USF Libraries
USF Digital Collections

Immunomodulatory role of flagellin in antigen-presenting cells

MISSING IMAGE

Material Information

Title:
Immunomodulatory role of flagellin in antigen-presenting cells
Physical Description:
Book
Language:
English
Creator:
Vicente-Suarez, Ildefonso
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
TLR5
Macrophages
Toll-like receptors
IL-10
DCs
Dissertations, Academic -- Cancer Biology -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Toll-like receptors (TLRs) expressed by cells of the immune system play a central role in the generation of immune responses against pathogens. Following TLR ligation, both pro-inflammatory and anti-inflammatory mediators are produced in order to elicit an immune response that controls the microbial infection while limiting tissue damage. Among these mediators, the proinflammatory cytokine IL-12 and the anti-inflammatory cytokine IL-10 are known to play major roles. Here, we show that in vitro or in vivo stimulation with flagellin, the TLR5 ligand, does not result in IL-10 production. Furthermore flagellin inhibits IL-10 production by other specific TLR ligands at the protein and mRNA levels while increasing IL-12p70 production. Several studies have linked the activation of extracellular signal regulated kinases (ERKs) with IL-10 induction by TLRs. Our findings that LPS-induced ERK activation is significantly decreased in flagellin-treated macrophages suggest that this pathway might play a role in the inhibition of IL-10 production by flagellin. Flagellin-mediated IL-10 inhibition was not observed in cells that do not express TLR5 supporting that this effect is TLR5-dependent.Flagellin used as an adjuvant is capable of priming antigen specific T cell responses in an in vivo model of tolerance using high dose peptide. Furthermore, DCs differentiated in tolerogenic conditions (tolerogenic-DCs) express higher levels of TLR5 mRNA than standard BM-DCs and respond more vigorously to flagellin stimulation. Antigen presentation by LPS-matured tolerogenic-DCs results in the differentiation of IL-10 producing T cells with a Tr1-like phenotype. On the contrary, antigen presentation by tolerogenic-DCs that have been stimulated with flagellin results in the differentiation of a typical Th1 responseThis study provides a new insight of the role of flagellin recognition by TLR5 in shaping the immune response elicited by flagellated microorganisms.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2007.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Ildefonso Vicente-Suarez.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 104 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001947516
oclc - 236484292
usfldc doi - E14-SFE0002201
usfldc handle - e14.2201
System ID:
SFS0026519:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Immunomodulatory Role of Flage llin in Antigen-Presenting Cells by Ildefonso Vicente-Suarez A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cancer Biology Graduate School University of South Florida Major Professor: Eduardo Martin Sotomayor, M.D. Julie Djeu, Ph.D. Thomas Guadagno, Ph.D. Kenneth Wright, Ph.D. Date of Approval: October 24, 2007 Keywords: TLR5, Macrophages, To ll-like receptors, IL-10, DCs 2007 Ildefonso Vicente-Suarez

PAGE 2

i TABLE OF CONTENTS LIST OF TABLES v LIST OF FIGURES vi LIST OF ABBREVIATIONS x ABSTRACT ix INTRODUCTION 1 T cell tolerance and antigen presenting cells 1 TLRs 5 TLR common signaling pathway (MyD 88-dependent pathway) 9 TRIF dependent pathway (M yD88-independent pathway) 11 Other TIR domain containing proteins 12 TLR5 and flagellin 13 TLR5 in the epithelia 16 TLR5 and innate immunity 16 TLR5 and adaptive immunity 17 IL-10 and IL-12 19 IL-12 19 Regulation of IL-12 production 19 IL-12 biological activity 20

PAGE 3

ii IL-10 21 Regulation of IL-10 production 21 IL-10 biological activity 22 MATERIALS AND METHODS 25 TLR ligands 25 Isolation of peritoneal elicited macrophages (PEM) and generation of bone marrow (BM)-der ived macrophages 26 Quantification of cytokines 27 Real time (RT)-PCR analysis 27 Preparation of flagellin-coated beads 28 Antigen-specific T-cell tolerance model 28 Cell lysates and western blot 29 Generation of DCs 30 Nave T cell preparation and in vitro differentiation 30 FliC expressing tumor cells 31 RESULTS 32 Flagellin preparation 32 Flagellin-stimulated PEM produce IL-12 but not IL-10 33 IL-12 but not IL-10 is detected in the serum of flagellin-treated mice 37 IL-10 mRNA dynamics in flagellin stimulated PEM 39 IL-10 mRNA dynamics in flagellin-stimulated BM-derived

PAGE 4

iii macrophages 39 LPS-induced IL-10 mRNA and protein are inhibited by flagellin 42 Pretreatment of macrophages with flagellin results in stronger inhibition of LPS-induced IL-10 44 IL-10 inhibition by flagellin is restricted to specific TLRs 47 IL-10 inhibition might depend on receptor colocalization 49 Flagellin treatment does not a ffect LPS-induced IL-10 mRNA stability 50 Flagellin stimulation decreases ERK activation by LPS in macrophages 52 Flagellin enhances IL-12 produc tion in response to LPS 54 Flagellin enhances IL-12p70 produc tion in response to CpG 56 Blocking IL-10 increases IL12p70 production by LPS-stimulated macrophages 57 Flagellin elicits CD4 + T-cell activation in a tolerogenic setting in vivo 58 DC differentiation in th e presence of IL-10 62 Tolerogenic-DCs induce T cell unresponsiveness in vitro 65 LPS stimulation of tolerogenic-DC s results in enhanced production of IL-10 67 TLR5 expression is specifically enhanced in tolerogenic-DCs 68 IL-10 treatment of BM-DCs does not result in TLR5 upregulation 69 Flagellin stimulation of toleroge nic-DCs results in enhanced

PAGE 5

iv production of IL-12p40-70 in the absence of IL-10 70 LPS-treated tolerogenic-DCs but not flagellin-treated tolerogenicDCs induce T cells that produ ce high levels of IL-10 71 Flagellin-expressing B78-H1 cells induce IL-12 p40-70 production by PEM 74 DISCUSSION 77 REFERENCES 87 ABOUT THE AUTHOR End Page

PAGE 6

v LIST OF TABLES Table 1. Toll-like receptors and their ligands 7

PAGE 7

vi LIST OF FIGURES Figure 1. T cell priming versus tolerance is determined by the state of activation of the APC 4 Figure 2. TLR localization 8 Figure 3. TLR common signaling pathway 10 Figure 4. TLR5 binds the conser ved domains in flagellin 15 Figure 5. Flagellin protein preparation 32 Figure 6 IL-12p40-70 but not IL-10 is detected in the supernat ants of flagellin-stimulated PEM 34 Figure 7. IL-12 p4070 production by flagellin-stimulated macrophages is not caused by endotoxin contamination 36 Figure 8. Serum levels of IL-12 p40-70 and IL-10 in mice treated with LPS or flagellin 37 Figure 9. IL-6 and TNFblood serum levels in flagellin-treated animals 38 Figure 10. IL-10 mRNA dynamics in flagellin-stimulated PEM 39 Figure 11. IL-10 mRNA dynamics in flagellin-stimulated BM-derived macrophages 40 Figure 12. BM-derived macrophage s express TLR5 and produce IL12p40-70 but not IL-10 when stim ulated with flagellin 41 Figure 13. Flagellin inhibits LPSinduced IL-10 protein and mRNA 43

PAGE 8

vii Figure 14. A short pretreatment with flagellin affects IL-10 and IL-12 induction in an opposite way 44 Figure 15. Inhibition of IL-10 by fl agellin is enhanced by a short pretreatment 46 Figure 16. IL-10 production by macropha ges treated with flagellin and other TLR ligands 48 Figure 17. Macrophages stimulated with flagellin-coated beads showed impair IL-10 induction by CpG 49 Figure 18. IL-10 repression by flagelli n is not caused by a decrease in IL-10 mRNA stability 51 Figure 19. Flagellin treatment d ecreases ERK activation by LPS in macrophages 53 Figure 20. Flagellin-stimulated PE M produce higher levels of IL12p35 and IL-12p40 mRNAs in response to LPS 54 Figure 21. Flagellin-stimulated PE M produce higher levels of IL12p70 in response to TLR4 ligands 56 Figure 22. Flagellin-stimulated PE M produce higher levels of IL12p70 in response to TLR9 ligands 56 Figure 23. IL-10 blockage incr eases IL-12p70 production by LPSstimulated macrophages 57 Figure 24. High dose peptide model of antigen-specific CD4+T cell tolerance (I) 58 Figure 25. Flagellin elicits CD4+ T-cell activation in a tolerogenic

PAGE 9

viii setting (I) 60 Figure 26. High dose peptide model of antigen-specific CD4+T cell tolerance (II) 61 Figure 27. Flagellin elicits CD4+ Tcell activation in a tolerogenic setting (II) 62 Figure 28. CD11c expression in DCs diffe rentiated in the presence of IL-10 63 Figure 29. Tolerogenic-DCs express lower levels of costimulatory molecules than BM-DCs 64 Figure 30. T cell differentiation diagram 65 Figure 31. T cells different iated using tolerogenic-DCs showed impaired responses upon antigen restimulation 66 Figure 32. LPS stimulation of toler ogenic-DCs results in enhanced production of IL-10 67 Figure 33. TLR5 expression is specif ically enhanced in tolerogenicDCs 68 Figure 34. IL-10 treatment of BM-DCs does not result in TLR5 upregulation 69 Figure 35. Flagellin stimulation of tolerogenic-DCs results in enhanced production of IL-12 p40-70 in the absence of IL-10 70 Figure 36. T cells cultured with BM-DCs produce Th1 and Th2 cytokines 72

PAGE 10

ix Figure 37. LPS-treated but not flagellin-treated tolerogenic-DCs induce T cells that produce high levels of IL-10 73 Figure 38. Flagellin-expressing cells stimulate production of IL-12 p40-70 by PEM 75

PAGE 11

x LIST OF ABBREVIATIONS APC Antigen presenting cells BCR B cell receptor BM Bone marrow C/EBP CCAAT enhancer-binding protein CFA Complete Freund Adjuvant DD Death domain ds Double-stranded FOXP3 Forkhead box p3 HPLC High-performance liquid chromatography IKK I nhibitor of kappaB factor kinases IL Interleukin IRAK Interleukin-1 receptor-associated kinase JAK Janus kinase LAL Limulus amebocyte lysate LPS Lipopolysaccharide LRR Leucine-rich-repeat LTA Lipoteichoic acid MAL Myeloid Differentiation Protein 88 Adapter-Like MAL/TIRAP MyD88-adaptor-lik e/TIR-associated protein

PAGE 12

xi MAPK Mitogen-activated protein kinase MHC II Major histocompatibility complex II MyD88 Myeloid differentiation factor 88 NF B Nuclear factor kappa B PAMPs Pathogen-associated molecular patterns PG Peptidoglycan PGE2 Prostaglandin E2 PRRs Pattern-recognition receptors PS Phosphatidylserine Sp Specificity protein 1 ss Single-stranded STAT Signal transducer and activator of transcription TAB TAK-1-binding protein TAK Transforming growth factor activated kinase TBK TANK-binding kinase TCR T cell receptor TGFransforming growth factor-beta Th T helper TIDCs Tumor infiltrating DCs TIR Toll/IL-1R homology TIRAP TIR domaincontai ning adaptor protein TLRs Toll-like receptors Tr1 Type 1 regulatory T cells

PAGE 13

xii TRAF TNF receptor associated factor TRAM Toll-receptor-associated molecule TRAM Toll-receptor-associated molecule TRIF Toll-receptor-associated activator of interferon

PAGE 14

xiii Immunomodulatory properti es of flagellin in antigen presenting cells Ildefonso Vicente-Suarez ABSTRACT Toll-like receptors (TLRs) expres sed by cells of the immune system play a central role in the generation of immune responses agai nst pathogens. Following TLR ligation, both pro-inflammatory and anti-inflammatory mediators are produced in order to elicit an immune response that controls the microbi al infection while limiting tissue damage. Among these mediators, the proinflammatory cytokine IL-12 and the anti-inflammatory cytokine IL-10 are known to play major roles. Here, we show that in vitro or in vivo stimulation with flagellin, the TLR5 ligan d, does not result in IL-10 production. Furthermore flagellin inhibits IL-10 produc tion by other specific TLR ligands at the protein and mRNA levels while increasin g IL-12p70 production. Several studies have linked the activation of extracellular signa l regulated kinases (ERKs) with IL-10 induction by TLRs. Our findings that LPSinduced ERK activatio n is significantly decreased in flagellin-treated macrophages suggest that this pathway might play a role in the inhibition of IL-10 production by flagelli n. Flagellin-mediated IL-10 inhibition was not observed in cells that do not express TLR5 supporting that this effect is TLR5dependent. Flagellin used as an adjuvant is capable of priming antigen specific T cell responses in an in vivo model of tolerance using high dose pept ide. Furthermore, DCs differentiated in tolerogenic conditions (toler ogenic-DCs) express higher le vels of TLR5 mRNA than

PAGE 15

xiv standard BM-DCs and respond more vigor ously to flagellin stimulation. Antigen presentation by LPS-matured tolerogenic-DCs results in the differentiation of IL-10 producing T cells with a Tr1-li ke phenotype. On the contra ry, antigen presentation by tolerogenic-DCs that have been stimulated with flagellin resu lts in the differentiation of a typical Th1 response This study provides a new insight of the role of flagellin recognition by TLR5 in shaping the immune response elicited by flagellated microorganisms.

PAGE 16

1 INTRODUCTION T cell tolerance and antigen presenting cells Bone marrow-derived antigen presenting cells (APCs) and in particular dendritic cells (DCs) play a central role in the generation of antigen-s pecific T-cell responses (1). However, these same cells are also required fo r the induction of T-cell tolerance (2). This seemingly dual function of APCs was attributed initially to the existence of specific APC subpopulation(s) that induce T-cell priming while othe r subpopulations induce T-cell anergy (3-5). The demonstration that primi ng and tolerance can be induced by a single APC subpopulation (6) led to the alternative explanat ion that the functi onal status of the APC would be the major factor determining T-cell activation versus T-cell tolerance. Antigen encounter in the pres ence of inflammatory mediator s and/or microbial products triggers the maturation of the APC to a functional status capable of priming T cell responses (Figure 1A). In contrast, antigen cap ture by these same APCs in the absence of inflammatory signals, or in the presence of i nhibitory mediators, leads to the development of antigen specific T-cell tolerance (Figure 1B) (2). Dendritic cells (DCs), macrophages a nd B-cells are all bone marrow (BM)derived cells that express major histocompatib ility complex class II (MHC II) as well as costimulatory molecules and, as such, can potentially pres ent antigens to the T-cells. Although it is plausible that under particul ar conditions each subpopulation might induce

PAGE 17

2 T-cell tolerance (7-12), several lines of evidence have pointed to the DCs as the main cell type involved in the developmen t of peripheral tolera nce (13-16). Immature DCs constantly migrate within tissues a nd secondary lymphoid organs (17). Under steady-state conditions, immature DCs capture apoptotic bodies arising from cell turnover and migrate to the draining lymph nodes where antigen presentation takes place. Phagocytosis of apoptotic bodies does not cause DC maturation, and therefore antigen presentation of tissue antigens phagocytos ed by immature DCs might represent a common mechanism of tolerance-induction to self antigens (17). Tumor growth especially at early stages wh en the tissue architecture has not been yet disrupted does not induce the release of inflammatory mediators. Therefore, it was proposed that uptake of tumor antigens occurs in an identical manne r as uptake of tissue self-antigens and the same mechanisms that establish T-cell toleranc e against self will also prevent the immune response against tumors (18). In the mid 90s, the demonstration by the Bogens and Levitskys groups that antigen-specific CD4 + T-cells were rendered tolerant during tumor growth in vivo provided the first experimental evidence supporting th e tumor-induced tolerance hypothesis (19-20). Since then, several studies have confirme d that antigen specific CD4+ as well as CD8+ T cell tolerance occurs during the progression of both hematologic and solid tumors expressing model or tr ue tumor antigens ( 21-28). Furthermore, data from our laboratory and others have demonstrated that bone marrow (BM)-derived APCs are required for the induction of tolerance to an tigens expressed by tumor cells (21) (29). These studies also provided evidence that the intrinsic antigen presenting capacity of

PAGE 18

3 tumor cells has little influence over T cell prim ing versus tolerance, a critical decision that is regulated at the level of the APC. Antigen presentation by immature DCs, self-antigens or tumor antigens alike, induces a modest T cell proliferation but not polarization into T helper 1 (Th1) or Th2 subsets. Instead, after several rounds of cell division almost all the antigen specific Tcells are deleted. The remaining T cells are functionally anergic upon antigen restimulation even when the antigen is administered with a strong adjuvant such as Complete Freund Adjuvant (CFA) (30-31). Furthermore, antigen presentation by immature DCs can also result in the developm ent of regulatory T cells with the ability to suppress effector responses by othe r T cells (32) (Figure 1B). In the tumor bearing host, antigen encount er by DCs might occur not only in the absence of inflammatory signals, but also in the presence of inhibitory factors such as interleukin (IL)-10, transformi ng growth factor-beta (TGF(33), phosphatidylserine (PS) and prostaglandi n E2 (PGE2) (34-36) that further suppress the APCs function. In this adverse environment, DCs acquire featur es as the production of IDO, and IL-10 that result in strong suppression of immune responses (37) (38). IL-10 production by DCs induces the differentiation of regulatory T cells that themselves produce high levels of IL-10 and further suppress inflammatory res ponses (38). The goal of immunotherapy is to disrupt this vicious cycle in order to elicit an effectiv e immune response against the tumor. Microbial products recognized by Toll-like receptors (TLRs) are considered the strongest stimulus to induce APC maturation and as such, in this proposal we focus in the better understanding of their inflammatory properties as a pote ntial strategy to effectively harness antitumor immune responses (39).

PAGE 19

FIGURE 1. T cell priming versus tolerance is determined by the state of activation of the APC(A) In the course of an infection, microbial products are recognized by the APC through TLRs. TLR stimulation results in APC maturation, a process that increases the levels of costimulatory molecules and cytokine production. Antigen presentation by mature APCs leads to efficient priming of nave T cells that proliferate and differentiate into effector cells. (B) Phagocytosis of self-antigens or tumor antigens in a non-inflammatory environment does not cause APC maturation. Immature APCs display low levels of costimulatory molecules and cytokine production. Antigen presentation by immature APCs to nave T cells results in transient proliferation followed by induction of anergic and/or regulatory T-cells.4

PAGE 20

5 TLRs The immune system has evolved to fight off microbial invasions that represent a constant thread to any multicellular organism. The mammalian immune system is divided in two broad categories, inna te and acquired immunity. The acquired branch of immunity is only present in vertebrates and is char acterized by a speciali zed cell type known as lymphocytes. There is two major lineages of lymphocytes called T (for thymus-derived) and B (for bursaor bone-marrow-derived) The attribute that makes lymphocytes different from other cells of the immune system is the presence of antigen receptors in their cellular surface. Engageme nt of these receptors results in clonal amplification, cellular differentiation, and in B cells, produc tion of antibodies with the same antigen binding specificity. Somatic dive rsification of the antigen-rece ptor genes generates a vast repertoire of cells, each of which expresses a different antigen receptor. This feature provides the acquired immune system with th e ability to recognize an unlimited array of ligands. The T cell receptors (TCRs) bind pe ptide fragments presented by other cells within cell-surface molecules encoded by the MH C class I and class II genes. Therefore, T lymphocytes typically recognize antigens th at have been partially digested by the antigen-presenting cells, primarily dendritic ce lls. In contrast, the B cell receptor (BCR) and antibodies recognize exposed determinan ts (epitopes) of intact molecules. Innate immunity is ancient, characterized by the presence of phagocytic cells and found in every organism studied. Innate immu ne cells express receptors that are present on all cells of a given type and are not subject to rearrangement. These receptors recognize microbial products that are not pres ent in the host, and therefore discriminate non-infectious self from infectious non-self (40). Microorganisms have the ability to

PAGE 21

6 rapidly change under environmental pressure ; consequently innate immune receptors have evolved to target molecu les essential for the microorga nism survival and therefore less susceptible to be altered. These mol ecules have been denominated pathogenassociated molecular patterns (PAMPs) (41) and the receptors that sense them, patternrecognition receptors (PRRs) (42). Toll-like re ceptors are the most studied family of PRRs and received their name from the Drosophila receptor Toll (43), a receptor involved in embryonic development but also in the defense against fungal infection (44). The first indication that mammalian TLRs may function as pattern recognition receptors came with the description of a human ho mologue of Drosophila Toll, now known as TLR4 (45). So far 11 members of the TLR fa mily have been identified based on the homology in the cytoplasmic region that ex ists among all of them The TLR intracellular domain is homologous to the IL-1R domain and for that reason it has been named Toll/IL-1R homology (TIR) domain. The TLR ex tracellular domains contain a varying numbers of leucine-rich-repeat (LRR) motifs. These motifs form a horseshoe structure, and it is thought that the concave surface of th is structure is directly involved in the recognition of PAMPs (46). The TLR family me mbers identified so far and their ligands are summarized in Table 1.

PAGE 22

Microbial Components Species TLR/s BACTERIA LPS Gram-negative bacteria TLR4 Diacyl lipopeptides Mycoplasma TLR6/ TLR2 Triacyl lipopeptides Bacteria and mycobacteria TLR1/ TLR2 LTA Group B Streptococcus TLR6/ TLR2 PG (Peptidoglycan) Gram-positive bacteria TLR2 Porins Neisseria TLR2 Lipoarabinomannan Mycobacteria TLR2 Flagellin Flagellated bacteria TLR5 CpG-DNA Bacteria and mycobacteria TLR9 Non-defined Uropathogenic bacteria TLR11 FUNGUS Zymosan Saccharomyces cerevisiae TLR6/ TLR2 Phospholipomannan Candida albicans TLR2 Mannan Candida albicans TLR4 Glucuronoxylomannan Cryptococcus neoformans TLR2 and TLR4 PARASITES tGPI-mutin Trypanosoma TLR2 Glycoinositolphospholipids Trypanosoma TLR4 Hemozoin Plasmodium TLR9 Profilin-like molecule Toxoplasma gondii TLR11 VIRUSES DNA Viruses TLR9 dsRNA Viruses TLR3 ssRNA RNA viruses TLR7 and TLR8 Envelope proteins RSV,MMTV TLR4 Hemagglutinin protein Measles virus TLR2 Non-defined HCMV,HSV1 TLR2 Modified from Akira S 2006 Cell (46) TABLE 1. Toll-like receptors and their ligands7(Lipoteichoic acid)

PAGE 23

Certain TLRs (TLRs 1, 2, 4, 5, and 6) are expressed on the cell surface while others (TLRs 3, 7, 8, and 9) are found almost exclusively in intracellular compartments such as endosomes (46-48) (Figure 2). Intracellular TLRs recognize nucleic acids, suggesting that degradation of the viral particles or the bacterial cell walls might be needed to release the microbial nucleic acids and allow their recognition by TLRs. FIGURE 2. TLR localization8

PAGE 24

9 cate together with TRAF6 and TAB1 to the cytoplasm. TAK1 is subsequently activated in the cytoplasm, ading to the activation of inhibitor of kappaB factor kinases (IKKs) and MAPKs. TLR common signaling pathway (MyD88-dependent pathway) Ligand binding by TLRs results in receptor dimerization and conformational changes required for the recruitment of TI R-domain-containing adaptor molecules to the TIR domain of the TLR. Four adaptor protei ns, MyD88 (myeloid differentiation factor 88) (49-50), MAL/TIRAP (MyD88-adaptor-like /TIR-associated protein) (51-54), TRIF (Toll-receptor-associated activator of inte rferon) (55-56) and TRAM (Toll-receptorassociated molecule) (56-57) have been identified. MyD88 is essential for responses against a broad range of microbial com ponents since MyD88-deficient mice display impaired cytokine production when exposed to IL-1 (58) or the TLR2-4-5-7or 9 ligands (59-62). MyD88 is characterized by the presence of a TIR domain that interacts with the cytoplasmic domain of the TLRs and IL-1R, and a death domain (DD) that binds DD containing proteins situated downstream in the signaling pathway. Serine-threonine kinases that belong to the interleukin-1 receptor-associated kinase (IRAK) family contain an N-terminal DD. MyD88 functions as an adaptor recruiting IRAK4 and IRAK1 proteins to the TLRs/IL-1Rs through interact ion with their DD domain. Activated IRAK1 auto-phosphorylates residues in its N termi nus and recruits TNF receptor associated factor 6 (TRAF6) to the TIR signaling complex. The IRAK1TRAF6 complex then uncouples from the receptor and interacts at the plasma membrane with members of the mitogen-activated protein kinase kinase kinase (MAPKKK) family transforming growth factor activated kinase (TAK) an d TAK-1-binding protein (TAB) This interaction induces phosphorylation of TAB2/TAB3 and TAK 1, which then translo le

PAGE 25

MAPKs activate the transcription factor activating protein-1 (AP-1) while activated IKKs phosphorylate the inhibitors of kappaB (IBs) leading to their degradation and consequently the release of nuclear factor kappa B (NFB) (Figure 3). FIGURE 3. TLR common signaling pathway10

PAGE 26

11 rates the existen 3, a transcription factor involved in th e induction and response to type I IF Ns, was also impaired (56). The downstream events of TRIF activation that result in NF B and IRF3 activation are still unclear The a ctivated NF B complex translocates into the nucleus and binds the DNA at kappa-B-binding motifs. As a result NF B and AP-1 (46) activate genes that code for cytokines, chemokines, growth factors and cell adhesion molecules. TRIF dependent pathway (MyD88-independent pathway) LPS stimulation results in MAPK activation and recruitment of NF B to the nucleus in MyD88-deficient macrophages even when cytokine production was impaired (59) Furthermore, LPS-treatment induces MyD88-deficient DC maturation as demonstrated by upregulation of costimulat ory molecules (CD80, CD86 and CD40) and increased ability to induce T cell proliferat ion (55-56). These data demonst ce of a MyD88-independent pathway/ s that can be activated by specific TLR ligands but not all since TLR2-5-7 and 9 si gnaling is completely abrogated in MyD88deficient cells (60-62). Analysis of the ge ne expression pattern elicited by LPS in MyD88deficient macrophages identified IFNand IFN-inducible genes (63). TRIF (also known as TICAM1) was identifi ed as an interacting partner with TLR3 by yeast two-hybrid screening (64). Following generation of TRIF-deficient mice, it was revealed that they were impaired in the induction of IFNand IFN-inducible genes by the TLR3 and TLR4 ligands. Furthermor e, activation of IRF NF B activation by TRIF might depend on TRAF6 meanwhile TANK binding kinase (TBK)-1 has been shown to be involved in IRF3 activation (65).

PAGE 27

12 type I IFN production in addition to matory signals. Interestin gly, TLR7and TLR9-mediated IFNsecretion occurs in t mice indicating that TRAM is involved in the activation of the MyD88indepen by TLR1-2-4 and -6 ligands. In cont rast, the TLR4-mediated maturation of DCs nd activation of IRF3 were intact in TIRAP-deficient mi ce (52). As explained above F3 activation and DC maturation can be achieved by the TRIF-dependent pathway TIRAP participates in the MyD88-dependent pathway of specific TLRs. TLR7 and TLR9 also induce proinflam in a MyD88-dependent manner (66-68), in contrast to TLR3or TLR4-mediated IFN responses, which are depende nt on TRIF but not on MyD88. Other TIR-domain containing proteins TRAM TRAM associates with TLR4 and TRIF suggesting that its function is to bring them together (57). LPS induced production of IFNand IRF3 activation are impaired TRAM-deficien dent pathway by TLR4 (69). TRAMs role as an adaptor might be sp ecific for TLR4 signa ling since cytokine production by TLR2 -3-7 and 9 ligands remained intact in TRAM-deficient mice (69). MAL/TIRAP Expression of dominant-negative TIRAP, which encodes only the TIR domain, blocked NF B activation by TLR4 (51). Furthermore TIRAP-deficient mice are impaired in inflammatory cytokine production and activ ation of the NF B and MAPK pathways induced a IR alone, suggesting that

PAGE 28

13 TLR5 and flagellin Flagella are complex organelles that play a major role in bacterial motility and chemotaxis. The body of the flagellum consists of a mass of protofilaments, each of which is a long, end-to-end polymer of a single protein, flagellin. Many important human pathogens are flagellated and for a long time e xpression of flagella has been examined as a virulence trait, but this examination has b een largely in the context of motility rather than immune stimulation (70-72). As menti oned before TLRs are characterized by the presence of an intracellular TIR domain shared by them and the IL-1R. TLR5 was identified in human and mice based on the presence of the TIR domain (73). TLR5 is expressed in epithelial cells, e ndothelial cells, macrophages, DC s, and T cells (72). Initial identification of flagellin as the ligand for TLR5 came from a study that isolated stimulatory components from Listeria culture supernatant prot eins by high-performance liquid chromatography (HPLC) (61). Parallel studies examining the activation of epithelial cells in response to Salmonella also identified flagellin as a stimulatory ligand for TLR5 (74). Analysis of the flagellin amino acid sequences from Gram-positive and negative bacteria revealed the presence of highly conserved sequences at the amino and carboxyl termini (75) TLRs target conserved sequences making the carboxyand aminoterminus the predictable candidates for TLR5 recognition. Studies from Eaves-Pyles et al initially confirmed this hypothesis. In their study constructs consisting of only the amino, central or carboxy regions of flagellin l acked stimulatory capacity, as evaluated by in vitro activation of NF B and IL-8 production in intestin al epithelial cells. However, a fusion protein composed of the conserve d amino and carboxyl termini, induced a response that was identical to the response induced by wild-type flagellin suggesting that

PAGE 29

14 raction to a group of amino acids from both ends br duction of inflammatory mediators and consequently the recruitment of inflam matory cells to the site of infection, recognition of flagellin promote systemic dissemination of the pathogen. Supporting this conclusion TLR5-/mice survived oral Salmonella infection better than wild-type mice as shown in a recent work fr om Uematsu et al (79). both ends of the protein but not the central variable region are needed for flagellin recognition by TLR5 (76). Furt her and deeper studies by Ad erems group targeted the specific location of the TLR5-flagellin inte ought together in the folded protein (77) Interestingly, muta tion of those specific residues greatly diminished the bacterias motility (77) supporting the paradigm that TLRs target molecules that are conserved sin ce their mutation would affect functions that are vital for the microorganism. TLR5s binding site is buried within the flagella since it acts as part of the anchorage region that binds one monomer to another in or der to form the flagellum filament (Figure 4). Accordingly, it has been shown by cross-linking st udies that flagellin monomers are much more potent than polymers to elicit TLR5 activity (77). It is not yet clear how the internal structure of the flag ellum filament would come in contact with TLR5. One possibility is that flagellin mono mers are released in the phagosome or may be exposed during the flagellum assembly. A surprising finding is that lysophospholipids produced by epithelial cells stimulate the sy nthesis and release of monomeric flagellin from Salmonella (78). It is unclear how this evidence affects our understanding of Salmonella infection but it could be that th rough in

PAGE 30

FIGURE 4. TLR5 binds the conserved domains in flagellinThe flagella present in the different species of Salmonella (A) are polymers of the protein flagellin. The flagellin monomers are assembled leaving the D3 and D2 domains exposed while the D1 domain is enclosed within the filament structure (B). The exposed region of the flagella will act as a paddle to facilitate the bacterial movement while the internal part is necessary for its assembly. TLR5 binds a group of aminoacids from the carboxy and amino terminus that are brought together in the folded protein as part of the D1 domain (C). Probably due to their structural role aminoacids in the D1 domain are highly conserved among flagellated bacteria while the other domains show a much higher variability.15 A BC(76)

PAGE 31

16 but ria. TLR5 is also highly expressed in the airway epitheli TLR5 in the epithelia The epithelial surfaces of the host re present principal en try sites for many pathogens and the expression of TLR5 by ep ithelium allows for rapid recognition of flagellated organisms. Studies by Gewirtz et al identified flagellin as the bacterial factor inducing IL-8 production following the interaction of Salmonella with human intestinal epithelial cells (74). The effects of flagellin on epithelial gene expression are not restricted to interleukin-8, but rather fl agellin has been shown to be Salmonellas dominant proinflammatory determinant, being necessary and sufficient for nearly all induction of epithelial proinflammato ry gene expression induced by Salmonella typhimurium (80). Interestingly, the activation of this inflammatory response was dependent upon the translocation of flagellin to the basolateral surface of the epithelial cells, where TLR5 is expressed (81). Presumably, this requirement limits epithelial cell activation to pathogens that can translocate flagellin, and therefore, avoids TLR5 ligation by the normal intestinal flora si nce flagellin expression is not restricted to pathogens rather is expressed by all motile bacte a and it is a pot ent inducer of inflammation in th e lung (82). Flagellin detection plays an important role in the defense agai nst pathogens of the respiratory tract since suppressing TLR5 signaling increas es susceptibility to inf ection by Legionella (83). TLR5 and innate immunity Flagellin has been shown to induce produc tion of cytokines a nd upregulation of costimulatory molecules from human DCs (84). The results with mouse DCs have been more controversial and while TLR5 expression and flagellin-indu ced maturation of mouse splenic and BM derived DCs have been reported by several groups (85-87), others

PAGE 32

17 tra st, the cytokine profile seen in flagellin roduction of proinflammatory cytokines in the absence of IL-1 at flagel lin induces Th1-biased responses in vivo (89). These found murine DCs not to be responsive to flagel lin stimulation due to very low or absent TLR5 expression (79) (84) The cause for these discrepancies is not clear si nce the purity of the flagellin preparation is well documented in the majority of these studies. One possibility is that these disc repancies are due to the plastic ity of TLR expression on APCs that is rapidly modulated in response to cytokines and enviro nmental stresses. Uematsu et al. recently demonstrated that high levels of TLR5 are expressed by murine lamina propria DCs. These DCs when stimulated with flagellin produced high levels of IL-6, IL12 but not IL-10 (79). Interestingly, DCs from the gut stimulated with microbial products or CD40L have been shown to produce higher le vels of IL-10 than those from the spleen (88). IL-10 production by intestinal DCs pr obably plays an important role in the establishment of tolerance to wards commensal bacteria an d food antigens through the development of regulatory T cells. In con stimulated lamina propria DCs (p 0) suggests that these cells would induce inflammato ry responses rather than tolerance. These data supports the prior notion that flagellin plays an important role in eliciting inflammatory responses in the gut. TLR5 and adaptive immunity Flagellins ability to work as an adjuvant for T cell responses has been evaluated by several studies. The first report came from Gewirtz group demonstrating that Salmonella s flagellin was capable of enhancing an tigen specific CD4+ T cell expansion and memory development in vivo Antigen-specific transgenic T cells primed in vivo with antigen in the presence of flagellin produced IFNbut not IL-4 upon in vitro restimulation suggesting th

PAGE 33

18 data is relate d with regulatory T ell development as FOXP3-transfected nave T cells suppressed inflammatory responses vitro and in vivo (93). Interestingly, tr eatment of CD4+CD25+ T cells with flagellin creased FOXP3 expression which could expl ain the enhancement of the suppressive henotype observed in flagellin-t reated regulatory T cells (91). at odds with reports from other groups supporting that flagellin induces a Th2 response in vivo. In the latter a Th2 antibody response was observed in flagellin immunized animals followed by the production of IL-4 and IL-13 by lymph node cells restimulated in vitro (85). In addition to flagellins ability to pr ime the adaptive immune response through its effects on APCs, recent evidence supports that flagellin could al so directly stimulate lymphocytes. Expression of mRNA from differe nt TLRs has been detected in human and murine T cells among them TLR5. In addition flagellin has been shown to increase proliferation and IFNproduction by memory-effector T cells and also to directly enhance IL-2 production and pr oliferation by nave T cells (9 0-91). In murine and human T cells, TLR5 expression has been shown to be selectively enhanced in CD4+CD25+ T cells as compared with their CD4+CD25nave counterparts (91-92). Furthermore, treatment of human CD4+CD25+ T cells with fl agellin increased their ability to suppress the proliferation of nave T cells stimulated with anti-TCR and anti-CD28 antibodies (91). Forkhead box p3 (FOXP3) is a transcription factor directly c in in p

PAGE 34

19 m directed to wards cytokine producti on (45). Cytokines act lar messengers shaping and expanding the immune response, furthermore they are respons roduced in excess over IL-12p35 limiti ng factor for IL-12p70 formation (96). IL-12p40 can be ccessible to IL-10 and IL-12 Recognition of viral or bacterial products through TLRs induces profound changes in APCs, many of the as cellu ible to terminate an ongoing response before tissue damage might occur. The cytokines IL-12 and IL-10 play key roles in expanding and limiting inflammation usually acting in opposition. IL-12 Macrophages, monocytes, neutrophils, and DCs, are the main sources of IL-12 (94). The biologically active form of IL12, IL-12p70, is a heterodimer formed by a 35kDa light chain (known as p35 or IL-12 ) and a 40-kDa heavy chain (known as p40 or IL-12 ) (95). IL-12p40 has been shown to be p suggesting that IL-12p35 acts as a secreted as a monomer but not IL-12 p35 that is secreted only when associated with p40 (96). IL-12p40 homodimers have been observed in mice in vivo but their function has not been completely elucidated (97-99). Regulation of IL-12 production IL-12 p35 and IL-12p40 are encoded by two genes located in different chromosomes and regulated independently. Re gulation of IL-12p40 expression has been reported to occur only at the transcriptiona l level while IL-12p35 might be regulated by transcriptional and translational mechanis ms (100). The endogenous p40 promoter is assembled in four tightly positioned nucleosomes (101) and th erefore is not a

PAGE 35

20 the tran -12p35 expression even in activated cells have complicated the stu microbial products is th e strongest stimulus to induce IL-12 produc scriptional machinery. LPS stimulatio n has been shown to result in chromatin remodeling that allows binding of the tran scription factor CCAAT enhancer-binding protein (C/EBP) (102). Howe ver, C/EBP by itself is not enough to induce IL-12p40 transcription and cooperation with other elements as NF B is necessary (94). The low levels of IL dy of the mechanisms that regulate its transcription. Nonetheless, cloning of the IL-12p35 promoter region from murine and huma n cells have served to identify binding sites for the transcription factors specificity protein 1 (SP1), IFNresponse element ( IRE) and C/EBP (103-104). TLR activation by tion that can be further enhanced by the cytokines IFNand IL-4 (105-106). On the contrary, IL-10 plays a ma jor role in the negative re gulation of IL-12 production by blocking transcription of the p40 and p35 genes (107-108). IL-12 biological activity The IL-12 receptor (IL-12R) is mainly expressed in activated T and NK cells making them the main target for this cytokine (94). Engagement of the IL-12R, as other cytokine receptors, activates the Janus kinase (JAK) family of prot ein tyrosine kinases, which in turn activate cytoplasmic signal transducer and activator of transcription (STAT) proteins. Activated STATs dimerize a nd translocate to the nucleus, where they induce expression of STAT-regulated genes (109). Although STAT1-3-4 and 5 have been reported to be activated by the IL12 recep tor (110), STAT4 appears to be the major player in the IL-12-induced response (111-112) The proinflammatory nature of IL-12 is mainly due to its strong ability to induce IFNproduction by T cells and NK cells. IL-12

PAGE 36

21 t also the production of inflammatory mediators that block nesis and/or have a dire ct toxic effect ov er the tumor (113). Finally, the powerful proinfla PCs, to block T cell function (116-117). IL-10 primarily acts by inhibiting a broad spectrum of activate is required for differentiati on of CD4+ T cells into IFNproducing T helper cells that are denominated T helper 1 (Th1) cells. Th1 cells are fundamental in the development of cellular immune responses as the differentia tion of cytotoxic CD8+ T cells (CTLs) and increase phagocytosis and microbial killi ng by members of the innate immune system (94). Treatment with IL-12 has been shown to have a marked anti-tumor effect on mouse models by inhibiting the estab lishment or inducing the regr ession of tumors (113). The anti-tumor effect of IL-12 is complex and involves not only antigen-specific responses against the tumor bu angioge mmatory nature of IL-12 plays a central role not only in the immune responses against tumors and pathogens but also in the development of organ-specific autoimmunity (114). IL-10 IL-10 was discovered in the early 1990s by Mossmans group using an assay to isolate factors that could suppress T cell activity (115). Later on, the same group and others showed that IL-10 act ed indirectly, via A The current understanding is that d functions in macrophages and dendritic cells. The functions inhibited include cytokine and chemokine production and expr ession of MHC class II and costimulatory molecules such as CD80 and CD86 (118-121). Regulation of IL-10 production The molecular mechanisms that regulate expression of the IL-10 gene are poorly understood. The transcription factors specificity protein (Sp) 1 (122-123), Sp3 (123),

PAGE 37

22 PS and other stimuli results in histone 3 (H3) phosphorylation at specific oter and enhanced chromatin accessibili ty (126). Furthermore mRNA ly ac tivated STAT3 recreates the anti-inflammatory effects induced CCAAT/enhancer-binding protein(C/EBP)(124), IFN regulatory factor 1 (IRF-1), and STAT3 (122) have been reported to be invol ved in IL-10 transcription and among them Sp1 seems to play a central role in the i nduction of IL-10 by L PS in macrophages (122). Sp1 is ubiquitously expressed s uggesting that other mechanisms of control exis t to ensure IL-10 production upon stimulation and not in a constitutive manner. One mechanism would be through restricted accessibility to the promoter. Supporting this possibility ERK activation by L regions of the IL-10 prom stability might also play an important ro le in IL-10 regulation as the presence of AU-rich elements that increase mRNA degradation have been described in the IL-10 mRNA (127). IL-10 biological activity Macrophages, DCs and certain T cell subs ets are the main source of IL-10. The main targets seem to be the antigen presenting cells even when the IL-10 receptor (IL10R) is expressed in most hematopoietic cells (128-129). IL-10R signaling results in the activation of STAT3 (121). STAT 3 activation is essential for the anti-inflammatory properties of IL-10 signaling since blocka de of the STAT3 function abrogates IL-10 mediated suppression of LPS-induced cytokine s and costimulatory molecules (130-132). Conversely, constitutive by IL-10 (133). Th e anti-inflammatory response induced by IL-10 has been shown to require the synthesis of new prot eins suggesting that STAT3 induces one or more genes that execute the an ti-inflammatory response but the identity of these proteins is still unknown (134).

PAGE 38

23 ial and fungal infection these mice develop strong Th1 res r prognosis for some cancers is not com lin and its recep tor (TLR5). The goals of our project were asically two. First, characterize the re sponse elicited by TLR5 in APCs. Second, valuate the ability of flag ellin to prime immune respons es in tolerogenic conditions. IL-10 deficient mice spontaneously devel op chronic intestinal inflammation as a result of aberrant immune responses to the mi crobiota of the gastrointestinal tract (135). Disease development depends on IL-12 and re quires the presence of resident enteric bacteria (136). Furthermore upon bacter ponses that results in enhanced cleara nce of the pathogen but also in toxicity and death due to massive inflammatory respons es (137-138). Disease development in IL-10 deficient mice demonstrates that IL-10 is essential to limit immune responses and other factors can not compensate for its loss. Elevated IL-10 serum levels have been reported as a negative prognostic factor for survival in lymphoma, lung cancer, hepa tocellular, renal or gastric carcinoma and other solid tumors (121). How IL-10 contribut es to a poo pletely elucidated and probably its role might vary for different malignancies. Nonetheless, it is clear that the presence of IL-10 will blunt the induction of an immune response against tumor cells by inhibiting DC function. Furthermore, IL-10 might serve as a growth factor for certai n cell types as B cells (139). The main objective of tumor immunotherapy is to induce productive and specific immune responses against malignant cells. Th e powerful proinflammatory nature of TLR ligands led us to explore the possibility of using them to achieve this goal. Among all TLR ligands, flagellin is the only protein, this characteristic f acilitates its use for vaccination purposes as it can be cloned or modified easily. Therefore, we decided to focus our research in flagel b e

PAGE 39

24 urthermore, we also investigated the transl ation of these studies into a suitable antimor vaccination strategy. F tu

PAGE 40

25 tion were detectable using the Limulu MATERIALS AND METHODS TLR ligands. Salmonella typhimurium flagellin was isolated as previously described (140). Briefly, Salmonella typhimurium is grown in a chemically defined media, in order to avoid the contamination of the flagellin preparation with other proteins. The dissociation of flagella from the bacterial cells was ach ieved by reducing the pH to 2.0 with HCl for only 30 min. The reduction in pH results in th e detachment and breakdown of flagella into its monomeric form, but it does not cause the death or di sruption of the bacteria. The monomeric form of the flagella, flagellin protein, is no longer centrifugable. This property is exploited to remove pH 2.0 insoluble contaminants before protein precipitation. Protein precipitation was ach ieved by saturating the preparation with ammonium sulfate (2.67 M final concentration). After which th e protein precipitate is resuspended in an appropriate volume of endot oxin free water and dialyzed overnight in distilled water plus activated charcoal. Even after all these purification steps the presence of small amounts of endotoxin in the protei n prepara s Amebocyte Lysate method (Cambrex Rutherford, NJ). Further purification steps combining filtration through 100 Kd pore size centricon co lumns (Millipore, Billerica, MA) and polymixin B columns, De toxi-Gel AffinityPak columns (Pierce, Rockford, IL) were used to remove the remaining LPS.

PAGE 41

26 e K were used, erfor med with commercially available S. typhimurium flagelli LB/c mice were injected intraperitoneally with 1 mL of thioglycollate (DIFCO Labora crophages was ach ieved by 5-6 days incubation of the cells SDS-PAGE analysis revealed no contaminating proteins accompanying the expected flagellin doublet at around 50kDa. In addition western blot using a monoclonal antibody against flagellin further conf irmed the proteins identity (Igen international,Gaithersburg, MA). In those e xperiments in which flagellin was digested with proteinase K (Sigma Aldrich, St Louis ,MO ) 100 g/ml proteinas digestion carried for 4 hours at 37C and the protease wa s inactivated at 100C for 1 hour. Experiments were also p n (InVivoGen, San Diego, CA) which yiel ded identical results. LPS was obtained from Sigma (Sigma, St Louis, MO). CpG, and Zymosan we re obtained from InVivoGen, (InVivoGen,San Diego, CA) and they were used as indicated in the text. Isolation of peritoneal elicited macroph ages (PEM) and generation of bone marrow (BM)-derived macrophages. BA tories, Detroit, MI). Four days later, PEMs were obtained by peritoneal lavage as previously described (141). For CK analysis by ELISA 10 5 cells per well are plated in a 96 well plate, for RN A analysis 1 x 10 6 cells per well are plated in a 24 well plate. After 2 hours those cells that did not adhere to the plate are washed off using ice-cold HBSS (2 washes). BM-derived macrophages were differe ntiated from bone marrow cells by harvesting the hind legs and flushing the bone marrow with RPMI. Red blood cells were lysed using ACK lysis buffer and the remaini ng cells extensively washed. Differentiation of bone marrow cells into ma

PAGE 42

27 in com Mice were treated with flagellin (10 g/animal), LPS (10 g/animal) or HBSS and the volume injected was 0.1 ml via tail vein. Ninety minutes later the animals were sacrificed and blood obtained by heart punc ture. Blood was spun down at maximum speed in a minicentrifuge to separate the serum from the cellula r components of the blood. Cytokine levels were quantified by sandwich ELISA following manufacturers n Diego, CA). For in vitro determination of cytokine produc Two million PEMs or BM-derived macrophages were plated per well in a 24 well plate. After 2 hours non-adherent cells were washed off with media and attached cells were then treated as indicated. Total RNA was extracted using TriZol reagent (Qiagen,Valencia,CA) and cDNA obtained w ith the iScript cDNA synthesis kit (BioRad,Hercules,CA). Target mRNA was quantifie d using MyIQ single color real time PCR detection system (Bio-Rad) and iQ SYBR gr een Supermix (Bio-Rad,Hercules,CA). ILplete media (20% FBS, 100 M -mercapto-ethanol in DM EM) supplemented with L-929 cells supernatants as a source of M-CSF (142). At th e end of the incubation period the plates are washed vigorously with ice-co ld HBSS and the strongly attached cells are macrophages. FACS analysis of these cells showed that they are CD11b high Gr1 low/+ Quantification of cytokines instructions (BD Pharmingen, Sa tion, 1x10 5 PEMs were plated by triplicate in 96 well-plates and treated for 24 hours unless otherwise specified. Supernatants were harvested and kept at -70C until ELISA for IL-10; IL12p40-70 (BD Pharmi ngen, San Diego, CA) or IL-12 p70 (Ebioscience San Diego, CA) was performed following manufacturers instructions Real time (RT)-PCR analysis.

PAGE 43

28 TCCTAC, right oligo sed for P CR amplification (cycling parameters 3 min 95 ticles (Fluor esbrite YG carboxylate microspheres 1 re us ed for covalent coupling of flagellin by activating the carboxyl groups with water-sol 12p35 primers (left oligo ATGGT GAAGACGGCCAGAG, right oligo CAGGTCTTCAATGTGCTGGTT) IL12p40 primers, (left oligo GCAACGTTGGAAAGGAAAGA, right oligo AAAGCCA ACCAAGCAGAAGA), IL10 primers (left oligo CAGGGATC TTAGCTAACGGAAA, right oligo GCTCAGTGAATAAATAGAATGGGAAC), TLR5 primers (left oligo GCATAGCCTGAGCCTGTTTC, right olig o AAGTTCCGGGGAATCTGTTT) and GAPDH primers (left oligo ATGGCCTTCCGTGT CAGATGCCTGCTTCACCAC) were u C, 15 secs 95 C, 30 secs 60C 40 reps, 1 min 95C). Single product amplification was confirmed by melting curve analysis and primer efficiency was near to 100% in all the experiments performed. Quantifi cation is expressed in arbitrary units and target mRNA levels were normalized to GAPDH expression. Preparation of flagellin-coated beads Carboxyl (COOH) micropar m Polysciences Inc, Warrington, PA) we uble carbodiimide. The carbodiimide reacts with the carboxyl group to create an active ester that is reactive toward primary amines on the protein of interest (PolyLink Protein Coupling Kit for COOH Microspheres Polysciences Inc, Warrington, PA) Antigen-specific T-cell tolerance model. Single cell suspensions were made from peripheral lymph nodes and spleen collected from anti-HA TCR transgenic donors (BALB/c HA+/mice). The percentage of

PAGE 44

29 by triplicate in a 96 well plate at a ells per well, in the pres ence or not of synthetic HApeptide bitors cocktail (S igma Aldrich, St Louis ,MO ) and phosphatase inhibitors igma Aldrich, St L ouis ,MO ) and subjected to SDS-PAGEimmun lymphocytes double positive for CD4 and the clonotypic TCR was determined by flow cytometry. Cells were washed three times in sterile Hanks balanced salt solution (HBSS), and injected into th e tail vein of male recipien ts such that a total of 2.5x10 6 CD4+ antiHA TCR + T cells were transferred into BALB/c mice. One day later, mice were injected intravenously (i.v) with a to lerogenic dose of HA-peptide 110-120 (200 g) in combination or notwith 10 g of flagellin. Two weeks later the animals were sacrificed and the spleen harvested. Transgenic T cells numbe rs in the spleen we re assessed by Flow Cytometry with FITC conjugated rat anti mouse CD4 antibodies (Pharmingen) and byotinilated rat anti-clonotypic TCR antibody MAb 6.5 (kindly provided by Dr Hyam Levitsky, John Hopkins University) and analyzed by Flow-Jo software (Treestar Inc). For in vitro restimulation analysis, splenocytes were pl ated final concentration of 1x10 6 c 110-120 After 48 hours stimulation supernatants were collected and the production of IFNand IL-2 was assessed by ELISA. Values for cells cultured in media alone are less than 10% of the values fo r antigen-stimulated cells. Data are expressed as the amount of cytokine produced by 100 clonotype+ T cells/well. Cell lysates and western blot Total cell lysates were prepared in RI PA buffer (150 mM Na Cl, 10 mM Tris-HCl, pH 7.4, 5 mM EDTA, pH8.0, 0.1% SDS, 1% de oxycholate, 1% Triton X-100) containing protease inhi cocktail (I and II) (S oblot analysis with anti-phospho-p44/42 MAPKinase (Thr202/Tyr204) polyclonal antibody (Cell Signaling), phos pho-IkappaB-alpha (Ser32) (14D4) rabbit monoclonal

PAGE 45

30 l GM-CSF plus 40 ented (144) we noticed that the additio APCs ter 48 hours res timulation supernatants were collected and CK production was quantified by ELISA. T cell proliferation was assessed after 72 hours restimulation by pulsing the cells with [3H]thymidine (1 Ci/well, NEN Life Science, antibody (Cell Signaling) and anti-MAPKina se (ERK1+ERK2) monoclonal antibody (Invitrogen) Generation of DCs Dendritic cells were differentiated as in (146). Briefly bone marrow was collected from the femur and tibia of 6-10 week old BALB/c mice. Red blood cells were lysed in ACK lysis buffer and CD4+, CD8+ cells depleted using complement-mediated lysis followed by extensive washing. Cells were cult ured for 7 days in media supplemented with 20 ng/ml GM-CSF plus 20 ng/ml IL-4 (BM-DCs) or 20 ng/m ng/ml IL-10 plus 2.5 ng/ml TNF(as already docum n of TNFdid not alter the DCs phenotype or ability to produce cytokines but it helped to expand the yield of these cells.). Every 2 days old media was removed from the plate and fresh media added. After 7 days in culture cells were harvested. Around 90% of the cells harvested were CD11c + as determined by FACS analysis. Nave T cell preparation and in vitro differentiation Nave T cells were purified from HA +/BALB/c mice using magnetic column separation. The phenotype of these T cells (CD4+ CD62L+) was confirmed by FACS analysis before culture and cells plated with BM-DCs or tolerogeni c-DCs and antigen for 7 days. After this incubation period cells were washed twice with ice cold HBSS and transferred to a new plate where they were restimulated using fresh splenocytes as plus antigen (HA peptide). Af

PAGE 46

31 The ATTCAGTGCCGATACCAAGG (left primer) and ACGTGTCGGTGAATCAATC (right primer) oligos were designed to amplify the whole fliC coding sequence from Salmonella typhimurium (Genbank accession number D13689). The PCR product was identified as a unique band running at the expected size of 1.6 Kb and purified from the agarose gel using the Qiaquick gel extraction kit (Qiagen). The PCR product obtained was initially cloned into the pCR 2.1 vector (Invitrogen TA cloning kit). The proper orie ntation of the insert was verified by sequen ct th e murine melanoma cell line B78H1 using the Lipofectamine plus t (Gibco). Transfected cells were initially selected in complete media plus 400 l of Hygromicin. Cells that survived were further selected in media containing 1200 g/ml of Hygromicin. Flagellin expression by these cells was confirmed by wes n blot analysis of ce ll lysates using an anti-flagellin specific monoclona l antibody ational). MA). Eighteen hours later, cells were harveste d with a Packard Micr omate cell harvester and thymidine incorporation into DNA was measured as counts per minute (cpm). FliC expressing tumor cells cing using an oligo for the T7 promot er present in the plasmid. Following this step, the construct was digest ed with the restriction en zymes XhoI and HindIII and subcloned into the pcDNA 3.1 (-)Hygro vector (I nvitrogen) for IL-10 protein expression in mammalian cells. The inserted fragment wa s sequenced and identified as the fliC gene of Salmonella typhimurium The pcDNA 3.1/fliC construct was then us ed to transfe r eagen g/m ter (Igen In tern

PAGE 47

77 kd 50 kd Flagellin preparation Flagellin was purified from Salmonella typhimurium as explained in the Materials and Methods section. Briefly, the dissociation of flagella from the bacterial cells was achieved by reducing the pH to 2.0 with HCl for 30 min. The reduction in pH results in the detachment and breakdown of flagella into its monomeric form, but it does not cause the death or disruption of the bacteria. Soluble flagellin is precipitated using ammonium sulfate at saturating conditions and further purified using dialysis, ultrafiltration and polymyxin B beads to eliminate endotoxin contamination. SDS-PAGE analysis of the flagellin preparation revealed no contaminating proteins accompanying the expected flagellin doublet at around 50kDa (Figure 5A). RESULTSFIGURE 5. Flagellin protein preparation(A) SDS PAGE followed by Coomasie staining of a Salmonella flagellin preparation. (B)Western blot analysis of the same protein preparation using monoclonal antibodies against flagellin 32

PAGE 48

33 ella known as F liC (flagellin phase type 1/H1) and FljB (flagellin phase type 2/H2) (145). The FliC and FljB Salmonella flagellin prot eins display 78% sequence identity and seem to activate TLR5 signali ng with similar potency (145). The iden etic studies s howed that even after 72 hours of treatment IL-10 was still not detected in the supernatants of flagellin-treated PEM (Figure 6C-open squares). In contrast, wh en PEM were stimulated with LPS, IL-10 The presence of two bands is due to th e expression of two different flagellin proteins by wild type Salmon tity of both proteins was verified by western blot using a monoclonal antibody against flagellin (Figure 5B). Flagellin-stimulated PEM produce IL-12 but not IL-10 Peritoneal elicited macrophages (PEM) were treated in vitro with increasing concentrations of purified flagellin or with LPS for 24 hours. At this time the supernatants were collected and production of IL-12 p40/p70 and IL-10 was determined by ELISA. Reminiscent of previous studies (121), LPS-treated PEM produce both the proinflammatory cytokine IL-12 as well as the anti-inflammatory cytokine IL-10 in a dose-dependent manner (Figure 6A ). Treatment of PEM with flagellin also resulted in a dose dependent production of IL 12p40/p70 (Figure 6B). The ma gnitude of this response was however not as potent as the one induced by LPS (Figure 6A versus 6B, black squares). IL-10 is commonly produced by m acrophages upon stimulation with different TLR ligands, but to our surprise we did not detect any IL-10 production in flagellinstimulated PEM (Figure 6B-open squares). The lack of IL-10 production was not the result of delayed production of this cytokine since kin

PAGE 49

020040060080010001200 HBSS 0.0010.010.1135 IL-12 IL-10 0100200300400500600 122436486072 pg/ml cytokine HBSS LPS Flagellin 020040060080010001200HBSS 0.0010.010.1135pg/ml cytokine LPS (g/ml)Time (hours) 122436486072 HBSS LPS FlagellinIL-10 pg/ml cytokineABC1002004000300500600 0100200300400HBSS FD0.1250.250 0.5 1 2 5pg/ml cytokine IL-12 IL-10Flagellin (g/ml)FIGURE 6. IL-12p40-70 but not IL-10 is detected in the supernatants of flagellin-stimulated PEM.(A-B) PEM from BALB/c mice (1x10 cells/well) were cultured for 24 hours with the indicated concentrations of LPS, flagellin or proteinase K digested flagellin (FD, volume added equivalent to 5 g/ml flagellin) Supernatants were then collected and IL12p40/70 or IL-10 were determined by ELISA. Data represent mean s.d. of triplicate cultures. Shown is a representative experiment of three independent experiments with similar results. (C) PEM were treated with flagellin (5 g/ml), LPS (1 g/ml) or with HBSS. Supernatants were collected at the indicated time points and the production of IL-10 was determined by ELISA. Data represent mean s.d. of triplicate cultures. Shown is a representative experiment of two independent experiments with similar results. was detected at early time points and its levels remained elevated throughout the duration of the incubation period (Figure 6C-open diamonds).34 IL-12 IL-105

PAGE 50

35 our data shows that the observed effects induced by flagellin on macrophages are not due to LPS contamination and require expression of TLR5 in the responding cells. One concern in the interpretation of the results described above is the possibility that the flagellin preparation would be contaminated with other bacterial products that could activate macrophages, especially l ypopolysaccharide (LPS). However we have used several controls to rule out this possibili ty. First, we tested the flagellin preparation with the Limulus amebocyte lysate test (LAL ). This chromogenic method is based on the activation of a proenzyme on the lysate when in contact with endotoxin and it is of standard use in pharmaceutical a nd medical facilities. Using this test we could not detect LPS contamination in our flagellin prepar ation. Second, digestion of the flagellin preparation with proteinase K resulted in loss of its abilit y to induce IL-12 production in PEM (Figure 6B-FD, and Figure 7A) indicating that this eff ect is induced by a protein and not by other non-proteinaceous potential c ontaminants in the preparation. Finally, given the previous demonstration that the inflammatory effect of flagellin requires binding to TLR5 (61) (79), we treated th e macrophage cell line RAW 264.7, which lacks TLR5 (146 and Figure 7B), with flagellin or LPS. While treatment with LPS resulted in IL-12 production by these cells, treatment with flagellin failed to induce such a response, indicating that induction of IL-12 by flagellin requires expre ssion of TLR5 in the target cell (Figure 7C). The absence of IL-12 production in RAW 264.7 cells also provides additional support to our claim th at the flagellin preparation used in our experiments was LPS-free, since some LPS contamination mi ght have otherwise resulted in IL-12 production by RAW 264.7 cells. To conclude

PAGE 51

-150-100-500501001502002503003500481216202428323640 -150-100-50050100150200250300350PEMRAW 264.7 04080120160200Media Proteinase KDigested FlagellinFlagellinIL-12 p40-70 (pg/ml) 050010001500200025003000MediaFlagellinLPS PEMRAW 264.7FIGURE 7. IL-12 p40-70 production by flagellinstimulated macrophages is not caused by endotoxin contamination(A) Proteinase K digested flagellin does not induce IL-12 production by PEM. Peritoneal macrophages were cultured in media alone or in digested or not with proteinase K. Supernatants were collected after 24 hours and IL-12 p40-70 was quantified by ELISA. Shown is one of at least three experiments made. (B) and (C) RAW 264.7 do not express detectable TLR5 mRNA levels and do not respond to flagellin stimulation. (B) TLR5 mRNA level from PEM or RAW 264.7 cells was determined by quantitative real-time RT-PCR. GAPDH mRNA levels were similar among the samples compared. Shown is a representative experiment of two independent experiments with similar results. (C) RAW 264.7 cells were cultured for 24 hours with flagellin (5alone. Supernatants were collected measured by ELISA. Data represent mean s.d. of triplicate cultures from a representative experiment of three with similar results. IL-12 p40-70 (pg/ml)CyclePCR substracted CF RFU36ABC

PAGE 52

IL12 p40-70 HBSS LPS FLAGELLIN 0 50 100 150200 HBSS LPS FLAGELLIN 0 500 1000 1500 IL10ABng/mlpg/mlIL-12 but not IL-10 is detected in the serum of flagellin-treated mice. To confirm the above in vitro results, we assessed next the production of IL-10 and IL-12 in mice that received a single intravenous (iv) injection of either flagellin or LPS. As shown in Figure 8A, similar levels of IL-12 p40-70 were detected in the serum of LPS or flagellin treated mice. In contrast, IL-10 production showed a completely divergent outcome upon treatment with either TLR ligand. While significant levels of IL-10 were detected in the serum of LPS-treated mice, this cytokine could not be detected in the serum of flagellin-treated mice (Figure 8B).37FIGURE 8. Serum levels of IL-12p40-70 and IL-10 in mice treated with LPS or flagellin.BALB/c mice were injected iv with either flagellin (10 g), LPS (10 g) or an equal volume of HBSS (0.1 ml). Blood was collected 1.5 hours later and serum levels of IL-12p40-70 (A) or IL-10 (B) were determined by ELISA. Shown is a representative experiment with four animals per group of two independent experiments with similar results. Each dot represents an animal and the line indicates the groups mean.

PAGE 53

0200400600800100012001400Animal 1Animal 2Animal 3Animal 1Animal 2Animal 3 pg/ml IL-6 TNFHBSS injected Flagellin injectedFIGURE 9. IL-6 and TNFblood serum levels in flagellin-treated animals BALB/c mice were injected iv with either flagellin (10 g) or an equal volume of HBSS (0.1 ml). Blood was collected 1.5 hours later and serum levels of IL6 or TNF were determined by ELISA. Shown is a representative experiment with three animals per group Other proinflammatory cytokines as IL-6 were also detected in flagellin-treated mice. Of notice, TNFwas absent from the serum of these animals (Figure 9). Several lines of evidence indicate that TNFis the principal mediator in the pathogenesis of septic shock. First, neutralizing anti-TNFantibodies can prevent the pulmonary failure and death associated with administration of endotoxin or Escherichia coli in mice (147). Second, intravenous infusion of TNFleads to a toxic syndrome indistinguishable from that caused by endotoxemia and gramnegative sepsis (147-148). These observations might indicate that the low toxicity observed by previous studies and also in our own experiments in flagellin-treated as compared with LPS-treated mice might be due to the absence of TNFin the serum of flagellin-treated animals.

PAGE 54

0 h3 h6 h9 h12 h Flagellin LPS ratio treated/untreated806040200PEMIL-10 mRNA dynamics in flagellin-stimulated PEM In order to assess if flagellin stimulation of macrophages results or not in the induction of IL-10 mRNA we determined the IL-10 mRNA kinetics in flagellin treated macrophages and compare them to those obtained in LPS-treated macrophages (Figure 10). In response to LPS stimulation, a rapid increase in IL-10 mRNA was observed by 3 hours, followed by a peak response at 6 hours after treatment. This induction is followed by a progressive decline and, after 12 hours of exposure to LPS, the IL-10 mRNA levels were back to baseline (Figure 10-white squares). The magnitude and kinetics of IL-10 mRNA were significantly different in flagellin-treated PEM. Following three hours of incubation, only a weak induction of IL-10 mRNA was detected by RT-PCR. This initial response was followed by a rapid decline and by 6 hours, IL-10 mRNA levels in flagellin-treated PEM were equivalent to those found in untreated cells (Figure 10-black squares).39FIGURE 10. IL-10 mRNA dynamics in flagellin-stimulated macrophages.PEM were cultured in media or stimulated with LPS (1 g/ml) or flagellin (5 g/ml) and the cells harvested in TriZol at the indicated time points. RNA was extracted and IL-10 relative to GAPDH mRNA was determined by quantitative RT-PCR. Data shows the ratio expressed in arbitrary units of treated versus untreated cells obtained at each of the time points. Shown is one of three independent experiments with similar results.

PAGE 55

040801200 h3 h6 h9 h12 hratio treated/untreated Flagellin LPS FIGURE 11. IL-10 mRNA dynamics in flagellin stimulated BM-derived macrophages.(A) BM-derived macrophages were cultured in complete media and stimulated with either LPS (1 g/ml) or flagellin (5 g/ml). Cells were then harvested in TriZol at the indicated time points. RNA was extracted from these cells and IL-10 mRNA relative to GAPDH mRNA was determined by quantitative RT-PCR. Data shows the ratio expressed in arbitrary units of treated cells versus untreated cells obtained at each of the indicated time points. Shown is a representative experiment of three independent experiments with similar results.IL-10 mRNA dynamics in bone marrow-derived macrophages PEM are elicited using a mild inflammatory agent (thyoglicollate). Therefore they have been exposed to maturating signals that might have affected their ability to respond to flagellin. In other to assess this possibility we generated macrophages from bone marrow (BM-macrophages) and exposed them to either LPS or flagellin. As shown in Figure 11 a similar pattern of IL-10 mRNA expression was observed in flagellin-treated BM-derived macrophages as compared to PEM (black squares). BM-derived macrophages express TLR5 (Figure 12A). Reminiscent of our findings with PEM (Figure 6B), no IL-10 protein was detected in the supernatants of BM-derived macrophages stimulated with flagellin (Figure 12B). The lack of IL-10 40

PAGE 56

050010001500200025003000 UntreatedLPSFlagellinIL-12p40-70 (pg/ml) 040080012001600IL-10 (pg/ml) UntreatedLPSFlagellinFIGURE 12. BM-derived macrophages express TLR5 and produce IL-12p40-70 but not IL-10 when stimulated with flagellin. (A) RNA from BM-derived macrophages was analyzed for TLR5 mRNA expression relative to GAPDH using realt-time RT-PCR. (B) and (C) BM-derived macrophages were cultured for 24 hours with LPS (1 g/ml) or flagellin (5 g/ml). Supernatants were collected and the levels of IL-10 and IL-12p40-70 were measured by ELISA. Data represent mean s.d. of triplicate cultures. Shown is a representative experiment of two independent experiments production is not due to the unresponsiveness of these cells since they produce significant levels of IL-12 p40-70 when stimulated with flagellin (Figure 12C)41ABC

PAGE 57

42 Taken together, our data indicates that flagel lin induces a short-lived expression of IL-10 mRNA in macrophages. The transient inducti on of IL-10 expression by flagellin might not be enough to result in detectable levels of IL10 protein production LPS-induced IL-10 mRNA and protei n are inhibited by flagellin Several TLR ligands can be found in any microbial organism; furthermore APCs and other immune cells express more th an one TLR. Therefore during an ongoing infection, flagellin and other TLR ligands expres sed in flagellated bact eria are lik ely to be recognized by cells of the immune system eith er simultaneously or sequentially. In order to find whether flagellin could influence th e production of IL-10 in response to other TLR ligands, we treated PEM with flagellin and the TLR4 ligand (LPS) either simultaneously (Figure 13) or sequentially (Figures 14 and 15 ). As shown in Figure 13A, no differences in IL-10 mRNA levels were observed in peritoneal macrophages after 2 hours of exposure to either LPS alone (white sq uares) or LPS in the presence of flagellin (F/LPS: black squares). However, unlike stimulation with LPS alone, IL-10 mRNA levels declined rapidly by 4 and 6 hours of simultaneous engagement of TLR4 and TLR5. The inhibition of IL-10 by flagellin was also reflected at the prot ein level. As displayed in Figure 13B, a dose dependent inhibition of IL-10 production was observed when PEM were treated with LPS (1 g/ml) in the presence of increas ing concentrations of flagellin. Inhibition of IL-10 was not observed when the TLR5-defici ent cell line RAW 264.7 was treated with LPS and flagellin, indicating th at flagellin-induced IL-10 inhibition in response to LPS requires TLR5 expression (Figure 13C).

PAGE 58

0204060801001201400 h2 h 4 h 6 h12 hIL-10 (pg/ml) 10008006002004000MediaLPS5101520 LPS + FlagellinPEM MediaLPS5101520LPS + Flagellin 2000160012004008000IL-10 (pg/ml)RAW 264.7IL-10 mRNA ABCSIMULTANEOUS TREATMENT LPS F/LPS ratio treated/untreatedFIGURE 13. Flagellin inhibits LPSinduced IL-10 protein and mRNA (A) PEM were stimulated with 1 g/ml LPS alone (open squares) or with LPS (1g/ml) in the presence of 20 g/ml flagellin (F/LPS, black squares). Cells were then harvested at the indicated time points. IL-10 mRNA levels were determined as in Figure 10. Data shows the ratio expressed in arbitrary units of treated cells versus untreated cells obtained at each of the indicated time points. Shown is a representative experiment of two independent experiments with similar results. (B, C) PEM or RAW 264.7 cells were stimulated with LPS alone (1 g/ml) or LPS plus increasing concentrations of flagellin for 24 hours as indicated. Supernatants were then collected and the levels of IL-10 were determined by ELISA. Data represent mean s.d. of triplicate cultures. Shown is a representative experiment of two independent experiments with similar results.43

PAGE 59

0204060801001201401601800 hours3 hours 6 hours 12 hours % fold induction over LPS No pretreatment IL-10 IL12-p40 FIGURE 14. A short pretreatment with flagellin affects IL-10 and IL-12 induction in an opposite wayPEM were cultured with flagellin (5 g/ml) or just media for the indicated time length after which LPS (final concentration 1g/ml) was added. Cells were harvested 2 hours after LPS addition and the levels of IL-10 (white squares) and IL-12 p40 (black squares) mRNA relative to GAPDH quantified using real-time RT-PCR.Pretreatment of macrophages with flagellin results in stronger inhibition of LPS-induced IL-10 Flagellin treatment decreased LPS-induced IL-10 mRNA levels at later times when macrophages are simultaneously stimulated with flagellin and LPS. This result prompted us to investigate how LPS induced IL-10 mRNA would behave if the cells are exposed to flagellin before LPS stimulation (Figure 14).44

PAGE 60

45 Figure 14 shows IL-10 (white squares) and IL-12p40 (black triangles) mRNA after 2 hours of treatment with LPS in cells that have receive d or not flagellin pretreatment. IL-10 mRNA inhibition by flagel lin was substantially increased when the cells were exposed to flagellin 3 hours be fore LPS treatment. Increasing the time in contact with flagellin to 6 hours before LPS stimulation re sulted in similar levels of inhibition to those observed after 3 hours treatment. Interestingly, IL-12p40 mRNA production by LPS was enhanced by pretreatment with flagellin for 3 hours. However the obs erved enhancement was gone when flagellinpretreatment was increased to 6 hours. Treati ng the cells for 12 hours with flagellin prior to LPS stimulation made the cells refractory to further st imulation with LPS (149-150). Given these results, in our next experime nts we used macrophages that have been stimulated with flagellin for a short period of time (3 hours) before adding LPS to the media. A profound inhibition of IL-10 mRNA expression was observed when PEM were exposed to flagellin (5 g/ml) for 3 hours prior to LPS stimulation (Figure 15A). In addition decreased levels of IL -10 protein were observed in PEM pretreated with flagellin (5 g/ml) and then stimulated with increasing concentrations of LPS (Figure 15B). In the pretreatment setting, flag ellin at a dose of 5 g/ml, which has minimal inhibitory effect when used simultaneously with LPS (Figure 13B), displayed stronger IL-10 inhibitory properties. Conversely, the inhibitory effect of flagellin on IL-10 production was not observed when the TLR5-deficient cells RA W 264.7 were pretreated with flagellin (Figure 15C).

PAGE 61

IL-10 (pg/ml)ratio treated/untreated 2 hours4 hours 020406080100120 0.3 0.6 1.250 MediaFlagellin250200150100500PEM MediaFlagellin 0.30.6 1.25 100080060020040001200IL-10 (pg/ml)RAW 264.7IL-10 mRNAABCPRETREATMENT MediaFlagellin0 LPS LPSFIGURE 15. Inhibition of IL-10 by flagellin is enhanced by a short pretreatment (A) PEM were treated with 5 g/ml flagellin (black bars) or with media alone (white bars) for 3 hours, followed by the addition of LPS (1g/ml). Cells were harvested at the indicated time points after the addition of LPS. IL-10 mRNA relative to GAPDH mRNA was determined by quanti-tative real-time RT-PCR. Shown is a representative experiment of four independent experiments with similar results. (B, C) PEM or RAW 264.7 cells were cultured with flagellin (5 g/ml) or media alone for 3 hours, followed by stimulation with LPS (1g/ml). Supernatants were collected 24 hours after LPS addition and the levels of IL-10 were determined by ELISA. Data represents mean s.d. of triplicate cultures. Shown is a representative experiment of three independent experiments. 46

PAGE 62

47 IL-10 inhibition by flagellin is restricted to specific TLRs To determine whether a similar inhibito ry effect over IL-10 production occurs when PEM are exposed to TLR-ligands other than LPS, we treated PEM with flagellin followed by stimulation with either zymosan (TLR2/6 ligand) or CpG (TLR9 ligand). As shown in Figure 16A, treatment of PEM with increasing concentrations of zymosan results in IL-10 production in a dose depe ndent manner (white bars). However, when these cells were treated with flagellin and then zymosan, a dramatic decrease in IL-10 production was observed (Figure 16 A-black bars). In contrast, such an inhibitory effect on IL-10 protein production was not observed when PEM were pretreated with flagellin followed by CpG (Figure 16B). In order to as sess if flagellin pretreatment decreased CpG-induced IL-10 at the mRNA but not at the protein levels we quantified the levels of IL-10 mRNA in PEM pretreated with flage llin or media followed by CpG. In agreement with the results obtained at the protein leve l, flagellin did not affect the IL-10 mRNA levels induced by CpG in PEM (Figure 16C). To summarize, our results have unveiled a previously unknown effect of flagellin in the negative regulation of IL-10 production in response to specific TLR ligands. Interestingly zymosan, flagellin and LPS engage TLRs that localize in the cellular membrane while CpG is detected by an intracellular receptor. IL-10 production by surface receptors but not by intracellular rece ptors is affected by flagellin stimulation suggesting that receptor colocalization mi ght be required for TLR5-mediated IL-10 repression.

PAGE 63

ABIL-10 (pg/ml) 800020040060010000 0.030.060.120.25 CpG (M) 0501002502001500 51020 Zymosan ( g/ml)IL-10 (pg/ml) MediaFlagellin MediaFlagellin 503040201002 hours4 hours6 hours CpG treatment IL-10 mRNA(ratio treated/untreated)CFIGURE 16. IL-10 production by macrophages treated with flagellin and other TLR ligands. PEM were cultured in media alone (white bars) or with 5 g/ml of flagellin (black bars) for 3 hours, followed by stimulation with either Zymosan (A) or CpG (B). Supernatants were collected 24 hours later and the production of IL-10 protein was determined by ELISA. Data represent +/s.d. of triplicate cultures. Shown is a representative experiment of two independent experiments with similar results. (C) Cells were harvested at the indicated time points after the addition of CpG. IL-10 mRNA relative to GAPDH mRNA was determined by real-time RT-PCR. Shown is a representative experiment of two independent experiments with similar results. MediaFlagellin48

PAGE 64

IL-10 mRNA 2 hours02468101214161820MediaCpGratio treated/untreated Ova-beads Flagellin-beads IL-10 mRNA 4 hours010203040506070MediaCpGratio treated/untreatedFIGURE 17. Macrophages stimulated with flagellin-coated beads showed impair IL-10 induction by CpGPEM were cultured with flagellin coated beads (equivalent to 5g/ml protein) (black bars) or beads coated with an irrelevant protein (OVA) (white bars). After 3 hours cells were washed and fresh media or media with CpG (final concentration 0.25 M) added. Cells were harvested at the indicated time points after the addition of CpG. IL-10 mRNA relative to GAPDH mRNA was determined by quantitative real-time RT-PCR.IL-10 inhibition might depend on receptor colocalization In unstimulated macrophages and DCs TLR5 and TLR9 have been shown to be expressed in different cellular compartments. TLR5 localizes to the cellular membrane (47) while TLR9 has been detected in the ER (endoplasmic reticulum) (48). Nonetheless, TLRs present in the cellular membrane have been shown to be recruited to phagosomes (151). In addition, phagosomes contain ER-resident proteins since ER membranes are a source of phagocytic membranes in macrophages and other cells (152). Therefore, in the context of phagocytosis it would be possible that TLR5 and TLR9 could localize in the phagosomal/lysosomal compartment. To test this hypothesis we used beads as a vehicle to introduce flagellin into the phagosomal/lysomal compartment (Figure 17).49AB

PAGE 65

50 As shown in Figure 17 CpG stimulation of macrophages that have phagocyted flagellin-coated beads resulted in inhibition of IL-10 mRNA as compared to those that uptook control protein (ova)-coated beads. Th ese data could support that signaling from the same compartment is required for TLR 5 negative regulation of IL-10 induction by other TLRs. Flagellin treatment does not aff ect LPS-induced IL-10 mRNA stability Stimulation of macrophages with LPS cau ses a dramatic increase in the IL-10 mRNA levels that might be due to an increase in the IL-10 gene transcription and also in the IL-10 mRNA stability (126-127), (153). In order to determine whether suppression of LPS-induced IL-10 by flagellin was caused by an increase in IL-10 mRNA degradation, we treated macrophages with actinomycin D, an inhibitor of mRNA synthesis, and followed the changes induced by flagellin in the stability of LPSinduced IL-10 mRNA. Figure 18A shows that actinomycin D suppresses mRNA synthesis. For this control experiment, cells were treated with LPS plus actinomycin D or LPS plus media for two hours. Cells were then harvested and the levels of IL-10 mRNA were measured by RTPCR. Actinomycin D (5 g/ml) completely blocked the synthesis of new mRNA (LPS + ActD). In our next set of experiments, PEM were cultured for 3 hours with either flagellin or media and then LPS was added. Actinomycin D was added to the cultures 2 hours after LPS treatment and cells were harv ested at the indicated time points after actinomycin D treatment. As shown in Figure 18B, an almost identical rate of IL-10 disappearance was observed; suggesting that pretreatment with flagellin does not affect IL-10 mRNA stability in response to LPS stimulation.

PAGE 66

020406080100120LPSLPS+ActDratio treated/untreated 0204060801001200 hours2 hours 4 hours LPS Flag/LPSpercentage changeMedia/AB51FIGURE 18. IL-10 repression by flagellin is not caused by a decrease in IL-10 mRNA stability(A) PEM were cultured with LPS (1g/ml) plus actinomycin D (5 g/ml) or vehicle. After 2 hours treatment the cells were harvested and the IL-10 mRNA levels relative to GAPDH mRNA were determined by RT-PCR. (B) Actinomycin D or vehicle were added to the media 2 hours after LPS treatment of PEM that had been cultured with (black squares)or without flagellin (without squares). Cells were harvested 2,4 and 6 hours after actinomycin D addition and the IL-10 mRNA levels relative to GAPDH mRNA were determined by RT-PCR. Shown is a representative experiment of two independent experiments with similar results

PAGE 67

52 Flagellin stimulation decreases ERK activation by LPS in macrophages A general outcome upon TLR engageme nt is the activation of the NF B and the mitogen-activated protein kinase (MAPK) signaling pa thways. Among the MAPKs, several studies have linked the extracellular signal regulated kinase s (ERKs) with IL-10 regulation by TLRs. These studies found that IL-10 induction by different TLRs depends on ERK activation (154-158). In order to assess if flagellin stimula tion would affect LPSinduced ERK phosphorylation we treated PEM with flagellin or media followed by LPS stimulation. Since signifi cant changes in the LPS-induced IL-10 mRNA levels are detected in flagellin-treate d macrophages at 2 hours stimul ation with LPS (Figure 15A) we decided to quantify ERK phosphorylation at earlier time points (30 and 60 minutes). Interestingly, LPS-induced phosphorylated ERK 1/2 levels were signi ficantly reduced in flagellin-treated macrophages as compared with media-treated m acrophages (Figure 19). This result suggests that decrea sed ERK activation could play a role in flagellin-mediated IL-10 inhibition. NF B activation plays a central role in inducing the expression of proinflammatory mediators by TLRs. In resting cells NF B is sequestered in the cytoplasm by molecules known as inhibitor of nuclear factorB (I B). Phosphorylation of I B results in its degradation and in the release of NF B that now can translocate to the nucleus and activate its target genes (62) Macrophages treated with flagellin or LPS alone showed increased I B phosphorylation suggesting that treatment with these TLR ligands results in NF B activation. As seen in Figure 19, flagellin treatment in combination with LPS did not result in decreased p-I B levels as compared with cells treated with LPS alone. Thes e data suggest that the NF B activation by LPS is not

PAGE 68

-/-F/-F/L-/L-/-F/-F/L-/L 30 minutes60 minutesp-ERK 1/2p-IBERK 1/2FIGURE 19. Flagellin treatment decreases ERK activation by LPS in macrophagesPEM were cultured with 5g/ml flagellin (F/) or just media for 3 hours (-/) followed by the addition of 1 g/ml LPS (/L). Cells were harvested 30 minutes and 1 hour after LPS addition. Whole-cell lysates were obtained and subjected to SDS-PAGE immunoblotting with the indicated antibodies. Unphosphorylated ERK 1/2 was used as loading control. Shown is a representative experiment of two independent experiments with similar results.affected by flagellin treatment and therefore is not involved in flagellin-induced IL-10 inhibition 53

PAGE 69

200160120804002 hours4 hours 200160120804002 hours4 hours ratio treated/untreatedratio treated/untreated-/LPSF/LPS ABIL-12p40 mRNAIL-12p35 mRNAF/p<0.01 p<0.001p<0.001FIGURE 20. Flagellin-stimulated PEM produce higher levels of IL-12p35 and IL-12p40 mRNAs in response to LPS. (A-B) PEM were cultured with 5 g/ml flagellin (F) for three hours. Then supernatants were removed and media (-) was added (F/-, white bars). In parallel, PEM were cultured with media alone (-) for three hours and then LPS was added (-/LPS, gray bar). A third group consisted of PEM pretreated with flagellin (F) for three hours and then stimulated with LPS (F/LPS, black bar). Cells were harvested at the indicated time points after the addition of LPS and the levels of IL-12p40 (A) and IL-12p35 mRNA (B) relative to GAPDH were determined by quantitative RT-PCR. Shown is a representative experiment of four independent experiments with similar results. Statistical analysis was performed using t-test.54Flagellin enhances IL-12 production in response LPS To further confirm the data suggesting that a short pretreatment with flagellin results in enhanced IL-12 production by LPS (Figure 14), we determined the IL-12 p40/ IL-12 p35 mRNA levels in macrophages treated with flagellin and LPS (Figure 20).

PAGE 70

55 Flagellin pretreatment increased the leve l of IL-12p40 mRNA in response to LPS stimulation for two hours (Figure 20A, black bar-2 hours). This increase is short-lived since at 4 hours IL-12p40 mRNA levels were back to those observed in PEM treated with LPS alone (Figure 20A4 hours). In additi on, an increase in IL-12p35 mRNA levels was observed in PEM treated with flagellin and subsequently stimulated with LPS (F/LPS: black bars) (Figure 14B). The response dura tion was longer than the one observed for IL12p40 mRNA induction, since enhanced leve ls of IL-12p35 mRNA were still observed after 4 hours of exposure to LPS (Figure 20B-4 hours). The biologically active form of the cytoki ne IL-12 is a heter odimer composed of the IL-12 p40 and p35 proteins and known as IL-12 p70 (94). IL-12 p40 has been reported to be produced in excess over IL-12p35 which acts as a limiting factor for IL-12 p70 production (96). Therefore, an increas e in IL-12 p35 might resu lt in elevated IL-12 p70 protein production that would not be detected using standa rd ELISA methods that do not discriminate between IL-12p40 and IL-12p70 production. For this reason, we specifically analyzed IL-12p70 production by PE M pretreated with flagellin followed by LPS. As shown in Figure 21, when PEM are pret reated with flagellin and then exposed to increased concentrations of LPS (black ba rs) they produced higher levels of IL-12p70 relative to PEM treated with LPS alone (wh ite bars). In summary, PEM treated with flagellin and then stimulated with LPS display enhanced expression of both IL-12p40 mRNA (Figure 20A) and IL-12p35 mRNA (Figur e 20B) as well as increased production of IL-12p70 protein (Figure 21).

PAGE 71

LPS 00.060.1250.250.5 20016012080400)lm/gp( 07p21-LIControlFlagellin 2000160012008004000MediaMedia/CpGFlagellin/CpGAB p<0.05 p< 0.0001)lm/gp( 07p21-LI(g/ml)56FIGURE 21 Flagellin-stimulated PEM produce higher levels of IL-12p70 in response to TLR4 ligands. PEM were cultured with media alone (open bar) or with flagellin 5 g/ml (black bar) for 3 hours. Then, PEM were treated with increasing concentrations of LPS. IL-12 p70 was quantified as in Figure 22. Shown is a representative experiment of three with similar resultsFIGURE 22 Flagellin-stimulated PEM produce higher levels of IL-12p70 in response to TLR9 ligands. PEM were cultured with media alone (open bar) or with flagellin 5 g/ml (black bar) for 3 hours. Then, PEM were treated with 0.25 M CpG. Supernatants were collected after 24 hours and IL-12 p70 levels were determined by ELISA. Data represent mean s.d. of triplicate cultures. Shown is a representative experiment of three with similar results. Flagellin enhances IL-12p70 production in response to CpG To determine whether flagellin-mediated enhancement of IL-12p70 production occurs only in response to LPS-stimulation or could also be observed in response to other TLR ligands, PEM were treated with flagellin in combination with either zymosan or CpG. While treatment with flagellin did not enhance IL-12p70 production in response to zymosan that remained undetectable (data not shown), a significant increase in IL-12p70 production was observed when PEM were treated with flagellin and CpG (Figure 22). Statistical analysis used was t-test

PAGE 72

01002003004005006007000100 ng/ml1 g/ml10 g/ml IL-12 p70 (pg/ml) MEDIA LPS IL-10 blocking antibody (cc)FIGURE 23. IL-10 blockage increases IL-12p70 production by LPS-stimulated macrophagesMacrophages were cultured with LPS (1 g/ml) (black squares) or media alone (white bars) plus IL-10 blocking antibody at the indicated concentration. After 24 hours culture the supernatants were harvested and IL-12 p70 production quantified by ELISA. These results (Figure 21 and 22) indicate that ligation of TLR5 in macrophages influences the inflammatory response of these cells to TLR4 and TLR9 ligands (LPS and CpG) resulting in enhanced production of the proinflammatory mediator IL-12p70. Blocking IL-10 increases IL-12p70 production by LPS-stimulated macrophages IL-10 has been shown to act as a powerful inhibitor of IL-12 production (107-108). Therefore, in the next experiment we assessed if blocking IL-10 signaling would enhance IL-12p70 production by LPS-treated PEM (Figure 23). 57

PAGE 73

Incubating the cells with increasing amounts of IL-10 blocking antibody increases IL-12 p70 production in a dose dependent manner (Figure 23). This result indicates that IL-10 repression by flagellin could be, at least in part, responsible for the increase in IL-12 p70 production observed in macrophages treated with flagellin in combination with LPS. Nonetheless, other mechanisms must be also playing a role since enhanced IL-12 p70 production was observed in macrophages treated with a combination of flagellin and CpG even when on those cells IL-10 production was not affected by flagellin stimulation (Figure 16).Flagellin elicits CD4+ T-cell activation in a tolerogenic setting in vivo In previous studies we have shown that APCs that produce significant levels of IL-12 in the absence of the inhibitory cytokine IL-10 effectively prime nave antigen-specific CD4+ T-cells and are capable of restoring the responsiveness of tolerized CD4+ T-cells (141). This finding, along with our data demonstrating that flagellin-treated APCs produce IL-12 but not IL-10, led us to explore whether treatment with this TLR-ligand could overcome antigen-specific CD4+ T-cell tolerance in vivo. Day 0Day +2Day +15Anti-HACD4+T-cells HA-peptideAnalysis58FIGURE 24. High dose peptide model of antigen-specific CD4+ Tcell tolerance (I)

PAGE 74

59 To answer this question, we followed th e experimental design outlined in Figure 24. Briefly, 2.5x10 6 nave CD4 + T-cells specific for a MHC cl ass II-restricted epitope of influenza hemagglutinin (HA) were adoptively transferred intrav enously (iv) into BALB/c mice. Twenty-four hours later, mice were given iv a tolerogenic dose of HApeptide (200 g), a combination of HA-peptide together with flagellin (10 g), or left untreated. Two weeks later, all the mice were sacrificed and the splenocytes harvested. Previous studies have shown that antigen encounter by clonotypic CD4 + T-cells in mice treated with a high dose of their cognate antigen leads to progressive T-cell deletion (159160). Indeed, as shown in Figure 25, in those mice treated with high dose HA-peptide, we observed a dramatic decrease in the percent of clonotypic CD4 + T-cells (0.34% in HApeptide treated mice versus 1.02% in untreated mice). Such a decrease in clonotypic Tcells was prevented however in mice treated with tolerogenic dose of HA-peptide plus flagellin (Figure 25A). Assessment of cyt okine production by clonotypi c T-cells isolated from the different experimental groups al so showed important differences. While treatment with high dose HA-peptide resulted in slight decrease in the production of IFNby clonotypic T-cells isolat ed from these mice relative to the untreated group, the opposite outcome was observed in mice treated with a high dose of peptide together with flagellin. Clonotypic T-cells from thes e mice produced higher levels of IFNin response to restimulation with cognate antigen, indicating that they have been primed in vivo in response to an otherwise toleroge nic dose of peptide (Figure 25B)

PAGE 75

0 50 100 150 200 250 IFN-(pg/ml)UntreatedHA peptideHA + FlagellinAB 100101102103104 100101102103104 1.02 100101102103104 100101102103104 0.34 100101102103104 100101102103104 0.96 UntreatedHA peptideHA + Flagellin6.5 PECD4 FITCFIGURE 25. Flagellin elicits CD4+ T-cell activation in a tolerogenic setting (I). BALB/c mice received 2.5 x 10 anti-HA TCR+ transgenic CD4+ T cells iv Twenty-four hours later mice were left untreated, given HA-peptide (200 g/iv) alone or HA peptide (200 g/iv) in combination with flagellin (10 g/iv). Two weeks later mice were sacrificed and T cells were purified from their spleens as described in Methods. (A) Shows two-color FACS analysis of splenocytes from one animal in each experimental group (each consisted of four animals). Upper right quadrant numbers represent the percentage of double positive CD4+ Tcells. (B) Purified T-cells from untreated mice or mice treated with high dose HA-peptide in vivo or HA-peptide plus flagellin were restimulated with HA-peptide (12.5 g/ml) in vitro for 48 hours. Each dot represents an animal and the bar represents the groups average. Shown is a representative experiment of three independent experiments with similar results. Data is expressed as the amount of cytokine produced by 100 clonotype+ T cells/well. 606

PAGE 76

In this model of antigen-specific T-cell tolerance we have also demonstrated that anergic anti-HA CD4+ T-cells are unable to respond to inflammatory stimuli provided by a recombinant vaccinia virus encoding HA (vaccHA). Therefore, in our next experiment we asked whether flagellin treatment could change this outcome and preserve antigen-specific T-cell responsiveness to the model antigen expressed by vaccinia virus. For this experiment we followed the esperimental design outlined in Figure 26. Day 0Day +2Day +15Anti-HACD4+T-cells HA-peptideAnalysis Vacc-HADay +9 First, antigen-specific T-cells reisolated from vaccinia HA-infected mice produced significant levels of IL-2 in response to in vitro stimulation with cognate HA-peptide (Figure 27, Untreated). Clonotypic T-cells from mice treated with a tolerogenic dose of HA-peptide failed to respond to vaccHA immunization in vivo as determined by their lack of IL-2 production in response to cognate HA-peptide (Figure 27, HA peptide). In sharp contrast, flagellin treatment preserved the response to vaccination in this tolerogenic setting, since clonotypic T-cells isolated from these mice produce levels of IL-2 that are equivalent to those produced by antigen-specific T-cells from control mice (Figure 27, HA + flagellin).61Flagellin IV Day +2FIGURE 26. High dose peptide model of antigen-specific CD4+ T cell tolerance (II)

PAGE 77

020406080UntreatedHA peptideHA + FlagellinIL-2 (pg/ml)FIGURE 27. Flagellin elicits CD4+ T-cell activation in a tolerogenic setting (II).Untreated mice, mice treated with high dose HA peptide or mice that received high dose HA-peptide plus flagellin in vivo were immunized with 1x10 pfu of recombinant vaccinia encoding HA (vaccHA) on day +9 after T-cell adoptive transfer. Six days later animals were sacrificed and T-cells isolated from their spleens. Purified T cells were stimulated with HA-peptide plus fresh splenocytes for 48 hr. Supernatants were collected and assayed for IL-2 production by ELISA. Data represent mean s.d. of triplicate cultures from three mice in each group. Summarizing, in vivo treatment with flagellin converts a tolerogenic environment into an inflammatory one in which antigen-specific CD4+ T-cells not only are not deleted but are efficiently activated and capable of responding to a subsequent immunization with recombinant vaccinia encoding HA. DC differentiation in the presence of IL-10 Several studies have shown that DC differentiation in the presence of IL-10 results in the development of DCs that produce high levels of IL-10 and induce T cell anergy and regulatory T cell differentiation (143-144). DCs differentiated in these conditions have been shown to induce tolerance (144), therefore to avoid confusion between BM-DCs differentiated using different protocols, DCs differentiated with GM-CSF plus IL-4 will be called just BM-DCs and those differentiated in the presence of IL-10 will be called tolerogenic-DCs.627

PAGE 78

02004006008001000 Forward Scatter 100101102103104 CD11c APC 88.5 02004006008001000Forward Scatter 100101102103104 CD11c APC 88.9CD11c APC 100101102103104 020406080100 % of Max BM-DCsTolerogenic-DCsBM-DC iso Tolerogenic-DCs iso BM-DCs CD11c Tolerogenic-DCs CD11c ABCFIGURE 28. CD11c expression in DCs differentiated in the presence of IL-10Bone marrow cells were cultured for 7 days in the presence of GM-CSF and IL-4 (A) or GM-CSF, IL-10 and TNF(B). On day 8, loosely adherent cells were harvested by flushing the plate with ice-cold HBSS and expression of the dendritic cell specific marker CD11c quantified by FACS analysis. (C) Shows a histogram comparing the magnitude of CD11c expression in both DC subsets and the isotype control antibodies. Our first goal for the series of experiments described bellow, was to generate DCs in the presence of IL-10 and evaluate their ability to present antigen. Differentiation of DCs in the presence of the anti-inflammatory cytokine IL-10 rendered similar yield of CD11c+ cells to those obtained by standard procedures (around 90%) even when these cells are characterized by a lower expression of this marker (Figure 28).63

PAGE 79

0102103104105B7-2 020406080100 tolerogenic-DCs BM-DCs 0102103104105 020406080100 0102103104105MHC II 020406080100 ABFIGURE 29. Tolerogenic-DCs express lower levels of costimulatory molecules than BM-DCsBone marrow cells were cultured for 7 days in the presence of GM-CSF and IL-4 (BM-DCs) (shaded area) or GM-CSF, IL-10 and TNF(tolerogenic-DCs) (solid line). On day 8, loosely adherent cells were harvested by flushing the plate with ice-cold HBSS and expression of the costimulatory molecules B7-2 (A) and MHC class II (B) were quantified by FACS analysis. As previously shown by others, expression of costimulatory molecules as MHCII or B7.2 was reduced in those cells that have been differentiated in the presence of IL-10 as compared with those differentiated following a standard protocol (Figure 29).% of Max% of Max64

PAGE 80

BM-DCsor tolerogenic-DCs+Purified CD4+ CD62L+ T cells (from HA+/-mice) 7 daysRe-stimulation splenocytes +/-HA peptide CK analysis/ Proliferation analysis48h / 72h 100101102103104: CD62L FITC 100101102103104: CD4 PerCP 0.66 89 7.68 2.61FIGURE 30. T cell differentiation diagramTolerogenic-DCs induce T cell unresponsiveness in vitro. In order to compare T cell priming by tolerogenic-DCs and BM-DCs we developed a protocol for T cell priming and differentiation in vitro, summarized in Figure 3065T Cells

PAGE 81

0500010000150002000025000BM DCs tolerogenic-DCsCPM (H3 counts) 0100200300400500600BM-DCstolerogenic-DCsIFN(pg/ml)FIGURE 31. T cells differentiated using tolerogenic-DCs showed impaired responses upon antigen restimulationT cells were differentiated as in Figure 30 and their responses upon antigen restimu-lation evaluated in terms of (A) prolifera-tion (H3 incorporation) and IFN-produc-tion (B).AB Briefly, nave CD4+ T cells (CD4+ CD62L high) from HA +/mice were cultured with DCs and antigen (HA peptide) for 7 days. This period of time is enough to allow T cell differentiation. After 7 days T cells were washed and transferred to a second plate were they were restimulated with antigen and fresh splenocytes used as antigen presenting cells.Culture of nave CD4+ T cells with tolerogenic-DCs resulted in significantly lower levels of IFNproduction and proliferation relative to T cells that have been cultured with BM-DCs (Figure 31) indicating that the antigen presenting function in tolerogenic-DCs is impaired. Lower expression of MHCII and costimulatory molecules by tolerogenic-DCs could account for the deficient priming of antigen specific CD4+ T cell responses. 66

PAGE 82

020040060080010001200140016000 0.5 1 2IL-10 (pg/ml) BM-DCs LPS (g/ml) 0100002000030000400005000060000IL-12 p40/70 (pg/ml)0 0.5 1 2 LPS (g/ml)tolerogenic-DCsFIGURE 32. LPS stimulation of tolerogenic-DCs results in enhanced production of IL-10BM-DCs (white squares) or tolerogenic-DCs (black squares) were cultured in the presence of increasing concentrations of LPS (0.5, 1 and 2 g/ml). After 24 hours the supernatants were removed and IL-10 and IL-12 p40-70 quantified by ELISA LPS stimulation of tolerogenic-DCs results in enhanced production of IL-10 Cytokine induction in tolerogenic-DCs by TLR ligands has not been fully characterized but evidence in the literature suggests an increase in IL-10 production associated with a decrease in proinflammatory cytokine production (144). In Figure 32 tolerogenic-DCs or BM-DCs were treated with LPS and the production of IL-10 or IL-12p40-70 quantified after 24 hours treatment. 67AB

PAGE 83

TLR relative expression in Tolerogenic DCs02468101214161820tlr4tlr9 tlr5relative expression to BM DCsFIGURE 33. TLR5 expression is specifically enhanced in tolerogenic-DCs BM-DCs (white bars) and tolerogenic-DCs (black bars) were obtained as detailed in the materials and methods section. After harvesting the cells, RNA was isolated using Trizol reagent and the levels of TLR5, TLR4 and TLR9 were quantified by real time RT-PCR using GAPDH as an internal control. In the graph the levels of TLR expression in tolerogenic-DCs are quantified relative to the levels of expression in BM-DCs. In agreement with others (165), Figure 32B shows that tolerogenic-DCs produce much higher levels of IL-10 than BM-DCs. Nonetheless, IL-12 p40-70 production by both DC subsets was similar (Figure 32A) suggesting that the capacity to produce IL-12p40-70 was not diminished in DCs that have been exposed to IL-10 during differentiation. TLR5 expression is specifically enhanced in tolerogenic-DCs The increased capacity to produce IL-10 by tolerogenic-DCs prompted us to investigate whether they would produce this cytokine in response to flagellin. First, we evaluated their ability to respond to flagellin stimulation by measuring TLR5 expression in BM-DCs and tolerogenic-DCs using quantitative RT PCR (Figure 33). 68

PAGE 84

TLR5 mRNA00.20.40.60.811.21.41.6ratio treated/untreated DCs + media DCs + IL10 FIGURE 34. IL-10 treatment of BM-DCs does not result in TLR5 upregulationBM-DCs were differentiated as described in the materials and methods section. DCs were harvested and cultured for 24 hours in media alone (white bar) or media plus IL-10 (10 ng/ml) (black bar). After the treatment period RNA was extracted using Trizol and TLR5 expression relative to GAPDH quantified using real-time RT PCR Surprisingly, TLR5 expression was greatly enhanced in DCs differentiated in the presence of IL-10. To assess if increased TLR expression in tolerogenic-DCs was specific for TLR5 or also occurred with other TLRs we quantified TLR4 and TLR9 expression in both DCs subsets. As shown in Figure 33, TLR4 and TLR9 expression levels are similar between BM-DCs and tolerogenic-DCs suggesting that IL-10 signaling might specifically enhance TLR5 expression in DCs. IL-10 treatment of BM-DCs does not result in TLR5 upregulation DCs differentiated in the presence of IL-10 display higher levels of TLR5 expression than regular BM-DCs. To test whether a similar effect would occur when the DCs are already differentiated, we cultured BM-DCs in media alone or supplemented with IL-10. DCs were harvested 24 hours after treatment and TLR5 mRNA expression analyzed using quantitative RT-PCR (Figure 34). 69

PAGE 85

050001000015000200002500002.5510IL-12 p40/70 (pg/ml)02.5510 Flagellin (g/ml)ABFIGURE 35. Flagellin stimula-tion of tolerogenic-DCs results in enhanced production of IL-12p40-70 in the absence of IL-10BM-DCs and tolerogenic-DCs were differentiated as described in the methods section. DCs were treated with flagellin (at the indicated concentrations 2.5, 5 and 10 g/ml). After 24 hours culture the supernatants were harvested and IL-12 p40-70 (A) and IL-10 (B) production were analyzed by ELISA.(IL-10 protein production by tolerogenic-DCs stimulated with LPS (gray circles) is shown to facilitate comparison between both TLR ligands) 020040060080010001200140016000 0.5 1 2IL-10 (pg/ml)LPS (g/ml) Flagellin (g/ml) TLR5 expression levels were virtually identical in DCs treated with IL-10 or those treated with media suggesting that TLR5 expression is not enhanced by IL-10 in DCs that are completely differentiated.Flagellin stimulation of tolerogenic-DCs results in enhanced production of IL-12p40-70 in the absence of IL-10 Tolerogenic-DCs express higher levels of TLR5 mRNA than BM-DCs. In agreement flagellin-treated tolerogenic DCs produced much higher levels of IL-12p40-70 than flagellin-treated BM-DCs (Figure 35A).70

PAGE 86

71 Flagellin-stimulated DCs, both BM and to lerogenic, did not produce IL-10. IL-10 production by tolerogenic-DCs plays a f undamental role in regulatory T cell differentiation and inhibition of antigen-specifi c T cells (38) (144). Therefore, regulatory T cell differentiation and inhibition of antig en-specific T cells should not occur when tolerogenic-DCs are activated with flagel lin since there is no production of IL-10. LPS-treated tolerogenic-DCs but not flagell in-treated tolerogenic-DCs induce T cells that produce high levels of IL-10 The differences in cytokine prod uction encountered among BM-DCs and tolerogenic-DCs prompted us to investigate how they coul d affect CD4+ T cell priming and differentiation. Dendritic cell maturation and T cell priming and restimulation were carried out as detailed in Figure 30. Briefly, BM-D Cs or tolerogenic-DCs were cultured for 24 hours in the presence of LPS, flagellin or just media. At this time supernatants were collected and the cells were washed be fore adding fresh media, antigen and nave antigen-specific transgenic T cells. Antigen restimulation of T cells that have been differentiated in the presence of BM-DCs resulted in production of IFN, IL-10 and IL4. Effector T cells with a Th1 phenotype produce IFNwhile IL-10 and IL-4 are produced by Th2 cells. Therefore, our data suggest that Th1 as well as Th2 cells are obtained when the APCs used are LPSor flagellin-matured BM-DCs (Figure 36)

PAGE 87

040008000120001600020000IFN(pg/ml) 01000200030004000IL-10 (pg/ml) 0100020003000MediaLPSFlagellinIL-4 (pg/ml)MediaLPSFlagellinMediaLPSFlagellinFIGURE 36. T cells cultured with BM-DCs produce Th1 and Th2 cytokinesBM-DCs were matured with LPS (1g/ml) or flagellin (5g/ml) and used to prime nave CD4+ T cells as indicated in Figure 30. Supernatants were collected after 48 hours of T cell restimulation and analyzed by ELISA to detect IFN-, IL-4 or IL-10 production.72HA+HAHA+HAHA+HAHA+HAHA+HAHA+HA-

PAGE 88

040008000120001600020000 01000200030004000 HA+ HA0100020003000HA+HAHA+ HA-MediaLPSFlagellinMediaLPSFlagellinMediaLPSFlagellinFIGURE 37. LPS-treated but not flagellin-treated tolerogenic-DCs induce T cells that produce high levels of IL-10BM-DCs or tolerogenic-DCs were matured with LPS (1g/ml) or flagellin (5g/ml) and used to prime nave CD4+ T cells as indicated in Figure 30. Supernatants were collected after 48 hours of T cell restimulation and analyzed by ELISA to detect IFN-, IL-4 or IL-10 production. 73IFN(pg/ml)IL-10 (pg/ml)IL-4 (pg/ml) Interestingly, antigen presentation by LPS-activated tolerogenic-DCs resulted in the differentiation of T cells that produce IFN-, very low levels of IL-4 and high levels of IL-10 (Figure 37).

PAGE 89

74 On the contrary, T cells that encounter antigen in flagellin-activated tolerogenicDCs are primed to produce IFNbut not IL-10 or IL-4. Taken together, our data indicates that antigen presentation by LPS-matured tolerogenic-DCs results in the differentiation of T cells with the potential to suppress the imm une response as they produce high levels of IL-10. This outcome was not observed when T cells were primed with flagellin-matured tolerogenic-DCs as T cells differentiated this way seem to have a typical Th1 phenotype. Flagellin-expressing B78-H1 cells i nduce IL-12p40-70 production by PEM As shown by our data and by others flagellin might function as an adjuvant to induce inflammation in toleroge nic environments as the gut (79), lungs (83) and of important relevance for our studies in the tumor microenvironment. A good strategy to administer flagellin with a therapeutic purpos e would be flagellin-expressing tumor cells. Using these cells as a vaccine would ensure a continuous release of flagellin (as long as the cells would live inside the host). Furthermore, the flagellin produced by these cells would be free of bacterial produc ts such as LPS that are hi ghly toxic. To explore this possibility, we constructed a flagellin-expressing cell us ing the murine melanoma cell line B78-H1. This cell line does not express MHC class I antigens or class II molecules (163) so it does not raise strong alloresponses against the MHC class antigens. A strong alloresponse would divert the immune system from the antigens of therapeutic interest, and it may also rapidly eliminate the flagellin-expressing cell from the host. We transfected B78-H1 cells with a construct expressing the fliC gene from S.typhimurium as described in the methods section. Figure 38A shows that flagellin production can be detected in fliC transfecte d cells using a monoclonal antib ody. Furthermore lysates from

PAGE 90

050100150200250HBSSWT FLAGIL12p40/70 (pg/ml) WTFLAGFIGURE 38. Flagellin-expressing cells stimulate production of IL-12p40-70 by PEM(A) shows the production of flagellin by B78-H1cells transfected with a construct expressing the fliC gene from S.typhimurium as assessed by western blot using a monoclonal antibody against flagellin. (B) shows the production of ILp40-p70 cytokine by PEM upon 24 hours of treatment with lysates from B78-H1cells transfected (FLAG) or untransfected (WT) with the fliC expressing construct. HBSS shows the results from vehicle-treated PEMs.ABfliC expressing cells induce IL-12p40-70 production by PEM more than twice as effectively as the wild-type, untransfected cell (Figure 38B).75

PAGE 91

76 These results provide the basis for the future development of a tumor-cell based vaccine to be used first in experimental m odels (to assess efficacy and side effects) and ultimately as an immunotherapeutic strategy to treat cancer patients.

PAGE 92

77 DISCUSSION In this study we found that flagellin, the TLR5 ligand does not induce IL-10 protein production either in vitro or in vivo. This occurs in contrast to other TLR ligands tested by us and others that induced produc tion of this anti-inf lammatory cytokine. Therefore, our results unveil a distinctive feature of flag ellin relative to other TLR ligands. In addition, flagelli n modifies the response elicited by specific TLR ligands by inhibiting IL-10 and/or increasing IL-12p70 production in macrophages. Immune cells specifically macrophages and dendritic cells display a broad repertoire of TLRs. Furthermore, different TLR ligands (PAMPs) are often expressed within one microorganism. These features suggest that pathogen recognition in vivo involves more than one TLR and imply that the final cellula r output will arise from the combination of several specific responses. Co mbined activation of APCs with different PAMPs has shown that specific TLRs synerg ize resulting in increased production of specific cytokines, mainly IL-12p70 and IL-23 (164-165). The mechanism by which stimulation with selected TLR pairs results in increase induction of certain genes remains to be established. One possibility could be that this increase is due to the activation of a novel signaling pathway/s not activated by engagement of a single TLR. Other explanation would be that more sustai ned signaling occurs when TLRs act in combination.

PAGE 93

78 Making the portrayal of pathogen recogni tion even more complex certain TLRs (TLRs 1, 2, 4, 5 and 6) are present on the cell surface while others (TLRs 3, 7, 8 and 9) are restricted to intracellular compartments (47-48). Recognition of PAMPs by TLRs in different cellular compartments probably a ffects the dynamics of engagement of the different ligands resulting in stimulation of surface receptors earlier than intracellular receptors. In summary, detection of microorganisms by APCs probably involves activation of several TLRs that will occu r simultaneously of sequentially depending on their cellular location Little is known whether signaling through a TLR may result in the suppression of a specific cytokine or signaling pathway. To our knowledge, this work represents the first evidence that flagellin specifically suppresses IL-10 production by macrophages in response to other TLR ligands. IL-10 inhibi tion by flagellin does not affect all TLR ligands and seems to be rather selective. Our results show that flagellins engagement to the membrane receptor TLR5 decreases IL10 production in response to ligands whose receptors are also in the cellular membrane such as TLR4 or TLR2/6 (47). In contrast, flagellin does not decrease IL-10 production in response to a ligand (CpG) that binds to an intracellular receptor (TLR9) (48). These findings suggest that some degree of TLR colocalization might be needed for flagellin-mediated IL-10 suppression. Also our data showing that CpG-induced IL-10 production is dramatically reduced in macrophages treated with flagellin-coated beads as compared to those treated with control beads provide some support to this possibility. After ligand binding, TLRs dimerize a nd recruit TIR-containing adaptor molecules to the TIR domain of the TLR ( 62). Although TLRs have been fundamentally

PAGE 94

79 described to work as homodimers, the exis tence of TLR heterodimers has also been reported (46). TLR2 has been shown to interact with TLR1 and TLR6 to form heterodimers that play an important role in the recognition of bacterial and yeast wall components (166). Recently, TLR5 has been show n to dimerize with TLR4 in flagellintreated macrophages (167). If TLR5 is able to form heterodimers with TLRs that colocalize with it, then specific adaptor mol ecules recruited to the TLR5 intracellular domain might influence their responses. However, if TLR colocalization and/or dimerization with TLR5 are required for IL-10 inhibition in response to flagellin remains undetermined. The mechanism(s) by which flagellin inhi bits IL-10 production are not elucidated yet. However, the finding that flagellin-tr eated macrophages display a transient and shortlived expression of IL-10 mR NA along with the decrease in IL-10 mRNA observed when macrophages are treated with flagellin and LPS suggest that the suppression occurs at the IL-10 gene transcriptional level and/or IL-10 mRNA stabil ity. We did not find differences in the stability of IL-10mRNA in macrophages trea ted with LPS alone or with LPS plus flagellin, what might indicate that the mechanism of suppression operates at the transcriptional level of the IL-10 gene. The use of specific MAPKs inhibitors a nd studies in mice deficient in MAPK phosphatases have shown significant altera tions on the cytokine profile induced by different TLRs (168-169) indicating th at MAPKs activity re gulates TLR-induced cytokine production. ERK, a MAPK family member, have been shown to play an important role in the induction of IL-10 by LPS (154) and other TLR ligands (155-157) but not in the production of other cytokine s such as IL-12 (158). Recent evidence

PAGE 95

80 indicates that ERK might be involved in chromatin remodeli ng of the IL-10 promoter in macrophages in order to allow binding of tran scription factors and ge ne expression (126). In our study we report that ERK activation by LPS is significantly impaired in flagellintreated macrophages. These data suggests that flagellin might inhibit IL-10 production through impairing ERK activation by other TLR ligands. Nonetheless, further experiments need to be done in order to confirm the role of the ERK signaling pathway and the potential contribu tion of other pathways. Furthermore, LPS-induced phosphorylation of I B was not altered in flagellin-tre ated macrophages suggesting that the NF B pathway is not involved in the nega tive regulation of IL-10 observed in flagellin-treated macrophages. Since NFkB is a master regulator of TLR mediated cytokine induction, our data indicating that activation of this pathway by LPS is not affected in flagellin-treated macrophages suppo rts that TLR5 engagement is not affecting the global immune response elicited by other TL Rs but targeting specific pathways. We observed that flagellin enhances the production of IL-12p70 by macrophages in response to other TLR ligands such as L PS or CpG. Given the previous demonstration (107-108) (and also in our data) that IL -10 is a powerful inhibitor of IL-12p70 production one possible explanation for our findings is that flag ellin enhances IL-12p70 by inhibiting IL-10. However, this assu mption might not be the only explanation. Treatment of macrophages with flagellin an d CpG resulted in increased IL-12p70 production, but it was not accompanied by inhibition of IL-10. Therefore, the inhibitory effect of flagellin on IL-10 and its abi lity to enhance IL-12p70 production might be independent from each other and mediated by different mechanisms.

PAGE 96

81 Overall our findings suggest a potential scen ario in which the ability of flagellin to inhibit IL-10 could facil itate the induction of inflammatory responses by flagellated bacteria. This effect would be particularly impor tant in organs such as colon and lungs. In these organs immune responses are tightly re gulated mainly by the production of IL-10 to avoid inflammation caused by commensal mi croorganisms (170-171) (88). Furthermore, flagellin has been shown to play a central role in inducing inflammatory responses in lungs and gut (80) (83) (172). Our data support that in the absence of flagellin, IL-10 would be produced in response to other TLR ligands such as LPS that is also expressed by flagellated bacteria. In this scenario, it is likely that th e inhibitory e ffects of IL-10 would prevail and lead to mi nimum or none inflammatory re sponse. Conversely, in the presence of flagellin and its IL-10 inhibitory effects, proinflammatory pathways (i.e. IL12) triggered by flagellin itself or other TLR-ligands would unleash stronger inflammatory responses. Interestingly, enhanced inflammation might favor systemic dissemination of flagellated bacteria (173). Th is concept is supported by recent studies in mice with genetic disruption of TLR5 (79). In these mice, it was predicted that if the main effect of flagellins recognition by TLR5 is to induce hosts protective inflammatory responses then the absence of TLR5 would lead to increased susceptibility to infection by flagellated microorganisms. At odds with this pred iction, TLR5 -/mice were found to be less susceptible to system ic infection following oral challenge with S almonella typhimurium (79). Given our results, it is pos sible that in the absence of flagellin-TLR5 interaction, IL-10 would continue to be produced in response to other TLR ligands. In this case, resistance rather th an susceptibility will be the outcome due to

PAGE 97

82 the inability of the bacteria to induce infl ammation, not as a protective mechanism but as a mechanism to facilitate its systemic dissemination. Therefore, for the first time our studies s how the effect of a TLR ligand inhibiting the production of a specific cytokine. Furt hermore, the observation that flagellin specifically suppresses IL-10 production in response to sele cted TLR ligands provides a potential explanation to how TLR5 might shape the inflamma tory responses elicited by flagellated pathogens. Studies coming from Grouxs group ( 144) among others have shown that differentiation of bone marrow derived DCs in th e presence of IL-10 results in cells with increased ability to produce IL-10. These cells (tolerogenic-DCs) in our hands responded in a similar way producing much higher leve ls of IL-10 than regular BM-DCs upon LPS stimulation. As observed before in vivo and also in macrophages, flagellin treatment of BM-DCs or tolerogenic-DCs did not result in IL-10 protein produc tion. Surprisingly, flagellin-treatment of tolerogenic-DCs resu lted in much higher levels of IL-12 p40-70 production than treatment of BM-DCs. One possible explanation for this result could come from the differences in TLR5 expres sion among these DC subsets, as TLR5 mRNA was much more abundant in tolerogenicDCs than in BM-DCs. Interestingly, TLR5 expression might be specifically enhanced in tolerogenic-DCs since a similar increase in expression was not observed in other TLRs such as TLR4 or TLR9. Based on the fact that the major difference between both subset s has been the exposure or not to IL-10, we explored the possibility that IL-10 treatment of DCs would result in increase expression of TLR5 mRNA. In our experiments treatment of differentiated BM-DCs with IL-10 did not induce any changes in TLR5 expression. This result indicate that IL-10 might

PAGE 98

83 enhance TLR5 expression in non-differentiated cells but not in fully differentiated DCs or perhaps a longer exposure to IL-10 might be needed. IL-10 production by APCs has been show n to induce differentiation of regulatory T cells that produce high levels of IL-10 and limit inflammation (38). Based on this evidence we could hypothesize that antig en presentation by flagellin-matured tolerogenic-DCs would not resu lt in regulatory T cell differen tiation. In order to verify this hypothesis we decided to differentiate nave CD4+ T cells in vitro using tolerogenicDCs treated with flagellin or LPS and analyze their re sponses upon restimulation. Nave CD4+ T cells primed with flagellin or LPS-activated BM-DCs produced IFN, IL-4 and IL-10. IFNis a hallmark of Th1 differentiation while IL-4 in combination with IL-10 is produced by Th2 cells. The presence of these cytokines might indicate that Th1 and Th2 cells are induced by activated BM-DCs. T cells differentiated by tolerogenic-DCs showed a different phenotype when the DCs were tr eated with LPS or flagellin. LPS-treated tolerogenic-DCs induced T cells that produced IFN, IL-10 and very low levels of IL-4. Differentiation of T cells with this same phenotype has already been described by Roncarolos group (161) when antigen presenta tion occurred in the presence of IL-10. In their study in order to assess if T cells differentiated in the presence of IL-10 had a regulatory/suppressor phenotype they explor ed the ability of these cells to block inflammatory responses using an inflammatory bowel disease model (IBD). In this model transfer of CD45RBhigh (nave ) CD4+ T cells into SCID mice, mice that lack T and B cells, induces the development of IBD that result s in colitis and weight lost. Cotransfer of IL-10 producing T cells toge ther with CD45RB high CD4+ T cells prevented colitis development and weight lost indicating that T cells differentiated in the presence of IL-10

PAGE 99

84 display regulatory properties. Due to their regulatory properties IL -10 producing T cells are commonly denominated IL-10 secreting t ype 1 regulatory T cells (Tr1) (38). Tr1 differentiation might be abrogated when flag ellin-treated tolerogenic-DCs act as APCs since T cells differentiated in these conditions did not produce IL10 upon restimulation. T cells differentiated with flagellin-treated tolerogenic-DCs produced IFNbut very low levels of IL-4 and IL-10 suggesting that the dominant response elicited has a Th1 character. In summary, our results might indicate that antigen presentation by tolerogenicDCs activated with LPS results in nave T cell differentiation into Tr1 cells meanwhile flagellin-treated tolerogenic-DCs induce Th1 differentiation. Tr1 differentiation has been shown to be dependent on IL-10 (174) that se ems to act on the APC and not directly over the T cell (119-121) (175). This evidence suggests that the differences in T cell differentiation between flagellin-treated a nd LPS-treated tolerogenic-DCs might be mainly due to the production or not of IL-10 by the APC. Our data supports that the use of flagellin or other TLR5 agonists as adjuvant in situations associated with the presence of high levels of IL-10 would be specially indicated. In contrast the use of other TLR ligands could result in enhanced suppression of immune responses through the expansion of T cells with a regulatory phenotype. IL-10 production can be dete cted at steady conditions in gut and lungs (170) (176) where it plays a fundamental role in the pr evention of anti-microbial responses (135). Interestingly, analysis of the TLR5 expression levels in different murine tissues have found the highest expression in the gut (79) an evidence th at supports our data suggesting that exposure to IL-10 increases TLR5 expression.

PAGE 100

85 IL-10 signaling in the mucosa is likely to affect DCs in a similar way as seen in our in vitro experiments. In fact DCs from the gut but not from the spleen produce high levels of IL-10 upon stimulation with CD 40 and microbial products (88). A similar phenomenon might also be occurring in th e lungs, since pulmonary DCs produce IL-10 and have been shown to induce Tr1 devel opment and antigen specific T cell tolerance (171). Furthermore, IL-10 has been also de tected in many tumors produced by tumor cells or immune cells recruited to the tumor site (121). The presence of IL-10 in the tumor environment has been linked with th e generation of regulatory T cells (38). Furthermore, in a recent study exploring the phenotype of tumor infiltrating DCs (TIDC) using different carcinoma mode ls (mammary, liver lung a nd colon) these cells were characterized as having low expression leve ls of costimulatory molecules (CD86 and CD40) and hyporesponsiveness to maturating stim uli. Interestingly, in order to induce maturation of TIDC using CpG (TLR9 ligand) in vivo, CpG should be administered along with IL-10 blocking antibodies bringing even more evidence of the suppressive role of IL-10 on TIDCs (177). This evidence points towards a similar phenotype between TIDCs and tolerogenic-DCs as IL-10 might be acting as the shaping agent in both situations. A question that remains to be answered in order to use TLR5 agonists to activate TIDCs would be if the degree of differentia tion at which TIDCs are exposed to IL-10 could make a difference in their ability to express TLR5. Our data suggest that IL-10 might enhance TLR5 expression in DCs goi ng through the differentiation proccess but not in those that are fully differentiated. N onetheless, DC precursors circulate in the

PAGE 101

86 blood and they have been shown to be recr uited to the tumor environment (178) where exposure to IL-10 might result in increase of TLR5 expression In summary, our study supports that stimula tion of TLR5 might play an important role in counteracting the anti -inflammatory effects of IL-10. TLR5 engagement limits the production of IL-10 by innate immune cells. Furthermore it abrogates the differentiation of IL-10 producing T cells that otherwise dom inate the immune response in IL-10 rich environments. Further studies will explore the flagellin-based vaccine we have created in our laboratory. The finding that flagellin can prime T cell responses in tolerogenic situations supports the use of this novel strategy to overc ome tolerance to tumor antigens, a barrier that we need to remove if we want to effectively harness antitumor immune responses

PAGE 102

87 REFERENCES 1. Guermonprez, P., J. Valladeau, L. Zitvogel, C. Thery, and S. Amigorena. 2002. Antigen presentation and T cell stimulation by dendritic cells. Annual review of immunology 20:621-667. 2. Steinman, R. M., D. Hawiger, and M. C. Nussenzweig. 2003. To lerogenic dendritic cells. Annual review of immunology 21:685-711. 3. Huang, F. P., N. Platt, M. Wykes, J. R. Majo r, T. J. Powell, C. D. Jenkins, and G. G. MacPherson. 2000. A discrete subpopulatio n of dendritic cells transports apoptotic intestinal epithelia l cells to T cell areas of mesenteric lymph nodes [see comments]. The Journal of experimental medicine 191:435-444. 4. Munn, D. H., M. D. Sharma, J. R. Lee, K. G. Jhaver, T. S. Johnson, D. B. Keskin, B. Marshall, P. Chandler, S. J. Antonia, R. Burgess, C. L. Slingluff, Jr., and A. L. Mellor. 2002. Potential regul atory function of human de ndritic cells expressing indoleamine 2,3-dioxygenase. Science (New York, N.Y 297:1867-1870. 5. Scheinecker, C., R. McHugh, E. M. Sh evach, and R. N. Germain. 2002. Constitutive presentation of a natural tissue autoantig en exclusively by dendritic cells in the draining lymph node. The Journal of experimental medicine 196:1079-1090. 6. Belz, G. T., G. M. Behrens, C. M. Smith, J. F. Miller, C. Jones, K. Lejon, C. G. Fathman, S. N. Mueller, K. Shortman, F. R. Carbone, and W. R. Heath. 2002. The CD8alpha(+) dendritic cell is responsible for inducing peri pheral self-tolerance to tissue-associated antigens. The Journal of experimental medicine 196:1099-1104. 7. Miyazaki, T., G. Suzuki, and K. Yamamu ra. 1993. The role of macrophages in antigen presentation and T cell tolerance. International immunology 5:1023-1033. 8. Watson, G. A., and D. M. Lopez. 1995. Abe rrant antigen presentation by macrophages from tumor-bearing mice is involved in the down-regulation of their T cell responses. J Immunol 155:3124-3134. 9. Ronchetti, A., P. Rovere, G. Iezzi, G. Galati, S. Heltai, M. P. Protti, M. P. Garancini, A. A. Manfredi, C. Rugarli, and M. Bell one. 1999. Immunogenici ty of apoptotic cells in vivo: role of antigen load, antigen-presenting ce lls, and cytokines. J Immunol 163:130-136.

PAGE 103

88 10. Ronchese, F., and B. Hausmann. 1993. B ly mphocytes in vivo fail to prime naive T cells but can stimulate antig en-experienced T lymphocytes. The Journal of experimental medicine 177:679-690. 11. Lassila, O., O. Vainio, and P. Matzinger. 1988. Can B cells turn on virgin T cells? Nature 334:253-255. 12. Fuchs, E. J., and P. Matz inger. 1992. B cells turn off virgin but not memory T cells. Science (New York, N.Y 258:1156-1159. 13. Heath, W. R., G. T. Belz, G. M. Behrens, C. M. Smith, S. P. Forehan, I. A. Parish, G. M. Davey, N. S. Wilson, F. R. Carbone, and J. A. Villadangos. 2004. Crosspresentation, dendritic cell subsets, a nd the generation of immunity to cellular antigens. Immunological reviews 199:9-26. 14. Itano, A. A., and M. K. Jenkins. 2003. Antigen presentation to na ive CD4 T cells in the lymph node. Nature immunology 4:733-739. 15. Adler, A. J., D. W. Marsh, G. S. Yochum J. L. Guzzo, A. Nigam, W. G. Nelson, and D. M. Pardoll. 1998. CD4(+) T cell tole rance to parenchymal self-antigens requires presentation by bone marrow-derive d antigen-presenting cells [In Process Citation]. The Journal of experimental medicine 187:1555-1564. 16. Kurts, C., F. R. Carbone, M. Barnden, E. Blanas, J. Allison, W. R. Heath, and J. F. Miller. 1997. CD4+ T cell help impairs CD8+ T cell deletion induced by crosspresentation of self-antig ens and favors autoimmunity. The Journal of experimental medicine 186:2057-2062. 17. Steinman, R. M., S. Turley, I. Mellman, and K. Inaba. 2000. The induction of tolerance by dendritic cells that have captured apoptotic cells [comment]. The Journal of experi mental medicine 191:411-416. 18. Sotomayor, E. M., I. Borrello, and H. I. Levitsky. 1996. Tolerance and cancer: a critical issue in tumor immunology. Crit Rev Oncog 7:433-456. 19. Bogen, B. 1996. Peripheral T cell tolerance as a tumor escape mechanism: deletion of CD4+ T cells specific for a monoclonal immunoglobulin idiotype secreted by a plasmacytoma. European journal of immunology 26:2671-2679. 20. Staveley-O' Carroll, K., E. Sotomayor, J. Montgomery, I. Borrello, L. Hwang, S. Fein, D. Pardoll, and H. Levitsky. 1998. Induction of antigen-specific T cell anergy: An early event in the course of tumor progression. Proceedings of the National Academy of Sciences of th e United States of America 95:1178-1183.

PAGE 104

89 21. Cuenca, A., F. Cheng, H. Wang, J. Brayer, P. Horna, L. Gu, H. Bien, I. M. Borrello, H. I. Levitsky, and E. M. Sotomayor. 2003. Extra-lymphatic solid tumor growth is not immunologically ignored and results in early induction of antigen-specific Tcell anergy: dominant role of cross-tolerance to tumor antigens. Cancer Res 63:9007-9015. 22. Morgan, D. J., H. T. Kreuwel, S. Fleck, H. I. Levitsky, D. M. Pardoll, and L. A. Sherman. 1998. Activation of low avidity CTL specific for a self epitope results in tumor rejection but not autoimmunity. J Immunol 160:643-651. 23. Overwijk, W. W., M. R. Theoret, S. E. Finke lstein, D. R. Surman, L. A. de Jong, F. A. Vyth-Dreese, T. A. Dellemijn, P. A. Ant ony, P. J. Spiess, D. C. Palmer, D. M. Heimann, C. A. Klebanoff, Z. Yu, L. N. Hwang, L. Feigenbaum, A. M. Kruisbeek, S. A. Rosenberg, and N. P. Restifo. 2003. Tumor regression and autoimmunity after reversal of a functionally tolera nt state of self-re active CD8+ T cells. The Journal of experi mental medicine 198:569-580. 24. Shrikant, P., and M. F. Mescher. 1999. Control of syngeneic tumor growth by activation of CD8+ T cells: efficacy is limited by migration away from the site and induction of nonresponsiveness. J Immunol 162:2858-2866. 25. Ohlen, C., M. Kalos, D. J. Hong, A. C. Shur, and P. D. Greenberg. 2001. Expression of a tolerizing tumor antigen in periphe ral tissue does not pr eclude recovery of high-affinity CD8+ T cells or CTL im munotherapy of tumors expressing the antigen. J Immunol 166:2863-2870. 26. Willimsky, G., and T. Blankenstein. 2005. Sporadic immunogenic tumours avoid destruction by inducing T-cell tolerance. Nature 437:141-146. 27. Lee, P. P., C. Yee, P. A. Savage, L. F ong, D. Brockstedt, J. S. Weber, D. Johnson, S. Swetter, J. Thompson, P. D. Greenberg, M. Roederer, and M. M. Davis. 1999. Characterization of circulat ing T cells specific for tumor-associated antigens in melanoma patients. Nature medicine 5:677-685. 28. Noonan, K., W. Matsui, P. Serafini, R. Ca rbley, G. Tan, J. Khalili, M. Bonyhadi, H. Levitsky, K. Whartenby, and I. Borrell o. 2005. Activated marrow-infiltrating lymphocytes effectively target plasma cells and their cl onogenic precursors. Cancer Res 65:2026-2034. 29. Sotomayor, E. M., I. Borrello, F. M. Rattis A. G. Cuenca, J. Abrams, K. StaveleyO'Carroll, and H. I. Levitsky. 2001. Crosspresentation of tumor antigens by bone marrow-derived antigen-presenting cells is the dominant mechanism in the induction of T-cell tolerance duri ng B-cell lymphoma progression. Blood 98:1070-1077.

PAGE 105

90 30. Hawiger, D., K. Inaba, Y. Dorsett, M. Guo, K. Mahnke, M. Rivera, J. V. Ravetch, R. M. Steinman, and M. C. Nussenzweig. 2001. Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo. The Journal of experimental medicine 194:769-779. 31. Bonifaz, L., D. Bonnyay, K. Mahnke, M. Rivera, M. C. Nussenzweig, and R. M. Steinman. 2002. Efficient targeting of protei n antigen to the dendr itic cell receptor DEC-205 in the steady state leads to antigen presentation on major histocompatibility complex class I products and peripheral CD8+ T cell tolerance. The Journal of experimental medicine 196:1627-1638. 32. Roncarolo, M. G., M. K. Levings, and C. Traversari. 2001. Di fferentiation of T regulatory cells by immature dendritic cells. The Journal of experimental medicine 193:F5-9. 33. Horna, P., and E. M. Sotomayor. 2007. Cellular and molecular mechanisms of tumorinduced T-cell tolerance. Curr Cancer Drug Targets 7:41-53. 34. Calderon, C., Z. H. Huang, D. A. Gage, E. M. Sotomayor, and D. M. Lopez. 1994. Isolation of a nitric oxide inhibitor from mammary tumor cells and its characterization as phosphatidyl serine. The Journal of expe rimental medicine 180:945-958. 35. Handel-Fernandez, M. E., X. Cheng, L. M. Herbert, and D. M. Lopez. 1997. Downregulation of IL-12, not a shift from a T helper-1 to a T helper-2 phenotype, is responsible for impaired IFN-gamma pr oduction in mammary tumor-bearing mice. J Immunol 158:280-286. 36. Cheng, X., and D. M. Lopez. 1998. CD4+ but not CD8+, T cells from mammary tumor-bearing mice have a down-regulated production of IFN-gamma: role of phosphatidyl serine. J Immunol 160:2735-2741. 37. Munn, D. H., M. D. Sharma, D. Hou, B. Baban, J. R. Lee, S. J. Antonia, J. L. Messina, P. Chandler, P. A. Koni, and A. L. Me llor. 2004. Expression of indoleamine 2,3dioxygenase by plasmacytoid dendritic ce lls in tumor-draining lymph nodes. The Journal of clinical investigation 114:280-290. 38. Roncarolo, M. G., S. Gregori, M. Battaglia R. Bacchetta, K. Fleischhauer, and M. K. Levings. 2006. Interleukin-10secreting type 1 regulator y T cells in rodents and humans. Immunological reviews 212:28-50. 39. Krieg, A. M. 2007. Development of TLR9 agonists for cancer therapy. The Journal of clinical investigation 117:1184-1194.

PAGE 106

91 40. Janeway, C. A., Jr. 1992. The immune system evolved to discriminate infectious nonself from noninfectious self. Immunology today 13:11-16. 41. Janeway, C. A., Jr. 1989. Approaching th e asymptote? Evolution and revolution in immunology. Cold Spring Harbor symposia on quantitative biology 54 Pt 1:1-13. 42. Medzhitov, R., and C. Janeway, Jr. 2000. Innate immune recognition: mechanisms and pathways. Immunological reviews 173:89-97. 43. Hashimoto, C., K. L. Hudson, and K. V. Anderson. 1988. The Toll gene of Drosophila, required for dorsal-ventral em bryonic polarity, app ears to encode a transmembrane protein. Cell 52:269-279. 44. Lemaitre, B., E. Nicolas, L. Michaut, J. M. Reichhart, and J. A. Hoffmann. 1996. The dorsoventral regulatory gene cassette sp atzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86:973-983. 45. Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protei n signals activation of adaptive immunity. Nature 388:394-397. 46. Akira, S., S. Uematsu, and O. Take uchi. 2006. Pathogen recognition and innate immunity. Cell 124:783-801. 47. Nishiya, T., and A. L. DeFranco. 2004. Li gand-regulated chimeric receptor approach reveals distinctive subcellular localizati on and signaling properti es of the Toll-like receptors. The Journal of biological chemistry 279:19008-19017. 48. Latz, E., A. Schoenemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, a nd D. T. Golenbock. 2004. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nature immunology 5:190-198. 49. Medzhitov, R., P. Preston-Hurlburt, E. K opp, A. Stadlen, C. Chen, S. Ghosh, and C. A. Janeway, Jr. 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Molecular cell 2:253-258. 50. Muzio, M., J. Ni, P. Feng, and V. M. Dixit. 1997. IRAK (Pelle) family member IRAK-2 and MyD88 as proximal me diators of IL-1 signaling. Science (New York, N.Y 278:1612-1615. 51. Fitzgerald, K. A., E. M. Palsson-McDermo tt, A. G. Bowie, C. A. Jefferies, A. S. Mansell, G. Brady, E. Brint, A. Dunne, P. Gray, M. T. Harte, D. McMurray, D. E. Smith, J. E. Sims, T. A. Bird, and L. A. O'Neill. 2001. Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction. Nature 413:78-83.

PAGE 107

92 52. Horng, T., G. M. Barton, R. A. Flavell, and R. Medzhitov. 2002. The adaptor molecule TIRAP provides signalling specificity for Toll-like receptors. Nature 420:329-333. 53. Horng, T., G. M. Barton, and R. Medzhitov. 2001. TIRAP: an adapter molecule in the Toll signaling pathway. Nature immunology 2:835-841. 54. Yamamoto, M., S. Sato, H. Hemmi, H. Sa njo, S. Uematsu, T. Kaisho, K. Hoshino, O. Takeuchi, M. Kobayashi, T. Fujita, K. Takeda, and S. Akira. 2002. Essential role for TIRAP in activation of the sign alling cascade shared by TLR2 and TLR4. Nature 420:324-329. 55. Hoebe, K., X. Du, P. Georgel, E. Janssen, K. Tabeta, S. O. Kim, J. Goode, P. Lin, N. Mann, S. Mudd, K. Crozat, S. Sovath, J. Han, and B. Beutler. 2003. Identification of Lps2 as a key transducer of MyD88-independent TIR signalling. Nature 424:743-748. 56. Yamamoto, M., S. Sato, H. Hemmi, K. Ho shino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of adaptor TRIF in the MyD88-independent toll-lik e receptor signaling pathway. Science (New York, N.Y) 301:640-643. 57. Fitzgerald, K. A., D. C. Rowe, B. J. Barn es, D. R. Caffrey, A. Visintin, E. Latz, B. Monks, P. M. Pitha, and D. T. Go lenbock. 2003. LPS-TLR4 signaling to IRF-3/7 and NF-kappaB involves the toll adapters TRAM and TRIF. The Journal of experimental medicine 198:1043-1055. 58. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, and S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1and IL-18-mediated function. Immunity 9:143-150. 59. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, and S. Akira. 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11:115-122. 60. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004. Innate antiviral responses by means of TLR7-m ediated recognition of single-stranded RNA. Science (New York, N.Y 303:1529-1531. 61. Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, and A. Aderem. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099-1103. 62. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nature reviews 4:499511.

PAGE 108

93 63. Toshchakov, V., B. W. Jones, P. Y. Perera K. Thomas, M. J. Cody, S. Zhang, B. R. Williams, J. Major, T. A. Hamilton, M. J. Fenton, and S. N. Vogel. 2002. TLR4, but not TLR2, mediates IFN-beta-induced STAT1alpha/beta-dependent gene expression in macrophages. Nature immunology 3:392-398. 64. Oshiumi, H., M. Matsumoto, K. Funami T. Akazawa, and T. Seya. 2003. TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferonbeta induction. Nature immunology 4:161-167. 65. Sato, S., M. Sugiyama, M. Yamamoto, Y. Watanabe, T. Kawai, K. Takeda, and S. Akira. 2003. Toll/IL-1 receptor domain -containing adaptor inducing IFN-beta (TRIF) associates with TNF receptor-associated f actor 6 and TANK-binding kinase 1, and activates two distinct tran scription factors, NF-kappa B and IFNregulatory factor-3, in the Toll-like receptor signaling. J Immunol 171:4304-4310. 66. Honda, K., H. Yanai, H. Negishi, M. Asagir i, M. Sato, T. Mizutani, N. Shimada, Y. Ohba, A. Takaoka, N. Yoshida, and T. Taniguchi. 2005. IRF-7 is the master regulator of type-I interferondependent immune responses. Nature 434:772-777. 67. Krug, A., G. D. Luker, W. Barchet, D. A. Leib, S. Akira, and M. Colonna. 2004. Herpes simplex virus type 1 activates murine natural inte rferon-producing cells through toll-like receptor 9. Blood 103:1433-1437. 68. Lund, J. M., L. Alexopoulou, A. Sato, M. Karow, N. C. Adams, N. W. Gale, A. Iwasaki, and R. A. Flavell. 2004. Recogni tion of single-stranded RNA viruses by Toll-like receptor 7. Proceedings of the National Ac ademy of Sciences of the United States of America 101:5598-5603. 69. Yamamoto, M., S. Sato, H. Hemmi, S. Ue matsu, K. Hoshino, T. Kaisho, O. Takeuchi, K. Takeda, and S. Akira. 2003. TRAM is specifically involved in the Toll-like receptor 4-mediated MyD88-independent signaling pathway. Nature immunology 4:1144-1150. 70. Salazar-Gonzalez, R. M., and S. J. Mc Sorley. 2005. Salmonella flagellin, a microbial target of the innate an d adaptive immune system. Immunology letters 101:117122. 71. Honko, A. N., and S. B. Mizel. 2005. Effects of flagellin on innate and adaptive immunity. Immunologic research 33:83-101. 72. Gewirtz, A. T. 2006. Flag in the crossroads: flagellin mo dulates innate and adaptive immunity. Current opinion in gastroenterology 22:8-12.

PAGE 109

94 73. Rock, F. L., G. Hardiman, J. C. Timans R. A. Kastelein, and J. F. Bazan. 1998. A family of human receptors structurally related to Drosophila Toll. Proceedings of the National Academy of Sciences of the United States of America 95:588-593. 74. Gewirtz, A. T., P. O. Simon, Jr., C. K. Sc hmitt, L. J. Taylor, C. H. Hagedorn, A. D. O'Brien, A. S. Neish, and J. L. Madara. 2001. Salmonella typhimurium translocates flagellin across intestinal epithelia, inducing a proinflammatory response. The Journal of clin ical investigation 107:99-109. 75. Joys, T. M. 1985. The covalent structure of the phase-1 flagellar filament protein of Salmonella typhimurium and its comp arison with other flagellins. The Journal of biological chemistry 260:15758-15761. 76. Eaves-Pyles, T. D., H. R. Wong, K. Odoms, and R. B. Pyles. 2001. Salmonella flagellin-dependent proinflammatory res ponses are localized to the conserved amino and carboxyl regions of the protein. J Immunol 167:7009-7016. 77. Smith, K. D., E. Andersen-Nissen, F. Hayashi, K. Strobe, M. A. Bergman, S. L. Barrett, B. T. Cookson, and A. Aderem 2003. Toll-like recep tor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility. Nature immunology 4:1247-1253. 78. Subramanian, N., and A. Qadri. 2006. Lysophospholipid sensing triggers secretion of flagellin from pathogenic salmonella. Nature immunology 7:583-589. 79. Uematsu, S., M. H. Jang, N. Chevrier, Z. Guo, Y. Kumagai, M. Yamamoto, H. Kato, N. Sougawa, H. Matsui, H. Kuwata, H. He mmi, C. Coban, T. Kawai, K. J. Ishii, O. Takeuchi, M. Miyasaka, K. Take da, and S. Akira. 2006. Detection of pathogenic intestinal bacteria by Toll-lik e receptor 5 on intestinal CD11c+ lamina propria cells. Nature immunology 7:868-874. 80. Zeng, H., A. Q. Carlson, Y. Guo, Y. Yu, L. S. Collier-Hyams, J. L. Madara, A. T. Gewirtz, and A. S. Neish. 2003. Flagel lin is the major proinflammatory determinant of enteropathogenic Salmonella. J Immunol 171:3668-3674. 81. Gewirtz, A. T., T. A. Navas, S. Lyons P. J. Godowski, and J. L. Madara. 2001. Cutting edge: bacterial flagel lin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J Immunol 167:1882-1885. 82. Liaudet, L., C. Szabo, O. V. Evgenov, K. G. Murthy, P. Pacher, L. Virag, J. G. Mabley, A. Marton, F. G. Soriano, M. Y. Kirov, L. J. Bjertnaes, and A. L. Salzman. 2003. Flagellin from gram-negativ e bacteria is a potent mediator of acute pulmonary inflammation in sepsis. Shock (Augusta, Ga 19:131-137.

PAGE 110

95 83. Hawn, T. R., A. Verbon, K. D. Lettinga, L. P. Zhao, S. S. Li, R. J. Laws, S. J. Skerrett, B. Beutler, L. Schroeder, A. Nachman, A. Ozinsky, K. D. Smith, and A. Aderem. 2003. A common dominant TLR5 stop codon polymorphism abolishes flagellin signaling and is associated with susceptibility to legionnaires' disease. The Journal of experi mental medicine 198:1563-1572. 84. Means, T. K., F. Hayashi, K. D. Smit h, A. Aderem, and A. D. Luster. 2003. The Tolllike receptor 5 stimulus bacterial flagellin induces maturation and chemokine production in human dendritic cells. J Immunol 170:5165-5175. 85. Didierlaurent, A., I. Ferrero, L. A. Otten, B. Dubois, M. Reinhardt, H. Carlsen, R. Blomhoff, S. Akira, J. P. Kraehenbuhl, a nd J. C. Sirard. 2004. Flagellin promotes myeloid differentiation fact or 88-dependent developmen t of Th2-type response. J Immunol 172:6922-6930. 86. Liu, T., T. Matsuguchi, N. Tsuboi, T. Yajim a, and Y. Yoshikai. 2002. Differences in expression of toll-like receptors and their re activities in dendriti c cells in BALB/c and C57BL/6 mice. Infection and immunity 70:6638-6645. 87. Edwards, A. D., S. S. Diebold, E. M. Slack, H. Tomizawa, H. Hemmi, T. Kaisho, S. Akira, and C. Reis e Sousa. 2003. Tolllike receptor expressi on in murine DC subsets: lack of TLR7 expressi on by CD8 alpha+ DC correlates with unresponsiveness to imidazoquinolines. European journal of immunology 33:827833. 88. Iwasaki, A., and B. L. Kelsall. 1999. Freshl y isolated Peyer's patch, but not spleen, dendritic cells produce interleukin 10 a nd induce the differentiation of T helper type 2 cells. The Journal of experimental medicine 190:229-239. 89. McSorley, S. J., B. D. Ehst, Y. Yu, and A. T. Gewirtz. 2002. Bacter ial flagellin is an effective adjuvant for CD4+ T cells in vivo. J Immunol 169:3914-3919. 90. Caron, G., D. Duluc, I. Fremaux, P. Jea nnin, C. David, H. Gascan, and Y. Delneste. 2005. Direct stimulation of human T cells via TLR5 and TLR7/8: flagellin and R848 up-regulate proliferation and IFN-gamma production by memory CD4+ T cells. J Immunol 175:1551-1557. 91. Crellin, N. K., R. V. Garcia, O. Hadisfar S. E. Allan, T. S. Steiner, and M. K. Levings. 2005. Human CD4+ T cells e xpress TLR5 and its ligand flagellin enhances the suppressive capacity and expression of FOXP3 in CD4+CD25+ T regulatory cells. J Immunol 175:8051-8059.

PAGE 111

96 92. Caramalho, I., T. Lopes-Carvalho, D. Ostler, S. Zelenay, M. Haury, and J. Demengeot. 2003. Regulatory T cells selec tively express toll-like receptors and are activated by lipopolysaccharide. The Journal of expe rimental medicine 197:403-411. 93. Hori, S., T. Nomura, and S. Saka guchi. 2003. Control of regulatory T cell development by the tran scription factor Foxp3. Science (New York, N.Y 299:10571061. 94. Trinchieri, G. 2003. Interleukin-12 and th e regulation of innate resistance and adaptive immunity. Nature reviews 3:133-146. 95. Kobayashi, M., L. Fitz, M. Ryan, R. M. Hewick, S. C. Clark, S. Chan, R. Loudon, F. Sherman, B. Perussia, and G. Trinchieri 1989. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. The Journal of experimental medicine 170:827845. 96. Snijders, A., C. M. Hilkens, T. C. van de r Pouw Kraan, M. Engel, L. A. Aarden, and M. L. Kapsenberg. 1996. Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocyt es is determined by the expression of the p35 subunit. J Immunol 156:1207-1212. 97. Ling, P., M. K. Gately, U. Gubler, A. S. Stern, P. Lin, K. Hollfelder, C. Su, Y. C. Pan, and J. Hakimi. 1995. Human IL-12 p40 homod imer binds to the IL-12 receptor but does not mediate biologic activity. J Immunol 154:116-127. 98. Gillessen, S., D. Carvajal, P. Ling, F. J. P odlaski, D. L. Stremlo, P. C. Familletti, U. Gubler, D. H. Presky, A. S. Stern, and M. K. Gatel y. 1995. Mouse interleukin-12 (IL-12) p40 homodimer: a potent IL-12 antagonist. European journal of immunology 25:200-206. 99. Heinzel, F. P., A. M. Hujer, F. N. Ahmed, and R. M. Rer ko. 1997. In vivo production and function of IL-12 p40 homodimers. J Immunol 158:4381-4388. 100. Babik, J. M., E. Adams, Y. Tone, P. J. Fairchild, M. Tone, and H. Waldmann. 1999. Expression of murine IL-12 is regula ted by translational control of the p35 subunit. J Immunol 162:4069-4078. 101. Weinmann, A. S., S. E. Plevy, and S. T. Smale. 1999. Rapid and selective remodeling of a positioned nucleosome during the induction of IL-12 p40 transcription. Immunity 11:665-675.

PAGE 112

97 102. Weinmann, A. S., D. M. Mitchell, S. Sanj abi, M. N. Bradley, A. Hoffmann, H. C. Liou, and S. T. Smale. 2001. Nucleosome remodeling at the IL-12 p40 promoter is a TLR-dependent, Rel-independent event. Nature immunology 2:51-57. 103. Tone, Y., S. A. Thompson, J. M. Babik, K. F. Nolan, M. Tone, C. Raven, and H. Waldmann. 1996. Structure and chromosomal location of the mouse interleukin12 p35 and p40 subunit genes. European journal of immunology 26:1222-1227. 104. Yoshimoto, T., K. Kojima, T. Funakoshi, Y. Endo, T. Fujita, and H. Nariuchi. 1996. Molecular cloning and characteriza tion of murine IL-12 genes. J Immunol 156:1082-1088. 105. Hayes, M. P., F. J. Murphy, and P. R. Burd. 1998. Interferon-gamma-dependent inducible expression of the human interleukin-12 p35 gene in monocytes initiates from a TATA-containing promoter distinct from the CpG-rich promoter active in Epstein-Barr virus-transf ormed lymphoblastoid cells. Blood 91:4645-4651. 106. Ma, X., J. M. Chow, G. Gri, G. Carra, F. Gerosa, S. F. Wolf R. Dzialo, and G. Trinchieri. 1996. The interleukin 12 p40 ge ne promoter is primed by interferon gamma in monocytic cells. The Journal of experimental medicine 183:147-157. 107. Aste-Amezaga, M., X. Ma, A. Sartor i, and G. Trinchieri. 1998. Molecular mechanisms of the induction of IL-12 and its inhibition by IL-10. J Immunol 160:5936-5944. 108. D'Andrea, A., M. Aste-Amezaga, N. M. Valiante, X. Ma, M. Kubin, and G. Trinchieri. 1993. Interleukin 10 (IL-10) inhibits human lymphocyte interferon gamma-production by suppressing natural ki ller cell stimulatory factor/IL-12 synthesis in accessory cells. The Journal of experimental medicine 178:1041-1048. 109. Darnell, J. E., Jr. 1997. STATs and gene regulation. Science (New York, N.Y 277:1630-1635. 110. Watford, W. T., M. Moriguchi, A. Morinobu, and J. J. O'Shea. 2003. The biology of IL-12: coordinating innate a nd adaptive immune responses. Cytokine & growth factor reviews 14:361-368. 111. Jacobson, N. G., S. J. Szabo, R. M. Webe r-Nordt, Z. Zhong, R. D. Schreiber, J. E. Darnell, Jr., and K. M. Murphy. 1995. Interl eukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal tr ansducer and activator of transcription (Stat)3 and Stat4. The Journal of expe rimental medicine 181:17551762.

PAGE 113

98 112. Bacon, C. M., E. F. Petricoin, 3rd, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, and J. J. O'Shea. 1995. Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proceedings of the National Academy of Sciences of th e United States of America 92:7307-7311. 113. Colombo, M. P., and G. Trinchieri. 2002. Interleukin-12 in anti-tumor immunity and immunotherapy. Cytokine & growth factor reviews 13:155-168. 114. Kang, B. Y., E. Kim, a nd T. S. Kim. 2005. Regulatory mechanisms and their therapeutic implications of interl eukin-12 production in immune cells. Cellular signalling 17:665-673. 115. Fiorentino, D. F., and M. W. Bond, Mosmann, T.R. 1989. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J. Exp. Med. 170:2081-2095. 116. de Waal Malefyt, R., J. Haanen, H. Spits M. G. Roncarolo, A. te Velde, C. Figdor, K. Johnson, R. Kastelein, H. Yssel, and J. E. de Vries. 1991. Interleukin 10 (IL-10) and viral IL-10 strongly reduce antigen-sp ecific human T cell proliferation by diminishing the antigen-presen ting capacity of monocytes via downregulation of class II major histocompatibility complex expression. The Journal of experi mental medicine 174:915-924. 117. Fiorentino, D. F., A. Zlotni k, P. Vieira, T. Mosmann, M. Howard, K. Moore, and A. O'Garra. 1991. IL-10 Acts on the Antigen-Pre senting Cell To Inhibit Cytokine Production by Th1 Cells. J. Immunol. 146:3444-3451. 118. Ding, L., P. S. Linsley, L. Y. Huang, R. N. Germain, and E. M. Shevach. 1993. IL10 inhibits macrophage costimulatory ac tivity by selectively inhibiting the upregulation of B7 expression. J Immunol 151:1224-1234. 119. Fiorentino, D. F., A. Zlotnik, T. R. Mosmann, M. Howard, and A. O'Garra. 1991. IL-10 inhibits cytokine production by activated macrophages. J Immunol 147:3815-3822. 120. de Waal Malefyt, R., J. Abrams, B. Benne tt, C. G. Figdor, and J. E. de Vries. 1991. Interleukin 10(IL-10) inhibits cytoki ne synthesis by hu man monocytes: an autoregulatory role of IL-10 produced by monocytes. The Journal of experimental medicine 174:1209-1220. 121. Moore, K. W., R. de Waal Malefy t, R. L. Coffman, and A. O'Garra. 2001. Interleukin-10 and the in terleukin-10 receptor. Annual review of immunology 19:683-765.

PAGE 114

99 122. Brightbill, H. D., S. E. Plevy, R. L. Modlin, and S. T. Smale. 2000. A prominent role for Sp1 during lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages. J Immunol 164:1940-1951. 123. Tone, M., M. J. Powell, Y. Tone, S. A. Thompson, and H. Waldmann. 2000. IL-10 gene expression is controlled by the transcription factors Sp1 and Sp3. J Immunol 165:286-291. 124. Liu, Y. W., H. P. Tseng, L. C. Chen B. K. Chen, and W. C. Chang. 2003. Functional cooperation of simian virus 40 promoter factor 1 and CCAAT/enhancer-binding protein beta and delta in lipopolysaccharide-induced gene activation of IL-10 in mouse macrophages. J Immunol 171:821-828. 125. Ziegler-Heitbrock, L., M. Lotzerich, A. Sc haefer, T. Werner, M. Frankenberger, and E. Benkhart. 2003. IFN-alpha induces the human IL-10 gene by recruiting both IFN regulatory factor 1 and Stat3. J Immunol 171:285-290. 126. Zhang, X., J. P. Edwards, and D. M. Mosser. 2006. Dynamic and transient remodeling of the macrophage IL-1 0 promoter during transcription. J Immunol 177:1282-1288. 127. Powell, M. J., S. A. Thompson, Y. Tone, H. Waldmann, and M. Tone. 2000. Posttranscriptional regulation of IL-10 gene expression through sequences in the 3'-untranslated region. J Immunol 165:292-296. 128. Liu, Y., S. H. Wei, A. S. Ho, R. de Waal Malefy t, and K. W. Moore. 1994. Expression cloning and characteriz ation of a human IL-10 receptor. J Immunol 152:1821-1829. 129. Tan, J. C., S. R. Indelicato, S. K. Narula, P. J. Zavodny, and C. C. Chou. 1993. Characterization of interleukin-10 receptors on human and mouse cells. The Journal of biological chemistry 268:21053-21059. 130. Williams, L., L. Bradley, A. Smith, and B. Foxwell. 2004. Signal transducer and activator of transcription 3 is the dominant mediator of the anti-inflammatory effects of IL-10 in human macrophages. J Immunol 172:567-576. 131. Lang, R., D. Patel, J. J. Morris, R. L. Rutschman, and P. J. Murray. 2002. Shaping gene expression in activated and resting primary macrophages by IL-10. J Immunol 169:2253-2263. 132. Qin, H., C. A. Wilson, K. L. Roberts, B. J. Baker, X. Zhao, and E. N. Benveniste. 2006. IL-10 inhibits lipopolysaccharide-i nduced CD40 gene expression through induction of suppressor of cytokine signaling-3. J Immunol 177:7761-7771.

PAGE 115

100 133. Williams, L. M., U. Sarma, K. Willets, T. Smallie, F. Brennan, and B. M. Foxwell. 2007. Expression of constitutively active STAT3 can replicate the cytokinesuppressive activity of interleuki n-10 in human primary macrophages. The Journal of biological chemistry 282:6965-6975. 134. Murray, P. J. 2005. The primary mechanism of the IL-10-regulated antiinflammatory respon se is to selectively inhibit transcription. Proceedings of the National Academy of Sciences of the United States of America 102:8686-8691. 135. Kuhn, R., J. Lohler, D. Rennick, K. Ra jewsky, and W. Muller. 1993. Interleukin-10deficient mice develop chronic enterocolitis. Cell 75:263-274. 136. Davidson, N. J., S. A. Hudak, R. E. Le sley, S. Menon, M. W. Leach, and D. M. Rennick. 1998. IL-12, but not IFN-gamma, plays a major role in sustaining the chronic phase of colitis in IL-10-deficient mice. J Immunol 161:3143-3149. 137. Gazzinelli, R. T., M. Wysocka, S. Hie ny, T. Scharton-Kersten, A. Cheever, R. Kuhn, W. Muller, G. Trinchieri, and A. Sher 1996. In the absence of endogenous IL-10, mice acutely infected with Toxoplasma gondii succumb to a lethal immune response dependent on CD4+ T cells and accompanied by overproduction of IL12, IFN-gamma and TNF-alpha. J Immunol 157:798-805. 138. Hunter, C. A., L. A. Ellis-Neyes, T. Slifer, S. Kanaly, G. Grunig, M. Fort, D. Rennick, and F. G. Araujo. 1997. IL10 is required to prevent immune hyperactivity during infection with Trypanosoma cruzi. J Immunol 158:33113316. 139. Rousset, F., E. Garcia, T. Defrance, C. Peronne, N. Vezzio, D. H. Hsu, R. Kastelein, K. W. Moore, and J. Banchereau. 1992. Interleukin 10 is a potent growth and differentiation factor for ac tivated human B lymphocytes. Proceedings of the National Academy of Sciences of the United States of America 89:1890-1893. 140. Ibrahim, G. F., G. H. Fleet, M. J. Lyons, and R. A. Walker. 1985. Method for the isolation of highly purifie d Salmonella flagellins. J Clin Microbiol 22:1040-1044. 141. Cheng, F., H. W. Wang, A. Cuenca, M. Hu ang, T. Ghansah, J. Brayer, W. G. Kerr, K. Takeda, S. Akira, S. P. Schoenberger, H. Yu, R. Jove, and E. M. Sotomayor. 2003. A critical role for Stat3 si gnaling in immune tolerance. Immunity 19:425436. 142. Park, J. M., F. R. Greten, Z. W. Li and M. Karin. 2002. M acrophage apoptosis by anthrax lethal factor thr ough p38 MAP kinase inhibition. Science (New York, N.Y 297:2048-2051.

PAGE 116

101 143. Haase, C., M. Ejrnaes, A. E. Juedes, T. Wolfe, H. Markholst, and M. G. von Herrath. 2005. Immunomodulatory dendritic cells requ ire autologous serum to circumvent nonspecific immunosuppressive activity in vivo. Blood 106:4225-4233. 144. Wakkach, A., N. Fournier, V. Brun, J. P. Breittmayer, F. Cottrez, and H. Groux. 2003. Characterization of dendritic cells that induce tolerance and T regulatory 1 cell differentiation in vivo. Immunity 18:605-617. 145. Simon, R., and C. E. Samuel. 2007. Ac tivation of NF-kappaB-dependent gene expression by Salmonella flag ellins FliC and FljB. Biochemical and biophysical research communications 355:280-285. 146. Applequist, S. E., R. P. Wallin, and H. G. Ljunggren. 2002. Variable expression of Toll-like receptor in murine innate and adaptive immune cell lines. International immunology 14:1065-1074. 147. Beutler, B., I. W. Milsark, and A. C. Cerami. 1985. Passive immunization against cachectin/tumor necrosis factor protects mice from lethal effect of endotoxin. Science (New York, N.Y 229:869-871. 148. Starnes, H. F., Jr., R. S. Warren, M. Jeevanandam, J. L. Gabrilove, W. Larchian, H. F. Oettgen, and M. F. Brennan. 1988. Tu mor necrosis factor and the acute metabolic response to tissue injury in man. The Journal of clinical investigation 82:1321-1325. 149. Langenkamp, A., M. Messi, A. Lanzavecch ia, and F. Sallusto. 2000. Kinetics of dendritic cell activation: impact on priming of TH1, TH2 and nonpolarized T cells. Nature immunology 1:311-316. 150. Sato, S., O. Takeuchi, T. Fujita, H. Tomizawa, K. Takeda, and S. Akira. 2002. A variety of microbial co mponents induce tolerance to lipopolysaccharide by differentially affecting MyD88-depe ndent and -independent pathways. International immunology 14:783-791. 151. Underhill, D. M., A. Ozinsky, A. M. Hajjar, A. Stevens, C. B. Wilson, M. Bassetti, and A. Aderem. 1999. The Toll-like recep tor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature 401:811-815. 152. Gagnon, E., S. Duclos, C. Rondeau, E. Chevet, P. H. Cameron, O. Steele-Mortimer, J. Paiement, J. J. Bergeron, and M. Desjardins. 2002. Endoplasmic reticulummediated phagocytosis is a mechanism of entry into macrophages. Cell 110:119131.

PAGE 117

102 153. Saraiva, M., J. R. Christensen, A. V. Tsytsykova, A. E. Goldfeld, S. C. Ley, D. Kioussis, and A. O'Garra. 2005. Identification of a macrophage-specific chromatin signature in the IL-10 locus. J Immunol 175:1041-1046. 154. Banerjee, A., R. Gugasyan, M. McMahon, and S. Gerondakis. 2006. Diverse Tolllike receptors utilize Tpl2 to activate ex tracellular signal-regulated kinase (ERK) in hemopoietic cells. Proceedings of the National Academy of Sciences of the United States of America 103:3274-3279. 155. Yi, A. K., J. G. Yo on, S. J. Yeo, S. C. Hong, B. K. English, and A. M. Krieg. 2002. Role of mitogen-activated protein kina ses in CpG DNA-mediated IL-10 and IL12 production: central role of extracellular signal-re gulated kinase in the negative feedback loop of the CpG DNA-mediated Th1 response. J Immunol 168:4711-4720. 156. Dillon, S., A. Agrawal, T. Van Dyke, G. Landreth, L. McCa uley, A. Koh, C. Maliszewski, S. Akira, and B. Pulendran. 2004. A Toll-like receptor 2 ligand stimulates Th2 responses in vivo, via i nduction of extracellul ar signal-regulated kinase mitogen-activated protein kinase and c-Fos in dendritic cells. J Immunol 172:4733-4743. 157. Agrawal, S., A. Agrawal, B. Doughty, A. Gerwitz, J. Blenis, T. Van Dyke, and B. Pulendran. 2003. Cutting edge: different To ll-like receptor a gonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal-regulated kinase-mitoge n-activated protein kinase and c-Fos. J Immunol 171:4984-4989. 158. Slack, E. C., M. J. Robinson, P. Hernanz-Falcon, G. D. Brown, D. L. Williams, E. Schweighoffer, V. L. Tybulewicz, and C. Reis e Sousa. 2007. Syk-dependent ERK activation regulates IL-2 and IL10 production by DC stimulated with zymosan. European journal of immunology 37:1600-1612. 159. Kusmartsev, S., F. Cheng, B. Yu, Y. Nefedova, E. Sotomayor, R. Lush, and D. Gabrilovich. 2003. All-trans-retinoic acid elim inates immature myeloid cells from tumor-bearing mice and improves the effect of vaccination. Cancer Res 63:44414449. 160. Sotomayor, E. M., I. Borrello, E. Tubb, F. M. Rattis, H. Bien, Z. Lu, S. Fein, S. Schoenberger, and H. I. Levitsky. 1999. Conversion of tumor-specific CD4+ Tcell tolerance to T-cell priming th rough in vivo ligation of CD40. Nature medicine 5:780-787. 161. Groux, H., A. O'Garra, M. Bigler, M. Roulea u, S. Antonenko, J. E. de Vries, and M. G. Roncarolo. 1997. A CD4+ T-cell subset inhibits antigen -specific T-cell responses and prevents colitis. Nature 389:737-742.

PAGE 118

103 162. Anderson, C. F., M. Oukka, V. J. Ku chroo, and D. Sacks. 2007. CD4(+)CD25()Foxp3(-) Th1 cells are the source of IL-10-mediated immune suppression in chronic cutaneous leishmaniasis. The Journal of expe rimental medicine 204:285. 163. Levitsky, H. I., A. Lazenby, R. J. Hayashi, and D. M. Pardoll. 1994. In vivo priming of two distinct antitumor e ffector populations: the role of MHC class I expression. The Journal of experimental medicine 179:1215-1224. 164. Napolitani, G., A. Rinaldi, F. Bertoni F. Sallusto, and A. Lanzavecchia. 2005. Selected Toll-like receptor agonist combina tions synergistically trigger a T helper type 1-polarizing program in dendritic cells. Nature immunology 6:769-776. 165. Gautier, G., M. Humbert, F. Deauvieau, M. Scuiller, J. Hiscott, E. E. Bates, G. Trinchieri, C. Caux, and P. Garrone. 2005. A type I interferon au tocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells. The Journal of experimental medicine 201:1435-1446. 166. Ozinsky, A., D. M. Underhill, J. D. Font enot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder, and A. Aderem 2000. The repertoire for pattern recognition of pathogens by the innate i mmune system is defined by cooperation between toll-like receptors. Proceedings of the National Academy of Sciences of the United States of America 97:13766-13771. 167. Mizel, S. B., A. N. Honko, M. A. Moors, P. S. Smith, and A. P. West. 2003. Induction of macrophage nitric oxide production by Gram-negative flagellin involves signaling via heteromeric Toll-like receptor 5/Toll-like receptor 4 complexes. J Immunol 170:6217-6223. 168. Salojin, K. V., I. B. Owusu, K. A. Millerchip, M. Potter, K. A. Platt, and T. Oravecz. 2006. Essential role of MAPK phosphatase-1 in the negative control of innate immune responses. J Immunol 176:1899-1907. 169. Qian, C., X. Jiang, H. An, Y. Yu, Z. Guo, S. Liu, H. Xu, and X. Cao. 2006. TLR agonists promote ERK-mediated preferen tial IL-10 production of regulatory dendritic cells (diffDCs), leading to NK-cell activation. Blood 108:2307-2315. 170. Fernandez, S., P. Jose, M. G. Avdius hko, A. M. Kaplan, and D. A. Cohen. 2004. Inhibition of IL-10 receptor function in alveolar macrophages by Toll-like receptor agonists. J Immunol 172:2613-2620. 171. Akbari, O., R. H. DeKruyff, and D. T. Umetsu. 2001. Pulmonary dendritic cells producing IL-10 mediate tolerance induced by respiratory exposure to antigen. Nature immunology 2:725-731.

PAGE 119

104 172. Mobley, H. L., R. Belas, V. Lockatell, G. Chippendale, A. L. Trifillis, D. E. Johnson, and J. W. Warren. 1996. Construction of a flagellum-negative mutant of Proteus mirabilis: effect on internalization by human renal epithelial cells and virulence in a mouse model of ascending urinary tract infection. Infection and immunity 64:5332-5340. 173. Ramos, H. C., M. Rumbo, and J. C. Sira rd. 2004. Bacterial flagel lins: mediators of pathogenicity and host imm une responses in mucosa. Trends in microbiology 12:509-517. 174. Levings, M. K., S. Gregori, E. Tresol di, S. Cazzaniga, C. Bonini, and M. G. Roncarolo. 2005. Differentiation of Tr1 cells by immature dendritic cells requires IL-10 but not CD25+CD4+ Tr cells. Blood 105:1162-1169. 175. Wakkach, A., F. Cottrez, and H. Groux. 2001. Differentiation of re gulatory T cells 1 is induced by CD2 costimulation. J Immunol 167:3107-3113. 176. Autschbach, F., J. Braunstein, B. Helmke, I. Zuna, G. Schurmann, Z. I. Niemir, R. Wallich, H. F. Otto, and S. C. Meuer. 1998. In situ expression of interleukin-10 in noninflamed human gut and in inflammatory bowel disease. The American journal of pathology 153:121-130. 177. Vicari, A. P., C. Chiodoni, C. Vaure, S. Ait-Yahia, C. Dercamp, F. Matsos, O. Reynard, C. Taverne, P. Merle, M. P. Co lombo, A. O'Garra, G. Trinchieri, and C. Caux. 2002. Reversal of tumor-induced dendritic cell paralysis by CpG immunostimulatory oligonucleotide and anti-interleukin 10 receptor antibody. The Journal of experi mental medicine 196:541-549. 178. Conejo-Garcia, J. R., F. Benencia, M. C. Courreges, E. Kang, A. Mohamed-Hadley, R. J. Buckanovich, D. O. Holtz, A. Jenki ns, H. Na, L. Zhang, D. S. Wagner, D. Katsaros, R. Caroll, and G. Coukos 2004. Tumor-infiltrating dendritic cell precursors recruited by a beta-defensin contribute to vasculogenesis under the influence of Vegf-A. Nature medicine 10:950-958.

PAGE 120

About the Author Ildefonso Vicente-Suarez was born and rais ed in Madrid (Spain). His initial studies were in Biology, and he received a Bachelor of Sc iences degree in Biology from the Universidad Complutense de Madrid in 2001. He entered the Cancer Biology PhD program at H. Lee Moffitt Cancer Center at USF in 2002. Ildefonso has conducted research with his mentor Dr. Eduardo M Sotomayor since 2002. This research was published in European Journal of Immunology 2007.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001947516
003 fts
005 20080729104615.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 080729s2007 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002201
035
(OCoLC)236484292
040
FHM
c FHM
049
FHMM
090
RC254.6 (ONLINE)
1 100
Vicente-Suarez, Ildefonso.
0 245
Immunomodulatory role of flagellin in antigen-presenting cells
h [electronic resource] /
by Ildefonso Vicente-Suarez.
260
[Tampa, Fla] :
b University of South Florida,
2007.
3 520
ABSTRACT: Toll-like receptors (TLRs) expressed by cells of the immune system play a central role in the generation of immune responses against pathogens. Following TLR ligation, both pro-inflammatory and anti-inflammatory mediators are produced in order to elicit an immune response that controls the microbial infection while limiting tissue damage. Among these mediators, the proinflammatory cytokine IL-12 and the anti-inflammatory cytokine IL-10 are known to play major roles. Here, we show that in vitro or in vivo stimulation with flagellin, the TLR5 ligand, does not result in IL-10 production. Furthermore flagellin inhibits IL-10 production by other specific TLR ligands at the protein and mRNA levels while increasing IL-12p70 production. Several studies have linked the activation of extracellular signal regulated kinases (ERKs) with IL-10 induction by TLRs. Our findings that LPS-induced ERK activation is significantly decreased in flagellin-treated macrophages suggest that this pathway might play a role in the inhibition of IL-10 production by flagellin. Flagellin-mediated IL-10 inhibition was not observed in cells that do not express TLR5 supporting that this effect is TLR5-dependent.Flagellin used as an adjuvant is capable of priming antigen specific T cell responses in an in vivo model of tolerance using high dose peptide. Furthermore, DCs differentiated in tolerogenic conditions (tolerogenic-DCs) express higher levels of TLR5 mRNA than standard BM-DCs and respond more vigorously to flagellin stimulation. Antigen presentation by LPS-matured tolerogenic-DCs results in the differentiation of IL-10 producing T cells with a Tr1-like phenotype. On the contrary, antigen presentation by tolerogenic-DCs that have been stimulated with flagellin results in the differentiation of a typical Th1 responseThis study provides a new insight of the role of flagellin recognition by TLR5 in shaping the immune response elicited by flagellated microorganisms.
502
Dissertation (Ph.D.)--University of South Florida, 2007.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 104 pages.
Includes vita.
590
Adviser: Eduardo Martin Sotomayor, M.D.
653
TLR5.
Macrophages.
Toll-like receptors.
IL-10.
DCs.
690
Dissertations, Academic
z USF
x Cancer Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2201