USF Libraries
USF Digital Collections

Androgen receptors in the bonnethead shark, Sphyrna tiburo

MISSING IMAGE

Material Information

Title:
Androgen receptors in the bonnethead shark, Sphyrna tiburo cDNA cloning and tissue-specific expression in the male reproductive tract
Physical Description:
Book
Language:
English
Creator:
Tyminski, John P
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
Androgen receptor
Steroid hormone
Polymerase chain reaction
Immunocytochemistry
mRNA probe
Dissertations, Academic -- Biology -- Masters -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Androgens and the androgen receptor (AR) play important roles in virilization, spermatogenesis, and sexual behavior in vertebrates. An understanding of the distribution and levels of expression of the ARs on the cellular and tissue level demonstrates the pattern of responsiveness to the androgenic hormones in a given organism. In this study, a fragment of the AR gene was cloned and sequenced from the bonnethead shark, Sphyrna tiburo, an elasmobranch species with a well-defined annual reproductive cycle. Acquiring this gene sequence facilitated the construction of species-specific AR polymerase chain reaction (PCR) primers and species-specific AR mRNA probes that were used to screen reproductive tissues for evidence of AR gene expression using reverse transcription (RT)-PCR and in situ hybridization (ISH), respectively. The RT-PCR screens demonstrated AR gene expression in the testes, epididymides, seminal vesicles, and claspers of male sharks.^ ^The use of relative PCR revealed that these organs have variable levels of AR gene expression that significantly differ with the stage of the shark's seasonal reproductive cycle. ISH results localized the AR RNA in the interstitial cells, Sertoli cells, and developing sperm of the testes, and mature spermatozoa within the seminal vesicles and the epididymides. Immunocytochemical methods used to detect the AR protein using a rabbit polyclonal antibody, PG-21, produced comparable results in the shark testes but did not yield positive results in the seminal vesicles or the epididymides. However, the Leydig gland, whose secretions contribute to the seminal fluid, demonstrated consistent AR immunoreactivity. Results of ICC in male and female embryos of S. tiburo revealed AR protein in the developing kidney but not in the embryonic reproductive structures. By characterizing AR distribution in the reproductive tract of male S.^ tiburo, this study provides the basis for future research on the direct and indirect effects of androgenic hormones in this species.
Thesis:
Thesis (M.S.)--University of South Florida, 2007.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by John P. Tyminski.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 86 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001967679
oclc - 263869532
usfldc doi - E14-SFE0002128
usfldc handle - e14.2128
System ID:
SFS0026446:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Androgen Receptors in the Bonnethead Shark, Sphyrna tiburo : cDNA Cloning and Tissue-Specific Expressi on in the Male Reproductive Tract by John P. Tyminski A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science Department of Biology College of Arts and Sciences University of South Florida Major Professor: Philip J. Motta, Ph.D. James J. Gelsleichter, Ph.D. Jessica L. Moore, Ph.D. Date of Approval: July 19, 2007 Keywords: androgen recept or, steroid hormone, pol ymerase chain reaction, immunocytochemistry, mRNA probe Copyright 2007, John P. Tyminski

PAGE 2

Dedication To April, Matty, and the little person that is about to enter our lives

PAGE 3

Acknowledgements I would like to take this oppor tunity to convey my heartfel t gratitude to my family, friends, and colleagues for their support on this journey. Firs t and foremost, I must thank my wife, April, for not only her unwavering l ove and encouragement but for her patience. She’s made a lot of sacrifices for me while I finish this up. I am indebted to Dr. Kumar Mahadevan and Mote Marine Laboratory for their support of my efforts to earn this degree. I am sincerely grat eful to Bob Hueter for provi ding me the flexibility, the freedom, and the environment needed to get th is done. I have been helped in many ways by the exceptional staff and interns at the Ce nter for Shark Research including Cristal Ange, Stephanie Leggett, Chip Collie, Carl Luer, Charlie Manire, and Cathy Walsh. I also want to thank Dr. Gail Prins and Lynn Birc h at the University of Illinois at Chicago for their generous donation of the AR21 and AR462 peptides and Dr. Elizabeth Wilson of the University of North Carolina for her donati on of the AR52 antibody. I wish to also acknowledge that many of my samples were acquired through field collections from unrelated projects that were funded thr ough agencies such as NOAA/NMFS (to the National Shark Research Consortium), the Environmental Protection Agency, and the Mote Scientific Foundation. I am indebted to my graduate committee for their time, patience, and guidance along the way. I wish to thank Dr. Jonathan Lindzey for helping to initiate this project and for indoctrinati ng me into the world of molecular biology. Dr. Jefferey Yoder also provided support and useful assistance. I wish to express my sincere

PAGE 4

thanks to Dr. Jessica Moore for her very helpful advice along the way and insightful comments to improve this manuscript. I owe a lot to Dr. Phil Motta who welcomed me into his lab when my options were few. A nd despite having a projec t that strayed from his many areas of expertise, his insight, advi ce, and patience have b een invaluable. And finally I owe tremendous thanks to Dr. James J. Gelsleichter. Jimmy G, you’ve managed to balance being a skilled advisor while at th e same time being a great friend. That has not been an easy task at times I’m sure. I am very grateful to have had the opportunity to work so closely with you.

PAGE 5

i Table of Contents List of Tables iv List of Figures v Abstract vii Introduction 1 Steroid Hormones 1 Androgenic Hormones 1 Androgen Receptors 2 Elasmobranchs 7 Steroids/Androgens in Elasmobranchs 9 Objectives of this Study 11 Materials and Methods 13 Sample Collection 13 Cloning AR cDNA 15 RNA Extraction and cDNA Synthesis 15 PCR Primer Development 16 PCR Conditions 17 Cloning and Sequencing 17 PCR for Evaluating AR 18 Isolation of Total RNA and Reverse Transcription 18

PAGE 6

ii Bonnethead Shark Specific Primers and AR Screening 18 Relative PCR to Quantify AR Gene Expression 19 In Situ Hybridization 21 Probe Labeling 21 Preparation of Tissue Sections 21 Pretreatment of Slides 22 Prehybridization, Hybridizat ion, and Post Hybridization 22 Immunological Detection 22 Detection of AR Protein Using Immunocytochemistry 23 Histology 23 Immunocytochemistry 23 Immunoblotting 25 Northern Blotting 26 Results 28 Androgen Receptor Cloning and Sequencing 28 AR Screening and Semi-Quantification by RT-PCR 33 Northern Blotting 38 In Situ Hybridization 38 Immunoblotting 38 Immunocytochemistry 46 Antibody Validation 46 AR Protein Detection 46

PAGE 7

iii Discussion 56 Testis 57 Epididymis 60 Seminal Vesicle 62 Spermatozoa 63 Claspers 65 Embryos 67 Heart 67 Steroid Hormones 68 Future Directions 69 Conclusions 72 References 74 Appendices 84 Appendix I Species with published a ndrogen receptor sequences that were aligned (Block Maker) and analyzed (CODEHOP) to develop degenerate primers for this study 85 Appendix II Recipe for 100 ml elasmobranch-modified phosphate buffered saline (E-PBS) 86 Appendix III Recipe for 1 ml of hybridization buffer 87

PAGE 8

iv List of Tables Table 1 Examples of vertebrate non-mammalian studies demonstrating presence of ARs 5 Table 2 Examples of vertebrate ma mmalian studies demonstrating presence of ARs 6 Table 3 Summary of organs tissues, and cells of Sphyrna tiburo that were evaluated for the presence of the androgen receptor using PCR screening, immunocytochemistry (ICC), and in situ hybridization (ISH) 29

PAGE 9

v List of Figures Figure 1 Structure of the ty pical androgen receptor 3 Figure 2 Map of Florida demonstrating the collection sites used in this study 14 Figure 3 Nucleotide and deduced amino acid sequence of the cloned androgen receptor gene fragme nt from the bonnethead shark ( Sphyrna tiburo ) 30 Figure 4 Comparison of the deduced am ino acid sequences of the cloned Sphyrna tiburo androgen receptor along with examples from 8 other species 31 Figure 5 Nucleotide and deduced amino acid sequences of the cloned actin gene fragment from Sphyrna tiburo 32 Figure 6 Screening of androgen receptor mRNA in tissues/organs of Sphyr na tiburo using Titanium™ One-Step RT-PCR 34 Figure 7 Results of separate PCRs to evaluate the log-linear range of AR amplification in Sphyrna tiburo, a necessary step to perform relative PCR 35 Figure 8 Examples of AR (174 bp) and 18s ribosomal (315 bp) bands amplified in a relative PCR using Sphyrna tiburo cDNA from testis (T), epididymis (Epi), and seminal vesicle (SV) samples 36 Figure 9 Results of relative PCR dem onstrating the levels of AR mRNA expression in the reproductive tract of male Sphyrna tiburo during different stages of the reproductive cycle 37 Figure 10 Detection of androgen recep tor (AR) transcripts by northern blotting from total RNA extracted from testis samples of Sphyrna tiburo 39 Figure 11 Localization of AR mRNA in te stis sections from a mature male Sphyrna tiburo using in situ hybridization 40

PAGE 10

vi Figure 12 Localization of AR mRNA in te stis sections from a mature male Sphyrna tiburo using in situ hybridization 41 Figure 13 Localization of AR mRNA in the testis of a mature male Sphyrna tiburo using in situ hybridization 42 Figure 14 Localization of AR mRNA in the epididymis of a mature male Sphyrna tiburo using in situ hybridization 43 Figure 15 Localization of AR mRNA in th e seminal vesicle of a mature male Sphyrna tiburo using in situ hybridization 44 Figure 16 Detection of androgen recepto r by western blot in testis lysates from two different mature male Sphyrna tiburo sampled during the spermatogenic stage 45 Figure 17 Immunocytochemistry of an immature testis (A, C, E) and a mature testis (B, D, F) of Sphyrna tiburo demonstrating specificity of PG-21 antibody through pr e-adsorbed controls 47 Figure 18 Immunostaining of AR prot ein in the testis of a mature Sphyrna tiburo demonstrating specificity of the PG-21 antibody through pre-adsorbed controls 48 Figure 19 AR protein detection usi ng immunocytochemisry from testis samples from three different Sphyrna tiburo specimens 50 Figure 20 Androgen receptor protein de tection using immunocytochemistry in the testis of a mature Sphyrna tiburo during the spermatogenic stage 51 Figure 21 Detection of AR protein in the Sphyrna tiburo epididymis using immunocytochemistry 52 Figure 22 Immunocytochemistry to dete ct the AR protein in the seminal vesicle of Sphyrna tiburo 53 Figure 23 Detection of the AR protein in cross sections of 5.5 cm total length male (A,B) and 4.3 cm total length female (C,D) embryos of Sphyrna tiburo using immunocytochemistry 55

PAGE 11

vii Androgen Receptors in the Bonnethead Shark ( Sphyrna tiburo ): cDNA Cloning and Tissue-specific Expression in the Male Reproductive Tract John P. Tyminski ABSTRACT Androgens and the androgen receptor (AR) play important roles in virilization, spermatogenesis, and sexual behavior in vertebrates. An understanding of the distribution and levels of expression of the ARs on th e cellular and tissue level demonstrates the pattern of responsivene ss to the androgenic hormones in a given organism. In this study, a fragment of the AR gene was cloned and sequenced from the bonnethead shark, Sphyrna tiburo, an elasmobranch species with a well-defined annual reproductive cycle. Acquiring this gene seque nce facilitated the c onstruction of speciesspecific AR polymerase chain reaction (PCR) primers and species-specific AR mRNA probes that were used to screen reproductive tissues for evidence of AR gene expression using reverse transcription (RT)-PCR and in situ hybridization (ISH), respectively. The RT-PCR screens demonstrated AR gene expre ssion in the testes, epididymides, seminal vesicles, and claspers of male sharks. The us e of relative PCR revealed that these organs have variable levels of AR gene expression that significantly differ with the stage of the shark’s seasonal reproductive cycle. ISH result s localized the AR RNA in the interstitial cells, Sertoli cells, and developi ng sperm of the testes, and mature spermatozoa within the seminal vesicles and the epididymides. Imm unocytochemical methods used to detect the

PAGE 12

viii AR protein using a rabbit pol yclonal antibody, PG-21, produced comparable results in the shark testes but did not yield pos itive results in the seminal ve sicles or the epididymides. However, the Leydig gland, whose secreti ons contribute to the seminal fluid, demonstrated consistent AR immunoreactivit y. Results of ICC in male and female embryos of S. tiburo revealed AR protein in the de veloping kidney but not in the embryonic reproductive structures By characterizing AR dist ribution in the reproductive tract of male S. tiburo, this study provides the basis for fu ture research on the direct and indirect effects of androgenic hormones in this species.

PAGE 13

1 Introduction Steroids Hormones Steroid hormones act by coordinating the suite of complex events involved in differentiation, reproductive development, and the physiological response to diverse stimuli (Evans, 1988). The lipoph ilicity of these molecules en ables them to directly pass across cell plasma membranes and enter the cytoplasm and nucleus (Whitfield et al. 1999). Once in the target cell, these hormonal ligands can bind to high-affinity receptors that are expressed in a tiss ue specific manner (Whitfield et al. 1999). This binding of the hormone elicits a structural alteration (or tr ansformation) of the receptor, which in turn enables the hormone-receptor complex to bind to specific sites on the DNA and directly regulate gene expression (Evans, 1988). Th e three major classes of steroid hormones include the adrenal steroids, vitamin D3, and the sex steroids (Evans, 1988). Sex steroids, including progesterone, es trogen, and androgens, cont rol reproduction and sexual development in vertebrates through bindi ng with their cognate receptors. Androgenic Hormones Androgens are male sex steroids secreted by the gonads that regulate virilization, spermatogenesis, and sexual behavior (Ste inberger, 1971; Borg, 1994). Testosterone (T) is the main androgen in most vertebrates and is produced largely by Leydig cells which lie between the testicular spermatocysts. In some tissues, T is converted to another biologically active form of androgen, dihydrotestosterone (DHT), by the action of 5 -

PAGE 14

2 reductase (Hadley, 2000). Of the 11-oxygenate d androgens, 11-ketotestosterone (11KT) appears to be the most important an drogen in teleost fishes (Borg, 1994). Androgen Receptors As with all steroid hormones, the physio logical action of androgenic hormones is mediated through their cognate receptors. Th e androgen receptor (AR) is a member of the subfamily of steroid receptors (SR) wh ich belongs to the broader superfamily of nuclear receptors (Hadley, 2000). It has been generally considered that SRs evolved in the chordate lineage about 400 to 500 milli on years ago from an ancestral estrogen receptor (ER) gene via gene duplication (Baker, 1997; Baker 2003). However, the isolation of an ER ortholog from the mollusk Aplysia californica would indicate that SRs evolved from a primordial gene that pre-da tes the origin of bilaterally symmetrical animals (Thorton et al. 2003). As with all the memb ers of the nuclear receptor superfamily, ARs have four major functional domains: (1) a hypervar iable transcriptional activation domain (TAD); (2) a highly conserved DNA-binding domain (DBD); (3) a variable hinge region; and (4) a moderately conserved ligand (hormone) binding domain (LBD) (Evans, 1988; Beato, 1989; Heinlein and Chang, 2006) (Figure 1). The AR protein functions as a steroid-activated transc ription factor (Rundlett et al., 1990). After binding to the androgenic hormone, the AR disso ciates from its coregulatory proteins, translocates to the nucleus and binds as a homodimer to a specific nucleotide sequence of DNA and positively or negatively regulates transcription of it s target gene (Betka and Callard, 1998, Heinlein and Chang, 2006). A lthough the molecular targets of androgens

PAGE 15

3 remain largely unknown, there is evidence in ce rtain cell types for the downstream effects of these steroid hormones. For example, grow th factors such as myostatin and insulinFigure 1. Structure of the typical androgen receptor. The major functional domains include the transcriptional activation doma in (TAD), the DNA-binding domain (DBD), a hinge region, and the liga nd binding domain (LBD). TAD Hin g e LBD DBD

PAGE 16

4 like growth factor-I appear to be direct ta rgets of AR in mammalian satellite cells (Chen et al ., 2005). Since ARs are essential for androgens to have a physiological effect, the presence and distribution of ARs determines the pattern of cellular responsiveness to the hormonal ligand within an organism. One of the tool s that has developed in recent years to facilitate this area of study has been cDNA cloning. The highly conserved nature of the AR DBD and LBD has facilitated its cDNA cl oning in a number of vertebrate species including mammals (Tan et al. 1988), birds (Nastiuk and Clayton, 1994), amphibians (GenBank accession no. X58955), reptiles (Young et al. 1995) and teleost fishes (Touhata et al. 1999; Takeo and Yamashita, 1999; Todo et al. 1999; Blsquez and Piferrer, 2005). These sequences have not only provided insight into steroid receptor evolution, but also facilitated the developm ent of species-specific molecular probes to examine the expression of these receptors on a cellular level. Signi ficant work has been devoted to evaluating the tissu e-specific expression of the AR gene and/or the presence of the AR protein in reproductive tissues as a means of understanding the role of androgenic hormones in a given organism. In non-mammalian vertebrate species, ARs have been found in testis, ovary, brain, liver, spleen, kidney, and muscle cells (Table 1). In mammals, ARs have been demonstrated in a number of male reproductive organs including the testis, epididymis, seminal vesi cle, phallus, as well as spermatozoa (Table 2).

PAGE 17

5 Table 1. Examples of vertebrate non-mammalian studies dem onstrating presence of ARs (SBA=steroid binding assay; ICC=immunocytochemistry; ISH=in situ hybridization; AA=androgen antagonists; TA=t ransactivation assays; Q-PCR=quantitative PCR; WB=western blot; CS=cloning/sequencing). Reprod. Detection AR Sensitive Species Stage Methods Organ/Tissue Cell Types Reference Squalus acanthias Adult SBA Testis Nuclear and cytosolic extracts Cuevas and Callard 1992 Micropogonias Undulates Adult SBA Ovary, brain, liver, drumming muscle Primarily the membrane fraction, less cytosolic/nuclear binding Braun and Thomas 2004 Gambusia affinis Adult, Juv. ICC, ISH, SA Distal region of anal fin rays Mesenchyme, epithelial cells Ogino et al. 2004 Carassius auratus Adult ICC Brain Nuclei of neurons, some neural cytoplasm Gelinas and Callard 1997 Anguilla japonica Adult TA, QPCR Spleen, liver, testis N/A Todo et al. 1999 Oncorhynchus Mykiss Adult TA Testis N/A Takeo and Yamashita 1999 Dicentrarchus Labrax Adult Q-PCR Testis, ovaries, brain, head, kidney, liver, spleen N/A Blzquez and Piferrer 2005 Rana catesbeiana Adult ICC Laryngeal muscle (both sexes) Primarily muscle fiber nuclei, some muscle fiber cytoplasm Boyd et al. 1999 Triturus marmoratus marmoratus Adult ICC, WB Testis Primord. germ, 1 & 2 spermatogonia, spermatocytes, interstitial cells Arenas et al. 2001 Streptopelia Risoria Adult ICC Brain Nuclei of telencephalon, diencephalon, and mesencephalon Belle and Lea 2001 Cnemidophrus Uniparens Adult CS Kidney N/A Young et al. 1995

PAGE 18

6 Table 2. Examples of vertebrate mammalian studies demonstra ting presence of ARs (ICC=immunocytochemistry; ISH=in situ hybridization; AA=androgen antagonists; TA=transactivation assa ys; Q-PCR=quantitative PCR; WB =western blot; NB=northern blotting; ImmB=immunobl otting; ImmF=immunofluorescence; SAR=steroid autoradiography). Reprod. Detection Species Stage Methods AR Sensitiv e Organ/Tissue Cell Types Reference Rattus norvegicus Adult ICC, NB, PCR Testis Sertoli cells Hill et al. 2004 R. norvegicus Adult ICC, AA Testis, epididymis Sertoli, Leydig, myoid, epithelial, stromal Zhu et al. 2000 R. norvegicus Adult WB, ICC, ImmB Testis Leydig, muscle of vessels, myoid nuclei, Sertoli, spermatids Vornberger et al. 1994 R. norvegicus Post-natal ICC Prostate Mesenchymal, epithelial, smooth muscle Prins and Birch 1995 R. norvegicus Adult ICC, ISH Pituit., testis, prostate, seminal vesicle Sertoli, myoid, Leydig, epithel., stromal, endothelial Pelletier et al. 2000 Mus musculus Adult ICC, WB Testis, effere nt ductules, vas deferens Leydig, Sertoli, peritubular, epithelial, stromal, connective Zhou et al. 2002 M. musculus EmbryoPost-natal SAR Efferent ductules, urogenital sinus, Wolffian ducts, epididymides, ductus deferens, seminal vesicles Mesenchymal/stromal cells Cooke et al. 1991 Macropus eugenii Embryo, Juv. ICC Testis, brain, urogenital sinus, phallus, Wolffian d., epidid. Epithelial, mesenchyme, stroma, Sertoli, interstitial Butler et al. 1998 Capra hircus Adult ICC Efferent ductules, epididymis, and ductus deferens Epithelial, connective tissue, and peritubular smooth muscle Goyal et al. 1998 Homo sapiens Embryo ICC Urogenital sinus, Mllerian and Wolffian ducts Epithelial, mesenchyme, Leydig precursors Sajjad et al. A 2004 H. sapiens Embryo ICC Urogenital tracts, phallus Epithelial, mesenchyme Sajjad et al. B 2004 H. sapiens Adult ICC Testis Sertoli, Leydig, peritubular myoid Surez-Quian et al. 1999 H. sapiens Adult ImmF, ImmB Sperm Midpiece at site of the mitochon. Solakidi et al. 2005

PAGE 19

7 Elasmobranchs The male reproductive tract of elasmobranch s is similar to that of amphibians and amniotes in its basic organization and embr yologic origins (Gilbert, 1973). The testes of the male shark are paired, symmetrical structures positioned at the anterior end of the peritoneal cavity and are the s ite of spermatogenesis. The te stes are typically attached to the dorsal surface of this cavity by the mesorchia (Wourms, 1977). Each testis is in close association with the ep igonal organ and is often embedded in the anterior portion of this immune functioning structure (Carrier et al ., 2004). The testes of mature sharks vary greatly in size and are often enlarged dur ing the breeding season in species with a seasonal reproductive cycle (P arsons and Grier, 1992). The spermatocyst (also known as a follicle or ampullae) is the functional and structural unit of the elasmobranch testis (Stanley, 1966). It is a spherical structure comprised of many spermatoblasts. A spermatoblast is define d as a single Sertoli cell and its cohort of germ cells (Parsons and Grier, 1992). Leydiglike cells are found in the interstitium of the shark testis (Pudney and Callard, 1984b). All the cells within a spermatocyst are essentially in the same stage of maturation. New cysts are formed continuously in the adult male shark from the fixed germinal sites on the lateral (or dorsola teral) aspect of the testis (Callard, 1988). In carcharhinid and sphyrnid sharks, development of the spermatocysts proceeds from the germinal sites on one wall across the diameter of the testis to the opposite wall (P ratt, 1988). Once spermatogenesis is complete, a connection is made to the terminal branch of the coll ecting ducts that enables spermatozoa to enter the efferent ducts (Callard, 1988). In contrast, the testis of the lamnid and alopiid sharks

PAGE 20

8 is divided into lobes. In these families, th e germinal sites are located near the center of each lobe and the development of the maturing spermatocysts proceeds radially from this central zone to efferent ducts at the circumference of the lobe (Pratt, 1988). All the ducts of the male shark are derived embryologically from the opisthonephric (Wolffian) duct (Callard, 1988). Spermatozo a are released from the testis through efferent ducts or vasa efferentia The number of ducts in th e testis of the male shark ranges from 2 to 6 (Wourms, 1977). The efferent ducts (or ductus efferens ) join the epididymis which typically forms a coiled tubule and serves as storage organs for spermatozoa. The epididymis then gives rise to the ductus deferens (or ampulla epididymis) which further functions for sper m storage (Jones and Jones, 1982). The posterior portion of the ductus deferens becomes a thick-walled straight tube called the seminal vesicle (or the ampulla ductus deferens ) (Carrier et al. 2004). The seminal vesicle functions primarily as a repository for sperm. Typically, the posterior end of the seminal vesicles terminates with a sphincter muscle that leads into sperm sacs which can be highly variable in si ze and location (Carrier et al. 2004). Mature spermatozoa pass from the sperm sacs into the urogenital si nus and through the uroge nital papilla where it enters the cloaca (Wourms, 1977). Internal fertilization is accomplished in sharks by copul atory organs known as claspers. Each clasper is formed by a cartilaginous elem ent that supports the medial margin of the pelvic fin and extends beyond the posterior margin as a rod (Wourms, 1977). In immature sharks, the claspers are small and fl exible (uncalcified). With the onset of

PAGE 21

9 maturity, the claspers calcify, become unbendabl e, and form articulati ons with the pelvic fin base (Carrier et al. 2004). During copulation, sper m is passed from the urogenital papilla into the clasper groove where it is fl ushed into the oviduct by seawater expelled from the siphon sac. The siphon sacs of the ma le shark lie just be neath the skin on the ventral side. The sacs are filled with seawater by repeated flexing of the clasper prior to copulation (Wourms, 1977). Steroids/Androgens in Elasmobranchs In most vertebrates, gonadal steroids ar e produced by Leydig cells that lie between spermatocysts. However, in male elasm obranchs the majority of these hormones are synthesized by Sertoli cells within the tes ticular spermatocysts (Simpson and Wardle, 1967; Holstein, 1969; Pudney and Callard, 1984a; DuBois et al. 1989). There is also evidence that Leydig-like cells (Pudney and Callard, 1984a, 1984b) and true Leydig cells (Marina et al. 2002) contribute to gonadal steroi dogenesis in the early stages of spermatogenesis in some elasmobranch speci es. However, the re lative contribution of these cell types to steroidogenesis is believed to be supplemental compared to that of Sertoli cells (Gel sleichter, 2004). Androgen-dependent targets have not been systematically studied in male elasmobranchs and only a few of the 600 species of Squalif ormes and Rajiformes have been evaluated for the tissue-specific roles of steroid horm ones (Callard, 1988). However, associations have been demonstrated between androgen le vels and seasonal stages that suggest T and/or DHT are involved in reproduction in elasmobranchs. For example, Manire and

PAGE 22

10 Rasmussen (1997) found that peak T and DHT le vels in August coin cided with maximum testicular development in the bonnethead shark ( Sphyrna tiburo ) but then dropped off significantly during the mati ng period (October-November ) Studies of steroid hormone production in the Atlantic stingray, Dasyatis sabina revealed that serum androgen levels in the male increased during the onset of spermatocyte development (August-October), decreased after maximum testis growth (N ovember-December), then increased again during the peak of mating activ ity (January-March) (Snelson et al. 1997; Tricas et al. 2000). In the epaulette shark ( Hemiscyllium ocellatum ), a species with a protracted mating period, male androgen levels meas ured through radioimmunoassay revealed a single broad peak (July-Octobe r) that also appeared to correlate with reproductive activity (Heupel et al. 1999). Cuevas and Callard ( 1992), through the use of steroid binding analyses on cytosolic a nd nuclear extracts, found direct evidence that ARs in the testis of the spiny dogfish ( Squalus acanthias ) were primarily localized in early stage (pre-meiotic and meiotic) spermatocysts. The finding that androgens are involved in early spermatogenesis was supported by a si milar study using semi-quantitative RT-PCR to measure AR mRNA in the same species (Betka and Callard, 1998). The elevated levels of circulating androgens in sharks dur ing mid and late stages of spermatogenesis may further indicate a role in development of gonoducts and/or the maturation and viability of spermatozoa. However, direct evidence of this relationship is presently missing. Piercy et al. (2003) found evidence that the genital ducts of D. sabina go through morphological and histological change s at different stages of the seasonal reproductive cycle and suggested that these changes could be directly or indirectly androgen mediated. Although the rate of claspe r growth increases sharply with the onset

PAGE 23

11 of testicular development (Collenot, 1969), a direct role of androgens in clasper development has not yet been demonstrated. Changes in circulating androgen levels were not found to be correlated with the rate of clasper growth in captive S. tiburo (Gelsleichter et al. 2002). The bonnethead shark, Sphyrna tiburo represents an abundant inshore species with a well-defined seasonal reproductive cycle. Males become func tionally mature and exhibit fully calcified claspers at about 2 ye ars of age (Parsons, 1993; Gelsleichter et al. 2002). Gonadal development begins in the late sp ring and a peak gonadosomatic index (GSI) occurs in late summer, about 2 months prio r to mating (Parsons a nd Grier, 1992; Manire and Rasmussen, 1997). Testicular regression begins prior to mating and continues until the following spring when gonadal recrudes cence begins (Parsons and Grier, 1992; Manire and Rasmussen, 1997). The steroidal cycles of this species have been well characterized (Manire et al. 1995; Manire and Ra smussen, 1997; Manire et al. 1999), however, the functional ro les of steroids in S. tiburo reproduction is unknown. In the case of the androgens, it is not known how T and DHT contribute to the cellular remodeling that takes place in the reproductive structures during the course of the annual cycle. Objectives of this Study The goal of this study was to examine th e functional role of androgens in the reproductive tissues of the male bonnethead shark. This was accomplished by characterizing the presence and pattern of ARs, which are essential for these sex steroid

PAGE 24

12 hormones to function. The AR was primarily localized in two form s: 1) the AR mRNA; and 2) AR protein. To detect AR mRNA, a molecular probe was de veloped to identify tissues and/or cells expressing AR mRNA through in situ hybridization (ISH) and northern blotting techniques. Re lative or semi-quantitative PCR was used to estimate the levels of AR mRNA expression. The presen ce of the AR protein in male reproductive tissues was investigated by immunocytochemist ry (ICC) using an an tibody specific to a portion of the AR protein from humans. A fu rther goal of this study was to initiate a preliminary examination of the role of androgens in the embryos of S. tiburo using immunocytochemical methods.

PAGE 25

13 Materials and Methods Sample Collection Sphyrna tiburo specimens were collected from 4 s ites along the southwest Florida coast using gill nets (11.4 cm stretch mesh si ze). The study sites included Yankeetown (28 59’ N, 82 49’ W), Tampa Bay (27 41’ N, 82 38’W), Charlotte Harbor (26 31’ N, 82 08’ W), and Long Key (24 50’N, 80 49’ W) (Figure 2). Mature male specimens were collected throughout the year dur ing all stages of the reproduc tive cycle. Immature males and embryos from pregnant females were al so collected for study. Embryos were preimplantation and ranged from 4-8 cm total length. All free-swimming specimens were measured, weighed and sexed at time of capture. Reproductive tissues (testes, epididymides, and seminal vesicles) were disse cted from euthanatized or recently dead sharks and flash-frozen in li quid nitrogen and stored at -80 C until use. Additional tissues, such as clasper cartilage and heart mu scle, were also collected for AR screening. To avoid RNase contamination, all instrume nts coming in contact with the dissected tissues were cleaned with RNaseZap decontamination solution prior to use (Ambion, Austin, TX). All animal co llection and handling procedures followed the specifications outlined in IACUC protocols for this study fr om the University of South Florida (#2556 under P. Motta) and Mote Marine Laborat ory (06-10-JT1 under J. Tyminski).

PAGE 26

14 Figure 2. Map of Florida demonstrating th e collection sites used in this study.

PAGE 27

15 Cloning AR cDNA RNA Extraction and cDNA Synthesis Total RNA was prepared from approximately 100 mg of mature male S. tiburo testis. The frozen tissue was placed in liquid nitr ogen and finely ground using a pre-chilled mortar and pestle. The powdered tissue was homogenized in Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s in structions with a ra tio of 1.0 ml Trizol per 50-100 mg of tissue. Samples were vortexe d and incubated at room temperature (RT) for 5 min. Water-saturated phenol-chloroform -isoamyl alcohol (Ambion) was added at 0.2 ml per ml of Trizol and shaken vigorous ly by hand for 15 seconds before a 2-3 min incubation. The mixture was then centrifuged at 12,000 g (4 C) for 15 min and the RNAcontaining aqueous phase removed and preci pitated in 100% isopr opanol (0.5ml/ ml Trizol solution). After 10-min incubation, the sample was centrifuged at 12,000 g for 10 min at 4 C. The supernatant was removed and the resultant RNA pellet was resuspended with 1.0 ml of 75% ethanol at RT. The sa mple was vortexed and centrifuged at 7,500 g for 5 min at 4 C. The resulting RNA pellet was briefly air-dried and resuspended in 50 l of water treated with 0.1% diethylpyro carbonate (DEPC) (Sigma Chemical Co., St. Louis, MO). The isolated RNA was quantifie d using spectrophotometry and its integrity evaluated by visual insp ection after running a 2-4 l sub-sample on a 1% agarose gel with ethidium bromide. The extracted RNA was then reverse transcribed producing complementary DNA (cDNA) using random hexamer primers and murine leukemia virus (MuLV) reverse transcriptase using the GeneAmp RNA PCR Core Kit (Applied Biosystems, Foster City, CA).

PAGE 28

16 PCR Primer Development Since no complete AR gene sequences were available for an elasmobranch at the initiation of this project, degenerate pr imer sequences for polymerase chain reaction (PCR) amplification of S. tiburo AR cDNA were designed from a comparison of GenBank-published AR sequences from 10 species (Appendix I) using Block Maker software (Henikiff et al. 1995). This program aligned th e sequences and identified the most conserved regions. The results of these comparisons were analyzed using CODEHOP software (Rose et al. 1998) to select the most appropriate sequences for degenerate DNA primer construction. Two se ts of AR oligonucleotide primers were commercially produced (Integrated DNA Tec hnologies, Coralville, IO) using standard de-salting conditions. The primer se quences were as follows: AR3-Fw; 5 -CGGCTCCT GCAAGGTGTT(C/T)TT(C/T)AA(A/G)(A/C)G-3 ; AR3-Rv; 5 -GAGATGATCTCGGC CATCAT(C/T)TC(deoxy-inosine) GG-3 ; ARn-Fw; 5 -(A/C)G(A/C/G /T)(A/C)G (A/C/G/T)AA(A/G)AA(C/T)TG(C/T)CC-3 ; ARn-Rv; 5 -(C/T)TG(A/C/G/T)C(G/T) (C/T)TC(A/C/G/T)CC(A/C/ G/T)A(A/G)(C/T)TC-3 Efforts were also made to clone actin with the intention of utilizing this constitu tively expressed gene as a standard and/or a positive control duri ng downstream applications. Non-degenerate primers were constructed using sequences successfully used to amplify a portion of this gene in the houndshark ( Triakis scyllium ) (GenBank Accession No. AB084472). The actin primers used were BA-Fw; 5 -GGATGATGAAATTGCAGC-3 and BA-Rv; 5 CGTTGTAGAAAGTGTGATGC-3 ) (C. Harutu, personal communication, July 31, 2002).

PAGE 29

17 PCR Conditions To amplify the AR cDNA fragment, a nested PCR strategy was employed in which two sets of AR primers were used in two su ccessive reactions. The product of the first reaction (AR3 primers) was used as the c DNA template for re-amplification in a second reaction using the ARn primers th at anneal to internal sites of that initial product. All PCR reactions included 10 pmol of the respective degenerate primers in a 25 l reaction run on a Techgene compact thermocycler (Techne, Cambridge, UK). The PCR conditions for both reactions were identical: 2 min at 94 C, 20 cycles of 30 s at 95 C, 30 s at 60 C with decreasing temperature proportionately each cycle to 51 C, 1 min at 72 C followed by 15 additional cycles of 30 s at 95 C, 30 s at 50 C, and 1 min at 72 C then 7 min at 72 C. Standard PCR was used to amplify -actin cDNA utilizing non-degenerate primers and a program of 95 C for 2 min followed by 33 cycles of 45 s at 95 45 s at 50 and 45 s at 72 then 7 min at 72 All PCR products were an alyzed on 1.2% agarose gels stained with ethidium bromide. Cloning and Sequencing PCR products corresponding to the predicted AR 324 bp fragment and the 275 bp -actin gene fragment were recovered from agaros e gels and purified us ing the Qiaex II Gel Extraction Kit (Qiagen, Germantow n, MD). The putative AR and -actin fragments were ligated into pCRII plasmid vectors (TA Cloning Kit; Invitrogen) and transformed into E. coli competent cells (One Shot, Invitrogen) following th e Invitrogen protocol. Positive (white) colonies we re selected and cultured in Luria broth containing 100 g/ml of ampicillin. Plasmids were isolat ed using the PureLink™ HQ Mini Plasmid Purification Kit (Invitrogen). A restriction digest of the purified plasmid DNA using

PAGE 30

18 EcoRI verified the presence of an insert of the appropriate size. The cloned gene fragments were sequenced by an independent laboratory (Macrogen, Inc., Seoul, Korea) using a 3730xl DNA Analyzer and the result s submitted to BLASTX for comparison to known sequences (Altschul et al. 1997). The sequence was a ligned against other known AR sequences using CLUSTAL W (Thompson et al. 1994) and BOXSHADE 3.21. PCR for Evaluating AR Isolation of Total RNA and Reverse Transcription Total RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s protocol. The extracted RNA was quantified by spectrophotometer (NanoDrop ND-1000, NanoDrop Technologies, Wilm ington, DE) and examined for quality by running a 2 l aliquo t on a 1% agarose gel with et hidium bromide. The RNA was then reverse transcribed using the Advantage RT-for-PCR Kit (Clontech, Mountain View, CA) with 0.5 g of total RNA and random hexamer primers. The cDNA from samples of S. tiburo testes, epididymides, and seminal ve sicles were aliquoted and stored at -80 C. Bonnethead Shark Specific Primers and AR Screening S. tiburo -specific non-degenerate AR primers we re designed from the sequence data obtained through cloning (AR-BH1-Fw; 5 -ATGCCGTCTGAGAAAGTGCT-3 ; ARBH1-Rv; 5 -AAATTGCTGCATCCTCGGTA-3 ). These primers were tested in a PCR reaction using cDNA from S. tiburo testis and resulted in the amplification of the expected 174 bp fragment. These primers we re then utilized to screen total RNA extracted from reproductive tissues for AR expression using the Titanium™ One Step

PAGE 31

19 RT-PCR Kit (BD Biosciences, Palo Alto, CA). Similarly, S. tiburo specific primers were generated for -actin for potential use as a positive control for PCR (BH-actin2-Fw; 5 GAATTGCAGCGCTTGTCATA3 ; BH-actin2-Rv; 5 -TCTCCATGTCATCCCAGTTG -3 ). Relative PCR to Quantify AR Gene Expression Quantification of AR gene transcripts wa s achieved through the use of multiplex PCR reactions using S. tiburo -specific AR primers and Competimer™/18s rRNA oligonucleotides (Ambion). These universal oligonucleotide primers are a more effective standard than the more commonly used -actin since rRNA levels do not vary from tissue to tissue. However, since rRNA is such a ma jor component of total RNA, the addition of the Competimers is necessary to modulate the efficiency of the PCR template while not affecting the performance of the AR target within the multiplex PCR. To evaluate the log-linear range of AR product formation, an individual mature male testis cDNA sample was used in a series of iden tical PCR reactions using the AR primers. Individual reaction tubes were sequentially removed from the th ermocycler at two cy cle intervals starting with the 21st and ending with the 39th cycle. Subsequent ge l electrophoresis and image analysis of these PCR products indicated that the mid-point of the detectable log-linear range occurred after 28 cycles of amplif ication. An annealing temperature of 68 C was found to be optimal for the S. tiburo -specific AR primers. Since the 18s primers function efficiently with annealing temperatures from 55-68 C it was determined that a 68 C annealing temperature could be used for all multiplex relati ve PCR reactions. Hence the relative PCR conditions were: 94 C for 3 min followed by 28 cycles of 94 for 45 s, 68 for 1 min, and 72 for 1 min with a fi nal extension of 72 for 5 min. Once the appropriate

PAGE 32

20 annealing temperature and ideal number of cycles were determined, another series of identical multiplex reactions were conducted to assess the appropriate Competimer to 18s primer ratio. Increasing concentrations of 18s Competimers were added to a series of reactions containing both the 18s and AR pr imers and run using the aforementioned PCR conditions. A 9:1 ratio of Competimer to 18s primer wa s found to be optimal to produce an 18s band of the same relativ e intensity as that of the am plified AR product. Samples of cDNA from the 3 reproductive structures we re amplified using this established method and electrophoretically sepa rated on 1.5% agarose gels with ethidium bromide and digitally photographed under UV lig ht. Individual bands from the images were identified and measured for maximum optical density (MOD) using Gel-Pro Express 4.0 software (Media Cybernetics Inc., Bethesda, MD). For each individual RNA sample evaluated, the MOD of the AR band was divided by the MOD of the 18s band to produce a relative measure of AR gene expression. Sample s were grouped by repr oductive stage using criteria established in prev ious studies (Gelsleichter et al ., 2003). The stages were defined as resting/quiescent (December-Apr il), spermatogenesis (May-August), and mating (September-November). Mean AR to 18s ratios by stage were analyzed for significance using a one-way analysis of variance (ANOVA) followed by the Tukey’s Honestly Significant Differences (HSD) test (InStat 3, GraphPad Software Inc., San Diego, CA). Data sets that failed tests of normality and/or equal variance were logtransformed prior to analysis.

PAGE 33

21 In Situ Hybridization Probe Labeling AR antisense and sense cRNA probes were constructed by in vitro transcription using the MEGAscript High Yield Transcription Kit (Ambion) Linearized plasmid containing the AR fragment was used as the DNA temp late for a digoxigenin (DIG)-labeled probe with DIG-labeled UTP (Roche Applied Scien ce, Indianapolis, IN). Both RNA probes were evaluated for their labeling efficiency us ing the direct detection method as described in the DIG Northern St arter Kit (Roche). Preparation of Tissue Sections Tissue sections for in situ hybridization (ISH) were fixed for 48 h in 4% paraformaldehyde prepared using phosphate buffered saline modified for use with elasmobranch tissues (E-PBS) (Appendix II ) then transferred to 100% ethanol for storage. Tissues were removed from the ethanol and incubated overnight in a 30% sucrose solution made with water treated with 0.1% dimethyl pyrocarbonate (DMPC) (Sigma). The ISH protocol followed the procedures outlined by Dijkman et al. (1995) with some modifications. After embedding in Tissue-Tek O.C.T. compound (Sakura Finetek U.S.A., Inc., Torrance, CA), 5 m frozen sections were cut on a Minotome Plus™ cryostat, (Triangle Biomedical Scie nces, Durham, NC), mounted directly on Superfrost Plus slides (A. Daigger and Comp any, Wheeling, IL), and incubated overnight at 40 C to fix the RNA in the tissue. Tissue sect ions were then used immediately for ISH or stored for later use at -80 C.

PAGE 34

22 Pretreatment of Slides Frozen slides were incubated for 2 h at 40 C and each tissue was then circled using a PAP pen (Electron Microscopy Sciences, Hatfie ld, PA). Tissue sections were incubated in phosphate buffered saline (PBS) containi ng 4% paraformaldehyde for 5 min at RT. The sections were then washed once with PBS for 3 min then twice for 5 min with 2x SSC (Ambion). Prehybridization, Hybridization, and Post Hybridization Each section was prehybridized for 60 min at 37 C in 25 l of hybridization buffer (Appendix III). The hybridization buffer was discarded and each section was covered with 25 l of hybridization buffer containing 200 ng/ml of DIG-labeled antisense cRNA probe for AR and incubated for 16-24 h at 37 C. Control sections were incubated with the DIG-labeled sense cRNA probe. Unbound pr obe was removed by a series of washes: 5 min in 2x SSC at 37 C, 3 washes of 5 min each with 60% formamide in 0.2x SSC at 37 C, and 2 washes of 5 min each with 2x SSC at RT. Immunological Detection Immunological detection of DIG-labeled R NA probes followed the procedures outlined in the DIG Northern Starter Kit (Roche). Br iefly, sections were washed for 5 min at RT in DIG washing buffer then incubated for 30 mi n at RT with DIG bl ocking buffer. The tissue sections were then in cubated for 2 h at RT with alkaline phosphatase-conjugated anti-DIG antibody (Roche) diluted 1:200 in blocking buffer. This was followed by 3 washes in washing buffer at RT for 5 mi n each. Each individual tissue group then received 25 l of detection buffer for 10 min at RT. Sections were then covered with detection buffer containing BCIP and levamisole and allowed to incubate overnight at

PAGE 35

23 RT. The color reaction was stopped by rinsi ng the sections in a washing buffer (1mM EDTA in 10mM Tris, pH 8). Sections were then washed for 5 min in reverse osmosis (RO) water and counterstained for 5 min in nuclear fast re d (Vector Laboratories, Inc., Burlingame, CA). Slides were washed for 5 min in RO water, then mounted using aqueous mounting media for histological examination. Detection of AR Protein Using Immunocytochemistry Histology Male S. tiburo reproductive organs (testes, epidid ymides, seminal vesicles) and embryos were fixed in 10% formalin prepared using E-PBS. Following a 48 h fixation period, the sections were transferred to 70% ethanol for long-term storage. The fixed tissue sections were trimmed then dehydrated in a graded series of alcohols (80-100%), cleared in a limonene-based xylene substitute (CitriSolv™, Fisher Scientific, Fair Lawn, NJ), and then processed for routine paraffin histol ogy. Reproductive organs and embryos were cross-sectioned (5 m) using a rotary microtome (‘ 820’ Spencer, American Optical Corporation, Buffalo, NY) and placed on micr oscope slides coated with 0.01% poly-Llysine (Sigma). Immunocytochemistry The presence of immunoreactive AR protein in S tiburo was determined according to methods outlined by Nichols et al. (2003). A rabbit polyclonal antibody against the first 21 amino acids of the human AR (PG-21, Upst ate, Lake Placid, NY) was used as the primary antiserum. Initially, an alternativ e primary antibody directed against amino acids 527-541 of the rat AR was utilized (AR52, given by E. Wilson, University of North

PAGE 36

24 Carolina) but was not found to be cross-reactive with S. tiburo AR. Tissue sections were de-paraffinized using a limonene-based solv ent and re-hydrated in a descending, graded series of histology-grade alcohols (100-95%). Following a 20 min tap water rinse, the tissue sections were incubated in an antigen retrieval solution (10 mM sodium citrate, pH 6.0) for 20 min in a 95 C water bath to expose AR epitopes. The sections were cooled to RT then rinsed in RO water and incubated for 30 min at RT in a solution of 3% hydrogen peroxide and 100% methanol (1:1) to quench endogenous peroxidase activity. Afterwards, the sections were rinsed in PBS and incubated overnight at 4 C in 2% normal horse serum to block nonspecific binding. Ti ssue sections were brought to RT, rinsed twice with PBS, and incubated with th e primary antibody (1: 100) diluted in PBS containing 0.1% gelatin and 0.1% sodi um azide (G-PBS) overnight at 4 C. Slides were rinsed with PBS containing 0.05% Tween-20 (P BS-T), twice rinsed with PBS, then incubated for 60 min at RT with the ImmPre ss™ Reagent Anti-Rabbit Ig (Vector). After 3 PBS rinses, diaminobenzidine hydrochlori de (DAB) (Vector) was applied to the sections for 5-8 min to reveal reddish-brown staining as an indicator of antigen-antibody complexes. After color development, secti ons were rinsed in tap water and counterstained in 2% methyl green (Vector) for 45-60 min at 37 C. The fully processed sections were then rinsed in tap water for 2 min, de hydrated in an ascending, graded series of alcohols (95-100%), cleared in a limonene-bas ed medium, and mounted using Cytoseal60 (Richard-Allan Scientific, Kalamazoo, MI). A series of controls were included in the immunocytochemical methods including: 1) stepwise deletion of all stages of the immunocytochemical procedure; 2) re placement of the primary antibody with nonimmune rabbit IgG or dilutant; 3) pre-ab sorption of the primary antibody with a 10-

PAGE 37

25 fold excess of the AR21 protein (the antigen used to make the PG-21 antibody); and 4) pre-absorption of the primary antibody with a 10-fold excess of a similarly sized peptide from the androgen receptor (AR462). Once an organ was established as being ARpositive via the pre-absorbed controls, sections of this organ type were included in all subsequent ICC runs as a positive control. In addition to the antibody concentration described above, a suite of repr oductive organ sections were also run with a PG-21 titer of 1:50 to assess whether increased antibody co ncentration would improve the sensitivity of the immunostaining. Immunoblotting Tissue sections were homogenized in 2 volumes of lysis buffer (50 mM Hepes, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.5 mM sodium orthovanadate, 20 mM disodium pyrophosphate, 10% glycer ol and 1% Triton X-100 [pH 7.2]) (Chieffi et al ., 2000) and then centrifuged at 14,000 g for 15 min at 4 C. The supernatant was mixed with 2 volumes of sample buffer and heated in a water bath for 5 min at 95 C. Proteins were separated via SDS gel electrophoresis under denaturing and reducing conditions using 10% polyacrylamide gels and the Laemmli buffer system. Gels were fixed in a standard fixation solution (40% methanol and 10% acetic acid) and stai ned with fixation solution with 0.25% coomassie blue. For immunoblotting, proteins were transferred from the gel to nitrocellulose membranes (Bio-Rad, Hercul es, CA) which were then incubated in 10% nonfat dry milk in Tris-buffered saline (TBS) (0.138 M NaCl, 0.0027 M KCl [ph 8.0]) for 2 h to block non-specific binding. Immunoreac tive AR protein was demonstrated using PG-21 as the primary antibody (diluted 1/ 500 in TBS containing 0.05% Tween-20 and

PAGE 38

26 1% nonfat dry milk), the Mouse ExtrAvidin Alkaline Phosphatase Staining Kit (Sigma), and NBT/BCIP. Membranes were rinsed thoroughly in TBS containing 0.05% Tween-20 between each incubation. Afte r color reaction, membranes were rinsed in RO water and air-dried. Northern Blotting The northern blotting procedure followed the methodology outlined by Bowman and Denslow (1999) with some modifications. Total RNA extracted from 5 mature male S. tiburo testes were pooled (20 g) and then concentrated in a microfuge tube to near dryness in a Vacufuge™ Concentrator 5301 (Eppendorf, Westbury, NY). The RNA was then brought to a 16 l volume with denaturing solution. An RNA marker with a range of 281 to 6,583 bases (Promega, Madi son, WI) was prepared using 6 l of marker and 10 l denaturing solution. Both sample s and markers were denatured in a 65 C water bath for 15 min. A volume of 5 l of NorthernMax formaldehyde loading dye (Ambion) was added to each sample for a total volume of 21 l. The samples were then loaded onto a 1% agarose-formaldehyde gel and run at 50 V for 3 hr. A positively charged nylon membrane (BrightStar™-Plus, Ambion) was so aked in DEPC-treated water for 5 min prior to use. Following electrophoresis, the ge l was soaked in DEPC-treated water for 1 min. Both gel and membrane were equilibra ted separately in 20x SSC for 10 min at RT on an orbital shaker. A downward capillar y transfer was performed overnight, as described by Bowman and Denslow (1999). The following day, the transfer stack was dismantled and the gel wells were marked on the nylon membrane with an ink pen. The nylon membrane was rinsed with 2x SSC a nd then dried in an incubator at 37 C for 10

PAGE 39

27 min. The membrane was then crosslinked twice (120 mJ/cm) using a UV Stratalinker 1800 (Stratagene, La Jolla, CA). Methylene blue was used to stain the membrane for 45 sec and then destained for 2 min (Herrin a nd Schmidt, 1988). The blot was photographed and stored in a plastic bag at 4 C until used in the hybridization step. The membrane was prehybridized with prewarmed DIG Easy Hyb for 30 min at 68 C following the procedures outlined in the DIG Northern St arter Kit (Roche). The DIG-labeled RNA probe (100 ng/ml) was denatured by boiling fo r 5 min followed by rapid cooling in ice water. The denatured probe was then added to prewarmed DIG Easy Hyb and mixed thoroughly. The prehybridizat ion solution was removed from the membrane and replaced with the probe/hybrid ization mixture and allowed to incubate overnight at 68 C with gentle agitation. The following day, a se ries of stringency washes were performed following the DIG Northern Starter Kit prot ocol (Roche). This included two 5-min washes in 2xSSC (0.1% SDS) at RT and tw o 15-min washes in 0.1xSSC (0.1% SDS) at 68 C. Afterwards, the membrane was rinsed again in DIG washing buffer (DIG Wash and Block Buffer Set, Roche) for 5 min fo llowed by 30 min incubations in DIG blocking solution (Roche) and antibody solution cont aining an anti-DIG antibody (1:5,000) conjugated with alkaline phospha tase (Roche). The membrane was washed twice for 15 min in washing buffer and then allowed to equilibrate for 5 min in detection buffer containing NBT/BCIP (Roche). The membrane was then rinsed 3 times with DEPCtreated water to stop the co lor reaction and photographed.

PAGE 40

28 Results This study used molecular and immunocytochemi cal methods to evalua te the presence of the androgen receptor in the primary and secondary sex structures in S. tiburo These results are summarized in Table 3. Androgen Receptor Cloning and Sequencing Four positive clones of putative AR cDNA ge ne fragments were obtained and sequenced. A BLASTX analysis of the sequence data (Figur e 3) revealed that the cloned insert was a 324 bp fragment of S. tiburo AR cDNA. This portion of the gene shares a high degree of sequence homology with other species (Figure 4), but most closely resembled ARs of the spiny dogfish shark ( Squalus acanthias ) and the African clawed frog ( Xenopus laevis ). The cloned region of the S. tiburo AR gene corresponds to the conserved DBD, the variable hinge region, and the carboxy-terminal LBD. Additionally, 2 positive clones of putative S.tiburo -actin cDNA fragments were also obt ained and sequenced. BLASTX analysis of the sequence data (Figure 5) revealed that the cloned insert was a 274 bp fragment of the S. tiburo -actin gene.

PAGE 41

29 Table 3. Summary of organs tissues, and cells of Sphyrna tiburo that were evaluated for the presence of the androgen receptor us ing PCR screening, immunocytochemistry (ICC), and in situ hybridization (ISH). Tissues/organs that were not evaluated or were evaluated but did not produce reliable results are identified as not determined (ND). Organ/Tissue/Cell Type PCR Screen ing mRNA (ISH) Protein (ICC) Testis + Leydig-like cells + + Sertoli cells + + Germ cells Spermatogonia Spermatocytes Spermatids + Spermatozoa + Epididymis + Epithelial cells Muscle cells Connective tissue Spermatozoa + Leydig gland ND + Seminal Vesicle + Epithelial cells Smooth muscle Connective tissue Spermatozoa + Clasper + ND ND Embryos N/A Developing gonad ND Kidney ND + Digestive tract ND Heart + ND ND

PAGE 42

30 aggcgcaaaaactgcccatcatgccgtctgagaaagtgctttgcagctggaatgacactt 60 R R K N C P S C R L R K C F A A G M T L 20 ggaggtcgaaaattaaagaatacacgaccattccaaaccacagatgaaaccgactctcca 120 G G R K L K N T R P F Q T T D E T D S P 40 gttgtacaaaagcaacaggacagcacacactctgttgtaccaagaattggtgtaccgagg 180 V V Q K Q Q D S T H S V V P R I G V P R 60 atgcagcaatttcagtatcagccactgtttctcactgtgctacaatctattgagcctgat 240 M Q Q F Q Y Q P L F L T V L Q S I E P D 80 atggtatattcaggctatgacaacacacagcctgatacatctgccagtttgttaacaagc 300 M V Y S G Y D N T Q P D T S A S L L T S 100 ctcaatgagcttggcgaacgtcaa 324 L N E L G E R Q 108 Figure 3. Nucleotide and deduced amino aci d sequence of the cloned androgen receptor gene fragment from the bonnethead shark ( Sphyrna tiburo ). The positions of the forward and reverse ARn degenerate primers are indi cated by the solid boxes. The positions of the non-degenerate AR BH1 primers are indicated by the broken line boxes.

PAGE 43

31 Figure 4. Comparison of the deduced am ino acid sequences of the cloned Sphyrna tiburo androgen receptor along with examples from 8 other species. The sequences given were taken from the Genba nk database and are referenced with accession numbers as follows : spiny dogfish Squalus acanthias (AY228761); African clawed frog Xenopus laevis (U67129); canary Serinus canarius (L25901), red sea bream Chrysophrys major (AB017158); human Homo sapiens (BC132975); rainbow trout ( ) Oncorhynchus mykiss (AB012095); Japanese eel Anguilla japonica (AB025361); and Burton’s mouthbrooder Haplochromis burtoni (AF121257). Sphyrna tiburo Squalus acanthias Xenopus laevis Serinus canarius Chrysophrys major Homo sapiens Oncorhynchus mykiss Anguilla japonica Haplochromis burtoni Sphyrna tiburo Squalus acanthias Xenopus laevis Serinus canarius Chrysophrys major Homo sapiens Oncorhynchus mykiss Anguilla japonica Haplochromis burtoni

PAGE 44

32 ggatgatgaattgcagcgcttgtcatagacaatggctccggaatgtgcaaggctgggttt 60 G I A A L V I D N G S G M C K A G F 20 gctggtgacgatgctccccgtgctgtgttcccttccattgttggacgcccaagacatcag 120 A G D D A P R A V F P S I V G R P R H Q 40 ggtgtgatggttggtatgggacagaaggacagctatgtaggtgatgaggctcagagcaag 180 G V M V G M G Q K D S Y V G D E A Q S K 60 agaggtattcttactttgaagtatcccattgagcatggtattgtcaccaactgggatgac 240 R G I L T L K Y P I E H G I V T N W D D 80 atggagaaaatctggcatcacactttctacaacg 274 M E K I W H H T F Y N 91 Figure 5. Nucleotide and deduced amino acid sequences of the cloned -actin gene fragment from Sphyrna tiburo The positions of the non-degenerate BA primers are indicated by the broken line boxes.

PAGE 45

33 AR Screening and Semi-Quantification by RT-PCR Tissue screening using RT-PCR resulted in th e amplification of the expected 174 bp AR cDNA product from RNA samples extracted from the testes, epididymides, seminal vesicles, claspers, and heart of S. tiburo (Figure 6). The clasper RNA samples produced noticeably weaker bands than those from the reproductive tr act. Similarly, heart tissue samples yielded weakly positive results in the form of a faint 174 bp band. The PCR results shown in Figure 7 demonstrat e that 28 PCR cycles represented the mid point of the log linear range of amplification. This was necessary to determine the optimal conditions for the relative (semi-quan titative) PCR procedure. Samples of cDNA from reproductive organs of mature sharks were amplified using semi-quantitative PCR with both AR and 18s ribosomal primers. The results of the multiplex PCR reactions produced the expected 174 bp AR band and a 315 bp 18s ribosomal band using cDNA from testes (n= 33), epididymides (n=23), and seminal vesicles (n=24) (Figure 8). Statistically significant differe nces in AR mRNA expression levels were observed among the reproductive stages in all 3 of these orga n types. For the testis, AR expression was higher during spermatogenesis relative to the resting stage (ANOVA and Tukey’s HSD test, p<0.01) and relative to mating (ANOVA an d Tukey’s HSD test, p<0.05) (Figure 9a). In the epididymis, AR expression levels we re significantly higher during mating than during the resting stage (ANO VA and Tukey’s HSD test, p<0 .01) (Figure 9b). In the seminal vesicle, AR expression was higher during mating than during the resting stage (ANOVA and Tukey’s HSD test, p<0.01) a nd during spermatogenesis (ANOVA and Tukey’s HSD test, p<0.05) (Figure 9c).

PAGE 46

34 Figure 6. Screening of androgen rece ptor mRNA in tissues/organs of Sphyrna tiburo using Titanium™ One-Step RT-PCR. Positive results are demonstrated by the amplification of a 174 bp band indicated by th e arrow. The type of tissue/organ is identified below the bands. Testis (T), Ep ididymis (Epi), Seminal Vesicle (SV), Clasper (CL), and Heart (H). T Epi SV CL H 200 100 bp

PAGE 47

35 Figure 7. Results of separate PCRs to evaluate the log-linear range of AR amplification in Sphyrna tiburo, a necessary step to perform relative PCR. The products were separated on an agarose gel with ethidium bromide, visualized under UV light, and each band had its maximum optical density measured (see inse rt). The arrow indicates the mid point of the log linear range (28 cycles). 1 1.2 1.4 1.6 1.8 2 2.2 1921232527293133353739 Cycle NumberLog Max. Optical Density

PAGE 48

36 Figure 8. Examples of AR (174 bp) and 18s ribosomal (315 bp) bands amplified in a relative PCR using Sphyrna tiburo cDNA from testis (T), epid idymis (Epi), and seminal vesicle (SV) samples. The reproductive stage of the sample is reported below the bands. Products were run on 1.5% agarose gels trea ted with ethidium bromide and photographed under UV light. T T Epi Epi SV SV SV Mat. Rest. Rest. Rest. Rest. Mat. Mat 200 300 bp 200 300 bp 18s AR

PAGE 49

37 0.0 0.5 1.0 1.5 2.0 2.5 RestingSpermatogen.MatingAR/18s Ratio 0.0 0.5 1.0 1.5 2.0 2.5 RestingSpermatogen.MatingAR/18s Ratio 0.0 0.5 1.0 1.5 2.0 2.5 RestingSpermatogen.MatingAR/18s Ratio Figure 9. Results of relative PCR demonstrat ing the levels of AR mRNA expression in the reproductive tract of male Sphyrna tiburo during different stages of the reproductive cycle. The data are reported as mean AR/18s ratios of optical density (SE) for the testis (A), epididymis (B), and seminal vesicle (C). Sample size per stag e is indicated in the lower part of the bars. Significant difference (*). 9 14 10 6 8 9 8 8 8 A B C * *

PAGE 50

38 Northern Blotting Northern blot analysis of total RNA extracted from S. tiburo testes revealed 2 AR transcripts of about 7 and 9 kb (Figure 10). These two bands were faint which suggest a relatively low level of AR expression. Stai ning observed in other parts of the membrane appeared to be artifactual. In Situ Hybridization Expression of AR was observed in the Leydig-like, interstitial cells that lie between the spermatocysts of the testis of mature S. tiburo (Figure 11A-D). Within post-meiotic spermatocysts, AR positive staining was obser ved in Sertoli cells (Figure 12 A-D). AR was also expressed in the nuclei of sperma tids (Figure 13A, B) and spermatozoa (Figure 13C, D) within late stage spermatocysts. There was no evidence of AR expression in the structural and secretive cells of the epididymis. However, spermatozoa within the lumen of the epididymis demonstrated a consistent positive AR reaction (Figure 14A, B). Similar to the epididymis, there was no eviden ce of AR expression in the epithelial cells, smooth muscle, or connective tissue that co mprise the seminal vesicles. The only consistent AR staining was observed in the sperm contained within the lumen of this structure (Figure 15A-D). Immunoblotting Immunoblot analysis of protein extracts from mature male S. tiburo testes using the antiAR PG-21 antibody demonstrated the pres ence of two weak ba nds corresponding to molecular weights of ~90 and ~100 kDa (Figure 16) This size is consistent with reports

PAGE 51

39 Figure 10. Detection of androgen receptor (A R) transcripts by nor thern blotting from total RNA extracted from testis samples of Sphyrna tiburo The nylon membrane has the positions and sizes of the RNA marker bands shown on the left of the membrane. The two arrows on the right of the membrane indicate the positions of positive bands detected by the AR mRNA probe. 6.6 3.6 1.4 0.6 1% AgaroseFormaldehyde gel Nylon Membrane 18s 28s kb

PAGE 52

40 Figure 11. Localization of AR mRNA in te stis sections from a mature male Sphyrna tiburo using in situ hybridization. (A) Negative cont rol using DIG labeled sense AR probe. (B) Positive staining with DIG labele d antisense AR probe in the Leydig-like cells in between spermatocysts. (C) Nega tive control at higher magnification. (D) Positive staining at higher magnification demonstrating individual Leydig-like cells. SP=Spermatocyst. Arrows in B and D indicate AR positive Leydig-like cells. A B C D SP SP

PAGE 53

41 Figure 12. Localization of AR mRNA in testis sectio ns from a mature male Sphyrna tiburo using in situ hybridization. (A, C) Negative c ontrols using DIG labeled sense AR probe. (B, D) Positive staining with DIG labeled antisense AR probe in the Sertoli cells (SC) within post-meiotic spermatocysts. A B C D SC SC

PAGE 54

42 Figure 13. Localization of AR mRNA in the testis of a mature male Sphyrna tiburo using in situ hybridization. (A) Negative control us ing DIG labeled sense AR probe. (B) Positive staining with DIG labeled antisen se AR of spermatids within stage 5 spermatocysts. (C) Negative control of a st age 7 spermatocyst. (D) AR positive staining of spermatozoa nuclei in stage 7 spermatocyst. A B C D

PAGE 55

43 Figure 14. Localization of AR mRNA in the epididymis of a mature male Sphyrna tiburo using in situ hybridization. (A) Negative control using DIG labele d sense AR probe. (B) Positive staining with DIG labeled antisense AR probe in the lumen (L) containing spermatozoa. A B L L

PAGE 56

44 Figure 15. Localization of AR mRNA in th e seminal vesicle of a mature male Sphyrna tiburo using in situ hybridization. (A) Negative cont rol using DIG labeled sense AR probe. (B) Positive staining in the lumen of the vesicle with DIG labeled antisense AR probe in the nuclei of spermatozoa. (C) Nega tive control. (D) Positive AR staining of spermatozoa nuclei. B C D A

PAGE 57

45 Figure 16. Detection of androgen receptor by we stern blot in testis lysates from two different mature male Sphyrna tiburo sampled during the spermatogenic stage. The arrows on the left side show the position of the molecular markers. Arrows on right demonstrate bands of ~90 kDa and ~100 kDa. 80 kDa 120 kDa Lane 1 2

PAGE 58

46 of AR from other verteb rate groups (Vornberger et al., 1994; Arenas et al ., 2001; Zhou et al ., 2002) (Figure 16). However, each of thes e previous studies re ported only a single AR band. Immunocytochemistry Antibody Validation The suitability of the PG-21 antibody to detect the AR protein in S. tiburo was demonstrated through a series of antibody co mpetition controls using ICC on testis samples from both mature and immature specimens (Figures 17 and 18). Positive staining of Leydig-like cells were observed when the primary antibody (PG-21) alone was applied to testis histological sections. Similarly, AR was detected from sections of the same testis samples when the PG-21 an tibody was preadsorbed with a 10-fold excess of the similarly-sized but unrelated AR462 pep tide demonstrating that this protein did not bind to the antibody and hinder the positive react ion observed in the Leydig-like cells. However, AR reactivity was abolished when the PG-21 was preadsorbed with a 10-fold excess of AR21, the antigen that was inject ed into a rabbit to generate the PG-21 antibody. This series of controls demonstr ates the specificity of the AR binding as preadsorbtion of the antibody with the antigen selectively abolished AR positive staining. AR Protein Detection Immunocytochemical methods demonstrated the presence of the AR protein in several different organs of S tiburo (Table 3). When the antibody titer was doubled (from 1:100 to 1:50), the immunostaining intensity was not increased nor were there any additional cell types showing immunoreactivity. Positiv e AR staining in the interstitium of S. tiburo

PAGE 59

47 Figure 17. Immunocytochemistry of an immature testis (A, C, E) and a mature testis (B, D, F) of Sphyrna tiburo demonstrating specificity of PG-21 antibody through preadsorbed controls. (A) Positive AR stai ning using PG-21 antibody alone. (C) Section from same testis with similar AR pos itive staining after PG-21 antibody was preadsorbed with AR462 peptide. (E) No pos itive staining when PG-21 was pre-adsorbed with AR21 peptide. (B) AR positive staining with antibody alone. (D) AR positive when antibody pre-adsorbed with AR462 peptide. (F) No AR positive staining after antibody was pre-adsorbed with AR21 peptide. Arrows indicate examples of AR-positive staining. A D C B F E

PAGE 60

48 Figure 18. Immunostaining of AR prot ein in the testis of a mature Sphyrna tiburo demonstrating specificity of the PG-21 anti body through pre-adsorbed controls. (A) AR positive staining in the interstitium. (B) AR positive staining in the interstitium when antibody was pre-adsorbed with AR462 peptid e. (C) No immunostaining when antibody was pre-adsorbed with AR21 peptide. Arrows indicate examples of AR positive staining. A B C

PAGE 61

49 testis samples was observed between sp ermatocysts during various stages of spermatogenesis (stages based on Parsons and Grier, 1992). Leydig-like cells demonstrated AR immunoreactivity in the vi cinity of spermatocysts containing both 1 and 2 spermatocytes (Figure 19 A, B). Positive immunostaining was also observed in the interstitium of early meiotic stages while at the same time AR staining was observed in later spermatogenic stages (Figure 19 C, D). Additionally, AR staining was detected in peripheral cells of the testis near effere nt ducts (Figure 19 E, F). In pre-meiotic spermatocysts, AR staining was observed in bo th Sertoli cells and Leydig-like cells of the interstitium (Figure 20). There was no positive AR staining observed in any of the epithelial cells, muscle cells, or connective tissue that comprises the epididymis Likewise, there was also no evidence of AR staining in the mature spermatozoa cont ained within the lumen of this structure (Figure 21 A, B). Positive AR staining was only observed in the epithelial cells of the Leydig gland which lies immediat ely dorsal to the anterior portion of the epididymis (Figure 21 C, D). No evidence of AR immunoreactivity was observed in the epith elial cells, smooth muscle, or connective tissue comprising the seminal vesicle (Figure 22 A-D). During the resting stage, when the contents of this structure is minimal, there was no evidence immunostaining in the lumen (Figure 22 A, B). Spermatozoa stored within the lumen of the vesicle during the mating period also di d not demonstrate any AR immunoreactivity (Figure 22 C, D).

PAGE 62

50 Figure 19. AR protein detec tion using immunocytochemisry from testis samples from three different Sphyrna tiburo specimens. Control is on left in each case. (A, B) Positive-staining in the interstitium of spermato cysts containing 1 and 2 spermatocytes. (C,D) AR positive staining of Leydig-like cel ls around meiotic spermatocysts. (E, F) Immuno-staining in the vicinity of efferent ducts of the testis. C A B D F E

PAGE 63

51 Figure 20. Androgen receptor prot ein detection using immunocyt ochemistry in the testis of a mature Sphyrna tiburo during the spermatogenic stage. (A, C) Negative control showing no AR immunostaining. (B) AR pos itive staining in the Sertoli cells (SC) within pre-meiotic spermatocysts. (D) AR immunostaining of Sert oli cells and Leydiglike cells (LC). B A C D SC SC LC

PAGE 64

52 Figure 21. Detection of AR protein in the Sphyrna tiburo epididymis using immunocytochemistry. Control sections on th e left. (A,B) No positive staining in the mature epididymis. (C,D) Positive AR stai ning in cells of the Leydig gland that lies distally to the epididymis. A B C D

PAGE 65

53 Figure 22. Immunocytochemistry to detect th e AR protein in the seminal vesicle of Sphyrna tiburo Control sections on th e left. (A,B) No positive staining in the mature seminal vesicle from a shark captured in Apr il (resting stage). (C,D ) No evidence of the AR protein in the seminal vesicle of an October captured shark (mating stage). D A B C

PAGE 66

54 Positive AR staining was observed in the de veloping kidney of both male (Figure 23 A, B) and female embryos (Figure 23 C, D) of S. tiburo There was no evidence in either sex of the presence of the AR protein in the developing gonad or any other reproductive organs. Similarly, there was no immunostain ing observed in nonreproductive structures such as the stomach, intestine, and muscle.

PAGE 67

55 Figure 23. Detection of the AR protein in cross sections of 5.5 cm total length male (A,B) and 4.3 cm total length female (C,D) embryos of Sphyrna tiburo using immunocytochemistry. Control tissues on the le ft in both cases. Positive staining was observed in the developing kidney only (arr ows). V, vertebrae; G, developing gonad. A B D C V V V V G G G G

PAGE 68

56 Discussion In vertebrates, androgens mediate a variet y of diverse responses by binding to their cognate receptor and regulating transcripti on of its target genes. Androgen receptor expression, which is found in a variety of cell types, changes throughout development (Keller et al., 1996). This study provides cellular lo calization and a measure of relative expression levels of AR sugges ting that androgens are involved in regulating some of the events associated with the seas onal reproductive cycle in male S. tiburo The immunocytochemical methods used in th is study demonstrated the presence of the functional AR protein using an antibody rais ed against the first 21 amino acids of the human AR. The high degree of amino aci d sequence conservation of this region increases the likelihood of cro ss-reactivity with the AR of other species. The PG-21 antibody has been previously used to identify ARs in the bullfrog Rana catesbeiana (Boyd et al ., 1999), red-bellied newt Cynops pyrrhogaster (Matsumoto et al ., 1996), rat Rattus norvegicus (Prins et al ., 1991), and goat Capra hircus (Goyal et al ., 1998). The specificity of this antibody to S. tiburo AR is supported by the results of the preadsorbed controls where AR staining in testis s ections was abolished when the antibody was previously incubated with the pe ptide used to produce the antibody.

PAGE 69

57 Testis Semi-quantitative PCR of testis samples reveal ed that AR expression levels were lowest during the resting phase (December-April) of the reproductive cycle, highest during spermatogenesis (May-August), and intermed iate during the mating period (SeptemberNovember) when spermatozoa are primarily be ing stored and not produced (Parsons and Grier, 1992). These results sugge st that the extent to which androgens regulate events in the testis of S. tiburo is dependent upon the seasonal st ages of the reproductive cycle. On a cellular level, evidence of AR protein in the Sertoli cells of pre-meiotic spermatocysts suggests that androgens may play a role in regulating the actions of these cells. Sertoli cell action in the shark testis, in addition to maintaining the microenvironment of the germ cells, is beli eved to include the production of steroid hormones (Callard et al ., 1978; Callard, 1991). The findings in the present study agree with reports of AR immunoreac tivity in adluminal Sertoli cell nuclei of spermatogonial stage spermatocysts of the S. acanthias using AR52 as the primary antibody (Engel and Callard, 2005). However, the latter study pr esented only preliminar y ICC results of AR in the testis of S. acanthias which precludes a detailed comparison with the present study’s findings on S. tiburo This same AR52 antibody did not produce reliable immunostaining when utilized in ICC on testis sections of S. tiburo The detection of AR mRNA in the Sertoli cells of S. tiburo is further evidence of an androgen associated role in regulating this cell type. The presence of AR mRNA in the Sertoli cells of postmeiotic spermatocysts, but not in the earlier stages, may indicate that the AR transcripts at these earlier stages were at levels below the threshold of detection of the methodology.

PAGE 70

58 The lack of AR protein associated with th ese post-meiotic Sertoli cells may reflect a cessation in AR mRNA translation in this cell type thus resulting in levels of transcripts that were detectable. Sertoli cells in the m ouse testis also demonstrated stage-specific AR expression with the highest levels during stages VI-VII and the lowest levels during stages I-III and VIII-XII of sp ermatogenesis. Stage-depe ndent expression of AR in Sertoli cells has been similarly described in the rat (Vornberger et al. 1994) and human (Surez-Quian et al ., 1999). By generating a knockout mouse with the AR gene deleted only in Sertoli cells, Chang et al. (2004) demonstrated that f unctional AR was required in this cell type to ensure normal spermatogene sis. Defective spermatogenesis due to the AR-negative Sertoli cells was partly attribut ed to increased expression of anti-Mllerian hormone which led to impaired steroidogenesi s in Leydig cells. Also contributing to impaired spermatogenesis and infertility in these transgenic mice was an increase in androgen-binding protein, a decrease in cyclin A1 and sperm-1 expression, as well as an overall reduction in serum T levels. AR expression in the present study was also loca lized in the Leydig-like cells of the testis as demonstrated by both in situ hybridization and immunocytoc hemistry. The zones of spermatocysts demonstrating the greatest leve l of AR expression were those containing primary and secondary spermatocytes. These observations suggest an important role for androgens around the meiotic stage of spermato genesis. Evidence of AR expression was also observed in the Leydig-like cells betw een more advanced spermatocysts containing early and late stage spermatids indicating an androgen-associated role later in spermiogenesis (post-meiotic stages). Thes e observations largely agree with the stage-

PAGE 71

59 related distribution of AR -like activity found in the S. acanthias which demonstrated the highest levels of steroid-bindi ng activity in the pre-meiotic stages followed by the meiotic and the post-meiotic stages (Cuevas and Calla rd, 1992). Stage-related AR expression of this cell type has also been observed in the marbled newt ( Triturus marmoratus Marmoratus ) where interstitial cells were shown to be AR-positive during only the periods of spermatogenesis and quiescence (Arenas et al ., 2001). In contrast, Leydig cells in the mouse ( Mus musculus) express AR regardless of the stage of spermatogenesis (Zhou et al ., 2002). A role for androgens in the post-meiotic stag es of spermatogenesis in the elasmobranch testis is supported by the results of the present study as well as a study on S. acanthias (Cuevas and Callard, 1992). However, th e observation of AR mRNA in the round and elongate spermatids coupled with the absence of the AR protein in these same cell types is unusual. Using the same PG-21 antibody, the AR protein was recen tly localized in the spermatocytes of D. sabina suggesting that androgens can act directly on germs cells to regulate spermatogenesis in an elasmobran ch (J. Gelsleichter, personal communication, April 1, 2007). This type of stage-specific AR expression in developing germ cells has also been described in mammals. For example, the rat AR protein has been detected in the nuclei of elongated spermatids (Vornberger et al. 1994). Once chromatin condensation had occurred in these cells, the AR was no longer localized in the nuclei but was observed in the cytoplasm of the sperma tids. Immunocytochemical localization of AR has also been demonstrated in the premeiotic and meiotic germ cells of the mouse (Zhou et al ., 1996) and human (Kimura et al ., 1993). It is possible that the titer of the

PAGE 72

60 PG-21 antibody used in the present study may have been too low to detect the AR protein in the spermatids and spermatozoa of the testis, despite being well-suited for AR detection in other cell types. Varying the concentration of PG-21 in ICC has shown very different levels of AR immunostaining of certa in cell types, such as Sertoli and Leydig cells, in the human testis (Surez-Quian et al ., 1999). This possibility was addressed in the present study by doubling the concentration of PG-21 used during ICC on sections of S. tiburo reproductive organs. However, the resu lts remained consistent with those from ICC using the original antibody titer. Despite the strong AR mRNA signal detected in post-meiotic germ cells, we must conclude that the AR protein in the testicular germ cells of S tiburo is either absent or presen t at levels that are below the threshold of detection of this study’s immunocytochemical methods. Epididymis On a cellular level, there was no evidence from the ICC and ISH of the presence of AR in the epithelial cells of the epididymis despite the presence of ARs. This suggests that the AR expression levels revealed through semi -quantitative RT-PCR of epididymis samples were likely from mRNA in the spermatozoa of this organ’s lumen. The lack of AR expression in S. tiburo is in contrast to the AR lo calization demonstrated in the epididymis of other vertebrates. Among the AR-positive cells were epithelial and stromal cells in the rat and mouse (Yamashita, 2004) and prin cipal and basal cells in the adult boar ( Sus scrofa ) epididymis (Pearl et al. 2006). Survival of spermatozoa in this organ has also been found to be andr ogen dependent in the tammar wallaby ( Macropus eugenii ) (Chaturapanich et al. 1992). In this same study, orchidectomy resulted in

PAGE 73

61 reduced concentrations of spermatozoa, decr eased luminal fluid volume, and changes in the electrophoretic pattern of proteins in the epididymis. The effect s of the orchidectomy were reduced or prevented by the replacement of exogenous testosterone. Through ultrastructural studies of the Port Jackson shark ( Heterodontus portusjacksoni ), the cells of the epididymis have been classi fied as ciliated cells, principal cells, and intraepithelial leucocytes and function in both protein secretion and tr ansport of fluid and solutes (Jones and Lin, 1993). In freshwater populations of D. sabina morphological changes and alterations of the histological architect ure of the epididymis have been found to coincide with seasonal reproductive stages (Piercy et al. 2003). However, a direct role for androgens in mediating these structural m odifications is unclear as these changes do not coincide with rises in T and DHT serum concentrations (Snelson et al. 1997). Failure to detect AR in the epididymal cells of S. tiburo suggests that th is organ is not directly responsive to androgens but ma y be mediated by other hormonal signals. The AR-positive tissue associated with the epididymis was identified as the Leydig gland, a specialized portion of the anterior mesonephros comprised of simple columnar epithelium with secretory a nd ciliated cells (Jamieson, 200 5). This gland has been described in the H. portusjacksoni as a series of branched tu bular glands that secretes eosinophilic bodies into the sp ermatozoa-carrying epididymis (Jones and Jones, 1982). Jones and Lin (1993) performed ultras tructural studies on this gland in H. portusjacksoni and determined that these s ecretory tubules are specialized for protein synthesis and secretion. Previous electron micrograph work indicated that some of these secreted

PAGE 74

62 proteins become associated with spermato zoa and may be the basis for spermatozoa bundle formation (Jones et al. 1984). The present study prov ides the first evidence that the actions of the elasmobranch Leydig gla nd may be regulated by androgens. However, the kidney of non-mammalian species (Young et al. 1995; Blasquez and Piferrer, 2005) and the analogous mammalian prostate (Cooke et al. 1991; Prins and Birch, 1995; Pelletier et al. 2000) have been demonstrated as ta rgets for androgens. Since the AR positive Leydig gland lies immediately dorsal to the epididymis, it is possible that some of the expression observed in this study’s se mi-quantitative PCR of the epididymis could result from contamination from the Leydig gland. The possibility of Leydig gland contamination of epididymis samples woul d most likely have been from samples dissected during the resting stage when the epid idymis is difficult to separate from the adjacent Leydig gland using routine dissection procedures. Seminal Vesicle There was no definitive evidence of AR in the epithelial cells, c onnective tissue, and contractile smooth muscle of the seminal vesicle in S. tiburo Therefore, the AR transcripts that were detected by semi-quantitative PCR from these tissues are most likely from spermatozoa mRNA contained within th e lumen of this orga n. The responsiveness of the seminal vesicle to androgens has not been evaluated in any other elasmobranch species to date. However, the ultrastructure of this organ has been described in a few chondrichthyans. For example in the ghost shark ( Callorhynchus milii ), the seminal vesicles are characterized by spiral sept a that project into the lumen (Hamlett et al ., 2002; Reardon et al. 2002). The epithelial cells in C. milii are simple columnar with

PAGE 75

63 microvillar and ciliated cells, with no evidence of secretory vesicles (Hamlett et al ., 2002; Reardon et al. 2002). This suggests the seminal vesi cle does not contribute to seminal fluid in this species but rath er stores and then delivers spermatozoa to the clasper (Reardon et al ., 2002). However in D. sabina epithelial cell proliferation in the seminal vesicle was found to be significantly elevat ed during both early and late periods of spermatogenesis compared to the re productively inactive stages (Piercy et al. 2003). The latter study hypothesized th at the accelerated ep ithelial growth observed during these spermatogenic stages is to facilitate the maintenance of spermatozoa during the protracted mating period observed in D. sabina and that these changes are likely to be androgen-mediated. The lack of evidence in S. tiburo for a direct role of androgens in the seminal vesicle contrasts a previous study of the rat wh ere AR immunostaining was demonstrated in the epithelial and stromal cells of the seminal vesicle by ICC (Pelletier et al. 2000). Although this study did not find evidence of AR in S. tiburo, it cannot rule out the possibility of downstream effects of thes e hormones or simply that these cells are regulated differently in this species. Furt her, the present study focused on mature male S. tiburo and did not perform a detailed evalua tion of ARs during embryonic and juvenile development of these structures. Spermatozoa The isolation of AR mRNA in spermatozoa of the present st udy does not appear to be an artifact of the ISH methodology gi ven the consistent level of de tection in the lumen of the epididymides and seminal vesicles as well as the similar detection of AR mRNA in the spermatids and spermatozoa of the testes. Sp ermatozoa are generally considered as being

PAGE 76

64 dormant cells given the loss of their tran scriptional and translational ability and specialized role in transpor ting the paternal genome to the oocyte (Hecht, 1998). Given this understanding, the detection of AR mRNA within the lumen of both the epididymis and seminal vesicle in this study was an une xpected but interesting finding. However, advancements in the field of molecular andrology has led to a compelling body of evidence demonstrating that human ejaculated spermatozoa retain a complex cohort of mRNAs (Dadoune et al. 2005; Zhao et al. 2006). Among the many identified transcripts in human spermatozoa are estrogen receptor (Richter et al ., 1999), estrogen receptor (Hirata et al ., 2001), and the progesterone receptor (Luconi et al ., 2002). However to date, no androgen receptor transcript s have been detected in spermatozoa. In contrast to the AR mRNA localization th rough ISH, the ICC conducted in this study did not show evidence of the AR protein in the spermatozoa of the epididymides and seminal vesicles of S. tiburo In an effort to addr ess the question of antibody concentration, ICC on epididymides and semina l vesicles using twi ce the standard PG-21 titer resulted in similar results with no ev idence of AR immunostaining in spermatozoa. These results contrast a recent finding of AR protein in the mitochondria of the mid-piece of human spermatozoa (Solakidi et al ., 2005). This study utilized alternative antibodies (H280 and C19) and immunofluorescence labeling to localize the AR on a cellular level. They also detected 110and 90-kDa protei n bands from spermatozoa lysates using western blotting and an enhanced chemilumine scence system. Hence it is possible that the lack of detection of the AR protein in certain cell types of S. tiburo could reflect methodological difficulties that may be overcome with a more sensitive detection system.

PAGE 77

65 Another possible explanati on for the presence of AR mRNA in the sperm of S. tiburo, without the presence of the protein, is that these transcripts are se lectively retained to play a role at a later time. Recent studie s demonstrating mRNA transcripts in human ejaculated spermatozoa have created controve rsy over the potential role of spermatozoa RNA and led to hypotheses that these transcri pts may play an important role in the establishment and maintenance of a viable paternal genome (Miller et al. 2005). In a recent review, Miller and Ostermeier (2006) discussed the reports of RNA carriage in human ejaculate spermatozoa and examined various explanations for possible roles including passive retention, genomic imprinti ng, and a post-fertilization role for paternal RNAs. Gur and Breitbard (2006) recently demonstrated that the 55S mitochondrial ribosomes in human, mouse, rat, and bovi ne spermatozoa conduct nuclear encoded protein translation during capacitation. They further concluded that this translational process is essential for spermatozoa to functi on in fertilization. T hus the notion that AR mRNA is selectively retain ed in the spermatozoa of S. tiburo is worthy of further scrutiny given the expanding evidence that the male gamete performs a role beyond simple delivery of the paternal genom e (Miller and Otermeier, 2006). Claspers In at least 2 elasmobranch species, peak plasma T levels have been reported to coincide with increased clasper size (Garnier, 1999; Heupel et al. 1999). However, there have been no studies that have demonstrated a direct androgen sensitivity of this organ. In a study measuring serum steroid horm one levels in captive pubertal S. tiburo androgen concentrations were not directly correlated w ith the rate of clasper growth (Gelsleichter et

PAGE 78

66 al. 2002). Injections of T into the yolk sac of the smallspotted catshark ( Scyliorhinus canicula ) before sex differentiation demonstr ated no macroscopic effect on the development of the claspers (Chieffi, 1967) The AR expression observed through RTPCR in the present study appears to be the firs t direct evidence of a ndrogen sensitivity of this secondary sex structure. In teleos ts, androgen dependent development of the gonopodium, the modified anal fin, has been studied in the western mosquitofish ( Gambusia affinis ). Ogino et al (2004) demonstrated AR and AR expression in the distal region of the outgrowing anal fin rays. However, after observing similar AR expression in other fins, these authors furt her showed an androgen-dependant induction of sonic hedgehog (Shh) and Shh receptor (Ptc1) genes in the developing gonopodium. Because Shh is a signaling molecule involved in fin regeneration (Quint et al. 2002), these results suggest that development of the male’s anal fin rays are mediated by downstream genes that are influenced by androgen actions. The elasmobranch clasper is composed of car tilaginous elements that support the medial margin of the pelvic fin and extend past th e posterior margin as a rod (Wourms, 1977). Upon maturity, these intromittent orga ns calcify and harden (Carrier et al. 2004), making the histological preparation of these structur es difficult. In the present study, clasper tissues processed for ICC yielded poor and in conclusive results. Furthermore, the low numbers of cells in these la rgely cartilaginous structur es was not optimal for RNA isolation. For this reason, this study did not attempt to measur e the levels of AR expression in clasper RNA. Future studies should focus on improving the methodology by decalcifying these structures prior to histological processing to overcome these

PAGE 79

67 problems and gain a better understanding of the role of androgens in mediating these secondary sex characters. Embryos Though not the main focus of this study, a pr eliminary evaluation was conducted of AR in the embryos of S. tiburo The observed AR expressi on in the embryonic kidney has not been described in other elasmobran chs although the adul t kidney has been demonstrated to be AR-positive in a nu mber of other non-mammalian species (Young et al. 1995; Ogino et al ., 2004; Blasquez and Piferrer, 2005) In mammals, AR expression has been observed in the embryonic male re productive organs including the Wolffian ducts, epididymides, ductus deferens and seminal vesicles (Cooke et al. 1991). This same study also indicated that androgen-med iated events in the embryo of the mouse have a clear temporal sequence. This is an important observation as the lack of evidence of AR expression in the embr yonic reproductive structures ex amined in the present study may be related to the limited temporal view of these tissues that may be expressing genes in a time sensitive pattern. Heart The expression of the AR gene in heart tissu e was examined by PCR with the intention of utilizing this organ as a nega tive control. However, the weakly positive results from the screening precluded this organ for that purpose. The findi ng of AR expression in the heart is not unprecedented in verteb rates. In the domestic dog ( Canis familiaris ), RTPCR analysis demonstrated low levels of expression in this organ (Lu et al ., 2001).

PAGE 80

68 Western blot analysis of whole tissue extracts of th e heart of the bullfrog ( Rana catesbeiana ) revealed a 100 kDa band corre sponding to AR (Chattopadhyay et al ., 2003). On a cellular level, ARs have been demonstr ated in the cardiac myocytes of several mammalian species including R. norvegicus C. familiaris and Homo sapiens (Marsh et al ., 1998). In a study to define the biologica l significance of cardiac AR function, AR knock-out male mice were found to have a si gnificant reduction in heart-to-body weight ratio compared to wild-type mice suggesting an androgen role in cardiac growth and modulation of cardiac ad aptive hypertrophy (Ikeda et al ., 2005). Steroid Hormones In mature male S. tiburo circulating androgen levels follow an annual cycle that is correlated with the reproductive stage of th e animal. Serum T and DHT concentrations have been shown to increase during the middle to late stages of the spermatogenic phase (late spring to summer), drop during the mating season (fall) and then remain at their lowest levels during the quies cent phase (winter to early spring) (Manire and Rasmussen, 1997). The present study has found a similar pattern with the androgen receptor which supports the notion that andr ogens regulate spermatogenesi s but also play role in regulating other primary and secondary se x characters during other phases of the reproductive cycle. When considering the lack of evidence for a direct role of androgens in a given cell or tissue via the receptor, one cannot rule out an indirect role as downstream genes may be important in regulating certain processes. It is worth noting that estrogen (E2) receptors have also been found in male reproductive tissue in several mammalian and non-mammalian species (Goyal et al. 1998; Pelletier et

PAGE 81

69 al. 2000; Arenas et al. 2001) and that the existence of multiple receptors in the same cells raises questions about steroid hormone in teractions in mediati ng the function of the male reproductive tract. In the case of S. tiburo Manire and Rasmussen (1997) found that testicular recrudescence coinci ded with an elevation of serum E2 levels and postulated that this “female” hormone could f unction to regulate spermatogenesis in the species. This notion is supported by the locali zation of estrogen receptors in regions of the S. acanthias testis containing pre-meiotic spermatocysts (Callard et al. 1985; Callard, 1992). Future Directions Sertoli cells and Leydig-like cells of the test is are assumed to be the primary source of androgens in S. tiburo. Evaluating the importance of these types of cells in androgen synthesis and the possible autocrine/paracr ine means of regulation would enhance the overall understanding of this steroid’s functiona l role in this species. One approach to address this is to use ICC with antibodies ag ainst some of the key steroidogenic enzymes, such as cytochrome P450c17 and 3 -dehydrogenase (Trant, 1996; Baker et al ., 1999). Although this study focused on identifying AR in reproductive tissues in male S. tiburo it is likely there are other andr ogen-regulated tissues/organs th at were not evaluated given the scope of this study. For example, serum a ndrogen levels have been shown to increase in males during the mating season in so me elasmobranch species (Snelson et al. 1997; Tricas et al. 2000) suggesting an androgenic role in mating behavior. Studies of the goldfish ( Carassius auratus ) have identified AR positive neur ons in brain tissue (Gelinas and Callard, 1997). Hence a future study to identify ARs in the brain of S. tiburo would

PAGE 82

70 contribute to our understanding of the role of androgens in mediating elasmobranch courtship and mating behavior. This study evaluated the AR expression patte rn in embryos of a size and age that corresponds to the period of sexual differentiation (J Gelsleichter, personal communication, April 11, 2007). However, AR expression in the embryos of S. tiburo may be finely regulated on a temporal level as demonstrated in the mouse reproductive tract (Cooke et al ., 1991). To address this possibilit y, future studies should evaluate the expression of AR throughout all stages of embryonic development wh ile at the same time maximizing the cross-sectional coverage of each sample in order to evaluate as many organs as possible. To further evaluate the presence of AR mRNA in the spermatozoa of S. tiburo semen samples could be collected from adult males during the mating season and purified by the swim-up technique to select for live sp erm and remove somatic contaminations (Hargreaves et al ., 1998). Extracted RNA from the pur ified gametes could be evaluated for AR expression using some of the mo lecular tools develo ped in this study. Lastly, the localization of estroge n receptors in the testis of S. acanthias (Callard et al. 1985; Callard, 1992) raises the hypothesis th at androgen and estrogen cooperate in regulating spermatogenesis in S. tiburo Hence a similar study of the cellular localization of estrogen receptors in the primary and s econdary sex structures would provide data toward understanding steroid-mediated cont rol of male reproduction in this species.

PAGE 83

71 Conclusions This study demonstrates that AR is expr essed in the testis of mature male S. tiburo during all stages of its seasonal re productive cycle, but expressi on appears high est during the summer spermatogenic stage. Cell-specific loca lization of AR in the testis appears stagerelated. The expression pattern of AR in Leydig-like cells sugge sts that they are primarily regulated by androgens just pr ior to and during th e meiotic stage of spermatogenesis but there is also evidence fo r post-meiotic androgen regulation of this cell type. Sertoli cells appear to be androge n sensitive in the meiotic stages. There is evidence of AR mRNA in the spermatids and spermatozoa of late stage spermatocysts but the role of these transcripts is yet to be determined since the functional AR protein was not detected in these developing germ ce lls. RT-PCR revealed that the epididymis and seminal vesicle of mature S. tiburo express AR in all stages of the male’s seasonal cycle, but expression is signifi cantly lower during the winter/spr ing resting stage. On the cellular level, there is no evidence of AR in either of these reproductive structures. However, AR mRNA was localized in the sp ermatozoa of both the epididymis and seminal vesicle. This study provides the firs t evidence that the action of the Leydig gland is associated with androgens. The clasper of S. tiburo was found to express AR but the cellular localization of the recep tors in this structure was not determined. A preliminary evaluation of AR in the embryos of this spec ies revealed that the developing kidneys may be a site of action of androgenic hormones.

PAGE 84

72 Although there appears to be considerable vari ability in the regulator y role of androgens in the male reproductive tract, both among and within vertebrate classes, S. tiburo seems to share many of the same AR characteristic s as more derived species. The seemingly advanced mechanism by which these ancient fishes are using steroid hormones to regulate reproductive events is an area requi ring further study. Future studies should work toward gaining a deeper understanding of the effect of these hormones on their target cells. The present st udy has provided a basis for such research by identifying some of the cells and tissues that androgens target in S. tiburo

PAGE 85

73 List of References Altschul, S.F., Madden, T.L., Schffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new ge neration of protein database search programs. Nucleic Acids Res 25 3389-3402. Arenas, M.I., Royuela, M., Lobo, M.V.T., Alfa ro, J.M., Fraile, B., Paniagua, R., 2001. Androgen receptor (AR), estrogen receptor-alpha (ER) and estrogen receptor-beta (ER) expression in the testis of the newt, Triturus marmoratus marmaratus during The annual cycle. J. Anat. 199 465-472. Baker, M.E., 1997. Steroid receptor phylogeny and vertebrate origins. Mol. Cell. Endocrinol 135 ,101-107. Baker, M.E. 2003. Evolution of adrenal and se x steroid action in ve rtebrates: a ligandbased mechanism for complexity. Bioessays 25 396-400. Baker, P.J., Sha, J.A., McBride, M.W., Peng, L., Payne, A.H., O’Shaughnessy, P.J., 1999. Expression of 3 -hydroxysteroid dehydrogenase type I and type VI isoforms in the mouse testis during development. Eur. J. Biochem 260 911-916. Beato, M., 1989. Gene regulat ion by steroid hormones. Cell. 56 335-344. Belle, M.D., Lea, R.W., 2001. Androgen recepto r immunolocalization in brains of courting and brooding male and female ring doves (Streptopelia risoria ). Gen. Comp. Endocrinol. 124 173-187. Betka, M., Callard, G.V., 1998. Cloning of an androgen receptor cDNA from Squalus acanthias testis The Bulletin: Mount Desert Island Biological Laboratory 37 111. Blzquez, M., Piferrer, F., 2005. Sea bass ( Dicentrarchus labrax ) androgen receptor: cDNA cloning, tissue-specific expression, a nd mRNA levels during early development and sex differentiation. Mol. Cell. Endocrinol 237 37-48. Borg, B., 1994. Androgens in teleost fishes. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol 109 219-245. Bowman, C.J., Denslow, N.D., 1999. Developmen t and validation of a speciesand gene specific molecular biomarker: vitellogenin mRNA in largemouth bass ( Micropterus salmoides ). Ecotoxicology 8 399-416.

PAGE 86

74 Boyd, S.K., Wissing, K.D., Heinsz, J.E., Pr ins, G.S., 1999. Androgen receptors and sexual dimorphism in the larynx of the bullfrog. Gen. Comp. Endocrinol 113 59-68. Braun, A.M., Thomas, P., 2004. Biochemical ch aracterization of a membrane androgen receptor in the ovary of the Atlantic croaker ( Micropogonias undulatus ). Biol Reprod 71 146-155. Butler, C.M., Harry, J.L., Deakin, J.E., Cooper, D.W., Renfree, M.B., 1998. Developmental expression of the androgen r eceptor during virilizati on of the urogenital system of a marsupial. Biol Reprod 59 725-732. Callard, G.V., 1988. Reproductive Physiology (Part B: The male). In “ Physiology of elasmobranch fishes ” (T. J. Shuttleworth, Ed.), pp. 292-317. Springer-Verlag, Heidelberg. Callard, G., 1991. Reproduction in male elasmobranch fishes. In “Oogenesis, spermatogenesis and reproduction” (R. Ki nne, E. Kinne-Saffran, and K. Beyenbach, Eds.), pp 104-154. Karger, Basel. Callard, G.V., 1992. Autocrine and paracrine role of steroids during spermatogenesis: studies in Squalus acanthias and Necturus maculosus J. Exp. Zool 261 132-142. Callard, I.P., Callard, G.V., Lance, V., Bo laffi, J.L., Rosset, J.S., 1978. Testicular regulation in non-mammalian vertebrates. Biol. Reprod 18 16-43. Callard, G.V., Pudney, J.A., Mak, P., Canic k, J.A., 1985. Stage-dependent changes in steroidogenic enzymes and estrogen receptors during spermatogenesis in the testis of the dogfish, Squalus acanthias Endocrinology 117 1328-1335. Carrier, J.C., Pratt, Jr., H.L., Castro, J.I., 2004. Reproductive biology of elasmobranchs. In “Biology of sharks and their relatives” (J. C. Carrier, J. A. Musick, and M. R. Heithaus, Eds.), pp. 269-286. CRC Press, Boca Raton, FL. Chang, C., Chen, Y.T., Yeh, S.D., Xu, Q., Wa ng, R.S., Guillou, F., Lardy, H., Yeh, S., 2004. Infertility with defective spermatoge nesis and hypotestosteronemia in male mice lacking the androgen receptor in Sertoli cells. Proc. Natl. Acad. Sci. Unit. States Am 101 6876-6881. Chattopadhyay, S., Park, J.H., Seong, J.Y ., Kwon, H.B., Lee, K., 2003. Cloning and characterization of andr ogen receptor from bullfrog, Rana catesbeiana Gen. Comp. Endocrinol 134 10-17. Chaturapanich, G., Jones, R.C., Clulow, J., 1992. Role of androgens in survival of spermatozoa in epididymis of tammar wallaby (Macropus eugenii ). J. Reprod. Fertil 95 421-429.

PAGE 87

75 Chen, Y., Zajac, J.D., MacLean, H.E., 2005. Androgen regulation of satellite cell function. J. Endocrinol 186 21-31. Chieffi, G., 1967. The reproductive system of elasmobranchs: development and endocrinological aspects. In “Sharks, rays and skates” (P. W. Gilbert, R. F. Mathewson, and D. P. Rall, Eds.), pp. 553-580. Johns Hopkins Press, Baltimore, MD. Chieffi, P., Franco, R., Fulgione, D., and St aibano, S., 2000. PCNA in the testis of the frog, Rana esculenta : a molecular marker of the mitotic testicular epithelium proliferation. Gen. Comp. Endocrinol 119 11-16. Collenot, G., 1969. Etude biomtrique de la croi sssance relative des pterygopodes chez la roussette Scyliorhinus canicula (L). Cah. Biol. Mar 10 309-323. Cooke, P.S., Young, P., Cunha, G.R., 1991. Androge n receptor expression in developing male reproductive organs. Endocrinology 128 2867-2873. Cuevas, M.E., Callard, G.V., 1992. Androgen and progesterone receptors in shark (Squalas) testis: characteristic s and stage-related distribution. Endocrinology 130 21732182. Dadoune, J.P., Pawlak, A., Alfonsi, M.F., Siffr oi, J.P., 2005. Identification of transcripts by macroarrays, RT-PCR and in situ hybridization in human ejaculate spermatozoa. Mol. Hum. Reprod 11 133-140. Dijkman, H.B.P.M, Mentzel, S., de Jong, A.S., Assmann, K.J.M., 1995. RNA in situ hybridization using digoxige nin-labeled cRNA probes. Biochemica (U.S. version) 2 23-27. DuBois, W., Mak, P., Callard, G.V., 1989. Sertol i cell functions during spermatogenesis: the shark testis model. Fish Physiol. Biochem 7 221-227. Engel, K.B., Callard, G.V., 2005. Th e testis and spermatogenesis. In “Reproductive biology and phylogeny of Chondrichthyes: sharks, batoids, and chimeras” (W.C. Hamlett, Ed), pp. 171-200. Science Publishers, Enfield, NH. Evans, R.M., 1988. The steroid and thyroid hormone receptor superfamily. Science 240 889-895. Garnier, D.H., Sourdaine, P., Jegou, B., 1999. S easonal variations in sex steroids and male sexual characteristics in Scyliorhinus canicula Gen. Comp. Endocrinol 116 281290. Gelinas, D., Callard, G.V., 1997. Immunoloca lization of aromataseand androgen receptor-positive neurons in the goldfish brain. Gen. Comp. Endocrinol 106 155-168.

PAGE 88

76 Gelsleichter, J., 2004. Hormonal regul ation of elasmobranch physiology. In “ Biology of sharks and their relatives” (J. C. Carrier, J. A. Musick, and M. R. Heithaus, Eds.), pp. 287-323. CRC Press, Boca Raton, FL. Gelsleichter, J., Rasmussen, L.E.L., Manire C.A., Tyminski, J., Chang, B., LombardiCarlson, L., 2002. Serum steroid concentra tions and development of the reproductive system during puberty in male bonnethead sharks, Sphyrna tiburo Fish Physiol. Biochem 26 389-401. Gelsleichter, J., Steinetz, B.G., Mani re, C.A., Ange, C., 2003. Serum relaxin concentrations and reproduc tion in male bonnethead sharks, Sphyrna tiburo Gen. Comp. Endocrinol. 132 27-34. Gilbert, S.G., 1973. Pictorial anatomy of the dogfish. University of Washington Press. Seattle. Goyal, H.O., Bartol, F.F., Wiley, A.A., Kh alil, M.K., Williams, C.S., Vig, M.M., 1998. Regulation of androgen and estrogen receptors in male excurrent ducts of the goat: an immunohistochemical study Anat. Rec 250 164-171. Gur, Y., Breitbart, H., 2006. Mammalian sp erm translate nuclear-e ncoded proteins by mitochondrial-type ribosomes. Gene. Dev 20 411-416. Hadley, M.E., 2000. Endocrinology. Fifth editio n. Prentice Hall, Upper Saddle River, NJ. Hamlett, W.C., Reardon, M., Clark, J., Walk er, T.I., 2002. Ultrastructure of sperm storage and male genital ducts in a male holocephalan, the elephant fish, Callorhynchus milii J. Exp. Zool 292 111-128. Hargreaves, C.A., Rogers, S., Hills, F., Ra hman, F., Howell, R.J.S., Homa, S.T., 1998. Effects of co-trimoxazole, erythromycin, amoxicillin, tetracycline, and chloroquine on sperm function in vitro Hum. Reprod. 13 1878-1886. Hecht. N.B., 1998. Molecular mechanisms of male germ cell differentiation. BioEssays 20 555-561. Heinlein, C.A., Chang, C., 2006. Androgen receptor (AR) core gulators: an overview. Endocr. Rev 23 175-200. Henikoff, S., Henikoff, J.G., Alford, W.J., Pietrokovski, S., 1995. Automated construction and graphical presentation of protein blocks from unaligned sequences. Gene 163 GC17-26. Heupel, M.R., Whittier, J.M., Bennett, M.B., 1999. Plasma steroid hormone profiles and reproductive biology of the epaulette shark, Hemiscylium ocellatum J. Exp. Zool 284 586-594.

PAGE 89

77 Herrin, D.L., Schmidt, G.W., 1988. Rapid, reversib le staining of norther n blots prior to hybridization. Biotechniques 6 196-200. Hill, C.M., Anway, M.D., Zirkin, B.R., Brow n, T.R., 2004. Intratesticular androgen levels, androgen receptor localization, and androgen receptor expression in adult rat Sertoli cells. Biol. Reprod 71 1348-1358. Hirata, S., Shoda, T., Kato, J., Hoshi, K ., 2001. The multiple untranslated first exons system of the human estrogen receptor beta (ER ) gene. J. Steroid Biochem. Mol. Biol 78 33-40. Holstein, A.F., 1969. Zur frange der lokalen steuerung der spermatogenese beim dornhai ( Squalus acanthias ). Z. Zellforsch 93 265-281. Ikeda, Y., Aihara, K., Sato, T., Akaike, M., Yoshizumi, M., Suzaki, Y., Izawa, Y., Fujimura, M., Hashizume, S., Kato, M., Yagi, S., Tamaki, T., Kawano, H., Matsumoto, T., Azuma, H., Kato, S., and Matsumoto, T., 2005. Androgen receptor gene knockout male mice exhibit impaired cardiac growth and exacerbation of angiotensin II-induced cardiac fibrosis. J. Biol. Chem 280 29661-29666. Jamieson, B.G.M., 2005. Chondrichthyan spermatozoa and phylogeny. In “Reproductive biology and phylogeny of Chondrichthyes: sharks, batoids, and chimeras” (W.C. Hamlett, Ed), pp. 201-236. Science Publishers, Enfield, NH. Jones, S.N., Jones, R.C., 1982. The structure of the male genital system of the Port Jackson shark, Heterodontus portusjacksoni with particular refere nce to genital ducts. Aust. J. Zool 30 523-541. Jones, R.C., Jones, W., Djakiew, D., 1984. Luminal composition and maturation of spermatozoa in the male genita l ducts of the Port Jackson shark, Heterodontus portusjacksoni J. Exp. Zool 230 417-426. Jones, R.C., Lin, M., 1993. Structure and functions of the genital ducts of the male Port Jackson shark, Heterodontus portusjacksoni Environ. Biol. Fish 38 127-138. Keller, E.T., Ershler, W.B., Chang, C., 1996. The androgen receptor: a mediator of diverse responses. Front. Biosci 1 d59-71. Kimura, N., Mizokami, A., Oonuma, T., Sasano, H., Nagura, H., 1993. Immunocytochemical localization of a ndrogen receptor with polyclonal antibody in paraffin-embedded human tissues. J. Histochem. Cytochem 41 671-678. Lu, B., Smock, S.L., Castleberry, T.A., Owen, T.A., 2001. Molecular cloning and functional characterization of the canine androgen receptor. Mol. Cell Biochem 226 129-140.

PAGE 90

78 Luconi, M., Bonaccorsi, L., Bini, L., Liberatori S., Pallini, V., Forti, G., and Baldi, E., 2002. Characterization of membrane nongenom ic receptors for progesterone in human spermatozoa. Steroids 67 505-509. Manire, C.A., Rasmussen, L.E.L., Hess, D.L., Hueter, R.E., 1995. Serum steroid hormones and the reproductive cycle of the female bonnethead shark, Sphyrna tiburo Gen. Comp. Endocrinol 97 366-376. Manire, C.A., Rasmussen, L.E.L., 1997. Serum con centrations of steroid hormones in the mature male bonnethead shark, Sphyrna tiburo Gen. Comp. Endocrinol 107 414-420. Manire, C.A., Rasmussen, L.E.L., Gross, T.S., 1999. Serum steroid hormones including 11-ketotestosterone, 11-ket oandrostenedione and dihyrdropr ogesterone in juvenile and adult bonnethead sharks, Sphyrna tiburo J. Exp. Zool 284 595-603. Marina, P., Annamaria, L., Barbara, D., Lo redana, R., Piero, A., and Francesco, A., 2002. Fine structure of Leydig and Sertoli cells in the testis of immature and mature spotted ray Torpedo marmorata Mol. Reprod. Dev 63 192-201. Marsh, J.D., Lehmann, M.H., Ritchie, R.H., Gw athmey, J.K., Green, G.E., Schiebinger, R.J., 1998. Androgen receptors mediate hypertrophy in cardiac myocytes. Circulation 98 256-261. Matsumoto, A., Arai, Y., Toyoda, F., Ki kuyama, S., and Prins, G.S., 1996. Immunohistochemical analysis of androgen receptor in th e abdominal glands of the cloaca of male red-bellied newts, Cynops pyrrhogaster Zool. Sci 13 429-433. Miller, D., Ostermeier, G.C., Krawetz, S.A ., 2005. The controversy, potential and roles of spermatozoal RNA. Trends Mol. Med 11 156-163. Miller, D., Ostermeier, G.C., 2006. Towards a better understanding of RNA carriage by ejaculate spermatozoa. Hum Reprod. Update 12 757-767. Nastiuk, K.L., Clayton, D.F., 1994. Seasonal an d tissue-specific regulation of canary androgen receptor messenger ribonucleic acid. Endocrinology 134 640-649. Nichols, S., Gelsleichter, J., Manire, C.A., Cailliet, G.M., 2003. Calcitonin-like immunoreactivity in serum and tissues of the bonnethead shark, Sphyrna tiburo J. Exp. Zool 298A 150-161. Ogino, Y., Katoh, H., and Yamada, G., 2004. Androgen dependent development of a modified anal fin, gonopodium, as a model to understand the mechanism of secondary sexual character expression in vertebrates FEBS Letters 575 119-126.

PAGE 91

79 Parsons, G.R., 1993. Age determination and growth of the bonnethead shark Sphyrna tiburo : a comparison of two populations. Mar. Biol. 117 23-31. Parsons, G.R., Grier, H., 1992. Seasonal change s in shark testicular structure and spermatogenesis. J. Exp. Zool 261 173-184. Pearl, C.A., Berger, T., Roser, J.F., 2006. Estr ogen and androgen receptor expression in relation to steroid concentrati ons in the adult boar epididymis. Domest. Anim. Endocrinol Available online 27 September 2006. Pelletier, G., Labrie, C., Labrie, F., 2000. Localization of oestrogen receptor oestrogen receptor and androgen receptors in the rat reproductive organs. J. Endocrinol 165 359-370. Piercy, A., Gelsleichter, J ., Snelson, F.F. Jr., 2003. Morphol ogical and histological changes in the genital ducts of the male Atlantic stingray, Dasyatis sabina during the seasonal reproductive cycle. Fish Physiol. Biochem 29 23-35. Pratt, H.L., Jr., 1988. Elasmobranch gonad structure: a description and survey. Copeia 3 719-729. Prins, G.S., Birch, L., Greene, G.L., 1991. Andr ogen receptor localization in different cell types of the adult rat prostate. Endocrinology 129 3187-3199. Prins, G.S., Birch, L., 1995. The developmenta l pattern of androgen receptor expression in rat prostrate l obes is altered after neona tal exposure to estrogen. Endocrinology 136 1303-1314. Pudney, J., Callard, G.V., 1984a. Development of agranular reticulum in Sertoli cells of the testis of the dogfish Squalus acanthias during spermatogenesis. Anat. Rec. 209 311-321. Pudney, J., Callard, G.V., 1984b. Identification of Leydig-like cells in the testis of the dogfish Squalus acanthias Anat. Rec 209 323-330. Quint, E., Smith, A., Avaron, F., Laforest, L ., Miles, J., Gaffield, W., and Akimenko, M. A., 2002. Bone patterning is altered in the regenerating zebraf ish caudal fin after ectopic expression of s onic hedgehog and bmp2b or exposure to cyclopamine. Proc. Natl. Acad. Sci. USA 99, 8713-8718. Reardon, M.B., Walker, T.I., Hamlett, W.C ., 2002. Microanatomy of spermatophore formation and male genital ducts in the holocephalan, Callorhynchus milii. Mar. Freshwat. Res 53 591-600.

PAGE 92

80 Richter, W., Dettmer, D., Glander, H., 1999. Detection of mRNA transcripts of cyclic nucleotide phosphodiesterase subtypes in ejaculated human spermatozoa. Mol. Hum. Reprod 5 732-736. Rose, T.M., Shultz, E.R., Henikoff, J.G., Piet rokovski, S., McCallum, C.M., Henikoff, S. C.M., 1998. Nucleic Acids Res 26 1628-1635. Rundlett, S.E., Wu, X.P., Mi esfeld, R.L., 1990. Functional characterization of the androgen receptor confirm that the molecular basis of androgen action is transcriptional regulation. Mol. Endocrinol 4 708-714. Sajjad, Y., Quenby, S.M., Nickson, P., LewisJones, D.I., Vince, G., 2004a. Expression of androgen receptors in uppe r human fetal reproductive tract. Hum. Reprod 19 16591665. Sajjad, Y., Quenby, S.M., Nickson, P., Lewis-Jones, D.I., Vince, G., 2004b. Immunohistochemical localiz ation of androgen receptors in the urogenital tracts of human embryos. Reproduction 128 331-339. Simpson, T.H., Wardle, C.S., 1967. A seasona l cycle in the testis of the spurdog, Squalus acanthias and the sites of 3 -hydroxysteroid dehydrogenase activity. Journal of the Marine Biological Association of the United Kingdom 47 699-708. Snelson, F.F., Jr., Rasmussen, L.E., Johnson, M.R., Hess, D.L., 1997. Serum concentrations of steroid hormones dur ing reproduction in the Atlantic stingray, Dasyatis sabina. Gen. Comp. Endocrinol 108 67-79. Solakidi, S., Psarra, A-M.G., Nikolaropoulos, S., Sekeris, C.E., 2005. Estrogen receptors and (ER and ER ) and androgen receptor (AR) in human sperm: localization of ER and AR in mitochondria of the midpiece. Hum. Reprod 20 3481-3487. Stanley, H.P., 1966. The structure and developm ent of the seminiferous follicle in Scyliorhinus caniculus and Torpedo marmorata (Elasmobranchii). Z. Zellforsch 75 453-468. Steinberger, E., 1971. Hormonal contro l of mammalian spermatogenesis Physiol. Rev. 51 1-22. Surez-Quian, C.A., Martnez-Garca, F., Nistal, M., Regadera, J., 1999 Androgen receptor distribution in the adult human testis. J. Clin. Endocrinol. Metabol 84 350358. Tan, J., Joseph, D.R., Quarmby, V.E., Lubahn, D. B., Sar, M., French, F.S., Wilson, E.M., 1988. The rat androgen receptor: primary st ructure, autoregulation of its messenger ribonucleic acid, and immunocytochemical localization of the receptor protein. Mol. Endocrinol 2 1276-1285.

PAGE 93

81 Takeo, J., Yamashita, S., 1999. Two distinct is oforms of cDNA encoding rainbow trout androgen receptors. J. Biol. Chem 274 5674-5680. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple se quence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nuc. Acid. Res 22 46734680. Thorton, J.W., Need, E., Crews, D., 2003. Resu rrecting the ancestral steroid receptor: ancient origin of estrogen signaling. Science 301 1714-1717. Todo, T., Ikeuchi, T., Kobayashi, T., Na gahama, Y., 1999. Fish androgen receptor: cDNA cloning, steroid activa tion of transcription in tran sfected mammalian cells, and tissue mRNA levels. Biochem. Biophys. Res. Comm 254 378-383. Touhata, K., Kinoshita, M., Tokuda, Y., Toyohara, H., Sakaguchi, M., Yokoyama, Y., and Yamashita, S., 1999. Sequence and expression of a cDNA encoding the red seabream androgen receptor. Biochimica et Biophysica Acta 1449 199-202. Trant, J.M., 1996. Heterologous expre ssion of the spiny dogfish shark ( Squalus acanthias ) cytochrome P450c17 (17 alpha-hydroxylase) in Escherichia coli Gen. Comp. Endocrinol 102 173-182. Tricas, T.C., Maruska, K.P., Rasmussen, L.E., 2000. Annual cycles of steroid hormone production, gonad development, and reproducti ve behavior in the Atlantic stingray. Gen. Comp. Endocrinol 118 209-225. Vornberger, W., Prins, G., Musto, N.A., Suarez-Quian, C.A., 1994. Androgen receptor distribution in rat testis: new implications for androgen regulation of spermatogenesis. Endocrinology 134 2307-2316. Walsh, C.J., Luer, C.A., 2004. Elasmobranch hema tology: identification of cell types and practical applications. In “The elasmobranch husbandry ma nual: captive care of sharks, rays and their relatives” (M. Smith, D. Warmolts, D. Thoney, and R. Hueter, Eds), pp. 307-323. Ohio Biological Survey, Inc., Columbus, OH. Whitfield, G.K., Jurutka, P.W., Haussler, C.A., Haussler, M.R., 1999. Steroid hormone receptors: evolution, ligands, and mo lecular basis of biologic function. J. Cell. Biochem 32/33 110-122. Wourms, J.P., 1977. Reproduction and deve lopment in chondrichthyan fishes. Am. Zool 17 379-410.

PAGE 94

82 Yamashita, S., 2004. Localization of estroge n and androgen receptors in male reproductive tissu es of mice and rats. Anat. Rec. A Discov. Mol. Cell. Evol. Biol 279 768-778. Young, L.J., Godwin, J., Grammar, M., Gahr, M., Crews, D., 1995. Reptilian sex steroid receptors: amplification, sequence and expression analysis J. Steroid Biochem. Mol. Biol 55 261-269. Zhao, Y., Li, Q., Yao, C., Wang, Z., Zhou, Y., Wang, Y., Liu, L., Wang, Y., Wang, L., Quao, Z., 2006. Characterization and quantif ication of mRNA transcripts in ejaculated spermatozoa of fertile men by se rial analysis of gene expression. Hum. Reprod 21 1538-1590. Zhou, X., Kudo, A., Kawakami, H., Hirano, H ., 1996. Immunohistochemi cal localization of androgen receptor in mouse testicular germ cells during fetal and postnatal development. Anat Rec 245 509-518. Zhou, Q., Nie, R., Prins, G.S., Saunders, P. T.K., Katzenellenbogen, B.S., Hess, R.A., 2002. Localization of androgen and estr ogen receptors in adult male mouse reproductive tract. J. Androl 23 870-881. Zhu, L.J., Hardy, M.P., Inigo, I.V., Huhtaniemi, I., Bardin, C.W., Moo-Young, A.J., 2000. Effects of androgen on androgen recep tor expression in rat testicular and epididymal cells: a quantit ative immunohistochemical study. Biol. Reprod 63 368376.

PAGE 95

83 Appendices

PAGE 96

84 Appendix I: Species with published androgen recep tor sequences that were aligned (Block Maker) and analyzed (CODEHOP) to de velop degenerate primers for this study. Common Name Scientific Name Accession No. Burton’s mouthbrooder Haplochromis burtoni AF121257 Goldfish Carassius auratus AY202775 Japanese eel Anguilla japonica AB02361 Rainbow trout (AR ) Oncorhynchus mykiss AB012095 Rainbow trout (AR ) Oncorhynchus mykiss AB012096 Red sea bream Chrysophrys major AB017158 African clawed frog Xenopus laevis U67129 Mouse Mus musculus NM013476 Boar Sus scrofa AF202775 Domestic dog Canis familiaris AF197950 Crab-eating macaque Macaca fascicularis MFU94179

PAGE 97

85 Appendix II: Recipe for 100 ml elasmobranch-modi fied phosphate buffered saline (EPBS) (Walsh and Luer, 2004). NaCl 2.63 g NaH2PO4 0.12 g Adjust pH to 7.4 with 1N HCl. Filter through 0.2 m sterile filter and store at 4 C.

PAGE 98

86 Appendix III: Recipe for 1 ml of hybridization buffer. Formamide (50%) 500 l SSPE Buffer (20x) 100 l Fish Sperm DNA (10 mg/ml) 100 l Yeast tRNA extract (10 mg/ml) 50 l Bovine Serum Albumin (10 mg/ml) 100 l DMPC-Treated Water 150 l


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001967679
003 fts
005 20081028121730.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 081028s2007 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002128
035
(OCoLC)263869532
040
FHM
c FHM
049
FHMM
090
QH307.2 (ONLINE)
1 100
Tyminski, John P.
0 245
Androgen receptors in the bonnethead shark, Sphyrna tiburo :
b cDNA cloning and tissue-specific expression in the male reproductive tract
h [electronic resource] /
by John P. Tyminski.
260
[Tampa, Fla.] :
University of South Florida,
2007.
3 520
ABSTRACT: Androgens and the androgen receptor (AR) play important roles in virilization, spermatogenesis, and sexual behavior in vertebrates. An understanding of the distribution and levels of expression of the ARs on the cellular and tissue level demonstrates the pattern of responsiveness to the androgenic hormones in a given organism. In this study, a fragment of the AR gene was cloned and sequenced from the bonnethead shark, Sphyrna tiburo, an elasmobranch species with a well-defined annual reproductive cycle. Acquiring this gene sequence facilitated the construction of species-specific AR polymerase chain reaction (PCR) primers and species-specific AR mRNA probes that were used to screen reproductive tissues for evidence of AR gene expression using reverse transcription (RT)-PCR and in situ hybridization (ISH), respectively. The RT-PCR screens demonstrated AR gene expression in the testes, epididymides, seminal vesicles, and claspers of male sharks.^ ^The use of relative PCR revealed that these organs have variable levels of AR gene expression that significantly differ with the stage of the shark's seasonal reproductive cycle. ISH results localized the AR RNA in the interstitial cells, Sertoli cells, and developing sperm of the testes, and mature spermatozoa within the seminal vesicles and the epididymides. Immunocytochemical methods used to detect the AR protein using a rabbit polyclonal antibody, PG-21, produced comparable results in the shark testes but did not yield positive results in the seminal vesicles or the epididymides. However, the Leydig gland, whose secretions contribute to the seminal fluid, demonstrated consistent AR immunoreactivity. Results of ICC in male and female embryos of S. tiburo revealed AR protein in the developing kidney but not in the embryonic reproductive structures. By characterizing AR distribution in the reproductive tract of male S.^ tiburo, this study provides the basis for future research on the direct and indirect effects of androgenic hormones in this species.
502
Thesis (M.S.)--University of South Florida, 2007.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 86 pages.
590
Adviser: Philip J. Motta, Ph.D.
653
Androgen receptor.
Steroid hormone.
Polymerase chain reaction.
Immunocytochemistry.
mRNA probe.
690
Dissertations, Academic
z USF
x Biology
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2128