USF Libraries
USF Digital Collections

Regulation of MDMX nuclear import and degradation by Chk2 and 14-3-3

MISSING IMAGE

Material Information

Title:
Regulation of MDMX nuclear import and degradation by Chk2 and 14-3-3
Physical Description:
Book
Language:
English
Creator:
LeBron, Cynthia
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
P53
MDM2
Ubiquitination
DNA damage
Posttranslational modifications
Dissertations, Academic -- Cancer Biology -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: The MDM2 homolog MDMX is an important regulator of p53 during mouse embryonic development. DNA damage promotes MDMX phosphorylation, nuclear translocation, and degradation by MDM2. Here we show that MDMX copurifies with 14-3-3, and DNA damage stimulates MDMX binding to 14-3-3. Chk2-mediated phosphorylation of MDMX on S367 is important for stimulating 14-3-3 binding, MDMX nuclear import by a cryptic NLS, and degradation by MDM2. Mutation of MDMX S367 inhibits ubiquitination and degradation by MDM2, and prevents MDMX nuclear import. Expression of 14-3-3 stimulates the degradation of phosphorylated MDMX. Chk2 and 14-3-3 cooperatively stimulate MDMX ubiquitination and overcome the inhibition of p53 by MDMX. These results suggest that MDMX-14-3-3 interaction plays a role in p53 response to DNA damage by regulating MDMX localization and stability. We also show the identification of a cryptic nuclear localization sequence within the C-terminus RING finger domain MDMX. Mutation of MDMX on one lysine residue at position 468 to glutamic acid completely abrogates the nuclear import after DNA damage. This mutation had no effect on MDM2-mediated nuclear import of MDMX in cotransfection assays, suggesting that it is specifically required for the MDM2-independent nuclear import. Interestingly, the MDMX- K468E mutant induces the expression of p21 more efficiently than the wild-type MDMX after ionizing radiation (IR). Furthermore, the K468E mutant induction of p21 is associated with enhanced G1 arrest after DNA damage. These results indicate an important function of MDMX nuclear import in regulating p53 activity after DNA damage.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2007.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Cynthia LeBron.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 131 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001919517
oclc - 184843332
usfldc doi - E14-SFE0001992
usfldc handle - e14.1992
System ID:
SFS0026310:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001919517
003 fts
005 20071218133706.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 071218s2007 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0001992
040
FHM
c FHM
035
(OCoLC)184843332
049
FHMM
090
RC254.6 (ONLINE)
1 100
LeBron, Cynthia.
0 245
Regulation of MDMX nuclear import and degradation by Chk2 and 14-3-3
h [electronic resource] /
by Cynthia LeBron.
260
[Tampa, Fla.] :
b University of South Florida,
2007.
3 520
ABSTRACT: The MDM2 homolog MDMX is an important regulator of p53 during mouse embryonic development. DNA damage promotes MDMX phosphorylation, nuclear translocation, and degradation by MDM2. Here we show that MDMX copurifies with 14-3-3, and DNA damage stimulates MDMX binding to 14-3-3. Chk2-mediated phosphorylation of MDMX on S367 is important for stimulating 14-3-3 binding, MDMX nuclear import by a cryptic NLS, and degradation by MDM2. Mutation of MDMX S367 inhibits ubiquitination and degradation by MDM2, and prevents MDMX nuclear import. Expression of 14-3-3 stimulates the degradation of phosphorylated MDMX. Chk2 and 14-3-3 cooperatively stimulate MDMX ubiquitination and overcome the inhibition of p53 by MDMX. These results suggest that MDMX-14-3-3 interaction plays a role in p53 response to DNA damage by regulating MDMX localization and stability. We also show the identification of a cryptic nuclear localization sequence within the C-terminus RING finger domain MDMX. Mutation of MDMX on one lysine residue at position 468 to glutamic acid completely abrogates the nuclear import after DNA damage. This mutation had no effect on MDM2-mediated nuclear import of MDMX in cotransfection assays, suggesting that it is specifically required for the MDM2-independent nuclear import. Interestingly, the MDMX- K468E mutant induces the expression of p21 more efficiently than the wild-type MDMX after ionizing radiation (IR). Furthermore, the K468E mutant induction of p21 is associated with enhanced G1 arrest after DNA damage. These results indicate an important function of MDMX nuclear import in regulating p53 activity after DNA damage.
502
Dissertation (Ph.D.)--University of South Florida, 2007.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 131 pages.
Includes vita.
590
Advisor: Jiandong Chen, Ph.D.
653
P53.
MDM2.
Ubiquitination.
DNA damage.
Posttranslational modifications.
690
Dissertations, Academic
z USF
x Cancer Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.1992



PAGE 1

Regulation of MDMX Nuclear Import and Degradation by Chk2 and 14-3-3 by Cynthia LeBron A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cancer Biology College of Interdiscip linary Graduate Studies University of South Florida Major Professor: Jiandong Chen, Ph.D. Kenneth L. Wright, Ph.D. Srikumar Chellappan, Ph.D. Hong-Gang Wang, Ph.D. Date of Approval: April 2, 2007 Keywords: p53, mdm2, ubiquiti nation, DNA damage, posttran slational modifications Copyright 2007, Cynthia LeBron

PAGE 2

DEDICATION I would like to dedicate this dissertation to all my family and friends who have supported me throughout my college career and my deci sion to complete my doctorates degree. Most notably: my parents, sister and brothe r. I owe all my successes to them and will forever be grateful for their love and guidance. I also f eel it necessary to acknowledge my grandparents, aunts, uncles and cousins w ho all lost their fight against cancer. I pledge to them a career focused on pursui ng the cure and prevention of cancer.

PAGE 3

ACKNOWLEDGMENTS I would like to acknowledge and thank many pe ople who all contributed to my successful graduation. Dr. Jiandong Chen, for his gui dance, knowledge, support and mentorship throughout my graduate training. I would also like to tha nk my committee members: Dr. Wright, Dr. Chellappan, and Dr. Wang for there participation in my development into a scientist and insightful ideas fo r my projects. I can never sa y thanks enough to my fellow lab mates and friends: Daniele Gilkes, Ne ha Kabra-Woods, Meghan Kreeger and Lihong Chen. My best friends: Valarie Reid, Kimb erlee Oren, Garrett Fuller, Michael Casner and Nicole McGroven. A big th anks to Cathy Gaffney for her continued help in the preparation of my defense and the entire Cancer Biology program and faculty. Thank you to Dr. Alvaro Monteiro for his helpful s uggestions on finding a postdoctoral position.

PAGE 4

i TABLE OF CONTENTS LIST OF FIGURES iv LIST OF ABBREVIATIONS vii ABSTRACT viii INTRODUCTION 1 Carcinogenesis 1 p53 3 History of p53 3 p53 Structure and Function 4 Regulation of p53 9 Activation of p53 in Response to DNA Damage 16 Targeting p53 in the Clinics 18 MDM2 22 MDM2 History 22 MDM2 Structure 22 MDM2 Functions 24 MDM2 Mouse Models 26 MDMX 28 MDMX History 28 MDMX Structure 28 MDMX Mouse Models 30 Regulation of MDMX 31 MDMX Expression in Tumors 34 MDMX-MDM2-p53 Circuit 35 Ubiquitination Process 37 14-3-3 40 14-3-3 Proteins 40 14-3-3 Structure 41 Models of Regulation of 14-3-3 Proteins 43 Diseases Associated with 14-3-3 Proteins 43 14-3-3 Functions 44 14-3-3 Regulation of p53 4 7

PAGE 5

ii MATERIALS AND METHODS 49 Cell lines and plasmids 49 Affinity purification of MD MX-associated protein 49 Site directed mutagenesis and primers 50 RNA interference 50 FACS analysis 51 Protein analysis 51 Immunoprecipitation assay 51 Capture of 14-3-3 using MDMX phosphopeptides 52 In vivo ubiquitination assay 52 Luciferase assay 53 Immunofluorescence staining 53 Nuclear cytoplasmic fractionation 54 In vivo phospholabeling and phosphopeptide analysis 54 RESULTS 56 MDMX interacts with 14-3-3 56 Identification of 14-3-3 binding on MDMX 65 S367 is a major phosphorylation site in vivo 68 Chk2 phosphorylation of S367 is importa nt for stimulating 14-3-3 71 binding Chk2 phosphorylation of MDMX is required for nuclear 74 import and degradation S367 phosphorylated MDMX preferentia lly localizes to the nucleus 83 MDMX contains a cryptic NLS that mediates Chk2 regulated nuclear 87 import 14-3-3 cooperates with Chk2 to promote MDMX ubiquitination 93 Investigating the role of MDMX nuclear import after DNA damage 100 DISCUSSION 107

PAGE 6

iii REFERENCES 112 ABOUT THE AUTHOR End Page

PAGE 7

iv LIST OF FIGURES Figure 1: Structure of p53 5 Figure 2: Functions of p53 9 Figure 3: Regulation of p53 16 Figure 4: Structure of MDM2 23 Figure 5: Structure homology of MDM2 and MDMX 30 Figure 6: 14-3-3 structure and dimer formation 42 Figure 7: 14-3-3 domains 42 Figure 8: Copurification of 14-3-3 with MDMX 57 Figure 9: Endogenous interaction between MDMX and 14-3-3 tau 58 Figure 10: MDMX interacts with other 14-3-3 isoforms 59 Figure 11: p53 interacts with all 14-3-3 isoforms 60 Figure 12: Knockdown of 14-3-3 ha s no effect on MDMX stability 62 Figure 13: Overexpression of 143-3 has no effect on p53 activity 64 Figure 14: Identification of phosphor ylation sites on MDMX by M.S. 65 Figure 15: S367 is the major MDMX-14-3-3 binding site 66 Figure 16: Phosphorylated S367 bi nds specifically to 14-3-3 67 Figure 17: S367 is a major MDMX phosphorylation sites 70 Figure 18: Chk2 is required for MDMX and 14-3-3 interaction 73 Figure 19: S367 mutant is defect ive in nuclear translocation 75 Figure 20: Chk2 deficiency effects MDMX nuclear translocation 77 Figure 21: Analysis of endogenous MDMX by subcellular fractionation 79

PAGE 8

v Figure 22: Subcellular distributi on of MDMX at early time points 80 after IR Figure 23: Chk2-null cells are partia lly defective for MDMX degradation 82 Figure 24: Specificity of P367 antibody 83 Figure 25: 14-3-3 promotes the elim ination of phosphorylated MDMX 85 from the nucleus Figure 26: Distribution of fused GFP moiety to fu ll length and deletion 88 mutant s of MDMX indicates a cryptic NLS region Figure 27: Diagram of MDMX indica ting the location of cryptic NLS 89 Figure 28: Full length MDMX-K468E failed to undergo nuclear 90 translocation after DNA damage Figure 29: Importin binds specifically to w ild-type MDMX but not 91 K468E mutant Figure 30: Chk2 promotes ubiquitination of wild -type MDMX and not 94 S367A mutant Figure 31: 14-3-3 cooperates w ith Chk2 to promote MDMX 96 ubiquitination Figure 32: 14-3-3 stimulates the de gradation of phosphorylated MDMX 97 Figure 33: Chk2 and 14-3-3 cooperate to neutralize MDMX inhibition of 99 p53 Figure 34: MDMX-K468E increase s p21 levels after DNA damage 101 more efficiently then wild-type MDMX Figure 35: Cell cycle analysis suppor ts the induction of p21 by K468E 103 mutant through enhanced growth arrest Figure36: Percentage of cells in G1 104 Figure 37: Wild-type MDMX and K468E mutant are bound and 107 degraded equally by MDM2

PAGE 9

vi Figure 38: Proposed Model 111

PAGE 10

vii LIST OF ABBREVIATIONS NLSnuclear localization sequence NESnuclear export sequence DNADeoxyribose nucleic acid CPTCampthothecin IRIonizing radiation GFPGreen fluorescence protein NPCnuclear pore complex Ub: ubiquitin UV: Ultraviolet radiation Rb: Retinoblastoma gene

PAGE 11

viii REGULATION OF MDMX NUCLEAR IMPO RT AND DEGRADATION BY CHK2 AND 14-3-3 Cynthia LeBron ABSTRACT The MDM2 homolog MDMX is an important regulator of p53 during mouse embryonic development. DNA damage promotes MDMX phosphorylation, nuclear translocation, and degradation by MDM2. Here we show that MDMX copurifie s with 14-3-3, and DNA damage stimulates MDMX binding to 14-3-3. Chk2-mediated phosphorylation of MDMX on S367 is important for stimulating 14 -3-3 binding, MDMX nuclear import by a cryptic NLS, and degradation by MDM 2. Mutation of MDMX S367 inhibits ubiquitination and degradation by MDM2, and prevents MDMX nuclear import. Expression of 14-3-3 stimulates the degr adation of phosphorylated MDMX. Chk2 and 14-3-3 cooperatively stimulate MDMX ubiquitin ation and overcome the inhibition of p53 by MDMX. These results suggest that MDMX -14-3-3 interaction plays a role in p53 response to DNA damage by regulating MDMX lo calization and stability. We also show the identification of a cryptic nuclear localization sequence within the C-terminus RING finger domain MDMX. Mutation of MDMX on one lysine residue at position 468 to glutamic acid completely abrogates the nuc lear import after DNA damage. This mutation had no effect on MDM2-mediated nuclear im port of MDMX in cotransfection assays,

PAGE 12

ix suggesting that it is specif ically required fo r the MDM2-independent nuclear import. Interestingly, the MDMXK468E mutant indu ces the expression of p21 more efficiently than the wild-type MDMX after ionizing radiat ion (IR). Furthermore, the K468E mutant induction of p21 is associated with enhanced G1 arrest after DNA damage. These results indicate an important functi on of MDMX nuclear import in regulating p53 activity after DNA damage.

PAGE 13

1 INTRODUCTION Carcinogenesis The development of cancer is a complex, multi-step process that usually initiates with changes in the act ivation of proto-oncogenes and inac tivation of tumor suppressors. Oncogenes are cellular or viral (inserted by vi rus into a cell) genes that can promote the development of neoplasm. Proto-oncoge nes are normal genes involved in cell proliferation, but amplification or modifi cations can result into the conversion of oncogenes. Tumor suppressor or anti-oncogenes are cellular ge nes that when inactivated increase the probability of cancer formation, wh ereas reactivation of their function can be growth suppressive (Kopnin 2000). While onc ogenes promote cell proliferation, tumor suppressors play important ro les in restraining prolifera tion. The accumulation of genetic mutations eventually leads to genomic instability. However, for this process to develop into cancer, these mutations must arise in cells with the potential to proliferate and survive. Carcinogenesis can be divided in to three steps: initiation, promotion, and progression. Modifications to the stru cture of DNA by chemical carcinogens or epigenetic changes initiate the process. Th ese genetic changes are thought to lead to abnormal proliferation of a single cell. Tu mor promotion is composed of the selective expansion of these abnormal cells, which devel op into a larger population of cells that are extremely unstable and are at risk for acquiri ng more mutations at the end of each round of cell division. Tumor progres sion is the process that resu lts in transformation of pre-

PAGE 14

2 malignant cells to those that display maligna nt phenotypes. The expansion of the cells that acquire this malignant phenotype facili tates the development of more aggressive characteristics and confers a selective advantag e. The majority of cancer cells display the following traits: uncontrolled cell growth, evasion from cell death, invasion and metastasis of other tissues/organs and re duced requirements for extracellular growth factors (Friend, Bernards et al. 1986; Hanahan and Wei nberg 2000). Aforementioned, carcinogenesis is a process that destabilizes the genome resulting in changes to gene activities and stability (Vogelste in, Lane et al. 2000). Many of the genes affected, are involved in cell cycle control, DNA damage/c heckpoint responses and DNA repair. One such example is the TP53 tumor suppressor ge ne, currently termed the guardian of the genome (Lane 1992). The function of p53 is to maintain cellular homeostasis and provide critical steps to en sure an effective tumor res ponse. Understandably, p53 is mutated or deregulated in ove r 50% of human cancers (Hollste in, Sidransky et al. 1991; Levine, Momand et al. 1991).

PAGE 15

3 P53 History of p53 P53 belongs to a family of transcri ption factors including p53, p63 and p73. Although p63 and p73 are required for normal development, only p53 prevents tumor formation (Yang and McKeon 2000). The P53 ge ne was first discovered in 1979 and was thought to play a role as an oncogene, due to the observation that it bound to the Simian Virus (SV40) large T-antigen and accumulate d in cancer cells (DeLeo, Jay et al. 1979; Lane and Crawford 1979; Linzer and Levine 1979; Linzer, Maltzman et al. 1979). In the late 1980’s researchers were studying a mutant form of p53 and not the wild type. These mutant forms contain missense mutations that acquire gain of function activities, which explain why p53 was acting in an oncogenic ma nner, thus accumulating in the nuclei of cancer cells. Mutated p53, unlike wild-type p53, is very stable due to its interaction with HSP90 that inhibits the ubiquitination by MDM2 (Peng, Chen et al. 2001; Peng, Chen et al. 2001). It was also found to form tetram ers with wild-type p53, thereby acting like a dominant negative to suppress wild-type p53 functions (Sigal and Rotter 2000). Interestingly, in 1990, Scheffner et al. found that DNA viruses, such as HPV, evolved a mechanism to inactivate p53 (Sch effner, Werness et al. 1990). More specifically they identified the viral E6 oncoprotein that coul d promote the ubiquitination and proteolytic degradation of p53. P53 is now widely accep ted as a tumor suppressor that continuously monitors the integrity of DNA. It responds to a wide variety of stress signals and

PAGE 16

4 becomes a rate-limiting factor in cert ain steps of tumor development. p53 structure and function P53 is a 393 amino acid transcription factor that binds to defined consensus sites within DNA as a tetramer (el-Deiry 1998). P53 can be divided into four functional domains: a transactivation domain in the Nterminus, a PxxP domain, a sequence specific DNA binding domain in the central region, a nd a tetramerization domain in the Cterminus. The transactivation domain (residue s 1-42) can interact with transcriptional machinery to regulate the expression of p53 target genes. The proline XX proline domain (residues 61-94) can regulate p53 i nduced cell cycle arrest and apoptosis, however mutation of this domain has no effect on the transactivation of p53. The central core domain (residues 102-292) is required for sequence specific DNA binding, and the tetramerization domain (residue s 324-355) is required for the efficient oligomerization of p53 tetramers. In addition the carboxyl te rminus (residues 311-393) contains a nuclear localization and nuclear export sequence resp ectively (Cho, Gorina et al. 1994; Hainaut, Soussi et al. 1997) ( Figure 1 ). Over 80% of human cance r contains missense mutations with in the DNA binding domain (Hainaut, He rnandez et al. 1998). Thirty percent of missense mutation in the DNA binding domain occur in six codons: 175, 245, 248, 249, 273 and 282 (Greenblatt, Bennett et al. 1994).

PAGE 17

5 Figure 1: Structure of p53 In the late 1980’s several important discoveries defi ned the normal function of p53 as anti-oncogenic. Introduction of wild type p53 into cells was found to be growth suppressive and more striking was the effect of p53 ablation. Genetic models of mice homozygous null for p53 were viable and app eared healthy. This indicated that p53 was indispensable for mouse development. Howeve r, after six months of age the mice were clearly more predisposed to spontaneous tumor development than control littermates. Mice heterozygous for p53 were also more pr one to tumor development, however at a more modest rate. The development of cancer in these mice was due to somatic loss of the wild-type allele; al so referred to as loss of hetero zygosity (Donehower, Harvey et al. 1992; Donehower, Harvey et al. 1995). Not surprising, germline mutations of p53 occur in individuals with Li-Fraumeni syndrome who are predisposed to cancer formation (Malkin, Li et al. 1990; Srivas tava, Zou et al. 1990). P53 is a transcriptional activator, re gulating the expression of many genes involved in growth arrest, DNA repair and apoptosis. Through these mechanisms p53

PAGE 18

6 facilitates the repair and surv ival of damaged cells or promotes the removal of severely damaged cells by initiating apoptosis. P53 has also been shown to be capable of transcriptional repression of its target genes. The inhibi tion may be in part due to p53 association with basal transcription machiner y, needed to initiate transcription (Seto, Usheva et al. 1992). Mammalian cell division is controll ed by two tumor suppressors proteins, retinoblastoma protein (Rb) and p53 (Tao and Levine 1999). Regulating the cell cycle is a very important step in ensuring that onl y normal genetic material is passed on to daughter cells. Mistakes during DNA synthesis or divi sion can all lead to the development of cancer. The cell cycle consis ts of four distinct phases: G1phase, Sphase, G2-phase and M-phase. Rb regulates the exit from G1 phase and p53 serves to maintain genomic integrity. Each of these di stinct phases is monitored by checkpoints. The molecular events that control the cell cy cle are ordered and dire ctional. All these stages have regulatory molecule s that determine the cells progress through the cell cycle. Passage through the cell cycle requires activation of cyclin dependent kinases (CDKs) and the transient association with regulato ry subunits: cyclins and cyclin dependent inhibitors. As their name implies, these kinases are directly dependent on cyclins for there activity. In order for the cell to move from G1 phase in to the replication phase (S), the intactness of DNA is required. If the ce ll is exposed to carci nogens or factors known to mutate DNA such as ultraviolet light or io nizing radiation, the G1 checkpoint will stop the progression into S-phase. DNA dama ge can directly induce the cell cycle checkpoints by the activation of p53, which stim ulates the transcri ption of p21, a cell

PAGE 19

7 cycle inhibitor that binds to Cdks to block the transition of G1 to S and from G2 to M phase (el-Deiry, Tokino et al. 1993). Another transcripti onal target of p53 is 14-3-3 sigma gene (Hermeking, Lengauer et al. 1997). 14-3-3 proteins function at several key points in the G1/S and G2/M transition to re gulate the cell cycle pr ogression. Induction of 14-3-3 sigma by p53 results in the cyt oplasmic sequestration of CDC2-cyclin B complexes that are essential for mitosis. The number of divisions for most normal cells is limited, excluding stem cells. The progressive shortening of telomeres and incomplete replication of the entire chromosome mainta ins this mechanism. Notably many cancers have been found to overexpress telomerase, the enzyme required to maintain telomeres. Proto-oncogenes such as Myc, activated Ra s and MDM2 have all been implicated in controlling telomerase activ ity (Fukasawa and Vande Woude 1997). These factors provide cancer cells with the potential to be come immortalized and grow indefinitely. DNA repair is the process whereby the cel l identifies and corrects damage to the DNA molecules that encode its genome. Although not requir ed, p53 facilitates multiple types of DNA repair such as nucleotide excision repair, base excision repair and correction of double stranded breaks (Gatz and Wiesmuller 2006). P53 can also function to promote the transcription of genes involved in DNA repair including GADD45 and p53R2. P53R2 encodes a ribonucleotide reduc tase, which is im portant for both DNA replication and repair. The manner in which p53 initiates apoptosis is a matter of intensive study since it was first demonstrated (Yonish-Rouach, Resn itzky et al. 1991). Apoptosis can be

PAGE 20

8 initiated by two distinct mechanisms: intrinsic and extrinsic pathways. The intrinsic pathway is governed by Bcl-2 family of protei ns that regulate the release of cytochrome C from the mitochondria (Cory and Adams 2002; Kuwana, Mackey et al. 2002). This family consist of pro-apoptotic member s: Bax, Noxa, PUMA and anti-apoptotic members: Bcl-2, Bcl-XL (Vousden and Lu 2002). Bax was the first identified member of pro-apoptotic proteins that can be induced by p53. In response to stress, Bax forms homodimers, which are thought to bind to the mitochondria creating po res. These pores allow the release of cytochrome C from the mitochondria, resulting in caspase 9 activation and the formation of the apoptosome leading to cell death. P53 can also induce PUMA and Noxa, which also promote m itochondrial depolari zation leading to cytochrome c release (Miyashi ta, Krajewski et al. 1994; Oda, Ohki et al. 2000; Nakano and Vousden 2001). Another group of p53-indu ced genes belongs to the death-receptor or tumor necrosis factor receptor family (TNF-R) including DR5, Fas and PERP (OwenSchaub, Zhang et al. 1995; Wu, Burns et al. 1997; Muller, Wilder et al. 1998; Lin, Ma et al. 2000). The extrinsic pathway involves the engagement of death receptors at the cell membrane and the consequent induction of caspa se 8 and caspase 3 activ ities. Fas is a cell surface receptor that is activated by Fas ligand binding. P53 can induce the transcription of Fas mRNA expression and DR5 in response to DNA damage (Wu, Burns et al. 1997; Bouvard, Zaitchouk et al. 2000) ( Figure 2 ).

PAGE 21

9 Figure 2: Functions of p53 Regulation of p53 The p53 protein is subject to tight regulation on three major levels: protein stability, protein activity and sub-cellular distribution. Each of these levels of control is achieved by positive and negative feedback loops ( Figure 3) Under normal conditions, resting cells maintain low le vels of p53 by continuous ubiquitination and degradation by the 26S proteasome. A variet y of different stresse s can activate and stabilize p53. Stress signals are tran smitted to p53 by multiple posttranslational modifications that allow for the activation and stabilization of p53. Posttranslational modifications are covalent a dditions of functional groups to p53, such as, ubiquitination, phosphorylation, acetylati on, and sumoylation (Appella and Anderson 2001). P53 phosphorylation is pivotal for its activation after DNA damage. Phosphorylation of p53 generally results in its stabilization. So far there are 18 serine

PAGE 22

10 and threonine sites that are reported to be phosphorylated on p53 (Bode and Dong 2004). Of particular importance are the phosphorylations of serine 15 and serine 20, which leads to the dissociation of MDM2 from p53 (Avant aggiati, Ogryzko et al. 1997; Shieh, Ikeda et al. 1997; Lambert, Kashanchi et al. 1998; Dumaz and Meek 1999; Zhang and Xiong 2001). MDM2 can also be phosphorylated on serine 395, promoting the disassociation from p53 (Mayo, Turchi et al. 1997). In addition, several lysines residues located in the C-terminal region have been identified as acetylation sites on p53. The role of acetylation is believed to enhance the affinity to the p53 responsive element, increase protein activ ity and promote an apoptotic response (Luo, Su et al. 2000; Rodriguez, Dest erro et al. 2000; Ito, Lai et al. 2001). Phosphorylation of the N-terminus has been im plicated in facilitati ng the acetylation of p53 and enhancing the recruitment of transcri ptional co-activators such as CBP/p300 and PCAF (Avantaggiati, Ogryzko et al. 1997; Gu, Shi et al. 1997; Lill, Grossman et al. 1997; Dumaz and Meek 1999) Posttranslationa l modifications such as sumoylation and neddylation can also be stimul ated by MDM2. Interestingly, these modifications have very different effects on p53 activity. It has been s hown that p53 sumoylation can enhance its transcriptional activity, while p53 neddylation leads to the transcriptional inhibition of p53 activity (Mel chior and Hengst 2002; Harper 2004; Xirodimas, Saville et al. 2004). MDM2 can also render p53 more susceptible to degrad ation by interfering with CBP/P300 acetylation of p53 (Kobet, Ze ng et al. 2000; Ito, Lai et al. 2001). P53 stability and activity can al so be regulated by a variet y of interacting proteins.

PAGE 23

11 The short half-life of p53 is primarily maintained by the in teraction with MDM2, an E3 ubiquitin ligase. However, other proteins can mediate the ubiquitination and degradation of p53 including Pirh2 and COP1. Both th ese genes, like MDM 2, are p53 inducible genes, thus creating a negativ e feedback loop (Leng, Lin et al. 2003; Dornan, Wertz et al. 2004). Pirh2 interacts with p53 and promotes its ubiquitination independent of MDM2 (Leng, Lin et al. 2003). Cop1 also ca n increase p53 turnover by promoting its degradation through the proteasome (Dornan, We rtz et al. 2004). Because MDM2 is involved in so many of the autoregulatory loops that regulate p53 functio n, it is likely that it plays a central role in regulating p53 activity. MDMX, a homolog of MDM2 has recently been implicated in the negative regulation of p53. Unlike its relative, MDMX does not have any intrinsic E3 ligase activity and thus does not prom ote the ubiquitination or degr adation of p53 (Jackson and Berberich 2000; Stad, Ramos et al. 2000; Stad, L ittle et al. 2001; Migliorini, Danovi et al. 2002). Instead, MDMX can bind to the trans activation domain of p53, thereby inhibiting its transcriptional activation (Finch, Donovi el et al. 2002). The inhibition of p53 by MDMX is mainly mediated through the interfer ence of co-activator bindings and transcriptional machinery. MDM2 and MDMX can also interact with each other forming heterodimers in the RING domains. This interaction was shown to protect p53 from MDM2-mediated degradation (Jackson and Be rberich 2000). This appears to be achieved by MDMX preventing nuc lear export of p53 (Stad et al. 2001). Our laboratory identified a link between MDMX downregulat ion and p53 activation following ribosomal

PAGE 24

12 stress. Studies showed that tumor cells expressing high levels of endogenous MDMX had less efficient p53 activation and growth ar rest during ribosomal stress and were less sensitive to agents that induce ribosomal stress. Interestingl y, down regulation of MDMX by siRNA knockdown enhanced p53 resp onse to ribosomal stress by promoting the ubiquitination of MDMX, mediated by MD M2 and L11 binding (Gilkes, Chen et al. 2006). Furthermore, they suggested that MDMX inhibits the DNA binding activity of p53 and possibly the recruitment of basal tr anscription factors to the promoter. The Alternate Reading Frame tumor s uppressor or ARF is another interacting protein that can positively re gulate p53 stability. ARF was identified as an alternative transcript of the INK4a/ARF locus. The other transcript is the p16 INK4a, a checkpoint gene that inhibits cyclin-dependent kina se 4 (Hatakeyama and Weinberg 1995; Sherr 2001). ARF is completely unrelated to p16, by virtue of unique first exons, generating transcripts translated by a lternative reading frames (Duro, Bernard et al. 1995). Hereditary human cancers commonly contain al terations to both p16 and ARF (Sharpless 2005). Mitogenic signals such as: E1A, E2F, myc, ras and v-abl induce the expression of ARF (Kamijo, Weber et al. 1998; Pomerantz, Schreiber-Agus et al. 1998; Stott, Bates et al. 1998; Zhang, Xiong et al. 1998). The induction of ARF can st abilize p53 by virtue of ARF’s nucleolar localization signal within the C-terminus (Kamijo, Weber et al. 1998; Pomerantz, Schreiber-Agus et al. 1998; Stott, Bates et al. 1998; Zhang, Xiong et al. 1998). By separating MDM2 from p53, ARF can stabilize p53, however recent findings indicate that the activation of p53 is a result of nucleol ar disruption, instead of ARF

PAGE 25

13 physically sequestering MDM2 in the nucleol us (Korgaonkar, Hagen et al. 2005). ARF has also been shown to stabilize MDM2 self E3 ligase activity (Weber, Taylor et al. 1999; Zhang and Xiong 1999; Ito, Lai et al. 2001). Interestingly, other components of the nuc leolus have been shown to affect p53 activity, including ribosomal proteins L5, L 11, L23 (Lohrum, Ludwig et al. 2003; Zhang, Wolf et al. 2003; Bhat, Itahan a et al. 2004; Dai and Lu 2004; Dai, Zeng et al. 2004; Jin, Itahana et al. 2004; Dai, Shi et al. 2006). Th ese proteins are releas ed from the nucleolus after ribosomal stress and have been shown to stabilize p53 by nega tively regulating both MDM2 and MDMX. The L-proteins can bind the acidic domain of MD M2 to inhibit the E3 ligase activity towards p53 (Dai, Shi et al. 2006). The inhibition of MDM2’s repression of p53 can induce target gene expres sion and a cell cycle arrest (Bhat, Itahana et al. 2004). It has been s uggested that the mechanism of p53 protection by L-proteins is the interference with the tran sfer of ubiquitin from the E2 to p53 (Zhang, Wolf et al. 2003). Nucleophosmin/B23 has been shown to activate p53 when overexpressed and can affect p53 stability by interacting with ARF (Colombo, Marine et al. 2002; Korgaonkar, Hagen et al. 2005). Preventing degradation or reducing the interaction with MDM2 are ways to stabilize p53; however, removing the ubiquitin mo ieties from p53 is another mechanism. The interaction between HAUSP (herpesvirus protein associated cellular) and p53 add another level of regulation. HAUSP has been shown to bind the C-terminus of p53 and deubiquitinate, thus stabilizing p53. The in fection of HAUSP into p53 positive cells,

PAGE 26

14 indicated a stabilization of p53, measured by p2 1 induction and a G1 arrest (Li, Chen et al. 2002). Interestingly, HAUSP can indir ectly affect p53 stab ility and activity by associating and deubiquitinating MDM2 (Li, Brooks et al. 2004). In addition, loss of HAUSP resulted in a destabilizatio n of MDM2 that lead to an increase in p53 levels and p53 dependent G1 arrest (Cummins and Voge lstein 2004). Understanding how HAUSP balances these two proteins in response to cellular stresses are currently being investigated. Sub-cellular localization is another im portant mechanism in regulating p53. Compartmentalization provides an opportunity fo r regulation and in eu karyotes is tightly controlled. Macromolecules can move b ack and forth between the nucleus and cytoplasm through structures ca lled nuclear pore complexes (NPC’s) (Lyman and Gerace 2001). Cargo proteins that are destined to be importe d, carry nuclear localization sequences whereas a nuclear export sequence (N ES) is used for export. These sequences are recognized by carriers: karyopherins and also referred to as: importins, exportins or transportins. During the process of nuclear import, car rier proteins bind to cargo proteins in the cytoplasm. These comple xes are than transported through the nuclear pore complex where they are dissociated by Ra n-GTP (Stewart 2003). As a transcription factor, p53 must be in the nucleus to res pond to stress signals and perform its normal functions in growth inhibition and apoptos is (Tan, Wallis et al. 1986; Yew and Berk 1992; Ueda, Ullrich et al. 1995). Regulation of p53 localization occurs on two levels by direct modifications to the NLS or NES sites on p53 or the interacti on with other protein that could limit or interfere with NLS or NES accessibility.

PAGE 27

15 The NLS and NES of p53 can be modified by posttranslational modifications. Although not clear, phosphorylation is thought to play an important role in regulating p53 sub-cellular localization. It has been reported that insu lin-like growth factor I can induce elevated levels of phosphorylation of p53 resul ting in elevated cyt oplasmic levels of p53 in MCF-7 human breast cancer cells (Takahas hi, Sumimoto et al. 1993). In addition, ATM phosphorylation of serine 15 can regulat e cellular localizati on by inhibiting MDM2 binding with p53 (Liang and Clarke 2001). Furthermore, MDM2 regulates p53 localization in two ways. First, MDM2 medi ates the nuclear expor t and degradation of p53, by shuttling it into the cytoplasm (Roth, Dobbelstein et al. 1998; Tao and Levine 1999). Alternatively, MDM2 can ubiquitinate p53 in the nucleus by unmasking p53 NES (Inoue, Wu et al. 2005) Studies have indicated that knoc kdown of MDM2 or inhibition by p19 (ARF) tumor suppressor results in nucl ear import and retention. Then again, it has been reported that the nuclear expor t of p53 is an MDM2 independent event (Stommel, Marchenko et al. 1999).

PAGE 28

16 Figure 3: Regulation of p53 Activation of p53 in response to DNA damage It appears that one of the most im portant functions of p53 in suppressing tumorigenesis is the ability to respond to da mage DNA. By initiati ng cell cycle arrest or apoptosis, p53 prevents the propagation of cells that may have acqui red cancer promoting mutations or an altered genome. Ionizing ra diation (IR), ultraviolet radiation (UV) and chemical carcinogens cause different types of DNA lesions. One of the more potent damages inflicted on the genome is DNA double stranded breaks, induced by IR. Cells possess a complex set of signaling pathwa ys for recognizing DNA damage. Several kinases have been identified that detect ge notoxic stress and initiate signaling to p53. The ATM gene is one of the main sensors of DNA damage. ATM belongs to a conserved family of proteins, PI3 kinase like protein kinases (PIKK), an d is also one of the main

PAGE 29

17 kinases that target p53. ATM deficiency leads to the autosomal recessive genetic disorder called Ataxia telangeictasia in huma ns. This genetic disorder is featured by immunodeficiency, radiation sensitivity, neurodegneration and cancer predisposition (Crawford 1998; Becker-Catania and Gatti 2001). Most of the PIKK family proteins possess serine/threonine kinase activity. Phosphorylation is an important mechanism for the activation of p53 in response to DNA dama ge. ATM/A-T related (ATR) kinase plays a fundamental role as the first activator of the DNA damage response, through the phosphorylation of a variety of target proteins with the consensus sequence characterized by serine or threonine residue followed by glutamic acid (Banin, Moyal et al. 1998; Canman, Lim et al. 1998). Furthermore, ATM can phosphorylate p53 directly on serine 15 and concomitantly mediates additiona l phosphorylation and posttranscriptional modification that enhance p53 stability and tran scriptional activity (Banin, Moyal et al. 1998; Canman, Lim et al. 1998; Khanna, Kea ting et al. 1998; Meek 2004). In addition, ATM also phosphorylates Chk1 and Chk2, checkpoi nt kinases needed to propagate the damage signal. While ATM and Chk2 activat e p53 in response to ionizing radiation, ATR and Chk1 appear to be required for re sponse to ultraviolet radiation (Chehab, Malikzay et al. 1999; Hirao, Kong et al 2000). The phosphorylation of Chk2 on threonine 68 by ATM facilita tes the dimerization of Chk2 homodimers (Ahn, Schwarz et al. 2000). Both Chk1 and Chk2 have been repo rted to phosphorylate p53 on Serine 37 or 20, respectively (Bartek, Falc k et al. 2001; McGowan 2002). Chk2 is an important regulator of both the stability and activation of p53 in cel ls exposed to IR and also functions as a tumor suppressor (Hirao, Ch eung et al. 2002). P53 phosphorylation of

PAGE 30

18 serine 15 and 20 promotes its stabilization and activation, through the disruption of its interaction with MDM2 and transcriptional act ivation of target genes important for cell cycle arrest and apoptosis. The prec ise mechanism by which Chk2 regulates p53 apoptosis remains unclear. Chk2 deficient mi ce are viable, fertile and do not show a tumor prone phenotype, except when exposed to IR (Hirao, Kong et al. 2000; Takai, Naka et al. 2002). The phenotype of thes e mice included increased resistance to IR, cellular defects in p53 function and ch eckpoint responses, and apoptosis. Furthermore, ATM can directly target phosphorylation of MDM2 on serine 395, enhancing its self-ubiquitin ation and degradation (Stomm el and Wahl 2005). Other newly identified PIKK family proteins such as ATX can carry out similar functions in phosphorylating p53, however mechanisms re main elusive (Kastan and Lim 2000; Abraham 2001; Hammond, Denko et al. 2002; Heffernan, Simpson et al. 2002; Shiloh 2003). ATX can collaborate with both ATM and ATR in response to other genotoxic stress such as hypoxia. Thus, the DNAdamage response of p53 is crucial for homeostasis and for avoiding neoplas ia generated from DNA lesions. Targeting p53 in the clinics The current treatment for cancer include s radiation therapy and a variety of chemotherapeutic reagents, which all carry numer ous physical and emotional side effects. Radiation therapy is considered the most eff ective form of cancer treatment for a variety

PAGE 31

19 of malignant tumors of all st ages. However, the limitation of this treatment is the nonselectivity of action between normal and tumo r cells. P53 is mutated in about 50% of human tumors or its functionality compromised by means of loss of positive regulators or overexpression of negative regulators. Current research has focused on three approaches to treat these types of cancers. The first a pproach would be to se lectively target cancer cells that possess the mutated form of p53, from those that are normal. Using a genetic engineering approach, research ers have designed retroviral and adenoviruses that are modified to selectively replicate in cells deficient for p53 (Bischoff, Kirn et al. 1996; Roth 1996; Roth, Konig et al. 1998). For exam ple, an adenovirus that encodes E1b can only replicate in mammalian cells by inactivat ing p53, however engineering a virus with this exact defect could select ively target cells with missens e mutations or allelic loss of p53. The hypothesis is that the introduction of this virus into cells w ould have no effect on normal cells, but tumor cells with mutant p53 are kille d by the productive lytic infection. Preliminary research in mice using the virus ONYX-015, showed promising results; however, preclinical tr ials have been less effective (Heise, Sampson-Johannes et al. 1997). Better results were obtained when the virus was combined with conventional chemotherapy (Yang, You et al. 2001). Alt hough promising, the use of viruses in the treatment of cancer is very preliminary and requires further testing for improvement. Another approach to restoring the normal function to mutant p53 is identifying pharmacological agents. PRIMA-1 a chemical reagent was designed to eliminate p53 mutant bearing cells. This compound wa s shown to induce cytotoxic effects and apoptosis in human tumor cells bearing muta nt p53. The selective nature of this

PAGE 32

20 compound provided an excellent proof of c oncept for targeting mutant cells and providing a strong anti-tumor re sponse and no apparent toxi city. Researchers found an increase in serine 15 phosphor ylation of p53 and well as restored DNA binding activity to pro-apoptotic promoters such as BAX a nd PUMA (Bykov, Issaeva et al. 2002; Chipuk, Maurer et al. 2003; Wa ng, Lee et al. 2007). The second approach would be to rescue the functionality of wild-type p53 that was been compromised by the loss or overexpre ssion of key regulators. The negative effect of MDM2 inflicted on p53 is not without control. As the inhibition of MDM2 will favor p53 function, MDM2 inhibi tor might possess tumor suppressor characteristics. Extensive work has been put into developing drugs towards selective targets that affect the function of p53. High throughput scre ening identified Nutlins, which are cisimidazoline analogs that inhibit p53-MDM2 bi nding with a low IC50 (Bottger, Bottger et al. 1996). Nutlin 3 showed the ability to act ivate p53 in cell cultu re and inhibit tumor growth in vivo, by inhibiting it s association of MDM2 with wild-type p53 and promoting self-ubiquitination of MDM2 with a low IC 50 in the 100-300nM range (Vassilev 2004; Vassilev, Vu et al. 2004; Vassilev 2005). This treatment would be ideal in cancers, such as sarcomas that overexpress MDM2, but reta in wild-type p53, howev er no clinical trial data is available as of yet. A limitation of using this drug would be in targeting tumor cells overexpressing MDMX, another key nega tive regulator of p53. We found that although MDMX and MDM2 are homologous a nd bind to the same region on p53, Nutlin

PAGE 33

21 does not disrupt MDMX-p53 interaction (Hu, Gilk es et al. 2006). This finding supports the need for developing small molecule in hibitors that are specific for MDMX. RITA is another compound identified to inhibit the p53-MD M2 interaction; however its mechanism of action is quite differe nt from that of Nutlins. RITA binds the N-terminus of p53 and leads to accumulati on of transcriptiona lly active p53. One advantage of this compound is its ability to activate the apoptosis inducing functions of p53 (Baker, Markowitz et al. 1990; D'Or azi, Marchetti et al. 2000) The third approach is in its infancy st ages; however the concept may lead to new chemotherapeutic agents. Lai et al. iden tified compounds that inhibit the E3 ligase activity of MDM2 (Lai, Yang et al. 2002). These compounds are selective for MDM2 and show no off target effects on other E3 ’s. Interestingly, these compounds can differentiate between MDM2 ubiquitination of p53 and self-ubiquitination with a low IC50. Another group has also identified sim ilar compounds that targ et MDM2 activity. These compounds indicate good cellular perm eability, however they show some p53independent cellular toxicity (Y ang, Ludwig et al. 2005).

PAGE 34

22 MDM2 MDM2 history : MDM2 or Murine Double Minute Clone 2 was first discovered through its amplification on murine double-minute chro mosomes (Cahilly-Snyder, Yang-Feng et al. 1987). These abnormal chromosomes called do uble minute frequently harbor amplified genes, leading to uncontrolled cell proliferation and tumori genesis (Fakharzadeh, Trusko et al. 1991). Mice bearing an amplification of MDM2 deve loped a high risk of tumor formation. Later, MDM2 was co-purified w ith p53 and found to negatively regulate p53 stability and transcriptional activity (Momand, Zambetti et al. 1992). This gave the first indication that MDM2 was an onc ogene due to its negative re gulation of p53. It was later found that overexpression of MDM2 can immortalize primary cultures of rodent fibroblast (Finlay 1993). In humans, over 30-40% of sarcomas and leukemic cells overexpress MDM2 (Oliner, Kinzler et al. 1992; Bueso-Ramos, Yang et al. 1993). These findings all implicated MDM2 as a typical proto-oncogene. MDM2 structure: Full length human MDM2 is composed of 491 amino acids (Oliner, Kinzler et al. 1992). MDM2 belongs to a family of RI NG finger E3 ubiquitin lig ases that promote the ubiquitination of itself a nd other substrate proteins ( Figure 4 ). MDM2 contains three major conserved regions, including the N-term inal composed of 90 amino acids in length (Region I). The second region is the central a nd highly acidic domain (Region II). Also

PAGE 35

23 present in the last domain is the nuclear lo calization and export se quences (Fakharzadeh, Trusko et al. 1991; Boddy, Freemont et al. 1994) Region I has been closely mapped due the finding that this region mediates the bi nding to p53. In the human protein amino acids 19-102 were the amino acids that interact ed with p53 in vitro (Chen, Marechal et al. 1993; Oliner, Pietenpol et al. 1993) It was later revealed by using a synthetic peptide of Xenopus laevis that MDM2 bound to the 15-resi due transactivation do main of p53. In addition, it was reported that the central acidic region of MDM2 has a second p53binding domain that is regulated by phosphoryl ation (Kulikov, Winter et al. 2006). The central acidic domain is also essential fo r MDM2 interaction with ARF, L11 and p300 (Kulikov, Winter et al. 2006). MDM2 cont ains a hydrophobic cleft which p53 binds as an amphipathic alpha helix (Kussie, Gorina et al. 1996). The amino acid contacts essential for p53 binding to the MDM2 clef t includes: phenylalan ine 19, tryptophan 23 and lysine 26 (Lin, Chen et al. 1994). Re gion III or the RING finger domain features a consensus motif characterized by CX2CX(9-39)CX(1-3)HX(2-3)C/HX2CX(4-48)CX2C. Figure 4: Structure of MDM2

PAGE 36

24 MDM2 functions The co-purification of MDM2 and p53 began the task of understanding its biological significance. Initia l studies were performed in cells containing wildtype p53 and identified the transforming capacity of MD M2; while other studies later revealed that the oncogenic properties of MDM2 could be at tributed to inhibiti on of p53’s growth suppression properties (Fakharzadeh, Trus ko et al. 1991; Finlay 1993). After the discovery that MDM2 could i nhibit p53 function, future stud ies identified one third of human sarcomas retained wildtype p53, but harbor MDM2 amplifications (Oliner, Kinzler et al. 1992). The observations that the MDM2 gene is a transcri ptional target of p53 and MDM2 is a negative regulator of p53 transcription, led to the proposed model of the p53MDM2 auto-regulatory feedback loop (Momand, Zambetti et al. 1992; Barak, Juven et al. 1993; Wu, Bayle et al. 1993) The hypothesis was that in orde r for cell cycle to progress, p53 must be inhibited by the activation MDM2. In support of these results, was the observation that the lethalit y of MDM2 null mice could be rescued by the simultaneous knockout of p53 alleles (Jones, Roe et al. 1995; Montes de Oca Luna, Wagner et al. 1995). The ability of the cell to regulate and maintain p53 at low levels is crucial for its survival. MDM2 acts as the major negativ e regulator of p53 by binding to the protein, masking its transactivation domain and keeping it functionally inactive (Momand, Zambetti et al. 1992). Biochemically, MDM2 functions as an E3 ligase that can ubiquitinate p53 on several lysine residues, in addition to its elf (Fang, Jensen et al. 2000; Honda and Yasuda 2000; Nakamura, Roth et al 2000; Rodriguez, Desterro et al. 2000).

PAGE 37

25 MDM2 can transcriptionally inactivate p53 si mply by binding to its transactivation domain and blocking the recruitment of co activators or transcriptional machinery. MDM2 promotes p53 turnover through the ubiquitin proteasome system (Jackson and Berberich 2000). The extent of ubiquitination ca n also determine the fate of the protein. Polyubiquitination is believed to promote degradation while mono-ubiquitination of p53 assist in the nuclear export (Yang and Yu 2003). Furthermore, MDM2 can shuttle p53 from the cytoplasm to the nucleus thereby re gulating its localization and its function as a transcription factor (Freedman and Levi ne 1998; Roth, Dobbels tein et al. 1998). As mentioned previously, MDM2 can promote the degradation and nuclear export of p53, thereby reducing the induction of target genes including p21, Bax and Gadd45 necessary for proper growth arrest and apoptosis. Alternatively, MDM2 has been reported to also have p53 independent functions. MDM2 affects the cell cycle regulation by inhibiting th e interaction with other key cell cycle proteins. Martin et al. identified that the N-terminus of MDM2 can stimulate the transactivation of reporter genes for E2F1/DP1 (Martin, Trouche et al. 1995). In addition, MDM2 can modulate the activity of Rb by forming a complex and pert urbing Rb-mediated G1 arrest (Xiao, Chen et al. 1995). Cancers with mutant p53, as well as MDM2 amplificati ons, show a poorer prognosis compared to cancers possessing a single mutation or amplification (CordonCardo, Latres et al. 1994). In the absence of p53, mice ove rexpressing MDM2 are predisposed to developing spontaneous tumors (Jones, Hancock et al. 1998). Although limited, additional studies suggest that MDM2 also plays role s in cell cycle control, DNA

PAGE 38

26 repair, DNA repair and differentiation, in the absence of p53. M DM2 mouse models The physiological importance of MDM2 as the major negative regulator of p53 was also revealed in mouse models. Homozygous knockouts of MDM2 resulted in embryonic lethality at day 3.5, due to the massive apoptosis induced by p53, supporting MDM2 as a major p53 negative regulator (Jones, Roe et al 1995). Furthermore, the embryonic lethality of MDM2 null mice can be rescued by crossing into p53 null background, indicating the major role of MDM2 is to negate p53 functionality. This in vivo model illustrated the importance of mainta ining p53 level under tight control. In order to elucidate the extent of MDM2 levels in regulating p53 in normal tissues; conditional knockout mice were generated. Th ese mice were engineered using the CreLox recombination mechanism ,by inserting two loxP flanking sites into the coding regions of exons 7-9, and a puromycin resi stance cassette in the non-coding region of MDM2 They crossed these mice to p53 wild -type mice to generate animals with one wild-type allele and one null allele of MDM2 (hypomorphic allele), thus avoiding the embryonic lethality of a complete MDM2 knockout (Mendrysa, O'Leary et al. 2006). Unexpectedly, these mice had dampened levels of the wild-type MDM2 allele due to the introduction of the puro-cassette in the non-coding region of MDM2. These mice had reduced body size, deficiencies in B-cell de velopment and lymphoid lineage cells, due to

PAGE 39

27 increase in p53 dependent apoptosis. In addition, all tissues sh owed increase in p53 transcription, however this increase did not overlap with nuclear accumulation or phosphorylation on serine 18. As expected, th ese mice were hypersensitive to ionizing radiation. An alternative approach to studying th e functions of MDM2 regulation of p53 was to generate mice overexpressing MDM2 Lundgren et al, generated animals that overexpressed MDM2 in the mammary epithe lium. These mice were prone to tumor formation and increased hypertrophy, although at a low penetrance (Lundgren, Montes de Oca Luna et al. 1997). Expression of extra copies of MDM2 by an endogenous promoter, supported the findings by Lundgren et al. They observed that higher levels of MDM2 reduced the anti-tumorsuppressor func tions of p53 (Jones, Hancock et al. 1998).

PAGE 40

28 MDMX MDMX history In 1996, Shvarts et al. set out to identify new p53 inte racting proteins. Using a 16-day-old mouse embryo cDNA expression libra ry, they isolated a p53 binding protein that shared homology at the DNA and protein level with MDM2. The protein was named MDMX, due to this structural similarity to MDM2. The human ortholog was identified a year later and termed HDMX (Shvarts, Bazuine et al. 1997). Both the mouse and human ortholog interacted and inhibite d p53 transcriptional activatio n (Shvarts, Steegenga et al. 1996). MDMX structure MDMX and MDM2 share si gnificant homology in seve ral functional domains, such as p53 binding domain, Zn finger a nd the RING domain. While MDM2 is 491 amino acids long, MDMX is 490 amino acids in length. The p53 binding region which compromises amino acids 42-94 share 53.6% homology with MDM2. Due to the conservation of the p53-binding domain, MDMX was found to bind the N-terminus of p53 and inhibit its transactivation (Jackson and Berberich 2000; Stad, Little et al. 2001). The Zinc finger region spans amino acids 301329, however the function of this domain remains unclear. Recent results indicate that this region is needed for the interaction of CKI-alpha and MDMX (Chen, Li et al. 2005). The RING domain located between amino acids 444-483 shares 53.2% homology w ith MDM2. This region allows for

PAGE 41

29 heterodimerization of MDM2 and MDMX (Tan imura, Ohtsuka et al. 1999). The RING finger domain of MDM2 is essential for its E3 ligase function, however MDMX does not possess any intrinsic E3 ligase activity (Momand, Zambetti et al. 1992; Jackson, Lindstrom et al. 2001; Migliori ni, Danovi et al. 2002; Linare s, Hengstermann et al. 2003) ( Figure 5 ). The protein homology of MDM2 a nd MDMX can be explained by the conservation of exons 4-12 (Parant, Chavez-Reye s et al. 2001). A lternatively, there is little sequence homology in the central re gion of MDMX compared to MDM2, although both regions are highly acidic. This region of MDM2 is required for the interaction with ARF and L-proteins, however the differences in homology could expl ain the inability of MDMX to interact with ARF (Jackson, Lindstr om et al. 2001; Wang, Arooz et al. 2001). MDM2 is transcriptionally activated by p53 due to the pr esence of two p53-responsive elements in its promoter located in exon 1 (Wu and Yan 2003). Conversely, MDMX does not contain a p53 responsive element on its promoter, and is not transcriptional activated by p53. As noted in Figure 5 other discrepancies between MDM2 and MDMX include the presence of a NLS and NES in MDMX. However data in this manuscript reveals the presence of a cryptic NLS in MDMX that is only functional after DNA damage induced phosphorylation and 14-3-3 binding.

PAGE 42

30 Figure 5: Structure homo logy of MDMX and MDM2 MDMX mouse models The similarities in structure between MDMX and MDM2 suggested that MDMX was also a negative regulator of p53. Loss of function mouse models supported this hypothesis. MDMX mutant mice lacking the p53-binding domain were generated using homologous recombination in stem cells. MDMX knockout mice result in embryo lethality at embryonic day 7.5 due to severe proliferation de ficiency, in contrast of massive apoptosis as in the case of MDM2 knockout mice (Parant, Chavez-Reyes et al. 2001). The functional relationship betw een MDM2 and MDMX null mice was demonstrated by the rescue of embryonic lethality by nullifying P53 simultaneously (Parant, Chavez-Reyes et al. 2001; Finch, Donovi el et al. 2002; Migl iorini, Danovi et al. 2002). Furthermore the loss of MDMX could not be compensated by MDM2, arguing in

PAGE 43

31 favor for non-redundant roles for ea ch protein in regulating p53. Regulation of MDMX Human tumor cell lines with wild-typ e p53 often overexpress MDMX, suggesting that MDMX may contribute to the p53 inactiv ation during tumorgenesis (Ramos, Stad et al. 2001). Understanding the re gulation of MDMX expression is equally as important in ensuring a proper p53 response. In the pres ence of DNA damage, th ere are vital steps needed for the activation of p53. These include inhibition of MDM2 mediated degradation of p53, MDM2 –MDMX binding a nd activation of ke y posttranslational modifications. Although MDMX alone does not promote p53 ubiquitination or degradation (Stad, Little et al. 2001), recent evidence showed that MDMX cooperates with MDM2 to promote p53 degrada tion (Gu, Kawai et al. 2002). Many in-vivo and invitro studies elucidated the func tional role of MDMX in th e inactivation of p53, however only recently has insight into the mechanism of MDMX regulation be en explored. The instability of MDM2 is due to its self-ubiquitination, unlike th at of the enhanced protein stability of MDMX, which lack s E3 ligase functions. The di fferences in stability also appear to be regulated not onl y at the protein level but also through the interaction with MDM2. The heterodimerization of MDMX-MDM 2 is mediated through the C-terminal Zn and RING finger domains (Tanimura, Ohtsuka et al. 1999). The interaction of these two proteins was shown to stabilize th e E3 ligase function of MDM2 towards p53, although the other studies indicate d that the ratios of the tw o proteins determine whether

PAGE 44

32 p53 is more efficiently ubiquitinated or st abilized (Sharp, Krat owicz et al. 1999; Gu, Kawai et al. 2002; Linares, He ngstermann et al. 2003). Early studies found that MDMX is constitutively expressed at both the mRNA and protein le vels during cell proliferation, differentiation and stress (Jackson and Berberic h 1999). Key to elucidating the role of MDMX is understanding its regulation af ter DNA damage. Unlike MDM2, which is mainly nuclear, but also shuttles from the cy toplasm, MDMX is localized primarily in the cytoplasm, depending on the cell type (Rallapa lli et al. 1999; Migliori ni et al. 2002). The ability of MDMX to inhib it p53 is regulated by MDM2 me diated nuclear import and MDM2 independent mechanisms, demons trated by the overexpression of MDM2 promoting MDMX nuclear entry and by p53 null/MDM2 null mouse embryo fibroblast translocation to the nucleus after DNA da mage (Rallapalli, Strachan et al. 1999; Migliorini, Danovi et al. 2002). Similar to MDM2 effects on p53, MDMX is also ubiquitinated and degraded by MDM2, however the main difference is that MDMX degradation is stimulated unde r cellular stress conditions such as DNA damage or by the overexpression of ARF (de Graaf, Little et al 2003; Kawai, Wiederschain et al. 2003; Pan and Chen 2003). The destabilization of both MDMX and MDM2 are required for a proper p53 response to DNA damage and aberra nt mitogenic signaling. Recent evidence from our laboratory and others indicates the importance of MDMX phosphorylation for efficient degradation in res ponse to DNA damage. Evidence indicated that degradation of MDMX requires ATM dependent phosphoryl ation on serine 342 and serine 367 by Chk2 and serine 403 by ATM, following DNA damage (Chen, Gilkes et al. 2005; Okamoto, Kashima et al. 2005; Pereg, Shkedy et al. 2005). Another report observed that

PAGE 45

33 ultraviolet treatment results in Chk1-mediated phosphorylation of serine 367 (Jin, Dai et al. 2006). Phosphorylation of MDMX enha nced the binding and ubiquitination by MDM2 (Chen, Gilkes et al. 2005). More importantly was the role of Chk2 phosphorylation in MDMX degradation, as demonstrated by HCT116-Chk2 -/cells having an impaired DNA damage induced phos phorylation and degradation of MDMX after ionizing radiation as compared to HC T116-Chk2 wild-type cells (Chen, Gilkes et al. 2005). To further elucidate th is mechanism, the findings in this manuscript provide another mechanism for the enhanced degrad ation of MDMX. We and others provide evidence that the phosphoryl ation of MDMX on serine 367 after ionizing radiation creates a 14-3-3 binding site (Okamoto, Kash ima et al. 2005; LeBron, Chen et al. 2006). 14-3-3 binding stimulated the nuclear im port of MDMX by exposing a cryptic NLS region and subsequent degradation of phosphorylated MDMX. However the exact mechanism on how 14-3-3 promotes MDMX degr adation is not clear. Additionally, it was reported that HAUSP can bind and deubiquitinate MDMX, thus counteracting MDM2 mediated degradation (Meulmeester, Pe reg et al. 2005). Interestingly, recent reports by Pereg et al suggest the displacement of HA USP from MDMX by 14-3-3, as a possible mechanism for MDMX destabilizat ion after DNA damage (Pereg, Lam et al. 2006). Mitogenic stimulation can also regu late MDMX protein levels, however phosphorylation does not appear to be i nvolved. Studies indicated that MDMX degradation was induced by ARF overexpre ssion. ARF binding to MDM2 selectively blocked p53 ubiquitination, while enhanci ng MDMX ubiquitination (Pan and Chen

PAGE 46

34 2003). P53 response to ribosomal st ress is another important f actor in tumor suppression. A recent connection between ribosomal stre ss and p53-dependent cell cycle arrest was suggested due to aberrant rRNA being sensed by p53 (Marechal, Elenbaas et al. 1994; Lohrum, Ludwig et al. 2003; Zhang, Wolf et al. 2003). Gilkes et al. 2006 determined the effect on MDMX stability after the addition of Acti nomycin D (5nM) to induce ribosomal stress. They found that HCT116 p53+/+, HCT116 p53-/and U2OS cells treated for 8-20 hours with Act.D, resulted in induction of p21 and MDM2. In contrast, MDMX levels decrease, due to an increase in L11 stimulating MDMX ubiquitination by MDM2. MDMX expression in tumors Disruption of the p53 pathway has been we ll established in human cancers. Over 50% of human cancers have mutations to th e p53 locus and the other 50% of tumors, which retain wild-type p53, have disruptions in p53 regulating protei ns. Several studies implicate MDMX functions as oncogenic a nd implicate it in tumor formation. HDMX localizes on chromosome 1q32, which happens to be frequently aberrant in cervical and ovarian carcinomas (Danovi, Meulmeester et al. 2004). Human gliomas and more recently 65% of retinoblastomas show amplification of HDMX (Danovi, Meulmeester et al. 2004; Laurie, Donovan et al. 2006). In all cases, HDMX amplif ications correlated with wild-type p53 and few HDM2 amplifica tions. In addition, MDMX overexpression can block oncogenic ras-induced premature se nescence, allowing formation of tumors in

PAGE 47

35 nude mice (Danovi, Meulmeester et al. 2004; Laurie, Donovan et al. 2006). MDMX overexpression provides a mechanism in which, the mutation of p53 is not necessary to promote tumorgenesis. MDMX-MDM2-P53 circuit There are several lines of published evidence supporting the importance of maintaining the p53-MDM2-p53 interacti on, most notably, the mouse models experiments supporting MDMX as another majo r negative regulator of p53 function in vivo (Parant, Chavez-Reyes et al. 2001; Mi gliorini, Danovi et al. 2002; Chavez-Reyes, Parant et al. 2003). The role of MDMX in control of p53 and MDM2 stability remains unclear, however the negative e ffect of MDMX on p53 transcrip tion is becoming clearer. The negative feedback loop between p53 and MDM2 has been well established. p53 transcriptionally activates MDM2, which negatively regulates p53 by inhibiting its transactivation and destabilizing p53 by media ting its proteasome degradation (Barak, Juven et al. 1993; Wu, Bayle et al. 1993; Barak, Gottlieb et al. 1994). Moreover, it is well recognized that MDMX can also bind to th e N-terminus transac tivation domain of p53, thus inhibiting p53 transcriptional function (Shvarts, Steegenga et al. 1996; Bottger, Bottger et al. 1999; Stad, Ramos et al. 2000; Ramos, Stad et al. 2001). We now know that MDMX is another substrate of MDM2 E3 lig ase activity (Kawai, Wiederschain et al. 2003; Pan and Chen 2003). MDMX is polyubiqu itinated by MDM2 and degraded in a proteasome-dependent pathway. Aforementi oned, MDM2 can induce the transcriptional inactivation, ubiquitination and degradation of p53 (Haupt, Maya et al. 1997; Kubbutat,

PAGE 48

36 Jones et al. 1997; Thut, Goodr ich et al. 1997), however MD MX overexpression in cells, does not seem to affect p53 ubiquitination and degradation directly (Jackson and Berberich 2000; Stad, Ramos et al. 2000; Mi gliorini, Danovi et al. 2002). Instead MDMX seems to work along side MDM2 to ma intain the transcrip tional activation and stability of p53. This is evident in ge netic knockout models for both MDMX and MDM2, in which neither protein can compensa te for the other in regulating p53 function. In vivo studies in mice null for MDM2 and MDMX in the central nervous system seem to indicate a more dramatic phenotype then seen with a single mutation (Xiong, Van Pelt et al. 2006). However the situation becomes a little for obscure when conditional inactivation studies were perf ormed. Studies were conducte d in cardiomyocytes and GI tract that indicated that the conditional lo ss of MDM2 showed more apparent phenotypes than that of loss of MDMX alone (Boesten, Zadelaar et al. 2006; Grier, Xiong et al. 2006). The investigators concluded that MD MX is only required for the inhibition of p53, in a subset of cell types and physiological conditions. Another study further complicated the genetic knockout studies. It was found that the overexpression of the MDM2 transgene could compensate for the embryonic lethal phenotype associated with loss of MDMX (Steinman, Hoover et al. 2005), indicating that high le vels of MDM2 can compensate for loss of MDMX. Furthermore, the model for regulation of p53 by both negative inhibitors proposes that in the absence of DNA damage or other st resses, the primary function of MDM2 is to maintain p53 at low levels, whereas the function of MDMX is to contri bute to the overall transcriptional inhibition of p53. Howeve r in the presence of stress, p53 becomes

PAGE 49

37 posttranslationally modified which inhibits th e interaction with MDM2, thus stabilizing the protein. Although MDM2 is a direct transc riptional target of p53, the cell maintains a lag in the induction of MDM2 after DNA dama ge. Another important factor is the interaction of MDM2 with AR F. All these factors allow for a proper and efficient p53 response. On the other hand, MDMX leve ls are very stable under non-stressed conditions, but after DNA damage becomes very unstable. This is in part due to phosphorylation, enhanced degradation of MD MX after DNA damage, and it not being transcriptionally indu ced by p53. Conversely, Gilkes et al. 2006 suggested that after ribosomal stress, the overexpr ession of MDMX could main tain both p53 and MDM2 in inactive complexes. Ubiquitination and deubiquitination process The attachment of ubiquitin and ubiquitin like proteins has emerged as an important mechanism to regulate diverse ce llular and biological processes. These regulatory processes include cell cycle progr ession, signal transduc tion, transcriptional regulation and growth control (Hochstrasser 1996; Pickart 2001). Ubiquitin is a protein composed of 76 amino acids and is activated by an ATP dependent mechanism. The conjugation of ubiquitin requires three different enzymes termed: E1, E2, E3. The first enzyme E1 activates the ubiquitin by activati on of the C-terminus, forming a covalently bound ubiquitin to which the terminal glycine re sidue of ubiquitin is linked to the thiol group of the cysteine residue of the E1 active site. Afterwards the ubiquitin is transferred to the carrier, ubiquitin conjugating enzyme or E2. The E2 enzyme then tags the

PAGE 50

38 ubiquitin to a lysine residue on the substrate protein with the aid of the E3 enzyme or ubiquitin protein. E2 enzymes have the abilit y to interact with multiple E3 enzymes, however the interaction is very specific. Ge nome analysis reveals a small number of E1 encoding genes, while E2 enzymes have 10-fold higher amount of encoding genes. Interestingly, there are over hundreds of E3 encoding ligases (Semple 2003). There are two sets of E3s classified by their distin ct functional domains. The E3 HECT domains contain a highly conserved 350 amino acid re gion in their carboxyl termini. HECT domain E3s form intermediates between E2 and the substrate proteins. The second functional domain is the RING finger contai ning proteins, which we re thought only to mediate protein dimerization. Until recentl y, the crystal structures of RING finger proteins indicated that th e protein structure of RING domain permits the optimal positioning between E2 and the substrate, ensuri ng the transfer of ubiquitin to the target protein. The extent of the number of ubiquitin attachments also dictates the fate of the tagged substrate protein. Chai ns of four or more ubiquiti n(s), also referred to as polyubiquitination, promotes effi cient binding to the 26S pr oteasome and degradation (Pickart 2001). Alternatively attachment of short linked ubiquitin chains to a protein can have a variety of consequences. Take for example p53; monoubiquiti nation can act as a mechanism for nuclear export to limit the potential of this tran scription factor to activate target genes. However, the functional signi ficance of protein m onoubiquitination is still elusive.

PAGE 51

39 The final apparatus that regul ates disposal is the proteas ome. The proteasomes is very abundant that constitutes nearly 1% of cellular proteins. In mammalian cells, proteasomes are primarily in the cytosol, how ever also display associations with the nucleus, endoplasmic reticulum, plasma memb rane and cytoskeletal elements depending on cell type (Wojcik and DeMa rtino 2003). The proteasome c onsist of a central hollow cylinder formed from multiple subunits (20S). These cylinders associate and stack up four heptameric rings. Each end of the cy linder is capped with large protein complexes termed 19S subunit. The 19S subunit contains over six proteins that hydrolyze ATP, and are thought to unfold proteins to be digested (Baumeister, Walz et al. 1998). Protein degradation is an important mechanism in controlling homeostasis and the functional mechanism of these processes has just started to be appreciated. The process of ubiquitination is also revers ible and carried out by a large subset of deubiquitin enzymes (DUBs) or thiol proteas es. The classical deubiquitinating enzymes belong to ubiquitin processing (UBP) a nd ubiquitin carboxy-termin al hydrolazes (UBH) families. UBP enzymes remove polyubiquitina ted proteins whereas UBH remove small adducts of ubiquitins, which creat es free monomeric ubiquitins that can be used later for recycling. The process of deubiquitinati on also has a plethora of functions.

PAGE 52

40 14-3-3 14-3-3 proteins The name 14-3-3 is derived from the combination of its fraction number on a DEAE-cellulose chromatography and it migration position in the starch-gel electrophoresis (Zdrojewski, Dubois et al. 1967). The family consists of highly conserved group of small, acidic proteins that are nearly ubiquitous in one form or another in all cells of every organism. Multip le genes encode different isoforms of 14-33. 14-3-3 proteins were first isolated in brain tissue, however have been isolated and described in all tissues. Th e 14-3-3 protein family have been found to participate in numerous signaling pathways th at regulate cell proliferation and apoptosis, often binding to phosphorylated serine or threonine residue s (Fu, Subramanian et al. 2000; Tzivion, Shen et al. 2001). The family consist of seven genes which each encode a highly conserved isoforms: 14-3-3 proteins are expr essed in all eukaryotic cells and are highly conserved in protein sequence form yeast to mammals, although 143-3 sigma is restricted to epithelial cells (Hermeking 2003). All 14-3-3 proteins form dimers that provide two bindi ng sites for phosphorylation motif s in ligand proteins. They can therefore act as adaptor proteins, bri nging two proteins that would not otherwise associate into close proximity (Hermeking 2003) (Figure 6)

PAGE 53

41 14-3-3 Structure: 14-3-3 proteins exist as monomers that can form homo and heterodimers. Each monomer consists of nine alpha helices orga nized in an anti-paral lel fashion, resembling a U-shape structure. Each monomer contai ns a highly conserved amphipathic groove. The interior of the groove c onsist of four alpha helices : Helix 3and Helix 5 contain charged and polar amino acids, while Helix 7 and Helix 9 are composed of hydrophobic amino acids. In particular, amino acids K49, R59 and R127 of the amphipathic groove are postulated to mediate inte ractions with phosphoamino aci ds in the ligand. This interaction is mediated through the formati on of salt bridges betw een the ligand and the 14-3-3 groove (Yaffe, Rittinger et al. 1997; Petosa, Masters et al. 1998). As previously mentioned, 14-3-3 proteins can form dimers. The dimerization occurs through the amino terminal of helix 1 of one monomer and the helix 3 and 4 of the other monomer (Aitken, Jones et al. 1995; Jones, Ley et al. 1995; Jones, Martin et al. 1995). The dimeric structure of 14-3-3 allows for the simultaneous binding of two ligands. The extreme Nand C termini of 14-3-3 proteins are highl y variable and are missing in the crystal structure, indicating the re gions are disordered.

PAGE 54

42 (Wilker and Yaffe 2004) Figure 6: Secondary and tertiary structure of 14-3-3. Hydrophobic residues in green, acidic residues in red and basic residues in blue. It has been observed that some 14-3-3 isofor ms preferentially form homodimers, such as 14-3-3 sigma due to the makeup of their st ructure (Jones, Ley et al. 1995; Chaudhri, Scarabel et al. 2003; Wilker and Yaffe 2004). In the case of 14-3-3 sigma, homodimers form due to seven unique hydrophobic amino aci ds in helix1 and helix 7. In nature, many 14-3-3 isoforms are found as heterodimers, which may suggest a mechanism for specific protein ligand interactions and the promotion of ligand interactions. Figure 7: Primary 14-3-3 structure. Dimerization domain 1 141 245Substrate Bindin g re g ion

PAGE 55

43 Modes of regulation by 14-3-3 proteins 14-3-3 are abundant and stable proteins that play key roles in regulating homeostasis within the all euka ryotic organisms (Aitken, Collinge et al. 1992; Aitken, Jones et al. 1995; Wang, Grammatikakis et al. 2003).Modes of regulation include alteration of DNA binding activity. For exampl e, 14-3-3 can bind p53 at the C-terminus and increase its DNA binding affinity (Waterma n, Stavridi et al. 1998 ). 14-3-3 protein binding have also been implicated in maski ng nuclear localization and export sequences, inhibiting and promoting protein interactions as well as altering enzymatic activities of proteins. 14-3-3 facilitates the interactions of RAF1 proteins which are bridged together through 14-3-3 dimers, on phosphorylation of 143-3 binding motifs (Tzivion, Luo et al. 1998). Although highly homologous in sequence a nd structure, different 14-3-3 isoforms have distinct biological func tions, as demonstrated by th e phenotypes of 14-3-3 epsilon and zeta disruption in Drosophila (Su, Parry et al. 2001). There is also extensive evidence that 14-3-3 sigma play significant roles in regulating cell differentiation and cancer development (Hermeking 2003). Diseases associated with 14-3-3 proteins: There are many reports that implicat e the deregulation of 14-3-3 protein expressions as indicators of many human diseases. Reports have indicated elevated levels of 14-3-3 proteins in cerebrospinal fluid of patients with various neurodegenerative disorders. Several 14-3-3 isoforms are expr essed at unregulated levels in Alzheimer’s disease and recent evidence suggest 14-3-3 play s a causative role in the development of

PAGE 56

44 this disease. 14-3-3 has been shown to reta in the Tau protein in a hyperphosphorylated form. Hyperphosphorylated Tau generates neurof ibral tangles associated in patients with Alzheimer’s disease. Alterations of expr ession of many 14-3-3 isotypes have been associated with several human cancers. For example, 14-3-3 sigma is detected in normal breast epithelial, however is undetectable in breast cancer ti ssue (Ferguson, Evron et al. 2000). In humans, deletion of 14-3-3 eps ilon indicates a more severe form of lissencephaly grade seen in pa tients with Miller-Dicker synd rome (MDS) (Dalal, Yaffe et al. 2004; Nguyen, Rothman et al. 2004). Until recently, only indirect evidence has accumulated which directly implicates 14-3-3 prot eins as the cause of disease. Some labs have recently shown that the overexpression of 14-3-3 zeta promotes tumor survival, and the abrogation of this overexpression result s in efficient apoptosis after DNA damage (Tzivion, Gupta et al. 2006). 14-3-3 proteins ability to in teract and promote so many different responses could be a clear indicator of why its deregulation could cause so many problems for the cell. It c ould also be a reason why cancers target such proteins for modification, due to the benefits associated with protection from a poptosis and increase proliferation. 14-3-3 Functions: The precise function of 143-3 proteins in cell biology has been very difficult to describe, partially due to 143-3 proteins ability to inte ract with so many different proteins. However, there are proposed mode ls for the function of 14-3-3 including:

PAGE 57

45 1. Modulating enzymatic activity 2. Alter localization 3. Regulate protein stability 4. Inhibit and/or promot e protein interactions 1. Modulating Enzymatic Activity: The activation of tyrosi ne and tryptophan hydroxylases was the first reported function of 14-3-3 proteins. 14-3-3 can modulate the enzymatic activity of the kinase; however the exact mechanism of this kinase dependent activation is unknown. The enzymatic activ ity of AANAT (two-serotonin-N-acetyl transferase) and its affinity for substrates has been shown to increase after 14-3-3 zeta binding. This interaction has been show n to be dependent on phosphorylation of AANAT by PKA (protein kinase A) (Obsil, Ghirlando et al. 2001). 2. Altering Localization: 14-3-3 function to modulate protein localization through sequestering the protein in cellular compartmen ts or simply masking a proteins nuclear export/import sequences. Binding of 14-3-3 proteins in most cases sequesters the protein and release of the protein allows for the re location. For example, 14-3-3 can bind to the human telomerase protein (Tert1) and promot e the nuclear import of the protein to the nucleus, thus promoting expression of telome rase (Seimiya, Sawada et al. 2000; Wang, Liu et al. 2004). 14-33 proteins have also been shown to bind the kinase Chk1 a kinase important for the induction of the DNA damage response (Jiang, Pereira et al. 2003). In addition, 14-3-3 can also affect the cytoplasmic-mitochondrial shuttling of Bad and Bax

PAGE 58

46 (Wang, Pathan et al. 1999; Samuel, Weber et al. 2001; Nomura, Shim izu et al. 2003). 3. Regulate protein stability: It is re asonable to conceive why 14-3-3 could promote protein stability. 143-3 binding could affect the in teraction of a protein and its corresponding E3 ligase. For example, recentl y reported was the induc ed stabilization of E2F1 by 14-3-3 tau binding. Binding preven ted the ubiquitination of E2F1 thereby promoting its stability. The vital mechanis m was the blocking degradation mediated by the p45 protein an E3 ligase. This report also provided evidence of the specificity of 143-3 isoforms. RNA interference against 14-3-3 tau abrogated the protein stability effect conferred by 14-3-3 binding. This report also indicated that other isoforms could not perform a redundant function as the tau isof orm (Wang, Das et al. 2004; Milton, Khaire et al. 2006). Recently our lab has shown th at 14-3-3 binding to Mdmx can promote the degradation of this protei n by through phosphorylation of MDMX and unmasking of a cryptic NLS region. Mutating the 14-3-3 binding site of this protein confers an increase in protein stability as well as abrogating the phosphorylation of this protein (Chen, Gilkes et al. 2005; Okamoto, Kashima et al. 2005; LeBron, Chen et al. 2006) 4. Inhibit / promote protein interactions: The activation of AKT protein kinase by survival signals leads to the phosphoryla tion of Bad on serine 136, which in turn promotes 14-3-3 binding (Zha, Harada et al. 1996; Datta, Katsov et al. 2000). Upon 143-3 binding to Bad, allows the release of the BCL2 family proteins, which can then activate anti-apoptotic responses in the cell (Brunet, Bonni et al. 1999; Brunet, Kanai et

PAGE 59

47 al. 2002). 14-3-3 can also reduce the abil ity of CBL an E3 ligase to degrade IRS1, thereby blocking the activation of CDC2 (Cra paro, Freund et al. 1997 ; Liu, Stanton et al. 1997; Forrest and Gabrielli 2001). Alterna tively, 14-3-3 binding c ould promote protein interactions. The oncogene kinase BCR-ABL ha s also been shown to interact with 14-33. This interaction can aid in the transforming capabilities of this kinase and promote aberrant interactions with othe r signaling pathways. 14-3-3 protei ns also play a role in the DNA damage response. 14-3-3 sigma has been shown to bind p53 and is also a direct p53 target gene (Hermeking 2003). In the presence of IR, p53 dephosphorylation of serine 376 occurs and promotes 14-3-3 bi nding. Binding between p53 and 14-3-3 is a mechanism for increased affinity of p53 fo r sequence-specific DNA (Waterman, Stavridi et al. 1998). It is also suggested that 14-3-3 is impor tant for the G2/M checkpoint maintenance. Targeted deletion of 143-3 by homologous recombination in HCT116 cells fails to maintain the G2/M checkpoint following exposure to Adriamycin (Chang, Chen et al. 1999). 14-3-3 regulation of p53: There are several lines of evidence that 14-3-3 proteins also play a role in regulating the p53 pathway during DNA damage response. 14-3-3 proteins are scaffold proteins that regulate many cellular functions by interacting with other proteins, often binding to phosphorylated serine or threonin e residues (Fu, Subramanian et al. 2000; Tzivion, Shen et al. 2001). There are seven 14-3-3 isoforms in humans (beta, gamma,

PAGE 60

48 epsilon, eta, sigma, tau, and zet a). Most of the isoforms ar e expressed in all tissues, although 14-3-3 sigma is restricted to ep ithelial cells (Herme king 2003). Although highly homologous in sequence and struct ure, different 14-3-3 isoforms have distinct biological functions, as demonstrated by the phenotypes of 14-3-3 epsilon and zeta disruption in Drosophila (Su, Parry et al. 2001) There is also extensive evidence that 14-3-3 sigma play significant roles in regulating cell differentiation and cancer development (Hermeking 2003). Involvement of 14-3-3 in the p53 pathway was first revealed by the ability of p53 to transcriptionally activate expression of 14-3-3 sigma, which can lead to G2/M cell cycle arrest (Hermeking, Lengauer et al. 1997). Furthermore, 14-3-3 sigma, gamma, epsilon, and tau isoforms can bind to p53 C terminus and activate p53 transcriptional activity (Stavridi, Chehab et al. 2001; Ya ng, Wen et al. 2003). P 53-14-3-3 interaction requires phosphorylation of S378, and is stim ulated by dephosphorylation of the adjacent S376 after DNA damage through an ATM-depende nt mechanism (Waterman, Stavridi et al. 1998). Mutation of S376 compromises the ab ility of p53 to induce p21 expression and G1 arrest after ionizing irradiation (Sta vridi, Chehab et al. 2001). 14-3-3 sigma interaction with p53 also inhibits p53 ubi quitination and degradation by MDM2 (Yang, Wen et al. 2003), possibly contributing to stabilization of p53 after DNA damage.

PAGE 61

49 MATERIALS AND METHODS Cell lines and plasmids H1299, U2OS, MCF-7, and 293T cells were maintained in DMEM medium with 10% fetal bovine seru m. HCT116 and HCT116-Chk2-/cells were kindly provided by Dr. Bert Vogelstein and maintained in McCoy 5A medium with 10% fetal bovine serum. Human MDMX cDNA wa s kindly provided by Dr. Donna George (Sharp, Kratowicz et al. 1999). FLAG tagged Chk2 wild type and A347 mutant were provided by Dr. Thanos Halaz onetis (Chehab, Malikzay et al. 2000). Expression plasmid for FLAG-14-3-3 tau was generated by PCR amplification of 14-3-3 tau cDNA from a Hela cDNA library and subcloning into pc DNA3. Expression plasmids for 14-3-3 beta, epsilon and eta were provid ed by Dr. Haian Fu. 14-3-3 ga mma was provided by Dr. Hua Lu, 14-3-3 sigma was provided by Dr. Mong-Ho ng Lee, and 14-3-3 zeta was provided by Dr. Anthony J. Muslin. GST-importin constructs were provided by Dr. Nancy Reich. For affinity purification and mass spectrometr ic analysis, a FLAG epitope tag was added to the C terminus of myc-MDMX by PCR to create double-tagged myc-MDMX-Flag. All MDM2 and MDMX constructs used in this study were based on human cDNA clones. Affinity purification of MDMX-associated protein Hela-S cells stably transfected with FLAG-tagged MDMX were grown as a suspen sion culture. Cells from 500 ml culture (~2x108 cells) were lysed in 10 ml lysis buffer [50 mM Tris-HCl (pH 8.0), 5 mM EDTA,

PAGE 62

50 150 mM NaCl, 0.5% NP40, 1 mM PMSF], centrifuged for 5 minutes at 10,000 g, and the insoluble debris were discar ded. The lysate was preclear ed with 100 l bed volume of protein A Sepharose beads for 30 minutes, and then incubated with 50 l bed volume of M2-agarose bead (Sigma) for 4 hours at 4 C. The beads were washed extensively with lysis buffer and MDMX and its associated protei ns were eluted with 70 l of 20 mM Tris pH8.0, 2% SDS, 200 g/ml FLAG epitope pep tide (Sigma) for 15 minutes. The eluted proteins were fractionated on SDS-PAGE and stained with Co omassie Blue. Proteins copurified with MDMX were excised from the ge l and subjected to protease digestion and peptide sequencing by mass spectrometry at the Harvard Microchemistry Laboratory. Site directed mutagenesis: The point mutation of MDMX nuclear localization region on lysine 468 to glutamic acid was perfor med using Quickchange kit (Stratagene) according to the manufacturers instructions. Forward primer: 5’ CACTGTGCCAGAAGACTA GAG AAGGCTGGGGCTTCATGC 3’ RNA interference: Purified and annealed duplex si RNA oligonucleotides targeting the 14-3-3 sequence: AACCGGTACCTTGCTGAAGTT were generated commercially by Dharmacon (Lafayette,Co.). The sense sequence was: 5’ CCGGTACCTTGCTGAAGTT 3’. Transfection of 100-300nM RNA was pe rformed using Oligofectamine (Invitrogen) according to manufacturers instructions for 24-48hrs. After 48hrs of transfection, cells were treated with 10Gy ioni zing radiation for various tim e points and analyzed.

PAGE 63

51 FACS analysis : U20S-stable pools were treated in the absence or presence of 10Gy IR and 100ng nocodazole for 18 hours. The cells were then harvested by trypsinization, fixed in 70% ethanol and stained with prop idium iodide (50mg/ml) containing 50mg/ml RNase A. The cells were then analyzed for cell cycle distribution. Protein analysis To detect proteins by western blot cells were lysed in lysis buffer [50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 0.5% NP40, 1 mM PMSF, 200 nM Okadaic acid], centrifuged for 5 mins. at 10,000 g, and the insoluble debris were discarded. Cell lysate (10-50 g protein) was fractionated by SDS-PAGE using a gradient gel and transferred to Immobilon P filters (Millipore). The filter was blocked for 1 hr with phosphate-buffered saline (PBS) contai ning 5% non-fat dry milk, 0.1 % Tween-20. The following monoclonal antibodies were used: 3G9 for MDM2 (Chen, Marechal et al. 1993); DO-1 (Pharmingen) for p53 western blot; 8C6 monoclonal or a rabbit polyclonal serum for MDMX western blot and IP (Li, Chen et al. 2002), PS357 antibody for phosphorylated MDMX (Chen, Gilkes et al. 2005). The filter was developed using ECLplus reagent (Amersham). Immunoprecipitation assay Cells were lysed in lysis buffe r [50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 0.5% NP40, 1 mM PMSF], centrifuged for 5 minutes at 10,000 g, and the insoluble debris were discarde d. Cell lysate (5001000 g protein) was immunoprecipitated using 100 l 8C6 hybrid oma supernatant against MDMX and protein G agarose beads for 4 hours at 4 C. The beads were washed extensively with lysis

PAGE 64

52 buffer, boiled in SDS sample buffer, frac tionated by SDS-PAGE, and analyzed by anti14-3-3 western blot using an isoform-specific rabbit polyclonal anti bodies (Santa Cruz Biotechnology). Capture of 14-3-3 using MDMX phosphopeptides Thirty micrograms of MDMX peptides S342 (HSLSTSDIT), PS342 [HSL (pS)TSDIT], S367 (RTISAPVVR) and PS367 [RTI(pS)APVVR] were crossli nked to 30 l of CarboxyLink beads (Pierce) according to instructions from the manufact urer. The beads (15 l) were incubated with 200 g lysate of MCF7 cells stably tran sfected with FLAG-14-3-3 (expressed at a level similar to endogenous 14-3-3 ) for 3 hours at 4 C, washed with lysis buffer, and analyzed by antiFLAG western blot. In vivo ubiquitination assay HCT116-Chk2-/cells in 6 cm plates were transfected with combinations of 0.5 g His6-ubiquitin expr ession plasmid, 1 g MDMX, 0.5 g MDM2 and 1 g Chk2 expression plasmids usi ng Lipofectamine Plus reagents (Life Technologies). For detection of 14-3-3 a nd Chk2 cooperation, 0.5 g His6-ubiquitin, 1 g MDMX, 0.1 g Chk2, and 0.05 g 14-3-3 plasmids were cotransfected. Twenty-four hours after transfection, cells were lysed in buffer A (6 M guanidinium-HCl, 0.1 M Na2HPO4/NaH2PO4, 0.01 M Tris-HCl pH8.0, 5 mM imidazole, 10 mM mecaptoethanol) and incubated with Ni2+-NTA beads (Qiagen) for 4 hours at room temperature. The beads were washed with buffer A, B (8 M urea, 0.1 M

PAGE 65

53 Na2PO4/NaH2PO4, 0.01 M Tris-Cl pH8.0, 10 mM -mecaptoethanol), C (8 M urea, 0.1 M Na2PO4/NaH2PO4, 0.01 M Tris-Cl pH6.3, 10 mM -mecaptoethanol), and bound proteins were eluted with buffer D (200 mM imidazole, 0.15 M Tris-Cl pH6.7, 30% glycerol, 0.72M -mercaptoethanol, 5% SDS). The eluted proteins were analyzed by western blot for the presence of conjugated MDMX using 8C6 antibody. Luciferase assay HCT116-Chk2-/cells were plated in 24-well plates (50,000/well) for 24 hours and transfected with a mixture containing 20 ng p53-responsive BP100luciferase, 40 ng MDMX, 5 ng CMV-lacZ, 2 ng 14-3-3 and 5 ng Chk2 plasmids. Transfection was achieved using Lipofectamin e PLUS reagents (Invitrogen) and cells were analyzed for luciferase and beta gal actosidase expression after 24 hours. The ratio of luciferase/beta galactosidase activity wa s used as indicator of p53 transcriptional activity. Immunofluorescence staining Cells cultured on chamber s lides were transfected with indicated combinations of MDMX and 14-3-3 expression plasmids using Lipofectamine PLUS reagents. Twenty-four ho urs after transfection, cells were fixed with acetonemethanol (1:1) for 3 minutes at room temp erature, blocked with PBS+10% normal goat serum (NGS) for 20 minutes, and incubated with a mixture of anti-MDMX 8C6 hybridoma supernatant and rabbit-anti-PS367 antibody in PBS+10% NGS fo r 2 hrs. The slides were washed with PBS+0.1% Triton X-100, incubated with rhodamine-goat-anti-rabbit IgG and

PAGE 66

54 FITC-goat-anti-mouse IgG in PBS+10% NGS for 1 hr, washed with PBS+0.1% TritonX100 and mounted. Nuclear cytoplasmic fractionation Approximately 1x107 cells were pelleted and suspended in 500 l of 1X Hypotonic bu ffer (40 mM Hepes pH7.9, 2 mM EDTA, 2 mM EGTA, 20 mM NaF, 1 mM DTT, 1 mM PMSF, 1 mM Na3VO4) containing protease inhibitor cocktail (Sigma). After incuba tion on ice for 2 min, cells were homogenized with ten strokes in a Dounce homogenizer. Samples were centrifuged at 4 C at 1,000 g for 5 min. Supernantant was colle cted (Cytosolic fraction) and the pellet was washed with Nuclear Wash Buffer (50 mM NaCl, 10 mM Hepes pH 8.0, 25% glycerol, 0.1 mM EDTA, 1 mM NaF, 20 mM Na3VO4) and centrifuged briefly at 4 C. The pellet was then lysed on a rotating wheel at 4 C for 20 min in 100 l of Hi gh Salt Buffer (840 mM KCl, 40 mM Hepes, 2 mM EDTA, 2 mM EGTA, 40% glycerol, 1 mM DTT) containing protease inhibitors and phosphatase inhibi tors. After centrifugation at 10,000 g for 20 min, supernatant was collected (Nuclear fr action). Protein concentrations in the cytoplasmic and nuclear fractions were determ ined, and identical amount of protein were subjected to western blot analyses. In vivo phospholabeling and phosphopeptide analysis To detect MDMX phosphorylation in vivo, 293T cells in 10 cm pl ates were transiently transfected with 10 g MDMX expression plasmids using the ca lcium phosphate precip itation method. Forty

PAGE 67

55 hours after transfection, cells were washed with DMEM without phosphate and incubated with 32P-orthophosphate (0.2 mCi/ml) in DMEM without phosphate for 4 hrs. Cell lysate was immunoprecipitated with 8C6 and an alyzed by SDS-PAGE and autoradiography. Nylon membrane containing radio-labeled MDMX bands were excised and incubated with 50 ng endoproteinase Asp-N (Sigma) for 16 hrs in 50 mM ammonium bicarbonate at 37 C. MDMX peptides were oxidized w ith performic acid and resolved by electrophoresis on a thin layer cellulose plate for 30 min at 1.0 kV in formic acid/glacial acetic acid/water (1:3.1:35.9; pH 1.9) using th e HTLE-7002 apparatus. This was followed by chromatography in the second dimension in n-butyl alcohol/pyridine/glacial acetic acid/water (5:3.3:1:4) for 16 hrs. The phosphopeptides were visualized by autoradiography.

PAGE 68

56 RESULTS MDMX interacts with 14-3-3 In order to determine whether MDMX inte racts with novel cellular proteins, Hela cells were stably transfected with FLAG-tagged MDMX. When FLAG-MDMX was purified by immunoprecipitation, two protei ns reproducibly copurified with MDMX ( Figure 8) Peptide sequencing by mass spectrometry determined the 34 kd protein as casine kinase 1 alpha, and the 24 kd protein as 14-3-3 (tau) isoform. In a separate report, we showed that CK1 interaction with the central region of MDMX promotes phosphorylation of S289 and cooperates with MDMX to inactivate p5 3 (Chen, Li et al. 2005). MDMX binding to 14-3-3 appeared to be independent of CK1 and is the focus of this study.

PAGE 69

57 Figure 8: Copurification of 14-3-3 with MDMX: Hela cells stably transfected with FLAG-MDMX were immunoprecipitated us ing anti-FLAG-M2 antibody, the purified MDMX and associated proteins were detect ed by Coomassie stain. Two marked bands were identified as CKI and 14-3-3 tau my mass spectrometric peptide sequencing.

PAGE 70

58 To confirm that endogenous MDMX inte racts with 14-3-3, MCF7 cells were immunoprecipitated with MDMX monoclona l antibody and probed for 14-3-3 using a 14-3-3 specific antibody. Endogenous MDMX inte raction with 14-3-3 was nearly below our detection limit in the abse nce of stress. However, DNA-damaging treatments with camptothecin or ionizing irradiation significantly stimulated MDMX-14-3-3 binding ( Figure 9 ). Furthermore, treatment with the proteasome inhibitor MG132 also increased MDMX-14-3-3 binding, suggesting that a population of unstable MDMX may preferentially bind to 14-3-3. DNA damage stimulation of MDMX-14-3-3 binding has also been reported in a recent public ation (Okamoto, Kashima et al. 2005). Figure 9: Endogenous interactio n between MDMX and 14-3-3 tau: MCF7 cells were treated with 30uM MG132 for 4 hrs, 0.5uM Camptothecin for 16 hours, or irradiated with 10Gy gamma irradiation for 4 hours. Cell lysates were immunoprecipitated with MDMX antibody (8C6 ) followed by anti-14-3-3 tau western blot.

PAGE 71

59 One of the dominant 14-3-3 isofor m expressed in Hela is 14-3-3 (Nomura, Shimizu et al. 2003). This may be the reason that 14-3-3 was found in the MDMX complex from this cell line. To determine whether MDMX also interacts with other 14-33 isoforms, MDMX was cotransfected with th e entire 14-3-3 panel (tau, sigma, beta, gamma, zeta, epsilon, eta). The epitope ta gged 14-3-3 was immunopr ecipitated and the coprecipitated MDMX was de tected by western blot. The results showed absence of binding to 14-3-3 sigma, weak binding to ga mma, and strong binding to tau, beta, zeta, epsilon, and eta ( Figure 10). This result suggested that MDMX interacts with multiple 14-3-3 isoforms. Figure 10: MDMX interacts with other 14-3-3 isoforms: H1299 cells transiently cotransfected with MDMX and epitope-tag ged 14-3-3 plasmids were immunoprecipitated using anti-FLAG (for ), and anti-myc (for ) and anti-His6 (for ) antibodies. Coprecipitations of MDMX with 14-3-3 isof orms were detected by western blot.

PAGE 72

60 To confirm the specificity of 14-3-3 isof orms binding to p53, we cotransfected p53 with the entire 14-3-3 panel (tau, sigma, be ta, gamma, zeta, epsilon, eta). The epitope tagged 14-3-3 was immunoprecipitated and th e coprecipitated p53 was detected by western blot. The results showed that al l 14-3-3 isoforms bound to p53 with similar affinities ( Figure 11 ). Figure 11: p53 interacts with all 14-3-3 isoforms. U20S cells transiently cotransfected with MDMX and epitope-tagged 14-3-3 plas mids were immunoprecipitated using antiFLAG (for ), and anti-myc (for ) antibodies. Copreci pitation of p53 (DO-1 antibody) with 14-3-3 isoforms were detected by western blot.

PAGE 73

61 To determine the functional conseque nce of MDMX-14-3-3 interaction, HCT (p53+/+), were transfected 14-3-3 siRNA o ligonucleotides and scramble siRNA as a negative control. Alt hough knockdown of 14-3-3 tau was significant, there was no change in p53 levels and a small in crease in p21 for siRNA construct #3 ( Figure 12a ). Since the interaction between 14-3-3 and MDMX increased after DNA damage, we next tested whether the knockdown of 14-3-3 would have any effe ct on MDMX stability and p53 induction after DNA damage. HCT p53 +/+ cells were transien tly knockdown with 14-3-3 siRNA for 48hrs followed by 10Gy of ioni zing radiation for various time points. Unexpectedly, knockdown of 14-3-3 had no ef fect on MDMX degradation after DNA damage, as well as induction of p21 ( Figure 12b )

PAGE 74

62 (a) (b) Figure: 12: Knockdown of 14-3-3 has no effect on MDMX stability: (a) HCT p53+/+ were transiently transfected with 14-3-3 siRNA oligonucleotides (100ng(#1) and 300ng (#3). Control siRNA ( C) was used as a non-sp ecific control. Using oligofectamine, cells were transfected for 48 hrs. Cell lysate was collected and western blots for endogenous 14-3-3 tau, p53, p21 and b-actin levels were compared. (b ) HCT p53 +/+ cells were transfected in a 10cm dish with 300ng of 143-3 siRNA construct #3 for 48 hours. Each plate was split into 4 6-cm dishes and treat ed and treated for va rious time points after DNA damage.

PAGE 75

63 We reasoned that knockdown of only one isof orm of 14-3-3 would not show any obvious effects on MDMX levels, since many other isoforms also interacted. However, it has been shown that knockdown of 14-3-3 gamm a after treatment with UV, induced p53 levels and G1 arrest (Jin el al. 2006). Since ablation of 14-33 tau had no significant effect on p53 levels, we next tested the possibility that overexpression of 14-3-3 may have some detectable effect. Again, in orde r to determine the role of 14-3-3 binding to MDMX, we generated 14-3-3 overexpression st able clones in MCF7 cell lines. The pCDNA pool was used as a negative contro l, while clones 1, 2, 3 were compared to pCDNA3 due to their varying e xpression levels. Selected cl one 1 had no expression of FLAG-14-3-3, clone 2 has a lower expression, wh ile clone 3 had the highest expression. To examine whether different levels of 143-3 overexpression had an effect on MDMX stability after DNA damage, we treated ea ch pool with 10Gy gamma irradiation at various time points. We expected that ove rexpression of 14-3-3 could perhaps more efficiently promote the degradation of MDMX since binding correlated with a decrease in MDMX binding after genotoxic stresses. However, overexpression alone or with IR had no effect on MDMX levels as well the induction of p53 target gene p21 ( Figure 13 ).

PAGE 76

64 Figure 13 : Overexpression of 14-3-3 has no effect on p53 target gene induction. (a) MCF7 cells were stable tr ansfected with FLAG-14-3-3 us ing 750ug/ml of G418. Single clones were selected that expressed high, lo w and no detectable levels of FLAG-14-3-3. (b) Cells were treated with 10Gy IR for 0,2,4, 6,8 hrs and collected for analysis. Cell lysate was were used to we stern blot for MDMX (8C6), p21, and 14-3-3. B-actin was used as a loading control.

PAGE 77

65 Identification of 14-3-3 binding site on MDMX A major function of 14-3-3 is to bind to proteins with phosphorylated serine and threonine residues. The increased MDMX binding to 14-3-3 after DNA damaging treatment suggested that MDMX phosphorylation is invol ved in regulating 14-3-3 binding. We recently found that DNA damage induces the appearance of MDMX with reduced mobility on SDS-PAGE. Inhibiti on of proteasome using MG132 can further preserve this labile populat ion. Mass spectrometric an alysis identified several phosphorylation sites on MDMX after DNA da mage by gamma irradiation, including S342, S367, S391, and S403 (Chen, Gilkes et al. 2005) ( Figure 14 ) A recent report by Pereg et al also identified phosphorylati on on S342, S367 and S403, and showed that S403 is a target for ATM after DNA da mage (Pereg, Shkedy et al. 2005). Figure 14: Identification of phosphoryla tion sites on MDMX by mass spectrometry Location of phosphorylation s ites on MDMX. Phosphorylat ion of S342, S367 and S403 were detected by mass spectrometry and verified by phosphorylation-specific antibody

PAGE 78

66 analyses in previous studies. Of particular interest, S367 is presen t in a sequence context favorable for interaction with 14-3-3 afte r phosphorylation (xSxPx) (Yaf fe, Rittinger et al. 1997). We tested this possibility by generating S 367A and P369S mutations to target the phosphorylation site and the adja cent proline residue important for providing the optimal sequence context. Mutants of adjacent phospho rylated sites S342A and S403A were also tested. The MDMX mutants were co-expressed with FLAG-14-3-3 in H1299 cells and analyzed by anti-FLAG IP followed by MDMX western blot. The results showed that MDMX binding to 14-3-3 was abrogated by the S367A mutati on and significantly reduced by P369S mutation ( Figure 15 ). Furthermore, S342A and S403A mutations had no effect on MDMX-14-3-3 binding (data not shown). These results suggested that S367 is the major binding site for 14-3-3. Figure 15: S367 is the major MDMX-14-3-3 binding site. H1299 cells were transiently cotransfected with MDMX mutant and FLAG-14-3-3 plasmids for 48 hours, followed by anti-FLAG IP and MDMX western blot.

PAGE 79

67 To confirm that phosphorylated S367 is directly involved in binding to 14-3-3, peptides with phosphorylated or un-phosphoryl ated S367 were conjugated to agarose beads. Whole cell extract was incubated with peptide-loaded bead s and the amount of 143-3 captured was determined by western blot. The result showed that peptide with phosphorylated S367 specifically captured 14-3-3 from the extract. Un-phosphorylated S367 peptide, phosphorylated or un-phosphoryl ated S342 peptides showed no binding above background noise ( Figure 16 ). These results further demonstrated that phosphorylated S367 is the 143-3 binding site on MDMX. Figure 16: Phosphorylated S367 binds specifically to 14-3-3: 14-3-3 binding by phosphorylated S367 peptide. MDMX peptides with or without phosphorylation on S342 and S367 were chemically cro ss-linked to agarose beads. Th e beads were incubated with whole cell extract, washed and bound 14-3-3 was detected by western blot.

PAGE 80

68 S367 is a major phosphorylation site in vivo If S367 plays a significant role in the regulation of MDMX after DNA damage, we would expect that this site should be strongly phosphorylated. Therefore, we determined the relative modification levels of several MDMX phosphorylation sites in vivo by metabolic labeling and 2-dimensiona l phosphopeptide analysis. 293T cells were transiently transfected with MDMX mutants with serine to alanine mutations at each phosphorylation site and labeled with 32P-orthophosphate. The labeled MDMX was immunoprecipitated, gel purified, digested with Asp-N endoprot einase, and the peptides were analyzed by 2D peptide mapping. The labeling of wild type and MDMX point mutant enabled us to assign some of the phosphopeptide spots on the 2D peptide map to particular serine residues (Figure 17). The results showed that the most intensely labeled MDMX peptide was eliminated by the S367A mutation, suggesting that S367 was the major phosphorylation site on MDMX under the labeling condition (Figure 17a). Although phosphorylation of S403 was de tectable by mass spectrometry and phosphorylation specific antibody, we were not able to definitively assign this site to a particular spot on the 2D peptide map of Asp-N digestion. This may be due to weak signal or poor solubility of the phosphopeptide containing S403. We also tested whether metabolic labe ling and 2D peptide mapping can be used to detect gamma irradiation stimulated phos phorylation of MDMX. Th e results indicated that treatment of cells with 10 Gy gamma irradiation immediately before the 4 hour labeling with 0.2 mCi/ml 32P-orthophosphate did not have an effect on the labeling level

PAGE 81

69 of S367 relative to other spot s, suggesting that the amount of irradiation received from the 32P-orthophosphate incubation alone was suffic ient to induce high level modification of S367 ( Figure 17d ).

PAGE 82

70 Figure 17: S367 is a major MDMX phosphorylation site in vivo 293T cells were transiently transfected with MDMX mutants with serine-to-alanine mutations at the indicated phosphorylation site and labeled with 32P-orthophosphate. The labeled MDMX was immunoprecipitated, dige sted with Asp-N endoprotei nase, and analyzed by 2D peptide mapping. As an additional control, one plate of wild-type MDMX was treated with 10Gy IR for 4 hours.

PAGE 83

71 Chk2 phosphorylation of S367 is impo rtant for stimulating 14-3-3 binding The sequence context of S367 (RRTIS 367APVV) fits the consensus substrate motif LxRxxS /T for Chk2 kinase as identified by oriented peptide libraries in vitro (O'Neill, Giarratani et al 2002). In order to study the regulation of MDMX by phosphorylation, we recently generated phospho rylation-specific antibody against S367. Using this antibody, we found that S367 wa s phosphorylated at a low basal level in undamaged cells, but significantly phosphor ylated after DNA damage by gamma irradiation. Furthermore, in vitro kinase reaction showed that purified Chk2 kinase preferentially phosphorylates S367 of recombin ant MDMX (Chen, Gilkes et al. 2005). As expected, DNA damage by gamma irradiati on or UV induced S367 phosphorylation in wild type HCT116 cells, but no t in HCT116-Chk2-/cells ( Figure 18a ) (Jallepalli, Lengauer et al. 2003). Therefore, Chk2 kinase is important for both ionizing irradiation and UV-induced phosphorylation of S367. Phosphor ylation of MDMX on at least some of the other sites (possibly on S403 by ATM) was still evident after gamma irradiation in Chk2-/cells, generating a visible shift in MDMX mobility as in wild type HCT116 cells ( Figure 18a ) To test the role of Chk2 in DNA damage-induced MDMX-14-3-3 binding, HCT116-Chk-/cells were infected w ith lentivirus expressing MDMX to obtain a level necessary for detection of endogenous 14 -3-3 binding. The cells were treated with 10 Gy irradiation in the presence of MG 132 (to prevent degradation of phosphorylated MDMX), MDMX was immunoprecipitated and an alyzed for the coprecipitation of 14-33. The results showed that loss of Chk2 expr ession completely abrogated the stimulation of 14-3-3 binding by DNA damage ( Figure 18b ). These results showed that Chk2

PAGE 84

72 phosphorylation of S367 is re quired for stimulation of MD MX-14-3-3 binding after DNA damage.

PAGE 85

73 Figure 18: Chk2 is required for MDMX and 14-3-3 interaction. (a) HCT116 and HCT-Chk2 null cells were treated with 10 Gy gamma irradiation for 4 hours in the presence of 30 M MG132 to preser ve phosphorylated MDMX. MDMX was immunoprecipitated with 8C6 and analyzed using anti-PS367 antibody by western blot. The membrane was reprobed with 8C6 to confirm the level of total MDMX. (b) HCT116 cells were stably infected with MDMX lent ivirus to facilitate detection of MDMX binding to endogenous 14-3-3. Cells were treated with 10 Gy gamma irradiation for 4 hours in the presence of 30 M MG132. MDMX was immunoprecipitated and analyzed using anti-PS367 antibody. H1299 cells with very low MDMX level were used as negative control. MDMX imm unoprecipitate was analyzed for the coprecipitation of 143-3

PAGE 86

74 Chk2 phosphorylation of MDMX is requi red for nuclear impo rt and degradation Previous studies revealed that tran sfected MDMX show ed predominantly cytoplasmic distribution and can be induced to accumulate in the nucleus by binding to MDM2, or through an MDM2-independent m echanism after DNA damage (Stad, Little et al. 2001; Li, Chen et al. 2002; Migliorini, Danovi et al 2002). The increased MDMX14-3-3 binding after DNA damage suggested th at Chk2-regulated 143-3 binding plays a role in MDMX nuclear transloc ation. To test this hypothesis, we generated a stable U2OS cell line overexpressing the S367A mutant Immunofluorescence staining showed that after gamma irradiation, wild type MDMX underwent nuclear translocation as reported previously, whereas the S367A mutant showed significant defect in nuclear translocation ( Figure 19 ). However, both wild type MDMX and S367A were targeted into the nucleus when cotransfected with MD M2 (data not shown), indica ting that S367A mutation does not affect MDM2-mediated nuclear import. Therefore, phosphoryl ation of S367 is required for the DNA damage-induced, MDM2 -independent nuclear import, possibly mediated by 14-3-3 binding.

PAGE 87

75 U20S Figure 19: S367 mutant is defective in nuclear translocatio n after DNA damage: S367A mutant does not undergo nuclear tran slocation after DNA damage. U2OS cells stably transfected with wild type MDMX or S367A muta nt were treated with 0.5 M CPT for 18 hours and stained using 8C6.

PAGE 88

76 The ability of S367A mutation to block MDMX nuclear translocation suggested that phosphorylation by C hk2 is required for DNA damage -regulated MDMX nuclear import. To test this prediction, wild type a nd HCT116-Chk2-/cells we re stably infected with lentivirus vector e xpressing MDMX and treated with gamma irradiation. Immunofluorescence staining of MDMX rev ealed that DNA damage induced MDMX nuclear import in wild type HCT116 cel ls, but not in HCT 116-Chk2-/cells ( Figure 20). Therefore, Chk2 phosphorylation of MDMX on S367 is important for its nuclear translocation after DNA damage.

PAGE 89

77 Figure 19 : Chk2 deficiency effects MDMX nuclear translocation: DNA damage does not induce MDMX nuclear import in C hk2-null cells. HCT116 wild type and Chk2null cells stably infected with lentivirus expressing MDMX were treated with 10 Gy irradiation for 18 hours and stained with 8C6 antibody.

PAGE 90

78 To further test the role of Chk2 in MDMX nuclear import, we examined the localization of endogenous MDMX by nuclear /cytoplasmic fractionation. The results showed that MDMX in wild type HCT116 cells were distributed in both cytoplasm and nucleus, with moderate preference for the nucleus ( Figure 21). Nuclear distribution became prominent 4 hours after gamma irra diation when MG132 was also added to prevent degradation of phosphorylated MDMX. Without MG132 treatment, gamma irradiation actually reduced the amount of nuclear MDMX due to degradation ( Figure 21 ). The nuclear MDMX in wild type HCT116 cells showed reduced gel mobility after irradiation, suggesting that th e phosphorylated form was prefer entially transferred to the nucleus ( Figure 20, second panel ). In contrast, MDMX was almost equally distributed between the cytoplasm and nucleus in C hk2-null cells, and this pattern was not significantly altered by gamma irra diation and MG132 co-treatment ( Figure 21 ). For comparison, p53 in the same experiment was predominantly locali zed in the nucleus irrespective of the treatments.

PAGE 91

79 Figure 21: Analysis of endogenous MDMX by subcellular fractionation: Analysis of endogenous MDMX distribution by sub-cellular fractionation. HCT116 cells were treated with 10Gy gamma irradiation in the presence or absence of 30 M MG132 for 4 hours. Nuclear and cytoplasmic fractions were analyzed by western blot. To facilitate comparison of ratio, loading of IR-treated C/ N pair was empirically increased to obtain MDMX signal similar to the untreated pair.

PAGE 92

80 Additional time course experiments s howed that in the absence of MG132, MDMX level in both compartments of wild type HCT116 cells de creased rapidly after irradiation. However, in the presence of MG132, cytoplasmic MDMX decreased whereas nuclear MDMX remained the same or increased after irradiation (Figure 22). These results showed that nuclear translocation and degradation of MDMX after DNA damage requires Chk2 activity. Inhibition of the proteasome caused accumulation of the phosphorylated MDMX in the nucleus. Figure 22: Subcellular distribution of MD MX at early time points after IR: HCT116 cells were treated with 10 Gy gamma i rradiation in the presence or absence of 30 M MG132. Cells harvested at indicated time points were analyzed by nuclear /cytoplasmic fractionation. Samples representi ng identical cell number were analyzed by western blot. In the absence of MG132, MD MX level in both compartment decreased after irradiation. In the presence of MG132, cytoplasmi c MDMX decreased whereas nuclear MDMX remained the same or increase d after irradiation, consistent with nuclear import and degradation.

PAGE 93

81 Direct comparison of total MDMX levels in HCT116 with a nd without Chk2 also showed that loss of Chk2 prevented effi cient degradation of MDMX after gamma irradiation. This was associated with modera tely reduced stabilization of p53 and weaker induction of p21 expression (Figure 23 ). These results suggested that Chk2 is critical for efficient degradation of MDMX and full act ivation of p53 after DNA damage, possibly in part through regulation of MDMX-14-3-3 interaction and promoting MDMX nuclear import.

PAGE 94

82 Figure 23 : Chk2-null cells were partially defective for MDMX degradation. Chk2null cells were partially def ective for MDMX degradation. HCT116 cells were treated with indicated doses of gamma irradiation fo r 4 hours and analyzed by western blot for different markers.

PAGE 95

83 S367 phosphorylated MDMX preferentially localizes to the nucleus The correlation between Chk2-medi ated S367 phosphorylation and MDMX nuclear import suggested that phosphorylated MDMX should prefer entially accumulate in the nucleus. To test this prediction, Hela cells stably expressing high level of MDMX were stained with MDMX 8C6 antibody and PS367 antibody. As expected, cytoplasmic MDMX prior to DNA damage was not st ained by the PS367 antibody. After gamma irradiation or treatment with camptothecin, the majority of MDMX accumulated in the nucleus and displayed a strong nucle ar staining by the PS367 antibody ( Figure 24). Figure 24: Specificity of P367 antibody. Hela cells stably transfected with MDMX were treated with 0.5 M CPT for 18 hours and stained using 8C6 or PS367 antibody.

PAGE 96

84 Transient transfection of MDMX into U2OS cells result ed in a subpopul ation of cells showing diffused cytoplasmic and nuclear dist ribution. Double IF staining of these cells also showed that PS367 antibody pref erentially stained the nucleus ( Figure 25). These results are consistent with the cell fracti onation experiment showi ng that nuclear MDMX has a slower electrophoretic mobility after DNA damage ( Figure 21). Phosphorylated MDMX is rapidly degraded after DNA damage, whereas mutation of S367 increases MDMX resistance to ubiquitin ation and degradation by MDM2 (Chen, Gilkes et al. 2005). These observations, together with the results in Figure 5c suggested that 14-3-3 binding help to promote degrad ation of nuclear MDMX. To test this hypothesis, MDMX was tr ansiently co-transfected with 14-3-3 into U2OS cells, which express relatively high le vels of endogenous MDM2. Staining of MDMX by 8C6 antibody showed that 14-3-3 overexpression promoted the elimination of nuclear MDMX, resulted in more promin ent cytoplasmic distribution ( Figure 25).

PAGE 97

85 Figure 25: 14-3-3 promotes the elimination of phosphorylated MDMX from the nucleus. 14-3-3 expression promotes eliminati on of phosphorylated MDMX from the nucleus. U2OS cells were transiently cotransfected with MDMX and 14-3-3 plasmids for 24 hours and treated with 30 M MG132 for 4 hours. Cells were double stained using 8C6 for total MDMX (green) and PS367 an tibody for phosphorylated MDMX (red).

PAGE 98

86 One interpretation of this result is that 143-3 overexpression promotes MDMX nuclear export. However, PS367 staining also show ed a loss of phosphorylated MDMX after 143-3 cotransfection, suggesting that 14-3-3 promotes degradation of phosphorylated MDMX. Furthermore, when MDMX and 14-3-3 cotransfected cells were treated with MG132, accumulation of phosphorylated MDMX was observed ( Figure 25 ). The diffused localization of phosphorylated MDMX after MG132 treatm ent may be due to overexpression, which was not seen in the fractionation of endogenous MDMX ( Figure 21 ). Overall, the results favor the interpre tation that 14-3-3 bi nding promotes MDMX nuclear import and degradation in the nucleus.

PAGE 99

87 MDMX contains a cryptic NLS that medi ates Chk2-regulated nuclear import To determine how phosphorylation and 14-3-3 binding promote MDMX nuclear import, we tested whether MDMX contains a cryptic nuclear import signal (NLS) that may be activated by 14-3-3 binding. When G FP was fused to the N terminus of fulllength MDMX, the fusion protein becomes constitutively cytoplasmic even after DNA damage (data not shown), indicating an interference of nuclear import by the GFP moiety. However, GFP-MDMX300-490 was constitutively nuclear localized ( Figure 26 ), suggesting the exposure of a cr yptic NLS in this region.

PAGE 100

88 Figure 26: Distribution of fused GFP moie ty to full length MDMX and deletion mutants indicates a cryptic NLS region. GFP-MDMX fusions were stably transfected into U2OS cells and photographed for localiz ation using fluorescence from the GFP tag.

PAGE 101

89 Figure 27 : Diagram of MDMX indica ting the location of cryptic NLS Inspection of MDMX sequence suggested that the only candidate is a stretch of basic residues within the RING domain (465RRLKK), which is similar to the cryptic nucleolar targeting signal on MDM2 (465KKLKK) (Lohrum, Ashcroft et al. 2000) ( Figure 27 ). An K468E mutation introduced into GFP-MD MX300-490 resulted in diffused localization ( Figure 26 ), demonstrating that it wa s required for nuclear local ization. Furthermore, full-length MDMX with K468E mutation failed to undergo nuc lear translocation after DNA damage ( Figure 28 ), despite normal levels of S367 phosphorylation and 14-3-3 binding (data not shown). This mutation had no effect on MDM2-mediated nuclear import of MDMX in cotransfection assays (data not shown), suggesting that it is specifically required for the MDM2 -independent nuclear import.

PAGE 102

90 Figure 28: Full length MDMX with K468E mutation failed to undergo nuclear translocation after DNA damage. Full-length MDMX with the K468E mutation was transiently transfected into U2OS cells, tr eated for 18 hours with 0.5 M CPT, and stained using 8C6 antibody.

PAGE 103

91 Classic NLS-mediated nuclear import requ ires binding of the NLS to a family of cytoplasmic receptors (importin ) (Weis 2003). When GST-importin 1, 3, 5, 6, and 7 fusion proteins were incubated with cell lysate containing MDMX, importin 3 showed significant binding to MDMX (Liu, McBride et al. 2005), which was abrogated by the K468E mutation ( Figure 29 ). Figure 29: Importin a binds specifically to wild type MDMX but not K468E mutant. GST-importin loaded beads were incubated with lysate of HCT116 cells transiently transfected with wild type or mutant MDMX. Bound MDMX were detected by western blot.

PAGE 104

92 This result was consistent with a role of the 465RRLKK sequence in mediating MDMX nuclear import. However, GST-importin 3 pull down efficiency was not affected by Chk2 phosphorylation of S367 (data not shown), suggesting that the in vitro binding assay does not recapitulate all aspects of the import process. These results showed that MDMX contains a cryptic NL S sequence that mediates Chk2 and 14-3-3regulated nuclear import after DNA damage.

PAGE 105

93 14-3-3 cooperates with Chk2 to promote MDMX ubiquitination To further investigate the role of the 14-3-3 binding site on regulation of MDMX ubiquitination, the effect of Chk2 on wild type MDMX and the S367 mutant was examined. HCT116-Chk2-/cells were tran siently transfected with MDMX, MDM2, His6-ubiquitin, and Chk2 plasmids. MDMX ubiquitination was determined by Ni-NTA purification of ubiquitinated proteins fo llowed by MDMX western blot. The results showed that expression of wild type Chk2, but not the kinase-deficie nt Chk2-A347 mutant (Chehab, Malikzay et al. 2000), str ongly stimulated the poly-ubiquitination and degradation of MDMX by MDM2 ( Figure 30). In contrast, ubiquitination and degradation of the MDMX-S367A muta nt was not stimulated by Chk2 ( Figure 30 ). Therefore, phosphorylation of S367 is impor tant for efficient ubiquitination of MDMX and is necessary for the regulation by Chk2.

PAGE 106

94 Figure 30: Chk2 promotes ubiquitination of wildtype MDMX and not S367 mutant. HCT116-Chk2-/cells were transien tly transfected wi th MDMX, MDM2, Chk2, and His6-ubiquitin. MDMX ubiquitination was detect ed by Ni-NTA purification followed by MDMX western blot. Whole cell extract was analyzed for MDMX level by western blot. Chk2-A347 is a kinase-deficient mutant.

PAGE 107

95 To determine whether 14-3-3 and Chk2-mediated phosphorylation cooperate to stimulate the ubiquitination of MDMX, HCT116-Chk2-/cells were transfected with His6-ubiquitin, MDMX, 14-3-3 and Chk2 ex pression plasmids. Under dose-limiting conditions where 14-3-3 and C hk2 alone had negligible e ffects on MDMX ubiquitination by endogenous MDM2 (50-100 ng plasmid for a 6 cm plate), coexpression of 14-3-3 and Chk2 significantly enhanced MDMX ubiquitination and degradation ( Figure 31, lane 5 vs. 2 and 3 ). Furthermore, mutation of S367 abr ogated the cooperative effect of 14-3-3 and Chk2 ( Figure 31, lane 11 vs. 9 and 10 ). Therefore, Chk2-mediated phosphorylation cooperates with 14-3-3 to stimulate MDMX ubiquitination and degradation.

PAGE 108

96 Figure 31 : 14-3-3 cooperates with Chk2 to promote MDMX ubiquitination. HCT116-Chk2-/cells were transfecte d with His6-ubiquitin, MDMX, 14-3-3 and Chk2 plasmids. MDMX ubiquitination was detect ed by Ni-NTA purification followed by MDMX western blot. 14-3-3 N is a 30-245 fragment of 14-3-3 lacking the dimerization domain. To further test whether 14-3-3 stimulate s degradation of MDMX phosphorylated on S367, MDMX and MDM2 were cotransfect ed with 14-3-3 in H1299 cells. The transfection procedure alone induced si gnificant phosphorylati on of MDMX on S367 without DNA damaging treatments. The levels of total MDMX level and PS367 MDMX level were determined by IP-western blot. The result showed that when MDM2 level was sub-optimal for significant de gradation of total MDMX, 14-33 cotransfection selectively

PAGE 109

97 stimulated the degradation of MDMX phosphorylated on S367 ( Figure 32 ). Under conditions of MDM2 overexpression, the le vels of total MDMX and phosphorylated MDMX were degraded at a similar ra te (data not shown), possibly because phosphorylation on S367 was no longer a rate-l imiting step. These results showed that 14-3-3 stimulates MDM2 degradatio n of MDMX phosphorylated at S367. Figure 32: 14-3-3 stimulates degr adation of phosphorylated MDMX. 14-3-3 stimulates degradation of PS367 MDMX. H1299 cells were transiently transfected with MDMX, MDM2, and 14-3-3 for 48 hours. MDMX was i mmunoprecipitated with 8C6 and probed with PS367 antibody for the phosphor ylated form, or with 8C6 for total MDMX level.

PAGE 110

98 To further test the effect of Chk2 and 143-3 on the ability of MDMX to inhibit p53 transcriptional activity, HCT116-Chk2-/cells were transfec ted with the p53responsive BP100-luciferase reporter (Freed man, Epstein et al. 1997). Transfected BP100-luc alone was activated by endogenous p5 3 and produced baselin e readout of p53 activity. Cotransfection of MDMX reduced p53 activity by ~2-fold ( Figure 33), which was typical for MDMX and weaker than the effect of MDM2 in such assay. Coexpression of 14-3-3 and Chk2 partially overcome the inhibition of p53 activity by wild type MDMX, consistent with the ability of this combination in promoting MDMX degradation. This effect re quired active Chk2 and was not seen using kina se-deficient Chk2-347A mutant ( Figure 33 ). Importantly, the MDMX 367A mutant was not regulated by 14-3-3 and Chk2 ( Figure 33) confirming a requirement for phosphorylation and 14-3-3 binding. These results demonstrat ed that Chk2 phosphorylation of MDMX on S367 and recruitment of 14-3-3 cooperates to abrogate its inhibitory effect on p53.

PAGE 111

99 Figure 33 : Chk2 and 14-3-3 cooperate to neutra lize MDMX inhibition of p53. HCT116-Chk2-/cells were tr ansfected with p53-responsive BP100-luc reporter to detect endogenous p53 transcriptional activity. The effects of wild type MDMX, 14-3-3 and Chk2 coexpression on p53 activity were detected by lucifera se assay and normalized to CMV-lacZ transfection efficiency control. (b) A control experiment identical to (a) except that the MDMX 367A mutant was used.

PAGE 112

100 Investigating the role of MDMX nuclear import after DNA damage MDMX has been shown to undergo nuclear tr anslocation after DNA damage (Li et al. 2001). Although we now know that MDMX nuclear translocation promotes its degradation, it appears count erintuitive that a negative regulator of p53 would undergo translocation to the nucleus after DNA damage In order to elucidate the biological function of MDMX nuclear tran slocation after DNA damage, we investigated the effects that MDMX-K468E deficient in nuclear tran slocation on p53 and targ ets gene induction. Stable pools were generated by transiently transfecting U20S cel ls with wild-type MDMX, K468E mutant as well as a pCDNA3 negative control. The cells were selected in G418 for one month and pooled. In order to determine whether overexpression of the MDMX-K468E mutant provided an advantage in inducing p53 due to its deficiency in nuclear accumulation; cells were exposed to 10Gy of ionizing radiation for 0, 2, and 4 hours, followed by western blots analysis for p53 and target gene induction ( Figure 33 ). As expected, DNA damage induced the de gradation of MDMX and induction of p53 stability. Degradation of MDMX was most evident after 4 hours of IR treatment. Surprisingly, both wild-type MDMX and MD MX –NLS deficient mutant had similar stabilities after DNA damage, even t hough wild-type MDMX underwent nuclear translocation and the NLS mutant was cytoplas mic. It is still possible that longer time points would have indicated a difference. The most evident difference amongst wild-type MDMX and the NLS mutant was the levels of p21. The NLS-mutant had higher levels of p21, even before the addition of DNA dama ge. In addition, MDM2 levels were

PAGE 113

101 somewhat higher after 4 hours of IR. These results suggest that p53 may be more active when MDMX nuclear tran slocation is blocked (Figure 34) Figure 34: MDMX-K468E NLS mutant in creases p21 protein levels after DNA damage more efficiently then wildtype MDMX. U20S stable pools were treated with 10Gy ionizing radiation for indicated time point s. Cell lysate was collected and western blots were performed to measure a ny effects on p53 and p53 target genes.

PAGE 114

102 In order to determine whether the increase in p21, observed in the NLS-mutant would affect p53-dependent cell cycle arrest, the st able pools were treated in the absence or presence of IR and Nocodazole to induce a G1 and G2 arrest, respectively. Cell cycle distribution was determined by flow cytome try analysis (FACS). As shown in ( Figure 34 ) stable pools that were unt reated had similar distributi on profiles. Only after the addition of IR, Nocodazole or combination of IR and Nocodazole, did we see a difference in the ability of cells to i nduce a G1 arrest after DNA damage FACS analysis supported the western analysis that the NLS mutant induce more p21 than the wild-type, thus allowing the cells to accumulate in G1 phase more efficiently ( Figure 34 ). The population of cells in G1 phase in each stab le pool population was compared using bar graphs. Untreated cells were nearly iden tical, while pools treated with Nocodazole showed a four fold difference between wild -type and NLS mutant. The addition of IR showed a two fold difference, while the comb ination indicated a three fold difference in cells accumulated in G1-phase ( Figure 36 ). It is unclear whether the NLS mutant cells are accumulating faster in the G1 phase or have a delayed response to entering the next cell cycle phase.

PAGE 115

103 Figure 35 : Cell cycle analysis supports the induction of p21 through enhanced growth arrest in K468E mutant. U20S stable pools were treated in the absence or presence of IR, Nocodazole (100ng/ml) or in combination. Cell cycle distribution characteristics were determined by flow cy tometry after 18 hours of treatment. A minimum of 10000 events were analyzed for each pool.

PAGE 116

104 Figure 35 : Percentage of cells in G1. Accumulation of cells in G1-phase of FACS analysis of U20S stable pools was compared using bar graphs. Samples were normalized to the negative pDNA3 control pool.

PAGE 117

105 The correlation between MDMX nuclear impor t and degradation, suggested that these events are important for the regulation of MD MX levels. To test this hypothesis we compared the ubiquitination status and bindi ng to MDM2 and 14-3-3 between wild-type MDMX and the NLS mutant. H1299 cells we re cotransfected with the wild-type and mutant alone and in combination with MDM2 and 14-3-3. The results showed that both wildtype and NLS mutant were ubiquitinated similarly and bound to MDM2 with the same affinity. However, binding to 14-33 was reduced for the NLS mutant, possibly because the lack of impor tin alpha protein binding ( Figure 37 ).

PAGE 118

106 Figure 37: Wildtype and K468E mutant MDMX bound and are degraded equally by MDM2. H1299 cells were transiently tran sfected with MDMX, MDMX-K468E, MDM2, 14-3-3 and His6-ubiquitin. Cell pellet was collected and divided into two samples. The first pellet was used to determine MDMX ubiquitination by Ni-NTA purification, followed by western blot s. The second pellet was lysed and immunoprecipated using MDMX antibody (8 C6) followed by anti -MDM2 (2A9) and anti-Flag-14-3-3.

PAGE 119

107 Discussion Results described above showed that MD MX specifically interacts with 14-3-3. S367 is the major 14-3-3 binding site on MDMX and is significantly phosphorylated after DNA damage in a Chk2-dependent fashion, re sulting in increased 14-3-3 binding. S367 phosphorylation and 14-3-3 binding stimul ate degradation of MDMX by MDM2. Furthermore, phosphorylation of S367 is requ ired for MDMX nuclear import after DNA damage, possibly by activating a cryptic NLS in the RING domain. These results suggest that 14-3-3 proteins regulate MDMX local ization and degradation in response to DNA damage, and this effect may contribut e to the efficient activation of p53. Recent findings showed that after DNA damage, ATM is critical for inducing phosphorylation of MDMX on mu ltiple sites. ATM directly phosphorylates S403, and is also required for phosphorylation of S367 a nd S342 by activating Chk2. S367 is also the most heavily phosphorylated MDMX residue after ionizing irradiation, and S367 mutation has the most significant impact on MDMX ubiquitination and degradation by MDM2. The recruitment of 14-3-3 by phosphoryl ated S367 suggests that 14-3-3 is an important regulator of MDMX. It is worth no ting that 14-3-3 was initially co-purified with MDMX from Hela cells in the absen ce of DNA damage, suggest ing a basal level of S367 phosphorylation. Chk1 is a likely candidate in this process because it has house keeping functions and is activ e in un-perturbed cells (Bar tek and Lukas 2003). However, ionizing irradiation and UV did not stimul ate S367 phosphorylation in Chk2-null cells,

PAGE 120

108 suggesting that Chk2 is critical for the DNA damage response. Our data showed that phosphorylation of S367 by Chk2 is important for nuclear translocation of MDMX afte r DNA damage. Mutation of S367 or loss of Chk2 function prevents MDMX nuclear import indu ced by DNA damage. MDMX has multiple mechanisms for nuclear import. Interacti on with MDM2 can target MDMX into the nucleus using the NLS on MDM2. As expected, this effect does not require MDMX S367 phosphorylation or the MDMX cryptic NLS. A second mechanism requires phosphorylation of S367 and possibly involves 14-3-3 recruitment. 14-3-3 binding to phosphorylated S367 may induce conformati onal change of the RING domain and activate the cryptic NLS. P hosphorylated MDMX also bi nds to MDM2 with higher affinity (Chen, Gilkes et al. 2005), consistent with conformational change in the RING domain. Therefore, MDMX belongs to a rare gr oup of proteins that are targeted to the nucleus by 14-3-3 binding. How 14-3-3 binding stimulates MDMX de gradation remains to be further investigated. Nuclear translocation should facilitat e interaction with MDM2 in the nucleus, resulting in ubiquitination and degrad ation of MDMX. Conformational change induced by phosphorylation and 14-3-3 bindi ng may increase affinity to MDM2, or increase the ability of MDMX RING domain to activate MDM2 E3 function after forming the heterodimer. A recent report s howed that the de-ubiquitinating enzyme HAUSP binds to MDMX and regulates MDMX stability by de-ubiquitination (Meulmeester, Maurice et al. 2005). Inte raction between MDMX-HAUSP was reduced after DNA damage and is thought to contribute to MDMX dest abilization. It is possible

PAGE 121

109 that 14-3-3 binding displaces HAUSP and c ontribute to increased MDMX ubiquitination. The exact function of MDMX nuclear transl ocation also remains to be elucidated, however our data shed some light on th e possible importance of nuclear import in regulating p53 response to DNA damage. We show that mutation of MDMX on one lysine residue at position 468 to glutamic aci d, completely abrogates the nuclear import after DNA damage. This mutation had no effect on MDM2-mediated nuclear import of MDMX in cotransfection assa ys, suggesting that it is sp ecifically required for the MDM2-independent nuclear import. We also show that the pattern of ubiquitination between the wild-type and NLS mutant is unchanged under nonstressed conditions. It is also possible we could have seen differences in ubiquitiantion, if proteasomal degradation was blocked with the addition of MG132. Anothe r important factor to test is the addition of DNA damage, although the use of anothe r cell line besides H1299 would be more beneficial due to the minimal induction of MDMX phosphorylation at serine 367 after DNA damage in this cell line. Another interpretation could be that in the absence of stress, degradation of both MDMX and NLS is unchanged. We did not test whether there was a change after DNA damage, however we expect there would be a differe nce in binding due to localiza tion differences. Whether or not the MDMX-NLS mutant can retain more MDM2 w ithin the nucleus after DNA damage, remains to be determined In terestingly, the MDMXK468E mutant induces the expression of p21 more efficiently than the wild-type MDMX af ter ionizing radiation

PAGE 122

110 (IR). This could be explained by MDM2 pref erentially binding the nuclear accumulated phosphorylated MDMX Furthermore, the K468 E mutant induction of p21 is associated with enhanced G1 arrest after DNA damage. These results indicate an important function of MDMX nuclear import in regulatin g p53 activity after DNA damage. Efficient activation of p53 after DNA da mage is likely to be achieved by phosphorylation of multiple targets incl uding p53, MDM2, and MDMX. The results described in this report add another leve l of complexity to p53 signaling. Further elucidation of the physiological functions of S367 phosphorylation will require a knockin or gene replacement approach. It will also be important to determine whether other types of stress also target MDMX or p53 by regulating MDMX-14-3-3 interaction.

PAGE 123

111 Proposed Model: Figure 38: MDMX is a very stable protein, howev er after the addition of DNA damage, it undergoes rapid degradation. This figure illustrates a possible mechanism for the enhanced degradation. We propose that afte r IR treatment, MDMX gets phosphorylated on serines 342, 367, 403 in a Chk1, Chk2 and ATM fashion, respectively. Phosphorylation of serine 367 creates a bi nding site for 14-3-3. Upon binding, 14-3-3 induces a conformational change in MDMX that exposes a cryptic NLS region. Importin alpha 3 proteins bind the NLS region of MDMX to initiate nuclear import. Nuclear translocation of phosphorylated MDMX makes it a better substrate for MDM2 binding. MDM2 binding promotes the polyubiquitination of MDMX and subsequent degradation. The combination of decreased MDM2-p53 a ssociation and MDMX degradation allows p53 to become more stable and transcriptional active.

PAGE 124

112 REFERENCES Abraham, R. T. (2001). "Cell cycle ch eckpoint signaling through the ATM and ATR kinases." Genes Dev 15 (17): 2177-96. Ahn, J. Y., J. K. Schwarz, et al. (200 0). "Threonine 68 phosphorylation by ataxia telangiectasia mutated is re quired for efficient activati on of Chk2 in response to ionizing radiation." Cancer Res 60 (21): 5934-6. Aitken, A., D. B. Collinge, et al. (19 92). "14-3-3 proteins : a highly conserved, widespread family of eukaryotic proteins." Tren ds Biochem Sci 17 (12): 498-501. Aitken, A., D. Jones, et al. (1995). "14-33 proteins: biological function and domain structure." Biochem Soc Trans 23 (3): 605-11. Appella, E. and C. W. Anderson (2001). "Pos t-translational modifi cations and activation of p53 by genotoxic stresses." Eur J Biochem 268 (10): 2764-72. Avantaggiati, M. L., V. Ogryzko, et al. (1997). "Recruitment of p300/CBP in p53dependent signal pathways." Cell 89 (7): 1175-84. Baker, S. J., S. Markowitz, et al. (199 0). "Suppression of human colorectal carcinoma cell growth by wild-type p53." Science 249 (4971): 912-5. Banin, S., L. Moyal, et al. (1998). "Enhanced phosphorylation of p53 by ATM in response to DNA damage." Science 281 (5383): 1674-7. Barak, Y., E. Gottlieb, et al. (1994). "Regula tion of mdm2 expression by p53: alternative promoters produce transcripts with nonident ical translation potential." Genes Dev 8 (15): 1739-49. Barak, Y., T. Juven, et al. (1993). "mdm2 expression is induced by wild type p53 activity." Embo J 12 (2): 461-8. Bartek, J., J. Falck, et al (2001). "CHK2 kinase--a busy messenger." Nat Rev Mol Cell Biol 2 (12): 877-86. Bartek, J. and J. Lukas (2003). "Chk1 and Chk2 kinases in checkpoint control and cancer." Cancer Cell 3 (5): 421-9.

PAGE 125

113 Baumeister, W., J. Walz, et al. (1998). "The proteasome: paradigm of a selfcompartmentalizing protease." Cell 92 (3): 367-80. Becker-Catania, S. G. and R. A. Gatti (2001) "Ataxia-telangiectasia." Adv Exp Med Biol 495 : 191-8. Bhat, K. P., K. Itahana, et al. (2004). "E ssential role of ribosomal protein L11 in mediating growth inhibitioninduced p53 activation." Embo J 23 (12): 2402-12. Bischoff, J. R., D. H. Kirn, et al. (19 96). "An adenovirus mutant that replicates selectively in p53-deficient human tumor cells." Science 274 (5286): 373-6. Boddy, M. N., P. S. Freemont, et al. (1994). "T he p53-associated protein MDM2 contains a newly characterized zinc-binding do main called the RING finger." Trends Biochem Sci 19 (5): 198-9. Bode, A. M. and Z. Dong (2004). "Posttranslational modification of p53 in tumorigenesis." Nat Rev Cancer 4 (10): 793-805. Boesten, L. S., S. M. Zadelaar, et al. ( 2006). "Mdm2, but not Mdm4, protects terminally differentiated smooth muscle cells from p53-mediated caspase-3-independent cell death." Cell Death Differ 13 (12): 2089-98. Bottger, V., A. Bottger, et al. (1999). "C omparative study of the p53-mdm2 and p53MDMX interfaces." Oncogene 18 (1): 189-99. Bottger, V., A. Bottger, et al (1996). "Identification of novel mdm2 binding peptides by phage display." Oncogene 13 (10): 2141-7. Bouvard, V., T. Zaitchouk, et al (2000). "Tissue and cell-spec ific expression of the p53target genes: bax, fas, mdm2 and wa f1/p21, before and following ionizing irradiation in mice." Oncogene 19 (5): 649-60. Brunet, A., A. Bonni, et al. (1999). "Akt pr omotes cell survival by phosphorylating and inhibiting a Forkhead tran scription factor." Cell 96 (6): 857-68. Brunet, A., F. Kanai, et al. (2002). "14-3-3 transits to the nucleus and participates in dynamic nucleocytoplasmic transport." J Cell Biol 156 (5): 817-28. Bueso-Ramos, C. E., Y. Yang, et al. (1993). "The human MDM-2 oncogene is overexpressed in leukemias." Blood 82 (9): 2617-23.

PAGE 126

114 Bykov, V. J., N. Issaeva, et al. (2002). "Mutant p53-dependent growth suppression distinguishes PRIMA-1 from known anticancer drugs: a statistical analysis of information in the National Cancer Institute database." Carcinogenesis 23 (12): 2011-8. Cahilly-Snyder, L., T. Yang-Feng, et al. (1987) "Molecular analysis and chromosomal mapping of amplified genes isolated from a transformed mouse 3T3 cell line." Somat Cell Mol Genet 13 (3): 235-44. Canman, C. E., D. S. Lim, et al. (1998). "Activation of the ATM kinase by ionizing radiation and phosphorylation of p53." Science 281 (5383): 1677-9. Chang, D., F. Chen, et al. (1999). "Dose-de pendent effects of DNA-damaging agents on p53-mediated cell cycle arre st." Cell Growth Differ 10 (3): 155-62. Chaudhri, M., M. Scarabel, et al. (2003). "Mammalian and yeast 14-3-3 isoforms form distinct patterns of dimers in vivo." Biochem Biophys Res Commun 300 (3): 67985. Chavez-Reyes, A., J. M. Parant, et al. ( 2003). "Switching mechanisms of cell death in mdm2and mdm4-null mice by deletion of p53 downstream targets." Cancer Res 63 (24): 8664-9. Chehab, N. H., A. Malikzay, et al. (2000) "Chk2/hCds1 functions as a DNA damage checkpoint in G(1) by stabilizing p53." Genes Dev 14 (3): 278-88. Chehab, N. H., A. Malikzay, et al. (1 999). "Phosphorylation of Ser-20 mediates stabilization of human p53 in response to DNA damage." Proc Natl Acad Sci U S A 96 (24): 13777-82. Chen, J., V. Marechal, et al. (1993). "M apping of the p53 and mdm-2 interaction domains." Mol Cell Biol 13 (7): 4107-14. Chen, L., D. M. Gilkes, et al. (2005). "ATM and Chk2-de pendent phosphorylation of MDMX contribute to p53 activ ation after DNA damage." Embo J 24 (19): 341122. Chen, L., C. Li, et al. (2005). "Regulation of p53-MDMX interaction by casein kinase 1 alpha." Mol Cell Biol 25 (15): 6509-20. Chipuk, J. E., U. Maurer, et al. (2003). "Pharmacologic activation of p53 elicits Baxdependent apoptosis in the absen ce of transcription." Cancer Cell 4 (5): 371-81.

PAGE 127

115 Cho, Y., S. Gorina, et al. (1994). "Cryst al structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations." Science 265 (5170): 346-55. Colombo, E., J. C. Marine, et al. (2002). "Nucleophosmin regulates the stability and transcriptional activity of p53." Nat Cell Biol 4 (7): 529-33. Cordon-Cardo, C., E. Latres, et al. (1994). "Molecular abnormalities of mdm2 and p53 genes in adult soft tissue sarcomas." Cancer Res 54 (3): 794-9. Cory, S. and J. M. Adams (2002). "The Bcl2 family: regulators of the cellular life-ordeath switch." Nat Rev Cancer 2 (9): 647-56. Craparo, A., R. Freund, et al. (1997). "14-3-3 (epsil on) interacts with the insulin-like growth factor I receptor and insulin receptor substrate I in a phosphoserinedependent manner." J Biol Chem 272 (17): 11663-9. Crawford, T. O. (1998). "Ataxia te langiectasia." Semin Pediatr Neurol 5 (4): 287-94. Cummins, J. M. and B. Vogelstein (2004) "HAUSP is required for p53 destabilization." Cell Cycle 3 (6): 689-92. D'Orazi, G., A. Marchetti, et al. (2000). "Exogenous wt-p53 pr otein is active in transformed cells but not in their non-tra nsformed counterparts: implications for cancer gene therapy without tumor targeting." J Gene Med 2 (1): 11-21. Dai, M. S. and H. Lu (2004). "Inhibition of MDM2-mediated p53 ubiquitination and degradation by ribosomal pr otein L5." J Biol Chem 279 (43): 44475-82. Dai, M. S., D. Shi, et al. (2006). "Regul ation of the MDM2-p53 pathway by ribosomal protein L11 involves a post-ubiquit ination mechanism." J Biol Chem 281 (34): 24304-13. Dai, M. S., S. X. Zeng, et al. (2004). "Ribos omal protein L23 activates p53 by inhibiting MDM2 function in response to ribosomal perturbation but no t to translation inhibition." Mol Cell Biol 24 (17): 7654-68. Dalal, S. N., M. B. Yaffe, et al. (2004). "14-3-3 family members act coordinately to regulate mitotic progr ession." Cell Cycle 3 (5): 672-7. Danovi, D., E. Meulmeester, et al. (2004). "A mplification of Mdmx (or Mdm4) directly contributes to tumor formation by inhi biting p53 tumor suppressor activity." Mol Cell Biol 24 (13): 5835-43. Datta, S. R., A. Katsov, et al. (2000). "14-3-3 protei ns and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation." Mol Cell 6 (1): 41-51.

PAGE 128

116 de Graaf, P., N. A. Little, et al. (2003). "H dmx protein stability is regulated by the ubiquitin ligase activity of Mdm2." J Biol Chem 278 (40): 38315-24. DeLeo, A. B., G. Jay, et al. (1979). "Detection of a transf ormation-related antigen in chemically induced sarcomas and other transformed cells of the mouse." Proc Natl Acad Sci U S A 76 (5): 2420-4. Donehower, L. A., M. Harvey, et al. (1992). "Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours." Nature 356 (6366): 215-21. Donehower, L. A., M. Harvey, et al. (1995). "Effects of genetic background on tumorigenesis in p53-deficient mice." Mol Carcinog 14 (1): 16-22. Dornan, D., I. Wertz, et al. (2004). "The ubiquitin ligase COP1 is a critical negative regulator of p53." Nature 429 (6987): 86-92. Dumaz, N. and D. W. Meek (1999). "S erine15 phosphorylation stimulates p53 transactivation but does not directly in fluence interaction with HDM2." Embo J 18 (24): 7002-10. Duro, D., O. Bernard, et al (1995). "A new type of p16I NK4/MTS1 gene transcript expressed in B-cell malignancies." Oncogene 11 (1): 21-9. el-Deiry, W. S. (1998). "Regulation of p53 downstream genes." Semin Cancer Biol 8 (5): 345-57. el-Deiry, W. S., T. Tokino, et al. (1993) "WAF1, a potential mediator of p53 tumor suppression." Cell 75 (4): 817-25. Fakharzadeh, S. S., S. P. Trusko, et al. (1991) "Tumorigenic potential associated with enhanced expression of a gene that is am plified in a mouse tumor cell line." Embo J 10 (6): 1565-9. Fang, S., J. P. Jensen, et al. (2000). "Mdm2 is a RING finger-depende nt ubiquitin protein ligase for itself and p53." J Biol Chem 275 (12): 8945-51. Ferguson, A. T., E. Evron, et al. (2000). "H igh frequency of hypermethylation at the 143-3 sigma locus leads to gene silencing in breast cancer." Proc Natl Acad Sci U S A 97 (11): 6049-54. Finch, R. A., D. B. Donoviel, et al. (2002). "mdmx is a nega tive regulator of p53 activity in vivo." Cancer Res 62 (11): 3221-5.

PAGE 129

117 Finlay, C. A. (1993). "The mdm-2 oncogene can overcome wild-type p53 suppression of transformed cell growth." Mol Cell Biol 13 (1): 301-6. Forrest, A. and B. Gabrielli (2001). "Cdc25B activity is regulated by 14-3-3." Oncogene 20 (32): 4393-401. Freedman, D. A., C. B. Epstei n, et al. (1997). "A genetic approach to mapping the p53 binding site in the MD M2 protein." Mol Med 3 (4): 248-59. Freedman, D. A. and A. J. Levine (1998). "Nuc lear export is required for degradation of endogenous p53 by MDM2 and human papi llomavirus E6." Mol Cell Biol 18 (12): 7288-93. Friend, S. H., R. Bernards, et al. (1986). "A human DNA segment with properties of the gene that predisposes to retinobl astoma and osteosarcoma." Nature 323 (6089): 643-6. Fu, H., R. R. Subramanian, et al. (2000). "14-3-3 proteins: stru cture, function, and regulation." Annu Rev Pharmacol Toxicol 40 : 617-47. Fukasawa, K. and G. F. Vande Woude (1997). "Synergy between the Mos/mitogenactivated protein kinase pathway and lo ss of p53 function in transformation and chromosome instability." Mol Cell Biol 17 (1): 506-18. Gatz, S. A. and L. Wiesmuller (2006). "p53 in recombination and repair." Cell Death Differ 13 (6): 1003-16. Gilkes, D. M., L. Chen, et al. (2006). "M DMX regulation of p53 response to ribosomal stress." Embo J 25 (23): 5614-25. Greenblatt, M. S., W. P. Be nnett, et al. (1994). "Mutations in the p53 tumor suppressor gene: clues to cancer etiology and mo lecular pathogenesis." Cancer Res 54 (18): 4855-78. Grier, J. D., S. Xiong, et al. (2006). "Ti ssue-specific differences of p53 inhibition by Mdm2 and Mdm4." Mol Cell Biol 26 (1): 192-8. Gu, J., H. Kawai, et al. (2002). "Mutual dependence of MDM2 and MDMX in their functional inactivation of p53." J Biol Chem 277 (22): 19251-4. Gu, W., X. L. Shi, et al. ( 1997). "Synergistic activation of transcription by CBP and p53." Nature 387 (6635): 819-23. Hainaut, P., T. Hernandez, et al. (1998) "IARC Database of p53 gene mutations in

PAGE 130

118 human tumors and cell lines: updated compilation, revised formats and new visualisation tools." Nucleic Acids Res 26 (1): 205-13. Hainaut, P., T. Soussi, et al. (1997). "Datab ase of p53 gene somatic mutations in human tumors and cell lines: updated compilation and future prospects." Nucleic Acids Res 25 (1): 151-7. Hammond, E. M., N. C. Denko, et al. ( 2002). "Hypoxia links ATR and p53 through replication arrest." Mol Cell Biol 22 (6): 1834-43. Hanahan, D. and R. A. Weinberg (2 000). "The hallmarks of cancer." Cell 100 (1): 57-70. Harper, J. W. (2004). "Neddylating the guard ian; Mdm2 catalyzed conjugation of Nedd8 to p53." Cell 118 (1): 2-4. Hatakeyama, M. and R. A. Weinberg (1995). "T he role of RB in ce ll cycle control." Prog Cell Cycle Res 1 : 9-19. Haupt, Y., R. Maya, et al. (1997). "Mdm2 prom otes the rapid degradation of p53." Nature 387 (6630): 296-9. Heffernan, T. P., D. A. Simpson, et al (2002). "An ATRan d Chk1-dependent S checkpoint inhibits replicon initia tion following UVC-induced DNA damage." Mol Cell Biol 22 (24): 8552-61. Heise, C., A. Sampson-Johannes, et al (1997). "ONYX-015, an E1B gene-attenuated adenovirus, causes tumor-specific cytolysi s and antitumoral efficacy that can be augmented by standard chemotherapeutic agents." Nat Med 3 (6): 639-45. Hermeking, H. (2003). "The 14-3-3 cancer connection." Nat Rev Cancer 3 (12): 931-43. Hermeking, H., C. Lengauer, et al. (1997). "14-3-3 sigma is a p53-regulated inhibitor of G2/M progression." Mol Cell 1 (1): 3-11. Hirao, A., A. Cheung, et al. ( 2002). "Chk2 is a tumor suppresso r that regulates apoptosis in both an ataxia telangiectasia mutated (ATM)-dependent and an ATMindependent manner." Mol Cell Biol 22 (18): 6521-32. Hirao, A., Y. Y. Kong, et al. (2000). DNA damage-induced activation of p53 by the checkpoint kinase Chk2." Science 287 (5459): 1824-7. Hochstrasser, M. (1996). "Ubiquitin-depende nt protein degrada tion." Annu Rev Genet 30 : 405-39.

PAGE 131

119 Hollstein, M., D. Sidransky, et al. (1991). "p53 mutations in human cancers." Science 253 (5015): 49-53. Honda, R. and H. Yasuda (2000). "Activity of MDM2, a ubiquitin ligase, toward p53 or itself is dependent on the RING finge r domain of the ligase." Oncogene 19 (11): 1473-6. Hu, B., D. M. Gilkes, et al. (2006). "MDM X overexpression preven ts p53 activation by the MDM2 inhibitor Nutlin." J Biol Chem 281 (44): 33030-5. Inoue, T., L. Wu, et al. (2005). "Control of p53 nuclear accumulation in stressed cells." FEBS Lett 579 (22): 4978-84. Ito, A., C. H. Lai, et al. (2001). "p30 0/CBP-mediated p53 acet ylation is commonly induced by p53-activating agents an d inhibited by MDM2." Embo J 20 (6): 133140. Jackson, M. W. and S. J. Berberich (1999). "Constitutive mdmx expression during cell growth, differentiation, and DNA damage." DNA Cell Biol 18 (9): 693-700. Jackson, M. W. and S. J. Berberich (2000) "MdmX protects p53 from Mdm2-mediated degradation." Mol Cell Biol 20 (3): 1001-7. Jackson, M. W., M. S. Lindstrom, et al. (2001). "MdmX binding to ARF affects Mdm2 protein stability and p53 tran sactivation." J Biol Chem 276 (27): 25336-41. Jallepalli, P. V., C. Lengauer et al. (2003). "The Chk2 tumo r suppressor is not required for p53 responses in human cancer cells." J Biol Chem 278 (23): 20475-9. Jiang, K., E. Pereira, et al (2003). "Regulation of Chk1 in cludes chromatin association and 14-3-3 binding following phosphoryl ation on Ser-345." J Biol Chem 278 (27): 25207-17. Jin, A., K. Itahana, et al. (2004). "Inhibit ion of HDM2 and activation of p53 by ribosomal protein L23." Mol Cell Biol 24 (17): 7669-80. Jin, Y., M. S. Dai, et al. (2006). "14-3-3ga mma binds to MDMX that is phosphorylated by UV-activated Chk1, resulting in p53 activation." Embo J 25 (6): 1207-18. Jones, D. H., S. Ley, et al. (1995). "Isofo rms of 14-3-3 protein can form homoand heterodimers in vivo and in vitro: implicat ions for function as adapter proteins." FEBS Lett 368 (1): 55-8.

PAGE 132

120 Jones, D. H., H. Martin, et al. (1995). "Expression and st ructural analysis of 14-3-3 proteins." J Mol Biol 245 (4): 375-84. Jones, S. N., A. R. Hancock, et al. (1998). "Overexpression of Mdm2 in mice reveals a p53-independent role for Mdm2 in tumo rigenesis." Proc Natl Acad Sci U S A 95 (26): 15608-12. Jones, S. N., A. E. Roe, et al. (1995). "Res cue of embryonic lethality in Mdm2-deficient mice by absence of p53." Nature 378 (6553): 206-8. Kamijo, T., J. D. Weber, et al. (1998). "Func tional and physical inte ractions of the ARF tumor suppressor with p53 and Mdm2." Proc Natl Acad Sci U S A 95 (14): 82927. Kastan, M. B. and D. S. Li m (2000). "The many substrates and functions of ATM." Nat Rev Mol Cell Biol 1 (3): 179-86. Kawai, H., D. Wiederschain, et al. (2003) "DNA damage-induced MDMX degradation is mediated by MDM2." J Biol Chem 278 (46): 45946-53. Khanna, K. K., K. E. Keating, et al. (1998) "ATM associates with and phosphorylates p53: mapping the region of interaction." Nat Genet 20 (4): 398-400. Kobet, E., X. Zeng, et al. (2000). "MDM2 inhibits p300-mediated p53 acetylation and activation by forming a ternary complex w ith the two proteins." Proc Natl Acad Sci U S A 97 (23): 12547-52. Kopnin, B. P. (2000). "Targets of oncogenes and tumor suppressors: key for understanding basic mechanisms of carcinogenesis." Biochemistry (Mosc) 65 (1): 2-27. Korgaonkar, C., J. Hagen, et al. (2005). "N ucleophosmin (B23) targets ARF to nucleoli and inhibits its func tion." Mol Cell Biol 25 (4): 1258-71. Kubbutat, M. H., S. N. Jones, et al. (1997) "Regulation of p53 stability by Mdm2." Nature 387 (6630): 299-303. Kulikov, R., M. Winter, et al. (2006). "Binding of p53 to the central domain of Mdm2 is regulated by phosphoryl ation." J Biol Chem 281 (39): 28575-83. Kussie, P. H., S. Gorina, et al. (1996). "S tructure of the MDM2 oncoprotein bound to the p53 tumor suppressor transact ivation domain." Science 274 (5289): 948-53.

PAGE 133

121 Kuwana, T., M. R. Mackey, et al. (2002) "Bid, Bax, and lipids cooperate to form supramolecular openings in the outer mitochondrial membrane." Cell 111 (3): 331-42. Lai, Z., T. Yang, et al. (2002). "Different iation of Hdm2-mediated p53 ubiquitination and Hdm2 autoubiquitination activity by small molecular weight inhibitors." Proc Natl Acad Sci U S A 99 (23): 14734-9. Lambert, P. F., F. Kashanchi, et al. (1998) "Phosphorylation of p53 serine 15 increases interaction with CBP." J Biol Chem 273 (49): 33048-53. Lane, D. P. (1992). "Cancer. p53, guardian of the genome." Nature 358 (6381): 15-6. Lane, D. P. and L. V. Crawford (1979). "T antigen is bound to a host protein in SV40transformed cells." Nature 278 (5701): 261-3. Laurie, N. A., S. L. Donovan, et al. ( 2006). "Inactivation of the p53 pathway in retinoblastoma." Nature 444 (7115): 61-6. LeBron, C., L. Chen, et al. (2006). "Re gulation of MDMX nuclear import and degradation by Chk2 and 14-3-3." Embo J 25 (6): 1196-206. Leng, R. P., Y. Lin, et al. (2003). "Pir h2, a p53-induced ubiquitin-protein ligase, promotes p53 degradation." Cell 112 (6): 779-91. Levine, A. J., J. Momand, et al. (1991). "The p53 tumour suppressor gene." Nature 351 (6326): 453-6. Li, C., L. Chen, et al. (2002). "DNA dama ge induces MDMX nuclear translocation by p53-dependent and -independent mechanisms." Mol Cell Biol 22 (21): 7562-71. Li, M., C. L. Brooks, et al. (2004). "A dynamic role of HAUSP in the p53-Mdm2 pathway." Mol Cell 13 (6): 879-86. Li, M., D. Chen, et al. (2002). "Deubiqui tination of p53 by HAUSP is an important pathway for p53 stabilization." Nature 416 (6881): 648-53. Liang, S. H. and M. F. Clarke (2001). "R egulation of p53 localization." Eur J Biochem 268 (10): 2779-83. Lill, N. L., S. R. Grossman, et al. (19 97). "Binding and modulation of p53 by p300/CBP coactivators." Nature 387 (6635): 823-7.

PAGE 134

122 Lin, J., J. Chen, et al. (1994). "Several hydrophobic amino acids in the p53 aminoterminal domain are required for transc riptional activation, binding to mdm-2 and the adenovirus 5 E1B 55-kD protein." Genes Dev 8 (10): 1235-46. Lin, Y., W. Ma, et al. (2000) "Pidd, a new death-domain-c ontaining protein, is induced by p53 and promotes apoptosis." Nat Genet 26 (1): 122-7. Linares, L. K., A. Hengstermann, et al (2003). "HdmX stimulates Hdm2-mediated ubiquitination and degradation of p53." Proc Natl Acad Sci U S A 100 (21): 12009-14. Linzer, D. I. and A. J. Levine (1979). "C haracterization of a 54K dalton cellular SV40 tumor antigen present in SV40-transf ormed cells and uninfected embryonal carcinoma cells." Cell 17 (1): 43-52. Linzer, D. I., W. Maltzman, et al. (1979). "The SV40 A gene product is required for the production of a 54,000 MW cellular tumor antigen." Virology 98 (2): 308-18. Liu, F., J. J. Stanton, et al. (1997). "The hum an Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and localizes to the endoplasmic reticulum and Golgi complex." Mol Cell Biol 17 (2): 571-83. Liu, L., K. M. McBride, et al. (2005). "STAT3 nuclear import is independent of tyrosine phosphorylation and mediated by importin-a lpha3." Proc Natl Acad Sci U S A 102 (23): 8150-5. Lohrum, M. A., M. Ashcroft, et al. (2000) "Identification of a cryptic nucleolarlocalization signal in MDM2." Nat Cell Biol 2 (3): 179-81. Lohrum, M. A., R. L. Ludwig, et al. (2003). "Regulation of HDM2 activity by the ribosomal protein L11." Cancer Cell 3 (6): 577-87. Lundgren, K., R. Montes de Oca Luna, et al (1997). "Targeted e xpression of MDM2 uncouples S phase from mitosis and i nhibits mammary gland development independent of p53." Genes Dev 11 (6): 714-25. Luo, J., F. Su, et al. (2000). "Deacetylation of p53 modulates its effect on cell growth and apoptosis." Nature 408 (6810): 377-81. Lyman, S. K. and L. Gerace (2001). "Nuclear pore complexes: dynamics in unexpected places." J Cell Biol 154 (1): 17-20. Malkin, D., F. P. Li, et al (1990). "Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms." Science 250 (4985): 1233-8.

PAGE 135

123 Marechal, V., B. Elenbaas, et al. (1994). "The ribosomal L5 protein is associated with mdm-2 and mdm-2-p53 complexes." Mol Cell Biol 14 (11): 7414-20. Martin, K., D. Trouche, et al (1995). "Regulation of transc ription by E2F1/DP1." J Cell Sci Suppl 19 : 91-4. Mayo, L. D., J. J. Turchi, et al. (1997 ). "Mdm-2 phosphorylation by DNA-dependent protein kinase prevents interaction with p53." Cancer Res 57 (22): 5013-6. McGowan, C. H. (2002). "Checking in on Cd s1 (Chk2): A checkpoint kinase and tumor suppressor." Bioessays 24 (6): 502-11. Meek, D. W. (2004). "The p53 response to DNA damage." DNA Repair (Amst) 3 (8-9): 1049-56. Melchior, F. and L. Hengst ( 2002). "SUMO-1 and p53." Cell Cycle 1 (4): 245-9. Mendrysa, S. M., K. A. O'Leary, et al. ( 2006). "Tumor suppression and normal aging in mice with constitutively high p53 activity." Genes Dev 20 (1): 16-21. Meulmeester, E., M. M. Maurice, et al. (2005). "Loss of HAUSP-mediated deubiquitination contributes to DNA dama ge-induced destabilization of Hdmx and Hdm2." Mol Cell 18 (5): 565-76. Meulmeester, E., Y. Pereg, et al. (20 05). "ATM-mediated phosphorylations inhibit Mdmx/Mdm2 stabilization by HAUSP in favor of p53 activation." Cell Cycle 4 (9): 1166-70. Migliorini, D., D. Danovi, et al. (2002). "Hdmx recruitment into the nucleus by Hdm2 is essential for its ability to regulate p53 stability and tr ansactivation." J Biol Chem 277 (9): 7318-23. Milton, A. H., N. Khaire, et al. (2006). "143-3 proteins integrate E2F activity with the DNA damage response." Embo J 25 (5): 1046-57. Miyashita, T., S. Krajewski, et al. (1994). "Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo." Oncogene 9 (6): 1799-805. Momand, J., G. P. Zambetti, et al. (1 992). "The mdm-2 oncogene product forms a complex with the p53 protein and inhib its p53-mediated tran sactivation." Cell 69 (7): 1237-45. Montes de Oca Luna, R., D. S. Wagner, et al. (1995). "Rescue of early embryonic lethality in mdm2-deficient mice by deletion of p53." Nature 378 (6553): 203-6.

PAGE 136

124 Muller, M., S. Wilder, et al. (1998). "p53 activates the CD95 (APO-1/Fas) gene in response to DNA damage by an ticancer drugs." J Exp Med 188 (11): 2033-45. Nakamura, S., J. A. Roth, et al. (2000). "M ultiple lysine mutations in the C-terminal domain of p53 interfere with MDM2-dependent protein degradation and ubiquitination." Mol Cell Biol 20 (24): 9391-8. Nakano, K. and K. H. Vousden (2001). "PUM A, a novel proapoptotic gene, is induced by p53." Mol Cell 7 (3): 683-94. Nguyen, A., D. M. Rothman, et al. (2004). "Caged phosphopeptides reveal a temporal role for 14-3-3 in G1 arrest and Sphase checkpoint func tion." Nat Biotechnol 22 (8): 993-1000. Nomura, M., S. Shimizu, et al. (2003). "143-3 Interacts directly with and negatively regulates pro-apoptotic Bax." J Biol Chem 278 (3): 2058-65. O'Neill, T., L. Giarratani, et al. (2002). "Determination of substrate motifs for human Chk1 and hCds1/Chk2 by the oriented pep tide library approach." J Biol Chem 277 (18): 16102-15. Obsil, T., R. Ghirlando, et al. (2001). "Cryst al structure of the 14-3-3zeta:serotonin Nacetyltransferase complex. a role for s caffolding in enzyme regulation." Cell 105 (2): 257-67. Oda, E., R. Ohki, et al. (2000). "Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-i nduced apoptosis." Science 288 (5468): 1053-8. Okamoto, K., K. Kashima, et al. (200 5). "DNA damage-induced phosphorylation of MdmX at serine 367 activates p53 by targeting MdmX for Mdm2-dependent degradation." Mol Cell Biol 25 (21): 9608-20. Oliner, J. D., K. W. Kinzler, et al. (1 992). "Amplification of a gene encoding a p53associated protein in human sarcomas." Nature 358 (6381): 80-3. Oliner, J. D., J. A. Pietenpol, et al. (1993) "Oncoprotein MDM2 c onceals the activation domain of tumour suppressor p53." Nature 362 (6423): 857-60. Owen-Schaub, L. B., W. Zhang, et al. (1995) "Wild-type human p53 and a temperaturesensitive mutant induce Fas/AP O-1 expression." Mol Cell Biol 15 (6): 3032-40. Pan, Y. and J. Chen (2003). "MDM2 prom otes ubiquitination and degradation of MDMX." Mol Cell Biol 23 (15): 5113-21.

PAGE 137

125 Parant, J., A. Chavez-Reyes, et al. (2001). "Rescue of embryonic lethality in Mdm4-null mice by loss of Trp53 suggests a nonoverlapping pathway with MDM2 to regulate p53." Nat Genet 29 (1): 92-5. Peng, Y., L. Chen, et al. (2001). "Stabili zation of the MDM2 oncoprotein by mutant p53." J Biol Chem 276 (9): 6874-8. Peng, Y., L. Chen, et al. (2001). "Inhibiti on of MDM2 by hsp90 contributes to mutant p53 stabilization." J Biol Chem 276 (44): 40583-90. Pereg, Y., S. Lam, et al. (2006). "Differe ntial roles of ATMand Chk2-mediated phosphorylations of Hdmx in response to DNA damage." Mol Cell Biol 26 (18): 6819-31. Pereg, Y., D. Shkedy, et al. (2005). "Phosphorylation of Hdmx mediates its Hdm2and ATM-dependent degradation in response to DNA damage." Proc Natl Acad Sci U S A 102 (14): 5056-61. Petosa, C., S. C. Masters, et al. (1998). 14-3-3zeta binds a phosphorylated Raf peptide and an unphosphorylated peptide via its c onserved amphipathic groove." J Biol Chem 273 (26): 16305-10. Pickart, C. M. (2001). "Mechanisms unde rlying ubiquitination." Annu Rev Biochem 70 : 503-33. Pomerantz, J., N. Schreiber-Agus, et al. (1998). "The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53." Cell 92 (6): 713-23. Rallapalli, R., G. Strachan, et al. (1999). "A novel MDMX transcript expressed in a variety of transformed cell lines enc odes a truncated prot ein with potent p53 repressive activity." J Biol Chem 274 (12): 8299-308. Ramos, Y. F., R. Stad, et al. (2001). "Abe rrant expression of HDM X proteins in tumor cells correlates with wild-type p53." Cancer Res 61 (5): 1839-42. Rodriguez, M. S., J. M. Desterro, et al. (2000). "Multiple C-terminal lysine residues target p53 for ubiquitin-proteasome-me diated degradation." Mol Cell Biol 20 (22): 8458-67.

PAGE 138

126 Roth, J., M. Dobbelstein, et al. (1998). "N ucleo-cytoplasmic sh uttling of the hdm2 oncoprotein regulates the le vels of the p53 protein via a pathway used by the human immunodeficiency vi rus rev protein." Embo J 17 (2): 554-64. Roth, J., C. Konig, et al. (1998). "Inactiv ation of p53 but not p73 by adenovirus type 5 E1B 55-kilodalton and E4 34-kilodalton oncoproteins." J Virol 72 (11): 8510-6. Roth, J. A. (1996). "Gene replacement st rategies for cancer." Isr J Med Sci 32 (2): 89-94. Samuel, T., H. O. Weber, et al. (2001). "The G2/M regulator 14-3-3sigma prevents apoptosis through sequestrati on of Bax." J Biol Chem 276 (48): 45201-6. Scheffner, M., B. A. Werness, et al. ( 1990). "The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promot es the degradation of p53." Cell 63 (6): 1129-36. Seimiya, H., H. Sawada, et al. (2000). "I nvolvement of 14-3-3 proteins in nuclear localization of telomerase." Embo J 19 (11): 2652-61. Semple, C. A. (2003). "The comparative proteomics of ubiquitination in mouse." Genome Res 13 (6B): 1389-94. Seto, E., A. Usheva, et al. (1992). "Wild-type p53 binds to the TATA-binding protein and represses transcription." Proc Natl Acad Sci U S A 89 (24): 12028-32. Sharp, D. A., S. A. Kratowicz, et al. (1999) "Stabilization of the MDM2 oncoprotein by interaction with the structurally related MDMX protein." J Biol Chem 274 (53): 38189-96. Sharpless, N. E. (2005). "INK4a/ARF: a mu ltifunctional tumor suppressor locus." Mutat Res 576 (1-2): 22-38. Sherr, C. J. (2001). "The INK4a/ARF networ k in tumour suppression." Nat Rev Mol Cell Biol 2 (10): 731-7. Shieh, S. Y., M. Ikeda, et al. (1997). "DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2." Cell 91 (3): 325-34. Shiloh, Y. (2003). "ATM: rea dy, set, go." Cell Cycle 2 (2): 116-7. Shvarts, A., M. Bazuine, et al. (1997). "Isolation and identification of the human homolog of a new p53-binding protein, Mdmx." Genomics 43 (1): 34-42. Shvarts, A., W. T. Steegenga, et al. ( 1996). "MDMX: a novel p53-bi nding protein with some functional propert ies of MDM2." Embo J 15 (19): 5349-57.

PAGE 139

127 Sigal, A. and V. Rotter (2000). "Oncogenic mutations of the p53 tumor suppressor: the demons of the guardian of the genome." Cancer Res 60 (24): 6788-93. Srivastava, S., Z. Q. Zou, et al. (1990). "Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome." Nature 348 (6303): 747-9. Stad, R., N. A. Little, et al. (2001). "Mdmx stabilizes p53 and Mdm2 via two distinct mechanisms." EMBO Rep 2 (11): 1029-34. Stad, R., Y. F. Ramos, et al. (2000). "H dmx stabilizes Mdm2 and p53." J Biol Chem 275 (36): 28039-44. Stavridi, E. S., N. H. Chehab, et al. (2001) "Substitutions that compromise the ionizing radiation-induced associati on of p53 with 14-3-3 protei ns also compromise the ability of p53 to induce cell cycle arrest." Cancer Res 61 (19): 7030-3. Steinman, H. A., K. M. Hoover, et al. (2005) "Rescue of Mdm4-def icient mice by Mdm2 reveals functional overlap of Mdm2 and Mdm4 in development." Oncogene 24 (53): 7935-40. Stewart, M. (2003). "Structural biol ogy. Nuclear trafficking." Science 302 (5650): 1513-4. Stommel, J. M., N. D. Marchenko, et al. (1999) "A leucine-rich nucle ar export signal in the p53 tetramerization domain: regulati on of subcellular localization and p53 activity by NES masking." Embo J 18 (6): 1660-72. Stommel, J. M. and G. M. Wahl (2005). "A new twist in the f eedback loop: stressactivated MDM2 destabili zation is required for p53 activation." Cell Cycle 4 (3): 411-7. Stott, F. J., S. Bates, et al. (1998). "The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2." Embo J 17 (17): 5001-14. Su, T. T., D. H. Parry, et al. (2001). "Cell cycle roles fo r two 14-3-3 proteins during Drosophila development." J Cell Sci 114 (Pt 19): 3445-54. Takahashi, K., H. Sumimoto, et al. (1993). "Protein synt hesis-dependent cytoplasmic translocation of p53 protei n after serum stimulation of growth-arrested MCF-7 cells." Mol Carcinog 8 (1): 58-66.

PAGE 140

128 Takai, H., K. Naka, et al. (2002). "Chk2deficient mice exhibit radioresistance and defective p53-mediated transcription." Embo J 21 (19): 5195-205. Tan, T. H., J. Wallis, et al. (1986). "Identif ication of the p53 protein domain involved in formation of the simian virus 40 large T-antigen-p53 protein complex." J Virol 59 (3): 574-83. Tanimura, S., S. Ohtsuka, et al. (1999). "MDM2 interacts with MDMX through their RING finger domains." FEBS Lett 447 (1): 5-9. Tao, W. and A. J. Levine (1999). "Nucleoc ytoplasmic shuttling of oncoprotein Hdm2 is required for Hdm2-mediated degradati on of p53." Proc Natl Acad Sci U S A 96 (6): 3077-80. Thut, C. J., J. A. Goodrich, et al. (1997). "Repression of p53-mediated transcription by MDM2: a dual mechanism." Genes Dev 11 (15): 1974-86. Tzivion, G., V. S. Gupta, et al. (2006). "143-3 proteins as potential oncogenes." Semin Cancer Biol 16 (3): 203-13. Tzivion, G., Z. Luo, et al. (1998). "A dimeric 14-3-3 protein is an e ssential cofactor for Raf kinase activity." Nature 394 (6688): 88-92. Tzivion, G., Y. H. Shen, et al. (2001). "14-3-3 proteins; bringing new definitions to scaffolding." Oncogene 20 (44): 6331-8. Ueda, H., S. J. Ullrich, et al. (1995). "Functional inactivati on but not structural mutation of p53 causes liver cancer." Nat Genet 9 (1): 41-7. Vassilev, L. T. (2004). "Small-molecule an tagonists of p53-MDM2 binding: research tools and potential therapeutics." Cell Cycle 3 (4): 419-21. Vassilev, L. T. (2005). "p53 Activation by sma ll molecules: applic ation in oncology." J Med Chem 48 (14): 4491-9. Vassilev, L. T., B. T. Vu, et al. (2004). "I n vivo activation of the p53 pathway by smallmolecule antagonists of MDM2." Science 303 (5659): 844-8. Vogelstein, B., D. Lane, et al. ( 2000). "Surfing the p53 network." Nature 408 (6810): 30710. Vousden, K. H. and X. Lu (2002). "Live or le t die: the cell's response to p53." Nat Rev Cancer 2 (8): 594-604.

PAGE 141

129 Wang, B., K. Liu, et al. (2004). "A role fo r 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis." J Biol Chem 279 (52): 54140-52. Wang, H. G., N. Pathan, et al. (1999). "Ca2+-induced a poptosis through calcineurin dephosphorylation of BAD." Science 284 (5412): 339-43. Wang, T., K. Lee, et al. (2007). "PRIMA-1 induces apoptosis by i nhibiting JNK signaling but promoting the activation of Bax." Biochem Biophys Res Commun 352 (1): 203-12. Wang, X., T. Arooz, et al. (2001). "MDM2 and MDMX can interact differently with ARF and members of the p53 family." FEBS Lett 490 (3): 202-8. Wang, X., N. Grammatikakis, et al. (2003). "R egulation of molecular chaperone gene transcription involves the serine pho sphorylation, 14-3-3 epsilon binding, and cytoplasmic sequestration of heat shock factor 1." Mol Cell Biol 23 (17): 6013-26. Wang, Y. K., B. Das, et al. (2004). "Role of the 14-3-3 prot ein in carbon metabolism of the pathogenic yeast Candida albicans." Yeast 21 (8): 685-702. Waterman, M. J., E. S. Stavridi, et al (1998). "ATM-depende nt activation of p53 involves dephosphorylation and associati on with 14-3-3 proteins." Nat Genet 19 (2): 175-8. Weber, J. D., L. J. Taylor, et al. (1999). "Nucleolar Arf sequester s Mdm2 and activates p53." Nat Cell Biol 1 (1): 20-6. Weis, K. (2003). "Regulating access to the genome: nucleocytoplasmic transport throughout the cell cycle." Cell 112 (4): 441-51. Wilker, E. and M. B. Yaffe (2004). "143-3 Proteins--a focus on cancer and human disease." J Mol Cell Cardiol 37 (3): 633-42. Wojcik, C. and G. N. DeMartino (2003). "Int racellular localization of proteasomes." Int J Biochem Cell Biol 35 (5): 579-89. Wu, G. and S. Yan (2003). "Determination of amino acid pairs in human p53 protein sensitive to mutations/variants by means of a random approach." J Mol Model 9 (5): 337-41. Wu, G. S., T. F. Burns, et al. (1997). "KILLER/DR5 is a DNA damage-inducible p53regulated death recepto r gene." Nat Genet 17 (2): 141-3. Wu, X., J. H. Bayle, et al. (1993). "The p53-mdm-2 autoregulatory feedback loop."

PAGE 142

130 Genes Dev 7 (7A): 1126-32. Xiao, Z. X., J. Chen, et al. (1995). "Inter action between the reti noblastoma protein and the oncoprotein MDM2." Nature 375 (6533): 694-8. Xiong, S., C. S. Van Pelt, et al. (2006). "S ynergistic roles of Md m2 and Mdm4 for p53 inhibition in central nerv ous system development." Proc Natl Acad Sci U S A 103 (9): 3226-31. Xirodimas, D. P., M. K. Saville, et al. (2004). "Mdm2-mediated NEDD8 conjugation of p53 inhibits its transcri ptional activity." Cell 118 (1): 83-97. Yaffe, M. B., K. Rittinger, et al. (1997). "T he structural basis for 14-3-3:phosphopeptide binding specificity." Cell 91 (7): 961-71. Yang, A. and F. McKeon (2000). "P63 and P73: P53 mimics, menaces and more." Nat Rev Mol Cell Biol 1 (3): 199-207. Yang, C. T., L. You, et al. (2001). "p14(ARF) modulates the cytoly tic effect of ONYX015 in mesothelioma cells with wild-type p53." Cancer Res 61 (16): 5959-63. Yang, H. Y., Y. Y. Wen, et al. (2003). 14-3-3 sigma positively regulates p53 and suppresses tumor growth." Mol Cell Biol 23 (20): 7096-107. Yang, Y., R. L. Ludwig, et al. (2005). "Small molecule i nhibitors of HDM2 ubiquitin ligase activity stabilize and activ ate p53 in cells." Cancer Cell 7 (6): 547-59. Yang, Y. and X. Yu (2003). "Regulation of apoptosis: the ubiquitous way." Faseb J 17 (8): 790-9. Yew, P. R. and A. J. Berk (1992). "Inhi bition of p53 transactivation required for transformation by adenovirus early 1B protein." Nature 357 (6373): 82-5. Yonish-Rouach, E., D. Resnitzky, et al. ( 1991). "Wild-type p53 induces apoptosis of myeloid leukaemic cells that is inhibited by interleukin-6." Nature 352 (6333): 345-7. Zdrojewski, A., L. Dubois, et al. (1967) "Column chromatography and spectroscopy in the analysis of airborne polycyclics." J Chromatogr 28 (2): 317-25. Zha, J., H. Harada, et al. (1996). "Serin e phosphorylation of d eath agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L)." Cell 87 (4): 619-28.

PAGE 143

131 Zhang, Y., G. W. Wolf, et al. (2003). "Ribosomal protei n L11 negatively regulates oncoprotein MDM2 and mediates a p53-de pendent ribosomal-stress checkpoint pathway." Mol Cell Biol 23 (23): 8902-12. Zhang, Y. and Y. Xiong (1999). "Mutations in human ARF exon 2 di srupt its nucleolar localization and impair it s ability to block nuclear export of MDM2 and p53." Mol Cell 3 (5): 579-91. Zhang, Y. and Y. Xiong (2001). "Control of p53 ubiquitination and nuclear export by MDM2 and ARF." Cell Growth Differ 12 (4): 175-86. Zhang, Y., Y. Xiong, et al. (1998). "ARF prom otes MDM2 degrada tion and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways." Cell 92 (6): 725-34.

PAGE 144

ABOUT THE AUTHOR Cynthia LeBron attended the University of South Florida from 1996-2001, where she received her bachelors of Science degree in Biology. She then worked as a technician in Dr. George Blanck’s laboratory at the College of Medicine in the Molecular Biology and Biochemistry department for two years. Af terwards she was accep ted into the Cancer Biology program in 2002 and began her research in Dr. Jiandong Chen’s laboratory at the Moffitt Cancer Center. Cynthia participated in numerous outside meeting and student research retreats, where she was awarded Over all Best Student Pres entation. She also received a five year supplement for $35,000 fr om the National Institu te of Health to conduct her thesis work. Cynthi a will continue her research in the field of cancer as a postdoctoral fellow at Johns Hopkins Hospital in the laboratory of Dr. David Sidransky.