USF Libraries
USF Digital Collections

AKT function and human oncogenesis

MISSING IMAGE

Material Information

Title:
AKT function and human oncogenesis
Physical Description:
Book
Language:
English
Creator:
Park, Sungman
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
STAT3
24p3
Foxo3a
TZP
p53
Dissertations, Academic -- Pathology and Cell Biology -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Accumulated evidence indicates that, by the phosphorylation of its physiological substrates, Akt promotes cell survival, proliferation and angiogenesis. While a number of Akt targets have been identified, the mechanism by which Akt regulates cell survival and growth and induces malignant transformation still remains elusive. During the last 5 years, I have shown that AKT1 cross-talks with Src/Stat3 pathway. AKT1 is a direct target gene of Stat3. Protein/mRNA levels and promoter activity of AKT1 are significantly induced by constitutively active Src and Stat3. Knockdown of Stat3 or dominant-negative Stat3 reduced AKT1 expression induced by constitutively active Src. Blockage of AKT1 expression largely reduced Stat3 function in cell survival and angiogenesis. Furthermore, I have shown that proapoptotic protein 24p3 is a major target of Akt to mediate IL3 signaling in hematopoietic cells. Forkhead transcription factor FOXO3a directly binds to and activates 24p3 promoter leading to expression of 24p3 in response to IL3 withdrawal. Akt phosphorylates FOXO3a and inhibits its action toward 24p3. Finally, I have identified a novel transcription factor TZP that interacts with Akt and p53. Expression of TZP inhibits cell growth and survival and induces both G1 and G2/M cell cycle arrest. TZP directly binds to the p53 promoter and induces p53 transcription. In addition, TZP interacts with p53 and prevents p53 from Mdm2-mediated degradation. In response to genotoxic stress, both TZP and p53 were upregulated and knockdown of TZP reduced p53 expression. Akt phosphorylated TZP resulting in its translocation from the nucleus into the cytoplasm, and thus inhibits TZP function. These data indicate that Akt induced by STAT3 confers oncogenesis through inhibition of the transcription factors.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2007.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Sungman Park.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 128 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001968146
oclc - 268966032
usfldc doi - E14-SFE0001885
usfldc handle - e14.1885
System ID:
SFS0026203:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001968146
003 fts
005 20081105120229.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 081105s2007 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001885
035
(OCoLC)268966032
040
FHM
c FHM
049
FHMM
090
RB37 (ONLINE)
1 100
Park, Sungman.
0 245
AKT function and human oncogenesis
h [electronic resource] /
by Sungman Park.
260
[Tampa, Fla.] :
b University of South Florida,
2007.
3 520
ABSTRACT: Accumulated evidence indicates that, by the phosphorylation of its physiological substrates, Akt promotes cell survival, proliferation and angiogenesis. While a number of Akt targets have been identified, the mechanism by which Akt regulates cell survival and growth and induces malignant transformation still remains elusive. During the last 5 years, I have shown that AKT1 cross-talks with Src/Stat3 pathway. AKT1 is a direct target gene of Stat3. Protein/mRNA levels and promoter activity of AKT1 are significantly induced by constitutively active Src and Stat3. Knockdown of Stat3 or dominant-negative Stat3 reduced AKT1 expression induced by constitutively active Src. Blockage of AKT1 expression largely reduced Stat3 function in cell survival and angiogenesis. Furthermore, I have shown that proapoptotic protein 24p3 is a major target of Akt to mediate IL3 signaling in hematopoietic cells. Forkhead transcription factor FOXO3a directly binds to and activates 24p3 promoter leading to expression of 24p3 in response to IL3 withdrawal. Akt phosphorylates FOXO3a and inhibits its action toward 24p3. Finally, I have identified a novel transcription factor TZP that interacts with Akt and p53. Expression of TZP inhibits cell growth and survival and induces both G1 and G2/M cell cycle arrest. TZP directly binds to the p53 promoter and induces p53 transcription. In addition, TZP interacts with p53 and prevents p53 from Mdm2-mediated degradation. In response to genotoxic stress, both TZP and p53 were upregulated and knockdown of TZP reduced p53 expression. Akt phosphorylated TZP resulting in its translocation from the nucleus into the cytoplasm, and thus inhibits TZP function. These data indicate that Akt induced by STAT3 confers oncogenesis through inhibition of the transcription factors.
502
Dissertation (Ph.D.)--University of South Florida, 2007.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 128 pages.
Includes vita.
590
Adviser: Jin Q. Cheng, M.D., Ph.D.
653
STAT3.
24p3.
Foxo3a.
TZP.
p53.
690
Dissertations, Academic
z USF
x Pathology and Cell Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1885



PAGE 1

AKT Function and Human Oncogenesis by Sungman Park A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology College of Medicine University of South Florida Major Professor: Jin Q. Cheng, M.D., Ph.D. Santo V. Nicosia, M.D. George Blanck, Ph.D. Patricia A. Kruk, Ph.D. Hong-Gang Wang, Ph.D. Jie Wu, Ph.D. Date of Approval: February 15, 2007 Keywords: STAT3, 24p3, FOXO3a, TZP, p53 Copyright 2007, Sungman Park

PAGE 2

TABLE OF CONTENTS LIST OF TABLES v LIST OF FIGURES vi ABSTRACT iv CHAPTER ONE. Review of Role of PI3K/ AKT Pathway in Oncogenesis 1 Protein Tyrosine Kinases (PTKs) 1 Cytokine Receptors 5 PI-3 Kinases 8 PI-3 Kinase Family 8 Signaling by PI3Ks 10 Regulation of PI3Ks 12 AKT/PKB 13 Origins and Cloning of Akt 13 Akt gene family 14 Biochemical features of Akt 15 Activation of Akt 16 PI3K/Akt pathway in human cancer 17 Akt amplification 17 PI3K gene amplification 18 Activation of upstream regulators of PI3K 18 PTEN mutation 19 Substrates of Akt 20 Function of Akt 21 Akt and cell survival 21 Akt and mTor signaling 23 Akt and transcrip tion factors 24 Akt and cell cycle 27 Akt and mouse model 28 Reference 31 CHAPTER TWO. Molecular cloning a nd characterization of the human AKT1 promoter uncovers its upregulation by the Src/Stat3 pathway 37 Abstract 37 Introduction 38 Material and methods 39 i

PAGE 3

Cell culture, Plasmid, Materials and Transfection 39 Transcription Start Site Mapping of Human AKT1 Gene 40 Cloning and Analysis of Human AKT1 Promoter 40 Luciferase Reporter Assay 41 Northern and Western Blot Analysis Analysis 41 ChIP and EMSA Assay 41 MTT Assay 42 Results 43 Cloning of the Human AKT1 Promoter Revealed Multiple of Putative Stat3 Binding Sites 43 Stat3 Increases AKT1 Expression at mRNA and Protein Levels 43 Stat3 Transactivates the AKT1 promoter 45 Src Induces AKT1 promoter Activity through Stat3 45 Stat3 Response Elements are primarily located within Exon-1/intron-1 Region 48 Akt1 mediates Stat3 Function 50 Discussion 51 References 54 CHAPTER THREE. Targeting Stat3 blocks both HIF1 and VEGF expression induced by multiple oncogenic growth signaling pathways 58 Abstract 58 Introduction 59 Material and methods 60 Generation of Stat3 knockdown tumor cell lines and Stat3 knockout mouse embryonic fibroblasts (MEFs) 61 Western blot analysis 61 Electrophoretic mobility sh ift assay (EMSA) 61 Northern blot analysis 62 Pulse-label assays 62 Cloning and analysis of human Akt1 promoter 62 Chromatin immunoprecipitation (ChIP) assays 62 In vivo tumor experiments and matrigel assays 63 Angiogenesis measurements 63 Results 63 Activation of IL-6R induces HIF-1 expression 63 Stat3 is obligatory for IL-6-induced HIF-1 and VEGF expression 65 Stat3 is required for HIF-1 and VEGF induction by activated Src and Her-2/Neu 66 Stat3 regulates Akt gene expression 68 Effects of small-molecule Stat3 inhibitors on HIF-1 and VEGF expression 69 Targeting Stat3 inhibits tumo r angiogenesis induced by both Jak/STAT and PI3K/Akt pathways 70 ii

PAGE 4

Discussion 73 Referrences 75 CHAPTER FOUR. Identification of 24p3 as a direct target of FOXO3a that is regulated by IL-3 through PI3K/Akt pathway 78 Abstract 78 Introduction 78 Material and methods 80 Cell Culture, Reagents a nd Transfection 80 Plasmids 80 Luciferase Reporter Assay 81 Northern Blot Analysis 81 Cell viability 82 ChIP Assay 82 DNA fragmentation and Caspase Activity 82 Results 84 PI3K/Akt but not MAPK pathway inhibits 24p3 expression induced by IL3-deprivation and mediates IL3 survival signal in FL5.12 cells 84 PI3K/Akt pathway inhibits 24p3 expression at transcriptional level 85 Isolation of human 24p3 promoter and IL3 inhibition of 24p3 promoter activity through PI3K/Akt Pathway 85 FOXO3a mediates IL3 signals to directly regulate 24p3 promoter 87 Define the FOXO3a binding site(s) in 24p3 promoter 89 Conditioned Medium (CM) from Myr-Akt-FL5.12 Cells Fail to Induce Apoptosis and Myr-Ak t-FL5.12 Cells Resist to the Apoptosis induced by CM expressing 24p3 91 Discussion 91 References 93 CHAPTER FIVE. Identification and characte rization of a transcription factor TZP that interacts with p53 and Akt 95 Abstract 95 Introduction 95 Material and methods 98 Yeast Two-hybrid Screening and Expression Constructs 98 Cell culture and Transfection 98 Glutathione S-Transferase (GST ) Fusion Protein and Generation of Anti-TZP Antibody 98 Northern Blot Analysis 98 Immunoprecipitation and Imm unoblotting Analysis 99 GST Pulldown Assay 99 In Vitro Kinase Assay 99 iii

PAGE 5

In Vivo Labeling of Cells with [ 32 P] Orthophosphate 99 Cell proliferation, Viability and DNA Synthesis Assays 100 Luciferase Reporter Assay 100 Cyclic amplification and selection of targets (CASTing) 100 ChIP and EMSA assay 101 RNA Interference (RNAi) 102 Chromatin Isolation 102 Flow Cytometry and Cell Cycle Analysis 103 In vivo ubiquitination assay 103 Results 104 Identification of Akt binding protein, TZP 104 Expression of TZP inhibits cell proliferation, DNA synthesis and cell survival, and induces G1 and G2/M cell cycle arrest 105 TZP associates with chromatin and binds to a DNA consensus motif 107 TZP transcriptionally upregulates p53 109 TZP binds to p53 promoter and induces the promoter activity 109 Akt phosphorylates TZP and induces TZP translocation from the nucleus into the cytoplasm where they interact 110 Akt phosphorylation of TZP inhibits TZP transactivation activity 113 Increase of TZP expression at mRNA and protein levels in response DNA damage 114 TZP mediates the upregulati on of p53 by DNA damage 115 Akt inhibits the interaction between TZP and p53 118 Discussion 119 Reference 120 CHPATER SIX. Discussion a nd Conclusion 124 APPENDICES 127 Appendix A: List of Publication 128 ABOUT THE AUTHOR End Page iv

PAGE 6

LIST OF TABLES Table 1 List of Stimuli that activate Akt 20 Table 2 Frequency of mutations in the PI3K-AKT pathway in cancers 22 Table 3 List of substrates of active Akt 26 v

PAGE 7

LIST OF FIGURES Figure 1. Human receptor protein-tyrosine kinases 2 Figure 2. Activation of receptor protein tyrosine kinase 3 Figure 3. Human cytokine receptor superfamily 5 Figure 4. Interaction of cytokine and cytokine receptors 6 Figure 5. Mammalian PI 3-Kinase family and their domain structure 9 Figure 6. Mechanisms of class I ph osphatidylinositol 3-kinase (PI3K) activation 11 Figure 7. Structural organization of the three major Akt/PKB isoforms 15 Figure 8. Proposed model for Akt/PK B regulation by receptor tyrosine kinases 16 Figure 9. Human AKT1 promoter contains multiple Stat3-binding site 44 Figure 10. Up-regulation of the AKT1 by Stat3 and Src 46 Figure 11. Constitutively active Stat3 induces AKT1 -4293/+1888, but not AKT1 -4293/+1 luciferase activity 47 Figure 12. AKT1 promoter is activated by Src through Stat3 48 Figure 13. Definition of the Stat3 response elements 49 Figure 14. Reintroduction of the AKT1 into Stat3-/MEFs rescues cell death induced by serum withdraw 52 Figure 15. Activation of IL-6 receptor induces HIF-1 expression 64 Figure 16. HIF-1 and VEGF expression induced by both IL-6 receptor and Src is Stat3 dependent 66 Figure 17. Her-2/Neu-induced HIF-1 and VEGF expression is Stat3 vi

PAGE 8

dependent 68 Figure 18. Stat3 signaling is required and sufficient for Akt1 expression 69 Figure 19. Targeting Stat3 by a smallmolecule Stat3 inhibitor reduces HIF-1 and VEGF expression in tumor cells 70 Figure 20. Blocking Stat3 inhibits tumo r growth and angiogenesis induced by both Stat3 and Akt 71 Figure 21. PI3K/Akt, but not MAPK, pa thway mediates IL3 regulation of 24p3 and cell survival 83 Figure 22. PI3K/Akt pathway regulates 24p3 at transcriptional level 84 Figure 23. Cloning of human 24p3 promoter and IL3 regulation of 24p3 promoter through PI3K/Akt pathway. 86 Figure 24. FOXO3a induces 24p3 promoter activity that is inhibited by IL3/Akt signaling. 87 Figure 25. FOXO3a regulates 24p3 expression through a phosphorylation-dependent manner. 88 Figure 26. Define the FOXO3a response elements in 24p3 promoter 89 Figure 27. Activation of Akt not onl y represses 24p3 expr ession induced by IL3 withdrawal but also inhi bits 24p3-induced cell death 90 Figure 28. Identification of TZP that interacts with Akt 104 Figure 29. TZP inhibits cell growth, DNA synthesis and survival and induces cell cycle arrest 106 Figure 30. TZP binds to DNA 107 Figure 31. TZP transcriptionally upregulates p53 108 Figure 32. TZP binds to and induces p53 promoter 111 Figure 33. Akt phosphorylates TZP in vivo and in vitro 112 Figure 34. Akt phosphorylation TZP resu lts in TZP nuclear exclusion and slightly increases TZP inter action with 14-3-3 protein 113 vii

PAGE 9

Figure 35. Akt inhibits TZP transc riptional activity 114 Figure 36. TZP is induced by DNA damage 115 Figure 37. Knockdown of TZP redu ces p53 expression induced by DNA damage 116 Figure 38. TZP stabilizes and interacts with p53 117 Figure 39. Akt inhibits the intera ction between TZP and p53 118 viii

PAGE 10

AKT Function and Human Oncogenesis Sungman Park ABSTRACT Accumulated evidence indicates that, by the phosphorylation of its physiological substrates, Akt promotes cell survival, proliferation and an giogenesis. While a number of Akt targets have been identified, the m echanism by which Akt regulates cell survival and growth and induces malignant transformati on still remains elusive. During the last 5 years, I have shown that AKT1 cross-talks with Src/Stat3 pathway. AKT1 is a direct target gene of Stat3. Protein/mRNA levels and prom oter activity of AKT1 are significantly induced by constitutively active Src and Stat3. Knockdown of Stat3 or dominant-negative Stat3 reduced AKT1 expres sion induced by constitu tively active Src. Blockage of AKT1 expression largely reduc ed Stat3 function in cell survival and angiogenesis. Furthermore, I have show n that proapoptotic protein 24p3 is a major target of Akt to mediate IL3 signaling in he matopoietic cells. Fo rkhead transcription factor FOXO3a directly binds to and activates 24p3 promoter leading to expression of 24p3 in response to IL3 withdrawal. Akt phosphorylates FOXO3a and inhibits its action toward 24p3. Finally, I have identifi ed a novel transcription factor TZP that interacts with Akt and p53. Expression of TZP inhibits cell growth and survival and induces both G1 and G2/M cell cycle arrest. TZP directly binds to the p53 promoter and induces p53 transcription. In addition, TZP interacts wi th p53 and prevents p53 from Mdm2-mediated degradation. In response to genotoxic stress, both TZP and p53 were upregulated and knockdown of TZP reduced p53 expressi on. Akt phosphorylated TZP resulting in its translocation from the nucleus into the cytoplasm, and thus inhibits TZP function. These data indicate that Akt i nduced by STAT3 confers oncogenesis through inhibition of the transcription factors. iv

PAGE 11

CHAPTER 1 Review of Role of PI3K/AKT Pathway in Oncogenesis The maintenance of normal cell function a nd tissue homeostasis is dependent on the precise regulation of multiple signaling pathways that regulate cellular determination such as proliferation, diff erentiation, cell growth arrest or programmed cell death (apoptosis and autophagy). Cancer arises fr om clones of mutated cells that break out this balance and proliferate inappropriately without compensatory apoptosis. Uncontrolled cell growth occurs as a resu lt of disturbed signal transduction that modulates or alters cellular be havior or function to keep th e critical bala nce between the rate of cell-cycle progression (cell division) and cell growth (cell mass) on one hand, and programmed cell death (apoptosis an d autophagy) on the other (1, 2). The PI3K/Akt pathway regulates a variety of cellular processes including nutrient metabolism, cell growth, proliferation, cell cycle control, survival, differentiation, migration, and angiogenesis (3). Deregul ation of the PI3K/Akt pathway has been related to the development of diseases such as diabetes, autoimmunity, and cancer (4-7). The link between activation of the PI3K/Akt pathway and cancer makes this pathway an attractive target for therapeutic strategies. Accumulated reports show that activation of receptor protein-tyrosine kinases (RTK) a nd cytokine receptor is one of the major resources for activating PI3K/Akt pathway. Protein Tyrosine Kinases (PTKs) Protein tyrosine kinases (P TKs) are enzymes that cat alyze the phosphorylation of tyrosine residues. There are two classe s of PTKs: receptor PTKs and cellular nonreceptor PTKs. Of the 91 protein tyrosine ki nases identified thus far, 59 are receptor 1

PAGE 12

tyrosine kinases and 32 are non-receptor tyrosine kinases (Fig. 1). These enzymes are involved in cellular signaling pathways and regulate key cell functions such as Figure 1. Human receptor protein-tyrosine kinases. The prototypic receptor for each family and the known members are indicated below the receptor. (A) The first six RTK receptors classes among the 19 human RTK classes. We can observe that the extracellular region is very different between all the RTKs, and, on the other hand, that the intracellular region is very conserved. (B) The new domain prediction of RTK. It shows some classification modifications and updated domain prediction from the latest domain databases SMART and Pfam. Abbreviation of the prototypic receptors: EGFR, epidermal growth factor receptor; InsR, Insulin receptor; PDGFR, platelet-derived growth factor receptor; FGFR, fibroblast growth factor receptor; EphR, ephrin receptor. (Referred to Grassort J et al. (2003) Nucleic Acids Research 31, 353) proliferation, differentiation and cell survival. Deregulation of these enzymes, through mechanisms such as point mutations or overexpression, can lead to various forms of cancer as well as benign proliferative conditions. Indeed, more than 70% of the known oncogenes and proto-oncogenes involved in cancer code for PTKs. 2

PAGE 13

Receptor PTKs possess an extracellular ligand binding domain, a transmembrane domain and an intracellular catalytic domain. The transmembrane domain anchors the receptor in the plasma membrane, while the extracellular domains bind growth factors. Characteristically, the extracellular domains are comprised of one or more identifiable structural motifs, including a cysteine-rich region, fibronectin III-like domain, immunoglobulin-like domains, EGF-like domain, cadherin-like domain, kringle-like domain, factor VIII-like domain, glycine-rich region, leucine-rich region, acidic region and discoidin-like domain (Fig. 1). Figure 2. Activation of receptor protein tyrosine kinase. (Copyright 2005 Pearson Education, Inc., publishing as Benjamin Cummings) The intracellular kinase domain of receptor PTKs can be divided into two classes: those containing a stretch of amino acids separating the kinase domain and those in which the kinase domain is continuous. Activation of the kinase is achieved by ligand binding to the extracellular domain, which induces dimerization of the receptor. Receptors thus 3

PAGE 14

activated are able to autophosphorylate tyrosine residues outside the cata lytic domain via cross-phosphorylation. The resu lts of this autophosphorylation are stabilization of the active receptor conformation and the crea tion of phosphotyrosine docking sites for proteins which transduce signals within the cell (Fig. 2). Signaling proteins which bind to the intracellular domain of receptor tyrosine kinases in a phosphotyrosine-dependent manner include RasGAP, PI3-kinase, phospholipase C phosphotyrosine phosphatase SHP and adaptor proteins such as Shc, Grb2 and Crk (8, 9). In contrast to receptor PTKs, cellula r non-receptor PTKs are located in the cytoplasm, nucleus or anchored to the inner leaflet of the plasma membrane. They are grouped into eight families: SRC, JAK, AB L, FAK, FPS, CSK, SYK and BTK (reviewed in 10). Each family consists of several members. With the exception of homologous kinase domains (Src Homology 1, or SH1 domains), and some proteinprotein interaction domains (SH2 and SH3 domains), they have little in common structurally. Of those cellular PTKs whose functions are known, many, such as SRC, are involved in cell growth. In contrast, FPS PTKs are involved in differentiation (11), ABL PTKs are involved in growth inhibition (12), and FAK is associated with cell adhesion (13). Some members of the cytokine recepto r pathway interact with JAKs, which phosphorylate the transcription factors, ST ATs (14, 15). Still other PTKs activate pathways whose components and functions remain to be determined. There are four main mechanisms of oncogenic transformation by PTKs. First, retroviral transduction of a proto-oncogene correspond ing to a PTK is a common transforming mechanism in rodents and chickens. Second, genomic rearrangements, such as chromosomal translocations resulting in formation of oncogenic fusion proteins containing a PTK catalytic domain and an unrelated protein that provides a dimerization function. Third, gain-of-function mutations or small deletions ar e associated with several malignancies. Finally, PTK overe xpression is a major mechanism in PTKinduced transformation. In general, the transforming effect can be ascribed to enhanced constitutive kinase activity with quantitatively or qua litatively altered downstream signaling (16). 4

PAGE 15

Cytokine Receptors Cytokines act on their target cells by binding specific membrane receptors. The receptors and their corresponding cytokines have been divided into several families based on their structure and activities. Hematopoietin family receptors are dimers or trimers with conserved cysteines in their extracellular domains and a conserved Trp-Ser-X-Trp-Ser sequence (17). Examples are receptors for IL-2 through IL-7 and GM-CSF. Interferon family receptors have the conserved cysteine residues, but not the Trp-Ser-X-Trp-Ser sequence, and include the receptors for IFN, IFN, and IFN. Tumor necrosis factor family receptors have four extracellular domains; they include receptors for soluble TNF and TNF as well as membrane-bound CD40 (important for B cell and macrophage activation) and Fas (which signals the cell to undergo apoptosis). Figure 3. Human cytokine receptor superfamily. (Copyright 2005 Pearson Education, Inc., publishing as Benjamin Cummings) 5

PAGE 16

Chemokine family receptors have seven transmembrane helices and interact with G protein. This family includes receptors for IL-8, MIP-1 and RANTES (reviewed in 18) (Fig. 3). Figure 4. Interaction of cytokine and cytokine receptors. (Referred to Oppenheim JJ et al. Cytokine Reference. Academic Press (2001)) Hematopoietin cytokine receptors are the best characterized. They generally have two subunits, one cytokine-specific and one signal transducing. An example is the GM-CSF subfamily, where a unique subunit specifically binds GM-CSF, IL3, or IL-5 with low affinity and a shared subunit signal transducer also increases cytokine6

PAGE 17

binding affinity. Cytokine binding promotes dimeri zation of the and subunits, an IL-2 rface ligands on effecto 7 which then associate with cytoplasmic tyro sine kinases to phosphor ylate proteins which activate mRNA transcription. GM-CSF and IL3 act on hematopoietic stem cells and progenitor cells and activate monocytes. W ith IL-5, they also stimulate eosinophil proliferation and basophil degranulation. All three receptors phosphorylate the same cytoplasmic protein. Antagonistic GM-CSF an d IL3 activities can be explained by their competition for limited amounts of subunit (reviewed in 19). The IL-2R subfamily of receptors for IL-2, IL-4, IL-7, IL-9, and IL-15 have a common signal-transducing chain. Each has a unique cytokine-specific chain. IL-2 and IL-15 are trimers, and share R chain. Monomeric IL-2R has low affinity for IL-2, dimeric IL-2R has intermediate affinity, and trimeric IL-2R binds IL-2 with high affinity. IL-2R chain (Tac) is expressed by activated but not resting T cells. Resting T cells and NK cells constitutively express low number of IL-2R Antigen activation stimulates T cell expression of high affinity IL-2R trimer s as well as secretion of IL-2, allowing autocrine stimulation of T cell proliferati on in an antigen-specific manner. Antigen specificity of the immune response is also maintained by the close proximity of antigenpresenting B cells and macrophages with their helper T cells, so that cytokines are secreted in the direction of a nd close to the membrane of the target cell. X-linked severe combined immunodeficiency (X -scid ) is caused by a defect in IL-2R family chain, which results in loss of activity from this family of cytokines (reviewed in 20). The TNF receptor family molecules CD40 and Fas bind to cell su r T cells: CD40L and FasL. CD40 is expressed on B cell and macrophage plasma membrane. T cell CD40L binding to B cell CD40 stimulates B cell proliferation and isotype switching. T cell CD40L binding to macrophage CD40 stimulates macrophages to secrete TNF and become much more sensitive to IFN T cell FasL binding to Fas leads to the activation of caspases that initia te apoptosis of the ce ll expressing membrane Fas. Activated lymphocytes express Fas, so that FasL-positive Tc cells can regulate the immune response by eliminating activated cells An immune deficiency disease linked to expression of a mutant Fas is characterized by over-prolif eration of lymphocytes (21).

PAGE 18

PI-3 Kinases PI-3 Kinase family Based on substrate preference and sequen ce homology, PI3Ks are divided into three various PI3K is oforms are illustrated in figure 5. In mamm A PI3K is a heterodimer that c onsists of a p85 regulatory subunit and a p110 c crucial in me diating the activation of class IA PI3K by rece 8 classes (Fig. 5). In vivo, class I PI3Ks primarily generate phosphatidylinositol(PtdIns)-3,4,5-trisphosphate from PtdIns(4,5)P 2 whereas class III PI3Ks generate PtdIns(3)P from PtdIns. Class II PI3Ks preferentially generate PtdIns(3)P and PtdIns(3,4)P 2 in vitro, and might generate PtdIns(3)P, PtdIns(3,4)P 2 and possibly PtdInsP 3 in vivo (22). The domain structures of als, numerous genes encode different isof orms of PI3Ks (23). All PI3K isoforms are widely expressed, with the exception of the class IA p55 subunit, which is enriched in the brain and the testes, and the p110 subunit, which is predominantly expressed in lymphocytes. Class I atalytic subunit. Three genes, PIK3R1, PIK3R2 and PIK3R3, encode the p85 p85 and p55 isoforms of the p85 regulatory subunit, respectively. The PIK3R1 gene also gives rise to tw o shorter isoforms, p55 and p50 through alternative transcriptioninitiation sites. The class IA p85 regulator y isoforms have a common core structure consisting of a p110-binding domain flanked by two Src-homology 2 (SH2) domains. The two longer isoforms, p85 and p85 also have an extended N-terminal region containing a Src-homology 3 (SH3) domain and a BCR homology (BH) domain flanked by two proline-rich (P) regions (23). The p85 regulatory subunit is ptor tyrosine kinases (RTKs). The SH2 domains of p85 bind to phospho-tyrosine residues in the sequence context pYxxM on ac tivated RTKs or adaptor molecules (such as IRS1) (24). This binding relieves the basal inhibition of p110 by p85 and recruits the p85p110 heterodimer to its substrate (PtdIns(4,5)P 2 ) at the plasma membrane (25, 26).

PAGE 19

F igure 5. Mammalian PI 3-kinase family and their domain structures. (Referred to Three genes PIK3CA, PIK3CB and PIK3CD encode the highly homolo Engelman JA et al. (2006) Nature Review Genetics. 7, 606-619) gous p110 catalytic subunit isoforms p110, p110 and p110, respectively (23). They possess an N-terminal p85-binding domain that interacts with the p85 regulatory subunit, a Ras-binding domain (RBD) that mediates activation by the small GTPase Ras, a C2 domain, a phosphatidylinositol kinase homology (PIK) domain and a C-terminal catalytic domain. The PIK and catalytic domains of p110 are homologous to domains found in a family of protein kinases that includes mTOR (mammalian target of rapamycin), ATM (ataxia telangiectasia mutated), ATR (ataxia telangiectasia Rad3 related) and DNA-PK (DNA-dependent serine/threonine protein kinase), indicating that these proteins share an ancient evolutionary origin. 9

PAGE 20

Cla Ps aro consis ss IBI3K i hetedimer ting of a p101 regulato ry subunit and a p110 p110-like catalytic subunit. The three is rest ricted to PtdIns and generate PtdIns(3)P. Signaling by PI3Ks The effects of polyphosphoinositides in cel ls are mediated th rough the specific binding are activated by growth f actor receptor tyrosine kinases (RTKs; left). receptors (GPCR catalytic subunit. Although p110 shares extensive homology with the class IA p110 proteins, p101 is distinct from p85 prot eins. Two other regulatory subunits, p84 and p87PIKAP, have been described recently (27, 28). Members of class II PI3Ks consist of onl y a oforms of class II PI3Ks PIK3C2 PIK3C2 and PIK3C2 are encoded by distinct genes. All three isoforms shar e significant sequence homology with the class I p110 subunits. In addition, class II PI3Ks have an extended divergent N terminus, and additional PX and C2 domains at the C termi nus. A remarkable feature of this class PI3Ks is that they can utilize Ca ++ /ATP for their in vivo lipid kinase activity through the binding between C2 domain and Ca ++ (29). Class III PI3Ks have a substrate specificity These PI3Ks are homologous to Vps34 (vacuolar protein-sorting defective 34) the only PI3K in yeast, which plays a very important ro le in protein trafficking from Golgi to the vacuole and autophagy (30). to at least two lipi d-binding protein domains, th e FYVE and pleckstrin-homology (PH) domains. (Fig. 6). Class IA PI3Ks Both insulin and insulin growth factor 1 (IGF1) receptors use the insulin receptor substrate (IRS) family of adaptor molecules (shown to the right of the RTK) to engage class IA PI3Ks, whereas other receptors, such as the platelet-derived growth factor (PDGF) receptor, recruit class IA PI3Ks di rectly (shown to the left of the RTK). By contrast, class IB PI3Ks are activ ated by G-protein-coupled s) by binding to G (right). PTEN (phosphata se and tensin homologue) dephosphorylates phosphatidylinositol-3,4,5-trisphosphate (PIP3) and therefore terminates PI3K signaling. The 5 -phosphatase SHIP converts PIP3 to phosphatidyl10

PAGE 21

inositol-3,4-bisphosphate (PI-3,4-P2). F igure 6. Mechanism of class I phosphatidylinositol 3-kinase (PI3K) activation. Class IA PI3Ks The FYVE domain, named after the first four proteins (F are activated by growth factor receptor tyrosine kinases (RTKs; left). Both insulin and insulin growth factor 1 (IGF1) receptors use the insulin receptor substrate (IRS) family of adaptor molecules (shown on the right of the RTK) to engage class IA PI3Ks, whereas other receptors, such as the platelet-derived growth factor (PDGF) receptor, recruit class IA PI3Ks directly (shown to the left of the RTK). By contrast, class IB PI3Ks are activated by G-protein-coupled receptors (GPCRs) by binding to G (right). PTEN (phosphatase and tensin homologue) dephosphorylates phosphatidylinositol-3,4,5-trisphosphate (PIP3) and therefore terminates PI3K signalling. The 5-phosphatase SHIP converts PIP3 to phosphatidylinositol-3,4-bisphosphate (PI-3,4-P2) (REF. 1). G, guanine nucleotide binding protein (G protein), ; G, guanine nucleotide binding protein (G protein), ; p110 and p110, catalytic subunits of PI3K; p85 and p101, regulatory subunits of PI3K; SHIP, SH2-domain-containing inositol-5-phosphatase. (Referred to Engelman JA et al. (2006) Nature Review Genetics. 7, 606-619) ab1, Y OTB, V ac1, and E EA1)of about 100 amino that contain this motif, is an ~80-amino acid sequence containing four conserved cysteine residues that coordinate two Zn ++ ions (31). The structure data clearly show that FYVE domains only bind to PtdIns(3)P, but not the other lipids (32). FYVE domains appear to be less widespread than PH domain. To date, 22 different FYVE domain-containing proteins have been found in mammals, and the majority of FYVE domain-containing proteins have been implicated in membrane trafficking. PH (Pleckstrin homology) domains are globular protein domains acids found in over 150 proteins to date. Some PH domains bind phospholipids with high affinity. Residues in PH domains essential for high-affinity binding to PIs have recently been identified (33, 34). These residues lie at the N-terminus, in a KX 7-13 R/KXRHyd motif, where X is any amino acid and Hyd is a hydrophobic amino acid (30). A subset of PH domains preferentially bind to PtdIns(3,4)P2, and PtdIns(3,4,5)P3 11

PAGE 22

(30, 35 gnaling by class I PI3Ks, especially IA PI3Ks, has been extensively studied. PtdIns( tudied due to their specific structu Regulation of PI3Ks PtdIns(3,4,5)P3, a product of PI 3-kinase, plays a re gulatory role in a vast array of biologi PTEN was first identified in 1997 by three independent groups, so it is also known ). Si 3,4)P2/PtdIns(3,4,5)P3-binding PH domains are found in diverse array of proteins including protein kinases (e.g. PKB, PDK1, Bt k), nucleotide-exchange factors (e. g. Vav, GRP1, ARNO, Sos1, Tiam1), GTP-activat ing factors (e. g. GAP1m, centaurins), phospholipases (e. g. PLC 2) and adaptor proteins (35, 36). Signaling by class II PI3Ks has not been widely s res, however, the association of class II PI3Ks with cellular membrane compartments indicates that they might be invo lved in sorting events or vesicle formation. Signaling by class III PI3Ks has been mainly placed on membrane trafficking events because they share high homology with Vps 34, which is clearly found to be involved in yeast membrane trafficking. For example, PtdIns(3)P-mediated recruitment of the SARA (Smad anchor for receptor activation) protein to TGFreceptor is crucial for this pathway (37, 38). EE1A is an effector of Rab5 which itself also binds to human Vps34 and p85/p110 and EE1A has been found to be esse ntial for the trafficking of protein from Golgi complex to the lysosome (39). cal responses to extra cellular signals, including pr oliferation, differentiation, apoptosis, vesicle trafficking, cell morphology and cell migration. The level of this phospholipid is low in resting cells but in creases rapidly in response to growth factor/cytokine-stimulated plasma membrane recruitment and activation of PI3-kinase, therefore, the negative regulation becomes important. So far, three enzymes, SHIP, SHIP2 and PTEN, have been shown to play ke y roles in regulating the level of PI-3,4,5P3. as MMAC or TEP1, and PTEN is found to be the major 3-phosphatase of phosphoinositol-(3,4,5)-triphosphate, a nd signals down to regulate PI3K/Akt pathway. 12

PAGE 23

Consistent with the role of PTEN in PI3K/Akt signaling, PTEN negatively regulates cell P, has received conside kt/PKB Origins and Cloning of Akt Akt, also named protein kinase B (PKB) and RAC, is a serine /threonine protein kinase survival by causing apoptosis and/or G1 ce ll cycle arrest. Dysfunctional/absent PTEN leads to high levels of Akt phosphor ylation, and germline mutations of PTEN tumorsuppressor gene have been found to result in a wide spectrum of phenotypes including Cowden syndrome (40, 41). PTEN has also been shown to bind FAK (Focal Adhesion Kinase) and inhibit FAK kinase activ ity via dephosphorylation (42). An SH2-containing inositol 5 phospha tase protein, SHI rable attention because it functions as a negative regulator for PI3K pathway. Based on current knowledge of PTEN and SHIP, SHIP mainly converts PI-3,4,5-P3 to PI3,4-P2. However, PTEN can conv ert PI-3,4,5-P3 to PI-4,5-P2. PTEN -/cells exhibits high basal level of Akt act ivation while only slightly elevated level of Akt phosphorylation has been observed in SHIP -/cells (40). So the exact difference between PTEN and SHIP is still under investigation ev en though they share similar biological function. A with homology to protein kinase s A and C (43). The AKT oncogene was isolated from the directly transforming muri ne retrovirus AKT8, which was isolated from an AKR mouse thymoma cell line (43) and s pontaneous lymphoma (43). This virus, termed AKT8, produced foci of malignant tr ansformation in the mink lung epithelial cell line CCL-64 (44). A unique feature of AKT8 was its inability to induce focus formation in other cell lines such as NI H3T3 fibroblasts, which suggested that the virus contained a previously unidentified oncogene. Sequenci ng the defective retrovi rus from mink lung epithelial cells infected with AKT8 revealed that it encode s a serine/threonine protein kinase, namely Akt1 (45). Subsequently, Akt2 was cloned and shown to encode a closely related kinase that is frequently amplified in human ovarian cancer (46). They 13

PAGE 24

containnsensus sequences characterist rotein kinase catalyt ic domain and share Akt gene family to, three members of Akt encoded by three se parate genes have been identified in uitously expressed in mammals, although the levels 14 co ic of a p more than 68% similarity to protein kina se C and cAMP-depende nt protein kinase. Moreover, Akt1 and Akt2 have a unique N-te rminal region originally designed as Akt homology (AH) domain (45, 46). Thus, Akt family of serine/threonine kinases was identified. Hither mammalian cells. All three genes have more than 85% sequence identity and their protein products share the sa me structural organization (Fig. 7). The first aminoterminal 100 amino acids are a pleckstri n homology (PH) domain that binds to phospholipids. A short glycine-rich region locates between PH and catalytic domains, and links the PH motif to the catalytic domain. All Akt members are assumed to have identical or similar substrat e specificity. The last 70 amino acids of the carboxyl terminal tail contain a putat ive regulatory domain. In v-Akt, a truncated viral groupspecific antigen, gag, is fused in frame to the full-length Akt1 coding region through a short 5 untranslated region of Akt1 (47). All three Akt members are ubiq of expression vary among the tissues (47). Akt1 is evenly expressed in most tissues. The uppermost expression of Ak t2 was observed in the insulin-responsive tissues such as skeletal muscle, heart, liver, and kidney, suggesting that this isoform is of important to insulin signaling. This is further substantiated by the observation that Akt2 expression in developing embryos is also highest in the insuli n-responsive tissues, including liver, brown fat, and skeletal muscle. A peculiar pattern of Akt1 expression was detected in brain, where it is markedly increased in regenerating neurons. Unlike the two other members, Akt3 shows a more lim ited pattern of expression. Higher levels of Akt3 were detected in tes tis and brain and low levels in the adult pancreas, heart, and kidney (48, 49, 50). The expression pattern of th e three members may not always reflect their activities.

PAGE 25

Dif the dif fferent kinase activity levels oferent members have been observed in certain Biochemical features of Akt Activation of Akt depends on the integrity of the PH domain, which binds to PI3K produc) in igure 7. Structural organization of the three major Akt/PKB isoforms is shown in comparison 15 tissues and during differentiation, which is not necessarily correlated with their level of expression (51, 52). t PtdIns-3,4,5-P3, and on the phosphorylation of Thr308 (Thr309 in Akt2 and Thr305 in Akt3) in the activation loop and Ser473 (Ser474 in Akt2 and Ser472 in Akt3 the C-terminal activation domain. Yang et al provided a molecular explanation for regulation of Akt activation through Ser474 phosphorylation by analyzing the crystal F to virally encoded v-Akt Akt/PKB variants contain a plecsktrin homology domain (PH), a catalytic domain, and a putative regulatory fragment at the C-terminus (RD). v-Akt is an in-frame fusion of Akt-1 with a portion of retroviral group-specific antigen (gag). Amino acid positions are shown for mouse proteins. Threonine and serine residues whose phosphorylation is required to induce activities of the enzymes are indicated. See text for details (Referred to Kim D et al. (2005) Front Biosci. 10, 975-987.)

PAGE 26

structures of the unphosphorylated and Thr309-phospho rylated states of the Akt2 kinase igure 8. Proposed model for Akt/PKB regulation by receptor tyrosine kinases. or tyrosine kinases by ligands such as epidermal growth factor and platelet-derived Activation of Akt Akt exists in the cytosol of unstimulated cells in a low-activity conformation. domain (53). Activation by Ser474 phosphorylation occurs via a disorder-to-order transition of the alpha-C helix with concomitant restructuring of the activation segment and reconfiguration of the kinase bilobal structure. These conformational changes are mediated by a phosphorylation-promoted interaction of the hydrophobic motif with a channel on the N-terminal lobe induced by the ordered alpha-C helix and are mimicked by peptides corresponding to the hydrophobic motif of Akt. FActivation of recept growth factor leads to autophosphorylation of specific tyrosine residues on the in tracellular portion of the receptor. Recruitment of phosphoinositol 3-kinase (PI3K) then occurs, via binding of the SH2 domains of the regulatory subunit p85 to the phosphotyrosine residues on the receptor, which leads to a conformational change in the kinase, and consequently to activation. 3'-phosphoinositides generated by activated PI3K (black circles) then mediate the membrane recruitment Akt/PKB from the cytosol to the plasma membrane via its PH domains, and change the kinase from an inactive to an active state. A change in the conformation of Akt/PKB upon lipid binding has been predicted based on biochemical data. Akt/PKB is then phosphorylated on Thr308 and/or Ser473 by PDK1, and by an as yet unidentified Ser473 kinase. Activated Akt/PKB mediates its intracellular effects, and then becomes inactivated by the action of phosphatases such as PP2A, which dephosphorylate pThr308 and pSer473 and return Akt/PKB to its inactive conformation in the cytosol. PTEN or SHIP, which are two known phosphatases, act to downregulate Akt/PKB activation by dephosphorylating PtdIns(3,4,5)P 3 (Referred to Kim D et al. (2005) Front Biosci. 10, 975-987.). 16

PAGE 27

Upon activation of PI3K, PtdIns(3,4,5)P 3 /PtdIn s(3,4)P2 are synthesized at the plasma e indicated that Akt can be activated in cells by a mechanism indepen I3k/Akt pathway in human cancer Akt amplification Akt was first identified as a component of a fusion product of the retroviral oncoge membrane and then Akt interacts through its PH domain with these lipids. This causes the translocation of Akt from the cytosol to the inner leaflet of the plasma membrane and leads to a conformational change, which conve rts Akt into a substrate for PDK1, perhaps by exposing the Thr308 and Ser473 phosphoryla tion sites. PDK1 then phosphorylates Thr308. PDK1 in this location of the cell also forms a complex with PtdIns(3,4,5)P 3 /PtdIns(3,4)P 2 Although the role of PDK1 in Thr308 phosphorylation is well established, the mechanism of Ser 473 phosphorylation is controversial. A number of candidate enzymes responsible for this m odification have been put forward, including integrin-linked kinase, PDK1 when in a complex with the kinase PRK2, Akt itself, through autophosphorylation, PKC PKC II, DNA-dependent kina se, and the rictormTOR complex (Fig. 8). Several reports hav dent of PI3K activation, for example in response to heat shoc k, or increases in intracellular Ca 2+ or cAMP. Akt is activated by heat shock in NIH3T3 fibroblasts and this response was not inhibite d by wortmannin (50). Howeve r, we and others showed that Akt1 and Akt2, activated by heat shock as well as oxidative stress are completely suppressed by the PI3K inhibitors wort mannin and LY294002 (54, 55). Agonists that increase Ca 2+ levels in cells have be en reported to activate Akt in a PI3K-independent manner through the Ca 2+ /calmodulin-dependent protein kinase kinase (CAMKK) (55). The stimuli of Akt activation from extensive studies in different fields are summarized in the Table 1. P ne v-akt that causes leukaemia in mice (45). A number of studies have discovered Akt gene amplifications in human cancers. The work that originally 17

PAGE 28

identified Akt as a potential human oncogene de tected amplification of Akt1 in a single PI3K gene amplification The PIK3CA gene, which encodes the p110 catalytic subunit of PI3K, is located on chro Activation of upstream regulators of PI3K PI3K is activated as a result of the liga nd-dependent activation of tyrosine kinase recepto gastric carcinoma (44). Akt2 gene amplifi cation has been found in ovarian, pancreatic, gastric, and breast tumors (44, 45). Akt2 amplification was mostly associated with high-grade aggressive ovarian tumors and ap pears to occur as part of the frequent amplification of the 19q13.1q13.2 chromosomal region (46). One study documented Akt3 mRNA overexpression and selective activa tion of the protein by growth factors in hormone-independent breast and prostate cancer cell lines (56). Overall, these studies indicate that Akt gene amplification, especi ally Akt2, may be a fr equent occurrence in several human cancers (57). mosome 3q26, a region that is frequently amplified in a number of human cancers. Recent studies have revealed amplification of PIK3CA in ovarian ( 58) and cervical (59) tumors. Furthermore, corresponding cell lines harboring this alteration display enhanced PI3K catalytic activity and grow th that is strongly suppressed by PI3K inhibitors, suggesting that PI 3K has oncogenic property at le ast in these tumor types. rs, G-protein-coupled receptors, or integrins. Receptor-independent activation can also occur, for example, in cells expressing constitutively active Ras proteins (60, 61). As cell surface receptors are frequently ove rexpressed and/or activated in many human cancers (62), downstream signaling pathways are often activated. One of the most extensively studied examples is the erbB 2 tyrosine kinase receptor, which is overexpressed in a large number of breast and other cancers (63 ). ErbB2 is an orphan receptor with no defined ligand, which acts as a dimerization partner for other members of the erbB family. ErbB2-containing heterodimers are potent activators of multiple 18

PAGE 29

signaling pathways involved in proliferati on, inva sion, and survival (64). Studies in PTEN mutation PTEN (Phosphatase and Tensin homolog deleted on Chromosome 10) is a dualfunctio itol triphos breast cancer cells, primary breast tumors, and transgenic mice, all indicate that erbB2, when overexpressed, is cons titutively associated with erbB3 (65). Because erbB3 possesses seven phosphorylatable tyrosine residues that act as binding sites for the SH2 domains of the p85 regulatory subunit of PI-3K (64), erbB2erbB3 dimerization robustly activate the PI3K/Akt pathway. This provide s a basis for data showing that tumor cells overexpressing erbB2 display cons titutive Akt activity (66). n lipid and protein phosphatase that was originally id entified as a tumor suppressor gene frequently mutated in the adva nced stages of a number of human cancers, particularly glioblastoma, endometrial, a nd prostate cancers. Additionally, germline mutations in PTEN induce the rare auto somal dominant inherited human cancer syndrome known as Cowden's disease, which is associated with increased risk of developing breast and other cancers (67). Th e results of studies in which PTEN has been overexpressed in various cell lines suggest that PTEN acts as a tumor suppressor by inhibiting cell growth (68) and increasing susceptibility to apoptosis and anoikis (69). The main physiological lipid substr ate for PTEN is phosphatidyl-inos phate (PIP 3 ), the product of PI3K. PTENnull embryonic fibroblasts show elevated PIP 3 levels and constitutive Akt activity, i ndicating that PTEN acts to restrain the pathway in the unstimulated cells. Absence of PTEN also str ongly correlates with activation of Akt in tumor ce ll lines. Conversely, rein troduction of PTEN in cells lacking PTEN down-regulates Akt phosphor ylation as well as reversing the phosphorylation of Akt cellular substrates such as BAD (68, 69, 72). PTEN and phosphorylated AKT levels were inversely correla ted in a large majority of samples with primary acute leukemias and non-Hodgkin lymphomas as well as in cell lines from these malignancies (70, 71). In addition, frequent overexpression of Akt has also been detected in human malignancies (72). Mu tation of Akt2 has also been found in 19

PAGE 30

T able 1 List of stimuli that activate Akt. regulate G Other activiators Tyrosine Kinase Stimuli that protein coupled receptor Angiopoietin-1 Bradyki nin Pertussis toxin -CD28 antibod ies C5a Zinc Epidermal growth fa ctor chol ium Carba Cadm Basic fibroblast grow th ted oncogene factor Growth-rela (GRO) Hypoxia Fibrone ctin n itroprusside Endotheli Sodium n Gas6 FMet-Leu-P he Exercise -inte grin antibodies -Opioids H 2 O 2 Interleukins 3 (regulated on eat shock RANTES activation, normal T cell expressed and secreted) H Insulin Fluid shear Platelet activating factor Insulin-l ike growth factor sis factor Tumor necro -killer cell inhibitor y osphatase inhibitors receptor antibodies Ph Leukaemia in hibitory ate factor Vanad Nerve g rowth factor id Okadaic ac N -methyl-D -aspartate (NMDA) Platelet-de rived growth factor Stem ce ll factor Vascular endothelial growth factor c olorectal cancer (73). Substrates of Akt To understand the physiological functions of Akt, it is important to identify its substra tes. It was originally established that the minimum motif in a peptide enabling Akt phosphorylation is Arginie-Xaa-Ar ginie-Yaa-Zaa-Serine/ThreonineHyd(RXRXXS/T), where Xaa is any amino acid, Yaa and Zaa are preferably small residues other than glycine, and Hyd is a bulky hydrophobic residue (phenylalanine or 20

PAGE 31

leucine) (74). le of dozen proteins have been iden tified as Akt substrates (Table 3), which unction of Akt Akt and cell survival Akt has an anti-apoptotic effect in many cell types. In the anti-apoptotic machin nd possibly later stages of apo A coup include BAD (Ser136) (75), glycogen synthase kinase 3 (GSK3) (76), 6phosphofructo-2-kinase (77) caspase-9 (78), endothelial nitric-o xide synthase (79, 80), I B kinase (81, 82), phosphodiesterase 3B (83), rac1 (84), raf-1 protein kinase (85, 86), mammalian target of rapamycin (mTOR) (87), breast cancer susceptibility gene 1 (BRCA1) (88), insulin receptor substrate 1 (IRS-1) (89), and forkhead transcription factors (90, 91), cAMPresponsive elem ent binding protein (CREB) (92), human telomerase reverse transcriptase (hTERT) (93) and MDM2 (94, 95). Although a number of physiological substrates of Akt have been reported, the detailed mechanism by which Akt regulates cell growth and survival ha s not been well documented, and putative critical substrates remain to be fully characterized. F ery, BAD, Forkhead transcription f actor family proteins, human caspase-9 and I B kinase have been reported to be the downstream targets of Akt. BAD can form heterodimer with anti-apoptotic proteins Bcl-2 or Bcl-X L and therefore, prevent them from exerting their anti-apopt otic function. Akt can phosphory late BAD at Ser136 (75), binds to 14-3-3 scaffold protein and is subjec ted to degradation, even though and Akt also induce BAD phosphorylation at Ser112 through PAK1 (p21-activating kinase 1) (96). After phosphorylation at Ser112 and Ser136, phosphorylated BAD phosphorylation at Ser 155 has been reported to be importa nt for binding to 14-3-3 (97). Caspase-9 is a protease that is essential in the initiation a ptosis, by forming apoptosomes with Apaf-1 and cytochrome c. Human procaspase-9 has been reported to be phosphor ylated and inhibited by Akt (98). It is still unclear how important a nd/or general event is for Akt-mediated regulation of 21

PAGE 32

Table 2. Frequency of mutations in the PI3K-A KT pathway in cancers uency Genetic mutations Cancer type Percentage freq PIK3CA (p110) Breast 26% (176/684) Colon 26% (88/337) Glioma 8% (14/182) Hepatoce llular 36% (26/73) Ovarian 10% (35/365) Lung 2% (4/253) Mutations Gastric 7% (24/338) Head an d neck 42% (54/128) Thyroid 9% (12/128) Lung: Squamou s cell Adenoc arcinoma 66% (46/70) 5 % (4/86) Breast 9% (8/92) Gastric 36% (20/55 ) Oesopha geal adenocacinoma 6% (5/87) Amplification ) Cervical 69% (11/16 PTEN Glioblastoma 54% (98/180) Prostate 35% (88/250) Breast 23% (37/164) Melano ma 37% (53/143) Loss of Heterozygosity Gastric 47% (14/30) Glioblas toma ) 28% (122/432 Prostate 12% (26/218) Breast 0% (0/164) Melano ma 8% (15/185) Mutations Gastric 0% (0/30) AKT Ovarian 12% (18/147) Pancreati c 20% (7/35) Breast 3% (3/106) Gastric 20% (1/5) Ampli fications d neck ) Head an 30% (12/40 PIK3RI (p85) Ovarian 4% (3/80) Mutations Colon 2% (1/60) 22

PAGE 33

a poptosis, because the site in which Ak t phosphorylates human caspase-9 is not Akt and mTOR signaling PI3K/Akt has recently emerged as an im portant mediator to regulate nutrientsand gro conserved in the mouse, rat and monkey homologues (99). wth factor-induced targ eting of the rapamycin (TOR) pathway. TOR (mTOR in mammals, also known as FRAP, RAFT, or RA PT) is an evolutionarily conserved serine/threonine kinase that regulates both cell growth and cell cycle progression by integrating signals from nutri ents (amino acids and energy) and growth factors (100-104). The best-known biochemical function of mT OR is to regulate protein translation by initiation of mRNA translation and ribosome synt hesis leading to an increased rate of cell mass and size, which is required to support the rapid proliferation. If the rate of cell growth is unable to keep up with a rapid ra te of cell division, th en cell proliferation cannot be continued, since cells would gradua lly lose cellular mass and cellular size with each cell division cycle, resulting in inevitabl e cell death. Studies in several organisms with rapamycin, which directly binds to and inhibits TOR function, have shown that inhibition of TOR pathway limits the rate of ce ll growth and induces cell cycle arrest in G1 phase and cell death. Therefore, mTOR and its downstream targ ets have recently been appreciated as an important cascade fo r tumorigenesis and novel therapeutic targets for cancer (103, 104). Using a murine lymphoma model, Akt promotes tumorigenesis and drug resistance by disrupti ng apoptosis, and disruption of Akt signaling using the mTOR inhibitor rapamycin reverses chemores istance in lymphomas expressing Akt, but not in those with other apoptotic defects ( 105). eIF4E (Human eukaryotic translation initiation factor 4E), a translational regulat or that acts downstream of Akt and mTOR, recapitulated Akt's action in tumorigenesis a nd drug resistance but was unable to confer sensitivity to rapamycin and chemotherapy. Akt signals through mTOR and eIF4E as an important mechanism of oncogenesis and drug resistance in vivo and reveals how targeting apoptotic programs can restore drug sensitivity in a genotype-dependent manner. It has been shown that mTOR feedback regulates Akt. In Drosophila and 23

PAGE 34

mammalian cells, TORnd its socia r are necessary for serine-473 Akt and transcription factors A recent study has shown that Akt regulates cellular processes through phosph scription fact or nuclear factorB (NF B)/Rel family is a key regulator of the imm aasted prot ein ricto phosphorylation of Akt, and a reduction in rict or or mTOR expression inhibited an Akt effector. The rictor-mTOR complex dir ectly phosphorylated Akt/PKB on serine-473 in vitro and facilitated threonine-308 phosphorylation by PDK1 (106). orylation of transcriptio n factors. The role of Akt in regulation of the Forkhead(FH or FoxO) transc ription factors was first id entified by findings from the genetic analysis of C. elegans (90, 107). Phosphorylation sites for Akt are highly conserved among Forkhead isoforms and species So far, three isoforms of Forkhead proteins (FKHR/FoxO1, FKHRL1 /FoxO3 and AFX/FoxO4) are directly phosphorylated by Akt (91, 108-111). Phosphorylation of Fo rkhead by Akt results in the nuclear exclusion of Forkhead, leading to decreased transcriptional activity that is required for promoting apoptosis. The ta rget genes for the Forkhead family are thought to be extracellular ligands, including the Fas ligand, TRAIL (TNF-related apoptosis-inducing ligand) and TRADD (TNF receptor type 1 as sociated death domain) and intracellular components for apoptosis such as Bim (bcl-2 interacting mediator of cell death), Bcl-6, and p27 (112). The tran une response, and deregulation of its activity is impli cated in the development of diseases such as autoimmune disease and can cer (113). In most cases, activation of NF B is dependent on the phosphoryl ation and degradation of I B, an inhibitor of NF B, by I B kinase (IKK) complex. Akt has been shown to regulate IKK activity in both direct and indirect manner. Akt interacts with and phosphorylates IKK on Thr23 in a PI3K-dependent manner that is required for NF B activation in response to TNF stimulation (81). Another study has shown that Akt phosphorylates Ser/Thr kinase Tpl2 (or Cot) on Ser 400, resulting in I KK complex activation (114). This NF B activation by Akt might result in the inhib ition of apoptosis by induction of cell survival genes that 24

PAGE 35

are transcriptionally activated by NF B ( tionship between phosphorylated Akt and FOXO MP response element (CRE)-binding protein ar receptor Nurr77 is required for T-cell antigen receptormediate tor (ER) the members of the nuclear recepto log 2) at serine-21 and suppresses its 25 113). Hu et al. investigated the pathologic rela 3A in primary tumors (115). FOXO3A was excluded from the nuclei of some tumors lacking phosphorylated Akt, suggesting an Akt-independent mechanism of regulating FOXO3A localization. This pheno menon is due to IKK physical interaction with, phosphorylation, and inhi bition of FOXO3A, which l eads to proteolysis of FOXO3A via the ubiquitin-dependent proteasome pathway. Cytoplasmic FOXO3A correlated with expression of IKK or phosphorylated Akt in many tumors and was associated with poor surviv al in breast cancer. A transcription factor, CREB (cyclic A ), is phosphorylated by Akt1 on Ser133. This process results in increased affinity of CREB to its co-activator CRB, and tran scriptional activation of CREB (92, 116). CREB is one of the targets of Akt in cell survival signaling, but a detailed mechanism remains to be elucidated. The orphan nucle d cell death (117). This transcrip tion factor is phosphorylated by Akt on Ser 350 (118). Phosphorylation of Nurr77 by Akt causes suppression of Nurr77 activity and partial inhibition of apoptosis induced by PMA and calcium. These observations suggest that Akt is implicated in early T-cell development. Androgen receptor (AR) and estrogen recep r transcription factor group, play an important role in cell growth and survival (119, 120). Akt phosphorylates AR on Ser 210 and Ser 790 and ER on Ser 167, which regulate their transactiv ational activity (120, 121). Akt phosphorylates EZH2 (enhancer of zeste ho mo methyltransferase activity by impeding EZH2 binding to histone H3, which results in a decrease of lysine-27 trimethylation and derepression of silenced genes. These results imply that AKT regulates the Histone methylation, through phosphorylation of EZH2, which may contribute to oncogenesis (122).

PAGE 36

Table 3 List of substrates of active Akt 26 Reference . Substrates Sites AHNAK Ser553 5 t al., 2001 JCB Sussmann e Arfaptin 2 Ser260 Rangone et al., 2005 JBC ArgBP2 Ser232, Thr234 Thr379 Yuan et al., JBC 2005 ARK5 Ser600 Suzuki et al.,2003 JBC ASK1 (MAP3K5) Ser83 Kim et al., 2001 MCB AS160 Ser588 Thr642 Kane et al., 2002 JBC ATP citr ate lyase Ser455 Be rwick et al., 2002 JB C Bad Ser75, Ser99 del Peso at al., 1997 Scien ce D t t t l 199 7 C ll Caspa se 9 alpha Ser196 Cardone et al., 1998 Science CRHSP24 Ser52 Auld et al., Biochem J 2005 Ezrin, Cytov illin, Villin 2 Thr567 Shiue et al., 2004 JBC Filamin C) Ser2213 Murray et al., 2004 Bioc hem J. Forkhead Thr24, Ser2 56, Ser319 Brunet et al., 1999 Cell R t l 1999 JBC GABA (A) receptor* Ser410 Wang et al., 2003 Neuro n GSK3 Ser19 Cross et al., 1995 Natu re GSK3 Ser9 Cross et al., 1995 Nature HAND2, dHAN D ? J. Biochem Ser11 4 Murakami et al., 2004 Eur HO-1 heme oxygenase 1 Ser188 Salin as et al., 2004 FEBS Lett. Huntingtin Ser421 Humbert et al.,2002 Dev Cell I -B kinase Thr23 Ozes et al., 1999 Nature IRS-1 Ser270 Ser307, Ser330, Ser527 Paz et al., 1999 JBC mTor Ser2448 Nave et al ., 1999 Bioc he m. J. PAK1 Ser21 Zhou et al., MCB p21 WA F er 146 1361 Thr145 S Li et al., 2002 JBC 277:11352-1 p27 Kip1 Thr157 Shin et al., 2005 JBC PIPPin RNA binding ti Ser58 Auld et al., 2005 Bioch em. J PTP-1B Ser50 Ravichandran et al.,2001 Mol Endocrinol. PF K-2 Ser466, Ser483 Deprez et al., 1997 JBC PRAS40 Thr246 Kovacina et al., 2003 JBC p47phox Ser304, Ser328 Chen et al., 2003 J. Immunol. 14-3-3-zet a Ser58 Powell et al., 2002 JBC Raf-1 = c-Ra f 99 Science Ser259 Zimmermann and Moelli ng 19 MKK4 = SEK1 Ser78 Park et al., 2002 JBC METTL1 tRNA m ethylase Ser27 Ca rtlidge et al., 2005 E MBO J. Synip (only by AKT2 ) Ser99 Yamada et al., 2005 J. Cell. Bio l. Tau Thr212 Ser214 Ksiezak-Reding et al., 2003 BBA Tube rin = TSC2 Ser939 Manning et al., 2002 Mol. Cell WNK1 Thr60 Vitari et al., 2003 Biochem J. YAP1 Ye s ass. pr otein Ser127 Basu et al.,2005 Mol. Cell. YB-1 Y-box binding protein 1 gene Ser102 Sutherland et al., 2005 Onco

PAGE 37

Akt and cell cycle p21cip1/waf1 is a cyclin/CDK (cyclin-dependent kinase) inhibito r which plays a importale in m another major cyclin/CDK inhibitor, is also regulated by Akt-dependent phosphti nt roaintaining cell cycle progr ession, and its impaired function is one of the major abnormalities in human cancer (123). p21 is reported to be a direct target of Akt, and phosphorylation of this protein by Akt results in the inhibiti on of its function to arrest the cell cycle. Zhou et al. were the first to describe Akt-mediated phosphorylation and regulation of p21 (95). They reporte d that phosphorylation of p21 on Thr145 by Akt inhibits nuclear localiza tion of p21, leading to activa tion of cyclin/CDK required for HER-2/neu-dependent tumor cell growth. Other groups have suggested different mechanisms for the regulation of p21 by phosphorylation. Rossig et al. reported that phosphorylation of the Thr145 of p21 prevents formation of the complex between p21 and proliferating cell nuclear antigen (PC NA) that causes DNA replication and cell proliferation (124). Phosphoryl ation of p21 on Thr145 also decreases the affinity of Cdk2 and Cdk4 to p21, which causes enzymatic ac tivation of these Cdks. They showed no significant effect of p21 phosphorylation on its subcel lular localization. Another report showed that p21 could be phosphoryl ated on Ser146 as well as Thr145 (125). Phosphorylation of Thr145 reduces affinity to PCNA, whereas phosphorylation of Ser146 enhances protein stability of p21. Phosphorylation of these si tes shows little effect of p21 on complex formation and inhibition of th e cyclin/CDK complex. The authors also suggested the possibility that p21 is a chem oresistance target of Akt-overexpressing cancer cells. These observations indicate that some expe rimental conditions or the genetic background of cells, such as erbB2 overexpression, might affect the regulation of p21 by Akt. p27 kip1 orylaon. In 2002, three reports desc ribed direct phosphor ylation of p27 by Akt in breast cancer cells (126-128). Akt phosphorylates p27 on Thr157, which is located in its nuclear localization signal (NLS), leading to the nuclear exclusion of p27, activation of cyclin/Cdk and cell cycle progression. In primary breast cancer cells, cytoplasmic retention of p27 correlates with prognosis, suggesting that the subcellula r localization of 27

PAGE 38

p27 mi get for breast cancer. ost importa kt and mouse models Genes encoding activated forms of Akt and Ras were transferred, in a tissuespecific e an Akt1-null mouse model was created. Homoz ght be a therapeutic tar The protein product of the tumor suppressor gene p53 is one of the m nt regulators for cell cy cle progression and apoptosis in response to genotoxic stresses (129). Murine double minute 2 (MDM 2) is an oncogene product and functions as an ubiquitin E3 ligase of p53 and also is transc riptionally induced by p53 (130). It directly binds to p53 and targets it for ubiqu itination. In 2001, two groups reported that Akt-dependent phosphorylation mi ght contribute to nuclear localization of MDM2 (94, 131). Two putative phosphorylation sites, Ser166 and Ser186, were determined by sitedirected mutagenesis. Another group showed that Ser186 was not an Akt site (132). Ogawara et al. reported that neither Akt nor point mutants for MDM2 on Ser166 and Ser186 showed any effect on subcellular localization of MDM2, but did show a PI3K/Akt-dependent increase of p53 ubiquitination (133). The precise effect of Akt on MDM2 is still controversial. Taken together, MDM2 should be, at least, an Akt target in the regulation of cell growth, but the detailed mechanism needs to be further investigated. A manner, to astrocytes and neural progenitors in mice (134). Although neither activated Akt nor Ras alone was sufficient to induce glioblastoma multiform (GBM) formation, the combination of activated Ras and Akt induced high-grade gliomas with the histological features of human GBMs. These tumors appeared to arise after gene transfer to neural progenito rs, but not after transfer to differentiated astrocytes. Increased activity of RAS is found in many human GBMs, and Akt activity is increased in most of these tumors, implying that combined activation of these 2 pathways accurately models the biology of this disease. By targeted disruption of the Akt1 gen ygous mice were viable but smaller than wild type littermates, and they did not display a diabetic phenotype. Upon exposure to genotoxic stress, their life span was shorter. The Akt1-null mice showed increa sed spontaneous apoptosis in testes and 28

PAGE 39

thymi. here ws an anuatio of sp enesis in the Akt1-null male mice, and sulin to lower blood glucose ouse platelets and is activated by platel et agonists in a PI3 kinasell Tattenerma tog thymocytes were more sensitive to -irradiation and dexamethasone-induced apoptosis. Akt1-null mouse embryo fibroblasts were also more susceptible to apoptosis induced by TNF, anti-Fas, ultraviolet irradiation, and serum withdrawal (135). Mice deficient in Akt2 are impaired in the ability of in because of defects in the action of the hormone on liver and skeletal muscle. Ablation of Akt2 in mice resulted in a mild but statistically significant fasting hyperglycemia due to peripheral insulin re sistance and nonsuppressible hepatic glucose production accompanied by inadequate compen satory hyperinsulinemia (136). In addition, Garofalo et al. showed that mice lacking Akt2 e xhibited mild growth deficiency and an age-dependent loss of adipose tissue or lipoatrophy, with all observed adipose depots dramatically reduced by 22 weeks of age (137). Akt2-deficient mice exhibit insulin-resistant wi th elevated plasma triglycerides, fasting hyperglycemia, hyperinsulinemia, glucose intole rance, and impaired muscle glucose uptake. In males, insulin resistance progressed to a severe form of diabetes accompanied by pancreatic cell failure; in contrast, female Akt2-defic ient mice remained mildly hyperglycemic and hyperinsulinemic until at least 1 year of age. Thus, Akt2-deficient mice exhibit growth deficiency similar to that reported for mice lacking Akt1, indicating that both Akt2 and Akt1 participate in the regulation of grow th. The marked hyperglycemia and loss of pancreatic cells and adipose tissue in Akt2-defic ient mice suggested that Akt2 plays critical roles in glucose metabolism and the development or maintenance of proper adipose tissue and islet mass for which other Akt/PKB isofor ms are unable to compensate fully. Akt2 is expressed in m dependent pathway. Deletion of th e Akt2 gene in mice impaired platelet aggregation, fibrinogen bindi ng, and granule secretion, esp ecially in response to low concentrations of agonists that activate the G protein-coupled receptors for thrombin and thromboxane A2. Loss of Akt2 also impaired arterial thrombus fo rmation and stability in vivo despite having little effect on platelet responses to collagen and ADP (138). Akt3 -knockout mice only exhibit an uniforml y reduced brain size, affecting a 29

PAGE 40

major brain regions, suggesting a centraf Akt3 in postnatal development of the ng. et al. DKO mice s Loss of Akt1, but not Akt2, resulted in defective ischemia and VEGF-induced angiog respon l role o brain (139). In addition, although Akt1and Akt3deficient brains are reduced in size to approximately the same degree, the absence of Akt1 reduces cell number, whereas the lack of Akt3 results in smaller and fewer cells (139). mTOR signaling is attenuated in the brains of Akt3 -/but not Akt1 -/mice, suggesting that differ ential regulati on of this pathway contributes to an isoform-sp ecific regulation of cell growth. Akt1/Akt2 double-knockout (DKO) mice were developed by Pe howed severe growth deficiency and died shortly after birth. These mice displayed impaired skin development due to a proliferation defect, skeletal muscle atrophy due to marked decrease in individual muscle cell size, and impaired bone development. The defects were similar to the phenotype of IG F-1 receptor (IGF1R)deficient mice, suggesting that Akt may serv e as an important downstream effector of IGF1R during mouse development. DKO mice also displayed impeded adipogenesis through decreased induction of PPARG (peroxi some proliferative activated receptor, ) (140). enesis and severe peripheral vascular disease in mice. Akt1-knockout mice also had reduced endothelial progen itor cell (EPC) mobilization in response to ischemia. Introduction of EPCs from wild type mice, but not EPCs from Akt1 -/mice, into wild type mice improved limb blood flow after isch emia. Loss of Akt1 reduced basal phosphorylation of several Akt substrates, migr ation of fibroblasts and endothelial cells, and nitric oxide release. This suggested that Akt1 exerts an essential role in blood flow control, cellular migration, and nitric oxide synthesis during postnat al angiogenesis (141). In vitro endothelial cells from Akt1-null mice showed impaired migration in se to VEGF and bound 3 times less fibri nogen than wild type cells. Akt1-null mice showed significantly enhanced angiogenesi s, which was associated with impaired blood vessel maturation and increased vascul ar permeability. The neovasculature in Akt1-null mice had decreased basement me mbrane thickness and decreased laminin deposition. These changes were associated with reduced expression of thrombospondin-1 (THBS1) and -2 (THBS2). This result implied that Akt1 is 30

PAGE 41

responsible for the regulation of vascular permeabi lity, angiogenic responses, and eferences Hunter, T. (2000) Cell 100, 113-127. 9) Genes Dev. 13, 2905-2927. 6. ., Nishida, J., Gima, T ., Barrett, J. C., and Wake, N. (1997) Mol. Carcinog. 7. Obata, K., Morland, S. J., Watson, R. H., Hitchcock, A., Chenevix-Trench, G., 8. ) Oncogene 19, 5582-5589. 247, 701-706. 11, 13. SA., Borgman, C. A., Cobb, B. S., Vines, R. R., Reynolds, A. B., and 14. S ., Gilman, M. Z., 15. M -3461. 65. himura, Y., and Lodish, 18. B 95) Int J Immunophamacol. 17, 10319. Geijsen, N., Koenderman, L. and Coffer, P. J. (2001) Cytokine Growth Factor Rev 12, 20. Kovanen, P. E. and Leonard, W. J. (2004) Immunol Rev. 202, 67-83. nd Waterfield, M. D. 23. F 1998) Annu. Rev. Biochem. 67, 481 24. Songyang, Z., Shoelson, S. E., Chaudhuri, M ., Gish, G., Pawson, T., Haser, W. G., 25. Y 31 vascular maturation (142). R 1 2. Reed, J. C. (1999) J. Clin. Oncol. 17, 2941-2953. 3. Datta, S. R., Brunet, A., and Greenberg, M. E. (199 4. Sengupta, P. S. Mcgown, A. T., and Bajaj, V. (2000) Eur. J. Cancer 36, 2317-2328 5. Shahin, M. S., Hughes, J. H., Sood, A. K., and Buller, R. E. (2000) Cancer. 89, 2006 2017. Kanuma, Y 18, 134-141. Thomas, E. J., and Campbell, I. G. (1998) Cancer Res. 58, 2095-2097. Valius, M., and Kazlauskas, A. (1993) Cell 73, 321-334. 9. Furge, K. A., Zhang, Y. W ., and Vande Woude, G. F. (2000 10. Neet, K., and Hunter, T. (1996) Genes cells 1, 147-169. 11. Claycomb, W. C., and Lanson, N. A. Jr. (1987) Biochem J 12. Renshaw, M. W., Kipreos, E. T., Albrecht, M. R., and Wang, J. Y. (1992) EMBO J 3941-3951. challer, M. Parsons, J. T. (1992) Proc. Natl. Acad. Sci. U. S. A. 89 5192-5196. huai, K., Ziemiecki, A., Wilks, A. F., Ha rpur, A. G., Sadowski, H. B and Darnell, J. E. (1993) Nature 366, 580-583. atsuda, T., and Hirano, T. (1994) Blood 83, 3457 16. Blume-Jensen, P., and Hunter, T. (2001) Nature 411, 355-3 17. Yoshimura, A., Zimmers, T., Neumann, D., Longmore, G., Yos H. F. (1992) J. Biol. Chem. 267, 11619-11625. aggiolini, M., Loetscher, P. and Moser, B. (19 108. 19-25. 21. Baker, S. J. and Reddy, E. P. (1998) Oncogene 17, 3261-3270. 22. Katso, R., Okkenhaug, K., Ahmadi K., White, S., Timms, J. a (2001) Annu. Rev. Cell Dev. Biol. 17, 615 675. ruman, D. A., Meyers, R. E. and Cantley, L. C. ( 507. King, F., Roberts, T., Ratnofsky, S., Lechleider, R. J., et al. (1993) Cell 72, 767 778. u, J., Zhang, Y., McIlroy, J., Rordorf-Nikol ic, T., Orr, G. A. and Backer, J. M. (1998) Mol. Cell. Biol. 18, 1379 1387.

PAGE 42

26. Yu, J., Wjasow, C. and Backer, J. M. (1998) J. Biol. C hem. 273, 30199-30203. ns, L. 28. V fer, M. (2006) J. Biol. Chem. 281, 9977 9986. t, I., 30. SH., Herman, P. K., Schu, P. V., and Emr, S. D. (1993) EMBO J 12, 219531. Misra, S., Hurley, J. H. (1999) Cell 97, 657-666 J. 346, 561-576. -820. agyan, R., 35. R Actal 436, 16537. Taki, T., Chiang, T. A., Davison, A. F., Attisano, L., Wrana, J. L. (1998) Cell 95, 38. ten Dijke, P., Heldin, C. H. (1999) Nature 397, 109-111. M., Zhao, L., Yip, S. C., 40. K 70, 829-844. es. 59, 442-449. 74, 44. S 87) Proc. Natl. Acad. Sci. U. S. A. 84, 5034. ) Science 254, 274 46. Cheng, J. Q., Godwin, A. K., Bellacosa, A., Taguchi, T., Franke, T. F., Hamilton, T. C., 47. B ardner, 48. N (1999) 49. B ) J. Biol. Chem 274, 9133. 51. K 1595. 09. 54. W ., Cohen, P., and Alessim, D. R. 32 27. Suire, S., Coadwell, J., Ferguson, G., Davidson, K., Hawkins, P. and Stephe (2005) Curr. Biol. 15, 566570. oigt, P., Dorner, M. B. and Schae 29. Arcaro, A., Volinia, S., Zvelebil, M. J., Stei n, R., Watton, S. J., Layton, M. J., Gou Ahmadi, K., Downward, J., a nd Waterfield, M. D. (1998) J. Biol. Chem. 273, 3308233090. tack, J. 2204. 32. Vanhaesebroeck, B, Alessi, D. R. (2000) Biochem 33. Fruman, D. A., Rameh, L. E., and Cantley, L. C. (1999) Cell 97, 817 34. Isakoff, S. J., Cardozo, T., Andreev, J., Li, Z., Ferguson, K. M., Ab Lemmon, M. A., Aronheim, A. and Skolnik, E. Y. (1998) EMBO J 17, 5374-5387. ameh, L. E., Cantley, L. C. (1999) J. Biol. Chem 274, 8347-8350. 36. Bottomley, M. J., Salim, K., Panayotou, G. (1998) Biochim. Biophys 183. sukaz 779-791. 39. Christoforidis, S., Miaczynska, M., Ashman, K., Wilm Waterfield, M. D., Backer, J. M., Zerial, M. (1999) Nat. Cell. Biol. 1, 249-252 rystal G. (2000) Semin. Immunol 12, 397-403 41. Waite, K. A., Eng, C. (2002) Am. J. Hum. Genet 42. Tamura, M., Gu, J., Takino, T., Yamada, K. M. (1999) Cancer R 43. Staal, S. P., Hartley, J. W., and Rowe, W. P. (1977) Proc. Natl. Acad. Sci. U. S. A 3065. taal, S. P. (19 45. Bellacosa, A., Testa, J. R., Staal, S. P., and Tsichlis, P. N. (1991 277. Tsichlis, P. N., and Testa, J. R. (1992) Proc. Nat. Acad. Sci. 89, 9267-9271. ellacosa, A., Franke, T. F ., Gonzalez-Portal, M. E., Da tta, K., Taguchi, T., G J., Cheng, J. Q., Testa, J. R., and Tsichlis, P. N. (1993) Oncogene 8, 745-754. akatani, K., Sakaue, H., and Thompson, D. A., Weigel, R. J., and Roth, R. A. Biochem. Biophys. Res. Commun. 257, 906. rodbeck, D., Cron, P., and Hemmings, B. A. (1999 50. Konishi, H., Matsuzaki, H., Tanaka, M., Ono, Y., Tokunaga, C., Kuroda, S., and Kikkawa, U. (1996) Proc. Natl. Acad. Sci. USA, 93, 7639. ulik, G., Klippel, A., and Weber, M. J. (1997) Mol. Cell. Biol 17, 52. Jones, P. F., Jakubowicz, T., and Hemmings, B. A. (1991) Cell Regul. 2, 1001 53. Yang, J., Cron, P., Thompson, V., Good, V. M., Hess, D., Hemmings, B. A., and Barford, D. (2002) Molec. Cell 9, 1227-1240. alker, K. S., Deak, M., Paterson, A., H udson, K (1998) Biochem J 331, 299-308.

PAGE 43

55. Tokumitsu, H., Takahashi, N., Eto, K., Yano, S., Sod erling, T. R., and Muramatsu, M. 56. Nakatani, K., Thompson, D. A., Barthel, A. Sakaue, H., Liu, W., Weigel, R. J., and 57. R Q., and Testa, J. R. (1998) Mol 58. S uo, W. L., Baldocchi, R., Godfrey, T., Collins, C., Pinkel, D., 59. M Liu, J. M., 60. R as, P., 61. ffer, P., 62. B 1. 00) EMBO J 19, 66. Z M. C., Miller, S. A., Y u, Z., Xia, W., Lin, S. Y., and Hung, M. C. 67. S Cell Res. 264, 29-41. es, J. A., and Eng, C. 69. L s, B., Fang, X., Yu, S. X., Davies, M. A., Khan, 70. D J. B., Caron, S., Sill, H., Marsh, D. 71. W. P., Brown, J. L., and Eng, C. (2001) Hum. Molec. Genet. 10, 237-242. M., 73. L E., and Godwin, A. K. (1998) Semin 74. Lessi, D. R., Caudwell, F. B., Andjel kovic, M., Hemmings, B. A. and Cohen, P. 75. D sters, S., Fu, H., Gotoh, Y., and Greenberg, M. E. 76. Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovic, M., and Hemmings, B. A. (1995) 77. D D., Alessi, D. R., Hue, L., and Rider, M. H. (1997) J. Biol. 78. C lvesen, G. S., Franke, T. F., Stanbridge, (1999) J Biol Chem 274, 15803-10. Roth, R. A. (1999) J Biol Chem 274, 21528-32. uggeri, B. A., Huang, L., Wood, M., Ch eng, J. Carcinog. 21, 81-86. hayesteh, L., Lu, Y., K Powell, B., Mills, G. B., and Gray, J. W. (1999) Nat Genet. 21, 99-102. a, Y. Y., Wei, S. J., Lin, Y. C., Lung, J. C., Chang, T. C., Whang-Peng, J. Yang, D. M., Yang, W. K., and Shen, C. Y. (2000) Oncogene 19, 2739-2744. odriguez-Viciana, P., Warne, P. H., Khwa ja, A., Marte, B. M., Pappin, D., D Waterfield, M. D., Ridley, A., and Downward, J. (1997) Cell 89, 457-467. Kauffmann-Zeh, A., Rodriguez-Viciana, P ., Ulrich, E., Gilbert, C., Co Downward, J., and Evan, G. (1997) Nature 385, 544-548. lume-Jensen, P., and Hunter, T. (2001) Nature 411, 355-365 63. Harari, D., and Yarden, Y. (2000) Oncogene 19, 6102-6114. 64. Prigent, S. A., and Gullick, W. J. (1994) EMBO J. 15, 2831-284 65. Olayioye, M. A., Neve, R. M., Lane H. A., and Hynes, N. E. (20 3159-3167. hou, B. P., Hu (2000) J Biol Chem 275, 8027-8031. impson, L., and Parsons, R. (2001) Exp 68. Weng, L. P., Smith, W. M., Dahia, P. L., Zi ebold, U., Gil, E., Le (1999) Cancer Res 59, 5808-5814. u, Y., Lin, Y. Z., LaPushin, R., Cueva H., Furui, T., Mao, M., Zinner, R., Hung, M. C., Steck, P., Siminovitch, K., and Mills, G. B. (1999) Oncogene 18, 7034-7045. ahia, P. L. M., Aguiar, R. C. T., Alberta, J., Kum J., Ritz, J., Freedman, A., Stiles, C., and Eng, C. (1999) Hum. Molec. Genet. 8, 185193. eng, L 72. Vasko, V., Saji, M., Hardy, E., Kruhlak, M., Larin, A., Savchenko, V., Miyakawa, Isozaki, O., Murakami, H., Tsushima, T., Burman, K. D., De Micco, C., and Ringel, M. D. (2004) J. Med. Genet. 41, 161-170. ynch, H. T., Casey, M. J., Lynch, J., White, T Oncol 25, 265-280. (1996) FEBS Lett. 399, 333-338. atta, S. R., Dudek, H., Tao, X., Ma (1997) Cell 91, 231-241. Nature 378, 785-789. eprez, J., Vertommen, Chem. 272, 17269-17275. ardone, M. H., Roy, N., Stennicke, H. R., Sa 33

PAGE 44

E., Frisch, S., and Reed, J. C. (1998) Science 282, 1318-1321. 79. D and Zeiher, A. M. 80. F e, T. J., Font ana, J., Fujio, Y., Walsh, K., Franke, T. F., 81. O nd Donner, D. 82. R S. S. (1999) Nature 401, 86-90. K., Konishi, H., 84. K n, D. Y., Chun, J., Kim, J. H., and Kang, S. S. (2000) J. Biol. Chem 85. Z and Moelling, K. (1999) Science 286, 1741-1744. R., Reid, K., 87. N 88. A N., Papautsky, A., Downward, J., Roberts, T. M., and 89. P n, M., Kanety, H., Seger, R., 90. P Hu, L. S., Anderson, M. J., 92. D m 274, 1308594. Zhou, B. P., Liao, Y., Xia, W., Zou, Y., Spohn, B., and Hung, M. C. (2001) Nat. Cell 95. Z g, M.C. (2002) Semin. Oncol 29, 62-70. 0) J. Biol. Chem 275, 97. Datta, S. R., Katsov, A., Hu, L., Petros, A. Fesik, S. W., Yaffe, M. B., and Greenberg, 98. C H. R., Salvesen, G. S., Franke, T. F., Stanbridge, 99. F Momoi, T. (1999) 100. Science 253, 905-909. R., and 102. e uter-Reinhard, M., Henriquez, R., and Hall 103. 4 immeler, S., Fleming, I., Fisslthaler, B., Hermann, C., Busse, R. (1999) Nature 399, 601-605. ulton, D., Gratton, J. P., McCab Papapetropoulos, A., and Sessa, W. C. (1999) Nature 399, 597-601. zes, O. N., Mayo, L. D., Gustin, J. A., Pfef fer, S. R., Pfeffer, L. M., a B. (1999) Nature 401, 82-85. omashkova, J. A., and Makarov 83. Kitamura, T., Kitamura, Y., Kuroda, S., Hi no, Y., Ando, M., Kota ni Matsuzaki, H., Kikkawa, U., Ogaw a, W., and Kasuga, M. (1999) Mol. Cell. Biol. 19, 6286-6296. won, T., Kwo 275, 423-428. immermann, S., 86. Rommel, C., Clarke, B. A., Zimmermann, S., Nunez, L., Rossman Moelling, K., Yancopoulos, G. D., and Glass, D. J. (1999) Science 286, 1738-1741. ave, B. T., Ouwens, M., Withers, D. J., Alessi, D. R., and She pherd, P. R. (1999) Biochem. J. 2, 427-431. ltiok, S., Batt, D., Altiok Avraham, H. (1999) J. Biol. Chem 274, 32274-32278. az, K., Liu, Y. F., Shorer, H., Hemi, R., LeRoith, D., Qua and Zick, Y. (1999) J. Biol. Chem 274, 28816-28822. aradis, S., and Ruvkun, G. Genes Dev. 12, 2488-2498. 91. Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Arden, K. C., Blenis, J., a nd Greenberg, M. E. (1999) Cell 96, 857-868. u, K., and Montminy, M. (1998) J. Biol. Chem 273, 32377-32389. 93. Kang, S. S., Kwon, T., Kwon, D. Y., and Do, S. I. (1999) J. Biol. Che 13090. Biol 3, 973-982. hou, B. P., and Hun 96. Tang, Y., Zhou, H., Chen, A., Pittm an, R. N., and Field, J. (200 9106-9109. M. E. (2000) Mol. Cell 6, 41-45. ardone, M. H., Roy, N., Stennicke, E., Frisch, S., and Reed, J. C. (1998) Science 282, 1318-1321. ujita, E., Jinbo, A., Matuzaki, H., Konishi, H., Kikkawa, U. and Biochem. Biophys. Res. Commun 264, 550. Heitman, J., Movva, N. R., and Hall, M. N. (1991) 101. Kunz, J., Henriquez, R., Schneider, U., Deuter-Reinhard, M., Movva, N. Hall, M. N. (1993) Cell. 73, 585-596. Helliwell, S. B., Wagner, P., Kunz, J., D M. N. (1994) Mol Biol Cell. 5, 105-118. Abraham, R. T. (2002) Cell 111, 9-12. 3

PAGE 45

10 ScmT.aN.) Cell 103, 4.helzle, and Hll, M. (2000 253-262. A., Ray, S., Kogan, S., 106. 307, 107. lion, M., Toker, A., Thomas, J.H., and Ruvkun, G. (1999) Genes Dev. 108. Cichy, S. C., Un terman, T. G., and Cohen, P. (1999), J. Biol. Chem 109. helder, J., Hunter, T., Cavenee, W. K., and Arden, K. C. (1999), 110. (2003) Proc. Natl. Acad. Sci. U. S. 111. D., De Vries-Smits, A. M., Powell, D. R., Bos, J. L. and 112. ukoc. Biol 73, 689. (2002) Mol. Cell. 115. Hu, M. C., Lee, D. F Xia, W., Golfman, L. S., Ou-Yang, F., Yang, J. Y., Zou, Y., 116. Navolanic, P. M., Steelman, L. S. and McCubrey, J. A. (2003) Int J Oncol 22, 237117. (2002) J. Leukoc. Biol 72, 440. A. Bullrich, F. Hi rata, Y., Bichi, R., 119. 120. P., Pate l, N. M., Constantin idou, D., Ali, S., and 121. 01) Proc Natl Acad Sci U S A. 98, 122. u, B. P., Xia, W., Wu, Y., Yang, C. C., Chen, C. T., Ping, B., Otte, A. 123. Zeiher, A. M., and Dimmeler, S. 125. 002) J. Biol. Chem 277, 113521361. ., 127. ., Kotchetkov, R., Connor, M. K., Han, K., Lee, J. 35 105. Wendel, H. G., de Stanchina, E., Fridma n, J. S., Malina, Cordon-Cardo, C., Pelletier, J., and Lowe, S. W. (2004) Nature 428, 332-337. Sarbassov, D. D., Guertin, D. A., Ali, S. M., and Sabati ni, D. M. (2005) Science 1098-1101. Paradis, S., Ai 13, 1438. Rena, G., Guo, S., 274, 17179. Biggs, W. H., Meisen Proc. Natl. Acad. Sci. U. S. A. 96, 7421. Wolfrum, C., Besser, D., Luca, E., and Stoffel, M A 100, 116241629. Kops, G. J., de Ruiter, N. Burgering, B. M. (1999), Nature 398 630. Burgering, B. M., and Medema, R. H. (2003) J. Le 113. Li, Q., and Verma, I.M. (2000) Nat. Rev. Immunol 2, 725. 114. Kane, L. P., Mollenauer, M. N., Xu, Z., Turck, C. W., and Weiss, A Biol 22, 5962. ., Bao, S., Hanada, N., Saso, H., Kobaya shi, R., and Hung, M. C. (2004) Cell 117, 225-237. 252. He, Y. W 118. Pekarsky, Y., Hallas, C., Palamarchuk, A., K oval, Letofsky, J., and Croce, C. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 3690. Simoncini, T., Hafezi-Moghadam, A., Brazil, D. P., Ley, K., Chin, W. W., and Liao, J. K. (2000) Nature. 407, 538-541. Campbell, R. A., Bhat-Nakshatri, Nakshatri, H. (2001) J Biol Chem 276, 9817-24. Lin, H. K., Yeh, S., Kang, H. Y., and Chang, C. (20 7200-7205. Cha, T. L., Zho P., and Hung, M. C. (2005) Science 310, 306-310. Coqueret, O. (2003) Trends Cell Biol 13, 65. 124. Rossig, L., Jadidi, A. S., Urbich, C., Bador ff, C., (2001) Mol. Cell. Biol. 21, 5644. Li, Y., Dowbenko, D., and Lasky, L. A. (2 126. Viglietto, G., Motti, M. L., Bruni, P., Melillo, R. M., D'Alessio, A., Califano, D Vinci, F., Chiappetta, G., Tsichlis, P., Bellacosa, A., Fusco, A., and Santoro, M. (2002) Nat. Med 8, 1136144. Liang, J., Zubovitz, J., Petroc elli, T H., Ciarallo, S., Catzavelos, C., Beniston, R., Franssen, E., and Slingerland, J. M. (2002). Nat. Med 8, 1153160.

PAGE 46

12 Shn,ke., F., N. Y ., B 8.i I., Yas, F. M Rojo,, Shin akin, A. V., Baselga, J., and Arteaga, C. 129. t. Rev 2, 594. 346. 11598 132. Ashcroft, M., Ludwig, R. L., Woods, D. B., Copeland, T. D., Weber, H. O., MacRae, 133. zuki, T., Tanaka, K., 134. ller, G. N. 135. Ch en, M.-L., Sokol, K., Shiyanova, T., Roninson, 136. Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B., III, 137. Garofalo, R. S., Orena, S. J., Rafidi, K., Torchia, A. J., Stock, J. L., Hildebrandt, A. 138. R., Birnbaum, M., and Brass, L. F. 139. hineman, D. W., Mizrahi, M., Forman, M. S., 140. Skeen, J., Jacobs, J., 141. Iwakiri, Y ., Skurk, C., Shibata, R., Ouchi, N., Easton, 142. Razorenova, O., Chen, W. S., Hay, N., Bornstein, P., and 36 L. (2002) Nat. Med 8, 1145152. Vousden, K. H., and Lu, X. (2002) Na 130. Shimizu, H., and Hupp, T. R. (2003) Trends Biochem. Sci 28, 131. Mayo, L. D., and Donner, D. B. (2001) Proc. Natl. Acad. Sci. U. S. A 98 11603. E. J., and Vousden, K. H. (2002) Oncogene 21, 1955. Ogawara, Y., Kishishita, S., Obata, T., Isazawa, Y., Su Masuyama, N., and Gotoh, Y. (2002) J. Biol. Chem 277, 21843. Holland, E. C., Celestino, J., Dai, C., Schaefer, L., Sawaya, R. E., and Fu (2000) Nature Genet. 25, 55-57. Chen, W. S., Xu, P. Z., Gottlob, K., I., Weng, W., Suzuki, R., Tobe, K., Kadowaki, T., and Hay, N. (2001) Genes Dev. 15, 2203-2208. Kaestner, K. H., Bartolomei, M. S., Shul man, G. I., and Birnbaum, M. J. (2001) Science 292, 1728-1731. L., Coskran, T., Black, S. C., Brees, D. J., Wicks, J. R., McNeish, J. D., and Coleman, K. G. J. Clin. Invest. 112, 197-208. Woulfe, D., Jiang, H., Morgans, A., Monk s, (2004) J. Clin. Invest. 113, 441-450. Easton, R. M., Cho, H., R oovers, K., S Lee, V. M. Y., Szabolcs, M., de Jong, R., Oltersdorf, T., Ludwig, T., Efstratiadis, A., and Birnbaum, M. J. (2005) Mol Cell Biol. 25, 1869-1878. Peng, X., Xu, P. Z., Chen, M. L., Ha hn-Windgassen, A. Sundararajan, D., Chen, W. S ., Crawford, S. E., Coleman, K. G., and Hay, N. (2003) Genes Dev. 17, 1352-1365. Ackah, E., Yu, J., Zoellner, S. R. M., Galasso, G., Birnbaum, M. J., Walsh, K., and Sessa, W. C. (2005) J. Clin. Invest. 115, 2119-2127. Chen, J., Somanath, P. R. Byzova, T. V. (2005) Nature Med. 11, 1188-1196.

PAGE 47

Chapter 2 Molecular cloning and characterization of the human AKT1 promoter uncovers its upregulation by the Src/Stat3 pathway Abstract Akt1, also known as protein kinase B (PKB ), is frequently activated in human cancers and has been impli cated in many cell processe s by phosphorylation of downstream molecules. However, transcriptional regulation of the Akt1 has not been documented. Here, we report the isola tion and characteriza tion of the human AKT1 promoter and demonstrate transc riptional upregulation of the AKT1 by the Src/Stat3 pathway. Protein and mRNA levels of AKT1 are elevated in cells expressing constitutively active Stat3 as well as in v-Src-transformed NIH3T3 cells. Knockdown of Stat3 reduces the AKT1 expression indu ced by v-Src. While the 4.2-Kb region upstream transcription start site of the AKT1 promoter contains five putative Stat3binding motifs, the promoter failed to be induc ed by Stat3 and/or Src. Further analysis reveals that major Stat3 response elements are located within exon-1 and intron-1 regions of the AKT1 gene, which is upstream of AKT1 transl ation initiation site. In addition, ectopic expression of wild type AKT1 in St at3/ MEF cells largely rescues serum starvation-induced cell death. Th ese findings indicate that the AKT1 promoter comprises the exon-1 and intron-1 in addition to the sequence upstream of transcriptional start site. Our data further show that the AKT1 is a direct target gene of Stat3 and contributes to Stat3 antiapoptotic function. 37

PAGE 48

In troduction Akt/PKB represents a subfamily of the se rine/threonine protein kinases. Three embers of this family, Akt1/PKB Akt2/PKB and Akt3/PKB have been identified -7). Akt1/PKB is the most extensively studied member and usually referred to Akt o stress) and intracellular as) stimuli to regulate ell growth, survival, differentiation and me tabolism (8-11). Activation of Akt by growth factor depends on the integrity omain, which binds to PI3K products tdIns-3,4-P2 and PtdIns3,4,5-P3, and on the phosphorylati on of Thr308 (Thr309 in Akt2 an cell differentiation (21). In addition, icroinjection of anti-Akt1 antibodies bloc ks cell cycle progression, whereas anti-Akt2 ntibodies have no effect on cell cycle but attenuate muscle differentiation (22). Amplification of the Akt1 gene has been detected in a single gastric carcinoma m (1 r PKB in the literature. Akt is activated by extracellular (growth f actor, cytokine and (altered receptor tyro sine kinase, Src and R c of th e PH d P d Thr305 in Akt3) in the activation loop and Ser473 (Ser474 in Akt2 and Ser472 in Akt3) in the C-terminal activation domain by PDK1 and ILK/DNA-PK (12-14). The activity of Akt is negatively regulated by PTEN a tumor suppressor gene that is mutated in a number of human malignancies. PTEN encodes a dual-specific ity protein and lipid phosphatase that reduces intracel lular levels of PtdIns-3,4-P2 and PtdIns-3,4,5-P3 in cells by converting them to PtdIns-4-P1 and PtdIns-4,5-P2, respectively, thereby inhibiting the PI3K/Akt pathway. There are no significant differences between three members of Akt in terms of upstream regulators and downstream targets. However, several lines of evidence suggest that the biological/physi ological functions of Akt1, Ak t2 and Akt3 are different. First, there are different levels of activati on and protein expression in various cell types between Akt1, Akt2 and Akt3 (5, 15-18). Second, multimeric complexes formed by Akt proteins are restricted to individual member, for exampl e, Tcl1b binds to Akt1 and Akt2 but not Akt3, indicating the need to maintain specificity in interactions with other signaling proteins (19). Th ird, although Akt1 and Akt2 proteins require membrane localization for activity, only Akt2 appears to accumulate in the cytoplasm during mitosis (20) and in the nucleus during muscle m a 38

PAGE 49

cell line (23), w hereas the Akt2 is amplified in different type s of human tumor (16-17, 24). ctopic expression of wild type Akt2, but not Akt1 and Akt3, results in invasion and metasta AKT1 gene. AKT1 is transcriptionally upregulated by Stat3 and Src. E g Akt, Stat3 a ). E sis in human breast and ovarian can cer cells (25) and induces a malignant phenotype in mouse fibroblasts (20). Fina lly, knockout mouse studies demonstrated distinct phenotype between Akt1, Akt2 and Akt3. The mice deficient in the Akt2 are impaired in the ability of insulin to lower blood glucose because of defects in the action of the hormone on skeletal muscle and liver, si milar in some important features to type 2 diabetes in human. In contrast, Akt1 -dificient mice do not display a diabetic phenotype. The mice are viable but display impairment in organismal growth with smaller organs than wild type littermates (26-28). In contrast, a recent report shows that Akt3-/knockout mice only exhibit a un iformly reduced brain size, affecting all major brain regions, suggesting a central role of Akt3 in postnatal development of the brain (29). While Akt1 signaling has been extensiv ely investigated, its transcriptional regulation remains largely unknown. In the present report, we have isolated and characterized the human AKT1 promoter. Multiple putative Stat3-binding sites reside within the promoter and major Stat3 response elements are identified in the exon-1 and intron-1 regions of the levated expression level of AKT 1 induced by Src is inhibited by dominant negative Stat3. Stat3/ MEFs display lower level of Akt1 and reintroduction of the AKT1 largely rescued cell death in response to serum starvation. Therefore, our results provide the first evidence that the AKT1 is a direct Stat3 target and mediates Stat3 survival signal. Material and methods Cell Culture, Plasmids, Ma terials and Transfection Human epithelial kidney HEK293, MCF10A, MCF7, mouse fibroblast NIH3T3, Src transformed NIH3T3, and Stat3 mouse embryonic fibroblast (MEF) were grown in Dulbeccos modified Eagles medium (DMEM) containing 10% fetal bovine serum. The plasmids expressin nd Src as well as domina nt negative Stat3 have been de scribed previously (30, 34 39

PAGE 50

The antibodies to Akt1 and Stat3 were purchased from Cell Signaling and Santa Cruz Biotechnology, respectively. For transfection, th e cells were seeded 18-24 h before transfection using Lipofectamine plus. The sequence for Stat3 antis ense oligonucleotide synthesized using phosphorothioate chem istry is 5-AAAAAGTGC CCAGATTGCCC-3. The sequence for control oligonucleotide is identical to the antis ense oligonucleotide except for three mismatched bases (italics), 5AAAAAG A G G CCT GATTGCCC-3. The sequence of Stat3 siRNA is 5'-AAC AUC UGC CUA GAU CGG CUA dTdT-3'; 3'dTdT GUA GAC GGA UCU AGC CGA U-5'. Transcription Start Site Mapping of Human AKT1 Gene For the analysis of the AKT1 transcription start site, human MCF7 mRNA was reverse transcribed at 55C using Supercript reverse transcriptas e (Invitrogen) and a primer from the AKT1 exon-1 specific reverse complement oligonucle otide 5'TGACTTC TTTGACCCAGGCTGG3' (31). am the translational star t site. Two DNA fragments (-4293/+1 and 293/+1888, Fig. 9C) were amplified with GC-RICH PCR System (Roche) using a e. The amplified DNA fragments -4293/+1 and 4293/+1888 ere subcloned into the luciferase reporter vector pGL3 (Promega) at Kpn I/Bgl II site. Progre Synthesized cDNAs were amplified by polymerase-chain reaction using a series of forward primers specific for the DNA seque nces within the 6,000 bp upstream of the translation start site and a reverse primer from the non-coding region of exon 1, and the products of these reactions were reso lved by agarose gel electrophoresis. Cloning and Analysis of Human AKT1 Promoter To clone the 5'-flanking region of the human AKT1 gene, 4 cosmid clones were obtaine d by screening a human placenta genomic cosmid library (Stratagene) using 5 non-coding region (a 520-bp fragment from ATG site) of the AKT1 as a probe. The cosmid clones were sequenced and compared with human genome database. Three clones were found to contain 12~28-kb DNA fragments upstre 4 cosmid clone as templat w ssive deletion mutants of the pGL3AKT1 promoter were created by PCR. The integrity of constructs was confirmed by D NA sequencing. The primers were used as follow: -4293(5) 5-CTTCGTGAACATTAACGACAGG GCCTGG-3; -3392(5) 5GTTCAGGCAGAACCTCTGCAGACTCAGG-3; -3356(5) 5-CTGG CCTGGGAGC TGCCCTGAGG-3; -2741(5) 5CTCTGCTTCCTCCCTGAATTCCTTCCTCC-3; 40

PAGE 51

1603(5) 5-CAGCCTGAAAGTCAACCTAAGC -3; -1361(5) 5-CAGCCCGGCCGC GCGCTCCCCG-3; -460(5) 5-GGCTAGCCACAAAGG ACTGTGACC-3; -880 (3) 5CCAGAATGGAGGAGCGGGAGCAGGAAGT-3; -732 (3) 5-GCCCCAGCCTCC CTCATGACCTT-3; -305 (3) 5-GCTTGCCCCTTAGATTGAGTAT-3; -103 (3) 5GGAGCTGTGTAGACTTCTCATACA-3; +159(3) 5-GCTCTGGACAG CTGTCTG ACTCTGT-3; +595(3) 5-GGCTGTGGAAAGACCCATGTTG-3; +1809(3) 5GCTTCCTTTGCTTCTCCCAGAGG-3. Luciferase Reporter Assay NIH3T3 or HEK293 cells were cultured in 12-well plates cted using the RNeasy and transiently transfected with AKT 1-Luc, Src and/or Stat3. The amount of DNA in each transfection was kept constant by the addition of empty vector. After 36 h of transfection, luciferase activity was measured using a luciferase assay reagent (Promega). Transfection efficiency was normalized by co-transfection with galactosidase expressing vector. The -galactosidase activity was measured by using Galato-Light (Tropix). Luciferase activity was expressed as relative luciferase activity. Northern and Western Blot Analysis Northern blot analysis of total cellular RNA was performed according to standard procedures. RNA was extra purification kits (QIAGEN Inc.). Total RNA was elect rophoresed in 1.0% formaldehyde-agarose gels, transferred to Duralon-UVTM membrane (Srtatagene), and then hybridized with randomly primed 32 P-labeled cDNA probes for AKT1 Membranes were exposed to autoradiography an d the mRNA levels were visualized and quantified using PhosphorImager analysis (Molec ular Dynamics). Western blot analysis was performed as described previously (32). Briefly, the cells were lysed with RIPA buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% Triton x-100, 1% Sodium deoxycholate. 0.1% SDS, 1 mM EDTA. 1 mM PMSF, 5 g/ml aprotinin and 5 g/ml leupeptin), separated in SDSPAGE and immunoblot ted with appropriate antibodies as indicated in the figure legends. ChIP and EMSA Assay ChIP assay was performed essentially as previously described (33). Solubilized chromatin was prepared from a total of 2 X 10 7 asynchronously growing HEK293 cells that were transfected with wild type Stat3 and vSrc. The chromatin solution was diluted 10-fold with ChIP dilution buffer (1.1% Triton 41

PAGE 52

, 1.2 mM EDTA, 167 mM NaCl, 16.7 mM Tr isHCl, pH 8.1, 0.01% SDS, protease NA were removed by incubation with 10 g protein CCCTA GAGCCTCCAGCC-3. Amplified PCR products were resolve inhibitors), and precleared w ith protein-A beads blocked with 2 g sheared salmon sperm DNA and pre-immune serum. The preclear ed chromatin solution was divided and utilized in immunoprecipitation assa ys with either an antiStat 3 antibody or an anti-actin antibody. Following wash, the antibody-prot ein-DNA complex was eluted from the beads by resuspending the pell ets in 1% SDS, 0.1 M NaHCO3 at room temperaturefor 20 min. After crosslinking, protein and R ase K and 10 g RNase A at 42 C fo r 3 h. Purified DNA was subjected to PCR with primers specific for 13 putative Stat3-binding sites within the AKT1 promoter. The sequences of the PCR primers used are as follows: region 1 forward (-4293) : 5CTTCGTGAACATTAACGACAGGGCC-3, reverse (-4143) : 5-AATGGCCACCCTG ACTAAGGAGTGG-3; region 2 forward (-4221) : 5AACCCTTCACTGGTTTCTCT TCATCC-3, reverse (-4056) : 5-TGCTGGAATATCCCACAATCACAGG-3; region 3 forward (-4134) : 5TTCCCTCGCAGT CCCTTCTGCTGC-3, reverse (-3840) : 5CTTCCTCTGAAGGTTCAGG-3; region 4 forward (+233) : 5ATCCAGAG GTCTTTGAGTCCAGCC-3, reverse (+438) : 5-TGCCAGGACAGGGAACACAGG3; region 5 forward (+413) : 5-AGGTGTGGTCTTCCCTGTCCTGGC-3, reverse (+481) : 5-GCTACACTTAGAATGGCAGGAAGG-3; region 6 forward (+447) : 5AGGCAGTGGGCCTTCCTGCCATTC-3, reverse (+598) : 5-TCCC AACATGGGTCT TTCCACAGC-3; region 7 forward (+831): 5-GGATAAAGTGTGCTCAGGTGAGG G-3, reverse (+1038): 5-GGCGTCTCAGGT TTTGCCAGGGGG-3; region 8 forward (+989) : 5-TCTCTTTGTCTCCAGCGCCCAGG3, reverse (+1200) : 5ATGAGGAA GAGAGGACCAGGATGC-3; region 9 forward (+1262) : 5-GATCCATGGGTAGGA ACACCATGG-3; reverse (+1419) : 5-TTCCCAGCCTCCCTAACCTGATGC-3; region 10 forward (+1440) : 5AGCCTGGGTCAAAGAAGTCAAAGG-3, reverse (+1598) : 5-ATTCTAGGCTTA d by 1.2% of agarose gel electrophoresis and visualized by BioImage. EMSA was performed as previously described (35). MTT Assay MTT assay was done following the pr ocedure described previously (36). Briefly, conditional STAT3 -/MEF cells (4 x 10 3 cells/well) were plated in 9642

PAGE 53

well microtiter plates and infected with re trovirus expressing Cre for disrupting Stat3. After infection, wild-type Akt1 was transf ected into the cells using LipofectAmine (Invitrogen). Cells were serum starved, incubated with MTT (10 l/well) and solubilized with 100 l/wel l of 20% sodium dodecyl su lphate (SDS) in 50% DMF (pH4.7) at room temperature for 4 h. Abso rbance was determined in a Titertek plate reader at 570 nm. The absorbance is directly related to viable cell number. The experiment was repeated three times. Results Cloning of the Human AKT1 Promoter R eveals Multiple Putative Stat3 Binding Sites To analyze the transcriptional regula tion of the serine/threonine kinase AKT1 we cloned the 5 flanking region of the human AKT1 gene. Sequence analyses revealed that the AKT1 gene consists of 12 exons. The exon-1 is 1.4 kb and locates within the 5 untranslated region. The translation initiation site ATG resides within the exon 2 (Fig. 9A). The transcripti on start site, which was determined by 5 race PCR, lies 1,888-bp upstream of the translation star t site. A putative TATA box was identified 7-bp upstream of th e transcriptional st art site. Transcription element analyses ( http://www.motif.genome.ad.jp ) of 6,181 bp of upstream of translation initiation site of the AKT1 gene revealed multiple binding sites for Stat3, NF B AP1 and GC box within the these regions (Fig. 9B). The transcription factor that has the most binding sites in the AKT1 promoter is Stat3 (t welve putative Stat3 binding sites; -4230/4223, -4143/-4136, -4053/-4046, -3287/3278, 2851/-2844, +407/+414, +439/+448, +483/+491, + 978/+986, +1047/+1055, +1324/+1331, and +1443/+1450). Consensus sequences of Stat3 binding site are TT(N) 4-6 AA (37). These observations suggest that the AKT1 gene could be regulated by Stat3 at transcriptional level. Stat3 Increases AKT1 Expression at mRNA and Protein Levels To directly demonstrate whether the AKT1 is transcriptionally regulat ed by Stat3, MCF-10A cells 43

PAGE 54

FIGURE 9. Human AKT1 promoter contains multiple Stat3-binding sites. A, schematic representation of the human AKT1 genomic locus. The exons are shown as boxes 1. B the AKT1 promoter sequence. Putative transcription factor binding sites are boxed. Transcriptional start site and boundaries of exon 1, intron 1, and exon 2 are indicated. Putative TATA box was b oxed within the AP-1-binding site. The translation initiation ite, ATG, was shaded. C, a diagram displays the location of 12 putative Stat3-binding ites indicated by asterisk within the 6-kb AKT1 promoter. ss were infected with adenovirus expressing constitutively active Stat3 (Stat3C) and 44

PAGE 55

dominant negative Stat3. The cells infected with adeno-GFP vector were used as control. Northern blot analysis showed that constitutively active Stat3C upregulates the AKT1 (Fig. 10A). Further, immunoblotting study revealed an elevated protein level of AKT1 in the cells treated with constitutively active Stat3C (Fig. 10B). Expression of dominant negative Stat3 sligh tly inhibited the mRNA and prot ein levels of AKT1 (Figs. 10A and 10B). As Stat3 is strongly activated by Src kinase (30), we next examined if expression level of AKT1 is elevated in v-Sr c transformed NIH3T3 cells. As shown in Figs. 10C and 10D, both protein and mRNA leve ls of AKT1 were significantly increased in v-Src transformed NIH3T3 cells. Further, blockage of Stat3 with antisense RNA considerably reduced v-Src-induced AKT1. Moreover, upregulation of AKT1 was also detected in human breast cancer cell line MDAMB-468, which exhibits constitutively active Src and Stat3, but not in MDA-MB453, which does not. Inhibition of Src/Stat3 by Src inhibitor (PD180970) or Stat3-SiRNA reduced AKT1 protein level in MDA-MB468 (Figs. 10E and 10F). In addition, conditional knockout of the Stat3 gene decreased Akt1 expression in mouse embryonic fibroblas ts (Fig. 14A). Based on these data, we concluded that the Akt1 is a downstream target of Stat3. Stat3 Transactivates the AKT1 Promoter We further examined whether the AKT1 promoter is regulated by Stat3. Lucifera se reporter assay revealed that pGL3AKT1-4293/+1, which contains 5 putative Stat3 binding sites, was not stimulated by wild type or constitutively active Stat3 even when Stat3 was combined with v-Src (Figs. 11A and 11B). However, ectopic expression of constitutively active Stat3 significantly induced the pGL3-Akt1-4293/+1888 activity (F ig. 11C), suggesting that major Stat3 sponse elements reside in the region of the AKT1 gene between transcription start site rmed (Fig. 10), we assumed that the AKT1 promoter should be induced by Src through Stat3. To re and translation initiation site, which contains exon-1 and intron-1 (Fig. 9B). Src Induces AKT1 promoter Activity through Stat3 As v-Src transfo NIH3T3 cells express high levels of AKT1 that was attenuated by knockdown Stat3 test this hypothesis, lucife rase reporter assay was perf ormed with NIH3T3 cells 45

PAGE 56

FIGURE 10. Up-regulation of the AKT1 by Stat3 and Src. A and B, constitutively active Stat3 increases AKT1 expression. MCF10A cells were infected with adenovirus expressing constitutively active Stat3C, dominant negative Stat3, and g reen fluorescent protein (GFP). After incubation for 48 h, cells were subjected to Northern (A) and Western (B) blot analyses. C, v-Src transformed NIH3T3 cells express elevated levels of Akt1. pcDNA3 and v-Src stably transfected NIH3T3 cells were lysed and immunoblotted with the indicated antibodies. D, blockage of Stat3 inhibits v-Src-upregulated Akt1. v-Src-transformed NIH3T3 cells were transiently transfected with antisense oligonucleotides of Stat3 and control oligonucleotides. Total RNA was isolated and subjected into Northern blot analysis with [32P] dCTP-labeled Akt1 (top). The second panel represents equal loading of total RNA. Expression of Stat3 was examined by immunoblotting with anti-Stat3 antibody (third panel). Bottom panel shows equal protein loading. E, the AKT1 protein level is elevated in human breast cancer cells with activation of Src and Stat3, and inhibition of Src reduces AKT1 were lysed and indicated antibodies. expression. MDA-MB-468 cells expressing constitutively active Src and Stat3 were treated with or without a Src inhibitor, PD180970 (250 ng for 24 h), and immunoblotted with the indicated antibodies. MDA-MB-453 cells with low levels of Src and Stat3 activity were used as control. F, knockdown of Stat3 reduces AKT1 expression. MDA-MB-468 cells were transfected with Stat3-siRNA (+) or scramble siRNA (-) using Oligofectamine. After 48 h of incubation, cells immunoblotted with the 46

PAGE 57

transfected with v-Src, pGL3-AKT1-4293/+1888 and wild ty12A, expression of v-Src alone induces the reporter activity expression of v-Src and Stat3 significantly stimulated thFurther, wild type Stat3 enhances v-Src induced the AKT1 prmanner (Fig. 12B). Notably, expression of dominant negative Stat3 considerably reduces the AKT1 promoter activity induced by v-Src (Fig. that Stat3 mediates Src stimulated AKT1 promoter activity. FIGURE 11. Constitutively active Stat3 induces AKT1-4293/+1888, but not AKT1-4293/+1 luciferase activity. NIH3T3 cells were transfected with AKT1-4293/+1-Luc (A and B) and AKT1-4293/+1888-Luc (C), -galactosidase and expression constructs are indicated in the figure. Following a 36-h culture, luciferase activity was measured and normalized to -galactosidase. Results are the mean S.E. of three independent experiments performed in iplicate. pe Stat3. As shown in Fig. about one-fold, whereas co-e AKT1 promoter activity. omoter in a dose dependent 12C). These data indicate tr 47

PAGE 58

Stat3 Response Elements are primarily located within Exon-1/intron-1 Region As shown in Fig. 9C, twelve putative Stat3 binding motifs were identified within ~6.0-kb region upstream translation initiation site of the AKT1 gene. Src and Stat3 induced pGL3-AKT1-4293/+1888 but not pGL3-AKT1-4293/+1 activity (Fig. 11), implying that the Stat3 response elements reside in a region between transcription start site and translation initiation site. To test this, we created a series of deletion mutants of the FIGURE 12. AKT1 promoter is activated by Src through Stat3. A, v-Src, but not wild type Stat3 stimulates Akt1 promoter activity. NIH3T3 cells were transfected with the indicated plasmids and subjected to luciferase reporter assay. B and C, v-Src-induced AKT1 promoter activity was enhanced by coexpression of wild type Stat3 but reduced by dominant negative gion between -4293 and -3172, i.e., pGL3-AKT1 -3172/+1888 considerably reduced Stat3. The transfection and luciferase reporter were performed as described in the legend to Fig. 5. AKT1 promoter. Reporter assay showed that pGL3-AKT1 -325/+1888 was significantly induced by coexpression of v-Src/Stat3 (Figs. 11C and 13A), whereas deletion of a re 48

PAGE 59

SIE oligonucleotides were used as positive control (right panel). 49 FIGURE 13. Definition of the Stat3 response elements. A and B, major Stat3 response elements located within the exon 1/intron 1 region of the AKT1 promoter. A series of deletion mutants of the AKT1 promoter (left) were introduced into NIH3T3 cetogether with or without lls v-Src/Stat3 (A) or constitutively active Stat3C (B) and then subjected to luciferase reporter assay. C, Stat3 binds to 4 sites of the AKT1 promoter in vivo. ChIP assay was performed as described under Experimental Procedures. Triple experiments showed that Stat3 directly binds to 4 sites of the AKT1 promoter. D, mutation of Stat3 DNA-binding sites within the AKT1 promoter abrogates the Src/Stat3-stimulated promoter activity. Luciferase assay was performed in NIH3T3 cells transfected with the AKT1-Luc/-325/-1888 and its mutants as well as v-Src and Stat3. E, Stat3 binds to DNA oligonucleotides corresponding to Stat3 SIE/GAS binding sites in the Akt1 promoter. EMSA of double-stranded oligonucleotides containing Stat3-binding sites are indicated on the top. Equal a 100 M excess of the unlabeled oligonucleotides (competitor). amounts of 32P-labeledoligonucleotides were incubatedwith nuclear extract preparedfrom Stat3C-transfected HEK293cells in the presence or absence of

PAGE 60

the promoter activity. Further, pGL3-AKT 1-3172/+5 (Fig. 13A) indicating that the major Stat3 response regions, where there are 7 putativ e Stat3 binding mot the promoter. Notably, the results also suggest th binding site(s) within -3172/325 region because the increased by deletion of this region as rev ealed by co 3172/+1888 and -325/+1888 (Figs. 13A and 13B). T bind to the Stat3-binding site within the AKT1 promot Stat3 response elements in the promoter, we carried o (ChIP) assay, which de tects specific genomic DNA se particular transcription factor in intact cells. Human transfected with wild-type Stat3 and v-Src and immuno The Stat3 bound chromatin was subjected to PCR u amplify region spanning each Stat3-binding site withi in Fig. 13C, the anti-Stat3 antibody pulled down four +978/+986, +1324/+1331, and +1443/+1450 (SB1, S immunoprecipitation with an irrelevant antibody (ant bands in these sites. These results indi cate that S promoter. By mutation of Stat 3 binding consensus 325/+1888 that is highly induced by Src/Stat 3 and further demonstrated that the Stat3 binding sites (SB6, intron-1 region are required for Stat3 transactivation Moreover, EMSA assay revealed th at Stat3 is capa oligonucleotides corresp onding to the four Stat3 SIE/G Akt1 promoter (Fig. 13E). Unlike SIE positive c ontro detected in these four Stat3 binding sites within the shown), which is also observed in other Stat 3-induced and c-Myc (34, 38, 39). AKT1 Mediates Stat3 Function Both Stat3 and AKT1 play an essential role in 95 failed to respond to v-Src/Stat3 elements exis t in exon-1/intron-1 ifs, as well as in a distal region of e presence of a repression factor promoter activity is significantly mparison of the activity between o determine if Stat3 could directly er in vivo and to further define the ut chromatin immunoprecipitation quences that are associated with a kidney cell line, HEK293, were precipitated with a Stat3 antibody. sing oligonucleotide primers that n the AKT1 promoter. As shown Stat3 bindi ng sites (-4230/-4223, B7, SB9 and SB10). In contrast, i-actin) resulted in the absence of tat3 directly binds to the AKT1 sequences (TT GG) in AKT1 Stat3C (Figs. 13A and 13B), we SB9 and SB 10) within exon-1 and of the AKT1 promoter (Fig. 13D). ble of binding in vitro to DNA AS binding sites identified in the l, however, the supershift was not prom oter (Fig. 13E and data not promoters, such as VEGF, Bcl-xL 50

PAGE 61

cell survival (4045). Because AKT1 is a di rect target of Stat3, we reasoned that AKT1 could mediate Stat3 function. To test this hypothesis, conditional knockout of Stat3 MEF cells were infected with Cre and adenovi rus expressing wild type AKT1 (Fig. 14A). Cell survival was evaluated after serum withdrawal for 24 h and 48 h. Triple experiments showed that Cre-infected Stat3 MEF increased cell death approximately 30%. Ectopic expression of wild type AKT1 largely rescued knockdown Stat3-induced cell death (Fig. 14B). It is noted that Akt1 protein level is considerably decreased in Stat3-knockout MEFs, further suggesting the cr itical role of Stat3 in transcriptional regulation of the AKT1 gene. To further examine the effects of Akt1 on Stat3 cell survival signal, constitutively active Stat3presenting breast cancer cell line MDAMB468 was treated with Stat3-SiRNA or Akt1-S iRNA as well as the co-transfection of SiRNA-Stat3 and HA-Akt1 (Fig. 14C). Tune l assay revealed that knockdown of either Stat3 or Akt1 induced cell death about 45~50% in response to serum starvation. However, reintroduction of Akt1 largely inhi bits the apoptosis resulting from knockdown of Stat3 (Fig. 14D). Disussion Alterations of the AKT1 at the DNA level have been re ported in a single gastric cancer (23). However, a number of tumors exhibit elevated leve ls of mRNA, protein and/or kinase of AKT1 (46), implicating that the AKT1 is regulated at transcriptional, translational and/or posttranslational levels. Posttranslatio nal regulation of AKT1 has well been documented (47). In this report, we cloned the human AKT1 promoter and demonstrated a number of transcription factor binding sites w ithin the promoter. Notably, 12 putative Stat3-binding motifs were identified in the promoter, 4 of which were shown to directly bind to Stat3 in vivo and in vitro as revealed by ChIP and EMSA assays. The promoter activity is significan tly induced by constitutively active Stat3. Further, we demonstrate d that ectopic expression of constitutively active Stat3 or v-Src ignificantly induces mRNA and protein levels of AKT1. Knoc kdown Stat3 decreased Akt1 ex s pression in v-Src transformed cel ls and mouse embryonic fibroblasts. 51

PAGE 62

FIGURE 14. Reintroduction of the AKT1 into Stat3-/MEFs rescues cell death induced by serum withdraw. A, conditional knock-out of the Stat3 down-regulates Akt1. Stat3 knock-out MEFs were infected with retrovirus expressing Cre or retrovirus vector alone and immunoblotted with anti-Stat3, -Akt1, and -actin antibodies (left panels). Right panels show expression of AKT1 by reintroduction of the AKT1 into Stat3-/MEFs. B, Stat3induced cell survival is mediated, at least in part, by AKT1. Stat3-/MEFs infected with or without retrovirus-Cre and adeno-AKT1 were assayed for cell survival after serum withdraw for the indicated times. C and D, knockdown of either Stat3 or Akt1 induces apoptosis and the reintroduction of Akt1 rescues programmed cell death from knockdown of Stat3. MDA-MB-468 cells were treated with the siRNA of Stat3 (lanes 2 and 3) or Akt1 (lane 5) as well as scramble siRNA (lanes 1 and 4). HA-Akt1 was simultaneously introduced into the Stat3-siRNA cells (lane 3). Following 48 h of transfection and 16 h of serum starvation, apoptotic cells were assessed by Tunel assay and quantified. Data are representative of three independent experiments. E, schematic illustration of the regulation of Akt1 by the Src/Stat3 pathway. 52

PAGE 63

Reintroduction of the AKT1 resc ued the cell death in Stat3 MEFs. We have noted that constitutively active, bu t not wild type Stat3 induces the AKT1 promoter activity (Fig. 12A). Howeve r, knockout Stat3 in MEFs and breast cancer cells significantly reduced Akt1 expr ession (Figs. 14A and 14C). These data suggest that basal level of Stat3, which could distribute to the cytoplasm and the nucleus, is required for expression of normal level of its target ge nes, such as AKT1. Ectopic expression of wild type Stat3 may not increase the nuclear fraction of Stat3 and only constitutively active Stat3 could translocate into the nucleus and transactivate its target gene(s). This notion is supported by the observations that Stat 3 is persistently activated in many human cancers and transformed cell lines and that only the activated Stat3 transform cell in cell culture and induces tumor formation in nude mice (48, 49). Akt and Stat3 pathways play an important role in cell processes a ssociated with tumorigenesis such as cell survival, growth and angiogenesis (50-54). Cross-talk between these 2 pathways, however, has not been documented. Therefore, the data presented in this study provide the first evidence of the AKT1 gene as a direct downstream target of Stat3. Recently, we have also observed that inhibition of AKT1 pathway induces hypoxia inducible factor (HIF)1 and that knockdown AKT1 largely abrogates the HIF-1 expression stimulated by Stat3 (55). These findings further support that Stat3 targets Akt to exert its function. It has been shown that Src is a key molecule for activation of Akt path way. We and others have previously demonstrated that constitutivel y active Src induces Akt kina se activity through PI3K (11, 56). There is also evidence showing that Sr c directly binds to Akt and activates Akt e through phosphorylation of Akt at tyrosine315 (57). Inhibition of Src reduces Akt activation by growth factor(s). In additi on, Src mediates estrogen/estrogen receptor and androgen/androgen receptor activation of Akt (58-61). In the present report, we present the evidence of Src regulation of Akt at transcriptional le vel through activation of Stat3 (Fig. 12E). It is noted that the Akt1 promoter activity induced by src is considerably lower than that by expression of constitutively active Stat3C (Figs. 11-13), suggesting that a repressive molecule(s) toward Akt1 promoter is regulated by Src kinase. In summary, we have isol ated and characterized the AKT1 promoter. Th 53

PAGE 64

promot Maurer, F., and Hemmings, B. A. (1991) 5. 2. Bellaco 16. Bel A., Wan, M., Dubeau, L., Scambia, G., and Masciullo, V., et al. (1995) Int J Cancer 64, er sequence analysis demonstrates Stat3 transcriptional regulation of the AKT1 Further, we have shown that Src/Stat3 indu ces Akt1 expression through directly binding to the promoter. Blocking Stat3 by antis ense or genetic kno ckout significantly decreases Akt1 expression. Ectopic expr ession of AKT1 rescues cell survival phenotype from Stat3 MEF cells. These findings are important for several reasons. First, they provide a mechanistic understanding of regulation of the AKT1 at transcriptional level. Second, a direct li nk between AKT1 and Stat3 pathways has now been established. Finally, pharmacologicals may have anti-growth effects in the tumor cells with activation of Stat3 or vice versa. References 1. Jones, P. F., Jakubowicz, T., Pitossi, F. J ., Proc. Natl. Acad. Sci. U. S. A. 88, 4171 sa, A., Testa, J. R., Staal, S. P., and Tsichlis, P. N. (1991) Science 254, 274 277. 3. Coffer, P. J., and Woodgett, J. R. (1991) Eur. J. Biochem. 201, 475. 4. Jones, P. F., Jakubowicz, T., and Hemmings, B. A. (1991) Cell Regul. 2, 1001. 5. Cheng, J. Q., Godwin, A., K., Bellacosa, A ., Taguchi, T., Franke, T., F., Hamilton, T., C., Tsichlis, P., N., and Testa, J. R. (1992) Proc. Natl. Acad. Sci. U. S. A 89, 92679271. 6. Konishi, H., Kuroda, S., Tanaca, M., O no, Y., Kameyama, K., Haga, T., and Kikkawa, U. (1995) Biochem. Biophys. Res. Commun. 216, 526-534. 7. Nakatani, K., Sakaue, H., Thompson, D. A. Weigel, R. J., and Roth, R. A. (1999) Biochem. Biophys. Res. Commun. 257, 906-910. 8. Burgering, B. M., and Coffer, P. J. (1995) Nature. 376, 599-602. 9. Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M., and Hemmings, B. A. (1995) Nature. 378, 785-789. 10. Shaw, M., Cohen, P., and Alessi, D. R. (1998) Biochem J 336, 241-246. 11. Liu, A. X., Testa, J. R., Hamilton, T. C., Jove, R., Nicosia, S. V., and Cheng, J.Q. (1998) Cancer Res 58, 2973-2977. 12. Datta, S. R., Brunet, A., and Greenberg, M. E. (1999) Genes Dev. 13, 2905-2927. 13. Delcommenne, M., Tan, C., Gray, V., Rue, L., Woodgett, J., and Dedhar, S. (1998) Proc Natl Acad Sci U S A. 95, 11211-11216. 14. Feng, J., Park, J., Cron, P., Hess, D., and Hemmings, B. A. (2004) J Biol Chem 279, 41189-41196. 15. Walker, K. S., Deak, M., Paterson, A., Hudson, K., Cohen, P., and Alessi, D. R. (1998) Biochem J. 331, 299-308. lacosa, A., de Feo, D., Godwin, A. K., Be ll, D. W., Cheng, J. Q., Altomare, D 54

PAGE 65

280-285. 17. Nakatani, K., Thompson, D. A., Barthel, A., Sakaue, H., Liu, W., Weigel, R. J., and Roth, R. A. (1999) J Biol Chem 274, 21528-21532. 18. Ruggeri, B. A., Huang, L., Wood, M., Ch eng, J. Q., and Testa, J. R. (1998) Mol Carcinog. 21, 81-86. 19. Laine, J., Kunstle, G., Obata, T., and Noguchi, M. (2002) J Biol Chem 277, 37433751. 20. Cheng, J. Q., Altomare, D. A., Klein, M. A., Lee, W. C., Kruh, G. D., Lissy, N. A., and Testa, J. R. (1997) Oncogene. 14, 2793-2801. 21. Calera, M. R., and Pilch, P. F. (1998) Biochem Biophys Res Commun 251, 835841 22. Vandromme, M., Rochat, A., Meier, R., Ca rnac, G., Besser, D., Hemmings, B. A., Fernandez, A., and Lamb, N. J. (2001) J Biol Chem 276, 8173-8179. 23. Staal, S. P. (1987) Proc Natl Acad Sci U S A 84, 5034-5037 4. Miwa, W., Yasuda, J., Murakami, Y., Yash ima, K., Sugano, K., Sekine, T., Kono, A., Egawa, S., Yamaguchi, K., Hayashi zaki, Y., and Sekiya, T. (1996) Biochem Biophys un 225, 968-974. 5. Arboleda, M. J., Lyons, J. F., Kabbinavar, F. F., Bray, M. R., Snow, B. E., Ayala, R., brandt, A. L., ino, 2 Res Comm 2 Danino, M., Karlan, B. Y., and Slamon, D. J. (2003) Cancer Res.63, 196-206. 26. Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B. 3rd., Kaestner, K. H., Bartolomei, M. S., Shulma n, G. I., and Birnbaum, M. J. (2001) Science. 292, 1728-1731. 27. Garofalo, R. S., Orena, S. J., Rafidi, K., To rchia, A. J., Stock, J. L., Hilde Coskran, T., Black, S. C., Brees, D. J., Wick s, J. R., McNeish, J. D., and Coleman, K G. (2003) J Clin Invest 112, 197-208. 28. Cho, H., Thorvaldsen, J. L., Chu, Q., Feng, F., and Birnbaum, M. J. (2001) J Biol Chem 276, 38349-38352. 29. Easton, R. M., Cho, H., Roovers, K., Shinem an, D. W., Mizrahi, M., Forman, M. S., Lee, V. M., Szabolcs, M., de Jong, R., Oltersdorf, T., Ludw ig, T., Efstratiadis, A., and Birnbaum, M. J. (2005) Mol Cell Biol 25, 1869-1878. 30. Yu, C. L., Meyer, D. J., Campbell, G. S ., Larner, A. C., Carter-Su, C., Schwartz, J., and Jove, R. (1995) Science. 269, 81-83. 31. Boorstein, W. R., an d Craig, E.A. (1989) Meth. Enzymol. 180, 347-369 32. Altomare, D. A., Guo, K., Cheng, J. Q., and Testa, J. R. (1995) oncogene 11, 10551060. 33. Wells, J., Boyd, K. E., Fry, C. J., Bartley, S. M., a nd Farnham, O. J. (2000) Mol. Cell Biol 20, 5797-5807. 34. Catlett-Falcone, R., Landowski, T. H., Oshi ro, M. M., Turson, J., Levitzki, A., Sav R., Ciliberto, G., Moscinski, L., Fernandez-Luna, J. L., Nunez, G., Dalton, W. S., and Jove, R. (1999) Immunity 10, 105-115. 35. Kaneko, S., Feldman, R..I., Yu, L., Wu, Z., Gritsko, T., Shelley, S. A., Nicosia, S. V., Nobori, T., and Cheng, J. Q. (2002) J Biol Chem. 277, 23230-23235. 36. Hansen, M.B., Nielsen, S.E., and Berg, K. (1989) J. Immunol. Methods 119, 203-210 37. Ehret, G. B., Reichenbach, P., Schindler, U., Horvath, C. M., Fritz, S., Nabholz, M., and Bucher, P. (2001) J Biol Chem 276, 6675-6688. 38. Niu, G., Wright, K. L., Huang, M., Song, L ., Haura, E., Turkson, J., Zhang, S., Wang, 55

PAGE 66

T., Sinibal di, D., Coppola, D., Heller, R., Ellis L. M., Karras, J., Bromberg, J., Pardoll, 39 on, W., Pledger, W. J., Sedivy, J. V., and Davies, A. M. (2001) Mol Cell Neurosci. 18, 270-282. ., 43 a, awada, M., Suzuki, K., 44 3) Int J Cancer 104, 19-27. ogy 39, 46 ., Nicosi a, S. V., and Cheng, J. Q. (2001) Am J Pathol. 159, 47 40. E Jr. (1999) Cell 98, 295-303. 50 E. (1999) Cell 96, 857-868. Califano, D., Med. 8, 1136-1144. lletier, J.; and Lowe, S. W.(2004) Nature 428, 332-337. 55 rt ylewski, M., Zhang, S., Gritsko, T., Turkson, 57 9-15793. D., Jove, R., and Yu H. (2002) Oncogene 21, 2000-2008. Bowman, T., Broome, M. A., Sinibaldi, D ., Whart M., Irby, R., Yeatman, T., Courtneidge, S. A., and Jove, R. (2001) Proc Natl Acad Sci U S A. 98, 7319-7324. 40. Alonzi, T., Middleton, G., Wyatt, S., Buch man, V., Betz, U. A., Muller, W., Musiani, P., Poli 41. Liu, H., Ma, Y., Cole, S. M., Zander, C., Chen, K. H., Karras, J., and Pope, R. M. (2003) Blood. 102, 344-352. 42. Klein, B., Tarte, K., Jourdan, M., Mathouk, K., Moreaux, J., Jourdan, E., Legouffe, E De Vos, J., and Rossi, J. F. (2003) Int J Hematol 78, 106-113. Kanda, N., Seno, H., Konda, Y., Marusawa, H ., Kanai, M., Nakajima, T., Kawashim T., Nanakin, A., Sawabu, T., Uenoyama, Y ., Sekikawa, A., K Kayahara, T., Fukui, H., Sawada, M., and Chiba, T. (2004) Oncogene 23, 4921-4929. Thomas, C. Y., Chouinard, M., Cox, M., Pa rsons, S., Stallings-Mann, M., Garcia, R., Jove, R., and Wharen, R. (200 45. Schulze-Bergkamen, H., Brenner, D., Krueger, A., Suess, D., Fas, S. C., Frey, C. R., Dax, A., Zink, D., Buchler, P., Muller, M., and Krammer, P. H. (2004) Hepatol 645-654. Sun, M., Wang, G., Paciga, J. E., Feldman, R. I., Yuan, Z. Q., Ma, X. L., Shelley, S. A., Jove, R., Tsichlis, P. N 431-437. Yang, J., Cron, P., Thompson, V., Good, V. M., Hess, D., Hemmings, B. A., and Barford, D. (2002) Mol Cell 9, 1227-12 48. Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Albanese, C., and Darnell J 49. Yu, H., and Jove, R. (2004) Nat Rev Cancer. 4, 97-105. Calo, V., Migliavacca, M., Bazan, V., Macaluso, M., Buscemi, M., Gebbia, N., and Russo, A. (2003) J Cell Physiol 197, 157-168. 51. Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Hu, L. S., Anderson, M. J., Arden, K. C., Blenis, J., a nd Greenberg, M 52. Viglietto, G., Motti, M. L., Bruni, P., Melillo, R. M., D'Alessio, A., Vinci, F., Chiappetta, G., Tsichlis, P., Bell acosa, A., Fusco, A., and Santoro, M. (2002) Nature 53. Wendel, H.-G.; de Stanch ina, E.; Fridman, J. S.; Malina, A.; Ray, S.; Kogan, S.; Cordon-Cardo, C.; Pe 54. Forough, R., Weylie, B., Patel, C., Ambrus, S., Singh, U. S., and Zhu, J. (2005) J Cell Biochem 94, 109-116. Xu, Q., Briggs, J., Park, S., Niu, G., Ko J., Kay, H., Semenza4, G. L., Cheng, J. Q., Jove, R., and Yu, H. (2005) Oncogene 24, 5552-5560. 56. Datta, K., Bellacosa, A., Chan, T. O., and Tsichlis, P. N. (1996) J Biol Chem. 271, 30835-30839. Jiang, T., and Qiu, Y. (2003) J Biol Chem. 278, 1578 58. Sun, M., Paciga, J. E., Feldman, R. I., Yua n, Z., Coppola, D., Lu, Y. Y., Shelley, S. 56

PAGE 67

A., Nicosia, S. V., and Cheng, J. Q. (2001) Cancer Res. 61, 5985-5991. 59 2001) Cancer Res. 61, 839060 J Biol Chem. 278, 42992-3000. Tsai, E. M., Wang, S. C., Lee, J. N., and Hung, M. C. ( 8392 Sun, M., Yang, L., Feldman, R. I., Sun, X. M., Bhalla, K. N., Jove, R., Nicosia, S. V., and Cheng, J. Q. (2003) 61. Migliaccio, A., Castoria, G., Di Domeni co, M., De Falco, A., Bilancio, A., and Auricchio, F. (2002) Ann N Y Acad Sci. 963, 185-190. 57

PAGE 68

Targeting Stat3 blocks both HIF-1 and VEGF expression induced by multiple oncogenic growth signaling pathways Abstract Vascular endothelial growth factor (V EGF) upregulation is induced by many ceptor and intracellular oncogenic proteins commonly activated in cancer, rendering olecular targeting of VEGF expression a complex challenge. While VEGF inducers bound, only two major transcription activators have been identified for its promoter: ypoxia inducible factor-1 (HIF-1 ) and signal transducer and activator of transcription tat3). Both HIF-1 expression and Stat3 activ ity are upregulated in diverse cancers. Here, e provide evidence that Stat3 is require d for both basal and growth signal-induced xpression of HIF-1. Moreover, induction of VEGF by dive rse oncogenic growth stimuli, cluding IL-6R, c-Src, Her2/Neu, is atte nuated in cells without Stat3 signaling. We rther demonstrate that Stat3 regulates expre ssion of Akt, which is required for growth gnal-induced HIF-1 upregulation. Targeti ng Stat3 with a small-molecule inhibitor locks HIF-1 and VEGF expression in vitro and inhibits tumor gr owth and angiogenesis vivo Furthermore, tumor cells' in vivo angiogenic capacity induced by IL-6R, which multaneously activates Jak/STAT and PI3K/A kt pathways, is abrogated when Stat3 is hibited. Activation of Stat3 signaling by various growth signaling pathway is prevalent diverse cancers. Results presented here dem onstrate that Stat3 is an effective target for hibiting tumor VEGF expr ession and angiogenesis. Chapter 3 re m a h (S w e in fu si b in si in in in 58

PAGE 69

In troduction A crucial role of vascular endothelial gr owth factor (VEGF) in angiogenesis and mor progression in both solid tumors and hematological malignancies has been well stablished (1-3). Inhibiting VEGF F receptor signaling alone or in com sis therapy in both animal ever, a large array of ncoproteins overactive in cancer cells act as VEGF inducers, creating a challenge for blocking tumor VEGF producti on. Phosphatidylinosital-3-kinase (PI3K) and Akt gnaling plays an important role in the re gulation of VEGF expression (8, 9). Both PI3K a mor angiogenesis in vivo (14) and locking Stat3 signaling in tumors can reduce tumor angiogenesis (16). A role of Stat3 upregulating VEGF expressi on in diverse human cancers ha s also been demonstrated 15-17). Importantly, constitutive activation of Stat3 occurs at 50% frequency in a tu e and/ or VEG bination with other treatments has shown promise for tumor antiangiogene models and cancer pa tients (4-7) How o si nd Akt are frequently activated in a wide range of human cancers by either gainof-function of oncogenic proteins or by loss-of-function of negative regulator, phosphatase and tensin homologue deleted on chromosome 10 (PTEN) (9, 10). The PI3K/Akt signaling pathway upregulates expression of VEGF in both tumor and endothelial cells, and hypoxia inducible fact or-1 (HIF-1) mediates PI3K/Akt-induced VEGF expression (8, 9, 11). In addition to controlling angiogenesis, HIF-1 regulates metabolic adaptation to hypoxia a nd other critical aspects of tumor progression (9). HIF-1 consists of two s ubunits: an inducible HIF-1 subunit and a constitutively expressed HIF-1 subunit (9, 12, 13). In solid tumors, HIF-1 is frequently upregulated by intratumoral hypoxia through loss of von Hi ppel-Lindau (VHL) or p53 function (9). Deregulation of growth signali ng pathways in both solid and hematological malignancies is common, and upregulation of HIF-1 by abnor mal growth signaling has been shown to be at the protein synthesis level and mediated by PI3K/Akt pathway. It has been demonstrated that inhibition of mTOR by rapamycin abrogates HIF-1 induction by growth signaling pathways (9). Recent studies have also identified Stat3 as a direct transcription activator of the VEGF gene (14, 15). Activation of Stat3 leads to tu b in ( 59

PAGE 70

broad range o f human cancers (18 22), sugge sting that Stat3 activity contributes gnificantly to tumor VEGF overproduction. si The Jak/STAT and PI3K/Akt are two para llel pathways mediating functions of many receptor and nonreceptor tyrosine kinases, including EGFR, Her-2 and c-Src (8, 10, 14, 16, 22 24). IL-6 receptor (IL-6R), which is frequently activated in a wide range of cancers (25), also signals through both Jak/STAT and PI3K/Akt pathways (19, 26). Overexpression and/or persistent activation of EGFR/Her-2, Src and IL-6R are known to promote tumor growth/survival and to induc e VEGF expression and angiogenesis (8-10, 12, 16, 20, 22, 23, 27, 28 ). As IL-6 activates the PI3K /Akt pathway (26), engagement of IL-6R is predicted to affect HIF-1 expression. Interestingly, it has been shown that blocking Stat3, but not PI3K activity, inhibi ts VEGF expression in tumor cells with constitutive IL-6R signaling (16), suggestin g that Stat3 continues to activate VEGF expression in the absence of PI3K/Akt signaling. In this study, we show that Stat3 is obligatory for both basal and growth signalinduced HIF-1 expression. Moreover, VEGF upregulation by multiple oncogenic proteins/growth pathways is abrogated in the absence of Stat3 signaling. We further demonstrate that Stat3 is required and suffic ient for Akt1 expression. Our results also show that targeting Stat3 by a small-molecule drug inhibits human melanoma growth and angiogenesis in a xenograft model. Furthe rmore, tumor angiogenesis induced by IL-6, which simultaneously activates Jak/STAT and PI3K/Akt, is attenuated in Stat3 knockdown tumor cells in vivo These results demonstrate th at Stat3 is a key regulator of the VEGF gene; in addition to being a direct act ivator of the VEGF promoter, Stat3 is required for PI3K-Akt-mediated HIF-1 expres sion, a key regulator of the VEGF gene. As such, strategically developing Stat3 antagonists may effectively impair tumor angiogenesis. Materials and methods The following reagents were purchased from various companies as indicated: IL-6 (BD Pharmingen); cycloheximide (Calbiochem) ; G418 (Cellgro); an ti-VEGF monoclonal 60

PAGE 71

antibody (R&D); anti-HIF-1 polyclonal antibody and antiactin monoclonal antibody (Santa Cruz Biotec hnology); anti-HIF-1 monoclonal antibody (NOVUS Biologicals); anti-Ph NA3, was used as control. Primary MEFs w ons) were used for the Western blot analyses. Horseradish peroxidaseonjugated sheep anti-mouse and donkey anti-ra bbit or anti-goat secondary antibodies :5000 dilutions, resp ectively. The signal was developed with uperSignal West Pico Chemiluminescent Substrate (PIERCE). ospho-Akt (Cell Signaling). Generation of Stat3 knockdown tumor cell lines and Stat3 knockout mouse embryonic fibroblasts (MEFs) MCF-7 breast cancer cells, DU 145 prostate cancer cells and A2058 melanoma cells were cultured in high-glucose RPMI 1640 supplemented with 10% FBS and penicillinstreptomycin. Th e Stat3siRNA oligonucleotide, AATTAAAA AAGTCAGGTTGCTGGTCAAATTCTCTTGAAATTTGACCAGCAACCTGACTTCC, was inserted into pSilencer 1.0-U6 siRNA ex pression vector (Ambion). To generate siRNA/Stat3 stable tumor cell clones, the siRNAStat3 expression vector was cotransfected with pcDNA3 into MCF-7 and A2058 cells us ing Lipofectamine (Invitrogen), followed by G418 (1 mg/ml) se lection. MCF-7 and A2058 clones stably transfected with the empty vector, pSilencer /pcD ere prepared from Stat3flox mice (k indly provided by Drs S Akira and K Takeda of Osaka University, Japan). To generate Stat3-/MEFs, MEFs prepared from Stat3flox mice were transduced with retroviral Cre vect or, and selected with puromycin. Deletion of the Stat3 gene in a majority of the Cr e-transduced cells was confirmed by PCR and Western blot analysis. Control Stat3+/+ MEFs were generated from Stat3flox mice (29), but the MEFs were transduced with a control empty retroviral vector. Western blot analysis MCF-7 cells and MEFs were serum starved for 20 h in serum-free medium before exposure to IL-6 for 6 h. 50 g of nuclear or whole-cell extracts was used for Western blot analysis. HIF-1 rabbit polyclonal antibody (H-206) (1:500 dilution), HIF-1 mouse monoclonal antibody (1:1500 dilution), Akt1 mouse monoclonal, anti-phospho-Ak t rabbit polyclonal and an ti-VEGF monoclonal antibody (1: 1000 diluti c were used at 1:2000 and 1 S Electrophoretic mobility shift assay (EMSA) Stat3 DNA-binding assays were performed as described previously (19) 61

PAGE 72

Northern blot analysis TRIzol reagent (Invitrogen) was used to isolate total RNAs, which were fractionated by 1% agaroseformaldehyde gel electrophoresis, followed by transferring onto nyl on membranes and hybridization with 32P-labeled human HIF-1 cDNA. Pulse-label assays Pulse-label assays were performed according to previously described methods (8). Briefly, MCF-7 tumor cells (2 10 6 ) were plated in a 10-cm dish, starved for 20 h and treated with 20 ng/ml IL-6 for 30 min in methionine-free acturer's procedure (Prome DMEM. Before harvesting cells, [ 35 S]Met-Cys was added to final concentration of 0.3 mCi/ml and pulse-labeled for 20 min. Preparation of extracts and immunoprecipitation with HIF-1 antibody was carried out as described (8). Cloning and analysis of human Akt1 promoter To clone the Akt1 promoter, a DNA fragment containing Akt1 genomic sequences upstream of the translational start site was obtained by screening a human placenta genomic library (Stratagene) with a 5' cDNA fragment of the Akt1. We used the following primers for subcloning of Akt1 promoter region: (5') upstream region 5'-GGCTAGCCACAAAGGACTGTGACC-3'; (3') downstream region 5'-GCTTCCTTT GCTTCTCCCAGAGG-3'. PCR amplified 2.2-kb Akt1 promoter fragment was subcloned into the pGL3 vector at BglII-HindIII sites (Promega). The construct was confirmed by DNA sequencing. Reporter assays were performed using the luciferase assay system according to the manuf ga). Chromatin immunoprecipitation (ChIP) assays Soluble chromatin was prepared from a total of 2 10 7 HEK293 cells that were transiently transfected with v-Src and wt-Stat3 expression vectors. Immunoprecipitation was performed with either an anti-STAT3 antibody or an unrelated antibody (Akt1 antibody). Following extensive washing, the immunoprecipitates were crosslinked and treated with proteinase K and RNase A. Purified DNA was subjected to PCR. The sequences of the PCR primers used are as follows: region 1 forward (+): 5'-GGATAAAGTGTGCTCAGGTGAGGG-3', reverse (-) : ATTCTAGGCTTAGAGCCTCCA GCC-3'; region 2 forward (+) : 5'-ACTC AGCAeactions cover the 2.2 kb Akt1 promoter. PCR AGCTCTCAGGCTCTGG-3', reverse (-) : 5'-CATTTACTGAACACC CACTTG CG-3'. The two fragments from the PCR r 62

PAGE 73

produc guidance and approved protocols. 2 ts were resolved on an agarose gel and visualized by BioImage. In vivo tumor experiments and matrigel assays Athymic (nu/nu) 6-week-old male mice (NCI) were maintained under pathogen-free conditions in accordance with established institutional 106 A2058 cells were injecte d to induce tumors. After tumors reached 3 mm in diameter, mice were injected (i.v.) with either vehicle (10% DMSO/PBS) or 5 mg/kg CPA-7 twice weekly. Matrigel assays were performed as described previously (21). Briefly, 2 10 6 MCF-7 tumor cells stably transfected with either an empty control vector or Stat3siRNA expression vector were suspended in 100 l PBS and mixed with 0.5 ml Matrigel (Collaborative Biochemical Products) on ice, followed by subcutaneous injection into the abdominal midlines (CD31-positive areas) were selected using the histogram and dropper tools. The Co r of nude nice. On day 5, Matrigel plugs were harvested for photography and hemoglobin content assays. Hemoglobin quantification was carried out by the Drabkin method. Briefly, after dissecting away all the surrounding tissue, Matrigel pellets were melted at 4 C and assayed for hemoglobin content (Drabkin's reagent kit, Sigma). Angiogenesis measurements Angiogenesis quantification was performed in a double-blinded fashion by the staff at the Analytic Microscopy Core of Moffitt Cancer Center and Research Institute. SPOT Advanced imaging software (v. 3.4.5) was used to capture bright-field images from two fields for each sample. Data for these image files were collected using the Count/Size function of Image-Pro Plus software (v. 5.0). The blood vessel unt function was then used to total the number of regions (CD31-positive areas). Measurement was selected within the Count/Size function and the Area tool was utilized to calculate the area of CD31-positive blood vessels in each entire field. Every field in each of the entire tumor section was examined and included in the analysis. Results Activation of IL-6R induces HIF-1 expression VEGF upregulation in cance cells is induced by a large number of receptor and nonreceptor oncoproteins (8, 13, 16, 21 28, 30, 31). While many of these oncogenic growth-signaling molecules have been 63

PAGE 74

shown to induce HIF-1 protein synthesis (9), whether IL-6 could u pregulate HIF-1 expressevated F-1 tal Akt protein ecific for Akt1. IL-6 treatment also increases Stat3 DNA-binding activity, and expression of VEGF. This figure worked by Xu, Q. blot analysis indic). ion has not yet been reported. As IL-6R overactivation has been observed in a number of human cancers (25), we addressed whether IL-6R engagement activates HIF-1. HIF-1 protein levels in MCF-7 human breast tumor cells were induced by IL-6 in a dose-dependent manner (Fig. 15a). It has been well documented that while hypoxia-induced HIF-1 expression is regulated at the protein stability level, HIF-1 expression induced by oncogenic growth signaling is regulated at the protein synthesis level (8, 9. 31). An earlier report has also shown that HIF-1 expression is controlled at the RNA level in rodent cells (32). We therefore determined how IL-6R activation might regulate HIF-1 expression. Northern Figure 15. Activation of IL-6 receptor induces HIF-1 expression. (a) MCF-7 breast cancer cells treated with IL-6 for 6 h at the indicated concentrations had elexpression of HIF-1 but not HI protein. Nuclear proteins were used for the Western blot analysis. (b) Northern blot analysis of HIF-1 mRNA levels in MCF-7 tumor cells treated with IL-6 at the indicated concentrations for 6 h. Ribosomal RNAs (28S and 18S) are internal controls for RNA loaded in each lane. (c) Inhibiting protein synthesis by cycloheximide (CHX)/(100 m) indicated a reduction of HIF-1 protein with time, as shown by Western blot analysis. Cells were treated by IL-6 (20 ng/ml) for 6 h before adding CHX. (d) IL-6 at 20 ng/ml increases levels of both total and activated Akt proteins in MCF-7 tumor cells as shown by Western blots. The antibody used for detecting phospho-Akt (pAkt) recognizes both Akt1 and Akt2. For the todetection, the antibody is sp cates that HIF-1 induction is not regulated at the mRNA level in MCF-7 breast cancer cells exposed to IL-6 (Fig. 15b). Blocking protein synthesis by cycloheximide (CHX) abrogated the increase in HIF-1 level induced by IL-6 (Fig. 15 64

PAGE 75

As the half-life of HIF-1 is only approximately 5 min, the disappearance of HIF-1 protein in the presence of CHX for 15 min or longer suggest that IL-6 signaling affects HIF-1 expression at the protein sy nthesis level, consistent w ith the previously reported mechanism for growth signaling-induced HIF-1 regulation (8, 31). It has been also demonstra ted that PI 3K/Akt pathway is required for growth signalin cells, which have little endogenous constituti ve Sat3 activity, stimulated Stat3 DNAbinding (Fig. 1d). Activation of Akt and Stat3 by I of both HIF-1 and VEGF (Fig. 1c and d). Stat3 is obligatory for IL-6-induced HIF-1 study showed that in cervical cancer cells with co Stat3 caused inhibition of VEGF expression ( 16). upstream Akt and thereby is expected to inhibit HIF VEGF expression (16). To i nvestigate whether S expression, we first determined HIF-1 inductio stably expressing siRNA/Stat3. MCF-7 tumo r control plasmid vector (pSile ncer 1.0-U6) or the The effect of the siRNA inhibition of Stat3 in the t selection was confirmed by Western blot analysis a urthermore, while control ce lls exhibit detectab rotein was detected in MCF-7 cells stably transfected with siRNA/Stat3 with and g-induced HIF-1 upregulation (8, 31). The ability of IL-6 to activate PI3K/Akt signaling has been reported (26). Activation of IL-6R in MCF-7 cells increased Akt activity as shown by phosphoryla tion of AKT, and to a lesser degree, the total protein level of AKT1 (Fig. 15d). In addition to PI 3K/Akt, the ability of IL-6 signaling to activate Jak/Stat3 pathway has been documen ted (19). Activation of IL-6R in MCF-7 t L-6 was accompanied by an induction and VEGF expression A previous nstitutively-activated IL-6R, blocking In contrast, targeting PI3K, which is -1 expression, did not interfere with tat3 has a regulatory role in HIF-1 n by IL-6R signaling in tumor cells cells were transfected with either a same v ector encoding siRNA/Stat3. umor cells su rviving G418 antibiotics nd by EMSA (Fig. 16a, bottom panels). little HIF-1 F le HIF-1 expression, p without IL-6 stimulation (Fig. 16a). More over, whereas a significant induction of VEGF by IL-6 stimulation was observed in control MCF-7 cells, no VEGF expression was detectable in IL-6-treated MC F-7 cells expressing siRNA/Stat3 (Fig 16a). These 65

PAGE 76

data suggest that Stat3 is necessary for both basal and IL-6-induced upregulation of HIF-1 and VEGF. Figure 16. HI F-1 and VEGF determined by EMSA, and Stat3 protein level was assessed by Western blot analysis. (b) Blocking Stat3 in v-Src transformed Balb/c 3T3 cells inhibits cells werSA expression induced by both IL-6 receptor and Src is Stat3 dependent. (a) Both HIF-1 and VEGF expression is abrogated in Stat3 knockdown MCF-7 tumor cells. Western blot analysis of HIF-1 and VEGF protein levels in control empty vector-transfected and siRNA/Stat3 expressing MCF-7 tumor cells. Nuclear protein was used for detection of HIF-1 and cytoplasmic proteins from the same cells were analysed for VEGF expression levels. Stat3 DNA-binding activity was HIF-1 expression. 3T3 and v-Src/3T3 e infected with MSCV containing either a control vector encoding GFP or a dominant-negative Stat3 mutant, Stat3D. Western blot analysis to detect protein levels and EM to detect Stat3 DNA-binding activity were shown. SP-1 nuclear protein was used here as an internal loading control. (c) Blocking Stat3 signaling by siRNA in the A2058 tumor cells, which exhibit activated c-Src, decreased the expression of both HIF-1 and VEGF proteins. A decrease in Stat3 DNA-binding and Stat3 protein levels in the siRNA/Stat3 A2058 tumor cells is shown by EMSA and Western blot analysis, respectively. This figure worked by Xu, Q Stat3 is required for HIF-1 and VEGF induction by activated Src and Her-2/Neu Like IL-6R signaling, Src tyrosine kinase is known to activate both Jak/Stat3 and PI3K/Akt pathways (23, 33). Our previous work has demonstrated that Src tyrosine 66

PAGE 77

kinase activity-induced VEGF e xpression requires Stat3 in mouse 3T3 fibroblasts (21), while other stud ies have shown that Src activ ity induces the protein synthesis of HIF-1 1). The question remains whether Stat3 is also required for HIF-1 upregulation duced by Src activity. Our published data de Src3T3 cells inhibits VEGF expression (21). Data 3T3 cells with v-Src leads to an increase in HIF-1 signaling in v-Src/3T3 cells with Stat3D, a domina Src-induced HIF-1 expression (Fig. 16b). We would inhibit Src-induced HIF-1 expression in h exhibit activated endogenous c-Src and is res Interrupting Stat3 signaling in A2058 tumor cells protein expression (Fig. 16c). Moreover, VEGF activity in A2058 melanoma cells were downregu (Fig. 16c). These data demonstrate that bloc king both HIF-1 and VEGF induced by c-Src activi PI3K/Akt pathways. In addition to Src tyrosine kinase, activ at induce HIF-1 expression through the PI3K/Akt p heregulin induces HIF-1 expression in MCF-7 ce displayed little endogenous activ ated Stat3, stimula detectable levels of activated Stat3 (Fig. 17a). Th to an increase in HIF-1 expression in control but cells (Fig. 17b). Moreover, Her-2 activation by he in control but not Stat3/siRNA MCF-7 tumor cells Stat3 in Her-2-induced HIF-1 and VEGF ngagement/overactivity is known to activate Stat3 signaling (22). Our results using Stat3 a (3 in monstrated that blocking Stat3 in vin Figure 16b s how that transforming protein level, whereas blocking Stat3 nt-negative Stat3 mutant, abrogates vfurthe r tested whether blocking Stat3 uman A2056 melanoma cells, which ponsible for Stat3 activation (23). by siRNA/Stat3 also reduced HIF-1 expression and Stat3 DNA-binding lated in th e presence of siRNA/Stat3 Stat3 signaling inhi bits expression of t y known to activate both Stat3 and ion of Her-2/Neu has been shown to athway (8). As shown in Figure 17a, lls. Wh ile MCF-7 breast cancer cells tion with heregulin at 100 ng/ml led to is upreg ulation of Stat3 corresponded not siRNA/Stat3 MCF-7 breast cancer regulin upregulat es VEGF expression suggesting a critical requirement for expression. Like Her-2, EGFR e ntisense oligonucleotide indicate that Stat3 is al so required for both HIF-1 and VEGF upregulation by EGF stimulation in DU 145 human prostate cancer cells (data not shown). 67

PAGE 78

Stat3 regulates Akt gene expression Our data thus far demonstrate that Stat3 is required for HIF-1 induction by various growth signaling molecules. The question remains as to how Stat3 might regulate HIF-1 expression. Several reports have shown that HIF-1 induction by Her2/neu and Src is mediated by the PI3K/Akt signaling pathway (8, 9, 31, 34). While the ability of Her2/neu to activate Akt has been demonstrated (35, 36), whether Stat3 is involved in regulating Akt1 expression or activity remains to be explored. IL-6 signaling-induced total Akt1 protein level was less in Stat3 knockdown MCF-7 breast cancer cells than control MCF-7 cells (Fig 18a, left). To eliminate the possibility that tumor cells might have unique mutations that nonspecifically influence these findings, we performed the same experiments using primary mouse embryonic fibroblasts (MEFs) with or without the Stat3 alleles (Fig. 18a, right). Figure 17. Her-2/Neu-induced HIF-1 and VEGF expression is Stat3 dependent. (a) Heregulin upregulates HIF-1 expression in MCF-7 breast cancer cells binding activity by heregulin in MCF-7 is detected by EMSA. (b) HIF-1 and VEGF upregulation by Her-2 activation requires Stat3. Western blot analysis of control vector and siRNA/Stat3-transfected MCF-7 cells showed a requirement for Stat3 in both basal and Her-2-induced HIF-1 and VEGF upregulation. This figure worked by Xu, Q. We next investigated whether Stat3 might regulate Akt gene expression. Transcriptional regulation of the Akt1 gene by Stat3 was investigated by cloning a 2.2 kb Akt1 promoter DNA fragment, beginning 2.2 kb upstream from the ATG translation start site, into the luciferase reporter vector, pGL3. Cotransfecting the pGL3/Akt1 promoter construct with an expression plasmid encoding a constitutively activated Stat3 mutant, Stat3C, into NIH 3T3 cells resulted in upregulation of Akt1 promoter activity (Fig. 18b). The 2.2 k (Western blot). Increased Stat3 DNAb Akt1 promoter region contains 13 consensus STAT DNA-binding 68

PAGE 79

sequentransfected with either a control vector or the siRNA/Stat3 expression vector in the presence or absence of IL-6 (left panel). MEtreasubjpanpromafterepo(StaDNAthe HEKvectStatprimers r2.2 Akt-1 promoter (Pro). This figure d ces,TT(N) 4-6 AA. We identified Stat3 binding to the Akt1 promoter region by chromatin immunoprecipitation (ChIP) assays, followed by PCR using two pairs of Akt1 promoter specific primers. For the ChIP assays, expression vectors encoding v-Src and wild-type Stat3 were transfected into HEK293 cells. Results from ChIP assays indicate that Stat3 protein binds to both fragments of the 2.2 kb Akt1 promoter region (Fig. 18c). This together with Western blot analyses data demonstrate that Stat3 participates in regulating Akt1 expression, suggesting that Stat3 increases HIF-1 levels through Akt1. Figure 18. Stat3 signaling is required and sufficient for Akt1 expression. (a) Western blot analysis of protein samples prepared from MCF-7 cancer cells worked by Park, S. Effects of small-molecule Stat3 inhibitors on HIF-1 and VEGF expression To date, several Stat3-selective small molecule inhibitors phosphopeptide (37) an 69 Fs with or without the Stat3 alleles ted with vehicle or IL-6 were also ected to Western blot analysis (right el). (b) Stat3 increases Akt1 oter activity. Luciferase activity r cotransfecting the Akt promoter/luc rter construct and an activated Stat3 t3C) expression vector at indicated concentrations. (c) Stat3 binds to Akt1 promoter. ChIP assays of 293 cells transfected with expression ors encoding v-Src and wild-type 3, followed by PCR using two pairs of ecognizing two fragments of the

PAGE 80

peptidomimetics (38) as well as platinum (IV) complexes (38) have been shown to inhibit Stat3 signaling with IC 50 values in the range of 5 M. We therefore determined whether interrupting Stat3 signaling by some of the new small-molecule Stat3 inhibitors could block HIF-1 and VEGF expression. Of the three tumor cell lines used in this study, A2058 and DU145 display constitutively activated Stat3 (23, 39), whereas MCF-7 tumor cells do not (Figure 16). Treating DU145 and A2058 tumor cells with a Stat3 inhibitor CPA-7 led to a reduction in Stat3 DNA-binding activity and expression o f oth HIF-1 and VEGF (Fig. 19a, b). FmaTwSEVttaT Targeting Stat3 inhibits tumor angioPI3K/Akt pathways Our data thus far identifVEGF expression induced by several major whether blocking Stat3 would result in inhibitihuman melanoma tumors, which display activated Stat3 due to activation of endogenous c-Src, were allowed to reach approximately 5 mm in diameter before mice were treated with the Stat3 inhibitor, CPA-7. Although in vivo Stat3 inhibition by CPA-7 in tumors sted only one day, treating mice with CPA-7 twice a week (i.v.) significantly inhibited mor growth (Fig. 20a). To assess whether antiangiogenesis effects might contribute to CPA-7-or b igure 19. Targeting Stat3 by a small-olecule Stat3 inhibitor reduces HIF-1 nd VEGF expression in tumor cells. (a) reatment of DU145 prostate cancer cells ith CPA-7 (20 M) resulted in lowered tat3 DNA-binding activity (bottom, MSA) and expression of both HIF-1 and EGF proteins (Western blot). (b) CPA-7 reatment (20 M) of A2058 melanoma umor cells resulted in inhibition of Stat3 ctivity and HIF-1 and VEGF expression. his figure worked by Xu, Q. genesis induced by both Jak/STAT and y Stat3 as an effective target for blocking activators of VEGF. We next determined on of tumor angiogenesis in vivo. A2058 la tu induced tumor growth inhibition, we harvested three tumors from mice treated with both vehicle and CPA-7 on day 8 to compare their vascular density. Since tum 70

PAGE 81

volumes of CPA-7-treated mice were smaller than control mice, which might potentially Figure 20. Blocking Stat3 inhibits tumor growth and angiogenesis induced by both Stat3 and Akt. (a) Targ eting Stat3 in human tumors inhibits tumor growth, which is accompanied by a reduction in tumor vessel density. Nude mice bearing subcutaneous A2058 tumors were treated with a Stat3 inhibitor, CPA-7, at 5 mg/kg twice weekly. Top: in vivo tumor Stat3 activity after treating with CPA-7 at indicated times. Bottom: tumor growth after CPA-7 treatment, DMSO=10%. n=8 for each group; P<0.05. (b) CPA-7 inhibits tumor angiogenesis. Representative microscopic photos of CD31 antibody-stained tumor sections ( 10). The bar graph shows the means of neovascular densities s.d. The entire area of each tumor was photographed and included in the analysis; three tumors from each group were analysed. Two additional DMSO-treated small-sized tumors were also included, ** P=0.004. (c) Tumor angiogenesis as determined by the Matrigel assays. Top: proliferation rates of MCF-7 cells stably transfected with either a control vector or Stat3siRNA expression vector. Bottom: microphotos of indicated Matrigel plugs harvested from mice 5 days after implantation. Control and Stat3 knockdown (siRNA) MCF-7 tumor cells were treated with IL-6 to activate both Stat3 and PI3K/Akt pathways. For each group, n=4 This figure worked by Briggs, J. influence tumor vessel density and therefore complicate interpretation of data, we 71

PAGE 82

included an additional control group that was given vehicle treatment when tumor v olumes were considerably smaller. Thus, several vehicle-treated tumors of comparable sizes to CPA-7-treated tumors were obta ined for measuring microvessel density. Microvessel density was significantly reduced in tumors from CPA-7-treated mice when compared to vehicle-treated groups (no diff erence was detected between the two vehicletreated groups) (Fig. 20b). Data from the above experiments indicate that targeting Stat3 inhibits tumor growth involving antiangiogenesis effect. Since blocking Stat3 is known to induce tumor cell death and/or growth inhibition, we used an independent system, which does not involve tumor cell apoptosis, to verify Stat3 as an effective target for antiangiogenesis. Our results indicate that siRNA/Stat3 tr ansfected MCF-7 tumor cells, having minimal endogenous Stat3 activity, survive well in short-term culture. While MCF-7 tumor cells failed to form tumors beyond 1 mm, which prevents us from analyzing microvessel density within tumors, control and siRNA/Stat3 MCF-7 tumor cells offer a unique opportunity to use Matrigel assays to dete rmine Stat3's role in tumor angiogenesis independent of tumor cell survival/apoptosis. For the duration of the Matrigel assay, we monitored proliferation rates of control and siRNA/Stat3 MCF-7 cells in culture. No obvious differences in their growth rates were noted during the 5 days time needed for completing the Matrigel assay in vivo (Fig. 20c, left panel). As our results demonstrate eir siRNA/Stat3 counterpart (Fig. 20c). These results de monstrate that blocking Stat3 and that Stat3 is required for HIF-1 and VEGF upregulation mediated by both Jak/STAT and PI3K/Akt pathways, Stat3 knockdown tumo r cells might have reduced tumor angiogenesis even when both signaling pathways are activated. To test this hypothesis, control and siRNA/Stat3 MCF7 tumor cells were serum-st arved for 4 h, followed by IL6 stimulation to activate both Jak/STAT and PI3K/Akt pathways. The MCF-7 tumor cells were then mixed with Matrigel and implanted in vivo Angiogenesis was considerably reduced in the Matrigel containing siRNA/Stat3 MCF-7 tumor cells compared to that of control MCF-7 cells (Fi g. 20c). Moreover, when stimulated by IL-6, the control MCF-7 tumor cells were able to induce substantially more angiogenesis than th in tumor cells abrogates tumor angiogenesis induced by activation of both PI3K/Akt 72

PAGE 83

Jak/Stat3 pathways. Discussion Our data demonstrate that Stat3 is a ke y regulator of VEGF induced by multiple oncogenic growth signalin g pathways commo nly activated in cancer (19, 22). The ability of Stat3 to activate the VEGF gene as a direct transcriptional activator has previously been demonstrated (14, 15). The da ta presented here show that Stat3 is also required for growth signaling-induced e xpression of HIF-1, the only other known inducible transcription factor of the VEGF promoter. A requiremen t of Akt1 signaling for growth signal-induced HIF-1 protein synthesis has been pr eviously established (9). Our results also identify Akt1 as a target gene of Stat3. Moreover, our data show that blocking Stat3 signaling inhibits tumor gr owth, reduces angiogenesis and abrogates tumor angiogenesis induced by simultaneous activation of Jak/Stat3 and PI3K/Akt signaling pathways. However, whether Stat3 contributes to HIF-1 expression/activity independent of Akt remains to be determined. Our data substantiate how targeting a si ngle transcription factor potentially neutralizes the oncogenic poten tial of a multitude of upstream genetic aberrations (20, 22). As proposed by Darnell, transcription fa ctors pose ideal targets for cancer therapy because a large array of diverse oncogenic/angi ogenic proteins feed into a relativelysmall number of signaling pathways (20). Oncogenic signaling pathways in turn converge upon a limited set of nuclea r transcription factors, the final 'switches' determining gene expression patterns and ultimately leading to malignancy (20). Recent work by Gray et al. also demonstrates that binding of both Stat3 and HIF to the VEGF promoter is required for optimal VEGF expression under hypoxia (40). Together with our findings, these results add a new dimension to the impor tance of targeting key transcription factors for cancer therapy. Although direct inhibition of specific transcription factors with small molecules has been perceived to be a major challenge, Stat3 peptide inhibitors based upon rational design have been obtained (37) Moreover, combinatorial chemical libraries are being 73

PAGE 84

used to systematic ally convert these sh ort peptides to peptidomimetics. The hosphopeptide sequence, PY*LKTK, and its peptidomimetic derivatives disrupt Stat3 with biological implications (38). In addition to structure-based rational pproaches, the availability of constructs in which luciferase expression is under the control tube formation (41-43). It has been demons dendritic cel ls, leading to inhibition of dendritic cell maturation. Conver p dimerization a of a Stat3-dependent responsive el ement allows cell-based, high-throughput screens of random chemical libraries for iden tifying specific inhib itors of Stat3. Our results here demonstrate that Stat3 inhibitors identified from such sc reens (38) also block the expression of HIF-1 and VEGF. Furthermore, inhibiting Stat3 by CPA-7 in vivo can inhibit tumor growth and tumor angiogene sis. The success of generating the first lead compounds inhibiting Stat3 activity and angiogenesis raises the possibility that targeting Stat3 with potent small-molecule drugs, actively being developed and/or modified, may provide an exciting novel approach for clinical antiangiogenesis therapy. This work demonstrates that Stat3 is required for bot h HIF-1 and VEGF expression induced by oncoproteins commonly activ ated in cancer. Stat3 also regulates angiogenesis at another critical level: Stat 3 signaling is necessary for endothelial cell proliferation, migration and microvascular trated that VEGFR signals through St at3 in endothelial ce lls (42). Blocking Stat3 in endothelial cells has been demonstrat ed to completely inhibit their migration and vessel formation (43). Moreover, Stat3 in endothelial cells is obligatory for the signaling of bFGF receptor (41). Our present study prov ides proof-of-concept that targeting Stat3 effectively blocks production of VEGF and tumor angiogenesis. Based upon these findings, Stat3 emerges as a mol ecular target whose inhibition not only prevents tumor cell production of angiogenic factor (s) but also endothelial cells' response to these factors. Interestingly, a similar relationship between tumor Stat3 activity and dendritic cell Stat3 signaling has been recently described (44). These studies show that Stat3 activity promotes the production of tumor factors, in cluding VEGF, that activate Stat3 signaling in sely, blocking Stat3 signaling in either tumor or dendritic cells abrogates tumorinduced inhibition of dendritic cell maturation (44). Thus, Stat3 plays a central role in propagating oncogenic signals from tumor cells to effector cells involved in tumor 74

PAGE 85

angiogenesis and immune evasion. It has be en well established that blocking Stat3 signaling in tumor cells with constitutive ly activated Stat3 inhibits tumor cell proliferation and induces apoptosis (20, 22). In diverse human cancers displaying dependence on persistently activated Stat3 fo r survival/proliferation (20, 22), targeting Stat3 is expected to evoke potent antitumo r effects through direct tumor cell death, antitumor immune responses and antiangiogenesis. References 1. Ferrara, N. (2002) Nat. Rev. Cancer 2, 795. 2. Podar, K., and Anderson, K. C. (2004) Blood 105, 1338. 3. Xie, K., Wei, D., Shi, Q., and Huang, S. (2004) Cytokine Growth Factor Rev. 15, 297 324. 4. Benjamin, L. E., Golijanin, D., Itin, A., Pode, D., and Keshet, E. (1999) J. Clin. Invest 103, S., 159. 5. Klement, G., Baruchel, S., Rak, J., Man, S ., Clark, K., Hicklin, D. J., Bohlen, P., and Kerbel, R. S. (2000) J. Clin. Invest. 105, R15. 6. Inoue, M., Hager, J. H., Ferrara, N., Gerber, H. P., and Hanahan, D. (2002) Cancer Cell 1, 193. 7. Huss, W. J., Barrios, R. J., and Greenberg, N. M. (2003) Mol. Cancer Ther. 2, 611. 8. Laughner, E., Taghavi, P., Chiles, K., Mahon, P. C., and Semenza, G. L. (2001) Mol. Cell. Biol. 21, 3995. 9. Semenza, G. L. (2003) Nat. Rev. Cancer 3, 721. 10. Vivanco, I., and Sawyers, C. L. (2002) Nat. Rev. Cancer 2, 489. 11. Jiang, B. H., Zheng, J. Z., A oki, M., and Vogt, P. K. (2000) Proc. Natl. Acad. Sci. USA 97, 1749. 12. Forsythe, J. A., Jiang, B. H., Iyer, N. V., Agani, F., Leung, S. W., Koos, R. D., and Semenza, G. L. (1996) Mol. Cell. Biol. 16, 4604. 13. Tan, C., Cruet-Hennequart, S. Troussard, A., Fazli, L., Costello, P., Sutton, K., Wheeler, J., Gleave, M., Sanghera J., and Dedhar, S. (2004) Cancer Cell 5, 79. 14. Niu, G., Wright, K. L., Huang, M., Song, L ., Haura, E., Turkson, J., Zhang, S., Wang, T., Sinibaldi, D., Coppola, D., Heller, R., Ellis, L. M., Karras, J., Bromberg, J., Pardoll, D., Jove, R., and Yu, H. (2002) Oncogene 21, 2000. 15. Wei, D., Le, X., Zheng, L., Wang, L., Frey J. A., Gao, A. C., Peng, Z., Huang, S., Xiong, H. Q., Abbruzzese, J. L., and Xie, K. (2003) Oncogene 22, 319. 16. Wei, L. H., Kuo, M. L., Chen, C. A., Chou, C. H., Lai, K. B., Lee, C. N., and Hsieh, C. Y. (2003) Oncogene 22, 1517. 17. Repovic, P., Fears, C. Y., Gladson, C. L., and Benveniste, E. N. (2003) Oncogene 22, 8117. 18. Grandis, J. R., Drenning, S. D., Chakraborty, A., Zhou, M. Y., Zeng, Q., Pitt, A and Tweardy, D. J. (1998) J. Clin. Invest. 102, 1385. 75

PAGE 86

19. Catlett-Falcone, R., Landowski, T. H., Os hiro, M. M., Turkson, J., Levitzki, A., Savino, R., Ciliberto, G., Moscinski, L., Fernandez-Luna, J. L., Nunez, G., Dalton, W. S., and Jove, R. (1999) Immunity 10, 10515. 20. Darnell, J. E. (2002) Nat. Rev. Cancer 2, 740. 21. Niu, G., Bowman, T., Huang, M., Shivers, S., Reintgen, D., Daud, A., Chang, A., Kraker, A., Jove, R., and Yu, H. (2002) Oncogene 21, 7001. 22. Yu, H., and Jove, R. (2004) Nat. Rev. Cancer 4, 97. 23. Liu, A. X., Testa, J. R., Hamilton, T. C., Jove, (1998) Cancer Res. 58, 2973. R., Nicosia, S. V., and Cheng, J. Q. 4. Rane, S. G., and Reddy, E. P. (2002) Oncogene 21, 3334. a, T., Bergsagel, P. L., Kuehl, W. M., and Anderson, K. C. (2004) Blood 104, 6. Hideshima, T., Nakamura, N., Cha uhan, D., and Anderson, K. C. (2001) Oncogene 20, 1352. l, W. E., and Kienast, J. (2000) Blood 95, 2630. (1997) Proc. Natl. Acad. Sci. USA 94, 3801. 2925. 33 ampbell, G. S ., Larner, A. C., Carter-Su, C., Schwartz, J., K. (2001) Cell 35 C., Makino, K., Spohn, B., Bartholomeusz, G., Ya n, D. H., and Hung, 36 and Hung, M. C. (2001) Nat. 37 bti, 38 arras, J., 40 Semenza, G. L., Evans, D. B., Watowich, S. S., 41. Deo, D. D., Axelrad, T. W., Robert, E. G., Marcheselli, V., Bazan, N. G., and Hunt, J. 42 2 25. Hideshim 607. 2 5991. 27. Porter, A., and Vaillancourt, R. R. (1998) Oncogene 16, 1343 28. Dankbar, B., Padro, T., Leo, R., Feldmann, B., Kropff, M., Mesters, R. M., Serve, H., Berde 29. Takeda, K., Noguchi, K., Shi, W., Tanaka, T., Matsumoto, M., Yoshida, N., Kishimoto, T., and Akira, S 30. Rak, J., Filmus, J., Finkenzeller, G., Grugel, S., Marme, D., and Kerbel, R. S. (1995) Cancer Metastasis Rev. 14, 263. 31. Karni, R., Dor, Y., Keshet, K., Meyuhas, O., and Levitzki, A. (2002) J. Biol. Chem. 277, 42919 32. Jiang, B. H., Agani, F., Passaniti, A., and Semenza, G. L. (1997) Cancer Res. 57, 5328. Yu, C. L., Meyer, D. J., C and Jove, R. (1995) Science 269, 81. 34. Jiang, B. H., Jiang, G., Zheng, J. Z., Lu, Z., Hunter, T., and Vogt, P Growth Differ. 12, 363. Wen, Y., Hu, M M. C. (2000) Cancer Res. 60, 6841. Zhou, B. P., Liao, Y., Xia, W., Spohn, B ., Lee, M. H. Cell Biol. 3, 245. Turkson, J., Ryan, D., Kim, J. S., Zhang, Y., Chen, Z., Haura, E., Laudano, A., Se S., Hamilton, A. D., and Jove, R. (2001) J. Biol. Chem. 276, 45443. Turkson, J., Kim, J. S., Zhang, S., Yuan, J ., Huang, M., Glenn, M., Haura, E., Sebti, S., Hamilton, A. D., and Jove, R. (2004) Mol. Cancer Ther. 3, 261. 39. Mora, L. B., Buettner, R., Seigne, J., Di az, J., Ahmad, N., Garcia, R., Bowman, T., Falcone, R., Fairclough, R., Cantor, A., Mu ro-Cacho, C., Livingst on, S., K Pow-Sang, J., and Jove, R. (2002) Cancer Res. 62, 6659. Gray, M. J., Zhang, J., Ellis, L. M. and Gallick, G. E. (2005) Oncogene 24, 3110. D. (2002) J. Biol. Chem. 277, 21237. Bartoli, M., Platt, D., Lemt alsi, T., Gu, X., Brooks, S. E., Marrero, M. B., Caldwell, R. 76

PAGE 87

B. (2003) FASEB J. 17, 1562. Yahata, Y., Shirakata, Y., Tokumaru, S., Yamasaki, K., Sayama, K., Hanakawa, Y., Detmar, M., and Hashimoto, K. (2003) J. Biol. C 43 hem. 278, 40026. hain, K., Zhang, S., Bhattacharya, 44. Wang, T., Niu, G., Kortylewski, M., Burdel ya, L., S R., Gabrilovich, D., Heller, R., Coppola, D., Dalton, W., Jove, R., Pardoll, D., and Yu, H. (2004) Nat. Med. 10, 48. 77

PAGE 88

Chapter 4 dentification of 24p3 as a direct target of FOXO3a that is regulated by IL3 through PI3K/Akt pathway Abstract Pro-apoptotic protein 24p3, a member of lipocalins, is induced upon interleukin (IL)-3 deprivation and plays a pivotal role in induction of apoptosis in hematopoietic cells (1). However, the molecular mech anism by which IL3 re gulates 24p3 expression is currently unknown. Here, we show that 24p3 is a direct target ge ne of FOXO3a and that PI3K/Akt mediates IL3 action on 24p3 through regulation of FOXO3a. Inhibition FL5.12 cells induced 24p3 expression and ed cell death in the presence of IL3. Further, constitutively active Akt largely ttenuated the 24p3 expression and apoptosis in response to IL3 withdrawal. FOXO3a irectly binds to 24p3 promoter and induces the promoter activity. Akt abrogates wildpe FOXO3a, but not Akt nonphosphorylatable FOXO3a-3A function toward 24p3 xpression and promoter activity. Therefore, these data indicate for the first time that 4p3 is a direct target gene of FOXO3a and that PI3K/Akt but not MAPK mediates IL3gulated 24p3 expression in hematopoietic cells. troduction Apoptosis is a genetically c ontrolled cell suicide program that has been implicated e development, homeostasis of multicellular organisms and defense mechanism agains t pathogens (2, 3, 4). Apoptosis in hematopoietic cells can be induced by withdrawal of cytokines such as IL3 (5). The IL3 I of PI3K/Akt but not MAPK pathway in programm a d ty e 2 re In in diverse biological processes such as th 78

PAGE 89

e xerts its survival and proliferative functions through a common signaling subunit, the c ceptor. Signal transduction events that regulate survival by IL3 are in part mediated y cytosolic tyrosine kinases (6). In the absence of IL3, IL3-depe ndent progenitor cells go apoptosis (7, 8). Another signaling molecule that is activated by IL3 is phosphoinositide 3-kinase types (11). Akt is a downstream able to support the survival of a number of cell types after su rvival factor deprivation ( 4, 12, 13). Previous study has also examined the abilit y of activated fo to pr otect cells from death induced by ithdrawal of IL-2 in BAF/3 cells (14). Akt activity is induced rapidly by IL3 and the activati one marrow cells, human primary eutrophils and human peri pheral blood lymphocytes. In contrast, human primary HeLa cells, and Jurkat cells were not susceptible to 24p3-mediated poptosis (1). In ad dition, 24p3 receptor (24p3R) was recently identified in the FL5.12 cells an re b under (PI3K) (9, 10). PI3K has been implicated in the regulation of su rvival in various cell target of PI 3K and is rms of Akt w on of Akt by IL3 depends upon the activity of PI3K. Previous studies demonstrated that Akt prevents IL3-depende nt FL5.12 cells from IL3 depletion-induced apoptosis through phosphoryl ation of BAD (15, 16). Proapoptotic protein 24p3, however, has been shown to be significantly elevated at mRNA and protein levels in FL5.12 cells after IL3 withdrawal, which was demonstrated to be essential for IL3 depriv ation-induced apoptosis (1). The conditioned medium from IL3-deprived cells, which c ontains secreted 24p3, i nduced apoptosis in nave cells, even when IL3 was present. The 24p3 also induces apoptosis in a wide variety of leukocytes, indicating that IL3 deprivation enhances 24p3 transcription and leads to synthesis and secr etes 24p3, which induces apopt osis through an autocrine manner (1). In addition to murine FL 5.12 pro-B cells, many other cell types were susceptible to 24p3-mediated apoptosis, which include murine primary thymocytes, murine primary splenocytes, murine pr imary b n macrophages, a d found to bind to iron-bound and ir on-free forms of 24p3 (17). However, their effects on cell survival are different. Iron-bound 24p3 increases intracellular iron concentration without promoting apoptosis; iron-free 24p3 decrease s intracellular iron levels, which induces expression of the proapoptotic protein Bim, resulting in apoptosis. 79

PAGE 90

Recent studies also showed that BCR-AB L oncoprotein activates expression of 24p3 but inhibits 24p3R transcription in BCRABL positive cells. The secreted 24p3 leads neighboring cells to apoptosis (17, 18). By inhibiting BCR-ABL, imatinib/Gleevec inhibits 24p3 transcription a nd induces 24p3R expression. As a result, BCR-A es IL3 down-regulation of 24p3. Activa BL positive chronic myeloid leukemia cells undergo the programmed cell death (18). Members of forkhead transcription factor family play a pr oapoptotic role in neurons or hematopoietic cells subjected to grow th factor or cyt okine withdrawal. Akt antagonizes FOXO proapoptotic function thro ugh phosphorylation of serine/threonine residues leading to FOXO translocation from the nucleus to the cytoplasm (19). In this report, we show that FOXO3a, a major member of the FOXO family, directly binds to 24p3 promoter and induces 24p3 transcription in response to IL3 withdrawal. Inhibition of PI3K/Akt but not MAPK pathway antagoniz tion of Akt inhibits 24p3 expression and apoptosis that are induced by IL3 deprivation in FL5.12 cells thr ough phosphorylation of FOXO3a. Material and methods Cell Culture, Reagents and Transfection IL3-dependent FL5.12 murine pro-B cells were cultured in RPMI-1640 medium su pplemented with 10% fetal bovine serum and 10% WEHI-3B-conditioned medium (a source of IL3) (20). PD98059, Wortmannin, and LY294002 were obtained from Calbioch em. Human recombinant IGF-1 was purchased from Invitrogen. Electroporation wa s used for transfection of FL5.12 cells. Cells were electroporated in 1 X 10 6 cells/400 l at 275 V, 960 F with with 25 g of plasmid DNA. Stable clonal cell lines were established after se lection with G418 (600 g/ml). Plasmids Human 24P3 gene is amplified with nested PCR using a human leukemia myeloid cDNA library (Stratag ene). The primers were 5-1: 5AGCAGCCACCACAGCGCCTG-3, 5-2: CCGGAATTCGGATCCATGCCCCTAGGT CTCCTGTG-3, 3-1: 5-TCAATGGTGTTC GGGCTGGTG-3, 3-2: 5TGCTCTAGACT 80

PAGE 91

CGAG TATCGCTCTGTTCCAGGC-3, 5-2: TTCAGATCTCCAGGCTAAAG TGCAA f empty vector. After 6 h of transfection, luciferase activity was measured using a luciferase assay reagent on efficiency was normalized by co-transfection with alactosidase expressing vector. The -galactosidase activity was measured by using Galato s performed according to standard procedure. Briefly, the cells were lysed with N GCCGTCGATACACTGGTCGATTG-3. Amplified DNA fragments were subcloned into the FLAG-tagged mammalia n expression vector pcDNA3.5-GW-FLAG and Glutathione S-Transferas e fused vector pGEX-4T-1. For cloning of human 24p3 promoter, a DNA fragment containing 24p3 promoter sequences were amplified from human genomic DNA using the nested PCR and primers (5-1: 5AAGACAGAA AGGGG-3, 3-1: 5-CTGCTGGG CCTGGCAGGGGTGGAAG-3, 3-2: 5CCCAAGCTTAGGAGGTGGCGAGTGAGAGG-3). Amplified DNA fragments were subcloned into the luciferase reporter vector pGL3 (Promega). The integrity of all constructs was confirmed by DNA seque ncing. HA-FOXO3a and Flag-FOXO3a-3A were kindly provided by Dr. B M T Burgering and Akt plasmi ds have previously been described (21). Luciferase Reporter Assay FL5.12 or HEK293 cells were cultured in 12-well plates and transiently transfected with pG L3/24p3-Luc, Foxo3a and/or Akt. The amount of DNA in each transfection was kept constant by the addition o 3 (Promega). Transfecti g -Light (Tropix). Luciferase activity was expressed as relative luciferase activity. Northern and Western Blot Analysis Northern blot analysis of total cellular RNA was performed according to standard pr ocedure. Briefly, total RNA was electrophoresed in 1.0% formaldehyde-agarose gels, transferred to Duralon-UV TM membrane (Srtatagene), and then hybridized with [ 32 p]-labeled 24p3 cDNA probe. Membrane was exposed to X-ray film and the mRNA levels were visualized and quantitated using PhosphorImager analysis (Molecular Dynamics). Western blot analysis wa P-40 lysis buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% NP-40, 1% Sodium deoxycholate, 1 mM EDTA, 1 mM PMSF, 5 g /ml aprotinin and 5 g/ml leupeptin), separated in a SDS-PAGE and immunoblotted w ith appropriate antibod ies as indicated in the figure legends. 81

PAGE 92

Cell Viability Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-5(3-carboxymethoxyphenyl)-2-(4-sulphophenyl)-2H -tetrazolium (MTS) dye-reduction assay measuring mitochondrial respiratory function (22). FL5.12 cells (10 4 cells/well) were plated in 96-well plate and treated with various conditi onal media and inhibitors as indicated in the figure legends. Cell s were incubated with MTS dye (20 l/well) for 2 h and solubilized with 25 l/well of 10% sodium dodecyl sulphate (SDS) at room temperature for 4 h. Absorbance was determined in a Titertek plate reader at 490 nm. ChIP Assay ChIP assay was performed essentially as previously described (23). Briefly, solubilized chromatin was prepared from a total of 2 X 10 16.7 mM TrisHCl, pH 8.1, 0.01% SDS, protease inhibitors), and preclea sites w e activity was measured with the Caspase-Glo 3/7 Assay system 7 asynchronously growing FL5.12 cells that were electropho rated with HA-Foxo3a. The chromatin solution was diluted 10-fold with ChIP di lution buffer (1.1% Triton 1.2 mM EDTA, 167 mM NaCl, red with protein-A beads. The precleared chromatin solution was divided and utilized in immunoprecipitation assay with either an anti -Foxo3a antibody (Upstate) or anti-actin antibody. Following wash, the antibody-protein-DNA complex was eluted from the beads by resuspending the pellets in a buffer (1% SDS and 0.1 M NaHCO 3 ) at room temperature for 20 min. After revers e-crosslink, protein and RNA were removed by incubation with 10 g of proteinase K an d 10 g of RNase A at 42 C for 3 h. Purified DNA was subjected to PCR with primers specific for 3 putative Foxo3a-binding ithin the 24p3 promoter. The sequences of the PCR primers used are as follows: region 1 forward (-) : 5-CAGGAGCAGCAAAC AGGTAAATCAATGGCC-3, reverse () : 5-CATCCCTCTGTCCCTGGCCATAACCTTG-3; region 2 forward (-) : 5TACCT TTGAAAGCAGCCAC AAGGGCGTGG-3, reverse (-) : 5-AACAGACCCTGTGCAGC TTCCTTGTCTGG-3; region 3 forward (-) : 5TTGCTCAACCTTGCACAGTTCCGA CCTGG-3, reverse (-) : 5-GGCCATGGTTTCCACAGCTACATGGTCTG-3. Amplified PCR products were resolved in 1.2% of agarose gel and visualized by BioImage. DNA Fragmentation and Caspase Activity Approximately 2 g DNA obtained from cells treated with di fferent reagents was separated on 1.5% agarose gel and visualized. Caspas 82

PAGE 93

accordiPI3K/Akt, but not MAPK, pathway mediates IL3 regulation of 24p3 and cell s were treated with indicated agents and immunoblottted with indicate ng to manufactures procedure (Promega). Figure 21. survival. (A) FL5.12 cell d antibodies. (B and C) FL5.12 cells were treated with indicated agents and cell death was measured by MTS and DNA fragmentation. (D and E) FL5.12 cells were stably transfected with constitutively active Akt or DN-Akt and treated with indicated agents. Cell death was examined as panels B and C. 83

PAGE 94

Results PI3K/Akt but not MAPK pathway inhibits 24p3 expression induced by IL3-deprivation and mediates IL3 survival signal in FL5.12 cells. Previous studies have demonstrated that IL3 activates Akt that leads to phosphorylation of BAD and cell survival in IL3-dependent FL5.12 cells. Deprivation of IL3 reduces Akt activation and BAD phosphorylation that results in programmed cell death (15, 16). Transcription induction of 24p3, however, has been shown to play a pivotal role in induction of apoptosis in response to IL3 withdrawal (1). To determine if PI3K/Akt pathway is involved in IL3 regulation of 24p3, FL5.12 cells were cultured in IL3 free medium for 12 h and switched into the medium containing IL3, PI3K inhibitor LY294002 or MEK inhibitor PD98059. Immunoblotting analysis revealed that upon IL3 withdrawal, 24p3 was increased approximately three fold. Addition of IL3 into the medium significantly reduced the 24p3 expression. However, inhibition of PI3K/Akt pathway with either LY294002 or dominant negative Akt largely abrogated the IL3-repressed 24p3 whereas MEK inhibitor PD98059 had no effect on 24p3 expression. Furthermore, stable expression of constitutively active Akt inhibited 24p3 induced by IL3 deprivation (Fig. 21A). Figure 22. PI3K/Akt pathway regulates 24p3 at transcriptional level. (A and B) Northern blot analysis. FL5.12 cells were transfected and treated with indicated p lasmids and agents. Total RNA was isolated and subjected to Northern blot analysis using [32P]-dCTP labeled 24p3 cDNA as probe (upper panels). were ontrol 84 The 28S and/or 18Sused as a loading c(bottom panels).

PAGE 95

W e further examined the role of PI3K/A kt and MAPK pathways in IL3-dependent ell survival. FL5.12 cells were treated with or without LY294002 or PD98059 in the presenc wal-induced 24p3 whereas dominant negative Akt partially abrogated IL3pressed 24p3 mRNA expression (Figs. 22A and 22B). Isolation of human 24p3 promoter and IL3 inhibition of 2 through PI3K/Akt pathway. To further analyze the tran script gene by Akt, we defined transcription start site using 5 race an region of the human 24p3 gene (Fig. 23A). Sequence analy binding sites (TTGTTTAC) for Foxo3a (178/-1163, -903/-892, and /-52), and one site for NFB, CREB and C/EBP in the 24p3 promoter. T promoter is regulated by IL3, FL5.12 cells were transfected with galactosidase, and then cultured in a me dium supplement with o ure 3C shows that 24p3 promoter activity was induced about 22 fold upon IL3 withdrawal, whereas addition of IL3 reduced the promoter activity. However, inhibition of PI3K c e or the absence of IL3. As show n in figure 21B and 21C, inhibition of PI3K induced more significant cell death than inhibition of MAPK pathway. Moreover, ectopic expression of constitutively active Akt largely rescued the programmed cell death induced by IL3 deprivation (Figs. 21D a nd 21E), whereas expression of dominant negative Akt inhibited IL3-prot ected apoptosis (Fig. 21E). These data indicate that PI3K/Akt pathway, but not MAPK, mediates IL3 action toward 24p3 an d cell survival. PI3K/Akt inhibits 24p3 expressi on at transcriptional level. Having observed PI3K/Akt pathway mediating IL3-regulated 24 p3 protein expression, we next examined if 24p3 is regulated by PI3K/Akt at transcriptional level. Following culture of FL5.12 cells in the absence or the presence of IL3 and treatment with LY294002, Akt inhibitor API-2 or PD98059, Northern blot anal ysis shows that mRNA level of 24p3 is elevated upon IL3 withdrawal. Addition of IL3 re pressed 24p3 mRNA expression. Inhibition of PI3K or Akt but not of ME K inhibits IL3 stimulation-reduced 24p3 mRNA (Fig. 21A and data not shown). Further, expression of constitutively active Akt inhibited IL3 withdra re 4p3 promoter activity ional regulation of 24p3 d cloned the 5 flanking sis revealed 3 putative o examine if the 24p3 pGL3-24p3-Luc and r without IL3. Fig 2 85

PAGE 96

but not of MAKP largely abrogated IL3-represssed 24p3 promoter activity. Furthermore, IL3 deprivation-induced 24p3 promoter activity was reduced by expression of constitutively active Akt in a dose-dependent manner (Fig. 23C). These findings culture, luciferase activity was measured and normalized to -galactosidase. Results are the mean S.E. of three independent experiments performed in triplicate. C/EBP sites are underlined and NFB cells with indicated plasmids and treated with indicated agents. Following a 36-h Figure 23. Cloning of human 24p3 promoter and IL3 regulation of 24p3 promoter activity through PI3K/Akt pathway. (A) DNA sequence of human 24p3 promoter. TATA box is labeled by bold. Putative FOXO3a binding sites are boxed, site is double underlined. (B) A diagram displays the location of putative FOXO3a-binding sites indicated by blue column within the 1.5-kb 24p3 promoter. (C and D) IL3 regulates 24p3 promoter via PI3K/Akt pathway. Luciferase reporter assay was performed by transfection of FL5.12 86

PAGE 97

suggest that IL3 controls 24p3 transcription by regulation of transcriptional factor(s) through a PI3K/Akt-dependent pathway. Figure 24p3 prinhibited(A) FOpromotecells wpGL3-2galatosiamountsFollowiluciferaand galactosFOXO3promotecells windicateassay describeregulateAkt phoFL5.12 transfecFOXO3nonphosA3 as wculturedabsenceassay describe FOXO3a mediates IL3 signals to regulate 24p3 promoave shown that expression of FOXO transcription factor induces cell death and cell growth arrest through transactivation of a number of molecules such as Bim, FasL and 24. FOXO3a induces omoter activity that is by IL3/Akt signaling. XO3a induces 24p3 r activity. HEK293 ere transfected with 4p3-Luc, -dase and increasing of FOXO3a. ng incubation for 36 h, se activity was measured normalized to -idase. (B) Akt inhibits a-induced 24p3 r activity. HEK293 ere transfected with d plasmids and reporter was performed as d above. (C) IL3 s 24p3 promoter through sphorylation FOXO3a. cells were stably ted with wild-type a and Akt-phorylatable FOXO3a-ell as 24p3-Luc and then in the presence or the of IL3. The reporter was performed as d above. ter. Previous studies h Gadd45 (23, 24, 25). Because 24p3 promoter contains 3 putative FOXO binding sites and FOXO is a major target of Akt (25), we next examined if 24p3 promoter is directly regulated by FOXO. HEK293 cells were transfected with pGL3-24p3-Luc, 87

PAGE 98

-galatosidase and increasing amounts of FOXO3a, one of the mostly studied FOXO family members. Figure 24A shows that 24p3 promoter activity was induced by OXO3a in a dose-dependent manner. Co-expression of constitutively active Akt repressed the promoter activity induced by FOXO3a but nowhich can not be phosphorylated by Akt (Fig. 24B). Mopromoter activity was largely inhibited by stimulation contrast, IL3 treatment had no effect on FOXO3a-A3-stim(Fig. 24C). Figu24p3phos(A) correrespotranscultuabsewith IL3 indunonpFL5.with subjeNort 88 F t FOXO3a-A3, a mutant form reover, FOXO3a-induced 24p3 of F5.12 cells with IL3. In ulated 24p3 promoter activity re 25. FOXO3a regulates expression through a phorylation-dependent manner. Phosphorylation of FOXO3a lates with expression of 24p3 in nse to IL3. FL5.12 cells were fected with pcDNA3 or Myr-Akt, red in the presence or the nce of IL3 and immunoblotted indicated antibodies. (B and C) failed to inhibit 24p3 expression ced by constitutively active (Akt-hosphorylatable) FOXO3a-A3. 12 cells were transfected/treated indicated plasmid and agent and cted immunoblotting (B) and hern blot (C) analyses.

PAGE 99

To further demonstrate that IL3 regulates 24p3 through Akt-FOXO3a axis, we examined the levels of FOXO3a phosphorylation and 24p3 expression in response to IL3 treatment. FL5.12 cells were transfected with constitutively active Akt (Myr-Akt) or pcDNA3 vector and treated with or without IL3. Immunoblotting analysis shows that IL3 deprivation reduced phosporylation levels of FOXO3a and Akt and increased 24p3 expression in pcDNA3but not myr-Akt-transfected cells (Fig. 25A). Further, expression of non-phosphorylatable FOXO3a-A3 abrogated IL3-inhibited 24p3 expression (F igs. 25B and 25C). Taken collectively, these data indicate that 24p3 is a irect downstream target of FOXO3a and that FOXO3a-regulated 24p3 is controlled by IL3-Akt pathway. d Figure 26. Define the FOXO3a response elements in 24p3 promoter. (A) -1309/-304 of 24p3 promoter is a FOXO3a response region. Reporter assay was performed as described above except using different deletion mutants of 24p3 promoter-driven luciferase as reporters. (B) FOXO3a directly binds to two putative FOXO sites within the response region in vivo. FL5.12 cells were transfected with HA-FOXO3a and subjected into chromatin immunoprecipitation assay. (C) Mutation of the FOXO3a binding sites reduces 24p3 promoter activity. The F5.12 cells were transfected with indicated plasmids and reporter assay was performed as described above. D efine the FOXO3a response element(s) in the 24p3 promoter. 24p3 89

PAGE 100

promot d and third sites in vivo (Fig. 26B). In addition, luciferase reporter ssay using point mutation of each FOXO3a binding site demonstrated that these two binding sites are required for the 24p3 promoter to respond to FOXO3a (Fig. 26C). Figure 27. Activation of Akt not only represses 24p3 expression induced by IL3 withdrawal but also inhibits 24p3-induced cell death. (A) Conditioned medium from FL5.12 but not Myr-Akt-FL5.12 cells induces death of nave FL5.12 but not of Myr-Akt-FL5.12 cells. Insert shows immunoblot of medium from pcDNA3-, Myr-Akt-transfected and parental FL5.12 cells cultured with or without IL3 for 36 h. Cell viability was examined by MTT assay. (B) IGF1 inhibits apoptosis after IL3 withdrawal but not 24p3-containing CM addition in nave FL5.12. CMs er contains 3 putative FOXO binding sites, and thus we next defined which binding site(s) is required for the promoter to respond to FOXO3a transcription factor. A series of deletion mutants of 24p3 promoter were created and used for reporter assay. As seen in Fig. 26A, a mutant with deletion of -340/+18 considerably enhanced the promoter activity induced by FOXO3a, whereas the mutant with deletion of a region (-1309/-304) containing the second and/or the third binding site reduced FOXO3a-stimulated promoter activity, suggesting that major response elements to FOXO3a are located in last two FOXO binding sites and that a repression element(s) may reside within a region between -304bp and +18bp. Furthermore, ChIP assay revealed that FOXO3a bound to the secon a prepared from indicated cells cultured in the medium with or without IL3 and/or IGF1 were added to nave and Myr-Akt-transfected FL5.12 cells. Cell viability was quantitated by MTT assay. 90

PAGE 101

Conditioned Medium (CM) from Myr-Akt-FL5.12 Cells Fail to Induce Apoptosis; Myr-Akt-FL5.12 Cells Resist to the Apoptosis Induced by CM Expressing 24p3 Previous studies have shown that CM from IL-3 deprived FL5.12 cells expresses 24p3 and induces apoptosis in a number of hema topoietic cell lines (1). Since Akt/FOXO3a mediates IL3 action on 24p3 and constantly activ e Akt inhibits 24p3 expression induced by IL3 withdr awal, we further examined the cell viability of nave FL5.12 cells following treatment with differ ent CMs. We collected medium from pcDNA3-, Myr-Akt-transfected and parental FL5.12 cells cultured with or without IL3, added the medium to nave FL 5.12 cells, and analyzed cell viability by MTT assay. Conditioned medium from pcDNA3-transfect ed and parental FL5.12 cells cultured without IL3 induced cell death. However, the medium from cons titutively active Akttransfected FL5.12 cultured in the absence of IL3 had no si gnificantly effect o n cell iability, which is comparable to nave FL5.12 cells treated with the medium from L5.12 cultured in the presence of IL3. In addition,onditioned medium from FL5.12 and pcDNA3-FL5.12 cultured in the absence of IL constitutively active Akt-transfected F5.12 cells (Fig. FL5.12 cells cultured in the absence of IL3 and p primarily activating PI3K/Akt pathway, had no signi 27B). These results further support our fi ndings tha PI3K/Akt/FOXO pathway and that activation of Akt induced by IL3 deprivation but al so reduces 24p3-indu Discussion Previous studies have shown that Akt mediates phosphorylation of Bad, which leads to the switchin complex into 14-3-3 and the loss of its proapoptotic fu 24p3 has recently been identified as a ke y mocule for IL3 withdrawal-induced poptosis in IL3-dependent cells (1). Neutralization of 24p3 using anti-24p3 antibody rgely reduces cell death induced by IL3 de privation (1). 24p3 is transcriptionally v F c 3 failed to induce cell death in 27A). Furthe r, the medium from resence of IGF1, a growth factor ficant effect on cell survival (Fig. t 24p3 is regulated by IL3 through not only inhi bits 24p3 expression ced cell death. IL3 cell survival signal through g of Bad from Bcl-2 and Bcl-X L nction (15). le a la 91

PAGE 102

regulat poptosis in FL5.12 ells even the culture medium containing IL 3 (1). However, our data showed that y active Akt-transfected FL5.12 cells resist to apoptosis induced by CM xpressing 24p3 (Fig. 27). Since IL3 induces Akt activation, it is hard to understand ons are required for the und ed by IL3 signaling, i.e., withdrawal IL3 induces whereas ad ditional IL3 represses 24p3 expression. We demonstrated in this st udy that IL3 regulati on of 24p3 is mediated by Akt/FOXO3a axis. Transcription factor FOXO3 a directly binds to and transactivates 24p3 promoter. The regulation of 24p3 by FOXO3a is modulated by IL3 through PI3K/Akt but not MAPK pathway. IL3 activates Akt and leads to phosphorylation and inhibition of FOXO3a acti on on 24p3, whereas IL3 deprivation resulted in dephosphorylation and activation FOXO3a and in creased expression of 24p3. Moreover, constitutively active Akt inhibits death of FL5.12 cells after depriva tion of IL3, which is due to suppression of 24p3 transcripti on through phosphorylation of FOXO3a. FOXO transcription factors are crucial regul ators of cell fate. It has been shown that FOXO transcription factor s control cell survival by regulation of the expression of genes. Common FOXO target genes th at are involved in apoptosis include bNIP3 and BCL2L11 which encode the pro-apoptotic Bcl2 family members, bNIP3 and Bim, respectively (23, 24). In addition to direct targets, FOXO also indirectly down-regulate the expression of the pro-survival Bcl-X L by inducing the expression of the transcriptional repressor Bcl-6 (26). In neur ons, FOXO3a triggers cell death circuitously by inducing the expression of Fas ligand, which triggers programmed cell death through the death receptor pathway (25). In hematopoiet ic cells, we showed in this report that 24p3 is a direct target of F OXO3a and provokes cell death after IL3 deprivation. FOXO3a up-regulates 24p3 tran scription through directly binding to 24p3 promoter. In addition, a previous study demonstrat ed that 24p3 induces a c constitutivel e why constitutively active Akt could ove rride 24p3-induced cell death. A possible explanation is that constitu tively active Akt inhibits 24p3 receptor cascade and/or other proapoptotic molecules prior to 24p3 treatment. Further inve stigati erlying mechanism. In summary, we demonstrated that FOXO3a directly regulates 24p3 expression and mediates IL3 signaling in hematopoietic ce lls. Deprivation of IL3 decreases Akt 92

PAGE 103

phosphorylation of FOXO3a, which leads to activation of 24p3 transcription and cell death. Inhibition of Akt but not MAPK increases 24p3 expression, whereas activation of Akt reduces mRNA and protein levels of 24p3 and inhibits 24p3-induced apoptosis. These findings indicate that 24p3 is a direct target of FOXO3a and that PI3K/Akt but not the MAPK pathway mediates IL-3 ac tion on 24p3 in hematopoietic cells. References 1. Devireddy, L. R., Teodoro, J. G., Ri chard, F. A., and Green, M. R. (2001) Scien 829-834. ce 293, 2. Raff 05) Onco 14. Ah Barltrop, J. A., and Cory, J. G. (1991) Cancer Commun 3, 20721. Sun 22. WeJ., Bo, K. EFry, C. J., Bar t., and Farnham, O. J. (2000) Mol. Cell M. C. (1992) Nature 356, 397-400. 3. Vaux, D. L. and Korsmeyer, S. J. (1999) Cell 96, 245-254. 4. Datta, S. R., Brunet, A., and Greenberg, M. E. (1999) Genes Dev. 13, 2905-2927. 5. Ishida, Y., Agata, Y., Shibahara, K., and Honjo, T. (1992) EMBO J. 11, 3887-3895. 6. Kinoshita, T., Yokota, T., Arai, K., and Miyajima, A. (1995) EMBO J 14, 266-275. 7. McCubrey, J., Holland, G., McKearn, J. and Risser, R. (1989) Oncogene Res. 4, 97-109. 8. Boise, L. H., Gonzalez-Garcia, M., Postema, C. E., Ding, L., Lindsten, T., Turka, L. A., Mao, X., Nunez, G., and Thompson, C. B. (1993) Cell 74, 597-608. 9. Gold, M. R., Duronio, V., Saxena, S. P., Schrader, J. W., and Aebersold, R. (1994) J Biol Chem 269, 5403-5412. 10. Scheid, M. P., Lauener, R. W., and Duronio, V. (1995) Biochem J 312, 159-162. 11. Franke, T. F., Yang, S. I., Chan, T. O ., Datta, K., Kazlauskas, A., Morrison, D. K., Kaplan, D. R., and Tsichlis, P. N. (1995) Cell 81, 727-736. 12. Dudek, H., Datta, S. R., Franke, T. F., Bir nbaum, M. J., Yao, R., Cooper, G. M., Segal, R. A., Kaplan, D. R., and Greenberg, M. E. (1997) Science 275, 661-665. 13. Cheng, J. Q., Lindsley, C. W., Cheng, G. Z., Yang, H., and Nicosia, S. V. (20 gene. 24, 7482. med, N. N., Grimes, H. L., Bellacosa, A ., Chan, T. O., and Tsichlis, P. N. (1997) Proc Natl Acad Sci U S A. 94, 3627-3632. 15. del Peso, L., Gonzlez-Gar ca, M., Page, C., Herrera, R., and Nuez, G. (1997) Science. 278, 687 689. 16. Datta, S. R., Dudek, H., Tao, X., Masters, S., Fu, S., Gotoh, Y., and Greenberg, M. (1997) Cell. 91, 231-241. 17. Devireddy, L. R., Gazin, C., Zhu, X., and Green, M. R. (2005). Cell 123, 1293. 18. Lin, H., Monaco, G., Sun, T., Ling, X., Stephens, C., Xie, S., Belmont, J., and Arlinghaus, R. (2005) Oncogene. 24, 3246-3256. 19. Greer, E. L., and Brunet, A. (2005) Oncogene. 24, 7410. 20. Cory, A. H., Owen, T. C., 212. M., Yang, L., Feldman, R. I., Sun, X., J ove, R., Nicosia, S. V., and Cheng, J.Q. (2003). J Biol Chem 278, 42992-43000. lls, yd., ley, S. M 93

PAGE 104

Biol 20, 5797-5807. 23. Tran, H., Brunet, A., Grenier, J. M., Datta, S. R., Fornace A. J. Jr., DiStefano, P. S., Chiang, L. W., and Greenberg, M. E. (2002) Science 296, 530 534. 24. Dijkers, P. F., Medema, R. H., Lammers, J. W., Koenderman, L., and Coffer, P. J. (2000) Curr. Biol 10, 1201-1204. 25. Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Hu, L. S., Anderson, M. J., Arden, K. C., Blenis, J., a nd Greenberg, M. E. (1999) Cell 96, 867-868. 2 6. Tang, T. T., Dowbenko, D., Jackson, A., Toney, L., Lewin, D. A., Dent, A. L., and Lasky, A. A. (2002) J. Biol. Chem. 277, 14255-14265. 94

PAGE 105

p53 and Akt ABSTRACT Akt regulates a diverse array of cellular functions, including apoptosis, cellular roliferation, differentiation, and metabolism. While a number of molecules have been entified as upstream regulators, such as PI3K, PDK1 and PTEN, or downstream targets, uch as MDM2, Bad, and FOXO, of Akt, the mechanisms by which Akt regulates the ellular processes remain elusive. Here, we identify a novel transc ription factor, dubbed ZP (referring to T CHAPTER 5 Identification and characterization of a transcription factor TZP that interacts with p id s c T udor and Z inc finger domain containing P rotein), which binds to Akt nd p53. TZP is an evolutionarily conserve d nuclear protein. Overexpression of TZP hibits cell growth and DNA synthesis as well as cell surv ival. TZP not only directly egulates p53 at the transcrip tion level but also binds to a nd stabilizes p53 protein, which ads to increase of expressi on of p53 downstream target ge nes, such as p21, BAX, and ADD45. Knockdown of TZP significantly redu ces p53 expression. Akt hosphorylates TZP in vitro and in vivo which results in its translocation from the nucleus the cytoplasm and attenuation of its function toward p53. These data suggest that ZP plays an important role in maintaining normal p53 function and that Akt induces cell rowth and survival through inhibition of TZP/p53 axis. ntroduction Akt was originally discovered as an oncogene transduced by the acute ansforming retrovirus (Akt-8), which was is olated from an AKR thymoma (1, 2), and 95 a in r le G p to T g I tr

PAGE 106

su bsequently found to encode a serine/threonine protein kinase (3). Akt is also known s protein kinase B (4, 5). Viral akt is highly activated and oncogenic due to the fact at v-akt is associated with the cell me mbrane through a myristylated Gag protein quence fused to the N-terminus The important role of Akt in transformation and cancer was shortly therea AKT2 cancers (6-8 ). In mammals, there a ms of Akt, termed Akt1, Akt2, and Akt3. These isoforms are pr oducts of distinct genes but are highly related, exhibiting 80% protein sequence identity and sharing the same stru ctural organization. The membe mor suppressor PTEN which is equently mutated in human malignancy ( 26-29). Akt phosphorylates and/or interacts of molecules to exert its normal cellular functions, which include roles in ell proliferation, survival, diff erentiation and metabolism (30). a th se of Akt (3). f ter strengthened by the cloning of the gene (6) and the discovery that AKT2 is frequently amplified and overexpressed in human re three isofor > rs of Akt family are activated by various stimuli in a phosphatidylinositol 3-kinase (PI3K)-dependent manner (9-12). Activati on of Akt depends on the integrity of the pleckstrin homology (PH) domain, which medi ates its membrane translocation, and on the phosphorylation of Thr 308 in the activation loop and Ser 473 (13-16). Phosphoinositides, PtdIns-3,4-P2 and PtdIns-3,4, 5-P3, produced by PI3K bind directly to the PH domain of Akt, drivi ng a conformational change in the molecule, which enables the activation loop of Akt to be phosphorylated by PDK1 at Thr 308 (17). Full activation of AKT1 is also associated with phosphorylation of Ser 473 (18) within a C-terminal hydrophobic motif characteristic of kinases in the AGC kinase family. Although the role of PDK1 in Thr 308 phosphorylation is well established, the mechanism of Ser 473 phosphorylation is controversial. A number of candidate enzymes responsible for this modification have been put forward, including in tegrin-linked kinase (19), PDK1 when in a complex with the kinase PRK2 (20), Ak t itself, through aut ophosphorylation (21), PKC (22), PKCII (23), DNA-dependent kinase (24) and the rictor-mTOR complex (25). The activity of Ak t is negatively regula ted by tu fr with a number c The p53 gene represents one of the most studied tumor suppressor genes in biology. It is frequently mutate d in a wide range of tumors a nd plays an essential role in 96

PAGE 107

maintaining genomic integrity (31 35). Exposure of a normal cell to genotoxic stress leads to an increase in p53 protein levels. The increase in p53 protein results in an increase in p53-dependent transc ription of p53 target genes, which subsequently leads to cell cycle arrest or apoptosis (36 39). The practical implication of these facts is that when a cell undergoes alterations that predis pose it to become cance rous, p53 is activated to trigger checkpoints th at either take care of the dama ge through its DNA repair function or eliminate the affected cells through induc tion of apoptosis, thereby preventing the development of tumors (34, 40). Therefore, re gulation of p53 activity is critical to allow both normal cell growth and tumor suppre ssion. The current dogma is that p53 regulation in DNA damage-activated cell cycle checkpoints occurs at the level of protein degradation and protein stabil ity. This includes regulat ion of p53 protein stability, posttranslational modifications, protein-protein interactions, and subcellular localization. These mechanisms keep a strong check on p53 in normal circumstances but allow rapid activation in response to cellular stress that might be caused by or contribute to oncogenic progression (33, 34). However, little is know n about the transcriptional regulation of the p53 gene and the contribution of this tr anscriptional control of p53 itself to DNA damageinduced cell cycle checkpoints. Previ ous studies have sh own that p53 is transcriptionally up-regulated by the home obox protein HOXA5 (41, 42). Recently, the Bcl6 oncoprotein was found to suppress p53 expression through binding to p53 an inhibiting p53 promoter activity (43). Several studies have raised the possibility that p53 may also be regulated at the transcriptiona l level in response to genotoxic stress (44, 45). However, the underlying mechanism a nd functional consequences remain unclear. A link between Akt and p53 pathway was established by identification of Akt phosphorylation of MDM2 (46). MDM2 is an E3 ubiquitin ligase that negatively d we identified a novel transcr regulates p53 transcriptional activity (47). Phosphorylation of MDM2 on serine 166 and serine 186 by Akt stimulates translocation of MDM2 to the nucleus, where it binds to p53 and targets p53 degradation by proteasome (48-50) Here, iption factor TZP that interacts with both p53 and Akt. TZP directly binds to p53 promoter and upregulates p53 at mRNA level. Notably, TZP also forms a complex with 97

PAGE 108

p53 and enhances p53 stability. As a resu lt, TZP inhibits cell growth, cell cycle progression and DNA synthesis as well as cell survival. Akt phosphorylates TZP on serine-291 within TZP nuclear lo calization signal, which leads to the translocation of TZP from the nucleus to the cytoplasm and loss of its function toward p53. Material and methods Yeast Two-hybrid Screening and Expression Constructs Yeast two-hybrid system was employed to identify Akt interaction protein(s) using the C-terminal regulatory region of Akt as bait following the manufacturer's procedure (Clontech). A human fetal brain library (Clontech) wa s screened. Full-length cDNA of TZP, amplified from a human Marathon-ready skeletal musc le cDNA (Clontech) by PCR, was subcloned into 3X Flag-pcDNA3, pEGFP-C1 and pTRE-tight vectors. TZP mutants were created with the QuikChange multiple site-directed mutagenesis kit (Stratagene). The cytomegalovirus-based expression constructs encoding HA-tagged, p53, MDM2, and ubiquitin as well as pGL3-p21-Luc and -p53-Luc have previously been described (51, 52). with Afel prein A (io-Rad 98 Cell Culture and Transfection HEK293, MCF7, HeLa, HCT116, and A-T cell lines GM9067 and GM9067-AT were obtained fr om ATCC and cultured in Dulbeccos modified Eagles medium (DMEM) containing 10% fetal bovine serum. Lipofectamine plus (Invitrgen) was used for transfection. Glutathione S-transferase (GST ) Fusion Protein and Generation of Anti-TZP Antibody Different portions of TZP, including AT-hook region, C 2 H 2 zinc finger domain, C-terminal motif, and the regions containing each Akt phosphorylation site, were subcloned into pGEX-4T1. Expression and purification of the GST fusion protein were carried out as previously described (53). Polyclonal anti-TZP antibody was raised in New Zealand White rabbit. Approximately 300 g of GST fusion protein (GST-TZP/AThook and GST-TZP/C-terminal) wa s used to immunize rabbit every 2 weeks; rabbits were bled 10 days after each booster injection. The anti-TZP antibodi es were affinity purified fi-GotB).

PAGE 109

Northern Blot Analysis Northern blot analysis of total cellular RNA was performed according to standard procedures. RNA was extracted using the RNea sy (Srtatagene), and en hybridized with randomly primed -32P-labeled cDNA probes for TZP or p53. d to autoradiography and the mRNA levels were visualized and uantified using PhosphorImager analysis (Molecular Dynamics). AGE and in vitro kinase assay. Protein expression was determined by probing Westerncubated with whole cell lysate ( purification kits (QIAGEN Inc.). Total RNA was electrophoresed in 1.0% formaldehyde-agarose gels, transferred to Duralon-UV TM membrane th Membranes were expose q Immunoprecipitation and Immunoblotting Analysis Cells were lysed in a lysis buffer containing 20 mM Tris-HCl (pH 7.5), 137 mM NaCl, 15% (v/v) glycerol, 1% Nonidet P-40, 2 mM phenylmethylsulfonyl fluoride, 2 g/ml aprotinin and leupeptin, 2 mM benzamidine, 20 mM NaF, 10 mM NaPPi, 1 mM sodium vanadate, and 25 mM -glycerolphosphate. Lysates were subjected to immunoprecipitation and immunoblotting analysis as previously described (54). Briefly, lysates were precleared with protein A-protein G (2:1)-agarose beads. Following the removal of the beads by centrifugation, lysates were incubated with appropriate antibodies in the presence of protein A-protein G (2:1)-agarose beads for 2 hours. After wash, the immunoprecipitates were subjected to SDS-P n blot of the immunoprecipitates or total cell lysates with the appropriate antibodies as noted in the figure legends. GST Pull-down Assay Glutathione-agarose beads coupled to GST alone, GST-p53, and GST-deletion mutants of p53 were i 800 g of protein of incorporated radioactivity were determined by ) for 2 h at 4 C. After wash four times with lysis buffer, the beads were subjected to Western blot analysis with appropriate antibodies. In vitro Kinase AssayAkt kinase assay was performed as previously described (55, 56). Briefly, reactions were carried out in the presence of 10 Ci of [32 P] ATP and 3 M cold ATP in 30 l of buffer containing 20 mM Hepes (pH 7.4), 10 mM MgCl 2 2 mM MnCl 2 and 1 mM dithiothreitol. GST-TZPs were used as exogenous substrate. After incubation at room temperature for 30 min, the reactions were stopped by adding protein loading buffer and separated in SDS-PAGE gels. Each experiment was repeated three times. The relative amounts 99

PAGE 110

autorad d by autoradiography (57). ce with 5ml of 10% TCA for 10 iography and quantified with a Phosphorimager (Amersham Biosciences). In Vivo [ 32 P]-orthophosphate Cell Labeling HEK293 cells were co-transfected with FLAG-TZP and constitutively active Akt or pcDNA3 and labeled with [ 32 P]orthophosphate (0.5 mCi/ml) in phosphateand serum-free minimum essential medium for 4 hours. Cell lysates were subjected to immunoprecipi tation with anti-FLAG antibody (Sigma). The immunoprecipitates were separated by SDS-PAGE and transferred to membrane. The phosphorylated TZP was examine Cell proliferation, Viability and DNA Synthesis Assays TZP-, TAP/Akt and pcDNA3-transfected cells were plated in 35-mm dishes at a density of 1.0 x 10 5 cells/dish. Cell numbers were measured with a Coulter Counter (Coulter Electronics, FL) daily for up to 3 days following seeding. MTS assays were performed according to the manufacturers recommendations (Promega, Ma dison, WI). The cells were plated in 96-well microtiter plates at a density of 1.0 x 10 3 cells/well in Dulbecco's modified Eagle's medium with 10% FBS. The number of cells at 1, 2, and 3 days was determined using cell counter and the co lorimetric CellTiter96 Aqueous (MTS) assay (Promega). Results were depicted as absorbance at 490 nm as a function of time. Cell viability was examined with Trypan blue staining following treatment of cells wi th doxorubicin (1 M) for 12 h. Thymidine incorporation was used to investigate the effect of TZP on DNA synthesis. The cells were gr own to 80% confluence in 6-well plates, and dur ing the last 16 h of growth they were subjected to 5 Ci/ml of [ 3 H] thymidine. After rinsing twice with ice-cold serum-free medium, the cells were incubated twi min on ice and lysed in 500 ul 1% SDS in 0.3N NaOH for 30 min at 37C. Incorporated radioac tivity was quantitated with a spectrometer. Luciferase Reporter Assay NIH3T3 or HEK293 cells were cultured in 12-well plates and transiently transfected with pG L3/p53-Luc, p21-Luc, TZP and/or Akt as well as pSV2-galactosidase. The amount of DNA in each transfection was kept constant by the addition of empty vector. After 36 h of transfection, luci ferase activity was measured using a luciferase assay reagent (Promega). Transfection efficiency was 100

PAGE 111

normalized by co-transfection with -galactosidase expressing vector. Th e galacto TGTC(N)26GAGGCGAATTCAGTGCAACTGCAGC-3; primer A, 5-GCTGCA GTTGC raphy, excised from gels and eluted overnight at 37 C in DNA-elution buffer contain cleotide sequences of 34 indepe sidase activity was measured by using Ga lato-Light (Tropix). Luciferase activity was expressed as relative luciferase activity. Cyclic Amplification and Sele ction of Targets (CASTing) A 76-bp oligonucleotide containing 26 random nucleotid es in the center flanked by sequences complementary to primers A and B was synthe sized (Invitrogen). The sequences of the oligonucleotides are as follows: 76-base oligonucleotide, 5CAGGTCAGTTCAGCGG ATCC ACTGAATTCGCCTC-3; primer B, 5CAGGTCAGTTCAGCGGATCCTGT CG-3. A random sequence library of doubl e-stranded radiolabeled oligonucleotides was prepared by annealing the oligonucleotide to 5-fold excess of primer B followed by extension with Klenow enzyme. EMSAs (electrophoretic mobility-shift assays) were performed by adding 5 g of Flag-TZP containing nuclear extract to radiolabeled DNA in DNA binding buffer (5% glycerol, 10 mM Hepe s, pH 7.9, 75 mM KCl, 1 mM DTT, 2.5 mM MgCl 2 1 mM EDTA) in the presence of 0.5 g of poly (dA.dT) and 1 g of bovine serum albumin. The reaction was incubate d at room temperature for 30 min and subsequently the DNA-protein complexes were resolved by electrophoresis. The complexes formed specifically in the presence of Flag-TZP proteins were detected by autoradiog ing 0.3 M NaCl, 1 mM EDTA, and 0.1% SDS. The eluted DNA was extracted once in phenol-chloroform, and then preci pitated with ethanol. Purified DNA was subjected to re-amplification by PCR in the presence of [ 32 P] dCTP. The amplified radiolabeled DNA was purified using G-50 Ni ck columns (Amersham) and was used in subsequent EMSA experiments. After four cycles of CASTing, the final amplified DNA was cloned directly using pGEM-T Cloning kit (Promega). Nu ndent clones were determined. The degenerate portion of the sequences was compiled and analyzed for shared sequence patterns by visual inspection and by weblogo software ( http://weblogo.berkeley.edu ). ChIP and EMSA Assay ChIP assay was performed essentially as previously described (58). Solubilized chromatin was prepared from a total of 2 X 10 7 101

PAGE 112

asynchronously growing HEK293 or HCT116 cells that were transfected with wild type TZP or mutant TZP. The chromatin solution was diluted 10-fold with ChIP dilution buffer (1.1% Triton 1.2 mM EDTA, 1 67 mM NaCl, 16.7 mM TrisHCl, pH 8.1, 0.01% [pH 7.9], 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose ncubated SDS, protease inhibitors), and precleared with protei n-A beads blocked with 2 g sheared salmon sperm DNA and pre-immune se rum. The precleared chromatin solution was divided and utilized in immunoprecipita tion assay with either anti-Flag, or -TZP antibody. Following wash, the antibody-prot ein-DNA complex was eluted from the beads by resuspending the pellets in 1% SDS, 0.1 M NaHCO 3 at room temperature for 20 min. After crosslink, protein and RNA were removed by incubation with 10 g proteinase K and 10 g RNase A at 42 C for 3 hour. Purified DNA was subjected to PCR with primers specific for putative TZP-binding site within the p53 promoter. Amplified PCR products were resolved by 1.2% of agarose gel electrophoresis and visualized by BioImage. EMSA was perfor med as described above. The sequences of oligonucleotides used for EMSA and ChIP assays are: p53 EMSA primer: 5-GTCCAGC TTTGTGCCAGGAGCCTC-3, 5-CCCCTCCCATGTGCTCTCAAGACTGG-3, 5-G GATTGGGGTTTTCCCCTCCCATGTG-3; p53 ChIP primer: 5-CAATTCTGCCCTC ACAGCTCTGGCTTGC-3, 5-CTCAAAA CTTTTAGCGCCAGTC TTGAGC-3 and p21 ChIP primer: 5-GGGGAGGGAGGTCC CGGGCGGCGTCGG-3, 5-GACATGGC GCCTCCTCTGAGTGCCTCG-3. RNA Interference (RNAi) The RNAi duplexes were synthesized by Dharmacon Research Inc. The cDNA-targeted region a nd the sequence of TZP RNAi duplexes are: AAGAGGAUGGAUCUUCUGAAU and A AAGCAUUGGAGGAGGAUAAU. The RNAi duplexes were reconstituted to 20 M in sterile RNase-free water. Transfection of RNAi for targeting endoge nous genes was performed using oligofectamine reagent (Invitrogen) according to the manufacturers instruction. Chromatin Association Chromatin was isolated as described previously with small modifications (59). Briefly, Flag-T ZP stably transfected HeLa cells were resuspended in buffer A (10 mM HEPE S, 10% glycerol, 1 mM DTT, 5 g/ml aprotinin, 5 g/ml leupeptin, 0.1 mM phenylmethylsulfonyl fluoride). NP-40 (0.1%) was added, and the cells were i 102

PAGE 113

for 5 min on ice. Nuclei (P1) were colle cted by low-speed cen trifugation (5 min, 1,300 g, 4 C). The supernatant (S1) was furthe r clarified by high-speed centrifugation (15 min, 20,000 g, 4 C). Nuclei were washed once in buffer A, and then lysed in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT, prot ease inhibitors as described above). Insoluble chromatin was collected by cen trifugation (5 min, 1,700 g, 4 C) and washed once in buffer B. The final chromatin pellet (P3) was resuspended in sonication buffer (50 mM Tris, [pH 8.1], 10 mM EDTA, 1%SD S) and sonicated 2 x 10s in a Branson sonicator using a microtip at 10% amplitude Chromatin was diluted 1:10 with dilution buffer (0.01 % SDS, 1.1 % Triton, 1.2 mM EDTA, 16.7 mM Tris-Cl pH 8.2, 167 mM NaCl, 10 g/ml PMSF, 10 g/ml leupeptin, 10 g/ml aprotinin) and Flag-TZP was immunoblotted with -Flag antiserum. To releas e chromatin-bound proteins by nuclease treatment, cell nuclei (P1) were resu spended in prewarmed buffer A plus 1 mM CaCl 12 h to synchronize cells at G2/M phase. The cells were w 2 and 0.3 U of micrococcal nuclease (Sigma). After incubation at 37C for 1 min, the nuclease reaction was stopped by the a ddition of 1 mM EGTA. Nuclei were collected by low-speed centrifugation and ly sed according to the chromatin isolation protocol described above. Flow Cytometry and Cell Cycle Analysis For flow cytometry, TZP HeLa/Tet-on cells were treated with or without 1 g/ml doxycycline for 12 h and then incubated with 40 ng/ml nocodazole for additional ashed and further cultured in fresh medium without nocodazole for different time points. Cells were fixe d in prechilled 70% ethanol for 2 h. Following wash with PBS, cells were resuspended in propidium iodide (P I) staining solution (0.1% Triton X-100/0.2 mg/ml DNase-free RNase A/20 g/ml PI prepared in PBS) for 15 min at 37 C and then analyzed by flow cytometry. DNA content histograms and FACS data were analyzed using FLOWJO software. In vivo Ubiquitination Assay H1299 cells were co-trans fected with wild type p53, TZP, and ubiquitin together with or w ithout MDM2, and then treated with 50 M of proteasome inhibitor MG132 (Sigma) for 2 hour s prior to harvest. Following wash twice with ice-cold PBS, harvested cells were lysed in a lysis buffer [50 mM Tris HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, (1% w/v) Triton X-100, Glycerol (10% w/v) and 103

PAGE 114

protease inhibitor mixture]. Cell lysates were immunoprecipitated with anti-p53 antibody and then blotted with an anti-ubiquitin antibody. Results Identification of Akt binding protein, TZP. In an attempt to identify protein(s) that interacts with Akt, the C-terminal regulatory domain of Akt (amino acids 410-480) was used as bait in a yeast two-hybrid screening. A human fetal brain cDNA library was used in this screen, because Akt is highly expressed in brain (60, 61). Altogether, 32 clones that specifically interacted with the bait were identified. Sequence analysis revealed that three of the clones contained overlapping sequences of a cDNA. The largest clone contained a 262-amino acid open reading frame with a conserved tudor domain and a A-T hook motif. Additional cDNA clones were isolated from a human skeletal cDNA library by plaque hybridization using the largest clone as radiolabeled probe. Sequence analysis revealed that the full-length open reading frame of cDNA TZP that interacts with Akt. Figure 28. Identification of (A) Schematic structure of TZP. TZP contains two tudor, an AT-hook, a C 2 H 2 Zinc finger, and a PHD finger domain and three nuclear localization signals (NLS). (B) Northern blot analysis shows the expression of TZP in multiple human tissues. (C) T Z P binds to Akt. HEK293 cells were co-transfected with Flag-TZP and HA-Akt. After incubation for 48 h, cells were lysed and immunoprecipitated, and immunoblotted with indicated antibodies. 104

PAGE 115

encodes an 1,012-amino acid protei n, which is composed of two t udor domains, a A-T hook motif, a z inc-finger domain and a P HD finger motif (Fig. 28A). Therefore, we amed it as TZP (accession number AY027523). In addition, TZP contains three ocalization signals and two putative Akt phosphorylat ion consensus sites (Fig. 8A). The expression pattern of TZP is similar to that of Akt1 being abundant in skeleta pic changes of cells expressing ectopic TZP. Since HeLa (w ild type p53 degraded by PV18-E6 oncoprotein; ref. 62) and MCF7 (wild type p53; levels of endogenous TZP, we stably tr ansfected the pCMV FLAG-TZP into HeLa/MCF7 and HeLa-Tet-on/MCF7-Tet-of controls, pCMV-3xFlag vector was also introduc ed into the cel from each transfectant were established after selecti on. confirmed by Western blot an alyses (Fig. 29A). Cell gro survival and cell cycle progression were evalua ted in these clo in Fig. 29B, cell growth was significantly inhibited by ectopic e Furthermore, [3H]-thymidine incorporation expe rim represses DNA synthesis (Fig. 29C). In addi tion, expression o (~40%) induced by doxorubicin (Fig. 29D). Nocodazole cel and doxycyclin induction of TZP revealed th at overexpressio transition both from G1 to S and from M to G1 phase (Fi ndings were further confirmed in TZP-stab ly transfected HCT116 and A2780S cell lines n nuclear l 2 l muscle, brain, pancreas, and heart (Fig. 28B). To confirm the association Akt with TZP identified by yeast two-hybrid sc reening, HEK293 cells were cotransfected with Flag-TZP and HA-Akt. Immunoprecipitation was performed with anti-Flag and detected with anti-HA antibody or vice vers a. As shown in Figure 28C, HA-Akt was detected in the Flag-TZP immunoprecipitates and TZP was coimmunoprecipitated with anti-HA antibody. These data suggest that TZP could be a transcription factor, which may be regulated by Akt. Expression of TZP inhibits cell prolif eration, DNA synthesis and cell survival, and induces G1 and G2/M cell cycle arrest. We next examined the phenoty H ref. 63) cells express low -3xFlag-TZP and pTREf cells, respectively. As ls. Eight clonal cell lines Expression of TZP was wth, DNA synthesis, cell nal cell lines. As shown xpression of TZP. ents revealed that TZP f TZ P enhanced cell death l synchronization analyses n TZP delayed cell cycle g. 29E and 29F). These fi 105

PAGE 116

(data not shown). Thus, we conclude that the TZP is a growth inhibition gene and its Figure 29. TZP inhibits cell growth, DNA synthesis and survival and induces cell cycle arrest. (A) Western blot analysis shows expression of TZP in an inducible TZP HeLa/Tet-on cell line. (B) TZP inhibits cell growth. TZP stably transfected HeLa and pcDNA3-HeLa (mock) cells were seeded into 12-well tissue culture plate. The cell number was counted at indicated time points. (C) TZP inhibits DNA synthesis. Indicated cells were labeled with [ 3 H] thymidine. The thymidine incorporation was count by liquid scintillation. (D) TZP re 106 doxycycline for 48 h and examined for cell cycle distribution. sensitizes cells to DNA damage-induced death. Inducible TZP HeLa cells were seeded in 96-well plate and treated with doxorubicin for indicated time. Cell survival was evaluated with MTS. (E) TZP induces cell cycle arrest. MCF7/Tet-off/TZP inducible cells were treated with or without doxycyclin and synchronized at G 2 /M phase. After wash, cells were further cultured in fresh medium without nocodazole for another 1 h and then fixed and analyzed by flow cytometry. (F) HeLa/Tet-on/TZP inducible cells wetreated with and without 1 g/ml

PAGE 117

protein product regulates cell proliferation, survival, and G1/S and G2/M cell cycle heckpoints. to on ) f ) P e. ity as al se r. ere ed h y ed ts ee nts TZP associates with chromatin and binds to s been demonstrated that AT-hook binds to the A/T r accessibility of the promoter to transcription factor (64). C2H2 zinc-finger and PHD finger domains are known to involve DNA binding and protein-protein interaction (65). Since TZP has three putative DNA binding motifs, i.e., an AT-hook, a C2H2 zinc finger, and a PHD finger domain, we examined whether TZP associated with DNA in the form f chroonation scheme illustrated in Fig. 107 c Figure 30. TZP binds DNA. (A and B) Associatiof TZP with chromatin. (CSchematic procedure oCASTing analysis. (DSequence alignment of TZbinding consensus sequenc(E) Electrophoretic mobilshift assay were performed described in experimentprocedures. (F) Luciferaassay. TZP consensusbinding sequence was clonedto pGL3-basic vectoHEK293 cells wtransfected with indicatplasmids. Following 36-culture, luciferase activitwas measured and normalizto -galactosidase. Resulare the mean S.E. of thrindependent experimeperformed in triplicate. a DNA consensus motif. It haich DNA sequence and enhances o matin. We used a small-scale biochemical fracti

PAGE 118

30A. HEK293-Flag-TZP cell lysates prepared with a nonionic detergent were divided by sequential centrifugation into soluble cytosolic components called S2 and nuclear fraction. The nuclear fraction was divided into two aliquots, treated with (+) or without -) micrococcal nuclease and further fractionated into soluble nuclear components called S3 and insoluble nuclear pellets called P3. Immunoblottprotein was not in S2 cytoplasmic fraction and that the mfraction becomes soluble (S3) after MNase treatment (Fig. ion. HCT116 p53+/+ cells were seeded into 6-well plate and treated with TZP/RNAi or scramble RNAi and subjected into Western (left panels) and Northern (right panels) blot analysis. ( ing analysis showed that TZP ajority of the TZP in the P3 30B). Figure 31. TZP transcriptionally upregulates p53. (A) HCT116 p53+/+ cells were transfected with TZP and immunoblotted with indicated antibodies. (B and C) TZP inducible HeLa/Tet-on and MCF7/Tet-off cells were treated with or without doxycyclin for indicated time and then immunoblotted with indicated antibodies. (D) Northern blot analysis of TZP inducible MCF7/Tet-off cells with [32p]dCTP-labeled p53 and actin cDNA as probes. (E) Knockdown of TZP reduces p53 express Next, we searched the TZP-DNA binding consensus sequence using cyclic amplification and selection of target (CASTing) assay (Fig. 30C). The oligonucleotide library selected after four rounds of TZP binding was cloned into pGEM-T, and the isolated clones were sequenced. Of 60 sequenced clones, all contained at least one RGTGNR (R = A or G and N = A, G, C or T; Fig. 30D). To confirm this result, EMSA was carried out with the [ 32 p]-ATP labeled TZP consensus sequence containing 108

PAGE 119

oligonucleotide. As shown in Fig. 30E, TZP bound to the oligonucleotide that was competed by excess of cold probe while the supershift was not observed. Further, we cloned three repeats of TZP binding consensus sequence (TBCS) into pGL3 luciferase vector (pGL3-3xTBCS-Luc). Reporter a ssay was performed with HEK293 cells the form of chromatin nd induces transcription by bindi ng to a specific DNA element. TZP transcriptionally upregulates p53. Since TZ survival and regulates both G1 and G2/M cell cycle checkpoi of TZP on expression of a dozen molecules involving both progression. Immunoblotting analysis rev ealed that p53 w different cell lines, including HCT116, HeLa and MCF7 However, TZP was unable to induce p53 e xpression in HCT not shown). Accordingly, downstream ta rgets of p53, such were also upregulated (Fig. 31C). Furtherm ore, mRNA leve inducing TZP expression (Fig. 31D). In addition, knock reduced p53 expression at both mR NA and protein leve conclude that TZP transcriptionally regulates p53 and is ess expression level of p53. TZP binds to p53 promoter and induces the pr xamined if TZP induces p53 promoter activit y. HeLa cells were transfected with pGL2-p two transfected with pGL3-3xT BCS-Luc and increasing amount s of TZP. Fig. 30F shows that the promoter activity was induced by TZP in a dose dependent manner. Taken collectively, these data indicat e that TZP associates with DNA in a P inhibits cell growth and nts, we examined the effects cell survival and cell cycle as upregulated by TZP in examined (Figs. 31 A-C). 116-p53 null cell line(data as p21, Bax and GADD45, l of p53 was increased after down of TZP significantly ls (Fig. 31E). Thus, we ential for maintaining basal omoter activity We next e 53/-2.4 or its deletion mutants (p GL2-p53/-110, pGL2-p53/-240, and pGL2-p53/460) and increasing amounts of TZP. Follo wing 36 h incubation, lu ciferase reporter assay was performed and showed that TZP considerably induced p53/-110 promoter activity, but to much lesser extent in othe r p53 promoter fragment-driven luciferase reporters (Fig. 32B). This suggests that repression element(s) resides in a region between -110bp and -2.4kb of the promoter. Further, sequence analysis revealed 109

PAGE 120

putative TZP-binding consensus sites in the p53 promoter at -29/-34 and -79/-84 (Fig. 32A). Mutations of these 2 sites by conve rting the core sequence GTG to AAA largely abrogated pGL2-p53/-110 promoter ac tivity induced by TZP (Fig. 32C). To determine if TZP directly bi nds to the TZP-binding site of p53 promoter in vivo we carried out chromatin immunoprecipitati on (ChIP) assay, which detects specific genomic DNA sequences that are associated with a particular transcription factor in intact cells. HEK293 cells were transfected with Flag-TZP and immunoprec ipitated with antiFlag antibody. The TZP bound chromatin wa s subjected to PC R using oligonucleotide rimers that amplify region spanning TZP-binding site within the p53 promoter. As show i ere they interact Since TZP contains two putative Akt hosphorylation consensus sites (Fig. 33A), we next determined whether TZP is phosph p n Fig. 32D, the anti-Flag antibody pu lled down TZP binding site (-268/-4). In contrast, immunoprecipitation with an irrele vant antibody (anti-Ig G) resulted in the absence of band in this site Since the two TZP binding s ites (-29/-34 and -79/-84) are very close to each other in the p53 promoter, ChIP assay is una ble to distinguish which site directly binds to TZP. However, mutation analysis of the promoter showed that the both TZP-binding sites are required for p53 promoter to respond to TZP (Fig. 32C). Furthermore, EMSA assay revealed that TZP is capable of binding to the DNA oligonucleotides corresponding to the two TZP-binding site s while supershift was not detected (Fig. 32E). Nevertheless, these data indicate that p53 is a direct target of TZP. Akt phosphorylates TZP and induces TZ P translocation from the nucleus into the cytoplasm wh p orylated by Akt. HEK293 cells were co-transfected with Flag-TZP and constitutively active Akt or pc DNA3 vector and then labeled with [ 32 P]-orthophosphate. The labeled TZP was immunoprecipitated with anti-Flag antibody, separated and blotted on a membrane. PhosphoImager quantification an alysis revealed that the incorporation of 32p into TZP was 8-fold higher in Akt/TZP transfected cells as co mpared to the cells transfected with pcDNA3/TZP (Fig. 33B). Further, in vitro kinase assay showed that Akt phosphorylation of TZP on serine-291 but not serine-265 (Figs. 33C and 33D). These results indicate that Akt phosphorylates TZP in vitro and in vivo We further 110

PAGE 121

F igure 32. TZP binds to and induces p53 promoter. (A) p53 promoter contains two putativanalysi e TZP binding regions highlighted by underlines. Primers used for Chip s are highlighted. (B and C) Luciferase assay. MCF7 cells were seeded into 12-well plate and transfected with indicated plasmids and then subjected into luciferase assay. (D) ChIP assay shows that TZP binds to p53 promoter in vivo. HEK293 cells were transfected with Flag-TZP and assayed with chromatin immunoprecipitation as described in experimental procedures. (E) TZP binds p53 promoter in vitro. EMSA was performed as described in experimental procedures. examined if Akt phosphorylation of TZP affects their interaction. Phosphomimic and nonphosphorylatable TZP were created by mutation of serine-291 into aspartic acid (TZP-D) and alanine (TZP-A), respectively. Co-immunoprecipitation analysis revealed that wild type TZP and phosphomimic TZP-D bound to Akt whereas nonphosphorylatable TZP-A failed to interact with Akt (Fig. 33E), implying that 111

PAGE 122

phosphorylation of TZP by Akt is important for their interaction. Since serine-291 of TZP locates at a nuclear localization signal, we next tested whether Akt phosphorylation of TZP affects its subcellular localization. MCF7 cells were transfected with Red-Myr-Akt and/or GFP-TZP. GFP-TZP was exclusively localized in the nucleus in the cells transfected with GFP-TZP alone. tive ells led thophosphate (0.5 mCi/ml) for 4 h. Cell lysates were immunoprecipitated ith anti-Flag antibody, separated by SDS-PAGE and transferred to a membrane. The rom Figure 33. Akt phosphorylates TZP in vitro and in vivo. (A) TZP contains two putaAkt phosphorylation sites. (B) TZP is phosphorylated by Akt in vivo. HEK293 cwere co-transfected with Flag-TZP and constitutively active Akt or pcDNA3 and labewith [ 32 P]-or w phosphorylated TZP band was examined by autoradiography. (C and D) Akt phosphorylates TZP on Ser291. In vitro Akt kinase assay was performed using full-length TZP (c), GST-fused wild-type and mutant TZP (d) as substrates. (E) Co-immunoprecipitation. HEK293 cells were co-transfected with Flag-tagged wild type and the phosphorylation site mutated TZP and HA-Akt. After 48 h incubation, cells were lysed, immunoprecipitated and immunoblotted with indicated antibodies. However, co-transfection of constitutively active Akt resulted in TZP redistribution f 112

PAGE 123

the nucleus to the cytoplasm. Interestingly, Akt was coloca lized with TZP in the cytoplanucleus into the ytoplasm where TZP interacts with Akt and 14-3-3. Figurcotransfected with GFP-TZP and Red-active Akt. Nucleus was stained with DAPI. (B) TZP binds to 14-3-3. HEK293 cells were transfected with Flag-TZP. After 48 h culture, immunoprecipitation was performed with anti-14-3-3 antibody and the ctivity induced by TZP was also inhibited by Akt in a dose-dependent manner (Fig. 35C). sm (Fig. 34A). Further, coimmunoprecipitation revealed the interaction between TZP and 14-3-3 in normal culture condition and the interaction was slightly increased by serum stimulation (Fig. 34B). Collectively, these results suggest that TZP is phophorylated by Akt which leads to TZP translocation from the c e 34. Akt phosphorylation to TZP results in TZP nuclear exclusion and slightly increases TZP interaction with 14-3-3 protein. (A) MCF7 cells were immunoprecipitates were immunoblotted with ant-Flag antibody. Akt phosphorylation of TZP inhibits TZP transactivation activity. Todetermine role of Akt phosphorylation of TZP in TZP function, Gal4 fused TZP construct was created and used for the reporter assay. As shown in Figs. 35A and 35B, Gal4-TZP but not TZP considerably induced the activity of pTK-Luc, a luciferase gene under thecontrol of the thymidine kinase minimal promoter. Expression of constitutively activeAkt inhibited the promoter activity induced by Gal4-TZP. Further, p53 promoter 113 a

PAGE 124

Accordingly, TZP-induced p53 expression was reduced when cells were co-transfected with constitutively active Akt (Fig. 35D). To examine if TZP regulation of p53 dependson phosphorylation of serine-291, HCT116 cells were transfected with TZP-S291A or TZP-S291D together with or without constitutively active Akt. As shown in Fig. 35D, expression of TZP-S291A but not TZP-S291D increased p53 expression and Akt had no effect on p53 expression in both TZPS291A and TZP-S291D-transfected ells. These findings suggest that TZP transactivation activity and TZP-regulated p53 are inhibited by Akt through a phosphorylation-dependent manner. Figure 35. Akt inhibits TZP transcriptional activity. (A-C) Reporter assay. HeLa cells were seeded into 12-well plate and transfected indicated plasmids Following 36 h incubation, luciferase activity was measured and normalized to -galactosidase. Results are the mean S.E. of three independent in tern 116 co-ated lture h, cells were lysed and immunoblotted with doxoruthern and Western blotting 114 c experiments performedtriplicate. (D) Wesblot analysis. HCTp53+/+ cells were transfected with indicplasmids. After cufor 36 indicated antibodies. Increase of TZP expression at mRNA and protein levels in response DNA damage. While p53 is upregulated primarily through stabilization in response to DNA damage, several studies have shown that p53 is also regulated at the transcriptional level in response to genotoxic stress (44, 45). Thus, we next asked if TZP is regulated by DNA damage and mediates stress-induced p53. HCT116 cells were treated with bicin or etoposide for different time points. Nor

PAGE 125

analyses revealed upregulation of TZP at mRNA and protein levels after the treatment for 30 min. Accordingly, elevated protein and mRNA levels of p53 were detected in response to the treatment (Fig. 36A-D). These findings were further confirmed in HeLa and MCF7 cell lines (Fig. 36E and 36F and data not shown). These results indicate that TZP is a DNA damage-response gene and could mediate transcriptional upregulation of p53 by genotoxic stress. TZP mediates the upregulation of p53 by DNA damage. To demonstrate hether TZP is responsible for stress-induced p53 expression, we knocked-down TZP ith RNA interference (RNAi) prior to challenging HCT116etoposide. Immunoblotting analysis showed that the knockreduced p53 levels induced by doxorubicin or etoposide in wilHCT116 cells (Figs. 37A and 37B). Accordingly, p53 downsBax were decreased (Fig. 37A). Moreover, chromatin immuthe ability of p53 to bind to p21 promoter was considerablyTZP (Fig. 37C). w w cells with doxorubicin or down of TZP significantly d-type p53 but not p53-null tream target genes p21 and noprecipitation showed that reduced by knockdown of Figure 36. TZP is induced by DNA damage. (A and B ) Northern blot analysis. HCT116 p53+/+ cells were seeded into 6-well plate and challenged with 100 M etoposide (A) and 10 M doxorubicin (B) for indicated time. Total RNA was extracted and assayed by Northern blot analysis. (C-F) Immunoblotting analysis. HCT116 p53+/+ (C, D), HeLa (E), and MCF7 (F) cells were treated with 100 M etoposide (C, E) and 10 M doxorubicin (D, F) for indicated time and then immunoblotted with indicated antibodies. 115

PAGE 126

Accumulated evidences demonstrate that upregulation of p53 by DNA damage is largely due to its protein stabilization through phosphorylation by stress kinases such as Chk1/2, ATM/ATR, DNA-PK and JNK (66). Thus, we further examined if TZP also regulates p53 stability. Pulse-chase assay was performed in pcDNAand TZP-transfected HCT116. Fig. 38A shows that the degradation rate of p53 was significantly decreased in TZP-HCT 116 cells. Further, the possible effect of TZP on p53 biquitination was examined in p53-null H1299 cells. After transfection with p53, u Figure 37. Knockdown of TZP reduces p53 expression induceB) Western blot analysis. HCT116 p53+/+ and p53-/cscramble and TZP SiRNA. After 68 h of the transfection, celdoxorubicin or 100 M etoposide for 4 h and then immunoblotted with indicated antibodies for p53. (C) Knockdown of TZP decreases p53 HCT116 p53+/+ cells were transfected with scramble andtreatment with doxorubicin, p53 DNA binding activity was using the primers derived from p21 promoter. d by DNA damage. (A and ells were transfected with ls were treated with 10 M binding to p21 promoter. TZP SiRNA. Following examined with ChIP assay 116

PAGE 127

Mdm2, and ubiquitin together with or without TZP, immunoblotting of p53 immunoprecipitates with anti-Myc (ubiquitin) antibody revealed that ubiquitination of p53 induced by Mdm2 was considerably reduced by TZP (Fig. 38B). Figure 38. TZP stabilizes and interacts with p53. (A) Western blot analysis. HCT116 p53+/+ cells were transfected with pcDNA3 (left) and TZP (right). After 36 h of the transfection, cells were treated with cycloheximide (CHX) for indicated time and then immunoblotted with indicated antibodies. (B) TZP inhibits mdm2-mediated p53 ubiquitination. P53-null H1299 cells were transfected with HA-p53, mdm2, Flag-TZP, and Myc-ubiquitin. Following 48 h incubation, cells were immunoprecipitated with anti-HA antibody and immunoblotted anti-myc antibody (top panel). Panels 2-4 show expression of transfected plasmids. (C) Co-immunoprecipitation. HEK293 was cotransfected with Flag-TZP and GFP-p53. After 48 h of the transfection, cells were, lysed, immunoprecipitated and immunoblotted with indicated antibodies. (D) TZP directly binds to p53. GST pull down assay was performed as described in experimental procedures. 117

PAGE 128

To explore underlying mechanism, co-immunoprecipitation showed that TZP physically interacts with p53 (Fig. 38C). GST-pull down assay revealed that GST-p53 directly bound to TZP (Fig. 38D). These data indicate th at TZP not only anscriptionally upregulates p53 but also binds to and stabilizes p53 protein and that TZP plays an important role in regulation of p53 at both physiological and DNA-damage conditions. Figure 39. Akt inhibits the interaction between TZP and p53. (A) HEK293 cells were transfected with TZP, p53, active Akt (Ac) and dominant negative Akt. After 48 h of the transfection, cells were lysed, immunoprecipitated and immunoblotted with indicated antibodies. (B) H1299 cells were transfected with Flag-tagged wild type TZP, nonphosphorylatable TZP-A, phospho-mimic TZP-D and Red-p53. After 48 h incubation, cells were lysed, immunoprecipitated and immunoblotted with indicated antibodies. Akt inhibits the interaction between TZP and p53. Akt was shown to phosphorylate TZP and reduce its transactivation activity (Figs. 33-35). Since TZP also binds to p53, we further asked if Akt phosphorylation of TZP affects TZP/p53 complex tr formation. Immunoprecipitation revealed that expression of constitutively active Aktreduced the ability of TZP to associate with p53 while dominant negative Akt had no detectable effect on the complex (Fig. 39A). Consistent with these findings, phosphomimic TZP-D reduced its capability of binding to p53 and nonphosphorylatable TZP-A exhibited no significant change of interacting with p53 as compared to wild type TZP (Fig. 39B). In combination with the findings in Figs. 33-35, our data suggest that Akt inhibits TZP transcriptional activity toward p53 and reduces the TZP association with p53 through phosphorylation of serine-291. 118

PAGE 129

Discus ZP as a transcrip tion factor that interacts with Akt and p53. TZP binds to nd transactivates p53 promoter resulting in induction of p53 mRNA. Further, TZP also interacts with p53 protein and inhibits Mdm2-med degradation. Akt phosphorylates TZP and prom otes TZP to the cytoplasm, which lead to downregul ation of p53 Importantly, we showed that TZP is required to maintain genotoxic stress-induced p53. These findings i ndicate t both Akt and p53 signaling and establish additional con cascades. TZP contains multiple functional doma ins includin C2H2 zinc finger and PHD finger domains. The tudor d daptor mediating intramolecular as well as intermolecular protein-protein interactions 67). AT-hook binds to the A/T rich DNA sequence mors and to transcriptionally activate p53 Our data showed that expression of TZP inhibits cell proliferation and induces cell 119 sion Akt was shown to regulate p53 th rough phosphorylation of Mdm2. Phosphorylated Mdm2 leads to its retention in the nucleus where Mdm2 inhibits p53 transactivation function and targets p53 degr adation (46, 50). In this report, we identified T a ia ted p53 ubiquitination and translocation from the nucleus at mRNA and protein levels. of basal level of p53 as well as hat TZP plays a pivotal role in nection between Akt and p53 g tudor motif, AT-hook region, omain was thought to act as an a and protein-nucleic acid associations ( and enhances accessibility of the prom oter to transcription factor (64). C 2 H 2 zinc finger and PHD finger domains are known to involve in DNA binding and proteinprotein interaction (65). We showed in th is study that TZP directly associates with chromatin and transactivates p53 promoter through binding to DNA motif (RGTGNR). Recent reports suggest that tudor and PHD-fi nger domains bind to methylated lysine residue of histone (68, 69). Further studies are required to examine if TZP binds to methylated histone and involves in chromatin modification. In addition to p53 gene mutation, frequent downregulation of p53 messenger RNA has been detected in human cancer (70, 71). However, little is known about the transcription factors that regulate p53 synthesis. HOXA5 was shown to be codownregulated with p53 in some of breast tu (72).

PAGE 130

death and c ell cycle arrest (Fig. 23). TZP localizes at chromosome 20q11 where is equently deleted in human cancer (73, 74) suggesting that TZP could be a putative tumor s f TZP by genotoxic stress remains to be investigated. Refere fr uppressor gene, which needs to be further investigated. Akt mediates extraand intra-cellular signals to regulate a variety of cellular processes (14). However, the role and m echanism of Akt in DNA-damage response has not been well documented. Several studies suggest that Akt overcomes DNA damageinduced G2/M arrest by inhibition of Chk1 and Chk2 kinase activity (75). However, only Chk1 was found to be directly phosphorylat ed by Akt (76). Activated Chk1 and Chk2 were known to phosphorylate and stabi lize p53. Our data showed that TZP upregulates p53 at both transcriptional and posttranslational levels. In response to genotoxic stress, both TZP and p53 were i nduced and knockdown of TZP decreased p53 level. Akt phosphorylates and abrogates TZP function. Thus, these findings provided another direct link between Akt and p53 in the stress pathway, while the mechanism of induction o In summary, TZP is a transcriptional factor and a binding partner of p53 and Akt. It exhibits tumor suppressor activ ity and plays a critical role in maintaining basal level of p53 and stress-induced p53. TZP not only tr anscriptionally regulates p53 but also stabilizes p53 protein. Akt phosphorylates TZ P leading to its translocation from the nucleus to the cytoplasm and attenuation of its growth inhibition function. Further investigations are required for the ability of TZP to bind to methylated histone and the role of TZP in histone modification. Impor tantly, tumor suppressor activity of TZP and its possible involvement in human malignancy need to be further studied. In addition, the genome wide TZP target genes need to be identified in order to illustrate normal cellular function of TZP. nce 1. Staal, S. P., Hartley, J. W., and Rowe, W. P. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 3065. 2. Staal, S. P. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 5034. 3. Bellacosa, A., Testa, J. R., Staal, S. P., and Tsichlis, P. N. (1991) Science 254, 274. 4. Coffer, P. J., and Woodgett, J. R. (1991) Eur. J. Biochem. 201, 475. 120

PAGE 131

5. Jones, P. F., Jakubowicz, T., Pitossi, F. J., Maurer, F., and Hemmings, B. A. (1991) Proc. Nat. Acad. Sci. 88, 4171-4175. 6. Cheng, J. Q., Godwin, A. K., Bellacosa, A., Taguchi, T., Franke, T. F., Hamilton, T. C., Tsichlis, P. N., and Testa, J. R. (1992) Proc. Natl. Acad. Sci.U. S. A. 89, 9267-9271. 7. Chen and T ffney, P. R. J., Reese, C. B., a li, S. M., and Saba tini, D. M. (2005) Science. 307, 1098-1101. en, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S. I., Puc, J., Miliaresis, C., L., McCombie, R., Bigner, S. H., Giovanella, B. C., Ittmann, M., Tycko, B., Hibshoosh, H., Wigler, M. H., and Parsons, R. (1997) Science 275, 1943-1947. A., Baumgard, M. L., Hattier, T ., Davis, T., Frye, C., Hu, R., Swedlund, 356 362. aki, T., g, J. Q., Ruggeri, B., Klein, W. M., So noda, G., Altomare, D. A., Watson, D. K., esta, J. R. (1996) Proc. Natl. Acad. Sci.U. S. A. 93, 3636 3641. 8. Bellacosa, A., de Feo, D., Godwin, A. K., Bell, D. W., Cheng, J. Q., Altomare, D. A., Wan, M., Dubeau, L., Scambia, G., and Masciu llo, V. Ferrandina, G., Benedetti Panici, P., Mancuso, S., Neri, G., and Testa, J. R. (1995) Int J Cancer 64, 280-285. 9. Burgering, B. M. T. and Coffer, P. J. (1995) Nature (London) 376, 599. 10. Franke, T. F., Yang, S., Chan, T. O., Da tta, K., Kazlauskas, A., Morrison, D. K., Kaplan, D. A., and Tsichlis, P. N. (1995) Cell 81, 727-736. 11. Liu, A. X., Testa, J. R., Hamilton, T. C ., Jove, R., Nicosia, S. V., and Cheng, J.Q. (1998) Cancer Res 58, 2973-2977. 12. Shaw, M., Cohen, P., and Alessi, D. R. (1998) Biochem J 336, 241-246. 13. Chan, T. O., Rittenhouse, S. E., and Tsichlis, P. N. (1999) Annu. Rev. Biochem 68, 965-1014. 14. Datta, S. R., Brunet, A., and Greenberg, M. E. (1999) Genes Dev. 13, 2905-2927. 15. Testa, J. R., and Bellacosa, A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 10983-10985. 16. Brazil, D. P., Park, J., and Hemmings, B. A. (2002) Cell. 111, 203-303. 17. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Ga nd Cohen, P. (1997) Curr Biol 7, 261-269. 18. Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P., and Hemmings, B. A. (1996) EMBO J. 15, 6541-6551. 19. Persad, S., Attwell, S., Gray, V., Mawji, N., Deng, J. T., Leung, D., Yan, J., Sanghera, J., Walsh, M. P., and Dedhar, S. (2001) J. Biol. Chem. 276, 27462 27469. 20. Balendran, A., Casamayor, A., Deak, M., Pate rson, A., Gaffney, P., Currie, R.,Downes, C. P., and Alessi, D. R. (1999) Cell. 9, 393-404. 21. Toker, A., and Newton, A. C. (2000) J. Biol. Chem. 275, 8271-8274. 22. Partovian, C., and Simons, M. (2004) Cell Signal 16, 951-957. 23. Kawakami, Y., Nishimoto, H., Kitaura, J., Maeda-Yamamoto, M., Kato, R. M., Littman, D. R., Rawlings, D. J., and Kawakami, T. (2004) J. Biol. Chem 279, 4772047725. 24. Feng, J., Park, J., Cron, P., Hess, D., and Hemmings, B. A. (2004) J. Biol. Chem 279, 41189-41196. 25. Sarbassov, D. D., Guertin, D. A., A 26. Li, J., Y Rodgers, 27. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K. A., Lin, H., Ligon, A. H., Langford, L. B., Teng, D. H. R., and Tavtigian, S. V. (1997) Nature Genetics 15 28. Parsons, R. (2004) Semin Cell Dev Biol 15, 171-176. 29. Stambolic, V., Suzuki, A., de la Pompa, J ., Brothers, G., Mirtsos, C., Sas 121

PAGE 132

Ruland, J., Penninger, J., Sider ovski, D., and Mak, T. (1998) Cell 95, 29-39. Brader, S., and Eccles, S. A. (2004) Tu 30 mori 90, 2-8. 32 0) 33 310. 35 Differ 10, 39 4, 592603. 26555. J. F., Maya, R., 50. Zhou, B. P 53 55 ., 31. Finlay, C. A., Hinds, P. W ., and Levine, A. J. (1989) Cell 57, 10831093. Baker, S. J., Markowitz, S., Fearon, E. R ., Willson, J. K., and Vogelstein, B. (199 Science 249, 912915. Vogelstein, B., Lane, D., and Levine, A. J. (2000) Nature 408, 307 34. Sherr, C. J. (2004) Cell 116, 235 246. Vogelstein, B., and Kinzler, K. W. (2004) Nat Med 10, 789 799. 36. Bourdon, J. C., Laurenzi, V. D., Melino, G., and Lane, D. (2003) Cell Death 397399. 37. El-Deiry, W. S. (2003) Oncogene 22, 74867495. 38. Oren, M. (2003) Cell Death Differ 10, 431442. Okada, H., and Mak, T. W. (2004) Nat Rev Cancer 40. Vousden, K. H., and Lu, X. (2002) Nat Rev Cancer 2, 594604. 41. Raman, V., Tamori, A., Vali, M., Zeller K., Korz, D., and Sukumar, S. (2000) J Biol Chem 275, 26551 42. Stasinopoulos, I. A., Mironchik, Y., Rama n, A., Wildes, F., Winnard, P. Jr., and Ram an, V. (2005) J Biol Chem 280, 2294-2299. 43. Phan, R. T., and Dalla-Favera, R. (2004) 635639. 44. Sun, X., Shimizu, H., and Yamamoto, K. (1995) Mol Cell Biol 15, 4489 4496. Nature 432, 45. Hellin, A. C., Calmant, P., Gielen, J., Bours, V., and Merville, M. P. (1998) Oncogene 16, 11871195. 46. Mayo, L. D., and Donner, D. B. (2001). Proc. Natl. Acad. Sci. USA. 98, 115981603. 47. Yin, Y., Stephen, C. W., Luciani, M. G., and Fahraeus, R. (2002) Nat. Cell Biol. 4, 462-467. 48. Ogawara, Y., Kishishita, S., Obata, Y., Isazawa, Y., Suzuki, T., Tanaka, K., Masuyama, N., and Gotoh, Y. (2002) J. Biol. Chem 277, 21843-21850. Leal 49. Oren, M., Damalas, A., Gottlieb, T., Michael D., Taplick, J., Moas, M., Seger, R., Taya, Y., and Ben Ze'Ev, A. (2002) Ann. N. Y. Acad. Sci. 973, 374383. ., Liao, Y., Xia, W., Zou, Y., Spohn, B., and Hung, M. C. (2001) Nat. Cell Biol. 3, 973-982. 51. Sun, M., Wang, G., Paciga, J. E., Feldman, R. I ., Yuan, Z. Q., Ma, X. L., Shelley, S. A., Jove, R., Tsichlis, P. N., Nicosia, S. V., and Cheng, J. Q. (2001) Am. J. Pathol. 159, 431-437 52. Liu, Q., Kaneko, S., Yang, L., Feldman, R. I., Nicosia, S. V., Chen, J., and Cheng, J. Q. (2004) J Biol Chem 279, 52175-52182. Dan, H. C., Sun, M., Kaneko, S., Feldman, R. I., Nicosia, S. V., Wa ng, H. G., Tsang, B. K., and Cheng, J. Q. (2004) J. Biol. Chem. 279, 5405-5412. 54. Wang, B., Golemis, E. A., and Kruh, G. D. (1997) J. Biol. Chem. 272, 17542-17550. Liu, A-X., Testa, J. R., Hamilton, T. C., Jove, R., Nicosia, S. V., and Cheng, J. Q. (1998) Cancer Res. 58, 2973-2977. 56. Sun, M., Wang, G., Paciga, J. E., Feldman, R. I ., Yuan, Z. Q., Ma, X. L., Shelley, S. A Jove (2001) Am. J. Pathol. 159, R., Tsichlis, P. N., Nicosia, S. V., and Cheng, J. Q 122

PAGE 133

431-437. 57. Dan, H. C., Sun, M., Yang, L., Feldman, R. I., Su i, X.-M., Ou, C. C., Nellist, M., (2002) J. 58 X., and Lazebnik Y. (2002) Science (Wash. DC) 297, 1352Proc Natl 61. Owada, Y., Utsunomiya, A., Yoshimoto, T., and Kondo, H. (1997) J Mol Neurosci 9, l. 68, 122-132. S., Sinha, S., and (2005) Curr Pharm ellert, H. S., Stavridi, E. S., and Halazonetis, T. D. (2004) Nature 432, 6) EMBO reports 7, 397403. 74 Yeung, R. S., Halley, D. J. J., Nicosia, S. V., Pledger, W. J., and Cheng, J. Q Biol. Chem. 277, 35364-35370. Lassus P., Opitz-Araya 1354. n, D. M., and Ginsberg, D. (1997) 59. Lindeman, G. J., Gaubatz, S., Livings to Acad Sci USA 94, 5095-5100. 60. Dudek, H., Datta, S. R., Franke, T. F., Bir nbaum, M. J., Yao, R., C ooper, G. M., Segal, R. A., Kaplan, D. R., and Greenberg, M. E. (1997) Science. 275, 661-665. 27-33. 62. Iotsova, V., and Stehelin, D (1995) Eur J Cell Bio 63. Mondal, A. M., Chinnadurai, S., Datta, K., Chauhan, S. Chattopadhyay, P (2006) Cancer Res. 66, 10466-10477. 64. Lee, J. K., Moon, K. Y., Jia ng, Y., and Hurwitz, J. (2001) Proc Natl Acad Sci U S A. 98, 13589-13594. 65. Moosmann, P., Georgiev, O., Le Douarin, B., Bourquin, J. P., and Schaffner, W. (1996) Nucleic Acids Res. 24, 4859-4867 66. Pommier, Y., Sordet, O., Rao, A., Zhang, H., and Kohn, K. W Des. 11, 2855-2872. 67. Yang, X. J. (2005) Oncogene. 24, 1653-1662. 68. Huyen, Y., Zgheib, O., DiTullio, R. A. Jr., Go rgoulis, V. Z., Zacharatos, P., Petty, T. J., Sheston, E. A., M 406-411. 69. Kim, J., Daniel, J., Espejo, A., Lake, A., Kr ishna, M., Xia, L., Zh ang, Y., and Bedford, M. T. (200 70. Takahashi, T., Nau, M. M., Chiba, I., Birr er, M. J., Rosenberg, R. K., Vinocour, M., Levitt, M., Pass, H., Gazdar, A. F., and Minna, J. D. (1989) Science 246, 491-494. 71. Lee, K., Jeon, K., Kim, J. M., Kim, V. N. Choi, D. H., Kim, S. U., and Kim, S. (2005) Glia 51, 1-12. Ram 72an, V., Martensen, S. A., Reisman, D., Evron, E., Odenwald, W. F., Jaffee, E., Marks, J., and Sukumar, S. (2000) Nature 405, 974-978. 73. Peng, Z., Zhou, C., Zhang, F., Ling, Y., Tang, H ., Bai, S., Liu, W., Qiu, G., and He, L. (2002) Chin Med J (Engl). 115, 1529-1532. Vauhkonen, H., Vauhkonen, M., Sajantila, A., Sipponen, P., and Knuutila, S. (2006) Cancer G enet Cytogenet. 167, 150-154. 75. Roos, P., and Kaina, B. (2006) Trends Mol Med. 12, 440-450. Shtivelman, E., Sussman, J., and Stokoe, D 76 (2002) Curr Biol. 12, 919-924. 123

PAGE 134

Chapter 6 surrounding tissue, re K/Akt signal transduction pathway has been giogenesis and migration. It has been hur. Increasing evidences have shown that expression of constitutively active nu argets of Akt have been identified, the mechanism of Akt in by gu lating downstream molecules which are arried out three projects dur ing last five years: 1) Cloning of Akt1 promoter and Discussion and Conclusion During cancer development, tumor cells acquire a number of phenotypic changes that allow them to proliferate both rapidly and limitlessly, invade the survive lacking their normal microenvironment, and finally, metastasize to other sites. These features are usually accompanied with up-regulation of oncogenic and/or downregulation of tumor suppresso r signaling. As a result of concentrated worldwide search activity in the last several years, PI3 shown to play an essential role in tumo r development-related cellular processes, including cell survival, apoptosis, proliferation, an demonstrated that three isoforms of Akt ar e frequently altered in a various types of man tumo Akt in many cell types promotes cellular transformation by two distinct mechanisms: inducing cell proliferation under conditions in which cells should normally be growth arrested and promoting cell survival under conditions in which they should die. While a mber of downstream t human oncogenesis remains elusive. The central hypothesis of this thesis is that Akt contributes to human oncogenesis mediating oncogenic signals and re associated with cell survival, growth and angiogenesis To test this hypothesis, I have c id entification of Akt1 as di rect target gene of Stat3; 2) Downregulation of pro-apoptotic p rotein 24p3 by Akt through phosphorylation of FOXO3a and 3) Identification and c haracterization of a transc ription factor TZP that interacts with p53 and Akt. 124

PAGE 135

Alterations of the AKT1 at the DNA level have been re ported in a single gastric ancer. However, a number of tumors exhibit elevated levels of mRNA, protein and/or kinase of AKT1, implicating that the AKT1 is regulated at transcriptional, translational and/or posttranslational levels. Postt regulation of AKT1 has well been documented. To examine transcription re gulation of AKT1, I have cloned the human AKT1 promoter and demonstra et gene of Stat3. The AKT1 romoter activity is significantly induced by constitutively active Src and Stat3. Knockd a tion-induced 24p3 expression and cell death. orkhead transcription factor FOXO3a binds to and activates 24p3 promoter leading to express Akt c ransl ational ted that AKT1 is a direct targ p own of Stat3 or domina nt-negative Sat3 reduced AKT1 expression induced by constitutively active Src. AKT1 level is low in Stat3-null MEFs and reintroduction of the AKT1 rescued the Stat3-nu ll MEF cell death resulted fr om serum starvation. In addition, we have recently reported that constitutively active Stat3 induces hypoxia inducible factor (HIF)-1 and knockdown AKT1 largely abrogates the HIF-1 expression stimulated by Stat3 (1, 2). All these findings indicate that the AKT1 gene is a direct downstream target of Stat3 and mediat es Src/Stat3 cell surv ival and angiogenesis function. In addition, elevated levels of AKT1 mRNA and protein could be resulted from activation of Stat3 in the same subset of human malignancy. Previous studies have shown that Ak t overcomes IL3 deprivation-induced apoptosis through phosphorylation of Bad in he matopoietic cells. However, expression level of endogenous Bad is low in these cell lines. A proapoptotic protein 24p3 has been demonstrated to play a key role in induction of apoptosis upon IL3 withdrawal. I have shown that Akt inhibits IL3 depriv F ion of 24p3 in response to IL3 withdrawal. Akt phosphorylates FOXO3a and inhibits its action toward 24p3. Therefore, th ese findings indicate for the first time that 24p3 is a direct target gene of FOXO3a and that Akt mediates IL3-regulated 24p3 expression in hematopoietic cells. In a ddition, 24p3, but not Bad, could be a major target of Akt protection cells from a poptosis induced by IL3 withdrawal. Finally, I have identified a novel transcrip tion factor TZP that interacts with 125

PAGE 136

and p53 eferences Expression of TZP inhibits cell grow th and survival and induces both G1 and G2/M cell cycle arrest. TZP directly binds to p53 promoter and induces p53 transcription. In additi on, TZP interacts with p53 and prevents p53 from Mdm2mediated degradation. In response genotoxi c stress, both TZP and p53 were upregulated and knockdown of TZP reduced p53 expression. Akt phosphorylates TZP resulting in its translocation from the nucleus into the cy toplasm, and thus inhibits TZP function. Therefore, I conclude that TZP is a key tr anscription factor that regulates p53. In addition to Mdm2 that is positively regulated by Akt, Akt reduces p53 function through negative regulation of TZP. These data suggested that Akt contribu tes to human oncogenesis by mediating oncogenic protein, Src and STAT3, which are a ssociated with cell survival, growth, and angiogenesis. Furthermore, I showed that Ak t regulates downstream transcription factor Foxo3a and TZP which are associated with ce ll cycle and cell death. These imply that akt is a good candidate as a therapeu tic target of human cancer. R 1. Park, S., Nicosia, S. V., Yu, H ., Jove, R., and Cheng, J. Q. (2005) J. Biol. Chem. 280, 38932-38941. 2. Xu, Q., Briggs, J., Park, S., Niu, G., Kortylewski, M., Zhang, S ., Gritsko, T., Turkson, J., Kay, H., Semenza, G. L., Cheng, J. Q., Jove, R., and Yu, H. (2005) Oncogene. 24, 5552-5560. 126

PAGE 137

APPENDICES 127

PAGE 138

A ppendix A: List of Publications hapter II of this thesis has been published as: ark, S ., Nicosia, S. V., Yu, H., Jove, R., and Cheng, J. Q. (2005) Molecular Cloning and haracterization of Akt1 Promoter Uncove rs its Upregulation by Src/Stat3 Pathway. J. iol. Chem. 280; 38932-38941. hapter III of this thesis has been published as: u, Q., Briggs, J., Park, S C P C B C X Niu, G., Kortylewski, M., Zhang, S., Gritsko, T., Turkson, J., ay, H., Semenza, G. L., Cheng, J. Q., Jove, R., and Yu, H. (2005) Targeting Stat3 blocks oth HIF-1 and VEGF expression induced by multiple oncogenic growth signaling pathways. Oncogene. 24; 5552-5560. (equal contribution) hapter IV of this thesis has been submitted as: ark, S. Nicosia, S. V., and Cheng, J. Q. (2007) Identification of 24p3 as a direct target f FOXO3a that is regulated by IL3 through PI3K/Akt pathway. Oncogene. hapter V of this thesis is prepared the manuscript. K b C P o C 128

PAGE 139

ABOUT THE AUTHOR gree in Biology from Kangwon National niversity in 1996 and a M.S. in 1999 at Sout h Korea. He starte d teaching Biology and uth Florida, Mr. Park received o times of superior presentation at the USF HSC research day. In addition, he is coogical Chemistry and Oncogene ). He is member of America Association for Cancer Research and presented his work at Annual Sungman Park received a Bachelors De U Cellular Biology while in the Masters program. He worked at Department of Anatomy as an assistant teacher until he entered the Ph.D. program at Department of Pathology, College of Medicine, Univers ity of South Florida in 2001. While in the Ph.D. program at the University of So tw author in other two publications ( Journal of Biol a AACR meeting.