USF Libraries
USF Digital Collections

Endothelial cell mediators of angiogenesis in Bartonella henselae infection

MISSING IMAGE

Material Information

Title:
Endothelial cell mediators of angiogenesis in Bartonella henselae infection
Physical Description:
Book
Language:
English
Creator:
McCord, Amy M
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Cat scratch disease
Bartonellosis
Bacillary angiomatosis
Apoptosis
Chemokines
CXCL8
MCP-1
Dissertations, Academic -- Medical Microbiology -- Doctoral -- USF
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Bacillary angiomatosis (BA), one of the clinical manifestations resulting from infection with the facultative intracellular bacterium Bartonella henselae, is characterized by angiogenic lesions. Endothelial cells have been identified as host cells for this pathogen and are presumed important for pathogenesis as lesions contain bacteria in direct contact with the endothelium. Lesions also contain infiltrating macrophages, which contribute to the angiogenic process during B. henselae infection by secreting vascular endothelial growth factor (VEGF). While virulence factors have been characterized, and the role for macrophages in B. henselae infection has been established, endothelial cell mediators of angiogenesis have not been well defined. We investigated three potentially important pathways that are triggered by the bacterial interactions with endothelial cells. We examined the ability of endothelial cells to upregulate the chemokines monocyte-macrophage chemoattracta nt protein-1 (MCP-1) and CXCL8 and the mechanism by which B. henselae secreted proteins (BHSP) induce endothelial cell proliferation. We determined that MCP-1 production is upregulated in response to B. henselae infection, which very likely contributes to angiogenic lesion formation by recruiting the VEGF-secreting macrophage. The chemokine CXCL8 is an important mediator of angiogenesis which can cause endothelial cell survival, proliferation, and capillary tube formation. We determined that CXCL8 is secreted from B. henselae-infected cells and contributes to B. henselae-induced angiogenesis in an autocrine manner. We also investigated the role of Ca2+ signaling during B. henselae infection. We determined that BHSP induce a robust intracellular Ca2+ response in HUVEC which originates from intracellular Ca2+ pools. Additionally, endothelial cell proliferation in response to BHSP required Ca2+ activity, indicating a role for intracellular Ca2+ pools during B. henselae-induced angio genesis. Endothelial cell proliferation during B. henselae infection possibly indicates a mechanism by which a pathogen induces proliferation of its host cell in order to propagate its own survival. Numerous factors culminate in the vascular lesions that are characteristic of BA. B. henselae infection represents an important and unique model for pathogen-triggered angiogenesis, and studies into the specific mechanisms of this process may elucidate host cell-pathogen interactions as well as pathways of pathogenic angiogenesis.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2006.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Amy M. McCord.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 84 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001909879
oclc - 173225675
usfldc doi - E14-SFE0001675
usfldc handle - e14.1675
System ID:
SFS0025993:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Endothelial Cell Mediator s of Angiogenesis in Bartonella henselae Infection by Amy M. McCord A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Medicine Department of Medical Microbiology College of Medicine University of South Florida Major Professor: Burt Anderson, Ph.D. Thomas Klein, Ph.D. Jonathan Harton, Ph.D. Srikumar Chellappan, Ph.D. Jane Koehler, M.D. Date of Approval: July 7, 2006 Keywords: cat scratch disease, bartonello sis, bacillary angiomatosis, apoptosis, chemokines, CXCL8, MCP-1 Copyright 2006, Amy McCord

PAGE 2

i Table of Contents List of Figures................................................................................................................ ......v Abstract....................................................................................................................... ......vii Introduction................................................................................................................... .......1 Bartonella Species and Human Disease..........................................................................1 Bartonella henselae .........................................................................................................3 Diseases Caused by Bartonella henselae ......................................................................3 B. henselae Pathogenesis.................................................................................................4 B. henselae -Induced Pro-Inflammatory Activation.................................................4 B. henselae -Induced Endothelial Cell Survival and Proliferation...........................5 Paracrine Effectors During B. henselae -Induced Angiogenesis..............................6 B. henselae Virulence Factors..............................................................................................6 TFSS........................................................................................................................8 Outer Membrane Proteins (OMPs) .......................................................................10 Bartonella Adhesin A (BadA)...............................................................................10 Lipopolysaccharide (LPS) ....................................................................................11 GroEL....................................................................................................................11 Angiogenesis................................................................................................................... ...12 Overview................................................................................................................12 Chemokines – MCP-1............................................................................................13

PAGE 3

ii Chemokines – CXCL8...........................................................................................13 Ca2+ Signaling........................................................................................................13 B. henselae and Angiogenesis............................................................................................14 Objectives..................................................................................................................... .....16 Materials and Methods.......................................................................................................18 Bacterial Strains.....................................................................................................18 Cell Lines...............................................................................................................18 HMEC-1 Infections................................................................................................19 Infections for CXCL8 ELISA................................................................................20 CXCL8 ELISA.......................................................................................................20 LPS and TLR Inhibition Assays............................................................................21 Semiquantitative RT-PCR –mcp1..........................................................................22 RNA Extraction and Reverse Transcription..........................................................23 Real-Time PCR...................................................................................................... 23 Semiquantitative RT-PCR – cxcr1 cxcr2 ...............................................................24 MCP-1 ELISA.......................................................................................................25 Isolation of B. henselae LPS..................................................................................25 Enrichment of Outer Membrane Proteins from B. henselae and Fractionation by Molecular Weight.......................................................................25 HUVEC Proliferation Assay..................................................................................26 Chemotaxis of THP-1 Monocytes.........................................................................27 In vitro Capillary Tube Formation Assay..............................................................28 Generation of B. henselae Secreted Proteins (BHSP)...........................................28

PAGE 4

iii Western Blotting....................................................................................................29 Proliferation Assays with BHSP............................................................................29 Measurement of CXCL8 Levels from BHSP-Treated HUVEC............................30 Ca2+ Imaging..........................................................................................................30 Ca2+ Inhibitors........................................................................................................31 Statistics.................................................................................................................32 Results........................................................................................................................ ........33 Induction of MCP-1 Gene Expre ssion and Protein Production.............................33 Induction of MCP-1 Gene Expressi on and Protein Production is Independent of B. henselae LPS and Endothelial Cell TLR4............................35 MCP-1 Production Requires NF B Activation.....................................................37 Low Molecular Weight Outer Membrane Proteins (OMP-1) from B. henselae Induce MCP-1 Production in HMEC-1..........................................37 Supernatants from B. henselae -Infected HMEC-1 Induce Chemotaxis of THP-1 Monocytes.....................................................................38 CXCL8 Production from a Variety of Cell Types Infected with B. henselae .........................................................................................................41 Effect of Blocking CXCL8 on B. henselae -Induced Endothelial Cell Proliferation................................................................................................43 Role of CXCL8 in B. henselae -Induced Endothelial Cell Survival.......................46 Role of CXCL8 in B. henselae -Induced Capillary Tube Formation.....................48 B. henselae Secreted Proteins (BHSP) Contain GROEL and BadA.....................48 BHSP Induce a Proliferative Response in HUVEC. ............................................51

PAGE 5

iv BHSP Induce an Intracellular Ca2+ Response in HUVEC.....................................51 BHSP Induce an Intracellular Ca2+ Response in HUVEC from Intracellular Stores...................................................................................54 BHSP-Induced HUVEC Pro liferation Requires Ca2+............................................54 BHSP Induce CXCL8 Production from HUVEC..................................................57 Discussion..................................................................................................................... .....59 Literature Cited............................................................................................................... ...71 Presentation of Studies.......................................................................................................8 3 About the Author...............................................................................................END PAGE

PAGE 6

v List of Figures Figure 1. Comparison of parsimony tree (l eft side) and neighbor-joining tree (r ight side) derived from complete ITS sequences for recognized Bartonella species (type strains).................................................................................................... ...........2 Figure 2. Model of paracrine and autocrine mechanisms of B. henselae -mediated angiogenesis................................................................................................... ......7 Figure 3. Structure of TFSS apparatus of B. henselae .......................................................9 Figure 4. B. henselae stimulated MCP-1 induction in HMEC-1......................................34 Figure 5. MCP-1 production dur ing inhibition assays......................................................36 Figure 6. MCP-1 production in re sponse to OMP fraction 1............................................39 Figure 7. THP-1 monocyte chemotaxis in response to supernatants from B. henselae -infected HMEC..............................................................................42 Figure 8. B. henselae -induced CXCL8 producti on assayed by ELISA.............................44 Figure 9. CXCR2 expression in HUVEC.........................................................................39 Figure 10. Effect of CXCL8 on HUVEC proliferation in response to B. henselae ...........45 Figure 11. Effect of anti-CXCL8 on i nhibition of HUVEC apoptosis induced by B. henselae ...........................................................................................................47 Figure 12. Effect of anti-CXCL8 on B. henselae -induced capillary formation in a GFR matrigel.................................................................................................... .......49

PAGE 7

vi Figure 13. B. henselae secreted proteins (BHSP) contain BadA and GROEL.................50 Figure 14. BHSP cause HUVEC proliferation.................................................................52 Figure 15. BHSP cause a Ca2+ rise in HUVEC................................................................53 Figure 16. BHSP cause a Ca2+ rise in HUVEC from intracellular stores..........................55 Figure 17. Ca2+ signaling is important for BHSP-mediated HUVEC proliferation.........56 Figure 18. BHSP induce CXCL8 production from HUVEC............................................58 Figure 19. Endothelial cell mediat ors of angiogenesis during B. henselae infection.......61

PAGE 8

vii Endothelial Cell Mediator s of Angiogenesis in Bartonella henselae Infection Amy M. McCord ABSTRACT Bacillary angiomatosis (BA) one of the clinical mani festations resulting from infection with the facultative intracellular bacterium Bartonella henselae is characterized by angiogenic lesions. Endothelial cells have been identified as host cells for this pathogen and are presumed important for path ogenesis as lesions contain bacteria in direct contact with the endothelium. Lesi ons also contain infiltrating macrophages, which contribute to the angiogenic process during B. henselae infection by secreting vascular endothelial growth factor (VEG F). While virulence factors have been characterized, and the role for macrophages in B. henselae infection has been established, endothelial cell mediators of a ngiogenesis have not been well defined. We investigated three potentially important pathways that are triggered by the bacterial interactions with endothelial cells. We examined the ability of endothelial cells to upregulate the chemokines monocyte-macrophage chemoattract ant protein-1 (MCP-1) and CXCL8 and the mechanism by which B. henselae secreted proteins (BHSP) induce endothelial cell proliferation. We determined that MCP1 production is upregulated in response to B. henselae infection, which very likely contri butes to angiogenic lesion formation by recruiting the VEGF-secreting macrophage. The chemokine CXCL8 is an important mediator of angiogenesis which can cause e ndothelial cell survival proliferation, and

PAGE 9

viii capillary tube formation. We determ ined that CXCL8 is secreted from B. henselae infected cells and contributes to B. henselae -induced angiogenesis in an autocrine manner. We also invest igated the role of Ca2+ signaling during B. henselae infection. We determined that BHSP i nduce a robust in tracellular Ca2+ response in HUVEC which originates from intracellular Ca2+ pools. Additionally, endo thelial cell proliferation in response to BHSP required Ca2+ activity, indicating a role for intracellular Ca2+ pools during B. henselae -induced angiogenesis. Endothe lial cell proliferation during B. henselae infection possibly indi cates a mechanism by which a pathogen induces proliferation of its host cell in order to pr opagate its own survival. Numerous factors culminate in the vascular lesions that are characteristic of BA. B. henselae infection represents an important and unique model for pathogen-triggered angiogenesis, and studies into the specific mechanisms of th is process may elucidate host cell-pathogen interactions as well as pathwa ys of pathogenic angiogenesis.

PAGE 10

1 Introduction Bartonella Species and Human Disease Bartonellae are short, pleomorphic, gr am negative rods which are fastidious, aerobic, oxidase negative organisms (4). They are classified within the 2 subgroup of the class proteobacteria. The single genus Bartonella was created by merging B. bacilliformis and the genus Rochalimaea (13). There are currently 16 Bartonella spp identified. Figure 1 shows a parsimony tree for Bartonella species derived from 16s rRNA sequences (37). Bartonella spp cause a chronic intraerythrocytic bacteremia in reservoir hosts and are transmitted by arthropod vectors during feeding. Bartonella can cause an asymptomatic bacteremia. B. quintana B. bacilliformis B. elizabethae B. grahamii B. vinsonii subsp. berkhoffii, B. vinsonii subsp. arupensis, B. henselae and B. clarridgeiae cause human disease. B. qunitana causes trench fever, a recurrent fever transmitted by human body lice, bacteremia, and bacillary angiomatosis (BA). B. bacilliformis causes Carrion’s disease and Orroya fever with chronic verrugae. B. henselae causes cat scratch di sease (CSD) and BA. B. quintana B. henselae B. elizabethae B. vinsonii subsp. berkhoffii, and B. vinsonii subsp. arupensis have been associated with endocarditis, usually in pati ents previously diagnosed with valvulopathy (31).

PAGE 11

2 Figure 1 Comparison of parsimony tree (lef t side) and neighbor-joining tree (right side) derived from comple te ITS sequences for recognized Bartonella species (type strains) The support of each branch, as determined from 100 bootstrap samples, is indicated by the va lue at the node. The lengths of vertical lines are not significant. For the parsimony tree, the lengths of horizontal lines are also not significant. For the neighbor-j oining tree, the scale bar represents evolutionary distance as cal culated by using the Kimura two-parameter distance calculation. (37).

PAGE 12

3 Bartonella henselae B. henselae are gram-negative bacilli that di splay twitching motility. The genome size is around 1.9 X 106 bp (3). There are two phases of B. henselae in culture: the rough and smooth forms. The “rough” bacteria expr ess a pilus-like stru cture that has been recently characterized as Bartonella adhesion A (BadA, see Virulence factors ). The presence of pili correlates with more effici ent attachment to host cells (4). The “rough” forms autoagglutinate, pit c hocolate agar, and display a dr y colony morphology (9). In contrast, the phase variation to “smooth” B. henselae which correlates with increased passage number, is characterized by mucoi d, non-pitting colonies, no auto-agglutination, and fewer pili (9). Diseases Caused by Bartonella henselae B. henselae is a flea-borne pathogen of cat s and humans. Blood donors in the USA and Australia exhibit a 3-6% seroprevalence for B. henselae (12, 19, 29, 39, 47). Two manifestations of B. henselae infection include CSD and BA CSD is a usually selflimiting lymphadenitis. While the lymph nodes usually regress after a period of weeks or months, in 10% of patients the lymphadeniti s may become suppurative. Additionally, rash, hepatosplenomegaly, lytic bone lesions, and deep lymphadenitis may also occur. The vasoproliferative diseases BA and baci llary peliosis (BP) o ccur preferentially in immunocompromised patients. BA may occur with either B. henselae or B. quintana infections; however, BP is associated only with B. henselae (48). BA is a proliferative disorder of the vascular endothe lium resulting in the formati on of tumorous lesions on the skin (BA) and internal organs (BP) (86).

PAGE 13

4 B. henselae Pathogenesis Bartonella spp .are unique among bacteria fo r causing angioproliferation. Endothelial cells appear to be important during BA and BP as the lesions contain bacteria in direct contact with the endothelium. Hist ological examination of BA lesions has also revealed infiltration by polymorphonuc lear leukocytes and macrophages. B. henselae pathogenesis can be divided into the effect s of pro-inflammatory activation in the endothelial cell, autocrine prom otion of proliferation in endo thelial cells, inhibition of endothelial cell apoptosis, stimulation of endothelial cell proliferation, and paracrine effects from infection of macr ophages and epithelial cells. B. henselae-Induced Pro-Inflammatory Activation NF B is a target for pathogens that eith er promote or inhibit inflammation. NF B activation in endothelial cells is char acterized by surface expression of adhesion molecules such as E-selectin and intrace llular adhesion molecule-1 (ICAM-1) and the release of Interleukin-8 (CXCL8, CXCL8). During B. henselae infection of endothelial cells, endothelial cell adhesion mo lecules are upregulated and NF B is activated (32). ICAM-1 expression is also upr egulated on HUVEC in response to infection (60). While many pathogens induce inflammation, only Bartonella spp possess the ability to cause vasoproliferation. The role of the inflammatory response in B. henselae pathogenesis is not well understood; however, th e bacteria may utilize this mechanism to attract key regulators of angiogenesis such as macrophage s to the sites of in fection, which secrete pro-angiogenic molecules and growth factors.

PAGE 14

5 B. henselae -Induced Endothelial Cell Survival and Proliferation Proliferation of endothelial cells is an important st ep during angiogenesis. B. henselae causes proliferation and mi gration of endothelial cells in vitro (20). B. henselae also causes enhanced survival of endothelial cells through inhibition of apoptosis. This mechanism consists of an inhibition of caspases 3 and 8 (43). Some aspects of B. henselae -induced endothelial cell pro liferation are controversia l and poorly defined. For example, some argue that direct contact with the bacterium is needed for proliferation, since the angiogenic factor of B. henselae was localized to the particulate fraction of the bacterium (20). Other studies revealed that di rect contact is not needed for stimulation of endothelial cell proliferation, as the endothelial cells will pro liferate if they are separated from the bacteria by a membrane (59). Anothe r hypothesis is that th e paracrine effect of macrophages is needed for prolifer ation. When supernatants from B. henselae -infected macrophages are added to endothelial cells, the ce lls proliferate at a hi gher rate than cells incubated with uninfected macrophage supernatan ts (71). These data revealed a role for the macrophage during infection as the macr ophage produced potent endothelial growth factors in response to B. henselae infection. The effect of i nhibition of apoptosis versus actual cell proliferation has also been debate d (43, 77). These differences may be due to different passages of bacteria used, differing multiplicities of infection (MOIs), and different phases of the bacteria. Despite th e presence of many conflicting ideas, B. henselae causes angiogenesis through the culmination of a multitude of factors.

PAGE 15

6 Paracrine Effectors During B. henselae –Induced Angiogenesis Peripheral cells are also key regul ators of angiogenesis. During B. henselae infection, polymorphonuclear lymphocyte s and macrophages are present in the angiogenic lesions from BA (49, 50, 64). Epithelial cells as well as macrophages produce VEGF in response to infection with B. henselae (41, 71, 77), which most likely also contributes to vasc ular proliferation during B. henselae infection. CXCL8 is also produced by B. henselae -infected epithelial cells (71, 77). These paracrine factors may also play a vital role in B. henselae induced endothelial ce ll proliferation and angiogenesis. A model of autocrine and pa racrine effects on endot helial cells during B. henselae infection, which shows the relative contributions of pe ripheral and hos t cells in B. henselae -induced angiogenesis, is de picted in Figure 2 (71). B. henselae Virulence Factors The recent sequencing of the B. henselae genome has opened many new investigations into B. henselae virulence factors. While ear lier investigations identified some putative virulence factors, such as out er membrane proteins (OMPs) and secreted factors, further identification and mutagenesi s of new and important virulence factors has been facilitated recently. R ecently identified or characteri zed virulence factors include the Type IV secretion system (TFSS), li popolysaccharide (LPS), GROEL, and BadA.

PAGE 16

7 Figure 2. Model of paracrine and autocrine mechanisms of B. henselae mediated angiogenesis B. henselae is able to adhere to and invade human macrophages (mac) and induce production of VEGF. This secreted VEGF functions in a paracrine manner and acts as an endothelial cell mitogens when it binds to its receptors on endothelial cells. Infection of endothelia l cells (EC) with B. henselae may serve to further enhance proliferation by NF B activation through upregulation of adhesion molecules such as E-selectin and ICAM-1. Also, chemokines may be produced upon endotheli al cell infection which would attract macrophages leading to enhanced growth factor signaling. In addition, caspases are inhibited in infected endothelial cells leading to enhanced endothelial cell survival (Resto-Ruiz et.al., 2002).

PAGE 17

8 TFSS TFSS are multicomponent transport systems of gram-negative bacteria. They can mediate transfer of diverse factors, from effector protei ns to DNA. The B. henselae TFSS is encoded by the virB operon. The virB operon is induced dur ing endothelial cell infection (79). It has be en recently determined that the TFSS encoded by the virB operon mediates invasion, proinflammatory activ ation, and anti-apopto tic protection of endothelial cells (77) However, at higher MOIs (l arger than 50) the TFSS has a cytotoxic effect on the endothelial cell. Thus the proteins coded by virB are important for endothelial cell survival and invasion. This does not necessarily exclude the possibility of a factor which mediates proliferation. Recently a model of the TFSS apparatus was suggested which includes interactions between the VirB2 pilus-associated protein and VirB3 and VirB5 (Fig. 3) (81). Recently, the proteins which are tran slocated by the TFSS machinery were identified as Bartonella effector proteins (Beps) A-G (80). Also, the VirD4 TFSS coupling protein was identified. BepD is tr anslocated into HUVECs in a VirB/VirD4 dependent manner. The e ndothelial cell re sponse to B. henselae with a deletion of the virB4 includes a decrease in NF B activation, endothelial cell survival, and bacterial invasion (77). B. henselae with deletions of bepA-G or virD4 induced an endothelial response similar to that elicited from the endothelial cells infected with the virB4 deletion mutant (80).

PAGE 18

9 Figure 3. Structure of TFSS apparatus of B. henselae The proteins coded by the virB operon of B. henselae are thought to assemble as depicted here. VirB2 is thought to be the main conduit through wh ich proteins are transported, which is driven by the VirB11 ATPase. VirB4 binds to itself as well as VirB10. VirB10 interacts with both VirB8 and VirB9. VirB5 and VirB3 exhibit the strongest interaction (Shamaei-Tousi et. al., 2004).

PAGE 19

10 Outer membrane proteins (OMPs) The outer membrane of gram-negative bact eria serves as an interface between the host cell and the pathogen. B. henselae expresses a variety of outer membrane components, including lipopolysaccharide and a hemin-binding protein (HbpA), immunoreactive antigens, and a red blood cell in vasion protein (IalB) (17). OMPs of 43kDa and 66-kDa molecular masses bound HUVEC membrane components (14). B. henselae OMPs are important for pathogenesis (14, 32) and they have been implicated in an NF B-dependent proinflammatory activation of endothelial cells (32). OMPs activate HUVEC dose-dependently as measured by E-se lectin and ICAM-1 protein expression (32). They also bind HUVEC membrane proteins and may be important for bacterial adhesion and entry (14). Bartonella Adhesin A (BadA) Until recently, a putative Type IV pilus on the surface of B. henselae was presumed to exist (9). Transmission electron microscopy of B. henselae strains showed the presence of a pilus-like structure on the surface of the bacterium (9). This “pilus” mediates VEGF secretion from macrophages and host cell adhesion (41). The presence of the pili correlates with the “rough” phenotype of B. henselae Recently, when the B. henselae genome was published (3) it was clear that the gene for the putative Type IV pilus was not present. Subsequently, the pr ojections were determined to be homologous to the non-fimbrial adhesin Yersinia adhesion A (YadA) and were renamed BadA accordingly (72). Non-fimbrial adhesins are non-pillin structures which contain a connector domain, a fibrous stalk, and a C-terminus anchoring domain (69). BadA

PAGE 20

11 mediates interaction of B. henselae with extracellular matrix proteins (ECM). In addition, BadA activates an important mediat or of angiogenesis, hypoxia inducible factor (HIF-1), and elicits an anti-Ba dA immune response in mice and rabbits (72). Thus BadA is important for B. henselae infection and also may serve as a clinical marker for infection (72). Lipopolysaccharide (LPS) Although LPS is usually considered a pathogenic factor in Gram-negative bacteria, the LPS from B. henselae exhibits remarkably low endotoxicity. Bacteremic patients display no signs of septic shock. Unique components of the LPS structure include a pentaacyl Lipid A and a small inner core composed of an -(2 4)-linked Kdo disaccharide with one glucose residue attached (97). In addition, B. henselae LPS does not signal through TLR4 or TLR2 (97). This lo w endotoxicity is consistent with other intracellular bacteria such as Legionella and Chlamydia spp GroEL The heat shock response of B. henselae begins at temperatures of 37C, human body temperature. The heat shock respons e includes production of GroEL, a 60 kDa protein; GroES, a 10 kDa pr otein; and DnaK, a 70 kDa ch aperonin (35). GroEL from B. bacilliformis is mitogenic for HUVEC (63). B. henselae GroEL, although less potent, is also mitogenic for HUVEC (63). Antibodies to GroEL inhibit prolif eration of HUVEC in response to B. bacilliformis lysate. GroEL was also presen t as a secreted protein (63).

PAGE 21

12 Angiogenesis Overview Pathogenic (tumor or inflammatory) angi ogenesis provides a survival mechanism for the tissues of tumors and tumor-like lesi ons (30). Angiogenesis is a multistep process during which the vessel wall disassembles, the basement membrane is degraded by matrix metalloproteinases (MMPs), endothelial cells migrate and invade the extracellular matrix, endothelial cells proliferate, and a capillary lumen is formed. Angiogenesis requires cooperation between cells cytokines, growth factors, and matrix components. A sensitive balance between angiostatic and a ngiogenic factors must exist in order to control angiogenic activity; how ever in tumors and tumor-like lesions, this tightly regulated system is upset (36). Angiogenesis is associated with conditions that involve inflammatory cell infiltrate (34), such as cancer, papopavirus infection, and herpesvirus infection (7, 15, 28, 55, 61). Angiogenesi s and inflammation coordinate through common stimuli for endothelial cells and le ukocytes; these stimuli include chemokines. Angiogenic chemokines exert a direct effect on the endothelium and an indirect effect on angiogenic-factor expressing leukocytes (68, 88). Chemoki nes are induced by TNF or IL-1 or by interaction with bacterial pat hogens and recruit leukoc ytes to sites of inflammation.

PAGE 22

13 Chemokines – MCP-1 Monocyte-macrophage chemoattractant protein-1 (MCP-1) is a potent and specific monocyte agonist and chemoattractant (33, 96) whic h is produced by endothelial cells, smooth muscle cells, and macrophages in response to various stimuli, including LPS (93). MCP-1 stimulates chemotaxis of monocytes and macrophages to sites of inflammation (51). MCP-1 can also directly promote angiogenesis (68, 88). Thus MCP1 could play dual roles in B. henselae -induced angiogenesis by ac ting in an autocrine manner on endothelial cells to promote angi ogenesis, while recruiting macrophages, the effector cell in the model, to the site of infection. Chemokines – CXCL8 CXCL8 is a member of a family of 8 st ructurally related chemokines that have been shown to induce angiogenesis. CXCL 8 augments angiogenesis through enhanced endothelial cell survival, pr oliferation, and MMP production (52, 53). CXCL8 receptors CXCR1 and CXCR2 are widely expressed on normal and tumor cells (38, 84, 85, 95) and have been observed on endothelial cells (67, 74). These receptors also play a role in proliferation of endothe lial cells (46). Ca2+ Signaling Calcium homeostasis may regulate impor tant cellular functions including activation of signal transduc tion pathways, proliferation, invasion, and differentiation (26, 65, 75, 87). Ca2+ plays a key role during angiogenesis; however, the mechanisms involved are not fully explained (2). Depletion of intracellular pools of Ca2+ and not

PAGE 23

14 cytosolic Ca2+ levels inhibits proliferation and migration of human vascular smooth muscle cells (10, 83). In additi on, inhibition of intracellular Ca2+ pools with thapsigargin inhibits angiogenesis in the rat isol ated aorta (82). Intracellular Ca2+ pools are crucial mediators of angiogenesis. B. henselae and Angiogenesis B. henselae -induced angiogenesis is reminis cent of tumor angiogenesis. B. henselae -induced angiogenesis represents a paradigm for pathogen-triggered tumor formation (22). Recently, the steps for B. henselae -induced angiogenesis have been clarified to most likely include (i) an NF B-dependent proinflamm atory activation, (ii) inhibition of endothelial cell a poptosis, (iii) direct endothelial cell proliferation, and (iv) growth factors produced from peripheral cells. During angiogenesis, endothelial cells migr ate and proliferate, then organize into vessels. As well as promoting endothelial cell proliferation, B. henselae causes angiogenesis in vitro Kirby et. al. demonstrated that B. henselae promotes survival of endothelial cords and promotes invasion, su rvival, and differentiation in a collagen matrix (42). Thus in addition to inhibition of apoptosis and endothe lial cell proliferation, B. henselae promotes capillary tube formation. Un fortunately, no small animal model of B. henselae -induced angiogenesis has been successfully developed. Zhang et. al. developed an animal model for B. quintana infection utilizing rhesus macaques ( Macaca mulatto ) (98). This model mimics the high-titer bacteremia in humans. A small animal model would allow for functional in vivo studies with bacterial mutants, further defining the roles of virulence factors in an in vivo environment.

PAGE 24

15 B. henselae -induced angiogenesis represents a unique phenomenon in which a bacterium induces angiogenic lesions. One possible rationale for pathogen-induced angiogenesis during Bartonella infections is that the pat hogen may improv e its survival by propagation of its host cell. Vasculari zation during infection is exclusive for Bartonella spp While many bacterial virulence f actors have been characterized, the effects of these factors on the host cell are unknown. Ther e are most likely numerous factors culminating in the vasc ular lesions that are a char acteristic of BA. However, specific investigations into th e direct effect of the bacter ium on human endothelial cells may clarify pathogenic mechanisms of angiogenesis.

PAGE 25

16 Objectives B. henselae causes angiogenic lesions in the immunocompromised, a phenomenon unique to Bartonella spp These lesions contain b acteria in direct contact with the endothelium as well as inf iltrating macrophages and polymorphonuclear leukocytes. Macrophages secrete VEGF in response to B. henselae infection, thus they are thought to be quite important during in fection. However, the bacteria induce endothelial cell proliferation in the absen ce of macrophages as well, so while VEGF signaling is probably important in vivo there may also be direct stimulation of proliferation by the bacterium. Since the bacterial genome was published recently, there has been much progress in identification a nd characterization of virulence factors. However, the endothelial mechanisms contributing to angiogenesis during B. henselae infection have not been fully clarified. Th is study was developed to identify important endothelial cell mediators of angiogenesis during B. henselae infection and to identify the mechanisms involved in the upregulation of thes e factors. Investigations into endothelial cell contributions during B. henselae –induced angiogenesis may reveal the factor or factors responsible for angioprol iferation. A review of the cu rrent literature led to the following hypothesis: B. henselae causes upregulation of pro-angioge nic factors during infection of endothelial cells, which contributes to the overall pathogenesis of B. henselae

PAGE 26

17 In order to refute or suppor t this hypothesis, the followi ng objectives were formulated: 1. To determine if B. henselae upregulates macrophage ch emoattractant protein-1 production and expression in endothelial cells and the mechanism by which this occurs. 2. To determine the role of CXCL8 in B. henselaeinduced endothelial cell proliferation, survival, and capillary tube formation. 3. To determine the effect of B. henselae secreted proteins on endothelial cell proliferation.

PAGE 27

18 Materials and Methods Bacterial Strains Bartonella henselae Houston-1 (ATCC 49882) (70) strain was grown on chocolate agar prepared with heart infusion agar base (Dif co, Detroit, MI) supplemented with 1% bovine hemoglobin (Beckton Dickinson, Cockeysville, MD). Bacterial cultures were maintained at 37C and 5% CO2 and humidity to saturation. For certain experiments, bacteria were heat-killed at 100C for 30 minutes as described previously (71). Escherichia coli JM109 strain was grown in LuriaBertani broth or agar (Difco). Cell Lines The immortalized human microvascular cell line (HMEC-1) (1) was cultured in MCDB131 cell culture media (G ibco BRL, Grand Island, NY) supplemented with 10% fetal calf serum (FCS) (Hycl one Laboratories, Logan, UT), 10 ng/ml epidermal growth factor, 1.461 g/L L-glutamine, 1 g/ml hydroc ortisone, 50 g/ml penicillin-streptomycin, 2.5 g/ml amphotericin B (Sigma-Aldrich, St. Louis, MO), 2 mg/ml sodium bicarbonate, and 10 mM HEPES (Mediatech, Herndon, VA). Human THP-1 monocytes (90) were cultured in RPMI 1640 medium (Sigma-Aldri ch) supplemented with 10 % FCS, 5 M 2mercaptoethanol (Sigma-Aldrich), 10 g/ml vancomycin (Sigma-Aldrich), and 1 g/ml amphotericin B. Human umbilical vein endothelial cells (HUVEC) were obtained from

PAGE 28

19 Clonetics Corporation (San Diego, CA) and we re cultured in EGM (Clonetics). HepG2 cells were obtained from American Type Culture Collection (Manassas, VA) and were cultured in MEM containing 10% fetal calf serum, 1.5 g/L sodium bicarbonate, 0.1 mM non-essential amino acids, and 1.0 M sodium py ruvate. Cells were maintained at 37C and 5% CO2 and humidity to saturation. HUVEC were used in experiments at passages from 4 to 7. HMEC-1 Infections. Prior to infection, the culture medium c ontaining antibiotics was removed from cell cultures and replaced with media without an tibiotics or growth factors. Cells were permitted to adapt overnight. B. henselae Houston-1 were harvested from chocolate agar and suspended in cell culture media, then concentration of bacteria was determined spectrophotometrically as described previously (44). Briefly, at OD600, a reading of 0.5 correlates with 109 colony forming units (cfu)/ml. B. henselae were added to cells at the multiplicity of infection (MOI) indicated. Cells were co-cultured with Houston-1 for various timepoints. For E. coli co-cultures, JM109 were harvested into cell culture medium and added to cells at a density of 100 E. coli cells per HMEC-1, also determined spectrophotometrically. During the experi ments with longer time courses and during inhibition assays, E. coli LPS (Sigma-Aldrich) was used as a positive control for MCP-1 production in order to keep HMEC-1 alive as E. coli JM109 infection was found to be cytotoxic for HMEC-1 at later time points.

PAGE 29

20 Infections for CXCL8 ELISA. To generate supernatants for th e analysis of CXCL8 secretion, HUVEC, HepG2, HMEC-1, or THP-1were placed in to 24-well tissue culture plates (Costar, Cambridge, Mass.) at 90% confluency. THP-1 were diffe rentiated by overnight incubation with 1 M vitamin D3 (Sigma-Aldrich). Nonadherent cells were removed by washing. Cells were infected with the Houston-1 strain of B. henselae as described prev iously using the appropriate cell culture medium with no antib iotics (71). For the downstream analyses real-time PCR and capillary tube formation, th e infections and inc ubations post-infection were carried out under serum-free conditions. Ce lls were infected at indicated MOIs. CXCL8 ELISA. To determine CXCL8 levels in supernatants from B. henselae -infected cells, the DuoSet ELISA development systems (R&D Systems, Minneapolis, Minn.) for human CXCL8 was used according to the manufacturer's directions. The 3,3',5,5'tetramethylbenzidine Liquid Substrate System (Sigma-Aldrich) was added and left for 20 min. The horseradish peroxidase reaction was stopped with 2 N sulfuric acid. ELISA plates were analyzed using a Quant plate reader (B io-Tek, Winooski, VT.) at 450 nm. HUVEC proliferation assay. HUVEC were seeded in 96-well plates at 1x103 cells per well in media without antibiotics and allowed to adapt overnight. Cells were infected the following day with Houston-1 at an MOI of 50 or incubated with recombinant human CXCL8 (100 ng/ml, R&D Systems). Anti-human CXCL8 (10 g/ml) or an isotype control (mouse IgG1, 10 g/ml) were added to cell media during infections. After 72

PAGE 30

21 hours, cells were fixed and examined with an inverted microscope and digital pictures were taken with a Kodak DC290. Cells were examined for qualitative differences in number. In addition, cells were counted in 5 high -powered fields per well and averaged. LPS and TLR Inhibition Assays Polymyxin B sulfate (Sigma-Aldrich) was us ed to neutralize the bacterial LPS in some experiments. Houston-1 or E. coli JM109 or purified E. coli LPS was incubated with 30 g/ml polymyxin B sulfate for 1 hour at 37C and 5% CO2 before adding to HMEC-1. In some experiments, HMEC-1 we re preincubated with a mouse monoclonal antibody (HTA 125) specific for toll-like recep tor-4 (TLR-4) (e-Bioscience, San Diego, CA) in order to determine if TLR-4 si gnaling was required for MCP-1 production. HMEC-1 were pre-incubated with 20 g/ml anti-TLR4 for one hour at 37C with gentle shaking, then co-cultures proceeded as usual and supernatants were collected eight hours after addition of bacteria or LPS. Live E coli JM109 were cultured with HMEC-1 during some experiments in order to ensure th at the TLR4 monoclona l antibody would block activity from the LPS of live E. coli as well as from purified LPS. An isotype control (mouse IgG2a, ) (e-Bioscience) was used as a co ntrol antibody at 20 g/ml. During NF B inhibition assays, HMEC-1 were incubated with 50 M pyrrolidinedithiocarbamate (PDTC) (Sigma) or 100 M N-tosyl-L-phenylalanine (TPCK) (Sigma) for one hour at 37C with 5% CO2 before infections. Inhibitors were maintained throughout the course of the assays.

PAGE 31

22 Semiquantitative RT-PCR – mcp1 RT-PCR was performed on HM EC-1 co-cultured with B. henselae or E. coli at the indicated times after infection. Total R NA was extracted with Trizol reagent (SigmaAldrich) according to manufact urer’s protocol. Total RNA was treated with RNase-fee DNase (Ambion, Inc., Austin, TX) according to the manufacturer’s instructions. Concentration of RNA was determined spect rophotometrically using a GeneQuant II (Pharmacia Biotech, Cambridge, England). cDNA preparation and subsequent PCR amplification were carried out by a One-Step RT-PCR kit (Qiagen, Inc., Valencia, CA) in the presence of gene-specific primers and 2 g total RNA. The PCR conditions were 1 min at 95C, 1 min at 58C, and I min at 72 C for 35 cycles. Primer sequences for RTPCR were as follows: -actin forward 5’-AGAAAATCTGGCACCACACC-3’; -actin reverse: 5’-CCATCTCTTGCTCG AAGTCC-3’; MCP-1 forward 5’TTCTCAAACTGAAGCTCGCACTCTCGCC3’; MCP-1 reverse: 5’TGTGGAGTGAGTGTTCAAGTCTTG GGAGTT-3’. PCR products were analyzed by electrophoresis through 2% agar ose gels and were visua lized by ethidium bromide staining. Amplicon sizes were 434 bp and 348 bp for -actin and MCP-1 primers, respectively. RT-PCR data were analyzed by scanning densitometry of gel bands with Kodak 1D Image Analysis software and normalizing to -actin signals obtained from the same time points. RT-PCR reactions includ ed a no template control and a no reverse transcriptase control to excl ude DNA or RNA contamination.

PAGE 32

23 RNA Extraction and Reverse Transcription. Cells were infected at an MOI of 100 with Houston-1 or incubated with 100 ng/ml rCXCL8. 10 g/ml anti-CXCL8 or an isotype c ontrol was added at the time of infection. After 24 hours, total RNA was extracted fr om HUVEC using TRIzol reagent (SigmaAldrich) according to manufact urer’s protocol. Turbo DNA-free (Ambion, Austin, TX) was used to remove remaining DNA accord ing to manufacturer’s protocol. Two micrograms of total RNA were transcribed with AMV reverse transcriptase (Promega, Madison, WI) and used for real-time PCR or semi-quantitative RT-PCR. Real-Time PCR. Primers used for real-time PCR were as follows: -actin forward 5 ACCAACTGGGACGACATGGAGAAA3 -actin reverse 5 -TAGCACAGCCTGG ATAGCAACGTA-3 ; Bax forward 5 -TCTACTTTGCCAGCAAACTGGTGC-3 Bax reverse 5 -TGTCCAGCCCATGATGGTTCTGAT-3 ; Bcl-2 forward 5 -ATTTCCTGCA TCTCATGCCAAGGG-3 Bcl-2 reverse 5 -TGTGCTTTGCATTCTTGGACGAGG-3 -actin was used as the housekeeping gene cont rol. Real-time PCR was performed with a Bio-Rad iQ iCycler Detection System (Bio-R ad Laboratories, Ltd.) with iQSYBR Green supermix (Bio-Rad Laboratories, Inc., Hercul es, CA). Reactions were performed in a total volume of 25 l with 400 nM concentrations of primers. Reactions consisted of 10 minutes at 95C, 45 cycles of 15 s at 95C, 15s at 58C, and 30 s at 72C. Melt curve analysis was used to determine PCR specifi city. Melt curve analysis was run with 80 cycles of 10 s at 55C with each cycle raising 0.5C. All reactions we re carried out in at

PAGE 33

24 least duplicate for each sample. The standa rd curve method was used to determine amounts of each transcript. Relative expr ession of Bcl-2 or Bax was determined by dividing amount (ng) of Ba x or Bcl-2 by amount of -actin in each sample. Relative induction was determined by normalizing th e relative expression of the uninfected control samples to 1. All experiments include d no template controls and untranscribed (noRT) RNA controls. Semiquantitative RT-PCR – cxcr1 cxcr2 Reverse transcription-PCR (RT-PCR) was performed on HUVEC 24 hours after infection. Total RNA was extracted as descri bed above. cDNA preparation and subsequent PCR amplification we re carried out with a One-Step RT-PCR kit (QIAGEN, Inc., Valencia, CA) in the presence of gene-specific primers and 2 g total RNA. The PCR conditions were 1 min at 95C, 1 min at 58 C, and 1 min at 72C for 35 cycles. Primer sequences for RT-PCR were as follows: for -actin forward, 5'-AGAAAA TCTGGCACCACACC-3'; for -actin reverse, 5'-CCATCTCTTGCTCGAAGTCC-3'; for CXCR2 forward, 5'-ATTCTGGGCATCCTTCACAG-3'; and for CXCR2 reverse, 5'TGCACTTAGGCAGGAGGTCT-3'. PCR products were an alyzed by electrophoresis through 2% agarose gels and were visualized by ethi dium bromide staining. RT-PCR data were analyzed by scanning densitometry of gel bands with Kodak 1D Image Analysis software and normalizing to -actin signals obtained from the same time points. RT-PCRs included a no-template control and a no-reverse-transcriptase control to exclude DNA or RNA contamination.

PAGE 34

25 MCP-1 ELISA MCP-1 levels in infected and uninfected HMEC-1 supernatants were assayed by MCP-1 DuoSet ELISA development system (R & D Systems, Minneapolis, MN) according to manufacturer’s protocol. Th e 3, 3’, 5, 5’tetramethylbenzidine liquid substrate system (Sigma-Aldrich) was added and the color was allo wed to develop for 20 minutes. The reaction was stopped with 2N sulf uric acid. ELISA plates were analyzed using a Quant platereader (Bio -Tek, Winooski, VT) at 450 nm. Isolation of B. henselae LPS B. henselae LPS was isolated as described pr eviously (92). Briefly, 3-day-old bacteria were harvested from chocolate agar and suspended in PBS. The bacterial pellet was washed three times with sterile water. Bacteria were lysed with lysis buffer (6% SDS, 60 mM Tris, 46% glycerol, 6% -mercaptoethanol, 10mM dith iothreitol) at 100C. Proteins were digested with proteinase K treatment. These crude extracts were concentrated by centricon YM-3 (Millipore Corp., Bedford, MA). Crude LPS was dialyzed against sterile endotoxi n-free water for four days. Enrichment of Outer Membrane Proteins from B. henselae and Fractionation by Molecular Weight B. henselae outer membrane proteins (OMP s) were enriched after inner membranes of total membrane preparations we re solubilized with sa rkosyl (14, 27). The sarkosyl-insoluble pellet was resuspende d in 10 mM HEPES (pH 7.4). Protein

PAGE 35

26 concentrations were determined usi ng the Lowry protein assay (56). 600 g protein in 400 l Laemmli sample buffer with 142 mM 2-mer captoethanol were heated at 95C for 5 minutes and separated in a single large well of a 2-dimensional 4-12% Bis-Tris NuPAGE gel (Invitrogen, Carlsbad, CA). Four sections of the gel were excised corresponding to 3-33kDa (OMP-1), 34-52 kD a (OMP-2), 53-97 kDa (OMP-3), and 98+ kDa (OMP-4). Each section was minced and proteins were eluted using the Model 422 Electro-Eluter (Bio-Rad, Hercules, CA) runni ng at 30 milliamps for three hours in elution buffer consisting of 25 mM Tris base, 192 mM glycine, and 0.1% SDS. Buffer was then exchanged using Microcon-YM-3 filters (Millipore Corp). Protein concentrations were determined using the Lowry protein assay (5 6). During some experiments, the lower molecular weight fraction of OMPs (OMP-1 ) was treated with polymyxin B sulfate (30 g/ml) or proteinase K. OMP-1 was added to proteinase K (10 g/ml) and incubated at 55C for 3 hours. Proteinase K was in activated at 100C for 15 minutes. HUVEC Proliferation Assay HUVEC were seeded in 96-well plates at 1x103 cells per well in media without antibiotics and allowed to adapt overnight. Cells were infected the following day with Houston-1 at an MOI of 50 or incubated with recombinant hu man CXCL8 (100 ng/ml, R&D Systems). Anti-human CXCL8 (10 g/ml) or an isotype control (mouse IgG1, 10 g/ml) were added to cell media during inf ections. After 72 hours, cells were fixed and examined with an inverted microscope and digital pictures were taken with a Kodak

PAGE 36

27 DC290. Cells were examined for qualitative differences in number. In addition, cells were counted in 5 high-powered fields per well and averaged. Chemotaxis of THP-1 Monocytes Chemotaxis of THP-1 monocytes was exam ined with modified Boyden chambers (Neuroprobe, Cabin John, MD) according to ma nufacturer’s instructions. Briefly, the lower well of the chamber was filled w ith 1.2ml supernatants from uninfected, B. henselae -infected, or E. coli -infected HMEC-1. 510 l of THP-1 cell suspension (5 x 105 cells) were added to the upper well. A 5 m pore size PVP-free polycarbonate membrane (Neuroprobe) separated the two wells. Mi gration occurred while incubating the chambers at 37C and 5% CO2 with humidity for four hours. After four hours, the upper side of the membrane was scraped with a st erile swab soaked in PBS three times to remove non-migrated cells and the lower side of the membrane was fixed and stained with Hema-3 Stat Pack (Biochemical Sc iences, Inc., Swedesbord, NJ) according to manufacturer’s instru ctions. Cells were counted in five high-powered fields per membrane and these numbers were averaged. Cell counts ranged from 6 to 10 cells per high-powered field, with the exception of cells migrated in response to uninfected HMEC-1 supernatants, in which case zero to tw o cells were counted per microscope field as a result of much less migration of THP-1 ce lls. Results are expressed as a chemotactic index (CI), in which the average number of cel ls that migrated in response to uninfected HMEC-1 supernatants was set to one. A gra ph of the means of CIs for three experiments is shown.

PAGE 37

28 In vitro Capillary Tube Formation Assay A 96-well plate was coated with growth factor-reduced (GFR) Matrigel (BD Biosciences, Mountain View, CA). The matr igel contained no antibodies, a control isotype, or anti-CXCL8 (10g/ml). The ma trigel was solidified at 37C for one hour, after which 104 uninfected or B. henselae -infected (MOI=100) HUVEC were added to each well. rCXCL8 (100 ng/ml) was added to some wells containing uninfected cells at this time. After 18 hours, plates were exam ined for qualitative diffe rences in capillary tube formation and photographs were take n with a Kodak DC290 digital camera. Generation of B. henselae Secreted Proteins (BHSP). B. henselae were harvested from chocolate ag ar plates and suspended in RPMI 1640. B. henselae were allowed to continue growth in flasks in RPMI 1640 for 24 hours at 220 rpm on an orbital shaker. After 24 hours of incubation, the suspension was removed from the flask and spun at 2000 rpm fo r 10 minutes to form a soft pellet. The supernatant was removed and passed through a 0.22 m filtered to remove all bacteria. The bacteria-free supernatant was then concentrated in a Centricon-Plus 20 per manufacturer’s instructions (Millipore, Bille rica, MA). Protein concentrations were determined by bicinchoninic acid assay (Pierce, Rockford, IL). Proteins were run on a 412% NuPAGE gel (Invitrogen) a nd visualized by silver staining (Bio-Rad). A vehicle control was also generated with identical me thods, except that bacteria-free agar plates were swabbed and resuspended in RPMI 1640.

PAGE 38

29 Western Blotting. BHSP (10 g) or vehicle control were r un on NuPAGE gels and transferred to nitrocellulose membranes in the presence of NuPAGE transfer buffer (Invitrogen) according to manufacturer’s instructions. A lternatively, 10 g BHSP or vehicle control were dotted on a nitrocellulose membrane. The membranes were blocked with TBST-5% skim milk overnight. The membranes were washed four times with TBST and then incubated with rabbit anti-BadA (1:1000 in blocking buffer) or rabbit anti-GROEL (1:500 in blocking buffer). The membranes were washed four times with TBST and incubated with a goat anti-rabbi t antibody conjugated to hors eradish peroxidase (1:5000 in blocking buffer). The membranes were wash ed and bands or dots were detected using the ECL chemiluminescent substrate (Amers ham Biosciences, Buckinghamshire, UK) and exposure to X-ray film. Proliferation Assays with BHSP. HUVEC were seeded in 96-well plates at a density of 103 cells per well and allowed to attach overnight in media without antibiotics. BHSP or vehicle controls were added in EBM containing no antibiotics at i ndicated concentrations After 72 hours, the HUVEC were photographed and 5 high-powered fields per well were counted and averaged.

PAGE 39

30 Measurement of CXCL8 Levels from BHSP-Treated HUVEC. HUVEC were treated with various concentrations of BHSP or medium controls. After 24 hours, the cell culture supernatants were collected and an ELISA was used to measure the CXCL8 levels as described under “CXCL8 ELISA”. Ca2+ Imaging. The calcium-sensitive dye fura2/AM was used for measuring intracellular free calcium concentrations in HUVEC, as previously described. Cells plated on coverslips were incubated for 1 h at room temperature in physiological salin e solution (PSS) consisting of 140 mM NaCl, 3 mM KCl, 2.5 mM CaCl2, 1.2 mM MgCl2, 7.7 mM glucose, and 10 mM HEPES (pH to 7.2 with NaOH), which also contained 1 M fura-2/AM and 0.1% Me2SO. The coverslips were then washed in PSS (fura-2/AM-free) prior to the experiments being carried out. PSS was applied via a rapid application system. B. henselae secreted proteins (BHSP) were app lied with a pipette to the coverslip. Concentrated liquid culture medi a containing no bacteria serv ed as a vehicle control. A DG-4 high speed wavelength swit cher (Sutter Instruments Co., Novato, CA) was used to apply altern ating excitation with 340and 380-nm UV light. Fluorescent emission at 510 nm was captured using a Sensicam digital CCD camera (Cooke Corp., Auburn Hills, MI) and recorded with Slidebook Version 3.0 software (Intelligent Imaging

PAGE 40

31 Innovations, Denver, CO) on a Pe ntium IV computer. Changes in [Ca2+]i were calculated using the Slidebook 3 software (Intelligent Imaging Innovations, Denver, CO) from the intensity of the emitted fluorescence following excitation with 340and 380-nm light, respectively, using the equation, (Eq. 1) where R represents the fluorescence intensity ratio ( F340/ F380) as determined during experiments, Q is the ratio of Fmin to Fmax at 380 nm, and Kd is the Ca2+ dissociation constant for fura-2. Calibration of the system was performed using a fura-2 calcium imaging calibration kit (Molecular Probes, Inc., Eugene, OR) and values were determined to be as follows: Fmin/ Fmax = 23.04; Rmin = 0.31; Rmax = 8.87. Ca2+ Inhibitors. The intracellular Ca2+ inhibitor thapsigargin was used in some assays when indicated. Cells were incubated for 30 mi nutes with 10 M thapsigargin followed by 30 minute incubation with Fura2/AM In some experiments, Ca2+ imaging was performed in the absence of extracellular Ca2+ by using PSS without Ca2+. BAPTA/AM, a Ca2+ chelator, was used during some experiments to inhibit Ca2+ signaling. The cells were

PAGE 41

32 pre-incubated with various concentrations of BAPTA/AM or DMSO for 10 minutes at 37C and then washed to remove excess BAPTA/AM or DMSO. Statistics. Significance was determined by a Student’s t test with two-tail ed distribution. P values less than 0.05 were considered signi ficant. Statistical significance of Ca2+ imaging data was determined by two-way ANOVA. All e xperiments were performed in triplicate. Data are presented as a mean one SD.

PAGE 42

33 Results Induction of MCP-1 Gene Expressi on and Protein Production. During B. henselae infection, monocytes and macrophages infiltrate the angiogenic lesions (49, 50, 64). MCP-1 is a C-C chemokine which recruits monocytes and macrophages to sites of infection through binding to it s CCR2B receptor (16). We investigated the effect of B. henselae infection on MCP-1 expr ession and production in HMEC-1. MCP-1 transcript le vels were assayed by semiquantitative RT-PCR at 6 and 24 hours after infection (Fig. 4). B. henselae -infected HMEC-1 had 1.6 times higher levels of MCP-1 transcript than uninfected c ontrols at 6 hours after infection (T6) and 1.8 times higher levels of MCP-1 transcript 24 hour s after infection (T24) (Fig. 4A, B). By 48 hours after infection, the MCP-1 message levels for uninfected HMEC-1 began to approach the MCP-1 message levels of B. henselae -infected HMEC-1 (data not shown). This was most likely due to th e absence of growth factors in culture media; after 48 hours of culture with no growth f actors, cells start to die and MCP-1 levels increase. MCP-1 levels in supernatants of infected or uninfected HMEC-1 were analyzed at 6, 24, and 48 hours after infection by ELISA (Fi g. 4C). There was a significant increase in MCP-1 levels when HMEC-1 were infected with B. henselae for 6, 24, or 48 hours (P<0.007). In order to determine whether th e bacterial stimulating molecule was heat stable, bacteria were heat-killed by boiling a 100C for 15 minutes before addition to

PAGE 43

34 Figure 4. B. henselae stimulated MCP-1 induction in HMEC-1. (A) Cells were stimulated with B. henselae or E. coli Some bacteria were pr eincubated with polymyxin B sulfate. The levels of MCP-1 mRNA in HMEC-1 were assayed by RT-PCR at 6 and 24 hours after infection (T6, T24). (B) R NA levels of MCP-1 were determined by scanning densitometry and normalized by comparison to -actin RNA levels (C) MCP-1 protein production was determined by ELI SA at 6, 24, and 48 hours after infection. (UN=uninfected cells; BH= B. henselae -infected cells; PB=pol ymyxin B sulfate; EC= E. coli infected cells; *P<0.007, B. henselae infection compared to uninfected cells; **P<0.007, untreated E. coli compared to E. coli treated with polymyxin B sulfate). Results shown are one representative of three similar experiments.

PAGE 44

35 HMEC-1. When bacteria were heat-killed, MCP-1 levels were not significantly lowered (data not shown). These data indicate that a heat-stable molecule is responsible for MCP1 production. Induction of MCP-1 Gene Expression a nd Protein Production is Independent of B. henselae LPS and Endothelial Cell TLR4. The cell walls of Gram-negative bacteria contain LPS, which instigates a proinflammatory response from cells through signaling through TLR4. This signaling may lead to upregulation of pro-infl ammatory cytokines such as IL-1 TNF, and MCP-1. We investigated the role of B. henselae LPS in MCP-1 production from HMEC-1. Bacteria ( B. henselae or E. coli ) were treated with polymyxin B sulfate before addition to HMEC-1. Although incubation of E. coli with polymyxin B sulfate significantly lowered MCP-1 gene expression and protein production from HMEC -1 at T6, T24, and T48 (P 0.006), polymyxin B had little effect on B. henselae -induced MCP-1 expression and production (Fig. 4A, B, C). MCP-1 production can be mediated by TLR 4 or TLR2 activation (89). Since HMEC-1 express TLR2 very weakly (25), we investigated whether B. henselae -induced MCP-1 production is mediated through TLR4 on HMEC-1. We preincubated HMEC-1 with a TLR4 mouse monoclonal antibody (HTA125) or an isotype control (mouse IgG2a, ), then infected with B. henselae or added E. coli LPS (100 ng/ml). Supernatants were collected 8 hours after in fection and assayed for MC P-1 by ELISA. While HTA125 reduced MCP-1 production caused by E. coli LPS (P<0.002), B. henselae -induced MCP1 production remained unchanged by the bloc king antibody (P>0.900) (Fig. 5A). These

PAGE 45

36 Figure 5. MCP-1 production during inhibition assays. Supernatants were collected 8 hours after inf ection and analyzed by ELISA for MCP-1 levels. (A) Cells were incubated with anti-tlr4 (HTA125) or a control isotype (mouse IgG2a, ) for 1 hour before infection with B. henselae or addition of E. coli LPS (100 ng/ml). (B) HMEC-1 were cultured in the presence of the NF B inhibitors PDTC or TPCK before infection with B. henselae or addition of E. coli LPS (1 g/ml). (UN=uninfected HMEC-1; BH= B. henselae -infected HMEC-1; EC=HME C-1 stimulated with E. coli LPS; *P<0.002; **P<2.00 X 10-4). A representative of th ree experiments is shown.

PAGE 46

37 data indicate that the MCP-1 produced in response to B. henselae from HUVEC does not involve endothelial cell TLR4 or B. henselae LPS. MCP-1 Production Requires NF B Activation. The mcp1 gene has binding sites for the transcription factors NF B and AP-1 (73). It was established that B. henselae can induce NF B activation in endothelial cells (32). In order to determine if the transcription factor NF B was responsible for MCP-1 production in HMEC-1 infected with B. henselae NF B inhibitors PDTC and TPCK were added to cells before infecti on. MCP-1 production in response to both B. henselae infection and E. coli LPS (1g/ml) decreased significantly in the presence of either inhibitor (P<0.0002) (Fig. 5B). Induction of MCP-1 production by B. henselae is NF B dependent. Low Molecular Weight Outer Membrane Proteins (OMP-1) from B. henselae Induce MCP-1 Production in HMEC-1. Since MCP-1 production in response to B. henselae infection occurs in an LPSindependent manner, we investigated whethe r OMPs of the bacteria stimulate MCP-1 production in HMEC-1. It has be en shown that OMPs induce NF B activation in human umbilical cord vein endothelial cells (HUVEC) (32). Because NF B is one of the transcription factors that induces MCP-1 ge ne expression (73, 91), we investigated whether OMPs could induce production of MCP-1 from HMEC-1. Outer membrane proteins were enriched from B. henselae as previously described (14). The OMPs were separated into four molecu lar weight fractions (see Materials and Methods ), and OMPs

PAGE 47

38 were added to HMEC-1 culture at 250 ng/ml Out of four fractions, only the lowest molecular weight fraction (from 3-33 kDa), Fraction 1 (OMP-1), si gnificantly increased MCP-1 production in HMEC-1 at 6 and 24 hour s after addition of OMPs (P<0.002) (Fig. 6A). OMP-1 also caused MCP-1 production fr om HMEC-1 in a dose-dependent manner (Fig. 6A). Preincubation of OMP-1 with Poly myxin B sulfate did not abrogate its effect (P>0.700) (Fig. 6B), suggesting that endotoxin contamination in the OMP-1 preparation is not responsible for MCP-1 induction. Ho wever, proteinase K treatment significantly lowered the effect of OMP1 (P<0.0002), revealing that the factor in OMP-1 which upregulates MCP-1 production is pr obably a protein or proteins. Supernatants from B. henselae -Infected HMEC-1 Induce Chemotaxis of THP-1 Monocytes. Since MCP-1 levels are heightened in response to B. henselae infection, we investigated whether supernatants from B. henselae -infected HMEC-1 could cause chemotactic migration of THP-1 monocytes. A modified Boyden chamber assay was used to assess the chemotactic response of THP-1 monocytes to chemoattractants present in the supernatant from B. henselae -infected HMEC-1. Migrated cells were fixed, stained, and counted in 5 highpowered fields. Supernatants from uninfected HMEC-1 were used as negative cont rols and supernatants from E. coli -infected HMEC-1 were used as positive controls. Supernatants from B. henselae -infected HMEC-1 induced THP-1 chemotaxis at a level about 6 times th at of supernatants from uninfected HMEC-1 (Fig. 7) and at similar leve ls to supernatants from E. coli -infected HMEC-1 (4 times that of uninfected supernatants). Th ese results indicate that the le vels of MCP-1 and/or other

PAGE 48

39 Figure 6. MCP-1 production in response to OMP fraction 1. HMEC-1 were stimulated with OMP-1 under various dosages and conditions. Supernatants were collected at 6 and 24 (T6, T24) hours after addition of OMP-1. MCP1 levels were determined by ELISA. (A) Dose-dependent response of HMEC-1 to vari ous OMP-1 concentrations (B) Effects of polymyxin B sulfate (30 g/ml) (PB) and prot einase K (10 g/ml) (PK) on OMP-1 induced MCP-1 production in HMEC-1. (*P<0.002; **P<2.00 X 10-4). A representative of three experiments is shown.

PAGE 49

40 Figure 7. THP-1 monocyte chemotaxis in response to supernatants from B. henselae -infected HMEC. (A) Chemotaxis of THP-1 monocytes in response to uninfected HMEC supernatants, B. henselae -infected HMEC supernatants (BH), or E. coli -infected HMEC supernatants (EC). Results are expressed as a chemotactic index. The number of migrated THP-1 in five micros copic fields was averaged for supernatants from uninfected, B. henselae -infected, and E. coli -infected HMEC-1. The chemotactic index for cells which migrated in response to uninfected supernatants was set at one, and other samples were normalized accordingly. Results shown are the mean of three separate experiments.

PAGE 50

41 chemokines in supernatants from infected HMEC-1 are sufficient to cause chemotaxis of monocytes. CXCL8 Production from a Variet y of Cell Types Infected with B. henselae. CXCL8 plays a role in angiogenesi s through induction of MMP production, endothelial cell survival, and cap illary tubule formation (52). It has been reported that CXCL8 production is enhanced from endothe lial cells and epithe lial cells by an NF Bdependent pathway in the presence of B. henselae (32, 77). We tested a variety of cell types for production of CXCL8 in response to B. henselae at an MOI of 100. Two types of endothelial cells, HMEC-1 and HUVEC (see Materials and Methods ), upregulated CXCL8 in response to B. henselae 24 hours after infection (Fi g. 8A). Other cells which may be important for B. henselae pathogenesis (hepatocyt es and monocyte-derived macrophages) were also examined for their ability to upregulate CXCL8 in response to B. henselae They also markedly upregulated CXCL 8 during infection (Fig. 8B, C). We have previously reported (71) that B. henselae -infected THP-1 do not enhance CXCL8 production at an MOI=500, which conflicts with the results presented here. However, this study used Vitamin D3 for monocyte differentiation (see Materials and Methods ) in place of phorbol myristate acetate (PMA), which lowers background CXCL8 production; thus the differences between uninfected a nd infected macrophages were more clearly distinguishable. Furthermore, we examined HUVEC fo r CXCL8 receptors CXCR1 and CXCR2 expression in the presence of B. henselae While CXCR1 RNA levels were not significantly different between uninfected and infected HUVEC (data not shown),

PAGE 51

42 Figure 8. B. henselae -induced CXCL8 production assayed by ELISA (A) B. henselae induced CXCL8 production from huma n umbilical vein endothelial cells (HUVEC) and; human microvascular endothelial cells (HMEC-1). (B) B. henselae induced CXCL8 production from hepatocytes (HepG2). (C) B. henselae -induced CXCL8 production from monocytederived macrophages (THP-1). ( Un=Uninfected cells; Bh= B. henselae -infected cells ; *P<0.001).

PAGE 52

43 CXCR2 levels were aro und four times higher in B. henselae -infected cells than in uninfected cells (Fig. 9A, B). B. henselae causes CXCL8 producti on from macrophages, endothelial cells, and hepatocytes; B. henselae also induces CXCL2 expression in endothelial cells, indicating a put ative autocrine mechanism during B. henselae infection of endothelial cells. Effect of Blocking CXCL8 on B. henselae -Induced Endothelial Cell Proliferation. B. henselae causes more endothelial cell prolifer ation at MOIs of under 50 than at higher MOIs (77). This is most likely due to a cytotoxic effect from a factor coded by the virB operon at higher MOIs. However, other aspects of B. henselae -induced angiogenesis such as inhibition of a poptosis, capillary tube formation, and NF Bdependent proinflammatory activation correla te positively with bacterial numbers(42, 43, 72). Since it has been reported that CXCL8 directly mediates endothelial cell survival and proliferation (46), we ex amined the role of CXCL8 in B. henselae -induced HUVEC proliferation (Fig. 10A). Cells were incubated with B. henselae (MOI of 50) or rCXCL8 (100 ng/ml). Cells were also treated with anti-human CXCL8 or a control IgG1 (10 g/ml). After 3 days, pictures were taken of the wells (Fig. 9A) and cells were counted (Fig. 10B). Both B. henselae and rCXCL8 induced prolif eration as compared to unstimulated cells. The presence of a CXCL 8 antibody quenched the proliferative effect of B. henselae and rCXCL8, while an isotype control did not. These data point to a putative role for CXCL8 during B. henselae -induced proliferation.

PAGE 53

44 Figure 9. CXCR2 expression in HUVEC (A) RNA was extracted from uninfected and B. henselae -infected HUVEC and subjected to semi-quantitative RT-PCR. (B) Scanning densitometry determined the relativ e intensities of CXCR2 expression when normalized to -actin house-keeping gene expres sion. Relative CXCR2 induction was measured as a ratio of CXCR2 to -actin when this ratio in uninfected cells was normalized to 1. (UN=uninfected HUVEC; BH= B. henselae -infected HUVEC)

PAGE 54

45 Figure 10. Effect of CXCL8 on HUVE C proliferation in response to B. henselae HUVEC were uninfected (UN) or infected with B. henselae (BH) or incubated with rCXCL8 in either the pres ence or absence of a neutralizing antiCXCL8 antibody or an isotype control (mouse IgG1) for 3 days. (A) Digital pictures of typical phase-contrast micr oscopic fields. (B) Cell proliferation expressed as a graph of average cell nu mber per high-powered field. *P<0.008.

PAGE 55

46 Role of CXCL8 in B. henselae -Induced Endothelial Cell Survival. The balance between Bax (a poptotic) and Bcl-2 (anti-a poptotic) is important for endothelial cell survival or apoptosis We examined HUVEC infected with B. henselae at an MOI of 100 for expression of Bcl-2 family members Bcl-2 and Bax. CXCL8 induces increased Bcl-2 expression and decrea sed Bax expression (53). While it has been reported that B. henselae inhibits apoptosis of HUVEC though inhibition of caspases (43), the Bcl-2 and Bax le vels in uninfected and B. henselae -infected HUVEC have not been previously compared. We examined Bax and Bcl-2 levels in HUVEC by real-time PCR. We found that B. henselae -infected HUVEC had almost unde tectable levels of Bax expression and about four times enhanced Bcl-2 expression (Fig. 11A) when compared with uninfected controls and normalized to a -actin housekeeping gene This increased Bcl-2/Bax ratio probably biases the cell into an anti-apoptotic state. We examined the role of CXCL8 on B. henselae -enhanced HUVEC survival. When anti-CXCL8 was added to HUVEC in the presence of B. henselae the anti-apoptotic response of the cells decreased markedly (Fig. 11B, C) Bax levels were raised ab out fivefold in the presence of anti-CXCL8 but not in the presence of c ontrol IgG1 (Fig. 11B). Conversely, Bcl-2 levels induced by B. henselae infection dropped six fold in the presence of a CXCL8 neutralizing antibody (Fig. 11C). These results reveal a possible autocrine role for CXCL8 in B. henselae -stimulated endothelial cell survival.

PAGE 56

47 Figure 11. Effect of anti-CXCL8 on inhi bition of HUVEC apoptosis induced by B. henselae (A) B. henselae causes enhanced Bcl-2 expression and decreased Bax expression in HUVEC. Results are expressed as relative expression units, a ratio of amounts of Bcl-2 or Bax transcripts to -actin transcript amounts. (B) Bax expression reduced by B. henselae is increased in the presen ce of a neutralzing antibody to CXCL8. (C) Bcl-2 expression increased by B. henselae is decreased in the presence of anti-CXCL8. ( UN=uninfected HUVEC; BH= B. henselae –infected HUVEC; rCXCL=rCXCL8-treated HUVEC ; *P<0.01).

PAGE 57

48 Role of CXCL8 in B. henselae -Induced Capillary Tube Formation. In vitro angiogenesis assays have revealed a pro-angiogenic response of HUVEC to B. henselae infection (42). HUVEC infected with B. henselae seeded on a GFR matrigel exhibited advanced capillary tube formation when compared to uninfected HUVEC (Fig. 12). HUVEC incubated with rCXC L8 also showed enhanced capillary tube formation. When anti-CXCL8 was pres ent in the matrigel, the capillary tube formation was visibly diminished (Fig. 12). Th e presence of an isotype control, however, had no such effect on tube formation. These da ta delineate further an autocrine role for CXCL8 during B. henselae infection. B. henselae Secreted Proteins (BHSP) Contain GROEL and BadA. B. henselae secreted proteins have been implicated in endothelial cell proliferation (59). However, the TFSS encoded by the virB operon is not responsible for endothelial cell proliferation, a nd is turned on only inside the endothelial cell (77, 79). Thus in order to avoid this cytotoxic effect and study si mply the effect of TFSSindependent secreted prot eins, we isolated secret ed proteins (SP) from B. henselae conditioned media as described in Materials and Methods The proteins were analyzed by electrophoresis and tested for the presence of GROEL, a heat s hock protein that is potentially secreted, and BadA, an immunoge nic adhesion (Fig. 13A, B), by western blot and dot blot, respectively. Both proteins were present in the SP fractions. The presence of GROEL was expected, as it has been pr eviously found in conditioned media from B.

PAGE 58

49 Figure 12. Effect of anti-CXCL8 on B. henselae -induced capillary formation in a GFR matrigel. HUVEC were infected with B. henselae (BH) or uninfected (UN) and seeded on a GFR matrigel containing no antibody, a control antibody (mouse IgG1, 10 g/ml), or anti-CXCL8 (10 g/ml). Uninfected HUVEC were then either stimulated with CXCL8 (100 ng/ ml) or left alone. Pictures were taken after 24 hours.

PAGE 59

50 Figure 13. B. henselae secreted proteins (BHSP) contain BadA and GROEL BHSP were analyzed by western blot for GR OEL (A) and dot blot for BadA (B). A medium control (MC) served to rule out non-specific anti body binding to proteins in the medium. Secreted proteins from a BadA mutant ( BadA) were also used as a negative control for the BadA dot blot.

PAGE 60

51 henselae (63). However, the presence of BadA was unexpected since it is an adhesin; perhaps it is shed from the bacteria du ring liquid culture. Thus we identified two potentially important proteins in the B. henselae secreted protein (BHSP) fraction. BHSP Induce a Proliferative Response in HUVEC There has been controversy in the litera ture concerning whether bacteria-host cell contact is needed for endothelial cell prolifer ation to occur (20, 59). Therefore we tested the ability of BHSP to cause proliferation in HUVEC. At a concentration of 250 g/ml, the BHSP caused HUVEC proliferation, while a medium control (MC) at the same concentration did not (Fig. 14A, B). The pro liferative response was almost 3 times that of untreated controls. In addition, the morphology of the cel ls incubated with BHSP was similar to the morphology of HUVEC when they are infected with B. henselae at MOIs of 50 or lower. They are elongated and disp lay morphology consistent with proliferating cells in the presence of VEGF (77). BHSP Induce an Intracellular Ca2+ Response in HUVEC Ca2+ signals play a key role in angiogenesis and other cellular processes (2). We tested the ability of BHSP to induce a Ca2+ rise in HUVEC. Interestingly, when 250 g BHSP were added to HUVEC, intracellular Ca2+ concentrations rose rapidly to 100 nM (Fig. 15A). When a medium contro l was added to HUVEC, there was no Ca2+ rise (Fig. 15A). The peak Ca2+ concentrations were significantly different (P<0.05) from base levels (Fig. 15B).

PAGE 61

52 Figure 14. BHSP cause HUVEC proliferation. HUVEC were incubated with a medium control (MC) or BHSP (250 g/ml) and incubated 96 hours. Cells were viewed by inverted microscope and pictur es were taken to view qualitative cell numbers (A). Five fields per well were counted and the average number for media controls was normalized to 1 (B).

PAGE 62

53 Figure 15. BHSP cause a Ca2+ rise in HUVEC BHSP were added to HUVEC mounted on a coverslip and intracellular Ca2+ was quantified as described in Materials and Methods (A) One HUVEC Ca2+ response to BHSP (250 g/ml) and a medium control (MC). (B) The average peak and baseline Ca2+ levels were compared for all cells. (*P<0.05; results are expressed as the mean plus one standard deviation).

PAGE 63

54 BHSP Induce an Intracellular Ca2+ Response in HUVEC from Intracellular Stores. In order to determine if the intracellular Ca2+ response from HUVEC resulted from extracellular Ca2+ entering the cell or from Ca2+ mobilization from intracellular stores, we tested the Ca2+ response to BHSP under various conditions. Under extracellular Ca2+-free conditions (0 Ca2+), the Ca2+ response did not change significantly (Fig. 16A, B) upon application of BHSP. Thus the Ca2+ response derived from inside the cell. Next we preinc ubated HUVEC with 1 M thapsigargin (THAPS), a Ca2+ ATPase inhibitor which depletes intracellular Ca2+ stores (10, 83). In the presence of the inhibitor, the Ca2+ levels did not increase in resp onse to BHSP (Fig. 15A) and the peak values of Ca2+ concentration were significantly lo wered (Fig. 16B, P<0.05). Therefore the BHSP-derived Ca2+ response in HUVEC derives from intracellular Ca2+ pools, which have been implicated as the crucial Ca2+ pool for angiogenesis (10, 80, 83). BHSP-Induced HUVEC Proliferation Requires Ca2+. Given that intracellular Ca2+ is important for angiogenesis and that BHSP induce such a high concentratio n of intracellular Ca2+ as well as HUVEC proliferation, we investigated whether HUVEC proliferation i nduced by BHSP would still occur in the presence of a Ca2+ chelator, BAPTA/AM. After 10 minute pre-incubation with BAPTA/AM at concentrations of 1 M BAPTA/AM or equi valent volumes of a DMSO vehicle control, the cells were washed and BH SP or medium controls were added. In the presence of BAPTA/AM, the HUVEC prolifera tion was reduced almost 50% (Fig. 17). We also determined that whole B. henselae -induced proliferation is also lowered when

PAGE 64

55 Figure 16. BHSP cause a Ca2+ rise in HUVEC from intracellular stores HUVEC were either incubated with 1 M thapsigargin(THAP) for 30 minutes followed by incubation with FURA-2-AM ( 20 M), or incubated with FURA-2AM and assayed in Ca2+-free conditions. BHSP were added to HUVEC and intracellular Ca2+ was quantified as described in Materials and Methods (A) Responses to BHSP from cells assayed with Ca2+ present (control), cells assayed in the absence of Ca2+ (0 Ca), and cells incubated with 1 M thapsigargin (THAPS). (B) The average peak and baseline Ca2+ levels were compared for all cells. Results are expressed as the mean plus one standard deviation. (*P<0.05).

PAGE 65

56 Figure 17. Ca2+ signaling is important for BHSP-mediated HUVEC proliferation HUVEC were preincubated with 1 M BAPTA/AM or a DMSO vehicle control. A medium control (MC) or BHSP were added to HUVEC at indicated concentrations 250 g /ml, or cells were infect ed at an MOI of 50 with B. henselae (BH). After 72 hours, cells were photographed and five high-powered fields (HPF) were counted and averaged (*P<0.02; **P<0.04).

PAGE 66

57 HUVEC are pre-incubated with BAPTA/ AM. Consequently, intracellular Ca2+ is important for BHSPand live B. henselae -induced HUVEC proliferation. BHSP Induce CXCL8 Production from HUVEC. We have determined that CXCL8 plays an autocrine role in B. henselae –induced endothelial cell survival, pro liferation, and capillary tube formation. In order to determine if the BHSP were inducing prolif eration through CXCL8 production, we tested the ability of BHSP to induce CXCL8 produc tion from HUVEC. When BHSP were added to HUVEC, the CXCL8 levels increase d (Fig. 18A). CXCL8 production did not increase in the presence of a medium c ontrol. Additionally, when BAPTA/AM was added to HUVEC before addition of BHSP, th e CXCL8 levels dropped significantly (Fig. 18B). These data indicate a role for intracellular Ca2+ activity in CXCL8 production mediated by BHSP.

PAGE 67

58 Figure 18. BHSP induce CXCL8 production from HUVEC (A) HUVEC were incubated with a medium control (MC) or BHSP at indicated concentrations (g/ml) for 24 hours. Supernatants were collected and ELISA was performed. (B) HUVEC were preincubated with BAPT A/AM or DMSO control. BHSP or media controls were added at shown concentr ations (g/ml) and supernatants were collected after 24 hours and ELISA was performed. *P<0.03.

PAGE 68

59 Discussion B. henselae, the etiologic agent of CSD, is a fastidious, gram-negative, oxidasenegative, aerobic bacillus (11, 13). B. henselae infections cause a range of symptoms from lymphadenopathy (CSD) to systemic diseas e. The severity of the disease tends to relate to immune status. Immunocompromised patients such as AIDS patients, chronic alcoholics, or immunosuppressed people can develop systemic disease. However, immunocompetent patients may still present with systemic bacteremia, endocarditis, and bacillary angiomatosis. B. henselae can cause vascular proliferative lesions (5) into which macrophages infiltrate during infection (49, 50, 64). In the paracrine and autocrine model of B. henselaeinduced angiogenesis (Fig. 2), macrophage s are implicated as effector cells; upon stimulation by B. henselae they secrete VEGF and other endothelial cell mitogens (71). Concurrently, endoth elial cells upregulate pro-a ngiogenic factors such as chemokines, inhibit apoptosi s through inhibition of cas pases (44), and upregulate adhesion molecules (32) which may promote pro liferation. In this study we investigated the endothelial cell mediators of angiogene sis which are induced upon infection with B. henselae Specifically, we determined that B. henselae (i) upregulates MCP-1 production, which brings the effector cell macr ophage into the site of infection, where it secretes VEGF and CXCL8 which would pr omote angiogenesis; (ii) induces CXCL8

PAGE 69

60 production and CXCL8 receptor CXCR2 expressi on, which promotes angiogenesis in an autocrine manner by enhancing endothelial cell survival, endothelial cell proliferation, and capillary tube formation; a nd (iii) causes an intracellular Ca2+ rise from intracellular pools which leads to NF B-directed pro-inflammatory ac tivation and endothelial cell proliferation. These mediators of angi ogenesis which are induced by the bacterium probably play a pivotal role in B. henselae -induced angiogenesis. When the additional factors from peripheral cells are considered, a model of B. henselae -induced angiogenesis emerges (Fig. 19). Macrophages and monocytes infiltrate lesions caused by BA (49, 50, 64). Macrophages secrete VEGF upon B. henselae infection, which proba bly contributes to angiogenesis during infection (41, 71). We investigated the mechanism by which the macrophage is brought into the site of infection by examining the expression and production of the chemokine MCP-1 from B. henselae -infected HMEC-1. MCP-1 is a member of the C-C chemokine family and is produced and secreted by monocytes, fibroblasts, and vascular endothe lial cells. MCP-1 then inte racts with its CCR2B receptor on monocytes and macrophages to cause chemot axis (16). MCP-1 can also directly promote angiogenesis. When tu mor cells are transfected with mcp-1 gene and injected into a murine model, angiogenesis is stim ulated (68). In addition, MCP-1 implants induce angiogenesis in a ra bbit cornea (88). During B. henselae infection, MCP-1 released from endothelial cells, most likely in addition to other factors, causes chemotaxis of monocytes and macrophages to the site of infection, thereby promoting an angiogenic state by recruiting the effector cell.

PAGE 70

61 Figure 19. Endothelial cell medi ators of angiogenesis during B. henselae infection This model depicts the mediator s of angiogenesis that are induced by B. henselae from endothelial cells (EC) When ECs are infected with B. henselae (BH), MCP-1 is produced and recruits macrophages (M ), which secrete VEGF when they are infected. CXCL8 is also produced from ECs, leading to enhanced EC survival and cap illary tube formation. BH secretes proteins (BHSP), which induce a Ca2+ spike from intracellular stores and contribute to NF B-dependent CXCL8 production and EC proliferation. These mechanisms culminate in B. henselae -induced angiogenesis.

PAGE 71

62 Bacterial pathogens such as E. coli Orientia tsutsugamushi and Porphorymonas gingivalis increase chemokine produc tion and secretion (18, 45, 99). MCP-1 is induced in HMEC-1 in response to B. henselae infection (Fig. 4). Both mRNA and protein levels are upregulated; mRNA levels are hi gher than uninfected controls in B. henselae -infected HMEC-1 at 6 and 24 hours after infection, while pr otein levels in infected cells are higher at 6, 24, and 48 hours after infection. Furthermore, supernatants from B. henselae infected HMEC-1 caused chemotaxis of THP-1 monocytes (Fig. 7). Thus the levels of MCP-1 produced by HMEC-1 in response to B. henselae infection in vitro are sufficient to function as a chemoattractant for monocytes. Results also reveal that the bacterial factor which causes MCP-1 production is probably a heat stable molecule. The LPS of B. henselae has recently been character ized as containing a lipid A possessing features known to reduce endotoxici ty, including a pentaacyl lipid A and a long-chain fatty acid (97). B. henselae LPS induces TLR4 1000-fold lower than Salmonella enterica sv. Friedenau LPS (97). In addition, LPS from B. quintana which is likely quite similar to B. henselae LPS, induces GRO-CINC-1 in rats but not TNF in rats or human whole blood (62). B. henselae LPS also does not induce TNF in cats. In this study, the addition of polymyxin B sulfate to B. henselae before infection of HMEC-1 did not reduce MCP-1 production; however, polymyxi n B sulfate had a significant lowering effect on E. coli -induced MCP-1 production (Fig. 4). These data corroborate with the low endotoxicity of LPS from Bartonella spp. to imply a limited or nonexistent role for LPS in B. henselae -induced MCP-1 production. Toll-like receptors activated by various microbial products can cause expression and production of chemokines (23, 24, 57), in cluding MCP-1 (76). LPS, a TLR4 agonist,

PAGE 72

63 causes MCP-1 production in a TLR4-dependent manner (89). Most studies confirm that MCP-1 production is TLR4-mediated, and usually caused by LPS in a bacterial infection. However, recently it was discovered that TLR 4-deficient and TLR4-competent mice have the same MCP-1 response to infection by Leishmania major (6), which is known to cause chemokine production early in infection ( 40). Our findings indicate that MCP-1 production in response to B. henselae infection is not TLR4-de pendent (Fig. 5A). In contrast, E. coli LPS-induced MCP-1 production was lo wered in the presence of a TLR4 monoclonal antibody. These data suggest the possibili ty of an alternate pathway to TLR4 activation for the MCP-1 production from B. henselae -infected HMEC-1. Furthermore, these results again exclude B. henselae LPS from a role in MCP-1 production. HMEC-1 express TLR1, TLR3, TLR4, and TLR5 but expr ess TLR2 very weakly, which is why they are unresponsive to TLR2 ligands (25). Thus the MCP-1 producti on investigated in this study is probably not TLR4or TLR2-me diated. Other TLR or similar receptor pathways must be investigated to pinpoint the exact mechanism of MCP-1 induction in HMEC-1 in response to B. henselae The mcp-1 gene contains binding sites for both NF B and AP-1 (73, 91), and both transcription factors have been implicated in mcp 1 expression (18, 94). It has been established that B. henselae induces NF B-dependent upregulation of adhesion molecules in HUVEC independent of LPS (32). Th e findings from our study suggest the independence of MCP-1 expressi on and protein production from B. henselae LPS. In addition, we used two NF B inhibitors to determine wh ether MCP-1 protein production requires NF B activation. Diverse NF B inhibitors have been used with HMEC-1 previously in similar experiments (18). PD TC is an antioxidant that inhibits the

PAGE 73

64 phosphorylation of I B (66, 78) and TPCK inhibits prot eosome-dependent degradation of inhibitory peptides (58). Consequentl y, through the use of th ese inhibitors, we demonstrated that MCP-1 production caused by B. henselae in HMEC-1 is NF Bdependent (Fig. 5B). OMPs of B. henselae are important for pathogenesi s (14, 32). Data presented here reveal the ability of B. henselae Houston-1 OMPs, specifically OMPs of low molecular weight, to enhance production of the C-C chemokine MCP-1 from HMEC-1 (Fig. 6A). This upregulation is again inde pendent of LPS, as shown by incubation of OMP-1 with polymyxin B sulfate before additi on to HMEC-1 (Fig. 6B). These data point to a heat-stable low molecular weight OMP of B. henselae Houston-1 that contributes at least in part to B. henselae -induced MCP-1 production from endothelial cells. Further studies are needed in order to specify the putative OMP that causes MCP-1 upregulation in endothelial cells. We have described upregulation of gene expression and protein production of the chemokine MCP-1 in response to B. henselae infection. This stim ulation of HMEC-1 is independent of B. henselae LPS and toll-like recept or 4 but dependent on NF B activity. MCP-1 produced by infected HMEC-1 most likely contributes to the ability of conditioned media from these cells to induce monocyte chemotaxis. The recruitment of macrophages by MCP-1 produced from infected endothelial cells could have broad implications on mechanisms of angiogenesis during this infection. Specifically, the macrophage effector cell which secretes VEGF and other angiogenic factors is brought to the site of infection. Pathogenic angiogenesi s provides actively grow ing target cells for B. henselae in an enriched vascularized microenvi ronment, and while the specific role of

PAGE 74

65 MCP-1 induction in this phenomenon is not completely understood, we suggest that recruitment of the monocyte/m acrophage effector cell is an important component of the pathway. Angiogenesis is a complex process invol ving several key steps. These steps include (i) inhibition of endothe lial cell apoptosis, (ii) endoth elial cell prolif eration, (iii) breakdown of the extracellular matrix by MMP s, and (iv) capillary tube formation. CXCL8 can promote each of these steps. Since B. henselae upregulates CXCL8 production from endothelial cells (21, 71), we in vestigated a putative autocrine role for CXCL8 in B. henselae -induced angiogenesis. There are conflicting reports on whether endothelial cells actively proliferate or whether they simply exhibit enhanc ed survival in the presence of B. henselae (43, 77). Endothelial cell proliferation in BA most likely comes from a combination of inhibition of apoptosis and mitogenic stimulation. In addition, endothelial ce ll proliferation and angiogenesis probably result from the effect s of the bacterium on both the endothelial cells and peripheral cells such as epithelial cells and macrophages (41, 71). While this particular study focuses on the autocrine role of CXCL8, a paracrine role should not be overlooked as many cell types produ ce CXCL8 after infection with B. henselae (Fig. 8). Furthermore, the bacterium causes an upregul ation of expression of one of the CXCL8 receptors, CXCR2 (Fig. 9). This may repr esent a mechanism by which the effects of CXCL8 on the endothelial cell are enhanced beca use the receptor is present at elevated levels. When the fact that CXCL8 producti on is upregulated from endothelial and other cells is combined with the information that CXCR2 expression is also enhanced during

PAGE 75

66 endothelial cell infection, a model emerge s whereby CXCL8 signaling is extremely elevated in the e ndothelial cell during B. henselae infection. The balance between Bax and Bcl-2 is impor tant for endothelial cell survival or apoptosis. CXCL8 induces an increase in Bcl-2 expression and a decrease in Bax expression, most likely favoring su rvival over apoptosis in endothelial ce lls (52). It has been shown that B. quintana can modulate the cell-progr ammed death of HUVEC-C by increasing Bcl-2 expression (54). In this study, we examined expression of two Bcl-2 family members, Bcl-2 (ant i-apoptotic) and Bax (apoptotic ) in HUVEC by real time RTPCR. In the presence of B. henselae Bax is decreased and Bcl-2 is increased (Fig. 11A). These increases and decreases are quite drama tic alone; however, when the ratio of Bcl-2 to Bax is considered, the comparison is even mo re drastic. This is the first report of B. henselae mediating Bax and Bcl-2 expression in e ndothelial cells. In addition, the data reveal a possible role for CXCL8 in this pr evention of apoptosis si nce the presence of anti-CXCL8 abrogates the higher Bcl2 leve ls and the lower Bax levels induced by B. henselae (Fig. 11B, C). These data also implicate CXCL8 as a me diator of endothelial cell proliferation and capillary tube formation during infec tion. Both aspects of angiogenesis were decreased in the presence of a CXCL8 neut ralizing antibody (Figs. 10, 12). However, other mechanisms are probably also involved in proliferation, incl uding the activity of growth factors such as VEGF from othe r cells. It has been shown that while B. henselae cause endothelial cells to proliferate, this pr oliferation is inhibited at higher MOIs as a result of a cytotoxic effect from the B. henselae TFSS (77). Our proliferation results agreed with this phenomenon; at MOIs a bove 50, endothelial ce ll proliferation was

PAGE 76

67 decreased. However, the other aspects of angiogenesis (capillary tube formation, enhanced endothelial cell survival, and CX CL8 production) increase d at an MOI of 100 when compared to an MOI of 50 (data not shown). These results suggest that the cytotoxic effect of the products of the virB does not have an effect on expression of Bcl-2 family members or capillary tube forma tion. Thus the pro-a ngiogenic effect of B. henselae may consist of a complicated fusion of many host cell and bacterial factors. Nevertheless, CXCL8 seems to play an au tocrine and possible paracrine role in B. henselae -induced angiogenesis, representing a mechanism by which the bacterium causes upregulation of CXCL8 thereby increasing its survival by expanding its host cell reservoir. An assessment of th e contribution of each of these in vitro components toward the overall angiogenesis mediated by B. henselae is still unfinished, and it will require extensive in vivo and in vitro studies. B. henselae secreted proteins (BHS P), or conditioned media, have been shown to induce endothelial cell pro liferation (59). These prot eins are isolated from B. henselae grown on chocolate agar and resuspended in liquid medium for 24 hours. There is a cytotoxic effect from the TFSS of B. henselae which mediates secretion of BepD into endothelial cells (80), at MOIs above 50. When a virB mutant is used to infect HUVEC, the proliferation is 4-fold higher than with wildtype B. henselae (77). Thus it was determined that the TFSS triggers a cytotoxic effect in HUVEC. The virB promoter is only active inside the cell; B. henselae containing a GFP reporte r construct driven by the virB promoter are not green outside of the cell (79). BHSP theref ore contain only low levels, if any, of TFSS-transported proteins.

PAGE 77

68 NF B activation links the upregulat ion of MCP-1 and CXCL8 during B. henselae infection. Thus we investigated upstream of NF B activation by examining the intracellular Ca2+ response to bacterial secreted proteins In this study we determined that BHSP in fact cause endothelial cell prolifera tion (Fig. 14) and that this proliferation is dependent on Ca2+ signaling, since in th e presence of the Ca2+ chelator BAPTA/AM HUVEC proliferation was lowered (Fig. 17). Additionally, we demonstrated that BHSP induce a Ca2+ elevation in HUVEC, while a medium c ontrol did not have the same effect (Fig. 15). Furthermore, we showed that the origin of the Ca2+ response to BHSP is an intracellular store, si nce the intracellular Ca2+ store inhibitor thapsi gargin abolished the BHSP-induced Ca2+ rise in HUVEC (Fig. 16). CXCL8 is an important mediator of angiogenesis and is important for HUVEC survival and capillary tube formation during B. henselae infection of HUVEC. Since the BHSP induced HUVEC proliferation, we s ought to ascertain whether BHSP induce CXCL8 production from HUVEC. In th e presence of BHSP, CXCL8 production was raised about four times higher than a medium control (Fig. 18A, P<0.001). However, the CXCL8 levels in the presence of BHSP did not increase above 100 pg/ml (Fig. 18A, B). These CXCL8 levels are lower than those elicited by live B. henselae (Fig. 8). Thus the question arises: Are these CXCL 8 levels sufficient to cause HUVEC proliferation or is there another proliferative pa thway activated by BHSP? In fact, during proliferation assays, HUVEC are seeded at a low density (103 HUVEC/well of a 96-well plate) in order to allow for proliferation over 3-4 days. Thus while MOIs of live bacteria take into account the cell numbers, the concentrations of BHSP are determined as g/ml. Therefore during proliferation assays, higher CX CL8 levels may be elicited as a result of

PAGE 78

69 lower numbers of cells. Unfortunately, si nce the HUVEC proliferate over 3 or 4 days, measurement of CXCL8 levels would be skewed as there are more cells in BHSP-treated wells. Additionally, the BH SP are present for 3 days and may cause more CXCL8 production over that time course. Conse quently, we propose that while the CXCL8 responses to BHSP were not as robust as the response to live B. henselae these levels may be sufficient to cause HUVEC prolifera tion. CXCL8 production enhanced by BHSP was lowered in the presence of a Ca2+ chelator BAPTA/AM (Fig. 18B). NF B activation can be mediated by intracellular Ca2+ signaling, and BHSP induction of CXCL8 appears to be Ca2+-dependent. The factor which induces the Ca2+ rise and subsequent e ffects is still unknown. We determined that BHSP contain BadA a nd GROEL (Fig.13), both which are important during B. henselae infection of endothelial cells (63, 72). BadA binds to the extracellular matrix proteins collagen, laminin, and fibronec tin (72). This could be responsible for the Ca2+ rise in HUVEC. GROEL is mitogenic for endothelial cells, which may contribute to HUVEC proliferation and CXCL8 production me diated by BHSP. The TFSS mediates CXCL8 production in HUVEC as well (77); perhap s low levels of some of the effectors translocated by the TFSS are present in th e BHSP or the components on the bacterial membrane are present in BHSP. Further studi es are necessary to determine the factor responsible for proliferation and CXCL8 produc tion, including proteomic analysis of the BHSP and functional assays of thes e species present in BHSP. We propose that the BHSP experiments ma y evolve into an animal model of B. henselae -induced angiogenesis. A rhesus macaque model of B. quintana infection was developed in which the levels of bacteria mi micked human infection (98). No infection

PAGE 79

70 model in mice has been successfully developed; Arvand et.al. showed bacterial presence up to one week after infecti on in C57/BL6 mice (8), afte r which the bacteria were cleared. Perhaps the BHSP could be used in an angiogenic model such as an in vivo matrigel in mice or the chicken embryo assay, which may circumvent the problems associated with clearance of B. henselae during mice infection. Endothelial cell mediators of angiogenesis induced by B. henselae contribute to the overall pathology in B. henselae infection. In this study we identified three mediators of angiogenesis induced from the endothelial ce ll as a result of b acterial factors: MCP-1, which brings the macrophage effector cell in to the site of infection; CXCL8, which directly promotes angiogenesis in an autocrine manner; and intracellular Ca2+ activity, which contributes to endothelial cell proliferation and NF B activation. These factors and others from peripheral cells culminate in the unique angiogenic lesions seen during B. henselae infection in the immunocompromise d. A better understanding of how B. henselae causes angio-proliferation could le ad to the development of improved therapeutics and contribute to the understan ding of interactions between intracellular bacteria and host cells.

PAGE 80

71 Literature Cited 1. Ades, E. W., F. J. Candal, R. A. Swerlic k, V. G. George, S. Summers, D. C. Bosse, and T. J. Lawley. 1992. HMEC-1: establishment of an immortalized human microvascular endothelial cell line. J Invest Dermatol 99: 683-90. 2. Alessandro, R., L. Masiero, L. A. Liotta, and E. C. Kohn. 1996. The role of calcium in the regulation of inva sion and angiogenesis. In Vivo 10: 153-60. 3. Alsmark, C. M., A. C. Frank, E. O. Ka rlberg, B. A. Legault, D. H. Ardell, B. Canback, A. S. Eriksson, A. K. Naslund, S. A. Handley, M. Huvet, B. La Scola, M. Holmberg, and S. G. Andersson. 2004. The louse-borne human pathogen Bartonella quintana is a genomic derivative of the zoonotic agent Bartonella henselae Proc Natl Acad Sci U S A 101: 9716-21. 4. Anderson, B. E., and M. A. Neuman. 1997. Bartonella spp. as emerging human pathogens. Clin Microbiol Rev 10: 203-19. 5. Anderson, B. E., and M. A. Neuman. 1997. Bartonella spp. as emerging human pathogens. Clin Microbiol Rev 10: 203-19. 6. Antoniazi, S., H. P. Price, P. Kropf, M. A. Freudenberg, C. Galanos, D. F. Smith, and I. Muller. 2004. Chemokine gene expre ssion in toll-like receptorcompetent and -deficient mice infected with Leishmania major. Infect Immun 72: 5168-74. 7. Arbeit, J. M., D. C. Olson, and D. Hanahan. 1996. Upregulation of fibroblast growth factors and their receptors duri ng multi-stage epidermal carcinogenesis in K14-HPV16 transgenic mice. Oncogene 13: 1847-57.

PAGE 81

72 8. Arvand, M., R. Ignatius, T. Regnath, H. Hahn, and M. E. Mielke. 2001. Bartonella henselae -specific cell-mediated im mune responses display a predominantly Th1 phenotype in experime ntally infected C57BL/6 mice. Infect Immun 69: 6427-33. 9. Batterman, H. J., J. A. Peek, J. S. Lout it, S. Falkow, and L. S. Tompkins. 1995. Bartonella henselae and Bartonella quintana adherence to and entry into cultured human epithelia l cells. Infect Immun 63: 4553-6. 10. Birkett, S. D., J. Y. Jeremy, S. M. Watts N. Shukla, G. D. Angelini, and C. A. McArdle. 1999. Inhibition of intracellu lar Ca2+ mobilisation by low antiproliferative concentrati ons of thapsigargin in human vascular smooth-muscle cells. J Cardiovasc Pharmacol 33: 204-11. 11. Birtles, R. J., T. G. Harrison, N. A. Saunders, and D. H. Molyneux. 1995. Proposals to unify the genera Grahamella and Bartonella, with descriptions of Bartonella talpae comb. nov., Bartonella peromysci comb. nov., and three new species, Bartonella grahamii sp. nov., Bartonella taylorii sp. nov., and Bartonella doshiae sp. nov. Int J Syst Bacteriol 45: 1-8. 12. Branley, J., C. Wolfson, P. Waters, T. Gottlieb, and R. Bradbury. 1996. Prevalence of Bartonella henselae bacteremia, the causative agent of cat scratch disease, in an Australi an cat population. Pathology 28: 262-5. 13. Brenner, D. J., S. P. O'Connor, H. H. Winkler, and A. G. Steigerwalt. 1993. Proposals to unify the genera Bartonella and Rochalimaea with descriptions of Bartonella quintana comb. nov., Bartonella vinsonii comb. nov., Bartonella henselae comb. nov., and Bartonella elizabethae comb. nov., and to remove the family Bartonellaceae from the order Ri ckettsiales. Int J Syst Bacteriol 43: 777-86. 14. Burgess, A. W., and B. E. Anderson. 1998. Outer membrane proteins of Bartonella henselae and their interaction with human endothelial cells. Microb Pathog 25: 157-64. 15. Carbone, M., H. I. Pass, P. Rizzo, M. Marinetti, M. Di Muzio, D. J. Mew, A. S. Levine, and A. Procopio. 1994. Simian virus 40-like DNA sequences in human pleural mesothelioma. Oncogene 9: 1781-90.

PAGE 82

73 16. Charo, I. F., S. J. Myers, A. Herman, C. Franci, A. J. Connolly, and S. R. Coughlin. 1994. Molecular cloning and functiona l expression of two monocyte chemoattractant protein 1 receptors reveal s alternative splicing of the carboxylterminal tails. Proc Natl Acad Sci U S A 91: 2752-6. 17. Chenoweth, M. R., C. E. Greene, D. C. Krause, and F. C. Gherardini. 2004. Predominant outer membrane antigens of Bartonella henselae Infect Immun 72: 3097-105. 18. Cho, N. H., S. Y. Seong, M. S. Choi, and I. S. Kim. 2001. Expression of chemokine genes in human dermal microva scular endothelial cell lines infected with Orientia tsutsugamushi. Infect Immun 69: 1265-72. 19. Chomel, B. B., R. C. Abbott, R. W. Kasten, K. A. Floyd-Hawkins, P. H. Kass, C. A. Glaser, N. C. Pedersen, and J. E. Koehler. 1995. Bartonella henselae prevalence in domestic cats in Californi a: risk factors and association between bacteremia and antibody tit ers. J Clin Microbiol 33: 2445-50. 20. Conley, T., L. Slater, and K. Hamilton. 1994. Rochalimaea species stimulate human endothelial cell pr oliferation and migration in vitro. J Lab Clin Med 124: 521-8. 21. Dehio, C. 2003. Recent progress in understand ing Bartonella-induced vascular proliferation. Curr Opin Microbiol 6: 61-5. 22. Dehio, C. 2005. Bartonella -host-cell interactions and vascular tumour formation. Nat Rev Microbiol 3: 621-31. 23. Doyle, S., S. Vaidya, R. O'Connell, H. Dadgostar, P. Dempsey, T. Wu, G. Rao, R. Sun, M. Haberland, R. Modlin, and G. Cheng. 2002. IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity 17: 251-63. 24. Fan, J., and A. B. Malik. 2003. Toll-like receptor-4 (TLR4) signaling augments chemokine-induced neutrophil migration by modulating cell surface expression of chemokine receptors. Nat Med 9: 315-21.

PAGE 83

74 25. Faure, E., O. Equils, P. A. Sieling, L. Thomas, F. X. Zhang, C. J. Kirschning, N. Polentarutti, M. Muzio, and M. Arditi. 2000. Bacterial lipopolysaccharide activates NF-kappaB through toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells. Differentia l expression of TLR-4 and TLR-2 in endothelial cells J Biol Chem 275: 11058-63. 26. Felder, C. C., L. MacArthur, A. L. Ma, F. Gusovsky, and E. C. Kohn. 1993. Tumor-suppressor function of muscarinic acetylcholine receptors is associated with activation of receptor-operated calci um influx. Proc Natl Acad Sci U S A 90: 1706-10. 27. Filip, C., G. Fletcher, J. L. Wulff, and C. F. Earhart. 1973. Solubilization of the cytoplasmic membrane of Escherichia coli by the ionic detergent sodiumlauryl sarcosinate. J Bacteriol 115: 717-22. 28. Flore, O., S. Rafii, S. Ely, J. J. O'Leary, E. M. Hyjek, and E. Cesarman. 1998. Transformation of primary human en dothelial cells by Kaposi's sarcomaassociated herpesvirus. Nature 394: 588-92. 29. Foley, J. E., B. Chomel, Y. Kikuchi, K. Yamamoto, and N. C. Pedersen. 1998. Seroprevalence of Bartonella henselae in cattery cats: association with cattery hygiene and flea infestation. Vet Q 20: 1-5. 30. Folkman, J., and Y. Shing. 1992. Angiogenesis. J Biol Chem 267: 10931-4. 31. Fournier, P. E., H. Lelievre, S. J. Eykyn, J. L. Mainardi, T. J. Marrie, F. Bruneel, C. Roure, J. Nash, D. Clave, E. James, C. Benoit-Lemercier, L. Deforges, H. Tissot-Dupont, and D. Raoult. 2001. Epidemiologic and clinical characteristics of Bartonella quintana and Bartonella henselae endocarditis: a study of 48 patients. Medicine (Baltimore) 80: 245-51. 32. Fuhrmann, O., M. Arvand, A. Gohler, M. Schmid, M. Krull, S. Hippenstiel, J. Seybold, C. Dehio, and N. Suttorp. 2001. Bartonella henselae induces NFkappaB-dependent upregulation of adhe sion molecules in cultured human endothelial cells: possible role of outer membrane protei ns as pathogenic factors. Infect Immun 69: 5088-97.

PAGE 84

75 33. Furutani, Y., H. Nomura, M. Notake, Y. Oyamada, T. Fukui, M. Yamada, C. G. Larsen, J. J. Oppenheim, and K. Matsushima. 1989. Cloning and sequencing of the cDNA for human monoc yte chemotactic and activating factor (MCAF). Biochem Biophys Res Commun 159: 249-55. 34. Griffioen, A. W., and G. Molema. 2000. Angiogenesis: potentials for pharmacologic intervention in the treatment of cancer, cardiovascular diseases, and chronic inflammation. Pharmacol Rev 52: 237-68. 35. Haake, D. A., T. A. Summers, A. M. McCoy, and W. Schwartzman. 1997. Heat shock response and groEL sequence of Bartonella henselae and Bartonella quintana Microbiology 143 ( Pt 8): 2807-15. 36. Hanahan, D., and J. Folkman. 1996. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 86: 353-64. 37. Houpikian, P., and D. Raoult. 2001. 16S/23S rRNA Intergenic Spacer Regions for Phylogenetic Analysis, Id entification, and Subtyping of Bartonella Species. J. Clin. Microbiol. %R 10.1128/JCM.39.8.2768-2778.2001 39: 2768-2778. 38. Inoue, K., J. W. Slaton, B. Y. Eve, S. J. Kim, P. Perrotte, M. D. Balbay, S. Yano, M. Bar-Eli, R. Radinsky, C. A. Pettaway, and C. P. Dinney. 2000. Interleukin 8 expression re gulates tumorigenicity and metastases in androgenindependent prostate cancer. Clin Cancer Res 6: 2104-19. 39. Jackson, L. A., B. A. Perkins, and J. D. Wenger. 1993. Cat scratch disease in the United States: an analysis of three national databases. Am J Public Health 83: 1707-11. 40. Ji, J., J. Sun, and L. Soong. 2003. Impaired expression of inflammatory cytokines and chemokines at early stag es of infection with Leishmania amazonensis. Infect Immun 71: 4278-88. 41. Kempf, V. A., B. Volkmann, M. Schaller, C. A. Sander, K. Alitalo, T. Riess, and I. B. Autenrieth. 2001. Evidence of a lead ing role for VEGF in Bartonella henselae -induced endothelial cell pro liferations. Cell Microbiol 3: 623-32.

PAGE 85

76 42. Kirby, J. E. 2004. In vitro model of Bartonella henselae -induced angiogenesis. Infect Immun 72: 7315-7. 43. Kirby, J. E., and D. M. Nekorchuk. 2002. Bartonella-associ ated endothelial proliferation depends on inhibition of apoptosis. Proc Natl Acad Sci U S A 99: 4656-61. 44. Kirby, J. E., and D. M. Nekorchuk. 2002. Bartonella -associated endothelial proliferation depends on inhibition of apoptosis. Proc Natl Acad Sci U S A 99: 4656-61. 45. Kobayashi-Sakamoto, M., E. Isogai, and K. Hirose. 2003. Porphyromonas gingivalis modulates the production of interle ukin 8 and monocyte chemotactic protein 1 in human vascular e ndothelial cells. Curr Microbiol 46: 109-14. 46. Koch, A. E., P. J. Polverini, S. L. Kunkel L. A. Harlow, L. A. DiPietro, V. M. Elner, S. G. Elner, and R. M. Strieter. 1992. Interleukin-8 as a macrophagederived mediator of angiogenesis. Science 258: 1798-801. 47. Koehler, J. E., C. A. Glaser, and J. W. Tappero. 1994. Rochalimaea henselae infection. A new zoonosis with the do mestic cat as re servoir. Jama 271: 531-5. 48. Koehler, J. E., M. A. Sanchez, C. S. Garrido, M. J. Whitfeld, F. M. Chen, T. G. Berger, M. C. Rodriguez-Barradas, P. E. LeBoit, and J. W. Tappero. 1997. Molecular epidemiology of bartonella in fections in patients with bacillary angiomatosis-peliosis. N Engl J Med 337: 1876-83. 49. LeBoit, P. E., T. G. Berger, B. M. Egbert, J. H. Beckstead, T. S. Yen, and M. H. Stoler. 1989. Bacillary angiomatosis. Th e histopathology and differential diagnosis of a pseudoneoplastic in fection in patients with human immunodeficiency virus disease. Am J Surg Pathol 13: 909-20. 50. LeBoit, P. E., T. G. Berger, B. M. Egbert, T. S. Yen, M. H. Stoler, T. A. Bonfiglio, J. A. Strauchen, C. K. English, and D. J. Wear. 1988. Epithelioid haemangioma-like vascular proliferation in AIDS: manifestation of cat scratch disease bacillus infection? Lancet 1: 960-3.

PAGE 86

77 51. Leonard, E. J., and T. Yoshimura. 1990. Human monocyte chemoattractant protein-1 (MCP-1). Immunol Today 11: 97-101. 52. Li, A., S. Dubey, M. L. Varney, B. J. Dave, and R. K. Singh. 2003. IL-8 directly enhanced endothelial cell su rvival, proliferation, and matrix metalloproteinases production and re gulated angiogenesis. J Immunol 170: 336976. 53. Li, A., S. Dubey, M. L. Varney, and R. K. Singh. 2002. Interleukin-8-induced proliferation, survival, and MMP pr oduction in CXCR1 and CXCR2 expressing human umbilical vein endothelial cells. Microvasc Res 64: 476-81. 54. Liberto, M. C., G. Matera, A. G. Lamberti, G. S. Barreca, A. Quirino, and A. Foca. 2003. In vitro Bartonella quintana in fection modulates the programmed cell death and inflammatory reac tion of endothelial cells. Di agn Microbiol Infect Dis 45: 107-15. 55. Lopez-Ocejo, O., A. Viloria-Petit, M. Bequet-Romero, D. Mukhopadhyay, J. Rak, and R. S. Kerbel. 2000. Oncogenes and tumor angiogenesis: the HPV-16 E6 oncoprotein activates the vascular e ndothelial growth f actor (VEGF) gene promoter in a p53 independent manner. Oncogene 19: 4611-20. 56. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J Biol Chem 193: 265-75. 57. Luster, A. D. 2002. The role of chemokines in linking innate and adaptive immunity. Curr Opin Immunol 14: 129-35. 58. Mackman, N. 1994. Protease inhibitors block lipopolysaccharide induction of tissue factor gene expression in human monocytic cells by preventing activation of c-Rel/p65 heterodimers. J Biol Chem 269: 26363-7. 59. Maeno, N., H. Oda, K. Yoshiie, M. R. Wahid, T. Fujimura, and S. Matayoshi. 1999. Live Bartonella henselae enhances endothelial ce ll proliferation without direct contact. Microb Pathog 27: 419-27.

PAGE 87

78 60. Maeno, N., K. Yoshiie, S. Matayoshi, T. Fujimura, S. Mao, M. R. Wahid, and H. Oda. 2002. A heat-stable component of Bartonella henselae upregulates intercellular adhesion molecule-1 expressi on on vascular endothelial cells. Scand J Immunol 55: 366-72. 61. Majewski, S., A. Szmurlo, M. Marczak, S. Jablonska, and W. Bollag. 1994. Synergistic effect of retinoids and interferon alpha on tumor-induced angiogenesis: anti-angiogenic effect on HPV-harboring tumor-cell lines. Int J Cancer 57: 81-5. 62. Matera, G., M. C. Liberto, A. Quirin o, G. S. Barreca, A. G. Lamberti, M. Iannone, E. Mancuso, E. Palma, F. A. Cufari, D. Rotiroti, and A. Foca. 2003. Bartonella quintana lipopolysaccharide effects on leukocytes, CXC chemokines and apoptosis: a study on the human whole blood and a rat model. Int Immunopharmacol 3: 853-64. 63. Minnick, M. F., L. S. Smitherman, and D. S. Samuels. 2003. Mitogenic effect of Bartonella bacilliformis on human vascular endotheli al cells and involvement of GroEL. Infect Immun 71: 6933-42. 64. Monteil, R. A., J. F. Michiels, P. Hofman, M. C. Saint-Paul, C. Hitzig, C. Perrin, and J. Santini. 1994. Histological and ultrastr uctural study of one case of oral bacillary angiomatosis in HIV dis ease and review of th e literature. Eur J Cancer B Oral Oncol 30B: 65-71. 65. Moody, T. W., and F. Cuttitta. 1993. Growth factor and peptide receptors in small cell lung cancer. Life Sci 52: 1161-73. 66. Munoz, C., D. Pascual-Salcedo, M. C. Castellanos, A. Alfranca, J. Aragones, A. Vara, M. J. Redondo, and M. O. de Landazuri. 1996. Pyrrolidine dithiocarbamate inhibits the production of interleukin-6, interleukin-8, and granulocyte-macrophage colony-stimulating factor by human endothelial cells in response to inflammatory mediators: modulation of NF-kappa B and AP-1 transcription factors activity. Blood 88: 3482-90. 67. Murdoch, C., P. N. Monk, and A. Finn. 1999. Cxc chemokine receptor expression on human endothe lial cells. Cytokine 11: 704-12.

PAGE 88

79 68. Nakashima, E., N. Mukaida, Y. Kubota, K. Kuno, K. Yasumoto, F. Ichimura, I. Nakanishi, M. Miyasaka, and K. Matsushima. 1995. Human MCAF gene transfer enhances the metastatic capac ity of a mouse cachectic adenocarcinoma cell line in vivo. Pharm Res 12: 1598-604. 69. Niemann, H. H., W. D. Schubert, and D. W. Heinz. 2004. Adhesins and invasins of pathogenic bacteria: a structural view. Microbes Infect 6: 101-12. 70. Regnery, R. L., B. E. Anderson, J. E. Clarridge, 3rd, M. C. RodriguezBarradas, D. C. Jones, and J. H. Carr. 1992. Characterization of a novel Rochalimaea species, R. henselae sp. nov., isolated from blood of a febrile, human immunodeficiency virus-positive patient. J Clin Microbiol 30: 265-74. 71. Resto-Ruiz, S. I., M. Schmiederer, D. Sweger, C. Newton, T. W. Klein, H. Friedman, and B. E. Anderson. 2002. Induction of a potential paracrine angiogenic loop between human THP-1 macrophages and human microvascular endothelial cells during Bartonella henselae infection. Infect Immun 70: 4564-70. 72. Riess, T., S. G. Andersson, A. Lupas, M. Schaller, A. Schafer, P. Kyme, J. Martin, J. H. Walzlein, U. Ehehalt, H. Lindroos, M. Schirle, A. Nordheim, I. B. Autenrieth, and V. A. Kempf. 2004. Bartonella adhesin a mediates a proangiogenic host cell response. J Exp Med 200: 1267-78. 73. Roebuck, K. A., L. R. Carpenter, V. Lakshminarayanan, S. M. Page, J. N. Moy, and L. L. Thomas. 1999. Stimulus-specific regulation of chemokine expression involves differential activation of the redox-responsive transcription factors AP-1 and NF-kappaB. J Leukoc Biol 65: 291-8. 74. Salcedo, R., M. L. Ponce, H. A. Young, K. Wasserman, J. M. Ward, H. K. Kleinman, J. J. Oppenheim, and W. J. Murphy. 2000. Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood 96: 34-40. 75. Savarese, D. M., J. T. Russell, A. Fatatis, and L. A. Liotta. 1992. Type IV collagen stimulates an increase in intrace llular calcium. Potential role in tumor cell motility. J Biol Chem 267: 21928-35.

PAGE 89

80 76. Schaefer, T. M., K. Desouza, J. V. Fa hey, K. W. Beagley, and C. R. Wira. 2004. Toll-like receptor (TLR) e xpression and TLR-mediated cytokine/chemokine prod uction by human uterine ep ithelial cells. Immunology 112: 428-36. 77. Schmid, M. C., R. Schulein, M. Dehio, G. Denecker, I. Carena, and C. Dehio. 2004. The VirB type IV secretion syst em of Bartonella henselae mediates invasion, proinflammatory activation and antiapoptotic protec tion of endothelial cells. Mol Microbiol 52: 81-92. 78. Schmidt, K. N., E. B. Traenckner, B. Meier, and P. A. Baeuerle. 1995. Induction of oxidative stress by okadaic acid is required for activation of transcription factor NF-kappa B. J Biol Chem 270: 27136-42. 79. Schmiederer, M., R. Arcenas, R. Widen, N. Valkov, and B. Anderson. 2001. Intracellular induction of the Bartonella henselae virB operon by human endothelial cells. Infect Immun 69: 6495-502. 80. Schulein, R., P. Guye, T. A. Rhomberg, M. C. Schmid, G. Schroder, A. C. Vergunst, I. Carena, and C. Dehio. 2005. A bipartite signal mediates the transfer of type IV s ecretion substrates of Bartonella henselae into human cells. Proc Natl Acad Sci U S A 102: 856-61. 81. Shamaei-Tousi, A., R. Cahill, and G. Frankel. 2004. Interaction between protein subunits of the ty pe IV secretion system of Bartonella henselae. J Bacteriol 186: 4796-801. 82. Shukla, N., N. Freeman, P. Gadsdon, G. D. Angelini, and J. Y. Jeremy. 2001. Thapsigargin inhibits angiogenesis in the ra t isolated aorta: st udies on the role of intracellular calcium pools. Cardiovasc Res 49: 681-9. 83. Shukla, N., J. Y. Jeremy, P. Nicholl, B. Krijgsman, G. Stansby, and G. Hamilton. 1997. Short-term exposure to low concentrations of thapsigargin inhibits replication of cultured human vascular smooth muscle cells. Br J Surg 84: 325-30.

PAGE 90

81 84. Singh, R. K., M. L. Varney, K. Ino, J. M. Vose, P. J. Bierman, and J. E. Talmadge. 2000. Immune dysfunction despite hi gh levels of immunoregulatory cytokine gene expression in autologous peripheral blood stem cell transplanted non-Hodgkin's lymphoma patients. Exp Hematol 28: 499-507. 85. Smith, D. R., P. J. Polverini, S. L. Kunkel M. B. Orringer, R. I. Whyte, M. D. Burdick, C. A. Wilke, and R. M. Strieter. 1994. Inhibition of interleukin 8 attenuates angiogenesis in bronc hogenic carcinoma. J Exp Med 179: 1409-15. 86. Stoler, M. H., T. A. Bonfiglio, R. T. Steigbigel, and M. Pereira. 1983. An atypical subcutaneous infection associat ed with acquired immune deficiency syndrome. Am J Clin Pathol 80: 714-8. 87. Takigawa, M., Y. Nishida, F. Suzuki J. Kishi, K. Yamashita, and T. Hayakawa. 1990. Induction of angiogenesis in chick yolk-sac membrane by polyamines and its inhibition by tissue inhibitors of me talloproteinases (TIMP and TIMP-2). Biochem Biophys Res Commun 171: 1264-71. 88. Toi, M., A. L. Harris, and R. Bicknell. 1991. Interleukin-4 is a potent mitogen for capillary endothelium. Biochem Biophys Res Commun 174: 1287-93. 89. Tsuboi, N., Y. Yoshikai, S. Matsuo, T. Kikuchi, K. Iwami, Y. Nagai, O. Takeuchi, S. Akira, and T. Matsuguchi. 2002. Roles of toll-like receptors in CC chemokine production by renal tu bular epithelial cells. J Immunol 169: 2026-33. 90. Tsuchiya, S., M. Yamabe, Y. Yamaguchi, Y. Kobayashi, T. Konno, and K. Tada. 1980. Establishment and characteriz ation of a human acute monocytic leukemia cell line (THP-1). Int J Cancer 26: 171-6. 91. Ueda, A., Y. Ishigatsubo, T. Okubo, and T. Yoshimura. 1997. Transcriptional regulation of the human monocyte chemoa ttractant protein-1 gene. Cooperation of two NF-kappaB sites and NF-kappaB/Re l subunit specificity. J Biol Chem 272: 31092-9.

PAGE 91

82 92. van den Akker, W. M. 1998. Lipopolysaccharide expression within the genus Bordetella : influence of temperature a nd phase variation. Microbiology 144 ( Pt 6): 1527-35. 93. Wang, J. M., A. Sica, G. Peri, S. Walter, I. M. Padura, P. Libby, M. Ceska, I. Lindley, F. Colotta, and A. Mantovani. 1991. Expression of monocyte chemotactic protein and in terleukin-8 by cytokine-act ivated human vascular smooth muscle cells. Arterioscler Thromb 11: 1166-74. 94. Wang, Y., G. K. Rangan, B. Goodwi n, Y. C. Tay, and D. C. Harris. 2000. Lipopolysaccharide-induced MCP-1 gene expr ession in rat tubular epithelial cells is nuclear factor-kappaB dependent. Kidney Int 57: 2011-22. 95. Yang, S. K., L. Eckmann, A. Panja, and M. F. Kagnoff. 1997. Differential and regulated expression of C-X-C, C-C, and C-chemokines by human colon epithelial cells. Gastroenterology 113: 1214-23. 96. Yoshimura, T., N. Yuhki, S. K. Moore, E. Appella, M. I. Lerman, and E. J. Leonard. 1989. Human monocyte chemoattractant protein-1 (MCP-1). Fulllength cDNA cloning, expression in m itogen-stimulated blood mononuclear leukocytes, and sequence similarity to mouse competence gene JE. FEBS Lett 244: 487-93. 97. Zahringer, U., B. Lindner, Y. A. Knir el, W. M. van den Akker, R. Hiestand, H. Heine, and C. Dehio. 2004. Structure and biological activity of the shortchain lipopolysaccharide from Bartonella henselae ATCC 49882T. J Biol Chem 279: 21046-54. 98. Zhang, P., B. B. Chomel, M. K. Schau, J. S. Goo, S. Droz, K. L. Kelminson, S. S. George, N. W. Lerche, and J. E. Koehler. 2004. A family of variably expressed outer-membrane proteins (Vomp) mediates adhesion and autoaggregation in Bartonella quintana PNAS %R 10.1073/pnas.0405284101 101: 13630-13635. 99. Zhao, B., R. A. Bowden, S. A. Stavchansky, and P. D. Bowman. 2001. Human endothelial cell response to gram-nega tive lipopolysaccharide assessed with cDNA microarrays. Am J Physiol Cell Physiol 281: C1587-95.

PAGE 92

83 Presentation of Studies Publications resulting from these stud ies include one first-authored paper published, one first-authored paper in press, and one manuscript in preparation. These results were also presented in part as posters at the Amer ican Society for Microbiology general meetings and as an oral presentati on at the American Society for Microbiology Southeastern Branch meeting. These pres entations and papers are listed below. McCord AM Cuevas J, Anderson B. B. henselae secreted proteins activate intracellular calcium stores in endothelial ce lls (manuscript in preparation). McCord AM Resto-Ruiz, SI, Anderson B. 2006. An autocrine role for IL-8 in Bartonella henselae -induced angiogenesis. Infect Immun (in press). McCord AM Burgess AW, Whaley M, Ande rson B. 2005. Interaction of Bartonella henselae with endothelial cells pr omotes monocyte/macrophage chemoattractant protein 1 gene expression and protein production and triggers monocyte migration. Infect Immun 73(9):5735-42.

PAGE 93

84 Poster Presentation A.M. McCord J. Cuevas, B. Anderson. (upcoming, May 2006). Bartonella henselae upregulates pro-angioge nic effectors in endothe lial cells leading to autocrine promotion of angiogenesis. Am erican Society for Microbiology General Meeting, Orlando, FL. Oral Presentation Amy M. McCord Sandra Resto-Ruiz, Burt E. Anderson. 2005. IL-8 Plays an Autocrine Role in Bartonella henselae -Induced Endothelial Cell Proliferation and Inhibition of Apoptosis. Southeastern Br anch of American Society for Microbiology Annual Meeting, St. Petersburg, Florida. Poster Presentation A.M. McCord A.W. Burgess, B. Anderson. 2005. Infection of Endothelial Cells with Bartonella henselae Increases Monocyte-Macrophage Chemotattractant Protein-1 Expression a nd Promotes Monocyte Chemotaxis. American Society for Microbiology Ge neral Meeting, Atlanta, GA. Poster Presentation S.I. Resto-Ruiz, A. McCord P. Baldi, M. Whaley, B. Anderson. 2004. Induction of Vascular Endothelial Growth Factor by Substances Secreted from Bartonella henselae. American Society for Microbiol ogy General Meeting, New Orleans, LA.

PAGE 94

About the Author Amy Marie McCord completed her undergradu ate education at the University of Florida where she was recognized as a Nati onal Merit Scholar and a Florida Bright Futures Scholar and received her B.S. in Mi crobiology and Cell Science. She entered the University of South Florida in 2001 as a gradua te student in the depa rtment of Medical Microbiology and Immunology. While at USF, she has received two Outstanding Presentation Awards during the Health Sciences Research Day and wa s recognized as an alternate for a national travel award from the American Society for Microbiology. She also was awarded Distinc tion for this dissertion.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001909879
003 fts
005 20070921132237.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 070921s2006 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001675
040
FHM
c FHM
035
(OCoLC)173225675
049
FHMM
090
QR46 (ONLINE)
1 100
McCord, Amy M.
0 245
Endothelial cell mediators of angiogenesis in Bartonella henselae infection
h [electronic resource] /
by Amy M. McCord.
260
[Tampa, Fla] :
b University of South Florida,
2006.
3 520
ABSTRACT: Bacillary angiomatosis (BA), one of the clinical manifestations resulting from infection with the facultative intracellular bacterium Bartonella henselae, is characterized by angiogenic lesions. Endothelial cells have been identified as host cells for this pathogen and are presumed important for pathogenesis as lesions contain bacteria in direct contact with the endothelium. Lesions also contain infiltrating macrophages, which contribute to the angiogenic process during B. henselae infection by secreting vascular endothelial growth factor (VEGF). While virulence factors have been characterized, and the role for macrophages in B. henselae infection has been established, endothelial cell mediators of angiogenesis have not been well defined. We investigated three potentially important pathways that are triggered by the bacterial interactions with endothelial cells. We examined the ability of endothelial cells to upregulate the chemokines monocyte-macrophage chemoattracta nt protein-1 (MCP-1) and CXCL8 and the mechanism by which B. henselae secreted proteins (BHSP) induce endothelial cell proliferation. We determined that MCP-1 production is upregulated in response to B. henselae infection, which very likely contributes to angiogenic lesion formation by recruiting the VEGF-secreting macrophage. The chemokine CXCL8 is an important mediator of angiogenesis which can cause endothelial cell survival, proliferation, and capillary tube formation. We determined that CXCL8 is secreted from B. henselae-infected cells and contributes to B. henselae-induced angiogenesis in an autocrine manner. We also investigated the role of Ca2+ signaling during B. henselae infection. We determined that BHSP induce a robust intracellular Ca2+ response in HUVEC which originates from intracellular Ca2+ pools. Additionally, endothelial cell proliferation in response to BHSP required Ca2+ activity, indicating a role for intracellular Ca2+ pools during B. henselae-induced angio genesis. Endothelial cell proliferation during B. henselae infection possibly indicates a mechanism by which a pathogen induces proliferation of its host cell in order to propagate its own survival. Numerous factors culminate in the vascular lesions that are characteristic of BA. B. henselae infection represents an important and unique model for pathogen-triggered angiogenesis, and studies into the specific mechanisms of this process may elucidate host cell-pathogen interactions as well as pathways of pathogenic angiogenesis.
502
Dissertation (Ph.D.)--University of South Florida, 2006.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 84 pages.
Includes vita.
590
Adviser: Burt Anderson, Ph.D.
653
Cat scratch disease.
Bartonellosis.
Bacillary angiomatosis.
Apoptosis.
Chemokines.
CXCL8.
MCP-1.
690
Dissertations, Academic
z USF
x Medical Microbiology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1675