USF Libraries
USF Digital Collections

Cloning and analysis of putative collegenases of the U32 family in Stretococcus mutans and Stretococcus agalactiae (Grou...

MISSING IMAGE

Material Information

Title:
Cloning and analysis of putative collegenases of the U32 family in Stretococcus mutans and Stretococcus agalactiae (Group B Stretococcus)
Physical Description:
Book
Language:
English
Creator:
Carson, Valerie
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Collagen
U32 peptidase
Dental root decay
Preterm labor
Fetal membrane
Dissertations, Academic -- Biology -- Masters -- USF
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Analysis of the genomic sequences of Streptococcus mutans UA159 and Group B Streptococcus (GBS) strains Streptococcus agalactiae NEM316 and S. agalactiae 2603V/R indicated the presence of two putative collagenase genes in each organism. smcol1 from S. mutans was previously cloned and analyzed and the results indicated that the enzyme belonged to the U32 family of collagenases/peptidases. This enzyme shares homology with the prtC of Porphyromonas gingivalis, one of the principal examples of the U32 family of peptidases. Considering the potential role of these enzymes in the pathogenicity of P. gingivalis (periodontitis or gum disease), GBS (premature rupture of the amniochorionic membrane) and S. mutans (dental root decay), it is necessary to study these enzymes and establish their role in the virulence of these organisms. Toward this goal the present study has focused on cloning collagenase 2 (smcol2) from S. mutans and cloning collagenase 1 (gbscol1), and collagenase 2 (gbscol2), from GBS. The information obtained will contribute to a further understanding of the U32 peptidase family.
Thesis:
Thesis (M.A.)--University of South Florida, 2006.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Valerie Carson.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 53 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001910910
oclc - 173617844
usfldc doi - E14-SFE0001721
usfldc handle - e14.1721
System ID:
SFS0026039:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001910910
003 fts
005 20071002142311.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 071002s2006 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001721
040
FHM
c FHM
035
(OCoLC)173617844
049
FHMM
090
QH307.2 (ONLINE)
1 100
Carson, Valerie.
0 245
Cloning and analysis of putative collegenases of the U32 family in Stretococcus mutans and Stretococcus agalactiae (Group B Stretococcus)
h [electronic resource] /
by Valerie Carson.
260
[Tampa, Fla] :
b University of South Florida,
2006.
3 520
ABSTRACT: Analysis of the genomic sequences of Streptococcus mutans UA159 and Group B Streptococcus (GBS) strains Streptococcus agalactiae NEM316 and S. agalactiae 2603V/R indicated the presence of two putative collagenase genes in each organism. smcol1 from S. mutans was previously cloned and analyzed and the results indicated that the enzyme belonged to the U32 family of collagenases/peptidases. This enzyme shares homology with the prtC of Porphyromonas gingivalis, one of the principal examples of the U32 family of peptidases. Considering the potential role of these enzymes in the pathogenicity of P. gingivalis (periodontitis or gum disease), GBS (premature rupture of the amniochorionic membrane) and S. mutans (dental root decay), it is necessary to study these enzymes and establish their role in the virulence of these organisms. Toward this goal the present study has focused on cloning collagenase 2 (smcol2) from S. mutans and cloning collagenase 1 (gbscol1), and collagenase 2 (gbscol2), from GBS. The information obtained will contribute to a further understanding of the U32 peptidase family.
502
Thesis (M.A.)--University of South Florida, 2006.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 53 pages.
590
Adviser: My Lien Dao, Ph.D.
653
Collagen.
U32 peptidase.
Dental root decay.
Preterm labor.
Fetal membrane.
690
Dissertations, Academic
z USF
x Biology
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1721



PAGE 1

Cloning and Analysis of Putative Coll agenases of the U32 Family in Streptococcus mutans and Streptococcus agalactiae (Group B Streptococci) By Valerie Carson A thesis submitted in partial fulfillment of the requirement s for the degree of Master of Science Department of Biology College of Arts and Sciences University of South Florida Major Professor: My Lien Dao, Ph.D. Daniel Lim, Ph.D. Valerie J. Harwood, Ph.D. Date of Approval: July 18, 2006 Keywords: collagen, U32 peptidase, dental root decay, preterm labor, fetal membrane Copyright 2006, Valerie Carson

PAGE 2

AKNOWLEDGEMENTS I would like to start out by thanking my ma jor professor, Dr. My Lien Dao, for her guidance, support, and her profound knowledge during my graduate studies. Being in her lab has taught me valuable less ons that I will carry on in my career. I would also like to thank my committee members, Dr. Daniel Lim, Dr. Valerie (Jody) Harwood and Dr. Andrew Cannons, for their va luable counsel and words of encouragement. I would also like to thank my colleagues, Theresa Trindade, Crystal Bedenbaugh and Ross Myer s, for their positive interaction during my studies. I would like to thank my family, especia lly my parents for believing in me and being so proud of me. I am truly blessed to have such a wonderful, supportive family. Last but not least, I would like to thank my husband, Chris, and daughter, Keira. They are the driving force that has gott en me through the tough times. I thank them for their patience and understanding dur ing this time. I love you guys with all my heart.

PAGE 3

i TABLE OF CONTENTS LIST OF FIGURES iii LIST OF TABLES iv ABSTRACT v INTRODUCTION 1 MATERIALS AND METHODS 12 Chemicals and Reagents 12 Bacterial Stains and Growth Conditions 12 Bioi nformatical Analysis 13 Isolation of Genomic DNA 13 PCR Amplification of S. mutans and S. agalactiae Genomic DNA 14 Cloning of the smcol2, gbscol1 and gbscol2 Genes into the pBAD-TOPO TA Vector 16 Analysis of the Recombinant Plasmids 18 Expression of the Reco mbinant Proteins 19 SDS-PAGE Analysis of Gene Expression in Recombinant E. coli 20 Western Blot Analysis of His-tagged Fusion Proteins 20 Purification of the Recombinant Proteins 22 Protein Concentration 22 Gelatinase Assay 23 Blue Collagenase Assay 23 RESULTS 25 Compar ative Analysis between Puta tive Collagenase Genes of S. mutans and GBS 25 Alignment Analysis 26 BLAST Results 25 T ables of Homology 29 PCR Amplification and Cloning of the smcol2, gbscol1 and gbscol2 genes into the pBAD-TOPO Vector 34 Expression and Detection of pBAD/smcol2 through induction with Arabinose, SDSPAGE and Western Blot 40 Purification of the Polyhistidi ne (6xHis) Tagged Fusion Proteins smcolsp, smcolwosp, gbscol1 and gbscol2 42 Gelatinase Assay 44 Blue Collagenase Assay 45

PAGE 4

ii DISCUSSION 46 REFERENCES 50

PAGE 5

iii LIST OF FIGURES Figure 1 Map of the expression vector pBAD TOPO TA 17 Figure 2 Alignm ent of homology for smcol1 27 Figure 3 Alignm ent of homology for smcol2 27 Figure 4 Phylogram 28 Figure 5 PCR results using S. mutans GS-5 genomic DNA and cu stom designed primers for smcol2 36 Figure 6 Confirmation of su ccessful insertion and orientation of the smcol2 PCR products into the pBAD vector using pBAD forward primer and the inserts reverse primer 37 Figure 7 PCR results using S. agalactiae USF704 genomic DNA and customdesigned primers for gbscol1 and gbscol2 38 Figure 8 PCR confirmation of successful insertion in the pBAD Vector 38 Figure 9 Western Blot of smcol2sp and smcol2wosp 40 Figure 10 Immunodot of induced clones 42 Figure 11 SDS-PAGE of purified recombinant enzymes 42 Figure 12 Western Blot of purified enzymes 43 Figure 13 Results of Blue Collagen Assay 44 Figure 14 Blue Collagenase Assay 45 Figure 15 Results of Blue Collagenase Assay 45

PAGE 6

iv LIST OF TABLES Table 1 PCR primers us ed in the amplification of smcol2 15 Table 2 Genes selected for fu rther bioinformatical analysis 26 Table 3 Homology of smcol2 30 Table 4 Homology of gbscol1 31 Table 5 Homology of gbscol2 32 Table 6 Primers designed for t he cloning into the pBAD vector and the anticipated molecular weight of the amplified product 34 Table 7 pBAD clones and the anticipated protein size, including the p BAD vector, and pI 41 Table 8 Raw data from Blue Collagenase Assay 44

PAGE 7

v Cloning and Analysis of Putative Co llagenases of the U32 Family in Streptococcus mutans and Streptococcus agalactiae (Group B Streptococci) Valerie Carson ABSTRACT Analysis of the genomic sequences of Streptococcus mutans UA159 and Group B Streptococcus (GBS) strains Streptococcus agalactiae NEM316 and S. agalactiae 2603V/R indicated the presence of two putative collagenase genes in each organism. smcol1 from S. mutans was previously cloned and analyzed and the results indicated that the en zyme belonged to the U32 family of collagenases/peptidases. This en zyme shares homology with the prtC of Porphyromonas gingivalis, one of the principal examples of the U32 family of peptidases. Considering the potential role of these enzymes in the pathogenicity of P. gingivalis (periodontitis or gum disease), GBS (premature rupture of the amniochorionic membrane) and S. mutans (dental root decay), it is necessary to study these enzymes and establish their role in the virulence of these organisms. Toward this goal the present study has focused on cloning collagenase 2 ( smcol2 ) from S. mutans and cloning collagenase 1 ( gbscol1), and collagenase 2 ( gbscol2), from GBS. The information obt ained will contribute to a further understanding of the U32 peptidase family.

PAGE 8

1 INTRODUCTION Collagen is a major structural protei n in our bodies, making up a large percentage of human tissue, from the skin to the tendons, eyes, bones, amniotic membrane and teeth. In the mouth, colla gen is one of the main components of gingival connective tissue and it is found in the matrix of alveolar bone and cementum, dentin of t he tooth and in the basement membrane beneath the gingival epithelium (37). Periodontal tissue is made up primarily of type I collagen, which is made up of three parallel polypeptid e chains composed of the sequence Gly-X-Y, with X representing proline and Y representing hydroxyproline. These amino acids give collagen stability and restrict the rotation of the polypeptide backbone (10) Collagen is extremely resistant to degradation because of its tightly coiled triple helix structure that is stabilized by hydrogen bonds and cross-linking and can only be cleaved by collagenases (20). Until recently it was thought that onl y a few species of bacteria produced collagenases, namely Clostridium and Vibrio alginolyticus but numerous other human pathogens have also been reported to have the ability to break down collagen (17). The specificity of bacterial collagenases is very broad and, unlike vertebrate collagenases that are more specific in their cleavage sites (33), bacterial collagenases are capable of hydr olyzing denatured as well as native collagen. Gelatin is produced when collagen loses its triple helix structure and

PAGE 9

2 becomes denatured. Numerous mammalia n proteases are able to hydrolyze gelatin, including pepsin, tryp sin and papain. Hydrolysis of collagen may help in bacterial infection and spreading, henc e collagenase has been considered as a virulence factor and the focu s of numerous studies. The most widely studied collagenas e is a metalloprotease produced by Clostridium histolyticum (32) that requires a zinc mole cule to retain its hydrolytic activity (47). This zinc-metalloprotease is unique in that it is able to cleave denatured and native collagen (32). Subsequently, C. histolyticum has been found to produce different types of coll agenases, which are separated into two classes based on their amino ac id sequences and peptide substrate requirements (31). C. histolyticum colH is a 116 kDa collagenase that co-purifies with a 98 kDa protein, which cleaves denat ured collagen, but not native collagen (47). Because they share identical N-te rminal sequences and peptide maps, it is believed that the 98 kDa gelatinase is produced by the cleavage of the Cterminal end of the 116 kDa collagenase (32). C. histolyticum also produces another collagenase, ColG. It was found that colG and colH are less than 760 kb apart on C. histolyticums genome. It is hypothesized that the presence of these similar clostridial collagenase genes is due to gene duplication and later divergence (31). Periodontitis is a collection of diseases involving the destruction of structural proteins in the oral cavity (37) Periodo ntal diseases, which are characterized by the destruction of collagen, vary in severity depending on the stage of development, age of the patient and re action to treatment. Degradation of

PAGE 10

3 gingival connective tissue, the supporting structure of t he tooth, including type I collagen, leads to periodontal lesions. Nu merous studies have shown that in regions of periodontal tissue degradation, extensive collagenase activity is evident (38). Collagenase activity by bacteria of the oral cavity were first discovered in the 1960s (17). Hence, an understanding of how bacteria interact with collagen of the periodontiu m is a necessary tool in the understanding of their pathogenecity. A common bacterium isolated from infected individuals suffering from advanced periodontitis is Porphyromonas gingivalis (27). This organism has collagenases, one of which is encoded by prtC. The prtC enzyme was found to be able to break down soluble type I colla gen (38), as well as fibrillar collagen; however it could not degr ade the synthetic collagenase substrate, PZ-PLGPA, gelatin nor denatured type I co llagen (27). The ability of P. gingivalis to cleave native type I collagen was eliminated by the inactivation of one of the two genes encoding Arg-gingipain A or B (20), suggesting that the collagenase activity of P. gingivalis requires the action of both enzymes (27). It was also found that the activity of these two enzymes is dependent on their association with the bacterial cell wall, given that purifi ed enzymes showed no activity (20). Indeed, prtC was classified in the U32 family of pepti dases/collagenases based on the presence of a consensus sequence. One of the most widespread and expensive infectious di seases in the world is dental caries (11), of which S. mutans is the primary etiological agent. It has been found that if oral st reptococci are inhibited on the root surface, the

PAGE 11

4 development of dental caries is greatly diminished (40). Dental caries results from the acidic end pr oducts produced by the metabolism of fermentable carbohydrates in the diet. This drastica lly decreases the pH in the oral cavity which leads to the dissolution of the tooth enamel and root surface (45). Dental caries is a public health problem world-wide, hence ext ensive research effort has focused on developing means to prevent th is infectious disease. Kassab et al, determined that approximately 24 million people in the United States have tooth surfaces that have 3 millim eters or greater of gingival recession and that the occurrence of gingival recession incr eased with age and was higher in men compared to women of the same age (26). Fluoridat ion of water and dental hygiene showed limited success. With current medical research, the average life span has greatly increased, but along with this, the occurrence of dental root decay has also increased. Dentin, unlike the tooth crown, is made up of organic components and hydroxyapatite, an inorganic material (10) The organic component of dentin is composed of about 90% type I collagen, citrate, lipid s and non-collagenous proteins. Root caries begin by exposur e of the root surf ace to the oral environment via recession of the gum and subsequently the exposed dentin becomes vulnerable to microbial infecti on, which can lead to loss of the tooth (10). Gingival recession, which is defined as the dislocation of the gingival tissue and exposure of the root, can be localized or generalized (26). It has recently been shown that greater than 50% of t he general populatio n had one or more locations with gingival recession of 1 m illimeter or greater Many factors are

PAGE 12

5 associated with gingival recession, incl uding age, lack of alveolar bone, the abnormal tooth position, and vigorous toot h brushing (26). The main factors involved in the progression of root caries is the invasion of bacteria into the dentin and fermentable carbohy drates derived from the hosts diet (5). Development of root and coronal caries differs greatly. Root caries involve the decomposition of dentin minerals whil e coronal caries involves enamel demineralization. Root surface caries seem to be more complex in their treatment and pathology as compared to coronal caries although both types of caries involve acidic demineralization ( 10). The rate at which coronal and root caries proceeds also differs. The destruc tion of dentin transpires about twice as quickly as the demineralizatio n of the enamel, due to the fact that the crown is composed of almost double the amount of minerals (5). One study showed that the microflora that co lonized isolated dentin specimens from patients were composed of a diverse community of bacteria (41). Numerous microorganisms have been isolated from root caries lesions including, Actinomyces spp, Streptococcus spp, and Lactobacillus spp (3). It has been found that Actinomyces and Streptococcus where the dominant species isolated from root surface lesions (41). S. mutans is routinely found in root caries plaque samples and has been shown to be one of the major players in root caries disease (3). It has also been found that the inhibi tion of streptococci at the root surface leads to the dec line of root caries (42). S. mutans produces a number of proteins that are associated with its cell wall and have b een implicated as virulence factors, hence they ar e the focus of research regarding S. mutans

PAGE 13

6 and dental caries (15, 40). Antibodies against these antigens could possibly thwart the development of dental caries by S. mutans The main objective for an anti-dental caries vaccine would be to prevent S. mutans from attaching and adhering to oral tissues, which could lead to the prevention of tooth decay on the surface and root of the tooth. With the increasing technology in recombinant DNA techniques, research has focused on identifying and isolating genes involved in the pathogenicity of S. mutans Numerous genes that are involved in coronal caries, such as polymer-fo rming glucosyltransferases, fructosyltransferases, and wall associated prot ein A have been cl oned and sequenced (12, 45). In studies where cell wall fr actions were exposed to proteases, animals that were immunized with the suspens ion were not protected against dental caries (13). Indeed, the i dentification of thes e cell-surface protei ns as potential immunogens against dental caries shoul d be further investigated. Degradation of collagen in tissues of the dento-epit helial seam leads to the development of a region that has a redox potential level t hat is lower than that of the surrounding tissue (17). This environ ment promotes the colonization of anaerobic organisms which can lead to per iodontal disease. Infection with S. mutans has been shown to degrade the periodontal ligament, instigate the massive loss of bone, wh ile the production of collagenase activity in this organism was substantiated by its ability to hydrolyze collagen fibrils in rat tail tendons (17, 18). S. mutans has been found in human root surface carious lesions and is able to bind collagen type I and II (22). S. mutans has been shown to possess two extracellular proteases that can hydrolyze PZ-PLGPA and

PAGE 14

7 breakdown type I collagen (18). It is speculated that these enzymes may be a factor in the degradation of collagen of the dent in and cementum of the oral cavity (17). Switalski et al. (42) found that S. mutans was able to bind collagen in dentin and that it ma y have a profound effect on the development of root surface caries. It was also demonstrated that S. mutans strain GS-5 was capable of breaking down alveolar bone and collagen of the peri odontal ligament (18). Jackson et al demonstrated cell-associated collagenase activities in S. mutans (22). It was found that S. mutans was able to bind coll agen and that cell lysate from S. mutans cross-reacted with antis erum to collagenase from C. histolyticum (22). These characteristics taken together lend to the fact that S. mutans plays a considerable role in the pa thogenesis of dentinal caries. These virulent factors may aid S. mutans in maintaining its environmental niche in the oral cavity and contribute to its abi lity to cause host tissue damage. A great deal of focus has been dire cted on producing a vaccine against coronal caries (16, 24), but this will hav e no effect on the colonization of dental root by S. mutans and subsequent destruction of t he root dentine. While coronal caries involves surface adhesins with bind ing affinity for salivary pellicles and glucan-binding proteins (42), dental root decay is mediated by collagen-binding protein and collagen degrading enzymes. More research is needed in order to identify and characterize the factors involved in dental root caries in order to develop specific prophylactic measures. Streptococcus agalactiae also referred to as Group B streptococci (GBS), is the leading cause of seve re neonatal bacterial infe ctions, including pneumonia,

PAGE 15

8 sepsis and meningitis. In the Unit ed States, about 10,000 instances of GBS infections occur with a 15% mortality rati o (28, 36), being responsible for two to three cases per 1000 live births (14). GBS can be found living asymptomatically in the vaginal epithelium and the lower gast rointestinal tract of healthy adults. GBS has a competitive advantag e over other microflora in the vaginal epithelium since it is able to attach to the epithelium and survive in the low pH environment. It is estimated that 10-40% of women who are pregnant are infected with GBS and that 40-70% of these women transmit the bacterium to their child (7). Human newborns contract GBS when th ey pass through the birth canal or swallow infected amniotic fl uid from their mother (30) GBS does not only infect neonates and pregnant women, it also affects people with chronic conditions and the elderly. The incidence of invasive GB S infections has steadily increased in recent years for the immunocompromised and the elderly to numbers similar to the incidence of the new born population (30). Most newborn that become infected with GBS do not develop disease, but the r ange of virulence factors attributed to GBS can lead to infection when the infants immune system fails. These virulence factors include its ab ility to hinder the newborns defensive system, factors that allow the organism to infect the bloodstream and deep tissue by its ability to invade the epithelial and endothelial barriers, the production of toxins, and mechanisms that allow inflammato ry reactions in the host (30). When an infant is born prematur ely, the likelihood that the infected newborn will become symptomatic is greatly increased. Generally, 1-3% of infected babies develop early-onset disease (sepsis and m eningitis) within the first 24 hours after

PAGE 16

9 birth (7). It has been suggest ed that vaginal infection or inflammation is linked to preterm rupture of the am niotic membrane and preterm labor (44). Labor before 37 weeks gestation is considered preterm labor (PTL) and delivery (PTD) and is usually preceded by pre-mature rupture of membranes (PPROM) (39). PTL and PTD is generally caused by such factors as: smoking, alcoho lism, poor nutrition, health disorders, PROM, multiple gestati on, placental abruption and bacterial infection (39). The main cause of PPROM and PTL can be contributed to bacterial infections (39). About 12% of pregnancies in 2001 were caused by preterm birth, with the number of pr eterm babies being born progressively increasing (39). In premature labors, it has been found that there is a decreased concentration of collagen (44). The fe tal membrane is composed of collagen types I, III, and V (2), with type I and ty pe V giving the amni otic membrane its strength (35). It is hypothesized that GBS may be involv ed in the premature rupture of the amniotic tissue based on the fact that infection with th is organism was associated with the degradation of t he amniochorionic membrane and on its ability to degrade the synthetic peptide FALGPA, which mimics colla gen (23). However, it was found that GBS was inca pable of degrading a film of reconstituted rat tail collagen (30). Lin et al (29) further isolated and tested the suspected collagenase and speculated that it was not a collagenase but an oligopeptidase, belonging to the M3 oligope ptidase family of metallopep tidases. Since the paper has been published, two strains of S. agalactiae 2603V/R (43) and NEM316 (14), have been sequenced and submitted online at www.ncbi.nlm.nih.gov

PAGE 17

10 Based on sequence analysis of both strains, it was found that S. agalactiae does indeed have a gene ( gbs0824 from strain NEM316 and SAG0805 from strain 2603V/R) similar to pepF from Lactococcus lactis (66.4% identity, data not shown), which is also an M3 oligopept idase and displayed many of the same properties as members of this family. Peptidases are categorized into clans and families where clans represent sets of families that share common ancestr y and families are arranged by their catalytic specifications. The peptidas e clan Ubelongs to MEROPS peptidase family U32 of the clan Uand has an un known catalytic mechanism. It also contains the consensus pattern: E-x-F-x( 2)-G-[SA]-[LIVM]-C-x(4)-G-x-C-x-[LIVM]S. The most studied peptidase of this family is the prtC collagenase from Porphyromonas gingivalis which is capable of degrading type I collagen and may require a metal cofactor. It is abl e to degrade soluble type I collagen but not gelatin or synthetic co llagenase substrates. The availability of sequenced genomes online has allowed a more thorough search and analysis of bacterial g enomes. And with the convenience of molecular genomics, such as PCR and cloning into expre ssion vectors, it is now possible to easily and efficiently study virulence factors from pathogens. Recently, our lab has isolated and characterized a collagenase gene ( smcol1) of the U32 peptidase family from S. mutans (Ioannides, Biology MS thesis, USF, 2004). smcol1 was cloned and expressed in Escherichia coli and the recombinant protein was purified and studied. The smcol1 was shown to be identical to the SMU.761 protease in S. mutans UA159.

PAGE 18

11 Preliminary analysis of the S. mutans UA159 indicated the presence of another putative collagenase (col2) encoded by a gene upstream from smcol1 (SMU.759). Similar enzymes to S. mutans col1 and col2 were also identified in the analysis of GBS NEM316 a nd 2603V/R genomic sequences ( gbs0762 and gbs0763 in GBS NEM316, and SAG0741 and SAG0742 in strain 2603V/R). The goal of the present study was to clone smcol2, gbscol1 and gbscol2 into E. coli TOP10 using the arabinose-inducible ex pression vector system pBAD TOPO TA (Invitrogen), which allows the ex pression and purific ation of soluble recombinant His-tagged protein. Recombinant proteins will be analyzed for collagenase and gelatinase acti vity. The results obtained in the present studies will add to our understanding of S. mutans and GBS role in their respective pathogenicity.

PAGE 19

12 MATERIALS AND METHODS Chemicals and Reagents Primers for PCR were produced by Operon Biotechnologies (Huntsville, AL). PCR reagents, restriction enzymes, The Wizard Genomic DNA Purification Kit and The Wizard Plus Minipreps Plas mid DNA Purification System were obtained from Promega Inc. (Madison, WI ) and used in accordance to the manufacturers protocols. The expression vector, pBAD TOPO TA was obtained from Invitrogen Life Technologies (Carlsbad, CA). All other reagents and chemicals were purchased from SigmaAldrich Co. (St. Louis, MO), Fisher Scientific (Pittsburg, PA), or Bio-Rad Laboratories (Hercules, CA) unless otherwise specified. Bacterial Strains and Growth Conditions S. mutans GS-5 serotype c, was initially obtained from J. J. Ferretti (University of Oklahoma Health Scienc es Center, Oklahoma City, OK). GBS USF704 (serotype Ib/c, , ) is a -hemolytic clinical isol ate originally obtained from a septic newborn and was acquired from Dr. Daniel Lim (University of South Florida Department of Biology and Center for Biological Defense, Tampa, FL). Both strains were cultured at 37C in BHI broth with 5% CO 2 Chemically competent E. coli TOP10 cells were obtained from Invitrogen and used in the

PAGE 20

13 cloning and expression of all recombinant plasmids. Lur ia-Bertani (LB) medium (Difco, Detroit, MI) containing 100 g/ml ampicillin (LBA) was used in the selection of transformants and the culturi ng of recombinant cl ones expressing the collagenase genes. Bioinformatical Analysis The sequences used for the cloning a nd analysis of the co llagenase 2 gene ( smcol2 ) from S. mutans and the collagenase 1 ( gbscol1), and collagenase 2 ( gbscol2) genes from GBS were obtained fr om the National Center for Biotechnology Information (NCBI) Entr ez server. The sequenced genomes of S. mutans UA159 (Accession # AE0141) and S. agalactiae NEM316 serotype III strain (Accession # AL732656 ) and S. agalactiae 2603V/R serotype V (Accession # AE009948 ) were used for the genomic analysis of the collagenases. Alignment analysis was performed using the ClustalW WWW Service at the European Bioinformatics In stitute (19). Signa l peptide analysis was derived from PSIPRED Protein St ructure Prediction Server (25, 34). Isolation of Genomic DNA The isolation of genomic DNA wa s accomplished using a genomic DNA purification kit (Promegas Wizard). T he isolation was performed according to the manufacturers protocol. Briefly, 1 ml from an overnight culture was centrifuged at 16,000 x g fo r 2 minutes and the supernatant removed. The cell pellet was resuspended in 480 l of 50 mM EDTA. 120 l of 10 mg/ml of

PAGE 21

14 lysozyme was added to the cell suspension and incubated at 37C for 1 hour to weaken the cell wall. The samples were centrifuged at 16,000 x g for 2 minutes. The supernatant was removed and 600 l of Nuclei Lysis Solution was added to the samples and incubated at 80C for 5 mi nutes to lyse the cells. The solution was cooled to room temperature. 3 l of RNase Solution was added to the cell lysate and incubated at 37C for 45 minutes. 200 l of Protein Precipitation Solution was added to the RNase-treated cell lysate and incubated for 5 minutes on ice. The samples were then centrif uged at 16,000 x g for 3 minutes. The supernatant containing the DNA was trans ferred to a clean 1.5 microcentrifuge tube and 600 l of room temperature isopropanol wa s gently mixed with the DNA. The mixture was cent rifuged at 16,000 x g for 2 minutes. The supernatant was gently aspirated off and 70% et hanol was added to the pellet. The suspension was again centrifuged at 16, 000 x g for 2 minutes and the ethanol aspirated. The pellet was allowed to air dry for 3 hours and 100 l of DNA Rehydration Solution was added to rehydrate the DN A pellet. The purity and concentration of the DNA was determined by analysis on a 1% agarose gel and measurement on the SmartS pec Plus Spectrophotometer (Bio-Rad Hercules, CA). PCR Amplification of S. mutans and S. agalactiae Genomic DNA Using purified genomic DNA from S. mutans GS-5 as a template, PCR was performed to amplify the collagenase 2 gene ( smcol2 ). Primers were designed based on the sequenced genome of S. mutans UA159 (9). Four primer sets

PAGE 22

15 were developed to amplify the gene with and withou t the signal peptide. The gene was also amplified with and without the native stop in order to include the V5 epitope and the polyhistidine region of the pBAD vector. PCR was performed using four different primer se ts (Table 1) to amplify the smcol2 gene from S. mutans GS-5 genomic DNA under the following conditions: an initial denaturation step at 95C for 2 minutes. Then 30 cycles of the following: 95C for 1 minute (denaturation step), 1 minute at the corre sponding annealing temperature for the specific primer (annealing step), and 72C for 1 minute (e xtension step). Lastly, a final extension step was done at 72C for 10 minutes The PCR mixture used contained the following: 12.5 l of PCR Master Mix (Promega), 0.2 M of the forward primer, 0.2 M of the reverse primer, 25 ng of genomic DNA, and 10.5 l of H 2 O. The PCR products were analyzed by electrophoresis on a 1% agarose gel. The DNA was stained wit h ethidium bromide and viewed under ultraviolet light. smcol2 Clones Forward Primer Reverse Primer Annealing Temp Clone 1 Includes the signal peptide 5ATGGAAAAAA TTGTTATCACT GCGACTGC Contains native stop 5TTACTTAAC TGTTTGCGG ATCAAGC 55.0C Clone 2 Includes the signal peptide 5ATGGAAAAAA TTGTTATCACT GCGACTGC Does not contain native stop 5CTTAACTGT TTGCGGATC AAGC 56.8C Clone 3 Excludes the signal peptide 5AATATTAAAC CATTTTTAGAA TTAATGAAGGA AATTCAG Contains native stop 5TTACTTAAC TGTTTGCGG ATCAAGC 55.4C Clone 4 Excludes the signal peptide 5AATATTAAAC CATTTTTAGAA TTAATGAAGGA AATTCAG Does not contain native stop 5CTTAACTGT TTGCGGATC AAGC 55.4C Table 1. PCR primers used in the amplification of smcol2

PAGE 23

16 The sequences for genes SAG0741, SAG0742, gbs0762 and gbs0763 of S.agalactiae 2603V/R (43) and S. agalactiae NEM316 (14), respectively, were used to develop primers for the gbscol1 and gbscol2 genes. The reason for this selection is based on the highest hom ology each one has with the corresponding enzyme in S. mutans SAG0742 and gbs0763 were used to design primers for gbscol1 Forward = 5 ATGTCTAATGTAAAAAAACGCCCT Reverse = 5 AGCTCTTACAGTCTTGCTAG SAG0741 and gbs0762 were used to design primers for gbscol2 Forward = 5 ATGG AAAAAATAATTTTGACAGCGAC Reverse = 5 TTTTACTGTTGATGGGTCAAAATC PCR conditions were optimized for t he specific primers and the conditions were as described above. The spec ific annealing temperature for the gbscol1 primers was 52.7C and 51.6C for gbscol2 primers (Operon Biotechnologies). Cloning of the smcol2, gbscol1 and gbscol2 Genes into the pBAD-TOPO TA Vector Once the correct size of the PCR produc ts was verified on a 1% agarose gel, the products were cloned into the pBAD TOPO TA vector (Figure 1). Briefly, for the cloning reaction, 2 l of fresh PCR product was mixed with 1 l of pBAD vector, 1 l of salt soluti on (1.2 M NaCl and 0.06 M MgCl 2 ) and 1 l of H 2 O and allowed to incubate at 24C for 5 minutes The cloning mixture was then placed

PAGE 24

on ice and 2 l was mixed with 250 l of One Shot TOP10 Chemically Competent E. coli cells (Invitrogen). The cells were incubated on ice for 15 minutes. Transformation was by heat shock treatment: 30 seconds in a 42C water bath followed by immediate cooling on ice. 250 l of S.O.C. medium (Invitrogen) was added to the cells and they were horizontally incubated at 37C for one hour with shaking. Finally, 20 l and 40 l samples were cultured on pre-warmed LBA plates. The plates were incubated for 24 hours at 37C. After incubation, five ampicillin resistant (Amp R ) clones from each cloning reactions were chosen at random for further screening of each gene. Figure 1. Map of the expression vector pBAD TOPO TA (Invitrogen) 17

PAGE 25

18 Analysis of the Recombinant Plasmids Plasmid DNA was isolated from the clones using the FastPlasmid Mini kit from Eppendorf (Westbury, NY) following the manufacturers protocol. Briefly, the Amp R transformants containing the recomb inant plasmids were grown in LBA for 16 hours at 37C with shaking. 1.5 l of each culture was centrifuged at 16,000 x g for 1 minute and the supernatant was removed. 400 l of the Lysis Solution was added to the pellet and re suspended with vigorous mixing. The mixture was then incubated for 3 minute at 24C. The lysate was removed and transferred to a spin column assembly t hat was then centrif uged for 1 minute at 16,000 x g. The spin column assembly was washed with 400 l of diluted wash buffer and centrifuged for 1 minute. The so lution in the bottom of the tube was decanted and the spin column assembly was centrifuged for an additional minute to remove any excess isopropanol from t he assembly. The spin column was then transferred to a clean tube and the plasmid DNA was eluted off by adding 30 l of elution buffer and centrifugi ng at 16,000 x g for 1 minute. The presence of the inserts was veri fied by PCR using the reverse and forward primers specific for each clone. Once the insert was confirmed to be present, clones that were positive for t he insert were analyzed to determine that the PCR product had been inserted in the correct orientation and was in frame with the C-terminal histidine residues. To test for this, the pBAD Forward primer (5 ATGCCATAGCATTTTTATCC) was used with the specific inserts reverse primer. Use of the pBAD Forward primer adds 179 bp to the PCR product. Once

PAGE 26

19 the PCR had been verified by electrophoresis of the P CR product on an agarose gel, one of the clones produc ing a band of the correct size was chosen and stored frozen in glycerol at -80 C as the laboratory stock strain. Expression of the Recombinant Proteins Pilot expression experiments were per formed on pBAD/smcol2 clones #2 and #4, pBAD/gbscol1, and pBAD/gbscol2 to determine the optimal concentration of arabinose for induction of the clones and the expression of the recombinant proteins. pBAD/smcol2 clones # 2 and # 4 were chosen for further analysis since they allowed for the producti on of the polyhistidine (6x) fusion protein tag, with and without the signal peptide, respectively. They were further termed pBAD/smcol2sp, pBAD/smcol2wosp, res pectively. pBAD/smcol2 clones #1 and #3 were prepared in previsi on of potential problem with enzyme activity being influenced by the polyhistidine fusion prot ein tag (since this problem did not occur, these two clones were not analyze d further). The expression experiment was done according to the manufacturers protocol. Briefly, the recombinant clones were inoculated into 2 ml of LBA broth (100 g/ml ampicillin) and grown for 24 hours at 37C with constant shaking. The following day, 0.1 ml of the overnight cultures was added to 10 ml of LBA and allowed to continue incubating at 37C with constant shaking. The cu ltures were allowed to grow to an OD 600 of 0.5, approximately 2.5 hours. A 1 ml sample of each culture was taken and the cells were sedimented by centrifugation. The supernatant was aspirated and the pellets were frozen for a zero time point sample. For each clon e, cultures were

PAGE 27

20 induced at five different concentrati ons of L-arabinose: 0.2%, 0.02%, 0.002%, 0.0002%, and 0.00002%. Un-induced cultures were also grown that did not have L-arabinose added to it. The cells were th en allowed to grow for an additional 4 hours at 37C with constant shaking. Ea ch culture was centrifuged to pellet the cells. The supernatant was aspirated and the samples were frozen for further analysis. SDS-PAGE Analysis of Gene Expression in Recombinant E. coli To determine if the recombinant bacteri a produced the protein of interest, the samples obtained above were analyzed by electrophoresis on a 10% SDSPolyacrylamide gel (1 mm). The cell pel lets were thawed, resuspended in 20 l of 1x SDS-PAGE Sample Buffer (Bio-R ad) and boiled in a water bath for 5 minutes. The samples were then separ ated by electrophoresis using a MiniProtean II Electrophoresis Cell (Bio-Rad) at 200V for 1 hour. Once the samples were separated through the gel, the gel was stained with 0.1% Coomassie blue R-250 (in 40% methanol and 10% acetic acid) for one hour, then was destained by incubation in a destaining solution (40% methanol and 10% acetic acid). Numerous washes were used to totally destain the gel and obtain sharp protein bands stained in blue.

PAGE 28

21 Western Blot Analysis of His-Tagged Fusion Protein A Western immunoblot was performed by separating the samples by SDSPAGE and then transferring them to a nitr ocellulose membrane. The proteins were transferred to the nitrocellulose fo r one hour at 30V and 100 mA, with an ice pack and constant stirring of the buffer us ing a Mini Trans-Blot electrophoretic transfer cell (Bio-Rad). The membrane was then blocked for 16 hours in 10 ml of Western Blot Blocking Solu tion (5% dry milk in PBS containing 0.05% Tween 20 with) with gentle agitation. Next, the membrane was washed twice with 10 ml of Western Blot Wash Buffer (PBS and 2% Tween 20) for 10 minutes each wash. The primary antibody, murine anti-HisG (Invitrogen), was diluted 1:5000 in Blocking Solution and incubated with the ni trocellulose for one hour at 24C with gentle agitation. The antibody was wa shed away with two washes of Wash Buffer, 10 minutes each wash. Next, the membrane was incubated with the secondary antibody, anti-mouse IgG an tibody (Sigma) diluted 1:30,000 in Blocking Buffer, for one hour at 24C with gentle agitat ion. The membrane was washed again with Wash buffer, twic e for 10 minutes each wash and then developed. The nitrocellulose was develop ed via Daos method (8). Briefly, the membrane is incubated with sodium bor ate buffer (60mM sodium tetraborate, 10mM magnesium sulfate, pH 9.7) cont aining 0.025% of O-dianisidine and 0.025% of -naphthyl acid phosphate. After a 1 hour incubation in the buffer, the membrane was fixed by incubating in Immunoblot Fixing Buffer (methanol: H2O: acetic acid, 4:5:1). The membrane was then rinsed in de ionized water and allowed to dry.

PAGE 29

22 Purification of Recombinant Proteins A fresh culture of the cl ones from the glycerol froz en stock was streaked onto LBA plates and grown for 24 hours at 37C. A culture of competent cells that contained the empty pBAD vector was used as a negative control. The recombinant clones were grown and i nduced as described above using the optimal concentration of arabinose. The fusion proteins were purified using Qiagens Ni-NTA Fast Start Superflow Columns. Pu rification was performed under native conditions and as described by the manufacturer. The cell pellet was resuspended in 10 ml of native lysi s buffer, containing lysozyme and benzonase and incubated on ice for 30 min. The lysate was centrifuged at 14,000 x g for 30 minutes at 4C to pellet the cellular debris. The Fast Start Columns were drained of the shipping buffer and the supernatant containing the soluble fraction of the recombinant pr otein was applied to the column. The column was washed twice with 4 ml of Native Wash Buffer. The bound 6x Histagged protein was eluted out with two 1 ml a liquots of Native Elution Buffer. The samples were analyzed by SDS-PAGE and Western Blot as described above.

PAGE 30

23 Protein Concentration The protein concentration of all samples were determined by the BCA Protein Assay developed by Bradford (4 ). Briefly, a serial dilution of Bovine Serum Albumin (BSA) was prepared and assayed along with the samples to be tested. After addition of the BCA Wo rking Reagent (Sigma) to t he samples, they were incubated for 15 minutes at 60C and the absorption was read at OD 595 The values obtained from the BSA were used to develop a standard curve, which was used to determine the protein concentration of the test samples. Gelatinase assay X-ray film coated with gelatin was stained with Coomassie blue R250, and used to assay for gelatinase activity. Ten l of each purifi ed sample obtained above was dotted onto the stained X-ray film, which was then placed in a humid chamber (box with a piece of wet paper to wel placed at the bottom). Incubation was at 37 o C for 16 hours, at which time the film was placed under running faucet water. Dots containing digested gelat inase were identified by a cleared zone exposing the shiny film backing.

PAGE 31

24 Collagenase Assay Controls for the coll agenase assay included C. histolyticum collagenase as a positive control and trypsin as a negative control. Purified SmCol2 with or without the signal peptide, GBSCol1 with the signal peptide and GBSCol2 with the signal peptide were prepared as fo llows: The samples were prepared by growing 30 ml cultures for 24 hours at 37 C. The following day, the cells were pelleted and the supernatant removed. T he pellet was resuspended in 5 ml of Gelatinase Assay Buffer (GAB: Tris-HCl with CaCl 2 at pH 7.4) and freeze-thawed 3 times on dry ice and a 42C water bath. The cells were then sonicated with short bursts and centrifuged at 8,000 X g for 25 minutes. The supernatant was poured off into clean tubes and the pellet was resuspended in 5 ml of assay Buffer (50mM Tris buffer, 5 mM CaCl 2 added at 5mM, pH 7.4). Purified fusion proteins were isolated as described ab ove and assayed for collagenase activity using a specific blue co llagenase substrate developed in our laboratory (Dao, unpublished method). Briefly, 100 l of each sample (each sample was approximately 600 g/ml) were incubat ed separately with 1 ml suspension of approximately 15 mg blue collagen type I from bovine tendon in assay buffer. The enzymatic assay using blue collagen was referred to as blue collagenase assay (proprietary method). After in cubation in an incubator shaker at 37 o C, followed by centrifugation, degradation of collagen result ed in the blue coloration of the supernatant, which was quantified by measuring the absorbance of the blue dye at 500nm (OD 500nm) using a spectrophotometer.

PAGE 32

25 RESULTS Comparative Analysis between Putative Collagenase Genes of S. mutans and GBS The completed genomes of S. mutans UA159 (9), S agalactiae strain NEM316 serotype III (14) and S. agalactiae strain 2603V/R serotype V (43) have been sequenced and, hence were used for this study. Analysis of the genomic sequence of S. mutans UA159 revealed two proteases related to collagenase (SMU.759 and SMU.761). These genes were used to find similar genes in Group B streptococci and compare t heir sequences with other known collagenases from C. histolyticum and P. gingivalis A BLink ("BLAST Link") was performed using SMU.759 and SMU761 sequences. It was found that SAG0741 from S. agalactiae 2603V/R showed the highest similarities with SMU.759 (78% homology, Figure 3) and SAG0742 from S. agalactiae 2603V/R showed the highest similarities with SMU.761 (78% homology, Figure 2). These genes were used for further analysis. SMU.761 was found to be 100% identical to smcol1 cloned recently in our lab from GS-5 (NCBI Accession # AY644675) (21). SMU.761 will be termed smcol1 and SMU. 759 will be termed smcol2 for the remainder of this study. The most closely related genes were selected for further analysis (Table 2).

PAGE 33

26 Alignment Analysis Comparative analysis of the deduced amino acid se quence of the genes of interest was done using the alignment pr ogram, ClustalW WWW Service at the European Bioinformatics Institut e (6) (Table 2). SMU.761 ( smcol1 ) showed high homology to SAG0742 from S. agalactiae 2604V/R (78%) and gbs0763 from S. agalactiae NEM316 (78%) (Figure 2). Minimal similarity was observed between smcol1 and colG (2%) or colH (2%). SMU.759 ( smcol2 ) was found to have significant similarities with SAG0741 from S. agalactiae 2604V/R (77%) and gbs0762 from S. agalactiae NEM316 (78%) (Figure 3), Minimal similarity was found to colG and colH 7% and 5% respectively. Only 9% homology was observed between smcol2 and smcol1 Based on the sequence ali gnment, it was found that S. agalactiae 2603V/R and S. agalactiae NEM316 presented parallel results with the sequences used (Figure 2 and 3). Hence, SAG0742 an d gbs0763 were determined to be the same gene, as SAG0741 and gbs0762. They were termed gbscol1 and gbscol2, respectively. Or g anism Gene Protein Function Streptococcus mutans UA159 SMU.759 Putative colla g enase Streptococcus mutans UA159 SMU.761 Putative colla g enase Streptococcus agalactiae 2603V/R SAG074 2 Peptidase, U32 Streptococcus agalactiae NEM316 g bs076 3 H y pothetical protein Streptococcus agalactiae 2603V/R SAG0741 H y pothetical protein Streptococcus agalactiae NEM316 g bs076 2 H y pothetical protein Clostridium histol y ticum colH Colla g enase Clostridium histol y ticum colG Colla g enase Porph y romonas g in g ivali s p rt C Colla g enase Table 2. Genes selected for fu rther bioinformatical analysis.

PAGE 34

Alignment Scores for smcol10102030405060708090smcol2gbscol1 2603 V/Rgbscol1 NEM31 6 gbscol2 2603 V/Rgbscol2 NEM31 6 colHcolGprtCGenesAlignment Score (% homology) Figure 2. Alignment of homology for smcol1 Alignment Scores for smcol20102030405060708090smcol1gbscol1 2603 V/ R gbscol1 NEM31 6 gbscol2 2603 V/ R gbscol2 NEM31 6 colHcolGprtCGenesAlignment Score (% homology) Figure 3. Alignment of homology for smcol2 27

PAGE 35

Figure 4. Phylogram. Estimated phylogeny between the selected genes. Branch lengths are proportional to the amount of inferred evolutionary change. Tables of Homology The sequence of smcol2, gbscol1 and gbscol2 was used as a query to identify homologous genes in other bacteria and to deduce the corresponding amino acid sequence and associated biochemical characteristics. The BLAST analysis indicated high homology with the U32 family of peptidases and collagenases of other related organisms (Tables 4, 5, and 6). By using the S. mutans UA159 smcol2 sequence as a query, a BLAST search showed 197 hits to 119 unique species (Table 3). Analysis of the deduced amino acid sequence showed notable homology with Streptococcus suis collagenase (79%), Streptococcus pyogenes putative protease (77%) and S. 28

PAGE 36

29 pyogenes peptidase family U32 (76%). It also showed homology to U32 peptidases of Enterococcus faecalis (53%) and Bacillus anthracis (31%). Using the gbscol1 sequence as a query, a BLAST analysis was done to determine which genes carried the most ho mology (Table 4). As expected, the collagenases and U32 peptidases of Str eptococcal species shared the highest homology to gbscol1 ranging from 99%-82%. It was found that gbscol1 had 77% and 74% homology to Lactococcus lactis collagenase and Enterococcus faecium U32 peptidase, respectively. It was also found that U3 2 peptidases from Listeria monocytogenes and Staphylococcus epidermidis had 63% and 49% homology, respectively. Using the sequence of gbscol2 from S. agalactiae NEM316, a BLAST search was performed to compare it to other organisms (Table 5). It was found that it shared high hom ology with other Streptoc occal collagenases and peptidases of the U32 family: 79% homology with S. pyogenes 76% homology with S. suis 72% homology with Streptococcus pneumoniae and 67% Streptococcus thermophilus. It was also found that it shared 56% homology with L. lactis and 55% homology with U32 peptidases from Enterococcus species. Lastly, it was found that gbscol2 had 30% homology to U32 peptidases from Bacillus species.

PAGE 37

Table 3. smcol2 homologous genes 30

PAGE 38

Table 4. gbscol1 homologous genes 31

PAGE 39

Table 5. gbscol2 homologous genes 32

PAGE 40

33 PCR Amplification and Cloning of the smcol2, gbscol1 and gbscol2 genes into the pBAD-TOPO Vector Using genomic DNA from S. mutans GS-5 as a template, PCR was used to amplify smcol2 The primers were designed based on the sequenced genome of S. mutans UA159 (9) and the PCR product obtai ned was cloned into the pBAD TOPO TA Cloning vector (Invitrogen). The pBAD vector employs TOPO Cloning, an easy and efficient method of cloning PCR products. The linearized vector has 3 deoxyribose thymidine (dT) overhangs that are complementary to the deoxyribose adenosine (dA) overhangs added by Taq polymerase to the 3 end of PCR products. This allows for the direct incorporation of PCR amplicons by Taq polymerase into the linearized plas mid vector. With TOPO Cloning, Topoisomerase I from Vaccinia virus is bound to the plasmid vector. This enzyme binds duplex DNA at specific sites and cleaves the phosphodiester bonds on the vector backbone. Th e energy generated from the broken phosphodiester backbone creates a high e nergy covalent bond between a tyrosyl residue of the enzyme and the phosphate residue of the cleaved DNA. This leads to the release of Topoisomerase I through the attack of the phospho-tyrosyl bond between the enzyme and the DNA by the 5 hydroxyl of the original cleaved strand. PCR products cloned into pBAD are regulated for expression in E. coli The expression of the PCR product in E. coli is determined by the araBAD promoter (pBAD). The pBAD-TOP O plasmid encodes for the AraC gene product, which positively regulates this pr omoter. The expression of the pBAD vector is controlled through the presence of L-arabinose. When L-arabinose is

PAGE 41

34 not present, transcription from pBAD is ex tremely low, while expression of pBAD is turned on in the presence of L-arabinose. Protein expression levels can be optimized by varying the concentration of L-arabinose. Four primer sets were developed to amplify the gene with and without the signal peptide. The gene wa s also amplified with and wit hout the native stop. In order to include the V5 epitope and the pol yhistidine region of the pBAD vector, the native stop must be removed. Once the PCR conditions were optimized for the four primer sets and the P CR product had been verified on agarose gel electrophoresis (Figure 5), it was cloned into the pBAD vector. The cloning reaction mixt ure was used to transform E. coli TOP10 cells. After an overnight incubation, each primer se t produced numerous transformants. Five ampicillin resistant (Amp R ) transformants of each pBAD clone were chosen at random for further screeni ng. Plasmid DNA was isolated from the clones and the presence of the insert was verifi ed through PCR using the above primers. Clones that produced plasmid that wa s positive for the corresponding PCR product were subjected to further testing. Forward Primer Reverse Primer MW of PCR Product Clone 1 Includes the signal peptide Contains native stop 927 bp Clone 2 Includes the signal peptide Does not contain native stop 924 bp Clone 3 Excludes the signal peptide Contains native stop 702 bp Clone 4 Excludes the signal peptide Does not contain native stop 699 bp Table 6. Primers designed for the cl oning into the pBAD vector and the anticipated molecular weight of the amplified product

PAGE 42

35 Once the insert had been confirmed to be present, the clones were analyzed to determine that the PCR product had been inserted in the correct orientation and were in frame with the C-terminal His tag. pBAD # 1 only produced one clone that had the insert in the correct ori entation, a band at 11 06 bp (Figure 6A). This lone clone was used for further investigation. Of the 5 clones screened, pBAD # 2 had two clones in the correct orientation which produced bands at 1103 bp (Figure 6B). Figure 6C shows pB AD # 3 and pBAD # 4 also had two clones, respectively, with the insert in the correct orientation and anticipated size; 881 bp and 878 bp for pBAD # 3 and pBAD # 4, respectively. Based on the PCR results, it was concluded that the smcol2 had been successfully cloned into the pBAD vector. One clone that produced positive results for the PCR was randomly chosen for further analysis. The cloning of the gbscol1 and gbscol2 was as described for smcol2 Primers were designed based on the sequenc ed genome of S. agalactiae 2603V/R and S. agalactiae NEM316 for the gbscol1 and gbscol2 gene. Once PCR conditions had been optimized, the pr oducts were cloned in the pBAD vector (Figure 7).

PAGE 43

36 Figure 5. PCR results using S. mutans GS-5 genomic DNA and custom designed primers for smcol2 A. Lane 1: Molecular weight standard Lane 2: PCR product for pBAD clone # 1 = 927 bp B. Lane 1: Molecular weight standard Lane 2: PCR product for pBAD clone # 2 = 924 bp C. Lane 1: Molecular weight standard Lane 2: PCR product for pBAD clone # 3 = 702 bp Lane 3: PCR product for pBAD clone # 4 = 699 bp

PAGE 44

Figure 6. Confirmation of successful insertion and orientation of the smcol2 PCR products into the pBAD vector using pBAD forward primer and the inserts reverse primer A. Lane 1: Molecular weight standard Lane 2: PCR conformation for pBAD clone # 1 = 1106 bp B. Lane 1: Molecular weight standard Lane 2: PCR confirmation for pBAD clone # 2a = 1103 bp Lane 3: PCR confirmation for pBAD clone # 2b = 1103 bp C. Lane 1: Molecular weight standard Lane 2: PCR confirmation for pBAD clone # 3a = 881 bp Lane 3: PCR confirmation for pBAD clone # 3b = 881 bp Lane 4: PCR confirmation for pBAD clone # 4a = 878 bp Lane 5: PCR confirmation for pBAD clone # 4b = 878 bp 37

PAGE 45

Figure 7. PCR results using S. agalactiae USF704 genomic DNA and customdesigned primers for gbscol1 and gbscol2 Lane 1: Molecular weight standard Lane 2: PCR product for gbscol1 = 1284 bp Lane 3: PCR product for gbscol2 = 924 bp Figure 8: PCR confirmation of successful insertion in the pBAD vector Figure 8A and 8C: Top lanes show plasmid isolated from pBAD/gbscol1 transformants. The bottom lanes show PCR using the pBAD forward primer with the above corresponding plasmid. Lanes 2 and 3 show bands at 1463 bp. Figure 8B and 8D: Top lanes show plasmid isolated from pBAD/gbscol2 transformants. The bottom lanes show PCR using the pBAD forward primer with the above corresponding plasmid. Lanes 8 and 11 show bands at 1103 bp. 38

PAGE 46

39 Plasmid DNA was isolated from the clones (Figure 8, top) and the presence of the insert was verified through PCR using th e primers specific for the insert. Clones that showed a ban d at 1284 bp for pBAD/ gbscol1 and 924 bp for pBAD/ gbscol2 were analyzed to determine whether the insert had been inserted in the correct orientation. Gbscol1 and Gbscol2 transformants both showed two clones that had the insert positioned in the co rrect orientation (Figure 8, bottom). These results show that the gbscol1 and gbscol2 had been successfully cloned into the pBAD vector. One of each cl one was chosen at random for further studies. Expression and Detection of p BAD/smcol2 through induction with Arabinose, SDS-PAGE and Western Blot Pilot expression experiments were performed on pBAD/ smcol2 clone # 2, pBAD/ smcol2 clone # 4, pBAD/ gbscol1 and pBAD/ gbscol2 to determine the optimal concentration of ar abinose for induction of the clones and the expression of the recombinant protein. pBAD/ smcol2 clone # 2 will be referred to as smcol2sp (smcol2 with signal peptide) and pBAD/ smcol2 clone # 4 will be referred to as smcol2wosp (smcol2 without signal peptide) throughout the rest of the paper. It was found that the highest pr oduction of the recombinant protein in the clones was with 0.2% arabinose. 0.2% arabinose was then used for all subsequent experiments as the inducer concentration.

PAGE 47

A Western blot was performed on clones smcol2sp, smcol2wosp, gbscol1 and gbscol2 using an anti-HisG antibody to definitely verify the size and the production of the fusion protein in the corresponding induced recombinant bacteria. As expected, smcol2sp clone produced a strong band at 40 kDa and smcol2wosp clone produced a smaller band at 31 kDa (Figure 9). The negative control (E. coli TOP10 transformed with pBAD-empty vector) showed no reactivity to the anti-HisG antibody. The gbscol1 clone showed a strong band at 52.5 kDa whereas gbscol2 showed a band at about 40 kDa. This data confirms that the four clones did produce successful induction of the polyhistidine (6xHis) tagged fusion protein. Figure 9: Western Blot of smcol2sp and smcol2wosp Lane 1: Molecular weight standard Lane 2: smcol2sp, 40 kDA Lane 3: smcol2wosp; 31 kDA Lane 4: Negative control, pBAD empty vector 40

PAGE 48

41 Purification of the polyhistidine (6xH is) tagged fusion proteins smcolsp, smcolwosp, gbscol1 and gbscol2 A large-scale induction was perform ed on the four clones using 0.2% arabinose. The presence of the recombi nant protein in the induced cells was verified through immunodot analysis using anti-HisG antibody (F igure 10) before isolation. The recombinant protein was then isolated from the cells via Qiagens NI-NTA Fast Start Columns (Catalog # 30600) using native conditions. The samples were separated by electrophoresis on an SDS-PAGE gel to confirm that the protein of the correct size was isol ated (Figure 11). The purified enzymes were then verified to be the correct pol y-histamine fusion recombinant protein through Western Blot analysis using an ti-HisG antibody. Bands with the anticipated molecular size were observed: 40 kDa smcol2sp, 31 kDa smcol2wosp, 52.5 kDa gbscol1and 40 kD a gbscol2 on both the SDS-PAGE and Western Blot (Figure 12). A Bradford assay was then performed to determine the concentration of the isolated protei ns. It was found that the protein concentration of each sample was as follows: smcol2sp, 559.8 ug/ml; smcol2wosp, 580.9 ug/ml; gbscol1, 613. 8 ug/ml; gbscol2, 538.9 ug/ml. These samples were analyzed for collagenase activity. pBAD Clones Size of protein (kDa ) pI smcol2sp 40 kDa 5.48 smcol2wosp 31 kDa 5.62 gbscol1 52.5 kDa 5.46 gbscol2 40 kDa 5.28 Table 7. pBAD clones and the antici pated protein size, including the pBAD vector, and pI

PAGE 49

Figure 10: Immunodot of induced clones Well 1: smcol2sp Well 2: smcol2wosp Well 3: gbscol1 Well 4: gbscol2 Figure 11: SDS-PAGE of purified recombinant enzymes Lane 1: Molecular weight standard Lane 2: Purified smcol2sp, 40 kDa Lane 3: Purified smcol2wosp, 31 kDa Lane 4: Purified gbscol1, 52.5 kDa Lane 5: Purified gbscol2, 40 kDa 42

PAGE 50

Figure 12: Western Blot of purified enzymes A. Lane 1: Molecular weight standard Lane 2: Negative control Lane 3: Purified smcol2sp, 40 kDa B. Lane 1: Molecular weight standard Lane 2: Negative control Lane 3: Purified smcol2wosp, 31 kDa C. Lane 1: Molecular weight standard Lane 2: Negative control Lane 3: Purified gbscol1, 52.5 kDa D. Lane 1: Molecular weight standard Lane 2: Negative control Lane 3: Purified gbscol2, 40 kDa Gelatinase Assay All the samples tested, which included pure recombinant smcol2sp, smcol2wosp, gbscol1 and gbscol2, were positive for gelatinase activity (Figure 13). As anticipated C. histolyticum collagenase, and trypsin, used as positive controls, also degraded the gelatin. No gelatinase activity was observed with a BSA dot. 43

PAGE 51

44 Figure 13. Gelatinase assay using X-Ray film Top row: smcol2sp; smcol2wosp Middle row: gbscol1; gbscol2 Bottom row: C. histolyticum collagenase; Trypsin Blue Collagenase Assay The Blue Collagenase Assay was used to determine whether or not the recombinant proteins had true collagenase activity. As anticipated, C histolyticum was strongly positive, whereas trypsin was negative (Figure 14). All recombinant enzymes showed the presence of small collagen fragments adhering to the wall of the tube (Figure 14). However, only smcol2sp and gbscol2 (also with the signal peptide) showed some measurable degraded collagen (OD 500nm ) (Table 8). Samples gbscol1 gbscol2 smcol2sp smcol2wosp C. histolyticum Trypsin Abs OD 500 0.0472 0.1237 0.1965 0.034 1.0985 0.075 Abs OD 500 0.0728 0.2268 0.1467 0.0705 0.913 0.015 Mean 0.060 0.175 0.1716 0.052 1.006 0.045 SD 0.018 0.072 0.035 0.025 0.130 0.042 Table 8. Raw Data from Blue Collagenase Assay

PAGE 52

1 2 3 4 5 6 7 8 9 10 Figure 14. Blue collagenase assay C. histolyticum collagenase (1) showing digestion of blue collagen Trypsin (2) showing no degradation of collagen Partial degradation of collagen into smaller fragments sticking to the tube wall gbscol1 (3 & 4); gbscol2 (5 & 6); smcol2sp (7 & 8); smcol2wosp (9 & 10) Blue Collagenase Assay00.20.40.60.811.2123456Collagenase SamplesAbsorbance (OD 500 nm) Figure 15: Results of Blue Collagenase Assay Mean OD 500nm of duplicate samples of: 1. Gbscol1 2. Gbscol2 3. Smcol2sp 4. Smcol2wosp 5. C. histolyticum collagenase 6. Trypsin The absorbance observed with samples 1, 4 and 6 is equal to the background level observed with blue collagen incubated in parallel with assay buffer alone. 45

PAGE 53

46 DISCUSSION With the recent availability of completely sequenced microbial genomes, analysis of S. mutans and GBS genomic sequences allo wed the identification of putative collagenase genes in these orga nisms. Of the put ative collagenases identified in S. mutans UA159, one identical gene ( smcol1 ) was previously cloned from S. mutans GS-5 and sequenced (21). Bioinformatical analysis of the second putative collagenase gene, smcol2 indicated the possibility of it being also a U32 collagenase. Homologous gen es in GBS were identified in two S. agalactiae strains NEM316 and 2603V/R. Subseq uently, primers were designed for the amplification of t hese genes using genomic DNA as a template. The PCR products obtained were then cloned into an inducible vector system that allowed for strict regulation of reco mbinant protein expression. Recombinant clones harboring the genes of interest in the right orientation were obtained and confirmed by PCR anal ysis, and the optimal recombinant protein expression was achieved by i nduction with 0.2% arabi nose. Expression of the 6xHis-tagged fusion proteins wa s confirmed by western immunoblot analysis. SDS-PAGE and Wester n blot analysis of smcol2sp and smcol2wosp indicated that the presenc e of the signal peptide did not interfere with protein expression. Hence, subsequent clon ing of GBS collagenases was conducted without removal of the signal peptide.

PAGE 54

47 As anticipated from His-tagged fusion prot ein, the purification of recombinant proteins was much facilitated, and pur e proteins were obtained and used in determining their enzymatic activity. Previously, gelatinase activity was observed with C. histolyticum collagenase (31), S. mutans (22) and GBS (2 3) but not with P. gingivalis prtC collagenase (27). In the pres ent study, gelatinase activity was demonstrated for pure recombinant S. mutans and GBS recombinant enzymes, thus indicating that these enzymes were not serine proteases like trypsin as they were not inhibited by PMSF. Since prtC collagenase was reported not to degrade gelatin, the observation of gelatinase activity in S. mutans and GBS enzymes denoted that members of the U 32 family of peptidases/collagenases were heterogeneous. It was shown that these three enzymes, smcol2, gbscol1 and gbscol2 had high degree of homology wi th other bacterial prot ease, most being U32 peptidases and collagenases (Tables 4, 5 and 6). Based on the ProtoMap database (46) all three enzymes were classi fied as members of the cluster, 1872. This cluster contains 24 members, with 13 containing the P eptidase family U32 signature It was also found that the Eu ropean Molecular Biology Laboratory (EMBL) database (1) grouped these proteins into family ENZYME: 3.4.-.(E.C. 3.4), which are peptide hydrolases, acti ng on peptide bonds. This family contains other well known collagenases from Vibrio alginolyticus and C. histolyticum Complete degradation of blue collagen by C. histolyticum collagenase and the lack of digestion by trypsin demonstrat ed that the blue collagen substrate prepared in our laboratory was useful in determining true collagenase activity.

PAGE 55

48 Generation of smaller fragments upon incubation with t he recombinant proteins indicated the presence of enzymes degrading partially the blue collagen substrate, even when the incubation time was extended to 72 hours. Only the smcol2sp and gbscol2 had the ability to degrade completely some of the collagen. This apparent difference may be due to the fact that the C. histolyticum collagenase sample contained a mixture of collagenases and proteases, or that the 6x His-Tag might interfer e with collagenase activity. Interestingly, smcol2sp protein showed some comple te collagenase activity, but not the smcol2wosp. Considering that collagenase activity was observed with P. gingivalis bacteria, but not with purified prtC enzyme, and that collagenase activity involved two enzymes (20), it is hypothesized that perhaps the same holds true for the S. mutans and GBS col1 and col2 enzymes. Prior to the present study, a major obstacle was encountered due to the lack of a true collagenase assay. Synthetic pe ptide substrate, ac id soluble collagen and denatured collagen used in commercially available collagenase assay kits were found not to be specific for colla genase as none contained the typical triple helix of native type I collagen (17). By using the specific blue collagenase assay developed in our laboratory, we were able to observe complete and incomplete collagen degradation activity by col1 and col2 in S. mutans and GBS. Since the recombinant enzymes contained the signal peptide and the 6xHis-Tag, it is not possible to extrapolate the data to the native enzymes, which may very well be more active than the recombinant fusion proteins. Nevertheless, the data obtained in the present study already showed that the S. mutans and GBS

PAGE 56

49 collagenases, col1 and col2, had both co llagenase and gelatinase activity, and that they appeared to be distinct from both C. histolyticum collagenase and P. gingivalis collagenase. Indeed, genetic analysis indicated that smcol1 smcol2, gbscol1 and gbscol2 had essentially no homology to C. histolyticum collagenases and moderate homology to P. gingivalis prtC enzymes. This is in agreement with the distinct differences between bacterial Zn-metalloproteases and U32 peptidases/collagenases, and t he heterogeneity among members of the U32 family. In conclusion, the work presented her ein has significantly added to our understanding of S. mutans and GBS in dental root decay and premature rupture of the amniochorionic membr ane, and provided the directi on for future studies. Work is already underway in our laborat ory by other members of our research team to inactivate smcol1, smcol2, gbscol1 and gbscol2 by allelic exchange in S. mutans and GBS to probe whether or not both enzymes are needed for collagenase expression in the respective bac teria, to clone these genes into a vector that will allow the purification of native enzymes for in vitro studies, and to analyze collagenase expression as a function of growth state, planktonic versus biofilms and to identify genes that are similarly regulated by mi croarray analysis.

PAGE 57

50 REFERENCES 1. Altschul, S. F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller and David J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograms. Nucleic Acids Res 25: 3389-3402. 2. Athayde N, E. S., Romero R, Gome z R, Maymon E, Pacora P, Menon R. 1998. A role for matrix metalloproteinase-9 in spontaneous rupture of the fetal membranes. Am J Obstet Gynecol 179: 1248-1253. 3. Bowden, G. 1990. Microbiology of root surf ace caries in humans. J Dent Res 69: 1205-1210. 4. Bradford, M. M. 1976. A rapid and sensitive method for quantitation of microgram quantities of pr otein utilizing the prin ciple of protein-dye binding. Anal. Biochem. 72: 248-254. 5. Burgess, O. B., J.R. Gallo. 2002. Treating Root Surface Caries. Dent. Clin. N. Am. 46: 385-404. 6. Chenna, R., Sugawara, Hideaki, Koike,Tadashi, Lopez, Rodrigo, Gibson, Toby J, Higgins, Desmond G, Thompson, Julie D. 2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31: 3497-3500. 7. Convert M, M. L. G., Dolina M, Piffaretti JC. 2005. Comparison of LightCycler PCR and culture for detect ion of group B streptococci from vaginal swabs. Clin Microbiol Infect 11: 1022-1026. 8. Dao, M. 1985. An improved method of ant igen detection on nitrocellulose: in situ staining of alkaline phosphatase conjugated antibody. J Immunol Methods 82: 225-231. 9. Dragana Ajdic, W. M. M., Robert E. McLaughlin, Gorana Savic, Jin Chang, Matthew B. Carson,, R. T. Charles Primeaux, Steve Kenton, Honggui Jia, Shaoping Lin, Yudong Qian, Shuling Li, Hua Zhu,, and H. L. Fares Najar, Jim White, Br uce A. Roe, and Joseph J. Ferretti. 2002. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. PNAS 99: 14434. 10. Dung S, L. H. 1999. Molecular pathogenesis of root dentin caries. Oral Diseases 5: 92-99. 11. Evans, S., J. Mckenzie, B. Shannon, and H. Wechsler. 1996. Guidelines for school health programs to promote lifel ong healthy eating. Morbid. Mortal. Weekly Rep 45: 1-5.

PAGE 58

51 12. Ferretti, J. J., Russell, R. R. B., Dao, M. L. 1989. Sequence analysis of the wall-associated protein precursor of Streptococcus mutans Antigen A. Mol. Microbiol 3: 469-478. 13. Forester, H., Hunter, N., Knox, K. W. 1983. Characteristics of a high molecular weight extracellular protein of Streptococcus mutans J. Gen. Microbiol. 129: 2779-2788. 14. Glaser, P., Rusniok, C., Buchrieser, C., Chevalier, F., Frangeul, L., Msadek, T., Zouine, M., Couv, E., La lioui, L., Poyart, C., Trieu-Cuot, P., Kunst, F. 2002. Genome sequence of Streptococcus agalactiae a pathogen causing invasive neonatal disease. Mol Microbiol. 45: 1499 1513. 15. Hamada S, M. S., Kiyono H, Menaker, McGhee J. 1985. Molecular microbiology and immunobiology of Streptococcus mutans Elsevier Science Publishers : 1-17. 16. Han TK, D. M. 2005 Differential immunogenic ity of a DNA vaccine containing the Streptococcus mutans wall-associated protein A gene versus that containing a truncated derivative antigen A lacking in the hydrophobic carboxyterminal region. DNA Cell Biol 24: 574-581. 17. Harrington, D. 1996 Bacterial collagenases and collagen-degrading enzymes and their potential role in human disease. Infect Immun 64: 18851891. 18. Harrington DJ, R. R. 1994. Identificat ion and characterisation of two extracellular proteases of Streptococcus mutans FEMS Microbiol Lett 121: 237-241. 19. Higgins D., T. J., Gibson T.Thomps on J.D., Higgins D.G., Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673-4680. 20. Houle MA, G. D., Plamondon P, Nakayama K. 2003. The collagenase activity of Porphyromonas gingivalis is due to Arg-gingipain. FEMS Microbiol Lett 221: 181-185. 21. Ioannides, M. 2004. Cloning, analysis, and detection of a U32 collagenase in Streptococcus mutans GS-5. University of South Florida, Tampa, FL Biology M.S. Thesis 22. Jackson R, D.V. Lim, ML. Dao. 1997. Identificati on and analysis of a collagenolytic activity in Streptococcus mutans Current Microbiology 34: 49. 23. Jackson, R. ML. Dao, and D. V. Lim. 1994. Cell-associated collagenolytic activity by group B streptococci. Infect. Immun. 62: 5647 5651. 24. Jia R, G. J., Fan MW, Bian Z, Chen Z, Fan B, Yu F, Xu QA. 2006. Immunogenicity of CTLA4 fusion anti-ca ries DNA vaccine in rabbits and monkeys. Vaccine. Epub ahead of print 25. Jones, D. T. 1999. Protein secondary structure prediction based on position-specific scoring matrices. J. Mol. Biol. 292: 195-2002.

PAGE 59

52 26. Kassab, M. M., Robert E. Cohen. 2003. The etiology and prevalence of gingival recession. J Am Dent Assoc 134: 220-225. 27. Kato T, T. N., Kuramitsu HK. 1992. Sequence analysis and characterization of the Porphyromonas gingivalis prtC gene, which expresses a novel collagenas e activity. J Bacteriol 174: 3889-3895. 28. Larsson C, S.-C. M., Lindahl G. 1999 Protection against experimental infection with group B streptococcus by immunization with a bivalent protein vaccine. Vaccine 17: 454-458. 29. Lin, B., Averett, W.F ., Novak, J., Chatham, W. W., Hollingshead, S.K., Coligan, J.E., et al. 1996. Characterization of PepB, a group B streptococcal oligopeptidase. Infect Immun 64: 3401. 30. Liu, G., Nizet, V. 2004. Extracellular virulence factors of group B streptococci. Frontiers in Bioscience 9: 1794-1802. 31. Matsushita O, J. C., Katayama S, Minami J, Takah ashi Y, Okabe A. 1999. Gene duplication and multip licity of collagenases in Clostridium histolyticum J Bacteriol 181: 923-933. 32. Matsushita O, J. C., Minami J, Katayama S, Nishi N, Okabe A. 1998. A study of the collagen-bind ing domain of a 116-kDa Clostridium histolyticum collagenase. J Biol Chem 273: 3643-3648. 33. Matsushita O, Y. K., Kataya ma S, Minami J, Okabe A. 1994. Purification and characterization of Clostridium perfringens 120-kilodalton collagenase and nucleotide sequence of the corresponding gene. J Bacteriol 176: 149-156. 34. McGuffin L.J., B. K., and D.T. Jones. 2000. The PSIPRED protein structure prediction server. Bioinformatics. 16: 404-405. 35. Moore RM, M. J., Redline RW, Mercer BM, Moore JJ. 2006. The physiology of fetal membrane r upture: Insight gained from the determination of physical properties. Placenta Epub ahead of print. 36. Morales WJ, D. S., Bornick P, Lim DV. 1999. Change in antibiotic resistance of group B streptococcu s: impact on intrapartum management. Am J Obstet Gynecol 181: 310-314. 37. Naito Y., G. R. J. 1988. Attachment of Bacteroides gingivalis to collagenous substrata J Dent Res 67: 1075-1080. 38. Nobuyoshi, T. K. a. H. K. K. 1991. Isolation and preliminary characterization of the Porphyromonas gingivalis prtC gene expressing collagenase activity. FEMS Microbiol Lett. 84: 135-138. 39. Peltier, M. R. 2003. Immunology of term and preterm labor. Rep Bio Endocrin 1 40. Qian H, D. M. 1993. Inactivation of the Streptococcus mutans wallassociated protein A gene (wapA) resu lts in a decrease in sucrosedependent adherence and aggregat ion. Infect Immun 61: 5021-2058. 41. Strijp A. J. P., v. S. T. J. M. de Graaff J., ten Cate J. M. 1994. Bacterial colonization and degradation of demineralized dentin matrix in situ. Caries Research 28: 21-27.

PAGE 60

53 42. Switalski L, B. W., Ca ufield P, Lantzi M. 1993. Collagen mediates adhesion of Streptococcus mutans to human dentin. Infect Immun 61: 4119-4125. 43. Tettelin, H., et al. 2002. Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae Proc Natl Acad Sci U S A 99: 12391-12396. 44. Vadillo-Ortega, F., Drew W. Sado wsky, George J. Haluska, Cesar Hernandez-Guerrero, Rebeca, and M. G. G. a. M. J. N. Guevara-Silva. 2002. Identification of matrix metalloproteinase-9 in amniotic fluid and amniochorion in spontaneous labor and after experimental intrauterine infection or interleukin-1 infusion in pregnant rhesus monkeys. Am J Obstet Gynecol 186: 128-138. 45. Yoder S, C. C., Ugen KE, Dao ML. 2000. High-level expression of a truncated wall-associated protein A from the dental cariogenic Streptococcus mutans DNA Cell Biol 19: 401-408. 46. Yona Golan, N. L., Michal Linial. 2000. ProtoMap: Automatic classification of protein sequences and hierarchy of protein families. Nucleic Acids Research 28: 49-55 47. Yoshihara K, M. O., Minami J, Okabe A. 1994. Cloning and nucleotide sequence analysis of the colH gene from Clostridium histolyticum encoding a collagenase and a gel atinase. J Bacteriol 176: 6489-6496.