USF Libraries
USF Digital Collections

Isolation and functional characterization of a dioxin-inducible CYP1A regulatory region from zebrafish (Danio rerio)

MISSING IMAGE

Material Information

Title:
Isolation and functional characterization of a dioxin-inducible CYP1A regulatory region from zebrafish (Danio rerio)
Physical Description:
Book
Language:
English
Creator:
ZeRuth, Gary T
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Arylhydrocarbon receptor (AHR)
Cytochrome p4501A1 (CYP1A1)
2,3,7,8-tetrachlorodibenzo-p-dioxin
Xenobiotic response element (XRE)
Gene regulation
Dissertations, Academic -- Biology -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Cytochrome P4501A1 (CYP1A1) is a phase I bio-transformation enzyme involved in the metabolism of xenobiotics via the oxygenation of polycyclic aromatic hydrocarbons (PAHs) including the carcinogen, benzo(a)pyrene. Induction of the CYP1A1 gene is regulated at the transcriptional level and is ligand dependent with the prototypical 2,3,7,8,-tetrachlorodibenzo-p-dioxin (TCDD) being the most potent known inducer of CYP1A1 transcription. This process is mediated by the AHR/ARNT signaling pathway whereby ligand binds AHR in the cytoplasm allowing its translocation to the nucleus where it binds with its hertrodimerization partner, ARNT and subsequently binds DNA at cognate binding sites termed xenobiotic responsive elements (XREs) located in the 5' flanking region of the CYP1A1 and other genes.The zebrafish (Danio rerio) has recently become an important model system for the study of TCDD-mediated developmental toxicity due to their relative ease of maintaining and breeding, external fertilization, abundant transparent embryos, and sensitivity to TCDD similar to mammalian models. It is therefore essential to vii characterize the molecular mechanisms of AHR mediated gene regulation in this organism. The upstream flanking region of a putative CYP1A gene from zebrafish was identified by the screening of a PAC genomic library. Sequencing revealed a region which contains 8 putative core xenobiotic response elements (XREs) organized in two distinct clusters. The region between -580 to -187 contains XRE 1-3 while the region between -2608 to -2100 contains XRE 4-8. Only XRE 1, 3, 4, 7, and 8 exhibited TCDD-dependant association of AHR/ARNT complexes when evaluated by gel shift assays.The use of in vitro mutagenesis and Luciferase reporter assays further showed that only XRE's 4, 7, and 8 were capable of conveying TCDD-mediated gene induction. The role of nucleotides flanking the core XRE was investigated through the use of EMSA and reporter assays. Similar methods were employed on additional transcription factor binding sites identified by in silico analyses revealing two sites conforming to an HNF- 3α and CREB motif, respectively, which demonstrate importance to regulation of the gene.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Gary T. ZeRuth.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 164 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001999213
oclc - 318186229
usfldc doi - E14-SFE0002447
usfldc handle - e14.2447
System ID:
SFS0026764:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 001999213
003 fts
005 20090410090957.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 090410s2008 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002447
035
(OCoLC)318186229
040
FHM
c FHM
049
FHMM
066
(S
090
QH307.2 (Online)
1 100
ZeRuth, Gary T.
0 245
Isolation and functional characterization of a dioxin-inducible CYP1A regulatory region from zebrafish (Danio rerio)
h [electronic resource] /
by Gary T. ZeRuth.
260
[Tampa, Fla] :
b University of South Florida,
2008.
500
Title from PDF of title page.
Document formatted into pages; contains 164 pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor: Richard S. Pollenz, Ph.D.
520
ABSTRACT: Cytochrome P4501A1 (CYP1A1) is a phase I bio-transformation enzyme involved in the metabolism of xenobiotics via the oxygenation of polycyclic aromatic hydrocarbons (PAHs) including the carcinogen, benzo(a)pyrene. Induction of the CYP1A1 gene is regulated at the transcriptional level and is ligand dependent with the prototypical 2,3,7,8,-tetrachlorodibenzo-p-dioxin (TCDD) being the most potent known inducer of CYP1A1 transcription. This process is mediated by the AHR/ARNT signaling pathway whereby ligand binds AHR in the cytoplasm allowing its translocation to the nucleus where it binds with its hertrodimerization partner, ARNT and subsequently binds DNA at cognate binding sites termed xenobiotic responsive elements (XREs) located in the 5' flanking region of the CYP1A1 and other genes.The zebrafish (Danio rerio) has recently become an important model system for the study of TCDD-mediated developmental toxicity due to their relative ease of maintaining and breeding, external fertilization, abundant transparent embryos, and sensitivity to TCDD similar to mammalian models. It is therefore essential to vii characterize the molecular mechanisms of AHR mediated gene regulation in this organism. The upstream flanking region of a putative CYP1A gene from zebrafish was identified by the screening of a PAC genomic library. Sequencing revealed a region which contains 8 putative core xenobiotic response elements (XREs) organized in two distinct clusters. The region between -580 to -187 contains XRE 1-3 while the region between -2608 to -2100 contains XRE 4-8. Only XRE 1, 3, 4, 7, and 8 exhibited TCDD-dependant association of AHR/ARNT complexes when evaluated by gel shift assays.The use of in vitro mutagenesis and Luciferase reporter assays further showed that only XRE's 4, 7, and 8 were capable of conveying TCDD-mediated gene induction. The role of nucleotides flanking the core XRE was investigated through the use of EMSA and reporter assays. Similar methods were employed on additional transcription factor binding sites identified by in silico analyses revealing two sites conforming to an HNF- 3 and CREB motif, respectively, which demonstrate importance to regulation of the gene.
653
Arylhydrocarbon receptor (AHR)
Cytochrome p4501A1 (CYP1A1)
2,3,7,8-tetrachlorodibenzo-p-dioxin
Xenobiotic response element (XRE)
Gene regulation
690
Dissertations, Academic
z USF
x Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2447



PAGE 1

Isolation and Functional Characteriz ation of a Dioxin-Inducible CYP1A Regulatory Region From Zebrafish ( Danio rerio ) by Gary T. ZeRuth A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Biology College of Arts and Sciences University of South Florida Major Professor: Richard S. Pollenz, Ph.D. Brian T. Livingston, Ph.D. Jessica L. Moore, Ph.D. Robert L. Potter, Ph.D. Date of Approval: April 11, 2008 Keywords: arylhydrocarbon receptor (AHR), cytochrome p4501A1 (CYP1A1), 2,3,7,8,tetrachlorodibenzo-p-dioxin (TCDD), xe nobiotic response element (XRE), gene regulation Copyright 2008, Gary T. ZeRuth

PAGE 2

Dedication Dedicated to Melissa S. Ze Ruth, without whom I could never have come so far.

PAGE 3

Acknowledgements Acknowledgements are given to Jeff Yoder for help in the initial screening of the PAC library and helpful discussion of this wo rk. Thanks are extended to Leonard Zon for providing the PAC library and arraying the pooled clones. Michael Carvan is recognized for providing p-1897Om1A3luc reporter vect or. Jeannette Wentworth is acknowledged for technical help on the initial screening of the PAC library and the Southern blotting experiments. Special thanks to Dr. Richard S. Pollenz for mentoring and support. Acknowledgments are given to the Pollenz Lab members, Edward J. Dougherty and Sarah E. Wilson for consultati on, assistance and support.

PAGE 4

i Table of Contents List of Figures iii List of Acronyms v Abstract vi Chapter One: Introduction 1 Isolation of AHR and ARNT 1 bHLH-PAS Proteins 3 AHR Ligands 5 AHR-mediated Signaling 8 CYP1A1 Regulation 13 AHR Regulated Genes 22 TCDD-mediated Developmental Toxicity in Zebrafish 26 AHR and ARNT in Fishes 28 Chapter Two: Results 32 Isolation of the zfCYP1A upstream region 32 Induction of the zfCYP1A gene by TCDD 35 In vitro analyses of AHR/ARNT association with zfXREs 42 Functional characterization of individual XREs within the zfCYP1A regulatory region 47 The pattern of expression controlled by the zfCYP1A and mCYP1A1 regulatory regions varies in different cell lines 56 Analysis of the zebrafish CYP1A proximal promoter 60 Functional analysis of XRE flanking sequence 62 Identification of additional cis -regulatory regions which impact the induction of zfCYP1A 67 Chapter Three: Discussion of Impact, Releva nce, and Future Direction 73 Chapter Four: Materials and Methods 87 References 97 Appendices 123 Appendix A: PAC 133 Sequencing data 123 Appendix B: Construct Maps 131 Appendix C: Additional Studies 147

PAGE 5

ii Generation of destabilized EGFP and EYFP constructs 147 ARNT domain Swapping 153 About the Author End Page

PAGE 6

iii List of Figures Figure 1.1. Comparison of bHLH -PAS Protein Structures 6 Figure 1.2. Common AHR Ligands 9 Figure 1.3. Schematic Overview of AHR-mediated signaling 14 Figure 1.4. Model of CYP1A1 Regulation by AHR 21 Figure 2.1. Comparison of CYP1 A Regulatory Regions from Different Species 34 Figure 2.2. Induction of the zfCYP1A gene by TCDD 36 Figure 2.3. Analysis of the E ffect of Orientation and Pos ition on TCDD-induced Lu ciferase Activity 39 Figure 2.4. Luciferase Reporter An alysis of the Ability of the Region Between -580 and +71 to Function as a Promoter 41 Figure 2.5. Analysis of TCDD-mediat ed Induction from Reporter Constr ucts Containing the zf CYP1A Promoter Region Between -580 and +71 and CYP1A Enhancer Regions from Different Species 43 Figure 2.6. In vitro Analysis of the Associati on of zfAHR2 with XREs 45 Figure 2.7. Association of zfAHR2 and rtARNTb with zfXREs 46 Figure 2.8. Comparison of TCDD-i nduced Luciferase Activity Between the p-2699/+71 and p-2608/-2100Ur Constructs 49 Figure 2.9. Functional Analys is of zfXREs 1 and 3 51 Figure 2.10. Functional An alysis of zfXREs 53 Figure 2.11. Functional Analysis of zfXREs in Different Cell Lines 55 Figure 2.12. Comparison of XR E8 Function Between the p-2608/-2100Ur and p-2727/2100Ur Constructs 57 Figure 2.13. Characterization of Mouse and Zebrafish CYP1A Promot er and Enhancer Regions in Various Cell Lines 58

PAGE 7

iv Figure 2.14. Analysis of the Zebr afish CYP1A Proximal Promoter 61 Figure 2.15. Comparison of Mouse and Zebrafish XRE Flanking Regions 63 Figure 2.16. Effect of Mutating Nucleotides Flanking XREs on AHR/ARNT Binding In Vitro 65 Figure 2.17. Putative Transcription Factor Binding Sites Within th e zfCYP1A Regulatory Re gion That Are Common to Both Mouse and Zebrafish 68 Figure 2.18. Analysis of cis -regulatory Elements Within the zfCYP1A Enhancer 69 Figure 2.19. Effect of HNF3 Mutation on the Full-length p-2699/+71 Construct 71 Figure AA1. Schematic Overview of Sequencing Strategy 124 Figure AC1. Strategy for Generating EYFP Construct 149 Figure AC2. Construct Maps of p-EGFP and p-dEYFP 151 Figure AC3. Schematic of ARNT Domain Swapping 160 Figure AC4. Construct Maps of p-hARNT and p-mARNT2 161 Figure AC5. Restriction Enzyme Digestion of p-mARNT2 162

PAGE 8

v List of Acronyms AHR – arylhydrocarbon receptor ARNT – arylhydrocarbon recepto r nuclear translocator XRE – xenobiotic response element TCDD – 2, 3, 7, 8 – tetrachlorodibenzopdioxin 3MC – 3-methylcholanthrene BaP – benzo[a]pyrene DMSO – dimethyl sulfoxide PAH – polycyclic aromatic hydrocarbon HAH – halogenated aromatic hydrocarbon CYP1A1 – Cytochrome P4501A1 SDS-PAGE – sodium dodecyl sulfat e polyacrylamide gel electrophoresis EMSA – electrophoretic mobility shift assay siRNA – small interfering RNA HNF-3 hepatic nuclear factor 3 CREB – cAMP response element binding protein Sp1 – stimulatory protein 1 ROS – reactive oxygen species XME – xenobiotic metabolizing enzyme ARE – anti-oxidant response element

PAGE 9

vi Isolation and Functional Characterization of a Dioxin-Inducible CYP1A Regulatory Region From Zebrafish ( Danio rerio ) Gary T. ZeRuth ABSTRACT Cytochrome P4501A1 (CYP1A1) is a phase I bio-transformation enzyme involved in the metabolism of xenobiotics via the oxygenation of polycyclic aromatic hydrocarbons (PAHs) including the carcinogen, benzo( a )pyrene. Induction of the CYP1A1 gene is regulated at the transcrip tional level and is liga nd dependent with the prototypical 2,3,7,8,-tetrachlorodibenzop -dioxin (TCDD) being the most potent known inducer of CYP1A1 transcription. This pr ocess is mediated by the AHR/ARNT signaling pathway whereby ligand binds AHR in the cy toplasm allowing its translocation to the nucleus where it binds with its hertrodimeri zation partner, ARNT and subsequently binds DNA at cognate binding sites termed xenobiotic responsive elements (XREs) located in the 5’ flanking region of the CYP1A1 and other genes. The zebrafish ( Danio rerio ) has recently become an important model system for the study of TCDD-mediated developmental t oxicity due to thei r relative ease of maintaining and breeding, ex ternal fertilization, abundant transparent embryos, and sensitivity to TCDD similar to mammalian models. It is therefore essential to

PAGE 10

vii characterize the molecular mechanisms of AHR mediated gene regulation in this organism. The upstream flanking region of a putat ive CYP1A gene from zebrafish was identified by the screening of a PAC genomic library. Sequencing revealed a region which contains 8 putative core xenobiotic re sponse elements (XREs) organized in two distinct clusters. The region between –580 to –187 contains XRE 1-3 while the region between –2608 to –2100 contains XRE 4-8. Only XRE 1, 3, 4, 7, and 8 exhibited TCDDdependant association of AHR/ARNT complexe s when evaluated by gel shift assays. The use of in vitro mutagenesis and Luciferase reporter assays further showed that only XRE’s 4, 7, and 8 were capable of conveying TCDD-mediated gene induction. The role of nucleotides flanking the core XRE was i nvestigated through the use of EMSA and reporter assays. Similar methods were em ployed on additional transcription factor binding sites identified by in silico analyses revealing two si tes conforming to an HNF3 and CREB motif, respectively, which demons trate importance to regulation of the gene.

PAGE 11

1 Chapter One Introduction Isolation of AHR and ARNT The aryl hydrocarbon hydroxylase, (AHH), wa s identified as being greatly varied in inducibility amongst different strains of mice in response to polycyclic aromatic hydrocarbons, (PAHs), and halogenated ar omatic hydrocarbons, (HAHs) (Nebert and Gelboin, 1969; Poland et al., 1974 ). Through the use of classical murine genetics, it was further ascertained that these variations we re controlled by a single gene locus termed Ah (Green, 1973; Schmidt and Bradfiel d, 1996; Thomas and Hutton, 1973). The Ah locus was later found to code for a receptor, the aryl hydrocarbon receptor (AHR), which is capable of binding ligand with high affinity leading to the subse quent induction of AHH (Poland et al., 1976). Polymorphisms in the Ahr were found to be the cause of the variable inducibility of AHH between mouse strains and[125I]-photoaffinity labeling led to the discovery of three a lleles encoding for high affin ity receptors designated Ahrb-1, Ahrb-2, and Ahrb-3 and a single allele enc oding the low affinity Ahrd allele.(Poland and Glover, 1990; Poland et al., 1987) Purification of the AHR and the development of antibodies specific to the receptor revealed that differences existed not only amongst mouse strains, but the molecular weight va ried remarkably between species as well (Hahn et al., 1994; Poland and Glover, 1987; Poland et al., 1991). These innovations

PAGE 12

2 additionally led to the gene ration of the first AHR cDNA and the revelation that the receptor was the second member of the basic-helix-loop-helix Per-ARNT-Sim (bHLHPAS) family of proteins identified (Burbach et al., 1992; Ema et al., 1992). Interestingly, the first member of th e bHLH-PAS family isolated was the heterodimerization partner of the AHR, the ar yl hydrocarbon nuclear translocator protein, ARNT, cloned approximately one year earl ier (Hoffman et al., 1991). ARNT was isolated in an attempt to identify constituen ts of AHR signaling abse nt in an induction defective mouse hepatoma cell line containing normal concentrations of AHR capable of binding ligand but which failed to subsequently localize to the nucleus. (Hoffman et al., 1991; Legraverend et al., 1982) Due to the ab ility of ARNT to re store function to the loss-of-function mutants, the name aryl hydr ocarbon nuclear transl ocator protein was actually a misnomer as it was later found that ARNT is not required for the nuclearization of liganded AHR but instead acts as a dime rization partner require d for the binding of DNA.(Dolwick et al., 1993b; Elfe rink et al., 1990; Reyes et al., 1992) Indeed, studies by Pollenz et al. (1994) showed that AHR was capable of translocating to the nucleus following TCDD treatment in ARNT deficient ce lls and that ARNT was confined to the nucleus both prior to and following li gand exposure while unliganded AHR was primarily cytosolic.(Pollenz et al., 1994) The unveiling of the scheme of heterodimerization between AHR and ARNT laid the foundation fo r the identification and characterization of novel members of the emerging super-family of bHLH-PAS proteins.

PAGE 13

3 bHLH-PAS Proteins While other proteins had been prev iously identified wh ich contain bHLH domains, including the well characterized MyoD, AHR and ARNT possess a domain adjacent to the bHLH which shows homology to the Drosophila Period (Per) and Single minded (Sim) genes and is termed Per-ARNT-Si m (PAS) after the identifying members (Burbach et al., 1992; Ema et al., 1992; Hoff man et al., 1991; Huang et al., 1993). The PAS region is typically composed of approxi mately 300 amino acids and is divided into PAS A and PAS B subdomains each consisting of 50 amino acid degenerate repeats (Burbach et al., 1992; Gu et al., 2000; Nambu et al., 1991). Having a role in dimerization, the PAS domain has been implicated in heterodimerization between Per and Sim and homodimerization of Per (Huang et al., 1993). In the case of AHR, the PAS domains serve as a binding site for chaperone proteins (Whitelaw et al., 1993) and ligand (Burbach et al., 1992; Dolwic k et al., 1993a; Schmidt and Bradfield, 1996; Whitelaw et al., 1993) as well as assisting in DNA bi nding (Dolwick et al., 1993a) while AHR/ARNT dimerization occurs concertedly within the HLH and PAS domains (R eisz-Porszasz et al., 1994; Schmidt and Bradfield, 1996). In addi tion to the basic, DNA binding domain, the HLH, and the PAS domains, the majority of bHLH-PAS proteins contain a C-terminal transcriptional activation domain (TAD). Unlike the previous domains, however, which share sequence homology, the TADs lack c onservation amongst members of the superfamily (Gu et al., 2000). A graphical de piction of the domain organization within selected bHLH-PAS proteins is shown in Figure 1.1.

PAGE 14

4 The existence of transcri ptional activation domains s upports the fact that most bHLH-PAS proteins serve as transcriptiona l regulators which act upon target genes in order to elicit an adaptive response to e nvironmental stimuli. (Furness et al., 2007; Kewley et al., 2004; Massari and Murre, 2000) In order to form active transcription factors, bHLH-PAS proteins are required to dimerize and are thus divided into two distinct classes. Class I proteins are capable of detecting environmental stimuli but must dimerize with a Class II protein in order to adopt an active, DNA binding form. While Class I proteins are incapable of homodimeri zation or dimerization with another Class I member, Class II bHLH-PAS proteins are far more promiscuous and confined to the nuclear compartment where they serve as master regulators capable of homo or heterodimerization. Some examples of Class I proteins include HIF1 and HIF2 (hypoxia inducible factors); regul ators of the cellular response to hypoxia, (Tian et al., 1997; Wang et al., 1995; Wang and Semen za, 1995) SIM 1 and 2 (single minded proteins); involved in neuroge nesis and mid-line development, (Ema et al., 1996; Probst et al., 1997) the circadia n rhythm protein, Clock, (Gekakis et al., 1998; King et al., 1997) and the AHR (aryl hydrocarbon receptor); involv ed in xenobiotic metabolism. Class II receptors include ARNT and ARNT2 (aryl hyd rocarbon receptor translocator proteins), BMAL1 and 2 (brain and muscle ARNT-like pr oteins), and Per. Figure 1.1 shows the domain structures of representative bHLH-P AS proteins. Of all the bHLH-PAS proteins, AHR and ARNT remain the best characterized members. Unlike the Class I AHR which only binds ARNT, ARNT exhibits promiscuity by dimerizing with AHR, hypoxia inducible factors HIF1 and HIF2 and Single mined

PAGE 15

5 proteins Sim1 and Sim2 (Fur ness et al., 2007; Kewley et al., 2004). ARNT -/mice die in utero at gestational day (GD) 10.5 due to a failur e of the placenta to vascularize. Other defects observed include forebrain hypoplasia placental hemorrhaging, visceral arch and neural tube abnormalities, and delayed rota tion of the embryo (Kozak et al., 1997). Phenotypically similar to HIF1 knockout mice, (Ke and Costa, 2006) these findings implicate ARNT as a compulsory, HIF associ ated, developmental tr anscription factor. ARNT2 is a close structural homolog of ARNT, bearing 57% sequence similarity in the mouse with divergence primarily with in the COOH-terminus (Hirose et al., 1996). Furthermore, unlike the ubiquitously expresse d ARNT, ARNT2 is expressed primarily in the CNS and kidneys in mice (Jain et al., 1998). ARNT2 -/mice perish perinatally bearing a phenotypic resemblance to SIM1 knock-out mice suggesting that ARNT2 may be the heterodimerization partne r of SIM-1 required for neurogenesis. Data also supports the hypothesis that ARNT or ARNT2 may ha ve overlapping function prior to embryonic day (ED) 8.5. While ARNT2 can form dimers with AHR and HIF1 its primary function appears to be as a pairing partner for SIM (Jain et al., 1998). AHR Ligands Unlike the Class II ARNTs which primarily serve as dimerization partners for the Class I bHLH-PAS proteins, the AHR serves as a “sensor” of environmental cues; therefore ligand activation must ensue to initi ate the pathway. Ligand binds the AHR in the form of a structurally diverse array of ch emicals both natural and synthetic in nature which are capable of activating the receptor su bsequently leading to the regulation of a

PAGE 16

6 Figure 1.1. Comparison of bH LH-PAS Protein Structures AHR ARNT ARNT2 HIF1 SIM1 BMAL1 1 825 400 200 600 b HLH PASAPASB TAD Fig. 1.1. Comparison of bHLH-PAS Protein Structures. Schematic overview of the domain structure of representative bHLH-PAS proteins. The domains are indicated. b: Basic region, HLH: Helix-loop helix domai n, PAS A and PAS B: Per-ARNT-Sim motifs, TAD: Transactivation domain. The scale at th e bottom represents number of amino acids.

PAGE 17

7 battery of genes. Representative AHR lig ands are shown in Figure 1.2. The most well characterized AHR ligands ar e the polycyclic aromatic hydrocarbons (PAHs) such as benzo[a]pyrene and 3-methylcholanthrene and the halogenated aromatic hydrocarbons (HAHs) represented by dibenzop -dioxins, biphenyls, and dibenzofurans. Environmental pollutants, exposure to these chemicals cont ributes to a broad spectrum of toxic and biological effects. PAHs typically exist as the product of combustion and can lead to cancers due to the generation of ROS (reactive oxygen speci es) resulting from the metabolism of the insulting compound and consequent DNA and protein adduct formation and cellular damage (Gelboin, 1980). While HAHs also l ead to toxicological responses in mice which include wasting syndrome, thymic i nvolution, tumor promotion, teratogenicity, immunosuppression, reduced fertility, epid ermal hyper and metaplasia, and death, (Poland and Knutson, 1982; Safe, 1990) unlik e PAHs, the molecular mechanism behind these effects are not understood bu t most, if not all, of these responses rely on the AHR. The most potent known agonist of AHR is 2,3,7,8-tetrachlorodibenzop -dioxin, (dioxin, TCDD), which has an affinity for the recep tor in the pM range versus PAHs which exhibit binding affinities in the nM to M range. The toxic effects of TCDD are thought to stem from the regulation of genes targeted by the activated AHR as opposed to direct genotoxicity of the compound or its metabolic by-products. Interestingl y, the severity of the response to TCDD depends on multiple factors including the type of cell, sex, age, and species exposed supporting a gene regulatory mechanism of toxicity over that of direct cellular damage.

PAGE 18

8 To date, no endogenous AHR ligand has been identified however a number of naturally occurring, non-anthropog enic chemicals have been shown to bind the AHR and induce target genes, albeit much more weakly than TCDD. A variety of dietary plant derivatives consisting largely of flavonoi ds have been identified as weak AHR agonists/antagonists and may e xplain an evolutionary purpose for the AHR as an activator of xenobiotic metabolism enzyme s (Denison and Nagy, 2003). The activation of AHR in the absence of exogenous ligand as well as numerous developmental defects in AHR null mice suggest that an endogenous, unidentified AHR ligand likely exists and may possibly be in the form of an indole, tetrapyrole, or an amino acid metabolite (Denison and Nagy, 2003). While natural or endogenous AHR ligands have yet to be confirmed, in regard to the elucidation of the molecular mechanisms behind AHR signaling and the impact on human health, activation by the classical PAHs and HAHs are relevant. The precise risk to human h ealth is still unknown but TCDD was upgraded to a Group 1 “human carcinogen” in 1997 by the International Agency for Research on Cancer and remains the prototypical AHR ligand. AHR-mediated Signaling Ligand binding to the AHR is thought to be supported by the fact that the latent AHR exists as a complex with several other proteins consisting of the 90kD heat shock protein, Hsp90, the 23kD p23, and the Hepatitis B virus X-associated protein 2, XAP2 (Carver et al., 1998; Denis et al., 1988; Kazlauskas et al., 1999; Ma and Whitlock, 1997; Meyer et al., 1998; Perdew, 1988). I mmunoprecipitation experiments from two independent laboratories first identified inte ractions between AHR and a dimer of the

PAGE 19

9 FIGURE 1.2. Common AHR Ligands O O Cl Cl Cl Cl 2,3,7,8-tetrachlorodibenzop -dioxin Cl Cl Cl Cl Cl 2,2',4,4',5-pentachlorobiphenyl O Cl Cl Cl Cl 2,3,7,8-tetrachlorodibenzop -furan benzo[a]pyrene CH33-methylcholanthrene O O -naphthoflavone O H3C HO OH O CH3 OO Curcumin N H CH2OH Indole-3-carbinol Fig. 1.2. Common AHR ligands. Chemical structures of representative AHR ligands and inducers. Cla ssical halogenated aromatic hydrocarbons are shown at the top. Classical polycyclic aromatic hydrocar bons are shown in the middle. Naturally occurring dietary AHR ligands are shown at the bottom.

PAGE 20

10 molecular chaperone, Hsp90 (Denis, 1988; Perd ew, 1988). The role of Hsp90 is thought to be one in which it stabilizes the AHR in a conformation susceptibl e to ligand binding to the PAS domain of AHR (Antonsson et al ., 1995; Carver et al., 1994; Coumailleau et al., 1995; Denis, 1988; Perdew, 1988; Pongratz et al., 1992) and to repress dimerization with ARNT and DNA binding in the absence of ligand and an additional unidentified event (Heid et al., 2000; McGuir e et al., 1994; Pongrat z et al., 1992). I ndeed, it has been established that liganded AHR enters the nuc leus along with Hsp90 but dimerization with ARNT and DNA binding require di ssociation from the heat s hock protein (Heid et al., 2000). In addition to Hsp90, the latent AHR is also complexed with a molecule of the FKBP52 immunophilin-like, Hepatitis B virus X-associated protein (XAP2, Ara9, AIP1) (Carver and Bradfield, 1997; Ma and Whitlock, 1997). Originally it was ascertained that XAP2 maintained the cytoplasmic localization of AHR, thus enhanci ng its ability to be activated by ligand (Bell and Poland, 2000; Berg and Pongratz, 2002; Ca rver et al., 1998; Kazlauskas et al., 2000; LaPres et al., 2000; Ma and Whitlock, 1997; Meyer and Perdew, 1999; Meyer et al., 2000; Petrulis et al., 2003) howeve r, recent studies have shown that these observations may be specific to the Ahb-1 allele and that othe r species do not exhibit association with XAP2 to the level observ ed with the b-1 receptor nor does XAP2 maintain a cytoplasmic localization, but in stead merely inhibits nucleocytoplasmic shuttling by interfering with the associati on of nuclear import receptors (Pollenz and Dougherty, 2005; Pollenz et al., 2006). Th e lack of necessity for XAP2 in AHR

PAGE 21

11 signaling is supported by the fact that AHR exhibits normal functioning in Saccharomyces cerevisiae which does not possess a homolog of XAP2 (Gu et al., 2000). The third protein known to exist in the heterotetrameric latent AHR complex is p23 which is known to interact with Hsp90 in other systems (Chadli et al., 2000; Grenert et al., 1997; Sullivan et al., 1997). Studies involving the yeast homologs of Hsp90 and p23, Hsp82 and Sba1 respectively, suggest that p23 blocks the ATPase activity of Hsp90, stabilizing the Hsp90-AHR interaction (Cox and Miller, 2004). Earlie r studies confirmed this role for p23 when loss the protein from the AHR-Hsp90 comple x resulted in ligandindependent interaction between AHR a nd ARNT. The addition of molybdate, a chemical known to stabilize p23-Hsp90 inter actions, restored normal function suggesting that a role of p23 is to stabilize the Hsp90-AHR latent complex (Kazlauskas et al., 1999). The association of p23 with Hsp90 along w ith the observation that the AHR may associate with p60 and Hip indica tes that the latent AHR complex may be similar to that seen in other steroid hormones (Nair et al., 1996). The proposed model for AHR signaling th en follows that a small, hydrophobic ligand, typified by TCDD, passes through the pl asma membrane where it binds to the latent AHR complex within the PAS domain of AHR between amino acids 232-334 (Burbach et al., 1992). The binding of ligand is supported by the folding of the AHR PAS domain into a favorable lignd binding c onformation due to its association with Hsp90 (Gu et al., 2000). Binding of ligand pr esumably causes a conformational change both displacing p23 and allowing for the nuclear translocation of the complex. Within the nucleus, it is suspected that AHR, due in part to the displacement of p23 by ligand,

PAGE 22

12 can form a dimer with ARNT, possibly after phosphorylation of ARNT (Chen and Tukey, 1996; Long et al., 1998). AHR-ARNT di merization leads to the dissociation of the molecular chaperone proteins and the formation of an active, DNA binding complex. The activated AHR-ARNT recognizes cognate enhancer sequences termed xenobiotic response elements (XREs) located within the re gulatory region of target genes. The XRE core consensus sequence is defined as: 5’-(T/G)NGCGTG-3’ whereby the basic region of ARNT binds to 5’-GTG and the AHR basic region binds the remaining nucleotides (Bacsi et al., 1995; Denison et al., 1988; Fisher et al., 1990; Hapgood et al., 1989; Lusska et al., 1993; Swanson et al., 1995) and the spec ificity of binding may be controlled, in part, by the PAS domain of AH R (Dolwick et al., 1993b). Binding of AHR-ARNT to the XREs of target genes results in gene regulatory events whic h are largely dependent on the COOH-terminal TAD domains of AHR and AR NT (Jain et al., 1994; Whitelaw et al., 1994). The endpoint of ligand-mediated AHR si gnaling is the degradation of the AHR. Indeed, studies have shown that AHR is rapi dly depleted in both cel l culture and animals following TCDD exposure, (Giannone et al ., 1995; Ma et al., 2000; Pollenz, 1996; Pollenz, 2002; Pollenz et al., 1998; Roman et al., 1998) the degradation event is connected to the nuclear lo calization of the AHR, (Song a nd Pollenz, 2002) and likely occurs via the 26S proteosome (Davari nos and Pollenz, 1999; Ma and Baldwin, 2000; Wentworth et al., 2004). The mechanism by which the AHR is degraded is yet unknown but it is suspected that ubiqitination is involve d considering most proteins targeted to the proteosome are ubiquitinated. To date, no ev idence of ubiquitination has been identified.

PAGE 23

13 CYP1A1 Regulation A member of the P450 family of cytochro mes, the aryl hydrocarbon hydroxylase or Cytochrome P1-450 1A1 (CYP1A1) is the most well characterized target of ligandactivated AHR and has become the prototype for the study of AHR-mediated signaling. The product of the inducible CYP1A1 locus is a heme-thiolate monooxygenase responsible for the metabolism of lipophili c aromatic hydrocarbons. These xenobiotic metabolizing enzymes receive electrons from NADPH-P450 reductase which activates an oxygen capable of being inserted into a specifi c substrate or group of substrates. In the case of CYP1A1, these substrates are planar aromatic hyd rocarbons and the monooxygenation event of CYP1A1 opens the be nzene rings of the PAH allowing for its subsequent metabolism. Ligands of the AHR PAHs then induce their own metabolism. Due to the toxic 2,3,7,8-chlorination of TC DD and similar HAHs, these persistent chemicals are poorly metabolized by xe nobiotic metabolism enzymes yet induce transcription of XMEs via the activation of AHR nonetheless. Early experiments revealed that TC DD-mediated CYP1A1 induction did not occur in AHR or ARNT deficient cells (J ones et al., 1986) and was a primary response which occurs in the absence of protein synt hesis (Whitlock, 1999). Further investigation demonstrated that TCDD-mediated i nduction of the gene was controlled by cisregulatory elements contained within ~500bp of the 5’ ups tream region of the gene in mice (Jones et al., 1985) which functioned as an enhancer up or downstream of an MMTV promoter regardless of orientation (Jones et al., 1986). Several features of the enhancer were

PAGE 24

F i li g e n tr a c h ta r F ig ure 1.3. S g an d -depen d n ters the cell a nslocates t o h aperone pr o r geted for d e F i g ure 1.3. chematic O d ant aryl hy d and binds t o o the nucleu s o teins, and b i e gradation f o Schematic O O verview of d rocarbon re c o the latent, c s where it di m i nds DNA a t o llowing D N 14 O verview o AH R -medi a c eptor sign a c ytoplasmic m erizes wit h t XREs loca t N A binding, f AH R -me d a ted Si g nal i a ling. Ligan d AHR com p h ARNT, di s t ed upstrea m likely via t h d iated Si g n a i n g Diagra m d represent e p lex. The ac s sociates fro m m of target g e h e 26S prote o a lin g m showing e d by TCD D tivated AH R m the e nes. AHR o some. D R is

PAGE 25

15 subsequently characterized. Using various truncations of the rat CYP1A1 enhancer region upstream of a CAT reporter gene driven by an SV-40 promoter and gel retardation assays, two regions composed of 15 nucleotid es which were require d for gene induction following treatment with 3-MC were isolated. Comparisons of the tw o regions revealed a 5 bp sequence, GCGTG, common between the two required regions which were designated “xenobiotic responsive elements” or “XREs” (Fujisawa-Sehara et al., 1987). Experiments with the murine CYP1A1 e nhancer region expand ed the protein-DNA interaction to a core sequence, 5’-T(A/T)G CGTG-3’. This sequence was specifically recognized by AHR/ARNT heteromers but showed that binding of the 7bp core sequence alone by the liganded receptor was not suffici ent to drive activation of the downstream gene; indicating that the seque nce flanking the XRE core is essential for transactivation (Denison et al., 1988; Hapgood et al., 1989). Subsequent studies attempting to characterize the role flanking nucle otides play in binding AHR/ARNT in vitro and in transactivating a downstream reporter produced a modified consensus: 5’(T/G )1YG 2 C 3 G 4 T 5 G 6 (A/C)7(C/G)8(A/T)9 -3’ (Lusska et al., 1993; Shen and Whitlock, 1992; Swanson et al., 1995). Indeed, Shen and Whitlock showed that either a C at position 1, G at position 7, A at position 8, or G at position 9 abolis hed XRE function in CAT reporters (Shen and Whitlock, 1992). Th ese observations are in agreement with studies done by Swanson et al (Swanson et al., 1995). Significantl y, experiments which placed tandem repeats of an XRE upstream of an SV-40 controlled CAT gene showed a 4-fold increase in both induced and constitu tive CAT activity in c onstructs containing two XREs versus a single XRE (Fujisawa-Sehara et al., 1987). It is also of importance that either linker scanning mutants, where by the core XRE was replaced with unrelated

PAGE 26

16 DNA of the same length, or truncations of the enhancer revealed that the elimination of any one of four mouse XREs resulted in a 25% decrease in TCDD induced activity. Removal of all four XREs eliminated re sponsiveness to TCDD (Fisher et al., 1990). Additionally, another importa nt component of the CYP1A1 enhancer, a GC-box was identified between -952 and -943 upstream of the mouse CYP1A1 transcriptional start site which was capable of being bound in vitro by Sp1 (or a related factor) and when removed, produced a 5-fold decrease in repor ter activity. Interestingly, this site is incapable of function in the absen ce of bound XREs (Fis her et al., 1990). The enhancer region defined above is non-functional unless li nked to a functional transcriptional promoter (Jone s et al., 1986; Neuhold et al., 1989). Likewise, the murine CYP1A1 promoter contains several regulator y elements which fail to function in the absence of the enhancer. A TATAAA box is located at position -30 upstream of the transcriptional start site, a pr oximal and a distal CTF/NF1 site are located at positions -59 and -136 respectively, and a G-box is locat ed at position -130 (Jones and Whitlock, 1990). The TATAAA box is an essential co mponent of the CYP1A1 promoter as mutation of this sequence reduces gene activ ation by >80%. The dist al CTF/NF1 site and the G-box appear to bind a functionally equiva lent protein as elimination of either one has no effect on gene activity; however, when both are eliminated a 50% reduction in inducible activity is observed. Furthermor e, footprinting experiments reveal that mutation of the G-box shifts protection at that site toward the distal CTF/NF1 site (Jones and Whitlock, 1990). The proximal CTF/NF1 site (identified by others as a BTE site in the rat CYP1A1 promoter) also contributes si gnificantly to promoter function (Jones and

PAGE 27

17 Whitlock, 1990; Yanagida et al., 1990). A numb er of proteins have been shown capable of binding this sequence including Sp1, Gutenriched Kruppel-like factor (GKLF), and BTEB1, 3, and 4 (Imataka et al. 1992, Sogawa et al. 1993, Zhang et al. 1998, Shields et al. 1998, Kaczynski et al. 2001, Kaczynski et al. 2002). While Sp1 binding leads to enhanced activation of the gene, (Yanagida et al. 1990, Kobayashi et al. 1996) GKLF and BTEB1, 3, and 4 binding leads to transcriptional repression of CYP1A1 (Imataka et al., 1992; Kaczynski et al., 2002; Sogawa et al., 1993; Zhang et al., 1998b) Kaczynski et al. have proposed a model whereby the constitu tively expressed BTEB proteins repress CYP1A1 activity by competing with Sp1 at th e BTE site but this model has yet to be confirmed. In the absence of ligand, the CYP1A1 enhancer/promoter is inactive and assumes a nucleosomal configuration (Wu and Whitlo ck, 1992; Wu and Whitlock, 1993). Studies using DNaseI protection and LMPCR have revealed that binding of AHR/ARNT heteromers at the XREs within the CYP1A1 en hancer results in a disruption of chromatin structure localized to approximately 180bp su rrounding the XRE, followed by the loss of the nucleosome at the promoter. The relaxati on of the nucleosomal promoter allows the binding of TBP, NF1, and general transcription factors initiating tran scription (Ko et al., 1997; Morgan and Whitlock, 1992; Okino and Whitlock, 1995). As hundreds of base pairs remain in a nucleosomal configurati on between the XRE containing enhancer and the promoter, the possibility of direct communication between the two regions is unlikely. Additional studies determined that the loss of the nucleosome at the promoter was the result of communication via the TAD of AHR bound at the e nhancer (Ko et al.,

PAGE 28

18 1996; Ko et al., 1997). Interestingly, the T AD containing C-terminus of AHR appears to have no effect on the nucleosomal re-arrangement of the enhancer implying that its effect on the promoter involves the recruitment or binding to other factors involved in stabilizing the promoter chromatin (Ko et al., 1996). A likely model is one in which AHR/ARNT binds at the enhancer and associ ates with a complex of other proteins involved in both chromatin remodeling and st abilization of the ge neral transcription factors at the promoter. A number of other proteins have been implicated in the regulation of CYP1A1 which may act to either remodel chromatin or stabilize the transcriptional machinery at the promoter. It has previously be en established that Sp1 interacts in vivo with the HLHPAS domain of AHR/ARNT via its zinc finger domain (Kobayashi et al., 1996). Interaction between these two proteins lends to a potential model in which a DNA loop is formed by binding of Sp1 at the promoter to AHR/ARNT heteromer at the enhancer. Furthermore, AHR or ARNT have been shown to interact in vitro with the general transcription factors TFIIB, IIF, and TBP (Rowlands et al., 1996; Swanson and Yang, 1998) supporting the role of AH R/ARNT in stabilizing the gene ral transcription complex. Other observed interactions include the HAT co-activator, CBP, interacting at the transactivation domain of ARNT (Kobayas hi et al., 1997) and RIP-140, retinoblastoma protein (Rb), Nedd8, and promyelocytic leukemi a nuclear bodies (PML ) interacting with AHR (Fujii-Kuriyama and Mimura, 2005; Hankinson, 2005), all of which have been shown to enhance reporter gene expression. Recent studies have al so demonstrated the involvement of the p-160 HAT coactivators, SRC-1 (NCoA-1), NCoA-2 (GRIP-1, TIF-

PAGE 29

19 2), and p/CIP (AIB, ACTR) in mediating TCDD-dependent CYP1A1 expression. ChIP assays and real time PCR reveal that all three proteins associate with the CYP1A1 enhancer region in vivo within 15 minutes of TCDD treatm ent, while antibodies specific to each reduce XRE-driven expression of re porter genes (Beischlag et al., 2002; FujiiKuriyama and Mimura, 2005; Hankinson, 2005; Hestermann and Brown, 2003; Kumar and Perdew, 1999). Overexpression of the coac tivators enhances repo rter gene activity and shows that all three are capable of in teracting with AHR while SRC-1 and NCoA-2 interact with ARNT (Beischlag et al., 2002). Further studie s need to be performed to elucidate the precise roles the p-160 family of receptors play in AHR-dependent signaling. Brahma/SW12-related Gene 1 Protein (B rg-1) is the ATPase subunit of certain ATP-dependent chromatin remodeling complexes and has been shown to associate with the TAD of AHR (Wang and Hankinson, 2002) Overexpression of exogenous Brg-1 enhanced expression of XRE–driven reporters in Hepa-1 cells and restored endogenous CYP1A1 activity in Brg-1 deficient cells wh en co-expressed with SRC-1 while an ATPase deficient Brg-1 mutant failed to do so. Finally, ChIP analysis demonstrated that Brg1 associates with the mouse CYP1A1 enha ncer region in a TCDD and ARNT dependent manner implicating its role in AHR-mediated induction of the gene (Fujii-Kuriyama and Mimura, 2005; Hankinson, 2005; Wang and Hankinson, 2002). The TRAP/DRIP/ARC mediator complex has also been shown to be involved in AHR-mediated regulation of CYP1A1. ChIP analyses show that two sub-units of the mediator complex, Med220 and CDK8 associ ate with the murine CYP1A1 enhancer

PAGE 30

20 shortly after binding of AHR/ARNT and p/CIP (10-30 min). RNAi experiments revealed that depletion of endogenous Med220 result ed in inhibition of endogenous CYP1A1 induction following treatment with TCDD (Wang et al., 2004). While Med220 and CDK8 have been shown to associate with the CYP1A1 enhancer in vivo other subunits of the mediator complex have previous ly been shown to bind to the general transcriptional complex suggesting a role fo r mediator to bridge the enhancer and promoter regions of CYP1A1 (Malik and Roeder, 2000). A hypothetical model for CYP1A1 regulati on based on the current literature is shown in Figure 1.4. Additional interactions are currently being evaluated. Indeed, the estrogen receptor alpha (ER ) has recently been in the spot light for its possible role as yet another cofactor. While an overwhel ming battery of coactivators have been implicated in AHR-mediated signaling, it is important to consider that many have suggested roles based on over-exp ression of proteins to leve ls far exceeding what a cell would experience in a norm al, physiological setting or in vitro interactions of artificially expressed proteins. Furthermore, even as new resources such as ChIP analyses and quantitative real-time PCR arise as valuable tools in assessing the proteins involved within this pathway, these procedures are not flawless and could possibly lead to the false implication of elements which, in reality, ar e not involved. Care mu st be taken in the analysis of future studies to avoid this. Ev en as a large number of factors are currently suggested to regulate TCDD-mediat ed gene induction, it is probab le that more will arise.

PAGE 31

21 Figure 1. 4. Model of CYP1A1 Regulation by AHR Fig. 1.4. Model of CYP1A1 Regulation by AHR. Hypothetical schematic overview of AHR-mediated transcriptional re gulation of CYP1A1. Number s indicate proposed events chronologically. Transcript ion factors and co-activators are shown bound to DNA and proteins respectively. See text and references for a dditional details.

PAGE 32

22 AHR Regulated Genes In addition to CYP1A1, ligand activated AHR leads to the in duction of a battery of other genes such as Glutathione S-transferase Ya ( Gst-Ya ), Uridine DiphoshateGlucuronosyl transferase ( UGT1A1 ), Aldehyde dehydrogenase ( ALDH ), Quinone oxidoreductase ( NQO1 ), and additional members of the P450 family of cytochrome monooxygenases. CYP1A2 and CYP1B1 are both phase I biotransformation enzymes known to be regulated by AHR. CYP1B1 is e xpressed constitutively in extrahepatic tissues such as the mammary, ovary, and pros tate (Shimada et al., 1996; Sutter et al., 1994) and has been implicated in the bi oactivation of benz o[a]pyrene and other procarcinogens. Importantly, CYP1B1 has been shown to be regulated by the AHR and contains three XREs within a 190bp span of its promoter region (Tang et al., 1996). Apart from AHR-mediated inducibility and a role in PAH metabolism, CYP1B1exhibits more differences than similarities to CYP1A 1. CYP1B1 is largely expressed in tissues originating from the mesenchyme while CYP1A1 is expressed ubiquitously. CYP1B1 is constitutively expressed while CYP1A1 genera lly shows little to no basal activity in the absence of liganded AHR. Differences also exis t structurally in that CYP1A1 consists of seven exons, like most other P450s, while CY P1B1 consists of only three exons. While the regulation of CYP1B1 is poorly unders tood, it is known that the mouse and human CYP1B1 promoters lack a TATA box, CTF/NF1 sites, or BTE sites as are found in the CYP1A1 regulatory region. Instead, the ge ne is under the cont rol of a TATA-like sequence located at position -27 relative to the transcriptional start site and a series of Sp1 sites located within the proximal pr omoter (Wo et al., 1997). Intriguingly,

PAGE 33

23 AHR/ARNT has been shown to bind at only one of the three CYP1B1 XREs while the other two are bound by a complex of proteins termed anomalous complex or anC (Eltom et al., 1999; Zhang et al., 1998a). The anC, which binds specif ically due to two nucleotides flanking the consensus XRE seque nce, likely functions to inhibit maximal CYP1B1 induction in the pres ence of high levels of activ ated AHR/ARNT by competing for binding with AHR/ARNT at the 5’ XRE. On the contrary, anC is also likely responsible for the constituti ve activity of Cyp1b1 by synerg istically activating the XRE bound to AHR/ARNT in the presence of very lo w levels of activated AHR (Zhang et al., 2003). The specific proteins which make up the anomalous complex or the exact molecular mechanisms behind the regulati on of CYP1B1 are cu rrently unclear. CYP1A2 is involved in aromatic amine metabolism and the metabolism of a number of drugs including caffeine and theophy lline. CYP1A2 is inducible by PAHs but unlike CYP1A1, is expressed constitutively a nd predominately in the liver. The CYP1A2 gene, in mammals, is on the same chromosome and orientated in a head-to-head fashion with CYP1A1, separated by approximately 23kb. Two regions were id entified w ithin the ~2.5kb upstream region of the CYP1A2 gene which are essential for 3-MC-mediated transcriptional activatio n (Quattrochi et al., 1994). One of the identified regions, termed X1, contains an XRE-like seque nce which weakly associates with AHR in the presence of 3-MC. Elimination of this region result ed in an approximately 50% reduction in activity. The second identif ied region, termed X2, di d not associate with AHR in vitro but may play a role in 3-MC-mediated inducti on due to a putative AP1 site (Quattrochi et al., 1994). Recent studies using a dual report er vector under control of the 23kb region between human CYP1A1 and CYP1A2 shows that an XRE cluster near the CYP1A1

PAGE 34

24 transcriptional start site may work bi-direc tionally to regulate CYP1A2 (Ueda et al., 2006). Further studies need to be performed to elucid ate the mechanisms behind CYP1A2 regulation. CYP2S1 was identified in 2001 as the onl y member of the novel, 2S, family of cytochrome P450s (Rivera et al., 2002; Ryla nder et al., 2001). CY P2S is a member of the CYP2 family which like Cyp2a5 and CY P2A6, from mouse and human respectively, is inducible by dioxin (Gokhale et al., 1997; Rivera et al., 2002). Expression of CYP2S is similar to that observed for CYP1B1, being prominent in epithelial tissues including skin, trachea, lung, and intestine (Rylander et al., 2001; Saarikoski et al., 2005). CYP2S1 also resembles CYP1B1 in that it lacks a TA TA box within the promoter (Rivera et al., 2007). Several XREs were identified w ithin the 5.2kb region upstream of the translational start codon of the mouse Cyp2s1 gene; however studies using reporter vectors containing combinations of mutate d XREs show that TCDD-mediated induction is attributed only to a regi on containing three overlapping XREs between -393 and -408 (Rivera et al., 2007). AHR/ARNT was capable of binding all three of the overlapping XREs in a ligand dependant manner as show n by EMSA. Each of the three XREs was also able to induce a reporter gene in ce ll culture; however simulta neous mutation of any two of the three trimeric XREs severely reduced TCDD responsiveness to near control levels as did mutation of all three (Rivera et al., 2007). A regulatory region containing a series of overlapping XREs such as exhibi ted in CYP2S1 has not been previously identified. Interestingly, the mouse region which contains the trimeric XREs also was found to contain three over lapping HREs of which at least one binds HIF1 /ARNT and

PAGE 35

25 is responsive to hypoxia. (Rivera et al., 2007) The human Cyp2s1 promoter was also found to contain two overlapping XREs and tw o overlapping HREs and is responsive to both dioxin and hypoxia (Rivera et al., 2002). Elucidation of the molecular mechanisms of CYP2S1 regulation is not only important because CYP2S1 may be partially important for the toxic effects of PAHs and dioxin, but additionally may help gain a better understanding of AHR-mediated signaling. While AHR additionally re gulates a number of phase II xenobiotic metabolizing enzymes which contain XREs within their regu latory regions, these genes also typically contain antioxidant response elements (ARE) which are bound by nuclear factor erythroid 2 p45-related factor (N rf2), the product of another target gene of AHR (Kohle and Bock, 2007; Miao et al., 2005). In a ddition to activation by AHR, Nrf2 can be activated by reactive oxygen sp ecies resulting from phase I XME metabolism of PAHs (Kohle and Bock, 2007; Marchand et al., 2004 ). Although functional AREs and XREs have not been identified in the regulatory regions of all phase II genes known to be regulated by AHR, analysis of NQO1 in AHR (-/-) and Nrf2 (-/-) null mice showed that TCDD-inducible expression requ ired both AHR and Nrf2 (K ohle and Bock, 2007; Ma et al., 2004). These findings led to a model whereby phase II XMEs may be regulated directly by AHR binding to XREs, by coordina te binding of AHR and Nrf2, or by AREs being bound by Nrf2 which is itself regulated by AHR and ROS. These mechanisms of cross-talk have yet to be confirmed bu t may be important in gaining a better understanding of the complexities of AHR-mediated signaling.

PAGE 36

26 Cyp1a1 I (-/-) and cyp1a2 (-/-) null mice have shown re latively little protection against the toxic effects of TCDD when comp ared to the extensive protection exhibited by Ahr (-/-) null mice (Bunger et al., 2003; G onzalez and Fernandez-Salguero, 1998; Smith et al., 2001; Uno et al., 2004) suggesti ng that induction of these genes may play little role in mediating TCDD toxicity. Mi croarray studies have identified numerous genes which are putatively regulated by AHR and have shown that the scope of genes may be far outside that of xenobiotic meta bolizing enzymes including genes involved in reproduction, growth and development, cell cycl e control, and differentiation (Tijet et al., 2006; Yoon et al., 2006). Recent advances in technology such as microarray analyses may help identify the genes responsible for the toxic response to dioxin, yet it is imperative that an understanding of the mol ecular mechanisms of AHR gene regulation be gained through the characteriza tion of well-defined AHR targets. TCDD-mediated Developmental Toxicity in Zebrafish In zebrafish, embryonic dioxin exposure leads to a series of fairly well characterized developmental defects which in clude disruption of er ythropoiesis, altered regional blood flow, craniofacial malfor mation, impaired lower jaw development, apoptosis and local circulat ion failure in the dorsal midbrain, edema, retarded development, and death (Antki ewicz et al., 2005; Belair et al., 2001; Dong et al., 2002; Henry et al., 1997; Hill et al., 2003; Teraoka et al., 2002). The defects associated with TCDD toxicity are exhibited between 48120 hours postfertiliza tion (hpf) with a reduction in the number of myocytes, reduced blood flow, and a change in the morphology of pronephric glomerulus being the ea rliest observed defects (Carney et al.,

PAGE 37

27 2006). The reduced peripheral blood flow and reduction in the number of myocytes which occur at 48 hpf as well as a change in the morphology of the he art are the earliest onset of cardiovascular dysfunction whic h ensues throughout the first 120 hpf (Antkiewicz et al., 2005; Carney et al., 2006; Henry et al., 1997; Te raoka et al., 2002). The morphological changes in the zebrafish heart following TCDD exposure are primarily due to the blockage of the co mmon cardinal vein fro m migrating dorsally toward the heart between 72 and 96 hpf (Ant kiewicz et al., 2005; Bello et al., 2004; Carney et al., 2006). Heart morphology is furthe r affected by an aberration of the normal looping of the heart which occurs concurren tly to defective remodeling of the common cardinal vein (Antkiewicz et al., 2005; Carn ey et al., 2006; Chen et al., 1997). These events lead to a heart which is mis-positioned and has an elongated atrium and a compact ventricle, although it is uncle ar whether these are direct effects of AHR regulation or secondary to a decrease in cardiac output (A ntkiewicz et al., 2005; Carney et al., 2006). Osmoregulatory defects are also obser ved in zebrafish embryos exposed to dioxin. Edema is observed in the pericardium and yolk sac at 72 and 96 hpf respectively (Belair et al., 2001; Dong et al., 2002; Henr y et al., 1997). Given that the gills do not play a role in osmoregulation until after 96 hpf (Rombough, 2002) and studies have shown that the pronephric kidney is not affect ed by TCDD prior to the onset of edema, (Hill et al., 2004) the likely cause of edema is linked to skin permeability and/or the circulatory defects defined above. Additional adverse effects of TCDD on zeb rafish development include inhibited growth of the cartilage which forms the lowe r jaw, increased apopt osis in the dorsal

PAGE 38

28 midbrain, a reduced brain volume, and a reducti on of definitive erythrocytes (Belair et al., 2001; Henry et al., 1997; Teraoka et al., 2002). The molecular mechanisms behind these defects are largely unknown but it is not likely that cran io-facial malformations or a failure of primitive erythrocytes to switch to definitive erythrocytes is secondary to cardiac dysfunction. The role AHR plays in me diating these effects will be a significant focus for studies in years to come. AHR and ARNT in Fishes Although polymorphisms are apparent in fish as they are in mammals, most fish exhibit multiple AHR genes whereas only a single gene is present in mammals. These multiple products are most likely the result of gene duplication events which occurred throughout the course of evolutionary history (Hahn, 2002). In zebrafish ( Danio rerio ) two known Ah receptors were isolated and designated zfAHR1 and zfAHR2 (Andreasen et al., 2002; Tanguay et al., 1999). Interestingly, while the zf AHR1 is the ortholog of the mammalian receptors, it is the zfAHR2 whic h is responsible for the TCDD-mediated AHR activity in this species (Andreasen et al., 2002; Prasch et al., 2003). Studies by Andreason et al. show that zfAHR2 is expres sed relatively ubiquit ously while zfAHR1 is limited to expression primarily in the liver (Andreasen et al., 2002). The functional differences between the two receptors likel y lies in the ligand binding domains and transactivation domains of the proteins as shown by experiments using zfAHR1/zfAHR2 chimeras (Andreasen et al., 2002). Like other piscine AHR s, zfAHR2 exhibits great similarity to mammalian AHR in the b-HLH-PA S domains but lacks the Q-rich region in the C-terminus essential for mammalian tr ansactivation (Hahn, 2002; Tanguay et al.,

PAGE 39

29 1999). Studies by Kumar et al. however, suggest that the requirement of this Glutamine rich region, in humans at least, may be lim ited to a single hydrophobi c residue (Leu-678) indicating that abundant glut amines may not be required per se for transactivation and fish AHRs may possess the necessary hydrophobi c residue (Kumar and Perdew, 1999). Furthermore, while the Q-rich domain was d eemed necessary for hAHR transactivation, in mice the Q-rich region of the AHR enhan ced the transactivation ability but was not required (Jain et al., 1994; Sogawa et al., 1995). Only a single ARNT has been identifie d in most teleost fishes. Two splice variants of an ARNT1 homolog have been isolated in rainbow trout ( Onchorhynchus mykiss ) and designated rtARNTa and rtARNTb (Po llenz et al., 1996). These proteins are identical over the first 533 amino acids wh ich include the b-HLH and PAS domains but diverge in the carboxyl end due to an additional 373 bp sequence in rtARNTb which causes a frame shift in the product. While both rtARNTa and rtARNTb are capable of binding AHR in vitro only rtARNTb appears able to facilitate transactivation of CYP1A1, likely due to the inefficiency of rtARNTa to bind DNA. Pollenz et al. also showed that rtARNTa is capable of beha ving as a dominant negative inhibitor of rtARNTb mediated gene induc tion; however, while rtARNT b is expressed ubiquitously, rtARNTa is expressed at much lower levels a nd restricted in its distribution (Pollenz et al., 1996). Interestingly, a single ARNT wa s isolated from the Atlantic killifish ( Fundulus heteroclitus ) as well; however, phylogenetic analyses revealed that, unlike rtARNT, the protein was a homolog of mamma lian ARNT2 (Powell et al., 1999). In zebrafish, the three alternatively spliced AR NTs originally identif ied by Tanguay et al.

PAGE 40

30 were also homologous to mammalian ARNT2 and were designated zfARNT2a, b, and c (Tanguay et al., 2000). zfARNT 2b was shown to bind zfAHR2 in vitro and could moderately induce XRE-driven reporters in COS-7 cells, yet zf ARNT2 morphants and zfARNT2 -/embryos still exhibited the same endpoints of TCDD toxicity observed in wild type fish (Prasch et al., 2004) suggesti ng that zfARNT2 is not the ARNT involved in mediating TCDD toxicity. Three additional alternatively spliced ARNTs were subsequently isolated from the zebrafish and found to be homologous to the rtARNTb and mammalian ARNT1. Designated zfARNT1a, b, and c, these three proteins were found to be expressed continuously thr oughout the timecourse critical for TCDDmediated developmental toxicity, albeit at considerably lower levels than zfARNT2. Furthermore, zfARNT1b and c were capable of forming dimers with zfAHR2, capable of binding DNA in vitro, and inducing XRE-driven reporter constructs. Most importantly, zfARNT1 morphants showed protection agains t three of the endpoints of TCDD toxicity: pericardial edema, reduced blood flow, and reduced lower jaw growth (Prasch et al., 2006). It is important to not e that there may be a species specific difference in XRE recognition sequences by AHR and AR NT. Tanguay et al. reported that zfAHR2/rtARNTb dimers failed to bind the mu rine XRE containing the core sequence 5’ –TTGCGTG3’ but actively bound the rainbow trout XRE c ontaining the sequence 5’ – TAGCGTG3’ (Tanguay et al., 1999). Upon is olation of zfARNT1, Pr asch et al. showed binding of zfAHR2/zfARNT2b and c dimers to the same murine XRE indicated above (Prasch et al., 2006). Surprisingly, mouse AHR/rtARNTb dimers bound both murine and rainbow trout XRE containing oligonucleotides (Tanguay et al., 1999). Further research

PAGE 41

31 will have to be done to elucidate the poten tial differences in DNA recognition between species.

PAGE 42

32 Chapter Two Isolation of the zfCYP1A upstream region To obtain the sequence of the zfCYP1 A1 promoter/enhancer, zfCYP1A1 cDNA sequence was used to query th e Sanger zebrafish genome da tabase. No sequence could be recovered that contained significant iden tity to zfCYP1A1 so a zebrafish genomic PAC library (Amemiya and Zon, 1999) was scr eened using primers specific to the 5’untranslated region (5’-UTR) a nd most 5’-region of the open reading frame (ORF) of the zfCYP1A1 cDNA. Two PACs, designa ted #133 and #150, containing putative zfCYP1A1 genes were identifie d. Restriction enzyme digestion and Southern analysis of the two PACs identified identical bands that hybridized to the zfCYP1A1 cDNA probe. A 0.5 kb and 2.5kb HindIII fragment as well as a 12 kb SpeI fragment were subcloned from PAC #150 and sequenced. The 2.5 kb Hind III fragment contained the putative ATG start codon and the first 134 bp of coding se quence that showed 100% identity to the zfCYP1A1 cDNA in Genbank (accession #BC 094977). The fragment also contained 14 bp of the 5’UTR with 100% identity to the zf-CYP1A1 cDNA. After nucleotide 14, the sequence showed minimal identi ty to zfCYP1A1 cDNA but c ontained a putative splice acceptor site at the region when identity was lost. The remaining sequence within the 2.5 kb HindIII fragment showed no identity to the CYP1A1 cDNA and contained substantial

PAGE 43

33 regions of repetitive DNA that were 80%–90% AT-rich. These results indicate that the zfCYP1A1 gene contains an intron within the 5’UTR sequence. This is consistent with the structure of other CYP1A1 genes (Carva n et al., 1999; Kubota et al., 1991; Powell et al., 2004; Sogawa et al., 1986). The size of the intron is estimated to be >2500 bp, but the entire sequence could not be obtained due to the high levels of AT-rich regions, numerous regions of repetitive DNA, and a l ack of unique restrict ion sites to allow subcloning of smaller fragments. Thus, to obtain the remaining 5’UTR and its 5’flanking region, the SpeI fragment wa s sequenced with an oligonucleotide complementary to the missing portion of the 5’UTR. This approach identified the remaining 74 bp of the 5’UTR and putative CAAT and TATA boxes. Subsequent sequence analysis identified the spli ce donor site for intron 1 and a putative promoter/enhancer that spanned a region 2629 bp upstream from the transcription start site. Several elements were identified within the isolated region which are characteristic of previously characterized CYP1A regulator y regions. A putative TATA box is located at position -31 relative to the transcriptional start site which has been designated +1. Additionally, two CTF/NF1 sites were identifi ed at positions -53 and -438 and an Sp1 site at -2474. These sites have all been implicated in the regulation of CYP1A1 in other organisms (Fisher et al., 1990; Jones and Whitlock, 1990; Yanagida et al., 1990). Importantly, eight putative XREs were id entified which conform to the consensus sequence: T/GNGCGTG. These XREs were de signated 1-8 with XRE1 being nearest the TATA box. Thus, the results indicate that zfCYP1A promoter/enhancer

PAGE 44

34 Figure 2.1. Comparison of CYP1A Regula tory Regions from Different Species -2699 +71 zf-2699/+71 m1A1-1674/+57 +57 -1674 -1897rt1A3-1897/+70 +70 +75 -1625 fh1A1-1625/+75 -2112 +57 r1A1-2112/+57 2580 +71 h1A1-2580/+71 Figure 2.1. Comparison of CYP1A regulator y regions from different species. The location of XREs, indicated by rectangl es, are shown in relation to the putative transcriptional start site. Functional XREs are shaded. The TATA box is represented by a shaded circle. CTF/NF1 or BTE s ites are indicated by triangles. Shaded triangles have been previously functiona lly characterized. Small shaded squares indicate putative HNF-3 sites. Zf = zebrafish; rt = rainbow trout; fh = Fundulus heteroclitus ; r = rat; m = mouse; h = human.

PAGE 45

35 contains numerous XREs and other consensu s regulatory sequences and bears an overall structure that is similar to the mouse, rat, and trout. A comparison of the zebrafish region to other characterized CYP1A regulat ory regions is shown in Figure 2.1. Induction of the zfCYP1A gene by TCDD Since zebrafish have undergone a gene duplication event, they can contain multiple copies of genes as well as pse udogenes that are nonfunctional (Postlethwait et al., 1998; Woods et al., 2000). Therefore it wa s pertinent to verify that the isolated zfCYP1A gene could support gene regulation an d was inducible by TCDD. To address this question, total RNA was isolated from ZFL cells that were treated with vehicle or TCDD for 6 h. RT-PCR was carried out to amplify CYP1A and actin mRNA. To confirm that expression was from the identified zfCYP1A promoter, the CYP1A primers were complementary to the 5’UTR and ORF and desi gned to be on either side of the first intron. Thus, the expected band from the amplification of CYP1A mRNA was 217 bp whereas a band that was generated by amp lifying genomic DNA would be >3 kb. The results show that a band of 217 bp was weak ly visible in the untreated ZFL but was dramatically elevated in the presence of TCDD. (Fig. 2.2) Amplification of actin shows that the changes in the level of CYP1A are not related to differen ces in the level of RNA used in the assay. Thus, the data are consistent with previous studies that have identified TCDD-inducible CYP1A in zebrafish (Henry et al., 2001; Miranda et al., 1993) and support the hypothesis that the identified zfCYP1A gene is indeed inducible by TCDD.

PAGE 46

36 Figure 2.2. Induction of the zfCYP1A gene by TCDD Figure 2.2. Induction of the zfCYP1A gene by TCDD. A. The location of the forward and reverse primers used for reverse transcriptase PCR are indicated with arrows and shown in relation to the zfCYP1A gene. B. Triplicate samples of were exposed to 2nM TCDD (TC-6) or 0.05% DMSO (0) for 6 hours and total RNA was pr epared. mRNA was amplified following reverse transcription with PCR primers specific to -Actin (357 bp) or CYP1A (217 bp). PCR products were visualized in a 2% agarose gel containing ethidium bromide and exposed to UV light. Specific markers of 357, 323, and 200 bp are indicated.

PAGE 47

37 While the previous experiment s suggest that the identified zfCYP1A gene was inducible by TCDD, it was sti ll important to show that th e 5’flanking region contained specific regions that conferred TCDD-responsiv eness. Unfortunately, due to the extreme AT-rich content and high level of repetitiv e DNA that is present between -600 and -2000, it was not possible to generate a cons truct containing the full 2600 bp of the promoter/enhancer. Thus, PCR was utilized to amplify the region between -580 and -187 (containing XREs 1-3) and the region be tween -2608 and -2100 (containing XREs 4-8). These fragments were ligated in the forwar d and reverse orientations both upstream and downstream of the SV-40 promoter in th e pGL3promoter vector. TCDD mediated induction of luciferase activity was then evalua ted in the mouse Hepa-1 cell line. The use of the mouse Hepa-1 line and not the zebra fish ZFL line for these studies was based on the ability to grow large numbers of cells and the ability to obtain high levels of transfection efficiency that facilitate d the analysis of the luciferase and -galactosidase activities. The results shown in Figure 2.3 reveal that the -26 08 to -2100 fragment confers TCDD responsiveness to the SV40 pr omoter regardless of its location or orientation. However, the maximal induction (approximately 40-fold) was observed in the -2608/-2100Rup constr uct in which the 506bp zfCYP1A fragment was placed in a reverse orientation upstr eam of the SV40 promoter. In this context, the magnitude of the response and the overall level of induction were approximately five-fold higher than when the fragment was inserted in the forward orient ation (-2608/-2100Fup). Interestingly, when the -2608 to -2100 fr agment was placed downstream of the SV40 promoter in either the forward or re verse orientation (2608/-2100Fdown and -2608/-

PAGE 48

38 2100Rdown), it was also capable of inducing signif icant levels of luci ferase activity in a TCDD-dependent manner. However, in th is context, the orientation of the zfCYP1A fragment made no difference in the overall le vel of the response although the magnitude of the response was 5-fold less than that observed for the -2608/-2100Rup. In contrast to the results with the -2608 to-2100 fragment, the constructs containing the proximal region between -580 to -187 (-580/-187Fup and -580/187Fdown) did not exhibit elevations in luci ferase activity in the presence of TCDD. Even when placed in the reverse orientati on, the proximal fragment failed to confer TCDD-responsiveness to the reporter gene constr uct (Fig. 2.3). This finding is intriguing since the region between -580 to -187 contai ns three putative XREs. It was important then to assess the function of XREs 1-3 in the context of their native promoter. PCR was used to amplify the region between -580 and +71 and the resulting fragment was ligated into pGL3Basic to generate the -580/+71Basic construct. This cons truct was transfected into Hepa-1 cells and treated with TCDD. Th e results in Figure 2.4A show that -580/+71 exhibits high levels of constitutive activity which is approximately 35-fold higher than naked vector however failed to convey TCDDmediated induction. These results confirm the observations made on the -580/+71Fup and -580/+71Fdown constructs and additionally validates the function of this re gion as a functional promoter. As a positive control, Hepa-1 cells were transfected with p-1897Om1A3luc that contains the full length trout CYP1A3 promoter/enhancer. This construct was induced approximately threefold in the Hepa-1 line. To determine whether the lack of TCDD-responsiveness by the 580/+71Basic construct wa s related to the analysis in a murine background, the construct

PAGE 49

39 Figure 2.3. Analysis of the Effect of Or ientation and Position on TCDD-induced Luciferase Activity Figure 2.3. Analysis of the effect of or ientation and position on TCDD-induced Luciferase activity. The indicated reporter c onstructs as well as pSV-galactosidase were transfected into Hepa-1 cells a nd treated with either 2nM TCDD or 0.05% DMSO for seven hours. Luciferase activity was measured with a Turner Instruments luminometer. -Galactosidase levels were measured by spectrophotometry (OD420). Normalization was carried out by dividing th e relative luciferase levels for each sample by the corresponding level of -galactosidase White bars represent DMSO treated cells while black bars indicate cells treated with TCDD. Bars represent the mean SE of three independent samples. indicates statistica lly significant from vehicle treated controls. P<0.001

PAGE 50

40 was transfected into the zebrafish liver cell li ne, ZFL. This line c ontains zfAHR2 and is responsive to AHR ligands (Miranda et al., 1993; Woods et al., 2000). The results show that that -1897Om1A3luc is responsiv e to TCDD in the ZFL cells and was induced approximately threefold (Fig. 2.4B) as was obs erved in Hepa-1 cells, (Fig. 2.4A) whereas -580/+71Basic exhibits elevated activity well above the pare ntal vector, but is still not responsive to TCDD. Thus, these stud ies show that th e region of the zfCYP1A gene containing defined TATA and CAAT boxes (-580 to +71) can function to promote gene expression in both mouse and zebrafish b ackgrounds. The region which confers TCDD responsiveness, however, appears to be located between -2100 and -2608. In order to determine whether or not the zebrafish CYP1A enhancer region was able to convey a similar TCDD-responsiven ess to the endogenous zfCYP1A promoter as was observed with the SV-40 promoter of the pGL3promoter vector, the -2100/-2608 region was ligated in either the forward or reverse orientation upstream of the -580/+71 region and transfected into Hepa-1 cells. These constructs were designated p-2608/2100Uf or p-2608/-2100Ur, respectively. Intere stingly, the results show that while the region driving the SV-40 promoter exhibi ted an approximately threefold greater induction in the reverse versus the forward or ientation, (Fig. 2.3) in the context of the native promoter the difference was marked ly less yielding approximately 18-fold induction in the forward orient ation and 22-fold induction in the reverse orientation. (Fig. 2.5) Despite this difference, the results show that the 2100/-2608 portion of the zfCYP1A regulatory region is capable of conveying TCDD-me diated induction to its endogenous promoter. As positive controls the mouse CYP1A1 regulatory region

PAGE 51

41 Figure 2.4. Luciferase Reporter Analysis of the Ability of the region between -580 and +71 to Function as a Promoter Figure 2.4. Luciferase reporter analysis of the ability of the region between -580 and +71 to function as a promoter. The indicated reporter co nstructs as well as pSV-galactosidase were transfected into Hepa-1 cells (A) or ZFL cells (B) and treated with 2nM TCDD or 0.05% DMSO fo r 7 hours. Luciferase activity was measured with a Turner Instruments luminometer. -Galactosidase levels were measured by spectrophotometry (OD420). Normalization was carried out by dividing the relative luciferase levels fo r each sample by the corresponding level of galactosidase White bars represent DMSO treated cells while black bars indicate cells treated with TCDD. Bars represen t the mean SE of three independent samples. indicates statis tically significant from vehi cle treated controls. P<0.001

PAGE 52

42 between -1315 and -819 and th e rainbow trout CYP1A3 regulatory region between -1897 and -1392 which have been previously shown to exhibit TCDD-responsiveness, (Carvan et al., 1999; Jones et al., 1986) were ligated upstream of the zf-580/+71 region and transfected into Hepa-1 cells. While these constructs respectively yielded approximately ten and threefold levels of induction, the magnitude of the response by the zf-2100/-2608 region was far gr eater indicating that zfCYP1 A is highly responsive to TCDD in Hepa-1 cells. In vitro analyses of AHR/ARNT association with zfXREs Since the fragments containing XREs 1-3 did not confer TCDD-responsiveness, it was of interest to determine whether they repres ented bona-fide regions that actually bound to AHR/ARNT complexes. To carry out these studies it was first important to establish the conditions for the detection of zfAHR2/ARNT complexes in vitro Previous studies carried out in COS-1 cells have shown th at the zfAHR2 can drive reporter gene expression in the presence of zfARNT2b. (Abnet et al., 1999; Tanguay et al., 2000) However, recent studies have challenged th ese findings by showing that zfARNT2b does not support TCDD-mediated responses in vivo (Prasch et al., 2004; Prasch et al., 2003). Thus, studies were carried out using rtAR NTb and zfARNT2b since rtARNTb has been shown to form a functional dimer with mAHR in vitro (Necela and Pollenz, 1999; Necela and Pollenz, 2001; Pollenz et al., 1996). For these studies, zfAHR2, zfARNT2b, and rtARNTb were synthesized in reticulocyte ly sates, incubated with TCDD, and analyzed by electrophoretic mobility shif t assays (EMSA). The results shown in Figure 2.6 reveal that complexes containing zfAHR2 and rt ARNT2b produce a specific shift that is

PAGE 53

43 Figure 2.5. Analysis of TCDD-mediated Induction from Reporter Constructs Containing the zfCYP1A Promoter Re gion Between -580 and +71 and CYP1A Enhancer Regions from Different Species Fig. 2.5.Analysis of TCDDmediated Induction from Reporter Constructs Containing the zfCYP1A Promoter Region Between 580 and +71 and CYP1A Enhancer Regions from Different Species. A. The indicated reporter constructs as well as pSV-galactosidase were transfected into Hepa-1 cells and treated with 2nM TCDD or 0.05% DMSO for 7 hours. Luciferase activity was measured with a Turner Instruments luminometer. Galactosidase levels were measured by spectrophotometry (OD420). Normalization was carried out by dividing the relative luciferase levels for each sample by the corresponding level of -galactosidase White bars represent DMSO treated cells while black bars indicate cells treated with TCDD. B. Fold induction was determined by dividing nRLU of vehicle treated cells by dioxin treated cells. Bars represent the mean SE of three independent samples.

PAGE 54

44 TCDD dependent and can be competed with antibodies specific to the zfAHR2 protein. In contrast, no shift was detected in the samples activated with zfAHR2 and zfARNT2b. These results are consistent with the hypothesis that TCDDmediated signaling does not utilize ARNT2 proteins, but occurs thr ough dimers with AHR and ARNT1 proteins (Prasch et al., 2004; Prasch et al., 2003). To assess the functionality of the XREs present in the zfCYP1A promoter, duplex oligonucleotides were prepared that contained the core XRE as well as 6–7 nucleotides of flanking sequence. Each XRE was then evaluated for binding to zfAHR2/rtARNTb complexes by EMSA (Fig. 2.7). The results show that only five of the eight XREs associate with zfAHR2/rtARNTb dimers in a TCDD-dependent manner. XRE3, XRE7, and XRE8 showed the most intense shifts while XRE1 and XRE 4 associated with AHR/ARNT dimers in a TCDD-dependent manner but showed slightly less intensity. Since all XREs were labeled to the same sp ecific activity, the reduced intensity of the shifted bands likely represents a reduced le vel of affinity between the AHR/ARNT dimer and the XRE. XRE2 and XRE6 showed no detectable shifts, while XRE5 showed a very weak shift after prolonged expos ure of the film (data not sh own). Identical results were obtained when the zfXREs were evaluate d in the presence of mouse AHR/ARNT complexes. To verify that the lack of bi nding by XRE2, XRE5, and XRE6 was not due to the use of zfAHR2 and rtARNTb, studies we re repeated using zfAHR2 and zfARNT2b. However, the use of zfAHR2/zfARNT2b hetero dimers also failed to produce a detectable shift (data not shown). Thus, these results s how that only a subset of the XREs are

PAGE 55

45 Figure 2.6. In vitro Analysis of the Association of zfAHR2 with XREs Fig. 2.6. In vitro analysis of the association of zfAHR2 with XREs. A. The indicated proteins were expressed in vitro resolved by SDS-PAGE, and bl otted to nitrocellulose. Blots were stained with zf-4 IgG (1.0 g/mL), rt-84 IgG (1.0 g/mL), or anti-ARNT2 antibodies (1:250) followed by GAR-HRP or RAG-HRP IgG (1:10,000). Reactivity was visualized by ECL. B. Equal amounts of zfAHR2 were mixed with equal amounts of either zfARNT2b or rtARNTb and incubated with TCDD (16 nM) or DMSO (1.0%) for 2 h at 30C. Samples were mixed with [32]P-labeled mXRE in the presence or absence of the indicated antibodies and reso lved on 5% acrylamide/0.5% TBE gels, dried, and exposed to film.

PAGE 56

46 Figure 2.7. Association of zfAH R2 and rtARNTb with zfXREs Fig. 2.7. Association of zfAHR2 and rtARNTb with zfXRES. Equal amounts of zfAHR2 were mixed with equal amounts of rtARNTb and incubated with TCDD (16 nM) or DMSO (1.0%) for 2 h at 30C. Sa mples were mixed with the indicated [32]Plabeled zfXREs and resolved on 5% acryl amide/0.5% TBE gels, dried, and exposed to film.

PAGE 57

47 functional in binding to AHR/ARNT in vitro and that there are slight differences in their affinities for AHR/ARNT dimers. In addition, the results suggest that the inability for the -580 to -187 fragment to respond to TCDD in the reporter gene studies is not due to the inability of the XREs to associate with AHR/ARNT complexes. Functional characterization of indivi dual XREs within the zfCYP1A regulatory region Due to the 1.7kb AT-rich region which sepa rates the proximal (-580 to +71) and distal (-2100 to -2608) cluster of XREs in the zfCYP1A regulatory region, PCR and PCR-dependant site directed mutagenesis could not be performed to amplify the complete 2.7kb fragment. Thus, the previous characterization of th e zfCYP1A regulatory region utilized constructs containing only th e regions between -2100 to -2608 and -580 to +71. Before site directed mutagene sis could be employed on the p-2608/-2100Ur construct in order to determine the functiona lity of individual XREs, it was imperative to determine whether its ability to drive a lucife rase reporter was representative of the full length promoter/enhancer. Thus, a full-lengt h construct was generated by cutting the zfCYP1A promoter/enhancer region from the original PAC clone and ligating it into pGL3. The full-length p-2699/+71 and p-2608/ 2100Ur constructs were then transfected into Hepa-1 cells and the level of TCDD-induced luciferase activity quantified. It can be observed in Figure 2.8 that the full-lengt h p-2699/+71 was highly inducible by TCDD and averaged approximately 20-fold inducti on over control treated cells. This is consistent with the p-2608/ 2100r construct that averag ed approximately 32-fold induction. The p-2699/+71 constr uct did exhibit reduced leve ls of total RLU in both

PAGE 58

48 control and TCDD exposed cells by comparison to the p-2608/ 2100Ur construct, but the difference between the two constructs may have been due in part to a significantly higher level of transfection efficiency for p-2608/ 2100Ur than the larger, AT-rich p-2699/+71. Therefore, these studies i ndicate that both the p-2608/ 2100Ur and the p-2699/+71 construct are highly responsive to TCDD exposure and validate the use of p2608/ 2100Ur for the analysis of the regulation of the zfCYP1A gene. Previous experiments have shown that the region between -580 and +71 which contains XREs 1-3 is incapable of conveyi ng TCDD-mediated gene induction (Fig. 2.4) even though XRE1 and XRE3 are able to bind AHR/ARNT in vitro in a TCDDdependant manner (Fig. 2.7). To determine whether XRE1 and XRE3 contribute to maximal induction by acting in concert wi th XREs in the distal cluster, in vitro mutagenesis was employed on p-2608/-2100U r in order to render XREs 1 and 3 nonfunctional, alone or in combination. Th e mutants, designated p-2608/-2100Ur(-1), p2608/-2100Ur(-3), or p-2608/-2100Ur(-1-3), or the non-mutated control were transfected into Hepa-1 cells and assayed for lucifera se activity. The results seen in Figure 2.9 indicate that the loss of XRE1 or XRE3 does not significantly affect the overall levels of maximum gene induction by TCDD. Considering the fact that these XREs are capable of binding AHR/ARNT in vitro it is intriguing that XRE1 a nd 3 do not play an apparent role in the regulation of the downstream gene. It should be noted that the distance of the elements from the transcriptional start site is likely not the reason behind the functionality of these XREs, as they failed to drive an SV-40 promoter when placed within the same position as the functional, dist al region of XREs. While it is possible that activated

PAGE 59

49 Figure 2.8. Comparison of TCDD-induced Luciferase Activity Between the p-2699/+71 and p-2608/-2100Ur Constructs Figure 2.8. Comparison of TCDD-induced Luciferase activity between the p-2699/+71 and p-2608Ur constructs. Hepa-1 cells were transfected with either p-2699/+71 or p-2608/ 2100Ur and treated with TCDD (2 nM) or DMSO (0.05%) for 15 h. Luciferase ac tivity was measured using a Turner Instruments luminometer and -galactosidase activity was determined by spectrophotometry (OD 420). (A) The norma lized relative luci ferase units are shown for the indicated plasmids. Open bars represent control treated cells while black bars indicate TCDD treated cells. Each bar = mean S.E. from four independent experiments. (B) The fold induction is shown for the indicated plasmids. Fold induction was determined by dividing the normalized RLU of samples treated with TCDD by the normalized RLU of control treated samples presented in (A).

PAGE 60

50 AHR/ARNT is capable of binding these elements in vitro but not in vivo the reason for this would likely be due to chromatin c ondensation within the region containing XREs 1 and 3 or the inaccessibility of the elements due to interference by other proteins binding nearby as.opposed to differences in intracellu lar binding affinities versus those observed by EMSA. Further experimentation will be required to elucidate the reasons for the lack of function of these XREs Contrary to what was observed for th e XREs within the proximal region, the distal region between -2100 and -2608 cont aining XREs 4 through 8, is capable of conveying TCDD-mediated gene induction (F igs. 2.3 and 2.5). Additionally, EMSA has shown that XREs 4, 7, and 8 are capab le of being bound by AHR/ARNT in a TCDD dependant fashion (Fig. 2.7). Therefore, in vitro mutagenesis was also performed on these three XREs in order to determine thei r individual contributions to maximal gene induction. Transfection into Hepa-1 cells and subsequent luciferase analysis shows that individual mutation of XRE4, XRE7, or XRE8 resulted in significant reductions in both raw levels of luciferase activity as well as fold-change of induction (Fig. 2.10). While the transcriptional activity of each XRE does not appear to be equivalent by assessing the degree of reduction observed by individual XR E mutations, this inequality is more apparent when more than one XRE is mutate d. Indeed, while elimination of any one of the active XREs (4, 7, or 8), resulted in a 30–50% decrease in TCDDmediated luciferase activity, XRE4 or XRE7 alone supported appr oximately 25% of the maximal luciferase induction in the absence of additional f unctional XREs while XRE8 alone showed minimal activity above p-2608/ 2100Ur( 478) or the p-580/+71Basic control. Therefore,

PAGE 61

51 Figure 2.9. Functional Anal ysis of zfXREs 1 and 3 Fig. 2.9. Functional analysis of zfXREs 1 and 3. Hepa-1 cells were transfected with the indi cated plasmids and treated with TCDD (2 nM) or DMSO (0.05%) for 15 h. Luciferase activity was measured using a Turner Instruments luminometer and -galactosidase activity was determined by spectrophotometry (OD 420). (A) The normalized relative luciferase units are shown fo r the indicated plasmids. Open bars represent control treated cells while black bars indicate TCDD treated cells. Each bar = mean S.E. from three independent experiments. (B) The fold induction is shown for the indicated plasmids. Fold induction was determined by dividing the normalized RLU of samples treated with TCDD by the normalized RLU of control treated samples presented in (A).

PAGE 62

52 these results suggest that in this model syst em, each of the regulatory sequences does not provide the same level of regulation to the CYP1A gene as suggested by Fisher et al. (Fisher et al., 1990). To verify that the prev ious results were not due to the analysis of the zfCYP1A promoter in a mouse cell line, studies were repeated using the zebrafish ZFL liver cell line. This line contains zfAHR2 as well as zfARNT1 and zfARNT2 and is capable of supporting TCDD-mediated gene re gulation (Carvan et al., 2000; Miranda et al., 1993; Pollenz and Dougherty, 2005; Wentwo rth et al., 2004; ZeRuth and Pollenz, 2005). In comparison to the mammalian cell li nes, transfection of the ZFL cells was much less efficient and the cells exhibited a high er level of basal activity that resulted in lower levels of fold induction in several cons tructs. Nevertheless, the results in the ZFL line (Fig. 2.11A) showed several similarities to the results in the Hepa-1 line (Fig. 2.10). First, single mutations of XRE4 or XRE7 resulted in a significant reduction in TCDDinducible luciferase activity. Second, mutation of XRE8 did not affect the luciferase induction as significantly as loss of XRE4 or XRE7. Thus, as in the Hepa-1 cells, the contribution of each XRE4 and XRE7 to the induction of the luciferase reporter was much more prominent than XRE8. To comp are the trend of the results across the different cell lines used in the studies, the results were scaled with the overall fold induction of wild type p-2608/ 2100Ur construct set at 100%. The fold induction yielded by constructs harboring XRE mutations was plotted as a percentage of the maximal induction (Fig. 2.11B). The results show that there is a similar trend of the various constructs when analyzed in Hepa-1 or zebra fish cells with mutation of XRE4 or XRE7 having a more dramatic impact than mutation of XRE8. The graph al so contains results from studies completed in the HepG2 line that is of human origin. In this cell line, the

PAGE 63

53 Figure 2.10. Functional Analysis of zfXREs Fig. 2.10. Functional analysis of zfXREs. The indicated plasmids were transfected into Hepa-1 cells as described for Fig. 2.9 (A) The normalized relative luciferase units are shown for the indicated plasmids. Open bars represent control treated cells while black bars indicate TCDD treated cells. Each bar = meanS.E. from five independent experiments. Schematics of the constructs are shown to the left of their respective bars. Open rectangles indicate XREs. Shaded re ctangles indicate mutated XREs. The TATAA box and luciferase cassette are shown. (B) Th e fold induction is shown for the results presented in (A) and was determined by dividing the normalized RLU of samples treated with TCDD by the normalized RLU of c ontrol treated samples. a. Statistically different from p-2608/ 2100Ur ( p < .001). b. Statistically different from p2608/ 2100Ur( 7) ( p < .01). c. Statistically different from all constructs except p2608/ 2100Ur( 478) and p-580/+71Basic ( p < .001). d. Statistically different from p2608/ 2100Ur( 8) ( p < .001). e. Statistically different from all constructs except p2608/ 2100Ur( 4 7) and p-580/+71Basic ( p < .001). f. Statistically different from all constructs exce p t p -2608 / 2100Ur ( 4 7 ) and p -2608 / 2100Ur ( 478 ) ( p < .001 ) .

PAGE 64

54 basal level of luciferase activity in contro ls was low for all the constructs and this resulted in very high levels of fold-change in the presence of TCDD. It can be observed that the overall trend obtained with the vari ous constructs in the HepG2 line follows that observed in the Hepa-1 and ZFL cells despite the fact that that overall fold induction varies dramatically between the cell lines. In order to determine whether the inability of XRE8 to function alone was due to the truncation of the fragment immediatel y upstream of the core sequence, a new construct was made extending the 5’ end of the insert up to -2727 and designated p2727/-2100Ur. XREs 4, 7, and 8 were mutate d individually or in combination as done previously with p-2608/-2100Ur an d evaluated for luciferase activity in the Hepa-1 cell line. The results in Figure 2.12 show that p-2727/-2100Ur exhibited approximately 60% higher levels of basal and induced lucife rase activity over p-2608/-2100Ur while the overall fold-induction increased by approxi mately 17% between the constructs. Considering the differences in the level of activity and fold-induction is consistent between p-2608/-2100Ur and p-2727 /-2100Ur equivalent mutants, it can be inferred that the region between -2727 and 2608 contributes to the overall transcriptiona l activity of the construct however does not ch ange the functionality of XRE8 or its ability to regulate the gene in the absence of additional f unctional XREs. The molecular mechanism that underlies the inability of XRE8 to function al one is not presently cl ear but it is possible that XRE8 is inaccessible prior to AHR /ARNT binding at XRE 4 and 7 or that AHR/ARNT binding to XRE8 cannot eff ectively recruit transcriptional coactivators. Indeed, chromatin relaxation and/or DNA bendi ng has been shown to occur following

PAGE 65

55 Figure 2.11. Functional Analysis of zfXREs in Different Cell Lines Fig. 2.11. Functional analysis of zfXREs in different cell lines. (A) The indicated plasmids were tr ansfected into ZFL cells and treated with TCDD (2 nM) or DMSO (0.05%) for 15 h. Lucife rase activity was measured using a Turner Instruments luminometer and -galactosidase activity was determined by spectrophotometry (OD 420). The normalized relative luciferase units are shown for the indicated plasmids. Open bars re present control treated cells while black bars indicate TCDD treated cells. Schematic s of the constructs are shown to the left of their respective bars as described for Fig. 2 .10A. Each bar = meanS.E. from three independent experiments. Th e number in parentheses indicates the fold-change for TCDD samples compar ed to DMSO treated controls. a. Statistically different from p-2608/ 2100Ur ( p < .001). b. Statistically different from paired control. c. Sta tistically different from p-2608/ 2100Ur( 4) and p2608/ 2100Ur( 7) ( p < .005). (B) Scaled line graph showing the TCDD-induced luciferase activity as a percen tage of the wild type p-2608/ 2100Ur construct. Data were derived from Hepa-1 cells (cir cles), ZFL cells (tri angles), or HepG2 cells (squares).

PAGE 66

56 AHR/ARNT binding at an XRE (Elferink and Whitlock, 1990; Okino and Whitlock, 1995) and this may impact protein–protein interactions or may prevent access to XRE8 prior to AHR/ARNT binding at XREs 4 or 7. In addition, a putative XF-1 site overlaps XRE8 and this could also contribute to its lack of function in the ab sence of binding at XRE4 and XRE7 as XF-1 binding has been previously been observed in the mouse CYP1A1 enhancer (Saatcioglu et al., 1990). Since ChIP assays cannot distinguish binding to enhancer regions th at are on the same fragment of amplified DNA, and the sequential association of AHR/ARNT with XREs in any gene has not been resolve. The importance of these findings will require additional analysis. The pattern of expression controlled by the zfCYP1A and mCYP1A1 regulatory region varies in different cell lines During the course of the studi es in this report, it was not ed that the overall level of gene induction of different re porter constructs va ried dramatically when tested in different cell lines. To formally investigat e this observation, four different reporter constructs containing regions from the zebrafish of mouse CYP1A1 promoter/enhancer were evaluated in seven different cell lines The two constructs derived from zebrafish were the full-length p-2699/ +71 construct (ZFL) and p-2727/ 2100Ur (ZFA). The mouse constructs included one containing the region from 1674/+47 from the mouse CYP1A1 promoter/enhancer (MFL), or the region spanning 1316/ 819 ligated upstream of the zebrafish CYP1A promoter region, 580/+71 (MMA). The cell lines utilized for these studies and their tissue of origin ar e detailed in Fig. 2.13 A. Interestingly, two distinct patterns of induction were observed. The re sults show that the constructs

PAGE 67

57 Figure 2.12. Comparison of XRE8 Func tion Between the p-2608/-2100Ur and p2727/-2100Ur Constructs Fig. 2.12. Comparison of XRE8 functi on between the p-2608/-2100Ur and p2727/-2100Ur constructs. The indicated plasmids were transfected into Hepa-1 cells and treated with TCDD (2 nM) or DM SO (0.05%) for 15 h. Luciferase activity was measured using a Turner Instruments luminometer and -galactosidase activity was determined by spectrophotometry (OD 420). The normalized relative luciferase units are shown for the indicated plasmids. Open bars represent control treated cells while black bars indicate TCDD treated cel ls. Each bar = meanS.E. from three independent experiments. The number in pa rentheses indicates the fold-change for TCDD samples compared to DMSO treated co ntrols. indicates percent of -2608/2100Ur fold induction. # indicates pe rcent of -2727/-2100Ur fold induction.

PAGE 68

58 Figure 2.13. Characterization of Mo use and Zebrafish CYP1A Promoter and Enhancer Regions in Various Cell Lines Fig. 2.13. Characterization of mouse and zebrafish CYP1A promoter and enhancer regions in various cell lines. (A) Species and tissue of origin, AHR allele, and presence or absence of ARNT 2 for each of the cell lines. (B and C) Fold induction of luciferase when the desi gnated constructs were transfected into the indicated cell lines and treated with TCDD (2nM). Each data point is the mean of at least three different samples. ZFL = p-2699/+71, ZFA= p2608/ 2100Ur, MFL= mouse-1647/+57, MMA= Mm-1315/ 819Uf.

PAGE 69

59 containing the zebrafish CYP1A promoter/enhancer (ZFL and ZFA), were more responsive in the Hepa-1, B19, and A498 cell lines than the constructs containing the mouse CYP1A1 regions (Fig. 2.13 B and C). In c ontrast, the hRPE, TCM, C2C12, and HepG2 cell lines significantly favor the fu ll-length mouse promoter/enhancer over the constructs containing the zebrafish regi ons. The data presented in Figure 2.13B also supports previously detailed results which s how that the zebrafish region -2100 to -2608 conveys an approximately 2-fold higher le vel of induction than does the mouse CYP1A1 region between -819 and -1316. It was previously detailed in this report that p-2608/2100Ur construct exhibited increased levels of luciferase activity and fold-induction over the full-length p-2699/+71 construct. The da ta presented in Fi gure 2.13 supports these findings although it is interesting to note that the increase is significantly more dramatic in the cell lines which favor the zebrafish constructs (Fig 2.13B) versus those which favor the full-length mouse construct (Fig 2.13C). Intriguingly, the contrary is observed in Fig. 2.13C wherein the full-length mouse construc t, MFL, produced considerably greater levels of induction than both p-2727/-2100Ur an d p-2699/+71. It is also important to recognize that the mouse enhancer region between -819 and -1316 yielded significantly less activity when driving the zebrafish CYP1A promoter (MMA) than the full-length MFL in these four cell lines. The molecular basis for the differences in response of the various reporters in the differe nt cell lines is currently unc lear. However, there does not appear to be a correlation to the level or species of AHR pr otein, the tissue type, or level of expression of ARNT2. The findings pr esented above suggest that the differences observed between the transcriptional activities in various cell lines ma y be due, in part, to interactions between the enhancer and promoter regions. It is possible that differences in

PAGE 70

60 the expression, binding affinities, or transactiv ation domains of cell specific factors may contribute to the observed results. Analysis of the zebrafis h CYP1A Proximal Promoter Since the different levels of response exhibited between the mouse and zebrafish regulatory regions may be due, in part, to their re spective proximal promoters, it was of interest to characterize the zebrafish CYP1A promoter region. To do this, successive truncations of the zebrafish CYP1A promot er region were cloned upstream of pGL3 Basic, transfected into Hepa-1 cells treated with either DMSO or TCDD, and assayed for luciferase activity. The results shown in Fi gure 2.14 indicate that up to three regions are required for maximal promoter function while one region may have an inhibitory effect on transcription. The loss of the region between -580 and -490 resulted in a 40% decrease in activity while further truncati on down to -439 results in an additional 10% loss. Transcription Element Search Software (TESS) identified two Sp1 binding sites and a CTF/NF1 binding site within these regions which may be responsible for the decrease in activity. Interestingly, loss of the regi on between -439 and -398 caused an increase in activity back to the levels yielded by p580/+71 Basic suggesting that an inhibitory element may reside within this region. In silico analysis identified an Sp1 site overlapping a USF1 site within these 40 bases which are possibly involved in the observed inhibition. Further tr uncation down to -206 resulted in another 50% decrease in activity which may be due to the loss of putative ER and HNF-3 sites located within the lost region. CTF/NF1 sites and G-boxes have both been implicated in the control of

PAGE 71

61 Figure 2.14. Analysis of the Ze brafish CYP1A Proximal Promoter Fig. 2.14. Analysis of the zebraf ish CYP1A proximal promoter. The indicated plasmids were transfected into Hepa-1 cells and treated with TCDD (2 nM) or DMSO (0.05%) for 15 h. Luciferase ac tivity was measured using a Turner Instruments luminometer and -galactosidase activity was determined by spectrophotometry (OD 420). The normalized relative luciferase units are shown for the indicated plasmids. Open bars re present control treated cells while black bars indicate TCDD treated cells. Each bar = meanS.E. from three independent experiments. The schematics to the left represent the portions of the promoter contained within the respective constr uct. Shaded circles = TATA box; Rectangles = CTF/NF1 sites; Triangles = ER sites; Diamonds = Sp1 sites.

PAGE 72

62 the mouse CYP1A1 promoter as well as th e existence of a possible inhibitory region. (Jones and Whitlock, 1990) Further studies will ha ve to be performed to characterize the importance of these elements in the zebrafish CYP1A promoter. Functional analysis of XRE flanking sequence Previous results suggest that just the presence of a core 5’-GCGTG XRE sequence is not sufficient to as cribe function to a putative XRE in vivo (Denison et al., 1988). For example, zfXRE5 has the same orie ntation and core sequence as zfXRE4, but does not associate with AHR/ARNT dimers in vitro and does not appear to participate in AHR-mediated regulation of zfCYP1A in cell culture. Thus, it was of interest to determine whether nucleotides flanking XRE5 co ntribute to the lack of function of this sequence in cell culture and in vitro To gain some insight into this question, the sequences of all eight zfXREs as well as the six XREs present in the mouse CYP1A1 were aligned and compared (Fig. 2.14). As previously detailed by Swanson et al. (Swanson et al., 1995) and others, it can be obs erved that all XREs contain the 5’GCGTG core at positions 2 through +3, however, those XR Es with defined activity in vivo also show consensus residues at positions 4, 5, 6 and 8. In contrast, XRE1, XRE2, XRE3, XRE5 and XRE6 as well as mouse XRE C that lack function in vivo do not fit the consensus at residues 6 and 8. Thus, in vitro mutagenesis was used to change T >A at position 6 and T >G at position 8 in XRE5 so that it more resembled XRE4 (termed XRE5 > 4). In addition, the converse changes we re made in XRE4 to convert it to XRE5 (termed XRE4 > 5). To assess whether the changes affected the ability of AHR/ARNT dimers to associate with the sequences in vitro EMSA was utilized. The results in Figure

PAGE 73

63 Figure 2.15. Comparison of Mouse a nd Zebrafish XRE Flanking Regions Fig. 2.15. Comparison of mouse and ze brafish XRE flanking regions. Core XREs and flanking sequences fr om zebrafish CYP1A (XREs: 1–8) and mouse CYP1A1 (XREs: A–F) were aligned. Shaded region indicates conserved nucleotides. Nucleotide positions are numbered below and ability of the XRE to bind in vitro or function in cell culture is indicated to the right, Y: yes, N: no. Nucleotides in non-functiona l XREs which diverge from conserved bases are circled.

PAGE 74

64 2.15A confirm that XRE5 does not associat e with AHR/ARNT dimers with the same efficiency as zfXRE4 and the XRE4 > 5 muta tions at positions 6 and 8 do not appear to affect binding in vitro In contrast, when the binding of XRE5 > 4 is compared to that of XRE5, there is an approximate 50% increase in association with AHR/ARNT. It was next pertinent to determine whether the various nucleotide changes results in increased or decreased ability to drive luciferase e xpression in cell culture. Thus, the various constructs were introduced into Hepa-1 cells and the overall le vel of TCDD-induced luciferase activity compared. Interestingly, mutation of XRE4 > 5 slightly reduced the level of luciferase induction in comparison to p-2608/ 2100Ur( 78), but the level of change was not significant over several expe riments. (Fig. 2.15B) Likewise, mutation of XRE5 > 4, resulted in a slight elevation of the luciferase activ ity and overall level of fold induction, but the elevation was never sign ificant. Thus, the XRE5 > 4 mutation functions like the XRE8, in that it can associate with AHRARNT dimers in vitro but does not appear to support higher levels of TCDD-mediated induction of luciferase in the absence of other XREs. Collectively these resu lts suggest that nucleotides within the 3’flanking sequence of the core XRE can influence associa tion of AHRARNT in vitro but changes in culture may be too subtle to detect. The role of nucleotides flanking the co re XRE motif in binding of AHR/ARNT dimers has been evaluated by a number of labs (Shen and Whitlock, 1992; Swanson et al., 1995). For example, Swanson et al. (Swans on et al., 1995) have shown that binding in vitro does not occur when a G is located at position 4. In addition, Shen and Whitlock (Shen and Whitlock, 1992) have shown that an A or C must be present at position 4 and a

PAGE 75

65 Figure 2.16. Effect of Mutating Nu cleotides Flanking XREs on AHR/ARNT Binding In Vitro Fig. 2.16. Effect of mutating nucleotides flanking XREs on AHR/ARNT binding in vitro (A) EMSA autoradiograph shows the ability of in vitro translated zebrafish AHR2 and rainbow trout ARNTb to bind synthetic double-stranded oli gonucleotides containing zebrafish XRE4 (4), zebrafish XRE5 (5), XRE4 with mutations at positions 6 and 8 (4 > 5), or XRE5 with mutations at positions 6 and 8 (5 > 4). Arrow indicates the AHRARNTDNA comple x. (B) The indicated plasmids were transfected into Hepa-1 cells and treated with TCDD (2 nM) or DMSO (0.05%) for 15 h. Luciferase activity was measured using a Turner Instruments luminometer and -galactosidase activity was determined by spectrophotometry (OD 420). The normalized relative luciferase units are shown for the indicated plasmids. Open bars represent control treated cells while black bars indicate TCDD treated cells. Each bar = meanS.E. from three independent samples. The number in parentheses indicates the fold-change for TCDD samples compared to DMSO treated controls. a. Statistically different from p2608/ 2100Ur ( p < .001).

PAGE 76

66 G or C must be present at position 5 for func tion in cell culture. These investigators also suggested that a G abolis hes function at position 6 (Shen and Whitlock, 1992). These rules partially explain why a number of the putative zfXREs are non-functional, as zfXREs 1,2, 3, and 6, have T or G at position 4, and all have a T at position 6 (as does the non-functional mouse XRE C). However, XRE5 is also non-functional yet matches the consensus at positions 4 and 5. Importantly, when the residues at positions 6 and 8 were changed to those found in the functional XR E4, there was a signifi cant increase in the binding to AHR/ARNT dimers in vitro although the binding di d not reach the level associated with wild type XRE4. (Fig 2.15A) However, when these same mutations were made at XRE5 in the p-2608/ 2100Ur reporter construct, th ere was a slight, but not significant elevation in TCDD-mediated induc tion of luciferase activity compared to controls. (Fig. 2.15B) Thus, it app ears that bases at positions 6 and 8 may play a role in DNA binding in vitro but the changes do not support func tion in the model system used to assess activity. This hypothe sis is supported by the correl ate studies that changed the bases at positions 6 and 8 in the functional XRE4 so they mimicked those of XRE5. In this case, the changes did not affect either the in vitro binding or activation in cells. Indeed, others have suggested that function is abolished when an A is located at position 5 (Shen and Whitlock, 1992), however, zeb rafish XRE4 binds AHR/ARNT and is functional yet has an A at position 5. Thus, to truly assess the f unction of individual XREs, it will be necessary to determine bindi ng to specific sites at the endogenous gene.

PAGE 77

67 Identification of additional cis -regulatory regions which impact the induction of zfCYP1A Since not all of the putative XREs in the zfCYP1A regulatory region were functional and since the pattern of expression varied in di fferent cell lines, it was of interest to determine whether additional cis-regulatory regions were involved in the TCDD-mediated induction of the CYP1 A gene. Analysis of the zfCYP1A enhancer by Transcription Element Search Software (TESS) revealed an extensive list of putative binding sites within the distal 500 bp enhancer region which contains XREs 4-8. To pare down the number of sites to a more manageable list, TESS was used to evaluate the mouse CYP1A1 enhancer and identify common s ites that shared similar relative positions within the enhancers of both ge nes. A summary of sites id entified is shown in Figure 2.16. To begin to assess the function of the various sites, in vitro mutagenesis was used to modify an Sp1 site located at 2474, HNF-3 sites located next to XRE7 and XRE5, an AP2 site, and a CREB site. Each site wa s mutated within the wild type p-2608/ 2100Ur construct and evaluated for TCDD-inducible activity in the Hepa-1 cell line. Interestingly, mutation of the AP2, Sp1 and proximal HNF3 sites di d not cause a change in either the magnitude or level of induction (F ig. 2.17). In contrast, mutation of the putative CREB binding site caused a modest reduction in the both the basal and TCDDinduced luciferase activity. Similarly, muta tion of the HNF-3 binding site located at position 2547 caused an even more dramatic reduction in both the basal and TCDDinduced luciferase activity that was reduced 10-fold below the level of the p-580/+71 construct. This finding is intriguing as it sugg ests that the removal of the site acts to

PAGE 78

68 Figure 2.17. Putative Transcription Fact or Binding Sites Within the zfCYP1A Regulatory Region That Are Common to Both Mouse and Zebrafish Fig. 2.17. Putative transcription factor binding sites within the zfCYP1A regulatory region that are common to both mouse and zebrafish. Putative transcription factor binding sites identified by TESS within the zfCYP1A enhancer that are common to both mouse and zebrafish. Specific binding regions are boxed and labeled. Binding sites that we re targeted for mutagenesis studies are double boxed.

PAGE 79

69 Figure 2.18. Analysis of cis -regulatory Elements Within the zfCYP1A Enhancer Fig. 2.18. Analysis of cis -regulatory elements within the zfCYP1A enhancer. The indicated plasmids were transfected in to Hepa-1 cells and treated with TCDD (2 nM) or DMSO (0.05%) for 15 h. Luciferase activity was measured using a Turner Instruments luminometer and -galactosidase activity was determined by spectrophotometry (OD 420). Open bars repr esent control treated cells while black bars indicate TCDD treated cells. *Bar is statistically different from p2608/ 2100Ur. The transcription factor denoted in the construct name indicates that the specific transcription fact or binding site has been mutated in that construct. – HNF-3(5) and –HNF-3(7) indicates HNF-3 binding sites flanking XRE 5 and XRE 7, respectively. The fold induction is s hown in the graph on the right and was determined by dividing the normalized RLU of samples treated with TCDD by the normalized RLU of control treated samp les. *Statistically different from p2608/ 2100Ur ( p < .001).

PAGE 80

70 repress the overall activity of the construc t. Indeed, HNF-3 has been implicated in chromatin remodeling functions (Roux et al ., 1995), nucleosome positioning (Shim et al., 1998), and has a supportive role in xenobiot ic-mediated transcriptional regulation (Bombail et al., 2004; RodriguezAntona et al., 2003). It is quite possible that in the absence of protein binding to this site, th e nucleosome is shifted toward the promoter and thereby blocks access of the transcripti onal machinery from assembling. Another possibility is that mutation of this site causes a bendi ng of the DNA such that the enhancer itself contacts the promoter bl ocking both assembly of transcriptional machinery as well as AHR/ARNT from accessing the XREs. Furthermore, HNF-3 has been shown to work cooperatively with C/ EBP (Christoffels et al., 1998) and NF1/CTF (Jackson et al., 1993) in regul ating the carbamolyphosphate s ynthetase I (CPS) and serum albumin genes, respectively. Since both C/EBP and NF1/CTF binding sites can be found in the zfCYP1A promoter/enhancer as determined by in silico analysis, it is interesting to speculate that such cooperative interactions with HNF-3 occur in this system as well. To determine what effect the HNF-3 mutation had on a construct containing the full-length zfCYP1A regulatory region, the p-2608/+71 (-HNF-3(7)) constr uct in which the PCR amplified region between -2100 and -2608 from p-2608/-2100Ur(-HNF-3(7)) was used to replace the same region of th e p-2699/+71 construct wa s transfected into Hepa-1 cells and evaluated for luciferase activ ity. The results in Figure 2.18 indicate that contrary to the mutation in the p-2608/-2100U r construct which resulted in ablation of both basal and inducible activity, the mutation in the p-2608 /+71 construct resulted in a 6 and 8-fold increase in basal and inducible activity, respectively. The overall foldinduction between p-2608/+71 and p-2608/+71 (-HNF-3(7)), however was consistent.

PAGE 81

71 Figure 2.19. Effect of HNF-3 Mutation on the Full-length p-2699/+71 Construct Fig. 2.19. Efect of HNF-3 mutation on th e full-length p-2699/+71 construct. The indicated plasmids were transfected into Hepa-1 cells and treated with TCDD (2 nM) or DMSO (0.05%) for 15 h. Luci ferase activity was measured using a Turner Instruments luminometer and -galactosidase activity was determined by spectrophotometry (OD 420). Open bars re present control treated cells while black bars indicate TCDD treated cells. Each bar = meanS.E. from three independent samples. The fold indu ction was determined by dividing the normalized RLU of samples treated with TCDD by the normalized RLU of control treated samples.

PAGE 82

72 This data supports a role fo r HNF-3 in maintaining the pos ition of the nucleosome as, if the loss of the site in the context of p-2608/-2100Ur results in a shifting of the nucleosome 3’-ward such that it blocks assembly at the promoter then the loss of the site in the full-length construct may shift the nucleosome into the 1.7kb AT-rich region which lacks any transcription factor binding sites. Positioning of the nucleosome within this region may open up the upstream enhancer re gion leading to the enhanced activity observed. While the mechanisms behind the obse rvations at this site are unclear, the results clearly suggest that bi nding of AHR/ARNT alone is like ly not sufficient to obtain a full transcriptional response and other bind ing proteins are required. This may explain the large differences in overall level of lucife rase induction of the va rious reporters in the different cell lines and the need to assess gene regulation in the proper cellular context. Future studies should be designed to asse ss the binding of additional factors to the CYP1A enhancer in genomic DNA. The la rge distance between the enhancer and promoter regions of the zebrafish CYP1A gene make this ideal for procedures such as in vivo footprinting and ChIP analyses as bindi ng at the two regions should be easily differentiated. It is anticipated that the future analysis of the zfCYP1A gene will provide significant informa tion on how the AHR mediates gene regulation in both aquatic and mammalian organisms.

PAGE 83

73 Chapter 3 Discussion of Impact, Relevance, and Future Direction The data presented herein confirms the isolation of the upstream regulatory region for a dioxin-inducible CYP1A gene in zebra fish. The identified region, which was sequenced approximately 2.8 kb upstream of the transcriptional start site, contains eight XREs and several other elements indicat ive of previously characterized CYP1A regulatory regions including a TATA box positi oned at -31. Sequence analysis revealed that the XREs were organized into two distin ct clusters. The proximal cluster of XREs (XREs 1-3) was incapable of conveying TC DD-mediated induction to a luciferase reporter gene while the distal cluster, containing XREs 4-8, enhanced luciferase expression in the presence of dioxin more than 20 fold. As determined by electrophoretic mobility shift assays, only a sub-set of the eight XREs were capable of binding AHR/ARNT in vitro Surprisingly, XRE1 and XRE3 were bound by AHR/ARNT in vitro in a TCDD-dependent fashion despite their in ability to drive luciferase expression in cell culture. The reason for the lack of f unction exhibited by these XREs is currently unclear. Considering the region between 580 and -187 containing XREs 1-3 failed to convey induction when cloned immediately ups tream of an SV-40 promoter or in the context of its native promoter, it is unlikely th at the lack of functionality is promoter specific. Additionally, when the region containing XREs 4-8 was cloned in the same

PAGE 84

74 position upstream of an SV-40 promoter, it was capable of conveying si gnificant levels of induction indicating that the distance from the promoter is also not responsible the inability of XRE1 and 3 to f unction. It is possible that XREs 1 and 3 are capable of binding protein in vitro but fail to function in cell cult ure due to chromatin condensation causing inaccessibility of the bi nding sites. To assess this possibility, tandem repeats of XRE1 or XRE3 along with several flanking nucleotides could be cloned upstream of a luciferase cassette driven by an SV-40 promoter and analyzed for TCDD-mediated luciferase induction. In such a scenario, the absence of additional native DNA which may recruit histones or influence the struct ure of the DNA will allow for the assessment of the XRE alone to enhance transcripti on. Others have characterized the mouse CYP1A1 XREs and found that XREC was also capable of binding AHR/ARNT in vitro but failed to function in vivo (Lusska et al., 1993). In th ese studies, tandem repeats of each of the six XREs were placed upst ream of an MMTV promoter controlled chloramphenicol acyltransferase cassette and even in such a context, XREC still failed to drive CAT expression. This suggests that in the mouse, chromatin inhibition of the XRE is likely not responsible for the lack of function. Another possibility for the failure of the XREs to contribute to gene induction may lay in the nucleotides flanking the core XRE sequence. Previous experiments have shown that an A is required at position 6 (Fig. 2.14) for XRE function in the mouse but not for in vitro binding (Lusska et al., 1993; Shen and Whitlock, 1992). These results would help explain the lack of function of XRE1 and XREC, but not XRE3 which contains an A at that position. It is important to note however that XREs 1 and 3 also diverg e from the consensus suggested in Figure 2.14 at positions 4 and 8 as well. Although it has been previously shown through the use

PAGE 85

75 of ligation mediated PCR that the AHR/ARN T complex likely only interacts with three or four guanine residues within the co re XRE sequence, (Wu and Whitlock, 1993) flanking nucleotides may affect the ability or degree to which the DNA bends or may reinforce the stability of the bound AHR/ARN T complex and recruited cofactors. Utilizing in vitro mutagenesis to alter the nucleotides at positions 4, 6, and 8 in XRE 1 and XRE3 within the p-580/+71 construct could shed light on the importance of these flanking nucleotides on XRE f unctionality. Furthermore, in vivo footprinting and ligation mediated PCR should be performed on th e zebrafish CYP1A regulatory region to determine whether or not protein inter acts with the XREs in intact cells. Nucleotides flanking the core XR E may also be implicated in the inability of XREs 5 and 6 to bind AHR/ARNT in vitro or function in vivo Inaccessibility of the XREs due to chromatin structure is unlikely in the case of XREs 5 a nd 6 since it has been previously established th at AHR/ARNT binding at an XRE results in chromatin relaxation spanning approximately 200 bases around the XRE (Okino and Whitlock, 1995). Knowing that activated AHR likely bi nds to both XRE4 and XRE7, XREs 5 and 6 should be free of any chromatin related constraints in the presence of TCDD. Chromatin interference can further be rule d out by the fact that AHR/ARNT does not bind double stranded oligonucleotides containing XREs 5 and 6 in vitro Failure to bind in vitro using in vitro translated AHR and ARNT also s uggests that inhibition is not being caused by competition or hindrances from additional proteins binding nearby the XRE. The observations stated above suggest th at any constraints set upon AHR/ARNT-XRE interactions exist within the DNA sequence itself. Like XREs 1 and 3, mentioned

PAGE 86

76 previously, XREs 5 and 6 both possess a T at position 6 (Fig. 2.14). A T at this position, however, has been implicated in loss of XR E function but has not been shown to affect protein binding (Lusska et al ., 1993). The alignment in Figure 2.14 shows that XRE6 also diverges from functional XREs at positi ons 4, 5, and 8 while XRE5 diverges only at positions 6 and 8. Experiments described previously in this work suggest that mutations of nucleotides at positions 6 and 8 can e nhance the ability of XRE5 to bind protein in vitro however the enhanced bindi ng was not to the level obs erved by functional XREs. Furthermore, the reverse mutations made to th e functional XRE4 did not appear to affect the level of binding observed in EMSA. Thes e findings suggest that additional flanking nucleotides may be involved in protein binding and is supported by the fact that statistically significant changes in luciferase activity were not observed when the same mutations were made in reporter construc ts. Swanson et al. have previously characterized XRE flanking nucleotides but their studies only examined in vitro interactions using synthetically generated oligonucleotides (Swanson et al., 1995). Wu and Whitlock have also characterized the role of flanking nucleotides in mouse XREs but their studies did not examine nucleotides extending beyond four bases around the core XRE (Wu and Whitlock, 1993). Utilizing a co mbination of synthetically generated double stranded oligonucleotides for EMSA and in vitro mutagenesis to alter flanking nucleotides of XRE5 alone and in combina tion until they are identical to a functional XRE may shed light on the precise nucleoti de combination required for a functional XRE. Species specificity could likewise be tested by performing the same experiments on mouse CYP1A1 XREs and by using m ouse AHR and mouse ARNT1 in EMSA experiments. Determination of specific nuc leotide sequences requi red for AHR function

PAGE 87

77 in transcriptional regulation could be greatly beneficial in the search for novel AHR target genes which contain bona fide, functional XREs within th eir regulatory regions. It is also of interest to note that the XRE5 exhibits weak binding to AHR/ARNT in EMSA experiments after prolonged exposur e. Characterization of the mouse CYP1B1 promoter has previously revealed that th ree of the five XREs located therein bound a non-AHR/ARNT complex which ran identically to AHR/ARNT on EMSA (Zhang et al., 1998a). These XREs diverged from AHR/A RNT binding XREs within the same region only at positions 6 and 7. While XRE5 in the zfCYP1A regulatory region does not share the same nucleotide sequence at these two positi ons, it would be of interest to repeat the EMSA of XRE5 with anti-AHR antibodies to ensure that the observed binding is indeed AHR/ARNT and not another protein pr esent in the reticulocyte. XRE4, XRE7, and XRE8 were capable of both binding in vitro and functioning to induce luciferase in TCDD treated cells transfect ed with luciferase reporter constructs. While all three of these XREs appear to be necessary for maximal induction, their contributions do not appear to be equal. When luciferase reporter a ssays were carried out using p-2608/-2100Ur constructs bearing mutations at each of the individual XREs, it was observed that the loss of XRE4 resulted in an appr oximately 50% reduction in activity compared to the non-mu tated control while loss of XRE7 yielded a 70% loss of activity and the mutation of XRE8 only decr eased activity by approxi mately 30%. These findings are contrary to previous studies wh ich suggested that each of the mouse XREs contribute equally to maximal induction (Fishe r et al., 1990). Late r studies by Lusska et al. showed that when duplicate copies of each of the six mouse XREs, A-F, were placed

PAGE 88

78 upstream of an MMTV promoter driven CAT reporter, XREC failed to respond to TCDD and XREA exhibited a considerable reduction in responsiveness compared to XREs B, D, E, and F (Lusska et al., 1993). Unfortuna tely, the experiments utilized by the investigators in these studies did not consider the enhancer elements within their native environment nor did they ev aluate cooperation between the XREs. Mutations of individual mouse XREs in the context of the full-length mouse CYP1A1 regulatory region have not been made, thus it is unknown what contributions mouse XREA and XREC make toward maximal induction of that ge ne. The results presented in this report, however, show that in the absence of a dditional functional XREs, XREs 4 and 7 can contribute 25-30% of the induced activity observed in the non-mutated p-2608/-2100Ur while XRE8 is incapable of functioning alone. This is the first time it has been shown that an XRE regulating a cytochrome P-450 wa s required for maximal gene induction but incapable of functioning in the absence of additional functional XREs. The reasons behind this observation are curre ntly unknown. It is possible that the sequence flanking the XRE is responsible for the inability of XRE8 to function alone although this is unlikely due to the fact that XRE only dive rges from XRE7 at positions 4, 7, and 8. The nucleotides found at these three positions within XRE8 are also found at the same positions in other functional mouse and zebrafish XREs. It is additionally possible that XRE8 is inaccessible to AHR/ARNT due to the presence of chromatin prior to chromatin relaxation caused by AHR/ARNT binding at XRE4 or XRE7. In order to test these hypotheses, duplicate copies of XRE8 should be cloned upstream of an SV-40 or MMTV promoter driven luciferase promoter and assayed for TCDD-mediated induction. Additional inhibitory factors su ch as chromatin should not be present in such a construct

PAGE 89

79 and if the XRE sequence is sufficient to regulate transcriptional activity, TCDD should mediate induction of the reporter. Alternatel y, mutation of the nucleotides at positions 4, 7, and 8 within XRE8 in the context of p2608/-2100Ur(-47) such that they are identical to XRE7 should shed light on the importan ce of nucleotide specificity. The converse mutations should also be made to XRE7 in the context of p-2608/-2100Ur(-48). If sequence is important, the XRE7 mutant s hould lose functionality while XRE8 should gain the ability to function alone. Finall y, analysis of the p2608/-2100Ur XRE mutants should be revisited in Hepa-1 cells treated wi th a histone deacetylas e inhibitor such as trichostatin-A. These studies should lessen or eliminate any inhibition chromatin has on the ability of AHR/ARNT to bind XREs within the reporte r constructs. Another observation made th roughout the course of th ese studies is that XRE reporter constructs behave differently in different cell lines. When various reporter constructs containing regulatory regions from zebrafish CYP1A and mouse CYP1A1 were transfected into various cell lines from different sp ecies and tissues, a distinct pattern of transcriptional re gulation was observed. For instance, when the zebrafish p2727/+71 construct was transfected into the human A498 kidney cell line it yielded approximately 20-fold induction when treate d with TCDD. By comparison the mouse 1647/+57 construct yielded less than 10-fold induction under the same conditions. Surprisingly however, in the C2C12 mouse my oblast cell line, tran sfection of p-2727/+71 led to only an approximately 10-fold induc tion of reporter while a 60-fold induction was observed in cells transfected with the mouse p-1647/+57. This overall trend was observed in several cell lines with the zebrafi sh constructs yieldi ng considerably higher

PAGE 90

80 levels of induction in the Hepa-1, A498, and B19 cells while the mouse constructs were favored in the C2C12, TCM, HepG2 and hR PE cell lines. The reasons behind this observation are unclear, however it does not appear to correlate with the AHR allele, the species or tissue of origin, or the presence or absence of ARNT2. Importantly, the data suggests that the differences observed may be dependent upon the proximal promoter. Each of the cell lines were also transfect ed with the pMm-1315/-819Uf construct which contains the indicated mouse CYP1A1 enha ncer region immediat ely upstream of the zebrafish CYP1A promoter region, -580/+71. In the Hepa-1, B19, and A498 cells which appear to favor the zebrafish full-lengt h construct over the mouse, pMm-1315/-819Uf yielded approximately 20% less induction than the full length mouse, p-1647/+57, in the same cell lines. These results are expected considering the full-length mouse construct contains two additional functional XREs not present between -1315 and -819 which should result in a 20% reduction if all 5 XREs contribute equa lly as reported previously. (Fisher et al., 1990) In the cell lines which appear to favor the mouse constructs, however, pMm-1315/819Uf exhibits >50% re duced fold-induction compared to p1647/+57. This difference is most noticeabl e in the C2C12 and HepG2 cell lines which exhibit greater overall levels of activity. To better unders tand the role the proximal promoter plays in these observed differences, additional constructs should be made which contain the zebrafish -2608/-2100 enhancer region immediately upstream of the mouse proximal promoter region and the mouse enhancer region between -1315 and -819 upstream of the mouse proximal promoter. A comparison of the luciferase activity exhibited by these constructs as well as p-2608/-2100Ur and pMm-1315/-819Uf should confirm the importance of the promoter regi on in begetting these differences.

PAGE 91

81 The mouse CYP1A1 promoter region has b een previously characterized by others (Jones and Whitlock, 1990). The results of these studies revealed that the mouse proximal promoter region contains a TATA box located at pos ition -30, two CTF/NF1like sites located at positions -59 and -136, and a G-box located at position -130. Mutation analyses showed that loss of eith er the TATA-box or th e proximal CTF/NF1 sequence resulted in an 80% decrease in pr omoter function. Additionally, simultaneous loss of the distal CTF/NF1 site and the Gbox resulted in a 50% decrease of promoter function while individual mutations of these el ements had little or no effect. Truncation experiments also suggest that there may ex ist inhibitory elements located between positions -419 and -246. Transcription Element Search Software (TESS) was used to identify putative transcription factor bindi ng sites within the zebrafish CYP1A proximal promoter region. A TATA-box was identified at position-31 along with several pertinent sites including putative CTF/NF1 sites, G-boxes and Sp1 sites. A proximal CTF/NF1 site was identified by TESS at position -54 and it is likely that the zeb rafish promoter is similar to the mouse CYP1A1 promoter and al so contains a distal CTF/NF1 site and a Gbox which are required for maximal promoter function. Luciferase reporter vectors containing successive truncations of the zebra fish proximal promoter suggest that two distal CTF/NF1 sites and two distal Sp1-like sites may be important for the transcriptional activity of th e downstream gene. Additi onally, the data suggests that another element lies between bases -398 and -206 which is also required for full promoter activity. TESS identified a putative ER binding site at posi tion -330 and a putative HNF-3 binding site at position -225 both of which have previ ously been implicated in the

PAGE 92

82 transcriptional regulation of cytochrome containing xenobiotic metabolism enzymes (Bombail et al., 2004; Gibson et al., 2002; Matt hews et al., 2005; Rodriguez-Antona et al., 2003). Finally, the data suggests that an inhibitory element may exist between bases 439 and -411. An Sp1 site was identified ove rlapping a USF1 site within this region by in silico analysis and may have a role in tran scriptional inhibiti on of the gene. Overall, the zebrafish CYP1A proximal promoter greatly resembles the previously characterized mouse CYP1A1 promot er. Many additional studies still need to be performed to better charac terize this region, however. In vitro mutagenesis needs to be utilized to mutate target binding sites within the prom oter region both alone and in combination to assess the function of the site s since truncation analys es alter the physical characteristics of the DNA and cannot, therefore, be reliable. Muta tions should also be carried out in the context of p-2608/-2100Ur and assayed in TCDD treated cells to obtain greater levels of overall activity and thus, mo re substantial differences between mutants and control samples. EMSA should be perfor med to identify the ability of the pertinent elements to bind protein in whole cell lysa tes and nuclear extracts from both DMSO and TCDD treated cells. It is possible that th e different patterns of regulation observed between the constructs containing mouse and zebrafish elements is due to differential binding to elements within the proximal promoter s. In order to assess this, EMSA can be performed using oligonucleotides containi ng elements of interest from both mouse CYP1A1 and zebrafish CYP1A and nuclear ex tracts from each of the seven cell lines used previously to determine differences in relative protein/DNA binding affinities between the cell lines. DNAse in vitro footprinting should be performed as well using

PAGE 93

83 nuclear extracts from the seven ce ll lines of interest to further characterize differences in protein binding at the two promoters. In vivo footprinting and LMPCR should ideally be performed in ZFL cells to confirm protein binding at the zfCYP1A promoter in intact cells. TESS was also used to identify putative transcription factor binding sites which were common between the mouse CYP1A1 and zebrafish CYP1A distal enhancers. In vitro mutagenesis of selected sites within p-2608/-2100Ur and subsequent luciferase assays identified both a CREB and HNF-3 sites which were important to the transcriptional activity of the downstream gene. Previously, no additional proteins have been implicated in binding at the enhancer other than AHR/ARNT and Sp1 (Fisher et al., 1990) however mutation of the CREB binding site results in modest reductions of both basal and induced reporter ac tivity. Even more surprising was the finding that mutation of an HNF-3 site located at position -2547 completely abla tes both basal and inducible transcriptional activity. This finding suggests that loss of the putative HNF-3 site somehow inhibits the assembly of the transc riptional machinery at the promoter in the presence or absence of TCDD. To investigat e the role of the site in more detail, the mutation of the HNF-3 site was assessed in the context of the full-length, p-2608/+71 construct. Unexpectedly, mutation of the HNF -3 site in this construct resulted in a significant 6-fold increase in both basal and i nduced activity while onl y slightly elevating the overall fold induction. The conflicting re sults obtained from the experiments using the two different constructs led to the fo rmulation of a hypothesis that HNF-3, or an HNF-3-like protein is responsible for the positioning of a nucleosome at the CYP1A

PAGE 94

84 enhancer. In such a scenario, it can be envi sioned that the nucleosome is shifted 3’-ward such that in the case of p-2608/-2100Ur, the nuc leosome blocks assembly at the promoter while in p-2608/+71, the nucleosome is shif ted into the 1 kb AT -rich region located between the proximal promoter and the enhancer region, openi ng up enhancer and leading to super-indu ction. Indeed, HNF-3 has been implicated by others in the positioning of the nucleosome (Shim et al., 1998) and in chromatin remodeling, (Roux et al., 1995) supporting this hypothesi s. Fascinatingly, two sim ilar binding motifs can be found in the mouse CYP1A1 regul atory region; both of which exist centrally within 200 bp spans known to undertake a nucleosomal configuration. HNF-3 is known to bind nucleosomal DNA (Shim et al., 1998) and this may explain why these sites may have been protected from DNaseI digestion in f ootprints of the mouse CYP1A1 promoter and enhancer regions (Okino and Whitlock, 1995; Sh en and Whitlock, 1992). To test this hypothesis, reporter assays using p-2608/-2100Ur and p-2608/+71 HNF-3 mutants should be repeated in cells treated with a chromatin inhibitor such as Tr ichostatin A. If the nucleosome is responsible for the effects obs erved in HNF-3 mutants then Trichostatin-A treatment should reduce or eliminate the inhibition observed in p-2608/-2100Ur HNF-3 mutants while super-induction should be observed in the non-mutated p-2608/+71. Additionally, EMSA using oligonucleotides c ontaining the putative HNF-3 binding site and Hepa-1 nuclear extracts could be utilized to conf irm binding at the site in vitro while super-shifting with an tibodies against HNF-3 could confirm that is the protein responsible for binding the element. These experiments may not be successful, however, since the forkhead region of HNF-3 interacts directly with histones which would be

PAGE 95

85 absent in an EMSA. In vivo footprinting could also be uti lized to detect the nucleosome in ZFL cells treated with control or HNF-3 siRNA. Overall, the structure and function of the zebrafish CYP1A regulatory region appears to be similar to that which has b een reported for other piscine and mammalian CYP1As. Several novel findings have been id entified for this model organism, however. Within this report, it has been shown that th ere exists an inequality of the contribution toward maximal induction exhibited by the func tional XREs within this regulatory region which contradicts what has been previously established in the m ouse. Furthermore, previous studies have not identified an XRE which is required for maximal induction yet which fails to function in the absence of a dditional functional XREs as was observed for the zebrafish XRE8. These findings are si gnificant in that they support a better understanding of the mechanisms of AHR /ARNT-XRE binding and subsequent gene regulation. Also within this report, it has been established that the degree of regulation mediated by CYP1A regulatory regions from di fferent organisms is inconsistent between cell lines. The data suggests that these inc onsistencies may be due, at least in part, to selective binding of proteins at the promoter This novel finding may help elucidate how AHR target genes are differentially expre ssed in various tissues and organisms; especially as pertains to the application of findings obtained using cell culture and model organisms to human health. Finally, a putativ e HNF-3 binding site was identified within the zebrafish CYP1A enhancer region which may have a role in nucleosome positioning based on mutational analyses. Chromatin re organization is a fundamental aspect of CYP1A regulation and an understanding the molecular mechanisms of nucleosome

PAGE 96

86 arrangement in this regulatory region is esse ntial to discerning the AHR-mediated control of this gene. The characterization of the zebrafish CY P1A regulatory region was an important step toward using Danio as a model organism for the study of AHR-mediated signaling and TCDD-toxicity. Apart from the numer ous benefits this organism offers for developmental studies, the zebrafish CYP1A ge ne may be useful for future studies of AHR-mediated regulation of target genes. Importantly, the distance between the promoter and enhancer regions in zebrafish CYP1A is fa r greater than observed in previously characterized organisms, thus ma king it ideal for procedures such as ChIP assays in that binding can be easily differentiated between the two regions. Additionally, the zebrafish can be used as a bio-detector of environmental pollutants such as TCDD by the creation of transgenic fish which can pr oduce a fluorescent signal in the presence of such chemicals at a dose dangerous to human health. Such methods would be far more accurate and reliable than bio-chemical testi ng which is often inaccurate and incapable of knowing precisely the doses which may pose a threat to human health.

PAGE 97

87 Chapter 4 Materials and Methods Materials TCDD (98% stated chemical purity) was obtai ned from Radian Corp. (Austin, TX) or Cambridge Isotope Laboratori es and was solubilized in dimethylsulfoxide (DMSO). Buffers PBS is 0.8% NaCl, 0.02% KCl, 0.14% Na 2HPO4, 0.02% KH2PO4, pH 7.4. Lysis buffer is 60 mM Tris, pH 6.8, 2% SDS, 15% gl ycerol, 2 mM EDTA, 5 mM EGTA, 10 mM DTT, 5% NP-40, 20 mM sodium molybdate 0.005% bromphenol blue. TBS is 50 mM Tris, 150 mM NaCl, pH 7.5. TTBS is 50 mM Tris, 0.2% Tween 20, 150 mM NaCl, pH 7.5. TTBS_ is 50 mM Tris, 0.5% Tween 20, 300 mM NaCl, pH 7.5. BLOTTO is 5% dry milk in TTBS. Gel Shift Buffer is 50 mM Hepes, pH 7.5, 15 mM MgCl2, 50% glycerol. Cells and growth conditions Wild-type Hepa-1c1c7 (Hepa-1), were a generous gift from Dr. James Whitlock, Jr. (Department of Pharmacology, Stanford Univ ersity). These cells were propagated in DMEM supplemented with 10% fetal bovine se rum (FBS). Stable cell lines expressing the Ahb-2 AHR in the Hepa-1 background (B19) were propagated as detailed previously

PAGE 98

88 (Pollenz and Dougherty, 2005). ZFL cells were obtained from ATCC (Manassas, VA) and propagated in a 0.5/0.35/0.15 mixture of L15:DMEM:Ham-F12 supplemented with bovine insulin (10 mg/L), EGF (20 g/L) and heat-inactivated FBS (5%) at 28 C. Human HepG2, human ARPE-19, human A498 cells, m ouse TCM cells and mouse C2C12 cells were purchased from ATCC a nd propagated as detailed by the manufacturer. All cells were passaged at 1-week inte rvals and used in experiment s during a 3-month period at approximately 70% confluence. For treatme nt regimens, TCDD was administered directly into growth media for the indicat ed incubation times. DMSO was used as the vehicle control and the final concentration present in the culture media was between 0.05 and 0.1%. Antibodies Specific antibodies against the zfAHR2 (zf-4) and rtARNTb (rt -84) are identical to those described previously. (Pollenz et al., 1996; Wentworth et al., 2004) All antibodies are affinity-purified IgG fractions. Antibodies specific to the zfARNT2b were purchased from Santa Cruz (Santa Cruz, CA). For West ern blot analysis, goat-anti-rabbit antibodies conjugated to horseradish peroxidase ( GAR-HRP) or rabbit an ti-goat antibodies conjugated to horseradish peroxidase (RAG-HRP) were utilized (Jackson Immunoresearch, West Grove, PA).

PAGE 99

89 Isolation of PAC clones c ontaining the zfCYP1A gene Oligonucleotide primers: zfCYP1A1-UTR-upstream: 5’ CTGGAAAGTATCCACTCGATCG3’ zFCYP1A1-ORF-downstream: 5’CCAGGACATTTCCGATAATCGG3’ were generated to the 5’UTR and ORF of the putative zfCYP1A mRNA (GenBank accession #BC094977). These primers were use to screen superpools of zebrafish genomic PACs, (Amemiya and Zon, 1999) by PCR. Two superpools displayed positive PCR products when visualized on a 2% agarose gel. The PAC 133 and 150 were then robotically dotted onto nitroc ellulose filters and screened by colony hybridization using the 312 bp zfCYP1A1 cDNA fragment. One positive clone was isolated from each of the two superpools and termed #133 and #150. Sout hern blotting was used to identify fragments corresponding to the CYP1A gene, and these were subcloned into pBluescript SK(Stratagene, Madison, W I) and sequenced. Sequence analysis and alignments were carried out using Lasergene so ftware (DNAStar, Madison, W I). Analysis of regulatory elements was carried out using Transcripti on Element Search Software (TESS) freeware available through the University of Pennsyl vania (http://www.cbil .upenn.edu/ tess). The sequence of the putative zfCYP1A promoter region (-2710 65) that includes a portion of the 5’UTR and the splice site for intron 1 has been entered into GenBank (Accession# DQ182546).

PAGE 100

90 Generation of reporter constructs and site-directed mutagenesis PCR was used to amplify the indicated regions of the zfCYP1A promoter/enhancer from subcloned SpeI fragment of PAC #150. The PCR fr agments were then ligated into pGL3promoter (Promega), to gene rate p-2608/-2100Fup, p-2608/-2100Rup, p-2608/2100Fdown, p-2608/-2100Rdown, p-580/-187Fup, and p-580/-187F or ligated into pGL3Basic (Promega) to generate p-580/ +71Basic, p-2608/-2100Uf, p-2608/-2100Ur,or p-2727/-2100Ur. Orientation was determined by restriction analysis. To generate constructs containing the fulllength promoter/enhancer, the 12kb SpeI fragment was digested with SacI to yield a 2.7 kb fragment containing all of the previously examined XREs but terminating at 42 and missing the TATA box and tr anscriptional start site. To deal with this issue, the fragment was ligated into pSK(Stratagene) and then cut out with SacI and KpnI This fragment was ligated into the SacI and KpnI sites of p-2727/ 2100Ur that had been cut to remove all but the +71 to 42 portion of the 2727/ 2100Ur fragment. The full-length promoter/enhan cer construct was termed p-2699/+71. The reporter vector containing the full promoter region from the mouse and the full promoter region from rainbow trout (p-1897Om1A3luc) were generous gifts from Dr. Michael Carvan (University of Wisconsin—Milwaukee) (Carvan et al., 1999). To generate Om1897/-1392Uf, Om-1897/-1392Ur,Mm-1315/819Uf, and Mm-1315/-819Ur, the

PAGE 101

91 indicated regions were amplified by PCR and ligated into pGL3Basic (Promega) upstream of the -580/+71 region of the zfCYP1A Site-directed mutagenesis of specific cis regions of the zfCYP1A was carried out on the appropriate parental vectors using the Quikchange II XL site-directed mutagenesis kit using the manufacturer’s prot ocol (Stratagene). The primer sets used are listed with the specific base changes indicated in bold. XRE1: 5’-CCATGTATGTGTG A GTGTGTTACATAC 5’GTATGTAACACAC T CACACATACATGG. XRE3: 5’-CTCTCATTCACAC T CACACTCATACAC 5’-GTGTATGAGTGTG A GTGTGAATGAGAG. XRE4: 5’-CACACCTTTGCAC T CGATGCTTTACCTGTTGC 5’-GCAACAGGTAAAGCATCG A GTGCAAAGGTGTG. XRE7: 5’-CAGGTGCGCGCAC T CGATGCTGTTTGATC 5’-GATCAAACAGCATCG A GTGCGCGCACCTG. XRE8: 5’-CCTCCTCCAGCTCAC T CAACGTGGCCAATC 5’-GATTGGCCACGTTGAGTG A GCTGGAGGAGG. Sp1: 5’-CTTCCCATAAACC AA CCGCAGAACAAAC 5’-GTTTGTTCTGCGG TT GGTTTATGGGTAG.

PAGE 102

92 HNF-3(7): 5’-GCACGCGATGCTGT GG GATCAGTTTATCGTAGC 5’-GCTACGATAAACTGATC CC ACAGCATCGCGTGC. HNF-3(5): 5’-CGCACGCACA T ACTCTCACAC 5’-GTGTGAGAGT A TGTGCGTGCG. AP2: 5’-CCAATCTTTAACC A GCGCTACAGGTGC 5’-GCACCTGTAGCGC T GGTTAAAGATTGG. CREB: 5’-CGACGGCCACGCGC T T A TACCCCATTCTGC 5’-GCAGAATGGGGTA T A A GCGCGTGGCCGTCG. XRE4(6/8): 5’-CACACACACACAC T T A TGACAGCGATG 5’-CATCGCGTGCA T A A GTGTGTGTGTGTG. XRE5(6): 5’-GCAGCGGTTCACCA T CGCACGCACAC 5’-GTGTGCGTGCG A TGGTGAACCGCTGC. XRE5(8): 5’-GCAGCGGTT C AC C ATCGCACGCACAC 5’-GTGTGCGTGCGAT G GTGAACCGCTGC.

PAGE 103

93 Transfection and reporter assays Approximately 2105 cells were plated into 35mm culture dishes and incubated at 37C for 16–24 h. Transfection cocktails were se t up so that multiple dishes could be transfected with aliquots of the same sample. This was accomplished by mixing the reporter plasmid and pSV-galactosidase in OptiMEM media (Gibco) and then incubating the mixture with either LipofectAMINETM or LipofectAMINE 2000TM (Gibco) as specified by the ma nufacturer. Aliquots were then applied to the appropriate plates and af ter 24 h; the cells were exposed to TCDD or DMSO (0.05%) for 6–16 h. When multiple reporter plasmids were tobe used in an experiment, the concentration of DNA utilized was the same and was verified by OD260 readings as well as agarose gel electrophoresis. Cells were harvested from plates by scraping directly into 200–400 l Reporter Lysis Buffer as specified by the manufacture (Promega). Luciferase activity was measured using identical sample volumes for 30 s in a Turner Instruments luminometer. -Galactosidase activity was measured using the galactosidase assay kit as specified by the manufacturer (Promega). Typically, each data point was evaluated in triplic ate and luciferase values we re normalized by dividing the relative luciferase units (RLU) of each sample by the corresponding level of galactosidase activity (OD420 reading). In mo st experiments, the relative transfection efficiency for all plasmids was similar in a given cell line, although the level of transfection efficiency across cell lines wa s different. Results are presented as normalized luciferase units (raw) as well as fold-change between control and treated samples.

PAGE 104

94 In vitro expression of protein Recombinant protein was produced from zf AHR2, rtARNTb, and zfARNT2b expression plasmids using the TNT™ Coupled Rabbit Reticu locyte Lysate Kit e ssentially as detailed by the manufacturer (Promega). Upon comple tion of the 90 min reaction, samples were either combined with an equal volume of 2X gel sample buffer and boiled for 5 min, or stored at -80C for use in functional st udies. The actual concentration of protein expressed in each reaction is estimated to be 6ng/ L, based on previous studies. In vitro activation of AHR:ARNT complexes and electrophoretic mobility shift assay The following oligonucleotides contai ning the core zfXRE sequences ( bold ) and 5’GG3’ overhangs ( underlined ) were synthesized by ID T (Coralville, IA). zfXRE1: 5’GG TGTAACA CACGCAC ACATAC3’ zfXRE2: 5’GG GGAAACC CACGCCA TGCAAA3’ zfXRE3: 5’GG ATGAGT GTGCGTG TGAATGA3’ zfXRE4: 5’GG TAAAGCA TCGCGTG CAAAGG3’ zfXRE5: 5’GG AGAGTGT GTGCGTG CGTTTG3’ zfXRE6: 5’GG TGTGAAA CACGCTA CGATAA3’ zfXRE7: 5’GG AACAGCA TCGCGTG CGCGCA3’ zfXRE8: 5’GG GGCCACG TTGCGTG AGCTGG3’

PAGE 105

95 Duplex DNA was produced by mixing each ol igonucleotide with its complementary strand, heating to 95C and cooling to 25 C. Duplex DNAs were labeled with [32P]dCTP by Klenow fill in. In vitro binding assays and EMSA were carried out by combining approximately 25 ng of in vitro translated AHR and ARNT protein with 60 L of MENG and incubated for 2 h at 30C in the presence of TCDD (16 nM) or DMSO (0.5%). 14 L of the activated sample was then incubate d at 2C for 15 min in 1X gel shift buffer supplemented with KCl (80 mM) and polydIdC (0.1mg/mL). 4 ng of the labeled zfXRE were added to each sample and incubated an additional 15 min at 22C. The samples were resolved on 5% acrylamide/0.5% TB E gels, dried, and exposed to film. Western blot analysis and quantification of protein Protein samples were resolved by de naturing electrophoresis on discontinuous polyacrylamide slab gels (SDS-PAGE) and electrophoretically transferred to nitrocellulose. Immunochemical staining was car ried out with varyi ng concentrations of primary antibody in BLOTTO buffer supplemen ted with DL-histidine (20 mM) for 1–2 h at 22C. Blots were washed with three cha nges of TTBS+ for a total of 45 min. The blot was then incubated in BLOTTO buffer cont aining a secondary antibody for 1 h at 22C and washed in 3 changes of TTBS+ as above. Bands were visualized with the enhanced chemiluminescence (ECL) kit as specified by the manufacturer (Amersham, Arlington Hts, IL). Multiple exposures of each set of samples were produced. Statistical analysis

PAGE 106

96 Normalized RLU values were compared by ANOVA and Tukey-Kramer multiple comparison tests using InStat software (GraphP ad Software Inc. San Diego, CA). Results are presented as mean SE. A probability value of 0.05 was considered significant.

PAGE 107

97 References Abnet CC, Tanguay RL, Heideman W and Peters on RE (1999) Transactivation activity of human, zebrafish, and rainbow trout ar yl hydrocarbon recept ors expressed in COS-7 cells: greater insight into spec ies differences in toxic potency of polychlorinated dibenzop -dioxin, dibenzofuran, and biphenyl congeners. Toxicol Appl Pharmacol 159 :11. Amemiya CT and Zon LI (1999) Generation of a zebrafish P1 artificial chromosome library. Genomics 58 :3. Andreasen E, Hahn ME, Heideman W and Tanguay RL (2002) The zebrafish (Danio rerio) aryl hydrocarbon receptor type I is a novel vertebrate receptor. Mol Pharmacol 62 (2):16. Antkiewicz DS, Burns CG, Carney SA, Pe terson RE and Heideman W (2005) Heart malformation is an early respons e to TCDD in embryonic zebrafish. Toxicol Sci 84 (2):368-377. Antonsson C, Whitelaw ML, McGuire J, Gust afsson JA and Poellinger L (1995) Distinct roles of the molecular chaperone hsp90 in modulating dioxin receptor function via the basic helix-loop-helix and PAS domains. Mol Cell Biol 15 (2):756-765. Bacsi SG, Reisz-Porszasz S and Hankinson O (1995) Orientation of the heterodimeric aryl hydrocarbon (dioxin) receptor complex on its asymmetric DNA recognition sequence. Mol Pharmacol 47 (3):432-438.

PAGE 108

98 Beischlag TV, Wang S, Rose DW, Torchia J, Reisz-Porszasz S, Muhammad K, Nelson WE, Probst MR, Rosenfeld MG and Ha nkinson O (2002) Recruitment of the NCoA/SRC-1/p160 family of transcripti onal coactivators by the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear translocator complex. Mol Cell Biol 22 (12):4319-4333. Belair CD, Peterson RE and Heideman W ( 2001) Disruption of eryt hropoiesis by dioxin in the zebrafish. Dev Dyn 222 (4):581-594. Bell DR and Poland A (2000) Binding of aryl hydrocarbon receptor (AhR) to AhRinteracting protein. The role of hsp90. J Biol Chem 275 (46):36407-36414. Bello SM, Heideman W and Peterson RE (2004) 2,3,7,8-Tetrachlorodibenzo-p-dioxin inhibits regression of the common cardi nal vein in developing zebrafish. Toxicol Sci 78 (2):258-266. Berg P and Pongratz I (2002) Two parallel pa thways mediate cytopl asmic localization of the dioxin (aryl hydrocarbon) receptor. J Biol Chem 277 (35):32310-32319. Bombail V, Taylor K, Gibson GG and Plan t N (2004) Role of Sp1, C/EBPa, HNF3, and PXR in the basal and xenobiotic mediat ed regulation of the CYP3A4 gene. Drug Metab Dispos 32 :11. Bunger MK, Moran SM, Glover E, Thomae TL, Lahvis GP, Lin BC and Bradfield CA (2003) Resistance to 2,3,7,8-te trachlorodibenzo-p-dioxin toxicity and abnormal liver development in mice carrying a mutation in the nuclear localization sequence of the aryl hydrocarbon receptor. J Biol Chem 278 (20):17767-17774.

PAGE 109

99 Burbach KM, Poland A and Bradfield CA (1992) Cloning of the Ah-receptor cDNA reveals a distinctive ligand-activated transcription factor. Proc Natl Acad Sci U S A 89 (17):8185-8189. Carney SA, Prasch AL, Heideman W a nd Peterson RE (2006) Understanding dioxin developmental toxicity us ing the zebrafish model. Birth Defects Res A Clin Mol Teratol 76 (1):7-18. Carvan MJ, Ponomareva LV, Solis WA, Matlib R, Puga A and Nebert DW (1999) The trout CYP1A3 gene: recognition of fish DNA motifs by mouse regulatory proteins. Marine Biotech 1 :12. Carvan MJ, Solis WA, Gedamu L and Nebert DW (2000) Activation of transcription factors in zebrafish cell cultures by environmental pollutants. Arch Biochem Biophys 376 :8. Carver LA and Bradfield CA (1997) Liga nd-dependent interac tion of the aryl hydrocarbon receptor with a novel immunophilin homolog in vivo. J Biol Chem 272 (17):11452-11456. Carver LA, Jackiw V and Bradfield CA (1994) The 90-kDa heat shock protein is essential for Ah receptor signali ng in a yeast expression system. J Biol Chem 269 (48):30109-30112. Carver LA, LaPres JJ, Jain S, Dunham EE and Bradfield CA (1998) Characterization of the Ah receptor-associated protein, ARA9. J Biol Chem 273 (50):33580-33587. Chadli A, Bouhouche I, Sullivan W, Stensg ard B, McMahon N, Catelli MG and Toft DO (2000) Dimerization and N-terminal domai n proximity underlie the function of

PAGE 110

100 the molecular chaperone heat shock protein 90. Proc Natl Acad Sci U S A 97 (23):12524-12529. Chen JN, van Eeden FJ, Warren KS, Chin A, Nusslein-Volhard C, Haffter P and Fishman MC (1997) Left-right pattern of cardiac BMP4 may drive asymmetry of the heart in zebrafish. Development 124 (21):4373-4382. Chen YH and Tukey RH (1996) Protein kinase C modulates regulation of the CYP1A1 gene by the aryl hydrocarbon receptor. J Biol Chem 271 (42):26261-26266. Christoffels VM, Grange T, Kaestner KH, Cole TJ, Darlington GJ, Croniger CM and Lamers WH (1998) Glucocorticoid recepto r, C/EBP, HNF3, a nd protein kinase A coordinately activate the glucocorticoid response unit of the carbamolyphosphate synthetase I gene. Mol Cell Biol 18 :11. Coumailleau P, Poellinger L, Gustafsson JA and Whitelaw ML (1995) Definition of a minimal domain of the dioxin receptor that is associated with Hsp90 and maintains wild type ligand binding affinity and specificity. J Biol Chem 270 (42):25291-25300. Cox MB and Miller CA, 3rd (2004) Cooperation of heat shock protein 90 and p23 in aryl hydrocarbon receptor signaling. Cell Stress Chaperones 9 (1):4-20. Davarinos NA and Pollenz RS (1999) Aryl hydrocarbon receptor imported into the nucleus following ligand binding is rapi dly degraded via the cytosplasmic proteasome following nuclear export. J Biol Chem 274 (40):28708-28715. Denis M, Cuthill, S., Wikstrom, A. C., Poellinger, L., Gustafsson, J. A. (1988) Association of the dioxin receptor with the Mr 90,000 heat shock protein: a

PAGE 111

101 structural kinship with th e glucocorticoid receptor. Biochem Biophys Res Commun 155 :7. Denis M, Gustafsson JA and Wikstrom AC (1988) Interaction of the Mr = 90,000 heat shock protein with the steroid-binding domain of the glucocorticoid receptor. J Biol Chem 263 (34):18520-18523. Denison MS, Fisher JM and Whitlock JP, Jr. (1988) The DNA recognition site for the dioxin-Ah receptor complex. Nucleotide sequence and functional analysis. J Biol Chem 263 (33):17221-17224. Denison MS and Nagy SR (2003) Activati on of the aryl hydrocarbon receptor by structurally diverse exoge nous and endogenous chemicals. Annu Rev Pharmacol Toxicol 43 :309-334. Dolwick KM, Schmidt JV, Carver LA, Swan son HI and Bradfield CA (1993a) Cloning and expression of a human Ah receptor cDNA. Mol Pharmacol 44 (5):911-917. Dolwick KM, Swanson HI and Bradfield CA (1993b) In vitro analysis of Ah receptor domains involved in liga nd-activated DNA recognition. Proc Natl Acad Sci U S A 90 (18):8566-8570. Dong W, Teraoka H, Yamazaki K, Tsukiyama S, Imani S, Imagawa T, Stegeman JJ, Peterson RE and Hiraga T (2002) 2,3,7,8-te trachlorodibenzo-p-dioxin toxicity in the zebrafish embryo: local circulation failu re in the dorsal midbrain is associated with increased apoptosis. Toxicol Sci 69 (1):191-201. Elferink CJ, Gasiewicz TA and Whitlock JP, Jr. (1990) Protein-DNA interactions at a dioxin-responsive enhancer. Evidence that the transformed Ah receptor is heteromeric. J Biol Chem 265 (33):20708-20712.

PAGE 112

102 Elferink CJ and Whitlock JP, Jr. (1990) 2,3,7,8-tetrachlorodibenzopdioxin inducible, Ah receptor mediated bending of enhancer DNA. J Biol Chem 265 :4. Eltom S, Zhang L and Jefcoate CR (1999) Re gulation of cytochrome P-450 (CYP) 1 B1 in mouse Hepa-1c1c7 variant cell lines: a possible role for aryl hydrocarbon receptor nuclear translocator (ARNT) as a suppressor of Cyp1B1 gene expression. Mol Pharmacol 55 :11. Ema M, Morita M, Ikawa S, Tanaka M, Mats uda Y, Gotoh O, Saijoh Y, Fujii H, Hamada H, Kikuchi Y and Fujii-Kuriyama Y (1996) Two new members of the murine Sim gene family are transcrip tional repressors and show different expression patterns during mouse embryogenesis. Mol Cell Biol 16 (10):5865-5875. Ema M, Sogawa K, Watanabe N, Chujoh Y, Matsushita N, Gotoh O, Funae Y and FujiiKuriyama Y (1992) cDNA cloning and struct ure of mouse putative Ah receptor. Biochem Biophys Res Commun 184 (1):246-253. Fisher JM, Wu L, Denison MS and Whitlock JP, Jr. (1990) Organization and function of a dioxin-responsive enhancer. J Biol Chem 265 (17):9676-9681. Fujii-Kuriyama Y and Mimura J (2005) Molecu lar mechanisms of AhR functions in the regulation of cytochrome P450 genes. Biochem Biophys Res Commun 338 (1):311317. Fujisawa-Sehara A, Sogawa K, Ya mane M and Fujii-Kuriyama Y (1987) Characterization of xenobi otic responsive elements upstream from the drugmetabolizing cytochrome P-450c gene: a sim ilarity to glucocorticoid regulatory elements. Nucleic Acids Res 15 (10):4179-4191.

PAGE 113

103 Furness SG, Lees MJ and Whitelaw ML ( 2007) The dioxin (aryl hydrocarbon) receptor as a model for adaptive responses of bHLH/PAS transc ription factors. FEBS Lett 581 (19):3616-3625. Gekakis N, Staknis D, Nguyen HB, Davis FC Wilsbacher LD, King DP, Takahashi JS and Weitz CJ (1998) Role of the CLOC K protein in the mammalian circadian mechanism. Science 280 (5369):1564-1569. Gelboin HV (1980) Benzo[alpha]pyrene metabo lism, activation and carcinogenesis: role and regulation of mixed-function oxidases and related enzymes. Physiol Rev 60 (4):1107-1166. Giannone JV, Okey AB and Harper PA (1995) Characterization of polyclonal antibodies to the aromatic hydrocarbon receptor. Can J Physiol Pharmacol 73 (1):7-17. Gibson GG, el-Sankary W and Plant NJ ( 2002) Receptor-dependent regulation of the CYP3A4 gene. Toxicology 181-182 :199-202. Gokhale MS, Bunton TE, Zurlo J and Yager JD (1997) Cytochrome P450 isoenzyme activities in cultured rat and mouse liver slices. Xenobiotica 27 (4):341-355. Gonzalez FJ and Fernandez-Salguero P ( 1998) The aryl hydrocarbon receptor: studies using the AHR-null mice. Drug Metab Dispos 26 (12):1194-1198. Green M (1973) Nomenclature of genetically determined biochemical variants in mice. Biochem Genet (9):11. Grenert JP, Sullivan WP, Fadden P, Haystead TA, Clark J, Mimnaugh E, Krutzsch H, Ochel HJ, Schulte TW, Sausville E, Neck ers LM and Toft DO (1997) The aminoterminal domain of heat shock protein 90 (hsp90) that binds geldanamycin is an

PAGE 114

104 ATP/ADP switch domain that regulates hsp90 conformation. J Biol Chem 272 (38):23843-23850. Gu YZ, Hogenesch JB and Bradfield CA (2000) The PAS superfamily: sensors of environmental and developmental signals. Annu Rev Pharmacol Toxicol 40 :519561. Hahn ME (2002) Aryl hydrocarbon recep tors: diversity and evolution. Chem Biol Interact 141 :30. Hahn ME, Poland A, Glover E and Stegeman JJ (1994) Photoaffinity labeling of the Ah receptor: phylogenetic survey of diverse vertebrate and invertebrate species. Arch Biochem Biophys 310 (1):218-228. Hankinson O (2005) Role of coactivators in transcriptional ac tivation by the aryl hydrocarbon receptor. Arch Biochem Biophys 433 (2):379-386. Hapgood J, Cuthill S, Denis M, Poellinger L and Gustafsson JA (1989) Specific proteinDNA interactions at a xenobiotic-respons ive element: copurification of dioxin receptor and DNA-binding activity. Proc Natl Acad Sci U S A 86 (1):60-64. Heid SE, Pollenz RS and Swanson HI (2000) Ro le of heat shock protein 90 dissociation in mediating agonist-induced activation of the aryl hydrocarbon receptor. Mol Pharmacol 57 (1):82-92. Henry TR, Nesbit DJ, Heideman W and Pete rson RE (2001) Relative potencies of polychloronated dibenzop -dioxin, dibenzofuran, and biphenyl congeners to induce cytochrome P4501A mRNA in zebrafish liver cell line. Environ Toxicol Chem 20 :6.

PAGE 115

105 Henry TR, Spitsbergen JM, Hornung MW, Abne t CC and Peterson RE (1997) Early life stage toxicity of 2,3,7,8-tetrachlorodibenzop-dioxin in zebrafish (Danio rerio). Toxicol Appl Pharmacol 142 (1):56-68. Hestermann EV and Brown M (2003) Agonist and chemopreventative ligands induce differential transcriptional cofactor recruitment by aryl hydrocarbon receptor. Mol Cell Biol 23 (21):7920-7925. Hill A, Howard CV, Strahle U and Cossins A (2003) Neurodevelopmental defects in zebrafish (Danio rerio) at envir onmentally relevant dioxin (TCDD) concentrations. Toxicol Sci 76 (2):392-399. Hill AJ, Bello SM, Prasch AL, Peterson RE and Heideman W (2004) Water permeability and TCDD-induced edema in zebrafish early-life stages. Toxicol Sci 78 (1):78-87. Hirose K, Morita M, Ema M, Mimura J, Hamada H, Fujii H, Saijo Y, Gotoh O, Sogawa K and Fujii-Kuriyama Y (1996) cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with clos e sequence similarity to the aryl hydrocarbon receptor nuc lear translocator (Arnt). Mol Cell Biol 16 (4):1706-1713. Hoffman EC, Reyes H, Chu FF, Sander F, Conley LH, Brooks BA and Hankinson O (1991) Cloning of a factor required for activity of the Ah (dioxin) receptor. Science 252 (5008):954-958. Huang ZJ, Edery I and Rosbash M (1993) PA S is a dimerization domain common to Drosophila period and severa l transcription factors. Nature 364 (6434):259-262. Imataka H, Sogawa K, Yasumoto K, Kikuchi Y, Sasano K, Kobayashi A, Hayami M and Fujii-Kuriyama Y (1992) Two regulatory proteins that bind to the basic

PAGE 116

106 transcription element (BTE), a GC box seque nce in the promoter region of the rat P-4501A1 gene. EMBO J 11 (10):3663-3671. Jackson DA, Rowader KE, Stevens K, Jiang C, Milos P and Zaret KS (1993) Modulation of liver-specific transcription by interactio ns between hepatocyte nuclear factor 3 and nuclear factor 1 bind ing DNA in close apposition. Mol Cell Biol 13 :10. Jain S, Dolwick KM, Schmidt JV and Brad field CA (1994) Potent transactivation domains of the Ah receptor and the Ah r eceptor nuclear translocator map to their carboxyl termini. J Biol Chem 269 (50):31518-31524. Jain S, Maltepe E, Lu MM, Simon C and Bradfield CA (1998) E xpression of ARNT, ARNT2, HIF1 alpha, HIF2 alpha and Ah receptor mRNAs in the developing mouse. Mech Dev 73 (1):117-123. Jones KW and Whitlock JP, Jr. (1990) Functional analysis of the transcriptional promoter for the CYP1A1 gene. Mol Cell Biol 10 (10):5098-5105. Jones PB, Durrin LK, Galeazzi DR and Whitlock JP, Jr. (1986) Control of cytochrome P1-450 gene expression: analysis of a dioxin-responsive enhancer system. Proc Natl Acad Sci U S A 83 (9):2802-2806. Jones PB, Galeazzi DR, Fisher JM and Whitlock JP, Jr. (1985) Control of cytochrome P1-450 gene expression by dioxin. Science 227 (4693):1499-1502. Kaczynski JA, Conley AA, Fernandez Zapico M, Delgado SM, Zhang JS and Urrutia R (2002) Functional analysis of basic transcription el ement (BTE)-binding protein (BTEB) 3 and BTEB4, a novel Sp1-like protein, reveals a subfamily of transcriptional repressors for the BTE site of the cytochrome P4501A1 gene promoter. Biochem J 366 (Pt 3):873-882.

PAGE 117

107 Kazlauskas A, Poellinger L and Pongratz I ( 1999) Evidence that the co-chaperone p23 regulates ligand responsiveness of th e dioxin (Aryl hydrocarbon) receptor. J Biol Chem 274 (19):13519-13524. Kazlauskas A, Poellinger L and Pongratz I (2000) The immunophilin-like protein XAP2 regulates ubiquitination and subcellular localization of the dioxin receptor. J Biol Chem 275 (52):41317-41324. Ke Q and Costa M (2006) Hypoxiainducible factor-1 (HIF-1). Mol Pharmacol 70 (5):1469-1480. Kewley RJ, Whitelaw ML and Chapman-Sm ith A (2004) The mammalian basic helixloop-helix/PAS family of transcriptional regulators. Int J Biochem Cell Biol 36 (2):189-204. King DP, Zhao Y, Sangoram AM, Wilsbacher LD, Tanaka M, Antoch MP, Steeves TD, Vitaterna MH, Kornhauser JM, Lowrey PL, Turek FW and Takahashi JS (1997) Positional cloning of the mouse circadian clock gene. Cell 89 (4):641-653. Ko HP, Okino ST, Ma Q and Whitlock JP, Jr. (1996) Dioxin-induced CYP1A1 transcription in vivo: the aromatic hydr ocarbon receptor mediat es transactivation, enhancer-promoter communication, and changes in chromatin structure. Mol Cell Biol 16 (1):430-436. Ko HP, Okino ST, Ma Q and Whitlock JP, Jr. (1997) Transactivation domains facilitate promoter occupancy for the dioxin-inducible CYP1A1 gene in vivo. Mol Cell Biol 17 (7):3497-3507.

PAGE 118

108 Kobayashi A, Numayama-Tsuruta K, Soga wa K and Fujii-Kuriyama Y (1997) CBP/p300 functions as a possible transcriptiona l coactivator of Ah receptor nuclear translocator (Arnt). J Biochem (Tokyo) 122 (4):703-710. Kobayashi A, Sogawa K and Fujii-Kuriyama Y (1996) Cooperative interaction between AhR.Arnt and Sp1 for the drug-indu cible expression of CYP1A1 gene. J Biol Chem 271 (21):12310-12316. Kohle C and Bock KW (2007) Coordinate regulation of Phase I and II xenobiotic metabolisms by the Ah receptor and Nrf2. Biochem Pharmacol 73 :10. Kozak KR, Abbott B and Hankinson O (1997) ARNT-deficient mice and placental differentiation. Dev Biol 191 (2):297-305. Kubota M, Sogawa K, Kaizu Y, Sawaya T, Watanabe J, Kawajiri K, Gotoh O and FujiiKuriyama Y (1991) Xenobiotic responsive element in the 5'-upstream region of the human P-450c gene. J Biochem 110 :5. Kumar MB and Perdew GH (1999) Nuclear receptor coactivator SRC-1 interacts with the Q-rich subdomain of the AhR and modul ates its transactivation potential. Gene Expr 8 (5-6):273-286. LaPres JJ, Glover E, Dunham EE, Bunger MK and Bradfield CA ( 2000) ARA9 modifies agonist signaling through an increase in cytosolic aryl hydrocarbon receptor. J Biol Chem 275 (9):6153-6159. Legraverend C, Hannah RR, Eisen HJ, Owens IS, Nebert DW and Hankinson O (1982) Regulatory gene product of the Ah locus. Characterization of receptor mutants among mouse hepatoma clones. J Biol Chem 257 (11):6402-6407.

PAGE 119

109 Long WP, Pray-Grant M, Tsai JC and Perd ew GH (1998) Protein ki nase C activity is required for aryl hydrocarbon receptor pathway-mediated signal transduction. Mol Pharmacol 53 (4):691-700. Lusska A, Shen E and Whitlock JP, Jr. ( 1993) Protein-DNA intera ctions at a dioxinresponsive enhancer. Analysis of si x bona fide DNA-binding sites for the liganded Ah receptor. J Biol Chem 268 (9):6575-6580. Ma G, Kinneer K, Bi Y, Chan JY and W KY (2004) Induction of NAD(P)H:quinone oxidoreductase by 2,3,7,8tetrachlorodibenzop -dioxin requires CNC (cap 'n' collar) basic leucine zipper factor Nrf2 ( nuclear factor erythroid 2-related factor 2) cross-interaction between AhR (ary l hydrocarbon receptor) and Nrf2 signal transduction. Biochem J 377 :10. Ma Q and Baldwin KT (2000) 2,3,7,8-tetrachlo rodibenzo-p-dioxin-induced degradation of aryl hydrocarbon receptor (AhR) by the ubiquitin-proteasome pathway. Role of the transcription activaton and DNA binding of AhR. J Biol Chem 275 (12):84328438. Ma Q, Renzelli AJ, Baldwin KT and Ant onini JM (2000) Supe rinduction of CYP1A1 gene expression. Regulation of 2,3,7, 8tetrachlorodibenzop-dioxin-induced degradation of Ah receptor by cycloheximide. J Biol Chem 275 (17):12676-12683. Ma Q and Whitlock JP, Jr. (1997) A novel cytopl asmic protein that interacts with the Ah receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. J Biol Chem 272 (14):8878-8884. Malik S and Roeder RG (2000) Transcri ptional regulation th rough Mediator-like coactivators in yeast and metazoan cells. Trends Biochem Sci 25 (6):277-283.

PAGE 120

110 Marchand A, Barouki R and Garlatti M (2004) Regulation of NAD(P)H:quinone oxidoreductase 1 gene expression by CYP1A1 activity. Mol Pharmacol 65 :9. Massari ME and Murre C (2000) Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol Cell Biol 20 (2):429-440. Matthews J, Wihlen B, Thomsen J and Gu stafsson JA (2005) Aryl hydrocarbon receptormediated transcription: ligand-dependent recruitment of estrogen receptor alpha to 2,3,7,8-tetrachlorodibenzo-p-dio xin-responsive promoters. Mol Cell Biol 25 (13):5317-5328. McGuire J, Whitelaw ML, Pongratz I, Gustaf sson JA and Poellinger L (1994) A cellular factor stimulates ligand-dependent re lease of hsp90 from the basic helix-loophelix dioxin receptor. Mol Cell Biol 14 (4):2438-2446. Meyer BK and Perdew GH (1999) Charact erization of the AhR-hsp90-XAP2 core complex and the role of the immunophilin-related protein XAP2 in AhR stabilization. Biochemistry 38 (28):8907-8917. Meyer BK, Petrulis JR and Perdew GH (2000) Aryl hydrocarbon (Ah) receptor levels are selectively modulated by hsp90-as sociated immunophilin homolog XAP2. Cell Stress Chaperones 5 (3):243-254. Meyer BK, Pray-Grant MG, Vanden Heuvel JP and Perdew GH (1998) Hepatitis B virus X-associated protein 2 is a subunit of the unliganded aryl hydrocarbon receptor core complex and exhibits transcriptional enhancer activity. Mol Cell Biol 18 (2):978-988.

PAGE 121

111 Miao W, Hu L, Scrivens J and Batist G (2005) Transcriptio nal regulation of NF-E2 p45related factor (Nrf2) expression by th e aryl hydrocarbon r eceptor xenobiotic response element signalling pathway. J Biol Chem 280 :9. Miranda CL, Collodi P, Zhao X, Barnes DW and Buhler DR (1993) Regulation of cytochrome P450 expression in a no vel cell line from zebrafish ( Brachyodanio rerio ). Arch Biochem Biophys 305 :8. Morgan JE and Whitlock JP, Jr. (1992) Transcription-dependent and transcriptionindependent nucleosome disruption induced by dioxin. Proc Natl Acad Sci U S A 89 (23):11622-11626. Nair SC, Toran EJ, Rimerman RA, Hjerms tad S, Smithgall TE and Smith DF (1996) A pathway of multi-chaperone interactions common to diverse regulatory proteins: estrogen receptor, Fes tyrosi ne kinase, heat shock tran scription factor Hsf1, and the aryl hydrocarbon receptor. Cell Stress Chaperones 1 (4):237-250. Nambu JR, Lewis JO, Wharton KA, Jr. a nd Crews ST (1991) The Drosophila singleminded gene encodes a helix-loop-helix protei n that acts as a master regulator of CNS midline development. Cell 67 (6):1157-1167. Nebert DW and Gelboin HV (1969) The in vivo and in vitro induction of aryl hydrocarbon hydroxylase in mammalian cells of different species, tissues, strains, and developmental and hormonal states. Arch Biochem Biophys 134 (1):76-89. Necela B and Pollenz RS (1999) Functional anal ysis of activation and repression domains within the rainbow trout ARNT protein. Biochem Pharmacol 57 :14. Necela B and Pollenz RS (2001) Role of Cterminal domain of rtARNTa in negative function. Biochem Pharmacol 62 :12.

PAGE 122

112 Neuhold LA, Shirayoshi Y, Ozato K, Jones JE and Nebert DW (1989) Regulation of mouse CYP1A1 gene expression by dioxi n: requirement of two cis-acting elements during induction. Mol Cell Biol 9 (6):2378-2386. Okino ST and Whitlock JP, Jr. (1995) Dioxi n induces localized, graded changes in chromatin structure: implications for Cyp1A1 gene transcription. Mol Cell Biol 15 (7):3714-3721. Perdew GH (1988) Association of the Ah recep tor with the 90-kDa heat shock protein. J Biol Chem 263 (27):13802-13805. Petrulis JR, Kusnadi A, Ramadoss P, Hollingshead B and Perdew GH (2003) The hsp90 Co-chaperone XAP2 alters importin beta recognition of the bipartite nuclear localization signal of the Ah receptor and represses transcriptional activity. J Biol Chem 278 (4):2677-2685. Poland A and Glover E (1987) Variation in the molecular mass of the Ah receptor among vertebrate species and strains of rats. Biochem Biophys Res Commun 146 (3):1439-1449. Poland A and Glover E (1990) Characterization and strain distribu tion pattern of the murine Ah receptor specified by the Ahd and Ahb-3 alleles. Mol Pharmacol 38 (3):306-312. Poland A, Glover E and Bradfield CA (1991) Ch aracterization of polyc lonal antibodies to the Ah receptor prepared by immunizati on with a synthetic peptide hapten. Mol Pharmacol 39 (1):20-26. Poland A, Glover E and Kende AS (1976) St ereospecific, high affinity binding of 2,3,7,8tetrachlorodibenzo-p-dioxin by hepatic cyto sol. Evidence that the binding species

PAGE 123

113 is receptor for induction of aryl hydrocarbon hydroxylase. J Biol Chem 251 (16):4936-4946. Poland A, Glover E and Taylor BA (1987) Th e murine Ah locus: a new allele and mapping to chromosome 12. Mol Pharmacol 32 (4):471-478. Poland A and Knutson JC (1982) 2,3,7,8-tetr achlorodibenzo-p-dioxin and related halogenated aromatic hydrocarbons: examin ation of the mechanism of toxicity. Annu Rev Pharmacol Toxicol 22 :517-554. Poland AP, Glover E, Robinson JR and Nebert DW (1974) Genetic expression of aryl hydrocarbon hydroxylase activ ity. Induction of monooxyge nase activities and cytochrome P1-450 formation by 2,3,7,8-te trachlorodibenzo-pdioxin in mice genetically "nonresponsive" to other aromatic hydrocarbons. J Biol Chem 249 (17):5599-5606. Pollenz RS (1996) The aryl-hydrocarbon recepto r, but not the aryl-hydrocarbon receptor nuclear translocator protei n, is rapidly depleted in hepatic and nonhepatic culture cells exposed to 2,3,7,8-tetr achlorodibenzo-p-dioxin. Mol Pharmacol 49 (3):391398. Pollenz RS (2002) The mechanism of AH recep tor protein down-regulation (degradation) and its impact on AH receptormediated gene regulation. Chem Biol Interact 141 (1-2):41-61. Pollenz RS and Dougherty EJ (2005) Redefini ng the role of the endogenous XAP2 and C-terminal hsp70-interacting protein on the endogenous Ah receptors expressed in mouse and rat cell lines. J Biol Chem 280 (39):33346-33356.

PAGE 124

114 Pollenz RS, Santostefano MJ, Klett E, Richardson VM, Necela B and Birnbaum LS (1998) Female Sprague-Dawley rats exposed to a single oral dose of 2,3,7,8tetrachlorodibenzo-p-dioxin exhibit su stained depletion of aryl hydrocarbon receptor protein in liver, spleen, thymus, and lung. Toxicol Sci 42 (2):117-128. Pollenz RS, Sattler CA and Poland A (1994) The aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator protein show distinct subcellular localizations in Hepa 1c1c7 cel ls by immunofluorescence microscopy. Mol Pharmacol 45 (3):428-438. Pollenz RS, Sullivan H, Holmes J, Necel a B and Peterson RE (1996) Isolation and expression of cDNAs from rainbow tr outthat encode two novel bHLH/PAS proteins with distinct func tions in the presence of th e aryl hydrocarbon receptor. J Biol Chem 271 :11. Pollenz RS, Wilson SE and Dougherty EJ ( 2006) Role of endogenous XAP2 protein on the localization and nucleocytoplasmic s huttling of the endogenous mouse Ahb-1 receptor in the presence and absence of ligand. Mol Pharmacol 70 (4):1369-1379. Pongratz I, Mason GG and Poellinger L (1992) Dual roles of the 90-kDa heat shock protein hsp90 in modulating functional ac tivities of the dioxin receptor. Evidence that the dioxin receptor functionally be longs to a subclass of nuclear receptors which require hsp90 both for ligand binding activity and repression of intrinsic DNA binding activity. J Biol Chem 267 (19):13728-13734. Postlethwait JH, Yan YL, Gates MA, Horne S, Amores A, Brownlie A, Donovan A, Egan ES, Force A, Gong Z, Goutel C, Fritz A, Kelsh R, Knapik E, Liao E, Paw B, Ransom D, Singer A, Thomson M, Abduljabbar TS, Yelick P, Beier D, Joly JS,

PAGE 125

115 Larhammar D, Rosa F, Westerfield M, Zon LI, Johnson SL and Talbot WS (1998) Vertebrate genome evolution and the zebrafish gene map. Nat Genet 18 :5. Powell WH, Karchner SI, Bright R and Ha hn ME (1999) Functional diversity of vertebrate ARNT proteins: identificati on of ARNT2 as the predominate form of ARNT in the marine teleost, Fundulus heteroclitus. Arch Biochem Biophys 361 :8. Powell WH, Morrison HG, Weil EG, Karchner SI, Sogin ML, Stegeman JJ and Hahn ME (2004) Cloning and analysis of the CYP1A1 promoter from the Atlantic killifish (Fundulus heteroclitus). Marine Environ Res 58 :6. Prasch AL, Heideman W and Peterson RE (2004) ARNT2 is not required for TCDD developmental toxicity in zebrafish. Toxicol Sci 82 :9. Prasch AL, Tanguay RL, Mehta V, Heideman W and Peterson RE (2006) Identification of ARNT1 homologs: 2, 3,7,8-tetracholorodibenzop -dioxin toxicity in the developing zebrafish requires ARNT1. Mol Pharmacol 69 :12. Prasch AL, Teraoka H, Carney SA, Dong W, Hiraga T, Stegeman JJ, Heideman W and Peterson RE (2003) Aryl hydrocarbon receptor 2 mediates 2,3,7,8tetrachlorodibenzop -dioxin developmental t oxicity in zebrafish. Toxicol Sci 76 :13. Probst MR, Fan CM, Tessier-Lavigne M a nd Hankinson O (1997) Two murine homologs of the Drosophila single-minded protein that interact with the mouse aryl hydrocarbon receptor nuclear translocator protein. J Biol Chem 272 (7):44514457. Quattrochi LC, Vu T and T ukey RH (1994) The human CY P1A2 gene and induction by 3-methylcholanthrene. J Biol Chem 269 (9):6.

PAGE 126

116 Reisz-Porszasz S, Probst MR, Fukunaga BN and Hankinson O (1994) Identification of functional domains of the aryl hydrocarbon receptor nuclear tr anslocator protein (ARNT). Mol Cell Biol 14 (9):6075-6086. Reyes H, Reisz-Porszasz S and Hankinson O (1 992) Identification of the Ah receptor nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science 256 (5060):1193-1195. Rivera SP, Saarikoski ST and Hankinson O (2002) Identification of a novel dioxininducible cytochrome P450. Mol Pharmacol 61 (2):255-259. Rivera SP, Wang F, Saarikoski ST, Taylor RT, Chapman B, Zhang R and Hankinson O (2007) A novel promoter element containi ng multiple overlapping xenobiotic and hypoxia response elements mediates induction of cytochrome P4502S1 by both dioxin and hypoxia. J Biol Chem 282 (15):10881-10893. Rodriguez-Antona C, Bort R, Jover R, Tindberg N, Ingelm an-Sundberg M, GomezLechon MJ and Castell NJV (2003) Transcri ptional regulation of human CYP3A4 basal expression by CCAAT enhancer bind ing protein a and hepatocyte nuclear factor 3 a. Mol Pharmacol 63 :10. Roman BL, Pollenz RS and Peterson RE ( 1998) Responsiveness of the adult male rat reproductive tract to 2,3,7,8-te trachlorodibenzo-p-dioxin exposure: Ah receptor and ARNT expression, CYP1A1 inducti on, and Ah receptor down-regulation. Toxicol Appl Pharmacol 150 (2):228-239. Rombough P (2002) Gills are needed for ionoregulation before they are needed for O(2) uptake in developing zebrafish, Danio rerio. J Exp Biol 205 (Pt 12):1787-1794.

PAGE 127

117 Roux J, Pictet R and Grange T (1995) Hepa tocyte nuclear factor 3 determines the amplitude of the glucocorticoid response of the rat tyrosine aminotransferase gene. DNA Cell Biol 14 :10. Rowlands JC, McEwan IJ and Gustafsson JA (1996) Trans-activation by the human aryl hydrocarbon receptor and aryl hydrocarbon rece ptor nuclear transl ocator proteins: direct interactions with ba sal transcription factors. Mol Pharmacol 50 (3):538-548. Rylander T, Neve EP, Ingelman-Sundberg M and Oscarson M (2001) Identification and tissue distribution of the novel human cytochrome P450 2S1 (CYP2S1). Biochem Biophys Res Commun 281 (2):529-535. Saarikoski ST, Rivera SP, Hankinson O and Husgafvel-Pursiainen K (2005) CYP2S1: A short review. Toxicol Appl Pharmacol 207 (2 Suppl):62-69. Saatcioglu F, Perry DJ, Pasco DS and B FJ (1990) Multiple DNA-binding factors interact with overlapping specificit ies at the aryl hydrocarbon response element of the cytochrome P4501A1 gene. Mol Cell Biol 10 :9. Safe S (1990) Polychlorinated biphenyls (PCBs), dibenzo-p-dioxins (PCDDs), dibenzofurans (PCDFs), and related co mpounds: environmental and mechanistic considerations which suppor t the development of toxic equivalency factors (TEFs). Crit Rev Toxicol 21 (1):51-88. Schmidt JV and Bradfield CA (1996) Ah receptor signaling pathways. Annu Rev Cell Dev Biol 12 :55-89. Shen ES and Whitlock JP, Jr. (1992) Protei n-DNA interactions at a dioxin-responsive enhancer. Mutational analysis of th e DNA-binding site for the liganded Ah receptor. J Biol Chem 267 (10):6815-6819.

PAGE 128

118 Shim EY, Woodcock C and Zaret KS (1998) Nucleosome positioning by the winged helix transcription factor HNF3. Genes Dev 12 :6. Shimada T, Hayes CL, Yamazaki H, Amin S, Hecht SS, Guengerich FP and Sutter TR (1996) Activation of chemically divers e procarcinogens by human cytochrome P450 1B1. Cancer Res 56 (13):6. Smith AG, Clothier B and Cart hew P (2001) Protection of the Cyp1a1 (-/-) null mice against uroporphyria and hepatic injury following exposure to 2,3,7,8tetrachlorodibenzop -dioxin Toxicol Appl Pharmacol 173 :10. Sogawa K, Fujisawa-Sehara A, Yamane M and Fujii-Kuriyama Y (1986) Location of regulatory elements responsible for drug induction in the rat cytochrome P-450c gene. Proc Natl Acad Sci U S A 83 :5. Sogawa K, Iwabuchi K, Abe H and Fujii-Ku riyama Y (1995) Transcriptional activation domains of the Ah receptor and Ah receptor nuclear translocator. J Cancer Res Clin Oncol 121 :9. Sogawa K, Kikuchi Y, Imataka H and Fu jii-Kuriyama Y (1993) Comparison of DNAbinding properties between BTEB and Sp1. J Biochem (Tokyo) 114 (4):605-609. Song Z and Pollenz RS (2002) Ligand-depende nt and independent modulation of aryl hydrocarbon receptor localization, degradation, and gene regulation. Mol Pharmacol 62 (4):806-816. Sullivan W, Stensgard B, Caucutt G, Bartha B, McMahon N, Alnemri ES, Litwack G and Toft D (1997) Nucleotides and two functional states of hsp90. J Biol Chem 272 (12):8007-8012.

PAGE 129

119 Sutter TR, Tang YM, Hayes CL, Wo YY, Jabs EW, Li X, Yin H, Cody CW and Greenlee WF (1994) Complete cDNA sequence of a human dioxin-inducible mRNA identifies a new gene subfamily of cytochrome P450 that maps to chromosome 2. J Biol Chem 269 (18):8. Swanson HI, Chan WK and Bradfield CA (1995) DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins. J Biol Chem 270 (44):2629226302. Swanson HI and Yang JH (1998) The aryl hydrocarbon receptor interacts with transcription factor IIB. Mol Pharmacol 54 (4):671-677. Tang YM, Wo YY, Stewart J, Hawkins AL, Griffin CA, Sutter TR and Greenlee WF (1996) Isolation and characterization of the human cytochrome P450 CYP1B1 gene. J Biol Chem 271 (45):7. Tanguay RL, Abnet CC, Heideman W and Peterson RE (1999) Cloning and characterization of the ze brafish (Danio rerio) aryl hydrocarbon receptor. Biochem Biophys Acta 1444 (1):14. Tanguay RL, Andreasen E, Heideman W a nd Peterson RE (2000) Identification and expression of alternatively spliced ar yl hydrocarbon nuclear translocator 2 (ARNT2) cDNAs from zebrafish with distinct functions. Biochem Biophys Acta 1494 :12. Teraoka H, Dong W, Ogawa S, Tsukiyama S, Okuhara Y, Niiyama M, Ueno N, Peterson RE and Hiraga T (2002) 2,3,7,8-Tetrachloro dibenzo-p-dioxin toxicity in the zebrafish embryo: altered regional blood flow and impaired lower jaw development. Toxicol Sci 65 (2):192-199.

PAGE 130

120 Thomas PE and Hutton JJ (1973) Genetics of aryl hydrocarbon hydroxylase induction in mice: additive inheritance in crosses between C3H-HeJ and DBA-2J. Biochem Genet 8 (3):249-257. Tian H, McKnight SL and Russell DW ( 1997) Endothelial PAS domain protein 1 (EPAS1), a transcription factor select ively expressed in endothelial cells. Genes Dev 11 (1):72-82. Tijet N, Boutros PC, Moffat ID, Okey AB, Tuomisto J and Pohjanvirta R (2006) Aryl hydrocarbon receptor regulates distinct di oxin-dependent and dioxin-independent gene batteries. Mol Pharmacol 69 (1):140-153. Ueda R, Iketaki H, Nagata K, Kimura S and Gonzalez FJ (2006) A common regulatory region functions bi-directi onally in transcriptional activation of the human CYP1A1 and CYP1A2 genes. Mol Pharmacol 69 :7. Uno S, Dalton TD, Sinclair PR, Gorman N, Wang B, Smith AG, Miller ML, Shertzer HG and Nebert DW (2004) Cyp1a1 (-/-) male mice: Prot ection against high dose TCDD-induced lethatlity and wasting syndr ome, and resistance to intrahepatocyte lipid accumulation and uroporphyria. Toxicol Appl Pharmacol 196 :12. Wang GL, Jiang BH, Rue EA and Semenza GL (1995) Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodime r regulated by cellular O2 tension. Proc Natl Acad Sci U S A 92 (12):5510-5514. Wang GL and Semenza GL (1995) Purificati on and characterization of hypoxia-inducible factor 1. J Biol Chem 270 (3):1230-1237. Wang S, Ge K, Roeder RG and Hankinson O ( 2004) Role of mediator in transcriptional activation by the aryl hydrocarbon receptor. J Biol Chem 279 (14):13593-13600.

PAGE 131

121 Wang S and Hankinson O (2002) Functional in volvement of the Brahma/SWI2-related gene 1 protein in cytochrome P4501A1 transcription mediated by the aryl hydrocarbon receptor complex. J Biol Chem 277 (14):11821-11827. Wentworth JN, Buzzeo R and Pollenz RS ( 2004) Functional characterization of aryl hydrocarbon receptor (zfAHR2) localization and degradation in zebrafish (Danio rerio). Biochem Pharmacol 67 (7):1363-1372. Whitelaw ML, Gottlicher M, Gustafsson JA and Poellinger L (1993) Definition of a novel ligand binding domain of a nuclea r bHLH receptor: co -localization of ligand and hsp90 binding activities within the regulable inac tivation domain of the dioxin receptor. EMBO J 12 (11):4169-4179. Whitelaw ML, Gustafsson JA and Poellinger L (1994) Identification of transactivation and repression functions of the dioxin r eceptor and its basic helix-loop-helix/PAS partner factor Arnt: inducible versus constitutive modes of regulation. Mol Cell Biol 14 (12):8343-8355. Whitlock JP, Jr. (1999) Induction of cytochrome P4501A1. Annu Rev Pharmacol Toxicol 39 :103-125. Wo YY, Stewart J and Greenlee WF (1997) Func tional analysis of the promoter for the human Cyp1B1 gene. J Biol Chem 272 :6. Woods IG, Kelly PD, Chu FF, Ngo-Hazelett P, Yan YL, Hua ng H, Postlethwait JH and Talbot WS (2000) A comparative map of the zebrafish genome. Genome Res 2000 :12.

PAGE 132

122 Wu L and Whitlock JP, Jr. (1992) Mechanis m of dioxin action: Ah receptor-mediated increase in promoter accessibility in vivo. Proc Natl Acad Sci U S A 89 (11):48114815. Wu L and Whitlock JP, Jr. (1993) Mechanis m of dioxin action: receptor-enhancer interactions in intact cells. Nucleic Acids Res 21 (1):119-125. Yanagida A, Sogawa K, Yasumoto KI a nd Fujii-Kuriyama Y (1990) A novel cis-acting DNA element required for a high level of inducible expression of the rat P-450c gene. Mol Cell Biol 10 (4):1470-1475. Yoon CY, Park M, Kim BH, Park JY, Park MS, Jeong YK, Kwon H, Jung HK, Kang H, Lee YS and Lee BJ (2006) Gene expre ssion profile by 2,3,7,8-tetrachlorodibenzop-dioxin in the liver of wild-type (AhR+/+) and aryl hydrocarbon receptordeficient (AhR-/-) mice. J Vet Med Sci 68 (7):663-668. ZeRuth G and Pollenz RS (2005) Isolation and characterization of a dioxin-inducible CYP1A1 promoter/enhancer region from zebrafish ( Danio rerio ). Zebrafish 2 :14. Zhang L, Savas U, Alexander DL and Jefcoa te CR (1998a) Characterization of the mouse Cyp1B1 gene. Identification of an enhan cer region that di rects aryl hydrocarbon receptor-mediated constitutive and induced expression. J Biol Chem 273 :10. Zhang L, Zheng W and Jefcoate CR (2003) Ah receptor regulation of mouse Cyp1B1 is additionally modulated by a second n ovel complex that forms at two AhR response elements. Toxicol Appl Pharmacol 192 :17. Zhang W, Shields JM, Sogawa K, Fujii-K uriyama Y and Yang VW (1998b) The gutenriched Kruppel-like factor suppresses the activity of the CYP1A1 promoter in an Sp1-dependent fashion. J Biol Chem 273 (28):17917-17925.

PAGE 133

123 Appendix A PAC 133 Sequencing Data In order to obtain the sequence of th e putative CYP1A regulatory region located within the fragments obtained from PAC 133 via restriction enzyme digestion, the 12kb SpeI fragment and the 2.5kb and 0.5kb HindIII fragments were subcloned into pBluescript ksand sequenced. The initial sequencing was carried out using the T7 and T3 primers native to the vect or. Subsequent primers were designed against the sequence retrieved from the in itial sequencing (Figure AA1). Since the completion of this work, the zfCYP1A gene has been identified in the Sanger zebrafish genome project database. The zfCYP1A has been assigned to chromosome 18. The closest neighbor ing genes are the transient receptor potential cation channel, subfamily M, member 7 ( trpm7 ), approximately 150 kb 5’-ward of CYP1A and fibroblast growth factor 7 ( fgf7 ), approximately 50kb 3’ward. The sequence obtained from the sequencing outlined above follows in this appendix. Directly sequenced nucleotides are capitalized. Sequence obtained in silico from other sources is represented by lowercase characters. Introns are italicized. Splice donor/ acceptor sites are bold faced. The TATA box is underlined. SpeI and HindIII restriction enzyme sites are bold faced. XREs are bold and underlined. Numbering is relative to the transcriptional start site such that -1 is immediately 5’ of the transcriptional start site and +1 is immediately 3’.

PAGE 134

124 Appendix A continued Figure AA1. Schematic Overvie w of Sequencing Strategy Fig. AA1. Schematic overview of sequencing strategy. Visual representation of the sequencing strategy employed on the subc loned constructs containing the region upstream of the zfCYP1A The 12kb SpeI fragment as well as the 2.5kb and 0.5kb HindIII fragments were subcloned into pBlues cript ksand sequenced using T7 and T3 primers. Subsequent primers were generated based upon the sequence retrieved from the initial sequencing. Primers and direction are indicated by arrows. The shaded region indicates the relative location of the HindIII fragments within the larger SpeI fragment. The positions of the 5’ untranslated region, the translational start codon, open reading frame, and sp lice donor/acceptor si tes are labeled.

PAGE 135

125 Appendix A continued > Danio rerio Cytochrome P4501A 5’ Regulat ory Region, 5’-UTR, and Intron 1 -3359 gttcataccattgtgaatgcataatctgtctatacaacaaaaaaagtcagtcaacagtctgaaac -3294 tggcagatttagagcaccgtaagagttcacaaaaaatagctgtttgtttctacatagactaaaag -3229 taaactaaaagtaaattagatgcatggagtgtatagtttgagctaaggtaagcctatgtaagtca -3164 gaatacactaatttgcctatccctatctctcagaaaacactgaaaacttaaacacatttcattaa -3099 taaattagatgtcatttaattaaatacataactttgattaactgaagcatgtattacacaattct -3034 catggggaaaattttaaatatatgtatatatttgtaatatttatttgtacaatttatttataatt -2969 tcatgttagtaattatttgttgtgaatgataacaacttgtttgtaaagttttttttttccttaac -2904 aacaaaactatagctgtagggttaatcaggctgagtgttaggacagggtttgtacatttgtaaag -2839 tgttttaatgaagcaaaaaaatctgaaaaccaaataatgacatactttcctttacaaaacaactc -2774 acagaaatcaaccatcgggccattttagtcatgtttgggatgaaatacttgcattcactgtattt -2709 atgtttttatttcaaggtcagataatgtttctcttaggatgtcctacatataaagccgaacagga -2644 gggtaaatagagcagaACTAGTGAACCTCTTCTCCTCCTCCAGCT CACGCAA CGTGGCCAATCTT -2579 TAACCCGCGCTACAGGTGCGCG CACGCGA TGCTGTTTGATCAGTTTATCG TAGCGTG TTTCACAC -2514 AGCGATAACAGTCTGAGGTCGCAGGAACTCTTCCCATAAACCCACCGCAGAACAAACACTCCGGC -2449 TTTAACACTCCTCGTGCTTTTGTGCATGAACCGCTGACATGCACGCTCTCCGACGGCCACGCGCG -2384 TCTACCCCATTCTGCCAGCTCTTCCTGTTGACAGTCAATGAGATGCATGAAAAATGTGTGAAGGA -2319 ATCTGCAGCAGCGGTTCACAAACG CACGCAC ACACTCTCACACACACACACCTTTG CACGCGA TG -2254 CTTTACCTGTTGCTTAATGAGTTACGAGCGCGTGCCAGATCAGCAGAGACTCAAACATGCAGGCA -2189 ATTATCGGATGTGTTGCAACAAACAATTTATTTAGTTCACATAATTGCCTAAACCATCACACTGA -2124 TTTATGACACTTTAGCTTAGACAGCTTTAAAAGATAAATAAACATCTCGAGCATGCTGTTTAACT -2059 TTTCATGATTTATATATTCTGATTTTATTGGGCTTATTTATTTCTCACATAATTATTATCCGCAT -1994 TGAGTTTGCTGTATTAAGAGTTGTGATGAAATGTGGGATTGATTTCTCAGTTAATGCACGTCGCT -1929 TTTGTCTACAAACTGTTCTGTAAATATTAACATTACATTACATAACATCAAAAAACACTGATAAG -1864 CCCAGTTCTGCCTTAATTATAAAGGCTAATTAAGCGTCTCATTTATTAATTTATTTCATTTATTT -1799 ATGTTTTAAATATATATTTGTTTACATATTGCAAATTTAGTTGGAAATGCATGTTAAAAATATTA -1734 GTGCTGTATAATTATTACCCAATCAAAAATGTTGCATTTGTGTTAAATATTGACATATATATGAT -1669 CACATTACATAAATATTGACATATATATGATTACAATACATAAATATTGACATATATATATATAA -1604 TAATGTTACATAAATATTGACATATATGATTACGTTACATAAATATTGACATATATATAATTACT -1539 TTACATAAATATTGATATATATATAATTACATTACATAAATATGAGCATATATATATAATTACAT -1474 TACATAAATATTGACATATATATTTAATTACAATACATAAATATTGACATATATATAATTACATT -1409 ACATAAATATTGACATATATGATTACATTACATAAATATTGACATATATAAGTACGTTACATAAA -1344 TATTGAGATATATATATATAATTACAATACATAAATATTGGCATATATATAATTACGTTACATAA -1279 ATATTGACATATATATATATATATATATATATATATATATATATATATATATATATATATATATA

PAGE 136

126 Appendix A continued -1214 ATTACAATACATAAATATTGACATATATGATTACGTTACATAAATATTGACACATATATAATTAC -1149 GTTACATAAATATTGACATATATATAATTACGTTTCATAAATATTGACATATATATAATAACGAT -1084 ACATAAATATTGACATATATATGATTACAATACATAAATATTGGCATAATTAAAATGACATTACA -1019 TAAATATTGACATATATATGACTATATTACAAAAATATTGACATATATATATATACACACACACA -954 CACATATATATATACAATTACGTTGAATCAATATTGACATATATATGAATGAATTACAAAAATAT -889 TGACATATATATAATAACGTTACATAAATATTGACATATATTTGATTTTATTAAATAAATATTGG -824 CATATATATAATTACATTACATAAATATTGACATATATATGATTACATTACATAAATATTGACAT -759 ATATATAATAACGTTACATAAATATTGACATATATTTGATTTTATTAAATAAATATTGGCATATA -694 TATGATTACATTACATAAATATTGACATATATATATATATATATATATATATATATATATATATA -629 TATATATATATATTTACTTTACATAAATATTGACATATTTGACTTAGTCCCTTTAATCAGGGGTC -564 GCCACTGCGGAATGAACCGCCAACTTATCCAGCATAGTTTTTACGCAGCAGATGCCCTTCCAGCT -499 GCAACCCAACACTGGGAAACACACATACCCTCTCATTCA CACGCAC ACTCATACACTACGGCCAA -434 TTTAGTTCATCAGTTCCCCTAAAGTGCATGTGTTTGGACTGTGGAGAAAACCGGAGCACCCGGAG -369 GAAACC CACGCCA TGCAAACTCCACACAGAAATGCCAGCTGACCCAGCTCGAACCAGCGATCGTG -304 CTACTCACTGCACTTTATAAATATATATTTTTCATTCATAACTTTTGTATACATTTTACATAGTC -239 TTTTGTACCATGTATGT GTGCGTG TGTTACATACATCAATCTCCTTCCCACAGTTTAGATATGTG -174 TGAGGTGAGTGTGTGTAATTACTCAGGGAGTTTACTCAGTGCAATCGATCAGCCTGTAATAAAAT -109 CTCAGCCCTTCTCAGCATCAAAGCCTCCTGCGCTCGGTGACGTCCGCGGAGGACAGCCAATCACG -44 GCGAGCTCTGCGCTATAAAA GATTTACCGCTGGAATAGTGCAGCACTCCTCTGGAGCTAATTGGC +21 ACTGG A TAGAAA C AGCTGAGAACTGGAAAGTATCCACTCGATCGCTCCGG GTGAGT CTGATGTCA +86 ATGGTTTTGTCTTATATTGAATATGTGATCATTGTGCAGGTGCTTTATGCAACTTTTAAACGTCA +151 AAACATTAACTTTCTTTACTTTTTCTACATGTTTTGCACAATATTGTACAGCTTAAATGGTGTGC +216 ATGTCACTTTTATAATAATTTTAGAGTTGAAAAAAAATGTATGTATAATATATATACTATAATTA +281 TATTATATATTATATTTTAATATCACTGTATTCCATTATAATGACATTTTTTGATTGCAAAGCAT +346 TTATTCATGCACCATTTTGCTCTTCATCATCAGTTTCAGTGCACATAAAGCCTATTTCCAGCTTT +411 TATATGAAGTTATATGGAGTA TAGCGTG TGTATGTGTGTGTATATATAGGTTTTTCTAACTTTAG +476 AATTATTATTTATCATTGTTATTAATATAATTATTATTATTATTGGTTTGATGATGATTGTTAAT +541 TATTTATTGCTTTGAATACTCCATATGGTCATTTAAACCCTTTATTGTTTCCCCACTTCTTTATT +606 TGAAATCATACTTGAAAATGCTATAAGATTTATGCATATGGTTGATGTTCAGA > Danio rerio Cytochrome P4501A Intr on 1 partial sequence and Exon 1 partial sequence …TATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATA TATATATATATTTATATTTATATGTAGGTTGTAGGTTTTTATGTTGCTGCACAGTATGCATGTGT GAGTATATCTTGCCTAATACAGGTGTGTGTGCATGTGCGTGTGTGTCTCAGATATGTGCTCTGAC CTTGAGACAAATCACTCCATGTGTAGTTTATCATTAATGAATTTTGCAATTCAAATAACCAACCA ATGCGCACTGGTTAAGCTGCACACTTATAGCATTTAGTTGCATAAAAACTCATGCATGTGCAGCA

PAGE 137

127 Appendix A continued TTAATGACAGACAGGTTGCGGAAACACACACCTTTCTCAGTATCGTTCATCTAAGAAGTGTTACT GTTAGACTTCTGCTGGCATCAAATTTACTTGTTGCAATTTATTGCTG AAGCTT GTAACTTGATAT ATGGTGTTATCACAATAGACTGCAAAATAAACTACTTTAACAGGTATAGCAACAATAATACTTGT ATTGATTTATCATTCAGGATAAACACATTTTTCAACTAAAATAAATTCTGAAAAAAATTATAAAG TACAACAGGTAACACTTTACATTAAAGATGAGTTAACACTAATTAATGTATTAAAATCTACAGTG ATAAAATGACATATTATGGTTGTGTTAAAGAAATATAAATAAATATTTTAAAATATCTTCTGTAA AACAACCGTCCTGGATGTTCTTGATCCCACTTAATACAATCCAGCCACAAAACATAGAAATTAGA CACAAACATTGTTCTGAACCGTAATAGTTTATTAAATCATTAAATAAATGCAAAGCTGACAGAGA CTTAAACAGCTGATGGAGTATAAACTAACCTGCACATTATTCAGACACTAGATGGCGCTAAAAAC AGTCAAAAACACAAAAGAAACTAAACAGCTGATGGAGTATACATTAACCTGCGCATTATTCACAC ACTAGATGGCGCTAAAAACAGTCAAAAACACAAAGCTGACAGACACTAAAACAGCTGATGGAGTA TACACTAACCTGCGCATTATTCAGACACTAGATGGCGCCAAACAGTCAAAAACACAACAGACACT AAAACAGCTGATGGAGTATACACTAACCTGCGCATTATTCAGACACTAGATGGCGCCAAACAGTC AAAAACACAACAGACACTAAAACAGCTGATGGAGTATGCACTAACCTGTGCATTATTCAGACACT AGATGGCACTAAAACAGTCAAAAACACAAAGCTAAAAAAACACGAACAGCTGATGGAGTATACAC TAACCTGCACATTATTCAGACACTAGATGGCGCTAAAAACAGTCAAAAACACAAAGCTGACAGAC ACTAAAACAGCTGATGGAGTATACACTAACCTGTGCATTATTCAGACACTAGATGGCGCTAAAAA CAGTCAAAAACACAAAGCTGACAGACACTAAAACAGCTGATGGAGTATACACTAACCTGCACATT ATTCAGACACTA… …TTCCATTTTCAGACACTAGATGGCGCCAACAGTCAAAACACACAAAAACACAACAGTTGATGGA GTATACACTAACCTGTGCATTATTCAGACACTAGAAGGCGCCAAACAGTTAAAAACACAACAGAC ACTAAAACAGCTGATGGAGTATACACTAACCTGCGCATTATTCAGACACTAGATGGCGCCAAACA GTTAAAAACACAACAGACACTAAAACAGCTGATGGAGTATACACTAACCTGCGCATTATTCAGAC ACTAGATGGCGCTAAACAGACAAAATCTGCAGTGTAAGTCAGCAGATACGTATAAACATGGACGT GTATTTAAATTTTGACATATGTGAATCTCAGTTCCGGGATGAGTCTGTATTATCCTGCAGTTGTT ATCTGTAAATAACATACCTTATTATTGTCACAACTGACCAATCAGAATCAAGTATTCTACACAAA ACCATGTAATAATTTTTACTAACAACCACCTGAATGTACTTAATTCCGCTTATTACATGGCTACT TACCACAAAGCATAAAAAAAGACTCAAAAATCAATTCAACAGTATATATTTAATAACTGATGGTG ATAATTACTGATATTCCCTCTCTAATACCTCATTTATGTCTGCTTCCTTCTAAACAG GTT ATTAA ATCAGCA ATG GCTCTGACTATTCTTCCAATATTGGGTCCGATTTCTGTGTCTGAGAGTCTCGTGG CCATTATAACAATATGTTTGGTGTATCTGCTCATGCGCCTAAACCGCACGAAAATCCCAGACGGG CTACAG AAGCTT > Danio rerio Cytochrome P4501A Exon 1 partial sequence AAGCTT CCCGGCCCGAAGCCTCTGCCGATTATCGGAAATGTCCTGGAAATCGGAAACAACCCACA TTTGAGTCTGACGGCCATGAGTAAGTGCTATGGCCCGGTTTTTCAGATCCAGATCGGCATGCGTC CTGTTGTCGTACTCAGTGGGAATGATGTGATCCGACAGGCGCTCCTAAAACAGGGCGAAGAGTTT

PAGE 138

128 Appendix A continued TCCGGACGTCCAGAATTGTACAGCACCAAGTTCATCAGTGATGGAAAGAGTCTGGCGTTCAGTAC GGATCAAGTCGGAGTCTGGAGAGCACGCCGAAAGCTGGCGCTCAATGCCCTGCGAACATTTTCAA CGGTGCAGGGAAAGAGTCCCAAATATTCCTGCGCCCTAGAGGAGCACATCAGTAATGAGGGTTTA TATTTGGTCCAGAGGCTGCACTCTGTTATGAAAGCCGATGG AAGCTT TGATCCATTCAGACATAT CGTAGTATCCGTGGCTAACGTAATCTGCGGGATCTGTTTCGGACGCCGGCATAGTCATGATGATG ATGAACTGGTGCGACTGGTTAATATGAGCGATGAGTTCGGGAAGATCGTGGGCAGCGGAAACCCT GCCGATTTCATCCCTTTCCTGCGCATTCTGCCGAGCACGACGATGAAGAAGTTCCTGGATATCAA CGAACGCTTCAGTAAATTCATGAAGAGGCTGGTGATGGAGCATTACGATACGTTCGATAAGG > Danio rerio Cytochrome P4501A Intr on 2 partial sequence and Exon 2 partial sequence TGGGGTGGGTTACGTTTGTGTGTGAGCTTATAGGAACATTCATTCATTCATTTTCGGCTTAGTCC CTTTATTAATCAGGGGTCACCACAGCAGAATGAACCACCAACTTATCCAGCACATGCTTTATGAA GCGCATGCCCTTCCAGCCGCAACCCATCACTGGGAAACACCCACACACTCTCATTCACACTCACA CACTACGGACAATTTAGCCTACCCAATTCCCCTACACCGCATGTGTTTGGACAGTGGGGGAAACC GGAGCACCCGGAGGAAACCCACACGAACGCAGGGAGAACATGCAAACTCCACACAGAAACACCAa ctgacccagctgaggatcgaaccagcaaccttcttgctgtgatgcgacagaagtacctactttta taatctttttatttattcaggagcagttttagcttagcttagcatccatcattgaatcagattag accattagcatctctctcaaaatattcaaaagttagactcttccatagtcgtgtatttattagtc acactggatcaataaaagcgggctgcacggtggcgtagtgggtagcacattcacctcacagcaag aaggtggctggttcgagcctcggctgggtcaggtggcgtttctgtgtggattttgcatgttctcc ctgtgtttgcgtgggtttcctccaggtgctccggtttcccccactgtccaaacgcatgtggtata ggtgaattgggtaggcgaaatgtgtgtgaataagtgtgtatgaatgattcccagtgatgggttgc agttggaagggcatccactgcataaaacatatgatgaataggttggtggttcattccgctgtggc gactccagattaatagagggacaaacctctagcttagcttagcttagcatagttcattgaatcag attagaccattagcatctctttcaaaaatgattatcaaagagttttgatgatttttctgactcct caagctttgaataggaaaataatccaaacaccttttacagttttttttagcaagatgctaatggt ctaatccgattcaatggtctatgctaagctaagttataagtcctccggccaaacttggagatcgg ctgaataaatccaataatgaaaaactcaaccgttaaactttagatctggggtgtccaaactcggt cctggagggctgttgtcctgcagattttagctccaacttgcctcaacacacctgcaaggatgttt ctagcttgttaaacagtggagtgtatcggtacttcacccaaaaatgtaaattctgtatataatta gttactcatcctcatttttaatccatcaccctaaaagcgacaatttgaatttattttaaaaaata gtaaatctgttgtaacttaaaagagttgacttaatttctaagttaatagtattttaaaaataaca gttatgcacacagtttttatttctattgtttattaagatccccattggccacaatattcctgggg

PAGE 139

129 Appendix A continued tccgacaaatgaaatgacaagtttagattaattcatcattaaaaacaataacaaaaaagctaatt taaattaaaataaaacaatagaaactttaaaaaaacacagaaaaaggctaattcacactaaacac aacaatagacatcaaaaccacaaccaactaaagacaaataagcattaaattacaaaaccaacaca ataaaacacactgtttcaatcatttgaaactatttatttaatttcaaggcaacgcattactcaaa ttttattgcatttattttagtttgatctccacatagataaacgatcttaaaaataggtcatttta aatagtgtttctctatcaggcaaatgtaatgttgcaagtttttccagtgtcgtgtggctcttcgt agctcattgtctgttaaatttttttcagg ACAACATCAGAGACATCACCGACTCTCTTATCAACC ACTGCGAAGACCGAAAACTGGACGAAAACTCCAACCTGCAAGTGTCCGATGAGAAGATCGTAGGA ATCGTCAATGACCTATTCGGAGCCGGTTTCGACACTATCAGTACGGCTCTGTCCTGGGCGGTTGT CTATCTAGTGCACTACCCAGAGGTCCAGGAGCGACTGCAAAGAGAATTGGATGAAAAGATCGGGA AGGATCGCACACCACTGTTATCTGACAGGGCGAACCTGCCGCTTCTGGAGTCCTTCATTCTGGAG ATCTTCCGTCATTCATCCTTCCTTCCCTTCACCATTCCTCACTGCACATCCAAAGACACGTCACT CAATGGCTATTTTATTCCCAAAGACACCTGCGTGTTTGTAAACCAGTGGCAAGTCAACCATGACC C GTAAGTTTCTCGTTATTAATCTGGTCTGATTTACAATGCTTTCTCAACACATTAAAAATACTGT AGTACTTACATACTATAGTCTATAAGTAACCATACCATAGTTTAGTTCTTGAACTGTTGTGGTGA TTCTACAGTTGCTATGGTAACACAACAACTTCAGTAATTAATCCATTGTGGCGATTGTACAGTTG CTATGGAAACACAATGACTAGAGTAATTGAGTTGTGGTGATTATACAGTTGCTATGGTAACAACA ACTATAGTAATTAATCTGTTGTGGTGATTCTACAGTTGCTATGGAAACACAACAACTATAGTAAT TGAGTTGTTGTGGTGATTCTACAGTTGCTATGGTAACACAACAACTATAGTAATTAATCCGTTGT GGTGATTCTACAATTGGTATGGAAACACAATGACTACCGTAATTGAGTTGTTGTGGTGATTCTAC AGTTGCTATGGTAACTCAACCACGATTGTAATTGATTGTTGTGGTTATTCTACAGTTGCTATGGT AACACAACAACTATAGTAATTAATCTGCTTTGATGATTCTAAAGTTGCTATGGTGACACAACAAC TATAGTATTTAATCCGTTGTGGTGATTCTACAGTTGCTATGGTAACACAACAACTATAGTTAATG ATCTGCTTTGATGATTCTATAGTTGCTATGGTAACACAACAACTGTACTATTATAAACAAATGAT CCAATACTGTAGTTTTCTACAACTATAGGGTATATTATACTACACTACATCACAGTGT ACTAGT a aaaaaggagtatgttacagtatttattataatttatcaggtcactgttgttaaactacagtatac tggaacattcattaacaaagtgttgtaaaaactataatatatatatgatattttacactttacta cagtatggttcacaaacactacagtattcaccatggatgaattgatatttaatttgtgactgata ccattagccgatgacttttaaaatttggagggtgttatctgatatataggccaatcaatgtgaat aataacatttctgcttgattgctaaaccaaaaggcaaacacatacagagaacaactctgaaatta atttatttagcaactattcatttctatggccagctttgctttcatataaaggaaatctattgaca aaaaacaacaacaacaaagcaataaagccattgaaaaagtggcacgcagcaagcatgtaaaatgg ctaaaccagaagaaataatacatctttaatcagcttattgaaccgataacaataatattaaatat agcgtataagactgtacattaatttagttaagcatttcatttgtgatttaacagtctttttatta atatgcagttttgcttattcattgtttttatcgtagtgtgatttattattgtgatctgattatgc ataagatgcaaatatatccacttaattctgttattggagctacaataatattacaaatagcattt atcagctgatattcatatggccactatcatgaatccccagtatttactataaattactgcacatt tatatgtgagtcaaaccaagctgaacctgttatttgtgtttgcagAGAACTGTGGAAGGATCCCT CGTCTTTTATTCCCGACCGGTTCCTCACTGCGGACGGTACTGAACTGAATAAGTTGGAAGGCGAG AAGGTGTTGGTTTTCGGTTTGGGAAAGCGCCGCTGCATTGGAGAGTCCATCGGACGCGCTGAAGT CTTCCTGTTCCTGGCCATCCTGCTGCAAAGGTTAAAGTTCACCGGGATGCCAGGAGAAATGCTGG ATATGACCCCAGAGTACGGGTTGACCATGAAACACAAGCGGTGTCTTCTTCGGGTCACACCACAG CCTGGGTTCTAGATCCAGAACTCCTCATCATGATCCAAAAATCAAAGATTGAGCCCCTGAAATCC AGGAAAACTGGCCAGCAGGTGGAGATGCTGAATATTAGAGATGTTTGTTCGCAGGTCAAAGCATC CGATGCATTCTGATGCAAGCACACTGCAAAATATATGCTATTATTACTTACTATTAGAGTTTTTG TCTTGCTTCTAGTCCAAATATCTCAAACGTCATTAATCAAGAAGCATTTTGTTGGCAAGTGAAAC ATCTTGTCTTGTTTTCAAATATAATGAGTGAAAATTAAATGACGTTTTCCGTAAAACAAGCAAAA TAATCTGCTTGCTCTGTTTAAAAAACTCTGTTAAACAGCTCTTTGGTAAGGAACTTTAATAATTG GATAGTTTTGTTGTAAATTGTGCATATATGCATATCAGATGCACGCTTGCATGGCCTTGTCCTTT CAAAACTGGAATGCTGATAATGTATTTGTGCTTTCAAACATACCGCGGTAAAGCACAGATCAGGA TGAAGAGTGCCTGTTTTAGCTGCGGTTTAGCTGTCTATCAAAGCAATGCCTTCTGTCTTCATAAG CTTAATGCAGATTCATCTGCCTGTCGACATACACTGATGCTGTTTTCTAATTGATGATGATCCCC

PAGE 140

130 GAATGTGATCCACATGTAAATACGCAGCGGCTGTTTCAATATGCACATTTTTTTTCCCATGTGCC TGATTTTACTTGTGTACAGATTTGTAATATCTACTTTTTGTATTTATCAAAGTGCTTAATCAGAT GTTTATTTCCTTGAGATATCGTGTCTGTGACCTGCTGAAACTCTTCGCAGGTGCTCATAATTGTA TTATGAAGGAATTCTGAAGTACTACTGCTATAATTAATTCATGCTAACATGGTCTCCAATGGCAG TTTGTTGTTGCATAGCATATTTATGATGTTGGCAAAATAAATAATAAAACTTCTACTGCTG

PAGE 141

131 Appendix B Construct Maps This appendix contains maps of constructs uses in the experiments outlined in this report. The names and size of the constr ucts in base pairs are indicated. Pertinent restriction enzyme sites are noted along w ith their numerical positions. Bold faced numbers represent the position of the indicated DNA insert relative to the transcriptional start site. The diagrams below the maps repr esent the portion(s) of the regulatory region within the construct. XREs are shown as shaded rectangles. The XRE designation and its position relative to the transc riptional start site are indicated.

PAGE 142

132 Appendix B continued Figure AB1. p-2608/-2100Fup SalI NcoI HindIII(753) BamHI SacI(513) XbaI (2710) (786) (5) (2704) (2442) KpnI p-2608/-2100Fup5518bp -2100 2 6 08 MluII-523 NheI-529 SmaI-536 XhoII-540 BglII-544 -2100K p nI -2608SacI

PAGE 143

133 Appendix B continued Figure AB2. p-2608/-2100Rup SalI NcoI HindIII(753) BamHI SacI(513) XbaI (2710) (786) (5) (2704) (2442) KpnI p-2628/-2100Rup5518bp -2100 -2608 MluII-523 NheI-529 SmaI-536 XhoII-540 BglII-544 -2100K p n I -2608S a cI

PAGE 144

134 Appendix B continued Figure AB3. p-2608/-2100Fdown SalI NcoI HindIII(245) BamHI SacI-11 XbaI (2710) (278) (2196) (1934) KpnI-5 p-2608/-2100Fdown5518bp -2100 -2608 MluII-15 NheI-21 SmaI-28 XhoII-32 BglII-36 -2100K p n I -2608S a c I

PAGE 145

135 Appendix B continued Figure AB4. p-2608/-2100Rdown SalI NcoI HindIII(245) BamHI SacI-11 XbaI (2710) (278) (2196) (1934) KpnI-5 p-2608/-2100Rdown5518bp -2100 -2608 MluII-15 NheI-21 SmaI-28 XhoII-32 BglII-36 -2100K p nI -2608S a cI

PAGE 146

136 Appendix B continued Figure AB5. p-580/-187Fup SalI NcoI HindIII(638) BamHI SacI(404) XbaI (2595) (671) (5) (2589) (2327) KpnI p--580/-187Fup5403bp -187 5 8 0 MluII-408 NheI-414 SmaI-421 XhoII-425 BglII-429 -187KpnI -580Sac I

PAGE 147

137 Appendix B continued Figure AB6. p-580/-187Fdown SalI NcoI HindIII(245) BamHI SacI-11 XbaI (2595) (278) (2196) (1934) KpnI-5 p-580/-187Fdown5403bp -187 -580 MluII-15 NheI-21 SmaI-28 XhoII-32 BglII-36 -187KpnI -580SacI

PAGE 148

138 Appendix B continued Figure AB7. P-580/+71Basic SalI NcoI HindIII(704) BamHI NheI(21) SacI(11) XbaI (2661) (737) (5) (2655) (2393) KpnI p-580/+71Basic5469bp SacI(559) -580 +71 MluII(15) -42 -580+71NheIHindIII -42SacI

PAGE 149

139 Appendix B continued Figure AB8. p-2608/-2100Uf SalI NcoI HindIII(1174) BamHI NheI(523) SacI(513) XbaI (3169) (1245) (5) (3163) (2901) KpnI p-2608/-2100Uf5977bp SacI(1061) -2100 2 6 08 -580 +71 MluI(517) -2100 -2608-580+71KpnISacINheIHindIII -42SacI

PAGE 150

140 Appendix B continued Figure AB9. p-2608/-2100Ur SalI NcoI HindIII(1174) BamHI NheI(523) SacI(513) XbaI (3169) (1245) (5) (3163) (2901) KpnI p-2608/-2100Uf5977bp SacI(1061) 2 100 -2608 -580 +71 MluI(517) -2100-2608-580+71KpnISacINheIHindIII -42SacI

PAGE 151

141 Appendix B continued Figure AB10. p-Om-1897/-1392Uf SalI NcoI HindIII(1171) BamHI NheI(520) SacI(510) XbaI (3166) (1242) (5) (3160) (2898) KpnI p-Om-1897/-1392Uf5974bp SacI(1058) -1392 1897 -580 +71 MluI(514) -1392 -1897-580+71KpnISacINheIHindIII -42SacI

PAGE 152

142 Appendix B continued Figure AB11. p-Om-1897/-1392Ur SalI NcoI HindIII(1171) BamHI NheI(520) SacI(510) XbaI (3166) (1242) (5) (3160) (2898) KpnI p-Om-1897/-1392Ur5974bp SacI(1058) 139 2 -1897 -580 +71 MluI(514) -1392-1897-580+71KpnISacINheIHindIII -42SacI

PAGE 153

143 Appendix B continued Figure AB12. p-Mm—1315/-819Uf SalI NcoI HindIII(1168) BamHI NheI(517) SacI(510) XbaI (3163) (1242) (5) (3160) (2898) KpnI p-Mm-1315/-819Uf5965bp SacI(1055) 1315 -819 -580 +71 MluI(511) -1315 -819 -580+71KpnISacINheIHindIII -42SacI

PAGE 154

144 Appendix B continued Figure AB13. p-Mm-1315/-819Ur SalI NcoI HindIII(1168) BamHI NheI(517) SacI(510) XbaI (3163) (1242) (5) (3160) (2898) KpnI p-Mm-1315/-819Ur5965bp SacI(1055) -1315 8 1 9 -580 +71 MluI(511) -1315 -819 -580+71KpnISacINheIHindIII -42SacI

PAGE 155

145 Appendix B continued Figure AB14. p--2699/+71 SalI NcoI HindIII(2775) BamHI XbaI (4780) (2856) (5) (4774) (4512) KpnI p-2699/+717588bp SacI(2662) +71 -2699 XhoI-27 SalI-33 ClaI-43 HindIII-48 EcoRV-56 EcoRI-60 PstI-70 SmaI-74 BamHI-78 SpeI(81) XhoI(630) HindIII KpnI-2699 +71 -2079XhoI -42SacI -262 8 SpeI BamHI(-2626) ClaI(-2661) EcoRI(-2644) EcoRV(-2648) HindIII(-2656) PstI(-2634) SalI(-2671) SmaI(-2630) XhoI(-2677)

PAGE 156

146 Appendix B continued Figure AB15. p—2608/+71 SalI NcoI HindIII(2754) BamHI XbaI (4759) (2835) (5) (4753) (4491) KpnI p-2608/+717476bp SacI(2641) +71 2 6 0 8 GTCGAG(630) HindIII KpnI-2608 +71 -2100 / -2079 -42SacI GTCGAG

PAGE 157

147 Appendix C Additional Studies Generation of destabilized EGFP and EYFP constructs In order to gain a bette r understanding of the ti mecourse of AHR-induced genes, constructs were generated which cont ain a gene encoding a destabilized enhanced green fluorescent protein (dEGFP) under contro l of the zfCYP1A regulatory region. The purpose of destabilizing the EYFP was to ensure that the fluo rescent signal produced is not persistent and can be representative of transcriptional activ ity over time without protein accumulation from earlier transcripti onal activity. To pr oduce a destabilized EGFP, the degradation domain of the mouse ornithine decarboxylase gene was fused to the EGFP coding sequence. Additionally, a 3x nuclear localization signal was fused to the amino terminus of EGFP to generate a nuclear fluorescent signal which would be easier to view via fluorescent microscopy. PCR was utili zed to make the constructs such that primers were synthesized which amp lified both the 3xNLS and the dEGFP with overhangs respectively complementary to each other. An additional PCR cycle was run using both products as template, the forward NLS primer, and the reverse dEGFP primer. A non-destabilized EGFP was also generate d by using a reverse EYFP primer which precedes the ornithine decarboxylase degradati on domain and includes a stop codon. The

PAGE 158

148 Appendix C continued 3xNLS template was purchased as a doubl e stranded oligonucleotide. The pd2EGFP vector (Clontech) was used as a template for the dEGFP. The primers used are listed below. I ndicated restriction enzyme sites are underlined. 3xNLS double strande d oligonucleotide: 5’CCGAGATCCGGTGGATCCCACTCTTTTCTTTTTGGGGTCCACCCTTTTTTTTTTT 3’GGCTCTAGGCCACCTAGGGTGAGAAAAGAAAAACCCCAGGTGGGAAAAAAAAAAA GGGTCAACCCGCTTCTTCTTAGGATCCATGGTGGGATATCTGAC -3’ CCCAGTTGGGCGAAGAAGAATCCTAGGTACCACCCTATAGACTG -5’ P1 FOR 3XNLS EcoRV – 5’ATCGTCAGATATC CCACCATGGATCC P2 REV 3XNLS –5’ CAGCTCCTCGCCCTTGCTCACCATCCGAGATCCGGTGGAT CCCACTCT P3 FOR GFP – 5’AGAGTGGGATCCACCGGATCTCGGATGGTGAGCAAGGGCG AGGAGCTG P4 REV GFP XbaI – 5’CCTCCATCTAGA CTACACATTGATCCTAGCAG After creating the recombinant GFP inserts they were ligated into the multiple cloning site of pcDNA 3.1 (Cl ontech) and termed p-EGFP and p-dEGFP. Transfection of the constructs into Hepa1c1c 7 cells, however failed to pr oduce fluorescence. The reason for the failure of the constructs to work is unknown. To allow for the problem lying within the GFP, additional constructs were made containing the coding sequence for an enhanced yellow fluorescent protein (EY FP) known to work previously. These constructs were assembled modularly such th at PCR was utilized to amplify the ODC and NLS from p-dEGFP with primers containing re striction enzyme sites integrated into them. EYFP was amplified from p-EY FP-C1 (Clontech) using primers with

PAGE 159

149 Appendix C continued Figure AC1. Strategy for Ge nerating EYFP Constructs Fig. AC1. Strategy for Gen erating EYFP Constructs. Schematic representation of the EY FP inserts used to generate EYFP constructs. EYFP = Enhanced yellow fluoresce nt protein. NLS = 3x nuclear localization signal. ODC = ornithin e decarboxylase degradation domain. Restriction sites and the PCR primers w ithin which they are integrated are indicated

PAGE 160

150 Appendix C continued corresponding restriction enzyme sites. To ensure the lack of function exhibited by pdEGFP was not due to the ornithine decarboxy lase cassette or the nuclear localization sequence, the new constructs were assemb led containing only the EYFP cassette, (pEYFP), the EYFP cassette with the ODC degradation domain, (p-dEYFP), the EYFP cassette with the 3xNLS, (p-NLSEYFP), and the EYFP with both the ODC and NLS, (pNLSdEYFP). A schematic overview of the modu lar assembly of the EYFP constructs is shown in Figure AC1. The primers used for the creation of the EY FP constructs follow. 3xNLS double strande d oligonucleotide: 3xNLS – 5’CTAGC CCCACCATG CCA CCT AAG AAA AAA AGA AAG GTT 3’G GGGTGGTAC GGT GGA TTC TTT TTT TCT TTC CAA GAA GAT CCTGGTAC -3’ CTT CTA GGAC -5’ P1 FOR 3xNLS NheI – 5’ATCGTCAGCTAGC CCACCATGGATCC EYFP IN NheI – 5’TTTTGCTAGC CCACCATGGTGAGCAAGGGC P4 REV EYFP HindIII – 5’TTTTAAGCTT TCACTTGTACAGCTCGT EYFP OUT FOR ODC – 5’TTTTAAGCTT GTACAGCTCGTC ODC IN HindIII – 5’TTTTAAGCTT AGCCATGGCTTC ODC OUT BamHI – 5’TTTTGGATCC CTACACATTGATCCT The appropriate modules were ligated into pcDNA 3.1 and the constructs were once again transfected into Hepa1c1c7 cells. Fluorescence microsc opy revealed that a

PAGE 161

151 Appendix C continued Figure AC2. Constrct Maps of p-EYFP and p-dEYFP MluI NheI HindIII BamHI EcoRI EcoRV NotI XhoI XbaI (229) (1388) (2113) (2236) (2259) (2269) (2285) (2292) (2298) KpnI BamHI (2118) (2130) *# # # # # #(2153) (2163) (2179) (2186) (2192) * p-2628/-2100UrEYFP/dEYFP#6630/6736bp#*EYFPonly dEYFPonly MluI NheI EcoRV NotI XhoI XbaI (229) (1388) (2300) (2316) (2323) (2329) *# # # # #(2177)* (2193) (2200) (2206) * p-2628/-2100UrNLS-EYFP/dEYFP#6630/6736bp NLS KpnI (1442) EcoRI (2167) EcoRI (2290) Fig. AC2. Construct maps of p-EYFP and p-dEYFP. Maps of the p-EYFP and p-dEYFP plasmids. The size of the constructs in base pairs is shown. Pertinent restriction enzyme sites ar e indicated. EYFP = enhanced yellow fluorescent protein. NLS = 3x nuclear lo calization signal. ODC = ornithine decarboxylase degradation domain.

PAGE 162

152 Appendix C continued fluorescent signal was produced by all constr ucts. The cells transfected with pNLSEYFP and p-NLSdEYFP however, did not app ear to localize to the nucleus and was dispersed throughout the cells. Treatment of transfected cells with cycloheximide additionally did not show a difference in th e rate of degradati on between p-EYFP and pdEYFP as expected. To test whether or not the EYFP coul d be controlled by an AHR dependant promoter, the recombinant EYFP inserts were cloned downstream of the zebrafish CYP1A enhancer region (-2628/-2100) and th e zfCYP1A promoter (580/+71). Maps of these constructs can be seen in Figure AC2. These constructs, termed p-2628/2100UrEYFP, p-2628/-2100UrdEYFP, p2628/-2100UrNLSEYFP, and p-2628/2100UrNLSdEYFP were then transfected into Hepa1c1c7 which were treated with vehicle dimethylsulfoxide or TCDD. The cel ls produced a fluorescent signal, however the signal was produced even in the abse nce of TCDD to the same levels as TCDD treated cells. The reason for the constitutive activity is unknown but may be due to moderate basal levels exhibi ted by luciferase constructs bearing the same regulatory region. As seen in previous experiments with p-EYFP, p-dEYFP, and p-NLSEYFP, the signal did not localize to the nucleus or appe ar to degrade at an accelerated rate when treated with cycloheximide. Sequencing of the constructs revealed th at the inserts had no aberrations. Further work will have to be done to design constructs capable of being used to address the timecourse of AHR-induced genes.

PAGE 163

153 Appendix C continued ARNT Domain Swapping To assess the role the bHLH, PAS, and TAD domains of ARNT and ARNT2 have on their function, the coding regions of the human ARNT and mouse ARNT2 genes were analyzed and a strategy to insert rest riction enzyme sites between domains was devised. PCR was utilized to alter nucleotides within the coding region to create unique restriction sites which did not alter the amino acids being encoded. The nucleotide and corresponding amino acid sequences of the human and mouse ARNT and ARNT2 are listed below. Ge nerated restriction enzyme sites are bold faced. Mutated nucleotides are capitalized a nd underlined. A schematic overview of the domains and the restriction enzyme s ites can be seen in Figure AC3. >C57/BL6 Mouse ARNT I S T M A A T T A N P E M T S D V P S L 3 atctcgaccatggcggcgactacagctaacccagaaatgacatcagatgtaccatcgctg 62 G P T I A S G N P G P G I Q G G G A V V 63 ggtcccaccattgcttctggaaaccctggacctgggattcaaggtggaggagctgttgta 122 Q R A I K R R S G L D F D D E V E V N T 123 cagagggctattaagcgacggtcagggctggattttgatgatgaagtagaagtgaacact 182 K F L R C D D D Q M C N D K E R F A R S 183 aaatttttgagatgcgatgatgaccagatgtgtaatgacaaggagcggtttgccaggtcg 242 D D E Q S S A D K E R L A R E N H S E I 243 gatgatgagcagagctctgcggataaagagagacttgccagggaaaatcatagtgaaata 302 E R R R R N K M T A Y I T E L S D M V P 303 gaacggcggcgacggaacaagatgacagcttacatcacagaactgtcagacatggtacct 362 T C S A L A R K P D K L T I L R M A V S 363 acatgtagtgccctggctcgaaaaccagacaagctaaccatcttacgcatggccgtttct 422 H M K S L R G T G N T S T D G S Y K P S 423 cacatgaagtccttgaggggaactggcaacacatctactgatggctcctacaagccatct 482 F L T D Q E L K H L I L E A A D G F L F 483 ttcctcactgatcaggaactgaaacatttgatc C tC gag gcagcagatggctttctgttt 542 I V S C E T G R V V Y V S D S V T P V L 543 attgtctcctgtgagactggacgggtggtgtatgtctctgactcagtgactcccgttttg 602 N Q P Q S E W F G S T L Y D Q V H P D D 603 aaccagccacagtctgaatggttcgggagcacactgtatgatcaggtgcacccagatgat 662 V D K L R E Q L S T S E N A L T G R V L 663 gtggataaacttcgagagcagctctctacatcagaaaatgccctaacagggcgggtcctg 722 D L K T G T V K K E G Q Q S S M R M C M 723 gatctgaagactggaacagtgaaaaaggaaggccagcagtcttccatgaggatgtgcatg 782 G S R R S F I C R M R C G T S S V D P V 783 ggctcacgaaggtcgttcatctgccgcatgaggtgtggtactagctccgtggaccctgtt 842 S M N R L S F L R N R C R N G L G S V K 843 tccatgaatagactgagctttttgaggaacagatgcaggaatgggcttggctctgtgaag 902 E G E P H F V V V H C T G Y I K A W P P

PAGE 164

154 Appendix C continued 903 gaaggagaacctcactttgtggtagtccactgc acC ggT tacatcaaggcctggccacca 962 A G V S L P D D D P E A G Q G S K F C L 963 gcaggtgtctccctcccagatgatgacccagaggctggccaggggagcaaattctgccta 1022 V A I G R L Q V T S S P N C T D M S N I 1023 gtggccattggcaggctgcaggtaactagttctcccaactgtacagacatgagtaacatt 1082 C Q P T E F I S R H N I E G I F T F V D 1083 tgtcagccaacagagttcatctcccgacacaacattgaagggatattcacttttgtagac 1142 H R C V A T V G Y Q P Q E L L G K N I V 1143 catcgttgtgtggctactgttggctaccagccacaggagctcttagggaagaatattgta 1202 E F C H P E D Q Q L L R D S F Q Q V V K 1203 gaattttgtcatcctgaagaccaacaacttctaagagacagctttcagcaggtggtgaaa 1262 L K G Q V L S V M F R F R S K T R E W L 1263 ttaaaaggtcaggtgctgtccgtcatgttccgattccgatctaagacccgagaatggctg 1322 W M R T S S F T F Q N P Y S D E I E Y I 1323 tggatgagaacgagctcctttaccttccaaaacccttattcagatgaaattgagtatatt 1382 I C T N T N V K N S S Q E P R P T L S N 1383 atctgcaccaacaccaatgtgaagaactctagccaggaaccacggcctacactgtccaac 1442 T I P R S Q L G P T A N L S L E M G T G 1443 accatcccaaggtcacaactaggtccgacagccaatttatccctagagatgggtacaggg 1502 Q L P S R Q Q Q Q Q H T E L D M V P G R 1503 cagctgcca tcT agA cagcagcagcagcagcacacagaactggatatggtaccaggaaga 1562 D G L A S Y N H S Q V S V Q P V A S A G 1563 gatgggctggccagctataatcattcccaggtttctgtccagcctgtggcaagtgcagga 1622 S E H S K P L E K S E G L F A Q D R D P 1623 tcagaacacagcaagccccttgagaagtcagaaggtctctttgcacaggacagagatcca 1682 R F P E I Y P S I T A D Q S K G I S S S 1683 aggtttccagaaatctatcccagcatcactgcagatcagagtaaaggcatctcctccagc 1742 T V P A T Q Q L F S Q G S S F P P N P R 1743 actgtccctgccacccaacagctgttctcccagggcagctcattccctcctaacccccgg 1802 P A E N F R N S G L T P P V T I V Q P S 1803 ccggcagagaatttcaggaatagtggtcttacccctcctgtaaccattgtccagccatca 1862 S S A G Q I L A Q I S R H S N P A Q G S 1863 tcttctgcagggcagatactggcccagatttcacgtcactccaaccctgcccagggatca 1922 A P T W T S T S R P G F A A Q Q V P T Q 1923 gcgccgacctggacctctacgtcccgcccaggctttgccgcccagcaggtgcccacccag 1982 A T A K T R S S Q F G V N N F Q T S S S 1983 gctacagccaagactcgttcttcccaatttggtgtgaacaactttcagacttcttcctcc 2042 F S A M S L P G A P T A S S G T A A Y P 2043 ttcagtgctatgtctcttccgggtgctcccactgcctcatctggtactgctgcctaccct 2102 A L P N R G S N F P P E T G Q T T G Q F 2103 gctctccccaaccgtggctccaactttcctcctgagactggacagaccacaggacagttc 2162 Q A R T A E G V G V W P Q W Q G Q Q P H 2163 caggcccggacagcagagggcgtgggggtctggccacagtggcagggccagcagccccat 2222 H R S S S S E Q H V Q Q T Q A Q A P S Q 2223 catcggtctagttccagtgagcagcatgttcagcagacacaagcacaagcacctagccag 2282 P E V F Q E M L S M L G D Q S N T Y N N 2283 cctgaggtctttcaagaaatgctgtccatgctgggagaccaaagcaacacctacaacaat 2342 E E F P D L T M F P P F S E N Y W G E 2343 gaagaatttcctgatctaactatgtttccccccttttccgaatagaactattggggtgag 2402 D K G G G K S L F V F K S K S F V N R I 2403 gataagggtggggggaaatcactgtttgtttttaaaagcaaatcttttgtaaacagaata 2462 K V L S L R S S P F P S L T P D M Y P F 2463 aaagtcctctccctccgttcctctcccttcccttccctcacccctgatatgtaccctttc 2522 P P P L A E E T Y R R N M N F P G F 2523 ccacccccttgacttgctgaagaaacgtatagaagaaattaaatgaatttcccaggcttt 2582 D P L K F G V R P E 2583 taggatcctctgaaattttgaggataggtgaggcctgaatc 2623

PAGE 165

155 Appendix C continued >C57/BL6 Mouse ARNT2 P A L R S L P G K M A T P A A V N P P E 3 ccggcgctccggtcccttcccggcaagatggcaaccccggccgccgtcaaccctccggag 62 M A S D I P G S V A L P V A P M A A T G 63 atggcgtcagacataccaggatctgtggccttgcctgttgcccccatggcagccaccgga 122 Q V R M A G A M P A R G G K R R S G M D 123 caggtgagaatggcaggggccatgcctgcccgaggaggaaagcgtcgatccggaatggac 182 F D D E D G E G P S K F S R E N H S E I 183 ttcgatgacgaagatggtgaaggtcccagtaaattctcaagagagaaccacagtgagatt 242 E R R R R N K M T Q Y I T E L S D M V P 243 gagcggcgcaggcggaacaagatgactcaatatattacggaactctccgacatggttccc 302 T C S A L A R K P D K L T I L R M A V S 303 acctgcagtgcactggctaggaagccagacaagctgaccatcctgcgcatggcggtctcg 362 H M K S M R G T G N K S T D G A Y K P S 363 cacatgaagtccatgaggggcaccggcaacaaatcgactgacggcgcctacaagccttcc 422 F L T E Q E L K H L I L E A A D G F L F 423 ttcctcactgagcaggaactgaagcatctcatc ctC gaG gccgctgatggatttctgttt 482 V V A A E T G R V I Y V S D S V T P V L 483 gtggtggcagctgagacagggagagtcatctacgtgtctgattcggtcactcctgtcctg 542 N Q P Q S E W F G S T L Y E Q V H P D D 543 aaccagccacagtcagagtggtttgggagcacgctttatgagcaggtgcaccctgatgac 602 V E K L R E Q L C T S E N S I T G R I L 603 gtggagaaactgagggaacagctgtgcacttcggaaaactccattacaggccgcatcctg 662 D L K T G T V K K E G Q Q S S M R M C M 663 gacctgaagactgggacagtgaagaaggagggacagcagtcatccatgcgcatgtgtatg 722 G S R R S F I C R M R C G N A P L D H L 723 ggctctcggcgctccttcatctgtaggatgaggtgtggaaacgctcccttggaccacctg 782 P L N R I T T M R K R F R N G L G P V K 783 cctttgaacagaataaccaccatgaggaaaaggttcaggaatggccttggccctgtgaaa 842 E G E A Q Y A V V H C T G Y I K A W P P 843 gaaggagaagcccagtatgctgtggtccactgc acC ggt tacatcaaggcttggccacca 902 A G M T I P E E D A D V G Q G S K Y C L 903 gcaggaatgaccatacccgaagaagatgctgatgtcggacaaggcagtaaatattgcctc 962 V A I G R L Q V T S S P V C M D M S G M 963 gtggcaattgggaggctccaggtgaccagctctcctgtgtgcatggacatgagcggcatg 1022 S V P T E F L S R H N S D G I I T F V D 1023 tcagtgcccacagagttcctgtcacggcacaactctgatgggattatcacgtttgtggac 1082 P R C I S V I G Y Q P Q D L L G K D I L 1083 cccagatgcatcagtgtgattggctaccagccccaggaccttctgggaaaggatattttg 1142 E F C H P E D Q S H L R E S F Q Q V V K 1143 gaattttgccaccctgaggatcagagccacctacgggagagcttccaacaggtggttaag 1202 L K G Q V L S V M Y R F R T K N R E W L 1203 ctgaagggccaagtgctgtcggtcatgtatcggttccgcaccaagaaccgggagtggctg 1262 L I R T S S F T F Q N P Y S D E I E Y V 1263 ttgatccgtaccagcagcttcaccttccagaacccctactctgatgagatcgagtacgtc 1322 I C T N T N V K Q L Q Q Q Q A E L E V H 1323 atctgcaccaacaccaatgtcaagcaacttcagcaacagcaggcagaactggaggtacat 1382 Q R D G L S S Y D L S Q V P V P N L P A 1383 cagcgagatgggctgtcgtcatatgacttatctcaggtcccagtacccaacctacccgct 1442 G V H E A G K S V E K A D A I F S Q E R 1443 ggtgttcacgaggccgggaagtctgtggaaaaggcagatgcaatcttctcccaagagaga 1502 D P R F A E M F A G I S A S E K K M M S 1503 gaccctcgttttgctgagatgtttgcaggcatcagtgcatctgagaagaagatgatgagc 1562 S A S A S G S Q Q I Y S Q G S P F P A G 1563 tcagcctcagcatcaggcagccagcagatctactcccaaggaagtccattccctgccggg 1622 H S G K A F S S S V V H V P G V N D I Q 1623 cactcgggcaaggccttcagctcttccgtggtccatgtgcctggagtgaatgacattcag 1682 S S S S T G Q N I S Q I S R Q L N Q G Q 1683 tcctcctcctcaacgggacagaacatatcccagatc tctA gA cagctgaaccagggccag 1742 V A W T G S R P P F P G Q P S K T Q S S 1743 gtggcatggacaggcagccgtccaccgttcccagggcagcccagcaagacgcagtcatct 1802 A F G I G S S H P Y P A D P S S Y S P L 1803 gccttcggaattggatcaagccacccttacccggctgacccttcatcctacagtcctctc 1862

PAGE 166

156 Appendix C continued S S P A A S S P S G N A Y P S L A N R T 1863 tccagcccagctgcctcctcaccaagtggaaacgcataccccagtcttgccaacaggact 1922 P G F A E S G Q S G G Q F Q G R P S E V 1923 ccagggtttgctgagagtggacagagtggcgggcagttccagggccggccctcggaggtc 1982 W S Q W Q S Q H H G Q Q S G E Q H S H Q 1983 tggtcccagtggcagagccagcatcacggacagcagagcggtgagcagcactcgcatcag 2042 Q P G Q T E V F Q D M L P M P G D P T Q 2043 cagcctggccagactgaagtgttccaggacatgctacccatgccgggcgacccgacgcag 2102 G T G N Y N I E D F A D L G M F P P F S 2103 gggactggcaactataacatcgaggactttgctgacctgggcatgttccctccattttct 2162 E L Q A K P G F Y C P D A I I M P M 2163 gagtagcttcaggcaaagccaggcttctactgcccagacgctattatcatgccatagatg 2222 P M F K E G P P H P A C P A V E P P E I 2223 cccatgttcaaagagggtccccctcacccagcttgccctgctgtagaacccccagaaatc 2282 S L I P H P P W T W H H L A L T H S P G 2283 tcccttattccccatcctccctggacatggcatcacctggctctaacccacagccctggc 2342 F L G L G S L Y L L Y F I C V L G R G P 2343 ttcttgggtttgggatctttgtatttattgtactttatctgtgtgctcggaagggggccg 2402 P G S I P L I I Y W 2403 ccagggtcttaaatcccattgtgaataatctattaatggac 2443 >Human ARNT G G S S H W G G G G A A A V A S A A M A 3 ggcggctcctcccactggggggggggtggcgcggcggcggtggcatctgcggccatggcg 62 A T T A N P E M T S D V P S L G P A I A 63 gcgactactgccaaccccgaaatgacatcagatgtaccatcactgggtccagccattgcc 122 S G N S G P G I Q G G G A I V Q R A I K 123 tctggaaactctggacctggaattcaaggtggaggagccattgtccagagggctattaag 182 R R P G L D F D D D G E G N S K F L R C 183 cggcgaccagggctggattttgatgatgatggagaagggaacagtaaatttttgaggtgt 242 D D D Q M S N D K E R F A R S D D E Q S 243 gatgatgatcagatgtctaacgataaggagcggtttgccaggtcggatgatgagcagagc 302 S A D K E R L A R E N H S E I E R R R R 303 tctgcggataaagagagacttgccagggaaaatcacagtgaaattgaacggcggcgacgg 362 N K M T A Y I T E L S D M V P T C S A L 363 aacaagatgacagcctacatcacagaactgtcagatatggtacccacctgtagtgccctg 422 A R K P D K L T I L R M A V S H M K S L 423 gctcgaaaaccagacaagctaaccatcttacgcatggcagtttctcacatgaagtccttg 482 R G T G N T S T D G S Y K P S F L T D Q 483 cggggaactggcaacacatccactgatggctcctataagccgtctttcctcactgatcag 542 E L K H L I L E A A D G F L F I V S C E 543 gaactgaaacatttgatc C tC gag gcagcagatggctttctgtttattgtctcatgtgag 602 T G R V V Y V S D S V T P V L N Q P Q S 603 acaggcagggtggtgtatgtgtctgactccgtgactcctgttttgaaccagccacagtct 662 E W F G S T L Y D Q V H P D D V D K L R 663 gaatggtttggcagcacactctatgatcaggtgcacccagatgatgtggataaacttcgt 722 E Q L S T S E N A L T G R I L D L K T G 723 gagcagctttccacttcagaaaatgccctgacagggcgtatcctggatctaaagactgga 782 T V K K E G Q Q S S M R M C M G S R R S 783 acagtgaaaaaggaaggtcagcagtcttccatgagaatgtgtatgggctcaaggagatcg 842 F I C R M R C G S S S V D P V S V N R L 843 tttatttgccgaatgaggtgtggcagtagctctgtggacccagtttctgtgaataggctg 902 S F V R N R C R N G L G S V K D G E P H 903 agctttgtgaggaacagatgcaggaatggacttggctctgtaaaggatggggaacctcac 962 F V V V H C T G Y I K A W P P A G V S L 963 ttcgtggtggtccactgc acC ggT tacatcaaggcctggcccccagcaggtgtttccctc 1022 P D D D P E A G Q G S K F C L V A I G R 1023 ccagatgatgacccagaggctggccagggaagcaagttttgcctagtggccattggcaga 1082 L Q V T S S P N C T D M S N V C Q P T E 1083 ttgcaggtaactagttctcccaactgtacagacatgagtaatgtttgtcaaccaacagag 1142 F I S R H N I E G I F T F V D H R C V A 1143 ttcatctcccgacacaacattgagggtatcttcacttttgtggatcaccgctgtgtggct 1202

PAGE 167

157 Appendix C continued T V G Y Q P Q E L L G K N I V E F C H P 1203 actgttggctaccagccacaggaactcttaggaaagaatattgtagaattctgtcatcct 1262 E D Q Q L L R D S F Q Q V V K L K G Q V 1263 gaagaccagcagcttctaagagacagcttccaacaggtagtgaaattaaaaggccaagtg 1322 L S V M F R F R S K N Q E W L W M R T S 1323 ctgtctgtcatgttccggttccggtctaagaaccaagaatggctctggatgagaaccagc 1382 S F T F Q N P Y S D E I E Y I I C T N T 1383 tcctttactttccagaacccttactcagatgaaattgagtacatcatctgtaccaacacc 1442 N V K N S S Q E P R P T L S N T I Q R P 1443 aatgtgaagaactctagccaagaaccacggcctacactctccaacacaatccagaggcca 1502 Q L G P T A N L P L E M G S G Q L A P R 1503 caactaggtcccacagctaatttacccctggagatgggctcaggacagctggcacccagg 1562 Q Q Q Q Q T E L D M V P G R D G L A S Y 1563 cagcagcaacagcaaacagaattggacatggtaccaggaagagatggactggccagctac 1622 N H S Q V V Q P V T T T G P E H S K P L 1623 aatcattcccaggtggttcagcctgtgacaaccacaggaccagaacacagcaagcccctt 1682 E K S D G L F A Q D R D P R F S E I Y H 1683 gagaagtcagatggtttatttgcccaggatagagatccaagattttcagaaatctatcac 1742 N I N A D Q S K G I S S S T V P A T Q Q 1743 aacatcaatgcggatcagagtaaaggcatctcctccagcactgtccctgccacccaacag 1802 L F S Q G N T F P P T P R P A E N F R N 1803 ctattctcccagggcaacacattccctcctaccccccggccggcagagaatttcaggaat 1862 S G L A P P V T I V Q P S A S A G Q M L 1863 agtggcctagcccctcctgtaaccattgtccagccatcagcttctgcaggacagatgttg 1922 A Q I S R H S N P T Q G A T P T W T P T 1923 gcccagatt tcTA gA cactccaaccccacccaaggagcaaccccaacttggacccctact 1982 T R S G F S A Q Q V A T Q A T A K T R T 1983 acccgctcaggcttttctgcccagcaggtggctacccaggctactgctaagactcgtact 2042 S Q F G V G S F Q T P S S F S S M S L P 2043 tcccagtttggtgtgggcagctttcagactccatcctccttcagctccatgtccctccct 2102 G A P T A S P G A A A Y P S L T N R G S 2103 ggtgccccaactgcatcgcctggtgctgctgcctaccctagtctcaccaatcgtggatct 2162 N F A P E T G Q T A G Q F Q T R T A E G 2163 aactttgctcctgagactggacagactgcaggacaattccagacacggacagcagagggt 2222 V G V W P Q W Q G Q Q P H H R S S S S E 2223 gtgggtgtctggccacagtggcagggccagcagcctcatcatcgttcaagttctagtgag 2282 Q H V Q Q P P A Q Q P G Q P E V F Q E M 2283 caacatgttcaacaaccgccagcacagcaacctggccagcctgaggtcttccaggagatg 2342 L S M L G D Q S N S Y N N E E F P D L T 2343 ctgtccatgctgggagatcagagcaacagctacaacaatgaagaattccctgatctaact 2402 M F P P F S E N Y W G E D K G W G R K 2403 atgtttccccccttttcagaatagaactattggggtgaggataaggggtgggggagaaaa 2462 N H C L F L K S K S F C K Q N K S S S P 2463 aatcactgtttgtttttaaaaagcaaatctttctgtaaacagaataaaagttcctctccc 2522 F P S L T P D M Y P L S L L A V P L L C 2523 ttcccttccctcacccctgacatgtaccccctttcccttctggctgttcccctgctctgt 2582 C L L R H L K K K 2583 tgcctcctaaggtaacatttataaaaaaaaaaaa 2616 >Human ARNT2 F V W R R R R L G L T G S P G L S A G L 2 tttgtgtggcggcggcggcgcctgggcctgaccgggtccccggggctgagcgccgggctc 61 R A A P P A P L P S G R L S S P S K M A 62 cgcgccgcccctcccgcgcccctgccaagcgggcgcctatcctctccgagcaagatggca 121 T P A A V N P P E M A S D I P G S V T L 122 accccggcggcggtcaaccctccggaaatggcttcagacatacctggatctgtgacgttg 181 P V A P M A A T G Q V R M A G A M P A R 182 cccgttgcccccatggcggccaccggacaggtgaggatggcgggggccatgcctgcccgt 241 G G K R R S G M D F D D E D G E G P S K 242 ggaggaaagcggcgttccggaatggacttcgatgatgaagatggtgaaggccccagtaaa 301 F S R E N H S E I E R R R R N K M T Q Y 302 ttttcaagagagaatcatagtgaaatcgaaaggcgcagacggaacaagatgactcagtac 361

PAGE 168

158 Appendix C continued I T E L S D M V P T C S A L A R K P D K 362 atcacggagctctccgacatggtccccacatgcagcgcactggctcggaagccagacaag 421 L T I L R M A V S H M K S M R G T G N K 422 ctcaccatcctccgcatggccgtctcgcacatgaagtccatgaggggtacagggaacaag 481 S T D G A Y K P S F L T E Q E L K H L I 482 tccaccgatggcgcgtacaagccttccttcctcacagagcaggaactgaagcatctcatc 541 L E A A D G F L F V V A A E T G R V I Y 542 ctC gaG gcagctgatggatttctgtttgtggtggctgctgagacagggcgagtgatttat 601 V S D S V T P V L N Q P Q S E W F G S T 602 gtgtctgactccgtcacccctgttctgaaccagccccagtcagagtggtttgggagcaca 661 L Y E Q V H P D D V E K L R E Q L C T S 662 ctgtatgaacaggtgcatcctgatgacgtggagaagctgagagagcaactgtgcacctca 721 E N S M T G R I L D L K T G T V K K E G 722 gaaaactcaatgacaggccggatcttggacctgaagactgggacggtcaagaaagaaggg 781 Q Q S S M R M C M G S R R S F I C R M R 782 cagcagtcatccatgaggatgtgcatgggctcgcggcggtctttcatctgcaggatgagg 841 C G N A P L D H L P L N R I T T M R K R 842 tgtggaaatgctcctttggaccaccttcctctaaacagaataaccaccatgaggaaaagg 901 F R N G L G P V K E G E A Q Y A V V H C 902 ttcaggaatggccttggccctgtgaaagaaggagaagcccaatatgctgtggtccactgt 961 T G Y I K A W P P A G M T I P E E D A D 962 acC ggT tacatcaaggcctggccaccagcaggaatgaccatacctgaagaagacgctgat 1021 V G Q G S K Y C L V A I G R L Q V T S S 1022 gtgggacaaggcagtaaatattgcctcgtggcaattgggagactccaggtgaccagctct 1081 P V C M D M N G M S V P T E F L S R H N 1082 cctgtatgcatggacatgaatgggatgtcggtgcccacagagttcttatcccggcataac 1141 S D G I I T F V D P R C I S V I G Y Q P 1142 tccgatggaatcatcacatttgtggatccaagatgtatcagtgtgattggctaccaaccg 1201 Q D L L G K D I L E F C H P E D Q S H L 1202 caggatcttctgggaaaggacattttggaattctgccaccctgaggatcaaagccatctg 1261 R E S F Q Q V V K L K G Q V L S V M Y R 1262 cgtgagagcttccagcaggtggttaagctgaaaggccaagtcctgtcggtcatgtatcga 1321 F R T K N R E W M L I R T S S F T F Q N 1322 tttcgcaccaagaaccgggagtggatgttgatccgcaccagcagcttcacattccagaat 1381 P Y S D E I E Y I I C T N T N V K Q L Q 1382 ccctattctgatgagattgagtacatcatctgcaccaacaccaacgtcaagcaacttcag 1441 Q Q Q A E L E V H Q R D G L S S Y D L S 1442 caacagcaggcagaattggaagtgcaccagagagatggattgtcatcgtatgacttatcc 1501 Q V P V P N L P A G V H E A G K S V E K 1502 caggtccccgtccccaacctaccagccggtgttcatgaggccgggaagtccgtggaaaag 1561 A D A I F S Q E R D P R F A E M F A G I 1562 gcggatgcaatcttctcccaggaaagagatcctcggtttgctgaaatgtttgcaggaatt 1621 S A S E K K M M S S A S A A G T Q Q I Y 1622 agtgcatcggagaagaagatgatgagctcagcctctgcagcaggaacccagcagatctac 1681 S Q G S P F P S G H S G K A F S S S V V 1682 tcccaaggaagcccatttccctctggacactccgggaaggccttcagctcttcagtggtt 1741 H V P G V N D I Q S S S S T G Q N M S Q 1742 catgtgcctggagtgaatgatattcagtcctcttcttccacgggccagaacatgtcccaa 1801 I S R Q L N Q S Q V A W T G S R P P F P 1802 atc tcTA gA cagctaaaccagagtcaggtggcatggacagggagtcgtccgccctttccg 1861 G Q Q I P S Q S S K T Q S S P F G I G T 1862 ggacagcaaatcccatctcagtccagcaagactcagtcatctccctttgggattggaacg 1921 S H T Y P A D P S S Y S P L S S P A T S 1922 agccacacctacccggcagacccctcttcctacagccccctctccagcccagctacctcc 1981 S P S G N A Y S S L A N R T P G F A E S 1982 tcgccaagtgggaatgcctactccagtcttgccaacaggactccagggttcgctgaaagt 2041 G Q S S G Q F Q G R P S E V W S Q W Q S 2042 ggacaaagtagcgggcagttccaagggcggccctcggaagtctggtcgcagtggcaaagc 2101 Q H H G Q Q S G E Q H S H Q Q P G Q T E 2102 cagcaccatggccagcagagcggtgagcagcactcccaccagcagcccggtcagactgaa 2161 V F Q D M L P M P G D P G N E W W S P H 2162 gtgttccaggacatgctgcccatgccaggagatccagggaatgaatggtggtctccccac 2221 S R Q H F R Q P I S Y A R M T L T L L 2222 tcccggcagcactttaggcagcccataagctatgcgagaatgtgaacgctcaccttgctc 2281

PAGE 169

159 Appendix C continued R H G S D L P H K Q E E A S D R N S S R 2282 cgtcacggttctgacctaccacataaacaggaagaagccagtgaccggaacagctctagg 2341 N N K S E K C P L Y Y Q K I W A W P K 2342 aataacaagtcagaatagaagtgtcctttatattaccagaaaatatgggcttggcctaag 2401 S L S P N L P G S F P T K H P I L R S H 2402 tcgctgtctcctaacctgccggggtcattccccaccaaacaccccatactaaggagccat 2461 E P P G H S P F L P S G V W G N L R R 2462 gagccacctggacattcaccttttctttgaccatctggagtctggggcaacttaaggagg 2521 H H T V V Q A H F Q A V S L A F V A K 2522 caccacacagtggtgcaggcacatttccaagcgtaggtgtccctggcttttgtggccaaa 2581 A S V M V N N R P G S V G H P K W Q 2582 gctagtgttatggtcaacaacaggccagggtctgtggggcactgaccttgaaagtggcaa 2641 N G G F T G C A G A G R L A S S N N L S 2642 aatggaggtttcacaggctgtgcgggagcaggacggcttgcttcatctaacaatctcagt 2701 F L K K K E R K R F H K Q V S V D S L 2702 ttcctttaaaaaaagaaagaaaggaaaagatttcataagcaggtgtcagtggacagttta 2761 S T P F L F L L M D V N C A V D K S F 2762 agtacttaaccatttctctttcttcttatggatgtgaactgtgctgtggataaatcattt 2821 V F L E C S L L T V I K S V V Y M C N 2822 gtatttcttgaatgttctctatgactaacagttattaagtcggttgtgtatatgtgtaac 2881 C N C L L K F H Y N K N D F A L K K K 2882 taatgtaactgccttttaaaatttcattacaataaaaatgactttgctctgaaaaaaaaa 2941 K K 2942 aaaaaaa 2948

PAGE 170

160 Appendix C continued Figure AC3. Schematic of ARNT Domain Swapping NheI: mARNT(63) mARNT2(36) hARNT2(36) hARNT(63) C.elegans(75P-->A) D.melanogaster(36) XhoI: mARNT2(426) mARNT(504) hARNT2(426) hARNT(504) C.elegans(366) D.melanogaster(276) AgeI: mARNT(924) mARNT2(846) hARNT(924) hARNT2(846) C.elegans(744) D.melanogaster(687) mARNT(1588) mARNT2(1689,1728) hARNT(1875) hARNT2(1014,1728) C.elegans() D.melanogaster() XbaI: PvuI MluI Fig. AC3. Schematic of ARNT domain swapping. Schematic representation of the restriction enzyme sites generated within ARNT and ARNT2 to create interchangeable domains. The basic,helix-loop-helix, PAS A, PAS B, and transactivation domains are shaded. Numbers in parentheses represent the nucleotide position of the indicated restrict ion enzyme site in the context of the cDNA.

PAGE 171

161 Appendix C continued Figure AC4. Construct Maps of p-hARNT-ID and p-mARNT2-ID phARNT-ID7859bp NheI XhoI AgeI XbaI HindIII (895) (1471) (1897) (2854) (229) MluI (3346) pmARNT2-ID7511bp NheI XhoI AgeI XbaI HindIII (895) (1329) (1755) (2643) (229) MluI (2998) Fig. AC4. Construct maps of p-hARNT-ID and p-mARNT2-ID. Maps of the p-hARNTID and p-mARNT2-ID plasmids. The size of the constructs in base pairs is shown. Pertinent restriction enzyme sites along with their positions are indicated. bHLH = basic helix-loop-helix domain. PAS A and PAS B = Per ARNT Sim domains A and B. TAD = transactivation domain.

PAGE 172

F Fi g ure A C containing indicated r lambda Hi n indicate th e F i g ure AC5 C 5. Restric t ethidium b r estriction e n n dIII/EcoR I e domain re m Ap p Restrictio t ion enz y m e r omide was l n zymes and r I marker. Fr a m oved by t h 162 p endix C co n n Enz y me D e di g estion o l oaded with r un at 100V a gment size s h e restrictio n n tinue d D i g estion o f o f p-mARN T p-mARNT 2 for one hou r s are shown n d igestion. f p-mARN T T 2-ID. 1% 2 digested w i r Left lane The labels T 2-ID agarose gel i th the contains at the botto m m

PAGE 173

163 Appendix C continued After generating the domains with the specified mutations via PCR, the fragments were digested with the appropriate enzymes and subcloned sequentially into pcDNA 3.1 (Clontech). The resultant constr ucts, named p-hARNT-ID and p-mARNT2ID (Figure AC4) were then digested with restriction enzymes and visualized in an agarose gel to ensure the proper sized fragme nts were produced. A representative photo of the agarose gel can be observed in Figure AC5. Next the constructs were used to produce in vitro transcribed/translated proteins, however the products were ~200kD in size, far smaller than the expected size. Sequence data did not reveal any early stop codons. The reason for the improperly sized pr oteins is unclear a nd will require further investigation.

PAGE 174

164 About the Author Gary T. ZeRuth was born February 23rd, 1976 in Phillipsburg, NJ. He spent the early part of his childhood near Easton, PA from which he moved in 1985 to the Tampa Bay area of Florida. Gary received his Bach elor’s Degree in Biology from the University of South Florida in Tampa, FL and went on to pursue his Ph. D. from the same institution. In addition to the sciences, Ga ry has an avid love of history and has performed in a number of historical festivals, plays, and dinner theaters. He also has great interests in languages, clas sic literature, and the visual ar ts. Gary married an artist, Melissa, in 1999. Hoping to eventually es tablish his own laboratory and work in academia, Gary has accepted a post doctoral rese arch position at the National Institutes of Health.