USF Libraries
USF Digital Collections

Generation and characterization of an attenuated mutant in a response-regulator gene of Francisella tularensis live vacc...

MISSING IMAGE

Material Information

Title:
Generation and characterization of an attenuated mutant in a response-regulator gene of Francisella tularensis live vaccine strain (LVS)
Physical Description:
93 leaves : ill. ; 28 cm.
Language:
English
Creator:
Sammons, Wendy L
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
Francisella tularensis   ( mesh )
Tularemia   ( mesh )
Vaccines, Attenuated   ( mesh )
Bacterial Vaccines   ( mesh )
Genes, Bacterial   ( mesh )
Mutant Proteins   ( mesh )
Tularemia
Rabbit fever
Two-component signal transduction system
Intracellular survival
Virulence regulation
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Francisella tularensis is a zoonotic bacterium that must exist in diverse environments ranging from arthropod vectors to mammalian hosts. To better understand how genes are regulated in these different environments, a transcriptional response- regulator gene (genome locus FTL0552) was deleted in F. tularensis live vaccine strain (LVS). The FTL0552 deletion mutant exhibited slightly reduced rates of extracellular growth but was unable to replicate or survive in mouse macrophages and was avirulent in the mouse model using either BALB/c or C57BL/6 mice. Mice infected with the FTL0552 mutant produced reduced levels of inflammatory cytokines, exhibited reduced histopathology and cleared the bacteria quicker than mice infected with LVS. Mice that survived infection with the FTL0552 mutant were afforded partial protection when challenged with a lethal dose of the virulent Schu S4 strain (4 of 10 survivors, day 21 post infection) when compared to naïve mice (0 of 10 survivors by day 7 post infection). Microarray experiments indicate that 148 genes are regulated in the FTL0552 mutant. Most of the genes are down regulated, indicating that FTL0552 controls transcription of genes in a positive manner. The list of down regulated genes includes genes located within the Francisella Pathogenicity Island (FPI) that are essential for intracellular survival and virulence of Francisella tularensis. Furthermore, a mutant in FTL0552 or the comparable locus in Schu S4 (FTT1557c) may be an alternative candidate vaccine for tularemia.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2007.
Bibliography:
Includes bibliographical references.
Additional Physical Form:
Also available online.
Statement of Responsibility:
by Wendy L. Sammons.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002045461
oclc - 493298306
usfldc doi - E14-SFE0002268
usfldc handle - e14.2268
System ID:
SFS0026586:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader ntm 2200433Ka 4500
controlfield tag 001 002045461
005 20091223143730.0
008 091223s2007 flua sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002268
035
(OCoLC)493298306
040
FHJ
c FHJ
049
FHJA
096
WC 200
b S189g 2007
1 100
Sammons, Wendy L.
0 245
Generation and characterization of an attenuated mutant in a response-regulator gene of Francisella tularensis live vaccine strain (LVS)
h [electronic resource] /
by Wendy L. Sammons.
260
[Tampa, Fla.] :
University of South Florida,
2007.
300
93 leaves :
ill. ;
28 cm.
3 520
ABSTRACT: Francisella tularensis is a zoonotic bacterium that must exist in diverse environments ranging from arthropod vectors to mammalian hosts. To better understand how genes are regulated in these different environments, a transcriptional response- regulator gene (genome locus FTL0552) was deleted in F. tularensis live vaccine strain (LVS). The FTL0552 deletion mutant exhibited slightly reduced rates of extracellular growth but was unable to replicate or survive in mouse macrophages and was avirulent in the mouse model using either BALB/c or C57BL/6 mice. Mice infected with the FTL0552 mutant produced reduced levels of inflammatory cytokines, exhibited reduced histopathology and cleared the bacteria quicker than mice infected with LVS. Mice that survived infection with the FTL0552 mutant were afforded partial protection when challenged with a lethal dose of the virulent Schu S4 strain (4 of 10 survivors, day 21 post infection) when compared to nave mice (0 of 10 survivors by day 7 post infection). Microarray experiments indicate that 148 genes are regulated in the FTL0552 mutant. Most of the genes are down regulated, indicating that FTL0552 controls transcription of genes in a positive manner. The list of down regulated genes includes genes located within the Francisella Pathogenicity Island (FPI) that are essential for intracellular survival and virulence of Francisella tularensis. Furthermore, a mutant in FTL0552 or the comparable locus in Schu S4 (FTT1557c) may be an alternative candidate vaccine for tularemia.
502
Dissertation (Ph.D.)--University of South Florida, 2007.
504
Includes bibliographical references.
500
Includes vita.
530
Also available online.
2 650
Francisella tularensis.
Tularemia.
Vaccines, Attenuated.
Bacterial Vaccines.
Genes, Bacterial.
Mutant Proteins.
653
Tularemia.
Rabbit fever.
Two-component signal transduction system.
Intracellular survival.
Virulence regulation.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2268



PAGE 1

Generation and Characterization of an Attenuated Mutant in a Response-Regulator Gene of Francisella Tularensis Live Vaccine Strain (LVS) by Wendy L. Sammons A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Co-Major Professor: Burt Anderson, Ph.D. Co-Major Professor: Jean Manch-Citron, Ph.D. Thomas Klein, Ph.D. Richard Heller, Ph.D. Date of Approval: August 17, 2007 Keywords: tularemia, rabbit fever, two-component signal transduction system, intracellular survival, virulence regulation Copyright 2007, Wendy L. Sammons

PAGE 2

Note to Reader The original of this document contains color that is necessary for understanding the data. The original dissertation is on file with the USF library in Tampa, Florida.

PAGE 3

i Table of Contents List of Tables……………………………………………………………………………..iv List of Figures……………………………………………………………………………..v Abstract……...…………………………………………………………………………...vii Introduction………………………………………………………………………………..1 Francisella Species………………………………………………………………..1 Francisella tularensis and Human Disease……………………………………….2 F. tularensis Pathogenesis and Treatment………………………………………...3 F. tularensis Live Vaccine Strain (LVS)……………………………………….....5 F. tularensis as a Bioweapon……………………………………………………...5 F. tularensis Virulence Factors……………………………………………………6 Lipopolysaccharide (LPS)………………………………………………...6 Type IV Pili……………………………………………………………….8 Francisella Pathogenecity Island (FPI)…………………………………...8 Intracellular Survival ……………………………………………………..9 Two-Component Signal Transduction Systems (TCS)…………………………..12 Objectives………………………………………………………………………………..15 Materials and Methods…………………………………………………………………..18 Bacterial Strains………………………………………………………………….18

PAGE 4

ii Cell Lines…………………………………………………...……………………18 Construction of pPVNot/Erm……………………………………………………19 Identification of the FTL0552 Response-Regulator Gene….……………………22 Construction of the pPV-FT L0552 Knockout Pl asmid... ………………………..22 Delivery of FTL0552:: kanR into F. tularensis LVS……………………………..23 RNA Extraction…...……………………………………………………………..25 RT-PCR Analysis of FTL0552 and Downstream Genes….……………………..25 RT-PCR Analysis of F. tularensis LVS Operon Transcript.…………………….26 Intracellular Survival Assay…...…………………………………………………26 Fluorescence Microscopy…...…………………………………………………...28 Magnesium Assay………………………………………………………………..29 pH Assay…………………………………………………………………………29 Hydrogen Peroxide Killing Assay……………………………………………….29 Determination of FTL0552 Mutant Polymyxin B Minimum Inhibitory Concentration (MIC)………..………………………………………………….30 Mouse Infection………………………………………………………………….30 Quantification of F. tularensis Burden…………………………………………..31 Histopathology…………………………………………………………………..32 Cytokine Measurement…………………………………………………………..32 Gene Microarray Analysis..……………………………………………………...32 Silver Stain of SDS-PAGE Gel…………………………………………………..34 Statistical Analysis……………………………………………………………….35 Results……………………………………………………………………………………36

PAGE 5

iii Identification of the Re sponse-Regulator Gene.…………………………………36 Mutation of F. tularensis LVS FTL0552………………………………………...40 FTL0552 Mutation Appears to Have Little Effect on Downstream Genes…..….45 FTL0552 Mutant is Unable to Replicate in Mouse Macrophages….……………45 FTL0552 Mutant is Deficien t for Invasion in MH-S Alveolar Macrophages…...49 FTL0552 Mutant is not Affected by Increasing Levels of Magnesium or Acidic pH…...…………………………………………………………………51 FTL0552 Mutant is Attenuated for Virulence in Mice….……………………….57 FTL0552 Mutant Exhibits Markedly Reduced Systemic Dissemination and is Cleared Ra pidly.… .... ………………………………………………………60 Infection with FTL0552 Mutant Induces Less Severe Histological Lesions...…..62 Mice Infected with FTL0552 Mutant Produce Lower Levels of Inflammatory Cytokines……...………………………………………………………………64 FTL0552 Regulates Genes Essential for Intracellular Survival and Virulence….66 SDS-PAGE Analysis Reveals a Soluble Protein Deleted from the FTL0552 Mutant......….…………………………………………………………………72 Discussion………………………………………………………………………………..74 Literature Cited…………………………………………………………………………..85 About the Author

PAGE 6

iv List of Tables Table 1. Oligonucleotides used in this study……...…………………………………….21 Table 2. Genes regula ted by FTL 0552... ………………………………………………..67

PAGE 7

v List of Figures Figure 1. F. tularensis LPS structure…………………………………………………….7 Figure 2. F. tularensis phagocytosis and trafficking within the endocytic pathway……….………………………………………………………………….…….11 Figure 3. Two-component Signal Transduction Systems (TCS)………………………..14 Figure 4. Schematic representation of the strategy used for generation of the FTL0552 deletion mutants………….……………………………………………….…24 Figure 5. Arrangement of FTL0552 and adjacent genes on the F. tularensis LVS genome (NC007880).……….………………………………………………………….38 Figure 6 mRNA of FTL0552 and the four downstream genes forms one complete transcript…….……..……...…………………………………………………………..39 Figure 7. Confirmation of FTL0552 knock-out…………………………………………42 Figure 8. Deletion of FTL0552 gene does not effect transcription of downstream genes in the FTL0552 mutant……….…………………………………………………44 Figure 9. FTL0552 mutant exhibits a growth defect under acellular and cellular growth conditions………………….…………………………………………………..46 Figure 10. Intracellular Survival Assay…………………………………………………48 Figure 11. Macrophage invasion assay using fluorescently labeled FTL0552 mutant and GFP-LVS…………………..……………………………………………………...50

PAGE 8

vi Figure 12. Magnesium Assay…………………………………………………………...54 Figure 13. Effects of low pH…………………………………………………………….55 Figure 14. Hydrogen Peroxide Assay…………………………………………………...56 Figure 15. FTL0552 mutant is attenuated for virulence in mice and provides partial protection against lethal Schu S4 challenge……………….….…....………………….58 Figure 16. FTL0552 mutant is rapidly cleared by BALB/c and C57BL/6 mice………..61 Figure 17. Mice infected with FTL0552 mutant exhibit markedly less severe histopathological lesions………………………………………………………………63 Figure 18. FTL0552 mutant exhibit lower leve ls of pro-inflammatory cytokines……...65 Figure 19. Silver Stain of F. tularensis LVS and FTL0552 mutant bacterial proteins……………..…………………………………………………………………..73 Figure 20. Model for the activation of the PmrA–PmrB two-component system by the PhoP–PhoQ two-component system……………….…………………………...79

PAGE 9

vii Generation and Characterization of an At tenuated Mutant in a Response-Regulator Gene of Francisella Tularensis Live Vaccine Strain (LVS) Wendy L. Sammons ABSTRACT Francisella tularensis is a zoonotic bacterium that must exist in diverse environments ranging from arthropod vectors to mammalian hosts. To better understand how genes are regulated in these different environments, a transcriptional responseregulator gene (genome locus FTL0552) was deleted in F. tularensis live vaccine strain (LVS). The FTL0552 deletion mutant exhibited slightly reduced rates of extracellular growth but was unable to replicate or survive in mouse macrophages and was avirulent in the mouse model using either BALB/c or C57BL/6 mice. Mice infected with the FTL0552 mutant produced reduced levels of inflammatory cytokines, exhibited reduced histopathology and cleared the bacteria quicker than mice infected with LVS. Mice that survived infection with the FTL0552 mutant were afforded partial protection when challenged with a lethal dose of the virulent Schu S4 strain (4 of 10 survivors, day 21 post infection) when compared to nave mice (0 of 10 survivors by day 7 post infection). Microarray experiments indicate that 148 genes are regulated in the FTL0552 mutant. Most of the genes are down regulated, indicating that FTL0552 controls transcription of genes in a positive manner. The list of down regulated genes includes genes located

PAGE 10

viii within the Francisella Pathogenicity Island (FPI) that are essential for intracellular survival and virulence of Francisella tularensis Furthermore, a mutant in FTL0552 or the comparable locus in Schu S4 (FTT1557c) may be an alternative candidate vaccine for tularemia.

PAGE 11

1 Introduction Francisella Species Francisella tularensis is a small, non-motile, aerobic, gram-negative coccobacillus, the only genus belonging to the Family Francisellaceae and a member of the subclass of proteobacteria. This bacterium was first discovered by McCoy and Chapin in 1911 following an outbreak of a plague-like illness in ground squirrels in Tulare County, California. There are two species within the Francisella genus: tularensis and philomiragia (26, 44, 58). These bacteria are hardy, non-spore forming organisms, with a thin lipopolysaccharide-containing envelope that can persist in the environment for long periods of time in low temperature water, moist soil, hay, straw, and decaying animal carcasses (www.bt.cdc.gov/agent/tularemia) (58). There are five subspecies of F. tularensis found in the Northern Hemisphere but only two subsp., tularensis and holarctica cause human disease (58). The most virulent subsp., tularensis (type A), is the causative agent of the zoonotic disease, tularemia. It is predominantly found in North America and is associated with lethal pulmonary infections. Recently, studies further divided the subsp. tularensis into two genetically distinct clades, type A1, found predominantly in California, the midwest and Massachusetts, and A2, found predominantly in California and the mountain states (58). The second subsp. holarctica (type B), also known as palearctica rarely causes a fatal disease in humans and is

PAGE 12

2 predominantly found in Europe and Asia. An attenuated Live Vaccine Strain (LVS), derived from a Russian strain of subsp. holarctica has been described and shown to offer protection to humans against naturally and laboratory acquired tularemia but remains as virulent to mice as wild type subsp. holarctica (35). LVS causes disease in mice that is virtually indistinguishable from that caused in humans by the highly virulent strains (5, 21, 29). The LVS strain is not fully licensed as a vaccine but is currently under review by the U.S. Food and Drug Administration. It has been used as an investigational new drug for persons at high risk for tularemia such as scientists working with F. tularensis The third subsp., novicida has been characterized as a relatively non-virulent strain, with only two documented cases of tularemia caused by novicida in two severely immunocompromised patients in North America. The most recently identified subsp. of Francisella is mediasiatica It is primarily found in Asia but very little is know about this subsp. or its association with human disease. F. philomiragia is a muskrat pathogen (58). Francisella tularensis and Human Disease F. tularensis is capable of infecting many invertebrates and vertebrates. Recent discoveries revealed that F. tularensis is resistant to killing by the free-living amoebae, Acanthamoeba castellanii and this protozoa is the suspected source of outbreaks of gastrointestinal and respiratory tularemia in humans in Norway (1, 8, 58). Humans can be incidentally infected through direct contact with infected mammalian reservoirs or through vectors such as ticks, mosquitoes, and deer flies. The most important mammalian species responsible for human infection include muskrats, beavers, squirrels, mice, voles (meadow or field mice) and lagomorphs (hares, rabbits and pikas) (58).

PAGE 13

3 There are no cases of human-to-human transmission documented. The most common form of the disease is ulceroglandular, which occurs through direct skin contact. Consumption of contaminated food or water can lead to an oropharyngeal infection and inoculation of the eye can lead to a conjunctival infection. The most severe form of disease, pneumonic tularemia, develops from the inhalation of aerosolized bacteria, often generated when handling infected animal carcasses, leading to the common reference to the disease as “rabbit fever”. Brushcutting and lawn mowing or disturbing contaminated areas can generate aerosolization of the bacteria. Worldwide incidence of naturally occurring tularemia is unknown. In the U.S., reported cases have dropped sharply from several thousand/year prior to1950 to fewer than 200/year in the 1990s (58). F. tularensis Pathogenesis and Treatment F. tularensis can infect humans through the skin, mucous membranes, gastrointestinal tract, and lungs. It is a facultative intracellular bacterium that multiplies within macrophages. Within the macrophage, the bacteria are capable of replicating to high numbers before the onset of a protective cell-mediated immune response, a hallmark of tularemia (35). The major target organs are the lymph nodes, lungs and pleura, spleen, liver, and kidney. Untreated, bacilli inoculated into skin or mucous membranes multiply, spread to regional lymph nodes, and further multiply, and then may disseminate to organs throughout the body. Bacteremia may be common in the early phase of infection. The initial tissue reaction to infection is a focal, intensely suppurative necrosis consisting largely of accumulations of polymorphonuclear leukocytes, followed by invasion of macrophages, epithelioid cells, and lymphocytes. Suppurative lesions become

PAGE 14

4 granulomatous, and histopathological examination of the granulomas shows a central necrotic, sometimes caseating, zone surrounded by a layer of epithelioid cells, multinucleated giant cells, and fibroblasts in a radial arrangement, typical of other granulomatous conditions such as tuberculosis and sarcoidosis. Humans with inhalational exposures also develop hemorrhagic inflammation of the airways early in the course of illness, which may progress to bronchopneumonia. Histopathological examination of the lungs shows alveolar spaces filled with an exudate of mononuclear cells. Pleuritis with adhesions and effusion and hilar lymphadenopathy are common in radiological and pathological findings. Primary clinical forms vary in severity and presentation according to virulence of the infecting organism, dose, and site of inoculum. The onset of tularemia is usually abrupt, with fever (38oC–40oC), headache, chills and rigors, generalized body aches (often prominent in the lower back), coryza, and sore throat. Pulse-temperature dissociation has been noted in as many as 42% of patients. A dry or slightly productive cough and substernal pain or tightness frequently occur with or without objective signs of pneumonia, such as purulent sputum, dyspnea, tachypnea, pleuritic pain, or hemoptysis. Nausea, vomiting, and diarrhea may occur. Sweats, fever, chills, progressive weakness, malaise, anorexia, and weight loss characterize the continuing illness (www.bt.cdc.gov/agent/tularemia). Tularemia is treatable with antibiotics, with streptomycin as the drug of choice. However, the time of onset of treatment and the route of infection determines the severity and form of disease progression. Up to 60% of untreated infections can be fatal (58). Gentamicin, which is more widely available and can be used intravenously, is an acceptable alternative. Treatment with aminoglycosides should be continued for 10 days.

PAGE 15

5 Tetracyclines and chloramphenicol are also used, but relapses and primary treatment failures occur at a higher rate with these bacteriostatic agents than with aminoglycosides, and they should be given for at least 14 days to avoid relapse. Both streptomycin and gentamicin are recommended as first-line treatment of tularemia in children. In a mass casualty setting, doxycycline and ciprofloxacin, administered orally, are the preferred choices for treatment of both adults and children (www.bt.cdc.gov/agent/tularemia). F. tularensis Live Vaccine Strain (LVS) A live vaccine strain (LVS) has been used for immunization in the past, but is not licensed for general use and does not provide complete protection (71). Problems with the LVS include its failure to induce full immunity against all forms of tularemia (10), and the effects of culture conditions on its attenuation (14). Although the origin and source of the attenuation are not known, recent data suggest a possible genetic basis for the reduced virulence of the LVS strain (70). The findings were based on identification of sequence variations from comparisons between the genome of LVS to the closely related strain, F. tularensis holarctica strain FSC200. F. tularensis as a Bioweapon Francisella tularensis has been classified by the United States Centers for Disease Control and Prevention (CDC) Strategic Planning Group as a Category A agent of high priority (37). F. tularensis is a candidate for bioterrorism because of its virulence, low infective dose, and its potential for transmission by aerosols (37). In humans, an infectious dose for type A strains can be as low as 10 bacteria for respiratory (57, 75) or

PAGE 16

6 intradermal routes (76). In addition to naturally occurring outbreaks reported since the mid-twentieth century, it is suspected that Japanese germ warfare research units studied and may have deliberately used F. tularensis subsp. tularensis against Chinese civilians, Russian troops and American prisoners of war between 1932 and 1945 (42, 58). Both the United States and Russia stockpiled tons of infectious agents, including F. tularensis subsp. tularensis for potential use a bioweapons during the cold war (15, 42, 58). F. tularensis Virulence Factors Little is known about virulence mechanisms of F. tularensis (60, 78). Francisella species are facultative intracellular pathogens that can survive phagocytosis and multiply within host macrophages (27, 73, 77). The ability of Francisella species to survive and multiply in macrophages plays a crucial role in its dissemination and pathogenesis (4, 27). Immunity to F. tularensis infection is afforded primarily by a cellmediated response (33, 78), and is not induced by immunization with killed bacteria (83, 84). Lipopolysaccharide (LPS) Unlike E. coli lipopolysaccharide (LPS), F. tularensis LPS does not activate cells to release pro-inflammatory cytokines via TLR4 and is 1000-fold less potent than LPS from other enteric bacteria. Recent studies suggest that unique structural features within the F. tularensis LPS lipid A backbone and core structure, as well as the insertion element (IS-Ftu1) contained within the O-antigen gene cluster are responsible for the phase variation and low bioactivity of Francisella LPS (Fig. 1) (3, 18, 46, 58, 72, 85, 90).

PAGE 17

7 Figure 1. Structure of F. tularensis LPS. The lipid A of F. tularensis subsp. holarctica strain 1547. Note the asymmetrical lipid A structure and the absence of O-acylation on hexosamine II ( arrow ). The phosphogalactosamine substitution on the 4'-position of this hexosamine is also unique to Francisella ( McLendon, M.K., M.A. Apicella, and L.A. Allen, 2006).

PAGE 18

8 Type IV Pili Type IV pili, on the surface of bacteria, help mediate attachment to host cells, DNA uptake, twitching motility and biofilm formation. Microscopy revealed structures resembling type IV pili on the surface of F. tularensis LVS and orthologs of genes required for expression of the type IV pilus are present in the F. tularensis subsp tularensis Schu S4 genome. Deletion of the type IV pilin gene resulted in attenuated virulence of the bacteria (25). However, the role of Francisella pili has yet to be determined (11, 12, 31, 52, 58, 67). Although F. tularensis does not appear to secrete toxins, homologs of pilin and pseudopilin genes associated with type II secretion, along with 15 potential ATP-binding cassette system genes that may be involved in type I secretion are present in the genome sequence of F. tularensis Schu S4 (31, 52, 58). Francisella Pathogenicity Island (FPI) The F. tularensis subsp. tularensis Schu S4 genome is approximately 1.9 Mb, containing 1804 predicted coding sequences. More than 10% of the genes are pseudogenes or gene fragments and there are five insertion elements scattered throughout the genome, resulting in the disruption of more than half of the predicted metabolic pathways (52, 58, 86). There is a unique 33.9-kb region, encoding 25 genes with no known homologs, that is duplicated within the Schu S4 genome and is also present in LVS and F. tularensis subsp. novicida Disruption of genes within this region results in attenuation of the bacteria’s ability to survive within host macrophages. The region is termed the Francisella Pathogenicity Island (FPI) (34, 36, 51, 52, 65).

PAGE 19

9 Intracellular Survival F. tularensis infects macrophages of humans, mice, rats, rabbits and guinea pigs. Macrophages are believed to be the primary host cell for survival and replication of the bacterium. Internalization of F. tularensis occurs via phagocytosis, mediated by large asymmetric pseudopod loops projecting from the surface of the macrophage that encircle the attached bacteria (16, 58). However, the exact niche occupied by this organism and the specific virulence factors modulating the organism’s intracellular growth and survival are not clearly defined (58). Once internalized, bacteria are maintained within a phagosomal compartment, which would normally undergo a series of interactions with early endosomes, late endosomes, and lysosomes to lead to the degradation of the ingested bacteria. In contrast, LVS phagosomes transiently associate with early endosomes, accumulate the late-endosome markers lamp-1, lamp-2, and CD63, but do not mature further and do not acquire lysosomal hydrolases. At 3 to 4 hours following ingestion, the late endosome markers, lamp-1 and CD63 begin to decline, the phagosome membrane is disrupted and by 6 hours following ingestion, the bacteria begin to replicate in the cytosol (Fig. 2) (2, 4, 17, 28, 32, 58, 74). How the phagosome membrane is disrupted is yet to be defined. Recent studies identified a 23-kDa protein, encoded by the intracellular growth locus ( iglC ) whose expression is up-regulated in macrophages. The iglC gene is located within the IglABCD gene cluster that is a major component of the FPI (34, 58, 65). The expression of FPI genes required for intramacrophage survival, including iglB and iglC is controlled by the macrophage growth locus A and B (MglA and MglB) (54). MglA and MglB are transcriptional regulators controlling the

PAGE 20

10 expression of virulence genes. Introduction of a mglA mutation into F. tularensis subsp novicida identified 102 genes regulated by this factor alone (9). Mutants in mglA, mglB, iglB and iglC do not escape the phagosome, are impaired in intracellular macrophage growth and are dramatically reduced in virulence in a mouse model (7, 35, 36, 51, 54, 74).

PAGE 21

11 Figure 2. Francisella tularensis phagocytosis and trafficking within the endocytic pathway. Following bacterial engulfment, the phagosome particles first matures to an early endosome (pH ~6.5) expressing Rab5 and EEA1, and then to a late endosome expressing Rab7, Lamps, and M6PR. The non-acidified late-endosome-like phagosome of Francisella tularensis does not fuse with lysosomes and is stable for 2-4 h, followed by gradual disruption and bacterial escape into the cytoplasm, where replication occurs. (www.biohealthbase.org/GSearch/imgs/image004.gif)

PAGE 22

12 Two-Component Signal Transduction Sytems (TCS) The pathogen-host relationship is complex, and successful infection depends upon the expression of a number of bacterial genes that are adapted for infection of the host (23, 24, 43, 48). In the case of the vector-borne zoonotic bacterium F. tularensis, it must survive and grow under a wide range of conditions including arthropod vectors, such as ticks, as well as in warm-blooded vertebrate hosts. The synthesis of bacterial virulence factors in these changing environments is highly regulated and responds to environmental cues such as growth phase, temperature, osmotic stress and changing concentration of extracellular ions such as Mg2+, Ca2+ and Fe2+ (59). Two component signal transduction systems (TCS), reviewed by Stock et al. (82), are the most prevalent strategies bacteria use to couple environmental signals to adaptive responses, and play an important role in bacterial survival under environmental stress including survival within macrophages (61). They typically contain a membrane bound sensor kinase and a cytoplasmic responseregulator. The sensor kinase detects environmental signals at the surface of the cells, resulting in autophosphorylation of a histidine residue in the cytoplasmic C-terminal tail. The response-regulator is comprised of two highly conserved domains, the regulatory/receiver domain and the effector domain (Fig. 3A). The receiver domain acts as a phosphorylation-activated switch that controls an associated effector domain. The sensor kinase transfers the phosphate group to a conserved active-site aspartic acid residue within the cytoplasmic response-regulator receiver domain, shifting the equilibrium to an active state. Phosphorylation modifies the effector domain’s ability to act as a DNA-binding, transcription activator controlling multiple genes (Fig. 3B) (79, 81). Inactivation of two component signal transduction systems results in reduced

PAGE 23

13 bacterial virulence (38). For example, Salmonella phoP / phoQ genes control the expression of more than 40 genes, including proteins encoded by virulence-associated genes important for intramacrophage survival during infection (55, 62). The PhoQ sensor kinase responds to changes in external stimuli, including magnesium concentrations, to activate the PhoP response-regulator, and results in the transcription of genes essential for survival of the bacteria in the changing environment (79). PhoP also controls virulence in Yersinia pestis (68), Shigella flexneri (64), Myocobacterium tuberculosis (69), Bordetella pertussis (47), and N. meningitidis (45, 66). A TCS response-regulator, PmrA has been recently described in Francisella tularensis subsp. novicida PmrA is an orphan member of typical two-component regulatory systems. PmrA shares high similarity (44%) with the Salmonella PmrA response-regulator. F. novicida mutants lacking the pmrA gene were defective for survival and growth within macrophages and offer complete protection in mice against homologous challenge but did not protect the mice against challenge with the Schu S4 strain. DNA microarray analysis identified 65 genes regulated by PmrA, some of which are located within the FPI (63).

PAGE 24

14 Figure 3. TCS (A) F. tularensis FTL0552 response-regulator conserved signal receiver and effector domains. (B) The sensor kinase detects environmental signals at the surface of the cells, resulting in autophosphorylation. The sensor kinase transfers the phosphate group to a conserved active-site aspartic acid residue within the cytoplasmic responseregulator receiver domain, modifying the effector domain’s ability to act as a transcription activator for several genes (www.bio.vu.nl/hwconf/IntrBCA00/img052.GIF). A B

PAGE 25

15 Objectives Very little is known about the molecular mechanisms of F. tularensis pathogenesis (53). A live vaccine strain (LVS) has been used for immunization in the past, but has failed to induce full immunity against laboratory acquired tularemia and is not approved for use against the disease (10, 89). The LVS is an attenuated strain of F. tularensis subsp. holarctica (type B). The reasons for attenuation and immunological basis for the efficacy of the LVS strain are not fully understood (53, 78, 87, 89). Immunity to F. tularensis infection is a cell-mediated immunity, with a very complex pathogen-host relationship (23, 24, 48). Successful infection depends on the coordinated expression of bacterial genes in response to the host cell environment (43). F. tularensis is able to respond to and exploit host cell functions in a process that avoids phagocytosis and permits the bacteria to survive and replicate within the host cell (53). The genes that facilitate the survival and replication of Francisella within the host cell play a crucial role in pathogenesis. In Francisella tularensis they are part of a very highly regulated system that is adapted to respond to environmental cues such as growth phase, temperature, changes in metal ion concentrations, and pH (56, 59). Bacterial survival within macrophages is highly dependent on genetic systems that respond to environmental stress (91). Two component genetic systems have been shown to be important for bacteria experiencing environmental stress by mediating signal

PAGE 26

16 transduction necessary to allow survival within macrophages (38, 61). Inactivation of two component signal transduction systems results in changing the cell physiology and modulating transcriptional activation of critical virulence genes (38, 61). The S. typhimurium PhoPQ system has been the most widely studied two-component signal transduction system (38, 61, 69, 91). Bioinformatics revealed a putative phoP coding sequence in F. tularensis LVS with significant homology to a consensus PhoP amino acid sequence derived from the alignment of PhoP from other Gram-negative bacteria. Subsequent sequencing of the LVS genome sequence identified a potential two-component response-regulator (FTL0552). The generation of a mutant F. tularensis strain that may be significantly reduced in virulence but still able to produce an immune response will be useful in the development of an improved live vaccine strain licensed for use against tularemia. Hypothesis: Locus FTL0552 of Francisella tularensis LVS controls transcription of genes whose products are necessary for the full virulence of this bacterium. The following aims were developed in order to refute or support this hypothesis. AIM 1 – Construct a knockout mutant in the F. tularensis LVS FTL0552. Determine if the mutant has altered phenotypic properties similar to those predicted for the phoP gene from other Gram-negative bacteria. A. Construct a mutagenic plasmid that will be introduced into the recipient strain by conjugation with selection for the inactivated phoP gene and allelic replacement of the wild-type gene with the mutant allele. B. Determine the growth properties for the mutant.

PAGE 27

17 C. Analyze the response to varying levels of Mg2+ as compared to the wild type. D. Analyze in vitro susceptibility to antimicrobial peptides and pH changes as compared to wild type. AIM 2 – Examine the FTL0552 mutant to analyze the role F. tularensis LVS FTL0552 plays in pathogenicity and immunogenicity. A. Perform in vitro survival and replication studies in macrophages. B. Perform in vivo studies to determine the ability of the mutant to cause disease in a mouse model. a. Perform time to death study of mice infected with the mutant. b. Perform bacterial clearance studies. c. Perform histopathological evaluation. C. Determine if the mutant is able to confer protection of infected mice. a. Challenge the infected mice with LVS and the fully virulent strain. b. Determine the cytokine profile of infected mice. AIM 3 – Identify F. tularensis LVS genes whose expression is controlled by FTL0552. A. Perform gene microarray studies for mutant and LVS wild type. B. Compare cell lysate and supernatant proteins in LVS wild type and mutant.

PAGE 28

18 Materials and Methods Bacterial Strains. F. tularensis LVS, kindly provided by Scott Bearden, CDC, Fort Collins, CO, was grown on agar consisting of GC agar base (Remel, Lenexa, KS) supplemented with 5% fetal bovine serum, 1% bovine hemoglobin and 1% IsoVitaleXTM (Becton Dickinson, Sparks, MD), incubated at 37C. The F. tularensis LVS FTL0552 mutant was grown on the same agar with the addition of 50g/ml kanamycin. For some experiments, bacteria were grown in Mueller Hinton II (MH) broth (Becton Dickinson, Sparks, MD) supplemented with 0.1% glucose, 2% IsoVitaleXTM and 33 M ferric pyrophosphate (56). For bacterial growth analysis, MH broth cultures were incubated at 37C with aeration and the OD550 was measured at various time points. Cell Lines. The immortalized mouse macrophage cell line (J774A.1) was cultured in Dulbecco’s Modification of Eagle’s Medium (DMEM), supplemented with 10% fetal bovine serum (FBS), 4.5g/mL glucose and L-glutamine, and 50g/ml penicillinstreptomycin. Mouse peritoneal exudate cells (PEC) were collected from thioglycolate treated BALB/c mice, washed and resuspended in medium containing, 10% FBS, 0.33 l/ml 2-mercaptoethanol, and L-glutamine.

PAGE 29

19 Construction of pPVNot/Erm. A plasmid derivative of pPV was constructed that has an added Not I restriction site and has the erythromycin resistance gene (ErmR) substituted for chloramphenicol resistance (CmR). To accomplish this task pPV shuttle vector (CmRApR) was kindly supplied by Drs. I. Golovliov and Anders Sjstedt (35). This plasmid was used to transform an E. coli DH5 recipient to chloramphenicol resistance. pPV DNA was prepared from an E. coli DH5 transformant, and subsequently altered to introduce a Not I cloning site. The pPV vector has unique Sal I and Xba I cloning sites. An adaptor was designed that could be ligated to Sal I and Xba I cleaved pPV DNA to generate a Not I site. Oligonucleotides P327 and P328 were annealed to produce adaptors (Table 1), and were ligated into pPV that had been cleaved with both Sal I and Xba I and transformed into E. coli DH5 with selection for chloramphenicol resistance. The presence of the Not I site was confirmed by restriction analysis and the resulting plasmid designated pPVNot. This resulted in a mobilizable plasmid with unique Not I, Sal I and Xba I sites. A derivative of pPVNot was constructed that had the CmR marker replaced with ErmR. pPVNot was partially digested with Hind III, re-ligated and transformed into E. coli DH5 with selection for ampicillin resistance. Colonies were screened for the loss of chloramphenicol resistance and the loss of (only) the 3.2 kb Hind III fragment which carries Cm resistance. This plasmid (ApR, CmS) was linearized by partial digestion with Hind III, and ligated to the ermC gene from pKS65. pKS65, the source of ermC was generously provided by Dr. Joseph Dillard (41), (University of Wisconsin Medical School Madison, WI). Transformants were scored for both ampicillin and erythromycin resistance on LB agar plates containing 200 g/ml erythromycin and 100 g/ml

PAGE 30

20 ampicillin. The resulting plasmid was designated pPVNot/Erm and this plasmid was used for gene transfer into F. tularensis LVS.

PAGE 31

21 Table 1. Oligonucleotides used in this study. Oligonucleotide Purpose/comments Sequence 5’ to 3’ P327 Forms adaptor with P328 to introduce Not I site into pPV1 TCGACATGCGGCCGCATT P328 Forms adaptor with P327 to introduce Not I site into pPV1 CTAGAATGCGGCCGCATG Left-F Amplify 5’ flanking region upstream of FTL0552, contains Not I site GCGCGGCCGCGACTCATTCAGTATCTGGGA Left-R Amplify 5’ flanking region upstream of FTL0552, 5’ overhang of primer contains kanR sequences CGGCAAGAAAGCCATCCAGTCATCTTCAGCCAACAATATTC TCAT Right-F Amplify 3’ flanking region downstream of FTL0552, 5’ overhang of primer contains kanR sequences GCGGGACTCTGGGGTTCGAAAGGTGTTGGTTAC TTTGTACA AAAGG Right-R Amplify 3’ flanking region downstream of FTL0552, contains Not I site GCGCGGCCGCTGGGACTCTAAGGTTTTCAA Kan-F Amplify the kanR gene from PBBR1MCS2 ACTGGATGGCTTTCTTGCCG Kan-R Amplify the kanR gene from PBBR1MCS2 TTTCGAACCCCAGAGTCCCGC FTL0552-F Amplify region within FTL0552 gene to confirm gene knockout and for RT-PCR TTCAGATGGTGAGGCAGCGCAAA FTL0552-R Amplify region within FTL0552 gene to confirm gene knockout and for RT-PCR CTTTGGTTACCGTTTCAGAGCTTGG FTL0552+1100-F Amplify region outside area of recombination to confirm integration of FTL0552:: kanR in the chromosome CGGTGCAAAGACAGGAAAAC FTL0552+1100-R Amplify region outside area of recombination to confirm integration of FTL0552:: kanR in the chromosome GTGACCGCCCTGTTCACTA lepB-F Amplify gene downstream of FTL0552 for RT-PCR GCTGATCAGGCGAGATC TTT lepB-R Amplify gene downstream of FTL0552 for RT-PCR AATTACATCGCCAGGCAAAC rnr-F Amplify gene downstream of FTL0552 for RT-PCR ACCAAGCTAGGCAAGAACGA rnr-R Amplify gene downstream of FTL0552 for RT-PCR TGCTAAAGCTTTGGGAGTCA mutS-F House keeping gene for RTPCR GTGGCGTCATCAAAGAAGGT mutS-R House keeping gene for RTPCR CGGGCTAGCGCCTTTTCTTT Operon 1-F Overlapping FTL0552 and lepB AGACTATTAGAGGTGTTGGTTACTTTG Operon 1-R Overlapping FTL0552 and lepB CTCATGTTTAACTCCATCAAGGTTT Operon 2-F Overlapping lepB and rnc AATGTTGACAATAAATGGTAAAAAACT Operon 2-R Overlapping lepB and rnc TCGATATTATTGGCTGATACCATTT Operon 3-F Overlapping rnc and truB TTGGCTGAAGGAAAACTATCG Operon 3-R Overlapping rnc and truB AGAGGTTGTCCATTATATTTAAGAGCT Operon 4-F Overlapping truB and rnr AAGCATTAACATTCCTGAGTTATCTG Operon 4-R Overlapping truB and rnr TGCACCCAAACGA TTTACAA

PAGE 32

22 Identification of the FTL0552 response-regulator gene. Bacterial PhoP protein sequences were retrieved from (NCBI) GenBank and aligned using the PileUp Program for aligning multiple sequences from the Genetics Computer Group (GCG) Wisconsin Package Version 10) (19, 22). The consensus sequence, generated from the alignment of bacterial PhoP proteins, was used to search the TIGR Comprehensive Microbial Resource (CMR) with the PhoP consensus sequence. This search brought up PhoP proteins and confirmed the specificity of the consensus sequence. A gapped BLAST search (3) of the Schu S4 and LVS genomes with the consensus sequence identified candidate phoP genes. A phoP homologue was identified with 26% identical deduced amino acid sequences and shown to have motifs consistent with response-regulator proteins, containing both a response-regulator receiver domain and a transcriptional regulatory protein domain. This amino acid sequence is highly conserved in the Schu S4 (FTT1557c) genomic sequence. Construction of the pPV-FTL0552 knockout plasmid. A modified version of a previously described method using PCR products to generate a knockout plasmid was used (53, 80). The flanking sequence consisting of approximately 700 bp upstream and 700 bp downstream of FTL0552 were amplified from F. tularensis LVS genomic DNA in two separate PCR reactions, using EasyStart 100 pre-aliquoted PCR reagents (Molecular BioProducts, San Diego, CA). The primer sequences for the 5’ flanking regions were Left-F and Left-R and the primer sequences for the 3’ flanking sequences were Right-F and Right-R (Table 1) A third PCR product consisting of the kanamycin resistance gene was amplified from pBBR1MCS2 (49),

PAGE 33

23 using primers Kan-F and Kan-R. All three products were gel-purified using Geneclean Turbo (MP Biomedicals, LLC., Solon, OH) and were used as templates in a PCR reaction to generate a single product with upstream and downstream flanking regions of FTL0552 and most of the coding region (including nucleotides 26-645) replaced with kanR (Fig. 4). This PCR product was generated using primers Left-F and Right-R and is flanked by Not I restriction sites. The entire PCR product was 2349 base pairs in length. The resulting PCR product was cleaved with Not I and ligated into the Not I site of pPVNot/Erm and transformed into E. coli JM109. Plasmid DNA was prepared with the GenElute HP Plasmid Midiprep Kit (Sigma, St. Louis, MO). The plasmid construct was confirmed by digestion with Not I and then transformed into E. coli S17-1. Delivery of FTL0552:: kanR into F. tularensis LVS. A previously described strategy for allelic replacement was used (35). The resulting plasmid with the FTL0552 coding sequence interrupted by the kanR gene was introduced into E. coli S17-1 for mobilization and transfer to LVS (Fig. 4). Conjugation and selection were performed on supplemented GC agar plates containing 100g/mL polymyxin B and 25g/mL kanamycin. Isolated colonies were spotted on plates containing 5% sucrose, kanamycin (25 g/ml), and polymyxin B (100 g/ml) for counterselection with s acB Colonies that were both kanamycin and sucrose resistant were verified by PCR and used for further analysis.

PAGE 34

24 Figure 4. Schematic representation of the strategy used for generation of the FTL0552 deletion mutants. The 5’ and 3’ flanking regions of FTL0552 gene were amplified from the F. tularensis LVS genomic DNA. The primers used for the amplification of the regions flanking the FTL0552 gene regions and kanamycin resistance gene ( kanR) were designed with short overlapping sequences to the kanR gene derived from pBBR1MCS2 (28). The resulting three amplicons were gel-purified and used as template to amplify a PCR product with the kanR gene replacing FTL0552 (PCR product #4). This product was digested with Not I and ligated into the suicide plasmid pPVNotErm (see text). The resulting plasmid was introduced into F. tularensis LVS by transconjugation from E. coli

PAGE 35

25 RNA Extraction. RNA was isolated from Mueller Hinton broth cultures of F. tularensis LVS parental strain and FTL0552 mutant grown overnight to log phase (OD550 of 0.600). RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA). The aqueous phase was used in the RNeasy clean-up protocol (Qiagen, Valencia, CA) with a 15 minute DNase digestion step (Qiagen, Valencia, CA) (9). The concentration of the RNA was assessed at OD260 and OD280, and the integrity of the 23S and 16S rRNA was verified on a 0.7% agarose gel. RT-PCR analysis of FTL0552 and downstream genes. Primers were designed for the second and fifth gene immediately downstream of FTL0552 (Table 1). RT-PCR was performed using the One-Step RT-PCR kit (Qiagen, Valencia, CA). Primers FTL0552-F and FTL0552-R (specific for FTL0552), primers lepB-F and lepB-R (specific for lep B), primers rnr-F and rnr-R (specific for rnr ) and primers mutS-F and mutS-R (specific for the reference house keeping gene, mut S) were used to reverse transcribe and amplify the cDNA synthesized from RNA isolated from both the F. tularensis LVS parental strain and the FTL0552 mutant. The products’ sizes are 352 bp for FTL0552, 288 bp for lepB 314 bp for rnr and 304 bp for mutS The conditions for reverse transcription and amplification were 50C for 30 minutes and 95C for 15 minutes, followed by 30 cycles of 94C for one minute, 55C for 1 minute and 68C for 1 minute, then a final elongation step of 72C for 10 minutes. For each primer set, reactions lacking reverse transcriptase were performed to detect DNA contamination. PCR products were run on a 1.0% agarose gel.

PAGE 36

26 RT-PCR analysis of F. tularensis LVS operon transcript. Overlapping primers were developed to determine if FTL0552 and the four genes immediately downstream are transcribed as one contiguous transcript. The four sets of primers, operon 1, operon 2, operon 3, and operon 4, were designed to produce overlapping PCR products ranging from 700-900 base pairs in size (Table 1). RNA was extracted as previously described. An additional DNase treatment was performed prior to reverse transcription by adding DNase to each RNA sample and heating for 10 minutes at 37C. The conditions for reverse transcription and amplification were 50C for 30 minutes and 95C for 15 minutes, followed by 35 cycles of 94C for one minute, 55C for 1 minute and 68C for 1 minute, then a final elongation step of 72C for 10 minutes. For each primer set, reactions containing no RNA and no reverse transcriptase were performed to detect DNA contamination. PCR products were run on a 0.7% agarose gel. Intracellular Survival Assay. The method for assessing intracellular growth of F. tularensis LVS in macrophages was performed with minor modifications of the method previously described by Golovliov et al. (34). J774A.1 mouse macrophage cells suspended in DMEM media (Dulbecco’s Modification of Eagle’s Medium (DMEM), 10% FBS, 4.5g/mL glucose and L-glutamine) were seeded into a 24 well tissue culture plate at a density of 6x104 cells/well and incubated overnight at 37C with 5% CO2. F. tularensis LVS parental and FTL0552 mutant strain were suspended in DMEM, added to each well at an MOI of 100, and allowed to infect for 2 hr at 37C in 5% CO2. Following infection, the cells were washed twice with PBS to remove extracellular bacteria. Gentamicin

PAGE 37

27 (50g/ml) was added to the wells and the incubation was allowed to continue for 1 hr. Thereafter, the cells were washed once with PBS and media containing gentamicin (2g/ml) was added to the wells. At various time points (0, 24, 48 and 72 hrs) the cells were washed with PBS and lysed with 0.1% sodium deoxycholate. Viable counts were performed by plating serial 10-fold dilutions of the lysates on supplemented GC agar plates and incubating at 37C (34). All experiments were performed in triplicate. The data are representative of three independent experiments. Infection of peritoneal exudate cells (PECs) was performed with modifications of the method described by Twine et al. (89). Peritoneal cells (PC) were collected from thioglycolate treated BALB/c mice, washed and resuspended in medium containing, 10% FBS, 50M 2-mercaptoethanol, and L-glutamine. PC cell suspensions were seeded into a 96 well tissue culture plate at a density of 1x105 cells/well and incubated overnight at 37C in 5% CO2. F. tularensis LVS and FTL0552 mutant bacteria were added to each well at an MOI of 50 and allowed to infect for 1.5 hrs. The cells were then washed twice with HBSS to remove extracellular bacteria. Medium containing gentamicin (50g/ml) was added to the wells and incubated for 1 hr. Thereafter, the cells were washed once with HBSS and cultured in medium containing gentamicin (2g/ml). At various time points, (0, 12, 24 and 48 hrs) the cells were washed with HBSS and lysed with 0.1% saponin. Viable counts were performed by plating serial 10-fold dilutions of the lysates on supplemented GC agar plates and incubating at 37 C (32). All experiments were performed in triplicate.

PAGE 38

28 Fluorescence Microscopy. FTL0552 mutant was stained with PKH67 green fluorescent cell linker mini kit (Sigma St. Louis, MO) as per the manufacturer’s instructions. LVS transformed with a GFP containing plasmid was used a control. 1x104 MH-S (murine alveolar macrophage cell line) cells in RPMI-1640 supplemented with 10% FBS (Invitrogen Inc, Carlsbad, CA) were seeded on a sterile Lab-Tek chamber slide (Nalge Nunc International, Rochester NY) and incubated for 12 hr at 370C. The cells were infected with the labeled FTL0552 or the GFP-LVS at an MOI of 100 and incubated at 370C for 15, 30 and 45 minutes. Uninfected cells served as controls. After each indicated time, the cells were washed twice with sterile PBS and fixed with 3% paraformaldehyde. The MH-S cells were counterstained with PKH26 red fluorescence cell linker mini kit (Sigma St. Louis, MO) as per the manufacturer’s instructions. The cells were washed, mounted with the coverslips and observed under a fluorescent microscope. For confocal microscopy 0.5 M Z sectioning was performed on a confocal microscope (Carl Zeiss Laser Scanning System, Biocompare Inc., San Francisco, CA). The slides were observed under a CApochromat objective at 40x magnification with 1.2 W corrections and visualized in channel-1 at 500-550 IR and channel-2 at 565-615 IR. The images were analyzed using LSM5 image browser software version 3,2,0,115 (Carl Ziess, Biocompare Inc., San Francisco, CA).

PAGE 39

29 Magnesium Assay. LVS parent strain and FTL0552 mutant cultures were grown at 37C in 5mL MH broth containing increasing concentrations of magnesium (0-500 M). After 18-24 hours, the OD550 was measured to assess growth. pH Assay. LVS parent strain and FTL0552 mutant cultures were grown at 37C in 5mL of MH broth at varying pH levels (6.5-4.0). After 18-24 hours, the OD550 was measured to assess growth. Hydrogen Peroxide Killing Assay. LVS wild type and FTL0552 mutant bacteria was cultured at 37C in MH broth to log phase (OD550 of 0.6) and diluted 1:100 in MH broth before mixing 50 l of each bacterial culture with 50 l of 30mM hydrogen peroxide in MH broth or with 50 l of MH broth alone (untreated control). The mixture was incubated at 37C in a 96 well culture plate and samples were collected at times points 0, 5, 10, 20, and 30 minutes. Serial dilutions of the samples at each time point were plated on GC agar plates to determine viable colony forming units.

PAGE 40

30 Determination of FTL0552 mutant Polymyxin B Minimum Inhibitory Concentration (MIC). LVS wild type and FTL0552 mutant bacterial cultures were incubated at 37C with agitation overnight in 5mL of MH broth supplemented with various concentrations (15.6 g/mL 1000 g/mL) of polymyxin B. OD550 measurements were taken at 18-24 hours to determine the MIC. Mouse infection. Six to eight week-old BALB/c and C57BL/6 mice (Taconic, Germantown, NY) of either sex were housed in a specific pathogen free environment in the Animal Resource Facility at Albany Medical College and used for screening of the FTL0552 mutant. A frozen aliquot of F. tularensis LVS or F. tularensis LVS FTL0552 mutant was thawed and diluted in sterile PBS. Prior to intranasal (i.n.) inoculation, the mice were deeply anesthetized via intraperitoneal injection of a cocktail of Ketamine (20mg/ml) and Xylazine (1 mg/ml). The mice (n=10 for each group) were infected i.n. with 1x104 or 1x105 CFU of LVS or FTL0552 mutant in a volume of 20 l PBS (10 l per nare). The mice were monitored closely for morbidity and mortality for a period of 21-30 days postinfection and the median survival time (MST) was calculated for each group of mice. Mice that survived the initial infection dose of 1x105 CFU of FTL0552 mutant were challenged with 1x102 CFU of the virulent F. tularensis Schu S4 strain. All mice that survived 1x104 CFU of FTL0552 mutant were boosted with 1x105 CFU of FTL0552 mutant and challenged 30 days later with 1x102 CFU of Schu S4. Actual numbers of bacteria were determined by plating the inoculum after primary infection and challenge.

PAGE 41

31 All the Schu S4 challenge experiments were carried out in the ABSL-3 facility of the Albany Medical College following standard operating procedures. All experiments conformed to the animal procedures approved by Institutional Animal Care and Use Committee guidelines A time course experiment was conducted to determine the kinetics of bacterial clearance. BALB/c and C57BL/6 mice were infected i.n. with 5x103 CFU of either LVS or FTL0552 mutant. A group of four mice each was sacrificed at days 1, 3, 5 and 7 postinfection. Lung, liver and spleen were collected aseptically for quantitation of bacterial burden and histology at the indicated times. Quantification of F. tularensis burden. Bacterial burdens were quantified in the lungs, livers and spleens of C57BL/6 and BALB/c mice. The lungs from the infected mice were inflated with sterile PBS and collected aseptically in PBS containing a protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN). Livers and spleens were also collected in a similar fashion. The organs were subjected to mechanical homogenization using a Mini-BeadBeater-8™ (BioSpec Products Inc., Bartlesville, OK). The tissue homogenates were spun briefly at 1000 x g for 10 sec in a microcentrifuge to pellet the tissue debris. Supernatants were diluted 10-fold in sterile PBS and 10 l of each dilution were spotted onto chocolate agar plates in duplicate and incubated at 37C for 2-3 days. The number of colonies on the plates were counted and expressed as CFU/gram of tissue. The remaining tissue homogenates were spun at 14000 g for 20 min and the clarified supernatants were stored at -20C and used for measurement of tissue cytokine levels.

PAGE 42

32 Histopathology. The lungs, livers, and spleens from infected mice were excised at days 1, 3, 5 and 7 post-infection and fixed with 10% neutral buffered formalin. Lungs were inflated via instillation of PBS into the trachea prior to fixation. Tissues were processed using standard histological procedures and 5 m paraffin sections were stained with hematoxylin-eosin and examined by light microscopy. Cytokine measurement. Mouse Inflammation Cytometric Bead Array (CBA) Kits (BD Bioscience, San Diego, CA) were used for the simultaneous measurement of multiple cytokines in lung homogenates of BALB/c and C57BL/6 mice infected either with LVS or FTL0552 mutant. Data were acquired on a FACSArray (BD Immunocytometry Systems) and analyzed using CBA software version 1.1. Gene Microarray analysis. RNA was extracted from broth cultures grown to log phase using the Enzymatic Lysis and Proteinase K Digestion of Bacteria protocol from the RNAprotect Bacteria Reagent Handbook (Qiagen, Valencia, CA), followed by purification using the RNeasy Mini Kit Purification of Total RNA from Bacterial Lysate protocol (Qiagen, Valencia, CA). cDNA was synthesized from 1 g of total RNA in a standard reverse transcription (RT) reaction using 5 g of random hexamers (Amersham Biosciences, Piscataway, NJ) and Superscript III (Invitrogen). Amino allyl dUTPs were incorporated at this step (2.5 mM dATP, 2.5 mM dCTP, 2.5 mM dGTP, 1 mM amino allyl dUTP, and 1.5 mM dTTP)

PAGE 43

33 (Invitrogen). cDNA was purified using Zymo DNA purification columns as specified by the manufacturer (Zymo Research Corp., Orange, CA), and samples were labeled with Cy5 (red) fluorophores and the reference was labeled with Cy3 (green) fluorophores (Amersham Biosciences). Unincorporated fluorophores were quenched using 5 l of 4M hydroxylamine and incubated in the dark for 15 min. The samples were then combined, and unincorporated dyes were removed using Zymo DNA purification columns. For hybridization, cDNA was eluted in 19 l of Tris-EDTA buffer, and 2 l of 20mg/ml yeast tRNA (Invitrogen), 4.25 l of 20 SSC, and 0.75 l of 10% sodium dodecyl sulfate were added to the probe. Probes were denatured for 2 min at 99C, spun at 17,900 g and cooled at room temperature before they were added to the arrays. The samples and arrays were incubated at 60C for ~14 h, and stringency washes were performed. Briefly, the arrays were washed for 2 min each in a series of four washes with increasing stringency: (i) 2 SSC-0.03% sodium dodecyl sulfate, (ii) 2 SSC, (iii) 1 SSC, and (iv) 0.2 SSC. The microarrays were scanned and analyzed using a Gene Pix 4000A scanner and GENEPIX5.1 software (both from Axon Instruments, Redwood City, CA). Normalized data were collected using the Stanford Microarray Database. Spots were excluded from analysis due to obvious abnormalities, a regression correlation of <0.6, or a Cy3 net mean intensity of <100. Only spots with at least 70% good data across the experiment were included for analysis. The ratios of the red channels to green channels for each spot were expressed as log2 (red/green) and used for hierarchical clustering using the CLUSTER program. Results were visualized using the TREEVIEW program. Using data from all of the microarrays, significant differences between the wild-type and mutant were determined using the Significance Analysis for Microarrays (SAM) program, v. 1.21.

PAGE 44

34 Using the two-class statistical analysis tool in the SAM program, a list of genes whose transcript levels were significantly increased or decreased between the two groups was calculated. A calculated false discovery rate of <1% was used to assign significance, and a two-fold cutoff in the change in expression level was imposed. Silver Stain of SDS-PAGE gel. F. tularensis LVS parent strain and FTL0552 were grown in MH broth cultures to log phase and spun down at 2500 rpm for 10 minutes to pellet the bacterial cells. The supernatant was removed, filter-sterilized, and concentrated in a Centricon-Plus-20 Centrifugal Filter Unit (Millipore Corporation, Billerica, MA). Cell lysate and concentrated supernatant samples were prepared using the NuPAGE Novex Bis-Tris Gel protocol (Invitrogen, Carlsbad, CA). Briefly, NuPAGE LDS Sample Buffer (4x), NuPAGE Reducing Agent (10x) and deionized water was added to each sample and heated for 10 minutes at 70C. 1x SDS Running Buffer was prepared using 20x NuPAGE MES and deionized water. 10g or 20g of each sample was loaded on a 412% NuPAGE Novex Bis-Tris Mini Gel (Invitrogen, Carlsbad, CA) and electrophoresis was performed according to manufacturer’s instructions. The gel was fixed, washed, and stained according to manufacturer’s instructions using the Silver Stain Plus Kit (Bio-Rad Laboratories, Inc., Hercules, CA).

PAGE 45

35 Statistical analyses. The survival results are expressed as Kaplan-Meier curves and P values were determined using a Log-Rank test. All other results were expressed as mean SEM and comparisons between the groups were made using one-way ANOVA followed by Bonferroni’s correction, nonparametric Mann-Whitney test, or Student’s t-test. Differences between the experimental groups were considered significant at P < 0.05 level.

PAGE 46

36 Results Identification of the response-regulator gene. Dr. Jean Citron first identified a putative response-regulator in the F. tularensis subsp. tularensis Schu S4 genome by homology with a consensus PhoP amino acid sequence derived from alignment of the deduced peptide sequence from other Gramnegative bacteria. The FTT1557c locus from the Schu S4 genome sequence was identified and shown to have motifs consistent with response-regulator proteins, containing both a response-regulator receiver domain and a transcriptional regulatory protein domain. Prior to publication of the F. tularensis LVS genome, Dr. Citron obtained the incomplete LVS genome sequence from Dr. Emilio Garcia from Lawrence Livermore National Laboratories. Dr. Citron compiled a file aligning the overlapping LVS sequence contigs to begin searching against the database for possible homologs to FTT1557c and other possible virulence regulator genes. It was with this alignment that she first identified potential genes in F. tularensis LVS sharing homology with the derived consensus PhoP sequence, as well as other genes associated with virulence regulation in gram negative bacteria, such as, rpoH (RNA polymerase sigma factor), and qseA (quorum sensing Escherichia coli regulator A). Upon publication of the LVS genome sequence, she was able to confirm the presence of the coding sequence for a putative response-regulator protein (FTL0552 in LVS and FTT1557c in Schu S4)

PAGE 47

37 identified by homology with a consensus PhoP amino acid sequence derived from alignment of the deduced peptide sequence from other Gram-negative bacteria. The FTL0552 locus from the F. tularensis LVS genome sequence was identified and shown to have motifs consistent with response-regulator proteins, containing both a responseregulator receiver domain and a transcriptional regulatory protein domain. The locus is annotated as a two-component response-regulator, however, no sensor histidine kinase gene can be identified in the area immediately upstream or downstream of this gene (Fig. 5). Recent studies identified 16 genes in Francisella spp involved in environmental signal transduction and only 4 appear to share homology with known TCS sensor histidine kinases or response-regulators. None of the TCS genes appear to be paired in the genome as typical TCS operons in other Gram negative bacteria (63). Although the locus was identified by homology with a PhoP consensus sequence, FTL0552 shares homology with other response-regulator proteins (63). The gene arrangement of adjacent genes and the deduced amino acid sequence homology of this putative response-regulator gene is highly conserved between LVS and the virulent F. tularensis Schu S4 strain (locus FTT1557c shows only one conservative amino acid change in residues 21-228). The putative response-regulator gene (FTL0552) is the first gene in a series of five that appear to form a single operon with minimal intergenic spaces or in some cases overlapping genes (Fig. 5). RT-PCR revealed that FTL0552 and the four downstream genes are transcribed as one complete transcript, suggesting that FTL0552 is the first gene of a five gene operon, transcribed from the same promoter (Fig. 6). The amplicon using primers specific for the region from lepB to rnc appears weak and is most likely due to the primer design and not the level of transcription for that region.

PAGE 48

38 response regulator Figure 5. Arrangement of FTL0552 and adjacent genes on the F. tularensis LVS genome (NC007880). The genome locus tags are indicated as are the size of the genes in base pairs (top) and the intergenic space between genes (below). The genes indicated are (as annotated on the genome sequence): ; pseudogene; putative response-regulator, lepB ; signal peptidase I, rnc ; RNase III, truB ; tRNA pseudouridine synthetase B, rnr ; RNaseR, and oleI ; delta9 acyl-lipid fatty acid desaturase. The gene arrangement is suggestive of a five-gene operon transcribed from a promoter region upstream of FTL0552.

PAGE 49

39 Figure 6. mRNA of FTL0552 and the four downstream genes forms one complete transcript. RT-PCR analysis of F. tularensis LVS, utilizing overlapping primers, was performed to determine whether FTL0552 is part of a five gene operon under the control of the same promoter. Lane 2; amplicons using primers specific for the region from FTL0552 to lepB (operon 1-F and operon 1-R), lane 3; amplicons using primers specific for the region from lepB to rnc (operon 2-F and operon 2-R), lane 4; amplicons using primers specific for the region from rnc to truB (operon 3-F and operon 3-R), lane 5; amplicons using primers specific for the region from truB to rnr (operon 4-F and operon 4-R). PCR products were run on a 0.7% agarose gel. response regulator 900 bp 700 bp

PAGE 50

40 Mutation of F. tularensis LVS FTL0552. F. tularensis LVS FTL0552 knockouts were confirmed by PCR using primers specific to FTL0552 and primers external to FTL0552 and the flanking region. The PCR product from colonies obtained after one pass on media containing 5% sucrose revealed two bands, consistent with the size predicted for the LVS parent strain FTL0552 gene (2081bp) and the size predicted for the region of recombination (2349bp), indicating the second recombinant event had not occurred and that the shuttle vector was still present (Fig. 7A). After three passes on media containing 5% sucrose, PCR of the same colonies revealed a single band at the size predicted for the recombinant region (2349bp), indicating a second recombinant event had occurred and that the shuttle vector had been lost. PCR with the primers specific for a region within the FTL0552 gene (FTL0552-F and FTL0552-R, Table 1) revealed loss of the FTL0552 gene (Fig. 7B). To confirm the recombination event occurred within the correct location within the chromosome, a third PCR was performed using primers specific for the region flanking the area of recombination (FTL0552+1100-F and FTL0552+1100-R, Table 1). The amplicon from this PCR reaction was the size predicted for recombination within the chromosome (3158 bp) but differed from the F. tularensis LVS parent strain PCR product (2880 bp) (Fig. 7C). Primers specific for the kanR gene were also used in PCR reactions to confirm incorporation of the kanR gene within F. tularensis LVS. Sequencing of the 3158 bp PCR product amplified from F. tularensis LVS FTL0552:: kanR revealed that nucleotides 26-645 of the FTL0552 gene (genome sequence 534341 to 534960) were deleted and replaced with the kanR gene. RT-PCR using primers specific for FTL0552 was also performed to confirm loss of transcription of FTL0552 gene in F. tularensis LVS

PAGE 51

41 FTL0552:: kanR. As expected, FTL0552 was not amplified from RNA isolated from F. tularensis LVS FTL0552:: kanR but was amplified in the F. tularensis LVS parent strain (Fig. 8).

PAGE 52

42 Figure 7. Confirmation of FTL0552 knockout (A) PCR of colonies obtained after one passage on agar with 5% sucrose. Primers are specific for the region of recombination to confirm replacement of FTL0552 with the kanR gene. Lane 1; exACTGene mid range DNA ladder, Lane 2; amplicon from LVS parent strain, Lanes 3 and 4; amplicons from potential FTL0552 mutants, Lanes 5 and 6; H2O controls. (B) PCR of colonies after three passages on agar containing 5% sucrose. Primers are specific for a region within the FTL0552 gene to confirm loss of FTL0552. Lane 1; exACTGene mid range DNA ladder, Lane 2; amplicon from LVS parent strain, Lane 3; amplicon from A B C 2000 bp 500 bp 300 bp 3675 bp 2323 bp 123456 1234 1234

PAGE 53

43 Figure 7 (Continued). potential FTL0552 mutant, Lane 4; H2O control. (C) PCR of colonies after three passages on agar containing 5% sucrose. Primers are specific for the region flanking the region of recombination to confirm incorporation within the chromosome. Lane 1; Lambda BstE II DNA digest, Lane 2; amplicon from LVS parent strain, Lane 3; amplicon from potential FTL0552 mutant, Lane 4; H2O control.

PAGE 54

44 FTL0552 mutSlepBrnr H20 LVS FTL0552 mutant LVS LVS LVS FTL0552 mutant FTL0552 mutant FTL0552 mutant FTL0552 mutant LVS H20 H20 H20 FTL0552 mutS lepB rnrno RT 13 112 11 10 9 8 7 6 5 4 3 214 400 bp 300 bp Figure 8. Deletion of FTL0552 gene does not effect transcription of downstream genes in the FTL0552 mutant. RT-PCR analysis of F. tularensis LVS FTL0552 and adjacent genes was performed to confirm loss of FTL0552 transcription in the F. tularensis LVS FTL0552 mutant and to determine the effects on downstream genes. Lanes 1 and 2; amplicons using FTL0552 specific primers FTL0552-F and FTL0552-R, lanes 3 and 4; amplicons using mutS (house keeping gene) specific primers mutS-F and mutS-R, lanes 5 and 6; amplicons using lepB specific primers lepB-F and lepB-R, lanes 7 and 8; amplicons using rnr specific primers rnr-F and rnr-R. F. tularensis LVS RNA was used for the reactions in lanes 1, 3, 5, 7 and 13. FTL0552 mutant RNA was used for the reaction in lanes 2, 4, 6, 8 and 14. Lanes 9-12 are water controls and lanes 13 and 14 are no reverse transcription (RT) controls. All PCR products are run on a 1.0% agarose gel.

PAGE 55

45 FTL0552 mutation appears to have little effect on downstream genes. RT-PCR analysis, using overlapping primers was performed on RNA isolated from F. tularensis LVS and F. tularensis LVS FTL0552 mutant using primers specific for FTL0552, lepB and rnr (Table 1). The two genes, lepB and rnr were selected to determine the effects of knocking out FTL0552 on transcription of downstream genes within the potential operon (Fig. 8). The results confirmed that FTL0552 was not transcribed in the mutant strain, while the two downstream genes examined were transcribed at levels similar to those seen in LVS (Fig. 8). Therefore, the phenotype seen in the FTL0552 knockout mutant is not a result of polar effects but is directly attributed to the mutation in FTL0552 and genes outside the putative operon that are regulated by FTL0552. FTL0552 mutant is unable to replicate in mouse macrophages. A growth comparison between the LVS parental strain and the FTL0552 mutant was performed to assess the effects of knocking out the FTL0552 gene on the bacteria’s ability to grow in an acellular environment. Isolated colonies of F. tularensis LVS were visible on supplemented GC agar plates in 24 hours. In contrast, isolated colonies from the FTL0552 mutant were visible in 38-42 hours. Overnight broth cultures were incubated at 37C with aeration for a period of 4 days and OD550 readings were measured at several time points during the course of growth. Growth of the FTL0552 mutant reached the same cell density as the parental strain of LVS, however, at a slightly slower rate (Fig. 9). The mutant reached stationary phase of growth about 6-8 hrs after the parental strain LVS.

PAGE 56

46 0 20 40 60 80 100 0.0 0.3 0.6 0.9 1.2 1.5F. tularensi s LVS FTL0552 mutant Time (Hours)O.D.550nm Figure 9. FTL0552 mutant exhibits a growth defect under acellular growth conditions. The effect of FTL0552 gene deletion on growth under acellular conditions was assessed by growing the FTL0552 mutant and wild type F. tularensis LVS in Mueller Hinton broth Aliquots were removed at the times indicated and the optical density was measured at 550nm (OD550).

PAGE 57

47 The ability of the mutant to invade and replicate within mouse macrophages was assessed using J774A.1 cells and mouse peritoneal macrophages. The cells were infected with the parental strain LVS or FTL0552 mutant LVS at an MOI of 100 for J774A.1 cells and an MOI of 50 for peritoneal cells for 2 hrs and 1.5 hrs, respectively. At the indicated time points, viable counts were performed by lysing the cells and incubating serial dilutions of the sample suspensions on GC agar plates. Over a period of 72 hrs, F. tularensis LVS was able to invade and replicate within J774A.1 cells and bacterial numbers increased approximately 50-fold (Fig. 10A). However, no viable bacteria were recovered from J774A.1 cells infected with F. tularensis LVS FTL0552 mutant (Fig. 10A). Viable bacteria from PCs infected with the FTL0552 mutant were recovered but the numbers were significantly less than the parental strain (Fig. 10B). Over a period of 48 hrs, the mutant bacterial numbers increased <20-fold, compared to the parental strain bacterial numbers which increased >700-fold. An important factor contributing to the virulence and dissemination of F. tularensis within a host is its ability to invade and replicate within host macrophages. Mutation in FTL0552 appears to significantly alter the bacterium’s ability to invade and replicate within mouse macrophage cells.

PAGE 58

48 0.00E+00 1.00E+04 2.00E+04 3.00E+04 4.00E+04 5.00E+04 6.00E+04 7.00E+04 8.00E+04 0244872 Time (Hours)CFU/ml F. tularensis LVS FTL0552 mutant 0.00E+00 1.00E+05 2.00E+05 3.00E+05 4.00E+05 5.00E+05 6.00E+05 7.00E+05 8.00E+05 0102030405060 Time (Hours)CFU/ml F. tularensis LVS FTL0552 mutant Figure 10. Intracellular Survival Assay. (A) Macrophage invasion assay of FTL0552 mutant and F. tularensis LVS. Murine macrophage J774A.1 cells were infected with FTL0552 mutant and F. tularensis LVS at an MOI of 100. Bacteria were allowed to adhere to cells for two hours and then treated with 50 g/ml gentamicin to kill the extracellular bacteria. At the indicated time points, cells were lysed, serially diluted and plated on GC agar plates to determine colony forming units. (B) Similar experiments were conducted using thioglycolate elicited peritoneal macrophages from BALB/c mice infected at an MOI of 50 for 1.5 hours. The results are expressed as CFU/ml and represent means standard errors of the means of the colony forming unit counts ( n = 3 per time point). *, P < 0.001; **, P < 0.05 (using the Student’s T-Test). A B **

PAGE 59

49 FTL0552 mutant is deficient for invasion in MH-S alveolar macrophages. The cell culture invasion assay with the J774 cells and the elicited peritoneal macrophages has shown that the FTL0552 mutant is incapable of intracellular survival. We investigated further if this phenotype is due to the inability of FTL0552 to invade the macrophages. After 30 min of incubation with the labeled bacteria, we observed that majority of the MH-S cells infected with GFP-LVS harbored 2-10 bacteria per cell. On the contrary, cells infected with FTL0552 mutant contained very few bacteria (1-3 bacteria per cell) (Fig. 11). The results demonstrate that FTL0552 mutant is deficient for invasion in the macrophages. Confocal microscopy confirmed that bacteria stained green were localized inside the cells whereas, bacteria that took the counter stain and appeared yellow when the images were merged together, were localized on the surface of the macrophages (Fig. 11 Insets).

PAGE 60

50 LVS FTL0552 mutant Figure 11 Macrophage invasion assay using fluorescently labeled F. tularensis FTL0552 mutant and GFP-LVS. Blue arrows indicate the bacteria stained green are located inside the macrophages, where as, white arrows indicate bacteria stained yellow are present on the surface of the cell. The macrophages were counterstained with PKH26 red fluorescence dye (Sigma St Louis, MO). Insets: Confocal images confirming the localization of the bacteria within the cells.

PAGE 61

51 FTL0552 mutant is not affected by increasing levels of Magnesium, or acidic pH. In Salmonella spp., the expression of several genes essential to survival in Mg2+limiting environments is governed by the PhoP/PhoQ system. Micromolar concentrations of Mg2+ has been shown to activate transcription of at least 18 PhoP activated genes, which are repressed in macromolar concentrations of Mg2+ (79). In addition, other environmental conditions have been shown to modulate the expression of other PhoP regulated genes essential to the survival of the bacteria in conditions such as low pH or in the presence of hydrogen peroxide (79, 88). To assess whether FTL0552 responds to the same environmental stimuli as PhoP in other gram negative bacteria, I compared the growth of F. tularensis LVS parent strain to the FTL0552 mutant in media containing increasing concentrations of Mg2+ (Fig. 12). Surprisingly, the mutant grew equally well in lower levels of Mg2+, compared to the parental strain. In addition, as the Mg2+ concentration increased, growth of the parental strain decreased, whereas growth of the FTL0552 mutant remained unaffected. The results suggest that FTL0552 is not involved in Mg2+ transport. The growth of F. tularensis LVS parent strain and the FTL0552 mutant in media of varying pH levels was then compared (Fig. 13). Again, the FTL0552 mutant did not respond to acidic pH levels as expected for a PhoP mutant. The FTL0552 mutant grew equally as well as, if not slightly better than, the parental strain in an acidic environment. The results suggest that low pH alone is not an environmental signal activating FTl0552 or governing the expression of FTL0552 regulated genes essential to the survival of the bacteria in an acidic environment. Since PhoP has been shown to play a role in hydrogen peroxide resistance in some bacteria, a comparison of FTL0552 mutant sensitivity to hydrogen peroxide and F. tularensis LVS parental strain

PAGE 62

52 was performed (Fig. 14). There was no apparent difference observed between the hydrogen peroxide sensitivity of the FTL0552 mutant as compared to the parental strain. This alone does not indicate that FTL0552 does not play a role in hydrogen peroxide resistance. Salmonella PhoP knockouts are susceptible to hydrogen peroxide killing when grown in low Mg2+. Previous studies suggest that a functional phoP gene is necessary for normal levels of rpoS during growth in low Mg2+. RpoS controls the antioxidant enzyme exonuclease IIII, responsible for hydrogen peroxide resistance. Inactivation of RpoS, renders Salmonella hypersensitive to hydrogen peroxide (88). The rpoS gene is not found in F. tularensis LVS or the Schu S4 strain. Perhaps there could be a similar connection between phoP and another rpoS -like gene in F. tularensis LVS. However, FTL0552 does not appear to function or respond to the environmental signals in the same manner as PhoP of other Gram negative bacteria. This suggests that, although FTL0552 was identified by homology to a PhoP consensus amino acid sequence, it does not display the same phenotypic properties of PhoP in other bacteria. Recent studies identified and characterized the same gene (FTT1557c, FNU0663.2) as an orphan response-regulator in F. tularensis subsp. novicida The locus was identified by homology to the Salmonella PmrA response-regulator. The Salmonella TCS, PmrAB, regulates resistance to the antimicrobial peptide (AMP) polymyxin B. A F. tularensis subsp. novicida pmrA mutant was 32-fold more susceptible to polymyxin B than the parental strain (63). The F. tularensis LVS FTL0552 mutant was initially selected on media containing 100 g/mL of polymyxin B, suggesting that FTL0552 is not essential for resistance to polymyxin B in F. tularensis LVS. Polymyxin B MIC studies revealed that there is no difference between the polymyxin B susceptibility of the

PAGE 63

53 FTL0552 mutant and the F. tularensis LVS parental strain. Both strains were resistant to polymyxin B up to 1000 g/mL. Therefore, FTL0552 does not appear to display the same phenotypic properties as PmrA of other Gram negative bacteria.

PAGE 64

54 Mg2+ assay0 0.1 0.2 0.3 0.4 0.5 0100200300400500 Mg2+ concentration (M)OD at 550nm LVS parent strain FTL0552 mutant Figure 12. F. tularensis LVS FTL0552 mutant response to increasing levels of magnesium LVS parent strain and FTL0552 mutant were grown in MH broth containing increasing levels of magnesium. The optical density was measured to assess growth.

PAGE 65

55 Effect of pH on growth0 0.1 0.2 0.3 0.4 0.5 0.6 6.465.554.54 pHOD at 550nm LVS parent strain FTL0552 mutant Figure 13. F. tularensis FTL0552 mutant response to acidic pH LVS parent strain and FTL0552 mutant were grown in MH broth of decreasing pH levels. The optical density was measured to assess growth.

PAGE 66

56 Hydrogen peroxide Killing Assay0.00E+00 1.00E+06 2.00E+06 3.00E+06 4.00E+06 5.00E+06 6.00E+06 7.00E+06 8.00E+06 9.00E+06 05102030 Time (minutes)CFU/mL LVS parent strain-untreated LVS parent strain-treated FTL0552 mutant-untreated FTL0552 mutant-treated Figure 14. F. tularensis LVS FTL0552 mutant response to hydrogen peroxide LVS parental strain and FLT0552 mutant bacterial cultures were either treated with hydrogen peroxide or left untreated and incubated for 30 minutes. Serial dilutions of the samples at each time point were plated on GC agar plates to determine viable colony forming units.

PAGE 67

57 FTL0552 mutant is attenuated for virulence in mice. We screened the FTL0552 mutant in BALB/c and C57BL/6 mice to assess the effect of the gene deletion on virulence. It was observed that all mice (n=10) of both strains infected with 1x104 or 1x105 CFU of F. tularensis LVS succumbed by days 17-19 post infection. In contrast, all BALB/c and C57BL/6 mice survived similar doses of FTL0552 mutant to at least day 21 post-infection (Fig. 15A and 15B). All mice that survived the primary infective dose of 1x105 of FTL0552 mutant were challenged with 1x102 CFU of Schu S4 strain. It was observed that C57BL/6 mice had a significantly extended MST of 9 days as compared to 6.5 days for the naive challenged mice. In the BALB/c mice challenged with Schu S4, the first death was recorded at day 12 postchallenge and 30% (3/10) of the mice survived the challenge dose out to at least 45 days post-challenge when the experiment was terminated (Fig. 15C). The other groups of mice that survived initial infection with 1x104 CFU of FTL0552 were subsequently boosted with 1x105 CFU of FTL0552 mutant and challenged with 1x102 CFU of Schu S4. Although the MST for C57BL/6 mice treated in this manner was not altered following challenge, 40% of the BALB/c mice survived until day 21 post-challenge and the others had a significant delay in time to death (Fig. 15D). Thus, these results show that the FTL0552 mutant is not only highly attenuated for virulence in mice, but also retains its antigenic potential and provides partial protection against virulent Schu S4 challenge.

PAGE 68

58 0 3 6 9 12 15 18 21 0 20 40 60 80 100 0 3 6 9 12 15 18 21 0 20 40 60 80 1001x105CFU 0 3 6 9 12 15 18 21 0 20 40 60 80 100P< 0.0001 0 3 6 9 12 15 18 21 0 20 40 60 80 1001x105CFU P< 0.0001 1x104CFU 1x104CFU Days Post-infectionPercent SurvivalBALB/c C57BL/6Percent SurvivalP< 0.001 P< 0.0001A B € !F. tularensis LVS FTL0552 mutantDays Post-infection Figure 15. FTL0552 mutant is attenuated for virulence in mice and provides partial protection against lethal Schu S4 challenge. Survival of BALB/c (A) ( n = 10) and C57BL/6 (B) ( n = 10) mice infected intranasally with 1 x 104 or 1x105 CFU of FTL0552 mutant or F. tularensis LVS.

PAGE 69

59 C Days Post-challengePercent SurvivalP<0.0001 0 3 6 9 12 15 18 21 0 20 40 60 80 100Control C57BL/6 / 105FTL0552 mutant BALB/c /105FTL0552 mutant 1x102CFU Schu4D Days Post-challengePercent Survival P<0.0001 1x102CFU SchuS4 105CFU Boost 0 3 6 9 12 15 18 21 0 20 40 60 80 100FTL0552 mutant FTL0552 mutant BALB/c / 104 C57BL/6 / 104 Controls Figure 15 (Continued). (C). Mice surviving 1x105 CFU of FTL0552 mutant (n=10) were challenged with 1x102 CFU of Schu S4. (D) Mice surviving 1x104 CFU of FTL0552 mutant (n=10) were boosted with 1x105 CFU of FTL0552 mutant and challenged 30 days later with 1x102 CFU of F. tularensis Schu S4 strain. Untreated mice were kept as controls. Results are expressed as Kaplan-Meier curves and P values determined using a Log-Rank test.

PAGE 70

60 FTL0552 mutant exhibits markedly reduced systemic dissemination and is cleared rapidly. We further investigated the kinetics of clearance of the FTL0552 mutant in mice. C57BL/6 and BALB/c mice were infected i.n. with 5x103 CFU of either FTL0552 mutant or LVS. The mice were sacrificed at the indicated times and bacterial numbers were quantitated in the lung, liver and spleen. An identical pattern of bacterial kinetics was observed in both BALB/c and C57BL/6 mice. At days 1, 3 and 5 post-infection, bacterial numbers were significantly lower in the lungs of FTL0552 mutant-infected mice compared to LVS infected mice, and at day 7 post-infection, bacteria were completely eliminated from the lungs of FTL0552 mutant-infected mice (Fig. 16A). No significant differences were observed in bacterial numbers in LVS or FTL0552 mutant infected mice in the liver, at day 3 post-infection, but at subsequent time points no bacteria were detected in FTL0552 mutant infected mice. Significantly lower numbers of FTL0552 mutant bacteria disseminated to the spleen as compared to the liver and no detectable bacteria were seen day 5 and 7 post-infection (Fig. 16B). These results corroborate attenuated virulence of FTL0552 mutant observed in mice and suggest that the attenuation of FTL0552 mutant may be due to the rapid clearance and significantly diminished dissemination.

PAGE 71

61 dissemination. 1 3 5 7 100 102 104 106 108** ** ** 100 101 102 103 104 100 101 102 103 104*** 100 101 102* 100 101 102 103 104Day 3 Post-infectionCFU/SpleenCFU/Liver CFU/LungDays Post-infectionA B 1 3 5 7 100 102 104 106 108F. tularensis LVS FTL0552 mutant ** *****BALB/cC57BL/6 BALB/cC57BL/6 Figure 16. FTL0552 mutant is rapidly cleared by BALB/c and C57BL/6 mice. (A) BALB/c and C57BL/6 mice were inoculated intranasally with 5 x 103 CFU of FTL0552 mutant or F. tularensis LVS. Four mice were killed at each indicated time point, and homogenates of the lungs were plated for the determination of bacterial burden. (B) Numbers of bacteria were quantified in the liver and spleen of the mice at day 3 postinfection. Results represent the means standard errors of CFU counts ( n = 4 per time point). **, P < 0.01; ***, P < 0.001 (using the nonparametric Mann-Whitney test).

PAGE 72

62 Infection with FTL0552 mutant induces less severe histological lesions. Extensive damage to vital organs is believed to be the primary cause of death from F. tularensis infection. We observed that the FTL0552 mutant is rapidly cleared; we further evaluated tissue sections from LVS and FTL0552 mutant infected mice to compare the degree of damage caused to the tissues by the two bacterial strains. Lesions in the lungs, livers and spleens of FTL0552 mutant and LVS infected mice appeared as early as 3 days post-infection and subsequently became more extensive by days 5 and 7 post-infection (Fig. 17A). Lesions in the lungs of LVS infected mice consisted mostly of multifocal bronchopneumonia and extensive lymphocytic to neutrophilic peribronchial and perivascular inflammation. However, these lesions were less severe and localized to very discrete areas in the lungs of FTL0552 mutant infected mice (Fig. 17A). Livers from LVS infected mice showed numerous multifocal neutrophilic to lymphocytic granulomas. These granulomas became larger as the infection progressed. On the contrary, few and very small granulomas were observed in the FTL0552 mutant infected mice (Fig. 17B). Lesions in the spleen consisted of multifocal to coalescing areas of neutrophilic infiltration in the red pulp, enlargement of the marginal zones, and extensive proliferative responses in the germinal centers. However, the splenic tissue in FTL0552 mutant-infected mice appeared to be normal and no inflammatory changes were observed (Fig. 17C). The results indicate that although the FTL0552 mutant is rapidly cleared from the tissues, it still induces a degree of inflammation and development of mild pathological lesions in the lungs and liver.

PAGE 73

63 Figure 17. Mice infected with FTL0552 mutant exhibit markedly less severe histopathological lesions Histopathological changes in the H&E stained sections of lungs (A), liver (B), and spleen (C) of BALB/c and C57BL/6 mice (n=4) were evaluated at day 5 after intranasal inoculation with 5x103 CFU of FTL0552 mutant or F. tularensis LVS. Lung, liver, and spleen sections of sham-inoculated mice served as a control. (Magnification x 40). Arrows indicate granulomas that were observed to be smaller in mice infected with the FTL0552 mutant than those infected with LVS.

PAGE 74

64 Mice infected with FTL0552 mutant produce lower levels of inflammatory cytokines. Unregulated production of cytokines in response to F. tularensis infection has been shown to be responsible for the severe histopathological lesions observed in the lungs, livers and spleens of infected mice. We determined the levels of inflammatory cytokines such as interferon-gamma (IFN), tumor necrosis factor-alpha (TNF), interleukin-6 (IL-6), monocyte chemoattractant protein (MCP-1) and interleukin 12 (IL12) in the lung homogenates of C57BL/6 and BALB/c mice infected either with LVS or the FTL0552 mutant. LVS infected mice had significantly elevated levels of all cytokines except IL-12 at days 5 and 7 post-infection (Fig. 18). The levels of IL-6 and IFNin FTL0552 mutant infected mice were below detection levels whereas elevated levels of IL-12 were seen at day 7 post-infection. The results suggest that lowered cytokine production results in less severe pathology in the lungs of FTL0552 mutant infected mice.

PAGE 75

65 0 1 2 3 4 5 6 7 8 0 50 100 200 300 400 500 0 1 2 3 4 5 6 7 8 0 250 500 1000 2000 3000 4000MCP-1 (Pg/ml) 0 1 2 3 4 5 6 7 8 0 100 500 1500 2500 0 1 2 3 4 5 6 7 8 0 100 200 300 400 500IFN(Pg/ml) 0 1 2 3 4 5 6 7 8 0 100 200 300 400 500 0 1 2 3 4 5 6 7 8 0 100 200 300 400 500 600 700IL-6 (Pg/ml) 0 1 2 3 4 5 6 7 8 0 100 200 300 400 500 600 700 0 1 2 3 4 5 6 7 8 0 10 20 30 40 50 60IL-12 (Pg/ml) 0 1 2 3 4 5 6 7 8 0 10 20 30 40 50 60Days Post-infectionBALB/c C57BL/6 0 1 2 3 4 5 6 7 8 0 50 100F. tularensis LVS FTL0552 mutant 200 300 400 500TNFa (Pg/ml) Figure 18. FTL0552 mutant exhibits lower levels of proinflammatory cytokines. Following intranasal inoculation of BALB/c and C57BL/6 mice with 5x103 CFU of FTL0552 mutant or F. tularensis LVS, lung homogenates were prepared, and levels of proinflammatory cytokine levels were measured using Cytometric Bead Array (BD Pharmingen, San Diego, CA). Results represent the means standard errors of the means of the cytokine concentrations ( n = 4 mice per time point). *, P < 0.05; **, P < 0.01; ***, P < 0.001 (by one-way ANOVA followed by Bonferroni's correction).

PAGE 76

66 FTL0552 regulates genes essential for intracellular survival and virulence. Gene microarray analysis revealed 148 genes regulated by FTL0552 (Table 2). The genes are identified by a 4-fold or greater difference between F. tularensis LVS parent strain and FTL0552 mutant. The majority (75%) of the genes regulated are down regulated in the FTL0552 mutant, indicating they are FTL0552 activated genes. Among the genes down regulated by the mutant, are the intracellular growth loci ( iglA, iglB, iglC and iglD ). These genes are located in the FPI and have been shown to be essential for intracellular survival (34, 54, 58, 65). Other down regulated genes include a macrophage infectivity potentiator fragment, the gene encoding a type IV pili fiber building block protein, ampC fopA and, interestingly, the superoxide dismutase gene, sodB The type IV pili fiber building block protein is involved in bacterial attachment and invasion of host cells. Citrobacter freundii AmpC is a cytoplasmic membrane protein gene required for induction of -lactamase and was recently identified as a permease required for recycling of murein tripeptide and uptake of anhydro-muropeptides, which are produced by turnover of the cell wall during logarithmic growth of E. coli K-12 (13). FopA is an outer membrane protein specific to F. tularensis and is used as the target gene to rapidly detect and distinguish F. tularensis from Francisella philomiragia and other bacteria by LightCycler (LC) PCR (30) The sodB gene in F. tularensis LVS encodes a functional FeSOD protein essential for bacterial survival under conditions of oxidative stress. A sodB mutant was attenuated for virulence in mice, indicating that FeSOD plays a role in virulence of F. tularensis LVS (6). The genes that are up regulated in the FTL0552 mutant include several hypothetical proteins, and pseudogenes, two transposases, and, interestingly, the gene encoding a type IV pili nucleotide-binding protein, pilT

PAGE 77

67 Table 2. Genes regulated by FTL0552. Fold Change adj.P.Val LVS loci Gene Product Genes down regulated in FTL0552 mutant -25.05928019 0.00233705 FTL_0236 rplC 50S ribosomal protein L3 -22.19311691 0.00597319 FTL_1789 gltA citrate synthase -19.35758199 0.00468233 FTL_0254 rpmD 50S ribosomal protein L30 -18.02126118 0.00710756 FTL_1751 tufA elongation factor Tu (EFTu) -17.77871998 0.00275065 FTL_0253 rpsE 30S ribosomal protein S5 -17.33021775 0.00816132 FTL_1452 rpmA 50S ribosomal protein L27 -17.19672181 0.01262576 FTL_1744 rpoB DNA-directed RNA polymerase beta chain -16.36824612 0.01503285 FTL_1158; FTL_0112 iglB intracellular growth locus, subunit B -16.04281684 0.01262576 FTL_0249 rpsN 30S ribosomal protein S14 -15.70008434 0.01625823 FTL_1553 sucC Succinyl-CoA synthetase beta chain -15.6848517 0.00496561 FTL_1138 acpP acyl carrier protein -15.5530817 0.02435709 FTL_1180 ptsN PEP-dependent sugar phosphotransferase system (PTS) family protein -15.26151237 0.00597319 FTL_0250 rpsH 30S ribosomal protein S8 -15.17791631 0.01259213 FTL_0456 rpsU1 30S ribosomal protein S21 -15.02396164 0.00496561 FTL_0255 rplO 50S ribosomal protein L15 -14.7544992 0.00861015 FTL_0104 hypothetical membrane protein -14.14970215 0.02435709 FTL_1786 sdhA succinate dehydrogenase, catalytic and NAD/flavoprotein subunit -13.98444357 0.00387005 FTL_0234 fusA elongation factor G (EF-G) -13.95892199 0.01151088 FTL_0248 rplE 50S ribosomal protein L5 -13.82131408 0.01118009 FTL_1405 rpmI 50S ribosomal protein L35 -13.72452491 0.00928887 FTL_0251 rplF 50S ribosomal protein L6 -13.62834175 0.01259213 FTL_0247 rplX 50S ribosomal protein L24 -13.22678364 0.01831857 FTL_1159; FTL_0113 iglC intracellular growth locus, subunit C -12.67540688 0.01860968 FTL_1404 rplT 50S ribosomal protein L20 -12.66500492 0.00721755 FTL_0252 rplR 50S ribosomal protein L18 -12.41193477 0.0176315 FTL_0457 cspC cold shock protein -12.34048842 0.01118009 FTL_0243 rplP 50S ribosomal protein L16 -11.89849425 0.00496561 FTL_0242 rpsC 30S ribosomal protein S3 -11.52757836 0.02475487 FTL_1790 ampG major facilitator superfamily (MFS) tranport protein -11.33508028 0.01262576 FTL_1328 fopA outer membrane associated protein -11.17326652 0.01694981 FTL_1800 atpE ATP synthase C chain -11.16020392 0.00861015 57 base overlap with FTL_1024 overlaps rpsF overlaps 30S ribosomal protein S6

PAGE 78

68 Table 2 (Continued). -10.76138971 0.01118009 FTL_1787 sdhD succinate dehydrogenase hydrophobic membrane anchor protein -10.75579449 0.01262576 FTL_1746 rplJ 50S ribosomal protein L10 -10.53371666 0.01262576 FTL_1797 atpA ATP synthase alpha chain -10.43829441 0.02430586 FTL_1309 accD Acetyl-CoA carboxylase beta subunit -10.11923752 0.01982448 FTL_1792 Glutaredoxin-related protein -10.11045205 0.03355773 FTL_1361 cspA cold shock protein -9.979771948 0.01625823 FTL_1479 pepA cytosol aminopeptidase -9.899502498 0.02915752 FTL_1748 rplK 50S ribosomal protein L11 -9.748119357 0.01262576 FTL_1736 trmD tRNA (Guanine-N(1)-)methyltransferase -9.676818132 0.01625823 FTL_1591 accC Acetyl-CoA carboxylase, biotin carboxylase subunit -9.570639159 0.01831857 FTL_1791 sodB superoxide dismutase [Fe] -9.567494795 0.0130139 FTL_1026 rplI 50S ribosomal protein L9 -9.535239754 0.01118009 FTL_1097 macrophage infectivity potentiator, fragment -9.504769551 0.04137074 FTL_1843 gatC Glu-tRNAGln amidotransferase C subunit -9.348565178 0.00948832 FTL_0421 lpnA conserved hypothetical lipoprotein -9.309757306 0.0111118 FTL_0246 rplN 50S ribosomal protein L14 -9.183991197 0.00948832 FTL_1735 rplS 50S ribosomal protein L19 -9.130656462 0.02475487 FTL_1745 rplL 50S ribosomal protein L7/L12 -9.109343253 0.03973755 FTL_1749 nusG transcription antitermination protein nusG -8.97743477 0.01625823 FTL_1442 fabI Enoyl-[acyl-carrierprotein] reductase (NADH) -8.931173932 0.01262576 FTL_1746 rplJ 50S ribosomal protein L10 -8.860087763 0.01625823 FTL_1802 hypothetical membrane protein -8.79275415 0.01625823 FTL_1783 sucB dihydrolipoamide succinyltransferase component of 2oxoglutarate dehydrogenase complex -8.411502096 0.01118009 FTL_0259 rpsK 30S ribosomal protein S11 -8.2600092 0.01262576 FTL_1914 conserved membrane protein -8.120925628 0.0448537 FTL_1747 rplA 50S ribosomal protein L1 -7.98099707 0.01262576 FTL_1866 pcm Protein-L-isoaspartate Omethyltransferase -7.975037811 0.0130139 FTL_0224 rpsB 30S ribosomal protein S2 -7.953326091 0.00948832 FTL_1747 rplA 50S ribosomal protein L1 -7.906516041 0.01942492 FTL_1800 atpE ATP synthase C chain -7.901501728 0.02657508 FTL_1236 infA translation initiation factor IF

PAGE 79

69 Table 2 (Continued). -7.834059565 0.03192562 FTL_0449 hypothetical protein -7.76975055 0.00948832 FTL_0240 rpsS 30S ribosomal protein S19 -7.723022596 0.02430586 FTL_1899 glnA glutamine synthetase -7.605369341 0.01625823 FTL_1160; FTL_0114 iglD intracellular growth locus, subunit D -7.523342004 0.01625823 FTL_1906 lpxC UDP-3-O-[3hydroxymyristoyl] Nacetylglucosamine deacetylase -7.463597743 0.01587326 FTL_1808 rbfA Ribosome-binding factor A -7.425803224 0.0130139 FTL_1744 rpoB DNA-directed RNA polymerase beta chain -7.324906566 0.02779293 FTL_0522 rpmB 50S ribosomal protein L28 -7.316623559 0.03355773 FTL_1794 atpC ATP synthase epsilon chain -7.106487115 0.02126889 FTL_0457 cspC cold shock protein -7.101383652 0.02915752 FTL_0225 tsf protein chain elongation factor EF-Ts -7.0326146 0.01880227 FTL_1161; FTL_0115 conserved hypothetical protein -6.886330976 0.01474031 FTL_1785 sdhB succinate dehydrogenase iron-sulfur protein -6.814183939 0.02915752 FTL_1908 ftsA cell division protein FtsA -6.788131408 0.01569351 FTL_0232 rpsL 30S ribosomal protein S12 -6.667272265 0.01262576 FTL_1392 deaD Cold-shock DEAD-box protein A -6.654382249 0.04137074 FTL_0552 Two-component response regulator -6.582903729 0.02587972 FTL_1866 pcm Protein-L-isoaspartate Omethyltransferase -6.390042955 0.02435709 FTL_1157; FTL_0111 iglA intracellular growth locus, subunit A -6.38412801 0.02475487 FTL_1364 conserved hypothetical protein -6.382618562 0.04208055 FTL_1538 rpsO 30S ribosomal protein S15 -6.356697689 0.03184661 FTL_1912 rpsA 30S ribosomal protein S1 -6.315994198 0.01860968 FTL_0248 rplE 50S ribosomal protein L5 -6.252961264 0.03500214 FTL_1400 conserved hypothetical protein -6.233222608 0.01587326 FTL_1809 infB translation initiation factor IF-2 -6.178737226 0.01810894 FTL_0262 rplQ 50S ribosomal protein L17 -6.154009595 0.01625823 FTL_0175 rpmH 50S ribosomal protein L34 -6.122084398 0.02915752 FTL_0166 usp universal stress protein -5.973209935 0.01587326 FTL_1461 deoD purine nucleoside phosphorylase -5.957196557 0.01587326 FTL_1799 atpF ATP synthase B chain -5.94144208 0.04208055 FTL_1811 conserved hypothetical protein

PAGE 80

70 Table 2 (Continued). -5.90717608 0.03500214 FTL_1785 sdhB succinate dehydrogenase iron-sulfur protein -5.836772303 0.02330711 FTL_1239 ffh signal recognition particle protein, Ffh -5.818402609 0.02891333 FTL_0252 rplR 50S ribosomal protein L18 -5.71724013 0.03500214 FTL_1788 sdhC succinate dehydrogenase, cytochrome b556 -5.620673623 0.02915752 FTL_1737 rimM 16S rRNA processing protein rimM -5.612959849 0.03500214 FTL_1137 fabF 3-oxoacyl-[acyl-carrierprotein] synthase II -5.578672881 0.02700348 FTL_0392 Type IV pili fiber building block protein -5.496727729 0.01729659 FTL_1789 gltA citrate synthase -5.456963006 0.02246866 FTL_1795 atpD ATP synthase beta chain -5.384322677 0.0448537 FTL_0070 rpsT 30S ribosomal protein S20 -5.320586462 0.02435709 FTL_0260 rpsD 30S ribosomal protein S4 -5.268390745 0.02988088 FTL_1453 rplU 50S ribosomal protein L21 -5.235104687 0.02587972 FTL_1892; FTL_1317 hypothetical protein -5.192961998 0.02444671 FTL_1309 accD Acetyl-CoA carboxylase beta subunit -5.178980027 0.03184661 FTL_1738 rpsP 30S ribosomal protein S16 -4.941337444 0.04390467 FTL_1504 katG Peroxidase/catalase -4.761407043 0.03905373 FTL_1143 rmpF 50S ribosomal protein L32 -4.507271922 0.03754453 FTL_1780 tpiA triosephosphate isomerase Genes down regulated in FTL0552 mutant 4.657900941 0.0476291 FTL_0010 glpe thiosulfate sulfurtransferase 4.758190213 0.04862308 FTL_0864 SIS domain protein 4.903062161 0.04424048 FTL_0035 hypothetical protein 5.887486797 0.02330711 FTL_1373 hypothetical protein 5.94921963 0.03500214 intergenic between FTL_1368 and FTL_1369 hypothetical protein 6.046543067 0.048071 intergenic between FTL_0408 and FTL_0409 hypothetical protein 6.086182237 0.0448537 intergenic between FTL_1645 and FTL_1646 6.152287936 0.02371267 intergenic between FTL_1953 and FTL_1954 conserved hypothetical membrane protein 6.288269169 0.01915536 FTL_0568 isftu2 Transposase 6.375452213 0.01503285 FTL_0496 thrB homoserine kinase (pseudogene) 6.819971411 0.02007481 FTL_0474 lolC lipoprotein releasing system, subunit C,putative membrane protein

PAGE 81

71 Table 2. (Continued). 7.238472409 0.01694981 FTL_0495 thrA bifunctional aspartokinase/homoserine dehydrogenase I (pseudogene) 7.408171347 0.01997309 intergenic between FTL_1589 and FTL_1590 msc mechanosensitive ion channel protein 7.613734457 0.040795 FTL_1124 hypothetical protein 7.906864993 0.02297458 FTL_1944; FTL_1925 isftu1 Transposase 8.066832218 0.03184661 19 base overlap with FTL_1648 oppF oligopeptide transporter, subunit F, ABC transporter, ATP-binding protein 8.103479133 0.04138666 FTL_0562 conserved hypothetical protein, pseudogene 8.241788902 0.02430586 FTL_1280 D-Beta-hydroxybutyrate dehydrogenase,psuedogene 8.871987933 0.03965435 FTL_0775 hsdR1 Type I restriction enzyme subunit R, pseudogene 9.181028537 0.00597319 intergenic between FTL_1493 and FTL_1494 hypothetical protein 9.303168779 0.03564467 FTL_0446 hypothetical protein 9.721982075 0.03564467 FTL_1092 betT Betaine/carnitine/choline transporter (BCCT) family protein, pseudogene 9.947699861 0.02475487 intergenic between FTL_1336 and FTL_1337 amino acid permease family protein, pseudogene 9.983033158 0.02700348 FTL_0323 Smf protein DNA processing chain A, pseudogene 10.09337723 0.0146488 FTL_1281 D-Beta-hydroxybutyrate dehydrogenase,psuedogene 10.10298529 0.02050863 FTL_0501 speA putative arginine decarboxylase 10.17116049 0.01625823 FTL_0446 hypothetical protein 10.39217736 0.01860968 FTL_1770 pilT Type IV pili nucleotidebinding protein 10.74624435 0.03973755 FTL_0022 gabD1 Succinate-semialdehyde dehydrogenase, fragment 12.4857256 0.01915536 FTL_0702 hypothetical protein 13.11213182 0.02788963 13.13737321 0.03099376 FTL_1767 deoxyribodipyrimidine photolyase 14.11177762 0.01262576 FTL_1944; FTL_1925 isftu1 Transposase 15.11674799 0.03500214 hypothetical protein 16.50777825 0.03973755 67 base overlap with FTL_0634 naoX NADH oxidase 17.7128157 0.04949982 FTL_1844 Secretion protein

PAGE 82

72 SDS-PAGE analysis reveals a soluble protein deleted from the FTL0552 mutant. In addition to gene microarray analysis, I used SDS-PAGE to compare protein expression of F. tularensis LVS parent strain and FTL0552 mutant. Bacterial lysate and supernatant samples were run on two SDS-PAGE gels and stained with Coomassie Brilliant Blue and Silver Stain. There was no observable difference between the two strain’s lysate or supernatant samples on the Coomassie Blue stained gel. However, the more sensitive Silver Stain revealed a protein band, migrating between 25-30 kDa, from the supernatant fraction of the F. tularensis LVS parental strain that is absent in the FTL0552 mutant sample (Fig. 19). Lowered production of a soluble protein in the FTL0552 mutant is not surprising given the number of genes identified as being regulated by FTL0552. Survival of F. tularensis LVS within host cells depends on the bacterium’s ability to have a mechanism which protects the bacteria from degradation by the host cell, allows escape from the phagosome, replication within the cytoplasm and signals the host cell to undergo apoptosis in order for the bacteria to be released and invade new cells. While several genes have been identified as being essential to the intracellular survival of F. tularensis the mechanism has yet to be characterized. Further analysis is required to identify the secreted proteins and their role in the interaction with the host cell.

PAGE 83

73 Figure 19. Silver Stain of F. tularensis LVS and FTL0552 mutant bacterial proteins. Lane 1 Mult Mark protein ladder ; Lane 2; media alone, Lanes 3 and 5; LVS wild type cleared lysate at 10g and 20g, Lanes 4 and 6; FTL0552 mutant cleared lysate at 10g and 20g, Lane 7; media alone, Lane 8; LVS wild type supernatant at 20g, Lane 9; FTL0552 supernatant at 20g. 25-30 kDa 1 2 3 4 5 6 7 8 9

PAGE 84

74 Discussion It was the goal of this project to identify genes encoding potential two-component regulatory systems in the F. tularensis that may be involved in regulation of virulence factor genes. In order to identify potential response-regulator genes that activate genes necessary for bacterial virulence, we searched the F. tularensis LVS genome using a consensus amino acid sequence derived from the phoP response-regulator genes from other Gram-negative bacteria. One locus, FTL0552, was identified by the similarity of its protein product to the PhoP response-regulator consensus sequence. The FTL0552 locus is 687 nucleotides in length and was annotated in the genome sequence as a transcriptional response-regulator. The corresponding locus in F. tularensis Schu S4 (FTT1557c) is highly conserved. In this report we describe the construction of a deletion mutant for FTL0552 in F. tularensis LVS. The FTL0552 gene was interrupted with a kanR gene, replacing nucleotides 26-645. A knockout mutant in the response-regulator gene (FTL0552) was constructed by combining PCR generated products delivered by conjugation, with subsequent recombination into the bacterial chromosome by allelic replacement. F. tularensis LVS mutant deleted for FTL0552 was shown to be defective for survival in both mouse J774A.1 cells and peritoneal macrophages. This mutant was completely

PAGE 85

75 attenuated in both BALB/c and C57BL/6 mice at doses up to 1 X 105 CFU/ mouse. Challenge studies of mice surviving infection with the FTL0552 mutant using the virulent Schu S4 strain suggest that some level of protective immunity is afforded to these mice. Furthermore, mice infected with the FTL0552 mutant exhibited reduced levels of proinflammatory cytokine production, and reduced evidence of histopathology in affected tissues, and correspondingly, reduced systemic infection and rapid clearance of the bacterium. Our results support a major role for the FTL0552 gene product in controlling expression of virulence genes in F. tularensis Despite identification of the genomic locus (FTL0552) encoding this gene by homology with a PhoP consensus sequence from other bacteria, it does not appear to function as a PhoP homologue. While the poor intramacrophage survival and reduced virulence in mice are consistent with pho P mutants described in other bacteria (38), the growth rate was not significantly altered at low Mg2+ concentrations. Low Mg2+ environments have been reported to result in slower growth for Salmonella phoP mutants, suggesting PhoP plays a role in regulating genes associated with Mg2+ transport, as well as increased susceptibility to hydrogen peroxide, and acidic pH (38, 88). The F. tularensis FTL0552 mutant was not observed to exhibit either property. Additionally, the absence of an adjacent gene on the F. tularensis genome sequence that is homologous to the sensor histidine kinase, pho Q, differs from the gene arrangement in other bacteria where phoP/phoQ forms a two-gene operon (38). However, it is certainly possible that FTL0552 could form a two-component regulatory system with the product of an unknown gene located within another region of the F. tularensis chromosome. At this

PAGE 86

76 point, it is unclear if FTL0552 encodes a response-regulator that is part of a twocomponent system. Two loci sharing homology to PhoQ have been identified (FTL1878 and FTL1762) and are being examined to determine if either gene is the cognate sensor histidine kinase functioning to activate FTL0552. FTL0552 protein is highly conserved among various Francisella strains including Francisella tularensis subsp. holarctica OSU18 (NC008369), Francisella tularensis subsp. tularensis FSC 198 (NC008245), and Francisella tularensis subsp. tularensis Schu S4 (NC006570). When the deduced amino acid sequence derived from FTL0552 was used in a BLAST search against all peptide and translated sequences in GenBank, the best hits were known or putative response-regulators. Included in these hits was PmrA from Pseudomonas aeruginosa, the response-regulator part of the two-component regulatory system PmrA-PmrB. PmrA is activated through PmrB and responds to extracellular iron and mild acid pH and confers resistance to polymyxin B and other antimicrobial peptides in Salmonella (50, 63, 92). Functional PmrA is required to allow Salmonella to adapt to the toxic effects of high iron environments (92). Since PmrA mutants in other bacteria are typically more susceptible to polymyxin B, we might expect the FTL0552 mutant to also be more susceptible to polymyxin B (92). However, the initial selection of our FTL0552 mutant was performed in the presence of 100 g/ml of polymyxin B suggesting that FTL0552 is not necessary to confer resistance to polymyxin B and does not function in the same manner as PmrA in other bacteria. The FTL0552 mutant was resistant to polymyxin B up to a concentration of 1000 g/ml. Thus, the

PAGE 87

77 stimulus that is responsible for activating genes that are regulated by FTL0552 remains uncharacterized. The PmrA-PmrB system in Salmonella controls the transcription of several genes necessary for polymyxin B resistance and mediates the modification of LPS when induced by high iron or promoted by growth in low magnesium (39, 40, 50). However, PmrA-activated genes stimulated by growth in low magnesium requires another twocomponent system, PhoP-PhoQ (50). Previous studies defined the genetic basis for the interaction between the PhoP-PhoQ and PmrA-PmrB systems that regulates expression of antimicrobial resistance determinants in response to two different environmental conditions (50). In the presence of low magnesium, PhoP mediates transcription of the pmrD gene that mediates the transcriptional induction of PmrA-activated genes (50). In the presence of excess iron, transcriptional activation of PmrA-activated genes is independent of PmrD, which controls the activity of the PmrA-PmrB system at a posttranscriptional level (50). A model for activation of the PmrA-PmrB system by the PhoP-PhoQ system is described by Gunn et al., 1998 (Fig. 20) (40, 50). PhoQ serves as a magnesium sensor that modulates PhoP to activate the pmrD gene. The interaction between PhoP-PhoQ and PmrA-PmrB in Salmonella is a novel type of interaction between a pair of two-component systems, affording the bacteria physiological plasticity in response to a broad spectrum of environmental conditions (50). The ability of the FTL0552 mutant to retain polymyxin B resistance indicates that the gene does not function like PmrA of other bacteria. However, the bacterium was exposed to polymyxin B under normal growth conditions. Perhaps exposure to a high iron or low magnesium

PAGE 88

78 environment would render the FTL0552 mutant sensitive to polymyxin B, due to the loss of activation of genes involved in LPS modification and polymyxin B resistance. However, a mutant in this gene in F. tularensis subsp. novicida (FNU663.2) was found to be sensitive to antimicrobial killing by polymyxin B but apparently not through the typical mechanism of LPS modification (Mohapatra, Soni et al. 2007). This suggests that LVS FTL0552 and pmrA of F. tularensis subsp. novicida exhibit unique phenotypic properties and the stimuli responsible for activating FTL0552 remains uncharacterized.

PAGE 89

79 Figure 20. Model for the activation of the PmrA–PmrB two-component system by the PhoP–PhoQ two-component system. Transcription of PmrA-activated genes can be induced by growth in high iron independently of the PhoP–PhoQ two-component system (right) or by growth in low magnesium in a PhoP–PhoQ-dependent manner (left). During growth in low magnesium, the PhoP–PhoQ system promotes expression of the pmrD gene. The PmrD protein controls the activity of the PmrA–PmrB system at a posttranscriptional level. The seven-gene pbgP / E operon has also been designated the pmrF locus (adapted from Linda F.F. Kox, Marc M.S.M. Wsten, and Eduardo A. Groisman, 2000).

PAGE 90

80 The gene encoding the FTL0552 response-regulator appears to be present as the first gene of a cluster of five genes. The intergenic space between these genes is either extremely short or absent. Some of the genes overlap with the putative start codon for truB located inside the reading frame for rnc and the start codon for rnr is inside the reading frame for truB Thus, it is unlikely that promoter and transcription termination sequences for each or any of these five genes are located inside this putative operon. RT-PCR analysis revealed that FTL0552 is transcribed as a five-gene operon. The other genes included in this putative operon include signal peptidase I ( lepB ), ribonucleases (rnc and rnr ) and tRNA pseudouridine synthetase B ( truB ). The five-gene arrangement is conserved in Francisella tularensis subsp. holarctica OSU18 (NC008369), Francisella tularensis subsp. tularensis FSC 198 (NC008245), and Francisella tularensis subsp. tularensis Schu S4 (NC006570). While it may be possible that some of these genes (the ribonucleases) are involved in some aspect of gene regulation, it appears that they encode proteins with diverse functions. This unusual cluster of genes is suggestive of some type of recombination event early in the evolution of Francisella spp .. Interestingly, with the exception of FTL0552, the gene arrangement is conserved in Legionella spp.. A hallmark of F. tularensis infection is the bacterium’s ability to invade and replicate within host macrophages. Once adapted to the host target cells, the bacterium is able to vigorously multiply before the host can offer a protective immune response, and spread to various organs such as the liver and spleen (32, 34). The host-derived response to the rapidly multiplying bacteria, results in severe organ damage and is primarily responsible for the high mortality associated with F. tularensis LVS in mice and F.

PAGE 91

81 tularensis tularensis (Type A) in humans (34). Mutations in genes encoding bacterial proteins associated with intracellular growth have been shown to result in attenuation of F. tularensis LVS (32, 34). Our studies indicate that the FTL0552 mutant is defective in intracellular replication in macrophages. These findings are corroborated by the studies performed in the mouse model. The FTL0552 mutant is completely avirulent in the mouse model. When boosted, 40% of the BALB/c mice that had been infected with the FTL0552 mutant survived subsequent challenge with the highly virulent Schu S4 strain. Therefore, the FTL0552 mutant is not only highly attenuated in mice, but also retains its antigenic potential and provides partial protection against virulent Schu S4 challenge. The mutant exhibited reduced dissemination and decreased ability to induce histopathology in the target organ tissues. Mice infected with the FTL0552 mutant were able to clear the bacteria much more efficiently than mice infected with the parental LVS strain. Significantly lower numbers of bacteria disseminated to the spleen and were completely cleared by day 5. After intranasal infection with the mutant strain, the mice were able to completely clear the bacteria from the lung by day 7. The efficiency of clearance correlated with the reduced histopathology evident in the lung, liver and spleen of FTL0552 mutant infected mice, with the spleen appearing normal and no inflammatory changes observed. Although some lesions and inflammation were observed in the liver and lung, there were very few, small lesions in these organs which was dramatically different from the parental LVS strain infected mice.

PAGE 92

82 The mutant caused a reduced level of inflammatory cytokine production yet afforded partial protection to Schu S4 challenge. The low levels of acute phase inflammatory cytokines from the FTL0552 infected lungs correlated with the low level of organ damage seen. The increase in IL-12 indicates that a protective immune response was induced and is a very promising finding for developing a vaccine that is protective against F. tularensis Of note, treatment of mice with IL-12 has previously been shown to induce significant protection against the lethal respiratory tularemia (20). DNA microarray analysis identified 148 genes regulated by FTL0552 in F. tularensis LVS. Of the genes identified, 75% were activated by FTL0552 and 1/3 of the genes repressed by FTL0552 were hypothetical proteins. The genes that are up regulated by the FTL0552 mutant include pseudogenes, two transposases, and, interestingly, the gene encoding a type IV pili nucleotide-binding protein, pilT Among the 113 genes activated by FTL0552 are the intracellular growth locus genes found within the FPI, iglA iglB iglC and iglD These genes have been shown to be essential for infection and survival within macrophages (34, 54, 58, 65). In addition, FTL0552 was shown to activate genes encoding a macrophage infectivity potentiator, type IV pili fiber building block protein, the transport protein ( ampG ), the outer membrane protein ( fopA ), and the sodB gene. The type IV pili fiber building block protein is involved in the bacterium’s ability to attach and invade host cells and the loss of expression of this gene is likely to result in a defect in the bacteria’s ability to infect macrophages, as seen in the FTL0552 mutant. The sodB gene has been shown to play a role in virulence of F. tularensis LVS (6). F. tularensis LVS SodB mutants were attenuated for virulence in mice.

PAGE 93

83 The loss of expression of these genes is likely to play a role in the impaired intracellular survival and the attenuated virulence in mice observed by the FTL0552 mutant. The presence of orphaned members of TCS in Francisella tularensis represents a unique phenomenon of virulence regulation to allow for the survival and persistence of this bacterium within a variety of environments. The lack of the typical TCS arrangement could be the result of evolutionary changes and the presence of five insertion elements scattered throughout the genome (58). The genetic basis of F. tularensis pathogenesis is poorly understood and only beginning to be studied. The recent advancements in genetic tools to manipulate F. tularensis has offered the Francisella community opportunities for making specific mutations and studying the bacteria at the genetic level that has, until now, hindered the progression of research in this area, particularly for type A and type B strains. In summary, we have described a strain of F. tularensis LVS that is deleted for FTL0552 encoding a putative response-regulator. This mutant is defective for replication in macrophages and is avirulent in the mouse model. Although the phenotypic properties observed in the FTL0552 mutant are inconsistent with PhoP of other bacteria, it clearly plays a role in regulation of virulence genes in F. tularensis LVS. Perhaps, as an orphan response-regulator, FTL0552 works in trans with other regulatory proteins to exert its effect. Identification of a sensor histidine kinase responsible for the activation of FTL0552 could provide insight into the environmental signaling cues that modulate the activity of this gene. Two loci sharing homology with PhoQ were identified by searching

PAGE 94

84 the database with a derived PhoQ consensus sequence from other gram negative bacteria (FTL1762 and FTL1878). The genes are identified as a sensor histidine kinase ( qseA ) and a two-component sensor protein ( kdpD ). QseA is the quorum sensing Escherichia coli regulator A and KdpD is the sensor kinase in the two-component regulatory system, KdpD-KdpE, responsible for regulating intracellular K+ in E. coli Although most twocomponent sensor kinases are specific for activation of their cognate response-regulator, it is possible evolution has forced some bacteria to adapt by programming sensor kinases to respond to more than one environmental cue and act on more than one responseregulator to exert a coordinated response for survival. This could explain the inconsistencies with the phenotypic properties of FTL0552 and the lack of a typical cognate sensor kinase. Identifying the environmental cues leading to activation of FTL0552 will provide insight into the protein interaction leading to FTL0552 activation and modulation of virulence genes. Currently, the data presented supports the role of FTL0552 in regulation of virulence in F. tularensis LVS and provides an opportunity for investigation of the effects of an FTT1557c mutant in F. tularensis subsp. tularensis for evaluation as a possible vaccine candidate. Such a mutant may form the basis of a defined live attenuated vaccine that affords protection in humans against more virulent type A strains.

PAGE 95

85 Literature Cited 1. Abd, H., T. Johansson, I. Golovliov, G. Sandstrom, and M. Forsman. 2003. Survival and growth of Francisella tularensis in Acanthamoeba castellanii Appl Environ Microbiol 69: 600-6. 2. Aderem, A., and D. M. Underhill. 1999. Mechanisms of phagocytosis in macrophages. Annu Rev Immunol 17: 593-623. 3. Ancuta, P., T. Pedron, R. Girard, G. Sandstrom, and R. Chaby. 1996. Inability of the Francisella tularensis lipopolysaccharide to mimic or to antagonize the induction of cell activation by endotoxins. Infect Immun 64: 20416. 4. Anthony, L. D., R. D. Burke, and F. E. Nano. 1991. Growth of Francisella spp. in rodent macrophages. Infect Immun 59: 3291-6. 5. Anthony, L. S., and P. A. Kongshavn. 1987. Experimental murine tularemia caused by Francisella tularensis live vaccine strain: a model of acquired cellular resistance. Microb Pathog 2: 3-14. 6. Bakshi, C. S., M. Malik, K. Regan, J. A. Melendez, D. W. Metzger, V. M. Pavlov, and T. J. Sellati. 2006. Superoxide dismutase B gene (sodB)-deficient mutants of Francisella tularensis demonstrate hypersensitivity to oxidative stress and attenuated virulence. J Bacteriol 188: 6443-8. 7. Baron, G. S., and F. E. Nano. 1998. MglA and MglB are required for the intramacrophage growth of Francisella novicida Mol Microbiol 29: 247-59. 8. Berdal, B. P., R. Mehl, N. K. Meidell, A. M. Lorentzen-Styr, and O. Scheel. 1996. Field investigations of tularemia in Norway. FEMS Immunol Med Microbiol 13: 191-5. 9. Brotcke, A., D. S. Weiss, C. C. Kim, P. Chain, S. Malfatti, E. Garcia, and D. M. Monack. 2006. Identification of MglA-Regulated Genes Reveals Novel Virulence Factors in Francisella tularensis Infect Immun 74: 6642-55.

PAGE 96

86 10. Burke, D. S. 1977. Immunization against tularemia: analysis of the effectiveness of live Francisella tularensis vaccine in prevention of laboratory-acquired tularemia. J Infect Dis 135: 55-60. 11. Burrows, L. L. 2005. Weapons of mass retraction. Mol Microbiol 57: 878-88. 12. Chen, I., and D. Dubnau. 2003. DNA transport during transformation. Front Biosci 8: s544-56. 13. Cheng, Q., and J. T. Park. 2002. Substrate specificity of the AmpG permease required for recycling of cell wall anhydro-muropeptides. J Bacteriol 184: 6434-6. 14. Cherwonogrodzky, J. W., M. H. Knodel, and M. R. Spence. 1994. Increased encapsulation and virulence of Francisella tularensis live vaccine strain (LVS) by subculturing on synthetic medium. Vaccine 12: 773-5. 15. Cieslak, P. R., S. J. Noble, D. J. Maxson, L. C. Empey, O. Ravenholt, G. Legarza, J. Tuttle, M. P. Doyle, T. J. Barrett, J. G. Wells, A. M. McNamara, and P. M. Griffin. 1997. Hamburger-associated Escherichia coli O157:H7 infection in Las Vegas: a hidden epidemic. Am J Public Health 87: 176-80. 16. Clemens, D. L., B. Y. Lee, and M. A. Horwitz. 2005. Francisella tularensis enters macrophages via a novel process involving pseudopod loops. Infect Immun 73: 5892-902. 17. Clemens, D. L., B. Y. Lee, and M. A. Horwitz. 2004. Virulent and avirulent strains of Francisella tularensis prevent acidification and maturation of their phagosomes and escape into the cytoplasm in human macrophages. Infect Immun 72: 3204-17. 18. Cowley, S. C., S. V. Myltseva, and F. E. Nano. 1996. Phase variation in Francisella tularensis affecting intracellular growth, lipopolysaccharide antigenicity and nitric oxide production. Mol Microbiol 20: 867-74. 19. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12: 387-95. 20. Duckett, N. S., S. Olmos, D. M. Durrant, and D. W. Metzger. 2005. Intranasal interleukin-12 treatment for protection against respiratory infection with the Francisella tularensis live vaccine strain. Infect Immun 73: 2306-11. 21. Eigelsbach, H. T., and C. M. Downs. 1961. Prophylactic effectiveness of live and killed tularemia vaccines. I. Production of vaccine and evaluation in the white mouse and guinea pig. J Immunol 87: 415-25.

PAGE 97

87 22. Feng, D. F., and R. F. Doolittle. 1987. Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J Mol Evol 25: 351-60. 23. Finlay, B. B., and S. Falkow. 1989. Common themes in microbial pathogenicity. Microbiol Rev 53: 210-30. 24. Finlay, B. B., and S. Falkow. 1997. Common themes in microbial pathogenicity revisited. Microbiol Mol Biol Rev 61: 136-69. 25. Forslund, A. L., K. Kuoppa, K. Svensson, E. Salomonsson, A. Johansson, M. Bystrom, P. C. Oyston, S. L. Michell, R. W. Titball, L. Noppa, E. FrithzLindsten, M. Forsman, and A. Forsberg. 2006. Direct repeat-mediated deletion of a type IV pilin gene results in major virulence attenuation of Francisella tularensis Mol Microbiol 59: 1818-30. 26. Forsman, M., G. Sandstrom, and A. Sjostedt. 1994. Analysis of 16S ribosomal DNA sequences of Francisella strains and utilization for determination of the phylogeny of the genus and for identification of strains by PCR. Int J Syst Bacteriol 44: 38-46. 27. Fortier, A. H., S. J. Green, T. Polsinelli, T. R. Jones, R. M. Crawford, D. A. Leiby, K. L. Elkins, M. S. Meltzer, and C. A. Nacy. 1994. Life and death of an intracellular pathogen: Francisella tularensis and the macrophage. Immunol Ser 60: 349-61. 28. Fortier, A. H., D. A. Leiby, R. B. Narayanan, E. Asafoadjei, R. M. Crawford, C. A. Nacy, and M. S. Meltzer. 1995. Growth of Francisella tularensis LVS in macrophages: the acidic intracellular compartment provides essential iron required for growth. Infect Immun 63: 1478-83. 29. Fortier, A. H., M. V. Slayter, R. Ziemba, M. S. Meltzer, and C. A. Nacy. 1991. Live vaccine strain of Francisella tularensis : infection and immunity in mice. Infect Immun 59: 2922-8. 30. Fujita, O., M. Tatsumi, K. Tanabayashi, and A. Yamada. 2006. Development of a real-time PCR assay for detection and quantification of Francisella tularensis Jpn J Infect Dis 59: 46-51. 31. Gil, H., J. L. Benach, and D. G. Thanassi. 2004. Presence of pili on the surface of Francisella tularensis Infect Immun 72: 3042-7. 32. Golovliov, I., V. Baranov, Z. Krocova, H. Kovarova, and A. Sjostedt. 2003. An attenuated strain of the facultative intracellular bacterium Francisella tularensis can escape the phagosome of monocytic cells. Infect Immun 71: 594050.

PAGE 98

88 33. Golovliov, I., M. Ericsson, L. Akerblom, G. Sandstrom, A. Tarnvik, and A. Sjostedt. 1995. Adjuvanticity of ISCOMs incorporating a T cell-reactive lipoprotein of the facultative intracellular pathogen Francisella tularensis Vaccine 13: 261-7. 34. Golovliov, I., M. Ericsson, G. Sandstrom, A. Tarnvik, and A. Sjostedt. 1997. Identification of proteins of Francisella tularensis induced during growth in macrophages and cloning of the gene encoding a prominently induced 23kilodalton protein. Infect Immun 65: 2183-9. 35. Golovliov, I., A. Sjostedt, A. Mokrievich, and V. Pavlov. 2003. A method for allelic replacement in Francisella tularensis FEMS Microbiol Lett 222: 273-80. 36. Gray, C. G., S. C. Cowley, K. K. Cheung, and F. E. Nano. 2002. The identification of five genetic loci of Francisella novicida associated with intracellular growth. FEMS Microbiol Lett 215: 53-6. 37. Greenfield, R. A., D. A. Drevets, L. J. Machado, G. W. Voskuhl, P. Cornea, and M. S. Bronze. 2002. Bacterial pathogens as biological weapons and agents of bioterrorism. Am J Med Sci 323: 299-315. 38. Groisman, E. A. 2001. The pleiotropic two-component regulatory system PhoPPhoQ. J Bacteriol 183: 1835-42. 39. Groisman, E. A., J. Kayser, and F. C. Soncini. 1997. Regulation of polymyxin resistance and adaptation to low-Mg2+ environments. J Bacteriol 179: 7040-5. 40. Gunn, J. S., K. B. Lim, J. Krueger, K. Kim, L. Guo, M. Hackett, and S. I. Miller. 1998. PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance. Mol Microbiol 27: 1171-82. 41. Hamilton, H. L., K. J. Schwartz, and J. P. Dillard. 2001. Insertion-duplication mutagenesis of neisseria: use in characterization of DNA transfer genes in the gonococcal genetic island. J Bacteriol 183: 4718-26. 42. Harris, S. 1992. Japanese biological warfare research on humans: a case study of microbiology and ethics. Ann N Y Acad Sci 666: 21-52. 43. Hensel, M., and D. W. Holden. 1996. Molecular genetic approaches for the study of virulence in both pathogenic bacteria and fungi. Microbiology 142 ( Pt 5): 1049-58.

PAGE 99

89 44. Hollis, D. G., R. E. Weaver, A. G. Steigerwalt, J. D. Wenger, C. W. Moss, and D. J. Brenner. 1989. Francisella philomiragia comb. nov. (formerly Yersinia philomiragia ) and Francisella tularensis biogroup novicida (formerly Francisella novicida ) associated with human disease. J Clin Microbiol 27: 1601-8. 45. Johnson, C. R., J. Newcombe, S. Thorne, H. A. Borde, L. J. Eales-Reynolds, A. R. Gorringe, S. G. Funnell, and J. J. McFadden. 2001. Generation and characterization of a PhoP homologue mutant of Neisseria meningitidis Mol Microbiol 39: 1345-55. 46. Kieffer, T. L., S. Cowley, F. E. Nano, and K. L. Elkins. 2003. Francisella novicida LPS has greater immunobiological activity in mice than F. tularensis LPS, and contributes to F. novicida murine pathogenesis. Microbes Infect 5: 397403. 47. Kinnear, S. M., R. R. Marques, and N. H. Carbonetti. 2001. Differential regulation of Bvg-activated virulence factors plays a role in Bordetella pertussis pathogenicity. Infect Immun 69: 1983-93. 48. Knodler, L. A., J. Celli, and B. B. Finlay. 2001. Pathogenic trickery: deception of host cell processes. Nat Rev Mol Cell Biol 2: 578-88. 49. Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop, 2nd, and K. M. Peterson. 1995. Four new derivatives of the broad-hostrange cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166: 175-6. 50. Kox, L. F., M. M. Wosten, and E. A. Groisman. 2000. A small protein that mediates the activation of a two-component system by another two-component system. Embo J 19: 1861-72. 51. Lai, X. H., I. Golovliov, and A. Sjostedt. 2004. Expression of IglC is necessary for intracellular growth and induction of apoptosis in murine macrophages by Francisella tularensis. Microb Pathog 37: 225-30. 52. Larsson, P., P. C. Oyston, P. Chain, M. C. Chu, M. Duffield, H. H. Fuxelius, E. Garcia, G. Halltorp, D. Johansson, K. E. Isherwood, P. D. Karp, E. Larsson, Y. Liu, S. Michell, J. Prior, R. Prior, S. Malfatti, A. Sjostedt, K. Svensson, N. Thompson, L. Vergez, J. K. Wagg, B. W. Wren, L. E. Lindler, S. G. Andersson, M. Forsman, and R. W. Titball. 2005. The complete genome sequence of Francisella tularensis the causative agent of tularemia. Nat Genet 37: 153-9.

PAGE 100

90 53. Lauriano, C. M., J. R. Barker, F. E. Nano, B. P. Arulanandam, and K. E. Klose. 2003. Allelic exchange in Francisella tularensis using PCR products. FEMS Microbiol Lett 229: 195-202. 54. Lauriano, C. M., J. R. Barker, S. S. Yoon, F. E. Nano, B. P. Arulanandam, D. J. Hassett, and K. E. Klose. 2004. MglA regulates transcription of virulence factors necessary for Francisella tularensis intraamoebae and intramacrophage survival. Proc Natl Acad Sci U S A 101: 4246-9. 55. Lejona, S., A. Aguirre, M. L. Cabeza, E. Garcia Vescovi, and F. C. Soncini. 2003. Molecular characterization of the Mg2+-responsive PhoP-PhoQ regulon in Salmonella enterica J Bacteriol 185: 6287-94. 56. Maier, T. M., A. Havig, M. Casey, F. E. Nano, D. W. Frank, and T. C. Zahrt. 2004. Construction and characterization of a highly efficient Francisella shuttle plasmid. Appl Environ Microbiol 70: 7511-9. 57. McCrumb, F. R. 1961. Aerosol Infection of Man with Pasteurella Tularensis Bacteriol Rev 25: 262-7. 58. McLendon, M. K., M. A. Apicella, and L. A. Allen. 2006. Francisella tularensis : Taxonomy, Genetics, and Immunopathogenesis of a Potential Agent of Biowarfare. Annu Rev Microbiol. 59. Mekalanos, J. J. 1992. Environmental signals contro lling expression of virulence determinants in bacteria. J Bacteriol 174: 1-7. 60. Michell, S., K. F. Griffin, and R. W. Titball. 2006. Tularemia Pathogenesis and Immunity, p. 121-138. In B. Anderson, H. Friedman, and M. Bendinelli (ed.), Microorganisms and Bioterrorism. Springer, New York. 61. Miller, S. I. 1991. PhoP/PhoQ: macrophage-specific modulators of Salmonella virulence? Mol Microbiol 5: 2073-8. 62. Miller, S. I., and J. J. Mekalanos. 1990. Constitutive expression of the phoP regulon attenuates Salmonella v irulence and survival within macrophages. J Bacteriol 172: 2485-90. 63. Mohapatra, N. P., S. Soni, B. L. Bell, R. Warren, R. K. Ernst, A. Muszynski, R. W. Carlson, and J. S. Gunn. 2007. Identification of an Orphan Response Regulator Required for the Virulence of Francisella spp. and Transcription of Pathogenicity Island Genes. Infect Immun 75: 3305-14.

PAGE 101

91 64. Moss, J. E., P. E. Fisher, B. Vick, E. A. Groisman, and A. Zychlinsky. 2000. The regulatory protein PhoP controls susceptibility to the host inflammatory response in Shigella flexneri Cell Microbiol 2: 443-52. 65. Nano, F. E., N. Zhang, S. C. Cowley, K. E. Klose, K. K. Cheung, M. J. Roberts, J. S. Ludu, G. W. Letendre, A. I. Meierovics, G. Stephens, and K. L. Elkins. 2004. A Francisella tularensis pathogenicity island required for intramacrophage growth. J Bacteriol 186: 6430-6. 66. Newcombe, J., L. J. Eales-Reynolds, L. Wootton, A. R. Gorringe, S. G. Funnell, S. C. Taylor, and J. J. McFadden. 2004. Infection with an avirulent phoP mutant of Neisseria meningitidis confers broad cross-reactive immunity. Infect Immun 72: 338-44. 67. Nudleman, E., and D. Kaiser. 2004. Pu lling together with type IV pili. J Mol Microbiol Biotechnol 7: 52-62. 68. Oyston, P. C., N. Dorrell, K. Williams, S. R. Li, M. Green, R. W. Titball, and B. W. Wren. 2000. The response regulator PhoP is important for survival under conditions of macrophage-induced stress and virulence in Yersinia pestis Infect Immun 68: 3419-25. 69. Perez, E., S. Samper, Y. Bordas, C. Guilhot, B. Gicquel, and C. Martin. 2001. An essential role for phoP in Mycobacterium tuberculosis virulence. Mol Microbiol 41: 179-87. 70. Rohmer, L., M. Brittnacher, K. Svensson, D. Buckley, E. Haugen, Y. Zhou, J. Chang, R. Levy, H. Hayden, M. Forsman, M. Olson, A. Johansson, R. Kaul, and S. I. Miller. 2006. Potential source of Francisella tularensis live vaccine strain attenuation determined by genome comparison. Infect Immun. 71. Sandstrom, G. 1994. The tularemia vaccine. J Chem Tech Biotech 59: 315-320. 72. Sandstrom, G., S. Lofgren, and A. Tarnvik. 1988. A capsule-deficient mutant of Francisella tularensis LVS exhibits enhanced sensitivity to killing by serum but diminished sensitivity to killing by polymorphonuclear leukocytes. Infect Immun 56: 1194-202. 73. Santic, M., M. Molmeret, K. E. Klose, and Y. Abu Kwaik. 2006. Francisella tularensis travels a novel, twisted road within macrophages. Trends Microbiol 14: 37-44.

PAGE 102

92 74. Santic, M., M. Molmeret, K. E. Klose, S. Jones, and Y. A. Kwaik. 2005. The Francisella tularensis pathogenicity island protein IglC and its regulator MglA are essential for modulating phagosome biogenesis and subsequent bacterial escape into the cytoplasm. Cell Microbiol 7: 969-79. 75. Saslaw, S., H. T. Eigelsbach, J. A. Prior, H. E. Wilson, and S. Carhart. 1961. Tularemia vaccine study. II. Respiratory challenge. Arch Intern Med 107: 702-14. 76. Saslaw, S., H. T. Eigelsbach, H. E. Wilson, J. A. Prior, and S. Carhart. 1961. Tularemia vaccine study. I. Intracutaneous challenge. Arch Intern Med 107: 689701. 77. Sjostedt, A. 2006. Intracellular survival mechanisms of Francisella tularensis a stealth pathogen. Microbes Infect 8: 561-7. 78. Sjostedt, A. 2003. Virulence determinants and protective antigens of Francisella tularensis. Curr Opin Microbiol 6: 66-71. 79. Soncini, F. C., E. Garcia Vescovi, F. Solomon, and E. A. Groisman. 1996. Molecular basis of the magnesium deprivation response in Salmonella typhimurium : identification of PhoP-regulated genes. J Bacteriol 178: 5092-9. 80. Song, J. H., K. S. Ko, J. Y. Lee, J. Y. Baek, W. S. Oh, H. S. Yoon, J. Y. Jeong, and J. Chun. 2005. Identification of essential genes in Streptococcus pneumoniae by allelic replacement mutagenesis. Mol Cells 19: 365-74. 81. Stock, A. M., and J. Guhaniyogi. 2006. A new perspective on response regulator activation. J Bacteriol 188: 7328-30. 82. Stock, A. M., V. L. Robinson, and P. N. Goudreau. 2000. Two-component signal transduction. Annu Rev Biochem 69: 183-215. 83. Tarnvik, A. 1989. Nature of protective immunity to Francisella tularensis Rev Infect Dis 11: 440-51. 84. Tarnvik, A., M. Eriksson, G. Sandstrom, and A. Sjostedt. 1992. Francisella tularensis-a model for studies of the immune response to intracellular bacteria in man. Immunology 76: 349-54. 85. Telepnev, M., I. Golovliov, T. Grundstrom, A. Tarnvik, and A. Sjostedt. 2003. Francisella tularensis inhibits Toll-like receptor-mediated activation of intracellular signalling and secretion of TNF-alpha and IL-1 from murine macrophages. Cell Microbiol 5: 41-51.

PAGE 103

93 86. Thomas, R., A. Johansson, B. Neeson, K. Isherwood, A. Sjostedt, J. Ellis, and R. W. Titball. 2003. Discrimination of human pathogenic subspecies of Francisella tularensis by using restriction fragment length polymorphism. J Clin Microbiol 41: 50-7. 87. Titball, R. W., A. Johansson, and M. Forsman. 2003. Will the enigma of Francisella tularensis virulence soon be solved? Trends Microbiol 11: 118-23. 88. Tu, X., T. Latifi, A. Bougdour, S. Gottesman, and E. A. Groisman. 2006. The PhoP/PhoQ two-component system stabilizes the alternative sigma factor RpoS in Salmonella enterica. Proc Natl Acad Sci U S A 103: 13503-8. 89. Twine, S., M. Bystrom, W. Chen, M. Forsman, I. Golovliov, A. Johansson, J. Kelly, H. Lindgren, K. Svensson, C. Zingmark, W. Conlan, and A. Sjostedt. 2005. A mutant of Francisella tularensis strain SCHU S4 lacking the ability to express a 58-kilodalton protein is attenuated for virulence and is an effective live vaccine. Infect Immun 73: 8345-52. 90. Vinogradov, E., and M. B. Perry. 2004. Characterisation of the core part of the lipopolysaccharide O-antigen of Francisella novicida (U112). Carbohydr Res 339: 1643-8. 91. Walters, S. B., E. Dubnau, I. Kolesnikova, F. Laval, M. Daffe, and I. Smith. 2006. The Mycobacterium tuberculosis PhoPR two-component system regulates genes essential for virulence and complex lipid biosynthesis. Mol Microbiol 60: 312-30. 92. Wosten, M. M., L. F. Kox, S. Chamnongpol, F. C. Soncini, and E. A. Groisman. 2000. A signal transduction system that responds to extracellular iron. Cell 103: 113-25.

PAGE 104

About the Author Wendy Sammons received a Bachelor’s Degree in Medical Technology and a commission as a 2nd Lieutenant in the United States Army through the Reserve Officer Training Corps (ROTC) from Salisbury University in 1994. Over a period of 13 years, she served numerous tours within and outside the continental United States as a Clinical Laboratory Officer. She entered the Ph.D. program at the University of South Florida in 2003, funded by the U. S. Army Long Term Health Education and Training (LTHET) program. While in the Ph.D. program at the University of South Florida, Wendy presented a poster at the Colleges of Medicine’s Annual Research Day and was awarded the outstanding poster presentation in the field of Allergy, Immunology and Infectious Diseases. Wendy made poster presentations at the Association of Microbiology Biodefense meeting and the Signature Interdisciplinary Program in Allergy, Immunology and Infectious Disease symposium.