USF Libraries
USF Digital Collections

Analysis of the role of bHLH/PAS proteins in aryl hydrocarbon receptor signaling

MISSING IMAGE

Material Information

Title:
Analysis of the role of bHLH/PAS proteins in aryl hydrocarbon receptor signaling
Physical Description:
Book
Language:
English
Creator:
Dougherty, Edward J
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
AHR
ARNT
ARNT2
XAP2
Dioxin
Dissertations, Academic -- Biology -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: The aryl hydrocarbon receptor (AHR) is a basic helix-loop-helix PER/ARNT/SIM (bHLH-PAS) transcription factor that binds ligands typified by 2,3,7,8-tetracholordibenzo-p-dioxin, translocates to the nucleus, dimerizes with the aryl hydrocarbon nuclear translocator (ARNT) and associates with specific cis xenobiotic response elements to activate transcription of genes involved with xenobiotic metabolism. AHR-mediated signal transduction has been evaluated thoroughly in the C57BL/6J mouse model system. This model system, however, may not be the most accurate model for human comparisons as the AHR b-1 allele carried by C57BL/6J contains a point mutation that prematurely truncates the receptor at 805 amino acids, while the AHR b-2, rat, and human AHR all contain an additional 42-45 amino acids at their carboxy-terminus that have 70% identity.This carboxy-terminal region could be functionally significant and the analysis of AHR-mediated signal transduction in the rat, human, or other mouse strains may better represent the physiology of the AHR pathway. ARNT is another member of the bHLH-PAS family of proteins that is essential in several distinct signal transduction pathways mediated by its dimerization with a variety of bHLH-PAS proteins. Several isoforms of ARNT have been identified in mammalian and aquatic species. While ARNT and ARNT2 exhibit >90% amino acid identity in the bHLH and PAS domains, gene knock-out of either ARNT or ARNT2 results in embryonic/perinatal lethality characterized by distinct phenotypes. This suggests that neither protein can compensate fully for the loss of the other.Since overlapping tissue specific expression of ARNT and ARNT2 does exist, but neither ARNT can compensate fully for loss of the other, this suggests that the two proteins have distinct functions in the presence of various dimerization partners. Thus, the focus of these studies is to examine the discrepancies between the rat, human, or AHR b-2 possessing the extended carboxy-terminal region and that of the AHRb-1 and also to examine the role of both ARNT and ARNT2 during AHR-mediated signal transduction.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Edward J. Dougherty.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 284 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001994161
oclc - 317408474
usfldc doi - E14-SFE0002441
usfldc handle - e14.2441
System ID:
SFS0026758:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001994161
003 fts
005 20090330145237.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 090330s2008 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002441
035
(OCoLC)317408474
040
FHM
c FHM
049
FHMM
090
QH307.2 (Online)
1 100
Dougherty, Edward J.
0 245
Analysis of the role of bHLH/PAS proteins in aryl hydrocarbon receptor signaling
h [electronic resource] /
by Edward J. Dougherty.
260
[Tampa, Fla] :
b University of South Florida,
2008.
500
Title from PDF of title page.
Document formatted into pages; contains 284 pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
520
ABSTRACT: The aryl hydrocarbon receptor (AHR) is a basic helix-loop-helix PER/ARNT/SIM (bHLH-PAS) transcription factor that binds ligands typified by 2,3,7,8-tetracholordibenzo-p-dioxin, translocates to the nucleus, dimerizes with the aryl hydrocarbon nuclear translocator (ARNT) and associates with specific cis xenobiotic response elements to activate transcription of genes involved with xenobiotic metabolism. AHR-mediated signal transduction has been evaluated thoroughly in the C57BL/6J mouse model system. This model system, however, may not be the most accurate model for human comparisons as the AHR b-1 allele carried by C57BL/6J contains a point mutation that prematurely truncates the receptor at 805 amino acids, while the AHR b-2, rat, and human AHR all contain an additional 42-45 amino acids at their carboxy-terminus that have 70% identity.This carboxy-terminal region could be functionally significant and the analysis of AHR-mediated signal transduction in the rat, human, or other mouse strains may better represent the physiology of the AHR pathway. ARNT is another member of the bHLH-PAS family of proteins that is essential in several distinct signal transduction pathways mediated by its dimerization with a variety of bHLH-PAS proteins. Several isoforms of ARNT have been identified in mammalian and aquatic species. While ARNT and ARNT2 exhibit >90% amino acid identity in the bHLH and PAS domains, gene knock-out of either ARNT or ARNT2 results in embryonic/perinatal lethality characterized by distinct phenotypes. This suggests that neither protein can compensate fully for the loss of the other.Since overlapping tissue specific expression of ARNT and ARNT2 does exist, but neither ARNT can compensate fully for loss of the other, this suggests that the two proteins have distinct functions in the presence of various dimerization partners. Thus, the focus of these studies is to examine the discrepancies between the rat, human, or AHR b-2 possessing the extended carboxy-terminal region and that of the AHRb-1 and also to examine the role of both ARNT and ARNT2 during AHR-mediated signal transduction.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor: Richard S. Pollenz, Ph.D.
653
AHR
ARNT
ARNT2
XAP2
Dioxin
690
Dissertations, Academic
z USF
x Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2441



PAGE 1

Analysis of the Role of bHLH/PAS Prot eins in Aryl Hydrocarbon Receptor Signaling by Edward J. Dougherty A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Biology College of Arts and Sciences University of South Florida Major Professor: Richard S. Pollenz, Ph.D. Brian T. Livingston, Ph.D. Kristina H. Schmidt, Ph.D. Robert L. Potter, Ph.D. Date of Approval: May 3, 2008 Keywords: AHR, ARNT, ARNT2, XAP2, Di oxin, Signal transduction, Xenobiotic metabolism Copyright 2008, Edward John Dougherty

PAGE 2

Dedication This manuscript is dedicated to Richar d S. Pollenz, Ph.D. who taught me that perseverance pays off (eventually) and that science can be fulfilling (eventually). I would also like to thank my wife Amy A.B. Tatem, for being extremely supportive and coming to the laboratory with me on late nights and weekends to watch me culture cells and my parents for helping me to attain the education necessary to reach this point. I would also like to thank the remaining members of both my families for all of their support over the years.

PAGE 3

Acknowledgements I would also like to acknowledge th e members of my committee: Brian T. Livingston, Ph.D., Kristina H. Schmidt, Ph.D., and Robert L. Potter, Ph.D. as well as my coworkers: Sarah E. Wilson, Gary T. Ze Ruth, Robert Buzzeo, and Jesal Popat who together have made working at the Universi ty of South Florida a wonderful experience and who have provided valuable i nput over the past four years.

PAGE 4

i Table of Contents List of Tables v List of Figures vi List of Acronyms xi Abstract xiv Chapter 1: Introduction 1 1.1 AHR and ARNT History 1 1.2 AHR and ARNT Domains 8 1.3 AHR Proteins 15 1.4 AHR-Mediated Signaling 21 1.5 AHR Associated Proteins 23 1.6 Degradation of the AHR 25 1.7 Consequences of AHR Degr adation or Overexpression 27 1.8 Mammalian ARNT Isoforms 28 1.9 ARNT Isoforms from Other Species 34 1.10 ARNT-Dependent Signaling 36 1.10.1 AHR Signaling 36 1.10.2 Hypoxic Signaling 38 1.10.3 SIM1/SIM2 Interactions 39 1.10.4 Circadian Signaling 41 1.10.5 AINT Interactions 42 1.10.6 ARNT Homodimer Interactions 43 1.11 ARNT Interactions with Transcriptional Repressors 45 1.11.1 Aryl Hydrocarbon Recepto r Repressor Interactions 45 1.11.2 NPAS Interactions 46 1.11.3 Necdin Interactions 46 1.12 AHR and ARNT Levels 47 1.13 ARNT Crosstalk 48 1.14 AHR and ARNT Defective Hepatoma Cell Lines 51 1.15 Knockout Animals 52 1.16 Toxicity of TCDD 56 1.17 Role of AHR and ARNT in Mediating TCDD Toxicity 58

PAGE 5

ii Chapter 2: Generation and Characterization of Stable Lines E xpressing Different Species of AHR 60 2.1 Rationale for Stable Cell Line s Expressing Different Species of AHR 60 2.2 Generation of LA-I lines Expressing AHRb-1 or AHRb-2 61 2.3 Reduced Association of XAP2 with Ahb-2 Receptors Expressed in the Hepa-1 Background Mimics That of Endogenously Expressed Ahb-2 Receptors 68 2.4 Ahb-2 Receptor Expressed in the He pa-1 Background Exhibits Dynamic Nucleocytoplasmic Shuttling 71 2.5 Exogenous Expression of XAP2 Do es Not Affect the Subcellular Localization of the Ahb-1 or the Ahb-2 Receptor 75 2.6 Degradation of the Mouse Ahb-2 Receptor in the Hepa-1 Background Varies From the Ahb-1 80 2.7 Time Course of CYP1A1 I nduction is Unaltered by Ah Receptor Type 83 2.8 AHb2 Stable Line Conclusions 86 Chapter 3: Generation and Characteriz ation of Stable Lines Expressing Ah-Receptors Deficient in DNABinding or ARNT Dimerization 88 3.1 Rationale for AHR Mutant Lines 88 3.2 Generation of LA-I Lines Expr essing AHR DNA Binding Mutants and ARNT Dimerization Mutants 92 3.3 Characterization of AHR Muta nts Deficient in DNA Binding and ARNT Dimerization 94 3.4 Ligand-Dependent Degrada tion of the AHR Requires DNA Binding 104 3.5 Ligand-Independent Degradati on of the AHR Does Not Require DNA Binding 108 3.6 Impact of NH-Terminal Tags on AHR Degradation 110 Chapter 4: Functional Analysis of ARNT 2 in AHR-mediated Signal Transduction 117 4.1 Rationale for Eval uating ARNT2 Function 117 4.2 ARNT2 Does Not Function to the Same Level as ARNT in AHR-Mediated Signaling 118 4.3 Inability of ARNT2 to Function in the Regulation of CYP1A1 is Not a Result of Proline 352 126 4.4 In Vitro Synthesized ARNT and ARNT2 Appear to Exhibit Equivalent Ability to Dimerize With the AHR and Bind DNA 128 4.5 ARNT2 Can Out-Compete ARNT for Association with the Liganded AHR 137

PAGE 6

iii 4.6 The Ability of ARNT2 to Associate with the AHR and Bind DNA is Not Dependent on AHR C oncentration or ARNT Protein Concentration 139 4.7 The Ability of ARNT2 to Associate with the AHR and Bind DNA May be XRE-Specific 144 4.8 DNA Binding Ability of AHR•ARNT 2 Heterodimers Appears to be Ligand Dependent 146 4.9 The Ability of ARNT or ARNT2 to Dimerize with the AHR in Vitro May be Receptor Species Dependent 153 4.10 The Ability of ARNT or ARNT2 to Dimerize with the AHR in Vitro Does Not Appear to Differ When Expressed in Vivo 157 4.11 Inhibition of ARNT by AR NT2 in AHR-Mediated Signaling 159 4.12 ARNT2 Does Not Function to the Same Level as ARNT in Endogenous AHR-Mediated Signaling 163 4.13 Analysis of ARNT2 Function When Endogenously Expressed 166 4.14 ARNT2 from Nuclear Extr acts Fails to Bind XREs 169 4.15 Function of ARNT Versus ARNT2 in Hypoxic Signaling 177 4.16 Evaluation of Potential ARNT and ARNT2 Homodimers 178 Chapter 5: Implications and Future Directions 183 5.1 Implications of AHRb-2 Studies 183 5.2 Implications of AHR Degradation Studies 190 5.3 Implications of ARNT2 Studies 198 Chapter 6: Materials and Methods 212 6.1 Materials 212 6.2 Buffers 212 6.3 Cells and Growth Conditions 213 6.4 Antibodies 213 6.5 Generation of Expression Constructs 214 6.6 In Vitro Expression of Protein 218 6.7 Transient Transfection 218 6.8 Viral Transfections and Selection 219 6.9 Luciferase Reporter Studies 220 6.10 RNA Interference 220 6.11 Immunofluorescence Staining and Microscopy 221 6.12 Preparation of Total Cell/Tissue Lysates 222 6.13 Preparation of Cytoso l and Nuclear Extracts 222 6.14 Western Blot Analysis a nd Quantification of Protein 223 6.15 In Vitro Activation of AHR•ARNT Complexes and Electrophoretic Mobility Shift Assays 224 6.16 Immunoprecipitations 226 6.17 Statistical Analysis 226

PAGE 7

iv References 227 Bibliography 264 Appendices 265 Appendix A: Endogenous AHRb-2 Data 266 Appendix B: Hypoxia qRT-PCR Primer Sets 274 About the Author End Page

PAGE 8

v List of Tables Table 1.1 Summary of ARNT cloning 5 Table 1.2 Amino acid identity comparisons of murine ARNT types and across ARNT isoform domains 6 Table 1.3 Amino acid changes among the first 805 amino acids of murine AHR alleles 18 Table 1.4 mRNA expression for mARNT and mARNT2 in murine peripheral organs and central ner vous system at postnatal day 1.5 33

PAGE 9

vi List of Figures Figure 1.1 Overview of known cellular pathways requiring ARNT or ARNT2 in mammals 7 Figure 1.2 Domain structures of the AHR (b1 allele) and ARNT 13 Figure 1.3 Protein sequence alignm ent of various AHR c-termini 17 Figure 1.4 AHR protein dendogram 20 Figure 1.5 Schematic of the AHR signaling pathway 22 Figure 1.6 Homology between ARNT and ARNT2 domains 32 Figure 1.7 ARNT protein dendogram 35 Figure 1.8 Structures of common tetrachlorinatedcongeners for various halogenated aromatic hydrocarbons 57 Figure 2.1 Invitrogen plasmid maps 62 Figure 2.2 Western analysis of AHR c onstructs following transfection into AHR-deficient PT67 viral packaging cells 64 Figure 2.3 Schematic for viral transfection 65 Figure 2.4 Western analysis of stable lin e expression of target AHR constructs 66 Figure 2.5 Analysis of AHR and XAP2 e xpression and association in stable cell lines expressing Ahb-1 or Ahb-2 receptors 70 Figure 2.6 Subcellular lo calization of AHR in AHWT and AHb2 cells exposed to TCDD or LMB 74 Figure 2.7 Association of the Ahb-2 receptor with XAP2 in cells expressing increased levels of XAP2 77 Figure 2.8 Quantification of association of the Ahb-2 receptor with XAP2 in cells expressing increased levels of XAP2 78

PAGE 10

vii Figure 2.9 Localization of Ahb-2 receptor in AHb2 cells expressing hXAP2 79 Figure 2.10 Western blot analysis of AHR in stable cell lines expressing Ahb-1 or Ahb-2 receptors exposed to TCDD 82 Figure 2.11 Western blot an alysis of CYP1A1 protei n in stable cell lines expressing Ah b-1 or Ahb-2 receptors following exposure to TCDD 84 Figure 2.12 Analysis of dose-response for CYP1A1 induction in stable cell lines expressing Ahb-1 or Ahb-2 receptor 85 Figure 3.1 Schematic of the AHR liga nd-dependent and ligand-independent 90 Figure 3.2 Schematic of AHR mutations for R39A and NES AHR mutant stable lines. 93 Figure 3.3 Western analysis of AHRtr, R39A, and NES AHR mutants 95 Figure 3.4 Western analysis of R39A and NES stable lines 96 Figure 3.5 Time course of liga nd-induced degradation of the AHRWT and trAHR 97 Figure 3.6 Overday or overnight li gand-induced degradation of the AHWT, R39A, or NES stable lines 99 Figure 3.7 Analysis of TCDD-induced luciferase activity in LA-I, AHWT, R39A, and NES stable lines 101 Figure 3.8 Subcellular localization of the NES and R39A AHR 102 Figure 3.9 Immunoprecipitation analys is of ARNT association in NES and R39A stable lines 103 Figure 3.10 Analysis of accumulation of AHR and ARNT in cytosolic and nuclear extracts for AHWT, R39A, and NES stable lines 105 Figure 3.11 Impact of actinomycin D on TCDD-induced degradation of AHRWT and NES stable lines 107 Figure 3.12 Geldanamycin-induced degrad ation of wild-type Hepa-1 cells, AHWT, R39A, or NES stable lines 109

PAGE 11

viii Figure 3.13 Invitrogen plasmid maps fo r generating constructs with NHterminal tags 111 Figure 3.14 Characterization of HMand GFP-tagged AHR stable lines 113 Figure 3.15 Ligand-induced degradation in HMand GFP-tagged AHR stable lines 114 Figure 3.16 Ligand-induced CYP1A1 i nduction in HMand GFP-tagged AHR stable lines 115 Figure 3.17 Geldanamycin-induced degrad ation of the HMand GFP-tagged AHR 116 Figure 4.1 Protein schematic of V5 -ARNT and V5-ARNT2 constructs 120 Figure 4.2 Analysis of TCDD-induced luciferase activity in LA-II cells transfected with ARNT or ARNT2 121 Figure 4.3 Induction of CYP1A1 protei n in cells expressing ARNT or ARNT2 123 Figure 4.4 Induction of CYP1A1 protein in ARNT or ARNT2 stable lines 125 Figure 4.5 Induction of CYP1A1 protei n in cells expressing ARNT, ARNT2, or ARNT2-H 127 Figure 4.6 Schematic for evaluation of DNA binding potential of ARNT and ARNT2 using in vitro synthe sized and activated samples 129 Figure 4.7 DNA binding of AHR•ARNT and AHR•ARNT2 heterodimers 131 Figure 4.8 Schematic for evaluation of DN A binding potential of a mixture of ARNT and ARNT2 using in vitr o synthesized and activated samples 133 Figure 4.9 DNA binding of AHR•ARNT and AHR•ARNT2 heterodimers in the presence of both ARNT and ARNT2 134 Figure 4.10 Association of AR NT and ARNT2 with AHR 136 Figure 4.11 Effect of ARNT2 concentra tion of the formation of AHR•ARNT complexes 138

PAGE 12

ix Figure 4.12 DNA binding of AHR•ARNT a nd AHR•ARNT2 heterodimers in the presence of limiting AHR 141 Figure 4.13 Effect of target protein concentration on the formation of AHR• ARNT and AHR•ARNT2 heterodimers 143 Figure 4.14 Analysis of XRE seque nce on DNA binding ability of AHR• ARNT and AHR•ARNT2 heterodimers 145 Figure 4.15 Effect of 3-MC on the DNA binding ability of AHR•ARNT and AHR•ARNT2 complexes 148 Figure 4.16 Effect of different li gands on the DNA binding ability 149 Figure 4.17 Association of ARNT and ARNT2 with BAP or TCDD activated AHR 152 Figure 4.18 Analysis of AHR species on the formation of TCDD or BAP dependent AHR•ARNT or AHR•ARNT2 heterodimers 155 Figure 4.19 DNA binding of ARNT or AR NT2 expressed in cell culture 158 Figure 4.20 Impact of ARNT2 expr ession on AHR-mediated signaling 161 Figure 4.21 Impact of ARNT2 expressi on on AHR-mediated signaling in cell culture 162 Figure 4.22 ARNT and ARNT2 protein expression in tissu es and cells 165 Figure 4.23 Reduction of endogenous AR NT or ARNT2 by siRNA knockdown in hRPE cells 167 Figure 4.24 DNA binding of NRK and hRPE nuclear extracts 170 Figure 4.25 DNA binding of NRK cytosolic extracts 172 Figure 4.26 DNA binding of Hepa-1 nuclear extracts 174 Figure 4.27 Immunoprecipitation analysis of NRK and WT Hepa-1 cells expressing ARNT2 176 Figure 4.28 Analysis of the role of ARNT2 in hypoxia 179 Figure 5.1 Hypothetical model for lack of ARNT2 function in vivo 203

PAGE 13

x Figure A-1 Analysis of AHR and XAP2 expression and association in Hepa-1, A7, and C2C12 cells 267 Figure A-2 Subcellular localization of AHR in Hepa-1, A7, C2C12, and 10T1/2 cells exposed to TCDD or LMB 268 Figure A-3 Reduction of endogenous XAP2 by siRNA knockdown in Hepa-1 cells 269 Figure A-4 Subcellular localization of AH R in cells with reduced levels of XAP2 270 Figure A-5 Association of endogenous XAP2 with AHR in Hepa-1 cells transfected with hXAP2 expression vectors 271 Figure A-6 Localization of endogenous Ahb-1 receptors in Hepa-1 cells expressing hXAP2 272 Figure A-7 Western blot an alysis of AHR in Hepa-1, A7, and C2C12 cells exposed to TCDD 273

PAGE 14

xi List of Acronyms 3MC, 3-methylcholanthrene AD, actinomycin-D AHR, aryl hydrocarbon receptor AHRR, aryl hydrocarbon receptor repressor ARNT, aryl hydrocarbon receptor nuclear translocator ARNT2, aryl hydrocarbon receptor nu clear translocator isoform 2 ARNTL, ARNT-like protein BAP, benzo[a]pyrene bHLH, basic helix-loop-helix domain BMAL, brain and muscle ARNT-like protein CAR, constitutively active AHR ChIP, chromatin immunoprecipitation CHIP, carboxyl terminus of hsc70-interacting protein CHX, cycloheximide CLIF, cycle-like factor CME, central midline enhancer CMV, cytomegalovirus CoCl2, cobalt chloride CUL4, cullin 4b CYP1A1, cytochrome P450 1A1 CyP40, cyclophilin 40 DDB1, DNA damage binding protein 1 DFO/DFX, desferrioxamine DMEM, Dulbecco’s modified Eagle’s medium DORV, double outlet right ventricle DRE, dioxin response element E-box, enhancer box ECL, enhanced chemiluminescence ED, embryonic dat EMSA, electrophoretic mobility shift assay ER, estrogen receptor EROD, 7-ethoxycoumarin O-demethylase FBS, fetal bovine serum FCS, fetal calf serum FK506, Tacrolimus or Fujimycin FK, FK506 binding domain GA, geldanamycin

PAGE 15

xii GAM-HRP, goat-anti-mous e IgG conjugated to hydrogen peroxidase GAR-HRP, goat-anti-rabbit IgG conj ugated to hydrogen peroxidase GAR-RHO, goat-anti-rabbit IgG conj ugated to hydrogen rhodamine GD, gestational day GFP, green fluorescent protein GR, glucocorticoid receptor GST, glutathione S-transferase HAH, halogenated aromatic hydrocarbons HIF, hypoxia-inducible factor HLF, hypoxia-like factor HM, hexahistidine tag with Xpress epitope (Invitrogen) HRE, hypoxia response element Hsp90, heat shock protein 90 IP, immunoprecipitation ITE, 2-(1'H-indole-3'-carbonyl)-thiazole -4-carboxylic acid methyl ester kD/kDa, kilodalton LMB, leptomycin B Me2SO, dimethyl sulfoxide MOP, modulator of PAS NES, nuclear export sequence NLS, nuclear localization sequence PAGE, polyacrylamide electrophoresis PAH, polycyclic aromatic hyrocarbons PAS, PER/ARNT/SIM homology domain PBS, phosphate buffered saline PCR, polymerase chain reaction PD, postnatal day PER, period protein Pi, Pre-immune PPI, peptidylprolyl isomerase domain PVN, paraventricular nuclei qRT-PCR, quantitative real time polymerase chain reaction SDS, sodium dodecyl sulfate SE, standard error of the mean SIM, single-minded protein SON, supraoptic nuclei SRC, steroid receptor coactivator TAD, transactivation domain TCDD, 2,3,7,8-tetrachlo rodibenzo-p-dioxin TNT, transcription and translation product TPR, tetratricopeptide repeat TTBS, Tris buffered saline with Tween 20 V5, epitope present on the P a nd V proteins of the paramyxovirus of simian virus 5 (SV5) VSD, ventricular septal defect WT, wild-type

PAGE 16

xiii XAP2, hepatitis B virus X-associated protein XRE, xenobiotic response element

PAGE 17

xiv Analysis of the Role of bHLH/PAS Proteins in Aryl Hydr ocarbon Receptor Signaling Edward J. Dougherty ABSTRACT The aryl hydrocarbon receptor (AHR) is a basic helix-loop-helix PER/ARNT/SIM (bHLH-PAS) transcription factor th at binds ligands typified by 2,3,7,8tetracholordibenzo-p-dioxin, tr anslocates to the nucleus, dimerizes with the aryl hydrocarbon nuclear translocator (ARNT) a nd associates with specific cis xenobiotic response elements to activate transcription of genes involved with xe nobiotic metabolism. AHR-mediated signal transduction has been evaluated thoroughl y in the C57BL/6J mouse model system. This model system, however, may not be the most accurate model for human comparisons as the AHRb-1 allele carried by C57BL/6J contains a point mutation that prematurely truncates the receptor at 805 amino acids, while the AHRb-2, rat, and human AHR all contain an add itional 42-45 amino acids at their carboxyterminus that have 70% identity. This carboxy-terminal region could be functionally significant and the analysis of AHR-mediated signal transduction in the rat, human, or other mouse strains may better represen t the physiology of the AHR pathway. ARNT is another member of the bHLH-PAS fa mily of proteins that is essential in several distinct signal transduction pathways mediated by its dimeri zation with a variety of bHLH-PAS proteins. Several isoforms of ARNT have been identified in mammalian

PAGE 18

xv and aquatic species. While ARNT and ARNT2 exhibit >90% amino acid identity in the bHLH and PAS domains, gene knock-out of either ARNT or ARNT2 results in embryonic/perinatal lethality ch aracterized by distinct phenot ypes. This suggests that neither protein can compensate fully for the loss of the other. Since overlapping tissue specific expression of ARNT and ARNT2 does exist, but neither ARNT can compensate fully for loss of the other, this suggests that the two proteins have di stinct functions in the presence of various dimerization partners. Thus, the focus of these studies is to examine the discrepancies between the rat, human, or AHRb-2 possessing the extended carboxyterminal region and that of the AHRb-1 and also to examine the role of both ARNT and ARNT2 during AHR-mediate d signal transduction.

PAGE 19

1 Chapter One Introduction 1.1 AHR and ARNT History The aryl hydrocarbon receptor (AHR) was init ially described as a heritable simple autosomal dominant trait, design ated the Ah locus that confer red the ability to induce aryl hydrocarbon hydroxylases by polyc yclic aromatic hydrocarbons in the C57BL/6N mouse (Gielen et al., 1972). Response to po lycyclic hydrocarbons, as measured in vitro by increased rate of formation of benzo[a]pyr ene metabolites through an increase in aryl hydrocarbon hydroxylase activity had been dete rmined by administration of aromatic hydrocarbon ligands such as 3-methylcholanth rene and benzo[a]pyrene. This response was not seen in the DBA/2N, DBA/2J, AKR /N, or NZW/BLN mice, now known to carry the AHRd low affinity ligand binding allele (Poland and Glover, 1974; Poland et al., 1976; Poland et al., 1994). It was later de scribed that 2, 3, 7, 8-tetrachlorodibenzo-pdioxin (TCDD) was approximately 30,000 times as potent as 3-methylcholanthrene as an inducer for hepatic aryl hydr ocarbon hydroxylase activity in the rat and could elicit induction of aryl hydrocarbon hydroxylase activ ity in the previously “nonresponsive” DBA/2N mice as well as in the "responsive" C57BL/6J mice (Giele n and Nebert, 1972). Intraperitoneal or topical admi nistration of TCDD to mice also led to an induction of aryl hydrocarbon hydroxylase activity and the formation of new cytochrome P1-450 in the

PAGE 20

2 liver, bowel, lung, kidney and skin as we ll as induction of 7-ethoxycoumarin Odemethylase (EROD) activity in the liver and kidney and hepatic p-nitroanisole Odemethylase and 3-methyl-4-methylaminoazobe nzene N-demethylase activity to a similar magnitude in either the "nonresponsive" or “responsive” mice (Poland and Glover, 1974). Thus, it was demonstrated that the genetica lly nonresponsive mice had the structural and regulatory genes necessary for aryl hydr ocarbon hydroxylase induction, but possessed a defect that failed to reco gnize less potent inducers. The regulatory product of the Ah locus wa s then shown to be a soluble protein that specifically bound [3H]-TCDD with high affinity with rank-ordered binding affinities for various ligands that correlated to their relative potencies to induce aryl hydrocarbon hydroxylase activity (Legraverend et al., 1982; Poland et al., 1976). Though the AHR was initially described as cytosolic, it has since been shown that the subcellular location of the endogenous complex may be cell/recep tor dependant and the AHR has been found in the cytoplasm and nucleus and may e xhibit dynamic nucleocytoplasmic shuttling (Pollenz and Dougherty, 2005; Pollenz et al., 199 4). In any case, there is no apparent difference in the ability of the AHR to serv e as a ligand-activated transcription factor from either subcellular compartment. While the AHR has been shown to be ac tivated by a variet y of polycyclic and halogenated hydrocarbons, the identity of an endogenous lig and remains controversial, though several endogenous and alternate e xogenous ligands have been suggested including: 2-(1'H-indole-3'carbonyl)-thiazole-4-carboxylic ac id methyl ester (ITE), a compound found predominantly in the prelimin ary testes and lung, equine estrogen equilenin, tryptophan products, dietary polyphenols prostaglandins, indirubin and indigo,

PAGE 21

3 biliverdin and bilirubin (Adachi et al., 2001; Gouedard et al., 2004; Henry et al., 2006; Jinno et al., 2006; Oberg et al., 2005; Phelan et al., 1998a; Se idel et al., 2001; Song et al., 2002; respectively). However, while these endogenous compounds have been shown to bind the AHR, little has been done to assess whether the AHR functionally binds these compounds in vivo The aryl hydrocarbon receptor nuclear tran slocator (ARNT) pr otein was initially proposed to function in the nuclear transloc ation of the aryl hydrocarbon receptor (AHR) protein. This assumption was based on the observation that mutant hepatoma cells deficient in AHR-mediated induction of the target ge ne, cytochrome P450 1A1 (CYP1A1), did not exhibit an increase of AHR in nuclear extracts following treatment with ligand as was seen in wild-type cells, and this lack of nuclear accumulation of AHR in response to ligand could be rescued by genomic DNA coding for ARNT (Hankinson, 1979; Hoffman et al., 1991; Legraverend et al ., 1982; Okey et al., 1980; Reyes et al., 1992; Whitlock and Galeazzi, 1984). These stud ies also established that ARNT was a basic helix-loop-helix protein, as was the AHR, and that ARNT served as a heterodimerization partner for the AHR a nd was a necessary component of the DNA binding AHR complex (Burbach et al., 1992; Ema et al., 1992; Hoffman et al., 1991; Reisz-Porszasz et al., 1994; Reyes et al ., 1992). Using immunohistoc hemical techniques, it was later determined that ARNT was cons titutively nuclear and played no role in ligand-mediated translocation of the AHR since nuclear translocation of the AHR occurred following ligand binding even in ARNT deficient cells, and that this translocation was not detected in nuclear extracts since the AHR lacked the ability to bind DNA in the absence of ARNT (Holmes and Po llenz, 1997; Pollenz et al., 1994).

PAGE 22

4 Since the initial cloning of AHR and AR NT, it has been demonstrated that the both proteins are members of the class VII he lix-loop-helix superfamily of transcriptional regulators, which are classi fied by the presence of a ba sic region prior to the HLH domain (bHLH) as well as the PER/ARNT/S IM (PAS) domain (Sablitzky 2005). These bHLH/PAS proteins can be further divided in to two main groups: one which contains the ARNT proteins: ARNT (HIF-1 ), ARNT2, BMAL1 (ARNT3, MOP3, JAP3, ARNTL1, TIC), and BMAL2 (ARNT4, ARNTL2, MOP9 ) and one which contains the hypoxiainducible factor 1 family (HIF-1 HIF-2 HIF-3 ), the hypoxia-like f actor (HLF), the single-minded proteins (SIM1, SIM2), and the AHR (Barrow et al., 2002; Drutel et al., 1996; Hirose et al., 1996; Hogenesch et al ., 1997; Hogenesch et al., 2000; Ikeda and Nomura, 1997; Ikeda et al., 2000; Maemura et al., 2000; Okano et al., 2001; Takahata et al., 1998; Wolting and McGlade, 1998) (Tab les 1.1, 1.2). These proteins generally appear to function through heterodimeriza tion of members of the first group with members of the second group, though homodi merization of ARNT has also been suggested. Together, these pr oteins are involved with th e regulation of a variety of signaling pathways ranging fr om angiogenesis, va sculogenesis, xenobiotic metabolism, and hypoxic response to developmental pathways wherein each dimer associates with specific cis acting DNA elements to regulate target gene s (Crews, 1998; Ema et al., 1996a; Ema et al., 1997; Furness et al., 2007; Ke wley et al., 2004; Whitelaw et al., 1993) (Figure 1.1). Interestingly, while many of ARNT's interactions with various dimerization partners have been established both in vitro and in vivo as have the more recently

PAGE 23

5 Table 1.1: Summary of ARNT cloning. ARNT Type, the ARNT group to which each cl one has the highest identity; Clone, the original name ascribed to th e individual cDNA during the cl oning of each gene; Species, the origin of the cDNA library or EST databa se used in the generation of probes. Tian,H., Russell,D.W. and McKnight,S.L., Unpublished Direct Submission to NCBI database 10-JUN-1996.

PAGE 24

6 Table 1.2: Amino acid identity compar isons of murine ARNT types and across ARNT isoform domains. Numbers represent the percent identities between compared proteins using the CLUSTALW (Slow/Accurate, Gonnet) met hod (MEGALIGN, DNAstar, Madison, WI) with a PAM250 residue weight table. A, Identity among murine ARNT types. Accession numbers were: mARNT (U10325), mA RNT2 (D63644), mARNT3 (AB014494), mARNT4 (AY005163). B, Identity among murine ARNT protein domains.

PAGE 25

7 Figure 1.1: Overview of known cellular pa thways requiring ARNT or ARNT2 in mammals. Protein•protein interactions betw een the ARNT proteins and their dimerization partners that have been func tionally and biochemica lly established both in vitro and in vivo are indicated by solid thick arrows, while interactions that have been established either in vitro or in vivo are indicated by solid th in lines, and presumed interactions are shown with dashed arrows. Also show n are the gene regulatory sequences to which the heterodimers/hom odimers bind: XRE: xenobiotic response element; HRE: Hypoxia response element; CME: central midline enhancer, with the bolded sequence representing the portion of th e regulatory sequence that is recognized by ARNT/2. Below these sequences are the some of the target genes of the heterodimers/homodimers that have been asse ssed and their overall physiological role.

PAGE 26

8 discovered ARNT3 and ARNT4 pr oteins’ roles in circadia n rhythm regulation with Clock, the physiological roles of ARNT2 remain less clear. 1.2 AHR and ARNT Domains These proteins are modular, and thei r common characteristics are the bHLH domains and the PAS domains that are distal to the bHLH motif. Through mutation and deletion analyses, the basic domain of these pr oteins has been shown to be critical for DNA binding whereby 2-4 basic re sidues appear to make dire ct contact with DNA (in the AHR and ARNT respectively) while other ba sic residues may make contact with the phosphodiester backbone (Bacsi and Hankinson, 1996) In the AHR, tyrosine 9 (Y9) and arginine 39 (R39) appear to be essential for AHR contact with the DNA, while other residues of the basic region maintain -helical structure and make contact with the phosphodiester backbone (Bacsi and Hankinson, 1996). Interestingly, the basic region of ARNT more closely resembles the basic re gion found in leucine zipper-HLH proteins such as TFEB, USF, c-Myc and Max than the basic region of the AHR (Sogawa et al., 1995). This basic region has been shown to be critical for binding to the E-box half site GTG, whereby during AHR signaling, four resi dues are critical for contact with DNA (H94, E98, Rl0l, and R102), which correspond in position to essential residues found in the bHLH proteins USF and MAX and are conserved across all characterized ARNT proteins (Bacsi and Hankinson, 1996; ED, unpublished observations). Though these mutational analyses focused on XRE binding ability of the AHR•ARNT complex as the endpoint and have not included other ARNT types (ARNT2/3/4), each ARNT protein appears to associate with the GTG half-site regardless of its dimerization partner, while

PAGE 27

9 the partner provides the specificity for e nhancer binding (Ebert et al., 1995; FujisawaSehara et al., 1986; Hapgood et al., 1989; Paul and Ferl, 1991; Semenza et al., 1994; Swanson et al., 1995; Wharton and Crews, 1993; Wharton et al., 1994). The HLH motif consists of two amphipathic -helices connected by a variable loop and appears to serve as a surface for protein-protein interactions and is also responsible for positioning the -helix of the basic domain within the major groove of BDNA to allow for specific interactions betw een the DNA binding protein and the target response elements (Anthony-Cahill et al., 1992). Deletion of eith er helix has been shown to abolish dimerization (Reisz-Porszasz et al., 1994). The PAS domain, named for the first th ree proteins found to exhibit this conserved sequence (PER/ARNT/SIM) is found in numerous proteins that are involved with detection of environmental cues and stress response (Gu et al., 2000). However, while this domain has a high level of iden tity between the ARNT and ARNT2 proteins, there is less than 20% identity in this re gion between the PER, ARNT, and SIM proteins themselves (Gu et al., 2000; Huang et al ., 1993). Therefore, the PAS domain is characterized by an approximately 100 am ino acid hydrophobic-rich region, which is further characterized by a highly degenerate ~50 amino acid repeat with an invariant phenylalanine, histidine, and aspartic acid at positions 1, 41, and 44 respectively within the PAS domain repeat (Huang et al., 1993; Na mbu et al., 1996). Both the AHR and all ARNT proteins appear to c ontain two PAS domains termed PAS A and PAS B. In each case, the PAS domain appears to provide sp ecificity for dimerizat ion, may also provide the specificity for the protein binding of the adjacent HLH domain, and may enable transcription following DNA binding (Chapman-Sm ith et al., 2004; Dolwick et al., 1993;

PAGE 28

10 Jain et al., 1994; Lindebro et al., 1995; Pongr atz et al., 1998; Reisz-Po rszasz et al., 1994; Whitelaw et al., 1994; Zelzer et al., 1997). In addition, it has been suggested that the PAS A domain is critical for DNA binding and protein-protein interactions and contributes directly to AHR•ARNT XRE binding (Chapm an-Smith et al., 2004; Chapman-Smith and Whitelaw, 2006; Pongratz et al., 1998). Similarly, the PAS B domain has been implicated in contributi ng to the heterodimeri zation potential and stability of ARNT and HIF-1 /HIF-2 through interactions o ccurring via the PAS B central -sheet, and mutations in this region have been suggested to affect the transcriptional ability of the overall heterodi mer (Card et al., 2005; Erbel et al., 2003). For the AHR, the PAS domain appears to have additional func tions including Hsp90-, XAP2-, and ligand-binding (Dolwick et al., 1993; Jain et al., 1994; Re isz-Porszasz et al., 1994; Whitelaw et al., 1994). It has also b een suggested that the PAS domain for the AHR contains a repressor region, since Ah receptor lacking this region exhibits constitutive activity (CAR mu tant), though it is now known that it is the presence of Hsp90 bound to the receptor by the PAS do main that prevents DNA binding from occurring (Antonsson et al., 1995; Heid et al., 2000; Whitelaw et al., 1994). The AHR and ARNT proteins also each contain a putative nuc lear localization site (NLS). While the AHR may be cyt oplasmic, nuclear, or shuttling through the cytoplasm and nucleus based on the receptor spec ies, ARNT appears to be constitutively nuclear (Pollenz and Dougherty, 2005; Pollenz et al., 1994). In the AHR, the NLS is a single basic region ( RKRRK PVQ K ) located at the NH-terminus that is capable of recognizing the importin proteins necessary for nuclear translocation following ligand binding, however, the AHRb-1 appears to exist in a conformation whereby the NLS is

PAGE 29

11 exposed only after a conformational change following ligand binding, resulting in the nuclear import of the AHR (Holmes and Pollenz, 1997). The AHR also contains a leucine-rich nucle ar export site (NES) located within the HLH helix 2 region amino acids 63-71 ( L DK L SV L R L ). Leucine to alanine scanning mutagenesis of leucines 66 and 71 of the putative AHR NES revealed that alanine substitutions at these residues resulted in a protein with re duced function in dimerization to ARNT and binding to DNA (Pollenz and Barbour, 2000). In these same studies, mutagenesis of leucine 69 did not impact f unction with regard to ARNT dimerization or DNA binding, yet resulted in a protein that wa s incapable of nuclear export suggesting that AHR defective in nuclea r export can remain functional during ligand mediated gene induction. The ARNT proteins also each contain a putative nuclear localization site (NLS) and appear to be localized to the nucleus though it has been sugge sted that partial cytoplasmic localization may be occurring in certain cell types or during developmental periods (Eguchi et al., 1997; Holmes and Pollenz, 1997; Ikeda and Nomura, 1997; Ikeda et al., 2000; Jain et al., 1998; Pollenz et al ., 1994; Sadek et al., 2000; Schoenhard et al., 2002). In the ARNT and ARNT2 proteins, this NLS is bipartite, consisting of two basic domains separated by an acidic region spacer ( R XX KRR SGX D F DDE XXXXX K FX R ) that are capable of interacting with the prot eins of the nuclear por e targeting complex for efficient nuclear localization (Eguchi et al., 1997). Deletion of this region, however, results in a cytosolic protein that remains capable of interacting with the AHR (Holmes and Pollenz, 1997; Song and Pollenz, 2003). ARNT3 and ARNT4 both contain a short basic NLS ( RKRK ), though the ARNT3 protein also appears to contain two nuclear

PAGE 30

12 export sites (NES) locat ed in the PAS domains that allow for dynamic nucleocytoplasmic shuttling of this ARNT isoform (Ikeda et al., 2000; Kwon et al., 2006; Schoenhard et al., 2002). Deletion and mutational analysis has also defined regions in the carboxy-terminus of the AHR that are important in transact ivation including an acidic domain, a prolinerich domain, and a serine-rich region as well as a glutamine rich regi on in ARNT (Jain et al., 1994; Ko et al., 1996; Ko et al., 1997; Li et al., 1994; Pollenz et al., 2005; Whitelaw et al., 1994) (Figure 1.2 ). In the AHR, loss of the prol ine and serine rich regions by truncation reduces the transactivation abil ity of the AHR as measured by a marked reduction of CYP1A1 protein following treatme nt with TCDD compared to full length AHR, while additional loss of the acidic region ab lated all apparent transactivation ability (Pollenz et al., 2005). The carboxy-terminal portion of the AR NT, ARNT2, and ARNT3 proteins also appears to contain a transactivation doma in and a glutamine-rich region has been demonstrated to have functional signifi cance in both ARNT and ARNT2, while ARNT3 appears to have an acidic re gion important to its transactiv ation potential when partnered to HIF-1 (Corton et al., 1996; Li et al., 1994; Ta kahata et al., 1998). In contrast, the carboxy-terminal portion of ARNT4 has been sh own to be dispensable for luciferase reporter transcription in the pr esence of Clock (Schoenhard et al., 2002). In the case of ARNT, reports of the functiona l role of the carboxy-terminal portion as a transactivation domain during AHR signaling ha ve shown conflicting results. Studies performed by Li et al. (1994) demonstrated th at deletion of the glutamine-rich region of the ARNT

PAGE 31

13 Figure 1.2: Domain structures of the AHR (b1 allele) and ARNT. Thin horizontal lines indicate domain regions; bold lines indi cate functional regions for the AHR. NLS, nuclear localization signal; NE S, nuclear export signal; b, ba sic region; HLH, helix-loophelix; PAS A and PAS B, PER/ARNT/SIM homology regions; PAC, PAS associated carboxy-terminal region; TAD, transac tivation domain. Nu mbers under each box represent amino acids.

PAGE 32

14 transactivation domain (TAD) by trunca tion resulted in decreased CAT activity controlled by a TCDD-responsive enhancer wh en ARNT deficient (c4) hepatoma cells were cotransfected with ARNT and reporter vect ors. In contrast, studies by Corton et al. (1996) using a Gal4 hybrid approach demons trated that loss of the ARNT TAD through truncation resulted in no change in overall a CAT activity re porter under th e control of multiple Gal4 upstream activating sequences. Thus, in contrast to the studies by Li et al., the studies by Corton et al. suggest th at the ARNT TAD has minimal impact on transactivation of the AHR•ARNT complex, and suggest that during AHR signaling, the AHR itself provides the functional TAD within the AHR•ARNT complex while the ARNT TAD is silent (Corton et al., 1996; Li et al., 1994). However, the studies by Corton et al. (1996) also suggested that the strength of the ARNT TAD may be cell specific, since th e ARNT TAD appeared to exhibit the same properties as the well-characterized VP16 TA D in COS-1 cells, but exhibited ~10 fold weaker activity in hepatoma ARNT deficient (c 4) cells. In separate studies, the AHR and ARNT TAD showed equal tran sactivation ability in Hepa -1, CHO, and COS-7 cells, while the ARNT TAD appeared to be much weaker than the AHR TAD in HepG2 cells when recombined with the glucocortico id receptor DNA binding domain and used to drive reporter activity controlled by a gluc ocorticoid receptor responsive enhancer (Whitelaw et al., 1994). Since the studies by Li et al. (1994) also employed the ARNT deficient c4 cells, cell-specifi city of the ARNT TAD cannot explain the discrepancies between these and other studies and sin ce all studies described herein employed transiently transfected cells with no imm unohistochemistry to support population wide

PAGE 33

15 transfection, more t horough studies were later conducte d in this area using stably transfected cells (Ko et al., 1996). Using re trovirally transfecte d truncated ARNT cDNA in ARNT deficient (BPrc1, LA-II) mouse hepatoma cells, these studies showed that in vivo the ARNT TAD is dispensable for TC DD-induced CYP1A1 induction and that the AHR when dimerized with ARNT supplies th e dominant TAD (Ko et al., 1996; Whitlock and Galeazzi, 1984). While reporter studies have also been performed using ARNT2-4, similar evaluations using stably transfected ce lls have not yet been performed using these ARNT proteins nor have such studies exam ined the contribution of the ARNT TAD in other ARNT requiring pathways (Cowden and Simon, 2002; Hirose et al., 1996; Takahata et al., 1998). 1.3 AHR Proteins AHR-mediated signal transduction has been evaluated thoroughly in the C57BL/6J mouse model system that carries the AHRb-1 allele. While this allele has been the most studied, it may not be the most a ppropriate choice for study as it is clearly the outlier amongst the AHR alleles as well as amongst Ah receptors from other species including the rat a nd human. The AHRb-1 is found in the C57, C58, and the MA/My strains where it exists as a ~95kDa (805 ami no acid) cytosolic receptor, which does not appear to be shuttling thr ough the nucleus endogenously (Pol and et al., 1994; Pollenz and Dougherty, 2005). The AHRb-2 found in the BALB/cBy and C3H strains exists as a ~104kDa (848 amino acid) recep tor that is primarily nu clear, though capable of nucleocytoplasmic shuttling. Additionally, the AHRb-3 is a~105kDa (883 amino acid) receptor allele found in mus caroli, mus spretus and the MOLF/Ei strains, while the

PAGE 34

16 AHRd allele found in the AKR, DBA/2, and 129 strains is a ~104kDa (848 amino acid) receptor. Collectively, these alleles differ by only 8 point mutations in the initial 805 amino acid open reading frame and by the pr esence of additional 43-78 amino acids in the carboxy-terminus of the Ahb2, Ahb3, and Ahd receptors. Of these 8 point mutations found amongst the murine AHR alleles, the AHRb-1 accounts for more than half, resulting in a receptor that binds Hsp90, XAP2, and ligand mo re avidly and is more stable than the other mouse allelic receptors (Figure 1.3, Ta ble 1.3). These discrepancies support the idea that the AHRb-1 is the outlier. The amino terminal halves of these AHR alleles are identical except for 1 amino acid change in the second PAS box (isoleucine to methionine at position 324) with the remaining mutations present in the carboxy-terminus. Interestingly, these mutations are generall y outside of the characterized functional domains with the exception of the PAS box mu tation (324) and a serine to asparagine mutation in the acidic portion of the transactivation domai n, yet these receptors have a varying degree of activity following ligand binding. Though the AHRd differs from the AHRb-2 by only three amino acids, it is nonresponsi ve to low affinity ligands, unlike the AHRb-2. This loss of function has been attributed to the alanine to valine mutation at position 375, which occurs immediately dist al to the ligand-bindi ng domain (Poland et al., 1994). Furthermore, the AHRb-1 is truncated when compared with Ah receptors found in other mammalian species, containing a point mutation that prematurely truncates the receptor at 805 amino acids, while the AHRb-2, rat, and human AHR all contain an additional 42-45 amino acids at their carboxyterminus that have 70% identity (Figure 1.3). As this additional carboxy-terminal sequen ce is present in the other AHR alleles as

PAGE 35

17 Figure 1.3: Protein sequence alignm ent of various AHR c-termini Carboxy-terminal alignment of AHR proteins from amino acid position 800 to termination in Mus musculus C57BL/6J (Ahb1 allele); Mus musculus BALB/c (Ahb2 allele); Mus musculus DBA/2J (Ahd allele); the chicken Gallus gallus ; Homo sapiens and Rattus norvegicus. Proteins were aligned by using the CLUSTALW (Slow/Accurate, Gonnet) method (MEGALIGN, DNAstar, Madison, WI) using a PAM250 residue weight table.

PAGE 36

18 Table 1.3: Amino acid changes among th e first 805 amino acids of murine AHR alleles. Full length AHR proteins were aligned fr om the murine strains: C57BL/6J (Ahb-1 allele); C3H (Ahb-2 allele); MOLF/Ei (Ahb-3 allele); and DBA/2J (Ahd allele) Proteins were aligned by using the CLUSTALW (Slow/ Accurate, Gonnet) method (MEGALIGN, DNAstar, Madison, WI) using a PAM250 residue weight table. Point mutations occurring in the first 805 amino acids betw een proteins are show n in bold. Numbers above each column represent the amino acid lo cation within the open reading frame.

PAGE 37

19 well as across species and is reasonably conserve d in sequence, it is reasonable to assume that this sequence may be functionally relevant. Several orthologs of the AHR have al so been identified in other mammalian, invertebrate, aquatic and avian species including Mesocricetus auratus, Gallus gallus, Cavia porcellus, Cricetulus griseus, the rabbit Oryctolagus cuniculus the seal Phoca siberica, the North Atlantic right whale Eubalaena glacialis the clam Mya arenaria the zebra mussel Dreissena polymorpha the sea lamprey Petromyzon marinus the common tern Sterna hirundo the common cormorant Phalacrocorax carbo the Asian malaria mosquito Anopheles stephensi Drosophila menologaster and Carnorhabditis elegans (Bennett et al., 1996; Butler et al., 2001; Emmons et al., 1999; Hahn et al., 2004; Jensen and Hahn, 2001; Karchner et al., 1999; Kim and Hahn, 2002; Korkalainen et al., 2001; Meyer et al., 2003; Powell-Coffman et al ., 1998; Roy and Wirgi n, 1997; Satoh et al., 2003; Takahashi et al., 1996; Tanguay et al., 1999; Walker et al., 2000; Yasui et al., 2004; Figure 1.4). Many more AHR prot eins have also been predicted in silico based on genomic sequencing data (www.ensembl.or g), though have not yet been evaluated in vivo Interestingly, the functi on of the AHR in response to xenobiotics appears to be well-conserved across many of these species. However, the AHR proteins from several invertebrate species appear to be deve lopmentally regulated, lacking constitutive expression and exhibiting a lack of ligand bi nding (Butler et al., 2001; Emmons et al., 1999; Powell-Coffman et al., 1998).

PAGE 38

20 0 140.3 2 0 4 0 60 80 1 00 12 0 14 0 Mus musculus C3H Mus musculus CBA/J Mus musculus BALB Mus musculus A/J Mus musculus CAST Mus musculus DBA/2J Mus musculus SJL/J Mus musculus MOLF/Ei Mus spicilegus Pancevo Mus spretus Mus Musculus C57Bl Mus caroli Rattus norvegicus Cricetulus griseus Mesocricetus auratus Eubalaena glacialis Megaptera novaeangliae Delphinapterus leucas Phoca siberica Homo sapiens Cavia porcellus Oryctolagus cuniculus Phalacrocorax carbo Sterna hirundo Gallus gallus Xenopus laevis Danio rerio 1B Petromyzon marinus Oncohynchus mykiss A Oncorhynchus mykiss B Salmo salar 2B Microgadus tomcod Danio rerio 2 Aedes aegypti Anopheles stephensi Drosophila melanogaster (SS) Dreissena polymorpha Mya arenaria Caenorhabditis elegans 1 Ciona intestinalis Figure 1.4: AHR protein dendogram. Full-length proteins were aligned by using the CLUSTALW (Slow/Accurate, Gonnet) met hod (MEGALIGN, DNAstar, Madison, WI) using a PAM250 residue weight table. Th e horizontal distance to the subclusters corresponds to degree of amino acid substitu tions among members. References are as follows: (Abnet et al., 1999; Bennett et al., 1996 ; Butler et al., 2001; Carver et al., 1994a; Emmons et al., 1999; Hahn et al., 2004; Jens en and Hahn, 2001; Karc hner et al., 1999; Kim and Hahn, 2002; Korkalainen et al., 2001; Meyer et al., 2003a; Nene et al., 2007; Powell-Coffman et al., 1998; Roy and Wirgin, 1997; Satoh et al., 2003; Takahashi et al., 1996; Tanguay et al., 1999; Walker et al., 2000; Yasui et al., 2004) Amino acid substitutions x100

PAGE 39

21 1.4 AHR-Mediated Signaling The current model of AHR-mediated signal transduction in mammals hypothesizes that the AHR in its unligande d state exists in a ~280 kDa multimeric complex consisting of two molecules of Hsp90, the immunophilin-like protein XAP2 (XAP, AIP, ARA9), and p23 (Chen and Pe rdew, 1994; Gu et al., 2000; Petrulis and Perdew, 2002; Pollenz et al., 2002; Whitlock, 1999). Once activated by ligand, the AHR translocates to the nucleus where it dissoci ates from the Hsp90 complex and forms a dimer with ARNT via its bHLH domains by an unknown regulatory step that may involve a phosphorylation even t on the AHR following nuclear import (Heid et al., 2000; Pollenz et al., 1994; Pongratz et al., 1998). The Hsp90-free AHR•ARNT complex is then capable of binding the non-canonical E-box li ke consensus xenobiotic response element (XRE, DRE, AHRE, ARE) 5'-T (T/A)GCGTG-3', associating with numerous coactivators such as members of the 160 family (SRC1, SRC-2, SRC-3), RIP140, CoCoA, and p300, and regulating the transcription of pha se I metabolizing enzymes including the monooxygenase CYP1A1, NAD(P)H:quinone ox idoreductase, alcohol dehydrogenase, and aldehyde dehydrogenase, along with pha se II conjugation enzymes including glutathione-S-transferase Ya, UDP-glucoronosyltransferase, a nd N-acetyltransferases that are important in the metabolism of drugs, steroids, and toxins (Denison et al., 1988; Hankinson, 2005; Hapgood et al., 1989). The AHR is then targeted for degradation by an unknown mechanism that termin ates at the 26-S proteasome (Pollenz, 1996; Pollenz, 2002). It must be noted, however, that this de scription is simplified and there are several unknowns throughout this pathway such as the regul ation of each step in the pathway, the

PAGE 40

22 Figure 1.5: Schematic of the AHR signaling pathway. In brief, ligands such as halogenated aromatic hydrocarbons (HAHs ), polychlorinated biphenyls (PCBs), polyaromatic hydrocarbons (PAHs) enter a cell, bind to the AHR complex leading to a conformational change of the receptor, which then translocates to the nucleus and heterodimerizes with ARNT. The AHR•ARNT complex then associates with xenobiotic response elements with the core sequence 5’-TNGCGTG to regulate phase I and phase II metabolizing enzymes, typified by CYP1A1. The AHR is then targeted for degradation via the 26S proteasome.

PAGE 41

23 involvement of specific coactivators and core gulators and the precise mechanism behind the degradation of the AHR (Figure 1.5). 1.5 AHR Associated Proteins The heat shock protein 90 family (H sp90a and Hsp90b in the human, Hsp84 and Hsp86 in the mouse) is a group of highly conserved and highly expressed chaperone proteins implicated in the maintenance of proper protein folding and prevention of protein aggregation with a variety of intracel lular receptors (Hickey et al., 1989; Moore et al., 1989). The AHR appears to have equal a ffinities for either Hsp90 type (Chen and Perdew, 1994; Czar et al., 1994), and this as sociation is essentia l for agonist-induced AHR signaling in vivo since Hsp90's association with the AHR, as well as with the glucocorticoid receptor (GR) and MyoD, has b een correlated to the receptor's ability to maintain proper conformation and to bind ligand (Carver et al., 1994b; Evans, 1989; Hutchison et al., 1994; Schmidt et al., 1996; Shue and Kohtz, 1994; Whitelaw et al., 1995). Preceding ligand binding, Hsp90 app ears to hold the AHR in a conformation capable of binding ligand while repressing the ability of the r eceptor to bind DNA. However, it has also been suggested that Hsp90 is necessary only for th e initial folding of the AHR, since in the presence of salt conditions that result in the disassociation of the existing AHR from the Hsp90 complex leads to Hsp90-free AHR that remains capable of binding ligand (Heid et al., 2000; Phelan et al., 1998b; Whitelaw et al., 1994). The affinity of Hsp90 for the AHR has been correl ated to the phosphorylation status of three serine residues within Hsp90 (S225 and S254 for Hsp90b and S230 in Hsp90a [equivalent to S225 of Hsp90b]) that occu r within the charged linker domain that

PAGE 42

24 associates with the AHR (Chen and Perdew, 1994; Ogiso et al., 2004). Interestingly, in these studies, mutation of the potential phosphor ylation sites S225 a nd S254 to alanines increased both the affinity of AHR for Hsp90 as well as the transactiv ation activity of the AHR as measured by a luciferase reporter fo llowing treatment with 3-methycholanthrene compared to glutamine substitutions at thes e residues, suggesting that phosphorylation status of Hsp90 may play a role in m odulating AHR signaling (Ogiso et al., 2004). XAP2 is a ~37kDa protein that contains three regions of homology to the tetratricopeptide (TPR) motif found in the FKBP12 and FKBP59 and FKBP52 immunophilins, which act as molecular chaperon es in steroid receptor signaling, targeting steroid receptors to the nucleus. Unlik e immunophilins, however, XAP2 does not associate with immunosuppressive drugs like FK506 (Tacrolimus, Fujimycin ) but appears to associate with the AHR through this drug-binding (F K) domain and with Hsp90 via its TPR domain (Carver et al., 1998; Ma and Whitlock, 1997). Also, XAP2 does not appear to be involved in matura tion of the AHR, but can modulate AHR activity in that overexpression of XAP2 has been suggested to increase response to aryl hydrocarbon hydroxylase inducers w ithout appearing to alter th e affinity of the AHR for TCDD (Carver et al., 1998; Ma and Whitlo ck, 1997). Reduction of XAP2 by siRNA appears to result in the transformation of th e AHR from a statically cytoplasmic receptor to one capable of undergoing dynamic nucleocytop lasmic shuttling (Pollenz et al., 2006). Furthermore, following ligand activation of the AHRb-1, XAP2 remains associated with the receptor following nuclear translocation a nd may serve to inhibit transformation of the AHR complex to the ARNT dimerized fo rm (Pollenz and Dougherty, 2005; Pollenz et al., 2005). Phosphorylation of XAP2 has not been implicated in modulation of AHR

PAGE 43

25 function; however, mutation of S53 to alanine appears to inhibit the ability of XAP2 to enter the nucleus (Dul l et al., 2002). P23 is a 23-kilodalton Hsp90 binding protein that appears to serve several roles in AHR signaling including stabi lization of the AHR-Hsp90 comp lex, assistance of nuclear translocation, and recruitment of XAP2 to the AHR complex (Kazlauskas et al., 2001). Similar to its role in glucocorticoid recep tor signaling, p23 appears to be important for proper maturation of the latent AHR complex, allowing for a stable complex capable of binding ligand, heterodimerizing with ARNT and subsequently binding DNA. These hypotheses stemmed from observations dem onstrating that loss of p23 from crude reticulocyte extracts resulted in a dimi nished DNA binding shift in electrophoretic mobility shift assays, while the presen ce of p23 appeared to enhance AHR•ARNT heterodimerization in an Hsp90-dependent manner (Shetty et al., 2003). This enhancement by p23 was also seen by others an d therefore, p23 has been suggested to be an important enhancer of AHR signaling, though ultimately not necessary for AHR function (Cox and Miller, 2003). Similar re sults were also seen with another Hsp90 binding protein cyclophilin 40 (CyP40), suggest ing that other proteins may also be involved with the formation/stability of th e latent AHR complex (Shetty et al., 2004). 1.6 Degradation of the AHR Agonist binding to the AHR results in degradation of the receptor following DNA binding, but not of the complex’s component s: ARNT, XAP2, or Hsp90 (Cioffi et al., 2002; Giannone et al., 1998; Pollenz, 2002; Roman and Peterson, 1998; Roman et al., 1998). Following TCDD binding, the AHRb-1 is rapidly depleted by >60-80% within 4-6

PAGE 44

26 hours of treatment in numerous ce ll culture models and does not return to basal levels as long as ligand is present in the media (Pollenz, 1996; Reick et al., 1994). This degradation is even more rapid with the Ahb-2, human or rat receptors, depleting by 90100% within 2 hours of treatment (Pollenz a nd Dougherty, 2005). In either case, this degradation has been demonstrated to occu r via the 26S proteasome complex since pretreatment with the proteasome inhibitors MG132 or lactacystin prior to treatment with agonist blocks degradation of the receptor, wh ile pre-treatment with inhibitors of calpain, serine, or cysteine protease s nor lysosomal proteases ca nnot (Davarinos and Pollenz, 1999; Ma and Baldwin, 2000; We ntworth et al., 2004). As such, several studies have suggest ed that the AHR is ubiquitinated, though none demonstrated definitive evidence of such events and at this time no E3 ligase has been demonstrated to be involved in the degradation of the AHR (Ciechanover, 2005; Kazlauskas, 2000; Ma and Baldwin, 2000). Fu rthermore, ligand-de pendant degradation can also be blocked by pre-trea tment with the transcription inhibitor actinomycin D (AD) or the translation inhibitor cycloheximide (C HX) without affecting nuc lear localization or DNA binding of the receptor, suggesting that bot h active transcription and translation are necessary for ligand-induced degradation of the AHR (Pollenz et al., 2005). Carboxy-terminally truncated Ah recept ors as well as those defective in DNA binding or ARNT dimerization similarly exhi bit a low level of degradation following treatment with TCDD albeit a much lower level of degradation than that seen in wild type; however, this degradati on cannot be blocked by either AD or CHX, suggesting that this loss is not representative of the typi cal degradation seen following ligand binding with the wild-type recepto r (Pollenz et al., 2005).

PAGE 45

27 It also appears, however, that the AHR is capable of being degraded by a second, distinct pathway that does not require ligand binding. This pathway is typified by treatment with geldanamycin (GA), a benzoqui none ansamycin capable of binding to the ATP-binding pocket of Hsp90 and thereby like ly altering the conf ormation of the Hsp90 associated AHR to allow for nuclear transloc ation of the receptor and its subsequent degradation without disrupti on of the AHR complex itself and, importantly, without DNA binding or subsequent gene induction (Chen et al., 199 7; Meyer et al., 2003b; Song and Pollenz, 2002). This second pathway is characterized by a rapid and robust degradation profile (>80% w ithin 1 hour) that also appears to occur via the 26S proteasome and can be blocked by MG-132 or lactacystin (Song and Pollenz, 2002). Though treatment with GA results in a rapid nu clear translocation of the AHR as does ligand-binding, further studies suggest this mode of degradation can occur in either the cytoplasm or nucleus (Song and Pollenz, 2002) Additionally, degradation of the AHR via GA cannot be blocked by treatment with either AD or CHX, suggesting that multiple mechanisms exist for the degradation of th e receptor, though both terminate at the 26S proteasome (Pollenz et al., 2005). 1.7 Consequences of AHR Degradation or Overexpression Studies have shown that a single oral dose of TCDD can lead to sustained depletion of AHR proteins in th e liver, spleen, thymus, and lung in vivo and that such a depletion correlates with re duction in TCDD-mediated re porter gene expression in mammalian culture cells following a second dose of TCDD (Pollenz et al., 1998). The importance of this loss is underscored by the variety of physiological defects seen in

PAGE 46

28 AHR-/mice (Andreola et al., 1997; FernandezSalguero et al., 1995; Gonzalez et al., 1995; McDonnell et al., 1996). It is important to note that many of the phenotypes seen in TCDD-treated mice are similar to those reported for AHR-/mice that have not been exposed to TCDD. Thus, this loss of AHR may contribute to some of the biological effects of xenobiotics. Degradation of th e AHR, therefore, which may be used as a means of attenuating the transcriptional res ponse, can have significant repercussions on future signaling ability of the AHR pool as well as biological implications. Conversely, blockage of degradation by C HX appears to result in potentiation of gene induction (superinduction), whereby gene s regulated by the AHR are induced to a higher level and for a longer period of time (Ma and Baldwin, 2000; Pollenz and Barbour, 2000). Induction of CYP1A1 protein in res ponse to TCDD has also been implicated in some subsets of the physiological defects associated with TCDD toxicity such as pericardial edema and reduced blood flow (Teraoka et al., 2003). Furthermore, constitutive activation of the AHR in the CAR mutant lacking a ligand-binding domain led to proliferation of stomach tumors and reduced life span (Ande rsson et al., 2002). Together, these data suggest a role for the gene products of AHR-dep endant signaling in mediating the toxic effects of TCDD. 1.8 Mammalian ARNT Isoforms Several isoforms of ARNT have been id entified in mammalian species and have been grouped into four ARNTs: ARNT (HIF-1B), ARNT2, ARNT3 (BMAL1, MOP3, JAP3, ARNTL1, TIC) and ARNT4 (BMAL2, ARNTL2, MOP9, CLIF) (Table 1.1). ARNT appears to be ubiquitously expresse d, while ARNT2 has been described primarily

PAGE 47

29 in the kidneys and central nervous system (Abbott and Probst, 1995; Aitola and PeltoHuikko, 2003; Hirose et al., 1996; Jain et al., 1998). A more recent study, however, has demonstrated that mRNA for both ARNT a nd ARNT2 is co-localized in many murine peripheral organs and neuronally derived ti ssue, suggesting that the distribution of ARNT2 may not be as restricted as prev iously described (Aitola and Pelto-Huikko, 2003). ARNT3 and ARNT4, on the other hand, we re initially characterized by Northern blot analysis as being expressed only in the skeletal muscle, heart, and brain, with high expression in the suprachiasmatic nucleu s (SCN) (Hogenesch et al., 1997; Ikeda and Nomura, 1997; Ikeda et al., 2000; Okano et al., 2001; Takahata et al., 1998), though other studies have reported more ubiquitous expr ession of ARNT3 including high levels detectable in the liver, kidney, lung, skeletal muscle pancreas, stomach, and testis, and a varied expression of ARNT 4 differing between splice variants (Ikeda et al., 2000; Schoenhard et al., 2002; Wolting and McGlad e, 1998). Given that the ARNT3 and ARNT4 proteins appear to be primarily invol ved with circadian rhythm signaling and are expressed in an oscillato ry manner, it is likely that expression would be seen not only in the SCN, which acts as the central pacemaker but also in the heart, kidney, liver, and other tissues that have peri pheral clocks (Kohsaka et al., 2007; Maemura et al., 2007). Additionally, since the e xpression of these proteins oscillat es, it is expected that detection of these proteins in vivo would differ based on the central clock time. Therefore, studies were carried out to examine the time course of expression of both ARNT3 and ARNT4 in the zebrafish in several tissues (Cermakian et al., 2000). These studies revealed that mRNA for both ARNT3 and ARNT4 can be dete cted in the zebrafish brain, pineal gland, eye, heart, liver, spleen, and testis depe nding on the physiological time point evaluated,

PAGE 48

30 suggesting a ubiquitous, but oscillatory e xpression pattern for these proteins in vivo that was asynchronous between ARNT3 and ARNT4. Since it has been suggested that expression of ARNT also oscillates on a ci rcadian rhythm in several tissues, similar studies to those performed on ARNT3 and AR NT4 should be considered for ARNT and ARNT2 to fully evaluate tissue distribution of these proteins in vivo (Garrett and Gasiewicz, 2006; Rich ardson et al., 1998). In contrast to mammalian systems, expr ession of ARNT2 is markedly different amongst several fishes and avian species; however, ARNT2 in Xenopus has also been characterized as being highly expressed in the brain and kidneys with low or absent levels in other tissues as has been described in mammalian systems. In contrast, the marine teleost, Fundulus heteroclitus appears to predominantly express a form of ARNT that is ARNT2-like (fhARNT2), resembling mouse ARNT2 (83%) more highly than mouse ARNT (63%), and surprisingl y, more highly than rainbow trout ARNT (rtARNTb, 54%) as well (Powell et al., 1999). These studies showed that fhARNT2 was detectable in the liver, gill, ovary, and brain and was the only de tectable form of ARNT (Powell et al., 2000; Powell et al., 1999). Similarly, studies identifying expression of ARNT proteins in the zebrafish, Danio rerio have identified an ARNT2 (zfARNT2b) that had a high level of identity when compared to fhARNT2 ( 80%) and mouse ARNT2 (82%), but had low identity with mouse ARNT (59%) and rtARNTb (52%; Tanguay et al., 2000). Expression of zfARNT2b was detected to high levels in the brain, eye, gill, skin, and skeletal muscle with low or undetectable levels in the liver, heart, and kidney (Andreasen et al., 2002; Tanguay et al., 2000). ARNT2 has also been described as being the predominant ARNT form in the common cormorant, Phalacrocorax carbo with high

PAGE 49

31 levels of mRNA detected in the liver, kidney, brain, muscle, heart, lung, spleen, testis/ovary, eye, stomach, and intestine (Lee et al., 2007). Taken together, these studies suggest a different functional role of ARNT2 in these species. It is important to note, however, that th e majority of studies examining the tissue distribution of the ARNT prot eins have focused primarily on mRNA expression patterns through Northern blot analysis or whole m ount in situ hybridization with little examination of endogenous protein expressi on and more thorough pr otein studies are missing from the current literature. Furthe rmore, numerous splice variants have been identified for each ARNT type and appear to exhibit different tissue distributions, which may also confound these characterizations (D rutel et al., 1996; Ik eda and Nomura, 1997; Korkalainen et al., 2003; Pollenz et al., 1996; Prasch et al., 2006; Tanguay et al., 2000; Wang et al., 1998; Wilson et al., 1997; Yu et al., 1999). Interestingly, while ARNT and ARNT 2 exhibit >90% and >80% amino acid identity between the bHLH and PAS domain s respectively (Figure 1.6), gene knock-out of either ARNT or ARNT2 results in embryonic/ perinatal lethality characterized by distinct phenotypes. This suggests that neit her protein can compensate fully for the loss of the other. The lack of compensation ma y be due to differenc es in tissue specific expression, discrepancies in th e level of protein expression, or biochemical differences that influence gene activation. While AR NT is known to have a more ubiquitous expression pattern than ARNT2, mRNA for th e two genes is clea rly co-expressed to some degree in many tissues, t hough the ratio of ARNT:ARNT2 proteins in these tissues is unknown (Table 1.4). Since overlapping tis sue specific expression of ARNT and

PAGE 50

32 Figure 1.6: Homology between ARNT and ARNT2 domains. Thin lines indicate domain regions. NLS, nuclear localization signal; b, basic region; HLH, helix-loop-helix; PAS A and PAS B, PER/ARNT/SIM homol ogy regions; TAD, transactivation domain. Numbers under each box represent amino acids. Thick lines represent regions of homology with the numbers repr esenting the percent identity.

PAGE 51

33 Table 1.4: mRNA expression for mARNT and mARNT2 in murine peripheral organs and central nervous system at postnatal day 1.5. ( Adapted from: Aitola and Pelto-Huikko, 2003). + indicates the level of mRNA expression; +, low but positive signal; ++, weak positive signal, +++, strong positive signal.

PAGE 52

34 ARNT2 does appear to exist, but neither ARNT can compensate fully for loss of the other, this suggests that the tw o proteins have distinct functi ons in the presence of various dimerization partners. Furthermore, the co -expression of ARNT and ARNT2 and the potential impact each may have on the other in terms of sign al transduction has not been fully explored to date. 1.9 ARNT Isoforms from Other Species Several orthologs of the ARNT proteins have also been identified in other mammalian, invertebrate, aquatic and avian species including Drosophila melanogaster Caenorhabditis elegans Xenopus laevis the yellow fever mosquito Aedes aegypti the common cormorant Phalacrocorax carbo the chicken Gallus gallus the domestic cow Bos taurus the rabbit Oryctolagus cuniculus the crustacean Daphnia magna the killifish Fundulus heteroclitus the zebrafish Danio rerio and the rainbow trout Oncorhynchus mykiss (Lee et al., 2007; Nene et al., 2007; Pollenz et al., 199 6; Powell-Coffman et al., 1998; Powell et al., 1999; Prasch et al., 2006; Rowatt et al., 2003; Smith et al., 2001; Sonnenfeld et al., 1997; Takahashi et al., 1996; Tanguay et al., 2000; Tokishita et al., 2006; Walker et al., 2000). Many more ARNT proteins have also been predicted in silico based on genomic sequencing data (www.en sembl.org), though have not yet been evaluated in vivo Phylogenetically, the ARNT protei ns appear to be divided into two major clades: one containing the BMAL t ype ARNT3 and ARNT4 proteins and one containing the ARNT an d ARNT2 type proteins (Figure 1.7). Consistent with the evolutionary timeline, the mammalian, avia n, and amphibian ARNT proteins grouped

PAGE 53

35 Figure 1.7: ARNT pr otein dendogram. Full-length proteins were aligned by using the CLUSTALW (Slow/Accurate, Gonnet) met hod (MEGALIGN, DNAstar, Madison, WI) using a PAM250 residue weight table. Th e horizontal distance to the subclusters corresponds to degree of amino acid substitutions among members. Cavia porcellus ARNT (AB263100) and Mesocricetus auratus ARNT (AB263099) sequences were unpublished direct submissions to the NCBI database by Kawanishi,M., Sakamoto,M., Shimohara,C. and Yagi,T. 19-JUN-2006. Mammalian, avian, and amphibian ARNT proteins grouped together, as did the ARNT2, ARNT3, a nd ARNT4 proteins. ARNT proteins from piscine and invertebrate sp ecies also primarily grouped together as ancestors to the ARNT/ARNT2 split. Exceptions ( Daphnia magna ARNT2 and Antheraea pernyi ARNT) are denoted by an asterisk. Amino acid substitutions x100

PAGE 54

36 together, while the ARNT proteins from pisc ine and invertebrate species also primarily grouped together as ancestors to the ARNT/A RNT2 event. The ARNT2 proteins also grouped together as did the BMAL type ARNT3 and ARNT4 proteins with few exceptions. 1.10 ARNT-Dependent Signaling The ARNT protein was initially proposed to function in the nuc lear translocation of the AHR protein (Hoffman et al., 1991; Reye s et al., 1992). It was later determined that ARNT was constitutively nuclear, pl aying no role in the ligand mediated translocation of the AHR (Holmes and Polle nz, 1997; Pollenz et al., 1994). ARNT is now known to act as a dimerization partner essential in severa l distinct signal transduction pathways each of which are mediated by ARNT's dimerization with a variety of bHLH-PAS proteins such as the aryl hydrocarbon nuclear receptor (AHR), the hypoxia-inducible factor 1 family (HIF-1 HIF-2 HIF-3 ), the hypoxia-like factor (HLF), the single minded proteins (SIM1 and SIM2), or ARNT itself; however, each dimer associates with specific cis acting DNA elements to regulate genes (Figure 1.1). Thus, ARNT is considered a master re gulator required for response to hypoxia, angiogenesis, xenobiotics, and in various developmental pathways. 1.10.1 AHR Signaling In response to xenobiotics typified by 2,3,7,8 tetrachlorodibenzo-p-dioxin, ARNT dimerizes with the liganded AHR and binds the asymmetric xenobiotic response element (XRE: 5'T T/A GCGTG) enhancer sequences to regulate a battery of phase I and II

PAGE 55

37 metabolizing enzymes that include CYP1 A1, glutathione-S-tra nsferase Ya, and NAD(P)H:quinone oxidoreductase as prev iously described (Hapgood et al., 1989; Hoffman et al., 1991; Ma, 2001; Ramadoss et al., 2005; Safe, 2001). Interestingly, analysis of the role of ARNT2 in AHR-mediated signaling is less clear and studies examining the ability of ARNT2 to function during AHR signaling have been sparse and conflicting. The initial ev aluation of the mouse ARNT2 clone included XRE driven luciferase reporter studies, in which it was dete rmined that ARNT2 appeared to be able to compensate for loss of ARNT in AHR signaling (Hirose et al., 1996). However, recently Sekine et al. (2006) have hypothesized that ARNT2 does not dimerize with the AHR because it contains a proline and not a histidine residue at amino acid 352 within the PAS B domain. This hypothesi s is based on the observation that all characterized mammalian ARNT2 proteins contain a proline residue in the PAS B domain while the homologous position in ARNT proteins contains a histidine residue. Therefore, studies were initiated in which the histidine at amino acid 378 in the PAS B region of ARNT was mutated to a proline causing the ARNT to have greatly reduced ability to function in AHR-mediated signaling that was similar to that observed with wild type ARNT2. Interestingly, while the histidine to proline mu tation in the Sekine et al. study affected the transcripti onal ability of ARNT•AHR hete rodimers, the transcriptional ability of ARNT•HIF-1 heterodimers remained unaffected, although the ARNT interactions of either AHR or HIF-1 appear to be mediated by the same domains. However, the studies did not directly evalua te the role of the P352 in ARNT2 function by converting it a histidine and producing a prot ein capable of functioning in AHR-mediated signaling. Thus, the mechanism that underl ies the lack of ARNT2 function in AHR-

PAGE 56

38 mediated signaling in vivo is currently undefined. Further studies assessing the potential roles of ARNT2 in AHR signaling should be considered. The BMAL type ARNT proteins do not appear to be involved with AHR signaling. Although, ARNT3 was initially demons trated to coimmunoprecipitate with the AHR using in vitro expressed and activated proteins, it was also determined that ARNT3 did not appear to associate w ith the AHR in a yeast two-hyb rid system and also did not appear to be able to substitute for ARNT in ARNT-deficient c4 hepatoma cells to regulate an XRE controlled re porter (Hogenesch et al., 1997 ; Takahata et al., 1998). 1.10.2 Hypoxic Signaling Under hypoxic conditions, ARNT binds w ith the bHLH/PAS protein hypoxiainducible factor (HIF) -1 -2 -3 which are constitutively degraded under nonhypoxic conditions, to mediate gene regul ation through binding to hypoxia response elements (HRE: 5'T/GACGTG) in specific genes involved with vascularization and glucose transport such as erythropoetin (EPO ), vascular endothelial growth factor (VEGF), and glucose-trans porter-1 (GLUT-1) (Maxwell et al., 1997; Poellinger and Johnson, 2004; Semenza, 2007; Semenza et al., 1997; Wood et al., 1996). However, since the angiogenic deficits seen in HIF-/animals are more severe than those seen in ARNT-/animals, it is likely that other protein(s) can partially substitute for loss of ARNT during hypoxic signaling (Iyer et al., 1998; Ryan et al., 1998). Thus, the suggestion that ARNT2 may be th is protein is provided by evidence that HRE controlled genes such as VEGF are still able to be regulated during development in areas where ARNT2 mRNA is known to be present, such as the neural tube (Maltepe et

PAGE 57

39 al., 1997). Furthermore, ARNT2 has been shown to be able to substitute for ARNT in regulation of a HRE controlled reporter in ARNT-deficient cells (Sekine et al., 2006). ARNT3 was originally demonstrated to associate with HIF-1 and HLF by yeasttwo hybrid screens and gel shift assays a nd could substitute for ARNT in ARNTdeficient c4 hepatoma cells to regulate an HRE controlled report er (Hogenesch et al., 1997; Takahata et al., 1998). However, it wa s later shown that ARNT3 did not appear to be participating in hypoxic response since ARNT3 could not complement hypoxiamediated signaling in ARNT-/ES cells and ARNT3-/embryos lacked angiogenic defects similar to those seen in ARNT-/, ARNT2-/or HIF1-/animals, though the ubiquitous expression pattern of ARNT would likely lim it potential angiogenic defects resulting through loss of ARNT3 since ARNT would be present to complement hypoxic signaling (Cowden and Simon, 2002; Kozak et al., 1997; Maltepe et al., 2000; Maltepe et al., 1997; Ryan et al., 1998). Similarly, ARNT4 has been shown to be competent to participate in hypoxic signaling in Hep3B cells by regula ting an HRE controlle d reporter (Hogenesch et al., 2000). Further biochemical studies us ing endogenously expresse d proteins should be carried out to continue to assess the poten tial interactions of ARNT2-4 with the HIF family of proteins. 1.10.3 SIM1/SIM2 Interactions The single-minded protein, first identified in Drosophila is another bHLH/PAS transcription factor that controls the devel opment of the neurons and glia in the central nervous system by regulating target genes that repress neuroectodermal genes and activate CNS midline genes (N ambu et al., 1991; Sonnenfeld et al., 1997; Thomas et al.,

PAGE 58

40 1988). The mammalian orthologs Sim1 and Sim2 are also expressed in the developing CNS and appear to similarl y regulate mammalian CNS deve lopment by regulating genes controlled by central midline enhancing elements (CME: G/ATACGTGA; Michaud and Fan, 1997; Nambu et al., 1991; Sonnenfeld et al., 1997; Swanson et al., 1995; Wharton and Crews, 1993). Since all ARNT proteins appear to be expresse d in the brain along with the Sim proteins (Sim1, Sim2), all AR NT proteins would appear to have the potential to interact with Sim i n vivo Interestingly, ARNT, ARNT2, and ARNT3 have all been shown to interact with Sim1 by co-immunoprecipitation, while the potential interactions of ARNT4 with Sim remain unexplored (Michaud et al., 2000). In Drosophila mutations in ARNT (tango) result in defects in CNS midline and tracheal development (Sonnenfeld et al., 1997). In the mouse, the interactions of ARNT with SIM1 are suggested by neural tube defects seen in ARNT knockout animals and have been supported with biochemical an alyses including co-i mmunoprecipitation, yeast two-hybrid, and electrophoretic mobility shift assays using CME oligos (Ema et al., 1996; Kozak et al., 1997; Probst et al., 1997). Furthermore, expression of Sim1 appears to inhibit TCDD-dependent reporter activity in Hepa-1 cells as well as the DNA binding activity of the AHR•ARNT complex in vitro suggesting that Sim1 is able to sequester ARNT away from the AHR (Probst et al., 1997 ). ARNT•Sim2 interactions have also been shown via co-immunoprecipitation and CME reporter assays, though these dimers lack transcriptional ability, and Sim2 a ppears to function as a dominant negative regulator (Moffett and Pelletie r, 2000; Moffett et al., 1997). Along these lines, the interactions of AR NT2 with SIM are implied by the similar phenotype of SIM-/and ARNT2-/animals in the failure to develop specific

PAGE 59

41 neuroendocrine lineages in the paraventricula r (PVN) and supraoptic nuclei (SON) of the hypothalamus (Hosoya et al., 2001 ; Michaud et al., 2000; Wines et al., 1998). In support of this, ARNT2 and Sim1 expression appears to be co-localized in the PVN/SON, while ARNT levels are low or absent (Michaud et al., 2000). Furthermore, these studies also demonstrated that both Sim1 and ARNT2 appear to function in maintaining the expression of Brn2 in the PVN/SON, which in turn, controls the differentiation of cells expressing vasopressin, oxytoci n, and corticotropin-releasin g hormones. Thus, since ARNT2 and Sim1 are co-localized spatially and temporally, exhibit similar phenotypes, and appear to control the same developmental pr ocesses, it is likely th at they are partners in vivo while interactions of other ARNT protei ns with Sim1 in ot her tissues or with Sim2 remain unexplored possibilities. 1.10.4 Circadian Signaling The BMAL type ARNT proteins, ARNT3 and ARNT4, are currently believed to be primarily involved in the maintenance of circadian rhythms sin ce targeted disruption of ARNT3 in the mouse results in the abo lishment of circadian rhythm maintenance under constant darkness (Bunger et al., 2000) During Clock/ARNT3/4 signaling, Clock and ARNT3/4 when temporally co-expressed fo rm a heterodimer that associates with Ebox response elements (5’CACGTG) to regula te target genes involved with circadian signaling such as the period (Per) family of genes, the cryptochrome (Cry) genes, and vasopressin, leading to gradual accumulation of the Per protein in the cytoplasm. In turn, Per, along with timeless (Tim) interact with Cry to inhibi t transcription by the Clock/ARNT3/4 complex as a negative fee dback loop. The interactions of both ARNT3

PAGE 60

42 and ARNT4 with Clock have been well estab lished biochemically and several excellent reviews detail these studies and the Clock path way (Gekakis et al., 1998; Gu et al., 2000; Maemura et al., 2007; Sangoram et al., 1998). As a result of these analyses, ARNT3 and ARNT4 are not believed to be involved with the same a rray of signaling pathways as ARNT and ARNT2. 1.10.5 AINT Interactions While interactions with ARNT proteins with Sim and HIF proteins are critical for proper development of the CNS and vasculature, other proteins have been suggested to interact with ARNT proteins during specific developmental time points. One of these proteins, the ARNT interacting protein (AINT, TACC3) is a coiled-coil/PAS protein that has been shown to interact with both ARNT and ARNT2 in yeast and in vitro (Sadek et al., 2000). These studies showed that overe xpression of AINT appears to lead to nonnuclearization of ARNT and an apparent augmentation of response to hypoxia as measured by HRE controlled luciferase reporters in Hepa-1 cells tr ansfected with naked vector or AINT. More recently, it was demonstrated that expression of AINT in vivo coincided with high levels of HIF-1 in the neuroepithelium of the neural tube and was highly expressed in several areas of rapid ce llular proliferation in the developing mouse as well as in the ovaries and testes of the adult, suggesting that AINT may be expressed as a means to augment cellular prolif eration possibly through increasing the speed/strength of hypoxic signaling (Aitola et al., 2003). Non-nuclearization of ARNT could also serve to inhibit constitutive AR NT homodimer regulation of genes, which

PAGE 61

43 have also been implicated in the regulati on of cellular differentiation and proliferation, and such studies have yet to be explored. Another protein suggested to interact with ARNT during specific developmental time points is the hypoxia-like factor (HLF) (Ema et al., 1997). In contrast to the hypoxia inducible factors, this nove l member of the HIF family appears to be expressed under normoxic conditions to high levels in the lung, heart, and liver and appears to regulate expression of VEGF in an ARNT dependent manner via the previously described HRE. 1.10.6 ARNT Homodimer Interactions ARNT has also been implicated in serv ing as a transcripti onal regulator in a homodimeric form, based on early studies in which it was demonstrated that during size exclusion high performance lipid chromatograp hy of Sf9 whole cell lysates, ARNT was eluted as a single peak with a molecular mass of 205 kDa (Sogawa et al., 1995). These studies also demonstrated that ARNT could form homodimers via the HLH/PAS domains, had affinity for the core sequence of the adenovirus major late promoter (MLP) containing the canonical E-box (5’CACGTG) se quence, and could drive expression of Ebox controlled reporters when produced in vitro similar to the activities of other E-box binding proteins MyoD, Max, and USF. Furthe r studies showed similar results, again suggesting that ARNT homodimers could a ssociate with the E-box sequence and could competitively displace the c-Myc/Max heterodimer from binding to the E-box, though the ability of ARNT to homodimerize may be dependent upon ARNT phosphorylation status (Antonsson et al., 1995; Huffman et al., 2001; Levine and Perdew, 2001; Levine and Perdew, 2002; Swanson et al., 1995; Swans on and Yang, 1999). However, physiological

PAGE 62

44 target genes for ARNT homodimers re mained undescribed until recently when microarrays examining differential gene regu lation between wild-typ e Hepa-1 cells and their ARNT-deficient variants revealed 27 genes whose expression was upregulated by 1.5-fold in the wild-type Hepa -1 cells, 15 of which had confirmed E-box sequences in the 5’ promoter region, including BCL2/ad enovirus E1B 19 kDa interacting protein 1 (NIP3), Serine (or cysteine) protease inhi bitor clade E number 1 (PAI1), and N-Myc downstream regulated-like (NDR1) (Wa ng et al., 2006). Additionally, ARNT homodimers have been implicated in th e partial regulation of CYP2A5 through chromatin immunoprecipitation, electrophoretic m obility shift assays, a liver-specific ARNT knockout mouse showing reduced CYP2A5 levels, and mutational analyses in the E-box region of the CYP2A5 promoter, though AHR•ARNT dimers have also been suggested to participate in the regulati on of CYP2A5 expression as well as PAI1 (Arpiainen et al., 2007; Arpi ainen et al., 2005; Son and Rozman, 2002). In contrast, multiple yeast two-hybrid experiments have i ndicated only weak or absent interactions for ARNT homodimers and other studies have failed to detect ARNT homodimerization (Hirose et al., 1996; Reisz-Porszasz et al., 1994 ). Similarly, the inte ractions of ARNT2-4 as homodimers have been examined through yeast two-hybrid systems and have showed only weak interactions at best (Hirose et al., 1996; Takahata et al., 1998). Thus, the potential role of ARNT as a homodimeric tran scriptional regulator remains controversial and though such studies prove difficult, attemp ts must be made to further explore the possibility under physio logical conditions.

PAGE 63

45 1.11 ARNT Interactions with Transcriptional Repressors Along with ARNT’s interactions with several transcription factors and coactivators, ARNT proteins also appear to asso ciate with transcriptional repressors such as the aryl hydrocarbon receptor repressor, NP AS, and necdin to prevent further PAS protein signaling. Such inte ractions have not been welldefined and may be important feedback or negative regu lators of several of th e aforementioned pathways. 1.11.1 Aryl Hydrocarbon Receptor Repressor Interactions ARNT has also been implicated in binding to the aryl hydrocarbon receptor repressor (AHRR), which is upregulated by liganded-AHR•ARNT dimers and subsequently appears to be involved with negatively influencing AHR signaling by associating with ARNT a nd binding XREs, thereby preventing association of AHR•ARNT dimers (Baba et al., 2001; Kikuc hi et al., 2003; Mimu ra et al., 1997). Interestingly, this repression does not appear to require DNA binding by the AHRR•ARNT complex and cannot be resc ued by additional ARNT expression, suggesting that AHRR repression of AHR si gnaling does not occur through sequestration of ARNT, but through alternative protein-prot ein interactions (Eva ns et al., 2008). Recently, it has been suggested that AHRR pl ays a role as a tumor suppressor since silencing of AHRR in several human malignant tissues led to increased cell growth, while exogenous expression of AHRR led to diminish ed growth, diminished angiogenesis, and appeared to confer resistance to apopto tic signals (Zudaire et al., 2008). AHRR null mice, however, exhibited a seemingly contra dictory delayed respons e to carcinogenesis in the skin following exposure to benzo[ a]pyrene along with increased CYP1A1 mRNA

PAGE 64

46 induction in the skin, stomach, and spleen co mpared to wild-type AHRR mice (Hosoya et al., 2008). Thus, the role of th e interaction of AHRR with AR NT remains controversial. Future studies should continue to address the potential physiologica l role of the AHRR and should address whether AHRR can inte ract with other ARNT proteins. The ARNT proteins have also been impli cated in binding to several repressors 1.11.2 NPAS Interactions ARNT and ARNT2 have been implicated in binding to the neuronal PAS domain protein 1 (NPAS), a bHLH-PAS transcriptiona l repressor expressed in the mouse brain following organogenesis that is thought to be involved with nervous system development and morphogenesis in the murine lung by regul ating genes such as erythropoeitin and tyrosine hydroxylase that are involved in hypoxic response (Levesque et al., 2007; Ohsawa et al., 2005; Teh et al., 2006). In these studies, NPAS was shown to be cytoplasmic, entering the nucleus via the NLS of ARNT following heterodimerization, resulting in binding to enhancer regions and subsequent transrepression of gene targets (Teh et al., 2006). In contrast, NPAS2 expre ssed in the mammalian forebrain appears to be CLOCK-like and can interact with AR NT3 to drive expression of PER and CRY, showing no transrepression (Franken et al., 2006 ; Reick et al., 2001; Rutter et al., 2001). 1.11.3 Necdin Interactions Necdin is a member of the melanoma antigen (MAGE) protein family that is thought to be a growth suppressor expre ssed predominantly in postmitotic neurons (Kuwako et al., 2004; Maruyama et al., 1991). Re cently, a study has imp licated necdin as

PAGE 65

47 a transcriptional repressor involved with modulation of ARNT2•SIM1 and ARNT2•HIF1 complexes (Friedman and Fan, 2007). In th is study, necdin could be co-precipitated with ARNT2 or HIF-1 and appeared to interact with the bHLH of ARNT2 or HIF-1 via a 115 residue region in its amino-terminus, resulting in a dramatic repression of reporter activity controlled by CMEs. Interest ingly, interaction of n ecdin with ARNT or ARNT3 was not seen in cell culture, sugges ting that necdin may specifically act to repress the transactivation of ARNT2 containing complexes. Since studies examining the impact of necdin on other bHLH-PAS protei ns are relatively non-ex istent, this avenue should be continued as well as the potential re pression of target genes by necdin in other ARNT2 requiring pathways. 1.12 AHR and ARNT Levels The levels of both AHR and ARNT are ex tremely important to the AHR-signaling pathway as it has been characterized. Calc ulations of the con centration of AHR and ARNT protein in continuous cell culture li nes from a variety of species and tissues revealed that the levels of ARNT remained relatively consistent be tween lines, ranging from approximately 13,979 molecules of ARNT /cell in MDCK canine kidney cells (94 fmol/mg lysate) up to 33,445 molecules of AR NT/cell in Hepa-1 mouse hepatoma cells (231 fmol/mg lysate; Holmes and Pollenz, 1997). In contrast, AHR levels in those lines showed a much greater range of expressi on, varying from 4,763 molecules AHR/cell in the H4IIE rat hepatoma cells (69.4 fmol/mg lysate) up to 323,004 mo lecules of AHR/cell (2231 fmol/mg lysate; Holmes and Pollenz, 1997).

PAGE 66

48 Recent studies have examined the cr itical importance of these levels by modulating the expression of these prot eins by siRNA (RSP, unpublished). While a moderate reduction of ARNT levels by siR NA in Hepa-1 cells has little effect on CYP1A1 induction following TCDD treatment a similar reduction of AHR levels by siRNA leads to a marked reduction of CYP1A1 levels following TCDD treatment. Similarly, overexpression of AHR in Hepa-1 cells can lead to an increased response in CYP1A1 induction at the mRNA and pr otein level following TCDD treatment, suggesting that the levels of AHR may be more limiting than the levels of ARNT, even though there appears to be ~10x more AHR than ARNT in these lines. 1.13 ARNT Crosstalk Since the ARNT proteins appear to be capable of dimerizing with a variety of partners in vivo and appear to be expressed at relatively low levels, it is possible that signaling in one pathway requi ring ARNT would potentially disrupt/inhibit simultaneous signaling of other ARNT requiring pathways (Holmes and Pollenz, 1997). Several studies have addressed these questions, but ha ve reported conflicting results (Chan et al., 1999; Chilov et al., 2001; Gradin et al., 1996; Lee et al., 2006; Pollenz et al., 1999; Qu et al., 2007; Safe and Wormke, 2003; Woods and Whitelaw, 2002). Early studies on hypoxia/AHR crosstal k demonstrated that AHR signaling appeared to be reduced following hypoxi c signaling induction by cobalt chlorine (CoCl2), a known inducer of hypoxia-inducible factor 1 (Gradin et al., 1996). In these studies, HepG2 cells transfected with an XR E controlled luciferase reporter showed reduced luciferase activity when treated with both CoCl2 and TCDF, a known AHR

PAGE 67

49 ligand, in comparison to those treated w ith TCDF alone (Gradin et al., 1996). Electrophoretic mobility shift assays (EMSA) of nuclear extracts from TCDF treated HepG2 cells also showed XRE binding that wa s reduced when the cells were pretreated for increasing time periods with CoCl2 prio r to TCDF treatment, suggesting decreased recruitment of AHR•ARNT heterodimers to XRE enhancers under hypoxic conditions and similar results were seen in EMSAs co mbining various amounts of in vitro produced AHR, ARNT, and HIF-1a in the presence of -naphthoflavone (Chan et al., 1999). Additionally, coimmunopr ecipitation studies using in vi tro translated AHR, ARNT, or HIF-1a demonstrated that coprecipitation of the AHR with ARNT antiserum following TCDD treatment was reduced in a concen tration dependent manner when HIF-1 was added to the activation (Gradin et al., 1996). However, in neither of these studies was ARNT used to rescue AHR signaling during hypoxia. In contrast, studies by Pollenz et al demonstrated that the physiological functional interferen ce between hypoxia and AHR signali ng does not appear to occur through competition for ARNT (Pollenz et al ., 1999). In these st udies, hypoxia did not affect the concentration or localization of ARNT, and th e ARNT protein sequestered during hypoxia was returned to the ce llular ARNT pool following hypoxia-driven signaling. Furthermore, under conditions of physiological hypoxia (1% O2), only a small fraction of the total cellular ARNT pool (1215% in Hepa-1 and H4IIE cells respectively) was sequestered, suggesting th at the remaining ARNT would remain free for other ARNT requiring pathways assuming that th e entire protein pool is accessible for dimerization. Additionally, the formation of AHR•ARNT heterodimers as measured by electrophoretic mobility sh ift assays of nuclear extracts from four distinct TCDD treated

PAGE 68

50 cell lines (Hepa-1, HepG2, MCF, or H4IIE) remained unchanged in comparison to normoxic conditions. Furthermore, these stud ies indicated that while the level of TCDD inducible CYP1A1 protein was decreas ed under hypoxic conditions, the level of CYP1A1 mRNA remained similar regardless of hypoxia, suggesting that reductions in CYP1A1 protein levels were distal to the induction of CY P1A1. Since cellular protein synthesis is generally reduced in hypoxic cells, it is likely that reductions in CYP1A1 protein occurred as a non-speci fic cellular response to hypoxia rather than a mechanistic response resulting from loss of available ARNT. More recent studies on AHR/HIF crosstal k suggest that AHR/HIF crosstalk is limited to genes with enhancer regions contai ning specific regulatory motifs (Lee et al., 2006). Using global gene expression pattern s derived from high-density oligonucleotide arrays of Hep3B cells treated with Me2SO, CoCl2, TCDD, or TCDD and CoCl2, Lee et al. identified only 33 target genes affect ed by co-treatment with TCDD and CoCl2 whose expression appeared to be modulated by cro sstalk. However, of these 33 genes, 35% were actually upregulated by co-treatment with TCDD and CoCl2, while 38% were downregulated by co-treatment with TCDD and CoCl2, and 33% were differentially regulated through co-treat ment with TCDD and CoCl2 in comparison with either TCDD or CoCl2 alone. Upon evaluating these target gene promoters, the authors found no correlation between the types or number of HRE or XRE response elements in the putative regulatory regions of these genes and the apparent crosstalk that was observed and, instead, determined that the incidence of serum response factor regulatory elements (SRE) was more predictive of crosstalk than the number of HRE or XRE sites. Given that the majority of genes evaluated appeared to be una ffected by co-treatment with

PAGE 69

51 TCDD and CoCl2 compared with either treatment alone it is unlikely that treatment with either TCDD or CoCl2 resulted in loss of ARNT to the other signaling pathway since such a loss would likely have a more global e ffect on gene regulati on by AHR or HIF. Furthermore, the co-treatment with TCDD and CoCl2 resulted in an additive effect in 35% of the 33 affected genes. Taken together along with the data presented by Pollenz et al., these data suggest that in a physiologi cal setting, AHR/HIF cr osstalk is limited in scope and does not appear to occur thr ough competition for ARNT (Lee et al., 2006; Pollenz et al., 1999). In addition to direct competition for ARNT, crosstalk of ARNT-requiring pathways may also be occurring indirectly through regulation of bHLH/PAS proteins by another bHLH/PAS pathway. For example, hypoxia has been implicated in the modulation of expression of PER and CLOCK in the mouse brain leading to increased expression of both PER1 and CLOCK and, similarly, Sim has been shown to attenuate regulation of EPO during hypoxia (Chilov et al., 2001; Woods and Whitelaw, 2002). 1.14 AHR and ARNT Defective Hepatoma Cell Lines Six benzo[a]pyrene mutant clones (c1-c6) all exhibiting decreased or undetectable levels of aryl hydrocarbon hydroxylase induc ibility, sparing them from the toxic metabolites of reactive benzo[a]pyrene intermedia tes, were isolated from the Hepa1-c1c7 mouse hepatoma parental line and charac terized (Hankinson et al., 1979; Hankinson, 1979; Legraverend et al., 1982). Through so matic cell hybridization, five of these mutations were found to be recessive and belong to three complementation groups (c1 and c5, c2 and c6, and c4), while another was found to be dominant (c3). The c2 and c6

PAGE 70

52 clones were shown to be AHR-deficient (<10% wt) and the c4 clone was later determined to be ARNT-deficient (Hankinson, 1979; Hoff man et al., 1991; Legraverend et al., 1982; Pollenz et al., 1994). At the same time, a nother laboratory group utilized the mouse Hepa1-c1c7 cell line to select populations defective in aryl hydrocarbon hydroxylase activity (Whitlock and Galeazzi, 1984). Sim ilarly, their LA-I variant was shown to be AHR-deficient, while the LA-II variant was late r shown to be ARNT-deficient (Pollenz et al., 1994; Reyes et al., 1992). Since re-i ntroduction of AHR c DNA is known to restore TCDD mediated CYP1A1 induction in the c2 a nd LA-I variants, these variants will be used to explore the function of other AHR s (Legraverend et al., 1982). Similarly, reintroduction of ARNT cDNA to the c4 or LA-II variants has been shown to restore some level of function in terms of AHRand hypoxiamediated signa ling (Maxwell et al., 1997; Pollenz et al., 1994). It is therefore expected that the re-introduction of various ARNT constructs, and possibly, ARNT2 shoul d complement AHR and hypoxia signaling and would thereby provide a common ge netic background to evaluate ARNT and ARNT2 function. 1.15 Knockout Animals An important tool for examining protein f unction is targeted disruption of genes through homologous recombination using target ing vectors. With the use of this technique, null mice have been gene rated for the AHR, ARNT, and ARNT2 independently. Two separate laboratories have generated AHR null mice (Gonzalez et al., 1995; Schmidt et al., 1996). The resulting AHR-/mice were demonstrated to be viable, though they exhibited a multitude of physiological changes and developmental

PAGE 71

53 abnormalities including: reduced liver weight w ith pronounced fibrosis in the portal tract, glycogen depletion, eosinophilia, reproductive defects, and a retarded growth rate (Fernandez-Salguero et al., 1995; Schmidt et al., 1996). A 40-50% ne onatal lethality and depressed immune systems were also seen in mice generated by the Fernandez-Salguero group, but neither was seen in those of Schmid t et al., (1996). As bot h studies were done in C57BL/6J mice, differences between th e two are not attributable to genetic background; rather, these differences are more li kely to be attributable to partial allelic inactivation, which was addressed by the Schi mdt et al. (1996) group, but not in the study by Fernandez-Salguero et al. (1995). In either case, mice lacking the AHR protein were unable to induce wild-type levels of CYP1 A1 in response to TCDD administration. Additionally, the Fernandez-Salguero AHR-/mice exhibited a significant decrease in CYP1A2 and GT*06, which are constitutively expressed in the wild-type mouse, indicating that the AHR is responsible for cont rolling the basa l levels of these enzymes as well as for controlling induc tion of other drug metabolizing enzymes in response to ligand (Fernandez-Salguero et al., 1995). In terestingly, the disruption of the Ah locus also led to protection from the harmful eff ects of TCDD, benzo[a]pyrene, polychlorinated biphenyls, and polybrominated biphenyls including protecti on against thymic atrophy, lesions, and disruption of thyr oid hormone homeostasis (Ferna ndez-Salguero et al., 1996; Nishimura et al., 2005). Null mice have also been generated fo r the ARNT, ARNT2, and ARNT3 proteins independently. Interestingly, while the ARNT and ARNT2 proteins possess a high degree of homology in the f unctional domain regions, the phenotypes of either null animal differ significantly. For ARNT, two separate laboratories have generated null

PAGE 72

54 mice (Kozak et al., 1997; Maltepe et al., 1997 ). In both groups, the knockout of ARNT proved to be fatal, with animals dying in utero between embryonic day (ED) 9.5 and 10.5. As such, the ARNT null animals were ex amined prior to 10.5 days of gestation in an attempt to reveal the underlying caus e of death. In the Maltepe line, ARNT-/animals exhibited defective angiogenesis of the yolk sac and branchial arches, stunted development and embryo wasting and were generally distinguishable from their heterozygous ARNT littermates by ED 8.5-10.5. Th e cause of lethality in these animals was attributed to the formation of hypoxic/ nutrient-deprived cells resulting from an inability to promote vascularization for the increasing tissue mass during organogenesis due to a loss of ARNT. To support these data, ARNT-/animals were shown to have less VEGF mRNA in the yolk sac as well as in the embryo overall, with high VEGF mRNA appearing to be restricted to areas known to be colocal ized with ARNT2 mRNA. In contrast, animals of the Kozak line were indi stinguishable from their littermates at ED 8.5, exhibiting normal vasculogenesis in the yolk sac and embryo. By ED 9.5, however, 60% of ARNT-/animals exhibited developmental delay and/or abnormal phenotypes (100% by ED 10.5). These abnormalities included : neural tube closure defects, forebrain hyperplasia, delayed rotation of the embryo, placental hemorrhaging, and visceral arch abnormalities, with no defects s een in yolk sac circulation. However, they postulated that the cause of lethality la y with the failure of the embr yonic component of the placenta to vascularize preventing further development, possibly as a result of loss of ARNT in necessary hypoxic response. These data are supported from evidence that other knockouts in which lethality occurs at ED 10.5 were attributed to improper placental development (Guillemot et al., 1994; Gurtner et al., 1995). Loss of ARNT has also been

PAGE 73

55 linked to pancreatic-islet dys function in type II diabetes (Czech, 2006; Gunton et al., 2005; Levisetti and Polonsky, 2005). ARNT2 knockouts have also been examin ed by three independent laboratories (Hosoya et al., 2001; Keith et al., 2001; Mich aud et al., 2000; Wines et al., 1998). In all groups, the knockout of ARNT2 was nonembryonic lethal; instead, ARNT2-/animals died perinatally within two weeks of birt h (Hosoya et al., 2001). Loss of ARNT2 was correlated to deficiencies in the formation of specific neuroendoc rine lineages in the hypothalamus and altered expression of Brn2 in the hypothalamus similar to SIM-/animals, and also exhibited impaired regulati on of HIF-1 target gene s and thymic defects (Keith et al., 2001; Wines et al., 1998). Attempted double knockouts of ARNT and ARNT2 in the mouse were unsuccessful and out of 67 embryos resulting from a crossing of heterozygous mutant ARNT-/+, ARNT2-/+ animals embryos, no embryos were found to be homozygous double mutants by ED 8.5, and in terestingly, only a single embryo was found for the ARNT-/+, ARNT2-/or ARNT-/-, ARNT2-/+ genotype (Keith et al., 2001). This suggests that in the m ouse, two wild-type alleles of either ARNT or ARNT2 are required to prevent resorptions of the em bryo and that ARNT and ARNT2 may have overlapping functions during earl y development prior to ED 8.5. Conversely, knockout of ARNT3 does not a ppear to elicit defects in early development, but does lead to increased mortality after 26 weeks of age, abolishment of circadian rhythm maintenance under constant darkness, and progressive noninflammatory arthropathy evidenced by ossification of tendons and ligaments (Bunger et al., 2005; Bunger et al., 2000). In another, independe nt, ARNT3 knockout mouse, deficiency in ARNT3 led to reduced levels of B cells in the peripheral blood, spleen and bone marrow

PAGE 74

56 and also led to increased mort ality around 6 months of age, but was correlated to elevated levels of serum glutamic oxaocetic transa minase, serum glutamic pyruvic transaminase, and blood urea nitrogen, which are indicators of liver, heart, and kidney damage (Sun et al., 2006a; Sun et al., 2006b). However, path ological assessment of these tissues revealed no obvious differences between wild-type and ARNT3-/mice, suggesting a possible loss of function in these tissues rather than tissue damage An ARNT4 knockout mouse has not yet been evaluated. 1.16 Toxicity of TCDD Halogenated aromatic hydrocarbons are wi despread environmental contaminants that are generally chemically stable, lipophilic, and resistant to degradation. As such, they tend to persist in the environment wher e they may bioconcentr ate and bioaccumulate through food webs. While some of these hydroc arbons are directly manufactured such as polybrominated biphenyls, some are formed as contaminants in the manufacture of other commercial products. TCDD, for example, is form ed as a contaminant in the synthesis of 2, 4, 5-trichlorophenol, which is used in the commercial synthesis of 2, 4, 5trichlorophenoxyacetic acid (2, 4, 5-T), a wi despread herbicide and defoliant. Of the common types, chlorinated di benzo-p-dioxins, dibenzofurans, azo(xy)benzenes, naphthalenes, biphenyls a nd brominated biphenyls, each has produced incidents of poisoning of industrial workers, members of the general population, or farm workers (Poland and Knutson, 1982). All of these aromatic hydrocarbons share similar chemical structures and produce similar toxic re sponses varying in potency (Figure 1.8).

PAGE 75

57 Figure 1.8: Structures of common tetrachlorinatedcongeners for various halogenated aromatic hydrocarbons. Shown above are seve ral of the chemical structures for various AHR ligands. A, hal ogenated hydrocarbons. The toxic isomers are halogenated at 3 or 4 of the lateral ring pos itions with at least 1 ring position that is unsubstituted. Adapted from: (Poland and K nutson 1982). B, polycyc lic hydrocarbons. C, potential endogenous (indirubin) and dietary (indole-3carbinol) ligands.

PAGE 76

58 The toxic isomers are halogenated at 3 or 4 of the lateral ring positions with at least 1 ring position that is unsubstituted (Poland and Knutson, 1982). Toxicity resulting from exposure to polyc yclic hydrocarbons is mediated by their high affinity and saturable binding to the AHR and involves a broa d range of adaptive and toxic responses including the induction of xenobiotic metabolizing enzymes, such as wasting syndrome, tumor production, thymic i nvolution, hepatotoxicity, skin disorders, gastric lesions, and altera tions in endocrine homeostasis (Poland and Knutson, 1982; Sutter et al., 1994). Exposure to TCDD has al so been associated with urinary tract hyperplasia, subcutaneous edema, decreased spermatogenesis, decreased testicular weight, degeneration of the seminiferous tubules, fetal death and resorptions, fetal wastage, and malformations (Kremer et al., 1994; Nebert et al., 1993; Okey et al., 1994; Safe et al., 1998). 1.17 Role of AHR and ARNT in Mediating TCDD Toxicity Recent studies using antisense morpholino oligonucleotides to knock down levels of the zebrafish AHR (zfAHR2) protein in vivo have revealed that the AHR is required for mediating many endpoints of TCDD toxi city, exhibiting protection against TCDDinduced toxic endpoints such as reduced blood flow, pericardial edem a, and reductions in lower-jaw growth (Bello et al ., 2004; Carney et al., 2004; Pras ch et al., 2003; Teraoka et al., 2003). Reductions of non-f unctional isoforms of the AH R (zfAHR1) showed no such protections. Similarly, zfAR NT1 morphants show comple te protection against TCDDinduced pericardial edema and show partial protection against reduced peripheral blood

PAGE 77

59 flow and lower-jaw growth defi ciencies (Prasch et al., 2006). These results have also been confirmed with a mammalian mode l system (Walisser et al., 2004). Interestingly, antisense morpholinos ag ainst zfARNT2 indicate that reduced or absent levels of ARNT2 provide no prot ection against TCDD-induced developmental toxicity (Prasch et al., 2004a; Prasch et al., 2004b). In these experiments, both wild-type and zfARNT2-/animals exhibited similar responses to TCDD as measured by the toxic endpoints previously described. Taken togeth er, these data suggest that disruption of AHR-mediated signaling provides protectio n against many of the molecular and physiological TCDD-induced toxic endpoints an d that the AHR and ARNT1 are essential for TCDD toxicity. Furthermore, these data also suggest that zfARNT2 is not functional in TCDD-mediated AHR signaling. While AHR-mediated signaling may be required for many endpoints of TCDDinduced toxicity, the mechanism(s) for this toxicity is still unknow n. Since the AHR and ARNT are transcription factors, it is likely that increased si gnaling leads to an alteration of gene expression resulting in toxicity. However, while zfCYP1A1 is the wellcharacterized of the known TCDD regulated genes, zfCYP1A1 morphants exhibit no protection against endpoints of TCDD-mediated toxicity (Carney et al., 2004). Thus, genes involved in mediating su ch toxicity are as yet unknown.

PAGE 78

60 Chapter Two Generation and Characterizati on of Stable Lines Expressi ng Different Species of AHR 2.1 Rationale for Stable Lines Expre ssing Different Species of AHR The aryl hydrocarbon receptor (AHR) is a basic helix-loop-helix PER/ARNT/SIM (bHLH-PAS) transcription factor th at binds ligands typified by 2,3,7,8tetracholordibenzo-p-dioxin (TC DD), translocates to the nucleus, dimerizes with the aryl hydrocarbon nuclear translocator (ARNT) and associates with specific cis acting xenobiotic response elements (XRE) to activ ate transcription of genes involved with xenobiotic metabolism and is subsequently de graded. AHR-mediated signal transduction has been evaluated primarily in the C57BL/6J mouse model system. This model system, however, may not be the most accurate model for human comparisons as the AHRb-1 allele carried by C57BL/6J c ontains a point mutation that prematurely truncates the receptor at 805 amino acids, while the AHR foun d in other murine strains as well as in the rat and human all contain an additional 42-45 amino acids at their carboxy-terminus that have 70% identity (Figure 1.3, Table 1.3) This carboxy-terminal region could be functionally significant and the analysis of AHR-mediated signal transduction in the rat, human, or other mouse strains may better re present the physiology of the AHR pathway. Since the Ah receptors found in mice carrying the Ahb-2 allele, like those found in the rat and human, possess a carboxy-terminal re gion that is more typical across species

PAGE 79

61 than the truncated b1 allele, these Ah receptors were chosen to be ev aluated in an attempt to evaluate a possible functional role for this additional carboxy-term inal sequence. The ability to directly compare the function of these Ah recep tors versus that of the AHRb-1 in a genetically identical background was essentia l for delineating possi ble roles of this sequence, since studies using an endogenously expressed AHRb-2 would need to be performed in a different cell line than the mu rine Hepa-1 line used to examine the AHRb-1 function and therefore could have confounding results due to other genetic variation between these lines. Furthermore, the AHRb-2 allele was highly useful in that antibodies currently in use by the Pollenz labor atory for the detection of the AHRb-1 allow equivalent detection of both proteins since these antibodies were generated against an amino-terminal portion of the AHRb-1 which shares 100% identity with the AHRb-2. To formally investigate protein-protein a ssociations and degradation patterns of the AHRb-2 receptor, and whether the differences seen were due to the receptor itself or other cellular factors, stable lines were generated exploiting the LA-I, AHR deficient cells as described in Chapter Six The use of a genetically identical background to examine the function and de gradation rate of the AHRb-2 in comparison with the AHRb-1 provided significant insights in to these biological properties of the AHR contributed by this functional region. 2.2 Generation of LA-I Lines Expressing the Ahb-1 or Ahb-2 Receptor The first step in these studies was the lig ation of the various coding regions from each cDNA into base and retrovir al vectors, as detailed in Chapter Six (Invitrogen; Figure 2.1). The base vector, pcDNA 3.1 allowed cloned products to be produced through in

PAGE 80

62 Figure 2.1: Invitrogen plasmid maps. Target genes are expressed from the cytomegalovirus immediate early (CMV IE) promoter and the plasmids contain both neomycin (G418) and ampicillin resistance used for antibiotic selecti on in eukaryotic and prokaryotic cells respectively. Top: pcDNA 3.1 was used as the base vector for most constructs and the T7 promoter exploited for the production of in vitro transcribed and translated proteins. This construc t also contains a CMV promoter for in vivo expression located upstream of the viral T7 (not s hown). Bottom: pQCXIN and pLNCX2 are retroviral vectors optimized to yield high titers. In pQCXIN the possibility of promoter interference is minimized by expressing the ge ne of interest along with the neomycin resistance gene as a bicistronic transcript by means of an internal ribosomal entry site (IRES). Following transfection of either retrov iral vector into pack aging cells, the vector provides the viral packaging signal ( +), the target gene, and the drug-resistance marker. Vectors were obtained from the manufact urer (Invitrogen; Ca rlsbad, California).

PAGE 81

63 vitro transcription and translation reactions. The initial retr oviral vector, pLNCX2, was chosen as it allows each of the proteins to be stably integrated into a common genetic background under the control of the same promoter. PCR was used to amplify the cDNA coding region as well as to add specific rest riction endonuclease sites that were exploited for the ligation of the cDNA into the multiple cloning site of pL NCX2. Alternatively, retroviral constructs were al so prepared using pQCXIN, a re troviral vector derived from pLNCX2 containing an internal ribosomal en try site for bicistronic expression of the neomycin resistance and target genes (Invitr ogen, Figure 2.1). Using this vector allows for a greater percentage of positive clones fo llowing infection with competent virus since expression of the neomycin resistance gene for selection in eukaryotic cells is coincident with expression of the target cDNA. Since neither pLNCX2 nor pQXCIN has an in vitro promoter, retroviral constructs were sequenced and tested by tr ansient transfection into the AHR-deficient LA-I Hepa-1 variant or in PT67 viral packaging cells derived from an NIH 3T3 line, then analyzed by SDS-PAGE and evaluated by Western blotting (Fi gure 2.2). Western analysis also validated that the molecular mass of each protein is correct. In either case, following transfection of viral packaging cells viral media was collected and used to infect target cells as shown in Figure 2.3 (see also Chapter Six) Stable lines surviving a two-week selecti on in neomycin were then analyzed for expression of the target genes by SDS-PAGE and Western blotting (Figure 2.4). While these studies were intended to generate stab le lines in the Hepa-1 background expressing either the wild-type AHR, the Ahb-2, the human AHR, or the rat AHR, numerous colonies surviving neomycin selection following inf ection with human or rat AHR viral media

PAGE 82

64 Figure 2.2: Western analysis of the AHR constructs following transfection into AHR-deficient PT67 viral packaging cells. Equal amounts of total cell lysates from independent clones were resolved by SDS-PAGE, blotted, and st ained with A-1A antiAHR IgG (1.0 g/ml) and -actin IgG (1:1000). Reactivity was visualized by ECL with GAR-HRP IgG (1:10,000). A, total cell ly sates from PT67 viral packaging cells transfected with Ahb-2 or Rat AHR. B, total cell lysates from PT67 cells transfected with Ahb-1, Ahb-2, rat AHR, or human AHR. WT, wild-type Hepa-1 cells; PT67, nontransfected viral packagi ng cells; B1, PT67 cells tran siently expressing the Ahb-1 receptor; B2, PT67 cells transiently expressing the Ahb-2 receptor; RAT, PT67 cells transiently expressing rat AHR; HU, PT67 cells transi ently expressing huma n AHR. HU TNT, in vitro transcribed and translated human AHR used as a control. Note that in each case PT67 cells express detectable levels of the target AHR. B A

PAGE 83

65 Figure 2.3: Schematic for viral transfection. (Adapted from Clontech user manual PT3132-1). The viral genes gag, pol and env are required for viral production and are absent from the retroviral vector, but are integrated in to the genome of the viral packaging cells. Following transfection of the retroviral vector into the packaging cells, the vector provides the viral packaging signal ( +), the target gene, and the drugresistance marker, while the packaging cells provide gag, pol and env to generate infection-competent, replication-incompetent virus, which is collected from the cell culture media. This viral media is then used to infect target cells, which are selected for infection by culturing in the pres ence of neomycin. Resultant colonies are subsequently evaluated for expression of the target gene.

PAGE 84

66 Figure 2.4: Western analysis of stable line expression of target AHR constructs. Equal amounts of total cell lysates from independent clones were resolved by SDS-PAGE, blotted, and stained with A-1A anti-AHR IgG (1.0 g/ml) and -actin IgG (1:1000). Reactivity was visualized by ECL with GAR-HRP IgG (1:10,000). A, LA-I clones surviving selection after infection with Ahb-2, a truncated AHR (AHRtr), or rat AHR. WT, LA-I clones stably expressing the Ahb-1 receptor; B2, LA-I clones stably expressing the Ahb-2 receptor; AHRtr, amino-terminally trunc ated AHR; PT67, non-transfected viral packaging cell line; RAT, LA-I clones survivin g selection after infection with rat AHR. B, LA-I clones surviving selection after infecti on with human AHR (Hu). Arrows indicate clones that were chosen for future analys is. Note that each lane represents an independent clone. Also note that several i ndependent clones for both the rat and human AHR failed to express th e AHR following selection. A B

PAGE 85

67 failed to express the desired target genes or expressed these genes at very low levels, though the constructs contained the correct se quence and transiently expressed the target genes following transient transfections into LA-I cells (Figure 2.2). Repeated attempts to generate the lines by altering th e number of rounds of infectio n with competent virus, the confluency of target cells, or by using differe nt lots of competent virus, all resulted in colonies that failed to express the target ge nes at levels detectable with the A1-A AHR antibody (Figure 2.4). Since the Ahb-1 and Ahb-2 lines were easily created, these lines became the focus for the following studies. Stable lines expressing the Ahb-2 were selected and those that expressed the receptor to the same physi ological level as the AHRb-1 in WT Hepa-1 cells were chosen for future study and are referred to as AHb2 cells (Figure 2.4). The same process was also completed for the AHRb-1 whereby the receptor was re-introduced into the LA-I AHR deficient line. This line, termed hereafter as AHWT, was used as the control for the following studies, rather than WT Hepa-1, sin ce these cells have al so undergone selection and this line is therefore more comparable to other generated stable lines. Since the expression of the AHRb-1 and AHRb-2 were achieved using retroviral vectors which insert the target genes directly into the genome, it wa s possible that inserti on of the target genes could disrupt the expression of other gene(s ) and thus confound the biochemical analyses of AHR function. Therefore, all studies were performed using at least three independent AHWT or AHb2 clones to increase the likelihood that the biochemical properties of the AHR being evaluated were not resulting from altered expres sion of other genes impacting the AHR signaling pathway.

PAGE 86

68 2.3 Reduced Association of XAP2 with Ahb-2 Receptors Expressed in the Hepa-1 Background Mimics that of Endogenously Expressed Ahb-2 Receptors It has been proposed that XAP2 functions in AHR-m ediated signal transduction by influencing the stability, shuttling behavior and expression of the AHR (Bell and Poland, 2000; Berg and Pongratz, 2002; Carver and Bradfield, 1997; Kazlauskas et al., 2002; LaPres et al., 2000; Lees et al., 2003; Ma and Whitlock, 1997; Meyer and Perdew, 1999; Meyer et al., 2000; Meyer et al., 1998; Pe trulis et al., 2003; Ramadoss and Perdew, 2005). However, these conclusions have been based primarily on the analysis of AHR and XAP2 in transient transfection systems. Thus, there has been minimal information on the function of endogenous XAP2 especially as it relates to interactions with AHR proteins from species other than the murine C57BL strain. Interestingly, initial studies carried out on mouse Hepa-1c1c7 cells, which express the C57BL Ahb-1 receptor, mouse C2C12 myoblasts, which express the Ahb-2 receptor, and rat smooth muscle cells (A7) suggested that AHR proteins from non-C57BL species exhi bited a reduced association with XAP2. This observation was based on evid ence that while Wester n blot analysis of total cell lysates from these lines showed equal levels of endogenous hsp90, p23, and XAP2 protein and similar levels of AHR prot ein, cytosol produced from these lines and immunoprecipitated with AHR an tibodies as detailed in Chapter Six showed that the level of XAP2 co-precipitated with the AHR in the C2C12 and A7 cells was greatly reduced in comparison to the Hepa-1 cells (F igure A-1). In repeated experiments, the amount of XAP2 co-precipita ted with AHR IgG from A7 and C2C12 cells averaged 15 7% and 19 6% respectively of the level co-precipitated from Hepa-1 cells. Since the overall level of AH R precipitated from the C2C12 or A7 cells was similar to that from the

PAGE 87

69 Hepa-1, and the total cellular levels of AHR and XAP2 were similar, these results suggested that the differences in XAP2 asso ciation between the He pa-1 cells and the C2C12 or A7 cells may be related to the AHR itself, rather than cellular context. Furthermore, recent studies likewise suggest that the human AHR is associated with reduced levels of XAP2 when transiently expressed in COS cells (Ramadoss and Perdew, 2005). However, since other cellular factor s could be contributing to the reduced association of AHR and XAP2 in these lines by competing for binding with either protein or blocking interaction sites, it was essential to explore thes e protein•protein interactions in a common genetic background. Thus, to further explore the reduced a ssociation of XAP2 seen in the C2C12 cells carrying the Ahb-2 allele and to determine more definitively whether this reduced association between the non-C57BL/6J AHR and XAP2 was receptor or cell specific, studies were carried out in the previously described AHWT and AHb2 stable cell lines. Figure 2.5 A shows the expression of AHR, hsp90, XAP2, and actin in the parental LA-I Hepa-1 variant, the AHWT, and the AHb2 lines. Importantly, the level of AHR expressed in each of the stable cell lines approximates that of the endogenous AHR in wild type Hepa-1 cells, and the levels of hsp90 and XAP2 in total cell lysates are also similar. To assess the composition of the unliganded AHR complex, cytosol was generated from two independent AHb2 cell lines as well as from the AHWT line and immunoprecipitated with antibodies specific to the AHR as previous ly described. As shown for the endogenous Ahb-1 receptor in Hepa-1 cells, immunoprecipitation of the AHR from the AHWT cells coprecipitated a high level of XAP2 (Figure 2.5 B). In c ontrast, as shown for the

PAGE 88

70 Figure 2.5: Analysis of AHR and XAP2 expression and association in stable cell lines expressing Ahb-1 or Ahb-2 receptors. Stable cell lines expressing the Ahb-1 (AHWT) or Ahb-2 (AHb2) were generated as detailed in Chapter Six. A equal amounts of total cell lysates from LA-I ( LA ), Hepa-1 ( He ), AHWT ( WT ), or AHb2 ( b2 ) cells were resolved by SDS-PAGE, blotted, and stained w ith A-1A rabbit IgG (1.0 g/ml), -actin rabbit IgG (1:1000), hsp90 rabbit IgG (1:500), or XAP2 mouse IgG1 (1:750). Reactivity was visualized by ECL with GAR-HRP or GAM-HRP IgG (1:10,000). B cytosol was prepared from AHWT ( WT ) or two independent AHb2 ( b2 ) cell lines as detailed. 800 g of cytosol was precipitated with either affin ity-pure A1-A IgG (5 g) or affinity-pure preimmune rabbit IgG (5 g) along with Prot ein A/G-agarose (25 l) for 2.5 h at 4 C with rocking. Pellets were washed three times for 5 min each with TTBS supplemented with sodium molybdate (20 mM) and then boiled in 30 l of SDS sample buffer. 15 g of cytosol (input) or 15 l of th e eluted protein were resolv ed by SDS-PAGE, blotted, and stained with A-1A IgG (1.0 g/ml) or XAP2 mouse IgG1 (1:750). Reactivity was visualized by ECL with GAR-HRP or GAM-HRP IgG (1:10,000). Ah precipitated with A1-A IgG; Pi precipitated with preimmune Ig G. The numbers under the XAP2 blot represent the percentage of XAP in relation to the level in the AHWT cell line (100%). The precipitated IgG band is shown to dem onstrate the uniformity of the precipitation across all samples.

PAGE 89

71 endogenous rat and Ahb-2 receptors, immunoprecipitation of the AHR from both of the AHb2 cell lines precipitated significantly lower levels of endogenous XAP2 than the AHWT (compare Figures 2.5 B and A-1 B). Inde ed, over several experiments, the average amount of XAP2 co-precipitated from the AHb2 cells was 21 8% of the level coprecipitated from AHWT, which highly mimics the 19 6% seen in the C2C12 cells endogenously expressing the Ahb-2 receptor. Taken togeth er, these studies clearly indicate that even in the sa me genetic background as the Ahb-1, the Ahb-2 receptor exhibits a reduced association with XAP2. Thus, the species of receptor, not the cellular context of its expression, appears to determine the level of association with XAP2. Furthermore, since the Ahb-1 and the Ahb-2 exhibit 99% identity of th e first 805 amino acids, this reduced association is likely to be relate d to the extended carboxy-terminal region found in most species. However, since XAP2 appear s to associate with amino acids 380-419 of the PAS B domain of AHR which share 100% identity between the Ahb-1 and Ahb-2 (Meyer and Perdew, 1999) and not through a carboxy-terminal region of AHR, this reduced association is likely due to a conf ormational change in the AHR resulting from the extended carboxy terminus rather than sequence specific differences. 2.4 Ahb-2 Receptor Expressed in the Hepa-1 Background Exhibits Nucleocytoplasmic Shuttling The endogenous Ahb-1 receptor is predominantly cytoplasmic in Hepa-1 cells when evaluated by immunohistochemistry or confocal microscopy (Pollenz, 1996; Pollenz et al., 1994), though exogenous expression of the Ahb-1 receptor in HeLa or COS cells is nuclear unless XAP2 is also expressed in the cells (Berg and Pongratz, 2002;

PAGE 90

72 Kazlauskas et al., 2000; Kazlauskas et al., 2002; Petrulis et al., 2000; Pe trulis et al., 2003). Thus, it has been hypothesized that XAP2 inhibits nuclear lo calization of the unliganded AHR complex. Previous studies have demonstrated that the endogenous Ahb-1 receptor in untreated Hepa-1 exhibits a predominantly cytoplasmic location that becomes strongly nuclear following exposure to ligand (P ollenz, 1996; Pollenz et al., 1994). In contrast, the endogenous AHR proteins expressed in A7, C2C12, or 10T1/2 embryonic fibroblasts, which express the rat (A7) or Ahb-2 receptor, exhibit a s ubcellular localization in untreated cells that is both cytoplasmic and nuclear but becomes predominantly nuclear after a 60min exposure to TCDD (Figure A2). Importantly, exposure of any of these cell lines to the CRM-1 nuclear export inhibitor leptomyc in B (LMB) for 2 or 4 h results in an accumulation of the AHR in the nucleus that is not seen in Hepa-1 cells expressing the Ahb-1 (Figure A-2). LMB-induced nuclear lo calization of the endogenous AHR was also observed in the MCF7 human breast cancer cell line (Wentworth et al., 2004). Thus, these previous findings show an LMB-induced accumulation of nuclear AHR that is suggestive of rat and mouse Ahb-2 receptors that are dynami cally shuttling between through the nucleus with a periodicity of 90–180 min. Since these results indicated that the s ubcellular localization of the AHR and its ability to shuttle through the nucleus was dependent on the species and strain of AHR examined and since these findings correlated to a reduced level of XAP2 associated with the AHR complex, it was again pertinent to asse ss whether the lack of shuttling seen in the Hepa-1 was related to its genetic background or whet her these biochemical properties were specific to the AHR expressed in the cell. To evaluate this question, AHWT and AHb2 cells were propagated on glass coverslips, exposed to TCDD or LMB, and then

PAGE 91

73 fixed and stained for AHR protein. As was previously shown, the location of the Ahb-1 receptor in the AHWT cells was predominantly cytoplasmic and became nuclear following 1 h of TCDD treatment (Figure 2.6). In a ddition, as observed in the wild-type Hepa-1 lines, 4 h of LMB exposure did not influence the location of the Ahb-1 receptor. In contrast, the unliganded Ahb-2 receptor exhibited a subcellular localization that was both cytoplasmic and nuclear that became more st rongly nuclear in the presence of LMB (Figure 2.8, lower panels). Since the Ahb-2 receptor showed a predominately nuclear localization prior to LMB treatment, the change in nuclear fluorescence intensity was measured by the average level of fl uorescence among a population of nuclei as detailed in Chapter Six In the experiment shown, the average level of fluorescence in control nuclei was 106 10 (across a population of 100 cells), whereas the LMB-treated nuclei averaged 165 12 (also across a population of 100 cells). Th us, these results show that nucleocytoplasmic shuttling of an AHR can occur in the He pa-1 cell line, but that this shuttling is dependent on the species of AHR that is expressed. Furthermore, this lack of nucleocyt oplasmic shuttling in the Hepa-1 line expressing the Ahb-1 receptor can be directly correl ated to the high level of XAP2 association seen with this receptor species. Other studies performed in this laboratory have demonstrated that reductions in XAP2 by siRNA treatment in the Hepa-1 line result in an AHR that is associated with reduced levels of XAP2 similar to the situation seen in cells expressing other AHR species (Figure A3). Additionally, while these cells with reduced XAP2 show the same cytoplasmic distribution of the AHR as cells transfected with control siRNA, there is a marked increase in the nuclear localization of the AHR when cells transfected with siXAP2 are treated with LMB for 4 h, which was not

PAGE 92

74 Figure 2.6: Subcellular localization of AHR in AHWT and AHb2 cells exposed to TCDD or LMB. Cells were grown on glass cove rslips exposed to the compounds detailed below and then fixed as detailed pr eviously (Holmes and Pollenz, 1997; Pollenz, 1996; Pollenz et al., 1994). Coverslips were incubated with A-1 IgG (1.0 g/ml) and visualized with GAR-Rhodamine IgG (1:400). A B D and E AHWT cells exposed to Me2SO (0.1%) ( A ) for 1 h, TCDD (2 nM) for 1 h ( B ), methanol (0.5%) for 4 h ( D ), or LMB (20 nM) for 4 h ( E ). F–I AHb2 cells exposed to Me2SO (0.1%) for 1 h ( F ), TCDD (2 nM) for 1 h ( G ); methanol (0.5%) for 4 h ( H ), or LMB (20 nM) for 4 h ( I ). C the parental LA-I cell line stained and photographed unde r the identical conditions to the AHWT and AHb2 cells. All panels were expos ed for identical times. Bar ( A ), 10 m.

PAGE 93

75 observed in LMB-treated cells tran sfected with siCON (Figure A-4). Together, these results suggest that when endogenous XAP2 is reduced in the Hepa-1 cell line, the endogenous AHR exhibits a reduced association with XAP2 that is similar to that seen in the rat and Ahb-2 receptor and, importantly, that such a reduction appears to result in a receptor capable of undergoing dynamic nucle ocytoplasmic shuttling. Thus, the high levels of XAP2 associated with the Ahb-1 appear to prevent shuttling of this AHR species. Since dynamic nucleocytoplasmic shuttling has been shown to be important level of control for many transcripti onal regulators such as members of the E2F family, NF B, and mdm2 (Cartwright and Heli n, 2000), transcripti onal regulation of so me target genes may differ between the C57BL/6J mouse and other species. 2.5 Exogenous Expression of XAP2 Does No t Affect the Subcel lular Localization of the Ahb-1 or the Ahb-2 Receptor Previous results from this labor atory further suggest that the entire pool of Ahb-1 receptor complexes in Hepa-1 cells is associated with XAP2 since exogenous expression of XAP2 in the Hepa-1 line results in an equiva lent level of associ ation between the Ahb-1 receptor and XAP2, though there was a large increase in cellular expression of XAP2 (Figure A-5). Additionally, when exogenous XAP 2 is expressed in the Hepa-1 line, no significant alterations were seen in the localization of the Ahb-1 receptor (Figure A-6). Likewise, transgenic animals exhibiting a hepatocyte specific increase in XAP2 expression levels also fail to exhibit increased levels of Ahb-1•XAP2 association (Hollingshead et al., 2006). Since the Ahb-2 receptor and rat AHR appeared to be associated with a lesser degree of XAP2, even in the presence of similar cellular levels of

PAGE 94

76 XAP2, these receptor complexes are either not all associated with XAP2, unlike the Ahb-1, or there is a reduced affinity of XAP2 for the Ahb-2 receptor leading to a weaker association of these proteins and possibl e loss during immunopreci pitation analysis. Therefore, studies were also carried out to determine whether in creased expression of XAP2 in lines expressing the Ahb-2 receptor would increase the level of association between the Ahb-2 and XAP2 and/or inhibit nucleo cytoplasmic shuttling of the Ahb-2 receptor. To establish whether Ahb-2 complexes could be generated with increased XAP2 association in the presence of exogenous XAP2 expression, AHb2 cells were transfected as above, lysed and the AHR immunopreci pitated with A-1A anti-AHR IgG. The samples were then evaluated fo r AHR and XAP2 protein by Western blotting. A representative experiment is shown in Figure 2.14 and quantified results presented in Figure 2.7. The input samp les demonstrate that AHb2 cells transfected with XAP2 exhibited an increase in the total cellular level of XAP2 compared with cells transfected with control vector, and that such an increas e in XAP2 resulted in increased association of the Ahb-2 receptor with XAP2 (Figures 2.7 and 2.8). Indeed, when the AHR was immunoprecipitated from these samples, the ratio between the level of AHR and the total amount of XAP2 associat ed with the endogenous Ahb-2 complex was similar to that seen in the Ahb-1 (Figure 2.8). To establish whether these Ahb-2 complexes exhibiting increased XAP2 association would be exhibit an al tered subcellular distribution, cells were transfected with control vector or pCI-hXAP2 as detailed in Chapter Six and allowed to recover for 48 h, and subsequently harvested and anal yzed by Western blotting or fixed onto coverslips and stained for AHR or XAP2 (Figur e 2.9 A). Western blot analysis of these

PAGE 95

77 Figure 2.7: Association of the Ahb-2 receptor with XAP2 in cel ls expressing increased levels of XAP2. Hepa-1 (WT) or AHb2 stable lines were tran sfected with pCI-hXAP2 or control vector pcDNA3.1 as detailed in Chapter Six. After 24 h, populations of cells were harvested, and cytosol was generated for i mmunoprecipitation experiments. 600 g of cytosol from the indicated samples was precip itated in duplicate w ith either AHR (AHRIgG) or preimmune IgG (P i-IgG) as detailed in Chapter Six Each of the precipitated samples as well as 15 g of cytosol (input) was resolved by SDS-PAGE and blotted. Blots were stained with either 1.0 g/ml A-1A IgG or XAP2 mouse IgG1 (1:750), and reactivity was visualized by ECL with GAR -HRP or GAM-HRP IgG (1:10,000). mXAP2, endogenous mouse XAP2; hXAP2, exogenous hum an XAP2; and AHR (AHR). The IgG bands are presented to show the consistency of the precipitations. C, samples from cells transfected with pcDNA3.1; X, samples from cells transfected with pCI-hXAP2. The precipitated IgG band is shown to demonstrate the uniformity of the precipitation across all samples.

PAGE 96

78 Figure 2.8: Quantification of association of the Ahb-2 receptor with XAP2 in cells expressing increased levels of XAP2. Computer densitometry was used to determine the relative level of AHR or XAP2 protein present in th e precipitated samples from Figure 2.13. Each column represents the relative densitometry units of an individual band and can be used to evaluate differences in the ratio of XAP2/AHR in the different samples. However, because of the differen ce in the sensitivity of each antibody for its target protein, the ratio does not represent th e absolute number of protein molecules. Note that the XAP2/AHR ratio is essentially be tween the WT and WT+XAP2 samples, while the relative amount of XAP2 increases in the b2 samples transfected with XAP2 to a XAP2/AHR ratio similar to WT levels. end, endogenous expression; ex, exogenous expression; tot, tota l expression levels.

PAGE 97

79 Figure 2.9: Localization of Ahb-2 receptor in AHb2 cells expressing hXAP. AHb2 populations were transfected with pCI-h XAP2 (XAP2) or control vector pcDNA3.1 (CON) as detailed in Chapter Six. A, Western blot of AHR an d XAP2 expression in total cell lysates prepared from tr ansfected cells. Each of the samples was resolved by SDSPAGE and blotted. Blots were stained with either 1.0 g/ml A-1A anti-AHR IgG, antiactin IgG (1:1000), or XAP2 mouse IgG (1: 750), and reactivity was visualized by ECL with GAR-HRP (1:10,000; AHR, Actin) or GAM-HRP IgG (1:10,000; XAP2). B, Duplicate populations of tran sfected cells were fixed and stained for the AHR with 1.0 g/ml A-1A AHR IgG or hXAP2 IgG and vi sualized with GAR-RHO IgG (1:400; AHR) or GAM-FITC (1:400; XAP2). Scale bar, 10 m.

PAGE 98

80 samples revealed an increased level of total cellular XAP2 fo llowing transfection. Unexpectedly, however, immunohistochemical staining of the Ahb-2 receptor in cells transiently transfected with XAP2 failed to e xhibit any changes in AHR localization from control transfected cells (Figure 2.9 B). Howe ver, it is important to note that while the total level of XAP2 association is these transfected cells incr eased relative to endogenous Ahb-2•XAP2 association, this level remained lower than that seen with the Ahb-1. It is noteworthy, though, that while 100% of the population of Ahb-1 complexes appeared to be associated with XAP2 and Ahb-2 complexes appeared to be endogenously associated with less XAP2, Ahb-2 complexes could be “forced” to a ssociate with increased levels of XAP2 when the cellular expression of XAP2 wa s greatly increased. Since an increased association with the Ahb-2 receptor could be achieved, further studies should be performed to evaluate the pot ential affect of this incr eased association of the Ahb-2 receptor with XAP2. Transgenic hepatocyte specific overexpression of XAP2 in the C3H mouse expressing the Ahb-2 receptor, as has been perf ormed in the C57BL/6J mouse (Hollingshead et al., 2006), may be particul arly insightful and may serve as a better model for examining the potential impact of XAP2 overexpression in model systems where the AHR is endogenously associat ed with lower levels of XAP2. 2.6 Degradation of the Mouse Ahb-2 Receptor in Hepa-1 Background Varies from the Ahb-1 Receptor The AHR proteins expressed in the A7 a nd C2C12 cells also exhibit an increased susceptibility to TCDD-induced degradation wherein C2C12 and A7 cells treated with TCDD for 0–120 min results in a dramatic reduction of cellular AHR protein by the 120-

PAGE 99

81 min time point (Figure A-7). Indeed, in the C2C12 lines, AHR protein was not detectable at the 90-min time point, and in A7 cells, the AHR protein decreased by 88% of control levels by the 120-min time point. Additionally, previous reports have shown that the AHR was also reduced by greater than 90% following 120 min of TCDD exposure in the 10T1/2 cell line (Pollenz et al ., 1994; Richter et al., 2001). In contrast, TCDD-induced degradation of the Ahb-1 receptor exhibits a degrad ation profile of lesser magnitude whereby AHR protei n in this line is only reduced by 30–40% after 120 min. Collectively, these results indicate that the endogenous Ahb-2 and rat receptors are degraded to near completion within 2 h of ligand exposure and highlight another striking difference in the response of th ese AHR proteins in comparison to the Ahb-1 receptor. Since the AHR expressed in the A7 and C2C 12 cells exhibited a di fferent time course and magnitude of degradation from the AHR expressed in the Hepa-1 cells, it was therefore pertinent to assess the degradation of the AHR in the AHb2 cell line in comparison to the AHWT line. To evaluate the degradat ion pattern of each receptor, both lines were compared in a time course of degradation following ligand binding. Two different time course experiments were comple ted. In the first experiment, cells were treated with TCDD for 0, 1, 2, 4, or 6 hours and total cell lysates were harvested and evaluated by SDS-PAGE and Western blotting for levels of AHR, CYP1A1, and actin. Results from a representative experiment are given in Figure 2.10. In the second experiment, cells were treated with TCDD for 0, 30, 60, 90, or 120 minutes and total cell lysates were again harvested and evalua ted by SDS-PAGE and Western blotting for levels of AHR, CYP1A1, and actin. Results from a representative experiment are given in Figure 2.10 B inset. In both time courses evaluated, TCDD-induced degradation in the

PAGE 100

82 Figure 2.10: Western blot an alysis of AHR in stable cell lines expressing Ahb-1 or Ahb-2 receptors exposed to TCDD. A, AHWT and AHb2 cells were treated with Me2SO (0.1%) for 6 h or TCDD (2 nM) for the indicated times. Total cell lysates were prepared, and equal amounts of protein were resolved by SDS-PAGE, blotted, and stained with A1A IgG (1.0 g/ml) and actin IgG (1:1000) Reactivity was visualized by ECL with GAR-HRP (1:10,000), and protein bands were quantified and normalized as detailed (Holmes and Pollenz, 1997; Pollenz, 1996; Polle nz et al., 1994). B, the levels of AHR protein in the AHWT and AHb2 samples were divided by the corresponding level of actin, and the average S.E. of the three independent samples was plotted as the percentage of time 0 control. The inset shows the time course of degradation over 120 min. *, statistically different from the control siRNA; p < 0.001.

PAGE 101

83 AHb2 line was more rapid and proceeded to a greater magnitude than that in the AHWT. Indeed, the Ahb-2 receptor was reduced by 52% after 2 h a nd >85% after 6 h of TCDD exposure compared with 28 and 74% for the Ahb-1 receptor. Overall, while the Ahb-2 receptor expressed in the AHb2 line exhibited a reduced degradation rate than that expressed in the C2C12 line, the increased magnitude of degradation seen in the AHb2 line was more representative of that obser ved in the C2C12 cell line which endogenously expresses the AHRb-2 or the rat A7 cell line than th e Hepa-1 (compare Figures 2.10 and A-7). 2.7 Time Course of CYP1A1 Induction is Unaltered by Ah Receptor Type Since nucleocytoplasmic shuttling and a mo re rapid degradation profile could be impacting target gene induction by the Ahb-2 compared to the Ahb-1 following ligand binding, the ability of each receptor to induce CYP1A1 was assessed. LA-I cells not expressing any exogenous AHR were also examined to insure that the levels of CYP1A1 protein were not influenced by the presence of any endogenous receptor in the LA-I line. Figure 2.11 shows that CYP1A1 was detectable within 2 h of TCDD exposure in both cells lines and increased proportionally over time. To determine whether there were any quantitative differences in the induction of CYP1A1 protein in the two cell lines, cells were treated with TCDD for 16 h, and identical levels of total cell lysates were evaluated by quantitative Western blotting. In terestingly, the level of CYP1A1 protein induced after 16 h was not statistically different between the AHWT and AHb2 cell lines although the Ahb-2 receptor was associated with less XAP2 and degraded with a more rapid profile (Figures A-1, 2.5, A-7, and 2.10). Thus, in this model system, a reduction in the level of

PAGE 102

84 Figure 2.11: Western blot analys is of CYP1A1 protein in stab le cell lines expressing Ahb-1 or Ahb-2 receptors following exposure to TCDD. A AHWT and AHb2 cells were treated with Me2SO (0.1%) for 6 h or TCDD (2 nM) for the indicated times. Total cell lysates were prepared, and equal amounts of protein were resolved by SDS-PAGE, blotted, and stained with rat CYP1A1 IgG ( 1.0 g/ml) and actin IgG (1:1000). Reactivity was visualized by ECL with GAR-HRP (1:10,000). B LA-I, AHWT, and AHb2 cells were treated with Me2SO (0.1%) or TCDD (2 nM) for 16 h. Total cell lysates were prepared, and equal amounts of protein were resolved by SDS-PAGE, blotted, a nd stained with rat CYP1A1 IgG (1.0 g/ml) and actin IgG (1: 1000). Reactivity was visu alized by ECL with GAR-HRP (1:10,000), and protein bands were quantified and normalized as detailed (Holmes and Pollenz, 1997; Polle nz, 1996; Pollenz et al., 1994). C the levels of CYP1A1 protein in the LA-I, AHWT, and AHb2 samples were divided by the corresponding level of actin, and the average S.E. of the three independent samples was potted as normalized densitometry units. Con average density of Me2SO-treated cells.

PAGE 103

85 Figure 2.12: Analysis of dose-response for CYP1A1 induction in stable cell lines expressing Ahb-1 or Ahb-2 receptors. A, Triplicate plates of AHWT or AHb2 cells were dosed with 1, 10, 100, or 1000 pM TCDD for 6 hr at 37 as detailed in Chapter Six Total cell lysates were prepared, and equa l amounts of protein were resolved by SDSPAGE, blotted, and stained with A-1A IgG (1.0 g/ml), rat CYP1A1 IgG (1.0 g/ml), and actin IgG (1:1000). Reactivity was vi sualized by ECL with GAR-HRP (1:10,000), and protein bands were quantified and normali zed as detailed (Holmes and Pollenz, 1997; Pollenz, 1996; Pollenz et al., 1994). B the levels of CYP1A1 protein in the AHWT and AHb2 samples were divided by the corresponding level of actin, and the average of the three independent samples was plotted compared to the time 0 control. Each data point represents the average of the triplicate nor malized samples for each TCDD concentration. Note that the EC50 for CYP1A1 induction in both AHWT or AHb2 cells is similar an close to the expected 30-50 pM range.

PAGE 104

86 XAP2 in the core AHR complex did not appear to impact induction of the endogenous CYP1A1 gene. To confirm these CYP1A1 induction levels, dose-response studies were performed using graded doses of TCDD on cell lines in culture. Following the incubation, cells were harvested and evaluate d for CYP1A1 protein and actin expression by quantitative Western blotting as detailed previously. Re presentative results are shown in Figure 2.12. From these studie s, it was determined that the AHWT and AHb2 lines exhibited a similar EC50 (~40 pM) for CYP1A1 induction in response to TCDD that was within the 30-50 pM published range (Pollenz, 1996). WT Hepa -1 cells were included as a control, and exhibited similar resu lts as those obtained using the AHWT line (data not shown). Together, these data further s upport the hypothesis that properties of the receptor itself rather than other cellular f actors are mostly respons ible for subcellular localization and degrada tion following ligand binding. 2.8 AHb2 Stable Line Conclusions When considered in the context of the results presented in Figures 2.5-2.19, these findings collectively show that the Ahb-2 receptor when in the same C57BL/6J genetic background as the Ahb-1 exhibits distinct susceptib ility to ligand exposure and nucleocytoplasmic shuttling when compared with the Ahb-1 receptor. Additionally, these biochemical properties of the Ahb-2 receptor mimic those of the Ahb-2 endogenously expressed in the C2C12 cell lin e. Furthermore, these studies indicate that these differences are likely related to the recep tor-dependent reduced association of the Ahb-2 receptor with XAP2 rather than cellular contex t. Studies focusing on the function of the

PAGE 105

87 AHR in the C57BL/6Jmouse or Hepa-1 cells ar e therefore not univers al descriptions of AHR function and may not be entirely repres entative of receptor function in the human.

PAGE 106

88 Chapter Three Generation and Characterization of Stable Lines Expressing Ah-Receptors Deficient in DNA-Binding or ARNT Dimerization 3.1 Rationale for AHR Mutant Lines Agonist binding to the AHR results in degradation of the receptor following DNA binding, but not of the complex’s component s: ARNT, XAP2, p23, or Hsp90 (Cioffi et al., 2002; Giannone et al., 1998; Pollenz, 2002; Roman and Peterson, 1998; Roman et al., 1998). While it has been well-established th at the AHR is targeted for degradation following ligand activation, the mechanism of this event remains unclear (Dale and Eltom, 2006; Davarinos and Pollenz, 1999; Giannone et al., 1998; Ma, 2007; Ma and Baldwin, 2000; Ma et al., 2000; Morales and Perdew, 2007; Ohtake et al., 2007; Poland and Glover, 1988; Pollenz, 2002; Pollenz, 2007; Pollenz and Dougherty, 2005; Pollenz et al., 2005; Song and Pollenz, 2002; Song and Pollenz, 2003; Wentworth et al., 2004). Following TCDD binding, the AHRb-1 is rapidly depleted by 80-95% within 4-6 hours of treatment in numerous cell culture models and does not return to basal levels as long as ligand is present in the media (Pollenz, 1996; Reick et al., 1994). This degradation is even more rapid with the Ahb-2, human or rat receptors, de pleting by 90-100% within 2 hours of treatment (Pollenz and Dougherty, 2005). In either case, this degradation has been demonstrated to occur via the 26S prot easome complex since pre-treatment with the

PAGE 107

89 proteasome inhibitors MG-132 or lactacystin prior to treatment w ith agonist blocks degradation of the receptor, while pre-treatm ent with inhibitors of calpain, serine, or cysteine proteases or lysosomal proteases does not inhibit the degradation response (Davarinos and Pollenz, 1999; Ma and Baldwin, 2000; Wentworth et al., 2004). Furthermore, ligand-dependant degradation can also be blocked by pre-treatment with the transcription inhibitor actinom ycin D (AD) or the translat ion inhibitor cycloheximide (CHX) without affecting nuclear localizati on or DNA binding of the receptor, suggesting that both active transcription and translation are necessary for ligand-induced degradation of the AHR (Pollenz et al., 2005). A summary of the potential path ways leading to AHR degradation is given in Figure 3.1. Thus, it was pertinent to assess whethe r ligand-induced degradation of the AHR, which appears to require active transcription and translation, required active transcription of the AHR•ARNT complex itself. If DNA binding is necessary for degradation of the receptor by the agonist-dependent pathway, th an mutations or truncations of the DNA binding domain should impact the ability of the receptor to be degraded. Similarly, if a region responsible for dimerization with ARNT were mutated, DNA binding would be prevented by loss of ARNT heterodimeriza tion and should impact degradation of the receptor. To formally investigate the impact that DNA binding and ARNT dimerization mutations would have on the degradation of the AHR, and whether the differences in degradation were due to the re ceptor itself or other cellular factors, stable lines were generated exploiting the LA-I, AHR deficient cells as described in Chapter Six The use

PAGE 108

90

PAGE 109

91 Figure 3.1: Schematic of the AHR liga nd-dependent and ligand-independent degradation pathways. In brief, ligands such as halogenated aromatic hydrocarbons (HAHs), polychlorinated biphenyls (PCBs), polyaromatic hydrocarbons (PAHs) enter a cell, bind to the AHR complex leading to a c onformational change of the receptor, which then translocates to the nucleus and he terodimerizes with ARNT. The AHR•ARNT complex then associates with xenobiotic re sponse elements with the core sequence 5’T(T/A)GCGTG to regulate phase I and phase II metabolizing enzymes, typified by CYP1A1. The AHR is then ta rgeted for degradation via the 26S proteasome in the nucleus (Roberts and Whitelaw, 1999), but degr adation can also occur following nuclear export via CRM-1 (dashed line; Davarinos a nd Pollenz, 1999). In ligand-independent degradation, hsp90 inhibitors such as geldanamycin and radicicol bind to Hsp90, resulting in nuclear accumulation of the AHR and subsequent degradation via the 26Sproteasome without DNA binding or ARNT di merization (Chen et al., 1997); however, this degradation is independent of nuclear import and can occur in the cytoplasm (dashed line; Song and Pollenz, 2002). Note that wh ile ligand-dependant degradation can be blocked by pre-treatment with the transcription inhibitor actinomycin D (AD) or the translation inhibitor cycloheximide (CHX), degradation of the AHR via GA cannot be blocked by treatment with either AD or CHX (Pollenz et al., 2005).

PAGE 110

92 of a genetically identical b ackground to examine the function and degradation rate of the mutant receptors in comparison with the wild-type AHRb-1 provided significant insights into these questions. 3.2 Generation of LA-I Lines Expressi ng AHR DNA Binding Mutants and ARNT Dimerization Mutants The first step in these studies was the evaluation of potential sites for mutation or truncation in the AHR that w ould disrupt DNA binding or ARNT dimerization as desired. The AHR basic domain spans amino acid resi dues 13-39 and appears to make 2 amino acid base contacts with DNA using tyrosine 9 and arginine 39 (Bacsi and Hankinson, 1996; Fukunaga et al., 1995). Based on this da ta, a construct was generated in which the amino-terminal portion of the AHR was truncat ed resulting in the loss of the first 40 amino acids (trAHR). This construct was ge nerated and stably integrated into the LA-I line as described in Chapter Six Additionally, a second construct was generated in which the AHR arginine 39 residue was mutated to an alanine, which has previously been shown to reduce the DNA binding potential of the AHR to approximately 11% versus wild-type receptor (B acsi and Hankinson, 1996; Figure 3.2). For the ARNT dimerization mutants, a construct which had previously b een evaluated by this la boratory (Pollenz and Barbour, 2000) was used, wherein two leucin e residues within a portion of the spacer region between the PAS-A and PAS-B domain s of the AHR, thought to contain a second nuclear export site (NES), were mutated to al anines leading to an inability to dimerize with ARNT (AHR-L69/71A, referred to as AHR NES; Figure 3.2).

PAGE 111

93 Figure 3.2: Schematic of AH R mutations for R39A and NES AHR mutant stable lines. AHR protein domain schematic indica ting the amino acid positions of the mutagenized residues and the lo cations of the characterized domains. Thin horizontal lines indicate functional doma in regions. NLS, nuclear localization sequence; NES, nuclear export sequence; bHLH, basichelix-loop-helix; PAS, PER/ARNT/SIM homology regions; PAC, PAS-associated c-term inal region; TAD, tr ansactivation domain; P/S/T-rich, proline, serine and threoninerich sequence. Numbers underneath represent amino acid positions. Note that while the Ahb-1 receptor is shown as an example, the R39 and the L69/71 are conserved among all characterized murine AHR alleles.

PAGE 112

94 Constructs were then tested by transient tr ansfection into the AHR-deficient LA-I Hepa-1 variant or in PT67 viral pack aging cells, then analyzed by SDS-PAGE and evaluated by Western blotting (Figure 3.3 A and B). West ern analysis also validated that the molecular mass of each protein was correct. Following transfection of viral packaging cells, viral media was collected and used to infe ct target cells and stable lines surviving a two-week selection in neomycin were then an alyzed for expression of the target genes by SDS-PAGE and Western blotti ng (Figure 3.3 C and D). Stable lines expressing the trAHR, the R39A, and the NES AHR proteins were then selected and those that expressed the receptor to the sa me physiological level as the AHRb-1 in WT Hepa-1 cells were chosen for future study. Total cell lysates of each stable line revealed no differences in total cellular levels of AHR, AR NT or Hsp90 (Figure 3.4). Note that while the cellular content of the trAHR line is not shown, no differences were observed. 3.3 Characterization of AHR Mutants Deficie nt in DNA Binding and ARNT Dimerization Stable cell lines expressing the trAHR were then treated with TCDD for 0, 1, 2, 4, or 6 hours and total cell lysates harvested, assayed for total pr otein content, and evaluated by SDS-PAGE and Western blotting for leve ls of AHR, CYP1A1, and actin. Results from a representative experiment are give n in Figure 3.5. However, there was no apparent difference in the rate of degradation between the AHRb-1 and the trAHR receptors when expressed in Hepa-1, sugge sting that DNA binding of the AHR was not relevant to the ability of the liganded r eceptor to undergo degradation. However, the trAHR, which was localized to the cytopl asm as expected, continued to become predominately nuclear in the presence of ligand, even though the NLS was removed in

PAGE 113

95 Figure 3.3: Western analysis of AHRtr, R39A, and NES AHR mutants. Equal amounts of total cell lysates from i ndependent samples were resolved by SDS-PAGE, blotted, and stained with A-1A rabbit IgG (1.0 g/ml) and -actin rabbit IgG (1:1000). Reactivity was visualized by ECL with GAR-HRP IgG (1:10,000). A, LA-I cells transiently expressing the AHRtr compared to WT cells endogenously expressing the Ahb-1 receptor. B, PT67 cells transiently stably expressing the R39A or NES receptor compared to several AHR controls. C, D, St able line analysis of the AHRtr, R39A, and NES AHR constructs. Arrows indicate examples of clones us ed for subsequent analysis based on similar expression levels of the AHR in WT Hepa-1 cells.

PAGE 114

96 Figure 3.4: Western analysis of R39A and NES AHR mutant stable lines. Stable cell lines expressing the R39A AHR, the NES AHR, and the wild-type AHR (A3) were generated as detailed in Chapter Six. Equal amounts of total cell lysates from LA-I, Hepa-1 (WT), NES, R39A, or A3 cells were resolved by SDS-PAGE, blotted, and stained with A-1A rabbit IgG (1.0 g/ml), -actin rabbit IgG (1:1000), or hsp90 rabbit IgG (1:500). Reactivity was visualized by ECL with GAR-HRP IgG (1:10,000).

PAGE 115

97 Figure 3.5: Time course of liga nd-induced degradation of AHRWT and trAHR A, The indicated cell lines we re treated with 0.5% Me2SO (time 0 control), or TCDD (5nM) for the indicated times (hr) at 37C. Dosi ng was staggered so that all cells were harvested at the same time. Equal amounts of total cell lysates were resolved by SDSPAGE, blotted and stained with A-1A anti-AHR IgG (1.0 g/ml), anti-P450 (1:750) and antiactin (1:1000). Reactivity was visualized by ECL with GAR-HRP (1:10,000). B, The level of AHR protein at each time point was divided by the corresponding level of actin for normalization purposes and the aver age S.E. of the three independent samples plotted as a function of the ve hicle control cells (100%).

PAGE 116

98 the truncation and this remova l confirmed by DNA sequencing an alysis (data not shown). Thus, the truncated AHR did not appear to be functioning as expected. However, the trAHR did appear to be unable to induce CYP1A1 protein in th e presence of ligand (Figure 3.5). Since the trun cation of 40 amino acids from the NH-terminus of the AHR could be affecting the folding of the AH recepto r or the interaction of the AHR with other proteins, leading to seemingl y confounding data, an altern ate approach was taken to evaluate the degradation of a full-length AHR deficient in DNA binding. For this approach, an AHR construct wa s generated in which the arginine 39 residue was mutated into an alanine (R39A) as previously described. As before, the functional ability of the R39A mutant was characterized and the degradation pattern assessed. Since the R39A mutant had alre ady been thoroughly characterized in its deficiency to bind DNA when coexpressed with ARNT and treated with TCDD (Bacsi and Hankinson, 1996), studies were initiated to confirm the lack of function in vivo by evaluating the ability of the R39A stable line to induce CYP1A1 following treatment with TCDD. A representative experiment is given in Figure 3.6. Similar to the trAHR construct, the absence of CYP1A1 induction in Hepa-1 cells stably expressing the R39A AHR following 6 or 16 hrs of TCDD treatment i ndicates the inability of the mutant AHR to bind DNA. Since this study only evaluated th e ability of either construct to induce a single gene, studies were initia ted to further support the hypot hesis that neither the R39A nor the NES AHR constructs were able to functi on in target gene induction,. For these studies, stable lines expressing th e wild-type AHR, the R39A, or the NES AHR constructs were transfected with the XRE c ontrolled GudLuc 1.1 luciferase reporter and pSV-Galactosidase as detailed in Chapter Six A representative experiment is given in

PAGE 117

99 Figure 3.6: Overday or overnight ligand-indu ced degradation of the AHRwt, R39A, or NES stable lines The indicated cell lines were treated with 0.5% Me2SO (time 0 control), or TCDD (5nM) for 6 (+) or 16 hours (++) at 37C. Dosing was staggered so that all cells were harvested at the same time A, Equal amounts of total cell lysates were resolved by SDS-PAGE, blotted and st ained with A-1A anti-AHR IgG (1.0 g/ml), antiP450 (1:250; Santa Cruz) and antiactin (1:1000). Reactivity was visualized by ECL with GAR-HRP (1:10,000). B, Computer densitom etry was used to determine the relative level of AHR protein present in the Me2SO or TCDD samples presented on the blot in A for the AHRWT and R39A stable lines. The level of AHR present was normalized to the level of actin and each column represents the relative densitometry units of an individual band and shows that the degrad ation of the R39A AHR is mi nimal compared to wild-type AHR.

PAGE 118

100 Figure 3.7. While stable line s expressing the wild-type AH R were capable of inducing very high levels of luciferase activity fo llowing TCDD treatment, neither the R39A nor the NES lines were capable of driving lucife rase expression above that of the AHRdeficient LA-I parental line. Indeed, thes e lines exhibited TCDDdependent luciferase activity that was >40-fold lower than th at of the lines expr essing wild-type AHR. However, unlike the trAHR, the R39A AHR remained predominately cytoplasmic and exhibited nuclear accumulation only following 1 hr of TCDD treatment (Figure 3.8). Since the R39A AHR should be capable of di merizing with ARNT, it is expected that such a nuclear accumulation should occur in the presence of TCDD. Interestingly, the NES lines appeared to express a receptor th at was predominately nuclear even in the absence of TCDD (Figure 3.8 middle panels). However, since association of the AHR with XAP2 appears to require the PAS B/lig and binding domain of the AHR (Meyer and Perdew, 1999), which partly overlaps with the sequence removed in the NES construct, it is possible that the NES AHR would exhibit a reduced association with XAP2, and would therefore be capable of shuttling through the nucleus as seen with the Ahb-2 receptor in Chapter Two However, this hypothesis has not yet been tested. To confirm that the R39A AHR remained capable of dimerizing with ARNT and to further confirm that the NES AHR could not, cytosol was prepared from R39A or NES cell lines treated with 0.5% Me2SO or 10 M TCDD and subjected to immunoprecipitation analysis using an ti-AHR antibodies as detailed in Chapter Six (Figure 3.9). In th ese studies, ARNT was specifically immunoprecipitate d in the TCDD treated R39A cell lines and failed to precipitate with AHR antibodies in the Me2SO treated samples or when pre-immune anti bodies were used. Furthermore, cytosol

PAGE 119

101 Figure 3.7: Analysis of TCDD-induced luciferase activity in LA-I, AHWT, R39A, and NES stable lines. The indicated cell lines we re transfected with pSV-Galactosidase along with GudLuc 1.1 and treated with Me2SO (0.5%) or TCDD (5nM) for 6 hours. Luciferase activity and -Galactosidase activity were measur ed as previously described in Chapter Six and (Zeruth and Pollenz, 2007). All luci ferase values were normalized to Galactosidase.

PAGE 120

102 Figure 3.8: Subcellular localization of the NES and R39A AHR Cells were grown on glass coverslips, exposed to Me2SO (0.5%) or TCDD (5nm) for 1 hr and then fixed as detailed in Chapter Six Coverslips were incubated with anti-AHR A-1 IgG (2.8 g/ml) and visualized with GAR-RHO IgG (1:400) The top row shows control LA-I, NES, or the R39A stable lines exposed to Me2SO. The bottom row shows those cells exposed to TCDD (5nM) for 1 hour (+). Each set of pa nels was exposed for identical times.

PAGE 121

103 Figure 3.9: Immunoprecipitation anal ysis of ARNT association in NES and R39A stable lines Cytosol was prepared from NES and R39A lines treated with 0.5% Me2SO (-) or 10uM TCDD (+) as detailed in Chapter Six 800 g of cytosol was precipitated with either high a ffinity anti-AHR A-1A IgG (5 g; A) or affinity pure preimmune rabbit IgG (5 g; Pi) along with protein A-G ag arose (25ul) for 2.5 hours at 4C with rocking. Pellets were washed 3 tim es for 5 minutes each with TTBS supplemented with sodium molybdate (20mM) and then boiled in 30ul SDS sample buffer. 15 g cytosol (input) or 15ul of th e eluted protein were resolv ed by SDS-PAGE, blotted, and stained for ARNT (R1 IgG at 1 g/ml). Reactivity was measured by ECL with GAR-HRP (1:10,000). A, precipitated with ARNT; Pi, precip itated with pre-immune IgG. Note the precipitation of ARNT in the treated R 39A samples that is absent in the NES samples. The precipitated IgG band is shown to dem onstrate the uniformity of the precipitation across all samples.

PAGE 122

104 prepared from 0.5% Me2SO or 10 M TCDD NES stable lines confirmed the lack of ARNT dimerization in this mu tant since ARNT was not co-p recipitated with the AHR in any sample type (Figure 3.9). Thus, wh ile the R39A AHR remained capable of associating with ARNT, the mutant receptor failed to function in CYP1A1 induction, while the NES AHR was neither capable of di merizing with ARNT or binding DNA. Additionally, cytosolic and nuc lear extracts prepared fr om the wild-type, R39A or NES stable lines treated with 0.5% Me2SO or 10nM TCDD revealed that while the AHR and ARNT co-accumulated in nuclear extr acts of cell lines expressing the wild-type AHR, in cells expressing AHR proteins de ficient in DNA binding or ARNT dimerization, ARNT failed to accumulate in nuclear extrac ts following TCDD treatment (Figure 3.10). While ARNT is a nuclear protein, in its latent state, ARNT is not tightly associated with nuclear structures and theref ore has a tendency to “leak” fr om nuclear extracts into the cytosolic compartment (Pollenz et al., 1994). T hus, this lack of nuclear accumulation is a result of the failure of ARNT to be recrui ted to bind DNA rather than being indicative of nuclear ARNT. Taken together, the collectiv e results shown in Fi gures 3.4-3.8 reveal that the R39A and NES stable lines express Ah receptor that is deficient in either DNA binding (R39A) or ARNT dimerization ( NES), but in each case remains otherwise functional. Thus the ability of the AHR r eceptor to be degraded under these conditions can now be examined. 3.4 Ligand-Dependent Degradation of the AHR Requires DNA Binding To initially examine the degradation profile of these constructs stable cell lines expressing the R39A or NES mutation were treated for 6 or 16 hours with TCDD and

PAGE 123

105 Figure 3.10: Analysis of accumulation of AHR and ARNT in cytosolic and nuclear extracts from AHWT, R39A, and NES stable lines. The indicated stable cell lines were treated with Me2SO (0.5%; -) or TCDD (10nM; +) fo r 1 h at 37C. Cytosolic (C) and nuclear extracts (N) were prepared as detailed in Chapter Six. Equal amounts of the indicated cytosolic and nuclear extracts were combined with 2X gel sample buffer and resolved by SDS-PAGE, blotted and st ained with anti-AHR A-1A IgG (1.0 g/ml) or antiARNT R1 IgG (1.0 g/ml). Reactivity was visualized by ECL with GAR-HRP (1:10,000). The bold arrow on the bottom indicates the accumulation of both AHR and ARNT in the nuclear extracts from TCDD treated AHRWT cells.

PAGE 124

106 the resulting protein levels analyzed by SD S-PAGE and Western bl otting and compared to those seen in the AHWT line (Figure 3.11). Interestingly, neither line exhibited >30% degradation of the AHR at eith er 6 or 16 hours. To confirm this lack of degradation, 4 and 5 hour time points of TCDD treatment we re also examined with neither point exhibiting >30% reduction in AHR (data not show n). Taken together, this suggests that the DNA-binding event is itself necessary for ligand-induced degradation of the AHR and by preventing DNA binding either directly or by inhibiting dimerization with ARNT, the ability of the AHR to degrade is limited. Since a modest level of degradation of the AHR was seen in both the R39A and NES lines in the presence of TCDD, it was al so pertinent to assess the mechanism of this degradation and whether this small leve l of degradation was occurring in a liganddependent manner similar to loss of the wild-t ype AHR; albeit to a lesser magnitude. To determine if this small loss of mutant recep tor was occurring via th e ligand-dependant or ligand-independent pathway, further studies were performed using actinomycin D (AD), a known blocker of ligand-induced degrada tion of the AHR (Pollenz et al., 2005). Interestingly, the 30% loss of the mutant AHR proteins exhibite d in the presence of TCDD was unable to be blocked by pretreatment of cells wi th AD prior to dosing with TCDD in either the NES or R39A line (results for R 39A not shown), though neither was it able to fully block degradation in the AHWT line, which still exhibited a >15% loss of receptor (Figure 3.11). Thus, while th e minimal loss of the receptor in the NES and R39A occurred in a ligand-dependent manner, it did not appear to be occurring via the same ligand-induced mechanism seen in the AHWT line. However, this assessment is difficult since pretreatment with AD did not co mpletely inhibit degradation of the AHR

PAGE 125

107 Figure 3.11: Impact of actinomycin D on TCDD-induced degradation of AHRwt and NES stable lines. Indicated cell lines (AHRwt, top; or AHR NES, bottom) were treated normally with 0.5% Me2SO (CON) or TCDD (5nM) for 4 hours (TCDD), with the AD (0.3uM) inhibitor for 5 hours (AD), or pre-treated with AD for 1 hour followed by treatment with TCDD (5nM) for an additional 4 hours (AD/ TCDD). A, Equal amounts of total cell lysates were resolved by SDS-PAGE, blotted and stained with A-1A anti-AHR IgG (1.0 g/ml) and antiactin (1:1000). Reactivity was visualized by ECL with GAR-HRP (1:10,000). B, Computer de nsitometry was used to determine the relative level of AHR protein present in the each sample treatment type presented on the blot in A for the AHRWT and NES stable lines. All AHR levels were normalized to actin controls.

PAGE 126

108 in the AHWT line, and, therefore, the low leve l of degradation seen in the AHWT line may be occurring by the same mechanism of that of the AHR in the NES and R39A lines. 3.5 Ligand-Independent Degradation of th e AHR Does Not Require DNA Binding Ligand-independent degradation of the AHR is typified by treatment with geldanamycin (GA), a benzoquinone ansamyci n capable of binding to the ATP-binding pocket of Hsp90 and thereby likely altering the conformation of the Hsp90 associated AHR to allow for nuclear translocation of th e receptor and its s ubsequent degradation without disruption of the AHR complex itsel f and, importantly, without DNA binding or subsequent gene induction (C hen et al., 1997; Meyer et al., 2003b; Song and Pollenz, 2002). This pathway is characterized by a rapid and robust degrad ation profile (>80% within 1 hour) that also appears to occur vi a the 26S proteasome and can be blocked by MG-132 or lactacystin (Song and Pollenz, 2002). Additionally, degradation of the AHR via GA cannot be blocked by treatment with either AD or CHX, suggesting that multiple mechanisms exist for the degradation of th e receptor, though both terminate at the 26S proteasome (Pollenz et al., 2005). Since ligand-independent de gradation of the AHR induced by GA results in degradation of the AHR without DNA bindi ng, it was expected that AHR protein deficient in DNA binding or ARNT dimerization would continue to exhibit the same time course and magnitude of GA-induced degrad ation as wild-type receptor. Thus, AHWT, R39A, and NES stable lines were treated with 200uM GA for 0, 60, or 120 min and the level of AHR protein assessed and compared to that of Hepa-1 lines endogenously expressing the Ahb-1. Results from a typical experiment are presented in Figure 3.12. In

PAGE 127

109 Figure 3.12: Geldanamycin-induced degrad ation of wild-type Hepa-1 cells, AHWT, R39A, or NES stable lines The indicated cell lines were treated with 0.5% Me2SO (time 0 control), or Geldanamycin (200nM) for 60 or 120 min at 37C. Dosing was staggered so that all cells were harvested at the same time. A, Equal amounts of total cell lysates were resolved by SDS-PAGE, blot ted and stained with A-1A anti-AHR IgG (1.0 g/ml) and antiactin (1:1000). Reactivity was visualized by ECL with GAR-HRP (1:10,000). B, Computer densitometry was used to determine the re lative level of AHR protein present in the each sample treatment type presented on the blot in A for the Hepa1, AHRWT, R39A and NES stable lines. All AHR levels were normalized to actin controls. Hepa-1, grey diamonds; AHRWT, open circles; NES, black triangles R39A, white squares.

PAGE 128

110 contrast to the minimal de gradation of the R39A or NES AHR in the presence of TCDD, in the presence of GA, the R39A and NES AHR proteins exhibited a similar time course and magnitude of degradation over 120 minutes in a ligand-independent manner. As expected, total AHR levels in all cell types were redu ced by >70% within 60 min and by nearly 100% within 120 min (Figur e 3.12). The similarity of both the time course and magnitude of this degradation in the absence of TCDD suggests that the ligand-independent mechanism of AHR de gradation induced by GA remains intact regardless of the ability of the receptor to f unction as a transcription factor. Therefore, GA-induced degradation of the AHR does not appear to require DNA binding of the AHR. Furthermore, these studies indicate that the lack of degradation of the AHR in the R39A and NES is not a result of an inability of the mutant AHR to be degraded. 3.6 Impact of NH-Terminal Tags on AHR Degradation During the creation of stable lines ex pressing amino-terminally tagged AHR proteins to be used in another set of studies it became apparent that the presence of these tags was altering the degrada tion rate of the AHR followi ng ligand binding. Figure 3.13 and 3.14 illustrates the sc hematic of the tagged AHR proteins as well as their expression levels in several cell lines stab ly expressing the untagged AHR (AHWT), His Max tagged AHR (HMAHR; a Hexahistidine tag with Xpre ss epitope), or GFP-tagged AHR (GFPAHR; green fluorescent protein), which were generated as detailed in Chapter Six After dosing these lines, or other independe nt stable lines expressing either tagged AHR, with TCDD for 0, 2, 4, 6, 8 or 16 hours, the amino-term inally tagged AHR proteins exhibited a marked reduction in the overall level of de gradation when compared to stable lines

PAGE 129

111 Figure 3.13: Invitrogen plasmid maps for generating constructs with NH-terminal tags. Target genes are expressed from the cy tomegalovirus immediate early (CMV IE) promoter and the plasmids contain both neom ycin (G418) and ampicillin resistance used for antibiotic selection in euka ryotic and prokaryotic cells re spectively. Top: Constructs were generated with NH-terminal EYFP tags by cloning products in frame with the EYFP sequence present on the EYFP fusion vector Bottom: Constructs were generated with NH-terminal HisMax tags by TOPO cloning products in frame with the 6xHis/Xpress sequence present on the pcDNA 4/ HisMax vector. Vect ors were obtained from the manufacturer (Invitr ogen; Carlsbad, California).

PAGE 130

112 expressing the untagged AHR (Fi gure 3.15). Indeed, while the AHWT exhibited an approximately 70-80% reduction in total AHR levels following 6 hours of TCDD TCDD treatment, which appeared to recover to n early time 0 levels by 16 hours, indicating a lesser magnitude of degradati on for these receptor types. Interestingly, while the overall magnitude of degradation in the HMAHR and GFPAHR lines was reduced compared to untagged AHR, these receptors exhibited a gr eater level of degradation following TCDD treatment than the non-functi onal AHR mutants (R39A and NES), and maintained the ability to induce CYP1A1 to nearly the sa me level as wild-type AHR (Figure 3.16). Thus, the magnitude of ligand-induced degrad ation of the AHR can be affected without creating non-functional AHR types and functional ability of the receptor is not the sole determinant for AHR degradation. Furthermore, treatment with GA reveal ed no difference in the time course or magnitude of the degradation of the AHR in lines expressing the untagged AHR, the HMAHR, or the GFPAHR with all three lines exhibiti ng a >80% reduction in total AHR levels after 120 min of GA-treatment, similar to the results obtained in the previously detailed studies (Figure 3.17). These result s again indicate a different mechanism for the ligand-induced and ligand-indepe ndent degradation of the AHR and further suggest that the mechanism for ligand-independent degrad ation may have little to do with the AHR itself, since numerous AHR c onstructs differing in size a nd in functional ability all exhibit similar magnitudes of GA-induced degradation.

PAGE 131

113 Figure 3.14: Characterization of HM and GFP-tagged AHR stable lines. A, Schematic showing location and size of the HisMax and GFP tags. B, Equal amounts of total cell lysates from independent clones were resolved by SDS-PAGE, blotted, and stained with A-1A anti-AHR ra bbit IgG (1.0 g/ml) and anti-actin rabbit IgG (1:1000). Reactivity was visualized by ECL with GAR -HRP IgG (1:10,000). LA-I, mutant Hepa-1 cells deficient in AHR expression ; WT, wild-type Hepa-1 cells; AHWT, LA-I clones stably expressing the Ahb-1 receptor; HMAH, LA-I clones stably expressing the HisMax tagged AHR; GFPAH, LA-I clones stably expressing the GFP tagged AHR. Note that each lane represents an independent clone.

PAGE 132

114TCDD exposure (hours)Normalized AHR Protein (% of time 0) TCDD Exposure (hr) AHRWT HMAHRGFPAHR 024816 AHR Actin AHR Actin AHR Actin 80 60 40 20 0 100 024681012 1416 AHRWT HMAHRGFPAHR A B Figure 3.15: Ligand-induced AHR degradatio n in HMand GFP-tagged AHR stable lines. A, Stable cell lines expressing the unt agged AHR, the HisMax tagged AHR, or the GFP-tagged AHR were dosed with Me2SO (0.5%, time 0 control) or 10 nM TCDD for 2, 4, 6, 8 or 16 hours. Equal amounts of total cel l lysates from independent samples were resolved by SDS-PAGE, blotted, and stained with A-1A anti-AHR rabbit IgG (1.0 g/ml) and anti-actin rabbit IgG (1:1000). Reactivity was visualized by ECL with GAR-HRP IgG (1:10,000). B, The amount of AHR pr otein at each time point was analyzed by computer densitometry of the bl ots shown in A as detailed in Chapter Six Results were normalized to the level of actin and are expre ssed as the percentage of protein seen at time 0 SEM. AHWT, LA-I clones stably expressing the Ahb-1 receptor; HMAH, LA-I clones stably expressing the HisMax tagged AHR; GFPAH, LA-I clones stably expressing the GFP tagged AHR. Note that each lane represents an independent clone. treatment, both the HMAHR and GFPAHR exhibited a nadir of 42% AHR after 4 hours of

PAGE 133

115 Figure 3.16: Ligand-induced CYP1A1 induc tion in HMand GFP-tagged AHR stable lines. A, Stable cell lines expressing the untagged AHR (A), the HisMax tagged AHR (H), or the GFP-tagged AHR (G) were dosed with Me2SO (0.5%, time 0 control) or 10 nM TCDD for 2, 4, 8 or 16 hours (+). Equal amounts of total cell lysates from independent samples were resolved by SDS-PAGE, blotted, and st ained with A-1A antiAHR rabbit IgG (1.0 g/ml), anti-CYP1A1 IgG (1:750) and anti-actin rabbit IgG (1:1000). Reactivity was visualized by EC L with GAR-HRP IgG (1:10,000). B, The amount of CYP1A1 protein after TCDD treatment was analyzed by computer densitometry of the blots shown in A as detailed in Chapter Six Results were normalized to the level of actin and are expressed as the percentage of protein compared to the untagged AHR control.

PAGE 134

116 GA Exposure (min) Normalized AHR Protein (% of time 0) 0 0306090120 20 40 60 80 100 AHR GFP-AHR HM-AHR AHR GFPAHR HMAHR AHR Actin 306090 0120 GA Exposure (min) AHR AHR Actin ActinA B Figure 3.17: Geldanamycin-induced degradation of the HMand GFP-tagged AHR The indicated cell lines we re treated with 0.5% Me2SO (time 0 control), or Geldanamycin (200nM) for 30, 60, 90 or 120 min at 37C. Dosi ng was staggered so that all cells were harvested at the same time. A, Equal amount s of total cell lysates were resolved by SDSPAGE, blotted and stained with A-1A anti-AHR IgG (1.0 g/ml) and antiactin (1:1000). Reactivity was visualized by ECL with GAR-H RP (1:10,000). B, Comp uter densitometry was used to determine the relative level of AHR protein present in the each sample treatment type presented on the blot in A. All AHR levels were normalized to actin controls.

PAGE 135

117 Chapter Four Functional Analysis of ARNT2 in AHR-mediated Signal Transduction 4.1 Rationale for Evaluating ARNT2 Function ARNT is a member of the basic-helix loop-helix PER/ARNT/SIM (bHLH/PAS) protein family that is involved in me diating numerous developmental and response pathways (Crews, 1998; Furness et al., 2007; Ke wley et al., 2004). Several isoforms of ARNT have been identified in mammalian and aquatic species and are termed: ARNT (HIF-1B), ARNT2, ARNT3 (BMAL1, ARNTL 1, MOP3, JAP3), and ARNT4 (BMAL2, ARNTL2, MOP9). ARNT and ARNT2 posse ss a 95% amino acid identity within the bHLH and >80% amino acid identity PAS A and B domains that are known to be involved in DNA binding and he terodimerization (Pongratz et al., 1998; Reisz-Porszasz et al., 1994). ARNT appears to be ubiquit ously expressed in near ly all cell types in various species (Abbott, 1995; Aitola and Pelto-Huikko, 2003; Hirose et al., 1996; Holmes and Pollenz, 1997; Kozak et al., 1997; Sojka et al., 2000), while ARNT2 was initially classified a being expressed primarily in the br ain and kidney (Hirose et al., 1996). However, while ARNT is known to have a more ubiquitous expression pattern than ARNT2, mRNA for the two genes is co-expressed to some degree during mouse development and in most adult tissues (Aito la and Pelto-Huikko, 2003). It is interesting, therefore, that gene knock-out of either ARNT or ARNT2 in mice, results in embryonic

PAGE 136

118 or perinatal lethality that is characterized by distinct phenotypes (Keith et al., 2001; Kozak et al., 1997; Maltepe et al., 1997). Th ese findings have led to the hypothesis that the ARNT and ARNT2 proteins have distin ct functions in the presence of various dimerization partners and are not fully capable of complementing each other, despite the high level of amino acid identity. But wh ile much is known about the expression of ARNT at the protein level and its ability to dimerize with various bHLH/PAS partners, the level of ARNT2 protein expression in cells and tissues and well as its interactions with other proteins are less defined (Crews 1998; Furness et al., 2007; Kewley et al., 2004; Reisz-Porszasz et al., 1994) (See Chapter One ). Unfortunately, the limited number of studi es that have evalua ted biochemical and molecular differences in ARNT and ARNT 2 function and whether they compete for dimerization partners report conflicting result s (Hirose et al., 1996; Sekine et al., 2006). In addition, there are no studies that have evaluated the co-expression of ARNT and ARNT2 protein in cell lines or tissues. In an effort to address th ese questions, studies were initiated to investigate the ability of defined concentrations of ARNT and ARNT2 to interact with the AHR and bind DNA in vivo and in vitro and to isolate model systems in which both proteins were expressed physiologically. 4.2 ARNT2 Does Not Function to the Same L evel as ARNT in AHR-Mediated Signaling It has been reported that in comparison with ARNT, the ARNT2 isoform exhibits a reduced ability to complement AHR signaling in the induction of XRE driven luciferase reporter activity in response to treatment w ith 3-Methylcholanthrene (3-MC) (Sekine et al., 2006). To directly compare the ability of ARNT2 to substitute for ARNT in AHR-

PAGE 137

119 mediated signaling of an endogenous gene (CYP1A1), seve ral ARNT/ARNT2 constructs were prepared. Initially, ARNT and ARNT2 full length cDNAs were cloned into either pcDNA 3.0(-) with or without a V5 epitope ta g at the NH-terminal of the full length ARNT or ARNT2 protein (Figure 4.1). Si nce antibodies raised against ARNT and ARNT2 are differently specific, the presence of a common NH-terminal tag allowed each ARNT to be detected with the same specificity by the same antibody. These constructs were then transiently transfected into the LA-II ARNT deficient cell line and their ability to complement the defect in these cells was analyzed. To determine whether or not each ARNT was able to form a DNA binding specie s with AHR capable of transactivation of XRE controlled genes, lucifera se reporter studies were comp leted using these constructs. In this case, the ARNT or ARNT2 lines we re transfected with an XRE controlled luciferase reporter construct along with -galactosidase, a transfecti on efficiency control. Results from a typical experiment are show n in Figure 4.2. In these experiments, LA-II cells transfected with naked vector were unable to complement AHR-mediated signaling in response to TCDD as expected. Additiona lly, when the LA-II cells were transfected with ARNT alone, high basal levels of lucife rase activity were seen that became even greater in the presence of TCDD. However, when mARNT2 was transfected into the LA-II cells, both the basal levels as well as the levels of luciferase activity in response to TCDD were significantly reduced to <17% of those levels se en with ARNT alone. These data indicate that ARNT2 is not as well ab le to complement the defect in the ARNTdeficient line.

PAGE 138

120 Figure 4.1: Protein schematic of V5 -ARNT and V5-ARNT2 constructs. The 14 amino acid V5 epitope (GKPIPNPLLGLDST) was cloned directly 5' to the ARNT sequence onto each of the ARNT protei ns into pcDNA 3.1 (-) downstream of a T7 promoter along with a consensus Kozak seque nce. The original ARNT start codon was removed to prevent possible transcription of a clam ARNT lacking the V5 tag.

PAGE 139

121 Figure 4.2: Analysis of TCDD-i nduced luciferase activity in LA-II cells transfected with ARNT or ARNT2. LA-II cells were transfected wi th identical amounts of ARNT or ARNT2 vector and with pSV-Galactosidase along with GudLuc 1.1 and treated with Me2SO (0.5%) or TCDD (5nM) for 6 hours. Luciferase activity and Galactosidase activity were measured as previously described in Chapter Six and (Zeruth and Pollenz, 2007). All luciferase values were normalized to -Galactosidase. LA-II = parental cells transfected with naked vect or; ARNT = LA-II cells expressing V5-ARNT; ARNT2 = LA-II cells expressing V5-ARNT2.

PAGE 140

122 To assess this data on a more physiologi cal scale, it was pertinent to determine whether or not each ARNT was able to fo rm a DNA binding species with AHR capable of transactivation of the endogenous CYP1A1 protein induc tion in response to treatment with TCDD as well as to assess the relative levels of ARNT and ARNT2 in each sample type. Therefore, ARNT and ARNT2 cons tructs possessing a common NH-terminal V5 epitope tag were separately transfected in to LA-II cells, treated with TCDD and the resulting cell lysates analyzed by SDS-PAGE and Western blotting for target protein expression. Representative results are give n in Figure 4.3. As expected, the LA-II cells were unable to induce CYP1A1 protein in resp onse to TCDD; however, they were able to do so when ARNT was reintroduced by tran sfection as has been previously shown (Hoffman et al., 1991; Whitlock and Galeazzi, 1984). In contrast, ARNT2 appeared to be unable to functionally substitute for ARNT during AHR-mediated induction of CYP1A1 protein in response to TCDD even though ARNT and ARNT2 were expressed to similar levels as assessed by computer densitometry quantification of V5 staining. This inefficiency in complementing loss of ARNT was also mimicked when untagged ARNT proteins were used, when AR NT2 was expressed at a greater level than ARNT, and when other AHR ligands were used (EJD, unpublished observations). To confirm that the inability of ARNT2 to substitute for ARNT was not a result of poor transfection efficiency resulting in s ubpopulations of LA-II cells expressing high levels of ARNT2 while others expressed litt le or no ARNT2, yielding an apparent overall similar level of ARNT2 with less apparent CYP1A1 induc tion, immunohistochemistry was performed on samples similar to those us ed in Figure 4.3 A. Resultant microscopy images are given in Figure 4.3 B. In these studies, it is apparent that while ARNT and

PAGE 141

123 Figure 4.3: Induction of CYP 1A1 protein in cells expressing ARNT or ARNT2. A, LA-II cells were transfected with the indicated constructs as detailed in Chapter Six and treated with Me2SO (0.5%) or TCDD (2nM) for 6 hours at 37C. Equal amounts of total cell lysates from triplicate plates were reso lved by SDS-PAGE, blotted and stained with A-1A IgG (1.0 g/ml), anti-V5 IgG (1:500), anti-CYP1A1 (1:200) as well as anti-actin (1:1000). Reactivity was visualized by ECL with GAR-HRP (1:10,000) or GAM-HRP (1:10,000). LA-II = parental ce lls transfected with naked vector; V5-ARNT = LA-II cells expressing V5-ARNT; V5-ARNT2 = LA-II cell s expressing V5-ARNT2. B, LA-II cells were propagated on glass coverslip s and transfected and treated as detailed in A. Fixed slips were stained with anti-ARNT IgG (0.5 g/ml), anti-ARNT2 IgG (0.5 g/ml), or antiCYP1A1 (1:100) and reactivity was visualized using GAR-RHO (1:400) All panels that were stained with the same antibodies were photographed for identical times. ARNT) LA-II cells transfected with ARNT and st ained for ARNT. ARNT+TC CYP) LA-II cells transfected with ARNT, treated with TCDD or Me2SO (CON) and stained for CYP1A1. Arrowheads indicate cells expressing cy toplasmic CYP1A1. ARNT2) LA-II cells transfected with ARNT2 and stained for ARNT2. ARNT+TC CYP) LA-II cells transfected with ARNT2, treated with TCDD or Me2SO (CON) and stained for CYP1A1.

PAGE 142

124 ARNT2 were not transfected with 100% effici ency, a similar percentage of cells were transfected with ARNT2 as was seen with ARNT; however, while th e ability of ARNT transfected cells to induce CYP1A1 in re sponse to TCDD was r obust, no induction of CYP1A1 was seen in any cell in the populat ion transfected with ARNT2. LA-II cells transfected with naked vector showed no apparent staining for ARNT, ARNT2, or CYP1A1 in the presence or absence of TC DD (data not shown). These data further suggest that in cell culture, ARNT2 is not able to substitute for ARNT in the TCDDdependent induction of CYP1A1. To further assess this question independently from transiently transfected cell lines, stable cell lines expressing ARNT or ARNT2 were generated using the ARNT deficient LA-II line as detailed in Chapter Six The creation of these li nes allowed for populations of cells clonally expressing either ARNT or ARNT2, allowing for a comparison of the ability of either protein in function in the AHR mediated induction of CYP1A1 following TCDD treatment. Thus, each cell line was plat ed onto triplicate 35mm cell culture plates, dosed with 0.5% Me2SO or 10nM TCDD for 2, 4, or 6 hr s, harvested, and assessed for total protein content. Identic al amounts of total cellular pr otein were then assessed by SDS-PAGE and Western blotti ng for target protein expres sion relative to wild-type Hepa-1 cells. Results from an experiment are shown in Figure 4.4. In these studies, the Hepa-1 cells endogenously expressing AR NT show a robust induction of CYP1A1 protein at 2, 4 and 6 hrs of TCDD treatment. Similarly, LA -II stable lines expressing ARNT were capable of inducing CYP1A1 prot ein in response to TCDD treatment at all examined time points. While the level of induc tion in this cell lines was lower than that

PAGE 143

125 Figure 4.4: Induction of CYP1A1 protei n in ARNT or ARNT2 stable lines. Equal amounts of total cell lysates from the i ndicated cell lines treated with 0.5% Me2SO or 10nM TCDD for 2, 4, or 6 hrs were resolved by SDS-PAGE, blotted and stained with A1A IgG (1.0 g/ml), anti-V5 IgG (1:500), anti-C YP1A1 (1:200) as well as anti-actin (1:1000). Reactivity was visualized by ECL with GAR-HRP (1:10,000) or GAM-HRP (1:10,000). ARNT, LA-II line stably e xpressing ARNT; ARNT2, LA-II line stably expressing ARNT2.

PAGE 144

126 seen in the Hepa-1 cells, the level of ARNT was also lower. This is expected since a reduction in ARNT can lead to a reduction in CYP1 A1 induction (RSP, unpublished observations). In contrast, cell lines stab ly expressing ARNT2 remained incapable of inducing CYP1A1 at any of the examined time points, confirming that ARNT2 cannot functionally substitute for ARNT in this situation. 4.3 Inability of ARNT2 to Function in the Regulation of CYP1A1 is Not a Result of Proline 352 Within the PAS B motif of all characte rized ARNT2 proteins, there is a proline residue in a position where all characterized vert ebrate ARNT proteins contain a histidine. A recent report has suggested that AR NT2 does not function in AHR signaling in vivo due to the presence of this proline at am ino acid 352 within the PAS B domain of the murine ARNT2 protein (Sekine et al., 2006). This assessment was based on the observation that mutant ARNT containing the homologous proline showed a reduced ability to function in the induc tion of CYP1A1, similar to the results obtained for ARNT2. However, this hypothesis was not examined directly since an ARNT2 construct possessing a histidine substitution was not evaluated for a gain-of-function study. Furthermore, homology modeling places th is residue outside of the central -sheet that is the characterized functional region for the PAS B domain and also suggests that the three-dimensional structure of the ARNT and ARNT2 PAS domains are similar (Figure 4.5 A). Therefore, to directly address whet her this residue is re sponsible for loss of function in ARNT2, mutagenesis was utilized to change the proline at amino acid 352 to a histidine in the V5-tagged ARNT2 cDNA (A RNT2-H). Studies were designed to

PAGE 145

127 Figure 4.5: Induction of CYP 1A1 protein in cells exp ressing ARNT, ARNT2, or ARNT2-H. A, Homology modeling of ARNT a nd ARNT2 PAS domains showing the position of the swapped histidine and prolin e residues within th e PAS B domain of ARNT and ARNT2 prepared by Pandini et al (2007). B, LA-II cells were transfected with the indicated expression constructs as detailed in Chapter Six and treated with DMSO (0.5%) or TCDD (2nM) for 6 hours at 37 C. Equal amounts of total cell lysates from triplicate plates were resolved by SD S-PAGE, blotted and stained with anti-V5 IgG (1:500), anti-CYP1A1 (1: 200) as well as anti-actin (1:1000). Reactivity was visualized by ECL using GAR-HRP (1:10,000) or GAM-HRP (1:10,000). Each lane represents an independent sample. LA-II, parental cells transfected with naked vector.

PAGE 146

128 assess the ability of ARNT2H to restore AHR-mediated induction of the endogenous CYP1A1 gene in the LA-II cell line as detailed for ARNT2 above. The results in Figure 4.5 B show that ARNT, ARNT2 and ARNT2-H we re expressed to sim ilar levels in the LA-II cells, but as before, only cells expr essing ARNT were capable of inducing endogenous CYP1A1. In addition, immunofluor escence microscopy confirmed that all proteins were expressed in the nucleus and only cells expressing ARNT expressed CYP1A1 protein (data not shown). Thus, these studies show that ARNT2 does not appear to function to the same level of ARNT in the induction of the endogenous CYP1A1 gene in cell culture and the lack of function is not due to the presence of a proline at amino acid 352. 4.4 In Vitro Synthesized ARNT and ARNT2 Appe ar to Exhibit Equivalent Ability to Dimerize with the AHR and Bind DNA To determine whether the reduced ability of ARNT2 to complement AHR signaling was occurring at the level of DNA binding, el ectrophoretic mobility sh ift assays (EMSA) were performed using either in vitro translated ARNT or ARNT2 along with mouse AHR (Ahb-1). Equal amounts of ARNT and ARNT2 protein as determined by quantified computer densitometry analysis of Western blotting against the co mmon NH-terminal V5 epitope were mixed with AHR and the sample s incubated in the presence of TCDD or Me2SO for 2 h. Antibodies against ARNT, ARNT2, AHR or pre-immune antibodies were then added to aliquots of the original TCDD-activated samples to supershift specific proteins (Figure 4.6). This technique preven ts proteins specific to the antibody being used from entering the gel matrix as a resu lt of the increased si ze of the antibody-bound

PAGE 147

129 Figure 4.6: Schematic for evaluation of DNA binding potential of ARNT and ARNT2 using in vitro synthesized and activated samples. In vitro synthesized V5ARNT, V5-ARNT2, and AHR were produced as detailed in Chapter Six and a portion of each sample was denatured and evaluated for ARNT, ARNT2, or AHR protein by Western analysis using either anti-V5 IgG (1:500) or A-1A anti-AHR IgG (1ug/ml) and visualized by ECL with GAM-HRP IgG (1:10,000; V5) or GAR-HRP IG (1:10,000; AHR). The intensity of the re sultant bands from the Wester n analysis were quantified by computer densitometry as detailed in Chapter Six and equal amounts of either ARNT protein were combined with unprogrammed reticulocyte and AHR protein and incubated in the presence of DMSO (0.5%, vehicle) or TCDD (100 nM, ligand) for 2 h at 30C. Following activation, aliquots of each sample were combined with EMSA sample buffer and antibodies as described in Chapter Six and in figure legends. These aliquots were then subjected to both EMSA and further Western analysis.

PAGE 148

130 protein complex. The formation of AHR•ARNT•XRE and AHR•ARNT2•XRE complexes were then evaluated by EMSA by probing the samples with a 32-P labeled XRE from the murine CYP1A1 promoter (Fig ure 4.7). In both cases (AHR and ARNT or AHR and ARNT2), mixtures of both proteins formed a TCDD-dependent DNA binding shift that was not visible in samples activated with the Me2SO vehicle suggesting that the evident shift was a result of activ ation of the AHR (Figur e 4.7, compare lanes 1-2 and 7-8). Furthermore, this study demons trated that the TC DD-dependent DNA binding shift depended on the presence of both the AHR as well as an ARNT protein (either ARNT or ARNT2) and the DNA binding shifts corresponded to the relative molecular mass of AHR•ARNT and AHR•ARNT2 complexes. In the TCDD-activated samples containing AHR and ARNT, addition of antibod ies against either AHR or ARNT resulted in a supershifting of complexes containi ng these proteins, essentially ablating DNA binding. In contrast, antibodies agains t ARNT2 in the AHR/ARNT samples or preimmune antibodies have no effect on the shif t, demonstrating that the shift depends on the presence of both the ARNT and AHR pr oteins. Similarly, in the TCDD-activated samples containing AHR and ARNT2, addition of antibodies against either AHR or ARNT2 resulted in a supershifting of comple xes containing these proteins, essentially ablating DNA binding. In contrast, anti bodies against ARNT in the AHR/ARNT2 samples or pre-immune antibodies have no eff ect on the shift, demonstrating that this shift depends on the presence of both the ARNT 2 and AHR proteins. Thus, these studies show that both ARNT and ARNT2 were capable of forming TCDD-dependent DNA binding shifts that depended on the presence of AHR protein. Furthe rmore, the intensity of the DNA binding shift was similar when e qual amounts of either ARNT protein was

PAGE 149

131 Figure 4.7: DNA binding of AHR•ARNT and AHR•ARNT2 heterodimers In vitro expressed AHR was combined with either ARNT or ARNT2 into a stock sample and then aliquoted and incubated in the presence of DMSO (0.5%) or TCDD (100 nM) for 2 h at 30C. A, Aliquots from the stock samples were mixed with 32P-labeled XRE oligonucleotides and protein•DNA comp lexes resolved as detailed in Chapter Six In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), AHR (Ah) or preimmune IgG (IG) were included in the bind ing reaction prior to loading on the gel. The location of the specific AHR•ARNT•XR E and AHR•ARNT2•XRE complex and free XRE are indicated. B, Aliquots of the activa tion reactions utilized in the EMSA were denatured and evaluated for ARNT, ARNT2 or AHR protein by West ern analysis using either anti-V5 IgG (1:500) or anti-AHR Ig G (1ug/ml) and visualized by ECL with GAMHRP IgG (1:10,000; V5) or GAR-HRP IG (1:10,0 00; AHR). Note that the concentration of both V5-ARNT and V5-ARNT2 in each sample is similar. C, control samples; T, samples activated with TCDD.

PAGE 150

132 co-expressed with the AHR, suggesting that ARNT and ARNT2 have an equal ability to associate with the AHR and bind DNA when expressed in vitro (Figure 4.7, B). To examine whether this would hold true when both ARNT and ARNT2 were coexpressed along with the AHR in equal ratio s, another EMSA was performed using a mixture of ARNT and AR NT2 proteins along with in vitro synthesized AHR (Figure 4.8). In this experiment, a mixture of both ARNT proteins with th e AHR again resulted in the formation of a DNA binding shift that was TCDD-dependent (Figure 4.9 A). Furthermore, this shift resulted from e qual expression of both ARNT proteins and appeared to require both prot eins as well as the AHR. In terestingly, the addition of antibodies against ARNT in the mixed sample resulted in a DNA binding shift that was approximately 51% of the intensity of the duplicate sample with TCDD alone when quantified by computer densitometry, sugge sting that ARNT containing complexes account for approximately 49% of the total DNA binding shift (Figure 4.9 A, lane 3, C). Similarly, the addition of antibodies against ARNT2 yielded a shift that was 50% of the intensity of the control, s uggesting that ARNT2 containing complexes also account for approximately 50% of the total shift (Figure 4.9 A, lane 4, C) In contrast, addition of antibodies against the AHR ab lated all evidence of DNA bi nding, further suggesting that the DNA binding shift seen in each lane is indeed representative of ARNT or ARNT2•AHR heterodimers, while addition of pre-immune IgG had no effect on DNA binding. Furthermore, these differences in DNA binding were not at tributable to the amount of protein in each sample as reveal ed by quantitative Western blotting performed on a portion of the exact samples used for th e EMSA since each EMSA sample contained approximately equal amounts of both ARNT an d ARNT2 as determined by V5 staining

PAGE 151

133 Figure 4.8: Schematic for e valuation of DNA binding po tential of a mixture of ARNT and ARNT2 using in vitro synthesized and activated samples. In vitro synthesized V5-ARNT, V5-ARNT2, and AHR were produced as detailed in Chapter Six and a portion of each sample was denature d and evaluated for ARNT, ARNT2, or AHR protein by Western analysis us ing either anti-V5 IgG (1:500) or A-1A anti-AHR IgG (1ug/ml) and visualized by ECL with GAM-H RP IgG (1:10,000; V5) or GAR-HRP IG (1:10,000; AHR). The intensity of the result ant bands from the Western analysis were quantified by computer densitometry as detailed in Chapter Six and equal amounts of both ARNT and ARNT2 proteins were comb ined with unprogrammed reticulocyte and AHR protein and incubated in the presence of DMSO (0.5%, vehicl e) or TCDD (100 nM, ligand) for 2 h at 30C. Following activation, aliquots of each sample were combined with EMSA sample buffer and antibodies as described in Chapter Six and in figure legends. These aliquots were then subjected to both EMSA, further Western analysis, and immunoprecipitation analyses.

PAGE 152

134 Figure 4.9: DNA binding of AHR•ARNT and AHR•ARNT2 heterodimers in the presence of both ARNT and ARNT2 In vitro expressed AHR was combined with equal amounts of both ARNT and ARNT2 into a stock sample and then aliquoted and incubated in the presence of DMSO (0.5 %) or TCDD (100 nM) for 2 h at 30C. A, Aliquots from the stock samples were mixed with 32P-labeled XRE oligonucleotides and protein•DNA complexes resolved as detailed in Chapter Six In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), AHR (Ah) or preimmune IgG (IG) were included in the binding reaction prior to loading on the gel. B, Aliquots of the activation reactions utilized in C were denatured and evaluated for ARNT expressing using anti-V5 IgG (1:500) and visualized by ECL with GAM -HRP IgG (1:10,000; V5). Note that the level of ARNT and ARNT2 was similar. C) The intensity of the shifted bands from several different EMSA experiments were quantified by computer densitometry as detailed in Chapter Six Results are plotted as the mean +/SE of each shifted band with the samples containing preimmune IgG set to 100%. IG, samples incubated with preimmune IgG; A1, samples incubated with anti-ARNT IgG; A 2, samples incubated with anti-ARNT2. Numbers on the bottom i ndicate the relative inte nsity compared to samples containing preimmune IgG. *, Statis tically different from samples incubated with IgG; p<0

PAGE 153

135 (Figure 4.9 B). Additionally, each sample also contained approximately equal amounts of AHR (data not shown). Taken together, th is suggests that both ARNT and ARNT2 are approximately equally able to heterodi merize with the AHR and bind XREs when synthesized in vitro and expressed at identical levels. While ARNT and ARNT2 appeared to exhib it an equal ability to contribute to a DNA binding shift that required AHR, it had not ye t been demonstrated directly that this shift was occurring through dimeri zation of the ARNT or ARNT 2 proteins with the AHR. Instead, the EMSA analyses identified th at the DNA binding shift depended upon ligandactivated AHR as well as the presence of an AR NT protein. Therefore, it was pertinent to assess the direct interaction of these proteins through altern ate methods. To establish that activated AHR complexes could be generated that were associated with either ARNT or ARNT2, in vitro expressed AHR and equal amounts of ARNT and ARNT2 were coincubated and activated as detailed previ ously, and immunoprecipita tion studies carried out using anti-AHR IgG. A repres entative experiment is shown in Figure 4.10. The input samples demonstrate that the in vitro expressed proteins exhi bited equal amounts of AHR protein and also expressed equal amounts of both ARNT and ARNT2 as assessed by quantitative Western blotti ng against the V5 epitope. As expected, when the AHR was immunoprecipitated from these samples in th e absence of TCDD, the AHR precipitated efficiently, but neither ARNT protein was co -precipitated with the AHR (Figure 4.10 lane 3). In the TCDD activated samples, the AHR wa s precipitated to the same level as before; however, in this sample both ARNT and ARNT2 were brought down using anti-AHR IgG (Figure 4.10 compare lanes 3 and 5). Furt hermore, the level of ARNT that was coprecipitated with the AHR was equal to that of the ARNT2 that was precipitated,

PAGE 154

136 Figure 4.10: Association of ARNT and ARNT2 with AHR In vitro expressed AHR, ARNT, and ARNT2 were combined into a stock sample and then equally split and incubated in the presence of DMSO (0.5%) or TCDD (100 nM) for 2 h at 30C. Equal amounts of each sample were then incubated with 1 g anti-AHR IgG (Ah) or preimmune IgG (Pi) for 1 hr at 4oC. The samples were then precipitated with protein A/G agarose beads, washed with TTBS and the boiled in the presence of 1x gel sample buffer. Equal amounts of sample were resolved by SDS-PAGE, blotted and stained with either anti-V5 IgG (1:500) or anti-AHR IgG (1ug/ ml) and visualized by ECL with GAM-HRP IgG (1:10,000; V5) or GAR-HRP IG (1:10,000; AH). The precipitated IgG band (lanes 3-6) is shown to demonstrate the uniformity of the precipitation across all samples.

PAGE 155

137 demonstrating that in the pr esence of both ARNT and ARNT2, the AHR was equally able to dimerize with either protein in a liganddependent manner. This held true in nonmixed ARNT samples as well, when ARNT or ARNT2 protein co-pre cipitated with the AHR individually (data not s hown). Thus, these studies demonstrate that both ARNT isoforms can form TCDD-dependent AHR heterodimers when expressed in vitro Additionally, these studies s upport the ability of these dimers to bind DNA, since portions of the samples used for immunoprecipi tation analyses were also used in EMSA experiments that mimicked the data previously shown (data not shown). 4.5 ARNT2 Can Out-Compete ARNT for Association with the Liganded AHR Since in vitro synthesized ARNT2 appeared to be equally able to heterodimerize with the AHR and bind DNA, the effect of increasing amounts of ARNT2 on the ability of ARNT to heterodimerize with the AHR was also evaluated. In vitro synthesized ARNT was mixed with AHR and ARNT2 was a dded in a 1:1, 1:3, or 1:11 ratio versus ARNT, in each case keeping the total level of ARNT proteins constant. The resulting samples were then incubated in the presence of TCDD or Me2SO for 2 h. Again, antibodies against ARNT, ARNT2, AHR or preimmune antibodies were then added to duplicate portions of the 1:11 protein mix in the presence of TCDD to prevent target proteins from entering the gel matri x. The formation of AHR•ARNT•XRE and AHR•ARNT2•XRE complexes were then eval uated by EMSA. Representative results shown in Figure 4.11 indicate that as prev iously shown, ARNT•AHR heterodimers formed a TCDD-dependent DNA binding shift and that addition of ARNT2 to this mixture increased the intensity of the DNA bi nding shift, reaching saturation by the 1:11

PAGE 156

138 Figure 4.11: Effect of ARNT2 concentr ation on the formation of AHR•ARNT complexes. In vitro expressed AHR was combined with the indicated ratios of ARNT and ARNT2, the samples equally split and incu bated in the presence of DMSO (0.5%) or TCDD (100 nM) for 2 h at 30C. A) Aliquots of the activated reac tions were denatured and evaluated for ARNT, ARNT2 or AHR prot ein by Western analysis using either antiV5 IgG (1:500) or A-1A (1ug/ml) and visu alized by ECL with GAM-HRP IgG (1:10,000; V5) or GAR-HRP IG (1:10,000; AHR). B) Th e exact samples visualized in A were mixed with 32P-labeled XRE oligonucleotides and pr otein•DNA complexes resolved as detailed in Chapter Six In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), or preimmune IgG (IG) we re included in the binding re action prior to loading on the gel (lanes 11-14). The locati on of the specific AHR•ARNT•XRE and AHR•ARNT2•XRE complex and free XRE are i ndicated. Numbers i ndicate the relative level of ARNT or ARNT2 that were used in the activ ation reaction.

PAGE 157

139 sample. Western blotting of the EMSA sa mples confirmed the relative ratios of both ARNT proteins as determined by computer de nsitometry analysis of V5 staining. In the 1:3 and 1:11 ratio sample containing incr eased levels of ARNT2, the majority of heterodimers appeared to be ARNT2•AH R dimers, though ARNT remained in this sample, as evidenced by the addition of anti bodies against each prot ein. While addition of ARNT antibodies to the 1:11 ratio sample had no appa rent effect on the overall intensity of the DNA binding shift, add ition of antibodies ag ainst ARNT2 or AHR instead ablated all DNA binding. These results suggest that ARNT2 is indeed able to associate with the AHR and furthermore can out-compete ARNT for AHR dimerization. 4.6 The Ability of ARNT2 to Associate with the AHR and Bind DNA is Not Dependent on AHR Concentration or ARNT Protein Concentration Since studies examining the ability of e ither ARNT protein to associate with the AHR have shown conflicting results (Doughert y and Pollenz 2007; Hi rose et al., 1996; Sekine et al., 2006), it was important to a ssess possible reasons for the discrepancies between these studies and in t hose contained in th is report. If ARNT and ARNT2 truly differed in their ability to associate with the AHR and bind DNA in vitro in contrast to the results presented in Figures 4.7-4.11, what conditions being used in our studies might lead to the apparent equal ability of th ese proteins to function in DNA binding? One such condition that could alter the appa rent ability of these proteins to function during the EMSA assay is if the level of AHR or ARNT being used in the studies. Since these studies used in vitro synthesized proteins, it is po ssible that high levels of expression of the ARNT proteins or the AHR led to an associ ation of these proteins that

PAGE 158

140 would not seen if the proteins were expressed at more physiological le vels. This idea was the basis for the explanation of the discre pancies between the ability of ARNT2 to associate with the AHR that was seen by Hi rose et al. (1996), ve rsus the apparent inability of these proteins to associate in the studies performed by Sekine et al. (2006). However, while this claim was made by Sekine et al. (2006), it remained untested. Thus, it was important to assess whether the con centration of either the AHR or the ARNT proteins played a role in the ability/in ability of these proteins to associate in vitro To begin to evaluate this question, limiting amounts of in vitro expressed AHR were combined with equal ratios of either ARNT or ARNT2 into stock samples and then aliquoted and incubated in the presence of DMSO (0.5%) or TCDD (100 nM) for 2 h at 30C and tested for target protein expre ssion by Western blotting (Figure 4.12 A). In these studies, the level of AHR was altere d while the level of ARNT and ARNT2 was held constant. Aliquots from the st ock samples were then mixed with 32P-labeled XRE oligonucleotides and protein•DNA comp lexes resolved as detailed in Chapter Six Representative results are given in Figure 4.12 B. As the level of AHR increased in the EMSA samples, so did the intensity of the ligand-dependent DNA binding shift, suggesting that the level of AHR being used in these studies was a limiting factor for ARNT or ARNT2. Since the level of DN A binding increased in the presence of increased AHR, and since the intensity of the DNA binding shift was similar between ARNT and ARNT2 when co-expressed with si milar levels of AHR, overexpression of the AHR could be ruled out as a factor influencing the asso ciation of these proteins.

PAGE 159

141 Figure 4.12: DNA binding of AHR•ARNT an d AHR•ARNT2 heterodimers in the presence of limiting AHR Limiting amounts of in vitro expressed AHR were combined with either ARNT and ARNT2 in equal ratios into stock samples and then aliquoted and incubated in the presence of DMSO (0.5 %) or TCDD (100 nM) for 2 h at 30C. A, Aliquots of the activatio n reactions utilized in B were denatured and evaluated for ARNT and AHR expression using anti-V5 IgG (1:500) or A-1A anti-AHR IgG (1 g/ml) and visualized by ECL with GAR-HRP IgG (1:10,000; AHR) or GAM-HRP IgG (1:10,000; V5). Note that the level of ARNT and AR NT2 was similar, while the level of AHR was altered. B, Aliquots from the stock samples were mixed with 32P-labeled XRE oligonucleotides and protein•DNA comp lexes resolved as detailed in Chapter Six

PAGE 160

142 Since the ability of ARNT 2 to associate with the AHR and bind DNA could also be related to possible overexpr ession of ARNT2 relative to the AHR yielding artifactual results, it was important to assess whether dilu tion of each of the ARNT proteins relative to each other would alter the results obtained in the assay. Therefore, another EMSA was performed to directly compare the ability of each ARNT to associate with the AHR and bind DNA at reduced levels. To analyze this increasing amounts of either in vitro synthesized ARNT or ARNT2 were incubate d with identical am ounts of AHR in the presence of TCDD or Me2SO for 2 h and the formation of AHR•ARNT•XRE and AHR•ARNT2•XRE complexes evaluated by EMSA as previously described. Comparable dilutions were then examined for DNA binding relative to the amount of ARNT or ARNT2. In each dilution set, both ARNTs were able to heterodimerize with the AHR and bind DNA in a TCDD-dependent fashion (Figure 4.13 A). Furthermore, quantification of the DNA binding shift by densit ometry revealed that the intensity of the DNA binding shift was similar between compar able ARNT2 dilution and ARNT dilution sets exhibiting 78% binding in the lowest ARNT2 dilution, 106% binding in the middle set, and 114% binding at the highest concentration of AR NT2 in comparison with the ARNT dilutions (Figure 4.13 B). Likewise, at each dilution, the relative amounts of ARNT and ARNT2 were similar in range as determined by quantified Western blotting of the EMSA samples stained against th e V5 epitope, though there was 1.9, 1.3, and 1.3 times more ARNT2 than ARNT respectively (F igure 4.13 B). No significant differences in the levels of AHR between samples were noted (Figure 4.13 A). Since the lowest dilution set showed 90% more ARNT2 th an ARNT, yet exhibited only 78% binding relative to the ARNT sample, there may have been a slight difference in affinity of

PAGE 161

143 Figure 4.13: Effect of target protein con centration on the formation of AHR•ARNT and AHR•ARNT2 heterodimers In vitro expressed AHR was mixed with increasing concentrations of ARNT or ARNT2, the sa mples equally split and incubated in the presence of DMSO (0.5%) or TCDD (100 nM) for 2 h at 30C. A) A portion of the activated samples were denatured and evaluated for ARNT and ARNT2 or AHR expression by Western analysis using anti-V 5 IgG (1:500) or anti-AHR IgG (1ug/ml), respectively. Reactive bands were visuali zed using GAM-HRP IgG (1:10,000) and ECL. The remaining samples were mixed with 32P-labeled XRE oligonucleotides and protein•DNA complexes resolved as detailed in Chapter Six The location of the specific AHR•ARNT•XRE and AHR•ARNT2•XRE complex and free XRE are indicated. B) The relative level of ARNT a nd ARNT2 protein (left) and DNA binding (right) was determined using computer densitometry of th e bands shown in the Western blot of A. The relative intensity of the shifted bands from the EMSA in A was determined using computer densitometry.

PAGE 162

144 ARNT2 for the AHR in comparison with ARNT at low levels of ARNT proteins. However, throughout the evaluated points, the expression of the ARNT proteins and the relative level of DNA binding was essentia lly equal, and under no conditions was ARNT2 unable to associate with the AHR and bind XREs. Ther efore, in contrast to the statement posed by Sekine et al. (2006), high expression levels of these proteins do not appear to play a role in their association. 4.7 The Ability of ARNT2 to Associate w ith the AHR and Bind DNA May be XRE-Specific The murine CYP1A1 promoter has been demonstrated to possess five functional putative XREs ranging from -489 to -1218 nucle otides upstream of the transcriptional start site and have been designated as XRE A, B, D, E, and F (Lusska et al., 1993). In those studies, each of these XREs was shown to exhibit varying levels of CAT activity when used to drive reporter constructs while XRE C appeared to be non-responsive (Figure 4.14 A). Since the previous studies described herein (Figures 4.7-4.13) had used only XRE D as a probe for DNA binding, it was possible that the ability of each ARNT to bind DNA was related to the XRE being used and would not be mimicked with other CYP1A1 XREs. To evaluate this possibili ty, each XRE as described by Lusska et al. (1993) was labeled with 32P, quantified by spectrophotomet ry and scintil lation counting, normalized to the number of counts/minute and used as a probe against aliquots of single samples containing in vitro activated AHR•A RNT or AHR•ARNT2 dimers as previously described. Typical results are shown in Figure 4.14 B. Each XRE showed an approximately equal ability to associate with AHR•ARNT or AHR•ARNT2 dimers with the exception of XRE A, which appeared to show a greater affinity for AHR•ARNT than

PAGE 163

145 Figure 4.14: Analysis of XRE sequence on the DNA binding ability of AHR•ARNT or AHR•ARNT2 heterodimers. A, Schematic representing the mouse CYP1A1 promoter XRE locations and relative activity le vels as described by Lusska et al. (1993). Position numbers are nucleotide positions relativ e to the transcriptional start site. B, AHR and ARNT or ARNT2 were expressed in vi tro and mixed together, incubated in the presence of Me2SO (-; 0.5%) or TCDD (170 nM) for 2 h at 30C and a portion of each sample analyzed by EMSA, as detailed in Chapter Six The location of the specific AHR•ARNT•XRE and AHR•ARNT2•XRE complex are indicated. C, Equal volumes of 2x gel sample buffer were added to the rema ining portion of each EMSA sample and the samples used for Western blotting. Duplicat e Western blots were stained with anti-V5 IgG (1:500) and visualized by ECL with GAM-HRP IgG (1:10,000).

PAGE 164

146 AHR•ARNT2 dimers. It is important to note, however, that in the studies by Lusska et al. (1993), XRE A appeared to contribute the leas t amount of functional activity towards the induction of CAT activity driven by this XRE alone in comparison with other functional CYP1A1 XREs. Additionally, in repeated expe riments, this discrepancy appeared to be less extreme than represented by this indivi dual EMSA. In the event that AHR•ARNT/2 dimers had a preference for the non-responsive XRE C, the ability of this XRE to bind either ARNT or AHR•ARNT2 dimers was also examined and no discrepancy found between binding (data not shown). Again, th ese differences were not attributable to variations in the levels of ARNT vs. ARNT2 and no significant differences in the levels of AHR between samples were noted (Figure 4.14 C, data not shown). Thus, while the ability of AHR•ARNT/2 heterodimers to bi nd DNA may be XRE specific, it is unlikely that increased affinity or a lack thereof of either dimer for i ndividual XREs of the CYP1A1 promoter plays a role in the ineffici ency of ARNT2 in substituting for ARNT in AHR-mediated regulation of CYP1A1 since XR Es B, C, D, E, and F that contribute >90% of the functional regulation of CYP1A1 all show an essentially equivalent ability to be bound by either heterodimer. 4.8 DNA Binding Ability of AHR•ARNT2 Heterodimers Appears to be Ligand Dependent Since previous studies had examined the ability of ARNT2 to associate with the AHR using 3-methylcholanthrene (3-MC) rather than TCDD and seen disparities between ARNT and ARNT2•AHR dimerization, and since little is known in regard to the structure of the liganded AHR, it was pertinen t to assess whether these disparities were related to the ligand being used (Hirose et al., 1996; Sekine et al., 2006). To examine this

PAGE 165

147 possibility, identical pools of AHR and ARNT or AHR and ARNT2 we re activated using either TCDD, 3-MC, or benzo[a]pyrene (BAP) and the formation of AHR•ARNT•XRE and AHR•ARNT2•XRE complexes evaluated by EM SA as previously described. In the first set of experiments, ARNT or ARNT2 we re co-expressed individu ally with the AHR, activated in the presence of Me2SO, TCDD, or 3-MC, and analyzed by EMSA (Figure 4.15). As previously seen, activation of the EMSA samples with TCDD yielded a DNA binding complex in both the AHR•ARNT a nd AHR•ARNT2 samples that exhibited a similar intensity (Figure 4.15 B). Interesti ngly, activation of the EMSA samples with 3MC resulted in a DNA binding shift that wa s similar in intensity to the AHR•ARNT TCDD activated sample, but was significantly ( p <0.05) reduced in the AHR•ARNT2 sample over the course of three experime nts, though the levels of ARNT and AHR proteins remained constant (F igure 4.15 B, data not shown). In a mixture experiment similar to Fi gure 4.9, samples containing equal levels of both ARNT and ARNT2 activated with either TCDD, 3-MC, or BAP exhibited similar discrepancies (Figure 4.16). As previously s een, in a sample containing equal levels of both ARNT and ARNT2, activation with TCDD yielded a DNA binding complex that consisted of approximately 46% ARNT•AHR dimers and 44-54% ARNT2•AHR dimers (Figure 4.16 A, B). In contrast, though ARNT and ARNT2 were equally expressed, activation by either 3-MC or BAP yielde d a DNA binding complex that exhibited 2436% binding when antibodies against ARNT were included following activation and 6164% binding when antibodies against ARNT2 we re included, suggesting that in the case of 3-MC, 64% of the DNA binding shift was at tributable to ARNT•AHR dimers and, in the case of BAP 76% were likewise attributed to ARNT•AHR dimers (Figure 4.16 B, D).

PAGE 166

148 Figure 4.15: Effect of 3-MC on the DNA binding of AHR• ARNT and AHR•ARNT2 complexes. A, In vitro expressed AHR was combined with either ARNT or ARNT2 into a stock sample and then ali quoted and incubated in the presence of DMSO (0.5%), TCDD (100 nM) or 3-MC (54M) for 2 h at 30 C. Aliquots from the stock samples were mixed with 32P-labeled XRE oligonucleotides and pr otein•DNA complexes resolved as detailed in Chapter Six The location of the specific AHR•ARNT•XRE and AHR•ARNT2•XRE complexes ar e indicated. Free XRE was run off the bottom of the gel so that the difference in migration of th e complexes could be observed. B, Aliquots of the activation reactions u tilized in A were denatured and evaluated for ARNT and ARNT2 protein by Western analysis using an ti-V5 IgG (1:500) and visualized by ECL with GAM-HRP IgG (1:10,000). Note that th e concentration of both V5-ARNT and V5ARNT2 in each sample is similar. T, samples activated with TCDD; M, samples activated with 3-MC. The intensity of the shifted bands from several different EMSA experiments were quantified by computer densitometry as detailed in Chapter Six Results are plotted as the mean +/SE of the 3-MC or TCDD activated samples. *, statistically different from the AR NT sample activated with 3-MC; p <0.05.

PAGE 167

149

PAGE 168

150 Figure 4.16. Effect of different ligands on the DNA binding of AHR•ARNT and AHR•ARNT2 complexes In vitro expressed AHR, ARNT, a nd ARNT2 were combined into a stock sample and then equally split a nd incubated in the pres ence of the specific ligands for 2 h at 30C as detailed below. A, Samples were incubated with DMSO (0.5%), TCDD (100nM) or 3-MC ( 54M) and then mixed with 32P-labeled XRE oligonucleotides and protein•DNA comp lexes resolved as detailed in Chapter Six. In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), AHR (AH) or preimmune IgG were included in the binding re action prior to loading on the gel. The location of the specific AHR•ARNT•XRE and AHR•ARNT2•XRE complex and free XRE are indicated. B, Aliquots of the st ock activation mixture utilized in A were denatured and evaluated for ARNT and AR NT2 expression by Western analysis. The Western blot was stained with anti-V5 Ig G (1:500) and visualized by ECL with GAMHRP IgG (1:10,000). The intensity of the shifted bands from the EMSA in A was quantified by computer dens itometry as detailed in Chapter Six Results are plotted with the samples containing preimmune IgG set to 100%. IG = samples incubated with preimmune IgG; A1 = samples incubated with anti-ARNT IgG; A2 = samples incubated with anti-ARNT2. Numbers on the bottom indi cate the relative intensity compared to samples containing preimmune IgG. C, Sa mples were incubated with DMSO (0.5%), TCDD (100nM) or BAP (17M) and EMSA performe d as detailed in A. D, Aliquots of the stock activation mixture utilized in C were denatured and evaluated for ARNT and ARNT2 expression by Western an alysis as indicated in B. The intensity of the shifted bands from the EMSA in C was quantified by computer densitometry as detailed in Chapter Six Results are plotted with the sample s containing preimmune IgG set to 100%. IG, samples incubated with preimmune IgG; A1, samples incubated with anti-ARNT IgG; A2, samples incubated with anti-ARNT2. Nu mbers on the bottom i ndicate the relative intensity compared to samples containing preimmune IgG.

PAGE 169

151 Since treatment with saturating levels of 3MC or BAP resulted in a greater proportion of ARNT•AHR dimers than ARNT2•AHR dimers, ARNT may have a greater affinity for 3MC or BAP liganded AHR than ARNT2 sugge sting that the activating AHR ligand may confer the specificity of the AHR for its heterodimeric partner (likely through receptor conformational differences) or may conf er the specificity of DNA binding by the AHR•ARNT/2 dimer using this model system. To evaluate whether the AHR ligand was altering the specificity of the AHR for either the ARNT proteins or altering the sp ecificity of the liga nded AHR•ARNT2 dimer, it was necessary to establish that AHR comp lexes activated with TCDD or BAP could be generated that were associated with eith er ARNT or ARNT2. Therefore, in vitro expressed AHR and equal amounts of AR NT and ARNT2 were co-incubated and activated as detailed previ ously, and immunoprecipitation studi es carried out using antiAHR IgG, anti-ARNT IgG, or anti-ARNT2 IgG. A representative experiment is shown in Figure 4.17. The input sample (lane 9) demonstrates equal amounts of both ARNT and ARNT2 were co-expressed with the AHR. As expected, when the AHR was immunoprecipitated from these samples in th e presence of TCDD, the AHR precipitated efficiently, and both ARNT prot eins were co-precipitated to equivalent levels (Figure 4.17 lane 5). Additionally, IgG against ARNT or ARNT2 specifically precipitated each ARNT protein and also co-precipitated the AHR. Interestingly, in the BAP activated samples, the AHR was precipitated to the same level as before; however, in this sample both ARNT and ARNT2 were also brought down using anti-AHR IgG to the same levels as before (Figure 4.17 compare lanes 1 and 5). Furthermore, when portions of the same mixture used for immunoprecipitation were subjected to EMSA analysis, DNA binding

PAGE 170

152 Figure 4.17: Association of ARNT and AR NT2 with BAP or TCDD activated AHR In vitro expressed AHR, ARNT, and ARNT2 were combined into a stock sample and then equally split and incubated in th e presence of DMSO (0.5%, -), BAP (17 M, B) or TCDD (100 nM, T) for 2 h at 30C. A, Equal amounts of each sample were then incubated with 1 g anti-AHR IgG (A), 1 g anti-ARNT IgG (1), 1 g anti-ARNT2 IgG (2), or pre-immune IgG (Pi) for 1 hr at 4oC or saved for analysis of input (Inp). The samples were then precipitated with protei n A/G agarose beads, washed with TTBS and the boiled in the presence of 1x gel sample buffer. Equal amounts of sample were resolved by SDS-PAGE, blotted and stained with either anti-V5 IgG (for ARNT and ARNT2, 1:500) or anti-AHR IgG (1ug/ml) and visualized by ECL with GAM-HRP IgG (1:10,000; V5) or GAR-HRP IG (1:10,000; AH). The precipitated IgG band is shown to demonstrate the uniformity of the precipitation across all samples. B, Portions of the immunoprecipitation reactions us ed in A were mixed with 32P-labeled XRE oligonucleotides and protein•DNA comp lexes resolved as detailed in Chapter Six

PAGE 171

153 shifts were seen as before. Taken together this suggests that th e ligand activating the AHR alters the ability of the AHR•ARNT2 dimer to bind DNA, but not the ability of these complexes to form in this model system. 4.9 The Ability of ARNT or ARNT2 to Dimerize with the AHR in Vitro May be Receptor Species Dependent The Ahb-1 receptor found in th e C57, C58, and the MA/My strains is known to exhibit several distinct characteristics from other Ah murine alleles as well as Ah receptors from other species (see Chapter Two ). While the Ahb-1 receptor exists as a ~95kDa (805 amino acid) cytosolic receptor, which does not appear to be shuttling through the nucleus endogenously, the Ahb-2 receptor found in the murine BALB/cBy, A, and C3H strains as well as the rat and hu man AHR exist as a ~104kDa (848 amino acid) receptor that is primarily nuclear and exhibits dynamic nucleocytoplasmic shuttling (Poland et al., 1994; Pollenz and D ougherty, 2005). Furthermore, the Ahb-1 is truncated when compared with Ah receptors found in other mammalian species, containing a point mutation that prematurely truncates the receptor at 805 amino acids, while the Ahb-2, rat, and human AHR all contain an additional 42 -45 amino acids at their carboxy-terminus that have 70% identity. As this additional carboxy-terminal sequence is present in the other AHR alleles as well as across species a nd is reasonable conserve d in sequence, it is reasonable to assume that this sequence may be functionally relevant. Therefore, it was relevant to assess the ability of ARNT or ARNT2 to heterodimerize with other Ah receptor species. This was inves tigated by incubating equal amounts of in vitro synthesized ARNT or ARNT2 with equal amounts of Ahb-1, Ahb-2 or rat AHR, activating

PAGE 172

154 the receptors with TCDD or BAP and ex amining the DNA binding ability of each AHR•ARNT or AHR•ARNT2 dimer by EMSA (F igure 4.18). As expected, both ARNT and ARNT2 were able to form a TCDDor BAP-dependant DNA binding shift with each Ah receptor species (Figure 4.18 A). Add itionally, the formation of AHR•ARNT and AHR•ARNT2 heterodimers was essentia lly equal in the presence of the Ahb-1 receptor activated with TCDD (Figure 4.18 A, compare lanes 2 and 5), while ARNT2 showed a reduced affinity for BAP liganded AHR as seen previously (Figure 4.18 A, compare lanes 3 and 6). In contrast, however, ARNT2 ap peared to exhibit a greater affinity for rat AHR in the presence of TCDD or BAP than AR NT as computer densitometry analysis of the intensity of the DNA binding shift reve aled a band that was 33-75% greater in intensity in the Ahb-2•ARNT2 and Rat AHR•ARNT2 samples than in identical samples containing ARNT (Figure 4.18 A, B) Importantly, this was not due to different levels of ARNT2 in these samples, since the levels of ARNT, ARNT2, and AHR remained constant across the sample types (Figure 4.18 C). Additionally, while ARNT previously showed a greater affinity for BAP-liganded AHR than ARNT2, this did not appear to be maintained when other Ah receptor species were used (Figures 4.16, 4.18). Instead, while ARNT and ARNT2 exhibited similar magnitudes of binding when activated by TCDD, but not when activated with BAP, in the presence of Ahb-1 receptor as expected, ARNT exhibited a lesser magnitude of binding in comparison with ARNT2 in the presence of Ahb-2 receptor or rat AHR irrespective of ligand. Similarly, both Ahb-2 receptor and rat AHR exhibited a lesser degr ee of binding when activated with BAP in

PAGE 173

155

PAGE 174

156 Figure 4.18: Analysis of AHR species on the formation of TCDD or BAP dependent AHR•ARNT or AHR•ARNT2 heterodimers. A, Ahb-1, Ahb-2, rat AHR, ARNT and ARNT2 were mixed and incubated in the presence of Me2SO (-; 0.5%), TCDD (100 nM), or BAP (17 M) for 2 h at 30C and a portion of each sample analyzed by EMSA, as detailed in Chapter Six The location of the specific AHR•ARNT•XRE and AHR•ARNT2•XRE complex and free XRE are i ndicated. Non-specifi c binding is also noted by the asterisk. B, Equal volumes of 2x gel sample buffer were added to the remaining portion of each EMSA sample and the samples used for Western blotting. Duplicate Western blots were st ained with either anti-V5 Ig G (1:500) or with A-1A AHR IgG (1.0 g/ml) and visualized by ECL with GAM-HRP IgG (1:10,000) or GAR-HRP (1:10,000). C, The DNA binding shift from each EMSA TCDD or BAP treated lane resulting from combination of Ahb-1, Ahb-2, or rat AHR with ARNT or ARNT2 was quantified by densitometry and normalized against background. Results are plotted as the relative densitometry units for each sample.

PAGE 175

157 the presence of either ARNT or ARNT2 in comparison to activation with TCDD, suggesting that BAP is a weaker ligand for these Ah receptor species, but not for the Ahb-1 receptor. Together, these results suggest that ARNT2 can dimerize with several Ah receptor species and the Ahb-2 and rat AHR, which more cl osely resemble the human AHR, may have a greater affinity for ARNT2 than ARNT. Thus, th e ability of ARNT2 to function in other genetic backgrounds from the Hepa-1 expressing Ahb-1 should be addressed. 4.10 The Ability of ARNT or ARNT2 to Dimerize with the AHR in Vitro Does Not Appear to Differ When Expressed in Vivo Since ARNT, ARNT2, or the AHR may have post-translational modifications that could potentially influence their ability to heterodimerize, it was important to assess whether the previously desc ribed relationships between ARNT and ARNT2•AHR dimer formation would be mimicked in vivo Therefore, V5-ARNT and V5-ARNT2 were transfected into LA-II cells, and following a 24 hr recovery period, to tal cell lysates were generated, activated by TCDD or BAP, anal yzed by EMSA and the resulting binding ability assessed by EMSA. Representative result s are given in Figure 4.19. As seen in the in vitro synthesized protein experiments, ARNT2 remained able to associate with the AHR and bind XREs when expressed in vivo suggesting that no post-translational modifications are occurring in LA-II cytosol that would alte r the affinity of the ARNT2 for the AHR (Figure 4.19 A). Additionally, since ARNT2 remained able to dimerize with the AHR when LA-II cytosol was incubate d with ARNT2, this also suggests that the

PAGE 176

158 Figure 4.19: DNA binding of ARNT and ARNT2 expressed in cell culture Expression vectors for ARNT and ARNT2 were transfected in LA-II cells and cytosol produced as detailed in Chapter Six A, Stock mixtures contai ning equal levels of ARNT and ARNT2 protein were incubated with DMSO (0.5%), TCDD (100nM) or BAP (17M) for 2 h at 30C. Samples were aliquoted and mixed with 32P-labeled XRE oligonucleotides and protein•DNA comp lexes resolved as detailed in Chapter Six In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), AHR (AH) or preimmune IgG were included in the binding reaction prior to loading on the gel. The location of the specific AHR•ARNT•XRE and AHR•ARNT2•XRE complex and free XRE are indicated. B, An aliquot of the stock activation mixture utilized in A were denatured and evaluated for ARNT and ARNT 2 expression by West ern analysis. The Western blot was stained with anti-V5 Ig G (1:500) and visualized by ECL with GAMHRP IgG (1:10,000). The intensity of the shifted bands from the EMSA in A was quantified by computer densitometry as detailed in Chapter Six Results are plotted with the samples containing preimmune IgG set to 100%. IG, samples incubated with preimmune IgG; A1, samples incubated with anti-ARNT IgG; A 2, samples incubated with anti-ARNT2. Numbers on the bottom i ndicate the relative inte nsity compared to samples containing preimmune IgG.

PAGE 177

159 Ahb-1 does not exhibit any post-translational modi fications that would alter its ability to recognize ARNT2. As expected, ARNT also retained an a pparent higher affinity for BAP liganded Ahb1 receptor in comparison with ARNT2 (Figure 4.19 A, B). When antibodies were included in the EMSA reaction using ARNT or ARNT2 expressing cytosol to ablate either ARNT or ARNT2 containing comple xes, as previously detailed, ARNT and ARNT2 again showed an apparently equal ab ility to bind DNA in the presence of TCDD, but not BAP. Furthermore, when similar studies were performed to directly compare the binding ability of samples generated from in vitro synthesis of ARNT or ARNT2 against those generated from transfected LA-II cytosol, th e intensity of DNA binding was equal when similar levels of ARNT prot eins were compared either in vitro or in vivo (data not shown). Importantly, these results collectively indi cate that the previous results based on in vitro synthesized ARNT, ARNT2, and AHR (Figur es 4.7-4.18) do not differ from similar studies based on in vivo expressed proteins and therefor e, there are no significant posttranslational modifications that appear to alter the ability of either ARNT protein or AHR to heterodimerize or bind XREs in this model system. 4.11 Inhibition of ARNT by ARNT2 in AHR-Mediated Signaling Since ARNT2 appeared to be able to bi nd DNA in response to TCDD, yet exhibited a decreased ability to complement loss of AR NT in LA-II cells, it be came of interest to determine if its co-expression with ARNT would impede the ability of ARNT to complement AHR-mediated signaling, possibly through squelching of the AHR. LA-II

PAGE 178

160 cells were therefore transfected with e ither: naked vector, ARNT, or ARNT with increasing amounts of ARNT2, along with pSV-Galactosidase and GudLuc 1.1 plasmids and treated with Me2SO (0.5%) or TCDD (5nM) for 6 hours. Luciferase studies were then performed as previously described. LA-II cells tr ansfected with naked vector were unable to complement AHR-me diated signaling in response to TCDD as expected (Figure 4.20). Additi onally, when the LA-II cells we re transfected with ARNT alone, high basal levels of luciferase activity were seen that became even greater in the presence of TCDD. However, when ARNT2 was co-expressed with ARNT in either a 2:1 or 1:1 ratio of plasmid DNA, the levels of luciferase activity in response to TCDD were significantly reduced in comparison w ith ARNT alone. Importantly, the overall level of ARNT expression remained constant as the level of ARNT2 was changed. Thus, this suggests that ARNT2 when co-expresse d with ARNT may exhibit some degree of dominant negative activity. To confirm whether or not this result would be mimicked in vivo WT Hepa-1 cells endogenously expressing ARNT were tran sfected with ARNT2 and correspondingly evaluated by SDS-PAGE and Western blotting. After 6 hr s of TCDD treatment, the WT cells transfected with ARNT2 exhibited an approximately 30% reduc tion in the level of CYP1A1 protein in comparison to the unt ransfected WT cells as determined by quantitative Western blotting (Figure 4.21 A). Similarly, in a second experiment where other time points were evaluated, the WT cells transfected with mARNT2 exhibited an approximately 20% reduction in the level of CYP1A1 protein in comparison to the untransfected WT cells as determined by qua ntitative Western blotti ng at 2 and 4 hrs of TCDD treatment (data not shown) At both 4 hours and 6 hours, this reduction was

PAGE 179

161 Figure 4.20: Impact of ARNT2 expre ssion on AHR-mediated signaling. LA-II cells were transfected with equal total amounts of naked vector, ARNT alone, or ARNT with increasing amounts of ARNT2 as indicated as well as with equal amounts of both pSVGalactosidase and GudLuc 1.1 plasmids as described in Chapter Six Following 24 h recovery, cells were then treated with Me2SO (0.05%) or TCDD (5nM) for 6 hours. Equal amounts of total cell lysates were reso lved by SDS-PAGE, blo tted and stained with mouse ARNT IgG (A1; 1 g/ l) or mouse ARNT2 IgG (1:500). Reactivity was visualized by ECL with GAR-HRP (1:10,000). A ll luciferase values were normalized to -Galactosidase.

PAGE 180

162 Figure 4.21: Impact of ARNT2 expression on AHR-mediated signaling in cell culture A, Hepa-1 cells were transfected wi th naked vector or ARNT2 expression vectors and treated with DMSO (0.5%) or TC DD (2nM) for 6 h at 37C. Equal amounts of total cell lysates were resolved by SDS-PA GE, blotted and staine d with either anti AHR IgG (1g/ml), anti-ARNT2 IgG (1g/ml), anti-CYP1A1 IgG (1:200), or antiactin IgG (1:1000). Reactivity was visuali zed by ECL with GAR-HRP (1:10,000). Each lane represents and independent sample. CYP1A1 protein expression was quantified by computer densitometry and normalized to -actin controls. Results represent the mean +/SE of three independent samples. *, Sta tistically different from TCDD treated cells that were not transfected with ARNT2; p <0.05. B, Hepa-1 cells were propagated on glass coverslips and transfected and treated as detailed in A. Fixe d slips were stained with anti-ARNT IgG (0.5 g/ml; A1), anti-ARNT2 IgG (0.5 g/ml; A2), or anti-CYP1A1 (1:100) and reactivity was visualized usi ng GAR-RHO (1:400). All panels that were stained with the same antibodies were phot ographed for identical times. WT, cells transfected with naked vector WT + A2, cells transfected with ARNT2 vector.

PAGE 181

163 statistically significant (P<0.05) and similar reductions were not seen when WT cells were transfected with exce ss ARNT (data not shown). Therefore, again, the coexpression of ARNT2 with ARNT appeared to be hindering the ab ility of ARNT to function in AHR-mediated signaling, albeit through an unknown mechanism. 4.12 ARNT2 Does Not Function to the Same Level as ARNT in Endogenous AHRMediated Signaling The previous studies suggest that ARNT2 has the potential to affect AHR-mediated signaling in a negative manner when expressed in cell culture However, it is not known whether the conditions utilized for the various studies repr esent a truly physiological condition. For example, the ability of ARNT2 to impact AHR-mediated signaling and affect the function of AHR•ARNT2 complexes in vivo will be dependent on the coexpression of ARNT and ARNT2 in the same cells. Also, since transient transfections typically lead to >60% overexpression of the target protein, th e inhibition of ARNT functionality in AHR-mediated signaling by ARNT2 may be artifactual based on nonphysiologic expression of ARNT 2. This stresses the importance of examining protein function using endogenous protein levels. Thus to examine the possible role of ARNT2 in AHR-mediated signaling, it is necessary to also examine cells endogenously expressing ARNT2. However, it has gene rally been hypothesized that ARNT and ARNT2 are not expressed in the same cells at the protein level due to the limited tissue distribution of ARNT2 (Hiros e et al., 1996). Importan tly, a more recent study, has described mRNA for both ARNT and ARNT2 as being co-localized in many murine peripheral organs and neuronally derived tissu e, suggesting that di stribution of ARNT2

PAGE 182

164 may not be as restricted as previously described (Aitola and Pelto-Huikko, 2003). In addition, studies of ARNT2 expression have generally examined mRNA for ARNT2 with no analysis of endogenous protein expression. In order to investigate possible inte ractions between ARNT and ARNT2 in a physiological setting, studies we re carried out to determine the expression of ARNT and ARNT2 protein in various murine tissues and cell culture lines. In the first set of studies, whole tissue lysates from the brain, eye, hear t, kidney, liver, lung, muscle, skin, spleen, and thymus were prepared as described in Chapter Six and analyzed for AHR, ARNT, and ARNT2 protein by Western blotting. Fi gure 4.22 shows that while ARNT protein was detected in all the tissues evaluated as has previously been de scribed, expression of ARNT2 protein was detected in the brain, eye, and kidney, and was also detected at lower expression levels in the heart, spleen and t hymus (Figure 4.22 A). From these studies, it is evident that ARNT2 expre ssion is not limited only to the brain and kidneys, though these tissues do exhibit the highe st relative levels. Since these results do not confirm that the ARNT and ARNT2 protein are localized to the same cells, several continuous cell lines were purchased from ATCC and the le vel of ARNT and ARNT2 protein evaluated by Western blotting. Figure 4.22 B shows th at ARNT and ARNT2 protein were co expressed in human pigmented retinal epithe lial cells (ARPE-19), rat central nervous system cells (B35), and human, mouse a nd rat kidney cells (A498, TCMK, NRK, respectively). To gain insight into the rati o of ARNT and ARNT2 protein in these lines, ARNT and ARNT2 TNT reactions containing equal amounts of ARNT and ARNT2 protein (Figure 4.22 C), were included in the experiment so that the staining with the specific ARNT and ARNT2 antibodies could be normalized against staining of the in

PAGE 183

165 Figure 4.22: ARNT and ARNT2 protein expression in tissues and cells A, Total cell lysates were generated from a variety of a dult C57BL/6Jmouse tissues, resolved by SDSPAGE, blotted and stained w ith anti-ARNT R1 IgG (1.0 g/ml) or anti-ARNT2 IgG (1:500). Antibodies were titered to react to the TNT samples with the same sensitivity. Reactivity was visualized by ECL with GAR -HRP (1:10,000). Tissues expressing both ARNT and ARNT2 proteins are noted by the as terisk. B, The indicated cell lines were purchased from ATCC, and cultured as detailed in Chapter Six Total cell lysates evaluated for expression of both ARNT and ARNT2 using RI and ARNT2 IgG that were titered to give the same level of reactiv ity to the TNT samples. ARPE-19 normal rat kidney; TCMK-1, mouse kidney; A498; human kidney adenocarcinoma; Hepa-1, mouse hepatoma; TNT, in vitro synthesized ARNT or ARNT2. C, The same level of TNT samples loaded in B was stained with anti-V 5 IgG (1:500). Reactivity was visualized by ECL with GAM-HRP (1:10,000). D, ARNT and ARNT2 levels were determined by computer densitometry from the blots presented in B. Results are presented as relative densitometry units.

PAGE 184

166 vitro synthesized proteins with anti-V5 IgG. The quantified results are presented in Figure 4.22 D. The ratio of ARNT:ARNT2 protein was variable among the different cells with the NRK-49F rat kidney cells show ing a near equal ratio (1.3:1), and the A498 cells showing the lowest (7.2:1). Thus, th ese studies confirm that ARNT and ARNT2 can be co-expressed in the same cell and provi de novel models for the future analysis of the physiological intera ctions of these proteins in AHR as well as other bHLH/PAS signaling pathways. 4.13 Analysis of ARNT2 Function When Endogenously Expressed Since the hRPE lines appeared to co-express both ARNT and ARNT2 endogenously as determined by SDS-PAGE a nd Western blotting, it was pertinent to assess the function of ARNT2 in these lines. Importantly, these lines also express AHR protein and CYP1A1 protein was induced in these cells in response to treatment with TCDD (Figure 4.23, lanes 3, 4). Using short-in terfering RNA (siRNA) against ARNT or ARNT2, levels of either ARNT or ARNT2 were decreased by >80% or by >50% respectively. Interestingly, reduction of ARNT led to complete ablation of CYP1A1 activity in response to TCDD, even though e ndogenous levels of ARNT2 continued to be expressed (Figure 4.23, lanes 5-8). While this agreed with pr evious data that suggested that ARNT2 was not capable of substituting for ARNT in the induction of CYP1A1 in cell culture (Figures 4.2-4.4), it is in contrast to unpublished st udies from this laboratory that suggest that low levels of ARNT ar e sufficient for CYP1A1 induction (RSP). Reduction of ARNT2, however, showed no alteration of the ability to induce CYP1A1 in response to TCDD (Figure 4.23, lane s 9-12). This result was intriguing in

PAGE 185

167 Figure 4.23: Reduction of endogenous ARNT or ARNT2 by siRNA knockdown in hRPE cells. A, hRPE cells were transfected w ith siRNA specific to ARNT (siA) or ARNT2 (siA2) or control siRNA (siCON) as detailed in Chapter Six Forty-eight hours later, cells were dosed with Me2SO (0.5%) or TCDD (5nM) for 6 h at 37C, and equal amounts of total cell lysates were resolved by SDS-PAGE, blotted and stained with either anti-AHR IgG (1g/ml), anti-ARNT IgG (1 g/ml ), anti-ARNT2 IgG (1:500), antiCYP1A1 IgG (1:200), or anti-actin IgG (1:1000). Reactivity was visualized by ECL with GAR-HRP (1:10,000). Each lane represen ts and independent sample. B, computer densitometry was used to determine the re lative level of ARNT or ARNT2 protein present in the samples presented on the blot in A. Each column represents the relative densitometry units of an individual band and shows the level of re duction of each protein following siRNA treatment.

PAGE 186

168 light of the results presented in Figure s 4.20-4.21 that suggested that ARNT2 could inhibit induction of CYP1A1 in Hepa-1 cel ls. Interestingly, reduction of ARNT2 by siRNA did not appear to increase induc tion of CYP1A1 protein induction following treatment with TCDD suggesting that co-expre ssion of ARNT2 with ARNT in the hRPE lines does not appear to have an inhibito ry effect on the induction of CYP1A1 in response to TCDD. However, pr evious studies in this laborat ory have demonstrated that ARNT when reduced to 10-15% of its e ndogenous concentration in Hepa-1 cells maintains its ability to fu nction in AHR-mediated signali ng with visible induction of CYP1A1 protein via Western blotting as a re sult of its endogenous expression level being 10-fold greater than that of the AHR protein (Holmes and Poll enz, 1997). In the case of this experiment, reduction of ARNT to 10% its normal concentration le d to an inability to complement AHR-mediated signaling. Theref ore, it is possible that ARNT2 has an inhibitory effect on ARNT only when expressed to a greater level than ARNT as seen in both the transient transfections in WT cells and following siRNA against ARNT. Thus, the ratio of ARNT to ARNT2 may be important to AHR-signaling in cells co-expressing both ARNT proteins. Co-siRNA treatment ag ainst both ARNT and ARNT2 may assist in demonstrating this possibility, whereby if th e above hypothesis were correct, it would be expected that in hRPE cells reduced in both ARNT and ARNT2, the 10% of ARNT remaining would then remain able to comple ment AHR-mediated signaling as a result of loss of the repressive ARNT2 expression. This is also particularly intriguing given that NRK cells, which express higher levels of AR NT2 than the hRPE cells, appear to be unable to induce CYP1A1 in the presen ce of TCDD, although the ARNT and AHR

PAGE 187

169 proteins are expressed. As su ch, reduction of ARNT2 in these lines may restore CYP1A1 induction if ARNT2 is truly inhi biting this signaling pathway. 4.14 ARNT2 from Nuclear Extracts Fails to Bind XREs To confirm previous findings that AR NT and ARNT2 are equally capable of heterodimerizing and binding DNA when expressed in cell culture, nuclear extracts were prepared as detailed in Chapter Six from hRPE and NRK lines treated with Me2SO or TCDD for 1 hr. The resultant nuclear extracts were then evaluated for target protein expression by Western blotting and DNA binding assessed by EMSA analysis. Representative results are shown in Figure 4.24. In striking contra st to the results presented in Figures 4.7-4.19, these EMSA a ssays revealed no evidence of XRE binding requiring ARNT2. Instead, while the typi cal TCDD-dependent DNA binding shift was evident in both the NRK and hRPE lines, incl usion of IgG against either ARNT or AHR ablated all evidence of DNA binding, while incl usion of ARNT2 IgG had no effect. This suggests that ARNT2 was not contributing to the level of DNA binding seen following TCDD treatment in these lines, though ARNT2 c ould be detected in the nuclear extracts of both lines (Figure 4.24 C, data not shown for RPE). Since these lines exhibit a reduced leve l of ARNT2 in comparison to ARNT, it is possible that the reduced leve l of ARNT2 was leading to an inability to visualize AHR•ARNT2 DNA binding. To assess whethe r the lack of apparent ARNT2 binding was a sensitivity issue or was specific to nucl ear extracts, cytosolic extracts were also prepared from NRK cells and in vitro activated with Me2SO or TCDD as previously described since cytosolic extracts of Hepa-1 cells exogenously expressing ARNT2 were

PAGE 188

170 Figure 4.24: DNA binding of NRK a nd hRPE nuclear extracts. Nuclear extracts from NRK and hRPE cells treated with Me2SO (0.5%, C) or TCDD (100nM, TC) for 1 hr at 37C were produced as detailed in Chapter Six A, B, 30g/well of nuclear extracts from NRK (A) or RPE (B) cells were aliquoted and mixed with 32P-labeled XRE oligonucleotides and protein•DNA comp lexes resolved as detailed in Chapter Six In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), AHR (AH) or preimmune IgG were included in the binding reaction prior to loading on the gel. The location of the specific AHR•ARNT•XRE and AHR•ARNT2•XRE complex and free XRE are indicated. C, An aliquot of the nuc lear extract mixtures utilized in A were denatured and evaluated for AHR, ARNT, a nd ARNT2 expression by Western analysis. The Western blot was stained with anti-AHR IgG (1g/l), anti-ARNT IgG (1g/l), or anti-ARNT2 IgG (1:250) and visualized by ECL with GAR-HRP IgG (1:10,000).

PAGE 189

171 capable of exhibiting ARNT2-dependent DNA binding in the EMSA assay. Therefore, NRK cytosolic extracts were evaluate d for DNA binding potential by EMSA assay analysis and representative results are shown in Figure 4.25. Interestingly, in contrast to the results obtained for in vitro activated cytosol of Hepa -1 cells co-expressing ARNT and ARNT2, the NRK lines did not exhibit any evidence of the formation of DNA-bound complexes containing ARNT2 (Figure 4.25 A, la nes 3 and 4). However, when additional ARNT2 was added to the DNA-binding reaction, the cytosolic extrac ts exhibited very strong TCDD-dependent DNA binding shifts that could be supershifted with IgG against ARNT2, but not with pre-immune IgG (Fi gure 4.25 B). Therefore, these studies demonstrate that ARNT2 remains capable of forming XRE-bound complexes with the AHR in the NRK genetic background, suggesting that protein(s) in the NRK lines is not inhibiting the ability of ARNT2 to function in these assa ys. Thus, the lack of visible ARNT2 association with DNA in Figure 4.24 and 4.25 A may be a sensitivity issue rather than a biochemical one. To further evaluate this, nuclear extracts were also prepared from wild-type Hepa-1 cells and wild-type Hepa-1 cells transf ected with ARNT2 (WT+ARNT2), expressing high levels of ARNT2 in comparison to the low levels seen in NRK or hRPE lines. Western blot analysis of these nuclear extracts revealed a TCDD-dependent nuclear accumulation of both the AHR and ARNT, and revealed that ARNT2 appeared to be constitutively associated with nuclear structur es (Figure 4.26 A), similar to results seen in the NRK line (Figure 4.24 C). EMSA analysis of the nuclear extracts also revealed strikingly similar results to those obtained in the NRK and hRPE lines, wherein the typical TCDD-dependent DNA binding shift was evident in both the WT and

PAGE 190

172 Figure 4.25: DNA binding of NRK cytosolic extracts. Cytosolic extracts from NRK cells treated with Me2SO (0.5%, C) or TCDD (100nM, TC) for 1 hr at 30C were produced as detailed in Chapter Six A, 60g/well of cytosolic extracts from NRK cells were mixed with 32P-labeled XRE oligonucleotides and protein•DNA complexes resolved as detailed in Chapter Six In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), AHR (AH) or preimmune IgG were included in the bi nding reaction prior to loading on the gel. The location of the specific AHR•ARNT•XRE and free XRE are indicated. A, 15g/well of cytosolic ex tracts from NRK cells were mixed with 32Plabeled XRE oligonucleotides and protein•DNA complexes resolved as detailed in Chapter Six In some samples, in vitro synthesized ARNT2 (A2) was included in the binding reaction prior to loading on the gel. The location of the specific AHR•ARNT•XRE, AHR•ARNT2•XRE, and free XR E are indicated. In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), AHR (AH) or preimmune IgG were included in the binding reaction prior to loadi ng on the gel. The location of the specific AHR•ARNT•XRE is indicated.

PAGE 191

173 WT+ARNT2 lines, but inclusion of ARNT2 Ig G had no effect, while inclusion of IgG against either ARNT or AHR ablated all ev idence of DNA binding. These data again suggested that ARNT2 was not contributing to the level of DNA binding seen following TCDD treatment in the WT+ARNT2 lines (F igure 4.26 B). This was particularly intriguing since in vitro activated cytosolic extracts of Hepa-1 cells expressing both ARNT and ARNT2 showed disparate results wherein XRE-bound complexes could be supershifted with ARNT2 IgG (Figure 4.19). However, since ARNT2 appeared to be constitutively associated with nuclear stru ctures even in the absence of TCDD and did not show a large increase in nuclear extrac t protein levels following TCDD treatment, unlike the ARNT or AHR protein, it is possibl e that ARNT2 is inaccessible to the AHR during the transformation of the AHR comple x into an AHR•ARNT/2 heterodimer. If this were true, it may be pertinent to asse ss whether the addition of ARNT2 to nuclear extracts from NRK cells woul d generate AHR•ARNT2 dimers as seen with cytosolic extracts in Figure 4.25. If excess ARNT2 le d to the formation of AHR•ARNT2 dimers, this would further suggest that AHR rema ins capable of dimerizing with ARNT2 and binding DNA in cell culture and that ARNT 2 may have an endogenous function that impairs its ability to freely associate with the ligand activated AHR in the nucleus. Thus, further studies should be performed to assess the ability of ARNT2 is olated from nuclear extracts to function during AHR signaling and to further identify possible reasons for the difference between in vitro activated cytosolic ARNT2 to dimerize with the AHR versus ARNT2 from nuclear extracts.

PAGE 192

174 Figure 4.26: DNA binding of Hepa-1 nuclear extracts. Nuclear extracts were generated from wild-type Hepa-1 cells transfected with nake d vector (WT) and wild-type Hepa-1 cells transfected with ARNT2 (WT+A2) dosed with Me2SO (0.5%, -) or TCDD (100nM, +) for 1 hr at 37C we re produced as detailed in Chapter Six A, An aliquot of the nuclear extract mixtures utilized in B were denatured and evaluated for AHR, ARNT, and ARNT2 expression by Western analysis. The Western blot was stained with antiAHR IgG (1g/l), anti-ARNT IgG (1g/l), or anti-ARNT2 IgG (1:250) and visualized by ECL with GAR-HRP IgG (1:10,000). B, 30 g/well of nuclear extracts from WT or WT+A2 cells were mixed with 32P-labeled XRE oligonucleotides and protein•DNA complexes resolved as detailed in Chapter Six In some samples, 50ng of IgG specific to ARNT (A1), ARNT2 (A2), AHR (AH) or pr eimmune IgG were included in the binding reaction prior to load ing on the gel. The location of the specific AHR•ARNT•XRE is indicated.

PAGE 193

175 Conversely, another possibility for the a pparent lack of DNA binding in nuclear extracts from lines expressing ARNT a nd ARNT2 is that AHR•ARNT2 dimers are forming in these extracts, but are unable to bind DNA. If this were the case, then immunoprecipitation analysis of nuclear extracts should rev eal the presence of such dimers. To test this hypothesis, nuclear extr acts were prepared from NRK cells and wildtype Hepa-1 cells transfected with ARNT2 (WT+A2), and subjected to immunoprecipitation analysis us ing anti-AHR IgG. Additionally, these samples were compared to cytosolic extracts generated fr om both lines, since cytosolic extracts from WT+A2 did exhibit AHR•ARNT2 dimerization and therefore, should act as a positive control for the nuclear extracts. Represen tative results are presented in Figure 4.27. Immunoprecipitation of the NRK extracts re vealed that precipitation of the AHR specifically co-precipitated AR NT in nuclear extracts of TC DD treated cells (Figure 4.27 A). In contrast, ARNT2 did not appear to co-precipitate with the AHR in any of the NRK samples. However, since the proporti on of AHR or ARNT2 precipitated in the nuclear extracts was less than 15% of the am ount seen in the input, it was again possible that sensitivity of the ARNT2 antibodies was an issue in this assay since 15% of the already low levels of ARNT2 expressed in the NRK line would be undetectable. Future studies employing a more sensitive ECL such as SuperSignal West Femto Maximum Sensitivity Substrate ECL kit (Pierce, Rockford, IL) or precipitation of larger amounts of nuclear extract could help to resolve this issue. In contrast to the studies shown in Figure 4.27 A, immunoprecipitation of the WT+A2 extracts revealed that precipitation of the AHR specifically co-precipitated ARNT in nuclear extracts of TCDD treated cells, but co-preci pitated ARNT2 in all of the

PAGE 194

176 Figure 4.27: Immunoprecipitation analysis of NRK and WT Hepa-1 cells expressing ARNT2. Cytosolic extracts (CY) from NRK cells (A ) or wild-type cell s transfected with ARNT2 (B) were treated with Me2SO (0.5%, C) or TCDD (100nM, TC) for 1 hr at 30C and were produced as detailed in Chapter Six Nuclear extracts (NE) from these lines were generated from lines treated with Me2SO (0.5%, C) or TCDD (10nM, T) for 1 hr at 37C and were produced as detailed in Chapter Six 800ug of cytosolic extracts or 300ug of nuclear extracts were then incubated with 1 g monoclonal anti-AHR IgG (IP) or preimmune IgG (Pi) for 1 hr at 4oC or saved for analysis of input (Input). The samples were then precipitated with protein A/G agarose beads, washed with TTBS and the boiled in the presence of 1x gel sample buffer. Equa l amounts of sample were resolved by SDSPAGE, blotted and stained with A-1A antiAHR IgG (1ug/ml), anti-ARNT IgG (1ug/ml), or anti-ARNT2 (1:500) and visualized by ECL with GAR-HRP IG (1:10,000). The precipitated IgG band is shown to demonstrate the uniformity of the precipitation across all samples.

PAGE 195

177 samples evaluated with the greatest levels of AHR associated ARNT2 present in the nuclear extracts from TCDD treated cells; howev er, these nuclear extr acts could not bind DNA in the EMSA assay (Figure 4.27 B, Figure 4.26). Numerous studies were performed to examine the specificity of th e AHR antibody that provide evidence that the monoclonal AHR antibody used for these analys es would not non-specif ically precipitate the ARNT2 protein (data not s hown). However, due to the very high levels of ARNT2 expression resulting from the transient tran sfection of the wild-t ype cells, it was also possible that the interaction itself was nonspecific, particularly since ARNT2 coprecipitated with the AHR even in Me2SO treated cells. Therefor e, this hypothesis is yet unclear and future studies should continue to assess whether AHR•ARNT2 dimers are forming that are unable to bind DNA. 4.15 Function of ARNT Versus ARNT2 in Hypoxic Signaling To confirm that ARNT2 is functional in ot her signaling pathways that are believed to involve ARNT2 and where its involvement has been supported by the previously described knockout studies as detailed in Chapter One the ability of ARNT2 to complement loss of ARNT in hypoxia-mediated signaling was evaluated. To evaluate the potential role of ARNT2 during hypoxia, va rious ARNT constructs were transfected into LA-II cells along with an HRE controlled luciferase reporter and were then subjected to physiological hypoxia for 14 hours. Represen tative results are given in Figure 4.28 A. These results demonstrate a functional role for ARNT2 in hypoxia-mediated signaling and functional activity for our ARNT2 construct. In LA-II cells tran sfected with either murine ARNT2 or zebrafish ARNT2, high levels of HRE controlled luciferase activity

PAGE 196

178 were seen following 16 hours of hypoxia that we re similar to those seen in LA-II cells transfected with murine ARNT. To correlate th ese data to results obtained in cell culture, NRK cells endogenously expressing ARNT and ARNT2 were cultured under normal conditions or in the presence of TCDD as cont rols or cultured in the presence of Cobalt chloride (CoCl2) or desferrioxamine (DFO), known chemical inducers of hypoxia (Cain, 1975; Myers et al., 1985; Nielse n et al., 1987; Wang and Semenza, 1993). As previously shown, following 1 hr treatment with TCDD, ARNT but not ARNT2, accumulated in nuclear extracts prepared from NRK cells (F igure 4.28 B). In contrast, both ARNT and ARNT2 protein increased in nuclear extrac ts in response to the hypoxic inducers CoCl2 or DFO, suggesting a functional DNA binding response for both ARNT proteins during the hypoxic response. Further analysis to ex amine specific gene regulation requiring the ARNT proteins as well as their ability to interact with HIF and bind HREs should be performed in the future, but, importantly, thes e initial results indicate that the ARNT2 used in the previously descri bed studies is capable of functioning in the hypoxic response and therefore a lack of response during AHR signaling is not an artifact of a nonfunctional ARNT2 construct. 4.16 Evaluation of Potential ARNT and ARNT2 Homodimers ARNT has also been implicated in serv ing as a transcripti onal regulator in a homodimeric form, based on early studies in which it was demonstrated that during size exclusion HPLC of Sf9 whole cell lysates, ARNT was eluted as a single peak with a molecular mass of 205 kDa (Sogawa et al., 1995). These studies also demonstrated that ARNT could form homodimers via the HLH/PA S domains, had affinity for the core

PAGE 197

179 Figure 4.28: Analysis of the role of ARNT2 in hypoxia. LA-II cells were transfected with identical amounts of ARNT or ARNT2 vector and with pSV-Galactosidase along with an HRE-controlled luciferase reporter and cultured in 5% O2 for 14 hrs. Hypoxia responsive luciferase activity and -Galactosidase activity were measured as previously described in Chapter Six and (Zeruth and Pollenz, 2007). All luciferase values were normalized to -Galactosidase. LA-II = parental cells transfec ted with naked vector; ARNT = LA-II cells expressing ARNT; AR NT2 = LA-II cells expressing ARNT2, zfARNT2 = LA-II cells expressing ARNT2 from the zebrafish, Danio rerio B, Cytosolic (CYTO) and nuclear extracts (NE) from wild-type Hepa -1 cells transfected with ARNT2 were cultured untreated (C), or in the presence of TCDD (2 nM, T), Cobalt Chloride (100 M, Co), or Desferrioxamine (100 M, D) for 1 hr at 37C were produced as detailed in Chapter Six Arrows below indicate accu mulation of ARNT and ARNT2, but not AHR in response to hypoxia induced by Cobalt Chloride or Desferrioxamine.

PAGE 198

180 sequence of the adenovirus major late prom oter (MLP) containing the canonical E-box (5’CACGTG) sequence, and could drive expr ession of E-box contro lled reporters when produced in vitro similar to the activities of othe r E-box binding proteins MyoD, Max, and USF. Further studies showed similar results, again suggesting that ARNT homodimerize, could associate with the Ebox sequence and could competitively displace the c-Myc/Max heterodimer from binding to the E-box, though the ability of ARNT to homodimerize may be dependent upon ARNT phosphorylation status (Antonsson et al., 1995; Huffman et al., 2001; Levine and Perdew, 2001; Levine and Perdew, 2002; Swanson et al., 1995; Swanson and Yang, 1999). However, no studies have attempted to examine ARNT homodimerization using full-leng th proteins expresse d in cell culture. Additionally, ARNT2 homodime rization has not been evaluated except by means of yeast-two hybrid interactions us ing truncated ARNT2 proteins. Furthermore, the idea of ARNT•ARNT2 interactions have not yet been proposed since it was believed that these proteins are not co-expressed. Therefore, the ability of ARNT or ARNT2 to serve a homodimeric role was analyzed as was th e potential for ARNT•ARNT2 interactions. To begin to analyze whether or not these interactions were oc curring, constructs for each ARNT were generated that possessed a Hi sMax (HM) or V5 epitope tag as detailed previously and in Chapter Six In each case, in vitro synthesized HM-ARNT was mixed with V5-ARNT, HM-ARNT with V5-ARNT 2, V5-ARNT and HM-ARNT2, or untagged ARNT and ARNT2. Alternativel y, sets of ARNT and ARNT2 were transfected into the ARNT deficient LA-II cells. In either case, immunopr ecipitation analyses were performed using antibodies against HM, V5, ARNT, or ARNT2 to assess the potential interactions of each protein. For example, LA-II cells were tran sfected with either

PAGE 199

181 HisMax (HM) tagged ARNT (or HM-ARNT2) and V5 tagged ARNT (or V5-ARNT2) or both ARNT and ARNT2. For the HM-A RNT•V5-ARNT and HM-ARNT2•V5-ARNT2 homodimerization studies, either ARNT or ARNT2 was immunoprecipitated using HM or V5 antibodies and Western blot analysis of each sample stained with the opposing antibody. For the ARNT•ARNT2 dimeriza tion study, either ARNT or ARNT2 was immunoprecipitated with ARNT or ARNT2 anti bodies and Western blots stained for the presumed partner. Interestingly, ARNT and ARNT2 showed little ability to homodimerize or heterodimerize with each ot her (data not shown). However, it is recognized that even in the event that such interactions were occurring, immunoprecipitation analyses woul d be able to resolve only a portion of these. In a mixture of HM-ARNT and V5-ARNT, where ARNT was capable of homodimerizing, it is possible that HM-ARNT•HM-ARNT, V5-ARNT•V5-ARNT, or HM-ARNT•V5ARNT interactions would occur as would a portion of non-dimerized ARNT proteins in all likelihood. Thus, the pool of HM-ARN T•V5-ARNT would likely only represent at most ~1/3 of total ARNT complexes and ther efore, detection of these dimerized species may be limited by the sensitivity of the assay. In a further attempt to analyze the potential formation of ARNT or ARNT2 homodimers, EMSA analyses using an E-box probe from the adenovirus major late promoter (MLP) were performed using cyto solic or nuclear extracts from cells endogenously expressing both ARNT proteins (RPE, NRK), wild-type Hepa-1 cells expressing ARNT, or Hepa-1 cells tran sfected with ARNT2 as detailed in Chapter Six In these analyses, a specific shift was observed that was not seen in the presence of a labeled mutant E-box probe, but this shift c ould not be supershifted with antibodies

PAGE 200

182 against ARNT or ARNT2, suggesting the i nvolvement of other E-box binding proteins (data not shown). A similar lack of ARNT or ARNT2 E-box binging was also obtained using in vitro synthesized ARNT proteins or unprogrammed reticulocytes (data not shown). Again, however, it remains possible th at such dimers exist yet do not associate with the adenovirus E-box as fl anking nucleotides may also pl ay a role in transcription factor DNA binding. Thus, while th ese studies failed to identify in vivo ARNT or ARNT2 dimerization or the presence of ARNT •ARNT2 dimers, they emphasize the need to identify in vivo ARNT or ARNT2 homodimers as we ll as the inherent difficulty of performing such studies. While ARNT homodime rs have been implicated in the partial regulation of CYP2A5 (Arpiainen et al., 2007) these studies focuse d on the regulation of CYP2A5 in the presence or absence of ARNT, which may be impacting more than ARNT alone.

PAGE 201

183 Chapter Five Implications and Future Directions 5.1 Implications of AHRb-2 Studies The AHRb-1 allele carried by the C57BL/6J murine strain contains a point mutation that prematurely truncates the receptor at 805 amino acids, while the AHR found in other murine strains as well as in the rat and human all contain an additional 4245 amino acids at their carboxy-terminus that have 70% identity (Figure 1.3, Table 1.3). Thus, as detailed throughout Chapters One and Two the current model system used for the evaluation of the physiological role of the AHR, which focuses on using the C57BL mouse and hepatoma cells isolated from this murine strain to assess AHR function, may not be the most accurate model. Furthermore, the results of this report detail a possible functional role of this extended carboxy-term inal sequence, either through an altered AHR conformation resulting from the presen ce of this extended sequence or through a direct function of this region in the association of the AHR with XAP2. Collectively, the results presented in Chapter Two also describe the impact of this extended region on AHR subcellular localization and degradation, which differ between Ah receptor species. Furthermore, the use of a genetically iden tical background to examine the function and degradation rate of the AHRb-2 in comparison with the AHRb-1 was ideal and provided significant insights into the biological properties of th e AHR contributed by this

PAGE 202

184 functional region, which, im portantly, were mimicked in alternate cell lines endogenously expressing the AHRb-2. Similarly, studies of XAP2 function in AHR-mediated signal transduction have focused on the interactio ns of XAP2 with the Ahb-1 receptor and have also been based primarily on the analysis of XAP2 in transient transfection systems using AHR-deficient COS-7 cells. Collectively, these studies s uggested that XAP2 may influence the stability, subcellular localization, and overall expression of the AHR (Bell and Poland, 2000; Berg and Pongratz, 2002; Carver and Bradfield, 1997; Kazlauskas et al., 2002 ; LaPres et al., 2000; Lees et al., 2003; Ma and Whitlock, 1997; Meyer and Perdew, 1999; Meyer et al., 2000; Meyer et al., 1998; Petru lis et al., 2003; Ramadoss a nd Perdew, 2005). However, there has been minimal information on the function of endogenous XAP2 as it relates to interactions with endogenous AHR proteins from species other than the murine C57BL/6J strain since there has been a ge neral assumption that the functions ascribed to XAP2 for the Ahb-1 receptor complex are universal for all other Ah recept or species as is the function of the AHR itself. The key fi ndings of the current report challenge this view by showing that (i) the level of endogenous XAP2 that associates with the AHR is receptor species specific, wherein the AHRb-1 associates with a level of XAP2 that is much greater then other mammalian AHR protei ns characterized in this report independently of its genetic background, (ii) the leve l of XAP2 associating with the AHR may partially alter the subcellular location of the AHR, wherein a high level of XAP2 association with the Ahb-1 receptor leads to cytoplasmic retenti on of the latent AHR complex, while AHR proteins exhibiting reduced association with XAP2 appear to dynamically shuttle through the nucleus, (iii) increased XAP2 associati on with the AHR may decrease the rate of

PAGE 203

185 ligand-induced degradation of the AHR, and (iv) association of XAP2 with the Ahb-1 receptor may stabilize a portion of the AHR popu lation in that ~30% of the total cellular levels of AHR remain even in the presence of TCDD for 6 hours, whereas >90% loss of endogenous Ahb-2 receptor is achieved under the same conditions. Since these associations are maintained even when each receptor species is expressed in the same genetic background (ie: in the presence of the same total le vels of XAP2 and AHR), these results collectively imply that XAP2 may only impact AHR-mediated signaling in the context of the Ahb-1 receptor and suggest that the analysis of the AHR-mediated signaling via rat and mouse Ahb-2 receptors may better represent the physiology of this signal transduction pathway across species and in the human. Since these studies revealed bioc hemical differences between the Ahb-1 receptor and AHR proteins from other mammalian speci es, it will be important to assess the functional relevance of these di fferences, particularly in term s of gene regulation. Since genetic variation will always complicate such st udies if different cell lines or organismal models are used, the model system of expressi ng each receptor to the same level in the same genetic background using the same promot er will prove useful for such studies. Additionally, non-mammalian Ah receptors coul d be placed in the same genetic context as the Ahb-1, though it is possible that non-murine Ah receptors would exhibit differences from the Ahb-1 or from their endogenous physiology as a result of not having their specific species AHR pathway components. Ho wever, since such studies can always be compared to lines endogenously expressed al ternate AHR species, such studies could be performed if care is taken to ensure that th e results obtained are indeed related to AHR function.

PAGE 204

186 High levels of XAP2 asso ciation with the AHR have also been linked to displacement of p23 from hsp90 (Hollingshead et al., 2004). However, these studies focused on overexpression of cellular XAP 2 in COS cells transfected with Ahb-1 receptor and an increase in XAP2 association with the AHR was minimal (Hollingshead et al., 2004). Since the studies shown in this report suggest that 100% of the Ahb-1 receptor pool is associated with XAP2 (Figure A-5), it is not surprising that no increase in XAP2 association was seen when XAP2 was overe xpressed. Thus, such studies should be repeated in the context of other AHR species that exhibit reduced XAP2 association and, preferably, in cells stably expressing the AHR to reduce population differences resulting from transfection efficiency. Importantly, p23 appears to be involved with stabilization of the latent AHR complex with Hsp90 and th e subsequent ability of the AHR complex to heterodimerize with ARNT, and is also involved in the modulation of function for many intracellular receptors such as the gl ucocorticoid receptor and members of the intracellular receptor family (D ittmar et al., 1997; Freeman et al., 2000; Shetty et al., 2003; Wochnik et al., 2004). In light of these studies, it could be suggested that increased XAP2 association with the AHR would lead to displacement of p23 and subsequent de stabilization of the latent AHR complex; however, the opposite of this effect was observed. In the studies described in Chapter Two the Ahb-1 exhibits high XAP2 associ ation and, yet, exhibits increased stabilization, though the studi es by Hollingshead et al. (2004) would imply that high levels of XAP2 association with the AHR would result in th e displacement of p23 and subsequent destabilization the AHR comple x. Thus, it would be pertinent to reassess the studies performed by Hollingshead et al. (2004). To ev aluate this, the Ahb-1 and the

PAGE 205

187 non-Ahb-1 receptors examined in this report, whic h exhibited differential association with XAP2, should be evaluated for p23 associati on in the latent AHR complexes. Such studies could easily be performed using th e same techniques as those shown for AHR•XAP2 analysis. If non-Ahb-1 receptor species exhibit increased p23 association, these data would be supportive of XAP2’s role in displacement of p23, yet would then appear to be contradictory of the reported role of p23 in stabiliz ation of the AHR since these receptor species undergo a more rapid degradation following ligand-activation. Likewise, unless non-Ahb-1 receptor species exhibited decreased p23 association, which would not be supportive of XAP2’s role in displacement of p23, there would be no apparent correlation between AHR•hsp90• p23 association and the role of p23 in stabilization of the AHR. However, since Ahb-2 complexes can be generated that associate with increased levels of XAP2 (Figures 2.7 and 2.8) compared to endogenous Ahb-2 when XAP2 is transfected into AHb2 stable lines, these lines will be an ideal model for directly analyzing the rela tionship between the associatio n of AHR•XAP2 and that of hsp90•p23 since the effect of increasing XAP2 association with the AHR can be evaluated in the context of a receptor capable of exhibiting such an increase. XAP2 knockout studies have also recently been performed in the C57BL/6J mouse (Lin et al., 2007). In these studies, knockout of XAP2 was embryonically lethal with most homozygous null mice dying by embryonic day 15-17 as a result of severe vascular and cardiac abnormalities includi ng the presence of a double outlet right ventricle (DORV) and reduced blood flow to the extremities, suggesting a role for XAP2 in cardiac development. The authors of this study suggest that thes e data indicate a role for XAP2 outside of AHR and PPAR function. It is striking, however, that AHR

PAGE 206

188 signaling has also been implicated in cardiac de velopment by other studies in that i) AHR null mice have been demonstrated to e xhibit cardiac hypertrophy resulting from thickened ventricular walls a nd increased cellular proliferation in the heart and ii) TCDDtreated mice have been shown to also exhibit cardiac hypertrophy, edema, and an increased formation of ventricular septal defects (VSDs), which are highly associated with DORV (Thackaberry et al., 2003; Walker et al., 1997). Since loss of XAP2 in the C57BL/6J mouse Hepa-1 cell line results in increased nucleocytoplas mic shuttling of the AHR and a more rapid degradation profile, loss of XAP2 in the C57BL/6J mouse may lead to altered regulation of AHR target genes or complete depletion of the AHR in the presence of ligand and in either case, may be contributing to the formation of DORV. Furthermore, since it appears that XAP2 may stabilize a portion of the AHR in the C57BL/6J mouse, cardiac abnormalities seen with loss of XAP2 could correlate with results obtained through loss of the AHR in knockout or TCDD-treated mice; however, C2C12 mice do not constitutively deve lop cardiac conditions though the Ahb-2 is endogenously associated with reduced levels of XAP2. Therefore, it remains possible that loss of XAP2 contributes to forma tion of DORV through disruption of AHR signaling by destabilization of th e receptor in the presence of ligand. However, since the authors chose to evaluate loss of XAP2 in the C57BL/6J mouse, which expresses the Ahb-1 receptor that associates with high levels of XAP2, it would be pertinent to assess loss of XAP2 in the BALB/cBy or C3H mouse as well, which express the Ahb-2 receptor that associates with reduced levels of XAP2. Care should al so be taken that the animal foods being used contain no AHR agonists as th e presence of AHR ligands would lead to loss of AHR and could contribute to cardiac abnormalities. Such studies may further

PAGE 207

189 support evidence that the effects of loss of XAP2 could be mediated through AHR signaling if different physiological abnormalities are seen in different murine strains. FKBP12 (human FKBP51) is structurally similar to XAP2 and both proteins contain FK (FK506-binding), TPR (tetratricopept ide), and peptidylprolyl isomerase (PPI) domains, and both proteins associate w ith Hsp90 through the TPR domain, yet XAP2 lacks the ability to bind immunosuppressive drugs through its FK domain and also appears to lack PPI activity in which PPI in teracts with dynein to regulate receptor localization (Carver et al., 1998; Galigniana et al., 2002; Gali gniana et al., 2001). Instead, XAP2 interacts with the AHR through its FK domain (Meyer et al., 1998; Peattie et al., 1992). It is also striking, however, th at loss of the immunophilin FKBP12, which functions in the release of Ca2+ from the sarcoplasmic reticul um in skeletal muscle, in knockout mice is also embryonic lethal, lead ing to death between embryonic day 14.5 and birth, resulting from cardiac hypertrophy and VSDs (Shou et al., 1998). Furthermore, these effects are seen only in male FKBP12 null mice, while null-females exhibit cardiac hypertrophy only in the presence of estroge n receptor antagonist s, though both sexes exhibit deficiencies in Ca2+ release. Thus, these results suggest a role for estrogen in protection from loss of FKBP12 induced cardi ac hypertrophy. It may also then be pertinent to assess whether female XAP2 nu ll mice exhibit a similar lack of cardiac hypertrophy as seen in males. Mutations in the FK domain of XAP2 (R304X), which contains an AHR binding region, have also been implicated in predispos ition for pituitary adenomas (Georgitsi et al., 2007; Vierimaa et al., 2006). Since little is known regarding the function of XAP2 outside of its interaction with the AHR, future studies should also therefore be aimed at

PAGE 208

190 further analyzing the potentia l physiological role(s) of XAP 2, focusing on its apparent role in cardiac development and whet her XAP2 also serves a role in Ca2+ regulation since knockout of FKBP12 resembles that of XAP2. Such studies coul d involve yeast twohybrid screens to identify XAP2 interacting proteins, conditional knockouts of XAP2 in the heart, and Northern or microarray an alysis of cardiac tissues in XAP2 and XAP2-/animals, followed by molecular eval uation of potential gene targets. 5.2 Implications of AHR Degradation Studies Importantly, association with XAP2 may also affect AHR degradation. Following TCDD binding, the AHRb-1 is rapidly depleted by 80-95% within 4-6 hours of treatment in numerous cell culture models and does not return to basal le vels as long as ligand is present in the media (Pollenz, 1996; Re ick et al., 1994). As detailed in Chapters Two and Three, this degradation is even more rapid with the Ahb-2, human or rat receptors, which deplete by 90-100% within 2 hours of treat ment. The importance of this loss is underscored by the variety of phys iological defects seen in AHR-/mice (Andreola et al., 1997; Fernandez-Salguero et al., 1995; G onzalez et al., 1995; Mc Donnell et al., 1996) and the evidence that a single oral dose of TCDD can lead to sustai ned depletion of AHR proteins in the liver, spleen, thymus, and lung in vivo and that such a depletion correlates with reduction in TCDD-mediated reporter ge ne expression in mammalian culture cells following a second dose of TCDD (P ollenz et al., 1998). It is important to note that many of the phenotypes seen in TCDD-treate d mice are similar to those reported for AHR-/mice that have not been exposed to TCDD. Thus, this loss of AHR may contribute to some of the bi ological effects of xenobiotics. Degradation of the AHR,

PAGE 209

191 therefore, which may be used as a means of attenuating the transcri ptional response, can have significant repercussions on the future signaling ability of the AHR pool as well as biological implications. Thus, a more rapid degradation prof ile in animals expressing alternate Ah receptor species w ould likely impact the toxic e ffects that result from loss of receptor, particularly since the AHRb-1 does not appear to exhi bit >80% reduction in cell culture, while the AHRb-2 and rat AHR appear to be nearly 100% degraded in response to TCDD. Thus, in the presence of suffici ent TCDD or other PAHs or HAHs, animals expressing non Ahb-1 receptors may exhibit increased sus ceptibility to these toxins as a result of total loss of receptor, particular ly if the AHR has other endogenous functions that may not be disrupted with >20% AHR remaining. Conversely, blockage of degradation by the translation inhibitor CHX in the context of a functional AHR appears to result in potentiation of gene induction (superinduction), whereby genes regulated by th e AHR are induced to a higher level and for a longer period of time (Ma and Ba ldwin, 2000; Pollenz and Barbour, 2000). However, in stable lines expressing amino-te rminally tagged AHR prot eins that exhibit a reduced magnitude of degradation, but are capable of inducing CYP1A1 (Figures 3.14 and 3.15), superinduction at the protein level is not readily apparent. In fact, the GFPAHR exhibits both a reduced magnitude of de gradation as well as a reduced level of CYP1A1 induction (Figure 3.15). This suggests that blockage of AH R degradation is not sufficient for superinduction of CYP1A1, a lthough evaluation of CYP1A1 at the mRNA level should also be performed since the studies describing superinduction using CHX could not evaluate CYP1A1 protein.

PAGE 210

192 From the results presented in this report, it appears that the AHR can be degraded through several distinct mechanisms: (i) li gand-dependant degradation that can be blocked by pre-treatment with the transcription inhibitor AD or the translation inhibitor CHX without affecting nucle ar localization or DNA binding ability of the receptor (Pollenz et al., 2005) that requires DNA binding by AHR•ARNT, which suggests that both active transcription and translation by AHR•ARNT are necessary for ligand-induced degradation of the AHR, (ii) ligand-depende nt degradation in which carboxy-terminal truncated Ah receptors (Pollenz et al., 2005) as well as those defec tive in DNA binding or ARNT dimerization ( Chapter Three ) similarly exhibit a very low level of degradation following treatment with TCDD; however, this degradation does not require DNA binding and cannot be blocked by either AD or CHX, suggesting that this loss is not representative of the typical degradation se en following ligand binding with the wild-type receptor, (iii) ligand-independent degradati on typified by treatment with geldanamycin (GA) that leads to nuclear tr anslocation of the receptor and its subsequent degradation, but cannot be blocked by treatment with eith er AD or CHX and occurs without disruption of the AHR complex itself and, importantl y, without DNA binding or subsequent gene induction (Chen et al., 1997; Meyer et al ., 2003b; Song and Pollenz, 2002), and (iv) endogenous turnover of the AHR about which little is known. Thus, the precise mechanisms involved with regulating the degradation of the AHR are still not resolved. It is intriguing to consider that several studies have shown that the degradation of some nuclear receptors is correlated to transactivation, DNA binding, and the recruitment of co-activators to the pr omoter/enhancer region of responsive genes (Reid et al., 2003; Salghetti et al., 2001; Verma et al., 2004), which

PAGE 211

193 appears to be the case with ligand-in duced degradation of the AHR. The strong association of XAP2 with the Ahb-1 receptor complex (as compared with rat and Ahb-2 receptors), may slow down the transformation process and prevent a population of AHRs from interacting with ARNT, binding DNA, a nd being degraded as may the presence of amino-terminal tags on the AHR, though these characteristics have not been directly assessed. To assess this, it would be possible to examine the intensity of DNA binding of in vitro expressed Ahb-1 receptor and ARNT in rabbit reticulocytes. Unprogrammed reticulocytes can be assessed for XAP2 expr ession by Western blotting to determine whether or not they express XAP2 endogenously If so, rabbit reticulocytes could be used from which XAP2 had been removed. Th is could be achieved using a Millipore centricon filtration device followed by imm unodepletion of the ~37 kDa fraction using XAP2 IgG and protein A/G beads in a manner si milar to that outlined by Shetty et al. (2004). In either case, in vitro produced XAP2 could be added along with AHR and ARNT in activation reactions in increasing amounts and por tions of each activation reaction removed every 15 min for 2 hours and run on an EMSA as previously described to examine AHR•ARNT DNA binding. A portion of each sample could also be immunoprecipitated to examine the associati on of XAP2 with the AHR complex. In the presence of increasing XAP2 up to saturation of the AHR, it would be expected that the presence of XAP2 would stabilize th e AHR complex and slow the AHR•ARNT transformation process as evidenced by a d ecreased intensity of DNA binding in XAP2 containing activation reactions at earlier time points of analysis. A significantly reduced effect on the transformation ability and AHR saturation point would be expected in the

PAGE 212

194 context of non-Ahb-1 receptors since these receptor sp ecies exhibit reduc ed association with XAP2. Interestingly, recent studies also suggest that the Ahb-1 receptor remains associated at the CYP1A1 promoter during lig and stimulation in Hepa-1 cells, whereas the human AHR shows periods of asso ciation and dissociation at the CYP1A1 promoter in MCF-7 cells (Hestermann and Brown, 2003; Wang et al ., 2004). Thus, it would be important to assess whether the human AHR in the Hepa-1 background continues to cycle on/off the CYP1A1 promoter to determine whether these associations occur as a result of the AHR itself, another cellular factor, or the genome. These results would be especially important in light of a recent report that suggest that oscillation of a transcription factor at a promoter is linked to accessibility of binding sites and not an oscillatory recruitment of the transcription factor itself (Karpova et al., 2008). Similar st udies could also be performed using chromatin im munoprecipitation (ChIP) time course analysis of TCDD treated AHb2 cells as well as C2C12 cells to determine whether the Ahb-2 receptor also cycles on/off the CYP1A1 promoter endogenou sly or when expressed in the Hepa-1 background. If these receptors also exhib it promoter associati on cycling, this would correlate these results with the rapid degr adation profile of th ese receptors. In either case, both ligand-dependent and ligand-independent degradation of the AHR have been demonstrated to occur via the 26S proteasome complex since pre-treatment with the proteasome inhibitors MG-132 or la ctacystin prior to tr eatment with agonist blocks degradation of the receptor, while pretreatment with inhibitors of calpain, serine or cysteine proteases nor lysosomal proteas es cannot (Davarinos and Pollenz, 1999; Ma and Baldwin, 2000; Wentworth et al., 2004). As such, several studies have suggested

PAGE 213

195 that the AHR is ubiquitinated, though none ha ve demonstrated definitive evidence of such events and at this time no specific E3 lig ase has been demonstrated to be involved in the degradation of the AHR nor has any lysine residue been implicat ed as a ubiquitination site (Ciechanover, 2005; Kazlauskas, 2000; Ma and Baldwin, 2000). Additionally, in studies performed in this laboratory, no accumulation of ubiquitinated AHR is seen under the presence of AD or MG-132 (RSP, unpublished observations). Recently, AHR ligand dependent, but not estradiol dependent, degradation of the estrogen receptor (ER ) has been shown to occur via ubiquitination by a cullin 4b (cul4) E3 ligase multiprotein complex containi ng the DNA damage binding protein 1 (ddb1), and the ubiquitin conjugating enzyme ring fi nger protein RBX1/ROC1 (Ohtake et al., 2007). Surprisingly, in the presence of AHR ligand, atypical cul4 multiprotein complexes are formed that also appear to contain the AHR (Ohtake et al., 2007). These cul4bAHR complexes then appear to be involve d with AHR ligand-mediated degradation of ER since reduction of any cul4bAHR complex component reduces the degradation of ER However, in contrast to these studies, ligand-dependent degradation of the AHR is unaffected by reduction of cul4b or cul4b a ssociated proteins such as ddb1 (RSP, unpublished results). Thus, cul4 complexes do not appear to mediat e the ubiquitination of the AHR. It has also been proposed that the car boxyl terminus of hsc70-interacting protein (CHIP), an E3 ligase which contains a TRP dom ain for interaction with Hsp proteins and a U-box domain for recruitment of ubiquitin co njugating enzymes, may play a role in AHR degradation. This hypothesi s stems from data suggesting that CHIP interacts with Hsp70/Hsc70 or Hsp90 to promote the degradatio n of Hsp client proteins including the

PAGE 214

196 glucocorticoid receptor and ta u (Ballinger et al., 1999; Dick ey et al., 2006; Lees et al., 2003; Morales and Perdew, 2007). In these st udies, CHIP appeared to be capable of interacting with both Hsp90 and the AHR wh en endogenously expressed, expression of CHIP resulted in a dramatic lo ss of AHR in COS-1 cells, and an in vitro degradation assay resulted in ubiquitination of the AHR in the presence of CHIP (Morales and Perdew, 2007). Interestingly, the studies of Mo rales et al. (2007) also suggested that XAP2 can partially protect in vitro expressed Ahb-1 receptor from CHIP mediated ubiquitination, but did not protect mutant AHR (Y408A) unable to bind XAP2. As previously discussed, these results again corr elate the reduced degrad ation profile of the Ahb-1 receptor, which associates with high le vels of XAP2, and the rapid degradation profile of the Ahb-2 receptor, which associates with lo w levels of XAP2. However, in these studies, expression of CHIP U-box in COS-1 cells also resulted in loss of AHR, suggesting this ubiquitin conj ugating domain was not essential for AHR turnover. Additionally, loss of CHIP via siRNA in Hepa -1 cells or using CHIP knockout cell lines did not impact the degradation of the AHR (Morales and Perdew, 2007; Pollenz and Dougherty, 2005). Thus, CHIP is either not i nvolved in the degradation of the AHR in the context of Hepa-1 cells or a compensato ry mechanism is at play wherein other E3 ligases can substitute for loss of CHIP. In support of a compensatory mechanism, during CHIP knockout studies, only 50% of CHIP-/mice died by postnatal day 30-35, while the remaining animals were viable (Dickey et al., 2006). Si nce CHIP has been implicated as an E3 ligase responsible for modulating the degradation of essential pr oteins, survival of CHIP knockout animals suggests that either a compensatory mechanis m(s) exist for degradation of Hsp client

PAGE 215

197 proteins, that CHIP alone is not essential for degradation of these proteins, or that degradation of these protei ns is not strictly necessary for survival. Thus, studies must be continued to iden tify the E3 ligase or AHR lysine residue necessary for degradation of th e AHR. While it is possible to mutate each lysine residue in the AHR singly to attempt to identify a mutation that would prevent ubiquitination, there are 33 lysine residues in the Ahb-1 receptor and mutation of each individually would be expensive. Additionally, any disruption of AHR function would prevent liganddependent degradation of the receptor without necessarily identifying a key ubiquitination site. Furthermore, more than one lysine residue c ould be a target for ubiquitination, which would likely result in failure of this scanning mutagenesis to identify a key residue. Thus, techniques s canning for protein-prot ein interactions may serve better to iden tify an E3 ligase. As such, studies are currently underway in this laboratory to identify a ligase using yeast expression systems in Saccharomyces cerevisiae and gene knockout libraries. However, while many of the ligases involved with ubiquitination are highly conserved, yeast may lack the specific E3 ligase involved with targeting the AHR for de gradation, particularly sin ce yeast lack AHR and ARNT homologs. Yeast strain may also be important; for example, Saccharomyces cerevisiae lack cul4 while Saccharomyces pombe do not (Higa and Zhang, 2007). In a second approach, a bacterial two-hybrid screen will be employed to attempt to identify proteins interacting with the carboxy-terminal region of the AHR, where it is believed that any ubiquitination would occur. Potential gene targets from either the yeast or bacterial screen will be validated in mammalian cell culture.

PAGE 216

198 5.3 Implications of ARNT2 Studies AHR-mediated signal transduction may also be impacted by other cellular factors, such as the presence/level of various cof actors or the presence/le vel of other potential heterodimeric partners (ARNT proteins). The ARNT and ARNT2 proteins share > 95% amino acid identity in the bHLH domain a nd exhibit >80% amino acid identity in the PAS A and PAS B domains (Hirose et al., 1996 ). These domains are known to specify both protein-protein interact ion and DNA binding of the va rious bHLH/PAS proteins (Pongratz et al., 1998; Reisz-Porszas z et al., 1994). Because of this high level of identity in these regions, it is striking that the knockout of either ARNT and ARNT2 in the mouse produces different phenotypes (Hosoya et al., 2001; Keith et al., 2001; Kozak et al., 1997; Maltepe et al., 1997), because it would appear that both protei ns have the same potential to dimerize with common bHLH/PAS partne rs. However, while many of the potential partners for ARNT have been evaluated both in vivo and in vitro the ability of ARNT2 to associate with these heterodimeric partners is less well established. Thus, because there is limited functional analysis of the ARNT2 protein in mammalian model systems, the goal of the studies outlined in Chapter Four was to investigate whether ARNT and ARNT2 could interact with a common dimerization partner in vitro and in cell culture. Since different phenotypes could also result from differential tissue/cellular expression of ARNT proteins or discrepancies in the level of ARNT proteins in these tissues/cells, it was also pertinent to determine the endogenous protein expression of these proteins in the mouse. Therefore, experiments were performed to assess the ability of ARNT or ARNT2 to associate with the AHR. The analysis of this interaction was chosen since the

PAGE 217

199 interaction of ARNT with th e AHR can be easily assessed in vitro where the stoichiometry of the expressed proteins can be precisely controlled and because there have been discrepancies in the literature as to whether or not this inte raction is capable of occurring (Hirose et al., 1996; Sekine et al., 2006). Early studies of ARNT2•AHR interaction suggested that AR NT2 could dimerize with the AHR, could bind XREs, and could induce XRE controlled luciferase report er activity when coexpressed with the AHR in the presence of ligand (Hirose et al., 1996). In more recent studies, results from the same laboratory suggested that the ARNT2 di d not dimerize with the AHR (Sekine et al., 2006). The results presented in Chapter Four challenge this second vi ew, in that they i) clearly show that both ARNT and ARNT2 can specifically interact with the AHR in a TCDD-dependant manner in vitro ii) that both proteins comp ete with each other equally to form dimers with the TCDD-bound AHR, and iii) that ARNT2 was able to outcompete ARNT for binding to the AHR wh en expressed in excess of ARNT. However, the studies designed in Chapter Four also sought to determine the reason for any inequity between the previous studies and our own. A major finding of these studies was that the ability of ARNT 2 to associate with the AHR appeared to decrease (in comparison to ARNT) when th e AHR was activated by ligands other than TCDD. Indeed, when the low affinity nonhalogenated polyaromatic hydrocarbons BAP or 3-MC were used to activate the AHR in the in vitro assay in the presence of equal concentrations of ARNT and ARNT2, a pproximately two-thirds of the DNA bound complexes formed were AHR•ARNT. Thes e findings were also observed when the in vitro assays were carried out with ARNT or ARNT2 protein expre ssed in cell culture lines that lacked either ARNT protein. Th is is an intriguing finding that suggests the

PAGE 218

200 AHR may have a slightly different confor mation when bound with different ligands. This implies that dimerization potential may be influenced by type of ligand and this may partially explain why recent studies suggest that ARNT2 does not in teract with the AHR (Sekine et al., 2006). However, there is little known about how the ligand binding domain impacts the structure of the HLH or PAS regions at the molecular level. Homology modeling is currently being used to gain insight into this important question (Pandini et al., 2007). In contrast to the in vitro studies, a physiological model of expression of ARNT2 using the ARNT-deficient LA-II variant of th e Hepa-1 cell line showed that ARNT2 was unable to support TCDD-mediated inducti on of the endogenous CYP1A1 gene. Furthermore, not only was ARNT2 unable to support TCDD-mediated induction of the endogenous CYP1A1 gene, expression of ARNT 2 in the context of the Hepa-1 line actually appeared to partially inhibit the positive function of ARNT in AHR-mediated signaling by an unknown mechanism. The abili ty of ARNT isoforms to function as dominant negative regulators of AHR-mediate d signaling has previous ly been reported for the ARNTa splice variant expressed in rainbow trout and zebrafish (Necela and Pollenz, 1999; Necela and Pollenz, 2001; Pollenz et al., 1996). In the case of the rtARNTa, negative function is manifested by dimerization with the AHR but lack of binding to XRE enhancers, resulting in squelching of the AHR. A similar mechanism may explain the cu rrent results with ARNT2, as Western blotting and EMSA studies faile d to detect AHR•ARNT2 comp lexes in nuclear extracts of Hepa-1 cells expressing ARNT2 protein, but immunoprecipi tation analyses of these lines revealed a possible association be tween ARNT2 and the AHR. Unfortunately,

PAGE 219

201 endogenous association of AHR and ARNT2 could not be detected in cell lines expressing both ARNT isoforms. As previous ly discussed, this may have arisen from a lack of sensitivity in the probing of the result ant precipitations. Future studies in this area should therefore seek to repeat these studi es using greater amounts of cytosolic and nuclear extracts and/or more sensitive ECL techniques, such as the SuperSignal West Femto Maximum Sensitivity Substrate ECL k it (Pierce, Rockford, IL) that allows detection of as little as 1 fg of HRP conjugated pr otein—approximately 5000x more sensitive than the ECL kit (Amersham, Piscat away, NJ) used to analyze the Western blots shown in Chapter Four These techniques may allow for the detection of dimers that were previously undetectable. Additionally, to reveal whether the negative impact of ARNT2 expression on AHR signaling stems from ARNT2•AHR dimerization, it would be pertinent to dose Hepa-1 cells expressing ARNT2 with ligands other than TCDD, such as BAP or 3-MC. Since these low-affinity liga nds appear to preferentially result in the formation of AHR•ARNT DNA binding heterodimers in vitro reducing the formation or DNA binding ability of AHR•ARNT2 dimers, similar reductions in CYP1A1 following dosing with BAP or 3-MC may imply that these reductions ar e not caused by DNA binding of AHR•ARNT2 dimers, but th rough another undefined mechanism. It is also possible that ARNT2 expressed in culture loses the ability to form AHR complexes capable of associating with DNA as evidenced by the lack of accumulation in nuclear lysates of TCDD trea ted cells expressing ARNT a nd ARNT2. Such a mechanism could involve the interaction with tissue specifi c proteins yet to be defined that are not found in cytosolic fractions used in the in vitro activation assay, the formation of homodimers that limit the pool of ARNT2 th at is available, the formation of a non-

PAGE 220

202 functional AHR•ARNT2 complex or compartm entalization or hete rodimerization with ARNT. Loss of ARNT2 function in vivo would be consistent with studies that have evaluated the function of ARNT 2 in zebrafish. In these studies, it has been shown that although ARNT2 is the predominate ARNT prot ein in aquatic species and can associate with AHR and bind DNA in vitro knockdown of ARNT2 levels using antisense morpholino oligonucleotides in vivo does not reduce AHR-mediated signaling in this organism. In contrast, reducing AHR or AR NT in zebrafish completely abolishes the effects of TCDD on the development of embryos indicating that zfARNT2 cannot compensate for the loss of ARNT in vivo (Bello et al., 2004; Carney et al., 2004; Prasch et al., 2004; Prasch et al., 2006; Prasch et al., 2003; Teraoka et al., 2003). However, this does not address the results demonstrating that ARNT2 expressed in culture remains capable of interacting with the AHR and bi nding XREs when cytosolic extracts from cells are in vitro activated (Figure 4.19). Thus, it is the presence of a component of the nuclear extract, a result of the preparation of the nuclear extract or a result of the conditions for the in vitro activation that leads to the a pparent inability of ARNT2 to function in AHR signaling. Intriguingly, nuclear extracts prepared from cell lines expressing ARNT2 (either transiently or endogenously) ex hibit a constitutive associat ion of ARNT2 with nuclear structures in direct contrast to ARNT or AHR, which exhib it a ligand-dependent increase in nuclear extracts (Figures 4.24 and 4.26). T hus, these results suggest a nuclear role for ARNT2 that may prevent ARNT2 from bei ng accessible to the liganded AHR (Figure 5.1). If this were true, it may be pertinent to assess whether the addition of ARNT2 to nuclear extracts from NRK cells would gene rate AHR•ARNT2 dimers as seen with

PAGE 221

203 Figure 5.1: Hypothetical model for lack of ARNT2 function in vivo Since the majority of ARNT2 appears to be constitutivel y associated with nuclear structures as previously described, it is possible that ARNT 2 is constitutively associated with other PAS proteins or otherwise bound to DNA as a homodimer. Such an association would potentially lead to ARNT2 being inaccessi ble to heterodimerization with the AHR following AHR activation.

PAGE 222

204 cytosolic extracts in Figure 4.25. If excess ARNT2 led to the formation of AHR•ARNT2 dimers, this would further suggest that AHR remains capable of dimerizing with ARNT2 and binding DNA in cell culture and that AR NT2 may have an endogenous function that impairs its ability to freely associate with the ligand activated AHR in the nucleus. If another nuclear component is preventing th e formation of AHR•ARNT2 dimers, then additional ARNT2 should eventually swamp out the competitor component allowing for heterodimerization with the AHR. Thus, further studies should be performed to assess the ability of ARNT2 isolated from nuclear extr acts to function during AHR signaling and to further identify possible reasons for the difference between in vitro activated cytosolic ARNT2 to dimerize with the AHR vers us ARNT2 from nuclear extracts. Therefore, it would also be important to assess whether protein•protein interactions or phosphorylation status of ARNT2 in nuclear extracts was impacting the ability of ARNT2 to associate with the AHR. One of the best available tools to analyze the components of protein complexes is mass spectrometry analysis, especially where the potential components of these mixtures ma y be previously unknown. However, the difficulty of such studies tends to stem from the availability or expense of mass spectrometry equipment and trained personnel and from the purification of the native proteins. In an attempt to assess the poten tial interactions of ARNT2, ARNT2 protein complexes can be precipitated from cell ex tracts endogenously expressing ARNT2 either by immunoprecipitation techni ques as previously descri bed or through affinity chromatography, and the components assessed by mass spectrometry. Tandem affinity purification (TAP) of proteins can be performed against pr oteins tagged with the “TAP” tag, which is composed of two IgG binding domains of the Staphylococcus aureus

PAGE 223

205 protein A and a calmodulin binding peptide separated by a TEV protease cleavage site (Puig et al., 2001). To achieve purificati on of ARNT2 complexes, TAP-tagged ARNT2 from total cell lysates or nuclear extracts ca n be run through an affinity column coated with Staphylococcus aureus protein A IgG beads. Elution of the proteins is subsequently triggered by treatment with TEV protease and the elutant subjected to a second round of purification using calmodulin beads and re-eluted following treatment with EGTA. The use of this technique will allow for high yield of protein complexes in their native states. With the ability to generate large amounts of these purified complexes, functional studies can be performed using these complexes and mass spectrophotometry can be employed to identify components of ARNT2 containing comp lexes. Furthermore, even without mass spectrophotometry, purified ARNT2 containi ng complexes can be denatured and the protein mixtures assessed for potential in teractions by Western blotting, including the potential presence of AHR in TCDD-treated cells expressing ARNT and/or ARNT2. Since this purification technique allows for high-yield purification, this will also increase the sensitivity of the previously described studies. 2D-gel an alysis or blue-native 2D gel analysis can also be used from these purified samples to assess the potential phosphorylation status of ARNT2 (or ARNT, AHR) to attempt to determine if such posttranslational modifications ma y also be playing a role in the regulation of ARNT2 in vivo Additionally, little is known regarding the transformation of the liganded AHR complex to the AHR•ARNT dimer and whet her the AHR component of an AHR•ARNT dimer can dynamically swap its partner protein is entirely unknown. Since in vitro ARNT and ARNT2 have an equal ability to dimerize with TCDD-bound AHR, studies could be initiated to anal yze the dynamics of AHR tran sformation using this model

PAGE 224

206 system. For these studies, in vitro activation reactions containing limiting AHR and ARNT could be run for 1.5-2 hrs at 30C as usual; however, after time is allowed for initial AHR•ARNT dimerization, ARNT2 could th en be added to the activation reactions at various time points for an additional 1-2 hours and portions of each activation reaction run on an EMSA as previously described us ing IgG against ARNT or ARNT2 to examine AHR•ARNT or AHR•ARNT2 DNA binding. A portion of each sample could also be immunoprecipitated to examine the association of ARNT proteins with the AHR complex. In this manner, the question of whethe r preformed AHR•ARNT dimers could swap partners could be assessed, if the level of AHR•ARNT dimerization decreased over time in the presence of ARNT2. However, if th is swapping was truly dynamic (ie: AHR could dimerize with ARNT, swap with ARNT2, swap again with ARNT, etc.), it would be expected that an “equilibrium” would be reach ed wherein 50% of the total dimers were AHR•ARNT and 50% were AHR•ARNT2 as pr eviously shown. In contrast, if preformed dimers could not swap partners the level of AHR•ARNT DNA binding seen initially would remain constant across all sa mples, and in the presence of limiting AHR, no ARNT2 dimerization would be seen. If th e AHR cannot swap partner proteins, it is certainly possible that ARNT2 does not a ssociate with the AHR as a result of inaccessibility if ARNT2 is asso ciated with other proteins. Thus, the mechanism that underlies the lack of ARNT2 function in AHRmediated signaling in vivo is currently undefined. However, Sekine et al., (2006) have hypothesized that ARNT2 does not dimerize with the AHR in vivo because it contains a proline and not a histidine residue at amino acid 352 within the PAS B domain. This hypothesis is based on studies in which the histidine at amino acid 378 in the PAS B

PAGE 225

207 region of ARNT was mutated to a proline (thus resembling the ARNT2 PAS B domain) causing the ARNT to have greatly reduced ab ility to function in AHR-mediated signaling that was similar to that observed with wild type ARNT2. However, the studies did not directly evaluate the role of the P352 in ARNT2 functi on by converting it a histidine and producing a protein capable of functioni ng in AHR-mediated signaling. However, Sekine et al., (2006) have hypothesized that ARNT2 does not dimerize with the AHR in vivo because it contains a prolin e and not a histidine residue at amino acid 352 within the PAS B domain. This hypothesis is based on st udies in which the histidine at amino acid 378 in the PAS B region of ARNT was mutated to a proline that caused ARNT to have reduced ability to function in AHR-mediated signaling. However, the studies did not directly evaluate the role of the P352 in ARNT2 functi on by converting it a histidine and producing a protein capable of functioni ng in AHR-mediated signaling. The PAS B domain has been implicated in contributi ng to the heterodimeri zation potential and stability of ARNT and HIF-1 /HIF-2 through interactions o ccurring via the PAS B central B-sheet, and mutations in this region have been suggested to affect the transcriptional ability of the overall heterodi mer (Card et al., 2005; Erbel et al., 2003). Importantly, mutation of P352 to histidine in the mouse ARNT2 did not cause the protein to function like ARNT in AHR-mediated signa ling when transfected into LA-II cells. This may be due to the observation that the PAS A domain is also critical for DNA binding and protein-protein in teractions and contributes directly to AHR•ARNT XRE binding (Chapman-Smith et al., 2004; Pongratz et al., 1998). Thus, the findings that i) ARNT2 containing the P352 can dimerize and form functional complexes with the AHR in vitro and ii) ARNT2-H does not restore ARNTlike function in cells, indicate that the

PAGE 226

208 reduced function of ARNT2 in vivo is unlikely to be solely related to P352 residue and, instead, is likely to involve regulatory mechanisms that ar e impacting the interaction of ARNT2 with the AHR. Since the PAS B proline/histidine re sidue does not explain the differences between the ability of ARNT or ARNT2 to function in AHR signaling, it would also be pertinent to assess which domain(s) woul d. Thus, swapping of functional domains between the ARNT proteins followed by their transfection into LA-II cells and evaluation of CYP1A1/reporter gene induction in cell culture following treatment with ligand may reveal more information about which regi ons of ARNT when placed into the ARNT2 protein would allow ARNT2 to function in AHR mediated CYP1A1 induction. In doing so, it is tempting to believe that the TAD of ARNT versus that of ARNT2 would be the key region since this domain shares <42% id entity between ARNT proteins, while other functional domains share >80% identity. With this in mind, it is ev idently possible that ARNT2 may be capable of binding DNA, but not capable of recruiting the necessary cofactors for the subsequent transcription of CYP1A1 However, as described in Chapter One the ARNT domain appears to be dispen sable for transactivation by the AHR•ARNT complex, though studies in this laboratory indi cated that truncated ARNT proteins could not functionally substitute for full-lengt h ARNT in LA-II cells (data not shown). However, it is also necessary to note th at so far, CYP1A1 induction or reporter gene activity controlled by XREs from the CYP1A1 promoter have been the primary endpoints examined. Thus, it remains possibl e that AHR•ARNT2 dimers function, even in cell culture, in the regulati on of other target genes, perhap s even in the regulation of a different set of target genes than AHR•A RNT dimers. While other AHR•ARNT targets

PAGE 227

209 have been identified, such as CYP1A2, CYP1 B1, and Glutathione Stransferase-ya, these targets are constitutively expressed and assessm ent of induction/repression is difficult. Therefore, an attempt should be made to id entify other target ge nes of AHR•ARNT or AHR•ARNT2 dimers. Such studies could involve microarray screening followed by Northern blotting of presumed targets, and subsequent protein evaluation. In order to further underst and the possible physi ological role of ARNT2, it is also necessary to evaluate its e xpression patterns and whether it is coexpressed with ARNT. Initial studies of the e xpression patterns of ARNT and ARNT2 mRNA in mouse suggested that ARNT2 had an expression patter n that was restricted to the kidneys and central nervous system and th is would limit the function of the ARNT2 protein (Hirose et al., 1996; Jain et al., 1998). Howe ver, the studies presented in Chapter Four demonstrate that while ARNT2 is expressed less ubiquit ously than ARNT in the mouse, ARNT and ARNT2 protein can be detected in the several tissues includi ng the brain, eye, and kidney, heart, spleen and thymus, and in many cell lines from the tissues indicating co-expression of these protein isoforms (Figure 4.22 A). Indeed, a more sensitive antibody may reveal expression of ARNT2 in still other tissues. Interestingly, ARNT2 has been demonstrated to be the predominant form of AR NT in several fishes including Fundulus heteroclitus and Danio rerio and more recently in the common cormorant, Phalacrocorax carbo (Lee et al., 2007; Powell et al., 1999; Tanguay et al., 2000). Furtherm ore, ARNT2 protein from aquatic species has also been shown to be able to associate with the liganded AHR and bind XREs when synthesized in vitro including those from Fundulus heteroclitus Danio rerio and Xenopus laevis but does not appear to function in vivo (Powell et al., 1999; Rowatt et al., 2003; Tanguay et al., 2000). Collectively, these results reveal the

PAGE 228

210 importance of studying the function of ARNT 2 and demonstrate the ARNT2 protein is fully capable of associating with th e AHR and binding DNA, but other unknown regulatory mechanism(s) or compartmentaliz ation prevent these interactions from occurring. The ability to now have model cell culture lines that for the first time show the endogenous co-expression of ARNT and ARNT2 in the same cell, will be key systems to further define the function and in teraction of these proteins across different signaling pathways. While the studies described in Chapter Four have focused on the potential role of ARNT2 in AHR signaling, the endogenous role of ARNT2 is likely to involve its dimerization with other bHLH/PAS proteins. Since the knockout of ARNT2 results in abnormalities of the hypothalamus in the failure to develop neuroendocrine lineages in the paraventricular and supraopt ic nuclei, similar to the effe cts seen with knockout of the single-minded protein (SIM), the physiologi cal role of ARNT2 appears to be as a dimerization partner with SIM (Hosoya et al ., 2001; Michaud et al ., 2000; Wines et al., 1998). Surprisingly, however, while the eval uation of the interac tions between SIM and ARNT2 have been analyzed via immunopreci pitation, reporter gene studies, and twohybrid screens, the target genes regulated by these heterodimers remains unclear. Since ARNT2 appears to play an essential role in development of the hypothalamus, it is important that these potential gene targets be assessed. The first step in these studies would be to perform microarray analysis using mRNA extracted from the hypothalamic tissue from wild-type or ARNT2-/mice between ED 8.5-PD 5, when expression of ARNT2 appears to be critical for proper development. An attempt could then be made to correlate these changes in gene expressi on between these tissues to those genes

PAGE 229

211 containing the CME enhancer that appears to bind ARNT2•SIM dimers. Depending on the results, further studies could be performed using Nort hern analyses to examine specific gene expression changes or usi ng quantitative real time PCR (qRT-PCR). ARNT2 also appears to play a role in hypoxic response, yet the potential differences between ARNT and ARNT2 in this role have not been evaluated. Since many of the target genes regulated by HIF-1 ar e constitutive, particularly in cancer cell lines, an optimal means of st udying gene regulation by HIF-1 •ARNT or HIF1 •ARNT2 dimers will be real time quantitat ive qRT-PCR. A compilation of commonly used primer sets and specific anti bodies used in immunofluorescence and immunohistochemical analysis of hypoxic respon se in several species has been culled from the literature base and is given in Appendix B focusing on studies that employed cell lines/model systems avai lable to this laboratory. Unlike gene regulation by ARNT2•SIM dimers, a variety of gene ta rgets have been identified for HIF-1 •ARNT dimers. Thus, the ability of ARNT2 to functionally substitute for ARNT or to heterodimerize with HIF-1 when co-expressed with ARNT can be evaluated using many of the resources available al ready in this laboratory.

PAGE 230

212 Chapter Six Materials and Methods 6.1 Materials 2,3,7,8-tetracholorodibenzop -dioxin (TCDD) ( 98% stated chemical purity) was obtained from Radian Corp. (Austin, TX) a nd was solubilized in dimethyl sulfoxide (Me2SO). Benzo[a]pyrene (BAP) ( 96% stated chemical purity) and 3methylcholanthrene (3-MC) ( 98% stated chemical purity) were purchased from Sigma (St. Louis, MO) and solubilized in dimethyl sulfoxide (Me2SO). 6.2 Buffers Phosphate-buffered saline is 0.8% NaCl, 0.02%KCL, 0.14% Na2HPO4, 0.02% KH2PO4, pH 7.4. Gel sample buffer (2X) is 125 mM Tris, pH 6.8, 4% SDS, 25% glycerol, 4 mM EDTA, 20 mM dithiothreitol, 0.005% bromophenol blue. Tris-buffered saline is 50 mM Tris and 150 mM NaCl, pH 7.5. TTBS is 50 mM Tris, 0.2% Tween 20, 300 mM NaCl, pH 7.5. TTBS+ is 50 mM Tr is, 0.5% Tween 20, 300 mM NaCl, pH 7.5. BLOTTO is 5% dry milk in TTBS. Lysis buffer (2X) is 50 mM HEPES, pH 7.4, 40 mM sodium molybdate, 10 mM EGTA, 6 mM MgCl2, and 20% glycerol. Gel shift buffer (5X) is 50 mM HEPES, pH 7.5, 15 mM MgCl2 and 50% glycerol. MENG is MOPS, EDTA, NaN3, glycerol. RIPA is 50 mM Tris pH 7.4, 150 mM NaCl, and 0.2% NP40.

PAGE 231

213 6.3 Cells and Growth Conditions Wild-type Hepa-1c1c7 (Hepa-1) mouse he patoma cells, type II (LA-II) Hepa-1 variants, human ARPE-19 reti nal pigmented epithelium ce lls, B35 rat central nervous system cells, TCMK-1 mouse kidney cells, NRK-49F rat kidney cells, and A498 human kidney cells were purchased from the American Type Culture Collection (Manassas, VA). The Hepa-1, LA-II, and B35 cells were prop agated in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 1.5 g/ L sodium bicarbonate and 10% fetal bovine serum. ARPE-19 cells were propagated in a medium containing a 1:1 mixture of DMEM and Ham’s F12 medium with 2.5 mM L-glutam ine adjusted to contain 15 mM HEPES, 0.5 mM sodium pyruvate, and 1.2 g/L sodium bicarbonate supplemented with 10% fetal bovine serum. NRK-49F cells were propagate d in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 1.5 g/L sodium bicarbonate and 5% bovine calf serum. TCMK-1 cells were propagated in Minima l Essential Medium (MEM) with 2 mM Lglutamine with Earle’s BSS adjusted to contain 1.5 g/L sodium bicarbonate, 0.1 mM nonessential amino acids and 1.0 mM sodium pyr uvate with 10% fetal calf serum. A498 cells were propagated in RPMI medium with 10% fetal calf serum. All cells were passaged at 3-4 day intervals and were used in experiments during a 2-month period at approximately 70-90% confluence. For trea tment regiments, TCDD was administered directly into growth medium fo r the indicated incubation times. 6.4 Antibodies Specific antibodies against the AHR (A-1 ) and ARNT (R-1) were identical to those described previously (Holmes and Pollenz, 1997; Pollenz et al., 1994). All

PAGE 232

214 antibodies are affinity-purified IgG fractions Monoclonal mouse antibodies against the V5 epitope were purchased from Invitrogen (Carlsbad, CA). Poly clonal mouse antibodies against ARNT2 and CYP1A1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Polyclonal rabbit B-actin antibodie s were purchased from Sigma (St. Louis, MO). 6.5 Generation of Expression Constructs Numerous expression construc ts were generated in order to obtain the results described in this report. The primer sets th at were used are liste d below and are grouped according to the type of construct that wa s generated and are listed by primer name containing the species, target DNA sequence, direction of primer (5’ or 3’), and restriction site if applicable. Mutagenesis pr imers are listed as mut for or mut rev (for forward or reverse). TOPO cloning primers are listed as T/A. Site-directed mutagenesis was performed using the Quikchange II XL site-directed mutagenesis kit as per the manufacturer's protocol (Stratagene). AHR NH-terminal tags HM mouse AHR 5’HindIII 5’-TTTTA AGCTTACCACCATGGGGGGTTCTCATCAT HM mouse AHR 5’MluI 5’-TTTTA CGCGTACCACCATGGGGGGTTCTCATCAT GFP-mouse AHR 5’StuI 5’-TTTTA GGCCTGCCACCATGGTGAGCAAGGGCGA GGAG GFP-mouse AHR 3’ClaI 5’-TTTTATC GATTCAACTCTGCA CCTTGCTTAGGAA TGC AHR constructs mouse AHR b2-3’ HindIII 5’-CAATAAGCTTCTACAGGAATCCACCAGG human AHR-3’ HindIII 5’-CAATAAGCTTTTACCAGGAATCCACTGGATG human AHR-5’ XhoI 5’-CAATCTCGAGCACCATGAACAGCAGCAGCGCC

PAGE 233

215 rat AHR-3’ HindIII 5’-CAATAAGCTGAGCTACAGGAATCCGCTGGG rat AHR-5’ XhoI 5’-CAATCT CGAGGCACCATGAGCAGCGGCGCC rat/b1/b2 AHR-5’ XhoI 5’-CAAT CTCGAGGCACCATGAGCAGCGGCGCCA ACATC mouse trAHR 5’XhoI 5’ATATCT CGAGCCACCATGGGG CTGAACACAGAG TTAGAC mouse AHR 5’HpaI 5’-CAATGTTAACCCACCATGAGCAGCGGCGCCAA CATC mouse AHR 3’XhoI 5’-CAAT CTCGAGTCAACTCTGCACCTTGCTTA mouse AHR b2 3’XhoI 5’-CAATCT CGAGCTACAGGAATCCACCAGGTGT rat AHR 3’XhoI 5’-CAATCTCGAGCTACAGGAATCCGCTGGGTGT human AHR 5’HpaI 5’-CAATGTTAACCCACCATGAACAGCAGCAGCG CCAAC human AHR 3’XhoI 5’-CAAT CTCGAGTTACAGAATCCACTGGATGT mouse AHR R39A mut for 5’-CAAATCCTTCTAAGCGACACGCAGACCGGCTGA ACACAGAG mouse AHR R39A mut rev 5’-CTCTGTGTTCAGCCGGTCTGCGTGTCGCTTAGAA GGATTTG mouse AHR b2 3’XhoI 5’-CAATCTCGAGTCAGCAGCGGCGCCAACATC mouse AHR b2 5’HindIII 5’-CAATAAGCTTTCAGCAGCGGCGCCAACATC mouse AHR b2/rat 5’HindIII 5’-CAATAAGCTTATGAGCAGCGGCGCCAACATC mouse AHR b2 3’ClaI 5’-CAATATCGATCTACAGAATCCACCAGG rat AHR 3’ClaI 5’-CAATATCGATCTACAGGAATCCGCTGG human AHR 5’HindIII 5’-CAAT AAGCTTATGAACAGCAGCAGCGCC human AHR 3’ClaI 5’-CAATATCGATTTACAGGAATCCACTGGATG mouse AHR 5’AgeI 5’-CAAT ACCGGTATGAGCAGCGGCGCCAACATC mouse AHR 3’PacI 5’-CAATTTAATTAATCAACTCTGCACCTTGCTTAG mouse AHR b2 3’PacI 5’-CAATTTAATTAACTACAGGAATCACCAGGTGTG rat AHR 3’PacI 5’-CAATTTAATTAACTACAGGAATCCGCTGGGTGT G human AHR 3’PacI 5’-CAATTTAATTAATTACAGGAATCCACTGGATG ARNT and ARNT2 studies mouse AHR 3’T/A 5’-TCAACTCTGACACCTTGCTTAG mouse AHR 5’T/A 5’-ATGAGCAGCGGCGCCAACATC mouse ARNT2 5’-T/A 5’-GCAACCCCGGCCGCCGTCAAC mouse ARNT2 3’-T/A 5’-CTACTCAGAAAATGGAGGGAA mouse ARNT2 3’SalI 5’TTTGTCGACCTACTCAGAAAATGGAGGGA mouse AHR b2 3’-T/A 5’-CTACAGGAATCCACCAGGTGT mouse AHR 3’Stu 5’-CAATA GGCCTTCAACTCTGCACCTTGCTTAG mouse AHR b2 3’Stu 5’-CAATAGGCCTCTACAGAATCCACCAGGTGT mouse ARNT2 5’XhoI 5’-CAATCTCGAGACCACCATGGCAACCCCGGCCG CCGTCAAC

PAGE 234

216 mouse ARNT2 3’BamH1mut 5’-C AATGGATCCAATTCCGAAGGCAGATGACTG mouse ARNT2 5’BamHI mut 5’-CAATGGATCCAGCCACCCTTACCCGGCTGAC mouse ARNT2 3’HindIII 5’-CAATA AGCTTCTACTCAGAAAATGGAGGGAACA TGCCCAG mouse ARNT V5 2nd half 5’-CCTAACCCTCTCC TCGGTCTCGATTCTACGGCGG CGACTACAGCTAACCCAG 5’Universal V5 half XhoI 5’-C AATCTCGAGCCACCATGGGTAAGCCTATCCCT AACCCTCTCCTCGGTCTC mouse ARNT2 V5 2nd half 5’-CCTAACCCTCTCC TCGGTCTCGATTCTACGGCAA CCCCGGCCGCCGTCAAC mouse ARNT 503 3’HindIII 5’-CAAT AAGCTTCTAGCTGGCCAGCCCATCTCTTC CTG mouse ARNT 450 3’HindIII 5’-CAAT AAGCTTTTACTGGCT AGAGTTCTTCACAT TGGTGTTGG mouse ARNT2 3’HindIII 5’-CAATA AGCTTCTACTCAGAAAATGGAGGGAACA TGC 5’V5 Universal AgeI 5’-CAATACCGGTCCACCATGGGTAAGCCTATCCC TAAC mouse ARNT 3’EcoR1 5’-CAAT GAATTCCTATTCGGA AAAGGGGGGAAAC ATAGTTAG mouse ARNT2 3’EcoR1 5’-CAATG AATTCCTACTCAGAAAATGGAGGGAACA TGC 5’V5 Universal HindIII 5’-CAATAAGCTTGCACCATGGGTAAGCCTATCC mouse ARNT 3’ClaI 5’-CAAT ATCGATCTATTCGGAAAACGGTGGAAACA TAGTTAG mouse ARNT2 3’ClaI 5’-CAATATCGATCTACTCAGAAAATGGAGGGAAC ATGC V5 2nd half human ARNT 5’-CCTAA CCCTCTCCTCGGTCTCGATTCTACGGC GGCGACTACTGCCAACC human ARNT 3’HindIII 5’-CAAT AAGCTTCTATTCTG AAAAGGGGGGAAAC ATAGTTAG human ARNT 3’PacI 5’-CAA TTTAATTAACTATTCTGAAAAGGGGGAAAC ATAGTTAG hARNT 378P mut for 5’-CTTC ACTTTTGTGGATCCCCGCTGTGTGGCTA CTG hARNT 378P mut rev 5’-CAGTAGCCACACAGCGGGGATCCACAAAAGTG AAG mARNT2 352H mut for 5’-ACGTTTGTGGACCACAGATGCATCAGTGTG mARNT2 352H mut rev 5’-CACACTGATGCATCTGTGGTCCACAAACGTG For the mouse ARNT2 construct, no full length ARNT2 cDNA was available, however, two cDNA fragments were obtai ned one of which contained the carboxy-

PAGE 235

217 terminal portion of ARNT2 (Sogawa fragme nt) while one contained the full length ARNT2 with a 10 amino acid insertion cont ained within the car boxy-terminal region (Simon clone). This second clone is believe d to be an ARNT2 splice variant since a similar variant in the rat possesse s an identical insert in this region (Drutel et al., 1996). To evaluate the full-length ARNT2 clone as published in GenBank, the amino terminal portion of the Simon clone was amplified us ing the following primers: mouse ARNT2 3’BamH1mut 5’-CAATGGATCCAATTC CGAAGGCAGATGACTG and mouse ARNT2 5’BamHI mut 5’-CAATGGATCCAGCCACCCTTACCCGGCTGAC. The amplicon was then ligated to the carboxy-term inal portion of the Sogawa clone after mutagenesis reactions were performed to creat e a BamH1 site within each construct. Using this BamH1 site, each amplified regi on was ligated together and cloned into pcDNA 3.1for further studies. The full-length ARNT2 construct was then sequenced to test for accuracy of the construct. For the V5-tagged constructs, each of the coding regions from ARNT and ARNT2 was ligated into a pcDNA 3.1(-) vector allowing each of the full-length untagged proteins to be expressed. V5 tagged ARNT s were also generated. For these expression constructs, the V5 epitope (GKPIPNPLLGLDST ) was added to the coding region of each ARNT by sequential PCR along with XhoI a nd HindIII sites allowing the resultant PCR product to cloned into pcDNA 3.1(-). The following forward primers were used for ARNT: 5'CCTAACCCTCTCCTCGGTCTCGATTCTACGGCGGCGACTACAGCTAA CCCAG and 5'CAATCTCGAGCCACCATG GGTAAGCCTATCCCTAACCCTCTCCT CGGTCTC. The reverse primer for ARNT was 5’CAATAAGCTTCTA TTCGGAAAAG

PAGE 236

218 GGGGGAAACATAGTTAG. For the V5 tag of ARNT2, the following forward primers were used: 5’-CCTAACCCTCTCCTC GGTCTCGATTCTACGGCAACCCCGGCCGC CGTCAAC and 5’-C AATCTCGAGCCACCATG GGTAAGCCTATCCCTAACCCTCT CCTCGGTCTC. The reverse ARNT2 primer was 5’-CAATAAGCTTCTA CTCAGAAA ATGGAGGGAACATGC. Transcription start and stop site s are underlined. 6.6 In Vitro Expression of Protein Recombinant protein was produced from expression constructs using the TNT Coupled Reticulocyte Lysate System essentially as de tailed by the manufacturer (Promega, Madison, WI). Upon completion of the 90-min reaction, a portion of the sample was combined with an equal volume of 2X gel sample buffer and boiled for 5 min for Western blotting and the remaining porti on stored at -80C for use in functional studies. 6.7 Transient Transfection LA-II cells were seeded at 1.5-2.2x105 cells/well onto 35 mm dishes and propagated overnight. A cocktail containing 3-6 g ARNT expression vector and 22 l LipofectAMINE™ (Gibco) transfection r eagent was prepared in 1.3 mL of serum-free DMEM. This volume was sufficient for tran sfecting 6 dishes with the same pool of DNA/transfection reagent and the transfec tion was carried out according to the manufacturer’s instructions. After a 6-8 h transfection period, medium from each well was replaced with fresh medium contai ning FBS or an equal volume of 20% FBS medium was added to each well to yield an overall 10% FBS DMEM culture medium. In

PAGE 237

219 either case, cells were allowed to recover for 16 h prior to experimental treatments. Cells were then harvested from plates and processed as detailed below. WT Hepa-1 cells were similarly transfected using 3-6 g expression vector and 15 l LipofectAMINE™. 6.8 Viral Infections and Selection. For stable cell generation, 1x105 PT67 viral packaging ce lls were plated onto 35mm plates or 8.2x105 PT67 cells were plated onto 100m m plates and each well/plate transiently transfected with one of the retrov iral constructs. The cells were grown for 24 hours during which time, the viral packaging cells created infectio us, but replicationincompetent virus, resulting in the creation of high-titer viral media. After this time, the viral media was harvested, sterile filtered through a 0.45-um filter and aliquots of viral media used immediately for infection of targ et cells or frozen at -80C for future experimentation. Target cells plated at 7.5x104 – 1.0x105 cells on 35 mm plates or 68x105 cells on 100mm plates in normal culture media were then washed and cultured with 1000ul of the viral media containing lim iting amounts of packaged virus. Based on infection efficiency judged by the number of colonies formed following infection, some repeated experiments included a second day of infection using another 1000ul of viral media. In either case, 48 hours after the initial infection, the cells were harvested by trypsinization and plat ed onto 150mm plates in the presence of 800 g/ml of G418 for selection. This concentration has already been confirmed as being fatal to the cultured cells being evaluated herein. After 7-14 da ys of growth, colonies were chosen and harvested via sterile cloning disks onto 15mm culture plates still in the presence of G418 selection media. One disk was placed into ea ch 15mm plate to allow for the growth of a

PAGE 238

220 clonal population and the continued use of G418 will allow for a second round of selection. At 90% confluence, the cells will be harvested and propagated onto 35mm plates and allowed to continue to propagat e until cell populations can be frozen in liquid nitrogen and evaluated for expression of the ge ne of interest. Previous experiments in the lab indicated that cells grown in this ma nner are typically a homogenous population in which >80% express the protein of interest. Populations expr essing inconsistent levels of the target protein in comparison to wild-type cells or inconsistencies in molecular mass were discarded. If all lines exhibited identical responses, 12 lines were selected for the analyses listed. Deviations among the cells re sulted in characterizati on of other clones to identify the consensus response. 6.9 Luciferase Reporter Studies LA-II cells were transfected with the ARNT expression constructs as well as pSVB-Galactosidase and GudLuc 1.1 plasmids and treated with Me2SO or TCDD for 6 hours (Garrison and Denison, 2000). The lucife rase reporter assay was then performed according to the protocol dictated by the ma nufacturer (Promega, Madison, WI). All luciferase values were then normalized to B-Galactosidase as a transfection efficiency control. 6.10 RNA Interference Annealed small interfering RNA (siRNA) complexes containing 21-bp regions of identity to regions of the murine XAP2 or an anneal ed 21-bp RNA to sequence not present in the mouse genome (siRNA cont rol) were purchased from Ambion (Austin, TX).

PAGE 239

221 siRNA (final concentration of 50–100 nM) was transfected into 35-mm dishes containing 1–2 x 105/cells using LipofectAMINE™ reagent (Gibco). 36–48 h after transfection, cells were treated as detaile d in the figure legends, and total cell lysates were harvested for Western blotting. The efficiency of siRNA gene knockdown was determined by Western blotting. Transfection effi ciency was monitored by microscopy using fluorescein isothiocyanate-labeled RNA (Clontech). In general, transfection efficiency in all experiments was >85%. 6.11 Immunofluorescence St aining and Microscopy All immunohistochemical procedures (cell plating, fi xation, and staining) were carried out as previously described (22-24). Dry, autoclaved cove rslips were charged with 0.01% sterile poly-lysine. These coverslips we re then placed in 35mm cell culture plates and cells were cultured directly onto the s lips in appropriate medium. The slips were then fixed with 4% paraformaldehyde (pH 7.4) and ice-cold methanol. Slips were stained using the A-1A AHR IgG (2.8 g/ml) in BSA/PBS/Histidine buffer, washed with TTBS/TTBS+ and stained with a GAR-Rhodami ne secondary antibody (1:200). Cells were observed on an Olympus IX70 microscope. On average, 15–20 fields (5–20 cells each) were evaluated on each coverslip, and 3–4 fields were photographed with a digital camera at the same exposure time to generate the raw data. Nuclear fluorescence intensities of 25–50 cells in three distinct fields of view were obtained using MicroSuite image analysis software (Olympus America Inc.).

PAGE 240

222 6.12 Preparation of Total Cell/Tissue Lysates After treatment, cell monolayers were wash ed twice with PBS and detached from plates by trypsinization (0.5% trypsin/0.5 mM EDTA). Cell pellets were then washed with PBS and suspended in 50 to 100 l of ice-cold 2X lysis buffer supplemented with Nonidet P-40 (0.5%), leupeptin (10 g/ml), and aprotinin (20 g/ml). Cell suspensions were immediately sonicated for 5 s, suppl emented with phenylmethylsulfonyl fluoride (PMSF, final concentration, 100 M), and sonicated for an additional 5 s. For total tissue lysates, frozen tissue samples were weighed and 200-750ul of 2x lysis buffer supplemented with Nonidet P-40 (0.5%), leupeptin (10 g/ml), and aprotinin (20 g/ml) was added to each sample depending on tissue sample size. Samples were then sonicated for 10-20 s, supplemented with PMSF, and sonicated for an additional 10-20 s. For either total cell or total tissu e lysates, following sonication, a small portion of the lysate was then removed for protein determination, and the remainder was combined with an equal volume of 2X gel sample buffer, vortexed, a nd immediately heated for 5 min at 100C. Samples were then sonicated for an additional 5 s and stored at -20C or -70C. Protein concentrations were determined by the Cooma ssie Blue Plus assay (Pierce, Rockford, IL) with bovine serum albumin as the standard. 6.13 Preparation of Cytosol and Nuclear Extracts Cell monolayers were washed twice with PBS and detached from plates by trypsinization (0.5% trypsin/0.5 mM EDTA). Cell pellets we re then washed with PBS and suspended in 1000 ul of ice-cold MENG. Lysis was carried out by homogenization in small glass dounce vessels using 30-50 stroke s or by vortexing for 30 s in 1% Nonidet P-

PAGE 241

223 40 lysis buffer. Samples were then centrifuged at 5,000 rpm for 2 min at 4C. The supernatant was then removed for protein de termination or combined with an equal volume of 2X gel sample buffer and boiled fo r 5 min for Western blotting to assess protein expression. Nuclei were then washed twice with 0% Nonidet P-40 lysis buffer and extraction performed with MENG suppl emented with 400 mM KCl for 30 min, vortexing periodically. Samples were then cen trifuged at 14,000 rpm fo r 15 min at 4C. Nuclear extracts were then dialyzed in 4L of MENG at 4C for 2 h in Slide-A-Lyzer Mini Dialysis Units (Pierce) according to the manufacturer’s instructions. The supernatant was then removed for protein dete rmination or combined with 2X gel sample buffer and boiled for 5 min for Western blot ting to assess protein expression. The remaining sample was stored at -80C until analysis. Protein concentrations were determined by the Coomassie Blue Plus assa y (Pierce, Rockford, IL) with bovine serum albumin as the standard. 6.14 Western Blot Analysis and Quantification of Protein Protein samples were resolved by de naturing electrophoresis on discontinuous polyacrylamide slab gels (SDS-PAGE) and were electrophoretically transferred to nitrocellulose. Immunochemical staining was car ried out with varyi ng concentrations of primary antibody (figure legends) in BLOTTO buffer supplemented with DL-histidine (20 mM) for 1 hour at 22C. Blots were wa shed with three changes of TTBS or TTBS+ for a total of 45 min. The blot was then incubated in BLOTTO buffer containing a 1:10,000 dilution of goat anti-rabbitor goat anti-mouse-HRP secondary antibodies for 1 h at 22C and washed in TTBS or TTBS+ as above. Before detection, the blots were

PAGE 242

224 washed in PBS for 5 min. Bands were visu alized with the enhanced chemiluminescence (ECL) kit as specified by the manufacturer (Amersham Biosciences, Piscataway, NJ). Multiple exposures of each set of samples we re produced. The relative concentration of target proteins were determined by computer analysis of the autoradiographs as detailed previously (Pollenz, 1996; Sojka et al., 2000). 6.15 In Vitro Activation of AHR • ARNT Complexes and Electrophor etic Mobility Shift Assays 50 ug of cytosol or approximately equal am ounts of in vitro translated ARNT or ARNT2, as determined by quantitative West ern blotting, were mixed with in vitro translated AHR and combined with 25 mM MOPS, 10 mM EDTA, and 10% glycerol buffer in a reaction of a total volume propor tionate to the number of samples being evaluated such that each sample being eval uated was taken from a pooled total reaction and therefore represents identical samples. Each sample was then supplemented with TCDD (170 nM), 3-MC (54 uM), BAP (1.7 uM) or Me2SO (0.5%) and incubated at 30C for 2 h. To examine specificity of bindi ng, 50-100 ng of antibodies against AHR, ARNT, or ARNT2 were also include d in the activation reactions. For EMSA, double-stranded fragments corresponding to the consensus XREs A, B, C, D, E and F of the murine CYP1A1 promoter have been described previously (Shen and Whitlock, 1992). XRE duplexes corresponding to the six XREs of the murine CYP1A1 promoter as described by (Lusska et al., 1993) were purchased from In tegrated DNA Technologies Inc. (Coralville, IA). Approximately 4 ng of each 32P-labeled XRE was added to each sample, and the incubation continued for an additional 15 min at 22C. The samples were then resolved

PAGE 243

225 on 5% acrylamide/0.5% 45 mM Tris-borate and 1 mM EDTA gels, dried, and exposed to film. A portion of the activated samples were also combined with an equal volume of 2X gel sample buffer and boiled for 5 min for West ern blotting to assess protein expression. The relative DNA binding intensity of EMSA samples were determined by computer analysis of the EMSA autoradiographs as deta iled previously (Polle nz, 1996; Sojka et al., 2000). Oligo duplexes used in the EMSA reac tion are given below showing the two guanine residue overhang used for [32P]-dCTP labeling. Core sequences are bolded and mutated residues underlined. mXRE A 5’-GGCCAAGC TCGCGTG AGAAGCG-3’ 3’-GGTTCG AGCGCAC TCTTCGCGG-5’ mXRE B 5’-GGGCTTGG CACGCAC ACAGGTT-3’ 3’-CGAACC GTGCGTG TGTCCAAGG-5’ mXRE C 5’-GGGAGGC TAGCGTG CGTAAGCC-3’ 3’-CTCCG ATCGCAC GCATTCGGGG-5’ mXRE D wild-type 5’-GGCCGGAG TTGCGTG AGAAGAG-3’ 3’-GGCCTC AACGCAC TCTTCTCGG-5’ mXRE D mutant 5’-GGCTCTTC TC GCGTA ACTCCGG-3’ 3’-GAGAAG AG CGCAT TGAGGCC-5’ mXRE E 5’-GGAGTGCTGT CACGCTA GCTGG-3’ 3’-TCACGACA GTGCGAT CGACCGG-5’

PAGE 244

226 mXRE F 5’-GGCCGGGT TTGCGTG CGATGCT-3’ 3’-GGCCCA AACGCAC GCTACGAGG-5’ E-box wild-type 5’-GGCCCGGT CACGTG GCCTACG-3’ 3’-GGGCCA GTGCAC CGGATGCGG-5’ E-box mutant 5’-GGCCCGGT CG CA TG GCCTACG-3’ 3’-GGGCCA GC GT AC CGGATGCGG-5’ 6.16 Immunoprecipitations For the immunoprecipitations, 30 ul of in vitro translated AHR, ARNT, or ARNT2 were precipitated in RIPA buffer supplemented with bovine serum albumin (20 g/ml), histidine (20 mM), 1 g specific or pre-immune IgG and 15 ul Protein A/G agarose (Pierce) for 2 hours at 4C. Pellets were washed with 800 ul TTBS three times for 10 minutes at 4C and protein eluted by boi ling in 30 ul SDS sample buffer. Samples were centrifuged at 14,000 rpm and the supern atant resolved by SDS-PAGE and Western blotting as described above. 6.17 Statistical Analysis Statistical analysis was carried out using InStat software (GraphPad Software Inc., San Diego, CA).

PAGE 245

227 Literature Cited 1. Abbott BD (1995) Review of the inter action between TCDD and glucocorticoids in embryonic palate. Toxicology 105 (2-3):365-373. 2. Abbott BD and Probst MR (1995) Devel opmental expression of two members of a new class of transcripti on factors: II. Expression of aryl hydrocarbon receptor nuclear translocator in the C57BL/6N mouse embryo. Dev Dyn 204 (2):144-155. 3. Abnet CC, Tanguay RL, Hahn ME, Heid eman W and Peterson RE (1999) Two forms of aryl hydrocarbon receptor type 2 in rainbow trout (Oncorhynchus mykiss). Evidence for differential ex pression and enhancer specificity. J Biol Chem 274 (21):15159-15166. 4. Adachi J, Mori Y, Matsui S, Takigami H, Fujino J, Kitagawa H, Miller CA, 3rd, Kato T, Saeki K and Matsuda T (2001) Indirubin and indi go are potent aryl hydrocarbon receptor ligands present in human urine. J Biol Chem 276 (34):31475-31478. 5. Aitola M, Sadek CM, Gustafsson JA a nd Pelto-Huikko M (2003) Aint/Tacc3 is highly expressed in proliferating mouse tissues during development, spermatogenesis, and oogenesis. J Histochem Cytochem 51 (4):455-469. 6. Aitola MH and Pelto-Huikko MT (2003) Expression of Arnt and Arnt2 mRNA in developing murine tissues. J Histochem Cytochem 51 (1):41-54. 7. Andersson P, McGuire J, Rubio C, Gradin K, Whitelaw ML, Pettersson S, Hanberg A and Poellinger L (2002) A constitutively active dioxin/aryl hydrocarbon receptor induces stomach tumors. Proc Natl Acad Sci U S A 99 (15):9990-9995.

PAGE 246

228 8. Andreasen EA, Spitsbergen JM, Tangua y RL, Stegeman JJ, Heideman W and Peterson RE (2002) Tissue-specific e xpression of AHR2, ARNT2, and CYP1A in zebrafish embryos and larvae: eff ects of developmental stage and 2,3,7,8tetrachlorodibenzo-p-dioxin exposure. Toxicol Sci 68 (2):403-419. 9. Andreola F, Fernandez-Sa lguero PM, Chiantore MV, Pe tkovich MP, Gonzalez FJ and De Luca LM (1997) Aryl hydroc arbon receptor knockout mice (AHR-/-) exhibit liver retinoid a ccumulation and reduced retinoic acid metabolism. Cancer Res 57 (14):2835-2838. 10. Anthony-Cahill SJ, Benfield PA, Fairman R, Wasserman ZR, Brenner SL, Stafford WF, 3rd, Altenbach C, Hubbell WL and DeGrado WF (1992) Molecular characterization of helix-loop-helix peptides. Science 255 (5047):979-983. 11. Antonsson C, Arulampalam V, Whitela w ML, Pettersson S and Poellinger L (1995) Constitutive function of the basi c helix-loop-helix/PAS factor Arnt. Regulation of target prom oters via the E box motif. J Biol Chem 270 (23):1396813972. 12. Arpiainen S, Lamsa V, Pelkonen O, Yim SH, Gonzalez FJ and Hakkola J (2007) Aryl hydrocarbon receptor nuclear transloc ator and upstream stimulatory factor regulate Cytochrome P450 2a5 transc ription through a common E-box site. J Mol Biol 369 (3):640-652. 13. Arpiainen S, Raffalli-Mathieu F, La ng MA, Pelkonen O and Hakkola J (2005) Regulation of the Cyp2a5 gene involves an aryl hydrocarbon receptor-dependent pathway. Mol Pharmacol 67 (4):1325-1333. 14. Baba T, Mimura J, Gradin K, Kuroiwa A, Watanabe T, Matsuda Y, Inazawa J, Sogawa K and Fujii-Kuriyama Y (2001) Structure and expression of the Ah receptor repressor gene. J Biol Chem 276 (35):33101-33110. 15. Bacsi SG and Hankinson O (1996) Func tional characteriza tion of DNA-binding domains of the subunits of the heterodi meric aryl hydrocarbon receptor complex imputing novel and canonical basic helix -loop-helix protein-DNA interactions. J Biol Chem 271 (15):8843-8850.

PAGE 247

229 16. Ballinger CA, Connell P, Wu Y, Hu Z, Thompson LJ, Yin LY and Patterson C (1999) Identification of CHIP, a novel tetr atricopeptide repeat-containing protein that interacts with heat shock protei ns and negatively regulates chaperone functions. Mol Cell Biol 19 (6):4535-4545. 17. Barrow LL, Wines ME, Romitti PA, Hold ener BC and Murray JC (2002) Aryl hydrocarbon receptor nuclear translocator 2 (ARNT2): structure, gene mapping, polymorphisms, and candidate evalua tion for human orofacial clefts. Teratology 66 (2):85-90. 18. Bell DR and Poland A (2000) Binding of aryl hydrocarbon receptor (AhR) to AhR-interacting protein. The role of hsp90. J Biol Chem 275 (46):36407-36414. 19. Bello SM, Heideman W and Peterson RE (2004) 2,3,7,8-Tetrachlorodibenzo-pdioxin inhibits regression of the comm on cardinal vein in developing zebrafish. Toxicol Sci 78 (2):258-266. 20. Bennett P, Ramsden DB and Williams AC (1996) Complete structural characterisation of the human aryl hydrocarbon receptor gene. Clin Mol Pathol 49 (1):M12-M16. 21. Berg P and Pongratz I (2002) Two para llel pathways mediate cytoplasmic localization of the dioxin (aryl hydrocarbon) receptor. J Biol Chem 277 (35):32310-32319. 22. Bollerot K, Angelier N and Coumailleau P (2001) Molecular cloning and embryonic expression of the Xenopus Arnt gene. Mech Dev 108 (1-2):227-231. 23. Bunger MK, Walisser JA, Sullivan R, Manley PA, Moran SM, Kalscheur VL, Colman RJ and Bradfield CA (2005) Pr ogressive arthropathy in mice with a targeted disruption of the Mop3/Bmal-1 locus. Genesis 41 (3):122-132. 24. Bunger MK, Wilsbacher LD, Moran SM, Clendenin C, Radcli ffe LA, Hogenesch JB, Simon MC, Takahashi JS and Bradfi eld CA (2000) Mop3 is an essential component of the master circadian pacemaker in mammals. Cell 103 (7):10091017.

PAGE 248

230 25. Burbach KM, Poland A and Bradfield CA (1992) Cloning of the Ah-receptor cDNA reveals a distinctive ligandactivated transcription factor. Proc Natl Acad Sci U S A 89 (17):8185-8189. 26. Butler RA, Kelley ML, Powell WH, Hahn ME and Van Beneden RJ (2001) An aryl hydrocarbon receptor (AHR) homol ogue from the soft-shell clam, Mya arenaria: evidence that inverteb rate AHR homologues lack 2,3,7,8tetrachlorodibenzo-p-dioxin a nd beta-naphthoflavone binding. Gene 278 (12):223-234. 27. Cain SM (1975) Oxygen delivery and utiliz ation in dogs with a sublethal dose of cobalt chloride. J Appl Physiol 38 (1):20-25. 28. Card PB, Erbel PJ and Gardner KH ( 2005) Structural basis of ARNT PAS-B dimerization: use of a common beta -sheet interface for heteroand homodimerization. J Mol Biol 353 (3):664-677. 29. Carney SA, Peterson RE and Heidem an W (2004) 2,3,7,8-Tetrachlorodibenzo-pdioxin activation of the aryl hydrocar bon receptor/aryl hydrocarbon receptor nuclear translocator pathway causes de velopmental toxicity through a CYP1Aindependent mechanism in zebrafish. Mol Pharmacol 66 (3):512-521. 30. Cartwright P and Helin K (2000) Nucleo cytoplasmic shuttling of transcription factors. Cell Mol Life Sci 57 (8-9):1193-1206. 31. Carver LA and Bradfield CA (1997) Li gand-dependent intera ction of the aryl hydrocarbon receptor with a novel immunophilin homolog in vivo. J Biol Chem 272 (17):11452-11456. 32. Carver LA, Hogenesch JB and Bradfiel d CA (1994a) Tissue specific expression of the rat Ah-recept or and ARNT mRNAs. Nucleic Acids Res 22 (15):3038-3044. 33. Carver LA, Jackiw V and Bradfield CA (1994b) The 90-kDa heat shock protein is essential for Ah receptor signali ng in a yeast expression system. J Biol Chem 269 (48):30109-30112. 34. Carver LA, LaPres JJ, Jain S, Dunham EE and Bradfield CA (1998) Characterization of the Ah recep tor-associated protein, ARA9. J Biol Chem 273 (50):33580-33587.

PAGE 249

231 35. Cermakian N, Whitmore D, Foulkes NS and Sassone-Corsi P (2000) Asynchronous oscillations of two zebrafish CLOCK partners reveal differential clock control and function. Proc Natl Acad Sci U S A 97 (8):4339-4344. 36. Chan WK, Yao G, Gu YZ and Bradfield CA (1999) Cross-talk between the aryl hydrocarbon receptor and hypoxia inducible factor signaling pathways. Demonstration of competition and compensation. J Biol Chem 274 (17):1211512123. 37. Chang DC, McWatters HG, Williams JA, Gotter AL, Levine JD and Reppert SM (2003) Constructing a feedb ack loop with circadian clock molecules from the silkmoth, Antheraea pernyi. J Biol Chem 278 (40):38149-38158. 38. Chapman-Smith A, Lutwyche JK and Whitelaw ML (2004) Contribution of the Per/Arnt/Sim (PAS) domains to DNA bi nding by the basic helix-loop-helix PAS transcriptional regulators. J Biol Chem 279 (7):5353-5362. 39. Chapman-Smith A and Whitelaw ML (2006) Novel DNA binding by a basic helix-loop-helix protein. The role of the dioxin receptor PAS domain. J Biol Chem 281 (18):12535-12545. 40. Chen HS, Singh SS, Perdew GH. (1997) The Ah receptor is a sensitive target of geldanamycin-induced protein turnover. Arch Biochem Biophys 348 (1):190-8. 41. Chen HS and Perdew GH (1994) Subunit composition of the heteromeric cytosolic aryl hydrocarbon receptor complex. J Biol Chem 269 (44):27554-27558. 42. Chilov D, Hofer T, Bauer C, Wenger RH and Gassmann M (2001) Hypoxia affects expression of circadian gene s PER1 and CLOCK in mouse brain. FASEB J 15 (14):2613-2622. 43. Ciechanover A (2005) The ubiquitin prot eolytic system. From a vague idea, through basic mechanisms, and onto human diseases and drug targeting. Neurology

PAGE 250

232 44. Cioffi CC, Pollenz RS, Middleton DL, Wilson MR, Miller NW, William Clem L, Warr GW and Ross DA (2002) Oct2 transc ription factor of a teleost fish: activation domains and func tion from an enhancer. Arch Biochem Biophys 404 (1):55-61. 45. Corton JC, Moreno ES, Hovis SM, Leonard LS, Gaido KW, Joyce MM and Kennett SB (1996) Identification of a cell-sp ecific transcripti on activation domain within the human Ah receptor nuclear translocator. Toxicol Appl Pharmacol 139 (2):272-280. 46. Cowden KD and Simon MC (2002) Th e bHLH/PAS factor MOP3 does not participate in hypoxia responses. Biochem Biophys Res Commun 290 (4):12281236. 47. Cox MB and Miller CA, 3rd (2003) Phar macological and genetic analysis of 90kDa heat shock isoprotein-aryl hydrocarbon receptor complexes. Mol Pharmacol 64 (6):1549-1556. 48. Crews ST (1998) Control of cell lineage -specific development and transcription by bHLH-PAS proteins. Genes Dev 12 (5):607-620. 49. Czar MJ, Owens-Grillo JK, Dittmar KD, Hutchison KA, Zacharek AM, Leach KL, Deibel MR, Jr. and Pratt WB (1994) Ch aracterization of th e protein-protein interactions determining the he at shock protein (hsp90.hsp70.hsp56) heterocomplex. J Biol Chem 269 (15):11155-11161. 50. Czech MP (2006) ARNT misbehavin' in diabetic beta cells. Nat Med 12 (1):39-40. 51. Dale YR and Eltom SE (2006) Calpain mediates the dioxin-induced activation and down-regulation of the aryl hydrocarbon receptor. Mol Pharmacol 70 (5):1481-1487. 52. Davarinos NA and Pollenz RS (1999) Aryl hydrocarbon receptor imported into the nucleus following ligand binding is ra pidly degraded via the cytosplasmic proteasome following nuclear export. J Biol Chem 274 (40):28708-28715. 53. Denison MS, Fisher JM and Whitlock JP, Jr. (1988) Inducible, receptordependent protein-DNA inte ractions at a dioxin-re sponsive transcriptional enhancer. Proc Natl Acad Sci U S A 85 (8):2528-2532.

PAGE 251

233 54. Dickey CA, Yue M, Lin WL, Dickson DW Dunmore JH, Lee WC, Zehr C, West G, Cao S, Clark AM, Caldwell GA, Cald well KA, Eckman C, Patterson C, Hutton M and Petrucelli L (2006) Deletion of the ubiquitin ligase CHIP leads to the accumulation, but not the aggregation, of both endogenous phosphoand caspase3-cleaved tau species. J Neurosci 26 (26):6985-6996. 55. Dittmar KD, Demady DR, Stancato LF, Kr ishna P and Pratt WB (1997) Folding of the glucocorticoid rece ptor by the heat shock prot ein (hsp) 90-based chaperone machinery. The role of p23 is to stabilize receptor.hsp90 heterocomplexes formed by hsp90.p60.hsp70. J Biol Chem 272 (34):21213-21220. 56. Dolwick KM, Swanson HI and Bradfield CA (1993) In vitro analysis of Ah receptor domains involved in li gand-activated DNA recognition. Proc Natl Acad Sci U S A 90 (18):8566-8570. 57. Dougherty EJ and Pollenz RS (2007) Analysis of AH Receptor-ARNT and AH Receptor-ARNT2 Complexes In Vitro and in Cell Culture. Toxicol Sci [Epub ahead of print] 58. Drutel G, Kathmann M, Heron A, Sc hwartz JC and Arrang JM (1996) Cloning and selective expression in brain and kidney of ARNT2 homo logous to the Ah receptor nuclear translocator (ARNT). Biochem Biophys Res Commun 225 (2):333-339. 59. Dull AB, Carlson DB, Petrulis JR and Perdew GH (2002) Characterization of the phosphorylation status of the hepatiti s B virus X-associated protein 2. Arch Biochem Biophys 406 (2):209-221. 60. Ebert BL, Firth JD and Ratcliffe PJ (1995) Hypoxia and mitochondrial inhibitors regulate expression of glucose transporte r-1 via distinct Cis-acting sequences. J Biol Chem 270 (49):29083-29089. 61. Eguchi H, Ikuta T, Tachibana T, Y oneda Y and Kawajiri K (1997) A nuclear localization signal of human ar yl hydrocarbon receptor nuclear translocator/hypoxia-inducible factor 1beta is a novel bi partite type recognized by the two components of nuclear pore-targeting complex. J Biol Chem 272 (28):17640-17647.

PAGE 252

234 62. Ema M, Morita M, Ikawa S, Tanaka M, Matsuda Y, Gotoh O, Saijoh Y, Fujii H, Hamada H, Kikuchi Y and Fujii-Kuriyama Y (1996a) Two new members of the murine Sim gene family are transcrip tional repressors and show different expression patterns durin g mouse embryogenesis. Mol Cell Biol 16 (10):58655875. 63. Ema M, Sogawa K, Watanabe N, Chujoh Y, Matsushita N, Gotoh O, Funae Y and Fujii-Kuriyama Y (1992) cDNA cloning a nd structure of mouse putative Ah receptor. Biochem Biophys Res Commun 184 (1):246-253. 64. Ema M, Suzuki M, Morita M, Hirose K, Sogawa K, Matsuda Y, Gotoh O, Saijoh Y, Fujii H, Hamada H and Fujii-Kuriyama Y (1996b) cDNA cl oning of a murine homologue of Drosophila single-minded, its mRNA expression in mouse development, and chromosome localization. Biochem Biophys Res Commun 218 (2):588-594. 65. Ema M, Taya S, Yokotani N, Sogawa K, Matsuda Y and Fujii-Kuriyama Y (1997) A novel bHLH-PAS factor w ith close sequence similarity to hypoxia-inducible factor 1alpha regulates the VEGF expr ession and is potentially involved in lung and vascular development. Proc Natl Acad Sci U S A 94 (9):4273-4278. 66. Emmons RB, Duncan D, Estes PA, Kief el P, Mosher JT, Sonnenfeld M, Ward MP, Duncan I and Crews ST (1999) The spineless-aristapedia and tango bHLHPAS proteins interact to control antenna l and tarsal development in Drosophila. Development 126 (17):3937-3945. 67. Erbel PJ, Card PB, Karakuzu O, Bruick RK and Gardner KH (2003) Structural basis for PAS domain heterodimerizati on in the basic helix--loop--helix-PAS transcription factor hypo xia-inducible factor. Proc Natl Acad Sci U S A 100 (26):15504-15509. 68. Evans BR, Karchner SI, Allan LL, Pollenz RS, Tanguay RL, Jenny MJ, Sherr DH and Hahn ME (2007) Repression of ar yl hydrocarbon receptor (AHR) signaling by AHR repressor (AHRR): Role of DNA binding and competition for ARNT. Mol Pharmacol 69. Evans RM (1989) Molecular characteri zation of the glucocorticoid receptor. Recent Prog Horm Res 45 :1-22; discussion 22-27.

PAGE 253

235 70. Fernandez-Salguero P, Pineau T, Hilbert DM, McPhail T, Lee SS, Kimura S, Nebert DW, Rudikoff S, Ward JM and Gonzalez FJ (1995) Immune system impairment and hepatic fibrosis in mi ce lacking the dioxin-binding Ah receptor. Science 268 (5211):722-726. 71. Fernandez-Salguero PM, Hilbert DM, Rudikoff S, Ward JM and Gonzalez FJ (1996) Aryl-hydrocarbon receptor-def icient mice are resistant to 2,3,7,8tetrachlorodibenzo-p-di oxin-induced toxicity. Toxicol Appl Pharmacol 140 (1):173-179. 72. Franken, P., Dudley, C.A., Estill, S.J., Barakat, M., Thomason, R., O'Hara, B.F., and McKnight, S.L. (2006). NPAS2 as a tr anscriptional regulat or of non-rapid eye movement sleep: genotype and sex interactions. Proc Natl Acad Sci U S A 103 (18), 7118-7123. 73. Freeman BC, Felts SJ, Toft DO and Yamamoto KR (2000) The p23 molecular chaperones act at a late step in intracellular receptor action to differentially affect ligand efficacies. Genes Dev 14 (4):422-434. 74. Fujisawa-Sehara A, Sogawa K, Nishi C and Fujii-Kuriyama Y (1986) Regulatory DNA elements localized remotely upstream from the drug-metabolizing cytochrome P-450c gene. Nucleic Acids Res 14 (3):1465-1477. 75. Fukunaga BN, Probst MR, ReiszPorszasz S and Hankinson O (1995) Identification of functional domains of the aryl hydrocarbon receptor. J Biol Chem 270 (49):29270-29278. 76. Furness SG, Lees MJ and Whitelaw ML (2007) The dioxin (aryl hydrocarbon) receptor as a model for adaptive responses of bHLH/PAS transcription factors. FEBS Lett 581 (19):3616-3625. 77. Galigniana MD, Harrell JM, Murphy PJ Chinkers M, Radanyi C, Renoir JM, Zhang M and Pratt WB (2002) Binding of hsp90-associated immunophilins to cytoplasmic dynein: direct binding and in vivo evidence that the peptidylprolyl isomerase domain is a dynein interaction domain. Biochemistry 41 (46):1360213610.

PAGE 254

236 78. Galigniana MD, Radanyi C, Renoir JM, Housley PR and Pratt WB (2001) Evidence that the peptidylprolyl is omerase domain of the hsp90-binding immunophilin FKBP52 is involved in both dyne in interaction and glucocorticoid receptor movement to the nucleus. J Biol Chem 276 (18):14884-14889. 79. Garrett RW and Gasiewicz TA (2006) The aryl hydrocarbon receptor agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin alters the circadian rhythms, quiescence, and expression of clock genes in murine he matopoietic stem and progenitor cells. Mol Pharmacol 69 (6):2076-2083. 80. Garrison PM and Denison MS (2000) Analysis of the murine AhR gene promoter. J Biochem Mol Toxicol 14 (1):1-10. 81. Gekakis N, Staknis D, Nguyen HB, Davis FC, Wilsbacher LD, King DP, Takahashi JS and Weitz CJ (1998) Role of the CLOCK protein in the mammalian circadian mechanism. Science 280 (5369):1564-1569. 82. Georgitsi M, Raitila A, Karhu A, Tuppurainen K, Makinen MJ, Vierimaa O, Paschke R, Saeger W, van der Luijt RB, Sane T, Robledo M, De Menis E, Weil RJ, Wasik A, Zielinski G, Lucewicz O, L ubinski J, Launonen V, Vahteristo P and Aaltonen LA (2007) Molecular diagnosis of pituitary adenoma predisposition caused by aryl hydrocarbon receptor-in teracting protein gene mutations. Proc Natl Acad Sci U S A 104 (10):4101-4105. 83. Giannone JV, Li W, Probst M and Okey AB (1998) Prolonged depletion of AH receptor without alteration of receptor mR NA levels after treatment of cells in culture with 2,3,7,8-tetrachl orodibenzo-p-dioxin. Biochem Pharmacol 55 (4):489497. 84. Gielen JE and Nebert DW (1972) Aryl hydrocarbon hydroxylase induction in mammalian liver cell culture. 3. Effects of various sera, hormones, biogenic amines, and other endogenous compounds on the enzyme activity. J Biol Chem 247 (23):7591-7602. 85. Gonzalez FJ, Fernandez-Salguero P, Lee SS, Pineau T and Ward JM (1995) Xenobiotic receptor knockout mice. Toxicol Lett 82-83 :117-121. 86. Gouedard C, Barouki R and Morel Y (2004) Dietary polyphenols increase paraoxonase 1 gene expression by an aryl hydrocarbon receptor-dependent mechanism. Mol Cell Biol 24 (12):5209-5222.

PAGE 255

237 87. Gradin K, McGuire J, Wenger RH, Kvieti kova I, fhitelaw ML, Toftgard R, Tora L, Gassmann M and Poellinger L (1996) Functional interference between hypoxia and dioxin signal transduction pathways: co mpetition for recruitment of the Arnt transcription factor. Mol Cell Biol 16 (10):5221-5231. 88. Gu YZ, Hogenesch JB and Bradfield CA (2000) The PAS superfamily: sensors of environmental and developmental signals. Annu Rev Pharmacol Toxicol 40 :519561. 89. Guillemot F, Nagy A, Auerbach A, Rossant J and Joyner AL (1994) Essential role of Mash-2 in extraembryonic development. Nature 371 (6495):333-336. 90. Gunton JE, Kulkarni RN, Yim S, Okad a T, Hawthorne WJ, Tseng YH, Roberson RS, Ricordi C, O'Connell PJ, Gonzalez FJ and Kahn CR (2005) Loss of ARNT/HIF1beta mediates altered gene expression and pancreatic-islet dysfunction in human type 2 diabetes. Cell 122 (3):337-349. 91. Gurtner GC, Davis V, Li H, McCoy MJ, Sharpe A and Cybulsky MI (1995) Targeted disruption of the murine VCAM 1 gene: essential role of VCAM-1 in chorioallantoic fusion and placentation. Genes Dev 9 (1):1-14. 92. Hahn ME, Karchner SI, Franks DG and Merson RR (2004) Aryl hydrocarbon receptor polymorphisms and dioxin resist ance in Atlantic killifish (Fundulus heteroclitus). Pharmacogenetics 14 (2):131-143. 93. Hankinson GJ, White WJ and Lang CM (1979) The effects of selected antimicrobials on glucose transport in the rat intestine. Lab Anim Sci 29 (1):35-39. 94. Hankinson O (1979) Single-step selection of clones of a mouse hepatoma line deficient in aryl hydrocarbon hydroxylase. Proc Natl Acad Sci U S A 76 (1):373376. 95. Hankinson O (2005) Role of coactivators in transcriptional ac tivation by the aryl hydrocarbon receptor. Arch Biochem Biophys 433 (2):379-386. 96. Hapgood J, Cuthill S, Denis M, Poellinger L and Gustafsson JA (1989) Specific protein-DNA interactions at a xenobiotic -responsive element: copurification of dioxin receptor and DNA-binding activity. Proc Natl Acad Sci U S A 86 (1):60-64.

PAGE 256

238 97. Heid SE, Pollenz RS and Swanson HI (2000) Role of heat shock protein 90 dissociation in mediating agonist-indu ced activation of the aryl hydrocarbon receptor. Mol Pharmacol 57 (1):82-92. 98. Henry EC, Bemis JC, Henry O, Kende AS and Gasiewicz TA (2006) A potential endogenous ligand for the aryl hydrocarbon receptor has po tent agonist activity in vitro and in vivo. Arch Biochem Biophys 450 (1):67-77. 99. Hestermann EV and Brown M (2003) A gonist and chemopreventative ligands induce differential transcri ptional cofactor recruitment by aryl hydrocarbon receptor. Mol Cell Biol 23 (21):7920-7925. 100. Hickey E, Brandon SE, Smale G, Lloyd D and Weber LA (1989) Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein. Mol Cell Biol 9 (6):2615-2626. 101. Higa LA and Zhang H (2007) Stealing the spotlight: CUL4-DDB1 ubiquitin ligase docks WD40-repeat proteins to destroy. Cell Div 2 :5. 102. Hirose K, Morita M, Ema M, Mimura J, Hamada H, Fujii H, Saijo Y, Gotoh O, Sogawa K and Fujii-Kuriyama Y (19 96) cDNA cloning and tissue-specific expression of a novel basic helix-loop-h elix/PAS factor (A rnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear tr anslocator (Arnt). Mol Cell Biol 16 (4):1706-1713. 103. Hoffman EC, Reyes H, Chu FF, Sander F, Conley LH, Brooks BA and Hankinson O (1991) Cloning of a factor required for activity of the Ah (dioxin) receptor. Science 252 (5008):954-958. 104. Hogenesch JB, Chan WK, Jackiw VH, Br own RC, Gu YZ, Pray-Grant M, Perdew GH and Bradfield CA (1997) Characterizati on of a subset of the basic-helix-loophelix-PAS superfamily that interacts w ith components of the dioxin signaling pathway. J Biol Chem 272 (13):8581-8593. 105. Hogenesch JB, Gu YZ, Moran SM, Shim omura K, Radcliffe LA, Takahashi JS and Bradfield CA (2000) The basic he lix-loop-helix-PAS pr otein MOP9 is a brain-specific heterodimeric partne r of circadian and hypoxia factors. J Neurosci 20 (13):RC83.

PAGE 257

239 106. Hollingshead BD, Patel RD and Pe rdew GH (2006) Endogenous hepatic expression of the hepatitis B virus X-associ ated protein 2 is adequate for maximal association with aryl hydr ocarbon receptor-90-kDa heat shock protein complexes. Mol Pharmacol 70 (6):2096-2107. 107. Hollingshead BD, Petrulis JR and Perd ew GH (2004) The aryl hydrocarbon (Ah) receptor transcriptional regulator hepa titis B virus X-associated protein 2 antagonizes p23 binding to Ah receptor-Hsp90 complexes and is dispensable for receptor function. J Biol Chem 279 (44):45652-45661. 108. Holmes JL and Pollenz RS (1997) Dete rmination of aryl hydrocarbon receptor nuclear translocator protein concentrati on and subcellular localization in hepatic and nonhepatic cell culture lines: devel opment of quantitative Western blotting protocols for calculation of aryl hydr ocarbon receptor and aryl hydrocarbon receptor nuclear translocator pr otein in total cell lysates. Mol Pharmacol 52 (2):202-211. 109. Hosoya T, Oda Y, Takahashi S, Morita M, Kawauchi S, Ema M, Yamamoto M and Fujii-Kuriyama Y (2001) Defective deve lopment of secretory neurones in the hypothalamus of Arnt2-knockout mice. Genes Cells 6 (4):361-374. 110. Hosoya, T., Harada, N., Mimura, J., Motoha shi, H., Takahashi, S., Nakajima, O., Morita, M., Kawauchi, S., Yamamoto, M., and Fujii-Kuriyama, Y. (2008). Inducibility of cytochro me P450 1A1 and chemical carcinogenesis by benzo[a]pyrene in AhR re pressor-deficient mice. Biochem Biophys Res Commun 365 (3), 562-567. 111. Huang ZJ, Edery I and Rosbash M (1993) PAS is a dimerization domain common to Drosophila period and seve ral transcription factors. Nature 364 (6434):259-262. 112. Huffman JL, Mokashi A, Bachinger HP and Brennan RG (2001) The basic helixloop-helix domain of the aryl hydrocar bon receptor nuclear transporter (ARNT) can oligomerize and bind E-box DNA specifically. J Biol Chem 276 (44):4053740544. 113. Hutchison KA, Dittmar KD and Pratt WB (1994) All of the f actors required for assembly of the glucocorticoid receptor in to a functional heterocomplex with heat shock protein 90 are preassociated in a self -sufficient protein folding structure, a "foldosome". J Biol Chem 269 (45):27894-27899.

PAGE 258

240 114. Ikeda M and Nomura M (1997) cDNA cloni ng and tissue-specific expression of a novel basic helix-loop-helix/PAS protei n (BMAL1) and id entification of alternatively spliced variants with altern ative translation initiation site usage. Biochem Biophys Res Commun 233 (1):258-264. 115. Ikeda M, Yu W, Hirai M, Ebisawa T, Honma S, Yoshimura K, Honma KI and Nomura M (2000) cDNA cloning of a nove l bHLH-PAS transcription factor superfamily gene, BMAL2: its mRNA e xpression, subcellula r distribution, and chromosomal localization. Biochem Biophys Res Commun 275 (2):493-502. 116. Ishikawa T, Hirayama J, Kobaya shi Y and Todo T (2002) Zebrafish CRY represses transcription mediated by CLOCK-BMAL heterodimer without inhibiting its binding to DNA. Genes Cells 7 (10):1073-1086. 117. Iyer NV, Leung SW and Semenza GL (1998) The human hypoxia-inducible factor 1alpha gene: HIF1A struct ure and evolutionary conservation. Genomics 52 (2):159-165. 118. Jain S, Dolwick KM, Schmidt JV and Br adfield CA (1994) Potent transactivation domains of the Ah receptor and the Ah r eceptor nuclear translocator map to their carboxyl termini. J Biol Chem 269 (50):31518-31524. 119. Jain S, Maltepe E, Lu MM, Simon C and Bradfield CA (1998) Expression of ARNT, ARNT2, HIF1 alpha, HIF2 alpha and Ah receptor mRNAs in the developing mouse. Mech Dev 73 (1):117-123. 120. Jensen BA and Hahn ME (2001) cDNA cloning and characterization of a high affinity aryl hydrocarbon receptor in a cet acean, the beluga, Delphinapterus leucas. Toxicol Sci 64 (1):41-56. 121. Jinno A, Maruyama Y, Ishizuka M, Kazu saka A, Nakamura A and Fujita S (2006) Induction of cytochrome P450-1A by the equine estrogen equilenin, a new endogenous aryl hydrocar bon receptor ligand. J Steroid Biochem Mol Biol 98 (1):48-55. 122. Karchner SI, Powell WH and Hahn ME (1999) Identification and functional characterization of two highly divergen t aryl hydrocarbon receptors (AHR1 and AHR2) in the teleost Fundulus heterocl itus. Evidence for a novel subfamily of ligand-binding basic helix loop helixPer-ARNT-Sim (bHLH-PAS) factors. J Biol Chem 274 (47):33814-33824.

PAGE 259

241 123. Karpova TS, Kim MJ, Spriet C, Nalley K, Stasevich TJ, Kherrouche Z, Heliot L and McNally JG (2008) Concurrent fast and slow cycling of a transcriptional activator at an endogenous promoter. Science 319 (5862):466-469. 124. Kazlauskas A (2000) A new member of an old family. Nat Cell Biol 2 (5):E78-79. 125. Kazlauskas A, Poellinger L and Pongrat z I (2000) The immunophilin-like protein XAP2 regulates ubiquitination and subcellula r localization of th e dioxin receptor. J Biol Chem 275 (52):41317-41324. 126. Kazlauskas A, Poellinger L and Pongratz I (2002) Two distinct regions of the immunophilin-like protein XAP2 regulate di oxin receptor function and interaction with hsp90. J Biol Chem 277 (14):11795-11801. 127. Kazlauskas A, Sundstrom S, Poe llinger L and Pongratz I (2001) The hsp90 chaperone complex regulates intracellular localization of the dioxin receptor. Mol Cell Biol 21 (7):2594-2607. 128. Keith B, Adelman DM and Simon MC (2001) Targeted mutation of the murine arylhydrocarbon receptor nuclear translocat or 2 (Arnt2) gene reveals partial redundancy with Arnt. Proc Natl Acad Sci U S A 98 (12):6692-6697. 129. Kewley RJ, Whitelaw ML and Chapma n-Smith A (2004) The mammalian basic helix-loop-helix/PAS family of transcriptional regulators. Int J Biochem Cell Biol 36 (2):189-204. 130. Kikuchi Y, Ohsawa S, Mimura J, Ema M, Takasaki C, Sogawa K and FujiiKuriyama Y (2003) Heterodimers of bHLH -PAS protein fragments derived from AhR, AhRR, and Arnt prepared by co-expression in Escherichia coli: characterization of their DNA binding activ ity and preparation of a DNA complex. J Biochem (Tokyo) 134 (1):83-90. 131. Kim EY and Hahn ME (2002) cDNA cloni ng and characterization of an aryl hydrocarbon receptor from the harbor seal (Phoca vitulina): a biomarker of dioxin susceptibility? Aquat Toxicol 58 (1-2):57-73.

PAGE 260

242 132. Kim EY, Iwata H, Suda T, Tanabe S, Amano M, Miyazaki N and Petrov EA (2005) Aryl hydrocarbon receptor (AHR) a nd AHR nuclear tran slocator (ARNT) expression in Baikal seal (Pusa sibiri ca) and association with 2,3,7,8-TCDD toxic equivalents and CYP1 expression levels. Comp Biochem Physiol C Toxicol Pharmacol 141 (3):281-291. 133. Ko HP, Okino ST, Ma Q and Whitlock JP, Jr. (1996) Dioxin-induced CYP1A1 transcription in vivo: the aromatic hydr ocarbon receptor mediates transactivation, enhancer-promoter communication, and changes in chromatin structure. Mol Cell Biol 16 (1):430-436. 134. Ko HP, Okino ST, Ma Q and Whitlock JP, Jr. (1997) Transactivation domains facilitate promoter occupancy for the dioxin-inducible CYP1A1 gene in vivo. Mol Cell Biol 17 (7):3497-3507. 135. Kohsaka A, Laposky AD, Ramsey KM, Estrada C, Joshu C, Kobayashi Y, Turek FW and Bass J (2007) High-fat diet disr upts behavioral and molecular circadian rhythms in mice. Cell Metab 6 (5):414-421. 136. Korkalainen M, Tuomisto J and Pohja nvirta R (2001) The AH receptor of the most dioxin-sensitive specie s, guinea pig, is highly homologous to the human AH receptor. Biochem Biophys Res Commun 285 (5):1121-1129. 137. Korkalainen M, Tuomisto J and Pohja nvirta R (2003) Identification of novel splice variants of ARNT and ARNT2 in the rat. Biochem Biophys Res Commun 303 (4):1095-1100. 138. Kozak KR, Abbott B and Hankinson O (1997) ARNT-deficient mice and placental differentiation. Dev Biol 191 (2):297-305. 139. Kremer J, Gleichmann E and Esser C (1994) Thymic stroma exposed to arylhydrocarbon receptor-binding xenobiotic s fails to support proliferation of early thymocytes but induces differentiation. J Immunol 153 (6):2778-2786. 140. Kuwako, K., Taniura, H., and Yoshikawa, K. (2004). Necdin-related MAGE proteins differentially interact with th e E2F1 transcription factor and the p75 neurotrophin receptor. J Biol Chem 279 (3), 1703-1712.

PAGE 261

243 141. Kwon I, Lee J, Chang SH, Jung NC, Lee BJ, Son GH, Kim K and Lee KH (2006) BMAL1 shuttling controls transac tivation and degradation of the CLOCK/BMAL1 heterodimer. Mol Cell Biol 26 (19):7318-7330. 142. LaPres JJ, Glover E, Dunham EE, Bunge r MK and Bradfield CA (2000) ARA9 modifies agonist signaling through an in crease in cytosolic aryl hydrocarbon receptor. J Biol Chem 275 (9):6153-6159. 143. Lee JS, Kim EY, Iwata H and Tanabe S (2007) Molecular characterization and tissue distribution of aryl hydrocarbon r eceptor nuclear transl ocator isoforms, ARNT1 and ARNT2, and identification of novel splice variants in common cormorant (Phalacrocorax carbo). Comp Biochem Physiol C Toxicol Pharmacol 145 (3):379-393. 144. Lee K, Burgoon LD, Lamb L, Dere E, Zacharewski TR, Hogenesch JB and LaPres JJ (2006) Identification and char acterization of genes susceptible to transcriptional cross-talk between the hypoxia and di oxin signaling cascades. Chem Res Toxicol 19 (10):1284-1293. 145. Lees MJ, Peet DJ and Whitelaw ML (2003) Defining the role for XAP2 in stabilization of the dioxin receptor. J Biol Chem 278 (38):35878-35888. 146. Legraverend C, Hannah RR, Eisen HJ, Owens IS, Nebert DW and Hankinson O (1982) Regulatory gene product of the Ah locus. Characterization of receptor mutants among mouse hepatoma clones. J Biol Chem 257 (11):6402-6407. 147. Levesque, B.M., Zhou, S., Shan, L., Johnston, P., Kong, Y., Degan, S., and Sunday, M.E. (2007). NPAS1 regulates branching morphogenesis in embryonic lung. Am J Respir Cell Mol Biol 36 (4), 427-434. 148. Levine SL and Perdew GH (2001) Aryl hydrocarbon receptor (AhR)/AhR nuclear translocator (ARNT) activity is unaltered by phosphorylation of a periodicity/ARNT/single-minded (PAS)-region serine residue. Mol Pharmacol 59 (3):557-566. 149. Levine SL and Perdew GH (2002) Okad aic acid increases ARNT homodimer transactivation potential. Cell Biol Toxicol 18 (2):109-120.

PAGE 262

244 150. Levisetti MG and Polonsky KS (2005) Diab etic pancreatic beta cells ARNT all they should be. Cell Metab 2 (2):78-80. 151. Li H, Dong L and Whitlock JP, Jr. (1994) Transcriptional ac tivation function of the mouse Ah receptor nuclear translocator. J Biol Chem 269 (45):28098-28105. 152. Lin BC, Sullivan R, Lee Y, Moran S, Glover E and Bradfield CA (2007) Deletion of the aryl hydrocarbon receptor asso ciated protein 9 leads to cardiac malformation and embryonic lethality. J Biol Chem 153. Lindebro MC, Poellinger L and Whitelaw ML (1995) Protein-protein interaction via PAS domains: role of the PAS domain in positive and negative regulation of the bHLH/PAS dioxin receptor-Arnt transcription factor complex. EMBO J 14 (14):3528-3539. 154. Lusska A, Shen E and Whitlock JP, Jr (1993) Protein-DNA in teractions at a dioxin-responsive enhancer. Analysis of six bona fide DNA-binding sites for the liganded Ah receptor. J Biol Chem 268 (9):6575-6580. 155. Ma Q (2001) Induction of CYP1A1. Th e AhR/DRE paradigm: transcription, receptor regulation, and expanding biological roles. Curr Drug Metab 2 (2):149164. 156. Ma Q (2007) Aryl hydrocarbon receptor degradation-promoting factor (ADPF) and the control of the xenobiotic response. Mol Interv 7 (3):133-137. 157. Ma Q and Baldwin KT (2000) 2,3,7,8-te trachlorodibenzo-p-dioxin-induced degradation of aryl hydrocarbon recept or (AhR) by the ubiquitin-proteasome pathway. Role of the transcripti on activaton and DNA binding of AhR. J Biol Chem 275 (12):8432-8438. 158. Ma Q, Renzelli AJ, Baldwin KT a nd Antonini JM (2000) Superinduction of CYP1A1 gene expression. Regulation of 2,3,7, 8-tetrachloro dibenzo-p-dioxininduced degradation of Ah receptor by cycloheximide. J Biol Chem 275 (17):12676-12683.

PAGE 263

245 159. Ma Q and Whitlock JP, Jr. (1997) A novel cy toplasmic protein that interacts with the Ah receptor, contains tetratricope ptide repeat motifs, and augments the transcriptional response to 2,3,7,8-tetrachlorodibe nzo-p-dioxin. J Biol Chem 272 (14):8878-8884. 160. Maemura K, de la Monte SM, Chin MT Layne MD, Hsieh CM, Yet SF, Perrella MA and Lee ME (2000) CLIF, a novel cycl e-like factor, regulates the circadian oscillation of plasminogen activat or inhibitor-1 gene expression. J Biol Chem 275 (47):36847-36851. 161. Maemura K, Takeda N and Nagai R ( 2007) Circadian rhythms in the CNS and peripheral clock disorders: role of the bi ological clock in cardiovascular diseases. J Pharmacol Sci 103 (2):134-138. 162. Maltepe E, Keith B, Arsham AM, Brorson JR and Simon MC (2000) The role of ARNT2 in tumor angiogenesis and the neural response to hypoxia. Biochem Biophys Res Commun 273 (1):231-238. 163. Maltepe E, Schmidt JV, Baunoch D, Bradfield CA and Simon MC (1997) Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature 386 (6623):403-407. 164. Maruyama, K., Usami, M., Aizawa, T ., and Yoshikawa, K. (1991). A novel brainspecific mRNA encoding nuclear protei n (necdin) expressed in neurally differentiated embryonal carcinoma cells. Biochem Biophys Res Commun 178 (1), 291-296. 165. Maxwell PH, Dachs GU, Gleadle JM, Ni cholls LG, Harris AL, Stratford IJ, Hankinson O, Pugh CW and Ratcliffe PJ (1997) Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proc Natl Acad Sci U S A 94 (15):8104-8109. 166. McDonnell WM, Chensue SW, Askari FK and Moseley RH (1996) Hepatic fibrosis in Ahr-/mice. Science 271 (5246):223-224. 167. Meyer BK and Perdew GH (1999) Charact erization of the AhR-hsp90-XAP2 core complex and the role of the immunophilin-related protein XAP2 in AhR stabilization. Biochemistry 38 (28):8907-8917.

PAGE 264

246 168. Meyer BK, Petrulis JR and Perdew GH (2000) Aryl hydrocarbon (Ah) receptor levels are selectively modulated by hsp90-associated immunophilin homolog XAP2. Cell Stress Chaperones 5 (3):243-254. 169. Meyer BK, Pray-Grant MG, Vanden Heuve l JP and Perdew GH (1998) Hepatitis B virus X-associated protein 2 is a subunit of the unliganded aryl hydrocarbon receptor core complex and exhibits transcriptional enhancer activity. Mol Cell Biol 18 (2):978-988. 170. Meyer JN, Wassenberg DM, Karchner SI, Hahn ME and Di Giulio RT (2003a) Expression and inducibility of aryl hydr ocarbon receptor pathway genes in wildcaught killifish (Fundulus he teroclitus) with different contaminant-exposure histories. Environ Toxicol Chem 22 (10):2337-2343. 171. Meyer P, Prodromou C, Hu B, Vaughan C, Roe SM, Panaretou B, Piper PW and Pearl LH (2003b) Structural and functiona l analysis of the middle segment of hsp90: implications for ATP hydrolysis and client protein and cochaperone interactions. Mol Cell 11 (3):647-658. 172. Michaud J and Fan CM (1997) Single-mi nded--two genes, three chromosomes. Genome Res 7 (6):569-571. 173. Michaud JL, DeRossi C, May NR, Hold ener BC and Fan CM (2000) ARNT2 acts as the dimerization partner of SIM1 for the development of the hypothalamus. Mech Dev 90 (2):253-261. 174. Mimura J, Yamashita K, Nakamura K, Morita M, Takagi TN, Nakao K, Ema M, Sogawa K, Yasuda M, Katsuki M and Fujii-Kuriyama Y (1997) Loss of teratogenic response to 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) in mice lacking the Ah (dioxin) receptor. Genes Cells 2 (10):645-654. 175. Moffett P and Pelletier J (2000) Different transcriptional properties of mSim-1 and mSim-2. FEBS Lett 466 (1):80-86. 176. Moffett P, Reece M and Pelletier J (1997) The murine Sim-2 gene product inhibits transcription by active repression and f unctional interference. Mol Cell Biol 17 (9):4933-4947.

PAGE 265

247 177. Moore SK, Kozak C, Robinson EA, Ullric h SJ and Appella E (1989) Murine 86and 84-kDa heat shock proteins, cDNA se quences, chromosome assignments, and evolutionary origins. J Biol Chem 264 (10):5343-5351. 178. Morales JL and Perdew GH (2007) Car boxyl terminus of hsc70-interacting protein (CHIP) can remodel mature ar yl hydrocarbon receptor (AhR) complexes and mediate ubiquitination of both the AhR and the 90 kDa heat-shock protein (hsp90) in vitro. Biochemistry 46 (2):610-621. 179. Murphy BA, Vick MM, Sessions DR, Cook RF and Fitzgerald BP (2006) Evidence of an oscillating pe ripheral clock in an equine fibroblast cell line and adipose tissue but not in peripheral blood. J Comp Physiol A Neuroethol Sens Neural Behav Physiol 192 (7):743-751. 180. Myers CL, Weiss SJ, Kirsh MM and Shla fer M (1985) Involvement of hydrogen peroxide and hydroxyl radical in the 'oxygen paradox': reduction of creatine kinase release by catalase, allopurinol or deferoxamine, but not by superoxide dismutase. J Mol Cell Cardiol 17 (7):675-684. 181. Nambu JR, Chen W, Hu S and Crews ST (1996) The Drosophila melanogaster similar bHLH-PAS gene encodes a prot ein related to human hypoxia-inducible factor 1 alpha and Drosophila single-minded. Gene 172 (2):249-254. 182. Nambu JR, Lewis JO, Wharton KA, Jr and Crews ST (1991) The Drosophila single-minded gene encodes a helix-loop-he lix protein that acts as a master regulator of CNS midline development. Cell 67 (6):1157-1167. 183. Nebert DW, Puga A and Vasiliou V (1993) Role of the Ah receptor and the dioxin-inducible [Ah] gene battery in toxicity, cancer and signal transduction. Ann N Y Acad Sci 685 :624-640. 184. Necela B and Pollenz RS (1999) Functiona l analysis of activation and repression domains of the rainbow trout aryl hy drocarbon receptor nucl ear translocator (rtARNT) protein isoforms. Biochem Pharmacol 57 (10):1177-1190. 185. Necela B and Pollenz RS (2001) Identification of a novel Carboxy-terminal domain involved in the negative function of the rainbow trout Ah receptor nuclear translocator protein isof orm a (rtARNTa) in Ah receptor-mediated signaling. Biochem Pharmacol 62 (3):307-318.

PAGE 266

248 186. Nene V, Wortman JR, Lawson D, Haas B, Kodira C, Tu ZJ, Loftus B, Xi Z, Megy K, Grabherr M, Ren Q, Zdobnov EM, Lobo NF, Campbell KS, Brown SE, Bonaldo MF, Zhu J, Sinkins SP, Hogenka mp DG, Amedeo P, Arensburger P, Atkinson PW, Bidwell S, Biedler J, Birney E, Bruggner RV, Costas J, Coy MR, Crabtree J, Crawford M, Debruyn B, Decap rio D, Eiglmeier K, Eisenstadt E, ElDorry H, Gelbart WM, Gomes SL, Hamm ond M, Hannick LI, Hogan JR, Holmes MH, Jaffe D, Johnston JS, Kennedy RC, Koo H, Kravitz S, Kriventseva EV, Kulp D, Labutti K, Lee E, Li S, Lovin DD, Mao C, Mauceli E, Menck CF, Miller JR, Montgomery P, Mori A, Nascimento AL, Naveira HF, Nusbaum C, O'Leary S, Orvis J, Pertea M, Quesneville H, Reidenbach KR, Rogers YH, Roth CW, Schneider JR, Schatz M, Shumway M, St anke M, Stinson EO, Tubio JM, Vanzee JP, Verjovski-Almeida S, Werner D, White O, Wyder S, Zeng Q, Zhao Q, Zhao Y, Hill CA, Raikhel AS, Soares MB, Knudson DL, Lee NH, Galagan J, Salzberg SL, Paulsen IT, Dimopoulos G, Collins FH Birren B, Fraser-Liggett CM and Severson DW (2007) Genome sequence of Aedes aegypti, a major arbovirus vector. Science 316 (5832):1718-1723. 187. Nielsen OJ, Schuster SJ, Kaufman R, Ersl ev AJ and Caro J (1987) Regulation of erythropoietin production in a hum an hepatoblastoma cell line. Blood 70 (6):19041909. 188. Nishimura N, Yonemoto J, Miyabara Y, Fujii-Kuriyama Y and Tohyama C (2005) Altered thyroxin and retinoid metabolic response to 2,3,7,8-tetrachlorodibenzo-pdioxin in aryl hydrocarbon receptor-null mice. Arch Toxicol 79 (5):260-267. 189. Oberg M, Bergander L, Hakansson H, Rannug U and Rannug A (2005) Identification of the tryptophan photopr oduct 6-formylindolo[3,2-b]carbazole, in cell culture medium, as a factor that controls th e background aryl hydrocarbon receptor activity. Toxicol Sci 85 (2):935-943. 190. Ogiso H, Kagi N, Matsumoto E, Nishimoto M, Arai R, Shirouzu M, Mimura J, Fujii-Kuriyama Y and Yokoyama S (2004) Phosphorylation analysis of 90 kDa heat shock protein within the cyto solic arylhydrocarbon receptor complex. Biochemistry 43 (49):15510-15519. 191. Ohsawa, S., Hamada, S., Kakinuma, Y., Yagi, T., and Miura, M. (2005). Novel function of neuronal PAS domain protei n 1 in erythropoietin expression in neuronal cells. J Neurosci Res 79 (4), 451-458.

PAGE 267

249 192. Ohtake F, Baba A, Takada I, Okada M, Iwasaki K, Miki H, Takahashi S, Kouzmenko A, Nohara K, Chiba T, Fu jii-Kuriyama Y and Kato S (2007) Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature 446 (7135):562-566. 193. Okano T, Sasaki M and Fukada Y (2001) Cloning of mouse BMAL2 and its daily expression profile in the suprachiasmatic nucleus: a remarkable acceleration of Bmal2 sequence divergence after Bmal gene duplication. Neurosci Lett 300 (2):111-114. 194. Okey AB, Bondy GP, Mason ME, Nebert DW, Forster-Gibson CJ, Muncan J and Dufresne MJ (1980) Temperature-dependent cytosol-to-nucleus translocation of the Ah receptor for 2,3,7,8-tetrachlorodibenz o-p-dioxin in continuous cell culture lines. J Biol Chem 255 (23):11415-11422. 195. Okey AB, Riddick DS and Harper PA ( 1994) The Ah receptor: mediator of the toxicity of 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) and related compounds. Toxicol Lett 70 (1):1-22. 196. Pandini A, Denison MS, Song Y, Sosh ilov AA and Bonati L (2007) Structural and functional characterization of the aryl hydrocarbon receptor ligand binding domain by homology modeling and mutational analysis. Biochemistry 46 (3):696708. 197. Paul AL and Ferl RJ (1991) In vivo f ootprinting reveals unique cis-elements and different modes of hypoxic induction in maize Adh1 and Adh2. Plant Cell 3 (2):159-168. 198. Peattie DA, Harding MW, Fleming MA, DeCenzo MT, Lippke JA, Livingston DJ and Benasutti M (1992) Expression and characterization of human FKBP52, an immunophilin that associates with the 90-kDa heat shock protein and is a component of steroid receptor complexes. Proc Natl Acad Sci U S A 89 (22):10974-10978. 199. Petrulis JR, Hord NG and Perdew GH (2000) Subcellular localization of the aryl hydrocarbon receptor is modulated by the immunophilin homolog hepatitis B virus X-associated protein 2. J Biol Chem 275 (48):37448-37453.

PAGE 268

250 200. Petrulis JR, Kusnadi A, Ramadoss P, Hollingshead B and Perdew GH (2003) The hsp90 Co-chaperone XAP2 alters importin beta recognition of the bipartite nuclear localization signal of the Ah recep tor and represses transcriptional activity. J Biol Chem 278 (4):2677-2685. 201. Petrulis JR and Perdew GH (2002) The ro le of chaperone prot eins in the aryl hydrocarbon receptor core complex. Chem Biol Interact 141 (1-2):25-40. 202. Phelan D, Winter GM, Rogers WJ, Lam JC and Denison MS (1998a) Activation of the Ah receptor signal transduction pathway by bilirubin and biliverdin. Arch Biochem Biophys 357 (1):155-163. 203. Phelan DM, Brackney WR and Denison MS (1998b) The Ah receptor can bind ligand in the absence of recepto r-associated heat-shock protein 90. Arch Biochem Biophys 353 (1):47-54. 204. Poellinger L and Johnson RS (2004) HIF-1 and hypoxic response: the plot thickens. Curr Opin Genet Dev 14 (1):81-85. 205. Poland A and Glover E (1974) Compar ison of 2,3,7,8-tetrachlorodibenzo-pdioxin, a potent inducer of aryl hydrocarbon hydroxylase, with 3methylcholanthrene. Mol Pharmacol 10 (2):349-359. 206. Poland A and Glover E (1988) Ca2+-depende nt proteolysis of the Ah receptor. Arch Biochem Biophys 261 (1):103-111. 207. Poland A, Glover E and Kende AS (1976) Stereospecific, high affinity binding of 2,3,7,8-tetrachlorodibenzo-p-dioxin by hepati c cytosol. Evidence that the binding species is receptor for induction of aryl hydrocarbon hydroxylase. J Biol Chem 251 (16):4936-4946. 208. Poland A and Knutson JC (1982) 2,3,7,8-te trachlorodibenzo-p-dioxin and related halogenated aromatic hydrocarbons: examin ation of the mechanism of toxicity. Annu Rev Pharmacol Toxicol 22 :517-554. 209. Poland A, Palen D and Glover E (1994) Analys is of the four alleles of the murine aryl hydrocarbon receptor. Mol Pharmacol 46 (5):915-921.

PAGE 269

251 210. Pollenz RS (1996) The aryl-hydrocarbon receptor, but not the aryl-hydrocarbon receptor nuclear translocator protein, is rapidly depleted in hepatic and nonhepatic culture cells exposed to 2,3,7,8tetrachlorodibenzo-p-dioxin. Mol Pharmacol 49 (3):391-398. 211. Pollenz RS (2002) The mechanism of AH receptor protein down-regulation (degradation) and its impact on AH receptor-mediated gene regulation. Chem Biol Interact 141 (1-2):41-61. 212. Pollenz RS (2007) Specific blockage of ligand-induced degradation of the Ah receptor by proteasome but not calpain inhibitors in cell culture lines from different species. Biochem Pharmacol 74 (1):131-143. 213. Pollenz RS and Barbour ER (2000) Analys is of the complex relationship between nuclear export and aryl hydrocarbon receptor-mediated gene regulation. Mol Cell Biol 20 (16):6095-6104. 214. Pollenz RS, Davarinos NA and Shearer TP (1999) Analysis of aryl hydrocarbon receptor-mediated signaling during phys iological hypoxia reveals lack of competition for the aryl hydrocarbon nuclear translocator transcription factor. Mol Pharmacol 56 (6):1127-1137. 215. Pollenz RS and Dougherty EJ (2005) Re defining the role of the endogenous XAP2 and Carboxy-terminal hsp70-inter acting protein on the endogenous Ah receptors expressed in mouse and rat cell lines. J Biol Chem 280 (39):3334633356. 216. Pollenz RS, Necela B and Marks-Sojka K (2002) Analysis of rainbow trout Ah receptor protein isoforms in cell culture reveals conservation of function in Ah receptor-mediated signal transduction. Biochem Pharmacol 64 (1):49-60. 217. Pollenz RS, Popat J and Dougherty EJ (2005) Role of the carboxy-terminal transactivation domain and active transc ription in the liga nd-induced and ligandindependent degradation of the mouse Ahb-1 receptor. Biochem Pharmacol 70 (11):1623-1633. 218. Pollenz RS, Santostefano MJ, Klett E, Richardson VM, Necela B and Birnbaum LS (1998) Female Sprague-Dawley rats e xposed to a single oral dose of 2,3,7,8tetrachlorodibenzo-p-dioxin exhibit su stained depletion of aryl hydrocarbon receptor protein in liver, spleen, thymus, and lung. Toxicol Sci 42 (2):117-128.

PAGE 270

252 219. Pollenz RS, Sattler CA and Poland A (1994) The aryl hydroc arbon receptor and aryl hydrocarbon receptor nucle ar translocator protein s how distinct subcellular localizations in Hepa 1c1c7 cel ls by immunofluorescence microscopy. Mol Pharmacol 45 (3):428-438. 220. Pollenz RS, Sullivan HR, Holmes J, Necela B and Peterson RE (1996) Isolation and expression of cDNAs from rainbow tr out (Oncorhynchus mykiss) that encode two novel basic helix-loopHelix/PER-ARNT-SIM (bHLH/ PAS) proteins with distinct functions in the presence of the aryl hydrocarbon receptor. Evidence for alternative mRNA splicing and dominant negative activity in the bHLH/PAS family. J Biol Chem 271 (48):30886-30896. 221. Pollenz RS, Wilson SE and Doughert y EJ (2006) Role of endogenous XAP2 protein on the localization and nucleocyt oplasmic shuttling of the endogenous mouse Ahb-1 receptor in the presence and absence of ligand. Mol Pharmacol 70 (4):1369-1379. 222. Pongratz I, Antonsson C, Whitelaw ML and Poellinger L (1998) Role of the PAS domain in regulation of dimerization and DNA binding specificity of the dioxin receptor. Mol Cell Biol 18 (7):4079-4088. 223. Powell-Coffman JA, Bradfield CA and Wood WB (1998) Caenorhabditis elegans orthologs of the aryl hydro carbon receptor and its hete rodimerization partner the aryl hydrocarbon receptor nuclear translocator. Proc Natl Acad Sci U S A 95 (6):2844-2849. 224. Powell WH, Bright R, Bello SM and Hahn ME (2000) Developmental and tissuespecific expression of AHR1, AHR2, a nd ARNT2 in dioxin-sensitive and resistant populations of the mari ne fish Fundulus heteroclitus. Toxicol Sci 57 (2):229-239. 225. Powell WH, Karchner SI, Bright R and Hahn ME (1999) Functional diversity of vertebrate ARNT proteins: identification of ARNT2 as the predominant form of ARNT in the marine teleost, Fundulus heteroclitus. Arch Biochem Biophys 361 (1):156-163. 226. Prasch AL, Andreasen EA, Peterson RE and Heideman W ( 2004a) Interactions between 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) and hypoxia signaling pathways in zebrafish: hypoxia decreas es responses to TCDD in zebrafish embryos. Toxicol Sci 78 (1):68-77.

PAGE 271

253 227. Prasch AL, Heideman W and Peterson RE (2004b) ARNT2 is not required for TCDD developmental toxicity in zebrafish. Toxicol Sci 82 (1):250-258. 228. Prasch AL, Tanguay RL, Mehta V, Heideman W and Peterson RE (2006) Identification of zebrafish ARNT1 hom ologs: 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity in the developing zebrafish requires ARNT1. Mol Pharmacol 69 (3):776787. 229. Prasch AL, Teraoka H, Carney SA, Dong W, Hiraga T, Stegeman JJ, Heideman W and Peterson RE (2003) Aryl hydr ocarbon receptor 2 mediates 2,3,7,8tetrachlorodibenzo-p-dioxin develo pmental toxicity in zebrafish. Toxicol Sci 76 (1):138-150. 230. Probst MR, Fan CM, Tessier-Lavigne M and Hankinson O (1997) Two murine homologs of the Drosophila single-minded protein that interact with the mouse aryl hydrocarbon receptor nucle ar translocator protein. J Biol Chem 272 (7):44514457. 231. Puig O, Caspary F, Rigaut G, Rutz B, Bouveret E, Bragado-Nilsson E, Wilm M, and Seraphin B (2001) The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods 24 :218-229. 232. Qu X, Metz RP, Porter WW, Cassone VM and Earnest DJ (2007) Disruption of Clock Gene Expression Alters Responses of the Ahr Signaling Pathway in the Mouse Mammary Gland. Mol Pharmacol 233. Ramadoss P, Marcus C and Perdew GH (2005) Role of the aryl hydrocarbon receptor in drug metabolism. Expert Opin Drug Metab Toxicol 1 (1):9-21. 234. Ramadoss P and Perdew GH (2005) The transactivation domain of the Ah receptor is a key determinant of cellu lar localization and ligand-independent nucleocytoplasmic shuttling properties. Biochemistry 44 (33):11148-11159. 235. Reick M, Robertson RW, Pasco DS a nd Fagan JB (1994) Down-regulation of nuclear aryl hydrocarbon receptor DNAbinding and transactivation functions: requirement for a labile or inducible factor. Mol Cell Biol 14 (9):5653-5660.

PAGE 272

254 236. Reid G, Hubner MR, Metivier R, Brand H, Denger S, Manu D, Beaudouin J, Ellenberg J and Gannon F (2003) Cyclic proteasome-mediated turnover of unliganded and liganded ERalpha on responsiv e promoters is an integral feature of estrogen signaling. Mol Cell 11 (3):695-707. 237. Reick, M., Garcia, J.A., Dudley, C., and McKnight, S.L. (2001). NPAS2: an analog of clock operative in the mammalian forebrain. Science 293 (5529), 506509. 238. Reisz-Porszasz S, Probst MR, Fukunaga BN and Hankinson O (1994) Identification of functional domains of the aryl hydrocarbon receptor nuclear translocator pr otein (ARNT). Mol Cell Biol 14 (9):6075-6086. 239. Reyes H, Reisz-Porszasz S and Hankins on O (1992) Identification of the Ah receptor nuclear tran slocator protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science 256 (5060):1193-1195. 240. Richardson VM, Santostefano MJ and Bir nbaum LS (1998) Daily cycle of bHLHPAS proteins, Ah receptor and Arnt, in multiple tissues of female SpragueDawley rats. Biochem Biophys Res Commun 252 (1):225-231. 241. Richter CA, Tillitt DE and Hannink M (2001) Regulation of subcellular localization of the aryl hydrocarbon receptor (AhR). Arch Biochem Biophys 389 (2):207-217. 242. Roberts BJ, Whitelaw ML. (1999) Degrad ation of the basic helix-loop-helix/PerARNT-Sim homology domain dioxin r eceptor via the ubiquitin/proteasome pathway. J Biol Chem. 274 (51):36351-6. 243. Roman BL and Peterson RE (1998) In uter o and lactational ex posure of the male rat to 2,3,7,8-tetrachlorodi benzo-p-dioxin impairs prostate development. 1. Effects on gene expression. Toxicol Appl Pharmacol 150 (2):240-253. 244. Roman BL, Pollenz RS and Peterson RE (1998) Responsiveness of the adult male rat reproductive tract to 2,3,7,8-tetrachl orodibenzo-p-dioxin exposure: Ah receptor and ARNT expression, CYP1A1 induction, and Ah receptor downregulation. Toxicol Appl Pharmacol 150 (2):228-239.

PAGE 273

255 245. Rowatt AJ, DePowell JJ and Powell WH (2003) ARNT gene multiplicity in amphibians: characterization of AR NT2 from the frog Xenopus laevis. J Exp Zoolog B Mol Dev Evol 300 (1):48-57. 246. Roy NK and Wirgin I (1997) Characte rization of the aromatic hydrocarbon receptor gene and its expression in Atlantic tomcod. Arch Biochem Biophys 344 (2):373-386. 247. Rutter, J., Reick, M., Wu, L.C., and Mc Knight, S.L. (2001). Regulation of clock and NPAS2 DNA binding by the red ox state of NAD cofactors. Science 293 (5529), 510-514. 248. Ryan HE, Lo J and Johnson RS (1998) HIF-1 alpha is required for solid tumor formation and embryonic vascularization. EMBO J 17 (11):3005-3015. 249. Sablistsky, F (2005) Protein motif s: the helix-loop-helix motif. In: Encyclopedia of Life Sciences (Online). John Wiley & Sons, Chichester, UK, pp. (5 pages) 250. Sadek CM, Jalaguier S, Feeney EP, Aitola M, Damdimopoulos AE, Pelto-Huikko M and Gustafsson JA (2000) Isolation and characterization of AINT: a novel ARNT interacting protein expressed during murine embryonic development. Mech Dev 97 (1-2):13-26. 251. Safe S (2001) Molecular biology of the Ah receptor and its role in carcinogenesis. Toxicol Lett 120 (1-3):1-7. 252. Safe S, Wang F, Porter W, Duan R and McDougal A (1998) Ah receptor agonists as endocrine disruptors: antiest rogenic activity and mechanisms. Toxicol Lett 102103 :343-347. 253. Safe S and Wormke M (2003) Inhibito ry aryl hydrocarbon receptor-estrogen receptor alpha cross-talk and mechanisms of action. Chem Res Toxicol 16 (7):807816. 254. Salghetti SE, Caudy AA, Chenoweth JG and Tansey WP (2001) Regulation of transcriptional activation domain function by ubiquitin. Science 293 (5535):16511653.

PAGE 274

256 255. Sangoram AM, Saez L, Antoch MP, Gekaki s N, Staknis D, Whiteley A, Fruechte EM, Vitaterna MH, Shimomura K, King DP, Young MW, Weitz CJ and Takahashi JS (1998) Mammalian circad ian autoregulatory loop: a timeless ortholog and mPer1 interact and nega tively regulate CLOCK-BMAL1-induced transcription. Neuron 21 (5):1101-1113. 256. Satoh N, Satou Y, Davidson B and Levi ne M (2003) Ciona intestinalis: an emerging model for whole-genome analyses. Trends Genet 19 (7):376-381. 257. Schmidt JV, Su GH, Reddy JK, Simon MC and Bradfield CA (1996) Characterization of a murine Ahr null alle le: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci U S A 93 (13):6731-6736. 258. Schoenhard JA, Eren M, Johnson CH and Vaughan DE (2002) Alternative splicing yields novel BMAL2 variants : tissue distributi on and functional characterization. Am J Physiol Cell Physiol 283 (1):C103-114. 259. Seidel SD, Winters GM, Rogers WJ, Zi ccardi MH, Li V, Keser B and Denison MS (2001) Activation of the Ah recept or signaling pathway by prostaglandins. J Biochem Mol Toxicol 15 (4):187-196. 260. Sekine H, Mimura J, Yamamoto M a nd Fujii-Kuriyama Y (2006) Unique and overlapping transcriptional roles of aryl hydrocarbon receptor nuclear translocator (Arnt) and Arnt2 in xen obiotic and hypoxic responses. J Biol Chem 281 (49):37507-37516. 261. Semenza GL (2007) Hypoxia-inducib le factor 1 (H IF-1) pathway. Sci STKE 2007 (407):cm8. 262. Semenza GL, Agani F, Booth G, Forsythe J, Iyer N, Jiang BH, Leung S, Roe R, Wiener C and Yu A (1997) Structural and functional analysis of hypoxiainducible factor 1. Kidney Int 51 (2):553-555. 263. Semenza GL, Roth PH, Fang HM a nd Wang GL (1994) Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J Biol Chem 269 (38):23757-23763.

PAGE 275

257 264. Shen ES and Whitlock JP, Jr. (1992) Protein-DNA interactions at a dioxinresponsive enhancer. Muta tional analysis of the DNA-binding site for the liganded Ah receptor. J Biol Chem 267 (10):6815-6819. 265. Shetty PV, Bhagwat BY and Chan WK (2003) P23 enhances the formation of the aryl hydrocarbon receptor-DNA complex. Biochem Pharmacol 65 (6):941-948. 266. Shetty PV, Wang X and Chan WK (2004) CyP40, but not Hsp70, in rabbit reticulocyte lysate causes the aryl hy drocarbon receptor-DNA complex formation. Arch Biochem Biophys 429 (1):42-49. 267. Shou W, Aghdasi B, Armstrong DL, Guo Q, Bao S, Charng MJ, Mathews LM, Schneider MD, Hamilton SL and Matzuk MM (1998) Cardiac defects and altered ryanodine receptor function in mice lacking FKBP12. Nature 391 (6666):489-492. 268. Shue G and Kohtz DS (1994) Structural and functional aspects of basic helixloop-helix protein folding by heat-shock protein 90. J Biol Chem 269 (4):27072711. 269. Smith TP, Grosse WM, Freking BA, Robe rts AJ, Stone RT, Casas E, Wray JE, White J, Cho J, Fahrenkrug SC, Bennett GL, Heaton MP, Laegreid WW, Rohrer GA, Chitko-McKown CG, Pertea G, Holt I, Karamycheva S, Liang F, Quackenbush J and Keele JW (2001) Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and cons truction of a gene index for cattle. Genome Res 11 (4):626-630. 270. Sogawa K, Nakano R, Kobayashi A, Ki kuchi Y, Ohe N, Matsushita N and FujiiKuriyama Y (1995) Possible function of Ah receptor nuclear translocator (Arnt) homodimer in transcriptional regulation. Proc Natl Acad Sci U S A 92 (6):19361940. 271. Sojka KM, Kern CB and Pollenz RS (2000) Expression and subcellular localization of the aryl hydrocarbon recepto r nuclear translocator (ARNT) protein in mouse and chicken over developmental time. Anat Rec 260 (4):327-334. 272. Son DS and Rozman KK (2002) 2,3,7,8Tetrachlorodibenzo-p-dioxin (TCDD) induces plasminogen activator inhibitor-1 through an aryl hy drocarbon receptormediated pathway in mouse hepatoma cell lines. Arch Toxicol 76 (7):404-413.

PAGE 276

258 273. Song J, Clagett-Dame M, Peterson RE Hahn ME, Westler WM, Sicinski RR and DeLuca HF (2002) A ligand for the aryl hydrocarbon receptor isolated from lung. Proc Natl Acad Sci U S A 99 (23):14694-14699. 274. Song Z and Pollenz RS (2002) Ligand-dep endent and independent modulation of aryl hydrocarbon receptor localizatio n, degradation, and gene regulation. Mol Pharmacol 62 (4):806-816. 275. Song Z and Pollenz RS (2003) Functiona l analysis of murine aryl hydrocarbon (AH) receptors defective in nuclear import: impact on AH receptor degradation and gene regulation. Mol Pharmacol 63 (3):597-606. 276. Sonnenfeld M, Ward M, Nystrom G, Mosh er J, Stahl S and Crews S (1997) The Drosophila tango gene encodes a bHLH-P AS protein that is orthologous to mammalian Arnt and controls CNS midline and tracheal development. Development 124 (22):4571-4582. 277. Sun Y, Yang Z, Niu Z, Peng J, Li Q, Xiong W, Langnas AN, Ma MY and Zhao Y (2006a) MOP3, a component of the molecula r clock, regulates the development of B cells. Immunology 119 (4):451-460. 278. Sun Y, Yang Z, Niu Z, Wang W, Peng J, Li Q, Ma MY and Zhao Y (2006b) The mortality of MOP3 deficient mice w ith a systemic functional failure. J Biomed Sci 13 (6):845-851. 279. Sutter TR, Tang YM, Hayes CL, Wo YY, Jabs EW, Li X, Yin H, Cody CW and Greenlee WF (1994) Complete cDNA se quence of a human dioxin-inducible mRNA identifies a new gene subfamily of cytochrome P450 that maps to chromosome 2. J Biol Chem 269 (18):13092-13099. 280. Swanson HI, Chan WK and Bradfield CA (1995) DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins. J Biol Chem 270 (44):26292-26302. 281. Swanson HI and Yang JH (1999) Specifi city of DNA binding of the c-Myc/Max and ARNT/ARNT dimers at th e CACGTG recognition site. Nucleic Acids Res 27 (15):3205-3212.

PAGE 277

259 282. Takahashi Y, Nakayama K, Shimojima T, Itoh S and Kamataki T (1996) Expression of aryl hydrocarbon receptor (AhR) and aryl hydrocarbon receptor nuclear translocator (Arnt) in adu lt rabbits known to be non-responsive to cytochrome P-450 1A1 (CYP1A1) inducers. Eur J Biochem 242 (3):512-518. 283. Takahata S, Sogawa K, Kobayashi A, Ema M, Mimura J, Ozaki N and FujiiKuriyama Y (1998) Transcri ptionally active he terodimer formation of an Arntlike PAS protein, Arnt3, with HIF-1a, HLF, and clock. Biochem Biophys Res Commun 248 (3):789-794. 284. Tanguay RL, Abnet CC, Heideman W and Peterson RE (1999) Cloning and characterization of the ze brafish (Danio rerio) aryl hydrocarbon receptor. Biochim Biophys Acta 1444 (1):35-48. 285. Tanguay RL, Andreasen E, Heideman W and Peterson RE (2000) Identification and expression of alternatively spliced aryl hydrocarbon nuclear translocator 2 (ARNT2) cDNAs from zebrafish with distinct functions. Biochim Biophys Acta 1494 (1-2):117-128. 286. Teh, C.H., Lam, K.K., Loh, C.C., Loo, J.M., Yan, T., and Lim, T.M. (2006). Neuronal PAS domain protein 1 is a tr anscriptional repressor and requires arylhydrocarbon nuclear translocator for its nuclear localization. J Biol Chem 281 (45), 34617-34629. 287. Teraoka H, Dong W, Tsujimoto Y, Iwasa H, Endoh D, Ueno N, Stegeman JJ, Peterson RE and Hiraga T (2003) Inducti on of cytochrome P450 1A is required for circulation failure and edema by 2,3,7,8-tetrachlorodibenzo-p-dioxin in zebrafish. Biochem Biophys Res Commun 304 (2):223-228. 288. Thackaberry EA, Bedrick EJ, Goens MB, Danielson L, Lund AK, Gabaldon D, Smith SM and Walker MK (2003) In sulin regulation in AhR-null mice: embryonic cardiac enlargement, neonatal macrosomia, and altered insulin regulation and response in pregna nt and aging AhR-null females. Toxicol Sci 76 (2):407-417. 289. Thomas JB, Crews ST and Goodman CS (1988) Molecular genetics of the singleminded locus: a gene involved in the development of the Drosophila nervous system. Cell 52 (1):133-141.

PAGE 278

260 290. Tokishita S, Kimura S, Mandokora Y, Kato K, Shiga Y, Takahashi Y, Ohta T and Yamagata H (2006) Tissue-specific expression of a bHLH-PAS protein homologous to ARNT during the devel opment of crustacean Daphnia magna. Gene 376 (2):231-239. 291. Verma S, Ismail A, Gao X, Fu G, Li X, O'Malley BW and Nawaz Z (2004) The ubiquitin-conjugating enzyme UBCH7 acts as a coactivator for steroid hormone receptors. Mol Cell Biol 24 (19):8716-8726. 292. Vierimaa O, Georgitsi M, Lehtonen R, Vahteristo P, Kokko A, Raitila A, Tuppurainen K, Ebeling TM, Salmela PI, Paschke R, Gundogdu S, De Menis E, Makinen MJ, Launonen V, Karhu A and Aa ltonen LA (2006) Pituitary adenoma predisposition caused by germline mutations in the AIP gene. Science 312 (5777):1228-1230. 293. Walisser JA, Bunger MK, Glover E a nd Bradfield CA (2004) Gestational exposure of Ahr and Arnt hypomorphs to di oxin rescues vascular development. Proc Natl Acad Sci U S A 101 (47):16677-16682. 294. Walker MK, Heid SE, Smith SM and Swanson HI (2000) Molecular characterization and developmental expr ession of the aryl hydrocarbon receptor from the chick embryo. Comp Biochem Physiol C Toxicol Pharmacol 126 (3):305319. 295. Walker MK, Pollenz RS and Smith SM (1997) Expression of the aryl hydrocarbon receptor (AhR) and AhR nuclear translocator during chick cardiogenesis is consistent with 2,3,7,8-tetrachlorodibe nzo-p-dioxin-induced heart defects. Toxicol Appl Pharmacol 143 (2):407-419. 296. Wang F, Gao JX, Mimura J, Kobayashi A, Sogawa K and Fujii-Kuriyama Y (1998) Structure and expre ssion of the mouse AhR nucl ear translocator (mArnt) gene. J Biol Chem 273 (38):24867-24873. 297. Wang F, Shi S, Zhang R and Hankinson O (2006) Identifying target genes of the aryl hydrocarbon receptor nuclear translocator (A rnt) using DNA microarray analysis. Biol Chem 387 (9):1215-1218. 298. Wang GL and Semenza GL (1993) Desfe rrioxamine induces erythropoietin gene expression and hypoxia-inducible factor 1 DNA-binding activity: implications for models of hypoxia signal transduction. Blood 82 (12):3610-3615.

PAGE 279

261 299. Wang S, Ge K, Roeder RG and Hanki nson O (2004) Role of mediator in transcriptional activation by th e aryl hydrocarbon receptor. J Biol Chem 279 (14):13593-13600. 300. Wentworth JN, Buzzeo R and Pollenz RS (2004) Functional characterization of aryl hydrocarbon receptor (zfAHR2) local ization and degradation in zebrafish (Danio rerio). Biochem Pharmacol 67 (7):1363-1372. 301. Wharton KA, Jr. and Crews ST (1993) CN S midline enhancers of the Drosophila slit and Toll genes. Mech Dev 40 (3):141-154. 302. Wharton KA, Jr., Franks RG, Kasai Y and Crews ST (1994) Control of CNS midline transcription by asymmetric E-box-li ke elements: similarity to xenobiotic responsive regulation. Development 120 (12):3563-3569. 303. Whitelaw M, Pongratz I, Wilhelmsson A, Gustafsson JA and Poellinger L (1993) Ligand-dependent recruitment of th e Arnt coregulator determines DNA recognition by the dioxin receptor. Mol Cell Biol 13 (4):2504-2514. 304. Whitelaw ML, Gustafsson JA and Poellinger L (1994) Identification of transactivation and repressi on functions of the dioxin receptor and its basic helixloop-helix/PAS partner fact or Arnt: inducible versus constitutive modes of regulation. Mol Cell Biol 14 (12):8343-8355. 305. Whitelaw ML, McGuire J, Picard D, Gust afsson JA and Poellinger L (1995) Heat shock protein hsp90 regulates dioxin receptor function in vivo. Proc Natl Acad Sci U S A 92 (10):4437-4441. 306. Whitlock JP, Jr. (1999) Induction of cytochrome P4501A1. Annu Rev Pharmacol Toxicol 39 :103-125. 307. Whitlock JP, Jr. and Galeazzi DR (1984) 2,3,7,8-Tetrachlorodibenzo-p-dioxin receptors in wild type and variant mo use hepatoma cells. Nuclear location and strength of nuclear binding. J Biol Chem 259 (2):980-985. 308. Wilson CL, Thomsen J, Hoivik DJ, Wormke MT, Stanker L, Holtzapple C and Safe SH (1997) Aryl hydrocarbon (Ah) nonresponsiveness in estrogen receptornegative MDA-MB-231 cells is associated with expression of a variant arnt protein. Arch Biochem Biophys 346 (1):65-73.

PAGE 280

262 309. Wines ME, Tiffany AM and Holdener BC (1998) Physical localization of the mouse aryl hydrocarbon receptor nuclear tr anslocator-2 (Arnt2) gene within the c112K deletion. Genomics 51 (2):223-232. 310. Wochnik GM, Young JC, Schmidt U, Holsboer F, Hartl FU and Rein T (2004) Inhibition of GR-mediated transcripti on by p23 requires interaction with Hsp90. FEBS Lett 560 (1-3):35-38. 311. Wolting CD and McGlade CJ (1998) Cloni ng and chromosomal localization of a new member of the bHLH/PAS transcription factor family. Mamm Genome 9 (6):463-468. 312. Wood SM, Gleadle JM, Pugh CW, Hankinson O and Ratcliffe PJ (1996) The role of the aryl hydrocarbon receptor nucl ear translocator (ARNT) in hypoxic induction of gene expression. Studi es in ARNT-def icient cells. J Biol Chem 271 (25):15117-15123. 313. Woods SL and Whitelaw ML (2002) Diffe rential activities of murine single minded 1 (SIM1) and SIM2 on a hypoxic response element. Cross-talk between basic helix-loop-helix/per-Arnt-Sim homology transcription factors. J Biol Chem 277 (12):10236-10243. 314. Yasui T, Kim EY, Iwata H and Tana be S (2004) Identification of aryl hydrocarbon receptor 2 in aquatic birds; cDNA cloning of AHR1 and AHR2 and characteristics of their amino acid sequences. Mar Environ Res 58 (2-5):113-118. 315. Yu W, Ikeda M, Abe H, Honma S, Ebisawa T, Yamauchi T, Honma K and Nomura M (1999) Characterization of three splice variants and genomic organization of the mouse BMAL1 gene. Biochem Biophys Res Commun 260 (3):760-767. 316. Zelzer E, Wappner P and Shilo BZ (1997) The PAS domain c onfers target gene specificity of Drosophila bHLH/PAS proteins. Genes Dev 11 (16):2079-2089. 317. Zeruth G and Pollenz RS (2007) Functi onal analysis of cis-regulatory regions within the dioxin-inducible CYP1A prom oter/enhancer region from zebrafish (Danio rerio). Chem Biol Interact

PAGE 281

263 318. Zudaire, E., Cuesta, N., Murty, V., Woodson, K., Adams, L., Gonzalez, N., Martinez, A., Narayan, G., Kirsch, I., Franklin, W. et al. (2008). The aryl hydrocarbon receptor repressor is a putative tumor suppressor gene in multiple human cancers. J Clin Invest 118 (2), 640-650.

PAGE 282

264 Bibliography 1. Alberts, B (2003) Essential Cell Biology Garland Science. 2. Boelsterli, UA (2003) Mechanistic Toxicology: The molecular basis of how chemicals disrupt biological targets New York: Taylor & Francis, Inc. 3. Hicks, BW (2002) Green Fluorescent Protein: A pplications and Protocols Totowa, New Jersey: Humana Press. 4. Lewis, DFV (2001) Guide to Cytochromes P450: Structure and Function New York: Taylor & Francis, Inc. 5. Nicholl, DST (2002). Genetic Engineering United Kingdom: Cambridge University Press.

PAGE 283

265 Appendices

PAGE 284

266 Appendix A: Endogenous AHRb-2 data The following figures (A-1 through A-7) were generated by Dr. Richard S. Pollenz and come from the publications: Pollenz RS, Wilson SE Dougherty EJ (2006) Role of endogenous XAP2 protein on the localization and nucleocytoplasmic shuttling of the endogenous mouse Ahb-1 receptor in the presence and absence of ligand. Mol Pharmacol. 70:1369-79 and Pollenz RS, Dougherty EJ (2005) Redefining the role of the endogenous XAP2 and Carboxy-terminal hsp70 -interacting protein on the endogenous Ah receptors expressed in mouse and rat cell lines. J Biol Chem. 280:33346-56. These figures are included since they will aid the r eader in interpreting th e studies performed in Chapter Two particularly in the comparison between endogenous Ahb-2 receptor function and that of Ahb-2 receptor in the Ahb-1 genetic background described in Chapter Two

PAGE 285

267 Appendix A: (Continued) Figure A-1: Analysis of AHR and XAP2 expr ession and association in Hepa-1, A7, and C2C12 cells. A, equal amounts of total cell lysa tes from the indicated cells were resolved by SDS-PAGE, blotted, and stained w ith A-1A rabbit IgG (1.0 g/ml), -actin rabbit IgG (1:1000), hsp90 rabbi t IgG (1:500), XAP2 mouse IgG1 (1:750), or p23 mouse IgG (1:1000). Reactivity was visualized by ECL with GAR-HRP or GAM-HRP IgG (1:10,000). B, cytosol was prepared from Hepa -1, A7, or C2C12 cells as detailed in Chapter Six 800 g of cytosol was pr ecipitated with eith er affinity-pure A1-A IgG (5 g) or affinity-pure preimmune rabbit IgG (5 g) along with Protein A/G-agarose (25 l) for 2.5 h at 4 C with rocking. Pellets were wa shed three times for 5 min each with TTBS supplemented with sodium molybdate (20 mM) and then boiled in 30 l of SDS sample buffer. 15 g of cytosol (input) or 15 l of the eluted protein were resolved by SDSPAGE, blotted, and stained with A-1A IgG (1.0 g/ml) or XAP2 mouse IgG1 (1:750). Reactivity was visualized by ECL with GAR-HRP or GAM-HRP IgG (1:10,000). He Hepa-1; C2 C2C12; Ah precipitated with A1-A IgG; Pi precipitated with preimmune IgG. The numbers under the XAP2 blot represent the percentage of XAP in relation to the level in Hepa-1 (100%). The precipitate d IgG band is shown to demonstrate the uniformity of the precipitation across all samples.

PAGE 286

268 Appendix A: (Continued) Figure A-2: Subcellular localization of AH R in Hepa-1, A7, C2C12, and 10T1/2 cells exposed to TCDD or LMB. Cells were grown on glass coverslips exposed to the compounds detailed below and then fixed as detailed previously (Holmes and Pollenz, 1997; Pollenz, 1996; Pollenz et al., 1994). Cove rslips were incubated with A-1 IgG (1.0 g/ml) and visualized with GAR-Rhodamine IgG (1:400). A–D Hepa-1 cells exposed to methanol (0.5%) for 4 h ( A ), TCDD (2 nM) for 1 h ( B ), LMB (20 nM) for 2 h ( C ),orLMBfor 4 h ( D ). E–H C2C12 cells exposed to methanol (0.5%) for 4 h ( E ), TCDD (2 nM) for 1 h ( F ), LMB (20 nM) for 2 h ( G ), or LMB for 4 h ( H ). Panels I–L A7 cells exposed to methanol (0.5%) for 4 h ( I ), TCDD (2 nM) for 1 h ( J ), LMB (20 nM) for 2 h ( K ), LMB for 4 h ( L ). M–P 10T1/2 cells exposed to methanol (0.5%) for 4 h ( M ), TCDD (2 nM) for 1 h ( N ), LMB (20 nM) for 2 h ( O ),or LMB for 4 h ( P ). Each set of four panels was exposed for identical times. Bar ( A ), 10 m.

PAGE 287

269 Appendix A: (Continued) Figure A-3: Reduction of endogenous XAP2 by siRNA knockdown in Hepa-1 cells. A, Hepa-1 cells were transfected with si RNA specific to XAP2 or control siRNA as detailed in Chapter Six Forty-eight hours later, cytoso l was prepared, and 600 g was precipitated with either AHR (Ah-IgG) or preimmune IgG (Pi-IgG) as detailed in Chapter Six Each of the precipitated samples as well as 15 g of cytosol (input) was resolved by SDS-PAGE and blot ted. Blots were stained with either 1.0 g/ml A-1A IgG or XAP2 mouse IgG1 (1:750), and reactivity was visualized by ECL with GAR-HRP or GAM-HRP IgG (1:10,000). The IgG bands are pr esented to show the consistency of the precipitations. C, cells transfected with cont rol siRNA; X, cells transfected with XAP2 siRNA. B, computer densitometry was used to determine the relative level of AHR or XAP2 protein present in the precipitated sa mples presented on the blot in A. Each column represents the relative densitometry units of an individual band and shows that the ratio of XAP2/AHR has changed in the si XAP samples. Ah, level of AHR protein; mX, level of XAP2 protein.

PAGE 288

270 Appendix A: (Continued) Figure A-4: Subcellular localization of AHR in cells with reduced levels of XAP2. Hepa-1 cells were transfected with siRNA specific to XAP2 or control siRNA along with FITC-labeled RNA (BLOCK-IT) as detailed in Chapter Six. Forty-eight hours later, cells were treated with either 0.1% methanol or 1 nM LMB for 4 h and either fixed for immunofluorescence microscopy or harvested for the preparation of to tal cell lysates. A, Western blot of AHR and XAP 2 expression in total cell lysates prepared from cells transfected with siCON or XAP 2 siRNA (siXAP). B, cells were visualized for AHR. Fixed cells were stained with 1.0 g/ml A-1 IgG and visualized with GAR-RHO IgG (1:400). The FITC-labeled panels represent th e exact fields presen ted to the left and illustrate the transfection efficiency of the experiment. Scale bar, 10 m.

PAGE 289

271 Appendix A: (Continued) Figure A-5: Association of endogenous XAP 2 with AHR in Hepa-1 cells transfected with hXAP2 expression vectors. Hepa-1 cells were transfected with pCI-hXAP2 or control vector pcDNA3.1 as detailed in Chapter Six. After 24 h, populations of cells were harvested, and cytosol was generated for imm unoprecipitation experiments. A, 600 g of cytosol from the indicated samples was precip itated in duplicate w ith either AHR (AHRIgG) or preimmune IgG (P i-IgG) as detailed in Chapter Six Each of the precipitated samples as well as 15 g of cytosol (input) was resolved by SDS-PAGE and blotted. Blots were stained with either 1.0 g/ml A-1A IgG or XAP2 mouse IgG1 (1:750), and reactivity was visualized by ECL with GAR -HRP or GAM-HRP IgG (1:10,000). mXAP2, endogenous mouse XAP2; hXAP2, exogenous hum an XAP2; and AHR (AHR). The IgG bands are presented to show the consistency of the precipitations. C, samples from cells transfected with pcDNA3.1; X, samples fr om cells transfected with pCI-hXAP2. B, computer densitometry was used to determin e the relative level of AHR or XAP2 protein present in the precipitated samples presented on the blot in A. Each column represents the relative densitometry units of an individual ba nd and can be used to evaluate differences in the ratio of XAP2/AHR in the different sa mples. However, because of the difference in the sensitivity of each antibody for its target protein, the ratio does not represent the absolute number of protein molecules. No te that the XAP2/AHR ratio is essentially unchanged in all the samples. The precipita ted IgG band is shown to demonstrate the uniformity of the precipitation across all samples.

PAGE 290

272 Appendix A: (Continued) Figure A-6: Localization of endogenous Ahb-1 receptor in Hepa-1 cells expressing hXAP2. Hepa-1 cells were transfected with pCI-hXAP2 along with FITC-labeled RNA (BLOCK-IT), pEYFP-XAP2-FLAG, or c ontrol vector pCDNA 3.1 as detailed in Chapter Six. After 24 h, populations of cells were either harvested for the generation of total cell lysates or fixed for immunocytochemical st aining. A, equal amounts of the indicated samples were resolved by SDS-PAGE and bl otted. Blots were stained with either 1.0 g/ml A-1A IgG, XAP2 mouse IgG1 (1:750), or anti-actin Ig G (1:1000), and reactivity was visualized by ECL with GAR-HRP or GAM-HRP IgG (1:10,000). Con, cells transfected with pcDNA3.1; +XAP, cells tr ansfected with pCI-hXAP2 and BLOCK-IT; +Y-XAP, cells transfected with pEYFP-hXAP 2-FLAG. B, exact Hepa-1 populations that were transfected as detailed in A were fi xed and stained for the AHR with 1.0 g/ml A-1 IgG and visualized with GAR-RHO IgG (1: 400). Con AHR, AHR staining pattern in cells transfected with pcDNA3.1; AHR + hXAP2, AHR staining pattern in cells transfected with pCI-hXAP2 a nd BLOCK-IT; FITC, FITC labeling of the exact field presented to the left to illustrate the tran sfection efficiency of the experiment; YFP-XAP2, pattern of the expressed EYFP-XAP2-FLAG; AHR, AHR staining pattern of the exact field presented to the left. The arrows indi cate cells that are not expressing the EYFPXAP2-FLAG protein. Scale bar, 10 m.

PAGE 291

273 Appendix A: (Continued) Figure A-7: Western blot analysis of AH R in Hepa-1, A7, and C2C12 cells exposed to TCDD. A Hepa-1, A7, and C2C12 cel ls were exposed to Me2SO (0.1%) for 2 h or TCDD (2 nM) for the indicated times. Equal amounts of total cell lysates were then resolved by SDS-PAGE, blotted, and stai ned with A-1A IgG (1.0 g/ml) and -actin IgG (1:1000). Reactivity was visualized by EC L with GAR-HRP IgG (1:10,000), and bands were quantified and normalized as detailed (Holmes and Pollenz, 1997; Pollenz, 1996; Pollenz et al., 1994). B the level of AHR protein at each time point was divided by the corresponding level of actin, a nd the average S.E. of the three independent samples was plotted as a function of the time 0 control. Th e error bars on some of the later time points are within the symbol used to show the data point. *, statistically different from the Hepa-1

PAGE 292

274 Appendix B: Hypoxia qRT-PCR Primer sets The following lists qRT-PCR primer sets (forward and reverse) and antibodies that have been used in analyzing hypoxic respon se in several cell lines. These data were complied from several publications, whose refere nces are listed above each data set, and are further subdivided by the species and cel l line being examined. Amplicon sizes for PCR products are given where known. Target genes are abbreviated as follows: HIF-1 hypoxia-inducible factor-1 ; VEGF, vascular endothelial growth factor; NMDA-R1, Nmethyl D-aspartate receptor subtype 1; eNOS, endothelial nitric oxide synthase; iNOS, inducible NOS; nNOS, neuronal NOS; ANG, angiopoietin, GLUT1, glucose transporter 1; PGK, phosphoglycerate kinase; GluR 2/3, glutamate receptor subunit; GFAP, glial fibrillary acidic protei n; GAPDH, glyceral dehydes 3-phosphate dehydrogenase.

PAGE 293

275 Appendix B: (Continued) HUMAN (ARPE-19 cells) Matsuda, S, Gomi, F, Katayama, T, Koya ma, Y, Tohyama, M, and Yasuo Tano (2006). Induction of Connective Tissue Growth Factor in Retinal Pigment Epithelium Cells by Oxidative Stress. Jpn J Ophthalmol 50:229–234 CTGF Forward 5’-CGGC TTACCGACTGGAAGAC Reverse 5’-CGTCGGTACATACTCCACAG VEGF 5’-CAGCGCAGCTACTGCCATCCAATCGAGA 5’-GCTTGTCACATCTGCAAGTACGTTCGTTTA human or mouse -actin 5 -TCCTCCCTGGAGAAGAGCTA 5 -TCCTGCTTGCTGATCCACAT

PAGE 294

276 Appendix B: (Continued) RAT (corpus collosum from brains of rats in hypoxic environment) Kaur C, Sivakumar V, Ang LS and S undaresan A (2006). Hypoxic damage to the periventricular white matter in neonatal brain: role of vascular endot helial growth factor, nitric oxide and excitotoxicity. J Neurochem. 98:1200-16. Primer Amplicon size HIF-1 Forward: 5’-TCAAGTCAGCAACGTGGAAG Reverse: 5’-TATCGAGGCTGTGTCGACTG 198 bp VEGF 5’-AGAAAGCCCAATGAAGTGGTG 5’-ACTCCAGGGCTTCATCATTG 177 bp NMDA-R1 5’-AACCTGCAGAACCGCAAG 5’-GCTTGATGAGCAGGTCTATGC 333 bp eNOS 5’-TGGCAGCCCTAAGACCTATG 5’-AGTCCGAAAATGTCCTCGTG 243 bp iNOS 5’-CCTTGTTCAGCTACGCCTTC 5’-GGTATGCCCGAGTTCTTTCA 179 bp nNOS 5’-AACCTGCAGAACCGCAAG 5’-GCTTGATGAGCAGGTCTATGC 617 bp -actin 5’-TCATGAAGTGTGACGTTGACATCCGT 5’-CCTAGAAGCATTTGCGGT GCAGGATG 285 bp

PAGE 295

277 Appendix B: (Continued) RAT (retinas) Kaur C, Sivakumar V, and Foulds WS (2006). Early response of neurons and glial cells to hypoxia in the retina. Invest Ophthalmol Vis Sci 47:1126-41 Primer Amplicon Size HIF-1 Forward: 5’-TCAAGTCAGCAACGTGGAAG Reverse: 5’-TATCGAGGCTG TGTCGACTG 198 VEGF 5’-AGAAAGCCCAATGAAGTGGTG 5’-ACTCCAGGGCTTCATCATTG 177 NMDA-R1 5’-AACCTGCAGAACCGCAAG 5’-GCTTGATGAGCAGGTCTATGC 333 GluR2 5’-CTATTTCCAAGGGGCGCTGAT 5’-CAGTCCAGGATTACACGCCG 539 GluR3 5’-CGCAGAGCCATCTGTGTTTA 5’-GTTGCCACACCATAGCCTTT 180 eNOS 5’-TGGCAGCCCTAAGACCTATG 5’-AGTCCGAAAATGTCCTCGTG 243 iNOS 5’-CCTTGTTCAGCTACGCCTTC 5’-GGTATGCCCGAGTTCTTTCA 179 nNOS 5’-AACCTGCAGAACCGCAAG 5’-GCTTGATGAGCAGGTCTATGC 617 -Actin (96% identity with mouse) 5’-TCATGAAGTGTGACGTTGACATCCGT 5’-CCTAGAAGCATTTGCGGT GCAGGATG 285

PAGE 296

278 Appendix B: (Continued) MOUSE Shao G, Gao C, and Lu G (2005). Alterations of hypoxia-inducible factor-1 alpha in the hippocampus of mice acutely and re peatedly exposed to hypoxia. Neurosignals 14:255– 261. GAPDH primers: Forward 5’-CCCTTCATTGACCTCAAC-3 Reverse: 5’-TTCACACCCATCACAAAC-3 HIF-1 primers: 5’-TATAAACCTGGCAATGTCTCC-3 5’-GATGCCTTAGCAGTGGTCGT-3

PAGE 297

279 Appendix B: (Continued) MOUSE (Used C57Bl mice) Kociok N, Krohne TU, Poulaki V, and Jou ssen AM (2006). Geldanamycin treatment reduces neovascularization in a mouse model of retinopathy of prematurity. Graefe’s Arch Clin Exp Ophthalmol. 245:258-66. VEGF: Forward 5 -CAG CTA TTGCCG TCC GAT TGA GA-3 and Reverse 5 -TGC TGG CTT TGG TGA GGT TTG AT-3 ANG1: 5 -CTG ATG GAC TGG GAA GGG AAC C-3 and 5 -CGC AGA AAT CAG CAC CGT GTA AG-3 ANG2: 5 -GAA GGA CTG GGA AGG CAA CGA-3 and 5 -CCA CCA GCC TCC TGA GAGCAT C-3 GAPDH: 5 -AAC TTT GTG AAG CT C ATT TCC TGG TAT-3 and 5 -CCT TGC TGG GCT GGG TGG T-3

PAGE 298

280 Appendix B: (Continued) MOUSE (Used C57Bl mice) Lazovic JL, Basu A, Lin H, Rothstein, RP, Krady K, Smith MB, and Levison SW (2005). Neuroinflammation and both cytotoxic and vaso genic edema are reduced in interleukin-1 type 1 receptor-deficient mi ce conferring neuroprotection. Stroke. 36:2226-31. iNOS Forward 5'-CCCTTCCGAAG TTTCTGGCAGCAGC-3' Reverse 5'-GGCTGTCAGAGCCTCGTGGCTTTGG-3' eNOS 5'-TTCCGGCTGCCACCTGATCCTAA-3' 5'-AACATATGTCCTTGCTCAAGGCA-3' Cyclophilin 5'-CCATCGTGTCATCAAGGACTTCAT-3' 5'-TTGCCATCCAGCCAGGAGGTCT-3'

PAGE 299

281 Appendix B: (Continued) MOUSE (Used primary mouse hepatocytes) Allen a JW, Johnsonb RS, Bhatia SN (2005). Hypoxic inhibition of 3methylcholanthrene-induced CYP1A1 expres sion is independent of HIF-1alpha. Toxicology Letters 155, 151–159. VEGF Forward 5’-AGTCCCATGAAGTGATCAAGTTCA Reverse 5’-ATCCGCATGATCTGCATGG PGK 5’-CAAATTTGATGAGAATGCCAAGACT 5’-TTCTTGCTGCTCTCAGTACCACA GLUT-1 5’-GGGCATGTGCTTCCAGTATGT 5’-ACGAGGAGCACCGTGAAGAT CYP1A1 5’-AAAACACGCCCGCTGTGAA 5’-TGAATCACAGGAACAGCCACC -Actin 5’-AGGCCCAGAGCAAGAGAGG 5’-TACATGGCTGGGGTGTTGAA

PAGE 300

282 Appendix B: (Continued) MOUSE: Antibodies used for immunohistoche mistry and immunofluorescence Kaur C, Sivakumar V, Ang LS and S undaresan A (2006). Hypoxic damage to the periventricular white matter in neonatal brain: role of vascular endot helial growth factor, nitric oxide and excitotoxicity. J Neurochem. 98:1200-16. Antibodies Dilution VEGF Rabbit-polyclonal Santa Cruz Biotechnology (S anta Cruz, CA, USA) 1: 200 NMDA-R1 Rabbit-polyclonal Chemicon Inte rnational Inc. (Temecula, CA, USA) 1: 200 eNOS Mouse-monoclonal BD Biosciences (Frankl in Lakes, NJ, USA) 1: 250 iNOS Mouse-monoclonal BD Biosciences (Fra nklin Lakes, NJ, USA) 1: 1000 nNOS Rabbit-polyclonal BD Transduction (Frankl in Lakes, NJ, USA) 1: 500

PAGE 301

283 Appendix B: (Continued) RAT (retinas) Kaur C, Sivakumar V, and Foulds WS (2006). Early response of neurons and glial cells to hypoxia in the retina. Invest Ophthalmol Vis Sci 47:1126-41 Antibodies Dilution VEGF Rabbit polyclonal Santa Cruz Biotec hnology, Santa Cruz, CA 1:200 GluR2/3 Rabbit polyclonal Chemicon International Inc., Temecula, CA 1:200 NMDA-R1 Rabbit polyclonal Chemicon International Inc., Temecula, CA 1:200 eNOS Mouse monoclonal BD Biosciences, San Diego, CA 1:250 iNOS Mouse monoclonal BD Bioscience s, San Diego, CA 1:1000 nNOS Rabbit polyclonal BD Transduction La bs, San Jose, CA 1:500 GFAP Mouse monoclonal Chemicon International Inc., Temecula, CA 1:1000 Glutamine synthetase Rabbit polyclonal Sigma-Aldrich, Ann Arbor, MI 1:600

PAGE 302

284 About the Author Edward John Dougherty received a Bachel or’s Degree in Biology from Ursinus College in 2001 and a M.S. in Biological Sc iences from Bowling Green State University in 2004. He was a laboratory teaching assist ant for Biology I and Endocrinology while in the Master’s program, and continued on as a laboratory teaching assistant in General Physiology and Cell Biology after entering the Ph .D. program at the University of South Florida in 2004. While in the Ph.D. program at the Univer sity of South Florid a, Edward received two consecutive second place awards for gra duate research given by the Molecular Biology Specialty Section of the Society of Toxicology as well as a Tharpe Summer Fellowship from the Department of Biology. He has also coauthored six publications in notable journals such as the Journal of Biological Chemistry and Molecular Pharmacology and has made several platform presen tations at international meetings of the Society of Toxicology. His rese arch on ARNT2 will be featured in Toxicological Sciences in May 2008