USF Libraries
USF Digital Collections

BRCA1 185delAG mutant protein, BRAt, amplifies caspase-mediated apoptosis and maspin expression in ovarian cells

MISSING IMAGE

Material Information

Title:
BRCA1 185delAG mutant protein, BRAt, amplifies caspase-mediated apoptosis and maspin expression in ovarian cells
Physical Description:
Book
Language:
English
Creator:
O'Donnell, Joshua D
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Ovarian cancer
Chemotherapy
Programmed cell death
Akt
Caspase 3
Dissertations, Academic -- Pathology and Cell Biology -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Ovarian cancer is a deadly disease that kills an estimated 15,000 women annually in the United States. It is estimated that approximately 10% of ovarian cancers are due to familial inheritance. The most commonly mutated genes in familial ovarian cancer are BRCA1 and BRCA2. It has been reported that cells carrying the BRCA1 185delAG mutation undergo an enhanced caspase-3 mediated apoptotic response. Here, we report on the transfection of cDNA coding for the putative truncated protein product of the BRCA1 185delAG mutant gene into BRCA1 wild-type human immortalized ovarian surface epithelial (IOSE) cells and ovarian cancer cells. Cells transfected with the BRCA1 185delAG truncation protein (BRAt) showed increased levels of active caspase 3, increased cleavage of caspase 3 substrates, PARP and DFF45, and decreased XIAP and cIAP1 following staurosporine (STS) treatment.BRAt also reduced Akt phosphorylation and over expression of activated Akt in BRAt cells restored caspase-3 activity to that seen in wild type cells. Further, BRAt expression increased chemosensitivity in platinum resistant ovarian cancer cells. Similarly, maspin protein has been shown to sensitize breast carcinoma cells to STS-induced apoptosis. We provide the first evidence that BRAt is sufficient to induce maspin protein in IOSE cells. IOSE cell lines carrying the BRCA1 185delAG mutation showed higher maspin levels than wild-type BRCA1 IOSE cell lines. BRCA1 wild-type IOSE cells were transfected with BRAt protein and showed increased maspin mRNA levels and increased nuclear maspin protein levels as compared to control cells. Additionally, both heterozygous carriers of the BRCA1 185delAG mutation and cells transfected with BRAt protein show an increased ability to activate the maspin promoter as compared to control cells.The transcription factor AP1 is at least partially required for full activation of the maspin promoter in BRAt cells, as siRNA directed towards c-jun decreased activation of the full-length maspin promoter. Taken together, our data demonstrate that truncated proteins arising from BRCA1 185delAG mutation increase Akt-mediated apoptosis by increasing nuclear maspin expression, suggesting a possible mechanism by which ovarian cancer patients with germline BRCA1 mutations may respond better to chemotherapy.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Joshua D. O'Donnell.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 111 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002007612
oclc - 405631125
usfldc doi - E14-SFE0002422
usfldc handle - e14.2422
System ID:
SFS0026740:00001


This item is only available as the following downloads:


Full Text

PAGE 1

BRCA1 185delAG Mutant Protein, BRAt, Amp lifies Caspase-Mediated Apoptosis and Maspin Expression in Ovarian Cells by Joshua D. O’Donnell A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology College of Medicine University of South Florida Major Professor: Patricia A. Kruk, Ph.D. Jin Q. Cheng, M.D., Ph.D. Santo V. Nicosia, M.D. Alvaro Monteiro, Ph.D. Rebecca Sutphen, M.D. Date of Approval: April 4, 2008 Keywords: ovarian cancer, chemothera py, programmed cell death, Akt, caspase 3 Copyright 2008, Joshua D. O’Donnell

PAGE 2

I would like to dedicate this disserta tion to my parents, David and Joanne O’Donnell of Maryville, Miss ouri. Without their loving support and encouragement I would not be where I am today and for that I am grateful. Additi onally, I would like to dedicate this dissert ation to my friend and former coworker/office mate Dr. Stephen Tebes. Dr. Tebes was the most inspirational human being I have ever had the pleasure to know. He was an incredibly compassiona te, dedicated, and talented gynecologic oncologist who used his persona l experiences as a cancer patient to give his own patients unique and insightful advice and care that only another cancer patient could give. Steve’s attitude and demeanor, even in his darkest hour, were incredible as he stood tall with a smile on his face; even though he knew the end wa s near. Dr. Tebes lost his battle with rhabdomyosarcoma in December of 2006 and will forever be missed.

PAGE 3

ACKNOWLEDGMENTS I would like to thank my mentor Dr. Patr icia Kruk for her continued support, guidance, and patience as I completed my dissertation research and prepared this manuscript. Additionally, I would like to thank Dr. Nicole Johnson for laying the foundation for this research proj ect. I would also like to th ank my other coworkers, Dr. Yira Bermudez, Nancy Lowell, Rebecca Li nger, Christina Drenberg, and Nicole Anderson for their support and encouragement. I am also grateful for the excellent advice and direction provided by my disse rtation committee consisting of Dr. Santo Nicosia, Dr. Jin Cheng, Dr. Al varo Monteiro, and Dr. Rebecca Sutphen. I appreciate the time they’ve given to attend committee meetings and am thankful for the great suggestions they’ve provided. Finally, I woul d like to thank my family and friends for encouraging me over the last five years. It has been a long road that I would not have been able to travel on my own.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES...……………………………………………………………………...iii LIST OF FIGURES……………………………………………………………………….iv LIST OF ABBREVIATIONS ..………………...………………………………………....vi ABSTRACT …….…………………………………………………...…………………….x CHAPTER I: INTRODUCTION……………………………………………… ...……….1 Ovarian Cancer………………………………………… ……………………..…..1 BRCA1……………………………………………………….……….……..…….8 Apoptosis….………..………………………… ……………………………..…..12 Maspin………………… …………………………………………………..…….16 CENTRAL HYPOTHESIS …………………………………………………………….20 SPECIFIC AIMS ..……………………………………………………………………….20 CHAPTER II: BRCA1 185delAG TR UNCATION PROTEIN, BRAT, AMPLIFIES CASPASE-MEDIATED APOPTOSIS IN OVARIAN CELLS ………21 Abstract .……………………………...………………………………………….21 Introduction ..……………………………………………………………………..23 Materials and Methods …..……………………………………………………….26 Cell Culture, Plasmid Constr uction, and Transfection …………..………26 Luciferase Assay ….……………………………………………………...28 BRAt Morphology and Cell Growth ..………………………………..…..29 Tumorigenesis and Telomerase Assays .……………………………..….29 BRAt Localization .…………………………………………………..…..29 BRAt RT-PCR ………………………………………….…………….….30 XIAP, cIAP1, and Bax RT-PCR ………………………………………...31 Apoptosis Induction and Quantification …………………………………32 Statistical Analysis …………………………………………………..…..34 Results ………………………………………….…………………………..……35 Detection of BRAt mRNA and nuclear localization of BRAt protein …..35 BRAt does not alter IOSE morphol ogy or induce tumorigenesis …….….44 BRAt increases caspase-3 mediated apoptosis following STS Treatment ............................................................………………………. 46

PAGE 5

ii BRAt cells express lower levels of XIAP, cIAP1, and p-Akt and increased levels of Bax ………………………………..…………….51 hTERT-BRAt can selectively incr ease apoptosis in cancer cell.…….…..56 BRAt increases cytotoxicity in pl atinum-resistant ovarian cancer cells …………………………………………………………………..…57 Discussion ……………………………………………………..…………………60 Acknowledgements ………..……………………………………………………..63 CHAPTER III: BRCA1 185delAG TRUNCA TION PROTEIN, BRAT, AMPLFIES MASPIN EXPRESSION IN OVARIAN SURFACE EPITHELIAL CELLS …...…64 Abstract ………………………………………………………………..…………64 Introduction …………………………………..…………………………………..66 Materials and Methods ..……………………………………………………….....68 Cell Culture and Transfection ……………………………………………68 Cell Viability Assay ……………………………………………………...68 Western Blot and RT-PCR …………………………………………….69 Luciferase Assay ………………………………………………………....70 Statistical Analysis ……………………………………………………….71 Results ………..…………………………………………………………………..72 BRAt and maspin have similar eff ects on ovarian cell proliferation following treatment …………………………………...………………72 IOSE cells carrying the BRCA1 185delAG mutation have increased maspin protein levels …………………..……………………..72 BRAt transfection increases maspin message and nuclear maspin protein…………………………………………………………… 74 IOSE cells carrying the BRCA1 185delAG mutati on and stable BRAt cells display increased activa tion of the maspin promoter ……….77 BRAt-enhanced maspin promoter act ivation is partially mediated by the transcription factor AP1 …………….…………………………….79 Discussion …….………………………………………………………………....84 Acknowledgements …..…………………………………………………………..87 CHAPTER IV: CONCLUSIONS .………….……...…………………………………...88 REFERENCES …………………………………………………………………………..93 ABOUT THE AUTHOR………………………………………………………….End Page

PAGE 6

iii LIST OF TABLES Table 1: Densitometric analysis of sel ected members of the caspase pathway in BRAt cells ..…………………………………………………………………..49

PAGE 7

iv LIST OF FIGURES Figure 1: BRAt Nucleotide and Protein Sequence….…………………….………..35 Figure 2: BRAt Expression Plasmids.………………………………………...…....36 Figure 3: Initial Application of the BRAt RT-PCR Protocol…………………..…..38 Figure 4: BRAt PCR Optimizatio n with DMSO and Glycerol …….……………...39 Figure 5: BRAt RT-PCR detects BRAt mRNA in Stable and Transiently Transfected Cells ……………………………………………40 Figure 6: Optimization of -actin Primer Addition for use as an Internal Control ..........................................................................................42 Figure 7: Localization of BRAt Protein………………………………………...….43 Figure 8: BRAt does not alter IOSE morphology or tumorigenicity…...………….45 Figure 9: BRAt confers increased STS-mediated cell death via caspase-3 cleavage …………………………………………………...…..48 Figure 10: BRAt confers increased STS-mediated cell death…………………...…..50 Figure 11: BRAt cells have decrease d cIAP1 and XIAP and increased Bax protein levels ……………………………………………………………..53 Figure 12: BRAt cells have decrease d XIAP and increased Bax message levels …...54 Figure 13: BRAt cells have decr eased levels of phosphorylated AKT ……………...55 Figure 14: BRAt increases STS-indu ced death in ovarian cancer cells ……………..57 Figure 15: BRAt increases cytotoxi city in platinum-resistant ovarian cancer cells ……………………………………………………………….59 Figure 16: BRAt and maspin protein ha ve similar effects on ovarian cell proliferation …………………….…………………………...……….73

PAGE 8

v Figure 17: The BRCA1 185delAG mutation correlat es with increased maspin expression ………………………………………………………..74 Figure 18: BRAt transfection increases ma spin message and protein levels………..76 Figure 19: IOSE cells carrying the BRCA1 185delAG mutati on and stable BRAt cells display increased activa tion of the maspin promoter ………..78 Figure 20: Truncated maspin promoter results in decreased activation of luciferase reporter ......................................................................................80 Figure 21: AP1 knockdown results in decrea sed activation of the full length maspin promoter …………………………………………………………81 Figure 22: AP1 knockdown decreases maspin protein levels in BRAt cells and attenuates the apoptotic re sponse following STS treatment …….…..83 Figure 23: Proposed mechanism for BRAt-induced maspin expression and caspase-3 cleavage in ovarian cells ……………………………..…...92

PAGE 9

vi LIST OF ABBREVIATIONS AA Constitutively active Akt AP1 Activator protein 1 Apaf-1 Apoptotic proteas e activating factor 1 b.p. Base pair BAP1 BRCA1 associate protein-1 BARD1 BRCA1-associated RING domain protein Bax BCL-2 -associated X protein Bcl-2 B-cell CLL/lymphoma 2 BH Bcl-2 homology domain BIR Baculovirus IAP repeat BRAt BRCA1 185delAG amino te rminal truncation protein BRCA1 Breast and ovarian cancer susceptibility gene 1 BRCA2 Breast and ovarian cancer susceptibility gene 2 BRCT BRCA1 c-terminal domain BRIT BRAt control plasmid containing a sc ramble sequence at the C-terminus BSA Bovine serum albumin CA-125 Cancer antigen 125 CARD Caspase recruitment domains CB Carboplatinum

PAGE 10

vii cDNA complementary DNA CP Cisplatinum Cyt Cytoplasmic fraction dATP Deoxyadenosine triphosphate DED Death effector domains DFF45 DNA fragmentation factor 45 DISC Death-inducing signaling complex DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid dns Data not shown ECL Enhanced chemiluminescence EGF Epidermal growth factor EGFR Epidermal growth factor receptor ELISA Enzyme linked immunosorbent assay ERCC1 Excision repair cross-complementi ng rodent repair deficiency, group 1 FADD Fas-associated protein with death domain GFP Green flourescent protein h Hour HDF Human dermal fibroblasts HER2/neu Human epidermal growth factor receptor 2 His Histidine tag hMLH1 Human MutL homolog 1

PAGE 11

viii hMSH2 Human MutS homolog 2 HNPCC Hereditary nonpolyposis colorectal carcinoma hTERT Human telomerase reverse transcriptase IAP Inhibitor of apoptosis protein IBM IAP-binding motif IC50 Median inhibition concentration IOSE Immortilized ovarian surface epithelium IP Immunoprecipitation Luc Luciferase M Minute MPTP Mitochondrial permeability transition pore mRNA Messenger ribonucleic acid ND Not detectable NER Nucleotide excision repair NMD Nonsense-mediated decay Nuc Nuclear fraction OVAD Ovarian adenoma PARP Poly (ADP-ribose) polymerase PBS Phosphate buffered saline PCR Polymerase chain reaction PI Propidium iodide PVDF Polyvinylidene fluoride

PAGE 12

ix RING Really interesting new gene RT-PCR Reverse transcriptase polymerase chain reaction s Second SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis SE Standard error siRNA Small interfering RNA STS Staurosporine SV-40 Simian virus 40 TBS Tris-buffered saline TM Trans-membrane VEGF Vascular endothe lial growth factor WT Wild-type XIAP X-linked inhibitor of apoptosis protein

PAGE 13

x BRCA1 185delAG Mutant Protein, BRAt, Amplifies Caspase-Mediated Apoptosis and Maspin Expression in Ovarian Cells Joshua D. O’Donnell ABSTRACT Ovarian cancer is a deadly disease that kills an estimated 15,000 women annually in the United States. It is estimated that approximately 10% of ovarian cancers are due to familial inheritance. The most commonly mutated genes in familial ovarian cancer are BRCA1 and BRCA2. It has been reported that cells carrying the BRCA1 185delAG mutation undergo an enhanced caspase-3 medi ated apoptotic response. Here, we report on the transfection of cDNA coding for the pu tative truncated protein product of the BRCA1 185delAG mutant gene into BRCA1 wild-type human immortalized ovarian surface epithelial (IOSE) cells and ovarian cancer cells. Cells tr ansfected with the BRCA1 185delAG truncation prot ein (BRAt) showed increase d levels of active caspase 3, increased cleavage of caspase 3 substrat es, PARP and DFF45, and decreased XIAP and cIAP1 following staurosporine (STS) treatment. BRAt also reduced Akt phosphorylation and over expressi on of activated Akt in BRAt cells restored caspase-3 activity to that seen in wild type cell s. Further, BRAt expression increased

PAGE 14

xi chemosensitivity in platinum resistant ovarian cancer cells. Similarly, maspin protein has been shown to sensitize breast carci noma cells to STS-induced apoptosis. We provide the first evidence that BRAt is suffici ent to induce maspin protein in IOSE cells. IOSE cell lines carrying the BRCA1 185delAG mutation showed higher maspin levels than wild-type BRCA1 IOSE cell lines. BRCA1 wild-type IOSE cells were transfected with BRAt protein and showed increased ma spin mRNA levels a nd increased nuclear maspin protein levels as compared to cont rol cells. Additiona lly, both heterozygous carriers of the BRCA1 185delAG mutation and cells tran sfected with BRAt protein show an increased ability to activat e the maspin promoter as compared to control cells. The transcription factor AP1 is at least partia lly required for full activation of the maspin promoter in BRAt cells, as siRNA directed to wards c-jun decreased activation of the fulllength maspin promoter. Taken together, our data demonstrate that truncated proteins arising from BRCA1 185delAG mutation increase Akt-me diated apoptosis by increasing nuclear maspin expression, suggesting a po ssible mechanism by which ovarian cancer patients with germline BRCA1 mutations may respond better to chemotherapy.

PAGE 15

1 CHAPTER I INTRODUCTION Ovarian Cancer It is estimated that over 15,000 women di e annually of ovarian cancer in the United States [1, 2]. Only three other cancer s, breast, lung, and colon, are estimated to kill more women annually [2]. Five-year survival rates for ovarian can cer vary based on stage and grade of the tumor. In the United States, the overall survival rate for stage I is 93%, stage II is 70%, stage III is 37%, and stage IV is 25%. However, only about 20% of patients are diagnosed at stage I, whereas approximately two-thirds of patients are diagnosed at stage III or IV [1]. Betw een 1995 and 2000, 68% of ovarian cancer patients were diagnosed with late stage disease, with only 29% of thes e late stage patients surviving five years [3]. Ovarian cancer is the deadliest of the gynecologic cancers due to the lack of symptoms resulting in difficult early dete ction. When symptoms present they are commonly mistaken as gastrointestinal prob lems or menopausal symptoms. Thus, many cases are misdiagnosed and these misdia gnoses are a primary cause for the high incidence of late stage diagnosis. The CA-125 blood test is the most specifi c screening tool av ailable for ovarian cancer detection. CA-125 is an epithelial antigen protein expressed on the coelomic

PAGE 16

2 epithelium, which includes the ovarian surf ace. Over 90% of patients with advanced ovarian tumors will have elevated plasma CA-125 levels, whereas 50% of stage 1 patients will show normal levels of CA-125 [4]. Thus, the CA-125 blood test is not an effective screen for early stage ovarian tumors due to the high percen t of false negatives. False positive results are also common a nd are caused by a wide range of conditions, including endometriosis, fibr oids, hemorrhagic ovarian cyst s, menstruation, pregnancy, acute pelvic inflammatory disease, renal disease, and cancers of the endometrium, pancreas, bladder, breast, liver, or lung [5]. Transvaginal ultrasound is also used to dete ct ovarian cancer. This tool is most useful for postmenopausal women. The ovari es of premenopausal women are active and may harbor large functional cysts which could lead to false positives. Multiple cyst formation, bilaterality, papillary projections, a nd ascites fluid are conditions characteristic of ovarian cancer that are de tectable by ultrasound [5]. A third, less effective tool is the manual pelvic exam. The physician will feel for the size, shape, and position of the uterus and ovaries. Only large palpable tumors will be detected by this method [6]. The origin of ovarian cancer has been debated, [7, 8] however, the traditional theory suggests that most ovarian cancers ar ise from the simple epithelial lining of the ovary or cortical inclusion cysts [7]. Se veral studies have used mouse models to introduce specific genetic lesions into ovarian surface epithelium, resulting in ovarian cancer and supporting the tr aditional theory [9-11]. Other theories suggest that ovarian cancer arises from the ‘secondary Mllerian syst em’ [8]. This includ es structures that exist in the ovarian hilum and in paratubal and paraovarian areas that are thought to be

PAGE 17

3 remnants of the Mllerian ducts [7]. Add itionally, a small proportion of ovarian tumors are believed to have granulos a or germ cell origins [12]. Tumors of the ovarian surface epithelium are classified into five types: serous, endometrioid, mucinous, clear-cell, and transitional-cell [13]. The most common form of ovarian cancer is serous carcinoma, acc ounting for about 53% of cases [14]. Morphologic and genetic data suggest that this form arises directly from ovarian surface epithelium or inclusion cysts [15]. Serous tu mors range from cystic, papillary tumors to solid masses often with papillary surfaces, and histologically are very similar to cancers of the fallopian tube. Endometrioid can cers account for 15-20% of ovarian cancers and are characterized by their e ndometrial-like glandular structures. Mucinous tumors account for 10% of ovarian cance rs and are typically composed of glands and cysts lined by cells with mucin-rich cytoplasm that resemb le epithelial cells of the endocervix or of the intestine. Generally, th e prognosis for women with ser ous carcinomas is poorer than those with endometrioid or mucinous carcinomas Clear-cell and transitional-cell types are less common [14, 16, 17]. The first step in the management of patie nts with epithelial ovarian cancer is an accurate diagnosis and thorough staging, with optim al surgical cytoreduction of disease. In early stage disease radical surgery w ill cure most women, although a minority of women would benefit from adjuvant chemothera py [18, 19]. In advan ced disease, where all macroscopic disease cannot be excised, the current practice is to debulk the tumor, aiming to remove as much macroscopic dis ease as possible. Optimal debulking surgery can improve patients’ responses to ch emotherapy and relieve their symptoms.

PAGE 18

4 Postoperative taxane– and plat inum–based chemotherapy is then administered to patients with a significant risk of recurrence [20, 21]. In the 1990s, the combination of paclitaxel and cisplatinum was found to have an improved response rate and an increase in progression-free and overall survival as compared to either drug administered individually. Recently, carboplatinum was introduced as a replacement for CP because of its ease of outpatient administration and bett er side effect profile Carboplatinum and paclitaxel, when directly compared to CP and paclitaxel, showed no difference in progression-free or overall survival and was less toxic [22]. Almost 80% of patients with advanced disease experience an initial favor able clinical respons e with platinum and taxane chemotherapy, however, most ultimately relapse and only 25% of patients are cured [23]. Patients who develop recurrent di sease at intervals of greater than 6 months following primary treatment, defined as “platinum-sensitive”, have a high probability of responding again to platinum-based ther apy. Patients who experience disease progression during treatment, who have stable disease in response to primary platinumbased therapy, or who relapse within 6 m onths are considered to have “platinumrefractory” disease [24, 25]. Dr ugs with demonstrated activ ity as secondary treatments for platinum-refractory disease include t opotecan, docetaxel, oral etoposide, liposome encapsulated doxorubicin, gemcitabine, ifosfamide and hexamethylmelamine. These secondary treatments rarely result in a cure and are generally considered as palliative [26]. There is a pressing need to identify the mechanisms underlying drug resistance to allow the development of novel drugs that can be used to re-sensitize tumor cells. There are many genes and pathways that have been im plicated in drug resistance. The primary

PAGE 19

5 mechanism of platinum toxi city is thought to be through DNA damage by the formation of DNA adducts. Genes invol ved in DNA damage repair are often up regulated in drug resistant tumors. For instance, the ERCC1 gene product is considered a rate-limiting component of the nucleotide-excision repa ir system (NER). NER is a primary mechanism by which cells repair platinum-i nduced DNA damage. Down regulation of ERCC1 leads to a sensitization of cells to platinum both in vitro and in xenograft tumor models [27]. Genes involved in regulating apoptosis are also involved in drug resistance. One such molecule that has been implicated in drug resistance is the caspase inhibitor XIAP. In cells that are sensitive to drug, CP treatment down re gulates XIAP, leading to a corresponding activatio n of caspase 3 and subsequent apoptosis. In contrast, drugresistant cells have shown no decrease in XIAP after exposure to CP [28, 29]. Recently there has been an increased emphasis placed on the development of novel agents targeting biological mechanisms necessary for ovarian tumor growth and progression. Inhibitors of the EGF and HER2 /neu receptors in epithelial ovarian cancer patients have received much attention. Pr eclinical evidence suggest s that the EGFR and HER2 pathways govern critical cellular processes in ovarian cancer, including cell proliferation and survival [30]. Drugs that target these pathways include Iressa (Astra Zeneca) and Tarceva (Roche), which are tyro sine kinase inhibitors specific for EGFR. Monoclonal antibody treatments have also be en developed. Erbitux (ImClone Inc.) targets the extracellular domain of the EGFR. Omintarg™ (Genentech) disrupts the interaction between HER2/Neu and its partne rs HER1 and HER3, blocking intracellular signaling downstream of HER2/Neu. Hercepti n is directed against the extracellular

PAGE 20

6 domain of HER2/neu. Unfortunately, Phase II clinical trials with many of these drugs have been disappointing. Patients with pl atinum-resistant ovaria n cancer were treated with Iressa or Tarceva and less than 6% of the tumors responded to the treatment [31, 32]. Similarly, only 7.3% of patients with HER2 positive ovarian cancer responded to Herceptin [33]. Another biological mechanism that is curre ntly being targeted is angiogenesis. Angiogenesis, the growth of new blood vesse ls from pre-existing vessels, is a normal process that is important for embryological development and wound healing [34]. It is also an essential mechanism that allows can cer cells to nest, expa nd, and invade distant tissues, making angiogenesis an attractive target for therapeu tic intervention. Angiogenesis is regulated by numerous proand anti-angiogenic molecules. Vascular endothelial growth factor (VEGF) is the most potent pro-angiogenic molecule known [35]. Expression of VEGF and of its recepto rs correlates with an invasive phenotype and worse clinical outcome in epithelial ovarian cancer [36]. VEGF also regulates the formation of ascites in ovar ian cancer [37]. Avastin (Gen entech) is an antibody against VEGF that has been shown to inhibit the grow th of human tumors in mice [38]. Clinical studies have shown that Avastin increases the efficacy of chemotherapy in breast, colorectal, and lung cancers [39-41]. In a Phase II clinical trial of patients with recurrent platinum-resistant ovarian cancer, the response rate to single agent Avastin was 17% and 39% of patients had no further disease pr ogression after six mont hs [42]. Another study coupled Avastin with metronomic cycl ophosphamide to treat platinum-resistant ovarian cancer. In this study 28% of patie nts responded and 59% had no further disease

PAGE 21

7 progression after six months [43]. More trials are needed to advance the use of Avastin as an adjuvant treatment. It is estimated that approximately 90% of ovarian cancers are spontaneous and the remaining 10% are due to familial inheritance [44]. Women in hered itary nonpolyposis colorectal carcinoma (HNPCC) fami lies or those carrying mutations in either the hMSH2 or hMLH1 genes have a tenfold increase in the ri sk for developing ovarian cancer [45, 46], however, these mutations make up a small percentage of familial ovarian cancer cases. Other genes commonly muta ted in various cancers, including PTEN and TP53, have also been associated with ovarian cancer [47, 48]. The most commonly mutated genes in familial ovarian cancer are the br east and ovarian cancer susceptibility genes, BRCA1 and BRCA2 [49, 50].

PAGE 22

8 BRCA1 The breast and ovarian can cer susceptibility gene, BRCA1 is located at chromosome 17q21, contains twenty-two codi ng exons, and encodes a 1863 amino acid protein [50, 51]. The BRCA1 locus was identified via linkage analysis in 1990 [52] and the gene was first cloned in 1994 [50]. BRCA1 is located primarily in the nucleus, however, its expression and distribution within the cytoplasm and nucleus varies with the cell cycle. BRCA1 is expressed during the mid G1 phase of the ce ll cycle and elevates to its maximum level during S phase [53, 54]. During S phase, BRCA1 lo calizes to subnuclear foci in response to DNA damage [55]. BRCA1 levels remain high during M phase wh ere it can be found associated with the centrosomes [56]. BRCA1 protein has two highl y conserved domains located at either end of the protein. The first 109 amino acids at the Nterminus form a RING finger domain. This region contains a core of approximately fift y amino acids with a conserved pattern of seven cysteine and one histidine residue ar ranged to form a structure responsible for coordinating the binding of two Zn2+ ions [57]. The C-terminus contains two BRCT (BRCA1 c-terminal) domains. The BRCT domain is approximately one hundred amino acids that is present in a number of DNA-repair and DNA-damage-response proteins [58].

PAGE 23

9 BRCA1 has been found to interact with ma ny different proteins. The N-terminal RING finger domain interacts with BARD1 (BRCA1-associated ring domain protein 1) and BAP1 (ubiquitin hydrolase BRCA1-associated protein 1) The interaction of BARD1 with BRCA1 is required to stabilize the BRCA1 RING finge r domain for E3 ubiquitin ligase activity [59]. Other proteins bind to the central portion of BRCA1, including cMyc, p53, pRB, RAD50, and RAD51. The C-terminal BRCT domains bind many proteins, including p53, pRB, p300/CBP, MSH2 BRCA2, CtIP, RNA Pol II, and RNA helicase A [60-65]. The exact biological function of BRCA1 ha s not been defined; however, multiple roles have been suggested. BRCA1 has been implicated in transcri ptional regulation, cell cycle checkpoint control, chromosome segreg ation, and DNA damage repair [66]. Many of the therapeutic agents used in cance r treatment cause DNA damage through various mechanisms. BRCA1 has been reported to be involved DNA repair and is implicated in both homologous recombination and non-hom ologous end joining of double-stranded DNA breaks and in nucleotide excision repair of DNA adducts [62]. As a result, BRCA1 has been classified as a tumor suppressor based on its involvement in DNA integrity maintenance. Thus, a better understanding of the role BRCA1 plays in the response to DNA damage caused by chemotherapeutic drugs ma y lead to more effective treatments. Specifically, BRCA1 status may have the potential be used as an indicator of the efficacy of specific drugs. There have been numerous different muta tions reported throughout the entire span of the BRCA1 gene. The Breast Cancer Info rmation Core lists over 1000 different BRCA1 alleles in its database. These incl ude nonsense, missense, and frameshift

PAGE 24

10 mutations as well as large and sm all deletions. Women who carry BRCA1 mutations are predisposed to the development of breast and/or ovarian cancer [67]. By age 70, BRCA1 mutation carriers have a breast cancer risk of 71% and an ovarian cancer risk of 47-63% [68]. The most common BRCA1 mutations are the germline founder mutations [69-71]. ‘Founders’ are small groups of people who have remained isolated from other populations, resulting in in terbreeding among the group. This interbreeding causes otherwise rare mutations to become more co mmon within the particular group. The bestknown example of a founder effect is that seen in the Ashkenazi Je wish population. This group has ancestors from Eastern and Centra l Europe and 1% of this population are carriers of the most common founder mutation, the BRCA1 185delAG truncation [72]. This is a frameshift mutation that results in a premature stop signal at codon 39 in the BRCA1 protein. This mutation is also car ried by significant nu mbers of non-Jewish Spanish, Spanish Gypsy, and women of mideastern decent [72-75]. The second most common founder mutation in BRCA1 the BRCA1 5382insC mutation, is found in 0.13% of Ashkenazi Jews [76]. Women carrying these mutations have an approximate 65% lifetime risk for developing breast cancer [ 77] and 15%-54% lifetime risk for developing ovarian cancer [78, 79]. Most clinical reports comparing the surv ival of ovarian cancer patients carrying BRCA1 mutations to those ovarian cancer patients with wild-type BRCA1 fail to differentiate the effects of the specific mutations present. Therefore, the data are inconsistent with some reports suggesting that BRCA1 mutation carriers have a prolonged survival compared to BRCA1 wild-type disease, whereas in other reports there is no

PAGE 25

11 survival difference between the two cohorts [ 80-83]. The few reports that do identify the effects of specific mutations suggest that ova rian cancer patients carrying the two most common BRCA1 founder mutations (185delAG and 5382i nsC) have a better initial response to treatment and longer median surviv al than ovarian cancer patients with wildtype BRCA1 [80, 84, 85] Ben David et al. (2002) compared 152 ovarian cancer patients carrying the BRCA1 185delAG mutation to 549 BRCA1 wild-type ovarian cancer patients and reported a median survival of 51.84 m onths for 185delAG carriers compared to 37.84 months for BRCA1 wild-type patients [86] Additionally, in vitro data show that BRCA1 -defective cells are sensitive to half the dose of CP (IC50: 30-40 M) compared to BRCA1 wild type cells (IC50: 90-100 M) [87] and that mu tations within the aminoterminus of BRCA1 are associated with incr eased apoptosis [88-90] and, therefore, may be responsible for the enhanced chemotherapeut ic response and survival associated with some BRCA1 founder mutation carriers.

PAGE 26

12 Apoptosis Apoptosis is a form of cell death in wh ich a programmed sequence of events leads to the elimination of cells without releas ing harmful substances into the surrounding tissue. Apoptosis plays a crucial role in deve loping and maintaining health by eliminating old cells, unnecessary cells and unhealthy cells. Apoptotic cells can be recognized by gross morphological changes: the cell shrinks, shows deformation and loses contac t to its neighboring cells. Its chromatin condenses and marginates at the nuclear me mbrane, the plasma membrane blebs or buds, and finally the cell is fragmented into co mpact membrane-enclose d structures, called 'apoptotic bodies' which contain cytosol, th e condensed chromatin, and organelles. The apoptotic bodies are engulfed by macrophage s and thus are rem oved from the tissue without causing an infla mmatory response [91]. Apoptosis is in contrast to the necrotic mode of cell-death in which case the cells suffer a major insult, resulting in a loss of me mbrane integrity, swe lling and disrupture of the cells. During necrosis, the cellular contents are released uncontrolled into the cell's environment which results in damage of surrounding cells and a strong inflammatory response in the corr esponding tissue [92]. Apoptosis is initiated by sequential activ ation of members of the human caspase (cysteine-aspartyl specific protease) famil y. The caspase family consists of twelve

PAGE 27

13 members that are all known to exclusivel y cleave their substrates immediately downstream of aspartic acid re sidues [93]. All members of the caspase family share a conserved active site and thei r precursors are all zymogens known as procaspases. The amino-terminal domain of procaspases contai ns a diverse structure required for caspase activation. All procaspases ar e capable of autoactivating as well as activating other caspases. Activation results in a heterodimer and two heterodimers join together to form an enzymatic activ e tetramer [94]. The caspase family is further divided into three subfamilies. The apoptosis activator family consists of caspases-2, -8, -9, and -10. The apoptosis executioner family consists of caspases-3, -6, and -7. The in flammatory mediator family consists of caspases-1, -4, -5, -12, and -14 [95]. The ac tivator caspases differ from the executioner caspases in that they have long N-terminal domains that allow them to associate with death effector domains (DED) or caspase recruitment domains (CARD) present in adaptor proteins. Caspase-mediated apoptosis can occur by two distinct, but converging pathways [96, 97]. The extrinsic pathway is triggered by the binding of “extern al” ligands to death receptors, one example being Fas binding to th e Fas receptor. Upon Fas binding to its receptor, oligomerization results and formation of the death-inducing signaling complex (DISC) occurs. DISC is comprised of Fas, the adaptor protein Fas-associated protein with death domain (FADD), and procaspase8. The aggregation of pro-caspase-8 in DISC leads to its auto-activation to activ e caspase-8. This ac tivation leads to the subsequent activation of downstream ef fector caspases [98].

PAGE 28

14 The intrinsic pathway occurs in response to cellular stress and genotoxic damages caused by chemotherapeutic agents. The initia l stress signal results in the release of cytochrome c from the inner-mitochondrial me mbrane space into the cytosol. The cytosolic cytochrome c then binds to dATP and causes the apoptotic protease-activating factor-1 (Apaf-1) to oligomerize and form a large complex called the apoptosome. The apoptosome recruits and interacts with the CARD domain of pro-caspase-9 which leads to its auto-activation. Active caspase-9 then recruits a nd activates pro-caspase-3 and-7. The activation of caspase-3 and -7 leads the cleavage of critical cellular substrates including poly-(ADP) ribose polymerase (PAR P), in what is known as the execution phase of apoptosis [99-101]. The intrinsic pathway is partially contro lled by the Bcl-2 protein family [102]. The members of the Bcl-2 family are categ orized into three groups based on their structure and function. The fi rst group are anti-apoptotic pr oteins and include A1/Bfl1, Bcl-2, Bcl-w, Bcl-xL, Boo/Diva, Mcl-1, NR13, and Nrf3 All members of this group have four short Bcl-2 homology (BH) dom ains; BH1, BH2, BH3, and BH4. They also contain a carboxy-terminal transmembrane domai n (TM) that targets them to the outer mitochondrial membrane, endoplasmic reticulum and nuclear envelope [103]. These proteins potently inhibit apopt osis and their mechanism app ears to be related to their ability to prevent proper assembly of the apoptosome complex [104]. The two other groups of Bcl-2 family prot ein are pro-apoptotic. The first includes Bax, Bak, and Bok which contain three BH domains (BH1, BH2, and BH3) and a TM domain [105] These prot eins are initially found in the cytoplasm and undergo a conformational change to integrate into th e outer mitochondrial membrane. They then

PAGE 29

15 oligomerize and this is thought to incr ease the permeability of mitochondrial permeability transition pores (MPTPs), permitting the release of cytochrome c into the cytosol [106]. The anti-apoptotic Bcl-2 prot eins are thought to sele ctively bind to active Bax, thus preventing its insertion into th e outer mitochondrial membrane [107]. The second group of pro-apoptotic Bcl-2 fam ily proteins is cl assified as ‘BH3only’. These include Bim, Bad, Bid, Bik, Bm f, Puma, Noxa, and Hrk [105]. The BH3only proteins are inactive in healthy cells. When a cell d eath signal is detected, these proteins are activated and translocate to intracellular membranes to inhibit the antiapoptotic Bcl-2 proteins [108, 109]. Another group of proteins th at regulate the apoptotic ca scade are the inhibitor of apoptosis (IAP) proteins. In humans th e IAP family includes cIAP1, cIAP2, XIAP, NAIP, survivin, and livin [110-115]. All member s of the IAP family contain at least one N-terminal baculovirus IAP repeat (BIR) domain and one conserved C-terminal RING domain. The IAP BIR domains can bind to caspases, thus protecting the cells from apoptosis by inhibiting the activity of the bound caspases [116]. IAP activity is opposed by Smac/Diablo or Omi/HtrA2m, proteins re leased from the mitochondria along with cytochrome c [117]. These IAP inhibitors contain IAP-binding mo tifs (IBM) that bind and sequester IAPs [118].

PAGE 30

16 Maspin Maspin, the mammary serine protease inhi bitor, has been shown to sensitize breast carcinoma cells to induced apoptosis [119, 120]. Maspin was identified based on its expression in normal, but not in tumor-d erived human mammary epithelial cells [121]. Maspin is a Class II tumor suppressor due to its ability to inhibit cellular invasion/motility and because it is not mutated or deleted, but rather transcriptionally downregulated or silenced by epigenetic changes in breast cancer [122-124]. The exact function of maspin is still un clear, however, studies on maspin have demonstrated its ability to inhibit cancer ce ll motility, invasion, meta stasis, angiogenesis, and to induce apoptosis in cancer cells [119, 121, 122, 125, 126]. One of the earliest studies on maspin function showed that masp in regulates cell i nvasion by altering the integrin profile of the cell. Breast cancer cells treated with recombinant maspin had increased levels of 3and 5containing integrins. The addition of an 5 1-blocking antibody diminished the anti-invasive propertie s induced by recombinant maspin [127]. Recombinant maspin also decreased Rac1 activity in MDA-MB-231 breast cancer cells, resulting in decreased cell motility and increa sed cell adhesion. The highly aggressive phenotype of these breast cancer cells was reve rted to a more epithe lial-like phenotype in the presence of maspin [128].

PAGE 31

17 Angiogenesis describes the formation of new blood vessels, which is necessary for rapidly proliferating tumors which require an increased blood supply to maintain their growth. In general, tumors that secrete high levels of angiogenic factors, such as VEGF, tend to be associated with an increased inva sive and metastatic phenotype. Maspin has been shown to interfere with the migration of cultured endothelial cells toward VEGF [129], which is an important chemoattractant for angiogenesis. Maspin has also been shown to obstruct neovascularization and d ecrease the density of tumor-associated microvessels in vivo [125]. Maspin has also been implicated in the control of apoptosis. Initial observations were that maspin inhibits SV-40 largeT-antigen-induced breast carcinogenesis by increasing apoptosis [130]. Subsequently, maspin has been shown to sensitize breast cancer cells to STS-induced apoptosis. It is increasingly apparent that the sub cellular localization of maspin is tissuedependent and that it is important for its function and usefulness as a potential prognostic marker. In addition to breast, maspin was init ially identified in prostate, thymus, testis, intestine, and lung tissues [ 131]. It has since been identified in many other tissues, including ovary, stomach, colon, bladder, pa ncreas, cornea, gall bladder, and thyroid [132-140]. Reports describing the expression of maspin in normal ovarian surface epithelial cells and epithelial ovarian cancer have been inconclusive. Initiall y, Sood et al. (2002) reported that maspin was minimally expressed in normal ovarian epithelium. It was also reported that maspin was expressed in a subs tantial portion of ovari an cancers and that nuclear localization of maspin was associated with increased patient survival, whereas no

PAGE 32

18 expression or cytoplasmic loca lization of maspin was associ ated with poor outcome in ovarian cancer [141]. El-Wahed et al. (2005) s uggested that maspin wa s not detectable in normal ovarian epithelium, whereas 63% of ovarian cancers expressed maspin, however, no survival difference was observed betw een patients with and without maspin expression [142]. Similarly, S ecord et al. (2006) reported th at maspin was detected in 72% of advanced epithelial ovarian cancer cases and that non-detectable maspin appears to be an independent predicto r of increased risk of disease progressi on and death [143]. Most recently Solomon et al. (2006) reported that high maspin expression in the nucleus of ovarian carcinoma cells is associated with lower tumor angiogenesis and improved patient survival [144]. The initial cloning of the ma spin promoter led to the identification of numerous transcription-factor binding sites within the one kilobase maspin promoter region, including sites for Ets, AP1, hormone-res ponse element, HIF, and p53 [145]. p53 was one the first factors to be investigated and was found to induce maspin expression in breast and prostate cancer cells by binding to a putative site near the transcription start site [146]. TAp63 can substitute for p53 in inducing maspin expression in hepatocellular carcinomas carrying only inactive fo rms of p53 [147]. The breast cancer drug Tamoxifen has also recently been described as a regulator of maspin expression in br east cancer cells. Tamoxifen induced maspin expression in vitro and in vivo primarily through the hormone-response element within the maspin promoter. This was the first evidence that maspin expression in breast tissue may be hormone-regulated. This was suppor ted by the observation that 17 -estradiol reduced maspin expression in normal mammary epitheli al cells [148] and that Tamoxifen induced

PAGE 33

19 maspin expression via estrogen receptorin normal and malignant breast cells [149]. Similar work in prostate shows that masp in expression is regulated by the hormoneresponse element site recognized by androge n receptor in prostate cells [145]. Maspin expression is also known to be epig enetically regulated [150]. Epigenetic changes that regulate maspin expression involve cytosine me thylation, histone deacetylation, and chromatin accessibility. Pr omoter methylation of the maspin gene leads to silenced maspin in breast, thyroid, skin, a nd colon cancers [135, 140, 151], whereas promoter demethylation leads the paradoxical overexpression of maspin in ovarian, pancreatic, and gastric cancers [133, 152, 153].

PAGE 34

20 CENTRAL HYPOTHESIS I hypothesize that transfecti on of the BRCA1 185delAG trun cation protein, BRAt, into human ovarian surface epithelial ce lls results in detectable protein that is sufficient to increase the apoptotic res ponse following STS treatment. I also hypothesize that this increased apoptotic response is due, in part, to BRAt induced maspin expression and that BRAt protein can be used to selectively transf ect ovarian cancer cells and is sufficient to increase/restore sensitivity in chemo-resistant cells. SPECIFIC AIMS 1. Develop BRAt expression vectors su itable for detecting BRAt protein in vitro and optimize detection protocols. 2. Identify and confirm molecular signali ng pathways involved in BRAt mediated apoptosis. 3. Identify potential BRAt target(s) and demons trate potential clinical relevance for BRAt mediated apoptosis.

PAGE 35

21 CHAPTER II BRCA1 185delAG TRUNCATION PROTEI N, BRAT, AMPLIFIES CASPASEMEDIATED APOPTOSIS IN OVARIAN CELLS Abstract Ovarian cancer patients with germline mutations in BRCA1 have been reported to respond more favorably to initial chemotherapy. We previously repor ted that cells from women carrying the BRCA1 185delAG founder mutation under go an enhanced caspase-3 mediated apoptotic response. Here, we report on the transient and st able transfection of cDNA coding for the putative trunc ated protein product of the BRCA1 185delAG mutant gene into BRCA1 wild type human ovarian surface ep ithelial cells and ovarian cancer cells. The BRCA1 185delAG truncation (BRAt) protein did not al ter epithe lial cell morphology or induce tumorigenesis. However, upon treatment with STS BRAt cells showed increased levels of active caspase 3, increased cleavage of caspase 3 substrates, PARP and DFF45, and decreased XIAP and cIAP-1. BRAt also reduced levels of phosphorylated Akt and over expression of activat ed Akt in BRAt cells restored caspase 3 activity to that seen in wild type cells. Further, BRAt expression increased chemosensitivity in platinum resistant ovarian cancer cells. Taken together, our data demonstrate that truncated proteins arising from BRCA1 185delAG mutation increase

PAGE 36

22 STSor platinum-induced apoptosis, sugge sting a possible mechanism by which women with germline BRCA1 mutations may respond better to initial chemotherapy.

PAGE 37

23 Introduction Ovarian cancer, the deadliest of the gynecologic cancers, kills an estimated 15,000 women annually [2]. The asymptomatic nature of early ovarian cancer leads to predominately late stage diagnoses, which results in a five-year surviv al rate of less than 30% [1, 3]. Primary treatmen t of epithelial ovarian cancer involves cytoreductive surgery and platinum-based chemotherapy, to which mo re than 80% of patients show an initial chemotherapeutic response. However, most women with advanced-stage disease at initial diagnosis will develop recurrent tumors that are resistant to traditional platinumbased therapy [154]. Thus, new protocols are needed to effectively treat chemo-resistant ovarian cancer. More than 10% of women with ovarian cancer show a positive familial history [155]. Mutations in the breast a nd ovarian susceptibility gene ( BRCA1 ) account for 60% of these familial ova rian cancers [51]. BRCA1 has been linked to numerous pathways within the cell with its best known function being tumor suppression [50]. Women with a mutation in BRCA1 have an 87% and a 44% increased chance of developing breast or ovarian cancer, respectively, a nd 80% of all hereditary cases of ovarian cancer are linked to mutations in BRCA1 [51, 156]. While the large size of BRCA1 (1863 amino acids in 22 exons) predisposes the protein to numer ous spontaneous mutations, the most common are germline founder mutations found primarily in the highly conserved terminal regions

PAGE 38

24 [69, 71, 157]. One such founder mutation is the BRCA1 185delAG, a frameshift in exon 2, carried by 1% of the Ashkenazi Jewish population, as well as significant numbers of non-Jewish Spanish, Spanish Gypsy, and wo men of mid-eastern decent [72-75]. Clinical studies have shown that women with breast and ovarian cancer who carry founder mutations have a better initial res ponse to chemotherapeutic treatment than women with wild-type BRCA1 (91.43 months versus 40.92 months survival) [81, 158, 159]. BRCA1 -defective cells are sensitive to half the dose of CP (IC50: 30-40 M) compared to BRCA1 wild type cells (IC50: 90-100 M) [87]. Lo ss of one or both BRCA1 carboxy terminal (BRCT) domains results in decreased apoptosis due primarily to the loss of FasL activation of caspase 8 [160]. In contrast, mutations within the aminoterminus of BRCA1 are associated with incr eased apoptosis [88] and, therefore, may be responsible for the enhanced chemotherape utic response associated with certain BRCA1 germline mutations. In addition to inherited germline BRCA1 mutations, BRCA1 normally produces various truncated proteins due to alternate splicing patterns re sulting in shorter proteins with distinct functions [161]. BRCA1 deletions in exons 2, 3, 9, 10, 11, 14, 15, 16, 17, and 18 also produce truncation proteins within the same open reading frame as the wild type BRCA1 transcript, yet they posses unique prope rties. For example, splice variants produced from the BRCA1 1b exon appear only in placen tal tissue, and splice variants lacking exon 7 are found predominantly in lymphocytes [162, 163]. Transcripts lacking exon 11 lose the ability to translocate to the nucleus, and have been shown to cause increased radiation-induced apoptosis in both human fibroblasts and breast cancer carcinoma cell lines [164, 165].

PAGE 39

25 Recently, we have shown that immorta lized ovarian surf ace epithelial (IOSE) cells cultured from women carrying the BRCA1 185delAG founder mutation express an elevated caspase 3-mediated apoptotic respon se [89, 90] associated with reduced p-Aktmediated XIAP stabilization and subsequent loss of XIAP-mediated ubiquitination of caspase 3 [89, 166]. Here, using transiently and stably transfected cell lines, we report that the specific protein product of the BRCA1 185delAG muta tion has direct effects on caspase-mediated apoptosis in ovarian cells. We also demonstrate the chemosensitizing effects of this mutant protein in chemoresistant ovarian cance r cells. These data not only provide a potential molecular mechanism for th e initial chemotherapeutic advantage seen clinically in women with certain BRCA1 founder mutations, but also suggest new therapeutic possibilities for the tr eatment of ovarian cancer.

PAGE 40

26 Materials and Methods Cell Culture, Plasmid Construction, and Transfection The SV 40-Large T-Ag transfecte d human IOSE cell line IOSE-118 ( BRCA1 wt) [89, 167] was cultured in Medium 199/ MCDB 105 (Sigma, St. Louis, MO) with 5% fetal bovine serum and gentamicin. Wild type BRCA1 status was confirme d via single site BRACAnalysis DNA sequencing at Myriad Biotechnologies (S alt Lake City, UT). OV2008 and C13 ovarian cancer cells, and MCF7 breast cancer cells were also cultured in Medium 199/ MCDB 105 media with 5% fe tal bovine serum and gentamicin. Primary cultures of human dermal fibroblasts (HDF ) and ovarian adenoma (OVAD) cells were cultured in Medium 199/MCDB 105 media (Sigma, St. L ouis, MO) with 10% fetal bovine serum and gentamicin. All cells were incubated at 37C with 5% CO2. cDNA encoding for BRCA1 185delAG with an N-terminal His-tag and Cterminal S-protein motif was generate d by Midland Certified Reagent Company (Midland, TX) using the published genbank BRCA1 sequence U14680. The truncated BRCA1 185delAG protein is referred to as BRAt (BR CA1 a mino-terminus t runcation) herein. S-His-BRAt cDNA was then lig ated using T4 DNA ligase (New England Biolabs) in 1X T4 ligase buffe r (50mM Tris-Hcl (pH 7.5), 10 MgCl2, 10mM dithiothreitol, 2mM ATP, 25g/mL BSA) into the pTriEx-4 plasmid (Novagen), transformed into DH5 competent cells and isolat ed under standard conditions

PAGE 41

27 (Invitrogen). The S-His-BRAt plasmid seque nce was confirmed. cDNA encoding for BRAt with an N-terminal Flag-tag wa s generated by Integrate DNA Technologies (Coralville, IA) usi ng the published genbank BRCA1 sequence U14680. Flag-BRAt cDNA was then ligated using T4 DNA ligase (N ew England Biolabs) in 1X T4 ligase buffer into the pcDNA3.1(+) expression vector (Clontech, Palo Alto, CA), transformed into DH5 competent cells and isolated under st andard conditions (Invitrogen). The Flag-BRAt plasmid sequence was confirmed. A control plasmid, named BRIT, was generated by inserting an in-frame missense mutation to abrogate the BRAt sequence fr om amino acids 22 through 33 in the S-HisBRAt plasmid. This plasmid was used as a negative control to demonstrate BRAt specificity. The human telomerase reverse transcriptase (hTERT) promoter-luciferase construct, pGL3–1375 [168], was used to de velop a BRAt expression plasmid under the control of the hTERT promoter. Flag-tagge d cDNA for the BRAt protein was inserted in sense orientation at the Hind III and Nco I sites. The resulting plasmid was sequenced to confirm the correct orientation and sequen ce of the insert. This plasmid was named hTERT-BRAt-luc and was also used to create a second plasmid lacking the luciferase reporter. Briefly, the luciferase reporter cDNA was removed from the hTERT-BRAt-luc plasmid by Nco I and Bam HI digestion and the resulting st icky ends were blunted by use of the Klenow fragment. Blunt-end liga tion was performed to close the plasmid, resulting in an hTERT-BRAt plasmid l acking the luciferase reporter gene. IOSE-118, OV2008, and C13 cells were transf ected using the Nucleofector device (Amaxa, Gaithersburg, MD) with 2 g of plasmid (GFP, S-His-BRAt, Flag-BRAt,

PAGE 42

28 hTERT-BRAt, hTERT-BRAt-luc, BRIT, Activ ated Akt, or pcDNA3.1(+)). Briefly, 1x106 cells were mixed with 2 g of the appropriate plasmid in 100 l of Nucleofector solution (kit #VPD-1005). The cell suspensions were then transferred to electroporation cuvettes and transfected using program X-005 on the Nucleofector device. To estimate overall transfection efficiency, GFP-transfect ed cells were visua lized and photographed 24 hours post-transfection usi ng a digital camera-equipped fluorescence microscope. Stable BRAt cells were generated using the S-His BRAt and Flag-BRAt plasmids. Two million IOSE-118 cells were transfected wi th 2 g of plasmid (S-His-BRAt, FlagBRAt, or pcDNA3.1(+)). After 24 hours, S-His-BRAt cells were grown with 1% hygromycin B selection media and Flag-BRA t and pcDNA3.1(+) cells were grown with 1 mg/ml G418 selection media. Multiple stable clones of each cell line were established and characterized for this study. Luciferase Assay Luciferase expression (to indicate BRAt expression) was confirmed in hTERTBRAt-luc-transfected cells using the lucifera se assay. To confirm the cancer-specific expression of our hTER T-BRAt-luc plasmid, 1x106 primary HDF cells or primary OVAD cells were transfected with 2 g of GFP or 2 g of hTERT-BRAt-luc using Nucleofector kit #VCA-1003 and program X-005. Lucife rase activity was measured 48 h after transfection using the Luciferase Assay System (Promega, Madison, WI) according to the manufacturers' instructions. -galactosidase was measured 48 h after transfection using the Luminescent -galactosidase Detection Kit II (Clontech, Mountain View, CA)

PAGE 43

29 according to the manufacturers' instructions. Transcriptional activity was expressed as relative luciferase activity S E, after normalization with -galactosidase activity. BRAt Morphology and Cell Growth To assess potential BRAt-depe ndent morphological changes, BRCA1 wt and stable S-His-BRAt cells were grown on coverslips a nd visualized via light microscopy. Cells were also fixed in 4% paraformaldehyde and immunostained with cytokeratin and vimentin [167, 169]. Tumorigenesis and Telomerase Assays Fifty thousand BRCA1 wt, stable S-His-BRAt, or the telomerase-positive, tumorigenic breast cancer carci noma MCF7 cells [170] were subjected to growth in 0.35% soft agar for 14 days. Agar culture s were lysed, stained with 0.005% Crystal Violet and photographed. Telomerase activity of each cell line was measured using the telomerase polymerase chain reactionenzyme-linked immunosorbent assay (PCRELISA) (Roche Molecular Biochemicals, Indian apolis, IN) as descri bed previously and according to manufacturer’s instructions [171]. BRAt Localization BRCA1 wt and transient S-His-BRAt cells we re lysed in chilled IGEPAL lysis buffer (50mM Tris-HCl (pH 8.0), 100mM NaCl, 5mM MgCl2, 0.5% (v/v) IGEPAL). Lysed cells were centrifuged at 15,000 x g a nd supernatant (containing cytoplasm/plasma membrane proteins) was removed for analysis. The pellet (containing nuclear proteins)

PAGE 44

30 was washed twice and resuspended in lysis bu ffer. Fractionation samples were incubated overnight with anti-His-tag antibody. Imm unocomplexes were then precipitated using Protein A agarose (Invitrogen), washed, resuspended with loading buffer and electrophoresed via 7% SDS-PAGE. Samples were transferred to PVDF membrane and probed against biotinylated S-Protein (N ovagen). Immunoprecipitate supernatant samples were electrophoresed via 7% SDS-PA GE, transferred to PVDF membrane, and probed for NF B p65 and Histone H2A (Cell Signa lling Technologies) to confirm fractionation purity. BRAt RT-PCR To determine if BRAt mRNA was subject to nonsense-mediated mRNA decay, we performed RT-PCR to detect BRAt mRNA le vels in stable Flag-BRAt cells. Total RNA was collected using TRizol reagent (G IBCO BRL). One microgram total mRNA, oligo(dT), and reverse transc riptase were used to gene rate single-strand cDNA as previously described [172]. The cDNA sample s were amplified using the Perkin-Elmer (Palo Alto, CA) GeneAmp kit. To prevent wild-type BRCA1 amplification, the sense primer encompassed a portion of the Flag sequence. The BRAt primers used were BRAtS (CGATGACAAAATGGATTTATC TGC) and BRAt-AS (GAGACAGGTTCCTTCATCAACTCC) with -actin primers actin-S (CCGTACCACTGGCATCGTGATGGA) and actin-AS (CCAGGGCAGTGATCTCCTTCTGCA) for an internal control. PCR was performed for 32 cycles of 94C for 30 s, 60C for 30 s, and 72C for 20 s. Ten percent DMSO and

PAGE 45

31 10% glycerol were added to the PCR r eaction to further prevent any wild-type BRCA1 amplification. Actin primers were added at cy cle 14. The amplified products were then separated by electrophoresis on a 10% polyacrylamide gel, stained with 1x SYBR Green (Lonza, Rockland, ME), and photographed with the Kodak EDAS 120 Digital Analysis System. XIAP, cIAP1, and Bax RT-PCR To determine if STS treatment affected mRNA levels of XIAP, cIAP1, and Bax, we used RT-PCR to measure their mRNA le vels following STS treatment. Total RNA was collected using TRizol reagent (GIBCO BRL) at 0, 2, 4, and 6 hours following STS treatment. One microgram total mRNA, oligo( dT), and reverse transcriptase were used to generate single-strand cDNA as previously described [172]. The cDNA samples were amplified using the Perkin-Elmer (Palo Alt o, CA) GeneAmp kit. The XIAP primers used were XIAP-S (CGCGAGCGGGGTTTCTCTACAC) and XIAP-AS (ACCAGGCACGGTCACAGGGTTC). The cI AP1 primers used were cIAP1-S (CCAGCCTGCCCTCAAACCCT CT) and cIAP1-AS (GGGTCATCTCCGGGTTCCCAAC). The Bax primers used were Bax-S (AGGGTTTCATCCAGGATCGAGCAG) and Bax-AS (ATCTTCTTCCAGATGGTGAGCGAG). -actin primers actin-S (GGGAATTCAAAACTGGAACGGTGAAGG) and actin-AS (GGAAGCTTATCAAAGTCCTCGGCCACA) were used as an internal control. PCR was performed for 35 cycles of 94C for 1 m, 65C for 1m, and 72C for 2 m. Actin primers were added after cycle 19. The am plified products were then separated by

PAGE 46

32 electrophoresis on a 10% polyacrylamide gel, stained with 1x SYBR Green (Lonza, Rockland, ME), and photographed with the Ko dak EDAS 120 Digital Analysis System. Apoptosis Induction and Quantification Cells were treated with 1M STS (Alexi s Biochemicals, San Diego, CA), 25 M CP (CP)(Sigma), or 25 M carboplatinum (CB )(Sigma) and incubated as indicated in the results. Cellular death was determined via trypan blue exclusion assay as previously described [160]. To ensure that any detach ed cells were included in the assay all conditioned media, PBS-wash samples, and tr ypsinized cell samples were pooled prior to centrifugation. Cells were pell eted by centrifuging at 1000 x g for 5 minutes and pellets were washed with PBS. Cells were then centrifuged again for 5 minutes and the cell pellets were resuspended in 1 ml of PBS. Aliquots of 100 l were transferred to 1.5 ml tubes and mixed with 100 l of 0.4% Trypan blue stain (Gibco BRL). Samples of the Trypan blue stained cells we re counted in quadruplet using a hemocytometer and classified as dead (blue/black in appearance) or alive (clear/refractile in appearance). The cell suspensions were also subjecte d to western blot analysis. Protein samples were lysed in CHAPS buffer and 15 g of protein was separated via 10% SDSPAGE. Proteins were transferred to PVDF me mbranes and blocked in 5% milk in Tween 20-TBS. Blots were incubated in their respec tive antibodies overni ght and developed via enhanced chemiluminescence (ECL) (Amersha m). Cleaved-caspase 3, caspase 3, DFF45, XIAP, cIAP1, cIAP2, survivin, Bax, Akt, a nd phospho-Akt antibodies were purchased from Cell Signaling Technology (Beverly, MA). FLAG and -actin antibodies were purchased from Sigma (St. Louis, MO).

PAGE 47

33 Cell viability was also measured by the CellTiter 96 AQueous One Solution Cell Proliferation MTS (Promega, Madison, WI) co lorimetric assay. The assay was performed in 96 well microtiter plates according to ma nufacturer's instructions and is based on soluble formazan production by dehydrogenase en zymes. Absorbance was determined at 490 nm using an ELx800 microplate reader (Bio-Tek Instruments, Winooski, VT) and the results expressed as the mean absorbance SE. Caspase 3 activation was confirmed a nd quantified via the Quantikine Active Caspase 3 ELISA Kit performed as previ ously described [89] and according to manufacturer’s instru ctions (R&D Systems, Minnea polis, MN). The results are expressed as the mean absorbance SE. Cell death was also measured via flow cytometry. Cells were treated with 1 M STS and incubated as indicated in the results. To ensure that any detached cells were included in the assay all conditioned media, PBS-wash samples, and trypsinized cell samples were pooled prior to centrifugation. Cells were pelleted by centrifuging at 1000 x g for 5 minutes and pellets were washed w ith PBS. Cells were then centrifuged again for 5 minutes and the cell pellets were resusp ended in 250 l of PBS. Ten microliters of propidium iodide (PI) were added to each sample and the samples were analyzed on a FACS Canto II Flow Cytometry System. Cells staining positive for PI are considered dead and negative staining cel ls are considered alive.

PAGE 48

34 Statistical Analysis Where applicable, the data were subjected to paired Student's t test analysis to determine statistical differences between cont rol and treated samples. The results are reported as a P value within the respective figures.

PAGE 49

35 Results Detection of BRAt mRNA and nuclear localization of BRAt protein The BRAt nucleotide and protein sequences were determined using the published genbank BRCA1 sequence U14680 (Figures 1A and 1B). Multiple BRAt expression plasmids were created and all were analyzed to confirm correct or ientation and sequence (Figure 2). Figure 1 BRAt Nucleotide and Protein Sequence A) The cDNA nucleotide sequence of wild-type BRCA1 (normal text) compared to the BRAt nucleotide (italic text). The deleted AG re sidues are underlined in bold in the wildtype sequence. The premature stop codon is double-underlined in bold in the 185delAG sequence. B) The amino aci d sequence of BRAt protein.

PAGE 50

36 Figure 2 BRAt Expression Plasmids Five different expression plasmids were cr eated. A) S-His-BRAt plasmid was used for detecting BRAt protein localiz ation. B) Flag-BRAt plasmi d was used for detecting BRAt mRNA. C) hTERT-promoterBRAt-Luciferase plasmid was used to demonstrate the selective transfection of ovarian cancer ce lls. D) hTERT-promoter-BRAt plasmid was used to selectively transfect and sensiti ze ovarian cancer cells to chemotherapeutic treatment. E) BRIT plasmid was used a negative control to demonstrat e the specificity of BRAt protein. An RT-PCR protocol was developed to c onfirm translation of Flag-BRAt mRNA in cells transfected with Flag-BRAt. The init ial application of this protocol demonstrates the inherent difficulties in detecting BRAt messa ge and protein due to the similarities in sequence to wild-type BRCA1 The BRAt-sense primer was designed to prevent amplification of wild-type BRCA1 by including ten nucleo tides from the Flag-tag sequence. However, as demonstrated in Figur e 3, a less intense, but appropriately sized band was initially detected in non-BRAt ce lls, indicating amplific ation of wild-type BRCA1 message. To address the non-specific amplification of wild-type BRCA1 varying amounts of DMSO and/or glycerol were added to the PCR reaction to increase primer binding

PAGE 51

37 specificity and eliminate any wild-type BRCA1 byproduct. Final PCR products were resolved on a 10% acrylamide gel and the co mbination of 10% DMSO and 10% glycerol completely abrogated the non-specif ic amplification of wild-type BRCA1 (Figure 4). To demonstrate the effectiveness of this optimized protocol for detecting FlagBRAt mRNA, stable and transiently transfec ted Flag-BRAt cells were analyzed and compared to stable and transiently transfected GFP cells. An appropriately sized 145 b.p. band was observed in both stable BRAt samp les and the single transient BRAt sample. No band was present in any of the GFP sample s, demonstrating the specificity of this protocol for BRAt mRNA (Figure 5).

PAGE 52

38 Figure 3 Initial Application of the BRAt RT-PCR Protocol IOSE 118 cells were transiently transfected with 2 g GFP plasmid, 2 g BRAt plasmid, or 4 g BRAt plasmid. mRNA samples were isolated and analy zed via RT-PCR. cDNA products were visualized on a 3% agarose gel.

PAGE 53

39 Figure 4 BRAt PCR Optimizati on with DMSO and Glycerol IOSE 118 cells transiently transfected with Flag-BRAt or transiently transfected with GFP were analyzed via RT-PCR with va rying amounts of DMSO, glycerol, and combinations thereof. Final cDNA products we re analyzed on a 10% acrylamide gel and optimal PCR conditions are indicated by the outlined band.

PAGE 54

40 Figure 5 BRAt RT-PCR detects BRAt mRNA in Stable and Transiently Transfected cells BRAt RT-PCR was performed on mRNA samples fr om stable and transiently transfected Flag-BRAt cells and stable and transiently transfected GFP cells. Final PCR products were analyzed on a 10% acrylamide gel

PAGE 55

41 Final optimization of the BRAt RT-PCR pr otocol was achieved by the addition of -actin primers for use as an internal control. The -actin primers are added at later cycles to prevent over-amplification of -actin message that could potentially deplete the reaction components necessary for am plification of BRAt mRNA. The -actin primers were added at the end of cycles 12, 14, 16, or 18 and final PCR products were analyzed on a 10% acrylamide gel. Samples with -actin primers added at cycles 12 or 14 contained detectable but not over-amplified -actin bands, whereas samples with -actin primers added at cycles 16 or 18 did not contain sufficiently detectable -actin bands (Figure 6). Therefor e, the addition of -actin primers at cycles 12 or 14 is sufficient to detect -actin message for use as an internal control. Following optimization of the BRAt RT-P CR protocol, Flag-BRAt PCR samples were resolved on a 3% gel and the 145 b.p. band was excised and purified. This band was then cloned into the pDrive cloning vector for DNA sequenci ng. Six independent clones were sequenced and all lacked the AG nucleotides at position 185, confirming successful amplification of Flag-BRAt mRNA (dns). To determine the cellular localization of BRAt, BRCA1 wt and transiently transfected S-His-BRAt cells were separated into nuclear and cyt oplasmic fractions. Western blot analysis for S-protein follo wing His-tag immunopreci pitation showed BRAt protein localized in the nuclear fraction (F igure 7). The immunoprecipitation supernatant was probed for NF B p65 (a cytoplasmic protein) and Hi stone H2A (a nuclear protein) to confirm fraction purity.

PAGE 56

42 Figure 6 Optimization of -actin Primer Addition for use as an Internal Control The addition of -actin primers was optimized for use as an internal control. -actin primers were added at cycles 12, 14, 16, or 18 and final PCR products were analyzed on a 10% acrylamide gel.

PAGE 57

43 Figure 7 Localization of BRAt Protein BRCA1 wt and transiently transfected S-His BRA t cells were lysed and separated into nuclear (nuc) and cytoplasmic (cyt) fractions. The BRAt 6X-His tag was immunoprecipitated from the fractionated samp les. IP reaction and supernatant were analyzed via SDS-PAGE. IP reaction wa s probed for biotinylated S-protein and supernatant was probed for NF B p65 and Histone H2A to ensure fraction purity.

PAGE 58

44 BRAt does not alter IOSE morphol ogy or induce tumorigenesis We next sought to determine whether BRAt altered the growth, morphology, and/or tumorigenesis of human IOSE cells. BRAt cells maintained equal expression of cytokeratin and vimentin (Figure 8A), two intermediate filaments characteristic of ovarian surface epithelial cells [169, 173]. Fu rther, BRAt cells retained the approximate size and morphology of the BRCA1 wt cells (Figure 8A). In addition, BRAt cells showed the same growth pattern as BRCA1 wt in the initial passages after transfection and BRAt expression did not alter endogenous leve ls of full length BRCA1 (dns). Transfection with BRAt did not cause tumorigenesis in BRCA1 wt cells (Figure 8B). Soft agar cultures stained with crystal violet showed colonies only in dishes seeded with MCF7 cells, a breast cancer carcinoma ce ll line known to be tumorigenic [170]. No colonies formed in BRCA1 wt or BRAt dishes. To confir m that BRAt transfection did not cause BRCA1 wt cells to become tumorigenic, we assayed all three cell lines for telomerase, an enzyme not found in normal adul t tissue, but active in almost 90% of all tumors [174]. BRCA1 wt and BRAt cells did not express telomerase levels above assay background levels, whereas MCF7 levels we re 2-fold higher (Figure 8C). Taken together, these results suggest BRAt expressi on does not alter ovarian surface epithelial morphology, growth, or tumorigenic capability.

PAGE 59

45 Figure 8 BRAt does not alter IOSE morphology or tumorigenicity A) BRCA1 wt and stable S-His BRAt cells we re grown on coverslips, fixed and immunostained for cytokeratin or vime ntin at 200X magnification. B) MCF7, BRCA1 wt, and stable S-His BRAt cells were grown in soft agar for 14 days and stained with crystal violet to visualize colonies. C) Parallel cult ures of (B) were colle cted, lysed, and probed for telomerase levels via PCR-ELISA. Results are expressed as the average absorption from triplicate samples at 495nm SE.

PAGE 60

46 BRAt increases caspase-3 mediated apoptosis following STS treatment To determine whether BRAt alters the apoptotic program, we treated BRCA1 wt and stable S-His-BRAt cells with 1 M STS and assayed overall cell death via trypan blue exclusion assay (Figure 9A). Approximately 70% of the BRAt cells were dead after 4 hours, as opposed to 50% death in the parental cell line. To determine if the difference in overall cell death observed at 4 hours was signi ficant, we analyzed the data using the paired Student's t test which revealed a P value of 0.047. While this value suggests only borderline significance, it is sufficient to c onclude that the presen ce of BRAt protein is indeed leading to increased cell death following STS treatment. Previous studies have shown that STS treatment evoked an enhanced caspase-3 mediated apoptotic response in BRCA1 185delAG IOSE cells [90]. Active-caspase-3 ELISA showed levels of active caspase-3 in BRAt cells to be 20% higher after STS treatment than in the contro l cell line (p< 0.039) (Figure 9B). This observation correlates favorably with the similar 20% difference in overall cell death observed in Figure 9A. Western blot confirmed higher levels of activ e caspase 3 as well as increased degradation of DFF45 and increased cleav age of PARP, substrates of caspase 3 [175, 176] (Figure 9C). Active caspase 3 and DFF45 were normaliz ed to their respective actin levels using Imagequant densitometry software and the re sults are shown in Table 1. Active caspase 3 levels were higher in BRAt cells at 3 and 4 h after STS treatment with greater than 6 times more caspase 3 activity present at 4 h in BRAt treated cells (Figure 9C and Table 1). Despite differences in initial levels, D FF45 cleavage was essentially complete at 3 h after STS treatment in BRAt transfected cells with only 7% DFF45 remaining at 4 h,

PAGE 61

47 while full length DFF45 was still at approxi mately 17% of controls through 4 h in BRCA1 wt cells (Figure 9C and Table 1). Furthe r, there was also gr eater PARP cleavage in BRAt cells compared to controls af ter 4 h STS treatment (Figure 9C). To determine whether the BRAt protein specifically caused the increase in active caspase 3 shown in the transfected cell line, we generated a 6X-His tagged construct of comparable size to BRAt containing an in -frame missense mutation abrogating the sequence coded at amino acids 22 thr ough 33 in BRAt. This construct, BRIt was transfected into BRCA1 wt cells, the cells were treated with 1M STS and assayed for active caspase 3 via western blot (Figure 9D). Cleaved caspase 3 levels in STS-treated BRIt cells were equal to cont rol cells, indicating that the differences observed in BRAt cells is specifically due to the presence of BRAt protein. To further confirm that BRAt cells unde rgo increased apoptosis following STS treatment, we treated BRAt and BRCA1 wt cells with STS and then measured the amount of dead cells present via flow cytometry (Fig ure 10). Cells were stained with propidium iodide (PI) and cells staining positive for PI were considered dead, where as non-staining cells were considered to be living. At six hours after tr eatment, 36.1% of the BRAt cells were dead, compared to only 13.9% of the BRCA1 wt cells. This trend continued at 8 hours after treatment as 50% of the BRAt cells were dead compared to only 22.2 % of the BRCA1 wt cells.

PAGE 62

48 Figure 9 BRAt confers increased ST S-mediated cell death via caspase-3 cleavage. BRCA1 wt and stable S-His BRAt cells were trea ted with 1M STS. A) Cells were then trypsinized and treated with tr ypan blue and counted in trip licate. Results are shown as the average percentage of dead cells after 0, 1 and 4 hours SE. B) Triplicate samples of BRCA1 wt and stable S-His BRAt cells were treated with 1M STS for 4 hours and assayed for active caspase 3 via ELISA. Un treated cultures from each line were also assayed as a control. Results are expresse d as average absorption at 450 nm SE. C) Parallel cultures were treated with 1M ST S, collected between 0 and 4 h, and assayed via western blot for cleavedcaspase 3, DFF45, and PARP. Bl ots were then stripped and reprobed for actin as a loading control. D) BRCA1 wt cells were tran siently transfected with BRIt, treated with 1 M STS, collected at 4 hours, and probed for cleaved-caspase 3 via western blot. Blot was th en stripped and reprobed for actin as a load ing control.

PAGE 63

49 Cl.Cas. 3 DFF45 XIAP p-Akt BRCA1 wt STS0 hr nd 1.52 6.02 2.80 BRCA1 wt STS 1.0 hr nd 2.02 4.60 4.00 BRCA1 wt STS 4.0 hr 3.06 0.26 3.83 5.37 BRAt STS 0 hr nd 2.47 1.26 1.90 BRAt STS 1.0 hr nd 1.97 1.73 2.30 BRAt STS4.0 hr 19.98 0.17 0.25 1.30 Table 1 Densitometric analysis of select ed members of the caspase pathway in BRAt cells. Representative immunoblots for activated caspase 3, full length DFF45, XIAP, and p-Akt were scanned and analyzed via the ImageQua nt software application. Values reported were normalized to the immunoblots’ respective actin levels or total protein in the case of phosphorylated protein and expressed as arbitr ary densitometric units. An entry of ‘nd’ represents a value not det ectable by the application.

PAGE 64

50 Figure 10 BRAt confers incr eased STS-mediated cell death BRCA1 wt and BRAt cells were treated with ST S and cell death was measured via flow cytometry. A) The peak to the right of the ve rtical line in each hi stogram represents the PI positive (dead) cells. B) The data from part (A) depicted graphically.

PAGE 65

51 BRAt cells express lower levels of XIAP, cI AP1, and p-Akt and increased levels of Bax To determine the mechanism by which BRAt cells display an elevated caspase 3mediated apoptotic response, we first assayed for the caspase 3-inhibiting IAP protein family (Figure 11A). Levels of cI AP2 and survivin were similar in BRCA1 wt and BRAt cells. However, levels of both cIAP1 and XI AP were lower in untreated BRAt cells than in untreated parental cells, w ith almost no detectable cIAP1 in the BRAt cells and at least 6 times less XIAP in BRAt than wt cells (Table 1). Further, the levels of XIAP in the BRAt cells decreased much more rapidly with STS treatment than the parental cell line (20% remaining in BRAt cells at 4 h and 63% remaining in wt cells), with almost total XIAP protein degradation by 4 h in BRAt cells (Table 1). We then assayed for Bax protein following CP treatment in BRCA1 wt and BRAt cells (Figure 11B). Bax protein levels remained constant in BRCA1 wt cells, however, Bax increased by approximately 60% in BRAt cells between 24 and 48 hours following CP treatment. Messenger RNA levels of XIAP, cIAP1, and Bax were also measured using semiquantitative RT-PCR. Final XIAP, cIAP1, a nd Bax PCR products were analyzed on a 10% acrylamide gel (Figure 12A-C, left pane l) and the relative amount of each message were calculated by normalizing to the respectiv e actin band (Figure 12A-C, right panel). XIAP message levels remained relatively constant in BRCA1 wt or BRAt cells before and after treatment, however, the overall XIAP messa ge levels were decreased in BRAt cells (Figure 12A), providing a possible explanation for the decreased XIAP protein levels in BRAt cells (Figure 11A). cIAP1 me ssage levels were similar in BRCA1 wt and BRAt cells (Figure 12B) suggesting post-translationa l protein modifications may be responsible

PAGE 66

52 for the decreased cIAP1 protein levels (Figur e 11A). Bax mRNA levels increased in both BRCA1 wt and BRAt cells following STS treatment however, the increase in BRAt cells was much more dramatic (Figure 12C). Since XIAP stability is due, in large part, to its phosphorylation by Akt, we examined Akt activation in BRCA1 wt vs. BRAt cells (Figure 13A). There was approximately 30% less p-Akt in resting BRA t cells (Table 1) with no appreciable change in total Akt protein. While STS treat ment doubled p-Akt levels in wt cells, it did not significantly affect p-Akt levels in BRAt cells (Figure 13B and Table 1). To determine the extent to which the Akt pathway was responsible for BRAtmediated caspase 3 elevation, constitutively active Akt (AA) was transfected into BRAt cells which were then treated with STS and caspase 3 activation was measured via western blot (Figure 13B). AA-transfected BRAt cells showed a dramatic decrease in caspase 3 activation following STS treatment, su ggesting that Akt play s a pivotal role in BRAt-mediated caspase-3 activation.

PAGE 67

53 Figure 11 BRAt cells have decreased cI AP1 and XIAP and increased Bax protein levels. A) BRCA1 wt and stable S-His-BRAt cells were treated with 1M STS and assayed via western blot analysis for member s of IAP protein family. B) BRCA1 wt and Flag-BRAt cells were treated with 25 M CP and assayed via western blot analysis for Bax protein. All blots were then stripped and reprobe d for actin as a loading control.

PAGE 68

54 Figure 12 BRAt cells have decreased XI AP and increased Bax message levels BRCA1 wt and stable Flag-BRAt cells were treated with 1M STS a nd (A) XIAP, (B) cIAP1, and (C) Bax mRNA levels were measur ed via RT-PCR. Final PCR products were analyzed on a 10% acrylamide gel (left pane l) and the relative amount of each message were calculated and graphed by normalizing to the respective actin band (right panel).

PAGE 69

55 Figure 13 BRAt cells have decreased levels of phosphorylated Akt A) BRCA1 wt and stable S-His-BRAt cells were treated with STS and assayed via western blot for p-Akt and total Akt levels. B) p-Akt levels were quantified using ImageQuant densitometric software. p-Akt values were normalized to total Akt and expressed as arbitrary units. C) BRCA1 wt and stable Flag-BRAt cells transfected with AA cDNA were treated with STS and assayed for cleaved-caspase.

PAGE 70

56 hTERT-BRAt can selectively increa se apoptosis in cancer cells To determine if BRAt protein was sufficient to increase the apoptotic response in drug-resistant ovarian cancer cells, we stably transfected S-His-BRAt into CP-resistant C13 ovarian cancer cells and trea ted with 1 M STS. In ag reement with previous data (Figures 9 and 10) C13-BRAt cells showed a 30% increase in cell death 24 hours after treatment (Figure 14A). To further explore BRAt’s ability to in crease apoptosis in cancer cells, we developed two BRAt expressi on plasmids operated by the hTERT gene promoter. The cancer cell specific expression of telomera se makes the hTERT gene promoter an attractive target for therapeutic interven tion. Using this approach, it has been demonstrated previously that telomerase-n egative cells transfected with plasmids encoding genes that are operated by the hTERT promoter do not recognize this promoter and, therefore, do not produce the target prot ein [168]. In contrast, telomerase-positive cancer cells drive hTERT promoter constructs and the encoded protein is produced as a result. To determine if hTERT-BRAt constr ucts were sufficient to selectively transfect cancer cells, we transfected the hTERT-BRAtluc plasmid into primary cultures of ovarian surface epithelial cells derived from adenomas and human dermal fibroblasts as well as C13 ovarian cancer cells and measured their luciferase activity. The primary adenoma and human dermal fibroblasts did no t display any luciferase activity, whereas the C13 ovarian cancer cells displayed high levels of luciferase activity following hTERT-BRAt-luc transfection (F igure 14B). This indicated that hTERT-driven plasmids were sufficient to selectively expr ess BRAt protein in cancer cells.

PAGE 71

57 Figure 14 BRAt increases STS-induced death in ovarian cancer cells. A) C13 ovarian carcinoma cells were transiently transfected with S-His-BRAt and treated with 1 m STS. Twenty-four hour s after treatment, overall cell death was measured in quadruplet samples via trypan blue exclusion assay. Resu lts are displayed as average death percentage SE B) Pr imary human ovarian adenoma (OVAD) cells, primary human dermal fibroblast cells (HDF ), and C13 ovarian carcinoma cells were transiently transfected with hTERT-BRAt, hTERT-BRAt-luc or GFP plasmid. Triplicate aliquots of each sample were assayed for lu ciferase activity. Resu lts are expressed as average relative luciferase activity SE. BRAt increases cytotoxicity in platinum -resistant ovarian cancer cells To begin to assess possible clinical uses for the apopt otic sensitizing effects of BRAt protein, we utilized the trypan blue excl usion assay to measure overall cell death in CP-resistant C13 ovarian cancer cells (whi ch were derived from CP-sensitive OV2008 ovarian cancer cells). C13 cells were tran sfected with the hTERT-BRAt plasmid and overall cell death following STS treatment was compared to OV2008 cells (Figure 15A). C13 cells expressing BRAt showed a signifi cant increase (p<0.05 at 4 hours and p<0.02 at 24 hours) in overall cell death as compar ed to control C13 cells. OV2008 and C13BRAt showed no significant difference in cell deat h at 24 hours. Western blot analysis

PAGE 72

58 for cleaved-caspase 3 revealed a 3-fold in crease in BRAt-transfected C13 cells after 4 hours (Figure 15B) indicating increase d apoptosis in these cells. We also utilized MTS assays to measur e overall cell viability and proliferation following cisor carboplatinum treatment in BRAt transfected C13 cells (Figures 15C and 15D). As expected, mock-transfected C13 cells showed no re sponse to carboand cisplatinum (CB and CP) treatment, as compared to untreated cells (Figure 15C and 15D). C13 cells transfected with BRAt show ed a 26% decrease (p<0.01) in cell growth at 24 hours and a 33% decrease (p<0.001) in cell growth at 48 hours following CB treatment. Similarly, C13 BRAt cells trea ted with CP also showed significantly decreased cell growth at 48 (p<0.01) and 72 (p<0.001) hours as compared to control transfected C13 cells. At 24 hours post CP treatment C13 BRAt cell growth had decreased by 56% as compared to mock-trans fected cells. This cell growth decrease remained constant at 48 and 72 hours post transfection (61% and 57% decreases). Together, these data demonstr ate the ability of the BRAt pr otein to sensitize platinum resistant ovarian cancer cells to cytotoxic treatment.

PAGE 73

59 Figure 15 BRAt increases cytotoxicity in platinum-resistant ovarian cancer cells. A) CP-resistant C13 cells, C13 cells tran sfected with hTERT-BRA t, and CP-sensitive OV2008 cells were treated with 1 M STS. Overall cell death was measured in quadruplet samples via trypan bl ue exclusion assay. Results are displayed as average death percentage SE. B) CP-resistant C 13 cells, C13 cells transfected with hTERTBRAt, and CP-sensitive OV2008 cells were treated with 1 M STS and assayed via western blot for cleaved caspase -3. Blot was then stripped and reprobed for actin as a loading control. Triplicate samples of mockand hTERT-BRAt transfected C13 cells were treated with 25 M CB (C) or 25 M CP (D) and analyzed via MTS assay for overall cell proliferation. Results are expres sed as average absorption at 450 nm SE.

PAGE 74

60 Discussion Previously, it has been shown that IOSE cells carrying the BRCA1 185delAG mutation have an increased sens itivity to caspase-mediated apoptosis [90]. This increase results from decreased XIAP-mediated ubiquitina tion and is associated with loss of Akt activation [89]. Here, we provide direct evidence of the 185delAG truncation, BRAt, protein’s involvement in caspase-mediated a poptosis of human IOSE. Transfection of BRAt protein into BRCA1 wt IOSE cells did not alter cell growth, morphology, intermediate filament profile or nuclear localization of full length BRCA1. Yet, STS treatment induced a significan tly stronger caspase 3-mediated apoptotic response in these cells. Further, western blot analysis revealed BRAt increased caspase-3 activation by decreasing Akt phosphorylation an d that BRAt protein sensitized platinum resistant ovarian cancer cells to cisand carboplatinum treatment. It is increasingly apparent that a pa radox exists between the tumor-suppressive function and therapeutic-se nsitivity of wild-type BRCA1 cell lines and those expressing BRCA1 mutants. Our study is the first to directly link the BRCA1 185delAG mutation to increased apoptosis, and our fi ndings are similar to those of others. For example, a BRCA1 mutant expressing the first 299 amino acids of the protein increased radiosensitivity in mammary epithelial cells [177], and a truncated BRCA1 mutant

PAGE 75

61 expressing the first 602 amino acids of the pr otein increased chemosensitivity in ID-8 mouse ovarian cancer cells [88]. The propensity for the nonsense-mediated decay (NMD) of mRNAs containing premature stop codons suggests that the mRNAs for the BRCA1 185delAG mutation and other BRCA1 truncation mutants would not be tran slated in cell lines carrying these mutants. It has been suggested that mRNA encoding the 185delAG has a very short halflife and that the expression of the 185delAG mu tant in transient transfection assays is undetectable [178]. Others have report ed that only twen ty-four of thirty BRCA1 truncating mutants are subject to NMD. Interestingly, the 185delAG mutant is among the six mutations found to have no significant de crease in steady-stat e transcript levels, suggesting that this mutant is not subject to NMD [ 179]. Our results su pport the latter, as we demonstrated the expression of stable and transiently-transfected BRAt in ovarian surface epithelial cells via RT -PCR and western blot. These data also correlate favorably with clinical repor ts noting reduced chemotherapeutic response in breast and ova rian cancer patients with sporadic disease when compared to patients carrying BRCA1 founder mutations [81, 158, 159]. Though this protein has yet to be shown to exist clinically, thes e data suggest that the BRCA1 185delAG protein is functional and plays a crucial clinical role in ovarian cancer patients carrying this mutation. While the exact function and molecular mechanisms of the BRCA1 185delAG protein are not known, this data suggests that BRAt may disrupt Akt activation in vitro Akt is often overexpressed or c onstitutively activated in ovarian cancers, thus it represents a valid therap eutic target [180, 181]. Accordingly, the development of molecules that target Akt is an active area of biomedical research [182,

PAGE 76

62 183]. Therefore, a better unde rstanding of the signaling pa thways responsible for the favorable clinical response of ova rian cancer patients carrying the BRCA1 185delAG mutation, especially those pertai ning to the ability of BRAt to abrogate Akt activation, is critical. Taken together, these findings indicate th at the truncated protein derived from the BRCA1 185delAG mutation is sufficient to incr ease cytotoxicity in ovarian cells following chemotherapeutic treatment. BRAt-enhanced caspase 3 activity, then, may represent a new approach to overcome redu ced apoptotic response commonly seen in chemoresistant tumors.

PAGE 77

63 Acknowledgements The cDNA for activated-Akt protein was a generous gift from Dr. Jin Cheng’s laboratory, H. Lee Moffitt Cancer Center, Ta mpa, FL. DNA sequencing was performed by the H. Lee Moffitt Cancer Center Molecula r Biology Core facility. Flow cytometry was performed under the direction of Dr. Charlie Szekeres in the USF Health Flow Cytometry Core Facility.

PAGE 78

64 CHAPTER III BRCA1 185delAG TRUNCATION PROTEI N, BRAT, AMPLIFIES MASPIN EXPRESSION IN HUMAN OVARIAN SURFACE EPITHELIAL CELLS Abstract Maspin protein has been shown to sensitize breast carcinoma cells to STS -induced apoptosis by a seemingly similar mechanism to what we see in BRAt induced apoptosis in our ovarian models. In ovarian cancer the relationship between maspin expression and patient prognosis appears to be dependent on the subcellular loca lization of maspin. Nuclear maspin has been associated with re duced markers of angiogenesis and prolonged survival. Additionally, ovarian cancer patients with complete response to CP treatment have been reported to have significantly higher levels nuclear maspin than nonresponsive patients. Based on these initial observations, we hypothesized that BRAt protein induces maspin protein expression in ovarian surface epithelial (IOSE) cells. Herein, we provide the first evidence th at the BRCA1 185delAG mu tant protein, BRAt, is sufficient to induce maspin protein in IO SE cells. Maspin protein levels in normal IOSE cells that are hete rozygous carriers of the BRCA1 185delAG mutation were compared to other normal IOSE cells with homozygous wild-type BRCA1 All four BRCA1 185delAG mutation carriers tested showed higher maspin levels than six of seven

PAGE 79

65 BRCA1 wild-type/ BRCA1 status unknown cell lines. Normal IOSE BRCA1 wild-type cells were transfected with BRAt protein a nd showed increased maspin mRNA levels and increased nuclear maspin protein levels as compared to mock-transfected cells. Additionally, both hetero zygous carriers of the BRCA1 185delAG mutation and cells transfected with BRAt protein s how an increased ability to activate the maspin promoter as compared to control cells. The transcripti on factor AP1 is at leas t partially required for full activation of the maspin promoter in BRAt cells, as siRNA directed towards c-jun decreased activation of the fu ll-length maspin promoter. In conclusion, the data herein demonstrates that BRAt protein is sufficient to increase maspin expression in IOSE cells, providing a possible explanation for the increas ed CP response observed in some ovarian cancer patients.

PAGE 80

66 Introduction Maspin (ma mmary s erine p rotease in hibitor) was originally identified in normal mammary epithelium by subtrac tive hybridization on th e basis of its expression in normal mammary epithelial cells [121]. Maspin protein has been shown to sensitize breast carcinoma cells to STS-induced apoptosis [119] and also plays a ro le in inhibition of growth, invasion, and metastatic potential of neoplastic cells [184]. In prostate cancer cell lines, maspin overexpression led to decreas ed tumorigenesis and reduced metastatic potential [185]. In contrast, maspin was f ound to be over-expressed in the progression of pre-invasive lesions to mali gnant tumors in pancreatic cancer specimens [186]. It is increasingly apparent that a paradox exists between maspin expression and malignant progression in some cancers. In ovarian cancer the relationship between maspin expression and patient prognosis a ppears to be dependen t on the subcellular localization of maspin. Maspin can inhibit ovarian cancer invasion in vitro and nuclear maspin is associated with increased surv ival, whereas cytoplasmic localization is associate with poor outcome [ 141]. Similarly, nuclear maspin was associated with reduced markers of angiogenesis and prolonge d survival in a retroactive study of 118 ovarian cancer patients [144] and non-detectable maspin appears to confer an increased risk of progression and death in advanced st age epithelial ovarian ca ncer [143]. A recent report by Surowiak et al. presents conflicti ng data, suggesting that cytoplasmic maspin

PAGE 81

67 correlates inversely with relapse of neoplastic disease. Interes tingly, they also report that patients with complete response to CP treatm ent showed significantly higher levels of nuclear maspin than non-responsive patients, suggesting that nuclear maspin expression may be characterstic of CP-sen sitive ovarian cancers [136]. Studies aimed at increasing CP sensitivit y are not unique, and we have recently reported that the BRCA1 185delAG mutant prot ein, BRAt, can increase sensitivity in platinum-resistant ovarian cancer cells [187]. Recently, the expression of maspin in ovarian cancer cells has been reported to be epigeneti cally regulated [123] through demethylation of the maspin promoter [133]. Herein, we provide the first evidence that BRAt protein induces maspin expression in ovarian cells, thereby providing a possible mechanism by which the BRCA1 185delAG mutation confers therapeutic sensitivity.

PAGE 82

68 Materials and Methods Cell Culture and Transfection The SV 40-Large T-Ag transfected huma n ovarian surface epith elial cell lines 3261-77a, 3261-77b, 1816-686a, 1816-686b, 1816-680a, 1816-680b, 1816-575, IOSE118, IOSE-135, IOSE-120, IOSE-29, IOSE-144, and IMCC3 were cultured in Medium 199/ MCDB 105 (Sigma, St. Louis, MO) w ith 5% or 10% fetal bovine serum and gentamicin. Wild type BRCA1 status was confirmed via single site BRACAnalysis DNA sequencing at Myriad Biotechnologies (Salt Lake City, UT). Stable BRAt cells were generated as previously desc ribed [187] and grown in 1 mg /ml G418 selection media. All cells were incubate d at 37C with 5% CO2. IOSE-118 cells were transiently transfected as previously described [187] using the Nucleofector device (Ama xa, Gaithersburg, MD) with 2 g of plasmid (GFP, FlagBRAt, BRIT, Maspin, MasPro-FL, MasPro -759, MasPro-297, or MasPro-116). Cell Viability Assay Cell viability was measured by the CellTiter 96 AQueous One Solution Cell Proliferation MTS (Promega, Madison, WI) co lorimetric assay. The assay was performed in 96 well microtiter plates according to ma nufacturer's instructions and is based on soluble formazan production by dehydrogenase enzymes. Two thousand IOSE-118 cells

PAGE 83

69 transiently transfected with Flag-BRAt, BRI T, or Maspin cDNA were plated on 96 well microtiter plates and incubated for 24 hours. The cells were then treated with 1M STS or 25M CP. Absorbance at 490 nm wa s measured at 0, 4, 24, 48, and 72 hours following treatment using an ELx800 microplate reader (Bio-Tek Instruments, Winooski, VT) and the results expressed as the mean absorbance SE. Western Blot and RT-PCR Protein samples were lyse d in CHAPS buffer and 15 g of protein was separated via 10% SDS-PAGE. Proteins were transferre d to PVDF membranes and blocked in 5% milk in Tween 20-TBS. Blots were incubated in their respective an tibodies overnight and developed via ECL (Amersham). Maspin anti body was purchased from BD Biosciences (San Jose, CA). Cleaved caspase-3, pro-cas pase-3, and c-Jun antibodies were purchased from Cell Signalling Technology (Beverly, MA). -actin antibodies were purchased from Sigma (St. Louis, MO). Stable Flag-BRAt cells were separated in to nuclear and cytoplasmic fractions by lysing in a chilled IGEPAL lysis buffer (50mM Tris-HCl (pH 8.0), 100mM NaCl, 5mM MgCl2, 0.5% (v/v) IGEPAL). Lysed cells were centrifuged at 15,000 x g and supernatant (containing cytoplasm/plasma membrane protei ns) was removed for analysis. The pellet (containing nuclear proteins) was washed tw ice and resuspended in lysis buffer. Fractionation samples were separated via 7% SDS-PAGE. Samples were transferred to PVDF membrane and probed for ma spin protein via western blot. mRNA samples were isolated using TR Izol reagent from Invitrogen per manufacturer’s protocol. One microgram total mRNA, oligo(dT), and reverse

PAGE 84

70 transcriptase were used to generate singl e-strand cDNA as previously described. The cDNA samples were amplified using the Perk in-Elmer (Palo Alto, CA) GeneAmp kit. The maspin primers used were Maspin-S (GGAGGCCACGTTCTGTAT) and MaspinAS (CCTGGCACCTCTATGGA) with -actin primers actin-S (GGGAATTCAAAACTGGAACGGTGAAGG) and actin-AS (GGAAGCTTATCAAAGTCCTCGGCCACA) for an internal control. PCR was performed for 35 cycles of 94C for 90 s, 55C for 90 s, and 72C for 90 s. Actin primers were added at cycle 19. The amplified produc ts were then separated by electrophoresis on a 10% polyacrylamide gel, stained with 1x SYBR Green (Lonza, Rockland, ME), and photographed with the Kodak EDAS 120 Digital Analysis System. Luciferase Assay To measure maspin promoter activity, th e full-length (MasPro-FL) and truncated maspin promoter luciferase constructs (MasPro-759, MasPro-297, or MasPro-116) were used. IOSE-118 cells were transiently co-transfected with 2 g of DNA and 1 g of galactosidase cDNA using program X-005 on th e Nucleofector device. To determine whether the transcription f actor, AP1, was involved in BRAt induced maspin expression, cells were transiently transfected with full-leng th or truncated maspin promoter luciferase constructs and either 1 M AP1 siRNA or 1 M control (scrambled) siRNA (Dharmacon, Chicago, IL). Luciferase activity was measured 48 h after transfection using the Luciferase Assay System (Promega, Madi son, WI) according to the manufacturers' instructions. -galactosidase was measured 48 h after transfection using the Luminescent

PAGE 85

71 -galactosidase Detection K it II (Clontech, Mountain View, CA) according to the manufacturers' instructions. Transcriptional activity was expressed as relative luciferase activity SE, after normalization with -galactosidase activity. Statistical Analysis Where applicable, the data were subjected to paired Student's t test analysis to determine statistical differences between cont rol and treated samples. The results are reported as a P value within the respective figures.

PAGE 86

72 Results BRAt and maspin have similar effects on ovar ian cell proliferation following treatment To begin to evaluate if a relationship exists between BRAt protein and maspin protein expression, we first performed indepe ndent transfections of BRAt, maspin, and BRIT, and compared their proliferation as measured by MTS assay following STS or CP treatment (Figure 16). Untreated BRAt, ma spin, and BRIT transfected cells did not display any significant differen ces in proliferation (Figure 16A). Interestingly, when treated with STS (Figure 16B) or CP (Figur e 16C), BRAt and maspin cell proliferation were similarly inhibited, whereas BRIT cells displayed an initial increase in cell proliferation before succumbing to the toxicity of the treatme nts at 48 hours. This data suggests that BRAt and maspin protein have si milar effects on ovari an cell proliferation following chemotherapeutic treatment. IOSE cells carrying the BRCA1 185delAG muta tion have increased maspin protein levels To determine if the BRCA1 185delAG mutation leads to higher levels of maspin protein, we compared maspin protein levels in cell lines that endogenously carry this mutation to those that are BRCA1 wt or BRCA1 status unknown (Figure 17 ). All four cell lines carrying the mutati on (3261-77a, 3261-77b, 1816-686a, and 1816-686b) had higher levels of maspin protein as measured by western blot than eight of the nine

PAGE 87

73 BRCA1 wt/ BRCA1 status unknown cell lines. Inte restingly, the IOSE-120 cell line contained the highest maspin levels of all cell lines tested; however the BRCA1 status of this cell line is unknown. Figure 16 BRAt and maspin protein have similar eff ects on ovarian cell proliferation Ovarian surface epithelial cells were transien tly transfected with BRAt, maspin, or BRIT plasmids and plated on 96 well plates. Cell proliferation was measured via MTS assay on triplicate samples of (A) untreated cells, (B ) 1 M STS treated cells, and (C) 25 M CP treated cells. Results are expressed as average absorption at 450 nm SE.

PAGE 88

74 Figure 17 The BRCA1 185delAG mutation correlates with increased maspin expression Normal IOSE cells carrying the BRCA1 185delAG mutation (3261-77a, 3261-77b, 1816686a, and 1816-686b) were analyzed for maspin protein levels vi a western blot and compared to BRCA1 wt/ BRCA1 status unknown cell lines. Blot s were then stripped and probed for -actin as a loading contro l. Upper panel shows a s horter exposure for maspin protein, lower panel shows a longe r exposure for maspin protein. BRAt transfection increases maspin message and nuclear maspin protein To further confirm that the increased maspin levels observed in Figure 17 are indeed related to the presence of the BRCA1 185delAG protei n product, BRAt, we analyzed cells transfected with BRAt for maspin message and protein levels (Figure 18).

PAGE 89

75 Normal IOSE-118 cells transien tly transfected with BRAt show ed an increase in maspin message levels as measured by semi-quantitat ive RT-PCR (Figure 18A). The intensity of the maspin band was normalized to the respec tive actin band and this indicated an 87% increase in maspin message in the BRAt transfected cells. Next, we measured the total levels of ma spin protein in stable BRAt cell lines as compared to BRCA1 wt cells. Both stable BRAt cell lin es tested contained more than double the amount of maspin pr otein as compared to the BRCA1 wt control cells (Figure 18B). We then separated the stable BRAt and control BRCA1 wt cells into nuclear and cytosolic fractions to determine if the increa sed maspin in BRAt cells was localizing to the cytoplasm or nucleus. Densitometric analys is of the western blot results show that overall maspin levels were consistent with th ose seen in Figure 18B. Interestingly, over 71% of the maspin in BRAt cells is localized to the nucleus, whereas less than 30% of maspin in the BRCA1 wt is localized to the nucleus (Figur e 18C). This data is consistent with clinical reports suggesting that ovarian tumors with increased nuclear maspin are associated with a favorable prognosis.

PAGE 90

76 Figure 18 BRAt transfection increases maspin message and protein levels (A) Normal IOSE-118 cells were transientl y transfected with BRAt and the relative maspin message levels were measured by RT-PCR and compared to 118 mocktransfected cells. (B) Stable BRAt cells and BRCA1 wt cells were probed for maspin protein levels. Blots were th en stripped and probed for -actin as a loading control. (C) Densitometric analysis of BRAt and BRCA1 wt nuclear and cytoplasmic fractions following analysis for maspin levels via wester n blot. Maspin levels were normalized to -actin for each lysate.

PAGE 91

77 IOSE cells carrying the BRCA1 185delAG mutation and stable BRAt cells display increased activation of the maspin promoter We have thus far demonstrated that IOSE cells carrying the BRCA1 185delAG mutation and stable BRAt cells have increased maspin message and protein levels as compared to BRCA1 wt cells. To further investigate th is increase in maspin expression we obtained a luciferase reporter plasmid operated by the maspin promoter. BRCA1 wt cells (IOSE-80 and IMCC5) and heterozygous carriers of the BRCA1 185delAG mutation (3261-77b and 1816-686b) were transfected with the maspin reporter plasmid and a galactosidase reporter for use as an internal pos itive control. Relative luciferase intensity levels were calculated by normalizing the luciferase activity to the respective galactosidase activity. Cells carrying the BRCA1 185delAG mutation had an approximate 4-fold increase in relative luciferase activity as compared to the BRCA1 wt cells (Figure 19A). This indicates that cel ls carrying this mutati on have an increased propensity to activate the maspin promoter. Additionally, the stable BRA t cells had approximately 2.5 times more relative luciferase activity than the BRCA1 wt. This data correlates favorably with those from the BRCA1 185delAG carriers, suggesti ng that the presence of BRAt protein leads to an increase in maspin promoter activation (Figure 19B).

PAGE 92

78 Figure 19 IOSE cells carrying the BRCA1 185delAG mutation and stable BRAt cells display increased activation of the maspin promoter (A) BRCA1 wt (IOSE-80 and IMCC5) and cells carrying the BRCA1 185delAG mutation (3261-77b and 1816-686b) or (B) BRCA1 wt and stable BRAt cells were cotransfected with a maspin promoter luciferase reporter plasmid and a -galactosidase reporter plasmid. Triplicate aliquots of each samp le were assayed for luciferase and galactosidase activity. Results are expresse d as average relative luciferase activity normalized to the average relative -galactosidase activity SE.

PAGE 93

79 BRAt-enhanced maspin promoter activation is partially mediated by the transcription factor AP1 To determine if a specific region of the maspin promoter was required for the BRAt-enhanced maspin promoter activati on, we obtained three truncated maspin promoter luciferase reporter plasmids and co mpared their relative luciferase activity in stable BRAt cells to that of the full length maspin promoter. The full length maspin promoter consists of the 957 base pairs directly upstream of the first exon in the maspin gene. The truncated plasmids represent the re gions from -759 to -1, -297 to -1, and -116 to -1 in the maspin promoter and are named accordingly (-759, -297, and -116). The longest of the truncated promoters, pl asmid -759, produced only approximately 20% less luciferase activity than the full-length promoter, sugge sting that the most distal region of the maspin promoter is only part ially required for maspin expression (Figure 20). The shorter promoter truncations, -297 and -116, pr oduced 50% less luciferase activity than the full length pr omoter, suggesting that the regi on of the maspin promoter between residues -759 and -297 is required fo r full activation of the maspin promoter. To further analyze the maspin promoter we performed an online analysis for potential transcription factor binding sites in the maspin prom oter. Our analysis revealed several potential AP1 binding sites between residues -759 and -297. Based on this observation, we used siRNA to knockdown c-J un, a component of the AP1 complex that is required for AP1’s ability to promote transcription. Surprisingly, API knockdown had no effect on luciferase activity from any of the truncated maspin promoter reporter plasmids (Figure 21). All three truncated ma spin reporter plasmids produced statistically similar levels of luciferase activity when AP1 was silenced, as compared to mock

PAGE 94

80 transfected control cel ls. Interestingly, AP1 knockdown re sulted in a decrease in fulllength promoter luciferase activit y to levels statistically similar to cells transfected with the -759 truncated maspin promoter lucifera se plasmid, suggesting that loss of an AP1 site or sites is responsible for the loss in luciferase activity observed with the -759 truncated maspin promoter luci ferase plasmid. Additionally, this data suggests that AP1 is at least partially required for full activation of the maspin promoter in BRAt cells. Figure 20 Truncated maspin promoter results in decreased activation of luciferase reporter BRAt cells were cotransfected with -galactosidase and full length maspin promoter luciferase reporter or truncated maspin promot er luciferase reporter. Triplicate aliquots of each sample were assayed for luciferase and -galactosidase activity. Results are expressed as average relative luciferase activity normalized to the average galactosidase activity SE.

PAGE 95

81 Figure 21 AP1 knockdown results in decreased activation of the full length maspin promoter BRAt cells were triple-transfected with or without c-Jun siRNA, -galactosidase, and full length maspin promoter luciferase reporter or truncated maspin promoter luciferase reporter. Triplicate aliquot s of each sample were assayed for luciferase and galactosidase activity. Results are expresse d as average relative luciferase activity normalized to the average -galactosidase activity SE. To confirm that the c-Jun siRNA resulted in decreased c-Jun protein levels we analyzed lysates from BRAt cells transfect ed with c-Jun siRNA or a scrambled siRNA (Figure 22A, top panel). c-Jun siRNA tran sfection resulted in a very strong knockdown of c-Jun as measured by western blot. Intere stingly, maspin protein levels in the sample transfected with c-Jun siRNA were also some what decreased (Figur e 22A, middle panel), confirming the previous observation that AP 1 knockdown results in decreased activation of the maspin promoter. To further analy ze the effect of AP1 knockdown in BRAt cells, BRAt cells transfected with c-Jun siRNA or scramble siRNA were treated with STS and measured their cleaved caspase-3 (Figure 22B, top panel) and pro-cas pase-3 (Figure 22B,

PAGE 96

82 lower panel) levels measured via western bl ot. AP1 knockdown resulted in a decrease in cleaved-caspase-3. Additionally, the available pool of pro-caspase-3 was greater in cells transfected with c-Jun siRNA. Taken toge ther, these results demonstrate that AP1 knockdown is sufficient to decrease maspin leve ls in BRAt cells and this decrease in maspin results in a decrease in cleavedcaspase-3 following STS treatment, indicating a decrease in overall apoptosis.

PAGE 97

83 Figure 22 AP1 knockdown decreases maspin protein levels in BRAt cells and attenuates the apoptotic response following STS treatment (A) BRAt cells transfected with a scrambled siRNA or c-Jun siRNA were analyzed for cJun (upper panel) and maspin (middle panel) pr oteins levels via west ern blot. Blot was then stripped and reprobed for actin as a load ing control. (B) BRAt cells transfected with a scrambled siRNA or c-Jun siRNA were tr eated with 1 M STS and lysates were collected six hours after treatment. Samples we re analyzed for cleaved caspase-3 (upper panel) and pro-caspase-3 (l ower panel) protein leve ls via western blot.

PAGE 98

84 Discussion Herein, we have demonstrated that the BRCA1 185delAG mutant protein, BRAt, is sufficient to increase maspin protein leve ls in immortalized human ovarian surface epithelial cell lines. We have demonstrated th at this increase in maspin protein is due, in part, to increased activation of the maspin pr omoter and that the transcription factor AP1 partially mediates this promoter activati on. Additionally, we demonstrate that AP1 knockdown in BRAt cells results in partially d ecreased maspin protein levels, and this corresponds with decreased caspase-3 cleavage following STS treatment. The tumor suppressor p53 has been describe d as a direct stimulator of the maspin promoter [146]. P53 protein has also been shown to bind to and be inactivated by the SV-40 Large T antigen [188]. The BRCA1 wt/ BRCA1 status unknown cell lines used in this study are all SV-40 Large T antigen immort alized, therefore it is plausible that the low levels of maspin protein expressed in these cells is at least partially attributed to their decreased levels of functional p53 protei n. Additionally, the cell lines that are heterozygous BRCA1 185delAG mutation carriers used in this study are also SV-40 Large T antigen immortalized, however, the masp in levels in these cells are increased, in addition to their increased ability to induce activation of the masp in promoter. This

PAGE 99

85 suggests that the BRCA1 185delAG mutation product, BRAt, may be acting as a transcription factor or intera cting with other transcripti on factors to induce maspin expression. The induction of maspin protein expr ession by the overexpression of other proteins has been previously establishe d. Most recently, Yamaguchi et al. (2008) describe induced maspin expression in a br east carcinoma cell line stably expressing the interferon-inducible protein IFIX The function of the induced maspin in their system is different than what we report here, as they observe decreased invasi on in cells expressing induced maspin [189]. However, their data support the general cla ssification of maspin as a tumor suppressor. We were the first to propose that the BRCA1 185delAG mutation protein product, BRAt, possesses a unique and novel function unr elated to that of full-length BRCA1 [187]. Herein, we provide the first evid ence that the novel func tion of BRAt may be related to its ability to induce maspin e xpression in ovarian cells. While the exact mechanism by which BRAt protein induces maspin expression is not known, we hypothesize that BRAt protein may in teract, either directly or indirectly, with the maspin promoter, possibly at an AP1 site at the distal region of the maspin promoter. The function of maspin in the nucleus is still unknow n. In the absence of a nuclear localization signal, maspin must either be chaperoned to the nucleus or cross the nuclear membrane by passive diffusion [190]. BRAt protein localizes to the nucleus [187], therefore it is possible that BRAt protein may act as a scaffolding protein to shuttle maspin to the nucleus. Further experiment ation is needed to determine if BRAt and maspin proteins physically interact.

PAGE 100

86 Our in vitro observation that BRAt pr otein increases nuclear levels of maspin protein in ovarian cells suppor ts the observation that wome n with ovarian tumors with nuclear maspin expression have prolonged survival as compared to those with cytoplasmic or no maspin expression [144]. Surowiak et al. ( 2006) report that that elevated nuclear maspin is typical for ovarian cancer cases with complete response to CP treatment. Unfortunately, the BRCA1 status of the cell lines and patients in their study is unknown, therefore we can not explore any potential correlations between specific BRCA1 mutations and maspin expression/subcellu lar localization and the relationship to chemosensitivity and prognosis In summary, this study shows that IOSE ce lls carrying or stably transfected with the BRCA1 185delAG mutation have increased maspin levels. This increase in maspin was most notable in the nucleus and the in creased maspin corres ponds with increased caspase-3 cleavage following STS treatment. The transcription factor AP1 partially mediates maspin promoter activity in BRA t cells and AP1 knockdown decreases maspin protein levels in BRAt cells.

PAGE 101

87 Acknowledgements Maspin expression plasmid was a generous gift from Dr. Shijie Sheng (Wayne State University). Full-length maspin-promoter-luciferase-reporter plasmid was a generous gift from Dr. Bernard Futscher (Arizona Cancer Center). The truncated maspin-promoter-luciferase-reporter construc ts were generous gifts from Dr. Shiv Srivastava (Uniformed Services Univ ersity of the Health Sciences).

PAGE 102

88 CHAPTER IV CONCLUSIONS Ovarian cancer is a deadly disease that kills an estimated 15,000 women annually in the United States [2]. Many of these deaths are attributed to tumors that are unresponsive to chemotherapeutic treatment due to the development of multi-drug resistance. The data presented herein s uggests a novel explanati on for the observation that a subset of ovarian can cer patients, those carrying the BRCA1 185delAG mutation, experience a better clinical response than t hose carrying other BRCA1 mutations or those with sporadic disease. We are the first to demonstrate that the protein product of the BRCA1 185delAG mutation, BRAt, is sufficient to increase the ch emotherapeutic response of ovarian cells in vitro Additionally, it is important to not e that the increased apoptotic response observed in our cell culture model occurs in the presence of w ild-type BRCA1. Wildtype BRCA1 is involved in the maintenance of genomic stability and DNA repair, thus it has been suggested that loss of wild-type BRCA1, either via mutation or epigenetic silencing, is responsible for the increased chemotherapeutic response observed in some patients. While the loss of wild-type BRCA1 may and likely partiall y contributes to the increased chemotherapeutic response observe d in ovarian cancer patients carrying the BRCA1 185delAG mutation, we provide evidence that shows that the protein product of

PAGE 103

89 this mutation also contributes and itself is su fficient to increase the therapeutic response in drug-resistant ova rian cancer cells. We have demonstrated that the mRNA c oding for BRAt is detectable in ovarian cells transfected with cDNA coding for BRAt. We have also demonstrated that BRAt protein is detectable in these cells, which in itself is a significan t contribution based on the general assumption that tr uncated mRNA transcripts ar e degraded via the non-sense mediated mRNA decay pathway and, thus are un able to transcribe a functional truncated protein. Additionally, we have provided insigh t into the mechanism by which BRAt protein increases drug-induced apoptosis in ovarian cells. Most not ably, BRAt cells have decreased phospho-Akt and XIAP protein le vels following STS treatment, suggesting that BRAt protein inhibits or decreases the phosphorylation of Akt and this decrease in phospho-Akt may be responsible for the decrease in XIAP protein levels. Overexpression of constitutively-activated Akt decreased the STS-induced apoptotic response in our model system, indicating that Akt is indeed a mediator of BRAt induced apoptosis. Finally, we have provided the first evidence that ovarian cells carrying or transfected with the BRCA1 185delAG mutation have increased levels of maspin protein. Specifically, we show that in ovarian cells tr ansfected with BRAt we see an increase in maspin levels in the nucleus which correlates favorably with current literature describing the effect of maspin protein expression in ovarian cancer patients [144]. We have

PAGE 104

90 demonstrated that BRAt cells have an increa sed ability to activate the maspin promoter and that this activation is at least partia lly dependent on an AP1 transcription factor binding site located at the distal end of the maspin promoter. Our data suggests that the signaling pa thway(s) associated with BRAt-induced maspin expression and drug-induced caspase-3 cleavage may be an attractive target for future adjuvant therapies to enhance the treatm ent of ovarian cancer patients. It appears that the unique sixteen amino acids at the Cterminus of BRAt pr otein are required for BRAt’s activity, as the similarly sized BRIT control protein (with a scrambled sequence at the C-terminus) did not elicit any ch anges in caspase-3 cl eavage following STS treatment. Thus, further analysis of these unique sixteen amino-ac ids should lead to a better understanding of the mechanism by which BRAt protein leads to an increase in induced apoptosis. From our data it is apparent that cau tion should be used when interpreting the results of clinical reports that group all BRCA1 mutation carriers into a single cohort. When known, carriers of BRCA1 germline founder mutations, specifically t hose carrying the 185delAG mutation, should be subcategorized into a separate group for more accurate analysis. Unfortunately, it is unlikely that our findings will alter current protocols for reporting BRCA1 mutation status, thus future report s will likely continue to fail to provide crucial details that could better th e understanding of this specific mutation. Additionally, our data lead us to speculate that other BRCA1 mutations could possibly lead to the production of stable truncated proteins with unique and novel functions. Specifically, the steady-state leve ls of mRNA from the second most common

PAGE 105

91 BRCA1 founder mutation, the 5382insC mutation, are reported to be stable, similar to those seen with the 185d elAG mutation [179]. In conclusion, based on our data we propose the following mechanism by which BRAt induced maspin expression and subseque nt drug-induced apoptos is occurs (Figure 23). BRAt protein, when expressed in ovarian cells induces maspin protein expression. This increased expression of maspin pr otein is partially dependent on an AP1 transcription factor binding s ite in the maspin promoter. Upon treatment with STS or CP, BRAt and/or maspin cause a reduction in IA P proteins, specifically XIAP and cIAP-1, and an increase in proapoptotic proteins, sp ecifically bax. Together, this leads to an increase in caspase-3 cleavage and subsequently an increase in apoptosis. This apoptotic increase can be attenuated by the overexpression of constitutively activated Akt, resulting in decreased caspase-3 cleav age and decreased apoptosis following STS treatment. Further experimentation is needed to de termine exactly how the overexpression of activated Akt is attenuating caspase-3 cleavage in our model system.

PAGE 106

92 Figure 23 Proposed mechanism for BRAt-induced maspin expression and caspase-3 cleavage in ovarian cells BRAt protein, when expressed in ovarian cells induces maspin protein expression. This increased expression of maspin protein is partially dependent on an AP1 transcription factor binding site in the maspin promoter. Upon treatment with STS or CP, BRAt and/or maspin cause a reduction in IAP prot eins, specifically XIAP and cIAP-1, and an increase in proapoptotic proteins specifically bax. Together, this leads to an increase in caspase-3 cleavage and subseque ntly an increase in apoptosis This apoptotic increase can be attenuated by the overexpression of c onstitutively activated Akt, resulting in decreased caspase-3 cleavage and decreas ed apoptosis following STS treatment.

PAGE 107

93 REFERENCES [1] A Jemaldci, R Siegel, E Ward, T Mu rray, J Xu, C Smigal and MJ Thun. Cancer statistics, 2006. CA Cancer J Clin 2006, 56(2): 106-130. [2] A Jemal, R Siegel, E Ward, T Murray, J Xu and MJ Thun. Cancer statistics, 2007. CA Cancer J Clin 2007, 57(1): 43-66. [3] A Jemal, T Murray, E Ward, A Samuels, RC Tiwari, A Ghafoor, EJ Feuer and MJ Thun. Cancer statistics, 2005. CA Cancer J Clin 2005, 55(1): 10-30. [4] VR Zurawski, Jr., H Orjaseter, A Ande rsen and E Jellum. Elevated serum CA 125 levels prior to diagnosis of ovarian ne oplasia: relevance for early detection of ovarian cancer. Int J Ca ncer 1988, 42(5): 677-680. [5] D Neesham. Ovarian cancer screenin g. Aust Fam Physician 2007, 36(3): 126-128. [6] Ovarian Cancer Screening. NC Institute. http://www.cancer.gov/cancert opics/pdq/screening/ovari an/Patient/page3#Keypoi nt8. [7] KM Feeley and M Wells. Precursor le sions of ovarian ep ithelial malignancy. Histopathology 2001, 38(2): 87-95. [8] L Dubeau. The cell of origin of ovarian epithelial tumors and the ovarian surface epithelium dogma: does the emperor have no clothes? Gynecol Oncol 1999, 72(3): 437-442. [9] S Orsulic, Y Li, RA Soslow, LA Vitale-Cross, JS Gutkind and HE Varmus. Induction of ovarian cancer by defined multiple genetic changes in a mouse model system. Cancer Cell 2002, 1(1): 53-62. [10] DC Connolly, R Bao, AY Nikitin, KC Stephens, TW Poole, X Hua, SS Harris, BC Vanderhyden and TC Hamilton. Female mice chimeric for expression of the simian virus 40 TAg under control of th e MISIIR promoter develop epithelial ovarian cancer. Cancer Res 2003, 63(6): 1389-1397.

PAGE 108

94 [11] A Flesken-Nikitin, KC Choi, JP Eng, EN Shmidt and AY Nikitin. Induction of carcinogenesis by concurrent inactivation of p53 and R b1 in the mouse ovarian surface epithelium. Cancer Res 2003, 63(13): 3459-3463. [12] LM Roth. Recent advances in the pa thology and classification of ovarian sex cord-stromal tumors. Int J G ynecol Pathol 2006, 25(3): 199-215. [13] F Tavassoli and P Devilee eds. WHO Cl assification of Tumours. Pathology and Genetics of Tumours of the Breast a nd Female Genital Organs. Lyon: IARC Press, 2003. [14] JD Seidman, I Horkayne-Szakaly, M Haiba, CR Boice, RJ Kurman and BM Ronnett. The histologic type and stage di stribution of ovarian carcinomas of surface epithelial origin. Int J Gynecol Pathol 2004, 23(1): 41-44. [15] M Shih Ie and RJ Kurman. Ovarian tumorigenesis: a proposed model based on morphological and molecular genetic an alysis. Am J Pathol 2004, 164(5): 15111518. [16] RH Young and RE Scully. Differentia l diagnosis of ovarian tumors based primarily on their patterns and cell types. Semin Diagn Pathol 2001, 18(3): 161235. [17] T Kaku, S Ogawa, Y Kawano, Y Ohis hi, H Kobayashi, T Hirakawa and H Nakano. Histological classification of ovarian cancer. Med Electron Microsc 2003, 36(1): 9-17. [18] JH Shepherd. Revised FIGO staging for gynaecological cancer. Br J Obstet Gynaecol 1989, 96(8): 889-892. [19] JB Trimbos, M Parmar, I Vergote, D Guthrie, G Bolis, N Colombo, JB Vermorken, V Torri, C Mangioni, S Peco relli, A Lissoni and AM Swart. International Collaborative Ovaria n Neoplasm trial 1 and Adjuvant ChemoTherapy In Ovarian Neoplasm trial: two parallel randomized phase III trials of adjuvant chemotherapy in patie nts with early-stage ovarian carcinoma. J Natl Cancer Inst 2003, 95(2): 105-112. [20] A du Bois, HJ Luck, W Meier, HP Ad ams, V Mobus, S Costa, T Bauknecht, B Richter, M Warm, W Schroder, S Olbr icht, U Nitz, C Jackisch, G Emons, U Wagner, W Kuhn and J Pfisterer. A randomized clinical trial of cisplatin/paclitaxel versus carboplatin/paclitaxel as firstline treatment of ovarian cancer. J Natl Cancer Inst 2003, 95(17): 1320-1329. [21] SA Cannistra. Cancer of the ovary. N Engl J Med 1993, 329(21): 1550-1559.

PAGE 109

95 [22] RF Ozols, BN Bundy, BE Greer, JM Fowler, D Clarke-Pearson, RA Burger, RS Mannel, K DeGeest, EM Hartenbach and R Baergen. Phase III trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally resected stage III ovarian cancer: a G ynecologic Oncology Group study. J Clin Oncol 2003, 21(17): 3194-3200. [23] VT De-Vita Jr, S Hellman and S Rose nberg eds. Cancer: Principles and practice of oncology. Philadelphia: Lippinc ott Williams and Wilkins, 2005. [24] M Markman, R Rothman, T Hakes, B Reichman, W Hoskins, S Rubin, W Jones, L Almadrones and JL Lewis, Jr. Second-lin e platinum therapy in patients with ovarian cancer previously treated with cisplatin. J Clin Oncol 1991, 9(3): 389393. [25] MG Cantu, A Buda, G Parma, R Rossi, I Floriani, C Bonazzi, T Dell'Anna, V Torri and N Colombo. Randomized controll ed trial of single-agent paclitaxel versus cyclophosphamide, doxorubicin, and ci splatin in patients with recurrent ovarian cancer who responded to first-line platinum-based regimens. J Clin Oncol 2002, 20(5): 1232-1237. [26] M Gore ed. Treatment of relapsed epithelial ovarian cancer. Alexandria: American Society of Clinical Oncology, 2001. [27] M Selvakumaran, DA Pisarcik, R Bao, AT Yeung and TC Hamilton. Enhanced cisplatin cytotoxicity by disturbing the nucleotide excision repair pathway in ovarian cancer cell lines. Cancer Res 2003, 63(6): 1311-1316. [28] E Asselin, GB Mills and BK Tsang. XI AP regulates Akt activity and caspase-3dependent cleavage during cisplatin-i nduced apoptosis in human ovarian epithelial cancer cells. Ca ncer Res 2001, 61(5): 1862-1868. [29] J Li, Q Feng, JM Kim, D Schneider man, P Liston, M Li, B Vanderhyden, W Faught, MF Fung, M Senterman, RG Korn eluk and BK Tsang. Human ovarian cancer and cisplatin resistan ce: possible role of inhib itor of apoptosis proteins. Endocrinology 2001, 142(1): 370-380. [30] M Campiglio, S Ali, PG Knyazev and A Ullrich. Characteristics of EGFR familymediated HRG signals in human ovari an cancer. J Cell Biochem 1999, 73(4): 522-532. [31] AN Gordon, N Finkler, RP Edwards, AA Garcia, M Crozier, DH Irwin and E Barrett. Efficacy and safety of erlotinib HC l, an epidermal growth factor receptor (HER1/EGFR) tyrosine kinase inhibitor, in patients with advanced ovarian carcinoma: results from a phase II multicenter study. Int J Gynecol Cancer 2005, 15(5): 785-792.

PAGE 110

96 [32] RJ Schilder, MW Sill, X Chen, KM Darcy, SL Decesare, G Lewandowski, RB Lee, CA Arciero, H Wu and AK Godwin. Phase II study of gefitinib in patients with relapsed or persistent ovarian or primary peritoneal carcinoma and evaluation of epidermal growth factor receptor mutations and immunohistochemical expression: a G ynecologic Oncology Group Study. Clin Cancer Res 2005, 11(15): 5539-5548. [33] MA Bookman, KM Darcy, D Clarke -Pearson, RA Boothby and IR Horowitz. Evaluation of monoclonal humanized anti-HER2 antibody, trastuzumab, in patients with recurrent or refractory ovari an or primary peritoneal carcinoma with overexpression of HER2: a phase II tria l of the Gynecologic Oncology Group. J Clin Oncol 2003, 21(2): 283-290. [34] N Ferrara, K Carver-Moore, H Chen, M Dowd, L Lu, KS O'Shea, L PowellBraxton, KJ Hillan and MW Moore. Heterozygous embryonic lethality induced by targeted inactivation of the VE GF gene. Nature 1996, 380(6573): 439-442. [35] J Folkman. Role of angiogenesis in tumor growth and metastasis. Semin Oncol 2002, 29(6 Suppl 16): 15-18. [36] L Li, L Wang, W Zh ang, B Tang, J Zhang, H S ong, D Yao, Y Tang, X Chen, Z Yang, G Wang, X Li, J Zhao, H Ding, E Reed and QQ Li. Correlation of serum VEGF levels with clinical stage, ther apy efficacy, tumor metastasis and patient survival in ovarian cancer. Anticancer Res 2004, 24(3b): 1973-1979. [37] S Yamamoto, I Konishi, M Mandai, H Kuroda, T Komatsu, K Nanbu, H Sakahara and T Mori. Expression of vascular e ndothelial growth factor (VEGF) in epithelial ovarian neoplasms: correlation with clinicopathology and patient survival, and analysis of serum VEGF levels. Br J Cancer 1997, 76(9): 12211227. [38] KJ Kim, B Li, J Winer, M Armani ni, N Gillett, HS Phillips and N Ferrara. Inhibition of vascular endot helial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 1993, 362(6423): 841-844. [39] KD Miller, LI Chap, FA Holmes, MA Cobleigh, PK Marcom, L Fehrenbacher, M Dickler, BA Overmoyer, JD Reima nn, AP Sing, V Langmuir and HS Rugo. Randomized phase III trial of capecitabine compared with bevacizumab plus capecitabine in patients with previously treated metastatic br east cancer. J Clin Oncol 2005, 23(4): 792-799. [40] F Kabbinavar, HI Hurwitz, L Fe hrenbacher, NJ Meropol, WF Novotny, G Lieberman, S Griffing and E Bergsland. Phase II, randomized trial comparing

PAGE 111

97 bevacizumab plus fluorouracil (FU)/le ucovorin (LV) with FU/LV alone in patients with metastatic colorectal cancer. J Clin On col 2003, 21(1): 60-65. [41] DH Johnson, L Fehrenbacher, WF Novotny, RS Herbst, JJ Nemunaitis, DM Jablons, CJ Langer, RF DeVore, 3rd, J Gaudreault, LA Damico, E Holmgren and F Kabbinavar. Randomized phase II tr ial comparing bevacizumab plus carboplatin and paclitaxel with carboplatin and paclitax el alone in previously untreated locally advanced or metastatic non-small-cell lung cancer. J Clin Oncol 2004, 22(11): 2184-2191. [42] RA Burger, M Sill, BJ Monk, B Greer and JI Sorosky. Phase II trial of bevacizumab in persistent or recurrent ep ithelial ovarian cance r (EOC) or primary peritoneal cancer (PPC): a Gynecolo gic Oncology Group (GOG) study. Proc. Am. Soc. Clin. Oncol 2005, 23: 4575. Abstract 5009. [43] AA Garcia, AM Oza, H Hirte, G Fl eming, D Tsao-Wei, L Roman, S Swenson, D Gandara, S Scudder and R Morgan. Interim re port of a phase II cl inical trial of bevacizumab (Bev) and low dose metronomic oral cyclophosphamide (mCTX) in recurrent ovarian (OC) and primary peri toneal carcinoma: A California Cancer Consortium Trial. Proc. Am. Soc. Cl in. Oncol. 2005, 23: 4555. Abstract 5000. [44] PA Futreal, Q Liu, D Sh attuck-Eidens, C Cochran, K Harshman, S Tavtigian, LM Bennett, A Haugen-Strano, J Swensen, Y Miki, K Eddington, M McClure, C Frye, J Weaver-Feldhaus, W Ding, Z Gholami, P Soederkvist, L Terry, S Jhanwar, A Berchuck, JD Iglehart, J Marks, DG Ballinger, JC Barrett, MH Skolnick, A Kamb and R Wiseman. BRCA1 mutations in primary breast and ovarian carcinomas. Science 1994, 266(5182): 120-122. [45] M Aarnio, JP Mecklin, LA Aaltonen, M Nystrom-Lahti and HJ Jarvinen. Lifetime risk of different cancers in here ditary non-polyposis colorectal cancer (HNPCC) syndrome. Int J Cancer 1995, 64(6): 430-433. [46] C Bewtra, P Watson, T Conway, C R ead-Hippee and HT Lynch. Hereditary ovarian cancer: a clinicopathological study. Int J Gynecol Pathol 1992, 11(3): 180-187. [47] Y Saga, H Mizukami, Y Takei, K Ozawa and M Suzuki. Suppression of cell migration in ovarian cancer cells medi ated by PTEN overexpression. Int J Oncol 2003, 23(4): 1109-1113. [48] Y Wang, A Helland, R Holm, H Skomed al, VM Abeler, HE Danielsen, CG Trope, AL Borresen-Dale and GB Kriste nsen. TP53 mutations in early-stage ovarian carcinoma, relation to long-term survival. Br J Cancer 2004, 90(3): 678685.

PAGE 112

98 [49] R Wooster, SL Neuhausen, J Mangi on, Y Quirk, D Ford, N Collins, K Nguyen, S Seal, T Tran, D Averill and et al. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science 1994, 265(5181): 2088-2090. [50] Y Miki, J Swensen, D Shattuck-Eidens, PA Futreal, K Harshman, S Tavtigian, Q Liu, C Cochran, LM Bennett, W Ding, R Be ll, J Rosenthal, C Hussey, T Tran, M McClure, C Frye, T Hattier, R Phelps A Haugen-Strano, H Ka tcher, K Yakumo, Z Gholami, D Shaffer, S Stone, S Ba yer, C Wray, R Bogden, P Dayananth, J Ward, P Tonin, S Narod, PK Bristow, FH Norris, L Helvering, P Morrison, P Rosteck, M Lai, JC Barrett, C Lewi s, S Neuhausen, L Cannon-Albright, D Goldgar, R Wiseman, A Kamb and MH Skolnick. A strong candidate for the breast and ovarian cance r susceptibility gene BRCA1. Science 1994, 266(5182): 66-71. [51] D Ford, DF Easton, DT Bishop, SA Nar od and DE Goldgar. Risks of cancer in BRCA1-mutation carriers. Breast Can cer Linkage Consortium. Lancet 1994, 343(8899): 692-695. [52] JM Hall, MK Lee, B Newman, JE Morrow, LA Anderson, B Huey and MC King. Linkage of early-onset familial breas t cancer to chromosome 17q21. Science 1990, 250(4988): 1684-1689. [53] H Ruffner and IM Verma. BRCA1 is a cell cycle-re gulated nuclear phosphoprotein. Proc Natl Acad Sci U S A 1997, 94(14): 7138-7143. [54] JM Gudas, T Li, H Nguyen, D Jens en, FJ Rauscher, 3rd and KH Cowan. Cell cycle regulation of BRCA1 messenger RNA in human breast epithelial cells. Cell Growth Differ 1996, 7(6): 717-723. [55] R Scully, J Chen, RL Ochs, K K eegan, M Hoekstra, J Feunteun and DM Livingston. Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell 1997, 90(3): 425-435. [56] LV Lotti, L Ottini, C D'Amico, R Gradini, A Cama, F Belleudi, L Frati, MR Torrisi and R Mariani-Cost antini. Subcellular localiz ation of the BRCA1 gene product in mitotic cells. Genes Ch romosomes Cancer 2002, 35(3): 193-203. [57] PS Brzovic, P Rajagopal, DW Hoyt, MC King and RE Klevit. Structure of a BRCA1-BARD1 heterodimeric RING-RI NG complex. Nat Struct Biol 2001, 8(10): 833-837. [58] RS Williams, R Green and JN Glover. Crystal structure of the BRCT repeat region from the breast cancer-associated protein BRCA1. Nat Struct Biol 2001, 8(10): 838-842.

PAGE 113

99 [59] PS Brzovic, JR Keeffe, H Nishik awa, K Miyamoto, D Fox, 3rd, M Fukuda, T Ohta and R Klevit. Binding and recogn ition in the assembly of an active BRCA1/BARD1 ubiquitin-li gase complex. Proc Natl Acad Sci U S A 2003, 100(10): 5646-5651. [60] CX Deng and SG Brodie. Roles of BRCA 1 and its interacting proteins. Bioessays 2000, 22(8): 728-737. [61] Y Wang, D Cortez, P Yazdi, N Neff SJ Elledge and J Qin. BASC, a super complex of BRCA1-associated proteins invo lved in the recognition and repair of aberrant DNA structures. Genes Dev 2000, 14(8): 927-939. [62] Q Zhong, CF Chen, S Li, Y Chen, CC Wang, J Xiao, PL Chen, ZD Sharp and WH Lee. Association of BRCA1 with the hRad50-hMre11-p95 complex and the DNA damage response. Science 1999, 285(5428): 747-750. [63] ON Aprelikova, BS Fang, EG Meissner, S Cotter, M Campbell, A Kuthiala, M Bessho, RA Jensen and ET Liu. BRCA1associated growth arrest is RBdependent. Proc Natl Acad Sci U S A 1999, 96(21): 11866-11871. [64] J Chen, DP Silver, D Walpita, SB Cantor, AF Gazdar, G Tomlinson, FJ Couch, BL Weber, T Ashley, DM Livingston and R Scully. Stable interaction between the products of the BRCA1 and BRCA2 tu mor suppressor genes in mitotic and meiotic cells. Mol Cell 1998, 2(3): 317-328. [65] R Scully, SF Anderson, DM Chao, W We i, L Ye, RA Young, DM Livingston and JD Parvin. BRCA1 is a component of the RNA polymerase II holoenzyme. Proc Natl Acad Sci U S A 1997, 94(11): 5605-5610. [66] AR Venkitaraman. Cancer susceptib ility and the functions of BRCA1 and BRCA2. Cell 2002, 108(2): 171-182. [67] MS Brose, TR Rebbeck, KA Calzone, JE Stopfer, KL Nathanson and BL Weber. Cancer risk estimates for BRCA1 mutation carriers identified in a risk evaluation program. J Natl Cancer Inst 2002, 94(18): 1365-1372. [68] DF Easton, D Ford and DT Bishop. Breast and ovarian cancer incidence in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Am J Hum Genet 1995, 56(1): 265-271. [69] LS Friedman, EA Ostermeyer, CI S zabo, P Dowd, ED Lynch, SE Rowell and MC King. Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat Genet 1994, 8(4): 399-404.

PAGE 114

100 [70] LS Friedman, CI Szabo, EA Ostermey er, P Dowd, L Butler, T Park, MK Lee, EL Goode, SE Rowell and MC King. Novel inherited mutations and variable expressivity of BRCA1 a lleles, including the f ounder mutation 185delAG in Ashkenazi Jewish families. Am J Hum Genet 1995, 57(6): 1284-1297. [71] SM Ginolhac, S Gad, M Corbex, B Br essac-De-Paillerets, A Chompret, YJ Bignon, JP Peyrat, J Fournier, C Lasset, S Giraud, D Muller, JP Fricker, A Hardouin, P Berthet, C Maugard, C Nogue s, R Lidereau, M Longy, S Olschwang, C Toulas, R Guimbaud, D Yannoukakos, C Szabo, F Durocher, AM Moisan, J Simard, S Mazoyer, HT Lynch, D Gol dgar, D Stoppa-Lyonnet, GM Lenoir and OM Sinilnikova. BRCA1 wild-t ype allele modifies risk of ovarian cancer in carriers of BRCA1 germ-line mutations. Cancer Epidemiol Biomarkers Prev 2003, 12(2): 90-95. [72] JP Struewing, D Abeliovich, T Pere tz, N Avishai, MM Kaback, FS Collins and LC Brody. The carrier frequency of the BRCA1 185delAG mutation is approximately 1 percent in Ashkenazi Jewish individuals. Nat Genet 1995, 11(2): 198-200. [73] J Simard, P Tonin, F Durocher, K Mo rgan, J Rommens, S Gingras, C Samson, JF Leblanc, C Belanger, F Dion, Q Liu, M Skol nick, D Goldgar, D Shattuck-Eidens, F Labrie and SA Narod. Common origin s of BRCA1 mutations in Canadian breast and ovarian cancer families. Nat Genet 1994, 8(4): 392-398. [74] LG Mullineaux, TM Castellano, J Shaw, L Axell, ME Wood, S Diab, C Klein, M Sitarik, AM Deffenbaugh and SL Graw Identification of germline 185delAG BRCA1 mutations in non-Jewish American s of Spanish ancestry from the San Luis Valley, Colorado. Ca ncer 2003, 98(3): 597-602. [75] O Diez, M Domenech, MC Alonso, J Br unet, J Sanz, J Cortes, E del Rio and M Baiget. Identification of the 185delAG BRCA1 mutation in a Spanish Gypsy population. Hum Genet 1998, 103(6): 707-708. [76] BB Roa, AA Boyd, K Volcik and CS Richards. Ashkenazi Jewish population frequencies for common mutations in BRCA1 and BRCA2. Nat Genet 1996, 14(2): 185-187. [77] AC Antoniou, PD Pharoah, S Nar od, HA Risch, JE Eyfjord, JL Hopper, H Olsson, O Johannsson, A Borg, B Pasini, P Radice, S Manoukian, DM Eccles, N Tang, E Olah, H Anton-Culver, E Warner, J Lubinski, J Gronwald, B Gorski, H Tulinius, S Thorlacius, H Eerola, H Neva nlinna, K Syrjakoski, OP Kallioniemi, D Thompson, C Evans, J Peto, F Lalloo, DG Evans and DF Ea ston. Breast and ovarian cancer risks to carriers of the BRCA1 5382insC and 185delAG and BRCA2 6174delT mutations: a combined an alysis of 22 population based studies. J Med Genet 2005, 42(7): 602-603.

PAGE 115

101 [78] JP Struewing, P Hartge, S Wacholde r, SM Baker, M Berlin, M McAdams, MM Timmerman, LC Brody and MA Tucker. Th e risk of cancer associated with specific mutations of BRCA1 and BRCA2 among Ashkenazi Jews. N Engl J Med 1997, 336(20): 1401-1408. [79] MC King, JH Marks and JB Mandell. Breast and ovarian cancer risks due to inherited mutations in BRCA1 a nd BRCA2. Science 2003, 302(5645): 643-646. [80] J Boyd, Y Sonoda, MG Federici, F Bogo molniy, E Rhei, DL Maresco, PE Saigo, LA Almadrones, RR Barakat, CL Brown, DS Chi, JP Curtin, EA Poynor and WJ Hoskins. Clinicopathologic features of BRCA-linked and sporadic ovarian cancer. Jama 2000, 283(17): 2260-2265. [81] H Aida, K Takakuwa, H Nagata, I Ts uneki, M Takano, S Tsuji, T Takahashi, T Sonoda, M Hatae, K Takahashi, K Hasegawa, H Mizunuma, N Toyoda, H Kamata, Y Torii, N Saito, K Tanaka, M Yakushiji, T Araki and K Tanaka. Clinical features of ovarian cancer in Japanese women with germ-line mutations of BRCA1. Clin Cancer Res 1998, 4(1): 235-240. [82] OT Johannsson, J Ranstam, A Borg a nd H Olsson. Survival of BRCA1 breast and ovarian cancer patients: a population-base d study from southern Sweden. J Clin Oncol 1998, 16(2): 397-404. [83] PD Pharoah, DF Easton, DL Stockton, S Gayther and BA Ponder. Survival in familial, BRCA1-associated, and BRCA2-asso ciated epithelial ovarian cancer. United Kingdom Coordinating Committee for Cancer Research (UKCCCR) Familial Ovarian Cancer Study Group. Cancer Res 1999, 59(4): 868-871. [84] SJ Ramus, A Fishman, PD Pharoa h, S Yarkoni, M Altaras and BA Ponder. Ovarian cancer survival in Ashkenazi Je wish patients with BRCA1 and BRCA2 mutations. Eur J Surg Oncol 2001, 27(3): 278-281. [85] I Cass, RL Baldwin, T Varkey, R Mosl ehi, SA Narod and BY Karlan. Improved survival in women with BRCA-associ ated ovarian carcinoma. Cancer 2003, 97(9): 2187-2195. [86] Y Ben David, A Chetrit, G Hirsh-Yech ezkel, E Friedman, BD Beck, U Beller, G Ben-Baruch, A Fishman, H Levavi, F Lubi n, J Menczer, B Piura, JP Struewing and B Modan. Effect of BRCA mutations on the length of survival in epithelial ovarian tumors. J Clin Oncol 2002, 20(2): 463-466. [87] P Tassone, P Tagliaferri, A Perricelli, S Blotta, B Quaresima, ML Martelli, A Goel, V Barbieri, F Costanzo, CR Bo land and S Venuta. BRCA1 expression

PAGE 116

102 modulates chemosensitivity of BRCA1 -defective HCC1937 hu man breast cancer cells. Br J Cancer 2003, 88(8): 1285-1291. [88] V Sylvain, S Lafarge and YJ Bignon. Dominant-negative act ivity of a Brca1 truncation mutant: effects on prolifer ation, tumorigenicity in vivo, and chemosensitivity in a mouse ovarian cancer cell line. Int J Oncol 2002, 20(4): 845-853. [89] NC Johnson, HC Dan, JQ Cheng and PA Kruk. BRCA1 185delAG mutation inhibits Akt-dependent, IAP-mediated cas pase 3 inactivation in human ovarian surface epithelial cells. E xp Cell Res 2004, 298(1): 9-16. [90] NC Johnson and PA Kruk. BRCA1 Zinc RING Finger Domain Disruption Alters Caspase Response in Ovarian Surface Epith elial Cells. Cancer Cell Int 2002, 2(1): 7. [91] A Saraste and K Pulkki. Morphologic and biochemical hallmarks of apoptosis. Cardiovasc Res 2000, 45(3): 528-537. [92] M Leist and M Jaattela. Four deaths and a funeral: from caspases to alternative mechanisms. Nat Rev Mol Cell Biol 2001, 2(8): 589-598. [93] P Fuentes-Prior and GS Salvesen. Th e protein structures that shape caspase activity, specificity, acti vation and inhibition. Bioc hem J 2004, 384(Pt 2): 201232. [94] S Launay, O Hermine, M Fontenay, G Kroemer, E Solary and C Garrido. Vital functions for lethal caspases. Oncogene 2005, 24(33): 5137-5148. [95] JC Timmer and GS Salvesen. Caspas e substrates. Cell Death Differ 2007, 14(1): 66-72. [96] JM Adams. Ways of dying: multiple pathways to apoptosis. Genes Dev 2003, 17(20): 2481-2495. [97] Y Shi. Mechanical aspects of a poptosome assembly. Curr Opin Cell Biol 2006, 18(6): 677-684. [98] DW Nicholson. Apoptosis. Baiting death inhibitors. Nature 2001, 410(6824): 3334. [99] IN Lavrik, A Golks and PH Kramme r. Caspases: pharmacological manipulation of cell death. J Clin Invest 2005, 115(10): 2665-2672.

PAGE 117

103 [100] SB Bratton, G Walker, SM Srinivasula, XM Sun, M Butterworth, ES Alnemri and GM Cohen. Recruitment, activation and rete ntion of caspases-9 and -3 by Apaf-1 apoptosome and associated XIAP complexes. Embo J 2001, 20(5): 998-1009. [101] A Saleh, SM Srinivasula, S Acharya, R Fishel and ES Alnemri. Cytochrome c and dATP-mediated oligomerizati on of Apaf-1 is a prerequisite for procaspase-9 activation. J Biol Ch em 1999, 274(25): 17941-17945. [102] JM Adams and S Cory. The Bcl-2 apoptotic switch in cancer development and therapy. Oncogene 2007, 26(9): 1324-1337. [103] YF Fu and TJ Fan. Bcl-2 family prot eins and apoptosis. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (S hanghai) 2002, 34(4): 389-394. [104] JM Adams and S Cory. Apoptosomes: engines for caspase activation. Curr Opin Cell Biol 2002, 14(6): 715-720. [105] MG Hinds and CL Day. Regulation of apoptosis: uncovering the binding determinants. Curr Opin St ruct Biol 2005, 15(6): 690-699. [106] S Cory, DC Huang and JM Adams. The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 2003, 22(53): 8590-8607. [107] CX Lu, TJ Fan, GB Hu and RS Cong Apoptosis-inducing factor and apoptosis. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 2003, 35(10): 881885. [108] EH Cheng, MC Wei, S Weiler, RA Flavell, TW Mak, T Lindsten and SJ Korsmeyer. BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAXand BAK-mediated mitochondrial apoptosis. Mol Cell 2001, 8(3): 705-711. [109] WX Zong, T Lindsten, AJ Ross, GR MacGregor and CB Thompson. BH3-only proteins that bind pro-surv ival Bcl-2 family members fail to induce apoptosis in the absence of Bax and Ba k. Genes Dev 2001, 15(12): 1481-1486. [110] CS Duckett, VE Nava, RW Gedrich, RJ Clem, JL Van Dongen, MC Gilfillan, H Shiels, JM Hardwick and CB Thompson. A co nserved family of cellular genes related to the baculovirus iap gene and encoding a poptosis inhibitors. Embo J 1996, 15(11): 2685-2694. [111] P Liston, N Roy, K Tamai, C Lefebvre, S Baird, G ChertonHorvat, R Farahani, M McLean, JE Ikeda, A MacKenzie and RG Korneluk. Suppression of apoptosis in mammalian cells by NAIP and a relate d family of IAP genes. Nature 1996, 379(6563): 349-353.

PAGE 118

104 [112] E Rajcan-Separovic, P Liston, C Le febvre and RG Korneluk. Assignment of human inhibitor of apoptosis protein (IA P) genes xiap, hiap -1, and hiap-2 to chromosomes Xq25 and 11q22-q23 by fluores cence in situ hybridization. Genomics 1996, 37(3): 404-406. [113] M Lagace, JY Xuan, SS Young, C McRobe rts, J Maier, E Rajcan-Separovic and RG Korneluk. Genomic organization of th e X-linked inhibitor of apoptosis and identification of a novel testis-specifi c transcript. Geno mics 2001, 77(3): 181-188. [114] G Ambrosini, C Adida and DC Altieri. A novel anti-apoptosis gene, survivin, expressed in cancer and lympho ma. Nat Med 1997, 3(8): 917-921. [115] GM Kasof and BC Gomes. Livin, a novel inhibitor of apoptosis protein family member. J Biol Chem 2001, 276(5): 3238-3246. [116] Y Yang, S Fang, JP Jensen, AM Weissman and JD Ashwell. Ubiquitin protein ligase activity of IAPs and their degrad ation in proteasomes in response to apoptotic stimuli. Science 2000, 288(5467): 874-877. [117] G Kroemer, L Galluzzi and C Brenner. Mitochondrial membrane permeabilization in cell death. Physiol Rev 2007, 87(1): 99-163. [118] BP Eckelman, GS Salvesen and FL Sco tt. Human inhibitor of apoptosis proteins: why XIAP is the black sheep of th e family. EMBO Rep 2006, 7(10): 988-994. [119] N Jiang, Y Meng, S Zhang, E Mensah-Osman and S Sheng. Maspin sensitizes breast carcinoma cells to induced ap optosis. Oncogene 2002, 21(26): 4089-4098. [120] K Latha, W Zhang, N Cella, HY Shi a nd M Zhang. Maspin mediates increased tumor cell apoptosis upon induction of the mitochondrial permeability transition. Mol Cell Biol 2005, 25(5): 1737-1748. [121] Z Zou, A Anisowicz, MJ Hendrix, A T hor, M Neveu, S Sheng, K Rafidi, E Seftor and R Sager. Maspin, a serpin with tumor-suppressing activity in human mammary epithelial cells. Science 1994, 263(5146): 526-529. [122] S Sheng, J Carey, EA Seftor, L Dias, MJ Hendrix and R Sager. Maspin acts at the cell membrane to inhibit invasion and mo tility of mammary and prostatic cancer cells. Proc Natl Acad Sci U S A 1996, 93(21): 11669-11674. [123] BW Futscher, MM Oshiro, RJ Wozniak, N Holtan, CL Hanigan, H Duan and FE Domann. Role for DNA methylation in the control of cell type specific maspin expression. Nat Genet 2002, 31(2): 175-179.

PAGE 119

105 [124] M Zhang, N Maass, D Magit and R Sa ger. Transactivation through Ets and Ap1 transcription sites determ ines the expression of the tumor-suppressing gene maspin. Cell Growth Differ 1997, 8(2): 179-186. [125] M Zhang, O Volpert, YH Shi and N Bouc k. Maspin is an angiogenesis inhibitor. Nat Med 2000, 6(2): 196-199. [126] ML Cher, HR Biliran, Jr., S Bhagat, Y Meng, M Che, J Lockett, J Abrams, R Fridman, M Zachareas and S Sheng. Maspin expression inhibits osteolysis, tumor growth, and angiogenesis in a model of pr ostate cancer bone metastasis. Proc Natl Acad Sci U S A 2003, 100(13): 7847-7852. [127] RE Seftor, EA Seftor, S Sheng, PA Pemberton, R Sager and MJ Hendrix. maspin suppresses the invasive phe notype of human breast carcinoma. Cancer Res 1998, 58(24): 5681-5685. [128] VA Odero-Marah, Z Khalkhali-Ellis J Chunthapong, S Amir, RE Seftor, EA Seftor and MJ Hendrix. Maspin regulate s different signaling pathways for motility and adhesion in aggressive br east cancer cells. Cancer Biol Ther 2003, 2(4): 398-403. [129] BJ Nickoloff, MW Lingen, BD Ch ang, M Shen, M Swift, J Curry, P Bacon, B Bodner and IB Roninson. Tumor suppressor maspin is up-regulated during keratinocyte senescence, exerting a paracr ine antiangiogenic activity. Cancer Res 2004, 64(9): 2956-2961. [130] M Zhang, Y Shi, D Magit, PA Furth and R Sager. Reduced mammary tumor progression in WAP-TAg/WAP-maspin bitransgenic mice. Oncogene 2000, 19(52): 6053-6058. [131] M Zhang, S Sheng, N Maass and R Sa ger. mMaspin: the mouse homolog of a human tumor suppressor gene inhibits mammary tumor invasion and motility. Mol Med 1997, 3(1): 49-59. [132] S Sugimoto, N Maass, Y Takimoto, K Sato, S Minei, M Zhang, Y Hoshikawa, KP Junemann, W Jonat and K Nagasaki. E xpression and regulation of tumor suppressor gene maspin in human bl adder cancer. Cancer Lett 2004, 203(2): 209215. [133] SL Rose, MP Fitzgerald, NO White, MJ Hitchler, BW Futscher, K De Geest and FE Domann. Epigenetic regulation of maspin expression in human ovarian carcinoma cells. Gynecol Oncol 2006, 102(2): 319-324.

PAGE 120

106 [134] C Ngamkitidechakul, JM Burke, WJ O'Brien and SS Twining. Maspin: synthesis by human cornea and regulation of in vitr o stromal cell adhesion to extracellular matrix. Invest Ophthalmol Vis Sci 2001, 42(13): 3135-3141. [135] M Bettstetter, M Woenckhaus, PJ W ild, P Rummele, H Blaszyk, A Hartmann, F Hofstadter and W Dietmaier. Elevated nuc lear maspin expression is associated with microsatellite instability and high tum our grade in colorectal cancer. J Pathol 2005, 205(5): 606-614. [136] P Surowiak, V Materna, M Drag -Zalesinska, A Wojnar, I Kaplenko, M Spaczynski, M Dietel, M Zabe l and H Lage. Maspin expression is characteristic for cisplatin-sensitiv e ovarian cancer cells and for ovarian cancer cases of longer survival rates. Int J Gyne col Pathol 2006, 25(2): 131-139. [137] N Sato, N Fukushima, H Matsubayashi and M Goggins. Identification of maspin and S100P as novel hypomethylation target s in pancreatic cancer using global gene expression profiling. Oncogene 2004, 23(8): 1531-1538. [138] S Ogasawara, C Maesawa, M Yamamo to, Y Akiyama, K Wada, K Fujisawa, T Higuchi, Y Tomisawa, N Sato, S Endo, K Sa ito and T Masuda. Disruption of celltype-specific methylation at the Maspin ge ne promoter is frequently involved in undifferentiated thyroid cancers. Oncogene 2004, 23(5): 1117-1124. [139] C Maesawa, S Ogasawara, A Yashim a-Abo, T Kimura, K Kotani, S Masuda, Y Nagata, T Iwaya, K Suzuki, T Oyake, Y Akiyama, H Kawamura and T Masuda. Aberrant maspin expression in gallbladder epithelium is associated with intestinal metaplasia in patients with cholelithi asis. J Clin Pathol 2006, 59(3): 328-330. [140] C Boltze, R Schneider-Stock, C Que dnow, R Hinze, C Mawrin, A Hribaschek, A Roessner and C Hoang-Vu. Silencing of the maspin gene by promoter hypermethylation in thyroid cancer. Int J Mol Med 2003, 12(4): 479-484. [141] AK Sood, MS Fletcher, LM Gruman, JE Coffin, S Jabbari, Z Khalkhali-Ellis, N Arbour, EA Seftor and MJ Hendrix. The pa radoxical expression of maspin in ovarian carcinoma. Clin Cancer Res 2002, 8(9): 2924-2932. [142] MM Abd El-Wahed. Expression and subcel lular localization of maspin in human ovarian epithelial neoplasms: correlation wi th clinicopathologic features. J Egypt Natl Canc Inst 2005, 17(3): 173-183. [143] AA Secord, PS Lee, KM Darcy, LJ Havrilesky, LA Grace, JR Marks and A Berchuck. Maspin expression in epithelial ovarian cancer and associations with poor prognosis: a Gynecologic Onco logy Group study. Gynecol Oncol 2006, 101(3): 390-397.

PAGE 121

107 [144] LA Solomon, AR Munkarah, VL Schim p, MH Arabi, RT Morris, H Nassar and R Ali-Fehmi. Maspin expression and lo calization impact on angiogenesis and prognosis in ovarian cancer. G ynecol Oncol 2006, 101(3): 385-389. [145] M Zhang, D Magit and R Sager. Expre ssion of maspin in prostate cells is regulated by a positive ets element and a negative hormonal responsive element site recognized by androgen receptor. Proc Natl Acad Sci U S A 1997, 94(11): 5673-5678. [146] Z Zou, C Gao, AK Nagaich, T Connell, S Saito, JW Moul, P Seth, E Appella and S Srivastava. p53 regulates the expression of the tumor suppressor gene maspin. J Biol Chem 2000, 275(9): 6051-6054. [147] K Spiesbach, A Tannapfel, J Mossner and K Engeland. TAp63gamma can substitute for p53 in inducing expression of the maspin tumo r suppressor. Int J Cancer 2005, 114(4): 555-562. [148] Z Khalkhali-Ellis, AL Christian, DA Kirschmann, EM Edwards, M RezaieThompson, MA Vasef, LM Gruman, RE Seftor, LE Norwood and MJ Hendrix. Regulating the tumor suppressor gene masp in in breast cancer cells: a potential mechanism for the anticancer propertie s of tamoxifen. Clin Cancer Res 2004, 10(2): 449-454. [149] Z Liu, HY Shi, Z Nawaz and M Zhang. Tamoxifen induces the expression of maspin through estrogen receptor-alpha. Cancer Lett 2004, 209(1): 55-65. [150] FE Domann, JC Rice, MJ Hendrix and BW Futscher. Epigenetic silencing of maspin gene expression in human br east cancers. Int J Cancer 2000, 85(6): 805810. [151] JS Reis-Filho, B Torio, A Albergaria and FC Schmitt. Maspin expression in normal skin and usual cutaneous carcinomas. Virchows Arch 2002, 441(6): 551558. [152] Y Akiyama, C Maesawa, S Ogasawar a, M Terashima and T Masuda. Cell-typespecific repression of the maspin gene is disrupted frequently by demethylation at the promoter region in gastric intestinal metaplasia and cancer cells. Am J Pathol 2003, 163(5): 1911-1919. [153] N Sato, A Maitra, N Fukushima, NT van Heek, H Matsubayashi, CA IacobuzioDonahue, C Rosty and M Goggins. Frequent hypomethylation of multiple genes overexpressed in pancreatic ductal adenocarcinoma. Cancer Res 2003, 63(14): 4158-4166.

PAGE 122

108 [154] MA Bookman. Standard treatment in advanced ovarian cancer in 2005: the state of the art. Int J Gynecol Cancer 2005, 15 Suppl 3(212-220. [155] P Speiser. [Familial ovarian carcin oma]. Wien Med Wochenschr 1996, 146(1-2): 10-13. [156] R Angioli, R Estape, M Mason and M Pe nalver. Hereditary and sporadic ovarian cancer: genetic testing and c linical implications (rev iew). Int J Oncol 1998, 12(5): 1029-1034. [157] CI Szabo, LA Wagner, LV Francisc o, JC Roach, R Argonza, MC King and EA Ostrander. Human, canine and murine BRCA1 genes: sequence comparison among species. Hum Mol Genet 1996, 5(9): 1289-1298. [158] JE Quinn, RD Kennedy, PB Mullan, PM Gilmore, M Carty, PG Johnston and DP Harkin. BRCA1 functions as a differentia l modulator of chemotherapy-induced apoptosis. Cancer Res 2003, 63(19): 6221-6228. [159] DA Levine, MG Federici, VE Reuter and J Boyd. Cell proliferation and apoptosis in BRCA-associated hereditary ovarian cancer. Gynecol Oncol 2002, 85(3): 431434. [160] M Thangaraju, SH Kaufmann and FJ Couch. BRCA1 facilitates stress-induced apoptosis in breast and ovarian cance r cell lines. J Biol Chem 2000, 275(43): 33487-33496. [161] KA McEachern, WB Archey, K Douvill e and BA Arrick. BRCA1 splice variants exhibit overlapping and distin ct transcriptional transactivation activities. J Cell Biochem 2003, 89(1): 120-132. [162] CF Xu, MA Brown, JA Chambers, B Griffiths, H Nicolai and E Solomon. Distinct transcription start sites gene rate two forms of BRCA1 mRNA. Hum Mol Genet 1995, 4(12): 2259-2264. [163] M Munnes, S Fanaei, B Schmitz, I Muiz nieks, AM Holschneid er and W Doerfler. Familial form of hirschsprung disease: nucleotide sequence studies reveal point mutations in the RET proto-oncogene in two of six families but not in other candidate genes. Am J Med Genet 2000, 94(1): 19-27. [164] N Shao, YL Chai, E Shyam, P Reddy and VN Rao. Induction of apoptosis by the tumor suppressor protein BRC A1. Oncogene 1996, 13(1): 1-7. [165] TI Orban and E Olah. Emerging roles of BRCA1 alternative splicing. Mol Pathol 2003, 56(4): 191-197.

PAGE 123

109 [166] YL Yang and XM Li. The IAP family : endogenous caspase inhibitors with multiple biological activities. Cell Res 2000, 10(3): 169-177. [167] PA Kruk, AK Godwin, TC Hamilton a nd N Auersperg. Telomeric instability and reduced proliferative potentia l in ovarian surface epithelia l cells from women with a family history of ovarian cance r. Gynecol Oncol 1999, 73(2): 229-236. [168] M Takakura, S Kyo, T Kanaya, H Hirano, J Takeda, M Yutsudo and M Inoue. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cance r cells. Cancer Res 1999, 59(3): 551-557. [169] SV Nicosia, GD Wilbanks, B Saunders, J Mayer, RJ Cardosi, PA Kruk, J Cheng, W Bai, D Coppola and J Fiorica. Cytology of human ovarian surface epithelial brushings. Cancer 2004, 102(1): 1-10. [170] P Correc, MC Fondaneche, M Bracke and P Burtin. The presence of plasmin receptors on three mammary carcinoma MCF-7 sublines. Int J Cancer 1990, 46(4): 745-750. [171] MY Alfonso-De Matte, JQ Cheng a nd PA Kruk. Ultraviole t irradiationand dimethyl sulfoxide-induced telomerase act ivity in ovarian ep ithelial cell lines. Exp Cell Res 2001, 267(1): 13-27. [172] GA Ulaner, JF Hu, TH Vu, LC Giudi ce and AR Hoffman. Telomerase activity in human development is regulated by huma n telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res 1998, 58(18): 4168-4172. [173] N Auersperg, SL Maines-Bandiera, HG Dyck and PA Kruk. Characterization of cultured human ovarian surface epithe lial cells: phenotypic plasticity and premalignant changes. Lab Invest 1994, 71(4): 510-518. [174] JW Shay and S Bacchetti. A survey of telomerase activity in human cancer. Eur J Cancer 1997, 33(5): 787-791. [175] BB Wolf, M Schuler, F Echeverri an d DR Green. Caspase-3 is the primary activator of apoptotic DNA fragmentat ion via DNA fragmentation factor45/inhibitor of caspa se-activated DNase inactivation. J Biol Chem 1999, 274(43): 30651-30656. [176] FJ Oliver, G de la Rubia, V Rolli, MC Ruiz-Ruiz, G de Murcia and JM Murcia. Importance of poly(ADP-ribose) polymerase and its cleavage in apoptosis. Lesson from an uncleavable mutant. J Biol Chem 1998, 273(50): 33533-33539.

PAGE 124

110 [177] MA Brown, H Nicolai, K Howe, T Katagiri, N La lani el, KJ Simpson, NW Manning, A Deans, P Chen, KK Khanna, MR Wati, BL Griffiths, CF Xu, GW Stamp and E Solomon. Expression of a trunc ated Brca1 protein delays lactational mammary development in transgenic mice. Transgenic Res 2002, 11(5): 467-478. [178] S Fan, R Yuan, YX Ma, Q Meng, ID Go ldberg and EM Rosen. Mutant BRCA1 genes antagonize phenotype of w ild-type BRCA1. Oncogene 2001, 20(57): 82158235. [179] L Perrin-Vidoz, OM Sinilnikova, D Stoppa-Lyonnet, GM Lenoir and S Mazoyer. The nonsense-mediated mRNA decay pathway triggers degradation of most BRCA1 mRNAs bearing premature te rmination codons. Hum Mol Genet 2002, 11(23): 2805-2814. [180] M Sun, G Wang, JE Paciga, RI Feldma n, ZQ Yuan, XL Ma, SA Shelley, R Jove, PN Tsichlis, SV Nicosia and JQ Cheng. AKT1/PKBalpha kinase is frequently elevated in human cancers and its constitutive activation is required for oncogenic transformation in NIH3T3 cells. Am J Pathol 2001, 159(2): 431-437. [181] ZQ Yuan, M Sun, RI Feldman, G Wa ng, X Ma, C Jiang, D Coppola, SV Nicosia and JQ Cheng. Frequent activation of AKT2 and induction of apoptosis by inhibition of phosphoinositide-3-OH kinase/Akt pathway in human ovarian cancer. Oncogene 2000, 19(19): 2324-2330. [182] JA Crowell, VE Steele and JR Fay. Ta rgeting the AKT protein kinase for cancer chemoprevention. Mol Cancer Ther 2007, 6(8): 2139-2148. [183] J LoPiccolo, CA Granville, JJ Gills and PA Dennis. Targeting Akt in cancer therapy. Anticancer Drugs 2007, 18(8): 861-874. [184] CH Streuli. Maspin is a tumour supp ressor that inhibits breast cancer tumour metastasis in vivo. Breast Cancer Res 2002, 4(4): 137-140. [185] S Abraham, W Zhang, N Greenberg a nd M Zhang. Maspin functions as tumor suppressor by increasing cell adhesion to extracellular matrix in prostate tumor cells. J Urol 2003, 169(3): 1157-1161. [186] N Maass, T Hojo, M Ueding, J Luttg es, G Kloppel, W Jonat and K Nagasaki. Expression of the tumor suppressor gene Maspin in human pancreatic cancers. Clin Cancer Res 2001, 7(4): 812-817. [187] JD O'Donnell, NC Johnson, TD Turb eville, MY Alfonso and PA Kruk. BRCA1 185delAG Truncation Protein, BRAt, Amplif ies Caspase-Mediated Apoptosis in Ovarian Cells. In Vitro Cell Dev Biol Anim Submitted for review, January 2008,

PAGE 125

111 [188] M Dobbelstein and J Roth. The large T antigen of simian virus 40 binds and inactivates p53 but not p 73. J Gen Virol 1998, 79 (3079-3083. [189] H Yamaguchi, Y Ding, JF Lee, M Zh ang, A Pal, W Bornmann, DH Yan and MC Hung. Interferon-inducible protein IF IXalpha inhibits cell invasion by upregulating the metastasis suppressor maspin. Mol Carcinog 2008, E-pub ahead of print. [190] Z Khalkhali-Ellis. Ma spin: the new frontier. C lin Cancer Res 2006, 12(24): 72797283.

PAGE 126

ABOUT THE AUTHOR Joshua O’Donnell completed his undergrad uate studies at Southwest Missouri State University where he graduated with a B.S. degree in Cell and Molecular Biology and a minor in Chemistry. Joshua complete d a predoctoral fellowship in the Pediatric Oncology Education program at St. Jude Child ren’s Research Hospital before entering the Medical Science Ph.D program in the U SF College of Medicine in 2003. He was awarded with the Superior Presentation Award at the USF Health Research Day in 2005. He presented his research at the American Association for Cancer Research annual meeting in 2004, 2006, and 2007 and was one of tw o students from USF to be invited to the 2007 National Graduate Student Research Fes tival at the National Institutes of Health in Bethesda, MD. Joshua was also very ac tive with the Association of Medical Science Graduate Students, serving one year as secret ary and another year as president.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 002007612
003 fts
005 20090622143147.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 090622s2008 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002422
035
(OCoLC)405631125
040
FHM
c FHM
049
FHMM
090
RB37(Online)
1 100
O'Donnell, Joshua D.
0 245
BRCA1 185delAG mutant protein, BRAt, amplifies caspase-mediated apoptosis and maspin expression in ovarian cells
h [electronic resource] /
by Joshua D. O'Donnell.
260
[Tampa, Fla] :
b University of South Florida,
2008.
500
Title from PDF of title page.
Document formatted into pages; contains 111 pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
520
ABSTRACT: Ovarian cancer is a deadly disease that kills an estimated 15,000 women annually in the United States. It is estimated that approximately 10% of ovarian cancers are due to familial inheritance. The most commonly mutated genes in familial ovarian cancer are BRCA1 and BRCA2. It has been reported that cells carrying the BRCA1 185delAG mutation undergo an enhanced caspase-3 mediated apoptotic response. Here, we report on the transfection of cDNA coding for the putative truncated protein product of the BRCA1 185delAG mutant gene into BRCA1 wild-type human immortalized ovarian surface epithelial (IOSE) cells and ovarian cancer cells. Cells transfected with the BRCA1 185delAG truncation protein (BRAt) showed increased levels of active caspase 3, increased cleavage of caspase 3 substrates, PARP and DFF45, and decreased XIAP and cIAP1 following staurosporine (STS) treatment.BRAt also reduced Akt phosphorylation and over expression of activated Akt in BRAt cells restored caspase-3 activity to that seen in wild type cells. Further, BRAt expression increased chemosensitivity in platinum resistant ovarian cancer cells. Similarly, maspin protein has been shown to sensitize breast carcinoma cells to STS-induced apoptosis. We provide the first evidence that BRAt is sufficient to induce maspin protein in IOSE cells. IOSE cell lines carrying the BRCA1 185delAG mutation showed higher maspin levels than wild-type BRCA1 IOSE cell lines. BRCA1 wild-type IOSE cells were transfected with BRAt protein and showed increased maspin mRNA levels and increased nuclear maspin protein levels as compared to control cells. Additionally, both heterozygous carriers of the BRCA1 185delAG mutation and cells transfected with BRAt protein show an increased ability to activate the maspin promoter as compared to control cells.The transcription factor AP1 is at least partially required for full activation of the maspin promoter in BRAt cells, as siRNA directed towards c-jun decreased activation of the full-length maspin promoter. Taken together, our data demonstrate that truncated proteins arising from BRCA1 185delAG mutation increase Akt-mediated apoptosis by increasing nuclear maspin expression, suggesting a possible mechanism by which ovarian cancer patients with germline BRCA1 mutations may respond better to chemotherapy.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor: Patricia A. Kruk, Ph.D.
653
Ovarian cancer
Chemotherapy
Programmed cell death
Akt
Caspase 3
690
Dissertations, Academic
z USF
x Pathology and Cell Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2422