USF Libraries
USF Digital Collections

Role of protein kinase C-iota in prostate cancer

MISSING IMAGE

Material Information

Title:
Role of protein kinase C-iota in prostate cancer
Physical Description:
Book
Language:
English
Creator:
Win, Hla Yee
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla.
Publication Date:

Subjects

Subjects / Keywords:
Small interfering RNA
Cell cycle
Apoptosis
Cell survival
Phosphorylation
Dissertations, Academic -- Chemistry -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Prostate cancer is one of the leading causes of death among males in the United States. In this study, we hypothesized that an activated PKC-ι-dependent anti-apoptotic pathway, drives the cell cycle proliferation and survival of prostate cancer cells. We investigated the role of atypical PKC-iota (PKC-ι) in androgen- independent prostate DU-145 carcinoma, androgen-dependent prostate LNCaP carcinoma compared to transformed non-malignant prostate RWPE-1 cells. Western blotting and immunoprecipitations demonstrated that PKC-ι is associated with cyclin-dependent activating kinase (CAK/Cdk7) in androgen-dependent, RWPE-1 and LNCaP cells but not in androgen-independent DU-145 cells. Treatment of prostate RWPE-1 cells with PKC-ι silencing RNA (siRNA) decreased cell proliferation, cell cycle accumulation at G₂/M phase and decreased phosphorylation of Cdk7 and cdk2.In addition, PKC-ι siRNA treatment provoked a decrease in phosphorylation of Bad and increased Bad/Bcl-xL heterodimerization, leading to cell apoptosis. In DU-145 cells, PKC-ι is anti-apoptotic and still required for cell survival. Treatment with PKC-ι siRNA blocked an increase in cell number, and inhibited G₁/S transition. In addition to cell cycle arrest, both RWPE-1 cells and DU-145 cells underwent apoptosis via mitochondria dysfunction and activating apoptosis cascades such as release of cytochrome c, activation of caspase-7, and poly-(ADP-ribose) polymerase (PARP) cleavage. Mechanistic pathways involving aPKCs in the NF-κB survival pathway were established using pro-inflammatory cytokine, tumor necrosis factor alpha (TNFα). Results demonstrated that RWPE-1 cells and DU-145 cells are insensitive to TNFα whereas LNCaP cells are sensitive to TNFα treatment and undergo apoptosis.In DU-145 cells, TNFα induced PKC-ι activation of IκB kinase, IKKα/β, while in RWPE-1 cells, PKC-ζ activates IKKα/β. Both RWPE-1 and DU-145 show degradation of IκBα allowing NF-κB/p65 translocation to the nucleus. In LNCaP cells, the upstream kinase activation IKKα/β was not observed, although there have been reports that LNCaP cells weakly activate IKKα and have NF-κB activation. In vivo kinase assay demonstrates that PKC-ι is the substrate of IKKκ/β. A putative PKC-ι inhibitor (ICA-1) inhibited activation of IKKα/β in vivo. Hence, PKC-ι is an antiapoptotic protein and this suggests that anti-PKC-ι therapy may be a viable option for prostate carcinoma cells.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
Statement of Responsibility:
by Hla Yee Win.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 154 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001970450
oclc - 276429266
usfldc doi - E14-SFE0002322
usfldc handle - e14.2322
System ID:
SFS0026640:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Role of Protein Kinase C-iota in Prostate Cancer by Hla Yee Win A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Chemistry College of Arts and Sciences University of South Florida Co-Major Professor: Mildred Acevedo-Duncan, Ph.D. Co-Major Professor: Robert Potter, Ph.D. Denise Cooper, Ph.D. Alfredo Cardenas, Ph.D. Mark McLaughlin, Ph.D. David Merkler, Ph.D. Date of Approval February 5, 2008 Keywords: small interfering RNA, cell cycle apoptosis, cell survival, phosphorylation Copyright 2008, Hla Yee Win

PAGE 2

This work is dedicated to my loving parents U Ba Thann Win and Daw Tin Yee and to my brothers and sisters.

PAGE 3

i Table of Contents List of Tables iv List of Figures v List of Acronyms vii Abstract x Chapter 1 Protein Kinase C 1 1.0 Introduction 1 1.1 PKC isoforms and their structural domains 2 1.1.1 Conventional PKCs (cPKCs) 2 1.1.2 Novel PKC (nPKCs) 7 1.1.3 Atypical PKC (aPKCs) 7 1.2 Regulation of PKC 9 1.2.1 Regulation by autophosphorylation 9 1.2.2 Regulation by membrane interaction and anchoring protein 9 1.2.3 Downregulation of PKC 13 1.2.4 Singnificant of PKC 13 1.3 References 14 Chapter 2 Prostate Cancer 19 2.0 Introduction 19 2.1 Prostate cancer cell lines and general characteristics 21 2.1.1 Androgen-dependent LNCaP cells 21 2.1.2 Androgen-independent DU-145 cells and PC-3 cells 21 2.1.3 Transformed non-malignant RWPE-1 cells 22 2.2 Cell-cycle and proliferation 24 2.2.1 Overview of cell cycle 24 2.3 Signal Transduction: PKC signaling in cancer cells 29 2.3.1 Targeting PKC in prostate cancer 30 2.4 References 31 Chapter 3 Role of PKCin prostate cell cycle and proliferation 39 3.0 Introduction 39 3.1 Materials and methods 40 3.1.1 Reagents and antibodies 40 3.1.2 Cell Culture 41 3.1.3 Trypan blue dye exclusion assay 41 3.1.4 Cell cyle analysis by flow cytometry 42 3.1.5 Electrophoresis and western blotting 42 3.1.6 Statistics 43 3.2 Results 43 3.2.1 Doubling time for RWPE-1, LNCaP and DU-145 cells 43 3.2.2 PKCexpression in dividing cells and arresting cells 44 3.2.3 PKC isoforms in RWPE-1, LNCaP and DU-145 cells 44 3.3 Discussion 51

PAGE 4

ii 3.4 References 53 Chapter 4 Involvement of cyclin-dependent kinases (cdks) in cell proliferation 58 4.0 Introduction 58 4.1 Cdk in transcription and activation by phosphorylation 61 4.2 Cdk inhibition by subunits and phosphorylation 61 4.3 Materials and methods 65 4.3.1 Immunoprecipitation and western blot analysis 65 4.4 Results 66 4.4.1 Associaiton of PKCand cdk7 in RWPE-1 cell proliferation 66 4.4.2 Assocaiton of PKCand cdk7 in LNCaP cell proliferaition 66 4.5 Discussion 69 4.6 References 70 Chapter 5 Effects of PKCsilenceing RNA on cell proliferation in prostate cells 74 5.1 Introduction 74 5.2 RNAi mechanism 74 5.3 Matrials and methods 77 5.3.1 Inhibition of gene expression with siRNA 77 5.3.2 Western blot analysis 78 5.3.3 Cell cycle analysis by flow cytometry 78 5.4 Results 79 5.4.1 Effects of PKCsilencing RNA on cell proliferation in RWPE-1 cells, LNCaP cells and DU-145 cells 79 5.4.2 Effects of PKCand PKCsilencing RNAs on cell proliferation in RWPE-1 cells and DU-145 cells 80 5.4.3 Effects of PKCsiRNA on cell cycle 81 5.5 Discussion 89 5.6 References 92 Chapter 6 Cell apoptosis 96 6.0 Introduction 96 6.1 Apoptosis 98 6.1.1 Death receptors 98 6.1.2 Involvement of Bcl-2 family members in apoptosis 99 6.2 Post-translational modifications determine active/inactive conformations 99 6.3 Other apoptosis signals 100 6.4 Materials and methods 104 6.4.1 Inhibition of gene expresiion with siRNA 104 6.4.2 Antibodies 104 6.4.3 Immunoprecipitation and western blotting 105 6.5 Results 105 6.5.1 Treatment with PKCsiRNAs to RWPE-1 cells and DU-145 cells leads to DNA damage 105 6.5.2 PKCsiRNAs treatment activates apop otosis cascades in RWPE-1 and DU-145 cells 106 6.5.3 Effects of PKCsiRNA on LNCaP cells 107 6.5.4 Effects of PKCsiRNA on RWPE-1 cdk7 and cdk2 107 6.5.5 PKCsiRNA effects of phosphorylation status of Bad and Bad/Bcl-xL heterodimerization 107 6.6 Discussion 114 6.7 References 117

PAGE 5

iiiChapter 7 Atypical PKCs activates NF-kappa B pathway in prostate cells 124 7.0 Introduction 124 7.1 NFB signal transduction cascade 124 7.2 IKK activation 125 7.3 Materials and methods 129 7.3.1 Reagents and Antibodies 129 7.3.2 Cell culture 129 7.3.3 TNF treatment 130 7.3.4 Immunoprecipitation and western blot analysis 130 7.3.5 Preparation of cytosol and nuclear extracts 130 7.3.6 Kinase assay 130 7.3.7 Prostate tissue analysis 131 7.4 Results 132 7.4.1 Susceptibility of RWPE-1, LNCaP and DU-145 cells to TNF treatment 132 7.4.2 Involvement of aPKCs in activation of IKK 132 7.4.3 Translocation of p65 from cytosol to nucleus in DU-145 cells 134 7.4.4 TNF induces apoptosis in LNCaP cells 134 7.4.5 In vivo kinase assay and ICA-1 effects 134 7.4.6 PKCis overexpressed in PIN and tumor tissues 135 7.5 Discussion 145 7.6 Conclusion and futher directions 148 7.7 References 149 About the Author End Page

PAGE 6

iv List of Tables Table 1 PKC family and their expression in tissue types 8 Table 2 Selected regulatory proteins that are the products of potential oncogenes, and their functions 28 Table 3 Summary of Cell Cycle Phases for RWPE-1 cells, LNCaP cells and DU-145 cells 48 Table 4 Cdks and cycling partner in cell cycle 59 Table 5 Summary of non-malignant prosta te, RWPE-1cell cycle after treatment with control siRNA and PKCsiRNA at indicated times 88 Table 6 Summary of androgen-independent prostate carcinoma, DU145, cell cycle phases after treatment with control siRNA and PKCsiRNA at indicated time 88 Table 7 Summary of NFB activation in prostate cells 144

PAGE 7

v List of Figures Figure 1.1 The family members of protei n kinase C isoforms and their major structural domains 3 Figure 1.2 Structural domains of C1 with phorbol ester binding site 5 Figure 1.3 Interaction of C2 domain with lipid membrane 6 Figure 1.4 Alignment of activation loop, tu rn motif and hydrophobic sites of PKCs, Akt, PKA and S6K 12 Figure 1.5 Specific phosphorylatio n events of conventional, novel, and atypical PKCs 20 Figure 2.1 From ACS: Illustration of ma le reproductive system and prostate gland 23 Figure 2.2 Photographs of prostate cells 23 Figure 2.3 The cell cycle 24 Figure 2.4 Major events in mitosis 25 Figure 2.5 Normal cell proliferation compared to unrestrained cell proliferation caused by an oncogene 27 Figure 3.1 Doubling time for RWPE-1 ce lls, LNCaP cells and DU-145 cells 46 Figure 3.2 Effect of cell density and cell cycle progression in RWPE-1 cells, LNCaP cells and DU-145 cells 47 Figure 3.3 Randomly selected PKC isoforms in 50% confulent and 100% confulent prostate cells 49 Figure 3.4 PKC isoforms in RWPE-1cells, LNCaP cells and DU145 cells 50 Figure 4.1 Cyclin and cdk complexe s control cell cycle regulation 60 Figure 4.2 Schematic illustration of cdk in transcription and phosphorylation in cell cycle control 63 Figure 4.3 Schematic representation of cell proliferation pathway 64 Figure 4.4 Association of PKCwith cdk7 in RWPE-1 cells 67 Figure 4.5 Association of PKCwith Cdk7 in LNCaP cells 68 Figure 5.1 The mechanism of RNA interference (RNAi) 76

PAGE 8

viFigure 5.2 Effect of PKCsiRNA on prostate cells 82 Figure 5.3 Immunoblot of PKCs in siRNA treated cells 83 Figure 5.4 Effects of PKCand PKCsiRNA treatment on RWPE-1 cells and DU-145 cells 84 Figure 5.5 Effects of PKCsiRNA on the RWPE-1 cell cycle 86 Figure 5.6 Effects of PKCsiRNA DU-145 cell cycle 87 Figure 6.1 Scheme illustrating morphological c hanges during apoptosis and necrosis 97 Figure 6.2 Model of apoptotic and survival signaling pathways involving the Bcl-2 members 102 Figure 6.3 Summary of anti-apoptotic and pro-apoptotic Bcl-2 members 103 Figure 6.4 RWPE-1 cells, LNCaP cells and DU-145 undergo apoptosis after treatment with PKCsiRNA 109 Figure 6.5 PKC-i siRNA induces apoptosis 110 Figure 6.6 Effects of PKCsiRNA on LNCaP cells 111 Figure 6.7 Effects of PKCon cdk7 and cdk2 activity 112 Figure 6.8 Effects of PKCsiRNA on Bad phosphorylation and Bad/Bcl-xL heterodimerization 113 Figure 7.1 Schematic representations of NFB, I B and IKK proteins family 126 Figure 7.2 Classical and alternative pathways of NFB activation 127 Figure 7.3 Activation of aPKCs by cytokines 128 Figure 7.4 Effects of TNF treatment on prostate cells 136 Figure 7.5 TNF treatment induces I B degradation 137 Figure 7.6 Role of PKCin activation of IKK 138 Figure 7.7 PKCactivates IKK in DU-145 cells 139 Figure 7.8 Translocation of I B from cytosol to the nucleus 140 Figure 7.9 Treatment of TNF induces apoptosis in LNCaP cells 141 Figure 7.10 In vivo kinase assay and the effects of ICA-1 treatment on RWPE-1 and DU-145 cells. 142 Figure 7.11 PKCexpression in prostate tissues 143

PAGE 9

vii List of Acronyms Akt protein kinase B aPKC atypical PKC AR androgen receptor Asp aspartate Bad pro-apoptotic “BH3-only” domain Bcl-2 anti-apoptotic protein Bcl-xL anti-apoptotic protein Ca2+ calcium CAK cdk7-activating kinase Cdk cyclin dependent kinase CNS central nervous system CRD cycsitne-rich domain CSF cerebral spinal fluid DAG diacylglycerol DD death domain DED death effctor domain DNA deoxyribonucleic acid DRE digital rectal examination DU-145 androgen-independent prostate carcinoma EGF epidermal growth factor FADD fas-associated DD protein G/S/M cell cycle phases: gap phase, DNA synthesis, and mitosis HPV-18 human papiloma virus IgG immunoglobulin G

PAGE 10

viiiIKK IkappaB kinase IL-1 interleukin 1 IP immunopreicipitation I B IkappaB alpha kDa kilo Dalton LNCaP androgen-dependent prostate carcinoma MAP mitogen-activated protein kinase MAT1 menage a trois-1 MyD88 functional analogue of TRADD NFB nuclear factor-kappa B NIK NFB-inducing kinase nM nanomolar NSCLC non-small Cell Lung Cancer PARP poly (ADP-ribose) polymerase PC-3 andrgen-independent prostate carcinoma PDGF platelet-derived growth factor PDK1 3-Phosphoinositide–dependent protein kinase 1 PIP3 phosphatidylinositol (3,4,5)-trisphosphate PKA protein kinase A PKC protein kinase C PMA 12-myristate-13-acetate PS phostidylserine PSA prostate-specific antigen Rb retinoblastoma RIP receptor interacting protein RNA ribonucleic acid

PAGE 11

ixRWPE-1 taransformed non-maglingnant prostate cells Ser serine siRNA silencing RNA tBID truncated pro-apoptotic “BH3-only” domain TGF transformation growth factorThr threonine TNFR tumor necrosis factor receptor TNF Tumor Necrosis Factor-alpha TPA 12-O-tetradecanoylphorbol-13-acetate TRADD TNFR-1-associating-death-domain TRAIL-R1 TNF-related apoptosis-inducing ligand WB western blot g microgram

PAGE 12

x Role of PKC-iota in Prostate Cancer Hla Y. Win ABSTRACT Prostate cancer is one of the leading causes of death among males in the United States. In this study, we hypothesized that an activa ted PKC-iota-dependent anti-apoptotic pathway, drives the cell cycle proliferation and survival of prostate cancer cells. We investigated the role of atypical PKC-iota (PKC) in androgenindependent prostate DU-145 carcinoma, androgen-dependent prostate LNCaP carcinoma compared to transformed non-malignant prostate RWPE-1 cells. Wester n blotting and immunoprecipitations demonstrated that PKCis associated with cyclin-dependent activating kinase (CAK/Cdk7) in androgendependent, RWPE-1 and LNCaP cells but not in androgen-independent DU-145 cells. Treatment of prostate RWPE-1 cells with PKCsilencing RNA (siRNA) decreased cell proliferation, cell cycle accumulation at G2/M phase and decreased phosphorylation of Cdk7 and cdk2. In addition, PKCsiRNA treatment provoked a decrease in pho sphorylation of Bad and increased Bad/Bcl-xL heterodimerization, leading to cell apoptosis. In DU-145 cells, PKCis anti-apoptotic and still required for cell survival. Treatment with PKCsiRNA blocked an increase in cell number, and inhibited G1/S transition. In addition to cell cycle arrest, both RWPE-1 cells and DU-145 cells underwent apoptosis via mitochondria dysfunction and activating apoptosis cascades such as release of cytochrome c, activation of caspase-7, and poly-(ADP-ribose ) polymerase (PARP) cleavage. Mechanistic pathways involving aPKCs in the NFB survival pathway were established using pro-inflammatory cytokine, tumor necrosis factor alpha (TNF ). Results demonstrated that RWPE-1 cells and DU-145 cells are insensitive to TNF whereas LNCaP cells are sensitive to TNF treatment and undergo apoptosis. In DU-145 cells, TNF induced PKCactivation of I B

PAGE 13

xikinase, IKK while in RWPE-1 cells, PKCactivates IKK Both RWPE-1 and DU-145 show degradation of I B allowing NFB/p65 translocation to the nucleus. In LNCaP cells, the upstream kinase activation IKK was not observed, although th ere have been reports that LNCaP cells weakly activate IKK and have NFB activation. In vivo kinase assay demonstrates that PKCis the substrate of IKK A putative PKCinhibitor (ICA-1) inhibited activation of IKK in vivo Hence, PKCis an antiapoptotic protein and this suggests that anti-PKCtherapy may be a viable option for prostate carcinoma cells.

PAGE 14

1 Chapter 1 Protein Kinase C 1.0 Introduction Kinases are enzymes that add phosphates to small molecules or other proteins creating active signaling molecules. Activation and deactivation of kinases changes their internal biochemistry in response to signals from the out side. One class of these kinases is protein kinase C (PKC). PKC is a family of serine-ther onine kinases that control many cellular processes such as proliferation, differentiation, immune response, transcriptional regulation, synaptic transmission, learning and memory [1, 2, 3]. Yasutomi Nishizuka and co-workers discovered PKC in early 1970s. They called it protei n kinase C because of activation by the Ca2+-dependent protease and calpain. All PKCs enzymes are dependent on anionic phospholipids, in particular phosphatidylserine (PS) [4]. There are twelve members of PKC and they are divided into three subgroups; conventional, novel, and atypic al PKCs. Classical PKCs include, PKC, , and Novel PKCs are PKC, , and Atypical PKCs includes PKC, and 5, 6]. All PKCs have N-terminal regulatory domain and C-termi nal catalytic domain also known as kinase domain (Figure 1.1, Table 1). The regulatory domain of the enzyme (2030 kDa) contains a pseudosubstrate, which binds to a substrates binding cavity of the cataly tic protion and acts as an autoinhibitory module. The regulatory domain consists of C1 and C2 that have high anffinity for membrane interaction. Diacylglycerol (DAG) enhances PKCs to recruite to the membrane. DAG interacts with C1 domain enhancing PKCs enchoring to the membrane. The kinase domain is approximately 45 kDa, and contains serine-theronine residues t hat are phosphorylated for the kinase to be catalytically competent [4]. Calssical PKC can be activated by combination of Ca2+, diacylglycerol (DAG), and phospholipds [5-7].

PAGE 15

21.1 PKC isoforms and their structural domains 1.1.1 Conventional PKCs (cPKCs) Conventional PKCs or classical PKCs ( 77 kDa) consists of PKC, and They were first identified by Parker PJ et al (1986) in bovine brain [8, 9]. They have a pseudosubstrate motif, phorbol ester binding sites (C1), and Ca2+ binding site at C2 region (Figure 1.2A, B) [4]. In addition, both C1 and C2 domains can interact with membrane. The pseudosubstrate is a molecular switch that activate s PKC isoforms. It occupies the active site on the kinase domain which allows phosphorylation of key residues such as serine or threonine. The pseudosubstrate requires a specific regulator to remove it from the active site to allow substrate access. Therefore, the pseudosubstrate is extremely proteolytically labile when PKC is active and resistant to proteolysis wh en the enzyme is inactive [10-13]. The regulatory C1 domain has been determined using X-ray crystallography and nuclear magnetic resonance spectroscopy (NMR) [14-23]. It is a membrane targeting module with compact / structural units of about 50 amino acids t hat tightly bind two zinc ions and DAG [1418]. In addtion, cPKCs have two “cystein-rich dom ains” (CRD) or “zinc-fingers” domains in C1 region [20-21].

PAGE 16

3 Protein Kinase C Isoforms Structural Domains Figure 1.1 The family members of protein kinase C isof orms and their major structural domains. Conventional PKCs are activated by Ca2+, DAG, and PS. Novel PKCs are activated by DAG and PS, while atypical PKCs are activated by lipid s and calpain [4]. C1A and C1B (red) represents phorbol ester and phospho lipid binding sites, and calcium bind to C2 domain (yellow). The kinase domain is represented in blue bar.

PAGE 17

4The C2 domain is also a membrane targeting module which requires calcium (Ca2+) binding. The C2 domain contains about 130 amino acids and it is involved in intracellular signaling and membrane trafficking. Structural elucidation from both the crystal structure and NMR solution reveals a -sheet-rich domain with Ca2+ binding pocket [5, 24-29]. It has also been shown that in the classical PKCisozymes, Ca2+ binding to membranes leads to a high specificity for PS. The mechanisms involved in the membrane interactions with the C2 domain remain unclear. Structural basis for lipids and Ca2+ cooperation in PKCs are also not well understood. However, mutational studies throughout C2 domains showed that it docks to membrane and forms a “jaw” (Figure 1.3) and that aspartate is required for Ca2+ coordination and for membrane docking [30-32]. The kinase domain is approximately 45 kDa and it is 40% identical to protein kinase A (PKA) and highly homologus to Akt kinase (protein ki nase B). Kinase activity is regulated by two independent mechanisms: first is the phosphoryl ation of PKC on serine and threonine residues, which make PKC catalytically competent; second is the removal of pseudosubstrate from the acitive site. Regulation by phosphorylation is further discussed in section 1.2 [4, 33-34].

PAGE 18

5 Figure 1.2 Structural domains of C1 with phorbol ester binding site (A) and C2 domain with calcium binding site (B) on PKC [4].

PAGE 19

6 Figure 1.3 Interaction of C2 domain with lipid membrane [30].

PAGE 20

71.1.2 Novel PKC (nPKCs) Following the discovery of PKC by Nishiz uka, other researchers screened for nPKCs such as PKC, , and ( 77-84 kDa) [35]. They are similar to classical PKCs but they are not activated by calcium (Ca2+). The crystal structure of C1 domain shows the DAG binding pocket which facilitates membra ne interaction [4, 36]. The C2 domain of novel PKCs have no aspartates for Ca2+ coordination compared to classical PKCs. This accounts for failure to be activated by Ca2+ [39]. In addition anionic phospholipids containing phosphotidylinositol2phosphate (PIP2), phosphotidylinositol (PI), phosphatidic acid (PA), phosphotidylglycerol (PG) or phosphotidylserine (PS) can bind to the C2 domain replacing the requirement of Ca2+ [36]. Thus, DAG binding and anionic phospholids binding facilitat es nPKCs translocation to the membrane site for subsequent activation. 1.1.3 Atypical PKC (aPKCs) Atypical PKCs include PKCand (protein kinase D: PKD) ( 67 and 115 kDa). The kinase domain of aPKCs is similar to cPKCs and nPKCs. The significant differences lie in the C1 domain. The C1 domains of atypical PKCs do not bind DAG. They also lack a calcium binding pockets. Hence, they are not activated by DAG or Ca2+. In addition, atypical PKCs have only one zinc finger domain. A recent report indicates that ceramide directly activates PKCin vitro [4, 37]. The catalytic regions of aPKCs are also highly homologus to those of other PKCs.

PAGE 21

8Protein Kinase C isoforms Table 1 : PKC family and their expression in tissue type. PKC isofoms MWt (kDa) Amino acids Predominant Tissue Expression Conventional PKC subfamily: 76.8 671 ubiquitous, high in T cells 76.8 672 ubiquitous, high in B cells 77.9 696 Brain Novel PKC subfamily: 77.5 675 T cells, B cells, platelets 83.5 736 T cells, B cells, platelets 78.0 681 ubiquitous, high in T cells 81.6 705 T cells, neurons, absent in B cells Atypical PKC subfamily: 67.2 586 ubiquitous 67.7 591 ubiquitous 115 912 ubiquitous

PAGE 22

91.2 Regulation of PKC 1.2.1 Regulation by autophosphorylation PKC activity is regulated by phosphorylat ion and activation by cofactors such as PS, DAG and Ca2+ depending on the isoforms. Newly synthesized PKCs are inactive and their pseudosubstrates are away from the substrates binding cavity. At this stage, PKC weakly interacts with the membrane (inactive state) [3841]. The maturation of PKC involves a series of phosphorylations initiated by phospho-dependent kinase 1 (PDK-1) and other substrates. Phosphorylation of PKC was first observed by Fabbro and coworkers when they used 12-phorbol 13-myristate acetate (PMA ), referred to as 12O -tetradecanoyl phorbol 13-acetate (TPA), to activate PKC [38]. Phosphorylation occurs at the activation loop, turn motif, and hydrophobic site (Figure 1.4). First, there is a rate limiting step, phosphorylation of threonine residue 500 on the “activation loop”, followed by aut ophosphorylation at C-terminal sites (serine and theronine at 641 and 660, respectively). For novel PKCs, theronine 566, 710, and serine 729 get autophosphorated, while in atypical PKC, ther onine 410 and 560 are autophosphorylated (Figure 1.5) [36]. These phosphorylation steps are necessary fo r PKC to be catalytically competent, for subcellular localization and stability [39-41]. After phos phorylation, it is released into the cytosol. This species is maintained in an inactive state by the bound pseudosubstrate. In this resting state, PKC bounces on and off the membranes by diffu sion-limited reactions. However, its affinity for membrane is so low that its lifetime on the membrane is too short to be significant. 1.2.2 Regulation by membrane interaction and anchoring protein The next step in the regulation of PKC is t he translocation of PKCs from cytosol to the membrane site. A landmark finding in 1982 by Anderson, Sando and coworkers described that phorbol ester caused rapid depletion of PKC activity from cytosol, followed by redistribution of PKC from cytosol to membrane [42-45]. Newly synthesized PKCs weakly interact with membrane however anchoring proteins such as receptors for activated C kinase (RACKS) and

PAGE 23

10substrates that interact with C kinase (STIC KS) facilitate PKC transloc ation to the membrane sites and allow interaction with cofactors [14]. Hence, anchoring proteins strongly hold PKCs to membrane sites. In the presence of cofa ctors at the membrane sites: PS, DAG and Ca2+, the “inactive” PKCs are translocated to membrane. PS and DAG can bind to the C1 domain while calcium (Ca2+) binds to C2 domain. Binding of one or more ligands provide sufficient energy for the pseudosubstrate to be released from the active site and allow substrate binding (activated state) [14].

PAGE 24

11 Figure 1.4 Alignment of activation loop, turn motif and hydrophobic sites of PKCs, Akt, PKA and S6K. Generally PKCs are phosphorylated on activation loop (Threonine 500), turn motif (Theronin e 641) and hydrophobic motif (serine 660) [36]. Protein kinase C phosphorylation sites

PAGE 25

12 Figure 1.5 Specific phosphorylation events of conven tional, novel, and atypical PKCs [14].

PAGE 26

131.2.3 Downregulation of PKC In addition to activation of PKC, phorbol ester is able to downregulate PKC. Downregulation involves decrease in phosphoryl ation of PKC and its enzyme activity. Studies have shown that prolonged treatm ent with phorbol esters result in downregulation of PKC by dephosphorylation. However, downregulation of PKC and their mechanisim is unsolved. At least in part, phorbol ester treatment leads to chronic PKC activation, leading to proteolytic cleavage and downregulation of PKC. An anchoring protein sequesters downregulated PKC, where PKC is rephosphorylated. However, this theory is still under study [46-48]. In addition, downregulation of PKC is achiev ed by degradation of PKC by the proteosome [49, 50]. Moreover, dephosphorylated enzyme is more sensitive to phosphatases, proteases and oxidation leading to inactivation of PKC [49-51]. 1.2.4 Singnificant of PKC Many cancer cells utilize PKCs to activate cell proliferation and survival pathways. However, PKCs have not being investigated thor oughly in prostate cancer. This study investigates the role of atypical PKC in cell cy cle progression, apoptosis and survival pathways in prosate cancer. We established three spec ific aims: 1) to determine whether a PKC/Cdk7/cdk2 signaling pathway contributes to prostate cancer cell cycle regulation; 2) to determine whether PKCphosphorylation of Bad promotes prostate canc er survival by disruption of the proapoptotic Bad/Bcl-xL interaction; 3) to determine whether PKCactivates the NFB survival pathway in prostate cells.

PAGE 27

141.3 References 1. Knapp TL and Klann E. Superoxide-induced stimulation of protein kinase C via thiol modification and modulation of zinc content. The Journal of Biological Chemistry 275: 2413624145, 2000. 2. Nishizuka Y. Studies and perspectives of protein kinase C. Science 233: 305-312, 1986. 3. Roberson ED, English JD, and Sweatt JD. A bioc hemist’s view of long-term potentiation. Learning Meomory 3: 1-24, 1996. 4. Conn PM, Means AR. Principles of molecula r regulation: protein kinase C. Humana Press Inc, Ototowa, New Jersey, pg. 20-218, 2000. 5. Verdaguer N, Corbalan-Garcia S, Ochoa WF, Fita I and Juan C. Gomez-Fernandez. Ca2+ bridges the C2 membrane-binding domain of protein kinase C directly to phosphatidylserine. The European Molecular Biology Organization 18: 6329-6338, 1999. 6. Bolsover SR, Gomez-Fernandez JC, and Corbalan-Garcia S. Role of the Ca2+/Phosphatidylserine binding region of the C2 domain in the translocation of protein kinase C to the plasma membrane. The Journal of Biological Chemistry 278:10282-10290, 2003. 7. Newton AC. Regulation of protein kinase C. Current Opinion in Cell Biology 9: 161-167, 1997. 8. Parker PJ, Coussens L, Totty N. Rhee Li, Y oung S, Chen E, Stabel S, Waterfield MD, Ullrich A. The complete primary structure of protei n kinase C-the major phorbol ester receptor. Science 233: 859-866, 1986. 9. Coussens L, Parker PJ, Rhee L et al. Mu ltiple, distinct forms of bovine and human protein kinase C suggest diversity in cellular si gnaling pathways. Science 233:853-859, 1986. 10. Downward J. Lipid-regulated kinases: so me common themes at last. Science 179: 673, 1998.

PAGE 28

1511. Johnson LN, Nobel NEM, Owen DJ. Active and inactive protein kinase: structural basis for regulation. Cell 85:149, 1996. 12. Kemp BE, Parker MW, Hu S-H, Tiganis T, House C. Substrate and pseudosubstarte interactions with protein kinases: determinants of specificity. Trends in Biochemical Sciences 19:1440, 1994. 13. Kemp BE, Mitchelhill KI, Stapleton D, Michell BJ, Chen ZP, Witters LA. Dealing with energy demand: the AMP-activated protein kinase. Trends in Biochemical Sciences 24:22, 1999. 14. Dekker Lodewijk V. Protein kinase C: molecular biology intelligence unit, 2nd Ed, New York, U.S.A Landes Biosciences Inc., 2004. 15. Hommel U, Zurini M, Luyten M. Solution stru cture of a cystein-rich domain of protein kinase C. Nature Structural and Molecular Biology 1:383-387, 1994. 16. Ichikawa S, Hatanaka H, Takeuchi Y et al Solution structure of cystein rich domain of protein kinase C The Journla of Biochemistry 117:566-574, 1995. 17. Xu RX, Pawelczyk T, Xia T-H et al. NM R structure of a protei n kinase C-phorbol-binding domain and study of protein-lipid micelle in teractions. Biochemistry 36:10709-10717, 1997. 18. Mott HR, Carpenter JW, Zhong S et al. The solution structure of the Raf-1 cystein-rich domain: A novel Ras and phospholipid binding site. Proceedings of the National Academy of Science 93: 8312-8317, 1996. 19. Hurley JH, Newton AC, Parker PJ, Blumber ga PM and Nishizuka Y. Taxonomy and function of C1 protein kinase C homology domai ns. Protein Science 6:477-480, 1997. 20. Kikkawa U, Kishimoto A, and Nishizuka Y. T he protein kinase C family: Heterogeneity and its implication. Annual Review of Biochemistry 58:31-44, 1989. 21. Bell RM, Burns DJ. Lipid activation of protei n kinase C. The Journal of Biological Chemistry 266:4661-4664, 1991. 22. Newton AC. Seeing two domains: C1 a nd C2. Current Biology 5:973-976, 1995.

PAGE 29

1623. Ono Y. Fujii T, Igarashi K, Takayoshi R, T anaka C, Ushio K, Nishizuka Y. Phorbol ester binding to protein kinase C requires a cysteinrich zinc-finger-like sequence. Proceedings of the National Academy of Science 86:4868-4871, 1989. 24. Boni LT and Rando RR. The nature of prot ein kinase C activation by physically defined phospholipid vesicles and diacylglycerols. The Journal of Biological Chemistry 260: 1081910825, 1985. 25. Sutton RB and Sprang SR. St ructure of the protein kinase C phospholipid-binding C2 domain complexed with Ca2+. Structure 6: 1395-1405, 1998. 26. Essen LO, Perisie O, Cheung R, Katan M and Williams R L. Crystal structure of a mammalian phosphoinositide-specific phospholipase C Nature, 380:595-602, 1996. 27. Perisic O, Fong Sl, Lynch D E, Bycroft M and Williams R L. Crystal structure of a calciumphospholipid binding domain form cytosolic phospholipase A2. The Journal of the Biological Chemistry 273:1596-1604, 1998. 28. Sutoon RB, Davletov BA, Berghuis AM, Sudhof TC and Sprang SR. Structure of the first C2 domain of synaptotagmin I: a novel calcium/phospholipid-binding fold. Cell 80: 929-938, 1995. 29. Pappa H, Murray RJ, Dekker LV, Parker PJ and McDonald NQ. Crystal structure of the C2 domain from protein kinase C Structure 6: 885-894, 1998. 30. Bittova L, Summandea M and Cho W. A struct ure-function of study of the C2 domain of cytosolic phospholipase A2. The Journal of Biological Chemistry 274: 9665-9672, 1999. 31. Denssen A, Tang J, Schmidt H, Stahl M, Clark J D, Seehra J and Somers WW. Crystal structure of human cytosolic phospholipase A2 reveals a novel topology and catalytic mechanism. Cell 97: 349-360, 1999. 32. Orr JW, Newton AC. Intrapeptide regulation of protein kinase C. The Journal of Biological Chemistry 269: 8383-8387, 1994.

PAGE 30

1733. Srinivasan N, Bax B, Blundell TL. Structural aspects of the functional modules in human protein kinase C alpha deduced from comparat ive analyses. Proteins 26: 217-235, 1996. 34. Nishikawa K, Toker A, Hohannes FJ. Dete rmination of the specific substrate sequence motifs of protein kinase C isozymes. The Journal of Biological Chemistry 272: 952-960, 1997. 35. Dekker LV and Parker PJ. Protein kinase Cquestion of specificity. Trends in Biochemical Scienece 19:73-77, 1994. 36. Pepio AM, Sossin WS. Membrane translocatio n of novel protein kinase Cs is regulated by phosphorylation of the C2 domain. The Journal of Biological Chemistry 276:3846-55, 2001. 37. Bourbon NA, Yun J, Kester M. Cera mide directly activates protein kinase C to regulate a stress-activated protein kinase signaling comple x. The Journal of Biological Chemistry 275: 35617-35623, 2000. 38. Borner C, Eppenberger U, Wyss R. Conti nuous synthesis of two protein kinase-Crelated proteins after downregulation by phorbol esters Procceeding of the National Academy of Science 85: 2110-2114, 1988. 39. Pears C, Stable S, Cazaubon S. Studies on the phosphorylation of protein kinase C-alpha. Biochemical Journal 283:515-518, 1992. 40. Parekh DB, Parker Z. Multiple pathways control protein kinase C phosphorylation. The Journal of the European Molecular Biology Organization 19:496-503, 2000. 41. Newton AC. Protein kinase C: Struct ural and spatial regulation by phosphorylation, cofactors, and macromolecular interacti ons. Chemical Reviews 101:2353-2364, 2001. 42. Kraft AS, Anderson WB, Cooper HI. Decrea se in cytosolic calcium/phospholipid-dependent protein kinase activity following phorbol estar treatment EL4 thymoma cells. The Journal of Biological Chemistry 257:13193-3196, 1982. 43. Kraft AS, Anderson WB. Phorbo l esters increase the amount of Ca2+, phospholipiddependent protein kinase associated with plas ma membrane. Nature 301:621-623, 1983.

PAGE 31

1844. Nishizuka Y. Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258:607-614, 1992. 45. Dutil EM, Newton AC. Dual role of pseudosu bstrate in the coordinated regulation of protein kinase C by phosphorylation and diacylglycerol. The Journal of Biological Chemistry 275:10697-10701, 2000. 46. Inoue M, Kishimoto A, Takai et al. Studies on a cyclic nucleotide-independent protein kinase and its proenzyme in mammalian tissues. The Journal of Biological Chemistry 252:76107616, 1977. 47. Rodriguez-Pena A, Rozengurt E. Disap pearance of calcium-sensitive, phospho-lipid dependent protein kinase activity in phorbol-ester treated 3T3 cells. Biochemical Biophysical Research Communication 120: 1053-1059, 1984. 48. Ballester R, Rosen OM. Fate of immunoprecipitable protein kinase C in GH3 cells treated with phorbol 12-myristate 12-acetate. The Jo urnal of Biological Chemistry 26:15194-15199, 1985. 49. Carmean D and Sardini A. Lifespan regulati on of conventional protein kinase C isotypes. Biochemical Society Transactions 35:1043-45, 2007. 50. Smith L., Chen L, Reyland ME, DeVries TA, Talanian RV, Omura S, and Smith JB. Activation of atypical protein kinase C by caspase processing and degradation by the ubiquitin-protesome system. The Journal of Biological Chemistry 275:40620-40627, 2000. 51. Lu Z, Liu D, Hornia A, Devonish W, Pagano M, and Foster DA. Activation of protein kinase C triggers its ubiquitination and degradation. Mo lecular and Cellular Biology 18:839-845, 1998.

PAGE 32

19 Chapter 2 Prostate Cancer 2.0 Introduction The prostate is a gland found only in human. It is about the size of a walnut, located below the bladder and in front of the rectum (Fig ure 2.1). The function of the prostate is to add various components to the seminal fluid [1]. It has been estimated that in United States, 1 out of 6 men will develop prostate cancer in his lifetime. In 2007, prostate cancer is second only to lung cancer among the cancer patients [2]. Prostate cancer rarely causes symptoms until it is in an advanced stage. The digital rectal examination (DRE) or serum prostate-specific antigen (PSA) elevations are the two recommended diagnoses for prostate cancer. Both normal and malignant prostate cells secrete PSA, but w hen cancer is present, PSA level in the circulation often rises. Elevated PSA levels indicate a precancerous stage even if the tumor is too small to detect [3-4]. There are a number of treatments available fo r prostate cancer: 1) hormonal therapy 2) surgery 3) radiation and chemotherapy. T here are many immortalized and malignant human prostatic epithelial cell lines developed for prostate study. The three most commonly used carcinoma cell lines are androgen-dependent, LNCaP, and androgen-independent, PC3 and DU145 cells. These three cell lines were develope d in 1977-1980 and have co ntributed significantly to the understanding of prostate cancer [5-6].

PAGE 33

20 Figure 2.1 From ACS: Illustration of male reproductive system and prostate gland [2].

PAGE 34

212.1 Prostate cancer cell lines and general characteristics 2.1.1 Androgen-dependent LNCaP cells LNCaP cells are androgen sensitive human prostate carcinoma cells. It requires androgen for growth and survival. They are adherent fibroblastoid cells. They can grow in aggregates and as single cell (Figure 2.2). LNCaP cells have low anchoring potential and do not produce a uniform monolayer in cell culture. T he androgen receptor (AR) is expressed in LNCaP cells. However, the androgen receptor contains a point mutation in the ligand-binding domain that results in increasing binding affinity for progesterone, estradiol and antiandrogens. They compete with androgens and increased the growth rate [6-9]. 2.1.2 Androgen-independent DU-145 cells and PC-3 cells DU-145 cells and PC-3 cells are androgen-independent prostate carcinoma cells. DU145 were cultured from a tumor removed from a me tastatic central nervous system (CNS) lesion [10]. A PC-3 prostatic carcinoma cell line was esta blished from a lumbar vertebra. Both cell lines can grow as either a monolayer or as single cells. They are androgen unresponsive and do not express AR. However, other studies show presen ce of AR in DU-145 and PC-3 cells. These contradictory results could be due to tumor cell heterogeneity and different experimental conditions. It is possible that the AR is expr essed in early passages and lost its expression due to natural selection and the androgen-independent cells became the dominant cell population [6]. Ras gene amplification and mutation are t he two major factors that appeared to be related to tumor progression. However, LNCaP, DU-145 and PC-3 cells have no Ras mutations. In a PC-3 drug-resistant variant, Ha-Ras amplif ication was observed [12-15]. Tumor suppressor genes such as p53 and Rb are considered important factors in etiology of many human cancers. Mutations in p53 gene have been reported in DU-145 and PC-3 but not detected in LNCaP cells. In addition, LNCaP and PC-3 cells express norma l Rb protein, whereas DU1-145 cells have a mutated Rb gene that shows a loss of 105 nucleot ides and encodes a truncated Rb protein [12, 15].

PAGE 35

222.1.3 Transformed non-malignant RWPE-1 cells RWPE-1 cells were isolated from the pr ostate of a Caucasian man and immortalized using human papiloma virus (HPV-18). These cells have an AR receptor as well as a prostate specific antigen (PSA). However, they are no n-malignant and do not form tumors in nude mice [6]. Immortalization of normal prostate cells a llows detailed investigations of many processes such as growth regulation, androgen responsi veness, drug efficacy, drug resistance, tumor progression, invasion and metastasis. It allows di fferent aspects of normal prostatic epithelial cell physiology and a reproducible source for study [6].

PAGE 36

23 Figure 2.2 Photographs of prostate cells. Nonmalignant RWPE-1 cells, androgen-dependent LNCaP carcinoma, androgen-independent DU-145 and PC-3 carcinoma cells. The pictures were taken from ATTC web sites.

PAGE 37

242.2 Prostate cell cycle and proliferation 2.2.1 Overview of cell cycle The cell cycle is the essential mechanism by which all living things reproduce. A cell carries out an orderly sequence of events such as DNA synthesis (S phase), and mitosis (M phase). These two phases are separated by gap phase (G1 and G2). The G1-phase is the interval between the completion of M-phase and the beginning of S-phase. The G2 phase is the interval between the end of S-phase and the beginning of M-phase (Figure 2.3) [16]. Figure 2.3 The cell cycle. A typical cell cycle has four phases: S, G1, G2, and M [1].

PAGE 38

25 M phase (mitosis) is subdivided into prophase, metaphase, anaphase, and telophase [16]. Briefly, at prophase the replicated chromosomes condense and the mitotic spindle assembles outside the nucleus. At metaphase t he mitotic spindle gathers all of the chromosomes to the center (equator) of the spindle. At anapha se the paired chromatids separate to form two daughter chromosomes. During telophase the two sets of daughter chromosomes arrive at the poles of the spindle. A new nuclear envelope reassembles around each set, completing the formation of two nuclei and marking the end of mi tosis. The cell cytoplasm is then divided into two by a contractile ring of actin and myosin, producing two daughter cells (Figure 2.4) [16-17]. Figure 2.4 Major events in mitosis ( http://en.wikipedia.org/wiki/Image :Major _events_in_mitosis).

PAGE 39

26 The cell cycle is regulated by phosphorylation of key proteins that initiate or regulate DNA replication, mitosis, and cytokinesis. Phos phorylation and dephosphorylation are the common ways used by cells to alter the activity of a prot ein. Phosphorylation reactions are controlled by a specific set of protein kinases, for example, cy lin-dependent protein kinases (cdks). They transfer a phosphate group from ATP to a particular amino acid side chain on the target protein. Dephosphorylation is carried out by protein phosphatases [16-17]. Hence, the cell cycle is regulat ed by protein kinases. At leas t 9 structurally related cdks (cdk1 through cdk9) have been identified, though not all have been clearly defined in cell cycle regulatory roles [17-18]. For example, cdk2 is shown to oscillate during the course of the cell cycle while Cdk7activating kinase (CAK) is involv ed in cell cycle regulation and transcription. In addition to the cell cycle, cell proliferation depends on signals from other cells. In some cases, extracellular signals from growth factors bi nd to the cell-surface receptors and activate intracellular signaling pathways [17-18]. In cancer cells, many biochemical pathway s are altered and selected for survival. For example, oncogene encodes abnormally active prot ein encouraging cells to proliferate, even in the absence of appropriate extracel lular signals (Figure 2.5) [16].

PAGE 40

27 Figure 2.5 Normal cell proliferation compared to unrestrai ned cell proliferation caused by an oncogene [16].

PAGE 41

28 Many proto-oncogenes control the growth of normal cells (Table 2). However overexpression or mutation of any of the prot o-oncogenes could cause deregulation, uncontrolled cell proliferation, de-differentiati on, and malignant transformation. Ras is the first oncogene found to be associated with a human tumor but the cells may survive even with ras mutated genes and acquire many ways to bypass the dysfuntional Ras [27]. Table 2 Selected regulatory proteins that are t he products of potential oncogenes, and their functions. Proto-oncogene Functions PDGF, EGF, CSF Growth factors Src and Raf protein kinases Cyt oplasmic, tyrosine-specific and serine/theronine-specific protein kinases Ras proteins Monomeric GTP-binding proteins Thyroid and steroid hormone receptors Nuclear receptors Myc, Fos/Jun, Rel Nuclear transcription factors

PAGE 42

29 Besides oncogenes, there are tumor-supressor genes such as Rb and p53 in healthy cells. For example, p53 monitor the integrity of the DNA molecule, when changes in the DNA are detected, p53 protien promotes transcription of an other protein, p21. P21 enters the cell cycle and shut down the G1 phase. This allows DNA repair befor e it enters DNA (S) synthesis phase. If the repair is possible, it would reduce the progression toward cancer. If the repair is not possible, p53 stimulates the cell to enter apoptosis. In total p53 could target 150 genes to prevent proliferation of damage cells. Thus, a loss of tumor-supressor gene is one of the characteristic properties of tumor cells [27-29]. 2.3 Signal Transduction: PKC signaling in cancer cells PKC is involved in survival of many cancer cells such as glioma, lung, pancreatic, ovarian, breast and prostate cancer [16-23]. The function of PKC in cancer is complex, primarily because it regulates many pathways in cellular tr ansformation. For example, in colon cancer, overexpression of PKCleads to hyperproliferation and increased susceptibility to carcinogenesis through cycloxygenase2 (COX2) and transforming growth factor(TGF ) signaling pathways [30-31]. Whereas PKCI is required for cell differentiation and downregulation of tumorigenesis in colorectal cancer [33]. In rat intestinal epithelial cells, PKCinduces cell invasion through K-Ras, Rac1, and Mek signaling pathway. PKCalso regulates Akt phosphorylation for glucose matabolsi m, and other cellular functions. In additon, PKCand are activated by vascular endothe lial growth factor (VEGF) and they participate in angiogneisis [35-36]. Tumor promoters such as phorbol esters can induce PKC activity, reduce intracellular drug accumulation, and promote multidrug-resistan ce (MDR) breast cancer (MCF7-MDR) cells [37-39]. Atypical PKCand classical PKChave been linked to phosphorylation of CAK/Cdk7 during cell proliferation in human glioma cells [21-22].

PAGE 43

30Adding to this complexity is the fact that PKC isozymes are highly homologus and targeting one specific isoform is a challenge in cancer cells. Although high homology between PKC isozymes complicates their specific function in cell lines, understanding the roles of PKC is crucial to elucidate cancer cell survival and development of therapeutic agents. 2.3.1 Targeting PKC in prostate cancer Prostate cancer is a prevalent disease in the Western world [40, 41]. The most common treatments available are radical prostatectomy, radiation therapy, and androgen deprivation. However, a significant number of patients will experience cancer re currence after the treatment. This is mainly due to development of androgen in dependence in metastasis prostate cancer [4243]. Several growth factors such as PKC are involved in prostate cancer. PKC isoenzymes and are expressed in both normal prostate and tumor tissues [44]. LNCaP cells are a widely studied model for prostate cancer. Early studies showed that activation of PKCwith TPA induced apoptosis in LNCaP cells [45]. However, androgen-independent prostate PC-3 and DU-145 cells are insensitive to TPA [45-47]. In PC-3 and DU-145 cells, epidermal growth factor (EGF) signals to PKCand PKCis associated with growth inhibition [48-50]. In addition, the PKCgene is part of chromosome 17q, and is commonly amplified in prostate cancers [51-52]. Hence, a specific inhibitor, aprinocarsen, a phosphorothioate antisense oli gonuclotides, has been developed to block PKCexpression [53-54]. Besides classical PKC, novel PKCoverexpressed in LNCaP cells caused phorbol ester-induced apoptosis. Howeve r, lack of proteolytic cleavage and caspase-3 inactivation suggested that an allosteric activation of PKCis sufficient to induce apoptosis in LNCaP cells [55]. In PC-3 and DU-145 cells, PKCis involved in cell motility and invasion of prostate tumor cells [56-57]. Morever, PKCalong with Akt promotes matrix adhesions containing actin filaments and intergins in recurrent prosta te cancer cells [58]. PKCalso regulates P-glycoprotein (P-gp) expression, which is responsible for drug resistance in LNCaP

PAGE 44

31prostate carcinoma cells [59]. In DU-145 cells the downregulation of PKCprevented apoptosis [60]. Hence, PKCis being targeted for prostate therapy. PKCand PKC-mTOR(mammalian target of rapamycin)/p70 S6 kinase pathway is associated with progression of androgen-dependent prostate cancer to androgen-independent prostate cancer [61-63]. However, this lin kage remains to be established. Nonetheless, understanding PKC isoforms in prostate cancer may contribute to possible therapeutic strategies. 2.4 References 1. Davies JA. Branching Morphogenesis. Springer, New York, USA, 176-184, 2006. 2. American Cancer Society, Inc. Cancer Statistics 2007. 3. Kumar NB, Cantor A, Allen K, Riccardi D, Be sterman-Dahan K, Seigne J, Helal M, Salup R, Pow-Sang J. The specific role of isoflavones in reducing prostate c ancer risk. Prostate 59:141-7, 2004. 4. Garnick MB and Fair WR. Prostate Canc er. Scientific American 279:75-84, 1998. 5. Mukta WM. In vitro model for prostatic cancer : summary. Progress in Clinical and Biological Research 37: 133-47, 1980. 6. Webber MM, Bello D, and Quader S. Immortalized and tumorigenic adult human prostatic epithelial cell lines: characteristics and applic ations part I. The Prostate 29:386-394, 1996. 7. Veldscholte J, Berrevoets CA, Ris-Stalpers C, Kuiper GGJM, Jenster G, Tarpman J, Brinkman AO, Mulder E. The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. The Journal of Steroid Bioc hemistry and Molecular Biology 41:665-669, 1992. 8. Berns EMMM, de Boer W, Mulder E. Andr ogen-dependent growth regulation of and release of specific proteins by t he androgen receptor containing hum an prostate tumor cell line LNCaP. Prostate, 9:247-259, 1986.

PAGE 45

329. Brolin J, Skoog L, Ekman P. Immunohi stochemistry and biochemistry in detection of androgen, progesterone, and es trogen receptors in benign and malignant human prostatic tissue. Prostate 20:281-295, 1992. 10. Mickey DD, Sotne KR, Wunderli H, Mickey G, Paulson DF. Characterization of a human prostate adenocarcinoma cell line (DU145) as a monolayer culture and a solid tumor in nude mice. “Models for prostate cancer.” Progression in Clinical biological Research, 37:67-84, 1980. 11. Webber MM, Bello D, and Quader S. Immortalized and tumorigenic adult human prostatic epithelial cell lines: characteristics and applicat ions part 2. Tumorigenic cell lines. The Prostate 30:58-64, 1997. 12. Webber MM, Bello D, and Quader S. Immortalized and tumorigenic adult human prostatic epithelial cell lines: characteristics and applicat ions part 3. Oncogenes, suppressor genes, and applications. The Prostate 30:136-142, 1997. 13. Anwar K, Nakakuki K, Shiraishi T, Naiki H, Yatani R, Inuzuka M. Presence of ras oncogene mutations and human papillomavirus DNA in human prostate carcinomas. Cancer Research 52:5991-5996, 1992. 14. Gumerlock PH, Poonamallee UR, Meyers FJ, White RW. Activated ras alleles in human carcinoma for the prostate are rare. Cancer Research 51:1632-1637, 1991. 15. Bookstein R, Shew J, Chen P, Scully P, Lee W. Supression of tumorigenicity of human prostate carcinoma cells by replacing a mutated RB gene. Science, 247:712-715, 1990. 16. Alberts B, Bray D, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Essential Cell Biology: An introduction to the molecular biology of t he cell. Garland Publishing Inc., NY, 547-589, 1998. 17. Mendelsohn J, Howley PM, Istrael MA, and Li otta LA; The Molecular Basis of Cancer, 2nd edition, W.B. Saunders, USA, 1995, pg.3-17.

PAGE 46

3318. Schwartz GK. Development of cell cycle acti ve drugs for the treatment of gastrointestinal cancers: a new approach to cancer therapy. Journal of clinical Oncology 23:4499-4508, 2005. 19. Xin M, Gao F, May WS, Flagg T, and Deng X. Protein kinase C abrogates the proapoptotic function of Bax through phosphorylation. The Journal of Biological Chemistry 282:2168-77, 2007. 20. Bae KM, Wang H, Jiang G, Chen MG, Lu L, Xiao L. Protein kinase C epsilon is overexpressed in primary human non-small ce ll lung cancers and functionally required for proliferation of non-small cell lung cancer cells in a p21/Cip1-dependent manner. Cancer Research 67:6053-63, 2007. 21. Acevedo-Duncan M, Patel R, Whelan S and BicaKu E. Huma glioma PKCand PKCphosphorylate cycle-dependent kinase activa ting kinase during the cell cycle. Cell Proliferation 35:23-36, 2002. 22. Bicaku E, Patel R, Acevedo-Duncan M Cyclin-dependent kinase activating kinase/Cdk7 colocalizes with PKC-iota in human glioma cells. Tissue and Cell 34:53-58, 2005. 23. Rcz GZ, Szucs A, Szlvik V, Vg J, Burgha rdt B, Elliott AC, Varga G. Possible role of duration of PKC-induced ERK activation in the effects of agonists and phorbol esters on DNA synthesis in Panc-1 cells. Journal of Cellular Biochemistry 98:1667-80, 2006. 24. Li H, Weinstein IB. Protein kinase C beta enhances growth and expression of cyclin D1 in human breast cancer cells. Cancer Research 66:11399-408, 2006. 25. Zhang L, Huang J, Yang N, Liang S, Barchetti A, Giannakakis A, Cadungog MG, O'BrienJenkins A, Massobrio M, Roby KF, Katsaros D, Gimotty P, Butzow R, Weber BL, Coukos G. Integrative genomic analysis of protein ki nase C (PKC) family identifies PKCiota as a biomarker and potential oncogene in ovarian carcinoma. Cancer Research 66:4627-35, 2006.

PAGE 47

3426. Choi WC and Ahn CH. Protein kinase C (PKC ) in cellular signaling system: translocation of six protein kinase c isozymes in human prostate adenocarcinoma PC-3 cell line. Korean Journal of Zoology 36:439-451, 1993. 27. Helmreich EJM. The biochemistry of cell si gnaling. Oxford University Press, New York, US, pg. 270-281, 2001. 28. Lancker LV. Apoptosis, genomic integrity, and cancer. Jones and Bartlett Publisher, Inc. London, UK, pg. 133-188, 2006. 29. Baserga R. The cell cycle and cancer. Marc el Dekker, Inc. New York, US, pg. 6-13, 1971. 30. Mackay HJ and Twelves CJ. Targeting the protein kinase C family: Are we there yet? Nature 7: 554-561, 2007. 31. Murray NR, Davidson LA, Chapkin RS, Gustaf son WC. Overexpression of protein kinase C induces colonic hyperproliferat ion and increased sensitivity to colon carcinogenesis. The Journal of Cell Biology 145:699-710, 1999. 32. Gokmen-Polar Y, Murray NR, Velasco MA, Gatalica Z, and Fields AP. Elevated protein kinase C is an early promotive event in colon ca rcinogenesis. Cancer Research 61:13751381, 2001. 33. Suga K, Sugimoto I, Ito H, and Hashimoto E. Downregulation of protein kinase C detected in human colorectal cancer. Biochemistry and Molecular Biololgy International 44:523-528, 1998. 34. J. Zhang, P Z anastasiadis, Y Liu, E. A. Thom pson, and A. P. Fields. Protein kinase C (PKC) induces cell invasion through a Ras/Mek-, PKC /Rac 1-dependent signaling pathway. The Journal of Biological Chemistry 279:22118-22123, 2004. 35. Kawakami Y, Nishimoto H, Kitaura J, Maeda-Yamamoto M, Kato RM, Littman DR, Rawlings DJ, and Kawakami T. Protein kinase C regulates Akt phosphorylation on ser-473 in a cell type-and stimulus-specific fashion. The Jour nal of Biological Chemistry 279:47720-47725, 2004.

PAGE 48

3536. Suzuma K, Takahara N, Suzuma I, Isshiki K, Ueki K, Leitges M, Aiello LP, and King GL. Characterization of protein kinase C isoform’s action on retinoblastoma protein phosphorylation, vascular endothelial growth fact or-induced endothelial cell proliferation, and retinal neovascularization. PNAS, 99:721-726, 2002. 37. Fine RL, Patel J, and Chabner BA. Phorbol esters induce multidrug resistance in human breast cancer cells. Pro. Natl Acad. Sci., USA, 85:582-586, 1988. 38. O’Brain CA, Ward NE, Stewart JR and Chu F. Prospects for targeting protein kinase C isozymes in the therapy of drug-resistant cancer – an evolving story. Cancer and Metastasis Review, 20:95-100, 2001. 39. Goodfellow HR, Sardini A, Ruetz S, Callagha n R, Gros P, McNaughton PA, and Higgins CF. Protein kinase C-mediated phosphorylation doe s not regulate drug transport by the human mutidrug resistance P-glycoprotein. The Jo urnal of Biological Chemistry 271:13668-13674, 1996. 40. Jemal A, Tiwari RC, Murray T. Cancer stat istics 2005. CA Cancer Journal of Clinicians 55:10-30, 2005. 41. Schally AV, Comaru-Schally AM, Plonowski A. Peptide analogs in the therapy of prostate cancer. Prostate, 45:158-166, 2000. 42. Stangelberger A, Schally AV, Varga JL, Zara ndi M, Cai R, Baker B, Hammann BD, Armatis P, Kanashiro CA. Inhibition of human androgen-independent PC-3 and DU-145 prostate cancers by antagonists of bombesin and growth hormone releasing hormone is linked to PKC, MAPK and c-jun intracellular signaling. European Journal of Cancer 41:2735-2744, 2005. 43. Hudes GR. Signaling inhibitors in the treatm ent of prostate cancer. Investigational New Drugs 20:159-173, 2002. 44. Cornfor P, Evans J, Dodson A, Parsons K, Woolfenden A, Neoptolemos J, and Foster CS. Protein kinase C isozymes patterns characterist ically modulated in early prostate cancer. American Journal of Pathology 154:137-144, 1999.

PAGE 49

3645. Powell CT, Birttis NJ, Stec D, Hug H, He ston WDW, and Fair WR. Persistent membrane translocation of protein kinase C during 12O -tetradecanoylphorbol-13-acetate-induced apoptosis of LNCaP human prostate cancer cells. Cell Growth and Differentiation 7:419-428, 1996. 46. Gonzalex-Guerrico AM, Meshki J, Xiao L, B enavides F, Conti CJ and M. G. Kazanietz. Molecular mechanisms of protein kinase C-induced apoptosis in prostate cancer cells. Journal of Biochemistry and Molecular Biology 38:639-645, 2005. 47. Garcia-Bermejo ML, Leskow FC, Fujii T, Wang Q, Blumberg PM, Ohba M, Kuroki T, Han K, Lee J, Marquez VE, and Kazanietz MG. Diacylglycerol (DAG)-lactones, a new class of protein kinase C (PKC) agonists, induce apopt osis in LNCaP prostate cancer cells by selective activation of PKC. The Journal of Biological Chemistry 244:645-655, 2002. 48. Stewart JR and O’Brian CA. Protein kinase Cmediates epidermal growth factor receptor transactivation in human prostate cancer cells Molecular Cancer Therapeutics 4:726-732, 2005. 49. Shih A, Zhang S, Cao HJ, Boswell S, Wu Y, Tang H, Lennartz MR, Davis FB, Davis PJ, and Lin H. Inhibitory effect of epidermal growth factor on reseveratrol-induced apoptosis in prostate cancer cells is mediated by protein kinase C. Molecular Cancer Therapeutics 3:1355-1363, 2004. 50. Lamm ML, Long DD, Goodwin SM, Lee C. Transforming growth factor-betaI inhibits membrane assocaition of protein kinase C alpha in a human prostate cancer cell line, PC3. Endocrinology 138:4657-4664, 1997. 51. Oxley JE, Winkler MH, Gillatt DA, Peat DS. Her-2/neu oncogene amplification inclinically localized prostate cancer. Journal of Clinical Pathology 55:118-120, 2002. 52. Lahn M, Sundell K, Gleave M, Lada F, Su C, Lit S, Ma D, Paterson DM and Bumol TF. Protein kinase Cin prostate cancer. British Journal of Urology International 93:1076-7081, 2004.

PAGE 50

3753. Dean NM, McKay R, Condon TP, Bennett CF Inhibition of protein kinase C-alpha expression in human A549 cells by antisense o ligonucleotides inhibits induction of intercellular adhesion molecule 1 (CAM-1) mRNA by phorbol-esters. The Journal of Biological Chemistry 269:16416-24, 1994. 54. Davies AM, Gandara D, Lara P, Mack P, Lau D, Gumerlock P. Antisense oligonucleotides in the treatment of NSCLC. Clinic al Lung Cancer 4:S68-S73, 2003. 55. Fujii T, Garcia-Bermejo ML, Bernabo JL, Caam ano J, Ohba M, Kuroki T, Li L, Yuspa SH, and Kazanietz MG. Involvement of protein kinase C (PKC ) in phorbol ester-induced apoptosis in LNCaP prostate cancer cells. The Journal of Biological Chemistry 275:7574-7582, 2000. 56. Kharait S, Dhir R, Lauffenburger D, Wells A. Protein kinase C signaling downstream of the EGF receptor mediates migration and invasivene ss of prostate cancer cells. Biochemical and Biophysical communications 343:848-856, 2006. 57. Rosenberg M and David S. Protein kinase C regulates myosin IIB phosphorylation, cellular localization, and filament assembly. Molecular Biology of the Cell 17:1364-1374, 2006. 58. Wu D, Thakore CU, Wescott GG, McCubrey JA and Terrian DM. Integrin signaling links protein kinase C to the protein kinase B/Akt survival pathway in recurrent prostate cancer cells. Oncogene 23:5689-8672, 2004. 59. Flescher E, Rotem R. Protein kinase C mediates the induction of p-glycoprotein in LNCaP prostate carcinoma cells. Cellular Signalling 14:37-43, 2002. 60. Rusnak JM, and Lazo JS. Downregulation of protein kinase C suppresses induction of apoptosis in human prostatic carcinoma cells Experimental Cell Research 224:189-199, 1996. 61. Rao PS, Jaggi M, Smith DJ, Hemstreet GP, and Balaji KC. Metallothionein 2A interacts with the kinase domain of PKC in prostate cancer. Biochemical and Biophysical Research Communications 310:1032-1038, 2003.

PAGE 51

3862. Jaggi M, Rao PS, Smith DJ, Hemstreet GP, and Balji KC. Protein kinase C is downregulated in androgen-independent prostate cancer. Biochemical and Biophysical Research Communications 307:254-260, 2003. 63. Inoue T, Yoshida T, Shimizu Y, Kobayashi T, Yamasaki T, Toda Y, Segawa T, Kamoto T, Nakamura E, and Ogawa O. Requirement of androgen-dependent activation of protein kinase C for androgen-dependent cell proliferation in LNCaP cells and its roles in transition to androgen-independent cells. Molecular Endocrinology 20:3053-3069, 2006.

PAGE 52

39 Chapter 3 Role of PKCin prostate cell cycle and proliferation 3.0 Introduction Atypical PKCand PKCare structurally and functionally distinct from other PKCs [1]. Activation of atypical PKCs is independent of DAG, Ca2+ and PS. Their activity is regulated by PDK1 and through protein-protein interactions [2-9]. PKCand PKCshare a 72% sequence homology at the amino acid level [10]. However, they have distinct functions. For example, overexpression of PKCleads to a longer cell doubling time, changes cell morphology, and increase adherence to plastic [11-12]. In contrast to PKC, PKCis involved in carcinogenesis both in vitro and in vivo in many cancers [13-17]. PKCand PKCare linked to phosphorylation of CAK/Cdk7 during cell proliferation in human glioma cells [18-19]. At ypical PKCs are likely antiapoptotic proteins in K562 leukemia cells becaus e overexpression of PKCprevented okadaic acid (OA) and taxolinduced apoptosis [14]. In non-small-cell lung cancer (NSCLC), PKCphosphorylated Bad, a proapoptotic BH3only protein, and disrupted Bad/Bcl-xL, leading to enhanced survival and chemoresistance [20]. In addition, PKCregulates the Rac1/Pak/ Mek/Erk signaling pathway involved in cell proliferation of NSCLC [20-23]. In prostate cancer cells, linoleic acid (LA) and eicosapentaenoic acid (EPA) increased the activity of PKCand PKCand augmented the proliferation rate of LNCaP cells [5]. In addition, an increasing number of studies implicate PKC isozymes in prostate cancer cell regulation [24-27]. Hence, evidence is accumulating for the significant role of PKC in progression and metastasis of prostate cancer.

PAGE 53

403.1 Materials and methods 3.1.1 Reagents and Antibodies Primary antibodies were purchased from the following companies: PKC(sc-8393) (sc-8049), (sc-937), (sc-214), (sc-211), (sc-212) from Santa Cruz Biotechnology, CA; PKC(cat number 610176) from Transduction Laboratory, Lexington, KY; PKC(catalog number 07-264) from Upstate Biotechnology, Lake Placid, NY. Secondary antibodies were purchased from the following companies: HRP Goat x Mouse IgG catalog number JGM035146, HRP Goat x Rabbit IgG catalog number JBZ03514 4 were from Accurate, Westbury, NY; HRP Bovine anti-goat IgG (sc-2350) from Santa Cruz Biotechnology, CA; Anti-rabbit IgG HRP-linked antibody (catalog number 7074) from Cell Signali ng Danver, MA. Standards for PKCs are from various sources that came with the antibody: H eLa, Jurkat, K-562, and whole cell lysates from Santa Cruz Biotechnology, CA. All other chemicals such as HEPES (cat alog number BP310-500), Tris-glycine 10X (catalog number BP1306), SDS (catalog numbe r BP166-500), Tris-Base (BP152-500), Glycerol (catalog number BP229), Triton x100 (catal og number BP151-500), methanol (catalog number A407), hydrochloric acid (catalog number A144) were purchased from Fisher Scientific, Norcross, GA. Ethylene glycol bis( -aminoethyl ether)N,N,N’,N’ -tetraacetic acid EGTA (catalog number E4378), sodium floride (catalog number S6521), sodium orthovanadate (catalog number S6508), PMSF (P7626), leupeptin (catalog number 62070), aprotinin (catalog number A6279) were purchased from Sigma Aldirch, St. Louis MO. Protein assay dye (catalog number 500-0006), EDTA (catalog number 161-0729), Tris-Buffe red Saline 10X (catalog number 170-6435) were purchased from Bio-Rad, Richamd, CA. Bovi ne serum albumin (BSA) (catalog number 23209) and SuperSignal West Pico Chemiluminescent Substrate (catalog number 34080) were purchased from PIERCE, Rockford, IL.

PAGE 54

413.1.2 Cell Culture RWPE-1 (CRL-11609), LNCaP (CRL-1740) an d DU-145 (HTB-81) the cell lines and their media were obtained from American Type Tissue Culture Collection (ATCC) (Rockville, MD). LNCaP cells were grown in RPMI1640 (catalog nu mber 30-2001). DU-145 cells were grown in Minimum Essential Medium Eagle (MEME) earle’s balanced salt solution (catalog number 302003). LNCaP and DU-145 cells were seeded (1 x 106) and grown as a monolayer in 75 cm2 flasks. Both RPMI1640 and MEME media were supplemented with 90% Minimum Essential Medium Eagle (MEME) earle’s balanced salt solution, non-essential amino acids; 1 mM sodium pyruvate; 2 mM L-glutamine; 1500 mg sodium bicarbonate/L; 10% fetal bovine serum (FBS) (catalog number 30-2020), and antibiotics 5ml (penicillin 10 U/ml and streptomycin 10 g/ml) (catalog number MT-30-001-CI from Fisher Scientific) in a 5% CO2 incubator at 37 oC. For RWPE-1 the media and supplements were purcha sed from Invitrogen, Carlsbad, CA. RWPE-1 cells were seeded (1 x 106) and grown as a monolayer on 75 cm2 flasks containing Keratinocyte Serum Free Media (catalog number 10724-011), Epidermal Growth Factor (2.5 g) (catalog number 10450-013) and Bovine Pituitrary Extr act (25 mg) (catalog number 13028-014) and antibiotics 5ml (penicillin 10 U/ml and streptomycin 10 g/ml) in a 5% CO2 incubator at 37 oC. 3.1.3 Trypan Blue Dye Exclusion Assay For cell doubling time, RWPE-1 cells, LNCaP cella and DU145 cells (1x106) were seeded into each of five 75 cm2 flasks. Each flask was counted every 24 hours over a 5 day period. At the indicated time, cells were trypsinized, pelleted, washed with 1ml of Dulbecco’s phosphatebuffered saline (DPBS) (catalog number 21-031-CV), resuspended in 0.4% Trypan Blue Solution (catalog number T8154, Sigma), and counted using a hemacyometer. Live (dye excluded) cells were counted. The results from three separate independent experiments were used to determine the mean viability and standard deviation for each time point.

PAGE 55

423.1.4 Cell Cycle Analysis by Flow Cytometry Confluent cell cultures were semi-synchroni zed by serum starvation for 48 hours. Cells were then incubated in serum and removed at specific times, washed in DPBS, trypsinized (catalog number 25-053-CI, Fisher Scientific), and fi xed by dropwise addition (while vortexing) of cold ethanol until a concentration of 60% ethanol was reached. The day before analysis, 60% ethanol was decanted and PBTB (PBS, 0.2% Trit on x100 and 1% bovine serum albumin) was added. Triton x100 (catalog number BP151-500 ) and bovine serum albumin (BSA) (catalog number B4287) were purchased from Fisher Scientific. The cells were counted and diluted to 1x106 cells/ml with PBTB. The cells were filter with cell strainer and 50 l of RNase was added. Nuclei were analyzed for DNA content using a propidium iodide (PI) 10 L staining protocol and flow cytometry [38]. RNase (catalog number 83931) and PI (catalog number P4170) were purchased from Sigma. The distributions of 1 x 106 nuclei were quantified using a FAC STARPlus, flow cytometry (Becton Dickinson, San Jose, CA) and ModFitLT Cell Cycle Analysis program (Version 2.0; Verity Software House, Topsham, ME, USA). The results from three separate independent experiments were used to determi ne the mean viability and standard deviation for each time point. 3.1.5 Electrophoresis and Western Blotting Cells (1 x 106) were placed on ice to terminate the incubation. Cell extracts were prepared by washing tw ice with 10 ml of ice cold DPBS. Monolayers were scraped at 4 oC, resuspended and sonicated in 2 ml homogenizati on buffer (50 mM HEPES, p.H. 7.5), 150 mM NaCl, 0.5% Triton-X100, 1mM EDTA, and 2mM EGTA, 0.1 mM sodium orthovanadate, 1mM NaF, 2mM PMSF, 2.5 g/ml leupeptin, 1mM DTT, 0.15 U/ml aprotinin. Cell suspensions were centrifuged at 40 000 g for 30 min to obtain cell extracts. Protein content was measured according to Bradford [ 40]. Protein samples were separated by 10% SDS-PAGE and electrophoresed 1 hour at 45-70 mAmps and then transferred to nitrocellulose membranes by electroblotting with transfer buffer 100 ml of 10 x Tris Glycine (0.25 M Tris and

PAGE 56

431.92 M glycine) and 20% methanol in 1 L of distilled water; electroblotted for one hour at 24 volts. For Western blot analysis with PKC antibodies, ea ch blot was blocked for 1 hour with 5% (w/v) fat-free dry milk in tris-buffe red saline with 0.05% Tween-20 (TTBS) solutions at room temperature. Protein bands were probed with primary antibody in 5% milk TTBS buffer at 4 oC overnight. The primary antibodies dilutions for PKC, , were 1:1000 (5 g), PKCand PKCantibodies were diluted 1:4000 (5 g). Membranes were subsequently washed for 15 minutes with TTBS and 15 minutes (2x) with 3% milk TTBS. Secondary antibodies such as horseradish-peroxidase-conjugate an ti-mouse, anti-rabbit or anti-goat were diluted 1:10000 in 5% milk TTBS. The membranes were incubated with secondary antibody at room temperature for 1 hour. Immunoreactive bands were visualized wi th SuperSignal West Pico Chemiluminescent Substrate: the membranes were incubated with 5 ml of Luminol enhancer and 5ml of stable peroxide buffer for 5 minutes and pictures were taken with Kodak flim. 3.1.6 Statistics Data from three independent experiments ar e performed and standard error of the mean (S. E.M; ) were calculated using Stude nt’s t-test and graph using SigmaPlot 8.0TM. P-values with p < 0.05 were considered significant. Stasti stical test (P) is compared between two groups of sample, for example, control population vs. treated population. 3.2 Results 3.2.1 Doubling Time for RWPE-1, LNCaP and DU-145 cells Cell proliferation involves activation of cdks. These proteins fluctuate throughout the cell cycle and are expressed in diffe rent cell cycle phases. Like cdks, PKC isoforms may also be expressed transiently or constitu tively in different phases of the cell cycle. Therefore, the doubling time for RWPE-1, LNCaP and DU-145 cells were first established to determine if PKCexpression is transient or constitutive. Afte r counting cells over 5-day period, extrapolation

PAGE 57

44revealed that the doubling time for three cell lines was 36 hours (Figure 3.1). In further experiments, we assumed this doubling time represents the length of a cell cycle. 3.2.2 PKCexpression in dividing cells and arresting cells To determine if PKCis involved in proliferating cells, we next focused on PKCexpression in confluent cell cycle arrested cells and dividing cells in RWPE-1, LNCaP and DU145. In 100% confluent cells, there was accumulation of cells at the G0/G1 cell cycle phase, but in dividing cells (50% confluent), the cells undergo regular cell cycle progression (Figure 3.2 and Table 3). The level of PKCin total cell lysates (15 g) was higher in 50% confluent cells compared to 100% confluent cell cycle arrested cells (Figure 3.3A). Other PKC isoforms such as PKCwere expressed constitutively with no differences between dividing and arrested cells. There was no caspase-7 activation in serum starved (S) and non-serum starved (NS) cells, indicating no cell death in temporally arrested cells. Absorbance densitometry revealed a twofold increase in PKCexpression in proliferating cells compar ed to arrested cells (Figure 3.3I). The presence of inactivated caspase-7 indica tes that cell death was not induced by serum starvation. Therefore, it is likely that PKCplays a role in the proliferation of rapidly dividing cells. 3.2.3 PKC isoforms in RWPE-1, LNCaP and DU-145 cells Next, we examined the PKC isozymes profiles in RWPE-1, LNCaP and DU-145 cells. The expression of PKCs was not always constitu tive and fluctuated throughout the cell cycle (Figure 3.4). Therefore, from the 36th h (doubling time), the expressions of PKC isoforms were monitored. Whole cell lysate (50-150 g) showed that there were nine PKC isozymes present in RWPE-1 and DU-145 cells: PKC, , , , and There were high levels of PKC, and present constitutively throughout the cell cy cle (Figure 3.2D, H, I) and low expression of PKCand isoforms in RWPE-1 cells and DU-145 cells (Figure 3.4A-E, G, second and fourth column). There were only traces of PKC, and (150 g of protein) in RWPE-1 (Figure 3.4F-G, second column). In DU-145 cells, PKCexpression may regulates the cell cycle (Figure 3.4F, fourth column). In tota l, there were nine PKC isoforms present in RWPE-1 cells and DU-

PAGE 58

45145 cells. However, in LNCaP cells, there were only seven PKC isoforms detectable. LNCaP whole cell lysates (50-100 g) showed the presence of PKC, , , and (Figure 3.4A-I, third column). There was no detectable level of PKCand isozymes (150 g of protein) (Figure 3.4C and F, third column). For loading contro l, a relatively stable cytoskeletal protein, -actin was used. In most cases regardless of expe rimental treatment or technical procedure, -actin expression is constant. Hence, western blot of -actin (50 g) verified equal loading of protein in each lane.

PAGE 59

46 RWPE-1 020406080100120140Number of viable cells (1x10 3 ) 0 1000 2000 3000 4000 5000 6000 7000 LNCaP 020406080100120140 0 1000 2000 3000 4000 5000 6000 DU-145Hours (h) 020406080100120 0 2000 4000 6000 8000 10000 12000 Figure 3.1 Doubling time for RWPE-1 cells, LNCaP ce lls and DU-145 cells. One million cells were seeded in each flask (time zero) and grown in their respective complete media as described in “Materials and Methods”. After every 24 hours, the cells were trypsinized and viable cells were counted using trypan blue exclusion assay using a hematocytometry at the indicated times. For each time point, triplicate cultures were counted and the mean value of viable cells with the SD was plotted. The graphs show the doubling ti me of 36 hours for RWPE-1 cells, LNCaP cells and DU-145 cells.

PAGE 60

47 Figure 3.2 Effect of cell density and cell cycle progre ssion in RWPE-1 cells, LNCaP cells and DU-145 cells. FACS analysis of DNA content in 100% confluent (first column) and 50% confluent (second column) RWPE-1 cells, LNCaP cells a nd DU-145 cells. RWPE-1 cells and LNCaP cells are diploid while DU-145 cells are hypotripliod. The histograms are from one representative experiment and illustrate DNA content for the Go/G1 peak at (first red shaded peak), DNA synthesis phase (S) and gap2 and mitosis (G2M, second red shaded peak). Forty thousand events were collected per time point and treatment group. The average cell cycle distribution is shown in Table 3.

PAGE 61

48 Table 3 Summary of Cell Cycle Phases for RW PE-1 cells, LNCaP cells and DU-145 cells* Cell Type G0/G1 S G2M 100% Confluent RWPE-1 72 + 1 23 + 1 5 + 1 50% Confluent RWPE-1 64 + 3 33 + 3 3 + 3 100% Confluent LNCaP 93 + 6 6 + 5 1 + 1 50% Confluent LNCaP 68 + 1 26 + 1 5 + 1 100% Confluent DU145 91 + 3 3 + 1 7 + 4 50% Confluent DU145 49 + 2 41 + 1 9 + 1 N=3 experiments

PAGE 62

49 Percent cell confluent (%) 50%100%PKCabsorbance arbitrary value (1x10 3 ) 0 20 40 60 80 RWPE-1 LNCaP DU145 I Figure 3.3 Randomly selected PKC isoforms in 50% c onlfluent and 100% conlfulent prostate cells. Western blots of PKC isoforms (15-100 g) (A-H) were performed as described in “Material and Method”. Inactivated caspase-7 indicates cell survival in both cells. Non-starved (NS): 100% confluent cells; and serum starved (S): 100% confluent cells. Western blot of -actin indicates equal loading of protein in each lane. Densitom etry for the mean and standard deviation of PKCabsorbance was calculated from three i ndependent Western blots obtained from three independent experiments (I). P = 0.026 (RWPE-1 cells), P = 0.023 (LNCaP cells), and P = 0.002 (DU-145 cells).

PAGE 63

50 Figure 3.4 PKC isoforms in RWPE-1cells, LNCaP cells and DU145 cells. Cells were grown to 70-80% confluent. The growth media was remov ed and the cells were semi-synchronized by serum starvation for 48 h (T = 0). Growth media was then added to flasks and cells were allowed to grow for the indicated time (3-36 h). Flas ks were collected every three hours and cells were lysed as described in “Materials and Met hods.” Equal amounts of protein (50-100 g) were loaded on each lane and ran on 10% SDS-PAGE. Column 1 is the standards for PKCs, column 2 is the PKCs isozymes from RWPE-1 cells and co lumn 3 is the PKCs isozymes in LNCaP cells and column 4 is the PKC isozymes from DU145 cells at the indicated time. Only nine PKCs isozymes were present: PKC, , , , and for RWPE-1 cells and DU145 cells (A-I). Higher protein concentrations were required to detect PKCand (150 g each) and only traces were observed in RWPE-1 cells (F-G). Regulation of PKCexpression with the cell cycle was observed in DU-145 cells (F). Western blots for PKCand PKCwere performed at higher concentrations of protein (200 g) for each cell line but their expressions were not observed. For LNCaP, there were only seven PKC isozymes present: PKC, , , and PKC PKC, and were not observed in LNCaP cells. -actin (J) verified that equal amounts of protein were loaded in each lane.

PAGE 64

513.3 Discussion Previous work in glioma cells has indicated that PKCplays a role in cell proliferation and tumor development [1]. To investigate the hypothesis involving PKCin cell proliferation, establishing the doubling time (36 hours) for all three cell lines: RWPE-1, LNCaP, and DU-145 enable us to fully investigate the PKCs expression s in prostate cells. Not all proteins are expressed constitutively, for example cdks and p5 3 expression dependent on cell cycle [28, 29]. Since protein expression could be either constitutive or transient, it is crucial to arrest the cell at G0/G1 stage. At G0 stage the cells are not proliferating (arres ted cells). During this time, various biochemical functions are carried out in accor dance with the differentiated state of the cell involved. Characteristically, these cells do not synthesize DNA – i.e., they do not enter S phase [30]. Some investigators have suggested that the resting cell is in a special biochemical condition, which they called “G0”. At quiesence (G0) stage, cellular processes are dissimilar to the cellular processes in the growth phase (S and G2/M phase). Others have concluded that “G0” state occurs because the cell is arrested at some point in G1 (post-mitotic pre-synthetic period) [31, 32]. In any case, one or more biochemical condition s must exit which differentiate the resting from the growing cell. There are many drugs ava ilable for inducing growth arrest. For example, treatment with thymidine or aphidicolin halts the cell in the G1 phase [33]. Mitotic shake-off can be achieved with colchicine [36] and treatment wi th nocodazole [35] halt the cell in M phase and treatment with 5-fluorodeoxyuridine halts the cell in S phase.The downside is that they can have toxicity effects to the cells and their physio logical biochemical responses are altered. Therefore, cells were semi-synchronized by serum starvation [36]. Serum starvation shows a significant arrest in both DU-145 cells and LNCaP cells. However, in RWPE-1 cell growth inhibition was 10% increased in G0/G1 and 10% decreased in S phase. This is due to a characteristic of the transformed non-malignant RWPE-1 cells. Immortilized RWPE-1 cell with HPV-18 disrupts the regulation of cell cycle and cell death through the interaction of E6 and E7

PAGE 65

52gene products that destabilize p53 and abrogate the f unction of Rb, respectively [37]. Hence, the data is consistent with the disruption of both Rb and p53 in this RWPE-1 cell line. Although, the cells were arrested temporally we are able to observe some changes in PKCs expression significant to the cell cycle arrest. We found that PKCexpression was decreased in arrested cells compared to rapidly proliferating prostate cells. We also randomly analyzed classical PKCnovel PKC, ; and atypical PKC. Unlike PKC, other PKC isoforms demonstrated no significant changes in their protein expression between resting cells and rapidly dividing cells. Note that during seru m starvation, there was no cell death as shown by inactivation of caspase-7 between non-serum st arved and serum starved cells. Activation of caspase-7 (35 kDa) i.e., degradation to subunits 20 kDa and 10 kDa is one of the biomarkers for cell apoptosis [38]. Apoptosis is decribed in detail in chapater 6. Hence, specific fluctuation of PKCbetween arrested cells and proliferating cells supports our hypothesis that PKCplays a role in cell proliferation. Analysis of PKC isozyme profile revealed nine PKC isoforms ( and ) in RWPE-1 cells and DU-145 cells throughout their cell cycle. LNCaP cells showed only seven PKC isoforms ( and ). PKCand were not detected in all three cell lines even at higher concentrations of protein (data not shown). Our data is in agreem ent with early studies of PKC isoforms ( and ) expressed in both normal prostate and tumor tissues [39]. Not all PKCs expressed equally in all three cell lines. PKCand were consitutively present in proliferating cells. However, PKCin DU-145 cells fluctuates with cell cycle.

PAGE 66

533.4 References 1. Moscat J, Daiz-Meco MT. The atypical protei n kinase Cs. Functional specificity mediated by specific protein adapters. European Bilogy Molecular Reports 1:399-403, 2000. 2. Nakanishi H, Brewer KA, Exton JH. Activait on of the zeta isozyme of protein kinase C by phosphatidylinositol 3, 4, 5-trisphosphate. The Journal of Biological Chemistry 268:13-6, 1993. 3. Le Good Ja, Ziegler WH, Parekh DB, Alessi DR, Cohen P, Parker PJ. Protein kinase C isotypes controlled by phosphoinositide 3-kina se through the protein kinase PDK1. Science 281:2042-5, 1998. 4. Dong LQ, Zhang Rb, Langlais P, He h, Clark M, Zhu L, et al. Primary structure, tissue distribution, and expression of mouse phosphoi nositide-dependent protein kinase-1, a protein kinase that phosphorylates and activates protei n kinase C zeta. The Journal of Biological Chemistry 274:8117-22, 1999. 5. Chou MM, Hou W, Johnson J, graham LK, Lee MH, Chen CS, et al. Regulation of protein kinase C zeta by PI 3-kinase and PDK1. Current Biology 8:1069-77, 1998. 6. Puls A, Schmidt s, Grawe f, Stable S. Interact ion of protein kinase C zeta with ZIP, a novel protein kinase C-binding protein. Proce edings of National Academy of Science, USA 94:6191-6, 1997. 7. Sanchez P, De Carcer G, Sandoval IV, Moscat J, Diaz-Meco MT. Localization of atypical protein kinase C isoforms into lysosome-targe ted endosomes through interaction with p62. Molecular Cell Biology 18:3069-80, 1998. 8. Suzuki a, YamanakaT, Hirose T, Manabe N, Mi zuno K, Mizuno K, shimizu M, et al. Atypical protein kianse C is involved in the evoluti onarily conserved par protein complex and plays a critical role in establishing epithelia-specific junctional structures. Journal of Cell Biology 152:1183-96, 2001.

PAGE 67

549. Aui RG, Abo A, Steven Martin G. A human homolog of the C. elegans polarity determinant Par-6 links Rac and Cdc42 to PKCzeta signaling and cell transformation. Current Biology 10:697-707, 2000. 10. Akimoto K, Mizuno K, Osada S, Hirai S, tanum a S, Suzuki K, et al. A new member of the third class in the protein kinase C fam ily, PKC lambda, expressed dominantly in an undifferentiated mouse embryonal carcinoma cell line and also in many tissues and cells. The Journal of Biological Chemistry 17:12677-83, 1994. 11. De Vente J, Kiley S, garris T, Bryant W, Hooker J, Posekany K, et al Phorbol ester treatment of U937 cells with altered protei n kinase C content and distribution induces cell death rather than differentiation. Cell Growth and Differentiation. 6:371-82, 1995. 12. Ways DK, Posekany K, de vente J, Garris T, chen J, Hooker J, et al Overexpression of protein kinase C-zeta stimulates leukemic cell differentiation. Cell Growth and Differentiation 11:1195-203, 1994. 13. Jamieson L, Carpenter L, Biden TJ, Fields AP. Protein kinase Ciota activity is necessary for Bcr-Abl-mediated resistance to drug-induced apopt osis. The Journal of Biological Chemistry 274:3927-30, 1999. 14. Murray NR, Fields AP. Atypical protein kina se C iota protects human leukemia cells against drug-induced apoptosis. The Journal of Biological Chemistry 272:27521-4, 1997. 15. Murray NR, Jamieson L, Yu W, Zhang J, Gokmen -Polar Y, Sier D, et al. Protein kinase C iota is required for Ras transformation and colon carcinogenesis in vivo. The Journal of Cell Biology 164:797-802, 2004. 16. Zhang J. Anastasiadis PZ, Liu Y, Thompson EA, Fields AP. Protein Kinase C II induces cell invasion through a Ras/MEK-, PKCiota/RAC 1-dependent signaling pathway. The Journal of Biological Chemistry 279:22118-23, 2004. 17. Lu Y, Jamieson L, Brasier AR, Fields AP. NF-kappaB/RelA transactivation is required for atypical protein kinase C iota-mediated cell survival. Oncogene 20:4777-92, 2001.

PAGE 68

5518. Acevedo-Duncan M, Patel R, Whelan S and Bicaku E. Human glioma PKCand PKCphosphorylate cyclin-dependent kinase activating kinase during the cell cycle. Cell Proliferation 35: 23-36, 2002. 19. Bicaku E, Patel R, Acevedo-Duncan M Cyclin-dependent kinase activating kinase/Cdk7 colocalizes with PKC-iota in human glioma cells. Tissue and Cell 34:53-58, 2005. 20. Zhaohui J, Meiguo X, and Xingming D. Survival function of protein kinase C as a Novel Nitrosamine 4-(methylnitrosamino)-1-(3-pyr idyl)-1-butanone-activated Bad kinase. The Journal Biological Chemistry 290: 16045-16052, 2005. 21. Stallings-Mann M, Jamieson L, Regala RP, Weems C, Murray NR, and Fields AP. A novel small-molecule inhibitor of protein kinase C blocks transformed growth of non-small-cell lung cancer cells. Cancer Research, 66:1761-1774, 2006. 22. Regala RP, Weems C, Jamieson L, Copland JA Thompson EA, Fields AP. Atypical protein kinase C plays a critical role in human lung cancer cell growth and tumorigenicity. The Journal Biological Chemistry. 280: 31109-31115, 2005. 23. Gustafson WC, Ray S, Jamieson L, Thom son EA, Brasier AR, and Fields AP. Bcr-Abl regulates protein kinase C (PKC ) transcription via an Elk1 site in the PKCpromoter. The Journal Biological Chemistry 279:9400-9408, 2004. 24. Cornford P, Evans J, Dodson A, Parsons K, Woolfenden A, Neoptolemos J, and Foster CS. Protein kinase C isozyme patterns characterist ically modulated in early prostate cancer. American Jouranl of Physiology 154: 137-144, 1999. 25. Yuichi Tanaka, M. Gavrielides V, Mitsuuchi Y, Fujii T, and Kazanietz MG. Protein kinase C promotes apoptosis in LNCaP prostate c ancer cells through activation of p38 MAPK and inhibition of the Akt survival pathway The Journal Biological Chemistry 278 : 33753-33762, 2003.

PAGE 69

5626. Choi WC and Ahn CH. Protein kinase C (PKC ) in cellular signaling system: translocation of six protein kinase c isozymes in human prostate adenocarcinoma PC-3 cell line. Korean Journal of Zoology 36: 439-451, 1993. 27. Henttu P and Vihko P. The protein kinase C activator, phorbol ester, elicits separate functional responses in androgen-sensitive and androgen-independent human prostatic cancer cells. Biochemical and Biophysical Research Communication 244: 167-171, 1998. 28. Lolli G, Johnson LN. CAK-cyclin-dependent ac tivating kinase: a key kinase in cell cycle control and a target for drugs? Cell Cycle 4:572-577, 2005. 29. Agarwal ML, Agarwal A, Taylor WR, Stark GR. P53 Controls both the G2/M and the G1 cell cycle checkpoints and mediates reversible grow th arrest in human fibroblasts. Proceeding of National Academy of Science USA 92:8493-8497, 1995. 30. Baserga R. The cell cycle and cancer. Marc el Dekker Inc. New York USA 132-225 1971. 31. Patt H. and Quastler H. Radiation effe cts on cell renewal and related systems. Physiology Review 43:357-96, 1963. 32. Pegorarol L, Galenti N, Stien G and Baser ga R. The synthesis of phospholipids in the nucleus and nuclear membrane of synchronized HeLa cells. Cell and Tissue Kinetics 5:6577, 1972. 33. Pedrali-Noy G, Spadari S, Miller-Faurs A, Miller AO, Kruppa J, and Koch G. Synchronization of HeLa cell cultures by inhi bition of DNA polymerase alpha with aphidicolin. Nucleic Acids Res. 8:377–387, 1980. 34. Prather RS, Boquest AC, Day BN. Cell cycl e analysis of cultured porcine mammary cells. Cloning 1:17-24, 1999. 35. Samake S, Smilth LC. Synchronization of cell division in eight-cell bovine embryos produced in vitro: effects of nocodazole. Molecula r Reproduction and Development 44:486-92, 1996. 36. Kues WA, Anger M, Carnwath JW, Paul D, Motlik J, Niemann H Cell cycle synchronization of porcine fetal fibroblasts: effects of serum dep rivation and reversible cell cycle inhibitors. Biology of Reproduction 62:412-9, 2000.

PAGE 70

5737. Bello D, Webber MM, Kleinman HK, Wartinger DD, and Rhim JS. Androgen responsive adult human prostatic epithelial cell lines immortalized by human papillomavirus 18. Carcinogenesis 18:1215-1223, 1997. 38. Gross A, McDonnell JM and Korsmeyer SJ. Bcl-2 family members and the mitochondria in apoptosis. Genes Development 13: 1899-1911, 1999. 39. Cornfor P, Evans J, Dodson A, Parsons K, Woolfenden A, Neoptolemos J, and Foster CS. PKC isozymes patterns characteristically m odulated in early prostate cancer. American Journal of Pathology 154:137-144, 1999. 40. Bradford MM. A rapid and sensitive method fo r the quantitation of mi crogram quantites of protein utilizing the proiciple of protein-dye bi nding. Analytical and Biochemistry 72:248-254, 1976.

PAGE 71

58 Chapter 4 Involvement of cyclin-dependent kinases (cdks) in cell proliferation 4.0 Introduction As mentioned earlier in chapter 2, cell cycl e consists of S phase (DNA sythesis) and M phase (mitosis) and G1 and G2 phases (gap junctions) [1]. Cell cycle is controlled by cdks, a family of serine/theronie protein kinases. Thei r regulation ensures the correct timing of kinase activity during cell cycle. At least eleven cdks have been identified and their protein size ranges form 34-40 kDa (Table 4). However, only cdk1, 2, 4 and 6 are involved directly in cell-cycle control [2-7]. Cdk1 and 2 participate in M phase and S phase whereas cdk4 and 6 regulates cell cycle in response to ex tracellular factors [8]. Cdk5 is expressed in post-mitotic cells and is required for neural differentiation. Cdk8 and 9 are involved in transcription [9]. However, Cdk7 is not easily identified due to its complex with Cdk-activating kinase (CAK). CAK is a trim eric enzyme composed of Cdk7-cyclin H-Mat1 (mnage a trios) which participates in phosphor ylation of other cdks and is a general component of transcription factor, TFIIH [10]. Catalytic subunits of cdks do not act alo ne. Their ability to trigger cell cycle events depends on association with cyclin subunits (Figure 4.1). Most cyclins oscillate (i.e. expression level changes) during cell cycle and generate cdk activity. For example, cyclin D-cdk4/6 and cyclin E-cdk2 complexes phosphorylate the retinoblastoma protein (Rb) to facilitate G1 S transition. Cylin A-cdk2/1 and cyclin B-cdk1 complexes are required for S-phase progression and the G2 M transition respectively [11-13].

PAGE 72

59Cyclin-dependent kinases Table 4 Cdks and cycling partner in cell cycle Species Name Size (amino acid) Cyclin Partner Function H. sapiens Cdk1 Cdk2 Cdk3 Cdk4 Cdk5 Cdk6 Cdk7 Cdk8 Cdk9 Cdk10 Cdk11 297 298 305 303 292 326 346 464 372 283 502 Cyclin B Cyclin E, A ? Cyclin D p35 Cyclin D Cyclin H Cyclin C Cyclin K? ? ? M G1/S, S, possibly M G1? G1 Neural differentiation G1 CAK, transcription Transcription S? G2M? ?

PAGE 73

60 Figure 4.1 Cyclin and cdk complexes control cell cycle regulation. The cell cycle consists of G0/G1, S, G2, and M phases. The restriction (R) point is the transition point between mitogendependent to mitogen-independent progression of cell cycle. In quiescent cells, cdk-2,-4,-5 together with cyclin D are involved with G1 phase. While cyclin E/cdk2 complexes are involved with G1/S transition. In DNA synthesis phase (S phase), cyclin A/cdk2 and cyclin B/cdc2 complexes are expressed. Phosphorylation of cdc-2/cyclin B allows G2/M transition.

PAGE 74

614.1 Cdk in transcription and activation by phosphorylation Cyclin binding alone is not enough to fully acti vate cdks involved in cell-cycle control. Complete activation of most cdks requires phosphor ylation of the cdk at a conserved threonine by CAK. The fully active complex can be turned off by a variety of mechanisms: Cdk inhibitory subunits (CKIs) inactivate some cdk-cyclin complexes, or regulatory kinases can phosphorylate the cdk subunit at inhibitory sites near the N terminus [14-17]. In the nucleus, CAK is part of general tr anscription factor (TFIIH) and phosphorylates RNA polymerase II at C-terminal domain (CTD) (Figure 4.2). This allows transcription to progress from the preinitiation stage to the initiation stag e. At mitosis, xeroderma pigmentosum disorder group D (XPD) degrades dissociated CAK from TF IIH, thus, removing its transcription, promoting CTD kinase activity and releasing the trimetric CAK to act as a cell-cycle promoter [18]. In proliferating cells, CAK levels are constant and t he levels of the subunits are not regulated by transcription or selective proteolysis. Free CAK is then able to phosphorylate cdk1, 2, 4 and 6 [19, 20]. For example, binding of cdk2 to cyc lin A induces a conformational change in the kinase and allows ATP to bind the substrate. Secondly, CAK is phosphorylated at a threonine residue (Thr160 in human cdk2) optimizes substrate binding affinity and align su bstrates for phosphoryl transfer [21-25]. In addition, Cdk7 autophosphorylates at threonine 170 and serine 164. Both sites are located on activation loop (T-loop). Phosphorylation of threonine 170 (Thr170) does not increase CAK activity but, it facilitates the interaction between Cdk7 and cyclin H [26-28]. MAT1 can substitute for Thr170 phosphorylation and activates Cdk7/cyclin H [29-30]. Phosphorylation of serine 164 enhances CAK activity and increases cyclin binding affinity [31-32]. 4.2 Cdk inhibition by subunits and phosphorylation The activity of cdk-cyclin complexes is cont rolled by cdk-inhibitory subunits (CKIs). There are two major structural families of CKIs: Cip/Kip and Ink4. The Cip/Kip family includes p21, p27, and p57, which inhibits cdk2and cdk4/6-cyclin complexes involved in G1 and G1/S

PAGE 75

62control. Members of the Ink4 family (p15, p16, p18, and p19) specifically inhibit cdk4 and cdk6cyclin D complexes. These CKIs proteins are im portant for promoting the arrest of the cell cycle in G1-phase by responding to unfavorable environmenal conditions or intracellular signals such as DNA damage [33-34]. Phosphorylation of cdks at conserved tryr osine (Tyr15) is another mechanism where cdkcyclin complexes are inhibited. In eukaryotes ce lls, WeeI phosphorylates Tyr 15 and inactivates the cdk-cylin complex. Dephosphorylation by t he phosphatase cdc25 leads to reactivation. Hence, a change in phosphorylation is important in the timing of mitosis, G1/S and S-phase in cdk activation [10]. There is much evidence that CAK/Cdk7 c ontributes significantly in cell cycle. Our hypothesis states that PKCphosphorylates CAK/Cdk7, which in turn phosphorylates cdk2. The following experiments were carr ied out to investigate the prop osed pathway (Figure 4.3) in prostate cells.

PAGE 76

63 DNA P P P P P P RNAPre-initiation InitiationElongationRNA-Pol II CTD TFIIH P-TEFb (Cdk9/Cylin T)Transcription RNA Mitotic silencing of transcriptionCAK/XPD XPD degredation Phosphorylation by CDK1/cyclin B P P P CAK Cdk7 Mat cyclin H pCAK CDK CDK/Cyclin pCDK/Cyclin cyclin synthesis P PP P pRb Cell Cycle Figure 4.2 Schematic illustration of cdk in transcripti on and phosphorylation in cell cycle control [18].

PAGE 77

64 CDK-7 CAK CDK-2 Rb/E2F Apoptosis SurvivalDifferentation Proliferation PKC Figure 4.3 Schematic representation of cell prolifer ation pathway. We hypothesized that PKCphosphorylates Cdk7/CAK, which in turn phosphorylates cdk2, drives cell cycle and cell proliferation.

PAGE 78

654.3 Material and Methods Most materials and methods used in this chap ter are found in chapter 3, section 3.1. Materials and methods used solely in this chapter are described below. 4.3.1 Immunoprecipitation and Western Blot Analysis Cells were placed on ice to terminate the in cubation. Cell extracts were prepared by washing twice with ice cold DPBS. Monolayers were scraped at 4 oC, resuspended and sonicated in 2 ml homogenization buffer. Cell suspensions were centrifuged at 40 000 g for 30 min to obtain cell extracts. Protein conten t was measured according to Bradford [39]. Immunoprecipitation was carried out as follows: cell lysataes (1 mg) were pre-cleared for 30 min at 4 oC with anti-rabbit IgG-agarose beads (1:1 v/v, 10 l) (catalog number A8914; Sigma Aldrich) and incubated with 5 g of anti-cdk7 (5 g; sc-727) rabbit polyclonal antibody for overnight at 4oC and then additional 1 h with anti-rabbit IgG-agarose beads (1:1 v/v, 50 l). Protein samples were separated by 10% SDS-PAGE and electroblotted onto supported nitrocellulose paper. Each blot was blocked for 1 h with 5% fat-free milk TTBS solutions at room temperature. Protein bands were probed with their respective primary antibody (described in chapter 3, section 3.1). Phospho specific antibodies were used as follow: phospho-cdk2 (Threonine 160) (catalog number 2561; Cell Signaling Technology, Danvers, MA) 1:1000 dilution (5 g) in 5% bovine serum albumin BSA; phospho-cdk7-T170 catalog number AP3068a (ABGENT, San Diego, CA) 1:1000 dilution (5 g) in 5% BSA were incubated at 4 oC overnight followed by horseradish-peroxidase-c onjugate anti-rabbit secondary antibody. The negative controls were immunoprecipitat ed as follow: the first negative control was with normal rabbit IgG beads with cell lysates (1 mg); the second negative control include cell lysate 1 mg plus normal rabbit IgG plus 5 g of normal rabbit serum (catalog number 12-370; Upsate). All the immuoreactive bands were visua lized with chemiluminescence according to the manufacturers’ instructions (SuperSignal West Pico Chemiluminescent Substrate; PIERCE, Rockford, IL).

PAGE 79

664.4 Results 4.4.1 Association of PKC-and Cdk7 in RWPE-1 cell proliferation Cell proliferation involves activation of cdks at different cell cycle phases. To test if PKCis associated with Cdk7, we immunoprecipitated PKCfrom RWPE-1 and performed Westerns probing for Cdk7. There was a transient association of PKCand Cdk7 at the 30 h time point (Figure 4.4A). Association of cdk2 was also observed with Cdk7 (Figure 4.4B). Whole cell lysates of 100 g were used as positive control. The two negative controls: one with molecular beads and another with normal rabbit serum show no reaction with anti-Cdk7 or anti-cdk2 primary antibodies. Phosphorylation of Cdk7 (Threonine 170) and cdk2 (Threonine 160) were also observed throughout the cell cycle (F igure 4D, 4E). Straight West ern blots of cdk2 detected the presence of cdk2 throughout cell cycle. Western blots of -actin verify equal loading of samples in each lane. Taken together, these results suggest that PKCis transiently associated with Cdk7, which in turn phosphorylated cdk2 for cell proliferation of RWPE-1 cells. 4.4.2 Association of PKC-and Cdk7 in LNCaP cell proliferation A similar experiment was carried out LN CaP cells. The association of PKCand Cdk7 was observed at the 33 hour time point. Like RWPE-1, the association was transient and weak. We found no association of cdk2 with Cdk7 in LNCaP cells (data not shown). Western blot of cdk2 reveals fluctuation of cd k2 expression with the cell cycl e whereas Cdk7 expression is constitutive throughout the cell cycle. Phosp ho-cdk2 (Threonine 160) was observed at 21-36 hours time point which reflects the cdk2 expression time point. Whole cell lysates were used as positive controls. Negative controls include molecular beads and normal rabbit serum. There were no reactions between primary antibodies and the two negative controls. In DU-145 cells, there was no association of PKCwith Cdk7 (data not shown); nor were PKC isozymes associated with Cdk7.

PAGE 80

67 Figure 4.4 Association of PKCwith Cdk7 in RWPE-1 cells. Whole cell extracts (1 mg) from each time point were immunoprecipitated with rabbit polyclonal anti-Cdk7 (5 g) as described in Materials and Methods. Column 1 is both positive (+) and two negative controls (). The positive control (+) is the whole cell lysates (100 g), the first negative control (-) contains w hole cell lysates (1 mg) plus rabbit IgG whole molecule (50 l of 1:1 v/v). The second negative control contains whole cell lysate (1 mg) plus rabbit IgG whole molecule (50 l) and normal rabbit IgG serum (5 g). Column 2 is the cell lysates taken at the indicated time point. Immunoprecipitates were separated by SDS-PAGE and Western bl otted with anti-PKCmouse monoclonal antibody. Physical association of PKCand Cdk7 were observed at 30 hour time points (A). Immunoprecipitation with rabbit polyclona l Cdk7 (B) showed that cdk2 is also co-immunoprecipitated (C) Western blot of phospho-Cdk7 (p-Cdk7; T170) phospho-cdk2 (p-cdk2; T160) were also observed (D, E). Presence of cdk2 was observ ed throughout the cell cycle (F) and -actin (G) shows equal loading of samples in each lane. IP: immunoprecipitation, WB: Western blot.

PAGE 81

68 Figure 4.5 Association of PKCwith Cdk7 in LNCaP cells. Whole cell extracts (1 mg ) from each time point were immunoprecipitated with rabbit polyclonal anti-Cdk7 (5 g) as described in Materials and Methods. Column 1 is both positive (+) and two negative controls (-). The positive control (+) is t he whole cell lysates (100 g), the first negative control (-) contains w hole cell lysates (1 mg) plus rabbit IgG whole molecule (50 l of 1:1 v/v). The second negative control contains whol e cell lysate (1 mg) plus rabbit IgG whole molecule (50 l) and normal rabbit IgG serum (5 g). Column 2 is the cell lysates taken at the indica ted time point. Immunoprecipitates were separated by SDS-PAGE and Western bl otted with anti-PKCmouse monoclonal antibody. Physical association of PKCand Cdk7 were observed at 30 hour time points (A) Immunoprecipitation with rabbit polyclonal Cdk7 (B). Cdk2 expression (C) is dependent on cell cycle wh ile Cdk7 (D) is expressed consitutiv ely. Phospho-cdk2 (p-cdk2; T160) were also observ ed parallel to cdk2 expression (E). Beta-actin (F ) shows equal loading of samples in each lane. IP: immunoprecipitation, WB: Western blot.

PAGE 82

694.5 Discussion As mentioned above cdk-activating kinase (CAK) is a master cell cycle regulator and we have shown that PKCtransiently associates with Cdk7 at the 30 hours time point in RWPE-1 cells. This physical association indicates that PKCmay contribute to cell cycle progression. In addition, we found an association between Cdk7 and cdk2. Cdk7 is known to phosphorylate cdk2, 4 and 6 [35, 36]. Cdk7 also phosphorylates itself on the activation segment at theronine 170 (T170) but does not contribute to CAK activity [29-30]. We have shown the presence of phospho Cdk7 and phospho cdk2 through out the ti me points. The results strongly indicate PKCcomplexes with Cdk7 which in turn phosphorylate cdk2 at threonine 160 (T160). Whether PKCtruly phosphorylate Cdk7 is still questionable. However, previous data indicate that PKCactivates Cdk7 in glioma cells [38]. Further experiments described in later chapters will strengthen our hypothesis. Similarly, LNCaP cells show association of PKCwith Cdk7 at the 33 hours time point. It has been shown that Cdk7 is ubiquitously ex pressed in tumor cells and Cdk7 activity is invariant during cell cycle [20, 37]. Our result al so shows that Cdk7 is constitutively expressed through out the cell cycle. Howeve r, cdk2 expression level fluctuat e thoroughout the cell cycle. The phosphorylation of cdk2 was similar to cdk2 expression pattern i.e, expression from 21-36 hours time point. Corresponding physical association of PKCand Cdk7 was observed at the 33 hours time point. Taken together, both RWPE -1 cells and LNCaP cells demonstrate PKCassociation with Cdk7, which in turn phosphorylat es cdk2 and contributes to cell proliferation. However, in DU-145 cells, similar experiment s were carried out as above but there was no association of PKCwith Cdk7 (data not shown); nor were PKC isozymes associated with Cdk7 (data not shown). Beside Cdk7, there are other cdks, for example, cdk-4 and cdk-6 can drive the cell cycle. Hence, PKCis not involved with Cdk7 in cell cycle but the presence of PKCmay be required for cell survival in DU-145 cells.

PAGE 83

704.6 References 1. Bruce Alberts, Dennis Bray, Alexander Johns on, Julian Lewis, Martin Raff, Keith Roberts, Peter Walter. Essential Cell Biology: An introdu ction to the molecular biology of the cell. Garland Publishing Inc., NY, 547-589, 1998. 2. Morgan DO. The cell cycle: principles of c ontrol. New Science Press Ltd, London, UK, 30-31, 2007. 3. Winge O and Lautsen O. On two types of spor e germination, and on genetic segregations in Saccharomyces demonstrated through single-spore cultur es. C. R. Trav. Lab, Carlsberg, Ser. Physioll, 22, 99, 1937. 4. Lindegren CC and Lindegren G. Segregation, mutation and copulation in Saccharomyces cerevisiae Ann Missouri Botanical Garden, 30:453, 1943. 5. Hartwell LH, Cultotti J, and Reid, B. Genetic control of the cell division cycle in yeast I. Detection of mutants. Proccedings of Na tional Academy of Science USA 66:352, 1970. 6. Williamson DH. The timing of deoxyribonucleoti de and acid synthesis in the cell cycle of Saccharomyces cerevisiae. The Journal of Cell Biology 25:517, 1965. 7. Hartwell LH. Macromolecule synthesis in temperature-sensitive mutants of yeast. The Journal of Bacteriology 93: 1662, 1967. 8. Ubersax JA, Woodbury EL, Quang PN, Paraz M, Blethrow JD, Shah K, Shokat KM, Morgan DO. Targets of the cyclin -dependent kinase Cdk1. Nature, 425:859-864, 2003. 9. Fisher RP. Secrets of double agent: cdk7 in cell-cycle control and transcription. Journal of Cell Science 118:5171-5180, 2005. 10. Morgan DO. Cyclin-dependent kinases: engi nes, clocks, and microprocessors. Annual Review of Cell and Developmental Biology 13:261-91, 1997. 11. Shapiro GI. Cyclin-dependent kinase pathways as targets for cancer treatment. Journal of Clinical Oncology 24:1770-1783, 2006. 12. Sherr CJ. G1 phase progression: cyclin on cue. Cell 79:551-556, 1994. 13. Pines J. Cyclins: wheels within wheels. Cell Growth and Differentiation 2:305-310, 1991.

PAGE 84

7114. Harper JW, Elledge SJ. The role of Cdk7 in CAK function, a retro-respective. Genes and Development 12:285-289, 1998. 15. Morgan DO. Principles of CDK regulation. Nature 374:131-134, 1995. 16. Sherr CJ and Roberts JM. Inhibitors of mammalian G1 cyclin-dependent kinases. Genes and Development 9:1149-1163, 1995. 17. Nigg EA. Cylin-dependent kinase 7: at the cr oss roads of transcription, DNA repair and cell cycle control? Current Opini on in cell Biology 8:312-317, 1996. 18. Chen J, Larochelle S, Li X, Suter B. Xpd/Ercc2 regulates CAK activity and mitotic progression. Nature 424:228-32, 2003. 19. Lolli G, Johnson LN. CAK-cyclin-dependent ac tivating kinase: a key kinase in cell cycle control and a target for drugs? Cell Cycle 4:572-577, 2005. 20. Tassan JP, Schultz S, Bartek J, Nigg EA. Ce ll cycle analysis of the activity subcellular localization and subunit composition of human CAK (CDK activating kinase). The Journal of Biological Chemistry 127:467-78, 1994. 21. Jeffery PD, Russo AA, Polyak K, Gibbs E, Hurwirz J. Massague J, Pavletich NP. Mechanism of cdk activation revaled by the st ructure of cyclin A-CDK2 complex. Nature 376:313-20, 1995. 22. Russo AA, Jeffrey PD, Pavletich NP. Structur al basis of cyclin-dependent kinase activation by phosphorylation. Nature Stru ctural Biology 3:696-700, 1996. 23. Brown NR, Noble MEM, lawrie AM, Morns MC, Tunnah P, Divita G, Johnson LN, Endicott JA. Effects of phosphorylation of threonine 1 60 on cyclin-dependent kinase 2 structure and activity. The Journal of Biological Chemistry 274:8746-56, 1999. 24. Jonhson LN, Noble MEM, Owen DJ. Active and inactive protein kinases. Cell 85:149-59, 1996. 25. Stevenson LM, Deal MS, Hagopian JC, Lew J. Activation mechanism of CDK2: Role of cyclin binding verses phosphorylatio n. Biochemistry 41:8528-34, 2002.

PAGE 85

7226. Poon RYC, Vamashita K, Howell M, Ershler MA, Belyavsky A, Hunt T. Cell cycle regulation of the p34cdc2/p33cdk2 activating kinase p40MO15. Journal of Cell Science 107:2789-2799, 1994. 27. Gerber MR, Farrell A, Raymond JD, hers kowitz I, Morgan DO. Cdc37 is required for association of the prot ein kianse Cdc28 with G1 and mitotic cyclins. Proceedings of National Academy of Science USA 92:4651-4655, 1995. 28. Makela TP, Tassan JP, Nigg EA, Frutiger S, Hughes GJ, Weinberg RA. A cyclin associated with the CDK-activating kinase MO15. Nature 371;254-257, 1994. 29. Fisher RP, Jin P, Chamberlin HM, Morgan DO. Alternative mechanism of CAK assembly requires an assembly factor or an activating kinase. Cell 83:47-57, 1995. 30. Devault A, Martinetz AM. Fesquet D, L abbe JC, Tassan JP, nigg EA, Cavadore JC. Doree M. MAT1 a new RING-finger protein subunit st abilizing cyclinH-cdk7 complexes in starfish and Xenepus CAK. EMBO Journal 14:5027-36, 1995. 31. Martinez A-M, Afshar M, Martin F, Cavador e JC, Labbe JC, Doree M. Dual phosphorylation of the T-loop in cdk7. Its role in controlling cy clin H binding and CAK activity. EMBO Journal 16:343-54, 1997. 32. Lolli G, Lowe ED, Brown NR, Johnson LN. The crystal structure of human CDK7 and its protein recognition properties Structure 12:2067-79, 2004. 33. Harper JW, Elledge SJ. Cdk inhibitors in development and cancer. Current Opinion in Genetics and Development 6:56-84, 1996. 34. Sherr CJ and Roberts JM. CDK inhibitors : positive and negative regulators of G1-phase progression. Genes and Development 13:1501-1512, 1999. 35. Wohlbold L, Larochelle S, Liao JCF, Livshits G, Singer J, Shokat KM, Fisher RP. The cyclindependent kinase (CDK) family member PNQALRE/ CCRK supports cell proliferation but has no intrinsic CDK-activating kinase (CAK) activity. Cell Cycle 5:546-554, 2006. 36. Lolli G and Johnson LN. Recognition of cdk2 by cdk7. Proteins: Structure, Function, and Bioinformatics 67:1048-1059, 2007.

PAGE 86

7337. Bartkova J, Zemanova M, Bartek J. Expr ession of CDK7/CAK in normal and tumor cells of diverse histogenesis, cell-cycle position and differentiation. International Journal of Cancer 66:732-7, 1996. 38. Acevedo-Duncan M, Patel R, Whelan S and Bicaku E. Human glioma PKCand PKCphosphorylate cyclin-dependent kinase activating kinase during the cell cycle. Cell Proliferation 35:23-36, 2002. 39. Bradford MM. A rapid and sensitive method fo r the quantitation of mi crogram quantites of protein utilizing the principle of protein-dye bi nding. Analytical and Biochemistry 72:248-254, 1976.

PAGE 87

74 Chapter 5 Effects of PKCsilencing RNA on cell prolif eration in prostate cells 5.1 Introduction Post-transcriptional gene silencing (PTGS) is the introduction of double-stranded RNA (dsRNA) or RNA interference (RNAi) to knock out expression of specific genes in a variety of organisms [1-3]. PTGS was initially observ ed in petunia plants by Rich Jorgensen and colleagues. They introduced a pigment-produc ing gene to deepen the purple color of these flowers. Instead of producing deep purple color, many of these flowers develop variegated or white. This phenomenon was termed ‘co-suppressi on’ as the expression of both the introduced gene and the homologus endogenous gene was suppressed [4-5]. Gene silencing was performed in nematode Caenorhabditis elegans by Guo and Kemphues [6]. They introduced antisense RNA to block the expression of the par-1 gene in order to assess its function. However, both the in jected antisense RNA and sense-strand disrupted expression of par-1 [6]. This result was puzz ling until Andrew Fire and Craig Mello introduced dsRNA, uncoding unc-22 RNA, into the gonad of C. elegans A decrease in unc-22 gene encoding the myofilament protein produced severe twitching movements. In addition, neither sense-RNA or antisense-RNA introduction to C. elegans provoked this phenotype. Furthermore, injection of dsRNA into the gut of the worm caused gene silencing not only throughout the worm, but also in its first generation offspring [7]. This milestone discovery led them to a Noble Prize in 2006 and RNAi has emerged as a powerful tool in molecular biology. 5.2 RNAi mechanism Prior to the siRNA era, approaches such as gene targeting by homologus recombination, ribozymes, and antisense technologies were commonly used to determine gene functions. However, these techniques have limitations and none can be applied universally [8]. RNAi/PTGS

PAGE 88

75has facilitated an efficient and inexpensive way to study gene functions. The key process is the initiation step. In the initiation step, an RNase III like enzyme Dicer (DCR) is able to digest the dsRNA into 21-25 neucleotides generating small interfering RNA species (siRNA) (Figure 5.1) [10-12]. The double-stranded siRNAs then bind to endoribonuclease-containing complexes known as RNA-induced silencing complexes (RIS Cs), unwinding in the process. The siRNA strands subsequently guide RISCs complex to sequence-specific, complementary mRNA molecules. The siRNA-RISC complex then cleaves the mRNA in the middle of its complementary region leading to the silencing of the targeted gene [13-15]. In eukaryotic cells, particularly in mammalian cells, dsRNAs triggered nonspecific suppression of gene expression [16]. This hampe red RNAi function of targeted gene. However, if dsRNAs are shorter than 30 bp, including siRNA duplexes, they do not affect nonspecific responses. Hence, synthetic siRNAs (22-25 nucleotides) were developed to prevent nonspecific binding. Another intriguing feature of RNAi is amplification of siRNA. Studies in C. elegans and D. melanogaster have demonstrated that synthetic siRNAs can suppress genes similar to those of the long dsRNAs [10, 17]. Based on these experimental analyses, siRNAs are being optimized to decipher the function of virtually any gene that is expressed in a cell type or pathway-specific manner. Similarly, in the following experiments, we use PKCsiRNA to elucidate prostate cell proliferation and survival pathways.

PAGE 89

76 Figure 5.1 The mechanism of RNA in terference (RNAi) [14].

PAGE 90

775.3 Materials and Methods Most materials and methods used in this chapter ar e found in chapter 3, section 3.1. Materials and methods used solely in this chapter are described below. 5.3.1 Inhibition of gene expression with siRNA For short interference RNAs: control siRNA-A (sc-37007), PKCsiRNA (h2) (sc-44320), PKCsiRNA (sc-29451), PKCsiRNA (sc-36253), siRNA transfection reagent (sc-29528), and transfection media (sc-36868) were purchased from Santa Cruz Biotechnology, CA. RNA interference functions by a regulator mechanis m for sequence-specific gene silencing through double stranded RNA (dsRNA). Sequence specific RNA that was 19-25 nucleotides in length were synthesized by Santa Cruz Biotechnology against PKC. The PKCsiRNA is a pooled sequence which consists of three combined RNA sequences – mRNA locations. The gene accession number for PKCis NM_002740. PKCsiRNA: 663 5’-CAAGCCAAG CGUUUCAACA-3’;5 ’-UGUUGAAACGCUUGGCUU G-3’; 739 5’-GGAACGAUUGGGUUGUCAU-3’, 5’-AUGACAACCCAAUCGUUUCC-3’; 2137 5’-CCCAAUAUCUUCUCUUGUA-3’, 5’-UACAAGAGAAGAUAUUGGG; PKCsiRNA: 5’AAGACGACACAUGUCUCUCACCCUGUCUC 5'AUACAUUUCU ACAGC UA GC -3' antisense: 5’-GAGACAGGGUGAGAGACAUGUGUCGUCUU 5' -GCUAGC UGUAGAAAUGUAU -3' sense; PKCsiRNA: 5'-UCAUAAAUCAGUUUCUCAC -3' antisense 5'AUGACAAAGAAAUUCUGAC 3' antisense, 5'-GUGAGAAACUGAUUUA UGA 3' sense 5'GUCAGAAUUUCUUUGUCAU -3' sense. Negative controls containing a scra mble sequence that do not lead to the specific degradation of any known cellular mRNA were synt hesized. The control siRNA-A sequence is proprietary and the manufacuture (Santa Cruz Bi otechnology) does not reveal the sequence. The effects of PKCPKC, PKCsiRNA were determined in exponentially growing RWPE-1 cells, LNCaP cells and DU145 cells in complete media over 72 hours. Cells were plated on 75 cm2 at a density of 1.5 to 2.5 x 105 cells/flask.

PAGE 91

78 The siRNAs complexes were made according to the following procedures: 60 l of siRNAs (10 M stock solution) were combined with 60 l of tranfection reagent and incubated at room temperature for 30 minutes to make the siRNA complex. The siRNA complex was then added to twenty four hours post plated cells gi ving a final concentration of 50 nM of siRNA complex in complete media. The cells were incubated with either siRNA-A, PKCPKC, PKCsiRNA (50 nM for RWPE-1, 100 nM for LNCaP and 150 nM for DU145 respectively). Following treatments, the cells were washed with pho sphate buffered saline (PBS), trypsinized and resuspended in 2-3 ml of PBS. Cell viability was quantified us ing trypan blue exclusion as say (section 3.1.1) and the numbers of unstained cells were counted as m entioned above. Three independent experiments were carried out for each treatment with controls. Cell viability was determined relative to vehicle control using the mean and SD for each time point. Statistical determination by Student’s T test using Minitab program (Minitab Inc. State College, PA) 5.3.2 Western blot analysis Briefly, after treating the cells with their re spective siRNAs, protein assay was performed and 15 g of protein were loaded onto 10% SDS PAGE and Western blotted as described earlier in section 3.1.5. Briefly, primary antibodies were diluted in 5% milk TTBS. The primary antibodies used were a PKCmouse monoclonal (5 g, 1:4000 dilutions). PKC(5 g, 1:1000 dilution) and PKC(5 g, 1:4000 dilution) were rabbit polyclonal. Beta-actin (5 g, 1:1000 dilutions) was a goat polyclonal. The nitrocellulose membranes were incubated with their respective antibody at 40C overnight. The next day, primary antibodies were washed with 20 ml of TTBS (three times) subsequently incubated with their respective secondary antibody at room temperature for 1 hour. Secondary antibodies such as HRP Goat x Mouse IgG, HRP Goat x Rabbit IgG, bovine anti-goat IgG were diluted 1: 10000 in 5% milk TTBS. Immuoreactive bands were visualized with chemilluminescence as described in section 3.1.5. 5.3.3 Cell Cycle Analysis by Flow Cytometry

PAGE 92

79The detailed method was previously described in chapter 3, section 3.1.4. Briefly, cells were treated with siRNA complex and removed at indicated times. The cells were washed in Dulbecco’s phosphate-buffered salin e (DPBS), trypsinized, and fixed by dropwise addition (while vortexing) of cold ethanol until a concentrati on of 60% ethanol was reached. The day before analysis, the cells were treated with 50 l of RNase and propidium iodide (PI) 10 L. The distributions of 1 x 106 nuclei were quantified using a FAC STARPlus flow cytometry. The results from three separate independent experiments were used to determine the mean viability and standard deviation for each time point. 5.4 Results 5.4.1 Effects of PKCsilencing RNA on cell proliferation in RWPE-1cells, LN CaP cells and DU145 cells To provide additional evidence that PKCis required for cell proliferation in RWPE-1 cells, PKCwas temporarily inhibited using PKCsiRNA. After titrating PKCsiRNA concentrations from 50-100 nM, we used an optimal concentration of PKCsiRNA (50 nM) and control siRNA to suppress PKCexpression. Treatment with PKCsiRNA (50 nM) decreased the number of viable cells by 87-96% after 24-72 hours ( p = 0.005, 0.004, 0.001 respectively) compared to control cells (Figure 5.2A). Howeve r, transfection with siRNA complex creates some toxicity to RWPE-1 cells. The control viable cells were lower than the numer of original cells plated at 24 h time point but it was overcome over the 24 h of incubations. Immunoblotting of PKCexpression shows no effect in co ntrol siRNA. Immunoblotting for PKCin PKCsiRNA treated RWPE-1 cells showed that expression decr eased by 90-92%. Absorbance densitometry (Figure 5.3A and D) shows the average of three independent PKCimmunoblot for both RWPE-1 cell treatments ( p = 0.013, 0.005, 0.029). To show sp ecificity, we immunobloted for PKCisoforms which is 98% identical to PKC(Figure 3A, second row).

PAGE 93

80 The PKCsiRNA effect was isospecific to the PKCisozyme and did not affect the atypical PKCisoforms. Similaly, LNCaP cells were treated with control siRNA and PKCsiRNA (100 nM). However, there was no significant decrease in cell number (Figure 5.2 B). Their p values were p = 0.038, 0.096, 0.269 respectively. T he siRNAs concentration was not increased due to some toxicity to cells. There was a sli ght decrease in LNCaP control cells post 24 hour transfection but later cells grew back between 24-72 hour. Immunoblot of PKCshows no significant decrease in PKCcompare to control siRNA ( p = 0.138, 0.050, 0.560) (Figure 5.3B and E). Therefore, the cells continue to proliferate. PKCsiRNA did not affect PKCisoforms (Figure 5.3B, second row). In accordance with our hypothesis that PKCmay be antiapoptotic and required for cell survival in DU-145 cells. Treatment with PKCsiRNA (150 nM) showed a decrease in cell viability by more than 80% compared to control si RNA (p = 0.002, 0.006, 0.004) (Figure 5.2C). Immunoblotting for PKCin PKCsiRNA treated DU-145 cells demonstrated a decrease in PKCexpression by 60-70% between 2472 hours (Figure 5C). The PKCsiRNA effect was isospecific to the PKCisozyme and did not affect atypical PKCisoforms (Figure 5.3C, second row). Absorbance densitometry (Figure 5.3F) compared the effects of PKCsiRNA and show the average of three independent PKCimmunoblot for DU-145 cells ( p = 0.001, 0.022, 0.015). 5.4.2 Effects of PKCand PKCsilencing RNAs on cell proliferation in RWPE-1 cells and DU145 cells More specifically, RWPE1 cells treated with PKCand PKCsiRNAs expressed a time dependent decrease in their viable cells compared to control siRNA (Figure 5.4). The respective protein expression in siRNA treated cells is shown in Figure 5.4B, C. The lack of effects on PKCexpression demonstrated specificity of PKCPKCand PKCsiRNA treatments in both cell lines. PKC( p = 0.008, 0.007, 0.019) siRNAs result ed in greater cell death compared to PKCsiRNA ( p = 0.007, 0.001, and 0.03) treated cells in RWPE-1 cells(Figure 5.4A). Similar results were obtained with DU-145 cells treated with PKCsiRNA ( p = 0.048, 0.012, 0.007) and PKC

PAGE 94

81siRNA ( p = 0.002, 0.006, 0.004). Thus, PKCsiRNA is isospecific to PKCand does not affect other PKC isoforms. Suppression of atypical PKCleads to greater cell deaths in both cell lines. 5.4.3 Effects of PKCsiRNA on cell cycle We established by flow cytometery whic h cell cycle phase was disrupted by treatment with PKCsiRNA. RWPE-1 cell cycle analysis sh owed a 44-63% decrease in S-phase and a more than two-fold increase in G2/M phase compared to control siRNA throughout the time period (Figure 5.5A and Table 5). Thus, PKCsiRNA inhibits G2/M cell cycle phase in RWPE-1. However, in DU-145 cells, PKCsiRNA increased the G0/G1 phase by 34-36%, and decreased the DNA synthesis (S-phase) by 41-44% throughout the time course (Figure 5.6A and Table 6). Hence, PKCsiRNA inhibited the G1/S transition in DU-145 cells.

PAGE 95

82 RWPE-1 0 100 200 300 400 500 600 Control siRNA PKCsiRNA (60nM) DU-145Hours 0244872 0 500 1000 1500 2000 Control siRNA PKCsiRNA (150 nM) LNCaP Number of viable cells ( 1 x 10 3 ) 0 200 400 600 800 1000 1200 1400 Control siRNA PKCsiRNA (100 nM) A B C Figure 5.2 Effect of PKCsiRNA on prostate cells. RWPE-1 (A), LNCaP (B) and DU-145 (C) cells. Subconfluent cells (2.5 x 105) were treated with PKCsiRNA (50 nM for RWPE-1, 100 nM for LNCaP and 150 nM for DU-145) complex from 24-72 h as described in “Materials and Methods.” At the indicated time, the viable ce lls were counted using trypan blue exclusion assay and a hematocyometry. Three independent experiments were performed and the mean of the viable cells and SD were plotted. There is a decrease in cell proliferation in PKCsiRNA treated cells compared to control siRNA. Their standard values were as follow: RWPE-1 (0.005, 0.004, 0.001); LNCaP (0.038, 0.098, 0.269); DU-145 (0.002, 0.006, 0.004).

PAGE 96

83 D RWPE-1 244872Absorbance aribitrary units (1 x 10 3 ) 0 20 40 60 80 100 120 Control siRNA-A PKCsiRNA (50 nM) E LNCaP Hours 244872 0 20 40 60 80 100 Control siRNA PKCsiRNA (100nM) F DU-145 244872 0 10 20 30 40 50 60 70 Control siRNA PKCsiRNA Figure 5.3 Immunoblot of PKCs in siRNA treated cells. After counting the cells (Figure 5.2), the same populations of treated cells were immunoblot for PKC, as described in “Materials and Methods.” A protein concentration of 15 g was loaded on each lane for each time point and separated by SDS-PAGE and Western blotted with anti-PKCmouse monoclonal or anti-PKCrabbit polyclonal antibody. There was no or very little PKCpresent in PKCsiRNA treated cells compared to control siRNA. PKCsiRNA has no or very little effect on PKCindicating specificity (A-C). Immunoblot with goat polyclonal -actin shows that the loading of protein is equal in all lanes. Densitometry on PKCimmunoreactivity was taken from three independent westerns and the mean of their absorban ce and SD was plotted (D-F). Their p values were as follow: RWPE-1 ( p = 0.013, 0.005, 0.029); LNCaP ( p = 0.138, 0.050, 0.560); DU-145 ( p = 0.001, 0.022, 0.015).

PAGE 97

84 A RWPE-1 0244872Number of viable cells (1x10 3 ) 0 500 1000 1500 2000 2500 3000 Control siRNA PKCsiRNA PKCsiRNA PKCsiRNA DU-145 Hours 0244872 0 500 1000 1500 2000 Control siRNA PKCsiRNA PKCsiRNA PKCsiRNA Figure 5.4 Effects of PKCand PKCsiRNA treatment on RWPE-1 cells and DU-145 cells. (A) Similar density of cells were plated as mentioned in Fig. 5 and treated with PKCand PKCsiRNA respectively. Three independent experim ents were performed and the mean of PKCand PKCwere plotted against PKCsiRNA proliferation curve (Figure 5.2); along with control siRNA and their SD.

PAGE 98

85 Figure 5.4 (B) In PKCtreated siRNA cells, the immunoblot of PKCand PKCwas performed according to “Materials and Methods”. Western blot of -actin verify that protein level (15 g) were equally loaded in each lane. The maximal effect of PKCsiRNA was at 48 h and 72 h for RWPE-1; 24h for DU-145 cells (C) Similarly, PKCsiRNA treated cells were immunoblotted for PKCand PKCrespectively using specific antibodies mentioned in “Material and Method”. Equal amount of protein (15 g) were loaded in each lane and verified by -actin protein content. The maximal effect of PKCsiRNA was at 24 h and 48 h for both RWPE-1 and DU-145 cells.

PAGE 99

86 Figure 5.5 Effects of PKCsiRNA on the RWPE-1 cell cycle. Cells were treated with both control siRNA and PKCsiRNA as described in “Materials and Methods”. At the indicated time the cells were trypsyni zed and incubated with 60% ethyl alcohol: 40% DPBS overnight at -20oC. The day before analysis, the 1 x 106 cells/ml were counted and treated with 1ml of PBTB, 50 l RNAse and 10 l of propidium iodine (PI). The distributions of 40,000 nuclei were quantified using a FAC STARPLUS, flow cytometer and ModFitLT Cell Cycle Analysis program. The histograms are from one representative ex periment and illustrate DNA content for Go/G1 peak at (first red shaded peak), DNA synthes is phase (S) and gap2 and mitosis (G2M, second red shaded peak). Forty thousand events were collected pe r time point and treatment group. The data represent one of the three independent experiments. The average cell cycle distribution is shown in Table 5.

PAGE 100

87 Figure 5.6 Effects of PKCsiRNA DU-145 cell cycle. Cells were treated with both control siRNA and PKCsiRNA as described in “Materials and Met hods”. At indicated times the cells were trypsynized and incubated with 60% et hyl alcohol: 40% DPBS overnight at -20oC. The day before analysis, the 1 x 106 cells/ml were counted and treated with 1ml of PBTB, 50 l RNAse and 10 l of PI. The distributions of 40,000 nu clei were quantified using a FAC STARPLUS, flow cytometer and ModFitLT Cell Cycle Analysis program. The histograms are fr om one representative experiment and illustrate DNA content for Go/G1 peak at (first red sh aded peak), DNA synthesis phase (S) and gap2 and mitosis (G2M, second red shaded peak). Forty thousand events were collected per time point and treatment group. Th e data represent one of the three independent experiments. The average cell cycle distribution is shown in Table 6.

PAGE 101

88Table 5: Summary of non-malignant prostate RWPE-1, cell cycle phases after treatment with control siRNA and PKCsiRNA at indicated time* N = 3 independent experiments Table 6: Summary of androgen-independent prostate carcinoma, DU145, cell cycle phases after treatment with control siRNA and PKCsiRNA at indicated time* N = 3 independent experiments G0/G1 S G2/M Time (h) Control siRNA Control siRNA Control siRNA 24 59 +/1 63 +/1 32 +/1 18 +/1 8 +/1 20 +/1 48 56 +/1 70 +/1 36 +/1 13 +/1 15 +/4 18 +/2 72 59 +/2 67 +/1 32 +/2 12 +/1 9+/1 22 +/2 G0/G1 S G2/M Time (h) Control siRNA Control siRNA Control siRNA 24 45 +/1 61 +/1 41 +/2 23 +/4 14 +/3 16 +/3 48 47 +/2 63 +/5 39 +/5 23 +/7 14 +/4 15 +/2 72 54 +/3 57 +/5 33 +/5 25 +/6 13 +/3 17 +/2

PAGE 102

895.5 Discussion To further demonstrate that PKCis involved in cell proliferation, we treated the cells with PKCsiRNA to temporarily suppress PKCexpression. To our knowledge, signal transduction pathway involving PKChas not been investigated in prostate cancer cells. Hence, this novel investigation will shed some light on the role of PKCin prostate cancer ce lls. First, we treated RWPE-1 cells with control siRNA (50 nM) and PKCsiRNA (50 nM) complex for 24-72 hour. The lack of proliferation demonstrated that the t he transfection reagent had some toxicity toward RWPE-1 cells. However, this was overcomed after 24 hour of incubation with the siRNA complex. The control cells continued to pr oliferate while cell viability decreases in PKCsiRNA treated cells. Western blot analysis and absorbance densitometry of PKCshowed a significant decrease in PKCexpression in RWPE-1 cells. In addition, temporal suppression of PKCdoes not affect PKCisoforms, which is 98% identical to PKC18]. Similarly, PKCwas temporarily suppressed in LNCaP cells by PKCsiRNA. Higher concentration of PKCsiRNA (100nM), two-fold more than RWPE-1, was used for LNCaP cells. However, at this concentration, PKCwas not significantly suppressed. Higher concentration of PKCsiRNA was tested but this caused high toxici ty to the LNCaP cells which resulted in a decrease in control cells as well (data not shown). Therefore, only 100 nM of PKCsiRNA was used for LNCaP cells. Immunoblot analysis depicted a very slight decrease in PKCexpression following 24 hour and 48 hour treatments. Both proliferation curves and absorbance densitometry of PKCshowed no significant decrease. However transfection of PKCsiRNA was specific to PKCand did not affect PKCisoforms. Taken together, PKCmay not play a significant role in proliferation and survival of LNCaP cells. There are other PKC isoforms such as PKCand PKCplay a role in LNCaP cell survival. Early studies showed that activation of PKCand with TPA induced apoptosis in

PAGE 103

90LNCaP cells. However, the lack of proteolytic cleavage and caspase-3 inactivation suggested that an allosteric activation of PKCis sufficient to induce apoptosis in LNCaP cells [19-22]. LNCaP cells are androgen sensitive and they can respond to androgen receptor elements (ARE) such as synthetic androgen R1881 to activate Ras-Mek-ERK signaling cascades for gene transcription and DNA synt hesis [23]. Other possible survival pathways may involve activation of mitogen-activ ated protein kinases (MAPKs) in LNCaP cells [24-25]. MAPK has at least three families: extracellula r signal regulated protei n kinase (ERK), the p38 kinase, and Jun N-termianl-kinase (JNK). Phosphorylation of ERK increases cell proliferation, while the p38 family is involved in apoptosis [25-30]. JNK proteins are involved in both positive and negative regulation of the cell cy cle [31-33]. In addition, the androgen receptor (AR) also influences progression of LNCaP prostate cancer. Stress kinase can regulate androgen receptor phosphorylation at serine 650 wh ich is necessary for transcription and nuclear export. A link between activation of MAP kinas e and increased phosphorylation of serine 650 leads to LNCaP cell survival [34]. Therefore, survival of LNCaP cells may involve other signal transduction pathway besides PKCs. In previous investigations (chapter 3) we did not find any association of PKCand CAK/Cdk7 in DU-145 cells. Although PKCmay not be involved in cell proliferation, it may require for DU-145 cell survival. Therefore, we further examined if PKCsiRNA would have any effects on DU-145 cells. We had to use three-fold (150 nM) more of PKCsiRNA to suppress at least 50% of PKCexpression in DU-145 cells compared to RWPE-1 cells (50nM). The proliferation curve demonstrated that the cont rol cells continue to proliferate while PKCsiRNA treated cells were inhibited in cell number. We stern blot analysis and absorbance densitometry of PKCshowed a significant decrease in PKCexpression in DU-145 cells in time dependent manner. In addition, temporal suppression of PKCdoes not affect PKCisoforms. For specificity, we suppressed PKCand PKCexpression using PKCsiRNA and PKCsiRNA respectively. Their concentrations were the same as PKCsiRNAs, 50 nM for

PAGE 104

91RWPE-1 cells and 150 nM for DU-145 cells. Both RWPE-1 cells and DU-145 cells showed a significant decrease in cell proliferation when treated with PKCsiRNA. PKCsiRNA shows a slight decrease in cell pr oliferation in both cell lines. However, there were more viable cells in PKCsiRNA treated cells compared to atypical PKCand PKCsiRNAs treated cells. Therefore, temporarily silencing PKCresulted in the slowest cell proliferation rate. Immunoblot of PKCand PKCshow a time dependent decrease in their protein levels within respective cell lines. There was no change in PKCexpression in PKCand PKCsiRNA treated cells. This demonstrates t hat siRNAs are specific to each isozyme and do not effect other PKC isoforms. Next, we also found that PKCsiRNA leads to cell cycle ar rest in both cell lines. In RWPE-1, PKCsiRNA treatment leads to G2/M arrest while in DU-145 cells, PKCsiRNA prevents G1/S transition. In summary, suppressing PKCleads to reduced cell proliferation, and cell cycle arrest in prostate cells.

PAGE 105

925.6 References 1. Cogoni C and Macino G. Post-transcriptional gene silencing across kingdoms. Genes and Development 10:638-643, 2000. 2. Guru T. A silence that speaks volumes. Nature 404:804-808, 2000. 3. Hammond SM, Caudy AA, hannon GJ. Post transcriptional gene silencing by doublestranded RNA. Nature Revi ews Genetics 2:110-119, 2001. 4. Napoli C, Lemieux C, and Jorgensen R. In troduction of a chalcone synthase gene into Petunia results in reversible co-supressi on of homologous genes in trans. Plant Cell 2:279-289, 1990. 5. Jorgensen RA, Cluster PD, English J, Que Q, and Napoli CA. Chalcone synthase cosuppression phenotypes in petunia flower s: comparison of sense vs. antisense constructs and single-copy vs. complex TDNA sequences. Plant Molecular Biology 31:957-973, 1996. 6. Guo S and Kempheus KJ. Par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase t hat is asymmetrically distributed. Cell 81:611-620, 1995. 7. Fire A, Xu S, Montgomery MK, Kostas SA, Drive SE, and Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans Nature 391:806-811,1998. 8. Sullenger BA and Gilboa E. Emerging clinical applications of RNA. Nature 418:252-258, 2002. 9. Hamilton AJ, and Baulcombe DC. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286:950-952, 1999. 10. Elbashir SM, Lendeckel W, and Tushi T. RNA interference is mediated by 21and 22nucleotide RNAs. Genes and Development 15:188-200, 2001. 11. Nicholson aW. Function, mechanism and re gulation of bacterial ribonucleases. FEMS Microbiology Reviews 23:371-390, 1999.

PAGE 106

9312. Bernstein E, Caudy AA, Hammond SM, and Hannon GJ. Role for a bidenate ribonuclease in the initiation step of RNA interference. Nature 409:363-366, 2001. 13. Hammond SM, Berstein E, Beach D, and Hannon GJ. An RNA-directed nuclease mediates post-transcroptional gene silencing in Dorsophila cells. Nature 404:293-296, 2000. 14. Dykshoorn DM, Novina CD, and Sharp PA. Killing the messenger: short RNAs that silence gene expression. Nature Reviews Molecular Cell Biology 4:457-467, 2003. 15. Zamore PD, Tushcl T, Sharp PA, and Bartel DP. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21to 23-nucleotide intervals. Cell 101:25-33, 2000. 16. Mc Manus MT and Sharp PA. Gene silencing in mammals by small interfering RNAs. Nature Reviews Genetics 3:737-747, 2002. 17. Yang D, Lu H, and Erichson JW. Evidence that processed small dsRNA may mediate sequence specific mRNA degradation during RNAi in Drosophila embryos. Current Biology 10:1190-1200. 18. Akimoto K, Mizuno K, Osada S, Hirai S, Tanuma S, Suzuki K. A new member of the third class in the protein kinase C family, PKC lambda, expressed dominantly in an undifferentiated mouse embryonal carcinoma cell line and also in many tissues and cells. The Journal of Biological Chemistry 17:12677-83, 1994. 19. Powell CT, Birttis NJ, Stec D, Hug H, He ston WDW, and Fair WR. Persistent membrane translocation of protein kinase C during 12O -tetradecanoylphorbol-13-acetate-induced apoptosis of LNCaP human prostate cancer cells. Cell Growth and Differentiation. 7:419-428, 1996. 20. Gonzalez-Guerrico AM, Meshki J, Xiao L, Benavides, Conti CJ and Kazanietz MG. Molecular mechanisms of protein kinase C-induced apoptosis in prostate cancer cells. Journal of Biochemistry and Molecular Biology, 38:639-645, 2005.

PAGE 107

9421. Garcia-Bermejo ML, Leskow FC, Fujii T, W ang Q, Blumberg PM, Ohba M, Kuroki T, Han K, Lee J, Marquez VE, and Kazanietz MG. Diac ylglycerol (DAG)-lactones, a new class of protein kinase C (PKC) agonists, induce apopt osis in LNCaP prostate cancer cells by selective activation of PKC. The Journal of Biological Chemistry, 244:645-655, 2002. 22. Fujii T, Garcia-Bermejo ML, Bernabo JL, Caam ano J, Ohba M, Kuroki T, Li L, Yuspa SH, and Kazanietz MG. Involvement of protein kinase C (PKC ) in phorbol ester-induced apoptosis in LNCaP prostate cancer cells. The Journal of Biological Chemistry, 275:7574-7582, 2000. 23. Carey AM, Pramanik R, Nicholson LJ, Dew TK, Martin FL, Muir GH, Morris JD. RasMEK-ERK signaling cascade regulates androgen receptor element-inducible gene transcription and DNA synthesis in prostate canc er cells. International Journal of Cancer 121:520-527, 2007. 24. Royuela M, Arenas MI, Bethencourt FR, S anche-Chapado M, Fraile B, and Paniagua R. Regulation of proliferation/apoptosis equilibrium by mitrogen-activated protein kinases in normal, hyperpalstic, and carcinomatous hum an prostate. Human Pahtyology 33:299306, 2002. 25. Magi-Galluzzi C, Mishra R, Fioretino M, Montroni R, yao H, Capodieci P, Wishnow K, Kaplan I, Strok PJ, Loda M. Mitogen activa ted protein kinase phosphatase 1 is overexpressed in prostate cancers and is inversely related to apoptosis. Laboratory Investigation 76:37-51, 1997. 26. Magi-Galluzzi C, Montironi R, Cangi MG, Wishnow K, Loda M. Mitogen-activated protein kinases and apoptosis in PIN. Vi rchows Archives 432:407-413, 1998. 27. Gioeli D, Mandell JW, Petroni GR, et al. Activation of mitogen-activated protein kinase associated with prostate cancer progre ssion. Cancer Research 59:279-284, 1999.

PAGE 108

9528. Price DT, Rocca GD, Guo C, ballo MS, Schwinn DA, Luttrell LM. Activation of extracellular signal-regulated kinase in human prostate cancer. Journal of Urology 162:1537-1542, 1999. 29. Deacon K, Blank JL. MEK kinas 3 directly activates MKK6 and MKK7 specific activators of the p38 and c-Jun NH2-termi nal kinases. Journal of Biological Chemistry 274:1660416610, 1999. 30. Ricote M, Garcia-Tunon I, Fraile B, Fernandex D, Aller P, Paniagua R, Royuela M. P38 MAPK protects against TNF-a provoked apoptos is in LNCaP prostatic cancer cells. Apoptosis 11:1969-1975, 2006. 31. Patel R, Bartosch B, Blank JL. P21WAF1 is dynamically associated with JNK in human Tlymphocytes during cell cycle progression. Journal of Cell Science 111:2247-225, 1998. 32. Fushs SY, Adler V, Pincus MR et al MEKK1/JNK signaling stab ilizes and activates p53. Proceedings of National Academy of Science USA 95:10541-10546, 1998. 33. Vivanco I, Palaskas N, Tran C, Finn SP, Ge tz G, Kennedy NJ, Jiao J, Rose J, Xie W, Loda m, Golub T, Mellinghoff IK, Davis RJ, Wu H, and Sawyers LC. Identification of the JNK signaling pathway as a functional target of the tumor suppressor PTEN. Cancer Cell 11:555-569, 2007.

PAGE 109

96 Chapter 6 Cell apoptosis 6.0 Introduction In previous chapter, we have demonstrated a decrease in prostate cell viability after PKCsiRNA treatment. It is possible that suppression of PKCcan lead to cell death. Two alternative modes of cell death can be distingui shed: apoptosis and necrosis [1]. The term necrosis comes from the Greek word meaning “the dead”. This involves massive destruction of well integrated but, different populations of cells. The mechanism involves inflammation and wound healing [2]. Apoptosis (i.e. falling autumn le aves from the Greek word) is often refer to as “programmed cell death” and does not involve infl ammation and multicellular healing process [2]. Programmed cell death involves activation of many regulatory pathways, preservation, modulating transcriptional and translational activities [1, 2]. Apoptosis and necrosis have two distinct, mu tually exclusive, modes of cell death. Apoptosis is active and executes its own demise and subsequent body disposal [3-5]. When apoptosis occurs in vivo apoptotic bodies are phagocytized by neighboring cells, including those of epithelial or fibroblast origin, without trigger ing an inflammatory reaction in the tissue [6-8]. Both of them have distinct biochemical ma rkers and a unique morphological appearance. Apoptosis involves cell shrinkage, chromatin co ndensation, and formation of apoptotic bodies but the cell membrane is preserved. Necrosis involv es swelling of cell and mitochondria followed by rupturing of cell membrane (Figure 6.1) [1, 2].

PAGE 110

97 Figure 6.1 Scheme illustrating morphological changes during apoptosis and necrosis [1].

PAGE 111

986.1 Apoptosis Apoptosis manifests two major pathways, the extrinsic and intrinsic pathways [9-10]. The molecular execution of cell death involves ac tivation of members of a family of cysteinedependent aspartate-specific proteases (caspases). The ‘intrinsic’ pathway, signals the release of prodeath factors form the mitochondria via t he action of pro-apoptotic members of the Bcl-2 family [11-13]. The ‘extrinsic’ pathway invo lves activating caspases by engagement of cellsurface ‘death receptors’ by their specific ligands [14]. 6.1.1 Death receptors Death receptors are cell-surface recept ors that trigger death signals following engagement with their cognate ‘death ligands’ [14]. Death receptors belong to the tumor necrosis factor receptor (TNFR) gene supe r family. They are composed of cysteien-rich domain (CRDs) in their amino terminal region and ‘death domain’ (DD) inserted into cytoplasm [15]. The best characterized death recptors are TNFR1, CD95 (also called Fas or Apo1), TRAIL-R1 (TNFrelated apoptosis-inducing ligand) [15-17]. These receptors are activated by TNF and lymphotoxin Ligand induced trimerization of death re ceptors facilitates binding of adapter protein, FADD (Fas-associated DD protein), whic h interacts with death effector domain (DED) in caspase-8 and -10 [18-19]. This interaction allows inactivated caspase-8, -10 (procaspase) to be cleaved between p20 and p10 domains (activation) (Figure 6.2) [20]. Activation of caspase-8 further activates downs tream effector caspase-3, which in turn cleaves other caspases (such as caspase-6) and other substrates, leading to the terminal events of apoptosis [21]. In addition, caspase-8 can cleave and activate BID, a “BH-3 domain only’ prodeath member of the Bcl-2 family [22-26]. The active truncated form of BID (tBID) then translocates to outer mitochondrial membrane, where it binds to BAX or BAK [27-28 ]. The tBID-induced hom ologomerization of BAX or BAK leads to mitochondrial disruption and rele ase of prodeath cofactors (such as cytochrome c and Smac/DIABLO) into the cytoplasm [29]. Cytochrome c binds to procaspase-9, which

PAGE 112

99activates further downstream caspases such as caspase-3 and caspase-7, thereby, amplifying the caspase cascade and promoting apoptosis [30]. 6.1.2 Involvement of Bcl-2 family members in apoptosis Apoptosis involving Bcl-2 family members (Figure 6.3) is yet another singal transduction cascades that targets various intracellular membranes, mitochondrial residence, pores-formation activity, and existence of different conformational states that contributes to programmed cell death. The Bcl-2 family of proteins includes both proas well as anti-apoptotic molecules (Figure 6.3). The ratio between two subsets determines whether the cell lives or dies [31-32]. An additional characteristic of the members of this fa mily is their frequent ability to form homo-as well as heterodimers, suggesting neutralizing competitio n between these proteins. They can also become integral membrane proteins [31]. The Bcl-2 family members possess four cons erved (BH) domains. They are BH1, BH2, BH3 and BH4, which correspond to -helical segments [33, 34]. Antiapoptotic members such as Bcl-2, Bcl-xL, and Bcl-w display all four domains while pro-apoptotic molecules such as Bax, Bak, MTD, and Bcl-xs display less sequence domain. In addition, deletion and mutagenesis studies showed that the BH3 domain serves as a crit ical death domain in pro-apoptoic members. The subset of pro-apoptotic members “B H3-domain-only” such as Bid, Bad, and Bik are considered all pro-apoptotic [35-36]. 6.2 Post-translational modifications determine active/inactive conformations Pro-apoptotic molecule Bax is monomeric and mainly resides in cytosol or loosely attached to membranes. Following a death stimulus, cytosolic Bax translocates to the mitochondria where it becomes an integral membrane protein and cross links to form a homodimer. This results in killing of cells desp ite the presence of surv ival factors and Bcl-xL [3738]. Like Bax, BH3-domain-only molecule, Bim can transolocate to the mitochondria following apoptotic stimuli. Bim interact with Bcl-2 to antagonize its anti-apoptotic activity [39].

PAGE 113

100In the presence of a survival factor the BH3-domain-only molecule Bad is phosphorylated on two serine sites (ser-112 and se r-136) and is sequestered in the cytosol by 14-3-3 molecule, a regulatory protein that interact with Bad to quench the apoptotic pathway [40]. However, in the presence of death signals (e.g ., IL-3 deprivation), Bad is dephosphorylated and found in association with Bcl-xL-Bcl-2, quenching its pro-apoptotic function [41]. To date, several kinases have been shown to phosphorylate and inactivate Bad. Akt/PKB/RAC phosphorylates ser-136 while PKA phosphorylates ser-112 on Bad [42-43]. Therefore, post-translational modifications of Bcl-2 family members represent a balance between anti-apoptotic and pro-apoptotic and, thus, determine if the cells lives or die. 6.3 Other apoptosis signals Cytochorme c is a member of electron transport chain and is a soluble mitochondrial matrix protein. When it is released into the cytoso l, it becomes part of the machinery that causes cell death. A nuclear gene encodes cytochrome c and after transcription and translation, the protein appears in the cytosol in the form of an apoprotein. The later is transported to the mitochondrial inner membrane where a heme lig ase binds the apoprotein to heme. The holoenzyme is localized in the inner membrane wher e it is safely secured to be released only when the membrane barrier becomes dysfunctional [2, 44]. One mechanism by which cytochrome c is re leased is by the regulation of the Bcl-2 family member homo and heterodimerizations induci ng mitochondria dysfunction. In addition, translocation of the pro-apoptotic family member (e.g., Bax) from cytosol to membrane disrupts the mitochondria integrity [45, 24]. Survivin is expressed in live cells compar ed to cells undergoing apoptosis. It is a bifuncitonal protein that suppresses apoptosis and regulates cell division [46]. In mitosis, expression of survivin persists during the entir e process starting at t he beginning of prophase and disappearing at the end of telophase.

PAGE 114

101Survivin is associated with t he microtubules of the mitotic spindles. Thus, suvivin is expressed during mitosis in a cell cycle-d ependent manner [46-48]. Poly (ADP-ribose) polymerase (PARP) is another pr otein marker for apoptosis. It is a nuclear zinc-finger DNAbinding protein that detects DNA strand breaks. PARP is cleaved by caspases during apoptosis. PARP is cleaved at conserved sequence 211DEVD214 to an 89-kDa fragment containing the active site and an automodification domain, and to a 24 kDa fragment containing the zinc fingers, responsible for its DNA binding activity. PARP cleavage has been shown in all forms of apoptosis, including apoptosis induced by irradi ation, by chemotherapeutic agents, and upon activation of the death receptors [49]. In this chapter, we further demonstrate that transiently silencing PKCusing PKCsiRNA in prostate cells leads to apoptosis.

PAGE 115

102 IL-3 IL-3 P18 P18 P10 P10 B I D t-BID BADBCL-XL BCL-2 B A X B A X B A X B A X B AX cyt c cyt c casp-9 Apaf-1 p17 p17 p12 p12 BAD BAD P P P P 14-3-3 PKA Akt "initiator' caspase-8 "effector' caspase-3 Other Death Substrates PDGF NDF Ligand (Fas-L, TNF) Receptor (Fas, TNF-R1) Figure 6.2 Model of apoptotic and survival signaling pat hways involving the Bcl-2 members [20].

PAGE 116

103 Figure 6.3 Summary of anti-apoptotic and pro-apopt otic Bcl-2 members. BH1-4 is Bcl-2 homology regions while TM is the carboxy terminal hydrophobic domain [31].

PAGE 117

1046.4 Materials and Methods Most materials and methods used in this chapter are found in chapter 3, sections 3.1 and chapter 5, section 5.3. Materials and methods used solely in this chapter are described below. 6.4.1 Inhibition of gene expression with siRNA Detailed transfection was described in chapter 5, section 5.3. Briefly, cells (3.75 x 103) were grown overnight in T75 flask. Triplica te flasks were used for both control and PKCsiRNAs. The next day the control complex and PKCcomplex (50 nM for RWPE-1 cells and 150 nM for DU-145 cells) were added to media and incubated for 24 hours. The flasks were then put on ice to terminate the incubation. 6.4.2 Anitibodies Specific antibodies were purchased from Santa Cruz Biotechnology and the amount of antibodies used was as follow: full PARP sc-7150 (5 g, 1:1000 dilution) rabbit polyclonal antibody, caspase-7 sc-8510 (5 g, 1:1000 dilution) goat polyclo nal, survivn sc-17779 (5 g, 1:1000 dilution) mouse monoclonal, cytochrome C sc-13560 ( 5 g, 1:1000 dilution) mouse monoclonal, -actin sc-1616 (5 g, 1:1000 dilution) goat polyclonal, phospho-Bad (5 g, 1:10000 dilution) ser-112, ser-136, ser-155 (sc-7998R, sc-12970-R, sc-7999-R respectively). Cleaved PARP (Asp214) (catalog number 9541) rabbit polyclonal (5 g, 1:1000 dilutions) was purchased form Cell Signaling. Secondary antibody Goat x Mouse IgG (catalog number JGM035146; 1 g, 1:10000 dilution) was from Accurate. Goat anti-rabbit sc-2004 (1 g, 1:5000 dilutions) was from Santa Cruz. Anti-rabbit IgG (catalog number 7074; 1 g, 1:1 000 dilution) was purchased form Cell Signaling.

PAGE 118

1056.4.3 Immunoprecipitation and Western blotting Whole cell lysates of 200 g was immunoprecipitated with Bad mouse monoclonal agarose conjugate (sc-8044 AC; 5 g). Negative control: mouse agarose conjugate (sc-2343; 5 g). The immunoprecipitated samples were run on 10% gel SDS-Page. Western blot were performed using specific antibodies. To detect phospho protein, the nitrocellulose membrane was blocked with 1% bovine serum albumin (BSA:milk ; 1:1 v/v) containing 50 nM of NaF at room temperature for 1 hour. Phospho specific prim ary antibodies were diluted in 20 ml of 1% BSA:Milk (1:1 v/v) containing 50 nM of NaF and blotted at 4 oC for overnight. The next day, the primary antibody was washed three times with 20 ml of TTBS and incubated with their respective secondary antibody diluted in 20 ml of 1% BSA:Milk (1:1 v/v) containing 50 nM of NaF and gently rocked for 1 hour at room temperature. The pr otein bands were visualized according to methods describe in chapter 3, section 3.1.5. Ten percent gel SDS-PAGE was used for separation of Full PARP and cleaved PARP. Fifteen percent gel SDS PAGE was used to separa te survivin and Cytochrome C. All the membranes were probed independently and from independent experiments. The data presented were the best out of triplicate experiments. 6.5 Results 6.5.1 Treatment with PKCsiRNAs to RWPE-1 cells and DU-145 cells leads to DNA damage Previously, we have shown that PKCsiRNA inhibits cell cycle phase in RWPE-1 and DU-145 cells. The cells were also observed unde r phase contrast microscopy. The cells treated with PKCsiRNA depicted cell rounding, cell membrane blebbing, chromatin condensation and lifting of cells from the flask, indicating ce ll death compared to control cells (Figure 6.4). After transfecting the cells with control siRNA or PKCsiRNA, 15 g of whole cell lysates were run on 15% SDS PAGE and analyzed for full PARP. Full PARP rabbit polyclonal antibody detected full PARP 113 kDa and activation of PARP (i.e cleaved PARP) at 89 kDa. RWPE-1

PAGE 119

106cells showed no significant changes in full PARP. In contrast, there was activation of PARP 89 kDa protein at 24 h siRNA treated cells and more si gnificantly at the 48 h time point of siRNA treated cells (Figure 6.5A). However, no si gnificant changes occured at 72 h time point. Similarly, control DU-145 cells shows no changes in full PARP protein level but there was significant activation of PARP at 24-72 h in siRNA treated cells compared to control siRNA (Figure 6.5B). Hence, activation of PARP c onfirmed that there is DNA damage, indicating apoptosis in RWPE-1 and DU-145 cells. One hundred micrograms of whole cell lysates of control siRNA and PKCsiRNA treated cells were separated using 10% SDS PAGE and Western blotted with rabbit polyclonal cleaved PARP (Asp214) antibody. PKCsiRNA treated RWPE-1 cells showed time dependent cleaved PARP at 89 kDa at the 24-48 h time point. In PKCsiRNA treated DU-145 cells, cleaved PARP was observed at 24-72 h. This indicates that all the siRNA treated cells undergo apoptosis. 6.5.2 PKCsiRNAs treatment activates apoptosis cascades in RWPE-1 and DU-145 cells. Next, we showed that PKCsiRNA treatment provokes ‘intrinsic’ apoptosis. Fifteen microgram of whole cells lystat es from both control and PKCsiRNA treated cells were run on 15% SDS-PAGE and Western blotted for cytochorme c. The increase in cytochrome c was observed in all the PKCsiRNA treated RWPE-1 cells and DU-145 cells (Figure 6.5). To demonstrate activation of caspases during apoptosis, whole cell lysate (100 g) of PKCsiRNA treated cells together with control cells were We stern blotted for caspase-7. In RWPE-1, a decrease in pro-caspase-7 was observed at 24-72 h of PKCsiRNA treated cells. In contrast, the control siRNA treated cells showed the presence of pro-caspase-7 protei n. However, in DU145 PKCsiRNA treated cells a decrease in pro-caspase-7 was observed in time dependent manner at the 42 h and 72 h time points (Figure 6.5B). In addition, we also Western blotted for suvivin protein (15 g) in both cell lines after treatment with PKCsiRNA. There was a higher level of survivn in control cells compared to PKCsiRNA treated cells. Western blot of -actin verified that protein loading for each sample

PAGE 120

107was equal. All the Western blots were taken from the best of three independent experiments (Figure 6.5). 6.5.3 Effects of PKCsiRNA on LNCaP cells Similarly, LNCaP cells were analyzed for apoptosis although there was no significant reduction in cell proliferaiotion (Figure 6.6). Whole cell lysate of 15 g was used to analyze for Full PARP and cleaved PARP. PKCsiRNA treated cells showed an activation of PARP (i.e. cleave PARP) at 24 h and 48 h time points. Howe ver, caspase-7 activation was not observed in both control and PKCsiRNA treated cells. In addition, there was no significant change in cytochorome c expression. However, a decrease in survivin was observed at 24 h and 48 h in PKCsiRNA treated cells. 6.5.4 Effects of PKCsiRNA on RWPE-1 Cdk7 and cdk2 Previously we have shown the association between PKCand Cdk-7 in RWPE-1 cells. We next determined if treatment of PKCsiRNA impaired the cell proliferation pathway (PKCCdk7 cdk2). The cells were incubated with PKCsiRNA complex for 48 h and 15 g of whole cell lysates were Western blotted for PKCCdk7 and cdk2. There was a significant decrease in PKCexpression in PKCsiRNA treated cells compared to control siRNA tread cells (Figure 6.7). There was no change in Cdk7 and cdk2 ex pression. One hundred and fifty micrograms of whole cell lysate was used for Western blotting of phosphorylation of Cdk7 and cdk2. We found that there was a significant changes in phosphory lation of Cdk7 (Th170) and cdk2 (Th160) in PKCsiRNA treated cells compared to control siRNA. Western blot of -actin verified equal loading of protein in each sample. 6.5.5 PKC-siRNA effects on phosphorylation status of Bad and Bad/Bcl-xL heterodimerization PKCis overexpressed in non-small cell l ung cancer cells (NSCLC) and it has been reported to phosphorylate Bad at multiple sites for cell survival [10]. To test whether PKCcan directly phosphorylate endogenous Bad, Bad protein (200 g) was immunoprecipitated from control siRNA and PKCsiRNA treated (incubation time 24 h) RWPE-1 and DU-145 cells.

PAGE 121

108Normal rabbit IgG agarose conjugate (5 g) was used as a negative control. Results demonstrated no detectable association between PKCand BAD. We also increased the protein level and performed reverse immunoprecipitation with PKCantibody, but no association of Bad with PKCwas observed. Whereas immunoblot with phospho specific Bad (ser-112, ser-155, ser-136) showed no significant changes in phos pho Bad ser-112, phosphory lation of Bad ser-155 and ser-136 decreased in RWPE-1 cells (Figigure 6.8A; second column). A similar experiment was performed with DU-145 (Figure 6.8A, third column). First, we investigated if PKCassociates with Bad. Our re sult showed no association of PKCand Bad (data not shown). However, we observed an increase in phosphorylation of Bad ser-112, no significant changes in p-Bad (s er-136) and p-Bad (ser-155). Our results also showed the disruption of Bad/Bcl-xL heterodimerization in PKCsiRNA treated cells compared to control siRNA but the anti-apoptotic protein level of Bcl-xL remained the same. The disruption of Bad/Bcl-xL heterodimerization may play a critical role in mitochondria dysfunction and apoptosis in PKCsiRNA treated cells. We also found that there were different levels of phosphorylation of Bad RWPE-1 and DU 145 cells (Figure 6.8A). All three phospho serine sites (112, 155,136) on Bad protein are expressed endogenously in RWPE-1 cells while DU-145 cells have only two p-Bad (ser-112 and ser136) (Figure 6.8B). Collectively, these results suggest that in DU-145 cells, phosphorylat ion of Bad (deactivation/ survival) was not able to rescue the cells from PKCsiRNA induced apoptosis.

PAGE 122

109 Figure 6.4 RWPE-1 cells, LNCaP cells and DU-145 undergo apoptosis after treatment with PKCsiRNA. The images of cells treated with c ontrol siRNA (RWPE-1: 50 nM; LNCaP:100 nM and DU-145:150 nM, respectively) compared to and PKCsiRNA treated (the same concentration as control) were captured using a digital camera interfaced with an inverted microscope (20x) and analyzed using the Scion image program (Scion Corp). The pictures were taken after 24 h incubating with siRNAs complex. The PKCsiRNA treated cells showed cell blebbing, rounding and rupturing of cells, which indicates the apoptosis process.

PAGE 123

110 Figure 6.5 PKC-i siRNA induces apoptosis. (A) Whole cell extracts of RWPE-1 treated with of control siRNA and PKCsiRNA treated cells were prepared as described in Materials and Methods and immunoblot of PARP and cleaved PARP (Asp214), indicate cells undergoing apoptosis via activation of caspase-7. Imm unoblot for survivin and cytochrome c further demonstrate apoptosis in PKCsiRNA treated cells. Western blot analysis of -actin shows that equal amounts of protein were loaded in each lane. (B) Similar immunoblots were performed for DU-145 cells. Activation of PARP and caspase-7, combined with an increase in cytochrome c and a decrease in survivin indicated apoptosis in DU-145 cells.

PAGE 124

111 Figure 6.6 Effects of PKCsiRNA on LNCaP cells. Whole cell extracts of LNCaP cells treated with control siRNA or PKCsiRNA were prepared as described in Materials and Methods and immunoblot analysis of PARP and cleaved PARP, and survivin demonstrate apoptosis in PKCsiRNA treated cells. Western blot analysis of -actin showed that an equal amount of protein is loaded in each lane.

PAGE 125

112 Figure 6.7 Effects of PKCon cdk7 and cdk2 activity. A separate experiment was repeated for RWPE-1 with control siRNA and PKCsiRNA and whole cells extracts (150 g) were analyzed for Cdk7, p-Cdk7 (T170), cdk2, p-cdk2 (T160), and -actin verified equal loading of protein.

PAGE 126

113 Figure 6.8 Effects of PKCsiRNA on Bad phosphorylation and Bad/Bcl-xL heterodimerization. (A) Both RWPE-1 cells and DU-145 cells were treated with PKCsiRNA for 24 h and cell lysates (300 g) were immunoprecipitated with Bad mouse monoclonal agarose-conjugate (5 g). The resulting supernatant and immuocomplex beads were subjected to SDS-PAGE. The first column is the negative control containing normal mouse IgG agarose conjugate with cell lysate. Phosphorylation of Bad was analyzed using phosp ho specific antibodies: Bad ser-112 (S112), ser-155 (S155) and ser-136(S136). Bound Bcl-xL with Bad and unbound Bcl-xL was also analyzed. (B) Cell lysates of endogenous protein (1 mg) was immunoprecipitated with Bad and different levels of phosphorylation status of Bad between normal RWPE-1 cells, and DU145 cells was also examined.

PAGE 127

1146.6 Discussion In the previous chapter, we demonstrated that suppressing PKCwith PKCsiRNA decreased cell proliferation and disrupted the cell cycl e. In this chapter, we further demonstrated that PKCsiRNA leads to cell apoptosis. Cell death is characterized by morphological changes such as cell shrinkage, chromatin condensation and DNA fragmentation [6-7]. Transfecting PKCsiRNA to all three cells lines produced cells undergoing stress signals such as membrane blebbing, rounding of cells, and lifting of cells from cultured flasks. This indicates apoptosis, which consis ts of intrinsic and extrinsic pathways [50, 51]. The intrinsic pathway depends on depolarization of the mito chondria and the extrinsic pathway involves activation of death receptors. Re lease of cytochorme c, activation of caspase-3, -6, -7 and cleaved PARP are relevant biomarkers in apoptosis induction for the intrinsic pathway [52-53]. All this occurred when PKCwas suppressed with PKCsiRNA in RWPE-1 cells and DU-145 cells. Survivin protein, which regulates cell divi sion and apoptosis, is also linked with “intrinsic” apoptosis [53-57] and we showed that surviv in is significantly suppressed in PKCsiRNA treated cells compared to control siRNA in RWPE-1 cells and DU145 cells. Collect ively, the data shows that PKCis an antiapoptotic protein and is re quired for cell survival in both healthy and cancerous prostate cells. However, PKCsiRNA has no signifant decrease in LNCaP cell viability shown previously in chapter 5. Although there was some activation of PARP observed in early transfection time, specific cleaved PARP (Asp214) was not observed (data not shown). In addition, there was no activation of caspase-7 a nd no changes in cytochrome c. However, survivn levels were lower in PKCsiRNA treated cells indicating there were some cell death but insufficient to induce apoptosis in LNCaP cells. One possible reason for insufficient effects of PKCsiRNA is that, there could be rapid syntheis of PKCin LNCaP cells that compete with suppression of PKCsiRNA. Secondly, there could be a truncated PKCor mutation point on PKC, which failed to recognize by wild type PKCsiRNA. However, this theory is yet to be

PAGE 128

115proven. There are also other mechanisims such as MAP kinase is involved in LNCaP cells survival [58]. Therefore, surviv al of LNCaP cells involves PKCas an antiapoptotic protein as well as other molecular mechanisms. Other studies showed that PKCcolocalized with CAK/Cdk7 in human glioma cells and phosphorylated CAK/Cdk7 during cell cycle progressi on [59-60). Similarly, in RWPE-1 cells, we found that PKCis transiently associated with Cdk7 which phosphorylates cdk2 and drives cell cycle progression (chapter 4). PKCmay be required for cell proliferation of RWPE-1 cells, because suppressing PKCsiRNA caused cell cycle arrest at G2/M, a decrease in phosphorylation of Cdk7 and cdk2 as well as apoptosis. There are a number of substrates fo r PKCs [61-62]. In particular, PKChas been shown to phosphorylate Bad at three different serine site s; ser-112, ser-155, and ser-136 for survival in non-small-cell lung cancer (NSCLC) [61]. Bad is a proapototic protein that can translocate from cytosol to nucleus and disrupt Bad/Bcl-2/Bcl-xL heterodimerization, leading to apoptosis. Phosphorylated Bad (inactivated Bad) is then sequestered by 14-3-3 pr oteins for cell survival [63, 64]. We also found that immunoprecipitation with either Bad antibody or PKCantibody showed no association of Bad and PKCin both normal prostate and carcinoma prostate cell lines (data not shown). Transient suppression of PKCalso induced no significant changes in phospho Bad ser-112, but there was a decrease in phospho Bad ser-155 and ser-136 in RWPE-1 cells. A slight increase in association of Bad/Bcl-xL was also observed in PKCsiRNA treated cells, meaning proapototic Bad quenched the antiapoptotic protein, Bcl-xL, leading to cell death of RWPE-1 prostate cells. However, in DU-145, pho sphorylation of Bad increased at ser-112, while ser-136 showed no significant change in phosphorylation. Phosphorylation of Bad at serine-155 was not observed in endogenous protein levels. An increase in phosphorylation of Bad could be due to Akt/PKB which m ediates phosphorylation of Bad at serine 136; while RSK2/PKA/PAK is invo lved with phosphorylation of Bad at serine 112

PAGE 129

116and 155 [65]. We also observed reduced disassociation of Bad/Bcl-xL. Taken together, PKCmay not directly involved in phosphorylation of Bad in prostate cells. However, transient suppression of PKCmay indirectly influence mitochondrial dysfunction, independent of phosphorylation of B ad, and lead to apoptosis in both RWPE-1 cells and DU145 cells. Our results indicate that RWPE-1 and DU145 cells have a different Bad phosphorylation pattern. In RWPE-1 prostate cells, there is an endogenous level of phospho Bad at ser-112, ser-136 and ser-155. In DU145 cells, p-Bad ser-112 and p-Bad ser-136 were present. It is reasonable to assume that there could be kinetic effects between phosphorylation of Bad and PKC(an anti-apoptotic protein). An increase in phosphorylated proapototic Bad did not overcome the suppression of anti-apoptotic PKCin prostate cancer cells. It has been hypothesized that a balance between prosurvial and prodeath Bcl-2 family members determines whether a cell lives or dies [66], but the precise molecular mechanisms of how membrane-bound Bcl-2 proteins exert their c ontrol over caspase activation and apoptosis is still unclear. Antiapoptotic Bcl-xL protein is overexpressed in prostate cancer cells and downregulation of Bcl-xL leads to TGFinduced apoptosis [67-68]. Bcl-xL also participates with Bcr-Abl, a protein responsible for chemotherap eutic resistance and mediates apoptosis in transformed pro-myelocytic HL-60 cells [69]. Taxol and 2-methoxyestradiol (2-ME) induced phosphorylation of Bcl-xL at serine 62 results in apoptosis of prostate cancer cells [70]. In addition, Bcl-xL has been shown to be overexpressed in many tumor cells leading to cell survival [71]. Our study found no decrease in Bcl-xL protein level or changes in phosphorylation status of Bcl-xL. PKCsiRNA increased the association of Bad/Bcl-xL in RWPE-1 cells, but disassociated Bad and Bcl-xL in DU145 cells, leading to mitochondrial dysfunction and apoptosis. In summary, suppression of PKCleads to cell cycle arrest and apoptosis in both RWPE-1 and DU-145 cells, independent of Bad phosp horylation. However, we suggest that anitPKC chemotherapy may be a viable option for the treatment of prostate cancer since normal untransformed prostate cells do not divide at the same rate as prostate carcinoma cells.

PAGE 130

117Therefore, suppression of PKCin prostate carcinoma may inhibit cancer cell proliferation with little effect on normal prostate cells. 6.7 References 1. Darzynkiewicz Z., Juan G, Li x., Gorczyca W., Murakami T., Traganos F. Cytometry in cell necrobiology: analysis of apoptosis and acci dental cell death (necrosis). Cytometry 27:1-20, 1997. 2. Lancker J. Apoptosis, genomic integrity, and cancer. Jones and Bartlett Publishers, Inc., USA pg. 1-50, 2006. 3. Arends MJ, Moriss RG, and Wyllie AH: Apoptosis: the role of endonuclease. American Journal of Pathology 136:593-608, 1990. 4. Cohen JJ. Apoptosis. Immunol Today 14:126-130, 1993. 5. Compton MM. A biochemical hallmark of apoptosis: internucleosomal degradation of the genome. Cancer and Metastasis Review 11:105-119, 1992. 6. Kerr JFR, Wyllie AH, Curie AR. Apoptosis. A basic biological phenomenon with wideranging implications in tissue kinetics. Br itish Journal of Canc er 26:239-257, 1972. 7. Majno G, Joris I. Apoptosis, oncosis, and nec rosis. An overview of cell death. American Journal of Pathology 146:3-16, 1995. 8. Wyllie AH, Arends MJ, Morris RG, Walk er SW, Evan G. The apoptosis endonuclease and its regulation. Seminars in Immunology 4:389-398, 1992. 9. Chipuk JE and Green DR. Do inducers of apoptosis trigger caspase-independent cell death? Nature 6:268-275, 2005. 10. Gross A, McDonnell JM and Korsmeyer SJ. Bcl-2 family members and the mitochondria in apoptosis. Genes and Development 13: 1899-1911, 1999. 11. Green DR. Apoptotic pathways: paper wr aps stone blunts scissors. Cell 102:1-4, 2000. 12. Green DR. Apoptotic pathways: the roads to ruin. Cell 94:695-698, 1998. 13. Green DR and Reed JC. Mitochondria and apoptosis. Science 281:1309-1312, 1998.

PAGE 131

11814. Ashkenazi A and Dixit VM. Death receptors: signaling and modulation. Science 281:1305-1308, 1998. 15. Smith CA, Farrah T and Goodwin RG. The TN F receptor superfamily of cellular and viral proteins: activation, co-stimulation, and death. Cell 76:959-962, 1994. 16. Nagata, S. Apoptosis by d eath factor. Cell 88:355-365, 1997. 17. Pan G, Orourke K, Chinnaiyan AM, gentz R, Ebner R, Ni J and Dixit VM. The receptor for the cytotoxic ligand TRAIL. Science 276:111-113, 1997. 18. Boldin MP, Varfolomeev EE, Pancer Z, Me tt Li, Camonis JH and Wallach D. A novel protein that interacts with the death domain of Fas/APO1 contains a sequence motif related to the death domain. The Journal of the Biological Chemistry 270:7795-7798, 1995. 19. Kischkel FC, Lawrence DA, Tinel A. Deat h receptor recruitment of endogenous caspase10 and apoptosis initiation in the absence of caspase-8. The Journal of Biological Chemistry 276:46639-46646, 2001. 20. Earnshaw WC, Martins LM and Kaufm ann SH. Mammalian caspases: structure, activation, substrates, and functions during apo ptosis. Annual Review in Biochemistry 68:383-424, 1999. 21. Scaffidi C, Fulda S, Srinivasan A, Frie sen C, Li f, Tomaselli KJ, Debatin KM, Krammer PH and Peter ME. Two CD95 (APO-1/Fas) si gnaling pathways. EMBO Journal 17:16751687, 1998. 22. Wang CY, Mayo MW and Baldwin AS Jr. TN Fand cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappaB. Science 274:784-787, 1996. 23. Li JH, Rosen D, Ronen D, Behrens CK, Krammer PH, Clark WR and Berke G. The regulation of CD95 ligand expression and f unction in CTL. Journal of Immunology 161:3949-3949, 1998.

PAGE 132

11924. Luo X, Budihardjo I, Zou H et al. Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 94:481-490, 1998. 25. Gross A, Yin XM, Wang K, Wei MC, Jockel J, Milliman C, Erdjument-Bromage H, Tempst P and Korsmeyer SJ. Caspase cleaved Bid targets mitochondria and is required for cytochrome c release, while Bcl-xL prevents this release but not tumor necrosis factorR1/Fas death. The Journal of Biological Chemistry 274:1156-1163, 1999b. 26. Roy S and Nicholson DW. Cross-talk in cell death signaling. The Journal of Experimental Chemistry 192:F21-F25, 2000. 27. Eskes R, Desagher S, Antonsson B and Mart inou JC. Bid induces the oligomerization and insertion of Bax into the outer mitochondrial membrane. Molecular Cell Biology 20:929-935, 2000. 28. Wei MC, Lindsten T, Mootha VK, Weiler S, Gross A, Ashiya M, Thompson CB and Korsmeyer SJ. tBID a membrane-targeted death ligand, oligomerizes BAK to release cytochrome c. Genes Development 14:2060-2071, 2000. 29. Li H, Zhu H, Xu CJ et al. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94:491-501, 1998. 30. Deveraux QL, Roy N, Stennicke HR, Van AT, Zhou Q, Srinivasuls SM, Alnemri ES, Salvesen GS and Reed JC. IAPs block apopt otic events induced by caspase-8 and cytochrome c by direct inhibiton of distinct caspases. EMBO J. 17:2215-2223, 1998. 31. Oltvai ZN, Milliman CL and Korsmeyer SJ Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerate s programmed cell death. Cell 74:609-619, 1993. 32. Adam JM and Cory S. The bcl-2 protein family: Arbiters of cell survival. Science 281:1322-1326, 1998. 33. Kelekar A and Thompson CB. Bcl-2 family proteins: the role of the BH3 domain in apoptosis. Trends in Cell Biology 8:324-330, 1998.

PAGE 133

12034. Chou JJ, Li H, salvesen GS, Yuan j and Wagner G. Solution structure of BID, an intracellular amplifier of apoptotic signaling. Cell 96:615-624, 1999. 35. McDonnell JM, Fushman D, Milliman CL, Korsmeyer SJ and Cowburn D. Solution structure of proapoptotic BID: A structural basis for apoptotic agonists and antagonists. Cell 96:625-634, 1999. 36. Wolter KG, Hsu YT, Smith CL, Nechushtan A, Xi XG and Youle RJ. Movement of Bax from the cytosol to mitochondria during apoptosis. The Journal of Cell Biology 139:12811292, 1997. 37. Gross A, Jockel J, Wei Mc, and Korsmeyer SJ. Enforced dimerization of BAX results in its translocation, mitochondrial dysfuncti on and apoptosis. EMBO Journal 17:3878-3885, 1998. 38. Puthalakath H, Huang DC, O’reilly LA, King SM and Strasser A. The proapototic activity of the Bcl-2 family member Bim is regula ted by interaction with the dynein motor complex. Molecular Cell 3:287-296, 1999. 39. Zha J, Harada H, Osipov K, Jockel J, Waksman G, and Korsmeyer SJ. BH3 domain of BAD is required for heterodimerizaiton with Bcl-xLand pro-apoptotic activity. The Journal of Biological Chemistry 272:24101-24104, 1997. 40. Ottilie S, Diaz JL, Horne W, Chang j, Wang y, Wilson G, C ahng S, Weeks S, Fritz LC and Oltersdorf T. Dimerization properties of human BAD. Identification of a BH-3 domain and analysis of its binding to mutant Bcl-2 and Bcl-xL proteins. The Journal of Biological Chemistry 272:30866-30872, 1997. 41. Datta SR, Dudek H, Tao X, master S, Fu H, Gotoh Y, and Greenberg ME. Akt phosphorylation of BAD couples survival signal s to the cell-intrinsic death machinery. Cell 91:231-241, 1997. 42. Harada H, Becknell B, Wilm M, Mann M, Huang LJ, Taylor SS, Scott JD, and Korsmeyer SJ. Phosphorylation and inactivation of BAD by mitochondria-anchored protein kianse A. Molecular Cell 3:413-422, 1999.

PAGE 134

12143. Crompton M. The mitochondrial permeability transition pore and its ro le in cell death. Biochemical Journal 381:335-41, 1996. 44. Marzo I, Brenner C, Zamzami N, Susin SA, Beutner G, Brdicska D, Remy R, Xie ZH, Reed JC, and Kroemer G. The permeabilit y transition pore complex: a target for apoptosis regulation by caspases and bcl2-related proteins. The Journal of Experimental Medicine 187:1261-71, 1998. 45. Reed JC. The survivin saga goes in vivo. The Journal of Clinical Investigation 108:965969, 2001. 46. Altieri DC, Marchisio PC, and Marchisio Pc. Survivn apoptosis: an interloper between cell death and cell proliferation in cancer. Laboratory Investigation 79:1327-1333, 1999. 47. Li F, Ambrosini g, Chu EY, Plescia J, Togni n S, Marchisio PC and Altieri DC. Control of apoptosis and mitotic spindle checkpoint by survivin. Nature 396:580-4, 1998. 48. Szabo C. Cell death: the role of PARP. CRC Press LLC 2000 Florida USA pg. 184-195. 49. Wyllie AH, Keer JFK, Currie AR. Cell death: the significance of apoptosis. International Review of Cytology, 68:251-306, 1980. 50. Chipuk JE and Green DR. (2005) Do in ducers of apoptosis trigger caspase-independent cell death? Nature 6: 268-275. 51. Kaufmann S, Desnoyers S, Ottaviano, Y ., Davidson N. and Poir ier, G. Specific proteolytic cleavage by poly(ADP-ribose) polym erase: an early marker of chemotherapyinduced apoptosis. Cancer Ressearch 53:3976-3985, 1993. 52. Green GR and Reed JC. Mitochondria and apoptosis. Science 283:1309-1312, 1998. 53. Marchetti P, Castedo M, Susin SA. Mitoch ondrial permeability transition is the central coordinating event of apoptosis. Journal of Experimental Medicine 184:1155-1160, 1996. 54. Grossman D, Kim PJ, Blanc-Brude OP, Bras h DE, Tognin S, Marchisio PC, Altieri DC. Transgenic expression of survivin in kera tinocytes counteracts UVB-induced apoptosis and cooperates with loss of p53. The Journal of Clinical Investigation 108:991-999, 2001.

PAGE 135

12255. Mesri M, Wall NR, Li J, Kim RW, and Alti eri DC. Cancer gene therapy using survivin mutant adenovirus. The Journal of Clin ical Investigation 108:981-990, 2001. 56. Atsushi S, Midoris H, Takeshi I, Hirokazu K, Takeshi N, Masayuki M, Kouichi A and Katsuya S. Survivin initiates cell cycle en try by the competitive interaction with Cdk4/p16INK4a and Cdk2/Cyclin E complex activation. Oncogene 19:3225-3234, 2000. 57. Ying L, Lee J, Allan RB and Alan PF. (2001) NFB/RelA transactivation is required for atypical protein kinase C -mediated cell survival. Oncogene 20:4777-4792. 58. Carey AM, Pramanik R, Nicholson LJ, Dew TK, Martin FL, Muir GH, Morris JD. RasMEK-ERK signaling cascade regulates androgen receptor element-inducible gene transcription and DNA synthesis in prostate canc er cells. International Journal of Cancer 121:520-7, 2007. 59. Acevedo-Duncan M, Patel R, Whelan S and Bicaku E. Human glioma PKCand PKCphosphorylate cyclin-dependent kinase activating kinase during the cell cycle. Cell Proliferation 35: 23-36, 2002. 60. Bicaku E, Patel R, Acevedo-Duncan M Cyclin-dependent kinase activating kinase/Cdk7 co-localizes with PKC-iota in human glioma cells. Tissue and Cell 34:53-58, 2005. 61. Zhaohui J, Meiguo X, and Xingming D. Survival function of protein kinase C as a Novel Nitrosamine 4-(methylnitrosamino)-1-(3-pyr idyl)-1-butanone-activated Bad kinase. The Journal of Biological Chemistry 290: 16045-16052, 2005. 62. Gustafson WC, Ray S, Jamieson L, Thom son EA, Brasier AR, and Fields AP. Bcr-Abl regulate protein kinase C (PKC ) transcription via an Elk1 site in the PKCpromoter. The Journal of Biological Chemistry 279:9400-9408, 2004. 63. Sandeep RD, Alex K, Linda H, Andrew P, Stephen WF, Michael BY, and Micahel EG. (2000) 14-3-3 proteins and survival kinases cooperate to inactivate Bad by BH3 domain phosphorylation. Molecular Cell 6: 41-51, 2000.

PAGE 136

12364. Jiping Z, Hisasha H, Elizabeth Y, Jenni fer J, and Stanley JK. Serine phosphorylation of death agonist BAD in response to survival fa ctor results in binding to 14-3-3 not Bcl-xL. Cell 87:619-628, 1996. 65. Downward J. How Bad phosphorylation is good for survival. Nature Cell Biology 1:E33E34, 1999. 66. Oltvai, ZN, and Korsmeyer SJ. (1994) Chec kpoints of dueling dimmers foil death wishes. Cell 79:189-192, 1994. 67. Chipuk JE, Bhat M, Hsing AY, Ma J, Danielpour D. Bcl-xL blocks transforming growth factor1-induced apoptosis by inhibiting cyto chrome c release and not by directly antagonizing apaf-1-dependent caspase activation in prostate epithelia cells. The Journal of Biological Chemistry 276: 26614-26621, 2001. 68. Larisch-Bloch S, Danielpour D, Roche NS Lotan R, Hsing AY, Kerner H, Hajouj T, Lechleider RJ, and Robers AB. Selective loss of transforming growth factorapoptotic signaling pathway in mutant NRP-154 rat prostatic epithelial cells. Cell Growth and Differentiation 11:1-10, 2000. 69. Amarante-Mendes GP, McGahon AJ, Nishioka WK, Afar D EH, Witte ON and Green GR. Bcl-2-independent Bcr-Abl-mediated resistance to apoptosis: protection is correlated with upregulation of Bcl-xL. Oncogene, 16:1383-1390, 1998. 70. Basu A, Haldar S. Identification of a nov el Bcl-xL phosphorylation site regulating the sensitivity of taxolor 2-methoxyestradiol -induced apoptosis. FEBS Letters, 538: 41-47, 2003. 71. Carlton JC, Terry NHA, White A. Measur ing potential doubling times of murine tumors using flow cytometry. Cytometry 12 : 645-6450, 1991.

PAGE 137

124 Chapter 7 Atypical PKCs activates NF-kappa B pathway in prostate cells 7.0 Introduction Atypical PKCs have been shown to control nuclear factor kappaB (NFB) and it plays a critical role in the development of human diseases such as cancer and inflammation [1-4]. There are five members of the mammalian NFB family, p65 (RelA), Rel-B, c-Rel, p50/p105 (NFB1), and p52/p100 (NFB2). They exist in unstimulated ce lls as homoor heterodimers bound I B family proteins for example, I B I B I B and I B (Figure 7.1) [5]. NFB can be stimulated by inflammatory cytokines such as Tumor Necrosis Factor (TNF)and Interleukin (IL)-1 [6]. Upon stimulation, I B kinase (IKK) is phosphorylated (activated) which triggers NFB downstream effectors. IKK complex cons ists of two catalytic subunits (IKK and IKK ) and an adapter protein IKK or Nemo [6]. 7.1 NFB signal transduction cascade NFB proteins have a conserved 300 amino acid Rel homology domain (RHD) that is located toward the N-terminus of the protein and is responsible for dimerization, interaction with I Bs, and binding to DNA [7-8]. The most classical (canonical) form of NFB is the heterodimer of p50 and p65 (Rel A), which is kept in the cytosol by an inhibitor protein, I B preventing nuclear translocation and activity (Figure 7.2). Upon stimulation by cell inflammatory cytokines such as TNF I B is phosphorylated on serine residues 32 and 36 by I B kinase (IKK) complex. This leads to ubiquitination and subsequent degradation of I B through the 26S proteosome pathway [3-4]. The liberated NFB/p65 is translocated to the nucleus where they bind to the promoter regions of b sites with the consensus sequence GGGRNNYYCC (N = any

PAGE 138

125base, R = pruine, and Y – pyrimidine). This results in an activation of NFB-responsive genes and in increased gene expression [8-10]. In the alternative (non-canonical) pathway, NFB is induced in response to stimuli such as B cell-activating factor (BAFF), CD40 ligand and LT R. It has slower activation kinetics than the canonical pathway. IKK is required for NFB-inducing kinase (NIK), which activates RelBp100 and is processed to RelB-p52, which leads to nuclear accumulation of RelB-p52 dimers. The dimer binds to the promoter regions of NFB-responsive genes and activates gene expression [11-15]. 7.2 IKK activation For upstream IKK activation, protein-protei n interactions are critical events in the signaling cascades activated by TNF The main inducer of TNF is the TNF Receptor-1 (TNFR1), a 55 kDa protein with the death domain (DD) in its intracellular region (Figure 7.3A) [16]. Upon cell stimulation, the TNFR-1-associating -death-domain (TRADD) st rongly interacts with TNFR-associated-factor-2 (TRAF2) and Receptor In teracting Protein (RIP). The recruitment of adapter proteins allows interaction with another ad aptor protein p62, which links atypical PKCs to the activation of NFB by the TNF signaling pathway [1, 17]. Similiarly, IL-1 can activate aPKCs via MyD88, a functional analogue of TRAD D (Figure 7.3B). The enzymatic interaction between DD and MyD88 is required for NFB activation [1]. Activation of IKK complex by TNF and Il-1, results in phosphorylation of specific se rine residues within the activation loop of IKK and IKK For example, IKK is phosphorylated on two sites within activation loop of the kinase domain: serine 176 and serine 180 while IKK is phosphorylated on serine 177 and serine 181 [6, 18]. MAP kinase and aPKCs have been shown to phosphorylate IKK / [19-20]. In this experiment, we further demonstrate that atypical PKCs are required for prostate cell survival. Particularly PKCactivates IKK kinases and triggers NFB survival cascades in prostate cells.

PAGE 139

126 Figure 7.1 Schematic representation of NFB, I B and IKK proteins family [37].

PAGE 140

127 Classical NFB Pathway Alternative NFB Pathway Figure 7.2 Classical and alternative pathways of NFB activation [37].

PAGE 141

128 Figure 7.3 Activation of aPKCs by cytokines. Signaling cascade activated by cytokines such as TNF (A) and IL-1 (B). TNF and IL-1 induces TNF Receptor-1 (TNFR-1) or MYD88 a functional analog of TRADD with a death domain (DD) in it s intracellular region. Upon stimulation, a receptor interacting protein (RIP) and an adptor pr otein (p62) serves to locate aPKC in the NFB signaling cascades [1].

PAGE 142

1297.3 Materials and Methods 7.3.1 Reagents and Antibodies Polyclonal primary antibodies were purchased from the following companies: IKK(sc7607), I B (sc-371) -actin (sc-1616), NFB p65 (sc-375), p-I B (sc-21689-R) IKK (sc7218), PARP (sc-7150), caspase-7 (sc-13560), and mouse monoclonal surviving (sc-17779) (Santa Cruz Biotechnology, CA); Anti-PKCmouse monoclonal catalog number 610176 (Transduction Laboratory, Lexi ngton, KY); rabbit polyclonal cleaved PARP (Asp 214) (catalog number 9541), p-IKK / catalog number 26875 (Cell Signaling Technology, Danvers, MA); Secondary antibodies were purchased from t he following companies: HRP Goat x Mouse IgG catalog number JGM035146, HRP Goat x Rabbit IgG (catalog number JGZ035144) (Accurate, Westbury, NY); HRP Bovine anti-goat IgG (sc-2350) (Santa Cruz Biotechnology, CA); Anti-rabbit IgG HRP-linked antibody (catalog number 7074) (Cell Signaling Danver, MA). Normal rabbit IgG (catalog number 12-370) (Upstate). For immunoprecipitation anti-rabbit IgG (whole molecule)agarose beads (1:1 v/v) (catalog numbe r A8914) (Sigma, St. Louis, MO); TNFwas purchased from Calbiochem (catalog number 654205). All other chemicals and reagents were commercially obtained from Sigma Aldrich, St. Louis, MO; Fisher Scientific, Norcross, GA; Pierce, Rockford, IL; and Bio-Rad Richmand, CA; unless otherwise stated. 7.3.2 Cell Culture. RWPE-1, LNCaP and DU-145 cell lines were obtained from American Type Tissue Culture Collection (ATCC) (Rockville, MD). LNCa P cells were grown in RPMI1640. DU-145 cells were grown in Minimum Essential Medium Eagle (MEME) earles balanced salt solution. Both RPMI1640 and MEME media were supplemented with 10% fetal bovine serum (FBS), and antibiotics 5ml (penicillin 10 U/ml and streptomycin 10 g/ml). For RWPE-1, cells were grown in Keratinocyte Serum Free Media, containing Epidermal Growth Factor (2.5 g) and Bovine Pituitrary Extract (25 mg) (GIBCO) and antibioti cs 5ml (penicillin 10 U/ml and streptomycin 10 g/ml). All cell lines were grown in a 5% CO2 incubator at 37 oC.

PAGE 143

1307.3.3 TNFTreatment Cells (3.75 x 105) were grown as monoloayer in T75 flasks. After incubation for 24 h, the cells were treated with TNF(20 ng/ml). At indicated times, cells were trypsinized, pelleted, washed with 1ml of PBS, resuspended in 0.4% Trypan Blue Solution (Sigma), and counted using a hemacyometer. Live (dye excluded) cells were counted. The result s from three seperate independent experiments were used to determi ne the mean viability and standard deviation for each time point. 7.3.4 Immunoprecipitation and Western Blot analysis After treatment with TNF (20 ng/ml), cells were placed on ice to terminate the incubation. Whole cell lysates of 100 g were immunoprecipitated as described in Chapter 4, section 4.3.1 with 5 g of PKCrabbit polyclonal antibody (5 g) and PKCrabbit polyclonal antibody (5 g), respectively. Western blots were performed using their repective primary antibody according to “Material and Methods” described in Chapter 3, section 3.1.5). 7.3.5 Preparation of cytosol and nuclear extracts Cells were washed twice with cold PBS and resuspended in hypot onic Buffer A [50 mM HEPES, pH 7.4), 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM PMSF, 2.5 g/m leupeptin, 0.15 U/ml aprotinin. The lysates were centrifuged at 4, 000 g for 30 min at 4 oC and the supernatants (cytoplasmic pr oteins) were collected. The pelleted nuclei were extracted with Buffer A containing 400 mM KCl and 0.5% Trit on X100. After centrifugation at 14 000 g for 30 min at 4 oC, the supernatant containing nu clear extracts was collected. 7.3.6 Kinase assay DU-145 cells (3.75 x 105) were grown as a monolayer in T75 flasks overnight. The following day, the cells were placed on ice and cell lysates were prepared according to methods described in Chapter 4, section 4. 3.1. Whole cell lysates of (100 g) were immunoprecipitated as follows: cell lystaes (50 g) were pre-cleared for 30 min at 4 oC with anti-rabbit IgG-agarose beads (1:1 v/v, 10 l) (catalog number A8914; Sigma Aldrich) and incubated with 5 g of PKC

PAGE 144

131rabbit polyclonal antibody and/or IKK / rabbit polyclonal antibody (5 g) overnight at 4oC and then a further 1 h with anti-rabbit IgG-agarose beads (1:1 v/v, 50 l). The immunoprecipitated samples were incubated with kinase buffer (50 l of 3.03 mg/10 ml ATP, 30 mM of Tris p.H 7.4, 50 l of 5 g phosphotidylserine) at 30 oC in a water bath for 5 minutes. The reaction was terminated by placing the samples in ice. The PKCinhibitor 1H-imidazole-4-carboxamide, 5amino-1-[2,3-dihydroxy-4-[(phosph onooxy) methyl]cyclopentyl]-,[1R-(1a, 2b, 3b, 4a)] (ICA-1; 100 nM) was synthesized by Southern Rese arch Institute (Birmingham, AL). The first negative control was immunoprecipitated with normal rabbit IgG beads with cell lysates (50 g); the second negative control included cell lysate (50 g) plus normal rabbit IgG (5 g). The kinase reaction was performed as described above. Protein samples were separated by 10% SDS-PAGE and electroblotted onto suppor ted nitrocellulose paper. Each blot was blocked for 1 h with 5% fat-free milk TTBS solutions at room temperature. Protein bands were probed with their repective primary antibody p-IKK / rabbit polyclonal antibody (5 g, 1:1000 dilution). Mouse monoclonal PKC( 5 g, 1:1000 dilution). All the Immuoreactive bands were visualized with chemiluminescence according to the manufacturers’ instructions (SuperSignal West Pico Chemiluminescent Substrate; PIERCE, Rockford, IL). 7.3.7 Prostate tissue analysis Normal prostate tissues (9 specimens) we re purchased from Tissue Network. The cancer prostate tissues were obtained from pros tectomy from patients from May August 2007. The specimens were placed on ice immediately afte r prostactomy, frozen in liquid nitrogen within 30 minutes to 1 hour after prostectomy. Prostate tissues (0.5-1g) were homogenized with 2 ml of complete lysis buffer and centrifuge at 40 000 g The tissue lysates (100 g) were Western blotted for PKCusing PKCmouse monoclonal antibody (5 g, 1:4000 dilution).

PAGE 145

1327.4 Results 7.4.1 Susceptibility of RWPE-1, LNCaP and DU-145 cells to TNFtreatment. There is accumulating evidence that an activated NFB pathway leads to prostate cancer cell survival [21-23]. Three prostate cell lines RWPE-1, LNCaP and DU-145 were treated with TNF (20 ng/ml) for 24, 48, and 72 hours. Viable ce lls were counted at indicated times using trypan blue exclusion assay. Results demonstr ated that LNCaP cells were sensitive to TNF and inhibited their growth rate (Figure 7.4B). RWPE-1 cells were slightly sensitive to TNF while DU145 were insensitive to TNF (Figure 7.4A, C). To investigate if TNF is signaling through NFB, Western blots were performed for the presence of I B in these cells. Results show that I B was degraded in RWPE-1 cells and LNCaP cells. However, there was no significant degradation of I B in DU-145 cells (Figure 7.5A). The insignificant degradation of I B in DU-145 cells could be due to the rapid turnover; i.e. rapid phosphorylation and degradation of I B in DU-145 cells [23-24]. Therefore, we changed the incubation time to a shorter period from 10-30 minutes. Results demonstrated IkB degradation in all three cell lines (Figure 7.5B). Western blot for actin in these samples showed equal loading of proteins. These results suggest that TNF induces NFB activation. 7.4.2 Involvement of aPKCs in activation of IKK Previous studies have demonstrated that atypical PKCs are involved in TNF activation of the NFB pathway [17]. We therefore determined if endogenous PKCis involved in TNF induced IKK activation in prostate cell lines. Sinc e, DU-145 displayed faster turnover of I B the activation of IKK is likely to be constitutive and rapid as well. Therefore, we treated TNF resistant cell lines RWPE-1 with TNF for a short incubation time (T = 10, 20, 30 min). We found no association of PKCwith IKK in RWPE-1 cells (Figure 7.6A). We also tested longer incubation times (T = 24, 48, 72 h) with TNF to determine the association of PKCand IKK

PAGE 146

133but there were none in RWPE-1 cells (data not shown). However, immunoprecipitation with PKCrabbit polyclonal demonstrated PKCand IKK association at 10 min post TNF treatment. Downregulation of I B was also observed (Figure 7.6B). Phosphorylation of IKK (Ser176/180) was observed at 30 min, while rapid association and dissociation of I B was observed at 10-30 min (Figure 7.6C). Taken together, TNF induce PKCleads to activation of IKK and NFB transactivation in RWPE-1 cells. Contrary to RWPE-1 cells, DU-145 cells showed an association of PKCand IKK at 10 min post TNF treatment in DU-145 cells (Fig ure 7.7A). Additionally, I B protein coimmunoprecipitated with the PKC/IKK complex (Figure 7.7A). For specificity, we showed that both IKK and IKK associated with PKCin TNF treated cells at 20 and 30 minutes respectively (Figure 7.7B). We also observed phosphorylation of IKK (ser176/180) at 30 minutes post TNF treatment, and phosphorylation of I B (Ser32) co-immunoprecipitated with the PKC/IKK complex (Figure 7.7C). Besides PKC, PKChas been shown to be involved with IKK activation [29]. Therefore, we immunoprecipitated PKCand found that both IKK and I B associated with PKC(Figure 7.7D). However, phosphorylation of IKK was not observed (data not shown). This findi ng suggests that in DU-145 cells, TNF induces PKCactivation of IKK and subsequent phosphorylation of I B (Ser32) leads to NFB activation. It is possible that there is a shift from PKCin transformed nontumorigenic RWPE-1 to PKCin DU-145 carcinoma cells in the IKK activation pathway. Although, LNCaP cells are sensitive to TNF treatment, there have been reports that IKK is weakly activated in LNCaP cells [24, 25 ]. In our experiment, LNCaP cells treated with TNF did not induce PKCor PKCin activation of IKK (data not shown) Therefore, our results demonstrated that constitutive activation of NFB in hormone-insensitive prostate DU145 carcinoma is a consequence of IKK activation but not in the hormone responsive LNCaP cell line [25].

PAGE 147

1347.4.3 Translocation of p65 from cyt osol to nucleus in DU-145 cells Many studies have shown that upon stimulati on of cells with cytokines such as TNF IKKs phosphorylate I B at serine residues 32 and 36 [26-28]. After phosphorylation, I B is ubiquitinated and subsequently degraded by 26S prot easome. This allows translocation of NFB/p65 from cytosol to the nucleus where it binds to targeted sites in DNA for transcription [29]. To test this process, DU-145 cells were treated with TNF and cytosol and nuclei fractions were separated. Western blot analysis shows translocat ion of p65 from cytosol to nucleus (Figure 7.8). This corresponds to other studies of NFB/p65 translocation to nucleus to function in transcription [25, 30]. These findings support a novel link between PKCand the NFB pathway in prostate cancer cell survival. 7.4.4 TNF induces apoptosis in LNCaP cells. It has been demonstrated that TNF induces apoptosis in androgen receptor positive LNCaP cells [34]. Our data also demonstrated that LNCaP cells undergo apoptosis after long incubation with TNF (Figure 7.9). Western blot of cleaved PARP (Asp214), activation of caspase-7 (20 kDa) and a decrease in survivin i ndicated cells undergoing apoptosis. However, RWPE-1 and DU-145 cells are resistant to apoptos is. There was no cleaved PARP, no activation of caspase-7, and presence of survivin. Hence, our data is in accordance with other reports that LNCap cells are sensitive to TNF while RWPE-1 and DU-145 are resistant to TNF treatment. 7.4.5 In vivo kinase assay and ICA-1 effects on prostate cells. It has been demonstrated that PKCphosphorylates IKK [36, 42]. To further demonstrate that IKK is a true substrate of PKC, IKK and PKCwere coimmunoprecitpitated and Western blots of p-IKK (Ser176/180) demonstrated that PKCphosphorylates IKK (Figure 7.10A) Little or no activation of IKK was observed in control immunoprecipitated PKCor IKK samples. Additionally, activation of IKK was inhibited

PAGE 148

135when the putative PKCinhibtor ICA-1 (100 nM) was incubated in co-immunoprecipitated PKCand IKK The inhibitor binds to the kinas e domain amino acid sequence 469-475. However, ICA-1 does not significantly ( p > 0.05 for both cell lines) inhibit the cell proliferation of LNCaP or DU-145 cells (Figure 7. 10B, C). Interestingly, low concentration of ICA1 (0.10.5 M) resulted in an increase in cell numbers while high concentration of ICA-1 (10-60 M) resulted in a inhibition of cell growth. It is possible that ICA-1 could be an activator at low concentration and an inhibitor at high concentration. However, this theory is yet to be proven. Whether ICA-1 specifically inhibits PKCand not other PKC isoforms remains unknown. 7.4.6 PKCis overexpressed in PIN and tumor tissues. We have demonstrated that PKCis antiapoptotic and is involved in prostate cell proliferation in tissue culture. We further anal ysed some prostate tissues obtained form tissue network and from patient samples. Benign prosta tic hyperplasia (normal), prostate intraepithelial neoplasia (PIN), and tumor samples were homogenized and tissue lysates (100 g) were Westrn blotted for PKC(Figure 7.11A, B). Our data demonstrated that PKCis overexpressed in PIN and tumor tissues compared to normal prostate tissues. PKCabsorbance densitometry demonstrates that there was an 8-fold increase in PIN tissues and 100 fold increase in tumor tissues compared to normal prostate tissues (Figure 11C).

PAGE 149

136 Figure 7.4 Effects of TNF treatment on prostate cells. Normal RWPE-1 prostate cells (A), LNCaP prostate cells (B) and DU-145 prostate cells (C) were used. Forty to fifty percent confluent cells (3.75 x104) were seeded in a T75 flask. After incubation for 24 hours, the cells were treated with 20 ng/ml of TNF for 24-72 hours. At the indicated time, both the control cells and TNF treated cells were trypsinized and viable cells were counted using trypan blue exclusion assay and a hematocytometry. Triplicate experiments were performed f or each cell line. The mean values of viable cells with SD were plotted.

PAGE 150

137 Figure 7.5 TNF treatment induces I B degradation. (A) After determining the cell viabilit y (Fig. 1), the left over cells population were immunoblotted for I B RWPE-1 and LNCaP cells show a significant degradation of I B while DU-145 cells showed no changes in I B The membrane was reprobed for -actin indicated that equal amounts of protein (50 g) were loaded in each lane. (B) In another independent experiment, cells were treated with TNF (20 ng/ml) for a short incubation time (T=10, 20, 30 min). Whole cell lysates (50 g) showed a time dependent I B degradation in all three cell lines. The membranes were reprobed for -actin and depicted an equal amount of protein loaded in each lane.

PAGE 151

138 Figure 7.6 Role of PKCin activation of IKK Forty to fifty percent confluent RWPE-1 cells (3.75 x104 cells/flask) were seeded in a T75 flask. After incubation for 24 hours, the cells were treated with 20 ng/ml of TNF for a short incubation time (T=20, 20, 30 min). At indicated time, the flasks were placed on ice and cells were washed cold with DPBS to terminate TNF incubation. (A) RWPE-1 whole cells extracts (100 g) from each time point were immunoprecipitated with rabbit polyclonal PKCantibody. Column 1 is the positive (+) control (50 g of whole cell extracts). Column 2 is the tw o negative controls: first is the sepharose beads (50 l of 1:1 v/v), the second negative control contai ns sepharose beads and rabbit IgG. Western blot analysis of IKK shows no association of PKCand IKK in RWPE-1 cells treated with TNF The membrane was reprobed for PKC. (B) In another independent experiment, both control and TNF treated cells were immunoprecipitated with rabbit polyclonal PKCantibody. The physical association of PKCand IKK was observed at 10 min post-TNF treatment. I B was also co-immunoprecipitated. (C) In a si milar experiment, there is phosphorylation of IKK (Ser 176/180) at 30 min and phospho-I B (Ser32) at 10 and 30 min post-TNF treatment.

PAGE 152

139 Figure 7.7 PKCactivates IKK in DU-145 cells. Similar experiments were performed as described in Figure 3 and in Materials and Met hods. (A) DU-145 whole cells extracts (100 g) from each time point were immunoprecipitated with rabbit polyclonal PKCantibody. Column 1 is the positive (+) control (50 g of whole cell extracts). Colum 2 depicts the two negative controls: first is the sepharose beads (50 l of 1:1 v/v), the second negative control contains sepharose beads (50 l) and normal rabbit IgG. Western blot analysis of IKK shows an association of PKCand IKK in cells treated with TNF The membrane was reprobed for PKC. (B) Using specific ant ibodies such as anti-IKK and anti-IKK demonstrated that PKCis associated with both IKK and IKK (C) Western blots of p-IKK (Ser 176/180) at 30 min post-TNF treatment and p-I B (Ser32) at 20 and 30 min post-TNF was also coimmunoprecipitated with PKC. (D) In another independent experiment, both control and TNF treated cells were immunoprecipitated with rabbit polyclonal PKCantibody. The physical association of PKCand IKK was observed at 30 min post-TNF treatment and I B was also co-immunoprecipitated.

PAGE 153

140 Figure 7.8 Translocation of I B from cytosol to the nucleus. Similar density (3.75 x 104 cells/flask) of RWPE-1, LNCaP and DU-145 cells were treated with TNF (20 ng/ml). The cytosol and nucleus were separated as described in Materials and Methods. Cytosol extracts (10 g) of RWPE-1 cells demonstrated a decrease in I B at 10 and 20 min while an increase in I B in the nucleus at 20 min post-TNF treatment. Similar pattern was observed with both LNCaP and DU-145 cells treated with TNF demonstrating translocation of NFB/p65 to the nucleus.

PAGE 154

141 Figure 7.9 Treatment of TNF induces apoptosis in LNCaP cells. A cell density of 3.75 x 104 cells were seeded and cultured for 24 hour. The following day the cells were incubated with TNF for 72 hours. Whole cell lysates of 100 g were separated on 12% SDS-PAGE. RWPE-1 and DU-145 cells demonstrated the presence of full PARP, pro caspase-7 and survivn in both control and TNF treated cells. Western blot of cleaved PARP (Asp214), activation of caspase-7 (20 kDa) and a decreased in survivn demonstrated that TNF induced apoptosis in LNCaP cells.

PAGE 155

142 LNCaPHours 02 44 87 2Number of viable cells ( 1 x 10 3 ) 0 100 200 300 400 Control 0.1 M 0.5 M 1 M 10 M 20 M 40 M B C DU-145 02 44 87 2 0 200 400 600 800 1000 Control 0.1 M 0.5 M 1 M 10 M 20 M 40 M 60 M Figure 7.10 In vivo kinase assay and the effects of ICA-1 treatment on RWPE-1 and DU-145 cells. (A) Cell lysates (50 g) of an exponentially growing DU-145 cells were immunoprecipitated with either rabbit polyclonal PKCantibody and/or IKK rabbit polyclonal antibody. Lane 1 and 2 are the two negative controls: fi rst is the sepharose beads (50 l of 1:1 v/v), the second negative control contains sepharose beads (50 l) and normal rabbit IgG. After immunoprecipitation, a kinase reaction was performed according to Materials and Methods. Western blot analysis showed presence of phospho-IKK (Ser176/180) in lane 3. Upon incubation with PKCinhibitor (ICA-1; 100 nM) phosphorylation of IKK was inhibited. (B) LNCaP and DU-145 cells (C) (50 x104) were seeded in a T25 flask. After incubation for 24-72 hours with ICA-1 (0.1 M-60 M), both the control cells and ICA-1 treated cells were trypsinized and viable cells were counted using trypan blue exclusion assay and a hematocytometry. Triplicate experiments were performed for each cell line. The mean values of viable cells with SD were plotted. P >0.05 demonstrated an insignificant effect of ICA-1 on cell proliferation.

PAGE 156

143 Prostate tissues Normal PN MalignantPKCabsorbance arbitrary value (1x103) 0 20 40 60 80 100 120 140 PKCC Figure 7.11 PKCexpression in prostate tissues. (A) Normal prostate (N) and prostate intraepithelial neoplasia (P) were obtained fr om Tissue Network. Tissue lysate (100 g) was used for western blot. Normal prostate tissue has very little or no PKCexpression while PIN tissues shows overexpression of PKC. (B) Prostate malignant ti ssues (M) show overexpression of PKCcompared to normal prostate tissues. Western blot for -actin demonstrates equal loading of each sample. (C) PKCabsorbance arbitrary value were plotted with p values of P = 0.00048 (normal vs. malignant), P = 0.0357 (normal vs. PIN), and P = 0.0257 (PIN vs. malignant).

PAGE 157

144Table 7: Summary of NFB activation in prostate cells. RWPE-1 LNCaP DU-145 PKC/IKK + PKC/IKK + + I B degration + + + NFB transloation + + + Cleaved PARP + Caspase-7 activation + Suvivin + +

PAGE 158

1457.5 Discussion There is growing evidence that NFB is implicated in oncogenesis [31, 32]. In addition, NFB has been shown to prevent cell death in many cancer cells after chemotherapy, radiotherapy or TNF treatment [21-23]. Constitutive activation of NFB has been detected in androgen-independent prostate cancer xenografts, ce ll lines and in prostate cancer tissue [33, 34]. The interaction between the death domain (TRADD, TRAF2, FADD, and RIP) and aPKCs have been extensively studied by Moscat et al [17, 35]. In addition aPKC is involved in IKK activation and the NFB pathway [17, 35-36]. NFB transcriptional activity is controlled by an antiapoptosis genes such cIAP1, cIAP2, and IEX-1L [37, 38]. In prostate cancer, nuclei localization and overexpression of NFB has been demonstrated in prostate tissue [21, 39]. Although NFB pathway has been extensively studied in prostate cancer, we further demonstrated that aPKC are specifically activate TNF -induced NFB pathway. In accordance with previous reports, TNF (20 ng/ml) induces significant cell death in LNCaP cells while RWPE-1 cells show a slig ht sensitivity [34]. However, DU-145 cells are insensitive to TNF (20 ng/ml) treatment [22]. It has been reported that higher concentration of TNF (100 ng/ml) treatment induces significant gr owth inhibition in DU-145 and PC-3 cells [22]. This discrepancy is due to the differences in TNF concentration used. We used a lower concentration of TNF to demonstrate PKCinduction in IKK activation. Upon cell activation by TNF I B is phosphorylated at serine 32 and 36, which triggers the ubiquitination and subsequent degradation of I B [40, 41]. Our experim ents showed degradation of I B in RWPE-1 cells, LNCaP and cells but ther e was no significant degradation of I B in DU-145 cells. One possible reason is that in androgen-independent prostate cancer cells, there is rapid phosphorylation and rapid degradation of I B (i.e. faster turnover) [23-25]. In addition, the I B half-life is shorter in DU-145 cells (30 minutes ) compared to LNCaP cells (60 minutes) [23]. Therefore, a shorter incubation time (10-30 min) was chosen for all three cell lines. We observed a significant degradation of I B in all the three cell lines within 10-30 minutes of

PAGE 159

146incubation with TNF (20 ng/ml). Hence, our data demonstrated the involvement of NFB activation in TNF treated cells. Another key regulator of NFB is the activation of upstream kinases IKKs [22, 23, 29]. Atypical PKCs hav e been shown to activate IKKs [17, 42-43]. Therefore, immunoprecipitation with PKCdemonstrated that in DU-145 cells, TNF induced PKCand activation of both IKK and IKK I B was also coimmunoprecipitated with PKC/IKK complex. Phosphorylation of IKK (serine 176/180) and phosphorylation of I B (serine 32) was also observed in TNF treated DU-145 cells. This strongly indicates that TNF induced PKCactivation of IKK, and subsequently phosphorlyation of I B This enables NFB/p65 to translocate to nucleus for transcription. Besides PKC, PKChas been involved in activation of IKK [35-36]. Therefore, we immunoprecipitated PKCfrom TNF treated cells. Results demonstrated that PKCis physically associated with IKK at 30 minutes post TNF treatment. However, phosphorylation IKK was not observed. It is likely that to a lesser extent, PKCmay be involved in TNF induced IKK activation in DU-145 cells. Similar experiments were performed in TNF resistant RWPE-1 cells. We found no association of PKCand IKK but there was a strong physical association between PKCand IKK in TNF treated cells. Moreover, there was an association at 10 minutes post-TNF treatment followed by disassociation of I B with the PKC/IKK complex. Similarly, phosphorylation of p-I B (serine 32) was observed with PKC/IKK complex. After phorylation, I B is degradted by the proteosome [23-24]. Our results strongly suggest that TNF induced PKCin activation of IKK in RWPE-1 cells. However, in LNCaP cells, there was very little or no association between atypical PKCand IKK Although TNF decreased the levels of I B expression in LNCaP cells, presumably due to increased degradation of I B indicates activation of the NFB pathway [25]. However, NFB activation in LNCaP cells is not cons titutive compared to androgen-independent prostate carcinoma DU-145 and PC-3 cells [ 23-24]. Moreover, LNCaP cells have low IKK basal

PAGE 160

147level and minimal IKK activity [25]. Therefore, it is possi ble that there is little or no association between PKCand IKK in LNCaP cells. Although the mechanism by which constitutive NFB activation occurs is still unclear, we find that the nature of the alteration s in upstream signaling pathways that result in constitutive IKK activation in prostate cancer cells may vary. Moreover, members of the MAPK kinases (MAPKKs) have been implicated in IKK activation [24, 44]. Studies have further demonstrated that t he tumor-suppressor PTEN inhibits NFB activation and has been implicated in prostate cancer [45]. DU-145 cells are able to secrete large amounts of interleukin-6 and other cytokines, whereas LNCa P cells secrete much lower levels. Chronic autocrine stimulation of the NFB may therefore account for constitutive NFB activation in DU145 cells [46-47]. However, whether interleukin-6 (or other factors) secreted by DU-145 cell is the consequence of NFB activation is not known. An alternative mechanism for constitutive activation of NFB in DU-145 is activation of an internal signal transduction pathway. For example, overexpression of the anti-apo ptotic protein bcl-2 can activate NFB and suppress apoptosis [48-49]. Activation of IKK subsequently phosphorylate s inhibitory protein, I B This allows translocation of NFB/p65 from cytosol to the nucleus [41]. Similarly, our data suggest that TNF induced NFB/p65 translocation to the nucleus in all three cell lines. Hence, our data is in agreement with other studies. Taken together, PKCactivates IKK in constitutive activation of NFB in RWPE-1 and DU-145 cells. Whereas, TNF induced NFB activation in LNCaP cells is indpendent of atypical PKCs. We further demonstrated that LNCaP cells are sensitive to TNF treatment and undergo apoptosis as observed by cleaved PARP (Asp214), and activation of caspase-7. These data are also in agreement with other reports [25, 34]. TNF induced death receptors in activation of caspase-8 and subsequent activation of caspase-3,-7 and cleaved PARP for extrinsic apoptosis [50]. In RWPE-1 and DU-145 cells, TNF induced very little apoptosis and cell survival. Another key event in NFB activation is the translocation of NFB/p65 from

PAGE 161

148cytosol to the nucleus [41]. Our results demonstrate that TNF treatment decreases NFB/p65 in cytosol and increases the NFB/p65 in the nucleus in all the three cell lines. This showed that TNF induces atypical PKCs in activation of the NFB pathway (Table 7). Although, there are PKC inhibitors such as staurosporine and tamoxifen, they do not specifically inhibit PKC[51-52]. Therefore, a putative PKCinhibitor (ICA-1) which targets the unique amino acid sequence of the kinase domain 469 475 (glutamine-469, isoleucine-470, arginine-471, isoleucine-472, proline-473, arginine-474, serine475) was used in a kinase assay to demonstrate that IKK is the substrate of PKC. Our data demonstrated that PKCphosphorylates IKK when PKCand IKK are co-immunoprecipitated. However, this activity is inhibited by ICA-1, indicating that IKK is the true substrate for PKC. However, there was no significant decrease in the cell pr oliferation rate in LNCaP and DU-145 cells. It is possible that higher concentrat ion of ICA-1 (greater than 60 M) will inhibit cell proliferation. In addition, we also analyzed the patients’ ti ssues samples, comparing normal prostate, prostate intraepithelial neoplasia and malignant tumor. Our data demonstrated an overexpression of PKCin PIN and malignant tumors compared to normal prostate. Although the samples analyzed are under represented, it is possible that overexpression of PKCin PIN may lead to malignant prostate cancer. Hence, PKCcan be a potential biomarker and an alternative target for treatment of prostate cancer. 7.6 Conclusion and future directions This study showed that PKCis multifunctional depending on cell types. In prostate cells, PKCassociated with Cdk7 for cell proliferation of non-malignant prosate RWPE-1 cells and malignant androgen-dependent prostate LNCaP carcinoma cells. PKCis also required for cell survival of androgen-independent prostate DU -145 carcinoma cells. Inhibition of PKCleads to cell apoptosis. This study also leads to many future challenging areas listed below:

PAGE 162

1491. Other cdks such as cdk4/6 may associate with PKCin DU-145 cell proliferation. Additionally, cell cycle arrest at G0/G1 in DU-145 cells indicates that other cdks may drive the cell cycle and it is not limited to PKC/Cdk7/cdk2 pathway. 2. Overexpression of PKCin malignant prostate cells coul d establish other pathways that are yet to be discovered. Quantification of PKCmRNA in prostate ce lls will illuminate if PKCis transcriptionally regulated. 3. LNCaP cells may have a point mutation on PKCthat may contribute to no significant effects of PKCsiRNA on cell proliferation and protein content. Another synthetic siRNA that target different sites on PKCmay be a better target for PKCin LNCaP cells. In addition, other PKCs may drive LNCaP cell survival. 4. A shift from PKCin RWPE-1 to PKCin DU-145 may be a possible survival mechanisim for androgen-independent prostate cells. Howeve r, activation (i.e phosphorylation) of IKK by PKCremains to be established. Therefore, further study on these areas may illumi nate the signal transduction pathways involving PKC, specific to PKC, in prostate cancer. 7.7 References 1. Dekker LV. Protein kinase C. Georgetown, Tex., U.S.A. : Landes Bioscience/Eurekah.com ; New York, N.Y., U.S.A. : Kluwer Academ ic/Plenum Publishers, pg. 100-110, 2004. 2. Didonato JA, Saatcioglu F, Karin M. Molecu lar mechanisms of immunosuppression and antiinflammatory activities by glucocorticoids. Am erican Journal of Respiratory and Critical Care Medicine 154:S11-15, 1996. 3. Karin M. The beginning of the end: IkappaB kinase (IKK) and NF-kappaB activation. The Journal of Biological Chemistry 274:27339-27342, 1999. 4. Karin M, Ben-Neriah Y. Phosphorylation meet s ubiquitination: The control of NF-[kappa]B activity. Annual Review of Immunology 18:621-663, 2000.

PAGE 163

1505. Hayden MS, Ghosh S. Signaling to NF-k B. Genes and Development 18:2195-2224, 2004. 6. Diaz-Meco MT, Berra E, Municio MM et al A dominant negative protein kinase C zeta subspecies blocks NF-kappa B activation. Molecular Cell Biology 13:4770-4775, 1993. 7. Bonnizzi G and Karin M. The two NFB activation pathways and their role in innate and adaptive immunity. Trends in Immunology 25:280-288, 2004. 8. Hu Y, Baud V, Delhase M et al. Abnormal morphogenesis but intact IKK activation in mice lacking the IKKalpha subunit of IkappaB kinase. Science 284:316-320, 1999. 9. Li Q, Estepa G, Memet S et al. Complete lack of NF-kappaB activity in IKK1 and IKK2 double-deficient mice: additional defect in neurulation. Genes and Development 14:17291733, 2000. 10. Kaisho T, Takeda K, Tsujimura T et al. Ikapp aB kinase alpha is essential for mature B cell development and function. Journal of Ex perimental Medicine 193:417-426, 2001. 11. Solan NJ et al. RelB cellular regulation and transcriptional activity are regulated by p100. The Journal of Biological Chemistry 277:1405-1418, 2002. 12. Claudio E, Brown K, Park S, Wang H, Siebenlist U. BAFF-induced NEMO-independent processing of NF-kB2 in maturing B cells. Nature Immunology 3:958-965, 2002. 13. Coope HJ, Atkinson PG, Huhse B, Belich M, Janzen J, Holman MJ, Klaus GG, Johnston LH, Ley SC. CD40 regulates the processing of NF-kB2 in p100 to p52. EMBO Journal 21:53755385, 2002. 14. Muller JR and Siebenlist U. Lymphotoxin receptor induces sequentia l activation of distinct NFB factors via separate signaling pathways. The Journal of Biological Chemistry 278:12006-12012, 2003. 15. Mordmuller B et. Al. Lymphotoxin and lipopolysaccharide induce NF-kB-p52 generation by a co-translational mechanism. EMBO Reports 4:82-87, 2003. 16. Hsu H, Huang J, Shu HB, Baichwal V, G oeddel DV. TNF-dependent recruitment of the protein kinase RIP to the TNF receptor1 signaling complex. Immunity 4:387-396, 1996.

PAGE 164

15117. Sanz L, Sanchez P, Lallena MJ, Diaz-Meco MT and Moscat J. The interaction of p62 with RIP links the atypical PKCs to NFB activation. The EMBO Journal 18:3044-3053, 1999. 18. Delhase M, Hayakawa M, Chen Y, and Kari n M. Positive and negative regulation of I B kinase activity through IKK subunit phosphorylation. Science 284:309-313, 1999. 19. Regnier CH, song HY, Gao X, Goeddel DV Cao Z and Rothe M. Identification of characterization of an I B kinase. Cell 90:373-383, 1997. 20. Ling L, Cao Z and Goeddle DV. NFinducing kinase activates IKK by phosphorylation of ser-176. Proceedings of National Academy of Science 95:3792-3797, 1998. 21. Lessard L, Mes-Masson, AM, Lamarre L, Wall L, Lattouf JB, and Saad F. NFB nuclear localization and its prognostic significance in prostate cancer. British Journal of Urology International 91:417-420, 2003. 22. Sumitomo M, Tachibana M, Nakashima J et al. An essential role for nuclear factor kappa B in preventing TNF-alpha-induced cell death in pr ostate cancer cells. Journal of Urology 161:674-9, 1999. 23. Gasparin AV, Yao YJ, Kowalczyk D, Lyakh LA, Karseladze A, Slaga TJ and Budunova IV. The role of IKK in constitutive activation of NFB transcription factor in prostate carcinoma cells. Journal of Cell Science 115:141-151, 2002. 24. Suh J, Payvandi F, Edelstein LC, Ament a PS, Zong WX, Gelinas C, Rabson AB. Mechanisms of constitutive NFB activation in human prostate cancer cells. The Prostate 52:183-200, 2002. 25. Palayoor ST, Youmell MY, Calderwood SK, Coleman CN and Price BD. Constitutive activation of IkB kinase a and NFB in prostate cancer cells is inhibited by ibuprofen. Oncogene 18:7389-7394, 1999. 26. Krappmann D, Wulczyn FG, Scheidereit C. Different mechanisms control signal-induced degradation and basal turnover of t he NF-kappaB inhibitor IkappaB alpha in vivo EMBO Journal 15:6716-6726, 1996.

PAGE 165

15227. Pando MP, Verma IM. Signal-dependent and –independent degradation of free and NFkappa B-bound IkappaBalpha. The Journal of Biological Chemistry 275:21278-21286, 2000. 28. Karin M, Ben-Neriah Y. Phosphorylation meet s ubiquitination: The control of NF-(kappa)B activity. Annual Review of Immunology 18:621-663, 2000. 29. Lellena MJ, Diaz-Meco MT, Bren G, Pa ya CV, Moscat J. Activation of I B Kinase by protein kinase C isoforms. Molecular Cell Biology 19:2180-2188, 1999. 30. Shukla S, MacLeannan GT, Fu P, Patel J, Marengo SR, Resnick MI, and Gupta S. Nuclear factor-kB/p65 (Rel A) is constitutively activated in human prostate adenocarcinoma and correlates with disease progression. Neoplasia 6:390-400, 2004. 31. Zgou Y, Yau C, Gray JW, Chew K, Dair kee SH, Moore DH, Eppenberger U, EppengergerCastori Serenella, and Benz CC. Enhanced NF B and AP-1 transcriptional activity associated with antiestrogen resistant breast cancer. BMC Cancer 7:59 2007. 32. Hermann JL, Beham AW, Sarkiss M et al. BCL-2 suppresses apoptosis resulting from disruption of the NFB pathway. Experimental Cell Research 237:101-9, 1997. 33. Sweency C, Li L, Shanmugam R, Bhat-Nakshat ri P, Jayaprakasan V, Baldridge LA, Gardner T, Smith M, Nakshatri H, and Chen L. Nuclear fact or-kB is consititutively activated in prostate cancer in virto and is overexpressed in prostatic intraepithelial neoplasia and adenocarcinoma of the prostate. Clinical Cancer Research 10:5501-5507, 2004. 34. Chopra DP, Menard RE, Januszewski J, and Mattingly RR. TNFmediated apoptosis in normal human prostate epithelial cells and tumor cell lines. Cancer Letters 203:145-154, 2004. 35. Leitgas M, Sanz L, martin P, Duran A, Braun U, Garcia JF, Camacho F, Diaz-Meco MT, Rennert PD, and Moscat J. Target disruption of the PKC gene results in the impairment of the NFB pathway. Molecular cell 8:771-780, 2001. 36. Duran A, Diaz-Meco MT and Moscat J. E ssential role of Rel Ser311 phosphorylation by PKC in NFB transcriptional activation. The EMBO Journal 22:3910-3918, 2003.

PAGE 166

15337. Wang CY, Mayo MW, Korneluk RG, Goeddel DV, Baldwin AS. NFB antiapoptosis: induction of TRAF1 and TRAF2 and cIAP1 and cIAP2 to suppress caspase-8 activation. Science 281:1680-1683, 1998. 38. Wu MX, Ao Z, Prasad KV, Wu R, Scholossman SF. IEX-1L, an apoptosis inhibitor involved in NFB mediated cell survival. Science 281:998-1001. 1998. 39. Fradet V, Lessard L, Begin LR, Karakiewic z P, Masson AMM, and Saad F. Nuclear factorB nuclear localization is predictive of biochemica l recurrence in patients with positive margin prostate cancer. Clinical Cancer Research 10:8460-8464, 2004. 40. Yamamoto Y and Gaynor R. I B kinases: key regulators of the NFB pathway. TRENDS in Biochemical Sciences 29:72-78, 2004. 41. Hu J, Haseebuddin M, Young M, and Col burn NH. Suppression of p65 phosphorylation conincides with inhibiton of I B polyubiquintination and degradation. Molecular Carcinogenesis 44:274-284, 2005. 42. Lu Y, Jamieson L, Brasier AR, and Fields AP. NFB/RelA transactivation is required for atypical protein kinase C -medicated cell survival. Oncogene 20:4777-4792, 2001. 43. Folgueira L, McElhinny JA, Bren GD, MacM orran WS, Diaz-Meco MT, Moscat J, and Paya CV. Protein kinase Cmediates NFB activation in human immunodeficiency virus-infected monocytes. Journal of Virology, 223-231, 1996. 44. Lee FS, Peters RT, Dang LC and Maniatis T. MEKK1 activates both IkappaB kinase alpha and IkappaB kinase beta. Proceedings of National Academy of Science 95:3792-3797, 1998. 45. Wang S, Gao J, Lei Q, Rozengurt N, Pritchar d C, Jiao J, Thomas GV, Li G, Roy-Burman P, Nelson PS, Liu X, and Wu H. Prostate-specific deletion of the murine Pten tumor suporessor gene leads to metastatic prostate cancer. Cancer Cell 4:209-221, 2003. 46. Baeuerle PA and Baltimore D. NF-kappa B: ten years after. Cell 87:13-20, 1996.

PAGE 167

15447. Basu S, Rosenzweig KE, Youmell MY and Price BD. The DNA-dependent protein kinase participates in the activation of NF kappa B following DNA damage. Biochemical Biophysical Research Communication 247:79-83, 1998. 48. Catz SD, Johnson JL. Transcriptional regulat ion of bcl-2 by nuclear factor kappa B and its significance in prostate cancer. Oncogene 20:7342-7351, 2001. 49. de Moissac D, Mustapha S, Greenberg AH and Kirshenbaum LA. Bcl-2 activates the transcription factor NFkappaB through the degradation of the cytoplasmic inhibitor IkappaBalpha. The Journal of Biological Chemistry 273:23946-23951, 1998. 50. Ashkenazi A and Dixit VM. Death receptors: signaling and modulation. Science 281:13051308, 1998. 51. Rohlff C, Blagosklonny MV, Kyle E, Kesari A, Kim IY, Zelner DJ, Hakim F, Trepel J, Bergan RC. Prostate cancer cell growth inhibition by tamo xifen is associated with inhibition of protein kinase C and induction of p21(waf1/cip1). Prostate 37:51-9, 1998. 52. Ko JH, Park WS, Earm YE. The protein kinase inhibitor, staurosporine, inhibits L-type Ca2+ current in rabbit atrial myocytes. Biochemical and biophysical Research Communicaiton 329:531-7, 2005.

PAGE 168

About the Author Ms. Hla Y. Win is a major in Chemistry and re ceived the Honors degree of Bachelor of Science from The University of Winnipeg, D epartment of Chemistry, Winnipeg, Manitoba, Canada, in June 2002. She continued her graduat e study at The Universi ty of South Florida, Department of Chemistry, Tampa, Florida. She received her Ph.D. in May 2008. She then moved on to her post-doctoral training at Case Western Reserve University, Cleveland, Ohio.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 2200421Ka 4500
controlfield tag 001 001970450
005 20090923090346.0
007 cr mnu uuuuu
008 081126s2008 flu sbm 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002322
035
(OCoLC)276429266
040
FHM
c FHM
049
FHMM
090
QD31.2 (ONLINE)
1 100
Win, Hla Yee.
0 245
Role of protein kinase C-iota in prostate cancer
h [electronic resource] /
by Hla Yee Win.
260
[Tampa, Fla.] :
b University of South Florida,
2008.
502
Dissertation (Ph.D.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
System requirements: World Wide Web browser and PDF reader.
Mode of access: World Wide Web.
500
Title from PDF of title page.
Document formatted into pages; contains 154 pages.
Includes vita.
590
Co-adviser: Mildred Acevedo-Duncan, Ph.D.
Co-adviser: Robert Potter, Ph.D.
520
ABSTRACT: Prostate cancer is one of the leading causes of death among males in the United States. In this study, we hypothesized that an activated PKC--dependent anti-apoptotic pathway, drives the cell cycle proliferation and survival of prostate cancer cells. We investigated the role of atypical PKC-iota (PKC-) in androgen- independent prostate DU-145 carcinoma, androgen-dependent prostate LNCaP carcinoma compared to transformed non-malignant prostate RWPE-1 cells. Western blotting and immunoprecipitations demonstrated that PKC- is associated with cyclin-dependent activating kinase (CAK/Cdk7) in androgen-dependent, RWPE-1 and LNCaP cells but not in androgen-independent DU-145 cells. Treatment of prostate RWPE-1 cells with PKC- silencing RNA (siRNA) decreased cell proliferation, cell cycle accumulation at G/M phase and decreased phosphorylation of Cdk7 and cdk2.In addition, PKC- siRNA treatment provoked a decrease in phosphorylation of Bad and increased Bad/Bcl-xL heterodimerization, leading to cell apoptosis. In DU-145 cells, PKC- is anti-apoptotic and still required for cell survival. Treatment with PKC- siRNA blocked an increase in cell number, and inhibited G/S transition. In addition to cell cycle arrest, both RWPE-1 cells and DU-145 cells underwent apoptosis via mitochondria dysfunction and activating apoptosis cascades such as release of cytochrome c, activation of caspase-7, and poly-(ADP-ribose) polymerase (PARP) cleavage. Mechanistic pathways involving aPKCs in the NF-B survival pathway were established using pro-inflammatory cytokine, tumor necrosis factor alpha (TNF). Results demonstrated that RWPE-1 cells and DU-145 cells are insensitive to TNF whereas LNCaP cells are sensitive to TNF treatment and undergo apoptosis.In DU-145 cells, TNF induced PKC- activation of IB kinase, IKK/, while in RWPE-1 cells, PKC- activates IKK/. Both RWPE-1 and DU-145 show degradation of IB allowing NF-B/p65 translocation to the nucleus. In LNCaP cells, the upstream kinase activation IKK/ was not observed, although there have been reports that LNCaP cells weakly activate IKK and have NF-B activation. In vivo kinase assay demonstrates that PKC- is the substrate of IKK/. A putative PKC- inhibitor (ICA-1) inhibited activation of IKK/ in vivo. Hence, PKC- is an antiapoptotic protein and this suggests that anti-PKC- therapy may be a viable option for prostate carcinoma cells.
653
Small interfering RNA.
Cell cycle.
Apoptosis.
Cell survival.
Phosphorylation.
690
Dissertations, Academic
z USF
x Chemistry
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2322