USF Libraries
USF Digital Collections

Molecular and genomic studies of temperate phages from Halomonas aquamarina and Bacillus spp. isolates from the Gulf of ...

MISSING IMAGE

Material Information

Title:
Molecular and genomic studies of temperate phages from Halomonas aquamarina and Bacillus spp. isolates from the Gulf of Mexico
Physical Description:
Book
Language:
English
Creator:
Mobberley, Jennifer M
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
Lysogeny
Sporulation
Bacteria
Plasmids
Marine
Dissertations, Academic -- Marine Science -- Masters -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Viruses are the most abundant biological entities in the ocean and are believed to contribute to nutrient cycling, bacterial diversity, and horizontal gene exchange. However, little is known about the relationship between temperate phages and their hosts in marine environments. In this thesis, phage-host systems from the Gulf of Mexico were used to study the influence of temperate phages in bacteria. PhiHAP-1 is a temperate myovirus induced with mitomycin C from Halomonas aquamarina isolate. The genome of this phage was 39,245 nucleotides long and contained 46 predicted genes. Besides genes involved in lysogeny, PhiHAP-1 contained a protelomerase, which is responsible for resolution of telomeric ends in linear plasmid-like phages. Hybridization studies and PCR analysis indicated not only a lack of integration of the prophage in the host chromosome, but differences in genome arrangement between the prophage and virion forms of PhiHAP-1.These results suggest that PhiHAP-1 exists as a non-integrating linear phage with telomeric ends. Eleven pigmented Bacillus spp. isolates were examined for the occurrence of lysogeny and sporulation through induction with mitomycin C and decoyinine, respectively. The results from these experiments suggested a variety of interactions can occur between phages and their hosts, some of which may influence sporulation. The lysogenic strain B14905 had high frequency of sporulation and was selected for further analysis. The genome of B14905 contained 4 prophage-like regions, one of which was independently sequenced from an induced lysate. PCR and TEM analysis of a mitomycin C induced lysate indicated that two of these regions were inducible prophage, one was a defective phage, and one was a non-inducible phage remnant. One of the inducible prophages contained a transcriptional regulator that is hypothesized to be involved in regulation of host sporulation.The diversity of prophage and prophage-like elements found in B14905 suggest that the genetic diversity of phages in the oceans is vast. The studies of the temperate phages from H. aquamarina and Bacillus spp. isolates illustrates that integration of molecular, genomic, and function studies can be used to provide insight into the influence of prophage on host bacteria.
Thesis:
Thesis (M.S.)--University of South Florida, 2007.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Jennifer M. Mobberley.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 124 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001935524
oclc - 226256508
usfldc doi - E14-SFE0002239
usfldc handle - e14.2239
System ID:
SFS0026557:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001935524
003 fts
005 20080424173552.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 080424s2007 flua sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002239
035
(OCoLC)226256508
040
FHM
c FHM
043
nm-----
049
FHMM
090
GC11.2 (ONLINE)
1 100
Mobberley, Jennifer M.
0 245
Molecular and genomic studies of temperate phages from Halomonas aquamarina and Bacillus spp. isolates from the Gulf of Mexico
h [electronic resource] /
by Jennifer M. Mobberley.
260
[Tampa, Fla.] :
b University of South Florida,
2007
520
ABSTRACT: Viruses are the most abundant biological entities in the ocean and are believed to contribute to nutrient cycling, bacterial diversity, and horizontal gene exchange. However, little is known about the relationship between temperate phages and their hosts in marine environments. In this thesis, phage-host systems from the Gulf of Mexico were used to study the influence of temperate phages in bacteria. PhiHAP-1 is a temperate myovirus induced with mitomycin C from Halomonas aquamarina isolate. The genome of this phage was 39,245 nucleotides long and contained 46 predicted genes. Besides genes involved in lysogeny, PhiHAP-1 contained a protelomerase, which is responsible for resolution of telomeric ends in linear plasmid-like phages. Hybridization studies and PCR analysis indicated not only a lack of integration of the prophage in the host chromosome, but differences in genome arrangement between the prophage and virion forms of PhiHAP-1.These results suggest that PhiHAP-1 exists as a non-integrating linear phage with telomeric ends. Eleven pigmented Bacillus spp. isolates were examined for the occurrence of lysogeny and sporulation through induction with mitomycin C and decoyinine, respectively. The results from these experiments suggested a variety of interactions can occur between phages and their hosts, some of which may influence sporulation. The lysogenic strain B14905 had high frequency of sporulation and was selected for further analysis. The genome of B14905 contained 4 prophage-like regions, one of which was independently sequenced from an induced lysate. PCR and TEM analysis of a mitomycin C induced lysate indicated that two of these regions were inducible prophage, one was a defective phage, and one was a non-inducible phage remnant. One of the inducible prophages contained a transcriptional regulator that is hypothesized to be involved in regulation of host sporulation.The diversity of prophage and prophage-like elements found in B14905 suggest that the genetic diversity of phages in the oceans is vast. The studies of the temperate phages from H. aquamarina and Bacillus spp. isolates illustrates that integration of molecular, genomic, and function studies can be used to provide insight into the influence of prophage on host bacteria.
502
Thesis (M.S.)--University of South Florida, 2007.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 124 pages.
590
Advisor: John H. Paul, Ph.D.
653
Lysogeny.
Sporulation.
Bacteria.
Plasmids.
Marine.
690
Dissertations, Academic
z USF
x Marine Science
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2239



PAGE 1

Molecular and Genomic Studies of Temperate Phages from Halomonas aquamarina and Bacillus Spp Isolates from the Gulf of Mexico by Jennifer M. Mobberley A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science College of Marine Science University of South Florida Major Professor: John H. Paul, Ph.D. Kathleen T. Scott, Ph.D. Mya Breitbart, Ph.D. Date of Approval: November 1, 2007 Keywords: lysogeny, sporulation, bacteria, plasmids, marine Copyright 2007, Jennifer M. Mobberley

PAGE 2

Acknowledgments First and foremost, I would like to acknow ledge my advisor, Dr. John H. Paul for his guidance and support over the past thr ee years. Thank you for making me a better student and scientist. I th ank my committee members Dr. Kathleen T. Scott and Dr. Mya Breitbart for their time and encouragement. I am very grateful to the National Science Foundation, the Florida Sea Grant, and the Aylesworth Foundation for providing financial support for this research. This th esis would not exist without the sequencing efforts of Anca Segall, Robert Edwards, and Nathan Authement at San Diego State University. Ralph Slepecky was an invalu able resource for all things concerning sporulation. I would like to th ank everyone in the Paul a nd Breitbart labs for their assistance, friendship, and for putting up with me. Special thanks go to Amy Long and Kathryn Bailey for always being there for me. My parents, Daniel a nd Belinda, have been my biggest supporters from day one. They have always believed I could achieve whatever I set my mind to. Finally, I w ould like to thank Tim for all his love, understanding, and chocolate milkshakes.

PAGE 3

i Table of Contents List of Tables iv List of Figures v Abstract vii Chapter 1 – Introduction 1 1.1 Viruses in the Marine Environment 1 1.1.1 Viral Distribution in th e Marine Environment 1 1.1.2 Effects of Viruses on Nutrient Cycling 2 1.1.3 Influence of Viruses on Host Diversity 3 1.1.4 Viral-Mediated Gene Transfer 4 1.2 Virus Lifecycles 5 1.2.1 Summary of Virus Lifecycles 5 1.2.2 The Lytic-Lysogenic Decision 7 1.2.3 Effect of Lysogeny on Bacterial Processes 9 1.2.4 Lysogeny in the Marine Environment 10 1.3 Sporulation 11 1.3.1 Initiation of Sporulation 11 1.3.2 Comparison of Prophage I nduction and Sporulation 14 1.3.3 The Genus Bacillus 15 1.3.4 Bacteriophages of Bacillus 16 1.4 Microbial Genomics 18 1.4.1 Bacteriophage Genomics 18 1.4.2 Sequencing Prophage Genomes 21 1.4.3 Genomics of Marine Phages 24 1.4.4 Marine Metaviromics 26 1.4.5 Beyond the Genome 28 1.5 Research Objectives 30 Chapter 2 – The Temperate Marine Phage HAP-1 of Halomonas aquamarina Possesses a Linear Plasmid-like Prophage Genome 31 2.1 Chapter Summary 31 2.2 Introduction 32 2.3 Materials and Methods 34 2.3.1 Isolation of Phage and Host Particles 34 2.3.2 Time Series Induction of Phage Particles 35

PAGE 4

ii 2.3.3 Transmission Electron Microscopy 36 2.3.4 Extraction of phage DNA 36 2.3.5 Library Construction, Sequencing, and Assembly of the HAP Genome 37 2.3.6 Sequence Analysis of the HAP Genome 37 2.3.7 Analysis of Phage Proteins by Mass Spectroscopy 38 2.3.8 Pulsed Field Gel Electrophresis 39 2.3.9 Riboprobe Labeling and Southern Hybridiz ation of H. aquamarina DNA Preparations 39 2.2.10 Polymerase Chain Reaction 40 2.2.11 Nucleotide Sequence Accession Numbers 41 2.4 Results 41 2.4.1 Characterization of the HAP-1 Virion 41 2.4.2 Analysis of the HAP-1 Genome 44 2.4.3 Genomic Organization of Pl asmid-like Double-stranded Linear Prophages 52 2.4.4 Integration of HAP-1 in Cellular Repl icons and Different Genomic Arrangements 53 2.5 Discussion 56 Chapter 3 – Lysogeny and Sporulation in Marine Bacillus 65 3.1 Project Summary 65 3.2 Introduction 66 3.3 Materials and Methods 68 3.3.1 Isolate Collection and Phylogeny 68 3.3.2 Induction of Sporulation in Bacillus Isolates 69 3.3.3 Prophage Induction in Bacillus Isolates 70 3.3.4 Host Range of Phage Lysates from Bacillus Isolates 71 3.3.5 Time Series Induction of Ph age Particles from Isolate B14905 72 3.3.6 Sequencing of the B14905 Host and Phage Genomes 73 3.3.7 B14905 Prophage Genome An alysis 74 3.3.8 Isolation of Phage Particles from B14905 74 3.3.9 Phage DNA Extraction 75 3.3.10 Polymerase Chain Reaction with B14905 Phage Primers 75 3.3.11 Transmission Electron Microscopy of B14905 Phage Lysate 77 3.4 Results 77 3.4.1 Induction of Sporulation in Bacillus Isolates 77 3.4.2 Prophage Induction in Bacillus Isolates 79 3.4.3 Prophage Induction Versus Spore Production in Bacillus Isolates 79 3.4.4 Host Range of Phage Lysates from Bacillus Isolates 81 3.4.5 Time Series Induction of Ph age Particles from Isolate

PAGE 5

iii B14905 81 3.4.6 Analysis of the B14905 Bacterial Genome 82 3.4.7 Analysis of Prophage-like Regions of the B14905 Genome 82 3.4.8 Polymerase Chain Reaction with B14905 Phage Primers 92 3.4.9 Transmission Electron Mi croscopy of B14905 Phage Lysate 93 3.5 Discussion 94 References 101 Appendices 118 Appendix A: Liquid and Solid Culture Media 119 Appendix B: Buffers and Solutions 122

PAGE 6

iv List of Tables Table 2.1 Open Reading Frames of the HAP-1 Genome and BLASTP Hits 45 Table 3.1 Collection of Bac illus Strains from the Gulf of Mexico 68 Table 3.2 List of Primer Sets for B14905 PCR 76 Table 3.3 Difference in Prophage Production and Spore Production 78 Table 3.4 Open Reading Frames of the B05-1 Genome and BLASTP Hits 84 Table 3.5 Open Reading Frames of the B05-1 Genome and BLASTP Hits 87 Table 3.6 Open Reading Frames of the B05-1 Genome and BLASTP Hits 89 Table 3.7 Open Reading Frames of the B05-1 Genome and BLASTP Hits 91

PAGE 7

v List of Figures Figure 1.1 Illustration of th e Marine Microbial Loop 3 Figure 1.2 Illustration of B acteriophage Lifestyles 6 Figure 1.3 Transcriptional Regulation of Lysogeny in Lambda 8 Figure 1.4 Diagram of the Stages of Sporulation in Bacillus subtilis 12 Figure 1.5 Initiation of Sporulation in Bacillus subtilis 13 Figure 1.6 Comparison of Lysogeny and Sporulation 15 Figure 1.7 Diagram of Ge nome Shotgun Sequencing 23 Figure 2.1 Phage Production and Bacterial Growth in H.aquamarina 43 Figure 2.2 Transmission El ectron Micrographs of HAP-1 43 Figure 2.3 Genomic Map of the HAP-1 44 Figure 2.4 SDS-PAGE of Pr oteins Associates with HAP-1 Particles 49 Figure 2.5 Nucleotide Sequence of HAP-1 Inverted Repeat 52 Figure 2.6 Genomic Comparisions of F our Completed Genome s of Phages Containing a Protelomerase Gene 53 Figure 2.7 Schematic Representation s of the Two Conformations of HAP-1 54 Figure 2.8 Southern Transfer and PFGE of H.aquamarina DNA Fractions 55 Figure 2.9 Gel Electrophoresis of H.aquamarina DNA PCR Amplicons 56 Figure 3.1 Frequency of Sporulation in Bacillus Isolates after 24 hour Decoyinine Incubation 78

PAGE 8

vi Figure 3.2 Prophage Production in Bacillus Isolates after 24 hour Mitomycin C Incubation 80 Figure 3.3 Prophage Producti on and Sporulation in Bacillus Isolates 80 Figure 3.4 Prophage Induction and Bact erial Growth in Isolate B14905 81 Figure 3.5 Genomic Map of Propha ge-like Regions of B14905 85 Figure 3.6 Agarose Gel Electr ophoresis of PCR of B14905 DNA Amplicons 92 Figure 3.7 Transmission Electron Micrographs of B14905 Lysate 93

PAGE 9

vii Molecular and Genomic Studies of Temperate Phages from Halomonas aquamarina and Bacillus Spp. Isolates from the Gulf of Mexico Jennifer M. Mobberley ABSTRACT Viruses are the most abundant biologi cal entities in the ocean and are believed to contribute to nutrient cycli ng, bacterial diversity, and horizontal gene exchange. However, little is known a bout the relationship between temperate phages and their hosts in marine environm ents. In this thesis, phage-host systems from the Gulf of Mexico were used to study the influence of temperate phages in bacteria. HAP-1 is a temperate myovirus induced with mitomycin C from Halomonas aquamarina isolate. The genome of this phage was 39,245 nucleotides long and contained 46 predicte d genes. Besides genes involved in lysogeny, HAP-1 contained a protelomerase, wh ich is responsible for resolution of telomeric ends in linear plasmid-li ke phages. Hybridiza tion studies and PCR analysis indicated not only a lack of integration of the prophage in the host chromosome, but differences in genome arrangement between the prophage and virion forms of HAP-1. These results suggest that HAP-1 exists as a nonintegrating linear phage with telomeric ends. Eleven pigmented Bacillus spp. isolates were examined for the occurrence of lysogeny and sporulation through induc tion with mitomycin C and decoyinine,

PAGE 10

viii respectively. The results from thes e experiments suggested a variety of interactions can occur between phages and their hosts, some of which may influence sporulation. The lysogenic strain B14905 had high frequency of sporulation and was selected for fu rther analysis. The genome of B14905 contained 4 prophage-like regions, one of which was independently sequenced from an induced lysate. PCR and TEM anal ysis of a mitomycin C induced lysate indicated that two of thes e regions were inducible pr ophage, one was a defective phage, and one was a non-inducible phage remnant. One of the inducible prophages contained a transcri ptional regulator that is hypothesized to be involved in regulation of host sporulation. The diversity of prophage and prophage-like elements found in B14905 suggest that th e genetic diversity of phages in the oceans is vast. The studies of the temperate phages from H. aquamarina and Bacillus spp. isolates illustrates that integration of molecular, genomic, and function studies can be used to provide in sight into the influence of prophage on host bacteria.

PAGE 11

1 Chapter 1 Introduction 1.1 Viruses in the Marine Environment 1.1.1 Viral Distribution in the Marine Environment Viruses have been studied since the early twentieth century, but it has only been recently discovered that they are the most a bundant biological entities on the planet. The marine environment is the largest reservoir of viruses, where concentrations typically range from 104108 virus like particles (VLP) per ml in the water column and up to 109 VLP per cc in marine sediments based on direct-counting methods (Bergh, et al.1989, Hewson, et al.2001, Wommack and Colwell 2000). In pelagic systems, viral abundance is influenced by a variety of factors including system productivity, water depth, temperature, and season (Hewson, et al.2006, Weinbauer, et al.2003, Williamson, et al.2002). In sediments, viral abundance typically decreases with sediment depth, but is at least a magnitude greater than that of the overlying water (Danova ro, et al.2001, Paul, et al.1993). Due to their abundance, most viruses are be lieved to be bacteriophages as bacteria are the most abundant hosts with an estimated 1028 bacteria in the ocean (Copley 2002, Murray and Jackson 1992). A survey of studi es on viroplankton and bacterial abundance in a variety of marine environments by Wommack and Cowell (2000) showed that, on average, there are three to ten viruses fo r every bacterium. The abundance of viruses compared to bacteria suggests that they exert a profound impact on a variety of marine

PAGE 12

2 microbial communities. Viruses in the ocean influence the microbial community through nutrient cycling, modifying host dive rsity, and gene transfer events. 1.1.2 Effect of Viruses on Nutrient Cycling Viruses contribute significantly to nutr ient cycling in th e ocean through their interactions in the microbial loop. The mi crobial loop was proposed by Azam et al. (1983) to explain the role of heterotrophic bacteria as the pr imary consumers of dissolved organic matter (DOM) from primary producers. Bacteria also serve as a link to the marine food web due to their consumption by protist grazers and th rough their salvaging of DOM from higher trophic levels (Azam, et al.1994). Phages influence the microbial loop through lysis of phytoplankton and hete rotrophic bacteria which results in the release of nitrogen and phosophorus-rich DOM that is recycled back into bacteria (Bratbak, et al.1992) ( figure 1.1). Phages contribute to appoximately 25% of the bacterial mortality in marine systems, with values approaching 100% when there are no protists to compete (Fuhrman and Noble 1995, Weinbauer, et al.2003). Experiments have shown that viral lysis leads to decreases in primary productivity and may serve as a shunt of DOM away from higher trophic levels (Evans, et al.2003, Suttle, et al.1990). Additionally, the impact of vira l lysis was found to be strongest in areas of high bacterial production, such as coastal areas (Murray a nd Eldridge 1994). Modeling shows that the net effect of viruses in the microbial l oop is the decrease of primary and zooplankton productions and an increase in bacteria l production and respiration (Fuhrman 1999).

PAGE 13

3 Figure 1.1. Illustration of the Marine Microbial Loop. 1.1.3 Influence of Viruses on Host Diversity Temporal changes in bacterial and viral assemblages paired with relatively stable abundance of bacterial and phage populations have been demonstrated in Chesapeake Bay and the oligotrophic Gulf of Mexico (Hewson, et al.2006, Wommack, et al.1999). These findings suggest that th rough a continual cycle of infection, viruses may influence host diversity in the marine microbial commun ity. However, the extent of this influence is not well understood. The “kill the winner” hypothesis states that viruses maintain diversity through lysis of the numerically domi nant species, which allows co-existence of less competitive species (Thingstad 2000). This concept has been supported by experiments with phagehost systems such as lysis of a Vibrio natrigens PWH3A bloom with indigenous phage

PAGE 14

4 populations, and in studies of natural populations Synechococcus and cyanophages (Hennes, et al.1995, Muhling, et al.2005). However, other studies have indicated that the density-dependent “kill the wi nner” model does not take into account other factors that may influence bacterial and viral di versity (Hewson and Fuhrman 2007). Phage lysis can change the compostion of available nutrients, which can lead changes in species diversity (Arrieta and Herndl 2002, Middelboe, et al.2003). This might explain the succession of bacterial species that is seen during the course of a cyanobacterial bloom. Experiments have also shown that rare taxa may be more susceptible to phage infection than more abundant bacteria. Bouvier and del Giorgio (2007) found that incubation of ambient marine bacterial communities in the absence of viruses resulted in dominance of alphaproteobacteria and Bacteriodetes groups in both abundance and in growth rate over the more common marine taxa, gammaproteobacteria. Host resistance mechanism such as changing host surface proteins and lysogeny can decrease the susceptibility of bacteria to phage attack leading to clonal diversity (Middelboe, et al.2001, Stoddard, et al.2007). 1.1.4 Viral-Mediated Gene Transfer Phages may serve as major agents of horiz ontal gene transfer in the ocean through transduction, virus-mediated transfer of DNA from one host to another. Lytic phages perform generalized transduction which resu lts from a packaging error during viral replication that leads to random pieces of host DNA being packaged and may lead to recombination events in th e infected cell (Miller 2001). In addition to generalized transduction, temperate phages can also perfor m specialized transducti on, which is due to

PAGE 15

5 an excision error resulting in host genes that flank the prophage be ing packaged in the phage particle (Paul 1999). Jiang an d Paul (1998) estimated that 1.3 x 1014 transduction events occurred per year in the Tampa Bay Es tuary. Extrapolation of this value by Paul et al (2002) suggests that ma rine phages transduce 1028 base pairs of DNA a year in the world’s ocean. It was also demonstrated that viruses can move between biomes since lake and sediment phages were able to infect marine bacteria (San o, et al.2004). Phageencoded exotoxin genes from human pathogens were identified in the majority of soil, sediment, and water samples, and even thos e from pristine environments (Casas, et al.2006). Through horizontal gene transfer, phages contribute to host pathogenicity which is best illustrated by toxigenic Vibrio cholera that contains the cholera-toxin carrying phage CTX-phi (Waldor and Mekalanos 1996). They may also contribute to environmental adaptation of their host; one such example is the presence of photosynthetic genes in the genomes of some phages infecting ma rine cyanobacteria (Clokie, et al.2006, Lindell, et al. 2005). Th ese findings suggest th at transduction is relevant in the marine environment and ma y serve as a pathway of horizontal gene transfer in the ocean. 1.2 Phage Lifecycles 1.2.1 Summary of Phage Lifecycles Most of the knowledge about phage lifecycl es comes from classical models such as and the T-phages. Bacteriophages can enter three types of lifesty les with their host: lysis, lysogeny, and pseudolysogeny (Figure 1.2 ). During the lytic pa thway, the virulent

PAGE 16

6 phage uses the host machinery to replicate it s genome, express genes, and assemble viral particles that are released cell lysis. Lysogeny occurs wh en a temperate phage genome integrates into the bacterial chromosome or exists as a plasmid in the host cell, allowing it to be replicated along with the host genome as a prophage. The prophage remains in this stable state until it is induced, either spontane ously or by other means, and it then enters the lytic lifestyle. The fina l possible lifestyle, pseudol ysogeny, happens when both phages and hosts exist in high numbers simultaneously and there is no phage DNA integration (Ackermann and DuBow 1987). In th is state the phage is not inducible and there may be a mixture of resistant and vul nerable hosts or temperate and lytic phages (Williamson, et al.2001). Host resistance can occur for a variety of reasons including adhesion deficiency resulting from mutations in bacterial coat proteins and superimmunity to infection (Barksdale and Arden 1974). This is different from the carrier state which Ackermann and DuBow (1987) define as a persiste nt infection by a plasmid-like phage. Figure 1.2. Illustration of Bacteriophage Lifestyles

PAGE 17

7 1.2.2 The Lytic-Lysogenic Decision Temperate phages contain a genetic switch that allows the phage to follow either the lytic or lysogenic pathway. The lambda coliphage lysogenic switch has been extensively studied and serves as a model sy stem for the molecular control of genetic switches (Ptashne 2004). Following infection, th e lambda DNA circularizes to allow the host RNA polymerase to transcribe the early regulatory phage genes cII, cIII, and cro. The early gene products CII and CIII en able binding of RNA polymerase to PRE, a promoter of the lambda repressor protein CI activating transcripti on. The targets of CI are the first two of the operator regions on the lytic promoter PR and the lysogenic promoter PL; CI forms octamers at these operators forming a DNA loop that represses PR and late gene expression (Figure 1.3)( Dodd, et al.2001). The binding of CI at OR2 also stimulates the autoregulatory cI promoter PRM, which is responsible for maintaining the lysogenic state. The two cI promoters PRM and PRE must constantly transcribe CI to maintain lysogeny. CII also activates transc ription of the integr ase, Int, enabling integration of the lambda into the host chromosome. The early gene product, Cro, is resp onsible for initiati ng lysis through its antagonism with CI. The binding of Cro to th e same operator regions of the promoter regions prevents transcription of cI and in creases its own transcri ption through a positive feedback loop (Ptashne 2006) Without CI repressing PR, late lytic genes such as phage structural proteins are transc ribed leading to host lysis. Lysis is the default pathway for most viral infections; it is only when CI reach es a certain level and is maintained that lysogeny can occur.

PAGE 18

8 Once initiated, lysogeny can be stable for many bacterial generations. However, when a lysogenic bacterium undergoes dama ge or conditions fa vor lysis, the SOS response is activated leading to induction of the temperat e phage. In the laboratory, the SOS response is often elicited with muta genic chemicals such as Mitomycin C or physically with UV, but natural inducers such as temperature and nutritional state can cause induction (Shinagawa 1996). The SO S response produces the protease RecA, which turns off the lysogenic switch by cleav ing the CI protein (Cohen, et al.1981). Since CI is unable to bind to the PRM operator the positive autoregulation ceases and Cro takes its place to initiate the lytic response. Figure 1.3. Transcriptional Regulation of the Lambda. Panel A shows the organization of the lyticlysogenic switch. Panel B shows a cartoon CI octamer occupying the operator regions of PL and PR. Transcrition of the cI gene from the PRM promoter by RNA polymerase (RNAP) is stimulated by CI bound at the OR2 but repressed by CI bound at OR3. Reprinted with permission from Cold Springs Harbor Press ; Dodd et al. Genes Dev. 2001. 15:3013-3022.

PAGE 19

9 The lysogenic-lytic switch is also in fluenced by the degradation of CII by the cellular protease FtsH. Kihara et al (1997) have proposed that when FtsH levels are high, such as when there is high cell density and or rapid growth, CII is degraded quickly so CI cannot be expressed, leading to lysis. When pr otease levels are low as a result of low cell density, CII is not degraded as quickly allowi ng cI to be expressed and lysogeny to occur (Kihara A., et al.1997). The early gene pr oduct CIII is a competitive inhibitor of FtsH that prevents binding of CII to the protease therefore enhancing development of lysogeny (Kobiler, et al.2007). 1.2.3 Effect of Lysogeny on Bacterial Processes The presence of lysogens in many diffe rent bacterial isolates and in the environment suggests that lysogeny provides net positive effects (Canchaya, et al.2004, Wommack and Colwell 2000). The establishmen t of a lysogenic infection is not only beneficial to the phage, due to protection fr om adverse environmental conditions, but it also influences the host fitn ess as well (Brussow, et al.2004 ). Some negative effects on host fitness include disruption of host gene s by integration of pha ges, the increased metabolic cost of replicating additional DNA, and the eventual killing of the host. Positive effects include protection from infection from similar phage through homoimmunity, lysis of clos ely related strains, and ly sogenic conversion (Ackermann and DuBow1987). During lysogenic conversion, prophages pr ovide genes that have no function in the phage but are able to incr ease the fitness of their host (Paul 2007). Some of the best studied examples of this are phage-encode d toxin genes that cause an increase in

PAGE 20

10 pathogenicity such as in the case of c holera toxin encoded by CTX-phi, phages of Streptococcus pyogenes, and vibriophage VHML (Canchaya, et al.2004, Oakey and Owens 2000, Waldor and Mekalanos 1996). Ly sogenic conversion has also been implicated in phenotype alterations. Fo r example, a gene for phosphoenolpyruvate carboxykinase, the first gene in the gluconeogenesis pathway, was down-regulated by the cI repressor in a lysogenic Escherichia coli strain; the authors believe that this increases lysogenic fitness by lowering the growth ra te (Chen, et al.2005). Suppression of carbon utilization based on phenot ypic tests occurred in Vibrio harveyi infected with temperate phage VHML and in Listonella pelagia infected with pseudotemperate phage HSIC (Paul, unpublished data, Vidgen, et al.2006). Thes e studies suggest th at temperate phages reduce metabolism in their host to increase the like lihood of lysogeny. This would confer a longer survival of lysogens in a nutrient poor environment, such as the oligotrophic ocean, compared to uninfected bacteria. 1.2.4. Lysogeny in the marine environment Numerous studies have shown that lysoge ns are a component of marine microbial populations. Forty-three percen t of marine heterotrophic ba cterial isolates tested contained inducible phag e (Jiang and Paul 1996). Synechoccocus isolates from the Gulf of Mexico were also found to have inducible phage (McDaniel, et al.2006). A survey of mitomycin C induction studies fr om a variety marine environm ents showed that prophage induction ranged from non-detectable to ne arly 100 percent (W einbauer 2004). Although the presence of lysogens has been investig ated using artificial means to induce phage, there is still questions about the factors that control lysogeny in the marine environment.

PAGE 21

11 Nutrient availability ha s been proposed to influe nce the lysogenic switch, although studies with nutrient amendments have shown varied results (McDaniel and Paul 2004, Motegi and Nagata 2007, Williams on and Paul2 004). Temperature, salinity, and sunlight may impact lysogeny in certain environments (Weinbauer and Suttle 1999). Anthropogenic pollutants including pesticides and hydrocarbons have also been shown to induce phage in the environment (Cochr an, et al.1998, Danovar o, et al.2003). Host abundance may have the largest influence on lysogeny in the ocean. Studies in various marine environments have shown that high host density favors the lytic cycle while lysogeny dominates during low host de nsity (Long, et al.2007, Mc Daniel and Paul 2005, Weinbauer, et al.2003). S easonal studies of the Tamp a Bay estuary have shown that viral induction, that is lysogeny, in both autotrophic and hete rotrophic bacteria is greatest during the winter months when prim ary and secondary production and nutrients were low (Williamson, et al. 2002). Additionally, lysogeny seems to dominate in oligotrophic offshore environments while envi ronments with nutrients, such as river plumes or estuaries had lower inciden ces of lysogeny (McDaniel and Paul 2004, Weinbauer and Suttle 1999). 1.3 Sporulation 1.3.1 Initiation of Sporulation Like lysogeny in temperate phages, some gram-positive bacteria have the ability to respond to unfavorable conditions by spor ulation. During sporulation the bacterium replicates its genome and releases an envi ronmentally resistant endospore (Figure 1.4). The spore lies dormant until conditions improve and it can germinate to resume a

PAGE 22

12 vegetative lifestyle. Spore formation is a complex developmental event requiring coordinated expression of diffe rent sets of genes in the mother cell and the developing spore. Premature or delayed s porulation leads to cell death so it is imperative that the initiation of sporulation pro cess is strictly controlled. Figure 1.4. Diagram of the stages of sporulation in Bacillus subtilis. Reprinted with permission Nature Publishing Group. Straiser and Losick. Ann. Rev. Gene. 1996. 30:297-342 In Bacillus species, sporulation is coordinated by several different factors that regulate phosophorylation and dephosphorylation events and a cascade of sigma factors (Figure 1.5). When nutri ent levels are high, the vegetative promoter PV is constantly transcribing sinR, a repressor of spo0A and stage II sporulat ion genes (Mandic-Mulec, et al.1995, Shafikhani, et al.2002). When the cell se nses that nutrient levels are low sigma factor H activates tr anscription of Spo0A.

PAGE 23

13 Figure 1.5. Diagram of the Pathways involved in Sporulation Initiation in Bacillus subtilis. Reprinted with permission Elsevier Science Ltd. Sonenshein. Curr Oppin Microbiol. 2000. 561-566. Spo0A is the response-regulator in a tw o-component signal transduction and the key decision maker in the in itiation of sporulation (Fujit a and Losick 2005, Molle, et al.2003). The competition between kinases and phosphatases affecting Spo0A determines whether or not the cell will initiate sp orulation. The phosphorylation of Spo0A is controlled by a complex phosphorelay system that is positively affected by high cell density (Spo0F, Spo0B, abrB), low nutrients (codY, Rap), and other metabolic signals such as DNA replication and damage (Dworkin and Losick 2001, RatnayakeLecamwasam, et al.2001, Shafikhani, et al .2004). High levels of phosphorylated Spo0A directly activate transcription of 121 genes, in cluding at least three operons that encode components of the sporulation sigma factor cascade (Molle, et al.2003). Phosphorylated Spo0A also activates expression of si nI from the sporulation promoter PS. SinI binds to

PAGE 24

14 and inactivates SinR, permitting transcripti on of sporulation genes in the bacteria (Sonenshein 2000). Commitment to sporulation allows other sigma factors to initi ate polar septation and DNA pumping resulting in the formation of two cell types; a mother cell and the forespore (Piggot and Losick 2002). When formation of the forespore cell wall is complete the cell lyses releasing the mature spore into the environment. This spore is resistant to UV, temperature, and chemi cals and may persist for many years in the environment (Nicholson 2002, Setlow 2006). Once favorable conditions are restored, the spore can quickly germinate into a vegetative cell (K eijser, et al.2007, Setlow 2003). 1.3.2 Comparison of Prophage Induction and Sporulation Prophage induction and sporulation are ad aptations by phages and bacteria to respond to unfavorable environmental conditi ons. During both processes, the genome of the phage or bacteria is replicated and exists in a form that increases its survival (Figure 1.6). The initiation of both prophage induction and sporulation involve the repression and activation of promoters that are regulated by f eedback from their gene products. cI binds to the lytic promoter PR during lysogeny while cro binds to PR during a virulent infection (Ptashne 2004). SinR binds to the vegetative promoter PV in the Sin operon during normal cell conditions and SpoA activates the sporulation promoter (Mandic-Mulec, et al.1995). The tertiary structure of th e DNA-binding domain of sinR from Bacillus subtilis and cI and cro from the Escherichia coli phage 434 are nearly identical (Lewis, et al.1998).These structural a nd functional similarities indica te a possible evolutionary relationship between prophage induction and sporulation.

PAGE 25

15 Figure 1.6. Comparison of Lysogeny and Sporulation. Reprinted with permission Elsiever Science Ltd. Lewis et al., 1998, Genes and Development. 283. 907-912. 1.3.3 The Genus Bacillus The Bacillus genus is composed of physiologi cally diverse spore-forming gram positive bacteria that have been isolated from virtually all biomes. Members of Bacillus include common soil bacteria such a B. subtilis and the causative agent of anthrax, B. anthracis In the marine environment, Bacillus species have been isolated from the water column, sediments, hydrothermal vents, and tidal flats (Caccamo, et al.2001, Siefert, et

PAGE 26

16 al.2000, Stevens, et al.2007). Marine Bacillus have also been found to produce novel metabolites, including ones from marine s ponges that inhibit biofouling bacteria, and isolates that oxidize mangane se in the deep-sea (Dick, et al.2006, Kanagasabhapathy, et al.2005). Two studies found pigmented Bacillus isolates in esta uaries, oligotrophic waters, and sediments (Du, et al.2006, Si efert, et al.2000). The presence of Bacillus in diverse marine environments may indicate that this genus is an important component of the marine microbial community. Their widespr ead distribution also serves as a testament to the ability of spores to survive in adverse conditions. 1.3.4 Bacteriophages of Bacillus Virulent, temperate, and pseudotempe rate bacteriophages that infect Bacillus have been studied and characterized (Hemphill and Whiteley 1975). Meijer et al (2005) found that lytic development of the virulent Bacillus phage 29 was repressed in sporulating cells. Host SpoA inhibited transcription of early phage genes, while host chromosomal partitioning proteins ensured the phage was pack aged into the developing spore (Meijer, et al.2005). The same mechanis m may occur in temperate phages, as well, since lytic development was suppressed during sporulati on with no viral production occurring when induced with UV (Osburne and Sonenshein 1976). This phenomenon could be a type of carrier state that serves as a survival mechan ism allowing for the phage to be protected in the spore during conditions that are unfavorable to infecti on such as low host abundance during nutrient depleted conditions. Survival would be increased if the phage contained genes that allowed the host to sporulate at a higher frequency than non-infected bacteria. Phages that can perform this function ar e known as spore-converting phages and have

PAGE 27

17 been found in Bacillus and Clostridium species (Bramucci, et al.1977a, Silver-Mysliwiec and Bramucci 1990, Stewart and Johnson 1977). Most of the studi es on spore-converting Bacillus phages were performed in the 1970s and 1980s, and there is little recent in formation available about these phages and none of the phage genomes have been sequenced. Bramucci et al. (1977) characterized PMB1, a pseudotemperate phage that converts spore-negative B. pumilus mutants into spore positive isolates. Another pseudotempe rate phage, PMB12, increased the frequency of sporulation in spore-negative B. subtilis strains (Kinney and Bramucci1981). The pseudotemperate transducing phage TP-13 incr eased the sporulation of an oligosporgenic B. thuringiensis isolate (Perlak, et al.1979). There ha ve been few studies on the mode of sporulation enhancement in spore-convert ing phages. Phages PMB12 and SP10 are believed to induce sporulation through catab olic repression of th e host, thus causing sporulation to occur when there are availabl e nutrients (Silver-Mysliwiec and Bramucci 1990). Genomic studies with different system s have shown that phages may influence sporulation through transcriptiona l regulation. The genome of the C. perfringens temperate phage 3226 contained a sporulation-associat ed sigma factor homolog and a sporulation-dependent transcri ptional regulator (Zimmer, et al.2002). Four genes from the B. anthracis temperate phage W were found to be active during sporulation; one of the genes was similar to a RNA-polymerase dependent sigma factor (Schuch and Fischetti2006). These two studies support the hypothesis presented by Stewart and Johnson (1977) that spore-converting pha ges enhance sporulation through phage conversion.

PAGE 28

18 Although phages have been identified in terrestrial Bacillus species, the phages infecting marine Bacillus isolates have not been studi ed. Only one published study was found that characterized the bi ology of two lytic phages from Bacillus isolates found in the deep-sea hydrothermal vent (Liu, et al.2006). There have been no studies were investigating the host-phage interactions at a molecular level. 1.4 Microbial Genomics 1.4.1 Bacteriophage Genomics Genomics is the study of all the genetic information encoded by the nucleotides in a system, which can be as small as a single or ganism or as large as an entire microbial community. The advent of genomics has allowe d researchers to analyze bacteria and their phages on a molecular level that is not possibl e with culture-based methods. Most of our knowledge about prophage genomics comes from work on medically and commercially relevant systems such as E.coli Lactobacillus and Streptococcus (reviewed in Canchaya, et al.2003). Studies of prophages found in bacterial genome and phage genomes have contributed to our understa nding of phage genetics. The largest group of sequenced bacteriopha ges is the tailed phages with doublestranded DNA genomes. At the nucleotide le vels there was little conservation between different phages, but there was conservation in the organization of groups of genes (Hendrix, et al.1999). These groups of functionally related ge nes are known as “modules” and they contribute to mosacism seen in almost all phage genomes through genetic recombination (Botstein 1980). The mosaic nature of phage genomes has been verified in

PAGE 29

19 numerous studies including Streptococcus thermophilis siphoviruses, lamboid coliphages, and marine phages (Brussow and Desiere 2001, Juhala, et al.2000, Paul, unpublished). The mosaic organization of phage genome s can be used to infer functional and evolutionary relationships between different phage types. A lytic S. thermophilis phage contained a degraded lysogeny module with no integrase-like genes indicating that lytic phages might be derived from temperate phages (Lucchini, et al.1999b). Studies of phages from B. anthracis and B. subtilis have also shown differences in presence of modules between lytic and temperate phage s (Earl, et al.2007, Schuch and Fischetti 2006). The gene content of phages has also been proposed as an alternative to morphology to classify phage type s (Rohwer and Edwards 2002) Sequencing of bacterial genomes has re vealed that prophages are abundant in cultured isolates. Identifying prophages in annotated genomes bacterial genomes is usually done by comparing the similarity of th eir genes to known prophage genes. Due to their diversity, there is no sp ecific gene that can be used to differentiate prophages from other elements in host chromosomes. Integras es are often used due to their conserved nature, but this approach can miss plasmi d-like prophages and also identify non-phage integrative agents (Balding, et al.2005, Casjen s 2003). Phage structur al genes including terminase, capsid, and tail genes have been used to identify prophage regions in aquatic bacteria (Krupovi and Bamford 2007). Identifyi ng prophage-like gene clusters (modules) within bacterial genomes is most likely the best strategy for identifying phages in silico (Casjens 2003, Paul 2007). Canchaya et al. (2004) used a computer to identify 190 prophage-like regions in 115 bacterial genomes Cluster analysis and attachment site characteristics were used to identify propha ge regions using the perl-script program

PAGE 30

20 Phage-Finder, which was able to identify 91% of the prophages in a group of bacterial genomes with 7% false positives and 9% false negatives (Fouts 2006). The main caveat of using similarity searches is its dependence on annotati on, particularly in uncurated, computer-based ones which can l ead to misidentifications. Comparative genome sequence analysis ha s shown that bacterial pathogens and their temperate phages have coevolved, main ly through lysogenic conversion (Brussow, et al.2004). Temperate phage genomes have been found to carry toxin genes and sporulation related genes that can increase host virulence or survival (Sakaguchi, et al.2005, Zimmer, et al.2002). A survey of 27 different strains of E.coli O157:H7 found 51 shiga-toxin containing phages (Osawa, et al.2000). Genetic variab ility in bacterial genomes can also be attributed to phages. Smoot et al. (2002) found that the alignment gaps of different strains of methicillin resistant S. pyogenes serotypes were due to differences in types of prophage present (Smoot et al.2002). The presence of four phages found in B. anthracis genomes to date have been used to differentiate these anthrax causing strains from other strains in the B. cereus family (Sozhamannan, et al.2006). In silico analysis of bacterial genomes has al so revealed the presence of prophagelike elements (reviewed in Casjens 2003) Defective phages may contain functional phage proteins, but are unable perfor m the full infective phage cycle. The B. subtilis defective phage, PBSX, contai ns structural and lytic gene s that enable it to package random 13kb portions of the host chromosome into phage particles when induced with mitomycin C (Hemphill and Whiteley 1975, Wo od, et al.1990). Defective phages also include phage remnants, which are non-inducib le entities present in bacterial genomes, which may be result from prophage decay. Sa tellite phages are fully functional but lack

PAGE 31

21 structural genes so they depend on other phages for encapsulating their genomes; the satellite phage P4 and helper phage P2 are the best st udied example (Lindqvist, et al.1993). Bacteriocins are proteinaeous particle s that have bacteriocidal activity against closely related strains (Daw and Falk iner 1996). Some high molecular weight bacteriocins resemble phage tails including the F and R types of Pseudomonas aerginousa Carotovoricin Er from Erwinia carotovora and bacteriocins from B. axotofixans (Nakayama, et al.2000, Nguyen, et al .1999, Seldin and Penido 1990). Gene transfer agents which were first identified in Rhodobacter capsulatus are tailed phagelike particles that are able to package parts of the bacterial genome s, and are able to transfer DNA through homologous recombinati on (Lang and Beatty 2000). They have been found to have a conserved genomic or ganization and are present in other alphaproteobacteria (Lang and Beatty 2007, Paul 2007). 1.4.2 Sequencing Prophage Genomes Most prophage genomes are below 100 k ilobases in size compared to 4 megabases in bacterial genomes, making them relatively quick and inexpensive to sequence independently. The general strategy for obtaini ng a prophage genome is isolation of phage particles, extraction of nucle ic acid, sequencing, and assembly and annotation. Prophage particles are usually obtained through inducing a lysogenic isolate through chemical or physical means. After remo val of cell debris, th e phage particles are concentrated and purified in preparation for sequencing. The vast majority of genome seque ncing projects utilize shotgun sequencing methods. Shotgun sequencing is a method us ed to sequence short fragments of DNA

PAGE 32

22 from whole organisms or communities (Fleis chmann, et al.1995, Venter, et al.2004). The process is essentially the same as with tr aditional Sanger molecular cloning with a few exceptions that will be briefly noted. Extr acted DNA is randomly sheared into smaller pieces (2,000-200,000 basepairs) by mechanical means before insertion in the cloning vector. Cloning vectors include plasmid systems that can accommodate smaller fragments, as well as bacterial artificial chromosomes (BACs) and fosmids which can accommodate large DNA fragments. The resu lting clone DNA libraries are randomly or directly selected for end-sequencing; this pr ocess is repeated for several rounds to get high sequence coverage. Once sequence read s are generated, they are matched by overlapping sequences into larg er contiguous pieces (contigs) using computer algorithms. Depending on source and the quality of DNA, these contigs can be assembled into complete genomes. An alternative to the clone-based libra ries is pyrosequencing, also known as massively parallel sequencing or 454, which us es fluidics and optics to generate large amount of sequence data in a fraction of time and cost of traditional sequencing (Margulies, et al.2005). The major drawbacks of this method is the generation of sequence reads between 100 and 200 basepairs and the lack of paired end sequences, which can complicate assembly. However th is technology has been used for marine metagenomic studies including the global o cean sequencing project and metaviromes (Angly, et al.2006, Rusch, et al.2007 Mcdaniel, unpublished data).

PAGE 33

23 Figure 1.7. Diagram of Genome Shotgun Sequencing. Sequencing marine phages involves two cha llenges not present in most bacterial sequencing projects (Paul, et al.2002). The biggest challenge is obtaining enough phage DNA for shotgun sequencing; this is especially true for phage s extracted directly from seawater. Most marine bacterial isolates gr ow slowly and do not reach the high density and growth rate as seen in non-marine isolates such as E.coli The DNA yield from induced phage lysate is often in nanograms while more than 1 microgram is needed for shotgun cloning. The other challenge is uncl onable phage DNA due to base modification by methylation and phage-encoded cytolytic ge nes. To circumvent these problems clone

PAGE 34

24 libraries of marine phages are created through random amplification (Rohwer, et al.2001). Linker-amplified shotgun libraries (LASL) are created by ligating a doublestranded DNA linker to hydrosheared pieces of phage DNA. PCR using a primer specific to this linker region not only randomly amp lifies the phage DNA but transforms modified DNA into unmodified. Clone libraries are constructed using the amplified DNA and sequenced (http://www.sci.sdsu.edu/PHAGE/LAS L/). LASL have been successfully used to clone the genome of the pseudotemperate phage HSIC and an environmental metavirome (Breitbart, et al.2002, Paul, et al.2005). Once the initial shotgun sequencing is done, viral genome contigs are closed through “primer walking” PCR (Rohwer, et al.2000). 1.4.3 Genomics of Marine Phages Since the first marine phage genome, Pseudoalteromonas espejianana BAL-31 PM2, was published by Mannisto et al. (1999), we have grea tly increased our knowledge of marine phage genomics and their interacti on with their hosts (re viewed in Paul and Sullivan 2005). Paul (2007) looked for the presence of prophages in the genomes of 102 marine bacterial isolates; 60 putative pr ophages were found in 43 marine bacterial genomes. A surprising finding was that 21 of these prophages resembled gene transfer agents and had a conserved genomic orga nization. The author also found that 41 temperate phages (39 prophage-elements and 2 phage genomes) had a higher occurrence of transcriptional regulators compared to 21 lytic marine phages, suggesting that temperate phages may play a role in regul ating gene expression in their hosts (Paul 2007).

PAGE 35

25 Two marine pseudotemperate phage genom es indicate that pseudolysogeny might be a viable strategy in a diverse number of marine environments. Listonella pelgia formerly Vibrio pelagius phage HSIC was originally isolated from surface waters near of Oahu, HI (Jiang, et al.1998). An unusual f eature of this phage was its ability to integrate into the host chromosome (Williams on, et al.2001). The genome contained 47 ORFs, but functional predictions could only be made for 9 of them (Paul, et al. 2005). Expression studies using macroarrays indica ted that phage genes were differentially expressed under different salinities (Long, A., Patterson, S., Paul, J.H. 2007). JL001 is a siphovirus-like pseudotemperate phage isolat ed from a alphaproteobacterium found on the surface of the sponge Ircinia strobilina in Key Largo, FL (L ohr, et al. 2005). The genome of this isolate was 63.5 kb in length; only 17 of 91 ORF had matches to other phage and bacterial sequen ces in GenBank. Although the JL001 genome contained an integrase, functional studies showed that it did not integrate into the host genome. The discovery of core photosynthe tic genes of photosystem II in lytic cyanophages infecting Synecheccoccus and Prochlorococcus suggests these genes play an important role in the life style of the phage (Lindell, et al. 2004, Mann, et al. 2003). Cloakie et al. (2006) performed transcripti onal studies in cyanophage S-PM2 found that psbA was expressed at high levels throughout the infection cycle. The host was working at a constant photosynthetic capacity during infection suggesting that phage-encoded psbA helped maintain levels of D1 until lysis (Lindell, et al. 2007). Cyanophage genomes from a variety of marine isolates were searched for the presence of psbA and psbD Eighty-eight percent contained psbA and the 50% of cyanophages that had both genes were broad host range lytic phages (Sullivan, et al. 2006).

PAGE 36

26 Recent findings have shown that RNA viruses may be abundant in some marine systems. The RNA-dependent RNA polymer ase gene on the genome of a ssRNA virus infecting the marine diatom Rhizosolenia setigera shares little nucleotide level homology with known RNA viruses (Shirai, et al.2006). Three RNA viruses were found as a result of metagenomic sequencing of RNA viruses o ff the coast of British Colombia (Culley, et al.2007). Two of the viruses shared sim ilarity with known picornaviruses, and amplification studies found that they were abundant in the near-shore surface waters off British Colombia. The other virus was classified as a Tombus viruses but its sequence was divergent enough to known RNA viruses that it may represent a new clade. 1.4.4 Marine Metaviromics One of the biggest problems in marine mi crobiology is the lack of cultivability of the majority of marine bacteria (Rappe and Giovannoni 2003). This limits the phage types that can be studied using traditi onal culture-based microbiological methods. Shotgun metagenomics, which is the sequenc ing of whole community DNA extracted directly from the environment, has revol utionized marine microbiology. The most notable examples are the sequencing of the Sargasso Sea metagenome in 2004 and metagenomic data from the first stage of the global ocean survey (GOS) (Venter, et al.2004, Yooseph, et al.2007). Shotgun sequenci ng of marine metaviromes provides a way to explore the diversity of phages in the ocean. Breitbart et al. (2002) seque nced the first marine metavirome from water collected off a dock at Scripps Pier, San Diego. A thir d of the genes in this metavirome were similar to other sequences; onl y ten percent were similar to phage genes and one percent

PAGE 37

27 was similar to eukaryotic viral genes. Th e metavirome of near-shore sediment gave similar results; 75% of the genes were unknown and most of the known genes were similar to those in temperate phages (Breitbar t, et al. 2004). The metavirome of marine RNA viruses found a high diversity of RNA viruses, including several unknown viral genotypes (Culley, et al. 2006). Pyrosequencing was used to produce 184 metagenomic assemblages from 68 diverse marine sites in four regions (Angl y, et al.2006). The globa l viral diversity was extremely high and the distribution of viru s genotypes varied regionally, although some species were found in multiple environments. These findings support the hypothesis that “everything is everywhere, but the envir onment selects”. The GOS metagenomic study has provided additional information on viruse s in the ocean. Only 27.5% of the viral proteins identified from the GOS contain ma tches to known protein families (Yooseph, et al.2007). Sixty percent of the psbA and psbB genes were related to those in sequenced cyanophages and gene transcripts for these two genes were found in the Mediterranean, indicating the prevalence of these viral-enc oding genes in the ocean (Sharon, et al. 2007). Another culture-independent approach to observing viral distribution and diversity are amplification based studies. The T7 DNA polymerase from lytic podophage contained conserved loci that can be used to examine viral diversity of T7-like podophages. Breibart et al. ( 2004) found that T7-like phages were found in nearly every sample from diverse environments. Furthe rmore, a group of nearly identical T7 DNA polymerases were found in 75% of the environments, implying rapid movement of phages between viromes. Amplification of th e g20 conserved structur al cyanophage gene

PAGE 38

28 found that similar sequences were present in a variety of di fferent aquatic environments (Short and Suttle 2004). 1.4.5 Beyond the Genome Nucleotide sequences enable functional ge ne predictions to be made; however, other methods are needed to look at the transc ription and translation of genes in order to characterize the functioning of a system. Gene expression is the process by which genes are transcribed into mRNA then translated into functional proteins (Primrose and Twyman 2003). Cellular activit ies in microbes occur through constant activation or deactivation of gene expression in response to changes in their environment. Gene expression can be measured and detected by several different means including reversetranscript PCR and array technologies (P rimrose and Twyman2003). Proteomics, the study of the protein component of an organi sm, is necessary because proteins are the ultimate products of most genes. A popular approach to studying protein expression is the “shotgun” approach where protei ns are separated, digested into crude peptides, then analyzed using mass spectrometry (rev iewed in Patterson and Aebersold 2003). Proteomics and transcriptomics provide an avenue for functional analysis of marine phages. The pseudotemperate phage-host system L. pelagia / HSIC is an example of integration of different “-omic” approaches to look at marine phage biology. The biology of the host and phage have been examined and the phage genome and proteome were characterized (Jiang, et al.1998, Paul, et al.2005, Williamson, et al.2001). Gene expression studies of the phage under different salinities revealed environmental factors

PAGE 39

29 influencing phage (Long et al.2007). Carbon utilization e xperiments of wild-type and phage cured strains of L. pelagia shed light on the influen ce of phage on host phenotype (Paul 2007). A strategy for investigating prophages is the use of host genomic data ( in silico ) as basis for functional studies ( in vivo ). Chen et al. (2006) used this method to examine the inducibility of prophage-like regions found on the genome of the marine bacterium Silicibacter sp. strain TM1040. Traditional phage assays and PCR showed that three of the five prophage-like regions were mitomy cin C inducible (Chen, et al.2006). Another study isolated phage particles of two temperate phages from Desulfovibrio vulgaris that were initially identified in the host geno me (Walker, et al.2006).Combining traditional host-phage characterization with genomic and functional studie s can be used to provide insight into the influence of prophage genomes on host metabolism and fitness in marine bacteria.

PAGE 40

30 1.5 Research Objectives Bacteria and phages have developed syst ems such as sporulation and lysogeny for dealing with environmental stresses. These sy stems have been characterized in laboratory strains of medically and agricu lturally important bacteria a nd their respective phages, but little research has been done on these processe s in marine isolates. The objectives of my research were to examine different host-phage systems from the Gulf of Mexico using a combination of genomic and molecular methods: 1. Characterization of a Halomonas aquamarina temperate phage HAP-1 2. Examination of the occurrence of lysogeny and sporulation in a collection of marine Bacillus spp. isolates

PAGE 41

31 Chapter 2 The Temperate Marine Phage HAP-1 of Halomonas aquamarina Possesses a Linear Plasmid-like Prophage Genome 2.1 Chapter Summary A myovirus-like temperate phage, HAP-1, was induced with Mitomycin C from an Halomonas aquamarina isolate from surface waters in the Gulf of Mexico. Induced cultures produced significantly mo re viral-like particles (3.73 x 1010 VLP ml-1) than control cultures (3.83 x 107 VLP ml-1). The induced phage was sequenced using linkeramplified shotgun libraries and found to c ontain a genome 39,245 nucleotides in length with a G+C content of 59 percent. The HAP-1 genome contained 46 putative open reading frames (ORFs) with 76 percen t sharing significant similarity (e<10-3) at the protein level with other seque nces in GenBank. Putative functional gene assignments included small and large term inase subunits, capsid and tail genes, an N6-adenine-DNA methyltransferase, and lysogeny-related genes. Although no integrase was found, the HAP-1 genome contained ORFs similar to protelomerase and parA genes found in linear plasmid-like phages with telomeric e nds. Southern probing and PCR analysis of host genomic, plasmid, and HAP-1 DNA indicated a lack of integration of the prophage with the host chromosome, and a difference in genome arrangement between the prophage and virion form. The lin ear plasmid prophage form of HAP-1 begins with the protelomerase gene, presumably, due to the activity of the protelomerase, while the induced phage particle has a circularly perm uted genome that begins with the terminase

PAGE 42

32 genes. The HAP-1 genome shares synteny and gene similarity with coliphage N15 and vibriophages VP882 and VHML, suggesti ng divergence from a common ancestor. 2.2 Introduction Temperate phages can exist either in a lyti c or lysogenic state. In the lysogenic state, the prophage is replicated along with the host genome. Jiang and Paul (1994) found that greater than 40% of marine bacteria is olates screened contained inducible phages. Studies in natural marine populations have in dicated that environmental cues, such as host density and temperature, may influen ce the incidence of lysogeny (McDaniel and Paul 2005, Weinbauer and Suttle 1999, Willia mson, et al. 2002). Although temperate phages are abundant in bacterial isolates and natural environments, little is known about the molecular control of lysogeny in mari ne bacteria. Sequencing and experimental characterization of temperate marine pha ge genomes may offer insights into novel lysogenic interactions that occur in the ocean. Most temperate bacteriophages integr ate into the host chromosome during lysogeny. However, some phages such as Escherichia coli phage P1 and phage cp32 from Borrelia burgdorferi exist as low copy-number pl asmids (Eggers and Samuels 1999, Ikeda and Tomizawa 1968). Escherichia coli phage N15, Klebsiella oxytoca phage KO2, and Yersinia enterocolitica phage PY54 are a group of closely related phages that exist as linear plasmid-like prophages with covalently closed hair pin ends (telomeres) due to the activity of a phage-encoded protelomerase protei n (Casjens, et al.2004, Hertwig, et al.2003a, Ravin 2003) During lysogeny, the protelomerase cuts the prophage DNA at an inverted repeat located between th e coding regions of the replication protein

PAGE 43

33 and then resolves the ends with phosphodiester bonds. The resulting plasmid prophage gene order is 50% circularly permuted with respect to the virion DNA, such that the terminase genes are found towa rds the middle of the prophage conformation (Hertwig, et al.2003a, Ravin 2003). In addition to a protel omerase, the genomes of these linear plasmid-like phages contain similar lysogeny mo dules and replication genes, as well as plasmid partitioning genes to ensure daughter cells receive a copy of the phage genome (Casjens, et al. 2004, Hertwi g, et al. 2003b, Ravin, et al. 2000). The presence of protelomerase genes in the genomes of Vibrio harveyi temperate phage VHML and the uncharacterized Vibrio parahemoloyticus phage VP882 indicate that linear plasmid-like prophages may be common amongst cultivated marine lysogens (Oakey, et al. 2002) Halomonas aquamarina formerly known as Deleya aquamarina is a gramnegative halophilic -proteobacterium that has been isolat ed from a variety of marine and hypersaline environments including the pela gic ocean, deep-sea hydrothermal vents, the brine-seawater interf ace of deep sea brine pools, and coastal surface waters (Kaye and Baross 2000, Ortifosa, et al. 1995, Sass, et al. 2001). The phage-host in teractions of two temperate myoviruses infecting Halomonas species from the Great Salt Plains in Oklahoma, and two temperate siphoviruses from Halomonas halophlia isolated from hypersaline soil have been characterized, but these phages have not been sequenced (Calvo, et al. 1988, Seaman and Day 2007). To increase our knowledge of marine prophage genomics, we characterized a temperate phage, HAP-1, in an H. aquamarina isolate from the Gulf of Mexico, with respect to morphological characteristics, nucleotide sequence, and overall phage-host relationship. Prophage induction resulted in tailed phage particles resembling members of

PAGE 44

34 the Myoviridae. Finally, genomic properties of the pha ge were experimentally analyzed, including presence of telomeric ends and its existence as a linear plasmid. 2.3 Material and Methods 2.3.1 Isolation of Host and Phage Particles Halomonas aquamarina was isolated from the surface waters of the Gulf of Mexico during a 2001 research cruise (Lat 26, 00 min. N, Long 83, 35.6 min W). Vortex flow filtration was used to concentr ate the water sample (Jiang, et al.1992). The retentate was heated at 80C for 10 minutes, then plated onto artifici al seawater nutrient agar plates (ASWJP+PY) (Paul and Myers 1982), a procedure employed to select for spore-forming bacteria. The H. aquamarina isolate was identified by partial sequencing of a cloned PCR product obtained by using a ba cterial 16S universal primer set (Griffin, et al.2001). The bacterium was maintained in pure culture by mont hly plating on A&PY plates, as well as, in 25% glycer ol stocks kept at -80 C. H. aquamarina phage particles were isolated by a mitomycin C (mit C) induction procedure. Fifty ml of overnight H. aquamarina culture was inoculated into 450 ml ASWJP+PY and grown to log phase (OD600=0.4). Mitomycin C (1 g ml-1) was added to the culture and incubated for 24 hours at 28 C. A bacteria-free viral lysate was obtained by centrifugation at 11,000 X rpm and filtering the supernatant through 1.0 m, 0.4 m, and 0.2 m filters. Deoxyribonuclease (DNase I) and Ribonuclease (RQ1) (Promega, Madison, WI) were each added (1 g ml-1) and incubated at room temperature for 30 minutes. The phage particles were further c oncentrated and purified essentially as described by Sambrook and Russell (2001) The phages were precipitated with

PAGE 45

35 Polyethylene Glycol 6000 (PEG) a nd eluted in 2.0 ml of 0.02 M filtered 75% artificial seawater (ASW). The phage particles were purified by discontinuous cesium chloride gradients of 1.7 1.5 and 1.35 in polycarbonate tubes, the samples were spun at 29,000 X rpm for 2 hours at 4 C. The purified phage band was collected using a syringe from the 1.5 -1.35 interface. Phage particles were enumerated by filtering 1 mL of a 10-6 dilution of the cesium chloride viral lysate onto 0.02 m 25mm glass Anodisc filters (Whatman, Maidstone, England). The filters were stained with Sybr Gold at a final dilution 1:10,000 (Molecular probes, Eugene, OR) (Chen, et al. 2001). The filters were stained for 12 minutes in the dark, blotted dry, then mounted on gla ss slides with a an tifade solution (pphenylenediamine (10%w/v) in 50/50 phosphate -buffered saline and filter sterilized glycerol). Virus-like particles (VLPs) were enumer ated under blue light excitation with an Olympus BH-2 epifluorescence microscope. At least 200 phage particle s in 10 fields per slide were counted. 2.3.2 Time Series Induction of Phage Particles Phage production in H. aquamarina was monitored over a 24 hour time series following induction with Mitomycin C. Fi ve ml of an overnight culture of H. aquamarina was diluted into 45 ml of fresh ASWJP+PY in separate flasks (control and treatment). Five ml was removed from each flask to enumerate bacteria and viruses (T0). When the OD600 reached 0.4, MitC (1.0 g ml-1) was added to the treatment flask and returned to shaker. Absorbance readings were taken ev ery two hours until eight hrs and at 24 hrs

PAGE 46

36 after induction, and 5 ml of culture was removed from each flask for phage enumeration. Samples were stained and enumerated as de scribed above. The number of bacteria were enumerated by bacterial direct counts (BDC). Statistical analysis was done in Microsoft Excel using the pooled students t-test for equal variances, = 0.05. Mean burst size was calculated by using the following equation for each time point after Mit C addition (t=3): Bz= (Vm-Vc)/ (Bc-Bm). Vm (VLP ml-1 in Mit C cultures), Vc (VLP ml-1 in control cultu res), Bc (BDC ml-1 in Mit C cultures), Bm (BDC ml-1 in control cultures). 2.3.3 Transmission Electron Microscopy Transmission electron microscopy (TEM) was used to determine the morphology of the HAP-1 particle. A cesium chloride pur ified phage lysate was obtained as previously described. A formvar carbon coated grid (Electron Microscopy Sciences, Hatfield, PA.) was floated on a large drop of lysate for 30 mi nutes. The grid was air-dried and then negatively stained with 2% uranyl acetate for 1 min. The phage particles were visualized with a Hitachi 7100 transmission electron microscope. The tail length, tail width, and head width of HAP particles were determined by measuring each feature on 14 different phage particles fr om several TEM micrographs. 2.3.4 Extraction of phage DNA Phage DNA was extracted from the cesium chloride purified phage lysate by the formamide extraction protocol adapted from Sambrook and Russell (2001). The lysate was heated at 65C for 30 minutes in 0.1 volumes of 2M Tris HCl, 0.5 volume 0.5M

PAGE 47

37 EDTA, 1.0 volume deionized formamide, a nd 2 ul/ml sample glycogen. The phage DNA was precipitated 2 times with 100% ethanol, fo llowed by an 80% ethanol wash to remove salts. The phage DNA pellet was resuspe nded in 0.02 um filtered 1X TE and DNA quantified by the Hoechst 33258 fluorom etric method (Paul and Myers 1982). 2.3.5 Library Construction, Sequencing, and Assembly of the HAP Genome The sequencing of the HAP genome was performed by Nathan Authement and Anca Segall at San Diego State University (San Diego, California). Linker amplified shotgun libraries (LASL) were used to cl one the phage genome. Briefly, the purified HAP DNA was hydrosheared and the resultin g fragments end-repaired then ligated with a linker. The DNA was then amplified usin g a primer to the linker; this transformed the modified phage DNA into unmodified and increased the amount of phage DNA for cloning. Shotgun libraries were created by Lucigen (Middleton, WI). Random clones from these libraries were sequenced usi ng an ABI 3100 capillary sequencer (Applied Biosystems, Foster City, CA). The softwa re program Sequencher (Gene Codes, Ann Arbor, MI) was used to assemble the contigs. Gaps between the contigs were resolved using multiplex PCR, followed by primer walking to sequence the ends of the phage genome. 2.3.6. Sequence Analysis of the HAP Genome Open reading frames (ORFs) were de fined using of KODON software (Applied Maths, Austin, TX) and the ORF Finder so ftware from the National Center of Biotechnology Information (http://www.nc bi.nlm.nih.gov/gorf/gorf.html) using the

PAGE 48

38 bacterial code option. Putative ORFs were compared to the non-redundant GenBank database using BLASTP (http://www.ncbi .nlm.nih.gov/BLAST/) (Altschul, et al.1997). Any BLASTP similarities that had high thre shold values were subjected to PSI-BLAST. Annotation was performed us ing the KODON software. For genomic comparisons of phages VHML and N15, the ORFs were a ssigned function based on the published genomes (Oakey, et al.2002, Ravin, et al.2000 ). For phage VP882, ORF functions were assigned based on putative function from the GenBank annotation. 2.3.7 Analysis of Phage Proteins by Mass Spectroscopy Phage proteins were separated on a on e-dimensional 12% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-P AGE) gel run at 4 mA for 16.5 h by the Laemmli method (Laemmli1970). Gels were fixed in methanol-acetic acid-water (50:10:40), followed by overnight staining with SYPRO Ruby (Biorad, Hercules, CA). Protein-containing bands were numbered and ex cised from the gel with a scalpel. The excised samples were sent to the Proteomics Core Facility at Moffitt Cancer Research Center (Tampa, FL) for analysis by matrix-assisted laser desorption ionization—time-offlight—time-of-flight (MALD I-TOF-TOF) mass spectroscopy. The tandem mass analysis produces a collision-induced dissociation spectrum (CID) that can be used for protein identification based on the peptide sequence ( de novo sequencing).

PAGE 49

39 2.3.8 Pulsed Field Gel Electrophresis Phage genomic DNA was extracted from a 500 ml induced lysate as described above. Host chromosomal and plasmid DNA we re extracted using the Wizard Genomic DNA Purification Kit and Wizard Plus SV Minipreps DNA Purification System (Promega, Madison, WI), re spectively, following the manufacturer’s protocol. The quality of the DNA preparations was assesse d by agarose gel el ectrophoresis, and the Hoechst 33258 fluorometric method. For pulsed-field gel electrophoresis ( PFGE) analysis approximately 325 ng of each DNA fraction was digested with 5 U of the specified restriction enzymes. Digestions were performed with Nar I, Xba I, BamHI, and double digests of Nar I plus Xba I for 3 hours at 37C. PFGE was performed in a 1% PFGE-certified agarose gel (Cambrex Bio Science, Rockland, ME) and 1X Trisacetate-EDTA (TAE). A CHEF-DR II PFGE system (Biorad, Hercules, CA) was used w ith the run parameters 3.4 V cm-1 for 22.5 h, with switch times ramped from 0.2 to 0.7 s. The tank buffer temperature was controlled at 14C. The gel was stained with ethidium bromide (0.5 ug ul-1) following electrophoresis. 2.3.9 Riboprobe Labeling and Southern Hybridization of H. aquamarina DNA preparations A phage riboprobe was created by cl oning a PCR amplified fragment of HAP-1 ORF 37 into the pCRII cloning vector using the TOPO clone kit per manufacturer’s instructions (Invitrogen, Carlsba d, CA). The probe was created by in vitro transcription using the Riboprobe Combination System SP6/T7 (Promega, Madison, WI) according to

PAGE 50

40 the manufacturer’s instructions. Probes were labeled with 35S-UTP (GE Healthcare, Piscataway, NJ). A Southern transfer of the pulsed-fiel d gel to charge nylon membranes was done using the standard method (Sambrook and Russell 2001). The DNA was cross-linked to the membrane using a FB-UVXL-1000 UV cro sslinker (Fisher Scie ntific, Pittsburgh, PA). The Southern transfer was hybridized and washed as previously described (Jiang, et al.1998). The probed blot was exposed to Biomax high sensitivity film (Kodak, Rochester, NY) for 3 days at 4C. 2.3.10 Polymerase Chain Reaction The two different genomic arrangements of the HAP-1, due to the activity of the protelomerase, were confirmed by desi gning specific oligonucleot ide PCR primer sets (Operon, Huntsville, AL). The primer set for the virion form (genomic arrangement starting with the putative terminase gene) is as follows: primer 1 (5’AGAAGTGCAGCTCAACACC 3’), and primer 2 (5’ATCCTCTACCGCTTCATCCA 3’). The PCR product size for this primer set was 2, 441 bp. The primer set used for the prophage arrangement (genomic arrangement starting with the protelomerase) is as follows: primer 3 (5’CGTCTTCTGTTTCGTCGTCA 3’) and primer 4 (5’GGTGTCTGCCAATGTTGAT G 3’).The PCR product size for this primer set was 2,681 bp. The DNA preparations were the same as those used in the Southern blot experiment. In order to acc ount for differing amount of phage DNA present in each preparation, 14 ng of host chromo somal DNA, and 2 ng of plasmid or phage DNA were used in the reactions. GoTaq Gr een Mastermix (Promega, Madison, WI) was

PAGE 51

41 used as recommended, and the primers sets we re added to a final concentration of 0.5 M per primer. The PCR was performed in a My Cycler thermal cycler (Biorad, Hercules, CA) with the following PCR program: initial ann ealing 2 min at 95C, 25 cycles of 95C for 1 min, 60C for 1 min, 72C for 2 min, and a final extension of 72C for 10 minutes. The amplicons were loaded on a 1% agarose gel with 0.5 ug l-1 of ethidium bromide, and run at 89 V for 45 minutes. The ge l was imaged using the AlphaImager 2200 imaging systems (Alpha Innotech, San Leandro, CA). 2.3.11 Nucleotide Sequence Accession Numbers. The sequence of HAP-1 will be deposited into GenBank prior to manuscript submission. The GenBank accession numbers for the phage genomes used in this study are as follows: VP882 (NC_009016), VHML (NC_004456), N15 (NC_001901). 2.4 Results 2.4.1 Characterization of the HAP-1 Virion The results of the H. aquamarina phage ( HAP-1) mitomycin C prophage induction experiments are shown in Figure 2.1. In the Mitomycin C treated cultures induction was observed as shown by the signif icantly greater numb er of viral-like particles (VLP) in the supern atant compared to the control culture, (p= 0.01, Fig 2.1-A). Phage production was greatest at eight hours after Mitomycin C addition (9 X 1010 VLP ml-1), and decreased slightly at 24 hrs (3.73 X 1010 VLP ml-1). Bacterial growth also decreased after the addition of Mitomycin C (Figure 2.1B). Mean burst size was calculated to be 45 pha ges per bacterium.

PAGE 52

42 Electron micrographs of negatively stained HAP-1 particles showed icosahedral capsids with long, thick tails consistent with Myoviridae (Figure 2.2). The capsid diameter was 49.81 4.89 nm, while the tail is 254.67 17.13 nm in length and 16.09 2.65 nm is width (mean SD, n=14). A phage pa rticle with a contract ed tail sheath and visible internal tube is denot ed by the arrow in Figure 2.2-A. Figure 2.1. Phage production (panel A) an d bacterial growth (panel B) in a control and mitomycin C treated culture. Asterisks denote when Mitomycin C was added. The mean VDC and BDC for each time point was used to chart production or growth, respectively. Standard deviation is represented by error bars.

PAGE 53

43 Figure 2.2. Transmission Electron Micrographs of HAP-1 particles. Panel A is 100,000X magnification. The black bar symbolizes 100 nm. Arrow indicates contracted tail sheath. Panel B is 150,000X magnification. The black bar symbolizes 50 nm. 2.4.2 Analysis of the HAP-1 Genome The HAP-1 genome was found to be 39,245 nuc leotides in length and had a G+C content of 59%. No cos sites were found through restriction analysis. The genome is double stranded DNA based on nuclease assay studies. The HAP-1 genome contains 46 putative ope n reading frames (ORFs) based on KODON analysis (Figure 2.3). Thirty-five of the ORFs (76%) shared significant similarity (e<10-3) at the protein level with othe r sequences in GenBank. Putative functional assignments and significant similari ties to other sequences are listed in Table 2.1. The identified ORFs were similar to genes from other phages or phage-related proteins from annotated bact erial genomes. The top BLASTP hits for 29 of the ORFs were similar to genes in V. parahameolyticus phage VP882; 20 of which these ORFs were also similar at the nucleotide level (e<10-3)(Table 2.1). A B

PAGE 54

44 Figure 2.3. Genomic Map of HAP-1. Kodon was used to construct the gene map. Colors were assigned based on functional assignment of the ORF. Color code: Conserved hypothetical protein (gray), Unknown (black), Packaging (magenta), Capsid associated (g reen), Tail associated (blue), DNA metabolism (red), DNA replication (orange), Ly sogeny related (yellow). ORF 1 & 2 Large and Small Terminase Terminase genes are responsible for AT P-dependent packaging on concatameric DNA in phage capsids. The small subunit possesses DNA recognition specificity while the large subunit has catalytic activity (Black 1989). ORF 1 is a hypothetical protein that is similar to vibriophage VP882 on both the protein (2e-44, 55% identity) and nucleotide level (5e-7, 77% identity). The second iteration of a psi-blast shows weak similarity of this ORF to phage terminase small subunit nu1 from bacteriophage (7e-5, 26% identity). ORF 2 is similar to the putative terminase large subunit in VP882 on both the protein (0, 62% identity) and nucleotide level (2e-88, 75% identity). ORF 2 also shares similarity with the terminase large subunit proteins from Pseudomonas aeruginosa 2192 (2e-26, 25% identity) and Synechococcus elongatus PCC 6301 (4e-26, 24% identity).

PAGE 55

45Table 2.1. Open Reading Frames of the HAP-1 genome and BLASTP hits. +, forward orientation; reverse orientation. b experimentally characterized, c nucleotide similarity (
PAGE 56

46Table 2.1 (Continued) ORF no./ orientation Nucleotide position Predicted function Related BLASTP hit(s) 20/+ 14420-15586 Tail sheath b,c Phage tail sheath [Vibrio phage VP882] YP_001039839 (e-142) Phage tail sheath [ Pseudomonas fluorescens PfO-1]YP_346877(9e-123) ORF39 [ Vibrio harveyi bacteriophage VHML] NP_758931 (2e-27) Phage tail sheath [ Silicibacter sp. TM1040] YP_613279 (2e-24) Phage tail sheath protein [ Thiomicrospira crunogena XCL-2] YP_390965 (4e-16) gpFI [Enterobacteria phage P2] NP_046778 (2e-13) 21/+ 15587-16093 Tail tube Tail tube protein [Vibrio phage VP882] YP_001039840 (5e-35) Phage-related tail tube [ Xyella fastidosa 9a5c] NP_298018 (4e-7) ORF 40 [ Vibrio harveyi bacteriophage VHML] NP_758932 (7e-6) Phage tail tube [ Thiomicrospira crunogena XCL-2] YP_390966 (4e-6) 22/+ 16156-16805 Hypothetical protein c Putative phage-related [Vibri o phage VP882] YP_001039841 (5e-36) 23/+ 16930-19515 Tail tape measure c Phage-related tail protein [Vibrio phage VP882] YP_001039842 (8e-84) Phage tail tape measure protein [ Thiomicrospira crunogena XCL-2] YP_390968 (8e-8) ORF43 [ Vibrio harveyi bacteriophage VHML] NP_758934 (1e-6) 24/+ 19516-19929 Tail proteinc Phage protein U-like [Vibrio phage VP882] YP_001039843 (7e-33) Phage protein U-like [ Pseudomonas fluorescens PfO-1] YP_346881 (4e-31) 25/+ 20107-21135 Tail protein c Phage protein D-like [Vibrio phage VP882] YP_001039846 (e-95) Phage protein D-like [ Pseudomonas fluorescens PfO-1] YP_346883 (3e-93) ORF46 [ Vibrio harveyi bacteriophage VHML] NP_758937 (1e-27) gpD [Enterobacteria phage P2] NP_046784 (4e-17) Phage protein D-like [ Thiomicrospira crunogena XCL-2] YP_390970 (4e-12) 26/+ 21276-22031 DNA adenine methyltransferase c DNA adenine methyltransferase [Vibrio phage VP882] YP_001039848 (2e-108) DNA adenine methyltransferase [ E125] NP_53683 (2e-94) 27/+ 22511-22858 28/23336-23794 29/23835-24248 30/24358-24954 Hypothetical c Hypothetical protein P27p04 [bact eriophages P27] NP_543056 (e-20) 31/25072-25494 32/25583-25827 33/25853-26617 Par titioning protein c ParA protein [Vibrio pha ge VP882] YP_001039864 (2e-65) ORF 58 [Vibrio harveyi bacteriophages VHML] NP_758949 (2e-54) ParA [ Pseudomonas alcaligenes ] YP_025341 (3e-49) 34/+ 27075-28637 Protelomerase b,c Protelomerase [Vibrio phage VP882] YP_001039865 (2e-137) Protelomerase [bacteriophages N15] NP_046924 (3e-59) Protelomerase [bacteriophages PY54] NP_892077 (e-47) ORF1 [ Vibrio harveyi bacteriophage VHML] NP_758894 (8e-14) 35/28613-28912 36/29849-32932 Phage replication c Replication protein RepA [V ibrio phage VP882] YP_001039868 (0) Replication protein RepA [bact eriophages PY54] NP_892081 (e-119) Replication protein RepA [bact eriophages N15] NP_046932 (4e-112) 37/+ 33292-33960 Prophage repressor Repressor prot ein [Vibrio phage VP882] YP_001039870 (8e-23) Repressor protein cI [phage 434] S32822 (3e-5) 38/+ 34092-34724 Prophage antirepressor ORF 7 [ Vibrio harveyi bacteriophage VHML] NP_758900 (2e-24) Phage-related protein [Vibri o phage VP882] YP_001039871 (2e-22) Cro [phage PY54] NP_892087 (3e-17) 39/+ 34986-35312 40/+ 35322-35842 41/+ 35889-36066 42/+ 36104-36712 Antiterminator Antiterminatior Q [Vibrio phage VP882] YP_001039873 (5e-27) Antiterminator Q [phage PY54] NP_892088 (9e-8) 43/+ 36954-37259 44/+ 37468-37665 45/+ 37790-38425 Hypothetical protein [V ibrio phage VP882] YP_001039881 (3e-56) ORF19 [ Vibrio harveyi bacteriophage VHML] NP_758912 (e-54) 46/+ 38536-38973 Hypothetical protein [V ibrio phage VP882] YP_001039882 (4e-13) ORF 20 [ Vibrio harveyi bacteriophage VHML] NP_758913 (3e-8)

PAGE 57

47 ORF 4 & 5. Portal and Capsid Proteins Portal proteins are responsible for fo rming a ring that enables DNA to pass into the major capsid during assembly and out dur ing infection, and it serves as a junction between the capsid and tail proteins (Bazi net and King 1985). ORF 4 encodes a protein similar to lambda-like portal proteins f ound in the putative prophage regions in the genomes of the Neisseria meningitidis FAM18 (6e-74, 35% identity) and Silicibacter sp. TM1040 (9e-37, 29% identity), and in the Wolbachia phage WO (1e-42, 29% identity). This ORF shares significant similarity w ith those found in the vibriophages VP882 (4e127, 52% identity) and VHML (6e-13, 23% identity). The expected size of HAP-1 portal protein based on the amino acid compos ition is 59.4 kD, which is smaller than the expressed protein identified by MADLI-Tof-T of from the 65.6 kD excised band from the SDS-PAGE gel shown in figure 2.4. ORF 5 shares similarity with VP882 (7e-171, 53% identity), and with major capsid proteins found in the genomes of Neisseria meningitidis FAM18 (2e-91, 33% identity) and Silicibacter sp. TM1040 (1e-73, 33% identity). It also shares w eaker identity with the major capsid proteins from the plasmidlike prophages KO2 (2e-7, 24% identity) and PY54 (7e-7, 25% identity). MALDI-ToFToF analysis of the structural protein profile of HAP-1 found protein fragments from the major capsid protein in two locations on the SDS-PAGE gel (figure 2.4). Based on the amino acid composition, the predicted size of ORF5 is 66.6 kD, while the bands of the gel correspond to 31.5 kD (ORF 5A) and 28.4 kD (ORF 5B).

PAGE 58

48 ORF 9, 10,11,12,13,16,20,21,23,24,25. Tail Proteins The HAP-1 genome contained 11 putative tail proteins, including three baseplate assembly proteins, a tail fiber prot ein, a tail tape measur e protein, a tail sheath, and a tail tube protein (figure 2.3, table 2.1). Tail sheath and tail tubes are components that make up the contractil e tail that is the hallmark of Myoviridae (Buchen-Osmond 2003). ORFs encoding tail proteins were similar to tail proteins from myoviruses including P2, P1, VHML, and CTX. Six of the HAP-1 ORFs (11,16, 20,21,23,25) were significantly similar to the inducible prophage from Thiomicrospira cruogena XCL2. Many of the ORFs were similar to prot eins found in a prophage-like region on the Pseudomonas fluorescens PfO-1 genome. All the putative HAP-1 tail proteins shared significant similarity with proteins from th e VP882 phage. The tail sheath protein (ORF 20) was identified from the st ructural protein profile of HAP-1, the predicted size of the protein (41.7 kD) is smaller to the expressed size of the protein (43.6 kD) (figure 2.4).

PAGE 59

49 Figure 2.4. SDS-PAGE of Proteins Associated with HAP-1 Particles. Molecular mass standards in kilodaltons (lane 1) and HAP-1 proteins with ORF designations based on peptide sequence (lane 2). ORF 26 DNA Methylating Protein ORF 26, which is immediately downstream of the tail genes, putatively encodes a DNA adenine methyltransferase protein. Meth yltransferase genes are believed to methylate phage DNA in order to protect it from host restriction endonucleases (Ackermann and DuBow 1987). This ORF has si gnificant similarity to proteins from other temperate phages infecting gram-neg ative bacteria including phage VP882 (2e-108, 72% identity) and the N-6 adenine methyltransferase from the Burkholderia mallei phage E125 (2e-94, 62% identity). Additionally ORF 26 sh ares 73% nucleotide identity across 90% of the gene with VP882, and 68% identity over 92% of the gene to E125. ORF 5A 1 2 200 kD 55.4 66.3 36.5 31.0 4.0 21.5 ORF 4 ORF 20 ORF 5B

PAGE 60

50 ORF 33, 34, 36. Plasmid-like Prophage Genes This group of ORFs is similar in sequ ence and organization of proteins found in other plasmid-like temperate phages. ORF 33 potentially encodes a partitioning protein (ParA) that was similar to genes from phage VP882 (2e-65, 60% identity), ORF 58 of phage VHML (2e-54, 55% identity), and the parA genes from a Pseudomonas alcaligenes plasmid pRA2 (3e-49, 53% identity). The parA protein is part of the system responsible for plasmid segregation during cell divi sion (Bignell and Thomas2001). ORF 34 is similar to protelomerases from linear plasmid-like phages including N15 (3e-59, 33% identity) and PY54 (e-47, 32% identity). Protelomerases di gest phage DNA at a specific inverted repeat found upstream from the en zyme’s coding region, resulting in linear phages with covalently closed ends (Den eke, et al.2000). This ORF also shared significant similarity to VP882 (2e-137, 54% identity). ORF 36 is a replication protein similar to those in other plasmid-like propha ges such as the RepA proteins in PY54 (e-119, 29% identity) and N15 (e-112, 29% identity). RepA is a multifunctional replication protein with primase and helicase activity that is found in plasmid-like phages (Weigel and Seitz2006). Additionally, these three ORFs shared significant nucleotide similarity with genes from VP882, with at least 65% identity along 42 to 71 percent of the gene (Table 2.1). ORF 37, 38, 42 Lysogeny genes HAP-1 contains lysogeny-related genes found in known temperate phages. This includes a putative phage repressor (ORF 37) that is upstream from and in reverse orientation to a conserved phage protein (O RF 38) and anti-terminator Q protein (ORF

PAGE 61

51 42). Phage repressors are the regulators of lysogeny by binding to promoter sites that prevent the transcription of lytic genes (Ptashne2004). The anti-terminator Q protein is not involved in the lytic-lys ogenic decision but it must accu mulate in order to enable transcription of late lytic genes (Kobiler, et al.2005). ORF 37 contains a conserved helixturn-helix DNA binding domain, and is similar to a gene from VP882 (8e-23, 31% identity) and the cI re pressor of phage 434 (3e-5, 21% identity). ORF 38 is a conserved phage protein similar to ORF 7 of VHML (2e-24, 37% identity) and ORF 60 of VP882 (2e-22, 38% identity). It also shares simila rity with the PY54 cro antirepressor (5e-17, 26% identity), which competes with cI for binding sites of the operator to inititiation the lytic cycle (Ptashne 2004). ORF 42, the putative antite rminator Q, is located 1380 base-pairs downstream from ORF 38. ORF 42 is si milar to proteins from VP882 ( 5e-27, 43% identity) and PY54 (9e-8, 29% identity), as well as Q fr om enterobacteria phage 82 (3e-7, 31% identity). No integrase or lytic genes we re identified by similarity search in the HAP-1 genome. Inverted Repeat Since N15 contains an invert ed repeat site that enables the protelomerase to break the phage genome and rejoin it to make the linear telomeres, we searched the HAP-1 for an inverted repeat. A 92 bp inverted palindromic repeat was found between the partitioning protein (ORF 33) and protelomer ase (ORF 34) ( Figure 2.5). The repeat was found to be 127 bp upstream from the star t codon of the protelomerase protein.

PAGE 62

52 Figure 2.5. Nucleotide Sequence of HAP-1 Inverted Repeat. The 96 bp inverted repeat is shown in the gray box. The dotted line represents the cut-site of th e protelomerase. The right and left telomere represent the covalently closed ends of the linear temperate HAP-1 genome. 2.4.3 Genomic Organization of Plasmid-li ke Double-stranded Linear Prophages The genomic organization of HAP-1 compared to that of the known linear plasmid prophage N15, and the vibriophage s VHML and VP882 is shown in figure 2.6. There is no nucleotide sequence homology between HAP-1, N15, or VHML but the organization of structural, lysogeny, and repl ication modules in these phage genomes is strikingly similar. The genome map of VHML in figure 2.4 is characteristic of the genomic organization of plasmid-like linea r temperate phages while in the prophage form. N15 is longer than the ot her genomes and is the only one that contains recognizable lytic module. The nucleotide sequence similari ty, with a minimum of 60% identity over at least 80 bases, between HAP-1 and VP882 is seen across the genomes including most of the structural, DNA metabolism, and plasmid-like genes, but not the lysogeny related genes. VP882 contains a putative transcriptional regu lator and exonuclease that are not present in HAP-1.

PAGE 63

53 Figure 2.6. Genomic Comparisions of Four Completed Genomes of Phages Containing a Protelomerase Gene. Kodon was used to construct the gene map. The genomes of N15, VHML, and VP882 were collected from GenBank, see methods for accession numbers. Nucleotide alignement of HAP-1 and VP882 was performed in Kodon using a minimum of 60% identity over at least 80 bases. Colors were assigned based on functional assignment of the ORF. Color code: Conserved hypothetical protein (gray), Unknown (black), Packaging (magenta), Capsid associated (g reen), Tail associated (blue), DNA metabolism (red), DNA replication (orange), Lysogeny related (yellow), Lysis (purple).The location of the protelomerase in each genome is noted by the “PT”. 2.4.4 Integration of HAP-1 in Cellular Replicons and Different Phage Genomic Arrangements Southern hybridization of host chromo somal, plasmid, and phage preparations were performed to determine if HAP-1 integrates into the chromosome or exists as an extrachromosomal element. Nucleic acid prepar ations were restricti on digested at unique sites or double digested to confirm assembl y. The digests were subjected to pulsed field electrophoresis and Southern transferred to charged nylon, followed by probing with a portion of the cI repressor gene (ORF 37). Figure 2.7 illustrates the different digestion

PAGE 64

54 sites for the restriction enzymes based upon two hypothetical structures derived from similarities of phage N15 st ructure. The undigested DNA prep arations hybridized at a molecular weight of 39 kb (Figure 2.8, lanes 2, 7, 12), indicating lack of integration into the host chromosomal DNA. The BamHI digest ed preparations served as a positive control for the presence of phage DNA in the fractions, in the host and plasmid fractions these hybridized at the around same molecular weight of 10kb, with the fragment in the phage being slightly larger (figure 2.8, lanes 6, 11, 16). Th e hybridization pattern of the rest of the host genomic and plasmid digest s were identical, while the phage digestion pattern was different (Figur e 2.8, lanes 3-5, 8-10, 13-15). Figure 2.7. Schematic representation of the two conformations of HAP-1. Protelomerase (Pt), Par A (Pa), Terminase small subu nit (Ts), ORF 46 hypothetical protein (46) and ORF 36 prophage repressor that was used as probe (cI). The cut-sites of restriction enzymes are denoted by vertical lines. The predicated sizes of fragments are noted to the right of each map. Arrows below each map represent the primers used for PCR analysis. Figures are not drawn to scale.

PAGE 65

55 Figure 2.8. Southern transfer (right) and PFGE (left) of HAP-1 DNA fractions. 8-48kb standard (lane 1). Host chromosomal DNA, undi gested (lane 2), XbaI/NarI (lane 3), Nar I (lane 4), Xba I (lane 5), BamHI (lane 6). H. aquamarina plasmid DNA, undigested (lane 7), XbaI/Nar (lane 8), Nar I (lane 9), Xba I (lane 10 ), Bam HI (lane 11). HAP-1 DNA, undigested (lane 12), XbaI/NarI (lane 13), Nar I (lane 14), Xba I (lane 15), BamHI (lane 16 ). Numbers at left are size in kilobases. Detection of the two different phage ge nomic arrangements was verified by PCR analysis of the host genomic, plasmid, and ces ium chloride purified phage preparations using the two form-specific primer sets (Figur e 2.7). The virion primer set (primers 1 & 2) result in an amplicon 2,441 bp in length, and the prophage primer set (primers 3 & 4) result in an amplicon 2,681 bp in length (Fig 2.9). Host genomic (lane 3) and plasmid (lane 5) amplicons are from th e prophage primers, with no amplification with the virion primers. For the phage preparation, there wa s only amplification from the virion primer set (lane 6). We interpret the similarity of the host genomic and plasmid preparations to be caused by the presence of plasmi d DNA in the host genomic preparation.

PAGE 66

56 Figure 2.9. Gel electrophoresis of H.aquamarina DNA PCR amplicons. MidRange Plus DNA Ladder (lane 1). Host chromosomal DNA, primer set 1&2 (lane 2) and primer set 3&4 (lane 3). H. aquamarina plasmid DNA, primer set 1&2 (lane 4) and primer set 3&4 (lane 5). HAP-1 DNA, primer set 1&2 (lane 6) and primer set 3&4 (lane 7). 2.5 Discussion Based on the TEM micrograph show ing thick, contractile tails, HAP-1 can be classified as a myovirus. The diversity and number of HAP-1 tail proteins including ORFs similar to a tail sheath, tail tube, and several baseplate prot eins from temperate myoviruses including colipha ges P1 and P2, VHML, and CTX support this finding (Maniloff and Ackermann 1998, Nakayama, et al.1999, Oakey, et al.2002). The major structural components of the contract ile tails that are the hallmark of Myoviridae are the tail tube and tail sheath prot eins, both of which are found on the HAP-1 genome. The tail sheath protein which contracts during in fection of the host was identified by peptide sequencing of a protein band from the HAP-1 proteome expressed on an SDS-PAGE

PAGE 67

57 gel. The actual molecular mass of the tail sheath protein agrees with the predicted molecular mass indicating little post-translation modification. The capsid associated proteins were sim ilar to phages that contained lambda-like head genes such as WOcauB1, PY54, and KO2 (Casjens, et al.2004, Fujii, et al.2004, Hertwig, et al.2003a). Expre ssion and identification of the major capsid and portal proteins on the SDS-PAGE gel confirmed our in silico annotation of these head genes and provided further information on the mature HAP-1 virion. The major capsid protein is typically the most abundant protein presen t in mature virions so that it is highly expressed on SDS-PAGE gels, as is seen in figure 2.5. Sequencing of the peptide fragments from two different sized protein bands suggests that the HAP-1 major capsid protein is cleaved after tran slation into two smaller pr oteins. The sum of the two fragments is 59.9 kD which is cl ose to the predicted size of 66.6 kD for the major capsid protein. Proteolytic cleaving of the viral coat proteins during assembly occurs in several phages including HK97, PY54, and KO2 (Casjens, et al.2004, Hertwig, et al.2003b). The expressed HAP-1 portal protein is 6 kD larger than the expected molecular mass based on the amino acid sequence indicating either abnormal migration in the SDSPAGE gel or post-translation modificati on of the protein. The similarity of HAP-1 capsid and tail proteins to those from mitomycin C inducible phages found in the genomes of the deep-s ea chemolithoautotroph T.cruogena and Pfisteria piscidia associated bacterium Silicibacter sp. TM1040 illustrates the cons ervation of structural genes in marine prophage (Che n, et al.2006, Scott, et al.2006). HAP-1 is a double-stranded DNA phage. No cos-site was found on the genome but, due to the presence of terminase genes, we propose that HAP-1 is packed by the

PAGE 68

58 headful packaging mechanism. Phages that use this mechanism have no specific cut site, so the phage DNA is packaged into the cap sid until it can no longe r fit, resulting in packaged DNA of different lengths (Black 1989). The H. aquamarina host behaved like a lysogen when treated with the prophage inducing chemical, Mitomycin C. Mitomyci n C is an antibiotic that inhibits DNA synthesis in bacteria by cross-linking co mplementary DNA strands, eliciting the SOS response, causing prophage induction (Otsuji, et al.1959).The increase in virus-like particles (VLPs) in the Mitomycin C treated cult ure as compared to the lack of change in VLPs in the control treatment was t ypical of a lysogenic bacterium. As HAP-1 is Mitomycin C inducible, the presence of severa l lysogeny-related genes on the HAP-1 genome is not surprising. Th e prophage repressor and cro antirepressor are responsible for determining if the phage will enter the lytic or lysogenic cycle. The location and orientat ion of these two proteins in HAP-1 are characteristic of repressors in the model phage system (Ptashne 2004). Functiona l studies in coliphage 434 and PY54, which share similarities with th e prophage repressor and anti-repressor in HAP-1, respectively, indicate that these genes act as repressor and anti-repressor in the model system (Hertwig, et al.2003b, Pirrotta and Ptashne 1969). In HAP-1 the antiterminator Q protein, which is part of the lytic switch that activates late gene expression, is located down stream from the re pressor proteins. This protein is similar to the antiterminator Q protein from enter obacteria phage 82, whose activity was shown during protein activity assays (Goliger and Roberts 1987). Although no recognizable lysis genes are present in the genome, the HAP-1 genome contained a N6 DNA adenine methyltr ansferase (N6-dam). Many tailed-phage

PAGE 69

59 genomes contain methyltransferase genes whic h are believed to methylate phage DNA to protect it from host restriction endonucl eases, providing a selective advantage over unmodified phages (Ackermann and DuBow 198 7). Phage methyltransferases may also play a role in host pathogenicity through lysogenic conversion (Oakey, et al.2002). In E125, the function of the N6-dam was conf irmed through protein expression (Woods, et al.2002). In N15 and KO2, adenine methyltransferases were expressed late during lytic growth and were not detected during lysogeny (Casjens, et al.2004, Ravin, et al.2000). In temperate phage genomes methyltran sferases are located in the lytic or DNA modifications modules (Oakey and Owens 2000, Ravin, et al.2000). The presence of three genes in HAP-1 similar to those in linear plasmid-like phages and bacterial plasmids, and the ab sence of an integrase, suggest that HAP-1 exists as a linear plasmid. This was also supported by restriction di gestion analysis and PCR of the plasmid and phage genomic pr eparations. Partitioning proteins, known generically as ParA and ParB ensure that daughter bact eria will contain a copy of bacterial chromosomal and low-copy number plasmids (Bignell and Thomas 2001). Both ParA and ParB are necessary for stable inhe ritance of the N15 prophage (Ravin and Lane 1999). Although the HAP-1 parA was similar to the two vi briophages and a bacterial plasmid gene, there was no parB homolog. This may indicate that the partitioning mechanism in this phage is different from the ParA/ParB system in coliphage N15. In N15, RepA is a multi-domain protein, containing conserved primase, helicase, and replication origin sites, whose activity simila r to the theta replication mechanism found in some plasmids (Ravin 2003, Weigel and Seitz 2006). The replication protein (RepA) in HAP-1 is very similar to those in plasmi d-like linear phages such as N15. Ravin et al

PAGE 70

60 (2003) also found that RepA was active dur ing lytic and lysogenic growth, allowing mainteince of the plasmid state. Protelomerase genes have been found in small number of phages, including temperate plasmid-like linear phages N15, PY54, and KO2; and the vibriophages VHML and VP882 (Casjens, et al. 2004, Hert wig, et al. 2003b, Oakey, et al. 2002, Ravin, et al.2000). In N15, this gene was found to be necessary for replication of the prophage form, but not the virion form (Ravin 2003). Th e protelomerase is responsible for breaking and resolving the single-stranded DNA ends into hairpin ends, allowing them to exist as a linear plasmid (Deneke, et al.2000, Hertwig, et al.2003a). Although the exact mechanism is unknown, studies with protelomerase from both N15 and KO2 suggest that two protelomerase molecules form a dimer on an 10 basepair core palindromic inverted repeat. Each molecule is responsible for cutti ng and rejoining the strands to form hairpin ends (Deneke, et al.2002, Huang, et al. 2004). The inverted repeats in these linear phages are found about 150 basepairs upstream from th e protelomerase gene and are between 4256 basepairs in length. The palindrom ic inverted repeat identified in HAP-1 was much longer than those in the N15like prophages. Like in PY54, it was also palindromic for the whole length, unlike N15 and KO2 which are interrupted by a 2 basepair insertion. These differences could result in difference s in binding affinity of the protelomerase, although further experiments are needed. Southern hybridization and PCR experiments indicate that HAP-1 does not integrate into the host chromosome, but exists as a linear episome. An integrated phage would have hybridized with the phage probe at a much higher mole cular weight in the undigested host DNA than in the phage and plasmid DNA fractions. This was not the

PAGE 71

61 case in our southern hybridi zation experiment as seen by the presence of the 39 kb HAP-1 genome sized fragment in all of the DNA preparations in figure 2.8. The linear nature of HAP-1 phage is seen in the phage DNA fraction digested with the unique cutter restriction enzyme, Nar I. If HAP-1 was a circular plas mid, the single restriction cut would linearize the molecule causing it to run at a high er molecular weight. In the case of our Southern hybridizat ion, the target fragment size was the same as predicted by the linear virion restri ction maps (figure 2.7). As a prophage, HAP-1 exists as a linear plasmid. In this arrangement, the genome starts with the protelomerase and e nds with the parA due to the activity the protelomerase. The prophage form was dom inant in the host genomic and plasmid DNA fractions as these cultures were not induced with Mitomycin C treatment. This is apparent in the digestion patterns of the host genom ic and plasmid DNA, where the hybridized fragments were the same as those predicte d by the prophage restri ction maps (Figure 2.7). Additionally, only the prophage primer set (3 & 4) amplified with the host and plasmid DNA. The differences in the hybr idization strength and amount of PCR amplicon between the host genomic and plas mid fractions are indicative of the low concentration of phage DNA present in th e whole host DNA fractions relative to the plasmid preparations. As a virion, the HAP-1 genome is a linear circul arly permuted molecule, as such; the terminase genes were used as an arbitrary start point. The phage DNA used in experiments was isolated from a large scal e Mitomycin C induction experiment, so the virion form dominated. The differences betw een the restriction di gests and Southern hybridization of the phage DNA compared to the host genomic and plasmid DNA

PAGE 72

62 support this arrangement. In the PCR experi ment, only the virion primer set (1 & 2) amplified phage DNA. These findings are simila r to what was seen in the restriction digest experiments for other linear plasmid phages, including N15, PY54, and KO2 (Casjens, et al. 2004, Hertwig, et al. 2003a, Ravin, et al. 2000). HAP-1 shares genetic characteristics with N15-like phages and two marine vibriophages, VP882 and VHML. The overall genomic organization of the functional modules is similar across all four phages with packaging, structural, and phage metabolism genes present. Conservation of functional gene groups is common among temperate tailed phages, including those fr om the marine environment (Brussow and Desiere 2001, Paul and Sullivan 2005). This conservation supports Botstein’s modular theory of phage evolution, where evoluti on occurs through exchange of a group of functional genes (modules) between phages that se lect for optimal biol ogical activity in a particular environment (Botstein 1980). It is possible that a plas mid-like prophage could be advantageous to the phage, not requi ring the constraints th at a chromosomallyintegrated temperate phage possesses. Th at is, a plasmid-like prophage could be transferred by the processes of conj ugation and transformation. Like N15, HAP-1 exists in two different linear plasmid forms a nd has a functional protelomerase. While HAP-1 and N15 are similar on the protein level, th ere is no significant nucleotide homology. The nucleotide similarity of 20 HAP-1 genes with genes from VP882 suggests that our phage is more closely related to the vibriophages than to N15. There are differences in the occurren ce and organization of genes involved in lysogeny and lysis between HAP-1, N15, VP882, and VHML. The N15 phage has three immunity regions; one which is similar to lysogeny module, one for lysogenic

PAGE 73

63 conversion, and an anti-repressor region si milar to those from phages P1 and P4 (Lobocka and Yarmolinsky1996, Ravin and Lane1999). Both HAP-1 and VP882 only have a type lysogeny region, while VHML also has an anti-repressor similar to one from phage 80 (Oakey, et al.2002). The coding re gion between the protelomerase and repA genes in HAP-1 contains a small hypotheti cal protein. In VP882 and VHML, there is a transcriptional re gulator between the two genes; while N15 has an antirepressor immunity region located ther e. Unlike the genomes of N15 and the vibriophages, which contain holin homo logs and exonucleases, respectively, the HAP-1 genome has no recognizable lytic genes. Additionally, the location of the N-6 adenine methyltransferase near the lysis m odule is different from that in HAP-1 and the vibriophages (Figure 2.6). These findings suggest that N15 and HAP-1 diverged from a common ancestor, while recent divergence may have occurred between HAP-1, VP882, and, to a lesser extent, VHML. Since Halomonas and Vibrio species are cosmopolitan in ocean, it is tempting to hypothesize that thei r respective phages may have encountered each other in environment resulting in gene transfer. Ho wever, it should be noted that our knowledge of the VP882 and VHML systems is limited. VHML has only been sequenced and there is limited knowledge of the host-phage system (Oakey and Owens 2000, Oakey, et al.2002). The genome of VP882 has not been pu blished, as such, nothing is known about the host-phage system. The genome of the temperate H. aquamarina phage HAP-1 is an important addition to the growing number of marine prophages that have been characterized to date. To our knowledge, HAP-1 is the first marine temper ate phage characterized to have

PAGE 74

64 behaved like a telomeric linear plasmid-li ke phage. Combing traditional host-phage characterization with molecular studies in this system has provided insight into the phage genome structure.

PAGE 75

65 Chapter 3 Lysogeny and Sporulation in Marine Bacillus 3.1 Project Summary Eleven Bacillus isolates from the surface and su bsurface waters of the Gulf of Mexico were examined for their capacity to sporulate and harbor prophages. Occurrence of sporulation was assessed in each isolate through dec oyinine induction and putative lysogens were identified by prophage induction with mitomycin C treatment. No obvious correlation between ability to sporulate a nd prophages was found. Four strains that contained inducible virus-like particles were shown to sporulate. Four strains did not produces virus-like particles, while one stra in only produced spores Two of the strains did not produce virus-like particles or sporulate significantly upon induction. Isolate B14905 had high virus-like particle production and a high occurrence of sporulation and was futher examined by genomic sequencing in an attempt to shed light on the relationship between sporulation and lysogeny. In silico analysis of the B14905 genome revealed four prophage-like regions, one of which was independently sequenced from a mitomycin C induced lysate. Based on PCR and TEM analysis of an induced phage lysate, one is a non-inducible phage remn ant, one may be a defective phage-like bacteriocin, and two were induc ible prophages. One of the inducible phages contained four transcriptional regulators, one of wh ich was a SinR-like regulator that may be involved in the regulation of host sporulation. Isolates that possess both the capacity to sporulate and contain temperate phage may be well adapted for th e oligotrophic ocean.

PAGE 76

66 3.2 Introduction Lysogeny and sporulation are strategies for phage and host survival, respectively, under adverse conditions. During both processes the genome of the phage or bacterium is replicated into a form, prophage or endospor e, which increases its survival (Dubnau and Losick 2006). The initiation of both lysogeny and sporulation involve the repression and activation of promoters that are regulated by feedback from their gene products. In coliphage cI binds to the lytic promoter PR during lysogeny while cro binds to PR during a virulent infection (Ptashne 2006). SinR binds to the vegetative promoter PV in the Sin operon during normal ce ll conditions and SpoA activates the sporulation promoter (Mandic-Mulec, et al. 1995). The tertiary st ructure of the DNA-binding domain of sinR from Bacillus subtilis and cI and cro from the Escherichia coli phage 434 are nearly identical (Lewis, et al. 1998). Recent work has also demonstrated that cIII and sporulation control protein s poVM are both inhibited by the ft sH protease (Kobiler, et al. 2007). These structural and functional simila rities indicate a po ssible evolutionary relationship between prophage induction and sporulation. Previous work has indicated a possi ble link between phage and sporulation. Meijer et al (2005) found that lytic development of the virulent Bacillus phage 29 was repressed in sporulating cells through inhibition of early phage genes by SpoA inhibited transcription of early phage genes. A phage-encoded sigma factor in the B. anthracis virulent Fah was negatively controlled by a s porulation anti-sigma factor (Minakhin, et al. 2005). Lytic development was also found to be suppressed in temperate phages during sporulation with no viral production occurr ing when induced with UV (Osburne and Sonenshein 1976). This phenomenon could be a survival mechanism that allows the

PAGE 77

67 phage to be protected in the spore during cond itions that are unfavorab le to infection such as low host abundance during nutrient depleted conditions. Survival would be increased if the prophage contained genes that allow the host to sporulate at a higher frequency than non-infected bacteria. Phages that can perform this function are known as spore-converting phages and they have been found in Bacillus and Clostridium species (Bramucci, et al.1977a, Stewart and Johnson 1977) Bacillus phages PMB12 and SP10 are believed to induce sporulation by activating sporulation in itiation signals (Silver-Mys liwiec and Bramucci 1990). Unfortunately most of these studies of Bacillus phages pre-date current sequencing technologies. However, the genome of C. perfringens temperate phage 3226 contained a sporulation-associated sigma factor homolog and a sporulation-dependent transcriptional regula tor that was believed to augment host sporulation (Zimmer, et al. 2002). Although spore-converting phages have been characterized in terrestrial Bacillus species, the phages infecting marine Bacillus strains have not been studied. In this study, a collection of eleven Bac illus isolates from the Gulf of Mexico were investigated for spore and phage production through traditional induction experiments. Genomic and molecular technique s were utilized to study the prophages of one of the isolates, B14905, in depth. Th ese studies provided a glimpse into hostprophage relationships of a marine Bacillus strain, and serve as a basis for functional studies to investigate the influen ce of prophage on host sporulation.

PAGE 78

68 3.3 Materials and Methods 3.3.1 Isolate Collection and Phylogeny Eleven pigmented marine Bacillus isolates were collected from different sites and depths during a 1992 research cruise to the Gulf of Mexico (Table 3.1). The bacterial populations were concentrated fr om seawater by vortex flow filtration (Jiang, et al.1992). The retentate was heated at 80 C for 10 minutes to select for spore-formers, and streaked onto agarose made from trypticase soy broth (TSA) (Becton Dickinson, Cockeysville,MD). In 2003, TSA slants of thes e strains were streaked for isolation onto A& PY and TSA plates. Each isolate was tran sferred monthly to fresh media plates. In August 2005, each culture was frozen down in 25 percent glycerol solution and stored at 80 C. The 16S ribosomal sequence for each isol ate that Siefert et al. (2000) sequenced was BLASTed in GenBank. Table 3.1. Collection of Bacillus Strains from the Gulf of Mexico. Best GenBank match is based upon partial 16S sequence previously pe rformed in Siefert et al. 2000. Strain Location Depth Environment Best Genbank match B-14850 Gulf of Mexico 85 m water column B.aquaemaris (96%) B-14851 Gulf of Mexico 65 m sediment B. barbaricus (95%) B-14904 Gulf of Mexico 2 m water column B.pumilus (99%) B-14905 Gulf of Mexico 1500 m water column B.fusiformis (94%) B-14906 Gulf of Mexico 85 m water column B.cibi (97%) B-14907 Gulf of Mexico 85 m water column B.subtilis (97%) B-14908 Gulf of Mexico 10 m water column B.pumilus (97%) B-14909 Bimini, Bahamas 1.5 m sediment B-14910 Tampa Bay 5 m sediment B.megaterium (94%) B-14911 Gulf of Mexico 10 m water column B. firmus (96%) B-14912 Gulf of Mexico 200 m sediment Paenibacillus sp. (96%)

PAGE 79

69 3.3.2 Induction of Sporulation in Bacillus Isolates Before the induction experiments, a colony from month old plates of each isolates was smeared on a clean microscope slide wi th 10 ul 0.22 um filtered DI water and observed for the presence or absence of s pores using phase contrast microscopy. This indicated the capacity of each strain to sporulate. Sporulation was initially induced in the isolates using a protocol modified from Mitani et al (Mitani, et al. 1977). Decoyi nine is an adenine-ketose antibiotic that inhibits guanosine monophosphate (GMP) synthetase. Star vation of GMP can initiate sporulation in the presence of ample nutrients servi ng as a quick and effective means to study sporulation (Mitani, et al. 1977, Vasantha and Freese 1979) One mL of overnight culture was added to 9 mL of A+PY media and inc ubated at 28 C in a shaker. After cultures reached log phase, two 2 mL aliquots were placed into fresh tubes. Sterile 0.22 m filtered decoyinine (0.5 mg ml-1) was added to the treatm ent tube. After a 24 hour incubation, 0.02 m filtered formalin (1.0%) was added. Wet mounts of the cultures were prepared in triplicate by adding 10 l of formalin treated culture onto a glass slide. Vegetative cells and spores ha ve different refractive indexes that allow differentiation of the two bodies under phase contrast microsc opy. The different cell types were counted on 10 field grids per slides to yiel d the number of spores (Cs) and vegetative cells (Cv) using the following equations: Cg/Vg= Cs,v Cg (direct counts in cells per grid ) and Vg (volume in ml per grid) Vg = (Vs/Acs)*(Ag)

PAGE 80

70 Vs (volume of sample), Acs (area of coverslip), and Ag (Area of the grid) Percent population sporulated was calc ulated by the following equation: (Cs/ Cv) *100 Isolates that did not ha ve significant sporulation fo llowing decoyinine treatment were subjected to heat and ethanol treatments. For the heat treatments, one ml of exponentially growing cultures were incubated at 80 C for 10 minut es, serially diluted, and plated in duplicate on ASWJP+PY plates One ml of the cultures left at room temperature served as a control. Ethanol treatment was performed essentially as by Kornasky et al (1978). Exponentially growi ng isolates were diluted 1:1 with 0.22um filtered absolute ethanol for 1 hour, dilutions were plated in duplicate on ASWJP+PY plates. Cultures diluted 1:1 with 0.22um DI wa ter served as controls. The plates were incubated 2472 hours until colonies appeared, then were enumerated. 3.3.3 Prophage Induction in Bacillus Isolates Mitomycin C, an antibiotic that inhibits DNA synthesis in prokaryotes by crosslinking complementary DNA strands, was used to induce prophages from these isolates. Mitomycin C elicits the SOS response causing the temperate phage to excise from the host (Otsuji, et al.1959 ). In should be noted that no t all known prophages are mitomycin C inducible, so this method might undere stimate prophage induction. Five ml of overnight cultures was added to flasks contai ning 45 ml of A+PY media. These cultures were grown on a shaker at 28 C and absorb ance was monitored every hour until they reached log phase. Mitomycin C (1 g ml-1) was added to the appropriate flask of culture and returned to the shaker. After 24 hours, the absorbance measurements were taken and

PAGE 81

71 5 ml was removed from the control and treatment flasks, then centrifuged and 0.22 m filtered to remove the bacteria. Serial dilutions up to 10-3 for each treatment were made for each treatment. The nucleic acid stain SYBR Gold (Molecu lar probes) was used to visualize phage from the inductions (Chen, et al .2001). The SYBR Gold stain was diluted 10-1 into 0.02 um filtered sterile water, and 2.5 l of this dilution was added to 97.5 l of sterile 0.02 m filtered water on a Petri dish. Filtration of 1 mL of the 10-2 dilution of the sample onto a 0.02 m 25mm glass Anodisc filter was performe d in triplicate. The filters were stained with SYBR Gold for 12 minutes in a da rk drawer, blotted dry, and then placed on a glass slide. An antifade solution of 50% PBS/ 50% filtered sterilized glycerol was placed on a glass cover slip and pressed onto the filter. The slides were wrapped and stored at -20 C. Viral enumeration was done by counting 10 fields per slide using the grids in the microscope. In each grid the number of virus like particles (VLP) seen under fluorescent illumination were counted. Correction factors we re used to calculate the number of VLP ml-1. Difference in prophage production between treated and control cultures were calculated. Statistical analysis was done in Microsoft Excel using the pooled Student’s ttest for equal variances w ith an alpha level of 0.05. 3.3.4 Host Range of Phage Lysates from Bacillus Isolates Three different methods were used to a ddress the cross-infec tivity of Mitomycin C induced lysates from the 11 Bacillus isol ates within the coll ection. Each of the Bacillus strains that had significant pr ophage production from the initi al screening were induced

PAGE 82

72 and viruses enumerated as described above. Host sensitivity to the phage lysates was first done using the cross-streaking test (Keel, et al. 2002). Approximately 30 l of each phage lysate was streaked on an ASWJP-PY plate and allowed to dry before a loopfull of an overnight culture of the test Bacillus isolate was cross-streaked against th e lysate. Plates were incubated at 28C for 24 to 74 hours then examined for any lysis of bacterial growth. A spot lysis assay was also perfor med by spotting approximately 2 x 107 VLP of each phage lysate on soft ASWJP-PY soft ag ar overlays containing 1 ml of overnight Bacillus culture (Jensen, et al.1998).This assay was done with duplicate spotting of each lysate on duplicate plates of the same overnig ht cultures. Plates we re incubated at 28C for 24 to 74 hours then examined for any lysis of bacterial growth. Cross-infectivity assays using 96-well pl ates were performed as a high throughput method to screen the Bacillus hosts sensitivity to phage lysates. A plate was set up for each phage lysate, so that 200 l of each Bacillus host was added to six wells, four treatment and two controls, on each plate. Ph age lysates were added to each treatment well to a final concentration of 2 x 107 VLP. The plates were incubated at 28C with shaking for 18 hours. Each plate was visually examined for lysis of treatment wells versus the control wells. 3.3.5 Time Series Induction of Ph age Particles from Isolate B14905 Phage production in B14905 was monito red over a 24 hour time series induction with Mitomycin C. Seven ml of an overnight culture B14905 was diluted into 45 ml of fresh ASWJP+PY; there was a control and tr eatment flask. Five ml was removed from

PAGE 83

73 each flask to enumerate bacteria and viruses (T0). The cultures were incubated at 200 rpm at 28 C. When the OD600 reached 0.4, Mitomycin C (1.0 g ml-1) was added to the treatment flask and returned to the shaker. Absorbance readings were taken every two hr until eight hr and at 24 hrs after induction, and 5 ml subsample was removed from each flask for phage enumeration. Samples were st ained and enumerated as described above. Statistical analysis was done in Microsoft Ex cel using the pooled Student’s t-test for equal variances, = 0.05. 3.3.6 Sequencing of the B14905 Host and Phage Genomes The genome of Bacillus sp. NRRL B14905 was sequenced using whole genome shotgun sequencing by the J. Craig Venter In stitute as part of the Gordon and Betty Moore Foundation Marine Microbial Genom e Sequencing Project. The genome was assembled by Robert Edwards and annotated by the subsystems approach in the SEED databank ( http://theseed.uchicago.edu/FIG/index.cgi )(Overbeek, et al.2004).The unfinished genome was submitted to GenBank under the accession number NZ_AAXV00000000. The genome of the induced phage B05-1 was sequenced by Nathan Authement and Anca Segall at San Diego State Universi ty (San Diego, California) using linker amplified shotgun libraries (LASL) as previous ly described (Paul, et al.2005). Assembly was carried out by Sequencher (Genecode, Ann Arbor, MI) and ORFs defined using KODON software (Applied Maths, Austin, TX).

PAGE 84

74 3.3.7 B14905 Prophage Genome Analysis The gene annotations of B14905 were sear ched in the SEED database using the term “phage”, which generated a list of a ll ORFs with the term in them. When these ORFs were clustered together, the region of the contig was investigated for prophage related genes, including integrases, represso rs/anti-repressors, p ackaging proteins, and lysis associated genes. Potential prophage -encoded regions were exported into KODON for further analysis. ORFs were analyzed more in depth by BLASTP of the nonredundant database. Any BLASTP similariti es threshold values between .001 and 0.1 were subjected to PSI-BLAST. 3.3.8 Isolation of Phage Particles from B14905 B14905 phage particles were isolated by a large scale Mitomycin C induction procedure. Fifty ml of overnight B14905 host culture was inoculated into 450 ml ASWJP+PY and grown to log phase (OD600=0.4). Mitomycin C (1 g ml-1) was added to the culture and incubated for 24 hours at 28 C. A bacteria-free viral lysate was obtained by centrifugation at 11,000 X g and f iltering the supernatant through 1.0 m, 0.4 m, and 0.2 m filters. Deoxyribonuclease (DNase I) and Ribonuclease (RQ1) (Promega, Madison, WI) were each added (1 g ml-1) and incubated at room temperature for 30 minutes. The phage particles were further c oncentrated and purified essentially as described by Sambrook and Russell (Sambrook and Russell2001). The phages were precipitated with Polyethylene Glycol 6000 (PEG) and eluted in 2.0 ml of 0.02 M filtered 75% ASW. The phage particles were purified with discontinuous cesium chloride gradients of 1.7 1.5 and 1.35 in polycarbonate tubes in which the samples were

PAGE 85

75 spun at 29,000 X rpm for 2 hours at 4 C. The purified phage band was collected using a syringe from the 1.5 -1.35 interface. Phage particles were stained with SYBR Gold (Molecular probes, Eugene, OR) and enumerated by epifluorescence microscopy unde r blue light excitation as previously described. 3.3.9 Phage DNA Extraction Phage DNA was extracted from the cesium chloride purified phage lysate by the formamide extraction protocol adapted from Sambrook and Russell (Sambrook and Russell2001). The lysate was heated at 65C for 30 minutes in 0.1 volumes of 2M Tris HCl, 0.5 volume 0.5M EDTA, 1.0 volume deionized formamide, and 2 l/ml sample glycogen. The phage DNA was precipitated 2 ti mes with 100% ethanol, followed by an 80% ethanol wash removed salts. The phage pellet was resuspended in 0.02 um filtered 1X TE and DNA quantified with the Na nodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE). 3.3.10 Polymerase Chain Reaction with B14905 Phage Primers Phage genomic DNA was extracted fr om a 500 ml Mitomycin C lysate as described above. Host chromosomal was extracted using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI) fo llowing the manufacturer’s protocol. The quantity and quality of the DNA preparat ions was assessed by agarose gel electrophoresis, and using the Nanodr op ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE).

PAGE 86

76 Primer sets were created for each potential prophage and for the host as described in Table 3.2. In order to account for di ffering amounts of phage DNA present in each preparation, 10 ng of host chromosomal DNA, and 1 ng of phage DNA were used in the reactions. GoTaq Green Mastermix (Promega Madison, WI) was used as recommended, and the primers sets were added to a final concentration of 0.5 M per primer (table 3.2). All PCR were performed in a My Cycler th ermal cycler (Biorad, Hercules, CA). For phage primer sets 1, 2, and 4, and the host primer set the following PCR program was used: initial annealing 2 min at 95C, 30 cycles of 95C fo r 1 min, 58C for 1 min, 72C for 2 min, and a final extension of 72C fo r 10 minutes. The PCR program used for phage primer set 3 was: initial ann ealing 2 min at 95C, 30 cycles of 95C for 1 min, 56C for 1 min, 72C for 2 min, and a final extension of 72C for 10 minutes. The amplicons were loaded on a 1% agarose gel with 0.5 ug l-1 of ethidium bromide, and run at 89 V for 45 minutes. The gel was imaged using the AlphaImager 2200 imaging systems (Alpha Innotech, San Leandro, CA). Table 3.2 List of Primer Sets for B14905 PCR. Primer name sequence Gene Amplicon size (bp) 1F GACGACTGGCGAAGTGTTTT 1R GCAGATGCCCT TGGTTATGT Phage anti-repressor (ORF 13) 224 2F TCGGAAGAAATCGATGGAAC 2R TAGGCAGCCGCAATAACTCT Terminase (ORF 18) 538 3F CGCGAGTCCGATACGATTTA 3R TTCACCAACAATTTCTTTCA Hypothetical protein (ORF 34) 206 4F GGACGAGTGTCTCGCAACA 4R CACAAAAGAGGCCCAGAAAT Tail tape measure protein (ORF10) 249 HostF ATTTGGCATGGAGCTAGTGC HostR GGAACGAACCGCTTTCTATG Non-coding region on contig 126650671 322

PAGE 87

77 3.3.11 Transmission Electron Microscopy of B14905 Lysate Transmission electron microscopy (TEM) wa s used to determine the presence and morphologies of multiple phages in B14905. Twel ve mls of a Mit C induced culture were ultracentrifigued at 38,000 g for 2 hours at 4 C. The phage pellet was resuspended in 100 l of 0.02 um filtered deionized water and the VLPs enumerat ed with epifluorescence as described above. A formvar carbon coated grid (Electron Microscopy Sciences, Hatfield, PA.) was floated on a large drop of lysate fo r 2 hours. The grid wa s air-dried and then negatively stained with 2% ura nyl acetate for 1 min. The phage particles were visualized with a Hitachi 7100 transmission electron microscope. 3.4 Results 3.4.1 Induction of Sporulation in Bacillus Isolates Month old colonies of all Bacillus strains were observed to contain spores that were similar to the morphology described in Siefert et al. (2000). Sporulation was characterized in the Bacillus isolates after a 24 hour trea tment with decoyinine (Figure 3.1). Isolates B14905, B14906, B14910, B14911, B14950 and B14851 had significantly higher spore production with decoyinine than in the controls. Spore production in decoyinine treated isolates B 14904, B14907, B14908, B14909, and B14912 was not significantly different from the contro ls. Within this group B14904, B14908, B14910 and B14912 had frequency of sporulation that was less than one percent, while B14907 had a high frequency of spontaneous sporulation. The difference between spontaneous spore production in the controls and decoyinine i nduced spore production for each isolate is displayed in Table 3.3

PAGE 88

78 * * *0.00% 10.00% 20.00% 30.00% 40.00% 50.00% 60.00% 70.00% 80.00% 90.00% 100.00% B14904B14905B14906B14907B14908B14909B14910B14911B14912B14850B14851IsolatesPercent SporesFigure 3.1. Frequency of Sporulation in Bacillus Isolates after 24 hour Decoyinine Incubation. Mean percent sporulation for each isolate was used to chart frequency of sporulation in decoyinine (light gray bars) and control (dark gray bars) cultures. Asterisks denote significantly different sporulation between the two treatments ( p<0.05). Standard deviation is represented by error bars. Table 3.3. Difference in Prophage Production and Spor e Production. Prophage production data is based on VLP ml-1 production in the control (spontaneous) and mitomycin C treated cultures. Spore production data is based on percent of spores in control (spontaneous) and decoyinine treated cultures. Percent difference between the treatment and control was calculated for each experiment. Asterisks denote significant difference between the two treatments for each experiment. Prophage Production (VLP ml-1) Spore Production (% spores ) Isolates Spontaneous Mitomycin C Percent Difference Spontaneous Decoyinine Percent Difference B14904 7.00E+06 1.50E+0753 00.7 100 B14905 2.50E+08 3.11E+1099* 1384.1 85* B14906 8.30E+07 8.18E+0890* 11.857.2 79* B14907 1.15E+07 1.35E+0999* 50.166.3 24 B14908 2.44E+09 3.43E+1093* 0.030.4 24 B14909 6.10E+07 3.45E+0882* 1.00.8 -25 B14910 3.12E+07 1.15E+0873* 0.249.6 99.6* B14911 2.50E+06 2.40E+06-4 29.971.4 58* B14912 8.25E+08 3.10E+0973* 0.40.7 46 B14850 2.50E+07 3.00E+0999* 74.886.6 14* B14851 2.60E+06 3.60E+060.28 25.681.4 69*

PAGE 89

79 The five isolates that di d not sporulate with decoyini ne treatment, as well as, B14907 and B14950, which had high levels of spontaneous sporulation, were subjected to both heat and ethanol treatments to veri fy that they produced spore spontaneously. There was no significant sporulati on in B14904, B14908, B14909, and B14912 with either of the treatments. B14907 had a 74% freq uency of sporulation with heat treatment, and ethanol treatment resulted in the 7% frequency of sporulation in B14950. 3.4.2 Prophage Induction in Bacillus Isolates Prophage induction was investigated in el even Bacillus isolates after 24 hour incubation with Mitomycin C ( f igure 3.2). Viral-like part icles produced by strains B14851, B14904, and B14911 were not significantly different from the controls (p > 0.05). Isolate B14912 was significantly different from the controls but there was high spontaneous induction in the control culture. Isolates B 14908 and B14910 had significant prophage induction, but it was less than an ma gnitude compared to the controls. Phage production in isolates B14905, B14906, B14907, B14909, and B14850 was more than a magnitude greater than in the controls Table 3.2 shows the difference between spontaneous phage production in the contro l and mitomycin C induced phage production. 3.4.3 Prophage Induction versus Spore production in Bacillus Isolates The percent difference in prophage pr oduction between the mitomycin C treated and control cultures, and the percent difference spore producti on from the decoyinine and control cultures for each isolate in table 3.3 was plotted against each other (figure 3.3).

PAGE 90

80 * * * *1.00E+06 1.00E+07 1.00E+08 1.00E+09 1.00E+10 1.00E+11 B14904B14905B14906B14907B14908B14909B14910B14911B14912B14850B14851IsolatesProphage Production (VLP ml-1) Figure 3.2. Prophage Production in Bacillu s Isolates after 24 hour Mitomycin C incubation. Mean prophage production for each isolate in control (dark gray bars) and Mitomycin C (li ght gray bars) cultures is shown. Asterisks denote significantly different prophage production (p<0.05). Standard deviation is represented by black bars. B14905 B14907 B14850 B14906 B14912 B14909 B14851 B14911 B14910 B14908 B14904 0 10 20 30 40 50 60 70 80 90 100 0102030405060708090100 percent sporulationpercent phage productio n Figure 3.3. Prophage Production and Sporulation in Bacillus Isolates. For each strain the percent difference in phage production (MitC treated-Spontaneous) and percent difference in number of spores from Table 3.2. were graphed.

PAGE 91

81 3.4.4 Host Range of Phage Lysates from Bacillus Isolates None of the three methods used, crossstreaking, spot lysis, or the crossinfectivity produced visible ly sis in isolates from our Bacillus collection. 3.4.5 Time Series Induction of Ph age Particles from Isolates B14905 A 24 hour time series prophage induc tion with Mitomycin C was performed on isolate B14905 shows that isolate B14905 cont ains inducible phages (figure 3.4A). After 24 hours prophage induction in the m itomycin C treated culture (3.11 x 1010 VLP ml-1) was significantly higher than in the control culture (2.51x108 VLP ml-1). As expected bacterial growth monitored by absorbance decr eased in the Mitomycin C treated culture (figure 3.4B) Figure 3.4 Phage production (panel A) and bacterial growth based on absorbance (panel B) in a control and mitomycin C treated culture. Black circles are the Mitomycin C treated cultres, white circles are the controls. Asterisks denote when Mitomycin C was added. The mean VDC and BDC for each time point was used to chart production or growth, respectively. Standard deviation is represented by error bars. Time (hrs) 0510152025 Phage Production (VLP ml-1) 1e+7 1e+8 1e+9 1e+10 1e+11 Time (hrs) 0510152025 Absorbance (OD600) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 A B

PAGE 92

82 3.4.6 Analysis of the B 14905 Bacterial Genome The draft B14905 genome is 4.4 Mbp in leng th with a G+C content of 37%. The genome was assembled into 99 contigs, a nd contained 4626 protein coding regions and 126 RNA genes. 55 percent of the coding regions could be assigned a putative functional assignment. 3.4.7 Analysis of Prophage-like Regions of the B14905 Genome B05-1 Sequencing of the Mit C induced lysate re sulted in a single double-stranded phage genome, B05-1, 18,118 bp in length with a G+C content of 33%, and this assembly was verified by comparison to the prophage seque nce in the B14905 host genome contained in contig 101159007470. Fourteen of the ORFs ( 52%) shared significant similarity (e<103) at the protein level with other sequences in GenBank. Ten of the ORFs were similar to genes found in other Bacillus and Bacillus phages. Putative func tional assignments and significant similarities to other sequences are listed in table 3.4 and figure 3.5. The B05-1 contained several genes that we re similar to those found in other temperate phages. ORF 1 was similar to an integrase (4e-37, 31% identity). ORF 6 was similar to the phage replication protein (2e-26, 47% identity) from the B. cereus temperate phage phBCA6A52. ORF 8 shared similarity with ORF 13 (8e-40, 49% identity) of B. subtilis phage -105. ORF 12 of B05-1 was similar to the antirepressor protein (2e-48, 48% identity) of Streptococcus phage 10750.4. No phage structur al or lytic genes were identified through si milarity searching.

PAGE 93

83 The B05-1 genome contained four putative transcriptional regulators, ORFs 2, 3, 17, and 20. ORF 2 is similar to the DNA bi nding domains of post-exponential phase transcriptional regulators from Oceanbacillus iheyensis HTE831 (2e-8, 44% identity), B. halodurans C-125 (2e-6, 41% identity), and Bacillus sp. NRRL-B14911 (3e-6, 38% identity). Post-exponential phase transcriptional regulators ar e involved in expression of genes that allow Bacillus to adapt to sub-optimal conditi ons in the transition from active to stationary phase (Strauch and Hoch 1993). The ORF also shared weak similarity to sinR, from B. thuringiensis (1e-04, 40% identity). SinR is a transition state regulator that represses stage II sporulation genes and spo0A expression during vege tative growth. ORF 3 is a weak hit to a tran scriptional regulator from Bacillus licheniformis ATCC 14580. ORF 17 was a very strong hit to a MerR type transcripti onal regulator from B. cereus E33L (5e-102, 63% identity). MerR type transc riptional regulators respond to a variety of stressful stimili including metals and antibiotics. Transcriptional regulators in this family, which have been found in vari ous bacteria and phages, have a similar DNA binding domain (Brown, et al.2003). ORF 18 is part if a group (ORF 17-20) that contains 2 ORFs similar to chlolo glycine hydrolases from B. cereus ATCC 14579 and B. cereus E33L. Choloylglycine hydrolases are bacterial products, usually associated with intestinal microflora, that catalyze the de gradation of bile salts that re sult in the production of free amino acids (Begley, et al.2005). ORF 20 is sim ilar to transcriptiona l regulator found in S. pyogenes (3e-8, 32% identity). It also shares similarity with a VanU, a gene involved in vancomycin resistance in Enterococcus faecalis (6e-7, 38% identity) and LlaI, part of a phage-encoded restriction modification system in Lactococcus lactis (2e-4, 28% identity) (Boyd, et al. 2006, Forde and Fitzgerald 1999).

PAGE 94

84Table 3.4. Open Reading Frames of the B05-1 genome and BLASTP hits.+, forward orientation; reverse orientation. ORF no./ orientation Nucleotide position Predicted function Related BLASTP hit(s) 1/ 65-1279 Integrase site-specific recombinase, pha ge integrase family [Ent erococcus faecalis V583] AAO81778 (2e-47) integrase [Bacteriophage phBC6A52] NP_852561 (4e-37) 2/+ 1318-2063 Transcriptional regulator transcriptional regulator of post-expo nential-phase responses [Oceanobacillus iheyensis HTE831] BAC14480 (2e-8) post-exponential-phase response transcri ptional regulator [Bacillus sp. NRRL B-14911]ZP_01170246 (3e-6) regulator SinR [Bacillus t huringiensis].AAG00996 (1e-4) 3/+ 2129-2449 Transcriptional regulator unknown [Staphylococcus aureus]AAP55248 (6e-5) putative transcriptional regulator [Bacillus licheniformis ATCC 14580] AAU25099 (1e-4) 4/+ 2446-2715 No significant hits 5/+ 2785-3102 No significant hits 6/+ 3139-4035 Replication protein replication protein [Bacteriopha ge phBC6A52] NP_852568 (2e-26) replication protein [Bacillus anthracis str. 'Ames Ancestor']. AAT33240 (9e26) 7/+ 4082-4390 No significant hits 8/4391-4912 Hypothetical protein [Bacillu s licheniformis DSM 13] AAU42447 (1e-42) ORF13 [Bacteriophage phi-105]. NP_690797 (8e-40) 9/4934-5356 No significant hits 10/+ 5484-5762 group-specific pr otein [Bacillus cereus cytot oxis NVH 391-98].ZP_01181082 (2e-19) group-specific protein [Bacillus cereus E33L]. AAU16808 (2e-18) 11/5838-6179 No significant hits 12/+ 6674-7174 Phage antirepressor phage antirepressor protein [Desulfotomaculum reducens MI-1]. ZP_01150439 (3e-56) phage antirepressor protein [Bacteriophage 10750.4] YP_603395 (2e-48) 13/+ 7405-7716 No significant hits 14/7727-8170 No significant hits 15/+ 8175-8807 No significant hits 16/+ 8795-9691 hypothetical protein [Bacillus cereu s E33L]. AAY60441 (1e-41) 17/+ 9808-10671 Transcriptional regulator transcriptional regulator [Bac illus cereus E33L]. AAY60476 (5e-102) regulatory protein [Clostridium beijerincki NCIMB 8052]. ZP_00908099 (2e30) 18/+ 10759-11748 Choloylglycine hydrolase conserved hypothetical protein [Baci llus cereus E33L]. AAY60477 (7e-150) Choloylglycine hydrolase [Bacillus cereus ATCC 14579]. AAP09328 (1e-12) 19/+ 11724-12911 Choloylglycine hydrolase Choloylglycine hydrolase [Bacillus cereus ATCC 14579]. AAP09328 (6e-86) conserved hypothetical protein [Baci llus cereus E33L]. AAU18072 (1e-82) 20/12973-13185 Transcriptional regulator hypothetical protein [Clostridium acetobutylicum ATCC 824] AAK79912 (2e11) transcriptional regulator [Streptococcus pyogenes MGAS10394] AAT86620 (3e-8) VanU [Enterococcus faecalis] ABA71726 (6e-7) LlaIC [Lactococcus lactis] AAR19408 (2e-4) 21/+ 13616-13954 No significant hits 22/+ 13947-14135 No significant hits 23/+ 14424-15371 Hypothetical protei n [Sphingomonas sp. SKA58] ZP_01305154 Appr-1-p processing protein [Thi obacillus denitrificans ATCC 25259] YP_315247 24/15368-16357 No significant hits 25/+ 16581-16988 No significant hits 26/+ 17110-17733 No significant hits

PAGE 95

85 Figure 3.5 Genomic Map of B14905 Prophage-like Regions. Kodon was used to construct the gene map. Colors were assigned based on functional assignment of the ORF. Color code: Conserved hypothetical protein (gray), Unknown (black), Packaging (magenta), Capsid associated (green), Tail associated (blue), DNA metabolism (red), DNA replication (orange), Lysogeny related (yellow), Lysis related (purple). integrase transcriptional regulator transcriptional regulator phage replication protein phage antirepressor transcriptional regulator hypothetical protein chloroglycine hydrolase transcriptional regulator phage replication protein single-strand DNA-binding protein terminase small subunit terminase large subunit transposase integrase phage repressor phage antirepressor phage replication protein replication protein terminase small subunit terminase large subunit portal protein phage lysis protien N-acetylmuramoyl-L-alanine amidase transposase N-acetylmuramoyl-L-alanine amidase phage tail protein phage tail protien baseplate hydrolase tail tape measure core tail tail sheath phage repressor Integrase, XkdAB05-1 B05-2 B05-3 B05-4

PAGE 96

86 B05-2 B05-2 was a prophage-like region 17,159 bp in length with a G+C content of 35.5% that was found on contig 101159007463 of the B14905 host genome. The genome is composed of 24 ORFs, 15 (62.5%) of whic h shared significant similarity (e<10-3) at the protein level with other sequences in GenBank (figure 3.5). Putative functional assignments and significant similarities to other sequences are listed in table 3.5. The genome of B05-2 contained phage related pr oteins that are found in other Bacillus strains and prophages. ORF 3 and 4 are similar to hypothetical proteins from Lactococcus lactis prophage bIL309 (6e-4, 31% identity) and Pneumococcus prophage EJ-1 (6e-10, 40% identity), respectively. Two phage replication associated proteins were found in the genome. ORF 5 shares similar ity with a DNA replication protein found in the lytic Bacillus phage gamma (7e-40, 65% identity), while ORF 7 is similar to the single-stranded DNA binding protein of Staphlyococcus aureus prophage PVL (2e-18, 49% identity). ORF 18 putatively encodes a term inase small subunit that is similar to the protein in temperate B. clarkii phage BCJA1c (1e-48, 48% identity). The large terminase gene encoded by ORF 19 is similar to the proteins in B. thuringiensis (4e-56, 42% identity) and temperate Acintobacillus actinomycetes phage Aaphi23 (3e-28, 35% identity). ORF 24, the final ORF of B05-2, is similar to transposases found in B. clausii (6e-166, 63% identity) and Streptococcus pyogenes (1e-122, 49% identity). No integrase, lysogeny-related, or stru ctural genes were found.

PAGE 97

87Table 3.5 Open Reading Frames of the B05-2 genome and BLASTP hits. +, forward orientation; reverse orientation. ORF no./ orientation Nucleotide position Predicted function Related BLASTP hit(s) 1/ 59-1087 Hypothetical protein [Bacillus weihenstephanensis] ZP_01185054 (3e-106) ybdG [Bacillus subtilis subsp. subtilis str. 168].CAB11993 (6e-24) 2/+ 1199-1537 hypothetical protein [Liste ria monocytogenes J2818] EBA25261 (1e-12) 3/+ 1560-1880 hypothetical protein [Liste ria monocytogenes J2818] EBA25260 (5e-18) hypothetical phage protein [Strepto coccus pyogenes MGAS10394] (2e-8) Orf13 [Bacteriophage bIL309] NP_076708 (6e-4) 4/+ 1808-2182 hypothetical protein [Lis teria monocytogenes J2818]EBA25260 (5e-24) hypothetical protein [Bacteriophage EJ-1] NP_945261 (6e-10) 5/+ 2552-2914 Phage replication hypothetical protein 3002 [Bacillus we ihenstephanensis] ZP_01186009 (3e-44) putative DNA replication protein [B acteriophage gamma] ABB55440 (7e-40) DnaA analog, DnaD domain protein [B acillus anthracis bacteriophage Fah] YP_512343 (7e-40) 6/+ 2999-3601 No significant hits 7/+ 3754-4104 ssDNA binding protein ssDNA binding protein [Bacillus cereu s subsp. Cytotoxis NVH 391-98] ZP_01181508 (3e-22) ssDNA binding protein [Staphylococcus aure us phage PVL] NP_058484 (2e-18) 8/4366-4929 Hypothetical protein with colla gen triple helix repeat domain [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00741314 (1e-33) Hypothetical protein with collagen trip le helix repeat domain [Bacteriophage phBC6A52] NP_852575 (2e-8) 9/5114-5464 Hypothetical protein with colla gen triple helix repeat domain [Bacillus weihenstephanensis KBAB4] ZP_01186176 ( 1e-29) 10/+ 5475-5630 No significant hits 11/6116-6625 hypothetical protein [Bac illus sp. NRRL B-14911] ZP_01169056 (5e-60) yvdQ [Bacillus subtilis subsp. s ubtilis str. 168] CAB15456 (3e-54) 12/6745-7023 13/+ 7526-7939 YqaQ [Bacillus subtilis] BAA12392 (9e-10) 14/7970-8311 No significant hits 15/+ 8673-8912 No significant hits 16/+ 9194-9634 No significant hits 17/+ 9879-10739 No significant hits 18/+ 10837-11754 Terminase, small subunit Terminase small subunit [Bacillus clar kii bacteriophage BCJA1c]YP_164411(1e48) putative terminase small subunit [L actobacillus johnsonii prophage Lj965] NP_958578 (1e-18) 19/+ 11732-12649 Terminase large subunit hypothetical protein [Listeria i nnocua Clip11262] NP_471068 (2e-89) terminase large subunit TerL [Bacter iophage Aaphi23] NP_852753 (3e-38) TerL [Lactococcus lactis bacteriopha ge TP901-1] NP_112694 (4e-16) 20/+ 12700-12891 No significant hits 21/+ 12924-13610 hypothetical protein [Enterococcus faeca lis V583] NP_815182 (8e-55) hypothetical protein JK_31 [Bacteriopha ge JK06](e.coli) YP_277469 (5e-8) gp26 [Burkholderia cenocepacia phage BcepB1A] YP_024873 (1e-6) 22/+ 14032-14616 No significant hits 23/+ 14762-15235 No significant hits 24/15442-16791 Transposase transposase [Bac illus clausii KSM-K16] YP_173748 (6e-166) Phage-associated cell wall hydrolase [Streptococcus pyogenes MGAS10394] YP_060515 (1e-122)

PAGE 98

88 B05-3 B05-3 is a prophage-like region 25,898 basepairs in length found on contig 101159007974, with a G+C content of 36.1%. The genome was composed of 43 ORF, 24 (54%) of which were similar to other prot eins in GenBank (figure 3.4). Table 3.6 shows putative functional assignme nts and significant similari ties to other proteins. The B05-3 genome contained lysogeny-relate d and phage replication genes that were similar to other temperate phages and pr ophage regions in bacterial genomes (Table 3.6). ORF 1 is similar to in tegrase proteins found in Geobacillus thermodenitrificans (5e-27, 33% identity) and temperate mycophage Ms6 (9e-12, 28% identity). ORF 3 encodes a phage repressor that is similar to those in Geobacillus phage GBSV1 (3e-12, 44% identity) and B. anthracis str. Ames (1e-9, 48% identity). ORF 7 is similar to the phage antirepressor proteins from S. aureus prophage phiPV83 (3e-24, 32% identity), temperate coliphage P1 (5e-14, 38% identity), and Clostridium difficile prophage phiCD119 (6e-14, 38% identity). ORF 20 and ORF 21 are sim ilar to phage replication genes from B. anthracis strains, Bacillus phage gamma, and Staphylococcus phage phiPVL108. Late phage genes involved in packagi ng and lysis are found on the right side of the B05-3 genome. ORF 35 was similar to the terminase small subunits from B. subtilis (1e-34, 39% identity), a Clostridium prophage phiC2 (1e-13, 34% identity), and B. clarkii temperate phage BCJA1c (8e-7, 63% identity). ORF 36 encodes the terminase large subunit that shares similarity with B. subtilis (9e-164, 67% identity), Staphylococcus phage phiETA2 (1e-34, 31% identity), and Bacillus phage SPP1 (2e-21, 27% identity). ORF 37 is similar to portal proteins from Staphylococcus phages phiNM4 (2e-39, 42% identity) and phiETA3 (7e-39, 42% identity). ORFs 41 and 42 are similar to a holin and a cell wall

PAGE 99

89 hydrolase, respectively, found in temperate Bacillus phages. No phage structural genes were found based on similarity to known protein sequences. Table 3.6 Open Reading Frames of the B05-3 genome and BLASTP hits +forward orientation; reverse orientation. ORF no./ orientation Nucleotide position Predicted function Related BLASTP hit(s) 1/ 1-778 integrase integrase [Geobacillusthe rmodenitrificans NG80-2] YP_00112487 (5e-27) integrase [Mycobacterium phage Ms6] AAD03774 (9e-12) 2/901-1446 xkdA [Bacillus subtilis subs p. subtilis str. 168] CAB13107(2e-21) 3/1499-1903 Transcriptioa l regulator immunity repressor protein [Geob acillus phage GBSV1] YP_764504 (3e-12) Transcriptional regulator [Bacteriophage ph BC6A51] NP_852484 (3e-5) 4/+ 2078-2290 Hypothetical protein [B acillus anthracis str.Ames] NP_846364 (5e-8) 5/+ 2344-2559 No significant hits 6/2513-2656 No significant hits 7/+ 2856-3665 antirepressor antirepressor [Staphylococcus aureus prophage phiPV83] NP_061599 (3e-24) KilA [Enterobacteria pha ge P1] YP_006517 (5e-14) antirepressor [Clostridium difficile phage phi CD119] YP_529598 (6e-14) 8/+ 3665-3877 No significant hits 9/+ 3912-4280 hypothetical pr otein gp52 [Geobacillus phage GBSV1] YP_764508 (4e-9) 10/+ 4461-4979 phage-related protei n [Geobacillus kaustophilus HTA 426] YP_146359 (1e-23) 11+ 4976-5221 No significant hits 12/+ 533-5742 No significant hits 13/+ 5739-5969 No significant hits 14/+ 5975-6925 hypothetical protein [Liste ria monocytogenes J0161] EBA18846(8e-23) 15/+ 6942-7679 hypothetical protein EJ-1p22 [Streptococcus phage EJ-1] NP_945261 (3e-29) Orf13 [Lactococcus phage bIL309] NP_076708 (5e-25) 16/+ 7693-7869 No significant hits 17/+ 7959-8246 hypothetical protein [Xanthom onas phage Xp15] YP_239311 (2e-16) hypothetical protein [Pse udomonas aeruginosa phage F116] YP_164287 (7e-7) 18/+ 8289-8969 gp47 [Bacteriophage phi1026b] NP_945078 (9e-23) hypothetical protein phiE125p43 [Bacteriopha ge phiE125] NP_536399 (3e-22) 19/+ 9035-9682 hypothetical prot ein [Bacillus clarkii bacteri ophage BCJA1c] YP_164397 (1e-5) 20/+ 9698-10630 replication phage re plication protein [Bacillus anthr acis phage gamma] ABA46496 (5e-43) DnaA/ DnaD protein [Bacillus anthracis bacteriophage Fah] YP_512343 (5e-43) 21/+ 10611-11390 replication Phage replication DnaC [Bacillus anthracis str. Ames] AAP27845 (1e-64) DNA replication protein DnaC [P hage Gifsy-2] NP_459990 (6e-22) DNA replication[Staphylococcus pha ge phiPVL108] BAF41172 (1e-16) 22/+ 11387-11608 No significant hits 23/+ 11612-11860 No significant hits 24/+ 11860-12252 No significant hits 25/+ 12245-12433 No significant hits 26/+ 12449-12574 No significant hits 27/+ 12781-13851 hypothetical protein [Rhodops eudomonas palustris CGA009] NP_947632 (2e33) 28/+ 13999-14433 response regulator [Bacillu s licheniformis ATCC 14580] YP_078644 (2e-8) 29/+ 14526-14921 No significant hits 30/14964-15110 No significant hits 31/+ 15135-15263 No significant hits 32/+ 15313-15471 No significant hits 33/+ 15468-16742 No significant hits 34/+ 16924-17610 hypothetical protein [C lostridium thermocellum ATCC 27405] YP_001038709(1e-19) 36/+ 18760-20022 Terminase, large subunit terminase large subunit [Bacillus lic heniformis ATCC 14580]YP_078647(1e176) PBSX terminase [Bacillus subtilis] CAA94059 (4e-156) terminase large subunit [Clostridium phage phiC2] YP_001110720 (2e-22) 37/+ 20035-20796 Portal phage porta l protein [Staphylococcus aureus phage phiNM4] ABF73268(2e-39) portal protein [Staphylococcus phage phiETA3] YP_001004371 (7e-39)

PAGE 100

90Table 3.6 continued ORF no./ orientation Nucleotide position Predicted function Related BLASTP hit(s) 38/+ 20780-21031 No significant hits 39/+ 21061-22248 phage-related pr otein [Geobacillus kaustophilu s HTA426] YP_146395 (4e-69) hypothetical protein [Bacteriophage phi LC3] NP_996717 (2e-15) 40/+ 22660-22839 No significant hits 41/22983-23390 Holin phage-relate d lysis protein [Geobacillus phage GBSV1] YP_764490 (4e-13) holin [Bacteriophage phBC6A52] NP_852604 (8e-11) holin [Bacillus anthracis phage Gamma] YP_338199 (4e-10) 42 23387-24097 Lysis gene XlyB [Bacillus lic heniformis ATCC 14580] YP_091161 (8e-56) N-acetylmuramoyl-L-alanine amidase [Bacillus weihenstephanensis] ZP_01182466(5e-53) N-acetylmuramoyl-L-alanine amidase [Bacillus phage Gamma]YP_338200(1e49) 43 24244-25824 transposase transposase of IS663 [Bacillus halodurans]BAD18252(0) transposase [Staphylococcus phage phiPVL108] YP_918946 (3e-150) B05-4 The B05-4 genome was found on the host contig 101159007441. The putative prophage is 17,991 bp in length, with a G+C c ontent of 36.5%. The genome contained 23 ORFs, 20 (87%) of which shared similarity wi th other proteins in GenBank (figure 3.5, Table 3.6). Twelve of the ORFS were similar to genes from the temperate Myoviruses, Clostridium phage phiC2 and the Streptococcus phage EJ-1. Ten B05-4 ORFs also shared similarity to genes of the defective Bacillus phage PBSX, a defective prophagelike element known for packaging random portions of host DNA. ORF 22 was similar to the integrase XkdA from B. subtilis (1e-25, 39% identity), and ORF 23 was similar to pha ge repressor proteins from B. clausii (3e-13, 50% identity) and B. lichenformis (6e-6, 33% identity). ORFs 7-11 and 14-21 encode genes that are similar to tail proteins from temperate M yoviruses phiC2 and EJ-1 and the defective phage PBSX found on B. subtilis (Table 3.6). ORFs 2, 12, and 13 are similar to cell wall hydrolases of phiC2 and and PBSX ORF 2 is similar to a holin protein found in phiC2. No identifiable replication, capsid, or DNA packaging genes were found in B05-4.

PAGE 101

91Table 3.7. Open Reading Frames of the B05-4 genome and BLASTP hits. +, forward orientation; reverse orientation. ORF no./ orientation Nucleotide position Predicted function Related BLASTP hit(s) 1/ 24-1439 No significant hits 2/1869-2591 Hydrolase N-acetylmuramoyl L-alalanine amidase [Lactobacillus sakei subsp. sakei 23K] YP_396195 (1e-46) N-acetylmuramoyl-L-alanine amidase [L isteria phage A511] CAA59368 (2e-26) N-acetylmuramoyl-L-alanine amidase [Streptococcus phage EJ-1]NP_945312 (5e20) 3/2588-2854 Holin hypothetical protein [C lostridium tetani E88] NP_782152 (1e-12) hypothetical protein [Bacillus sp NRRL B14911] ZP_01171442 (3e-8) holin [Clostridium phage phiC2] YP_001110752 (7e-7) 4/2867-3211 hypothetical protein [Bacillus anthracis phage lambda Ba01]AAP24508 (2e-6) 5/3239-3349 No significant hits 6/3349-3768 hypothetical pr otein [Geobacillus kaustoph ilus HTA426] YP_146400 (8e-8) 7/3782-5407 Tail fiber phage variab le tail fiber protein [Pseudomona s entomophila L48] YP_609632 (2e-4) 8/5407-5955 hypothetical protein [Clostri dium phytofermentans ISDg]ZP_01354785 (6e-29) hypothetical protein phiC2p26 [Clostri dium phage phiC2] YP_001110743 (1e-16) hypothetical protein EJ-1p62 [Strep tococcus phage EJ-1] NP_945301 (2e-9) xkdU [Bacillus subtilis] CAA94042 (3e-5) 9/5948-7033 Baseplate Baseplate J-like protein [Clo stridium phytofermentans ISDg] ZP_01354786 (1e-88) hypothetical protein [Clostridium phage phiC2] YP_001110742 (8e-79) tail protein [Streptococcus phage EJ-1] NP_945300 (9e-41) xkdT [Bacillus subtilis] CAA94041 (6e-32) 10/7033-7437 PBSX related protein [Clostri dium phytofermentans ISDg]ZP_01354787 (4e-23) hypothetical protein EJ-1p60 [Strep tococcus phage EJ-1] NP_945299 (5e-12) xkdS [Bacillus subtilis] CAA94040 (3e-7) 11/7437-7751 PBSX related protein [Clostri dium phytofermentans ISDg]ZP_01353997 (2e-9) phage related protein [Bacillus liche niformis ATCC 14580] YP_078533 (5e-4) 12/7753-8715 Hydrolase putative hydrolase [C lostridium phage phiC2] YP_001110740 (9e-71) hypothetical protein [Bacteriophage EJ-1] CAE82140 (3e-28) xkdQ [Bacillus subtilis] CAA94050 (5e-21) 13/8708-9391 Lysin putative LysM [Clostri dium phage phiC2] YP_001110739 (2e-37) xkdP [Bacillus subtilis]CAA94038 (1e-13) 14/9384-11309 Tail Tape Measure putative tail tape measure protein [Clost ridium phage phiC2] YP_001110738 (2e-40) tail length tape measure protein [Str eptococcus phage EJ-1] NP_94529 (2e-23) 15/11572-11736 No significant hits 16/11766-12200 hypothetical protein phiC2p16 [Clostridium phage phiC2] YP_001110734 (8e-26) xkdN [Bacillus subtilis] CAA94036 (3e-8) 17/12261-12782 Tail Core putative core tail [C lostridium phage phiC2] YP_001110732 (1e-46) core tail protein [Streptococcus phage EJ-1] NP_945293 (4e-23) xkdM [Bacillus subtilis] CAA94035 (2e-21) 18/12798-14120 Tail Sheath putative sheath tail protein [Clostri dium phage phiC2] YP_001110731 (5e-122) sheath tail protein [Streptococcus phage EJ-1] NP_945292 (7e-48) xkdK [Bacillus subtilis] CAA94066 (5e-30) 19/14122-14343 No significant hits 20/14315-14773 hypothetical protein phiC2p12 [Clostridium phage phiC2] YP_001110730 (1e-6) 21/15546-15878 YqaQ [Bacillus licheni formis ATCC 14580] YP_091054 (2e-5) 22/+ 16668-17024 Phage repressor Phage related transcriptional regulat or [Bacillus clausii ]YP_177057 (3e-13) Xre [Bacillus licheniformis ATCC 14580] YP_090915 (6e-6) 23/+ 17099-17620 Integrase Hypothetical protein [Bacillus weihenstepha nensis KBAB4]ZP_01185521 (6e-27) XkdA [Bacillus licheniformis ATCC 14580] YP_090914 (1e-25) xkdA [Bacillus subtilis] CAA94051 (2e-11)

PAGE 102

92 3.4.8 Polymerase Chain Reaction with B14905 Phage Primers Detection of prophage-like regions in B14905 host genomic DNA and cesiumchloride purified Mitomycin C induced phage DNA with the individual primer sets is shown in figure 3.6. All four prophage primer sets amplified in the host DNA (lane 2-5) confirming that these regions are found in the host genome. Only the B05-1 (lane 7) and B05-3 (lane 9) amplified in the indu ced phage DNA. PCR using host specific bacterial primers produced an amplicon in th e host DNA (lane 6), but not in the phage DNA (lane 11), suggesting that th e phage DNA was host DNA-free. Figure 3.6. Agarose Gel Electrophoresis of B14905 DNA PCR Amplicons. Fisher 100bp DNA standard (lanes 1&12). Host chromosomal, B05-1 primer set (lane 2), B05-2 primer set (lane 3), B05-3 primer set (lane 4), B05-4 primer set (lane 5), host primer set (lane 6). CsCl phage lysate DNA, B05-1 primer set (lane 7), B05-2 primer set (lane 8), B05-3 primer set (lane 9), B05-4 primer set (lane 10), host primer set (lane 11).

PAGE 103

93 3.4.9 Transmission Electron Microscopy of B14905 Lysate Electron micrographs of negatively stai ned B14905 lysates showed two different phage morphologies (figure 3.7). A possible Myovirus-like partic le is seen in panel A; with capsid diameter of 138 nm and a tail le ngth of 307 nm and width of 23 nm. Panels B and C showed smallers particles with icosah edral capsids (103 nm diameter) with thick tails (210 nm length and 35 nm width) consistent with Myoviridae There were also incomplete phage tail components as seen in panels D and E, F. Figure 3.7. TEM micrographs of B14905 induced phage lysates. Panels A, B, D, and F are 100,000X magnification; the black bars symbolizes 100 nm.. Panel C and D are 150,000X magnification; the black bars symbolizes 50 nm.

PAGE 104

94 3.5 Discussion Members of the Bacillus genera are ubiquitous in natu re due to their ability to form spores that are resistant to a dverse conditions. The Gulf of Mexico Bacillus isolates displayed a range of spore production fre quencies when sporulation was induced by artificial means during exponential growth. The isolates that had si gnificant levels of sporulation with decoyinine treatment indi cate that this chemical was effective in inhibiting GMP synthesis in these isolat es. Strains B14850 and B14907 are interesting because of their high levels of sporulation in both the control and decoyinine treatments after 24 hours. This could be due to poorly controlled sporulation initiation caused by a mutation resulting in repression of catabolite sensing (Boylan, et al.1988, Shafikhani, et al. 2003). Alternatively, these isolates may ha ve salvage pathways that allow them to obtain GMP by other means so that decoyini ne treatment in ineffective in inducing sporulation (Ratnayake-Lecamwasam, et al. 2001).With the exception of B14907, the four isolates that did not produce spores during chemi cal or heat treatment had frequencies of sporulation belo w one percent in both control and treatment. This indicates that these isolates may have tightly regulated initiation of sporula tion that prevents any sporulation occurring when nutrients are presen t. Further work is needed to elucidate the signals that control sporul ation in these isolates. Eight (66%) of the isolates may have contained temperate phages since virus like particles were inducible upon Mitomycin C a ddition. This high incidence of lysogeny among this collection of isolates is not su rprising given the prevalence of inducible prophages in the Bacillus genus (Hemphill and Whiteley 1975).Based on the absence of lytic activity during the cross-infection expe riments with induced lysates, the phages

PAGE 105

95 from these isolates were host specific. This is not conclusive, howev er, since it is possible for phages to lysogenize a host without pr oducing a lytic infec tion. Isolate B14912 may be a psuedotemperate phage since it was not inducible with Mitomycin C, and it displayed a high level on spontaneous pr ophage induction (Williamson, et al.2001). The three Bacillus isolates that did not produce signif icant levels of phage either do not contain a temperate phage or the prophages are not Mitomycin C inducible. The absence of prophage has been confirmed from in silico investigation of the draft genome of B14911 (GenBank accession number AAOX00000000). The range of prophage induction in these Bacillus isolates indicated that the phages in these Bacillus isolates have different relationships with their hosts. Isolates B14905, B14906, B14910, and B14950 had significant prophage induction and had high levels of sporulati on (Figure 3.3, Table 3.2). Although it is based on circumstantial evidence from our limited ex periments, these isolates may contain temperate phages that enhance host sporul ation such as temperate phages PMB12, SP10, and 3226 (Silver-Mysliwiec and Bramucci1990, Zimmer, et al.2002). Prophageencoded transcriptional factors may be the mechanism for sporulation enhancement in our Bacillus isolates. Isolate B14905 which was a lysogenic stra in that produced high levels of spores under decoyinine induction was selected for sequencing in order to investigate the influence of prophage on sporulation. Seque ncing of an induced Mitomycin C lysate resulted in a single phage genome, B05-1. Parallel sequencing of the B14905 chromosomal DNA not only confirmed the presence of B05-1, but also three additional prophage-like regions. Genomic analysis of these four potential prophages along with

PAGE 106

96 transmission electron microscopy and PCR analys is were performed in order to elucidate which of these regions we re inducible prophages. The genome sizes of the four pr ophages ranging from 17,991 bp to 25,898 bp were much smaller than typical ta iled prophages (Ackermann and DuBow 1987, Canchaya, et al.2004). Smaller phage genome sizes are usually associated with lytic phages, defective phages, or phage remnants (Lucchini, et al.1999b). However, a survey of marine bacterial isolates indicated that most prophage regions were under 30 kb (Paul 2007). Gene content, although it can be related to size, is a more important consideration for determining prophages. The genomes of B05-1, B05-3, and B05-4 contained integrases and phage repressor proteins, while B05-2 contained only phage replication, terminase, and a transposase (figure 3.5). Since B05-2 was not amplified by PCR in the induced phage DNA, we believe this region is a prophage remnant. Prophage remnants, which can contain functional genes, are common in bacterial genomes and are believed to be a result of decay processes (Casjens 2003). B05-4 was the only putative prophage in this host that had identifiable structural genes. These ORFs were similar to tail gene s from the temperate Myoviruses from Gram positive bacteria, phiC2 and EJ-1, and to those of the B. subtilis defective phage PBSX. The presence of lysogeny-like genes, along with absence of any repl icative or packaging genes on the B05-4 implies that this region may en code an defective phage. Defective phages can be inducible by Mitomycin C and ab le to form phage particles that have bacterocidal activity but are noninfectious (H emphill and Whiteley 1975). In the case of PBSX, random 13 kb portions of the host chromosomal genome is packaged but is not injected into other host cells (Anderson and Bott 1985, Wood, et al. 1990). In this respect

PAGE 107

97 B05-4 may be similar to PBSX since it di d not produce a PCR amplicon in the induced phage DNA. A notable difference between the two phages is the l ack of identifiable terminase, capsid, and packaging proteins in the B05-4. In PBSX, this group of genes, which is about 6000 basepairs in length, is located between the xr e repressor and tail genes (Kunst, et al.1997); this region is not seen in the gene map of B05-4 (figure 3.5). Given the absence of injectable phage DNA and lack capsid proteins B05-4 may be a tail-like bacteriocin. Bacteriocins are us ually proteinaeous particles that have bacteriocidal activity closely releated st rains (Daw and Falkiner 1996). Some high molecular weight bacteriocins resemble phage tails including th e F and R types of Pseudomonas aerginousa Carotovoricin Er from Erwinia carotovora and from B. axotofixans (Nakayama, et al.2000, Nguyen, et al.1999, Seldin and Penido1990). When B14905 Mitomycin C induced lysates were exam ined with TEM, many myovirus-like tail particles were observed (fi gure 3.6 D-F). Based on the evidence from our experiments, we believe B05-4 is an tail-like bacteriocin, a lthough additional experiments to identify in situ production tail proteins in an induced lysate are needed to confirm this. B05-1 and B05-3 are inducible temperate phages of isolate B14905 based on their amplification from induced phage DNA. Given the lack of identifiable structural genes in these two prophages, it was not po ssible to identify these phages with the tailed phage structures observed in TEM examination of the lysates. Besides the presence of a lysogeny module, the genomic structure of these two prophages di ffers substantially. The genome of B05-1 is smaller and does not ha ve the functional modules that are associated with tailed prophages (Lucchini, et al.1999a). An interesting feature of the B05-1 phage genome is the presence of f our transcriptional regulators. The one

PAGE 108

98 encoded by ORF 2 was not similar to phage encoded genes, but to the xre-like DNA binding domains in other Bacillus transition state regulator s. These transcriptional regulators, which include AbrB and SinR, re direct cellular metabolic activity to use available source and regulate the expression of sporulation genes dur ing the beginning of the stationary phase (Shafikhani, et al. 2002, Strauch and Hoch 1993). SinR specifically inhibits transcription of spo0A and stage II sporulation genes until sufficient levels of phosphorylated Spo0A accumulate. Possession of transition state regulators by prophages may provide an additional level of sporulation control in marine Bacillus The lack of similarity of the N-terminal of ORF 2 to any known sequences may indicate that this gene is a novel transcriptiona l regulator. Further experime nts are needed to assess the function of this potential prophage-encode d transcriptional regulator in B14905 sporulation. ORF 17 is another transcriptiona l regulator found on the genome of B05-1. This gene is located upstream from two putative choloyglycine hydrol ase genes; all three genes are similar to those found in two B.cereus genomes (Han, et al. 2006). Choloylglycine hydrolases are b acterial proteins that degrad e bile salts in the mammalian intestine (Begley, et al. 2005). Since B. cereus is an opportunistic intestinal pathogen these genes might serve as a survival mechan ism for this bacteria. The presence of the genes in an inducible prophage of a marine Bacillus isolate might be indicative of a horizontal gene transfer even t mediated by transduction. The genome of B05-1 also contained two other ORFs that had weak hits to transcriptional regula tors found in bacterial genomes. It is possible that ORF 3 is involved in lytic gene expressi on given that its loca tion and orientation is similar to cro

PAGE 109

99 repressors in other temper ate phages (Brussow and Desi ere 2001, Ptashne 2004). Given its similarity to experimentally characteri zed proteins LlaI an d VanU, ORF 20 may be involved in a phage-encoded resistance. The location of this ORF in the genome is similar methyltransferase proteins found in lytic of DNA modifi cation modules other temperate phages such as VHML and N15 (Oakey and Owens 2000, Ravin, et al. 2000). The variety of transcri ptional regulators in B05-1 may be indicative of the role of these proteins for regulating ho st and phage functions. The genome of B05-3 is the largest of the pr ophage-like regions of B14905 and is the closest in genome content to a classi c tailed phage (Casjens 2003). Genes involved in phage replication, phage particle assemb ly, and lysis are similar to those found on temperate phages. Even though the genomic and PCR evidence suggests that B05-3 is an inducible prophage, the genome of this pha ge was not recovered by sequencing of an induced phage lysate as B05-1 was. It is possible that this phage induced at low copy number relative to B05-1, so that it was at too low of a concentration to be sequenced. Further functional are needed to determine the relationship this phage has with the host strain. The combination of in silico analysis of prophage in the B14905 genome and in vivo molecular studies of the induced phage ly sate provided information about the hostphage interactions that would not be possible using either approach alone. The results from this study indicate that polylysogeny occurs in marine Bacillus strains as observed for terrestrial strains (Hem phill and Whiteley 1975, Kunst, et al.1997). The diversity of the two inducible prophage and two prophagelike elements found on this single bacterial genome supports metagenomic studies that the diversity of phages in the ocean is vast

PAGE 110

100 (Angly, et al.2006). This work also suggest s that prophage and host have co-evolved advantageous adaptations to su rvive during adverse conditions.

PAGE 111

101 References Ackermann, H. W. and M. S. DuBow. 1987. Viruses of prokaryotes. CRC Press, Boca Raton, FL. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nuclei c Acids Res. 25:3389-3402. Anderson, L. and K. Bott. 1985. DNA packaging by the Bacillus subtilis defective bacteriophage PBSX. J. Virol. 54:773-780. Angly, F. E., B. Felts, M. Breitbart, P. Sala mon, R. A. Edwards, C. Carlson, A. M. Chan, M. Haynes, S. Kelley, H. Liu, J. M. Mahaff y, J. E. Mueller, J. Nulton, R. Olson, R. Parsons, S. Rayhawk, C. A. Suttle, and F. Rohwer. 2006. The marine viromes of four oceanic regions. PLoS Biol. 4:e368. Arrieta, J. M. and G. J. Herndl. 2002. Cha nges in Bacterial b-Glucosidase Diversity during a Coastal Phytoplankton Bl oom. Limnol. Oceanogr. 47:594-599. Azam, F., D. Smith, G. Steward, and Hagstrm. 1994. Bacteria-organic matter coupling and its significance for oceani c carbon cycling. Mi crob. Ecol. 28:167-179. Azam, F., T. Fenchel, J. Field, J. Gray, L. Meyer-Reil, and F. Thingstad. 1983. The ecological role of water-column microbe s in the sea. Marine ecology progress series.Oldendorf 10:257-263. Balding, C., S. A. Bromley, R. W. Pickup, and J. R. Saunders. 2005. Diversity of phage integrases in Enterobacteriaceae: development of markers for environmental analysis of temperate phages. Environ. Microbiol. 7:1558-1567. Barksdale, L. and S. Arden. 1974. Persisti ng Bacteriophage Infections, Lysogeny, and Phage Conversions. Annu. Rev. Microbiol. 28:265-300. Bazinet, C. and J. King. 1985. The DNA transl ocating vertex of dsDNA bacteriophage. Annu. Rev. Microbiol. 39:109-129. Begley, M., C. G. Gahan, and C. Hill. 2005. The interaction between bacteria and bile. FEMS Microbiol. Rev. 29:625-651.

PAGE 112

102 Bergh, O., K. Y. Borsheim, G. Bratbak, a nd M. Heldal. 1989. High abundance of viruses found in aquatic environments. Nature 340:467-468. Bignell, C. and C. M. Thomas. 2001. The bacterial ParA-ParB partitioning proteins. J. Biotechnol. 91:1-34. Black, L. W. 1989. DNA packaging in dsDNA bacteriophages. Annu. Rev. Microbiol. 43:267-292. Botstein, D. 1980. A theory of modular evolut ion for bacteriophages. Annals of the New York Academy of Sciences 354:484-490. Bouvier, T. and P. A. del Giorgio. 2007. Key ro le of selective viralinduced mortality in determining marine bacterial community composition. Environ. Microbiol. 9:287-297. Boyd, D. A., T. Du, R. Hizon, B. Kaplen, T. Murphy, S. Tyler, S. Brown, F. Jamieson, K. Weiss, and M. R. Mulvey. 2006. VanG-type vancomycin-resistant Enterococcus faecalis strains isolated in Canada. Antimicrob. Agents Chemother. 50:2217-2221. Boylan, S. A., K. T. Chun, B. A. Eds on, and C. W. Price. 1988. Early-blocked sporulation mutations alter expression of enzymes under carbon control in Bacillus subtilis. Mol. Gen. Genet. 212:271-280. Bramucci, M. G., K. M. Keggins, and P. S. Lovett. 1977a. Bacteriophage conversion of spore-negative mutants to spore-positive in Bacillus pumilus. J. Virol. 22:194-202. Bramucci, M. G., K. M. Keggins, and P. S. Lovett. 1977b. Bacteriophage PMB12 conversion of the sporulation defect in RNA polymerase muta nts of Bacillus subtilis. J. Virol. 24:194-200. Bratbak, G., M. Hedldal, F. Things tad, B. Riemann, and O. H. Haslund. 1992. Incorporation of viruses into the budget of microbial C-tran sfer. A first approach. Mar. Ecol. Prog. Ser. 83:273-280. Breitbart, M., B. Felts, S. Kelley, J. M. Ma haffy, J. Nulton, P. Salamon, and F. Rohwer. 2004. Diversity and population structure of a near-shore marine-sediment viral community. Proceedings: Biological Sciences 271:565-574. Breitbart, M., P. Salamon, B. Andresen, J. M. Mahaffy, A. M. Segall, D. Mead, F. Azam, and F. Rohwer. 2002. Genomic analysis of uncultured marine viral communities. Proceedings of the National Academy of Sciences 99:14250-14255. Breitbart, M., J. H. Miyake, and F. Rohwer 2004. Global distribution of nearly identical phage-encoded DNA sequences. FEMS Microbiol. Lett. 236:249-256. Brown, N. L., J. V. Stoyanov, S. P. Kidd, and J. L. Hobman. 2003. The MerR family of transcriptional regulator s. FEMS Microbiol. Rev. 27: 145-163.

PAGE 113

103 Brussow, H. and F. Desiere. 2001. Compara tive phage genomics and the evolution of Siphoviridae: insights from dairy phages. Mol. Microbiol. 39:213-223. Brussow, H., C. Canchaya, and W. D. Hardt. 2004. Phages and the E volution of Bacterial Pathogens: from Genomic Rearrangements to Lysogenic Conversion. Microbiology and Molecular Biology Reviews 68:560-602. Buchen-Osmond, C. 2003. The universal virus database ICTVdB. Computing in Science & Engineering [see also IEEE Computati onal Science and Engineering] 5:16-25. Caccamo, D., T. L. Maugeri, and C. Guglia ndolo. 2001. Identification of thermophilic and marine bacilli from shallow thermal vent s by restriction analysis of their amplified 16S rDNA. J. Appl. Microbiol. 91:520-524. Calvo, C., Garca de la Paz, A., V. Bejar, E. Quesada, and A. Ramos-Cormenzana. 1988. Isolation and characterization of phage F9-11 from a lysoge nic Deleya halophila strain. Curr. Microbiol. 17:49-53. Canchaya, C., C. Proux, G. Fournous, A. Bruttin, and H. Brussow. 2003. Prophage Genomics. Microbiology and Mo lecular Biology Reviews 67:238-276. Canchaya, C., G. Fournous, and H. Brussow. 2004. The impact of prophages on bacterial chromosomes. Mol. Microbiol. 53:9-18. Casas, V., J. Miyake, H. Balsley, J. Roark, S. Te lles, S. Leeds, I. Zurita, M. Breitbart, D. Bartlett, F. Azam, and F. Rohwer. 2006. Wi despread occurrence of phage-encoded exotoxin genes in terrestrial and aquatic e nvironments in Southern California. FEMS Microbiol. Lett. 261:141-149. Casjens, S. 2003. Prophages and bacterial genomic s: what have we learned so far? Mol. Microbiol. 49:277-300. Casjens, S. R., E. B. Gilcrease, W. M. Hua ng, K. L. Bunny, M. L. Pedulla, M. E. Ford, J. M. Houtz, G. F. Hatfull, and R. W. He ndrix. 2004. The pKO2 Linear Plasmid Prophage of Klebsiella oxytoca. J. Bacteriol. 186:1818-1832. Chen, F., J. Lu, B. J. Binder, Y. Liu, and R. E. Hodson. 2001. Application of Digital Image Analysis and Flow Cytometry To En umerate Marine Viruses Stained with SYBR Gold. Appl. Environ. Microbiol. 67:539-545. Chen, Y., I. Golding, S. Sawai, L. Guo, a nd E. C. Cox. 2005. Population Fitness and the Regulation of Escherichia coli Genes by Bacterial Viruses. PLoS Biol. 3:e229. Chen, F., K. Wang, J. Stewart, and R. Be las. 2006. Induction of multiple prophages from a marine bacterium: a genomic appro ach. Appl. Environ. Microbiol. 72:4995-5001.

PAGE 114

104 Clokie, M. R. J., J. Shan, S. Bailey, Y. Ji a, H. M. Krisch, S. West, and N. H. Mann. 2006. Transcription of a ‘photosynthetic’T4-type phage during infection of a marine cyanobacterium. Envir on. Microbiol. 8:827-835. Cochran, P. K., C. A. Kellogg, and J. H. Paul. 1998. Prophage i nduction of indigenous marine lysogenic bacteria by environmental pollutants. Marine Ecology-Progress Series 164:125-133. Cohen, S., B. J. Knoll, J. W. Little, and D. W. Mount. 1981. Preferential cleavage of phage lambda repressor monomers by recA protease. Nature 294:182-184. Copley, J. 2002. All at sea. Nature 415:572-574. Culley, A. I., A. S. Lang, and C. A. Suttle. 2007. The complete genomes of three viruses assembled from shotgun libraries of marine RNA virus communities. Virol. J. 4:69. Culley, A. I., A. S. Lang, and C. A. Suttl e. 2006. Metagenomic analysis of coastal RNA virus communities. Science 312:1795-1798. Danovaro, R., A. Dell'Anno, A. Trucco, M. Se rresi, and S. Vanucci. 2001. Determination of Virus Abundance in Marine Sediment s. Appl. Environ. Microbiol. 67:1384-1387. Danovaro, R., M. Armeni, C. Corinaldesi, and M. L. Mei. 2003. Viruses and marine pollution. Mar. Pollut. Bull. 46:301-304. Daw, M. A. and F. R. Falkiner. 1996. Bacter iocins: nature, function and structure. Micron 27:467-479. Deneke, J., G. Ziegelin, R. Lurz, and E. Lanka. 2000. The protelomerase of temperate Escherichia coli phage N15 has cleaving-joining activity. Proc. Natl. Acad. Sci. U. S. A. 97:7721-7726. Deneke, J., G. Ziegelin, R. Lurz, and E. Lanka. 2002. Phage N15 telomere resolution. Target requirements for recognition and proces sing by the protelomerase. J. Biol. Chem. 277:10410-10419. Dick, G. J., Y. E. Lee, and B. M. Tebo. 2006. Manganese(II)-oxidizing Bacillus spores in Guaymas Basin hydrothermal sediments and plumes. Appl. Envir on. Microbiol. 72:31843190. Dodd, I. B., A. J. Perkins, D. Tsemitsidis, and J. B. Egan. 2001. Octamerization of lambda CI repressor is needed for effec tive repression of PRM and efficient switching from lysogeny. Genes and Development 15:3013. Du, H., N. Jiao, Y. Hu, and Y. Zeng. 2006. Diversity and distribution of pigmented heterotrophic bacteria in marine environments. FEMS Microbiol. Ecol. 57:92-105.

PAGE 115

105 Dubnau, D. and R. Losick. 2006. Bistability in bacteria. Mol. Microbiol. 61:564-572. Dworkin, J. and R. Losick. 2001. Differ ential Gene Expression Governed by Chromosomal Spatial As ymmetry. Cell 107:339-346. Earl, A. M., R. Losick, and R. Kolter. 2007. Bacillus subtilis genome diversity. J. Bacteriol. 189:1163-1170. Eggers, C. H. and D. S. Samuels. 1999. Mol ecular evidence for a ne w bacteriophage of Borrelia burgdorferi. J. Bacteriol. 181:7308-7313. Evans, C., S. D. Archer, S. Jacquet, a nd W. H. Wilson. 2003. Dir ect estimates of the contribution of viral lysis and microzoopla nkton grazing to the decl ine of a Micromonas spp. population. Aquat. Microb. Ecol. 30:207-219. Fleischmann, R., M. Adams, O. White, R. Clayto n, E. Kirkness, A. Kerlavage, C. Bult, J. Tomb, B. Dougherty, and J. Merrick. 1995. Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269:496. Forde, A. and G. F. Fitzgerald. 1999. Bacter iophage defence systems in lactic acid bacteria. Antonie Van Leeuwenhoek 76:89-113. Fouts, D. E. 2006. Phage_Finder: Automated id entification and classi fication of prophage regions in complete bacterial genome sequences. Nucleic Acids Res. 34:5839. Fuhrman, J. A. 1999. Marine viruses and their biogeochemical and ecological effects. Nature 399:541-548. Fuhrman, J. A. and R. T. Noble. 1995. Viru ses and Protists Cause Similar Bacterial Mortality in Coastal Seawater Limnol. Oceanogr. 40:1236-1242. Fujii, Y., T. Kubo, H. Ishikawa, and T. Sasaki 2004. Isolation and characterization of the bacteriophage WO from Wolbachia, an arth ropod endosymbiont. Biochem. Biophys. Res. Commun. 317:1183-1188. Fujita, M. and R. Losick. 2005. Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A. Genes Dev. 19:2236-2244. Goliger, J. A. and J. W. Roberts. 19 87. Bacteriophage 82 gene Q and Q protein. Sequence, overproduction, and activity as a transc ription antiterminator in vitro. J. Biol. Chem. 262:11721-11725. Griffin, D. W., V. H. Garrison, J. R. Herma n, and E. A. Shinn. 2001. African desert dust in the Caribbean atmosphere: Microbiology and public health. Ae robiologia 17:203-213.

PAGE 116

106 Han, C. S., G. Xie, J. F. Challacombe, M. R. Altherr, S. S. Bhotika, D. Bruce, C. S. Campbell, M. L. Campbell, J. Chen, and O. Chertkov. 2006. Pathogenomic Sequence Analysis of Bacillus cereus and Bacillus thuringiensis Isolates Closely Related to Bacillus anthracis†. J. Bacteriol. 188:3382-3390. Hemphill, H. E. and H. R. Whiteley. 1975. Bacteriophages of Bacillus subtilis. Microbiol. Mol. Biol. Rev. 39:257-315. Hendrix, R. W., M. C. M. Smith, R. N. Burns, M. E. Ford, and G. F. Hatfull. 1999. Evolutionary relationships among diverse ba cteriophages and prophages: All the world's a phage. Proceedings of the National Academy of Sciences 96:2192-2197. Hennes, K., C. Suttle, and A. Chan. 1995. Fluorescently Labeled Virus Probes Show that Natural Virus Populations Can Control the St ructure of Marine Mi crobial Communities. Appl. Environ. Microbiol. 61:3623-3627. Hertwig, S., I. Klein, R. Lurz, E. Lanka, and B. Appel. 2003a. PY54, a linear plasmid prophage of Yersinia enterocolitica with cova lently closed ends. Mol. Microbiol. 48:9891003. Hertwig, S., I. Klein, V. Schmidt, S. Beck, J. A. Hammerl, and B. Appel. 2003b. Sequence analysis of the genom e of the temperate Yersinia enterocolitica phage PY54. J. Mol. Biol. 331:605-622. Hewson, I. and J. A. Fuhrman. 2007. Covariati on of viral paramete rs with bacterial assemblage richness and diversity in the wate r column and sediments. Deep Sea Research Part I: Oceanographic Research Papers 54:811-830. Hewson, I., J. M. O'Neil, J. A. Fuhrman, and W. C. Dennison. 2001. Virus-like Particle Distribution and Abundance in Sediments and Overlying Waters along Eutrophication Gradients in Two Subtropical Estu aries. Limnol. Oceanogr. 46:1734-1746. Hewson, I., D. M. Winget, K. E. Williamson, J. A. Fuhrman, and K. E. Wommack. 2006. Viral and bacterial assemblage covariance in oligotrophic waters of the West Florida Shelf (Gulf of Mexico). Journal of the Ma rine Biological Association of the UK 86:591603. Huang, W. M., L. Joss, T. Hsieh, and S. Casjens. 2004. Protelomerase uses a topoisomerase IB/Y-recombinase type mechanis m to generate DNA hairpin ends. J. Mol. Biol. 337:77-92. Ikeda, H. and J. Tomizawa. 1968. Prophage P 1, and extrachromosomal replication unit. Cold Spring Harb. Symp. Quant. Biol. 33:791-798.

PAGE 117

107 Jensen, E. C., H. S. Schrader, B. Rieland, T. L. Thompson, K. W. Lee, K. W. Nickerson, and T. A. Kokjohn. 1998. Prevalence of Broa d-Host-Range Lytic Bacteriophages of Sphaerotilus natans, Escherichia coli, a nd Pseudomonas aeruginosa. Appl. Environ. Microbiol. 64:575-580. Jiang, S. C. and J. H. Paul. 1998. Gene Transfer by Transduction in the Marine Environment. Appl. Environ. Microbiol. Jiang, S. C. and J. H. Paul. 1994. Seasonal and diel abundance of viruses and occurrence of lysogeny/bacteriocinogeny in the marine environment. Marine ecology progress series.Oldendorf 104:163-172. Jiang, S. C., C. A. Kellogg, and J. H. Paul 1998. Characterization of Marine Temperate Phage-Host Systems Isolated from Ma mala Bay, Oahu, Hawaii. Appl. Environ. Microbiol. 64:535-542. Jiang, S. C., J. M. Thurmond, S. L. Pichard, and J. H. Paul. 1992. Concentration of microbial populations from aquatic environments by Vortex Flow Filtration. Marine ecology progress series.Oldendorf 80:101-107. Jiang, S. C. and J. H. Paul. 1996. Occurrence of lysogenic bacteria in marine microbial communities as determined by prophage induction. Marine Ecology-Progress Series 142:27-38. Juhala, R. J., M. E. Ford, R. L. Duda, A. Youlton, G. F. Hatfull, and R. W. Hendrix. 2000. Genomic sequences of bacteriophage s HK97 and HK022: pervasive genetic mosaicism in the lambdoid bacteriophages. J. Mol. Biol. 299:27-51. Kanagasabhapathy, M., H. Sasaki, K. Na kajima, K. Nagata, and S. Nagata. 2005. Inhibitory Activities of Surf ace Associated Bacteria Isolated from the Marine Sponge Pseudoceratina purpurea. Microbe s and Environments 20:178-185. Kaye, J. Z. and J. A. Baross. 2000. High incide nce of halotolerant bacteria in Pacific hydrothermal-vent and pelagic environm ents. FEMS Microbiol. Ecol. 32:249-260. Keel, C., Z. Ucurum, P. Michaux, M. Adria n, and D. Haas. 2002. Deleterious Impact of a Virulent Bacteriophage on Surv ival and Biocontrol Activity of Pseudomonas fluorescens Strain CHA 0 in Natural Soil. Mol. Plant-Microbe Interact. 15:567-576. Keijser, B. J., A. Ter Beek, H. Rauwerda, F. Schuren, R. Montijn, H. van der Spek, and S. Brul. 2007. Analysis of temporal gene expression during Bacillus subtilis spore germination and outgrowth. J. Bacteriol. 189:3624-3634. Kihara A., Akiyama Y., and Ito K. 1997. Ho st regulation of lysogenic decision in bacteriophage lambda: transmembrane modul ation of FtsH (HflB), the cII degrading protease, by HflKC (HflA). Pr oc. Natl. Acad. Sci. 94:5544-5549.

PAGE 118

108 Kinney, D. M. and M. G. Bramucci. 1981. Analysis of Bacillus subtilis sporulation with spore-converting bacteriophage PMB12. J. Bacteriol. 145:1281-1285. Kobiler, O., A. Rokney, N. Friedman, D. L. Court, J. Stavans, and A. B. Oppenheim. 2005. Quantitative kinetic analysis of the bacteriophage genetic network. Proceedings of the National Academy of Sciences 102:4470-4475. Kobiler, O., A. Rokney, and A. B. Oppenhe im. 2007. Phage lambda CIII: a protease inhibitor regulating the lysis-ly sogeny decision. PLoS ONE 2:e363. Koransky, J. R., S. D. Allen, and V. R. Dowell Jr. 1978. Use of ethanol for selective isolation of sporeforming microorganisms. Appl. E nviron. Microbiol. 35:762-765. Krupovi M. and D. H. Bamford. 2007. Putativ e prophages related to lytic tailless marine dsDNA phage PM2 are widespread in the genomes of aquatic bacteria. BMC Genomics 8:236. Kunst, F., N. Ogasawara, I. Moszer, A. Alber tini, G. Alloni, V. Azevedo, M. Bertero, P. Bessieres, A. Bolotin, and S. Borchert. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256. Laemmli, U. K. 1970. Cleavage of structural pr oteins during the assembly of the head of bacteriophage T4. Nature 227:680-685. Lang, A. S. and J. Beatty. 2000. Genetic analysis of a bacterial genetic exchange element: The gene transfer agent of Rhodobacter capsulatus. Proceedings of the National Academy of Sciences 97:859-864. Lang, A. S. and J. T. Beatty. 2007. Importance of widespread gene transfer agent genes in alpha-proteobacteria. Tre nds Microbiol. 15:54-62. Lewis, R. J., J. A. Brannigan, W. A. Of fen, I. Smith, and A. J. Wilkinson. 1998. An evolutionary link between s porulation and prophage inductio n in the structure of a repressor:anti-repre ssor complex. J. Mol. Biol. 283:907-912. Lindell, D., M. B. Sullivan, Z. I. Johnson, A. C. Tolonen, F. Rohwer, and S. W. Chisholm. 2004. Transfer of photosynthesis gene s to and from Prochlorococcus viruses. Proceedings of the National Academy of Sciences 101:11013-11018. Lindell, D., J. D. Jaffe, M. L. Coleman, M. E. Futschik, I. M. Ax mann, T. Rector, G. Kettler, M. B. Sullivan, R. Steen, and W. R. Hess. 2007. Genome-wide expression dynamics of a marine virus and host reveal features of co-evolu tion. Nature 449:83-86. Lindell, D., J. D. Jaffe, Z. I. Johnson, G. M. Church, and S. W. Chisholm. 2005. Photosynthesis genes in marine viruses yi eld proteins during hos t infection. Nature 438:86-89.

PAGE 119

109 Lindqvist, B. H., G. Deho, and R. Calendar. 1993. Mechanisms of genome propagation and helper exploitation by satellite phage P4. Microbiol. Rev. 57:683-702. Liu, B., S. Wu, Q. Song, X. Zhang, and L. Xie. 2006. Two novel bacteriophages of thermophilic bacteria isolated from deep-sea hydrothermal fields. Curr. Microbiol. 53:163-166. Lobocka, M. and M. Yarmolinsky. 1996. P1 plasmid partition: a mutational analysis of ParB. J. Mol. Biol. 259:366-382. Lohr, J., F. Chen, and R. Hill. 2005. Genomi c analysis of bacteriophage PhiJL001: insights into its inte raction with a sponge-associated alpha-proteobacterium. Appl. Environ. Microbiol. 71:1598-1609. Long, A., L. McDaniel, L., J.M. Mobberl ey, and J.H. Paul. 2007. Comparison of lysogeny (prophage induction) in heterotrophic and autotroph ic microbial populations in the Gulf of Mexico. ISME Long, A., Patterson, S., Paul, J.H. 2007. Macroarr ay Analysis of Gene Expression in a Marine Pseudotemperate Bacter iophage. Aquat Microb Ecol Lucchini, S., F. Desiere, and H. Brssow. 1999a. Similarly Organized Lysogeny Modules in Temperate Siphoviridae from Low GC Content Gram-Positive Bacteria. Virology 263:427-435. Lucchini, S., F. Desiere, and H. Brussow. 1999b. Comparative genomics of Streptococcus thermophilus phage species suppor ts a modular evolution theory. J. Virol. 73:8647-8656. Mandic-Mulec, I., L. Doukhan, and I. Smith. 1995. The Bacillus subtilis SinR protein is a repressor of the key sporulation ge ne spo0A. J. Bacteriol. 177:4619-4627. Maniloff, J. and H. W. Ackermann. 1998. Taxonom y of bacterial viruses: establishment of tailed virus genera and the orde r Caudovirales. Arch. Virol. 143:2051-2063. Mann, N., A. Cook, A. Millard, S. Bailey, and M. Clokie. 2003. Bacterial photosynthesis genes in a virus. Nature (Lond 424:741. Mannisto, R. H., H. M. Kivela, L. Paulin, D. H. Bamford, and J. K. Bamford. 1999. The complete genome sequence of PM2, the firs t lipid-containing bacterial virus To Be isolated. Virology 262:355-363. Margulies, M., M. Egholm, W. E. Altman, S. Attiya, J. S. Bader, L. A. Bemben, J. Berka, M. S. Braverman, Y. J. Chen, and Z. Che n. 2005. Genome sequencing in microfabricated high-density picolitre re actors. Nature 437:376-380.

PAGE 120

110 McDaniel, L. and J. Paul. 2004. Effect of Nu trient Addition and Environmental Factors on Prophage Induction in Natural Populations of Marine Synechococcus Species. Appl. Environ. Microbiol. 71:842-850. McDaniel, L. D., M. delaRosa, and J. H. Paul. 2006. Temperate and lytic cyanophages from the Gulf of Mexico. Journal of th e Marine Biological Association of the UK 86:517-527. McDaniel, L. and J. H. Paul. 2005. Effect of nutrient addition and environmental factors on prophage induction in natura l populations of marine Synechococcus species. Appl. Environ. Microbiol. 71:842-850. Meijer, W. J., V. Castilla-Llorente, L. Villar, H. Murray, J. Errington, and M. Salas. 2005. Molecular basis for the exploitation of spore formation as survival mechanism by virulent phage phi29. EMBO J. 24:3647-3657. Middelboe, M., L. Riemann, G. F. Stewar d, V. Hansen, and O. Nybroe. 2003. Virusinduced transfer of organi c carbon between marine bact eria in a model community. Aquat. Microb. Ecol. 33:1-10. Middelboe, M., A. Hagstrom, N. Blackburn, B. Sinn, U. Fischer, N. H. Borch, J. Pinhassi, K. Simu, and M. G. Lorenz. 2001. Ef fects of Bacteriophages on the Population Dynamics of Four Strains of Pelagic Marine Bacteria. Microb. Ecol. 42:395-406. Miller, R. V. 2001. Environmental bacteriopha ge-host interactions: factors contribution to natural transduction. Ant onie Van Leeuwenhoek 79:141-147. Minakhin, L., E. Semenova, J. Liu, A. Vasilov, E. Severinova, T. Gabisonia, R. Inman, A. Mushegian, and K. Severinov. 2005. Geno me sequence and gene expression of Bacillus anthracis bacteriophage Fah. J. Mol. Biol. 354:1-15. Mitani, T., J. E. Heinze, and E. Freese. 1977. In duction of sporulation in Bacillus subtilis by decoyinine or hadacidin. Bioc hem. Biophys. Res. Commun. 77:1118-1125. Molle, V., M. Fujita, S. T. Jensen, P. Eichenberger, J. E. Gonzalez-Pastor, J. S. Liu, and R. Losick. 2003. The Spo0A regulon of Bac illus subtilis. Mol. Microbiol. 50:1683-1701. Motegi, C. and T. Nagata. 2007. Enhancement of viral production by addition of nitrogen or nitrogen plus carbon in subtropical surface wa ters of the South Pacific. Aquat. Microb. Ecol. 48:27-34. Muhling, M., N. J. Fuller, A. Millard, P. J. Somerfield, D. Marie, W. H. Wilson, D. J. Scanlan, A. F. Post, I. Joint, and N. H. Mann. 2005. Genetic diversity of marine Synechococcus and co-occurring cyanophage co mmunities: evidence for viral control of phytoplankton. Environ. Microbiol. 7:499-508.

PAGE 121

111 Murray, A. G. and P. M. Eldridge. 1994. Marine viral ecology: Incorporation of bacteriophage into the microbial planktonic food web paradigm. J. Plankton Res. 16:627641. Murray, A. and G. Jackson. 1992. Viral dynamics : A model of the effects size, shape, motion and abundance of single-celled plankton ic organisms and othe r particles. Marine ecology progress series.Oldendorf 89:103-116. Nakayama, K., S. Kanaya, M. Ohnishi, Y. Te rawaki, and T. Hayashi. 1999. The complete nucleotide sequence of phiCTX, a cytot oxin-converting phage of Pseudomonas aeruginosa: implications for phage evolu tion and horizontal gene transfer via bacteriophages. Mol. Microbiol. 31:399-419. Nakayama, K., K. Takashima, H. Ishihara, T. Shinomiya, M. Kageyama, S. Kanaya, M. Ohnishi, T. Murata, H. Mori, and T. Haya shi. 2000. The R-type pyocin of Pseudomonas aeruginosa is related to P2 phage, and the Ftype is related to lambda phage. Mol. Microbiol. 38:213-231. Nguyen, A. H., T. Tomita, M. Hirota, T. Sa to, and Y. Kamio. 1999. A simple purification method and morphology and component analyses for carotovoricin Er, a phage-tail-like bacteriocin from the plant pathogen Erwinia carotovora Er. Biosci. Biotechnol. Biochem. 63:1360-1369. Nicholson, W. L. 2002. Roles of Bacillus endos pores in the environment. Cell Mol. Life Sci. 59:410-416. Oakey, H. J. and L. Owens. 2000. A new bact eriophage, VHML, isolated from a toxinproducing strain of Vibrio harveyi in tropi cal Australia. J. Appl Microbiol. 89:702-709. Oakey, H. J., B. R. Cullen, and L. Owens. 2002. The complete nucleotide sequence of the Vibrio harveyi bacteriophage VHM L. J. Appl. Microbiol. 93:1089-1098. Ortifosa, M., E. Garay, and M. J. Puja lte. 1995. Numerical taxonomy of aerobic, Gramnegative bacteria associated with oysters and surrounding seaw ater of the Mediterranean coast. Syst. Appl. Microbiol. 17:589-600. Osawa, R., S. Iyoda, S. I. Nakayama, A. Wada, S. Yamai, and H. Watanabe. 2000. Genotypic variations of Shig a toxin-converting phages from enterohaemorrhagic Escherichia coli O157: H7 isolat es. J. Med. Microbiol. 49:565-574. Osburne, M. S. and A. L. Sonenshein. 1976. Be havior of a temperate bacteriophage in differentiating cells of Bacillus subtilis. J. Virol. 19:26-35. Otsuju, N., M. Sekiguchi, T. Iijima, and Y. Takagi. 1959. Induction of Phage Formation in the Lysogenic Escherichia-Coli K12 by Mitomycin-C. Nature 184:1079-1080.

PAGE 122

112 Overbeek, R., T. Disz, and R. Stevens. 2004. The SEED: a peer-to-peer environment for genome annotation. Commun ACM 47:46-51. Patterson, S. D. and R. H. Aebersold. 2003. Pr oteomics: the first decade and beyond. Nat. Genet. 33:311-323. Paul, J. H. 1999. Microbial gene transfer: an ecological perspective. J. Mol. Microbiol. Biotechnol. 1:45-50. Paul, J. H. 2007. Prophages in Marine Bact eria: Dangerous Molecular Time Bombs or the Key to Survival in the Seas? In prep. Paul, J. H. and M. B. Sullivan. 2005. Marine phage genomics: what have we learned? Curr. Opin. Biotechnol. 16:299-307. Paul, J. H., M. B. Sullivan, A. M. Segall, and F. Rohwer. 2002. Marine phage genomics. Comp. Biochem. Physiol. B, Biochem. Mol. Biol. 133:463-476. Paul, J., J. Rose, S. Jiang, C. Kellogg, and L. Dickson. 1993. Distribution of viral abundance in the reef environment of Key Largo, Florida. Appl. Environ. Microbiol. 59:718-724. Paul, J. H. and B. Myers. 1982. Fluoromet ric Determination of DNA in Aquatic Microorganisms by Use of Hoechst 33258. Appl. Environ. Microbiol. 43:1393-1399. Paul, J. H., S. J. Williamson, A. Long, R. N. Authement, D. John, A. M. Segall, F. L. Rohwer, M. Androlewicz, and S. Patt erson. 2005. Complete genome sequence of phiHSIC, a pseudotemperate marine phage of Listonella pelagia. Appl. Environ. Microbiol. 71:3311-3320. Perlak, F., C. Mendelsohn, and C. T horne. 1979. Converting bacteriophage for sporulation and crystal formation in Bacillu s thuringiensis. J. Bacteriol. 140:699-706. Piggot, P. and R. Losick. 2002. Sporulation Ge nes and Intercompartmental Regulation, p. 482-517. In A. Sonenshein, J. Hoch and R. Losi ck (ed.), Bacillus subtilis and its Closest Relatives From Gene to Cells. ASM Press, Washington D.C. Pirrotta, V. and M. Ptashne. 1969. Isolation of the 434 phage repressor. Nature 222:541544. Primrose, S. and R. Twyman. 2003. Principl es of Genome Analysis and Genomics. Blackwell Publishing, Massachusetts. Ptashne, M. 2004. A Genetic Switch: Phage Lambda Revisited. Cold Spring Harbor Laboratory Press,

PAGE 123

113 Ptashne, M. 2006. Lambda's switch: lessons from a module swap. Curr. Biol. 16:R45962. Rappe, M. S. and S. J. Giovannoni. 2003. Th e uncultured microbial majority. Annu. Rev. Microbiol. 57:369-394. Ratnayake-Lecamwasam, M., P. Serror, K. W. Wong, and A. L. Sonenshein. 2001. Bacillus subtilis CodY represses early-sta tionary-phase genes by sensing GTP levels. Genes and Development 15:1093-1103. Ravin, N. and D. Lane. 1999. Partition of the Linear Plasmid N15: Interactions of N15 Partition Functions with the sop Locus of the F Plasmid. J. Bacteriol. 181:6898-6906. Ravin, N. V. 2003. Mechanisms of replicati on and telomere resolution of the linear plasmid prophage N15. FEMS Microbiol. Lett. 221:1-6. Ravin, V., N. Ravin, S. Casjens, M. E. Fo rd, G. F. Hatfull, and R. W. Hendrix. 2000. Genomic sequence and analysis of the atypi cal temperate bacteriophage N15. J. Mol. Biol. 299:53-73. Rohwer, F. and R. Edwards. 2002. The Phage Proteomic Tree: a Genome-Based Taxonomy for Phage. J. Bacteriol. 184:4529-4535. Rohwer, F., A. Segall, G. Steward, V. Segurit an, M. Breitbart, F. Wolven, and F. Azam. 2000. The Complete Genomic Sequence of the Marine Phage Roseophage SIO1 Shares Homology with Nonmarine Phag es. Limnol. Oceanogr. 45:408-418. Rohwer, F., V. Seguritan, D. H. Choi, A. M. Segall, and F. Azam. 2001. Production of shotgun libraries using random amplif ication. BioTechniques 31:108-12, 114-6, 118. Rusch, D. B., A. L. Halpern, G. Sutton, K. B. Heidelberg, S. Williamson, S. Yooseph, D. Wu, J. A. Eisen, J. M. Hoffman, K. Remington, K. Beeson, B. Tran, H. Smith, H. BadenTillson, C. Stewart, J. Thorpe, J. Freeman, C. Andrews-Pfannkoch, J. E. Venter, K. Li, S. Kravitz, J. F. Heidelberg, T. Utterback, Y. H. Rogers, L. I. Falcon, V. Souza, G. BonillaRosso, L. E. Eguiarte, D. M. Karl, S. Sa thyendranath, T. Platt, E. Bermingham, V. Gallardo, G. Tamayo-Castillo, M. R. Ferrari, R. L. Strausbe rg, K. Nealson, R. Friedman, M. Frazier, and J. C. Venter. 2007. The Sor cerer II Global Ocean Sampling expedition: northwest Atlantic through eastern tropical Pacific. PLoS Biol. 5:e77. Sakaguchi, Y., T. Hayashi, K. Kurokawa, K. Nakayama, K. Oshima, Y. Fujinaga, M. Ohnishi, E. Ohtsubo, M. Hattori, and K. Oguma. 2005. The genome sequence of Clostridium botulinum type C neurot oxin-converting phage and the molecular mechanisms of unstable lysogeny. Proc. Natl. Acad. Sci. U. S. A. 102:17472-17477. Sambrook, J. and D. W. Russell. 2001. Mol ecular Cloning: A Labor atory Manual. Cold Spring Harbor Laboratory Press, Woodbury, NY.

PAGE 124

114 Sano, E., S. Carlson, L. Wegley, and F. Rohwer. 2004. Movement of Viruses between Biomes. Appl. Environ. Microbiol. 70:5842-5846. Sass, A. M., H. Sass, M. J. L. Coole n, H. Cypionka, and J. Overmann. 2001. Microbial Communities in the Chemocline of a Hypersaline Deep-Sea Basin (Urania Basin, Mediterranean Sea). Appl. E nviron. Microbiol. 67:5392-5402. Schuch, R. and V. A. Fischetti. 2006. Detailed Genomic Analysis of the W and Phages Infecting Bacillus anthracis: Implications for Evolution of Environmental Fitness and Antibiotic Resistance†. J. Bacteriol. 188:3037-3051. Scott, K. M., S. M. Sievert, F. N. Abril, L. A. Ball, C. J. Barrett, R. A. Blake, A. J. Boller, P. S. Chain, J. A. Clark, C. R. Davis, C. Detter, K. F. Do, K. P. Dobrinski, B. I. Faza, K. A. Fitzpatrick, S. K. Freyermuth, T. L. Harm er, L. J. Hauser, M. Hugler, C. A. Kerfeld, M. G. Klotz, W. W. Kong, M. Land, A. Lapi dus, F. W. Larimer, D. L. Longo, S. Lucas, S. A. Malfatti, S. E. Massey, D. D. Martin, Z. McCuddin, F. Meyer, J. L. Moore, L. H. Ocampo Jr, J. H. Paul, I. T. Paulsen, D. K. Reep, Q. Ren, R. L. Ross, P. Y. Sato, P. Thomas, L. E. Tinkham, and G. T. Zeruth. 2006. The genome of deep-sea vent chemolithoautotroph Thiomicrospira crunogena XCL-2. PLoS Biol. 4:e383. Seaman, P. F. and M. J. Day. 2007. Isolation a nd characterization of a bacteriophage with an unusually large genome from the Great Salt Plains National Wildlife Refuge, Oklahoma, USA. FEMS Microbiol. Ecol. 60:1-13. Seldin, L. and E. G. Penido. 1990. Production of a bacteriophage, a phage tail-like bacteriocin and an antibiotic by Bacillus az otofixans. An. Acad. Bras. Cienc. 62:85-94. Setlow, P. 2006. Spores of Bacillu s subtilis: their resistance to and killing by radiation, heat and chemicals. J. Appl. Microbiol. 101:514-525. Setlow, P. 2003. Spore germination. Curr. Opin. Microbiol. 6:550-556. Shafikhani, S. H., I. Mandic-Mulec, M. A. Strauch, I. Smith, and T. Leighton. 2002. Postexponential Regulation of sin Operon Expres sion in Bacillus subtilis. J. Bacteriol. 184:564-571. Shafikhani, S. H., E. Nunez, and T. Lei ghton. 2003. ScoC mediates catabolite repression of sporulation in Bacillus s ubtilis. Curr. Microbiol. 47:327-336. Shafikhani, S. H., E. Nunez, and T. Le ighton. 2004. Hpr (ScoC) and the phosphorelay couple cell cycle and sporulation in Bacillus subtilis. FEMS Micr obiol. Lett. 231:99-110. Sharon, I., S. Tzahor, S. Williamson, M. Shmo ish, D. Man-Aharonovich, D. B. Rusch, S. Yooseph, G. Zeidner, S. S. Golden, and S. R. Mackey. Viral photosynthetic reaction center genes and transcripts in the marine environment.

PAGE 125

115 Shinagawa, H. 1996. SOS response as an adaptive response to DNA damage in prokaryotes. EXS 77:221-235. Shirai, Y., Y. Takao, H. Mizumoto, Y. Tomaru, D. Honda, and K. Nagasaki. 2006. Genomic and phylogenetic an alysis of a single-stra nded RNA virus infecting Rhizosolenia setigera (Stramenopiles: Bacillariophyceae). Jour nal of the Marine Biological Association of the UK 86:475-483. Short, C. M. and C. A. Suttle. 2004. Nearly Identical Bacteriophage Structural Gene Sequences Are Widely Distribu ted in both Marine and Freshwater Environments. Appl. Environ. Microbiol. 71:480-486. Siefert, J. L., M. Larios-Sanz, L. K. Nakamura, R. A. Slepecky, J. H. Paul, E. R. Moore, G. E. Fox, and P. Jurtshuk Jr. 2000. Phylogeny of marine Bacillus isolates from the Gulf of Mexico. Curr. Microbiol. 41:84-88. Silver-Mysliwiec, T. and M. Bramucci. 1990. Bacteriophage-enhanced sporulation: comparison of spore-converting bacteri ophages PMB12 and SP10. J. Bacteriol. 172:1948-1953. Smoot, J. C., K. D. Barbian, J. J. Van Gomp el, L. M. Smoot, M. S. Chaussee, G. L. Sylva, D. E. Sturdevant, S. M. Ricklefs, S. F. Porcella, and L. D. Parkins. 2002. Genome sequence and comparative microarray analysis of serotype M18 group A Streptococcus strains associated with acute rheumatic fe ver outbreaks. Proceedings of the National Academy of Sciences 62526099. Sonenshein, A. L. 2000. Control of sporulation initiation in Bacillus subtilis. Curr. Opin. Microbiol. 3:561-566. Sozhamannan, S., M. D. Chute, F. D. McAfee, D. E. Fouts, A. Akmal, D. R. Galloway, A. Mateczun, L. W. Baillie, and T. D. Read. 2006. The Bacillus anthracis chromosome contains four conserved, excision-proficie nt, putative prophages. BMC Microbiol. 6:34. Stevens, H., T. Brinkhoff, B. Rink, J. Vollmers, and M. Simon. 2007. Diversity and abundance of Gram positive bacteria in a tidal flat ecosystem. Environ. Microbiol. 9:1810-1822. Stewart, A. W. and M. G. Johnson. 1977. Incr eased numbers of heat-resistnat spores produced by two strains of Cl ostridium perfringens bearing temperate phage s9. J. Gen. Microbiol. 103:45-50. Stoddard, L. I., J. B. H. Martiny, and M. F. Marston. 2007. Selection and Characterization of Cyanophage Resistan ce in Marine Synechococcus Strains Appl. Environ. Microbiol. 73:5516-5522.

PAGE 126

116 Strauch, M. A. and J. A. Hoch. 1993. Transiti on-state regulators: sentinels of Bacillus subtilis post-exponential gene e xpression. Mol. Microbiol. 7:337-342. Sullivan, M. B., D. Lindell, J. A. Lee, L. R. Thompson, J. P. Bielawski, and S. W. Chisholm. 2006. Prevalence and evolution of core photosystem II genes in marine cyanobacterial viruses and th eir hosts. PLoS Biol. 4:e234. Suttle, C. A., A. M. Chan, and M. T. Cottrell. 1990. Infection of phytoplankton by viruses and reduction of primary pr oductivity. Nature 347:467-469. Thingstad, T. F. 2000. Elements of a Theory for the Mechanisms Controlling Abundance, Diversity, and Biogeochemical Role of Lytic Bacterial Viruses in Aquatic Systems. Limnol. Oceanogr. 45:1320-1328. Vasantha, N. and E. Freese. 1979. The role of manganese in growth and sporulation of Bacillus subtilis. J. Gen. Microbiol. 112:329-336. Venter, J. C., K. Remington, J. F. Heidelber g, A. L. Halpern, D. Rusch, J. A. Eisen, D. Wu, I. Paulsen, K. E. Nelson, and W. Nelson. 2004. Environmental Genome Shotgun Sequencing of the Sargasso Sea. Science 304:66-74. Vidgen, M., J. Carson, M. Higgins, and L. Owens. 2006. Changes to the phenotypic profile of Vibrio harveyi wh en infected with the Vibrio harveyi myovirus-like (VHML) bacteriophage. J. Appl. Microbiol. 100:481-487. Waldor, M. K. and J. J. Mekalanos. 1996. Ly sogenic conversion by a filamentous phage encoding cholera toxi n. Science 272:1910-1914. Walker, C. B., S. S. Stolyar, N. Pinel, H. C. Yen, Z. He, J. Zhou, J. D. Wall, and D. A. Stahl. 2006. Recovery of temperate Desulfovi brio vulgaris bacteriophage using a novel host strain. Environ. Microbiol. 8:1950-1959. Weigel, C. and H. Seitz. 2006. Bacteriophage replication modules. FEMS Microbiol. Rev. 30:321-381. Weinbauer, M. G. 2004. Ecology of prokaryot ic viruses. FEMS Microbiol. Rev. 28:127181. Weinbauer, M. G. and C. A. Suttle. 1999. Lysogeny and prophage induction in coastal and offshore bacterial communitie s. Aquat. Microb. Ecol. 18:217-225. Weinbauer, M. G., I. Brettar, and M. G. Hoefle. 2003. Lysogeny and virus-induced mortality of bacterioplankton in surface, deep, and anoxic marine waters. Limnol. Oceanogr. 48:1457-1465. Williamson, S. and J. Paul. 2004. Nutrient s timulation of lytic phage production in bacterial populations of the Gulf of Mexico. Aquat. Mi crob. Ecol. 36:9-17.

PAGE 127

117 Williamson, S., L. Houchin, L. McDaniel, and J. Paul. 2002. Seasonal Variation in Lysogeny as Depicted by Prophage Inducti on in Tampa Bay, Florida. Appl. Environ. Microbiol. 68:4307-4314. Williamson, S. J., M. R. McLaughlin, and J. H. Paul. 2001. Interaction of the PhiHSIC virus with its host: lysogeny or pseudoly sogeny? Appl. Environ. Microbiol. 67:16821688. Wommack, K. E., J. Ravel, R. T. Hill, J. Chun, and R. R. Colwell. 1999. Population Dynamics of Chesapeake Bay Virioplankton: Total-Community Analysis by Pulsed-Field Gel Electrophoresis. Appl. E nviron. Microbiol. 65:231-240. Wommack, K. E. and R. R. Colwell. 2000. Viri oplankton: viruses in aquatic ecosystems. Microbiol. Mol. Biol. Rev. 64:69-114. Wood, H., M. Dawson, K. Devine, and D. Mc Connell. 1990. Characterization of PBSX, a defective prophage of Bacillus su btilis. J. Bacteriol. 172:2667-2674. Woods, D. E., J. A. Jeddeloh, D. L. Fritz, and D. DeShazer. 2002. Burkholderia thailandensis E125 Harbors a Temperate Bacter iophage Specific for Burkholderia mallei. J. Bacteriol. 184:4003-4017. Yooseph, S., G. Sutton, D. B. Rusch, A. L. Halpern, S. J. Williamson, K. Remington, J. A. Eisen, K. B. Heidelberg, G. Manning, W. Li, L. Jaroszewski, P. Cieplak, C. S. Miller, H. Li, S. T. Mashiyama, M. P. Joachimiak, C. van Belle, J. M. Chandonia, D. A. Soergel, Y. Zhai, K. Natarajan, S. Lee, B. J. Raphael, V. Bafna, R. Friedman, S. E. Brenner, A. Godzik, D. Eisenberg, J. E. Dixon, S. S. Taylor R. L. Strausberg, M. Frazier, and J. C. Venter. 2007. The Sorcerer II Global Ocean Sa mpling expedition: expanding the universe of protein families. PLoS Biol. 5:e16. Zimmer, M., S. Scherer, and M. J. Loessn er. 2002. Genomic Analysis of Clostridium perfringens Bacteriophage {phi } 3626, Which Integrates in to guaA and Possibly Affects Sporulation. J. B acteriol. 184:4359-4368.

PAGE 128

118 Appendices

PAGE 129

119 Appendix A: Liquid and Solid Culture Media Recipe for 1.0 L of ASWJP: Stock Chemical g / 100 ml #1 KCl 5.5 g NaHCO3 1.6 g #2 KBr 0.8 g SrCl2 0.34 g #3 Na2SiO3 9H2O 0.4 g #4 NaF 0.24 g #5 NH4NO3 0.16 g #6 Na2HPO4 0.8 g #7 CaCl2 2H2O 23.8g Stock solution #44 Chemical g / volume ml / L for final stock Na2EDTA 12 g / 200 ml 50 ml / 1000 ml FeCl3 6H2O 3.84 mg / 20 ml 2 ml / 1000 ml MgCl2 6H2O 4.32 g / 20 ml 2 ml / 1000 ml CoCl2 6H2O 0.2 g / 20 ml 2 ml / 1000 ml ZnCl2 0.315 g / 20 ml 2 ml / 1000 ml CuCl2 4.8 mg / 34.4 ml 2 ml / 1000 ml H3BO3 3.42 g / 100ml 10 ml / 1000 ml

PAGE 130

120 Appendix A (Continued) Preparation of ASWJP: Add 22.05 g NaCl and 9.8 g MgSO4 7 H2O (4.79 g anhydrous) to 900 ml ultrapure deionized water and dissolve. Add the following amounts of stock solutions: Stock #1 10.0 ml Stock #2 10.0 ml Stock #3 1.0 ml Stock #4 1.0 ml Stock #5 1.0 ml Stock #6 1.0 ml Stock #7 10.0 ml Stock #44 10.0 ml Bring volume up to 1.0 L with ultrapure deio nized water. Sterilize by autoclaving. Recipe for 1.0 L of ASWJP+PY (liquid): Follow recipe for ASWJP (1.0 L). Add 5.0 g BactoPeptone and 1.0 g BactoYeast extract prior to bringing volume to 1.0 L. Bring up to volume and sterilize by autoclaving.

PAGE 131

121 Appendix A (Continued) Recipe for 1.0 L ASWJP+PY (solid): Preparation of botto m agar and slants: Follow recipe for ASWJP+PY. Add 15.0 g (1.5% final concentration) BactoAgar prior to bringing volume to 1.0 L. Dissolve agar by heating on a hot plate. Sterilize by autoclaving. Preparation of top agar: Follow recipe for ASWJP+PY. Add 10.0 g (1.0% final concentration) BactoAgar prior to bringing volume to 1.0 L. Dissolve agar by heating on a hot plate. Sterilize by autoclaving.

PAGE 132

122 Appendix B: Buffers and Solutions 0.5 M EDTA Add 186.1 disodium ethylenediaminetetraacetate • 2 H2O (Na2EDTA) to 800 mL of deionized water. Stir vigorously using a magne tic stirbar on a stirplate. Adjust pH to 8.0 using NaOH pellets, EDTA will not dissolve until pH of 8.0 is reached. Sterilize by autoclaving. Decoyinine Add 10 ml of 0.02um sterile deionized water to 1 mg of decoyinine. Vortex for 1 minute to ensure complete dissolution. Aliquot 1 ml into sterile 1.5 ml tubes and store at -20C. Ethidium Bromide Add 1 g of ethidium bromide to 100 mL of deio nized water. Stir for an hour to ensure complete dissolution. Wrap container in alum inum foil and store at room temperature. Mitomycin C Add 2 ml of 0.02um sterile de ionized water to 20 mg of Mitomycin C. Vortex for 1 minute to ensure complete dissolution. Store in dark at 4C.

PAGE 133

123 Appendix B (continued) PES To make 1 L: 250 ml 1M 1M Na2HPO4 pH 7.4 20 g SDS 2 ml of 0.5M ETDA pH 8.0 DI to 1 L PSE To make 1L: 40 ml 1M Na2HPO4 pH 7.4 10g SDS 2 ml 0.5 M EDTA pH 8.0 DI to 1 L

PAGE 134

124 Appendix B (continued) Ribohybe solution To make 200 ml: 50 ml 1M Na2HPO4 pH 7.4 20 ml 2.5 M NaCl 0.4 ml 0.5 M EDTA pH 8.0 100 ml deionized formamide 2 ml 10mg/ml salmon sperm DNA (boil for 5 mins to denature) 28 ml DI 14g SDS 2 ml 1M DTT (freshly prepared) 20X SSC Dissolve 175.3 gram sodium chloride and 88.2 g sodium citrate in 800 mL deionized water. Adjust pH to 8.0 using 5 N NaOH. Bring volume up to 1 L and sterilize by autoclaving. 50X TAE Dissolve 242 g Tris base in 600 mL of dei onized water. Add 57.1 mL of glacial acetic acid and 100 mL 0.5 M EDTA pH 8.0. Bring up to 1 L a nd sterilize by autoclaving.