USF Libraries
USF Digital Collections

Regulation of transcription and analysis of drug targets in lymphoma and myeloma cells

MISSING IMAGE

Material Information

Title:
Regulation of transcription and analysis of drug targets in lymphoma and myeloma cells
Physical Description:
Book
Language:
English
Creator:
Bolick, Sophia C. E
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Plasma cell
B cell
PRDI-BF1
Farnesyltransferase inhibitors
Ras
Dissertations, Academic -- Molecular Medicine -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Hematological malignancies, such as lymphomas and myelomas, have low cure rates or remain refractory to treatment, although advances have been made in treatment regimens for these patients. Questions still remain as to what is occurring in these cells on a molecular level, specifically at the level of gene transcription. The positive regulatory domain I binding factor 1 (PRDI-BF1) has been shown to directly repress genes required for cell proliferation and maintenance of the B cell phenotype, however very little is known as to its regulation. The first study presented in this dissertation demonstrates regulation of the PRDM1 gene occurs primarily at the level of transcription in B cell receptor (BCR)-stimulated lymphoma cells and myeloma cells. It also demonstrates PU.1 binding is involved in BCR-mediated activation of lymphoma cells. Most importantly, this study presents evidence of a promoter poised and primed for activation in lymphoma cells. These studies lay the groundwork for the second study which examines modulation of PRDM1 expression in lymphoma cells by chemotherapeutic agents. Induction of PRDI-BF1 in lymphoma cells negative for PRDM1 gene expression correlates with increased apoptosis, which has important therapeutic implications for treatment of lymphomas. One common problem that arises in treatment of cancer patients is the eventual emergence of a drug resistant population of cells. Identifying specific drug targets and whether they confer drug resistance is an important area of study, which is the focus of the third study presented in this dissertation. It demonstrates the response of myeloma cells to treatment with the farnesyltransferase inhibitor (FTI)-277 and examines whether known mechanisms of drug resistance in these cells are responsible for cross-resistance to FTI-277.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2006.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Sophia C. E. Bolick.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 141 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001929836
oclc - 212917962
usfldc doi - E14-SFE0001750
usfldc handle - e14.1750
System ID:
SFS0026068:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001929836
003 fts
005 20080306144357.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 080306s2006 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001750
035
(OCoLC)212917962
040
FHM
c FHM
049
FHMM
090
QR46 (ONLINE)
1 100
Bolick, Sophia C. E.
0 245
Regulation of transcription and analysis of drug targets in lymphoma and myeloma cells
h [electronic resource] /
by Sophia C. E. Bolick.
260
[Tampa, Fla] :
b University of South Florida,
2006.
3 520
ABSTRACT: Hematological malignancies, such as lymphomas and myelomas, have low cure rates or remain refractory to treatment, although advances have been made in treatment regimens for these patients. Questions still remain as to what is occurring in these cells on a molecular level, specifically at the level of gene transcription. The positive regulatory domain I binding factor 1 (PRDI-BF1) has been shown to directly repress genes required for cell proliferation and maintenance of the B cell phenotype, however very little is known as to its regulation. The first study presented in this dissertation demonstrates regulation of the PRDM1 gene occurs primarily at the level of transcription in B cell receptor (BCR)-stimulated lymphoma cells and myeloma cells. It also demonstrates PU.1 binding is involved in BCR-mediated activation of lymphoma cells. Most importantly, this study presents evidence of a promoter poised and primed for activation in lymphoma cells. These studies lay the groundwork for the second study which examines modulation of PRDM1 expression in lymphoma cells by chemotherapeutic agents. Induction of PRDI-BF1 in lymphoma cells negative for PRDM1 gene expression correlates with increased apoptosis, which has important therapeutic implications for treatment of lymphomas. One common problem that arises in treatment of cancer patients is the eventual emergence of a drug resistant population of cells. Identifying specific drug targets and whether they confer drug resistance is an important area of study, which is the focus of the third study presented in this dissertation. It demonstrates the response of myeloma cells to treatment with the farnesyltransferase inhibitor (FTI)-277 and examines whether known mechanisms of drug resistance in these cells are responsible for cross-resistance to FTI-277.
502
Dissertation (Ph.D.)--University of South Florida, 2006.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 141 pages.
Includes vita.
590
Adviser: Kenneth L. Wright, Ph.D.
653
Plasma cell.
B cell.
PRDI-BF1.
Farnesyltransferase inhibitors.
Ras.
690
Dissertations, Academic
z USF
x Molecular Medicine
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1750



PAGE 1

Regulation of Transcription a nd Analysis of Drug Targets in Lymphoma and Myeloma Cells by Sophia C.E. Bolick A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Kenneth L. Wright, Ph.D. W. Douglas Cress, Ph.D. Dmitry Gabrilovich, M.D., Ph.D. Noreen Luetteke, Ph.D. Larry P. Solomonson, Ph.D. Date of Approval: November 2, 2006 Keywords: plasma cell, B cell, PRDI-B F1, farnesyltransferase inhibitors, Ras Copyright 2006, Sophia C.E. Bolick

PAGE 2

Dedication For my mother, Cornelia P.E. Bolick, who had looked forward to this day. Gone but never forgotten. (October 17, 1937-April 15, 2006)

PAGE 3

Acknowledgements I would like to thank my mentor, Dr Wright, for providing me with the opportunity to continue my dissertation research in his lab. I grea tly appreciate his time, effort, and mentorship in helping me complete my Ph.D. I would also like to thank my first mentor, Dr. Dalton, for his guidance and mentorship th e first 2 years of graduate school. I would also like to acknowledge my cu rrent and past labmates, as the work environment is critical to the experience one has as a graduate stude nt. I would like to extend a special thanks to Dr. Wright, Matt Smith, Shruti Desai, and Michelle Maurin for helping me through a very difficult tim e following the death of my mother by maintaining a normal lab environment, which was paramount to getting me focused on work again. I would also like to thank all my friends, who ar e too numerous to list in one page, for their support and friendship all these years. The support of my family, especially my mother, has been crucial to my success in education through the years. I would not be here today if it were not for them. A special thank you goes to my nephew Haidyn a nd my niece Myla for keeping me focused on what really is important in life. Finally, I would like to thank my fianc, Darren Ferreira, for his unconditional suppo rt the past few years.

PAGE 4

i Table of Contents List of Figures......................................................................................................................v List of Tables................................................................................................................. ..viii List of Abbreviations.........................................................................................................ix Abstract....................................................................................................................... ......xii Chapter One: General Introduction.....................................................................................1 B cell to plasma cell differentiation.........................................................................1 Inducers of plasma cell differentiation....................................................................4 B cell receptor cross-linking....................................................................................5 Transcription factors involved in plasma cell differentiation..................................8 Positive regulatory domain I binding factor 1 (PRDI-BF1)........................8 Role of PRDI-BF1/Blimp-1 in development.................................13 Direct targets of PRDI-BF1/Blimp-1.....................................................................14 B cell-lineage specific activator (BSAP)...................................................14 Class II transactivator (CIITA)..................................................................15 c-Myc.........................................................................................................16 Spi-B and Id3.............................................................................................17 X-box binding protein-1 (XBP-1)..........................................................................18 Plasma cells and immunoglobulin secretion..............................................18 B-cell lymphoma 6 (BCL-6)..................................................................................20

PAGE 5

ii Interferon regulatory factor family........................................................................20 PU.1.......................................................................................................................21 B cell lymphomas..................................................................................................22 Role of PRDI-BF1/Blimp-1 in lymphoma and myeloma cells..............................23 Drug resistance in multiple myeloma....................................................................25 Apoptosis and role of Bcl-x L .................................................................................26 The role of the Ras oncogene in myeloma.............................................................27 Prenylation of the Ras oncoprotein........................................................................28 Downstream targets of Ras....................................................................................32 Inhibitors of protein prenylation............................................................................33 Chapter Two: Transcriptional regulati on of PRDI-BF1/Blimp-1 in lymphoma and myeloma cells.....................................................................................35 Introduction............................................................................................................35 Results ....................................................................................................................37 Expression of PRDM1 levels in lymphoma and myeloma cells................37 PRDI-BF1 regulation occurs at the transcriptional level...........................40 Identification of regulatory regi ons in the PRDI-BF1 promoter...............42 Identification of putative factor binding sites in the PRDI-BF1 promoter.....................................................................................................44 Identification of a functiona l factor binding site on the PRDI-BF1 promoter...................................................................................50 PU.1 is involved in anti-IgM-mediated transcriptional regulation of PRDI-BF1.............................................................................55 The PI3K and MAPK signaling pathways are involved in the anti-IgM-mediated induction of PRDI-BF1...............................................55

PAGE 6

iii Discussion..............................................................................................................58 Materials and Methods...........................................................................................63 Cell lines and drugs....................................................................................63 Apoptosis assay..........................................................................................63 Real-time PCR...........................................................................................64 Isolation of nascent RNA...........................................................................64 DNA constructs..........................................................................................65 Luciferase assays.......................................................................................66 Dimethyl sulfate in vivo footprinting.........................................................66 Ligation-mediated PCR (LM-PCR)...........................................................68 Nuclear extract preparation and electrophoretic mobility shift assays.................................................................................................70 Transfections with siRNA..........................................................................71 Chapter Three: Modulation of PRDM1 gene expression in lymphoma cells...................75 Introduction............................................................................................................75 Results ....................................................................................................................77 Treatment with HDAC inhib itors or Bortezomib induce PRDM1 levels in lymphoma cell lines and mantle cell patient samples...........................................................................................77 Human B cells differentiated to plasmablasts have increased PRDM1 mRNA levels...............................................................................84 Discussion..............................................................................................................86 Materials and Methods...........................................................................................89 Cell lines and drugs....................................................................................89 Apoptosis assay..........................................................................................89

PAGE 7

iv Real-time PCR...........................................................................................89 B cell isolation and differe ntiation to plasmablasts...................................90 Chapter Four: The farnesyl transferas e inhibitor, FTI-277, inhibits growth and induces apoptosis in drug-resistant myeloma cells.............................92 Introduction............................................................................................................92 Results ....................................................................................................................93 Myeloma cells with a N-Ras mutation are highly sensitive to FTI-277..................................................................................................93 Inhibition of Ras processing and relationship to FTI-induced apoptosis....................................................................................................97 Bcl-x L and classical mechanisms of drug resistance are not determinants of resistance to FTI-277.....................................................101 Discussion............................................................................................................107 Materials and Methods.........................................................................................109 Cell lines and drugs..................................................................................109 MTT cytotoxicity assay...........................................................................110 Soft agar clonogenic assay.......................................................................110 Ras processing assay................................................................................111 Apoptosis assays......................................................................................111 Statistical analysis....................................................................................112 Chapter Five: General Discussion..................................................................................113 References........................................................................................................................119 About the Author...................................................................................................End Page

PAGE 8

v List of Figures Figure 1. Stages of B cell differentiation and development..............................................3 Figure 2. The PRDM1 gene e xpresses two different products.........................................9 Figure 3. PRDI-BF1 represses a number of downstream targets....................................11 Figure 4. Expression of CIITA gene expression is regulated by four independent promoters.....................................................................................16 Figure 5. The mevalonate pathway pl ays a role in generating prenylated proteins.............................................................................................................30 Figure 6. Prenylation occurs on the carboxy terminal CAAX box.................................31 Figure 7. PRDI-BF1 mRNA levels ar e elevated in myeloma cells versus lymphoma cells................................................................................................38 Figure 8. Anti-IgM treatment i nduces PRDI-BF1 mRNA levels and apoptosis in CA46 lymphoma cells.................................................................39 Figure 9. PRDI-BF1 regulation occu rs at the level of transcription...............................41 Figure 10. Characterization of PRDM1 promoter activity in CA46 lymphoma cells and U266 myeloma cells.........................................................................43 Figure 11. In vivo genomic footprinting of the PRDI-BF1 proximal promoter region reveals numerous protei n-DNA interactions in both lymphoma and myeloma cells.........................................................................45 Figure 12. Sp1 binds the PR DI-BF1 proximal promoter..................................................46 Figure 13. In vivo genomic footprinting of the PRDI-BF1 promoter region -1528 to -1921 bp distal to the transcription start site reveals numerous protein-DNA interactions in both lymphoma and myeloma cells..................................................................................................47

PAGE 9

vi Figure 14. In vivo genomic footprinting of the PR DI-BF1 promoter -2271 to -2491 bp distal to the transcrip tion start site reveals no proteinDNA interactions in both lymphoma and myeloma cells................................49 Figure 15. Site-directed mutagenesis de monstrates sites P.C and P.F are not necessary for activity of the PR DI-BF1 promoter in either CA46 lymphoma cells or U266 myeloma cells..........................................................51 Figure 16. Site-directed mutagenesis dem onstrates site P.H is necessary for activity of the PRDI-B F1 promoter in CA46 lymphoma cells, but not in U266 myeloma cells..............................................................................52 Figure 17. Site P.H is a PU.1 factor bi nding site in CA46 lymphoma cells, but not U266 myeloma cells..................................................................................53 Figure 18. Site P.H is not a IRF-4 or IRF-8 factor binding site in CA46 lymphoma cells................................................................................................54 Figure 19. PU.1 is involved in anti-IgM -mediated transcriptional regulation of PRDI-BF1....................................................................................................56 Figure 20. The PI3K and MAPK signaling pathways are involved in the antiIgM-mediated induction of PRDI-BF1............................................................57 Figure 21. Levels of nascent RNA in myeloma cells are elevated when compared to lymphoma cells...........................................................................78 Figure 22. Treatment with the HDAC i nhibitor Trichostatin A induces PRDIBF1 mRNA levels in CA46 lymphoma cells...................................................79 Figure 23. In vivo genomic footprinting of the PRDI-BF1 proximal promoter reveals no protein-DNA interactions in lymphoma cells treated with Trichostatin A..........................................................................................80 Figure 24. Activity of the HDAC inhi bitor LBH589 in Mi no mantle cell lymphoma cells................................................................................................81 Figure 25. Treatment with the HDAC i nhibitor SAHA decreases PRDI-BF1 mRNA levels in freshly isolat ed cells from a mantle cell lymphoma patient.............................................................................................81 Figure 26. Treatment with the protea some inhibitor Bortezomib induces PRDI-BF1 mRNA levels in CA46 lymphoma cells........................................82

PAGE 10

vii Figure 27. Treatment with the protea some inhibitor Bortezomib induces PRDI-BF1 mRNA levels and induc es apoptosis in Mino mantle cell lymphoma cells.........................................................................................82 Figure 28. Treatment with the protea some inhibitor Bortezomib induces PRDI-BF1 mRNA levels in freshl y isolated cells from a mantle cell lymphoma patient......................................................................................83 Figure 29. Purified B cells differentia ted to plasmablasts have increased levels of PRDI-BF1 mRNA expression...........................................................85 Figure 30. Myeloma cells with activat ed N-Ras mutation are more sensitive to cytotoxicity by FTI-277 compared to cells with wild-type Ras or K-Ras mutation...............................................................................................95 Figure 31. FTI-277 inhibits N-Ras pro cessing in myeloma cells with wildtype Ras (U266) and activated N-Ras (H929), while both FTI-277 and GGTI-2166 inhibit K-Ras processing.......................................................98 Figure 32. Both FTI-277 and GGT I-2166 inhibit K-Ras processing..............................100 Figure 33. Bcl-x L is not a determinant of resistance to FTI-277....................................103 Figure 34. Drug-resistant myeloma cells are not cross-resistant to FTI-277..................106

PAGE 11

viii List of Tables Table 1. Primers used for LM-PCR..................................................................................73

PAGE 12

ix List of Abbreviations ABC Activated B-cell-like ABi Ammonium bicarbonate APC Allophycocyanin ATF-6 Activating transcription factor 6 Blimp-1 B lymphocyte induc ed maturation protein-1 BCAP B cell adaptor for phosphoinositide 3-kinase BCL B cell lymphoma B-CLL B cell chronic lymphocytic leukemia BCR B cell receptor BL Burkitts lymphoma BLNK B cell linker BMSC Bone marrow stromal cells Bp Base pair BSA Bovine serum albumin BSAP B cell-lineage-specific activator protein CIITA Class II transactivator Ci Curie CI Confidence interval CLP Common lymphoid progenitor CMXRos Chloromethyl-X-Rosamine Cox Cyclooxygenase CTL Cytotoxic T lymphocyte D H IgH diversity DLBCL Diffuse large B-cell lymphoma DMS Dimethyl sulfate DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid DTT Dithiothreitol EMSA Electrophoretic mobility shift assay ER Endoplasmic reticulum F Farad FACS Fluorescence activated cell sorting FBS Fetal bovine serum FDP Farnesyl diphosphate FITC Fluorescein isothiocyanate FL Follicular lymphoma FTase Farnesyl transferase

PAGE 13

x FTI Farnesyl transferase inhibitor GC Germinal center GAP GTPase activating factor GDP Guanine diphosphate GEF Guanine nucleotide exchange factor GGTase Geranylgeranyl transferase GGTI Geranylgeranyl tr ansferase inhibitor GTP Guanine triphosphate IC50 Inhibitory concentration of 50% Id3 Inhibitor of differentiation 3 IFN Interferon Ig Immunoglobulin IgH Immunoglobulin heavy chain IL Interleukin IRF Interferon regulatory factor J H IgH joining LBCL Large B cell lymphoma LM-PCR Ligation mediated PCR LPS Lipopolysaccharide MCL Mantle cell lymphoma MDR Multidrug resistance MHC Major histocompatibility complex MMP Mitochondrial membrane perturbation MTT 3-[4,5-dimethylthiazol-2-yl]2,5 diphenyltetrazolium bromide MZL Marginal zone lymphoma NFB Nuclear factor kappa beta NHL Non-Hodgkins lymphoma PAGE Polyacrylamide gel electrophoresis Pax5 Paired box protein 5 PBS Phosphate buffered saline PCR Polymerase chain reaction PCV Pellet cell volume PMSF Phenylmethylsulfonylfluoride PR PRDI-BF1 and RIZ1 PRDI-BF1 Positive regulatory domain I binding factor 1 PRDM1 PR domain containing 1 P/S Penicillin/streptomycin PVDF Polyvinylidene fluoride Rag Recombination activating gene RNA Ribonucleic acid RT-PCR Reverse transcription PCR SAHA Suberoylanilide hydroxamic acid SDS Sodium dodecyl (lauryl) sulfate STAT Signal transducer and activator of transcription TBE Tris-borate-EDTA

PAGE 14

xi Tm Melting temperature TSA Trichostatin A UPR Unfolded protein response UV Ultraviolet V Volt XBP X-box binding protein

PAGE 15

xii Regulation of Transcription a nd Analysis of Drug Targets in Lymphoma and Myeloma Cells Sophia C.E. Bolick ABSTRACT Hematological malignancies, such as lymphomas and myelomas, have low cure rates or remain refractory to treatment, although advances have been made in treatment regimens for these patients. Questions still remain as to what is occurring in these cells on a molecular level, specifically at the le vel of gene transcription. The positive regulatory domain I binding f actor 1 (PRDI-BF1) has been shown to directly repress genes required for cell pro liferation and maintenance of the B cell phenotype, however very little is known as to its regulation. The first study pr esented in this dissertation demonstrates regulation of the PRDM1 gene occurs primarily at the level of transcription in B cell receptor (BCR)-stimulated lympho ma cells and myeloma cells. It also demonstrates PU.1 binding is involved in BCR -mediated activation of lymphoma cells. Most importantly, this study presents eviden ce of a promoter poised and primed for activation in lymphoma cells. These st udies lay the groundwork for the second study which examines modulation of PRDM1 expression in lymphoma cells by chemotherapeutic agents. Induction of PRDI-BF1 in ly mphoma cells negative for PRDM1 gene expression correlates with in creased apoptosis, which has important therapeutic implications for treatment of ly mphomas. One common problem that arises

PAGE 16

xiii in treatment of cancer patients is the eventu al emergence of a drug resistant population of cells. Identifying specific drug targets and whether they confer drug resistance is an important area of study, which is the focu s of the third study presented in this dissertation. It demonstrates the respons e of myeloma cells to treatment with the farnesyltransferase inhibitor (FTI)-277 and examines whether known mechanisms of drug resistance in these cells are respons ible for cross-resistance to FTI-277.

PAGE 17

1 Chapter One General Introduction B cell to plasma cell differentiation All hematopoietic cells are derived from pluripotent stem cells, which can selfrenew and give rise to progenitor cells in the myeloid and lymphoid lineages. At each step in the development process, these proge nitors become more and more differentiated (160). Early lymphoid progenitors start to express recombination activating genes 1 and 2 ( Rag1 and Rag2) and can recombine at the immunoglobulin heavy chain (IgH) locus (101). They can further differentiate into either bone ma rrow common lymphoid progenitors (CLPs) or early T-cell lineage prec ursors. CLPs give rise to a multitude of cells of the lymphoid lineage, such as B cells, T cells, dendri tic cells, and natural killer cells. With the onset of expression of the cell surface marker B220, CLPs are committed to the B cell differentiation process. Cells then begin to express CD19 and completion of IgH diversity (D H )-to-joining (J H ) gene segment rearrangement by pre-B cells occurs. Rearrangement of the IgH locus at it s variable (V) region continues until V H -DJ H alleles are generated. Rag1 and Rag2 expression is terminated a nd the product of IgH locus rearrangement is expressed on the cell surface. It forms the pre-B cell receptor (BCR) by assembling with the immunoglobulin (Ig) light chains and signaling molecules Ig and

PAGE 18

2 Ig defining the immature B cell stage of development (160, 175). Immature B cells are also characterized by expression of surface IgM (213). Immature B cells expressiong surface IgM migrate to the spleen from the bone marrow for further development (213). A sm all minority become nave marginal-zone B cells, homing to the splenic marginal zone ( 201). Most become nave follicular B cells, circulating to follicles in the spleen, lymph node s, and bone marrow. At this point, they either encounter antigen or die. Thos e encountering antigen will either further differentiate to a plasma cell or form germ inal centers, at which point they become memory B cells or undergo differentiation to a plasma cell (figure 1, derived from (160, 236)). This process is very tightly regulated at the level of transcription. Several transcription factors are invol ved in maintaining the B cell phenotype, while others are involved in progression to and maintenance of the plasma cell phenotype. Most of these transcriptional regulators work in a mutually exclusive manner, meaning that a factor responsible for maintaining the B cell phenot ype is repressed duri ng further development to the plasma cell state (236).

PAGE 19

Immature B c ellarrow Bone m Spleen Marginal zone B c ell Secondary lymphoid o rgans Plasma c ell ell ell Follicular B c Germinal center B cell Memory B c Figure 1. Stages of B cell differentiation and development. B cell to plasma cell differentiation occurs in a temporal and compartmentalized manner. Immature B cells exit the bone marrow for further differentiation in the spleen. In the spleen, they become marginal zone B cells, moving to the secondary lymphoid organs for further development. It is here that follicular B cells, germinal center B cells, and memory B cells further differentiate to plasma cells. 3

PAGE 20

4 Inducers of plasma cell differentiation Treatment of B cells with cytokines stimulates the differentiati on process. In both murine primary B cells (223) and BCL1 lympho ma cells (263), interleukin (IL)-2 and IL5 co-stimulation differentiate B cells to plas ma cells (164, 223, 263), as demonstrated by increases in PRDI-BF1/Blimp-1 and J chai n mRNA (223) and a corresponding increase of Ig-secreting cells measured (118, 223). The effects of IL-2 and IL-5 in the murine system are mimicked by IL-6 in human cells Human CESS cells stimulated with IL-6 differentiate to plasma cells, with an incr ease in Ig secretion (173, 295) and PRDIBF1/Blimp-1 levels (202) and concomitant decrease in B cell markers, like class II major histocompatability complex (MHC) (173). In some cases, IL-6 requires an additional stimulus to act as a differentiation factor, su ch as CD40 ligation (25) or IL-2 stimulation (242). Treatment of both murine and human B cells with IL-21 induces plasma cell differentiation (62, 192). In murine B cells, co-treatment with the B cell receptor (BCR) cross-linker anti-IgM no t only induced B cell proliferati on, but also induced expression of the plasma cell markers Syndecan-1 and surface Ig and decreased expression of MHC class II (192). This correlated with an increase in PRDI-BF1/Blimp-1 mRNA and a decrease in BSAP/Pax5 mRNA expression. IL-21 treatment ei ther in the presence or absence of anti-IgM crosslinking of the BCR, induced Blimp-1 protein expression in murine cells (192). In human B cells, the same effect is achieved by a combination of IL21, CD40 ligation, and cross-linking of the BCR with anti-IgM. Cell cycle analysis demonstrated the majority of plasma cells we re not actively cycling, indicating they were

PAGE 21

5 terminally differentiated. They were also ab le to secrete Ig, a hallmark of plasma cells (62, 192). B cell receptor cross-linking When immature B cells leave the bone marrow (BM), they must undergo selection to become a mature B cell or they die (154). This process is regulated by the BCR. The majority of surviving immature BM B cells become mature B cells of the follicular or mantle zone cell subtypes. Fo llicular B cells are resting, long-lived B cells with a half-life of approximately 4.5 months. Working with T cells, they are important in the adaptive immune response (86) Mantle zone B cells are r eadily able to detect foreign antigen, as they are localized to the marginal sinus region of the spleen that filters blood (149). Upon encountering antigen, they resp ond rapidly by prolif erating rapidly and differentiating to plasma cells, independent of T cell involvement (187, 200). These plasma cells generate low affinity antibodies an d are likely able to mount a first line of defense against foreign pathogens, allowing time for follicular B cells to coordinate with T cells to mount a high affin ity antibody response (257). BCR signaling plays an important role in the development of an immature BM B cell to a mature B cell. BCRs themselves lack intrinsic cell signali ng ability, pairing with both Igand Igto form the BCR complex. Antigen binding to a BCR results in crosslinking of multiple BCRs, leading to the formation of intracellular signaling complexes responsible for different cellular outcomes like proliferation, differentiation, and survival (257). During early B cell development in the BM, the BCR only acts as a scaffold for intracellular signaling complexes, as truncation of the antigen receptor or targeting of Ig/ to the membrane do not hinder development past the pre-B stage of development (7,

PAGE 22

6 231). However, as B cells tran sition from immature to mature B cells, termed transitional B cell maturation, the role of the BCR becomes important (257). Immature and mature B cells exhibit different responses to BCR stimulation. This may in part be explainable by how BCR signaling works at the cell membrane. In resting B cells, the majo rity of BCR complexes are located outside lipid rafts. However, upon antigen stimulation, these complexes loca lize inside lipid raft s, activating other BCRs in an antigen-independent manner and am plifying the antigen response. Many Src family kinase members like Lyn, Fyn, Blk, and Lck are localized to lipid rafts, which puts them near BCR complexes upon antigen stimulation, allowing for the rapid phosphorylation of immune receptor tyrosi ne-based activation motifs (ITAM) on Igand Ig(257). Mutating ITAMs on Igand Igblocks B cell development in the bone marrow (148, 258). Some of the Src family kina se members do not play an essential role in BCR activation, such as Blk and Fyn (240, 255), while loss of Lyn results in reduced numbers of transitional B cells (2, 35). P hosphorylated ITAMs recruit the cytoplasmic Syk/ZAP-70 kinase family member Syk, whic h then initiates th e intracellular BCR response (264, 265). ITAM activation results in recruitment of the adaptor molecules B cell linker (BLNK) and B cell adaptor for phosphoinositide 3-kinase (BCAP), which act as scaffolds for more signaling molecules. BLNK and BC AP both appear to be important in the transitional B cell stage of development, as studies with knock-out mice have shown (110, 194, 287, 290). When BLNK is absent, di fferentiation of immature B cells is delayed (287). BLNK and BCAP activate phospholipase C 2 (PLC 2) signaling acting through separate pathways. BLNK binds PLC 2 (103) as well as Btk (288), which then

PAGE 23

7 allows for further activation of PLC 2 (67). Syk and Btk phosphorylate BCAP, allowing it to bind phosphoinositide 3-kinase (PI3K) (10, 186), which leads to the phosphorylation of more downstream targets, leading to activation of PLC 2 (250). Activation of PLC 2 leads to the production of diacylglycerol (DAG) and inositol-1,4,5-triphosphate (IP 3 ), which activates a number of downstream signalin g pathways responsible for the differing outcomes of BCR signaling (257). In addition to proximal signaling even ts, expression of surface molecules on B cells can modulate outcomes during transition al B cell development. The tyrosine phosphatase CD45 may dephosphorylat e the inhibitory tyrosine on Src family kinases, thereby lowering the threshold for BCR-medi ated B cell activation (42, 148). CD19 also positively regulates BCR signaling through PI3K and its loss or overexpression affect transitional B cell development (60, 190, 298). BCR-mediated signaling is an important pa rt of transitional B cell development. However, the differential response of immature and mature B cells to BCR activation suggests the signaling pathways necessary for further development are expressed in a temporal manner (257). To elucid ate what is occurring in B cells in vivo numerous in vitro studies have been done using anti-Ig cr oss-linking to stimulate the BCR. Anti-IgM cross-linking of the BCR of an immature B cell in the absence of co-stimulatory molecules induces growth arrest or apoptosis (89). The WEHI 231 immature B cell line undergoes growth arrest and/or apoptosis when treated with anti-IgM (12, 87), which may be due to defects in BCR signaling at multiple steps of the pathway. It has been shown transitional B cells contain half the memb rane cholesterol of mature B cells (113). Studies in immature B cells have demonstrated the inability of BCRs to localize to lipid

PAGE 24

8 rafts (39, 243), limiting their access to adap ter molecules necessa ry for further BCR signaling cascades. When WEHI-231 B cells ar e co-stimulated by CD40 ligation, they survive, partly due to the upregulation of the anti-apoptotic Bcl-2 family member A1 (122). In murine primary B cells, survival conferred by IL-4 and anti-IgM co-treatment is mediated by upregulation of another anti-a poptotic member of the Bcl-2 family, Bcl-x L (284). Much of the work detailing BCR activ ation and consequent signaling cascades have been done in vitro These studies have recently been extended to primary B cells isolated from normal donors, which have had co mparable results and have been able to further elucidate the kinetics of BCR-mediated signaling following anti-IgM crosslinking (102). Transcription factors involved in plasma cell differentiation Positive regulatory domain I binding factor 1 (PRDI-BF1) The positive regulatory domain I binding factor 1 (PRDI-BF1) was originally found to specifically bind the interferon beta (IFN) promoter and suppress IFNtranscription following viral induction (116). PRDI-BF1/Blimp-1, a zinc-finger containing-protein (116), is induced by IL-2 and IL-5 in murine cell lines (263) and by IL-6 in human cell lines (202). IL-21 is also able to induce PRDI-BF1/Blimp-1 expression (192). Because PRDI-BF1/Blimp-1 is able to drive the differentiation of B cells to immunoglobulin-secreting plasma cells, it has been termed the master regulator of plasma cell differentiation (263). PRDI-BF1/Blimp-1 belongs to the PR ( P RDI-BF1 and R IZ1) domain family, a small family of transcription factors involved in cell differentiation and tumorigenesis. Family members include RIZ1 (PRDM2) ( 27), MDS1-EVI1 (PRDM3) (66), PFM1/SC-1

PAGE 25

(PRDM4) (38, 291), and MEL1/PFM13 (PRDM16) (168). Similar to several of its fellow PR domain family members (66, 143, 286), the PRDM1 gene expresses two different products, the full-length PRDI-BF1 (hereafter referred to as PRDI-BF1) and PRDI-BF1, characterized by a truncated PR domain (figure 2). PRDI-BF1 is the product of alternative transcription initiation using an internal promoter of the PRDM1 gene. PRDI-BF1 is a transcriptional repressor, while PRDI-BF1 binds DNA but lacks transcriptional repression activity (80). PRDI-BF1 mRNA expression is elevated in myeloma cell lines, suggesting the oncogenic potential of this gene (80). Pro Zn fingers Acidic PR Acidic Pro Zn fingers Acidic PR Figure 2. The PRDM1 gene expresses two different products. Either full length PRDI-BF1 or the truncated PRDI-BF1 form are transcribed. PRDI-BF1 is the result of alternative transcription initiation using an internal promoter. PRDI-BF1 has a truncated PR domain and only one acidic domain. 9

PAGE 26

10 PRDI-BF1/Blimp-1 is able to directly repress several downstream targets involved in cell proliferation or maintenance of the B cell phenotype, thereby allowing a B cell to differentiate to a plasma cell. Direct targets include c-myc (140), BSAP/Pax5 (137), Spi-B (229), Id3 (229), and CIITA ( 74, 202) (figure 3). Mechanisms for how PRDI-BF1/Blimp-1 exerts is repressive ac tivity include recruitment of histone deacetylase activity (296) or histone methyltran sferase activity to target promoters (81). Studies using c-myc as a target promoter demonstrated PRDI-BF1/Blimp-1 and HDAC2 associate in vivo and are able to bind the c-myc promoter as a complex. PRDIBF1/Blimp-1 is able to recr uit HDAC activity to its target DNA beca use it contains two independent HDAC association domains, one in the proline-rich region and the other in a zinc-finger region (296). The histone methyltransferase G9a is recruited to the IFNpromoter by PRDI-BF1/Blimp-1 by binding its zi nc finger domain and thereby silences IFNgene transcription (81). Whether these mechanisms are involv ed in silencing of other targets, namely those specifically involved in B cell differentiation, is still unknown.

PAGE 27

PRDI-BF1 c-m yc BSAP Spi-B Id3 DHFR CDC2 ODC LDH-A Gadd153Ga dd45 p 21 p 18 AID BLNK CD19 CD79aCI ITA Syk Btk IgL VpreB MHCII J cIgH hain-1 XBP CIITA Figure 3. PRDI-BF1 represses a number of downstream targets. Direct targets of PRDI-BF1 are c-myc, BSAP, Spi-B, Id3, and CIITA promoter 3. Repression by PRDI-BF1 further affects the expression of additional targets, changing the global gene expression profile of B cells differentiating to plasma cells. 11

PAGE 28

12 PRDI-BF1/Blimp-1 is known to cause either differentiation or apoptosis of B cells. The fate of a cell is determined by the stage of development a B cell finds itself in. The 5B1b and 3B3 sublines of the murine BCL 1 B cell lymphoma cell line were used to demonstrate activated B cells were able to further differentiate, while immature and partially activated B cells underwent apopt osis upon IL-2 and IL -5 stimulation. The activated 3B3 subline, which was derived fr om the 5B1b line, underw ent differentiation upon interleukin stimulation, w ith a concomitant increase in plasma cell marker Syndecan expression and decrea se in B cell marker CD19 e xpression. In contrast, the partially activated 5B1b line demonstrated no change in Syndecan or CD19 expression. Transfection of Blimp-1 into these cells de monstrated Blimp-1 induced apoptosis in 5B1b cells, but not 3B3 cells. Similar results were found with forced expression of Blimp-1 in several B ce ll lines representing va rious stages of B cell development. Blimp1 expression resulted in apoptosis of th e pre-B 18-81, immature WEHI-231 and mature L10A cell lines. Therefore, induced expr ession of PRDI-BF1/Blimp-1 determines the ultimate fate of a cell depending on its stage of B cell development. (164) Recent studies using Prdm1 conditional knockout mice have demonstrated PRDIBF1/Blimp-1 is required for plasma cell develo pment (237). Its role in this process is accomplished by affecting several downstream targets. It affects cell cycle and proliferation by targeting c-myc (140) and the an ti-apoptotic gene A1 (119). Upon introduction of Blimp-1 into immature WEHI-231 lymphoma cells, these markers decreased to levels below that of control ce lls. These data agree with the normal short life span of plasma cells (119). A1 gene expression levels are comparable to those of mature plasma cells and myeloma cells (254), indicating there is another mechanism for

PAGE 29

13 how long-lived plasma cells are able to circ umvent apoptosis. PRDI-BF1/Blimp-1 is also responsible for upregulating genes involved in the plasma cell phenotype, namely those involved in Ig secretion. These incl ude Ig heavy and light chain genes, J chain (263) and X-box binding protein ( XBP ) (229). Finally, PRDI-BF1/Blimp-1 is also responsible for downregulating genes associated with main tainence of the B cel l phenotype, such as BSAP/Pax5 (137, 267) and BCL-6 (229). Role of PRDI-BF1/Blimp-1 in development Blimp-1 homologues play an important ro le in the embryogenesis of a number of organisms, including Drosophila zebrafish, sea urchin, chick, and mouse. Blimp-1 activity is required for the development of the peripheral nervous system sense organs and tracheal system in Drosophila (180) and is a key mediator in the development of slow twitch muscle in zebrafish, acting downstream of Hedgehog signaling (9). The zebrafish Blimp-1 homologue u-boot ( ubo) specifies formation of the neural crest and sensory neuron progenitors in the zebrafish embryo (217). In chick embryos, the cBlimp1 is expressed during development of limb buds, eyes, and brachial arches (82). In sea urchin development, the Blimp-1 homologue krox is alternatively transcribed and each form is expressed in a temporal and spatial specific manner (146) This is similar to what occurs during mouse embryogenesis (36). For instance, in the mouse embryo, Blimp-1 expression appears as early as day 7 in th e anterior endoderm and mesoderm head regions. Expression at day 8 is restricted to the developi ng foregut and primordial germ cells. During organogenesis, Blimp-1 expressi on is found in devel oping bone, teeth, and hands, with expression decreasing as development is completed (36).

PAGE 30

14 Direct targets of PRDI-BF1/Blimp-1 B cell-lineage-specifi c activator protein ( BSAP) B cell-lineage-specific activator protei n (BSAP), also known as the murine homologue Pax5 (paired box protein 5), is expr essed only in B cells. It both initiates commitment to the B cell lineage and mainta ins the B cell phenotype (165, 176) and is a direct target of PRDI-BF1/B limp-1 (137). BSAP/Pax5 is re sponsible for activating the Rag-mediated V H -to-DJ H recombination of IgH (297) and Pax5 -/B cells have severely impaired V H gene segments, thereby demonstr ating a requirement for BSAP/Pax5 expression in pre-B cell development (266). Pro-B cells can differentiate into other cell types upon cytokine-induction when BSAP/Pax5 expression is absent (181). BSAP/Pax5 acts upstream of genes important to the iden tity of B cells, namely CD19 and B cell linker (BLNK) (98) and when BSAP/Pax5 is deleted from B cells, gene expression of these downstream targets is downregulated. Impaired BCR signaling occurs in Pax5 -/B cells, which is a reflection of decreased Blnk expression (98). Downregulation of BSAP/Pax5 results in the loss of the B ce ll phenotype and a transition to the plasma cell state. This was seen by the decreased expression of BCR signaling and elevated levels of secreted IgM in the supernatant, bot h characteristics of a plasma cell phenotype (176). Genes represse d by BSAP/Pax5 have recently been shown to be re-expressed in plasma cells, demonstr ating the importance of BSAP/Pax5 in the plasma cell differentiation process (51) as repression of BS AP/Pax5 allows for differentiation to a plasma cell (137). BSAP/Pax5 represses X-box binding protein 1 (XBP), a transcription factor shown to be required for plas ma cell differentiation (209). Inhibiting XBP is one mechanism by which BSAP is able to inhibit differentiation to a

PAGE 31

15 plasma cell (210). However, loss of BSAP expression does not mean PRDI-BF1 expression is automatically induced (98). This indicates other factors are also important in maintaining the B cell phenotype and preven ting the differentiation to a plasma cell. Class II transactivator (CIITA) Products of MHC class II ge nes play an integral role in immune responses. MHC class II molecules present exogenous peptides to CD4 + T cells, thereby initiating the humoral immune response. They are primar ily expressed in antigen presenting cells (APCs), such as dendritic cells, B cells, and macrophages (269), but have also been shown to be expressed in cells of a non-he matopoietic origin ( 130). MHC class II transactivator (CIITA) is the master regulat or of MHC class II transcription. CIITA is constitutively expressed in B cells and de ndritic cells and is also induced by IFNin some systems (130). The human CIITA gene, MHC2TA is transcriptionally regulated by four independent promoters, which each transcribe a unique first exon (fi gure 4). Promoter I is active in dendritic cells, while promoter III is active in B cells. Promoter IV is the IFN-inducible promoter. The exact function of promoter II has yet to be elucidated (170). Although promoter III was first shown to be active and functional in B cells, further study has demonstrated it to also be used in activated T cells (97, 281), monocytes (99), and dendritic cells (124, 130). Expression of the gene encoding CIITA, MHC2TA is silenced during the differentiation from a B cell to a plasma cell (220, 239). As PRDI-BF1/Blimp-1 expression increases during di fferentiation to a plasma cell, expression of CIITA promoter III decrease s (202). Additionally, in vivo footprinting of the CIITA promoter

PAGE 32

III in plasma cells demonstrates lack of factor binding, meaning CIITA promoter III is bare (75, 239). CIITA promoter III is a direct target of PRDI-BF1 repression (74, 202). PRDI-BF1/Blimp-1 binds CIITA promoter III at a site in the proximal promoter region (74, 202). However, no interaction with this site is seen in plasma cells (75), because the promoter is bare in these cells. PRDI-BF1/Blimp-1 has also recently been shown to repress CIITA promoter IV in lymphoid lineage cells (37). Myeloid ? Lymphoid IFN1 kb exon 1.3 ATG exon 1.4 exon 1.2 exon 1.1 ATG exon 2 ATG Figure 4. Expression of CIITA gene expression is regulated by four independent promoters. Each promoter transcribes a unique exon 1, which occurs in a cell-type specific manner. Promoter IV is IFNinducible. c-Myc c-Myc plays an important role in the growth, proliferation, and apoptosis of cells (40, 179, 224) and its dysregulation plays an important role in the onset of many different types of cancers, including B cell malignancies (127, 179). c-Myc is a member of the helix-loop-helix/leucine zipper family of transcription factors (18). It is an important factor in normal B cell differentiation, with high expression in the pro-B and pre-B stages 16

PAGE 33

17 of development and lower expression in immatu re B cells which are in more of a resting stage of development. Levels of c-myc in crease during antigen-induced proliferation of mature B cells (125, 163). c-Myc is one of the five direct downs tream targets of PRDI-BF1/Blimp-1. The cmyc promoter contains a PRDI-BF1/Blim p-1 binding site, which when occupied represses c-myc promoter activity. These data implicated c-myc as a direct target of PRDI-BF1/Blimp-1 (140). When BCL1 cells ar e induced to different iate by IL-2 and IL5 stimulation, PRDI-BF1/Blimp-1 mRNA le vels are induced while c-myc protein expression is decreased (140). Ectopic expression of c-myc in BCL1 cells blocked differentiation of these cells, as demonstrat ed by the low levels of secreted IgM and unchanged levels of Syndecan-1 on the cell surface. These cells also continued proliferating (138). However, repression of cmyc transcription by a dominant negative form of c-myc did inhibit cell proliferation, but was not sufficient to cause differentiation of BCL1 cells. These data pointed to regulat ion of additional PRDI-BF1/Blimp-1 target genes as a requirement for plasma cell differentiation (138). Spi-B and Id3 PRDI-BF1/Blimp-1 was found to directly bind Spi-B and Id3 by gel shift assays and chromatin immunoprecipation assays, corro borating microarray data (229). The Ets family member Spi-B and inhibitor of di fferentiaton 3 (Id3) are both involved in regulating BCR signaling (70, 193, 244). Spi-B is expressed at all stages of B cell development (226) and has also been shown to be expressed in normal plasma cells as well as those isolated from myeloma patients, but not in myeloma cell lines (172). Spi-B acts with PU.1 to regulate proper BCR signaling downstream of Syk phosphorylation

PAGE 34

18 (70) and also affects Btk transcription (171). Id3 is required for proliferation of B cells following BCR cross-linking, but is dispensable for normal B cell development, as has been shown using Id3 knockout mice (193). Both mR NA and protein levels are increased in WEHI 231 B cells stimulated with the BCR cross-linker anti-IgM, with corresponding growth arrest (88). This is due to transcriptional regulation of the Id3 promoter by anti-IgM in these ce lls (135). Id3 is a direct downstream target of PRDIBF1, but the authors never studied PRDI-BF1 e xpression levels in these experiments. X box binding protein 1 (XBP-1) X box binding protein 1, or XBP, is a tr anscriptional activator belonging to the CREB/ATF family. It is require d for differentiation to a plasma cell and is expressed at high levels in plasma cells (104, 210). E xpression of PRDI-BF1 is required for the induction of XBP expression (237). This occu rs by the direct repression of BSAP/Pax5 by PRDI-BF1, which leads to the upregulation of XBP (137) Splicing of XBP mRNA generates a more stable form of XBP, termed XBP S which plays an important role in the secretory process of plasma cells (105). Plasma cells and immunoglobulin secretion A hallmark of plasma cells is their ability to secrete immunoglobulins (236). PRDI-BF1/Blimp-1 and XBP have separate and distinct roles in th is process (232). Microarray experiments were done using prdm1 -deficient and xbp -deficient mice. Using lipopolysaccharide (LPS) treatment to induce plasma cell differentiation in the splenic B cells of these mice, XBP1 mRNA was shown to be indu ced in wild-type, but not prdm1 deficient mice, while PRDM1 mRNA expression was induced equally in wild-type and xbp -deficient mice. These data were consis tent with previous findings that PRDI-

PAGE 35

19 BF1/Blimp-1 acts upstream of XBP (229, 237). This work showed ma ny genes involved in the secretory pathway were dependent on both PRDI-BF1 and XBP. Expression of the sdc1 gene, which encodes the plasma cell ma rker Syndecan-1, was dependent only on PRDI-BF1 expression. PRDI-BF1 was also required for Ig ge ne induction. Therefore, PRDI-BF1 is responsible for plasma cell ge ne expression, while XBP, acting downstream of PRDI-BF1, is responsible for coordinating the changes in cell stru cture and function as leading to the secretory phe notype of plasma cells (232). XBP is involved in the unfolded protein response (UPR) in plasma cells. The endoplasmic reticulum (ER) is the site of pr otein synthesis and fold ing, which require an optimal mix of factors such as ATP, Ca 2+ and an environment c onducive to disulphidebond formation. Because of this, the ER environment can be disturbed by stresses affecting cellular energy levels, the redox state, and Ca 2+ concentrations. Upon ER stress, unfolded proteins accumulate in the ER, which results in the cell responding with the UPR (249). During the UPR, the ER folds and translocates proteins, protein synthesis decreases, and cell cycle ar rest and apoptosis occur ( 225). While the endoplasmic reticulum is involved in plasma cell differentiation, decreased protein synthesis is not. Therefore, it has been suggested that there is a physio logic UPR in addition to the welldefined stress-induced UPR. And, it is this physiologic UPR that plasma cells use (72, 232). Activating transcription factor 6 (A TF-6) (294), IL-4 (105), and Blimp-1dependent repression of BSAP (137) are all responsible for inducing XBP mRNA. Studies using xbp -deficient mouse B cells induced to differentiate and human Raji B cells expressing the transcriptionally active, processed form of XB P demonstrated XBP

PAGE 36

20 involvement in almost every aspect of th e secretory process. XBP regulated genes responsible for targeting proteins to the e ndoplasmic reticulum (ER), translocating them across the ER membrane, foldi ng of ER proteins, degrada tion of misfolded proteins, protein glycosylation, trafficking between th e ER and the Golgi, trafficking in the endosomal pathway, and targeting of secretory vesicles to the plasma membrane (232). XBP is also responsible for increasing the ma ss of mitochondria and nucleus, size of the ER, and overall size of the cell (232). B-cell lymphoma 6 (BCL-6) B-cell lymphoma 6, or BCL-6, was discovere d as a gene that is translocated in some non-Hodgkins lymphomas (8, 292). It is required for germinal center (GC) formation (52) and is highly expressed in th ese cells (33). BCL-6 represses PRDI-BF1 expression (234, 262) by inhibiting AP-1-dep endent activation (271), by blocking STAT3-dependent gene transcription (211 ), and by direct re pression (235). By repressing PRDI-BF1/Blimp-1 expression, BCL-6 allows the GC reaction to continue before plasma cell differentiation occurs ( 234). However, microarray analysis shows PRDI-BF1/Blimp-1 is also able to repress BCL-6 expression (229). Interferon regulatory factor family Expression of interferon regulatory fact or (IRF) family members is primarily restricted to lymphoid cells (57, 159). IR F-4 is a member of the IRF family of transcriptional regulators. IRF-4 has b een shown to be required for plasma cell differentiation (28) and is ex pressed by both plasma cells and GC B cells expressing PRDI-BF1/Blimp-1 (5, 64). It is also required for the initial proliferative burst of activated B cells (166). IRF-4 has been proposed to be resp onsible for preparing B cells

PAGE 37

21 for the differentiation process by induci ng this proliferative burst which precedes terminal differentiation (236). This is base d on the observation that loss of Mitf, a factor which represses IRF-4, leads to the formation of plasma cells and a concomitant increase in IRF-4 expression (139). IRF-4 is able to bind IFN-stimulated response elements and repress IFNstimulated genes on its own (289). In the pr esence of the Ets family member PU.1, IRF-4 is able to activate the CD20 promoter and the Ig 3 enhancer (57, 94, 203), while IRF-4 complexed with PU.1 can downregulate CD68 e xpression in lymphoid cells (183). IRF-4 can interact with BCL-6 (79) as well as PR DI-BF1/Blimp-1 (78). Its interaction with PRDI-BF1/Blimp-1 represses CD23b (78). IRF-8 is another member of the IRF fa mily, which has recently been shown to activate PRDI-BF1/Blimp-1 in murine my eloid progenitor cells (252). IRF-8 is constitutively expressed in macrophages, B cells, T cells, and dendritic cells (56, 152, 174, 221, 259, 276, 277). A recent study demonstrated insertion of proviral elements at the IRF-8 locus in mice with primarily B cell lymphomas or plasmacytomas (153), indicating IRF-8 might play a role in the proliferation of B cell lymphomas. IRF-8 expression was found to be high in B cells, but is decreased in plasma cells (128). In GC B cells, BCL-6 was shown to be a target of activation by IRF-8 (128). Therefore, IRF family members appear to play an im portant role in B cell development and differentiation. PU.1 PU.1 is a transcription factor belonging to the Ets family and is an important regulator of B cell development (83). PU.1 regulates genes expre ssed at both early and

PAGE 38

22 late stages of B cell development (49, 161, 270, 293), but is not expre ssed in plasma cells (172, 198). Mice lacking PU.1 are deficient for both B cells and macrophages, demonstrating the importance of PU.1 in B cell development (162, 227). PU.1 regulates expression of the IL-7R which is necessary for pro-B cell differentiation and survival signals conferred by IL-7 (49). This regula tion occurs in a graded manner. If PU.1 expression is low, B cell development occu rs, with concomitant increases in IL-7R gene expression (49, 50). When PU .1 expression is high, B cell de velopment is repressed and macrophage differentiation is induced (50). Ets family members can complex with othe r transcription factors or other family members to regulate gene expression (134). They can interact with AP-1, Sp1, BSAP, NFB (134), and IRF family members (61, 157) in a cell-type specific manner. In hematopoietic cells, PU.1 can interact with IRF family members to regulate gene expression (183, 188, 270). For example, IRF-8 has been shown to regulate gene expression of RANTES in cooperation with IRF-1, PU.1, and NFB at an NFB site in murine macrophages (142). B cell lymphomas Lymphoid malignancies, such as lympho mas and leukemias, can occur when the normal process of B cell differentiation is disrupted. Gene expression profiling has recently demonstrated the sim ilarity between lymphoid malignancies and various stages of normal B cell development (46, 230, 233, 238). Diffuse large B-cell lymphomas (DLBCL) are further classified as either germinal center B-cell-like (GC) DLBCL or activated B-cell-like (ABC) DLBCL. GC DL BCLs have a gene expression profile comparable to that of normal GC B cells ( 1, 214, 215) and appear to be fixed at the GC

PAGE 39

23 stage of B cell differentiation (230). Unlike GC DLBCLs, ABC DLBCLs have a molecular profile analogous to activated peripheral B cells (1, 214, 215). They resemble pre-plasma cells in terms of their increased expression of I g, X-box binding protein 1(XBP), IRF-4, and PRDI-BF1/Blimp-1 ( 195, 215, 230, 251) while their expression of BCL-6 is lower (215, 230). Burkitts lymphomas also express GC B cell genes, as do follicular lymphomas (230). Burkitts lympho mas can be distinguished from DLBCL by high levels of c-myc target genes and a subgroup of GC B cell genes as well as low levels of MHC class I genes and NFB target genes (46). Distinguishing the molecular profiles of lymphomas is important, as the sp ecific genetic alterations that occur disrupt normal B cell differentiation by affecting thei r progression through the cell cycle, their ability to undergo apoptosis, and their ab ility to differentiate normally (230). Role of PRDI-BF1 in lymphoma and myeloma cells PRDI-BF1/Blimp-1 has long been demonstrated to be expressed in plasma cells, but not in B cells (172). Recent findings demonstrate expression of PRDI-BF1/Blimp-1 in a subset of lymphoma cells, namely GC B cells which are also positive for plasma cell markers (32). Diffuse large B cell lympho ma (DLBCL) can be divided into several subtypes based on recent molecular profiling data. These subtypes are representative of the origins from the different stages of B cell differentiation. Germinal center B cell-like (GCB) DLBCL is thought to derive from GC centroblasts, while activated B cell-like (ABC) DLBCL resembles the phenotype of a small group of GC cells undergoing differentiation to a plasma cell (1, 230). However, even though a subset of ABC-DLBCLs expresses the PRDM1 gene, it appears to be a functionally inactive form, as protein levels are not expressed in these

PAGE 40

24 cells (24, 69, 195, 251). It has been proposed th at lack of functional PRDI-BF1/Blimp-1 leads to inhibition of differentiation in these cells, forcing these GC B cells to remain in an active, proliferativ e state, eventually l eading to the developm ent of DLBCL (251). Mutational analysis of the PRDM1 gene in both DLBCL cell lines and patients demonstrated genetic alterations, leading to a la ck of protein expression in these cells. Of 35 patient samples studied, 8 had genetic altera tions such as point mutations and frameshift mutations, all leading to prematur e translation termination and production of a non-functional form of PRDI-BF1/Blimp-1 (251). Pasqualucci et al did a similar study of the PRDM1 gene, but looked at mutations in both ABC-DLBCL and GC-DLBCL patients. No PRDM1 gene mutations were found in GC-DLBCL patient samples, but 24% of ABC-DLBCL patient samples had genetic alterations ( 195). It appears PRDM1 gene inactivation by mutation in some DLBCL patients contributes to lymphomagenesis by inhibiting the normal differentiation process of GC B cells (195, 251). The loss of functional PRDI-BF1/Blimp-1 in some DLBCL cases suggests PRDM1 acts as a tumor suppressor gene in a small subset of lymphomas (195, 251). The expression of PRDI-BF1/Blimp-1 in myeloma cells has been widely reported (21, 74, 80, 172). However, a recen t report by Borson et al. shows PRDM1 gene expression is found in B cells derived from myeloma patients, but not in those from normal, healthy donors (21). Genetic alterations of the PRDM1 gene were not studied (21), but these findings indicate PRDI-BF1/B limp-1 may be important to the pathology of lymphomas and myelomas.

PAGE 41

25 Drug resistance in multiple myeloma Multiple myeloma is a fatal plasma cell malignancy characterized by the accumulation of latent plasma cells in the bone marrow (84). These cancerous cells resist apoptosis and are characterized by a low-proliferative index ( 268). The disease course of patients with myeloma typically includes the emergence of drug-resistant plasma cells (76), a phenotype termed multidrug resistance (MDR). Following an initial response to treatment, many patients invariably become refractory to treatment. Therefore, it becomes important to find new drugs which can overcome this pheno type and still be effective in patients. Several mechanisms of MDR have been well elucidated. These include decreased uptake of drugs, due to the presence of dr ug transporters; cellular mechanisms which diminish the capacity of drugs to kill cells, such as cell cycle alterations, DNA damage repair mechanisms, and altered drug metabolis m; and, increased ener gy-dependent efflux of drugs that enter the plas ma membrane by diffusion (248). Drug resistance in myeloma cells is also conferred by interaction of myeloma cells with extracellular matrix components of the bone marrow (45). Activating Ras mutations have been show n to be involved with chemoresistance in melanoma cells (107) and ovarian cancer cells (96). They have also been demonstrated to be important in myeloma ce lls. ANBL6 myeloma cells transfected with mutated Nor K-Ras were shown to be more resistant to dexamethasone, doxorubicin, and melphalan than control cells (216). Recently, the same ANBL-6 transfectants were shown to have enhanced bindi ng to both the extracellular matrix component fibronectin and bone marrow stromal cells (BMSC), whic h was found to be mediated by increased

PAGE 42

26 levels of cyclooxygenase (cox)-2 in fibrone ctin-adhered cells. The mechanism for enhanced binding to the BMSCs remains to be elucidated (95). Regardless, increased cox-2 levels in ANBL6 cells expressing activ ated Nand K-Ras are correlated with increased resistance to treatme nt with melphalan (95). A lthough the exact mechanism by which activated Ras protects cancer cells from apoptosis is stil l unknown, activating mutations of the Ras oncogene play an importa nt role in protecting myeloma cells from chemotherapy-induced apoptosis. Apoptosis and role of Bcl-x L Apoptosis, or programmed cell death, is a finely tuned cascade of events leading to the eventual death of cells. Apoptosis play s an important role in the daily self-renewal of organs and tissues in the body. As new cells are pr oduced, a homeostatic balance is maintained by older cells dying in an ordere d fashion (207, 208). The apoptotic process contrasts with necrosis, in that there are no inflammatory reactions or tissue scarring (207). When apoptosis is deregulated, disease states such as cancer occur and can be maintained due to defects in the apoptotic machinery. The Bcl-2 family of proteins plays an important role in regulating cell death. Several family members are pro-apoptotic (B ax, Bok, Bid), while others have an antiapoptotic role in cells (Bcl-2, Bcl-x L Mcl-1, Bfl-1/A1) (34). Bcl-2 family members regulate apoptosis by either interacting with other family members (197) or by regulating ion-channel activity (207). It is the ratio of proand anti-apoptotic Bcl-2 family members which determines the ultimate fate of a cell in response to an apoptotic signal (268). Anti-apoptotic family members are locali zed to the nuclear membrane, endoplasmic

PAGE 43

27 reticulum, or mitochondrial outer membrane while pro-apoptotic family members are generally found in the cytosol or associ ated with the cytoskeleton (77). Bcl-x L expression is associated with chemor esistance in myeloma cells (261) and is expressed in normal plasma cells as we ll as myeloma cell lines and patient samples (205, 241). IL-6, an essential cytokine to the growth and survival of myeloma cells, upregulated Bcl-x L protein levels in both patient samples and cel l lines (205). Studies using Bcl-x L transgenic mice demonstrate a nonmalignant plasma cell phenotype in both the bone marrow and lymphoid organs of these mice, whose incidence increased with the age of the animal (141). However, when the Bcl-x L mice were crossed with c-myc transgenic mice, the plasma cell phenotype became one of malignancy with death from lymphoproliferative disorder at 5.5 weeks in 50% of the double-tran sgenic mice (141). These data provide a link between Bcl-x L and myeloma disease pathology. The role of the Ras oncogene in myeloma The Ras proteins are members of a la rge superfamily of GTP-binding proteins, which are subdivided based on sequence homol ogy. Ras family members are involved in control of cell growth. This family is comp rised of 3 members, namely H-Ras, K-Ras, and N-Ras. These members can be activated by mutation at codons 12, 13, and 61 (22). When Ras is activated, it is bound to GTP and ab le to interact with its downstream target enzyme (55). When Ras is inactive, it is found in the GDP-bound form. In the normal situation, the ratio of bound GTP to GDP controls the activity of Ras proteins (29). This biological activity is contro lled by a GDP/GTP cycle, which is regulated by GDP/GTP exchange and GTP hydrolysis. GEFs, or guanine nucleotide exchange factors, regulate the exchange of GDP for GTP, while GAPs, or GTPase activating proteins, regulate

PAGE 44

28 hydrolysis of GTP (29). However, when Ras is mutated, the equilibrium of Ras-GTP to Ras-GDP is weighted in favor of the activ e, GTP-bound form. GAPs are prevented from hydrolyzing the GTP on Ras, locking it in the ac tive form (55). This leads to constitutive activation of Ras proteins. Members of the Ras family GTPases have a well-established role in oncogenesis (22). Mutations of various Ras family member s have been shown to be associated with various cancers (156), including multiple my eloma. Numerous investigators have examined the frequency of Ras mutations in multiple myeloma, and have reported a correlation between activating Ras mutati ons and disease progression (15, 41, 144, 178, 204, 206). Activating mutations of N-Ras and K-Ras codons 12, 13, and 61 are involved in myeloma disease progression (15). Prenylation of the Ras oncoprotein Ras proteins must undergo further post-translational modification upon being synthesized to become biologically active molecules. Otherwise, Ras remains an inactive, cytosolic protein. Ras proteins under go protein prenylation to allow targeting to the plasma membrane, where they become active players in signaling cascades (55, 85, 280). The mevalonate pathway, also commonly recognized as the cholesterol biosynthetic pathway, is responsible for the production of cholesterol and nonsterol products (167). It is also the pathway that plays an important role in protein prenylation reactions (see figure 5). Two enzyme s, farnesyltransferase (FTase) and geranylgeranyltransferase I (GGTase I), catalyze this prenyl posttranslational modification by transferring farnesyl or gerany lgeranyl, respectively, to the cysteine of the carboxyl terminal CAAX box ((C=cystein e, A=aliphatic amino acid (leucine,

PAGE 45

29 isoleucine, or valine), X=any amino acid)) (55, 106). Follow ing addition of the farnesyl or geranylgeranyl group to th e cysteine residue, the three terminal amino acid residues (AAX) are cleaved in the endoplasmic re ticulum by the endoprotease Rce1(191). Finally, the cysteine residue becomes carboxyl methylated (43, 65). H-, N-, and K-Ras are all farnesylated. When FTase is inhibi ted, K-Ras, but not N-Ras or H-Ras, becomes geranylgeranylated (133).

PAGE 46

HMG-CoA Mevalonate Isopentenyl Diphosphate Geranyl Diphosphate Farnesyl Pyrophosphate Geranylgeranyl Diphosphate Farnesylated proteins Squalene Geranylgeranylated proteins Cholesterol Figure 5. The mevalonate pathway plays a role in generating prenylated proteins. Farnesyl or geranylgeranyl are transferred to the carboxyl terminal cysteine residue by either the enzyme farnesyl transferase or geranylgeranyl transferase, respectively. (adapted from (167)) 30

PAGE 47

Cys A A X SH Cys A A X S p renyl g roup prenyl t ransferase Cys S p renyl g roup OMe Rce1 E R Figure 6. Prenylation occurs on the carboxy terminal CAAX box. Farnesyl and geranylgeranyl groups are transferred to the cysteine residue of the CAAX motif by either farnesyl or geranylgeranyl transferase, respectively. The AAX residue is cleaved in the endoplasmic reticulum (ER) by the enzyme Rce1 and the cysteine residue is modified by addition of a carboxy methyl group (OMe). (adapted from (123)) 31

PAGE 48

32 Downstream targets of Ras Activated Ras is able to mediate signa ling through a variety of downstream kinase pathways that regulate cell pr oliferation and surv ival (123). These include the Raf-MEKMAPK (mitogen-activated protein kinase) and PI 3 K (phosphatidyl inositol-3 kinase)/AKT pathways. These pathways can be activated in res ponse to a variety of growth factors (131). However, activated Ras has been shown to act independently of the exogenous myeloma growth factor IL-6 in Ras-mutated ANBL6 cells (16, 17), while the parental ANBL6 cells are IL-6-dependent and stop growing when IL-6 is removed (108). Therefore, mutated Ras confers a survival advantage to myeloma cells by activating signaling pathways responsible for cell growth and surviv al, independent of normal growth factors. The Raf-MEK-MAPK pathway is one of the key signaling pathways downstream of Ras. Raf is a serine-thr eonine protein kinase which bi nds Ras to become active (23, 274). Once active, Raf is able to initia te a cascade of phosphorylation events in downstream targets, which results in the phosphorylation of MA PK. MAPK is now active and can translocate to the nucleus, ac tivating transcription factors which regulate cell proliferation and apoptosis (20, 285). In myeloma, MIP1was recently shown to be a downstream target of MAPK signaling in Ras mutated myeloma cells. MIP1is an important survival and proliferation factor in myeloma cells as well as an important factor in myeloma-associ ated bone disease (158). Myeloma growth-stimulating cytokines, such IL-6 (4, 115), activate signal transduction through the PI3K/AKT signaling pa thway resulting in cell proliferation and survival (26, 117). Activated Ras interacts directly with the PI3K catalytic subunit,

PAGE 49

33 which leads to the activation of the serine-threonine ki nase AKT (109, 212). AKT is frequently activated in myeloma cells and correlates with disease activity (100). Inhibition of AKT resulted in decreased cell proliferation (260) and increased apoptosis (93). Treatment with both the farnesyl transferase inhibitor lonafarnib and the proteasome inhibitor Bortezomib were s hown to downregulate phospho-AKT and induce apoptosis (47). Inhibitors of protein prenylation The high incidence of Ras mutations in cancers, which leads to the constitutive activation of Ras proteins, drove the devel opment of pharmacologic inhibitors of Ras (123). Non-selective agents which targeted the mevalonate pathway, such as the HMG CoA reducatase inhibitor lovast atin, were initially used to inhibit Ras prenylation. Unfortunately, patients treated with this drug developed dose-inhibiting side effects due to the nonspecific nature of th is compound (256). Therefore, inhibitors to other steps of the mevalonate pathway were developed to ta rget protein prenylati on of Ras. Several classes of farnesyl transferas e inhibitors (FTI) have been designed in recent years to target the biological function of Ras proteins. Screening of libraries and natural products has yielded farnesyl diphosphate (FDP) analogues as one class of FTIs. CAAX peptidomimetics are another class of FTIs which compete fo r farnesyl transferase binding by mimicking the carboxyl term inus CAAX motif of Ras a nd related proteins. Some compounds share properties of both the CAAX box and farnesyl diphosphate and are known as bisubstrate analogues because they mimic a step in the mevalonate pathway. A fourth class of FTIs are the nonpeptidomimetic inhibitors, which have been identified by random screening of compound libraries (55, 123).

PAGE 50

34 FTIs have been developed by pharmaceutical companies as potential anti-cancer agents. Some of these include R115777 ( tipifarnib), SCH66336 (lonafarnib), and BMS214662 (106). In clinical tr ials, R115777 has been found to be effective against hematopoietic malignancies, like myeloma (3). Geranylgeranyl tran sferase inhibitors have also been developed because when farnesylation of Nand K-Ras are blocked, they become alternatively geranylgeranylated. Howe ver, attempting to use both together at doses required to block prenylation are not effective due to toxi city issues (147). Therefore, targeting activating mutations of Ras in myeloma cells with prenyltransferase inhibitors is an im portant area of study.

PAGE 51

35 Chapter Two Transcriptional regulation of PRDI-BF1/Blimp-1 in lymphoma and myeloma cells Introduction The positive regulatory domain I binding factor 1 (PRDI-BF1) was originally found to specifically bind the interferon beta (IFN) promoter and suppress IFNtranscription following viral induction (116). Blimp-1, the murine homologue of PRDIBF1, was originally described by Turner et al. as a transcription fa ctor that could induce the differentiation of B cells (263). PR DI-BF1/Blimp-1 has sinc e been found to be required for the differentiation of a B cel l to a plasma cell (237). During the differentiation of mature B cells to plasma cells, PRDI-BF1 represses multiple genes involved in maintaining the B cell phenotype and in maintaining ce llular proliferation, such as CIITA (74, 202), c-myc (140), and BS AP (137). Microa rray studies have outlined the PRDI-BF1 repression profile and led to the identification of two additional direct targets, Spi-B an d Id3 (229). Additionally, PRDM1 has recently been linked to cellular stress and the unfo lded protein response (54). Anti-IgM cross-linking of the B cell receptor has been reported in multiple studies to induce apoptosis in lymphoma (12, 30, 87, 112, 299). This response has been correlated with decreased levels of c-myc (140). Inducing PRDI-BF1/Blimp-1 expression in lymphoma cells with histon e deacetylase inhibitors also decreased

PAGE 52

36 expression of the downstream targets c-my c and BSAP (129). More specifically, introduction of Blimp-1 into lymphoma cells can induce apop tosis, suggesting PRDI-BF1 may be an important mediator of the anti-IgM and apoptotic response (119, 164). However, no direct link between expre ssion of PRDI-BF1/Blimp-1 and anti-IgM mediated B cell receptor activation has been described. Recently, PRDI-BF1/Blimp-1 expression has be en detected in some diffuse large B cell lymphomas (DLBCL) (69, 195, 251). Ho wever, inactivatin g mutations were described indicating a potential tumor suppressor role for this gene (195, 251). Similarly, proliferating myeloma cells and myeloma ce ll lines abundantly express the truncated PRDI-BF1 isoform, PRDI-BF1 which has impaired function (80). In addition, Borson et al (21) suggest that PRDM1 expression is present in B cells isolated from myeloma patients while normal donors lack expression as expected. The mutation status of PRDM1 in these myeloma derived B cells is unknow n. Together these findings indicate PRDIBF1/Blimp-1 may be important to the pathol ogy of various hematopoietic malignancies, including lymphoma. Very little is known about how PRDI-BF1 expression is regulated. Our data now demonstrate PRDM1 is regulated primarily at the level of transcription in both myeloma cells and in lymphoma cells stimulated by cross-linking of the B cell receptor. B cell receptor stimulation leads to rapid increases in mRNA levels and promoter activity while mRNA stability is unchanged. Using promoter deletion constructs and in vivo genomic footprinting, we demonstrate tw o regions of activation in the PRDM1 promoter and multiple in vivo protein-DNA interactions at the proxi mal promoter and at more distal activation regions in both lymphoma and myeloma cells. Three of the detected

PAGE 53

37 interactions occur in a cell-type specific manner and PU.1 binding is revealed to be functionally important for promoter activity in stimulated lymphoma cells. These findings demonstrate the PRDM1 promoter is poised for rapid activation in lymphoma cells, which suggests inducing PRDI-BF1 expres sion in lymphoma cells may be a viable target to inhibit lymphoma progression. Results Expression of PRDM1 mRNA levels in lymphoma and myeloma cells Most B cells lack detectable levels of PRDM1 until they commit to differentiate (5, 24, 32, 69). As shown in figure 7, Burki tts lymphoma cell lines lack detectable levels of PRDM1 while myeloma cells have abundant PRDM1 expression. Analysis of myeloma patient bone marrow samples show that compared to normal bone marrow, myeloma bone marrow expre sses very high levels of PRDM1 mRNA. We next examined the effects of B cell receptor cross-linking on PRDM1 mRNA levels in CA46 Burkitts lymphoma cells. Treatment with anti-IgM to cross-link the B cell receptor significantly increased PRDM1 mRNA levels approximately 8-fold above untreated controls (p<0.05) (figure 8A). This induction st rongly correlated with increa sed apoptosis, as measured by Annexin V staining (figure 8B).

PAGE 54

Figure 7. PRDI-BF1 mRNA levels are elevated in myeloma cells versus lymphoma cells. A, Basal levels of PRDI-BF1 mRNA were determined in both lymphoma and myeloma cell lines by real-time RT-PCR. Lymphoma cells have nearly undetectable mRNA, while myeloma cell lines have significant but variable levels. PRDI-BF1 mRNA levels were normalized to GAPDH mRNA levels. The data is representative of at least three experiments. B, PRDI-BF1 mRNA levels are elevated in bone marrow samples derived from myeloma patients when compared to normal healthy donor samples. NBM, normal bone marrow (Stratagene); N1 and N2, donors with other disease but without any evidence of bone marrow involvement (H. Lee Moffitt Cancer Center Tissue Bank); M1-M5, myeloma patient bone marrow containing 53-76% plasma cells. 38

PAGE 55

Figure 8. Anti-IgM treatment induces PRDI-BF1 mRNA levels and apoptosis in CA46 lymphoma cells. A, Treatment of CA46 lymphoma cells for 24 hours with 10 g/ml anti-IgM induces PRDI-BF1 mRNA levels significantly. The mean of 3 experiments is shown (p<0.05, Students t-test). B, Treatment with anti-IgM for 24 hours induces apoptosis approximately 60% above the control in CA46 lymphoma cells, as assessed by Annexin V staining followed by FACS analysis. The data is representative of 3 independent experiments. (Gray histogram, untreated control; black outlined histogram, treated cells) 39

PAGE 56

40 PRDI-BF1 regulation occurs at the transcriptional level As was shown in figure 7A, lymphoma ce lls do not have detectable levels of PRDM1 mRNA, while myeloma cells express very high levels. Therefore, to determine the level at which PRDM1 regulation occurs, we examined basal levels of nascent RNA production in both lymphoma and myeloma cells. Nascen t RNAs, defined as those RNAs still in the process of being transcri bed, are an accurate measure of endogenous transcriptional activity (283). The nascent RNA were purified from nuclei after extensive washing to remove the released transcri pts and quantified by real-time RT-PCR with specific primers directed to the 5 end of the RNA transcript. Le vels of nascent RNA production in CA46 lymphoma cells are signific antly lower (p<0.005) than that of U266 myeloma cells (figure 9A). Because an ti-IgM stimulation significantly increases PRDM1 mRNA levels (figure 8A), nascent RNA production in CA46 lymphoma cells stimulated with anti-IgM was examined. Treatment of these cells for 1 hour with anti-IgM significantly increased producti on of PRDI-BF1 nascent RNA (p<0.05) (figure 9B). To further establish the transcripti onal activation of PRDM1, we cloned 2618 basepairs of the promoter (80) and examined the effect of B cell re ceptor stimulation on transcriptional activity (figure 9C). A statistically significant increase in luciferase activity was observed 24 hours after stimulation. This indicates that, at least in part, the transcription activation is mediated by elements within the 2618 bp promoter. Examination of PRDM1 mRNA stability did not reveal any changes upon anti-IgM treatment (figure 9D). Together these data indicate regulation of PRDI-BF1 occurs primarily at the level of transcription.

PAGE 57

Figure 9. PRDI-BF1 regulation occurs at the level of transcription. A, Relative levels of nascent RNA were determined by real-time RT-PCR for both CA46 lymphoma and U266 myeloma cells. Levels in U266 myeloma cells are significantly higher than that of CA46 lymphoma cells (p<0.005, Students t-test). B, In CA46 lymphoma cells treated with anti-IgM for 1 hour, relative levels of PRDI-BF1 nascent RNA increase significantly (p<0.05, Students t-test). C, Anti-IgM treatment (24 hours) of transiently transfected CA46 cells with PRD 2618 shows a significant increase in luciferase activity (p<0.05, Students t-test). D, Stability of PRDM1 mRNA is unchanged upon treatment with anti-IgM. CA46 cells were pre-treated for 1 hour with anti-IgM, followed by a time course with Actinomycin D to determine mRNA half-lives. In all panels, data shown is the mean of at least 3 experiments. 41

PAGE 58

42 Identification of regulatory regions in the PRDI-BF1 promoter Because PRDI-BF1 is primar ily regulated at the level of transcription, further examination of the PRDI-BF1 promoter is necessary to determine specific areas of regulation. Using promoter deletion constr ucts, potential regulatory regions in the promoter were identified in both CA46 lym phoma and U266 myeloma cells. As shown in figure 10A, strong promoter activity is detected in U2 66 myeloma cells with the proximal 521 bp promoter region as compared to the pGL3-basic control. Two distal regions conferring additional activation were al so detected. The firs t region of activation is found -1528 to -1921 upstream of the transcrip tion start site, while the second region is found at -2271 to -2618. These two regions bo th confer an increase of approximately 2fold in activity and suggest important regulatory factors bind in these areas. Transfection of the same PRDM1 constructs into the CA46 lymphoma cell line revealed a similar pattern of activation thr ough the proximal 521 promoter and the distal 1528 to -1921 activator (figure 10B). However, the region between -2271 and -2618 was not active in lymphoma cells. While it is no t possible to definitively compare absolute activity levels in transient transfections between different cell lines, the 2618 promoter construct shows consistently higher e xpression in the U266 myeloma cells, which correlates with higher expression of the endogenous gene expression in these cells.

PAGE 59

Figure 10. Characterization of PRDM1 promoter activity in CA46 lymphoma cells and U266 myeloma cells. CA46 lymphoma cells and U266 myeloma cells were transiently transfected with PRDI-BF1 promoter deletion constructs fused to the luciferase reporter gene to map regions of activation. A, U266 cells show elevated levels of promoter activity in the proximal promoter. Regions of activation are located -1528 to -1921 and -2271 to -2618 relative to the transcription start site. B, CA46 lymphoma cells show increased activity at the proximal promoter. There is also one region of activation located -1528 to -1921 relative to the transcription start site. Data shown are the mean of 3 experiments for both figures. 43

PAGE 60

44 Identification of putative factor bi nding sites in the PRDI-BF1 promoter To further elucidate what transcription f actors are responsible for the activation of the promoter in these cells, we employed in vivo genomic footprinting to identify where factors are bound to the promoter in these put ative regulatory regions. Examination of the region proximal to the transcription start site demonstrated fact or binding in both the lymphoma and myeloma cells (figure 11). Thes e sites are similarly occupied in both cell types. A cluster of contacts closest to the transcription start site are centered over a sequence with homology to a Sp1 elemen t. Sp1 binding was confirmed by electrophoretic gel mobility shif t assay and specific antibody r eactivity (figure 12). The P.A and P.B contact points do not have obvious homology with known elements. To examine the more distal promoter regions by in vivo footprinting, approximately 600 bp were scanned between -1600 to -2200 and 400 bp between -2200 and -2600. We utilized ten in vivo footprinting primer sets to display both the upper and lower strands across these regions. The majority of contacts were in the region -1700 to 2100. Three cell line-speci fic interactions, which are de noted as P.C, P.F, and P.H (figure 13), were found in this region. The ot her indicated protein-DNA interactions (i.e., P.D, P.E, P.F, P.I, and P.J) are found in bot h lymphoma and myeloma cells. Site P.C is located at -2067 and is a myeloma-specific fact or. Sites P.F and P.H are located at -1974 and -1742, respectively, and are ly mphoma specific factors. S ite P.J is located at -1807, and has been previously characterized as the AP-1 element binding site by Vasanwala et al (271). Because the -2271 to -2618 region is a myeloma-specific region of activation, we thoroughly examined this region of the promoter, but found no uniqu e contacts in this region (figure 14).

PAGE 61

Figure 11. In vivo genomic footprinting of the PRDI-BF1 proximal promoter reveals numerous protein-DNA interactions in both lymphoma and myeloma cells. A, 8226 myeloma and CA46 lymphoma cells were analyzed for interactions at the first 160 basepairs of the promoter region using the PRDLOW2 primer set. The control lanes show the in vitro methylated guanine residues, while the DMS lanes show the in vivo methylated residues. Protections (closed arrowheads) and enhancements (open arrowheads) are shown on the right side of each footprint panel and indicated in the sequence by black or gray, respectively, triangles. Potential elements are labeled site P.A and P.B. B, 8226 myeloma and Raji lymphoma cells were analyzed for interactions at the first 275 basepairs of the promoter region. The Sp1 element was confirmed in vitro (see figure 12). 8226 and Raji fooprints used PRD UP primer 1 combined with PRDPI primers 2 and 3. 45

PAGE 62

Figure 12. Sp1 binds the PRDI-BF1 proximal promoter. EMSA assays were done using an oligonucleotide containing the Sp1 consensus sequence and Raji lymphoma cell nuclear extract. Competitor oligonucleotides were added to the binding reaction at 25to 50-fold molar excess. 0.2 g of either Sp1 or ATF-1 antibody were used where indicated. The Sp1 complex is supershifted by addition of Sp1 antibody (lane 3), while addition of non-specific ATF-1 antibody (lane 4) shows no change from the probe only (lane 1). 46

PAGE 63

47

PAGE 64

Figure 13. In vivo genomic footprinting of the PRDI-BF1 promoter region -1528 to -1921 bp distal to the transcription start site reveals numerous protein-DNA interactions in both lymphoma and myeloma cells. A, U266 myeloma and CA46 lymphoma cells were analyzed for in vivo interactions in the region between -1897 to -2072 bp using PRD C primer set. The control lanes show the in vitro methylated guanine residues, while the DMS lanes show the in vivo methylated residues. Protections (closed arrowheads) and enhancements (open arrowheads) are shown on the right side of each footprint panel and indicated in the sequence by black or gray, respectively, triangles. B, U266 myeloma and CA46 lymphoma cells were analyzed for in vivo interactions in the region between -1718 to -1895 bp using PRD H primer set. Site P.H is a novel protection found only in the CA46 cells. C, H929 myeloma and CA46 lymphoma cells were analyzed for in vivo interactions in the region between -1811 to -1966 bp using PRD D set. There are no unique interactions in this specific region. 48

PAGE 65

Figure 14. In vivo genomic footprinting of the PRDI-BF1 promoter -2271 to -2491 bp distal to the transcription start site reveals no protein-DNA interactions in both lymphoma and myeloma cells. A, U266 myeloma and Raji lymphoma cells were analyzed for in vivo interactions in the region between -2273 to -2431 bp. B, U266 and 8226 myeloma and Raji lymphoma cells were analyzed for in vivo interactions in the region between -2381 and -2544 bp. The control lanes show the in vitro methylated guanine residues, while the DMS lanes show the in vivo methylated residues. There are no apparent protections in this region of the promoter in either myeloma or lymphoma cells. This region was analyzed using the PRD 0.4K FWD and PRD 0.4K REV primer sets, respectively. 49

PAGE 66

50 Identification of a functional factor binding site on the PRDI-BF1 promoter Sites P.C, P.F, and P.H, which were occupied in a cell type-specific manner, were mutated within the PRD 1921 and 2618 promoter constructs. Transfection of the mutated constructs into either lymphoma or myeloma cells demonstrates sites P.C and P.F are not required for PRDM1 promoter activity (figure 15). However, mutating the lymphomaspecific factor P.H in both constructs decr eases promoter activity by approximately 50% when transfected into CA46 lymphoma cells. Ther e is a slight effect on promoter activity in U266 myeloma cells, but the decrease in activity of the mutate d constructs when compared to the wild-type constructs is much less dramatic (figure 16). These data correlate with the occupation of site P.H in a lymphoma-specific manner in the footprints. Gel shift assays were done to confirm factor-binding in a specific manner at site P.H. Examination of both CA46 lympho ma and U266 myeloma cells demonstrate specific binding of factor P.H in the lympho ma cells. Site P.H is homologous to an Ets factor binding site. PU.1 is a B cell specific Ets family me mber (172), so we examined its ability to bind P.H in lymphoma and myeloma cells. Addition of antibody against PU.1 competes out binding to P.H in CA46 lymphoma cells (figure 17A), but has no effect on P.H binding in U266 myeloma cells (fi gure 17B), which correl ates with the lack of PU.1 expression in myeloma cells (172). PU.1 is known to bind DNA in a complex with IRF family members on other promoters (58, 61), so we examined numerous IRF family members to determine if they also bound the PRDM1 promoter in CA46 lymphoma cells at site P.H. However, usi ng IRF-4 and IRF-8 antibodies did not shift or cause a disappearance of the P.H binding site indicating that thes e factors do not bind site P.H in CA46 lymphoma cells (figure 18).

PAGE 67

Figure 15. Site-directed mutagenesis demonstrates sites P.C and P.F are not necessary for activity of the PRDI-BF1 promoter in either CA46 lymphoma cells or U266 myeloma cells. A, Mutating the P.C and P.F sites in the PRD 2618 promoter deletion construct had no effect on promoter activity in CA46 lymphoma cells. B, In the U266 myeloma cells, there is also no change in mutant promoter activity when compared to wild type promoter activity. Promoter activity was normalized to Renilla activity and pGL3 basic activity set to 1. The mean of 3 independent experiments is shown with standard deviations. 51

PAGE 68

Figure 16. Site-directed mutagenesis demonstrates site P.H is necessary for activity of the PRDI-BF1 promoter in CA46 lymphoma cells, but not in U266 myeloma cells. A, Mutating the P.H site in both the PRD 1921 and PRD 2618 promoter deletion constructs decreases promoter activity in CA46 lymphoma cells by approximately 50%. B, In the U266 myeloma cells, there is minimal change in mutant promoter activity when compared to wild type promoter activity. Promoter activity was normalized to Renilla activity and pGL3 basic activity set to 1. The mean of 6 independent experiments is shown with standard deviations. 52

PAGE 69

Figure 17. Site P.H is a PU.1 factor binding site in CA46 lymphoma cells, but not U266 myeloma cells. Gel shift assays were done using an oligonucleotide containing the P.H consensus sequence and CA46 or U266 nuclear extract. A, Competitor oligonucleotides were added to the binding reaction at 150to 300-fold molar excess. 1 g IRF-4 antibody and 0.5-4 g PU.1 antibody was used. The P.H complex is shifted by addition of PU.1 antibody, while addition of IRF-4 antibody does not affect the complexes. B, Competitor oligonucleotides were added to the binding reaction at 20to 40-fold molar excess. 0.2 ug IRF-4 antibody, 0.5 ug PU.1 antibody (BD Pharmingen), 0.2 ug PU.1 antibody (Santa Cruz), or 0.2 ug Sp1 antibody were used. There is no factor binding to site P.H in U266 myeloma cells. 53

PAGE 70

Figure 18. Site P.H is not a IRF-4 or IRF-8 factor binding site in CA46 lymphoma cells. Gel shift assays were done using an oligonucleotide containing the P.H consensus sequence and CA46 nuclear extract. Competitor oligonucleotides (specific cold P.H, mutant P.H, and non-specific Sp1) were added to the binding reaction at 25to 50-fold molar excess. 0.2 g IRF-4 antibody and 0.5 g IRF-8 antibody was used. Addition of IRF-4 or IRF-8 antibody does not affect the P.H binding. 54

PAGE 71

55 PU.1 is involved in anti-IgM-mediated tr anscriptional regulation of PRDI-BF1 To determine if PU.1 is involved in the activation of the PRDM1 promoter by B cell receptor cross-linking, CA46 lymphoma cells were transfected with PU.1 siRNA and treated with anti-IgM. Treatment of cells for 24 hours with anti-IgM demonstrated a decrease in anti-IgM-mediated induction of PRDI-BF1 mRNA leve ls (figure 19A). Additionally, treatment of cells for 1 hour with anti-IgM demo nstrated a marked decrease in anti-IgM-mediated PRDI-BF1 nascent RNA induction (figure 19B). PU.1 siRNA specifically targeted PU.1, but not PRDI-BF1, as demonstrated in figure 19C. These data indicate that PU.1 is one of the factors involved in anti-IgM i nduced transcription of PRDM1. The PI3K and MAPK signaling pathways are involved in anti-IgM-mediated induction of PRDI-BF1 in lymphoma cells To investigate th e role of signaling pathways involved in anti-IgM-mediated induction of PRDI-BF1 in CA46 lymphoma cells, preliminary experiments were done utilizing the MAPK inhibito r U0126 and the PI3K inhibitor Wortmannin. Pretreatment of cells with these compounds inhibited anti-IgM-mediat ed induction of PRDI-BF1 mRNA levels (figure 20), in dicating these pathways are involved in the induction of PRDM1. However, further investigation will n eed to be done to el ucidate the role of these pathways in regulating PRDI-BF1.

PAGE 72

Figure 19. PU.1 is involved in anti-IgM-mediated transcriptional regulation of PRDI-BF1. A, CA46 lymphoma cells transfected with either MARK (neg) or PU.1 siRNA were treated with anti-IgM for 24 hours and PRDI-BF1 mRNA levels were detected. B, Cells were also treated for 1 hour with anti-IgM and PRDI-BF1 nascent RNA levels were measured. C, PU.1 mRNA levels are decreased using PU.1 siRNA 48 hours after transfection. Additionally, PU.1 mRNA levels are unaffected by anti-IgM treatment. The data are representative of 2 experiments done in duplicate. 56

PAGE 73

Figure 20. The PI3K and MAPK signaling pathways are involved in the anti-IgM-mediated induction of PRDI-BF1. CA46 lymphoma cells were pretreated with the PI3K inhibitor Wortmannin or the MAPK inhibitor U0126 for 2 hours, followed by treatment with 10 g/ml anti-IgM for 4 hours. Control cells had a 5-fold induction in PRDI-BF1 mRNA levels, while cells undergoing pretreatment with either inhibitor lacked an induction of PRDI-BF1. 57

PAGE 74

58 Discussion The transcription factor PRDI-BF1/Blimp1 is required for the differentiation of a mature B cell to a plasma cell (237). It does this by directly repressing downstream targets, which in turn has a widespread eff ect on further downstream targets (236). These downstream effector cascades ha ve been well studied, however very little is known as to how PRDI-BF1/Blimp-1 expression is regulat ed. Bcl-6 is known to repress PRDI-BF1 by acting through AP-1 elements (271) and IR F-8 is known to activate PRDI-BF1 in murine myeloid progenitor cells (252). This study demonstrates a direct link between B cell receptor cross-linking by anti-IgM and transcriptional activation of PRDI-BF1/Blimp-1. Treatment of CA46 lymphoma cells with anti-IgM significantly induced PRDM1 mRNA levels, caused apoptosis, and increased activity of the PRDM1 promoter. Because there was no change in mRNA stability with anti-IgM treatment, while actively transcribing nascent RNA levels were rapidly induced, th is indicated regulation occurs primarily at the level of transcription. Nascent RNA levels are very low in CA46 lymphoma cells, but in myeloma cells they are significantly higher. While nascent RNA levels can be rapidly induced upon BCR cross-linking to levels signifi cantly higher than that of control cells, luciferase activity is only nominally induced by BCR cross-linking. This could be due to the IgM response element on the PRDM1 prom oter being located more than 2618 bp distal to the transcription start site, whic h is the PRDM1 promoter construct tested. Rapid induction of nascent RNA levels by B cell receptor cross-linking and the evidence of a promoter with many protein-DNA interactions detected by in vivo genomic

PAGE 75

59 footprinting indicate the PRDM1 promoter is occupied and primed for transcription in lymphoma cells, even though PRDI-BF1 ge ne expression is not detectable. This is comparable to the situation in T cells, which also do not express PRDM1 However, it has recently been sh own that activating CD4+ T cells in vitro will elevate PRDM1 levels equivalent to that of splenic B ce lls treated with LPS (111). Our findings in lymphoma cells are also important in lig ht of recent evidence which demonstrates the presence of PRDI-BF1 gene expression in DLBCL (32, 195, 251). Mutations of PRDM1 were found in 23% of DLBCL patient sample s examined (251). Another group further characterized their DLBCL pa tient population and determined only the activated B celllike DLBCL samples were positive (24%) for mutated PRDM1 expression (195). Alterations in PRDM1 included frameshift mutations point mutations, chromosomal inversions and, most importantly, all led to PRDM1 gene inactivation (195, 251). Mutations in DLBCL suggest a potential ro le for PRDI-BF1 as a tumor suppressor, consistent with its differentiation and apoptosis promoting effects. Our work is the first to directly link th e expression of PRD I-BF1/Blimp-1 to antiIgM mediated B cell receptor activation. It has long been known that anti-IgM induces apoptosis in lymphoma cells (12, 30, 87, 112, 299) and has been correlated with decreased levels of c-myc e xpression (112), a dire ct target of PRDI -BF1 (140). The BCL1 murine B cell model was used to demo nstrate phenotypic di fferences resulting from the introduction of Blimp-1 into partia lly activated mature 5B1b and activated 3B3 cells, a cell line derived from the 5B1b line. Blimp-1 is able to induce apoptosis in the mature 5B1b cell line (164), as well as numerous other B cell lines in the early stages of development (119, 164). However, in the ac tivated 3B3 cells, ectopic expression of

PAGE 76

60 Blimp-1 induces differentiation (164). Our study directly correlati ng apoptosis with increased PRDM1 mRNA expression is importa nt because it may be possible to induce apoptosis in PRDM1-negative lymphoma cells by inducing PRDI-BF1 expression levels. Furthermore, PRDI-BF1 has been shown to be an important target in immunotherapy of myeloma by induction of PRDI-BF1-specific CTLs (150). Regions of PRDM1 promoter activation are locali zed to two distal regions in U266 myeloma cells and one distal region in CA46 lymphoma cells. In vivo genomic footprinting of the regions of activation in both lymphoma and myeloma cells yielded multiple protein-DNA interactions. One of thes e was site P.J, which is the AP-1 factor binding site shown to be important for Bc l-6-mediated repression of the PRDI-BF1 promoter by Vasanwala et al (271). Our in vivo footprinting data show site P.J is occupied in both CA46 lympho ma and U266 myeloma cells. Another study in the murine system suggested c-Fos acting through distinct elements is a key tran scription factor for Blimp-1 expression in activated B cells, regardless of Bcl-6/AP-1 element interactions (185). Our findings of factor binding at site P.J in bot h lymphoma and myeloma cells support a BCL-6 independent role for c-fos/AP 1 at site P.J, as myeloma cells do not express Bcl-6 (272). The dist al region of activation spec ific for only myeloma cells demonstrated no protein-DNA interactions, indicating factors may be bound to this region but are undetectable using DMS in vivo footprinting which recognizes methylated guanine residues. Several cell-type specific interactions, na mely P.C, P.F, and P.H, were observed by in vivo footprinting. Basal and anti-IgM stimulated PRDM1 promoter activity was significantly inhibited by mutati ng the P.H site in lymphoma cells. This indicates P.H,

PAGE 77

61 which shares homology with Ets family member binding sites, is an important functional site for PRDM1 promoter regulation. PU.1 is an Et s family member found only in B cells (172) and is bound to P.H, as demonstrated by electrophoretic mobility gel shift assay. PU.1 antibody supershifted the P.H complex. Ets and IRF family members have been reported to complex with one another and bi nd promoters (58, 61). In addition, the transcription factor IRF-8/ICSBP ha s been shown to directly induce Blimp-1 expression in myeloid cells (252). However, we did not detect specific binding of IRFs at the P.H site in CA46 lymphoma cells. This suggests that either other undetected IRF elements exist or the activity of IRF-8 on PRDM1 is specific for myeloid cells. This study further demonstrated a role for PU.1 in anti-IgM-mediated induction of PRDM1 in lymphoma cells, as introduction of PU.1-specific siRNA in lymphoma cells diminished the antiIgM-mediated induction of PRDI-B F1 mRNA expression. However, PRDM1 expression was only reduced approximately 50%, indicating PU.1 is not the sole factor responsible for anti-IgM-mediated induction of gene expression. Preliminary data using inhibitors to the MAPK and PI3K signaling pathways i ndicate these pathways are involved in inducing PRDI-BF1 in CA46 lymphoma cells However, further experiments are required to elucidate additional factors res ponsible for inducing PRDI-BF1 in lymphoma cells using anti-IgM. In conclusion, we have demonstrated PRDM1 regulation occurs primarily at the transcriptional level in lymphoma and myelom a cells. We have also demonstrated the involvement of PU.1 in basal and anti-IgM i nduced activation of th e PRDM1 promoter in lymphoma cells. Importantly, we report th at the promoter is poised and ready for activation in lymphoma cells, suggesting that inducing PRDI-BF1 expression in

PAGE 78

62 lymphoma cells lacking PRDM1 gene mutations is a viable therapeutic approach to inducing apoptosis in these cells.

PAGE 79

63 Materials and Methods Cell lines and drugs The RPMI-8226, U266, and NCI-H929 multiple myeloma and CA46, Raji, and BJAB Burkitts lymphoma cell lines were maintained in RPMI medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (HyClone), and 1% penicillin/streptomycin (P/S) (Invitrogen). The NCI-H929 cell line was also supplemented with 0.05 M -mercaptoethanol (Sigma, St. L ouis, MO). Bone marrow cells derived from myeloma patients were obtained from the H. Lee Moffitt Cancer Center Tissue Bank under Institutional Re view Board approval. Normal adult bone marrow samples were obtained from the H. Lee Moffitt Cancer Center Tissue Bank and Stratagene. Goat anti-human IgM antibody (Southern Biotechnology) was used at 10 g/ml. Actinomycin D (Sigma) was used at 10 g/ml to determine mRNA stability. Trypan blue exclusion was used to determine total live cell counts. Apoptosis assay Cells were treated with anti-IgM con tinuously for 24 hours, followed by Annexin V-PE and 7-AAD staining per manufacturers protocol (BD Pharmingen). Flow cytometry acquisition was done on a FACSCalibur and analyzed with CellQuest software (Becton Dickinson, Carpinteria, CA).

PAGE 80

64 Real-time PCR RNA was isolated from cells using TriZol reagent (I nvitrogen) and the manufacturers protocol. One g RNA was DNase-treated using RQ1 DNase (Promega), followed by first-strand cDNA synt hesis using the iScript cDNA synthesis kit (Bio-Rad). 1/20 th of the final cDNA reaction volume was used in each PCR reaction. Primers sequences are as follows: PRDI-BF1 FWD, 5TACATACCAAAGGGCACACG -3, PRDI-BF1 REV, 5TGAAGCTCCCCTCTGGAATA -3, PU.1 FWD, 5AGCAGATGCACGTCCTCGATA -3, PU.1 REV, 5AGACCTGGTGGCCAAGACTG -3, GAPDH FWD, 5GAAGGTGAAGGTCGGAGT -3, and GAPDH REV, 5GAAGATGGTGATGGGATTTC -3. Primer sets were run using an annealing temperature of 60 o C. Real-time PCR reactions were performed in a volume of 25 l, which included 200 nM of each forward an d reverse primer and iQ SYBR Green Supermix (Bio-Rad). Reactions were run in duplicate using an iCycler and iQ software Version 1.0 (Bio-Rad). Average threshold cycl es (Ct) for the genes of interest were normalized to the average GAPDH Ct values for each cDNA sample and relative levels of the genes of interest were calculated by the Ct method (145): for example, 2 -(PRDIBF1-GAPDH) for PRDI-BF1 gene expression. Isolation of nascent RNA Nascent RNA was isolated as previously described (121, 283). Briefly, nuclei from lymphoma and myeloma cells was isolat ed in a RNase-free buffer comprised of 140 mM NaCl, 1.5 mM MgCl 2 0.5% NP-40, 1000 U/ml RNase OUT (Invitrogen), 1 mM

PAGE 81

65 DTT, and 50 mM Tris, pH 8. Extracted nuclei were washed in this buffer three times to remove cytoplasmic RNA, followed by lysis in a RNase-free bu ffer containing 300 mM NaCl, 1 M urea, 1% NP-40, 7.5 mM MgCl 2 0.5 mM EDTA, 1 mM DTT, and 20 mM HEPES, pH 7.6 to isolate histone-bound chromatin. RNA isolation was done as described above. Nascent RNA levels were measured by real-time PCR. DNA constructs PRD 2618, originally re ferred to as PRDM1 was cloned as previously described (80). Using PRD 2618 as a cloning template, PRD 521 was sub-cloned using a NheI/SmaI digest to remove the 521 bp fragment, blunt-ended, a nd cloned into pGL3 basic. PRD 1648 was cloned by digesting PRD 2618 with BglII to yield a 1648 bp fragment, which was then ligated into pGL3 basic. PR D 1921 was cloned by digesting PRD 2618 with Kpn/PacI to remove 703 bp. PRD 2391 was derive d from PRD 2618 by digestion with HindIII to remove 2391 bp an d cloned into pGL3 basic. PRD 983 and PRD 2041 were PCR-cloned. Site-directed mutagenesis was done by PCR cloning the mutated sequence into the PRD 1921 or PRD 2618 constructs. Briefly, mutations were introd uced into either construct using a common PRD 2618 forward or reverse primer, paired with either a reverse or forward primer, re spectively, containing the site mutation. Primer sets used are as follows, with the mutated bases indi cated in lower case letters: PRD 2618 FWD, 5TTCCTATTATGGAGCAAGCTTCC -3, PRD 2618 REV, 5CATTTCTCCTTCGACCTGCA -3, P.C mut FWD, 5CCTTAAAGTTCTA tttaaagCCTTGTCCAGCTC -3, P.C mut REV, 5

PAGE 82

66 GAGCTGGACAAGGctttaaaTAGAACTTTAAGG -3, P.F/G mut FWD, 5GTTTGCGTCCT aaagctagc CAAGCCCATTTCAC -3, P.F/G mut REV, 5GTGAAATGGGCTTG gctagcttt AGGACGCAAAC -3, H3 mut FWD, 5 ATTCTAAAAGGaA c GT t AAATACTCTTTAAC 3, and H3 mut REV, 5 GTTAAAGAGTATTTa ACgT t CCTTTTAGAAT 3. PCR products were gel-purified and paired with their resp ective mutation partner and am plified using PRD 2618 common primers. PRD 1921 mut P.H was derived from the PRD 2618 mut P.H construct by digesting with KpnI/PacI, removing a 703 bp fr agment, and re-ligating the vector. All mutations were confirmed by sequencing. Luciferase assays Cells were transfected by electroporati on using the Gene Pulser II (Bio-Rad, Hercules, CA). Cells (1 x 10 7 ) were pulsed with 250 V at a capacitance of 1070 F. Transfections were done with 10 g of luci ferase reporter construct and 50 ng of the internal control plasmid pRL-TK. Cells we re placed in complete medium for 42-48 hours and harvested for luciferase activity per the Dual-Luciferase Reporter Assay System protocol (Promega). Lucifera se readings were done using the 20/20 n luminometer (Turner Biosystems). Firefly lu ciferase activity was normalized to Renilla luciferase activity in all experiments. Dimethyl sulfate in vivo footprinting In vivo methylation of cells with dimethylsu lfate (DMS) and subsequent isolation of DNA was done as previously described (75, 199). Cells were in vivo -treated with 1

PAGE 83

67 l/ml DMS and methylation of guanine residue s was ensured by occasional swirling for 5 minutes at 37 o C. The reaction was stopped by adding ice-cold PBS plus 60 mM Tris, pH 7.5, and washing twice. Cells were lysed in lysis buffer (100 mM EDTA, 60 mM Tris, pH 7.5, 0.1% SDS, 500 g/ml Proteinase K (Roche)) for 4 hours at room temperature. Samples were stored at 4 o C or genomic DNA was extracted immediately. To extract genomic DNA, samples were brought to room temperature to bring the SDS back into solution. DNA was extracted using phenol (Roche)/chloroform:isoamyl alcohol (24:1) and washed twice with ch loroform:isoamyl alcohol (24:1). DNA was precipitated by adding 1/10 volume 3 M NaAc (pH 7) and 2.5 volumes 95% ethanol, followed by spooling with a hooked Pasteur pipet to remove the DNA. DNA was resuspended in 3-5 ml Tris:EDTA (10 mM: 0.1 mM). Genomic DNA was digested with either 100 units HindIII or PstI (NEB) and extracted as above. Control samples were treated with 1 l DMS for 20 seconds. The reaction was stopped by adding DMS stop buffe r (1.5 M NaAc, pH 7, 1 M -mercaptoethanol, 100 g/ml tRNA (Ambion)). DNA wa s precipitated by adding -20 o C 95% ethanol and snapfreezing in a dry-ice/ethanol ba th for 10 minutes, washed twice with cold 75% ethanol, and dried by Speed-Vac. DNA was cleav ed at guanine residues by adding 200 l piperdine (diluted 1:10 in ice-cold H 2 O) and incubating at 90 o C for 30 minutes. DNA was precipitated and lyophilized to dryness in a Speed-Vac. DNA was washed twice with H 2 O, lyophilized to dryness, and resuspended in 50 l H 2 O.

PAGE 84

68 Ligation-mediated PCR (LM-PCR) Primers for the ligation-mediated PCR, LM-PCR, are shown in Table 1 with Tms used in each reaction. Full-length primers were purified using denaturing polyacrylamide gel electrophoresis. Briefly, primers were in cubated with an equal volume formamide at 55 o C for 5 minutes. Products were separated using a pre-run 16% polyacrylamide gel (7 M urea, 20:1 acrylamide/bisacrylamide, 1x TBE) run at 1500 V for 1 hour. UV shadowing was used to distinguish between full-length primers and prematurely terminated products. Primers were extracted from the gel using an EluTrap (Schleicher and Schuell) and passed over a Sep-Pack colu mn (Waters) using a 10 ml syringe and slow flow rate. The column was equilib rated by adding 10 ml 100% acetonitrile and 20 ml water. The extracted primer was added in 1.5 ml volume water and eluted using 10 ml fresh 25 mM ammonium bicarbonate (ABi ), 10 ml ABi/5% acetonitrile, 20 ml water/5% acetonitrile, and 4 ml water/30% acetonitrile. Primers were dried in a SpeedVac and resuspended in water. LM-PCR was performed as previously reported (169, 282). Approximately 7.5 g DMS-treated genomic DNA was annealed to 0.3 pmol primer 1 by first denaturing for 4 minutes at 95 o C and then annealing for 30 minutes at the Tm reported in Table 2 in a 15 l solution containing 1x Mg-free Sequenase buffer (40 mM Tris, pH 7.7 and 50 mM NaCl). Primer extension was performed by adding 7.5 l Mg/DTT/dNTP solution ((20 mM MgCl 2 20 mM DTT, 0.2 mM each dNTP (USB)) and 1.5 l diluted Sequenase 2.0 (USB) (diluted 1:4 in ice-cold TE) and incubating for 10 minutes at 47 o C, 5 minutes at 60 o C, and holding at 22 o C. The Sequenase extension reaction was stopped by adding 6 l 310 mM Tris, pH 7.7 and incubating at 67 o C for 10 minutes. Ligation of the

PAGE 85

69 hybridized linker (hybridized long linker and sh ort linker primers) to the above reaction product was done by adding 20 l dilution solution (17.5 mM MgCl 2 42.3 mM DTT, 125 g/ml BSA) and 25 l ligation mix (10 mM MgCl 2 20 mM DTT, 50 g/ml BSA, 50 mM Tris, pH 7.7, 3 mM rATP (P romega), 100 pmol hybridized linker per reaction, 400 U T4 DNA ligase (NEB)) and ligating overnight at 16 o C. The ligation products were precipitated with 1/10 volume 3 M NaAc, pH 7, 10 g tRNA (Ambion), and 95% ethanol, air-dried, resuspended in 70 l water, and 30 l PCR mix (40 mM NaCl, 10 mM Tris, pH 8.9, 5 mM MgCl 2 0.01% (w/v) gelatin, 20 nmol dNTPs, 10 pmol primer 2, 10 pmol long linker primer, 5 U Ampli-Taq (A pplied Biosystems)) was added. The PCR reaction was heat denatured at 97 o C for 3.5 minutes, primer 2 a nnealed at the appropriate Tm (see Table 1), and extended at 76 o C for 3 minutes. PCR pr oducts were amplified with 16 cycles of heat dena turation for 1 minute at 97 o C, annealing of primer 2 at the appropriate Tm, and extension at 76 o C for 3 minutes, 5 seconds, with an additional extension of 5 seconds each cycle. One final cycle of PCR was performed by heat denaturation for 1 minute at 97 o C, primer 2 annealing for 2 minutes at appropriate Tm, and final extension for 10 minutes at 76 o C. PCR products were purified by phenol/chloroform extraction and ethanol precipitation and resuspended in 15 l loading dye (80% formamide, 0.5x TBE, bromophenol blue, xylene cyanol). PCR products (10 l) were size-fractionated using a pre-r un 6% polyacrylamide wedge sequencing gel made with 7.75 M urea, 20:1 ac rylamide/bisacrylamide (Bio-R ad), and 1x TBE. The gel was dried and products were vi sualized by autoradiography. Primer 3 was radioactively labeled in a kinase reaction mix containing 20 pmol primer, kinase buffer (NEB), 150 Ci 32 P-ATP (Amersham), and 10 U polynucleotide

PAGE 86

70 kinase (NEB). Primer labeling occu rred by incubating for 45 minutes at 37 o C, followed by heat inactivation of the enzyme for 10 minutes at 68 o C. Unincorporated ATP was removed by using the Qiagen nucleotide remova l kit and eluting labeled primer with 200 l H 2 O (pH 7.7). The PCR product was radioac tively labeled by annealing 20 pmol primer 3 in a reaction mix containing 40 mM NaCl, 10 mM Tris, pH 8.9, 5 mM MgCl 2 0.01% (w/v) gelatin, 20 pmol dNTPs, and 5 U Ampli-Taq and annealing by cycling twice through 3.5 minutes of heat denaturation at 97 o C, annealing at appropriate primer 3 Tm for 2 minutes, and extending at 76 o C for 10 minutes. Nuclear extract preparation and elect rophoretic mobility shift assays Nuclear extracts were prepared according to Dignam et al (53). To summarize, a minimum of 3 x 10 8 cells were pelleted and the pellet cell volume (PCV) was estimated. Cells were resuspended in 5x PCV buffe r A (10 mM Hepes, pH 7.9, 1.5 mM MgCl 2 10 mM KCl, 0.5 mM DTT, and 0.5 mM PMSF) and swelled in this hypotonic buffer for 10 minutes on ice. Cells were resuspended in 2x original PC V buffer A and dounced with B pestle of the Dounce homogenizer until 95% of the cells were lysed. The nuclei were isolated by a quick centrifugation at 30000 x g in a Beckman JA25.50 rotor. The nuclear pellet was resuspended in 1 ml buffer C (modified) (20 mM Hepes, pH 7.9, 20% glycerol, 1.5 mM MgCl 2 0.2 mM EDTA, pH 8.0, 0.42 M KCl, 0.5 mM DTT, and 0.5 mM PMSF)/1 x 10 9 cells. Nuclei were extracted by agitating on a nutator for 20 minutes at 4 o C, centrifuging for 30 minutes at 25000 x g in a 4 o C Beckman JA25.50 rotor, and resuspending in dialysis buffer D (20 mM Hepes, pH 7.9, 20% v/v glycerol, 0.2 mM EDTA, pH 8.0, 0.5 mM DTT, and 0.5 mM PMSF).

PAGE 87

71 The Sp1 oligonucleo tide sequence is 5GATCTGGCCACGCCCCCACTTCGCG C -3. The Sp1 mutant oligonucleotide sequence is 5GATCTGGCCAC aaaaaCACTTCGCGC -3. The P.H oligonucleotide sequence is 5GATCCAGAGTTTGATTCTAAA AGGGAAGTGAAATACTCTTTAAC -3. The mutant P.H oligonucleotide contains the sa me mutation as in construct PRD 2618 mut H3. The AP2 oligonucleotide sequence is 5GATCAAGCCCTGGGCTCGGCCAG 3. Gel shift probes were e nd-labeled using T4 polynucleo tide kinase (NEB). Five picomoles of radioactive probe were end-labeled with 32 P-ATP and purified using mini Quick Spin DNA columns (Roche). 50 pi comoles of cold competitor probe was synthesized using the same conditions as above. For each EMSA reaction, 4 l of nuclear extract were combined with 0.5 mM DTT, 1 g poly (dI:dC), and either antibody (0.2-4 g) or 20-300-fold molar excess cold competitor oligonucleotides. Antibody incubations occurred on ice for 1-2 hours, followed by labeling with 100000 counts of probe for 0.5 hours. Gels were run cold for 1.5 hours and DNA binding was observed by au toradiography. PU.1 antibodies were obtained from BD Pharmingen and Santa Cr uz, while IRF-1, IRF-2, IRF-4, ATF-1, and Sp1 antibodies were from Santa Cruz. Transfections with siRNA CA46 lymphoma cells were transfected with 3 g MARK or PU.1 siRNA (Dharmacon) by electroporating 1 x 10 7 cells in 0.3 ml serum-free RPMI medium. Live cells were isolated using a Fi coll gradient and washed in complete medium. Cells were

PAGE 88

72 treated for either 1 hour or 24 hours with 10 g/ml anti-IgM. Following 1 hour incubation, cells were harvested for nascent RNA as previously described. Following 24 hour incubation, cells were harvested fo r mRNA, as previously described.

PAGE 89

73 Table 1. Primers used for LM-PCR. Primers used to detect promoter region of interest, sequence of primers, and Tm for each LM-PCR reaction are listed. Primer name Sequence Tm Short linker 5GAATTCAGATC -3 64 Long linker 5GCGGTGACCCGGGAGATCTGAATTC -3 64 PRDI primer 2 5GGAGCT GCCTCAAACCGATTAACCCAC -3 66 PRDI primer 3 5GCTGCCTCA AACCGATTAACCCACCACAGA -3 68 PRDLOW primer 1 5TAAGCAGGGAGGGGAAGC -3 62 PRDLOW primer 2 5AGTGTTGCGGAGAGGCAAGAGCAG -3 65 PRDLOW primer 3 5TTGCGGAGAGGCAAGAGCAGCGACCG -3 69 PRDUP primer 1 5 ACCCAGTCCACATTCTC -3 57 PRDUP primer 2 5AGGCTGAGCCGCACAGACGCGCAC -3 70 PRDUP primer 3 5ACAGAC GCGCACCTCGGCGGTCCCTC -3 72 PRDLOW2 primer 1 5GTACCTGGGGATTTGAGC -3 60 PRDLOW2 primer 2 5AGG AACGTGCGCCCCCTAATTCTGCCGC -3 70 PRDLOW2 primer 3 5CGTG CGCCCCCTAATTCTGCCGCGCCAG -3 73 PRDUP2 primer 1 5GCTTTCCCCCAGATTGC -3 60 PRDUP2 primer 2 5AGCAC AGCCGCCGAGAGCTTCCTC -3 68 PRDUP2 primer 3 5GCCGCCGAGAGCTTCCTCTCTTCGCATG -3 70 PRD 0.4K FWD primer 1 5 CTGAGGTTCTTTTCGGTG -3 58 PRD 0.4K FWD primer 2 5CCAGACAGTGGCAGCCTCTGATAGC -3 65 PRD 0.4K FWD primer 3 5GTGGCAGCCTCTGATAGCTCTCTCTGCAC -3 68 PRD 0.4K REV primer 1 5ATTTAGGTATTGTCCAGCAC -3 56 PRD 0.4K REV primer 2 5CCATTAAGGGGGAATAAAAGGGACTGACC -3 62 PRD 0.4K REV primer 3 5CCATTAAGGGGGAATAAAAGGGACTGACCTCTG -3 66

PAGE 90

74 Table 1 (continued from previous page) PRD A1 5CCACGGGAATAGATGAG -3 57 PRD A2 5CTGAGAACAGAACTATTTGGCTCATTCAT -3 64 PRD A3 5CTATTTGGCTCATT CATGATTTGCTGCCATTG -3 68 PRD B1 5AGCCTCT GATAGCTCTC -3 57 PRD B2 5CTCTGGGAGGACCGAGTGAAGTTC -3 68 PRD B3 5GGAGGACCGAGTGAAGTTCAGAGGTCAG -3 72 PRD C1 5CAAGAAGCAAACATGTGAAG -3 57 PRD C2 5GCAAACATGTGAAGGACTTTACATTCCAAC -3 68 PRD C3 5GAAGGACTTTACATTCCAACACTCTGTGTCTG -3 72 PRD D1 5GCTGGGACACCTGGAAC -3 57 PRD D2 5CACTGGTATTTGAAGTTTGCGTCCTC -3 67 PRD D3 5ATTTGAAGTTTGC GTCCTCCCTAGACTCAAGC -3 71 PRD E1 5GCCTATTCCCTTACTCTATC -3 57 PRD E2 5GTTGACTCACCAGCAGTTGCATGATG -3 64 PRD E3 5CAGCAGTTGCATGATGGTGTATGTGGC -3 68 PRD F1 5TTCTGTCCATTGTGGTGC -3 57 PRD F2 5GACTCAGCATCAGTTAATAAACCCTC -3 67 PRD F3 5GCATCAGTTAATAAACCCTCTTGAGCAG -3 71 PRD G1 5GATTAGCACACACTCGC -3 57 PRD G2 5CCACCTGTGATTGCATGTTATGCCAGAG -3 67 PRD G3 5TGCATGTTATGCCAGAGGGGACGCTAGCAC -3 71 PRD H1 5GAGTCAGCACCACAATG -3 57 PRD H2 5CAATGTAGTCATACTGAAGGCTGGC -3 67 PRD H3 5TCATACTGAAGGCTGGCCTGCTGTTC -3 71

PAGE 91

75 Chapter Three Modulation of PRDM1 gene expression in lymphoma cells Introduction Lymphomas encompass a group of cancers localized to the lymphoid system. The most frequent type of lymphomas are the B cell lymphomas (BCL) (219), a group to which both mantle cell lymphoma and Burk itts lymphoma belong. Mantle cell lymphoma (MCL) is an aggressive form of non-Hodgkins lymphoma (NHL), accounting for approximately 5-8% of NHL cases. Ev en though there are a variety of treatment regimens available to patients, it remains an incurable disease (279). MCL is a distinct biologic subtype of NHL, demonstrated by high levels of cyclin D1 expression, which is caused by the t(11;14) (q13;q32) chromosomal translocation. However, experiments using transgenic mice have demonstrated that this alone is not sufficient to cause MCL (151). Another form of NHL is Burkitts ly mphoma (BL), which has a very aggressive pathology and presents c linically as three different subt ypes. The endemic form of BL occurs at a 50-fold higher rate in equatori al Africa than in the United States. The immunodeficiency subtype is found in patients with human immunodeficiency virus (HIV), while sporadic BL accounts for 1-2% of all adult lym phomas in the United States and Western Europe (19). BL is characte rized by overexpression of c-myc (136), often

PAGE 92

76 caused by a t(8;14) transloca tion (73, 90, 177) or ge netic alterations in the c-myc gene (92). While Burkitts lymphoma adolescent pa tients have cure ra tes of 70%, older patients typically have a poorer response ra te and many are unable to finish their treatment regimens due to cytotoxic side e ffects (63). In the case of mantle cell lymphoma (MCL), many patients become refr actory to treatment and their prognosis is poor (132). Much excitement has been gene rated by newer chemotherapeutic drugs, such as the proteasome inhibitor Bortezomib, which has been fa st-tracked for approval in MCL by the FDA based on phase 2 trial data (182) In pre-clinical studies, Bortezomib was shown to induce apoptosis in both man tle cell lines and patient samples (196). Histone deactylase (HDAC) inhibitors are al so effective drugs in lymphoma. The new HDAC inhibitor LBH589 has potent antitumor activity in myeloma cells (155), while sodium butyrate and SAHA have been sh own to induce apoptosis in mantle cell lymphoma cells (91). HDAC inhibitors were shown to induce Blimp-1 gene expression in L10A murine lymphoma cells and i nduce differentiation, as shown by increased expression of the plasma cell surface marker Syndecan-1 (129). However, targets of Bortezomib and HDAC inhibitors have not been fully elucidated to date. Modulating PRDM1 expression in ly mphoma cells may have therapeutic potential, as the promoter of lymphoma cells is poised for activation, as demonstrated by experiments using the B cel l cross-linker anti-IgM (s ee Chapter Two). The PRDM1 gene has recently been shown to be expressed in one form of lymphoma, namely DLBCL. However, inactivating mutations of PRDM1 were described in DLBCL, implicating this gene as a potential tumor suppressor in lymphoma (69, 195, 251). In this study, the

PAGE 93

77 activity of the proteasome inhibitor Bortezo mib and the HDAC inhibitors Trichostatin A and LBH589 were assessed in CA46 Burkitts lymphoma and Mino mantle cell lymphoma cell lines. These chemotherapeutic agents induce PRDM1 gene expression in both cell lines and patient samples, indicati ng these could drugs could have therapeutic potential in these aggressive forms of leukemia. Results Treatment with HDAC inhibitors or Bortezomib induce PRDM1 levels in lymphoma cell lines and mantle cell patient samples Most B cells lack detectable levels of PRDM1 until they commit to differentiate (5, 24, 32, 69). As shown in figure 7, lymphom a cell lines lack dete ctable levels of PRDM1 These data correlate with low levels of nascent RNA purified from nuclei of these cells. Levels of nascent RNA are an indicator of endogeno us transcriptional activity in a cell (283). When compared to U266 myeloma cells which express abundant levels of PRDI-BF1 nascent RNA, both CA 46 and Mino cells have significantly lower levels of nascent RNA production (figure 21).

PAGE 94

Figure 21. Levels of nascent RNA in myeloma cells are elevated when compared to lymphoma cells. Relative levels of nascent RNA were determined by real-time RT-PCR for both CA46 and Mino lymphoma and U266 myeloma cells. Levels in U266 myeloma cells are significantly higher than that of CA46 and Mino lymphoma cells (p<0.005, Students t-test). 78

PAGE 95

HDAC inhibitors have been shown to induce Blimp-1 mRNA expression in murine lymphoma cells (129) as well as inducing apoptosis (91, 218). Trichostatin A treatment of CA46 cells induced PRDM1 expression in CA46 BL cells (figure 22). Because it has been recently established PRDM1 expression is regulated primarily at the level of transcription (see Chapter Two), cells were treated with Trichostatin A and analyzed for protein-DNA interactions at the proximal promoter by in vivo DMS footprinting. However, analysis of one region of the promoter revealed no protein-DNA interactions (figure 23). The clinically relevant HDAC inhibitor, LBH589, is able to induce PRDM1 expression in the Mino mantle cell lymphoma line, with a concomitant induction of apoptosis (figure 24). However, when a patient sample was treated with the HDAC inhibitor SAHA, PRDM1 expression decreased at both 6 and 20 hours of treatment (figure 25). Figure 22. Treatment with the HDAC inhibitor Trichostatin A induces PRDI-BF1 mRNA levels in CA46 lymphoma cells. Treatment of CA46 lymphoma cells for 24 hours with 100 ng/ml Trichostatin A significantly induces PRDI-BF1 mRNA levels. The mean of 7 experiments is shown (p<0.0005, Students t-test). 79

PAGE 96

Figure 23. In vivo genomic footprinting of the PRDI-BF1 proximal promoter reveals no protein-DNA interactions in lymphoma cells treated with Trichostatin A. CA46 lymphoma cells were analyzed for interactions at the first 200 basepairs of the promoter region. The control lanes show the in vitro methylated guanine residues, while the DMS lanes (Control and TSA) show the in vivo methylated residues. No interactions are induced by Trichostatin A treatment at this specific region of the proximal promoter. 80

PAGE 97

Figure 24. Activity of the HDAC inhibitor LBH589 in Mino mantle cell lymphoma cells. LBH589 induces PRDM1 gene expression and induces apoptosis in Mino mantle cell lymphoma cells following 24 hours of treatment. Figure 25. Treatment with the HDAC inhibitor SAHA decreases PRDI-BF1 mRNA levels in freshly isolated cells from a mantle cell lymphoma patient. Treatment of patient cells for 6-20 hours with increasing doses of SAHA decreased PRDI-BF1 mRNA levels. 81

PAGE 98

Figure 26. Treatment with the proteasome inhibitor Bortezomib induces PRDI-BF1 mRNA levels in CA46 lymphoma cells. Treatment of CA46 lymphoma cells for 24 hours with increasing doses of Bortezomib induces PRDI-BF1 mRNA levels. The mean of 3 experiments is shown with standard deviations. Figure 27. Treatment with the proteasome inhibitor Bortezomib induces PRDI-BF1 mRNA levels and induces apoptosis in Mino mantle cell lymphoma cells. Treatment of Mino mantle cell lymphoma cells for 24 hours with increasing doses of Bortezomib induces PRDI-BF1 mRNA levels and apoptosis, as measured by Annexin V staining. The data shown are representative of 3 independent experiments. 82

PAGE 99

Figure 28. Treatment with the proteasome inhibitor Bortezomib induces PRDI-BF1 mRNA levels in freshly isolated cells from a mantle cell lymphoma patient. Treatment of patient cells for 6-20 hours with increasing doses of Bortezomib induced PRDI-BF1 mRNA levels. A, This patient sample was comprised of approximately 90% mantle cell lymphoma cells. B, Total mantle cell lymphoma cells unknown for this patient sample. 83

PAGE 100

84 The proteasome inhibitor Bortezomib induced PRDM1 mRNA levels in a dosedependent manner in both the Mino and CA46 lymphoma cell lines. Induction of PRDIBF1 mRNA levels correlates with an increase in apoptosis of these cells (figures 26 and 27). Fresh patient samples from lymphoma patients were treated for 6-20 hours with this drug and some induction was seen at lower doses A high dose of 50 nM in one patient demonstrated a decrease in PRDM1 expression, compared to the 25 nM dose (figure 28). This could be due to apoptosis and cell deat h caused by higher drug dos es. However, this was not examined. Human B cells differentiated to plasma blasts have increased PRDM1 mRNA levels Using lymphoma and myeloma cell lines with differing levels of PRDM1 gene expression is one method to study the regula tion of PRDM1 gene expression. Another way is to utilize normal B cells capable of differentiation. However, even though this procedure has been previously described (253), it was necessary to work out the proper conditions in our lab and dete rmine if PRDM1 levels incr eased upon differentiation. Using peripheral blood from normal human donor s, we were able to differentiate the purified B cells to plasmablasts e xpressing increased levels of PRDM1 and PRDM1 and reduced levels of PRDI-BF1 downstream targets CIITA promoter 3 and BSAP (figure 29). On day 6 of cultu re, the cell yield was decreased compared to what had been previously described (253). The availability of low numbers of plasmablasts at day 6 has limited the ability to do experiments beyond mRNA analysis at this stage. This problem is currently being addressed in the lab.

PAGE 101

Figure 29. Purified B cells differentiated to plasmablasts have increased levels of PRDI-BF1 mRNA expression. Activated B cells (day 4 of culture) have increased levels of CIITA promoter III and BSAP mRNA expression, while PRDI-BF1 and PRDI-BF1 mRNA levels are not expressed. However, upon differentiation to a plasmablast (day 6 of culture), PRDI-BF1 and PRDI-BF1 mRNA expression are increased, while the PRDI-BF1 downstream targets BSAP and CIITA promoter III are decreased. 85

PAGE 102

86 Discussion The transcription factor PRDI-BF1/Blimp1 is required for the differentiation of a B cell to a plasma cell (237) and accomplishe s this by directly re pressing a number of downstream targets (236). Work from our la b has demonstrated a rapid induction of PRDI-BF1/Blimp-1 mRNA in lymphoma cells as measured by nascent RNA levels in anti-IgM-stimulated cells as well as factor binding to the promoter as seen by in vivo DMS footprinting. These data indicate the prom oter is poised and ready for activation in these cells (see Chapter Two). Very recent evidence demonstrates expression of PRDIBF1/Blimp-1 mRNA in a DLBCL cells (32, 195, 251). However, PRDM1 gene mutations were found in approximately one quarter of all DLBCL patients studied and led to transcription of a nonfunctional protein (251). The work presented in this chapter demonstrates a correlation between PRDM1 induction and apoptosis in both BL and MCL cell lines and patient samples. Overexpression of c-myc is a classica l hallmark of BL. c-Myc is a direct downstream target of PRDI-BF1/Blimp-1 (140), so induction of PRDM1 in this type of lymphoma may be a way to target dysregulated cell growth and survival of these cells. When CA46 BL cells were treated with the HDAC inhibitor Trichostatin A, PRDM1 expression levels increased sign ificantly. Exactly what the mechanism for this remains to be elucidated. It could be due to decreas ed BCL-6 expression, which is known to repress PRDI-BF1 (262) and is known to be regulated by histone acetylation (13). Another possible explanation is downregulation of c-myc by induction of PRDI-BF1. Mantle cell lymphoma is an incurable disease characterized by high levels of cyclin D1 (275). Therefore, discovery of chemotherapeutic agents which may have

PAGE 103

87 therapeutic potential in treating this disease is of upmost importan ce. The proteasome inhibitor has been effective alone or in comb ination with other drugs in the treatment of myeloma (120). Its use has been extended to treatment of lymphoma patients (132). Our work demonstrates the ability of Bortezomi b to induce apoptosis in these cells, which correlates with the induction of PRDM1 ge ne expression. Bortezomib was shown to induce the UPR in myeloma cells (184), whic h involves XBP. XBP is downstream of PRDI-BF1, so inducing PRDM1 could affect XB P expression in these cells. Our studies have been broadened to study the therapeutic potential of both Bortezomib and SAHA in mantle cell patient samples. By increasing PRDM1 expression in these cells, it may be possible to modulate downstream target gene expression re sponsible for the aggressive phenotypes of these lymphomas. However, our studies do not curren tly address the role of XBP in MCL upon PRDM1 induction. Bortezomib does induce PRDM1 expression in patient samples tested. However, the HDAC inhibitor SAHA decreased PRDM1 levels in the one patient examined (f igure 25). This does not corre late with data acquired in Mino cells using LBH589 (figure 24 ). This could be due to th is particular patient being unresponsive to drug treatment in general. The current and past treatment regimens of the patients tested are unknown to us, as is their disease status. Studies with both Bortezomib and SAHA, or other HDAC inhibitors will need to be extended to a greater number of patients. Cyclin D1 is not one of the known dire ct targets of PRDI-B F1 repression. In normal plasma cells, which express high levels of PRDI-BF1, microarray data demonstrates absence of the cyclin D1 gene CCND1 expression (48). Analysis of the cyclin D1 promoter indicates there are at least three putative PRD I-BF1 binding sites.

PAGE 104

88 One possible mechanism for apoptosis seen in drug-treated MCL cells is PRDI-BF1mediated repression of cyclin D1 promoter activity. Cyclin D1 is important in cell cycle progression and, as such, repression of its activity could cause growth arrest and apoptosis. Analyzing the role PRDI-BF1 pl ays in cyclin D1 re pression would provide further insight into how MCL ce lls may die upon drug treatment.

PAGE 105

89 Materials and Methods Cell lines and drugs The CA46 Burkitts lymphoma cell line, Mino mantle cell lymphoma line, and U266 myeloma cell lines were maintained in RPMI medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (HyClone ), and 1% penicillin/streptomycin (P/S) (Invitrogen). The HDAC inhibitor Trichosta tin A (Sigma) was dissolved in 100% ethanol and used at a concentration of 100 ng/ml. The Nova rtis HDAC inhibitor LBH589 was obtained from Dr. K. Bhalla (Moffitt Cancer Center), while the proteasome inhibitor Bortezomib was obtained from Dr. W.S. Dalton (Moffitt Cancer Center). Apoptosis assay Cells were treated with either Tricho statin A, SAHA, LBH589, or Bortezomib as denoted, followed by Annexin V-PE and 7-AAD staining per manufacturers protocol (BD Pharmingen). Flow cytometry acquisiti on was done using a FA CSCalibur and data was analyzed with CellQuest software (B ecton Dickinson, Carpinteria, CA). Real-time PCR RNA was isolated from cells using TriZol reagent (I nvitrogen) and the manufacturers protocol. On e g RNA was DNase-treated using RQ1 DNase (Promega), followed by first-strand cDNA synt hesis using the iScript cDNA synthesis kit (Bio-Rad). 1/20 th of the final cDNA reaction volume was used in each PCR reaction. Primers sequences are as follows: PRDI-BF1 FWD, 5TACATACCAAAGGGCACACG -3,

PAGE 106

90 PRDI-BF1 REV, 5TGAAGCTCCCCTCTGGAAT A -3, CIITA promoter 3 FWD, 5CAATGCGTTGCCTGGCTC -3, CIITA promoter 3 REV, 5GCTGTTAAGAAGCTCCAGGTAG 3, BSAP FWD, 5TGGAGGATCCAAACCAAAGG -3, BSAP REV, 5GGCAAACATGGTGGGATTTT -3, GAPDH FWD, 5GAAGGTGAAGGTCGGAGT -3, GAPDH REV, 5GAAGATGGTGATGGGATTTC -3. PRDI-BF1, CIITA promoter 3, and GAPDH primer sets were run using an annealing temperature of 60 o C, while the BSAP primer set was run using an annealing temperature of 55 o C. Real-time PCR reactions were performe d in a volume of 25 l, which included 200 nM of each forward and reverse primer an d iQ SYBR Green Supermix (Bio-Rad). Reactions were run in duplicat e using an iCycler and iQ software Version 1.0 (Bio-Rad). Average threshold cycles (Ct) for the genes of interest were normalized to the average GAPDH Ct values for each cDNA sample and rela tive levels of the gene s of interest were calculated by the Ct method (145): for example, 2 -(PRDI-BF1-GAPDH) for PRDI-BF1 gene expression. B cell isolation and differentiation to plasmablasts Peripheral blood B cells were obtained fr om healthy donors and differentiated to plasmablasts, as previously described (253). Briefly, B cells were purified from peripheral blood lymphocytes by positive se lection with anti-CD19 MACS Microbeads (Miltenyi) or negative selection with the human B cell isolation kit II (Miltenyi) using the AutoMACS magnetic bead sorter (Miltenyi). Purification and cell viabiltiy was verified by staining cells with CD19-PE (BD Pharmi ngen) and 2 nM ToPr o3 (Invitrogen) and

PAGE 107

91 analyzing for viable CD19+ B cells using the FACSCalibur. Purified B cells were plated on irradiated CD40L cells (71) and treated with IL-2 (20 U/ ml), IL-4 (50 ng/ml), IL-10 (50 ng/ml), and IL-12 (2 ng/ml) (Peprotech) in RPMI supplemented with 10% FBS and 1% P/S for 4 days. The activated B cells were gently detached from the CD40L cells and washed three times with complete medium an d grown an additional 2 days in complete medium supplemented with IL-2 (20 U/ml), IL-6 (5 ng/ml), IL-10 (50 ng/ml), and IL-12 (2 ng/ml) (Peprotech). On day 6 of cultu re, cells were staine d with CD20-FITC, CD38APC, and 7-AAD, and plasmablasts were so rted out by selecting CD20-/CD38+ viable cells on the FACSAria cell sorter. RNA was co llected and analyzed by real-time PCR.

PAGE 108

92 Chapter Four The farnesyl transferase inhibitor, FTI-277, inhibits growth and induces apoptosis in drug-resistant myeloma cells Introduction Multiple myeloma is a fatal plasma cell malignancy characterized by the accumulation of latent plasma cells in the bone marrow (84). Numerous investigators have examined the frequency of ras mutations in multiple myeloma, and have reported a correlation between activating ras mutati ons and disease progression (144, 178, 204). Furthermore, Rowley et al demonstrated that ANBL6 myeloma cells transfected with activated Nor K-Ras were more resist ant to apoptosis indu ced by dexamethasone, doxorubicin, and melphalan, suggesting a role for Ras mutations in resistance to chemotherapeutic drugs (216). Following in itial response to th erapy, patients with multiple myeloma invariably relapse and are refractory to additional treatment regimens. Thus, myeloma has long served as a model sy stem for investigation of the drug resistant phenotype. These model systems have led to the characterization of several mechanisms of resistance, including overexpression of the anti-apoptotic protein, Bcl-x L (261); induced expression of the ATP dependent e fflux pump P-glycoprotei n (44); and altered expression of topoisomerases (68). The Ras oncoprotein is a small G-protein si gnal tranducer that requires a prenyl lipid modification and membrane associati on for signal transduction activity (85, 280). Two enzymes, farnesyltransferase (FTase) and geranylgeranyltransferase I (GGTase I),

PAGE 109

93 catalyze this prenyl posttranslational modi fication by transferring farnesyl or geranylgeranyl to the cysteine of the carboxy l terminal CAAX (C=cysteine, A=aliphatic, X=any amino acid). H-, N-, and K-Ras are all farnesylated. When FTase is inhibited, KRas, but not N-Ras or H-Ras, becomes gerany lgeranylated (133). Because prenylation is required for the oncogenic activ ity of Ras, we, and others designed FTase and GGTase I inhibitors as potentia l anticancer drugs (228) To date, the majority of studies using prenylation inhibitors have focused on solid tumors, includ ing lung, bladder, breast, and colon carcinomas (14, 133, 246, 247). In this study, we examined the activity of prenylation inhibitors in myeloma cell lines with differe nt Ras mutation status, using the CAAX peptidomimetics FTI-277 (273) and GGTI-2166 (245). These inhibitors are structural analogues based on th e tertiary structure of th e CAAX tetrapeptide (228). Cytotoxicity and growth inhibition were examined for correlation with inhibition of Ras protein processing. In addition, myeloma cell lines with well-characterized mechanisms of drug resistance were analyzed for response to farnesyltransferase in hibitors (FTI). No cross-resistance to FTI was identified in myeloma cells selected for resistance to doxorubicin or melphalan, nor did forced constitutive overexpression of Bcl-x L confer resistance to FTI. These studies provide support for further pre-clinical and clinical trials with prenylation inhibitors in drug resistant myeloma. Results Myeloma cells with a N-Ras mutation are highly sensitive to FTI-277 We used MTT and clonogenic assays to determine the sensitivity of myeloma cells to growth inhibition by FTI-277. The MT T assay measures the metabolic activity of

PAGE 110

94 cells, while the soft agar clonoge nic assay assesses th e ability of cells to divide and form colonies in an anchorage-i ndependent fashion. H929 cells which express activated NRas, were found to be significantly more se nsitive to growth inhibition by FTI-277 than either U266 cells, which expre ss wild-type Ras, or 8226 cells which express activated KRas (figure 30A). The 8226 cell line was th ree times more resistant to the growth inhibitory activity of FTI-277 than H929 cells (IC 50 41.6 M vs. IC 50 12.7 M), while U266 cells demonstrated an intermediate sensitivity (IC 50 25.4 M). Soft agar clonogenic assays demonstrated a similar pa ttern of sensitivity, with H929 cells more sensitive to treatment with FTI-277 than 8226 cells with ac tivated K-Ras over all doses (p<0.05, Students t-test) (figure 30B). Neith er mutant Nnor Kras containing cells were significantly different in sensitivity to FTI-277 compar ed to the wild-type ras U266 cells. Because prenylation inhibitors are genera lly considered to be cytostatic agents, we also examined the ability of FTI-277 to induce apoptosis in myeloma cells. Myeloma cells were treated with FTI-277 for 48 h, followed by staining with Annexin V-FITC and flow cytometry analysis. In correlation with the growth inhibition assays, a dose dependent response was demonstrated, with gr eatest cell death in the N-Ras mutant H929 cells, followed by the wild-type U266 cells. Similar to the growth inhibition and clonogenic analysis, the K-ras mutant 8226 cell li ne was found to be th e least sensitive to FTI cytotoxicity (figure 30C). These data ar e also compatible with previous reports, in which tumor cells of epithelial origin with activated K-Ras were shown to be less responsive to FTI treatment compared to cells with activated N-Ras or wild-type Ras (6, 59).

PAGE 111

95

PAGE 112

96 Figure 30. Myeloma cells with activated N-Ras mutation are more sensitive to cytotoxicity by FTI-277 compared to cells with wild-type Ras or K-Ras mutation. A, Myeloma cells were treated with FTI-277 continuously for 96 hours and assayed using the MTT cytotoxicity assay. IC50s were calculated by linear re gression of percent survival versus log drug concentration and 95% confidence intervals were determined by statistical analysis. Data shown are a minimum of three independent experiments, and summarized with the Ras mutation status, co rresponding regression es timate of the IC50, and 95% confidence intervals. B, H929, U266 or 8226 cells were treated with vehicle (DTT/DMSO), 5 M, 10 M, or 15 M FTI-277 and grown in 0.3% agar layered over 0.6% agar. Colonies were stained with MTT dye and quantitated by counting. H929 cells with activated N-Ras were significantl y more sensitive to FTI-277 treatment over all doses than 8226 cells with activated K-Ras (p <0.05). The data are represented as mean percent survival above control and are the mean of a minimum of five independent experiments done in triplicate. The table summarizes 95% confidence intervals for a comparison of two cell lines. (* indicates st atistical significance by regression analysis.) C, Myeloma cells were tr eated for 48 hours with 5-30 M FTI-277, then assayed for apoptosis using Annexin V-FITC staining as determined by flow cytometry. FTI-277 caused apoptosis in myeloma cells in a dos e-dependent manner, with N-Ras mutated H929 cells being most sensitive to FTI-277-in duced apoptosis. The data are represented as percent apoptosis above control and are th e mean of a minimum of three independent experiments.

PAGE 113

97 Inhibition of Ras processing and re lationship to FTI-induced apoptosis To determine if there was a correlation between inhibition of Ras processing and either growth inhibition or apoptosis, we ex amined the ability of FTI-277 to block Ras prenylation in the myeloma cell lines. Lipi d modification of the p21 Ras protein alters the protein mobility on SDS-PAGE, resulting in a shift to a lower apparent molecular weight on Western blots and allowing detectio n of intracellular drug activity. Although FTI-277 demonstrates greater toxicity in the H929 cell line, inhibition of N-Ras processing is more effective in the U266 cells compared to H929 cells even when treated with doses as low as 1.25 M FTI-277 (figure 31). Additi onally, N-Ras processing in U266 cells is inhibited at much lower doses (range: 1.25-10 M FTI-277) than that required for induction of apoptosis (15-30 M FTI-277), suggesting that the mechanism by which FTI-277 induces apoptosis in U266 most likely does not involve inhibition of the prenylation and function of N-Ras. Processing of K-Ras in the 8226 cells was completely unaffected by any dose of FTI-277 up to 30 M following 48 hour treatment. Because K-Ras becomes geranylgeranylated when FTase is inhibi ted (133, 278), we also examined K-Ras prenylation following exposure to the gera nylgeranyltransferase inhibitor, GGTI-2166, either alone or in combination with FTI-277. No effect was seen with either FTI-277 or GGTI-2166 alone (figure 31C). When 8226 cells were treated simultaneously with FTI277 and GGTI-2166 for 48 hours, inhibition of K-Ras processing occurs in a dosedependent manner. Maximal response for i nhibiting K-Ras processing occurred at 5 M GGTI-2166 in combination with 10 M FTI-277 (figure 31D).

PAGE 114

(A) H929 0 1.25 2.5 5 10 uM FTI-277 P U N-Ras (B) U266 0 1.25 2.5 5 10 uM FTI-277 P U N-Ras (C) 8226 GGTI-2166 FTI-277 0 5 10 98 Figure 31. FTI-277 inhibits N-Ras processing in myeloma cells with wild-type Ras (U266) and activated N-Ras (H929), while both FTI-277 and GGTI-2166 inhibit K-Ras processing. Myeloma cells were treated with FTI-277 for 48 hours. Inhibition of Ras processing was demonstrated by a band shift to a higher apparent molecular weight by Western blot analysis (U, unprocessed Ras, P, processed Ras). A, N-Ras processing of H929 cells following treatment with 0 (vehicle control), 1.25, 2.5, 5, or 10 M FTI-277 for 48 hours. B, N-Ras processing of U266 cells following treatment with 0 (vehicle control), 1.25, 2.5, 5, or 10 M FTI-277 for 48 hours. C, K-Ras processing of 8226 cells following treatment with 0 (vehicle control), 5, 10, 15, or 30 M FTI-277, and 5 or 10 M GGTI-2166 for 48 hours. D, K-Ras processing of 8226 cells following treatment with 0 (vehicle control), 5 M GGTI-2166 plus 5-30 M FTI-277 or 10 M GGTI-2166 plus 5-30 M FTI-277 for 48 hours. Equal loading was determined by immunoblotting with -actin (data not shown). K-Ras 30 5 10 15 uM (D) 8226 K-Ras 0 5 10 15 15 uM FTI-277 0 5 10 uM GGTI-2166 5 30 P U 10 30

PAGE 115

99 Co-treatment of the 8226 cell lin e with FTI-277 and GGTI-2166 also demonstrated an enhanced apoptotic response above the levels for each drug alone. 8226 cells treated with 30 M FTI-277 alone induced approx imately 12% drug-specific apoptosis, while GGTI-2166 treatment alone was completely ineffective in these cells. However, the combination of 10 M GGTI-2166 with FTI-277 increased the cell death two-fold compared to FTI-277 alone in both MTT growth inhibition and Annexin V apoptosis assays (figure 32). Statistical analysis using linear regression with integrated and reduced models demonstrated that grow th inhibition and apoptosis following cotreatment with FTI-277 and GGTI-2166 occurs in an additive manner. These data are compatible with previous studies demonstratin g that inhibition of farnesyl transferase is insufficient to affect K-ras processing, a nd concomitant inhibition of geranylgeranyl transferase is required. Furthermore, inhi bition of N-Ras proce ssing in H929 and U266 cells occurs at doses well below those necessary to cause growth inhibition and apoptosis, while inhibition of K-Ras processing and significant apoptosis in 8226 cells requires cotreatment with FTI-277 and GGTI-2166.

PAGE 116

051015202530355 uM15 uM30 uM5 uM10 uMPercent apoptosis above control30 uM FTI-277 +10 uM GGTI-2166 FTI-277GGTI-2166 02040608010010-50.0001 0 GGTI-2166 5uM GGTI-2166 10uM GGTI-2 A B 166Percent of controlFTI-277 (M) 100

PAGE 117

101 Figure 32. Both FTI-277 and GGTI-2166 inhibit K-Ras processing. A, Myeloma cells were treated for 48 hours with 5-30 M FTI-277 alone, 5-10 M GGTI-2166 alone, or 10 M GGTI-2166 combined with 30 M FTI-277, then assayed for apoptosis using Annexin V-FITC staining by flow cytome try. FTI-277 caused apoptosis of 8226 myeloma cells in a dose-dependent manner, while GGTI-2166 had no effect on the cells. A combination of FTI-277 and GGTI-2166 had an additive effect on inducing apoptosis in 8226 cells. The data are represented as percent apoptosis above control and are the mean of a minimum of three independent expe riments. B, Myeloma cells were treated with FTI-277 alone, FTI-277 plus 5 M GGTI-2166, or FTI-277 plus 10 M GGTI-2166 for 96 hours, then assayed using the MTT cy totoxicity assay. In creasing the dose of GGTI-2166 enhanced the cytotoxic effect above that of FTI-277 treatment alone. The data are represented as percent survival abov e control cells. The data are the mean of three independent experime nts done in quadruplicate. Bcl-x L and classical mechanisms of drug resistance are not determinants of resistance to FTI-277. The anti-apoptotic protein Bcl-x L is a known determinant of drug resistance in multiple myeloma and has previ ously been shown to protect myeloma cells from cytotoxic drugs including doxorubicin, melphalan, mitoxantr one, and VP-16 (189). We explored the ability of FTI-277 to indu ce apoptosis in myeloma cells overexpressing Bcl-x L Using U266 cells engineered to constitutively overexpress Bcl-x L (U266/Bcl-xl), we compared the cytotoxic activity of FTI-277 in U266 cells expressing low basal levels of Bcl-x L (U266 and U266/Neo) to t hose overexpressing Bcl-x L (figure 33A-B). Using both MTT cytotoxicity and CMXRos/Annexi n V apoptosis assays, no significant difference was found in the response to FTI277 between the cells e xpressing low levels of Bcl-x L and those with high constitutive expression. Bcl-x L has been shown to prevent cell death by preventing the release of cytochrome c and mitochondrial perturbation (222). Equal sensitivity of cells expressing varying levels of Bcl-x L indicate that apoptosis induced by the FTIs in myel oma cells occurs through a mitochondrialindependent mechanism. Furtherm ore, the observation that Bcl-x L does not confer

PAGE 118

102 resistance to prenylation inhi bitors supports the use of these agents in patients with drug resistant disease.

PAGE 119

103

PAGE 120

Figure 33. Bcl-x L is not a determinant of resistance to FTI-277. A, U266, U266Neo, and U266Bclxl cells were treated with FTI-277 continuously for 96 h and assayed for cytotoxicity using the MTT assay. IC 50 s were calculated and the 95% confidence intervals estimated by linear regression of percent survival vs log drug concentration. The data shown are of three independent experiments done in quadruplicate. The corresponding table summarizes the IC 50 estimate and 95% confidence intervals from linear regression for the U266 cell lines. B, Bcl-X L protein expression. The myeloma cell lines H929, U266, U266Neo and 8226 express minimal levels of endogenous Bcl-X L protein relative to the overexpressing transfectant, U266Bcl-xl. Equal loading was determined by immunoblotting for -actin. C, U266, U266Neo, and U266Bcl-xl cells were treated with FTI-277 continuously for 48 hours and assayed for apoptosis using CMXRos (Chloromethyl-X-Rosamine)Annexin-V staining. Loss of MMP and Annexin-V staining of cell surface phosphatidylserine are independent markers of apoptosis, therefore viable cells appear in the upper left quadrant of the flow cytometry dot plot, while the other three quadrants represent cells in various stages of apoptosis. There is no significant difference in apoptosis in the U266 and U266Bcl-xl cell lines, indicating that Bcl-x L protein overexpression in U266 cells is not a determinant of resistance to FTI-277 in U266 myeloma cells. The data shown are representative of three individual experiments. 104

PAGE 121

105 Patients with multiple myeloma frequently relapse with multi-drug resistant disease, and myeloma cells selected in vitro for resistance to ch emotherapeutic drugs provide a model for examining mechanisms of acquired drug resistance. We utilized cells selected for resistance to doxorubicin, in the presence (68) or absence (44) of the calcium channel blocker, verapamil, and cells selected for resistance to melphalan (11) for cross resistance to FTI-277. No significan t differences were found in the response of the parental cells, 8226/S, as compared to the drug resistant variants, 8226/Dox40, 8226/Dox1V, or 8226/LR5 (figure 34). The 8226/Dox40 cell line has been shown to overexpress the ATP-dependent efflux pump, P-glycoprotein, and is approximately 180fold resistant to doxorubicin. Additionally, this cell line dem onstrates cross-resistance to mitoxantrone, etoposide, and vincristine (44) However, no cross-resistance to FTI-277 was demonstrated, indicating th at the prenylation inhibito r is not a substrate for Pglycoprotein efflux. Additionally, 8226 drug re sistant cells with ot her mechanisms of drug resistance, such as altered topoisomera se II activity and elevated levels of intracellular glutathione, are also not significan tly more resistant to treatment with FTI277 compared to parental cells. These data su pport the potential utility of FTI inhibitors in relapsed myeloma patients, either as sing le agents, or in combination with standard chemotherapeutic drugs.

PAGE 122

Cell lineIC50 (uM)95% CI82263630-428226/Dox4040.530.8-50.38226/Dox1V23.917.9-29.88226/LR53830.8-45.3 010203040506082268226/Dox408226/Dox1V8226/LR5IC50 (uM) Figure 34. Drug-resistant myeloma cells are not cross-resistant to FTI-277. 8226/S, 8226/Dox40, 8226/Dox1V, and 8226/LR5 were treated with FTI-277 continuously for 96 hours and assayed using the MTT cytotoxicity assay. IC50s were calculated by linear regression of percent survival versus log drug concentration and 95% confidence intervals were determined by statistical analysis. The IC50 estimates from linear regression were calculated from three independent experiments done in quadruplicate. The table summarizes the IC50s and 95% confidence intervals for the myeloma cell lines. 106

PAGE 123

107 Discussion Ras mutations are among the most common oncogenic mutations identified in many malignant diseases, including multiple myeloma. Prenylation inhibitors are a new class of agents developed to inhibit Ras protein processing and prevent constitutive signal transduction by the activated protein. Clinical trials with FTIs have demonstrated a therapeutic response in leukemia patients, even though Ras mutation status was not a determinant for clinical res ponse (6, 114). Similarly, prec linical studies using solid tumor xenografts have not supported a correla tion of response with Ras mutation status (6, 59). Thus, the biologic basis for FTI activity in tumor cells is yet to be fully defined. In this study we examined the cytotoxi c activity and inhibiti on of Ras processing in three myeloma cell lines with differing Ra s mutation status. The U266 cell line, which expresses wild type Ras, is the most sensi tive to inhibition of Ras processing; however, these cells are not sensitive to FTI-mediated cytotoxicity. The H929 cell line, which expresses mutant N-ras, demonstrates an intermediate sensitivity to FTI-277-induced inhibition of N-Ras processing, but is the most sensitive to growth inhibition and apoptosis. In all assays, the 8226 cell lin e containing a K-ras mutation is the most resistant to the cytotoxic effects of FTI. Similar to previous studies in epithelial carcinomas, K-Ras processing could only be i nhibited with a combination of FTI and GGTI in 8226 cells. In a study by Lerner et. al pancreatic, bladder, and pulmonary tumor cells also demonstrated resistance to inhibition of K-Ras processing when treated with FTI-277 or GGTI-298 alone (133). Furthe rmore, inhibition of K-Ras processing in these cell lines did not correlate with grow th inhibition as measured by soft agar clonogenic assays. In contrast, in this study the most sensitive cell line is the one with N-

PAGE 124

108 Ras mutation suggesting that N-Ras mutation st atus may be a determinant of response. Consistent with this is the f act that the IC50 for growth inhi bition is similar to that of inhibition of N-Ras processing in H929 but not in U266. In U266, inhibition of N-Ras processing (IC 50 =2 M) does not result in inhibition of growth (see Figure 31). Expression of the anti -apoptotic protein Bcl-x L has been shown to contribute to resistance to a broad range of chemotherape utic agents in myeloma cells (189, 261). However, the data presented here demonstrates that FTI-277 is effective in myeloma cells in vitro independent of Bcl-x L expression. The U266 myeloma cell line expresses a basal level of Bcl-x L, that confers resistance to both Fas and chemotherapeutic agents (31, 189). In contrast, H929 myeloma cells express low levels of Bcl-x L and are more sensitive to the cytotoxicity of the FTIs. This observa tion led us to examine FTI activity in U266 myeloma cells engineered to express very high levels of Bcl-x L (31). In these myeloma cell lines, Bcl-x L expression had no effect on the cytotoxi city of the FTI. These data are in contrast to a previous study demonstrat ing resistance to the farnesyltransferase inhibitor L-739,749 by Bcl-x L overexpression in Rat1 cells (126). This discrepancy is most likely due to the different cell t ypes and their relative dependence on Bcl-x L for survival. Classical mechanisms of acquired drug resistance include increased expression of drug efflux proteins such as P-glycoprotein, reduced expre ssion of intracellular drug targets, such as topoisomerase II (68), and enhanced drug detoxificat ion by glutathione Stransferase (11). The novel observation that these classical mediators of drug resistance do not confer cross-resistance to FTI-277 provid es strong rationale for clinical trials of FTI in myeloma patients that are refractory to standard chemotherapeutic agents.

PAGE 125

109 Therapeutic agents with molecular ta rgets provide a uni que opportunity to specifically inhibit malignant growth with minimal systemic toxicity. Many of these agents are being extensively investigated as potential combination therapies, and in fact, previous studies using a xenograft model have demonstrated that FTI in combination with cisplatin, taxol, or gemcitabine is more effective than either agent alone (245). Our data demonstrate that farnesyl transferase inhibi tors inhibit growth and induce apoptosis in both drug sensitive and drug resistant myeloma cells in vitro These results support ongoing clinical studies in myel oma patients, and may contribu te to the development of a novel treatment for this incurable disease. Recently, phase II clinical trial data has demonstrated stabilization of disease in over 60% of myel oma patients treated with the FTI Zarnestra (3). Materials and Methods Cell lines and drugs The RPMI 8226, U266, and H929 multiple myeloma cell lines were maintained in RPMI medium (CellGro, MediaTech, Herndon, VA) supplemented with 5% or 10% fetal bovine serum (FBS) (Omega Scie ntific, Tarzana, CA), 1% pe nicillin/streptomycin (P/S), and 100 mM L-glutamine (Gemini Bio-Products Calabasas, CA). The H929 cell line was also supplemented with 0.05 M 2-mercapto ethanol (Sigma, St. Louis, MO). U266 cells transfected with Bcl-x L were cloned and selected for high (U266/Bcl-xl) or low (U266/Neo) Bcl-x L protein expression and have been previously described (189). The drug resistant cell lines, 8226/Dox40 (44), 8226/Dox1V (68), and 8226/LR5 (11) have all

PAGE 126

110 been previously described. The farnesyl transferase inhibitor (FTI)-277 (273) and geranylgeranyltransferase inhibitor (GGTI)-2166 (245) were initially dissolved in 10 mM dithiothreitol in dimethyl sulfoxide (D TT/DMSO) and diluted to the appropriate concentrations with RPMI complete medium. MTT cytotoxicity assay Cells were seeded at 8000-14000 cells/w ell in 96-well plates (Becton Dickinson, Lincoln Park, NJ). To establish a dose-response to FTI-277, cells were incubated 96 hours in two-fold serial dilutions ranging from 3.75x10 -7 M to 1x10 -5 M. Following continuous drug exposure, 50 l 3-[4,5-dimethylthiazol-2yl]-2,5-diphenyltetrazolium bromide (MTT) dye was added. The insolubl e formazan complex was solubilized with DMSO and absorbance measured at 540 nm. IC 50 s and 95% confidence intervals were calculated by regression anal ysis of the linear portion of the dose-response curve. Soft agar clonogenic assay Cells were seeded at densities established for optimal cloning efficiency (range: 24000-30000 cells per well) and grown in 0.3% ag ar (Difco, Detroit, MI) layered over 0.6% agar. FTI-277 or vehicle control (10 mM DTT/DMSO) was included in the 0.3% agar layer of cells. Approximately 2-3 weeks after plating, colonies were stained with 1 mg/ml MTT and counted.

PAGE 127

111 Ras processing assay Cells were treated with FTI-277, GGTI-2166, or combinations thereof for 48 hours. Following drug exposure, cells were washed in PBS and lysed in a buffer containing 30 mM HEPES, pH 7.5, 10 mM Na Cl, 1% Triton X-100, 10% glycerol, 5 mM MgCl 2 1 mM EGTA, 25 mM NaF, 25 g/ml leupeptin, 2 mM phenylmethylsulfonylfluoride (PMSF), 2 mM sodium orthovanadate, 10 g/ml soybean trypsin inhibitor, and 10 g/ml aprotinin. The lysates were cleared and total protein was determined by the Bradford assay (Bio-Rad, Hercules, CA). Equal amounts of protein (50 g) were separated on 12.5% SDS-PAGE and transferred to PVDF membrane (BioRad). Membranes were probed with polyclonal antisera specific for Nor K-Ras (Santa Cruz Biotechnology, Sant a Cruz, CA), Bcl-x L (Pharmingen, San Diego, CA), or monoclonal antiserum specific for -actin (Sigma, St. Louis, MO), followed by detection with chemiluminescence (Roche, Indianapolis, IN). Apoptosis assays Cells were treated with FTI-277 an d/or GGTI-2166 for 48 hours continuously, followed by Annexin V-FITC staining accor ding to the manufacturer's protocol (BioVision, Mountain View, CA). In experi ments that included CMXRos staining for mitochondrial perturbation, cells were incubate d for hour prior to collection with 200 nM CMXRos (Molecular Probes, Eugene OR). Flow cytometry acquisition was done on a FACSCalibur and analyzed with CellQuest software (Becton Dickinson, Carpinteria, CA).

PAGE 128

112 Statistical analysis IC 50 values were calculated and 95% conf idence intervals were estimated using a simple linear regression analysis followi ng logistic transforma tion of the response variable where applicable. Differences across cell lines or doses were tested using either the Students t-test or W ilcoxon Rank Sum test. Differen ces in the mean of the transformed responses were determined by 95% confidence intervals. In the combination FTI-277/GGTI-2166 study, a linear regression analysis was used to test for synergism and additivity across dose levels.

PAGE 129

113 Chapter Five General Discussion The work presented in this dissertation provides insight into the regulation of the human PRDM1 gene and explores the possibility of modula ting PRDM1 gene expression as a target for inducing apoptosis of lympho ma cells. Very little was known as to the regulation of PRDI-BF1 upon initiati on of this project. The fi nding that regulation of this gene occurs primarily at the transcriptional leve l is very novel. It is also at the foundation of preliminary data presented here demonstrating induction of PRDM1 by chemotherapeutic agents both in cell lines and patient samples. This induction correlates with a dose-dependent increase of apoptosis suggesting the possibi lity PRDI-BF1 may play an important role in more than just differentiation. PRDI-BF1 was traditionally thought to play a role in the differentiation from a B cell to a plasma cell. However, since incep tion of this project, PRDI-BF1 has been shown to be expressed by a number of organi sms at different stages of development as well as in cells where it was originally thought to not be expressed, such as T cells (111) and B cells of myeloma patien ts (21). These findings are intriguing and lead to many more questions as to the role PRDM1 might play here. The finding that the PRDI-BF1 promoter is loaded with factors in lymphoma cells is a very interesting one, as one would antici pate a bare promoter in a cell which does not

PAGE 130

114 express this gene. However, when taken w ith the data demonstrating the rapid induction of the transcriptional activation, as is seen in figure 9 with 1 hour anti-IgM treatment, it indicates the PRDI-BF1 promot er is poised and primed for activation. PU.1 is shown to be a factor involved in anti-IgM-induced activat ion of the promoter, but is definitely not the sole factor involved in th is rapid induction of transcriptional activity as is seen by data presented in figures 19 and 20. Further elucidation of the roles played by the PI3K and MAPK signaling pathways may reveal additional factors involved in regulating PRDI-BF1. Utilizing the chro matin immunoprecipitation assa y (ChIP) in these cells could also be a useful tool for analyzing potential candidate factors as to their role in regulating the PRDM1 promoter as well as id entifying chromatin modifications involved in promoter regulation. However, this assay is very difficult to do in B cells and is currently being optimized in our lab. Luciferase activity was shown to be hi gh in myeloma cells, but is overall much lower in lymphoma cells. These data agree with the expression pattern of PRDM1 in lymphoma and myeloma cells. However, fact ors required for activation are present in these cells, as demonstrated by the ra pid induction of nascent RNA production in lymphoma cells (figure 9). There is one distal region of activation common to both lymphoma and myeloma cells and an additiona l region specific to only myeloma cells. These regions were further analyzed by DMS in vivo footprinting to identify putative factors responsible for promoter activity in both cell types. Each of these approximately 400 bp regions were extensively analyzed fo r unique contacts, but only three factor binding sites were eventually identified.

PAGE 131

115 The proximal promoter was loaded with factors in both lymphoma and myeloma cells (figure 11), however there were no dis tinct differences observed between the cell types. There was a completely protected site in both cell types which was later verified to be a Sp1 binding site (figure 12). Howeve r, because there were no cell-type specific DNA-protein interactions in this region of the promoter, we further analyzed the distal promoter regions of activation. Analysis of the distal promoter regions revealed several factors unique to either lymphoma or myeloma cells. However, upon further examination, only the PU.1 binding site was demonstrated to be functionally rele vant to promoter activity, as shown by sitedirected mutagenesis (figures 15 and 16). Using a footprinting technique specific for residues other than guanine may be help ful in identifying additional DNA-protein interactions which may be functionally rele vant for promoter activity. Myeloma cells had one unique distal region of activation, as measured by lu ciferase assay. However, no contacts were detected in this region by DMS in vivo footprinting. Using one footprinting method may have limited our ability to detect protein-DNA interactions. PU.1 was found to bind the PRDI-BF1 promot er in a cell-type specific manner. It is a B cell specific factor a nd was found to only play a ro le in promoter activity of lymphoma cells, but not myeloma cells. It is not expressed in myeloma cells, but promoter activity was found to also be increase d two-fold in the same distal region of the promoter in these cells (figure 10). This indi cates another as yet undetermined factor is important for increased promoter activity in myeloma cells. This undetermined factor also binds a site other than site P.H, as ge l shift analysis did not demonstrate occupancy of this site in myeloma cells (figure 17). Since PRDM1 gene expression is elevated in

PAGE 132

116 myeloma cells, this factor may also be one which is ubiquitously expressed in plasmalike cells, but not B cells. Because PU.1 has been known to bind promoters in complex with IRF family members (58, 61), we examined whether the IRF family members IRF-4 or IRF-8 were binding to site P.H in complex with PU.1 (fi gure 17 and 18). IRF-8 has been shown to induce Blimp-1 expression in myeloid cells (252), while IRF-4 has been shown to be required for plasma cell differentiation (28). Competition with antibodies to either IRF-4 or IRF-8 did not affect P.H binding to DNA, indicating these fact ors do not appear to bind site P.H in complex with PU.1. Work presented in Chapter Two is the fi rst of its kind to directly link anti-IgM mediated B cell receptor activation to expr ession of PRDI-BF1/Blimp-1. It also demonstrates regulation of PRDI-BF1/Blim p-1 occurs primarily at the level of transcription. The promoter is poised and ready for activation, which is a significant finding in light of the preliminary data pres ented in Chapter Three, demonstrating the induction of PRDM1 gene expression levels PRDM1-negative lymphoma cells in parallel with induction of apoptosis. However, th ere is no direct link between induction of PRDMI-BF1/Blimp-1 and induction of apoptosis. This could be due to an indirect effect. It has previously been shown introduction of PRDI-BF1 is able to induce apoptosis in cells (164), so one could hypothesize that ther e is a direct link between induction of PRDI-BF1/Blimp-1 and induction of apoptos is. Introduction of PRDI-BF1 into lymphoma cells and measuring apoptosis is th e direct approach that would answer this question. However, B cells are very difficult to transfect usi ng methods other than electroporation. Electroporat ion causes a large amount of background cell death, which

PAGE 133

117 makes a study of apoptosis caused by introduc tion of PRDI-BF1 diffi cult. These studies are currently the focus of our lab, as this is a critical question that remains to be answered. Work presented in Chapter Four focuses on myeloma cells and the ability of the farnesyl transferase inhibitor, FTI-277, to i nduce apoptosis. The goal of this study was to determine whether Ras mutation status correlated with induction of apoptosis in several myeloma cells with differing Ras mutation status Protein prenylation has been shown to be required for oncogenic activ ity of activated Ras, therefore using an inhibitor which blocks the transfer of the prenyl group to Ra s itself would diminish its oncogenic activity. Our data demonstrate greatest inhibition of Ras processing in U266 myeloma cells with wild-type Ras, while they are not sensitive to FTI-mediated cytotoxicity, as measured by MTT assay and soft agar cl onogenic assay. However, H929 myeloma cells with mutated N-Ras were most sensitive to treatment with FTI, but demonstrated intermediate sensitivity to FTI-277-induced inhibition of Ra s processing. Inhibition of mutant K-Ras processing in 8226 myeloma cells was only accomplished by a combination of FTI-277 and GGTI-2198, which correlates with finding s in epithelial cell lines (133). These findings indicate N-Ras mutation status might be a determinant of response to FTI treatment in myeloma patients, as the cell line harboring the N-Ras mutation was most sensitive to FTI-277 treatment. Drug resistance is a common problem in myeloma patients, therefore it is important to study the effectiveness of new drugs in both drug-sensitive and drugresistant cell lines. The anti-apoptotic protein Bcl-x L has been shown to confer resistance to chemotherapeutic agents in myeloma ce lls (189, 261), which led us to study cytotoxic

PAGE 134

118 effects of FTI-277 in a cell line engineered to overexpress Bcl-x L (31). Our studies indicate Bcl-xL expression had no effect on FTI cytotoxicity (figure 32). We extended our studies to include severa l 8226 cell lines selected for various mechanisms of drug resistance, including increased P-glycoprotein expression (44), reduced expression of topoisomerase II (68), and enhanced drug detoxification by glutat hione-S-transferase (11). These had no effect on cytotoxicity of FTI-277, indicating they are not crossresistant to FTI-277 treatment. This is an important finding, as many myeloma patients initially respond to drug trea tment, but then become re fractory to treatment upon emergence of a drug-resistant population. This work provides the rationale to study FTIs in clinical trials with myeloma patients who no longer respond to standard treatment regimens. This dissertation presents work on the tr anscriptional regulation of the PRDI-BF1 gene and extends these findings to studies on the modulation of the PRDM1 gene in PRDM1-negative lymphoma cells. Work is also presented on the correlation between Ras mutation status and sensitivity to FTI277 treatment. These studies are extended to cell lines with known mechanisms of drug resi stance in myeloma patients. Cell lines with the drug resistant phenotype are not cross-resistant to FTI-277 treatment, demonstrating a potential role for use of this drug in clinical trials.

PAGE 135

119 References 1. Alizadeh, A. A., M. B. Eisen, R. E. Davis, C. Ma, I. S. Lossos, A. Rosenwald, J. C. Boldrick, H. Sabet, T. Tran, X. Yu, J. I. Powell, L. Yang, G. E. Marti, T. Moore, J. Hudson, Jr., L. Lu, D. B. Lewi s, R. Tibshirani, G. Sherlock, W. C. Chan, T. C. Greiner, D. D. Weisenbur ger, J. O. Armitage, R. Warnke, R. Levy, W. Wilson, M. R. Grever, J. C. Byrd, D. Botstein, P. O. Brown, and L. M. Staudt. 2000. Distinct types of diffuse la rge B-cell lymphoma identified by gene expression profiling. Nature 403: 503-11. 2. Allman, D., R. C. Lindsley, W. DeMuth, K. Rudd, S. A. Shinton, and R. R. Hardy. 2001. Resolution of three nonprolifer ative immature splenic B cell subsets reveals multiple selection poin ts during peripheral B cell maturation. J Immunol 167: 6834-40. 3. Alsina, M., R. Fonseca, E. F. Wilson, A. N. Belle, E. Gerbino, T. PriceTroska, R. M. Overton, G. Ahmann, L. M. Bruzek, A. A. Adjei, S. H. Kaufmann, J. J. Wright, D. Sullivan, B. Djulbegovic, A. B. Cantor, P. R. Greipp, W. S. Dalton, and S. M. Sebti. 2004. Farnesyltransferase inhibitor tipifarnib is well tolerated, induces stabilization of disease, and inhibits farnesylation and oncogenic/tumor survival pathways in patients with advanced multiple myeloma. Blood 103: 3271-7. 4. Anderson, K. C., R. M. Jones, C. Mori moto, P. Leavitt, and B. A. Barut. 1989. Response patterns of purified myelom a cells to hematopoietic growth factors. Blood 73: 1915-24. 5. Angelin-Duclos, C., G. Cattoretti, K. I. Lin, and K. Calame. 2000. Commitment of B lymphocytes to a plasma cell fate is associated with Blimp-1 expression in vivo. J Immunol 165: 5462-71. 6. Ashar, H. R., L. James, K. Gray, D. Carr, M. McGuirk, E. Maxwell, S. Black, L. Armstrong, R. J. Doll, A. G. Taveras, W. R. Bishop, and P. Kirschmeier. 2001. The farnesyl transferase i nhibitor SCH 66336 induces a G(2) --> M or G(1) pause in sensitive human tumor cell lines. Exp Cell Res 262: 17-27. 7. Bannish, G., E. M. Fuentes-Panana, J. C. Cambier, W. S. Pear, and J. G. Monroe. 2001. Ligand-independent signaling functions for the B lymphocyte antigen receptor and their role in posi tive selection during B lymphopoiesis. J Exp Med 194: 1583-96. 8. Baron, B. W., G. Nucifora, N. McCabe, R. Espinosa, 3rd, M. M. Le Beau, and T. W. McKeithan. 1993. Identification of the ge ne associated with the recurring chromosomal translocations t( 3;14)(q27;q32) and t(3;22)(q27;q11) in Bcell lymphomas. Proc Natl Acad Sci U S A 90: 5262-6.

PAGE 136

120 9. Baxendale, S., C. Davison, C. Muxwor thy, C. Wolff, P. W. Ingham, and S. Roy. 2004. The B-cell maturation factor Blimp1 specifies vertebrate slow-twitch muscle fiber identity in res ponse to Hedgehog signaling. Nat Genet 36: 88-93. 10. Beitz, L. O., D. A. Fr uman, T. Kurosaki, L. C. Cantley, and A. M. Scharenberg. 1999. SYK is upstream of phosphoinositide 3-kinase in B cell receptor signaling. J Biol Chem 274: 32662-6. 11. Bellamy, W. T., W. S. Dalton, M. C. Gleason, T. M. Grogan, and J. M. Trent. 1991. Development and characterization of a melphalan-resistant human multiple myeloma cell line. Cancer Res 51: 995-1002. 12. Benhamou, L. E., P. A. Cazenave, and P. Sarthou. 1990. Antiimmunoglobulins induce death by apoptosis in WEHI-231 B lymphoma cells. Eur J Immunol 20: 1405-7. 13. Bereshchenko, O. R., W. Gu, and R. Dalla-Favera. 2002. Acetylation inactivates the transcriptional repressor BCL6. Nat Genet 32: 606-13. 14. Bernhard, E. J., W. G. McKenna, A. D. Hamilton, S. M. Sebti, Y. Qian, J. M. Wu, and R. J. Muschel. 1998. Inhibiting Ras prenylation increases the radiosensitivity of human tumor cell lin es with activating mutations of ras oncogenes. Cancer Res 58: 1754-61. 15. Bezieau, S., M. C. Devilder, H. Avet-Loi seau, M. P. Mellerin, D. Puthier, E. Pennarun, M. J. Rapp, J. L. Harousseau, J. P. Moisan, and R. Bataille. 2001. High incidence of N and K-Ras activating mutations in multiple myeloma and primary plasma cell leukemia at diagnosis. Hum Mutat 18: 212-24. 16. Billadeau, D., G. Ahmann, P. Greipp, and B. Van Ness. 1993. The bone marrow of multiple myeloma patients cont ains B cell populations at different stages of differentiation that are clonally related to the malignant plasma cell. J Exp Med 178: 1023-31. 17. Billadeau, D., D. F. Jelinek, N. Sh ah, T. W. LeBien, and B. Van Ness. 1995. Introduction of an activated N-ras oncogene alters the growth characteristics of the interleukin 6-dependent myeloma cell line ANBL6. Cancer Res 55: 3640-6. 18. Blackwood, E. M., and R. N. Eisenman. 1991. Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science 251: 1211-7. 19. Blum, K. A., G. Lozanski, and J. C. Byrd. 2004. Adult Burkitt leukemia and lymphoma. Blood 104: 3009-20. 20. Bonni, A., A. Brunet, A. E. West, S. R. Datta, M. A. Takasu, and M. E. Greenberg. 1999. Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and -independent mechanisms. Science 286: 1358-62. 21. Borson, N. D., M. Q. Lacy, and P. J. Wettstein. 2002. Altered mRNA expression of Pax5 and Blimp-1 in B cells in multiple myeloma. Blood 100: 462939. 22. Bos, J. L. 1989. ras oncogenes in human cancer: a review. Cancer Res 49: 4682-9. 23. Brtva, T. R., J. K. Drugan, S. Ghosh, R. S. Terrell, S. Campbell-Burk, R. M. Bell, and C. J. Der. 1995. Two distinct Raf domains mediate interaction with Ras. J Biol Chem 270: 9809-12.

PAGE 137

121 24. Buettner, M., A. Greiner, A. Avramido u, H. M. Jack, and G. Niedobitek. 2005. Evidence of abortive plasma cell differentiation in Hodgkin and ReedSternberg cells of classical Hodgkin lymphoma. Hematol Oncol 23: 127-32. 25. Burdin, N., C. Van Kooten, L. Gali bert, J. S. Abrams, J. Wijdenes, J. Banchereau, and F. Rousset. 1995. Endogenous IL-6 and IL-10 contribute to the differentiation of CD40-activated human B lymphocytes. J Immunol 154: 253344. 26. Burgering, B. M., and P. J. Coffer. 1995. Protein kinase B (c-Akt) in phosphatidylinositol-3-OH kinase signal transduction. Nature 376: 599-602. 27. Buyse, I. M., G. Shao, and S. Huang. 1995. The retinoblastoma protein binds to RIZ, a zinc-finger protein that shares an epitope with the adenovirus E1A protein. Proc Natl Acad Sci U S A 92: 4467-71. 28. Calame, K. L., K. I. Lin, and C. Tunyaplin. 2003. Regulatory mechanisms that determine the development and functi on of plasma cells. Annu Rev Immunol 21: 205-30. 29. Campbell, S. L., R. Khosravi-Far, K. L. Rossman, G. J. Clark, and C. J. Der. 1998. Increasing complexity of Ras signaling. Oncogene 17: 1395-413. 30. Carey, G. B., and D. W. Scott. 2001. Role of phosphatidylinositol 3-kinase in anti-IgMand anti-IgD-induced apoptos is in B cell lymphomas. J Immunol 166: 1618-26. 31. Catlett-Falcone, R., T. H. Landowski, M. M. Oshiro, J. Turkson, A. Levitzki, R. Savino, G. Ciliberto, L. Moscinski, J. L. Fernandez-Luna, G. Nunez, W. S. Dalton, and R. Jove. 1999. Constitutive activation of Stat3 signaling confers resistance to apoptosis in huma n U266 myeloma cells. Immunity 10: 105-15. 32. Cattoretti, G., C. Angelin-Duclos, R. Shaknovich, H. Zhou, D. Wang, and B. Alobeid. 2005. PRDM1/Blimp-1 is expressed in human B-lymphocytes committed to the plasma cell lineage. J Pathol 206: 76-86. 33. Cattoretti, G., C. C. Chang, K. Cechova, J. Zhang, B. H. Ye, B. Falini, D. C. Louie, K. Offit, R. S. Chaganti, and R. Dalla-Favera. 1995. BCL-6 protein is expressed in germinal-center B cells. Blood 86: 45-53. 34. Chan, S. L., and V. C. Yu. 2004. Proteins of the bcl2 family in apoptosis signalling: from mechanistic insights to therapeutic opportunities. Clin Exp Pharmacol Physiol 31: 119-28. 35. Chan, V. W., F. Meng, P. Soriano, A. L. DeFranco, and C. A. Lowell. 1997. Characterization of the B lymphocyte populations in Lyn-deficient mice and the role of Lyn in signal initiati on and down-regulation. Immunity 7: 69-81. 36. Chang, D. H., G. Cattoretti, and K. L. Calame. 2002. The dynamic expression pattern of B lymphocyte induced matura tion protein-1 (Blimp-1) during mouse embryonic development. Mech Dev 117: 305-9. 37. Chen, H., C. A. Gilbert, J. A. Hudson, S. C. Bolick, K. L. Wright, and J. F. Piskurich. 2006. Positive regulatory domain I-binding factor 1 mediates repression of the MHC class II transact ivator (CIITA) type IV promoter. Mol Immunol.

PAGE 138

122 38. Chittka, A., and M. V. Chao. 1999. Identification of a zinc finger protein whose subcellular distribution is regulated by se rum and nerve growth factor. Proc Natl Acad Sci U S A 96: 10705-10. 39. Chung, J. B., M. A. Baum eister, and J. G. Monroe. 2001. Cutting edge: differential sequestration of plasma memb rane-associated B cell antigen receptor in mature and immature B cells into glycosphingolipid-enriched domains. J Immunol 166: 736-40. 40. Cole, M. D., and S. B. McMahon. 1999. The Myc oncoprotein: a critical evaluation of transactivation and target gene regulation. Oncogene 18: 2916-24. 41. Corradini, P., M. Ladetto, G. Inghirami, M. Boccadoro, and A. Pileri. 1994. Nand K-ras oncogenes in plasma cell dyscrasias. Leuk Lymphoma 15: 17-20. 42. Cyster, J. G., J. I. Healy, K. Kishihara, T. W. Mak, M. L. Thomas, and C. C. Goodnow. 1996. Regulation of B-lymphocyte negative and positive selection by tyrosine phosphatase CD45. Nature 381: 325-8. 43. Dai, Q., E. Choy, V. Chiu, J. Romano, S. R. Slivka, S. A. Steitz, S. Michaelis, and M. R. Philips. 1998. Mammalian prenylcysteine carboxyl methyltransferase is in the endoplasmic reticulum. J Biol Chem 273: 15030-4. 44. Dalton, W. S., B. G. Durie, D. S. Alb erts, J. H. Gerlach, and A. E. Cress. 1986. Characterization of a new drug-resi stant human myeloma cell line that expresses P-glycoprotein. Cancer Res 46: 5125-30. 45. Damiano, J. S., L. A. Hazlehurst, and W. S. Dalton. 2001. Cell adhesionmediated drug resistance (CAM-DR) protects the K562 chronic myelogenous leukemia cell line from apoptosis i nduced by BCR/ABL inhibition, cytotoxic drugs, and gamma-irradiation. Leukemia 15: 1232-9. 46. Dave, S. S., K. Fu, G. W. Wright, L. T. Lam, P. Kluin, E. J. Boerma, T. C. Greiner, D. D. Weisenburger, A. Rosenwald, G. Ott, H. K. MullerHermelink, R. D. Gascoyne, J. Delabie, L. M. Rimsza, R. M. Braziel, T. M. Grogan, E. Campo, E. S. Jaffe, B. J. Dave W. Sanger, M. Bast, J. M. Vose, J. O. Armitage, J. M. Connors, E. B. Smela nd, S. Kvaloy, H. Holt e, R. I. Fisher, T. P. Miller, E. Montserrat, W. H. Wilson, M. Bahl, H. Zhao, L. Yang, J. Powell, R. Simon, W. C. Chan, and L. M. Staudt. 2006. Molecular diagnosis of Burkitt's lymphoma. N Engl J Med 354: 2431-42. 47. David, E., S. Y. Sun, E. K. Waller, J. Chen, F. R. Khuri, and S. Lonial. 2005. The combination of the farnesyl tran sferase inhibitor lonafarnib and the proteasome inhibitor bortezomib induces s ynergistic apoptosis in human myeloma cells that is associated with down-regulation of p-AKT. Blood 106: 4322-9. 48. De Vos, J., D. Hose, T. Reme, K. Tarte, J. Moreaux, K. Mahtouk, M. Jourdan, H. Goldschmidt, J. F. Rossi, F. W. Cremer, and B. Klein. 2006. Microarray-based understanding of normal and malignant plasma cells. Immunol Rev 210: 86-104. 49. DeKoter, R. P., H. J. Lee, and H. Singh. 2002. PU.1 regulates expression of the interleukin-7 receptor in ly mphoid progenitors. Immunity 16: 297-309. 50. DeKoter, R. P., and H. Singh. 2000. Regulation of B lymphocyte and macrophage development by graded expression of PU.1. Science 288: 1439-41.

PAGE 139

123 51. Delogu, A., A. Schebesta, Q. Sun, K. Aschenbrenner, T. Perlot, and M. Busslinger. 2006. Gene repression by Pax5 in B cells is essential for blood cell homeostasis and is reversed in plasma cells. Immunity 24: 269-81. 52. Dent, A. L., A. L. Shaffer, X. Yu D. Allman, and L. M. Staudt. 1997. Control of inflammation, cytokine expression, a nd germinal center formation by BCL-6. Science 276: 589-92. 53. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475-89. 54. Doody, G. M., S. Stephenson, and R. M. Tooze. 2006. BLIMP-1 is a target of cellular stress and downstream of the unf olded protein response. Eur J Immunol. 55. Downward, J. 2003. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer 3: 11-22. 56. Driggers, P. H., D. L. Ennist, S. L. Gleason, W. H. Mak, M. S. Marks, B. Z. Levi, J. R. Flanagan, E. Appella, and K. Ozato. 1990. An interferon gammaregulated protein that binds the interfer on-inducible enhancer element of major histocompatibility complex class I genes. Proc Natl Acad Sci U S A 87: 3743-7. 57. Eisenbeis, C. F., H. Singh, and U. Storb. 1995. Pip, a novel IRF family member, is a lymphoid-specific, PU.1-dependent transcriptional activator. Genes Dev 9: 1377-87. 58. Eklund, E. A., A. Jalava, and R. Kakar. 1998. PU.1, interferon regulatory factor 1, and interferon consensus sequencebinding protein cooperate to increase gp91(phox) expression. J Biol Chem 273: 13957-65. 59. End, D. W., G. Smets, A. V. Todd, T. L. Applegate, C. J. Fuery, P. Angibaud, M. Venet, G. Sanz, H. Poignet, S. Skrzat, A. Devine, W. Wouters, and C. Bowden. 2001. Characterization of the antitumor effects of the selective farnesyl protein transferase inhibitor R115777 in vivo and in vitro. Cancer Res 61: 131-7. 60. Engel, P., L. J. Zhou, D. C. Ord, S. Sato, B. Koller, and T. F. Tedder. 1995. Abnormal B lymphocyte development, activ ation, and differentiation in mice that lack or overexpress the CD19 signa l transduction molecule. Immunity 3: 39-50. 61. Escalante, C. R., A. L. Brass, J. M. Pongubala, E. Shatova, L. Shen, H. Singh, and A. K. Aggarwal. 2002. Crystal structure of PU.1/IRF-4/DNA ternary complex. Mol Cell 10: 1097-105. 62. Ettinger, R., G. P. Sims, A. M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, and P. E. Lipsky. 2005. IL-21 induces differentiation of human naive and memory B cells in to antibody-secreting plasma cells. J Immunol 175: 7867-79. 63. Evens, A. M., and L. I. Gordon. 2002. Burkitt's and Burkitt-like lymphoma. Curr Treat Options Oncol 3: 291-305. 64. Falini, B., M. Fizzotti, A. Pucciarini, B. Bigerna, T. Marafioti, M. Gambacorta, R. Pacini, C. Alunni, L. Nata li-Tanci, B. Ugolini, C. Sebastiani, G. Cattoretti, S. Pileri, R. Dalla-Favera, and H. Stein. 2000. A monoclonal antibody (MUM1p) detects expression of th e MUM1/IRF4 protein in a subset of germinal center B cells, plasma cells, and activated T cells. Blood 95: 2084-92.

PAGE 140

124 65. Farh, L., D. A. Mitchell, and R. J. Deschenes. 1995. Farnesylation and proteolysis are sequential, but distinct steps in the CaaX box modification pathway. Arch Biochem Biophys 318: 113-21. 66. Fears, S., C. Mathieu, N. Zeleznik -Le, S. Huang, J. D. Rowley, and G. Nucifora. 1996. Intergenic splici ng of MDS1 and EVI1 occurs in normal tissues as well as in myeloid leukemia and produces a new member of the PR domain family. Proc Natl Acad Sci U S A 93: 1642-7. 67. Fluckiger, A. C., Z. Li, R. M. Kato, M. I. Wahl, H. D. Ochs, R. Longnecker, J. P. Kinet, O. N. Witte, A. M. Scharenberg, and D. J. Rawlings. 1998. Btk/Tec kinases regulate su stained increases in intracellular Ca2+ following Bcell receptor activation. Embo J 17: 1973-85. 68. Futscher, B. W., N. E. Foley, M. C. Gleason-Guzman, P. S. Meltzer, D. M. Sullivan, and W. S. Dalton. 1996. Verapamil suppresses the emergence of Pglycoprotein-mediated multi-dr ug resistance. Int J Cancer 66: 520-5. 69. Garcia, J. F., G. Roncador, J. F. Garcia, A. I. Sanz, L. Maestre, E. Lucas, S. Montes-Moreno, R. Fernandez Victoria, J. L. Martinez-Torrecuadrara, T. Marafioti, D. Y. Mason, and M. A. Piris. 2006. PRDM1/BLIMP-1 expression in multiple B and T-cell lymphoma. Haematologica 91: 467-74. 70. Garrett-Sinha, L. A., G. H. Su, S. Rao, S. Kabak, Z. Hao, M. R. Clark, and M. C. Simon. 1999. PU.1 and Spi-B are required for normal B cell receptormediated signal transduction. Immunity 10: 399-408. 71. Garrone, P., E. M. Neidhardt, E. Garcia, L. Galibert, C. van Kooten, and J. Banchereau. 1995. Fas ligation induces apoptosis of CD40-activated human B lymphocytes. J Exp Med 182: 1265-73. 72. Gass, J. N., N. M. Gifford, and J. W. Brewer. 2002. Activation of an unfolded protein response during differentiation of antibody-secreting B cells. J Biol Chem 277: 49047-54. 73. Gerbitz, A., J. Mautner, C. Geltinger, K. Hortnagel, B. Christoph, H. Asenbauer, G. Klobeck, A. Polack, and G. W. Bornkamm. 1999. Deregulation of the proto-oncogene c-myc through t(8; 22) translocation in Burkitt's lymphoma. Oncogene 18: 1745-53. 74. Ghosh, N., I. Gyory, G. Wright, J. Wood, and K. L. Wright. 2001. Positive regulatory domain I binding f actor 1 silences class II tr ansactivator expression in multiple myeloma cells. J Biol Chem 276: 15264-8. 75. Ghosh, N., J. F. Piskurich, G. Wright K. Hassani, J. P. Ting, and K. L. Wright. 1999. A novel element and a TEF-2like element activate the major histocompatibility complex class II transa ctivator in B-lymphocytes. J Biol Chem 274: 32342-50. 76. Grogan, T. M., C. M. Spier, S. E. Salmon, M. Matzner, J. Rybski, R. S. Weinstein, R. J. Scheper, and W. S. Dalton. 1993. P-glycoprotein expression in human plasma cell myeloma: correla tion with prior chemotherapy. Blood 81: 4905. 77. Gross, A., J. M. McDonnell, and S. J. Korsmeyer. 1999. BCL-2 family members and the mitochondria in apoptosis. Genes Dev 13: 1899-911.

PAGE 141

125 78. Gupta, S., A. Anthony, and A. B. Pernis. 2001. Stage-specific modulation of IFN-regulatory factor 4 function by Kruppeltype zinc finger proteins. J Immunol 166: 6104-11. 79. Gupta, S., M. Jiang, A. An thony, and A. B. Pernis. 1999. Lineage-specific modulation of interleukin 4 signaling by in terferon regulatory factor 4. J Exp Med 190: 1837-48. 80. Gyory, I., G. Fejer, N. Ghosh, E. Seto, and K. L. Wright. 2003. Identification of a functionally impaired positive regulatory dom ain I binding factor 1 transcription repres sor in myeloma cell lines. J Immunol 170: 3125-33. 81. Gyory, I., J. Wu, G. Fejer, E. Seto, and K. L. Wright. 2004. PRDI-BF1 recruits the histone H3 methyltransferase G9a in transcriptional s ilencing. Nat Immunol 5: 299-308. 82. Ha, A. S., and R. D. Riddle. 2003. cBlimp-1 expression in chick limb bud development. Gene Expr Patterns 3: 297-300. 83. Hagman, J., and K. Lukin. 2006. Transcription factors drive B cell development. Curr Opin Immunol 18: 127-34. 84. Hallek, M., P. L. Bergsagel, and K. C. Anderson. 1998. Multiple myeloma: increasing evidence for a multistep transformation process. Blood 91: 3-21. 85. Hancock, J. F., A. I. Magee, J. E. Childs, and C. J. Marshall. 1989. All ras proteins are polyisopren ylated but only some are palmitoylated. Cell 57: 1167-77. 86. Hao, Z., and K. Rajewsky. 2001. Homeostasis of peripheral B cells in the absence of B cell influx from the bone marrow. J Exp Med 194: 1151-64. 87. Hasbold, J., and G. G. Klaus. 1990. Anti-immunoglobulin antibodies induce apoptosis in immature B ce ll lymphomas. Eur J Immunol 20: 1685-90. 88. Hata, K., T. Yoshimoto, and J. Mizuguchi. 2004. CD40 ligand rescues inhibitor of differentiation 3-mediated G1 arre st induced by anti-IgM in WEHI-231 B lymphoma cells. J Immunol 173: 2453-61. 89. Healy, J. I., and C. C. Goodnow. 1998. Positive versus negative signaling by lymphocyte antigen receptors. Annu Rev Immunol 16: 645-70. 90. Hecht, J. L., and J. C. Aster. 2000. Molecular biology of Burkitt's lymphoma. J Clin Oncol 18: 3707-21. 91. Heider, U., M. Kaiser, J. Sterz, I. Zavrski, C. Jakob, C. Fleissner, J. Eucker, K. Possinger, and O. Sezer. 2006. Histone deacetylase inhibitors reduce VEGF production and induce growth suppression and apoptosis in human mantle cell lymphoma. Eur J Haematol 76: 42-50. 92. Hernandez, L., S. Hernandez, S. Bea, M. Pinyol, A. Ferrer, F. Bosch, A. Nadal, P. L. Fernandez, A. Palacin, E. Montserrat, and E. Campo. 1999. cmyc mRNA expression and genomic alterations in mantle cell lymphomas and other nodal non-Hodgkin's lymphomas. Leukemia 13: 2087-93. 93. Hideshima, T., N. Nakamura, D. Chauhan, and K. C. Anderson. 2001. Biologic sequelae of interleukin-6 i nduced PI3-K/Akt signaling in multiple myeloma. Oncogene 20: 5991-6000.

PAGE 142

126 94. Himmelmann, A., A. Riva, G. L. Wilson, B. P. Lucas, C. Thevenin, and J. H. Kehrl. 1997. PU.1/Pip and basic helix loop helix zipper transcription factors interact with binding sites in the CD20 promoter to help c onfer lineageand stage-specific expression of CD20 in B lymphocytes. Blood 90: 3984-95. 95. Hoang, B., L. Zhu, Y. Shi, P. Frost, H. Yan, S. Sharma, S. Sharma, L. Goodglick, S. Dubinett, and A. Lichtenstein. 2006. Oncogenic RAS mutations in myeloma cells selectively induce c ox-2 expression, which participates in enhanced adhesion to fibronectin and chemoresistance. Blood 107: 4484-90. 96. Holford, J., P. Rogers, and L. R. Kelland. 1998. ras mutation and platinum resistance in human ovarian carcinomas in vitro. Int J Cancer 77: 94-100. 97. Holling, T. M., N. van der Stoep, E. Quinten, and P. J. van den Elsen. 2002. Activated human T cells accomplish MHC class II expression through T cellspecific occupation of cl ass II transactivator pr omoter III. J Immunol 168:763-70. 98. Horcher, M., A. Souabni, and M. Busslinger. 2001. Pax5/BSAP maintains the identity of B cells in late B lymphopoiesis. Immunity 14: 779-90. 99. Hornell, T. M., G. W. Beresford, A. Bushey, J. M. Boss, and E. D. Mellins. 2003. Regulation of the class II MHC path way in primary human monocytes by granulocyte-macrophage colony-s timulating factor. J Immunol 171: 2374-83. 100. Hsu, J., Y. Shi, S. Krajewski, S. Renner, M. Fisher, J. C. Reed, T. F. Franke, and A. Lichtenstein. 2001. The AKT kinase is activated in multiple myeloma tumor cells. Blood 98: 2853-5. 101. Igarashi, H., S. C. Gregory, T. Yoko ta, N. Sakaguchi, and P. W. Kincade. 2002. Transcription from the RAG1 locus marks the earliest lymphocyte progenitors in bone marrow. Immunity 17: 117-30. 102. Irish, J. M., D. K. Czerwinski, G. P. Nolan, and R. Levy. 2006. Kinetics of B cell receptor signaling in human B ce ll subsets mapped by phosphospecific flow cytometry. J Immunol 177: 1581-9. 103. Ishiai, M., M. Kurosaki, R. Pappu, K. Okawa, I. Ronko, C. Fu, M. Shibata, A. Iwamatsu, A. C. Chan, and T. Kurosaki. 1999. BLNK required for coupling Syk to PLC gamma 2 and Rac1-JNK in B cells. Immunity 10: 117-25. 104. Iwakoshi, N. N., A. H. Lee, and L. H. Glimcher. 2003. The X-box binding protein-1 transcription factor is required for plasma cell differentiation and the unfolded protein response. Immunol Rev 194: 29-38. 105. Iwakoshi, N. N., A. H. Lee, P. Vallabhajosyula, K. L. Otipoby, K. Rajewsky, and L. H. Glimcher. 2003. Plasma cell differentiati on and the unfolded protein response intersect at the transcri ption factor XBP-1. Nat Immunol 4: 321-9. 106. Jabbour, E., H. Kantarjian, and J. Cortes. 2004. Clinical activity of farnesyl transferase inhibitors in hematologic malignancies: possible mechanisms of action. Leuk Lymphoma 45: 2187-95. 107. Jansen, B., H. Schlagbauer-Wadl, H. G. Ei chler, K. Wolff, A. van Elsas, P. I. Schrier, and H. Pehamberger. 1997. Activated N-ras contributes to the chemoresistance of human melanoma in severe combined immunodeficiency (SCID) mice by blocking apoptosis. Cancer Res 57: 362-5.

PAGE 143

127 108. Jelinek, D. F., G. J. Ahmann, P. R. Greipp, S. M. Jalal J. J. Westendorf, J. A. Katzmann, R. A. Kyle, and J. A. Lust. 1993. Coexistence of aneuploid subclones within a myeloma cell line th at exhibits clonal immunoglobulin gene rearrangement: clinical implications. Cancer Res 53: 5320-7. 109. Jones, P. F., T. Jakubowicz, F. J. Pitossi, F. Maurer, and B. A. Hemmings. 1991. Molecular cloning and iden tification of a serine/thre onine protein kinase of the second-messenger subfamily. Proc Natl Acad Sci U S A 88: 4171-5. 110. Jumaa, H., B. Wollscheid, M. Mitterer, J. Wienands, M. Reth, and P. J. Nielsen. 1999. Abnormal development and func tion of B lymphocytes in mice deficient for the signaling adap tor protein SLP-65. Immunity 11: 547-54. 111. Kallies, A., E. D. Hawkins, G. T. Belz, D. Metcalf, M. Hommel, L. M. Corcoran, P. D. Hodgkin, and S. L. Nutt. 2006. Transcriptional repressor Blimp-1 is essential for T cell homeos tasis and self-tolerance. Nat Immunol 7: 466-74. 112. Kaptein, J. S., C. K. Lin, C. L. Wang, T. T. Nguyen, C. I. Kalunta, E. Park, F. S. Chen, and P. M. Lad. 1996. Anti-IgM-mediated regulation of c-myc and its possible relationship to apoptosis. J Biol Chem 271: 18875-84. 113. Karnell, F. G., R. J. Brezski, L. B. King, M. A. Silverman, and J. G. Monroe. 2005. Membrane cholesterol content accounts for developmental differences in surface B cell receptor compartmentali zation and signaling. J Biol Chem 280: 25621-8. 114. Karp, J. E., J. E. Lancet, S. H. Kaufmann, D. W. End, J. J. Wright, K. Bol, I. Horak, M. L. Tidwell, J. Liesveld, T. J. Kottke, D. Ange, L. Buddharaju, I. Gojo, W. E. Highsmith, R. T. Belly, R. J. Hohl, M. E. Rybak, A. Thibault, and J. Rosenblatt. 2001. Clinical and biologic activity of th e farnesyltransferase inhibitor R115777 in adults with refractor y and relapsed acute leukemias: a phase 1 clinical-laboratory co rrelative trial. Blood 97: 3361-9. 115. Kawano, M., T. Hirano, T. Matsuda, T. Taga, Y. Horii, K. Iwato, H. Asaoku, B. Tang, O. Tanabe, H. Tanaka, and et al. 1988. Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature 332: 83-5. 116. Keller, A. D., and T. Maniatis. 1991. Identification and characterization of a novel repressor of beta-interfer on gene expression. Genes Dev 5: 868-79. 117. Klippel, A., M. A. Escobedo, M. S. Wachowicz, G. Apell, T. W. Brown, M. A. Giedlin, W. M. Kavanaugh, and L. T. Williams. 1998. Activation of phosphatidylinositol 3-kinase is suffici ent for cell cycle entry and promotes cellular changes characte ristic of oncogenic tran sformation. Mol Cell Biol 18: 5699-711. 118. Knodel, M., A. W. Kuss, I. Berberich, and A. Schimpl. 2001. Blimp-1 overexpression abrogates IL-4and CD40-medi ated suppression of terminal B cell differentiation but arrests is otype switching. Eur J Immunol 31: 1972-80. 119. Knodel, M., A. W. Kuss, D. Lindema nn, I. Berberich, and A. Schimpl. 1999. Reversal of Blimp-1-mediated apoptosis by A1, a member of the Bcl-2 family. Eur J Immunol 29: 2988-98. 120. Kropff, M., G. Bisping, D. Wenning, W. E. Berdel, and J. Kienast. 2006. Proteasome inhibition in multiple myeloma. Eur J Cancer 42: 1623-39.

PAGE 144

128 121. Kuchtey, J., M. Pennini, R. K. Pai, and C. V. Harding. 2003. CpG DNA induces a class II transactivator-inde pendent increase in class II MHC by stabilizing class II MHC mRNA in B lymphocytes. J Immunol 171: 2320-5. 122. Kuss, A. W., M. Knodel, F. Berberich-Siebelt, D. Lindemann, A. Schimpl, and I. Berberich. 1999. A1 expression is stimu lated by CD40 in B cells and rescues WEHI 231 cells from anti-IgM-induced cell death. Eur J Immunol 29: 3077-88. 123. Lancet, J. E., and J. E. Karp. 2003. Farnesyltransferase inhibitors in hematologic malignancies: ne w horizons in therapy. Blood 102: 3880-9. 124. Landmann, S., A. Muhlethaler-Mottet, L. Bernasconi, T. Suter, J. M. Waldburger, K. Masternak, J. F. Arrighi, C. Hauser, A. Fontana, and W. Reith. 2001. Maturation of dendrit ic cells is accompanied by rapid transcriptional silencing of class II transactivat or (CIITA) expression. J Exp Med 194: 379-91. 125. Langdon, W. Y., A. W. Harris, S. Cory, and J. M. Adams. 1986. The c-myc oncogene perturbs B lymphocyte development in E-mu-myc transgenic mice. Cell 47: 11-8. 126. Lebowitz, P. F., D. Sakamuro, and G. C. Prendergast. 1997. Farnesyl transferase inhibitors induce apoptosis of Ras-transformed cells denied substratum attachment. Cancer Res 57: 708-13. 127. Leder, P., J. Battey, G. Lenoir, C. Moulding, W. Murphy, H. Potter, T. Stewart, and R. Taub. 1983. Translocations among antibody genes in human cancer. Science 222: 765-71. 128. Lee, C. H., M. Melchers, H. Wang, T. A. Torrey, R. Slota, C. F. Qi, J. Y. Kim, P. Lugar, H. J. Kong, L. Farrington B. van der Zouwen, J. X. Zhou, V. Lougaris, P. E. Lipsky, A. C. Grammer, and H. C. Morse, 3rd. 2006. Regulation of the germinal center gene program by in terferon (IFN) regulatory factor 8/IFN consensus sequence-binding protein. J Exp Med 203: 63-72. 129. Lee, S. C., A. Bottaro, and R. A. Insel. 2003. Activation of terminal B cell differentiation by inhibition of hi stone deacetylation. Mol Immunol 39: 923-32. 130. LeibundGut-Landmann, S., J. M. Waldburger, M. Krawczyk, L. A. Otten, T. Suter, A. Fontana, H. Acha-Orbea, and W. Reith. 2004. Mini-review: Specificity and expression of CIITA, the master regulator of MHC class II genes. Eur J Immunol 34: 1513-25. 131. Lentzsch, S., M. Chatterjee, M. Gries, K. Bommert, H. Gollasch, B. Dorken, and R. C. Bargou. 2004. PI3-K/AKT/FKHR and MAPK signaling cascades are redundantly stimulated by a variety of cy tokines and contribute independently to proliferation and survival of multiple myeloma cells. Leukemia 18: 1883-90. 132. Leonard, J. P., R. R. Furman, and M. Coleman. 2006. Proteasome inhibition with bortezomib: a new therapeutic st rategy for non-Hodgkin's lymphoma. Int J Cancer 119: 971-9. 133. Lerner, E. C., T. T. Zhang, D. B. Know les, Y. Qian, A. D. Hamilton, and S. M. Sebti. 1997. Inhibition of the prenylation of K-Ras, but not Hor N-Ras, is highly resistant to CAAX peptidomimetics and requires both a farnesyltransferase and a geranylgeranyltransferase I inhibito r in human tumor cell lines. Oncogene 15: 1283-8.

PAGE 145

129 134. Li, R., H. Pei, and D. K. Watson. 2000. Regulation of Ets function by protein protein interactions. Oncogene 19: 6514-23. 135. Li, X. J., K. Hata, and J. Mizuguchi. 2005. Engagement of membrane immunoglobulin enhances Id3 promoter ac tivity in WEHI-231 B lymphoma cells. Acta Pharmacol Sin 26: 486-91. 136. Li, Z., S. Van Calcar, C. Qu, W. K. Cavenee, M. Q. Zhang, and B. Ren. 2003. A global transcriptional regulatory role for c-Myc in Burkitt's lymphoma cells. Proc Natl Acad Sci U S A 100: 8164-9. 137. Lin, K. I., C. Angelin-Duclos, T. C. Kuo, and K. Calame. 2002. Blimp-1dependent repression of Pax-5 is requi red for differentiation of B cells to immunoglobulin M-secreting pl asma cells. Mol Cell Biol 22: 4771-80. 138. Lin, K. I., Y. Lin, and K. Calame. 2000. Repression of c-myc is necessary but not sufficient for terminal differentiation of B lymphocytes in vitro. Mol Cell Biol 20: 8684-95. 139. Lin, L., A. J. Gerth, and S. L. Peng. 2004. Active inhibition of plasma cell development in resting B ce lls by microphthalmia-associat ed transcription factor. J Exp Med 200: 115-22. 140. Lin, Y., K. Wong, and K. Calame. 1997. Repression of c-myc transcription by Blimp-1, an inducer of terminal B cell differentiation. Science 276: 596-9. 141. Linden, M., N. Kirchhof, C. Carlson, and B. Van Ness. 2004. Targeted overexpression of Bcl-XL in B-lymphoid cells results in lymphoproliferative disease and plasma cell malignancies. Blood 103: 2779-86. 142. Liu, J., and X. Ma. 2006. Interferon regul atory factor 8 regu lates RANTES gene transcription in cooperation with interferon re gulatory factor-1, NF-kappaB, and PU.1. J Biol Chem 281: 19188-95. 143. Liu, L., G. Shao, G. Steele-Perkins, and S. Huang. 1997. The retinoblastoma interacting zinc finger gene RIZ produ ces a PR domain-lacking product through an internal promoter. J Biol Chem 272: 2984-91. 144. Liu, P., T. Leong, L. Quam, D. Billadeau, N. E. Kay, P. Greipp, R. A. Kyle, M. M. Oken, and B. Van Ness. 1996. Activating mutations of Nand K-ras in multiple myeloma show different clinical associations: analysis of the Eastern Cooperative Oncology Group Phase III Trial. Blood 88: 2699-706. 145. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quan titative PCR and the 2(-D elta Delta C(T)) Method. Methods 25: 402-8. 146. Livi, C. B., and E. H. Davidson. 2006. Expression and func tion of blimp1/krox, an alternatively transcribed regulatory gene of the sea urchin endomesoderm network. Dev Biol 293: 513-25. 147. Lobell, R. B., C. A. Omer, M. T. Abrams, H. G. Bhimnathwala, M. J. Brucker, C. A. Buser, J. P. Davide, S. J. deSolms, C. J. Dinsmore, M. S. EllisHutchings, A. M. Kral, D. Liu, W. C. Lumma, S. V. Machotka, E. Rands, T. M. Williams, S. L. Graham, G. D. Hartman, A. I. Oliff, D. C. Heimbrook, and N. E. Kohl. 2001. Evaluation of farnesyl:protein transferase and geranylgeranyl:protein transferase inhibito r combinations in preclinical models. Cancer Res 61: 8758-68.

PAGE 146

130 148. Loder, F., B. Mutschler, R. J. Ray, C. J. Paige, P. Sideras, R. Torres, M. C. Lamers, and R. Carsetti. 1999. B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals. J Exp Med 190: 75-89. 149. Lopes-Carvalho, T., and J. F. Kearney. 2004. Development and selection of marginal zone B cells. Immunol Rev 197: 192-205. 150. Lotz, C., S. A. Mutallib, N. Oehlrich, U. Liewer, E. A. Ferreira, M. Moos, M. Hundemer, S. Schneider, S. Strand, C. Huber, H. Goldschmidt, and M. Theobald. 2005. Targeting positive regulatory domain I-binding factor 1 and X box-binding protein 1 transcription factors by multiple myeloma-reactive CTL. J Immunol 175: 1301-9. 151. Lovec, H., A. Grzeschiczek, M. B. Kowalski, and T. Moroy. 1994. Cyclin D1/bcl-1 cooperates with myc genes in the generation of B-cell lymphoma in transgenic mice. Embo J 13: 3487-95. 152. Lu, R., K. L. Medina, D. W. Lancki, and H. Singh. 2003. IRF-4,8 orchestrate the pre-B-to-B transition in ly mphocyte development. Genes Dev 17: 1703-8. 153. Ma, S. L., A. B. Sorensen, S. Kunder, K. D. Sorensen, L. QuintanillaMartinez, D. W. Morris, J. Schmidt, and F. S. Pedersen. 2006. The Icsbp locus is a common proviral insertion site in mature B-cell lymphomas/plasmacytomas induced by exogenous murine leukemia virus. Virology. 154. MacLennan, I. C. 1998. B-cell receptor regulation of peripheral B cells. Curr Opin Immunol 10: 220-5. 155. Maiso, P., X. Carvajal-Vergara, E. M. Ocio, R. Lopez-Perez, G. Mateo, N. Gutierrez, P. Atadja, A. Pand iella, and J. F. San Miguel. 2006. The histone deacetylase inhibitor LBH589 is a potent antimyeloma agent that overcomes drug resistance. Cancer Res 66: 5781-9. 156. Malumbres, M., and M. Barbacid. 2003. RAS oncogenes: the first 30 years. Nat Rev Cancer 3: 459-65. 157. Marecki, S., C. J. Riendeau, M. D. Liang, and M. J. Fenton. 2001. PU.1 and multiple IFN regulatory factor proteins synergize to mediate transcriptional activation of the human IL-1 beta gene. J Immunol 166: 6829-38. 158. Masih-Khan, E., S. Trudel, C. Heise, Z. Li, J. Paterson, V. Nadeem, E. Wei, D. Roodman, J. Claudio, L. Bergsagel, and A. K. Stewart. 2006. MIP1{alpha} (CCL3) is a Downstream Targ et of FGFR3 and RAS/MAPK Signaling in Multiple Myeloma. Blood. 159. Matsuyama, T., A. Grossman, H. W. Mitt rucker, D. P. Siderovski, F. Kiefer, T. Kawakami, C. D. Richardson, T. Taniguchi, S. K. Yoshinaga, and T. W. Mak. 1995. Molecular cloning of LSIRF, a lymphoid-specific member of the interferon regulatory factor family that binds the interferon-stimulated response element (ISRE). Nucleic Acids Res 23: 2127-36. 160. Matthias, P., and A. G. Rolink. 2005. Transcriptional ne tworks in developing and mature B cells. Nat Rev Immunol 5: 497-508. 161. McDevit, D. C., L. Perkins, M. L. Atchison, and B. S. Nikolajczyk. 2005. The Ig kappa 3' enhancer is activated by gradients of chromatin accessibility and protein association. J Immunol 174: 2834-42.

PAGE 147

131 162. McKercher, S. R., B. E. Torbett, K. L. Anderson, G. W. Henkel, D. J. Vestal, H. Baribault, M. Klemsz, A. J. Feene y, G. E. Wu, C. J. Paige, and R. A. Maki. 1996. Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. Embo J 15: 5647-58. 163. Melchers, F. 1997. B-lymphocyte-lineage cells from early precursors to Igsecreting plasma cells: targets of regulation by the myc/mad/max families of genes? Curr Top Microbiol Immunol 224: 19-30. 164. Messika, E. J., P. S. Lu, Y. J. Sung, T. Y ao, J. T. Chi, Y. H. Chien, and M. M. Davis. 1998. Differential effect of B lymphocyte-induced maturation protein (Blimp-1) expression on cell fate during B cell development. J Exp Med 188: 51525. 165. Mikkola, I., B. Heavey, M. Horcher, and M. Busslinger. 2002. Reversion of B cell commitment upon loss of Pax5 expression. Science 297: 110-3. 166. Mittrucker, H. W., T. Matsuyama, A. Grossman, T. M. Kundig, J. Potter, A. Shahinian, A. Wakeham, B. Patterson, P. S. Ohashi, and T. W. Mak. 1997. Requirement for the transcription fact or LSIRF/IRF4 for mature B and T lymphocyte function. Science 275: 540-3. 167. Mo, H., and C. E. Elson. 2004. Studies of the isoprenoi d-mediated inhibition of mevalonate synthesis applied to cancer chemotherapy and chemoprevention. Exp Biol Med (Maywood) 229: 567-85. 168. Mochizuki, N., S. Shimizu, T. N agasawa, H. Tanaka, M. Taniwaki, J. Yokota, and K. Morishita. 2000. A novel gene, MEL1, mapped to 1p36.3 is highly homologous to the MDS1/EVI1 gene an d is transcriptiona lly activated in t(1;3)(p36;q21)-positiv e leukemia cells. Blood 96: 3209-14. 169. Mueller, P. R., and B. Wold. 1989. In vivo footprinti ng of a muscle specific enhancer by ligation mediated PCR. Science 246: 780-6. 170. Muhlethaler-Mottet, A., L. A. Otten, V. Steimle, and B. Mach. 1997. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. Embo J 16: 2851-60. 171. Muller, S., P. Sideras, C. I. Smith, and K. G. Xanthopoulos. 1996. Cell specific expression of human Bruton's agammaglobulinemia tyrosine kinase gene (Btk) is regulated by Sp1and Spi-1/PU.1-family members. Oncogene 13: 195564. 172. Nagy, M., B. Chapuis, and T. Matthes. 2002. Expression of tr anscription factors Pu.1, Spi-B, Blimp-1, BSAP and oct-2 in normal human plasma cells and in multiple myeloma cells. Br J Haematol 116: 429-35. 173. Natkunam, Y., X. Zhang, Z. Liu, and S. Chen-Kiang. 1994. Simultaneous activation of Ig and Oct-2 synthesis and reduction of surface MHC class II expression by IL-6. J Immunol 153: 3476-84. 174. Nelson, N., M. S. Marks, P. H. Driggers, and K. Ozato. 1993. Interferon consensus sequence-binding protein, a memb er of the interferon regulatory factor family, suppresses interferon-induced gene transcription. Mol Cell Biol 13: 58899.

PAGE 148

132 175. Nemazee, D., and M. Weigert. 2000. Revising B cell receptors. J Exp Med 191: 1813-7. 176. Nera, K. P., P. Kohonen, E. Narvi, A. Peippo, L. Mustonen, P. Terho, K. Koskela, J. M. Buers tedde, and O. Lassila. 2006. Loss of Pax5 promotes plasma cell differentiation. Immunity 24: 283-93. 177. Neri, A., F. Barriga, D. M. Knowles, I. T. Magrath, and R. Dalla-Favera. 1988. Different regions of the immunoglobulin heavy-chain locus are involved in chromosomal translocations in distinct pathogenetic forms of Burkitt lymphoma. Proc Natl Acad Sci U S A 85: 2748-52. 178. Neri, A., J. P. Murphy, L. Cro, D. Ferrero, C. Tarella, L. Baldini, and R. Dalla-Favera. 1989. Ras oncogene mutation in multiple myeloma. J Exp Med 170: 1715-25. 179. Nesbit, C. E., J. M. Tersak, and E. V. Prochownik. 1999. MYC oncogenes and human neoplastic disease. Oncogene 18: 3004-16. 180. Ng, T., F. Yu, and S. Roy. 2006. A homologue of the vertebrate SET domain and zinc finger protein Blimp-1 regulates te rminal differentiation of the tracheal system in the Drosophila embryo. Dev Genes Evol 216: 243-52. 181. Nutt, S. L., B. Heavey, A. G. Rolink, and M. Busslinger. 1999. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 401: 55662. 182. O'Connor, O. A., J. Wright, C. Moskowit z, J. Muzzy, B. Ma cGregor-Cortelli, M. Stubblefield, D. Straus, C. Portlock P. Hamlin, E. Choi, O. Dumetrescu, D. Esseltine, E. Trehu, J. Adams, D. Schenkein, and A. D. Zelenetz. 2005. Phase II clinical experience with the novel proteasome inhibitor bortezomib in patients with indolent non-Hodgkin's lym phoma and mantle cell lymphoma. J Clin Oncol 23: 676-84. 183. O'Reilly, D., C. M. Quinn, T. El-Shana wany, S. Gordon, a nd D. R. Greaves. 2003. Multiple Ets factors and interferon regulatory factor-4 modulate CD68 expression in a cell type-specific manner. J Biol Chem 278: 21909-19. 184. Obeng, E. A., L. M. Carlson, D. M. Gu tman, W. J. Harrington, Jr., K. P. Lee, and L. H. Boise. 2006. Proteasome inhibitors i nduce a terminal unfolded protein response in multiple myeloma cells. Blood 107: 4907-16. 185. Ohkubo, Y., M. Arima, E. Arguni, S. Okada, K. Yamashita, S. Asari, S. Obata, A. Sakamoto, M. Hatano, O. W. J, M. Ebara, H. Saisho, and T. Tokuhisa. 2005. A role for c-fos/activator pr otein 1 in B lymphocyte terminal differentiation. J Immunol 174: 7703-10. 186. Okada, T., A. Maeda, A. Iwamatsu, K. Gotoh, and T. Kurosaki. 2000. BCAP: the tyrosine kinase substrate that co nnects B cell receptor to phosphoinositide 3kinase activation. Immunity 13: 817-27. 187. Oliver, A. M., F. Martin, and J. F. Kearney. 1999. IgMhighCD21high lymphocytes enriched in the splenic margin al zone generate effector cells more rapidly than the bulk of fo llicular B cells. J Immunol 162: 7198-207. 188. Ortiz, M. A., J. Light, R. A. Maki, and N. Assa-Munt. 1999. Mutatio n analysis of the Pip interaction domain reveals cr itical residues fo r protein-protein interactions. Proc Natl Acad Sci U S A 96: 2740-5.

PAGE 149

133 189. Oshiro, M. M., T. H. Landowski, R. Ca tlett-Falcone, L. A. Hazlehurst, M. Huang, R. Jove, and W. S. Dalton. 2001. Inhibition of JAK kinase activity enhances Fas-mediated apoptosis but redu ces cytotoxic activity of topoisomerase II inhibitors in U266 myelom a cells. Clin Cancer Res 7: 4262-71. 190. Otero, D. C., and R. C. Rickert. 2003. CD19 function in early and late B cell development. II. CD19 facilitates th e pro-B/pre-B tran sition. J Immunol 171: 5921-30. 191. Otto, J. C., E. Kim, S. G. Young, and P. J. Casey. 1999. Cloning and characterization of a mammalian prenyl pr otein-specific protease. J Biol Chem 274: 8379-82. 192. Ozaki, K., R. Spolski, R. Ettinger, H. P. Kim, G. Wang, C. F. Qi, P. Hwu, D. J. Shaffer, S. Akilesh, D. C. Roopenian, H. C. Morse, 3rd, P. E. Lipsky, and W. J. Leonard. 2004. Regulation of B cell differentiation and plasma cell generation by IL-21, a novel inducer of Blimp-1 and Bcl-6. J Immunol 173: 536171. 193. Pan, L., S. Sato, J. P. Frederi ck, X. H. Sun, and Y. Zhuang. 1999. Impaired immune responses and B-cell proliferati on in mice lacking the Id3 gene. Mol Cell Biol 19: 5969-80. 194. Pappu, R., A. M. Cheng, B. Li, Q. Gong, C. Chiu, N. Griffin, M. White, B. P. Sleckman, and A. C. Chan. 1999. Requirement for B cell linker protein (BLNK) in B cell development. Science 286: 1949-54. 195. Pasqualucci, L., M. Compagno, J. Houldsworth, S. Monti, A. Grunn, S. V. Nandula, J. C. Aster, V. V. Murty, M. A. Shipp, and R. Dalla-Favera. 2006. Inactivation of the PRDM1/BLIMP1 gene in diffuse large B cell lymphoma. J Exp Med 203: 311-7. 196. Perez-Galan, P., G. Roue, N. Villamor, E. Montserrat, E. Campo, and D. Colomer. 2006. The proteasome inhibitor bo rtezomib induces apoptosis in mantle-cell lymphoma through genera tion of ROS and Noxa activation independent of p53 status. Blood 107: 257-64. 197. Petros, A. M., E. T. Ole jniczak, and S. W. Fesik. 2004. Structural biology of the Bcl-2 family of proteins. Biochim Biophys Acta 1644: 83-94. 198. Pettersson, M., C. Sundstrom, K. Nilsson, and L. G. Larsson. 1995. The hematopoietic transcription factor PU .1 is downregulated in human multiple myeloma cell lines. Blood 86: 2747-53. 199. Pfeifer, G. P., R. L. Tanguay, S. D. Steigerwald, and A. D. Riggs. 1990. In vivo footprint and methylation analys is by PCR-aided genomic sequencing: comparison of active and inactive X chromosomal DNA at the CpG island and promoter of human PGK-1. Genes Dev 4: 1277-87. 200. Phan, T. G., S. Gardam, A. Basten, and R. Brink. 2005. Altered migration, recruitment, and somatic hypermutation in the early response of marginal zone B cells to T cell-dependent antigen. J Immunol 174:4567-78. 201. Pillai, S., A. Cariappa, and S. T. Moran. 2005. Marginal zone B cells. Annu Rev Immunol 23: 161-96.

PAGE 150

134 202. Piskurich, J. F., K. I. Lin, Y. Lin, Y. Wang, J. P. Ting, and K. Calame. 2000. BLIMP-I mediates extinction of major hist ocompatibility class II transactivator expression in plasma cells. Nat Immunol 1: 526-32. 203. Pongubala, J. M., S. Nagulapalli, M. J. Klemsz, S. R. McKercher, R. A. Maki, and M. L. Atchison. 1992. PU.1 recruits a second nuclear factor to a site important for immunoglobulin kappa 3' enhancer activity. Mol Cell Biol 12: 36878. 204. Portier, M., J. P. Moles, G. R. Mazars, P. Jeanteur, R. Bataille, B. Klein, and C. Theillet. 1992. p53 and RAS gene mutations in multiple myeloma. Oncogene 7: 2539-43. 205. Puthier, D., S. Derenne, S. Barille, P. Moreau, J. L. Harousseau, R. Bataille, and M. Amiot. 1999. Mcl-1 and Bcl-xL are co -regulated by IL-6 in human myeloma cells. Br J Haematol 107: 392-5. 206. Rasmussen, T., M. Kuehl, M. Lodahl, H. E. Johnsen, and I. M. Dahl. 2005. Possible roles for activating RAS mutations in the MGUS to MM transition and in the intramedullary to extramedullary transition in some plasma cell tumors. Blood 105: 317-23. 207. Reed, J. C. 1999. Dysregulation of apoptosis in cancer. J Clin Oncol 17: 2941-53. 208. Reed, J. C., and M. Pellecchia. 2005. Apoptosis-based therapies for hematologic malignancies. Blood 106: 408-18. 209. Reimold, A. M., N. N. Iwakoshi J. Manis, P. Vallabhajosyula, E. Szomolanyi-Tsuda, E. M. Gravallese, D. Fr iend, M. J. Grusby, F. Alt, and L. H. Glimcher. 2001. Plasma cell differentiation requires the transcription factor XBP-1. Nature 412: 300-7. 210. Reimold, A. M., P. D. Ponath, Y. S. Li, R. R. Hardy, C. S. David, J. L. Strominger, and L. H. Glimcher. 1996. Transcription fa ctor B cell lineagespecific activator protein regulates the gene for human X-bo x binding protein 1. J Exp Med 183: 393-401. 211. Reljic, R., S. D. Wagner, L. J. Peakman, and D. T. Fearon. 2000. Suppression of signal transducer and activator of transcripti on 3-dependent B lymphocyte terminal differentiation by BCL-6. J Exp Med 192: 1841-8. 212. Rodriguez-Viciana, P., P. H. Warne, R. Dhand, B. Vanhaesebroeck, I. Gout, M. J. Fry, M. D. Waterfield, and J. Downward. 1994. Phosphatidylinositol-3OH kinase as a direct target of Ras. Nature 370: 527-32. 213. Rolink, A. G., J. Andersson, and F. Melchers. 2004. Molecular mechanisms guiding late stages of B-ce ll development. Immunol Rev 197: 41-50. 214. Rosenwald, A., and L. M. Staudt. 2003. Gene expression profiling of diffuse large B-cell lymphoma. Leuk Lymphoma 44 Suppl 3: S41-7.

PAGE 151

135 215. Rosenwald, A., G. Wright, W. C. Chan, J. M. Connors, E. Campo, R. I. Fisher, R. D. Gascoyne, H. K. Mulle r-Hermelink, E. B. Smeland, J. M. Giltnane, E. M. Hurt, H. Zhao, L. Av erett, L. Yang, W. H. Wilson, E. S. Jaffe, R. Simon, R. D. Klausner, J. Po well, P. L. Duffey, D. L. Longo, T. C. Greiner, D. D. Weisenburger, W. G. Sa nger, B. J. Dave, J. C. Lynch, J. Vose, J. O. Armitage, E. Montserrat, A. Lopez-Guillermo, T. M. Grogan, T. P. Miller, M. LeBlanc, G. Ott, S. Kvaloy, J. Delabie, H. Holte, P. Krajci, T. Stokke, and L. M. Staudt. 2002. The use of molecular profiling to predict survival after chemotherapy for diffuse large-B-cell lymphoma. N Engl J Med 346: 1937-47. 216. Rowley, M., P. Liu, and B. Van Ness. 2000. Heterogeneity in therapeutic response of genetically altered myel oma cell lines to interleukin 6, dexamethasone, doxorubicin, and melphalan. Blood 96: 3175-80. 217. Roy, S., and T. Ng. 2004. Blimp-1 specifies neur al crest and sensory neuron progenitors in the zebrafish embryo. Curr Biol 14: 1772-7. 218. Sakajiri, S., T. Kumagai, N. Kawamat a, T. Saitoh, J. W. Said, and H. P. Koeffler. 2005. Histone deacetylase inhibitors profoundly decrease proliferation of human lymphoid cancer cell lines. Exp Hematol 33: 53-61. 219. Sanchez-Beato, M., A. Sanchez-Aguilera, and M. A. Piris. 2003. Cell cycle deregulation in B-cell lymphomas. Blood 101: 1220-35. 220. Sartoris, S., G. Tosi, A. De Lerma Ba rbaro, T. Cestari, and R. S. Accolla. 1996. Active suppression of the class II tr ansactivator-encoding AIR-1 locus is responsible for the lack of major histocompatibility complex class II gene expression observed during di fferentiation from B cells to plasma cells. Eur J Immunol 26: 2456-60. 221. Schiavoni, G., F. Mattei, P. Borghi, P. Sestili, M. Venditti, H. C. Morse, 3rd, F. Belardelli, and L. Gabriele. 2004. ICSBP is critically involved in the normal development and trafficking of Langerhan s cells and dermal dendritic cells. Blood 103: 2221-8. 222. Schlesinger, P. H., A. Gross, X. M. Yin, K. Yamamoto, M. Saito, G. Waksman, and S. J. Korsmeyer. 1997. Comparison of the ion channel characteristics of proapoptotic BAX and antiapoptotic BCL-2. Proc Natl Acad Sci U S A 94: 11357-62. 223. Schliephake, D. E., and A. Schimpl. 1996. Blimp-1 overcomes the block in IgM secretion in lipopolysaccharide/anti-mu F(ab')2-co-stimulated B lymphocytes. Eur J Immunol 26: 268-71. 224. Schmidt, E. V. 1999. The role of c-myc in cellu lar growth control. Oncogene 18: 2988-96. 225. Schroder, M., and R. J. Kaufman. 2005. The mammalian unfolded protein response. Annu Rev Biochem 74: 739-89. 226. Schweitzer, B. L., and R. P. DeKoter. 2004. Analysis of gene expression and Ig transcription in PU.1/Spi-B-deficien t progenitor B cell lines. J Immunol 172: 14454.

PAGE 152

136 227. Scott, E. W., M. C. Simon, J. Anastasi, and H. Singh. 1994. Requirement of transcription factor PU.1 in the devel opment of multiple hematopoietic lineages. Science 265: 1573-7. 228. Sebti, S. M., and A. D. Hamilton. 2000. Farnesyltransferase and geranylgeranyltransferase I inhibitors in cancer therapy: important mechanistic and bench to bedside issues. Expert Opin Investig Drugs 9: 2767-82. 229. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, J. M. Giltnane, L. Yang, H. Zhao, K. Calame, and L. M. Staudt. 2002. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17: 51-62. 230. Shaffer, A. L., A. Rosenwald, and L. M. Staudt. 2002. Lymphoid malignancies: the dark side of B-cell differentiation. Nat Rev Immunol 2: 920-32. 231. Shaffer, A. L., and M. S. Schlissel. 1997. A truncated heavy chain protein relieves the requirement for surrogate light chains in early B cell development. J Immunol 159: 1265-75. 232. Shaffer, A. L., M. Shapiro-Shelef, N. N. Iwakoshi, A. H. Lee, S. B. Qian, H. Zhao, X. Yu, L. Yang, B. K. Tan, A. Ro senwald, E. M. Hurt E. Petroulakis, N. Sonenberg, J. W. Yewdell, K. Calame, L. H. Glimcher, and L. M. Staudt. 2004. XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases protein synthesis in pl asma cell differentiation. Immunity 21: 81-93. 233. Shaffer, A. L., G. Wright, L. Yang, J. Powe ll, V. Ngo, L. Lamy, L. T. Lam, R. E. Davis, and L. M. Staudt. 2006. A library of gene expression signatures to illuminate normal and pathological lymphoid biology. Immunol Rev 210: 67-85. 234. Shaffer, A. L., X. Yu, Y. He, J. Boldri ck, E. P. Chan, and L. M. Staudt. 2000. BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity 13: 199-212. 235. Shapiro-Shelef, M., and K. Calame. 2004. Plasma cell differentiation and multiple myeloma. Curr Opin Immunol 16: 226-34. 236. Shapiro-Shelef, M., and K. Calame. 2005. Regulation of plasma-cell development. Nat Rev Immunol 5: 230-42. 237. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams J. Liao, M. G. McHeyzer-Williams, and K. Calame. 2003. Blimp-1 is required for the formation of immunoglobulin secreting pl asma cells and pre-plasma memory B cells. Immunity 19: 607-20. 238. Shen, Y., J. Iqbal, L. Xiao, R. C. Lync h, A. Rosenwald, L. M. Staudt, S. Sherman, K. Dybkaer, G. Zhou, J. D. Eudy, J. Delabie, T. W. McKeithan, and W. C. Chan. 2004. Distinct gene expression profiles in different B-cell compartments in human periphera l lymphoid organs. BMC Immunol 5: 20. 239. Silacci, P., A. Mottet, V. Steimle, W. Reith, and B. Mach. 1994. Developmental extinction of major histocompatibility complex class II gene expression in plasmocytes is mediated by silencing of the tr ansactivator gene CIITA. J Exp Med 180: 1329-36.

PAGE 153

137 240. Sillman, A. L., and J. G. Monroe. 1994. Surface IgM-stimulated proliferation, inositol phospholipid hydrolysis, Ca2+ flux, and tyrosine phosphorylation are not altered in B cells from p 59fyn-1mice. J Leukoc Biol 56: 812-6. 241. Spets, H., T. Stromberg, P. Georgii-Hemming, J. Siljason, K. Nilsson, and H. Jernberg-Wiklund. 2002. Expression of the bcl-2 family of proand antiapoptotic genes in multiple myeloma a nd normal plasma cells: regulation during interleukin-6(IL-6)-induced growth and survival. Eur J Haematol 69: 76-89. 242. Splawski, J. B., L. M. McA nally, and P. E. Lipsky. 1990. IL-2 dependence of the promotion of human B cell differe ntiation by IL-6 (BSF-2). J Immunol 144: 562-9. 243. Sproul, T. W., S. Malapati, J. Kim, and S. K. Pierce. 2000. Cutting edge: B cell antigen receptor signaling occurs outside lipid rafts in immature B cells. J Immunol 165: 6020-3. 244. Su, G. H., H. M. Chen, N. Muthusamy, L. A. Garrett-Sinha, D. Baunoch, D. G. Tenen, and M. C. Simon. 1997. Defective B cell recep tor-mediated responses in mice lacking the Ets protein, Spi-B. Embo J 16: 7118-29. 245. Sun, J., M. A. Blaskovich, D. Knowles, Y. Qian, J. Ohkanda, R. D. Bailey, A. D. Hamilton, and S. M. Sebti. 1999. Antitumor efficacy of a novel class of nonthiol-containing peptidomimetic inhi bitors of farnesyltransferase and geranylgeranyltransferase I: combinati on therapy with the cytotoxic agents cisplatin, Taxol, and gemcitabine. Cancer Res 59: 4919-26. 246. Sun, J., Y. Qian, A. D. Hamilton, and S. M. Sebti. 1998. Both farnesyltransferase and geranylgeranyltran sferase I inhibitors are required for inhibition of oncogenic K-Ras prenylation but each alone is sufficient to suppress human tumor growth in nude mouse xenografts. Oncogene 16: 1467-73. 247. Sun, J., Y. Qian, A. D. Hamilton, and S. M. Sebti. 1995. Ras CAAX peptidomimetic FTI 276 selectively blocks tumor growth in nude mice of a human lung carcinoma with K-Ras mu tation and p53 deletion. Cancer Res 55: 4243-7. 248. Szakacs, G., J. K. Paterson, J. A. Lu dwig, C. Booth-Genthe, and M. M. Gottesman. 2006. Targeting multidrug resistance in cancer. Nat Rev Drug Discov 5: 219-34. 249. Szegezdi, E., S. E. Logue, A. M. Gorman, and A. Samali. 2006. Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep 7: 880-5. 250. Takata, M., and T. Kurosaki. 1996. A role for Bruton's tyrosine kinase in B cell antigen receptor-mediate d activation of phospholipase C-gamma 2. J Exp Med 184: 31-40. 251. Tam, W., M. Gomez, A. Chadburn, J. W. Lee, W. C. Ch an, and D. M. Knowles. 2006. Mutational analysis of PRDM1 indicates a tumor-suppressor role in diffuse large B-cell lymphomas. Blood 107: 4090-100. 252. Tamura, T., H. J. Kong, C. Tunyaplin H. Tsujimura, K. Calame, and K. Ozato. 2003. ICSBP/IRF-8 inhibits mit ogenic activity of p210 Bcr/Abl in differentiating myeloid progenitor cells. Blood 102: 4547-54.

PAGE 154

138 253. Tarte, K., J. De Vos, T. Thykjaer, F. Zhan, G. Fiol, V. Costes, T. Reme, E. Legouffe, J. F. Rossi, J. Shaughnessy, Jr., T. F. Orntoft, and B. Klein. 2002. Generation of polyclonal plasmablasts from peripheral blood B cells: a normal counterpart of malignant plasmablasts. Blood 100: 1113-22. 254. Tarte, K., M. Jourdan, J. L. Veyrune, I. Berberich, G. Fiol, N. Redal, J. Shaughnessy, Jr., and B. Klein. 2004. The Bcl-2 family member Bfl-1/A1 is strongly repressed in normal and maligna nt plasma cells but is a potent antiapoptotic factor for myeloma cells. Br J Haematol 125: 373-82. 255. Texido, G., I. H. Su, I. Mecklenbrauker, K. Saijo, S. N. Malek, S. Desiderio, K. Rajewsky, and A. Tarakhovsky. 2000. The B-cell-specific Src-family kinase Blk is dispensable for B-cell development and activation. Mol Cell Biol 20: 122733. 256. Thibault, A., D. Samid, A. C. Tompkins, W. D. Figg, M. R. Cooper, R. J. Hohl, J. Trepel, B. Liang, N. Patronas, D. J. Venzon, E. Reed, and C. E. Myers. 1996. Phase I study of lovastatin, an inhibitor of the mevalonate pathway, in patients with cancer. Clin Cancer Res 2: 483-91. 257. Thomas, M. D., B. Sriv astava, and D. Allman. 2006. Regulation of peripheral B cell maturation. Cell Immunol 239: 92-102. 258. Torres, R. M., H. Flaswinkel, M. Reth, and K. Rajewsky. 1996. Aberrant B cell development and imm une response in mice with a compromised BCR complex. Science 272: 1804-8. 259. Tsujimura, H., T. Tamura, C. Gongora, J. Aliberti, C. Reis e Sousa, A. Sher, and K. Ozato. 2003. ICSBP/IRF-8 retrov irus transduction re scues dendritic cell development in vitro. Blood 101: 961-9. 260. Tu, Y., A. Gardner, and A. Lichtenstein. 2000. The phosphatidylinositol 3kinase/AKT kinase pathway in multiple my eloma plasma cells: roles in cytokinedependent survival and prolif erative responses. Cancer Res 60: 6763-70. 261. Tu, Y., S. Renner, F. Xu, A. Fleishma n, J. Taylor, J. Weisz, R. Vescio, M. Rettig, J. Berenson, S. Krajewski, J. C. Reed, and A. Lichtenstein. 1998. BCL-X expression in multiple myeloma: possible indicator of chemoresistance. Cancer Res 58: 256-62. 262. Tunyaplin, C., A. L. Shaffer, C. D. An gelin-Duclos, X. Yu, L. M. Staudt, and K. L. Calame. 2004. Direct repression of prdm1 by Bcl-6 inhibits plasmacytic differentiation. J Immunol 173: 1158-65. 263. Turner, C. A., Jr., D. H. Mack, and M. M. Davis. 1994. Blimp-1, a novel zinc finger-containing protein th at can drive the maturati on of B lymphocytes into immunoglobulin-secreting cells. Cell 77: 297-306. 264. Turner, M., A. Gulbranson-Judge, M. E. Quinn, A. E. Walters, I. C. MacLennan, and V. L. Tybulewicz. 1997. Syk tyrosine ki nase is required for the positive selection of immature B cells into the recirculati ng B cell pool. J Exp Med 186: 2013-21. 265. Turner, M., P. J. Mee, P. S. Costello, O. Williams, A. A. Price, L. P. Duddy, M. T. Furlong, R. L. Geahlen, and V. L. Tybulewicz. 1995. Perinatal lethality and blocked B-cell development in mice l acking the tyrosine kinase Syk. Nature 378: 298-302.

PAGE 155

139 266. Urbanek, P., Z. Q. Wang, I. Fetka, E. F. Wagner, and M. Busslinger. 1994. Complete block of early B cell differentiation and altered patterning of the posterior midbrain in mice lacking Pax5/BSAP. Cell 79: 901-12. 267. Usui, T., Y. Wakatsuki, Y. Matsunaga, S. Kaneko, H. Koseki, and T. Kita. 1997. Overexpression of B cell-specific activator protein (BSAP/Pax-5) in a late B cell is sufficient to suppress differentia tion to an Ig high producer cell with plasma cell phenotype. J Immunol 158: 3197-204. 268. van de Donk, N. W. C. J., H. M. Lokhorst, and A. C. Bloem. 2005. Growth factors and antiapoptotic signaling pa thways in multiple myeloma. 19: 21772185. 269. van den Elsen, P. J., T. M. Holling, H. F. Kuipers, and N. van der Stoep. 2004. Transcriptional regulation of antig en presentation. Curr Opin Immunol 16: 67-75. 270. van der Stoep, N., E. Quinten, M. Marcondes Rezende, and P. J. van den Elsen. 2004. E47, IRF-4, and PU.1 synergize to induce B-cell-specific activation of the class II transactivator promoter III (CIITA-PIII). Blood 104: 2849-57. 271. Vasanwala, F. H., S. Kusam, L. M. Toney, and A. L. Dent. 2002. Repression of AP-1 function: a mechanism for the regulation of Blimp-1 expression and B lymphocyte differentiation by the B cell lymphoma-6 protooncogene. J Immunol 169: 1922-9. 272. Vega, F., C. C. Chang, L. J. Medeiros, M. M. Udden, J. H. Cho-Vega, C. C. Lau, C. J. Finch, R. A. Vilchez, D. McGregor, and J. L. Jorgensen. 2005. Plasmablastic lymphomas and plasmablastic plasma cell myelomas have nearly identical immunophenotypic profiles. Mod Pathol 18: 806-15. 273. Vogt, A., Y. Qian, T. F. McGuire, A. D. Hamilton, and S. M. Sebti. 1996. Protein geranylgeranylation, not farnesylation, is required for the G1 to S phase transition in mouse fi broblasts. Oncogene 13: 1991-9. 274. Vojtek, A. B., S. M. Holl enberg, and J. A. Cooper. 1993. Mammalian Ras interacts directly with the seri ne/threonine kinase Raf. Cell 74: 205-14. 275. Weisenburger, D. D., and J. O. Armitage. 1996. Mantle cell lymphoma-an entity comes of age. Blood 87: 4483-94. 276. Weisz, A., S. Kirchhoff, and B. Z. Levi. 1994. IFN consensus sequence binding protein (ICSBP) is a conditional repres sor of IFN inducible promoters. Int Immunol 6: 1125-31. 277. Weisz, A., P. Marx, R. Sharf, E. Appella, P. H. Driggers, K. Ozato, and B. Z. Levi. 1992. Human interferon consensus sequence binding protein is a negative regulator of enhancer elements common to interferon-inducib le genes. J Biol Chem 267: 25589-96. 278. Whyte, D. B., P. Kirschmeier, T. N. Hockenberry, I. Nunez-Oliva, L. James, J. J. Catino, W. R. Bishop, and J. K. Pai. 1997. Kand N-Ras are geranylgeranylated in cells treated with fa rnesyl protein transferase inhibitors. J Biol Chem 272: 14459-64. 279. Williams, M. E., and J. J. Densmore. 2005. Biology and therapy of mantle cell lymphoma. Curr Opin Oncol 17: 425-31.

PAGE 156

140 280. Willumsen, B. M., A. Christensen, N. L. Hubbert, A. G. Papageorge, and D. R. Lowy. 1984. The p21 ras C-terminus is required for transformation and membrane association. Nature 310: 583-6. 281. Wong, A. W., N. Ghosh, K. P. McKinnon, W. Reed, J. F. Piskurich, K. L. Wright, and J. P. Ting. 2002. Regulation and specific ity of MHC2TA promoter usage in human primary T lymphocytes and cell line. J Immunol 169: 3112-9. 282. Wright, K. L., and J. P. Ting. 1992. In vivo footprint an alysis of the HLA-DRA gene promoter: cell-specific interaction at the octamer site an d up-regulation of X box binding by interferon gamma. Proc Natl Acad Sci U S A 89: 7601-5. 283. Wuarin, J., and U. Schibler. 1994. Physical isolation of nascent RNA chains transcribed by RNA polymerase II: eviden ce for cotranscriptional splicing. Mol Cell Biol 14: 7219-25. 284. Wurster, A. L., V. L. Rodgers, M. F. White, T. L. Rothstein, and M. J. Grusby. 2002. Interleukin-4-mediated prot ection of primary B cells from apoptosis through Stat6-dependent up-re gulation of Bcl-xL. J Biol Chem 277: 27169-75. 285. Xing, J., D. D. Ginty, and M. E. Greenberg. 1996. Coupling of the RAS-MAPK pathway to gene activation by RSK2, a growth factor-regulated CREB kinase. Science 273: 959-63. 286. Xinh, P. T., N. K. Tri, H. Nagao, H. Na kazato, F. Taketazu, S. Fujisawa, F. Yagasaki, Y. Z. Chen, Y. Hayashi, A. Toyoda, M. Hattori, Y. Sakaki, K. Tokunaga, and Y. Sato. 2003. Breakpoints at 1p36.3 in three MDS/AML(M4) patients with t(1;3)(p36;q21) occur in th e first intron and in the 5' region of MEL1. Genes Chromosomes Cancer 36: 313-6. 287. Xu, S., and K. P. Lam. 2002. Delayed cellular maturation and decreased immunoglobulin kappa light chain producti on in immature B lymphocytes lacking B cell linker protein. J Exp Med 196: 197-206. 288. Xu, S., J. E. Tan, E. P. Wong, A. Manickam, S. Ponniah, and K. P. Lam. 2000. B cell development and activation defects resulting in xid-like immunodeficiency in BLNK/SLP-65-deficient mice. Int Immunol 12: 397-404. 289. Yamagata, T., J. Nishida, S. Tanaka, R. Sakai, K. Mitani, M. Yoshida, T. Taniguchi, Y. Yazaki, and H. Hirai. 1996. A novel interferon regulatory factor family transcription factor, ICSAT/Pip/LSIRF, that negatively regulates the activity of interferon-regulated genes. Mol Cell Biol 16: 1283-94. 290. Yamazaki, T., K. Takeda, K. Gotoh, H. Takeshima, S. Akira, and T. Kurosaki. 2002. Essential immunoregulator y role for BCAP in B cell development and function. J Exp Med 195: 535-45. 291. Yang, X. H., and S. Huang. 1999. PFM1 (PRDM4), a new member of the PRdomain family, maps to a tumor suppressor locus on human chromosome 12q23q24.1. Genomics 61: 319-25. 292. Ye, B. H., F. Lista, F. Lo Coco, D. M. Knowles, K. Offit, R. S. Chaganti, and R. Dalla-Favera. 1993. Alterations of a zinc fi nger-encoding gene, BCL-6, in diffuse large-cell lymphoma. Science 262: 747-50.

PAGE 157

141 293. Ying, H., J. I. Healy, C. C. Goodnow, and J. R. Parnes. 1998. Regulation of mouse CD72 gene expression during B lymphocyte development. J Immunol 161: 4760-7. 294. Yoshida, H., T. Matsui, A. Yamamoto, T. Okada, and K. Mori. 2001. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107: 881-91. 295. Yoshizaki, K., T. Nakagawa, K. Fukunaga, L. T. Tseng, Y. Yamamura, and T. Kishimoto. 1984. Isolation and characterization of B cell differentiation factor (BCDF) secreted from a human B lymphoblastoid cell line. J Immunol 132: 294854. 296. Yu, J., C. Angelin-Duclos, J. Greenwood, J. Liao, and K. Calame. 2000. Transcriptional repression by blimp-1 (PRDI-BF1) involves recruitment of histone deacetylase. Mol Cell Biol 20: 2592-603. 297. Zhang, Z., C. R. Espinoza, Z. Yu, R. St ephan, T. He, G. S. Williams, P. D. Burrows, J. Hagman, A. J. Feeney, and M. D. Cooper. 2006. Transcription factor Pax5 (BSAP) transactivates the RAG-mediated V(H)-to-DJ(H) rearrangement of immunoglobulin genes. Nat Immunol 7: 616-24. 298. Zhou, L. J., H. M. Smith, T. J. Walds chmidt, R. Schwarting, J. Daley, and T. F. Tedder. 1994. Tissue-specific expression of the human CD19 gene in transgenic mice inhibits antigen-independent B-lymphocyte development. Mol Cell Biol 14: 3884-94. 299. Zupo, S., L. Isnardi, M. Megna, R. Massara, F. Malavasi, M. Dono, E. Cosulich, and M. Ferrarini. 1996. CD38 expression dist inguishes two groups of B-cell chronic lymphocytic leukemias w ith different responses to anti-IgM antibodies and propensity to apoptosis. Blood 88: 1365-74.

PAGE 158

About the Author Sophia (Sophie) Cornelia Elisabeth Boli ck was born May 25, 1972 in Delft, the Netherlands. She graduated from Vrije Univ ersiteit Amsterdam (the Netherlands) with a M.Sc. in Medical Biology in 1999. As an unde rgraduate, Sophie did research in the lab of Dr. R.J. Scheper in the Department of Pathology at the Academisch Ziekenhuis Vrije Universiteit. Sophie joined the graduate progr am in the Department of Biochemistry and Molecular Biology (currently the Department of Molecular Medicine) in Fall 1999 and started her dissertation work in the lab of Dr. W.S. Dalton. Upon hi s departure from USF in 2001, she began a new project in the lab of Dr. K.L. Wright. Sophie has published in several peer-reviewed journals, including Leukemia. While a graduate student, Sophie also served on the USF Graduate Council and was the Association of Medical Sciences Graduate Students (AMSGS) President.