicing. Gene 341: 93-100. Zhong H, and Neubig RR (2001) Regulator of G protei n signaling proteins: novel multifunctional drug targets. J Pharmacol Exp Ther 297: 837-45.

PAGE 137

ABOUT THE AUTHOR Cristina Jan received her bachelor degree of Scien ce from the Universitat de Barcelona, Barcelona, Spain in 1996. She was a visi ting scholar for one year in the Department of Allergy and Immunology at the Uni versity of South Florida, Tampa, prior to her acceptance as a graduate studen t in the Department of Physiology and Biophysics. She was elected to membe rship in Phi Kappa Phi honor society, and in 2002 she received a M.S. degr ee in Medical Sciences while in the Ph.D. program. As part of her dissertation, she has authored several publications: C. Jan and C. Doupnik. Neuronal Kir3.1/Kir3.2a channels c oupled to serotonin 1A and muscarinic m2 receptors are dif ferentially modulated by the ‘short’ RGS3 isoform. Neuropharmacology,. 2005 Sep;49(4):465-76 C. Doupnik, C. Jan, Q. Zhang. Measuring the modulatory effects of regulators of G protein signaling on G protein-g ated potassium channels. Methods in Enzymology 389:131-154, 2004. C. Jan and C. Doupnik. RGS4 directly associates with mult iple GPCR-Kir3 channel signaling complexes (submitted)


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001956554
003 fts
005 20070626150751.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 070626s2006 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001533
040
FHM
c FHM
035
(OCoLC)145601651
049
FHMM
090
QP34.5 (ONLINE)
1 100
Jan, Cristina.
0 245
Differential coupling of RGS3s and RGS4 to GPCR-GIRK channel signaling complexes
h [electronic resource] /
by Cristina Jan.
260
[Tampa, Fla] :
b University of South Florida,
2006.
3 520
ABSTRACT: 'Regulators of G protein signaling' (RGS proteins) modulate the G proteincycle by enhancing the GTPase activity of Ga subunits. These changesaccelerate the kinetics of ion channel modulation by Gai/o-coupled receptors(GPCRs) such as the G protein-gated inward rectifier K+ (GIRK/Kir3) channel. Myexperiments indicate that a single cerebellar granule (CG) neuron, a cell type thatendogenously expresses GIRK channels is able to express a wide variety ofRGS proteins. I selected two of them, which are widely expressed andtranscriptionally regulated during pathophysiologic conditions, to compare theirfunctional properties. I originally described the differential modulatory effects oftwo RGS proteins, the RGS3 short isoform (RGS3s) and RGS4, on muscarinicm2 and serotonin 1A receptor-coupled Kir3.1/Kir3.2a channels expressed inChinese hamster ovary (CHO-K1) cells. Both RGS3s and RGS4 acceleratedGIRK activation and deactivation current kinetics in a similar way. However, onlyRGS3s si gnificantly decreased the maximal GIRK current (Imax) elicited by ACh(~45% inhibition) and significantly increased the EC50 for both GPCRs. Thehypothesis that emerged from this initial study was that the distinct RGS4 Nterminaldomain mediated a direct coupling of RGS4 to GPCR-GIRK channelsignaling complexes that was not shared by RGS3s. To test this hypothesis, Iepitope-tagged several GPCRs, the Kir3.1 subunit, RGS3s, RGS4, and severaldeletion mutants and chimeras for co-immunoprecipitation experiments. Using anepitope-tagged degradation resistant RGS4 mutant RGS4(C2V), I detected coprecipitationof different GPCR-GIRK channel complexes with RGS4 but notRGS3s.The functional impact of RGS4 coupling to the GPCR-Kir3 channelcomplex versus uncoupled RGS3s was not apparent in recordings from CHO-K1cells presumably due to a high degree of RGS collision-coupling. Controlledexpression in Xenopus oocytes revealed a 30-fold greater potency for RGS4 inthe accelerating GIRK channel gating kinetics. In summary, these findings demonstrate that one of the ways for the cellto achieve signaling pathway specificity may be through selective coupling of thedifferent GPCR-effector-RGS protein complexes.
502
Dissertation (Ph.D.)--University of South Florida, 2006.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 125 pages.
Includes vita.
590
Adviser: Craig A. Doupnik, Ph.D.
653
Kir3.
Transfection.
Cho-k1 cells.
Precoupling.
Signaling pathway.
690
Dissertations, Academic
z USF
x Physiology and Biophysics
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1533