USF Libraries
USF Digital Collections

Bcl-2 related ovarian killer, Bok, is cell cycle regulated and sensitizes to stress-induced apoptosis

MISSING IMAGE

Material Information

Title:
Bcl-2 related ovarian killer, Bok, is cell cycle regulated and sensitizes to stress-induced apoptosis
Physical Description:
Book
Language:
English
Creator:
Rodríguez, José M
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
E2F1
Flavopiridol
Promoter
Luciferase assay
Chromatin immunopresipitation
Dissertations, Academic -- Cancer Biology -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Bok/Mtd (Bcl-2-related ovarian killer/Matador) is considered a pro-apoptotic member of the Bcl-2 family. Though identified in 1997, little is known about its biological role. We have previously demonstrated that Bok mRNA is upregulated following E2F1 over-expression. In the current work, we demonstrate that Bok RNA is low in quiescent cells and rises upon serum stimulation. To determine the mechanism underlying this regulation, we cloned and characterized the mouse Bok promoter. We find that the mouse promoter contains a conserved E2F binding site (-43 to -49) and that a Bok promoter-driven luciferase reporter is activated by serum stimulation dependent on this site. Chromatin immunoprecipitation assays demonstrate that endogenous E2F1 and E2F3 associate with the Bok promoter in vivo. Surprisingly, we find that H1299 cells can stably express high levels of exogenous Bok. However, these cells are highly sensitive to chemotherapeutic drug treatment. Taken together these results demonstrate that Bok represents a cell cycle-regulated pro-apoptotic member of the Bcl-2 family, which may predispose growing cells to chemotherapeutic treatment.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2007.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by José M. Rodríguez.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 82 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001921480
oclc - 191063438
usfldc doi - E14-SFE0002146
usfldc handle - e14.2146
System ID:
SFS0026464:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001921480
003 fts
005 20080123114429.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 080123s2007 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002146
035
(OCoLC)191063438
040
FHM
c FHM
049
FHMM
090
RC254.6 (ONLINE)
1 100
Rodrguez, Jos M.
0 245
Bcl-2 related ovarian killer, Bok, is cell cycle regulated and sensitizes to stress-induced apoptosis
h [electronic resource] /
by Jos M. Rodrguez.
260
[Tampa, Fla.] :
b University of South Florida,
2007.
3 520
ABSTRACT: Bok/Mtd (Bcl-2-related ovarian killer/Matador) is considered a pro-apoptotic member of the Bcl-2 family. Though identified in 1997, little is known about its biological role. We have previously demonstrated that Bok mRNA is upregulated following E2F1 over-expression. In the current work, we demonstrate that Bok RNA is low in quiescent cells and rises upon serum stimulation. To determine the mechanism underlying this regulation, we cloned and characterized the mouse Bok promoter. We find that the mouse promoter contains a conserved E2F binding site (-43 to -49) and that a Bok promoter-driven luciferase reporter is activated by serum stimulation dependent on this site. Chromatin immunoprecipitation assays demonstrate that endogenous E2F1 and E2F3 associate with the Bok promoter in vivo. Surprisingly, we find that H1299 cells can stably express high levels of exogenous Bok. However, these cells are highly sensitive to chemotherapeutic drug treatment. Taken together these results demonstrate that Bok represents a cell cycle-regulated pro-apoptotic member of the Bcl-2 family, which may predispose growing cells to chemotherapeutic treatment.
502
Dissertation (Ph.D.)--University of South Florida, 2007.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 82 pages.
Includes vita.
590
Advisor: W. Douglas Cress, Ph.D.
653
E2F1.
Flavopiridol.
Promoter.
Luciferase assay.
Chromatin immunopresipitation.
690
Dissertations, Academic
z USF
x Cancer Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2146



PAGE 1

Bcl-2 Related Ovarian Killer Bok, Is Cell Cycle Regulated And Sensitizes To StressInduced Apoptosis By Jos M. Rodrguez A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cancer Biology College of Graduate School University of South Florida Major Professor: W. Douglas Cress, Ph.D. Srikumar P. Chellappan, PhD. Eric B. Haura, MD. Kenneth Wright, PhD. Date of Approval June 28, 2007 Keywords: E2F1, flavopiridol, promoter, luciferase assay, chromatin immunopresipitation Copyright 2007, Jos M. Rodrguez

PAGE 2

Dedication I would like to dedicate this work to my parents Mara C. Medina and Jos A. Rodrguez for all their support and love dur ing this journey. Mom, you always told me to believe in God because he is the onl y one who is going to help me pass this challenge, and also told me how important it is in taking care of my family because at the end of the day, that is what really maters. Dad you are my rock, you never hide the reality of how hard it is to accomplish my goal and you told me that anything in this life is not easy to obtained specia lly a good education. Because of your support, now I am graduating with a PhD. Tha nk you mom and dad for teaching me how important it is to have a career and be grat eful for all the good things I have in my life. To my sister Michelle J. Rodrigu ez thank you for being the best sister and teaching me how to be patient with my self and the rest of the people, thank you for all the advice you gave me during this time. To my in-laws, Luisa A. Cruz and Carlos Reyero for always been there for me and help me with the children. Also thank you for youre daughter Carole C. Reyero Cruz who is my lovely wife because with out her I wouldnt be the person I am now. To Carole for always been there even during the very stressful times. Thank you for your unconditional love and for making me a better person. Last but not least, to my beautiful children Adrian A. and Ryan L. Rodrguez who make my life complete and jo yful. You guys are, with out a doubt, the base of my will to succeed!

PAGE 3

Acknowledgments First I will like acknowledge my mentor Dr. Cress for all of his support, advice and guidance and thank him for believing in me when not even I was believing in myself. I feel fortunate to have him as ment or in science as well as in life. Also my committee Dr. Chellappan, Dr. Haura and Dr Wright for taking time from their busy schedule to advice and review my work. In addition I like to acknowledge Jaime L. Matta, PhD. from the Ponce School of Medicine in Ponce, Puerto Rico for being a great advisor as well as the ch airman of my committee. This work was supported by funds from the National Cancer Institute (CA90489, W.D.C.), Minority Supplement to CA 090489 (J.M.R.), Department of Defense (National Functional Geno mics Pilot Project 12-12990-01-01, W.D.C.) and by the Molecular Biology, Flow Cytometry, Analy tical Microscopy, and the Molecular Imaging Core Facilities of the H. Lee Moffitt Cancer Center and Research Institute. I also acknowledge Michele A. Glozak, Yihong Ma, Scott N. Freeman and Rachel C. Haviland for their friendship, scientific input and review.

PAGE 4

Note to Reader The original of this document contains co lor that is necessary for understanding the data. The original dissertation is on file with the USF library in Tampa, Florida.

PAGE 5

i Table of Contents List of Figures iii Abstract v Chapter 1: Introduction 1 E2F Family of Transcription Factor 1 E2F Role in Cell Cycle 3 Role of E2F1 in Apoptosis 5 Bcl-2 Family of Transcription Factors 8 Chemotherapeutic Drugs 9 Flavopiridol 11 VP-16 12 Experimental Procedures 13 Chapter 2: Characterizing the Bok Promoter 18 Identification of Bok as a Potential E2F1 Target 18 The Bok Promoter Contains a Cons erved E2F Binding Site Between Mouse and Human 21 Regulation of the Bok Promoter Thr oughout Cell Cycle 26 Activation of the Bok Promoter is Not Specific to E2F1 26 The Bok Promoter is Not Activated by p53 28 In vivo Association of E2F1 and E2F3 With the Bok Promoter 31

PAGE 6

ii Chapter 3: Functional Relevance of Bok 33 Bok d-siRNA Shuts Down the Expression of Bok 33 Bok is Not Necessary for E2F1-Induced Apoptosis 35 Bok is Not Necessary for Cell Cycle Progression 39 Bok Localizes to the Cytoplasm 41 Bok Expression Sensitizes Cells to Stre ss-Induced Apoptosis 46 Chapter 4: Discussion 51 Future Studies 53 Reference 56 About the Author End Page

PAGE 7

iii List of Figures Figure 1: Schematic representation of the E2F fa mily of proteins. 2 Figure 2: Role of E2F in cell cycle co ntrol. 4 Figure 3: E2F1 pathways towards apoptosis. 7 Figure 4: Bok mRNA is activated by E2F1 or serum stimulation. 19 Figure 5: Cell cycle progression of NIH 3T3 after treatment of serum and infection with E2F1 virus. 20 Figure 6: Overlapping subclones in pBS encompassing the entire Bok genomic locus. 22 Figure 7: Evolutionary conserved E2F binding site. 23 Figure 8: Schematic representation of the WT and MUT Bok promoter constructs. 25 Figure 9: The Bok promoter is activated by a ddition of serum dependent upon a conserved E2F binding site. 27 Figure 10: S phase promoting members of the E2F family activate the Bok promoter. 30 Figure 11: p53 protein does not activate the B ok promoter. 31 Figure 12: E2F1 and E2F3 associate with the Bok promoter in vivo. 33 Figure 13: Stable over-expression of Flag-Bok protein. 35 Figure 14: Generation of the Bok d-siRNA. 37

PAGE 8

iv Figure 15: Bok d-siRNA shuts down the expression of Bok. 38 Figure 16: Bok deficiency does not block E2F1-induced apoptosis. 39 Figure 17: Bok is not required for cell cycle progression. 41 Figure 18: Bok localizes to the cytoplasm. 43 Figure 19: Generation of responsive H1299 HA-ER-B ok protein. 45 Figure 20: Boks apoptotic role is not enhanced in the nucleus. 46 Figure 21: Kinetics of apoptosis inducti on in response to Flavopiridol treatment. 49 Figure 22: Constitutively Bok expression sensitizes to apoptosis after DNA damage. 50 Figure 23: A molecular marker of apoptosis is seen by 24 hrs after FP treatment in the Flag-Bok expressing cell line. 51

PAGE 9

v Bcl-2 Related Ovarian Killer, Bok, is Cell Cycle Regulated and Sensitizes to Stress-Induced Apoptosis Jos M. Rodrguez ABSTRACT Bok/Mtd (Bcl-2-related ovari an killer/Matador) is c onsidered a pro-apoptotic member of the Bcl-2 family. Though iden tified in 1997, little is known about its biological role. We have previously dem onstrated that Bok mRNA is upregulated following E2F1 over-expression. In the current work, we demonstrate that Bok RNA is low in quiescent cells and ri ses upon serum stimulation. To determine the mechanism underlying this regulation, we cloned and ch aracterized the mouse Bok promoter. We find that the mouse promoter contains a cons erved E2F binding site (-43 to ) and that a Bok promoter-driven lucifera se reporter is activated by se rum stimulation dependent on this site. Chromatin immunoprecipitation assa ys demonstrate that endogenous E2F1 and E2F3 associate with the Bok promoter in vivo Surprisingly, we fi nd that H1299 cells can stably express high levels of exogenous Bok. Ho wever, these cells are highly sensitive to chemotherapeutic drug treatment. Taken toge ther these results demonstrate that Bok represents a cell cycle-regulated pro-apoptot ic member of the Bcl-2 family, which may predispose growing cells to chemotherapeutic treatment.

PAGE 10

1 Chapter 1: Introduction E2F Family of Transcription Factors The E2F family of transcription factor s has key roles in regulating the G1/S transition 67,79,85,90 There are nine E2F members identified, so far 12,20,24,42,62,89,114,132 This family can be divided into three di stinct groups based on both structure and function. E2F1, 2 and 3A make up the first di stinct group. Structurally, a long N-terminal region, of unclear function, distin guishes these E2Fs (Fig 1). They also contain a cyclin A binding domain important for thei r down regulation in S phase 72,76,144 At the C-terminus, each possesses a potent transcriptional activa tion domain that contains an Rb binding motif 1,44,69,78,78 Functionally, these E2Fs appear n ecessary for cell cycle progression 1,57,90 they are primarily expressed at the G1/S boundary 1,27,52,59,65,79,92,116 and they potently drive S phase when expressed in otherwise quiescent rodent fibroblast 22,67,75,85 In contrast, members of the second group of E2Fs (3B, 4 and 5) lack the Nterminal region (Fig 1) and are expre ssed ubiquitously through the cell cycle 134 They can activate transcription of G1/S genes when over expressed in rodent fibroblast, particularly E2F3B 43 but do so less efficiently than E2F1-3A 22,85 These E2Fs appear essential to maintain growth arrest 31,109 and contribute to differentiation 103,109 Mechanistically these E2Fs may primarily serve to tether Rb to E2F-regulated promoters

PAGE 11

E2F1 E2F2 E2F3 E2F3B E2F4 E2F5 E2F6 E2F7 E2F8 CyclinA DNA binding DP dimerization TA domain RB binding E2F1 E2F2 E2F3 E2F3B E2F4 E2F5 E2F6 E2F7 E2F8 CyclinA DNA binding DP dimerization TA domain RB binding Figure 1. Schematic representation of the E2F family of proteins. Shaded boxes indicate important and conserved domains. What all E2Fs have in common is the DNA binding domain. E2F1-3 are the activating E2Fs, where as E2F3B-8 are implicated in growth repression. 2

PAGE 12

3 during G0 31,103 and may also serve to generate an initial pulse of E2F activity that is subsequently amplified by activating the transc ription of the more potent E2F1, 2 and 3A. Finally, E2F6, 7 and 8 represent the thir d group (Fig 1). These E2Fs appear to lack the transcriptional activation/Rb bindi ng domain present in other E2Fs and serve exclusively to repress transcription via interaction with transcriptional repressors 12,20,24,83,89,97,132 For example, E2F6 binds to transcrip tional co-repressors due to its ability to bind polycomb protein molecules and generally serves to repress growth 97 E2F Role in Cell Cycle Progression through the cell cycle is regul ated by many proteins, which include cyclins, cyclin dependent kinases (CDK), cyc lin dependent kinase i nhibitors (CKI), E2F family members and the retinoblastoma protein (pRb) family members among others 2,6,9,14,23,32,36,41,45,66,71,73,95,98,106,115,120,121,124,127,128,131,133,146,147 In a resting cell, hypophosphorylated pRb and its family memb ers p107 and p130, bind and inactivate the E2F transcription factors forming the checkpoint during the G1/S boundary. This checkpoint regulates the transition between cel l proliferation and te rminal differentiation. Studies in mouse fibroblast with deleted pRb, p107 or p130 suggest th eir important role in the arrest of the G1 phase of the cell cycle 15 When a cell receives mitogenic signals by growth factors, cyclins become upregulated and form complexes with CDKs. The main regulators of the G1/S transition are th e D type cyclins and their binding partners CDK4/6 (Fig 2). After mitotic stimulation, cyclin D/CDK4 and cyclinD/CDK6 complex hyperphosphorylates pRb family leading to th e release and activation of E2F. The E2F

PAGE 13

E2F1 pRB DP1Mitogens Cyclin D Cdk4/6 Cyclin D Cdk4/6 Cyclin E Cyclin E Cdk2 E2F1 pRB DP1 Cdk2 p E2F1 pRB DP1 p p p p Degradation G0/G1G1/SSTranscription offTranscription on Cyclin A Cdk2 E2F1 DP1 p p p p DegradationS Cyclin E DNA pol ORC Transcription off E2F1 pRB DP1 E2F1 E2F1 pRB pRB DP1 DP1Mitogens Cyclin D Cyclin D Cdk4/6 Cdk4/6 Cyclin D Cdk4/6 Cyclin D Cyclin D Cdk4/6 Cdk4/6 Cyclin E Cyclin E Cyclin E Cdk2 Cyclin E Cdk2 E2F1 E2F1 pRB pRB DP1 DP1 Cdk2 Cdk2 p E2F1 E2F1 pRB pRB DP1 DP1 p p p p Degradation G0/G1G1/SSTranscription offTranscription on Cyclin A Cdk2 Cyclin A Cdk2 E2F1 E2F1 DP1 DP1 p p p p DegradationS Cyclin E Cyclin E DNA pol ORC Transcription off Figure 2. Role of E2F in cell cycle control. After mitogenic stimulation (top left), cyclin D/CDK 4/6 lays the initial phophorylation on RB. Cyclin E/CDK 2 then continues to phosphorylate RB and this leads to the hyperphosphorylation and degradation of RB. Thus, E2Fs are free to transactivate genes required for DNA synthesis. Once in S phase, cyclin A/CDK 2 in a negative feedback loop targets E2Fs for degradation. 4

PAGE 14

5 transcription factor then medi ates cell cycle-dependent expression of genes important for DNA synthesis such as thymidylate synthase (TS), dihydrofolate re ductase (DHFR) and DNA polimerase 21 Though in vitro E2F1 can bind DNA as a homodimer, in cells E2F binds promoters as a heterodimer with a memberof the DP family 104,149,150 Association with a DP protein significantly increases its sequence-specific binding to its target genes. After S phase induction Cyclin A/CDK2 dow n regulates E2F by phosphorylating it and targeting it for degradation 125 (Fig 2). Down regulation of E2F is important for cell survival because otherwise the cell would unde rgo apoptosis. In addition to the regulation of genes required for cell cycle progression E2 Fs also regulate gene s involved in growth arrest, differentiation and apoptosis. Another layer of regulation involves CKI, which mediated growth arrest through the inhibition of the phosphorylation of p RB and the stabilization of p53; and are therefore involved in tumor suppression. The CK Is are grouped in two families, the INK4 and the Cip/Kip family 13,40,117 The first family, the INK4 (inh ibitors of cdk4) proteins, is composed of 4 members and selectively in hibits CDK4 and C DK6. The four INK4 inhibitors are p16 INK4a p15 INK4b p18 INK4c and p19 INK4d and they do not bind any other CDKs. The second family, Cip/Kip inhibitors (CDK interacting protei n/Kinase inhibitory protein) are p21 Cip1 p27 Kip1 and p57 Kip2 and in contrast to the INK4 family, they are not as selective in their activity, and are able to inhibit cyclin E/CDK2 and cyclin A/CDK2.

PAGE 15

6 Role of E2F1 in Apoptosis The most striking functional difference between E2F family members is the unique ability of E2F1 to induce apopto sis and our laboratory and others have demonstrated this role of E2F1 by over-expre ssing it in tissue culture cells and measuring apoptosis 1,10,22,28,29,33,50,51,53,58,64,81,82,99,100,105,113,122,123,143 Physiologically, E2F1s role in apoptosis is suggested by experiments show ing that mice deficient in E2F1 develop tumors in the reproductive tract, lung and lymphatic system, presumably for the lack of apoptosis 26,139,148 E2F1 can induce apoptosis by both p53-dependent 1,63,100,112 and p53independent pathway 80,123 (Fig 3). In tissue culture, over-expression of E2F1 leads to the increase of p53 and subsequent apoptosis. One of the molecular pa thways this is achieved is by the direct transcriptional activatio n of p14ARF gene (p19ARF in mouse) by E2F1 5,48,82,129,130 Accumulation of p14ARF leads to its interac tion with the Hdm2 (Mdm2 in mouse) E3 ubiquitin ligase. The binding between p14ARF a nd Hdm2 inhibits the ability of Hdm2 to target p53 for degradation. As a net conse quence the E2F1 increase in p14ARF levels leads to stabilization and activation of p53. In addition, E2F1 can lead to the accumulation of a p53 relative by directly tr ansactivating p73. p73 is a homolog of p53 that regulate the p53 promoter 82,136 p73 transactivates some of the same targets genes as p53 68,82,119 and also has the ability to induce apoptosis in mouse embryonic fibroblast that are deficient of p53 61 indicating a tumor control mechanism that runs parallel. Additionally E2F1 can elevate the activity of the ataxia-t elangiectasia-mutated kinase 49 promoter and induces an increase in the ATM mRNA and protein. In turn ATM leads to

PAGE 16

E2F1 ARF Hdm2p53 Oncogenic stressViral infectionDNA damage Apoptosis ATM p53 phosphorylationp53 stabilization p53 dependent BokApaf-1p73Caspase 7 p53 independentDirect transactivationof apoptotic genesMcl-1Direct repressionhTERT Survival signal p53 independentE2F1 ARF Hdm2p53 Oncogenic stressViral infectionDNA damage Apoptosis ATM p53 phosphorylationp53 stabilization p53 dependent BokApaf-1p73Caspase 7 p53 independentDirect transactivationof apoptotic genesMcl-1Direct repressionhTERT Survival signal p53 independent Figure 3. E2F1 pathways towards apoptosis. E2F1 is the best inducer of apoptosis among the E2F family and it does this trough a p53-dependent (top lanes), and p53-independent (bottom lanes) pathways. E2F1 can lead to the stabilization of p53 by transactivating ARF, which leads to the inhibition of Hdm-2 (a protein that targets p53 for degradation), or by inducing an ATM-dependent phosphorylation of p53. In addition, E2F1 can induce apoptosis independently of p53 protein by directly transactivating apoptotic genes or directly repressing survival genes. 7

PAGE 17

8 the phosphorylation and stabilization of p53 as well as E2F1 (in a positive feedback loop) in response to genotoxic stress 105 Many cancer cells evade apoptosis by deregulating or mutating the tumor suppressor gene p53. Most chemotherapeutic ag ents work by inducing apoptosis incancer cells, but in many cancer cells the apoptotic induction of p53 is not functional. In the other hand E2F1 is not found mutated in human cancers and it can induce apoptosis in a p53-independent manner 19,47,61 Thus, E2F1 and the apoptotic proteins that it induces are excellent targets that might be used in cancer chemotherapy. Figure 3 also highlights the fact that E2F1 can induce apoptosis independent of p53 by transactivating genes invo lve apoptosis and repressing genes involved in survival pathways. Our lab showed in a microarray a nd Northen blot analysis that E2F1 can repress the survival genes such as my eloid cell leukemia-1 (Mcl-1), amyloidprecursor protein binding protein 2(A PP-BP2), programmed cell death 4 (PDCD4), and carnitine palmitoyltransferace I (CPT-I) 87 On top of that, E2F1 can activate genes involved in the induction of apoptosis such as Bok, apoptosis protease-activating f actor 1 (Apaf-1), and caspase 7 102,111 Increase E2F1 activity leads to the release of cytochrome C from the mitochondria to the cytoplasm as a conse quence of the action of the aforementioned genes. Thus, E2F1 can tip the balance between pro-survival and pro-apoptotic genes towards cell death.

PAGE 18

9 Bcl-2 Family of Proteins Apoptosis or programmed cell death is an important process for the maintenance of tissue homeostasis and the prevention of diseases such as cancer. A number of targets in E2F-regulated cell death have been identi fied and these include members of the Bcl-2 family 19,25,39 The Bcl-2 family of proteins consis ts of different anti and pro-apoptotic members that mediate cytochrome C release from mitochondria and thus play important roles in the decision step of the intrinsic apoptotic pathway 16,108 All members of the Bcl-2 family are characterized by containing at least one of the four Bcl-2 homology domain (BH). Traditionally anti-apoptotic memb ers, contain all four BH domains, where as pro-apoptotic members contain only three or less. Within the pro-apoptotic members there is a subgroup that contai n only one BH domain (the BH3-only members), which is presume as a critical death domain in the pro-apoptotic 91 Bok, a pro-apoptotic member of the Bcl-2 family, was first cloned in a yeast two hybrid screen of an ovarian cDNA library for proteins that interacted with Mcl-1, BHRF1 and Bfl-1 55 The mouse homolog (Mtd) was identified bioinformatically 60 Bok contains Bcl-2 homology domains (BH1, 2, 3) and can heterodimerize with Mcl-1, BH RF-1 and Bfl-1, but not Bcl-2 or Bcl-xl 54,55,60 Bok can induce apoptosis in a variety of cell types 7,54,55,60,126 and this activity is inhibited by Mcl-1, BHRF-1 and Bfl-1, but not Bcl-2 or Bcl-xl. There have been reports that Bok has a nuclear export signal within it s BH3 domain and that Bok localizes to the nucleus as well as the cytoplasm 4 They also showed that accumulation of Bok in the nucleus increases Boks apoptotic activity. In the present work, we investigated the transcriptional regulation of Bok and its potential roles in cell cycle. We find that Bok is an E2F-regulated gene activated by serum s timulation that localizes mainly in the

PAGE 19

10 cytoplasm, and that it may function as a checkpoint sensitizing grow ing cells to stressinduced apoptosis. Chemotherapeutic Agents One of the hallmarks of cancer is the limitless replicative potential, which is not under strict regulatory control as in a normal ce ll. Cancer cells lose the ability to respond to contact inhibition. In addition cancer cells bypass cell cycle checkpoints and apoptosis that otherwise a normal cell will undergo after sensing an imbalance or an uncontrolled regulation of cell division. Most of the chemotherapeutic agents developed target this characteristic of a rapidly dividing cancer cell. The firs t chemotherapeutic agent was discovered by accident during World War I when Mustard gas was used as a chemical warfare agent. The observation that people that were exposed to this gas had low blood cell count intrigued scientist and motivated th em to study it further. During the decade of the 1940s, patients with lymphomas were gi ven the drug intravenously (instead of inhaling the irritating gas) and scientist saw a remarkable improvement, although temporary 101,137 Thereafter many studies have focus on discovering or developing other chemical agents to kill rapidly dividing cells such as cancer cells. Most of the chemotherapeutic agents can be classified as alkalating agents, antimetabolites, kinase inhibitors or topoisomerase inhibitors. In my research I used the chemotherapeutic agent Flavopiridol, which is a kinase inhibitor, and VP-16 (a .k.a. etoposide) that is a topoisomerase II inhibitor because they func tion via E2F1. We believe that Flavopiridol inhibits cyclin A/cdk 2s ability to phos phorylate E2F1 and target it for degradation, leading to its stabilization and consequent transactivation of apoptotic target genes, where

PAGE 20

11 as VP-16 induces cell death by stabilizing topo II-double st randed breaks complex, which leads to the accumulation of ATM kina se, and subsequent phophorylation and stabilization of E2F1. Flavopiridol Flavopiridol is one of the most studi ed CDK inhibitors. A semi-synthetic Nmethylpiperidinyl chlorophenyl flavone alkaloid compound originally isolated from the leaves of Amora rohituka It was first intended to be us ed as an inhibitor of EGFR, however upon examination it was found to inhibit the cell replication CDKs at a far lower concentration. At nanomolar concentrations Flavopiridol was shown to inhibit CDK4 and CDK6 11,93 the main kinases known to regulate the G1/S transition and E2F1 activity, among others. Its been shown in clinic al trials that combination of Flavopiridol treatment and other chemotherapeutic drugs, su ch as docetaxel, can increase apoptosis in cancer cells 34 Flavopiridol induces ce ll cycle arrest in G1 in vivo and in vitro 96,107,142 It is cytotoxic to cells synthesizing DNA and can induce apoptosis in a p53-independent manner 118 Flavopiridol stabilizes E2F1 protein levels in a dose-dependent manner and the inverse effect is s een on the Mcl-1 levels 86 One of the proposed mechanisms in which Flavopiridol can lead to apoptosi s is by antagonizing cyc lin/cyclin dependent kinase 2s ability to target E2F1 for degrad ation. This leads to E2F1 stabilization and subsequent reduction in Mcl-1, a pro-survival protein, and presumably the accumulation of pro-apoptotic E2F1 target genes such as Bok, p73, caspases and others. In this study we assess the importance of Bok, an E2F1 targ et gene, in the sensitivity of Flavopiridolinduced apoptosis. We found that higher expr ession of the Bok protein, the faster the

PAGE 21

12 induction of apoptosis by Flavopiridol. This observation suggests that assessing a patients levels of Bok might predict the outc ome response of the flavopiridol treatment. VP-16 Topoisomerase II is a ubiquitously express enzyme that regulates the winding of DNA 30,77 It removes the knots and tangles generated during DNA replication and transcription, through the crea tion of double-stranded breaks in the double helix. VP-16 is a chemotherapeutic agent that targets topoisomerase II enzyme 3,8,38,84,94,151 and has been used for several types of cancer including lung, prostate, ovarian a nd testicular cancer. VP-16 works by stabilizing a covalent en zyme-cleaved DNA complex. After treatment with VP-16, cells accumulate enzyme-cleaved DNA complexes, which results in the generation of permanent DNA strand breaks that in turn trigger recombination/repair pathways and mutagenesis. The massive accu mulation of these breaks can overwhelm the cell and can trigger the initiation of death pathways. Thus, VP-16 converts topoisomerase II from an essential enzyme to a potent cellular toxin that fragments the genome.

PAGE 22

13 Experimental Procedures Cloning the Bok promoterApproximately 5x10 5 plaques from a Sau3A I partially digested 129SV mouse genomic library in FIXII (Stratagene) were screened in duplicate with a mixture of Bok cDNA probe s. The probes consisted of full-length human Bok cDNA (nt 247-882 of NM_032515) ( human and mouse sequences are 88% identical in the coding region) and a 3 UTR mouse Bok probe (nt 940-1430 of NM_016778). Screening was performed in 50% formamide and filters were washed at high stringency. Ten positive plaques were iden tified and rescreened in secondary and tertiary screens using the same combination of probes. Following plaque purification and a quaternary screen, seven purified positive plaques were identified. Plate lysates were prepared from these seven clones to serve as phage stocks. The phage stocks were titered, then used to prepar e plate lysates to extract the phage DNA. Phage DNA was extracted using the Qiagen MIDI lambda kit according to manufacturer s specifications. NotI digestion of the phage DNA indicated th at each clone had a di fferent sized insert, each in the ~15-20 kb range. Each of the phage DNAs was digested with a panel of restriction enzymes, then loaded on duplicate 0.8% agarose gels. The digested DNA was Southern blotted overnight to Immobilon Ny+ membranes. The duplicate blots were hybridized to each of the Bok probes individually to roughly map the 5 and 3 ends of the inserts. Comparison of the hyridization to each of the probes revealed similar, but not identical, patterns of hybridizing bands. This indicated that the clones were unique.

PAGE 23

14 Each of the phage DNAs was then digested with NotI to excise the entire insert for cloning into pBluescript (pBS). In addition, based on differential hybridization patterns, phage DNAs was also digested with Xh oI or SstI to subclone smaller fragments into pBS. Bluescript clones containing inserts were sequenced with T3 and T7 promoter primers using the Moffitt Cancer Center Molecular Biology Core F acility. Sequences were BLASTed against the mouse genome databa se to confirm the ends of each clone. Each clone matched an area of the Mus musculus chromosome 1 genomic contig NT_039173.2. Overlapping clones c overing the entire Bok locus are shown in Figure 1. Clones 8N1 (approximately 15 kb, 8090408(the 3 and has not been determined due to suboptimal sequencing), 11N6 (16.2 kb, 8083204-8099427) and 15N9 (16.8 kb, 8089917-8106754) contain the entire phage insert. In particular, clone 11N6 contains the entire Bok coding region and will be used to prepare the targeting construct. Plasmids -Mouse Bok promoters were generate d by digestion of pBS-13S2 with Sst I and ligated into pGL3 ba sic. Initial PCR primers we re design to amplify 331 bp (244/+87) of our sequenced Bok promoter which are numbered relative to the transcriptional start site. Th e forward (192 F) and reverse (141 R) PCR primers for the Bok promoter were 5-GGTACCAG AACTTGTGCTGGCCTTTCT-3 and 5AAGCTTAGTTCTGGTTTCAGGACCCGC-3, respec tively. The forward primer added a Kpn I site, and the reverse added a Hind III site to facilitate sub-cloning. The E2F binding site mutant of the Bok promoter was generated by site-directed mutagenesis with PCR. The initial reaction was done using 192 F and 192 R (5TCCGCCGGTCTTCC AT CGCGC-3); a second reaction used primer 141 F (5-

PAGE 24

15 CGCG AT GGAAGACCGGCGGA-3) and 141 R. The PCR products from these reactions, 192 bp and 141 bp respectively, were band purified, phenol/chloroform extracted and ethanol precipitated. They were then resuspended in water, combined, and used as template in another PCR reacti on using the flanking primers 192 F and 141 R. The resulting PCR product was inserted in pCRII-TOPO, followed by digestion with Kpn I and Hind III (to excise PCR insert). Insert wa s run in a 1% agarose gel and band purified using QIAquick gel ex traction kit (Quiagen) and li gated to pGL3 luciferase vector. The E2F1 mutant constructs, E2F1 (1-284) and E2F1 (Eco 132) have been previously described 17,18 Cell cultureMouse NIH 3T3 fibroblasts were cultured in Dulbeccos Modified Eagles Medium (DMEM) supplemented with 5% calf serum. The H1299 lung cancer cell line was cultured in DMEM supplemented with 5% fetal bovine serum. H1299 cells that constitutively express Flag-Bok fusion pr otein were obtained by transfecting with pcDNA3-Flag-Bok (a gift from Gabriel Nunez, Univ. of Michigan) and selecting for transformants in 400 g/ml G418. G418-resistan t lines were screened for expression of Flag-Bok. Adenoviruses were described previously 18,87 and were tittered by plaque assay. Cell cycle parameters were measur ed by fixing cells with 70% ethanol-PBS, staining with propidium iodide (PI) and analyzin g by FACS, using ModFit. Biochemical assays Transfections were performed using LipofecAMINE PLUS TM Reagent from Invitrogen with test DNA totaling 2.85 g of DNA per 60-mm dish. Transfections included 100 ng of expre ssion plasmids (pcDNA3-based vectors), 2.5

PAGE 25

16 g of test construct firefly luciferase reporter plasmid (pGL3, Promega), and 250 ng of renilla luciferase reporter plasmid (pRL-TK, Promega). Cells were harvested 48 hrs after transfection, and luciferase assays were performed using the Dual-Luciferase Reporter Assay System following the manufacturers pr otocol (Promega). Experiments were done in duplicate or triplicates, and the relative activities and standard deviation values were determined. To control for transfection effi ciency, firefly luciferase values were normalized to the values for renilla luci ferase. Western blots were performed as previously described 18,86 using monoclonal antibody ag ainst Flag epitope (F3165, Sigma) or against PARP antibody (Cell signa ling 9542). Western blots were stripped and re-probed with an antibody to actin (A5441, Sigma) to ensure equivalent loading. RT-PCRIsolation of total RNA was done using the RNeasy mini kit (Qiagen 74104) as recommended by manufacturer. Total RNA was primed with random hexamers and cDNA created using SuperScrip TM First Strand Synthesis System for RT-PCR (Invitrogen 11904-018). PCR primers were desi gned to amplify 490 bp. The forward and reverse primers were 5-CGC TCGCCCACAGACAAGGAG-3 and 5TCTGTGCTGACCACACACTTG-3. Chromatin ImmunoprecipitationChIP assays were performed as previously described 18,37,86,110,138-140 Briefly, asynchronously growing NIH 3T3 cells were treated with formaldehyde to create protein-DNA cr oss-links, and the cross-linked chromatin was then extracted, diluted with ChIP buffe r, and sonicated. Sonicated chromatin was

PAGE 26

17 divided into equal samples for immuno-precip itation. Antibodies used included E2F1 (sc193X), E2F3 (sc-878X), and IgG (sc-2027) (from Santa Cruz Biotechnology).

PAGE 27

18 Chapter 2: Characterizing the Bok Promoter Identification of Bok as a Potential E2F1 Target In a previous microarray screen 87 we identified Bok as a potential E2F1 target gene. To confirm this observation, we tested if over-expression of E2F1 would correlate with increased expression of Bok mRNA. NIH 3T3 cells were brought to quiescence by 48-hrs incubation in 0.5% calf serum. Cells were then stimulated with 10% fetal calf serum or were infected with ten plaque-formi ng units of the indica ted adenovirus per cell. Fig. 4 highlights the observation that Bok mRNA is very low in quiescent NIH3T3 fibroblasts (lane 3), but is highly induced following infection with an E2F1-expressing adenovirus (lane 1). Lane 4 reveals that seru m treatment, which stimulates quiescent cells to enter S phase, also elevated Bok message (lane 4), suggesting that Bok is E2F and cell cycle regulated. As a control we wanted to de termine the cell cycle status of the treated cells (Fig 4) by harvesting half of the sa mples and fixing the NIH 3T3 cells with 70% ethanol-PBS, stained with PI and analyzed by FACS. Figure 5 demostrate that NIH 3T3 cells were brought to quiescence by 48-hrs incubation in 0.5% calf serum (accumulation in G0/G1), and upon stimulation with 10% fetal calf serum or infection with ten plaqueforming units of E2F1 adenovirus, cells progr ess through the cell cycle, in contrast to empty-vector control virus.

PAGE 28

Starved GAPDH BokAd E2F1Ad Con10% FBS2134Starved GAPDH BokAd E2F1Ad Con10% FBS2134 Figure 4. Bok mRNA is activated by E2F1 or serum stimulation. NIH 3T3 cells were brought to quiescence by 48-hrs incubation in 0.5% calf serum. Cells were then stimulated with 20% fetal calf serum or were infected with ten plaque-forming units of the indicated adenovirus per cell. Total RNA was harvested after 24 hrs (serum) or 30 hrs (virus). Twenty microgram of RNA were subjected to Northern analysis using the indicated cDNA probes. 19

PAGE 29

G0/G1 0102030405060708090100Starved10% FBSAd ConAdE2F1Number of cells (%) S G2/MG0/G1 0102030405060708090100Starved10% FBSAd ConAdE2F1Number of cells (%) S G2/M Figure 5. Cell cycle status of NIH 3T3. NIH 3T3 cells were brought to quiescence by 48-hrs incubation in 0.5% calf serum. Cells were then stimulated with 10% fetal calf serum or were infected with ten plaque-forming units of the indicated adenovirus per cell. Cells were harvested after 24 hrs (serum) or 30 hrs (virus). NIH 3T3 cells were fixed with 70% ethanol-PBS, stained with PI and analyzed by FACS. 20

PAGE 30

21 The Bok Promoter Contains a Conserved E2F Binding Site Between Mouse and Human. To understand how Bok is regulated in an E2F/cell cycle-dependent manner, we compared the genomic sequences of human (AC110299) and mouse Bok (NT_039173). To obtain authentic Bok genomic sequence from mouse, we screened a lambda phage library using a mixture of human cDNA probe s and mouse UTR Bok probes. Fig 6 shows a schematic of the various clones obtained. One of the sub-clones, 13S2, which contains the first two Bok exons and over 900 bp of upstream promoter region, was sequenced. Comparison of the mouse and human Bok 5 regions (shown in Fig. 7) revealed significant sequence homology within the first exon (non-coding) and in a region upstream of the putative transcriptional start site in mouse 141 Crude deletion analysis localized th e promoter to /+87 (not shown). Potentially important motifs within this region include numerous SP1 binding sites and, most importantly, a conserved E2F1 consensu s-binding site. We used PCR to generate a luciferase reporter vector using the mouse genomic sequence from /+87. To examine the role of the conserved E2F1 site spanni ng from position to we also generated a mutated version of the /+87 construc t in which the E2F1 site was rendered nonfunctional. Fig. 8 shows a schematic represen tation of the construc ts generated. They differ in that the consensus E2F binding site CGCG CG GGAAGACCGGCGGA (wild type) is changed to CGCG AT GGAAGACCGGCGGA (mutant).

PAGE 31

XXX80802008102200 SSSSSSS 1kb 13S2 13S4 8X3 13X11 11N6 15N9 8N1 A. ATG SstI SstI SmaI SmaI XbaI SmaI XbaI Bok /+2269 B. XXX80802008102200 SSSSSSS 1kb 13S2 13S4 8X3 13X11 11N6 15N9 8N1 A. ATG SstI SstI SmaI SmaI XbaI SmaI XbaI Bok /+2269 B. Figure 6. Overlapping subclones in pBS encompassing the entire Bok genomic locus. (A) Subclones were excised from the phage clones with Sst I (S), Xho I (X) or Not I (N). Not I subclones represent the entire insert of the phage clones, whereas Sst I and Xho I subclones contain only part of the original phage clone. Numbering is relative to the Mus musculus chromosome 1 genomic contig NT_039173.2, which contains the Bok locus. Solid boxes indicate exons. Exon 1 is noncoding. The ATG start codon is located at position 8083483 in exon 2. The stop codon is located at position 8092198 in exon 5. (B) The pBS-13S2 was further subcloned into pGL3 luciferase vector using Sst I, Sma I or Xba I. These subclones contain the Bok promoter region and the longest four putative E2F binding sites marked by black circles. 22

PAGE 32

ATCCTATTGTTCAAACTGTGTGAGGTTGATTCAAGGATAAAGAAATAAACCAGTGGGATAGAGTTCCGAG hbok TTCCTGCAGGTTGGACCAGCT**GGTCAACACAGAGCTCCAGA**CAAGCCTCT***CTCTCTTTGTGAG mBok (-843/-781) ACACACACACACACACACACACACTCTTCAGCTGATTTATGTTGAGATGTTGGGGACTCCTCCAATTCGG hbok TCTCTC*******TGTCTCTGCCTCTCTCTGTGTCTCTGTCTC****TCTCCCTCCCTCCCCTTTTTCTG mBok (-780/-722) TGGAAAAAAAATGA**TGCTTTTCAATAAATGATGCCAGGTCAATTGGATATCTACACGAAAAAAAATGA hbok TCAAAGGGAAATACCCTAATGAGAGATAACTAACTACAAAA*GATTATATATTGGATTGGATATAAATAA mBok (-721/-653) GCTCTAGCCCCGTA****CCACACCATTCACAATAATTAATATGTAATCAATCATAG*ATCTAAATATGA hbok G*TCCAGCTCATTAAAAGCAAAGCTAGACTTGAGTGGGAATGGATGGGTATTTGTAGTATCTTCAACCAT mBok (-652/-584) GCCCTAAAACAAGCTTCTAAAAGGAAATACAGGAGGATATCCCAATAAAAAGGTACTAACCATAAAGAAA hbok GTACATACCCAAGTCTTCACCACACTCCAAAGG*********CTCTATTAAG***CCAAGAATGCAGAAT mBok (-583/-526) ATATTGATAAATTGGACATCACTAAGAGTAACTCCTGTTCATCCAAAGCAAAAGTAAACCACAAAATAGA hbok CTATTTTTAAATAT****TTACTTATTGTTATTTTTGTT**TTGTGTATGAATGTTTGCCT********G mBok (-525/-470) GGAAGATATTTGCAATAACTTCAATAAATGCGAATCCAATAATCCATCTACAATACAA*AGGGCATGCG* hbok CCTCCATGTCTGTG**AATCCCCGTGCATGC****CTGGTG*TCCTTGGAGATCAGAAGAGGGCATCAGA mBok (-469/-407) TCCGGACCAAGAACACGTCTCCAGACTCTGGAAAGAACCTCTACGAACGAAGAAGACAACCCAA****** hbok TCTCCTACAACTTCAAGAATCCAGGATCTTTAAGGAGCCTCTATAAGACAATAAGGAAATATAAGTCAGC mBok (-406/-337) ***TTTTCAAATGGACCCCGGGGAACACCCAGGCGGCTGGGGCTGGCTCTAGGTCCCCACTGCTCTGCCT hbok TCATTTTAAAATGGAACTTGGTGCGC*CCCAGTGGGTTGGTGTCAGAGCTGGATGTTCTTCGCGCTGCCT mBok (-336/-268) TGCGGGGGCCGCTCCGGCCTGGTCGCCTTCTCCGGGCGCATCCAGGGAACTCGCTC*GGTCCTCCTTAAG hbok *GCCGGGACAGCTCCAGTCTGGCGGCGTTC*CCGGGCGCATCCCGAGAACTTGTGCTGGCCTTTCTTAAA mBok (-267/-200) Sp1 Figure 7. Evolutionary conserved E2F binding site. An alignment between the mouse (NT_039173) and human (AC110299) Bok gene sequences using MegAlign (DNASTAR, Inc) showed a conserved putative E2F binding site that extends from position to relative to the putative transcriptional start site in the mouse sequence. Shaded blocks indicate sequence identity of at least five base pairs. Boxed areas indicate putative transcription factor binding sites identified by MatInspector (Genomatix). The highlighted G at +1 in the mouse sequence indicates the putative transcription start site based on NCBI annotations (1). 23

PAGE 33

C*GGGGAAGC*TCGGAAAGCGTCT**CCCCGACTCCGCCCCCA*GGGTTGCCTTTCCCTTAGAAGGCCAA hbok CCAGGGAGGCGTTGGGCAGAGCTGGGCTGCGGCTCCGCCCCCGGGGGTTGCCGTTTCCTTAGAAGGCGAA mBok (-199/-130) Sp1 Myb GCCCCAAGCCCAGCCTCTCGCCAGCTGGGAGTCGCGCGCTGCCCACCTCGCTGCCCAGGCCCCCGACGCC hbok GCCCTAAGCCTGGCTTCTCGCCCGCGGGGAGAC*CGCGGTACGCCTCCCGC*****AC*CCCTCGGGACC mBok (-129/-67) Sp1 GCGGCAGGAGCCCCCCAAGAGCGCGGGAAGCCCCGTGGACCTGGCGCTCCCGGCTCGGGCGTGGACGGGG hbok *****AGGACTTCTGCGAGCGCGCGGGAAGACCGGCGGAGCCTGTGCTTC*AGCTCGGGTGTGGACGGGG mBok (-66 to -3) E2F/Ets1 Sp1 CGGGCGCCGGGGCGGGGCGCGCGTCCTCGCGGGTCTGAATGGAAGGGTCGAGGTCGTCGT***CGGCGGC hbok CGGGCGCTGGGGCGGGGCGCGCG**CTCGCGGGTTTGAATGGAAGGGTCTAGACCGCCGGAGACGGCAGC mBok (-2 to +66) Sp1 Sp1 Sp1 Ets1 GAGCAGATCCTGAAGCCAGAACTCCACCCCGGCGCC*CGCGCCATGCGGCGGGAGA*end exon I hbok GAGCGGGTCCTGAAACCAGAACTCCACCGCCGCCCCGCGCGCCATGAGGCGGGAGAGGTGAGTCGGGCGG mBok (+67/+136) Sp1 NF-1 Sp1 -43 -49 +1 Hbok GCGTGGCGTCGGTGCCCTGGATGT*end exon I mBok (+137/+160) 24

PAGE 34

mBok 44/+87 E2F WTmBok 44/+87 E2F MUT LucLuc mBok 44/+87 E2F WTmBok 44/+87 E2F MUT LucLuc Figure 8: Schematic representation of the Bok promoter. Site-directed mutagenesis assay was used to mutate the putative E2F binding site. The Bok promoter containing wild type (closed circle) or mutated (X) E2F binding site are shown. These fragments were then cloned into pGL3. 25

PAGE 35

26 Regulation of the Bok Promoter Throughout Cell Cycle To characterize the activity of the cloned Bok promoter throughout the cell cycle, NIH 3T3 cells were transfected with Bok / +87 WT or MUT promoter/reporter. Cells were brought to quiescence by in cubation with 0.5% calf serum for 48 hrs and were then serum stimulated with 10% fetal calf serum a nd harvested every 6 hrs. In parallel, cells were fixed with 70% ethanol-P BS, stained with PI and analyzed by FACS to determine cell cycle status. Fig. 9A shows that the activity of the WT Bok promoter is maximal at 6 and 12 hrs after addition of serum corresponding to the mid to late G1 phase of the cell cycle (Fig 9B). This pattern of regulation is very typical of an E2 F1-regulated gene. In contrast, the activity of the MUT Bok prom oter is unaffected by serum addition. This supports the conclusion that the conserved E2F binding site at -49/ -43 is central to the cell cycle regulat ion of Bok. Activation of the Bok Promot er is Not Specific to E2F1. E2F1 is the most potent inducer of apoptosis amongst the E2F family of proteins and appears essential for E2F-induced apoptosis 22,74 Since Bok is a known pro-apoptotic protein, we anticipated that E2F1 might be a sp ecific activator of B ok. To test this idea, we compared the ability of various E2Fs to induce the Bok luciferase reporter. We cotransfected the wild type (Bok /+87 WT) promoter, or the E2F site mutant (Bok 244/+87 MUT) in the presence and absence of exogenous E2F proteins (Fig 10A). E2Fs 1, 2 and 3B expression each led to promot er activation. This result suggests that

PAGE 36

020406080 % G0/G1 % S % G2/MNumber of cells (%)B.Starved6 Hrs12 Hrs18 Hrs24 Hrs + serummBok+87 A.Relative promoter activity Starved + serum 6Hrs + serum 12 Hrs + serum 18 Hrs + serum 24Hrs 012345 WTMUT 020406080 % G0/G1 % S % G2/MNumber of cells (%)B.Starved6 Hrs12 Hrs18 Hrs24 Hrs + serum 020406080 % G0/G1 % S % G2/MNumber of cells (%)B.Starved6 Hrs12 Hrs18 Hrs24 Hrs + serummBok+87 A.Relative promoter activity Starved + serum 6Hrs + serum 12 Hrs + serum 18 Hrs + serum 24Hrs 012345 WTMUTA.Relative promoter activity Starved + serum 6Hrs + serum 12 Hrs + serum 18 Hrs + serum 24Hrs 012345 WTMUT Figure 9: The Bok promoter is activated by addition of serum dependent upon a conserved E2F binding site. (A) NIH 3T3 cell were transfected with the WT or MUT /+87 Bok promoter luciferase construct and then brought to quiescent by 48-hrs incubation with 0.5% calf-serum. Following starvation cells were stimulated with 10% fetal calf serum and harvested every 6-hrs and assayed for luciferase activity. (B) Cells cycle progression of NIH 3T3 cells after treatment as above. Cells were fixed with 70% ethanol-PBS, stained with PI and analyzed by FACS. Luciferase assay was performed three time in triplicates each. p values were less than 0.05 at 6 and 12 hrs after serum treatment. 27

PAGE 37

28 activation of Bok is not specific to E2F 1. The growth-repressing members of the E2F family E2F4, 5 and 6 did not significantly ac tivate the promoter and neither did two E2F1 mutants. E2F1 1-283 is a C-terminally truncated version of E2F1 18 that does not have a transcriptional activation domain, indicating that activation of the Bok promoter requires the activation domain. Likewise, th e DNA binding E2F1 mutant, Eco 132 17 was unable to activate transcription. Thus, DNA binding is required for activ ation of the Bok promoter. Since E2F1 and E2F3B were the most poten t activators of the Bok promoter in the comparison of Fig. 5A, we focused experiments comparing E2F1, E2F3A and E2F3B. Together Fig. 10A and 10B reveal that E2F3A is the most potent inducer of the Bok promoter followed by E2F3B, E2F1 and E2F2. Although the importance of this pattern of activity is not certain, it is clear that E2F1 is un likely to be the sole regulator of Bok. The observation that over-expression of E2Fs can stimulate the MUT Bok reporter suggests that additional functi onal E2F binding sites may exist in the promoter, if E2F levels are sufficiently high. The Bok promoter is Not Activated by p53 Expression. A recent report suggested that Bok was a p53 target and that Bok was an essential mediator of p53-mediated apoptosis duri ng treatment with chemotherapuetic drugs 145 In their study they evaluated the role of caspases and new prot ein synthesis in the induction of the intrinsic pathway of apoptosis. They demonstrated that if protein synthesis was inhibited by treatment of cyclohexamide they would block the induction of apoptosis by

PAGE 38

29 the DNA damaging agent VP-16. They also dem onstrated that the activity of the tumor suppressor p53 was also necessary for apoptosis induction by VP-16. They then investigated what pro-apoptotic members of the Bcl-2 family were up-regulated by VP16, in which Bok and Noxa were identified. Furthermore, experiments with RNAi targeting exogenous Bok ans Noxa demonstrated their importance in the apoptosis induction after VP-16 treatment. Taken togeth er their results suggested that p53 activity and new protein synthesis was required fo r apoptosis induction after DNA damage by VP-16 and that decreasing the expression of exogenous Bok and Noxa significantly protected from cell death after VP-16 treatm ent. In their discussion they strongly suggested the possibility of p53 elements on the promoter of Bok and Noxa that would account for the activation of these proteins. Ho wever, sequence analysis did not reveal a p53 element in the Bok promoter, calling to que stion whether Bok is indeed a direct p53 target. To test this, we cotransfected NIH 3T3 cells with our /+87 WT Bok construct in the presence or absence of p53 expression (Fig 11A). In this experiment we can conclude that E2F1 is a st ronger inducer of the Bok promoter than p53. However, we do not exclude the possibility of other p53 bindi ng sites further upstream or downstream of the E2F binding site that are not present in our Bok promoter c onstruct (-244/+87). In addition, we are also limited by our control, a p53-regulated reporte r that was induced two-fold under identical conditi ons, similar to the induction of the Bok promoter (Fig 11B). Future experiments with larger Bok pr omoter constructs and additional controls such as a Bax promoter construct could proof or disproof the h ypothesis that the Bok promoter is regulated by the tumor suppressor p53.

PAGE 39

E2F1 Eco 132E2F1 1-283E2F6E2F5E2F4E2F3BpcDNA3E2F1E2F2Relative promoter activityWTMUT mBok/+87A 012345678 E2F1 Eco 132E2F1 1-283E2F6E2F5E2F4E2F3BpcDNA3E2F1E2F2 E2F1 Eco 132E2F1 1-283E2F6E2F5E2F4E2F3BpcDNA3E2F1E2F2Relative promoter activityWTMUT mBok/+87A 012345678 0123456789E2F1 pcDNA3E2F3AE2F3B WTMUTmBok /+87Relative promoter activityB 0123456789E2F1 pcDNA3E2F3AE2F3BE2F1 pcDNA3E2F3AE2F3B WTMUTmBok /+87Relative promoter activityB Figure 10: S phase promoting members of the E2F family activate the Bok promoter. (A) E2F binding site MUT and WT Bok promoters were co-transfected with expression vectors for different members of the E2F family and their ability to activate the Bok promoter was measured. (B) Same as in A except focusing on strongest S phase promoting E2Fs. E2F3A is the most potent activator of the Bok promoter. Experiments were performed in twice in triplicates each. p values were less than 0.05 for E2F-1, -2, -3a and -3b. 30

PAGE 40

05101520253035404550Relative promoter activity mBok/+87WTMUTpcDNA3E2F1p53A. 050100150200250300350400450BP100Relative promoter activity pcDNA3p53B. 05101520253035404550Relative promoter activity mBok/+87WTMUTpcDNA3E2F1p53A. 05101520253035404550Relative promoter activity mBok/+87WTMUTpcDNA3E2F1p53A. 050100150200250300350400450BP100Relative promoter activity pcDNA3p53B. 050100150200250300350400450BP100Relative promoter activity pcDNA3p53 050100150200250300350400450BP100Relative promoter activity pcDNA3p53B. Figure 11. p53 protein does not activate the Bok promoter. (A) E2F binding site MUT and WT Bok promoters were co-transfected with either E2F1 expression vector or p53 expression vector and measure their ability to activate the Bok promoter. (B) As a control p53 was co-expressed with a known p53 regulated promoter, BP100. Experiment was performed twice in triplicates each. p values were less than 0.05. 31

PAGE 41

32 E2F1 and E2F3 Associate With the Bok Promoter in vivo In light of the fact that E2F1 and E2 F3A potently activate th e Bok promoter in context of a luciferase reporter, we wanted to determine whether E2Fs associate with the Bok promoter in vivo For this, we turned to chro matin immunoprecipitation assay of asynchronous NIH 3T3 cells. As shown in Fig. 12, using Bok specific oligonucleotide primers that span to +87 of the muri ne Bok gene, E2F1 and E2F3 each associate with the Bok promoter in vivo in agreement with the afor ementioned luciferase result. The fact that immunoprecipitation with a contro l antibody (anti-IgG) re sults in absence of signal from the Bok promoter, demonstrates the specificity of the interaction between E2Fs and the Bok promoter. In addition, th e lower panel in Fig. 12 reveals that the murine albumin promoter, which does not po ssess E2F sites and has been shown not to associate with E2F (98), is not immunoprecip itated with E2F antibod ies under identical conditions.

PAGE 42

1kB LadderInputNo AbE2F3 AbE2F1 AbIgGAbNo DNAmBokmAlbumin1345672 1kB LadderInputNo AbE2F3 AbE2F1 AbIgGAbNo DNAmBokmAlbumin1345672 Figure 12. E2F1 and E2F3 associate with the Bok promoter in vivo. Asynchronously growing NIH 3T3 were subject to chromatin immunoprecipitation analysis with antibodies against E2F1 (lane 4), E2F3 (lane 5), or IgG (lane 6). Following DNA purification, samples were subject to PCR with primers designed to amplify the Bok promoter or the albumin promoter as control. 33

PAGE 43

34 Chapter 3: Functional Relevance of Bok In chapter two we demonstrate that E2F1 binds to the Bok promoter and leads to its transcriptional activation. Since E2F1 is the most potent inducer of apoptosis amongst the E2F family, it was interesting to see that other members of this family also regulate the Bok promoter. Furthermore, the observa tion that Bok mRNA increases after serum stimulation and that the Bok promoter is cell cycle regulated, suggested to us that Bok might have an unprecedented role in cell cycle. In this chapter we will investigate the role of Bok in cell cycle, E2F1-induced apoptosis and stress-induced apoptosis. We will use RNA interference to deplete cells from Bok and test its effect in the aforementioned context Bok d-siRNA Shuts Down the Expression of Bok. To determine the functional effect of in creased Bok expression, we created H1299 cells lines that constitutively express a Flag epitope-tagged version of Bok. Expression of the introduced Flag-Bok transgene was confirmed via RT-P CR and Western blot (Fig. 13A and 13B). Surprisingly, constitutive ex pression of Flag-Bok did not necessarily induce spontaneous apoptosis in these cells, and several lines were developed. Clone #8 expressed the highest level of Flag-Bok and wa s this used for subsequent experiments.

PAGE 44

125689H1299 Flag-Bok linesA.28 kDa RTH1299H1299 Flag-Bok #8----++++RNA in RT1 g1 g10 ng10 ng B.490 bp 125689H1299 Flag-Bok linesA.28 kDa 125689H1299 Flag-Bok linesA.28 kDa RTH1299H1299 Flag-Bok #8----++++RNA in RT1 g1 g10 ng10 ng B.490 bp RTH1299H1299 Flag-Bok #8----++++RNA in RT1 g1 g10 ng10 ng B.490 bp Figure 13. Stable over-expression of Flag-Bok protein. Flag-Bok expressing H1299 cell lines were generated by transfection with pcDNA3-Flag-Bok followed by selection with G418 (see Methods). G418-resistant colonies emerged with same efficiency as control pcDNA3. Of the first six lines emerging from this screen three expressed Flag-Bok as measured by anti-Flag Western blot. Clone #8 was used for subsequent experiments. 35

PAGE 45

36 In order to block Bok expre ssion we decided to turn to RNAi, and we utilize an approach that would target the most of the Bok mRNA. Using plasmid pcDNA3 FlagBok as template, we PCR amplified a 561 bp fragment of Bok and that PCR product cloned it into pCRII-TOPO vector. We then transformed this plasmid into bacteria, grew it up and screened for insert orientation. We finally identified one plasmid with each orientation. Using a RiboMax TM Large Scale RNA production System under the T7 promoter we in vitro transcribed and produced milligram quantities of RNA from both, the sense and the antisense strand of Bok. We then continue and combine 60 g of each RNA strand and let them a nneal by heating up to 65 C and letting it slowly cool down to room temperature. As control we ran an a liquot on a 4% agarose gel to make sure the RNAs anneal and form a single band ~561 bp ( not shown). After ann ealing we performed the Dicer reaction (Block IT TM Dicer kit from Invitrogen) followed by purification. With this experiment we generated a pool of ~21 bp diced-small interfering RNA (d-siRNA) (Figure 14, lanes 2 and 3) dire cted to many different part s of the of the Bok mRNA transcript. We then tested if these Bok d-siRNAs shut down the expression of Bok on H1299 cell lines that constitutively express Bok (Flag-Bok). Figure 15 shows Western blot analysis against Flag Bok protein after transfection of Bok d-siRNA at 24, 48 and 72 hours post transfection. Bok is Not Necessary for E2F1-Induced Apoptosis. We have shown that E2F1 overexpression increases Bok mRNA (Fig 4). For this reason we hypothesize that Bok is down st ream of E2F1 and being a pro-apoptotic member of the Bcl-2 family it might be an important player in E2F1-induce apoptosis. In

PAGE 46

Bok d-siRNA50 bp Bok d-siRNA50 bp1 2 3 Bok d-siRNA50 bp Bok d-siRNA50 bp1 2 3 Figure 14. Generation of Bok d-siRNA. Bok d-siRNA was produced by in vitro transcription of the sense and anti-sense strand of Bok cDNA. The product was then purified, mixed and heated to 65 followed by slow cool down in order to anneal both ssRNA. The 561 bp dsRNA was then diced using Invitrogens Dicer enzyme kit. This generated a pool of 21-23 bp dsRNAi that was visualized in a 4% agarose gel after the reaction (lane 2) and after purification (lane 3). Lane 1 is a 50bp ladder for size comparison. 37

PAGE 47

Flag-BokActinGFP 24 hrBok d-siRNA 24 hrGFP 48 hrBok d-siRNA 48 hrGFP 72 hrBok d-siRNA 72 hr Flag-BokActinGFP 24 hrBok d-siRNA 24 hrGFP 48 hrBok d-siRNA 48 hrGFP 72 hrBok d-siRNA 72 hr Figure 15. Bok d-siRNA shuts down the expression of Bok. H1299 Flag-Bok cell line were mock transfected with GFP or transfected with Bok d-siRNA at 0 and 24 hrs. Cells were harvested at the indicated times and 100 g of cell lysate was run on a 12 % SDS-PAGE. Western blot was against Flag-Bok and actin as a control. 38

PAGE 48

M1A. ER-E2F1 OHT M1B. ER-E2F1 + OHT M1C. ER-E2F1 OHT + Bok d-siRNA M1D. ER-E2F1 + OHT + Bok d-siRNA Cell numberPI stainingSub G1 = 0.83%Sub G1 = 20.27%Sub G1 = 2.87%Sub G1 = 19.86% M1A. ER-E2F1 OHT M1B. ER-E2F1 + OHT M1C. ER-E2F1 OHT + Bok d-siRNA M1D. ER-E2F1 + OHT + Bok d-siRNA Cell numberPI stainingSub G1 = 0.83%Sub G1 = 20.27%Sub G1 = 2.87%Sub G1 = 19.86% Figure 16. Bok deficiency does not block E2F1-induced apoptosis. This experiment was done in H1299 cells that stably express ER-E2F1 fusion protein. A. Mock transfected. B. Mock transfected and treated with OHT. C. Transfected with Bok d-siRNA. D. Transfected with Bok d-siRNA and treated with OHT. Note that there is no difference between B. and D. therefore Bok is not necessary for E2F1 induced apoptosis. 39

PAGE 49

40 order to test this hypothesis, we used a cell line that stably expresses ER-E2F1 fusion protein. When these cells are treated w ith 4-Hydroxytamoxifen (OHT) they undergo apoptosis induced by E2F1 following its nucle ar re-localization. Cells were mock transfected or transfected w ith Bok d-siRNA and after 24, 48 and 72 hrs post-transfection they were harvested, fixed with 70 % ethanol -PBS, stained with PI and sub-G1 content measured by FACS analysis. We expected th at cells lacking Bok by virtue of Bok dsiRNA would be more resistant to E2F1-i nduce apoptosis. Surprisingly Bok deficient cells were not significantly resistant to the induction of apoptosis by E2F1 (Figure 16). This suggests that Bok is not an essential pl ayer in the induction of apoptosis by E2F1, at least in the limited context of our experimental model. Bok is Not Necessary for Cell Cycle Progression. We were very surprised by the observati on that Bok message is up regulated by E2F1 as well as by serum, since Bok is an apoptotic protein. However, this pattern of regulation suggested that Bok play s a role in cell cycle contro l. The idea that Bcl-2 family members regulate cell cycle progression is no t new since there have been reports that Bcl-2 negatively regulates cell cycle progr ession by increasing the activity of p27 Kip1 135 which leads to the formation of a repressive E2F4/p130 complex that in turn block cell cycle progression through the G1/S boundary. To determine if transient Bok deficien cy would affect ce ll cycle progression, H1299 cells were transiently transfected with Bok RNAi and cell cy cle distribution was determined. Since endogenous Bok is difficult to detect with current antibodies it was

PAGE 50

01020304050607080 sub-G1% G0/G1% S% G2/MpcDNA3Flag-BoksiControlBokRNAiNumber of cells % 01020304050607080 sub-G1% G0/G1% S% G2/MpcDNA3Flag-BoksiControlBokRNAiNumber of cells % Figure 17. Bok is not required for cell cycle progression. The pattern of Bok regulation suggested that Bok might have an important role in the progression of cell cycle. However, neither over-expression nor depletion of Bok significantly affected the cell cycle compared to control counterparts. Experiment was performed more than three times and representative data is shown. p values were more than 0.05. 41

PAGE 51

42 necessary to use a surrogate cell line to demonstrate that the Bok RNAi was functional. Having established that the Bok RNAi was active (Fig 15), the parental H1299 cell line was transfected with the B ok siRNA and cell cycle distri bution was measured. Figure 17 shows a cell cycle analysis of cells that were mock transfected with pcDNA3-empty vector, transfected with Flag-Bok plasmi d, control RNAi or Bok d-siRNA. After repeating this experiment several times we did not find any significant evidence that Bok is required for cell cycle progression. Bok Localizes to the Cytoplasm The mechanism by which the Bcl-2 family of proteins induce cell death is not completely understood, yet a key component is the activation of caspases. The Bcl-2 family of proteins regulat e the activation of caspases by controling the release of cytochrome C from the mitochondria; which with Apaf-1 and procaspase 9 form the apoptosome. In the traditional view, proa nd anti-apoptotic members of the Bcl-2 family are found as heterodimeric proteins in the cy tosol. After stress such as DNA damage, proapoptotic proteins such as Bok, Bax, a nd Bak, release anti-apoptotic members and oligomerizes or heterodimerizes with other pro-apoptotic members in the mitochondrial membrane. It is propose that the pro-apoptotic proteins form pores in the mitochondrial membrane bringing about the re lease of cytochrome C, and this event triggers the apoptosis cascade. In the traditional view B ok should be cytosolic, howe ver a recent report from Bartholomeusz et al. 4 suggests that Bok contains a nuclear export sequence (NES)

PAGE 52

siControlBok d-siDAPIGFP-BokH1299Merge siControlBok d-siDAPIGFP-BokH1299Merge Figure 18. Bok localizes to the cytoplasm. H1299 cells were co-transfected with GFP-Bok and either Bok d-siRNA or control RNA and cell were then visualized by fluorescent microscopy. Over-expression of GFP-Bok demonstrate that Bok is mainly cytoplasmic. Top row, separation from blue (DAPI) and green (GFP-Bok). As expected co-transfection with Bok d-siRNA abrogated the expression of Bok. 43

PAGE 53

44 and is also found in the nucleus, where its a poptotic activity is e nhanced. In order to determine where does Bok localizes we turn ed to fluorescent microscopy using a green fluorescent protein (GFP) tagged Bok construc t. H1299 cells were co-transfected with GFP-Bok and either Bok d-siRNA or siContro l using lipofectamine reagent and observed under the fluorescent microscope after 24 hrs. Figure 18 demonstr ates that GFP-Bok localizes primarily to the cytoplasm. Thus, in our hands nuclear Bok appears minimal. In order to determine if Boks apoptotic activity is enhanced in the nucleus we developed H1299 cells that stably express an HA taggedestrogen receptor (ER) taggedfusion of Bok (Fig 19A). Wester n blot against HA reveal that all three cell lines express HA-ER-Bok fusion protein, however cell line number 2 less strong. Figure 19B demonstrate that HA-ER-Bok fusion protein is express in the cytoplasm and after treatment with the ER ligand, OHT, the fusion pr otein is forced into the nucleus, however some stays in the cytoplasm. Using this experimental approach H1299 HA-ER-Bok cell lines were treated with or without 300nM OHT and analyzed by FACS for subG1-DNA content as a measure of apoptosis. In cont rast to reports this did not induce any spontaneous apoptosis at 48 or 72 hrs (Fig 20 lanes 2, 6 and 10). We also performed a similar experiment where H1299 HA-ER-Bok cell line was treated with and without OHT and also 200nM Flavopiridol, since H1299 cells undergo apoptosis after FP treatment (86). Consistent with our previews result this did not enhance Boks apoptotic activity. If observed carefully, shuttling Bok into the nucleus slightly decreased sub-G1 DNA content (Fig 20, compare lanes 3 and 4, 11 and 12) suggesting that Boks apoptotic role is in the cytoplasm. Similar results were seen in an additional experiment; however,

PAGE 54

45 CNCN~55kDa -OHT+OHT124~55kDaH1299 ER-Bok cell lines A. B.H1299 ER-Bok #1 CNCN~55kDa -OHT+OHT124~55kDaH1299 ER-Bok cell lines A. B.H1299 ER-Bok #1 Figure 19. Generation of responsive H1299 HA-ER-Bok cell line. HA-ER-Bok expressing H1299 cell lines were generated by transfection toplasm with pcDNA3-HA-ER-Bok followed by selection with G418 (see Methods). (A) At least three cell lines emerging from this screen expressed HA-ER-Bok as measured by anti-HA Western blot. (B) Fractionatio experiment reveal that ER-Bok is expressed in the cyand after treatment with 300 nM OHT more than half of ER-Bok isshuttled into the nucleus.

PAGE 55

46 01020304050607080 48 hrs 72 hrs-OHT-OHT+FP-OHT-OHT+OHT+OHT+OHT+OHT+FP-OHT+FP-OHT+FP+OHT+FP+OHT+FPER-Bok#1 ER-Bok#2 ER-Bok#4 % apoptosis123456789101112 01020304050607080 48 hrs 72 hrs-OHT-OHT+FP-OHT-OHT+OHT+OHT+OHT+OHT+FP-OHT+FP-OHT+FP+OHT+FP+OHT+FPER-Bok#1 ER-Bok#2 ER-Bok#4 % apoptosis123456789101112 Figure 20. Boks apoptotic role is not enhanced in the nucleus. H1299 HA-ER-Bok cell lines1, 2 and 4 were treated with or without 300 nM bt OHT in order to shuttle Bok into the nucleus. In contrast to reports this did not induce any spontaneous apoptosis as measured by FACS for suG1 DNA content, after 48 and 72 hrs of OHT treatment (compare lane 1and 2, 5 and 6, 9 and 10). We also combined OHT and flavopiridol treatment (to induce apoptosis) and tested if Bok in the nucleus had an enhance apoptotic activity, however we saw a slightly opposite effec(compare lanes 3 and 4, 7 and 8, 11and 12). Experiment was performedtwice in singles each. Representative result is shown.

PAGE 56

47 further experimentation in duplicates or tripli cates is needed to so lidify this observation. Additionally this experiment is limited by the lack of good antibody against endogenous Bok, since tagging Bok with GFP or HA-ER migh t affect the ability of Bok to move to different compartments in the cell. Bok Expression Sensitizes Cells to Stress-Induced Apoptosis The Flag-Bok expressing cells generated in Figure 13 grew at the same rate as parental H1299s (Fig 21). In light of the observation that Bok over-expression alone is not sufficient for apoptosis induction, we s ought to determine whether over-expression of Bok sensitizes cells to stre ss-induced apoptosis. To this end, the H1299-Flag-Bok #8 cell line (as well as parental H1299s ) were assayed for viability after treatment with the cyclin-dependent kinase inhibitor flavopiridol, which we have previously shown to induce apoptosis in H1299 cells 86,88. Fig. 21 reveals that flav opiridol-induced loss of viability is greatly accelerat ed in Bok expressing cells. We next sought to verify our viability assay in a more direct measurement of apoptosis induction. The H1299Flag-Bok cell line and control H1299s were treated with flavopiridol, harvested at 24 hrs intervals, stained with propidium iodide (PI) and assayed for sub-G1 DNA content via flow cytometry. In agreement with low viability, there was a significant increase in sub-G1 content within the flavopiridol trea ted H1299-Flag-Bok cell lines in comparison to the parental cont rols (Fig. 21). Similar results were obtained with other genotoxic agents (Fig 22). For further conf irmation, we conducted Western blot analysis for the presence of poly-ADP ribose polymerase (PARP) cleavage (a

PAGE 57

48 oticeable 48 hrs and maximal at 72 hrs within the 1299 parental controls (Fig. 23). Taken togeth er, these data suggest that expression of measurement of apoptosis) within the same experiment. As expected, both H1299-FlagBok and parental H1299s displayed cleavage of PARP, however, PARP cleavage began 24 hrs post flavopiridol treatment and was ma ximal at 48 hrs in the Bok expressing cell line, whereas PARP cleavage was n H Bok sensitizes cells to rapid apoptosis induction.

PAGE 58

49 103104105106107024487296120Total viable cells H1299 no drug H1299-Flag-Bok #8 no drug H1299 FP H1299-Flag-Bok #8 FP Time (hrs) 103104105106107024487296120Total viable cells H1299 no drug H1299-Flag-Bok #8 no drug H1299 FP H1299-Flag-Bok #8 FP Time (hrs) Figure 21. Kinetics of apoptosis inducti on in response to Flavopiridol treatment. H1299 and H1299 Flag-Bok cell line #8 were plated in 60mm plates and their growth rate/sur vival was measured by trypsinization, followed by counting trypan blue excluding cells after treatment with DMSO control or flavopiridol [200 nM]. H1299 and H1299 Flag-Bok cell lines grow at similar rates (circles and squares), however upon treatment with FP, the Flag Bok cell line dies faster. Experiment was performed in triplicates and p values were less than 0.05.

PAGE 59

090none48h72h96h48h72h96h120h48h72h96h120h 1020304050607080 H1299 H1299-Flagbok8 VP16FPUV % apoptosis Figure 22. Constitutively Bok expression sensitizes to apoptosisDNA damage. DNA damage was induce in H1299 or H1299 Flagby treatment with chemotherapeutic drugs (VP16 or Flavopiridoirradiation. Cells were then harvested at 48, 72, 96 or 120 hrs, fixe70% ethanol-PBS, stained with PI and analyzed f after -Bok l) or UV d with or sub-G1 DNA content. 50

PAGE 60

51 Flavopiridol048729624 H1299H1299-Flag Bok #8 cleaved PAR(85 kDa)actin (43 kDa)cleaved PAR(85 kDa)actin (43 kDa)Hrs P P Flavopiridol048729624 H1299H1299-Flag Bok #8 cleaved PAR(85 kDa)actin (43 kDa)cleaved PAR(85 kDa)actin (43 kDa)Hrs Figure 23. A molecular marker of apoptosis is seen by 24 hr after FP treatment in the Flag-Bok expressing cell line. Protein extracts of H1299 or H1299 Flag-Bok cell lines after treatment of flavopiridol were hoop arvested in 24 hr intervals and Western blotted for PARP as a measure f apoptosis. PARP cleavage was visible by 24 hrs and maximal at 48 hrs n H1299 Flag Bok cell line in contrast to being maximal at 72hrs on arental H1299 cells P P

PAGE 61

52 in a m roteins that modulate survival are growing increasingly complex and interwoven. This the first example of a pro-apoptotic member of the Bcl-2 family found to have its xpression tied to cell cycle progression, although this is no t the first example of gulation of Be at E2F1 can an directly rero-apoptotic the Bcl-2 family (PUMA, Noxa, Bim, and Hrk/DP5) re also activated by E2F1 46. In the current work, we find that E2F1 can directly activate xpression of Bok. Since E2F1 is a well-characterized inducer of apoptosis its effects on cl-1, PUMA, Noxa, Bim, Hrk/DP5 and Bok are logical. The net consequence of over-active E2F1 is thus to tip the balancing act within the Bcl-2 family toward apoptosis. Chapter 4: Discussion In the current work we show that the Bok promoter is activated by serum addition anner dependent upon a conserved E2F site in the promoter. The Bok promoter is also activated by over-expression of S phase promoting members of the E2F family. We also show by ChIP assay that E2F1 and E2F3 both bind the Bok promoter region in vivo. Finally we find that Bok over-expression sensitizes to flavopiridol-induced apoptosis. Our understanding of the interactions between the E2F and Bcl-2 families of p is e re cl-2 family by E2F1 in its apoptotic role. It has been known for some timrepress the expression of Bcl-2 25 and, we have demonstrated that E2F1 press the Mcl-1 promoter th 19,87 Other laboratories have found that several BH3-only members of c p a e M

PAGE 62

53 The transcriptional activati on of Bok at the G1/S bounda ry by serum stimulation was not anticipated since Bok is considered a ember of the Bcl-2 family. Bok might have a number of roles at G1/S. Bok might serve a specific G1/S or S phase function. For example, recent work has shown that BID (a pro-apoptotic Bcl-2 protein) can induce an S phase arrest fo llowing its phosph orylation by ATM While we cannot formally exclude the possibility that Bok has a specific G1/S function, we have performed extensive siRNA and shRNAi experi mentation aimed at depleted proliferating cells of Bok. Though we are confident in our ability to deplete cells of 80-90% of endogenous Bok mRNA or exogenou s protein, we obtained no convincing evidence that Bok deficiency affects cell cycle progression. Of course these studies are hampered by the lack of good quality antibody to Bok, and so, it is possible that future studies will find an additional role for Bok in cell cycle. An alternative role for Bok induction at the G1/S boundary would be to serve as a checkpoint. G1/S phase cells are known to be highly sensitive to apoptosis induction and it reasonable that expression of Bok might mediate this sensitivity, at leas t in part. This model would lead to the prediction that ce lls expressing exogenous Bok would survive and grow normally, but would be sensitive to apoptosis-inducing stresses. Indeed, this appears to be the case since Flag-Bok expr essing H1299 cell lines ar e obtained with high efficiency and they grow normally, yet they are much more readily killed by treatment with flavopiridol, as well as by other death-inducing agents. Taken together the results in pro-apoptotic m 35,70,152

PAGE 63

54 is dissertation demonstrate that Bok is a cell cycle regulated member of the Bcl-2 family d ric at nts should use the reagents we have developed generate Bok-deficient mice using the conventional ta rgeting approach. behavior in aspects such as appearance, viability, growth ra te, fertility and longevity. Any th that serves as a chec kpoint sensitizing replicating cells to stress-induced apoptosis Future Studies Throughout my graduate st udies, we have demonstr ated that Bok mRNA is upregulated by serum stimulation and by E2F1 over-expression. We have also cloned an characterized the Bok promoter and demons trated that E2F1 directly binds and transactivates it via a conserved E2F elemen t. In addition we have shown that high expression of Bok sensitizes cells to apoptos is after treatment with chemotherapeut agents. Furthermore, it is known that appropria te patterns of apoptos is are essential for normal tissue development, and since Bok is an inducer of apoptosis a nd it is expressed various levels in diverse tissues 126 it may play a significant role in mouse development.. To test these hypotheses future experime to Bok mRNA expression is highest in the uterus, ovaries and testes; therefore these tissues are most likely to be dramatically affected by Bok deficiency. However, we may also expect to see tumor suppressor effects in other tissue that express Bok including lung, brain, liver, mammary epithelium and lymphoid tissues. Assuming that Bok heterozygous mice are viable and fertile, we e xpect them to be developmentally normal, however litter sizes and animal weights will be monitored and recorded to detect any differences from control animals. Mice will be observed carefully for overall health and

PAGE 64

55 m bnormalities and weighed to determine if Bok deficiency affects organ size. The organs ly interested include the testes, ovaries, uterus, lung, brain, liver and mph for at t h as TUNEL nd apo-BrdU would reveal fewer positive cells compared to wild type counter parts. For exampl think be outstanding abnormalities will be noted and aff ected animals euthanized. Organs fro age matched wt and heterozygous animals will be removed, examined for gross a we are particular lynodes. Once weighed, organs will be fixed, paraffin-embedded and sectioned histological examination and immunohistochemistry for BrdU, TUNEL and levels of Bok protein. Two heterozygous mice will be crossed and by Mendelian genetics we expect th about twenty-five percent of the offspring to be homozygous null. The first question tha this analysis will answer is whether we can establish Bok-deficient mice. Since Bok is an apoptotic protein we predict that Bok-defi cient mice will display apoptotic defects in multiple tissues. The defects we may observe could be organ enlargement, but perhaps poor organization and differentiation due to im paired apoptosis. Assays suc a e, mice over-expressing Bcl-2 in the ova ries results in suppression of follicular cell apoptosis, enhancement of folliculogenesi s and increased germ cell tumorigenesis 56 Interestingly, the Bcl-2 transgenic mice were fertile and their litters were on average 2 pups larger than litters of wild-type females, due to enhanced folliculogenesis. We that it is likely that the effects of Bok defici ency, at least within the ovary, will be similar to the effects of Bcl-2 over-expression, and thus, Bok deficient animals will probably more fertile than control mice. Again, health and behavior will be monitored for up to twenty-four months to determine thes e animals develop spontaneous tumors.

PAGE 65

56 s these le, ere the Bcl-2 family members are co-expressed at high levels. In addition, ombined deficiencies may result in a str onger predisposition towa rd tumor formation. ia In the case of successfully developing Bok-deficient mice, we could cros animals with commercially available Baxand Bak-deficient animals in order to identify unique versus redundant or cooperative functions within this family of proteins. If viab we anticipate that pathological effects of either Bax or Bak deficiency may be significantly aggravated by defi ciency of Bok, particularly in lymphoid or reproductive tissue wh c In summary, future studies with a Bok-deficient animal will seek to determine the role of Bok in vivo and in mouse tumorgenesis. We anticipate that Bok will be found to be a tumor suppressor and that Bok-deficien t animals will be predisposed to hyperplas and neoplasia. We also anticipate that Bok may play a role in reproductive development or physiology.

PAGE 66

57 References 2. Angus, S. P., A. F. Fribourg, M. P. Markey, S. L. Williams, H. F. Horn, J. 3. Baldwin, E. L. and N. Osheroff 2005. Etoposide, topoisomerase II and cancer. Curr. Med. Chem. Anticancer Agents 5:363-372. 4. Bartholomeusz, G., Y. Wu, S. M. Ali, W. Xia, K. Y. Kwong, G. Hortobagyi, and M. C. Hung 2006. Nuclear translocation of the pro-apoptotic Bcl-2 family member Bok induces apoptosis. Mol. Carcinog. 45 :73-83. 5. Bates, S., A. C. Phillips, P. A. Clark, F. Stott, G. Peters, R. L. Ludwig, and K. H. Vousden 1998. p14ARF links the tumour suppressors RB and p53. Nature 395:124-125. 1. Adams, P. D. and W. G. Kaelin, Jr. 1996. The cellular effects of E2F overexpression. Curr. Top. Microbiol. Immunol. 208:79-93. DeGregori, T. F. Kowalik, K. Fukasawa, and E. S. Knudsen 2002. Active RB elicits late G1/S inhibition. Exp. Cell Res. 276:201-213.

PAGE 67

58 6. Bindels, E. M., F. Lallemand, A. Balkenende, D. Verwoerd, and R. Michalides 2002. Involvement of G1/S cycl ins in estrogen-independent proliferation of estrogen receptor-pos ive breast cancer cells. Oncogene 21:81588165. P. E. cell development in the bursa of Fabricius. Dev. Comp Immunol. 28:619-634. 8. oisomerase II.etoposide interactions direct the formation of drug-induced enzyme-DNA cleavage 9. Calbo, J., M. Parreno, E. Sotillo, T. Yong, A. Mazo, J. Garriga, and X. 0274. ol. 173:1111-1117. it 7. Brown, C. Y., S. J. Bowers, G. Loring, C. Heberden, R. M. Lee, and Neiman 2004. Role of Mtd/Bok in normal and neoplastic BBurden, D. A., P. S. Kingma, S. J. Froelich-Ammon, M. A. Bjornsti, M. W. Patchan, R. B. Thompson, and N. Osheroff 1996. Top complexes. J. Biol. Chem. 271:29238-29244. Grana 2002. G1 cyclin/cyclin-dependent ki nase-coordinated phosphorylation of endogenous pocket proteins diffe rentially regulates their interactions with E2F4 and E2F1 and gene expression. J. Biol. Chem. 277:50263-5 10. Cao, Q., Y. Xia, M. Azadniv, and I. N. Crispe 2004. The E2F-1 transcription factor promotes caspase-8 and bid expr ession, and enhances Fas signaling in T cells. J. Immun

PAGE 68

59 Worland inase 12. Cartwright, P., H. Muller, C. Wagener, K. Holm, and K. Helin. 1998. E2F-6: n. 13. Chim, C. S., T. K. Fung, K. F. Wong, J. S. Lau, M. Law, and R. Liang 2006. 14. Classon, M. and N. Dyson 2001. p107 and p130: versatile proteins with 15. l cycle control. Proc. Natl. Acad. Sci. U. S. A 97:10820-10825. 16. l e 22:8590-8607. 11. Carlson, B. A., M. M. Dubay, E. A. Sausville, L. Brizuela, and P. J. 1996. Flavopiridol induces G1 arrest with inhibition of cyclin-dependent k (CDK) 2 and CDK4 in human br east carcinoma cells. Cancer Res. 56:2973-2978. a novel member of the E2F family is an inhibitor of E2F-dependent transcriptio Oncogene 17:611-623. Methylation of INK4 and CIP/KIP families of cyclin-dependent kinase inhibitor in chronic lymphocytic leukaemia in Chinese patients. J. Clin. Pathol. 59:921926. interesting pockets. Exp. Cell Res. 264:135-147. Classon, M., S. Salama, C. Gorka, R. Mulloy, P. Braun, and E. Harlow 2000 Combinatorial roles for pRB, p107, and p130 in E2F-mediated cel Cory, S., D. C. Huang, and J. M. Adams 2003. The Bcl-2 family: roles in cel survival and oncogenesis. Oncogen

PAGE 69

60 19. Croxton, R., Y. Ma, L. Song, E. B. Haura, and W. D. Cress 2002. Direct 20. 3. fication and characterization of E2F7, a novel mammalian E2F family member capable of blocking cellula r proliferation. J. Biol. Chem. 278:4204121. DeGregori, J., T. Kowalik, and J. R. Nevins 1995. Cellular targets for 22. DeGregori, J., G. Leone, A. Mi ron, L. Jakoi, and J. R. Nevins 1997. Distinct 17. Cress, W. D., D. G. Johnson, and J. R. Nevins 1993. A genetic analysis of the E2F1 gene distinguishes regulation by Rb, p107, and adenovirus E4. Mol. Cell Biol. 13:6314-6325. 18. Cress, W. D. and J. R. Nevins. 1994. Interacting domains of E2F1, DP1, and the adenovirus E4 protein. J. Virol. 68:4213-4219. repression of the Mcl-1 pr omoter by E2F1. Oncogene 21:1359-1369. de Bruin, A., B. Maiti, L. Jakoi, C. Timmers, R. Buerki, and G. Leone 200 Identi 42049. activation by the E2F1 transcription f actor include DNA synthesisand G1/Sregulatory genes. Mol. Cell Biol. 15:4215-4224. roles for E2F proteins in cell growth cont rol and apoptosis. Proc. Natl. Acad. Sci. U. S. A 94:7245-7250.

PAGE 70

61 24. Di Stefano, L., M. R. Jensen, and K. Helin 2003. E2F7, a novel E2F featuring etti, both c-Myc and E2F-1. Oncogene 20:6983-6993. 26. ce 85:549-561. on is 28. Frame, F. M., H. A. Rogoff, M. T. Pi ckering, W. D. Cress, and T. F. Kowalik. 23. Delavaine, L. and N. B. La Thangue 1999. Control of E2F activity by p21Waf1/Cip1. Oncogene 18:5381-5392. DP-independent repression of a subset of E2F-regulated genes. EMBO J. 22:6289-6298. 25. Eischen, C. M., G. Packham, J. Nip, B. E. Fee, S. W. Hiebert, G. P. Zamb and J. L. Cleveland 2001. Bcl-2 is an apoptotic target suppressed by Field, S. J., F. Y. Tsai, F. Kuo, A. M. Zubiaga, W. G. Kaelin, Jr., D. M. Livingston, S. H. Orkin, and M. E. Greenberg 1996. E2F-1 functions in mi to promote apoptosis and suppress proliferation. Cell 27. Flores, A. M., R. F. Kassatly, and W. D. Cress 1998. E2F-3 accumulati regulated by polypeptide stability. Oncogene 16:1289-1298. 2006. E2F1 induces MRN foci formation a nd a cell cycle chec kpoint response in human fibroblasts. Oncogene 25:3258-3266.

PAGE 71

62 A role ng thymic negative selection. Cell Growth Differ. 11:91-98. 30. merase and phosphoryla tion. Antonie Van Leeuwenhoek 62:15-24. ol. Cell 6 :729-735. s. 244:157-170. 34. Gomez, L. A., P. A. de Las, and C. Perez-Stable 2006. Sequential combination 35. Gross, A. 2006. BID as a double agent in cell life and death. Cell Cycle 5 :582584. 29. Garcia, I., M. Murga, A. Vicario, S. J. Field, and A. M. Zubiaga. 2000 for E2F1 in the induction of apoptosis duri Gasser, S. M., R. Walter, Q. Dang, and M. E. Cardenas. 1992. Topoiso II: its functions 31. Gaubatz, S., G. J. Lindeman, S. Ishi da, L. Jakoi, J. R. Nevins, D. M. Livingston, and R. E. Rempel 2000. E2F4 and E2F5 play an essential role in pocket protein-mediated G1 control. M 32. Gill, R. M., R. Slack, M. Kiess, and P. A. Hamel 1998. Regulation of expression and activity of distinct pRB, E2F, D-type cyclin, and CKI family members during terminal differentiation of P19 cells. Exp. Cell Re 33. Ginsberg, D. 2002. E2F1 pathways to apoptosis. FEBS Lett. 529:122-125. of flavopiridol and docetaxel reduces the le vels of X-linked inhibitor of apoptosis and AKT proteins and stimulates apop tosis in human LNCa P prostate cancer cells. Mol. Cancer Ther. 5:1216-1226.

PAGE 72

63 iol. nol. 5:299-308. 38. and K. -107. 42. as, and W. D. Cress 2000. Identification of E2F-3B, an alternative form of E2F-3 lacking a conserved N-terminal region. 36. Gutierrez, C., E. Ramirez-Parra, M. M. Castellano, and J. C. del Pozo 2002. G(1) to S transition: more than a cell cycle engine switch. Curr. Opin. Plant B 5:480-486. 37. Gyory, I., J. Wu, G. Fejer, E. Seto, and K. L. Wright 2004. PRDI-BF1 recruits the histone H3 methyltransferase G9a in transcriptional silencing. Nat. Immu Hande, K. R. 1998. Clinical applications of anticancer drugs targeted to topoisomerase II. Biochim. Biophys. Acta 1400:173-184. 39. Hao, H., Y. Dong, M. T. Bowling, J. G. Gomez-Gutierrez, H. S. Zhou M. McMasters. 2007. E2F-1 induces melanoma cell apoptosis via PUMA up regulation and Bax translocation. BMC. Cancer 7:24. 40. Harper, J. W. 1997. Cyclin dependent kinase inhibitors. Cancer Surv. 29 :91 41. Hatakeyama, M. and R. A. Weinberg 1995. The role of RB in cell cycle control. Prog. Cell Cycle Res. 1:9-19. He, Y., M. K. Armanious, M. J. Thom Oncogene 19:3422-3433.

PAGE 73

64 44. Helin, K., J. A. Lees, M. Vidal, N. Dyson, E. Harlow, and A. Fattaey 1992. A 45. Hengstschlager, M., K. Braun, T. Soucek, A. Miloloza, and E. nsition 47. Holmberg, C., K. Helin, M. Sehested, and O. Karlstrom 1998. E2F-1-induced ibits mor suppressor p53. EMBO J. 18 :22-27. d induce apoptosis. Cell Cycle 5:801-803. 43. He, Y. and W. D. Cress 2002. E2F-3B is a physiological target of cyclin A. J. Biol. Chem. 277 :23493-23499. cDNA encoding a pRB-binding protein with pr operties of the transcription factor E2F. Cell 70:337-350. Hengstschlager-Ottnad 1999. Cyclin-dependent kinases at the G1-S tra of the mammalian cell cycle. Mutat. Res. 436:1-9. 46. Hershko, T. and D. Ginsberg. 2004. Up-regulation of Bcl-2 homology 3 (BH3)only proteins by E2F1 mediates apoptosis. J. Biol. Chem. 279 :8627-8634. p53-independent apoptosis in transgenic mice. Oncogene 17:143-155. 48. Honda, R. and H. Yasuda 1999. Association of p19(ARF) with Mdm2 inh ubiquitin ligase activit y of Mdm2 for tu 49. Hong, S., R. V. Pusapati, J. T. Powers, and D. G. Johnson 2006. Oncogenes and the DNA damage response: Myc and E2F1 engage the ATM signaling pathway to activate p53 an

PAGE 74

65 h a, R. Slack, and J. P. MacManus 2000. The transcription factor E2F1 modulates apoptosis of neurons. J. Neurochem. 75:9151. S. Dostanic, I. Rasquinha, T. Comas, P. Morley, and J. P. MacManus 2001. Increased expression of th e transcription factor E2F1 cal neurons. 52. Hsiao, K. M., S. L. McMahon, and P. J. Farnham. 1994. Multiple DNA nd is inhibited by the reti noblastoma protein through dir ect interaction. Genes Dev. 54. Hsu, S. Y. and A. J. Hsueh 1998. A splicing variant of the Bcl-2 member Bok 50. Hou, S. T., D. Callaghan, M. C. Fournier, I. Hill, L. Kang, B. Massie, P. Morley, C. Murray, I. Rasquin 100. Hou, S. T., E. Cowan, during dopamine-evoked, caspase-3-mediated apoptosis in rat corti Neurosci. Lett. 306 :153-156. elements are required for the growth re gulation of the mouse E2F1 promoter. Genes Dev. 8:1526-1537. 53. Hsieh, J. K., S. Fredersdorf, T. Kouzarides, K. Martin, and X. Lu 1997. E2F1-induced apoptosis requires DNA bindi ng but not transactivation a 11:1840-1852. with a truncated BH3 domain induces apoptosis but does not dimerize with antiapoptotic Bcl-2 proteins in vitro. J. Biol. Chem. 273:30139-30146.

PAGE 75

66 s a Sci. U. S. A 94:12401-12406. icle and J. in 59. Ikeda, M. A., L. Jakoi, and J. R. Nevins 1996. A unique role for the Rb protein 60. Inohara, N., D. Ekhterae, I. Garcia, R. Carrio, J. Merino, A. Merry, S. Chen, and G. Nunez 1998. Mtd, a novel Bcl-2 family member activates apoptosis in 55. Hsu, S. Y., A. Kaipia, E. McGee, M. Lomeli, and A. J. Hsueh 1997. Bok i pro-apoptotic Bcl-2 protein with restricted expression in reproductive tissues and heterodimerizes with selective anti-apoptotic Bcl-2 family members. Proc. Natl. Acad. 56. Hsu, S. Y., R. J. Lai, M. Finegold, and A. J. Hsueh 1996. Targeted overexpression of Bcl-2 in ovaries of tran sgenic mice leads to decreased foll apoptosis, enhanced folliculogenesis, a nd increased germ cell tumorigenesis. Endocrinology 137:4837-4843 57. Humbert, P. O., R. Verona, J. M. Trimarchi, C. Rogers, S. Dandapani, A. Lees. 2000. E2f3 is critical for normal cellular proliferation. Genes Dev. 14:690-703. 58. Hyde, R. K. and A. E. Griep 2002. Unique roles for E2F1 in the mouse lens the absence of functional pRB protei ns. Invest Ophthalmol. Vis. Sci. 43:15091516. in controlling E2F accumulation during ce ll growth and differentiation. Proc. Natl. Acad. Sci. U. S. A 93 :3215-3220.

PAGE 76

67 61. ips, R. S. Seelan, D. I. Smith, W. Liu, E. R. Flores, K. Y. Tsai, T. Jacks, K. H. Vousden, and W. G. Kaelin, Jr. 2000. 7:64562. E. Huber, P. J. Goodhart, A. Oliff, and D. C. Heimbrook 1993. Cloning and characterization of E2F-2, a novel protein with 63. Jiang, Z., P. Liang, R. Leng, Z. Guo, Y. Liu, X. Liu, S. Bubnic, A. Keating, D. sis during skeletal myogenesis. Dev. Biol. 227:8-41. 65. Johnson, D. G., K. Ohtani, and J. R. Nevins 1994. Autoregulatory control of the absence of heterodime rization with Bcl-2 and Bcl-XL. J. Biol. Chem. 273:8705-8710. Irwin, M., M. C. Marin, A. C. Phill Role for the p53 homologue p73 in E2F-1-induced apoptosis. Nature 40 648. Ivey-Hoyle, M., R. Conroy, H. the biochemical properties of transcri ption factor E2F. Mol. Cell Biol. 13 :78027812. Murray, P. Goss, and E. Zacksenhaus. 2000. E2F1 and p53 are dispensable, whereas p21(Waf1/Cip1) cooperates with Rb to restrict endoreduplication and apopto 64. Johnson, D. G. 2000. The paradox of E2F1: oncogene and tumor suppressor gene. Mol. Carcinog. 27 :151-157. E2F1 expression in response to positive and negative regulators of cell cycle progression. Genes Dev. 8:1514-1525.

PAGE 77

68 66. ycle r. Front Biosci. 3 :d447-d448. 68. Kaelin, W. G., Jr. 1999. The emerging p53 gene family. J. Natl. Cancer Inst. 69. uchs, T. Chittenden, Y. Li, P. J. Farnham, M. A. Blanar, and 1992. Expression cloning of a cDNA encoding a retinoblastoma-binding protein with 70. BID is an ATM effector in the DNA-damage response. Cell 122:593-603. 71. 998. Cell cycle regulation and apoptosis. Annu. Rev. Physiol 60:601-617. Johnson, D. G. and R. Schneider-Broussard 1998. Role of E2F in cell c control and cance 67. Johnson, D. G., J. K. Schwarz, W. D. Cress, and J. R. Nevins 1993. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature 365:349-352. 91:594-598. Kaelin, W. G., Jr., W. Krek, W. R. Sellers, J. A. DeCaprio, F. Ajchenbaum, C. S. F E2F-like properties. Cell 70 :351-364. Kamer, I., R. Sarig, Y. Zaltsman, H. Niv, G. Oberkovitz, L. Regev, G. Haimovich, Y. Lerenthal, R. C. Marcellus, and A. Gross 2005. Proapoptotic King, K. L. and J. A. Cidlowski 1

PAGE 78

69 Phosphorylation of E2F-1 by cyclin A-cdk2. Oncogene 10:229-236. 73. isco, J. Y. Wang, and E. S. Knudsen 2000. RB-dependent S-phase response to DNA damage. Mol. Cell Biol. 20:7751-7763. 74. F., J. DeGregori, G. Leone, L. Jakoi, and J. R. Nevins 1998. E2F1-specific induction of apoptosis a nd p53 accumulation, which is blocked by 75. leads to inducti on of cellular DNA synthesis and apoptosis. J. Virol. 69:2491-2500. 76. nt. Cell 83:1149-1158. 77. and K. Bojanowski 1996. The roles of DNA topoisomerase II during the cell cycle. Prog. Cell Cycle Res. 2 :229-239. 72. Kitagawa, M., H. Higashi, I. Suzuki-Takahashi, K. Segawa, S. K. Hanks, Y. Taya, S. Nishimura, and A. Okuyama 1995. Knudsen, K. E., D. Booth, S. Naderi, Z. Sever-Chroneos, A. F. Fribourg, I. C Hunton, J. R. Feram Kowalik, T. Mdm2. Cell Growth Differ. 9:113-118. Kowalik, T. F., J. DeGregori, J. K. Schwarz, and J. R. Nevins 1995. E2F1 overexpression in quiescent fibroblasts Krek, W., G. Xu, and D. M. Livingston 1995. Cyclin A-kinase regulation of E2F-1 DNA binding function underlies suppression of an S phase checkpoi Larsen, A. K., A. Skladanowski

PAGE 79

70 :7813-7825. ion es. 33:2813-2821. 1. gene 05. 83. Logan, N., L. Delavaine, A. Graham, C. Reilly, J. Wilson, T. R. DNAbinding domains. Oncogene 23:5138-5150. 78. Lees, J. A., M. Saito, M. Vidal, M. Valentine, T. Look, E. Harlow, N. Dyson, and K. Helin 1993. The retinoblastoma protein binds to a family of E2F transcription factors. Mol. Cell Biol. 13 79. Leone, G., J. DeGregori, Z. Yan, L. Jak oi, S. Ishida, R. S. Williams, and J. R. Nevins 1998. E2F3 activity is regulated during the cell cycle and is required for the induction of S phase. Genes Dev. 12:2120-2130. 80. Li, Z., J. Stanelle, C. Leurs, H. Hanenberg, and B. M. Putzer 2005. Select of novel mediators of E2F1-induced apoptos is through retroviral expression of an antisense cDNA library. Nucleic Acids R 81. Lin, S. C., S. X. Skapek, D. S. Papermaster, M. Hankin, and E. Y. Lee 200 The proliferative and apoptotic activities of E2F1 in the mouse retina. Onco 20:7073-7084. 82. Lindstrom, M. S. and K. G. Wiman 2003. Myc and E2F1 induce p53 through p14ARF-independent mechanisms in human fibroblasts. Oncogene 22:4993-50 Brummelkamp, E. M. Hijmans, R. Bernards, and N. B. La Thangue 2004. E2F-7: a distinctive E2F family member with an unusual organization of

PAGE 80

71 ier, e DNA topoisomerase II cleavage near leukemia-associated MLL translocation breakpoints. Biochemistry 85. K. Helin 1996. Deregulated expression of E2F family members i nduces S-phase entry and overcomes 86. induced apoptosis is mediated through up-regulation of E2F1 and repression of Mcl-1. Mol. Cancer 87. xton, R. L. Moorer, Jr., and W. D. Cress 2002. Identification of novel E2F1-regulated genes by mi croarray. Arch. Biochem. Biophys. 399:21288. Ma, Y., S. N. Freeman, and W. D. Cress 2004. E2F4 deficiency promotes drug89. Cloning and characterization of 84. Lovett, B. D., D. Strumberg, I. A. Blair, S. Pang, D. A. Burden, M. D. Megonigal, E. F. Rappaport, T. R. Re bbeck, N. Osheroff, Y. G. Pomm and C. A. Felix 2001. Etoposide metabolites enhanc 40:1159-1170. Lukas, J., B. O. Petersen, K. Holm, J. Bartek, and p16INK4A-mediated growth s uppression. Mol. Cell Biol. 16 :1047-1057. Ma, Y., W. D. Cress, and E. B. Haura 2003. FlavopiridolTher. 2:73-81. Ma, Y., R. Cro 224. induced apoptosis. Cancer Biol. Ther. 3:1262-1269. Maiti, B., J. Li, A. de Bruin, F. Gord on, C. Timmers, R. Opavsky, K. Patil, J Tuttle, W. Cleghorn, and G. Leone 2005.

PAGE 81

72 90. -cycle arrest. Curr. Biol. 6:474-483. ructural 93. Moorthamer, M., M. Panchal, W. Greenhalf, and B. Chaudhuri 1998. The 94. Morris, S. K. and J. E. Lindsley 1999. Yeast topoisomerase II is inhibited by e. Mol. Cell Biol. 22:856-865. mouse E2F8, a novel mammalian E2F fam ily member capable of blocking cellular proliferation. J. Biol. Chem. 280 :18211-18220. Mann, D. J. and N. C. Jones 1996. E2F-1 but not E2F-4 can overcome p16induced G1 cell 91. McDonnell, J. M., D. Fushman, C. L. Milliman, S. J. Korsmeyer, and D. Cowburn 1999. Solution structure of the proapoptotic molecule BID: a st basis for apoptotic agoni sts and antagonists. Cell 96:625-634. 92. Moberg, K., M. A. Starz, and J. A. Lees 1996. E2F-4 switches from p130 to p107 and pRB in response to cell cycle reentry. Mol. Cell Biol. 16:1436-1449. p16(INK4A) protein and fla vopiridol restore yeast cell growth inhibited by Cdk4. Biochem. Biophys. Res. Commun. 250:791-797. etoposide after hydrolyzing the first ATP a nd before releasing the second ADP. J. Biol. Chem. 274 :30690-30696. 95. Morrison, A. J., C. Sardet, and R. E. Herrera 2002. Retinoblastoma protein transcriptional repression through histone deacetylation of a single nucleosom

PAGE 82

73 96. in vivo in human gastric cancer cells. Mol. Cancer Ther. 2:549-555. 97. ston, and Y. Nakatani 2002. A complex with chromatin modifi ers that occupies E2Fand Myc98. -dependent kinases, INK4 inhibitors a nd cancer. Biochim. Biophys. Acta 1602:73-87. 99. F by oncogenic stress in mouse fibroblasts is independent of E2F1 and E2F2. 100. asaki, and T. Van Dyke 1998. Key roles for E2F1 in signaling p53-dependent apoptosis and in cell 101. ent of spontaneous leukemia in mice with nitrogenized mustard gas. Ac ta Pathol. Microbiol. Scand. 27:9-15. 102. alsano, E. Alesse, A. Gulino, and M. Levrero. Motwani, M., C. Rizzo, F. Sirotnak, Y. She, and G. K. Schwartz 2003. Flavopiridol enhances the effect of docetaxel in vitro and Ogawa, H., K. Ishiguro, S. Gaubatz, D. M. Living responsive genes in G0 cells. Science 296:1132-1136. Ortega, S., M. Malumbres, and M. Barbacid 2002. Cyclin D Palmero, I., M. Murga, A. Zubiaga, and M. Serrano 2002. Activation of AR Oncogene 21:2939-2947. Pan, H., C. Yin, N. J. Dyson, E. Harlow, L. Yam division within developing tumors. Mol. Cell 2 :283-292. PEDERSEN, E. 1950. On treatm Pediconi, N., A. Ianari, A. Costanzo, L. Belloni, R. Gallo, L. Cimino, A. Porcellini, I. Screpanti, C. B

PAGE 83

74 NA 103. Persengiev, S. P., I. I. Kondova, and D. L. Kilpatrick 1999. E2F4 actively 104. Pierce, A. M., R. Schneider-Broussard, J. L. Philhower, and D. G. Johnson apoptosis. Mol. Cancer Res. 2:203-214. : 107. Raju, U., E. Nakata, K. A. Mason, K. K. Ang, and L. Milas 2003. f 2003. Differential regulation of E2F1 apopt otic target genes in response to D damage. Nat. Cell Biol. 5 :552-558. promotes the initiation a nd maintenance of nerve gr owth factor-induced cell differentiation. Mol. Cell Biol. 19:6048-6056. 1998. Differential activities of E2F fam ily members: unique functions in regulating transcrip tion. Mol. Carcinog. 22:190-198. 105. Powers, J. T., S. Hong, C. N. Mayhew, P. M. Rogers, E. S. Knudsen, and D. G. Johnson 2004. E2F1 uses the ATM signaling pathway to induce p53 and Chk2 phosphorylation and 106. Qu, Z., W. R. MacLellan, and J. N. Weiss 2003. Dynamics of the cell cycle checkpoints, sizers, and timers. Biophys. J. 85:3600-3611. Flavopiridol, a cyclin-dependent kinase in hibitor, enhances ra diosensitivity o ovarian carcinoma cells. Cancer Res. 63 :3263-3267. 108. Reed, J. C. 1997. Bcl-2 family proteins: regulators of apoptosis and chemoresistance in hematologic malignancies. Semin. Hematol. 34:9-19.

PAGE 84

75 109. M. Pipas, C. Smith, and J. R. Nevins 2000. Loss of E2F4 activity leads to abnorma l development of multiple cellular 110. ejer, Y. D. Wen, Y. L. Yao, I. Gyory, K. Wright, and E. Seto 2003. Targeted recruitment of a histone H4111. Rodriguez, J. M., M. A. Glozak, Y. Ma, and W. D. Cress 2006. Bok, Bcl-2112. Rogoff, H. A. and T. F. Kowalik 2004. Life, death and E2F: linking 113. Rogoff, H. A., M. T. Pickering, M. E. Debatis, S. Jones, and T. F. Kowalik 114. Sardet, C., M. Vidal, D. Cobrinik, Y. Geng, C. Onufryk, A. Chen, and R. A. are Rempel, R. E., M. T. Saenz-Robles, R. Storms, S. Morham, S. Ishida, A. Engel, L. Jakoi, M. F. Melhem, J. lineages. Mol. Cell 6 :293-306. Rezai-Zadeh, N., X. Zhang, F. Namour, G. F specific methyltransferase by the tr anscription factor YY1. Genes Dev. 17:10191029. related Ovarian Killer, Is Cell Cycle-regul ated and Sensitizes to Stress-induced Apoptosis. J. Biol. Chem. 281:22729-22735. proliferation control and DNA damage signaling via E2F1. Cell Cycle 3:845-846 2002. E2F1 induces phosphorylation of p53 that is coincident with p53 accumulation and apoptosis. Mol. Cell Biol. 22:5308-5318. Weinberg 1995. E2F-4 and E2F-5, two members of the E2F family,

PAGE 85

76 115. ycle: a review. Vet. Pathol. 35 :461-478. to 117. Shambaugh, G. E., III, G. K. Haines, III, A. Koch, E. J. Lee, J. Zhou, and R. s 999. cell lung cancer cell lines Clin. Cancer Res. 5:2925-2938. 119. t. Genet. expressed in the early phases of the cell cycle. Proc. Natl. Acad. Sci. U. S. A 92:2403-2407. Schafer, K. A. 1998. The cell c 116. Sears, R., K. Ohtani, and J. R. Nevins 1997. Identification of positively and negatively acting elements regulating expres sion of the E2F2 gene in response cell growth signals. Mol. Cell Biol. 17 :5227-5235. Pestell 2000. Immunohistochemical examinati on of the INK4 and Cip inhibitor in the rat neonatal cerebellum: cellular localization and the impact of protein calorie malnutrition. Brain Res. 855:11-22. 118. Shapiro, G. I., D. A. Koestner, C. B. Matranga, and B. J. Rollins 1 Flavopiridol induces cell cycle arrest a nd p53-independent apoptosis in non-small Soengas, M. S. and S. W. Lowe 2000. p53 and p73: seeing double? Na 26:391-392. 120. Stevens, C. and N. B. La Thangue 2003. A new role for E2F-1 in checkpoint control. Cell Cycle 2:435-437.

PAGE 86

77 121. lerch. Biochem. Biophys. 412:157-169. n the DNA damage response and checkpoint control. DNA Repair (Amst) 3:1071-1079. 123. 125. Stubbs, M. C., G. D. Strachan, and D. J. Hall 1999. An early S phase Res. 126. Suominen, J. S., W. Yan, J. Toppari, and A. Kaipia 2001. The expression and Eu r. J. Endocrinol. 145:771-778. regulation. Front Biosci. 5:D121-D137. Stevens, C. and N. B. La Thangue 2003. E2F and cell cycle control: a doub edged sword. A 122. Stevens, C. and N. B. La Thangue 2004. The emerging role of E2F-1 i Stiewe, T. and B. M. Putzer 2000. Role of the p53-homologue p73 in E2F1induced apoptosis. Nat. Genet. 26:464-469. 124. Strobeck, M. W., A. F. Fribourg, A. Puga, and E. S. Knudsen 2000. Restoration of retinoblastoma mediated signaling to Cdk2 resu lts in cell cycle arrest. Oncogene 19:1857-1867. checkpoint is regulated by the E2F1 tran scription factor. Bi ochem. Biophys. Commun. 258:77-80. regulation of Bcl-2-related ovarian kill er (Bok) mRNA in the developing and adult rat testis 127. Tamrakar, S., E. Rubin, and J. W. Ludlow 2000. Role of pRB dephosphorylation in cell cycle

PAGE 87

78 U. S. A 96:3077-3080. 130. stabilizes p53 by blocking nucleocytoplasmic shuttling of Mdm2. Proc. Natl. Acad. Sci. U. S. A 96:6937-6941. 131. Leone 2007. E2f1, E2f2, and E2f3 control E2F target expression and cellular proliferation via a p53-dependent negative 132. airchild, J. Wen, and J. A. Lees 2001. The E2F6 transcription factor is a component of the mammalian Bmi1-containing polycomb 133. nhibition of retinoblastoma protein (Rb) phosphorylation at serine si tes and an increase in Rb-E2F complex noma LNCaP 128. Tannoch, V. J., P. W. Hinds, and L. H. Tsai 2000. Cell cycle control. Adv. Exp. Med. Biol. 465:127-140. 129. Tao, W. and A. J. Levine 1999. Nucleocytoplasmic shuttling of oncoprotein Hdm2 is required for Hdm2-mediated degr adation of p53. Proc. Natl. Acad. Sci. Tao, W. and A. J. Levine 1999. P19(ARF) Timmers, C., N. Sharma, R. Opavsky, B. Maiti, L. Wu, J. Wu, D. Orringer P. Trikha, H. I. Saavedra, and G feedback loop. Mol. Cell Biol. 27:65-78. Trimarchi, J. M., B. F complex. Proc. Natl. Acad. Sci. U. S. A 98:1519-1524. Tyagi, A., C. Agarwal, and R. Agarwal 2002. I formation by silibinin in androgen-dependent human prostate carci cells: role in prosta te cancer prevention. Mol. Cancer Ther. 1 :525-532.

PAGE 88

79 nce for di stinct mechanisms underlying growth suppression by different re tinoblastoma protein family members. Genes Dev. 135. M. Upton, J. Zalvide, J. A. DeCaprio, M. E. Ewen, A. Koff, and J. M. Adams 2000. Bcl-2 retards cell cy cle entry through p27(Kip1), 136. Wang, S. and W. S. El Deiry 2006. p73 or p53 directly regulates human p53 137. n lating agents]. Dtsch. Med. Wochenschr. 100:919-923. 138. members in living cells. Mol. Cell Biol. 20:5797-5807. 139. 134. Vairo, G., D. M. Livingston, and D. Ginsberg 1995. Functional interaction between E2F-4 and p130: evide 9:869-881. Vairo, G., T. J. Soos, T pRB relative p130, and altered E2F regulation. Mol. Cell Biol. 20:4745-4753. transcription to maintain cell cycle checkpoints. Cancer Res. 66 :6982-6989. Weiss, A. and B. Weiss 1975. [Carcinogenesis due to mustard gas exposure i man, important sign for therapy with alky Wells, J., K. E. Boyd, C. J. Fry, S. M. Bartley, and P. J. Farnham 2000. Target gene specificity of E2F and pocket protein family Wells, J., C. R. Graveel, S. M. Bartley, S. J. Madore, and P. J. Farnham 2002. The identification of E2F1 -specific target genes. Pr oc. Natl. Acad. Sci. U. S. A 99:3890-3895.

PAGE 89

80 Madden, D. R. Maglott, J. Ostell, K. D. Pruitt, G. D. Schuler, L. M. Schriml, Database resources of the National Center for Biotechnology Information. 142. Burgemei ster, L. Haase, D. H. Schmidt, C. Doehn, S. C. Mueller, and D. Jocham 2005. Flavopiridol, an inhibitor of 143. Wyllie, A. H. 2002. E2F1 selects tumour cells for both life and death. J. Pathol. 140. Wells, J., P. S. Yan, M. Cechvala, T. Huang, and P. J. Farnham 2003. Identification of novel pRb binding sites using CpG microarrays suggests that E2F recruits pRb to specific genom ic sites during S phase. Oncogene 22:14451460. 141. Wheeler, D. L., T. Barrett, D. A. Benson, S. H. Bryant, K. Canese, V. Chetvernin, D. M. Church, M. DiCuccio, R. Edgar, S. Federhen, L. Y. Geer, W. Helmberg, Y. Kapustin, D. L. Kent on, O. Khovayko, D. J. Lipman, T. L E. Sequeira, S. T. Sherry, K. Sirotkin A. Souvorov, G. Starchenko, T. O. Suzek, R. Tatusov, T. A. Tatusova, L. Wagner, and E. Yaschenko 2006. Nucleic Acids Res. 34:D173-D180. Wirger, A., F. G. Perabo, S cyclin-dependent kinases, induces grow th inhibition and apoptosis in bladder cancer cells in vitro a nd in vivo. Anticancer Res. 25 :4341-4347. 198:139-141.

PAGE 90

81 of 145. Yakovlev, A. G., S. Di Giovanni, G. Wang, W. Liu, B. Stoica, and A. I. 146. 147. on 7149. Zhang, Y. and S. P. Chellappan 1995. Cloning and characterization of human 150. Zhang, Y., V. S. Venkatraj, S. G. Fischer, D. Warburton, and S. P. Chellappan 1997. Genomic cloning and chromosomal assignment of the E2F dimerization partner TFDP gene family. Genomics 39:95-98. 144. Xu, M., K. A. Sheppard, C. Y. Peng, A. S. Yee, and H. Piwnica-Worms 1994. Cyclin A/CDK2 binds directly to E2F1 and inhibits the DNA-binding activity E2F-1/DP-1 by phosphorylation. Mol. Cell Biol. 14 :8420-8431. Faden 2004. BOK and NOXA are essentia l mediators of p53-dependent apoptosis. J. Biol. Chem. 279:28367-28374. Yam, C. H., T. K. Fung, and R. Y. Poon 2002. Cyclin A in cell cycle control and cancer. Cell Mol. Life Sci. 59:1317-1326. Yamasaki, L. 2003. Role of the RB tumor suppressor in cancer. Cancer Treat. Res. 115:209-239. 148. Yamasaki, L., T. Jacks, R. Bronson, E. Goillot, E. Harlow, and N. J. Dys 1996. Tumor induction and tissue atr ophy in mice lacking E2F-1. Cell 85:53 548. DP2, a novel dimerization partner of E2F. Oncogene 10:2085-2093.

PAGE 91

82 nts with AML and CLL. Br. J. Haematol. 105:420-427. 152. D in the DNA-damage response. Cell 122:579-591. 151. Zhou, R., S. Vitols, A. Gruber, J. Liliemark, Y. Wang, and E. Liliemark 1999. Etoposide-induced DNA strand breaks in relation to pglycoprotein and topoisomerase II protein expression in le ukaemic cells from patie Zinkel, S. S., K. E. Hurov, C. Ong, F. M. Abtahi, A. Gross, and S. J. Korsmeyer 2005. A role for proapoptotic BI

PAGE 92

About the Author Jos M Rodrguez was born on June 21, 1981, and was raised in Ponce, Puerto ath and science. ted in the PUCPR and was part of the MARC honor program since his sophomore year. As a MARC student Jos did research in the k. In 2002 Jos graduated with honors from PUCPR and in the fall of 2002 was accepte d to the Cancer Biology Ph.D. program. During his graduate studies Jos did poster presentations on various national conferences and published a peer reviewed paper in the Journal of Biological Chemistry While in the Cancer Biology Ph.D. program Jos was aw arded the LAC Biology Ph.D. Scholarship, the USF Latino Fellowship, and the Minority Grant Supplement Scholarship. After graduation Jos will seek an MD degree at PSM. Rico. Jos graduated with honors from CROEM which is a specialize school in m After high school he was accep PSM and was expose early on to bench wor