USF Libraries
USF Digital Collections

Rb-Raf-1 interaction as a therapeutic target for proliferative disorders

MISSING IMAGE

Material Information

Title:
Rb-Raf-1 interaction as a therapeutic target for proliferative disorders
Physical Description:
Book
Language:
English
Creator:
Kinkade, Rebecca
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Cancer
Tumor suppressor
Cell-cycle
Small-molecule
Inhibition
Dissertations, Academic -- Cancer Biology -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: The retinoblastoma tumor suppressor protein, Rb, is a key regulator of the mammalian cell cycle and its inactivation facilitates S-phase entry. Rb is inactivated through multiple waves of phosphorylation, mediated mainly by kinases associated with D and E type cyclins in the G1 phase of the cell cycle. Our earlier studies had shown that the signaling kinase Raf-1 (c-Raf) physically interacts with Rb upon growth factor stimulation and initiates the phosphorylation cascade. We had shown that an 8 amino acid peptide derived from Raf-1 could disrupt the Rb-Raf-1 interaction leading to an inhibition of Rb phosphorylation, cell proliferation and tumor growth in nude mice. Here, we describe a newly identified orally-active small molecule, RRD-251 (Rb - Raf-1 Disruptor 251), that disrupts potently and selectively the binding of Raf-1 to Rb; it had no effect on Rb-HDAC1, Rb-Prohibitin, Rb-Ask1, Rb-cyclin E, or Raf-1-Mek interactions.RRD-251 inhibited anchorage-dependent and -independent growth of human cancer cells; it could also potently inhibit angiogenesis both in vitro and in vivo. Oral or intra-peritoneal administration of RRD-251 resulted in a significant suppression of growth of tumors xenotransplanted into athymic nude mice; the tumor suppressive effects were restricted to tumors carrying a wild-type Rb gene. Thus, selective targeting of Rb-Raf-1 interaction appears to be a promising approach for developing novel anti-cancer agents. In addition to mitogens, tobacco components like NNK and nicotine can induce cell proliferation and angiogenesis, contributing to lung cancer. Induction of cell proliferation by tobacco components required the binding of Raf-1 to Rb and RRD-251 could prevent nicotine induced cell proliferation. Our studies also show how nicotine not only promotes tumor growth in vivo, it also increases chance of tumor recurrence and metastasis.In addition to growth factors and tobacco components, cytokines like TNF could induce Rb-Raf-1 interaction in vascular smooth muscle cells. Since TNF-induced proliferation of vascular smooth muscle cells contributes to growth of atherosclerotic plaques, RRD-251 could be beneficial in controlling atherosclerosis as well. Thus, it appears that drugs that can disrupt the Rb-Raf-1 interaction might have beneficial effects in a wide spectrum of human diseases.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Rebecca Kinkade.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 181 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001994142
oclc - 317394538
usfldc doi - E14-SFE0002426
usfldc handle - e14.2426
System ID:
SFS0026744:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Rb Raf 1 Interaction as a Therapeutic Target for Proliferative Disorders by Rebecca Kinkade A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cancer Biology College of Graduate School University of South Florida Major Professor: Srikumar Chellappan Ph.D. Said Sebti, Ph.D. W. Douglas Cress, Ph.D. Eric Haura, M.D. Scott Hiebert, Ph.D. Date of Approval: March 31, 2008 Keywords: cancer,tumor suppressor, cell cycle, small molecule, inhibition Copyright 2008 Rebecca Kinkade

PAGE 2

DEDICATION To my loving husband Christian Davis and my parents Barbara Kinkade and Gary Kinkade.

PAGE 3

ACKNOWLEDGMENTS I would like to sincerely thank my mentor, Dr. Srikumar Chellappan for his guidance. I have learned so much from you about science as well as the passion for great science, I will be forever grateful. You have trained me to think like an independent scientist and always supported my thoughts and ideas for new experiments. The patience and trust has given me the confidence to explore new methods in the laboratory. I would like to thank my committee members Drs Said Sebti, Eric Haura an d Douglas Cress. I appreciate the helpful discussions and guidance over the years. The encouragement as well as genuine interest has helped me reach my goals. I would especially like to thank Dr. Scott Hiebert for being so kind to serve as my external chai rperson at my defense. One of the most important aspects of this Cancer Biology program is the amazing people who serve their time to make sure this program remains outstanding. Dr. Wright, Dr. Cress and Cathy Gaffney have been instrumental in my success i n this program. My deepest gratitude to Dr. Piyali Dasgupta, Piyali shared with me the best ways to conduct good science and spent countless hours training me. I am so grateful for her excellent training at the bench. I would like to thank all my friends i n the lab who have supported me along the way.

PAGE 4

i TABLE OF CONTENTS LIST OF FIGURES v i 1 LIST OF ABBREVIATIONS ix ABSTRACT xi i Chapter 1: Introduction 1 1.Re tinoblast oma Tumor Suppressor Gene and Cell C ycle 1 1.1 Regulation of Cell C ycle by Rb 2 1.2 Rb Family M embers 5 1. 3 Rb Inactivation in C ancer 8 2. Downstream Effectors of Rb F unction 9 2.1 E2F Family of Transcription Factors and Cell C y cle R egul ation 9 2.2 Discovery of E2F and its F unction 10 2.3 E2F Family M embers 11 2.4 E2F Target G enes 15 2.4.1 Proliferative E2F Target G enes 15 2.4.2 Apoptotic E2F Target G enes 16 2.5 E2Fs in O ncogenesis 18 2.5.1 Genetic A lterations of E2F in C ancer 1 9 2.5.2 E2F Knockout S tudies 20 2.6 E2Fs Regulate A ngiogenesis 22

PAGE 5

ii 2.7 Targeting E2F Biology for Cancer T herapy 2 3 3. Upstream Regulators of Rb Function in P roliferation 25 3.1 Regulation of Rb by Growth Factor S timulation 2 6 3.1.1 Raf 1 K inase 30 3.1.2 Raf 1 in C ancer 3 3 3. 1.3 Regulation of Rb by Raf 1 3 4 3.1.4 Raf 1 as a Target for Cancer T herapy 3 6 3.1.5 Role of Rb Raf 1 Interaction in C ancer 3 7 3. 1.6 Disruption of the Rb Raf 1 I nteraction 40 3.2 Growth Factor Independent R egulation of Rb 4 3 3.2.1 Rb Inactivation upon Nicotine S timulation via nicotinic acetylcholine receptors (nAChRs) 4 3 4. Upstream regulators of Rb E2F function in apoptosis 4 7 4.1 ApoptoticSsignaling Pathways Regulate Rb F unction 4 7 5. Summary 51 Chapter 2: Materials and Methods 5 5 Chapter 3: An orally available small molecule disruptor of Rb Raf 1 interaction inhibits cell proliferation, angiogenesis and growth of human tumor xenografts in nude mice 70 Abstract 70 Introduction 71 Results 72

PAGE 6

iii GFGFK are the essential amino acids of the Raf 1 peptide for complete disruption of the Rb Raf 1 interaction 72 Identification of small molecule Rb Raf 1 disruptor, RRD 251 7 5 RRD 251 inhibits cell proliferation in a wide range of cell lines 7 7 Inhibition of prolifera tion by RRD 251 is dependent on Rb status 7 9 Melanoma and pancreatic cell lines are sensitive to RRD 251 81 RRD 251 displays high specificity for Rb Raf 1 interaction 8 8 RRD 251 is selec tiv e for Rb Raf 1 interaction 90 RRD 251 inhibits Rb phosphorylatio n independent of kinase inhibition 9 4 RRD 251 inhibits E2F transcriptional activity 9 6 RRD 251 inhibits angi ogenesis in vitro and in vivo 9 9 Antitumor activity of RRD 251 103 Tumor growth inhibitio n by RRD 251 is Rb dependent 10 9 Discussion 1 11

PAGE 7

iv Chapter 4: Nicotine promotes tumor growth and metastasis in mouse models of lung cancer 11 5 Abstract 11 5 Introduction 11 6 Results 1 23 Nicotine promotes the growth of tumors in mice 1 23 Nicotine promotes re growth and metastasis of tumors in mice 12 8 Nicotine enhance s the growth of tumors induced by tobacco carcinogens 1 30 Nicotine facilitates EMT like changes in lung cancers 1 33 Discussion 13 5 Chapter 5: TNF stimulates proliferative pathways in vascular smooth muscle cells 13 8 Abstract 13 8 Introduction 13 9 Results 14 2 TNF stimulates proliferation of vascular smooth muscle cells 1 4 2 TNF activates Raf/MAPK pathway is vascular smooth muscle cells 14 5 TNF induced AoSMC proliferation is abrogated by targeting upstream activators of Raf 1 14 7

PAGE 8

v TNF treatment indu ces E2F regulated genes involved in proliferation 14 9 TNF induced AoSMC proliferation involves Rb Raf 1 interaction 1 51 Discussion 1 53 Chapte r 6: Summary and Conclusions 15 6 References 15 9 About the Author end page End Page

PAGE 9

vi LIST OF FIGURES Figure 1. Cell cycle dependent regulation of Rb/E2F 4 Figure 2. Pocket protein family members 7 Figure 3. Domain structures of the E2F family 14 F igure 4. Ras signaling pathway 29 Figure 5. Domai n str uctures o f Raf kinase family 3 2 Figure 6. Colocalization of Raf 1 and Rb 3 5 Figure 7. Rb Raf 1 interaction is elevated in tumors 3 9 Figure 8. The penetratin Raf 1 conjugate can inhibit Rb Raf 1 interaction in intact cells 4 2 Figure 9. Nicotine stimulates Rb Raf 1 signaling 4 6 Figure 10. A model for the Rb/E2F pathway in cell proliferation and apoptosis in AoSMCs and HAECs upon T NF stimulation 50 Figure 11. S chematic for Rb Raf 1 signaling pathway 5 4 Figure 12. GFGFK pentapeptide is necessary for disruption of the Rb Raf 1 interaction 7 4 Figure 13. Identifi cation of Rb Raf 1 inhibitors 7 6 Figure 14. RRD 251 inhibits S phase entry 7 8 Figure 15. RRD 251 inhibits S phase entry dependent on Rb status 80 Figure 16. Melanoma cells are most sensitive to

PAGE 10

vii treatment with RRD 251 79 Figure 17. RRD 251 induces apoptosis in melanoma c ell lines 8 4 Figure 18. RRD 251 inhibits cell viability in PANC1 cancer cells 8 6 Figure 19. RRD 251 inhibits soft agar colony formation in sever al cancer cell lines 8 7 Figure 20. RRD 251 specifically targets R b Raf 1 in living cells 8 9 Figure 21. RRD 251 selectively targets Rb Raf 1 in living cells 91 Figure 22. RRD 251 inhi bits Rb Raf 1 co localization 9 3 Figure 23. RRD 251 doe s not inhibit kinase activity 9 5 Figure 24. RRD 251 inhibits E2F transcriptional activity 9 8 Fi gure 25. RRD 251 inhibits angiogenesis in vitro and in vivo 101 Figure 26. RRD 251 inhibi ts tumor growth in nude mice 10 5 Figure 27. Tumors treated with RRD 251 display a decrease in proliferative and angiogenic markers 10 7 Figure 28. RRD 251 disrupts R b Raf 1 interaction in xenograft tumors 10 8 Figure 29. Inhibition of tumor growth is dependent on a functional Rb protein 1 10 Figure 30. Rb Raf 1 interaction is elevated in NSCLC tumors 11 9 Figure 31. Schematic predicting the proliferative signaling by nAChRs in NSCLC cells 1 2 1 Figure 32. Nicotine (1 M) stimulates S phase entry in Line1 cells 12 4 Figure 33. Schematic for the experimental design of

PAGE 11

viii Line1 tumor growth 12 2 Figure 34. Nicotine promotes Line1 tumor growth 12 7 Figure 35. Nicotine inc reases metastatic potential 12 9 Figure 36. Schematic for NNK induced carcinogenesis experimental design 1 31 Figure 37. Nicotine (1 mg/kg) increases number and size of NNK induced lung tumors 1 32 Figure 38. Nicotine reduced expression of epithelial markers 13 4 Figure 39. TNF stimulates proliferation in vascular smooth muscle cells 1 44 Figure 40. TNF activates Raf/MAPK pathway in VSMCs 14 6 Figure 41. Targeting Raf 1 activation blocks AoSMC proliferation 14 8 Figure 42. TNF and PDGF induce E 2F regulated genes in AoSMCs 1 50 Figure 43. Inhibition of Rb Raf 1 interaction prevents AoSMC proliferation 1 52

PAGE 12

ix LIST OF ABBREVIATIONS Rb Retinoblastoma SV40 T Ag Simian virus 40 large tumor antigen E1A Early region 1A DP Dimerization partner HDAC1 Histone deacetylase 1 HP1 Heterochromatin protein 1 DNMT1 DNA (cytosine 5 ) methyltransferase 1 S CLC Small cell lung cancer NSCLC non small cell lung cancer Cdc2 Cell division cycle 2 Cdc25A Cell division cycle 25 homolog A HATs histone acetyltransferase TGF transforming growth factor ChIP Chromatin Immunoprecipitation BRCA1 breast ca ncer 1 early onset Bcl 2 B cell leukemia/lymphoma 2 Ask1 apoptosis signal regulating kinase 1 / knockout PcG polycomb group

PAGE 13

x APAF1 apoptotic peptidase activating factor Tg GFAP transgenic human glial fibrillary acidic protein promoter n number of samples MMP16 matrix metalloproteinase 16 VEGF vascular endothelial growth factor VEGFR vascular endothelial growth factor receptor FGFR Fibroblast growth factor receptor IL 8 interleukin 8 HIF1 hypoxia inducible factor 1 alpha ATM ataxia telangiectasia mutated ATR Ataxia telangiectasia mutated and rad3 related protein p 300/CREB cAMP response element binding protein G1 gap phase 1 G2 gap phase 2 EGFR epidermal growth factor receptor Erb2 avian erythroblastosis oncogene B PDGF platelet derived growth factor PDGFR platelet derived growth factor receptor Grb2 growth factor receptor bound protein 2 SOS son of sevenless GDP guanosine diphosphate GTP guanosine triphosphate nAC hRs Nicotinic acetylcholine receptors

PAGE 14

xi NNK 4 (methylnitrosamino) 1 (3 pyridyl) 1 butanone NNN N' nitrosonornicotine TNF Tumor necrosis factor alpha VSMC vascular smooth muscle cells HAEC human aortic endothelial cells HUVEC Human Umbilical Vei n Endothelial Cells EC endothelial cells ECM extra cellular matrix Pak p21 activated kinase JAK janus tyrosine kinase PECAM1 platelet endothelial cell adhesion molecule RKIP Raf 1 kinase inhibitor protein Mdr1 multi drug resistance gene 1 AML acute myelogenous leukemia kDa kilodalton nM nanomolar M micromolar

PAGE 15

xii Rb Raf 1 Interaction as a Therapeutic Target for Proliferative Disorders Rebecca Kinkade ABSTRACT The retinoblastoma tumor suppressor protein, Rb, is a key regulator of the mammalian cell cycle and its inactivation facilitates S phase entry. Rb is ina ctivated through multiple waves of phosphorylation, mediated mainly by kinases associated with D and E type cyclins in the G1 phase of the cell cycle. Our earlier studies had shown that the signaling kinase Raf 1 (c Raf) physically interacts with Rb upon g rowth factor stimulation and initiates the phosphorylation cascade. We had shown that an 8 amino acid peptide derived from Raf 1 could disrupt the Rb Raf 1 interaction leading to an inhibition of Rb phosphorylation, cell proliferation and tumor growth in n ude mice. Here, we describe a newly identified orally active small molecule, RRD 251 (Rb Raf 1 Disruptor 251), that disrupts potently and selectively the binding of Raf 1 to Rb; it had no effect on Rb HDAC1, Rb Prohibitin, Rb Ask1, Rb cyclin E, or Raf 1 Mek interactions. RRD 251 inhibited anchorage dependent and independent growth of human cancer cells; it could also potently inhibit angiogenesis both in vitro and in vivo Oral or intra peritoneal administration of RRD 251 resulted in a significant sup pression of growth of tumors xenotransplanted into athymic nude mice; the tumor suppressive effects were restricted to tumors carrying a wild type Rb gene.

PAGE 16

xiii Thus, selective targeting of Rb Raf 1 interaction appears to be a promising approach for developing novel anti cancer agents. In addition to mitogens, tobacco components like NNK and nicotine can induce cell proliferation and angiogenesis, contributing to lung cancer. Induction of cell proliferation by tobacco components required the binding of Raf 1 to Rb and RRD 251 could prevent nicotine induced cell proliferation. Our studies also show how nicotine not only promotes tumor growth in vivo it also increases chance of tumor recurrence and metastasis. In addition to growth factors and tobacco components, cytokines like TNF could induce Rb Raf 1 interaction in vascular smooth muscle cells. Since TNF induced proliferation of vascular smooth muscle cells contributes to growth of atherosclerotic plaques, RRD 251 could be beneficial in controlling atheroscle rosis as well. Thus, it appears that drugs that can disrupt the Rb Raf 1 interaction might have beneficial effects in a wide spectrum of human diseases.

PAGE 17

1 Chapter 1: Introduction 1. The retinoblastoma tumor suppressor gene and cell cycle While the presence of tumor suppressor genes have been realized for many years, the retinoblastoma tumor suppressor gene (RB) was the first to be identified and clon ed (1) Recognized as the first identified tumor suppressor gene, RB was identified based on studies on the inheritance pattern of retinoblastoma, which is a pediatric tumor of the eye. Retinoblastoma could be familial or sporadic; familial forms are bilateral and mutifocal while sporadic forms are unilateral (2) Based on these observations, Alfred Knudsen proposed th at hit same cell to initiate cancer (2) Sever al laboratories cloned the RB tumor suppressor gene in the late 1980s through positional cloning of minimally deleted chromosomal regions (1,3,4) Rb protein was found to be a 928 amino acid nuclear phospho protein that has no catalytic activity and very weak DNA binding activity (3) It was found that viral oncoproteins such as SV40 large T antigen, adenovirus E1A and human papilloma virus E7 are capable of binding to Rb and disrupting its tumor suppressive function (5 7) Mutants of such viral oncoproteins that could not bind to Rb could not transform cells; further, mutant Rb proteins found in tumors could not bind to the viral oncoproteins (5,7) These findings led

PAGE 18

2 to the hypothesis that binding of these viral oncoproteins caused an inactivation of the Rb protein equivalent to mutating its gene. This finding also revealed how viral oncoproteins can instigate tumor formation by inactivation of a tumor suppressor protein Rb (5,7) 1.1 Regulation of cell cycle by Rb Further studies showed that that there are many cellular proteins that bind to Rb and this allowed Rb to regulate a variety of cellular processes (8) Such proteins can be classified into two groups those that are upstream of Rb and regulate or affect Rb function and those that are downstream of Rb, facilitating Rb functions. The major downstream targets of Rb are those involved in transcrip tional control; these include the E2F family of transcription factors (9) E2F family members bind to DNA as heterodimers with DP proteins, DP1 or DP2 (Dimerization partner 1 or 2) (10) E2F DP complexes bind to the canonical sequence TTTCGCGC or its derivatives present on many cellular promoters and regulate the expression of genes involved in DNA repl ication, cell cycle progression and DNA repair (11 15) In quiescent cell (G 0 ) and early in G1, Rb remains hypo phosphorylated and is in its active state; this is when Rb is most efficient at bin ding and repressing E2F regulated genes (16) Mutant Rb proteins that are unable to bind to E2F cannot inhibit tr anscription (17) In response to mitogenic stimulation, Rb becomes increasingly phosphorylated, causing Rb to become less efficient at

PAGE 19

3 interacting with associated proteins such as E2F and co repressor molecules (18) Therefore, phosphorylation of Rb weakens its ability to repress transcription. The phosphorylation of Rb is catalyzed by cyclin/ cyclin dependent kinase (CDK) complexes (19 21) The cyclin/CDK complexes that phosphorylate Rb in G1 phase are cyclin D/CDK4/6 and cyclin E/cdk2. Mitogenic signaling (growth factor stimulation) leads to activation of cyclin/CDK complexes. Cyclin/CDK complexes in G1 efficiently phosphorylate Rb to completely inactivate its transcriptional repressor function, thus allowing expression of E2F target ge nes (22,23) E2F functions to activate genes that are essential for entry into S phase (24,25) Rb remains inactive throughout the remainder of the cell cycle. Mitotic cyclin s/CDK complexes CDK2/cyclin A and CDK1/cyclin B phosphorylate Rb and mediate the progression through the S/G2/M phases of the cell cycle (26) Rb phosphorylation is reversed by dephosphorylation, causing a transient reactivation. From anaphase to G1 protein phosphatase 1 ( PP1) dephosphorylates Rb in response to growth inhibitory signals (27,28) Under normal conditions, it is assumed that PP1 complexes contain PP1 regulatory proteins termed PNUTs (29) During hypoxic conditions or in the presence of chemotherapeutics, PNUTS were found to dissociate from PP1 and this led to the activation of PP1 towards Rb, causing an early dephosphorylation of Rb (29) T hese findings support that inactive and active Rb serves as a critical c ontroller of cell proliferation and growth suppression.

PAGE 20

4 Figure 1. Cell cycle dependent regulation of Rb/E2F Mitogenic signals stimulate the accumulation of cyclin dependent kinases and initiate phosphorylation of Rb in G1 phase of the cell cycle. Once Rb is inactivated though phosphorylation it releases E2F to induce S phase genes. Late in mitosis, Rb is dephosphorylated by protein phosphatase 1 (PP1).

PAGE 21

5 1.2 Rb family members Rb belongs to a family of three proteins, generally referred to as the (30) They are termed pocket proteins because of a shared domain called the pocket through which these proteins bind viral oncoproteins, cellular proteins and transcription factors. RB and p130 are found on chromosomes 13q 14 and 16p12.2, in which mutations are evident in cancer (31) The p107 gene has been mapped to chromosome 20q11.2, which is not frequently mutated in cancer (32) The pocket region of Rb family members contains two domains (A and B) separated by a spacer (S), which is different among the Rb proteins. Rb proteins also contain a C terminal domain that has been referred to as the C pocket and is involved in E2F binding (33) (Figure 2) The m ajority of Rb binding proteins interact with the A and B pocket domains. Most proteins that bind to Rb share a LXCXE motif; this is present in the three viral oncoproteins mentioned earlier as well as the D type cyclins and histone deacetylase ( HDAC ) Structurally and functionally, p107 and p130 are more related to each other than either is related to Rb p107 and p130 proteins also bind to E2Fs and their phosphorylation by cyclins and cdks results in dissociation of E2F and genes that regulate S phase (34) However, both p107 and p130 bind different E2Fs compared to Rb, and they reg ulate different E2F responsive genes (34) In addition, their expression pattern is unique from one another; Rb is expressed in both proliferating and non proliferating cells, p107 is

PAGE 22

6 predominantly expressed in proliferating cells and p130 is mainly expressed in arrested cells (34) Many years of research have suggested specific models for pocket protein E2F networks. It is thought that in G0 and early G1, p107 and p130 form repressor complexes in conjunction with E2F4 or E2F5 at most of the E2F responsive promoters. At the same time, Rb is thought to bind E2F1 3 either at or sequestered away from E2F responsive promoters (30) Pocket proteins are inactivated by phosphorylation in late G1 leading to the dissociation of E2Fs; at this time, E2Fs 4 and 5 are thought to translocate to the cytoplasm, allowing E2Fs1 3 to occupy the proliferative promoters. This binding of E2Fs independent of the pocket proteins facilitates the expression of genes needed for DNA synthesis and cells enter S phase. Thus the progression of cells from G1 to S phase is a stringently regula ted process that involves many vital components (30)

PAGE 23

7 Figure 2. The pocket family of proteins consists of Rb, p107 and p130. Homology lies within the pocket domain made up of regions A and B separated by a spacer. All three proteins contain the C terminal domain, the region where E2Fs bind. Arrows indicate the many regulatory phosphorylati on sites. Proteins containing the LXCXE mainly bind within the pocket region of these proteins.

PAGE 24

8 1.3 Rb inactivation in cancer inactivated by mutation in sporadic and inherited forms of retinoblastoma tumors (35) The most common mutations are point mutations, small deletions, or insertions in the gene, which results in frameshifts and premature termination of the protein product (35) It is rare for a gross deletion or rearrangement of the gene to occur (35) Inactivation of the Rb gene leads to oncogenesis, n ot only in eye tissue, but also in osteosarcoma, small cell lung cancer (SCLC), 20 30% of non small cell lung cancers (NSCLC) (36) prostate cancer, and breast cancer (37,38) Rb inactivation is required for the tumors to overcom e the Rb mediated oncoproteins like adenovirus E1a (7) human papilloma virus E7 (5) and SV40 large T antigen (6) Perturbations in the Rb pathway are present in almost all cancers, and several mechanisms have been identified for inactivating Rb. Over expression of cyclin D or CDK4 kinases from amplification, mutation, or chromosomal translocation can lead to enhanced Rb phosphorylation a nd poor prognosis (18,39 43) Also, loss or mutation in p16 INK4a (cdk inhibitor) can induce excessive CDK4/cyclin D activity and will lead to increased Rb phosphorylation and inactivation. Since p16 is responsible f or the control of cyclin D/cdk4 kinase activity, mutations or loss of p16 correlates with Rb activity and are often found in human cancers (37,44 47) Increased expression of cyclin E/cdk2 or reduced levels of the c dk inhibitor p27 Kip1 also give

PAGE 25

9 a poor prognosis in many cancers since these too will lead to increased Rb inactivation (18) Another common method for Rb inactivation in cancers is through viral oncoprotein E7 (5,48) The tumor promoting HPV contains at least two genes, E6 and E7 which encode for proteins that interfere with cell cycle regulation. E7 disrupts the cell cycle via its direct binding to Rb and other members of the retinoblastoma family (p107 and p130). The human papilloma virus 16 is found associated with approximate ly 50 percent of cervical carcinomas (5) 2. Downstream effectors of Rb function More than 100 proteins have been reported to bind to Rb. Rb interacts with kinases, phosphatases, transcriptional regulators, kinase regulators and various miscellaneous proteins (8) Althoug h there are several Rb targets reported in the literature, most of the attention has been focused on the E2F family of transcription factors (8 49, 50 ) 2.1 E2F Family of Transcription Factors and Cell Cycle Regul ation Each of the Rb family members bind to distinct members of the E2F family of transcription factors which regulate and drive cell cycle progression. A broad range of studies have revealed that Rb family members associate with a wide variety of transcri ption factors and chromatin remodeling enzymes to control gene expression, of which the E2F family of transcription factors are

PAGE 26

10 predominantly studied. Our studies are focused on the regulation of E2F by Rb and mechanisms to prevent cell cycle progression via inhibiting Rb inactivation. 2.2 Discovery of E2F and its function The m ammalian cell cycle is stringently regulated by growth stimulatory and inhibitory signals from the environment. The transcriptional activity of the E2F family of proteins can r espond appropriately to the wide array of signals the cell receives. E2F was originally discovered as a cellular activity that is required for the early region 1A (E1A) transforming protein of adenovirus to mediate transcription of the viral E2 promoter (51) Experiments later determined how E2F is regulated in normal cells, when Joe Nevins and colleagues determined that E2F i s inhibited by its association with the retinoblastoma protein, Rb (51 53) E2F family members are the key downstream targets of Rb and regulators of S phase entry (54) Rb can bind directly to the tra nsactivation domain of E2Fs and block their ability to activate transcription (55,56) and can recruit chromatin remodeling enzymes to repress E2F activity (57 59) Transcript ional repression by Rb is mediated through its various co repressors including HDAC1 (60,61) Brg1/Brm (62) HP1 (63) SuV39H (64) PcG proteins (65) and DNMT1 (66) but repression is not restrict ed to only these co repressors. E2F1 also induces the expression of the cyclin dependent kinase inhibitor p27, resulting in negative feedback regulation of E2F1 transcriptional activity through the inhibition of cyclin dependent kinase activity and Rb hypophosphorylation (67)

PAGE 27

11 In G0 and early G1, p107 and p130 bind E2F4 or E2F5 at most E2F responsive promoters to form a repressor complex (54) At the same time, Rb is thought to bind E2F1 3 either at the promoters or sequestered away from the promoters (30) In late G1, pocket proteins are phosphorylated causing them to dissociate from E2Fs. E2F4 and E2F5 relocate t o the cytoplasm, and the promoters are then occupied by E2Fs1 3. For most promoters the binding of E2F1 3 coincides with recruitment of histone acetyltransferases (HATs), leading to acetylation of histones at the promoters facilitating transcriptional acti vation (30,68) It is the activator E2Fs that interact with various HATs, whereas Rb recruits histone deacteylases (HDAC) and histone methyltransferases (69) Complexes of E2F family members with repressive pocket proteins are high in G0 and early G1 phases of the cell cycle; these complexes are disrupted in late G1 (30) This allows E2Fs to induce the transcription of genes required for S phase entry such as cyclin E (CCNE1), cyclin A, CDC2, CDC25A, p107, RB, c Myc, N Myc, B Myb, E2F1 and E2F2 (70 72) 2.3 E2F family members The E2F family of transcription factors is a large and continuousl y growing family of proteins, with the first member being cloned in 1992 (E2F1) till the recent identification of E2F8 in 2005, totaling 9 different proteins altogether (73) (Figure 3) E2Fs heterodimerize with Dime rization Partner protein 1 and 2 (DP1, DP2) for optimal transcriptional activity and all possible combinations of E2F DP

PAGE 28

12 complexes can exist in vivo (74) (10) It is the specific identity of E2F and the proteins involved in the complex that determines the transcriptional response The various E2F/DP complexes preferentiall y recognize the same nucleotide sequence TTTCCCGC, or variants thereof (75) E2F activity is interconnected through complexe s with any of the 9 E2Fs, 2 DP binding proteins (DP1 and DP2) and 3 pocket proteins (Rb, p130, p107) (76) E2Fs can be subdivided into three groups: the activating E2Fs, the passively repressing E2Fs and the actively repressing E2Fs. E2F1, E2F2 and E2F3a are the potent transcriptional activators that interact only with Rb and are expressed intermitten tly throughout the cell cycle (9) E2F4 and E2F5 are po or transcriptional activators and function as passive repressors by recruiting pocket proteins to the E2F regulated promoters (9) E2F4 interacts with all three pocket proteins yet E2F5 binds predominantly to p130 (30) The activator E2Fs are typically involved in promoting cell cycle progression and the repressor E2Fs function for cell cycle exit and differentiation (54) Unlike E2Fs 1 5, E 2F6 and E2F7 lack transactivation and pocket protein binding domains; they actively repress transcription independent of pocket proteins (77) Both the E2F6 and E2F7 loci produce several alternatively spliced mRNAs, which encode distinct protein isoforms (78) E2F6 can repress transcription through binding to polycomb group (PcG) proteins (79) ; however, mechanisms underlying repression by E2F7 are still unclear. E2F7 associates with promoters during S and G2 phase of the cell cycle suggest ing that it may function to repress E2F targets once they are expressed and have executed their

PAGE 29

13 functions (78) The newest identified member of the E2F family, E2F8, has transcriptional repressive functions similar to E2F7 (80) These specific interactions between E2F transcription factors and pocket proteins have suggested several models of the pocket protein E2F network. Once entry into S phase has occurred, E2F1 3 continue to bind and activate some promot ers whilst other promoters are bound by E2F1 3 only until G1 S transition, depending on the cellular function of the target gene (81) Certa in studies have suggested a preferential role for E2F3a, the predominant form of E2F3, in regulating S phase entry compared to other proliferative E2Fs. The activator E2Fs can als o overcome growth arrest signals such as TGF inhibitors (82) It should be mentioned that the activator E2Fs do not always promote S phase entry (70) The ability of E2F to induce S phase depends entirely on the cellular context and the nature of the signals.

PAGE 30

14 Figure 3. Domain structure of the E2F family. E2Fs 1 6 contain 1 DNA binding domain (DBD) and one DP dimerization domain (Dim ). Transactivation domai ns (blue) and binding sequences for pocket proteins are found only in E2Fs1 5. E2F1 3 have cyclin binding domains in their N terminal region (green). E2F7 and E2F8 have two DNA binding domains.

PAGE 31

15 2.4 E2F Target Genes A diverse set of potent ial E2F target genes have been identified, shedding light on the many cellular functions that can be regulated by E2Fs. The list of E2F target genes has been growing from studies including microarray analysis and Chromatin Immunoprecipitation (ChIP) assays (13,14,83 93) The known target genes are no longer restricted to those involved in G1/S progression and DNA replication, although they remain the best studied. 2.4.1 Proliferative E2F target genes E2F activit y regulate s a variety of genes required for entry into S phase. In accordance with its ability to activate S phase gene transcription, overexpre ssion of the E2F1 product drove quiescent cells into S phase (94) All three activating E2Fs are responsible for the expression of cyclin E and only E2F1 and E2F3 activate the expression of Cdc6 and p107 (95) Dihydrof olate reductase is involved in nucleotide synthesis and is preferentially targeted by E2F2, whereas E2F3 is the primary activator of cdk2, a G1/S cell cycle regulator (96) Both ribonucleotide reductase (RRN 1, 2) and cyclin A are activated by E2F1 and E2F2 (96) A set of G2 expressed genes regulated by E2F, namely, cyclin B1, cyclin A2, Cdc20, Bub1, and Importin 2 were discovered through DNA microarray analysis, along with several other tar gets involved in checkpoint regulation (86) Other groups have revealed new E2F target genes by microarray that are involved in DNA replication, such as DNA replication protein A2, MCM 2,

PAGE 32

16 3, 4, 5, 6, 7, and DNA poly merase (89) The repressive E2F4/p130 complex (97) regulates DNA repair enzymes such as BRCA1 and RAD51. 2.4.2 Apoptotic E2F target genes Certain E2Fs are also equipped with pro apoptotic functions to protect cells from undergoing abe rrant oncogenic transformation. E2F1 appears to be the crucial family member facilitating E2F dependent apoptosis (54) The role for E2F1 in apoptosis was confirmed by the observation that mice lacking E2F1 display a high incidence of tumors implicating a role in tumor suppression probably by promoting apoptosis (98,99) While in certain tissues like skin and liver, E2F1 overexpression can result in tumor formation (100,101) A d eficit in E2F1 can also impair the development of pituitary tumors in Rb +/ mice implying that E2F1 can play a tumor suppressive or oncogenic role depending on tissue type (102) Different mech anisms have been identified by which E2F 1 induces apoptosis and the picture is becoming clearer with passing years. Interestingly, E2F1 can induce apoptosis in p53 dependent and independent pathways. Ectopic expression of E2F1 induces p53 dependent apopto sis both in vitro and in vivo (101,103 105) through the transactivation of p19 ARF (106,107) and thus alleviation of MDM2 mediated degradation of p53 (106 109) In addition, E2F1 can induce the expression of p73 (110) Apaf 1 (111) caspases (112) and pro

PAGE 33

17 apoptotic BH3 only proteins of the Bcl 2 family (113) and thereby induces apoptosis through a p53 independe nt mechanism. Thus, pharmacologic activation of E2F1 mediated apoptosis in p53 deficient tumors can be explored to overcome the chemoresistance in these tumors. In addition to p53 and p73, a variety of cellula r proteins have been identified that ca n facilitate the induction of apoptosis by E2F1. E2 F1 downregulate s the expression of Mcl 1, an antiapoptotic member of the Bcl 2 family (114) E2F1 has also been shown to upregulate the expression of the pro apopto tic BH3 only proteins PUMA, Noxa, Bim, and Hrk/DP5 through a direct transcriptional mechanism leading to apoptosis (88,112,113,115,116) Expression of the E7 protein of HPV16, which disrupts Rb/E2F complexes also up regulates the expression of these four BH3 only proteins, implicating endogenous E2F in this phenomenon. Furthermore, increased Noxa and PUMA levels have been shown to mediate E2F1 induced apoptosis (113) HDAC inhibitors such as SAHA and Trichostatin A can promote E2F1 mediated apoptosis through the induction of the pro apoptotic Bcl2 family memb er Bim as well as ASK1, and this apoptosis does not require p53 or p73 (117) ; as a result ca ncer cells with deregulated E2F1 activit y are sensitive to HDAC inhibitor s. ASK1 induction contribute s to SAHA induced apoptosis through positive feedback regulation of E2F1 apoptotic activity (117)

PAGE 34

18 These studies highlight that E2F1 regulates the apoptotic machinery by activating a number of pro apoptotic genes. In addition to t hese studies it was found that depletion of E2F4 and not E2F1 could enhance apoptosis induced by chemotherapeutic drugs in human cancer cell lines, suggesting that E2F1 and E2F4 act in opposing manner s in drug induced apoptosis (118) Such studies and many more reveal the complex contributions of E2F family members to the biology of the cell and a panorama of apoptotic target genes that may be less characterized than the well understood cell cycle progression genes. 2.5 E2Fs in Oncogenesis The E2F family of transcription factors can execute opposing roles in activating or inhibiting cellular proliferation; this enables them to act as potential were the first to show that E2F is inhibited through its association with Rb (51 53) Nevins and colleagues also discovered that overexpression of E2F1 in cell culture could lead to proliferation (119) ; it was also found that E2F1 could transform cells in association with other oncogenes like Ras and c myc (119,120) Unlike Rb, E2F itself is rarely found to be mutated in cancers, altho ugh recent findings have discovered deregulated levels or mutations of E2F family members in certain types of cancers (121) Gene disruption studies in mice lacking E2F family members clearly demonstrated the complexity and opposing roles of the E2F family.

PAGE 35

19 2.5.1 Genetic Alterations of E2F in Can cer Most reviews on E2F family members conclude that there are not many known mutations in this family of transcription factors in human cancer, and this holds true for the most part (122) (123) At the same time there are some reports indicating genetic alterations of E2F genes in cancer (124) Among the E2F family members, it has been the E2F3 gene, located at chromosome 6p22, which is frequently amplified and overexpressed in certain types of cancers like retinoblastoma and transit ional cell carcinomas of the urinary bladder (125,126) In bladder cancer especially, E2F3 amplification is associated with a more malignant and invasive tumor (127,128) E2F 3 overexpression has been identified in prostate, ovarian, and non small cell carcinoma and also correlates with poor survival rates (129 132) There is also evidence that other E2F genes are involved in some cancer s. The E2F5 gene is amplified in some breast cancers often along with c myc and or c mos amplification (133) It has also been reported that E2F4 is also mutated in a number of stomach and colon cancers (134 137) In addition, E2F4 protein levels are often elevated in colon cancers and th is is associated with low levels of apoptosis (134) Moreover, deregulated E2F1 (transgenic mice engineered to express E2F1 in Glial cells; tg GFAP E2F1) activity in the brain increases the onset of multilineage brain tumors in mice old and young; this demonstrates that E2F1 functions specifically as an oncogene in mouse brain tissue (138)

PAGE 36

20 The amplification of E2F1 in cancer cell lines has been examined thoroughly, it has been demonstrated in esophageal, colorectal, ovarian, melanoma and lymph node metastasis of melanoma (139 144) High expression of E2F1 E2F2 and E2F8 were linked to ovarian cancer cell lines (n=77) and also correlated with histopathologic grade 3 ovarian tumors (145) The c linical relevance of E2F family members was assessed in ovarian cancers to predict if E2Fs provide resistance to chemotherapy with platinum based drugs. Low expression of activating E2F1 or E2F2 and high expression of inhibiting E2F4 or E2F7 was associated with favorable disease free and overall survival of patients who had undergone surgery (145) Platinum resistant tumors were associated with lower E2F4 and E2F7 expression when compared to platinum sensitive tumors indicating that their downregulation could be contributing to mechanisms underlying platinum resistance (145) High levels of E2F1 in cancers of the lung, breast and pancreas correlate with poorer outcome (76) Conversely, it is reduced E2F1 expression in colon cancer, bladder cancer and diffuse large B cell lymphoma that correlates with a mo re aggressive disease (76) Even though there are plenty of studies that link E2F expression with cancer, it is mainly alterations in the Rb E2F pathway that are common in all types of cancers. 2.5.2 E2F knockout studies Studies on E2F1 null mice provided novel insights into the opposing roles of E2F1 in oncogenesis and tumor suppression (99) E2F1 / mice are viable and

PAGE 37

21 fertile except, as they age these mice exhibit hyperplasia and neoplasia (98,99) As the mice age, a broad range of tumors was seen, including lymp homas, sarcomas of the reproductive tract and lung tumors (99) E2F2 / mice die early due to autoimmune disease with splenomegaly, multiorgan inflammatory infiltrates, glomerulonephritis, and serum anti DNA antibod ies (146) The loss of E2F1 and E2F2 in mice results in tumor formation, primarily hematopoetic malignancies (147) Studies in E2F3 knockout mice revealed that although these mice die prematurely the mice that do survive are significantly growth retarded. E2F3 / mice have no obvious signs of tumor formation; instead they have the typical signs of congestive heart failure (148) A loss of both E2F1 and E2F3 did not increase the tumor incidence therefore demonstrating that it is E2F1 that has the tumor suppressive functions and not E2F3 (148) Mice lacking E2F4 surprisingly show no abnormalities i n cell proliferation or cell cycle arrest; however, E2F4 was essential for normal development of the mouse. Mice lacking E2F4 have several developmental defects including a craniofacial abnormality (149,150) Knocko ut studies on E2F5 revealed that it was also not essential for proliferation; instead E2F5 was required in differentiated neural tissue, as these mice developed hydrocephalus at 7 weeks of age (151) Mice lacking E2F6 are viable and healthy, they only display skeletal transformations, these mice display posterior homeotic transformations of the axial skeleton, which is very similar to what is observed in mice lacking PcG proteins, which is consistent with the ability of E2F6 to associate with PcG proteins (79) The phenoty pe of knockout E2F7

PAGE 38

22 and E2F8 have yet to be published. It can be concluded that mice lacking repressive E2Fs have developmental defects but are not predisposed to developing tumors. Oddly enough, tumor suppressive activity is associated with the E2Fs that are activators of transcription and promoters of proliferation. 2.6 E2Fs regulate Angiogenesis While a role for E2Fs in c ell proliferation and apoptosis is well established, their role in angiogenesis is less clear. Recent studies raise the possibility that E2Fs might be contributing to the growth and progression of tumors by affecting angiogenesis. Overexpression of E2F1 i s associated with increased tumor cell invasiveness and metastatic progression (152,153) Many E2F1 target genes include genes involved in angiogenesis such as bFGF, metalloproteinase 16 (MMP16) and VEGF B through a direct or indirect transcriptional regulation of the promoters (154) Several ge nes whose expression is regulated by VEGF contain E2F bind ing sites in their promoter. H uman metallothionein 1G (hMT1G) is involved in metal metabolism and r egulation of angiogenesis. Stimulation of cells with VEGF led to a dissociation of Rb, p130 and p1 07 and an increase in activator E2Fs on this promoter (155) In other studies, E2F1, E2F2 and E2F3 can activate the fibroblast growth factor receptor 2 (FGFR 2) promoter that is involved in angiogenesis (156) These findings raise the possibility that even though E2F genes by themselves are seldom mutated in cancers, E2Fs can promote the growth of solid tumors by promoting angiogenesis.

PAGE 39

23 2.7 Targeting E2F biology for cancer therapy In certain circumstances, either an increase or decrease in E2F1 activity can inhibit tumor development; although this is entirely context dependent there is great potential for the design of cancer therapies targeting E2F1. Recombinant aden ovirus E2F1 has been shown to kill human tumor cells in vitro and in nude mouse models (157 162) Since deregulated E2F activity appears to be a common event in various malignancies, these treatments would have the potential to reach a broad range of cancers. It is important to note that E2F activity has been shown to influence chemotherapeutic response (163) It can b e assumed that when E2F upregulates p73 and APAF 1, this could sensitize cells to other pro apoptotic signals from DNA damaging agents (110) A key target for therapy could be the downstream targets in E2F1 induced apoptosis. It can be imagined that chemotherapeutic agents that are most active in S phase could benefit from E2F activity to induce cell death. Agents such as 5 flurouracil and hydroxyurea that target E2F responsive genes thymidylate synthase and ribonucleotide reductase respectively, would benefit from forced expression of E2F (164,165) Experiments with E2F1 transient transfection have been shown to enhance the efficacy of etoposide, camptothecin, and adriamycin (166) Induction of DNA damage leads to E2F1 protein stability t hrough several mechanisms, including phosphorylation by the ataxia telangiectasia mutated (ATM) kinase, the ATM and RAD3 related (ATR) and the Chk2 kinase. E2F1

PAGE 40

24 stability is also mediated by acetylation through p300/CREB binding protein factor (P/CAF). The common deregulation of Rb/E2F pathway in human cancers suggest that E2F1 plays an important role in tumor cells sensitivity to DNA damage induced cell death. In the same context, loss of E2F1 is protective and anti apoptotic. The important question is how E2Fs can be targeted to induce apoptosis in cancer cells without inducing cell proliferation and tumor growth. Since the absence of all three activating E2Fs leads to abroga tion in cellular proliferation and mouse development (167) it appears that targeting any one of the activating E2Fs or all of them would be a viable mechanism to shut down tumor cell proliferation. Studies from the Harlow lab demonstrated how dominant negative mutants of DP1 that can prevent DNA binding and transcriptional regulation by E2F leading to cell cycle arrest in G1 (168) These studies and others collectively suppor t the idea that inhibiting E2F with small molecules would inhibit cellular proliferation. Introduction of peptides into human cells that functionally antagonize E2F DNA binding activity resulted in rapid onset of apoptosis (169) In another setting, peptides that bound to the DNA binding domain of E2F and bl ocked its association with DP1 resulted in a G1 block in mammalian fibroblasts (170) Although these experiments clearly indicate that blocking E2F DNA binding activity could inhibit cell proliferation and sometimes cause apoptosis, it

PAGE 41

25 is not clear how inhibiting this interaction would selectively target cancer cells in comparison to normal proliferating cells. The latest findings of new family members, new biological activities and a plethora of novel target gen es have gained significant attention towards the E2F transcription factor. It is almost impossible to tie E2F to one unified model of transcriptional regulation. It is clear however, that this family has diverse and sometimes opposing activities (oncogene or tumor suppressor), the signaling pathways involved vary depending on the setting. The E2F field has matured and new discoveries will possibly conclude the specific roles of E2F in normal development and tumorigenesis. The possibility of using E2F effect or pathways for enhancement of chemotherapeutic drugs may provide useful tools for drug development of E2F activators or repressors. Since E2F can both stimulate proliferation as well as induce apoptosis, developing both E2F antagonists (to block prolifer ation) and E2F agonists (to promote apoptosis) seems a daunting task. It is difficult to determine whether there will be a positive or negative effect from these therapies. E2F family of proteins are involved in regulating an abundance of genes; determinin g which genes to shut off or turn on by E2F may result in complicated and insufficient therapies. A more simplistic approach to inhibiting proliferation would incorporate targeting upstream of E2F, i.e. Rb protein. 3. Upstream regulators of Rb function in proliferation

PAGE 42

26 It is well established that the Rb protein is inactivated by kinases associated with D and E type cyclins and this facilitates inactivation of Rb and S phase entry (22) Cyclin dependent Rb regulation is well studied; it is the non cyclin dependent regulation of Rb that is less understood. This section discusses the upstream regulators of Rb in proliferation by various stimuli including growth factors and nicotine. 3.1 Regulation of Rb by growth facto r stimulation Since inactivation of the Rb protein is widespread in many forms of disease it is vital to understand the mechanisms involved. The Ras/Raf/MEK/MAPK pathway signaling pathway functions in a growth factor dependent manner to upregulate cycli n D1 dependent kinase activity and this in turn regulates Rb phosphorylation and its cell cycle functions (171) It has been shown that components of the MAP kinase cascade, including ERK kinases and Raf 1 kinase can phosphorylate Rb in response to proliferative signals (172,173) One st udy revealed that Rb is rapidly phosphorylated on Serine 795 upon treatment of vascular smooth muscle cells with angiotensin II or 5 hydroxy tryptamine and this phosphorylation could be inhibited by blocking MEK activity (172) In other studies, the role for MAPK cascade in inactivating Rb has been shown using wild type mouse embryonic fibroblasts (MEFs). MEFs containing wild type Rb required the activation of the MAPK cascade to enter the cell cycle and MEFs lacking Rb did not (65,174)

PAGE 43

27 It has been suggested that the MAP kinase cascade can phosphorylate Rb in response to proliferative signals. This cascade is initiated by ligand bound cell surface tyrosine kinase receptors such as epidermal growth factor receptor (EGFR), HER 2, vascular EGFR (VEGFR) and platelet derived growth factor receptor (PDGFR) leading to the activation of Ras (175,176) The tyrosine kinase receptor becomes phos phorylated upon ligand binding and recruits the adaptor protein Grb2 and SOS the guanine nucleotide exchange factor to activate Ras by exchanging GDP for GTP. Active Ras GTP recruits Raf from the cytosol to the plasma membrane for activation by itself and other kinases, such as PAK and Src (177 179) Active Raf binds and phosphorylates MEK on two serine residues (217, 221) in the kinase domain (175) ME K then binds and phosphorylates ERK1 and ERK2 on Thr202/Tyr204 and Thr185/Tyr187 respectively (175) Activated ERK acts on several downstream substrates involved in the induction of numerous transcription factors and genes such as myc, c fos, elk1, p90rsk (175,180 182) (Figure 4) These genes are known to be involved in promoting cellular proliferation, differentiation, cytoskeletal changes, cellular mo tility and extracellular matrix remodeling among many others (183 185) This pathway is hyperactivated in 30% of all human tumors. Although the proteins of the Ras/Raf/MEK/ERK pathway are mutated in many cancers, di rect mutations of Raf 1 leading to tumorigenesis have not been identified (186,187) It is the downstream effector of Raf 1, ERK that impinges on all stages of malignant transformation (188) The potential for Raf 1 to play a huge role in tumorigenesis

PAGE 44

28 is eviden ced by its broad activation by many kinases independent o f Ras, like PKC Src, JAK, and Pak (177 179) Raf 1 has also been implicated in promoting expression of the multi drug resistance gene MDR1 (189) There are several clinical trials currently underway that target Raf 1 (190,191)

PAGE 45

29 Figure 4. Binding of growth factors to the cell surface receptor tyrosine kinases (RTKs) signals through adaptor proteins such as growth factor receptor bound 2 (Grb2) and guanine nucleotide exchange factors like son of sevenless (SOS) activate Ras by exchanging GDP for GTP on Ras. Active Ras initiates membrane recruitment and activation of Raf, which leads to activa tion of dual specificity mitogen activated protein kinase (MAPK or MEK) and subsequently extracellular signal regulated kinase (ERK). Activated ERK acts on several nuclear transcription factors such as c myc, c fos and Elk 1.

PAGE 46

30 3.1.1 Raf 1 Kinase C R af, in particular (referred to as Raf 1), was identified in humans as the cellular homologue of the v Raf oncogene (1 92) Shortly after, A Raf was identified and had 85% sequence homology to Raf 1 in its central 100 amino acids (193) Identification of B Raf, another member of the Raf family, linked all three Raf genes together (Figure 5) ; approximately 75% of the kinase domain was conserved on all Raf genes (194) Raf 1 is the most studied of the isoforms, yet it remains poorly understood. Raf 1 ranges in size from 72 74 kDa and can be localized in the membrane, cytoplasm as well as the mitochondria; its presence in the mitochondria has been correlated with a role in apoptosis (176,195) Raf 1 has also been shown to translocate to the nucleus upon mitogenic stimulation (173) Expression of Raf 1 is ubiquitous in adult tissues and has the highest expression in muscle, cerebellum, and fetal brain (196) Raf 1 / mice show a recessive lethal phenotype, are growth retarded and die midgestation. The fetal livers of these mice contain a high number of apoptotic cells. Raf 1 / embryos stained with platelet endothelial cell adhesion molecule 1 (PECAM 1) revealed a reduction in the number of vessels and showed abnormal vascular network formation in the head region. ERK activation was not affected in Raf 1 knockout mice indicating that the phenotypes seen are d ue to lack of signaling through Raf 1 effector proteins independent of the ERK pathway (197) It has been shown that B Raf can compensate for Raf 1 by activating MEK kinase raising the possibility that it is compensating for Raf 1 function in the MAP

PAGE 47

31 kinase cascade in Raf 1 null mice. Mice co endogenous 340 and 341 tyrosines to phenylalanine ( raf 1 FF/FF ) resulting in an inactive form of Raf, survive to adulthood and ERK activation was not compromised despite the nonfunctional Raf 1 (197) MEK independent functions of Raf 1 have garnered a significa nt amount of attention. The Bcl 2 anti apoptotic protein can target Raf 1 to the mitochondria and together they cooperate in suppressing apoptosis (195) Bcl 2 binding protein Bag1 can activate Raf 1 in vitro and in vivo further increasing Raf (198) P ak1 phosphorylates Raf 1 on S338 and S339, this activation by Pak is thought to direct Raf 1 to the mitochondria where it interacts with Bcl 2 by phosphorylating BAD and displacing BAD from Bcl 2 (199) Just as the role of Raf 1 in cell proliferation has provided therapeutic avenues for development of treatments, the role of Raf 1 and Bcl 2 in resistance to apoptosis may provide a target for inducing apoptosis in cancers with a constitutive activation of Raf 1 kinase The cAMP dependent protein kinase (PKA) is activated by second messenger cAMP. PKA then phosphorylates serine 43 on Raf 1 which is inhibitory for Raf 1 kinase activation (185).

PAGE 48

32 Figure 5. Domain structures of the Raf kinase family. There are th ree conserved regions on Raf kinases and remain conserved across isoforms and species. The N terminal CR1 domain contains a Ras binding domain (RBD and CRD). The CR2 domain is a serine/threonine rich domain. CR3 is the catalytic kinase domain. S43 and S259 in C Raf (Raf 1), S364, S428 and T439 in B Raf are inhibitory phosphorylation sites.

PAGE 49

33 3.1.2 Raf 1 in Cancer Gene rearrangements, point mutations, and truncations leading to constitutive activation of Raf 1 have been identified in several cancers most notably in small cell lung cancer (SCLC) (200) Raf 1 overexpression has been linked with colon c ancer and lung cancer cell lines, but not in human cancer tissues (175,183) One group from the Cancer Research UK Centre has linked Raf 1 expression with ovarian cancer cell lines. It was found that Raf 1 was the p redominant Raf isoform accountable for regulating cell growth and apoptosis in ovarian cancer cell lines (201) Although the studies of Raf 1 expression have only been linked to cancer cell lines, it does confirm the role for Raf 1 in cancer development. Another study implicating Raf 1 in cancer involves the Raf 1 kinase inhibitor protein (RKIP). RKIP inhibits the phosphorylation of MEK by Raf 1 (202) In 103 human breast cancer specimens and lymph node metastasis examined, it was observed that RKIP expression was significantly reduced or completely lost in the lymph node metastasis compa red to the normal levels of RKIP in the primary tumor (203) This suggests that the loss of an endogenous Raf 1 inhibitor might contribute to breast cancer metastasis. Although Raf 1 is not mutated extensively in cancers like Ras or p53 genes, it might contrib ute to tumorigenesis independent of Ras as well. This contention is supported by the fact that Raf 1 can be activated by Bcl 2 protein binding protein Bag1, protein kinase C alpha (PKC ) and has been linked to expression of the multidrug resistance gene m dr1 (176,195,198,204,205) Thus Raf 1 appears to be ideally placed to affect

PAGE 50

34 the proliferation as well as apoptosis of cells in Ras dependent and independent fashions, depending on the signaling event. Alterations in the signaling events or components can potentially lead to oncogenesis, via mediation of Raf 1. Several advances have been made toward understanding the potential of improper activation of ERK signaling. Alterations in Ras genes are the most frequen tly detected mutations in cancer. Ras alterations are associated with 90% of pancreatic cancer, 50% of thyroid cancer, 50% of colon cancer, 30% of lung cancer, and 30% of acute myeloid leukemia (AML) (206) 3.1.3 Regulation of Rb by Raf 1 Experiments in yeast two hybrid assays and in vitro binding assays revealed that Raf 1 could bind to Rb and p130, not p107 (173) Raf 1 was also found to bind Rb and p130 in Immunoprecipitation Western blot experiments (173) The Rb Raf 1 interaction was time course dependent; Rb Raf 1 interaction is not detected in quiescent cells. Cells that were subsequently stimulated with serum showed Rb Raf 1 interaction from 30 minutes to 2 hours of stimulation. After 2 hours of serum stimulation, Raf 1 Rb interaction was no longer detected (173) Rb is a nuclear protein and Raf 1 is predominantly cytoplasmic with activation occurring at the plasma membrane. A portion of Raf 1 was found to translocate to the nucleus upon serum stimulation where it bound to Rb (173) (Figure 6) Raf 1 could efficiently phosphor ylate Rb in vitro Raf 1 could inactivate Rb and reverse Rb mediated repression of E2F1 in transcriptional activity assays as well as S phase entry assays.

PAGE 51

35 Figure 6. (A) Colocalization of Raf 1 and Rb in the nucleus of HSF8 cells. Colocalization can b e observed in yellow (bottom panel). (B) The Rb Raf 1 interaction is induced by serum. Extracts from HSF8 fibroblast cells stimulated with serum for the indicated time points were immunoprecipitated with monoclonal Raf 1 antibody The presence of Rb was de tected by western blot analysis. The Rb Raf 1 interaction occurs from 30minutes to 2 hours of serum stimulation. Adapted with permission from Wang et al (173)

PAGE 52

36 3.1.4 Raf 1 as a target for cancer therapy Mutated Ras and Raf 1 are constitutively active and ha ve transforming potential in vitro. It is apparent that mutations leading to Raf activation are the force behind many different types of malignancies and there is solid proof of principle for B Raf and Raf 1 to serve as targets in cancer therapy (207) Although antisense oligonucleotide (ASO) therapy has been attempted and not been efficacious in clinical trials, this underscores the need to optimize this therapy in a patient specific manner (208) Poor results with ASO therapy does not mean that Raf 1 does not serve as an outstanding potential target, essentially, this therapy needs better regimens for inhibiting Raf 1 mRNA. Recent candidate drugs su ch as nanoparticles conjugated to a mutant form of Raf 1, B Raf inhibitors and Rb Raf 1 protein protein inhibitors (discussed in this thesis) will provide valuable insights into the molecular biology of Raf signaling in cancer (209 211) The BAY 43 9006 compound, termed sorafenib, was originally identified as a small molecule inhibitor of Raf 1. Further characterization of the bi aryl urea compound demonstrated inhibition of wild type B Raf and mutant B Raf kina se, VEGFR 2, mVEGFR 3, mPDGFR Flt 3, c KIT, and FGFR 1 (212) Sorafenib inhibits Raf 1 and mVEGFR2 activity with an IC 50 50 s for B Raf mut, B Raft wt, VEGFR2, mVEGFR3, Flt 3, c kit, p38 and mPDGF R ranges from 12 68nM. Sorafenib is highly selective for Raf 1 and B Raf showing no activity

PAGE 53

37 against downstream MEK and ERK (212) The FDA has approved Sorafenib for the treatment of advanced RCC since previous ph ase II and phase III results showed significant responses specifically in RCC patients. A phase II placebo controlled randomized discontinuation trial of sorafenib for patients with metastatic RCC resulted in 50% of patients being progression free at 24 we eks. This result showed significant disease stabilizing activity with the tolerability of daily therapy in comparison to the standard of care (cytokine therapy, IL 2) for RCC (213) RCC commonly has mutations in VHL (Von Hippel Lindau) gene leading to increased production of VEGF, which makes these tumors largely dependent on VEGF mediated angiogenesis (214) Sorafenib is likely functioning in RCC because of its ability to inh ibit VEGFR and the kinases involved in signaling production of VEGF. 3.1.5 Role of Rb Raf 1 Interaction in Cancer Given the fact that both Rb and Raf 1 play important roles in cancer cell signaling pathways; the Rb Raf 1 interaction was examined in can cer. Whole cell lysates were prepared from ten non small cell lung carcinomas (NSCLC) as well as the adjacent normal tissue that were resected from patients. The Rb Raf 1 interaction was examined by IP WB. In eight out of 10 matched pairs the Rb Raf 1 inte raction was elevated in the tumor tissue compared to the normal adjacent tissue (215) ChIP assays also revealed a similar result in NSCLC tumor tissues; more Raf 1 was found on the proliferative promoters cdc6 and cdc25A in tumor

PAGE 54

38 tissue compared to the normal tissue (Figure 7 ) (215) This suggests that the Rb Raf 1 interaction might have contributed to the oncogen esis of the tumors.

PAGE 55

39 Figure 7. The Rb Raf 1 interaction is elevated in tumor samples. (A) NSCLC tumors (T) contained more Rb Raf 1 complexes than adjacent normal tissue (N). Rb Raf 1 interaction was assessed by IP WB on nuclear extracts. (B) ChI P assays on human NSCLC tumor samples show that more Raf 1 was present on both cdc6 and cdc25A promoters in tumor samples compared to adjacent normal tissue. Adapted with permission from Dasgupta et al (215)

PAGE 56

40 3.1.6 Disruption of the Rb Raf 1 Interaction The Rb Raf 1 interaction was found to occur on amino acids 10 18 in the N terminal region of Raf 1 (209) Raf 1 seems to function similar to viral oncoproteins; stable binding is required for inactivation of Rb an d Raf 1 binds in the pocket domain of Rb. One major difference is viral oncoproteins dissociate E2F1 from Rb and Raf 1 does not. A peptide corresponding to amino acids 10 18 on Raf 1 was created to examine disruption of the Rb Raf 1 interaction. The pepti de sequence is ISNGFGFK, a C was added to the carboxyl terminal end to allow coupling to the carrier molecule penetratin. The Raf 1 peptide (1 M) could inhibit the Rb Raf 1 interaction without inhibiting the binding of other proteins to Rb or Raf 1 (209) The Raf 1 peptide pen conjugate could disrupt the binding of Rb Raf 1 in cells; this was shown in confocal colocalization experiments as well as several other biochemical assays (Figure 8) Kinetic experiments show ed that the Rb Raf 1 interaction occurred as early as 30 minutes from serum stimulation up to 4 hours, and this binding preceded the binding of cyclin D. Rb phosphorylation was also found at two hours of serum stimulation (time when Raf 1 is found to bind to Rb). More surprisingly, the inhibition of Rb Raf 1 with the Raf 1 peptide pen conjugate could significantly inhibit Rb phosphorylation even up to 16 hours post serum stimulation (209) Since Raf 1 binding to Rb does not cause E2F1 to dissociate yet could reverse Rb mediated repression of E2F1, it was examined how Raf 1 de represses E2F1. Chromatin Immunoprecipitation assays (ChIPs) and Immunoprecipitation western blot

PAGE 57

41 assays (IP WBs) revealed that Raf 1 binding t o Rb led to the dissociation of chromatin remodeling protein Brg1 from Rb. Although other corepressors are present, Raf 1 seems to specifically dissociate Brg1 from the promoters of E2F regulated genes. Treatment with the Raf 1 peptide pen conjugate led to Brg1 recruitment on proliferative promoters. There was no change in the binding of HDAC1 and HP1. Disruption of the Rb Raf 1 interaction with the Raf 1 peptide pen conjugate also significantly inhibited proliferation (209) The peptide pen conjugate could inhibit 50% of cells from entering S phase. The peptide pen conjugate efficiently inhibited angiogenic tubule formation in matrigel assays as well as adhesion, migration and invasion of human aortic endothelial cel ls (HAECs) (209) An anti angiogenic and anti proliferative agent can be expected to inhibit tumor growth since these are hallmarks of cancer. A549 human xenograft tumor growth was inhibited approximately 80% from tr eatment with the Raf 1 peptide pen conjugate intratumorally (209) These results clearly demonstrated that disruption of Rb Raf 1 interaction could efficiently inhibit tumor growth and angiogenesis in vivo. It can b e assumed that small molecules that are capable of inhibiting the Rb Raf 1 interaction have therapeutic potential for controlling proliferative disorders such as cancer. Essentially, the abovementioned studies led to the screening of small molecule librari es for compounds capable of inhibiting Rb Raf 1 interaction, these experiments and more will be discussed in chapter 3 of this thesis

PAGE 58

42 Figure 8. The penetratin Raf 1 conjugate can inhi bit Rb Raf 1 interactio n in intact cells (A) U2 OS cells immunostained with Raf 1 (Red) and Rb (green) were visualized by confocal microscopy. Serum starved cells show no association of Raf 1 with Rb. Serum stimulation induces Raf 1 to translocate to the nucleus where it binds Rb, colocalization is seen in yellow. The presence of 1 M of the Raf 1 peptide conjugate could inhibit the binding of Raf 1 to Rb. The Raf 1 scrambled peptide has no effect on Raf 1 Rb binding. (B) Nuclear and cytosolic extracts revealed that Raf 1 peptide conjugate does not affect the nuclear translocation of Raf 1. Adapted with permission from Dasgupta et al ( 209)

PAGE 59

43 3.2 Growth factor independent regulation of Rb The Rb protein contains approximately 18 potential phosphorylation sites, cdk4/6 has been shown to target 4 residues C terminal to the pocket domain (216,217) Cyclin D associated kinases; cyclin E cdk2 complexes have also been shown to modulate Rb function. Although it has been shown that there is a clear link between growth factor stimulated Ras/MAPK pathway and Rb phosphorylation cell cycle, other non growth factors regulating this pathway have not been defined. Studies involving hormones and neurotransmitters have also revealed a link between Ras/MAPK signaling and Rb E2F pathway. Treatment with Angiotensin II or Serotonin could induce phosphorylation of serine 795 on Rb and this activation was mediated by CDK4 and MAPK pathway (172) Stimulation with either Serotonin or Angiotensin II also resulted in dissociation of E2F from Rb (172) These studies support the idea that Rb is regulated during growth factor dependent stimulation as well as non growth factor activation. 3.2.1 Rb inactivation upon nicotine stimulation via nicotin ic acetylcholine receptors ( nAChRs) Non small cell lung cancer (NSCLC) is associated with 80% of the total number of lung cancer cases and is strongly associated with tobacco use. There are several carcinogenic compounds found in tobacco smoke such as 4 (m ethylnitrosamino) 1 (3 pyridyl) 1 nitrosonornicotine (NNN); these molecules can form DNA adducts leading to mutations in vital

PAGE 60

44 genes like Ras, p53, and Rb (218,219) The carcinogen NNK that is structurally related to nicotine has been shown to induce proliferation and angiogenesis through nicotinic acetylcholine receptor subunits (nAChRs). nAChRs are pentameric proteins consisting of nine subunits ( 2 10) and three subunits ( 2 4) in non neuronal cells; and subunits are present in neuronal systems (220) Studies in recent years have shown that nicotinic receptors are also present in a wide variety of non neuronal tissues, including human bronchial epithelial cells, human endothelial cells and astrocytes (220 223) These observations led to the realization that signaling through the nicotinic acetylcholine receptors could have functional roles in non neuronal cells as well. The finding that nAChRs are present on non ne uronal cells was followed by the observation that nicotine could induce the proliferation of endothelial cells (221,224) Further, it was found that nicotine and structurally related carcinogens like NNK could indu ce the proliferation of a variety of small cell lung carcinoma cell lines (225,226) stimulation induces the activation of Raf 1 (227) In addition to these studies, it has been shown that persistent nicotine exposure stimulates Ras signaling and MAPK activation in mouse epithelial cells (228) Nicotine was also shown to induce the cyclin D1 promoter an d therefore cell cycle (228) Recently, our lab has demonstrated the how nicotine signaling involves

PAGE 61

45 the Rb E2F pathway and promotes cell cycle entry. Nicotine stimulation of NSCLC cell lines leads to the binding of Arrestin to the 7 nAChR, which in turn activates Src kinase (215) The a ctivation of Src leads to the activation and binding of Raf 1 to Rb. Raf 1 can bind to Rb and initiate its inactivation facilitating cell cycle progression (Figure 9) Nicotine stimulation resulted in dissociation of E2F1 from Rb and this correlated with the induction of cyclin/cdk activity as well as Rb phosphorylation. In response to nicotine stimulation, proliferative promoters cdc6 and cdc25A were found to have more E2F1 and dissociation of Rb (215) Nicotine functions via the 7 nAChR upstream of Rb E2F pathway facilitating cell cycle progression. This le d to the hypothesis that nicotine might be playing a direct role in the progression of human lung cancers. While there is no evidence that nicotine contributes to the induction of tumors, it has been demonstrated that nicotine promotes the growth of solid tumors in vivo suggesting that nicotine might be playing a more important role in the progression of tumors already initiated (229,230) Chapter 4 focuses on the role of nicotine in tumor growth and metastasis.

PAGE 62

46 Figure 9. Schematic predicting the proliferative signaling by nAChRs in NSCLC cells. Nicotine stimulation causes the assembly of oligomeric complexes involving Arrestin, Src and nAChRs, facilitating the activation of Src. This leads to the activation o f Raf 1, which binds to Rb; activation of MAPK and cyclins/cdks also occur. The activation of Src facilitates the binding of Raf 1 to Rb and multimeric complexes containing Rb, Raf 1 and E2F1 occupy proliferative promoters. Sustained mitogenic signaling le ads to the dissociation of Raf 1 and Rb, while E2F remains bound to the promoter facilitating S phase entry. Adapted with permission from Dasgupta et al (215)

PAGE 63

47 4. Upstream regulators of Rb E2F Function in Apoptosis Several attempts have been made to understand how extracellular signals modulate Rb and E2F function to bring about cellular apoptosis. It has been suggested that suppression of apoptosis may be the primary function of Rb, independent of its anti proliferative activity. It has been shown that Rb is in activated upon apoptotic signaling as well as proliferative signaling (231 233) 4.1 Apoptotic Signaling Pathways Regulate Rb Function In an earlier study, experiments were done to assess whether kinases involved in non proliferative pathways like JNK and p38 affect Rb/E2F function (234) These two kinases were found to have opposite effects on E2F function: the stress induced kinase JNK1 inhibits E2F1 activity whereas the related p38 kinase reverses Rb mediated repression of E2F1. JNK1 could phosphorylate E2F1 in vitro reducing the DNA binding activity. Phosphorylation of Rb by p38 kinase upon Fas stimulation resulted in the dissociation of E2F and increased transcriptional activity. The inactivation of Rb by Fas was blocked by SB203580, a p38 specific inhibitor, as well as a dominant negative p38 construct; cyclin dependent kinase (cdk) inhibitors as well as dominant negative cdks had no effect (235) These results suggest that Fas mediated inactivation of Rb is mediated via the p38 kinase, independent of cdks. The Rb/E2F mediated cell cycle regulatory pathway appears to be a normal target for non mitogenic signaling cascades and coul d be involved in mediating the cellular effects of such

PAGE 64

48 signals (234,236) It has also been shown that the apoptotic signal regulating kinase 1 (ASK1) kinase can modulate apoptotic signaling by affecting Rb function (237) It was found that ASK1 kinase had to overcome the anti apoptotic effects of Rb to induce cell death. ASK1 was found to directly associate with Rb protein leading to its dissociation from specific p ro apoptotic promoters like p73. Release of Rb from pro apoptotic promoters coincided with its enrichment on proliferative promoters; it appears that this is a mechanism to prevent inappropriate cell cycle entry in adverse conditions. This suggests that t he ASK1 p38 kinases are able to modulate cellular apoptosis by modulating Rb function as well as the transcriptional activity of E2F1 (Figure 10) It can be assumed that during mitogenic scenarios, Rb binds to prosurvival kinases such as Raf 1 and cyclins/ cdks to promotes proliferation. In the presence of apoptotic stimuli, Rb binds to apoptotic kinase ASK1. Even though both of these interactions can inactivate Rb and activate E2F1 transcriptional activity, they induce different promoters: such as p73 (apop totic stimuli) or cdc25A (mitogenic stimuli) (237) One very interesting finding is that the specific stress stimulus of tumor necrosis factor alpha (TNF ) regulates Rb function very differently depending on the cellular context. TNF is a pleiotropic inflammatory cytokine and has been shown to play two very important opposing roles in both inhibition of endothelial

PAGE 65

49 cell proliferation and enhancement of apoptosis, yet stimulation of vascular smooth muscle cel l proliferation and migration (238,239) TNF like other chemoattractants such as PDGF, stimulates VSMC migration through the MAPK pathway (240) It has been shown that TN F can induce Rb phosphorylation via p38 and ASK1 kinases, leading to apoptosis in most cells, including human aortic endothelial cells (HAECs). One intriguing exception to this is in vascular smooth muscle cells (VSMCs), where TNF is capable of inducing proliferation. Migration of VSMCs is a crucial event in the formation of vascular stenotic lesions. TNF is upregulated by VSMCs in atherosclerosis and following angioplasty. The VSMC response to TNF provides a therapeutic possibility to prevent VSMC p roliferation and therefore block restenosis. Chapter 5 reveals new insights into TNF induced VSMC proliferation via Rb Raf 1 and MAPK pathways.

PAGE 66

50 Figure 10. A model for the Rb/E2F pathway in cell proliferation and apoptosis in AoSMCs and HAECs upon T NF stimulation. In AoSMCs, TNF stimulates binding of Raf 1 to Rb, facilitating its inactivation and stimulating cell cycle progression. In HAECs, TNF stimulates the binding of ASK1 to Rb, leading to inactivation and E2F1 inducing apoptosis through p7 3. The inactivation of Rb releases E2F1, which can bind to proliferative or apoptotic promoters and make vital decisions on cell survival or death.

PAGE 67

51 5. Summary Rb plays a central role in cellular homeostasis. It acts as the main component of a very compl ex network in which cell cycle is regulated; it can be imagined that regulation of Rb is often disrupted in various diseases. Studies in mice genetically deficient in Rb in all hematopoietic cells revealed a significant role for Rb in hematopoiesis; sugges ting that Rb is involved in many different types of cells in the body (241) Rb has also been linked to atherosclerosis and restenosis. In addition to cancer and heart disease, Rb/E2F pathway is found to (242) Studies from our laboratory have been focused specifically on Rb E2F signaling pathways in lung cancer and heart disease, namely atherosclerosis. Development of atherosclerosis is a stringently regulated and complex process that occurs as a result of aberrations in endothelial cell and smooth muscle cell (SMCs) function. Endothelial cells ( EC) form the lining of the blood vessels and the heart, functioning as a barrier by regulating permeability, thrombogenicity, and production of growth inhibitory molecules (243) Endothelial cells also respond to me chanical forces. ECs are contact inhibited under normal conditions; but when endothelial cells sense an injury such as abrasion of a vessel, they proliferate and migrate leading to reendothelialization at sites of injury (244 ) At the same time, vascular smooth muscle cells proliferate and

PAGE 68

52 migrate from the injured arterial wall into the vessel lumen leading to vessel thickening and occlusion, called restenosis (245) Intimal hyperplasia characterized by VSMC proliferation and extracellular matrix (ECM) deposition is a major process contributing to restenosis (246) Atherosclerotic lesions can be blocked if inhibition of VSMCs is effective (243) Several growth factors and cytokines are capable of stimulating VSMC migration and proliferation, such as platelet derived growth factor (PDGF), which plays a vital role in the development of restenosis (247) VSMC prolifer ation leads to downstream activation of Raf/MEK/ERK signaling pathway, which in turn inactivates Rb to induce cell proliferation. We have shown that an effective way to inhibit endothelial cell migration and invasion is through disruption of Rb Raf 1. Targ eting Rb Raf 1 with small molecule inhibitors to prevent VSMC migration and invasion will serve as viable targets for drug therapy for vascular proliferative disorders. The studies described indicate the role of Raf 1 binding to and regulating Rb funct ion. Mitogenic and non mitogenic stimulation have been shown to induce this interaction in a variety of cell types (209,215) Raf 1 can bind and inactivate Rb and this facilitates further phosphorylation by cyclins/ cdks and cell cycle progression. The Rb Raf 1 interaction is elevated in NSCLC tumors suggesting this interaction plays a role in the oncogenesis of the tumors (215) The Rb Raf 1 interaction may be regulating two very important hallmarks of cancer; proliferation and angiogenesis. Targeting the protein protein in teraction

PAGE 69

53 with the Raf 1 peptide could prevent S phase entry, inhibit angiogenesis and tumor growth in nude mice (209) Disruption of this interaction with peptides or small molecule inhibitors is a viable alternati ve to controlling proliferative disorders such as cancer and atherosclerosis (Figure 11)

PAGE 70

54 Figure 11. Schematic depicting the Raf 1 Rb signaling pathway. Small molecule inhibitors capable of disrupting the Rb Raf 1 interaction is a viable strategy to prevent cell cyc le progression, invasion, migration, angiogenesis and tumor growth.

PAGE 71

55 Chapter 2: Materials and Methods Cell culture and transfection The human promyelocytic leukemia cell line U937 was cultured in RPMI (Medi atech) containing 10% fetal bovine serum (FBS; Mediatech). U2 OS, Saos 2, PANC1, CAPAN2, A375, DU145, SK MEL 5, SK MEL 28, MDA MB 468, H1299 and MDA MB 231 cell lines were cultured in Dulbecco modified Eagle Medium (DMEM; Mediatech) containing 10% FBS. A5 49 cells and A549 shRNA Rb cell lines were maintained in Ham F 12K supplemented with 10% FBS. ShRNA cells lines were maintained in media containing 0.5 g/ml puromycin. Line1, H1650, H596, H2172, PC 9, LNCap, PC3 and Aspc1 cell lines were cultured in RPMI ( Gibco) containing 10% FBS. Human aortic endothelial cells (HAECs) and human umbilical vein endothelial cells (HUVECs) were obtained from Lonza and cultured in endothelial growth medium, supplemented with 5% Human aortic smooth muscle cells were obtained from Lonza and cultured in smooth muscle basal medium, instructions. U251MG and U87MG glioma cell lines were maintained in DMEM supple mented with non essential amino acids, 50mM mercaptoethanol, and

PAGE 72

56 10% FBS. Nicotine (Sigma) was dosed at 1 M concentration for all nicotine experiments. TNF (Promega) was added at 100ng/ml. PDGF (Biosource) was added at 100ng/ml concentration. ShRNA cel l lines were made by stably transfecting A549 cells with two different shRNA constructs that specifically target Rb obtained from a shRNAmir library from Open Biosystems, Huntsville, AL. In vitro drug library screening ELISA 96 well plates (Nunc) were coated with 1 g/ml of GST Raf 1 (1 149aa) overnight at 4 C. Subsequently the plates were blocked for 1 hour. GST Rb at 20 g/ml was pre incubated at RT for 30 minutes in the presence or absence of the compounds at 20 M. This GST Rb was added to the pla te and incubated for 90min at 37 C. The amount of Rb bound to Raf 1 was detected by Rb polyclonal antibody (Santa Cruz) 1:1000 incubated for 60 min at 37 C. Donkey anti rabbit IgG HRP (1:10,000) was added to the plate and incubated at 37 C for 60 minutes. The color was developed with orthophenylenediamine peroxidase substrate tablets (Sigma) and the reaction was terminated with 3M H 2 SO 4 Absorbance was read at 490nm. To determine disruption of Rb to E2F1, Phb, or HDAC1 the above protocol was used with the e xception of coating GST Rb on the ELISA plate and adding the drugs in the presence or absence of GST E2F1, Phb, or HDAC1. E2F1 monoclonal antibody (Santa Cruz) (1:2000) was used to detect the amount of Rb bound to E2F1. Prohibitin monoclonal antibody (NeoM arkers) was used at 1:1000 to detect the amount of Rb bound to

PAGE 73

57 Prohibitin. HDAC1 polyclonal antibody (Santa Cruz) was used at 1:1000 to detect the amount of Rb bound to HDAC1. For disruption of Mek Raf 1 binding ELISAs, Raf 1 1 g/ml was coated on the plat e and GST Mek (20 g/ml) was incubated in the presence or absence of the compounds for 30 minutes at room temperature. Mek1 polyclonal antibody (Cell Signaling) was used at 1:1000 to detect the binding of Raf 1 to Mek1. The IC 50 concentrations for the Rb Ra f 1 inhibitors were determined by plotting with Origin 7.5 software. Lysate preparation, immunoprecipitation, and Western blotting Lysates from cells treated with different agents were prepared by NP 40 lysis as described earlier (209) Tumor lysates were prepared with T Per tissue lysis buffer (Pierce) and a Fischer PowerGen 125 dounce homogenizer (248) Physical interaction between proteins in vivo was analyzed by immunoprecipitation indicated antibody as previousl y described. Polyclonal E2F1, B Raf, ASK1, Cyclin D and E were obtained from Santa Cruz Biotechnology. Monoclonal Rb and Raf 1 were supplied by BD Transduction laboratories. Polyclonal antibodies to phospho Rb (807,811), phospho Raf (338), phospho JNK, ph ospho ERK 1/2 and phospho Mek1/2 were supplied by Cell Signaling. CAT assays galactosidase

PAGE 74

58 were performed using standard protocols (173) Cells were transfected by CaCl 2 and treated with drug asynchronously for 24 hours. Chromatin Imm unoprecipitation (ChIP) assay A549 cells were rendered quiescent by serum starvation and re stimulated with serum for 2h or 16h in the presence or absence of RRD 251 at 20 M. Cells were cross linked with 1% formaldehyde for 10 minutes at room temper ature. Subsequently, the cells were harvested and ChIP lysates were prepared (209) Immunoprecipitations were conducted using antibodies against E2F1, Rb, Raf 1, Brg1, HP1, and HDAC1 and the association with specifi c promoters detected by PCR as previously described. Rabbit anti mouse secondary antibody was used as the control for all reactions. The sequences of the PCR primers used in the PCRs were as follows: cdc6 GGCCTCACAGCGACTCTAAG A cdc6 CTCGGACTCACCACAAGC TS promoter (forward primer), and 5' GAC GGA GGC AGG CCA AGT G 3' TS promoter (reverse primer). The cdc25A and c fos primers are described in (209) Real time PCR A549 cells were subjected to serum starvation or treatment with RRD 251. Unstimulated serum starved cells were used as a control. Total RNA was isolated by an RNeasy miniprep kit from QIAGEN following the manufacturer's protocol.

PAGE 75

59 One microgram of RNA was DNase treated using RQ1 DNase (Promega), followed by first strand cDNA synthesis using the iScript cDNA synthesis kit (Bio Rad). A fraction (1/20) of the final cDNA reaction volume was used in each PCR (249) Primers sequences are as follows: 5' CTG CCA GCT GTA CCA GAG AT 3' ( TS forward primer), 5' ATG TGC ATC TCC CAA AGT GT 3' ( TS reverse primer), 5' CCC C AT GAT TGT GTT GGT AT 3' ( Cdc6 forward primer), 5' TTC AAC AGC TGT GGC TTA CA 3' ( Cdc6 reverse primer), 5' CTC AAC ACG GGA AAC CTC AC 3' ( 18S forward primer), and 5' AAA TCG CTC CAC CAA CTA AGA A 3' ( 18S reverse primer). Real time PCR was performed using a Bio Rad iCycler. In vitro kinase assay The kinase reaction for Raf 1 was carried out with 100ng of Raf 1 (Upstate Signaling), 0.5 g of MEK1 (Upstate) as the substrate or 0.1 g Rb (QED Biosciences), 10 M ATP, 10 Ci of [ 32 P] ATP in the kinase assay buffer in the presence or absence of the drugs at 30C for 30 minutes. 1 M of BAY 43 9006 was used as a control and 20 M RRD 251 was used. Cyclin D and E kinase assays are described in reference (209) Proliferati on assays Bromodeoxyuridine (BrdU) labeling kits were obtained from Roche Biochemicals. Cells were plated in poly D lysine coated chamber slides at a

PAGE 76

60 density of 10,000 cells per well and rendered quiescent by serum starvation for 24 hours. Cells were then re stimulated with serum in the presence or absence of the indicated drugs for 18h. S phase cells were visualized by microscopy and quantitated by counting 3 fields of 100 in quadruplicate. For nicotine treatments, Line1 cells were serum starved for 72 hours and subsequently stimulated with 1M Nicotine (Sigma). Soft Agar Colony Formation assays Soft agar assays were done in triplicate in 12 well plates (Corning). First, the bottom layer of agar (0.6%) was allowed to solidify at room temperatur e. Next the top layer of agar was (0.3%) was mixed with 5,000 cells per well and the indicated drug. The drugs were added twice weekly in complete media to the agar wells. Colonies were quantified by staining with MTT 1mg/ml for 1hour at 37 C. Matrigel A ssays Matrigel (Collaborative Biomedical Products) was used to promote the differentiation of HUVECs or HAECs into capillary tube like structures (209) A total of 100 l of thawed Matrigel was added to 96 wel l tissue culture plates, followed by incubation at 37 C for 60 minutes to allow polymerization. Subsequently, 1 X 10 4 HAECs or HUVECS were seeded on the gels in EGM medium supplemented with 5% FBS in the presence or absence of 20 M

PAGE 77

61 concentrations of the in dicated compounds, followed by incubation for 24 hours at 37 C. Capillary tube formation was assessed using a Leica DMIL phase contrast microscope. Ex vivo Rat Aorta Ring Angiogenesis assays Forty eight well tissue culture plates were coated with 20 0 l of Matrigel and allowed to polymerize for 1 hour at 37 C. Thoracic aortas were excised from 8 10 week old male Sprague Dawley Rats (250 300g) (250) The fibroadipose tissue was removed. The aortas were rinsed several times with EGM 2 (Clonetics), sectioned into 1mm rings and pla ced on the matrigel coated wells. The rings were covered with an additional 200 l of Matrigel and allowed to polymerize. The rings were cultured in EGM 2 media in the presence or absence of 20 M of RRD 251. The media and drug were supplemented twice a week for one week. The Aortic rings were photographed on day 7 using a Leica phase contrast microscope. Quantitation of microvessel growth was done using Image Pro Plus (v.6.0) software and values are reported as microvessel area. In vivo Matrigel Plug Angiog enesis assays In vivo matrigel plug assays were carried as previously described (251) Cooled liquid matrigel (Collaborative Biomedical Products) (300 l) was injected subcutaneously into both flanks of nude m ice. The next day, the mice were separated into two groups; one group received the vehicle (PBS/DMSO) every

PAGE 78

62 day by i.p. injection and the second group received RRD 251 50 MPK daily by i.p. injection. The mice were treated for 7 days. At 7 days post matrige l injection, the mice were injected with 100 l of 100 MPK FITC Dextran (Sigma) through the tail vein. 30 minutes later, the mice were euthanized and the matrigel plugs were removed and fixed in buffered formalin. Each sample was visualized and searched for areas of vessel formation. Two images were captured per matrigel plug. Samples were viewed with a Leica DMI6000 inverted microscope, TCS SP5 confocal scanner, and a 20X/0.7NA Plan Apochromat objective (Leica Microsystems, Germany). An Argon 488 laser li ne was applied to excite the samples and tunable filters were used to minimize background fluorescence. Image sections at 2.0 m were captured with photomultiplier detectors 3D projections were prepared with the LAS AF software version 1.6.0 build 1016 (L eica Microsystems, Germany). Quantification of intensity and angiogenesis was performed using Image Pro Plus 6.2 (Media Cybernetics, Inc., Maryland). Average intensity per pixel is plotted as percent angiogenesis in each image, (n=12). Each image is repre sentative of areas of vessel formation throughout entire matrigel plug. After confocal imaging, samples were paraffin blocked and stained with H&E. H&E images shown display of the matrigel plug. Quantitation of VEGF Asynchronously growing A549 cells wer e treated with RRD 251 (20 and 50 M) for 24 hours. Aliquots of media (1mL) were taken and stored at 20C for

PAGE 79

63 later analysis. ELISA to human VEGF (Biosource, Invitrogen) was performed the standard curve. Animal Studies Nude mice (Charles River, Wilminton, MA, USA) were maintained in accordance with Institutional Animal Care and Use Committee (IACUC) procedures and guidelines. A549 or H1650 cells were harvested and resuspended in PBS, and then injected s.c. into the right and left flanks (10 x 10 6 cells per flank) of 8 week old female nude mice as reported previously (209,248) For SK MEL 28 xenograft experiments, SK MEL 28 cells were resus pended in 1:1 PBS/Matrigel solution. When tumors reached about 100 200mm 3 animals were dosed intraperitoneally (i.p.) or orally by gavage with 0.1ml solution once daily. Control animals received a vehicle, whereas treated animals were given RRD 251 at th e indicated doses. The tumor volumes were determined by measuring the length ( l ) and the width ( w ) and calculating the volume ( V= lw 2 /2) as described previously. Statistical significance between control and treated t test. Immunohistochemistry staining Upon termination of xenograft anti tumor experiments, tumors were removed and fixed in 10% neutral buffered formalin before processing into

PAGE 80

64 paraffin blocks. Tissue sections (5 m thick) were cut from the blocks a nd stained with H&E, Ki 67, CD31, phospho Rb, Catenin and E cadherin antibodies. Paraffin sections were rehydrated to PBS and processed using the following protocols. Sections were rinsed in dH2O, and then subjected to microwave 0 minutes on 70% power, with a 1 minute cooling period after every 5 minutes, in 0.01 M sodium citrate, pH 6.0. Sections were cooled for 20 minutes, rinsed 3 times in dH2O, twice in PBS and incubated in 5% normal goat serum for 30 minutes. Sections were in cubated in primary antibody for 1 hour in 5% normal goat serum, rinsed 3 times in PBS. For color development the slides were treated with ABC kit from Vector labs, rinsed in dH2O, and developed using DAB as chromogen. After a final rinse in dH2O, sections were lightly counterstained in hematoxylin, dehydrated, cleared and coverslipped. Tissue sections were stained with hematoxylin and eosin (H&E) using standard histological techniques. Tissue sections were also subjected to immunostaining for CD31 (BD Biosc iences, San Diego, CA, USA) using the avidin biotin peroxidase complex technique. Mouse monoclonal antibody was used at 1 : 50 dilution following microwave antigen retrieval (four cycles of 5 min each on high in 0.1 M citrate buffer Stained slides were s canned on an Ariol SL 50 Automatic Scanning System and whole tumor sections were quantitated using Image Pro Plus (v.5.1.0) software. Statistical Analysis

PAGE 81

65 test. Values were considered significant when the p value <0.01. Exact p values are reported. In vitro binding assays Glutathione S transferase (GST) fusions of Rb and Raf 1 have been previously described (209,237) 35 S labeled Raf 1 proteins were generated by in vitro transcription translation in rabbit reticulocyte lysate according to the l of the lysates were incubated with the GST Rb beads in 200 l of protein binding buffer (20mM Tris [pH 7.5], 50mM KCL, 0.5mM EDTA, 1mM DTT, 0.5% NP 40, 3mg/ml BSA) at 4 C for 2 hours as described earlier (209,237) The input lanes contained approximately one fourth of that used in the binding assay. Peptide synthesis was carried out by Ted Gauthier at the USF Chemistry department. Alanine scan of Peptide consisted of the 8 amino acid peptide with an alanine replacing one amino acid at each position on the peptide. Cell Viability Assays MTT [3 (4,5 dimethylt hiazol 2 yl) 2,5 diphenyltetrazolium bromide] was purchased from Sigma and was constituted at 10mg/ml in sterile PBS. Cells were plated at densities of 3,000 5,000 cells per well in 96 well plates. Cells were treated asynchronously with several inhibitors at varying concentrations. DMSO was used as the control. 24 48 hours post treatment, MTT was added to the

PAGE 82

66 wells and allowed to metabolize for 30 min 2 hours. Media was carefully aspirated out from the wells and DMSO was added to solubilize the crystals. A bsorbance was measured at 540nM on a Victor plate reader. Apoptosis Assays Cells (10,000/well) were plated in poly D lysine coated chamber slides. Drug treatment on asynchronous cells was for 18 24 hours and subsequently fixed with formalin. Apoptosis was measured using a TUNEL assay kit (Promega). Parallel experiments were also set up in 10cm tissue culture dishes and apoptosis was confirmed by immunoblotting for PARP (Cell Signaling). Double Immunofluorescence Assays U2 OS osteosarcoma cells were plated on poly D lysine coated chamber slides and rendered quiescent by serum starvation for 48 hours. Thereafter, the cells were re stimulated with serum for 2 hours in the presence or absence of RRD 251 at 20 M concentration. Cells were fixed with 4% paraforma ldehyde and permeabilized with PBS containing 0.2% Triton X 100. Monoclonal anti Rb (1:50) and polyclonal anti Raf 1 (1:200) were added in blocking buffer, and incubated on the cells overnight at 4C. Secondary antibodies, goat anti mouse (IgG) Alexa Fluo r 488 (green fluorochrome), and goat anti rabbitt (IgG) Alexa Fluor 548 (red fluorochrome) (Molecular Probes) were used as described previously (209) Nuclear staining was performed using DAPI. Immunostained Rb

PAGE 83

67 and Raf 1 were visualized by confocal microscopy using a Zeiss scanning microscope model 510 system equipped with argon (458/488nm) and helium neon (543nm) laser systems. NNK induced Carcinogenesis Animal Model Two experiments were carried out using female A/J mice 4 6 weeks of age (Jackson Labs). NNK (NCI) (100mg/kg) was administered to all mice ( n =16) once a week for 5 weeks. The mice were randomized into two groups; group one received the vehicle (PBS) ( n =8) and group two received nicotine ( n =8) by (i.p.) injection at a dose of 1 mg/kg three times a week for an additional 23 weeks. Nicotine levels in mice were analyzed using a cotinine ELISA kit. At the end of the experiment, the mice were euthanized and the lungs were fixed in 10% buffered formalin. The l ungs were subsequently examined by stereoscope for number of lung tumors. The lungs were paraffin embedded and sectioned for IHC staining and pathological examination. Line1 model of tumor growth and metastasis Line1 Tumor Growth Experiments. Female BA LB/c mice age 26 30 days (Charles River) were clipped and depilated using Nair for complete hair removal on the back and flanks. Line1 cells (1 X 10 6 per tumor) were harvested and resuspended in 100 l of PBS for injection (252) The mice were randomized 3 7 days after injection of tumor cells. Mice were separated into two groups

PAGE 84

68 Vehicle ( n =8) and Nicotine ( n =8) (patch or i.p. injection). Mice rece ived nicotine by i.p. injection at a dose of 1mg/kg three times a week. Nicotine was also applied using transdermal patches (Nico Derm CQ, GlaxoSmithKline) at a dose of 25 mg/kg daily. Patches (14mg) were cut into 30 equal sized squares representing 0.45m g of nicotine using a razor blade. Nicotine was administered for 2 weeks and tumor growth was measured thrice weekly. Nicotine levels in mice were analyzed using a cotinine ELISA kit. Line1 Metastasis Experiments. Line1 cells (1 X 10 6 per tumor) were in jected and the mice were subsequently randomized into two groups. Group one received the vehicle ( n =16) and group two received nicotine (1mg/kg) ( n =16) by i.p. injection thrice weekly. After 3 weeks of nicotine treatment, the tumors were removed under anes thesia and the skin was stapled, mice recovered on a warmed heating pad and the staples were removed after 7 days. Mice continued to receive nicotine or vehicle for an additional 2 weeks. At the end of the experiment, the mice were euthanized and the lungs were fixed in formalin. Quantitation of Cotinine Level of cotinine in urine was used as a marker for nicotine levels. Urine (100 l) was collected throughout the length of the experiments and stored in 20 o C for later analysis. Cotinine levels were d etermined by using the BioQuant Cotinine Direct ELISA kit (CalBiotech, Spring Valley, CA) following

PAGE 85

69 with cotinine levels in urine of heavy smokers (253,254) Mice receiving 1mg/kg nicotine thrice weekly had an average urine cotinine concentration of 3000ng/ml. Mice that received 25mg/kg nicotine by transdermal patch had an average cotinine concentration of 5000ng/ml cotinine in their urine Cotinine levels in urine are often in a wide range of concentration due to the variance of urine collection volumes. In human smokers, cotinine concentrations have been reported in values ranging from 1500ng/ml to 8000ng/ml (253 255)

PAGE 86

70 Chapter 3: An orally available small molecule disruptor of Rb Raf 1 interaction inhibits cell proliferation, angiogenesis and growth of human tumor xenografts in nude mice Abstract Though it is well established th at cyclin dependent kinases phosphorylate and inactivate Rb, the Raf 1 kinase physically interacts with Rb and initiates the phosphorylation cascade early in the cell cycle. We have identified an orally active small molecule, RRD 251 (Rb Raf 1 Disruptor 251), that potently and selectively disrupts the Rb/Raf 1 but not Rb/E2F, Rb/Prohibitin, Rb/Cyclin E and Rb/HDAC binding. The selective inhibition of Rb/Raf 1 binding suppressed the ability of Rb to recruit Raf 1 to proliferative promoters and inhibited E 2F1 dependent transcriptional activity. RRD 251 inhibited anchorage dependent and independent growth of human cancer cells; and knockdown of Rb with shRNA or forced expression of E2F1 rescued from RRD251 mediated growth arrest. Oral treatment of mice re sulted in significant tumor growth suppression only in tumors with functional Rb; and this was accompanied by inhibition of angiogenesis, inhibition of proliferation, decreased phospho Rb levels, and inhibition of Rb/Raf 1 but not Rb/E2F1 binding in vivo Thus, selective targeting of Rb Raf 1 interaction appears to be a promising approach for d eveloping novel

PAGE 87

71 anti cancer agents. Introduction The retinoblastoma tumor suppressor protein, Rb, is a vital regulator of the mammalian cell cycle and its inactivat ion facilitates S phase entry (256,257) Rb is inactivated through multiple waves of phosphorylation during cell cycle progression, mediated by kinases associated with D and E type cyclins in the G1 phase (20,258) Rb is inactivated in most cancers, either by mutation or deletion of the gene, interaction with viral oncoproteins, or alterations in the levels and activity of upstream regulators of Rb function (1,38,259,260) Rb controls the G1/S boundary by repressing the transcriptional activity of the E2F family of transcription factors, especially E2Fs 1, 2, and 3 (30) Many genes necessary for DNA synthesis and cell cycle progression, such as cyclins A and E cdc2 thymidylate synthase DHFR ORC1 and DNA polymerase require E2F for their expression (49,54,69,124) While cyclins and cdks phosphorylate Rb in mid to late G1 phase releasing transcriptionally active E2F (22,23,261) Raf 1 kinase binds an d phosphorylates Rb early in the G1 phase (173) Disruption of this Rb/Raf 1 interaction by an eight amino acid peptide (corresponding to Raf 1 residues 10 18) prevented Rb phosphorylation even late in the G1 phase, suggesting that the binding of Raf 1 is necessary for the eventual inactivation of Rb (209) Further, the level of Rb Raf 1 interaction is elevated in NSCLC tissue compared to the adjacent normal tissue (215) suggesting that this interaction

PAGE 88

72 contributes to the oncogenesi s of these tumors. These observations suggested that disruption of the Rb/Raf 1 interaction might have anti cancer effects and raised the possibility that small molecules that can disrupt the Rb/Raf 1 interaction might be useful as novel anticancer drugs. Here we report a potent and selective small molecule disruptor of Rb/Raf 1 interaction that significantly inhibits angiogenesis and tumor growth in vivo in an Rb dependent manner. Results GFGFK a pentapeptide corresp ondin g to amino acids 13 1 8 of Raf 1 is sufficient for complete disruption of Rb Raf 1 interaction Previous work from our lab had shown that a peptide ISNGFGFK which corresponds to amino acids 10 18 on Raf 1 disrupts the Rb Raf 1 interaction (209) I n an effort to design peptide mimics or disruptors of this interaction we first performed an alanine scan to determine the minimum requirements for Rb Raf 1 disruption. To this end, eight amino acid peptides were synthesized with each position replaced wit eight amino acids synthesized were named A1 A8 corresponding to A for Alanine (Figure 12A ) Figure 12 shows that amino acids 10, 11 and 12 (I,S or N) are not required for Rb Raf 1 disruption. However, replacement of any amino acids 13 15 (GFGFK) with alanine was detrimental (Figure 12B ) A peptide with the sequence FGFK could not disrupt the Rb Raf 1 interaction indicating that amino acid 13 (G) was necessary for complete disruption (Figure 12C) A pept ide with

PAGE 89

73 the amino acids ISNG also could not inhibit the Rb Raf 1 binding. Thus, t he minimum amino acids responsible for Rb Raf 1 disruption were GFGFK. This peptide could disrupt Rb Raf 1 as efficiently as the Raf 1 peptide (Figure 12 D ) Although peptid es are useful for targeting specific sequences of proteins in vitro to disrupt their interactions or enzymatic activity, they are of limited use as drugs in vivo This is because they are degraded very quickly and delivery into cells is problematic. At th e same time, information generated from studies on peptides can be fruitfully used to generate peptidomimetic drugs or other small molecules to target the interaction. Our future studies will use the GFGFK motif to generate new RB Raf 1 disruptors. Given that the small peptide could disrupt the binding of two relatively large proteins, we embarked on identifying small molecules that can disrupt the binding of Raf 1 to Rb.

PAGE 90

74 Figure 12. GFGFK pentapeptide is necessary for disruption of the Rb Raf 1 interaction. (A ) Alanine scan of 8 amin o acid Raf 1 peptide. (B ) Binding of 35 S Raf 1 to GST Rb or unprimed GST in the presence or absence of 1 M of the peptides. (C) FGFK peptide is not sufficient to disrupt Rb Raf 1 binding (D) GFGFK of the Raf 1 peptide is required for disruption of Rb/Raf 1 binding.

PAGE 91

75 Identification of the small molecule Rb Raf 1 disruptor, RRD 251 An ELISA was used to identify compounds that could inhibit the binding of GST Rb to GST Raf 1. Screening of the NCI dive rsity library of 1,981 compounds by Piyali Dasgupta identified two compounds, NSC 35400 and NSC 35950, which inhibited Rb Raf 1 interaction 100% and 95% respectively at 20 M concentration. NSC 35400 and NSC 35950 each contained a benzyl isothiourea derivat ive and a phenyl based counter ion (Figure 13A) ; to establish whether the benzyl isothiourea derivative is the active component laboratory at the Moffitt Cancer Center synthesized RRD 251 (Figure 13A ) which was similar to NSC 35400 bu t contains chloride as the counter ion. ELISA analysis showed that NSC 35400 could disrupt the Rb Raf 1 interaction with an IC 50 of 81 4nM; NSC 35950 had an IC 50 of 283 46nM, while RRD 251 had a value of 77 3.6 nM (Figure 13B ) suggesting that the ben zylisothiouronium pharmacophore disrupts the Rb Raf 1 interaction IC 50 assays were done by Piyali Dasgupta ELISAs showed that the Rb/Raf 1 binding disruptors were highly selective for Rb/Raf 1 interaction over Rb/E2F1, Rb/HDAC1, Rb/prohibitin (Figure 1 3C) and Raf 1/Mek (Figure 13D) associations at a concentration of 20 M.

PAGE 92

76 Figure 13. Identification of highly specific and selective Rb Raf 1 inhibitors. (A) Chemical structures of compounds identified in the NCI diversity set that showed the highest inh ibition of Rb Raf 1 by ELISA. Highest scoring compounds NSC 35400 and NSC 35950 are both benzyl isothiourea derivatives. RRD 251 was synthesized to determine activity based on isothiourea structure. (B) NSC35400, NSC35950 and RRD 251 disrupt the Rb Raf 1 i nteraction with high potency. IC 50 values (81nM, 283nM and 77nM, respectively) were determined using ELISA. (C) Rb Raf 1 inhibitors at 20 M concentration do not inhibit other binding partners to Rb (E2F1, prohibitin and HDAC1) and to Raf 1 (Mek).

PAGE 93

77 RRD 25 1 inhibits cell proliferation in a wide range of cell lines Since d isruption of the Rb Raf 1 interaction in cells via the Raf 1 peptide conjugate was capa ble of preventing S phase entry, we evaluated the efficacy of RRD 251 to prevent S phase entry in th e A549 NSCLC cell line. RRD 251 could inhibit A549 S phase entry with an IC 50 of 15.93 M (Figure 14A) It was next examined whether RRD 251 could inhibit the proliferation of cells that have mutations in the signaling pathways that impinge on Rb function, rather than in the Rb gene itself. RRD 251 could inhibit S phase entry by 50 65% in pancreatic cancer cell lines such as Aspc1, PANC1, and CAPAN2 that harbor a non functional p16INK4a gene (262) (Figure 14B) RRD 251 also inhibited S phase entry in two glioblastoma cell lines U87MG and U2 51MG, both of which are null for p16 and PTEN (263) The metastatic human breast cancer cell line MDA MB 231 harbors a K Ras mutation and overexpresses EGFR (264) ; RRD 251 was able to inhibit its proliferation by 56% (Figure 14B ). The A375 melanoma cell line harbors the V600E B Raf mutation (265) and RRD 251 inhibited S phase entry by 58%. Prostate cell lines LNCaP and PC3 both contain mutations in K Ras and PTEN genes (266) and RRD 251 inhibited proliferation 86% and 35% respectively (Figure 14B) These results indicate that treatment with RRD 251 could inhibit the proliferation of cell lines harboring a wide array of mutations in upstream sign aling molecules and cell cycle regulators.

PAGE 94

78 Figure 14. RRD 251 inhibits S phase entry. (A) RRD 251 inhibits A549 S phase entry in BrdU assays with an IC 50 of 15.93 M. (B) BrdU incorporation assays showing the growth arrest mediated by RRD 251 in a vari ety of tumor cell lines harboring various mutations. RRD 251 could effectively arrest cells with mutations in EGFR, p16 PTEN, K Ras and p53

PAGE 95

79 Inhibition of proliferation by RRD 251 is dependent on Rb status Given the ability of RRD 251 to inh ibit Rb pho sphorylation it was examined if it could inhibit cell proliferation and whether such an inhibition required a functional Rb gene. RRD 251 was effective at inhibiting serum induced S phase entry in parental A549 cells but had no effect on cells stably expr essing sh6 and sh8, which lacked Rb ( Figure 15A). We further examined RRD 251 treatment on cancer cell lines containing Rb mutations that render Rb non functional. Osteosarcoma Saos 2 cells that have a loss of Rb (23 4) were not sensitive to treatment with RRD 251 while the U2 OS osteosarcoma cells carrying wild type Rb could be inhibited efficiently (Figure 15B) In prostate cancer cell lines, RRD 251 was unable to inhibit proliferation in the Rb mutant DU145, yet co uld inhibit 60% of S phase cells in PC3 cells (wt Rb) (Figure 15B) RRD 251 did not inhibit proliferation in the lung cancer cell lines H596 and H2172, both of which harbor mutations in Rb, yet treatment with RRD 251 in H1650 and H1299 (wt Rb) could inhibi t proliferation 90% and 70% respectively (Figure 15B)

PAGE 96

80 Figure 15. RRD 251 inhibits S phase entry is dependent on Rb status. (A) A549 cells stably expressing shRNA to two different Rb constructs display almost complete knockdown of Rb protein (B) B rdU incorporation assay showing that 20 M of RRD 251 does not inhibit the proliferation of A549 cells over expressing shRNA constructs to Rb, but arrests wild type A549 cells and a non homologou s (NH) control shRNA. RRD 251 also does not inhibit S phase en try in cancer cell lines that contain mutant Rb.

PAGE 97

81 Melanoma and Pancreatic cell lines are sensitive to RRD 251 Next, the compounds were analyzed for inhibition of cell proliferation in several pancreatic cancer and melanoma cells lines, which have elevated MAP kinase activity as a result of Ras mutations or B Raf mutations. RRD 251 was found to have the greatest effect on cell viability in three melanoma cell lines (SK MEL 2, SK MEL 5, SK MEL 28) compared to agents that prevent the MAPK pathway such as BAY 43 9006 and PD 98089 (Figure 16A B) These results are independent of B Raf status; SK MEL 2 contains wild type B Raf and SK MEL 5 and SK MEL 28 harbor V600E B Raf mutation. BAY 43 9006 is a multi kinase inhibitor that was found to target B Raf, Raf 1, Flt 1, C kit and several other receptor tyrosine kinases (RTKs). In addition, treatment of RRD 251 in melanoma cell lines was compared to the standard of care for melanoma Dacarbazine (DTIC); melanoma cells were significantly more sensitive to RRD 251 treatm ent compared to DTIC (Figure 16C) The aforementioned melanoma cell lines were very sensitive to RRD 251 treatment in cell viability assays, this increased sensitivity was not observed in other cell lines such as A549 lung cancer cell line (data not shown) One surprising finding was that treatment of the melanoma cell lines resulted in apoptosis as shown by TUNEL staining (Figure 17A B) To confirm these results, PARP cleavage was assessed as a marker for apoptosis. SK MEL 28, and not A549 displayed signif icant PARP cleavage as early as 4 hours from treatment with RRD 251 (Figure 17C) Again, RRD 251 was more effective at inducing apoptosis in SK MEL 28 compared to DTIC as

PAGE 98

82 examined by PARP cleavage (Figure 17D) experiments done in Figure 17C D were perfor med by Sandeep Singh

PAGE 99

83 Figure 16. Melanoma cells are most sensitive to treatment with RRD 251. (A) Treatment with RRD 251 at increasing doses (1, 5, 10, 20 and 50M) inhibits cell proliferation in comparison to BAY 43 9006 and PD98089 at the sa me concentrations in two B Raf V600E mutant cell lines (B) RRD 251 displays significant inhibition of cell viability in SK M EL 2 wild type B Raf cell line (C) RRD 251 has a greater effect on melanoma cells compared to standard of care chemotherapy DTIC.

PAGE 100

84 Figure 17. RRD 251 induces apoptosis in melanoma cell lines. (A) RRD 251 (20 M) induces 40% apoptosis as shown by TUNEL assays. (B) Brightfield images of TUNEL staining on treated vs. non treated melanoma cells (C). RRD 251 induced apoptosis at 4 hou rs in SK MEL 28 and not A549 as shown by PARP cleavage. (D) RRD 251 induced significantly more apoptosis in SK MEL 2 and SK MEL 28 compared to DTIC, cisplatin was used as a control.

PAGE 101

85 Another cell line found to have increased sensitivity to RRD 251 trea tment in cell viability assays was the pancreatic cancer cell line, PANC1. We expanded this observation by comparing the treatment of RRD 251 on pancreatic canc er cell line PANC1 to the immortalized pancreatic ductal epithelial cell line HPDE6C7. PANC1 can cer cells were more sensitive to treatment with RRD 251 than HPDE6C7 (Figure 18A B) In addition to the cell line comparison, RRD 251 inhibited cell proliferation more than standard of care chemotherapy for pancreatic cancer, Gemcitabine and 5 Fluorouracil (Figure 18A) RRD 251 treatment was also compared to inhibitors of the Ras/MAPK pathway (BAY 43 9006 and PD98059) and found to be more effective at inhibiting the cancerous PANC1 compared to the immortalized pancreatic ductal cell line HPDE6C7 (Figure 18B ) Next, we examined the ability of RRD 251 to prevent soft agar colony formation. Ability to grow independent of a substratum is a feature of cancer cells and growth in soft agar measures the ability of cells to grow in an adherence independent manner. E xperiments were conducted on a panel of five cell lines to assess whether RRD 251 affected their growth in soft agar. Treatment with RRD 251 (100 M) twice a week could significantly inhibit the growth A549, H1650, PANC1, SK MEL 5 and SK MEL 28 colonies in soft agar (Figure 19)

PAGE 102

86 Figure 18. RRD 251 inhibits cell viability in PANC1 cancer cells (A) RRD 251 inhibits cell proliferation in PANC1 cells better than standard of care therapy; 5 Fluorouracil or Gemcitabine (B) Inhibiting Rb Raf 1 with RRD 251 is more effective than the multikinase inhibitor BAY 43 9006 or PD98059

PAGE 103

87 Figure 19. RRD 251 inhibits colony formation in soft agar. RRD 251 (100 M) dosed thrice weekly inhibits the adherence independent growth in A549, H1650, PANC1, SK MEL 5, and SK MEL 28 cells.

PAGE 104

88 RRD 251 displays high specificity for Rb Raf 1 interaction The specificity of RRD 251 for the Rb Raf 1 interaction in living cancer and normal cells was examined by immunoprecipitation western blot analysis (IP WB). H1650 or HUVEC c ells were serum starved for 48 hours and subsequently serum stimulated for 2 hours in the presence or absence of RRD 251 at 100nM, 1 M, 5 M, 10 M and 20 M. In the NSCLC H1650 cell line, RRD 251 inhibited the Rb Raf 1 interaction with an IC 50 of 444nM ( Figu re20 A B) In the normal HUVEC cell line RRD 251 disrupted Rb Raf 1 interaction with an IC 50 of 903nM (Figure 20 C D)

PAGE 105

89 Figure 20. RRD 251 specifically targets Rb Raf 1 interaction in living cells. (A) RRD 251 inhibits the Rb Raf 1 interaction in v ivo in H1650 cells. (B) The IC 50 for disruption in H1650 was 444nM. (C) RRD 251 inhibits the Rb Raf 1 interaction in vivo in HUVEC cells. (D) The IC 50 for disruption in HUVEC cells was 903nM.

PAGE 106

90 RRD 251 is selective for Rb Raf 1 interaction The select ivity of RRD 251 for Rb Raf 1 interaction in living cells was next examined by IP WB. A549 cells were serum starved for 72 hours and subsequently serum stimulated for 2 hours in the presence or absence of 20 M of NSC 35400, NSC 35950, and RRD 251; Raf 1 pe ptide conjugated to penetratin (209) was used as a positive control and a Raf 1 scrambled peptide was used as a negative control. It was found that the compounds inhibited the serum stimulated binding of Raf 1 to Rb (Figure 21A) but the binding of Rb to E2F1 was not affected experiments done in Figure 21A were performed by Piyali Dasgupta To further confirm the selectivity of RRD 251, cyclin E was immunoprecipitated from lysates of quiescent cells or those serum stimulated for 8 hours in the presence or absence of RRD 251; western blotting of the immunoprecipitates showed that RRD 251 did not inhibit the binding of Rb to Cyclin E (Figure 21B) Since B Raf has been shown to bind to Rb in in vitro pull down assays (209) a similar experiment was done on lysates from cells that were serum stimulated for 2 hours; RRD 251 did not inhibit the binding of B Raf to Rb (Figure 21C) Similarly, the binding of Raf 1 to Mek1/2 was not aff ected by RRD 251 (Figure 21D)

PAGE 107

91 Figure 21. RRD 251 is selective for Rb Raf 1 interaction in living cells (A) Serum stimulated binding of Raf 1 to Rb is inhibited by Rb Raf 1 disruptors (20 M) as well as a Raf 1 peptide conjugated to penetratin, the drugs do not inhibit the binding of E2F1 to Rb. Further selectivity of the disruption was assessed by IP western blots (B) RRD 251 does not inhibit Rb Cyclin E interaction in cell serum stimulated for 8 hours. (C) RRD 251 does not disrupt the Rb B Raf binding in IP Western Blots. (D) Treatment of cells with RRD 251 for 5 minutes in the presence of serum does not affect the binding of MEK1/2 to Raf 1.

PAGE 108

92 Next the ability of RRD 251 to disrupt Rb Raf 1 interaction in vivo was examined by double immunofluorescence experiments in U2 OS cells. Serum starved cells display low amounts of Raf 1 (red) in the cytoplasm. However, upon serum stimulation for 2 hours, Raf 1 translocates to the nucleus where it binds to Rb (green), areas of co localization can be visualized in yellow. Treatment with RRD 251 in the presence of serum displays no evidence of co localization (yellow) (Figure 22) This result verifies that RRD 251 can disrupt the Rb Raf 1 interaction in intact cells

PAGE 109

93 Figure 22. RRD 251 can inhibit R b Raf 1 colocalizatio n U2OS cells were immunostained with an anti Raf 1 polyclonal antibody and an anti Rb mouse monoclonal antibody, and the proteins were visualized by confocal microscopy.

PAGE 110

94 RRD 251 inhibits Rb phosphorylation independe nt of kinase inhibition Phosphorylation of Rb is necessary for inactivation of Rb and cell cycle progression to occur. Previous studies with the Raf 1 peptide revealed that inhibition of Rb Raf 1 interaction resulted in inhibition of phosphorylation of R b. Examination of lysates from cells serum stimulated for 2 hours (time point when Raf 1 binds and phosphorylates Rb) in the presence of RRD 251 showed a reduction in Rb phosphorylation, as seen by western blotting (Figure 23A) At the same time, in vitro kinase assays showed that RRD 251 did not affect the kinase activities associated with Raf 1 (Figure 23B C) on either MEK or Rb substrates, cyclin D on Rb substrate (Figure 23D) or cyclin E on Histone H1 substrate (Figure 23E) cyclin D and E kinase assay s were performed by Piyali Dasgupta These results suggest that the reduction in Rb phosphorylation in cells treated with RRD 251 is due to a disruption in the association of Raf 1 with Rb and that Raf 1 has to physically interact with Rb to inactivate it.

PAGE 111

95 Figure 23. RRD 251 does not affect kinase activity. (A) RRD 251 inhibits Rb phosphorylation at the time point when Raf 1 binds to Rb, 2 hours (B C) RRD 251 treatment does not inhibit Raf 1 kinase activity on MEK (B) or Rb (C) in in vitro kinase assays; BAY 43 9006 was used as a control. (D) RRD 251 does not inhibit cyclin D kinase activity in in vitro kinase assays. (E) RRD 251 does not inhibit cyclin E kinase activity in in vitro kinase assays.

PAGE 112

96 RRD 251 inhibits E2F transcriptional activity We next reasoned that if the disruption of the Rb/Raf 1 binding has functional consequences on cellular physiology, then RRD 251 should affect the transcriptional activity of E2F1. To examine this, transient transfection experiments were done in control A 549 cells as well as A549 cells stably expressing two different shRNA constructs (sh6 and sh8) targeting Rb; these A549 cells had significantly less Rb protein compared to parental A549 cells Transfection of E2F1 induced the expression of an E2 CAT report er; treatment of the transfected cells with RRD 251 repressed E2F1 mediated transcription in a dose dependent manner (25 100 M) in wild type A549 cells but not in the A549 cells lacking Rb (Figure 24A) ; this suggests that the presence of Rb is necessary fo r RRD 251 to function E2 CAT reporter assays done in Figure 24A were done by Smitha Pillai The effect of RRD 251 on the expression of two endogenous E2F regulated proliferative promoters was next examined. A549 cells were serum starved for 72 h and serum stimulated for 24h in the presence or absence of RRD 251 (20 M) and the level of thymidylate synthase ( TS ) and cdc6 gene expression was assessed by Real time PCR. It was found that inhibition of the Rb Raf 1 interaction correlated with the silencing of th e TS and c dc6 genes (Figure 24B) We had reported that Raf 1 can be detected on proliferative promoters upon serum stimulation and these results indicate that RRD 251 probably affects E2F mediated transcription by dissociating Raf 1 from the promoters. We had shown that the binding of Raf 1 to Rb resulted in the

PAGE 113

97 dissociation of the co repressor Brg 1 from E2F responsive proliferative promoters (209) ; chromatin immunoprecipitation assays were carried out to examine wh ether RRD 251 affects this process. It was found that the association of Raf 1 to the above promoters upon serum stimulation for 2 hours was disrupted by pre treatment of cells with RRD 251 (20 M) (Figure 24C) Furthermore, dissociation of the co represso r Brg 1 from these promoters was also inhibited by RRD 251. This suggests that RRD 251 can modulate the transcriptional regulatory functions of Rb by modulating its phosphorylation status and affecting its interaction with chromatin remodeling proteins li ke Brg 1. The association of E2F1, HDAC1 and HP1 with these promoters was not affected by RRD 251, as seen by ChIP assays (Figure 24C) ChIP assays done in Figure 24C were performed by Piyali Dasgupta

PAGE 114

98 Figure 24. RRD 251 Inhibits E2F transcript ional activity (A) RRD 251 inhibits E2F1 mediated E2CAT transcription in CAT reporter assays. (B) RRD 251 inhibits TS and cdc6 gene expression in real time PCR experiments. (C) ChIP assays show that Brg1, not Raf 1 is present on quiescent A549 cdc6, cdc25A and TS promoters. Upon serum stimulation, Brg1 dissociates from the promoters, correlating with Raf 1 binding. Serum stimulation in the presence of RRD 251 causes the dissociation of Raf and retention of Brg1 on E2F1 responsive promoters. Serum stimulati on for 16 hours causes dissociation of Rb, Raf 1, Brg1, HDAC1 and HP1 from the promoters. An irrelevant antibody was used as a control for immunoprecipitations; c fos promoter was used as a negative control.

PAGE 115

99 RRD 251 inhibits angiogenesis in vitro and in vi vo Raf 1 kinase has been shown to play a role in facilitating angiogenesis (210,267) and it has been suggested that Raf 1 mediated inactivation of Rb is involved in the process (209) We first examined A549 cells treated with RRD 251 for VEGF levels in culture media. Asynchronously growing A549 cells treated with RRD 251 for 24hours with either 20 M or 50 M displayed a significant decrease in VEGF levels (Figure 25A) To exa mine whether angiogenic tubule formation could be inhibited by RRD 251, human umbilical vein endothelial cells (HUVECs) were grown in matrigel in the presence or absence of 20 M RRD 251; RRD 251 significantly inhibited the angiogenic tubule formation (Figu re 25B) These results were confirmed in an ex vivo experiment using rat aortic rings. As shown in Figure 25C 20 M RRD 251 was able to inhibit angiogenic sprouting from rat aortic rings grown in growth factor rich matrigel for 7 days. Quantitation of vess el area showed a significant reduction in angiogenesis (Figure 25D) Because RRD 251 was able to greatly inhibit angiogenesis in vitro we examined whether RRD 251 could inhibit angiogenesis in matrigel plugs in vivo (251) Aythmic nude mice were injected with cold matrigel in both flanks. Mice were administered either vehicle or RRD 251 50 mg/kg body weight (MPK) by intraperitoneal (i.p.) injection daily for one week. On the last day the mice were injected with 100 MPK FITC Dextran via the tail vein. The mice were euthanized and matrigel plugs were fixed in formalin; angiogenesis in the entire plugs were assessed by confocal imaging. FITC images displayed growth of angiogenic

PAGE 116

100 tubules in plugs from mice that received vehicle; in contrast, there was a remarkable inhibition of angiogenic vessel formation in the matrigel plugs from mice treated with RRD 251 (Figure 25E) Quantitation of vessel intensity is plotted as relative angiogenesis per image and shows significant i nhibition, p=0.0004 (Figure 25F) Further examination of the matrigel plugs by H&E staining showed a complete inhibition of cells migrating into the matrigel for vessel formation (Figure 25G)

PAGE 117

101 Figure 25. RRD 251 inhibits angiogenesis in vit ro and in vivo (A) RRD 251

PAGE 118

102 inhibits VEGF levels in asynchronously growing A549 cells when treated at 20 M and 50 M. (B) RRD 251 inhibits Human Umbilical Vein Endothelial cell angiogenic tubule formation in matrigel. (C) RRD 251 inhibits angiogenesis in a rat aorta matrigel model. (D) Quantitation of vessel density. (E) Confocal FITC images of matrigel plugs from nude mice treated with Vehicle or RRD 251 50 MPK daily for one week. (F) Quantitation of FITC vessels in plugs. (G) H&E staining of matrigel plugs from nude mice treated with Vehicle or RRD 251 50 MPK. H&E images display of matrigel plug.

PAGE 119

103 Antitumor activity of RRD 251 The ability of RRD 251 to inhibit cell proliferation, adherence independent growth and angiogenesis de monstrates that it has desirable anti cancer drug properties. This prompted us to assess whether RRD 251 could inhibit tumor growth in vivo in nude mouse xenograft models. Athymic nude mice were implanted s.c. with 1X10 7 A549 cells bilaterally and the tum ors were allowed to reach 200mm 3 in size before oral or i.p. administration of RRD 251 or vehicle (209,248) Tumors from vehicle treated mice grew to an average size of 1040 128 mm 3 ; in contrast, tumors in mice tre ated with RRD 251 did not grow and even regressed slightly (50 MPK i.p.: 145 20mm 3 ; 150 MPK oral 148 32 mm 3 ) (Figure 26A) Oral dose response experiments were carried out on A549 xenografts, which resulted in RRD 251 100 MPK and 150 MPK completely inhib iting tumor growth (Figure 26B) Tumors from vehicle treated mice reached an average size of 996 180 mm 3 ; in contrast, tumors in mice treated with RRD 251 (oral) responded in a dose dependent manner. Complete inhibition was seen in 100 MPK oral: 293 44 mm 3 and 150 MPK oral: 237 67 mm 3 (Figure 26B) A549 xenograft assays in Figure 26A B were done by Adam Carie. Similar results were observed with H1650 xenograft tumors; RRD 251 inhibited tumor growth significantly (2185 326mm 3 in vehicle treated anima ls compared to 557 76mm 3 in RRD 251 (50 MPK i.p.) treated animals) (Figure 26C) We also examined the efficacy of RRD 251 treatment in SK MEL 28/matrigel xenografts since this cell line was most sensitive to treatment with RRD 251. SK MEL 28

PAGE 120

104 cells do not form tumors easily in mice and therefore were used in combination with matrigel (1:1) to allow the tumors to form. Mice treated with RRD 251 50 MPK i.p. had significantly smaller tumors compared to vehicle treated mice (861106mm 3 in vehicle treated mice compared to 34142mm 3 in RRD 251 treated mice) (Figure 26D) These results indicate that disruption of Rb Raf 1 interaction is a viable method for inhibiting several types of tumor s

PAGE 121

105 Figure 26. Intraperitoneal (i.p.) and oral administratio n of RRD 251 inhibits human tumor growth in nude mice (A) A549 cells xenotransplanted bilaterally into the flanks of athymic nude mice were allowed to grow for 14 days until tumor volume reached 200mm 3 ; daily administration of RRD 251 at 50 MPK i.p. and 1 50 MPK oral completely inhibited tumor growth. (B) Dose response of RRD 251 administered by oral gavage, 100 MPK and 150 MPK could completely inhibit tumor growth. (C) RRD 251 inhibited H1650 xenograft tumor growth in nude mice. (D) RRD 251 inhibited SK M EL 28 melanoma xenograft tumor growth in nude mice.

PAGE 122

106 The A549 tumors (Figure 27A) were harvested at the end of the treatment and analyzed by immunohistochemistry by staining with hematoxylin and eosin (H&E), Ki 67, phospho Rb (807,811), and CD 3, IHC st aining was performed by Sandy Livingston in the University of South Florida IHC core Histopathological analysis revealed a significant inhibition of proliferation in tumors from RRD 251 treated animals as seen by a reduction in Ki 67 staining (Figure 27A ) ; phosphorylation of Rb was also reduced as seen by staining with an antibody to phospho Rb (Figure 27A) The tumors also showed a reduction in microvasculature, as seen by CD31 staining (Figure 27A) Quantitation of Ki 67 staining, phospho Rb staining an d CD31 staining is shown (Figure 27 B D) To assess whether RRD 251 reached its target, tumors were homogenized and lysates were prepared to assess the inhibition of Rb Raf 1 interaction in vivo RRD 251 was found to specifically inhibit Rb R af 1 but not R b/E2F1 binding in the lysates from tumor xenografts of treated mice (Figure 28)

PAGE 123

107 Figure 27. Tumors treated with RRD 251 display a decrease in proliferative and angiogenic markers (A) Immunohistochemical staining of tumors from mice treated with R RD 251. Tumors were stained with Ki 67 for proliferation, pRb for cell cycle, and CD31 for angiogenesis. (B D) Quantitation of staining intensity for Ki 67, pRb and CD31.

PAGE 124

108 Figure 28. RRD 2 51 disrupts Rb Raf 1 binding in xenograft tumors. Both dos es of RRD 251 inhibit the Rb Raf 1 interaction in tumor lysates without inhibiting Rb E2F1 interaction, as seen by IP Western blots.

PAGE 125

109 Tumor Growth Inhibition by RRD 251 is Rb dependent Since RRD 251 did not inhibit the proliferation of A549 c ells lacking Rb in vitro experiments were done to assess whether tumors generated from these cells can respond to RRD 251 in vivo E xperiment s in Figure 29A were carried out on nude mice carrying tumors from A549 cells stably expressing shRNAs for Rb (sh6 and sh8). Interestingly, these tumors did not respond to RRD 251 and continued to grow at the rate of the vehicle treated tumors (Figure 29 A B) A549 sh6 and sh8 xenograft assays in Figure 29A B were performed by Adam Carie and repeated by Rebecca Kinkade To examine whether the sh6 and sh8 tumors maintained downregulation of Rb, lysates were made from the sh6 and sh8 tumors at the end of the experiment and a western blot was done for Rb. It was found that these tumors lacked Rb, further confirming that RR D 251 specifically targets the Rb Raf 1 protein interaction to inhibit cell proliferation and tumor growth (Figure 29C)

PAGE 126

110 Figure 29. Inhibition of tumor growth is dependent on a functional Rb protein. A549 sh6 and A549 sh8 cells were implanted into the flanks of nude mice. (A B) RRD 251 was unable to inhibit tumor growth in tumors lacking Rb protein. (C) Tumors maintain downregulation of Rb protein at the end of the experiment.

PAGE 127

111 Discussion The Ras/Raf/Mek/MAPK cascade is a proliferative pathway induced by a wide array of growth factors and is activated in many human tumors (175,176,268) and is an attractive target for the development of anti cancer drugs (20 7,208,210,267) Raf 1 kinase itself has been targeted for cancer therapy and two clinical attempts have been made to inhibit Raf 1 activity in patients (190,269,270) It has been shown that signaling pathways throu gh the MAP kinase cascade do not proceed in a linear fashion; instead they have been found to have substrates outside the cascade as well (173,271,272) In this context, the Rb protein appears to be an important cel lular target of the Raf 1 kinase outside the MAP kinase cascade. Analysis of human NSCLC tumor samples revealed elevated levels of Rb Raf 1 binding in tumor compared to adjacent normal controls (215) suggesting that Rb Raf 1 interaction contributes to the oncogenesis of these tumors. While it is established that Rb gene itself is mutated in cancers like retinoblastoma, osteosarcoma and small cell lung carcinoma, the majority of tumors harbor mutations in the upstream regulators of Rb function (1,38) These include genes li ke Ras, PTEN, p16INK4 as well as receptor tyrosine kinases (273 275) Our results show that the disruption of the Rb Raf 1 interaction can be fruitfully utilized to inhibit the proliferation of cells harboring such mutations in the Rb regulatory pathway. Thus we believe that these molecules have the potential to target a wide variety of human cancers.

PAGE 128

112 While inhibitors of cell proliferation, DNA damaging agents as well as microtubule disruptors have widely been us ed as anticancer agents, developments in the past decade have demonstrated that targeting angiogenesis is also an effective way of combating tumor growth (210) Thus humanized antibodies have been approved for use against certain canc ers; further, recent studies suggest that growth factors like PlGF might be potential targets for anti angiogenic therapy (276) In this context, our results show that RRD 251 can not only inhibit cell proliferation, but also inhibit neoangiogenesis in vitro and in vivo Given the published reports that Raf 1 kinase contributes to angiogenesis and that VEGF can indu ce Rb phosphorylation, it is likely that RRD 251 is inhibiting angiogenesis by affecting these molecules (210,277) The ability of RRD 251 to inhibit both cell proliferation as well as angiogenesis might be acting in a two pronged manner to inhibit the growth of tumors in vivo ; these are desirable features in anti cancer drugs. Raf 1 has been shown to play a role in apoptosis, independently of MAPK activation. Raf 1 has prosurvival functions that regulate apopt osis; two different mechanisms have been established for this role (195,278) In one study, Raf 1 is targeted to the mitochondria by Bcl 2 protein promoting resistance to apoptosis (195) Another anti apoptotic mechanism in which Raf 1 was shown to function was through its association with apoptosis signal regulating kinase 1 (ASK1) (278) It can be imagined that our results with apoptosis in melanoma cells may

PAGE 129

113 be reflective of one of these two scenari os. ASK1 also binds to Rb to inactivate it apoptosis (237) Since both Raf 1 and Rb bind to ASK1, it is possible that in certain types of cells (melanoma) these proteins function in an oligomeric complex where Raf 1 is bound to Rb and ASK1, when the Rb Raf 1 interaction is disrupted, ASK1 can then induce apoptosis. Further studies are needed to examine the cell line and stimuli dependency o f this interaction and will be useful for developing novel inhibitors capable of either inducing apoptosis or inhibiting cell proliferation, depending on the cellular context. While it has been difficult to generate small molecule inhibitors of protein protein (269) interactions that are clinically active, recent success in disrupting the hdm2 p53 (279) interaction shows that this is a viable strategy to develop novel anti cancer drugs. Identification of RRD 251 as a cell permeable, orally available, and highly selective inhibitor of the Rb Raf 1 interaction is an example of the practicality of targeting protein protein interaction for cancer therapy. Although we find that RRD 251 inhibits Rb Raf 1 in vitro at nM con centrations in an in vitro ELISA assay, higher concentrations are needed to inhibit cell proliferation as well as growth of cells in soft agar; this finding is similar to what has been observed with other anti cancer drugs such as BAY 43 9006, R547, and Ir essa (212,280,281) At the same time, our in vivo studies show that concentrations can be achieved in vivo where RRD 251 has a significant

PAGE 130

114 therapeutic benefit. The finding that RRD 251 is effective in inhibiting t he proliferation of cells harboring a wide variety of mutations in signaling cascades that inactivate Rb, but does not affect cells carrying mutated Rb or no Rb shows the specificity of this agent. Rb protein has been reported to interact with about one hu ndred proteins in the cell; it can be imagined that small molecules that can maintain the tumor suppressor functions of Rb by disrupting its physical interaction with other proteins would be a fruitful avenue to develop novel anti cancer drugs.

PAGE 131

115 Chapter 4: Nicotine Promotes Tumor Growth and Metastasis in Mouse Models of Lung Cancer Abstract Nicotine is the major addictive component of tobacco smoke. Although it is non carcinogenic, it can induce cell proliferation and angiogenesis in non n euronal cells. Here we show that nicotine significantly promotes the progression and metastasis of tumors already initiated. Nicotine administration either by intraperitoneal (i.p.) injection or transdermal patches caused a remarkable increase in the size of Line1 tumors implanted into BALB/c mice. Once the tumors were surgically removed, nicotine treated mice had markedly higher tumor recurrence as compared to the vehicle treated mice (59.7 % +/ 3.5 vs. 19.5 % +/ 7.7 respectively, p = 0.01, n =16). Nicoti ne also increased metastasis of dorsally implanted Line1 tumors to the lungs. While vehicle treated mice had an average of 0.9 +/ 0.2 lung metastases per mouse, nicotine treated mice had 8.1 +/ 1.7, p = 0.001, n =16. These studies on transplanted tumors w ere extended to a mouse model where the tumors were induced by the tobacco carcinogen, NNK. Lung tumors were initiated in A/J mice by i.p. injection of NNK; administration of 1 mg/kg nicotine three times a week led to an increase in the size as well as the number of tumors formed in the lungs. In addition, nicotine

PAGE 132

116 significantly reduced the expression of epithelial markers, E Cadherin and Catenin in the tumors of A/J mice. We believe that exposure to nicotine, either by tobacco smoke or nicotine supplemen ts might facilitate increased tumor growth and metastasis. Introduction Lung cancer is the predominant cancer in the developed world and its onset is strongly associated with smoking habits (282,283) Despite the e vident linkage of smoking to lung cancer, 30% of smokers diagnosed with lung cancer continue to smoke (284) Tobacco smoke contains a wide array of compound s that are deleterious to health; some of these compounds such as 4 (methylnitrosamino) 1 (3 pyridyl) 1 nitrosonornicotine (NNN) are nicotine derivatives and are highly carcinogenic (218) Th ese molecules can form adducts with cellular DNA, leading to mutations in vital genes like Ras, p53, and Rb (219) While nicotine is the addictive component in cigarette smoke, it is not a carcinogen and cannot initiate tumor formatio n in animals. Nicotine exerts its cellular functions through nicotinic acetylcholine receptors (nAChRs), which are widespread in neurons and neuromuscular junctions (285) nAChRs are pentameric proteins consisting of nine subunits ( 2 10) and three subunits ( 2 4) in non neuronal cells; delta and subunits

PAGE 133

117 are present in neuronal systems (220) Recent studies have shown that nAChRs are also present in a wide array of non neuronal tissues, including human bronchial epithelial cells, human endothelia l cells and astrocytes (220 222) The finding that nAChRs are present on non neuronal cells was followed by the observation that nicotine could induce the proliferation of endothelial cells (221) as well as lung carcinoma cell lines (226) In non neuronal tissues, nicotine has been shown to induce the secretion of growth factors such as bFGF, TGF V EGF, and PDGF (286) Nicotine has been shown to induce migration and invasion of cells vi a phosphorylation of calpain family members (287) Nicotine and its related carcinogens, like NNK, have been found to activate Raf 1, EGFR, Src, Akt and 5 lipooxygenase mediated growth stimulatory pathways (227,288,289) In addition, nicotine has also been found to inhibit apoptosis induced by opioids, etoposide, cisplatin, and UV irradiation in lung cancer cells (290,291) phosphorylate anti apoptotic proteins like Bcl 2, induction of NF B complexes, activation of Akt pathway as well as inactivation of pro apoptotic proteins such as Bad and Bax through phosphorylation in lung cancer cells (292,293) It was found that nicotine could prevent the apop totic activity of gemcitabine, cisplatin and taxol, which are standard therapy for NSCLC, in a variety of human NSCLC cell lines. The protective effects of nicotine involved induction of IAP proteins,

PAGE 134

118 XIAP and survivin in lung cancer cells (290) The anti apoptotic effects of nicotine were mediated by activation of Akt which facilitated the stabilization of XIAP proteins and transcriptional activation of survivin. Nicotine stimulation increased the binding of E2F1 to the survivin promoter (290) These results further support clinical studies that demonstrate how patients who continue to smoke have worse survival profiles than those who quit before treatment (282) These studies also raise the possibility that patients who use nicotine supplements for smoking cessation might reduce the response to chemotherapeutic agents. Recently, the mecha nisms underlying the proliferative signaling of nAChRs have been discovered. It was found that nicotine functions like a growth factor, binding to nAChRs causing a recruitment of arrestin and Src to the nicotinic receptors resulting in the activation of MAPK and the subsequent binding of Rb Raf 1 pathways (215) It was found that the levels of Rb Raf 1 interaction were elevated in human NSCLC tumors compared to normal adjacent tissue (215) (Figure 30A) This result suggested that Rb Raf 1 pathways probably contribute to oncogenesis; the increased presence of Raf 1 on proliferative promoters in human NSCLC tumors suppor ts this hypothesis (215) (Figure 30B) It is likely that t umors exposed to nicotine have a proliferative advantage. Smokers have been found to be less responsive to chemotherapy and were also found to have increased metastasis of breast cancers to the lung (294 296)

PAGE 135

119 Fig ure 30. Rb Raf 1 interaction is elevated in tumors. (A) NSCLC tumors (T) contained more Rb Raf 1 complexes than adjacent normal tissue (N). Rb Raf 1 interaction was assessed by IP WB on nuclear extracts. (B) ChIP assays on human NSCLC tumor samples show t hat more Raf 1 was present on cdc6 and cdc25A promoters in tumor samples compared to normal adjacent tissues. Adapted with permission from Dasgupta et al (215)

PAGE 136

120 The key players mediating the mitogenic effects of nicotine are arrestin 1 and Src kinase Src family kinases are involved in multiple receptor mediated signaling pathways that regulate proliferation, survival, metastasis and angiogenesis. arrestin 1 is vital for nicotine mediated activation of Src and cell proliferation. arrestin 1 family members have been shown to act as scaffold proteins that recruit a variety of signaling molecules to membrane bound receptors in a highly coordinated manner. arrestin 1 is required for nAChR mediated activation of MEK/ERK pathway and proliferation of NS CLCs. Binding of nicotine to nAChRs causes a recruitment of arrestin 1 and Src to the nicotinic receptor resulting in activation of Rb Raf 1 pathways (297) This signaling event causes the recruitment of E2F1, Raf 1 and Rb on E2F responsive proliferative promoters (215) Raf 1 inactivates Rb and facilitates Rb dissociation fr om the promoters and an increase in E2F1 therefore, inducing transcription of S phase genes and further cell cycle progression (215) Understanding of the signaling pathways mediated by nAChRs in cancer cells may be a possible avenue for cancer therapy by targeting either arrestin Src or Rb Raf 1 interactions ( Figure 31) We have shown in Chapter 3 that inhibition of Rb Raf 1 interaction is a viable mechanism for targeted cancer therapy.

PAGE 137

121 Figure 31. Schematic predicting the proliferative signaling by nAChRs in NSCLC cells. Nicotine stimulation causes the a ssembly of oligomeric complexes involving Arrestin, Src and nAChRs, facilitating the activation of Src. This leads to the activation of Raf 1, which binds to Rb; activation of MAPK and cyclins/cdks also occur. The activation of Src facilitates the bindi ng of Raf 1 to Rb and multimeric complexes containing Rb, Raf 1 and E2F1 occupy proliferative promoters. Sustained mitogenic signaling leads to the dissociation of Raf 1 and Rb, while E2F remains bound to the promoter facilitating S phase entry. Disruption of the Rb Raf 1 interaction can block nicotine induced proliferation of NSCLC cells. Adapted with permission from Dasgupta et al (215)

PAGE 138

122 Induction of cell proliferation, enhancement of cell survival and induction of angiogenesis are all effects seen from nicotin e stimulation and they all contribute to the growth and progression of solid tumors in vivo. Studies from the Cooke laboratory have shown that nicotine can induce angiogenesis both in vitro and in vivo (222,223) It has also been shown that second hand smoke could induce tumor angiogenesis and growth (298) nAChR subunits. Interestingly, inhibition of Src or Rb Raf 1 inte raction and not PI3K could efficiently inhibit nicotine induced angiogenesis (297) Although tobacco carcinogens initiate and promote tumorigenesis, recent studies on nicotine raise the possibility that exposure to nicotine either by cigarette substitutes or nicotine su pplements might confer a proliferative advantage for tumors already initiated. Recent studies from the Russo lab has shown that inhibition of nAChRs by cobratoxin can inhibit the growth of A549 tumors in immunocompromised mice (229) ; similarly, i t has been shown that a combination of nicotine and estradiol can promote the growth of A549 tumors in athymic mice (230) While these studies suggest a role for nAChRs in tumor growth, there are no studies demonstr ating the effect of nicotine as a single agent on tumor growth and metastasis in immunocompetent mice. Studies presented here show that nicotine by itself can induce the growth and metastasis of tumors in immunocompetent mice, independent of other tobacco carcinogens. Nicotine administered intraperitoneally or by commercially available transdermal

PAGE 139

123 patches could promote tumor growth substantially. Further, mice exposed to nicotine showed significantly enhanced lung metastasis as well as tumor recurrence pos t surgical removal of the primary tumor. Similar effects were observed on implanted tumors as well as tumors induced by the tobacco carcinogen, NNK. These results imply that nicotine can enhance the growth and metastasis of pre established lung tumors. Results Nicotine promotes the growth of tumors in mice To determine the effects of nicotine on tumor growth and metastasis in immunocompetent mice, Line1 mouse adenocarcinoma cells were utilized. Line1 cells form subcutaneous (s.c.) tumors in BALB/c mice, which can metastasize to the lungs (252) To examine whether nicotine induced proliferation of Line 1 cells, the cells were serum starved for 7 2 hours and subsequently stimulated with 1M nicotine for 18 hours. S phase entry was measured using BrdU incorporation assays. Nicotine could efficiently stimulate Line1 cells into S phase and treatment with the Rb Raf 1 disruptor, RRD 251 abrogated nicot ine induced proliferation in Line1 cells (Figure 32) Next, it was examined how nicotine affects the growth and metastasis of Line1 cells implanted into the flanks of BALB/c mice (Figure 33) Female BALB/c mice were injected with 1 million Line1 cells s.c into each flank. The mice were randomized into two groups, with one group receiving vehicle ( n =8) and the second receiving 1mg/kg nicotine ( n =8) thrice weekly by intraperitoneal (i.p.) injection (Figure 33)

PAGE 140

124 Figure 32 Nicotine (1 M) stimulates S pha se entry in Line1 mouse adenocarcinoma cells. Treatment with RRD 251 (20 M) abrogated nicotine induced proliferation in Line1 cells.

PAGE 141

125 Figure 33 Schematic for the experimental design of Line1 tumor growth and metastasis in BALB/c mice. Line1 cell s (1x10 6 ) are injected s.c. into the flanks of shaved BALB/c mice. Mice are randomized into two groups and administered either Vehicle (PBS) or nicotine 1mg/kg thrice weekly for 2 weeks. After two weeks, or when tumors reach 500 700mm 3 the tumors are surg ically removed and the skin is stapled for one week. Mice continue to receive treatment for another 2 weeks or until tumors recurrence is evident.

PAGE 142

126 Mice that received nicotine had significantly larger tumors compared to those receiving vehicle; tu mor volumes averaged 695 +/ 98 mm 3 in vehicle treated mice, compared to 2267 +/ 369 mm 3 in nicotine treated mice (Figure 34A) p = 0.002. Based on the results with nicotine administered i.p., experiments were done to examine whether nicotine administered by over the counter transdermal patches could promote tumor growth. BALB/c mice ( n =16) implanted with Line 1 tumors were randomized into two groups and nicotine patches were applied daily at a dose of 25 mg/kg nicotine. It was found that nicotine administe red by transdermal patches could significantly increase the growth of Line1 tumors; control mice had an average tumor volume of 530 +/ 59 mm 3 whilst nicotine patch mice had an average volume of 871 +/ 106 mm 3 (Figure 34B) p =0.019. Mice wearing nicotine patches also displayed changes in tumor shape, from oval with well defined borders, to polygonal with irregular borders (Figure 34C) potentially suggesting the nicotine treatment confers a more malignant phenotype. These experiments confirm that exposure to nicotine, even through nicotine supplements, might affect pre established tumors.

PAGE 143

127 Figure 34. Nicotine promotes Line1 tumor growth. (A) Nicotine (1mg/kg) significantly promotes the growth of s.c. Line1 tumors when administered thrice weekly by i.p injection. (B) Daily application of nicotine transdermal patches (25 mg/kg) enhanced tumor growth. (C) Mice bearing nicotine patches displayed irregular polygonal shaped tumors compared to control mice.

PAGE 144

128 Nicotine promotes re growth and metastasis of tumo rs in mice Since nicotine was found to enhance tumor growth, experiments were conducted to assess its effect on tumor metastasis. In order to examine this, the implanted tumors were surgically removed after 14 days of treatment or once they reached 500 700mm 3 Tumors were removed to prevent discomfort from large tumors. Mice were anesthetized for tumor removal, and wounds were stapled closed. After the removal of staples, mice were administered vehicle or nicotine by i.p. injection for an additional 14 d ays. Interestingly, mice treated with nicotine showed a higher rate of tumor recurrence after the tumors were surgically removed (Figure 35A) ; vehicle treated mice displayed an average of 19 +/ 7% tumor recurrence, as compared to an average of 59 +/ 3% tu mor recurrence in nicotine (1mg/kg) treated mice, p = 0.01. Tumor recurrence was calculated as percentage of recurring tumors out of the total number of tumors removed. Mice receiving the vehicle had an average of 0.9 +/ 0.2 metastatic foci in the lungs pe r mouse; in comparison, mice that received nicotine, 1 mg/kg thrice weekly, had an average of 8.1 +/ 1.7 foci in the lungs per mouse, p=0.001 (Figure 35B) As shown in Figure 35C nicotine treated mice also displayed significantly greater number of lung m etastases as well as larger metastatic foci compared to those receiving vehicle. In addition, histologic examination of the lung tumors revealed larger metastatic foci in the nicotine treated mice (Figure 35D)

PAGE 145

129 Figure 35. Nicotine increases metastatic p otential. (A) Nicotine treated mice (1mg/kg) displayed higher incidence of tumor recurrence following surgical removal of tumors compared to the vehicle control group p =0.01, n =16. (B) Graph displaying the average total number of lung tumors per mouse in v ehicle and nicotine treated mice, p =0.001, n =16. (C) Nicotine treated mice display significantly more lung metastasis from primary Line1 subcutaneous (s.c.) tumors. (D) H&E staining of lungs from vehicle and nicotine treated mice, nicotine treated mice dis play larger tumors.

PAGE 146

130 Nicotine enhances the growth of tumors induced by tobacco carcinogens Experiments were designed to examine the effects of nicotine on tumors induced by the tobacco carcinogen, NNK; this experimental system mimics a situation where tumo rs are initiated by a carcinogen, followed by exposure to nicotine alone. Towards this purpose, A/J mice ( n =16) were treated with 100mg/kg NNK once a week for five weeks to initiate tumor formation and subsequently they were randomized into two groups. One group of mice received the vehicle (PBS) ( n =8) whilst the second group received nicotine 1mg/kg ( n =8) thrice weekly by i.p. injection; mice were treated with nicotine or vehicle for 28 weeks (Figure 36) At necropsy, lungs from both vehicle and nicotine t reated mice had tumors (Figure 37A B) H&E stained lung sections, from both groups, we re scanned and a pathologist (Dr. Domenico C oppola, Moffitt Cancer Center Pathology ) outlined the tumor. The size and number of tumor foci were quantitated. Mice that rec eived PBS after NNK injections had an average of 10 +/ 3 lung tumors per section and mice that received nicotine 1mg/kg had 16 +/ 3 tumors per section (Figure 37C) p =0.01. Tumor size was also increased in nicotine treated mice (Figure 37D) This sugges ts that exposure to nicotine of pre established tumors can result in enhanced tumor growth.

PAGE 147

131 Figure 36. Schematic for NNK induced carcinogenesis experimental design. A/J mice were administered 100 mg/kg NNK once a week for 5 weeks and subsequently ran domized into two groups. The control group received the vehicle (PBS) thrice weekly and group two received nicotine 1mg/kg thrice weekly by i.p. injection. Treatment with nicotine or PBS continued for 28 weeks. At endpoint, mice were sacrificed and lungs w ere examined for tumors.

PAGE 148

132 Figure 37. Nicotine (1 mg/kg) increases number and size of NNK induced lung tumors. (A) H&E staining of transverse sectioning of lungs. (B) Representative scanned images of H&E stained coronal lung sections. (C) Nicotine increases the average number of lung tumors per mouse p =0.01, n =8. (D) Nicotine increased tumor area.

PAGE 149

133 Nicotine facilitates EMT like changes in lung cancers Given the observation that nicotine can induce tumor growth and promote metastasis, attempts w ere made to understand the molecular events mediating these processes. Epithelial mesenchymal transition (EMT) is a phenomenon by which cells lose their epithelial phenotype and acquire more mesenchymal features that facilitate detachment and migration. We examined the tumors in A/J mice for changes consistent with an EMT like phenomenon, using immunohistochemical staining for E cadherin and Catenin, two proteins involved in the adhesion of epithelial cells. Catenin binds to E Cadherin to facilitate c ell adhesion and to exert its signaling functions. E cadherin levels were found to be significantly decreased in the tumors of mice treated with nicotine (Figure 38A) E Cadherin staining was performed by Sarmistha Banerjee ; the results are quantified in F igure 38B The same mice revealed a loss of the typical Catenin membranous staining pattern in their lung tumors (Figure 38C) Catenin staining was performed by Sandy Livingston in the USF IHC core ; the results are quantitated in Figure 38D

PAGE 150

134 Fi gure 38 Nicotine reduced expression of epithelial markers (A) E cadherin staining of A/J lung tumors induced by NNK or NNK+ Nicotine. (B) Quantitation of E cadherin intensity in tumors. (C) Catenin staining of A/J lung tumors induced by NNK or NNK and nicotine. (D) Quantitation of membranous Catenin.

PAGE 151

135 Discussion Several observations suggest that those exposed to tobacco carcinogens are more likely to develop larger, more vascularized tumors with a high propensity for metastatic spread and resi stance to chemotherapy (296) In addition, about 30% of lun g cancer patients who are smokers continue to smoke after they have been diagnosed (282) T his is problematic, as smokers who continue to use tobacco after a cancer di agnosis or return to smoking, experience increased adverse medical consequences, such as: increased tumor progression, development of a second cancer, greater recurrence following successful treatment, greater cancer related mortality, and reduced quality of life (299,300) While these studies strongly demonstrate a role for tobacco carcinogens in the initiation, growth and progression of cancers, the relative contribution of nicotine by itself to these processes i s not known. This is a significant aspect, since the use of nicotine supplements is usually part of most cigarette smoking cessation programs. Nicotine supplementation through patches, nasal sprays, chewing gum, etc., is now widely used to assist in smoki ng cessation. The serum concentrations of nicotine achieved with these modalities vary, but the transdermal delivery of nicotine can result in serum concentrations of nicotine that are observed in active smokers (301) Although it is known that nicotine is not carcinogenic, the risks associated with long term nicotine supp lementation are unknown.

PAGE 152

136 While nicotine has been demonstrated to induce cell proliferation, angiogenesis and growth of tumors implanted in immunodeficient mice (229) the studies presented here show for the first time that nicotine could indeed promote tumor growth in two fully immunocompetent mouse models. Further, our results show that the presence of nicotine can enhance the growth of lung tumors induced by a tobacco carcinogen. Essentially, the A/J mouse model is reflective of a situation wh ere a smoker who has tumors initiated in the lung quits smoking and uses nicotine supplements to overcome the craving. Our results also show that a commercially available nicotine transdermal patch can promote the growth of tumors implanted into mice. The finding that epithelial adhesion molecules like E Cadherin and its binding partner Catenin are affected by nicotine provides a molecular basis for these findings. It can be imagined that nicotine, through the nAChR signaling pathways, induces cha nges in gene expression patterns to facilitate EMT and tumor metastasis. Indeed, it has been reported that the expression pattern of nAChR subunits are different in tumors from smokers and non smokers (302) Given t he ability of nicotine to affect various aspects of tumor growth and metastasis, it is possible that antagonists of nAChR signaling might prove beneficial in controlling the growth and progression of lung cancers; certain studies support this contention. Further, such agents that modulate the function of nAChRs such as varenicline, an agonist of 4 2 nAChRs, might be better

PAGE 153

137 alternatives for smoking cessation than nicotine itself. We have shown that RRD 251 is capable of inhibiting nicotine induced proli feration in line1 cells. It has previously been shown that treatment with the Raf 1 peptide to disrupt the Rb Raf 1 function can inhibit nicotine induced cell proliferation, migration, invasion, and angiogenesis in vitro (215,297) In addition to targeting Rb Raf 1, inhibition of Src activation could also prevent nicotine induced angiogenesis in vitro (297) Targeting the key molecules in nicotine mediated tumor progression and metastasis may be a better alternative for smokers wit h NSCLC.

PAGE 154

138 Chapter 5: TNF stimulates proliferative pathways in vascular smooth muscle cells Abstract Atherosclerosis is characterized by hyperplastic neointima and an inflammatory response with cytokines such as TNF TNF is a pleiotropic cytokine that mediates inflammatory, proliferative, cytostatic, and cytotoxic effects in a variety of cell types, including endothelial cells (ECs) and vascular smooth muscle cells (VSMCs) Interestingly, TNF has been shown to play two very opposing roles in the se cell types; it mediates the inhibition of EC proliferation and induction of EC apoptosis while facilitating stimulation of proliferation and migration in VSMCs. Here we show that TNF is capable of stimulating proliferation in rat VSMCs as well human V SMCs in a Raf 1/MAPK dependent manner. TNF could increase the expression of E2F regulated proliferative cdc6 and cdc25A genes in AoSMCs, as seen by real time PCR assays. Surprisingly, we find an activation of the stress induced kinase, JNK1, in VSMCs upo n treatment with TNF TNF was capable of inducing the Rb Raf 1 interaction and treatment with the Rb Raf 1 inhibitor, RRD 251, could prevent TNF induced S phase entry in AoSMCs. In addition, inhibition of Raf 1 or Src kinases using pharmacologic inh ibitors could also prevent S phase entry, while

PAGE 155

139 inhibition of JNK was not as effective. These results suggest that inhibiting the Rb Raf 1 interaction is a potential avenue to prevent VSMC proliferation associated with atherosclerosis. Introduction Deve lopment of atherosclerosis is a stringently regulated and complex process that results from aberrations in endothelial cell and vascular smooth muscle cell (VSMCs) function. Endothelial cells (EC) form the lining of the blood vessels and the heart, functio ning as a barrier by regulating permeability, thrombogenicity, and production of growth inhibitory molecules (243) Endothelial cells also respond to mechanical forces. ECs are contact inhibited under normal conditi ons; but when endothelial cells sense an injury such as abrasion of a vessel, they proliferate and migrate leading to re endothelialization at sites of injury (244) At the same time, vascular smooth muscle cells proliferate and migrate from the injured arterial wall into the vessel lumen leading to vessel thickening and occlusion, called restenosis (245) Intimal hyperplasia characterized by VSMC proliferation and extracellular matrix (ECM) deposition is a major process contributing to restenosis (246) Atherosclerotic lesions can be blocked if inhibition of VSMCs is effective (243) Several growth fa ctors and cytokines are capable of stimulating VSMC migration and proliferation, such as platelet derived growth factor (PDGF), which plays a vital role in the development of restenosis (247)

PAGE 156

140 PDGF can stimulate VSMC proliferation and migration at sites of stre ss (303) It has been shown that suppression of PDGFR activation can inhibit VSMC proliferation by decreasing activation of its downstream signaling molecules (304 306) PDGF is a potent mitogen that mediates arterial response, and stimulates proliferation and matrix production (307) PDGF signaling leads to downstream activation of proliferative genes that contribute to atheroscl erosis and restenosis. Tumor necrosis factor alpha (TNF ) is a pleiotropic inflammatory cytokine. Accelerated atherosclerosis is characterized by hyperplastic neointima and an inflammatory response with cytokines such as TNF TNF has been shown to play two opposing roles in inhibition of endothelial cell proliferation and enhancement of apoptosis, while stimulating vascular smooth muscle cell proliferation and migration (243,308) Although there are conflicting reports on the ability of TNF to stimulate VSMC proliferation, there is compelling evidence defining the migration stimulating activity of this cytokine (309,310) TNF like other chemoattractants s uch as PDGF, stimulates VSMC migration through the MAPK pathway (240) The apoptosis induced by TNF superfamily requires binding of a ligand to its receptor leading to oligotrimerization of receptors (311 313) This results in aggregation of death domain containing proteins allowing recruitment of TRADD (TNF receptor 1 associated death domain protein). TRADD binds FADD (Fas

PAGE 157

141 associated death domain containing protein) and TR AF 2 (TNF receptor 1 associated protein 2) proteins, which in turn lead to activation of procaspase 8 and apoptosis signal regulating kinase 1 (ASK1), respectively (311,314 316) TNF treatment leads to simultaneou s activation of the ASK1 JNK/p38 death signal (315 318) Reports on the effects of TNF on apoptosis or proliferation in VSMCs are conflicting (308) Several investigations report that TNF itself does not induce VSMC proliferation while other studies suggest TNF induces proliferation of VSMCs through NF B mediated transcription mechanisms (308,319) Regarding apoptosis, there are also inconsistent reports. Certain studies have shown that TNF could induce apoptosis in VSMCs via caspase 3 activation while others found no pro apoptotic activity for TNF in these cells (309) Further investig ations revealed that activity for TNF in VSMCs is dependent on two distinct cell phenotypes: spindle and epithelioid VSMCs, which respond distinctly to diverse stimuli. While TNF induces proliferation in spindle VSMCs, it induced apoptosis in epithelio id VSMCs (308) Although PDGF and TNF have very different signaling intermediates, their downstream functions require MAPK activation. It is therefore important to identify the upstream mechanisms contribut ing to increased proliferation by these two stimuli. Stimulation of VSMCs with PDGF leads to downstream activation of Erk1/2 via the Ras/Raf/MAPK (mitogen activated protein kinase/extracellular signal regulated kinase) pathway. Activated ERK1/2 rapidly tra nslocates to the

PAGE 158

142 nucleus where they target transcription factors that regulate cell cycle progression, such as cyclin D1 (320) Cyclin D1 binds cdk4/6 and together they facilitate S phase entry through phosphorylation of the retinoblastoma (Rb) protein (275) Stimulation of VSMCs with TNF has been shown to enhance proliferation through ERK1/2 (321) although the exact mechanism is not known. The Rb Raf 1 pathway has been shown to play a role in response to mitogens as well as non mitogens and enhance S phase progression of a wide variety of cell lines (209,215) Here, we show that TNF stimulates proliferation in VSMCs by activating Raf 1/MEK/ERK pathway and facilitating Rb Raf 1 in teraction. Results TNF stimulates proliferation of vascular smooth muscle cells Because of conflicting reports on the effects of TNF induced proliferation of VSMCs, we examined the effects of serum, TNF and PDGF on VSMCs by BrdU incorporation as says. Rat A10 cells, which are immortalized vascular smooth muscle cells, were serum starved for 24 hours and subsequently re stimulated with serum, TNF (100ng/ml), or PDGF (100ng/ml) for 18 hours and S phase entry was measured using standard BrdU incorp oration assays. TNF could stimulate proliferation in vascular smooth muscle cells to a certain extent (Figure 39A) In the same manner, we examined the effects of TNF in primary human aortic vascular smooth muscle cells (AoSMCs). As shown in Figure 39B

PAGE 159

143 TNF could stimulate S phase entry comparable to PDGF; serum was used as the positive control.

PAGE 160

144 Figure 39. TNF stimulates proliferation in vascular smooth muscle cells. (A) Rat A10 VSMCs were serum starved and subsequently stimulate d with serum, TNF or PDGF for 18 hours and BrdU incorporation was measured. (B) Similar assay was done using human AoSMCs.

PAGE 161

145 TNF activates Raf/MAPK pathway in vascular smooth muscle cells TNF has been shown to induce migration of vascular sm ooth muscle cells through ERK1/2 activation (240) We wanted to examine if TNF treatment had any effects on Raf 1 kinase in these cells. Treatment of vascular smooth muscle cells with TNF for 10 min, 30 min, 1h and 2 hours led to a shift in Raf 1 migration indicative of Raf 1 phosphorylation, as seen by western blotting (Figure 40A) Indeed, phosphorylated Raf 1 can be seen by western blotting for serine 338 on Raf 1; activation was highest at 1 hour of TNF tr eatment (Figure 40A) ERK1/2 activation was seen in response to TNF and was highest at 30 minutes of treatment (Figure 40A) The stress activated protein kinase/ Jun amino terminal kinase SAPK/JNK is a member of the MAPK family that is potently and pref erentially activated by stresses such as UV irradiation, ceramides and cytokines like TNF (313) In certain instances, JNK can be activated by growth factors (322 324 ) We wanted to examine if TNF was capable of activating stress kinases in a proliferative scenario. To this end, AoSMCs were serum starved and stimulated with TNF or PDGF for 30 minutes (time point when Raf 1 activation and ERK1/2 activation was pres ent). Western blotting for JNK activation using an antibody that recognizes phosphorylated Thr183/Tyr185 residues revealed TNF and PDGF activated JNK in VSMCs ( Figure 40B) Time course studies showed that activation of ERK1/2 and JNK1 occurred at 10 minu tes of stimulation and was highest at 30 minutes, activation went down to basal levels at 2 hours of TNF treatment (Figure 40C)

PAGE 162

146 Figure 40. TNF activates Raf/MAPK pathway in VSMCs. (A) Time course stimulation of AoSMCs results in Raf 1 activation h ighest at 1 hour and ERK1/2 activation peaks at 30 minutes. (B) Activation of ERK1/2 coincides with JNK1 activation from 30 minutes of TNF treatment. (C) PDGF and TNF time course stimulation shows ERK1/2 and JNK activation occurs simultaneously from th e different stimuli.

PAGE 163

147 TNF induced AoSMC proliferation is abrogated by targeting upstream activators of Raf 1 Since TNF led to activation of Raf 1 in vascular smooth muscle cells and Raf 1 has been shown to play a very important role in cell proliferation we examined if vascular smooth muscle cell proliferation could be inhibited via targeting Raf 1 or kinases that activate Raf 1. Both Src and PKC kinases are known to activate Raf 1 in response to growth factor signaling (175) To evaluate the importance of these kinases in TNF induced proliferation, the Src inhibitor PP2 and the PKC inhibitor Ro 31 8220 were used in BrdU incorporation assays. AoSMCs were serum starved and sub sequently stimulated with PDGF or TNF in the presence or absence of the aforementioned inhibitors for 18 hours. BrdU incorporation assays revealed that both inhibition of Src and PKC could efficiently block TNF or PDGF induced S phase entry (Figure 41A ) Targeting upstream of Raf 1 or Raf 1 itself using the multikinase inhibitor BAY 43 9006 could completely inhibit S phase entry induced by PDGF or TNF (Figure 41B) Next we examined if inhibition of downstream activation of JNK could prevent S phase en try induced by PDGF or TNF Inhibition of downstream JNK activation did not significantly block proliferation, suggesting that in order to efficiently block proliferation, activation of Raf 1 should be inhibited (Figure 41B)

PAGE 164

148 Figure 41. Targetin g Raf 1 activation blocks AoSMC proliferation. (A) Src inhibitor (PP2) and PKC inhibitor (Ro 31 8220) block TNF and PDGF induced proliferation. (B) Multi kinase inhibitor BAY 43 9006 that targets Raf 1 can completely inhibit PDGF and TNF induced prolif eration while the JNK inhibitor (SP600125) does not significantly affect TNF induced proliferation.

PAGE 165

149 TNF Since TNF was functioning similar to a growth factor in stimulating cell cycle, we examined if this was in an E2F dependent mechanism. To this end, Real Time PCR was performed on tw o E2F responsive genes from AoSMCs that were serum starved and subsequently stimulated with either TNF or PDGF for 18 hours. TNF could induce cdc25A and cdc6 gene expression 3.5 and 3 fold respectively (Figure 42A B) Next, we examined if in fact E2F1 was present on the proliferative promoter cdc25A in response to TNF Treatment with TNF or PDGF for 18 hours led to an increase in E2F1 on the cdc25A promoter and a dissociation of Rb (Figure 42C) In quiescent cells, we consistently observed a faint band for E2F1 on the cdc25A promoter and the presence of Rb was also detected in starved cells on this promoter. The c fos promoter was used as a negative control.

PAGE 166

150 Figure 42. TNF and PDGF induce E2F regulated genes in AoSMCs. (A) Treatmen t with TNF and PDGF for 18 hours led to 3.5 and 4 fold increase, respectively in cdc25A gene expression in real time PCR assays. (B) Treatment with TNF and PDGF for 18 hours led to 3.5 and 7 fold increase, respectively in cdc6 gene expression in real t ime PCR assays. (C) Treatment with TNF or PDGF led to an increase in E2F1 and dissociation of Rb on the proliferative promoter cdc25A in ChIP assays, c fos was used as the negative control.

PAGE 167

151 TNF induced AoSMC proliferation involves Rb Raf 1 interacti on Our lab has shown the importance of the Rb Raf 1 interaction in mediating proliferation in a wide array of cell lines. Since Raf 1 activation is evident in response to TNF induced proliferation in AoSMCs, we examined if Raf 1 Rb interaction is inv olved in mediating these effects. Treatment with the Rb Raf 1 inhibitor RRD 251 in the presence of TNF or PDGF for 2 hours could efficiently reduce Raf 1 levels in both AoSMCs and rat A10 cells (Figure 43A B) Next, we examined if TNF stimulation of Ao SMCs could induce the Rb Raf 1 interaction, this was done by IP WB analysis. Treatment with TNF and PDGF for 2 hours led to an increase in Raf 1 bound to Rb; in addition there was less E2F1 associated in the TNF and PDGF stimulated complexes (Figure 4 3C) We next examined if RRD 251 could prevent serum, TNF or PDGF induced proliferation in AoSMCs. AoSMCs were serum starved and subsequently stimulated with serum, TNF or PDGF in the presence or absence of 20 M RRD 251. In response to all three stimu li, RRD 251 was capable of inhibiting S phase entry in AoSMCs (Figure 43D) These results suggest that inhibiting Rb Raf 1 interaction and signaling might be a viable alternative to prevent atherosclerosis.

PAGE 168

152 Figure 43. Inhibition of Rb Raf 1 intera ction prevents AoSMC proliferation. (A B) treatment with TNF or PDGF in the presence of RRD 251 inhibits Raf 1 levels in AoSMCs (A) and A10s (B). (C) TNF and PDGF treatment induced Rb Raf 1 binding in AoSMCs. (D) Treatment with RRD 251 inhibits AoSMC p roliferation induced by serum, TNF and PDGF.

PAGE 169

153 Discussion The dynamics of endothelial and vascular smooth muscle cells play the predominant role in the progression of atherosclerosis and restenosis. Migration, proliferation, and differentiation of ECs as well as VSMCs are important pathological responses that contribute to the development of vascular lesions. migratory phenotype is a vital event in the pathogenesis of at herosclerosis and restenosis post angioplasty. Therefore, VSMC proliferation and migration both serve as suitable targets for drug therapy in vascular proliferative disorders. This study provides evidence that TNF and PDGF evoke similar signaling mechani sms that contribute to VSMC proliferation. Although they are not equally efficacious in activating these pathways, TNF is capable of activating growth factor receptor signaling pathways. S phase entry assays revealed that TNF is capable of stimulating cell cycle progression in vascular smooth muscle cells. The proliferative response also increased E2F regulated genes cdc6 and cdc25A in fact TNF stimulation led to an increase in E2F1 on the proliferative promoter cdc25A One interesting finding was in response to TNF Raf/MAPK activation occurred and this coincided with an activation of the stress kinase JNK1. Inhibition of TNF or PDGF induced cell proliferation with pharmacologic inhibitors targeting Raf 1, upstream of Raf 1 or JNK displayed inhib ition of S phase entry only when targeting Src, PKC or Raf 1 not JNK. This suggests that

PAGE 170

154 JNK activation most likely is not responsible for the proliferative responses seen with TNF Studies from our lab have shown that upon TNF treatment, ASK1 is res ponsible for Rb inactivation as an initial signaling event in Ramos and Jurkat cells (237) We observe similar response in HAECs where Rb is inactivated on TNF treatment in addition to upregulation of the pro apop totic proteins like p73 (unpublished data). The role of p53 in TNF induced apoptosis has been controversial (325,326) We also find that TNF has no affect on p53 expression however p73 levels were found to be up regulated implicating p73 to be major contributing factor to endothelial apoptosis induced by TNF We have observed that TNF signaling in ECs functions in an E2F1 regulated apoptotic pathway (unpublished data). Especially in this context the studies fr om our lab show that Rb interacts with ASK1 upon apoptotic stimuli, and ASK1 has to overcome Rb function to execute its pro apoptotic functions suggesting that Rb acts as a critical connector between apoptotic and proliferative pathways, by interacting wit h the functionally distinct kinases like Raf 1 and ASK1 (237) Thus the role of Rb phosphorylation by specific kinases is pertinent for directed signaling for apoptotic or proliferative pathways (234) The contrasting observation in AoSMCs, where TNF treatment resulted in a lack of apoptotic response and increase in proliferation suggests that TNF is involved in multiple pathways depending on the cellular context. We obser ved

PAGE 171

155 activation of Raf 1 and ERK, which are also indicative of a proliferative response. It has been shown that a colocalization of TNF and ERK1/2 occurs and ERK 1/2 activation induces the expression of Ets 1, Egr 1, and c fos in neointimal lesions from r at aortae 2 weeks post balloon injury (327) The ChIP and RT PCR experiments showed recruitment of E2F1 to proliferative promoters suggesting that E2F1 is a key mediator in the TNF induced proliferative or apoptot ic pathways in VSMCs or ECs, respectively. Rb Raf 1 interaction was found to play a vital role for serum, PDGF and TNF induced proliferation in VSMCs. Targeting Rb Raf 1 interaction using RRD 251 could completely inhibit S phase entry in these cells Our lab has previously shown that disrupting the Rb Raf 1 interaction can prevent endothelial cell adhesion, migration and proliferation. Taken together, the importance of this interaction in both endothelial cell as well as vascular smooth muscle cell p hysiology in atherosclerotic lesions needs further evaluation and may provide useful tools in development of therapies for heart disease. This study is an attempt to delineate mechanisms underlying the differential effects of E2F 1 in different cellular ac tivities with regard to the involvement of proliferative and apoptotic genes. The divergent responses of AoSMCs and HAECs to TNF thus provide unique therapeutic possibilities: simultaneously targeting the cell cycle of two different cell types, within sa me tissue microenvironment resulting in opposite and biologically complimentary effects.

PAGE 172

156 Summary and Conclusions Rb plays a vital role in cell proliferation and its inactivation facilitates S phase entry (257) It has been well accepted that inactivation of Rb occurs through a cascade of phosphorylation events mediated by kinases associated with D and E type cyclins (328) Rb is known to have growth suppressive properties and an inhibition of Rb phosphorylation can lead to a G1 arrest (329) S everal studies have suggested that mitogenic signaling pathways converge on the Rb dependent g1/S checkpoint (330,331) Members of the Ras/Raf/MAPK pathway have been shown to be involved in the upregulation of cycli nD1 and Rb phosphorylation (171,330,331) Furthermore, it has been shown that Ras mediated transformation and stimulated cell cycle progression requires inhibition of Rb activation through cyclin D (332) It is well established that most cancers inactivate Rb function by regulating the phosphorylation events that govern its function. Studies from our laboratory have shown that Raf 1 is capable of binding to Rb and facilitating its inactivation and this occurs prior to the binding of cyclins and cdks (173,209) We find that the Rb Raf 1 interaction facilitates mitogenic and non mitogenic stimulation and disruption o f this interaction has great therapeutic potential for controlling proliferative disorders.

PAGE 173

157 Although it has been difficult to generate small molecule protein protein interactions that translate to the clinic the recent successes in disrupting the hdm 2 p53 protein protein interaction clearly show that this is a viable strategy for developing novel drugs (269,279) We have described the discovery and characteristics of a novel protein protein inhibitor for the di sruption of the Rb Raf 1. We have shown that blocking the Rb Raf 1 interaction can prevent S phase entry in a wide range of cancer cell lines including lung, breast, prostate, brain, pancreatic, and melanoma; indicating that the Rb Raf 1 interaction may be involved in mediating cell cycle progression is several cancers of varying origin. RRD 251 also prevented tumor growth in vivo in both lung and melanoma xenografts. Our lab has specifically focused on the Rb Raf 1 interaction in NSCLC, mainly because nicotine and tobacco carcinogens such as NNK have been shown to stimulate the binding of Raf 1 to Rb in normal lung cells as well a lung cancer cells (215) In addition, non small cell lung cancer (NSCLC) is associated with 80% of the total number of lung cancer cases and is strongly associated with tobacco use. Our lab and others have shown that the Rb Raf 1 interaction is found to be elevated in human NSCLC tissue samples compared to adjacent control suggesting that this pathway contributes to the oncogenesis of these tumors (215) Blocking the Rb Raf 1 interaction with either the Raf 1 peptide or

PAGE 174

158 RRD 251 could preven t nicotine induced proliferation and angiogenesis in vitro (297) Future in vivo experiments could reveal whether blocking the Rb Raf 1 interaction is necessary to prevent nicotine induced lung metastasis. These studies along with other in vivo models will open the door to developing novel therapeutic for treatment of NSCLC in smokers. In another scenario, we find the Rb Raf 1 interaction to mediate both endothelial cell and vascular smooth muscle cell proliferation. In endothelial cells, mitogenic as well as nicotine stimulation induced the Rb Raf 1 interaction and cell proliferation. In vascular smooth muscle cells, mitogenic as well as non mitogenic (cytokine TNF ) stimulation induced the Rb Raf 1 interaction and cell proliferation. ECs and VSMCs in the heart respo nd to a variety of stimuli that decides if and when these cells will either proliferate or die (apoptosis). The proliferative response of these cells contributes to vessel thickening (occlusion) often known as restenosis or atherosclerosis. Inhibition of t he Rb Raf 1 interaction with RRD 251 prevented both EC and VSMC proliferation. Based on the above findings we propose that inhibition of Rb Raf 1 interaction is a viable mechanism for the treatment of proliferative disorders. We have shown that treatme nt with the Rb Raf 1 disruptor RRD 251 could prevent cell cycle progression in response to a wide range of cell signals. In addition, smokers may have elevated levels of Rb Raf 1 interaction and disrupting this interaction may help prevent the progression of NSCLC.

PAGE 175

159 Reference s 1. Friend, S. H., Bernards, R., Rogelj, S., Weinberg, R. A., Rapaport, J. M., Albert, D. M., and Dryja, T. P. (1986) Nature 323, 643 646 2. Knudson, A. G., Jr. (1971) Proc Natl Acad Sci U S A 68, 820 823 3. Fung Y. K., Murphree, A. L., T'Ang, A., Qian, J., Hinrichs, S. H., and Benedict, W. F. (1987) Science 236, 1657 1661 4. Lee, W. H., Bookstein, R., Hong, F., Young, L. J., Shew, J. Y., and Lee, E. Y. (1987) Science 235, 1394 1399 5. Dyson, N., Howley, P. M., M unger, K., and Harlow, E. (1989) Science 243, 934 937 6. Ludlow, J. W., DeCaprio, J. A., Huang, C. M., Lee, W. H., Paucha, E., and Livingston, D. M. (1989) Cell 56, 57 65 7. Whyte, P., Williamson, N. M., and Harlow, E. (1989) Cell 56, 67 75 8. Morris, E. J ., and Dyson, N. J. (2001) Adv Cancer Res 82, 1 54 9. Dyson, N. (1998) Genes Dev 12, 2245 2262 10. Zhang, Y., and Chellappan, S. P. (1995) Oncogene 10, 2085 2093 11. Blais, A., and Dynlacht, B. D. (2004) Curr Opin Genet Dev 14, 527 532 12. Cam, H., and Dyn lacht, B. D. (2003) Cancer Cell 3, 311 316 13. Ishida, S., Huang, E., Zuzan, H., Spang, R., Leone, G., West, M., and Nevins, J. R. (2001) Mol Cell Biol 21, 4684 4699 14. Ren, B., Cam, H., Takahashi, Y., Volkert, T., Terragni, J., Young, R. A., and Dynlacht B. D. (2002) Genes Dev 16, 245 256 15. Zhu, W., Giangrande, P. H., and Nevins, J. R. (2004) Embo J 23, 4615 4626

PAGE 176

160 16. Knudsen, E. S., Sexton, C. R., and Mayhew, C. N. (2006) Curr Mol Med 6, 749 757 17. Hiebert, S. W., Chellappan, S. P., Horowitz, J. M., a nd Nevins, J. R. (1992) Genes Dev 6, 177 185 18. Knudsen, E. S., and Knudsen, K. E. (2006) Exp Biol Med (Maywood) 231, 1271 1281 19. Deshpande, A., Sicinski, P., and Hinds, P. W. (2005) Oncogene 24, 2909 2915 20. Reed, S. I. (1997) Cancer Surv 29, 7 23 21. Sherr, C. J., and Roberts, J. M. (1999) Genes Dev 13, 1501 1512 22. Harbour, J. W., Luo, R. X., Dei Santi, A., Postigo, A. A., and Dean, D. C. (1999) Cell 98, 859 869 23. Knudsen, E. S., and Wang, J. Y. (1997) Mol Cell Biol 17, 5771 5783 24. Mittnacht, S. (1998) Curr Opin Genet Dev 8, 21 27 25. Chew, Y. P., Ellis, M., Wilkie, S., and Mittnacht, S. (1998) Oncogene 17, 2177 2186 26. Jackman, M., Firth, M., and Pines, J. (1995) Embo J 14, 1646 1654 27. Rubin, E., Tamrakar, S., and Ludlow, J. W. (1998) Front B iosci 3, D1209 1219 28. Ludlow, J. W., Glendening, C. L., Livingston, D. M., and DeCarprio, J. A. (1993) Mol Cell Biol 13, 367 372 29. Krucher, N. A., Rubin, E., Tedesco, V. C., Roberts, M. H., Sherry, T. C., and De Leon, G. (2006) Exp Cell Res 312, 2757 2 763 30. Cobrinik, D. (2005) Oncogene 24, 2796 2809 31. Baldi, A., Boccia, V., Claudio, P. P., De Luca, A., and Giordano, A. (1996) Proc Natl Acad Sci U S A 93, 4629 4632 32. Ichimura, K., Hanafusa, H., Takimoto, H., Ohgama, Y., Akagi, T., and Shimizu, K. ( 2000) Gene 251, 37 43

PAGE 177

161 33. Rubin, S. M., Gall, A. L., Zheng, N., and Pavletich, N. P. (2005) Cell 123, 1093 1106 34. Classon, M., and Dyson, N. (2001) Exp Cell Res 264, 135 147 35. Gallie, B. L., Dunn, J. M., Hamel, P. A., and Phillips, R. A. (1990) N Engl J Med 322, 1397 1398 36. Reissmann, P. T., Koga, H., Takahashi, R., Figlin, R. A., Holmes, E. C., Piantadosi, S., Cordon Cardo, C., and Slamon, D. J. (1993) Oncogene 8, 1913 1919 37. Geradts, J., Kratzke, R. A., Niehans, G. A., and Lincoln, C. E. (1995) Ca ncer Res 55, 6006 6011 38. Harbour, J. W., Lai, S. L., Whang Peng, J., Gazdar, A. F., Minna, J. D., and Kaye, F. J. (1988) Science 241, 353 357 39. Bartkova, J., Lukas, J., Strauss, M., and Bartek, J. (1995) Oncogene 10, 775 778 40. Bellacosa, A., Almadori G., Cavallo, S., Cadoni, G., Galli, J., Ferrandina, G., Scambia, G., and Neri, G. (1996) Clin Cancer Res 2, 175 180 41. Gillett, C., Fantl, V., Smith, R., Fisher, C., Bartek, J., Dickson, C., Barnes, D., and Peters, G. (1994) Cancer Res 54, 1812 1817 42. Sheyn, I., Noffsinger, A. E., Heffelfinger, S., Davis, B., Miller, M. A., and Fenoglio Preiser, C. M. (1997) Hum Pathol 28, 270 276 43. Yatabe, Y., Nakamura, S., Seto, M., Kuroda, H., Kagami, Y., Suzuki, R., Ogura, M., Kojima, M., Koshikawa, T., Ueda, R., and Suchi, T. (1996) Am J Surg Pathol 20, 1110 1122 44. Kratzke, R. A., Greatens, T. M., Rubins, J. B., Maddaus, M. A., Niewoehner, D. E., Niehans, G. A., and Geradts, J. (1996) Cancer Res 56, 3415 3420 45. Otterson, G. A., Kratzke, R. A., Coxon, A., Kim, Y. W., and Kaye, F. J. (1994) Oncogene 9, 3375 3378 46. Sakaguchi, M., Fujii, Y., Hirabayashi, H., Yoon, H. E., Komoto, Y., Oue, T., Kusafuka, T., Okada, A., and Matsuda, H. (1996) Int J Cancer 65, 442 445

PAGE 178

162 47. Shapiro, G. I., Edwards, C. D., Kobzik, L., G odleski, J., Richards, W., Sugarbaker, D. J., and Rollins, B. J. (1995) Cancer Res 55, 505 509 48. Munger, K., Werness, B. A., Dyson, N., Phelps, W. C., Harlow, E., and Howley, P. M. (1989) Embo J 8, 4099 4105 49. Nevins, J. R. (1992) Science 258, 424 429 50. Nevins, J. R. (2001) Hum Mol Genet 10, 699 703 51. Chellappan, S. P., Hiebert, S., Mudryj, M., Horowitz, J. M., and Nevins, J. R. (1991) Cell 65, 1053 1061 52. Bagchi, S., Weinmann, R., and Raychaudhuri, P. (1991) Cell 65, 1063 1072 53. Chittenden, T., Livingston, D. M., and Kaelin, W. G., Jr. (1991) Cell 65, 1073 1082 54. Trimarchi, J. M., and Lees, J. A. (2002) Nat Rev Mol Cell Biol 3, 11 20 55. Flemington, E. K., Speck, S. H., and Kaelin, W. G., Jr. (1993) Proc Natl Acad Sci U S A 90, 6914 6918 56. H elin, K., Harlow, E., and Fattaey, A. (1993) Mol Cell Biol 13, 6501 6508 57. Bremner, R., Cohen, B. L., Sopta, M., Hamel, P. A., Ingles, C. J., Gallie, B. L., and Phillips, R. A. (1995) Mol Cell Biol 15, 3256 3265 58. Sellers, W. R., Rodgers, J. W., and Ka elin, W. G., Jr. (1995) Proc Natl Acad Sci U S A 92, 11544 11548 59. Weintraub, S. J., Chow, K. N., Luo, R. X., Zhang, S. H., He, S., and Dean, D. C. (1995) Nature 375, 812 815 60. Ferreira, R., Naguibneva, I., Mathieu, M., Ait Si Ali, S., Robin, P., Pritc hard, L. L., and Harel Bellan, A. (2001) EMBO Rep 2, 794 799 61. Luo, R. X., Postigo, A. A., and Dean, D. C. (1998) Cell 92, 463 473 62. Dunaief, J. L., Strober, B. E., Guha, S., Khavari, P. A., Alin, K., Luban, J., Begemann, M., Crabtree, G. R., and Goff, S. P. (1994) Cell 79, 119 130

PAGE 179

163 63. Nielsen, S. J., Schneider, R., Bauer, U. M., Bannister, A. J., Morrison, A., O'Carroll, D., Firestein, R., Cleary, M., Jenuwein, T., Herrera, R. E., and Kouzarides, T. (2001) Nature 412, 561 565 64. Vaute, O., Nicolas, E. Vandel, L., and Trouche, D. (2002) Nucleic Acids Res 30, 475 481 65. Dahiya, A., Wong, S., Gonzalo, S., Gavin, M., and Dean, D. C. (2001) Mol Cell 8, 557 569 66. Robertson, K. D., Ait Si Ali, S., Yokochi, T., Wade, P. A., Jones, P. L., and Wolffe, A. P. (2000) Nat Genet 25, 338 342 67. Wang, C., Hou, X., Mohapatra, S., Ma, Y., Cress, W. D., Pledger, W. J., and Chen, J. (2005) J Biol Chem 280, 12339 12343 68. Giacinti, C., and Giordano, A. (2006) Oncogene 25, 5220 5227 69. DeGregori, J. (2002) Biochim Biop hys Acta 1602, 131 150 70. DeGregori, J., Kowalik, T., and Nevins, J. R. (1995) Mol Cell Biol 15, 4215 4224 71. DeGregori, J., Leone, G., Ohtani, K., Miron, A., and Nevins, J. R. (1995) Genes Dev 9, 2873 2887 72. Ohtani, K., DeGregori, J., and Nevins, J. R (1995) Proc Natl Acad Sci U S A 92, 12146 12150 73. Maiti, B., Li, J., de Bruin, A., Gordon, F., Timmers, C., Opavsky, R., Patil, K., Tuttle, J., Cleghorn, W., and Leone, G. (2005) J Biol Chem 280, 18211 18220 74. Ormondroyd, E., de la Luna, S., and La T hangue, N. B. (1995) Oncogene 11, 1437 1446 75. Slansky, J. E., and Farnham, P. J. (1996) Curr Top Microbiol Immunol 208, 1 30 76. DeGregori, J., and Johnson, D. G. (2006) Curr Mol Med 6, 739 748 77. Trimarchi, J. M., Fairchild, B., Verona, R., Moberg, K., Andon, N., and Lees, J. A. (1998) Proc Natl Acad Sci U S A 95, 2850 2855 78. Di Stefano, L., Jensen, M. R., and Helin, K. (2003) Embo J 22, 6289 6298

PAGE 180

164 79. Trimarchi, J. M., Fairchild, B., Wen, J., and Lees, J. A. (2001) Proc Natl Acad Sci U S A 98, 1519 15 24 80. Christensen, J., Cloos, P., Toftegaard, U., Klinkenberg, D., Bracken, A. P., Trinh, E., Heeran, M., Di Stefano, L., and Helin, K. (2005) Nucleic Acids Res 33, 5458 5470 81. Zhang, H. S., and Dean, D. C. (2001) Oncogene 20, 3134 3138 82. Schwarz, J. K., Bassing, C. H., Kovesdi, I., Datto, M. B., Blazing, M., George, S., Wang, X. F., and Nevins, J. R. (1995) Proc Natl Acad Sci U S A 92, 483 487 83. Cho, R. J., Huang, M., Campbell, M. J., Dong, H., Steinmetz, L., Sapinoso, L., Hampton, G., Elledge, S. J ., Davis, R. W., and Lockhart, D. J. (2001) Nat Genet 27, 48 54 84. Ferreira, R., Naguibneva, I., Pritchard, L. L., Ait Si Ali, S., and Harel Bellan, A. (2001) Oncogene 20, 3128 3133 85. Iyer, V. R., Eisen, M. B., Ross, D. T., Schuler, G., Moore, T., Lee, J. C., Trent, J. M., Staudt, L. M., Hudson, J., Jr., Boguski, M. S., Lashkari, D., Shalon, D., Botstein, D., and Brown, P. O. (1999) Science 283, 83 87 86. Kalma, Y., Marash, L., Lamed, Y., and Ginsberg, D. (2001) Oncogene 20, 1379 1387 87. Ma, Y., Croxton R., Moorer, R. L., Jr., and Cress, W. D. (2002) Arch Biochem Biophys 399, 212 224 88. Muller, H., Bracken, A. P., Vernell, R., Moroni, M. C., Christians, F., Grassilli, E., Prosperini, E., Vigo, E., Oliner, J. D., and Helin, K. (2001) Genes Dev 15, 267 2 85 89. Polager, S., Kalma, Y., Berkovich, E., and Ginsberg, D. (2002) Oncogene 21, 437 446 90. Takahashi, Y., Rayman, J. B., and Dynlacht, B. D. (2000) Genes Dev 14, 804 816 91. Wang, S., Nath, N., Adlam, M., and Chellappan, S. (1999) Oncogene 18, 3501 351 0 92. Weinmann, A. S., Yan, P. S., Oberley, M. J., Huang, T. H., and Farnham, P. J. (2002) Genes Dev 16, 235 244

PAGE 181

165 93. Wells, J., Boyd, K. E., Fry, C. J., Bartley, S. M., and Farnham, P. J. (2000) Mol Cell Biol 20, 5797 5807 94. Johnson, D. G., Schwarz, J. K ., Cress, W. D., and Nevins, J. R. (1993) Nature 365, 349 352 95. Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M. C., and Helin, K. (1999) Mol Cell Biol 19, 6379 6395 96. DeGregori, J., Leone, G., Miron, A., Jakoi, L., and Ne vins, J. R. (1997) Proc Natl Acad Sci U S A 94, 7245 7250 97. Bindra, R. S., and Glazer, P. M. (2007) Oncogene 26, 2048 2057 98. Field, S. J., Tsai, F. Y., Kuo, F., Zubiaga, A. M., Kaelin, W. G., Jr., Livingston, D. M., Orkin, S. H., and Greenberg, M. E. ( 1996) Cell 85, 549 561 99. Yamasaki, L., Jacks, T., Bronson, R., Goillot, E., Harlow, E., and Dyson, N. J. (1996) Cell 85, 537 548 100. Conner, E. A., Lemmer, E. R., Omori, M., Wirth, P. J., Factor, V. M., and Thorgeirsson, S. S. (2000) Oncogene 19, 5054 5 062 101. Pierce, A. M., Fisher, S. M., Conti, C. J., and Johnson, D. G. (1998) Oncogene 16, 1267 1276 102. Yamasaki, L., Bronson, R., Williams, B. O., Dyson, N. J., Harlow, E., and Jacks, T. (1998) Nat Genet 18, 360 364 103. Macleod, K. F., Hu, Y., and Jac ks, T. (1996) Embo J 15, 6178 6188 104. Qin, X. Q., Livingston, D. M., Kaelin, W. G., Jr., and Adams, P. D. (1994) Proc Natl Acad Sci U S A 91, 10918 10922 105. Wu, X., and Levine, A. J. (1994) Proc Natl Acad Sci U S A 91, 3602 3606 106. Bates, S., Phillip s, A. C., Clark, P. A., Stott, F., Peters, G., Ludwig, R. L., and Vousden, K. H. (1998) Nature 395, 124 125 107. Zhu, J. W., DeRyckere, D., Li, F. X., Wan, Y. Y., and DeGregori, J. (1999) Cell Growth Differ 10, 829 838

PAGE 182

166 108. Inoue, K., Roussel, M. F., and S herr, C. J. (1999) Proc Natl Acad Sci U S A 96, 3993 3998 109. Kamijo, T., Weber, J. D., Zambetti, G., Zindy, F., Roussel, M. F., and Sherr, C. J. (1998) Proc Natl Acad Sci U S A 95, 8292 8297 110. Irwin, M. S., Kondo, K., Marin, M. C., Cheng, L. S., Hahn, W. C., and Kaelin, W. G., Jr. (2003) Cancer Cell 3, 403 410 111. Moroni, M. C., Hickman, E. S., Lazzerini Denchi, E., Caprara, G., Colli, E., Cecconi, F., Muller, H., and Helin, K. (2001) Nat Cell Biol 3, 552 558 112. Nahle, Z., Polakoff, J., Davuluri, R. V., McCurrach, M. E., Jacobson, M. D., Narita, M., Zhang, M. Q., Lazebnik, Y., Bar Sagi, D., and Lowe, S. W. (2002) Nat Cell Biol 4, 859 864 113. Hershko, T., and Ginsberg, D. (2004) J Biol Chem 279, 8627 8634 114. Croxton, R., Ma, Y., Song, L., Haura, E. B., and Cress, W. D. (2002) Oncogene 21, 1359 1369 115. Cao, Q., Xia, Y., Azadniv, M., and Crispe, I. N. (2004) J Immunol 173, 1111 1117 116. Fortin, A., MacLaurin, J. G., Arbour, N., Cregan, S. P., Kushwaha, N., Callaghan, S. M., Park, D. S., Albert, P. R., and Slack, R. S. (2004) J Biol Chem 279, 28706 28714 117. Tan, J., Zhuang, L., Jiang, X., Yang, K. K., Karuturi, K. M., and Yu, Q. (2006) J Biol Chem 118. Ma, Y., Freeman, S. N., and Cress, W. D. (2004) Cancer Biol Ther 3, 1262 1269 119. Johnson, D. G ., Cress, W. D., Jakoi, L., and Nevins, J. R. (1994) Proc Natl Acad Sci U S A 91, 12823 12827 120. Singh, P., Wong, S. H., and Hong, W. (1994) Embo J 13, 3329 3338 121. Tsantoulis, P. K., and Gorgoulis, V. G. (2005) Eur J Cancer 41, 2403 2414 122. Bell, L. A., and Ryan, K. M. (2004) Cell Death Differ 11, 137 142 123. Nakamura, T., Monden, Y., Kawashima, K., Naruke, T., and Nishimura, S. (1996) Jpn J Cancer Res 87, 1204 1209

PAGE 183

167 124. Dimova, D. K., and Dyson, N. J. (2005) Oncogene 24, 2810 2826 125. Orlic, M., S pencer, C. E., Wang, L., and Gallie, B. L. (2006) Genes Chromosomes Cancer 45, 72 82 126. Volinia, S., Calin, G. A., Liu, C. G., Ambs, S., Cimmino, A., Petrocca, F., Visone, R., Iorio, M., Roldo, C., Ferracin, M., Prueitt, R. L., Yanaihara, N., Lanza, G., Scarpa, A., Vecchione, A., Negrini, M., Harris, C. C., and Croce, C. M. (2006) Proc Natl Acad Sci U S A 103, 2257 2261 127. Oeggerli, M., Tomovska, S., Schraml, P., Calvano Forte, D., Schafroth, S., Simon, R., Gasser, T., Mihatsch, M. J., and Sauter, G. (2 004) Oncogene 23, 5616 5623 128. Veltman, J. A., Fridlyand, J., Pejavar, S., Olshen, A. B., Korkola, J. E., DeVries, S., Carroll, P., Kuo, W. L., Pinkel, D., Albertson, D., Cordon Cardo, C., Jain, A. N., and Waldman, F. M. (2003) Cancer Res 63, 2872 2880 1 29. Borczuk, A. C., Gorenstein, L., Walter, K. L., Assaad, A. A., Wang, L., and Powell, C. A. (2003) Am J Pathol 163, 1949 1960 130. Feber, A., Clark, J., Goodwin, G., Dodson, A. R., Smith, P. H., Fletcher, A., Edwards, S., Flohr, P., Falconer, A., Roe, T. Kovacs, G., Dennis, N., Fisher, C., Wooster, R., Huddart, R., Foster, C. S., and Cooper, C. S. (2004) Oncogene 23, 1627 1630 131. Foster, C. S., Falconer, A., Dodson, A. R., Norman, A. R., Dennis, N., Fletcher, A., Southgate, C., Dowe, A., Dearnaley, D., Jhavar, S., Eeles, R., Feber, A., and Cooper, C. S. (2004) Oncogene 23, 5871 5879 132. Lu, K. H., Patterson, A. P., Wang, L., Marquez, R. T., Atkinson, E. N., Baggerly, K. A., Ramoth, L. R., Rosen, D. G., Liu, J., Hellstrom, I., Smith, D., Hartmann, L., F ishman, D., Berchuck, A., Schmandt, R., Whitaker, R., Gershenson, D. M., Mills, G. B., and Bast, R. C., Jr. (2004) Clin Cancer Res 10, 3291 3300 133. Polanowska, J., Le Cam, L., Orsetti, B., Valles, H., Fabbrizio, E., Fajas, L., Taviaux, S., Theillet, C., and Sardet, C. (2000) Genes Chromosomes Cancer 28, 126 130 134. Mady, H. H., Hasso, S., and Melhem, M. F. (2002) Appl Immunohistochem Mol Morphol 10, 225 230

PAGE 184

168 135. Schwemmle, S., and Pfeifer, G. P. (2000) Int J Cancer 86, 672 677 136. Souza, R. F., Yin, J., Smolinski, K. N., Zou, T. T., Wang, S., Shi, Y. Q., Rhyu, M. G., Cottrell, J., Abraham, J. M., Biden, K., Simms, L., Leggett, B., Bova, G. S., Frank, T., Powell, S. M., Sugimura, H., Young, J., Harpaz, N., Shimizu, K., Matsubara, N., and Meltzer, S. J. (1 997) Cancer Res 57, 2350 2353 137. Woo, D. K., Lee, W. A., Kim, Y. I., and Kim, W. H. (2000) Pathol Int 50, 690 695 138. Olson, M. V., Johnson, D. G., Jiang, H., Xu, J., Alonso, M. M., Aldape, K. D., Fuller, G. N., Bekele, B. N., Yung, W. K., Gomez Manzano C., and Fueyo, J. (2007) Cancer Res 67, 4005 4009 139. Brookman Amissah, N., Duchesnes, C., Williamson, M. P., Wang, Q., Ahmed, A., Feneley, M. R., Mackay, A., Freeman, A., Fenwick, K., Iravani, M., Weber, B., Ashworth, A., and Masters, J. R. (2005) Pros tate Cancer Prostatic Dis 8, 335 343 140. Fujita, Y., Sakakura, C., Shimomura, K., Nakanishi, M., Yasuoka, R., Aragane, H., Hagiwara, A., Abe, T., Inazawa, J., and Yamagishi, H. (2003) Hepatogastroenterology 50, 1857 1863 141. Nelson, M. A., Reynolds, S. H ., Rao, U. N., Goulet, A. C., Feng, Y., Beas, A., Honchak, B., Averill, J., Lowry, D. T., Senft, J. R., Jefferson, A. M., Johnson, R. C., and Sargent, L. M. (2006) Cancer Biol Ther 5, 407 412 142. Postma, C., Hermsen, M. A., Coffa, J., Baak, J. P., Mueller J. D., Mueller, E., Bethke, B., Schouten, J. P., Stolte, M., and Meijer, G. A. (2005) J Pathol 205, 514 521 143. Saito, M., Helin, K., Valentine, M. B., Griffith, B. B., Willman, C. L., Harlow, E., and Look, A. T. (1995) Genomics 25, 130 138 144. Suzuki, T., Yasui, W., Yokozaki, H., Naka, K., Ishikawa, T., and Tahara, E. (1999) Int J Cancer 81, 535 538 145. Reimer, D., Sadr, S., Wiedemair, A., Stadlmann, S., Concin, N., Hofstetter, G., Muller Holzner, E., Marth, C., and Zeimet, A. G. (2007) Clin Cancer Re s 13, 144 151 146. Murga, M., Fernandez Capetillo, O., Field, S. J., Moreno, B., Borlado, L. R., Fujiwara, Y., Balomenos, D., Vicario, A., Carrera, A. C., Orkin, S. H., Greenberg, M. E., and Zubiaga, A. M. (2001) Immunity 15, 959 970

PAGE 185

169 147. Li, F. X., Zhu, J W., Hogan, C. J., and DeGregori, J. (2003) Mol Cell Biol 23, 3607 3622 148. Cloud, J. E., Rogers, C., Reza, T. L., Ziebold, U., Stone, J. R., Picard, M. H., Caron, A. M., Bronson, R. T., and Lees, J. A. (2002) Mol Cell Biol 22, 2663 2672 149. Humbert, P. O., Rogers, C., Ganiatsas, S., Landsberg, R. L., Trimarchi, J. M., Dandapani, S., Brugnara, C., Erdman, S., Schrenzel, M., Bronson, R. T., and Lees, J. A. (2000) Mol Cell 6, 281 291 150. Rempel, R. E., Saenz Robles, M. T., Storms, R., Morham, S., Ishida, S., Engel, A., Jakoi, L., Melhem, M. F., Pipas, J. M., Smith, C., and Nevins, J. R. (2000) Mol Cell 6, 293 306 151. Lindeman, G. J., Dagnino, L., Gaubatz, S., Xu, Y., Bronson, R. T., Warren, H. B., and Livingston, D. M. (1998) Genes Dev 12, 1092 1098 152. Banerjee, D., Gorlick, R., Liefshitz, A., Danenberg, K., Danenberg, P. C., Danenberg, P. V., Klimstra, D., Jhanwar, S., Cordon Cardo, C., Fong, Y., Kemeny, N., and Bertino, J. R. (2000) Cancer Res 60, 2365 2367 153. Zhang, S. Y., Liu, S. C., Johnson, D. G. and Klein Szanto, A. J. (2000) Cancer Res 60, 5972 5976 154. Stanelle, J., Stiewe, T., Theseling, C. C., Peter, M., and Putzer, B. M. (2002) Nucleic Acids Res 30, 1859 1867 155. Joshi, B., Ordonez Ercan, D., Dasgupta, P., and Chellappan, S. (2005) Oncoge ne 24, 2204 2217 156. Tashiro, E., Maruki, H., Minato, Y., Doki, Y., Weinstein, I. B., and Imoto, M. (2003) Cancer Res 63, 424 431 157. Dong, Y. B., Yang, H. L., Elliott, M. J., Liu, T. J., Stilwell, A., Atienza, C., Jr., and McMasters, K. M. (1999) Cancer 86, 2021 2033 158. Fueyo, J., Gomez Manzano, C., Yung, W. K., Liu, T. J., Alemany, R., McDonnell, T. J., Shi, X., Rao, J. S., Levin, V. A., and Kyritsis, A. P. (1998) Nat Med 4, 685 690 159. Hunt, K. K., Deng, J., Liu, T. J., Wilson Heiner, M., Swisher, S G., Clayman, G., and Hung, M. C. (1997) Cancer Res 57, 4722 4726

PAGE 186

170 160. Liu, T. J., Wang, M., Breau, R. L., Henderson, Y., El Naggar, A. K., Steck, K. D., Sicard, M. W., and Clayman, G. L. (1999) Cancer Gene Ther 6, 163 171 161. Yang, H. L., Dong, Y. B., E lliott, M. J., Liu, T. J., Atienza, C., Jr., Stilwell, A., and McMasters, K. M. (1999) Clin Cancer Res 5, 2242 2250 162. Yang, H. L., Dong, Y. B., Elliott, M. J., Liu, T. J., and McMasters, K. M. (2000) Clin Cancer Res 6, 1579 1589 163. Kaelin, W. G., Jr. (2003) Cancer Biol Ther 2, S48 54 164. Banerjee, D., Schnieders, B., Fu, J. Z., Adhikari, D., Zhao, S. C., and Bertino, J. R. (1998) Cancer Res 58, 4292 4296 165. Logan, T. J., Evans, D. L., Mercer, W. E., Bjornsti, M. A., and Hall, D. J. (1995) Cancer Res 55, 2883 2891 166. Meng, R. D., Phillips, P., and El Deiry, W. S. (1999) Int J Oncol 14, 5 14 167. Wu, L., Timmers, C., Maiti, B., Saavedra, H. I., Sang, L., Chong, G. T., Nuckolls, F., Giangrande, P., Wright, F. A., Field, S. J., Greenberg, M. E., Orkin, S., Nevins, J. R., Robinson, M. L., and Leone, G. (2001) Nature 414, 457 462 168. Wu, C. L., Classon, M., Dyson, N., and Harlow, E. (1996) Mol Cell Biol 16, 3698 3706 169. Bandara, L. R., Girling, R., and La Thangue, N. B. (1997) Nat Biotechnol 15, 896 90 1 170. Fabbrizio, E., Le Cam, L., Polanowska, J., Kaczorek, M., Lamb, N., Brent, R., and Sardet, C. (1999) Oncogene 18, 4357 4363 171. Downward, J. (1997) Curr Biol 7, R258 260 172. Garnovskaya, M. N., Mukhin, Y. V., Vlasova, T. M., Grewal, J. S., Ullian, M. E., Tholanikunnel, B. G., and Raymond, J. R. (2004) J Biol Chem 279, 24899 24905 173. Wang, S., Ghosh, R. N., and Chellappan, S. P. (1998) Mol Cell Biol 18, 7487 7498 174. D'Abaco, G. M., Hooper, S., Paterson, H., and Marshall, C. J. (2002) J Cell Sci 1 15, 4607 4616

PAGE 187

171 175. Kolch, W. (2000) Biochem J 351 Pt 2, 289 305 176. Kolch, W., Kotwaliwale, A., Vass, K., and Janosch, P. (2002) Expert Rev Mol Med 2002, 1 18 177. Chaudhary, A., King, W. G., Mattaliano, M. D., Frost, J. A., Diaz, B., Morrison, D. K., Cob b, M. H., Marshall, M. S., and Brugge, J. S. (2000) Curr Biol 10, 551 554 178. King, A. J., Sun, H., Diaz, B., Barnard, D., Miao, W., Bagrodia, S., and Marshall, M. S. (1998) Nature 396, 180 183 179. Xia, K., Mukhopadhyay, N. K., Inhorn, R. C., Barber, D. L., Rose, P. E., Lee, R. S., Narsimhan, R. P., D'Andrea, A. D., Griffin, J. D., and Roberts, T. M. (1996) Proc Natl Acad Sci U S A 93, 11681 11686 180. Lewis, T. S., Shapiro, P. S., and Ahn, N. G. (1998) Adv Cancer Res 74, 49 139 181. Robinson, M. J., and Cobb, M. H. (1997) Curr Opin Cell Biol 9, 180 186 182. Sears, R., Nuckolls, F., Haura, E., Taya, Y., Tamai, K., and Nevins, J. R. (2000) Genes Dev 14, 2501 2514 183. Kohno, M., and Pouyssegur, J. (2003) Prog Cell Cycle Res 5, 219 224 184. Tanimura, S., Asa to, K., Fujishiro, S. H., and Kohno, M. (2003) Biochem Biophys Res Commun 304, 801 806 185. Wellbrock, C., Karasarides, M., and Marais, R. (2004) Nat Rev Mol Cell Biol 5, 875 885 186. Daum, G., Eisenmann Tappe, I., Fries, H. W., Troppmair, J., and Rapp, U. R. (1994) Trends Biochem Sci 19, 474 480 187. Naumann, U., Eisenmann Tappe, I., and Rapp, U. R. (1997) Recent Results Cancer Res 143, 237 244 188. Hanahan, D., and Weinberg, R. A. (2000) Cell 100, 57 70 189. Kim, S. H., Lee, S. H., Kwak, N. H., Kang, C. D ., and Chung, B. S. (1996) Cancer Lett 98, 199 205 190. Rudin, C. M., Holmlund, J., Fleming, G. F., Mani, S., Stadler, W. M.,

PAGE 188

172 Schumm, P., Monia, B. P., Johnston, J. F., Geary, R., Yu, R. Z., Kwoh, T. J., Dorr, F. A., and Ratain, M. J. (2001) Clin Cancer Re s 7, 1214 1220 191. Strumberg, D., Voliotis, D., Moeller, J. G., Hilger, R. A., Richly, H., Kredtke, S., Beling, C., Scheulen, M. E., and Seeber, S. (2002) Int J Clin Pharmacol Ther 40, 580 581 192. Bonner, T. I., Oppermann, H., Seeburg, P., Kerby, S. B., Gunnell, M. A., Young, A. C., and Rapp, U. R. (1986) Nucleic Acids Res 14, 1009 1015 193. Huleihel, M., Goldsborough, M., Cleveland, J., Gunnell, M., Bonner, T., and Rapp, U. R. (1986) Mol Cell Biol 6, 2655 2662 194. Ikawa, S., Fukui, M., Ueyama, Y., Tamao ki, N., Yamamoto, T., and Toyoshima, K. (1988) Mol Cell Biol 8, 2651 2654 195. Wang, H. G., Rapp, U. R., and Reed, J. C. (1996) Cell 87, 629 638 196. Storm, S. M., Cleveland, J. L., and Rapp, U. R. (1990) Oncogene 5, 345 351 197. Huser, M., Luckett, J., Ch iloeches, A., Mercer, K., Iwobi, M., Giblett, S., Sun, X. M., Brown, J., Marais, R., and Pritchard, C. (2001) Embo J 20, 1940 1951 198. Wang, H. G., Takayama, S., Rapp, U. R., and Reed, J. C. (1996) Proc Natl Acad Sci U S A 93, 7063 7068 199. Jin, S., Zhuo Y., Guo, W., and Field, J. (2005) J Biol Chem 280, 24698 24705 200. Sithanandam, G., Dean, M., Brennscheidt, U., Beck, T., Gazdar, A., Minna, J. D., Brauch, H., Zbar, B., and Rapp, U. R. (1989) Oncogene 4, 451 455 201. McPhillips, F., Mullen, P., MacLeod K. G., Sewell, J. M., Monia, B. P., Cameron, D. A., Smyth, J. F., and Langdon, S. P. (2006) Carcinogenesis 27, 729 739 202. Yeung, K., Janosch, P., McFerran, B., Rose, D. W., Mischak, H., Sedivy, J. M., and Kolch, W. (2000) Mol Cell Biol 20, 3079 3085 20 3. Hagan, S., Al Mulla, F., Mallon, E., Oien, K., Ferrier, R., Gusterson, B., Garcia, J. J., and Kolch, W. (2005) Clin Cancer Res 11, 7392 7397

PAGE 189

173 204. Cornwell, M. M., and Smith, D. E. (1993) J Biol Chem 268, 15347 15350 205. Yang, J. M., Vassil, A. D., and Hait, W. N. (2001) Mol Pharmacol 60, 674 680 206. Marais, R., Light, Y., Paterson, H. F., Mason, C. S., and Marshall, C. J. (1997) J Biol Chem 272, 4378 4383 207. Sridhar, S. S., Hedley, D., and Siu, L. L. (2005) Mol Cancer Ther 4, 677 685 208. Kinkade, R. Dasgupta, P., and Chellappan, S. (2006) Curr Can Ther Rev 2, 305 314 209. Dasgupta, P., Sun, J., Wang, S., Fusaro, G., Betts, V., Padmanabhan, J., Sebti, S. M., and Chellappan, S. P. (2004) Mol Cell Biol 24, 9527 9541 210. Hood, J. D., and Cheresh, D. A. (2002) Cold Spring Harb Symp Quant Biol 67, 285 291 211. Newbatt, Y., Burns, S., Hayward, R., Whittaker, S., Kirk, R., Marshall, C., Springer, C., McDonald, E., Marais, R., Workman, P., and Aherne, W. (2006) J Biomol Screen 11, 145 154 212. Wilhelm, S. M. Carter, C., Tang, L., Wilkie, D., McNabola, A., Rong, H., Chen, C., Zhang, X., Vincent, P., McHugh, M., Cao, Y., Shujath, J., Gawlak, S., Eveleigh, D., Rowley, B., Liu, L., Adnane, L., Lynch, M., Auclair, D., Taylor, I., Gedrich, R., Voznesensky, A., Rie dl, B., Post, L. E., Bollag, G., and Trail, P. A. (2004) Cancer Res 64, 7099 7109 213. Ratain, M. J., Eisen, T., Stadler, W. M., Flaherty, K. T., Kaye, S. B., Rosner, G. L., Gore, M., Desai, A. A., Patnaik, A., Xiong, H. Q., Rowinsky, E., Abbruzzese, J. L. Xia, C., Simantov, R., Schwartz, B., and O'Dwyer, P. J. (2006) J Clin Oncol 24, 2505 2512 214. de Paulsen, N., Brychzy, A., Fournier, M. C., Klausner, R. D., Gnarra, J. R., Pause, A., and Lee, S. (2001) Proc Natl Acad Sci U S A 98, 1387 1392 215. Dasgupt a, P., Rastogi, S., Pillai, S., Ordonez Ercan, D., Morris, M., Haura, E., and Chellappan, S. (2006) J Clin Invest 116, 2208 2217 216. Kitagawa, M., and Taya, Y. (1997) Tanpakushitsu Kakusan Koso 42, 1594 1602 217. Taya, Y. (1997) Trends Biochem Sci 22, 14 17

PAGE 190

174 218. Brunnemann, K. D., and Hoffmann, D. (1991) Crit Rev Toxicol 21, 235 240 219. Sekido, Y., Fong, K. M., and Minna, J. D. (2003) Annu Rev Med 54, 73 87 220. Sharma, G., and Vijayaraghavan, S. (2002) J Neurobiol 53, 524 534 221. Heeschen, C., Jang, J. J., Weis, M., Pathak, A., Kaji, S., Hu, R. S., Tsao, P. S., Johnson, F. L., and Cooke, J. P. (2001) Nat Med 7, 833 839 222. Heeschen, C., Weis, M., Aicher, A., Dimmeler, S., and Cooke, J. P. (2002) J Clin Invest 110, 527 536 223. Heeschen, C., Weis, M., an d Cooke, J. P. (2003) J Am Coll Cardiol 41, 489 496 224. Villablanca, A. C. (1998) J Appl Physiol 84, 2089 2098 225. Cattaneo, M. G., D'Atri, F., and Vicentini, L. M. (1997) Biochem J 328 ( Pt 2), 499 503 226. Maneckjee, R., and Minna, J. D. (1990) Proc Na tl Acad Sci U S A 87, 3294 3298 227. Jull, B. A., Plummer, H. K., 3rd, and Schuller, H. M. (2001) J Cancer Res Clin Oncol 127, 707 717 228. Chu, M., Guo, J., and Chen, C. Y. (2005) J Biol Chem 280, 6369 6379 229. Grozio, A., Paleari, L., Catassi, A., Serve nt, D., Cilli, M., Piccardi, F., Paganuzzi, M., Cesario, A., Granone, P., Mourier, G., and Russo, P. (2007) Int J Cancer 230. Jarzynka, M. J., Guo, P., Bar Joseph, I., Hu, B., and Cheng, S. Y. (2006) Int J Oncol 28, 337 344 231. Chau, B. N., and Wang, J. Y. (2003) Nat Rev Cancer 3, 130 138 232. Sherr, C. J., and McCormick, F. (2002) Cancer Cell 2, 103 112 233. Tan, X., and Wang, J. Y. (1998) Trends Cell Biol 8, 116 120 234. Wang, S., Nath, N., Minden, A., and Chellappan, S. (1999) Embo J 18, 1559 1570

PAGE 191

175 235. Nath, N., Wang, S., Betts, V., Knudsen, E., and Chellappan, S. (2003) Oncogene 22, 5986 5994 236. Hou, S. T., Xie, X., Baggley, A., Park, D. S., Chen, G., and Walker, T. (2002) J Biol Chem 237. Dasgupta, P., Betts, V., Rastogi, S., Joshi, B., Morris, M., Brennan, B., Ordonez Ercan, D., and Chellappan, S. (2004) J Biol Chem 279, 38762 38769 238. Navab, M., Fogelman, A. M., Berliner, J. A., Territo, M. C., Demer, L. L., Frank, J. S., Watson, A. D., Edwards, P. A., and Lusis, A. J. (1995) Am J Cardiol 76, 18 C 23C 239. Peppel, K., Zhang, L., Orman, E. S., Hagen, P. O., Amalfitano, A., Brian, L., and Freedman, N. J. (2005) Cardiovasc Res 65, 674 682 240. Goetze, S., Xi, X. P., Kawano, Y., Kawano, H., Fleck, E., Hsueh, W. A., and Law, R. E. (1999) Hypertension 3 3, 183 189 241. Daria, D., Filippi, M. D., Knudsen, E. S., Faccio, R., Li, Z., Kalfa, T., and Geiger, H. (2008) Blood 111, 1894 1902 242. Ying, L., Marino, J., Hussain, S. P., Khan, M. A., You, S., Hofseth, A. B., Trivers, G. E., Dixon, D. A., Harris, C. C ., and Hofseth, L. J. (2005) Cancer Res 65, 9132 9136 243. Losordo, D. W., Isner, J. M., and Diaz Sandoval, L. J. (2003) Circulation 107, 2635 2637 244. Folkman, J., and Shing, Y. (1992) J Biol Chem 267, 10931 10934 245. Abedi, H., and Zachary, I. (1995) C ardiovasc Res 30, 544 556 246. Schwartz, R. S., Huber, K. C., Murphy, J. G., Edwards, W. D., Camrud, A. R., Vlietstra, R. E., and Holmes, D. R. (1992) J Am Coll Cardiol 19, 267 274 247. Ferns, G. A., Raines, E. W., Sprugel, K. H., Motani, A. S., Reidy, M. A., and Ross, R. (1991) Science 253, 1129 1132 248. Carie, A. E., and Sebti, S. M. (2007) Oncogene

PAGE 192

176 249. Rastogi, S., Joshi, B., Dasgupta, P., Morris, M., Wright, K., and Chellappan, S. (2006) Mol Cell Biol 26, 4161 4171 250. Nicosia, R. F., Zhu, W. H., Fo gel, E., Howson, K. M., and Aplin, A. C. (2005) J Vasc Res 42, 111 119 251. Akhtar, N., Dickerson, E. B., and Auerbach, R. (2002) Angiogenesis 5, 75 80 252. Gautam, A., Li, Z. R., and Bepler, G. (2003) Oncogene 22, 2135 2142 253. Mathai, M., Skinner, A., L awton, K., and Weindling, A. M. (1990) Aust N Z J Obstet Gynaecol 30, 33 36 254. Matsukura, S., Taminato, T., Kitano, N., Seino, Y., Hamada, H., Uchihashi, M., Nakajima, H., and Hirata, Y. (1984) N Engl J Med 311, 828 832 255. Thompson, S. G., Stone, R., N anchahal, K., and Wald, N. J. (1990) Thorax 45, 356 361 256. Sherr, C. J. (1994) Trends Cell Biol 4, 15 18 257. Weinberg, R. A. (1995) Cell 81, 323 330 258. Reddy, G. P. (1994) J Cell Biochem 54, 379 386 259. Nevins, J. R. (1994) Curr Opin Genet Dev 4, 130 134 260. Nguyen, L. L., and D'Amore, P. A. (2001) Int Rev Cytol 204, 1 48 261. Knudsen, E. S., and Wang, J. Y. (1996) J Biol Chem 271, 8313 8320 262. Gerdes, B., Bartsch, D. K., Ramaswamy, A., Kersting, M., Wild, A., Schuermann, M., Frey, M., and Rothmund M. (2000) Pancreas 21, 369 375 263. Weller, M., Rieger, J., Grimmel, C., Van Meir, E. G., De Tribolet, N., Krajewski, S., Reed, J. C., von Deimling, A., and Dichgans, J. (1998) Int J Cancer 79, 640 644 264. Price, J. T., Tiganis, T., Agarwal, A., Djakiew D., and Thompson, E. W. (1999) Cancer Res 59, 5475 5478

PAGE 193

177 265. Davies, H., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M. J., Bottomley, W., Davis, N., Dicks, E., Ewing, R., Floyd, Y., Gray, K., Hall, S ., Hawes, R., Hughes, J., Kosmidou, V., Menzies, A., Mould, C., Parker, A., Stevens, C., Watt, S., Hooper, S., Wilson, R., Jayatilake, H., Gusterson, B. A., Cooper, C., Shipley, J., Hargrave, D., Pritchard Jones, K., Maitland, N., Chenevix Trench, G., Rigg ins, G. J., Bigner, D. D., Palmieri, G., Cossu, A., Flanagan, A., Nicholson, A., Ho, J. W., Leung, S. Y., Yuen, S. T., Weber, B. L., Seigler, H. F., Darrow, T. L., Paterson, H., Marais, R., Marshall, C. J., Wooster, R., Stratton, M. R., and Futreal, P. A. (2002) Nature 417, 949 954 266. Tanaka, M., Rosser, C. J., and Grossman, H. B. (2005) Cancer Detect Prev 29, 170 174 267. Alavi, A., Hood, J. D., Frausto, R., Stupack, D. G., and Cheresh, D. A. (2003) Science 301, 94 96 268. Beeram, M., Patnaik, A., and Ro winsky, E. K. (2005) J Clin Oncol 23, 6771 6790 269. Arkin, M. R., and Wells, J. A. (2004) Nat Rev Drug Discov 3, 301 317 270. Wilhelm, S., Carter, C., Lynch, M., Lowinger, T., Dumas, J., Smith, R. A., Schwartz, B., Simantov, R., and Kelley, S. (2006) Nat Rev Drug Discov 5, 835 844 271. Ehrenreiter, K., Piazzolla, D., Velamoor, V., Sobczak, I., Small, J. V., Takeda, J., Leung, T., and Baccarini, M. (2005) J Cell Biol 168, 955 964 272. Lee, K. Y., Ladha, M. H., McMahon, C., and Ewen, M. E. (1999) Mol Cell Bi ol 19, 7724 7732 273. Bai, F., Pei, X. H., Pandolfi, P. P., and Xiong, Y. (2006) Mol Cell Biol 26, 4564 4576 274. Braden, W. A., Lenihan, J. M., Lan, Z., Luce, K. S., Zagorski, W., Bosco, E., Reed, M. F., Cook, J. G., and Knudsen, E. S. (2006) Mol Cell Bio l 26, 7667 7681 275. Peeper, D. S., Upton, T. M., Ladha, M. H., Neuman, E., Zalvide, J., Bernards, R., DeCaprio, J. A., and Ewen, M. E. (1997) Nature 386, 177 181

PAGE 194

178 276. Fischer, C., Jonckx, B., Mazzone, M., Zacchigna, S., Loges, S., Pattarini, L., Chorianop oulos, E., Liesenborghs, L., Koch, M., De Mol, M., Autiero, M., Wyns, S., Plaisance, S., Moons, L., van Rooijen, N., Giacca, M., Stassen, J. M., Dewerchin, M., Collen, D., and Carmeliet, P. (2007) Cell 131, 463 475 277. Suzuma, K., Takahara, N., Suzuma, I. Isshiki, K., Ueki, K., Leitges, M., Aiello, L. P., and King, G. L. (2002) Proc Natl Acad Sci U S A 99, 721 726 278. Chen, J., Fujii, K., Zhang, L., Roberts, T., and Fu, H. (2001) Proc Natl Acad Sci U S A 98, 7783 7788 279. Issaeva, N., Bozko, P., Enge, M ., Protopopova, M., Verhoef, L. G., Masucci, M., Pramanik, A., and Selivanova, G. (2004) Nat Med 10, 1321 1328 280. DePinto, W., Chu, X. J., Yin, X., Smith, M., Packman, K., Goelzer, P., Lovey, A., Chen, Y., Qian, H., Hamid, R., Xiang, Q., Tovar, C., Blain R., Nevins, T., Higgins, B., Luistro, L., Kolinsky, K., Felix, B., Hussain, S., and Heimbrook, D. (2006) Mol Cancer Ther 5, 2644 2658 281. Moasser, M. M., Basso, A., Averbuch, S. D., and Rosen, N. (2001) Cancer Res 61, 7184 7188 282. Bepler, G. (2003) Ca ncer Control 10, 275 276 283. Johnson, B. E. (1998) Prim Care 25, 279 291 284. Cox, L. S., Africano, N. L., Tercyak, K. P., and Taylor, K. L. (2003) Cancer 98, 632 644 285. Itier, V., and Bertrand, D. (2001) FEBS Lett 504, 118 125 286. Conklin, B. S., Zhao W., Zhong, D. S., and Chen, C. (2002) Am J Pathol 160, 413 418 287. Xu, L., and Deng, X. (2006) J Biol Chem 281, 4457 4466 288. Schuller, H. M., Plummer, H. K., 3rd, and Jull, B. A. (2003) Anat Rec A Discov Mol Cell Evol Biol 270, 51 58 289. West, K. A., Brognard, J., Clark, A. S., Linnoila, I. R., Yang, X., Swain, S. M., Harris, C., Belinsky, S., and Dennis, P. A. (2003) J Clin Invest 111, 81 90

PAGE 195

179 290. Dasgupta, P., Kinkade, R., Joshi, B., Decook, C., Haura, E., and Chellappan, S. (2006) Proc Natl Acad Sci U S A 103, 6332 6337 291. Mai, H., May, W. S., Gao, F., Jin, Z., and Deng, X. (2003) J Biol Chem 278, 1886 1891 292. Heusch, W. L., and Maneckjee, R. (1998) Carcinogenesis 19, 551 556 293. Trombino, S., Cesario, A., Margaritora, S., Granone, P., Motta, G. Falugi, C., and Russo, P. (2004) Cancer Res 64, 135 145 294. Murin, S., and Inciardi, J. (2001) Chest 119, 1635 1640 295. Murin, S., Pinkerton, K. E., Hubbard, N. E., and Erickson, K. (2004) Chest 125, 1467 1471 296. Richardson, G. E., Tucker, M. A., Ven zon, D. J., Linnoila, R. I., Phelps, R., Phares, J. C., Edison, M., Ihde, D. C., and Johnson, B. E. (1993) Ann Intern Med 119, 383 390 297. Dasgupta, P., and Chellappan, S. P. (2006) Cell Cycle 5, 2324 2328 298. Zhu, B. Q., Heeschen, C., Sievers, R. E., Ka rliner, J. S., Parmley, W. W., Glantz, S. A., and Cooke, J. P. (2003) Cancer Cell 4, 191 196 299. Garces, Y. I., Yang, P., Parkinson, J., Zhao, X., Wampfler, J. A., Ebbert, J. O., and Sloan, J. A. (2004) Chest 126, 1733 1741 300. Johnston Early, A., Cohen, M. H., Minna, J. D., Paxton, L. M., Fossieck, B. E., Jr., Ihde, D. C., Bunn, P. A., Jr., Matthews, M. J., and Makuch, R. (1980) Jama 244, 2175 2179 301. Zevin, S., Gourlay, S. G., and Benowitz, N. L. (1998) Clin Dermatol 16, 557 564 302. Lam, D. C., Girar d, L., Ramirez, R., Chau, W. S., Suen, W. S., Sheridan, S., Tin, V. P., Chung, L. P., Wong, M. P., Shay, J. W., Gazdar, A. F., Lam, W. K., and Minna, J. D. (2007) Cancer Res 67, 4638 4647 303. Ross, R. (1993) Nature 362, 801 809 304. Bilder, G., Amin, D., Morgan, L., McVey, M., Needle, S., Galczenski, H., Leadley, R., He, W., Myers, M., Spada, A., Luo, Y., Natajaran, C., and Perrone, M. (2003) J Cardiovasc Pharmacol 41, 817 829

PAGE 196

180 305. Boucher, P., Gotthardt, M., Li, W. P., Anderson, R. G., and Herz, J. (2003) Science 300, 329 332 306. Yoshimura, H., Nariai, Y., Terashima, M., Mitani, T., and Tanigawa, Y. (2005) Biochim Biophys Acta 1745, 350 360 307. Bilder, G., Wentz, T., Leadley, R., Amin, D., Byan, L., O'Conner, B., Needle, S., Galczenski, H., Bostwick, J., Kasiewski, C., Myers, M., Spada, A., Merkel, L., Ly, C., Persons, P., Page, K., Perrone, M., and Dunwiddie, C. (1999) Circulation 99, 3292 3299 308. Selzman, C. H., Shames, B. D., McIntyre, R. C., Jr., Banerjee, A., and Harken, A. H. (1999) Ann Thorac Surg 67, 1227 1231; discussion 1231 1222 309. Geng, Y. J., Wu, Q., Muszynski, M., Hansson, G. K., and Libby, P. (1996) Arterioscler Thromb Vasc Biol 16, 19 27 310. Sawada, H., Kan, M., and McKeehan, W. L. (1990) In Vitro Cell Dev Biol 26, 213 21 6 311. Chen, G., and Goeddel, D. V. (2002) Science 296, 1634 1635 312. Choy, J. C., Granville, D. J., Hunt, D. W., and McManus, B. M. (2001) J Mol Cell Cardiol 33, 1673 1690 313. Madge, L. A., and Pober, J. S. (2001) Exp Mol Pathol 70, 317 325 314. Ashkena zi, A., and Dixit, V. M. (1998) Science 281, 1305 1308 315. Ichijo, H. (1998) Kokubyo Gakkai Zasshi 65, 155 163. 316. Ichijo, H., Nishida, E., Irie, K., ten Dijke, P., Saitoh, M., Moriguchi, T., Takagi, M., Matsumoto, K., Miyazono, K., and Gotoh, Y. (1997) Science 275, 90 94. 317. Matsuzawa, A., and Ichijo, H. (2001) J Biochem (Tokyo) 130, 1 8 318. Takeda, K., Matsuzawa, A., Nishitoh, H., and Ichijo, H. (2003) Cell Struct Funct 28, 23 29 319. Selzman, C. H., Shames, B. D., Reznikov, L. L., Miller, S. A., Me ng, X., Barton, H. A., Werman, A., Harken, A. H., Dinarello, C. A., and Banerjee, A. (1999) Circ Res 84, 867 875

PAGE 197

181 320. Weber, J. D., Raben, D. M., Phillips, P. J., and Baldassare, J. J. (1997) Biochem J 326 ( Pt 1), 61 68 321. Ouyang, P., Peng, L. S., Yang, H., Peng, W. L., Wu, W. Y., and Xu, A. L. (2003) Sheng Li Xue Bao 55, 128 134 322. Kyriakis, J. M. (1999) Gene Expr 7, 217 231 323. Kyriakis, J. M. (1999) Biochem Soc Symp 64, 29 48 324. Leppa, S., and Bohmann, D. (1999) Oncogene 18, 6158 6162 325. Chau, B. N., Chen, T. T., Wan, Y. Y., DeGregori, J., and Wang, J. Y. (2004) Mol Cell Biol 24, 4438 4447 326. Piguet, P. F., Vesin, C., Guo, J., Donati, Y., and Barazzone, C. (1998) Eur J Immunol 28, 3499 3505 327. Goetze, S., Kintscher, U., Kaneshiro, K., Meehan W. P., Collins, A., Fleck, E., Hsueh, W. A., and Law, R. E. (2001) Atherosclerosis 159, 93 101 328. Murray, A. W. (2004) Cell 116, 221 234 329. Angus, S. P., Fribourg, A. F., Markey, M. P., Williams, S. L., Horn, H. F., DeGregori, J., Kowalik, T. F., Fuk asawa, K., and Knudsen, E. S. (2002) Exp Cell Res 276, 201 213 330. Lukas, J., Bartkova, J., and Bartek, J. (1996) Mol Cell Biol 16, 6917 6925 331. Malumbres, M., and Pellicer, A. (1998) Front Biosci 3, d887 912 332. DeGregori, J. (2006) Mol Cell Biol 26, 1165 1169


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001994142
003 fts
005 20090923085027.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 090330s2008 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002426
035
(OCoLC)317394538
040
FHM
c FHM
049
FHMM
090
RC254.6 (Online)
1 100
Kinkade, Rebecca.
0 245
Rb-Raf-1 interaction as a therapeutic target for proliferative disorders
h [electronic resource] /
by Rebecca Kinkade.
260
[Tampa, Fla] :
b University of South Florida,
2008.
500
Title from PDF of title page.
Document formatted into pages; contains 181 pages.
502
Dissertation (Ph.D.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
520
ABSTRACT: The retinoblastoma tumor suppressor protein, Rb, is a key regulator of the mammalian cell cycle and its inactivation facilitates S-phase entry. Rb is inactivated through multiple waves of phosphorylation, mediated mainly by kinases associated with D and E type cyclins in the G1 phase of the cell cycle. Our earlier studies had shown that the signaling kinase Raf-1 (c-Raf) physically interacts with Rb upon growth factor stimulation and initiates the phosphorylation cascade. We had shown that an 8 amino acid peptide derived from Raf-1 could disrupt the Rb-Raf-1 interaction leading to an inhibition of Rb phosphorylation, cell proliferation and tumor growth in nude mice. Here, we describe a newly identified orally-active small molecule, RRD-251 (Rb Raf-1 Disruptor 251), that disrupts potently and selectively the binding of Raf-1 to Rb; it had no effect on Rb-HDAC1, Rb-Prohibitin, Rb-Ask1, Rb-cyclin E, or Raf-1-Mek interactions.RRD-251 inhibited anchorage-dependent and -independent growth of human cancer cells; it could also potently inhibit angiogenesis both in vitro and in vivo. Oral or intra-peritoneal administration of RRD-251 resulted in a significant suppression of growth of tumors xenotransplanted into athymic nude mice; the tumor suppressive effects were restricted to tumors carrying a wild-type Rb gene. Thus, selective targeting of Rb-Raf-1 interaction appears to be a promising approach for developing novel anti-cancer agents. In addition to mitogens, tobacco components like NNK and nicotine can induce cell proliferation and angiogenesis, contributing to lung cancer. Induction of cell proliferation by tobacco components required the binding of Raf-1 to Rb and RRD-251 could prevent nicotine induced cell proliferation. Our studies also show how nicotine not only promotes tumor growth in vivo, it also increases chance of tumor recurrence and metastasis.In addition to growth factors and tobacco components, cytokines like TNF could induce Rb-Raf-1 interaction in vascular smooth muscle cells. Since TNF-induced proliferation of vascular smooth muscle cells contributes to growth of atherosclerotic plaques, RRD-251 could be beneficial in controlling atherosclerosis as well. Thus, it appears that drugs that can disrupt the Rb-Raf-1 interaction might have beneficial effects in a wide spectrum of human diseases.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor: Srikumar Chellappan, Ph.D.
653
Cancer
Tumor suppressor
Cell-cycle
Small-molecule
Inhibition
690
Dissertations, Academic
z USF
x Cancer Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2426