USF Libraries
USF Digital Collections

Impact of West Nile virus on the natural history of St. Louis encephalitis virus in Florida

MISSING IMAGE

Material Information

Title:
Impact of West Nile virus on the natural history of St. Louis encephalitis virus in Florida
Physical Description:
Book
Language:
English
Creator:
Ottendorfer, Christy L
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Flavivirus
Arbovirus
Phylogeny
Dual infection
Surveillance
Dissertations, Academic -- Global Health -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: The emergence of West Nile virus (WNV) has raised important questions about the capacity of the public health infrastructure to implement surveillance and control programs for WNV and other emerging or re-emerging arboviruses in the United States. Florida's mild climate supports year round enzootic transmission of WNV, St. Louis encephalitis virus (SLEV), and Eastern Equine Encephalitis virus (EEEV). It is unknown what effect the establishment of WNV (in 2001) will have on SLEV transmission in Florida, where these closely related flaviviruses share amplifying hosts, habitats, and vectors. An Arbovirus Isolation Network was formed to obtain and characterize arbovirus strains collected from a large population of naturally exposed birds, including sentinel chickens and wild birds admitted to rehabilitation centers in Florida.Weekly sentinel seroconversion data was used to target sampling of chicken flocks at 37 active sites (17 WNV, 7 EEEV, and 13 SLEV) in eight counties from 224 birds during 2005-2006. Sampling of wild birds occurred following admittance at rehabilitation centers in 2006, based on symptoms and known amplifying host species (n=64), but virus was not detected. We report the isolation of St. Louis encephalitis virus, West Nile virus and detection of Eastern Equine Encephalitis viral RNA from cloacal swabs of naturally exposed adult sentinel chickens. We also report the first known dual infection and isolation of St. Louis encephalitis and West Nile viruses from one chicken. In addition, a novel flavivirus strain was detected in two chickens. Early season transmission of WNV appears to limit subsequent infection and amplification of SLEV late in the year.Phylogenetic analysis revealed that the introduction (and re-introduction) of South American (Brazil) SLEV occurred in 1972 and 2006 in Florida. These strains represent the first reported isolation of South American strains of SLEV in the United States, with placement in Lineage VA and VB, as proposed by Kramer and Chandler (2001). Arbovirus isolation remains an effective tool for surveillance programs and a targeted strategy is most cost-effective to capture arboviruses in their natural settings for molecular epidemiology analysis that can elucidate genetic variations impacting virulence, mosquito infectivity, and disease potential of these pathogens.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Christy L Ottendorfer.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 719 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002007637
oclc - 405658093
usfldc doi - E14-SFE0002452
usfldc handle - e14.2452
System ID:
SFS0026769:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 002007637
003 fts
005 20090622153614.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 090622s2008 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002452
035
(OCoLC)405658093
040
FHM
c FHM
049
FHMM
090
RA425 (Online)
1 100
Ottendorfer, Christy L.
0 245
Impact of West Nile virus on the natural history of St. Louis encephalitis virus in Florida
h [electronic resource] /
by Christy L Ottendorfer.
260
[Tampa, Fla] :
b University of South Florida,
2008.
500
Title from PDF of title page.
Document formatted into pages; contains 719 pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
520
ABSTRACT: The emergence of West Nile virus (WNV) has raised important questions about the capacity of the public health infrastructure to implement surveillance and control programs for WNV and other emerging or re-emerging arboviruses in the United States. Florida's mild climate supports year round enzootic transmission of WNV, St. Louis encephalitis virus (SLEV), and Eastern Equine Encephalitis virus (EEEV). It is unknown what effect the establishment of WNV (in 2001) will have on SLEV transmission in Florida, where these closely related flaviviruses share amplifying hosts, habitats, and vectors. An Arbovirus Isolation Network was formed to obtain and characterize arbovirus strains collected from a large population of naturally exposed birds, including sentinel chickens and wild birds admitted to rehabilitation centers in Florida.Weekly sentinel seroconversion data was used to target sampling of chicken flocks at 37 active sites (17 WNV, 7 EEEV, and 13 SLEV) in eight counties from 224 birds during 2005-2006. Sampling of wild birds occurred following admittance at rehabilitation centers in 2006, based on symptoms and known amplifying host species (n=64), but virus was not detected. We report the isolation of St. Louis encephalitis virus, West Nile virus and detection of Eastern Equine Encephalitis viral RNA from cloacal swabs of naturally exposed adult sentinel chickens. We also report the first known dual infection and isolation of St. Louis encephalitis and West Nile viruses from one chicken. In addition, a novel flavivirus strain was detected in two chickens. Early season transmission of WNV appears to limit subsequent infection and amplification of SLEV late in the year.Phylogenetic analysis revealed that the introduction (and re-introduction) of South American (Brazil) SLEV occurred in 1972 and 2006 in Florida. These strains represent the first reported isolation of South American strains of SLEV in the United States, with placement in Lineage VA and VB, as proposed by Kramer and Chandler (2001). Arbovirus isolation remains an effective tool for surveillance programs and a targeted strategy is most cost-effective to capture arboviruses in their natural settings for molecular epidemiology analysis that can elucidate genetic variations impacting virulence, mosquito infectivity, and disease potential of these pathogens.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Co-advisor: Boo H. Kwa, Ph.D.
Co-advisor: Lillian Stark, Ph.D.
653
Flavivirus
Arbovirus
Phylogeny
Dual infection
Surveillance
690
Dissertations, Academic
z USF
x Global Health
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2452



PAGE 1

Impact of West Nile Virus on the Natural History of St. Louis Encephalitis Virus in Florida by Christy L. Ottendorfer A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Global Health College of Public Health University of South Florida Co-Major Professor: Boo Kwa, Ph.D. Co-Major Professor: Lillian Stark, Ph.D. Azliyati Azizan, Ph.D. Andrew Cannons, Ph.D. Carina Blackmore, Ph.D. Date of Approval: April 7, 2008 Keywords: flavivirus, arbovirus, phylogeny, dual infection, surveillance Copyright 2008, Christy L. Otte ndorfer, All Rights Reserved

PAGE 2

DEDICATION For Eric His support during this project was well-deserving of a honoray PhD and well above & beyond the usual h oney-do list required for husbands.

PAGE 3

ACKNOWLEDGEMENTS I have been extremely fortunate to work with some of the most talented and knowledgeable colleagues, faculty, and students in the public health field. I am especially grateful to Dr. Lillian Stark, for her encouragement, expertis e in virology, and critical review of the manuscript. This project certai nly raised more questions to answer! I would also like to thank Dr. Azliyati Azizan for her valuable advice, encour aging me to apply to the PhD program, and keeping me on track. I would also like to express my sincere gratitude to Dr. Boo Kwa, Dr. Andrew Cannons, and Dr. Carina Blackmore for serving on the doctoral committee and for critical review of the project and manuscript. Special thanks to Dr. Tom Unnasch and Greg White for taking this sequencing project to the next level. I look forward to our continued co llaboration. I would also like to acknowledge Dr. John Day for his extensive work on SLEV in Florida and for his field collection of virus strains used for this projec t. Thanks to everyone at the Florida Fish and Wildlife Conservation Commission, wildlife rehab centers, and especially, the county mosquito control districts th at collected cloacal swabsyour hard work & enthusiasm made all of the difference. The credit fo r these isolates is shared with you. At the Florida Department of Health, I would like to th ank everyone (past & present) in the Arbovirology Department at the DOHTampa Lab for their assistance and contributions to this research. Dr. Kyou ro ck! I would especially like to thank Jason Ambrose for his assistance in every technical as pect of this project. I would also like to thank my work family: Maribel Castaneda, Rita Judge, and Eddie Tensley for their

PAGE 4

support (plus, their HAI & MIA work!). I also extend my thanks to Ann Mitulinsky for her help with the MAC-ELISA, as well as Heidi Hernandez & Priscila Iwakawa for maintaing the cell lines used in this study. In addition, I would like to thank Calvin Desouza and Rebecca Shultz at the FDOH, Bureau of Community and Environmental Health for providing the human and sentinel ch icken GPS maps of Florida used in this manuscript. Special thanks & love to my families: the Voakes, Welshans, Ottendorfers & Bindis for their continued support and he lp during the public health program. This project was supported by Gr ant/Cooperative Agreement Number U38/CCU423095 from CDC. Its contents are sole y the responsibility of the author and do not necessarily represent the official views of the CDC.

PAGE 5

i TABLE OF CONTENTS LIST OF TABLES ix LIST OF FIGURES xii LIST OF SYMBOLS & ABBREVIATIONS xviii ABSTRACT xx CHAPTER ONE: INTRODUCTION 1 Problem Statement 4 Specific Aims 8 Implications of this Study 12 CHAPTER TWO: LITERATURE REVI EW 13 Arthropod-Borne Viruses (Arboviruses) 13 Classification 14 Bunyaviridae (Genus Bunyavirus ) 16 Togaviridae (Genus Alphavirus) 17 Flaviviridae (Genus Flavivirus ) 18 Viral Life Cycle 19 Molecular Biology 21 Genome Structure 21 Structural Elements 23 Non-Structural Elements 26 Phylogeny and Evolution 28 Important Biologic Characteristics 35 Pathogenesis and Pathologic Changes 35 Antigenic Characteristics 37 Immune Response 38 West Nile Virus 40 Discovery 40 Phylogeny and Evolution 41 Natural History 42 Amplification Cycle 42 Vectors 43 Amplifying Hosts 46 Incidental Hosts 47 Ecology & Habitat 49

PAGE 6

ii Geographic Location 49 Transmission Season 51 Contribution of Climatic Conditions 53 Clinical Disease 55 Human 55 Avian 56 Epidemiology 59 Molecular Epidemiology 60 Economic Burden 64 Public Health Implications 67 St. Louis Encephalitis Virus 68 Discovery 69 Phylogeny and Evolution 69 Natural History 75 Amplification Cycle 75 Vectors 76 Amplifying Hosts 77 Incidental Hosts 79 Ecology & Habitat 80 Geographic Location 80 Seasonal Transmission 82 Contribution of Climatic Conditions 85 Clinical Disease 88 Human 88 Avian 90 Geographic Strain Differences of SLEV 92 Epidemiology 93 Molecular Epidemiology 97 Economic Burden 100 Public Health Implications 102 Surveillance for Arboviral Activity 102 Surveillance in Florida (State and Local Levels) 104 Florida Sentinel Chicken Program 105 Chicken Serosurveillance Guidelines 106 Wildlife Surveillance 107 Serological Detection Methods 107 Hemagglutination Inhibition Test 108 IgM Antibody Capture Enzyme-Linked Immunosorbent Assay 109 IgM Antibody Microsphere-Based Immunoassay 111 Plaque Reduction Neutralization Test 111 Arbovirus Cell Culture Methods 112 Virus Growth Characteristics 113 Plaque Assay 114 Molecular Detection Methods 115 End-Point RT-PCR 117

PAGE 7

iii Real-Time RT-PCR 117 Nucleotide Sequencing 120 Surveillance Case Definition for Arb oviral Encephalitis 123 Clinical Description 123 Neuroinvasive Disease 123 Non-neuroinvasive Disease 124 Laboratory Criteria for Dia gnosis 124 Serological Methods 124 Molecular Methods 125 Surveillance: A Team Approach 126 CHAPTER THREE: RESEARCH METHODS 127 Study Design 127 Virus Strains 127 Pilot Field Study 131 Pilot Laboratory Studies 131 Sentinel Chicken Surveillance Program 134 Sentinel Chickens 134 Monitoring Sites and Sample Collection 137 Serological Methods 137 Wild Birds 139 Florida Fish and Wildlife Conserva tion Commission (FWC) 139 Wildlife Rehabilitation Centers 141 Sites, Symptoms and Sample Collection 141 Targeted Sampling Strategy (Sentinel Chickens) 142 Targeted Sentinel Sampling Sites (2005) 142 Targeted Sentinel Sampling Sites (2006) 144 Field Sample Collection 144 Blood and Cloacal Swabs 144 Field Sample Processing 155 Blood Processing 155 Cloacal Swab Processing 155 Vero Cell Culture, Plaque Assays and PRNT 157 Nucleic Acid Extraction 160 Nucleic Acid Amplification and Detection 162 Real-Time Reverse Transcriptase-Poly merase Chain Reaction 162 End Point Reverse Transcriptase-Po lymerase Chain Reaction 171 Detection of End Point RT-PCR Products 172 Sample Preparation for Nucleotid e Sequencing 172 Nucleotide Sequencing 172 Sequence Analysis 174 Phylogenetic Analysis 175 CHAPTER FOUR: RESULTS 176 Network for Isolation/Detection of Arbovi ruses in Florida 176 Evaluation of Arbovirus Surveillance Methods 177

PAGE 8

iv Identification of Existing Arbovirus Su rveillance Resources 180 Optimization of Methods for Network 182 Optimization of Targeted Sampling Strategy for Network Agencies 187 Protocol and Sampling Criteria for Specimen Collection 187 Targeted Strategy for Collection and Processing of Submitted Samples 189 Weekly Surveillance Results of Arbovirus Transmission Activity (2005-2006) 189 Implementation of Targeted Sampling Strategy (2005) 190 Targeted Sampling of Orange County (2005) 195 Serology Results 197 Implementation of Retrospective Targeted Strategy for Sample Processing 197 Targeted Sampling of Manatee County (2005) 199 Targeted Sampling of Sarasota County (2005) 204 Targeted Sampling of Lee County (2006) 207 Targeted Sampling of Orange County (2006) 209 Targeted Sampling of Pasco County (2006) 210 Targeted Sampling of Volusia County (2006) 213 Targeted Sampling of Sarasota County (2006) 215 Serology Results 215 Bird 8-003-R (Site 004) 221 Evaluation of SLEV-WNV Coinfection 223 Virus Neutralization Assays 226 Bird 9-005-B (Site 001) 229 Bird 8-005-B (Site 004) 231 Bird 7-005-B (Site 005) & Birds 9-005-B, 9-000-W (Site 001) 231 Targeted Sampling of Wild Birds 233 Arbovirus Isolation and Detection 233 Blood Samples 235 Cloacal Swabs 235 Arbovirus Characterization 236 Real-Time RT-PCR (TaqMan) 236 End-Point RT-PCR 237 SLEV Envelope Region 240 SLEV Membrane/Envelope Region 242 WNV Capsid/prM Region 242 Flavivirus NS5 Region 242 Flavivirus 3NC Region 247 Sequence Analysis 249 St. Louis Encephalitis Virus Strains 251 FL52 251 TBH-28 254 FL72 257 FL85 (a & b) 258 FL89 258

PAGE 9

v FL90 (a, b, c & d) 259 TR58 260 TR62 261 BR64 261 BR69 263 FLS569 263 FLS650 264 West Nile Virus Strains (2001-2006) 267 FLWN01a 267 FLWN01b 268 FLWN02 (a & b) 268 FLWN05a 270 FLWN05b 271 FLM38 272 FLS502 272 FLS504 274 FLS545 275 Novel Flavivirus Strains (2006) 276 SLEV M/E Region (SLEC) 276 FLS649 276 FLS694 280 FLS281 282 WNV capsid/prM Region (WNAE) 283 FLS649 283 FLS694 285 WNV NS5 Region (WNBE) 285 FLS694 285 Phylogenetic Analysis 286 Envelope Region 287 SLEV M/E Region 288 WNV Capsid/prM Region 291 Flavivirus NS5 Region 296 NS5 Primer Set (Fu1/cfd3) 296 WNBE Primer Set 301 Flavivirus 3 Non-coding Region 302 FLS569 Complete Coding Sequence 307 Arbovirus Growth Characteristics 309 Primary Passage (Mouse Brain to Vero Cell Culture) 309 Primary Passage (Cloacal Brain to Vero Cell Culture) 310 Secondary Passage (Cloacal Swab to Vero Cell Culture) 314 CHAPTER FIVE: DISCUSSION 319 Aim One 320 Evaluation of Arbovirus Isolation Network 320

PAGE 10

vi Arbovirus Isolation Network (Senti nel Chicken Program) 322 Arbovirus Isolation Network (Wild Birds) 323 Aim Two 324 Evaluation of Targeted Sampling Strategy 324 Targeted Strategy for Sentinel Chickens 325 Targeted Strategy for Wild Birds 333 Seasonal Timing of WNV and SLEV 334 Aim Three 336 Evaluation of Arbovirus Identification Methods 336 Serology & RT-PCR Assays 336 Evaluation of Seroconversions 338 Evaluation of RT-PCR Assays 341 Real-Time (TaqMan) RT-PCR 341 Mutations in the SLEV Envelope Region 342 End-Point RT-PCR 347 Sample Collection Methods 351 Characterization of Primary Immune Res ponse in Sentinel Chickens 356 Aim Four 370 Assessment of Arboviral Strain Diffe rences in Florida 370 Phylogeny of St. Louis Encephalitis Virus in Florida 373 Envelope Region 374 Membrane/Envelope Region (SLEC) 379 3NC Region 381 NS5 Region 381 Phylogeny of West Nile Virus 383 Capsid/preMembrane Region (WNAE) 385 NS5 Region (WNBE) 386 Mutation Analysis 389 St. Louis Encephalitis Virus 389 Evaluation of FL52 391 Genotype 391 Phenotype 392 Evaluation of TBH-28 392 Genotype 392 Phenotype 393 Evaluation of FL72 393 Genotype 393 Phenotype 394 Evaluation of FL85 a & b 394 Genotype 394 Phenotype 395 Evaluation of Florida Epidemic Strains (FL89, FL90 a-d) 396 Genotype 396 Phenotype 397 Evaluation of S. American SLEV Strains (TR58 & 62, BR64 & 69) 398

PAGE 11

vii Genotype 398 Phenotype (TR62, BR69) 399 Evaluation of FLS569 399 Genotype 399 Phenotype 400 Evaluation of FLS650 401 Genotype 401 Phenotype 402 West Nile Virus 403 Evaluation of FLWN01a 403 Evaluation of FLWN01b 404 Evaluation of FLWN02a 405 Evaluation of FLWN02b 405 Evaluation of FLWN05a 407 Evaluation of FLWN05b 407 Evaluation of FLM38 408 Genotype 408 Phenotype 408 Evaluation of FLS502 409 Genotype 409 Phenotype 409 Evaluation of FLS504 409 Genotype 409 Phenotype 410 Evaluation of FLS545 410 Genotype 410 Phenotype 411 Molecular Epidemiology Analysis 412 Discovery of a Novel Arbovirus 422 Evaluation of FLS649 426 Genotype 426 Phenotype 426 Evaluation of FLS694 429 Genotype 429 Phenotype 431 Impact on Surveillance Methods 436 Molecular Detection Methods 438 Virus Isolation Methods 439 Serological Methods 440 Aim Five 442 Assessment of Virus Isolation Methods as Surveillance Tool 442 Evaluation of Virus Isolation/Mo lecular Detection Compared to Serologic Assays 442 Impact of Retrospective Processing on Arbovirus Characterization 451 Recommendations for Arbovirus Surveillance Methods 454

PAGE 12

viii Conclusions of WNV Impact on Natural History SLEV in Florida 460 Summary of Findings 471 Aim One 471 Aim Two 471 Aim Three 473 Aim Four 474 Aim Five 476 REFERENCES 478 APPENDICES 504 Appendix A: Media Components 505 Appendix B: Serologic Assay and Viru s Specific Reagents 508 Appendix C: Cloacal Swab Sampling Criteri a & Protocol For Wild Birds 510 Appendix D: Master Mix Components fo r RT-PCR and Sequencing 515 Appendix E: Comprehensive Arbovirus Surveillance Maps (2005) 516 Appendix F: Comprehensive Arbovirus Surveillance Maps (2006) 523 Appendix G: Sentinel Chicken Ar boserology Results 526 Appendix H: Wild Bird Species 528 Appendix I: BLASTN Results for St. Loui s Encephalitis Virus Strains 529 Appendix J: BLASTN Results for West Nile Virus Strains 544 Appendix K: BLATN Results for Novel Flavivirus Virus Strains 554 Appendix L: Multiple Sequence Alignment: WNV Capsid/prM Region 556 Appendix M: Multiple Sequence Alignment: WNV NS5(3) Region 561 Appendix N: Multiple Sequence Alignment: SLEV Envelope Region 564 Appendix O: Multiple Sequence Alignment: SLEV Membrane/Envelope 588 Appendix P: Multiple Sequence Alignment: Flavivirus NS5 Region 593 Appendix Q: Multiple Sequence Alignment: SLEV 3NC Region 612 Appendix R: Arbovirus Strain Sequences Downloaded From GenBank 616 Appendix S: Amino Acid Abbreviations 618 Appendix T: Second Multiple Sequence A lignment: SLEV Env Region 619 Appendix U: Second Multiple Sequence Alignment: SLEV M/E Region 672 Appendix V: Second Multiple Sequence Alignment: Flavivirus NS5 Region 679 Appendix W: Second Multiple Sequence Alignment: WNV Capsid/prM 713 ABOUT THE AUTHOR End Page

PAGE 13

ix LIST OF TABLES Table 2-1 Medically Im portant Vector-borne Flaviviruses 20 Table 2-2 St. Louis Encephalitis Virus Classification Scheme 73 Table 3-1 Eight WNV Reference Strains Sequenced for Phylogenetic Analysis 129 Table 3-2 Fourteen SLEV Reference Strains Sequenced for Phylogenetic Analysis 130 Table 3-3 Evaluation of Nucleic Acid Extraction Kits 133 Table 3-4 Florida Agencies and Co llaborating Partners in the Field Study Network 135 Table 3-5 County Sentinel Chicken Sites & Arbovirus Transmission (2005) 143 Table 3-6 County Sentinel Chicken Sites & Arbovirus Transmission (2006) 148 Table 3-7 WNV Oligonucleotide Primer s and Probes Used in Real Time (TaqMan) and End Point RT-PCR Assays 165 Table 3-8 SLEV Oligonucleotide Primers and Probes Used in Real Time (TaqMan) and End Point RT-PCR Assays 167 Table 3-9 Flavivirus Oligonucleotide Primers and Probes Used in End Point RT-PCR Assays 169 Table 4-1 Confirmed Sentinel Chicken Arbovirus Seroconversions (2005-2006) 194 Table 4-2 Serology Results for Three Sentinel Chicken SLEV Seroconversions in Lee County (2006) 208 Table 4-3 Serology Results for Firs t Confirmed SLEV Positive Chicken Sera Collected in Sarasota County (2006) 218 Table 4-4 Real-Time RT-PCR (TaqMan) Results for Arbovirus Clones Picked After Homologous Antibody Challenge 228

PAGE 14

x Table 4-5 Arboviruses Detected/Isolated During a Targeted Sampling Strategy of Sentinel Chicken Flocks (2005-2006) 234 Table 4-6 Real-Time RT-PCR (TaqMan) Re sults for Arboviruses Isolated from Sentinel Chickens in 2005 238 Table 4-7 Real-Time RT-PCR (TaqMan) Resu lts for Arboviruses Isolated from Sentinel Chickens in 2006 239 Table 4-8 Analyzed Regions of the Viru s Genome (Nucleotide Base and Amino Acid Positions) 250 Table 4-9 Recent 2005-2006 and Reference Flavivirus Strains Sequenced 252 Table 4-10 Primer Sets for Sequencing of Recent 2005-2006 and Reference Flavivirus Strains 253 Table 4-11 Nucleotide and Amino Acid Cha nges Identified in SLEV Strains from Florida (1952-1990) 255 Table 4-12 Nucleotide and Amino Acid Cha nges Identified in SLEV Strains from Florida and South America 262 Table 4-13 Nucleotide and Amino Acid Changes Identified in SLEV Strains Isolated from Sentinel Chic kens in Florida 265 Table 4-14 Nucleotide and Amino Acid Cha nges Identified in WNV Strains from Florida (2001-2005) 269 Table 4-15 Nucleotide and Amino Acid Changes Identified in WNV Strains Isolated from Sentinel Chic kens in Florida 273 Table 4-16 Nucleotide and Amino Acid Changes Identified in Novel Flavivirus Strains Isolated in Florida 281 Table 4-17 Incubation Period for SLEV Reference Strains 311 Table 4-18 Incubation Period & Titer of Arbovirus Strains Isolated from Cloacal Swabs of Sentinel Chickens 315 Table 4-19 Plaque Morphology of Arbovirus Strains Isolated from Sentinel Chickens (2005-2006) 318 Table 5-1 Comparison of the Number of Targ eted Sites to the Number of Sites with Virus Detected/Isolated, by County 326

PAGE 15

xi Table 5-2 Comparison of Sen tinel Chicken Seroconversions to Birds Targeted for Virus Detection/Isolation (2005) 328 Table 5-3 Comparison of Sen tinel Chicken Seroconversions to Birds Targeted for Virus Detection/Isolation (2006) 329 Table 5-4 Dates of Reported Serology Test Results & Start Dates of Targeted Sampling 331 Table 5-5 Real-Time RT-PCR (TaqMan) Results for SLEV Reference Strains 344 Table 5-6 Comparison of Sample Coll ection Methods for the Detection of Arboviruses 357 Table 5-7 Characteristics of Adult Sen tinel Chickens Placed at Enzootic Transmission Sites by County 359 Table 5-8 Duration of Arbovirus Shedding from the Cloacae of Naturally Infected Chickens 450

PAGE 16

xii LIST OF FIGURES Figure 2-1 Global Distribution of the Major Arbovi ral Encephalitides 15 Figure 2-2 Life Cycle of Flaviviruses 22 Figure 2-3 Replication Scheme of Single Stranded Positive Sense RNA Viruses 24 Figure 2-4 Flavivirus Genome Organization 25 Figure 2-5 Phylogeny of the Flavivirus Genus 31 Figure 2-6 Theoretical Primary and Secondary Antibody Response After Exposure to an Infectious Agent 39 Figure 2-7 Arbovirus Transmission Cycle 44 Figure 2-8 Distribution of Human Cases of St. Louis Encephalitis Virus in the United States (1964-2006) 71 Figure 2-9 Epidemics of Human SLEV Cases in the United States, 1964-2006 96 Figure 3-1 Historical SLEV Transmissi on Belt in Florida 136 Figure 3-2 BOL-Tampa Diagnostic Tes ting Algorithm for Detection of Arbovirus Antibodies in Sentinel Chicken Sera 140 Figure 3-3 Manatee County Sentinel Chicken Sites (2005) 145 Figure 3-4 Orange County Sentinel Chicken Sites and Arbovirus Activity (2005) 146 Figure 3-5 Sarasota County Sentin el Chicken Sites and Arbovirus Activity (2005) 147 Figure 3-6 Lee County Sentinel Chicken Sites and Arbovirus Activity (2006) 150

PAGE 17

xiii Figure 3-7 Orange County Sentinel Chicken Sites and Arbovirus Activity (2006) 151 Figure 3-8 Pasco County Sentinel Chicken Sites and Arbovirus Activity (2006) 152 Figure 3-9 Sarasota County Sentin el Chicken Sites and Arbovirus Activity (2006) 153 Figure 3-10 Volusia County Sentin el Chicken Sites and Arbovirus Activity (2006) 154 Figure 3-11 Diagnostic Algorithm fo r the Isolation and Detection of Arboviruses From Cloacal Swabs 161 Figure 3-12 Molecular Diagnostic Testing Algorithm for Detection of Arboviruses 163 Figure 3-13 Amplicons Generated by WNV Primers for RT-PCR and Sequencing 166 Figure 3-14 Amplicons Generated by SLEV Primers for RT-PCR and Sequencing 168 Figure 3-15 Amplicons Generated by Universal Flavivirus Primers for RT-PCR and Sequencing 170 Figure 4-1 Rate of Sentinel Chicken Seroconversions to Flaviviruses (1988-2006) 178 Figure 4-2 Comparison of Arbovirus Surv eillance Methods for the Detection of SLEV, as compared to WNV, from 1999-2004. 181 Figure 4-3 SLEV Recovery From Spiked Sw ab Culturettes (Cat. No. 261514) 184 Figure 4-4 SLEV Recovery From Spiked Sw ab Culturettes (Cat. No. 220221) 185 Figure 4-5 WNV Recovery From Spiked Swab Culturettes (Cat. No. 220221) 186 Figure 4-6 Rate of EEEV Sentinel Chicken Seroconversions in Florida (2005-2006) 191 Figure 4-7 Rate of WNV Sentinel Chicken Seroconversions in Florida (2005-2006) 192

PAGE 18

xiv Figure 4-8 Rate of SLEV Sentin el Chicken Seroconversions in Florida (2005-2006) 193 Figure 4-9 Targeted Sampling of Sentinel Chicken Sites in Orange County (2005) 196 Figure 4-10 Development of the Primary Immune Response Following Natural Eastern Equine Encephalitis Virus Infecti on in a Sentinel Chicken 198 Figure 4-11 Targeted Laboratory Sample Pr ocessing Strategy (2005) 200 Figure 4-12 Targeted Laboratory Sample Proces sing Strategy (2006) 201 Figure 4-13 Targeted Sampling of Sentinel Chicken Sites in Manatee County (2005) 203 Figure 4-14 Development of the Prim ary Immune Response Following Natural West Nile Virus Infection in a Sentinel Chicken 205 Figure 4-15 Targeted Sampling of Sentinel Chicken Sites in Sarasota County (2005) 206 Figure 4-16 Targeted Sampling of Sentinel Chicken Sites in Lee County (2006) 211 Figure 4-17 Targeted Sampling of Sentinel Chicken Sites in Orange County (2006) 212 Figure 4-18 Targeted Sampling of Sentinel Chicken Sites in Pasco County (2006) 214 Figure 4-19 Targeted Sampling of Sentinel Chicken Sites in Volusia County (2006) 216 Figure 4-20 Targeted Sampling of Sentinel Chicken Sites in Sarasota County (2006) 220 Figure 4-21 Comparison of SLEV Serology Te st Results for Bird 8-003-R 222 Figure 4-22 Development of the Prim ary Immune Response Following Natural St. Louis Encephalitis Viru s & West Nile Virus Infection in a Sentinel Chicken 224 Figure 4-23 Comparison of SLEV and WNV IgM Antibody Development and Estimate of Infectious Virus Shed in the Feces of Bird 8-003-R 225

PAGE 19

xv Figure 4-24 Comparison of Plaque Phenot ype of Arbovirus Isolates Before and After Polyclonal Antibody Challenge 226 Figure 4-25 Comparison of Serology Test Results for Bird 9-005-B 230 Figure 4-26 Development of the Primar y Immune Response Following Natural St. Louis Encephalitis Vi rus Infection in a Sentinel Chicken 231 Figure 4-27 Gel Electrophoresis of SLEV Is olates (Envelope Region) 241 Figure 4-28 Gel Electrophoresis of FLS569 & SLEV Reference Strains (SLEC: M/E Region) 243 Figure 4-29 Gel Electrophoresis of FL M38 & WNV Reference Strains (WNAE: Capsid/prM Region) 244 Figure 4-30 Gel Electrophoresis of FLS502, FLS545 & FLS569 (NS5 Region) 245 Figure 4-31 Gel Electrophoresis of FLS502, FLS545 & FLS569 Isolated from Bird 8-003-R (WNBE: 3 NS5 Region) 246 Figure 4-32 Gel Electrophoresis of FLS569 & SLEV Reference Strains (YF: 3 NC Region) 248 Figure 4-33 Gel Electrophoresis of Se ntinel Chicken Arbovirus Isolates: FLS569, S649, S650, S694 (M/E Region) 277 Figure 4-34 Gel Electrophoresis of Sen tinel Chicken Arbovirus Isolates: FLS569, S649, S650, S694 (SLE Complete Envelope Region) 278 Figure 4-35 Gel Electrophoresis of Sen tinel Chicken Arbovirus Isolates, FLS569, S649, S650, S694 (Partial NS5 Region, and 3NC) 279 Figure 4-36 Gel Electrophoresis of Se ntinel Chicken Arbovirus Isolates, FLS569, S649, S650, S694 (WNAE, WNBE Primers) 284 Figure 4-37 Phylogenetic Relationships of SLEV Strains (Envelope Region), Neighbor-Joining Method 289 Figure 4-38 Phylogenetic Relationships of SLEV Strains (Envelope Region), Maximum Parsimony Method 290 Figure 4-39 Phylogenetic Re lationships of SLEV and Flavivirus Strains (Partial Membrane/Envelope Region), Neighbo r-Joining Method 292

PAGE 20

xvi Figure 4-40 Phylogenetic Re lationships of SLEV and Flavivirus Strains (Partial Membrane/Envelope Region), Maximum Parsimony Method 293 Figure 4-41 Phylogenetic Re lationships of SLEV and Flavivirus Strains (Partial Membrane/Envelope Region), UPGMA Method 294 Figure 4-42 Phylogenetic Re lationships of WNV and Flavivirus Strains (Partial Capsid/prM Region), Neighbor-Joining Method 295 Figure 4-43 Phylogenetic Re lationships of WNV and Flavivirus Strains (Partial Capsid/prM Region), Maximum Parsimony Method 297 Figure 4-44 Phylogenetic Re lationships of WNV and Flavivirus Strains (Partial Capsid/prM Region), UPGMA Method 298 Figure 4-45 Phylogenetic Relationships of SLEV & WNV Strains (NS5 Region), Neighbor-Joining Method 299 Figure 4-46 Phylogenetic Relationships of SLEV & WNV Strains (NS5 Region) Maximum Parsimony Method 300 Figure 4-47 Phylogenetic Re lationships of WNV and Flavivirus Strains (WNBE: Partial NS5 Region) Neighbor-Joining Method 303 Figure 4-48 Phylogenetic Re lationships of WNV and Flavivirus Strains (WNBE: Partial NS5 Region), Maximum Parsimony Method 304 Figure 4-49 Phylogenetic Relati onships of SLEV Strains ( Flavivirus 3NC Region), Maximum Parsimony Method 305 Figure 4-50 Phylogenetic Relati onships of SLEV Strains ( Flavivirus 3NC Region), UPGMA Method 306 Figure 4-51 Phylogenetic Rela tionships of North and South American SLEV Strains (Complete Coding Sequences) 308 Figure 4-52 Comparison of Plaque Phenot ype of Reference St. Louis Encephalitis Virus Strains 312 Figure 4-53 Comparison of Plaque Phenotype of Sentinel Chicken Arbovirus Strains 316 Figure 5-1 Multiple Sequence Alignment of the 3 Envelope Region Targeted by Real-Time RT-PCR (TaqMan) Primer-Probe 346

PAGE 21

xvii Figure 5-2 Development of the Primar y Immune Response Following Natural Flavivirus Infection in a Sentinel Chicken 367 Figure 5-3 Phylogenetic Relationships of North & South American SLEV, NeighborJoining 376 Figure 5-4 Phylogenetic Rela tionships of North & South American SLEV, Maximum Parsimony Method 377 Figure 5-5 Phylogenetic Rela tionships of SLEV & WNV Strains (NS5 Region), Second Multiple Sequence Alignment 384 Figure 5-6 Mosquito Surveillance Results Conducted at Site 004 (Sarasota County, 2006) 424 Figure 5-7 Mosquito Surveillance Results Conducted at Site 001 (Sarasota County, 2006) 427 Figure 5-8 Phylogenetic Re lationships of SLEV & Flavivirus (Partial Membrane/Envelope Region), Second Alignment 433 Figure 5-9 Phylogenetic Re lationships of SLEV & Flavivirus Strains (Partial Membrane/Envelope Region), UPGMA Second Alignment 434 Figure 5-10 Phylogenetic Relationships of WNV & Flavivirus Strains (Capsid/prM Region), MP Second Alignment 435

PAGE 22

xviii LIST OF SYMBOLS & ABBREVIATIONS Symbol and Abbreviations Description % Percent C Degrees Centigrade Ab Antibody Ag Antigen BOL-Tampa Florida Department of Health, Bureau of LaboratoriesTampa CO2 Carbon Dioxide Gas CDC Centers for Disease Control and Prevention CNS Central Nervous System CPE Cytopathic Effect CSF Cerebrospinal Fluid DPI Days Post-Isolation EEEV Eastern Equine Encephalilitis virus EMEM Essential Minimal Eagle Media FDOH Florida Department of Health FDOH-BCEH Florida Department of Health, Bureau of Community & Environmental Health (FDOH-BCEH) FWC Florida Fish and Wildlife Conservation Commission g gravity HAI Hemagglutination Inhibition Assay HJV Highlands J virus IgG Immunoglobulin G IgM Immunoglobulin M JE Japanese Encephalitis serocomplex LCMCD Lee County Mosquito Control District MAC-ELISA IgM Antibody Capture Enzyme-Linked Immunosorbent Assay MCD Mosquito Control District MCMCD Manatee County Mosquito Control District MIA Microsphere-based Immunoassay L microliter M micromolar ml milliter min minute OCMCD Orange County Mosquito Control District

PAGE 23

xix PCMCD Pasco County Mosquito Control District PCR Polymerase-chain reaction PRNT Plaque Redu ction Neutralization Test RNA Ribonucleic Acid RT-PCR Reverse transcriptase polymerase chain reaction SCMCD Sarasota County Mosquito Control District SLEV St. Louis encephalitis virus SVD Serum Virus Diluent WNV West Nile virus

PAGE 24

xx IMPACT OF WEST NILE VIRUS ON TH E NATURAL HISTORY OF ST. LOUIS ENCEPHALITIS VIRUS IN FLORIDA Christy L. Ottendorfer ABSTRACT The emergence of West Nile virus (WNV ) has raised important questions about the capacity of the public health infrastruc ture to implement surveillance and control programs for WNV and other em erging or re-emerging arbovir uses in the United States. Floridas mild climate supports year round enzootic transmission of WNV, St. Louis encephalitis virus (SLEV), and Eastern Equine Encephalitis virus (EEEV). It is unknown what effect the establishment of WNV (i n 2001) will have on SLEV transmission in Florida, where these closely related flaviviruses share amplifying hosts, habitats, and vectors. An Arbovirus Isolation Network was form ed to obtain and characterize arbovirus strains collected from a larg e population of naturally exposed birds, including sentinel chickens and wild birds admitted to rehabilitation centers in Florida. Weekly sentinel seroconversion data was used to target sampli ng of chicken flocks at 37 active sites (17 WNV, 7 EEEV, and 13 SLEV) in eight counties from 224 birds during 2005-2006. Sampling of wild birds occurred following admittance at rehabilitation centers in 2006, based on symptoms and known amplifying hos t species (n=64), but virus was not detected. We report the isolation of St. Loui s encephalitis virus, West Nile virus and detection of Eastern Equine Encephalitis vi ral RNA from cloacal swabs of naturally exposed adult sentinel chickens. We also report the first known dual infection and

PAGE 25

xxi isolation of St. Louis encephal itis and West Nile viruses from one chicken. In addition, a novel flavivirus strain was detected in two chicke ns. Early season transmission of WNV appears to limit subsequent infection and am plification of SLEV late in the year. Phylogenetic analysis rev ealed that the introduction (a nd re-introduction) of South American (Brazil) SLEV occurred in 1972 a nd 2006 in Florida. These strains represent the first reported isolation of South American strains of SLEV in the United States, with placement in Lineage VA and VB, as proposed by Kramer and Chandler (2001). Arbovirus isolation remains an effective tool for surveillance programs and a targeted strategy is most cost-effective to capture arboviruses in their natural settings for molecular epidemiology analysis that can elucidate genetic variations impacting virulence, mosquito infectivity, and di sease potential of these pathogens.

PAGE 26

1 CHAPTER 1 INTRODUCTION An ar thropodbo rne virus (arbovirus) is a virus that requires a hematophagous (blood-sucking) arthropod vector for transmission to vertebrate hosts to maintain its life cycle (Gubler, 2001). Arboviruses are globally distributed, but are primarily found in tropical areas where the climate can suppor t year-round transmission by cold-blooded arthropods (Gubler, 2002). The past 20 year s has witnessed changing epidemiological trends resulting in dramatically increased global epidemic arbovira l activity. Population growth, new irrigation systems, deforestati on, and uncontrolled urbanization in tropical developing countries have contributed to th e emergence/resurgence of arboviral diseases (Gubler, 2001). During this time, viruses once thought to be controlled or not of major public health significance caused epidemic disease in many regions of the world. For example, West Nile virus (WNV) was introduced into North America in 1999 with epidemics and epizootics of severe neurologic disease in hum ans, horses, and birdsan apparent shift from relatively less pathogeni c strains found previously in the eastern hemisphere (Gubler, 2002). From 1999 to 2006, there were 23,975 cases of WNV illness reported to the Centers for Disease Control and Preven tion (CDC), with 962 fatalities in the US (CDC, 2007e). This recent emergence of a ne w, more virulent strain of WNV with greater epidemic potential has raised important questions abou t the capacity of the public

PAGE 27

2 health infrastructure to implement survei llance, prevention, and control programs not only for WNV, but also in the event other ar boviruses emerge or re-emerge with greater virulence characteristics or highe r epidemic potential (Gubler, 2002). WNV is maintained in an enzootic transmission cycle between birds and Culicine mosquitoes, with humans and horses as in cidental (dead-end) hosts (Blackmore et al. 2003). In the temperate zone, tr ansmission occurs during the warmer months with peak activity from July-October (OLeary et al., 2004). The main competent bird reservoirs in the temperate United States (US) are corvid species, house sparrows, house finches, and grackles (Komar, 2003). The spread of W NV throughout the United States and to Canada, Latin America, and the Caribbean is due to the migration patterns of these bird reservoirs (Hayes, 2001; Gubler, 2007). West Nile virus continues to spread slowly southward through Central and South America, with recent isolates of the virus in Mexico and Argentina (Gubler, 2007). North American WNV isolates were initially characterized by widespread mortality in resident bird populations, a distinctive characteristic that appears to have decreased in recent years with the emergence of the WN02 North American dominant genotype of the virus (Unite d States Geological Survey [USGS], 2007). In contrast, South American WNV strains have not been found to cause significant morbidity or mortal ity in birds, equines, or humans (Kramer and Shi, 2007; Gubler, 2007). Like WNV, St. Louis ence phalitis virus (SLEV) is a member of the family Flaviviridae and is vectored by Culex species mosquitoes. These cl osely related viruses share many antigenic, genetic and ec ologic characteristics (Chambers et al. 1990). SLEV has been found in both North and South America. The human case fatality ratio depends

PAGE 28

3 upon geographic location, but in general, South Am erican strains of SLEV also appear to be more attenuated (similar to WNV) in co mparison to North American strains (Diaz et al. 2006). In the United States, SLEV has intermittent epidemic transmission with up to 3,000 cases per year (average 128), and a cas e fatality rate of 5% (CDC, 2007j). Interestingly, SLEV has recently been isolat ed from humans in South America, where it caused an outbreak of encephalitis in both Argentina and Brazil (2003 and 2005) [Spinsanti et al. 2003; Diaz et al. 2006; Rocco et al. 2005; dos Santos et al. 2006]. In contrast to WNV, enzootic SLEV transmission is very silent in natu re with no reports of avian mortality (CDC, 2007j). The mild climate of Florida supports year round enzootic transmission of SLEV, with most human cases occurring in the la te summer and early fall months (Blackmore et al. 2003). Outbreaks of SLEV over the last fort y years led to the establishment of an arboviral surveillance program in Florida (Bigler B, 1999). SLEV epidemics are sporadic, often cycling every 10 years, due to complex interactions be tween environmental factors, vector abundance, and avian amplifying hos ts. The last large outbreak of SLEV in Florida occurred in 1990-1991 re sulting in 11 deaths and 223 laboratory confirmed cases. These epidemics not only have significant public health impacts, but al so adversely affect communities through curtailed ev ening recreational activities and tourism in Florida due to emergency response measures and widespread publicity (Day, 2001). In 2001, West Nile virus was first detect ed in Florida. 199 cases of WNV illness were reported to the CDC from 2001 through 2006, with 11 fatalities (CDC, 2007e). Case numbers and enhanced surveillance data for WNV in the last five years supports the concern that WNV has firmly established enzoo tic transmission foci within the state. In

PAGE 29

4 2002, surveillance programs detected extensiv e WNV activity, but did not detect SLEV transmission activity in th e state (Stark and Kazanis, 2002). A single human case was reported in 2002 (CDC, 2007 l ). SLEV reappeared at low levels in 2003 and every year since then (Stark and Kazanis: 2003, 2004, 2005, & 2006). Despite frequent detection of both viruses in bird/mosquito populations and reported clinical cas es (USGS, 2007; CDC, 2007e & l ), a review of the literature indicates that St. Louis encephalitis virus has not been reported isolated from a region after se veral years of concurrent WNV transmission activity. SLEV is an important public health con cern, especially in the southern states, where transmission of the virus commonly o ccurs. Despite the presence of active surveillance and mosquito c ontrol programs in many regions sporadic human cases of the disease occur every year in the United States (Chandl er and Nordoff, 1999). The introduction of WNV into SLEV-endemic re gions has created the need for improved detection methods and prevention strate gies across the United States. Problem Statement Since its unexpected appearance in New York City in 1999, WNV has spread across North America and into Canada, the Caribbean, Latin and Central America. The largest epidemics of neuroinvasive WNV dis ease occurred in the United States in 2002 and 2003, far exceeding WNV case numbers in the eastern hemisphere (Hayes and Gubler, 2006). SLEV, a closely related flavivirus family member, is also maintained in an enzootic transmission cycle between birds and Culex sp. mosquitoes in North and South America. WNV and SLEV infections of ten present with similar clinical profiles

PAGE 30

5 (sudden onset of fever, headache, and myalgia), and have similar prevention measures (Johnson et al. 2005). The expansion of WNV into the western hemisphere has prompted a surge in research to elucidate the natu ral history of WNV. Extensiv e studies have investigated virus characteristics that in fluence pathogenicity (Davis et al 2005; Hayes et al 2005b; Kuno and Chang, 2005; Deardorff et al 2006; Samuel and Diamond, 2006), clinical features (Kuno, 2001; Klee et al 2004; Hayes and Gubler, 2006; Kramer and Shi, 2007), and epidemiology of the disease (Hayes et al 2005a). There have also been several ecological studies on WNV reviewed by Koma r (2003), including biologic and abiotic factors such as vector competence (Sardelis et al 2001; Reisen, Fang and Martinez, 2005), mosquito feeding behaviors (Kilpatrick et al, 2006), avian amplifying hosts and mortality (Komar et al 2003; Langevin et al 2005; LaDeau, Kilp atrick and Marra, 2007), wetting and temperature conditions (S haman, Day and Stieglitz, 2005; Reisen, Fang and Martinez, 2006 ), spatial-temporal di stribution (Davis et al 2003; Kuno and Chang, 2005), and how the virus overwinte rs in northern climates (Reisen et al 2006). Yet, the potential influence of WNV or its impact on SLEV has largely been ignored in these studies. From 1960-1975, the arbovirus field experien ced its heyday. During this time, several arboviruses were disc overed and many regions of the world had fully functional arbovirus laboratories with high levels of governmental and institutional support. These laboratories often supported ep idemiological investigations, as well as research and training opportunities for those in terested in the isolation a nd characterization of viruses from arthropods, vertebrate animals and c linical specimens. However, as time passed, a

PAGE 31

6 lack of funding and increased regulations on the use and exchange of infectious arboviruses often restricted th eir study to high-security la boratories. As such, virus isolation techniques were not f easible for most facilities a nd have became less important as molecular methods were discovered that co uld rapidly identify vi rus strains, without handling infectious virus. Unfortunately, th is paradigm shift has limited the information that can be gained about novel viruses when they are not isolated (e.g. many strains of hantavirus) as phenotypic informa tion cannot be assessed (Calisher et al 2001). During the 1960s and 1970s, field studi es were conducted throughout Florida by the Epidemiology Research Center (ERC) to improve the knowledge of the natural history of arboviruses in response to ep idemics of SLEV. These studies were instrumental in identifying mo squito vectors and avian am plifying hosts for arboviruses in Florida, including isolation of several arboviruses (Dow et al 1964; Lewis, Jennings and Schneider, 1964; Bond et al 1966; Jennings, Allen a nd Lewis, 1966; Jennings et al 1967; Jennings et al 1970; Sather et al 1970; Bigler et al 1974 & 1975). However, these studies were terminated because of a lack of funding and have not been repeated on as large of a scale. These inves tigations were also conducted prior to the de velopment of molecular diagnostic techniques, such as pol ymerase chain reaction (PCR) and nucleotide sequencing for identification of viruses. C onsequently, a sample of these historical SLEV isolates will now be in cluded in the current study fo r molecular characterization and comparison to currently circulating arboviruses. It is unknown what effect the establis hment of WNV endemicity will have on SLEV transmission in Florida. Florida has a unique climate and ecosystem that is unlike most of the continental United States. It has distinct regions, such that the northern part

PAGE 32

7 of Florida approximates the habitat found in the southeastern US, whereas the southern part of the state is more tropical in nature WNV transmission activity has been detected throughout the state, whereas SLEV transmissi on activity predominates in the southern region (subtropical) [Day and Curtis, 1993; Day and Stark, 2000; Day, 2001; Shaman, Day and Stieglitz, 2004 & 2005]. A recent study in Texas indicates that SLEV and WNV are able to coexist in the same region (Lillibridge et al. 2004), which is also supported by Department of Health surveillance data in Florida (Stark and Kazanis: 2003, 2004, 2005, & 2006). However, the authors only cultured SLEV in the first month of concurrent WNV transmission from mosquitoes in Texas (Lillibridge et al. 2004). In Florida, SLEV has not been isolated in culture after the introduction of WNV, despite the operation of the largest arbovira l surveillance program in the United States. Will the viruses peacefully co-exist or will one virus dominate the other as they both compete for shared mosquito vectors, ha bitat and amplifying hos ts? These concerns motivated the inception of this project to perform virus isolation studies and capture arboviruses in their na tural settings. Genetic and phenot ypic studies of these viruses, especially St. Louis encephalitis virus, are cr itically necessary becau se they can identify variations in a virus that may impact its virulence, mosquito infectivity, and disease potential. As such, this research study will enhance existing collaborations between the Florida Department of Health and participating counties within the state, as well as develop new partnerships with wildlife rehabilitation centers, the University of South Florida and the University of Florida. These agencies will, for the first time, utilize the Florida Sentinel Chicken Program or sample wild bird species to obtain and characterize

PAGE 33

8 arbovirus isolates. This proj ect was funded in part by th e Southeastern Centers for Emerging Biologic Threats (G rant # U38/CCU423095). Specific Aims The objective of this project is to inve stigate the impact on the natural history of St. Louis encephalitis virus following the emerge nce of West Nile virus in Florida. This study was designed to serve five major purposes: 1) Establish a network to enhance arbovirus surveillance (w ith virus isolation) in Florida, 2) Evaluate a targeted strategy for collection and processing of samples, 3) Identify and characterize arbovirus isolates, 4) Compare current flavivirus isolates to strains collected prior to the introduction of WNV in Florida, and 5) Evaluate the effectiveness of vi rus isolation/detection (cell culture/PCR methods) as a surveillance tool in Florida. Aim Statements Aim One Develop and implement a network for the isol ation/detection of ar boviruses in Florida Research Strategies: A. Evaluate current surveillance methods for the detection of arboviruses B. Identify existing arbovirus surveillance re sources at the state and local level 1. Arboviral Surveillance Network (Sentinel Chicken Program) 2. Wildlife Rehabilitation Centers

PAGE 34

9 C. Optimize methods for use by the vi rus isolation/detection network 1. Optimize testing methods for the de tection/isolation of arboviruses 2. Optimize targeted sampling strategy for network agencies 3. Establish protocol and sampling criteria for use by the agencies to collect specimens Aim Two Evaluate a targeted strategy for the collection and processing of submitted samples Research Strategies: A. Monitor weekly arbovirus surveillance data for arbovi rus transmission activity 1. Implement targeted sampling strategy by network partners of sentinel chicken sites based on sentinel seroconversions B. Evaluate targeted sampling strategy of sen tinel chickens at sites with confirmed arbovirus activity (arbovirus transmission hot zones) C. Evaluate the use of current serologi cal testing methods (HAI, MAC-ELISA, PRNT) for early targeting of ac tive arbovirus transmission sites D. Evaluate targeted sampling of wild birds admitted to rehabilitation centers (with presumptive symptoms of arbovirus infection) E. Evaluate effectiveness of sample collect ion from sentinel chickens for virus isolation/detection 1. Initiation or continuation of swa bbing by county agencies immediately following presumptive or confirmed se roconversions at sentinel hot zones 2. Cloacal swabs collected 1 day/week vs. 2 days/week

PAGE 35

10 F. Evaluate effectiveness of retrospective processing of samples from confirmed positive sentinel chickens for the isolation of arboviruses for surveillance Aim Three Identification and Characteri zation of Arbovirus Isolates Research Strategies: A. Evaluate sample collection methods for arbovirus isolation from naturally exposed birds 1. Effectiveness of sample type for isolation of arboviruses i. Blood ii. Fecal (cloacal swab) B. Evaluate effectiveness of current mol ecular tests (real time TaqMan RT-PCR) used for detection of arboviruses C. Describe arboviruses isolated 1. Genotypic characteristics 2. Phenotypic characteristics (in cell culture) D. Describe the primary immune response fo llowing natural arbovirus infection in adult chickens 1. Impact of strain (breed) and ag e of chicken on antibody response 2. Compare primary immune response in naturally infected chickens to reports of artificially infected birds in laboratory studies Aim Four Compare current flavivirus isolates to strains collected prior to the introduction of WNV in Florida

PAGE 36

11 Research Strategies: A. Evaluate phylogenetic analysis of recent and historical isolates of SLEV and WNV 1. Phylogeny of SLEV 2. Phylogeny of WNV B. Describe changes (mutations) found between current SLEV isolates versus SLEV strains collected prio r to the introduction of WNV in Florida 1. Genotypic characteristics 2. Phenotypic characteristics (in cell culture) C. Evaluate use of nucleotide sequence information for molecular epidemiology studies of SLEV in Florida 1. North American strains 2. South American strains D. Evaluate impact of mutations in the envelope region of SLEV on molecular detection of the virus 1. What impact does this have on public health surveillance for the virus? 2. What molecular methods should be used to identify and confirm atypical SLEV strains? E. Summarize impact of WNV on the natu ral history of SLEV in Florida 1. Evaluate seasonal timing of WNV tran smission activity and its impact on SLEV transmission activity in Florida i. Inhibition of SLEV transmission act ivity and/or the isolation of SLEV with early season transmission of WNV

PAGE 37

12 2. Impact on current surveillance methods i. Molecular methods ii. Serological methods Aim Five Evaluate the effectiveness of virus isolation/detection (cell culture/PCR methods) as a surveillance tool in Florida Research Strategies: A. Evaluate the effectiveness of virus isol ation and/or molecular detection assays compared to serological assays for p ublic health surveillance of arbovirus transmission activity (from blood and fecal samples) B. Impact of retrospective processing of samples on further characterization of flavivirus natural infection in chickens C. Recommendations for serological and viru s isolation surveillance methods to identify transmission activity and arbovirus strains D. Summarize impact of WNV on the natura l history of SLEV in Florida Implications of this Study This studys findings will further elucidate the natu ral history and molecular epidemiology of WNV and SLEV, which is n ecessary to improve pr evention strategies needed to protect the public health from these pathogenic arboviruses. The wide geographic range, migration of avian amp lifying hosts, and presence of susceptible vectors also allows for the emergence of th ese viruses into new territories which can adversely impact global health.

PAGE 38

13 CHAPTER 2 LITERATURE REVIEW Arthropod-borne viruses (arboviruses) An ar thropodbo rne virus (arbovirus) is a virus that requires a hematophagous (blood-sucking) arthropod vector for transmission into vertebra te hosts to maintain its life cycle (Gubler, 2001). Most arbovir uses are zoonoses with ve rtebrate hosts other than humans as their primary reservoir. Vertebra te infection can occu r after an infected arthropod takes a blood meal, and arthropod in fections occur after feeding on viremic (presence of virus in the bloods tream) hosts. Usually the virus cycles silently between the primary arthropod vector and primary vertebrate host until an ecologic change occurs that allow the virus to escape this focus (Centers for Disease Control & Prevention [CDC], 2003). The most common amplifying hosts are birds and rodents and the most important arthropod vectors are mosquitoes and ticks for arboviral diseases of public health consequence, although exceptions to this rule exist. For instance, dengue virus has adapted completely to humans and is maintained in a mosquito-human-mosquito transmission cycle in urban centers of th e tropics and sub-trop ics (Gubler, 2002). In South America and East Africa, yellow feve r virus cycles in both urban and jungle environments, where the sylvatic cycle is maintained in wild monkeys (Burke and Monath, 2001; CDC, 2007a). Important ecologi cal parameters that govern these cycles

PAGE 39

14 include temperature, rainfall, and humidity which influence geographi c distribution of the vectors and hosts (Gubler, 2002). Figure 2-1 presents the gl obal geographic distribution of the major arboviral encephalitides. Although arboviruses are globall y distributed, they are pr imarily found in tropical areas where the climate can support year-round transmission by cold-blooded arthropods (Gubler, 2002). The past 20 years has witn essed changing epidemiological trends resulting in dramatically in creased global epidemic arbovir al activity. Population growth, new irrigation systems, deforestation, a nd uncontrolled urbanization in tropical developing countries have es pecially contributed to the emergence/resurgence of arboviral diseases (Gubler, 2001). During this time, viruses once thought to be controlled or not of major public health significance cau sed epidemic disease in many regions of the world. For example, dengue virus expanded gl obally resulting in larger and more frequent epidemics. West Nile virus (WNV ) was introduced into North America in 1999 with epidemics and epizootics of severe neurol ogic disease in humans, horses, and birds. The resurgence or emergence of these pathogens necessitates a reasse ssment of the public health infrastructure and its ability to implement survei llance, prevention, and control programs for medically important arboviruses (Gubler, 2002). Classification Currently, there are over 534 viruses regist ered in the International Catalogue of Arboviruses (Karabatsos, 1985). Only 134 of these registered viruses have caused documented disease in humans (Karabatsos, 1985). Arboviruses are taxonomically diverse and belong to eight virus families and fourteen genera. The arboviruses that are medically important for humans be long to three virus families: the Bunyaviridae

PAGE 40

15 Figure 2-1 Global distribution of th e major arboviral encephalitides. Arboviruses have established enzootic or endemic foci on every continent, where the virus cycles between primar y avian or rodent hosts and primary arthropod vectors. In 1999, West N ile virus emerged in the western hemisphere in New York City, effectiv ely escaping its prev ious restriction to the eastern hemisphere. Figure appears courtesy of the Centers for Disease Control & Pr evention (CDC, 2005a) Adapted by author to show the emergen ce of WN in the western hemisphere.

PAGE 41

16 Flaviviridae and Togaviridae (Gubler & Roehrig, 1998). The Bunyaviridae and Togaviridae families will briefly be desc ribed, emphasizing the viruses vectored by arthropods. The Flaviviridae family will be co vered in greater detail in the next section. Bunyaviridae (genus Bunyavirus) Recognized as the largest and most dive rse arboviral family, the Bunyaviridae has at least 248 identified viruse s belonging to five genera (Gubler, 2001), including the Bunyavirus, Phlebovirus, Nairovirus, Tospovirus and Hantavirus genera (CDC, 2004a). The Bunyaviridae are single st randed negative-sense RNA viruses, where all genera include viruses transmitted by arthropods, with the exception of hantavirus, which is rodent-borne (CDC, 2004a). First classified as Californi a serogroup arboviruses, the Bunyavirus genus has at least 167 arbovirus members found on five continents. California encephalitis virus (CEV), La Cr osse virus (LACV), Jamestown Canyon virus (JCV), and Snowshoe hare virus (SSHV) are the medically important arboviruses found in North America (Calisher, 1994; Schmaljohn and Hooper, 2001). For example, LACV is a mosquito-borne pathogen that maintains an enzootic life cycle with the tree-hole mosquito, Aedes triseriatus that feeds on Eastern gray squirrels and chipmunks, which serve as amplifying hosts for LACV. Mosquito LACV infection is lifelong and mosquitoes can become dually in fected with other bunya viruses allowing for development of intra-genus reassortants (Bennett et al 2007). LACV has been identified in several Midwestern and Mi d-Atlantic states, with an average of 75 cases of LAC encephalitis reported to the CDC each year (CDC, 2005b). While California serogroup arboviruses (other than LACV or CEV) have previously been isolated in Florida (Lewis

PAGE 42

17 et al 1965; Quick et al 1965; Bigler et al 1975), they are not significant human pathogens in the state. Togaviridae (genus Alphavirus) The Togaviridae family was restructur ed in 1984 (Karabatsos, 1985) and now contains only two genera, Alphavirus and Rubivirus. Rubella virus is the sole member of the Rubivirus genus and is more commonly known as German measles, which is transmitted person-to-person (Schlesinger and Schlesinger, 2001; Chantler, Wolinsky and Tingle, 2001). In contrast, the genus Alphavirus includes 28 viruses (Gubler, 2001) and were initially classified as serologic Group A arboviruses (Casals and Brown, 1954). The alphaviruses are all transmitted by arthropods, are restricted geographically in distribution, and share a common re plication strategy. The pathogenic alphaviruses can be divided into two groups, those causing human diseases characterized by encephalitis, usually found in the New World (e.g.Eastern Equine Encephalitis virus [EEEV]), and viruses that cause arthritis and rash, found primarily in the Old World (e.g. Chikungunya virus) [Griffin, 2001]. The emergence of West Nile virus in the western hemisphere has raised concerns that Chikungunya virus may be introduced into the United States by infected travelers returning from Africa, India, or Asia, where the virus has caused epidemics. A recent study found that infect ed travelers had high titers of Chikungunya viremia, sufficient to potentially infect Aedes aegypti and Aedes albopictus mosquitoes and could facilitate local transmission in the United States (Lanciotti et al 2007). Alphaviruses can be transmitted by a wide range of mosquito species, but each virus typically has a preferred mosquito vector for the enzootic cycle that uses either birds or mammals as primary amplifying hos ts (Scott and Weaver, 1989). Viruses which

PAGE 43

18 use avian amplifying hosts, such as EEE comple x viruses in North America, may be more efficiently dispersed over wide geographic re gions, enhancing gene flow, and thus far have remained highly conserved. On the other hand, viruses which utilize mammalian enzootic hosts, such as Venezuelan equine encephalitis virus (V EEV) and strains of EEEV which amplify in rodent hos ts in the tropics, have a sm aller range of dispersal due to limited mobility of the host, which has re sulted in genotypic evolution within multiple geographic foci in South America (Cilnis et al 1996; Weaver et al 1997). Recombination between alphaviruses has been difficult to achieve in vitro, but is estimated to have occurred naturally thousa nds of years ago when a Sindbis-like virus and EEEV recombined to form the Western Equine Encephalitis complex viruses (Western Equine Encephalitis virus (WEEV), Highlands J virus (HJV), and Fort Morgan virus). In Florida, surveilla nce programs have found that EEEV and HJV are enzootic throughout the region, with EEEV an important human pathogen (Bigler et al 1976; Stark and Kazanis, 2004, 2005, 2006). Flaviviridae (genus Flavivirus) The Flaviviridae family (from the Latin flavus or yellow referring to the prototype yellow fever virus) has three genera, including the Flavivirus, Pestivirus and Hepacivirus Pestiviruses are animal pathogens (e .g. bovine viral diarrhea virus) and the human pathogen hepatitis C viru s is the only member of th e hepaciviruses (Lindenbach and Rice, 2001). The genus Flavivirus includes about 70 vi ruses (Gubler, 2001; King et al 2007), which were originally classified as serologic Group B arboviruses (Casals and Brown, 1954). Forty of these flaviviruses are significant human pathogens, including Japanese encephalitis virus (J EV), the 4 serotypes of dengue virus (DENV 1-4), yellow

PAGE 44

19 fever virus (YFV), tick-borne encephalitis vi rus (TBEV), St. Louis encephalitis virus (SLEV) and West Nile virus (WNV) [Lindenb ach and Rice, 2001]. These viruses are arthropod-borne and transmitted to vertebra tes through infected mosquitoes or ticks (Chambers et al 1990). Yellow fever virus was the first flavivirus isolated (1927), the first filterable agent proven to cause huma n disease and the first virus proven to be transmissible by an arthropod vect or (Burke and Monath, 2001). Flaviviruses can be categorized into antigen ic complexes and subcomplexes based on serological criteria or into clus ters, clades and species based on molecular phylogenetics (Lindenbach and Rice, 2001). Th e Japanese Encephalitis (JE) antigenic serocomplex includes 10 arboviruses, including the medically important flaviviruses in the Americas. The American pathogenic JE viruses with mosquito vectors include St. Louis encephalitis virus, West Nile virus and Rocio virus. JE serocomplex viruses demonstrate extensive antigenic cross-reactivity with family members, often complicating diagnosis of disease (Chambers et al 1990). However, only SLEV and WNV are enzootic to the United States (Kra mer and Chandler, 2001). Table 2-1 lists the medically important viruses of the Flavivirus genus, including geographic distribution, primary vertebrate hosts and a ssociated clinical syndromes. Virus Life Cycle Flaviviruses are able to enter cells via interactions between the viral surface glycoprotein and several cellular receptors The immune response may enhance viral uptake into cells if viral pa rticles are opsonized with non-ne utralizing antibodies and bind to cells expressing Fc receptors (antibodydependent enhancement) [Lindenbach and Rice, 2003]. The virus enters a cell by recep tor-mediated endocytosis, mediated by the

PAGE 45

20 Table 2-1 Medically Important Vector-borne Flaviviruses Flaviviruses pose a significant risk to the health of millions of people around that world that live in regions with endemic, enzootic, or epidemic transmission of these arboviruses. This table summarizes ch aracteristics of each virus, including the clinical disease fr equently associated with inf ection, the vector and primary ve rtebrate host integral to the transmission cycle, and geographic distribution. Medically Important Vector-borne Flaviviruses Virus Vector Vertebrate Host Huma n Disease Geographi c Distribution Dengue 1-4 Yellow fever Japanese encephalitis West Nile St. Louis encephalitis Rocio Murray Valley encephalitis Kyasanar Forest disease Omsk hemorrhagic fever Tick-borne encephalitis Mosquitoes Mosquitoes Mosquitoes Mosquitoes Mosquitoes Mosquitoes Mosquitoes Ticks Ticks Ticks Humans, primates Humans, primates Birds, pigs Birds Birds Birds Birds Primates, rodents, camels Rodents Birds, rodents FI, HF FI, HF FI, ME FI, ME FI, ME FI, ME FI, ME FI, HF, ME FI, HF, FI, ME Worldwide (tropics) Africa, South America Asia, Pacific Africa, Asia, Europe, Americas Americas South America Australia India, Saudi Arabia Asia Asia, Europe, North America FI Febrile illness, HFhemorrh agic fever, ME Meningoencephalitis Table adapted from Gubler, 2007

PAGE 46

21 virion envelope protein and plasma membrane receptors (Chambers et al 1990) and is internalized into clathrin-coated pits (L indenbach and Rice, 2003). Low pH induces fusion of the virus and host cellular memb rane to release the virus nucleocapsid. Nucleocapsid uncoating occurs in the host cy toplasm for release of the viral genome. Transcription and translation of the vira l genome produces proteins that lead to replication of the virus and assembly of ne w viral particles (Lindenbach and Rice, 2003). The flavivirus life cycle is illustrated in Figure 2-2. Molecular Biology Flaviviruses are small, lipid-enveloped RNA viruses approximately 50 nm in diameter with a 30 nm core containing a single positive-strand genomic RNA. Flavivirus virions contain a nucleocapsid (30 nm core ) surrounded by a host membrane derived lipid bilayer. This lipid surface contains the viral envelope (E) and membrane (M) spike proteins (Chambers et al 1990). The major antigenic determinant is the E glycoprotein, which mediates binding and fusion of virus entry into a cell. The M protein is a proteolytic fragment of the precursor membrane (prM) prot ein and is produced during maturation of nascent viral particles. Re moval of the lipid envelope (with nonionic detergents) exposes the nucleo capsid, which contain capsid (C ) proteins and the genomic RNA (Lindenbach and Rice, 2003). Genome Structure The genome consists of single-stranded positive sense RNA of approximately 11,000 nucleotides. This genomic RNA is infectious and appears to be the only virusspecific mRNA molecule in infected cells (Chambers et al 1990). Flaviviral genomic RNAs have type I caps (m7GpppAmpN2) at their 5 ends and ar e not 3 polyadenylated

PAGE 47

22 Figure 2-2 Life cycle of Flaviviruses Flaviviruses enter a cell through recepto r-mediated endocytosis, where uncoating of the nucleocapsid occurs in the cytoplasm. This releases the viral genome, which allows transla tion of the polyprotein followed by replication of the viral genome, virus assembly and maturation. Used with permission (Lindenbach and Rice, 2001)

PAGE 48

23 (unlike cellular mRNAs). Positive strand RNA viruses do not make subgenomic mRNAs. Instead, the genomic RNA is used directly as mRNA for the translation of both structural and nonstructural proteins followed by repl ication of the RNA genome (Ball, 2001). Figure 2-3 diagrams the replication scheme used by single stranded positive-sense RNA flaviviruses. The most notable feature of the flaviviral genome is the presence of a single long open reading frame (ORF ) of more than 10 kilobases (kb). Flanking the long ORF are 5and 3-noncoding (untranslated) regions of approximately 100 bases and 400-700 bases, respectively. Translation of the long ORF produces a large po lyprotein which is cleaved both coand post-translationally into 10 pr oteins, divided into 3 structural and 7 nonstructural elements. Figure 24 illustrates the genome struct ure, with the structural genes located at the 5 end and the nonstruc tural genes at the 3 end of the genome in order 5-(C-prM-E-NS1-NS2A-NS2B-N S3-NS4A-NS4B-NS5)-3 (Chambers et al 1990; Lindenbach and Rice, 2003). Structural Elements Three structural proteins are encoded by th e N-terminal region of the flaviviral ORF (approximately 25% of the genome be ginning at the 5 end) and include the precursor/membrane [prM(M)] capsid (C), and envelope (E) proteins. Membrane proteins are responsible for the maturation of immature viral partic les into infectious forms (Lindenbach and Rice, 2001). The glyc oprotein precursor of the M protein, prM has chaperone-like properties and is needed for proper folding of the envelope protein. In the secretory pathway, immature virus particle s are converted into mature virions with cleavage of the prM protein into pr and M fr agments by Golgi apparatus furin or furin

PAGE 49

24 Figure 2-3 Replication Scheme of Sing le Stranded Positive Sense RNA Viruses The flavivirus genome is a single stranded positive sense RNA, which is infectious. A positive sense ssRNA genome is infectious because once it is uncoated in the cell (Step 1), the virus delivers the genomic RNA to cellular ribosomes and initi ates the infection cycle with translation. The genomic RNA is utilized directly as the mRNA for tr anslation of both structural and nonstructural proteins (Steps 2 & 3). The nonstructural proteins catalyze replication w ith a virus RNA dependent RNA polymerase (Step 4) and the synthesis of antigenomic RNA (Step 5). Replication creates more genomic RNA for further transla tion of proteins (Steps 6 & 7) and for assembly with st ructural proteins to produce progeny virus (Step 8) [Ball LA, 2001]. Figure adapted from Ball (2001) Polyprotein precursor Structural & nonstructural proteins Replication enzymes 8 Antigenomic RNA Enzyme assembly (+ host subunits?) Virus assembly Translation of replicated genomes Progeny virus Flaviviruses Entry, uncoating of genomic RNA Proteolytic processing Viral RNA 2 6 7 3 4 1Translation of genomic RNA RNA replication Transcription 5

PAGE 50

25 Figure 2-4 Flavivirus Genome Organization The flavivirus genome consists of single-stranded positive sense RNA of approximately 11,000 nucleotides, with a single long open reading frame (ORF). The structural genes are enco ded at the 5 end of the genome for the capsid (C), membrane (M), and envelope (E). Seven nonstructural genes are located downstream of the structural genes for NS1, NSA/B, NS3, NS4A/B, and NS5. The ORF is flanked by noncoding (NC) regions at the 5 and 3 ends. Figure adapted from Chambers, Hahn, Galler, & Rice (1990) 3' 5'NC 3'NC ORF anchCprME NS2BNS3 NS5 pr CN S 1 N S 2 A NS1-2A NS4A NS4A-4B NS4B M Structural Nonstructural C Capsid M Membrane E Envelope NS Nonstuctural Pr -Precursor 5'-cap Flavivirus Genome Organization

PAGE 51

26 like enzymes. Thus, the pr fragment is beli eved to stabilize E and prevent it from rearranging in the early secret ory pathway. After cleavage, pr is secreted and the M protein is found in mature virions (Lindenbach and Rice, 2003). The capsid protein is highly basic wi th charged residues that mediate RNA interaction, with a si gnal peptide C-terminal hydrophobic an chor for translocation of the prM to the endoplasmic reticulum (ER). This hydrophobic anchor is cleaved from the mature capsid protein by viral serine proteases (Lindenbach and Rice, 2003). Mature C proteins are then integrated to form stru ctural nucleocapsids (Lindenbach and Rice, 2001). The envelope (E) protein is the major structural and surface protein of the flaviviral virion, which mediates binding and membrane fusion (Chambers et al 1990; Lindenbach and Rice, 2003). The envelope protein is also the main target for neutralizing antibodies (Chambers et al 1990). The envelope regi on is highly conserved, although it has been suggested that viral mu tations in this region may impact virus biology and host immune response to the vi rus (Twiddy and Holmes, 2003). As such, the envelope region has been intensively studied for phylogenetic and molecular epidemiology purposes to identify alterations in flaviviral envelope protei ns that could impact disease potential. Cons equently, the majority of flavivirus published gene sequences in GenBank are E gene sequences (Twiddy and Holmes, 2003). Nonstructural Elements Seven nonstructural proteins are encoded by the long ORF of the flaviviral genome (the remaining 75% of the genome), including NS1, NS2A & NS2B, NS3, NS4A & NS4B and NS5. While they are not struct ural elements, these proteins still have

PAGE 52

27 important functions for replication, transl ation and packaging of the virion, and attenuation of host antiviral responses (Samuel and Diamond, 2006). It should be noted that a complete understanding of many of these processe s is still unknown (Chambers et al 1990; Lindenbach and Rice, 2003). The NS1 protein is retained in cells, but also has cell-surface and extracellular forms (Lindenbach and Rice, 2003). Antibodi es to this protei n are elicited in flaviviral infections, which also have significant complement fixing activity (Chambers et al 1990). NS1 is also important for RNA rep lication, virus production and has cofactor activity for the viral replicase (Samuel and Diamond, 2006). NS2A is membrane associated and cleaved from NS1 to become an important determinant for infectious particle production, as it inte racts with NS3 for virion assembly and may coordinate the shift from RNA packaging to RNA replication with NS3, NS5 and the 3 UTR. NS2B is a small, membrane-associated protein that is a ne cessary cofactor for the serine protease in NS3, and the two proteins form a complex (NS2B-NS3) [Lindenbach and Rice, 2003]. NS3 is the second largest viral protein a nd is highly conserved among flaviviruses (Chambers et al 1990). NS3 is a multifunctional protein with enzymatic activities that are involved in RNA replica tion and polyprotein processing (strategy that allows for synthesis of multiple protein products from a single RNA genome) [Lindenbach and Rice, 2003]. The N-terminal region of NS3 has been determined to be a serine protease (in conjugation with NS2B) that cleaves most of the nonstructural proteins for polyprotein processing. In addi tion, the C-terminal region of NS3 has been implicated in RNA replication with significant homology to RNA helicases (enzymes responsible for unwinding RNA duplexes). The C-terminal region also encodes RNA triphosphatase

PAGE 53

28 (RTPase) activity that may be involved in dephosphorylating genomic RNA at the 5end prior to cap addition. NS4A and NS4B are small hydrophobic proteins with unknown functions, although both may play some role in RNA replication (Lindenbach and Rice, 2003). The NS5 protein is the larg est and most highly conserved flaviviral protein (Chambers et al 1990) and is important to RNA repl ication of the virus. At the Nterminus, NS5 has homology to S-ade nosyl-methionine (SAM)-dependent methyltransferases. This SA M-methyltransferase activity i ndicates that NS5 is involved in formation of the 5 cap. Deletions in SA M binding regions have been proven lethal for virus replication (Lindenbach and Rice, 2003). In contrast, the C-terminal region of NS5 has polymerase activity with significant homology to RNA-dependent RNA polymerases. NS5 has been shown to function as the R NA-dependent RNA polymerase (RdRp), which is critical for RNA replica tion (Lindenbach and Rice, 2003). Phylogeny and Evolution Phylogeny can be defined as the evolutionary relationship between organisms, where each organisms phylogeny reflects the e volutionary branch that led up to the organism and has taxonomic significance. On e advantage of the use of nucleotide sequence data in virus taxonomy is that phylogeny can more readily be inferred (Mayo and Pringle, 1998). Previously, arboviruses were classified into groups based on their antigenic characterist ics in hemagglutination inhibiti on assays (Casals and Brown, 1954) and cross-neutralization tests (de Madrid and Porterfield, 1974 ). Over the last 20 years, significant advances in biomedical tec hnology have produced more sophisticated, discriminatory molecular methods and inst ruments (e.g. polymerase chain reaction, real-

PAGE 54

29 time thermal cyclers and nucleotide sequencers) for the typing of microorganisms. As a result, the classification of arboviruses is now routinely based on phylogeny from nucleotide sequence analysis rather than trad itional antigenic tec hniques for phenotypic characterization to identify new strains or to re-classify previous isolates (Calisher et al 2001). Phenotypic characterization is important to assess relative fitness of a newly isolated virus (in vertebra tes and arthropods) and its di sease potential, yet these classical methods are difficult to standardi ze, less sensitive to variants, as well as less sophisticated, slower and less specific than molecular techniques. Plus, it is usually necessary to isolate and handle the infectious agent. However, these classical techniques have become obsolete in many virology labor atories due to the tremendous diagnostic power of molecular techniques (Calisher et al 2001). Rapid genotypi c characterization is possible from the nucleic acid only and ha s provided researchers with insight into arbovirus replication, important elements for virion assembly and processing of the genome, and molecular targets for vaccine development and drug discovery (Lindenbach and Rice, 2003). Prior to 1984, flaviviruses were classified as members of the Togaviridae based on traditional antigenic methods (Karabatso s, 1985). Phylogenetic analysis of flaviviral genes and studies of viral stru cture and replication found that flaviviruses were an evolutionary distinct group from the Togaviridae. Consequently, these viruses were reclassified in 1984 as a separate family, th e Flaviviridae (Karabat sos, 1985). Molecular phylogenetics has allowed for the classification of yellow fever virus, which lacks close relatives (Burke and Monath, 2001).

PAGE 55

30 In 1998, an extensive molecula r phylogenetic study of the Flavivirus genus was conducted by the CDC to establish the genetic relationship among these arboviruses as compared to the existing serolo gical classification method (Kuno et al 1998). The study was motivated by the discovery of new arboviruse s that were not defi ned or serologically classified, yet were described as flaviviruses in the literature. In addition, classification through molecular phylogeny could be used for viruses that cannot be grouped by serology (i.e. yellow fever virus) [Kuno et al 1998]. A total of 71 viruses were typed based on a 1 kb portion of the NS5 gene. An unrooted neighbor-joining phylogram iden tified a monophyletic tree with 14 flaviviral clades (group of viruses with 69% or higher pairwise nucleotide sequence identity), with 3 clusters separated into: 1) mosquito-borne viruses, 2) tick-borne viruses and 3) no known vector viruses (cluster definition: bootstrap support greater than 95% and hostvector association). An updated smaller vers ion of this phylogram (n=35) is shown in Figure 2-5 (Kuno and Chang, 2005). The CDC st udy created objective criteria for the classification of flaviviruses based on the NS5 gene, which agree with previous flaviviral phylograms based on the envelope gene. The authors noted that phylograms based on short sequences (<300 bases) can be different from those cr eated with longer sequences, and caution should be used when interpreting such phylograms (Kuno et al 1998). RNA viruses have the capacity for rapid evolution due to their short replication times, high mutation rates (RNA polymerases lack proof-reading ability) and large population sizes in comparison to DNA viruse s (Drake and Holland, 1999). However, rapid rates of evolution have not been observed in arboviruses (Weaver et al 1992; Cilnis et al 1996; Jenkins et al 2002). Evolutionary pressures on flaviviruses are predominately

PAGE 56

31 Figure 2-5 Phylogeny of the Flavivirus Genus Phylogram of flaviviruses (n=35) generated using a neighbor-joining inference method (MEGA). The number at each node indicates % branch support by bootstrap sampling with 500 replicates. Phylogram is based on the complete RNA-dependent RNA polym erase domain of the NS5 gene. The mosquito-borne flaviviruses emphasized in this review include WNV, SLEV, DENV 1-4, YFV, and JEV. Used with permission, Kuno and Chang (2005)

PAGE 57

32 applied by arthropod and avian environments which have been hypothesized to limit rapid evolution by alternate cycles of viral re plication in arthropod ve ctors and vertebrate hosts. This implies that compromises in rep licative ability are ma de by virus populations in both vertebrate and arthropod hosts (Weaver et al 1992 & 1994). Homologous recombination is a process of physical rearrangement that can occur between two DNA strands to create genetic diversity and may c onfer evolutionary advantages to an organism. Recently, RNA reco mbination has also been demonstrated in a few RNA viruses, including polio virus and Western Equi ne Encephalitis virus (WEEV a recombination of EEEV and Sinbis virus) These findings bely the traditional assumption that evolution in arboviruses is clonal with di versity generated through the accumulation of mutational changes over time Subsequently, homologous recombination was demonstrated in the Flaviviridae for all four serotypes of dengue virus (Holmes et al 1999; Tolou et al 2001) and St. Louis encephalitis virus (recombination between Argentina and United States strains of SLEV) [Twiddy and Holmes, 2003]. Note: the recombination identified for SLEV may be a spurious result due to the removal of the envelope sequence from the GenBank databa se (personal communication, L. Kramer). The impact of recombination on the evoluti on of virus taxa will largely depend on the level of difference between the viruses that undergo a recombination event. Currently, recombination in flaviviruses has been identified only in very closely related viruses, leading to low level sequence dive rgence (Calisher and Gould, 2003). Genetic diversity can also be genera ted through mutation. There are two basic categories of mutation, base substitution and deletion/insertion mutations. Base substitution mutations result in the replacem ent of one nucleotide with a different

PAGE 58

33 nucleotide in a nucleic acid sequence. De letion or insertion mutations involve the deletion or insertion of one or more nucleotides in a nucleic acid se quence. Both types of mutation can occur in coding (impact amino acid sequence of a protein) or non-coding regions of the genome. In a coding region, ba se substitution mutations may be silent (no change in amino acid sequence), missense (replacement of wild type amino acid with another residue), or nonsense (resulting in premature termination of translation during protein synthesis). Similarly, deletion or inse rtion of multiples of three nucleotides results in removal or addition of one or more amino acids in a protein sequence. Deletions or insertions not in multiples of three can result in a translational reading frame shift. In general, frameshift or nonsense mutations may inactivate a gene whereas missense mutations may result in subtle phenotypic differences (Condit, 2001). Phylogenetic studies are an important tool to elucidate the evolution of viruses and are especially valuable to identify the origin and spread of emerging or re-emerging diseases (Gaunt et al 2001). In the family Flaviviridae, most phylogenetic studies imply that flaviviruses originated in Africa and then spread to other continents. One example is the trans-Atlantic dispersal of yellow fever vi rus that likely coincided with transportation of mosquitoes and people from Africa to the Americas on slave ships (Gould et al 1997; Gould et al 2003). It has been estimated that flaviviruses diverged from an ancestral virus sometime in the past 5,000 to 10,000 years (Zanotto et al 1996b), such that the evolution of this genus likely followed the e nding of the last ice age and accompanied the development of human civilizati on and farming practices (Gould et al 2003). Additional studies indicate that the evolution of flaviviruses is largely driven by arthropod vectors. Two theories of evolution are widely hypothesized: 1) the mosquito

PAGE 59

34 and tick-borne viruses evolved from a comm on ancestor, with the no known vector viruses entering into arthropod tran smission cycles. However, a few flaviviruses are competently transmitted by both vectors (e.g. WNV, SLEV and YFV have been found in ticks). And, non-vector viruses cannot be cu ltured in mosquito cell lines. As such, another theory has been proposed: 2) flaviviruses may have instead evolved from the no known vector to tick-borne and then into th e mosquito-borne group (Burke and Monath, 2001). Estimates of the relative degree of am ino acid divergence between tick-borne and mosquito-borne flaviviruses concluded that mosquito-borne flaviviruses evolved 2.5 times faster than tick-born viruses. Physiol ogically, these results can be explained by the life cycles for ticks versus mosquitoes, wh ere ticks have a long life span and few blood meals as compared to the short life span and multiple blood meals of mosquitoes (Zanotto et al 1995). As a result, further research is needed to elucidate the evolution of flaviviruses and identify which group (no known vect or, tick-borne or mosquito-borne) is the most divergent (Gould et al 2003). A combination of constraints, including arthropod vectors, vertebrate hosts and ecology plus human activity, has determined the evolution, dispersal patterns, and epidemiological characteristics of flaviviruses For instance, flavivirus phylogenetic relationships have been show n to correlate to biogeography (Old World vs. New World), disease association (encephalitic vs. he morrhagic illness) and arthropod vectors (mosquito-borne clade further subdivided into Aedes sp. and Culex sp. clades) (Gaunt et al 2001). Therefore, phylogenetic analysis wi ll continue to provide insight into virus taxonomy and further improve our knowledge of vi rus relationships, as well as the origin and spread of diseases of ma jor public health significance.

PAGE 60

35 Important Biologic Characteristics Hemagglutination can be described as the clumping together of erythrocytes (RBCs) to form interlocking matrices due to the binding of a gglutinin (protein) molecules on the surface of each cell. Flaviviruses have the ability to hemagglutinate avian RBCs, especially goose and chicken erythrocytes, which continues to be a valuable method for virus quantification, and for measuring antiviral antibody by the inhibition of hemagglutination (HAI) test (Clarke and Casals, 1958). Flaviviruses produce cytopathic effects and fo rm plaques in a variety of cell cultures, including vertebrate reptilian and arthropod deri ved types. In contrast to alphaviruses, flaviviruses replicate slowly in most verteb rate cell lines, where SLEV has an 11 hour latent period and reaches peak ti ter at 28 hours (in BHK-21 cells) [Burke and Monath, 2001]. Pathogenesis and Pathologic Changes Three pathogenic patterns have been described in flaviviral encephalitis: 1) fatal encephalitis (preceded by early viremia, extens ive extraneural replication); 2) subclinical encephalitis (preceded by low viremia, late infection of the brain, and viral clearance); and 3) inapparent infection (trace vire mia, limited extraneural replication, no neuroinvasion). The course of infection and prognosis is influenced by both virus and host factors. Virus strains may differ in virulence and neuroi nvasiveness, or both. Host factors that impact pathogenesis include age, sex, immunocompromised status, and genetic susceptibility (B urke and Monath, 2001). Flaviviruses are commonly injected into the hos t through the bite of an infected mosquito and cross-infection can occur from adjacently feeding mosquitoes, which may

PAGE 61

36 increase transmission to the host. Mosqu ito saliva reduces the local immune response and promotes the success of viral infecti on. Additional transmission routes have been reported for West Nile virus, and include transplacental and breast milk transmission, blood transfusion and organ tran splantation associated inf ections, as well as urinary excretion of the virus (human) and experimental oral transm ission (birds) (King et al 2007). Flaviviruses are pleiotropic and infect a wide range of cell types (King et al 2007). After inoculation into the skin, virus may be taken up and infect Langerhans cells in the skin (e.g. dengue virus). Langerhans cell s could then transport the virus and infect lymph nodes draining the inoculation site. Viru s replication in lymph nodes allows the virus to be carried throu ghout the lymphatics to the thoracic duct and into the bloodstream. A substantial plasma viremia (existence of virus in the bloodstream) seeds extraneural tissues, including skeletal and smooth muscle, connective tissue, myocardium, and endocrine and exocrine gl ands. These tissues support additional virus replication and release of virus into the bloodstream (Burke and Monath, 2001). The exact mechanism by which encephalitic flaviviruses enter the central nervous system (CNS) is unclear. High viremia, develo pment of brain infection and appearance of viral antigen in nervous tissue leads to the conclusion of hematogenous spread into the CNS. Artificial disruption of the blood-brain barrier (by und erlying infection) may also lead to encephalitis and neuroinvasion, alt hough olfactory neuronal infection has also been suggested as a route of neuroinvasion. Once the virus gains entry to the CNS, it spreads rapidly (Burke and Monath, 2001).

PAGE 62

37 Pathologic changes in th e CNS of humans with flaviviral encephalitis include neuronal and glial damage, inflammation, nodu le formation, and cerebral in terstitial edema. After recovery from acute encephal itis, residual neurologic deficits may range up to 12 through 67 years post infection (Japanese encephalitis virus) [Burke and Monath, 2001]. Antigenic Characteristics Flaviviruses can be grouped based on antigen ic classification schemes derived from hemagglutination inhibition (HAI) and neutralization assays. Currently, flaviviruses can be separated into eight antigenic co mplexes, including Modoc, Rio Bravo, TBE, Dengue, JE, Tyuleniy, Ntaya and Uganda S. The envelope protein is the viral hemagglutinin and primary target for neutra lizing antibodies. In addition, monoclonal antibodies have identified differences at the epitope level that link these antigenic complexes (Burke and Monath, 2001). Recent classification schemes of flaviviruses based on phylogenetic analyses strongly para llel earlier relationships identified in flaviviral family members based on antigenic methods (Calisher and Gould, 2003). The nonstructural protein NS1 is expresse d on the surface of infected cells and secreted. This antigen has been shown to e licit an immune response; however, antibodies to NS1 are non-neutralizing and do not react with the virion. Desp ite these somewhat contradictory findings, NS1 antibodies have a protective effect such that passive transfer of these antibodies can experimentally prot ect animals from infection with dengue and yellow fever viruses. Studies suggest that th e protective role of NS1 may be a function of its recognition by the immune system and subse quent destruction of in fected cells (Burke and Monath, 2001).

PAGE 63

38 Immune Response E protein, NS1, and NS3 are the mo st immunogenic proteins during a flavivirus infection (Hill et al ., 1993). Envelope proteins are the major surface proteins considered to be an important factor in receptor bindi ng and membrane fusion with host cells. The E protein stimulates neutralizi ng antibody response and changes in this protein have been shown to affect WNV virulence (Hayes and Gubler, 2006). Active immunization with NS1 has been protective for anim als challenged with homologous flaviviruses (Chambers et al 1990). Adaptive cellular and humoral immune responses induced by arboviral infection are important in recovery from infec tion. Virus-specific immunoglobulin M (IgM) antibodies are produced very early in the course of disease, usually detectable in serum within 3 to 4 days of infection, and are the targeted molecules for diagnosis of infection. IgM antibodies are generally not long lasting, often diminish ing within 14 to 30 days, and their presence denotes a recent infection (Olson et al 1991; Martin, 2000). Yet, IgM antibodies have been detected in sera after 12 months for WNV encephalitis patients that have survived infection (36%). Thus, dete ctable IgM may sometimes reflect a past infection (Hayes et al 2005b). Conversely, immunoglobulin G (IgG) antibodies are first detectable in serum 7 to 14 da ys after infection (Calisher et al 1986c; Olson et al 1991), but can remain at high levels for years, espe cially after secondary exposure to the same, or closely related, infec tious agent (Figure 2-6). Appearance of antibody correlates with dec lining viremia as well as neutralization of virus infectivity. The hu moral antibody response not only provides protection from flaviviral disease, but also allows for early se rologic antibody test ing to diagnose the

PAGE 64

39 Figure 2-6 Theoretical Primary and Secondary Antibody Response after Exposure to an Infectious Agent Within 3-4 days, IgM antibodies are quickly produced but decline as IgG antibodies rise, which can remain elevat ed for months to years. Secondary exposure to the same antigen rapidl y results in high levels of IgG. Figure adapted from Immune Response by Dr. Thomas Terry. Available from URL: http://sp.uconn.edu/~bi102vc/102f01/terry/immunity.html

PAGE 65

40 infection (Lindenbach and Rice, 2001). This immune response prevents reinfection with the same virus strain in most mammalian ho sts, and may promote herd immunity in a population (Kuno and Chang, 2005). A live-atte nuated virus vaccine (17-D strain) is available for yellow fever virus for humans. In addition, inactivated virus vaccines are available for Japanese encephalitis and tickborne encephalitis viruses (Lindenbach and Rice, 2001). For WNV, two vaccines are available to immunize horses: an inactivated virus vaccine and a recombinant vaccine to express WNV antigens (using canarypox virus). Currently, several WNV vaccine candida tes are in animal and clinical studies for development of a human vaccine (Hayes et al 2005a). West Nile Virus Discovery In 1937, West Nile virus was first isol ated from the blood of a febrile woman participating in a malaria study in the West Nile region of Uganda (Smithburn et al 1940). Thirteen years later, WNV isolates were obtained from the blood of three apparently healthy child ren in Egypt (Melnick et al 1951). Since the 1950s, hundreds of WNV isolates have been obtained over a wide geographic regi on and from humans, birds, and mosquitoes (Hayes, 2001). Research ers have shown that WNV is antigenically related to two other arboviruse s known to cause encephalitis, St. Louis encephalitis virus (SLEV) and Japanese encepha litis (JE) virus (Smit hburn, 1942). In 1999, WNV dramatically expanded its geographic range (previously limited to the Old World or Eastern Hemisphere) to include the New Worl d with its emergence in North America in New York City (Davis et al 2005).

PAGE 66

41 Phylogeny & Evolution West Nile virus can be grouped into two distinct genetic linea ges (I and II) on the basis of signature amino acid s ubstitutions or deletions in the envelope protein (Brinton, 2002). Lineage I strains are f ound in Africa, Europe, Asia, Au stralia, and the Americas. All outbreaks of human and equine disease have been associated with WNV lineage I strains, whereas lineage II strains are not associated with clin ical disease (Hayes et al 2005a). Lineage II strains have only b een isolated in sub-Saharan Africa and Madagascar, where they cause endemic enzootic infections (Brinton, 2002). Lineage I strains are further subdivided in to three clades: 1a, 1b (Kunjin), and 1c (Indian) [Lanciotti et al 2002]. The isolates in clade 1a include the strains from the United States that are highly virulent, whereas other lineage I clades (and lineage II) comprise both virulent and atte nuated strains. These differences in pathogenicity are not clearly understood, but may be related to nucle otides coding for speci fic regions in the prM, E, or nonstructural proteins. WNV strains in the United States are closely related to isolates obtained in Israel during 199 8 (99.7% nucleotide sequence homology) and indicate that the US strains originated in the Middle East (Hayes et al 2005a). The North American strain of the virus isolated in Ne w York is more virulent in American crows than strains from Kenya and Australia (where Kunjin virus has been identified as a subtype of WNV) [Langevin et al 2005]. In the United States, phylogenetic anal ysis reveals that WNV was successfully introduced only once (into New York Cit y, NY99 strain) and has remained highly conserved in its spread across the continent (Kramer et al 2007). However, two genetic variants of the North American strain have r ecently emerged. Both variants were isolated

PAGE 67

42 in Texas in 2002, where the major variant di ffered from the NY99 strain by 0.18% in the nucleotide sequence and the minor variant by 0.35% of nuc leotides (Hayes et al 2005a). This second genotype of WNV is referred to as WN02, since it was recognized as a significant entity that year (Snapinn et al 2007). In 2003, attenuate d strains of this genotype were isolated from birds in Texas and Mexico characteriz ed by smaller plaque sizes and reduced neuroinvasiveness (as comp ared to the NY99 strain). These studies provide the first evidence of phenotypic vari ation of WNV in the Western Hemisphere (Hayes et al 2005a). Natural History The natural history of a virus can be defi ned as the multiple factors that influence the viral life cycle. The natura l history of an arbovirus is especially complex, as several conditions influence virus success including vector and avian abundance/competence to complete the amplification cycle, ecologi cal niches and rainfall/drought conditions (Monath, 1979). Some of these conditions are poorly understood, such as the exact mechanism(s) for arboviral pers istence between epidemic y ears and recrudescence of the virus each spring in colder climates. In addition, the sporadic nature of arbovirus transmission and unknown factors that switch an enzootic cycle into an epidemic continue to challenge researchers to further el ucidate the natural history of these viruses. An improved understanding of arboviral natu ral history will enha nce public health prevention strategies and predicti on of disease outbreaks (CDC, 1993). Amplification Cycle The flaviviral amplification cycle is similar for WNV and SLEV in North America. These arboviral encephalitides are zoonotic and maintained in complex life

PAGE 68

43 cycles involving a primary ve rtebrate host (avian) and a primary arthropod vector (mosquito). Vertebrate infection can occur af ter an infected arthropod takes a blood meal, and arthropod infections o ccur after feeding on viremic (presence of virus in the bloodstream) hosts. Usually the virus cycles silently between the primary arthropod vector and the primary vertebrate host until an ecologic ch ange occurs that allow the virus to escape this focus (Gubler, 2002). These cycles remain undetected until humans encroach on a natural focus, or the virus escap es this focus via anot her vector, vertebrate host or as the result of ecologic change. Humans and domestic animals may develop clinical illness but usually are incidental or "dead-end" hosts as they do not produce significant viremia to infect mosquito v ectors and continue the cycle (CDC, 2004b). Figure 2-7 illustrates the amp lification and transmission cycle of arboviruses, including WNV and SLEV. Vectors WNV has established enzootic foci in na ture, with amplification cycles between adult blood-feeding mosquitoes and bird rese rvoir hosts. Infectious mosquitoes carry virus particles in their salivary glands and infect suscepti ble bird species during bloodmeal feeding (CDC, 2007b). Several mosquito species have been shown to be competent vectors for WNV including Aedes, Anopheles, Mansonia and Minomyia species in Africa, Asia and the United States; however Culex species mosquitoes are the most competent for infect ion (Brinton, 2002). Culicine mosquitoes have been implicated as both the enzootic and/or epizootic vectors of WNV (Gubler, 2007). In general, flavivirus infection of the vector does not appear to damage the mosquito or have a deleterious effect on mosquito offspri ng (Burke and Monath, 2001).

PAGE 69

44 Figure 2-7 Arbovirus Transmission Cycle West Nile virus and St. Louis encephalitis virus share a similar amplification and transmission cycle. Both viruses are vectored by Culicine mosquitoes, share avian amplifying host species, and are impacted by abiotic conditions (rain, temperature) that influence host dynamics. Figure appears courtesy of the Centers fo r Disease Control & Prevention (CDC, 2007c)

PAGE 70

45 In Egypt, early field studies c onducted from 1952-1954 implicated Culicine mosquitoes as important WNV vectors, including virus isolates from pools of Culex antennatus, Culex univittatus, and Culex pipiens. Additional studies in South Africa and Israel in the 1960s further supported the role of the Culex univittatus complex as the major vectors of WNV in th e eastern hemisphere (Hayes 2001). Since those early studies, WNV has been isolated from more than 40 mosquito species in the eastern hemisphere (Gould and Fikrig, 2004). In th e three epidemics of WNV between 1996 and 2000, Culex pipiens mosquitoes were implicated as th e major vector for the first time, including the Romanian and North American epidemics (Hayes, 2001). Mosquitoes in the Culex pipiens complex have been observed to feed mainly on birds, although some members of the comple x primarily bite humans or other mammals (Kuno and Chang, 2005). Since the 1999 introducti on of WNV, 62 mosquito species with diverse ecologies and behaviors infected with WNV have been identified in the United States (CDC, 2007d), although it is believed that less than 10 of these species are the principal vectors of WNV (Hayes et al 2005b). In the US, Culex species are the most important maintenance vectors in the avian cycl e, with other species serving as the bridge vectors from birds to incident al hosts in mid to late su mmer (Gould and Fikrig, 2004). Culex nigripalpus, Culex salinarius, Culex restuans, Culex pipiens and Culex quinquefasciatus are the principal vectors involved in bird to human transmission of the virus, which may result in disease (Rey et al 2006). In Florida, Culex nigripalpus has been identified in the majority of WNV positive mosquito pools collected by state agencies (Stark and Kazanis, 2002-2006) and is considered to be the primary vector.

PAGE 71

46 West Nile virus has also been isolated occasionally from ticks but their role in the transmission and ecology of th e virus remains unknown (Hayes, 2001). Amplifying Hosts Vertebrate hosts for the virus to amplify in are also critical to maintenance of the enzootic cycle. Primary amplifying hosts fo r WNV in North America are corvids (crows, jays and magpies), house sparrows, house finches, and grackles (Komar et al 2003). Competent bird reservoirs will sustain an in fectious viremia (virus circulating in the bloodstream) for 1 to 4 days after exposure after which these hosts develop life-long immunity. Infected vertebrate hosts must develop high viremia titers (in excess of 105 plaque forming units [PFU]/ml) for a mosquito to acquire the virus from the blood (Burke and Monath, 2001). In laboratory studies, migratory Passeriformes (perching birds/songbirds), Strigiformes (owls), Falconiformes (hawks), and Charadriiformes (shorebirds) developed sufficient viremia to infect feeding mos quitoes. Certain passerine species including corvids, grackles, house sparrows and house finches were highly infectious to mosquitoes but had high mortality rates (>40%) [Komar et al 2003; Hayes et al 2005b]. Field studies conducted in different geographical areas corroborated the importance of birds in the transmission cycle of WNV based on the presence of high antibody rates in birds (Hayes, 2001). The spread of WNV throughout the United States into Canada, the Caribbean, Central and South America is due to the migration patterns of these bird reservoirs (Rappole and Hubalek, 2003; Gubler, 2007). In the United States, the westward movement of the virus in 2001, 2002, 2003 and 2004 is correlated to the Atlantic,

PAGE 72

47 Mississippi, Central, and Pacific flyways of migratory birds (Gubl er, 2007). After WNV spread throughout the northeas t, it appeared in Florid a in 2001 bypassing several midAtlantic states, a pattern that can be explained from these migratory patterns (Deardorff et al 2006). Further migration of these bird reservoirs south spread WNV into the Caribbean, Mexico and Central America from 2001-2003 (Gubler, 2007). The first evidence of activity in Sout h America occurred in 2004 (Colombia and Trinidad) and then caused equine deaths in 2006 (Argentina) [Morales et al 2006; Gubler, 2007]. Alligators may also serve as a reservoir for WNV in the southeastern United States (Klenk et al 2004; Jacobson et al 2005; Bowen and Nemeth, 2007). In addition, the lake frog appears to serve as a reservoir of infection in Russia. WNV has also been isolated from rodents in Nige ria and a bat in India, but mo st mammals do not appear to generate the high titered viremias necessary to contribute to the transmission cycle (Hayes et al 2005b). Incidental Hosts Humans, horses, and other mammals are not preferred reservoir hosts and do not contribute to WNV amplificati on; only low levels of viru s circulate in the bloodstream. They are incidental hosts, a dead-end for the transmission cycle since mosquitoes will not be infected upon taking a blood meal from these hosts (CDC, 2005c). In the eastern hemisphere, WNV infections in these mammal s are truly incidental where outbreaks of disease are infrequent and infections result in asymptomatic or mild illness in humans, horses and birds; rarely re sulting in death or neurologic disease (Gubler, 2007). However, the introduction of WNV into th e western hemisphere has resulted in significant morbidity and mortality associat ed with incidental host infections,

PAGE 73

48 especially in humans and horses. From 1999 to 2006, there were 23,975 human cases of WNV illness reported, with 962 fatalities in North America (4% mortality rate) [CDC, 2007e]. Approximately 44% of all confirme d cases were caused by WNV neuroinvasive disease (Kramer et al 2007). Conversely, it is important to note that severe neurologic disease and fatalities are rare in humans, hor ses and birds south of the North American border in the Caribbean, Mexico, Cent ral and South America (Gubler, 2007). Equines are significantly affected by WNV disease in North America. Horses are at higher risk for infection with arboviruses because of higher exposure levels; they remain outdoors and attract hordes of biting mosquitoes (CDC, 2005c) and if infected, may develop WNV encephalitis characterized by weakness, paralysis and recumbency (Morales et al 2006). In 2002, a large epiz ootic occurred in ho rses with 14,571 cases reported to the CDC in North America. Fortunately, the number of equine cases has declined dramatically since 2003 and 2004 due to the widespread use of an equine vaccine for WNV (Gubler, 2007). Case fata lity rates range from 30 to 40% in unvaccinated horses (Gubler, 2007; CDC, 2007b). Equine arboviral encephalitis cases are valuable surveillance tools, since morbidity in horses typically prec edes bridging of the virus into human populati ons (CDC, 2005c; Blackmore et al 2003). For the first time in the natural history of WNV, fatal infections were identified in mammals other than humans and horses during the epidemic/epizootic in the northeastern United States. Fatal WNV infections were diag nosed and reported to the CDC in a bat, cat, chipmunk, rabbit, squirrel, and skunk (Hayes, 2001). WNV has also been detected in over 30 species of wild vertebrate hosts includi ng alligators, bears, wolves, cattle, llamas, sheep, reindeer, elephants, rhinoceros, camels, seals and penguins in the US (Gould and

PAGE 74

49 Fikrig, 2004; Weaver and Barrett, 2004; Gubler, 2007). These findings indicate the tremendous host range of WNV in the west ern hemisphere, where it is highly promiscuous as compared to its host range in the eastern hemisphere and may result from a new geographical range with non-immune hosts (Weaver and Barrett, 2004). Ecology & Habitat Important ecological parameters govern the amplification and transmission cycles of arboviruses and include habitat, temperature and rainfall. These fa ctors also influence geographic distribution of the v ectors and hosts (Gubler, 2002). Geographic Location Until 1999, there were no Old World extant Culicine mosquito-associated viruses in the New World (Gould et al 2003). As a result, West Nile virus has become one of the most widespread flaviviruses in the world and its geographi c range continues to steadily increase (Rappole et al 2000; Gubler, 2007). West Nile virus is widely distributed throughout Africa, Europe, the Middle East west and central Asia, Oceania (WNV subtype Kunjin), and most recently, in North and South America (CDC, 2007f). The ecology of WNV is clos ely tied to its mosquito vectors as the virus cycles between bird and mosquito hosts. Conseque ntly, regions that ma intain or contain favorable habitats for Culicine mosquito vectors are predispo sed to enzootic transmission and epidemics of WNV based on the feeding be havior and preferences of these vectors (Kilpatrick et al 2006). Outbreaks of WNV in the United States have highlighted the importance of favorable mosquito habitats to the transmission of disease. For example, cases in the New York 1999 epidemic were cl ustered in an area with higher vegetation

PAGE 75

50 cover; in 2002, human cases in Chicago occu rred in areas with more vegetation, older homes, and lower human population density (Hayes et al 2005b). Ecologic niches with the appropriate ha bitat for these viruses may be artificially created from human influence in certain geogr aphic regions. For example, in the Nile delta, WNV transmission intensity is greater in the southern vs. the northern region due to the greater amount of irrigated land under cu ltivation in the southern region (Hayes, 2001). Extensive irrigation systems ha ve also been instrumental to Culex tarsalis vectored transmission of WNV in California and the southwest, where it affords extensive breeding grounds for the mosquitoes (Hayes, 2005b). In addition, epidemics in Israel (1960s) were restricted to two geographic sites previo usly covered by swamps that had been converted to fish ponds, but still retained earlier ecol ogical characteristics (Hayes, 2001). However, the importance of avian hosts in the transmission cycle cannot be discounted, especially as migratory birds ha ve effectively disper sed WNV throughout the Americas. Natural geographic features that fo ster habitat for birds also contribute to WNV activity as shown by epidemics in Romania, Russia, and NYC in the late 1990s. All three transmission sites were adjacent to large rivers, which provided a favorable wetland habitat for both resident a nd migratory birds (Hayes, 2001). In contrast to WNV infec tions reported in North Amer ica, very few human or animal cases of severe neurologic disease or death due to WNV have been reported in tropical regions (Caribbean, Mexico, Central and South Am erica) despite the abundance of Culicine mosquito vectors, passerine bird sp ecies, and habitat that support other epizootic/epidemic flaviviral transmission cycles (Gubler, 2007). It has been suggested

PAGE 76

51 that the extensive prevalence of other flaviviruses (especially dengue viruses) confers protective immunity to humans whereas enzootic SLEV, Rocio and Ilheus viruses (among others) may confer protective immun ity to bird and small mammal amplifying hosts, thus preventing infection with WNV. Geographic location may also impact this apparent attenuation of West Nile disease in the tropics as found for JEV and SLEV which typically only cause neuroinvasive epid emic disease in the temperate regions of their geographic distribution desp ite widespread transmission in the tropics. In fact, this geographic dichotomy has also been descri bed for WNV infection in the Old World (Gubler, 2007). Transmission Season In the eastern hemisphere, several charac teristics of WNV tran smission were first elucidated during the 1950s (Hay es, 2001). Serosurvey studies in the southern part of the Nile delta region of Egypt f ound that WNV transmission activity was most intense during the summer (June through September), peaki ng in July. In contrast, along the northern rim of the Nile delta near the Mediterranean coast, transmission intensity was much lower and maybe related to a smaller human popul ation density and lower density of the primary mosquito vector (Hayes, 2001). Tr ansmission is clearly influenced by both vector and host abundance. In the western hemisphere, the transm ission season is longer and WNV activity peaks at a different time. In the United St ates, human cases of W NV usually occur from May to December, with onset in August and September in 85% of cases (Gould and Fikrig, 2004). In temperate regions, outbreaks of WNV occur during late summer or early fall (July through October) coinciding wi th the arrival of high numbers of migratory

PAGE 77

52 birds and mosquitoes (Rappole et al 2000). However, in Florida and other Gulf Coast states, WNV can be transmitted year-round due to the mild climate that supports continuous mosquito activity (Blackmore et al 2003). Recent evidence indicates that mosquito feeding behaviors appears to modulate the WNV transmission season. In northeaste rn and north-central regions of North America, Culex pipiens mosquitoes demonstrate a late su mmer shift in feeding behavior from their preferred avian hosts (American r obins) to humans, which may explain the late summer timing and intensity of human WNV epidemics (Cx pipiens is the dominant enzootic and bridge vector in the northeast). In addition, these feed ing shifts intensify WNV transmission and epidemics in central and western regions of the US following dispersal and migration of American robins and other avian competent hosts following their breeding. In the southeast, Cx. nigripalpus also shifts its feed ing behavior on birds in the spring to mammals and humans later in the summer. Consequently, these shifts in mosquito feeding behavior are a geogra phically widespread phenomenom that may intensify epidemics of avian zoonotic viru ses such as WNV and SLEV (Kilpatrick et al 2006). The transmission season of WNV is also linked to geographic location, as warmer climates appear to lengthen the annual tran smission period of the virus as WNV spread south throughout the United States. Onset of human illness has been described as early as April and as late as December (Hayes et al 2005b), which creates a lengthy transmission season. In Florida, a widesp read epidemic of WNV with hundreds or thousands of human cases has not yet occurred (Shaman et al 2005). However, recorded transmission cycles indicate focal and sporad ic activity of WNV, with rare outbreaks of

PAGE 78

53 human cases (Blackmore et al 2003). This transmission pa ttern is very similar to reported transmission patterns of SLEV in the same region, with one important difference. Sporadic and focal outbreaks of WNV appear to result in more human cases than similar outbreaks historically associated with SLEV (Shaman et al 2005). Contribution of Climatic Conditions Climatic conditions are directly related to arboviral transm ission intensity and epidemics of disease, especially temperature and rainfall conditions that impact biology of the mosquito vector. Temperature is an important parameter that influences vector competence and transmission of arboviruses by mosquitoes. Once a mosquito ingests an infectious blood meal, the time from inge stion until the mosquito is capable of transmitting the virus is termed the extrinsic incubation period (EIP). The mosquito host temperature approaches ambient conditions and studies have shown th at fluctuations in environmental temperature impact the durat ion of extrinsic incubation periods and replication of arboviruses (Reise n, Fang and Martinez, 2006). WNV is widely distributed throughout temperate and tropical regions of the world, indicating that it must be transmissible under a variet y of temperature conditions. Unlike a lineage II WNV strain from South Africa, the North American NY99 strain required warmer temperatures for efficient transmission. In the United States, enzootic WNV activity began soon after ambient envi ronmental temperatures increased, resulting in a shorter duration of the EIP and virus tr ansmission likely occurred after only one or two blood meals by the female mosquitoes. In addition, summer temperature deviations from a 30-year mean in the United States i ndicate that WNV always dispersed into new areas in years with above-normal temperatures and amplification in the following year

PAGE 79

54 occurred during summers with normal or el evated temperatures. Subsequent cooler summers correlated with decreased or dela yed WNV activity, especially at northern latitudes. Outbreaks of WNV in Louisiana and Arizona di d not correlate with higher summer temperatures, likely because average summer temperatures are already sufficient for transmission (Reisen, Fang and Martinez, 2006). Climatic rainfall and drought patterns have been correlated to mosquito infection rates and abundance to promote arbovirus transmission (Shaman et al : 2002, 2003a & b, 2004a & b, 2005a). Prior to the 1990s, the largest known epidem ic of WNV in the eastern hemisphere occurred in South Africa in 1974. The South African epidemic followed unusually heavy rains in a normally arid regi on, where this rainfall contributed to an increase in mosquito densities ( Cx. univittatus in this situation) and compounded with high temperatures during summe r months created the perfec t conditions for an outbreak of disease (Hayes, 2001). Further evidence of the cont ribution of climatic conditi ons can be shown from the first epidemics reported from large cities in the 1990s (in Romania, Russia and New York), which may have been triggered by drought conditions where these urban environments had below average rainfall in the summer of the epidemic (Hayes, 2001). In southern Florida, modeling of human WN V cases and WNV transmission to sentinel chickens was associated with land surface we tness conditions (water table depth). Low water table depth (WTD) occurred in dr ought conditions, whereas high WTD occurred after wetting (rainfall). Th is study found that dry conditi ons followed by wetting led to subsequent WNV activity. The auth ors proposed that drought brings Cx. nigripalpus mosquitoes and wild birds into close contact, which facilitates epizootic WNV

PAGE 80

55 amplification in the spring (Shaman et al 2005). In other regions, dry conditions could increase the number of fa vorable breeding sites for Cx. pipiens which lay eggs in stagnant or polluted water sour ces (Hayes, 2001). In conclusion, the natural history of West Nile virus is influenced by multiple parameters governing the bird-mosquito-bird am plification cycle, which are impacted by the ecology and habitat of these hosts. Togeth er, these factors implicate a complex virus life cycle that will be difficult to comple tely eradicate, but im proved understanding of these conditions will enhance transmission forecasting and prevention strategies to minimize human WNV disease. Clinical Disease Human The incubation period of WNV ranges from 1 to 6 days (Burke and Monath, 2001). WNV infection is characterized by an acute onset of fever, headache, malaise, fatigue, weakness, muscle pain, and difficulty concentrating. Symptomatic illness develops 2-14 days after virus infection in humans (Gubler, 2007). However, approximately 80% of WNV infections are asymptomatic, 20% result in self limiting West Nile virus fever (WNF), and <1% result in neuroinvasive disease (Hayes et al 2005b). Neuroinvasive cases include encephalitis, meningitis, and polio-like flaccid paralysis with case fatality rates of 4-15% (Gubler, 2007). The risk of WNV encephalitis increases with age and is higher among organ transplant recipients (Hayes et al 2005b). The main risk factor for death is advanced age (>70 years old) as shown by a case fatality rate ranging from 15-29% (Gould and Fikrig, 2004).

PAGE 81

56 Patients that recover from WNV neur oinvasive disease often have a poor prognosis and may experience long-lasting or permanent neurologic sequelae (Gubler, 2007). Patients with polio-like flaccid paraly sis may have some improvement in limb strength, but many do not recover (Leis et al 2002; Marciniak et al 2004). The case fatality rate for WNV ne uroinvasive disease is ap proximately 9% (OLeary et al 2004). One follow-up study found that for patients that sought medical attention for WNF (n=98), fatigue and muscle weakness lasted for approximately one month after onset, as well as difficulty concentra ting, neck pain and stiffness. The median time for full recovery in these patients was 60 days, and 79% of these patients missed work or school because of their illness (Watson et al 2004). Since 2002, it has been noted that huma n-to-human transmission of WNV can also occur through blood transfus ion, organ transplantations, and intrauterine infection and through breast milk (Gould and Fikrig, 2004). Avian The importance of wild birds to West Nile virus transmission was first established in Egypt from 1952-1954 in a village-based study on ecology. Serosurveys (a surveillance technique used to assess the pr evalence of disease through detection of agent-specific antibodies in a population) on si x of the Nile delta regions most common bird species found neutralizi ng antibody rates between 48% and 100% to WNV. In addition, the hooded crow population had a se ropositive prevalence rate of 40% during the late spring that increased to 87% in summer and winter. These findings were supported forty years later following the Roma nian epidemic of 1996, where a serosurvey detected high antibody rates (41%) to WNV in domestic birds. Additional experimental

PAGE 82

57 studies in South Africa found that most w ild birds were susceptible to WNV and developed high titered viremias, but did not result in bird mortality (Hayes, 2001). The first avian deaths from natural WNV inf ections were reported in 1998 in domestic goslings and white storks in Israel. This Middle Eastern 1998 goose strain of WNV is nearly identical to the New York 1999 strain (Komar et al 2003). As a result, the intense epizootic of WNV in the United States has had a significant impact on native North American wild bird species, with thousands of reported deaths (Un ited States Geological Survey, 2007; LaDeau, Kilpat rick and Marra, 2007). In the United States, West Nile virus has been detected in dead birds of at least 317 different species (CDCg, reported to Arbonet as of 4/19/07), although most fatal infections occur in crows (Komar et al 2003). Birds, particularly crows and jays, infected with WN virus may die or become ill, but most infected birds do survive in natural settings (CDC, 2007g). Experiment al studies performed by Komar et al (2003) investigated the role of 25 different species of wild birds in transmission of the New York 1999 strain of WNV. The authors found that viremias were higher and longer in duration in passerine and charadriiform bird species than in other or ders. Passerine bird species were also implicated as competent reservoirs for WNV (Komar et al 2003). Signs of illness in these experimentally infected wild birds included lethargy, unusual posture, ruffled feathers, inability to hold head upright, ataxia (Komar et al 2003), anorexia or weight loss, shaking and convulsion (Brault et al 2004). For most of the birds, clinical symptoms were followe d by death within 24 hours. In addition, this study demonstrated that oral transmission a nd direct contact transmission of WNV is possible from infected meals or cage mates, respectively. Both types of transmission

PAGE 83

58 induced viremia and neutralizi ng antibody production in the inf ected birds. The mode of direct contact transmissi on is still unknown (Komar et al 2003). A previous study has shown that WNV vire mia and cloacal shedding is limited in adult chickens (17, 20 or 60 w eeks old), with low titers of virus recovered between 2-6 days post-inoculation (DPI). After needle or mosquito inoculation of WNV, experimentally infected chickens were vire mic between two to three DPI and shed WNV from the cloaca between two to six days. All 60 week old chickens (n=5) inoculated by mosquito shed virus from the cloaca as co mpared to 17 week old birds, where only 18% shed (2 of 11 chickens). Neutralizing antibody titers to WNV developed within two weeks of infection (Langevin et al 2001). In contrast, one study conducted in young chickens (7 weeks old) found that needle-inoc ulated hens developed higher titers of viremia (105 pfu/ml), with WNV detected in blood plasma up to eight DPI and neutralizing antibodies detected as early as five DPI. Cloacal swabs detected fecal shedding of WNV only on days 4 and 5 after infection (Senne et al 2000). These findings were experimentally replicated in wild birds, such that most birds shed WNV in the feces (71% of 24 species) a nd wild species excret ed higher titers of virus than shown for chickens. Thus, it is pos sible that oral or cloacal shedding of WNV in naturally infected birds may spread the virus (mechanism for contact transmission) or pose a risk to animal handlers (Komar et al 2003). Kipp et al (2006) confirmed that high titered shedding of WNV in the feces of wild birds could present a risk for fecal-oral transmission in crows, as well as direct tr ansmission to birds and animal handlers that come into contact with contaminated feces.

PAGE 84

59 Finally, experimental WNV infection of wild birds resulted in disseminated infection, such that all 11 orga ns tested had virus including the brain, heart, spleen, liver (lowest titer), kidney, eye, ovar y, and skin. Interestingly, th e highest titer of virus was recovered from skin samples which may improv e transmission of the virus to mosquitoes or ticks that feed on the skin. Persistent infections of the ovaries may also allow transovarial transmission of the virus to progeny (Komar et al 2003). Epidemiology Prior to the introduction of WNV to th e United States, the largest known human epidemic of WNV occurred in Cape Provide nce, South Africa in 1974 with 3,000 clinical cases (Brinton, 2002). WNV is endemic in Afri ca and Asia (and likely now in the United States, as well), with outbreaks occurring ev ery few years during the late summer and fall months. Significant epidemics were reported in Israel in the 1950s and the Rhone delta region of France in 1962 (Hayes, 1989). In th e late 1990s, epidemics of WNV in humans and horses have been much more frequent including these outbreaks in recent years: Romania and Morocco (1996), Tunisia (1997), Italy (1998), Russia and the United States (1999), and Israel, France, and the United States (2000) [Brinton, 2002]. Early epidemiological studi es conducted in Egypt a nd the Sudan during the 1950s revealed that WNV human infections were extremely common. In the Nile delta, serosurveys discovered that 22% of children and 61% of adults were immune in this endemic region (Burke and Monath, 2001). Rema rkably, 50% of four year olds and 90% of adults aged 20 had neutralizing antibodies to WNV in surveys conducted in 1952-1954 in Egypt (Hayes, 2001). However, in areas where people have low immunity to WNV, epidemic disease can cause very high attack rates. For example, summertime epidemics

PAGE 85

60 in Israel during the 1950s result ed in hundreds of cases and att ack rates greater than 60%. A similar situation occurred during the 1974 South African epidemic, with an attack rate of 55% in the Cape Province popul ation (Burke and Monath, 2001). West Nile virus was first detected in No rth America in 1999 during an outbreak of encephalitis in New York City (Hayes and G ubler, 2006). At first mistaken for St. Louis encephalitis virus (SLEV), researchers identi fied WNV by its high mortality in birds and appeared to be a highly vi rulent strain of WNV intr oduced from Israel (Lanciotti et al 1999). Epidemiologic evidence suggested that the virus was introduced in the spring or early summer of 1999 by infected humans/birds /mosquitoes arriving from Israel, as Tel Aviv also experienced epidem ic WNV infections at that time, although this hypothesis may never definitively be proven (Giladi et al 2001). Since 1999, WNV rapidly spread across North America and into Canada, the Ca ribbean, and Latin and South America. The largest epidemics of neuroinvasive WNV dis ease ever reported occurred in the United States in 2002 and 2003 (Hayes and Gubler, 2006). West Nile virus has emerged as a major public health threat and rapidly imp acted humans, horses, and birds throughout the western hemisphere. Molecular Epidemiology Molecular epidemiology has been defined as a science that investigates the contribution of potential genetic and environm ental risk factors, identified at the molecular level, to the etio logy, distribution and preventi on of disease (Dorman, 1998). Since the emergence of WNV in North Amer ica, molecular epidemiology studies have been useful in tracing the geographic and temporal spread of the virus (Davis et al 2003; Estrada-Franco et al 2003; Ebel et al 2004). Analysis of the complete and partial

PAGE 86

61 genome sequences from viruses isolated in the northeast at the beginning of the epidemic (1999 and 2000) has provided a genetic baseli ne for future comparative studies. The complete genetic characterization of the NY99 strain of WNV has allowed for the identification of novel mutations in genomes of WNV isolates made in different parts of the country and Mexico. These differences can then be used to infer phylogenetic relationships among isolates and characteri ze the evolution of WNV in the western hemisphere (Davis et al 2005). Molecular epidemiology studies on Nort h American strains of WNV have provided important clues to th e pathogenicity of the virus. The first genotype of WNV associated with the North American outbreak was isolated in New York City (NY99 strain). However, this strain was found to be nearly identical to WNV isolated from Israel and was not a novel United States strain, i.e. originating in the Middle East (Lanciotti et al 1999). In 2002, a second genotype of the virus was isolated in Texas. This strain was recognized as a significant entity, designated WN02, and is considered the North American genotype of WNV (not the NY99 isol ate). WN02 is closely related to NY99, but belongs to a distinct phylogenetic lineage and seems to have displaced the NY99 strain as the dominant Nort h American genotype (Davis et al 2005). Interestingly, isolates of WNV made after 2002 demonstr ate the highest degree of nucleotide and amino acid sequence divergen ce from the progenitor NY99 strain. These mutations may be significant as they coinci ded with the largest recorded epidemic of arboviral encephalitis in North America and the vast geographi c expansion of the virus. Several fixed mutations have been found si nce 2002 in Georgia, Texas and Indiana isolates, and are present in all isolates fr om western states. These nucleotide mutations

PAGE 87

62 may reflect the rapid westward progressi on of WNV from 2002 through 2004 (Davis et al 2005). A single conserved amino acid substi tution (V159A) in the envelope gene is shared by strains isolated since 2002 and also found in eastern hemi sphere strains of WNV (Davis et al 2005). The majority of the nucleoti de mutations are silent but amino acid substitutions have been identified, which result in phenotypic variation within the North American WNV population (Beasley et al 2004; Davis et al 2004; Ebel et al 2004; Davis et al 2005). A recent study indicates that the WN02 va riant has an epidemic doubling time of one month, as compared to five months for the NY99 strain, through analysis of nucleotide substitution rates, population growt h, and time of origin (Bayesian Markov chain Monte Carlo method) [Snapinn et al 2007]. In addition, the period of highest growth for WN02 coincides with the peak in human cases in 2002-2003 reported to the CDC. Snappin et al (2007) propose that WN02 has in creased mosquito transmission efficacy, which is responsible for the di splacement of NY99 as the dominant North American genotype. This hypothesis is supported by experimental data that found Cx. pipiens mosquitoes transmitted WN02 two days ea rlier in the extrinsic incubation period compared to NY99, with significant increases in vectorial capacity of WN02 infected mosquitoes (Ebel et al 2004). However, these populati on growth studies of North American WNV isolates concluded that th e WN02 genotype is no longer growing and has likely reached peak prevalen ce in North America (Snappin et al 2007). Although North American WNV isolates were characterized by widespread mortality in resident birds upon introducti on of the virus to a naive population, South American WNV strains have not been found to cause significant morbidity or mortality

PAGE 88

63 in birds, humans or horses (Kramer and Shi, 2007; Gubler, 2007). A potential attenuating mutation identified in a WNV isolate from Taba sco state in southern Mexico is an E-156 Ser Pro glycosylation negative variant (gly cosylation of the E protein plays an important role in flavivirus assembly in mammalian cell culture) [Estrada-Franco et al 2003; Beasley et al 2004]. However, analysis of isolates from near the US-Mexican border are more closely related to Texas st rains and do not encode mutations at the E glycosylation motif (Beasley et al 2004; Deardorff et al 2006). A molecular epidemiology study of Mexican isolates indi cate that this glycos ylation negative WNV variant appears to be limited to southern Mexico, as strains fo und in northern Mexico contain the glycosylated mo tif typical of United States WNV strains (Deardorff et al 2006). Consequently, more research is n eeded to identify additional attenuating mechanisms of virulence in Central and South America. Perhaps the answer to this puzzling question does not rely on attenuation of the viral genotype or phenotype in the tropical Americas; rather demographic factors or surveillance for WNV may account for the rela tively few cases reported in the Caribbean, Central and South America. For example, th e incidence of human WNV encephalitis is much higher on the United States (California) side than on the Mexican (Baja California and Sonora) side of the common border. One potential explanation for this discrepancy could be differences in disease diagnosi s, surveillance and reporting in Mexico (Deardorff et al 2006). However, a second hypothesis for the decr eased incidence of severe disease may involve cross-reactive flavivirus antibodies that provide prot ection for animal and human populations. Several endemic flaviviruses circulate in the Caribbean, Central and South

PAGE 89

64 America, including dengue, SLEV, yellow feve r, Ilheus, and Rocio to name a few. Experimental evidence has shown that heterotypic flavivirus antibody can modulate clinical illness and re duce virus loads (Bond, 1969; Bond and Hammon, 1970; Vaughn et al 2000). As such, widespread flaviviral antibody among bird, domestic animal and human populations in tropical America may modulate viremia and clinical illness in WNV infections and potentially reduce transmission. In addi tion, intrinsic or extrinsic host and environmental factors may select le ss virulent genetic variants of WNV. Heterotypic flavivirus antibody, development of innate immunity due to frequent exposure to several flaviviruses warmer ambient temperatures, different species of mosquito vectors, and secondary vertebrate hosts are factors that may influence selection of less virulent strains of WNV (Gubler, 2007). Economic Burden The emergence of West Nile virus in the western hemisphere has had a significant impact on regional economies that have e xperienced or that are still experiencing epidemic/epizootic WNV activity. It is unknown what long-term impact this disease will have on avian biology as well as that of ot her endemic arboviruses in the United States, but it is believed that WNV may continue to cause a higher incidence of human illness than all other endemic arboviruses combined in the US (Zohrabian et al 2004; Gubler, 2007). For instance, it has been estimated that fo r 1 clinically apparent infection of WNV, there are 150 human cases that are infected with WNV but that do not seek medical treatment. Consequently, during the larg est outbreak of WNV in 2003, it has been estimated that 1.5 million people were infected (Peleman, 2004).

PAGE 90

65 Few studies on the short or long-term ec onomic burden of arboviruses have been conducted in the United States (Zohrabian et al 2004). Although WNV results in fewer apparent clinical cases and deaths in the United States then influenza (i.e. >36,000 deaths/year) [CDC, 2007h], it has highlighted the importance and necessity of public health agencies for the detection and prev ention of WNV. Many of these agencies effectively prevent arbovirus transmission through mosquito abatement and medical alerts, which often have lower operating costs than those associated with the hospitalization and life-long de bilitation of a single neur oinvasive or encephalitic arbovirus case. A long-term economic impact study in Massachusetts of eastern equine encephalitis virus, which has a similar range of clinical illness as WNV, found that the economic cost for transiently affected pa tients (with full recovery) averaged $21,000 per case (in 1995 dollars), mostly for direct me dical services. However, for a person with residual sequelae the average lifetime cost of EEEV infection approached $3 million, including loss of potential income earned (Villari et al 1995). These figures have likely increased over the last decade as medical cost s have increased. In c ontrast, massive aerial applications of ultra-low volume (ULV) malath ion for insecticidal interventions that are very effective at preventing outbreaks of EEEV infection, co st between a quarter ($0.7 million) to one half ($1.4 million) less than the expense of a single residually affected child (Villari et al 1995). Vector control t echnologies have also improved in the last decade allowing for targeted pesticide applica tions based on surveillance data which is much more cost-effective.

PAGE 91

66 One study on the short-term economic im pact of an epidemic of WNV in Louisiana in 2002 (Zohrabian et al 2004) agreed with the EEEV model above, but resulted in lower cost estimates because it did not evaluate long-term costs associated with WNV sequelae. The authors estimated that the total short-term costs of the 2002 WNV epidemic in Louisiana were $20.14 million. The median acute-care inpatient medical cost per patient was $8,274, w ith a range of $623 $164,688 (Zohrabian et al 2004). A later study by Zohrabian, Hayes and Pe terson (2006) derived the cost per case of neuroinvasive WNV illness (with full r ecovery) as $27,500, a figure closer to the findings for EEEV above. The cost of mos quito surveillance and abatement programs, including reimbursement requests from em ergency preparedness funds to handle the epidemic, was $8.3 million for the 2002 epidemic in Louisiana. The central state public health agency expenses were estimate d at $866,000, with $586,000 for operating costs, $134,000 for laboratory expenses, and $166,000 for ve terinary and entomologic services (Zohrabian et al 2004). Zohrabian et al. (2004) extrapolated their fi ndings for the 2002 epidemic in Louisiana to estimate the magnitude of the WNV epidemic nationwide that year. They found that short-term costs for inpatien t treatment were $57.5 million, outpatient treatment costs were $5.6 million, and nonmedical associated expenses were $76.7 million, totaling $139.8 million for 4,156 cases (2,942 CNS cases). This total did not include the costs of mosquito ab atement and prevention (Zohrabian et al 2004). Even though clinically apparent arbovir al infections in the United St ates are relatively rare, the severe sequelae and potential need for lifelong institutionalized care for survivors of

PAGE 92

67 encephalitis or neuroinvasive disease may make expensive preventive programs much more cost-effective over time for a community. Finally, the economic burden of WNV ma y be ameliorated by the successful development and implementation of a human vaccine for the disease. A costeffectiveness study for the development of a WNV vaccine from the societal perspective found that the average savings per case of WNV illness prevented by a vaccine would be approximately $36,000 (range from $20,000 $59,000). In this model, vaccination of a hypothetical population of 100 million people would cost approximately $8.7 billion (as determined by baseline costs of the vaccine and its administration, as averaged from the costs of yellow fever, JEV, and Lyme diseas e vaccines). These findings suggest that a universal vaccination program to prevent W NV disease would not result in societal monetary savings unless the incidence of the di sease substantially increases or the cost is less than $12 per person vaccinated (Zohrabian, Hayes, and Peterson, 2006). Public Health Implications In the absence of a human vaccine, public health prevention and protection from WNV must rely on surveillance and vector-control programs to minimize risk of disease (CDC, 2003Aa). Unlike regions in the eastern hemisphere where WNV has established endemic foci, recent outbreaks in the United States, Europe and the Middle East are characterized by low prevalence of WNV infection in the human population. WNV appears to cause infection in less than 5% of these affected populations, including asymptomatic infections. Consequently, WNV remains a public health concern as these low levels of infection are unable to decr ease the frequency of epidemics, modulate severity, or provide protectiv e herd immunity (principle wh ere a large proportion of a

PAGE 93

68 population is immunized to a disease, resul ting in fewer susceptible individuals and community-wide protection from out breaks) to the disease (Hayes et al 2005a). In the United States, WNV has demonstrated the danger an emerging vectorborne disease can have on a nave environmen t, with widespread avian mortality, wide host ranges, and thousands of clinically apparent human cases with millions of human infections estimated (Zohrabian, Hayes, and Peterson, 2006). As such, WNV is a significant threat to public health in Nort h America, where it has likely established enzootic foci in many states. Infections can be severe with permanent neurologic damage in a low percentage of survivors, 4% case fatality rates (Gubler, 2007), and incredible economic costs to communities (Zohrabian et al 2004). It is unlikely that WNV will be elimin ated from the Western Hemisphere, as WNV will persist in many different ecologic systems due to its broad vector and host ranges. The public health infrastructure fo r vector-borne and zoonotic diseases must improve to face this and other potential emerging threats (Gubler, 2007). Early detection of arboviral activity is crucial for timely implementation of risk-reduction strategies, such as vector-control practices, medical alerts, and educational campaigns to promote use of repellents and avoid insect bites (CDC, 1993) Critical areas in need of improvement include epidemiologic, vector control, and laboratory infrastructures for vector-borne diseases to enhance prevention and control strategies for arbovi ruses (Gubler, 2007). St. Louis Encephalitis Virus Prior to the outbreak of WNV in New York City, St. Louis encephalitis virus (SLEV) was the most important agent of epidemic viral encephalitis in North America and the only

PAGE 94

69mosquito-borne human pathogen in the family Flaviviridae found on this continent. SLEV activity is restricted to the western hemisphere, in North and South America (Tsai & Monath, 1987; Hunt et al 2002). Discovery In 1932, St. Louis encephalitis virus (S LEV) was first recognized as a human pathogen following an outbreak in Paris, Illinois (Burke and Monath, 2001). The following year, a large human epidemic ch aracterized by central nervous system infections occurred in St. Louis (origin of the virus name) and Kansas City, Missouri. The causative agent was isolated from human brain tissue after inoculation into mice and monkeys; Culex pipiens mosquitoes were implicated as the vector on epidemiologic grounds. This mosquito species was later conf irmed (after more than 20 years) as the principal vector in the east-c entral United States. In the 1940s, SLEV was recognized in Pacific Coast states and isolated from Culex tarsalis mosquitoes. In Florida, a third transmission cycle involving Culex nigripalpus mosquitoes was implicated during outbreaks in 1959 and 1961. Numerous outbreaks of SLEV have occurred in the western United States, Texas, Florida, and the Ohio -Mississippi Valley since its discovery in 1933 (Burke and Monath, 2001). Distribution of SLEV by state is shown in Figure 2-8, including the cumulative number of human cases from 1964-2006 (CDC, 2007i). Phylogeny and Evolution Unlike West Nile virus, there is no ge nerally accepted classification of SLEV subtypes. Previously, oligonucleotide finge rprinting (ONF) analysis and virulence markers of 43 SLEV isolates suggested four unique genotypes of the virus in the United States, with two additional genotypes found in South America. These isolates were

PAGE 95

70 grouped into clusters as follows by Trent et al 1980; Monath et al 1980a & b; Bowen et al 1980: 1) Central and Atlantic US, 2) Florida epidemic, 3) Florida enzootic, 4) Western US, 5) Central and South America [mixed virulence], and 6) South America [low virulence]. At that time, phylogeny could not readily be inferred until developments in molecular genetics over a decade later allowed for im proved understanding of SLEV genetics and distribution (Reisen, 2003). A recent classification scheme proposed by Kramer and Chandler (2001) has improved genotypic characteriza tion and elucidated the phylog enetic relationships that exist among strains of St. Louis encephalitis virus. Phylogene tic analysis of the entire envelope region (~1700 nucleotides ) of SLEV indicates that is olates (n=62) studied from North and South America form a monophyletic group, with most is olates clustering according to geographic region. Two major grou ps of SLEV occur in the United States, which appears to also be the case in S outh and Central America. Parsimony and neighbor-joining tree analyses have identifie d seven lineages of SLEV designated I-VII (Kramer and Chandler, 2001). Overall, these lineages appear to have some overlap with the original ONF classification schemes deve loped nearly 30 years ago (Reisen, 2003). Lineage I and II viruses predominately c ontain North American strains (with a few South American isolates). Lineage I st rains are found in the western United States

PAGE 96

71 Figure 2-8 Distribution of Human Cases of St. Louis encephalitis virus in the United States (1964-2006) Map of the United States that illust rates the total number of SLEV human cases per state reported to the Center s for Disease Control and Prevention from 1964 through 2006. Texas leads th e nation with th e largest number of reported cases (n=1015), followed by Illinois (n=697) and then Florida (n=380). Figure appears courtesy of the Centers for Disease Control and Prevention (CDC,2007i)

PAGE 97

72 with two clusters: IA and IB. Lineage II has the largest number of st rains and is grouped into six clusters (IIA IIF) Interestingly, at least one Florida strain has been grouped into most of these clusters (IIA IID). Lineage IIE contains the prototypical SLEV strains Hubbard and Parton isolated in St. Louis, Missouri in 1933 and 1937, respectively. The sixth group IIF contains one isolate from Guatemala in 1969 (Kramer and Chandler, 2001), which has also been id entified as a putative recombinant in the envelope region between Argentinean (Lineag e III) and Tennessee (Lineage IIB) strains of SLEV by Twiddy and Holmes (2003). No te: this envelope sequence has been removed from the GenBank database (personal communication, L. Kramer). The remaining lineages (III-VII) of SLEV consis t of strains isolated in South America [Kramer and Chandler, 2001]. The seven lin eages have been summarized in Table 2-2. A maximum of 10% nucleotide differences in the envelope region was shown for 62 strains of SLEV. An earlier study by Kramer et al (1997) also found that some SLEV strains (in California) remained almost unchang ed within regional foci, in some cases for periods longer than 25 years. Evidently, SLEV persists with little change for consecutive years but may become extinct over time, allowing for the possible evolution or introduction of new genot ypes in California (Kramer et al 1997). This relative genetic homogeneity over time supports the hypothesis of local tran smission and maintenance of SLEV in a particular geographic region. Yet, both of these studies identified that SLEV strains can be transported between regions within and outside of the United States (Reisen, 2003). The most divergent lineages (ancestral ) of SLEV were found in Argentina, whereas the least divergent were isolated in North America by analysis of the E gene

PAGE 98

73 Table 2-2 St. Louis Encephalitis Virus Classification Scheme Lineage Cluster Strain Location Year Host E22924 Kern Co., CA 1970 Cx. tarsalis Bfs4772 Kern Co., CA 1963 Cx. tarsalis A Bfs1750 Kern Co., CA 1953 Cx. tarsalis PV7-3389 El Paso Co., TX 1987 Cx. quinquefas. PVO-620 Dallas, TX 1989 Cx. quinquefas. Coav750 Riverside Co., CA 1998 Cx. tarsalis Iv 824 Imperial Co., CA 1978 Cx. tarsalis Soue135 Los Angeles, CA 1985 Cx. stigmatos. P17797 Dallas, TX 1966 Human 72V1165 Chaves Co., NM 1972 Cx. tarsalis 68V1587 Hale Co., TX 1968 Cx. inornata TD6-4G Dallas, TX 1966 Cx. pipiens I B 72V4749 Washington Co.,CO 1972 Cx. tarsalis II L695121.05 South Florida 1969 Cx. nigripalpus 69M1143 Polk Co., FL 1969 Procyon lotor Kent904 Calvert City, KY 1956 Colaptes auratus Tex16017 Texas ? unknown TexU1193 Texas ? unknown TexM6 Texas ? unknown Texas1955 Rio Grande Valley,TX 1955 Human A SpAn9398 Sao Paulo, Brazil 1968 Akodon sp 83V4953 Houston, TX 1983 Cx. quinquefas. PV1-2419 Corpus Christi, TX 1991 Cx. quinquefas. 98V3181 Houston, TX 1998 Cx. quinquefas. TNM4711K Memphis, TN 1974 Cx. pipiens B GHA-3 Tampa Bay, FL 1962 Human C Imp1311 Imperial Co., CA 1991 Cx. tarsalis Chlv587 Riverside Co., CA 1992 Cx. quinquefas. Chlv374 Riverside Co., CA 1991 Cx. tarsalis Imp917 Imperial Co., CA 1988 Cx. tarsalis Kern217 Kern Co., CA 1989 Cx. tarsalis 75v14868 Memphis, TN 1975 Cx. pipiens MSI-7 Mississippi 1975 Passer domesticus 75256PG-3 Maryland 1975 Cx. pipiens VP34 Prince Georges City, MD 1977 Cx. pipiens FortWash Maryland 1977 Cx. pipiens FL79-411 Florida 1979 Cx. nigripalpus D P15 Tampa Bay, FL 1962 Cx. nigripalpus TBH-28 Tampa Bay, FL 1962 Human 65V310 PanAn902604 Mexico Panama 1965 1973 Butorides virescens Cormorant

PAGE 99

74 Table 2-2 St. Louis Encephalitis Virus Classification Scheme, Continued Table adapted from lineages proposed by Kramer & Chandler, 2001. Lineage Cluster Strain Location Year Host II E Hubbard St. Louis, MO 1937 Human Parton St. Louis, MO 1933 Human F Gmo94 Guatemala 1969 Cx. nigripalpus III 79V2533 Sante Fe, Argentina 1979 Cx. spp IV Gml902612 Panama 1973 Haemag. equinus PanAn902745 Panama 1973 Haemag. lucifer Gml902984 Panama 1977 Mansonia dyari Gml902981 Panama 1977 Mansonia dyari Gml900968 Panama ? unknown V A BeAn242587 Belem, Brazil 1973 Cx. declarator 75D90 Peru 1975 Mosquito sp BeAn248398 Brazil ? unknown 78V6507 Santa Fe, Argentina 1978 Cx. pipiens BeAn246407 Belem, Brazil 1973 Hylo. poecilonota TR9464 Trinidad 1955 Psorophora ferox B BeAn246262 Belem, Brazil 1972 Opossum BeH203235 Brazil 1971 Human BeAr23379 Belem, Brazil 1960 Sabethes belisarioi VI GML903797 Panama 1983 Sentinel chicken VII CorAn9124 Argentina 1966 Calom. musculinus CorAn9275 Argentina 1967 Mus musculus

PAGE 100

75 (Kramer and Chandler, 2001). These findings suggest that SLEV first arose (or was introduced) and successfully es tablished in South America prior to evolution and dispersal into North America. Further evidence of this theory is that all flaviviruses associated with Culicine mosquitoes are found in South Am erica, but few of them are found in North America. In all likelihood, one theory suggests that several different flaviviruses were introduced to South America fr om the Old World in the last few centuries, rather than a single virus diverging into all of the New World flaviviruses (Gould et al 2003). Interestingly, no clear differences have been found between isolates from multiple host sources, including mosquito, avian, or human suggesting conserved evolution in the envelope region despite phenot ypic differences associated with geographic origin (Kramer and Chandler, 2001). Evolutionary pressures have likely contributed to the segregation of North American genotypes by species of mosquito, as seen with Culex tarsalis vectored transmission of Lineage I viruses (formerly genotype III by ONF, as shown in a classification scheme proposed by Trent et al 1980) in the western states (especially California) [Burke and Monath, 2001]. Natural History Amplification Cycle In nature, SLEV is maintained in the sa me mosquito-bird-mosquito cycle as West Nile virus (see Figure 2-7), with periodi c amplification by peridomestic birds and Culex species mosquitoes. Unlike WNV, the St. Louis ence phalitis virus cycle is silent in nature and does not cause disease (morbidity or mortality) in wild birds (McLean et al 2001; CDC, 2007j). An amplification cycle is necessary to achieve mosquito infection rates

PAGE 101

76 sufficient to allow spillover of the virus from the enzootic/epizootic cycle into the human population to cause an epidemic (Shaman et al 2004). Vectors In the eastern and mid-western United Stat es, principal mosquito vectors of SLEV are Culex pipiens and Culex quinquefasciatus complexes, which lay eggs in polluted water and gain high population densities in urban-suburban environments (Monath, 1979). In contrast, frequent human exposures occu r in rural areas in we stern states due to Culex tarsalis activity as it breeds in irrigated or flooded arid regions with a widespread distribution. In Florida, the principal epidemic vector is the tropical mosquito Culex nigripalpus which is commonly found in central a nd southern counties in the state. The majority of human cases in the US have occurred in regions with Cx. pipiens and Cx. nigripalpus transmission cycles (Monath, 1979; Burke and Monath, 2001) Culex pipiens is known as the northern house mosquito, whereas Culex quinquefasciatus is considered the southern equi valent, and it is often difficult to distinguish between the two species. Cx. pipiens complex mosquitoes are important in urban epidemics of SLEV, especial ly in the Midwest and Texas. Cx. pipiens female mosquitoes primarily feed on birds, whereas Cx. quinquefasciatus females prefer avian blood but readily also feed on mammals (CDC, 1993). Culex nigripalpus ranges northward from northern South America and can be found in southeastern states. Cx. nigripalpus is an opportunistic feeder on mammals and birds, with a seasonal shift of host feeding practices demonstrated in Florida. Peak abundance usually occurs between August to December, and Cx. nigripalpus has 8 to 10 generations per year, with up to 15 broods in Florida (CDC, 1993).

PAGE 102

77 Culex tarsalis is the primary enzootic and epid emic vector of SLEV (and WEEV) in agricultural areas in western states. Unlike other Culicine species, Cx. tarsalis is an avid biter of humans and feeds readily on people outside during dusk and dawn hours in summer months. Cx. tarsalis females may travel up to 10 miles in two nights and may spread up to 25 miles from breeding sites, leading to widespread transmission (CDC, 1993). Culex restuans has also been implicated as an efficient vector of SLEV in the laboratory and SLEV has been isolated in fi eld collected mosquito pools. This species feeds primarily on birds, has early season a bundance in the spring and breeds throughout the summer in cooler regions. However, its role as either an epizootic or enzootic vector is uncertain (CDC, 1993). In Central and South America, the transmission cycle for SLEV is not well defined, and other mosquito genera may be involved. In this region, SLEV has been isolated from 11 diffe rent genera, including Mansonia, Haemagogus, Sabethes, as well as Culicine species of mosquitoes (Reisen, 2003). Amplifying Hosts Vertebrate hosts for the virus to amplify in are also critical to maintenance of the enzootic cycle. Primary reservoir hosts for SLEV include the avian orders Passeriformes (perching birds/songbirds) a nd Columbiformes (pigeons and doves). In North America, house sparrows, house finches, mourning doves, pigeons, blue jays, robins, and cardinals are competent bird reservoirs for SLEV (C DC, 1993). Generally, infection with SLEV does not result in morbidity or mortality in amplifying wild bird species (CDC, 2007j).

PAGE 103

78 Birds involved in the urban transmissi on cycles of SLEV throughout the eastern and central regions are peridomestic species, where Culex pipiens mosquitoes are also abundant. House sparrows and pigeons that live in close proximity to the human population are the primary avian amplifying hosts in these environments. Conversely, the mourning dove, blue jay and cardinal (as well as the house sparrow and pigeon) have been found to be important amplifying hosts in Florida, where the primary vector is Culex nigripalpus (CDC, 1993). In Florida, resident juvenile and nest ling wild birds are primary vertebrate amplifying hosts for SLEV because young birds have reduced mobility, poorly developed immune systems, and sparse feather coverage to enable blood-feeding by mosquitoes (Day and Stark, 1999). It is possible that SLEV transmission cycles may also include mammals, such as the raccoon, armadillo and cotton rat in some regions of the state (CDC, 1993; Day et al 1995). In Central and South America, SLEV has been isolated from a wide variety of wild bird genera, including egrets, herons, a nd cormorants. In this region, wild birds may not be the primary amplifying hosts in tr opical America as many tropical mosquito species frequently feed on mammals. Eviden ce of SLEV infection has been found in a variety of forest mammals (Reisen, 2003). C oupled with distinct genetic differences between North and South American strains of SLEV (Kramer and Chandler, 2001), these findings indicate that there may be im portant differences in the ecology and epidemiology of SLEV amplification and tr ansmission in tropical America (Reisen, 2003).

PAGE 104

79 Incidental Hosts Mammals in North America generally do not develop high titers of SLEV and do not contribute to the amplifica tion cycle. As such, they ar e considered dead-end hosts. Humans, horses, and other mammals are not preferred reservoir hosts and do not contribute to SLEV amplificati on; only low levels of viru s circulate in the bloodstream (CDC, 2005j). In North America, human SLEV infections are reported annually (Calisher, 1994; CDC, 2007j). From 1964 to 2006, 4658 SLEV encephalitis case s were identified in the United States (7% mortality rate). However, less than 1% of all SLEV infections are clinically apparent and the vast majority of infections remain undiagnosed (CDC, 2007k). Conversely, it is important to note that severe ence phalitic disease and fatalities are very rare in humans in the Caribbean, Mexico, Cent ral and South America, similar to recent findings for West Nile virus (Gubler, 2007). Unlike WNV, SLEV is not pathogenic for equines (Monath, 1979). Horses are frequently infected in nature without known clinical pathology, but are susceptible to lethal encephalitis after intracerebral inocula tion of SLEV in experimental studies (Burke and Monath, 2001). SLEV has been isolated, or neutralizing antibodies detected, in other mammals, including bats, bears, moose, and non human primates. The ex act role of these animals to maintenance or amplification of the virus has not been s hown; they are more likely to have minimal contribution to pers istence of SLEV (Sulkin, Sims and Allen, 1966; Allen, Taylor and Sulkin, 1970; Trai ner and Hoff, 1971; Dunbar, Cunningham and Roof, 1998). In Florida, neutra lizing antibodies to SLEV have been detected in a cotton mouse, opossums, raccoons, horses and dogs. SLEV was also isolated from one raccoon

PAGE 105

80 during these wild vertebrate st udies; however, the exact role of these hosts in the SLEV amplification and transmission cycle is unknown (Bigler et al 1975). Ecology & Habitat Geographic Location SLEV is widely distribute d from Argentina to Canada (Calisher, 1994). SLEV has been isolated in the United States, Central a nd South America, and the Caribbean islands. There is no evidence that SLEV exists naturally outside of the western hemisphere (Luby, Sulkin and Sanford, 1969). In the United States, SLEV is an endemic (occasionally epidemic) disease west of the Mississippi Rive r; whereas in eastern states, it periodically reappears in epidemic form. These epidemic s primarily occur in the Mississippi-Ohio River Valley, eastern Texas and central Flor ida (Monath, 1979; Calisher, 1994). In the United States, SLEV human cases occur annua lly (Calisher, 1994), whereas only a small number of cases have occurred in South Am erica with no large outbreaks of the virus (Kramer and Chandler, 2001). The ecology of SLEV is closely tied to its mosquito vectors as the virus cycles between bird and mosquito hosts. As desc ribed on page 71, four genetic lineages of SLEV were previously defined based on o ligonucleotide fingerprin ting patterns that correlated with avian and mosquito transmission cycles in North America: 1) central and Atlantic states including the Mississippi flyway ( Cx. quinquefasciatus or Cx. pipiens cycles), 2 & 3) Florida epidemic a nd enzootic strains (associated with Cx. nigripalpus cycles), and 4) western states strains ( Cx. tarsalis cycles). This dist ribution suggests that SLEV is maintained in each region in local reservoir hosts or vect ors and the virus may have become adapted to the mosquito species (Calisher, 1994). Recent phylogenetic

PAGE 106

81 analysis supports th e relationship between Culex tarsalis cycles in the western United States (Kramer and Chandler, 2001). Consequently, geographic regions that main tain or contain favorable habitats for Culicine mosquito vectors and wild bird hosts are predisposed to enzootic transmission and epidemics of SLEV based on the feeding behavior and preferences of these vectors (CDC, 1993). Outbreaks of SLEV in the Un ited States have highlighted the importance of favorable mosquito habitats to the transmi ssion of disease. For example, cases in the St. Louis 1933 epidemic were clustered am ong residents living in lower income housing located near inadequate open drainage /sewer ditches that produced large Culex sp. mosquito populations (Lumsden, 1958). In contrast, Culicine mosquitoes were more abundant in extensively irrigated and landscaped upper socioeconomic level neighborhoods as compared to lower income neighborhoods with minimal landscaping in California (Reisen, 2003). An epidemic in Philadelphia, Pennsylvania in 1964, cases were clustered near the Delaware River and an outbreak in Corpus Christi, Texas in 1966, human cases were related to residence in ar eas of the city which had open storm sewers (Luby, Sulkin and Sanford, 1969). Culicine mosquito larval habitats vary depending on the species and benefit from both natural and man-made habitats. Cx. nigripalpus larval habitats consist of nearpermanent bodies of water (i.e. ditches, catch basins and grassy pools) and occasionally larvae may be found in artificial cont ainers (i.e. tires, wading pools). Cx. nigripalpus mosquitoes are primarily restricted to forest habitats. Adults congregate in areas of dense vegetation, such as cypress or oak hammo cks, during the day. In contrast, Cx. pipiens larvae are found in water with high organic c ontent, but may also be found in clean water

PAGE 107

82 sources. During dry seasons, Cx. pipiens population densities rise as organic concentrations increase due to water evapor ation. Larval habitats include roadside ditches, ponds, construction sites, as well as artificial contai ners including tires, abandoned swimming pools, and tin cans. During the day, adults prefer to rest in dark, damp shelters (storm sewers, cellars, culverts). Cx. quinquefasciatus larval habitats are similar to those described for Cx. pipiens (CDC, 1993). Ecologic niches with the appropriate ha bitat for these viruses may be artificially created from human influence in certain geographic regions. The expanded development of suburban environments across North Amer ica has contributed to an increase in populations of peridomestic bird species, such as house sparrows, blue jays, robins, and cardinals. Extensive irrigated farmlands th roughout the western states have been correlated to increased populations of wild bird species, as well as to Culex tarsalis vectored transmission of SLEV (and WEEV), where they afford extensive breeding grounds for the mosquitoes. Consequently, m odification of natural habitats in these regions has provided additional food and shel ter for vector mosquitoes and amplifying hosts, which increases human risk as all elements for virus transmission are brought closer together (CDC, 1993). Seasonal Transmission The seasonal timing of amplification a nd transmission cycles of SLEV from spring through late summer/early fall ha s been well-documented (Reeves and Hammond, 1962; Monath et al 1980; Tsai et al 1989; Day and Curtis, 1993; Shaman et al 2004a). The disease appears first in July, with peak incidence in August and September (Burke and Monath, 2001). Human cases nearly always occur from mid to late summer and into

PAGE 108

83 early fall (Reisen, 2003). In southern latit udes, SLEV transmission activity may occur year-round, with onset of illness in humans as late as December (Monath and Tsai, 1987; Hayes et al 2005b). In south Florida, the annual dynamics of SLEV transmission can divided into four phases: 1) maintenance in January-March, 2) amplification in AprilJune, 3) early transmission in July-September, and 4) late transmission in OctoberDecember (Day and Curtis, 1993). The efficiency and rate of transmission depends heavily on the mosquito host, as the majority of the SLEV transmission cycl e is spent in the mosquito. The mosquito body temperature roughly parallels ambient e nvironmental conditions (Meyer, Hardy and Reisen, 1990), where the duration of the extrin sic incubation period de creases and rate of transmission increases with warmer temperat ures (Reisen, 2003). Human cases appear to occur relatively late in the transmission season (Monath, 1980) after considerable amplification in the primary bird-mosquito cycle results in spillover to the human population (Reisen, 2003; Shaman et al 2004). Cooler weather then slows virus replication and initiates mos quito diapause (temporary inte rruption in development of eggs or larvae, associated with a dormant pe riod) in the late fall months in temperate regions (Reisen, 2003). Most evidence indicates that maintena nce of SLEV occurs in local winter reservoirs in North America, with the possibili ty of reintroduction of the virus from South America by migrating birds or bats involved in year-round transmission cycles. Several studies have investigated mo squitoes and wild birds to identify a local reservoir of infection; however, the mechanism for main tenance of SLEV during winter months is still unclear (Burke and Monat h, 2001). SLEV has been isolated from hibernating adult

PAGE 109

84 female Cx. pipiens mosquitoes (Bailey et al 1978), and vertical transmission (transovarial routean infected female mosquito transmits virus to her progeny) of SLEV has been experimentally demonstrated for Cx. pipiens, Cx. restuans and Cx. quinquefasciatus (Nayar, Rosen and Knight, 1986) Venereal transmission (vertically infected males sexually transmit virus to females) has also been reported in Culicine mosquitoes (Shroyer, 1990). Overall, the mechanisms for SLEV persistence and long distance transport have not been resolved. Current genetic data has not provided conclusive evidence for the local maintenance and emergence of new strains or to the local extinction and annual reintroduction of similar SLEV genotypes (Reisen, 2003). A lthough introduction by migratory birds has been suggested as a mechanism for initiation of spring transmission, this hypothesis has not been s ubstantiated as migrants are rarely positive for virus (Calisher et al 1971) nor have antibody from previ ous arbovirus infections (Reisen et al 2000b). This indicates that th ey are not a likely source for SLEV introduction (Reisen et al 2003). Recent evidence for WNV indicates th at migratory birds have dispersed the virus throughout North Amer ica and into South America (Gubler, 2007), but the reintroduction of South Ameri can WNV strains to North America has not been shown. In Florida, extensive arboviral surveilla nce studies were conducted from the late 1950s to 1971, when research activities associated with the Fl orida Department of Health Epidemiology Research Center in Tampa Bay were discontinued (Monath and Tsai, 1987). Extensive field studies characterized th is research period, which was launched to investigate SLEV following human outbreaks in the state, and hundreds of arbovirus isolates were obtained from mosquitoes and wild vertebrate hosts (Wellings, Lewis and

PAGE 110

85 Pierce, 1972). From 1963 to 1970, only 4 of 697 arbovirus isolates were identified as SLEV: 1 isolated from a raccoon in October and 3 isolated from Cx. nigripalpus pools in November. These 4 isolates were obtained in 1969 during a sporadic human outbreak of SLEV in Polk County (3 human cases), appa rently an interepidemic year of SLEV transmission. The authors concluded that a ll virus strains isolated, except SLEV, were endemic during that time period (i.e. EEEV, WEEV [HJV], Keystone virus, Tensaw virus, etc). As such, SLEV appeared to be an exotic agent that was reintroduced into Florida during 1969, but failed to survive the severe 1969-1970 winter as no evidence of SLEV activity was detected in the followi ng year (Wellings, Lewis and Pierce, 1972). Unfortunately, the heyday of arbovirology (and funding) waned in the 1970s and the mechanism for continued survival or reintroduction of SLEV remains unknown. Contribution of Climatic Conditions Historically, the distribution of Nort h American mosquito-borne encephalitis epidemics has been delineated by temperature, with Western Equine Encephalitis virus in the north (California) and S LEV predominating as the etiologic agent in southern latitudes (Hess, Cherubin and LaMotte, 1963 ; Reisen, 2003). Extraordinarily cold weather may also impact virus transmission cycl es in Florida. For example, a widespread freeze in central Florida during the winter of 1989-1990 altered ecological habitats by removing understory vegetation. This may ha ve enhanced mourning dove populations the following spring, which contributed to exte nsive SLEV amplifi cation during the 1990 epidemic year (Day and Stark, 1999). In addition to temperature, important abio tic factors such as rainfall, humidity and drought influence SLEV amplification and tran smission cycles in both the mosquito and

PAGE 111

86 avian host. Wetting (precipitati on) in the form of winter ra infall and snow pack in the west (Wegbreit and Reisen, 2000) or summer rainfall in the east (D ay and Curtis, 1989) creates oviposition and larval habitats for mos quito species. In rural mosquito species, studies found that Cx. nigripalpus and Cx. tarsalis increase in abundance as rainfall creates new habitats, as they can breed in surface pools (Day and Curtis, 1989; Day, Curtis and Edman, 1990; Reisen, 2003). In contrast, urban mosquito species such as Cx. pipiens increase in abundance when rainfall d ecreases and municipal drainage systems dry up, creating pools, which favors Cx. pipiens that prefers breeding in drainage systems. Rainfall patterns also influence bi rd survival, nestling success, and number of broods per year, as wetting directly impacts plant and insect food availability. These factors are important to arbovi ral transmission, although the full impact of bird survival measures may be delayed until the ne xt transmission season (Reisen, 2003). Humidity levels also may influence v ector-host seeking behavior and impact transmission. Elevated humidity tends to enhance transmission efficiency, as humid environments increase vector survival. During dry periods, mosquito host-seeking is arrested, which allows virus infections in grav id and parous vectors to complete extrinsic incubation. Once rainfall resumes, humidity rises and initiates mosquito host-seeking behavior resulting in synchronized transmi ssion events (Reisen, 2003). Day and Curtis (1989) also found th at the tropical Cx. nigripalpus vector only blood feeds after humidity levels increase following rainfall. One of the most important abiotic factor s leading to increased amplification of SLEV and outbreaks of disease is drought. In 1933, a summer drought with low rainfall concentrated sewage in creeks surrounding St. Louis, which led to large populations of

PAGE 112

87 Cx. pipiens mosquitoes and spread of the di sease (Lumsden, 1958). Researchers investigating the 1990 epidemic in Florida al so implicate drought as a necessary factor for epidemic SLEV activity (Shaman, Day and Steiglitz, 2003 & 2004). The authors suggest that three conditions created the 1990 human epidemic in Florida: 1) large population of susceptible wild birds, 2) severe spring time drought, and 3) continued rainfall and wetting of the land surface in summer and early fall (Shaman, Day and Steiglitz, 2004). The severe springtime drought facilitated amplification of SLEV among wild bird and Cx. nigripalpus populations, and summer and fa ll wetting sustained large numbers of infective Cx. nigripalpus mosquitoes. This investigation found that antecedent drought is a necessary (alt hough not sufficient) condition for SLEV amplification and transmission in Florida, su ch that drought is asso ciated with spatialtemporal variability of human cases and SLEV epicenters are identifiable with drought and wetting foci (Shaman, Day and Steiglitz, 2004). The mechanism of drought-induced amplif ication and transmission of SLEV (and WNV) has been proposed to relate primarily to mosquito-wild bird interactions in Florida. Although Cx. nigripalpus populations increase dur ing very dry conditions preceding heavy SLEV transmission, it is believed that drought restricts Cx. nigripalpus activity to more humid, densely vegetated ha mmock habitats. In addition, drought periods in southern Florida usually occu r during the spring, when nesting wild birds also reside in the hammocks. Consequently, drought drives mosquito vectors and amplifying wild bird hosts into contact with one another providi ng an ideal environment for rapid epizootic amplification of SLEV. Once water res ources increase following summer and fall

PAGE 113

88 wetting, infected mosquitoes and wild bird s disperse and carry SLEV out of the hammocks (Shaman, Day and Steiglitz, 2005). Clinical Disease Human SLEV causes an acute illness in man, w ith a spectrum of CNS manifestations from self-limited fever plus headache to fatal meningoencephalitis (Monath, 1979). Primarily, three clinical syndromes have b een reported including encephalitis, aseptic meningitis, and febrile headache, although mo st SLEV infections are asymptomatic (Calisher, 1994; CDC, 2007j). The disease is generally milder in children than in adults, but in those children with the disease, there is a high rate of encepha litis. The elderly are at highest risk for severe di sease and death (CDC, 2007j), as nearly 90% of elderly SLEV patients develop encephalitis (Calisher, 1994). The overall case fatality rate is approximately 7%, but can be significantly influenced by age as shown below (CDC, 2007j). The severity of SLEV disease in humans is greatly dependent on age. During epidemics, incidence of disease in people older than 60 is generally 5-40 times greater than in people less than 10 years old. Encephalitis is the most severe symptom of SLEV infection, and it is also age-dependent. Frequency of encephalitis increases from 56% for those aged 20 or younger to 87% for those over 60. In a ddition, mortality is 7-24% among those over 50, and less than 5% for those under 50 (Shroyer, 1990). Since its discovery, SLEV has been responsible for over 1,000 deaths, more than 10,000 severe clinical illnesses, and over 1 million mild or subclinical infections (Calisher, 1994). The ratio of apparent to inapparent infection is 1:806 in children, as compared to 1:85

PAGE 114

89in the elderly (Burke and Monath, 2001). From 1964 to 2006, there have been 4,658 human encephalitis cases of SLEV reported in the US (see Figure 2-8) [CDC, 2007l]. A period of prolonged convalescence occurs in 30 50% of patients, characterized by memory loss and headaches asthenia, irritab ility, tremulousness, sleeplessness, and depression lasting up to 3 years. Approximately 20% of these cases have long-term sequelae or persistence of these symptoms, including gait and speech disturbances, tremors, and sensorimotor im pairment. Old age and severity of acute illness predispose patients to these type s of sequelae (Burke and Monath, 2001). However, in endemic areas where the human population has high rates of acquired immunity, illness peaked in children and was low in older residents (Reeves and Hammon, 1962). In Florida, cross-protective disease protection may have modulated or moderated SLEV infections, where incidence of encephalitic disease was significantly lower in patients previously infected with dengue virus (protective immunity) during an epidemic of SLEV (Bond and Hammon, 1970). Interestingly, humans are frequently infected with SLEV in California but clinical disease is rare, which may be influenced by genotype of the infecting strain (Reisen and Charles, 1997). SLEV isolation from CSF or serum is very unusual, although it has been recovered from fatal cases in the following tissues: brain, liver, kidney, spleen, and lung. IgM antibodies appear in sera with the first 4 days after onset, peak at 7 to 14 days, and decline afterward. In 25% of patients, IgM antibody may persist for up to one year (Burke and Monath, 2001). Antibodies are ge nerally present at th e time of onset of symptoms due to the relatively long incubation period (4 to 21 days) of SLEV. As such, viremia is believed to be short in duration (Calisher, 1994).

PAGE 115

90 Avian Enzootic SLEV transmission is silent in nature with no reports of avian mortality, unlike the high rates of avian mortality associated with WNV in the western hemisphere (Komar, 2001; Edison et al 2001; Lanciotti and Kerst, 2001). Several studies have evaluated viremia and/or serological responses to SLEV infection in wild and domestic birds (McLean and Bowen, 1980; McLean et al 1983; Reisen et al 1994, 2000, 2001, & 2003; Day and Stark, 1999; Reisen, 2003; Fang and Reisen, 2006; Reisen and Hahn, 2007). Overall, acute SLEV infection in most birds is characterized by a low titered, short-lived viremia detected between 1 to 5 days post-infection that does not produce clinical illness (McLean and Bowen, 1980; Reisen et al 1994; Fang and Reisen, 2006; Reisen and Hahn, 2007). As a result, diagnosis of bird (and animal) infections by virus isolation from field populations is extremely difficult and occurs infrequently (Reisen, 2003). In California, Reisen et al (2003) found that only 6 out of 22 wild bird species developed sufficient viremia after experimental inoculation with SLEV to become competent host species. These findings may, in part, be explained by the low viremogenic capacity of SLEV strains associated with Cx. tarsalis in the west, as compared to isolates from Cx. pipiens mosquitoes in eastern states (Bowen et al 1980). Consequently, the strain of SLEV inoculated, as well as the bird species and age at time of infection result in markedly different viremic responses in avian hosts (highest titers between 2-4 DPI) [Bowen et al 1980]. In general, immature birds produce a higher viremia than adults in response to SLEV infection (Reisen, 2003) and SLEV isolations have been more successful from nestling birds, where viremias are typically higher (McLean and Bowen, 1980). Regardless of viremic response, most birds develop detectable antibody titers to SLEV (Calisher et al 1986c) and produce an IgM response to infection (Calisher et al

PAGE 116

911986c; Reisen et al 1994 & 2003). This characteristic response has been exploited for decades as a reliable indicator of arboviral transmission activity in sentinel chicken programs throughout the United States (Komar, 2001). For example, adult chickens develop high antibody titers when infected with SLEV and are useful as sentinels (Day, 1989; Reisen et al 1994 & 2000; Day and Stark, 1999; Blackmore et al 2003). Importantly, mature chickens rarely produce detectable viremias and therefore are not competent hosts capable of infecting mosquito vectors (Reisen et al 1994; Langevin et al 2001). In 1977, sentinel chicken seroconversions to SLEV were noted one month before the first human case in Florida to provide an early warning of epizootic activity, whereas wild bird seroconversions appeared late (Monath, 1979). The recent introduction of West Nile virus into North America renewed interest in St. Louis encephalitis virus, as prior to 1999, the geographic distributions of SLEV and WNV did not overlap. The ra pid spread of WNV across the United States and its establishment in regions hist orically endemic for SLEV, in cluding Florida, California and Texas, raised questions about the ability of both viruses to coexist during the same and subsequent transmission seasons (Lillibridge et al 2004). Initial evidence suggests that SLEV activity disappears for a few years be fore rebounding to low levels following the introduction of WNV, such as has been reported in Texas (Lillibridge et al 2004) and Florida (Stark and Kazanis, 2002-2006). In Cali fornia, WNV spread to the southern part of the state in 2003 during ac tive SLEV transmission, but as with Florida and Texas, SLEV disappeared in 2004-2005 (Fang and Reisen, 2006). Consequently, the impact of acquired immunity to one virus in avian hosts may limit or prevent subsequent infection (and amp lification) by another closely related virus,

PAGE 117

92 such as appears to be the case for WNV tr ansmission followed by SLEV. A recent study tested this hypothesis by inf ecting house finches with either SLEV or WNV, followed by challenge six weeks later with either the hom ologous (same) or heterologous (different) virus (e.g. WNV/WNV, SLEV/WNV, etc). Initia l infection with West Nile virus resulted in sterilizing immunity in house finches agai nst both viruses upon challenge. In contrast, previous infection with SLEV only provide d protection against subsequent challenge with a homologous virus, i.e. preventing a s econd SLEV viremia. When the original SLEV birds were challenged with the hetero logous virus instead, WNV was still able to infect these birds and significant viremias developed (range from 102.7-6.4 pfu/ml) capable of infecting mosquitoes. As a result, WNV infections appear to prevent subsequent SLEV infections in wild birds and may imp act arboviral amplification and transmission cycles where these viruses coexist. Conversely, previous infection with SLEV in house finches does not induce sterilizing immunity that would prevent subsequent WNV infection and development of high titered WNV viremias (Fang and Reisen, 2006). Geographic Strain Differences of SLEV Early oligonucleotide finger printing (ONF) studies indica te that enzootic strains of SLEV vary from isolates collected during epidemics. ONF identified 6 groupings of SLEV from different geographic locations (Trent et al 1980 & 1981), where virulence and neuroinvasiveness of disease in mice a nd monkeys correlated with ONF patterns and geographic origin of SLEV isolates (Trent et al 1980; Monath et al 1980). These studies classified SLEV strains based on 1) high virulence, 80-100% mortality rates; 2) intermediate virulence, variable mortality rates; and 3) low viru lence, no or minimal mortality for entire dose range. In North Am erica, the authors concluded that 90% of

PAGE 118

93 SLEV strains isolated in epidemic years were highly virulent (n= 27), with the remaining 10% of intermediate virulence (n=3). In c ontrast, isolates obtained during non-epidemic years were of low or intermediate virulence (n=14), with only 29% virulent for mice (n=4). In Florida, six strains isolated during epidemic years (i n 1962 and 1977) were of high virulence, as compared to two avirulent strains isolated in an interepidemic year (1969) [Monath et al 1980]. Similar to North America, strains isolated throughout the Caribbean, Central and South America could be grouped into high, inte rmediate, and low virulence categories. Unlike the majority of isolates studied from the United States, these strains were considered endemic (or enzootic) since they we re either associated with sporadic human cases or were obtained in absence of human c linical illness during fi eld studies. Despite low levels or absent human cases, 52% of st rains were highly virulent (n=12) whereas 48% were completely or partially attenuated in mice (n=11). In general, attenuated strains occurred more frequently in the southern part of South America (Monath et al 1980). A companion paper to this mouse study investig ated the virulence of many of these North and South American SLEV strains in two speci es of avian hosts, nestling and adult house sparrows ( Passer domesticus ) and 3-week old chickens ( Gallus gallus ) [Bowen et al 1980]. Bowen et al (1980) found that variations in virulence by geographic region in mice correlated well to viremogenic capacity of SLEV in birds (also high, intermediate, and low). Epidemiology In the United States, national surveillance for SLEV began in 1955. Since the 1960s, epidemics of SLEV have occurred approximately every 10 years and epidemic attack rates

PAGE 119

94 range from 1 to 800 per 100,000 population (C alisher, 1994). In eastern states, serosurveys conducted during epidemics in urba n areas indicate a 6% incidence of SLEV infection. A survey conducted in both rura l and urban Indiana residents found an overall seroprevalence of 3.6% to SLEV, with an estimated annual inf ection rate of 0.32% (Burke and Monath, 2001). In California, surveys have detected a range of seroprevalence rates (<1% to 11%) throughout the state. In sum, these low seroprevalence rates indicate that there w ould be minimal protection in the North American population by acquired immunity to SLEV in the event of an epidemic (Reisen, 2003). The epidemiology of SLEV differs dramati cally in the United States. In western states, SLEV transmission is an endemic (occasionally epidemic) disease transmitted by Cx. tarsalis mosquitoes that affects the non-imm une childhood population. In contrast, SLEV transmission in eastern states is char acterized by explosive epidemics. SLEV is absent or at low levels duri ng interepidemic periods, with no accumulation of immunity with age. The disease primarily affects elderly populations and is transmitted by Cx. pipiens, Cx. quinequfasciatus or Cx. nigripalpus mosquitoes (Monath et al 1980). Other risk factors include residence (souther n United States), outdoor occupation, and socioeconomic status related to the distribut ion of human SLEV cases. The decline in SLEV cases over time paralleled the in crease in television ownership and air conditioning, as well as lowered antibody prev alence to SLEV with extensive screened housing (Reisen, 2003). Figure 2-9 illustrate s epidemic SLEV activity in the United States from human encephalitis cases reported to the CDC since 1964 (CDC, 2007 l ).

PAGE 120

95 In Florida, the first indication that SLEV was a threat to the human population occurred in 1952 when the virus was isolated from a 30-year-old Miami man (Sanders et al 1953). Human SLEV infections have been classified into four frequencies in the state: 1) no cases, seen in the majority of years, 2) focal outbreak, less than 10 cases/year in a clearly defined geographical region, as seen in 1958, 1969 and 1993, 3) sporadic outbreak, less than 10 cases/year over a widespread geographical area, as seen in 1979, 1997 and 1999, and 4) epidemic, greater than 20 human cases, which may be focal or widespread (Day and Curtis, 1999). Major SLEV epidemics occurred in 1959, 1961, 1962, 1977 and 1990 (Shroyer, 1991; Day and Stark, 2000). Notably, 333 of 377 clinical cases reported in Florida from 1976 through 2000 occurred during two ep idemics, 1977 and 1990 (Reisen, 2003). In Central and South America, SLEV transmission is endemic in humans, as shown by high antibody prevalence in serosu rveys conducted in Mexico, Brazil, and Argentina. Prior SLEV infection has been estimated at 13.7% in northwestern Mexico (Calisher, 1994), approximat ely 5% in Brazil (Mondini et al 2007) and ranging from 350% in Argentina (Sabbatini et al 1985) based on SLEV speci fic antibodies detected in the population. However, these seroprevalence studies should be in terpreted cautiously in South America as diagnostic tests may be influenced by cross-reacting antibodies to dengue virus or other endemic flaviviruses and extensive yellow fever vaccination of the population (Mondini et al 2007). A high prevalence of cross-reactive immunity may modulate severe symptoms associated with SLEV infection, such that CNS involvement is rarely reported. Epidemics of diseas e are also rare in the region (Monath et al 1980; Calisher, 1994; Spinsanti et al 2003; Diaz et al 2006; Mondini et al 2007; Gubler, 2007).

PAGE 121

96 Figure 2-9 Epidemics of Human SLEV Cases in the United States, 1964-2006 Periodic epidemics of St. Louis encephalitis virus have o ccurred over the last twenty years throughout the United States. Confirmed and probable human cases of SLEV inf ections are shown from 19642006, as reported to the CDC. The most recent outbreaks (greater than 20 encephalitis cases) occurred in Louisian a in 2001 (n=71 cases) and in Florida in 1990 (n=223 cases). [Figure adapted from Reisen, 2003] Confirmed and Probable St. Louis Encephalitis Cases (1964-2006)0 250 500 750 1000 1250 1500 1750 2000 19641968197219761980198419881992199620002004YearNumber of Reported Cases SLEV1975 Illinois (n = 581) Indiana (n = 290) Mississippi (n = 210) Ohio (n = 416) 1964 Texas (n= 232) 1966 Texas (n =254) 1976 Texas (n = 96) A labama (n = 69) Mississippi (n = 81) 1977 Florida (n = 110) 1990 Florida (n = 223) 2001 A rizona (n = 1) A rkansas (n = 2) Louisiana (n = 71) Texas (n = 5) 2002 A rizona (n = 2) Florida (n = 1) Texas (n = 19) 2003 Arizona (n = 5) Texas (n = 17)

PAGE 122

97 Molecular Epidemiology Previous oligonucleotide fingerprinting studies have shown that SLEV strains have genomic variability and can be classified by thei r geographic origin (Trent et al 1980 & 1981). These experiments used radioactive RNase T1 digestions of the RNA genome to produce a signature oligonucleot ide fingerprint for each SLEV strain studied. Although phenotypic strain differen ces related to geographic origin and virulence in mice and birds were found (Trent et al 1980 & 1981), these early studies were unable to identify the lo cation of nucleotide sequence polymorphisms in the viral genome (Kramer et al 1997). In contrast, dideoxy-terminator chai n sequence analysis allows for the identification of individual nuc leotide residues and their loca tion within a genome. This principle has been exploited for molecular epidemiology studies of arboviruses (Gaunt et al 2001), as well as for the recent complete sequencing of the human genome (IHGSC, 2004). The partial nucleotide sequence of SLEV was first reported by Trent et al in 1987, which identified the coding sequence for th e structural proteins and three (out of seven) nonstructural proteins (NS1, NS2A/B) and presented a rudimentary evolutionary tree with other flavivirus outgroups. A decade later, a more sophisticated phylogenetic analysis of the (partial) enve lope region of strains collected in periods of high and low activity in California found no consistent differences, but did detect new genotypes of SLEV after 1972 that either were introduced to the region or mutated from earlier strains (Kramer et al 1997). SLEV isolates throughout the Americas were further investigated by studying the complete envelope gene: geog raphic differences that could be grouped into seven lineages based on parsimony analys is were detected (Kramer and Chandler,

PAGE 123

98 2001). Consequently, this study provided a fr amework for the molecular epidemiological analysis of SLEV strains. It is now possible for the genotype of newly isolated St. Louis encephalitis viruses to be ra pidly characterized, such that strain origin, virulence classification, and epidemic potential can qui ckly be ascertained based on nucleotide sequence. Since the introduction of WNV in the Unite d States, an epidemic of SLEV has not occurred following the appearance and widespre ad transmission of WNV in a state. Only Louisiana experienced an epidemic of SL EV (n=71 cases) in 2001, when WNV was first introduced and concurrently circulated in th e state. In Texas, 19 human cases of SLE were reported in 2002 (introduction of WNV to the regi on) and 17 cases in 2003, but both years had less than 20 cases indicativ e of a epidemic. From 2004 through 2006, a total of 26 sporadic human cases of SLEV have occurred throughout the United States, with 5 or fewer cases reported from any single state (CDC, 2007 l ). Thus far, there have been no reported isolations of SLEV or phylogenetic analyses on any strains detected since the introduction and widespread transmi ssion of WNV in North America. However, this is not the case south of the North American border. In South America, SLEV strains represen t distinct genotypes from those found in North America. Recent phylogenetic analysis in dicates that five lineages occur in South America, with up to 161 nucleotide differen ces (Argentina 1966 strain) from all other SLEV isolates (Kramer and Chandler, 2001). Consequently, annual recrudescence of transmission in North America is thought not likely to depend on reintroduction from migratory birds or bats infected with S outh America genotypes (Burke and Monath, 2001).

PAGE 124

99 Recent outbreaks of SLEV in tropical regions have raised concerns that the mild illness typically associated with the virus in South America may have become more severe. In 2002, SLEV emerged in Cordoba Pr ovince, Argentina with one case of human encephalitis after a seventeen year absence from the region (Spinsanti et al 2003). Encephalitic cases in Argentina are rare, desp ite a widespread distri bution of SLEV with seroprevalence rates from 3 to 50% of the population (Sabattini et al 1985). In 2005, an outbreak of SLEV in the same province resulted in 47 laboratory confirmed cases, with 9 fatalities. Field investigations in response to this outbreak isolated SLEV from two mosquito pools. These strains were subse quently sequenced (E gene) for molecular epidemiology purposes, and matched to Lineag e III subtypes, as proposed by Kramer and Chandler in 2001. This correlates with the si ngle Argentinean isolate previously placed in that lineage (Diaz et al 2006). Prior to 2005, only two SLEV isolates from humans have been reported in Brazil in 1971 and 1978 from the Amazon region. Each patient had febrile illness and jaundice, without CNS symptoms. Then, in January of 2004, a female patient was hospitalized with fever, severe headache, macular rash, a nd myalgia with an initial clinical diagnosis of probable dengue fever in Sao Paulo Stat e, Brazil. SLEV was isolated from serum (designated SPH253175), a portion of the NS5 gene was sequenced (~1 kb at the 3 terminus), and shared 93% nuc leotide sequence identity with a Mississippi isolate (MSI7) from 1975 (Lineage IIC) [Rocco et al 2005]. However, dos Santos et al (2006) sequenced the complete envelope region of th e Sao Paulo isolate a nd found that it shared ~100% nucleotide sequence identity with an Ar gentinean strain (79V-2533), placing it in

PAGE 125

100 Lineage III instead (dos Santos et al 2006). The discrepancy between the NS5 phylogenetic analysis and that based on the envelope region was not discussed. A community outbreak of SLEV also occu rred in Sao Paulo State, Brazil in 2006 (n=6 human cases). Simultaneously, a la rge epidemic of dengue virus (DENV-3 serotype), with more than 15,000 estimate d cases, was reported to various health agencies. Despite initial misdiagnosis as dengue infections, six patients were later confirmed SLEV positive after dengue and yellow fever etiologies were ruled out. Interestingly, three of these cases had clini cal symptoms of hemorrhagic disease and is the first time that hemorrhagic signs have b een linked to SLEV infections. Yet, dengue virus is endemic in the region and previous infections with dengue may confound this association. A small portion of the NS5 region was sequenced (159 base pairs) and indicated 96% homology to an Argentinean SLEV isolate (Mondini et al 2007). Consequently, molecular epidemiology studies of SLEV strains are rapid, sensitive methods that can identify geographic orig in, genotype, and phenotypic (virulence) characteristics of newly isolated viruses. Su ch studies are in critical demand to further improve epidemiologic analysis and public heal th prevention and response strategies for outbreaks of arboviral disease. Economic Burden One study has directly assessed the economic costs related to an epidemic of St. Louis encephalitis virus in Dallas, Texa s during 1966. This outbreak resulted in 172 confirmed or probable human cases, with 20 d eaths. The total costs associated with the Dallas epidemic were estimated at $796,500 in 1966 dollars, with $348,500 needed for public health control measures (Schwab, 1968). Over the last forty years, medical and

PAGE 126

101 mosquito control expenses have dramatically increased. Zohrabian et al (2004) adjusted these 1966 dollar figures based on consumer price indices to reflect current prices, in 2002 dollars. The authors estimat ed a total adjusted epidem ic cost of $5.4 million, with $1.9 million spent on vector and epidemic contro l expenditures. These adjusted findings for the Dallas epidemic are a sharp contrast to the total short-term cost estimates ($20.1 million) associated with the WNV epidemic in Louisiana during 2002, with 329 reported cases and 24 deaths (Zohrabian et al 2004). Schwab (1968) also investigated the br oader impact of the 1966 epidemic of SLEV on the Dallas community. Conventi on, school and theater attendance were examined, as well as retail sales and highway us age. Results identified a mild impact on the economy, such that convention attendance was lower during August, coinciding with the most intensive national publicity about the epidemic and aerial spraying to control the vector population. School attendance, reta il sales and highway usage were not significantly impacted. Residents may have altered their outdoor act ivities somewhat, as evidenced by decreased attendance at outdoor theaters (especially drive-in movie theaters). Authorities also re ported numerous calls from out -of-state residents concerned about traveling to Dallas, but tourist a nd convention business was not significantly affected (Schwab, 1968). The 1990-1991 epidemic in Florida resulted in the closing of recreational parks at night, such as Walt Di sney World, and cancellation of other evening activities (Meehan et al 2000). As in 1966, publicized he alth warnings in 1990 also prompted out-of-state travelers concerned about the epidemic to contact public health agencies on the advisability of traveling to central Florida (L.M. Stark, personal communication). The extent of economic impact on Floridas tourism and convention

PAGE 127

102 attendance due to arboviral medical alerts and early closing of businesses is unknown, for either SLEV or WNV. Public Health Implications Currently, there is no approved human vaccine for SLEV (or WNV) and specific antiviral therapy is not available for treatment of flavivirus infections (Leyssen et al 2003; Kramer and Shi, 2007). It is unlikely that a SLEV vaccine will be developed, as the costbenefit ratio is not high due to the traditionally sporadic, low number of cases that occur annually (as compared to WNV) [Reisen, 2003]. The main mode of prevention for SLEV and WNV is to control the vector population (mosquitoes) through integrated vector control management programs and encourage use of personal protection behaviors. A surveillance network of federal, state, and local health departments monitors arboviral activity in humans, vectors and wildlife hosts (Gubler, 2002). The recent introduction of WNV into areas historically endemic for SLEV in North and South America, where both viruses share mosquito vectors, amplifying hosts and habitat, has unknown consequences. As such, it will be of utmost importance to continue to closely monitor flaviviral activity in the western hemisphere should competition pressures promote rapid evolution of these viruses (Reisen, 2003; Gubler, 2007). Surveillance for Arboviral Activity Surveillance systems serve as an early warning for the transmission of disease and aim to limit or prevent human cases. A su rveillance program s hould quantify arbovirus activity at a specific time, predict the likely fu ture course of the transmission cycle, as well as indicate when control should be im plemented to prevent epizootic or epidemic viral transmission. An effectiv e surveillance program requires long-term commitment and

PAGE 128

103 proactive projects to gather data in epidemic and interepidemic years. This allows for baseline (background) levels to be set and can provide the basis for setting thresholds so that prompt decision making for vector c ontrol and medical alerts can begin when increased activity is detected. Due to the complex life cycles of arboviruses, no single technique can collect all the da ta necessary for accurate risk assessment of vector-borne diseases. Thus, multiple detection methods are necessary and threshold levels and indicator parameters may vary by region and s eason. Current year data should also be compared with historical data for the same region as well (CDC, 1993). Successful arboviral surveillance progr ams focus on components of both the enzootic cycle and the epizootic cycle. An ideal program should monitor meteorological data (rainfall and temperature patterns which promote development of large mosquito populations), vector data (field infecti on rates, density a nd age structure of Culicine species), avian morbidity and mortality (for WNV), and vertebrate host data (high flaviviral antibody prevalence in wild passerine birds will prohibit further viral amplification). Active or passive surveillan ce of encephalitis in unvaccinated equine cases can also be useful pr edictors (CDC, 1993; Blackmore et al 2003). A few states including Alabama, Califor nia, Colorado, Delaware, Florida, Utah, Louisiana, Maryland, Nebraska, Nevada, North Carolina, Tennessee, and Texas use sentinel chicken flocks scattered throughout regions at grea test risk for WNV, SLEV, EEEV and/or WEEV infection (C DC, 1993; Komar, 2001). Where Cx. tarsalis and Cx. nigripalpus are the primary mosquito vectors, these programs provide a sensitive and cost-effective method to monito r SLEV transmission activity in western states (Reisen et al 2000b; Scott et al 2001) and in Florida (Day, 1989). However, sentinel chickens may

PAGE 129

104 not be the perfect indicators for all regions, as they were not usef ul for detecting WNV activity in Cx. pipiens complex associated epidemics in New York City (Komar, 2001; Cherry et al 2001). For example, in Houston, Texas, mosquito infection rates instead of sentinel chickens are used for WNV and SLEV surveillance (Chandler, Parsons and Randle, 2001). Despite this, domestic chickens are still the most widely used sentinel animals for detection of arboviru ses, but it is likely that one ideal captive av ian sentinel truly does not exist (CDC, 1993). The primary a dvantage of captive bird sentinels is that time and place of exposure are known. Conve rsely, sentinels only detect focal transmission and multiple flocks must be pl aced to accurately represent geographic areas (CDC, 2003Aa). Surveillance in Florida (State and Local Levels) In Florida, arboviral activity is moni tored year-round with several surveillance activities, which may include screening of mosquito populati ons, sentinel chickens, wild birds and other animal cases, to detect increased transmission activity and to intervene and reduce the risk of transmission to humans These activities ar e coordinated through interagency cooperation at local and state levels, where differe nt agencies may participate or respond at various times during routine surveillance for arboviruses. Evidence of increased transmission activity in nature initiat es control measures a nd intensification of surveillance. At the state level, the Florida Interage ncy Arbovirus Partners Group recommends policy. The Florida Department of Health (FDOH)-Bureau of Community Environmental Health (BCEH) coordinates statewide surveillance, prevention and control programs, as well as reports epidemiologic information to participating agencies and recommends health alerts. The Department of Agriculture and Consumer Services

PAGE 130

105 (DACS) oversees both entomological and ve terinary surveillance activities, and the Florida Fish and Wildlife Conservation Co mmission (FWC) monitors and investigates wild bird mortality. Florida is comprised of 67 counties and currently 32 participate in arbovirus surveillance activities; county health departments (CHD) and/or mosquito control districts perform rou tine field sampling (sentinel chickens, mosquito pools) for arbovirus surveillance. CHD also investigate and report human cases, as well as provide community information and education, as n eeded. The FDOH Bureau of Laboratories (BOL) performs assays for detection of flaviviral (and alphaviral ) infections: the Jacksonville Virology Laboratory performs clinical serology, whereas the Tampa Virology Laboratory (BOL-Tampa) performs serology, molecular and virus isolation assays for the detection of arboviruses in clinical and field sp ecimens (FDOH-BCEH, 2007). For field surveillance activities, this revi ew will discuss only sentinel chicken and wild bird surveillance activities in Florida, as they are most pertinent to this project. Florida Sentinel Chicken Program Periodic outbreaks of St. Louis encepha litis virus over the last forty years (e.g. 1959 to 1962315 human cases/55 deat hs; 1977110 cases/8 deaths; 1990223 cases/11 deaths) led to the formation and continuation of an arboviral surveillance program in Florida (Bigler B, 1999). At the hear t of this program is the Florida Sentinel Chicken Arboviral Surveillance Network, which was established in 1978 (Nelson et al 1983). Chickens are chosen as sentinels becaus e they are susceptible to infection and will develop antibodies, the infecti on is mild, and significant vire mia does not develop; thus

PAGE 131

106 they are non-infectious to handlers, mo squitoes, and other chickens (Langevin et al 2001). Every year, approximately 30 counties (out of 67) participate in the network and place thousands of sentinel chickens at poten tial arboviral enzootic transmission sites for weekly monitoring (administered by mosquito control districts) [FDOH-BCEH, 2007]. This statewide surveillance program has show n that sentinel chicken seroconversions (development of antibodies) to arboviruses often precede human cases and can serve as an early warning system (Blackmore et al 2003; Butler and Stark, 2005). Chicken Serosurveillance Guidelines Six flocks of six chickens each are recommended for each county, where they are placed at potential enzootic transmission sites. Sentinel sites are permanently positioned in areas free from public access and vandali sm, within 2-3 miles of active mosquito breeding areas, in both swamps and near resi dential areas. Chicke ns are protected from the elements and predators, and an additional flock of chickens is recommended to be kept in a mosquito-proof build ing as replacements for chicke ns removed from flocks due to seroconversion or mortalit y. All chickens are uniquely identified by numbered wing or leg bands. Leghorn, Rhode Island Red, or Barred Rock chickens that are 10-12 weeks old at onset are recommended. Chickens are bled and baseline antibody levels analyzed prior to placement in the field. It is recommended th at all chickens in a flock are sampled every week (FDOH-BCEH, 2007). Seroconversion (development of antibodies after exposure to an infectious agent) rates in sentinel chickens, along with data collected by mosquito control agencies, are utilized by public health offici als as indicators of the intens ity of enzootic transmission

PAGE 132

107 activity as a potential predictor of epidem ic arboviral transmission in an area and to determine control measures needed to prevent clinical disease. The recent emergence of West Nile virus (WNV) in Florida mobili zed public health agencies statewide and reaffirmed the importance of the sentinel chic ken program as an early warning system not only for endemic diseases, like SLEV and EEEV, but also allows for the detection of new or reemerging diseases (Blackmore et al 2003; FDOH-BCEH, 2007). Wildlife Surveillance The Florida Fish and Wildlife Conser vation Commission was established in 1999 for the protection, management, regulation and res earch of wildlife resources in the state. Surveillance for arboviral infections in wild birds is monitored by the FWC through investigation of dead bird mo rtality clusters and through dead bird sightings (reported by the public). These data are espe cially useful to detect foca l areas of intense West Nile virus activity, as most other arboviruses ar e non-pathogenic for wild birds. Wildlife rehabilitation centers are included under the aegis of the FWC, both of which may request arboviral testing by the BOL-Tampa for diagnosis of infection in suspected animal cases (FWC, 2007). Serological Detection Methods It is rare to isolate arboviruses from blood (or cer ebrospinal fluid [CSF] from humans) taken during the acute phase of inf ection because the viremic stage is often completed prior to onset of illness. Conseque ntly, diagnostic methods primarily are based upon detection of antibodies. Serologic det ection methods are complex due to close antigenic relationships within virus families. After a sample is determined to be a certain virus group positive by the screening test, speci alized diagnostic tests are required to

PAGE 133

108 differentiate between specifi c viruses, including crossreactions between WNV and SLEV (FDOH-BCEH, 2007). Hemagglutination Inhibition (HAI) Test Hemagglutinating antigens from SLEV WNV, WEEV and dengue virus were first demonstrated by Sabin and his asso ciates. These studies indicated that hemagglutination was characteri stic of most arboviruses, and that hemagglutinins had specific requirements for type of erythroc yte and pH (Sabin & Buescher, 1950; Sabin, 1951; Chanock & Sabin, 1953, 1954a, 1954b; Sweet & Sabin, 1954). Later studies were able to use this property to extend the list of arboviruses with HA activity (after sucrose acetone and ether-extracted antigen preparatio n) and show that most of the arboviruses fall into three immunologically distinct groups: A, B, and C (Casals and Brown, 1954; Casals, 1957). Antiviral antibodies in sera can specifically inhib it the hemagglutination reaction such that this test can be utilized for diagnostic purposes (Clarke and Casals, 1958). Previously one of the most common laboratory techniques used to determine arboviral infections, the HAI test now is only used by a few states for this purpose. The HAI test may be used for a variety of etio logic agents; it is inexpensive and easy to perform, and allows for testing of large num bers of specimens at one time. However, when testing a large number of specimens, samples are usually batched and results reported once a week. Laborator ies (mostly state diagnostic facilities) that use this method are typically located far from the surv eillance site. The HAI test as used by these laboratories is cost-effective, reproducible, a nd is useful for analyzing hundreds or over a thousand specimens (only Florida has this capability) at once. However, results may not

PAGE 134

109 be reported for a week and may effect local ag encies response time to initiate or intensify control measures (Olson et al 1991). The best source of HA antigens is su crose-acetone extracted suckling mouse brain. Suckling mice are inoculat ed with virus, and the brai n tissue, which contains high titers of virus, is harvested. Acetone extraction removes nonspecific lipoprotein inhibitors of agglutination, and treatment of the test sera with protamine sulfate also removes serum inhibitors and broadens the pH range for HA activit y. Goose erythrocytes are routinely used to remove naturally occurri ng agglutinins in the sera. The sera are then serially diluted and a ppropriate antigens containing 4-8 units of hemagglutinin are added. The serum-virus mixture is incubated overn ight to allow for antigen-antibody binding. Then, goose RBCs are added to the test sera-a ntigen mixtures and incubated for 1 hour. Inhibition of agglutination is indicated by a button of red cells (Cla rke and Casals, 1958). Cross-reactivity within a virus group is common and can complicate interpretation of HAI test results. As such, HAI tests are valuable screening assays (with a high sensitivity), but a positive test result requires additional confirmatory tests. Both the IgM and IgG antibody fractions are involved in the HA I reaction so that a f ourfold rise in titer between acute and convalescen t sera may be diagnostic of recent infection (FDOHBCEH, 2007). IgM Antibody Capture Enzyme-Linked Immunosorbent Assay (MAC-ELISA) IgM antibodies are efficient agglutinating molecules, excellent complementactivators, and largest in si ze. Although they cannot pass through the placenta and are inefficient in the neutralization of viruse s, IgM antibodies are very important for diagnosis of disease etiology as they are typically the first cl ass of immunoglobulins

PAGE 135

110 produced following infection. Elevated levels of IgM usually indicate recent exposure to antigen or a recent infection (Benjamini et al 2000). The immunoglobulin M antibody capture enzyme-linked immunosorbent assay (MAC-ELISA) has proven to be an excellent technique for measuring IgM antibodies in response to viral infection (Duermeyer et al 1979; Hofmann et al 1979; Schmitz et al 1980; Roggendorf et al 1981; Burke & Nisalak, 1982; Jamnback et al 1982; Monath et al, 1984; Calisher et al 1986a; Calisher et al 1986b; Calisher et al 1986c; Olson et al 1991; Martin et al 2000; Johnson et al 2003). This diagnostic method has been standardized and allows for a consistent ra pid approach for monito ring arboviral disease, but is restricted by species type (Martin et al 2000). The MAC-ELISA is more specific than the hemagglutination inhibition test, which can only indicate viral group infection (i.e. Alphavirus or Flavivirus) due to extensive cross reactio ns between family members. The presence of virus-specific IgM antibodies in a single serum speci men indicates that it is a presumptive positive. This eliminates th e need for a convalescent-phase serum to be drawn (Martin et al 2000), which often is difficult to achieve due to improper timing and loss to follow-up for humans. Chickens can be lost to follow-up as well; they may escape, be lost to predation, or not re-bled (personal ob servation, sentinel submission sheets). The test is performed as follows: antispecies IgM capture antibody is coated on 96-well microplates, and the wells are blocked with milk protein to decrease background non-specific protein adsorption to the plate. Serum from the animal species is added followed by non-infectious viral antigen. The pr esence of antigen is detected using an enzyme-conjugated anti-viral antibody that interacts with a chromogenic substrate to generate a colorimetric result (Martin et al 2000).

PAGE 136

111 IgM Antibody Microsphere-based Immunoassay (MIA) The microsphere-based immunoassay (MIA) is a more rapid serological test than the ELISA for laboratory diagnos is of many diseases (Kellar et al 2001). This technology merges the concepts of ELISA and flow cytometry, where monoclonal antibodies are coupled to beads in a micros phere-based flow cytometric assay as an alternative to the microtiter plate-based ELI SA (Vignali, 2000). Advantages of the MIA include greater sensitivity than the conventional ELISA and it can of ten resolve clinical samples indeterminate by other as say methods (Vignali, 2000; McHugh et al 1997). Recently, a MIA was developed to detect IgM antibodies to WNV and SLEV in human sera. This duplex method uses a flavivirus group-reactive monoclonal antibody coupled to two different bead sets. The use of this monoclonal antibody allows for different types of antigen (e.g. WNV or SLEV) th at can be attached to unique bead sets. Human serum is added and detection of virus specific IgM antibody is done with a single primary antibody (Anti-human IgM) that is conjugated to the detection molecule phycoerythrin. These duplex MIA results compar ed favorably to those of the plaque reduction neutralization test (PRNT) and MAC-ELISA (Johnson et al 2005). The BOL-Tampa has developed an experi mental technique for the detection of IgM antibodies in chicken sera (Haller, 2005) based on the MIA originally developed for human sera by Johnson et al. (2005). This method will be described in greater detail in Chapter Three. Plaque Reduction Neutralization Test (PRNT) The plaque reduction neutralization te st (PRNT) is the gold standard for differentiating between closely related etiologic agents. Time consuming, expensive, and

PAGE 137

112 laborious, the assay utilizes live infectious agents to challenge suspect sera for the presence of specific neutralizing antibodies. This assay may also be used to determine the identity of viral isolates. The test is highly sensitive and sp ecific and, for arboviruses, is usually performed in African green monkey ki dney (Vero) cell culture s. The principle of the assay is that specific neutralizing antibod ies in serum will block viral infectivity so that the virus cannot a ttach to cells. Any viru s that is not neutrali zed will initiate as a plaque, which develops when the infected cell monolayers are maintained under media solidified by agarose. To easil y visualize the plaques, the media is supplemented with neutral red, a vital dye. Plaque s characteristically form as colorless, round areas, where the cells have been killed by the virus. These appear against a red background of viable cells, and can be quantified. If neutralizing antibodies are present, a reduction in the number of plaques occurs (Beaty et al 1989). Serum neutralizing antibody is prim arily IgG antibody (FDOH-BCEH, 2007). Unlike IgM molecules, IgG antibodies are effective at neutralizing viruses and predominate in the blood, lymph, and CSF. The IgG class also has the longest half-life of all the immunoglobulin isotypes, as well as agglutinating properties (Benjamini et al 2000). Serum neutralizing antibody, especially Ig G molecules, may persist for life after some viral infections, as seen for SLE and dengue viruses in humans (FDOH-BCEH, 2007). Arbovirus Cell Culture Methods The most commonly used virus isolation t echnique in arbovirology is cell culture. Cell culture is the maintenance of animal cells in vitro and provides the most powerful host for cultivation and assay of viruses (Condit, 2001). For flaviviruses cell cultures can

PAGE 138

113 be used to replicate and multiply the virus from viral stocks or from unknown specimens in mammalian, mosquito and avian cell lines (m ost commonly used). They also can be grown in rodent, swine, amphibi an or reptilian cells; all of which have different growth characteristics (Burke and Monath, 2001). In this manner, viruses are now more often isolated from in vitro cell cultures, as opposed to in vivo from susceptible animals (mice), because of ease of use and the extensive regulations required for experiments on research animals. From a public health perspective, cell cult ure is an important tool as it allows for the isolation of many different viruses, including some that are not even suspected at the time of inoculation. For instan ce, isolation of novel or emerging viruses may be detected in cell culture, but missed w ith other diagnostic assays that are limited to known or suspected pathogens for which diagnostic reag ents are available. This is a tremendous advantage over nucleic-acid based or immunolog ic tests, which only detect the specific virus to which the diagnostic reagent is dir ected. However, disadvantages of virus culture include the required expertise and specialized facilities for handli ng infectious agents, greater expense, and a longer time needed for detection (Storch, 2001). Yet, virus isolation from cell culture or animals rema ins the gold standard for virus detection assays (Lanciotti, 2003). Virus Growth Characteristics Cytopathic effect (CPE) is the simplest and most widely used criterion for detection of virus infection in cell culture. CPE is the pathology caused to the cell by a virus, which may include cell rounding, shrinkage, loss of adherence, lysis or fusion. Virus growth in cell culture is distinct fo r each virus, with characteristic CPE and

PAGE 139

114 incubation times needed for maximal growth. Inoculated cell cultures can be examined with inverted light microscopes to identify cytopathic effect or inclusion bodies for several days to detect positive cultures. Inclusion bodies are intracellular abnormalities specific to an infected cell and visible w ith light microscopy. These inclusion bodies typically represent focal points of viral re plication and assembl y, which may appear different for each virus type (Condit, 2001). Plaque Assay The plaque assay is the most quantitative, useful, and elegant biologic assay for the study of viruses. This technique was originally developed in the early 1900s (for bacteriophage studies) and then adapted to animal viruses in 1953 by Dulbecco and Vogt. Plaque assays are quantitative, qualitative, and have enabled cloning of individual genetic variants of a virus. In add ition, phenotypic differences in viruses can be characterized based on plaque morphology, growth prope rties or cytopathology (Condit, 2001). In general, the plaque assay relies on th e principle that a single infectious viral particle can infect a single cell (in a cell monolayer). For diagnostic virology, viral titers (concentrations) of unknown samples or virus st ocks can be precisely calculated using a plaque assay. Serial dilutions of the virus st ock or specimen are made and then inoculated into separate cell monolayers. After a one hour adsorption period, cel ls are overlaid with media solidified with agarose, which traps the virus to that area and does not allow it to infect other cells. Over a peri od of days, the single virus will give rise to progeny viruses that will infect surrounding cells, and after mu ltiple rounds of infection, a plaque will form. A second media-agarose overlay containi ng neutral red is often used to visualize the plaques. Plaques are then counted and the titer (concentration) of infectious virus in

PAGE 140

115 the original sample or stock is calculated ba sed on the serial diluti on, expressed as plaque forming units per milliliter (pfu/ml) [Condit, 2001]. Plaque assays can also be used to clone genetically unique virus variants. These virus variants may only form plaques under certain conditions (temperature, drug treatment) or the plaques may appear altered in size or shape. Theoretically, since each plaque results from a single virus particle, individual genetic variants can be cloned by picking plaques by removing a small plug of agar and infected cells with a pipet (Condit, 2001). Molecular Detection Methods Due to the expense, expertise, specialized facilities and longer time needed for virus growth, cell culture procedures in diagnostic virology have largely been replaced with molecular techniques for identification of viruses. Virus isolation studies have become less important as rapid molecular me thods, especially polymerase chain reaction (PCR), were discovered that could identify viruses. These molecular methods detect specific nucleic acid sequences and can be applied for identification of a single virus species, or for a group of related viru ses (Storch, 2001; Lanciotti, 2003). There are two types of nucleic acid in living systems, deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), although th e majority of viruses have an RNA genome. Nucleic acid amplifica tion assays are especially im portant in diagnostic virology for virus species that grow slowly in culture or those that are di fficult or impossible to cultivate. Molecular techniques only require a small volume of sample (Storch, 2001) and flaviviral nucleic acids can be extracted from a variety of bodily fluids (CSF, blood, serum, urine) and tissues (brain, heart, l ung, kidney, etc) [Lanci otti, 2003; FDOH-BCEH,

PAGE 141

116 2007]. All molecular amplification assays i nvolve three basic step s, including nucleic acid extraction/purification from specimens, amplification of the nucleic acid, and detection of the amplified product (Lanciotti, 2003). The prototype of targeted amplification assays is PCR, which was developed in conjunction with the discovery of thermo stable DNA polymerases in the late 1980s (Mullis et al 1987; Saiki et al 1988). Briefly, PCR utilizes short oligonucleotide primers and a thermostable DNA polymerase (e.g. Taq polymerase) to amplify a segment of target DNA, typically 100-1000 ba se pairs in size. The P CR reaction includes at least three steps, denaturation, primer annea ling and extension, whic h require different temperatures. These steps are cycled 25 to 40 times to generate the PCR product, or amplicon. A thermal cycler is the instrument used to control the progression of the cycle steps and the temperature of the reacti on. The analytical sensitivity of PCR is tremendous, as it can amplify very low copy numbers of the target DNA in a sample, often between 1 to 10 copies. Contamination of the reaction may occur due to the highly sensitive nature of PCR, which may result in false-positives. As such, it is important to carefully follow established procedures, physi cally separate the laboratory into areas for sample prep, PCR amplification, or detecti on, and to include negative extraction and no template controls with every PCR run to ve rify contamination has not occurred (Storch, 2001). This technique has revolutionized the field of viral diagnostics (Lanciotti, 2003). For RNA viruses, it is not possible to perform PCR directly on the ribonucleic acid, as Taq polymerase only uses DNA as a template Consequently, detection of viral RNA sequences requires a reverse-transcriptas e (RT) step prior to PCR to convert the RNA into complementary DNA (cDNA) that will be used as the template (Storch, 2001).

PAGE 142

117 Since flaviviruses have RNA genomes, an RT step is required in both end point PCR and real-time PCR techniques for species detection and sequence analysis. End Point RT-PCR A reverse transcriptase step prior to PCR requires additional cycling times and temperatures for the reverse transcription of the viral (plus sense) genomic RNA into single stranded DNA (cDNA). Taq polymerase in the PCR reaction then converts the cDNA into double-stranded DNA (dsDNA) and amplifies the dsDNA. Consequently, reverse transcriptase polymerase chain reacti on (RT-PCR) occurs in either a one or twostep process for the conversion of RNA into DNA and subsequent amplification of the dsDNA. In one step RT-PCR, the RT and PCR reactions are combined in the same tube. This is often accomplished by mixing reverse transcriptase and Taq polymerase enzymes with common reagents to carry out bo th the RT and DNA polymerase reactions (Lanciotti, 2003), where the thermal cycler controls both RT and PCR conditions (Storch, 2001). In two step RT-PCR, the reverse transc riptase reaction is car ried out separately from the PCR reaction, and after the cDNA templa te is created, a porti on of it is added to another tube for the PCR r eaction and conversion into dsDNA (Lanciotti, 2003). After the RT-PCR reaction is complete, the e nd-point is visuali zed/detected by gel electrophoresis and ethidium bromide staining (Storch, 2001). Real-Time RT-PCR Real-time polymerase chain reaction is revolutionizing tradi tional gel-based, endpoint PCR methodologies. The improved process combines PCR amplification and confirmation in a single step, so that results are detected during the PCR cycling steps rather than later running the PCR products on a gel for visualization (Storch, 2001;

PAGE 143

118 Lanciotti et al 2000). Real time PCR technology allo ws for detection of amplification during early stages of the reaction versus gel-based systems that require end-point detection (gels). In additi on, real time PCR assays have improved precision, are very sensitive and specific, have high throughput, and rapid turn around of results, which does not rely on product size discrimination (whi ch may only differ by a few base pairs between strains of virus) in end-point platforms (Applied Biosystems, 2001; Lanciotti, 2003). Real time PCR assays also have the advantage of detecting products during logarithmic and linear phases, which correlates to starting template and can be quantified. In comparison, the plateau stage (end point ) for traditional PCR may have the same plateau despite different star ting templates, and is where the products may begin to degrade (Applied Biosystems, 2001). For example, TaqMan is real-time PCR chemistry that is commonly used for the identification of infectious diseases. An advantage of this system over other real-time PCR platforms (e.g. Light Cycler with SYBR Green platform, SmartCycler with multiplex platform) is that 96 samples can be analyzed at once. The RT and PCR amplification reactions are iden tical to those already descri bed above for end-point PCR, except the reaction master mix also includes a sp ecific oligonucleotide probe that is duallabeled (Lanciotti, 2003). Briefly, the TaqM an system is designed with 2 specific primers and 1 probe (Applied Biosystems, 2001). The probe anneals to a specific sequence in between the forward and reverse primers on the template and has two types of fluorophores, reporter (R) at the 5end and quencher (Q ) at the 3 end. Before Taq polymerase acts, the probe is attached or unattached to the template, and the quencher reduces the fluorescence from the reporter fluorophore through Fluorescence Resonance

PAGE 144

119 Energy Transfer (FRET). Once the TaqMan probe is bound to th e template after denaturation and the reaction cools, the primers anneal to the DNA. Taq polymerase then adds nucleotides and removes the probe from the template, separating the quencher from the reporter, allowing the reporter to rele ase its energy. The emitted light is then quantified with a computer to generate CT values (cycle threshold where emitted light from sample reaches fluorescent intensity above background) [Storch, 2001; Pierce, 2003]. TaqMan chemistry has been developed for detection of WN and SLE viral RNA for surveillance programs and diagnosis of clin ical cases in the United States (Lanciotti et al 2000; Lanciotti and Kerst, 2001), as it offers increased sensitivity, higher throughput, quantification, and increased reproducibility as compared to traditional, end-point RTPCR (Morris, Robertson and Gallagher, 1996; Martell et al 1999). Lanciotti et al (2000) developed a TaqMan RT-PCR assay that was able to detect 0.1 plaque forming units of WNV (compared to 1 PFU for traditi onal PCR) and was much more sensitive for testing mosquito pools, where it detected 1 to 10 PFU of WNV, as compared to the traditional RT-PCR assay that could only dete ct >100 PFU in a sample. In addition, the two TaqMan primer/probe sets accurately iden tified all WNV strains tested in the study (NY99, Romania, Italy, Egypt, Kenya, Kunjin ), with no false-pos itive results from serologically related flaviviruses or other arboviruses (Lanciotti et al 2000). Similar results were obtained with the two TaqMan primer/probe sets developed for SLEV, which detected SLEV strains from the Unite d States and South America, with no falsepositive results from other arboviruses (Lanci otti and Kerst, 2001). For both WNV and

PAGE 145

120 SLEV TaqMan RT-PCR assays, CT values < 37 were considered positive (Lanciotti et al 2000; Lanciotti and Kerst, 2001). Nucleotide Sequencing Nucleotide sequencing of PCR products (amplicons) provides valuable information about the identity of the virus and can be used for phylogenetic analysis, molecular epidemiology, and presence of muta tions in the viral genome (Storch, 2001). The nucleotide sequence represents the primar y structure of a DNA molecule or strand, with the capacity to carry genetic information. The possible letters in a nucleotide sequence represent the four nucleotide s ubunits of a DNA strand, the adenine (A), cytosine (C), guanine (G) and thymine (T) ba ses that are covalently linked to the sugar phosphate backbone. A nucleotide sequence may be either coding or noncoding, and is dependent on the region of the genome analyzed (Innis et al 1988). Consequently, for viruses with genomic RNA, the dsDNA amp licon generated from the RT-PCR reaction is analyzed, not the RNA. The Sanger chain-termination method utili zes dye-terminators incorporated into an enzyme-mediated amplification reaction, where dideoxynucleotides insert into the nascent (elongating) DNA strand terminate DNA strand extension, resulting in DNA fragments of varying length (Sanger and Coulson, 1975). Labeling these chain terminators is called dye-terminator sequenci ng, where incorporation of bases with dyeterminators effectively halts polymerization in the PCR-like reacti on. Linear products of varying sizes (ranging from 1 to n, where n is the length of the amplicon) are obtained. This product is ethanol precipitated, rec onstituted and loaded onto a sequencing instrument where it is passed through a polyacrylamide gel and separated based on size.

PAGE 146

121 A laser within the instrument detects the wa velength of each dye and makes a base call based on the covalent linkage associated with each dye to a specific base [black = G, red = T, blue = C, green = A]. The computer software computes the sequence, based on usersupplied parameters, and the final nucleotide sequence for each amplicon is displayed. Nucleic acid sequence analysis offers the clearest, least ambiguous picture of amplified DNA products (Lanciotti, 2003) a nd has improved phylogenetic analyses and molecular epidemiology studies on viruses, where it can be used to identify strains, mutations, and virulence markers in the genome (Storch, 2001; Kramer and Chandler, 2001). Figure 2-10 summarizes the molecula r amplification and detection methods described in this brief review.

PAGE 147

122 Figure 2-10 Molecular Amp lification & Detection Methods for RNA Arboviruses Diagram provides an overview of the molecular methods for the amplification and detection of RNA arboviruses. This is a three step process: 1) extraction of the nucleic acid (i.e. RNA) from a variety of sample types; 2) amplification of the RNA with RT-PCR in one of two methods, end-point or real-time; 3) detection of the RT-PCR product. For end-point RT-PCR, the amplicons are vi sualized on an agarose gel stained with ethidium bromide (EtBr). For real-time RT-PCR, detection occurs simultaneously with amplification of the PCR reaction and is recorded by the instrument. Molecular Amplification and Detection Methods for RNA Arboviruses: A 3 Step Process Figure adapted from Lanciotti, 2003 2. Amplification RNA Extraction from human, animal or mosquito samples End-Point RT-PCR Real-Time RT-PCR TaqMan (ABI 7000-7700 series) SYBR Green (Light Cycler) Multiplex (SmartCycler) Nucleic Acid sequencing Agarose Gel + EtBr Stain 1. Extraction 3. Detection

PAGE 148

123 Surveillance Case Definition for Arboviral Disease In Florida, WNV, SLEV and EEEV are re portable human diseases. As a result, physicians and county health departments pr ovide case information to the Bureau of Community Environmental Health for data anal ysis and dissemination. The wide range of clinical illness in humans infected with thes e arboviruses complicates the case description and requires laboratory diagnosis to confirm a case (FDOH-BCEH, 2007). Clinical Description A spectrum of illness in humans may result from arboviral infections including asymptomatic infections to CNS disease of variable severity. Ar boviral encephalitis is characterized by such symptoms as fever, h eadache, and altered mental status ranging from confusion to coma (CDC, 2004c). Consequently, diagnosis with either neuroinvasive or non-neuroinvasi ve disease from an arbovira l infection requires specific case findings that are not e xplained by a more likely clin ical explanation (FDOH-BCEH, 2007). Neuroinvasive Disease Neuroinvasive disease is reported if the patient has presence of fever and at least one of the following symptoms: 1) acutely altered mental stat us (such as stupor, disorientation, or coma); or 2) acute signs of central or peripheral neurologic dysfunction (for example, paralysis, nerve palsies, sensory deficits, abno rmal reflexes, or generalized convulsions); or 3) pleocytosis (increased white blood cell count in CSF) associated with symptoms clinically compatible with mening itis (headache or stiff neck), as documented by a physician and in the absence of a more likely clinical explan ation. Rarely, WNV poliomyelitis (paralysis) has also b een reported (CDC, 2004b; FDOH-BCEH, 2007).

PAGE 149

124 Non-neuroinvasive Disease Similar to neuroinvasive disease, non-neuroinvasive disease is only considered in the absence of a more likely explanation for illness. The patient must have, at minimum, presence of a documented fever (measured by e ither patient or clinician) and the absence of neuroinvasive disease. Involvement of non-neurological organs (heart, pancreas, liver) should be documented using standard clin ical and laboratory criteria (FDOH-BCEH, 2007). For WNV, thousands of cases of non-ne uroinvasive West Nile fever have been reported. Clinical features of West Nile fever include fever, headache, and/or occasionally the following symptoms: swollen ly mph glands, skin rash on the trunk of the body, or eye pain (CDC, 2004c). Neuroinvasive and non-neuroinva sive cases are then classi fied as either probable or confirmed arboviral infections base d upon laboratory diagnosis (CDC, 1993). Laboratory Criteria for Diagnosis Results of diagnostic assays are used in conjunction with clinical findings to classify suspected arboviral infections eith er as confirmed or probable cases. Several diagnostic tests are performed to investigate each clinical case, where two methods are commonly used for confirmation of an arbovira l infection. Serological methods test for the presence of virus-specif ic antibodies in the blood, wher eas molecular methods detect virus-specific genomic sequences in a variety of samples. Isolation of the virus also confirms an infection (FDOH-BCEH, 2007). Serological Methods For humans, a fourfold or greater rise in virus-specific se rum antibody titer; virusspecific IgM antibodies detected by antibody cap ture enzyme immunoassay; or detection

PAGE 150

125 of virus specific serum IgG antibodies in th e same or convalescent specimen by HAI or PRNT are utilized to confirm an arbovira l infection (CDC, 1993; FDOH-BCEH, 2007). For chickens, demonstration of virusspecific IgM antibodie s by MAC-ELISA or detection of virus-specific serum IgG antibod ies by PRNT is confirmation of arboviral infection (FDOH-BCEH, 2007). Molecular Methods The detection of arbovirus-specific ge nomic sequences in blood, tissue or CSF confirms an arboviral infection. Traditional and real-time RT-PCR assays are frequently used by public health laboratories to test clinical, animal and mosquito samples for arboviruses (Lanciotti et al 2000; Lanciotti and Kerst, 2001). The CDC recommends several criteria for laboratory diagnosis of WNV using molecular methods. A positive RT-PCR test for WN viral RNA must be vali dated by one of the following methods: 1) a repeated positive test with different primers; 2) a positive PCR result using another system (e.g. TaqMan); or 3) virus isolat ion (CDC, 2003A). Consequently, the Florida Department of Health has modeled its molecular protocols for WNV and SLEV detection based on these recommendations, such that suspected human cases and field (animal, mosquito) samples must first screen positive with one TaqMan primer/probe set targeted to a specific region of the genome (Ct value <37). Samples that screen positive must then be confirmed with another TaqMan primer/probe set specific for a different region of the viral genome, and vi rus isolation attempted (Lanciotti et al 2000; Lanciotti and Kerst, 2001). Cell cultures that display characteristic cytopath ic effect are then confirmed by real-time RT-PCR assays to id entify isolation of the infecting agent.

PAGE 151

126 Surveillance: A Team Approach Surveillance systems are most effectiv e when data is shared and feedback strategies are built into the program, so th at results can trigge r a change in action. For example, the Florida Arbovirus Response Plan is designed for control measures that must be activated when surveillance detects arboviral activity in an area. At Response Level 2, where wide-spread detec tion in sentinel flocks, wild birds, or mosquitoes occurs, a Department of Health (DOH) declared medi cal alert will be considered for affected counties. Additional sentinel chickens may be placed to increase surveillance activities and the Department of Agriculture and Consum er Services (DACS) can issue a mosquito declaration, with increased vect or control measures, such as aerial adulticiding. Sentinel chicken surveillance data are summarized and reported weekly by the Florida Department of Health, Bureau of Laboratories (BOL ). The state Bureau of Community and Environmental Health summarizes the data on a weekly basis and provides the information to interagency partners, DOH County Health Departments, and the CDC. Consequently, coordination between multiple state agencies, local county health departments and mosquito control districts is crucial for implementation and success of an arboviral surveillance program (F DOH-BCEH, 2007). Successful arboviral surveillance programs should integrate data fr om all aspects of th e arbovirus life cycle, including avian, mosquito, and incidental host infections, as well as important abiotic factors, such as rainfall and temp erature (Reisen, 2003; Gubler 2007).

PAGE 152

127 CHAPTER 3 RESEARCH METHODS Study Design Field studies for the detection or isolation of arboviruses from naturally exposed animals or arthropod vectors are often cost-p rohibitive with several logistical problems (e.g. large geographic area, sporadic transm ission activity, larg e host population, short viremic period in the host). Consequentl y, this study proposed to perform targeted sampling on a large population of caged chicke ns located in active arboviral transmission areas (based on serological surveillance data ), rather than rely on samples passively submitted from all regions. Additionally, wild birds admitted to rehabilitation centers were also sampled, based on patient symptoms. In 2004, initial pilot experiments were conducted to test the study design, field protocol, and to optimize laboratory reagents for virus detection and isolation. The active study period occurred during the 2005 and 2006 calendar years for the targeted collection of samples to detect or isolate arboviruses fr om naturally exposed birds. All samples were collected from sentinel chickens permanently located in several c ounties or from birds admitted to wildlife rehabilitati on centers throughout Florida. Virus Strains Reference virus strains were obtained fr om the archived collection maintained by the Florida Department of Health, Bureau of Laboratories, Tampa (BOL-Tampa), the

PAGE 153

128 Division of Vector-Borne Infectious Diseases CDC, Fort Collins, Colorado, or purchased from the American Type Culture Collection (ATCC). Three control viruses were used throughout the study period, one strain for SLEV and two strains of WNV. St. Louis encephalitis virus (strain TBH-28) was isolated in Florida and archived; West Nile virus strains were obtained either from the CDC (Egypt 101 strain) or from ATCC (NY99, strain 385-99, Cat. No. VR-1507). These vi ruses were used to optimize molecular extraction, amplification, and detection assays, as well as for positive controls in RT-PCR and plaque assays. St. Louis encephalitis virus strains chosen from the ar chive for sequence analysis were representative of isolates made in each of the last 5 decades (1950s, 1960s, 1970s, 1980s, and 1990s) in Florida. Genetic sequences of these strains have not previously been published, except for strain TBH-28 (1962) [K ramer and Chandler, 2001]. In addition, two Brazilian strains and two Trinidad strains of SLEV were acquired by the Epidemiology Research Center (ERC) prior to 1972. These strains were chosen from the BOL-Tampa (previously the ERC) archive fo r sequence analysis to represent South American strains of St. Louis encephalitis virus. West N ile virus strains were also included in the study: the emer gent North American strain (NY99, strain 385-99) and an Old World strain (Egypt 101) used as positive co ntrols, as well as six strains isolated in Florida from 2001 (two strains), 2002 (two strains) and 2005 (two strain). A list of these control and reference viru ses, including their strain designation, source, passage history and ge ographic location is presented in Table 3-1 (W NV strains) and Table 3-2 (SLEV strains).

PAGE 154

129 Table 3-1 Eight WNV Reference Strains Sequenced for Phylogenetic Analysis Eight strains of West Nile vi rus were sequenced for phylogenetic analysis. Six of these strains were isolated (cultured) in Florida, including 3 WNV strains from different avian species following death from natural infection. A strain isolated from an alligator was also in cluded in the study following death from W NV (natural exposure at an alligator farm). Two mosquito pool WNV isolates were also studied from 2002. Two contro l strains were analyzed and used as positive controls in RT-PCR and sequencing assays, incl uding Egypt101 obtained from the CDC, Fort Collins, and strain 385-99 (NY) purchased from ATCC. STRAIN DESIGNATION LOCATION YEAR HOST PASSAGE Eg101* 385-99* FL01-I401 FL01-I403 FL02-M1215 FL02-M1220 FL05-I189 FL05-I242 WNEgypt WNNY99 FL01a FL01b FL02a FL02b FL05a FL05b Egypt New York City, NY Madison Co., FL Suwanee Co., FL St. Johns Co., FL St. Johns Co., FL Clermont, FL Dixie Co., FL 1952 1999 2001 2001 2002 2002 2005 2005 Human Snowy owl Crow Blue Jay Oc. taeniorhynchus Oc. taeniorhynchus Alligator Crow SM2, Vero 3 Vero 5 Vero 1 Vero 1 Vero 1 Vero 1 Vero 1 Vero 1 WNV strain used as positive control.

PAGE 155

130 Table 3-2 Fourteen SLEV Reference Strain s Sequenced for Phylogenetic Analysis Ten strains of St. Louis encephalitis virus collected duri ng the last 5 decades in Fl orida were sequenced for phylogenetic analysis. After 1972, archived Florida SLEV strains were collected by Dr. Jonathan Day (University of Florida) and submitted to the BOL-Tampa for virus detectio n and culture. South American strains of SLEV were acquired by the BOL-Tampa (formerly the Epidemiology Research Center) prior to 1972. One control strain (TBH-28) was analyzed and used as a positive control in RT-PCR and sequencing assays. This strain also represents a Florida isolate of SLEV made in 1960s. STRAIN DESIGNATION LOCATION YEAR HOST PASSAGE Miami TBH-28* F72-M022 86-100309 86-100802 1A-059 3-594 3A-038 3-582 CXN GR8 TRVL 21647 TRVL 43174 BeAn 70092 BeAn 156204 FL52 TBH-28 FL72 FL85a FL85b FL89 FL90a FL90b FL90c FL90d TR58 TR62 BR64 BR69 Miami, FL Tampa Bay, FL Walnut Hill, FL Indian River Co., FL Indian River Co., FL Indian River Co., FL Indian River Co., FL Indian River Co., FL Indian River Co., FL Indian River Co., FL Trinidad Trinidad Belem, Brazil Belem, Brazil 1952 1962 1972 1985 1985 1989 1990 1990 1990 1990 1958 1962 1964 1969 Human Human Opossum ( D. marsupialis) Cx. nigripalpus Cx. nigripalpus Northern cardinal Common grackle Mourning dove Common grackle Cx. nigripalpus Cx. coronator Cx. nigripalpus Kingfisher ( C. inda) Chicken SM1, Vero SM11, Vero 2 SM3, Vero SM1 SM2 SM2 SM1 SM1 SM1 SM2 SM3 SM4 ?, SM1 M2, Vero 1 *SLEV strain used as positive control and representative strain of the 1960s.

PAGE 156

131 Pilot Field Study One small field study was conducted in Hillsborough County, where a total of eighteen cloacal swabs were collected from se ntinel chickens at three sites experiencing arboviral transmission activity (based on re sults of weekly BOL-Tampa serological assays). Molecular and tissue culture assays were performed on each swab, but no virus was detected or isolated from these chickens In addition, four of the chickens sampled were confirmed positive for antibodies to WNV and these findings indicated that it may be unlikely for successful arbovirus isolat ion after a chicken has developed antibody (seroconverted). The results from this initia l field study guided the design of a targeted sampling strategy used by the collaborating agencies when collecting specimens from the sentinel chickens to minimize waste of resources. Pilot Laboratory Studies Preliminary studies were performed to standardize and improve efficacy of arbovirus recovery from swab culturettes. E xperiments were performed to standardize nucleic acid extraction methods and real-tim e (TaqMan) RT-PCR detection thresholds. Swab culturettes (Becton Dickinson, Cat. No. 261514) were inoculated with 0.1 ml tenfold serial dilutions of St. Louis encephalitis virus (SLE TBH) [100 through 10-4] and then processed in 1 ml biologic field d iluent (BFD) [see Appendix A for BFD reagent formulas] for cell culture plaque assays and RNA extraction/detection. However, the manufacturer discontinued pr oduction of these swab culturettes after 2005. In 2006, replacement swab culturettes (Becton Dickin son, Cat. No. 220221), which contain 3 ml of media (proprietary), were also validated. These swabs were inoculated with 0.3 ml tenfold serial dilutions of St. Louis encephalitis virus (SLE TBH) [100 through 10-5] in 3 ml

PAGE 157

132 culture media to approximate the previous swab conditions. Swab s were processed as described later in this chapter. Four types of Qiagen nucleic acid extrac tion kits [QIAamp Viral RNA Mini Kit, Cat. No. 52906; QIAamp MinElute Virus Spin Kit, Cat. No. 57704; QIAamp RNA Blood Mini Kit, Cat. No. 52304; and RNeasy Mini Ki t, Cat. No. 74104] were tested to optimize viral RNA detection from whole blood samples; lysis buffers varied between kits (AVL, AL, EL, RLT, respectively). Four spiked di lutions of fresh goose blood (collected from geese maintained by BOL-Tampa for the hemaggl utination inhibition as say) were tested. Four ten-fold serial dilutions were prep ared, each dilution contained 0.9 ml anticoagulated whole goose blood spiked with 0.1 ml of SLEV TBH [10-1 through 10-4]. Nucleic acid was extracted following manuf acturers instructions for each kit. RT-PCR assays were performed, as described late r this chapter. Results indicated that the cell-free kits (QIAamp Viral RNA Mini Kit and QIAamp MinElute Virus Spin Kit) specifically designed for virus nucleic acid ex traction produced the hi ghest yield; not the whole blood kit or RNeasy Mini Kit. Table 3-3 summarizes the RT-PCR results for each extraction kit. The QIAamp Viral RNA Mini kit was chosen for use in the study. This type of kit had previously been validated at the BOL-Tampa for nucleic acid extraction from cloacal swabs (Brennan, 2003), and it was al so used for nucleic acid extraction from whole blood samples in this study. AVL lysis buffer with carrier RNA (10 g/ml) added [Qiagen, Cat. No. 19073] was aliquoted (0.56 ml) into 1.5 ml microcentrifuge tubes (Fisher, Cat. No. 02-681-320), and shipped on ice packs overnight to participating counties for blood specimen collection.

PAGE 158

133 Table 3-3 Evaluation of Nucl eic Acid Extraction Kits Four Qiagen nucleic acid extraction kits were tested to optimize the extraction procedure for the dete ction of SLEV from whole blood samples. Whole goose blood was spiked with St. Louis encephalitis virus. Blood dilutions were then lysed with the appropriate volumes of blood and lysis buffer, and extracted, following ma nufacturers instructions for each kit. Real time RT-PCR (TaqMan) was performed for each dilution, tested in replicate, with the SLE A primer/probe set. CT values for each dilution were averaged and are shown in table. SLEV Dilutions QIAGEN Kit 10 -1 10 -2 10 -3 10 -4 Negative Viral RNA Mini 20.9 24.72 26.96 31.52 undet MinElute Virus 26.64 29.19 39.06 40.83 undet Whole Blood 30.95 34.18 36.12 40.82 undet RNeasy Mini 35.93 undet undet undet undet

PAGE 159

134 study network. Table 3-4 provides a list of the collaborating agencies. Field studies were conducted on both domestic fowl (sentinel chicke ns) and wild birds to simulate the rural and urban transmission cycles of arboviruse s (refer to Chapter 2, p. 77-79). In 2005 and 2006, sentinel chickens were sampled for th e detection of viral RNA/isolation of arboviruses from blood (2005 only) and cloaca l swabs (2005-2006). In 2006, wild birds admitted to collaborating rehabilitation centers and studied by the Florida Fish and Wildlife Conservation Commission (FWC) were sampled for the de tection of viral RNA/isolation of arboviruses from cloacal swabs. Sentinel Chicken Surveillance Program Participants in the Florid a Arboviral Surveillance Netw ork include county health departments and county mosquito control dist ricts. These agencies maintain sentinel chicken flocks at potential ar boviral enzootic transmission s ites throughout the state. In 2005 and 2006, sentinel chickens detected flaviviral and alphaviral activity. County agencies in the traditional S LEV belt (central and southern counties) typically support sentinel chicken surv eillance programs and were request ed to participate in the study based on historical reported human cases a nd SLEV transmission patterns in Florida (Figure 3-1). Sentinel Chickens Young female white Leghorn, Barred Ro ck, Rhode Island Red or Minorcan chickens were recommended for sentinel surv eillance, however, other breeds are used by some agencies. Chickens were purchased by county agencies either from local chicken farmers or from other vendors, including Zephyr Eggs, Hillandale Farms, or Clyde

PAGE 160

135 Table 3-4 Florida Agencies and Collabo rating Partners in the Field Study Network Collaborating Agencies in the Arbovirus Isolation/Detection Field Study Network State Agencies Florida Department of Health, Bureau of Community & Environmental Health (FDOHBCEH) Florida Department of Health, Bureau of LaboratoriesTampa (BOL-Tampa) Florida Fish and Wildlife C onservation Commission (FWC) Florida Department of Agriculture and Consumer Services (DACS) University of South Florida (USF) University of Florida (UF) County Agencies* Charlotte County MCD Collier County MCD Hillsborough County MCD Lee County MCD Manatee County MCD Orange County MCD Pasco County MCD Pinellas County MCD Sarasota County MCD Volusia County MCD Wildlife Rehabilitation Centers Florida Wildlife Care Center (Gainesville) Audubon Center for Birds of Prey (Orlando) Wildlife Inc, Education & Rehabilitation (Bradenton) Pelican Harbor Seabird Station, Inc (Miami) Marathon Wild Bird Center (Marathon) *Mosquito Control District (MCD)

PAGE 161

136 Figure 3-1 Historical SLEV Tran smission Belt in Florida Distribution of reported human cases of St. Louis encephalitis virus in Florida (1987-2006). The majority of cases were reported from central and southern counties, the traditiona l SLEV belt, where ecologic factors and habitat support amplification and transmission of SLEV.

PAGE 162

137 Mizell, Inc (FDOH-BCEH, 2007). After 16 weeks of age, chickens were placed in the field in potential enzootic arboviral transmissi on sites (as determined by mosquito control agencies). Prior to field-placement, ch ickens were bled and tested in the hemagglutination inhibition (HAI) assay for the presence of arboviral antibodies to rule out previous infection (FDOH-BCEH, 2007). Monitoring Sites and Sample Collection Sampling of sentinel chicken flocks is a r outine part of arbovirus surveillance in Florida conducted by local county health depart ments and/or mosquito control districts. These agencies utilize sentinel chickens to recognize areas of increased arbovirus transmission in order to target mosquito control/abatement strategies and to estimate risk of human infection (FDOH-BCEH, 2007). In 2005, 3,801 adult sentinel chickens were maintained at 279 potential enzootic transmission sites in 31 Florida counties. During the second year of the study (2006), 2,901 adult sentinel chickens we re maintained at 275 potential enzootic transmission sites in 34 Florida counties. Blood was collected from each chicken (1.5 ml to 2.0 ml) up to 4 times per month, with weekly sampling duri ng peak transmission months (July through December) as previously described (Blackmore et al 2003). Clotted blood was centrifuged at 1200 x g for 15 minutes to separate serum and sent to the BOL-Tampa for analysis. Serological Methods At the Florida Department of Health, Bureau of Laboratories-Tampa (BOLTampa), as many as four types of serological diagnostic assays were routinely performed on the chicken sera to identify arboviral inf ections: the hemagglutin ation inhibition (HAI)

PAGE 163

138 antibody test, the IgM-capture enzyme-li nked immunosorbent assay (MAC-ELISA), IgM-capture microsphere-based immunoa ssay (MIA), and the plaque reduction neutralization test (PRN T). Serum samples were screened for the presence of antibody to alphavirus and flavivirus group antigens with the HAI antibody test, where serum samples were treated with protamine sulfate (Holden et al 1966), acetone extracted and assayed by the method of Clarke and Casals ( 1958) in microtiter plates. Hemagglutining antigens (SLEV TBH 28; EEEV D64-837) were prepared from suckling mouse brains by sucrose-acetone-extraction (Schmidt, 1979) a nd betapropriolactone-i nactivation (Sever et al 1964). Sentinel chickens that were HAI flavivirus or alphavirus positive for the first time were confirmed as WNV, SLEV, or EEEV pos itive with the MAC-ELISA, as in previous studies (Calisher et al 1986c; Martin et al 2000). Chicken sera that were IgM negative or equivocal were further assayed in the PRNT test for WNV and SLEV or EEEV and HJV. PRNT assays were performed at BioSafety Level 3, using previously described methods (Schmidt, 1979; Beaty, Calisher and Shope, 1989; Voakes, 2004). HAI, MACELISA, and PRNT antigens/viruses are listed in Appendix AI. A microsphere-based immunoassay (MIA) for the detection of IgM antibodies in chicken sera was developed and standardiz ed in the BOL-Tampa for WNV and SLEV (Haller, 2005) based on a procedure deve loped for human sera at the CDC (Johnson et al 2005). Briefly, sera samples, primary and secondary antibody, and antigen/bead set mixtures were diluted to working concentrations and added to filter plates designed for the MIA (Millipore, Cat. No. MABVN1250). Sera, including positive and negative controls, were diluted 1:400 in MIA running buffer (PBS 1% BSA) [Sigma, Cat. No.

PAGE 164

139 P3688]. Primary antibody, goat anti-chicken Ig M serum lyophilized (MP Biomedicals, Cat. No. 64395) was diluted to 2 g/ml in MIA running buffer. Secondary antibody, porcine anti-goat IgG-phycoery thrin (PE) (R&D Systems, Ca t. No. F0106) was diluted to 1 g/ml in MIA running buffer. Coupled bead sets (Cat. No. 32 & 57/6B6C-1 Bead Sets) were purchased from Radix Biosolutions, Georgetown, TX. Positive WNV recombinant antigen (Cat. No. M120-270) and negative an tigen (Cat. No. M130-270) was purchased from Hennessy Research Associates, Shawnee, KS. Positive SLEV (TBH-28) suckling mouse brain antigen (M29797) and normal control suckling mouse brain antigen (VB2115) was obtained from CDC, Fort Collins, CO. Coupled antigen/6B6C-1 bead set mixtures (bead set 32/WNV+Ag, bead set 32/WNV-Ag, bead se t 57/SLEV+Ag, bead set 57/SLEV-Ag) were also diluted in MIA r unning buffer (1:10) and MIA performed as previously described (Haller, 2005). The BOL-Tampa testing algorithm for sentinel chicken sera is shown in Figure 3-2. Wild Birds The natural mosquito-bird-mosquito cycl e of arbovirus amplification primarily occurs in wild avian hosts that develop hi gh titered viremias (as opposed to domestic fowl). As such, this study requested partners that routinely work with a variety of wild avian species for arbovirus detec tion/isolation in the primary ve rtebrate amplifying host. Florida Fish and Wildlife Conservation Commission (FWC) The FWC is a state agency that investigates clusters of wild bird deaths for the detection of avian pathogens, including ar boviruses. In 2006, the FWC agreed to collaborate on this project. FWC veterinari ans collected cloacal swab samples from 23 birds, as part of routine diagnostic proce dures to investigate these fatal cases.

PAGE 165

140 Figure 3-2 BOL-Tampa Diagnostic Testing Algorithm for Detect ion of Arbovirus Antibodies in Sentinel Chicken Sera Sentinel chicken sera were first scre ened in the HAI antibody test with flavivirus and alphavirus group antigens. Positive sera were confirmed using the MAC-ELISA with WNV, SLEV, or EEEV antigens. MACELISA negative or equivocal sera were tested in the PRNT for WNV and SLEV or EEEV and HJV. In 2006, HAI flavivirus group positive samples were also tested in the MIA with WNV and SLEV antigens/bead sets. HAI Positive HAI Negative Discard MIA MAC-ELISA Positive WNV, SLEV, EEEV Negative or Equivocal Negative or Equivocal Positive WNV & SLEV Positive WNV & SLEV EEEV & HJV Negative Discard PRNT Sentinel Chicken Sera

PAGE 166

141 Wildlife Rehabilitation Centers In March 2006, wildlife rehabilitation centers were contacted by email through the Florida Wildlife Rehabilitators Associat ion (FWRA) and requested to collaborate in the study. Wildlife rehabilitation centers r outinely perform medical examinations and diagnosis of injured, orphaned or diseased wild life, including birds. These agencies also provide treatment for these animals, incl uding medication, physical therapy, feeding, husbandry, and pre-release conditioning, with the ultimate goal of releasing each into its natural habitat. However, most of the anim als received at rehabil itation centers are sick or injured not because of natural causes, but because of accidental or intentional human intervention (FWRA, 2007). Five wildlife rehabilitation centers agreed to particip ate in the study (see Table 35). Three of the five centers specialized in wild bird reha bilitation, including seabirds and birds of prey. Previous studies have found that these wild bird species can be infected with arboviruses (Spalding et al 1994; Nemeth et al 2007). In this study, 64 birds were sampled during routine medical exams performed upon admission to each center. Sites, Symptoms and Sample Collection The collaborating wildlife re habilitation centers were located throughout the state of Florida (see Table 3-4 for locations). Since many birds admitted to rehab centers are not injured or ill because of natural cause s (e.g. arboviral infection), sample collection criteria were established to mi nimize waste of resources. Criteria used for triage of birds for admission to this study included: 1) species (known amplifying hosts) [Komar et al 2003]; 2) symptoms indicative of arbovi ral infection (e.g. le thargy, shaking and convulsions, anorexia, wei ght loss, etc) [Komar et al 2003; Brault et al 2004]; and 3)

PAGE 167

142 recent admission (swab cloaca within 1-2 days of admission). Complete Sample Collection Criteria for Wild Bi rds are shown in Appendix B. Targeted Sampling Strategy (Sentinel Chickens) Elevated arboviral activity (especially flaviviral) was detected in sentinel chicken flocks in both 2005 and 2006. County agencies with confirmed arboviral transmission sites based on sentinel surveillance te st results (HAI, MAC-ELISA, MIA) were immediately contacted and reque sted to participat e in this study. Arbovirus transmission activity was detected at several sites in each participating county; a nd two to six sites per county were sampled weekly. At the positive sites targeted for arboviral detection/isolation, a ll sentinel chickens that had not yet sero converted in a flock (site) were sampled for up to two months following the initial sentinel seroconversi on. Cloacal swabs and blood samples were collected from each bird during the weekly scheduled bleeding of the flocks (2005); however, blood sampling was discontinued and only cloacal swabs were collected in 2006. Cloacal swabs were collecte d twice each week (2-3 da ys apart), county personnel and resources permitting. In general, most counties swabbed the sentinels once a week. Complete Sample Collection Criteria for Sentinel Chickens are li sted in Appendix B. Targeted Sentinel Sampling Sites (2005) In 2005, sentinel sites were targeted in Manatee, Orange and Sarasota counties based on weekly seroconversion test result s (HAI, MAC-ELISA, PRNT). Table 3-5 lists sentinel chicken sites located in each count y and type of arbovirus transmission activity (WNV, SLEV, EEEV, and/or HJV) detected by se ntinel chicken seroco nversions at each

PAGE 168

143 Table 3-5 County Sentinel Chicken Site s & Arbovirus Transmission (2005) Counties maintained sentinel chicken flocks located at sites scattered throughout each county. Sentinel chic ken seroconversions (development of virus-specific antibodies) i ndicated the presence of arbovirus transmission activity (WNV, SLEV, EEEV, and/or HJV) in the area. Sentinel Chicken Sites and Arbovi rus Transmission Activity (2005) County All Sites WNV+ SLEV+ EEEV+ HJV+ Manatee 001 002 003 006 007 008 009 010 011 012 013 014 015 001 002 003 006 008 010 011 012 013 014 015 002 003 008 Not Detected Orange 001 002 003 004 005 006 007 008 Not Detected Not Detected 001 004 005 006 007 008 004 006 Sarasota 001 002 003 004 005 006 007 008 009 010 011 002 003 004 005 007 009 010 011 008 006 Not Detected

PAGE 169

144 location. Figures 3-3 (Manatee County), 3-4 (Orange County) and 3-5 (Sarasota County) indicate the location of the sentinel chicken flocks (s ites) and confirmed arbovirus activity detected at each site. Targeted Sentinel Sampling Sites (2006) In 2006, sentinel sites were targeted in Orange and Sarasota counties based on confirmed weekly seroconversion data (HAI, MAC-ELISA, PRNT) and on experimental MIA results for Lee, Pasco, and Volusia coun ties. Table 3-6 lists the sentinel chicken sites located in each county and the type of arbovirus transmission activity (WNV, SLEV, EEEV, and/or HJV) detected by confir med sentinel chicken seroconversions at each location; experimental MIA data not shown. Figures 3-6 (Lee County), 3-7 (Orange), 3-8 (Pasco), 3-9 (Sarasota) and 3-10 (Volusia) indicate the location of the sentinel chicken flocks (site s) and confirmed arbovirus activ ity detected at each site. Field Sample Collection Blood and Cloacal Swabs In the field, two drops of blood (~0.2 ml) from the specimen collected as part of routine sentinel surveillance were added to each of two pre-labeled sterile 1.5 ml microcentrifuge tubes containing: 1) 0.56 ml lysis buffer plus carrier RNA (10 g/ml) and 2) 1 ml of Biology Field Diluent (BFD ) for each sentinel chicken sampled. Blood samples were briefly mixed. Blood sa mples were collected in 2005 only. For sentinel chickens and w ild birds, swabs of the cloacae were taken with viral culturettes (Becton Dickinson, Cat. N o. 261514 in 2005 or Cat. No. 220221 in 2006), such that the cotton applicator tips were thor oughly wetted. All specimen s were placed in

PAGE 170

145 Figure 3-3 Manatee County Sentinel Chicken Sites and Arbovirus Activity (2005) Sentinel chicken sites are shown as triangle shapes ( ) on the map. Sites that experi enced arbovirus activity (EEE, SLE, or WN) during 2005 are shown on the map (* = W NV, circled triangles = SLEV, and square boxes = EEEV activity). SLEV was detected at S ite 015. Two sites (002, 003) had both WN V and EEEV confirmed transmission in those regions in 2005.

PAGE 171

146 Figure 3-4 Orange County Sentinel Chicke n Sites and Arbovirus Activity (2005) Sentinel chicken sites are shown as triangle shapes ( ) on the map. Sites that experi enced arbovirus activity (EEE, SLE, or WN) during 2005 are shown on the map (* = W NV, circled triangles = SLEV, and square boxes = EEEV activity). The majority of sites e xperienced confirmed EEEV activity, with three sites with both WNV and EEEV transmission in 2005.

PAGE 172

147 Figure 3-5 Sarasota County Sentinel Chic ken Sites and Arbovirus Activity (2005) Sentinel chicken sites are shown as triangle shapes ( ) on the map. Sites that experi enced arbovirus activity (EEE, SLE, or WN) during 2005 are shown on the map (* = W NV, circled triangles = SLEV, and square boxes = EEEV activity). SLEV activity was detected at one site (008) in the northwestern region of the county in 2005.

PAGE 173

148 Table 3-6 County Sentinel Chicken Site s & Arbovirus Transmission (2006) Counties maintained sentinel chicken flocks located at sites scattered throughout each county. Confirmed se ntinel chicken seroconversions (development of virus-specific antibodies) indicated the presence of arbovirus transmission activity (WNV, SLEV, EEEV, and/or HJV) in the area. Sentinel Chicken Sites and Arbovi rus Transmission Activity (2006) County All Sites WNV+ SLEV+ EEEV+ HJV+ Lee 001 002 003 004 005 006 007 008 009 010 011 012 013 014 015 016 017 018 002 002 003 005 008 010 013 014 Not Detected Not Detected Orange 001 002 004 005 006 007 008 000HP Not Detected Not Detected 001 004 006 Not Detected Pasco 001 002 003 004 005 006 007 001 Not Detected Not De tected Not Detected

PAGE 174

149 Table 3-6 County Sentinel Chicken Si tes & Arbovirus Transmission (2006), Continued Counties maintained sentinel chicken flocks located at sites scattered throughout each county. Confirmed se ntinel chicken seroconversions (development of virus-specific antibodies) indicated the presence of arbovirus transmission activity (WNV, SLEV, EEEV, and/or HJV) in the area. Sentinel Chicken Sites and Arbovirus Tr ansmission Activity, Continued (2006) County All Sites WNV+ SLEV+ EEEV+ HJV+ Sarasota 001 002 003 004 005 006 007 008 009 010 011 005 001 004 006 007 Not Detected Not Detected Volusia 001 002 003 004 005 006 007 008 009 010 011 012 013 014 015 016 010 Not Detected 004 010 014 003

PAGE 175

150 Figure 3-6 Lee County Sentinel Chicken Sites and Arbovirus Activity (2006) Sentinel chicken sites are shown as triangle shapes ( ) on the map. Sites that experi enced arbovirus activity (EEE, SLE, or WN) during 2006 are shown on the map (* = W NV, circled triangles = SLEV, and square boxes = EEEV activity). SLEV was detected at seven sites. One site (002) had both WNV and SLEV c onfirmed transmission at that location in 2006.

PAGE 176

151 Figure 3-7 Orange County Sentinel Chicke n Sites and Arbovirus Activity (2006) Sentinel chicken sites are shown as triangle shapes ( ) on the map. Sites that experi enced arbovirus activity (EEE, SLE, or WN) during 2006 are shown on the map (* = W NV, circled triangles = SLEV, and square boxes = EEEV activity). Several sites had c onfirmed EEEV transmission in 2006.

PAGE 177

152 Figure 3-8 Pasco County Sentinel Chicke n Sites and Arbovirus Activity (2006) Sentinel chicken sites are shown as triangle shapes ( ) on the map. Sites that experi enced arbovirus activity (EEE, SLE, or WN) during 2006 are shown on the map (* = W NV, circled triangles = SLEV, and square boxes = EEEV activity). A single site (001) had confirmed WNV transmission in 2006.

PAGE 178

153 Figure 3-9 Sarasota County Sentinel Chic ken Sites and Arbovirus Activity (2006) Sentinel chicken sites are shown as triangle shapes ( ) on the map. Sites that experi enced arbovirus activity (EEE, SLE, or WN) during 2006 are shown on the map (* = W NV, circled triangles = SLEV, and square boxes = EEEV activity). Four sites (001, 004, 006, 007) had SLEV transmission in 2006.

PAGE 179

154 Figure 3-10 Volusia County Sentinel Chic ken Sites and Arbovirus Activity (2006) Sentinel chicken sites are shown as triangle shapes ( ) on the map. Sites that experi enced arbovirus activity (EEE, SLE, or WN) during 2006 are shown on the map (* = W NV, circled triangles = SLEV, and square boxes = EEEV activity). Three sites (0 04, 010, 014) had EEEV transmission in 2006. Site 010 also had confirmed EEEV activity.

PAGE 180

155 coolers on ice packs during samp le collection and transport from the sites, and then stored at -70C until shipment to the Florida Department of Health, BOL-Tampa laboratory for testing. Samples were shipped to the laboratory with dry ice overnight. To conserve resources, samples were pr ocessed retrospectively based on weekly seroconversion data for each chicken, that is, samples were processed if seroconversion was detected after collection date. All bl ood samples and cloacal swabs were processed in a Biosafety cabinet in accordance with laboratory biosafety 2 procedures and regulations. Field Sample Processing Blood Processing Viral RNA was extracted from blood samples in 0.56 ml lysis buffer with QIAamp Viral RNA Mini spin column kits (Qiagen, Cat. No. 52906) following the manufacturers instructions. Blood samples pl aced in 1 ml of BFD were rapidly thawed in a 37C water bath, vortexed for 30 sec onds, and centrifuged in a microcentrifuge at 4,000 x g for 4 minutes, 4C. A 0.2 ml aliquot of the BFD sample was transferred into a sterile 1.5 ml centrifuge tube and stored at -70C for plaque assays. The remainder of the BFD sample (0.8 ml) was directly inoculated in to Vero cell culture as described below. Cloacal Swab Processing The two types of viral culturettes used in this study required different processing procedures. In 2005, viral culturettes (Becton Dickinson, Cat. No. 261514) were processed as following: sterile 12x75mm glass tubes were labeled and 1 ml of Biology Field Diluent (BFD) was added. Cellulose acetate syringe filters, 0.2 um pore size (Nalgene Cat. No. 0974061A), were pretreated w ith inactivated fetal calf serum (FCS).

PAGE 181

156 Swabs were rapidly thawed at 37C and placed in an ice bath for processing. Each swab was immersed in 1 ml of BFD and agitated for approximately 1 minute to release virus and particulate from the swab. The BFD wa s then passed through a pretreated cellulose filter into a sterile 5 ml tube (Falcon, Ca t. No. 352063) to remove bacteria and fecal material. A 0.14 ml aliquot of the filtrate was removed, added to 0.56 ml AVL lysis buffer in a sterile 1.5 ml centrifuge tube, vortexed and stored at 4 C for RNA extraction. An additional 0.2 ml aliquot was transferred into a sterile 1.5 ml centrifuge tube and stored at -70C for plaque assays. The rema inder of the swab sample (0.7 ml) was frozen at -70 C until inoculation onto Vero cell culture. In 2006, viral culturettes (Becton Dickin son, Cat. No. 220221) were processed with a different procedure, as swabs were im mersed in 3 ml media in each culturette. These culturettes also contained small glass beads that assist the release of virus and particulate from the swab when vortexed for 15 seconds. Cellulose acetate syringe filters, 0.2 um pore size, were pretreated with inactiv ated FCS. Swabs were rapidly thawed at 37C and placed in an ice bath for processing. Swabs were vortexed for 15 seconds to release virus and particulate from the swab. A 0.14 ml aliquot of the culture media was removed, added to 0.56 ml AVL lysis buffer in a sterile 1.5 ml centrifuge tube, vortexed and stored at 4 C for RNA extraction by QIAamp Viral RNA Mini kits. Alternatively, a 0.4 ml aliquot of the culture media was rem oved, added to 0.45 ml AVL lysis buffer in a sterile 1.5 ml centrifuge tube, vortexed and stored at 4 C for RNA extraction with the Qiagen M48 Biorobot (Cat. No. 9000708). Ne xt, 1.5 ml of the sample was passed through a pretreated cellulose filter into a ster ile 5 ml tube to rem ove bacteria and fecal material. A 0.2 ml aliquot of the filtrate wa s transferred into a st erile 1.5 ml centrifuge

PAGE 182

157 tube and stored at -70C for plaque assays. The remainder of the swab filtrate (~1.3 ml) was frozen at -70 C until inoculation onto Vero cell culture. Vero Cell Culture and Plaque Assays African Green Monkey Kidney (Vero) cel ls (ATCC, Cat. No. CCL-81, passage 130-140) were seeded into tissue culture si x-well plates (Falcon, Cat. No. 35520), grown in 3 ml/well outgrowth media. Media reag ents and catalog numb ers are provided in Appendix A. Plates were incubated at 37C, 4% CO2 until the cells were approximately 90% confluent (4 days). These plates were used for the PRNT (Schmidt, 1979; Beaty, Calisher and Shope, 1989; Voakes, 2004) and for virus plaque assays (see below). Tissue culture 25 cm2 flasks (Nalgene Nunc International, Cat. No. 156340) were concurrently seeded with Vero cells in 10 ml outgrowth media and incubated at 37C until confluent (4 days). The PRNT is a quantitative assay that requi res precision in pipetting and must be performed under stringent biosafety requirements (Beaty et al 1989). A protocol developed 30 years ago at the CDC is sti ll in use today, with minor modifications (Lindsey et al 1976). Briefly, a virus stock is titrated so that the challenge virus contains approximately 200 PFU/0.1 mL (plaque forming un it). Test sera are inactivated (56C for 30 min) to destroy endogenous complement and are serially diluted two-fold in Serum Virus Diluent (SVD) [see Appendix 1 for vendors, reagents and recipes for cell culture medias] and then combined with an equal vol ume of challenge virus diluted in the same media plus labile serum factor (Beaty et al 1989; Chappell et al 1971). The serum-virus mixtures are incubated overnight at 4C befo re 100 l of this mi xture (containing 100 PFU) is inoculated onto Vero cells in six-well plates. Af ter a one hour adsorption period,

PAGE 183

158 cells are overlaid with media solidified with agarose. Timing of the second overlay with the vital dye is virus specific and depends on the incubation period for each virus. Plaques are counted and serum antibody titers are determined based on specified plaque reduction levels, commonly 80, 90, or 95% (Beaty et al 1989). Prior to inoculation, cell monolayers in 25cm2 flasks were washed with 6 ml of Earles Balanced Salts (EBSS) (Sigma, Cat. No. E-6132). A micropipette was used to inoculate approximately 0.8 ml of the proce ssed BFD blood and/or cloacal swab sample onto the Vero cell monolayer in 25cm2 flasks. The processed blood and/or cloacal swab filtrates were removed from -70 C and rapidly thawed at 37 C immediately prior to inoculation. Samples were inoculated onto the Vero cell monolayer in 25cm2 flasks using a sterile 1 ml pipet. The flasks were rocked at 37 C for 2 hours and fed with 10 ml liquid maintenance media (see Appendix A). Cultures were incubated at 37 C and cell monolayers were examined daily by microsc ope for evidence of cytopathology (cpe) for fourteen days. Flavivirus positive samples exhibited char acteristic cpe between 5 to 8 days post-infection, including round, suspended clusters or single cells as the cells detached from the monolayer (Schmidt, 1979). Positive cultures were confirmed by RTPCR methods (see below) for the identification of the infectious agent. Once a positive cell culture had been identified by molecular assay (e.g. WNV, SLEV, EEEV), viral plaque assa ys were performed on the stor ed (reserved) samples of swab filtrate (0.2 ml) or blood filtrate (0.2 ml ) to quantify the amount of virus present in the swab and/or blood samples. Viral plaque assays were executed in six-well plates with a method previously described (Lindsey, Ca lisher and Mathews, 1976), as modified by Beaty, Calisher and Shope (1989) for six well plates. Briefly, 0.2 ml aliquots of the

PAGE 184

159 filtered cloacal swab sample and BFD blood sample were rapidly thawed at 37 C. A 0.1 ml portion of each sample was serially diluted to 10-5 in serum virus diluent (SVD) [reagents found in Appendix A]. Media was aspirated from the Vero cell monolayer leaving approximately 0.05 ml of media per well. Plates we re inoculated with 0.1ml of each sample dilution, one dilution per well. An undiluted 0.1 ml portion of the sample was also inoculated into one well. Plates were incubated for 1 hour in a 37C, 4% CO2 incubator, and were rocked every 10 minutes Media agarose overlay s were performed as described (Beaty, Calisher and Shope, 1989), with second neutral re d overlays performed at different virus incubati on periods (WNV 3 DPI, SLEV 7 DPI, and EEEV 2 DPI). After the addition of a neut ral red second overlay, plates were incubated at 37C overnight, then inspected on a light box and plaques counted on two consecutive days. Media-agarose overlay reagents are provided in Appendix A. Neutralization assays were also conducted on positive cloacal swab virus isolates to verify the infectious agent. WNV-speci fic polyclonal antibodies (Cat. No. 0069) and SLEV-specific polyclonal antibodies (Cat. No. 0055) were obtained from the CDC, Fort Collins for use in the PRNT. These antibodies were diluted in SVD (1:10), heat inactivated at 56C for 30 minutes, serially titrated and challenged with an equal volume of control virus (SLEV TBH 28 or WNV E g101) containing ~ 200 pfu/0.1 ml. These virus-antibody mixtures were in cubated overnight at 4C and then inoculated into Vero 6-well plates for plaque reduction neutralization assays to determine the 95% neutralization end-point of each antibody. Serial dilutions (10-1 to 10-6) of cloacal swab virus isolates (passaged once in Vero cel ls) were challenged with the appropriate

PAGE 185

160 concentration of polyclonal an tibody (1:100 for WNV, 1:20 for SLEV) and plaque assays performed, as described above. Individual plaques (clones) for all cloacal swab virus isolates were picked from 6-well Vero plates and suspended into 1 ml of SVD. A portion of the SVD (0.14 ml) was removed, added to 0.56 ml AVL lysis buffer in a sterile 1.5 ml centrifuge tube, vortexed and stored at 4 C for RNA extraction. The remainder of the SVD (0.8 ml) was added to 25cm2 Vero flasks. The flasks were rocked at 37 C for 2 hours, and then fed with 10 ml maintenance media (Appendix A). Cultures were incubated at 37 C and cell monolayers were examined daily by microscope for ev idence of cytopathology (cpe) for fourteen days. After RNA extraction of the 0.14 ml a liquots, clones were confirmed with realtime (TaqMan) RT-PCR assays. Figure 3-11 illustrates the complete testing algorithm for cloacal swabs. Nucleic Acid Extraction Viral RNA was extracted from blood samples and cloacal swab samples with QIAamp Viral RNA Mini spin column kits (Qiagen, Cat. No. 52906) or a BioRobot M48 (Qiagen, Cat. No. 9000708) with MagAttract Virus Mini M48 kits (Qiagen, Cat. No. 955336). A 0.14 ml or 0.4 ml aliquot from each sa mple was added to 0.56 ml or 0.45 ml AVL lysis buffer, respectively. All samples we re processed according to manufacturers instructions and RNA was eluted from the membrane in 0.06 ml elution buffer (QIAamp Viral RNA Mini Kits) or from magnetic beads in 0.1 ml el ution buffer (MagAttract Viral RNA M48 Kits) into sterile 1.5 ml centrifuge tubes. The RNA sa mples were stored at -70 C until amplification and detection by real-time or end-point RT-PCR.

PAGE 186

161 Figure 3-11 Diagnostic Algorithm for the Isolation and Detection of Arboviruses from Cloacal Swabs Cloacal swabs were processed for both ce ll culture (left side of flowchart) and molecular assays (right side of flowchart). Inoculat ion of a portion of the sample into cell culture allows for the growth and isolation of arboviruses, which can be identified using molecular RT-PCR assays. Each sample was also lysed for RNA extraction followed by RT-PCR amplification/detection te sts, using a panel of ar bovirus-specific primer sets. Positive samples were confirmed through nucleotide sequencing. Plaque Assay Real Time RT-PCR End Point RT-PCR Discard Pick Clones Real Time RT-PCR Discard Cloacal Swab Testing Algorithm Filter Inoculate 1 ml 25 cm2 bottle Freeze 0.2 ml Discard Choose Negative Negative Positive RNA Extraction Positive Negative Nucleotide Sequencing Cloacal Swab Molecular Assay Virus Detected 0.14 ml + 0.56ml AVL Buffer 0.4 ml + 0.45ml AVL Buffer RNA Extraction Viral RNA Mini Kit BioRobot M48 Positive Negative Discard Positive Virus Detected Negative 0.14 ml + 0.56ml AVL Buffer Inoculate 1 ml 25 cm2 bottle Positive Cell Culture Virus Isolated Virus Isolated

PAGE 187

162 Viral RNA was extracted from positive Vero cell cultures (passage 1) with QIAamp Viral RNA Mini spin column kits. A 0.14 ml aliquot from each culture was added to 0.56 ml AVL lysis buffer (AVL). All samples were processed according to manufacturers instructions and RNA was eluted from th e membrane in 0.06 ml elution buffer into sterile 1.5 ml centrifuge tubes. The RNA samples were stored at -70 C until amplification and detection by real-time and end point RT-PCR. Figure 3-12 illustrates the nucleic acid extraction pro cedure with these two methods (Viral RNA Mini Spin kits or MagAttract Viral RNA M48 kits), followed by amplification/detection, in a flow chart. Nucleic Acid Amplification and Detection RNA was amplified in a one-step revers e transcriptase-polymerase chain reaction (RT-PCR) procedure for both real-time and e nd-point reactions. Oligonucleotide primers were obtained from Operon (Alameada, CA) as lyophilized powders and were rehydrated in 1 ml (primers) or 0.1 ml (probe s) RNase/DNase free water upon receipt. 100 M (real-time primers), 200 M (end-point primers) and 25 M (real-time probes) working dilutions were prepared, aliquoted in 20 l volumes and stored at -20C to eliminate excessive freeze/thaws of stock solu tion. Primer sets and probes are shown in Table 3-7 (WNV), Table 3-8 (SLEV ), and Table 3-9 (universal flavivirus ), as described in previous studies (cit ations provided below). Target regions on the flaviviral RNA genome and amplicon product sizes are indi cated in Figures 3-13 (WNV), Figure 3-14 (SLEV) and Figure 3-15 (flavivirus ). Real-Time Reverse Transcriptas e-Polymerase Chain Reaction Arboviral RNA was amplified and detected using TaqMan technology on ABI Prism7000 or 7500 Sequence Detectors (Applied Biosystems, Foster City, CA), in 2005

PAGE 188

163 Figure 3-12 Molecular Diagnos tic Testing Algorithm for Detection of Arboviruses Virus nucleic acids were extracted from samples with Qiagens Viral RNA Mini Spin kits or BioRobot M48. Samples were screened in real-time RTPCR (TaqMan) assays, with a specific primer set (A) for WNV, SLEV, or EEEV. Positive samples were confir med with a second virus-specific primer set (B) in real-time RT-P CR and/or end-point RT-PCR assays. End-point RT-PCR products were excise d from an 1% agarose-EtBr gel, cleaned and prepared for nucleotide sequencing. Sample Real Time RT-PCR Discard BioRobot M48 0.1ml RNA Lysis RNA Extraction Amplification TaqMan primer set "A" Positive Negative Detection TaqMan primer set "B" Choose 0.14ml + 0.56ml AVL Buffer 0.4ml + 0.45ml AVL Buffer Viral RNA Mini Spin Kit Positive Negative Nucleotide Sequencing End Point RT-PCR 1% Agarose Gel Detection Excise & Clean Bands Positive Discard Negative 0.06 ml RNA

PAGE 189

164 or 2006, respectively. West Nile virus (Lanciotti et al 2000) [see Table 3-7], St. Louis encephalitis virus (Lanciotti and Kerst, 2001) [see Table 3-8], and Eastern equine encephalitis virus (Lambert, Martin and Lanciotti, 2003) specific TaqMan primer-probe sequences were used as previously described. Two primer-probe sets (targeting different regions of the viral genome) were used for each virus. A primer/probe sets were used to screen samples and B primer/probe sets confirmed positive samples for each virus (WNV, SLEV or EEEV) per CDC recommendati ons (CDC, 2003A). Positive, negative extraction and amplification controls were in cluded with each run. Figure 3-12 illustrates the molecular diagnostic testing algorithm used by the BOL-Tampa. One-step TaqMan RT-PCR master mix (Applied Biosystems, Cat. No. 4309169) was prepared for each primer/probe set on ice. RT-PCR master mix reagent volumes varied depending on whether the ABI Pris m 7000 or 7500 Sequence Detector was used (see Appendix AV for real time RT-PCR master mix components and cycling profiles). In a 96-well plate (Applied Biosystems, Cat. No. 4302109), 45 l of RT-PCR master mix and 5 l of sample RNA were combined for a total reaction volume of 50 l for the ABI 7000 system. However, the ABI 7000 system was only used in 2005. Alternatively, 20 l of RT-PCR master mix and 5 l of sample RNA were combined for a total reaction volume of 25 l in a 96-well plate (Applied Biosystems, Cat. No. 4346906) for use in the ABI 7500 system (instrument used during 2006). The plate was loaded into the appropriate ABI sequence detector for temperature cycling and detection. Samples were considered positive for WNV, SLEV or EEEV if they exhibited CT counts at 40 or below and a valid multicomponent split with both A and B primer/probe sets. However,

PAGE 190

165 Table 3-7 WNV Oligonucleotide Primers and Probes used in Real Time (TaqMan) and End Point RT-PCR Assays The TaqMan primer/probe set WN3NC was named WNA at the BOL-Tampa and used to screen all samples for detection of WNV. Positive samples were confir med with the WNB primer/probe set (WNENV). End point RT-PCR was conducted on TaqMan-positive samples to generate a larger amplicon for sequencing (WN233-640c was named WNAE). Real Time and End Point RT-P CR Primers & Probes for WNV Primer Sequence (5 3) Genome Positionb Platform Name & Reference Product Size WN3NC F WN3NC R WN3NC P WNENV F WNENV R WNENV P WN233 F WN640c R CAG-ACC-ACG-CTA-CGG-CG CTA-GGG-CCG-CGT-GGG CTG-CGG-AGA-GTG-C AG-TCT-GCG-AT-BHQ TCA-GCG-ATC-TCT-CCA-CCA-AAG GGG-TCA-GCA-CGT-TTG-TCA-TTG TGC-CCG-ACC-ATGGGA-GAA-GCT-C-BHQ TTG-TGT-TGG-CTC-TCT-TGG-CGT-TCT-T CAG-CCG-ACA-GCA-CTG-GAC-ATT-CAT-A 10668-10684 10770-10756 10691-10714 1160-1180 1209-1229 1186-1208 233-257 640-616 TaqMan RT-PCR TaqMan RT-PCR End Point RT-PCR WNA WNB WNAE 103 bp 70 bp 408 bp F = forward (sense) primer, R = reverse (anti-sense) primer, P = probe. Primer sequences published by Lanciotti et al (2000). Probes adapted with black hole quenchers (BHQ) to enhance sensitivity (Lanciotti, personal communication, 2007). bWest Nile virus-specific genome positions are according to WNV NY99 sequence in GenBank (Accession Number AF196835).

PAGE 191

166 Figure 3-13 Amplicons Generated by WNV Primers for RT-PCR and Sequencing Location of amplicons on the flavivirus genome. Primers anneal to the fla nking sides and lines represent three expected amplicons generated from WNV real-time and end point RT-P CR assays. End point RT-PCR products (WNAE primer set) were sequenced. F = forward (sense) primer, R = reverse (anti-sense) primer, P = probe. 5'NC PrM/M E NS1 NS2A/B NS3 NS4A/B PrM/M EWNB-F WNB-P WNB-R WNAE-R NS5 C 3'NC 70 bp Name Genome Position WNAE-F408 bp C WNA-F 3'NC WNA-P WNA-R 103 bp NS5 WNBE-F WNBE-R312 bp WNA-F 10668 WNA-R 10770 WNA-P 10691 WNB-F 1160 WNB-R 1209 WNB-P 1186 WNAE-F 233 WNAE-R 640 WNBE-F 9483 WNBE-R 9794

PAGE 192

167 Table 3-8 SLEV Oligonucleotide Primers and Probes used in Real Time (TaqMan) and End Point RT-PCR Assays TaqMan primer/probe set SLE834/905c was named SLEA at the BOL-Tampa and used to screen all samples for detection of SLEV. Positive samples were confirmed with the SLEB primer/probe set (SLE2420/2487c). End point RT-PCR was conducted on TaqMan-positive samples to generate a larger amplicon for sequencing (SLE727/1119c was named SLEC; envelope region of 1700 bp was sequenced with primers F880 through B2586). Real Time and End Point RT-P CR Primers & Probes for SLEV Primer Sequence (5 3) Genome Position Platform Name & Reference Product Size SLE834 F b SLE905c R SLE857 P SLE2420 F b SLE2487c R SLE2444 P SLE727 F b SLE1119c R F880 F c F1390 F B1629 R F1990 F B1993 R B2586 R GAA-AAC-TGG-GTT-CTG-CGC-A GGT-GCT-GCC-TAG-CAT-CCA-TCC TGG-ATA-TGC-CCT-AGT-TGC-GCT-GGC-BHQ CTG-GCT-GTC-GGA-GGG-ATT-CT TAG-GTC-AAT-TGC-ACA-TCC-CG TCT-GGC-GAC-CAG-CGT-GCA-AGC-CG-BHQ GTA-GCC-GAC-GGT-CAA-TCT-CTG-TGC ACT-CGG-TAG-CCT-CCA-TCT-TCA-TCA CGA-TTG-GAT-GGA-TGC-TAG-GTA-G GTG-CAT-GGT-TCA-ACG-GAC-TCT-AC GGT-TCA-AGT-CGT-GAA-ACC-AGT-C CTG-CAA-ACC-TCA-TGG-ATT-TGA-CAC-C GCA-GTC-ACG-GAG-ATG-GGA-ACT-CGG-C CAG-TTG-GAG-TCA-GAG-GGA-AAT-ACT-T 834-852 905-889 857-880 2420-2439 2487-2468 2444-2466 727-750 1119-1096 880-901 1390-1411 1629-1608 1990-2014 1993-1969 2586-2562 TaqMan RT-PCR TaqMan RT-PCR End Point RT-PCR End Point RT-PCR + Direct Internal Sequencing SLEA SLEB SLEC F880 F1390 B1629 F1990 B1993 B2586 72 bp 68 bp 393 bp 750 bp 1700 bp F = forward (sense) primer, R = reverse (anti-sense) primer, P = probe. St. Louis encephalitis virus-specific genome positions are according to SL EV MSI-7 sequence in GenB ank (Accession Number M1661 4). bPrimer sequences published by Lanciotti and Kerst (2001). Probes adapted with black hole quenchers (BHQ) [Lanciotti, personal commun, 2007]. cRT-PCR and sequencing primers published by Kramer and Chandler (2001).

PAGE 193

168 Figure 3-14 Amplicons Generated by SL EV Primers for RT-PCR and Sequencing Location of amplicons on the flavivirus genome. Primers anneal to the fla nking sides and lines represent five expected amplicons generated from SLEV real-time and end point RT-P CR assays. End point RT-PCR products (SLEC, F880 through B2586 primer sets) were sequenced. F = forward (sense) primer, R = reverse (anti-sense) primer, P = probe. 5'NC C E NS1 NS2A/B NS3 F880-FB1390-F NS4A/B PrM/M 3'NC NS5SLEA-R SLEA -F SLEC-R 72 bp B1629-R393 bp SLE C-F NS1 E 750 bp PrM MB1993-R F1990-F SLEA-P SLEB-P SLEB-R SLEB-F 68 bp B2586-R 1700 bp Genome Position SLEA-F 834 SLEA-R 905 SLEA-P 857 SLEB-F 2420 SLEB-R 2487 SLEB-P 2444 SLEC-F 727 SLEC-R 1119 F880-F 880 F1390-F 1390 B1629-R 1629 F1990-F 1990 B1993-R 1993 B2586-R 2586 Name

PAGE 194

169 Table 3-9 Flavivirus Oligonucleotide Primers and Probes used in End Point RT-PCR Assays End point RT-PCR was conducted on TaqMan-positive samples (WNV and SLEV) to generate a larger amplicon for sequencing. A portion of the NS5 region wa s amplified with the FU1/cFD3 primer set (named NS5 at the BOL-Tampa), which generated a product size of ~1 kb for both WNV and SLEV. The YF1/YF2 primer set (named YF) targeted the 3UTR with an overlap in the NS5 gene and generated different sized products, 700 bp or 600 bp, for WN V and SLEV, respectively. End Point RT-PCR Primers for Flaviviruses Primer Sequence (5 3) Genome Positionc, d Platform Name & Reference Product Size FU1 F cFD3 R YF1 F b YF2 R TAC-AAC-ATG-ATGGGA-AAG-AGA-GAG-AA AGC-ATG-TCT-TCC-GTG-GTC-ATC-CA GGT-CTC-CTC-TAA-CCT-CTA-G GAG-TGG-ATG-ACC-ACG-GAA-GAC-ATG-C 8993-9018 10077-10055 10052-10070 10709-10685 End Point RT-PCR End Point RT-PCR NS5 YF 1 kb (WN & SLE) WN: 700 bp SLE: 600 bp F = forward (sense) primer, R = reverse (anti-sense) primer. Primer sequences published by Kuno et al (1998). bPrimer sequences published by Tanaka (1993). c FU1/cFD3 primer genome positions are according to YF virus sequence in GenBank (Accession Number K0274). dYF1/YF2 primer genome positions are according to YF 17D vaccine strain (taxa: 11090).

PAGE 195

170 Figure 3-15 Amplicons Generated by Universal Flavivirus Primers for RT-PCR and Sequencing Location of amplicons on the flavivirus genome. Primers anneal to the fl anking sides and lines represent two expected amplicons generated from universal flavivirus end point RT-PCR assays. End point RT-PCR products (NS5 and YF primer sets) were sequenced. F = forward (sense) primer, R = revers e (anti-sense) primer, P = probe. 5'NC C PrM/M E NS1 NS2A/B NS3 3'NC NS5 NS4A/B YF2-R NS5 3'NC FU1-F cFD3-R YF1-F Genome Position FU1-F 8993 cFD3-R 10077 YF1-F 10052 YF2-R 10709 Name1000 bp ~700 bp

PAGE 196

171 positive samples with a single TaqMan primer/probe set were further tested with end point RT-PCR primer sets (see below) for confirmation. End Point Reverse Transcriptase-Polymerase Chain Reaction Several previously published primer sets were used in end point RT-PCR reactions to amplify and sequence SLEV, incl uding the complete envelope (Kramer and Chandler, 2001) and partial membrane (Lanci otti and Kerst, 2001) regions (see Table 39). For WNV, a portion of the capsid region was amplified and sequenced with primer set WN233-640c published by Lanciotti et al (2000) [see Table 3-8]. Universal flavivirus primer sets were used to generate amplic ons for sequencing both SLEV and WNV strains (see Table 3-10). These included a primer se t (FU1/cFD3) targeting the partial NS5 region (Kuno et al 1998) and another set (YF1/YF2) th at targets the 3 UTR, with a slight overlap in the NS 5 region (Tanaka, 1993). Arboviral RNA was amplified for subseque nt nucleotide sequencing using the SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity polymerase (Invitrogen, Cat. No. 12574-035). This system allowed for amplification of longer templates with improved fidelity due to the Platinum Taq high fidelity enzyme mix, which includes a proof-reading en zyme with 3 to 5 exonucl ease activity to repair base mismatches. RT-PCR master mix was prepared for each primer set on ice following the manufacturers instru ctions. In 0.2 ml thin walled P CR tubes (Molecular BioProducts, Cat. No. 3412), 48 l of RT-PCR master mix and 2 l of sample RNA were combined for a total reaction volume of 50 l. Thermal cycling was performed in a GeneAmp PCR System 9700 thermal cycler (Applied Bios ystems, Foster City, CA). Positive and

PAGE 197

172 negative controls were included with each run. See Appendix AV for end point RT-PCR master mix components and cycling conditions. Detection of End Point RT-PCR Products All end point RT-PCR products were visu alized via gel electrophoresis, with 1% agarose gels (0.435g NuSieve agar [Cambrex, Cat. No. 50090], 0.215g SeaKem agar [Cambrex, Cat. No. 50004], 65ml 1X TAE [F isher, Cat. No. BP13324, 50X solution], 8 l 1% ethidium bromide [Fisher, Cat. N o. BP1302-10]). Electr ophoresis was conducted at 120mV for approximately fort y five minutes with 10 l lane marker (Promega: 1 kb ladder, Cat. No. G316A; 10 kb ladder, Cat. No. G754A). Sample Preparation for Nucleotide Sequencing Bands of the correct amplicon size were excised from the gels with scalpels. Bands were placed in 1.5ml microfuge tubes and weighed using an analytical balance (Mettler, Cat. No. AE260). These amplification products were then cleaned with QIAquick Gel Excision kits (Qiagen, Cat. No. 28706) following the manufacturers instructions. Nucleic acid was eluted in 0.1 ml Buffer EB (included in kit). Cleaned products (5l) were analyzed on a second 1% agarose gel along with 2l and 4l lane marker in order to provide a rough estimat e of dsDNA concentration. Approximately 5ng to 20ng of dsDNA template was added to th e sequencing reaction for each sample. Sequencing reactions were performe d in replicate for each sample. Nucleotide Sequencing Sequencing reactions were performed w ith DTCS Quick Start kits (BeckmanCoulter, Cat. No. 608126). Twenty microliter sequencing reactions were prepared in 96well plates (Beckman-Coulter, Cat. No. 609801) and thermal cycling was performed in a

PAGE 198

173 GeneAmp PCR System 9700 thermal cycler (A pplied Biosystems, Foster City, CA). Master mix and cycle parameters for sequenc ing are shown in Appendix AV. A reaction stop solution consisting of glycogen (supplied in kit at 20mg/ml), 100mM EDTA (Sigma, Cat. No. E-7889, 0.5 M solution), and 3M Sodium Acetate (Sigma, Cat. No. S7899) was combined in a 1:2:2 rati o. 5 l of this stop solutio n was added to all wells to ensure termination of sequencing PCR pr oduct extension. Well c ontents were then ethanol-precipitated to remove salts. One wash was performed with cold 95% ethanol (stored @ -20C) prior to centrifugation at 6,000 x g for 5 minutes. Two additional washes with cold 70% ethanol (stored @ -20 C ) were followed by two centrifugations at 6,000 x g for 3 minutes. Samples were allowed to air-dry for 10 minutes and then 40 l SLS solution (supplied in kit) was added to each well. After 10 minutes incubation at room temperature, plates were vortexed lightly and each well was overlayed with mineral oil (included in kit). Nucleotide sequencing of RT-PCR amplicons was performed with a Beckman-Coulter (Fullerton, CA) CEQ8000 Automated Sequence Analysis System (Cat. No. 285501), in accordance with the manufact urers protocol. Plat es were added to instrument and run was initiated. Method LFR (long fragment read) was used for all runs. Additional sequencing reacti ons for the complete envelope and NS5 regions of historical SLEV isolates were performed by the H. Lee Moffitt Cancer Center molecular biology core facility. Complete genome maps of FLS545 and FLS569 isolates (excluding 5 and 3 non-coding regions) were as sembled at the University of Alabama at Birmingham (UAB), with nucleotide seque ncing reactions performed at the UAB molecular genetics core facility.

PAGE 199

174 Sequence Analysis The basic local alignment search tool (BLAST) was used to identify virus subtypes. BLAST utilizes a freely available sequence database at the following URL: http://www.ncbi.nlm.nih.gov/BLAST. Briefly, this program compares user submitted sequence data (nucleotide, BL ASTn, or protein, BLASTp) against an extensive database commonly referred to as GenBank. Sequences obtained were queried against GenBank and evaluated for accuracy. Sequences for isol ates evaluated for the first time in this study were submitted to GenBank and provide d unique identifiers, known as Accession Numbers. Sequence data was exported to the Seqman II module of the Lasergene software suite, version 5.08 (DNAStar, Madison, WI) as .scf files. These files contain raw sequence data and the analyzed base calls data for each sequencing reaction. Contigs were assembled in the SeqmanII module, wh ich are consensus sequences derived from bi-directional sequencing using both the forward (sense) and reverse (anti-sense) primers. This provides a level of quali ty control and allows for be tter coverage of the amplicon region. Assembled contigs were saved as .seq files for use in all modules of Lasergene. In addition, large amplicons (greater than 700bp) were assembled with overlapping fragments to generate a consensus sequence in both the forward and reverse directions. Overlapping fragments were necessary to ge nerate a complete contig for the 1633 bases analyzed in the SLEV envelope region. Contigs were converted to GCG format (.msf files) using Megalign (DNAStar) and exported for use in the multiple sequence alignment program MEGA 4.0.1. Multiple sequence alignments were performed in MEGA4.0.1 using the ClustalW 1.6 method.

PAGE 200

175 Clustal W 1.6 was also used in the MEGA (m olecular evolutionary genetic analysis) module, a free software program (v ersion 4.0.1) downloaded from URL: http://www.megasoftware.net/ (Tamura et al 2007). ClustalW is a progressive pair-wise alignment algorithm, which aligns homologous bases and inserts gaps where homology is not present. Phylogenetic Analysis Multiple sequence alignments were used to create phyloge netic trees. The Megalign module automatically constructs a phylogenetic tree when an alignment is produced. In addition, MEGA (molecular evolutionary genetic analysis) was downloaded from URL: http://www.megasoftware.net/. This free software program allows the user to specify preferences (feature not available in the MegAlign module). Additional complete flavivirus sequences were downloaded from GenBank for use as outgroups. Phylogenetic trees were computed in MEGA4.0.1 to infer th e evolutionary relati onships of SLEV and WNV strains. Neighbor-joining, maximum parsimony, and unweighted paired group means arithmetic (UPGMA) methods were used to construct trees, with 1000 bootstrap replicates performed for each tree method. The consensus tree was chosen. Neighborjoining and maximum parsimony trees were used where a constant rate of evolution is not assumed unlike the UPGMA (Unweight ed paired group mean arithmetic) tree method. Phylogenetic trees from these methods were evaluated for accuracy of branch points and phyletic clusters.

PAGE 201

176 CHAPTER FOUR RESULTS In Florida, St. Louis encephalitis virus ha s not been isolated in culture since the introduction of West Nile virus. It is unknown what impact the establishment of WNV endemicity will have on the natural history of SLEV. Consequently, this study proposed to isolate arboviruses, especially St. Louis encephalitis virus, fr om naturally exposed birds with a targeted sampli ng strategy. The project inve stigated potential strain differences in current circulating isolates as compared to a historical archive of flavivirus isolates. A network was established for th e isolation and/or molecular detection (RTPCR) of arboviruses in Florida from sentinel chickens and wild birds. Network for Isolation/Detection of Arboviruses in Florida The largest arboviral surveillance program in the United States operates yearround in Florida. However, Floridas surveillance program rarely attempts arbovirus isolation from specimens (e.g. sera) collected from live subj ects, with the exception of clinical (human) cases where cerebral spinal fluid is collected during acute infection. Instead, this program utilizes multiple other strategies for the early identification of arbovirus transmission activity, in cluding routine serological te sting of sentinel chicken sera for virus-specific antibodies and molecular detection/ virus isolation assays of dead mosquito pools, bird and mammalian tissues to identify the etiological agent. In 2004, these routine surveillance techniques were assessed following the introduction of WNV

PAGE 202

177 to New York (1999) and to Florida (2001) in order to determine an optimal sampling strategy for the detectio n/isolation of SLEV. Evaluation of Arbovirus Surveillance Methods A method that anchors the states arbovi rus surveillance prog ram is the Florida Sentinel Chicken Arboviral Surveillance Network, which was established in 1978 (Nelson et al 1983). This statewide surveillance progr am has shown that sentinel chicken seroconversions (development of antibodies ) to arboviruses often precede human cases and can serve as an early warning system (Blackmore et al 2003; Butler and Stark, 2005). Figure 4-1 illustrates the rate (num ber positive birds divided by total number of susceptible birds x 100 = %) of sentinel chicken flavivirus seroconversions from 1988 to 2006 (figure appears courtesy of Stark and Kazanis, 2006). The rate of SLEV seroconversions dramatically declined following the introduction of WNV in Florida (2001). Although low levels of SLEV were detected by sentinel chic kens in 2001 (n=7) during the first year of WNV transmissi on activity, SLEV was not detected by the sentinels in 2002. SLEV sentinel chicken seroconversions reapp eared in 2003 (n=10) and 2004 (n=12) at much lower levels than in 1999 (n=193) and 2000 (n=144) prior to the introduction of WNV. Figure 4-2A illust rates this decline in number of SLEV positive sentinel chickens, as well as the ra te (%) of SLEV and WNV seroconversions (1999-2004) [data summarized from Laborat ory Reports 1997-2006 and Annual Reports 2002-2006, available at the FDOH-BECH website at URL: http://www.doh.state.fl.us/environment/com munity/arboviral/survey-info.htm].

PAGE 203

178 A second surveillance tool for the det ection and/or isolation of arboviruses involves testing of pools of trapped mosquitoes (1-50 mosquitoes pe r pool). Mosquitoes were collected, anesthetized, speciated, and pooled by county mosquito control districts (MCD) and then submitted to the laboratory on dry ice for diagnostic purposes. During 2001-2004, the BOL-Tampa performed molecular assays for the detection of arboviral RNA on 13,496 traditional mosquito pools, as well as inoculati on of homogenized, filtered mosquito pools for viru s isolation in cell cultures. Nucleic acid was extracted from each pool and screened for flavivirus -specific RNA in a real time RT-PCR assay (TaqMan). Alternatively, mosquito control districts performed ex traction and RT-PCR assays of collected mosquito pools inhouse, depending on personnel, resource and equipment availability. Positive mosquito pool results were reported by the BOL-Tampa or mosquito control districts to the FDOH-BC EH by agencies in the state that performed virology molecular detection assays (FDOH-BCEH, 2007). Unlike sentinel chicken seroconversi ons, assays for the detection of flaviviruses in mosquito pools have not been as sensitive in Florida with few positives reported by the BOL-Tampa, especially in years with fe w seroconversions (Stark and Kazanis, 20012007). SLEV has rarely been detected in mo squito pools since the introduction of WNV, with zero positive pools in 2001, 2003, and 2004. In 2002, the only SLEV positive mosquito pools detected in the state were extracted and assayed by Lee County Mosquito Control District (n=2) following th e introduction of WNV (FDOH-BCEH, 2002). Interestingly, sentinel chicke n seroconversions to SLEV we re not detected in flocks located in Lee County or elsewhere in the state during 2002 (Stark and Kazanis, 2002). Figure 4-2 B shows the number of positiv e mosquito pools for SLEV and WNV (1999-

PAGE 204

179 Sentinel Chicken Seroconversions to Flavivirus 1988-20060% 10% 20% 30% 40%1988198919901991199219931994199519961997199819992000200120022003200420052006rate (%) %WN %SLEFigure 4-1 Rate of Sentinel Chicken S eroconversions to Flaviviruses (1988-2006) In Florida, sentinel chickens are used to detect arbovirus activity throughout the state. Th e rate of sen tinel chicken seroconversions to flaviviruses are shown below, with fluc tuating rates of WNV (yellow) and SLEV (red) over time. Figure appears courtesy of Lillian Star k, where it is available for open acce ss at the FDOH-BCEH website at URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm (Annual Laboratory Reports, 2006)

PAGE 205

180 2004) reported to FDOH-BCEH (Stark a nd Kazanis, 1999-2004; Mosquito-Borne Disease Summaries 2002-2004 available from URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm ). Another component of Floridas ar bovirus surveillance program is the detection/isolation of virus from tissues collected from dead birds and mammals. This surveillance technique was r outinely performed at the BOL-Tampa, where specimens submitted to the laboratory were tested for the presence of arbovirus RNA (TaqMan RTPCR) and cultured in Vero cells for virus isolation. Tissues from 15,586 dead birds/mammals were tested by the BOL-Tamp a for arbovirus detec tion/isolation during 2000-2004. SLEV was not detected or isolated in these samples. Figure 4-2 C illustrates the number of positive dead birds/mammals for SLEV and WNV. Identification of Existing Arbovirus Surveillance Resources In Florida, several resources exist at local and state levels for surveillance of arboviruses, including West Nile virus a nd St. Louis encephalitis virus transmission activity. Three methods were evaluated to id entify a system (live domestic birds, dead wild birds/mammals and mosquitoes) that could be targeted for the is olation/detection of SLEV. The number of sentinel chickens that seroconverted (developed antibodies) to SLEV [n=10 in 2003, n=12 in 2004] was higher than the number of positive mosquito pools [n=2 in 2002] or positive dead bird s/mammals [n=0 during 2001-2004], following the introduction of WNV. Cons equently, the sentinel chicken program was chosen to implement a targeted sampling strategy for the isolation of St. Louis encephalitis virus. During the study period, 14 county agenci es with active sentinel chicken programs in central and southern regions of th e state were recruited. These local agencies

PAGE 206

181 0 42 3 0 2 0 31 10 0 5 10 15 20 25 30 35 40 45 199920002001200220032004 YearNumber of Positive Mosquito Pools SLE WN 0 0 0 0 33 1113 489 450 0 200 400 600 800 1000 1200 199920002001200220032004 YearNumber of Positive Dead Birds/Mammals SLE WN Figure 4-2 Comparison of Arbovirus Surveillance Methods for the Detection of SLEV, as compared to WNV, from 1999-2004. A) Sentinel chicken seroconversions to SLEV declined following the introduction of WNV in 2001 (# chickens on the first y axis). Low levels of SLEV sentinel seroconversi ons resumed in 2003 and 2004 (rate on second y axis). B) WNV was detected in 86 mosquito pools during 20012004; SLEV was identified in 2 pool s during 2002. C) SLEV was not detected in dead bird/mammalian tissu es, despite the de tection of more than 2000 WNV infections in the same time period. A) B) C) 1343 352 12 10 0 7 193 144 1102 202 0 200 400 600 800 1000 1200 1400 1600 199920002001200220032004 Year# Positive Sentinel Chickens0 5 10 15 20 25 30 35Rate (%) SLE WN SLE Rate WN Rate

PAGE 207

182 were selected based on historical SLEV transmission patterns in Fl orida (traditional SLE belt, see Figure 3-1). The University of Florida (IFAS, FMEL) was contacted for inclusion in this project, as this agency submitted sentinel chicken sera during 2006. In 2006, wildlife rehabilitation centers affiliated with th e Florida Wildlife Rehabilitation Association (FWRA) were also recruited usin g the FWRA listserv directory of its members. In addition, th e Florida Fish and Wildlife Conservation Commission (FWC) was contacted to collect cloacal swabs from wild bird mortality events, when the agency investigated clus ters of dead birds throughout the state. Agencies and rehab centers were contact ed with a description of the study by email and/or telephone and reque sted to collaborate with the Florida Department of Health, Bureau of LaboratoriesTampa for the isolation of arboviruses from naturally exposed birds. Shipping and laboratory tes ting of collected samples was offered at no cost to each agency. Optimization of Methods for Network In 2004 and 2006, testing methods were opt imized at the BOL-Tampa for the detection/isolation of arboviruses from blood (see Methods for details) and viral culturette swabs. The QIAamp Viral RNA Mini kit had previously been validated at the BOL-Tampa for nucleic acid extraction from cloacal swabs (Brennan, 2003) and was validated in 2004 for blood samples. At the initiation of this study, the cloacal swab processing protocol was assesse d to quantify recovery of virus by RT-PCR (TaqMan) and plaque assays after processing a swab. This information was used to determine virus detection thresholds in cloacal samples and for quantification (titer) of arbovirus shedding in the feces. In 2004, swab cultu rettes (Becton Dickinson, Cat. No. 261514)

PAGE 208

183 were inoculated with 0.1 ml ten-fold serial dilutions of St. Louis encephalitis virus (SLE TBH) [100 through 10-4] and then processed in 1 ml bi ologic field diluent (BFD). The protocol did not require modifications, as the amount of recovered virus closely matched the expected quantity of SLEV inoculated on to each swab (titered by plaque forming assays). It was also determined that the dilution containing 2 PFU /0.1 ml SLEV was not recovered or detected using this swab extr action protocol. Figure 4-3 illustrates the relationship between the TaqMan CT value and the titer of vi rus recovered (PFU/0.1 ml) following processing of a swab. Expected plaque forming units are also shown for each dilution. In 2006, replacement swab culturettes (Becton Dickinson, Cat. No. 220221) were validated (following manufacturers disconti nuation of the initial swabs (Cat # 261514) used for the project). These swabs were inoculated with 0.3 ml ten-fold serial dilutions of St. Louis encephalitis virus (SLE TBH) [100 through 10-5] in 3 ml culture media. Unlike in 2004, the amount of recovered SLEV was mu ch lower than the expected quantity of virus inoculated onto each swab (measured by plaque forming assays). This experiment was repeated and the average of the results (CT values within 0.15) is reported. The SLEV dilution containing 2 PFU/0.1 ml was detected (CT value 36.95), but not recovered by culture, using this swab extraction protocol. In addition, this swab type was inoculated with 0.3 ml ten-fold serial dilutions of West Nile virus (NY99) [100 through 10-5]. For WNV, the amount of recovered virus closely matched the expected quantity of WNV inoculated onto each swab and the 10-5 dilution containing 13 PFU/0.1 ml WNV was detected (CT value 39.58). Figures 4-4 and 4-5 illustrate the relationship s between the RT-PCR (TaqMan) CT value and the

PAGE 209

184 Figure 4-3 SLEV Recovery From Spike d Swab Culturettes (Cat. No. 261514) The expected and recovered titers of SLEV from spiked cloacal swabs were determined by plaque assays in Vero cells, measured in plaque forming units (PFU/0.1 ml) [logarith mic scale]. The amount of SLEV recovered following the processing protocol closely matched the titer of each virus dilution spiked onto a sw ab. The data table provides the averaged result of replicates performe d for each dilution used to generate the graph. SLEV Dilution TaqMan CT Value Recovered PFU/0.1 ml Expected PFU/0.1 ml 10 -0 24.3 280000 250000 10 -1 26.02 25500 25000 10 -2 30.05 1350 2500 10 -3 33.19 165 250 10 -4 37.29 9.5 25 1 10 100 1000 10000 100000 1000000 10-010-110-210-310-4 SLEV DilutionsPFU/0.1 ml0 5 10 15 20 25 30 35 40Cycle Number (TaqMan) Recovered Expected CT Value

PAGE 210

185 Figure 4-4 SLEV Recovery From Spike d Swab Culturettes (Cat. No. 220221) The recovered titers of SLEV were mu ch lower than the expected quantity of virus inoculated onto each swab, de termined by plaque assays in Vero cells and measured in plaque form ing units (PFU/0.1 ml) [logarithmic scale]. However, the improved transport media in this swab type enhanced detection of SLEV to 2 PFU/0.1ml, but not recovery at the highest dilution. RT-PCR (TaqMan) and plaque assays were performed for each dilution, tested in replicate. The data table provides the averaged result of replicates performed for each dilution used to generate the graph. SLEV Dilution TaqMan CT Value Recovered PFU/0.1 ml Expected PFU/0.1 ml 10 -0 22.93 48500 240000 10 -1 23.58 4850 24000 10 -2 26.64 485 2400 10 -3 26.96 180 240 10 -4 29.47 5 24 10 -5 36.95 0 2 1 1000 10-0 10-1 10-2 10-3 10-4 10-5 SLEV DilutionsPFU/0.1 ml0 5 10 15 20 25 30 35 40Cycle Number (TaqMan) Recovered Expected CT Value

PAGE 211

186 Figure 4-5 WNV Recovery From Spike d Swab Culturettes (Cat. No. 220221) The expected and recovered titers of WNV from spiked cloacal swabs were determined by plaque assays in Vero cells and measured in plaque forming units (PFU/0.1 ml) [logarith mic scale] .The amount of WNV recovered following the processing protocol closely matched the titer of each virus dilution spiked onto a sw ab. RT-PCR (TaqMan) and plaque assays were performed for each dilution, tested in replicate. The data table provides the averaged result of replic ates performed for each dilution used to generate the graph. WNV Dilution TaqMan CT Value Recovered PFU/0.1 ml Expected PFU/0.1 ml 10 -0 21.43 1275000 1300000 10 -1 23.94 127500 130000 10 -2 27.59 12750 13000 10 -3 30.97 1275 1300 10 -4 34.62 127.5 130 10 -5 39.58 24 13 1 10 100 1000 10000 100000 1000000 10000000 10-010-110-210-310-410-5 WNV DilutionsPFU/0.1 ml0 5 10 15 20 25 30 35 40 45Cycle Number (TaqMan) Recovered Expected CT Value

PAGE 212

187 titer of virus recovered (PFU/0.1 ml) follo wing swab processing for SLEV and WNV, respectively. Expected plaque forming units are also shown for each dilution. Optimization of Targeted Sampling Strategy for Network Agencies In 2004, a small pilot field study was conducted in Hillsborough County to design a targeted sampling strategy for use by netw ork agencies. Weekly sentinel chicken surveillance results identified extensive WNV seroconversions ( flavivirus positive in the HAI assay and confirmed WNV by MAC-ELISA) in sentinel chicken flocks located in Hillsborough County during June (19 confirmed positive birds). During the last two weeks of June, WNV activity was confirme d at 3 sites in Hillsborough County with a total of 7 confirmed positive bi rds (weekly sentinel chicken seroconversion results can be found at the FDOH-BECH website for arbovirus activity in the state, available at URL: http://www.doh.state.fl.us/environment/com m unity/arboviral/Weekly-Summary.html ). These sites were then targeted in the last week of the month (4 confirmed positive birds) to pilot the protocol for collection of cloaca l swabs prior to widespread implementation in the surveillance network. Cloacal swabs were collected at these targeted sites one day following confirmation in the MAC-ELISA; however, the chickens were initially sampled seven days (positive sera specimens) prior to these test results. Swabs were collected from 14 chickens that had not seroconverted at these sites, as well as from four confirmed positive chickens, for a total of 18 swabs. No viru s was detected or isolated for all swabs. Protocol and Sampling Criteria for Specimen Collection The pilot field study in Hillsborough Count y provided a guideline for a targeted protocol and sampling criteria for specimen collection from sentinel chickens. The BOL-

PAGE 213

188 Tampa determined hot zones of arbovirus transmission activity based on weekly HAI and MAC-ELISA test data, and requested that county agencies collect additional samples at these positive sites. The pilot study indicate d that it was unlikely that West Nile virus could be detected or isolated on cloacal sw abs seven days after the initial positive blood (serum) collection date, or from birds that recently seroconverted. As a result, this strategy requested targeted county agencies to immediately implement sample collection at sites where sentinel chic kens seroconverted with high flavivirus or alphavirus antibody titers (1:40 and >40) in the HAI assay. Ch ickens that had not seroconverted were sampled. In addition, sites with chickens that were weakly positive or reactive in the HAI assay were confirmed in the MAC-ELISA prior to targeting of that site. SLEV-specific targeted sampling of sentinel chicken fl ocks was first confirmed by MAC-ELISA or PRNT, due to its low prevalence. Thus, recommended sentinel chicken sampling strategies were guided by weekly HAI test results and/or confirmation by MAC-ELISA of positive birds, on a case by case basis. Targeted agencies collected samples from positive chicken flocks for up to two months upon request by the BOL-Tampa. Samp ling was terminated by a targeted agency after a decline in new sentinel seroconversi ons over a period of one month, or at the agencys discretion at any time. For wild birds in rehabilitation centers, a separate protocol and sampling criteria was established as they are not routinely bled for arbovirus sero logical testing by the BOL-Tampa. Wildlife rehabilitation centers recei ve injured or ill birds from a variety of sources and locations in the region where a center provides care. As a result, a specific site cannot be targeted for swab collecti on. Instead, birds were triaged and swabbed

PAGE 214

189 based on patient symptoms at admission. Symp toms indicative of encephalitis (shaking, weakness, inability to hold head upright, etc) were provided to participating centers to screen admitted birds for inclusion in the study. In addition, each center that participated in the study was requested to swab these tr iaged bird one time, as soon as possible following admission. The complete protocols an d sampling criteria for the collection of cloacal swabs from sentinel chickens and wild birds are available in Appendix C. Targeted Strategy for Collection a nd Processing of Submitted Samples A targeted strategy for the collection of blood samples and cloacal swabs for the detection/isolation of arbovi ruses at active transmission sites was conducted from June 2005 to December 2006 by participating agencies with sentinel chicken programs. Three (out of four) counties particip ated in the study during 2005, and five (out of five) counties participated in the study during 2006. The collection of blood samples for RT-PCR and cell culture testing was discontinued after 2005; only cloacal swabs were collected in 2006. The targeted strategy was expanded to include wild birds in 2006 (March through December). Both sentinel and wild birds were located outdoors, such that the detection of an arbovirus infection occurred from a natural exposure to the virus. Weekly Surveillance Results of Arbo virus Transmission Activity (2005-2006) In 2005, the HAI assay was performed on 47,535 sentinel chicken sera samples from birds (n=3801) located at 279 sites through out the state. HAI positive samples were confirmed in either the IgM antibody cap ture-enzyme linked immunosorbent assay (MAC-ELISA) or the plaque reduction neutralization test (PRNT) for WNV, SLEV, EEEV and HJV. During 2005, transmission of all 4 viruses occurred to the sentinel chickens resulting in 869 confirmed seroconversions.

PAGE 215

190 The HAI assay was performed on 47,132 se ntinel chicken sera from birds (n=2901) located at 277 sites in 2006. As in 2005, HAI positive samples were confirmed by MAC-ELISA or PRNT. During 2006, transm ission of WNV, SLEV, EEEV, and HJV occurred to sentinel chic kens resulting in 155 confir med seroconversions. Weekly arbovirus surveillance results reported for the sentinel chickens can be found at http://www.doh.state.fl.us/environment/com m unity/arboviral/Weekly-Summary.html for 2005 and 2006. Sentinel chicken seroconversions occurred during every month in both years (see rate of arbovirus transmission by region fo r EEEV [Figure 4-6], W NV [Figure 4-7] and SLEV [Figure 4-8]). Table 4-1 lists the tota l number of sentinel chicken seroconversions by arbovirus for 2005 and 2006. Maps of Florida with the cumulative totals and location of confirmed sentinel chicken arbovirus se roconversions are located in Appendix E (2005) and Appendix F (2006) [open access, available at http://www.doh.state.fl.us/environment/com m unity/arboviral/maps-arboviral.html ]. Implementation of Targeted Sampling Strategy (2005) The targeted sampling project was implemented in June 2005. Flaviviral activity (WNV) was present in several counties with sentinel chic ken programs during the early summer months (May-July). However, these ag encies opted not to participate in the targeted program (4 out of 14) when init ially recruited. One pa rtner (Pinellas County) was unable to participate upon request, due to in tensive vector control efforts needed to limit a human outbreak of WNV in the region. Consequently, one county with alphavirus activity was first able to accommodate a reque st by the BOL-Tampa to target sentinel chicken flocks.

PAGE 216

191 Figure 4-6 Rate of EEEV Sentinel Chic ken Seroconversions in Florida (20052006) The rate of sentinel seroconversi ons to EEEV was higher in the north, panhandle, and central regions of th e state in 2005 than in 2006. In addition, statewide EEEV activity (black circle) was elevated for most months of the year in 2005 over the average historical mean (black line). Figures appear courtesy of Lillian Stark (Stark and Kazanis, 2006).

PAGE 217

192 Figure 4-7 Rate of WNV Sentinel Chic ken Seroconversions in Florida (20052006) The rate of sentinel seroconversi ons to WNV was higher in the north, central, and panhandle regions of the state in 2005 than in 2006. However, sentinel seroconversions to WNV were dramatically reduced for all regions in 2006, as compared to 2005. Figures appear courtesy of Lillian Stark (Stark and Kazanis, 2006).

PAGE 218

193 Figure 4-8 Rate of SLEV Sentinel Ch icken Seroconversions in Florida (20052006) The rate of sentinel seroconversions to SLEV was much lower in 2005 (five seroconversions total) than in 2006. In addition, SLEV activity was elevated from August to December compared to the same period in 2005 and averaged close to the historical mean (black line) in Florida. Figures appear courtesy of Lillian Stark (Stark and Kazanis, 2006).

PAGE 219

194 Table 4-1 Confirmed Sentinel Chicke n Arbovirus Seroconversions (2005-2006) During 2005-2006, sera were collected from sentinel chickens and submitted to the BOL-Tampa for arboserology testing. In 2005, 414 chickens developed antibodies (ser oconversion) to WNV and 5 birds seroconverted to SLEV, as conf irmed by MAC-ELISA or PRNT. In contrast, the number of chickens th at seroconverted to SLEV in 2006 was greater than number of sentinel bi rds with confirmed WNV infections. This increased SLEV transmission activity to sentinel chickens occurred for the first time since the introduc tion of WNV to Florida in 2001. # Arbovirus Confirmed Sentinel Chicken Seroconversions Year # Chickens WNV SLEV EEEV HJV 2005 3,801 414 5 342 108 2006 2,901 30 40 79 6

PAGE 220

195 Targeted Sampling of Orange County (2005) One mosquito control district in Orange County collected blood and cloacal swab samples from the first week of July through August 2005, following extensive alphaviral transmission activity in the county. Six si tes were targeted, where 303 swabs were collected from 41 birds. Three sentinel s were confirmed antibody positive for EEEV (Sites 004, 007), 3 birds seroconverted to HJV and one bird was alphavirus antibody positive (Sites 004, 006) over this time period. However, only one of these three positive sites was targeted for swab co llection at the same time of these seroconversions (Site 004 in August). From July to August, no sentinels seroconverted at three other targeted sites (001, 005, 008) following the initial transmissi on activity. One chicke n at Site 008 later seroconverted to EEEV (in November), but ta rgeting of that site was discontinued in August. EEE viral RNA was detected on four swab s collected from Site 004 in August. For Bird 846, two swabs collected at -8 a nd -6 days preceding the development of detectable HAI alphavirus antibodies had EEEV specific RNA identified on the swab. EEE viral RNA was also detected on two swabs collected from Bird 870. However, Bird 870 did not seroconvert, as test ed by the HAI assay. Virus was not isolated (cultured) from these processed swab or blood samples (CT values 33.5 34). In total, 102 cloacal swabs and 100 blood samples were pro cessed for this county. Confirmed seroconversions, site names, and detection of EEEV from targeted samples are plotted on a timeline (Figure 4-9), including start and stop dates of targeted sampling of these flocks.

PAGE 221

196 Figure 4-9 Targeted Sampling of Sentinel Chicken Sites in Orange County (2005) From July to August 2005, confirmed arbovirus sentinel sero conversions (rectangles) tri ggered targeted sampling of sites (triangles). Chickens that had not yet seroconverted at six targeted sites (gray triangles below timeline) were swabbed for virus isolation/detection assays. EEEV vira l RNA (diamond shapes) was confirmed by TaqMan RT-PCR on 4 swabs collected from two chickens at Site 004 in August. However, virus wa s not isolated (cultured) from these swabs (NVI). One of these chickens (Bird 846) later developed low titers of cross-reactive alphaviral antibody.

PAGE 222

197 Serology Results The mosquito control district in Orange County was especially effective at swabbing targeted flocks twice a week. However, fre quent swabbing of the ta rgeted flocks did not appear to improve recovery of infectious EEEV from cloacal swabs, as evidenced by detection of viral RNA only on swabs coll ected 2 days apart from a bird that seroconverted 6 days later. Despite this fi nding, collection of cloaca l swabs at Site 004 twice a week resulted in detection of the ar boviral infection 8 days prior to the initial serum sample taken for serology testing. HAI positive test results were then reported on this sentinel 16 days after the first swab collected on August 17 (with EEE viral RNA), due to additional testing in the PRNT to c onfirm infection. Specifi c serology results are provided in Figure 4-10, which illustrates the development of the primary immune response following natural EEEV infection in th is adult chicken. Note: the exact date of infection is unknown. Implementation of Retrospective Targ eted Strategy for Sample Processing Based on the sporadic arbovirus transm ission activity in Orange County, a targeted retrospective processing strategy was implemented by the BOL-Tampa for processing, virus isolation and molecular detection assays to prioritize collected samples. The first 30 targeted samples (cloacal swabs and blood) collected from active transmission sites were processed as quickly as possible upon receip t at the laboratory, usually within two weeks. If virus was not detected in the first 30 swabs, the retrospective processing strategy described below was implemented. Cloacal swabs and blood samples from targeted sites were processed only after a sentinel had seroconverted in the HAI assay. Swabs collected with in two weeks of the

PAGE 223

198 Figure 4-10 Development of the Primar y Immune Response Following Natural Eastern Equine Encephalitis Virus Infection in a Sentinel Chicken Serum samples were collected from Bird 846 (Site 004) and submitted to the BOL-Tampa for arbovirus screening in the HAI assay. Alphavirus group antibody (titer 1:10, pink dotted lin e) was first detected in samples submitted after August 25. EEE viral RNA was detected on cloacal swabs collected on August 17 & 19 (TaqMan CT values, red line). Serum collected on August 25 was tested fo r EEEV-specific IgM antibodies in the MAC-ELISA (P/N value 0.97, blue line). However, the last serum sample collected on September 8 had cross-reactive to tal antibody titers (IgM + IgG) to both EEEV and HJV in the PRNT. Serological testing was unable to distinguish EEEV from HJ V due to cross-reactive antibody in these samples; the chicken was reported alphavirus positive. Assay Type Serum #1 8/25/05 Serum #2 9/1/05 Serum #3 9/8/05 HAI 1:10 1:10 NT EEE HJ EEE HJ EEE HJ MAC-ELISA* PRNT 0.97 <10 N/A 1:10 NT <10 N/A 1:10 NT 1:10 N/A 1:10 NT = Not Tested. *MAC-ELISA P/N values. HJV MAC-ELISA was not available (N/A) at the BOL-Tampa. 0.97 2.3 2.3 2.3 33.68 33.95 0 0.5 1 1.5 2 2.5 8/12/058/17/058/19/058/25/059/1/059/8/05 DateNatural Log of Total Ab Titer (HAI & PRN T or MAC-ELISA P/N Value25 26 27 28 29 30 31 32 33 34 35TaqMan Ct Value (EEEA) HAI (Alpha Total Ab) PRNT (Alpha Total Ab) ELISA (IgM Ab) EEEV RNA Development of the Primary Immune Response Following Natural Eastern Equine Encephalitis Virus Infection in a Sentinel Chicken

PAGE 224

199 seroconversion were tested for the entire floc k, such that collection dates one week prior to and following the positive serum sample were tested. This strategy was implemented for all other programs that submitted samples in 2005, and then limited initially to 10 samples in 2006 to conserve laboratory resour ces. Figures 4-11 and 4-12 indicate the total number of cloacal swabs rece ived by the BOL-Tampa for each agency and the subset of samples processed for molecular and cell cu lture assays in 20 05 and 2006, respectively. Targeted Sampling of Manatee County (2005) In August 2005, the first confirmed se ntinel seroconversion to St. Louis encephalitis virus in the state occurred in Manatee County. Targeted sampling of the chicken flock at Site 015 began within 1 da y of the confirmed MAC-ELISA test result and continued for 12 days. However, St. L ouis encephalitis virus was not detected or isolated from swabs or blood samples collected from this chicken or in the flock at Site 015. In addition, no other sentinels seroconverted to SLEV in Manatee County for the remainder of 2005. A total of 10 sites were targeted from August through November, where 216 swabs were collected from 63 birds. Over this time period, 28 sentinels had confirmed arbovirus seroconversions. However, only 14 birds seroconverted to WNV (out of 28) where cloacal swabs and blood was collected a nd preserved for virus detection/isolation studies. Consequently, following a targeted processing strategy at the BOL-Tampa 119 swabs and 100 blood samples were processed for molecular detec tion and cell culture assays at these sites. The EEEV positive site (003) was not actively sampled when two out of six (33.3%) sentinels in that flock seroconverted. Confirmed seroconversions, site

PAGE 225

200 Figure 4-11 Targeted Laboratory Sample Processing Strategy (2005) A targeted processing strategy was also conducted for sample extraction, molecular detection assays and inoc ulation of cell cultures at the BOLTampa. Sporadic transmission activity of arboviruses and low prevalence of SLEV (2005) resulted in several sites that were targeted, but no chickens in the flocks seroconverted. Samples were stored at -70C and processed only if chickens with sero conversions at targeted sites were detected by the HAI assay. Then, samples from a positive flock (with collection of cloacal swab and blood at active sites) were tested from one week prior and following confirmed se ntinel seroconversions. A total of 259 swabs were tested (out of 623) in 2005. 303 102 119 38 216 104 0 50 100 150 200 250 300 350 Orange Manatee Sarasota CountyNumber of Swabs Total Processed n = 63 n = 25 n = 41

PAGE 226

201 Figure 4-12 Targeted Laboratory Sample Processing Strategy (2006) A targeted processing strategy was also conducted for sample extraction, molecular detection assays and inoc ulation of cell cultures at the BOLTampa. Sporadic transmission activity of arboviruses and low prevalence of SLEV (2006) resulted in several sites that were targeted, but no chickens in the flocks seroconverted. Samples were stored at -70C and processed only if chickens with sero conversions at targeted sites were detected by the HAI assay. Then, samples from a positive flock (with collection of cloacal swab at active site s) were tested from one week prior and following confirmed sentinel se roconversions. A total of 529 swabs were tested (out of 1338) in 2006. 427 22 36 248 913 119 22 12 20 48 0 100 200 300 400 500 600 700 800 900 1000 Lee OrangePascoSarasotaVolusia CountyNumber of Swabs Total Extracted n = 36 n = 16 n = 16 n = 18 n = 9

PAGE 227

202 names and detection of arboviruses from ta rgeted samples are plotted on a timeline (Figure 4-13), including start and stop dates of targeted sampling of these flocks. West Nile virus was detected (confirme d by TaqMan RT-PCR) and cultured from the swab of one chicken (Bird 1773, aged 64 we eks) located at Site 001 on the first day of targeted sampling at that site. The WNV is olate was designated FLM38. Plaque assays conducted on the processed swab diluent iden tified 3 PFU/0.1 ml infectious West Nile virus shed in the feces. Whol e blood collected from the sentinel at the same time was added to lysis buffer and BFD, but were negative by TaqMan RT-PCR and cell culture assays, respectively. However, a separate serum sample collected on the same date as the cloacal swab confirmed positive for IgM antibodies to WNV in the MAC-ELISA (P/N 6.2) for Bird 1773. Interestingly, this serum samp le did not screen positive for flaviviral -specific antibodies in the HAI assay (t iter <10). As a result, th e BOL-Tampa requested that Manatee County remove the bird from the flock (due to confirmed infection), but still continue to submit sera from this chicken until it developed detectable antibodies in the HAI assay. The bird developed detectable an tibody titer (1:10) in the HAI test twentyeight days following isolation of WNV from a cloacal swab colle cted on September 12. Figure 4-14 illustrates the development of the primary immune response following natural WNV infection in this adult chicken, aged 64 weeks. Note: the exact date of infection is unknown. WN viral RNA was also detected in cloaca l swabs collected from two other birds, located at separate sites (002 and 015). Neither of these birds developed antibodies toWNV, as detected by the HAI assay. Virus was not isolated (cultured) from these

PAGE 228

203 Figure 4-13 Targeted Sampling of Sentin el Chicken Sites in Manatee County (2005) From August to November 2005, confirmed arbovirus sentin el seroconversions (rectan gles) triggered additional sampling of sites (triangles). Chickens th at had not yet seroconverted at ten target ed sites (gray triangles) were swabbed for virus isolation/detection assays. West Nile viral RNA (diamond shapes) was detected on three cloacal swabs from 3 separate sentinels (Sites 001, 002, 015), but only cultured from one chicken (Bird 1773) that also seroconverted. Virus isolate was designated FLM38 and was sequenced for phylogenetic analysis at this site.

PAGE 229

204 processed swab or blood samples. However, CT values for the detected WN viral RNA were high (greater than 35, WNA primer set). Targeted Sampling of Sarasota County (2005) In September 2005, the second and third sen tinel chickens seroconverted to St. Louis encephalitis virus in Sara sota County. Both birds were located at Site 008 and sera samples collected on September 19 were submitted for arboserology testing by the BOLTampa. Positive seroconversions in the HAI assay (both titers 40) on September 23 were confirmed by MAC-ELISA on Septembe r 27. Targeted sampling of the chicken flock began 3 days later at Si te 008. Cloacal swabs were only collected at this site for 21 days. SLEV was not detected or isolated from processed samples (total of 38 swabs only). SLEV activity was not detected agai n by sentinel chicken flocks located in Sarasota County. A total of four sentinel si tes in Sarasota County were targeted from September through November, where 104 swabs were collect ed from 25 birds. Nine sentinels had confirmed WNV seroconversions (Sites 004, 008, 009, 010) over this time period. However, these seroconversions did not occu r where cloacal swabs were collected for virus detection/isolation studies. One chicke n (Bird 137-P) seroconverted to WNV 4 days after targeted sampling of Site 009 was term inated. Cloacal samples were negative for that flock on the previous collection date by RT-PCR and cell culture assays. Confirmed seroconversions and site names are plotte d on a timeline (Figure 4-15), including start and stop dates of targeted sampling of thes e flocks. No arbovirus was detected or isolated from samples processed for Saraso ta County in 2005 despite prompt collection by the agency upon notification of confirmed seroconversions by the BOL-Tampa. In

PAGE 230

205 6.3 21.9 2.3 5.5 6.4 5.2 3.0 0 5 10 15 20 25 30 0 7 16 21 28 Days (Post-Isolation)Natural Log Total Antibody Titer (HAI) or P/N Value IgM Antibody (ELISA)0 1 2 3 4 5PFU/0.1 ml Flavi Total Ab (IgM + IgG) IgM Ab WNV Figure 4-14 Development of the Primary Immune Response Following Natural West Nile Virus Infection in a Sentinel Chicken Day 0 indicates the time of sample collection from a West Nile virus infected chicken; not necessarily the first day of infection. IgM antibodies were present at Day 0, peaked at Day 7, and remained elevated for 28 days post isolation of the virus (blue) as detected by the IgM ELISA (P/N values). In a separate assay, IgG an tibodies were first detected by the hemagglutination inhibition assay 28 da ys post viral isolation (pink, dotted line). Virus shed in the feces (3 PFU/0.1 ml) was detected on Day 0 only (triangle). Viremia was not detected at Day O and a cloacal swab taken 4 days post-isolation was also negative (data not shown). Development of the Primary Immune Response Following Natural West Nile Virus Infection in a Sentinel Chicken

PAGE 231

206 Figure 4-15 Targeted Sampling of Sentinel Chicken Sites in Sarasota County (2005) From September to November 2005, conf irmed arbovirus sentinel seroconversi ons (rectangles) triggered additional sampling of sites (triangles). Chickens th at had not yet seroconverted at 4 target ed sites (gray triangles) were swabbed for virus isolation/detection assays. Targeted sampli ng of these sites did not appear to coincide with flavivirus transmission activity.

PAGE 232

207 addition, cloacal swabs were often collected tw ice in one week but th e targeted timing of active arbovirus transmission sites was not effective. In summary, targeted sampling of active arbovirus transmission sites occurred in three counties during 2005. In addition, ar boviruses detected on sentinel chicken cloacal swabs included two de tections of West Nile vi rus (FLM42-2, FLM50) and one cultured isolate of West Nile virus (FLM 38) in Manatee County. Eastern Equine Encephalitis viral RNA was detected on four cloacal swabs from two chickens (FLR80, FLR84, FLR86, FLR90) in Orange County. Vi rus isolation attemp ts on these positive EEE samples were negative. No virus was detect ed or isolated from targeted sites in Sarasota County in 2005. Targeted Sampling of Lee County (2006) In August 2006, three sentinel chickens seroconverted to St. Louis encephalitis virus in Lee County and were the first SLE positi ve sentinels in the state that year. These chickens were located at separate site s (002, 010 and 014) and had cross-reactive antibody profiles to WNV and SLEV in the MAC-ELISA that required further confirmation in the plaque reduction neutralization assay to confirm SLEV seroconversion. As a result of the additional PRNT testing needed, final confirmation of these birds was delayed by two weeks (a total of 22 days since origin al collection of the sera). Table 4-2 lists the serology results fo r these first confirmed SLEV positive sentinel chickens. Unlike many other sentinel chicken pr ograms in Florida, Lee County does not bleed each flock in the region every week. Instead, most sites are rotated and each flock

PAGE 233

208 Table 4-2 Serology Results for Three Sent inel Chicken SLEV Seroconversions in Lee County (2006) Serum samples were collected from three chickens (Birds 360, 422, and 439) and submitted to the BOL-Tampa for arbovirus screening in the HAI assay. Flavivirus-group antibody was detected in these samples (titers 1:10, 1:20 and 1:20, respectively). These samples were tested in the MACELISA for WNV and SLEV, where P/ N values greater than 2.0 were considered positive. However, the sera were cross-reactive to both WNV and SLEV in this assay and furthe r confirmation was required in the PRNT. PRNT titers confirmed that the sentinels developed antibodies to St. Louis encephalitis virus (1: 10, 1:10 and 1:20, respectively). Arboserology Test Results fo r First Confirmed SLEV Positive Chicken Sera Collected in Lee County (2006) Sentinel Chicken Band Number Assay Type Bird 360 Bird 422 Bird 439 HAI 1:10 1:20 1:20 WN SLE WN SLE WN SLE MAC-ELISA* PRNT 2.6 <10 2.0 1:10 3.7 <10 2.5 1:10 2.4 <10 2.0 1:20 *MAC-ELISA P/N values.

PAGE 234

209 sampled every two weeks to suit the agencys need. Consequently, the first targeted sampling of these positive site s occurred only at Site 002 on September 11. This targeted sampling started five days after the confirmed SLEV seroconversions were reported, when the next sera samples were scheduled for collection. Cloacal swabs were then collected at this site for 14 days. Site 016 was also targeted based on its location and mosquito abundance in traps collected at the site (data not shown, personal communication by J. Burgess, LCMCD). Conse quently, two sentinel sites were targeted for two weeks in September, where 22 swabs we re collected from ni ne birds. Virus was not detected or isolated from these samples. After this time period, targeted sampli ng was terminated due to no new arbovirus sentinel chicken seroconversions in the count y. Targeted sampling of the chicken flocks was not reinitiated despite new SLEV seroconversions starting on October 10 andcontinuing through December 12, 2006. The lengthy lag time necessary to confirm cross-reactive flavivirus infections and the bi-weekly sampling strategy used by the county limited effective targeting of the si tes by the BOL-Tampa. Figure 4-16 provides a timeline of confirmed seroconversions and si te names in Lee County, including start and stop dates of targeted sampling of these flocks. Targeted Sampling of Orange County (2006) In 2006, targeted sampling of sentinel ch icken flocks by one mosquito control district in Orange County was based on tw o methods. Early season transmission of EEEV had been detected at Site 003 in February. Then, EEEV activity was detected in flocks maintained by a neighboring mosquito control di strict in Orange County in June (data not

PAGE 235

210 shown). As a result, the BOL-Tampa requested for Orange County to target three of its sentinel chicken flocks ba sed on early transmission and neighboring activity in 2006. Orange County sampled the sentinel flock at Site 003 and chickens at two other sites (006 and 008) based on historical alphaviral activity during the previous transmission season. Targeted sampling was only performed for a period of ten days. During this time, three birds seroconverted to EEEV at non-ta rgeted sites, including Birds 868, 917 at Site 001, and Bird 871 at Site 004. Si x days following termination of targeted sampling at Site 006, Bird 891 seroconverted to EEEV at this location with historical alphavirus transmission activity during 2005. Consequently, three sentinel sites were targeted in July, where 36 swabs were collected from 18 birds. Virus was not dete cted or isolated from processed samples (n=12). Figure 4-17 provides a timeline of confirmed seroconversions and site names in Orange County, including start and stop dates of targeted sampling of these flocks. Targeted Sampling of Pasco County (2006) During 2006, the BOL-Tampa continued to validate a microsphere-bead immunoassay (MIA) for the de tection of WNV or SLEV-specific IgM antibodies in chicken sera (Haller, 2005). Presumptive positive samples to WNV in the MIA were confirmed by MAC-ELISA and used to target one site (006) in Pa sco County during July 2006. Targeted sites were also chosen based on two previous sentinel seroconversions (at Sites 003, 006) in Pasco County, as well as th e location of one site near Pasco County Mosquito Control headquarters (Site 004). A total of 248 cloacal swabs were collected from 16 birds located at three sites during July 16 through November 6, 2006.

PAGE 236

211 Figure 4-16 Targeted Sampling of Sentin el Chicken Sites in Lee County (2006) In September 2006, confirmed arbovirus sen tinel seroconversions (rectangles) tr iggered additional sampling of sites (triangles). Chickens that had not yet seroconverted at 2 targeted sites (gray triangles below the timeline) were swabbed for virus isolation/detection assays based on sentinel se roconversions (Site 002) and mosquito abundance (Site 016, data not shown). Targeted sampling of thes e sites did not appear to coincide with flavivirus transmission activity in September. SLEV transmission activity dramatically incr eased on October; however, thes e sites were not targeted.

PAGE 237

212 Figure 4-17 Targeted Sampling of Sentin el Chicken Sites in Orange County (2006) In July 2006, confirmed arbovirus sentinel seroconversi ons (rectangles) triggered additional sampling of sites (triangles). Chickens that had not yet seroconverted at 3 targeted sites (gray triangles below the timeline) were swabbed for virus isolation/detection assays. Targeted sites were chosen based on one EEEV sentin el seroconversion (Site 003) and transmission activity at a neighboring mosquito control district. Confirmed alphaviral activity in the previous transmission season of 2005 was used to target Sites 006 a nd 008. Targeted sampling of these sites for 10 days did not coincide with alphavirus transmission activity in July. Ho wever, one sentinel (Bird 831) seroconverted to EEEV within one week of the termination of targeted sampli ng at a site (006) with historical EEEV activity.

PAGE 238

213 Targeted sampling of these sites did not coincide with flavivirus transmission activity in Pasco County over a four mont h time period. After June 6, no additional sentinel chickens seroconve rted in the region for the remainder of the year. Consequently, only 20 (out of 248) swabs were processed for this agency. No virus was detected or isolated in th ese processed samples. Figur e 4-18 provides a timeline of confirmed seroconversions and site names in Pasco County, including start and stop dates of targeted sampling of these flocks. Targeted Sampling of Volusia County (2006) For Volusia County, the BOL-Tampa also used presumptive positive chicken seroconversions in the micr osphere-bead immunoa ssay (MIA) for the detection of WNV or SLEV-specific IgM antibodies in chicken sera to target active transmission sites. Three chickens were positive by MIA for SLEV-speci fic antibodies at two sites on June 6 (Sites 006 and 011). Site 002 had one WNV presump tive positive seroconversion on the same date. These results were confirmed in the MIA the next week on June 16, but did not confirm by MAC-ELISA. Volusia County target ed the presumptive SLE positive sites on the next scheduled bleeding of the flocks (June 23) for the weekly sera submission to the BOL-Tampa for serology testing. Two additional sites were included for targeted sampling based on early season transmission of alphaviruses. One chicken seroconversion to HJV occurred in January at Site 003, whereas one sentinel seroconverted to EEEV at Site 014 in March. A total of four sites were sampled in Volusia County, where 119 cloacal swabs were collected from 16 birds over a one month period (June 23 through July 24).

PAGE 239

214 Figure 4-18 Targeted Sampling of Sentin el Chicken Sites in Pasco County (2006) In 2006, confirmed and presumptive arboviru s sentinel seroconversions (rectangles and circle, respectively) triggered additional sampling of sites (triangles). Ch ickens that had not yet se roconverted at 3 targeted sites (gray triangles below the timeline) were swabbed for virus is olation/detection assays. Targeted site s were chosen based on two sentinel seroconversions (Sites 003, 006) and location near Pa sco County Mosquito Control headquarters (Site 004).

PAGE 240

215 Targeted sample collection was discontinued after July, when no new seroconversions were detected in chicken floc ks located in Volusia County. Sampling of these sites with early season data or presumptive MIA test results did not accurately predict flavivirus or alphavirus transmission activity as assessed by assay of cloacal swabs. A single sentinel chicken seroconverted to WNV in October (well after targeted sampling was discontinued). Consequently, 48 (out of 119) swabs were processed for this agency. No virus was detected or isolated in these processed samples. Figure 4-19 provides a timeline of presumptive and conf irmed seroconversions and site names in Volusia County, including start and stop date s of targeted sampling of these flocks. Targeted Sampling of Sarasota County (2006) Serology Results The BOL-Tampa requested the mosquito co ntrol district in Sarasota County to initiate targeted sample collection following presumptive flavivirus positive MIA results on chicken sera collected from four sites (003, 005, 006, and 007) in June 2006. At three sites, one chicken each developed antibodies to SLEV as detected and confirmed by the MIA on June 16. Although none of these birds screened flavivirus antibody positive in the HAI assay, two of these chickens (S ites 005, 007) were confirmed by MAC-ELISA for presence of flaviviral -specific antibodies (cross-reactiv e to both WNV and SLEV). In addition, Site 003 had one chicken that was detected by MIA as a presumptive WNV positive (although not confirmed by MAC-ELISA). Sarasota County collected cloacal swabs from chicken flocks located at Sites 003 and 005, within three days of confirmed MIA results. Site 007 was not targeted, as this site was not on the weekly routing for the tr ained personnel that co llected cloacal swabs.

PAGE 241

216 Figure 4-19 Targeted Sampling of Sentin el Chicken Sites in Volusia County (2006) In 2006, presumptive arbovirus sentinel seroconversions (circl es) triggered additional samp ling of sites (triangles). Chickens that had not yet seroconverted at 4 targeted sites (gray triangles below the timeline) were swabbed for virus isolation/detection assays. Targeted site s were chosen based on three presump tive sentinel seroconversions to SLEV (Sites 006, 011). Confirmed early season alphaviral activity in January and March was used to target Sites 003 and 014. Targeted sampling of these sites for one month did not coincide with flavivirus or alphavirus transmission activity.

PAGE 242

217 In July and August, Site 002 and Site 006 (previously MIA+ for SLE) were added for targeted sample collection at the agen cys discretion in each month respectively. Cloacal swabs were collected from targeted sites continuously from June through December 2006. The county sentinel chicken program was discontinued for the winter months after December 12. Swabs were coll ected again on December 18 from the flock at Site 002 upon request by the BOL-Tampa, due to a late confirmed seroconversion at that site. The first confirmed sentinel chicken SLEV seroconversion in the county was located at Site 004 (Bird 8-00-W). Serum from this bird was collected on August 28 and a reactive (weak positive) in the HAI a ssay reported on Septem ber 1, with SLEV confirmed results in the MAC-ELISA repor ted on September 6. The second sera collected from this bird deve loped higher HAI antibody titers ( 40) and a P/N value of 9.4 in the second MAC-ELISA (data not shown) These findings indicate that Bird 8000-W was recently exposed to St. Louis encephalitis virus. Confirmed SLEV transmission activity remained quiescent for approximately 1 month in the region, until Bird 9-003-R at Site 001 seroconverted on September 25. Similar to Bird 8-000-W, this bird also was reactive in the HAI te st and was confirmed SLEV positive by MAC-ELISA. The third conf irmed seroconversion (Bird 8-004-G) was located at Site 004. A serum sampled collected on October 3 had a slightly elevated antibody titer (1:10) in the HAI assay a nd was confirmed SLEV by MAC-ELISA. Table 4-3 provides the serology te st results on the three sera co llected from these sentinel chicken in Sarasota County, 2006.

PAGE 243

218 Table 4-3 Serology Results for First Confirmed SLEV Positive Chicken Sera Collected in Sarasota County (2006) Serum samples were collected from three chickens (Birds 8-000-W, 9003-R, and 8-004-G) and submitted to the BOL-Tampa for arbovirus screening in the HAI assay. Weak flavivirus -group antibody was detected in these samples (titers R, R and 1:10, respectively). These samples were tested in the MAC-ELISA for WNV a nd SLEV, where P/N values greater than 2.0 were considered positive. Howe ver, the sera were cross-reactive to both WNV and SLEV in this assa y, but suggestive of SLEV infection. PRNT was performed on a serum sample from the third sentinel chicken and confirmed that the sentinel de veloped antibodies to St. Louis encephalitis virus (antibody titer 40). Arboserology Test Results for the First Confirmed SLEV Positive Chicken Sera Collected in Sarasota County (2006) Sentinel Chicken Band Number Assay Type Bird 8-000-W Bird 9-003-R Bird 8-004-G HAI R R 1:10 WN SLE WN SLE WN SLE MAC-ELISA PRNT* 2.6 NT 4.3 NT 2.0 NT 2.89 NT 1.9 <10 6.1 40 R = Reactive (weak positive result). *NT = Not Tested.

PAGE 244

219 Preliminary HAI test results were reporte d for all sera collected on October 3 to each submitting agency at the end of the week (October 6). Bird 8-004-G located at Site 004 was the second chicken in the flock to seroconvert to SLEV. Based on this information, Sarasota County targeted this site for collection of cloa cal swabs at the next scheduled sample date (October 9) and continued swabbing through December. Site 001 was also targeted in a similar manner; Sarasota County did not wait for confirmed MAC-ELISA results prior to cloacal swab collection at a flavivirus positive site. A serum sample collected from Bird 9-001-Y (Site 001) on October 16 tested HAI flavivirus antibody positive (titer 40) and was reported on October 20. Targeted sample collection of Site 001 began on October 23 and the flock was continuously swabbed through December. Figure 4-20 provides a timeline of presumptive and confirmed seroconversions and site names in Sarasota County, including star t and stop dates of targeted sampling of these flocks. As a result, 913 cloacal swabs were collected from 36 birds. The BOL-Tampa processed 427 swabs for molecular detection and cell culture assays. A total of seven chickens seroconverted to SLEV from August 28 to December 04, 2006. An additional bird was flavivirusantibody reactive in the HAI assay on December 12, but did not confirm in the MAC-ELISA or PRNT. Howeve r, six (out of eight) of these chickens were not targeted for cloacal swab collection at the time of seroconversion. The other two chickens that seroconverted to SLEV were located in targeted flocks, and virus was isolated in culture from cloacal swabs for bot h birds. Virus was also isolated from three birds (band numbers 8-005-B, 9-000-W, and 9004-G) that failed to seroconvert; virus

PAGE 245

220 Figure 4-20 Targeted Sampling of Sentinel Chicken Sites in Sarasota County (2006) From June to December 2006, presumptive (circles) and confirmed arbovirus sentinel seroconversions (rectangles) triggered additional sampling of sites (triangles). Chickens that had not yet seroconverted at six targeted sites (gray triangles below timeline) were swabbed for virus isolation/detection assays SLEV, WNV, and novel flavivirus strains were detected and/or isolated from Sites 001, 004 and 005. Isolates were seque nced for phylogenetic analysis (except FLS853).

PAGE 246

221 was only cultured for bird 8-005-B. The antibod y profiles for these chickens are detailed below for sera submitted to the BOL-Tampa for serological testing. Bird 8-003-R (Site 004) St. Louis encephalitis virus and West Nile virus was isolated from one chicken (Bird 8-003-R) that seroconverted to SLEV as confirmed by MAC-ELISA and PRNT. The band number, site number, and collection dates were compared to submitted paperwork and information label on each swa b, and verified by the agency for this sentinel chicken (personal communication, N. Osborn, SCMCD). Since this bird required additional testing for confirmation (PRNT), th e chicken was swabbed four times over the course of 14 days (October 9 October 23) before it was removed from the field. Three HAI positive sera samples were also collected from this chicken on October 9, 16, and 23. Figure 4-21 compares the test results for three antibody assays (HAI, MAC-ELISA, and MIA) performed on these serum samples for SLEV-specific antibodies. Interestingly, virus was isolated from cloacal swabs at two of the three time points, despite elevated antibody titers in the sera. Detailed assay values for Bird 8-003-R have been provided for each serology test in Appendix G. Notably, no other sentinel chicken seroconversions to WNV were detected in Sarasota County in 2006 (following a single WNV seroconversion at Site 005 on Apr il 10). However, the MIA test identified WNV-specific antibodies in one sentinel in June 2006 at Site 003, but this was a presumptive positive that failed to confirm in other assays.

PAGE 247

222 Figure 4-21 Comparison of SLEV Sero logy Test Results for Bird 8-003-R A) Comparison of HAI and MAC-ELISA methods for the detection of flavivirus total antibody (HAI assay, squares, dotted line) [second y axis] or SLEV-specific IgM antibody (MAC-ELI SA, circles) [first y axis]. Total flavivirus-specific antibody remained elevated in sera collected at 3 time points following arbovirus isolation on Day 0. SLEV-specific IgM antibody was the highest at Day 0 (P/N 3.9) and declined over time. B) Comparison of MAC-ELISA [first y axis] and MIA [second y axis] methods for the detection of SLEV -specific IgM antibody. Both the MACELISA (circles) and MIA screening (triangles) assays detected IgM antibodies to SLEV on all three time poi nts that declined over the course of infection. 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 071 4 Days (Post Isolation)ELISA P/N Values (IgM Antibodies)0 0.5 1 1.5 2 2.5 3 3.5 4Natural Log of HAI Antibody Titer (Total Ab) IgM Ab Total Ab (IgM + IgG) 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 071 4 Days (Post-Isolation)ELISA P/N Values (IgM Antibodies)0 5 10 15 20 25 30 35MIA Adjusted Values (IgM Antibodies) IgM Ab (ELISA) IgM Ab (MIA Confirm) IgM Ab (MIA Screen) Comparison o f HAI and ELISA Methods for Detection of Antibodies Following Natural SLEV Infection in a Sentinel Chicken Comparison of ELISA and MIA Methods for Detection of IgM Antibodies Followin g Natural SLEV Infection in a Sentinel Chicken A) B)

PAGE 248

223 Evaluation of SLEV-WNV Coinfection The isolation of West Nile virus and St. Louis encephalitis virus from the same chicken was unexpected. The exact date of infection is unknown, but a serum sample collected from the bird on October 3 was nega tive (Day -6). This site was not targeted until a week later, so a clo acal swab was not taken at that early time point. FLS502 (WNV) was isolated on October 9 (Day 0). FLS545 (WNV) was isolated from a swab collected from this bird on October 16 (Day 7) and FLS569 (SLEV) was isolated from a third swab collected on October 18 (Day 9). These samples were confirmed by real-time (TaqMan) RT-PCR [see Table 4-8 later in this section], gel-based RT-PCR (Figures 4-30, 4-31), and sequencing of the PCR products. A matching serum sample was not collected on Day 9, as cloacal swabs were collected tw ice a week and sera once a week. A final swab (FLS593) and serum sample was collect ed on October 23 (Day 14). However, virus was not detected or isolated from FLS593. Figure 4-22 illust rates the development of the primary immune response following natura l SLEV & WNV infec tion (based on SLEV antibody response) in this adult chicken, aged 52 weeks. Note: the exac t date of infection is unknown. Each serum sample was tested in th e MAC-ELISA for the detection of IgMspecific antibodies to SLEV and WNV. Plaque assays were also conducted to titer the quantity of infectious virus shed in the feces at each time point. Figure 4-23 compares MAC-ELISA IgM antibody results for SLEV a nd WNV (P/N values) from Day -6 to Day cross-reactive WNV IgM antibod ies detected in the MAC-ELISA (P/N values < 2.0 for all sera).

PAGE 249

224 Figure 4-22 Development of the Primary Immune Response Following Natural St. Louis Encephalitis Virus & West Nile Virus Infection in a Sentinel Chicken Day 0 indicates the time of first sample collection from Bird 8-003-R; not necessarily the first day of infection. IgM antibodies (blue line) to SLEV were present at Day 0 and declined through Day 14, as detected by the IgM ELISA (P/N values, blue line) [firs t y axis]. In a separate assay, total flavivirus antibodies (IgG + Ig M) were first detected by the hemagglutination inhibition assay (pi nk dashed line) on the same day as the initial WNV isolation [first y axis]. West Nile virus shed in the feces was detected on Day 0 and Day 7, whereas St. Louis encephalitis virus shed in the feces on Day 9 (triangles) [second y axis]. A cloacal swab taken 5 days post-isolation of SLEV was negative for virus (no virus detected, NVD) on Day 14. 3.7 1.46 3.7 3.7 2.4 3.9 0 32 816 36 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 0791 4 Days (Post-Isolation)Natural Log Total Ab Titer (HAI) or ELISA P/N Values (IgM Ab)0 100 200 300 400 500 600 700 800 900PFU/0.1 ml Flavi Total Ab (HAI) IgM Ab (ELISA) Virus WNV WNV SLEV Development of the Primary Immune Response Following Natural WNV and SLEV Infect ion in a Sentinel Chicken NVD

PAGE 250

225 00 0 816 0 32 36 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 0791 4 Days (Post-Isolation)ELISA P/N Value (IgM Ab)0 100 200 300 400 500 600 700 800 900PFU/0.1 ml SLE IgM Ab WN IgM Ab SLEV WNV Figure 4-23 Comparison of SLEV a nd WNV IgM Antibody Development and Estimate of Infectious Virus She d in the Feces of Bird 8-003-R MAC-ELISA IgM antibody results (P/N values) for SLEV (red bars) and WNV (gray bars) are shown for Bird 8-003-R from Day -6 to Day 14 [first y axis]. Virus plaque forming units detected on each swab (PFU/0.1 ml) are shown for WNV (gray line) and SLEV (dotted red line) [second y axis]. These assays confirmed that Bird 8-003-R seroconverted to St. Louis encephalitis virus, with no cross-reactive WNV IgM antibodies detected in the MAC-ELISA (P/N values < 2.0 for all sera). In addition, the titer of infectious West Nile virus was much higher (816 pfu/0.1ml) on the first day of cloacal swabbing (Day 0) than the titer shed in the feces 7 days later (36 pfu/0.1ml). St. Louis encephalitis virus was primarily shed in the feces (32 pfu/0.1ml) on Day 9. FLS502 FLS545 FLS569 FLS593

PAGE 251

226 Virus Neutralization Assays Neutralization assays were also conducted on these isolates to investigate possible co-infection of SLEV on the WNV swabs (FLS502 and FLS545) and/or WNV mixed on the SLEV swab (FLS569). The West Nile viru s isolates formed large plaques within 3 days and may have inadvertently blocked grow th of SLEV due to th e shorter incubation period of West Nile virus (3 days vs. 57 days). WNV-specific polyclonal antibodies (Cat. No. 0069) and SLEV-specific polyclona l antibodies (Cat. No. 0055)were obtained from the CDC, Fort Collins for use in the PRNT. Seri al dilutions (10-1 to 10-6) of cloacal swab virus isolates (FLS502, FLS545, and FLS569 passaged once in Vero cells) were challenged with the appropriate concentr ation of polyclonal antibody (1:100 for WNV isolates, 1:20 for SLEV) [concentration dete rmined by 95% plaque reduction of control viruses] Figure 4-24 illustrates the phenotype in Vero cells of FLS502 (WNV), FLS545 (WNV) and FLS569 (SLEV) wild type plaques compared to variant plaques that formed after virus-specific polyclonal antibody challenge (e.g. SLEV polyclonal antibody used to challenge FLS569). At least 20 individual plaques (clones) were picked for each strain challenged with antibody, suspended into 1 ml of SVD, and 140 l transferred to lysis buffer for RNA extraction. Clones were conf irmed SLEV and/or WNV (with real-time (TaqMan) RT-PCR assays. Real-time RT-PCR results are listed in Table 4-4 for 5 representative clones picked for each strain. None of the clones picked from FLS502 or FLS545 were confirmed as SLEV alone, although some of the clones were cross-reactive to both WNV & SLEV by TaqMan RT-PCR. In addition, FLS569 did not have confirmed WNV plaques

PAGE 252

227 Figure 4-24 Comparison of Plaque Phenotype of Arbovirus Isolates Before and After Polyclonal Antibody Challenge West Nile virus strains FLS502 and FLS545 were challenged with polyclonal WN antibody to neutralize infection so that plaque clones could be picked to determine co-infection with SLEV. FL S569 was challenged with polyclonal SLE antibody to neutralize SLEV infection for the identific ation of West Nile vi rus in a single swab. FLS502 FLS502 +WN Ab FLS545 FLS545 + WN Ab FLS569 FLS569 +SLE Ab WN+ NY99 Negative Control

PAGE 253

228 Table 4-4 Real-Time RT-PCR (TaqMan) Re sults for Arbovirus Clones Picked After Homologous Antibody Challenge Real-time RT-PCR assays were run for th e detection of virus strains. West Nile virus was detected using two prim er-probe sets specific to the virus (designated WNA & WNB, see Tabl e 3-7). Two primer-probe sets designed to specifically target S LEV (designated SLEA & SLEB, see Table 3-8) were used to detect St Louis encephalitis virus strains. Samples were screened with the A primer sets. If the homologous isolate only was detected (e.g. clon es 1c,14c,20c,31c identified WNA but not SLEA), the B primer sets were not tested on that clone. Positive A clones to a heterologous virus (e.g. clones 2c,7c,9c,11c,12c,13c that were detected by SLEA) were confirmed with the B primer sets. CT values 40 were considered positive, as pic ked clones were diluted and then extracted with only a small portion of the sample assayed (samples were confirmed positive by virus isolation in cell culture). Real-Time RT-PCR (TaqMan) Results for WNV & SLEV Arbovirus Strain Clone # WNA (CT) WNB (CT) SLEA (CT) SLEB (CT) #1c 20.99 NT Undet NT #2c 21.45 18.99 36.64 Undet #7c 21.79 19.50 33.99 34.19 #9c 19.32 17.90 35.59 34.69 FLS502 + WN Ab #31c 21.20 NT Undet NT #11c 19.83 17.46 37.25 Undet #12c 21.58 18.86 37.49 Undet #13c 19.41 18.24 36.47 32.98 #14c 21.30 NT Undet NT FLS545 +WN Ab #20c 23.87 NT Undet NT #55c Undet 39.31 Undet Undet #56c Undet 39.53 Undet Undet #58c 36.36 32.18 36.07 Undet #65c NT NT 31.29 30.01 FLS569 + SLE Ab #66c NT NT 27.66 25.64 *NT = Not Tested; Undet = viral RNA not detected, CT > 45 cycles.

PAGE 254

229 after neutralization with SLEV polyclonal antibodies. Instead, most clones were confirmed SLEV (14 of 20) or were cro ss-reactive to both WNV & SLEV by TaqMan RT-PCR (6 of 20) [see Table 4-4]. Bird 9-005-B (Site 001) St. Louis encephalitis virus was isolated from one chicken (Bird 9-005-B) that seroconverted to SLEV antibody positive, as confirmed by MAC-ELISA and PRNT assays. The virus was not detected on a swab collected on the same date as seroconversion (October 23). However, St. L ouis encephalitis viru s was isolated in culture on October 30, when the chicken wa s re-sampled following seroconversion. The bird was removed from the field after this date due to confirmation of infection (SLEVspecific IgM antibodies) in the MAC-ELISA Consequently, only two antibody positive sera samples were collected from this chicken on October 23 and 30. Despite high total flavivirus antibody titers in the seru m, SLEV was isolated (cultured) seven days following seroconvers ion. High SLEV-specific IgM levels (P/N 17.0) may have prevented virus isolation in the feces on date of seroconversion (October 23). Figure 4-25 compares the test results for three antibody assa ys (HAI, MAC-ELISA, and MIA) performed on these sera samples. Detailed test result data for Bird 9-005-B has been provided for each serology assay in Appendix G. Plaque assays were also conducted on pr ocessed swab (S-650) media to titer the quantity of infectious virus shed in the f eces. However, no plaques formed from this cloacal swab (titer less than 2 PFU/0.1 ml). This assay was repeated twice and no plaques were identified. However, addition of 1 ml of processed swab eluate to Vero cells

PAGE 255

230 Figure 4-25 Comparison of Serology Test Results for Bird 9-005-B A) Comparison of HAI and MAC-ELISA methods for the detection of flavivirus total antibody (HAI assay, dotted line) or SLEV-specific IgM antibody (MAC-ELISA, solid blue line). Total flavivirusspecific antibody remained elevated in sera collected at one time point following arbovirus isolation on Day 0 [second y axis]. SLEV-specific IgM antibody was the highest at Day 0 (P/N 17.0) and de clined over time [first y axis]. B) Comparison of MAC-ELISA and MIA methods for the detection of SLEV-specific IgM antibody. MAC-ELISA (blue line) [first y axis] and MIA screening (red line) [second y ax is] assays detected SLEV IgM antibodies on two time points, which also declined over time. An MIA confirmation assay (serum sample test ed with both positive and negative antigens) was not performed. 0 2 4 6 8 10 12 14 16 18 0 7 Days (Post-Isolation)ELISA P/N Values (IgM Antibodies)0 0.5 1 1.5 2 2.5 3 3.5 4Natural Log HAI Antibody Titer (Total Abs) IgM Ab Total Ab (IgM + IgG) 0 2 4 6 8 10 12 14 16 18 0 7 Days (Post-Isolation)ELISA P/N Values (IgM Ab)0 5 10 15 20 25 30MIA Adjusted Values (IgM Ab) IgM Ab (ELISA) IgM Ab (MIA Screen) Comparison of HAI and ELISA Methods for Detection of Antibodies Following Natural SLEV Infection in a Sentinel Chicken Comparison of ELISA and MIA Methods for Detection of IgM Antibodies Following Natural SLEV Infection in a Sentinel Chicken A) B)

PAGE 256

231 in a 25cm2 flask resulted in culture of the viru s. The passaged virus strain FLS650 was assayed for the ability to form plaques (see Arbovirus Growth Char acteristics, described later in this chapter). Al though plaque forming units were too low for detection on the cloacal swab elution media in the plaque assay, SLE viral RNA was detected directly from extracted swab material (CT = 37.53, SLEA primer-probe set). Figure 4-26 illustrates the development of the primar y immune response following natural SLEV infection in this adult chicken. Note: the exact date of infection is unknown. Bird 8-005-B (Site 004) West Nile virus was also isolated from one chicken that failed to seroconvert in the HAI assay (Bird 8-005-B, Site 004). Sera samples for this bird had unfortunately not been saved for retrospective testing and the BOL-Tampa was unable to further evaluate this chickens antibody profile (seroconvers ion) in the MAC-ELISA, MIA or PRNT assays. West Nile virus was isolated fr om another chicken (Bird 8-003-R, discussed previously) at this site, whic h also was not detected by th ese serology assays (confirmed SLEV antibody response instead). Bird 7-005-B (Site 005) & Birds 9-005-B, 9-000-W (Site 001) Novel flavivirus strains were detected in two diffe rent chickens at two sites. Two cloacal swabs from one bird (9-000-W) test ed positive by RT-PCR for this virus, despite a space of 20 days between sample collections. None of these novel flavivirus-positive chickens seroconverted and/or generated an tibodies detectable by the current HAI assay (SLEV-group antigen).

PAGE 257

232 Figure 4-26 Development of the Primary Immune Response Following Natural St. Louis Encephalitis Virus Infection in a Sentinel Chicken Day 0 indicates the time of seroconve rsion from a St. Louis encephalitis virus infected chicken; not the first day of infection. IgM antibodies were present at Day 0 and then declined over the next seven days, as detected by the IgM ELISA (P/N values, blue line) [second y axis]. In two separate assays, IgG antibodies were first detected by the hemagglutination inhibition assay on Day 0 and remained elevated over the 2 time points (pink dashed line) [first y axis]. Total antibody (IgG + IgM) titer ( 40) measured by the PRNT was also first detected on Day 0 (green) [first y axis]. No further serum samples were confirmed in the PRNT. Virus shed in the feces was detected by real time RT-PCR (TaqMan CT value, red) [second y axis], but the swab eluate had less than 1 PFU/ 0.1ml infectious virus in plaque assays. 37.53 0 0.5 1 1.5 2 2.5 3 3.5 4 -6 0 7 DaysNatural Log Total Ab Titer (HAI & PRNT)0 5 10 15 20 25 30 35 40ELISA P/N Values or TaqMan CT Values (SLEA) HAI (Flavi Total Ab) PRNT (Flavi Total Ab) ELISA (IgM Ab) SLEV RNA Development of the Primary Immune Response Following Natural St. Louis Encephalitis Virus Infe ction in a Sentinel Chicken X X

PAGE 258

233 Targeted Sampling of Wild Birds From April to December 2006, five wildli fe rehabilitation centers submitted 64 cloacal swabs from admitted birds targeted for arbovirus ev aluation. The Florida Fish and Wildlife Conservation Commission (FWC) also submitted 23 swabs collected from dead birds. A total of 87 swabs were submitted fr om 36 different bird species (see Appendix H) to the BOL-Tampa for virus detection and isolation assays. Birds were targeted for cloacal swab collection based on species (known amplifying host) and/or symptoms indicative of arboviral infec tion in live birds [Komar et al 2003; Brault et al 2004]. All wild bird cloacal swabs were processed and extracted for virus isolation and molecular detection assays. Despite triage of birds based on these crit eria, no virus was isolated or detected. Arbovirus Isolation and Detection During 2005-2006, a targeted sampling strategy for the isolation or detection of arboviruses from naturally exposed birds was implemented in severa l counties throughout Florida. Blood samples (2005 only) and clo acal swabs were collected from chickens located at potential hot z ones of arbovirus activity, based on weekly serological surveillance results (antibody positive in the HAI and/or MAC-ELISA tests). Table 4-5 summarizes the arboviruses isolated or detected from targeted sen tinel chickens during 2005-2006. Wild bird species were swabbed dur ing medical exams or after death, based on the species of bird and/or triage of symp toms. Virus was not isolated or detected from these wild birds.

PAGE 259

234 Table 4-5 Arboviruses Detected/Isolated During a Targeted Sampling Strategy of Sentinel Chicken Flocks (2005-2006) aNC viruses were detected by RT-PCR, but did not replicate in Vero cells. Arbovirus Strains Detected & Isolated from Adult Sentinel Chickens (2005-2006) STRAIN DESIGNATED LOCATION YEAR HOST PASSAGEa West Nile Virus FL05-M038 FL05-M042.2 FL05-M050 FL06-S502 FL06-S504 FL06-S545 FLM38 FLM42-2 FLM50 FLS502 FLS504 FLS545 Manatee Co., FL Manatee Co., FL Manatee Co., FL Sarasota Co., FL Sarasota Co., FL Sarasota Co., FL 2005 2005 2005 2006 2006 2006 Chicken Chicken Chicken Chicken Chicken Chicken Vero 1 NCNC Vero 1 Vero 1 Vero 1 St. Louis Encephalitis Virus FL06-S569 FL06-S650 FLS569 FLS650 Sarasota Co., FL Sarasota Co., FL 2006 2006 Chicken Chicken Vero 1 Vero 1 Novel Flavivirus FL06-S649 FL06-S694 FL06-S853 FLS649 FLS694 FLS853 Sarasota Co., FL Sarasota Co., FL Sarasota Co., FL 2006 2006 2006 Chicken Chicken Chicken NC NC NC Eastern Equine Encephalitis Virus FL05-R80 FL05-R84 FL05-R86 FL05-R90 FLR80 FLR84 FLR86 FLR90 Orange Co., FL Orange Co., FL Orange Co., FL Orange Co., FL 2005 2005 2005 2005 Chicken Chicken Chicken Chicken NC NC NC NC

PAGE 260

235 Blood Samples In 2005, blood samples were collected and placed on ice packs for virus detection/isolation assays from targeted sentinel chickens. Whole blood samples from chickens collected in Orange County were extracted and screened with Eastern equine encephalitis virus specific TaqMan prime r-probe sequences (Lambert, Martin and Lanciotti, 2003). Blood samples collected in Manatee County were screened with both West Nile virus (Lanciotti et al 2000) and St. Louis encephalitis virus (Lanciotti and Kerst, 2001) specific TaqMan primer-probe sequences, used as previously described. A total of 200 blood samples were tested (n=100 from each county), including five samples collected from birds (different sites in tw o counties) on the same date that virus was isolated from a corresponding cloacal swab. No virus was detected or isolated from these processed blood samples, as tested by real-time RT-PCR (TaqMan) with the above primer-probe sets. Cloacal Swabs In 2005, three counties participated in th e Arbovirus Isolatio n/Detection Network and implemented a targeted strategy for the co llection of samples from sentinel chicken flocks. A total of 129 birds were sampled in Manatee, Orange and Sarasota counties. 623 cloacal swabs were collected. A retrospect ive processing strategy was used by the BOLTampa to assay a subset of these samples, where 259 swabs were processed and extracted for virus isolation and molecular detection assays. Arboviruses (two EEEV and three WNV) were detected in five ch ickens (out of 129 sampled). In 2006, five counties participated in th e Arbovirus Isolation/Detection Network. A total of 95 chickens were sampled in Lee, Orange, Pasco, Sarasota and Volusia

PAGE 261

236 counties, where 1338 cloacal swabs were co llected. The BOL-Tampa retrospectively processed 529 swabs for virus isolation and molecular detection assays. Arboviruses (two SLEV, two WNV, and three novel flaviviruses ) were isolated and/or detected in six chickens from one county (Sarasota). Arbovirus Characterization Real-Time RT-PCR (TaqMan) In Orange County, EEE viral RNA only was detected in two birds (four isolates were identified, as each bird was swabbed twice). However, the aims of the study were to characterize flavivirus isolates and these EEEV strains were not further analyzed. WNV was detected and isolated from one bird in Manatee County (FLM38). Two additional isolates were identified by the de tection of WN viral RNA on cloacal swabs from Manatee County chickens (three WN pos itive of 119 tested). These swabs were collected and processed from August to November 2005 by the BOL-Tampa. Real-time RT-PCR results are listed in Table 4-6 for arboviruses isolated/detected in Orange and Manatee counties during 2005. In 2006, three isolates were made from one chicken (Bird 8-003-R), including two West Nile virus strains isolated prior to a St. Louis encephali tis virus strain cultured from the last swab collected. West Nile virus was al so isolated from another chicken located at the same site (004). One cloacal swab processed in Dece mber 2006 from Bird 7-005-B (Site 005) replicated in Vero cell culture (+ cpe at 4 DPI, cpe at 5 DPI). The culture was passed again in Vero cells (+ cpe at 7 DPI) to improve viral tite r. However, both the swab and cultures for this bird were ne gative on screening by real-time RT-PCR for

PAGE 262

237 WNV, SLEV, and EEEV (data not shown for EEEV). This FLS281 isolate was later identified as Newcastle virus in March 2008 with the SLEC end-point primer set [data not shown]. A novel flavivirus strain (FLS853) was detected by real-time RT-PCR with WNV and SLEV primers in February 2007, but did not replicate (produce cytopathic effect) in Vero cells. This isolated viral RNA was interesting as more than 100 of the WNV positive samples tested by the BOL-Tampa since the introduction of WNV to Florida did not cross-react with the SLEV-specific primer-probe sets developed by the CDC (Lanciotti et al 2000; Lanciotti and Kerst, 2001), when run in parallel. In addition, the CDC had validated these primer sets prior to publication and reported that these two strains did not cross-react in real-time RT-PCR (TaqMan) assays with the primer sets, as supported by BOL-Tampa results. A total of 381 cloacal swabs were pro cessed at the BOL-Tampa from August 2006 through April 2007. In September 2007, 46 swabs collected in Sarasota County were retrospectively proce ssed based on positive RT-PCR re sults (FLS853) from Site 001. A second SLEV isolate was made from Bird 9-005-B (strain FLS650). Two novel flavivirus strains (FLS649 and FLS694) were also de tected in two chickens at this site. TaqMan real-time RT-PCR results are listed in Table 4-7 for arboviruses isolated/detected from sentinel chic ken cloacal swabs collected during 2006. End-Point RT-PCR Traditional gel-based (end-point) RT-PCR a ssays were either performed directly on RNA extracts of cloacal swab material and/ or Vero cell cultures to confirm real-time RT-PCR detection of most strains isolated in 2005-2006. End-point primers specific for

PAGE 263

238 Table 4-6 Real-Time RT-PCR (TaqMan) Results for Arboviruses Isolated from Sentinel Chickens in 2005 Real-time RT-PCR assays were run in dupli cate for the detection of virus strains. Arboviruses were detected using two primer-probe sets specific to each virus (designated EEEA & EEEB for EEEV; design ated WNA & WNB for WNV; and designated SLEA & SLEB for SLEV). Samples were scr eened with the A primer sets. Samples that confirmed with the B primer sets were considered true positives. CT values were averaged and values 40 were considered positive, as virus titers in cloacal swabs were low. Real-Time RT-PCR (TaqMan) Res ults for EEEV, WNV & SLEV 2005 Virus Strains EEEA (CT) EEEB (CT) WNA (CT) WNB (CT) SLEA (CT) SLEB (CT) FLR80 33.95 33.41 Undet Undet NT NT FLR84 33.57 36.96 Undet Undet NT NT FLR86 33.68 36.54 Undet Undet NT NT FLR90 33.90 33.57 Undet Undet NT NT FLM38 Undet Undet 34.50 34.56 Undet Undet FLM42.2 Undet Undet 35.30 37.28 Undet Undet FLM50 Undet Undet 36.32 34.65 Undet Undet *NT = Not Tested to conserve RNA template volum e; Undet = viral RNA not detected, CT > 45 cycles.

PAGE 264

239 Table 4-7 Real-Time RT-PCR (TaqMan) Re sults for Arboviruses Isolated from Sentinel Chickens in 2006 Real-time RT-PCR assays were run in duplicate for the detection of virus strains. West Nile virus was detected using two primer-probe sets specific to the virus (designated WNA & WNB) Two primer-probe sets designed to specifically target SLEV (designated SLEA & SLEB) were used to detect St. Louis encephalitis virus strains. Samples were screened with the A primer sets. Samples that confirmed with the B primer sets were considered true positives. CT values were averaged and values 40 were considered positive, as virus titers in cloacal swabs were low. Real-Time RT-PCR (TaqMan) Results for WNV & SLEV 2006 Virus Strains WNA (CT) WNB (CT) SLEA (CT) SLEB (CT) FLS281 Undet Undet Undet Undet FLS502 25.00 26.4 Undet Undet FLS504 33.55 34.95 Undet Undet FLS545 33.27 34.88 Undet Undet FLS569 Undet Undet 23.76 15.85 FLS650 Undet Undet 35.53 34.48 FLS649 Undet NT 38.37 38.24 FLS694 37.77 31.26 36.20 38.01 FLS853 36.5 36.49 36.01 Undet *NT = Not tested to conserve RNA template volume; Undet = vira l RNA not detected, CT > 45 cycles, Assayed cell culture supe rnatant (with negative cpe). Note: FLS649 cell culture supernatant not assayed.

PAGE 265

240 WNV (Table 3-7) and SLEV (Table 3-8) we re used to assay each new arbovirus strain detected by TaqMan RT-PCR, as well as two uni versal primer sets for identification of most arthropod-borne flaviviruses In addition, reference strains of St. Louis encephalitis virus and West Nile virus archived at th e BOL-Tampa were assayed with gel-based primer sets for sequence and phylogenetic comp arison to recent isolates (Table 3-1, also see Tables 4-9 and 4-10 la ter in this section). Two gel-based primer sets each were used for confirmation of real-time results (CT 40) for St. Louis encephalitis virus (com plete envelope & SLEC, Table 3-8), West Nile virus (WNAE & WN BE, Table 3-7), and/or flavivirus group (partial NS5, 3NC regions, Table 3-9). PCR products were electr ophoresed and amplicons of the appropriate size were excised from the gel and purified for sequence analysis. SLEV Envelope Region The largest PCR product generated for anal ysis in this study was the complete envelope region (~1700bp). The F880/B2586 primer set was used to specifically detect and amplify the SLEV envelope for phylogenetic analysis, as previously described by Kramer and Chandler (2001). Four internal pr imers (two sense and two anti-sense) were used to overlap segments for sequenci ng of both directions along the genome. In addition, a 5 partial envelope region (750bp) was amplified with the forward (F880) and one internal anti-sense primer (B1629) for rapid sequence analysis of a smaller region (however, only sequence analysis of the complete region was used for this study). Gel electrophoresis of these PCR produc ts identified a single band for both North American and South American strains of SLEV with the envelope primer sets (Figure 427). These SLEV envelope primer sets also did not cross-react with West Nile virus.

PAGE 266

241 Figure 4-27 Gel Electrophoresis of SLEV Isolates (Envelope Region) RT-PCR was performed with F880/ B2586 primers to amplify the complete envelope region of SLEV isolates for sequencing. In addition, a partial portion of the envelope gene was amplified with F880/B1629 primers (5 end). Both PCR products were run on 1.0% agarose gels and resulted in single bands (complet e envelope product size 1.7 kb, partial product 750bp) for both North and South American strains. Lane 1: Marker (10 kb ladder) Lane 2: Blank Lane 3: FL85a [partial envelope] Lane 4: NTC Lane 5: SLE+ (TBH-28) [complete envelope, lanes 5-13] Lane 6: FLS569 Lane 7: FL52 Lane 8: TR62 Lane 9: BR69 Lane 10: FL90d Lane 11: FL90b Lane 12: FL72 Lane 13: FL85a Lane 14: NTC 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 267

242 SLEV M/E Region The SLEC primer set (SLE727/SLE1119c) [Lanciotti and Kerst, 2001] was also used for phylogenetic analysis of the Membrane (M)/Envelope (E) region of recent SLEV isolates compared to a selected subset of reference strains (FL52, TBH-28, FL72, FL85a, BR69 and TR62) [Figure 4-28]. Unlike the SLEV complete envelope primers, this primer set detected West Nile virus but resulted in an amplicon of the incorrect size (~700bp) [data not shown]. WNV Capsid/prM Region A small portion of the West Nile virus capsid and precursor membrane region was amplified by the WNAE primer set (WN233/WN640c) [Lanciotti et al 2000]. Real-time TaqMan RT-PCR results were confirmed West Nile virus positive with this primer set. Multiple sequence and phylogenetic analysis of this region was evaluated for all cultured isolates of WNV, as well as used to characterize novel flavivirus strains (Figure 4-29). Flavivirus NS5 Region The Fu1/cfd3 primer set (Kuno et al 1998) was used to amplify the NS5 (RNA dependent RNA polymerase) region of the flavivirus genome. This universal primer set detected both WNV and SLEV; sequencing of the PCR products (Figure 4-30) was used to generate a multiple sequence alignment and phylogeny of both virus species An additional experimental primer set devel oped by the CDC (personal communication, RS Lanciotti) and sequences provided to the BOL-Tampa for gel-based confirmation of WNV (also cross-reactive with SLEV) detected a 300 bp region of the NS5 gene (downstream at the 3end) [Figure4-31]. Howe ver, this primer set did not amplify the Florida WNV isolates well for

PAGE 268

243 Figure 4-28 Gel Electrophoresis of FL S569 & SLEV Reference Strains (SLEC: M/E Region) RT-PCR was performed with SLE727/ SLE1119c primers to amplify the M/E region of St. Louis encephalitis virus. PCR products were run in duplicate on 1.0% agarose gels. A single band was produced (400bp) for both North and South American strains. Lanes 1, 15: Marker (1 kb ladder) Lanes 2, 4, 6, 9, 12, 16, 19, 22, 25: Blank Lane 3: SLE + (TBH-28) Lane 5: FLS569 Lanes 7, 8: FL52 Lanes 10, 11: TR62 Lanes 13, 14: BR69 Lanes 17, 18: FL90d Lanes 20, 21: FL90b Lanes 23, 24: FL72 Lanes 26, 27: FL85a Lane 28: NTC 15 16 17 18 19 20 21 22 23 24 25 26 27 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 269

244 Figure 4-29 Gel Electrophoresis of FLM38 & WNV Reference Strains (WNAE: Capsid/prM Region) RT-PCR was performed with WN233/ WN640c primers to amplify the capsid/prM region of West Nile virus. Visualizat ion of PCR products was run on 1.0% agarose gels. A single ba nd was produced (408bp) for both recent and archived strains of West Nile virus. Lanes 1, 14, 15, 28: Marker (1 kb ladder) Lane 2: WN + (NY99) Lanes 3, 5, 7, 9, 11, 13, 17, 19, 21, 23, 25, 27: Blank Lane 4: WN + (Eg101) Lane 6: FLWN01a Lane 8: FLWN01b Lane 10: FLWN02a Lane 12: FLWN02b Lane 16: FLM38 Lane 18: FLWN05a Lane 20: FLWN05b Lane 22: FLCxs231 Lane 24: FLCxn280 Lane 26: NTC 15 16 17 18 19 20 21 22 23 24 25 26 27 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 270

245 Figure 4-30 Gel Electrophoresis of FLS502, FLS545 & FLS569 (NS5 Region) RT-PCR was performed with FU1/cFD3 primers to amplify the partial internal NS5 region of flaviviruses PCR products were run in duplicate on 1.0% agarose gels. A distinct triple banding pattern (sizes 1 kb, 750 bp, and ~300 bp) and was found in this region in FLS569 (SLEV) that was not seen for North American SLEV or WNV strains (a single 1 kb band). Lanes 1, 15: Marker (1 kb ladder) Lanes 2, 5, 6, 9,10, 13, 16, 18, 19, 22, 23, 26, 27: Blank Lanes 3, 4: SLE + (TBH-28) Lanes 7, 8: FLS569 Lanes 11, 12: FLS502 Lanes 14, 28: Marker (10 kb ladder) Lane 16: NTC Lane 17: SLE + (TBH-28) Lanes 20, 21: FLS545 Lanes 24, 25: WN+ (NY99) 15 16 17 18 19 20 21 22 23 24 25 26 27 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 271

246 Figure 4-31 Gel Electrophoresis of FL S502, FLS545 & FLS569 Isolated from Bird 8-003-R (WNBE: 3 NS5 Region) RT-PCR was performed with primers to amplify the 3 region of the NS5 gene of flaviviruses PCR products were run in duplicate on 1.0% agarose gels. SLEV strains also amplified w ith this primer set and resulted in several amplicon sizes (including FLS569) that was not seen for WNV strains (a single 300bp band). Lanes 1, 15: Marker (1 kb ladder) Lanes 2, 5, 6, 9,10, 13, 16, 18, 19, 22, 23, 26, 27: Blank Lanes 3, 4: SLE + (TBH-28) Lanes 7, 8: FLS569 Lanes 11, 12: FLS502 Lanes 14, 28: Marker (10 kb ladder) Lane 16: NTC Lane 17: SLE + (TBH-28) Lanes 20, 21: FLS545 Lanes 24, 25: WN+ (NY99) 15 16 17 18 19 20 21 22 23 24 25 26 27 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 272

247 sequencing reactions, so it was only used for additional confirmation of novel flavivirus strains. Flavivirus 3NC Region The YF1/YF2 primer set amplif ied the 3 non-coding region of flaviviruses A subset of SLEV strains (FL52, TB H-28, FL72, FL85a, FL90b, FL90d, FLS569, TR62, BR69) were evaluated with this primer set (Figure 4-32).

PAGE 273

248 Figure 4-32 Gel Electrophoresis of FLS 569 & SLEV Reference Strains (YF: 3 NC Region) RT-PCR was performed with YF1/YF 2 primers to amplify the 3NC region of flaviviruses A subset of SLEV strain s was sequenced in this region for comparison to recent SLEV is olates (FLS569 shown below). PCR products were run in replicate on 1.0% agarose gels. Lanes 1, 2: BR69 Lanes 3, 5, 7, 10, 13, 16, 19, 22, 25: Blank Lane 4: SLE + (TBH-28) Lane 6: FLS569 Lanes 8, 9: FL52 Lanes 11, 12: TR62 Lanes 14, 15: Marker (1 kb) Lanes 17, 18: FL90d Lanes 20, 21: FL90b Lanes 23, 24: FL72 Lanes 26, 27: FL85a Lane 28: NTC 15 16 17 18 19 20 21 22 23 24 25 26 27 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 274

249 Sequence Analysis A minimum of two forward and two revers e sequencing reactions were performed for each PCR product analyzed. Sequences were uploaded into the DNAStar program (SeqManII) to edit base calls and to gene rate a consensus (contig) sequence for each sample. The consensus sequences were entered into the BLASTN tool ( http://www.ncbi.nlm.nih.gov/ ) to search the GenBank nucleotide database for homologous strains. The top 5 matches (with accession number, max score, query coverage, e-value, and max identity score) for each strain and primer set are provided in Appendix I for SLEV, Appendix J for WNV, and Appendix K for novel flavivirus strains. MEGA4.0.1 was used to generate multiple sequence alignments for each region analyzed (ClustalW 1.6 algorithm). Sequences were trimmed to specific start and stop positions to minimize gapped data for SLEV and WNV strains (Table 4-8). Position numbers were based on the complete nuc leotide sequence of the Kern217 strain (Accession # NC_007580) for SLEV, or th e complete sequences of WN NY99 (Accession # AF196835) and WN Egypt101 (Ac cession # AF260968) for WNV isolates. These alignments were used to generate phy logenetic trees and to identify mismatched nucleotide bases and/or predic ted translational (amino acid) changes in each strain. Multiple sequence alignments (nucleotide and amino acid) for West Nile virus are provided in Appendix L (WNAE primer se t) and Appendix M (WNBE primer set). Nucleotide and translated protein alignments for St. Louis encephalitis virus are provided in Appendix N (complete envelope primer set), Appendix O (membrane/envelope, SLEC primer set). Flavivirus alignments are provided in Appe ndix P (NS5, Fu1/cfd3 primer set)

PAGE 275

250 Table 4-8 Analyzed Regions of the Virus Genome (Nucleotide Base and Amino Acid Positions) Multiple sequence alignments were trimmed to the nucleotide base or amino acid positions provided below, based on complete nucleotide sequences of SLEV and WNV. Th e capsid/prM (WNAE) and 3NS5 (WNBE) regions were analyzed for WNV strains only. Partial membrane/envelope (SLEC), complete e nvelope, and 3NC (YF) regions were analyzed for SLEV strains only. Both WNV and S LEV sequences were evaluated in the NS5 region. Analyzed Regions of the Virus Genome* Capsid/prM (WNAE) Mem/Env (SLEC) Envelope NS5 3NS5 (WNBE) 3NC Sequence Position Number (Nucleotide Bases) 231 640 734 1082 916 2547 9082 10087 (WN) 9072 10077 (SLE) 9505 9776 10104 10706 Sequence Position Numbers (Amino Acids) 78 214 246 362 308 850 3031 3364 (SLE) 3033 3366 (WN) 3169 3259 NA *Nucleotide base positions and translated amino acid positions are numbered according to the complete nucleotide sequence of Kern217 for SLEV, and complete nucleotide sequen ces of WNNY99 and WNEgypt101 for WNV isolates.

PAGE 276

251 and Appendix Q (3NC, nucleotide alignment only). Standard amino acid abbreviations (1 letter symbols) are listed in Appendix S. The following flavivirus reference and recent (2005-2006) strains were sequenced by the BOL-Tampa. Sequence results were firs t uploaded into the BLASTN search tool in GenBank to identify strains with the closest sequence identity to these isolates. A multiple sequence alignment was then pe rformed for each region, including outgroup (and SLEV Kern217) sequences download ed from GenBank, to identify unique nucleotide and predicted amino acid differen ces. Table 4-9 provides a comprehensive list of the strains sequenced fo r this project by the BOL-Ta mpa, including the strain designation, host, collection date, and virus id entity. In addition, Table 4-10 provides the RT-PCR and sequencing results for each strain. St. Louis Encephalitis Virus Strains FL52 The 1952 reference strain was isolated fr om the first recognized human case of SLEV in Florida, a Miami resident. BLAS TN search results on the envelope sequence identified that FL52 shares 97% sequence iden tity with strains from Tampa Bay, Florida (GHA-3), Mexico (65 V 310), a nd the prototypical Parton strain (USA, Missouri). The NS5 and M/E (SLEC) regions also matche d the Tampa Bay (TBH-28), Mexico, and Parton strains with 97% iden tity (Appendix I). The 3NC region matched Kern217 (California), MSI-7 (Mississippi), and South American st rains with 96% identity (Appendix I). However, these results are likely due to the limited number of SLEV strains that have been completely sequenced in this region and submitted to the GenBank database.

PAGE 277

252 Table 4-9 Recent 2005-2006 and Reference Flavivirus Strains Sequenced Thirty flavivirus strains were sequenced in this study, including eight new strains isolated from sentinel chickens in Florida. The exact collection date for recent strains is shown below, whereas the year of collection for all reference strains has been provided. St. Louis encephalitis virus isolates are shaded in gray. STRAIN DESIGNATION HOST COLLECTION DATE VIRUS IDENTITY FL05-M038 FLM38 Chicken 1773 09.12.05 WNV FL06-S502 FLS502 Chicken 8-003-R 10.09.06 WNV FL06-S504 FLS504 Chicken 8-005-B 10.09.06 WNV FL06-S545 FLS545 Chicken 8-003-R 10.16.06 WNV FL06-S569 FLS569 Chicken 8-003-R 10.18.06 SLEV FL06-S649 FLS649 Chicken 9-004 G 10.30.06 FLAVI FL06-S650 FLS650 Chicken 9-005-B 10.30.06 SLEV FL06-S694 FLS694 Chicken 9-000-W 11.06.06 FLAVI Eg101 WNEgypt Human 1952 WNV 385-99 WNNY99 Snowy Owl 1999 WNV FL01-I401 FLWN01a Crow 2001 WNV FL01-I403 FLWN01b Blue Jay 2001 WNV FL02-M1215 FLWN02a Oc. taeniorhy. 2002 WNV FL02-M1220 FLWN02b Oc. taeniorhy. 2002 WNV FL05-I189 FLWN05a Alligator 2005 WNV FL05-I242 FLWN05b Crow 2005 WNV Miami FL52 Human 1952 SLEV TBH-28 TBH-28 Human 1962 SLEV F72-M022 FL72 Opossum 1972 SLEV 86-100309 FL85a Cx. nigripalpus 1985 SLEV 86-100802 FL85b Cx. nigripalpus 1985 SLEV 1A-059 FL89 Northern cardinal 1989 SLEV 3-594 FL90a Common grackle 1990 SLEV 3A-038 FL90b Mourning dove 1990 SLEV 3-582 FL90c Common grackle 1990 SLEV CXN GR8 FL90d Cx. nigripalpus 1990 SLEV TRVL 21647 TR58 Cx. coronator 1958 SLEV TRVL 43174 TR62 Cx. nigripalpus 1962 SLEV BeAn 70092 BR64 Kingfisher 1964 SLEV BeAn 156204 BR69 Chicken 1969 SLEV

PAGE 278

253 Table 4-10 Primer Sets for Sequencing of Recent 2005-2006 and Reference Flavivirus Strains Arbovirus strains were tested with a total of six primer sets for sequencing. The complete envelope was sequenced for reference and recent SLEV strains, whereas the capsid/prM (WNAE) region was sequenced for reference and recent WNV strains. The NS5 region was sequenced for both WNV and SLEV strains. STRAIN DESIGNATION WNAE SLEC ENV NS5 WNBE 3NC FL05-M038 FLM38 NT NT DNS NT FL06-S502 FLS502 X X DNS NT FL06-S504 FLS504 X X NT FL06-S545 FLS545 X X DNS NT FL06-S569 FLS569 DNS NT FL06-S649 FLS649 X X DNS X FL06-S650 FLS650 NT NT NT FL06-S694 FLS694 X X X Eg101 WNEgypt NT X 385-99 WNNY99 X X FL01-I401 FLWN01a NT NT NT NT FL01-I403 FLWN01b NT NT NT NT FL02-M1215 FLWN02a NT NT NT NT FL02-M1220 FLWN02b NT NT NT NT FL05-I189 FLWN05a NT NT NT NT FL05-I242 FLWN05b NT NT NT NT Miami FL52 NT NT TBH-28 TBH-28 X DNS F72-M022 FL72 NT NT 86-100309 FL85a NT NT 86-100802 FL85b NT NT NT NT 1A-059 FL89 NT NT NT NT 3-594 FL90a NT NT NT NT 3A-038 FL90b NT NT NT 3-582 FL90c NT NT NT NT CXN GR8 FL90d NT NT NT TRVL 21647 TR58 NT NT NT NT TRVL 43174 TR62 NT NT BeAn 70092 BR64 NT NT NT NT BeAn 156204 BR69 NT NT Legend: = sequenced, X = did not amplify, DNS = did not sequence (amplicon failed to sequence), NT = not tested.

PAGE 279

254 Multiple sequence alignment with other Florida (TBH-28, FL72, FL85a&b, FL90a-d) and South American reference strains (TR58, TR62, BR64, BR69) identified 21 changes in the envelope nuc leotide sequence that were unique from other Florida SLEV viruses. This resulted in 13 amino acid changes in the translat ed envelope protein (substituted amino acids are located on right side of each arrow in Table 4-11). One insertion of an adenine (A) base between positions 1580 and 1581 resulted in the insertion of a cysteine in the amino acid sequence (528-529). Six nucleotide substitutions were detected in the partial NS5 region, with five amino acid changes. In addition, one nucleot ide (C) was inserted between positions 9741 and 9742 resulting in the insertion of a glutamine (Q between positions 3250 and 3251) in the protein sequence. One nucleotide difference was found in the membrane/envelope (SLEC) region, a synonymous mutation resul ting in one amino acid substitution (asparagine). Finally, 3 nucleotide diff erences were noted in the 3NC region (untranslated) [Table 4-11]. These alignmen ts are provided for all SLEV strains in Appendices N-Q. TBH-28 Tampa Bay 28 is a commonly used reference strain of SLEV. For the purpose of this study, it was included as a representative Florida SLEV isolate collected in the 1960s. BLASTN search results on the envelope region sequenced by the BOL-Tampa identified that TBH-28 shares 99% sequence identity with strains from Tampa Bay (TBH-28) and Pinellas (P-15) county, Florida (a s expected for the positive control strain). The Mexico strain (65 V 310) sh ares 98% identity with TBH-28 in the envelope region.

PAGE 280

255 Table 4-11 Nucleotide and Amino Acid Changes Iden tified in SLEV Strain s from Florida (1952-1990) Multiple sequence alignments identified unique nucleotide and amino acid changes in a comparison of reference SLEV strains (FL & South America) and the Kern217 (California) st rain (complete sequence). Envelope Region NS5 Region SLEC Region 3NC Region SLEV Strain # Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) FL52 1006, 1100, 1147, 1200, 1203, 1214, 1388, 1413, 1551, 1552, 1776, 1816, 2044, 2082, 2134, 2162, 2232, 2254, 2393, 2425 Ai (1580-1581) 369 (* R) 402 (K R) 403 (L R) 407 (K E) 473 (H R) 519 (S F) 683 (F L) 713 (T A) 722 (E G) 753 (I V) 799 (R H) 810 (V I) Yi (528-529) 9074, 9164, 9230 9315, 9320, 9490 Ci (9741-9742) 3028 (G E) 3058 (T I) 3080 (S F) 3110 (K R) 3166 (R K) Q i (32503251) 1006 No unique translated differences 10353 10522 10629 TBH-28 1135, 1146, 1458, 1506, 1713, 1734, 1953, 2007, 2157, 2322, 2442 381 (E K) 384 (T M) 488 (L P) 504 (A V) 9093, 9197, 9905 3034 (E D) 3069 (L S) No unique nucleotide differences No unique translated differences 10137 10405 10427 10580 T i (1065810659) FL72 923, 954, 1128, 1322, 1425, 1522, 2055, 2091, 2319, 2490 310 (S F) 320 (R Q) 378 (L P) 403 (L P) 443 (H Y) 477 (I T) 522 (R S) 9104, 9215, 9368, 9378, 9629, 9641, 9890, 9914 3038(T I) 3075 (R K) 3126 (L S) 3213 (G E) 3217 (L P) 897, 954 301 (* W) 320 (R Q) 10188 10323 10532 iInserted nucleotide base/amino acid at the position number. *Termination (stop codon). Matched Kern217 (California).

PAGE 281

256 Table 4-11 Nucleotide and Amino Acid Changes Identifi ed in SLEV Strains from Florida (1952-1990), Continued Bolded residues are shared in FL ep idemic strains (1989-1990), but are unique from the other SLEV strains analyzed (except where noted for Kern217). Envelope Region NS5 Region SLEC Region 3NC Region SLEV Strain # Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) FL85 (a & b) No unique nucleotide differences No unique translated differences 9086, 9926 3032(E A) 864 290 (MT) (FL85a) 10165, 10257, 10325, 10400, 10417, 10431, 10675 FL89 1068 b, 1092, 1239, 1335, 1461, 1493 c, 1800, 1899, 1986, 2010, 2076, 2196, 2313, 2433, 2460 366 (S L) 415 (A V) 447 (R K) 489 (D G) 9188, 9254, 9296, 9387, 9446, 9653, 9710, 9752, 9863, 9875, 9956, 10037, 10040, 10055 3066 (M T) 3088 (Q R) 3102 (PL) 3132 (I S) 3152 (TI) 3221 (V A) 3240 (PL) NT NT NT FL90 a, b, c & d 1068 b, 1092, 1239, 1335, 1461, 1493 c, 1800, 1899, 1986, 2010, 2076, 2196, 2313, 2433, 2460 358 (H R)b 470 (R Q) 500 (R W) c 366 (S L) 415 (A V) 447 (R K) 489 (D G) 9188, 9254, 9296, 9387, 9654, 9701, 9710, 9752, 9863, 9875, 9956, 10040, 10055 3066 (M T) 3088 (Q R) 3102 (PL) 3132 (I S) 3221 (V A) 3237 (TI) 3240 (PL) NT NT (FL90b & d) 10176, 10242, 10252, 10435 FL85a or FL90a only. bFL90a, c, d only. cFL90c only. Matched Kern217 (California). *T ermination codon. NT = not tested

PAGE 282

257 Similar results were found with the NS5 (additional match to MS I-7 strain at 97% identity) and partial membrane/enve lope (SLEC) regions [Appendix I]. Multiple sequence alignment with other re ference strains indicates that TBH-28 has 11 unique nucleotide differences (Table 4-11) but only four amino acid changes in the predicted translated protein. Alignment of the NS5 region identified three unique nucleotide differences, with two translationa l differences. No unique differences were found in the partial membrane/envelope regi on (SLEC), as compared to the reference strains in this study. Five nucleotide differen ces were noted in the 3NC region, including the insertion of thymine between positions 10658 and 10659 [Table 4-11]. FL72 The FL72 strain of SLEV was isolated from the blood of an adult, female opossum in 1972 from the Florida panhandle (W alnut Hill, Escambia County). BLASTN search results on the envelope region seque nced by the BOL-Tampa identified that FL72 shares 97 98% sequence identity with strains from South America (Brazil: BeAn246262, BeAr 23379 and BeH203235), as well as 96% identity with one strain from Peru (75 D 90). Similar results were found with the NS5 and partial membrane/envelope (SLEC) regions, with an additional match to a Trinidad strain (TRVL 9464) at 96% identity (Appendix I). Multiple sequence alignment with SLEV reference strains identified ten nucleotide base differences in the envelope region, resulting in seven translational changes (see Table 4-11). Alignment of the NS5 region identified eight unique nucleotide differences, with five amino aci d substitutions. In addition, two nucleotide changes were detected in the M/E region, with two amino acid substitutions. Three

PAGE 283

258 nucleotide differences were noted in the 3 NC region, where one of these substitutions was shared by the Kern217 stra in of SLEV [Table 4-11]. FL85 (a & b) During 1985 through 1997, archived SLEV isolates at the BOL-Tampa were collected in Indian River C ounty, Florida, which experienced the most recent large outbreaks of SLEV in the state. FL85 (a & b) strains were collected during an interepidemic year from Culex nigripalpus pools. BLASTN search results on the envelope sequence identified that FL85 a & b share 99% sequence identity with the Mexico strain (65 V 310), as well as 98% identity with stra ins from Tampa Bay (TBH-28 and GHA-3). Similar results were found with the NS5 (additional match to MSI-7 strain at 97% identity) and partial membrane /envelope (SLEC) regions [Appendix I]. Multiple sequence alignment with SLEV reference strains identified no unique nucleotide or amino acid differences in the en velope region for FL85a & b. Alignment of the NS5 region identified two nucleotide di fferences in FL85a, with only one change noted in FL85b (position 9086). The single change shared by FL85a & b resulted in one amino acid substitution (glutamic acid to al anine at position 3032). In addition, one nucleotide change was detected in the M/E region (SLEC primers) in FL85a, with one amino acid change. Seven nucleotide differen ces were also noted in the 3NC region (untranslated) for FL85a, but were non-codi ng [Table 4-11]. FL85b was not assayed with the SLEC or YF primer sets (Table 4-10). FL89 SLEV strain FL89 was isolated from the blood of a northern cardinal in Indian River County, Florida in 1989. BLASTN s earch results on the envelope sequence

PAGE 284

259 identified that FL89 shares 98% sequence identity with USA strain (V 2380-42), Guatemala strain (78 A 28), and Tennessee st rain (TNM 4-711). Guatemala strain (GMO 94) and Tampa Bay strain (GHA-3) were also in the top five matches, with 97% sequence identity. Similar results were found with the NS5 region (additional match to Mexico 65 V 310 strain @ 97% identity); this region did not include a Tampa Bay isolate in the top 5 matches [Appendix I]. Multiple sequence alignment with SLEV re ference strains identified 15 mutations in the envelope region, the majority of whic h were silent and did not alter the protein sequence. However, four amino acid substi tutions were noted (positions 366, 415, 447, and 489), which were all shared with 1990 stra ins of SLEV. In addition, 14 nucleotide differences were detected upon alignment of the NS5 region, with seven changes to the amino acid sequence of the NS5 protein (see Table 4-11 for amino acid changes). Only one amino acid substitution was not found in the 1990 strains (isoleucine, 3152). This strain was not tested with the SLEC (M/E re gion) or YF1/YF2 (3NC region) primer sets, due to limited sequence diversity noted for FL52, TBH-28, FL72, FL85a, as well as to conserve resources (Table 4-10). FL90 (a, b, c & d) These isolates were collected in 1990 during an epidemic of SLEV in Florida from the blood of three birds (two common grackles, one mourning dove) (FL90 a, b & c) and from a pool of Culex nigripalpus mosquitoes (FL90d). BLASTN search results on the envelope sequence identif ied that strains FL90a-d share 98% sequence homology with USA strain (V 2380-42), Guatemala strain (78 A 28), and Texas strains (83V4953,

PAGE 285

260 PVI-2419, 98V3181). The top two matches (U SA V 2380-42, Guatemala 78 A 28) were identical for these strains in the NS5 region [Appendix I]. Unique nucleotide mismatches were iden tified for epidemic strains of SLEV (isolated during 1989-1990) in the envelope and NS5 regions as compared to other Florida SLEV strains. Multiple sequence alignm ent with these reference strains identified 15 nucleotide base changes in the envelope re gion, which resulted in a total of six amino acid substitutions in the prot ein sequence (some changes not shared by all 1990 strains, see Table 4-11). FL90c had an amino acid substitution at position 500, from arginine to tryptophan (R W). Thirteen nucleotide differences were detected upon alignment of the partial NS5 region, with seven amino acid substitutions (see Table 4-11 for specific amino acid changes, right side of arrow). These strains were not tested with the SLEC primers (M/E region) due to limited seque nce diversity, as shown for FL52, TBH-28, FL72 and FL85a (Table 4-12). The 3NC re gion of FL90b and FL90d were sequenced, and identified 4 nucleotide base changes at the same positions for both strains [Tables 410, 4-11]. TR58 TR58 is one of four South American stra ins included in the study for comparison to Floridas isolates of St. Louis encephali tis virus. In 1958, the TR58 strain of SLEV was isolated from Culex coronator mosquitoes collected in the Vega de Oropouche area of Trinidad (Aitken et al 1964). BLASTN search results on the envelope sequence identified that TR58 shared 96 97% sequenc e identity with strains from Trinidad (TRVL 9464), Brazil (BeAr 23379, BeAn246262, BeAn 247377), and Peru (75 D 90). The same matches were found with the NS5 region (Appendix I). Multiple sequence

PAGE 286

261 alignment of these regions identified severa l nucleotide and amino acid changes that were shared by South American strains of SLEV (Table 4-12). TR62 In 1962, the TR62 strain of SLEV was isolated from Culex nigripalpus mosquitoes collected in the Bush Bush Forest in Trinidad (Aitken et al 1964). BLASTN search results on the envelope sequence id entified that TR62 shar ed 95 96% sequence identity with strains from Trinid ad (TRVL 9464), Brazil (BeAr 23379, BeAn246262, BeAn 247377), and Peru (75 D 90). The sa me matches were found with the NS5 and M/E (SLEC) regions (Appendix I). Multiple sequence alignment of these regions identified several nucleotide base and ami no acid changes that were shared by South American strains of SLEV (Table 4-12). BR64 St. Louis encephalitis virus strain BR64 wa s isolated in blood collected from a Chloroceryle inda (wild bird species) near Be lem, Brazil in 1964 [personal communication to F. Wellings (ERC) from G. Sather (University of Pittsburg, 1971). BLASTN search results on the envelope seque nce identified that BR64 shares 96 97% sequence identity with strains from Brazil (BeAr 23379, BeAn246262, BeAn 247377), Trinidad (TRVL 9464), and Peru (75 D 90). The same matches were found with the NS5 region (Appendix I). Multiple sequence alignment of these regions identified several base and amino acid changes that were shared by South American strains of SLEV (Table 412).

PAGE 287

262 Table 4-12 Nucleotide and Amino Acid Changes Identi fied in SLEV Strains from Florida & South America Multiple sequence alignments identified residues shared by Florida South American strains (FL72, FLS569, FLS650) and four strains isolated in South America (Trinidad, TR58, 62 and Brazil, BR64, 69). Envelope Region NS5 Region SLEC Region SLEV Strain # Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) Amino Acid (Pos.#/AA) FL72 FLS569 FLS650 TR58 TR62 BR64 BR69 943, 951, 966, 969, 996, 1002, 1004, 1044, 1084, 1113, 1116, 1125, 1143, 1185, 1215, 1260, 1296, 1314, 1329, 1354, 1359, 1437, 1485, 1557, 1575, 1578, 1605, 1623, 1624, 1692, 1698, 1719, 1731, 1743, 1759, 1798, 1818, 1824, 1887, 1909, 2139, 2142, 2193, 2208, 2226, 2247, 2253, 2265, 2277, 2307, 2310, 2353, 2371, 2427, 2439, 2448, 2451, 2466, 2535, 2541 319 (L P) 334 (LS) 336 (R K) 337 (E G) 350 (G E) 373 (L P) 374 (P R) 377 (P L) 383 (V A) 397 (A V) 407 (K R) 422 (A V) 434 (G E) 440 (Q R) 455 (E G) 481 (R K) 497 (R H) 512 (I T) 521 (R Q) 522 (R K) 523 (I T) 527 (S L) 528 (L Q) 9080, 9098 9111, 9137, 9149, 9185, 9186, 9251, 9269, 9299, 9341, 9350, 9377, 9387, 9389, 9392, 9493, 9563, 9583, 9626, 9647, 9674, 9677, 9713, 9725, 9731, 9743, 9761, 9782, 9797, 9806, 9884, 9977, 1004, 10022, 10031, 10052, 10064 3030 (L P) 3036 (F S) 3041 (W *) 3049 (K R) 3053 (S F) 3093 (T M) 3103 (G A) 3117 (R K) 3120 (K M) 3129 (Q R) 3151 (P L) 3167 (W *) 3191 (W *) 3198 (R *) 3219 (D G) 3228 (T M) 3229 (TI) 3241 (L P) 3245 (F S) 3247 (IT) 765 900 943 951 969 1002 1005 1044 1056 257 (I T) 275 (N S) 302 (V A) 319 (LP) 325 (TI) 336 (R K) 337 (EG) 350 (G E) 354 (LS) *Termination codon. SLEC region only sequenced for FL72, FLS569, FLS650, TR62, BR69.

PAGE 288

263 BR69 In 1969, SLEV strain BR69 was isolated in blood collected from a sentinel chicken near Belem, Brazil [personal communication to F. Wellings (ERC) from G. Sather (University of Pittsburg), 1971]. BLASTN search results on the envelope sequence identified that BR69 shares 96% se quence identity with strains from Brazil (BeAr 23379, BeAn246262, BeAn 247377), Trinidad (TRVL 9464), and Peru (75 D 90). The same matches were found with the NS5 region and membrane/envelope (SLEC) regions (Appendix I). Multiple sequence alignment of these regions identified several base and/or amino acid change s that were shared by South American strains of SLEV (Table 4-12). FLS569 FLS569 was cultured from a cloacal swab collected from a sentinel chicken in Sarasota County, Florida in 2006. Nucleotide sequence analysis of purified PCR products targeting the complete envelope, membrane /envelope (SLEC) and partial NS5 regions confirmed that FLS569 strain was SLEV (refe r to previous Figures 4-27, 4-28, and 430 in this chapter). BLASTN search results on the envelope sequence identified that FLS569 shares 98% sequence identity with S outh American strains of SLEV, including Brazil (BeAn247377, BeAn242587) and Peru (75 D 90). FLS569 also matched the Coav 405 strain of SLEV isolated in the Coachella Valley of California in the envelope region. Similar results were found with the NS5 a nd partial membrane/envelope (SLEC) regions, with an additional match to a Trinid ad strain (TRVL 9464) [Appendix I]. Multiple sequence alignment also indicated that FLS569 was most closely related to South American strains. However, an alysis of the nucleo tide alignment of the

PAGE 289

264 envelope region identified 14 uni que nucleotide changes (Table 4-13) that were not seen in archived Florida or South American is olates studied (see Appendix N). Only one (#1407) of these mutations was not found in the second SLEV strain (FLS650) later isolated from Sarasota county, such that 13 of these mutations were shared between the two recent strains. The T C transition mutation (pyrimidin e to pyrimidine) at position 1281 was shared by the Kern217 (California) strain of SLEV. These nucleotide base changes coded for eight predicted amino acid ch anges to the translated protein sequence. The partial NS5 region of FLS569 was also sequenced. 19 unique nucleotide base changes were observed (note: 18 were shar ed with FLS650), with 12 predicted amino acid substitutions (see Table 4-13 for specific amino acid changes on the right side of each arrow). The SLEC primer set (M/E regi on) was initially used to confirm TaqMan RT-PCR results. Sequence analysis of this 400 bp PCR product confirmed that this isolate was South American in origin, with nine nucleotide substitutions in the M/E region of the virus (one transition mutation [C T] at position 735 was shared by Kern217). These nucleotide substititutions re sulted in eight amino acid substititutions to the protein coding sequence. In addition, a por tion of the 3NC region was sequenced for this strain, which identified five nucleot ide base changes (see Table 4-13). FLS650 FLS650 was confirmed SLEV positive by se quencing three regions of the virus (envelope, M/E and NS5). BLASTN search resu lts were identical to those reported above for FLS569 (Appendix I). In addition, multiple sequence alignment id entified 13 (out of 14) nucleotide substitutions in the envelope region and 18 of 20 mutations in the NS5

PAGE 290

265 Table 4-13 Nucleotide and Amino Acid Changes Identified in SLEV Strains Isolated from Se ntinel Chickens in Florida Multiple sequence alignments of the envelope and NS5 regions identified unique nucleotide and amino acid changes in a comparison of recent SLEV isolates (FLS569 & FLS650) to reference strains (FL, California [Kern217], and South American (TR58, TR62, BR64, BR69). Mutations in the nu cleotide coding sequence often resulted in amino acid substitutions (new amino acid located on right side of each arrow). Bolded residues are shared in the recent Florida isolates, but are unique from other stra ins of SLEV analyzed (except for two nucleotide mismatches that were also found in Kern217). Envelope Region NS5 Region SLEV Strain # Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) Amino Acid (Pos.#/AA) FLS569 993, 999, 1026, 1098, 1281, 1407, 1500, 1665, 1797, 1932, 2103, 2328, 2394, 2439 333 (T I) 335 (SL) 344 (L S) 364 (W *) 429 (V A) 471 (T I) 472 (P L) 502 (TI) 9092, 9326, 9458, 9470, 9496, 9522, 9527, 9530, 9545, 9564, 9614, 9707, 9722, 9749, 9851, 9899, 9983, 9992, 10019 3034 (E G), 3112 (K R) 3156 (S F), 3160 (T I) 3168 (S L), 3176 (P F) 3179 (P L), 3180 (F C) 3186 (A V), 3208 (R Q) 3239 (L S), 3244 (T I) FLS650 993, 999, 1026, 1098, 1281, 1410, 1500, 1665, 1797, 1932, 2103, 2328, 2394, 2439 333 (T I) 335 (SL) 344 (L S) 429 (V A) 472 (P L) 502 (TI) 9092, 9182 9326, 9458, 9496, 9522, 9527, 9530, 9545, 9564, 9614, 9707, 9722, 9749, 9851, 9899, 9983, 9992, 10019, 10061 3034 (E G), 3064 (T I) 3112 (K R), 3156 (S F) 3168 (S L), 3176 (P F) 3179 (P L), 3180 (F C) 3186 (A V), 3208 (R Q) 3239 (L S), 3244 (T I) Matched Kern217 (California).

PAGE 291

266 Table 4-13 Nucleotide and Amino Acid Changes Identified in SLEV Strains Isolated from Se ntinel Chickens in Florida, Continued Multiple sequence alignments of the membrane/envelope (SLEC Region) and 3non-coding regions identified unique nucleotide changes in a comparison of recent SLEV isolates (FLS569 & FLS650) to refere nce strains (FL, California [Kern217], and South America). Mutations in the nucleotide coding se quence (consensus amino acid on left side of arrow) often resulted in amino acid substitutions (new amino acid located on right side of each arrow), early termination (* on right side of arrow) &/o r continuation of translati on instead of termination (* on left side of arrow). Bolded residues are shared in these recent Florida isolates, but are unique from other strains of SLEV analyzed (except for two nucleotide mismatches that were also found in Kern217). SLEC Region 3NC Region SLEV Strain # Nucleotide (Position #) Amino Acid (Pos.#/AA) Nucleotide (Position #) Amino Acid (Pos.#/AA) FLS569 735, 744, 807, 834, 846, 876, 993, 999, 1026 247 (D G) 250 (S F) 280 (S L) 284 (FS) 294 (R H) 333 (T I) 335 (S L) 344 (L S) 10209, 10227, 10397, 10620, 10712 Untranslated region FLS650 807, 834, 846, 876, 993, 999, 1026 280 (S L) 284 (FS) 294 (R H) 333 (T I) 335 (S L) 344 (L S) NT NT Matched Kern217 (California).

PAGE 292

267 region (with predicted amino acid changes) that were identical to those detected in FLS569. However, seven nucleotide changes we re noted in the SLEC region, with six substitutions to the translated sequence. The 3NC region was not sequenced for this strain [Table 4-13]. West Nile Virus Strains (2001-2006) FLWN01a In 2001, FLWN01a was isolated from a wild bird (Corvidae, Corvus spp., crow) following natural exposure and death during th e first year that WNV was introduced to Florida. The bird was collected in the nor thern region of the state (Madison County). BLASTN search results on the capsid/prM sequence indicated that FLWN01a shares 99% sequence identity with West Nile virus strains isolated in Texas (TVP 8533) in 2002, Oklahoma and Florida in 2003, and Ne w York in 2000. The NS5 region had 98% sequence homology to New York strains of th e virus (385-99, 3356K VP2) [Appendix J]. Multiple sequence alignment identified four base changes in the capsid/prM nucleotide sequence that were different from Florida strains isol ated from sentinel chickens during 2005-2006. Four of the changes were shared by strain s isolated in 2001, 2002, and 2005 (positions 300, 348, 459 and 483). The cytosine at position 483 is conserved in the NY99 stra in of the virus (Beasley et al 2004). These were silent mutations, in that the translated protein coding sequence was not altered for FLWN01a. In contrast, multiple sequence alignment on th e NS5 gene revealed two nucleotide base changes, including one amino acid substitution (tryptophan to glycine at position 3054) [Table 4-14].

PAGE 293

268 FLWN01b West Nile virus strain FLWN01b was also isolated from a wild bird (Corvidae, Cyanocitta cristata blue jay) following natural exposure to the virus and subsequent death in Suwanee County. BLASTN search re sults on the capsid/prM sequence indicated that FLWN01b shares 99% sequence identity with West N ile virus strains from the United States, including strains isolated in Iowa (crow envelope protein) in 2003, New York (3356K VP2) in 2000, as well as Arizona from 2004-2005 (BSL-2004-2005, human blood donor samples). In contrast, the NS5 region has 96% sequence homology to WNV strains isolated in Florida (FL232, 03-113FL) as well as to NY99 (385-99) [Appendix J]. FLWN01b had the highest number of nuc leotide mutations and amino acid substitutions out of the six Florida strains studied (in the NS5 regi on). Multiple sequence alignment with reference strains indicate d three nucleotide base changes in the capsid/prM region, a transition mutation (T C) at position 428. This resulted in the substitution of threonine for isoleucine at position 144 of the predicted translated protein (Table 4-14). Unlike the capsid region, the NS5 re gion had 12 unique nucleotide changes, including one inserted base. Eight of thes e were transversion mutations (purine to pyrimidine, for example, A T), with only four transition mutations (T C and A G). These nucleotide base changes resulted in eight amino acid substitutions, including the insertion of tyrosine between pos itions 3231 and 3232 (Table 4-14). FLWN02 (a & b) In 2002, FLWN02 (a & b) were isolated from mosquito pools ( Ochlerotatus taeniorhynchus ) collected in St. Johns county in the northern region of the state.

PAGE 294

269 Table 4-14 Nucleotide and Amino Acid Changes Id entified in WNV Strains from Florida (2001-2005) Multiple sequence alignments of the capsid/prM (WNAE) and NS5 (Ful/cfd3) regions identified unique nucleotide and amino acid changes in reference strain s of WNV collected in different year s in Florida (except where noted). Capsid/prM Region NS5 Region WNV Strain # Nucleotide (Position #) Amino Acid (Position#/AA) Nucleotide (Position #) Amino Acid (Position#/AA) FLWN01a 300, 348, 459 483 (C) No unique translated differences 9103, 9152 3054 (W G) FLWN01b 428, 459 483 (C) 144 (I T) 9163, 9164, 9166, 9180, 9182, 9276, 9297, 9336, 9706, 9744, 9828 T i (9685-9686) 3058 (M L ), 3063 (L *) 3064 (E *), 3095 (S F) 3102 (A G ), 3115 (K R ) Yi (3231-3232) 3238 (DH ) FLWN02a 300, 348, 459 483 (C) No unique translated differences No unique nucleotide differences No unique translated differences FLWN02b 483 (T) No unique translated differences 9744, 9828 No unique translated differences FLWN05a 300, 348, 459 483 (C) No unique translated differences 9264, 9352, 9366, 9420, 9456, 9468, 9660 3091 (L P), 3125 (N S), 3155 (S L), 3159 (S F), 3223 (S L) FLWN05b 459 483 (C) No unique translated differences 9136, 9352, 9704 3048 (S F) 3238 (P L) Conserved position reported in NY99 strain of WNV (Beasley et al 2004). Position where nucleotide matches WN Egypt101, not NY99. *Termination (stop codon). iInserted nucleotide base/amino acid at the position number. Bolded residues are shared in WN isolates, but are unique from other strains of WNV analyzed.

PAGE 295

270 BLASTN search results on the capsid/prM sequence indicated that FLWN02a shares 99% sequence identity with West Nile virus strains isolated in Texas (TVP 8533), Iowa, New York and Arizona. The NS5 region ha d 99% sequence homology to New York strains of the virus (38599, 3356K VP2) [Appendix J]. In contrast, FLWN02b closely matched a strain isolated from a human blood donor sample collected in Utah (2003) and fr om WNV isolated from viremic patients in Israel during an outbreak in 2000 (99% seque nce identity in the capsid/prM region). BLASTN results on the NS5 region also matched Florida (FL232, 03-113FL) and New York (385-99, 3356K VP2) strains, with 99% homology (Appendix J). Multiple sequence alignment identified four silent mutations in the capsid/prM region at positions 300, 348, 459, and 483 in stra in FLWN02a. No base changes were identified in the NS5 region. In additi on, one non-conserved transition mutation was identified at position 483 (C T) in strain FLWN02b. However, no unique amino acid substitutions were found for FLWN02a or FLWN 02b in the capsid region (Table 4-14). Two nucleotide substitutions were note d for FLWN02b in the NS5 region, where positions 9744 and 9828 matched FLWN01b and the Egypt101 strain of West Nile virus (unlike NY99). However, these nucleotide changes did not aff ect the amino acid coding sequence. FLWN05a In 2005, FLWN05a was isolated from an alligator following natural WNV exposure and death (juvenile, farmed alli gator). BLASTN search results on the capsid/prM sequence indicated that FLWN05a shares 99% sequence identity with West Nile virus strains from the United Stat es, including Texas (TVP 8533), New York,

PAGE 296

271 Florida (FL03-FL2-3), and Arizona isol ates. The NS5 region has 98% sequence homology to strains isolated from viremi c blood donors in New Mexico and Colorado during 2004, as well as to WNV isolated fr om a grackle in Sonora, Mexico in 2005 (TVP9115) [Appendix J]. Multiple sequence alignment of the capsid/prM region identified the same four silent mutations at positions 300, 348, 459 and 483, as seen for FLWN01a and FLWN02a. However, several differences were noted in the NS5 region for FLWN05a, where seven unique transition mutations (T C and A G) resulted in five changes to the translated amino acid coding sequence (Table 4-14). FLWN05b West Nile virus strain FLWN05b was isolated from a wild bird (Corvidae, Corvus sp., crow) following natural exposure to the vi rus and subsequent death in Dixie County, Florida (northern region of the state). BLASTN search results on the capsid/prM sequence indicated that FLWN 05b shares 99-100% sequence identity with West Nile virus strains isolated in Iowa, New York and Arizona, as described above for FLWN01b. However, the NS5 region had 98% homology to strains isolated from viremic blood donors in North Dakota, Colorado and Texas from 2003-2004, as well as one isolate from a cardinal in Louisiana (TWN496) [Appendix J]. Alignment of the capsid/prM sequences fr om WNV isolates collected in Florida found two differences, at positions 459 and 483, in the nucleotide sequence (as shown above for the other Florida strains of WNV) which were silent mutations. However, three nucleotide and and two amino acid subs titutions were found in the NS5 region for

PAGE 297

272 FLWN05b, including a serine to phenylalanine substitution at position 3048 and proline to leucine change at position 3238 (Table 4-14). FLM38 In 2005, FLM38 was cultured from a cloacal swab of an adult sentinel chicken following natural exposure to WNV in Manatee County, Florida (s outhern Gulf Coast region). BLASTN search results of GenBank found that FLM38 closel y matched a strain isolated from a human blood donor sample collected in Ut ah (2003) and WNV isolated from viremic patients in Israel during an outbreak in 2000 (99% sequence identity in the capsid/prM region). However, this region is conserved a nd FLM38 was also homologous to an Iowa WNV strain (2003) and New York isolate in 2000. 98% sequence identity in the NS5 region was found to viremic blood donors, from Florida (in 2003), North Dakota (2004), Colorado (2004), and Texas (2003) [Appendix J]. Results of the multiple sequence alignmen ts for this strain also found a single unique nucleotide tran sition mutation (C T) in the capsid region, but did not result in a change to the amino acid coding sequence. Three base changes were noted in the NS5 region, but they were silent mutations (Table 4-15). FLS502 In 2006, FLS502 was cultured from a cloacal swab of an adult sentinel chicken following natural exposure to WNV (and SLEV ) in Sarasota County, Florida (southern Gulf Coast region). BLASTN search of Ge nBank returned identical results to those found for FLM38 above (Utah, Israel, Iowa and New York for capsid/prM region; WNV strains detected in blood donors from severa l states for the NS5 region) [Appendix J].

PAGE 298

273 Table 4-15 Nucleotide and Amino Acid Changes Identified in WNV Strains Isolated from Se ntinel Chickens in Florida Analysis of multiple sequence alignments of the capsid/prM (WNAE) and NS5 (Ful/cf d3, WNBE) regions identified limited unique nucleotide changes in 2005-2006 WNV isolates (FLM38, FLS502, FLS504, FLS545). Reference strains included isolates collected in Florid a since 2001, as well as WN NY99 and WN Egypt101. Each nucleotide and amino acid change was unique from other strains of WNV analyzed (except for 1 nuc leotide mismatch also found in WN Egypt101). Capsid/prM Region NS5 Region NS5 (3) [WNBE] Region WNV Strain # Nucleotide (Position #) Amino Acid (Position#/AA) Nucleotide (Position #) Amino Acid (Position#/AA) Nucleotide (Position #) Amino Acid (Position#/AA) FLM38 483 (T) No unique translated differences 9352, 9912, 9966 No unique translated differences Sequencing failed Sequencing failed FLS502 483 (T) No unique translated differences 9352, 9912, 9966 No unique translated differences Sequencing failed Sequencing failed FLS504 483 (T) No unique translated differences 9352, 9912, 9966 No unique translated differences No unique nucleotide differences No unique translated differences FLS545 237, 483 (T), 591 81 (L V) 9352, 9912 3248i (R) Sequencing failed Sequencing failed Position where nucleotide matches WN Egypt101. iInserted nucleotide base/amino acid at the position number. Bolded residues are shared in strain s isolated in Florida from se ntinel chickens (2005-2006).

PAGE 299

274 Results of the multiple sequence alignments for this strain also found a single unique nucleotide transition mutation (C T) in the capsid region, but did not result in a change to the amino acid coding sequence. Three base changes were noted in the NS5 region, but they were silent mutations (Table 4-15). FLS504 FLS504 was also cultured from a cloacal sw ab of another sentinel chicken located at the same site as FLS502 above, followi ng natural exposure to WNV in Sarasota County, Florida. BLASTN search of GenBank returned identical results to those found for FLM38 and FLS502 above (Utah, Israel, Io wa and New York for capsid/prM region; WNV strains detected in blood donors from se veral states for the NS5 region) [Appendix J]. Results of the multiple sequence alignmen ts for this strain also found a single unique nucleotide tran sition mutation (C T) in the capsid region, but did not result in a change to the amino acid coding sequence. Three base changes were noted in the NS5 region, but they were silent mutations. The WNBE primer set was used to target an internal segment of the NS5 region to corroborate sequence homology for this WNV isolate. No differences were found. Se quencing reactions for FLM38, FLS502 and FLS545 failed with this primer set, when assayed by both the BOL-Tampa and molecular biology core at the H. Lee Moffitt Cancer Center. A single contig (consensus) sequence could not be produced due to poor quality seque nce data of different sizes for the forward and reverse primers, due to long runs of rep eated bases in the sequence (Table 4-15). BLASTN search results on the 3NS5 re gion (WNBE) returned 100% sequence identity to Oklahoma (OKO3), New York (385-99, 3356K VP2), and Florida (FL03-FL2-

PAGE 300

275 3) strains of WNV. A Nort h Dakota strain cultured from blood donors also matched at 100% (consistent with results found for the larger NS5 region) [Appendix J]. FLS545 In 2006, FLS545 was cultured from a cloacal swab collected from a sentinel chicken in Sarasota County seven days followi ng the first isolation of West Nile virus (FLS502) from that chicken. SLEV (FLS569) was then isolated from another swab collected from this bird 2 days later. BLASTN search results on the WNV cap sid/prM region identified 99% identity to strains previously described for FLM38, FLS502 and FLS504 (WNV strains from Utah, Israel, Iowa and New York). 98% homology was also found for the NS5 region, which matched WNV strains cultured from blood donors in several states [Appendix J]. Unlike previous WNV strains (FLM38, FLS 502, FLS504) collected from sentinel chickens, two nucleotide and one amino acid su bstitution was identified in the genome of FLS545. Multiple sequence alignment results for this strain identified one unique nucleotide difference in the capsid/prM re gion at position 237. This transversion mutation (thymine to guanine) resulted in th e substitution of valine (instead of lysine) at position 81 in the translated protein sequence. An additional nucleotide base change was found at position 591, but was shared with WN Egypt101, FLS649 and FLS694 (see next section). This base difference was not seen for WN NY99 or other WNV strains analyzed from Florida (Table 4-15, Appendix L). One inserted amino acid (arginine) was not ed at position 3248 predicted in the portion of the NS5 region analyzed for FLS545 (Table 4-15, Appendix P).

PAGE 301

276 Novel Flavivirus Strains SLEV Membrane/Envelope Region FLS649 FLS649 was also isolated from Site 001 in Sarasota County, Florida in 2006. This strain was detected on a cloacal swab colle cted the same day as FLS650 (SLEV), but from another sentinel chicken located at the same site (Bird 9-004-G). This bird failed to seroconvert in the HAI assay following RT -PCR detection (TaqMan) of presumptive SLEV viral RNA on a cloacal swab. Several primer sets were used to confirm the TaqMan results. Since FLS649 did not replic ate in Vero cells, it was first confirmed SLEV positive by sequencing the membrane/enve lope region of the virus (non-specific banding pattern observed on gel-electrophoresis) [Figure 4-33]. RT-PCR was repeated in a second assay and the PCR products sequenced by the BOL-Tampa and by the molecular biology core facility at the H. Lee Moffitt Cancer Center. BLASTN search results on the membra ne/envelope sequence identified 97% sequence homology with strains from Tamp a Bay (TBH-28 and GHA-3), as well as a Mexico strain (65 V 310). St. Louis encephalitis virus strains from Missouri (Parton) and Tennessee (TNM 4-711) were also matche d to the FLS649 query sequence at 96% identity (Appendix K). Unlike SLEV reference stra ins, the FLS649 strain was not detected by several RT-PCR assays used for this project. The co mplete envelope primers did not amplify the viral RNA of FLS649 [Figure 4-34] nor did primer sets used to target the NS5 and 3NC regions [Figure 4-35].

PAGE 302

277 Figure 4-33 Gel Electrophoresis of Se ntinel Chicken Arbovirus Isolates: FLS569, S649, S650, S694 (M/E Region). RT-PCR was performed with SLE 727/SLE1119c primers (SLEC) to amplify the partial M/E region of SLEV. PCR products were run in duplicate on 1.0% agarose gels. This region was amplified by all four isolates, with different banding patterns. The top band was excised for sequence analysis, with th e exception of FLS649 (2nd band from top was used). Lane 1: Marker (1 kb ladder) Lane 2: NTC Lane 3: SLE+ (TBH-28) Lanes 4, 6, 9, 12: Blank Lane 5: FLS569 Lanes 7, 8: FLS649 Lanes 10, 11: FLS650 Lanes 13, 14: FLS694 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 303

278 Figure 4-34 Gel Electrophoresis of Sent inel Chicken Arbovirus Isolates: FLS569, S649, S650, S694 (SLE Complete Envelope Region). RT-PCR was performed with F880/ B2586 primers to amplify the complete envelope region of SLEV. This region was successfully amplified in two of these viruses, FLS569 (Lane 5) and FLS650 (Lanes 10 and 11). Lane 1: Marker (10 kb ladder) Lane 2: NTC Lane 3: SLE+ (TBH-28) Lanes 4, 6, 9, 12: Blank Lane 5: FLS569 Lanes 7, 8: FLS649 Lanes 10, 11: FLS650 Lanes 13, 14: FLS694 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 304

279 Figure 4-35 Gel Electrophoresis of Se ntinel Chicken Arbovirus Isolates, FLS569, S649, S650, S694 (Parti al NS5 Region, and 3NC) A) RT-PCR was performed with FU1/cFD3 primers to amplify the partial NS5 region. PCR products were run in duplicate on 1.0% agarose gels. The NS5 region was successfully am plified in two viruses, FLS569 and FLS650. FLS649 and FLS694 failed to amplify. B) The 3NC region was amplified by RT-PCR with YF1/YF2 primers. This region was successfully amplified by one virus, FLS569. A) Lane 1: Marker (1 kb ladder). Lane 2: NTC. Lane 3: SLE+ (TBH-28). Lanes 4, 6, 9, 12: Blank. Lane 5: FLS569. Lanes 7, 8: FLS649 Lanes 10, 11: FLS650. Lanes 13, 14: FLS694. B) Lane 1: Marker (1 kb ladder). Lane 2: SLE+ (TBH-28). Lane 3: WN+ (NY99). Lanes 4, 5, 6, 7, 8, 9: Clones. Lane 10: FLS569. Lane 11: FLS649. Lane 12: FLS650. Lane 13: FLS694. Lane 14: NTC. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 305

280 However, multiple sequence alignment was performed on the sequenced PCR products that targeted the M/E region. Analysis of the alignment identified six nucleotide mutations (positions 757, 760, 762, 772, 788, 1050) that were either transition or transversion substitutions. These nucleotide base differences altere d the translated amino acid sequence at six positions (252, 253, 254, 257, 263, and 351) [Table 4-16]. FLS694 In RT-PCR analysis, FLS694 was most si milar to FLS649. Both were isolated from Site 001 in Sarasota County, but were collected seven days apart and from two different birds. Bird 9-000-W also failed to seroconvert in the HAI assay post-detection of viral RNA from a cloacal swab. Conse quently, FLS694 was detected and confirmed SLEV positive by sequencing the membrane/e nvelope region of the virus. RT-PCR assays and sequencing of the PCR products were performed as described for FLS649. Clear differences were noted in the gel electorphoresis banding pattern, such that multiple bands were identified for FLS649 versus double bands observed for FLS694. FLS650 resulted in a single band with the SLEC membrane/envelope primer set (Figure 4-33). BLASTN search results on the membrane /envelope region were identical to FLS649, where the query sequence of FLS 694 had 97% homology with strains from Tampa Bay (TBH-28 and GHA-3), as well as a Mexico strain (65 V 310). St. Louis encephalitis virus strains from Missouri (Par ton) and Tennessee (TNM 4-711) were also matched to the FLS694 query sequence at 96% identity (Appendix K). The complete envelope primers did not detect the viral RNA of FLS694. In addition, this genome did not amplify with the NS5 primer set or the 3NC primer set (Figur es 4-34 and 4-35).

PAGE 306

281 Table 4-16 Nucleotide and Amino Ac id Changes Identified in Novel Flavivirus Strains Isolated in Florida Analysis of multiple sequence alignments of the capsi d/prM (WNAE), membrane/envelope (SLEC) and NS5 (WNBE) regions identified unique nucleotid e and amino acid changes in 2005-2006 flavivirus isolates (FLS649, FLS694) as compared to reference flavivirus strains. Each nucleotide and amino acid change was unique from other strains of SLEV or WNV analyzed (except wher e noted for WN Egypt101, FLS545). Se quencing reactions failed for WNBE PCR products of the appropriate size for FLS649, due to long runs of repeated bases in the sequence. M/E [SLEC] Region Capsid/prM [WNAE] Region NS5 (3) [WNBE] Region Strain # Nucleotide (Position #) Amino Acid (Position#/AA) Nucleotide (Position #) Amino Acid (Position#/AA) Nucleotide (Position #) Amino Acid (Position#/AA) FLS649 757, 760, 762, 772, 788, 1050 255 (M I) 256 (EG) 259 (H Q), 265 (R S) 352 (A G) {445, 483, 504, 513, 528, 561, 585, 591, 600, 615} 137 (K ?) 149 (G ?) 188 (N ?) 198 (G ?) Sequencing Failed Sequencing Failed FLS694 834 280 (S L) {445, 483, 504, 513, 528, 561, 585, 591, 600, 615}, 619 104 (G ?) 208 (E K) No unique nucleotide differences No unique translated differences Positions where nucleotides match WN Egypt101. Bolded residues are shared between the two novel flavivirus strains and WN Egypt101, but not by other strains (excep t position 591 by FLS545). ? = Missing residue.

PAGE 307

282 A multiple sequence alignment was performed on the sequenced PCR products that targeted the M/E region. Analysis of the alignment identified one nucleotide mutation (position 834). This base change was a transition substitution between two pyrimidines (cytosine thymine). Translation of the pr otein polypeptide was terminated (*) at position 279 of the amino acid sequence, in stead of addition of ar ginine (R) at that site [Table 4-16, Appendix O]. FLS281 FLS281 was isolated from Bird 7-005-B locat ed at Site 005 in Sarasota County in August 2006. Despite replication of virus in cell culture, this bird failed to develop detectable flavivirus antibodies in the HAI assay post-isol ation of the viru s from a cloacal swab. In addition, this isolate was not detected by the TaqMan primer-probe sets (Table 4-9). As a result, this isolate was unidentified in 2006. In 2008, further investigation of FLS281 iden tified the strain as Newcastle virus (contagious zoonotic disease transmitted by contaminated bodily secretions, including respiratory and fecal, in susceptible bird populations). However, this Newcastle virus strain generated a RT-PCR product of the appropriate size (~400bp) with the SLEC primer set (data not shown). In itial interpretation of this result identified the virus as SLEV, but was disproved by sequence analysis of the RT-PCR product. BLASTN search results on the SLEC membrane/envelope region confirmed that FLS281 had 94% homology with a dove strain (Italy/2736/00, AY562989.1 ) of Newcastle virus disease.

PAGE 308

283 WNV Capsid/prM Region (WNAE) FLS649 FLS649 was also tested with WNV specifi c primers to the conserved capsid/prM region [Figure 4-36, left side of gel]. Thes e PCR products were excised from the gel, cleaned and sequenced by the BOL-Tampa. The assay was repeated and PCR products were sequenced by the molecular biology core facility at the H. Lee Moffitt Cancer Center. BLASTN search results indicated that FLS649 shares 100% sequence identity with West Nile virus strains isolated in the Old World from Portugal (PTRoxo), Egypt (Eg101) and India (WNI68856B). 99% homology was identified for a strain isolated in Romania (96-1030) in the capsid/prM regi on. Repeated sequencing of this region returned the same results. A second WNV specific RT-PCR was performe d that targeted the 3 NS5 region of the virus (WNBE primer set) [Figure 4-36, right side of gel]. Despite PCR products of the appropriate size (300bp), sequencing failed to generate a quality consensus sequence for FLS649, due to long runs of repeated bases in the sequence. The primer set (Fu1/cfd3) that targeted a la rger region of the NS5 gene did not amplify the viral RNA for FLS649. Multiple sequence alignment identified nine base changes in the capsid/prM nucleotide sequence that were unique compared to other Florida isolates of the virus. However, this pattern is identical to Old World strains of WNV at those positions (446, 505, 514, 529, 562, 586, 592, 601, 616). These were silent mutations, in that the predicted translated protein sequence was not altered (Table 4-16, Appendix L).

PAGE 309

284 Figure 4-36 Gel Electrophoresis of Se ntinel Chicken Arbovirus Isolates, FLS569, S649, S650, S694 (WNAE, WNBE Primers). The WNAE capsid/prM region wa s amplified by RT-PCR with WN233/WN640c primers. This region was successfully amplified by FLS569, FLS649, and FLS694. FLS650 did not produce the correct size amplicon (400bp) [Lane 5]. The WNBE 3 NS5 region was amplified with WN9483/9794 primers. As for WNAE, this region also failed to amplify the correct 300bp product for FLS 650 [Lane 12]. FLS569, FLS649 and FLS694 were detected with both primer sets. Lane 1: Marker (1 kb ladder) Lane 2: WNAE + (NY99) Lane 3: FLS569 Lane 4: FLS649 Lane 5: FLS650 Lane 6: FLS694 Lane 7: SLE + (TBH-28) Lane 8: NTC Lane 9: WNBE + (NY99) Lane 10: FLS569 Lane 11: FLS649 Lane 12: FLS650 Lane 13: FLS694 Lane 14: NTC 1 2 3 4 5 6 7 8 9 10 11 12 13 14

PAGE 310

285 FLS694 FLS694 was also tested with WNV specifi c primers to the conserved capsid/prM region [Figure 4-36, left side of gel]. Thes e PCR products were excised from the gel, cleaned and sequenced by the BOL-Tampa. The assay was repeated and PCR products were sequenced by the molecular biology core facility at the H. Lee Moffitt Cancer Center. BLASTN search results indicated th at FLS694 also shares 100% sequence identity with West Nile viru s strains isolated in the Ol d World from Portugal (PTRoxo), Egypt (Eg101) and India (WNI68856B). 99% homology was identified for a strain isolated in Romania (96-1030) in the capsi d/prM region. Repeated sequencing of this region returned the same results. Multiple sequence alignment identified nine base changes in the capsid/prM nucleotide sequence that were unique compared to other Florida isolates of the virus. However, this pattern is identical to Old World strains of WNV at those positions (446, 505, 514, 529, 562, 586, 592, 601, 616). These were silent mutations, in that the translated protein sequence was not altered (Table 4-16, Appendix L). NS5 Region (3) [WNBE] FLS694 A second WNV specific RT-PCR was performe d that amplified the 3 NS5 region of the virus (WNBE primer set) for FLS 694 [Figure 4-36, right side of gel]. PCR products were excised for the gel, cleaned and sequenced. This region was successfully sequenced for FLS694, but failed for FLS281, FLS649, FLCxs231, and FLCxn280 (data not shown). BLASTN search re sults were similar to those obtained for FLS504 in this

PAGE 311

286 region, which returned 100% sequence identity to Oklahoma (OKO3), New York (38599, 3356K VP2), and Florida (FL03-FL2-3) stra ins of WNV. 100% sequence identity was also found for a California WNV strain cultured from a blood donor [Appendix K]. Several sequences were downloaded from GenBank to include additional West Nile virus (Texas, Mexico, Hungary, and Florid a) sequence information in this region for multiple sequence alignment with FLS694 and FLS504. However, no nucleotide or amino acid differences were found in this region (Table 4-16). Phylogenetic Analysis Contiguous DNA sequences were assembled (SeqMan II program v.5.08, DNAStar) for each PCR product to generate a consensus sequence from the sense (forward) and anti-sense (reverse) primers. In addition, large amplicons (greater than 700bp) were assembled with overlapping fragme nts to generate a consensus sequence in both the forward and reverse directions. Ov erlapping fragments were necessary to generate a complete contig for the 1633 base s analyzed in the SLEV envelope region. Contigs were converted to GCG format (. msf files) using Me galign (v. 5.08, DNAStar) and exported for use in the multiple sequence alignment program MEGA 4.0.1. Multiple sequence alignments were performed in MEGA4.0.1 using the ClustalW 1.6 method. Additional complete flavivirus sequences were downloaded from GenBank for use as outgroups. Phylogenetic trees we re computed in MEGA4.0.1 to infer the evolutionary relationships of SLEV and WNV strain s. Neighbor-joining, maximum parsimony, and unweighted paired group means arithmetic (UPGMA) methods were used to construct

PAGE 312

287 phylogenetic trees, with 1000 bootstrap replicat es each. The consensus tree generated for each method was chosen. The complete sequence of Kern217 was downloaded, aligned and trimmed to the appropriate length for each re gion analyzed to represent a well-characterized strain of SLEV in the alignment and subsequent phyl ogenetic trees. In addition, the complete sequences of West Nile virus NY99 and Egypt101 were also downloaded, aligned, trimmed, and included as outgroups in th e multiple sequence alignment of these genomes. Additional outgroup sequences downloa ded from GenBank were also aligned and trimmed for analysis of the flavivirus NS5 region, WNV capsid/prM and 3NS5 regions (Appendix R). Envelope Region The complete envelope gene extends from base 963 to 2465 on the SLEV genome (Kramer and Chandler, 2001). Reference St. L ouis encephalitis virus strains and recent isolates (listed in Tables 32 and 4-4, respectively) were sequenced in this region from bases 915 through 2548 (overlaps into the membrane and NS1 gene were included). One unique nucleotide difference was found in the ov erlap region of the membrane gene for FL72 (position 954) and FL85a ( position 948). A single base ch ange was identified in the 83 bases of the NS1 overlap for FL72 (position 2490) only. The consensus tree for the neighbor-joini ng method [Figure 4-37] indicates that reference strains fall into two separate clades, grouped predominately according to geographic origin (North American and Sout h American). Branch bootstrap values were below 95% (except for the outgroups), which may infer inaccurate branch topology. The maximum parsimony method resulted in a cons ensus tree with higher bootstrap values,

PAGE 313

288 indicating improved topology of the interior branches drawn [Figure 4-38]. The UPGMA method produced similar results to the maxi mum parsimony tree for this region of the virus (tree not shown). All three trees sepa rated the reference SLEV strains based on geographic origin. However, three exceptions to grouping by geographic origin were noted for Florida strains (FL72, FLS569 and FLS650). SLEV strain FL72 was collected in the Florida panhandle, but grouped w ith Brazilian and Trinidad re ference strains. In addition, both neighbor-joining and maximum parsimon y algorithms estimated that the SLEV strains FLS569 and FLS650 (isolated in the sout hern region of the state) diverged from Brazilian and Trinidad strains (and FL72) to form a separate cluster in the South American clade. FL89 and FL90a-d strains formed a separate cluster in the North American (Florida) clade of SLEV. These epidemic strains were collected during the last large outbreak of SLEV in Florida and diverged from Florida strains isolated in 1952, 1962, and 1985, as detected in the entire enve lope gene (Figures 4-37 and 4-38). SLEV Membrane/Envelope Region A subset of reference strains was sequenced for comparison to recent circulating SLEV strains in the partial membrane/envel ope region of the virus from base 728-1112 (genome position based on complete Kern217 strain, Accession # NC_007580). Phylograms on the partial membrane /envelope region included the novel flavivirus strains collected from sentinel chickens in Sarasota County (FLS649 and FLS694).

PAGE 314

289 Figure 4-37 Phylogenetic Relationships of SLEV Strains (Envelope Region), Neighbor-Joining Method Phylogram of the complete envel ope region was inferred using the neighbor-joining method in MEGA4.0.1, where bootstrap analysis was performed (1000 replicates). The co nsensus tree was chosen. Branch lengths represent the amount of gene tic divergence, with the scale bar corresponding to number of base cha nges per site (maximum composite likelihood method). Bootstrap values are shown on branches. Outgroup and Kern217 sequences were downloa ded from GenBank (Appendix R). FL85a FL85b TBH-28 Kern217 FL52 FL90d FL90b FL89 FL90a FL90c FLS569 FLS650 FL72 TR58 TR62 BR64 BR69 WNNY99 WNEgypt 92 90 55 46 90 86 73 66 57 84 42 48 59 79 96 0.05 South American Florida South American Florida Epidemic Florida & California Outgroups

PAGE 315

290 Figure 4-38 Phylogenetic Relationships of SLEV Strains (Envelope Region), Maximum Parsimony Method Phylogram of the complete envel ope region was inferred using the maximum parsimony method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was chose n. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base changes in th e entire sequence. Bootst rap values are shown on branches. Outgroup and Kern217 sequences were downloaded from GenBank (Appendix R). FL85a FL85b TBH-28 Kern217 FL52 FL89 FL90b FL90d FL90a FL90c FLS569 FLS650 FL72 TR58 TR62 BR64 BR69 WNNY99 WNEgypt 37 37 26 99 99 99 46 76 72 99 98 33 39 53 91 99 50 South American Florida South American Florida Epidemic Florida & California Outgroups

PAGE 316

291 The consensus tree for the neighbor-joining me thod [Figure 4-39] indicates that SLEV reference strains fall into two separate cl ades, as seen for the complete envelope sequence, and grouped predominately according to geographic origin. Unlike FLS569 and FLS650 that have been characterized as South American (Brazil) in origin, FLS649 and FLS694 cluster with North American strain s of SLEV despite is olation in the same time period and location. However, branch bootstrap values were below 95% (except for the outgroups) for both the neighbor-joini ng and maximum parsimony (Figure 4-40) phylogenetic trees, which do not assume a constant rate of evolution. In contrast, the UPGMA method produced a consensus tree with high bootstrap support values for branch topology (Figure 441). This method produced a rooted tree and assumed a constant rate of evolution. Mi nimal sequence divergence was identified in Florida strains of SLEV, as depi cted by the short branch lengths. WNV Capsid/prM Region The complete capsid/prM gene extends from base 97 to 2465 on the WNV genome (Lanciotti et al 1999). A fragment of this regi on was sequenced extending from base 232 to 641. Multiple sequence alignment detected one synonymous mutation in two strains analyzed in this region, includi ng FLWN01b at base position 429 and FLS545 at base position 238. This highly conserved regi on of the virus is reflected in the short branch lengths drawn for these phylogeneti c trees. The limited number of WNV strains analyzed in this study formed a monophylet ic tree using neighbor-joining, maximum parsimony and UPGMA methods, with 1000 bootstrap replicates. However, branch bootstrap values were below 95% (except fo r the outgroups) for the neighbor-joining tree (Figure 4-42). The maximum parsimony and UPGMA phylograms had more robust

PAGE 317

292 Figure 4-39 Phylogenetic Relationships of SLEV and Flavivirus Strains (Partial Membrane/Envelope Region), Neighbor-Joining Method Phylogram of the partial membrane /envelope region (bases 728-112) was inferred using the neighbor-joi ning method in MEGA4.0.1, where the consensus tree (1000 bootstrap repli cates) was chosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base cha nges per site (maximum composite likelihood method). Bootstrap values are shown on branches. Outgroup and Kern217 sequences were downloa ded from GenBank (Appendix R). FL52 FLS649 TBH-28 FL85a Kern217 FLS694 BR69 FL72 TR62 FLS569 FLS650 WNNY99 WNEgypt 61 77 65 65 66 58 77 47 100 0.1

PAGE 318

293 Figure 4-40 Phylogenetic Relationships of SLEV and Flavivirus Strains (Partial Membrane/Envelope Region), Maximum Parsimony Method Phylogram of the partial membrane /envelope region (bases 728-112) was inferred using the maximum parsim ony method in MEGA4.0.1, where the consensus tree (1000 bootstrap repli cates) was chosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base change s in the entire se quence. Bootstrap values are shown on branches. Outgroup and Kern217 sequences were downloaded from GenBank (Appendix R). FL52 FLS649 TBH-28 FL85a Kern217 FLS694 FLS569 FLS650 BR69 FL72 TR62 WNNY99 WNEgypt 81 77 77 21 49 57 52 99 10

PAGE 319

294 Figure 4-41 Phylogenetic Relationships of SLEV and Flavivirus Strains (Partial Membrane/Envelope Region), UPGMA Method Phylogram of the partial membrane /envelope region (bases 728-112) was inferred using the unweighted-paire d group means arithmetic (UPGMA) method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was chosen. UPGMA me thod produced a rooted tree and assumed a constant rate of evolution. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base changes per site (maximum compos ite likelihood method). Bootstrap values are shown on branches. Outgroup and Kern217 sequences were downloaded from GenBank (Appendix R). FL52 TBH-28 FL85a FLS694 Kern217 FLS649 FLS569 FLS650 BR69 FL72 TR62 WNNY99 WNEgypt 99 59 65 50 57 97 37 94 99 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14

PAGE 320

295 Figure 4-42 Phylogenetic Relationships of WNV and Flavivirus Strains (Partial Capsid/prM Region), Neighbor-joining Method Phylogram of the partial capsid/pr M region (bases 232-641) was inferred using the neighbor-joining method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was c hosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base changes per site (max imum composite likelihood method). Bootstrap values are shown on branches Lineage I strains of West Nile virus formed a monophyletic group (e xpected). However, two strains isolated in Florida clustered with an Old World strain of the virus (WN Egypt101). Outgroup sequences we re downloaded from GenBank (Appendix R). FLM38 FLS504 FLS545 FLWN02b FLS502 FLWN05b FLWN01b WNNY99 FLWN05a FLWN01a FLWN02a FLS694 FLS649 WNEgypt Kunjin MVE JE Kern217 98 87 64 56 54 78 99 99 67 5 Old World WNV North American WNV Outgroups

PAGE 321

296 bootstrap values for the subtrees (Figure 443 and Figure 4-44, resp ectively). These trees indicate minimal sequence divergence of recen tly isolated strains of WNV as compared to WNV NY99 and WNV Egypt101 ( both Lineage 1 strains) in the capsid/prM region. Unusually, two Florida isolates clustered with the Egypt strain of We st Nile virus (Old World) instead of grouping with the other North American strains in this region. Flavivirus NS5 Region NS5 Primer Set (Fu1/cfd3) The complete NS5 gene extends from base 7637 to 10395 on the WNV genome (Lanciotti et al 1999). A fragment of this region wa s sequenced extending from base 9090 to 10091 (WNV) and from 9080 to 10077 (SLEV). Multiple sequence alignment detected several mutations in archived Florid a strains of SLEV and WNV, including base and amino acid changes noted for the stra ins isolated in 2006 (one WNV, two SLEV strains). Although this region encodes th e RNA-dependent RNA polymerase, greater sequence diversity was detected in this non-structural protein than found in the capsid or membrane regions of the viru ses analyzed in this study. Multiple sequence alignment was performed on WNV and SLEV strains simultaneously to generate a combined phyloge netic tree for these two arbovirus species. The novel flavivirus strains were not included in this analysis, as this region failed to amplify with the NS5-specific primer set in RT-PCR assays. The phylogenetic trees were calculated with neighbor-joining and maxi mum parsimony methods, with 1000 bootstrap replicates each. The consensus tree was chos en for each method. Branch bootstrap values for subtrees were more robust for the maxi mum parsimony (Figure 4-45) method than for the neighbor-joining tree (Figure 4-46). Howeve r, both trees branched into two separate

PAGE 322

297 Figure 4-43 Phylogenetic Relationships of WNV and Flavivirus Strains (Partial Capsid/prM Region), Maximum Parsimony Method Phylogram of the partial capsid/prM region (bases 232-641) was inferred using the maximum parsimony method in MEGA4.0.1, where the consensus tree (1000 bootstrap repli cates) was chosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base change s in the entire sequence. Bootstrap values are shown on branches. Lineage I strains of West Nile virus formed a monophyletic group (expected). However, two strains isolated in Florida clustered with an old world strain of the virus (WN Egypt101). Outgroup sequences were downloaded from GenBank (Appendix R). FLWN02a FLWN05a FLWN01a FLWN01b FLWN05b WNNY99 FLS502 FLM38 FLWN02b FLS504 FLS545 FLS649 FLS694 WNEgypt Kunjin MVE JE Kern217 92 84 51 59 97 100 58 10 Old World WNV North American WNV Outgroups

PAGE 323

298 Figure 4-44 Phylogenetic Relationships of WNV and Flavivirus Strains (Partial Capsid/prM Region), UPGMA Method Phylogram of the partial capsid/pr M region (bases 232-641) was inferred using the unweighted-paired group m eans arithmetic (UPGMA) method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was chosen. UPGMA method produced a r ooted tree and assumed a constant rate of evolution. Branch lengths represent the amount of genetic divergence, with the s cale bar corresponding to number of base changes per site (maximum composite likel ihood method). Bootstrap values are shown on branches. Lineage I strain s of West Nile virus formed a monophyletic group (expected). However, two strains isolated in Florida clustered with an old world strain of the virus (WN Egypt101), with robust bootstrap values. Outgroup sequences were downloaded from GenBank (Appendix R). FLS502 FLWN02b FLS545 FLM38 FLS504 FLWN01b FLWN05b WNNY99 FLWN05a FLWN01a FLWN02a FLS694 FLS649 WNEgypt Kunjin MVE JE Kern217 98 86 62 76 99 99 0 5 10 15 20 Old World WNV North American WNV Outgroups

PAGE 324

299 Figure 4-45 Phylogenetic Relationships of SLEV & WNV Strains (NS5 Region), Neighbor-Joining Method Phylogram of the partial NS5 regi on for SLEV and WNV isolates was inferred using the neighbor-joi ning method in MEGA4.0.1, where the consensus tree (1000 bootstrap repli cates) was chosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base cha nges per site. Bootstrap values are shown on branches. Outgroup and Ke rn217 sequences were downloaded from GenBank (Appendix R). FL85a FL85b Kern217 TBH-28 FL52 FL89 FL90a FL90d FL90b FL90c FL72 TR62 TR58 FLS569 FLS650 BR64 BR69 Ilheus JE MVE Kunjin WNEgypt FLWN05a FLWN05b FLM38 FLS502 FLS504 FLS545 WNNY99 FLWN01a FLWN02a FLWN01b FLWN02b Rocio 67 17 20 53 27 42 88 81 99 99 98 73 98 63 58 95 67 49 41 99 44 86 81 0.2 West Nile Virus St. Louis Encephalitis Virus Outgroups Outgroup

PAGE 325

300 Figure 4-46 Phylogenetic Relationships of SLEV & WNV Strains (NS5 Region), Maximum Parsimony Method Phylogram of the partial NS5 regi on for SLEV and WNV isolates was inferred using the maximum parsim ony method in MEGA4.0.1, where the consensus tree (1000 bootstrap repli cates) was chosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base change s in the entire se quence. Bootstrap values are shown on branches. Outgroup and Kern217 sequences were downloaded from GenBank (Appendix R). FL85a FL85b Kern217 TBH-28 FL52 FL89 FL90b FL90a FL90c FL90d TR58 TR62 FL72 FLS569 FLS650 BR64 BR69 Ilheus JE MVE Kunjin WNEgypt FLWN01a WNNY99 FLWN02a FLWN01b FLWN02b FLWN05a FLWN05b FLS545 FLM38 FLS502 FLS504 Rocio 86 69 62 33 47 18 99 99 99 68 99 99 99 37 51 58 98 77 45 75 47 94 99 64 99 69 50 West Nile Virus St. Louis Encephalitis Virus Outgroups Outgroup

PAGE 326

301 groups, such that SLEV isolates clustere d in the top region whereas WNV strains clustered in the lower half of the tree. As shown for the complete envelope region of SLEV, Floridas epidemic strains clustered into a separate group from reference SLEV isolates collected over five decades in Florid a. In addition, recent S LEV strains collected from sentinel chickens also clustered with S outh American strains, as seen in the partial membrane/envelope (SLEC) and complete envelope regions of the genome. A small number of sequence mutations were identified in the NS5 (RNAdependent RNA polymerase domain) region of West Nile virus strains collected over a five year time span. Consequently, these stra ins clustered into a si ngle group with little sequence variation and shorter branch lengths. WNBE Primer Set A second C-terminal fragment of the NS5 gene was analyzed for detection of WNV (and non-specifically amplified SLEV). Recent West Nile virus and novel flavivirus strains isolated from sentinel chickens were assayed with the WNBE primer set for amplification of this region. However, this primer pair was not optimal for sequencing reactions and most of the strains sequenced with this primer set failed. A contig was successfully generated fo r FLS504 with the forward and reverse primers for this region of the virus. In addition, a contig for one of the novel flavivirus strains (FLS694) was also assembled for this shorter C-terminal fragment of the NS5 gene (~300bp). Interestingly, the larger NS5 gene fragment (~1.0 kb) was not successfully amplified by the Fu1/cfd3 primer set for the FLS694 strain. Additional West Nile virus complete genome sequences were downloaded from GenBank (Accession numbers provided in Appendix R) and imported into MEGA4.0.1. A ClustalW 1.6

PAGE 327

302 multiple sequence alignment was performed with the FLS504 and FLS694 sequences, as well as the downloaded WNV sequences, for trimming of complete sequences to the appropriate size (Appendix M). Phylogenetic trees were constructed using neighbor-joining and maximum parsimony methods. The neighbor-joining met hod produced a consensus tree with the North American, Mexican and European (Hungary 2003) strains diverging from the Egypt101 strain of WNV, with a poor bootstra p value (82) [Figure 4-47]. However, the maximum parsimony method generated a more robust phylogenetic tree, such that the bootstrap value for the branch diverg ing from Egypt101 was 99 [Figure 4-48]. Flavivirus 3Non-coding Region The complete 3Non-coding region of flaviviruses extends from genomic position 10, 396 through 11,029 (as reported for WNV) [Lanciotti et al 1999]. A 600bp fragment of this region was analyzed for a subset of St. Louis encephalitis virus strains, including one recent strain (FLS569) isolated from a sentinel chicken. Phylogenetic trees were constructed using neighbor-joining, maxi mum parsimony and UPGMA methods, with 1000 bootstrap replicates each. The consensu s tree was chosen for each method. Neither the neighbor-joining or maxi mum parsimony (Figure 4-49) methods produced phylogenetic trees with robust bootstrap values at the interior branches (neighbor-joining tree not shown). Howeve r, the UPGMA method produced improved bootstrap values for most branches (although still below 95) [Figure 4-50]. Topology of these trees was similar to topologi es estimated for the complete envelope and NS5 regions, in that SLEV strains branch into North and South American groups. In

PAGE 328

303 Figure 4-47 Phylogenetic Relationships of WNV and Flavivirus Strains (WNBE: Partial NS5 Region), Neighbor-joining Method Phylogram of the partial partial NS5 region was inferred using the neighbor-joining method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was chosen. Bran ch lengths repres ent the amount of genetic divergence, with the scale bar corresponding to number of base changes per site (maximum compos ite likelihood method). The bootstrap value is shown on the branch. Four additional complete WNV sequences (WNFL03, WNHungary, WNTX02, WNMexico) were downloaded from GenBank (Appendix R) for comparison to FLS504 and FLS694. FLS694 FLS504 WNNY99 WNFL03 WNTX02 WNMexico WNHungary WNEgypt Kern217 82 0.1

PAGE 329

304 Figure 4-48 Phylogenetic Relationships of WNV and Flavivirus Strains (WNBE: Partial NS5 Region), Maximum Parsimony Method Phylogram of the partial partial NS5 region was inferred using the maximum parsimony method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was chose n. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base changes in th e entire sequence. Four additional complete WNV sequences (WNFL03, WNHungar y, WNTX02, WNMexico) were downloaded from GenBank (Appendix R) for comparison to FLS504 and FLS694. FLS504 WNNY99 WNFL03 WNHungary FLS694 WNTX02 WNMexico WNEgypt Kern217 99 10

PAGE 330

305 Figure 4-49 Phylogenetic Relationships of SLEV Strains ( Flavivirus 3NC Region), Maximum Parsimony Method Phylogram of the 3non-coding regi on was inferred using the maximum parsimony method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was chosen. Bran ch lengths repres ent the amount of genetic divergence, with the scale bar corresponding to number of base changes in the entire sequence. Bootstrap values are shown on the branches. Kern217, WNNY99 and WNEgypt complete genome sequences were downloaded from GenBank to incl ude in this analysis (Appendix R). TBH-28 FL85a Kern217 FL52 FL90b FL90d FLS569 TR62 FL72 BR69 WNNY99 WNEgypt 91 77 46 64 27 45 47 99 20

PAGE 331

306 Figure 4-50 Phylogenetic Relationships of SLEV Strains ( Flavivirus 3NC Region, UPGMA Method Phylogram of the 3non-coding regi on was inferred using the UPGMA method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was chosen. Branch leng ths represent the amount of genetic divergence, with the s cale bar corresponding to number of base changes per site (maximum composite likel ihood method). Bootstrap values are shown on the branches. Kern217, WNNY99 and WNEgypt complete genome sequences were downloaded fr om GenBank to include in this ) analysis (Appendix R). FL90b FL90d FL52 Kern217 TBH-28 FL85a TR62 BR69 FL72 FLS569 WNNY99 WNEgypt 99 76 52 86 54 47 64 100 0.0 0.1 0.2 0.3 0.4

PAGE 332

307 addition, the SLEV strains isolated in 1990 cl ustered together for all genomic regions analyzed, including this segmen t of the 3non-coding region. FLS569 Complete Coding Sequence The complete nucleotide coding sequence for FLS569 was sequenced and assembled at the University of Alabama at Birmingham to investigate potential recombination between flaviviruses in this SLEV strain. Reco mbination was not detected when 1000bp sequence fragments were blasted in GenBank (99-100% identity matches to Brazilian and Peruvian strains previously described for FLS569). A phylogenetic tree was created using the heuristic search op tion in PAUP 4.0 (D.Swofford, Sunderland, Massachusetts, available at http://paup.csit.fsu.edu/index.html ), with 1000 bootstrap replicates for the complete coding sequen ce of FLS569 (Figure 4-51). One WNV strain (FLS545) collected from this sentinel chicken two days earlier than FLS569 was also sequenced in the coding regions. The FLS 545 WNV strain coding sequence was blasted, with BLASTN sequence identity matches 100% to North American strains of West Nile virus. Recombination was not detected when 1000bp sequence fragments were blasted in GenBank for this strain of WNV (data not shown).

PAGE 333

308 Figure 4-51 Phylogenetic Relationship s of North and South American SLEV Strains (Complete Coding Sequences) A phylogenetic tree was computed fo llowing sequencing of the complete coding region of FLS569. Complete coding sequences for North and South American strains of SLEV were evaluated (downloaded from GenBank, see Appendix R). Phylogeny was inferred using PAUP4.0, heuristic search option and 1000 bootstra p replicates. Bootstrap values are shown on the branches. FLS569 has been identified as 569Tampa in this phylogram. This tree corroborates BLASTN results on FLS569 and recommends placement of this strain in Lineage V, as proposed by Kramer and Chandler (2001).

PAGE 334

309 Arbovirus Growth Characteristics Primary Passage (Mouse Brain to Vero Cell Culture) From the 1950s to the 1970s, reference stra ins of St. Louis encephalitis virus were passaged in suckling mice and stored at -70 C at the Florida Department of Health Epidemiology Research Center (now known as the Virology section of the FDOH Bureau of Laboratories). These included Florida and South American strains of the virus. For this project, aliquots of these reference st rains were thawed and virus was extracted from the tissue. A two-log dilution (10-2) of the extracted virus sample was prepared and inoculated into Vero cell culture to evaluate the in vitro phenotype of sele cted strains. South American SLEV strains adapted quickly to Vero cell culture, with first observed cytopathic effect (cpe) at 6 days post-inoculation. The FL52 Miami strain of SLEV replicated slowly in culture (1+ cpe at Day 6) and was harvested at Day 11 (2+ cpe). FL72 is olate adapted quickly to Vero cell culture and was preserved (frozen) seven days post-inoc ulation (DPI), with 3 cpe observed at this time point. TBH-28 had previously been cultured in Vero cells and required 7-9 days to replicate in cell culture and/ or plaque assays. SLEV strains from the 1980s and collected during 1990 were previously cultured in Vero cells. However, two strains of SLEV isolated in 1985 from Culex nigripalpus mosquito pools (FL85a & FL85b) were difficult to cultu re again. FL85a produced weak cpe (+/-) seven days post-inoculation but this cytopathic effect did not increase through Day 14. The FL85a (Vero1) culture was re-passaged and cpe was first observed 10 days following second passage (1+ cpe) and preserved on Day 12. In addition, cytopathic effect was not detected during the 14 days following initia l passage of FL85b. This culture was also

PAGE 335

310 passaged again and cpe first observed 10 DP I and frozen on Day 12. SLEV FL89 also was difficult to culture, with the same pattern observed as described above for FL85a (except cpe was first noted 7 DPI, Vero2). Table 4-17 summarizes the incubation times and cpe value noted for each strain. Plaque assays were also performed for a s ubset of the reference strains by diluting an aliquot of the passaged culture (Vero1) 1:100 and 1:1000 and inoculating 0.1 ml into 6-well Vero culture plates, in duplicate. Ne utral red agarose-media overlays were added at the appropriate time for each strain, 3 da ys post-inoculation for South American SLEV isolates and 7 DPI for North American isolates (except FL72, FLS569, and FLS650). Plaques were then clearly visible on Day 5 and Day 9 for South and North American isolates, respectively. Plaque morphology is illustrated in Figure 4-52, where North American strains generally formed larger pla ques than South American strains that were studied. Note: small plaque variants we re also seen, especially for FL90d. Primary Passage (Cloacal Sw ab to Vero Cell Culture) The pattern of virus repli cation in cell culture (phenot ype) of recent arbovirus isolates was characterized in vitro to investigate potential strain differences. In 2005, first passage of FLM38 (WNV) in vitro was tested by inoculation of 1.0 ml filtered cloacal swab diluent into Vero cell culture (25cm2 flasks). This first passage of FLM38 required 3 days to produce a microscopically obs ervable weak cytopathic effect (+/-) and 5 days post-inoculation to produce 3+ cpe. Plaque assays were performed on the cloacal swab diluent to estimate the titer of virus in the sample. Results from this assay estimated 3 PFU/0.1ml infectious WNV shed in the feces for this strain. FLM38 was the only arbovirus cultured in 2005 fr om sentinel chickens.

PAGE 336

311 Table 4-17 Incubation Period for SLEV Reference Strains Cloacal swabs were processed and 1.0 ml of diluent was filt ered and inoculated into Vero cell cultures. Cultures were microscopically examined each day for cytopathic effect (cpe) and incubated for 14 days. South American SLEV strains quickly developed cpe, wherea s first passage of North American st rains needed a longer incubation period. O b s e r v e d c y t o pathic effect for each time point is provi ded on scale of 0, +/-, 1, 2, 3, 4 (note: plus signs indicate a half-way point between each level from 1 to 4, with 4 as the strongest eff ect). Cultures were examined microscopically each day to detect cpe and cultures were preserved (frozen) when cpe reached 2+ to 4. First Observed Cytopathic Effect for SLEV Reference Strains Inoc ulated into Vero Cell Culture* SLEV Reference Strains Vero Cell Culture FL52 TBH-28 FL-72 FL85a FL85b FL89 FL90a TR62 BR69 Passage 1 6 DPI (1+) 7 9 DPI (2+) 7 DPI (3) 7 DPI (+/-) 14 DPI (0) 7 DPI (+/-) 3 DPI (+/-) 6 DPI (+/-) 7 DPI (+/-) Passage 2 NA NA NA 10 DPI (1+) 10 DPI (1+) 7 DPI (+/-) NA NA NA

PAGE 337

312 Figure 4-52 Comparison of Plaque Phenotype of Reference St. Louis Encephalitis Virus Strains Cell culture media from VERO passage 1 of St. Louis encephalitis virus strains were diluted two logs (10-2), inoculated into 6-well Vero culture plates, and incubated for 5-9 days. SLEV strains FL52, TBH-28, FL90a and FL90d formed plaques 9 days post inoculation. FL72 and South American strains of SLEV formed pla ques 5 days post-inoculation. FL52 TBH-28 FL72 FL90a FL90d TR62 BR69 Negative Control

PAGE 338

313 In 2006, FLS502 (WNV) produced strong cytopa thic effect (2+) after 4 days of incubation in Vero cell culture on initial passage and was frozen at Day 5 (4 cpe). Plaque assays on the cloacal swab diluent detected 816 PFU/0.1ml shed in the feces. In contrast, weak cpe (+/-) was observed for FLS504 and FL S545 after primary passage in Vero cells at 4 days post-inoculation, but quickly reached an observed cpe of 4 within 24 hours (Day 5). Plaque assays on the processed cloacal swab media for FLS504 detected 6 PFU/0.1ml of virus shed in the feces. WNV was is olated from Bird 8-003-R in Sarasota County twice, the FLS502 and FLS545 strains. The second cloacal swab (FLS545) contained 36 PFU/0.1ml of virus in the feces seven days following collection of the initial swab (FLS502, 816 PFU/0.1ml). First passage of FLS569 (SLEV) from th e processed cloacal swab in Vero cell culture required 11 days to produce weak cytopathic effect (+/-) and the culture was frozen after 13 days (2+ cpe). Plaque fo rming units were directly detected on the processed cloacal swab media (32 PFU/0.1 ml) after ten days. FLS650 (SLEV) required a longer incuba tion period than FLS569 after primary inoculation from the cloacal swab into Vero cultures in order to replicate. Cytopathic effect was not observed at Days 11 or 14 post-inoculation, but was identified after 17 days (3 cpe) and the culture was frozen. Molecular detection of the viral RNA (TaqMan RT-PCR) on the cloacal swab prevented this culture from being discarded after 14 days (the normal incubation period). In addition, plaque forming units were not detected directly from processed cloacal swab me dia for FLS650 despite a longer incubation period (20 days as compared to 10 days) allowed for the plaque assays. As a result, the

PAGE 339

314 amount of virus shed in the feces for this chicken could not be quantified but was estimated at less than 2 PFU/0.1 ml (d etection limit of the plaque assay). Cytopathic effect was not observed for the novel flavivirus strains FLS649 and FLS694 following inoculation into Vero cell cu ltures with processed cloacal swab media (14 days). 1.0 ml of the origin al Vero culture (first passage) was inoculated into a second culture and incubated for 14 days, but cyt opathic effect was not detected (second passage). In addition, plaque a ssays performed on the processed cloacal swab diluent for FLS649 and FLS694 did not produce plaque forming units. Table 4-18 summarizes the incubation times for first and second passage of arboviruses isolated from cloacal swabs. Secondary Passage (Vero Culture to Vero Culture) Plaque assays were also performed for each recent arbovirus strain collected from sentinel chickens by first diluting an ali quot of the passaged culture (Vero1) 1:100 and 1:1000. These dilutions were inoculated into 6 well Vero culture plates, 0.1 ml per well, and performed in replicate. Neutral red agarose-media overlays were added at the appropriate time for each strain, 3 days post-inoculation for West Nile and South American SLEV isolates and 7 DPI for No rth American SLEV isolates (TBH-28). Plaques were then clearly visible on Day 5 for WNV, as well as for South American SLEV strains. TBH-28 plaques were not visible until 9 DPI. Plaque morphology of the 1:100 dilution for each strain is illustrated in Figure 4-53, wher e it can be seen that West Nile virus formed much larger plaques than S LEV strains isolated from sentinel chickens. Although SLEV strain FLS569 formed seve ral large plaques, it also produced hundreds of small plaques that scattered acr oss the cell monolayer. In contrast, SLEV FLS650 did not produce large plaques; instead hu ndreds of very small, pin point plaques

PAGE 340

315 Table 4-18 Incubation Period & Titer of Arbovirus Stra ins Isolated from Cloacal Swabs of Sentinel Chickens Cloacal swabs were processed and 1.0 ml of diluent was filt ered and inoculated into Vero cell cultures (the inoculum was out of 1.0 ml total for FLM38 or out of 3.0 ml for FL S502-FLS694). Cultures were microscopically examined each day for cytopathic effect and typicall y incubated for up to14 days. West Nile virus isolates quickly developed cpe, whereas first passage of St. L ouis encephalitis virus required up to 17 days post-inoculation. *Observed cytopathic effect for each time point is provided on s cale of 0, +/-, 1, 2, 3, 4 (note: plus signs indicate a half-wa y point between each level from 1 to 4, with 4 as the strongest effect). Cultures we re examined microscopically each day to detect cpe and cultures were preserve d (frozen) when cpe reached 2+ to 4. Cloacal swabs collected from the same bird. First Observed Cytopathic Effect & Virus Titer for Cloacal Swabs Inoc ulated into Vero Cell Culture* WNV SLEV FLAVIVIRUS Vero Cell Culture FLM38 FLS502 FLS504 FLS545 FLS569 FLS650 FLS649 FLS694 Passage 1 3 DPI (+/-) 4 DPI (2+) 4 DPI (+/-) 4 DPI (+/-) 11 DPI (+/-) 17 DPI (3) 14 DPI (0) 14 DPI (0) Passage 2 3 DPI (2+) 3 DPI (2+) 3 DPI (1+) 3 DPI (3+) 5 DPI (2+) 6 DPI (1+) 14 DPI (0) 14 DPI (0) Virus Titer on Cloacal Swab (PFU/0.1 ml) 3 816 32 36 32 < 2 NA NA

PAGE 341

316 Figure 4-53 Comparison of Plaque Phenotyp e of Sentinel Chicken Arbovirus Strains Cell culture media from VERO passag e 1 of West Nile virus strains FLM38, FLS502, FL504 and FLS54 was diluted two logs (10-2), inoculated into 6-well Vero culture plates, an d incubated for five days. SLEV strains FLS569 and FLS650 (passage 1) were also assayed as above. SLEV isolat ed from sentinel chickens was assayed as above and also formed plaques five days post-inoculation. FLM38 (WN) FLS502 (WN) FLS504 (WN) FLS545 (WN) FLS569 (SLE) FLS650 (SLE) TBH-28 (SLE+ Control) Negative Control

PAGE 342

317 formed after 7 days-post inoculation (Figure 4-53). Ten plaques were measured for each virus strain (Vero1) isolated from sentinel chickens for both the wild type and antibodyneutralized plaque variants. The average pl aque size and incubati on period for each virus strain is included in Table 4-19. Novel flavivirus strains (FLS649 and FLS694) did not replicate or produce cytopathic effect in Vero cell cultures. Further studies are needed to fully evaluate the detection of these flavivirus strains, including inoculati on into susceptible hosts to investigate host range, virulence potential, a nd to generate additional viral RNA template for complete genome sequencing of these strains.

PAGE 343

318 Table 4-19 Plaque Morphology of Arbovi rus Strains Isolated from Sentinel Chickens (2005-2006) Plaque assays were performed on arbovirus isolates collected from sentinel chickens. Ten plaques were measured for each virus strain (passaged once in Vero cells, wild t ype), with the average size reported below. Virus neutralization assays were also performed on four of these strains by challenge with the homologous antibody (polyclonal WN antibody for FLS502, FLS504, and FLS545; polyclonal SLE antibody for FLS569). Smaller plaque sizes were identified for each strain following neutralization with polyclonal antibody. Ten plaque s (small variants) were measured, with the average size repor ted below. The incubation periods for the plaque assays are shown for each strain, as timed days postinoculation (DPI). Plaque Morphology of Arbovirus Strains Isolated from Sentinel Chickens Strain Wild Type Vero 1 (mm) Small Variants +Ab Vero1 (mm) Incubation Period (DPI) FLS502 6 1 5 FLS504 5.5 5 5 FLS545 7 5.25 5 FLS569 4.08 0.92 5 FLS650 0.05 NA 7 Cloacal swabs collected from the same bird.

PAGE 344

319 CHAPTER FIVE DISCUSSION The introduction of West Nile virus to the United States in 1999 demonstrated the potential of arboviruses to emerge into ne w regions, with widespread impact on the native human and animal populations (Gubler, 2002; CDC, 2007e). The rapid dispersal and establishment of enzootic foci of West Nile virus tran smission activity throughout the United States (likely Canada, the Caribbean and South America, as well) in the last eight years created the need for public health agenci es to enhance surveillance and research of this serious zoonotic, vector-bor ne pathogen (Gubler, 2007). Prior to 1999, St. Louis encephalitis virus was the only mosquito-borne human pathogen in the family Flaviviridae found on this continent, with intermittent epidemic transmission up to 3,000 cases per year (average 128), and a case fatality rate of 5% (CDC, 2007j). However, limited transmission activity of SLEV has also been shown by sentinel chicken surv eillance for both viruses in Flor ida (Stark & Kazanis, 2001-2006) and throughout the United States (USGS, 2007) since the introduction of West Nile virus. The reason for the disappearance of SLEV in areas with enzootic foci of WNV has not been thoroughly investigated. A co mplex interplay of abiotic (rainfall, temperature, habitat) and biotic (competent vector and host species, virus strain) factors contribute to the life cycle a nd subsequent transmission of these viruses (see Figure 2-7) [Day, Curtis and Edman, 1990; Day, 2001; Re isen, 2003; Shaman, Day, Stiegletz, 2005;

PAGE 345

320 Reisen, Fang, Martinez, 2006; CDC, 2007b and d]. However, the establishment of a closely related flavivirus family member (West Nile virus) in historically endemic areas of St. Louis encephalitis virus transmission likely influences th eir life cycles as they share and/or compete for these resour ces (Reisen, 2003; Lillibridge et al 2004). This study was motivated to elucidate the impact of West N ile virus on the natural history of St. Louis encephalitis virus in Florida, where several outbreaks of SLEV led to the establishment (and continuation) of one of the largest ar boviral surveillance programs in the United States (Bigler B, 1999). In 2004, as part of this study, an Arboviru s Isolation Network was established to collect arbovirus samples from naturally e xposed birds at potentia l hot zones of transmission activity based on weekly surveillance results for the Sentinel Chicken Program. In particular, this project investigated the impact on the St. Louis encephalitis viral genome by assessing genotypic and phenotypi c characteristics of the virus prior to and following the introduction of West N ile virus to Florida in 2001. A molecular epidemiology analysis of Florida SLEV st rains identified nucleotide base changes characteristic of the 1990 epidemic strains that may be useful from a public health perspective to evaluate the relative pathogenicity of futu re circulating strains. Aim One Evaluation of Arbovirus Isolation Network Earlier studies were unsuccessful in the isolation of SLEV from migratory or resident birds and/or mosquitoes (Calisher et al 1971; Reisen et al 2000; Reisen et al 2003). In fact, diagnosis of animal infection by virus isolation of SLEV is infrequent (Reisen, 2003). These findings are supporte d by surveillance data in Florida. The

PAGE 346

321 submission of mosquito pools and dead bird s since the introduction of WNV has not resulted in the detection or culture of St Louis encephalitis virus at the BOL-Tampa (Stark and Kazanis, 2001-2007). Consequently, a random approach to arbovirus isolation is unlikely to succeed due to the low prevalen ce of SLEV and sporadic transmission of arboviruses in Florida. Epidemio logical data has been used to target mosquito collections during local transmi ssion of malaria ( P. vivax) in Palm Beach, Florida, where trapping was performed within 1 mile of patient homes The parasite was not detected in these mosquito collections (CDC, 2003b). This st rategy has also been used to collect mosquitoes during outbreaks of West Nile vi rus near patient homes and active sentinel chicken sites during 2001-2005 in Florida to detect the viru s, with moderate success (unpublished data, BOL-Tampa). In 2004, a similar strategy was employed in the State of Sao Paulo, Brazil following the isolation of SLEV (strain SPH 253175) from one patients serum, the first human case in more than twenty years reporte d in the region. Mosquitoes and wild birds were trapped near the patients residence and in forested areas in the region from May 18 through May 22, 2004. Sentinel mice were also se t up in the same locations for 3 days. All samples collected were SLEV negative. However, the patients illness had occurred five months earlier in January (Rocco et al 2005). Arbovirus Isolation Network (Sentinel Chicken Program) Therefore, a targeted method was designe d to collect samples from sentinel chickens at hot zones of arbovirus (especially SLEV) tr ansmission activity based on weekly surveillance data for these viruses. In 2004, local agencies collaborating in the Florida Sentinel Chicken Program were invite d to participate in the Arbovirus Isolation

PAGE 347

322 Network based on their location in the historic al SLEV transmission belt in Florida (see Figure 3-1). Ten out of fourteen agencies contacted by the Fl orida Department of Health, Bureau of Laboratories, Tampa (BOL-Tampa ) agreed to participate in the Arbovirus Isolation Network. The effectiv e recruitment of these partners relied on the long-standing success of the Florida Sentinel Chicken Progr am and nearly two decades of collaboration with the BOL-Tampa. In 2004, one agency (Hillsborough Count y Mosquito Cont rol District) successfully piloted a protocol at 3 target ed sites to optimize sampling criteria and collection methods, which guided the design of the targeted protocol for all agencies. During 2005-2006, the Arbovirus Isolation Network was effective at targeting sites for virus isolation. The BOL-Tampa requested 9 ag encies to target se ntinel chicken sites based on alphavirus and flavivirus surveillance results ( HAI, MAC-ELISA, PRNT assays). Eight agencies implemented sample co llection at targeted sites within one week of request, with most collaborators starting sample co llection within 2-3 days. The only agency that was unable to accomm odate the request to target its active sentinel chicken sites experi enced an outbreak of WNV in its area during July, 2005. Due to intensive vector control efforts needed to limit the human outbreak, personnel were unable to also target active sites for clo acal swab collection. A lthough targeted samples in this region may have provi ded the highest success of ar bovirus isolation, personnel to perform the collections were not availabl e. For an Arbovirus Isolation Network to specifically target sites during an outbreak of WNV or SLEV, additional funding may be required to supplement mosquito control personnel for the collecti on of samples from sentinel chickens (as shown in this study).

PAGE 348

323 Partner agencies in the Sentinel Chicken Program estimated that the time needed to collect cloacal swabs from a targeted si te during the weekly co llection of serum was minimal, approximately 5-10 additional minut es per site [personal communications, E. Elbert (OCMCD) and N. Osborn (SCMCD)]. In addition, these agencies monitored the chickens every 2-3 days during the week to feed, water, a nd monitor the health of the flock so that collection of swabs twice duri ng a week did not requi re a special trip. Arbovirus Isolation Network (Wild Birds) Nevertheless, adult chickens are not believed to devel op the high titered viremias necessary to infect mosquitoes and do not contribute to the amplification cycle, as estimated by previous studies on SLEV and WNV (Reisen et al 1994; Langevin et al 2001; Komar, 2001; Patiris et al 2008). In 2006, sampling of wild birds was also implemented to attempt SLEV detection/is olation from the primary avian amplifying hosts of the virus. Wildlife rehabilitation cen ters were recruited to the Arbovirus Isolation Network based on membership in the Florid a Wildlife Rehabilitati on Association. Five wildlife centers located throughout Florida participated in the study and submitted samples from wild bird species (Appendix H) from March through December, 2006. The Florida Fish and Wildlife Conservation Commission (FWC) al so collected samples from wild bird mortality events in the state. Wildlife rehabilitation centers also re ported minimal time spent for sample collection [personal communication, D. Flynt (ACBP)]. Samples were often frozen, batched and shipped to the laboratory every fe w weeks. However, virus was not detected or isolated from these samples. These strategies for sample collection from wild bird species were either from ill or injured birds, or from fatalities. While these methods have

PAGE 349

324 been successful for West Nile vi rus detection/isolation (Komar et al 2002; Nemeth et al 2007; CDC, 2007g), SLEV has not been reported to cause morbidity or mortality in wild bird species (CDC, 2007j). The addition of ag encies to the Arbovirus Isolation Network that work with live, healthy wild species is recommended in future studies for the specific detection of SLEV. This Arbovirus Isolation Network focused on a targeted sampling strategy of avian species for the detection/isolation of St. Louis encephalitis virus. However, the weekly surveillance results th at identify arbovirus transm ission activity at sentinel chicken sites would be especially useful in future studies to also target mosquitoes and wild birds at/near these sites for virus isolation. Currently, many mosquito control agencies collect mosquitoes at sites when se ntinel activity is dete cted for speciation and counts but may not perform or submit pools for molecular detection of the virus. Additional investigations to de tect/isolate the virus in the vector and primary amplifying hosts would require additional funding and coordination between the mosquito control district and ornithologi sts/veterinarians for sample collect ion from mosquitoes and birds, respectively. Aim Two Evaluation of Targeted Sampling Strategy Previously, SLEV has been isolated from one sentinel chicken in Panama in 1983 (Kramer and Chandler, 2001) and Belem, Brazil in 1969 [personal communication to F. Wellings (ERC) from G. Sather (University of Pittsburg) about the BR69 strain acquired by the Epidemiology Research Center in 1971]. Murray Valley encephalitis virus was isolated from the blood of sentinel chic kens in Australia during 1974 (Campbell and

PAGE 350

325 Hore, 1975). In addition, SLEV was isolated from a flock of domestic pigeons in 1962 near Tampa, Florida (Gainer et al 1964). However, these collections were not systematically targeted (with the exception of samples collected from the flock of pigeons following 12 pigeon deaths in 1962). Targeted Strategy for Sentinel Chickens In Florida, the targeted sampling stra tegy of sentinel chicken sites for the isolation/detection of arboviruses was performed from July 2005 through December 2006. Most sampling occurred during peak months of the SLEV transmission season (August through November) in Florida. This long -term study (two year s) is the first to actively target sentinel chicken flocks for the isolation of St. Louis en cephalitis virus with cloacal swabs. Eight agencies with sentinel chicken programs activ ely participated and collected blood and/or cloacal swabs as part of routine arbovirus surveillance programs. Sentinel chicken serological assay results were used to target sites (range 2-10) which limited the collection of swabs from ev ery site in the count y. This reduced handson time for animal handlers, waste of resources and effectively investigated sites with confirmed arbovirus transmission activity. An a dditional targeted laboratory strategy was employed by the BOL-Tampa to retrospectivel y assay swabs from sites with sentinel seroconversions (see Figures 4-11 and 4-12) Despite targeting of sites with known arbovirus transmission activity, virus was not detected/isolated from processed samples in five of the eight counties (Table 5-1) The complex arbovirus transmission cycle, influence of abiotic factors, and prompt vect or-control efforts by these mosquito control districts likely resulted in only sporadic arbovirus transmission in many of these counties,

PAGE 351

326 Table 5-1 Comparison of the Number of Targeted Sites to the Number of Sites with Virus Detected/Isolated, by County Eight counties targeted sentinel chicke n flocks for the detection/isolation of arboviruses at several sites in each region (2005-2006). However, sporadic arbovirus transmission activity and vector-control efforts often limited continued sentinel chicken se roconversions, such that virus was detected/isolated from a subset of ta rgeted sites. The number of cloacal swabs processed and confirmed positive by molecular detection assays are also shown for each county. Number of Targeted Sites Compared to Number of Sites with Virus Detected/Isolated, by County County (Year) Targeted Sites Sites with Virus Detected/Isolated # Processed Cloacal Swabs # Positive Cloacal Swabs Manatee (2005) 10 3 119 3 Orange (2005) 6 1 102 4 Orange (2006) 3 0 36 0 Sarasota (2005) 5 0 38 0 Sarasota (2006) 6 2 427 8 Lee (2006) 2 0 22 0 Pasco (2006) 3 0 20 0 Volusia (2006) 4 0 48 0

PAGE 352

327 where no further confirmed sentinel seroconve rsions occurred during targeted sampling (Lee, Pasco, and Volusia counties). Further analysis of sentinel chicken se roconversions in thes e counties revealed that 19 birds with confirmed seroconversions were swabbed at targeted sites. Virus was detected/isolated from six of these positive chickens and also from six chickens that failed to seroconvert in the HAI assay (Tables 5-2 and 5-3). The majority of chickens that seroconverted but arboviruses were not isolated or detected from cloacal swab and blood samples occurred in one county. In Manatee County, virus was not detected/isolated for thirteen (out of 14) sentin els that seroconverted in Ma natee County during targeted sampling. The reason for this high number of failed arbovirus isolation attempts was likely due to the age of the chickens (see se ction on the developmen t of primary immune response, page 355), rather than the targeted sampling method. The use of sentinel chicken serology re sults was critical to successful arbovirus isolation from these sites. HAI, MAC-ELISA and PRNT reported results were compared to evaluate the most effective method for targ eting of sentinel chic ken sites (Table 5-4). MAC-ELISA confirmed seroconversions approp riately targeted and resulted in virus detection/isolation from two counties, wher e the reported dates of MAC-ELISA results for Manatee and Orange counties initiated targeted sample co llection within 2 days. In Manatee County, the single West Nile viru s isolation from a confirmed sentinel seroconversion occurred on the fi rst date of targeted sampli ng, which was also the report date of a positive MAC-ELISA result on another chicken in the flock. In Orange County, targeted sample colle ction began four days days after HAI detected seroconversion to alphavirus was reported in July 2005. The sample was

PAGE 353

328 Table 5-2 Comparison of Sentinel Chicken Seroconversions to Birds Targeted for Virus Detection/Isolation (2005) During 2005, three counties with arbovirus transmission activity to sentinel chickens (seroconversions) targeted selected flocks for virus detection/isol ation sampling. The annual total number of sentinel seroconversions is shown for each county; however, sampling for virus isolation was not performed year-round. During sampling, a subset of birds seroconverted at all sites. The number of birds that seroconverted at target ed sites provided a better measure of arbovirus isolation/detecti on success. Manatee County had 13 chickens seroconvert from whom no virus was isolated/detected. Annual total includes both alphavirus and/or flavivirus sentinel chicken seroconversions. Sentinel Chicken Seroconversions & Virus De tected/Isolated from Ta rgeted Sites (2005) County # Birds Seroconverted (Annual Total) # Birds Seroconverted During Sampling (All Sites) # Birds Seroconverted During Sampling (Targeted Sites) # Birds Seroconverted Arbovirus Detected/Isolated # Birds Sero-negative Arbovirus Detected/Isolated Manatee 49 29 14 1 2 Orange 21 7 1 1 1 Sarasota 17 8 0 NA 0

PAGE 354

329 Table 5-3 Comparison of Sentinel Chicken Seroconversions to Birds Targeted for Virus Detection/Isolation (2006) During 2006, five counties with arbovirus tr ansmission activity to sentinel chicke ns (seroconversions) targeted selected flocks for virus detection/isolation sa mpling. The annual total numbe r of sentinel se roconversions is shown for each county; however, virus isolation sampling was not performe d year-round. During targeted sampling, a subset of birds seroconverted at all sites. The number of birds that seroconverted at target ed sites provided a better measure of arbovirus isolation/detection su ccess. Virus was isolated/detected from each bird that seroconverted in Sarasota Co. Annual total includes both alphavirus and/or flavivirus sentinel chicken seroconversions. *14 SLEV seroconversions, 1 WNV seroconve rsion. Note: 11 birds seroconverted to SLEV after targeted sampling was terminated in Lee County. 7 SLEV seroconversions (August-December 2006), 1 WNV seroconversion (April 2006). Sentinel Chicken Seroconversions & Virus De tected/Isolated from Ta rgeted Sites (2006) County # Birds Seroconverted (Annual Total) # Birds Seroconverted During Sampling (All Sites) # Birds Seroconverted During Sampling (Targeted Sites) # Birds Seroconverted Arbovirus Detected/Isolated # Birds Sero-negative Arbovirus Detected/Isolated Lee 15* 0 0 NA 0 Orange 5 3 0 NA 0 Pasco 1 0 0 NA 0 Sarasota 8 10 4 4 3 Volusia 7 0 0 NA 0

PAGE 355

330 negative for IgM. However, this sample was assayed in the PRNT and later confirmed positive (reported 08/02/05). Targeted sample collection continued at Site 004 for one month and EEE viral RNA was detected on cloacal swabs on August 17 and 19. In this situation, a delay in targeting of the site until co nfirmation in the PRNT would still have resulted in detection of EEEV (due to the re latively short PRNT assay time of 5 days compared to 14 days for SLEV) [Table 5-4]. Unlike these two agencies, Sarasota Count y did not wait until confirmation in the MAC-ELISA or PRNT to initiate target ed sample collection in 2006. At site 004, presumptive seroconversions in the HAI assa y were reported on October 6 and targeted sampling of this flock started 3 days later on October 9. At this site West Nile virus was isolated from Bird 8-003-R twice before confirmed MAC-ELISA re sults were reported on October 18 for a serum sample collected from this chicken on October 9 (Figure 420). Consequently, HAI positive test results were indicative of acute stage arbovirus infections in Sarasota County, with viru s shedding in the feces (Table 5-4). Targeted sampling of sentinel chic ken sites based on confirmed SLEV seroconversions in the PRNT were un successful. In Lee County, a confirmed seroconversion in the PRNT necessitated a dela y of more than two we eks since the initial serum collection date and was not effective at targeting sites for the detection/isolation of arboviruses during the acute stage of in fection. Although SLEV transmission was detected at several sites located throughout Lee County in 2006 (Figur e 3-6), this activity was sporadic with positive sentinel seroconvers ions at different time points (Figure 4-16). Timing of sample collection at targeted site s in Lee County was too late and a quiescent period of one month resulted in no arbovirus de tected/isolated (Table 5-4). However, a

PAGE 356

331 Table 5-4 Dates of Reported Serology Te st Results & Start Dates of Targeted Sampling Serology test results (HAI MAC-ELISA, and PRNT) were used to initiate targeted sample collection at sen tinel chicken sites during 2005-2006. The reported dates on these assays are compar ed to the start of targeted sample collection for four counties, with and without subsequent virus isolation. The first bird (top row) triggered target ed sample collecti on at one site in each county. The second bird (shaded row) was the next bird to seroconvert at the site (excep t for Lee County, the second bird seroconverted at another site). Targeted Sampling Based on Serology Positive Result Dates County Bird # Serum Collect Date Lab Receipt Date HAI + Report Date MACELISA+ Report Date PRNT+ Report Date Targeted Sampling Start Date Virus Isolated/ Detected? Manatee 1772 09/05/05 09/07/05 09/09/05 09/12/05 NT 09/12/05 NA 1773 09/12/05 09/14/05 09/16/05 (HAI -) NT NT 09/12/05 Yes Orange 778 07/14/05 07/19/05 7/22/05 07/25/05 ELISA08/02/05 07/25/05 NA 846 08/25/05 08/30/05 09/02/05 HAI09/06/05 ELISA09/13/05 07/27/05 Yes Sarasota 8-004-G 10/03/06 10/04/06 10/06/06 10/11/06 10/25/06 10/09/06 NA 8-003-R 10/09/06 10/11/06 10/13/06 10/18/06 11/01/06 10/9/06 Yes Lee 360 08/14/06 08/16/06 08/18/06 08/23/06 09/06/06 09/11/06 NA 425 10/10/06 10/11/06 10/13/06 10/18/06 NT Stopped 09/26/06 No Detection of virus on cloacal swabs on 08/17/05 preceded first detection of antibody development (seroconversion) in the HAI assay for this sentinel chicken.

PAGE 357

332 recommendation for future studies in Lee County would request that the agency continue (or reinstate) targeted sampling ba sed on positive HAI assay results. Overall, the use of sentinel chicken se roconversions for targeted collection of samples from active transmission sites was e ffective for the isola tion of arboviruses. However, one caveat to the us e of this strategy should be noted. Real-time detection of arboviral infections (i.e. transmission activ ity) was not possible for sentinel chickens. Instead, an estimated 2-4 day lag time was necessary for the birds to first develop antibodies to the virus following infection (Reisen et al 1994; Langevin et al 2001). A further time delay was required for antibody de tection in the HAI sc reening assay (2-7 days, depending on sera collection date and da te of submission to the laboratory). As a result, targeted sampling of active sites alwa ys occurred following at least one sentinel seroconversion and a time lag of 2-9 days. For some regions, this delay may have adversely affected the success of virus isol ation attempts where arbovirus transmission activity was extremely limited or sporadic (as noted for Pasco and Volusia counties in 2006, Figures 4-18 and 4-19). In addition, mosquito control agencies may have used the seroconversions to target areas for immediate eradication/ vector control activities. Most agencies routinely collected cloacal swabs only once during the week, at the same time as the scheduled bleeding of the flocks. However, Manatee, Orange and Sarasota counties intermittently collected clo acal swabs twice a week. As a result, this method improved virus detection/ isolation in these counties on first and/or second swabs from positive chickens. This method was not strictly necessary fo r the detection of arboviruses (as shown by Sarasota County in 2006), but it provided additional

PAGE 358

333 information on the course of natural arbovirus infections in adult ch ickens (Figures 4-10, 4-14, 4-22). Targeted Strategy for Wild Birds From April to December 2006, a total of 87 cloacal swabs were submitted from five wildlife rehabilitation centers and th e Florida Fish and Wildlife Conservation Commission from 36 different bird species. De spite targeting of cer tain species (known amplifying host) and/or symptoms indicative of arboviral infection in live birds [Komar et al 2003; Brault et al 2004; Nemeth et al, 2007], arboviruses were not detected/isolated. A previous study on clin ic-admitted raptors in Colorado identified West Nile virus infections months earlier than other traditional surveillance methods, but used both oral swabs and seroconversions to identify the virus in wild bird species (Nemeth et al 2007). This study agrees with the work by Nemeth et al (2007) that found that wildlife rehabilitation centers in Colorado provided an existing resource outside of the public health system for surveillance of arboviru ses in wild birds, where nationwide an estimated 10,000 birds are admitted to 1,000 centers each year. In addition, participation in this study provided Florida rehabilitators with access to the diagnostic services of the BOL-Tampa for detection of arbovirus infected birds. As a result, one raptor admitted to the Audubon Center for Birds of Prey was di agnosed with EEEV infection based on a four-fold rise in neutralizing antibody titer s in the PRNT. Virus isolation was not attempted on this bird, due to its admission to the rehabilitation center two weeks after first symptoms of infection.

PAGE 359

334 For the detection of St. L ouis encephalitis virus, one recommendation for future studies on wild birds would be for the collecti on of swabs and sera from a larger sample size of birds admitted to these centers, not just those exhibiting symptoms characteristic of arbovirus infection or known amplifying hos t species (n=64). In addition, agencies should be recruited for the study of healthy bird populations, such as wildlife stations that routinely band and track migrat ory birds. One such resource is already available in Florida for the surveillance of avian influen za virus in wild bird populations [personal communication, D. Wolf (FWC)] A study to attempt targeted sample collection from wild birds located near positive sentinel chic ken sites would also be beneficial. However, this would require mist net trap s and experienced handlers (Reisen et al 2000b; Reisen et al 2004b). The impact to the bird and e nvironment would be minimized by release following collection of a serum sample and cloacal swab. The techniques used in this study for sa mple collection from wild birds were previously proven successful for the is olation of West Nile virus (Langevin et al 2001; Komar et al 2002; Nemeth et al 2007). Targeted sampling during a year with increased rates of WNV transmission activity may improve isolation of West Nile virus from rehabilitated birds in Florida. SLEV has not been shown to cause significant morbidity or mortality in wild avian sp ecies (Gainer, 1964; McLean et al 2001; Reisen, 2003) and the detection of SLEV-infected wild birds would require a funding increase to add to existing arbovirus surveillance programs in Florida. Nonetheless, blood samples collected from wild trapped/released birds was proven su ccessful in Florida during the 1980s and 1990s for the isolation of SLEV, including the FL 89, FL90a-c strains analyzed in this study.

PAGE 360

335 Seasonal Timing of West Nile Vi rus and St. Louis Encephalitis Virus In 2006, the flavivirus transmission season in Florida was unusual due to the increased incidence of sentinel chicken sero conversions to SLEV (n=40) than to WNV (n=30) for the first time since the introducti on of West Nile virus to the state in 2001 (Stark and Kazanis, 2001-2006). One laborat ory study has suggested the impact of acquired immunity to one viru s in avian hosts may limit or prevent subsequent infection (and amplification) by another closely related virus, such as appears to be the case for WNV transmission followed by SLEV (Fa ng and Reisen, 2006). WNV infections appeared to prevent subsequent SLEV inf ections in wild caught house finches and may impact arboviral amplification and transmissi on cycles where these viruses coexist (Fang and Reisen, 2006). These viruses coexist in Florida and flavivirus amplification and transmission cycles have been impacted since 2001 (Figure 4-1). During the study period, seasonal timing was shown by rates of sentinel chicken seroconversions to West Nile virus (Figure 4-7) and St. Louis encephalitis virus (F igure 4-8) in 2005 and 2006. A comparison of these rates indicated that WNV transmissi on activity during May through August in 2005 was much higher than detected during the same months in 2006. Consequently, limited West Nile virus activity appeared to allow late season amplifica tion of SLEV (without early season transmission of WNV) during August through December, 2006. These findings support the experiment al evidence that found previous West Nile virus infection of avian amplifying hosts led to sterilizi ng immunity, whereby ne utralizing antibodies prevented a later St. Louis encephalitis virus infection (Fang and Reisen, 2006).

PAGE 361

336 Therefore, the influence of West Nile virus should not be discounted when a targeted sampling strategy for SLEV is im plemented in the United States. Effective surveillance data may alert an agency that the large scale tran smission of St. Louis encephalitis virus may be unlikely during a calendar year following the early season transmission of WNV. This situation was found during this study in 2005, where SLE virus not isolated or detect ed despite targeted sample collection in two counties. Additional targeted studies over several y ears and surveillance studies in naturally infected wild bird populations would be recommended to support this finding and to further estimate risk of an epidemic/epizo otic of SLEV during active West Nile virus seasons in Florida. Aim Three Evaluation of Arbovirus Identification Methods This study relied on two methods for the accurate identification of arbovirus infections in sentinel chickens, antibody development (s eroconversions) a nd detection of the viral genome with RT-PCR. The sero logy method was based on the detection of arbovirus-specific antibodies th rough testing of chicken se ra samples with the HAI, MAC-ELISA, and PRNT assays, performed as previously described (Clarke and Casals, 1958; Holden et al 1966; Calisher et al 1986c; Martin et al 2000; Schmidt, 1979; Beaty, Calisher and Shope, 1989; Voakes, 2004). These assays confir med WNV, SLEV, EEEV, and HJV transmission activity to sentinel chickens during 2005 and 2006 (Table 4-1). This information was used to target collection of samples at sentinel chicken sites located in three counties in 2005 (Figures 3-3, 3-4 a nd 3-5) and five counties in 2006 (Figures 36, 3-7, 3-8, 3-9, 3-10).

PAGE 362

337 Serology & RT-PCR Assays The HAI assay was extremely sensiti ve for the detection of arbovirus transmission activity, and also detected sentinel chicken seroconversions to South American strains of SLEV at Sites 001 and 004 in Sarasota County during 2006. However, two drawbacks to the use of this assay for the identification of arboviruses existed, as performed at the BOL-Tampa. Th is assay detected antibodies that were flavivirus or alphavirusgroup specific and could not disti nguish between closely related arboviruses, such as WNV and SLEV (or EEEV and HJV). As a result, additional confirmatory testing (MAC-ELISA or PRNT) was required to identify the etiologic agent. In addition, sera samples were batched for analysis in this test, as the laboratory typically processed up to 1500 chicken sera e ach week. Results were then reported each Friday. Consequently, confirmation of a positive test result in the HAI assay required at least 7 days (MAC-ELISA) following the origin al serum collection date, or up to 22 days when additional confirmation (PRNT) was need ed. Therefore, the use of confirmed HAI results for targeted sample collection at se ntinel chicken sites introduced an unavoidable time delay, which may have negatively impact ed the success of ar bovirus isolation in some areas (notably Manatee and Lee counties for SLEV targeting). A molecular RT-PCR assay was the second method used to screen samples for the detection of arboviruses in blood and/or cloaca l swabs. The rapid, sensitive real-time RTPCR (TaqMan) method was used to screen bo th field samples and archived reference strains of these viruses, performed as previously described (Lanciotti et al 2000; Lanciotti and Kerst, 2001; Lambert, Martin a nd Lanciotti, 2003). Sa mples that screened

PAGE 363

338 positive with the A primer sets were then confirmed with a second TaqMan assay using another (B) primer-probe set specific for each virus type. All samples that screened positive were further assayed with end-point primer sets for confirmation and sequencing (Figure 3-12). Real-time RT-PCR effectively detected (and confirmed) WNV, SLEV and EEEV in extracted cloacal swab samples. Six strain s of the virus (4 WNV+ and 2 SLEV+) were detected in cloacal swabs and matching Vero cell culture extracts. Real-time RT-PCR also detected arboviral RNA on 9 cloacal swab s (from 6 birds) but these viruses did not replicate in cell culture (2 WNV+, 4 EEEV+, and 3 Flavi+) [Table 4-5]. These molecular assays also detected and confirmed plaque clones picked from a VERO cell culture monolayer, inoculated into 1 ml of media, and RNA extr acted for both WNV and SLEV (Table 4-4). Evaluation of Seroconversions Sentinel chicken seroconversions have proven to effectively detect arbovirus transmission activity prior to human cases in Florida (Blackmore et al 2003; Butler and Stark, 2005). In Florida, sen tinel chicken seroconversions (rates, distribution) are evaluated and provided on a weekly basis ( http://www.doh.state.fl.us/environment/com m unity/arboviral/Weekly-Summary.html ) for partner agencies to assess transmission activity and to implement control measures. This information is also summarized year ly by the BOL-Tampa (Stark and Kazanis, 2001-2007). The current study has also identified that sentinel chicken seroconversions (development of antibodies) in the HAI test indicated current or re cent shedding of the virus in the feces as detected by RT -PCR (Figures 4-10, 4-14, 4-22, 4-23, 4-26).

PAGE 364

339 However, the HAI assay failed to detect se roconversions to arbovirus infections in some sentinel chickens (n=6) where the viral RNA genome was identified on cloacal swabs. RNA extraction and RT-PCR assays were repeated from the starting swab material, with similar results, indicating that contamination or switched samples likely did not occur in the laborato ry. The exact reason for the failure of these birds to seroconvert (i.e. escape dete ction in the HAI assay) is unknown and has not been demonstrated experimentally (Reisen et al 1994; Senne et al 2000; Langevin et al 2001; Patiris et al 2008). In Manatee County, many sentinel chickens were at least one year in age or older (some up to 3 years) [personal communicat ion, D. Kinney (MCMCD)]. Only chickens that seroconverted each year were remove d from the field and replaced with younger birds. Consequently, many chickens were not removed following each season and flocks contained birds of mixed ages. WNV was dete cted on cloacal swabs from chickens at Sites 002 (Bird 1714) and 015 (Bird 1695) that di d not later seroconvert (Figure 4-13). This may be a result of the advanced age and/or an altered imm une response in these chickens, whereas younger chickens usually se roconverted earlier (as seen for Sarasota County with birds aged 52 week s or 3 months younger). Howeve r, previous studies have investigated the immune response followi ng inoculation of WNV in adult chickens (Langevin et al, 2001; Patiris et al 2008) and found that all bi rds developed neutralizing antibodies. One potential explanation for these findi ngs in Manatee County may result from low-titered viremia following infection (note: no virus was detected in blood samples collected from these birds) that may have resulted in weak an tibody production and/or

PAGE 365

340 non-detection in the HAI assay. A previous study of old chickens (38 weeks) experimentally infected with SLEV found th at these birds did not develop a low-titer viremia following inoculation, unlike younger bi rds. Nonetheless, both old and young chickens inoculated with S LEV eventually developed detectable antibody in the HAI assay (Reisen et al 1994). Further animal studies woul d be necessary to evaluate the antibody response following WNV infection in olde r chickens to elucidate these findings. This phenomenon was not restricted to Ma natee County. Interes tingly, West Nile virus was also detected by RT-PCR in two birds from Sarasota County, which did not screen antibody-positive in the HAI assay in 200 6. Despite the culture of infectious West Nile virus (strain FLS504), Bird 8-005-B did not develop detectable HAI antibody at Site 004. Since swab samples were processed retros pectively, the paired serum sample (HAI negative) for the cloacal swab was discar ded and further testing (MAC-ELISA, PRNT) could not be performed. Later sera samples were drawn but were also negative by HAI and MAC-ELISA. It is interesting to note that three plaques (out of four) picked from direct inoculation of the cloacal swab (FLS504) eluate confirmed WNV and SLEV positive by TaqMan RT-PCR. CT values ranged from 22-24 for WN primer-probe sets and 37-40 for SLE primer-probe sets. The other plaque picked only tested positive for WNV, with CT values of 23-24 (data not shown) [not e: additional plaques formed in more concentrated wells but grew too cl ose together to be picked]. The CT values for both SLE primer sets were higher (37-40) th an noted for FLS502 collected at the same time point, so this may be an equivocal result. However, cross-reactions between these primer sets have not been noted during rou tine testing at the BOL-Tampa, or in prior publications (Lanciotti et al 2000; Lanciotti and Kerst, 2001) It is unknown if a mixed

PAGE 366

341 population of WNV and SLEV in the cloacal swab resulted in these cross-reactions (although this possibility was not supporte d by plaque assays, where only WNV was detected). West Nile virus (strain FLS502) was is olated from another chicken (Bird 8-003R) at this site from the same time point and did not develop WNV-specific antibodies in serum collected on October 9 (Figure 4-23). However, this chicken was also infected with SLEV and only developed SLEV-speci fic antibodies in the HAI or MAC-ELISA assays (detected in all serology assays). In addition, no seroconvers ions to West Nile virus were detected in sentinel chickens af ter April in Sarasota County (2006) [except for a presumptive positive for WNV by the MIA te st at Site 003 in June, Figure 4-20]. Consequently, the isolation of West Nile virus from these chickens was surprising, as the virus was only detected by molecular met hods (RT-PCR) in October. As in Manatee County, the age of these chickens (52 weeks) in Sarasota County may play a role in development of the immune response followi ng natural West Nile virus infection. Finally, two chickens at Site 001 in Saraso ta also failed to produce detectable total antibodies (HAI negative) followi ng RT-PCR detection of a novel flavivirus strain on cloacal swabs. Unfortunately, serum samples from these birds were not tested in the MAC-ELISA or PRNT, as these swabs were processed retrospectiv ely. It is unknown if these birds developed detectable WNV or SLEV antibodies in a more specific assay, such as the MAC-ELISA. A future study is planne d to perform complete genome sequencing of these virus strains, which may elucidate these unusual findings. Virus genotype and/or mutations in the envelope gene have been identified that pred ict virulence and/or modulate the production of cross-reactive neutralizing antibodies (Beasley et al 2002;

PAGE 367

342 Beasley et al 2004; Crill and Chang, 2004; Trainor et al 2006). Perhaps similar mutations in these genomes ma y be found that produced the c linical picture presented by these flavivirus and West Nile virus strains. Evaluation of RT-PCR Assays Real-Time (TaqMan) RT-PCR The TaqMan primer-probe sequences and gel-based primer sets developed for WNV and SLEV (Lanciotti et al 2000 and Lanciotti and Kerst, 2001, respectively) were accurate for the detection of Florida strains of these arboviruses. New strains (n=8) collected during 2005 and 2006, as well as W NV (n=8) and SLEV (n=14) reference strains, were confirmed and sequenced with these gel-based primer sets. The WNV primer sets performed as previously reported (Lanciotti et al 2000), such that six reference strains of WNV from Florida were detected in TaqMan RT-PCR assays (WNA and WNB primer-probe sets) and confirmed by sequencing the partial capsid/envelope region (WNAE primer set) [Tab le 3-7]. In addition, recent isolates of WNV from sentinel chickens (n=4) also were detected by real-time and gel-based RTPCR assays. Interestingly, the WNA and WN B primer-probe sets detected the novel flavivirus strain FLS694, but did not detect FLS 649. In contrast, the SLEA and SLEB primer-probe sets detected both novel flavivirus strains (Table 4-7). Conversely, the SLEV real-time primer-probe sets (Lanciotti and Kerst, 2001) did not perform as expected for South American reference strains and one Florida isolate (FL72) of St. Louis encephalitis virus [Table 5-5]. The SLEA primer-probe set (SLE834/SLE905c/SLE857p) targeted the membrane region of the virus and detected all of the reference strains (n=14) analyzed in th is study. In addition, recent isolates of SLEV

PAGE 368

343 from sentinel chickens (n=2) were detected by the SLEA primer-probe set. However, confirmation of South American reference strain s failed to detect several strains with the SLEB primer-probe set (SLE2420/SLE2487c/S LE2444p) [Table 5-5], especially SLEV isolates from Trinidad. Each of the Florid a strains of SLEV conf irmed with the SLEB set, with the exception of FL72 (strain collected in the panha ndle region of the state in 1972). Lanciotti and Kerst (2001) only reporte d the detection of three South American strains of SLEV [Guatemala (1969), Panama (1973), a nd Ecuador (1976)] with these TaqMan assays. Trinidad and Brazilian strain s were not assayed or experimental results were not published, if they were evaluated in this study (Lanciotti and Kerst, 2001). Mutations in the St. Louis Encep halitis Virus Envelope Region Four additional reference strains from S outh America were tested (three isolates from Trinidad [TRVL strains] and one strain from Brazil) with TaqMan primer sets [Table 5-5] to evaluate strain-specific diffe rences in the envelope region of SLEV. The four supplemental reference strains also screened positive with the SLEA set (CT values 40), with two strains undetec ted by the SLEB set. However, these strains were not studied further or included in phylogenetic analysis of the envelope region due to incomplete strain histories (unknow n source, passage, or date). TaqMan primers and probes are designed to specific conserved regions of the virus. In fact, the oligonucleotide probe has been shown to be especially intolerant of nucleotide substitutions at its binding site for the envelope region of West Nile virus. A single nucleotide change in the probe re gion can prevent ann ealing of the probe and detection by the instrument. Viral variants with multiple substitutions may escape

PAGE 369

344 Table 5-5 Real-Time RT-PCR (TaqMan) Results for SLEV Reference Strains Real-time RT-PCR assays were run in replicate for the detection of virus strains. Two primer-probe sets designed to specifically target SLEV (designated SLEA & SLEB) were use d. Samples were screened with the A primer sets and confirmed with B primer sets. CT values were averaged and values 40 were positive. One Florida strain and several South American (Trinidad & Brazil) st rains of SLEV we re negative with the SLEB primer set (shaded boxes). Reference SLEV Strains SLEA (CT) SLEB (CT) FL52 21.60 24.48 TBH-28 28.20 22.03 FL72 23.74 43.00 FL85a 22.43 16.52 FL85b 24.28 15.12 FL89 18.50 17.22 FL90a 25.07 20.83 FL90b 21.72 18.89 FL90c 21.86 19.74 FL90d 21.93 18.80 TR58 19.14 Undet TR62 19.15 Undet BR64 21.86 33.86 BR69 22.26 Undet BeAn 208331 17.94 Undet TRVL 33228-1 36.53 36.07 TRVL 21882 18.88 37.42 TRVL 35928 20.45 Undet

PAGE 370

345 detection by TaqMan, as shown by a 47% fa lse-negative rate fo r WNV mutants with altered probe-binding sites (Papin, Vahrson and Dittmer, 2004). Synthesized mutations to th e viral envelope region and subsequent detection of St. Louis encephalitis virus strains with Ta qMan primer-probe sets has not been investigated,nor has a SYBER green-based assay been developed, as shown for WNV (Papin, Vahrson and Dittmer, 2004). However, SLEV strain-specific differences have been demonstrated in this study for TaqMan detection of North American versus South American strains (3 end of the envelope region). The complete envelope region of fourteen reference strains was sequenced a nd aligned (Appendix N). This region was also trimmed to the 68 base pairs amplified by th e SLEB real-time TaqMan primer-probe set (Figure 5-1) and analyzed. Several conserve d nucleotide substitutions were noted for South American strains (compared to a single mutation in Florida epidemic strains) in this envelope region. However, conservati on of cytosine (C) at position 2458 likely allowed for detection of FLS569 and FLS650 by th e SLEB primer set. It is not clear why BR64 was detected by the SLEB primer-probe set, when this strain was identical to other strains (except TR58) over the probe anneali ng region. In this situation, mutations at binding sites of the forward and reverse pr imers for TR58, TR62, and BR69 appear to be responsible for non-detection of th ese strains. This po ssibility (altered bi nding sites in the sense and anti-sense primers) was mentione d but not deemed relevant or further investigated for WNV strains (P apin, Vahrson and Dittmer, 2004). These findings are significant in the public heal th setting, where public health diagnostic laboratories frequently screen suspected clinical and surv eillance samples for arboviruses with the primer sets developed by the CDC (Lanciotti and Kerst, 2001). The

PAGE 371

346 Figure 5-1 Multiple Sequence Alignment of the 3 Envelope Region Targeted by Real-Time RT-PCR (TaqMa n) Primer-Probe Set The sense primer binds at position 24 20 (first base in this figure). The probe anneals to the region encomp assing nucleotide positions 2444-2466 (boxed sections). The anti-sense prim er binds over the region from 24872468. Multiple sequence alignment of North American (Florida) and South American strains of SLEV indi cated several nucleotide substitutions (transition mutations) in Florida S outh American strains and isolates from South American countries (Tri nidad and Brazil). South American strains have 3 nucleotide substituti ons in the probe annealing region. #FL52 CTG GCT ATC GGA GGG ATT CTC ATC TTT CTG GCA [2452] #TBH-28 ... ... G.. ... ... ... ... ..T ... ... ... [2452] #FL72 ... ... G.T ... ... ... ..A ... ... ..A ..G [2452] #FL85a ... ... G.. ... ... ... ... ... ... ... ... [2452] #FL85b ... ... G.. ... ... ... ... ... ... ... ... [2452] #FL89 ... ... G.. ... ..A ... ... ... ... ... ... [2452] #FL90a ... ... G.. ... ..A ... ... ... ... ... ... [2452] #FL90b ... ... G.. ... ..A ... ... ... ... ... ... [2452] #FL90c ... ... G.. ... ..A ... ... ... ... ... ... [2452] #FL90d ... ... G.. ... ..A ... ... ... ... ... ... [2452] #FLS569 ... ... G.T ... ... ... ..G ... ... ..A ..G [2452] #FLS650 ... ... G.T ... ... ... ..G ... ... ..A ..G [2452] #TR58 ... ... G.T ... ... ... ..A ... ..C ..A ..G [2452] #TR62 ... ... G.T ... ... ... ..A ... ... ..A ..G [2452] #BR64 ... ... G.T ... ... ... ..A ... ... ..A ..G [2452] #BR69 ... ..C G.T ... ... ... T.A ... ... ..A ..G [2452] #Kern217 ... ... G.T ... ... ... ..T ... ... ... ... [2452] #WNNY99 ..C ..A G.T ... ..A G.. ..G C.. ..C ..C T.C [2452] #WNEgypt ..C ..A G.T ... ... G.. T.G C.. ... ..C T.C [2452] #FL52 ACC AGC GTG CAA GCC GAT TCG GGA TGT GCA ATT GAC [2488] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... [2488] #FL72 ... ... ... ... ..T ... ... ... ... ... ... ... [2488] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... [2488] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... [2488] #FL89 ... ... ..A ... ... ..C ... ... ... ... ... ... [2488] #FL90a ... ... ..A ... ... ..C ... ... ... ... ... ... [2488] #FL90b ... ... ..A ... ... ..C ... ... ... ... ... ... [2488] #FL90c ... ... ..A ... ... ..C ... ... ... ... ... ... [2488] #FL90d ... ... ..A ... ... ..C ... ... ... ... ... ... [2488] #FLS569 ... ... ... ... ..T ... ... ... ... ... ... ... [2488] #FLS650 ... ... ... ... ..T ... ... ... ... ... ... ... [2488] #TR58 ... ..T ... ... ..T ... ... ... ... ... ... ... [2488] #TR62 ... ..T ... ... ..T ..C ... ... ... ... ... ... [2488] #BR64 ... ..T ... ... ..T ... ... ... ... ... ... ... [2488] #BR69 ... ..T ... ... ..T ... ... ... ... ... ... ... [2488] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... [2488] #WNNY99 GTG .A. ... ..C ..T ..C A.T ..G ... ..C ..A ... [2488] #WNEgypt GTG .A. ... ..C ..T ..C A.T ... ... ..C ..A ... [2488]

PAGE 372

347 current diagnostic testing algorithm used by the BOL-Ta mpa would report a negative result for a sample detected only with a si ngle TaqMan primer-probe set (e.g. SLEA). Confirmation of a screening result with a second TaqMan primer-probe set (SLEB) is required to report a positive result by molecular RT-PCR assays, per CDC guidelines [CDC, 2003A]. A false-negative could result in misdiagnosis of a patient and/or impair mosquito control agencies that utili ze surveillance results to implement control measures. As a result of this study, modifications have been made to the BOL-Tampa algorithm to include confirmation of SLEA positive screening assays with gel-based RT-PCR (if also negative by SLEB primer set) prior to repor ting of a result. Thus far, false-negative samples have not been identified (or reported) due to the low prevalence of SLEV over the last decade. The two South American strain s of SLEV isolated from sentinel chickens (FLS569 and FLS650) represent the first detection of Nort h American SLEV since the 1997 outbreak in Florida. Future studies are planned to develop new TaqMan primerprobe sets that detect a complete battery of known South American strains of St. Louis encephalitis virus, which would provide more rapid results than confirmation by traditional RT-PCR methods (see End-Point RT-PCR below). In Florida, this study has shown the introduction and re-introduction of South American strains of SLEV in the last 35 years. A previous phylogenetic analysis of the envelope region (Kramer and Chandler, 2001) had shown clustering of South American strains (Brazil, Mexico, and Panama) into Lineage IIA and IID, predominately North American clades (refer to Table 2-2). Southeas tern states appear to be most affected by these findings, especially Florida and Texas, where phylogenetic analysis places South

PAGE 373

348 American strains into clusters of isolates fr om these two states. In fact, Florida strains isolated in 1962 (TBH-28 and P-15) cluster w ith strains isolated in Mexico and Panama [Kramer and Chandler, 2001]. Consequently, diagnostic laboratories and public health agencies should be aware of potential falsenegative results in r eal-time (TaqMan) RTPCR assays (Lanciotti and Kerst, 2001) for S outh American strains of SLEV circulating in the United States. Traditional RT-PCR me thods are recommended for addition to the real-time (TaqMan) testing algorithm to confirm SLEA (screening primers) positive results, providing a second TaqMan primer set does not detect the virus. End-Point RT-PCR Several end-point RT-PCR primer sets designed for flaviviruses as well as specifically for WNV and SLEV were used for confirmation of real-time (TaqMan) results (Tables 3-7, 3-8 and 3-9). The tr aditional gel-based RT-PCR method was not used to screen blood or cloacal swabs for detection of arboviruses, due to the lower reported sensitivity of the assay (1 PFU) compared to a real-time RT-PCR (TaqMan) assay (<1 PFU) for West Nile virus [Lanciotti et al 2000]. Sensitivities were identical for gel-based and real-time RT-PCR assays fo r St. Louis encephalitis virus (1 PFU) (Lanciotti and Kerst, 2001). Consequently, th ese more laborious, slower assays were performed for confirmation and sequencing reactions on positive real-time RT-PCR samples, including RNA extracted from cloacal swabs and cell culture supernatants. With the exception of WN and EEE viral RNA detected on cloacal swabs (virus not culturable) in 2005, TaqMan positive results (n=9) were confirmed with end-point RT-PCR primer sets. Reference strains were also tested (SLEV, n=14; WNV, n=8). These strains either confirmed with the S LEC (membrane/envelope region) or WNAE

PAGE 374

349 (capsid/prM region) primer se ts depending on the strain of virus. The SLEC primer set amplified a subset of South American (and North American) strain s studied (Figures 410, 4-28). West Nile virus did not cross-react with this primer set. Instead, West Nile virus strains were successfully amplified with the WNAE primer set (Figure 4-29), which did not cross-react with SLEV. Novel flavivirus strains confirmed in both assays (Figures 4-33 and 4-36). Based on this study, both gelbased primer sets would serve to confirm suspected SLEV or WNV positive samples by real-time RT-PCR assays, as previously reported (Lanciotti et al 2000; Lanciotti and Kerst, 2001). In addition, several larger fragments of the viral genome were amplified for sequencing and phylogenetic analys is of reference and recent circulating strains of SLEV and WNV. The complete envelope region of St. Louis encephalitis virus strains was amplified (1700bp PCR product) [Figure 4-27] and sequenced. The F880/B2586 primer set detected both North American and South American strains of SLEV (Kramer and Chandler, 2001), with successful amplificatio n of all South American strains studied. West Nile virus did not cross-react with this primer set. The novel flavivirus strains also were not detected by this primer set (Figur e 4-34) despite detection with both SLEV TaqMan primer sets. However, the complete envelope reverse primer (B2586) anneals to the genome approximately 100 bases downstream of the TaqMan SLEB primer set (3 envelope region). In contrast, the SLEA primer set targets the membrane region approximately ~70 bases upstream of the forwar d envelope primer (F880). This results in no overlapping regions with these primer sets (Figure 3-14). The RNA-dependent RNA polymerase (RdRp) domain is located at the carboxy (3) terminus of the NS5 region, encoded fr om nucleotide positions 8997 to 9233 (based

PAGE 375

350 on the yellow fever genome). The RdRp re gion in the NS5 gene is also the most conserved coding sequence in the flavivirus genome and important to transcription and replication of the virus [Chao, Davis, a nd Chang, 2006]. A portion of this NS5 region was amplified (larger 1000bp PCR product) [F igure 4-30] and sequenced. The Fu1/cfd3 primer set (Kuno et al 1998) detected both WNV and SLEV strains and amplified a portion of the RdRp domain [starting at positions 9070 (SLEV) and 9080 (WNV)]. Interestingly, South American SLEV stra ins included in this study produced three amplicons (1000bp, 750bp, and ~300bp) with this primer set, as shown for FLS569 (Figure 4-30). North American SLEV and WNV strains produced a single 1000bp PCR product. However, the novel flavivirus strains were not detected by this primer set (Figure 4-35). A second primer set (WNBE) was used to amplify an internal portion of the NS5 region described above. However, this prim er set was provided to the BOL-Tampa by the CDC following the introduc tion of WNV to the United States and was not fully validated nor published (personal communi cation, R. Lanciotti). Unlike the WNAE primer set, RT-PCR assays with these prim ers were non-specific and detected both WNV and SLEV (Figure 4-31). In addition, most sequencing re actions with these primers failed, as performed at two different facili ties (BOL-Tampa and H. Lee Moffitt Cancer Center). Nevertheless, three recent strains isolated from sentinel chickens were successfully amplified and sequenced (FLS 504, FLS649 and FLS694). Notably, this 300 bp region was detected and sequenced for the novel flavivirus strains despite nonamplification of the larger NS5 product (1000bp). Nonetheless, this primer set is not recommended for confirmation or sequenc ing of West Nile virus isolates.

PAGE 376

351 Finally, a second universal flavivirus primer set (YF1/YF2) was used for amplification of 600-700 bases of the 3 non-coding region (Tanaka, 1993). This primer set detected both SLEV (600bp amplicon) a nd WNV (700bp amplicon) [Figures 4-32 and 4-35]. Novel flavivirus strains were not amplified by th is primer set (Figures 4-35). A subset of SLEV strains were assayed a nd sequenced in this region. Few nucleotide mutations were noted (Tables 4-10, 4-11). BLASTN results (Appendix I) were indistinguishable between strains, due to the limited number of St. Louis encephalitis virus sequences available in GenBank for th is region. Consequently, the use of this primer set was discontinued at the BOL-Tamp a and is not recommended for analysis of SLEV (at this time). In conclusion, several primer sets were evaluated for detection and sequencing of SLEV and WNV strains collected in Florid a, or SLEV strains acquired from South America (Table 4-10). These primer sets produced the expected amplicon sizes, as previously published, and di stinguished between West Nile virus and St. Louis encephalitis virus after sequencing. One univers al primer set for the detection of WNV, SLEV and the novel flavivirus strains was not identified (the WNBE primers produced poor sequence data for most strains). Howeve r, the primer set targeting the NS5 region (Fu1/cfd3) was able to rapidl y distinguish between North American and South American strains of SLEV without sequencing. A charact eristic banding pattern for South American strains (3 amplicon sizes) was visualized by gel electrophoresis, and confirmed with sequencing. The WNAE and SLEC primers ar e recommended for the detection of WNV and SLEV, respectively, as we ll as identific ation of novel flavivirus strains with paired analysis of these primer sets.

PAGE 377

352 Sample Collection Methods In 2005, whole blood samples were added to lysis buffer (for molecular detection assays) and biological field diluent (for cell culture assays) during the weekly scheduled sampling of chickens at targeted sites. Concurrently, cloacal swabs were collected from these birds. Periodically, cloacal swabs were collected twice in one week from targeted birds at each agencys discretion; however, blood was not collected again. Arboviral RNA was detected on a total of seven cloacal swabs from two counties (3 WNV+ and 4 EEEV+). However, real-time (TaqMan) RT-PCR assays performed on six corresponding blood samples were negati ve (note: FLM42-2 was a second swab, without a matching blood sample). Virus isola tion in cell culture was attempted for each sample. BFD samples were filtered prior to inoculation into Vero cells and monitored for cytopathic effect for two weeks. All cell cultures were negative. Consequently, these results indicate that viremia was absent or below the threshold of detection by TaqMan RT-PCR on these collection date s, despite shedding of the virus in the feces. A further evaluation of blood samples collected from sentinel chickens was performed, where 194 specimens were screened by molecular detection and cell culture assays (200 total). A subset of these blood sa mples (n=20) were collected from 13 birds prior to and on the date of seroconversi on in Manatee County. The remaining samples were tested from both Orange and Manatee c ounties from birds that did not seroconvert, as detected by the HAI assay. No virus was de tected or isolated. These results further support the conclusion that viremia in naturally exposed chickens is ve ry transient and/or at levels that are too low for detection, as performed in this experimental design. Consequently, the detection of arboviruses from blood samples was not practicable and

PAGE 378

353 was discontinued during targeted sample collection by Sarasota County in 2005. Whole blood samples were not collected in 2006. These results were not surprising base d on previous laboratory studies that identified transient, low titered viremias in chickens for SLEV or WNV (Reisen et al 1994; Senne et al 2000; Langevin et al 2001; Patiris et al 2008). Experimentally infected chickens (needle inoculated) were viremic betw een two to three days postinoculation. These studies also indicated that neutralizing antibody titers developed within two weeks of infection (Senne et al 2000; Langevin et al 2001). One study on SLEV identified that young chickens (19 week s) developed a low titer, transient viremia for 1 day post-inoculation, which was not obs erved for older birds (38 weeks). These birds developed IgG antibodies to SLEV after 14 days post-inoculation (Reisen et al 1994). A recent study found that WNV and SLEV viremia in chickens subsided after 5 days and the viremic response had significantly lower titers for SLEV (Patiris et al 2008). These studies were performed in cont rolled environments, where sample collection allowed for the immediate preser vation of viremic blood (placed on ice or frozen) for later detection and quantification of the virus. In contra st, blood and cloacal swab collection from chickens was perfor med in the field during the warm summer months in Florida. Blood samples and cloacal swabs were placed in coolers with gel ice packs following collection. Consequently, it is possible that a low-level viremia was present for birds that later se roconverted but that environmental conditions and transport to the laboratory may have allowed for speci men degradation. Nevertheless, these birds did not appear to contribute to the local arbovirus transmission cycle and support earlier

PAGE 379

354 studies indicating that viremia was well below the threshold required to infect mosquitoes (Langevin et al, 2001; Reisen, Fang and Martinez, 2005; Patiris et al 2008). Several studies of West Nile virus and St. Louis encepha litis virus in wild birds (experimental infections) identified transient, high titered viremias capable of infecting mosquitoes (Komar et al 2003; Reisen et al 2003; Fang and Reisen, 2006). Fang and Reisen (2006) found that house finches infect ed with SLEV devel oped a lower titered viremia than birds infected with WNV. Immune responses following inoculation of WNV and SLEV for wild bird species were also assessed, where two studies identified birds that failed to produce detectable an tibody. For WNV, two birds out of 67 did not produce antibodies after 14 days post-inoculation, where detect able viremia was preset at 24 hours post-inoculation and a pe rsistent infection in the heart tissu e was found for one bird. The second bird did not deve lop detectable viremia (Komar et al 2003). SLEVinoculated wild birds were sampled for si x weeks and 58 birds (out of 163) failed to develop detectable antibodies (Reisen et al 2003). These experimental results in wild birds may in part explain the finding of six sen tinel chickens that fa iled to seroconvert in the HAI assay following detection of the viral RNA on cloacal swabs (3 WNV+, 2 Flavi+, and 1 EEEV+), either by escape of sy stemic infection or a low-level viremia resulted in the development of detectable titers of neut ralizing antibodies. West Nile virus has been extensively isolated from over one hundred bird species in North America, following invasion of th e virus and subsequent widespread bird mortality (CDC, 2007b, g). In contrast, St. Loui s encephalitis has rarely been isolated from birds (Reisen, 2003). Following the in troduction of WNV to the United States, cloacal swabs were a sensitive, low-resource method for virus detection and isolation

PAGE 380

355 from dead wild birds without necropsy (Komar et al 2002; Brennan, 2003). In addition, experimental studies detected West Nile vi rus shed in the feces from live, laboratoryinfected chickens on cloacal swabs (Senne et al 2000; Langevin et al 2001). In young chickens (seven weeks old), shedding was onl y detected on cloacal swabs four and five days post-inoculation (DPI) [Senne et al 2000]. Another study using older chickens (1760 weeks) found that WNV shed in the feces from two to six DPI. However, peak detection of the virus occurred between days three through five post-inoculation. Interestingly, virus was not detected (shed) in the majority of mosquito-inoculated younger birds aged 17 weeks (9 of 11). However, West Nile virus was detected in the feces of all mosquito-inoculated chickens aged 60 weeks (n=5), as well as needleinoculated birds aged 20 weeks (n=5) [Langevin et al 2001]. In this case, the age of the birds positively influenced the outcome of this study, such that virus was detected in the feces (but not blood) of sentinel chickens over 40 weeks of age. Table 5-6 provides a comparison of the detection of arboviruses from whole blood samples compared to cloacal swabs during the study period. Langevin et al (2001) reported very low titers of West Nile virus detected on cloacal swabs (1-200 PFU/0.5ml). In Florida, these findings were supported in naturally infected sentinel chickens (Table 4-18), where three chickens shed an average 34 PFU/0.1ml (range 32-36 PFU/0.1ml ) of WNV or SLEV, as de tected by cloacal swabs. Two other birds shed very low levels of virus in the feces, such that 3 PFU/0.1ml of WNV was detected on one cloacal swab (F LM38), whereas another bird shed SLEV (FLS650) below the level of detection (< 2 PFU/ 0.1ml) in the plaque assay. In contrast to

PAGE 381

356 experimental studies, a single chicken shed a higher titer (816 PFU/ 0.1ml) of West Nile virus (FLS502) in the feces, as detected by plaque assay on cloacal swab eluate. Additional experimental studies measured the titer of West Nile virus directly shed in the feces (measured by gram) of wild birds, which indicated that titers were actually two to three fold higher than reported for cloacal swabs (Komar et al 2003; Kipp et al 2006). However, the WNV titers detected in sentinel chickens during this study were well below the approximate range of 103 through 109 PFU/g detected in wild bird species and likely do not repres ent as high of a risk to ha ndlers of sentinel chickens compared to those that work with sick or dead wild birds (Komar et al 2003; Kipp et al 2006). Characterization of Primary Immune Response in Sentinel Chickens The current study provided a unique oppor tunity to charact erize arbovirus infections and development of the primary i mmune response in adult chickens following natural exposure. Transmission of the virus by mosquito bite is an ideal model that experimental studies may use to mimic a n atural arbovirus infection of a vertebrate host in the laboratory, which also have had quantification and deba te over the titer of virus delivered by mosquito bite (Reisen et al 2000a). This method has previously been described in adult chickens fo r West Nile virus (Langevin et al 2001). The timing and titer of viremia are important measures that in fluence the ability of th e vertebrate host to infect mosquito populations and contribut e to the amplifica tion cycle (Reisen et al 2000a; Langevin et al 2001; Reisen et al 2002; Reisen, 2003; CDC, 2003A, 2004b, 2005c, 2007b). In addition, the development of virus-specific antibodies, both IgM and

PAGE 382

357 Table 5-6 Comparison of Sample Coll ection Methods for the Detection of Arboviruses In 2005, two sample types were collected from sentinel chickens, whole blood and cloacal swabs. Cloacal swabs were a more successful sample type for the detection of arbovi ruses than whole blood samples. Consequently, the collection of whole blood samples from sentinel chickens for virus detection/isolation assays was discontinued in 2006. Comparison of Cloacal Swab and Whole Blood Sample Types Collected for Arbovirus Detection/Isolation Year Total Number Cloacal Swabs Total Number Processed Cloacal Swabs Number Positive Cloacal Swabs Total Number of Blood Samples Total Number Processed Blood Samples Number Positive Blood Samples 2005 623 259 7 445 200 0 2006 1338 529 8 NA NA NA

PAGE 383

358 IgG, are important to assess vertebrate recove ry from infection and susceptibility to reinfection (Calisher et al 1986b & c). From a public health perspective, seve ral arbovirus surveill ance programs in the United States utilize sentinel chicken sero conversions for detec tion of transmission activity and as an early warn ing system for potential epid emics/epizootics of disease (Komar, 2001; Blackmore et al 2003; Reisen et al 2004b; Butler and Stark, 2005; Patiris et al 2008). For the first time in Florida, this study used the sentinel chicken program to collect samples that were tested for detection/is olation of the virus, as well as for sentinel seroconversions. Arboviruses were detected/i solated from six naturally infected birds that also seroconverted to antibody positive fo r the infecting agent. The development of the primary immune response differed by ar bovirus strain and lo cation (county) of collection. Vendor (local chicken farms), type and approximate age of chickens at the time of transmission activity differed for each county where virus was detected (Table 57). In Orange County, Eastern equine en cephalitis viral RNA was detected by TaqMan RT-PCR on two cloacal swabs collected from Bird 846 in August 2005. However, a serum sample collected from this chicken at the same time was negative for the presence of alphavirus total antibody, as measured by the HAI assay (Figure 4-10). Although the exact date of infec tion is unknown for this chicken, it is likely that it either coincided or occurred within one to two days of viral RNA detecti on on the cloacal swab. This finding is supported by the detection of alphavirus total antibody (s eroconversion) six to eight days later in the HAI assa y, which corresponds to the seven days postinoculation previously reporte d by experimental studies of chickens (Ogata and Byrne,

PAGE 384

359 Table 5-7 Characteristics of Adult Sentinel Chickens Placed at Enzootic Transmission Sites By County Chickens were purchased from different vendors for the 2005 and 2006 seasons. Manatee, Orange and Sarasota counties purchased female, white leghorns for use at enzootic arbovirus transmission sites. Age of sentinel chickens are shown as an estimate of age (i n weeks) at the time of virus dete ction/isolation in each county. Characteristics of Adult Sentinel Chickens Placed at Enzootic Arbovirus Transmission Sites County Year Type Age (weeks) Vendor Manatee 2005 White leghorn 40 156 Port Manatee Inmate Farm (bred in Alabama) 2005 White leghorn 40 Hillandale LLC Farms (FL) Orange 2006 White leghorn 36 Hillandale LLC Farms (FL) 2005 White leghorn 52 Hillandale LLC Farms (FL) Sarasota 2006 White leghorn 52 Tampa Farms (FL)

PAGE 385

360 1961; Calisher et al 1986b). However, experimental inoc ulation of chickens with EEEV detected virus-specific IgM antibodies four days post-inoculation (Calisher et al 1986b; Olson et al 1991). This experiment al finding was not replicated by this naturally infected chicken. An IgM antibody capture ELISA did not detect EEEV-specific antibodies in the first HAI positive serum. It was assumed that IgM antibodies had already declined since cro ss-reactive neutralizing antibody was detected in the PRNT, such that further sera samples were not assayed in the MAC-ELISA (Figure 4-10). Consequently, it is unknown if the IgM response remained negative (P/N value < 2.0) or increased over the next 14 days that the bird was sampled. As a result, infection may have occurred earlier than first detected by cloacal swabs, with a corresponding elevated IgM re sponse that was not detected by the HAI assay. Or this chicken may have had a poor im mune response to the virus resulting in an initial low titered, cross-reac tive total antibody produced, follow ed by a rise in IgM more than six days post-infection. A previous infection with HJV may also have led to a low level cross-reactive antibody, with a depresse d IgM and early strong IgG response. Future targeted studies for the detection of EEEV in sentinel chickens woul d be beneficial to resolve these questions and to describe the natural course of infection and development of the primary immune response in several bird s. Overall, the HAI assay detected total antibody for this bird soon after infection, which allowed for rapid detection of arbovirus transmission activity base d on this seroconversion. In contrast to the EEEV seroconversi on, the development of antibodies in a sentinel chicken following natural West Nile virus infection in Ma natee County was quite different (Figure 4-14). For Bird 1773, isolatio n of infectious WNV from a cloacal swab

PAGE 386

361 occurred on the first day of ta rgeted sampling. A serum sample collected at the same time point was negative in the HAI assay for flavivirus total antibodies. However, this serum sample was assayed in the MAC-ELISA and WNV-specific IgM antibodies were detected (P/N = 6.3). The agency was notified that the bird had seroconverted to WNV, so that it could be removed from the field. However, the BOL-Tampa requested for the agency to continue sampling the bird until de tectable total antibody developed in the HAI assay. Unlike the EEEV seroconversion, the next serum sample and cloacal swab collected seven days later were also negative. This serum sample was also tested in the MAC-ELISA, which detected that the peak IgM response occurred at day seven postisolation (P/N = 21.9). Bird 1773 first devel oped detectable HAI total antibodies 28 days post-isolation of West Nile virus. This unusual antibody prof ile has not been reported previously for chickens, where total antibody titer failed to develop despite elevated virus-specific IgM antibodies for 28 day period. It should be noted that this chicken is likely an exception to the rule and may not represent the primary immune response followi ng natural WNV infection. In fact, most chickens develop an IgM response that ri ses and decays within one to two weeks (Calisher et al 1986c; Martin et al 2000). In contrast, this chicken had elevated IgM antibody until 28 days post-isolation of the virus and likely for longer, as the P/N value (5.2) was still elevated on the last time point collected. The chicken was 64 weeks old when virus was first detected and this ma y have influenced its subsequent immune response. The success of the sentinel chicke n program for early warning of transmission activity in Florida through th e detection of seroconversions in the HAI assay has been established (Blackmore et al 2003; Butler and Stark, 2005). Sentinel seroconversions to

PAGE 387

362 West Nile virus infections were likely detected much earlier than shown in Manatee County, and have played a role in limiting the number of human cases in Florida. However, a month delay until initial identificat ion of transmission activity in a sentinel chicken flock is not an effectiv e surveillance tool. If this we re the norm, public health in the region could be jeopardized, as this may allow virus amplification to occur without early warning and hamper immediate vector control efforts. Interestingly, the slow antibody response in these chickens may have allowed for the extensive transmission of arboviruses to sentinel chicken flocks th roughout Manatee County in 2005 (Figure 3-3), where 11 out of 13 sites expe rienced activity. Despite these active sentinel sites, no human cases of arboviral disease were reported in the county. Nonetheless, it is recommended that sentinel chickens be repl aced each year so that advanced age does not impact detection of seroconversions in the following transmission season. In 2006, St. Louis encephalitis virus was isol ated from two sentinel chickens in Sarasota County. The primary immune res ponse will be described for each chicken separately. West Nile virus and St. Louis en cephalitis virus was isolated from Bird 8-003R in October. WNV was isolated from the firs t cloacal swab collected from this chicken. On the same collection date, the matching se rum sample was strongly positive in the HAI assay, with total antibody titer 40 (Figure 4-23). This serum sample confirmed positive for St. Louis encephalitis virus in the MACELISA, an experimental MIA test, and the PRNT (titer 40), with negative values in all assays for West Nile virus. In this situation, it appears that high neutralizi ng antibody titers to SLEV (a s detected by the PRNT) did not prevent a dual infection of this bird with WNV.

PAGE 388

363 The second cloacal swab and serum sample collected seven days later were tested and with identical results; WNV was isolated from the swab and the serum was confirmed SLEV positive in the MAC-ELISA, MI A, and PRNT assays. Then, two days later a third swab was collected from this bird (no matching serum sample). Infectious SLEV was isolated. Based on the serology prof ile from sera collected over 14 days, it appears that SLEV was not isolated from thes e birds when IgM antibodies were highest. Instead, the virus was isolated two days af ter WN virus titers also declined, which corresponded to a decline in S LEV-specific IgM. Neutralizing antibody titers in the sera were measured by the PRNT and remained elevated over the entire time course, so they did not appear to modulate shedding of SLEV or WNV from the cloaca. No conclusive evidence has proven that mixed SLEV and WNV populations were present in these swabs. However, challenge of these virus strains (Vero passage 1) with homologous polyclonal antibod ies (WN antibodies to FLS502, FLS545; SLE antibodies to FLS569) revealed several clones that were cross-reactive to both viruses by TaqMan RT-PCR assays (Table 4-4). The significan ce of these results is unknown. Unfortunately, none of the original swab diluent was left for challenge with these polyclonal antibodies, which may have identified a mixed population prior to first passage in Vero cell culture. A recent study by Fang and Reisen (2006) may partly explain the isolation of WNV from a chicken previously infected wi th SLEV (based on its confirmed serology profile) in Sarasota County. Experimental i noculation of house finches with either SLEV or WNV was performed, followed by challe nge six weeks later with either the homologous (same) or heterologous (different) virus. Initial infection with West Nile virus resulted in sterilizing immunity in house finches against both viruses upon

PAGE 389

364 challenge. In contrast, previous infecti on with SLEV only provided protection against subsequent challenge with a homologous viru s (SLEV). When these SLEV birds were challenged with the heterologous virus in stead, WNV was still able to infect and significant viremias developed (range from 102.7-6.4 pfu/ml) [Fang and Reisen, 2006]. A second study performed a similar experime nt in adult chickens, with similar results (Patiris et al 2008). This study also included co-infection of chickens with WNV and SLEV, but found that PRNT titers to WNV were significantly greater than those detected for SLEV (Patiris et al 2008). If these results are comparable to this natural dual infection, it may be inferre d that SLEV and WNV did not concurrently infect Bird 8003-R based on the high PRNT titers to SLEV in the serology profile. However, the experimentally infected chickens were give n a higher dose of West Nile virus than St. Louis encephalitis virus and developed a si gnificantly higher viremia titer, which may have biased the PRNT association. It is also unknown the WNV and SLEV titers naturally inoculated by mosquito into Bird 8-003-R, so the experime ntal conclusions may be valid (although a natural dual infection in one chicken did not produce detectable IgM or PRNT antibodies to WNV th rough 14 days post-isolation). However, heterologous challenge with WNV significantly boosted antibody levels in house finches and chickens against SLEV (concept of original antigenic sin) [Fang and Reisen, 2006; Patiris et al 2008]. This experimental finding was not supported by MAC-ELISA serology results for Bird 8003-R following isolation of WNV, where a decline in SLEV-specific IgM antibodies was noted over a 14-day period. Perhaps secondary infection with WNV quickly boos ted HAI and PRNT ne utralizing antibodies (titer 40 for all time points) to SLEV in this bird, instead. As a result, the second

PAGE 390

365 infection with WNV supports th e concept of original antigenic sin to SLEV in this naturally infected bird, where the high titers of IgG were non-neutralizing to WNV. This hypothesis for subsequent natural WNV in fection boosting SLEV antibody titers is supported by serology results for the first thr ee sentinel chickens th at seroconverted to SLEV in Sarasota County during the previous 6 weeks. In contrast to the strong SLEV antibody titers noted for the firs t positive serum on Bird 8-003-R, the earlier confirmed seroconversions were weakly positive in the HAI assay (reactive, reactive and 1:10, respectively) [Table 4-3]. Since cloacal swabs were processed retr ospectively, no additional sera samples were drawn on this bird to investigate if WNV-specific IgM antibodies developed at a later time point. The BOL-Tampa requested th at the agency re-sample this bird following detection of virus on the swabs; however, the chicken had been relocated to another state, and was lost to follow-up [personal comm unication, N. Osborn (SCMCD)]. In summary, virus isolation and serology results for Bird 8-003-R indicate that this bird had a dual infection of West Nile virus and St. Louis encephalitis virus. The sentinel chicken was likely naturally infected with SLEV prior to a second infection with West Nile virus (within a six day time frame). Based on previous experimental studies, it is probable that this bird was not co-infected at the exact same time, although co -infection by both virus strains may have occurred in vivo over a nine day period. However, recombination was not identified in either the FLS569 (SLEV) or FLS545 (WNV) isolates. Further vertebrate bird studies would elucidate the competence of adult chic kens and wild birds to serve as a mixing vessel for arboviruses, where challenge with heterologous strains occur within a few days instead of weeks (Fang and Reisen, 2006; Patiris et al 2008).

PAGE 391

366 A second strain (FLS650) of St. Louis ence phalitis virus was isolated in Sarasota County. Bird 9-005-B also develope d high titered antibodies (titer 40) in the HAI and PRNT to SLEV on the first positive serum collected. A second serum sample collected seven days later also had an antibody titer 40 in the HAI assay. Both sera were confirmed SLEV in the MAC-ELISA and MIA te sts (Figure 4-25). Unlike Bird 8-003-R, only SLEV was isolated from this chicken. No virus was isolated on the second swab collected. These serology results closely a pproximated experimental findings, where IgM and total antibody (primarily IgG) titers were elevated early in the infection and then quickly decayed (Olson et al 1991; Reisen, 1994; Ma rtin, 2000; Patiris et al 2008). Finally, three novel flavivirus strains were identified on cloacal swabs collected from two chickens (Figure 4-20). Similar to the West Nile virus st rain (FLS504) isolated in Sarasota County, these birds also failed to develop detectable HAI antibody following infection (Figure 5-2). Molecular RT-PCR assa ys of these strains failed to amplify the envelope region of the virus, indicating that this part of the genome may be altered. The envelope protein has been shown to be a major determinant of neutralizing antibody development [Chambers et al 1990] which may partially explain these findings. For Bird 9-000-W, a real-time RT-PCR assay first detected the virus on November 6. The next detection of the virus occurred 21 days later on a cloacal swab collected on November 27. Swabs collected on November 13 and 20 were negative. This finding may indicate that the bird did develop flavivirusspecific IgM antibody that limited shedding of the virus until the IgM decay ed two weeks later. However, sera samples from this chicken were HAI antibody negative, as det ected by SLEV-group antigen, and discarded.

PAGE 392

367 Figure 5-2 Development of the Primary Immune Response Following Natural Flavivirus Infection in a Sentinel Chicken Serum samples were collected from Bird 9-000-W (Site 001) and submitted to the BOL-Tampa for arbovirus screening in the HAI assay. Flavivirus (SLEV) -group antibody (pink dotted line) was not detected in samples submitted from October 30 to November 27. SLE viral RNA (triangles) and WN viral RNA (circl es) were detected on cloacal swabs collected on November 6 & 27 (TaqMan CT values). Serum had been previously discarded and since th e chicken was HAI antibody negative; MAC-ELISA and PRNT assays were not performed. 0 37.77 00 00 0 36.5 36.2 36.01 0 5 10 15 20 25 30 35 40 10/30/0611/06/0611/13/0611/20/0611/27/06 DateTaqMan CT Value (A Primer Sets)0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1Natural Log HAI Antibody Titer (Total Ab) WNV RNA SLEV RNA Flavi Total Ab (IgM + IgG) Development of the Primary Immune Response Following Natural Flavivirus Infection in a Sentinel Chicken

PAGE 393

368 Consequently, a complete evaluation of the development of the primary immune response (MAC-ELISA, PRNT) for Bird 9-000-W was not performed. Future studies on the viral genome are planned to sequence the envelope and NS1 regions (most immunogenic) to see if mutations (or recombination) prevented this bird from producing detectable antibody. In conclusion, these results have provid ed new insights into the development of the primary immune response following natura l arbovirus infection in adult chickens. Further studies are needed to elucidate the natural immune response to EEEV infection, as well as West Nile virus in Florida. Base d on previous laboratory studies of inoculated chickens, a natural dual infect ed (SLEV & WNV) chicken in this study was likely not coinfected at the same time (F ang and Reisen, 2006; Patiris et al 2008). However, it is possible that a secondary WNV infection following SLEV resu lted in a boost of HAI and PRNT antibodies in early serum samples (con cept of original antigenic sin). Chickens infected with novel flavivirus strains also did not develop antibodies detected by the SLEgroup antigen used in the HAI assay to identify flavivirus infection. Consequently, the birds may have developed SLEV or WNVspecific IgM antibodies and seroconverted; however, these HAI-negative sera were not saved due to retrospective processing of cloacal swabs. Based on limited RT-PCR assays of these flavivirus strains, the envelope protein may be altered which may have resulted in modified antibodies that would escape detection in the HAI assay. In summary, these findings have important implications to sentinel chicken programs for the surveillance of arboviruses, es pecially in regions wh ere West Nile virus and St. Louis encephalitis virus co-exist. The development of the primary immune

PAGE 394

369 response following natural arboviral infection in adult chickens occurred as previously described for St. Louis encephalitis virus, when isolated from a sentinel chicken alone or dually-infected with West Nile vi rus (Fang and Reisen, 2006; Patiris et al 2008). In contrast, the isolation of West Nile virus identified concurre nt production of IgM, but an extensive time delay until the development of detectable HAI antibody (IgM + IgG), likely as a result of the chickens advanced age during 2005. Despite the isolation of West Nile virus in 2006, total antibody ( HAI) or WNV-specific IgM antibody was not detected in the chickens located at site s with confirmed transmission of SLEV. These findings have demonstrated that natural arbovirus infe ctions in adult chickens do not entirely compare to laborat ory studies. Further targeted studies are needed to investigate these concerns and improve understanding of the immune response following natural infection. This research will have a direct impact on arbovirus surveillance systems that utilize sentinel sero conversions to detect transmission activity. Consequently, a variety of diagnostic assays are needed for accurate interpretation of cross-reactive flavivirus antibodies in regions where WN V and SLEV co-circulate, for both humans and sentinel animals. Research to improve diagnostic techniques for these pathogenic viruses is currently in progress at the BOL-Tampa (development of an MIA for detection of arbovirus-specific IgM in ch icken sera). Rapid, sensitive and specific antibody-based assays for arboviruses are in high demand, as they are frequently used to detect arbovirus transmission activit y (Day and Stark, 1999 & 2000; Reisen et al 2000b; Komar, 2001; Blackmore et al 2003; Patiris et al 2008). As the technology improves, these diagnostic assays may soon appro ach real-time detection of arbovirus transmission and acute infections.

PAGE 395

370 Aim Four Assessment of Arboviral Strain Differences in Florida Three pathogenic arboviruses have establ ished enzootic transmission foci in Florida, including St. Louis encephalitis virus, Eastern Equine Encephalitis virus, and the recently introduced West Nile virus (Blackmore et al 2003; Stark and Kazanis, 20012007). Consequently, a statew ide surveillance program fo r the detection of these arboviruses operates year-round. The purpose of this project was to investigate and characterize genotypic and phenotyp ic differences in St. Louis encephalitis virus strains prior to and following the introduction of West Nile virus. Several isolations of West Nile virus from sentinel bi rds during the study period result ed in the inclusion of WNV reference strains for genotypic comparison to recent circulating strains of the virus. Despite the detection of EEE viral RNA on cloacal swabs from two chickens, these strains were not further analyzed. The Epidemiology Research Center (ERC) was established following epidemics of St. Louis encephalitis virus in the late 1950s and located in Tampa, Florida. This center conducted extensive vertebrate and vect or studies in the field to determine the primary vector and avian amplifying hosts in Florida during the 1960s through 1970s (Dow et al 1964; Lewis, Jennings and Schneider, 1964; Bond et al 1966; Jennings, Allen and Lewis, 1966; Jennings et al 1967; Jennings et al 1970; Sather et al 1970; Bigler et al 1974 & 1975). The ERC was merged with the Florida Department of Health and evolved into what is now the Bureau of Laboratories, Tampa (BOL-Tampa) Virology facility, which still provides testing for ar bovirus surveillance programs in Florida (and neighboring states).

PAGE 396

371 Currently, the BOL-Tampa holds an extens ive collection of ar boviruses isolated in Florida from these early ERC field studi es, as well as strains resulting from collaborative projects conducted with other institutions over th e last 50 years. The recent introduction of West Nile virus to the state prompted enhanced surveillance for the virus and the collection of more than 2000 isolat es of WNV during the last seven years. Several of these arbovirus strains have been provided to the Centers for Disease Control and other institutions to add to th eir reference collections (Trent et al 1980 & 1981; Monath et al 1980; Kramer and Chandler, 2001; Davis et al 2005; etc.). Consequently, this study investigated SLEV reference strains collected in Florida that were not included in the large phylogenetic analysis of St. Louis encephalitis virus conducted by Kramer and Chandler (2001), with the exception of the 1962 human strain TBH-28. Florida reference strains included in this study were isolated from a variety of sources, including humans, mosquitoes, wild birds, and sentinel chickens. The FL52 strain represents the first isolation of SLEV from a human in Flor ida, a resident of Miami. Several strains of SLEV were colle cted in 1962 during a large outbreak of the virus (Chamberlain et al 1964), although they have previously been studied (TBH-28, Pinellas 15, GHA-3, TBM-229G, TB M-163E, T349-62, etc) [Monath et al 1980] and a few are no longer in the BOL-Tampa referen ce collection. However, TBH-28 is one of the most commonly used reference strains a nd was included in this study as a positive control, and as a representative 1962 strai n. Additional interepidemic strains of SLEV were isolated in 1969 (L695121.05 and 69-M-1143), but were not included in this study due to previous analys is elsewhere (Trent et al 1980 & 1981; Monath et al 1980; Kramer and Chandler, 2001).

PAGE 397

372 An ERC project conducted during the early 1970s investigated strain differences of SLEV with kinetic HAI assays (personal communication, L. Stark). At this time, the ERC acquired several South American strains of St. Louis encephalitis virus for analysis, including TR52, TR58, BR64, and BR69 strains used for this project. However, these early studies were unable to identify significan t strain differences or relatedness between these North and South American SLEV is olates, as detected in the HAI assay. Interestingly, FL72 was collected from an opossum in the panhandle region of Florida and was not identified for nearly two years due to inconclusive results in HAI and complement-fixation assays (unpublished da ta, BOL-Tampa). This strain has been included for genotypic and phenotypic analysis. Vector and wild bird ecol ogy studies were conducted in Indian River County from the early 1980s through the 1990-1991 epidemic of St. Louis encephalitis virus in Florida, with collaborators at the Univers ity of Florida. Mosquito pools and blood collected from wild birds were submitted to the BOL-Tampa for virus isolation and serology testing (wild bird se ra only). SLEV was isolated during an interepidemic year from pools of Culex nigripalpus collected in 1985 (strains FL85a & b). During 1989 through 1990, several epidemic strains of S LEV were isolated during the last large outbreak of the disease in Florida (223 c onfirmed cases, see Figure 2-9). These strains (FL85 a & b, FL89, FL90 a-d) have also been included in the study to investigate potential epidemic strain differences from ot her Florida reference a nd recent isolates of SLEV. In addition, these strains were not in cluded in previous phylogenetic analysis of SLEV (Kramer and Chandler, 2001). Table 49 provides strain, designation, and virus identity of the flaviviruses sequenced and analyzed.

PAGE 398

373 Phylogeny of St. Louis Ence phalitis Virus in Florida An analysis of the genetic evolutionary relationships (phylogeny) between strains of St. Louis encephalitis virus was performe d in this study by comparing virus isolates from Florida and South America. These genom es were not completely sequenced (with the exception of FLS569); instead fragments of the viral genome were analyzed for comparison. As performed in MEGA4.0.1, the ClustalW 1.6 algorithm was used to align sequences. This program performed multiple sequence alignment by initially computing similarity in a pair-wise comparison of taxa (i.e. virus strains in this study), followed by a second computation (multiple alignment) that tested the pair-wise re sults over the entire set of taxa to ensure accuracy [Tamura et al 2007]. Next, three types of phylogenetic tree construction methods were used, neighbor-joining, maximum parsimony, and unweighted paired group means arithmetic (UPGMA) to create phylograms, each tree with 1000 bootstrap replicates. Neighbor-joining analysis is a step-wis e method that prefers a tree topology where the least total branch length (minimum evolution criterion) is chosen during pairwise calculations for the taxa. A constant rate of evolution is not assumed to produce an unrooted tree. However, the addi tion of outgroups to the analysis can be used to root the tree [Saitou and Nei, 1987]. Maximum parsimony analysis also does not assume a constant rate of evolution. This method calculates tree topology based on a requirement for the fewest number of evolutionary transi tions to develop the most parsimonious tree, which can also be rooted with outgro ups (Johnson, 2007). In contrast, the UPGMA method assumes a constant rate of evolution to produce a rooted tree. It is the simplest

PAGE 399

374 method of tree construction, where the taxa are clustered according to similarity in a pairwise calculation (Tamura et al 2007). Envelope Region The largest fragment (~1700bp) studied wa s the complete envelope region of SLEV. This region codes for the major stru ctural and surface protein of the virion (Chambers et al 1990; Lindenbach and Rice, 2001), and is the main target for neutralizing antibodies (Chambers et al 1990). Consequently, changes in this highly conserved region of the virus may impact the host immune response and viral biology leading to extensive study of this gene in flaviviruses (Twiddy and Holmes, 2003). The consensus tree was chosen for both the neighbor-joining (Figure 4-37) and maximum parsimony (Figure 4-38) methods. The maximum parsimony tree had the highest bootstrap values (95 or higher c onsidered most accurate). A previous phylogenetic analysis of the complete enve lope region of North and South American strains of SLEV identified a monophyletic tree, with se ven lineages. SLEV strains predominately clustered according to geogra phic origin (Kramer and Chandler, 2001). Both tree topologies also indica ted that SLEV strains isolated in Florida grouped into a monophyletic tree, within North and South Amer ican clades. Four strains isolated in 1952, 1962 and 1985 grouped together to form one cluster of Florida strains. A second cluster appeared to emerge during 1989 thr ough 1990, where five stra ins isolated during these epidemic years grouped together. These isolates were collect ed from wild birds and one mosquito pool during the last large outbreak of SLEV in the state, with 223 confirmed human cases.

PAGE 400

375 Thirty-four years following the isolation of FL72 in the panhandle region of Florida, SLEV strains FLS569 and FLS650 were isolated in the s outhern region of the state during 2006. Interestingly, al l three strains groupe d into the South American clade. However, it is not clear from this inferre d phylogeny (Figures 437, 4-38), which lineage should be assigned to these strains. Conse quently, the majority of SLEV envelope sequences, originally submitted for publication by Kramer and Chandler (2001), were downloaded from GenBank (Appendix R). Please refer to Table 2-2 for strain names and locations for the sequences downloaded fr om GenBank (Kramer and Chandler, 2001). Neighbor-joining and maximum parsimony methods were performed on these strains, with the inclusion of additional strains from Brazil (dos Santos et al 2006), Argentina (Diaz et al 2006), and the Florida South American isolates (Figures 5-2 and 5-3, respectively). Appendix R also includes the strain names and GenBank Accession numbers of the included strains. Based on these updated phylogenetic trees (Figures 5-3 and 5-4), FLS569 and FLS650 cluster into Lineage VA and FL72 groups into Lineage VB, which predominately contain Brazilian isolates. Thes e are the first strains isolated in North America shown to cluster into these lineages and are highlighted in red in the figures. South American reference strains (TR52, TR 58, BR64, BR69) also cluster in Lineage V. This finding is significant because it provi des the first conclusive evidence for a previously suggested hypothesi s that SLEV may be period ically reintroduced to the United States from South America with conseq uent cycles of amplification (Kramer and Chandler, 2001; Reisen, 2003). Although a mech anism is not necessarily needed for successful overwintering of the virus in sout h Florida (where mosquito populations often

PAGE 401

376 Figure 5-3 Phylogenetic Relationships of North & South American SLEV, Neighbor-Joining Method Phylogram of the complete envelope region for SLEV strains was inferred using the neighbor-joining method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates, valu e shown on branches) was chosen. Branch lengths represent the amount of genetic divergence. BFS4772 E22924 BFS1750 72V4749 72V1165 P17797 Soue135 Coav750 PV0-620 PV7-3389 L695121.05 69M-1143 904 Tex1955 Span9398 FL52 GHA-3 75V14868 MSI-7 Chlv374 Kern217 FL79-411 FortWash VP34 Pinellas15 TBH-28 FL85b FL85a 65V310 PanAn902604 Hubbard Parton FL90c FL90a FL90d FL90b FL89 98V3181 PVI-2419 83V4953 TNM4-711K GMO94 CbaAr4006 CbaAr4005 79V2533 SPH253157 FLS650 FLS569 BeAn242587 75D90 BeAn248398 BeAn246407 TR58 TR62 TR9464 BR69 BR64 BeAr23379 BeH203235 FL72 BeAn246262 GML903797 GML902612 PanAn902745 GML900968 GML902981 CorAn9124 CorAn9275 WNNY99 WNEgypt Kunjin MVE JE 100 99 100 80 96 79 70 52 100 100 100 100 99 100 100 100 100 64 53 32 99 44 32 100 100 100 90 49 67 51 99 61 68 55 97 86 48 45 45 19 76 53 100 100 99 99 98 96 49 73 97 59 83 79 59 55 47 55 98 88 93 42 36 53 100 99 99 97 0.05 Lineage VI Lineage I Lineage II Lineage III Lineage VA Lineage IV Lineage VII Lineage VB

PAGE 402

377 Figure 5-4 Phylogenetic Relationships of North & South American SLEV, Maximum Parsimony Method Phylogram of the complete envelope region for SLEV strains was inferred using the maximum parsimony method in MEGA4.0.1, where the consensus tree (1000 bootstrap repli cates, value shown on branches) was chosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base changes in the sequence. BFS4772 E22924 BFS1750 72V4749 72V1165 P17797 Soue135 PV7-3389 Coav750 PV0-620 L695121.05 69M-1143 904 Tex1955 Span9398 FL52 GHA-3 FL90c FL90a FL90d FL90b FL89 98V3181 PVI-2419 83V4953 TNM4-711K Chlv374 Kern217 75V14868 MSI-7 FL79-411 FortWash VP34 TBH-28 Pinellas15 PanAn902604 65V310 FL85a FL85b Hubbard Parton GMO94 SPH253157 79V2533 CbaAr4005 CbaAr4006 GML902612 PanAn902745 GML900968 GML902981 FLS650 FLS569 BeAn242587 75D90 BeAn248398 BeAn246407 TR9464 BR69 BR64 TR58 TR62 BeAr23379 BeH203235 FL72 BeAn246262 CorAn9124 CorAn9275 GML903797 WNNY99 WNEgypt Kunjin JE MVE 99 99 99 99 97 99 99 99 99 99 99 99 99 78 98 79 46 70 99 99 63 99 46 39 99 81 73 57 69 99 99 64 39 96 83 43 24 46 42 17 12 21 50 99 99 59 71 81 98 97 97 97 76 88 73 58 38 34 24 93 84 92 18 21 49 99 71 50 Lineage I Lineage II Lineage III Lineage VA Lineage IV Lineage VB Lineage VI Lineage VII

PAGE 403

378 survive year-round), the introduc tion of SLEV from South America has the potential to impact northern states. In addition, the molecular methods (RT-PCR, sequencing) for strain identification have fi nally clarified studies in th e early 1970s by the Florida Epidemiology Research Center (ERC) that did not find significant differences in kinetic HAI assays conducted on South American and Fl orida strains of SLEV As a result of those studies, investigators at the ERC hypot hesized that South American SLEV strains were closely related to Florida isolates (p ersonal communication, L. Stark). This finding was further supported by the detection of South American strains of SLEV in the hemagglutination inhibition assay routinel y performed at the BOL-Tampa during 2006. The introduction of South American stra ins of SLEV to the United States has been supported indirectly by earlier phylogene tic analysis (Kramer and Chandler, 2001) that identified the clustering of South Am erican (SA) strains into Lineage II, a predominately North American (NA) clad e. In addition, the GMO94 isolate was identified as a recombinant virus of Tennessee and Argentina strains (Twiddy and Holmes, 2003), which was isolated in Guatem ala in 1969. However, the isolation of a South American strain of SLEV has never b een reported in the United States. SA strains with close homology to NA isolates [e.g. strains 65V310 (Mexico), PanAn902604 (Panama), Span9398 (Brazil)] have only been is olated south of the border. This result has not been from a lack of research, as seve ral investigators over th e last 50 years have attempted to isolate the virus from migrat ory birds returning to North America (BOLTampa, unpublished data 1964-1966; Calisher et al 1971; Reisen et al 2000b). It is not clear from this analysis if the reintroduction of SA strains has occurred frequently (i.e. annually) but was not detected, or if reintroduction is limited to

PAGE 404

379 southeastern states only, where some SA strains share close homology to Florida, Texas, and Tennessee (recombinant) viruses. The sp read of West Nile virus across North America and into the Cari bbean and South America (G ubler, 2007) predicts that migratory birds are not as discriminatory, but local ecologic conditions (habitat, vector) may suggest a larger role in the annual arbovirus recr udescence, amplification and transmission cycles of SA SLEV strains in North America. Further virus isolation studies are recommended to investigate the frequency of this occurrence and its potential impact on SLEV strains in Florida that have mo re North American characteristics. Membrane/Envelope Region (SLEC) The membrane protein is necessary fo r the maturation of an immature virus particle into an infectious form (Linde nbach and Rice, 2001) and the function of the envelope protein was discussed above. A second phylogenetic analys is was performed on a subset of SLEV reference strains for co mparison to recent isolates of SLEV on sequences from the partial membrane/envelope re gion. In particular, this region was also sequenced for the novel flavivirus strains. The UPGMA method provided the highe st level of bran ch support on the consensus tree, not the neighbor-joining or maximum parsimony trees, which may be an indication of the high conservation seen in th e membrane and start of the envelope region (Tables 4-11, 4-12). As shown for the e nvelope region, North American and South American strains clustered into two clades, where FLS569, FLS650 and FL72 remained associated with SA strain s. In contrast, the novel flavivirus isolates clustered with the North American clade of Florida reference strains (Figures 4-39, 4-40 and 4-41) despite isolation from the same site as FLS650.

PAGE 405

380 Interestingly, multiple amplicons were pr oduced for these two strains that were not seen for either North or South American strains of SLEV (Figure 4-33), and the RTPCR product fragments were also different be tween the two strains (individual chickens). Although one band was sequenced for each virus, differences within this region are shown in the placement of these strains within the Florida NA clade. It is unlikely that these strains resulted from contamination in the laboratory, as swabs collected from these chickens were processed by different techni cians and at different times (the second positive swab from one chicken was initially processed seven months prior, with the same RT-PCR results). The significance of these results is unknown without sequencing the complete genome. Multiple hypotheses could be sugge sted to explain these findings and may include the co-circulation of both Florida enzo otic and South American strains of SLEV during peak transmission months in Florida, inter-genotypic recombinants (as shown for dengue 1 virus, Aaskov et al [2007]), or a genetic shift from South American to a North American strain. Brazilian strains of SLEV appear to be highly promiscuous and have been reported to infect hosts c oncurrently infected with other flaviviruses A recent study identified a patient simultaneously infected with SLEV and dengue 3 virus, which did not appear to increase disease severity, alt hough minor hemorrhagic symptoms were noted (Mondini et al 2007). Consequently, further studie s are needed to investigate these Florida strains of SLEV, as well as research th e newly isolated strain s of Brazilian SLEV. 3NC Region The 3non-coding region in flaviviruses has been shown to serve an enhancer function for viral RNA replica tion (Gritsun and Gould, 2007) and its interactions with the

PAGE 406

381 NS5 region have also been shown to aff ect phenotype of West Nile virus (Davis et al 2007). A subset of SLEV reference strains wa s sequenced in this region, but the lack of submitted GenBank sequences at the 3 terminus for SLEV limited interpretation and comparison to other North and South American strains. The novel flavivirus strains failed to amplify in RT-PCR assays targeting this region. As shown for earlier phylogenetic analys is of the membrane and envelope regions, the 3 untranslated region also separated North Am erican and South American strains into two clades, where FLS569, FLS 650 and FL72 remained associated with SA strains. Neither the maximum parsimony nor UPGMA methods (Figures 4-49, 4-50) resulted in robust bootstrap values on the c onsensus tree for the untranslated region. Few mutations were identified in this region (Tables 4-11, 4-13) and the limited number of strains analyzed contribu ted to this finding. NS5 Region Nonstructural protein 5 is the largest and most highly conserved flaviviral protein (Chambers et al 1990). The region sequenced for phyl ogenetic analysis in this study included a portion of the RNA-dependent R NA polymerase (RdRp) domain that is critical for RNA replication (Lindenbach and Rice, 2003). Current circulating and reference strains of both SLEV and WNV were sequenced in this region and combined phylogenetic trees were generated. Novel flavivirus strains failed to amplify in RT-PCR assays for this region. St. Louis encephali tis virus and West Nile virus clustered according to species, forming monophyletic tr ees. Maximum parsimony analysis resulted in more robust bootstrap support values fo r both SLEV and WNV than found in the neighbor-joining method (Figures 4-45, 4-46).

PAGE 407

382 Analysis of the NS5 region of St. Louis encephalitis virus isolates resulted in the same phylogenetic tree previously noted, two clades segregated into North and South American strains. The most parsimonious tree generated a longer branch length for the FLS569 and FLS650 cluster in the South Amer ican clade, as compared to reference strains of SLEV. However, North American st rains of SLEV were still grouped into two clusters, with the most recent epidemic (1990) strains forming one cluster (Figure 4-46). Limited diversity in West Nile virus st rains isolated in Florida over six years (Tables 4-14, 4-15) resulted in shorter br anch lengths in the NS5 region than in comparison to SLEV strains isolated ove r 50 years. FLWN01b and FLWN05a had the longest branch lengths of the studied West Nile virus isolates collected in Florida. The FLWN01b strain was collected from a blue jay during the first year that WNV was introduced to Florida. The number of base changes in this isolate exceeded those found in FLWN01a isolated from a crow during the same y ear or from later reference strains. It is unknown if this anomaly may be found in other Florida strains from 2001. Several studies have reported the existence of diverse quasispecies of WNV isolated from a relatively homogenous genetic population of viruses (Ebel et al 2004; Jerzak et al 2005; Ciota et al 2007), which have higher mutation ra tes than found in the consensus population strains identified in the same year (Jerzak et al 2005). The FLWN05a strain was isolated from an alligator in 2005 and several mutations were noted in the NS5 region than identified for the crow (FLWN05b) and sentinel chicken (FLM38) isolates from the same year For this isolate, these changes are likely strain specific for reptilia n hosts, where poor replication of WNV has been identified experimentally (Klenk and Komar, 2003).

PAGE 408

383 A second multiple sequence alignment resulted in more robust bootstrap values and the accurate placement of Ilheus and Ro cio viruses grouped togther, as the SLEV outgroup viruses (Figure 5-5). Phylogeny of West Nile Virus An analysis of the genetic evolutionary relationships (phyloge ny) between strains of West Nile virus collected in Florida were compared for this project following the isolation of WNV from se ntinel chickens (FLM38, FLS502, FLS504, FLS545). These genomes were not completely sequen ced (with the exception of FLS545). Reference strains of West Nile virus were either purchased from ATCC (NY99) or obtained from the Center for Disease Control, Fort Collins (Egypt101). Lineage 2 strains of West Nile virus (p rototypical Ugandan, Madagascar and South African strains) were not included in this analysis. Conse quently, only Lineage 1 strains were studied. Kunjin (Accession # AY274505), Japanese encephalitis (Accession # EF571853), and Murray valley encephalitis (Accession # AF161266) viral genomes were downloaded from GenBank to root the phylogenetic trees. The NS5 region was analyzed for these WNV strains and discussed above. Mutations in the nonstructural proteins have been shown to significantly impact virus replication and virulence (Davis et al 2004; Beasley DWC, 2005). A recent study has also identified that the NS5 region was the most variable with impacts on viral replication in Lineage 2 strains of WNV (Botha et al 2008).

PAGE 409

384 Figure 5-5 Phylogenetic Relationships of SLEV & WNV Strains (NS5 Region), Second Multiple Sequence Alignment Phylogram of the partial NS5 regi on for SLEV and WNV isolates was inferred following a second multiple sequence alignment and using the maximum parsimony method, where the consensus tree (1000 bootstrap replicates) was chosen. Branch leng ths represent the amount of genetic divergence, with the scal e bar corresponding to number of base changes in the entire sequence. Bootstrap values are shown on branches. FL90b FL90d FL90c FL90a FL89 TNM4-711Kc GHA-3c MSI-7c Partonc FL52 TBH-28 FL79-411c Kern217 65V310c FL85a FL85b GML902612c FL72 BeAn246262c TR58 TR62 TRVL9464c BR64 BR69 75D90c FLS569 FLS650 Ilheus Rocio MVE JE AnMg798 Kunjin WNEgypt FLWN01a WNHungary FLWN02a WNNY99 WNFL03 WNMexico 03-113FL FLWN01b FLWN02b FLS502 FLS504 FLM38 FLS545 FLWN05a AZ-2004 CO-2003-1 WNTX02 FLWN05b 03-124FL GA-2002-1 TX-2004H 87 87 86 71 66 55 21 45 21 99 99 99 99 70 99 99 99 90 85 72 58 74 51 18 36 99 99 98 94 73 59 54 55 84 79 99 63 99 99 51 50 West Nile Virus St. Louis Encephalitis Virus Outgroups

PAGE 410

385 Capsid/preMembrane Region (WNAE) Capsid proteins are assembled to form the structural nucleoc apsid of the virion (Lindenbach and Rice, 2001) and the glycoprot ein precursor of the membrane protein, prM, has chaperone-like properties needed for proper folding of the envelope protein (Lindenbach and Rice, 2003). These structural proteins are highly conserved in flaviviruses West Nile virus strains is olated in Florida clustered into four groups with the neighbor-joining and maximum parsimony methods, forming a monophyletic tree. Neighbor-joining analysis resulted in the hi ghest bootstrap values of the three methods, with robust support of subtrees for Old World and North Amer ican clusters (Figures 442, 4-43, 4-44). The recent stra ins of WNV isolated from sentinel chickens (FLM38, FLS502, 504, and 545) consistent ly clustered with the FLWN 02b strain, isolated from a mosquito pool ( Oc. taeniorhynchus) during 2002. In contrast, a second strain (FLWN02a) isolated from mosquitoes (same species) in Florida (same county) during 2002 clustered together with FLWN01a (crow) and FLWN05a (alligator) stra ins. These results support previous studies that found that WNV stra ins exhibited greate r diversity between mosquito strains compared to strains isolated from avian hosts. The authors also suggested that inter-host quasispecies, esp ecially in mosquitoes, may contribute to evolution of the virus in an overall ho mogenous population of the dominant genotype (i.e. NY99 and WN02) [Ebel et al 2004; Jerzak et al 2005]. Unexpectedly, the two novel flavivirus strains (FLS649 and FLS694) clustered together with an Old World strain, Egypt101. Laboratory contamination of the samples was considered, but all RT-PCR and sequenc ing assays were conducted with the NY99

PAGE 411

386 strain of the virus as a pos itive control. Egypt101 was not in use at the time these samples were extracted and amplified, suggesting that this was not a laboratory artifact. While this may indicate a second introduction of an Old World strain of West Nile virus to North America, these results should be interpreted with caution du e to the small region of the genome analyzed (400 bp). Complete seque ncing of these stra ins is needed for confirmation of this result. NS5 Region (WNBE) Nonstructural protein 5 is the la rgest and most highly conserved flaviviral protein, with important transcription and replication elements (Chambers et al 1990). Mutations in the NS5 region have been shown to a lter phenotype and virulence of naturally occurring West Nile virus strains (Davis et al 2007; Botha et al 2008). After WNV was introduced to New York City in 1999, the Cent ers for Disease Control initially confirmed suspected cases of West Nile virus. However, the overwhelming number of samples submitted for testing in the next year required supplementation by state public health agencies to confirm cases (human and animal). As a result, public health laboratories that met appropriate biosafety containment requir ements for this agent were trained by the CDC and provided with RT-PCR primer set se quences for confirma tion of West Nile virus. An experimental primer set (persona l communication, RS. Lanciotti) targeting the 3 terminus of the NS5 gene was provided to the BOL-Tampa for gel-based confirmation of WNV. However, this primer set was cross-reactiv e with SLEV (as shown in this study) and was not later published (Lanciotti et al 2000). The 3 region of the NS5 gene did no t sequence well for most of the recent Florida WNV strains analyzed in this study. Only two recent isolates were successfully

PAGE 412

387 sequenced, FLS504 and FLS694, and both clus tered in the same group. A monophyletic tree was generated, with high bootstrap confiden ce (99) on this branch of the consensus maximum parsimony tree (Figure 4-48). Interestingly, the novel flavivirus strain clustered with North American isolates of WNV, rather than Egypt101, in this region of the viral genome. As a result, it is hypothesized that th is strain will likely have closer homology to North American than to Old Wo rld strains of West Nile viru s once the complete sequence is known, due to its isolation in Florida and si milarity to the NY99 st rain in the 3 NS5 region. Although the novel flavivirus strain FLS694 did not produce an amplicon for the larger NS5 fragment, these results suggest that a portion of the NS5 ge ne is intact, which may or may not be sufficient for viral re plication. Future studies are planned to investigate these findings. In summary, phylogenetic analysis of St. Louis encephalitis virus has revealed that strains isolated in Florida belong to No rth and South American lineages, as proposed by Kramer and Chandler (2001) [see Figures 5-3, 5-4). For the first time, strains of SLEV collected in the continental United States are placed into Lineage V in the South American clade. From a public health st andpoint, this complicates surveillance and prevention strategies for SLEV in Florida as reintroduction of S outh American strains may occur periodically in the state (both north and south regi ons). As a result, future St. Louis encephalitis virus epidemics in Florida wi ll be difficult to prev ent/eradicate without the elimination of the virus reservoir in South America. Real-time RT-PCR and sequence analysis of several South American strains also identified mutations in Brazilian and Trin idadian viral genomes that complicated confirmation of these South American strain s of SLEV by RT-PCR assays. Surveillance

PAGE 413

388 programs should be aware of the limitation of one real-time RT-PCR (TaqMan) primerprobe set (Lanciotti and Kerst, 2001) and alte rnative gel-based conf irmation strategies added to the testing algorithm to confirm these atypical strains. Additional arbovirus surveillance techniques and the development of a new real-time RT-PCR primer-probe set are recommended to detect these strains that may periodically circulate in North America. South American strains of SLEV isolated in Florida were from sentinel chickens in 2006 and an opossum in 1972, not from migrat ory birds, so the route of introduction remains unknown. However, migratory birds have been implicated in the spread of West Nile virus throughout the Americas and likely play a role in the dispersal of St. Louis encephalitis virus along bird migration routes. Florida is direc tly situated in the Atlantic Coast Route and Tributaries West migrat ion pathway (Gubler, 2007). In fact, the migration pattern of birds from the New York and New England region to Florida introduced WNV to the state in 2001, but bypass ed several mid-Atlan tic states (Deardorff et al 2006). Based on this information, it can be assumed that migratory birds transfer West Nile virus and potentially St. Louis en cephalitis virus bidirectionally. This study provides the first report th at South American strains of SLEV were transported northward, likely by migrating birds. Conseque ntly, the potential of northward transport of West Nile virus also exists from S outh America, where migrating birds may reintroduce and seed the virus throughout Nort h America in the future (Gubler, 2007). Several questions require fu rther study to investigate this North-South American connection for SLEV: How often are SA stra ins of SLEV introduced or circulating in Florida? What ecologic conditions allow for this to occur in southeastern states? Have

PAGE 414

389 South American strains circulated in other regions of th e United States, but escaped detection? Does mixing occur between NA an d SA strains of SLEV? Can these strains cause epizootics/epidemics in North America? Will reintroductions of West Nile virus from South America al so occur periodically? Phylogenetic analysis of West Nile strains isolated in Florida identified that recent strains of West Nile virus collected in 2006 (the only WNV strains isolated by the BOLTampa that year) clustered with strains coll ected in previous years. Overall, branch lengths for these strains were short and all strains clustered into a monophyletic tree, indicating limited divergence in these strains over a six year time period. Unusually, the two novel flavivirus strains isolated in 2006 shared ho mology with Old World strains of WNV (Egypt101) in the capsid/pr M region of the viral genome, but one strain (FLS694) also clustered with North American isolat es sequenced in the NS5 region. Additional experiments are planned to resolve this discrepancy. Mutation Analysis Sequences were aligned using the ClustalW 1.6 algorithm in MEGA4.0.1 and each strain was analyzed for nucleotide and am ino acid changes, based on its relationship to other sequences in the multiple sequence alignment. Multiple sequence alignments for the capsid/prM region (WNV), 3NS5 regi on (WNV), envelope region (SLEV), membrane/envelope region (SLEV), NS5 re gion (WNV and SLEV), and 3NC region (SLEV) are provided in Appe ndices L-Q, respectively. St. Louis Encephalitis Virus SLEV-specific mutation analysis studies have been limited and rarely performed with modern nucleotide sequence analysis For example, a previous SLEV study

PAGE 415

390 identified epitopes and cross -reactive residues on the envel ope protein with monoclonal antibodies (Roehrig, Mathews and Trent, 1983). One study identified highly conserved amino acid residues located at positions 104 (Glycine), 106 (Glycine), and 107 (Leucine) of SLEV recombinant virus-li ke particles in the E glycopr otein that influenced crossreactive monoclonal antibody reac tivity; however, wild type viruses were not described (Trainor et al 2007). Another study performed cell cultu re adaptation of West Nile virus and St. Louis encephalitis virus to evaluate phenotype and subsequent nucleotide changes over repeated passage in mosquito and avian cell lines (Ciota et al 2007b). The complete genome for these virus strains were sequenced, and 8 nucleotides changes were noted for SLEV after repeated passage comp ared to the wild type virus (Kern217). It should be noted that a limited number of complete coding sequences (cds) have been submitted to GenBank for SLEV, with only seven complete cds published (as of March 25, 2008). Without a large subset of published sequences for SLEV, it is difficult to perform accurate mutation analysis as uni que differences identified in a few strains may match other strains when aligned. As a re sult, the 14 reference strains analyzed in the study may not provide a true reflection of non-conserved changes in these genomes, as the analytical power is d ecreased without a large sample size. These strains have also been passaged in mice and/or Vero and other cell culture lines, which may introduce mutations. Finally, these strains were not se quenced over the entire coding region and only fragments of the genome were analyze d, which may later impact mutation analysis results.

PAGE 416

391 Evaluation of FL52 Genotype The nucleotide and amino acid sequence of FL52 (isolated from a Miami resident) had the greatest sequence diversity of the No rth American strains of SLEV analyzed in this study (Table 4-11). The complete e nvelope region of FL52 was sequenced and aligned to 16 other SLEV strains. This ali gnment identified 20 nucleot ide changes, with a single insertion. Although this was the highest number of substitutions in the envelope region for Florida isolates st udied, it is not significant compared to the 160 and 161 nucleotide differences noted for Argentina st rains in the envelope region (Kramer and Chandler, 2001). A second analysis of the envelope region was performed to further validate these results for the Florida strains. A majority of envelope sequences (n=47) submitted by Kramer and Chandler (2001) and recent SLEV isolates (n=3) in South America from Argentina (Diaz et al 2006) and Brazil (dos Santos et al 2006) were downloaded from GenBank for multiple sequence alignment analysis (Appendix T) and phylogenetic relationships (Figures 5-3, 5-4). This larger sample size invalidated many of the unique nucleotide differences noted for FL52. Th e second analysis id entified 10 nucleotide substitutions not shared by other SLEV isol ates, all non-synonymous mutations resulting in the insertion of one amino insertion (valine) and nine predicted amino acid substitutions (see Appendix T). Very few nucleotide substitutions were noted in the membrane/envelope region or 3NC region (Table 4-11). For the NS5 region, 5 nucleotide differences were noted

PAGE 417

392 resulting in four predicted amino acid changes. In addition, two insertions were identified in both the nucleotide and amino acid sequences (Appendix U). Phenotype The number of mutations in the envelope and NS5 regions appeared to alter the phenotype of this SLEV strai n. The strain grew very sl owly after extraction from suckling mouse brain and did not adapt well in cell-culture. Weak cytopathic effect was observed after six days post-inoculation in Vero cell culture (Table 417). In addition, the plaque phenotype of FL52 consisted of seve ral large, diffuse plaques without sharp borders nine days post-inoculation. Plaques we re difficult to visualize or count due to their size and weakly defined borders (Figur e 4-52). This phenotype may be directly related to mutations in the NS5 and 3NC regi ons that are important to virus replication and may alter phenotype, as shown for WNV (Davis et al 2007). Evaluation of TBH-28 Genotype In contrast to FL52, the nucleotide and amino acid sequence of TBH-28 (collected in Tampa Bay, 1962) was highly conserved, wi th minimal sequence changes (Table 411). The complete envelope region of TBH-28 was sequenced and aligned to 16 other SLEV strains. This alignment identified 11 nucleotide changes, with the majority of mutations silent and four predicted amino acid changes. However, the second analysis of the envelope region with additional SLEV strains did not detect any nucleotide changes that were unique. Most of the mutations prev iously noted were shared by the Pinellas 15 strain of the virus, also isolated in the Tampa Bay area during 1962. Consequently, no amino acid substitutions were predicted for TBH-28 (Appendix T).

PAGE 418

393 Very few nucleotide substitutions were not ed in the membrane/envelope region or 3NC region. For the NS5 regi on, three nucleotide differences were noted in both the first (Table 4-11, Appendix P) and second multiple sequence alignments (Appendix U). However, in the second alignment three amino acid changes were predicted, instead of two in the first alignment. Phenotype The BOL-Tampa routinely uses the TBH-28 strain of the virus for plaquereduction neutralization tests (PRN T). Consequently, this strain had already been cultured in Vero cells. As shown in th is study, Florida isolates of SLEV grow more slowly than other strains in plaque assays. For example, the Kern217 strain (Cal ifornia) often forms plaques between 4-5 DPI in Vero cell culture (Payne et al 2006). In contrast to the FL52 strain, TBH-28 formed both small and large plaq ues, with distinct borders nine days postinoculation (Figure 4-52). Evaluation of FL72 Genotype The nucleotide and predicted amino acid sequence of FL72 (collected in Escambia County, 1972) was less conserved than corresponding Florida isolates of SLEV (Table 4-11). Nine unique nucleo tide substitutions were identified, with one insertion that differed from both North and South American st rains, which resulted in seven predicted amino acid changes in the envel ope region. However, this stra in was most closely related to South American strains of the virus, where a characte ristic pattern of nucleotide substitutions was noted for SA strains that segregated them from their North American counterparts (Table 4-12). The second analys is of the envelope region with additional

PAGE 419

394 SLEV strains detected only three nucleo tide changes that were unique, with two predicted amino acid substitutions. Interestingly, this isolate most closely matched a South American strain also isolated from an opossum in 1972 from Brazil (BeAn246262) [Kramer and Chandler, 2001]. Between the two strains, 21 nucleotide changes were noted in the envelope region (Appendix T). Very few nucleotide substitutions were not ed in the membrane/envelope region or 3NC region. For the NS5 region, eight nucleo tide differences were noted in the first alignment (Table 4-11, Appendix P) with five amino acid substitutions. A second alignment was performed, which identified f our unique nucleotide changes and predicted four amino acid substitutions (Appendix U). Phenotype Unlike FL52, the FL72 strain quickly adapte d to cell culture w ith the strongest cytopathic effect noted for any of the re ference strains on day seven post-inoculation (Table 4-17). As a result, FL72 quickly re plicated in Vero cell culture and formed distinct, large plaques within five days post-inoculation (Figure 4-52). Consequently, nucleotide substitutions likely c ontributed to improved relative fitness of South American strains allowing them to quickly replicate in cell culture. This phenomenon has also been described for the Kern217 strain in adaptation studies (Ciota et al 2007b). Evaluation of FL85 a &b Genotype The first multiple sequence alignment did not identify unique nucleotide or predicted amino acid differences in the enve lope region. However, a second analysis of this region with a larger sa mple size of SLEV strains identified two unique nucleotide

PAGE 420

395 mutations shared by these strains, at positions 1440 and 1518. These were synonymous mutations that did not alter the consensus predicted amino acid sequence (Appendix T). Very few nucleotide substitutions were not ed in the membrane/envelope region or 3NC region for FL85a. For the NS5 region, two nucleotide differences were noted in the first (Table 4-11, Appendix P) alig nment, which predicted one amino acid substitution. In contrast, the second multiple sequence alignment detected four unique nucleotide substitutions, with three predicted amino acid changes (Appendix U). Phenotype Interestingly, these strains replicated very poorly in Vero cell culture. FL85a resulted in equivocal cytopath ic effect seven DPI. This strain required a second passage for cpe to be detectable (1+) after ten DPI in Vero culture. Similar results were found for FL85b, which produced no cytopathic effect 14 DPI on first passage. Second passage of this strain resulted in detectable cpe (also 1+) after ten DPI (Table 4-17). Consequently, these virus strains did not perform well in the plaque assay, as plaques were not detected after 14 DPI, with the plaque method used at the BOL-Tampa (data not shown). For all of the Florida strains studied, only FL85a and FL85b had two nucleotide substitutions identified in the partial RdRp domain an alyzed in the second alignment of the NS5 region. It is suggested that the combina tion of these changes may have negatively affected replication of the virus, which resu lted in the slow grow ing phenotype observed in this study (Appendix V).

PAGE 421

396 Evaluation of Florida Epidemic Strains (FL89, FL90 a-d) Genotype The first multiple sequence alignment identified 13-15 conserved mutations in the envelope region of Florida epidemic strains th at were not present in other Florida or SA strains analyzed. This resulted in four predicted amino acid differences for FL89 and seven predicted changes to the protein sequence for FL90a-d (Appendix N). However, a second analysis of this region with a larger sample size of SLEV strains identified only one unique nucleotide mutation shared by these strains, a pr edicted non-synonymous mutation that substituted aspartic acid for asparagine at position 671 of the protein sequence. An additional nucleotide substitution for FL90a, c & d was noted, but it was silent with no predicted amino acid change (Appendix T). Consequent ly, the addition of a larger sample size of SLEV strains result ed in matching of many unique nucleotide changes noted for Florida epidemic strains that were conserved in other North (and South) American strains. Although Kramer and Chandl er (2001) found no clear evid ence relating epidemic strains to nucleotide/amino acid substitutions, the initial alignment performed in this Florida study identified severa l differences in the epidemic strains from inter-epidemic and SA strains of SLEV circulating in Flor ida (Appendix T). A characteristic pattern of nucleotide/amino acid substitutions for these st rains still emerged following the second alignment, where Florida epidemic strains consistently matched those collected either during an SLEV epidemic or the year preceding one in Texas and Tennessee (TNM4711K, Texas: 83V4953, 98V3181; PVI-2419). This pa ttern matches the isolation of FL89 prior to the FL90a-d strains of SLEV collected during the last large outbreak in the state.

PAGE 422

397 These strains were not analyzed in th e membrane/envelope region as very few nucleotide differences had previously been noted for other Florida or South American strains. A future study to inve stigate strain differences over the entire genome would be recommended for these isolates for comparison to other North American epidemic strains of SLEV. FL90a & d were, however, sequenced in the 3 non-coding region but only four nucleotide differences were detected (Table 4-11). For the NS5 region, 13-14 nucleotide differences were noted in the fi rst alignment (Table 4-11, Appendix P) for FL90a-d and FL89, respectively, which predicted seven amino acid substitutions. As shown above for the envelope region, the second multiple sequence alignment abrogated many unique differences and detected only six unique nucleotide substitutions, which resulted in six non-synonymous predicte d amino acid changes in the NS5 region (Appendix V). Again, an epidemic pattern emerged, such that many of the unique changes noted in the first alignment for FL89 and FL90a-d strains matched with the Tennessee strain (TNM4-711K) in cluded in this analysis. Phenotype FL89 first exhibited a weak equivocal (+/) cytopathic effect seven DPI, whereas FL90a & 90d produced a stronger cpe at the sa me time point (1 & 1+, respectively) on first passage. Second passage of the FL89 stra in resulted in the same equivocal result seven DPI, not a stronger cpe as expecte d. In contrast, FL90a & d both produced an equivocal (+/-) cytopathic e ffect three DPI in the second passage (Table 4-17). As a result, FL89 did not perform as well in the plaque assay similar to FL85a & b. Plaques were detected after nine DPI but were very indistinct and did not photograph well (data not shown). Both FL90a & d formed distinct large and sm all plaques nine DPI

PAGE 423

398 (Figure 4-52). FL90a produced larger indi vidual plaques than FL90d, whereas the plaque phenotype for FL90d resulted in smaller plaque sizes. The two viral genomic regions analyzed for both the FL89 and FL90 strains shared several conserved mutations. Howeve r, FL89 did not have as many nucleotide substitutions (13) in the envelope region, with less predicted amino acid changes (four) than found for FL90a-d strains (15 nucleo tides and seven amin o acids). Multiple sequence analysis also identified two nucleot ide differences in the NS5 region between FL89 & FL90 strains, resulting in one different amino acid substitution predicted between these closely related strains. Cons equently, these changes may have adversely impacted the phenotype of FL89, as compared to FL90 strains. Evaluation of South American SLEV Strains (TR58, TR62, BR64 and BR69) Genotype The South American reference strain s included in this study exhibited a characteristic genotype, such that TR58, TR62, BR64, BR69 shared conserved nucleotide and predicted amino acid substitutions in the envelope, NS5, and membrane/envelope regions (Table 4-12). However, each strain had 5 nucleotide substitutions that were not conserved in each region and differed from the consensus presented (Appendix N). Nonetheless, multiple sequence alignment i ndicated a characteristic pattern shared by South American strains of SLEV that can be used to distinguish them from North American strains of the virus. In addition, SA strains colle cted in Florida (FL72, FLS569, FLS650) also had these conserved nucleotide and predicted amino acid changes at the same positions.

PAGE 424

399 The highest number of nucleotide substitu tions was noted in the envelope region, where 59 changes from the North American consensus sequence were identified (with 23 predicted amino acid differences). The C T transition mutation was frequently noted, which were synonymous (silent) mutations. Interestingly, four nucleo tide substitutions in the NS5 region resulted in early termination (* ) of translation, a pattern not seen in North American strains of SLEV at these positions. The altered genotype of these strains may play a role in the phenotype and lower pat hogenicity exhibited by some SA strains. Phenotype (TR62, BR69) As previously noted for FL72, these SA strains quickly adapted to cell culture following extraction from suckling mouse brai n tissue. TR62 first exhibited a weak equivocal (+/-) cytopathic e ffect six DPI, whereas BR69 pr oduced equivocal cpe one day later (seven DPI) on first passage. However, TR62 and BR69 culture s produced a strong cpe (3) by 11 DPI and were frozen at that time. A second passage was not required (Table 4-17). Unlike FL72 that formed large pla ques, TR62 and BR69 produced much smaller plaques within five days postinoculation in the plaque assa y (Figure 4-52). Differences in phenotype were also noted between these tw o strains, such that TR62 formed small but distinct plaques whereas the BR69 strain form ed smaller plaques without distinct edges. Evaluation of FLS569 Genotype The nucleotide and predicted amino acid changes found in reference SA strains were also detected in FLS569 (Table 4-12). In addition, several unique differences were noted for this strain that differed from both SA and NA strains. In the envelope region, 13 nucleotide substitutions were noted, with ei ght predicted amino acid changes (including

PAGE 425

400 one early termination of tran slation) [Table 4-13]. In striking contrast, the second multiple sequence alignment only identifie d one unique nucleotide substitution (G A), which resulted in an amino acid change (D N) in the predicted protein sequence (Appendix T). The substitutions noted on the first alignment were predominately shared by other SA strains of SLEV. Unique nucleotide substitutions were noted in the membrane/envelope region (n=9, with 8 amino acid changes) or 3NC re gion (n=5) on the first alignment. A second alignment of the membrane/envelope region identified a single nucleotide change and one amino acid difference for FLS569 (Appe ndix U). For the NS5 region, 19 nucleotide differences were noted in the first (Table 4-13) alignment, which predicted 12 amino acid substitutions. In contrast, the second multip le sequence alignment detected six unique nucleotide substitutions, with six predicted amino acid changes (Appendix V) shared by these strains. Phenotype As previously noted for SA strains, FLS 569 quickly adapted to Vero cell culture following the initial culture of the processed cloacal swab diluent (32 PFU/0.1ml). The first passage of FLS569 exhibited a weak e quivocal (+/-) cytopathic effect 11 DPI. However, the second passage of the virus repl icated much faster and produced stronger cpe (2+) after five DPI (Table 4-18). The plaque phenotype of FLS569 produced a variety of plaque sizes: pinpoint, medium and large, within five DPI (Figure 4-53, Table 4-19). The unusual variety of di fferent sized plaques was not noted for other reference or recent strains, with the cl osest appearance to SLEV FL90a and WNV NY99 (Figures 453 and 4-24, respectively). However, larger plaque sizes were found in FLS569 as

PAGE 426

401 compared to FL90a, but FLS569 plaque sizes we re not as large as the plaques formed for NY99. Consequently, clones were picked from this mixed size population of plaques. Real-time RT-PCR detected SLEV alone in seve ral clones, as well as clones that crossreacted with both SLEV and WNV. However, WNV was not detected alone from any of the plaques selected, even following challe nge with homologous polyclonal antibody (i.e. SLE+ ab) [Table 4-19, Figure 4-24]. Evaluation of FLS650 Genotype The nucleotide and predicted amino acid changes found in reference SA strains were also detected in FLS650 (Table 412). In addition, several unique shared differences were noted for this strain a nd FLS569 that differed from both SA and NA strains (Table 4-13). In the envelope re gion, one nucleotide substitution differed from FLS569; in the NS5 region, two nucleotides were not conserved between the strains. However, compared to eight predicted am ino acid changes for FLS569, only six were identified for FLS650 [Table 4-13] in the first alignment of th e envelope region. In striking contrast, the second multiple sequence alignment only identified one unique nucleotide substitution (G A), which resulted in an amino acid change (D N) in the predicted protein sequence (Appendix T). The substitutions noted on the first alignment were predominately shared by other SA strains of SLEV. Unique nucleotide substitutions were noted in the membrane/envelope region (n=7, with six amino acid changes) on the first alignment. A second alignment of the membrane/envelope region identified a single nucleotide change and one amino acid difference for FLS650 (Appendix U). For the NS 5 region, 20 nucleotide differences were

PAGE 427

402 noted in the first (Table 4-13) alignment, wh ich predicted 12 amino acid substitutions. In contrast, the second multiple sequence alignment detected six unique nucleotide substitutions, with six predicted amino aci d changes (Appendix V) shared by these strains. Phenotype Unlike previous SA strains, FLS650 did not adapt well to Vero cell culture. The slow replication noted for the first passage may have been a result of the low titer of infectious virus particles on the cloacal swab (< 2 PFU/0.1 ml), which were below detection of the plaque assay performed at the BOL-Tampa (Table 4-18). In fact, most cultures are discarded 14 days post-inoculation, if no cytopa thic effect is observed. However, this sample was confirmed SLEV positive by real-time RT-PCR prior to inoculation into cell culture. As a result, this culture was not discar ded after 14 days even though no cpe had been detected. The first id entification of cpe (3) occurred 17 DPI following continued culture incubation over a weekend. Interestingl y, second passage of this strain did not replicate as quickly as the other SA strains of SLEV. The first observation of low cytopathic e ffect (1+) occurred seven DPI of the second passage. In contrast to the plaque phenotypes shown for other SLEV strains, FLS650 produced hundreds of pinpoint plaques (Figure 4-53, Tabl e 4-19), when the Vero 1 passage of the strain was diluted and tested in the plaque assay. Computer ge nerated contrast was applied to the image for enhanced visuali zation of the plaques (Figure 4-53). Despite a nearly identical genotype to FLS569 in the regions sequenced, the phenotype of this strain was dramatically different. Two hypotheses may explain this discrepancy: i) mixed population of viruses present in FLS569 sample, including SLEV,

PAGE 428

403 WNV, and hybrid SLEV/WNV that resulted in multiple plaque phenotypes (as suggested by TaqMan RT-PCR results), ii) additional mutations in region(s) of the genome that are not shared by the strains. Complete se quencing of the FLS650 genome is planned, including additional sequencing of WNV and SLEV cross-reactive clones to resolve the discrepancy. West Nile Virus For the purpose of this study, Florida reference strains of WNV were sequenced following the collection of West Nile virus strains from sentinel chickens in 2005 and 2006. However, reference strains were not phe notyped, as they were not re-cultured in Vero cells. RNA was extracted from these reference strains only. However, NY99 and Egypt101 strains were phenotyped, due to thei r use as positive controls in plaque reduction neutralization assays (data not show n for Egypt101). Recently isolated strains of WNV from sentinel chickens we re phenotyped in the plaque assay. Evaluation of FLWN01a Many of the nucleotide and predicted amino acid changes found in FLWN01a were shared by the other WNV reference and re cent strains sequenced (Tables 4-9, 4-10), but were unique when compared to WN NY99 and WNEgypt101. In the capsid/prM region, three nucleotide substitutions were note d, but were synonymous (silent) mutations with no predicted changes to the amino acid sequence [Table 4-14]. The cytosine at position 483 was conserved, as has previously been noted for North American strains of WNV (NY99) [Estrada-Franco et al 2003; Beasley et al 2004]. Additional West Nile virus sequences were downloaded from GenBank to perform a second multiple sequence alignment, with a larger sample size of strains for comparative purposes. The second

PAGE 429

404 multiple sequence alignment of this region identified two nucleotide substitutions, both shared by FLWN02a (Appendix W). Two unique nucleotide substitutions were noted in the NS5 region, resulting in one amino acid change to the predicted prot ein sequence on the first alignment (Table 414). A second alignment of the NS5 region produced identical results (Appendix V). Evaluation of FLWN01b In the capsid/prM region, two nucleot ide substitutions we re noted, with one predicted change to the amino acid sequence [Table 4-14]. The cytosine at position 483 was conserved, as has previously been noted for North American st rains of WNV (NY99) [Estrada-Franco et al 2003; Beasley et al 2004]. The second multiple sequence alignment of this region identified one unique nucleotide substitution, a T C transition mutation that resulted in the substitution of isoleucine for threoni ne in the predicted protein sequence (Appendix W). Twelve nucleotide substitutions were noted in the NS5 region, including one insertion, resulting in eight changes to the predicted protein sequence on the first alignment (Table 4-14). Two early termina tion of translation codons were observed, as well as the insertion of an amino acid. A s econd alignment of the NS5 region identified ten nucleotide changes, including one inse rtion, and seven amino acid differences for FLWN01b (Appendix V). These changes represen t the highest sequence diversity of the WNV isolates studied from Florida. Curiousl y, this isolate was collected the first year that WNV was introduced to the state. Further sequence analysis on other regions (e.g. the envelope) of the viral genome should be performed to characterize this strain.

PAGE 430

405 Evaluation of FLWN02a For the capsid/prM region, three nucleo tide substitutions were noted, but were shared with FLWN01a and were synonymous (silent) mutations with no predicted changes to the amino acid sequence [Table 4-14]. The cytosine at position 483 was conserved, as has previously been noted for North American stra ins of WNV (NY99) [Estrada-Franco et al 2003; Beasley et al 2004]. A second multiple sequence alignment identified these two 2 shared nuc leotide differences (Appendix W). No unique nucleotide or predicted amino acid substitutions were noted in the NS5 region on the first (Table 4-14) or second (Appendix V) alignments of the NS5 region for FLWN02a. Evaluation of FLWN02b In the capsid/prM region, a single nucleotide substitution was noted. The C T transition mutation (synonymous) at position 483 did not result in a predicted change to the amino acid sequence [Table 4-14]. Howeve r, this substitution was not conserved, as previously demonstrated for North American strains of WNV (NY 99) [Estrada-Franco et al 2003; Beasley et al 2004; Deardorff et al 2006]. This mutation was first reported in the New World for West Nile virus strain TM171-03 collected in Mexico from a dead common raven (May 2003). Intere stingly, this strain of WNV was collected in St. Johns County (northern region of Florida) on July 23, 2002, which predates the Mexican isolate by nearly a year. Ten additional WNV stra ins collected in Florida (2001-2002) were provided to another group in Texas to add to its reference collection. A later study by this group suggested that the spread of this virus (one of the mo st divergent from the parental NY99 strain identified in 2003) entered Mexi co from migratory birds flying south from

PAGE 431

406 Florida, Louisiana or indirectly throu gh the Caribbean, and likely not from Texas (Deardorff et al 2006). Consequently, FL WN02b is not the only Florida isolate from that year with these characteristic mutations. TM171-03 was the first strain of WNV isol ated in Mexico despite later studies that identified WNV positive IgG antibodies in horse sera collected during 2002 through 2003 (Estrada-Franco et al 2003). In addition, this strain has an attenuating mutation in the envelope region, at position 156, where pr oline had been substituted for serine. This residue removes the N-linked gl ycosylation site found in most North American strains, which is a putative virulence determinant th at, when removed, results in an attenuated phenotype (likely in conjunction with nonstructural mutations) [Beasley et al 2004]. Interestingly, this residue has only been ot herwise reported from W NV isolates in China and Egypt (Deardorff et al 2006). Further sequencing stud ies are needed on FLWN02b (and other reference WNV strains in Florida) to identify if the E-156 Pro residue is present in Florida isolates. The second multiple sequence alignment of the capsid/prM region identified the same transition mutation at position 483. In addition, nucleotides at positions 459 and 624 matched Old World strains of the virus. These transition mutations were not noted in Florida isolates from 2001, 2002 (a), or 2005 (except FLM38) nor in other isolates from the United States (Appendix W). Two unique nucleotide substitutions were not ed in the NS5 region, also shared by FLWN01b and WN Egypt101, which did not result in a change to the predicted protein sequence on the first alignm ent (Table 4-14). A second alignment of the NS5 region identified two silent nucleotide mutations that matched to FLWN01b (Appendix V).

PAGE 432

407 Evaluation of FLWN05a FLWN05a was isolated from an alligator in Clermont, Florida. In the capsid/prM region, no unique nucleotide substitutions were noted [Table 4-14]. The adenine (position 459) and cytosine (position 483) were conser ved, as has previously been noted for position 483 in North American strain s of WNV (NY99) [Estrada-Franco et al 2003; Beasley et al 2004]. A second multiple sequence alignment corroborated these findings (Appendix W). Seven nucleotide substitutions were noted in the NS5 region, resulting in five changes to the predicted protein sequence on the first alignment (Table 4-14). A second alignment of the NS5 region identified five nucleotide changes and four amino acid differences for FLWN05a (Appendix V). Evaluation of FLWN05b No unique nucleotide substitutions were noted in the capsid/prM region [Table 414]. The adenine (position 459) and cytosi ne (position 483) were conserved, as has previously been noted for position 483 in North Ameri can strains of WNV (NY99) [Estrada-Franco et al 2003; Beasley et al 2004]. A second multiple sequence alignment supported these findings (Appendix W). The C T transition mutation (synonymous) at position 624 was shared in Florida st rains collected in 2001, 2002, 2005 and 2006, but not in 2003. The thymine at this position is also found in Old World strains of the virus. Three nucleotide substitutions were noted in the NS5 region, resulting in two amino acid changes to the predicted protein sequence on the first alignment (Table 4-14). A second alignment of the NS5 region iden tified a single nucleotide change and one amino acid difference for FLWN05b (Appendix V).

PAGE 433

408 Evaluation of FLM38 Genotype WNV strain FLM38 was collected in 2005 from a sentinel chicken in Manatee County, Florida. In the capsid/prM region, a si ngle nucleotide substitution was noted. The non-conserved C T transition mutation (synonymous) at position 483 did not result in a predicted change to the amino acid sequence [Table 4-15]. The second multiple sequence alignment of this region identified the same substitution, as well as identified substitutions at positions 459 and 624 that were shared by Old World Strains of the virus (Appendix W). Three synonymous nucleotide substitutions were noted in the NS5 region that were shared by FLM38, FLS502 and FLS504, as well as Egypt101, on the first (Table 415) and second (Appendix V) alignments. Phenotype As previously noted for WNV strains, FLM38 quickly adapted to Vero cell culture following the init ial culture of the processed cloa cal swab diluent (3 PFU/0.1ml). The first passage of FLM38 exhibited a weak e quivocal (+/-) cytopathic effect three DPI. This weak positive result was likely due to the low titer of virus present on the swab. Consequently, the second passage of the virus replicated much faster and produced stronger cpe (2+) after three DPI (Table 4-18). FLM38 produced medium sized plaques five DPI that were not as large as NY99 (F igure 4-24) or the WNV strains isolated from sentinel chickens in 2006 (Figure 4-53).

PAGE 434

409 Evaluation of FLS502 Genotype WNV strain FLS502 was collected in 2006 from a sentinel chicken in Sarasota County, Florida. In the capsid/prM region, a si ngle nucleotide substitution was noted. The non-conserved C T transition mutation (synonymous) at position 483 did not result in a predicted change to the amino acid sequence [Table 4-15]. The second multiple sequence alignment of this region identified the same substitution, as well as identified substitutions at positions 459 and 624 that were shared by Old World Strains of the virus (Appendix W). Three synonymous nucleotide substitutions were noted in the NS5 region that were shared by FLM38, FLS502 and FLS504, as well as Egypt101, on the first (Table 415) and second (Appendix V) alignments. Phenotype FLS502 also quickly adapted to Vero cell culture following the initial passage of the processed cloacal swab diluent (816 PFU/0.1ml). The firs t passage exhibited a strong positive (2+) cytopathic effect at four DPI. The second passage of the virus also produced the same cpe (2+) after three DPI (Table 4-18). FLS502 produced large plaques, with diffuse borders after an incubation period of five DPI (Figure 4-53). Evaluation of FLS504 Genotype WNV strain FLS504 was collected in 2006 from another sentinel chicken in Sarasota County, Florida. In the capsid/pr M region, a single nucleotide substitution was noted. The non-conserved C T transition mutation (synonymous) at position 483 did

PAGE 435

410 not result in a predicted change to the am ino acid sequence [Table 4-15]. The second multiple sequence alignment of this region id entified the same substitution, as well as identified that substitutions at positions 459 and 624 were shared by Old World Strains of the virus (Appendix W). Three synonymous nucleotide substitutions were noted in the NS5 region that were shared by FLM38, FLS502 and FLS504, as well as Egypt101, on the first (Table 415) and second (Appendix V) alignments. Phenotype FLS504 also quickly adapted to Vero cell culture following the initial passage of the processed cloacal swab diluent (32 PFU/0.1ml). Th e first passage of FLS504 exhibited a weak equivocal (+/-) cytopathic effect four DPI. This weak positive result was likely due to the low titer of virus present on the swab. Consequently, the second passage of the virus replicated much faster and produced stronger cpe (1+) after three DPI (Table 4-18). FLS504 produced large pl aques five DPI. These plaques were characterized by the halo appearance en circling each plaque (Figure 4-53). Evaluation of FLS545 Genotype WNV strain FLS545 was collected in 2006 from a sentinel chicken in Sarasota County, Florida (FLS502 also isolated from th is bird). In the capsid/prM region, three nucleotide substitutions were noted, in contra st to the other WNV strains isolated from chickens. The non-conserved C T transition mutation (s ynonymous) at position 483 did not result in a predicted change to th e amino acid sequence. Two additional mutations were noted at position 237 (transversion mu tation) and position 591 (transition mutation)

PAGE 436

411 [Table 4-15]. The transversion mutation at pos ition 237 altered the predicted amino acid sequence, with the substitution of vali ne (instead of leucine). The synonymous substitution at 591 also matched Old World strains of West Nile virus. The second multiple sequence alignment of this region iden tified the same substitutions, as well as identified that substitutions at positions 459 and 624 were also shared by Old World Strains of the virus (Appendix W). One nucleotide insertion was noted in the NS5 region, resulting in one amino acid inserted into the predicted pr otein sequence on the first alig nment. In addition, one other shared mutation was identified for FLWN05b that matched FLM38, FLS502, and FLS504 (Table 4-15). A second alignment of the NS5 region identified three shared nucleotide substitutions that matched Egypt101 and not NY99 strains of the virus. In addition, one amino acid was inserted into the predicted protein sequence for FLS545 (Appendix V). It should be noted that the only other conserved mutation identified for North American isolates (that was also in regi ons of the genome sequenced by this study) collected during 2002-2005 was position 9352 (thy mine) that was the same as Egypt101, instead of the NY99 strain of West Nile virus. (Grinev et al 2008). Phenotype FLS545 also quickly adapted to Vero cell culture following the initial passage of the processed cloacal swab diluent (36 PFU/0.1ml). Th e first passage of FLS545 exhibited a weak equivocal (+/-) cytopathic effect four DPI. This weak positive result was likely due to the low titer of virus present on the swab. Consequently, the second passage of the virus replicated much faster and produced stronger cpe (3+) after three

PAGE 437

412 DPI (Table 4-18). FLS545 also formed large plaques five DPI, with distinct borders (Figure 4-53). Molecular Epidemiology Analysis Molecular epidemiology has been defined as a science that investigates the contribution of potential genetic and environm ental risk factors, identified at the molecular level, to the etio logy, distribution and preventi on of disease (Dorman, 1998). For arboviruses, widespread use of molecular epidemiology principles have been applied in the study of global dengue virus infections (Aquino et al 2006; Aaskov et al 2007; Tung et al 2008), including molecular id entification of the country of origin for travelimported cases (Ito et al 2007). The emergence of WNV in North America has prompted extensive molecular epidemiology studies on flaviviruses in the continental United States, as these techniques have also been useful in tracing the geographic and temporal spread of the virus (Davis et al 2003; Estrada-Franco et al 2003; Ebel et al 2004). Consequently, these studies have become highly effective in efforts to discover the etiology of novel agents and identify the di stribution of disease and trace its movement, not only in the United States but across nationa l borders. As these techniques approach real-time monitoring of diseas e trends, molecular epidemiolo gy studies may be used to limit or prevent outbreaks of disease and can improve public health, as globalization creates one global community. The utility of molecular epidemiology studi es to identification of the geographic movement of St. Louis encephalitis virus in Florida has also been demonstrated by this study. The introduction of South American strain s into the continental United States has previously been suggested by phylogenetic analysis of SLEV strains from North and

PAGE 438

413 South America (Kramer and Chandler, 2001). Ho wever, the isolation of South American SLEV strains in North America has not been reported, despite the distribution of SLEV throughout the Americas. In particular, all Sout h American strains of the virus have been isolated south of the border. Conversely, a strain isolated in Guatemala in 1969 is currently the only successful isolation of a No rth American SLEV strain outside of the continental US (except Canada); although this virus has been identified as a recombinant strain (Tennessee-Guatemala) in the enve lope region [Twiddy and Holmes, 2003], which may be a spurious result as the sequence wa s recently removed from GenBank (personal communication, L. Kramer). From 1963 to 1970, investigators at the Ep idemiology Research Center in Tampa performed extensive field studies in the stat e and collected nearly 700 arbovirus strains. During that time period, SLEV was isolated four times, only in 1969. The authors concluded that SLEV was an exotic agent th at must be introduced to Florida (Wellings, Lewis and Pierce, 1972). More than thirty five years later, the results of this molecular epidemiology study has finally provided na tural biologic evidence that SLEV is reintroduced periodi cally from South America. P hylogenetic analysis of the membrane/envelope, complete envelope, and NS 5 regions of the viral genome identified the recent introduction of SLEV from South America (B razil) into Sarasota County during 2006, as well as a historical introduction of a di fferent Brazilian st rain collected in Escambia County in 1972. An extensive phylogenetic an alysis of SLEV was performed in 2001 by Kramer and Chandler. The authors sequenced the co mplete envelope region of 62 SLEV strains and proposed seven lineages based on homol ogous sequence identity between strains and

PAGE 439

414 their geographic origin. North American stra ins of SLEV were grouped into Lineages I and II, whereas South American strains were separated into Lineages III through VII. Florida isolates clustered into Lineage II, A, B, C and D clades. However, three South American strains were also grouped into Lin eage A and D clades, including a strain from Brazil, Mexico, and Panama (Kramer and Chandler, 2001). Based on these results, it can be inferred that Florida strain s of the virus share homology to strains isolated throughout eastern and central states, wh ere the strains may be transp orted by migratory birds. In addition, SA strains from three different countri es have likely circulated in Florida during the last century. Phylogenetic analysis of the complete e nvelope (see Figures 5-3 and 5-4) and a portion of the NS5 (Figure 5-5, second alignment tree) region s have identified that two strains of SLEV isolated duri ng an interepidemic year of tr ansmission in Florida share the highest homology to the Mexico (65V310) strain. The relations hip of a Panama (PanAn902604) strain is also shown to these st rains in the Lineage II (D) clade for the envelope region (complete coding sequence not available). Alt hough bootstrap support for these branches is not hi gh, the known transmission of Br azilian strains in Florida provides potential evidence for their accuracy. Another potential use of molecular epidem iology analysis is the prediction or forecasting of epidemics based on patterns encoded in the nucleotide or amino acid sequences of microbes. In Florida, several epidemics of SLEV ha ve occurred since its first recognition in a Miami resident in 1952 (Sanders et al 1953). More recently, the last large outbreak of SLEV in the state happened in 1990-1991, with 223 laboratory confirmed cases, which also impacted tourism and Floridas economy (Meehan et al

PAGE 440

415 2000). Consequently, knowledge of the curren t circulating arbovirus strains could assist public health and vector control agencies implement prevention strategies based on surveillance for agents that have caused out breaks in the past, epidemic strains. In this study, four strains isolat ed during 1989-1990 were sequenced to characterize a potential epide mic profile for SLEV strain s in Florida. The earlier phylogenetic study by Kramer and Chandler (2001) did not id entify a pattern associated with epidemic SLEV strains or particular host specific differences. However, these 19891990 strains were not included in the 2001 study, so they were invest igated with other Florida strains to evaluate if a pattern c ould be detected. With the exception of TBH-28, FL89, and FL90a-d, all other Florida strains an alyzed in this study were not collected during epizootic/epidemic transmission of SLEV. Although no consensus could be drawn from the 1962 (TBH-28) or 1989/1990 strains, pa tterns were noted that may be used as potential epidemic indicators in Florida. Tw o strains (TBH-28, Pinellas15) isolated in 1962 from an epidemic in the Tampa Bay ar ea were found to exhibit a characteristic paired pattern in the complete envelope region (15 nucleotide s ubstitutions) [Appendix T]. Some of these positions were shared by other North and/or South American strains of SLEV; however, no other strain included in this analysis characteristically shared more than three of the same substitutions in the complete envelope coding sequence. For the most recent widespread epidemic of SLEV in Florida, a pattern emerged for the five analyzed strains where nucleoti de bases were identical and shared for each strain. Twenty bases were shared for FL 89, FL90a-d in the complete envelope coding region of SLEV [Appendix T] that were unique from the majority of strains included for multiple sequence alignment. Unlike the re latively unique pattern observed for the 1962

PAGE 441

416 strains, most of these epidemic mutations were shared by four additional strains analyzed from Tennessee (TNM4-711K) and Texas (83V4953, 98V3181, and PVI-2419). Four or more human cases of SLEV were re ported in the same year or in the year preceding the epidemic (as shown for FL89) from Tennessee and Texas [CDC, 2007 l ]. Notably, these mutations were rarely shared by South American strain s of the virus (less than three nucleotides per any SA strain). Caution should be used when applying th ese criteria in real-world practice. As new SLEV sequences are uploaded to GenBa nk, the alignment should be repeated to verify that these nucleotide substitutions truly reflect epidemic/epizootic transmission. Kuno and Change (2005) proposed that the enve lope region is under se lective pressure to evolve since that may allow for the vi rus to avoid the host immune response. Consequently, new strains with additional divers ity (mutations) could arise in Florida that do not share these twenty nucleotide substitu tions and may still result in an outbreak. Due to the relatively tight constraints placed on arbovirus evolution (S cott and Weaver, 1989; Weaver et al 1992; Weaver et al 1997; Gould et al 2003; Kuno and Chang, 2005), this may not rapidly occur as the virus must stil l be able to replicate in both the arthropod vector and vertebrate amplifying host. Of course, additional recombination events may suddenly arise, producing an altered genotype. Interestingly, a study on vesicular stom atitis virus (VSV) [negative-sense RNA virus] found that rapid evoluti on in RNA viruses was possible, as evidenced by an isolate with a significant number of nucleotide muta tions (n=221 nt) collected 26 years prior to another strain (n=23 nt) w ith a common ancestor (Nichol et al 1993). VSV is an important animal pathogen and surveillance pr ograms for the disease had collected these

PAGE 442

417 strains from cattle in Alabama and Costa Ri ca, respectively. Conse quently, the authors concluded that quasispecies of the virus could become established in a region (tropics, Panama or Costa Rica in this case), wh ere the most fit virus quasispecies could predominate and undergo rapid evolution. In ad dition, vector-borne transmission of this virus may also have increased genetic diversity in the strain as the virus adapted to the insect vector and was then transported to the temperate zone (U nited States) [Nichol et al 1993]. This theory was hypothesized as a potential mechanism to explain the sudden appearance of a new genotype of S LEV in California around 1972 (Kramer et al 1997). From 1933 through 1972, SLEV strains appeared to be variants of the same genotype by parsimony analysis. In 1972, the virus either en tered a period of rapid evolution or a new strain of SLEV (not South American in or igin) was introduced into the Sacramento area and the earlier strains died out. The role of migratory birds was also evaluated and avian species banded in California were observed to travel in the Mississippi and Pacific flyways and migrate to Gulf States and Mexico in the winter, which may have introduced the new virus variant from other states (Kramer et al 1997). As shown in our Florida study, a combinat ion of these possibilities (quasispecies development through mutation vs. importation of a new strain and hybridization) could explain the introduction of South American strains of SLEV in 1972 and 2006, as well as a potential rapid evolution of the FL85 strains into the epidemic/epizootic strains isolated 4 years later (FL89, FL90a-d). However, th ese Florida SLEV strains are markedly different from each other and cluster in diffe rent clades (Figures 5-3, 5-4, 5-5). It is unknown what impact South American stra ins of SLEV have on North American

PAGE 443

418 genotypes of the virus in Florida, where severa l SA strains cluster genetically with North American isolates. In addition, novel flaviviruses were isolated from the same site as one South American strain of SLEV (FLS 650) in 2006, but the portion of the flavivirus genome that amplified was not South Ameri can in origin. Instead, it shared 98% sequence homology to the 1962 genotype of is olates in the Tampa Bay region. Future studies are needed to investigate this relationship. The emergence of a new genotype of WN V in 2002 was first detected in Texas and has now become the dominant genotype of the virus in North America. Several factors allowed this genotype to rapidly sp read, including viral mu tations and apparent increased fitness for replication in mosquito es over the NY99 strain. A combination of these factors allowed the WN02 strain to rapidl y spread across the United States in 20022003, with record WNV human case numbers. As a result, the earlier NY99 strain of WNV appeared to die out or was out -competed by the new variant (Davis et al 2004 & 2005; Kilpatrick et al 2006; Snappin et al 2007). Several nucleotide mutations have been identified and become fixed in the North American clade of WNV strains is olated from 2002-2004 (not e: Florida strains from 2001 and 2002 have been placed in the Eastern States clade) [Davis et al 2005]. A few WNV reference strains collected in Florida from 2001, 2002, and 2005 were studied in this project. One conser ved mutation at position 9352 (C T) in the NS5 region was first detected in the Florid a strains isolated during 2005 and 2006, which had reverted to the nucleotide shared by the Old World strain s of the virus. This had previously been reported for other WNV stra ins earlier in 2002 (Davis et al 2005; Grinev et al 2008). However, one complete coding genome sequen ce of WNV strain (03113FL) collected in

PAGE 444

419 Florida from 2003 also had the mutation, so th is variant position may have become fixed in Florida strains starting in 2003 (Appendix V) Several mutations noted for individual strains studied here may not become fixe d in the WNV population, but may represent quasispecies of the dominant virus population in Florida. Additional Florida WNV strains should be sequenced to continue to study th e accumulation of mutations and evolution of the virus in the state, as routinely pe rformed in Texas and New York (Davis et al 2003, 2004 & 2005; Ebel et al 2004). Previous studies on SLEV strains assessed virulence characteristics in isolates collected from different geographic locations through 1977 (Trent et al 1980 & 1981; Monath et al 1980; Bowen et al 1980, 1981). Strains were placed into three categories: high, intermediate and low virulence based on neuroinvasiveness of the disease in mice and monkeys (Trent et al 1980; Monath et al 1980). 90% of North American epidemic strains were highly virulent (including Florida strains is olated in 1962, 1977, which were not studied as part of this proj ect), as compared to interepide mic years that resulted in an attenuated (low virulence) phenotype. Low virulence phenotypes were noted for two SLEV strains collected in Polk C ounty, Florida in 1969 (Table 5-8). Molecular epidemiology analysis of the th ree SLEV isolates collected in Florida placed these strains in South American lineage s. Consequently, it is hypothesized that the potential virulence of these recent Florida strains may be similar to the estimated virulence for closely related South American is olates that have previously been examined in a mouse model (Monath et al 1980). Unlike the majority of isolates studied from the United States, South American strains were c onsidered endemic (or enzootic) since they were either associated with sporadic human cases or were obtained in absence of human

PAGE 445

420 clinical illness during field studies. Despite low levels or absent human cases in South America, 52% of SA strains were highly virulent (n=12) whereas 48% were completely or partially attenuated in mice (n=11) [Monath et al 1980]. Phylogenetic analysis of FLS569 and FLS650 place these strains in Lineage VA, with closest homology to BeAn242587, a high virulence phenotype. In Lineage VA, only TR9464 was of intermediate virulence, but it was placed in a sister cluster. In contrast, FL72 was placed in Lineage VB, with closest homology to BeAn246262, also a high virulence phenotype. However, other strains in the cluster had low or intermediate virulence characteristics in mice (Monath et al 1980). FLS569 and FLS650 had the highest nucleotide sequence homology to Brazilian and one Peruvian strain that demonstrated high virulence in animal models. FL72 also had the highest homology to a strain colle cted in the same year (1972) from the same host species (opossum) in Brazil. BeAn246262 also was categorized with high virulence in a mouse model (Monath et al 1980). However, two other strains in Lineage VB were more attenuated, with low and intermediate virulence, than those grouped into Lineage VA. Although these virulence characteristics ma y not directly relate to epidemics of SLEV and/or pathogenicity of the strain for humans (Kramer et al 1997), it is important to note that virulent South American stra ins may have been introduced to Florida. Virulence characteristics for these strains s hould be assessed with animal models to confirm this hypothesis. Epidemics of SLEV are uncommon in South America (Sabattini et al 1985; Spinsanti et al 2003; Rocco et al 2005), where high seroprev alence rates to dengue (and other endemic flaviviruses that circulate in South Ameri ca) may provide cr oss-protective

PAGE 446

421 immunity to the population from high virulence SLEV strains. Recently, cross-reactive antibodies to dengue virus in amplifying and dead-end hosts have been proposed to explain the apparent attenuatio n/absence of severe WNV disease in humans, as well as several other circulating flaviv iruses with avian-mosquito cycles that provided protective immunity for the primary amplifying host (b irds) in Central and South America (Gubler, 2007). Likely, the same scenario limits outbreak s and epizootic amplification of SLEV. Several flaviviruses circulate in South America, which can significantly impact disease diagnosis. Two outbreaks of SLEV we re recorded in Argentina and Brazil in 2005 (47 confirmed human cases, nine fataliti es) and 2006 (six confirmed human cases), respectively (Diaz et al 2006; Rocco et al 2005; Mondini et al 2007a). Molecular epidemiology analysis on the envelope region (Diaz et al 2006) and a small portion of the NS5 region (Mondini et al 2007a) identified that the outb reaks were related. SLEV strains isolated from both epidemics shared nucleotide sequence homology to Argentinean strains of the virus, placing them in Lineage III (Figure 5-4). Despite initial misdiagnosis as dengue infections, the six pa tients in Brazil were later confirmed SLEV positive after dengue and yellow fever etiologies were ruled out. Notably, three of these cases had clinical symptoms of hemorrhagic disease, which is the first time that hemorrhagic signs have been linked to SLEV in fections. Yet, dengue virus is endemic in the region and previous infections with de ngue may confound this association (Mondini et al 2007a). A recent report from Brazil identified one patient that was co-infected with St. Louis encephalitis and dengue type 3 viruses, which did not result in severe disease (Mondini et al 2007b).

PAGE 447

422 Recent outbreaks of SLEV in tropical regions have raised concerns that the mild illness typically associated with the virus in South America may have become more severe. The potential introducti on (or reintroduction) of these SA strains to the United States should be carefully monitored, wher e the potential attenuation of virulence from cross-protective dengue antibod ies in South America may no t protect an immunologically nave population in the US from disease. In conclusion, St. Louis encephalitis viru s strains collected in Florida during 1972 and 2006 were identified as South American in origin; molecular epidemiology and phylogenetic analysis of the envelope region cl assified these strain s into Lineages VA and VB, as proposed by Kramer and Cha ndler (2001). These strains, FLS569 and FLS650, may be highly virulent, as found in animal models for other SLEV strains that are grouped into the same lineages (Monath et al 1980). Phylogenetic analysis is an important surveillance tool for the study of arboviruses, where avian amplifying hosts can travel long distances and transpor t exotic agents, such as st rains of SLEV or West Nile virus into (or out of) the United States (Wellings, Lewis, and Pierce, 1972; Gubler, 2007). Discovery of a Novel Arbovirus In 2006, targeted sampling of sentinel chicken flocks located at Site 004 in Sarasota County resulted in th e detection, of St. Louis encep halitis virus and West Nile virus from a single confirmed SLE antibody positive bird. This finding was unexpected because confirmed WNV transmission activity (seroconversions) had not been detected in sentinel chicken flocks in Sarasota C ounty since April 2006, six months earlier. An experimental MIA test identified WN activity at Site 003 in June, which indicated that

PAGE 448

423 the virus was likely still circulating in th e rural, wild bird-m osquito populations. Beginning October 9 and over the next nine days, cloacal swab s were collected from this sentinel chicken three times; virus was is olated from each swab (WNV on the first two specimens and SLEV on the third). Interestin gly, West Nile antibodi es were not detected in any of the birds located at Site 004. The county mosquito control district was contacted to verify submitted paperwork and accuracy of sample collection on those date s. It was concluded that samples were not switched in the field (e.g. with other SLE pos itive chickens). Targeted sample collection at the second positive location (Site 001) did not begin until five days later on October 23, following reported HAI results on October 20 (see Figure 4-20). CDC light traps baited with CO2 were also operated for three hours every other night at Site 001 from August through November. Mosquito collecti on results made at Site 004 during the months when sentinel seroc onversions were detected i llustrates the importance of Culex nigripalpus to the transmission cycle of SLEV (Figure 5-6) [unpublished data, W. Brennan (Sarasota County Mos quito Control District)]. Ground and aerial spraying are routinely triggered by an increase in pest mosquitoes ( Psorophora sp. ) or when Culex sp. numbers reached over 3000. Due to the low mosquito numbers collected each week in September and October, ground and aerial spraying was only initiated on September 15 ne ar Site 004. Once sentinels seroconverted in October, larvaciding efforts were intens ified and neighboring w oodlots were treated by hand application of insec ticide [personal communicat ion, W. Brennan (SCMCD)]. Culex nigripalpus was the primary mosquito vector collected, although Culex melanoconion

PAGE 449

424 Figure 5-6 Mosquito Surveillance Results Conducte d at Site 004 (Sarasota County, 2006) In 2006, Sarasota County Mosquito Control District trapped mosquitoes located at Site 004 every other day, using CDC light traps baited with CO2 and operated for three hours. The date ground and aerial pesticide treatment was decided (blue) and dates of chicken sera coll ection (green) indicates the time that a bird first developed SLE+ antibodies. Culex nigripalpus was the mosquito species predominatel y trapped during this time period, although Cx. melanoconion was also collected in low levels. 2021 1267 344 107 1390 1386 2175 908 0 400 800 1200 1600 2000 2400 28009/4-9/109/119/179/189/249/25-10/110/2-10/810/9-10/1510/16-10/2210/23-10/29Week# Mosquitoes Aedes Anopheles Culex Ochlerotatus Psorophora Site 004 Mosquito Collections & Seroconversion Dates, Sarasota County (September-October 2006) Spray 9/15 SLE + Bird 10/4 SLE + Bird 10/9

PAGE 450

425 was also detected in mosquito traps (less th an 40 collected in a si ngle night preceding and at time of sentinel seroc onversions) throughout September a nd October. At Site 004, West Nile virus was collect ed on October 9 and October 16, whereas St. Louis encephalitis virus was isolated on October 18. However, retrospective processing of these samples was performed in November once the seroconversion was confirmed SLE positive. Targeted sample collection at Site 001 was initiated by the county on October 23 following a second SLE+ sentinel seroconversion in the HAI assay. The BOL-Tampa performed molecular de tection, cell culture, and serology assays on samples collected from Site 004 for the next several months to investigate the dually infected sentinel chicken. Complete genome sequencing of FLS545 and FLS569 was performed to investigate if these strain s of the virus had recombined. However, recombination was not detected. During this time period, samples were also processed from each site targeted by Sarasota County where a seroconversion had been detected. The first evidence for the cross-reaction of W NV and SLEV by real-time (T aqMan) RT-PCR was noted for FLS853 (the first novel flavivirus detected) at Site 001. The test was repeated following a second RNA extraction and RT-PCR assay, with the same results. However, this sample did not replicate in culture and was not further investigated. Additional specimens collected at this time were examined retrospectively. Consequently, samples collected from the seco nd SLE+ at site (001) were only extracted several months later, afte r the sentinel chicken program in Sarasota County had discontinued for the winter months. Cloacal swabs were processed, extracted and tested by molecular assay prior to inoculation in cell culture. Three addi tional arbovirus strains

PAGE 451

426 were detected on swabs collected at S ite 001: FLS650 (SLEV+), FLS649 and FLS694 (novel flavivirus +). Sarasota County Mosquito Control District has provided the results of mosquito collections that were made at Site 001 in the months that sentinel seroconversions occurred (Figure 5-7) [unpublished data, W. Brennan (SCMCD)]. November data is not shown, but low numbers of Culex nigripalpus were reported trapped every other day Collections from November 29 included 151 Culex sp. but every other collection in November had 50 or less. In addition, the di stance between the locations of Site 001 and Site 004 is 12 Km (7.5 miles). It has been well-established that Culex nigripalpus is the primary epidemic and enzootic mosquito vector for SLEV and WNV in Florida (Burke and Monath, 2001; Reisen, 2003; Stark and Kazanis, 2001-2005). Evaluation of FLS649 Genotype FLS649 was detected by real-time RT-PCR for SLEV (screened and confirmed), but it was a weak pos itive with high CT values (38.37 on screening). This cloacal swab was also screened with the WNA TaqMan prim er-probe set, but was not detected (unlike FLS853). However, the gel-based primer s for the membrane/envelope (SLEC) and capsid/prM (WNAE) regions amplified RNA from this strain. Gel-electrophoresis of the PCR products identified a multiple banding pattern for FLS649 (Figure 4-33). Strain identity was confirmed by sequencing. FL S649 shared 97% homology with Tampa Bay strains of SLEV (TBH-28 and GHA-3) in the membrane/envelope region. Sequencing of the capsid/prM region identified that FLS649 shared 98% sequence identity with Old World strains of WNV, although several am ino acids were missing in the multiple

PAGE 452

427 Figure 5-7 Mosquito Surveillance Results Conducte d at Site 001 (Sarasota County, 2006) In 2006, Sarasota County Mosquito Control District trapped mosquitoes located at Site 001 every other day, with CDC light traps baited with CO2 and operated for 3 hours. The dates ground and aerial pesticide treatment was decided (blue) and dates of chicken sera collection (green) indicates the time that a bi rd first developed SLE+ antibodies. Culex nigripalpus was the mosquito species predominatel y trapped during this time period, although Cx. melanoconion was also collected in low levels. 65413 1025 1100 1817 269 151 125 3 12 7 3110 215 189 175 42 43 526618 42637 130 812 592 1210 400 800 1200 1600 2000 2400 28009/49/109/119/179/189/249/25-10/110/2-10/810/9-10/1510/16-10/2210/23-10/29Week# Mosquitoes Aedes Anopheles Culex Ochlerotatus Psorophora Site 001 Mosquito Collections & Seroconversion Dates, Sarasota County (September-October 2006) Spray 9/20 SLE+ Bird 9/25 SLE + Bird 10/16 Spray 9/27 SLE + Bird 10/23

PAGE 453

428 sequence alignment due to inconclusive base calls between the sense and anti-sense sequences for some nucleotide positions (Appendix L, Table 4-16). Confirmation of this homology to Old Worl d strains was not possible, as RT-PCR with the WNBE primer set (3 NS5 region) generated an amplicon, but sequencing failed (Figure 4-36, Table 4-16). In addition, RT -PCR assays targeting the SLEV envelope, flavivirus NS5, and flavivirus 3non-coding regions did not produce amplicons. Consequently, results indicate that this st rain has homology to SLEV and WNV in one region each, but the fragments do not overlap and are less than 400 ba se pairs in size (7% of the genome collectively). Complete genome sequencing was attempted on this strain, but the primer sets [Ciota et al 2007c] used were designed to amplify large portions of the genome (overlapping fragments ~1.5kb in size) and non-specific amplicons of smaller sizes resulted. Additional studies ar e needed to resolve these findings. The first multiple sequence alignment identified six unique nucleotide and five predicted amino acid differences in the me mbrane/envelope region (SLEC) (Table 4-16, Appendix O). However, a second analysis of this region with a la rger sample size of SLEV strains identified five unique nucleo tide mutations (non-synonymous) that resulted in five amino acid changes to the predicte d protein sequence (Appendix U). In contrast, the first and second alignments identified te n conserved nucleotides that matched the Old World strains of West N ile virus in the capsid/pr M region (Appendix L and W, respectively). Phenotype Similar to FLS853, these extracted novel flavivirus samples (FLS649) also did not replicate in cell culture or produce detectable cytopathic effect afte r two passages (Table

PAGE 454

429 4-18). As a result, FLS649 did not produce plaques in assays with two different incubation periods (three DPI and seve n DPI) before media-agarose overlays (supplemented with neutral red) were added and plaques counted, if present. In addition, FLS649 was inoculated into human pulmonary endothelial cells (HPMEC), an in vitro system that collaborators with the BOLTampa have developed to study cytokine production following dengue virus infection (Azizan et al 2006). However, cytopathic effect was not observed in this system (dat a not shown). Real-time RT-PCR assays also did not detect replicat ion of the virus during a 14 day tim e course experiment in this cell line. Additional in vivo (mouse) and in vitro (mosquito and avian cell lines) studies are planned to evaluate the phenotype of this vi rus and to assess its ability to replicate. Evaluation of FLS694 Genotype FLS694 was detected by real-time RT-PCR for SLEV (screened and confirmed), but it was a weak pos itive with high CT values (36.20 on screening). This cloacal swab was also screened with the WNA TaqMan prim er-probe set, but was not detected (unlike FLS853). However, cell culture supernatant fr om the first passage of this strain was extracted and tested by real-time RT-PCR and was positive with the WNA and WNB TaqMan primer sets. In addition, the gel-based primers for the membrane/envelope (SLEC) and the capsid/prM (WNAE) regions were amplified for this strain. FLS694 produced a double band at the expected size w ith the SLEC primer set (Figure 4-33) and a single band with the WNAE primer se t (Figure 4-36). The PCR products were extracted, purified and sequenced as described above for FLS649.

PAGE 455

430 BLASTN search results on the membra ne/envelope sequence identified 98% homology with strains from Tampa Bay (TBH-28 and GHA-3), as well as a Guatemala strain (78 A 28). St. Louis encephalitis viru s strains from Mexico strain (65 V 310) and Missouri (Parton) were also matched to the FLS694 query sequence at 97% identity (Appendix K). As shown for FLS649, the capsid/ prM region identified that FLS694 also shared 99% sequence identity with Old World strains of WNV (Appendix L, Table 4-16). In addition, the FLS694 viral genome did not amplify with the complete envelope primer set, the larger NS5 primer set (Fu1/cf d3) or the 3NC primer set (YF1/2) [Figures 4-34 and 4-35], as previously shown for FLS649. However, the RT-PCR product targeting the carboxy terminus of the NS5 ge ne did sequence for FLS694 (Figure 4-48). These WNBE primers targeted a small, inte rnal region of the larger NS5 fragment (300 bp). BLASTN search results found 100% se quence identity to Oklahoma (OKO3), New York (385-99, 3356K VP2), and Florida (FL 03-FL2-3) strains of WNV. 100% sequence identity was also found for a California WNV strain cultured from a blood donor [Appendix K]. The discrepancy between the BLASTN results for this region (homology to North American strains) compared to th e capsid/prM region (homology to Old World strains) will be analyzed in future studie s. Complete genome sequencing was attempted to resolve this contradicti on, but the primer sets failed to produce amplicons of the correct size, as described above for FLS649. Multiple sequence alignment was performed on the sequenced PCR product that targeted the M/E region. Analysis of the membrane/envelope alignment identified a single nucleotide mutation that resulted in one predicted amino acid substitution (Table 416). A second alignment of this region found no unique differences since the nucleotide

PAGE 456

431 substitution at position 834 matched South American strain s of SLEV (including FLS569 and FLS650). As a result, no unique amino acid substitutions were predicted. Finally, the alignment of the carboxy NS5 region (WNB E) found no unique differences in either the nucleotide or predicted amino acid se quence, with closest homology to North American strains of WNV. Phenotype As found for FLS649 and FLS853, this extracted novel flavivirus sample (FLS694) did not replicate in cell culture or produce detectable cytopathic effect after two passages (Table 4-18). As a result, FLS694 did not produce plaques in assays with two different incubation peri ods (three DPI and seven DPI) before media-agarose overlays (supplemented with neutral red) were added and plaques counted, if present. In addition, FLS649 was also inoculated into hum an pulmonary endothelial cells (HPMEC), a second mammalian in vitro system. Cytopathic effect was not observed in this system (data not shown). Real-time RT-P CR assays also did not detect replication of the virus during a 14 day time course experiment in this cell line. Additional in vivo (mouse) and in vitro (mosquito and avian cell lines) studies are planned to evaluate the phenotype of this virus and to assess it s ability to replicate. In summary, the genotypes of FLS649 and FLS694 were unusual. These strains were identified as SLEV+ by TaqMan RT-P CR with SLEV primers, but FLS694 also exhibited cross-reactivity with WNV primers in this real-time nucleic acid amplification assay. Despite these results, FLS649 and FL S694 did not produce an amplicon for the SLEV complete (or partial) envelope region in gel-based RT-PCR assays. The only SLEV-specific region that was detected and sequenced was the partial

PAGE 457

432 membrane/envelope (SLEC), but these viruse s produced amplicon ba nding patterns that differed from that of the control viruses. After sequencing, phylogene tic analysis did not group these strains with each ot her. In fact, all other North American strains of SLEV shared FLS694 as a common ancestor. However, bootstrap values we re low indicating that these branches may not be accurately drawn, as shown in the maximum parsimony method, with additional reference strains (Fig ure 5-8). In contrast, the UPGMA method resulted in more robust bootstrap support (F igure 5-9) although FLS694 grouped close to two other North American strains (FL 79-411 and Kern217). These results suggest that the novel flavivirus strains were quasispecies of a viru s that was transmitted to sentinel chickens from the mosquito-wild bird cycle (quasispecies have b een identified for WNV in naturally infected mosquitoes, Jerzak et al 2005), or that may have developed in the chicken following infection with prototype of the virus. Specific primer sets for the detection of West Nile virus were also used to characterize these strains based on real-time RT-PCR results. Both strains produced a single amplicon size for the capsid/prM regi on of WNV. In contrast to the SLEV membrane/envelope region, sequencing result s and phylogenetic anal ysis grouped these strains together in the maximum parsimony method, as shown with additional reference strains (Figure 5-10). In addition, only FLS 694 was successfully sequenced in the 3 terminal region of the NS5 gene, which indi cated that the virus shared homology with North American WNV strains (Figure 4-48). Unlike neutralized plaque variant clones (picked for FLS502, FLS545 and FLS569) that were cross-reactive in the Ta qMan assays, these strains did not amplify with several gel-based primer sets that were pr eviously able to confir m identifty of cross-

PAGE 458

433 Figure 5-8 Phylogenetic Relationships of SLEV & Flaviviruses (Partial Membrane/Envelope Region), Second Alignment Phylogram of the partial membrane /envelope region (bases 728-112) was inferred using the maximum parsim ony method in MEGA4.0.1, where the consensus tree (1000 bootstrap repli cates) was chosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base change s in the entire sequence. Bootstrap values are shown on branches. FL52 TBH-28 FL85a FLS649 65V310c FL79-411c Kern217 GHA-3c TNM4-711Kc Partonc MSI-7c FLS694 GML902612c FLS569 FLS650 75D90c TRVL9464c BR69 BeAn246262c FL72 TR62 WNNY99 WNEgypt 95 86 86 80 33 19 27 68 42 44 41 33 30 51 99 10

PAGE 459

434 Figure 5-9 Phylogenetic Relationships of SLEV & Flavivirus Strains (Partial Membrane/Envelope Region), UPGMA Second Alignment Phylogram of the partial membrane /envelope region (bases 728-112) was inferred using the unweighted-paire d group means arithmetic (UPGMA) method in MEGA4.0.1, where the consensus tree (1000 bootstrap replicates) was chosen. UPGMA me thod produced a rooted tree and assumed a constant rate of evolution. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base changes per site (maximum compos ite likelihood method). Bootstrap values are shown on branches. FL52 TBH-28 FL85a 65V310c GHA-3c FLS694 Partonc MSI-7c TNM4-711Kc FL79-411c Kern217 FLS649 FLS569 FLS650 75D90c BeAn246262c TRVL9464c BR69 FL72 TR62 GML902612c WNNY99 WNEgypt 97 84 44 17 16 28 93 86 91 32 80 77 97 0.00 0.02 0.04 0.06 0.08 0.10

PAGE 460

435 Figure 5-10 Phylogenetic Relationships of WNV & Flaviviruses (Capsid/prM Region), Second Alignment Phylogram of the partial membrane /envelope region (bases 728-112) was inferred using the maximum parsim ony method in MEGA4.0.1, where the consensus tree (1000 bootstrap repli cates, value shown on branches) was chosen. Branch lengths represent the amount of genetic divergence, with the scale bar corresponding to number of base changes in the sequence. FLWN01a TX-2004H CO-2003-1 WNNY99 FLWN02a Hungary03 03-113FL GA-2002-1 FLWN05a TX2002 FLWN05b 03-124FL FL03-03-2 AZ-2004 FLWN01b TM171Mx FLWN02b FLM38 FLS504 FLS502 FLS545 FLS649 FLS694 India WNEgypt Kunjin AnMg798 MVE JE Kern217 96 31 32 32 90 99 99 69 20

PAGE 461

436 reactive clones. Since infectious virus wa s isolated from a WNV and SLEV dually infected chicken, the cross-re active results may be explaine d by a mixture of the viruses on the swab (further studies are needed). However, infectious virus was not detected by traditional cell culture or plaque assays for the novel flavivirus strains. Consequently, mutations in the genome may have negatively impacted the phenotype of these strains (potential lethal mutations) and/or prevented replication. This hypothesis is supported by RT-PCR assays that failed to produce an amplicon for longer contiguous sequences of the genome, including the SLEV complete envelope, flavivirus NS5 and 3non-coding regions. As a result, these genotypic differences may have prevented the detecti on of these strains in traditional serology assays, especially if replication was altered/ defective, which may have caused an aborted infection and little or no antibody production. Consequently, further studies are needed to assess genotypic and phenotypic differences found for these novel strains and their impact on surveillance methods used fo r the detection of arboviruses. Impact on Surveillance Methods The Arbovirus Isolation Network was su ccessful in targeting regions where arbovirus activity was present, which improve d arbovirus isolation from field collected samples with a systematic approach used by several local agencies. However, the detection and isolation of S outh American SLEV and novel flavivirus strains required the use of additional molecular methods (gel-based assays and sequence analysis), as well as modified plaque assays for the identificati on and characterization of these strains. The current surveillance systems (mosquito pools, dead birds, sentinel chicken seroconversions) for detection of arbovirus transmission acti vity in Florida failed to

PAGE 462

437 identify these novel flavivirus strains; yet, sentinel chicke n seroconversions did detect South American strains of SL EV. As discussed above, novel flavivirus strains may have been missed by the traditional serology assays performed on chicken sera due to an altered genotype (atypical e nvelope region) resulting in development of antibodies of different specificity. No one surveillance method exists that can concurrently detect seroconversions (antibody development) and capture virus st rains for molecular ep idemiology analysis. Several surveillance technique s are recommended for an eff ective arbovirus surveillance program (CDC, 2003A) to detect enzootic/epi zootic transmission ac tivity. As shown in this study, natural arbovirus infections resulted in transient and low level viremias that would not be adequate for surveillance purpos es. In addition, detection of infection by arbovirus shedding in the feces appeared to be impacted by the age of the chicken, rarely identified infections prior to the development of antibodi es, and was a more expensive test to perform than traditional antibody-ba sed assays. Consequently, serological assays are still the gold standard for detection of arbovirus transmission in Florida, where sentinel seroconversions have been shown to provide early warning for human cases of WNV (Blackmore et al 2003; Butler and Stark, 2005). Th e Arbovirus Isolation Network has created another tool that can be used to track the evolution and distribution of arboviruses in Florida. As di scussed previously, arbovirus strains may rapidly evolve where variant quasispecies exist in an ot herwise homogenous populat ion of a dominant genotype (e.g. WNV) or mixing of strains (quasispecies) in mosquito and/or avian amplifying hosts may provide a mechanism for these RNA viruses to evolve.

PAGE 463

438 Homologous recombination was demonstrated in the Flaviviridae for all four serotypes of dengue virus (Holmes et al 1999; Tolou et al 2001). The impact of recombination on the evolution of virus ta xa will largely depend on the level of difference between the viruses that unde rgo a recombination event. Currently, recombination in flaviviruses has been identified only in very closely related viruses, leading to low level sequ ence divergence (Calisher a nd Gould, 2003). Despite the isolation of WNV and SLEV strains from a dually infected sentinel chicken, recombination was not identified in either isolate. However, recombination between WNV and SLEV strains would not be a homologous event as they belong to separate taxa. This may result in a high level of se quence divergence in a hypothetical recombined WNV/SLEV strain that is lethal to replication of the virus. Nonetheless, there are still conserved regions within the viral genome that are shared by all flaviviruses including residues in the 5UTR, envelope and NS5 regi ons that may allow for such an event to occur (McMinn, 1997; Kuno et al 1998; Twiddy and Holmes, 2003). This type of recombination event may negatively impact both the molecular and serological methods currently in use for detection of West N ile virus and St. Louis encephalitis virus. Molecular Detection Methods The novel flavivirus strains were detected with the SLEV-specific primer-probe sets in real-time RT-PCR (TaqMan) assays and FLS694 tested pos itive with the WNVspecific primer-probe sets. The low titer of virus/viral RNA present on cloacal swabs often resulted in samples that were weakly positive by TaqMan RT-PCR, where the strains were not detected by the instrume nt until later in the RT-PCR cycle (cycle numbers greater than 30). It is recommended that all samples that screen positive in real-

PAGE 464

439 time RT-PCR assays with weak CT values (greater than 37) be confirmed with additional real-time and traditional gel-based RT-PCR assays. Consequently, novel flavivirus strains are not likely to be missed during molecular te sting, as long as samples are run in parallel with both SLE and WN specific RT-PCR assa ys when collected from sites with confirmed SLEV seroconversions. The application of this principle to routine testing of mosquito pools and tissues submitted to the BOL-Tampa for arbovirus molecular detection assays would require additional st udy, as this would signi ficantly add to the cost of the assay. Perhaps this method could be implemented only at certain times of the year, i.e. during peak transmission season when samples are routinely screened for WNV only. Although these novel flavivirus strains were detected by real-time RT-PCR methods, they were difficult to amplify with the majority of gel-based RT-PCR methods used in this study. One end-point primer set for SLEV and WNV worked for both strains, and an additional WNV primer set amplified FLS694 only. However, these primer sets amplified 300-400 nucleotide bases of the viral genome, whereas primer sets that targeted a longer contiguous sequence (600-1700 bases) failed. Complete genome sequencing is planned to elucidate the reason(s) why these molecular detection methods were unsuccessful. Virus Isolation Methods Another arbovirus surveill ance method that will be impacted by these novel flaviviruses is the use of Vero cell cultures for arbovirus isolation assays. At this time, this is the only cell line used by the BOL-Tampa for inoculation of field collected samples for virus isolation. The failure of th ese strains to produce cytopathic effect in

PAGE 465

440 Vero cells may limit the future detect ion of these novel strains with this in vitro system. This finding was unusual as cell culture systems are often usef ul for the isolation of novel viruses, whereas molecular methods can be employed only for previously recognized viruses and those of suspected etiology for a diagnostic sample (Oglivie, 2001). However, it is likely that genotypic differen ces may have influenced the ability or efficiency of these strains to replicate in culture and not th e methods used in this study. Real-time RT-PCR CT values were also high, which may indicate that intact infectious virus on the swab was also lo w, if present. Additional in vitro systems should be assessed with these strains and enzootic arboviruses (EEEV, HJV, CA L) in Florida to determine if an alternative culture system would produ ce cytopathic effect for all viruses. Serological Methods The hemagglutination inhibition assay is an antigen-antibody based test that can be used for the detection of arbovirus-sp ecific antibodies (Casal s and Brown, 1954). As performed at the BOL-Tampa, this assay is highly sensitive for the detection of flavivirus and alphavirus antibodies in chicken sera Nonetheless, this assa y may also be impacted by novel arbovirus strains in that the group antigens used in the test (SLEV for flaviviruses and EEEV for alphaviruses ) may not be capable of detecting novel antibodies generated to a virus with altered envelope and/or NS1 epitopes to which most host antibodies are formed (Chambers et al 1990). The results of molecular RT-PCR assays on the novel flavivirus strains indicated that the e nvelope and NS1 (overlapping bases at the 5 terminus) regions may be si gnificantly different at the genomic level, which may correlate to insertions, deleti ons or base substitutions that are nonsynonymous.

PAGE 466

441 A new predicted protein sequence in th e envelope region may have serious consequences not only for the host, but also fo r serology assays that rely on the detection of antibodies generated to envelope epitopes. Consequently, it was not unexpected that these novel flavivirus infections in sentinel chickens were missed by the HAI assay, based on genotypic characteristics of these stra ins. Unfortunately, the HAI-negative sera from these birds were discarded, due to the retrospective processing st rategy used in this study. As a result, these and later sera samples were not tested in additional assays that may have detected SLEV or WNV-specific IgM and neutralizing an tibodies and thus no assessment of the immune response to these vi ruses in naturally infe cted chickens could be made. However, the detection of these novel flaviviruses only occurred because other chickens at Site 001 were id entified by the HAI assay follo wing seroconversion to SLEV. It is unlikely that these strains would have been discovered w ith the retrospective processing strategy used by the BOL-Tampa, if no evidence of infection was detected at a site (seroconversion). In pa rticular, a retrospective pr ocessing strategy that only processed cloacal samples collected from bi rds with confirmed seroconversions would have missed these infections. As shown in this study, it is important to process samples collected from the entire flock at a su spected site based on a single confirmed seroconversion, as virus was detect ed and/or isolated from othe r birds in these flocks that did not seroconvert. Based on these findings, it is possible that th ese strains may be present in cloacal swabs collected from HA I-antibody negative birds located at sites without confirmed seroconversions in Saraso ta County, or even in other counties. In

PAGE 467

442 addition, it is unknown if these novel flaviviruses were circulating in Florida prior to 2006 but were undetected. Aim Five Assessment of Virus Isolation/Detection Me thods as a Surveillance Tool in Florida This study has clearly shown the import ance of serological assays for the detection of arbovirus transm ission activity in naturally exposed sentinel chickens. Serosurveys have frequently been used to detect arbovirus tran smission activity, where exposure rates for humans or other animals are based on seroprevalence estimates in populations studied in the Unite d States and South America (Calisher, 1994; Sabbatini et al 1985; Burke and Monath, 2001; Reisen, 2003; Mondini et al 2007a). In essence, a serosurvey was conducted each week on approximately 3,000 4,000 sentinel chickens naturally exposed to arboviruses th roughout Florida during 2005 and 2006. Positive seroconversions detected by the HAI assay are usually indicative of a recent infection (due to weekly or biweekly sample submittal) and can be used to assess risk of epizootic/epidemic transmission resulting in implementation of prev ention strategies by public health and mosquito cont rol agencies (FDOH-BCEH, 2007). However, the sentinel chicken program in Florida relies on serological testing for detection of antibodies to the viruses. This program does not attempt to isolate arboviruses for molecular charact erization studies from sample s routinely collected from live chickens; instead arboviruses are usually cultured from mosquito pools or tissues from birds/mammals. The major disadvantage of th is approach is that when prevalence of the disease is low during interepidemic ye ars (as seen for SLEV since 1997), natural

PAGE 468

443 evolution or alterations of these viruses may be missed until an outbreak of disease occurs. Consequently, an Arbovirus Isola tion Network was implemented to collect arboviruses in Florida with a targeted sampling strategy in order to analyze molecular epidemiology trends. Evaluation of Virus Isolation/Molecular Detection Compared to Serological Assays Assays performed by the BOL-Tampa were sensitive for the isolation and detection of low titered arbovi rus shedding in the feces ( 2 PFU/0.1ml) processed from cloacal swabs by Vero cell culture and real-t ime RT-PCR, respectively. However, culture and molecular methods were not successful for the detection of viremia from whole blood samples (Table 5-6). Viremia in adult ch ickens appears to be transient (consistent with previous reports: Reisen et al 1994; Langevin et al 200; Patiris et al 2008) and/or below the detection threshold of the TaqMan assay routinely used at the BOL-Tampa. Consequently, this sampling strategy was di scontinued for the 2006 transmission season and is not recommend for future targeted studies of sentinel chickens. In 2005, three counties performed targeted sample collection at sentinel chicken sites. Manatee County had a total of 49 bi rds seroconvert during 2005, with 29 chickens that seroconverted during the countys activ e participation in the Arbovirus Isolation Network. However, only 14 of these birds were targeted for sample collection at the time of seroconversion. West Nile virus was isol ated from a single bird. In addition, WNV was detected (but not cultured) from two additional birds in Manatee County that failed to seroconvert in the HAI assay (Tables 5-1, 52). As previously discussed, the advanced age of chickens in these flocks may have contributed to an altered immune response following infection. In particular, the chicken where WNV was cultured from the cloacal

PAGE 469

444 swab did not seroconvert in the HAI assay until 28 days post isolation. The extensive time delay for this chicken to develop dete ctable antibody may have contributed to the decreased recovery of virus from confirmed sentinel seroconversions in Manatee County, as targeting of the site did not occur until well after infection. As a result, this was likely the single largest factor that contributed to the poor recovery of virus from the 13 other birds that seroconverted but vi rus was not isolated/detected. Orange County had a total of 21 bird s seroconvert during 2005, with seven chickens that seroconverte d during the countys active pa rticipation in the Arbovirus Isolation Network. However, only one of these birds was targeted for sample collection at the time of seroconversion. Eastern Equine Encephalitis viral RNA wa s detected (but not cultured) on cloacal swabs from this bird, at two different time point s. In contrast to Manatee County, Bird 846 seroconverted within eight days post detection of the initial positive cloacal swab. In addition, EEE viral R NA was detected (but not cultured) from one additional bird in Orange County that fa iled to seroconvert in the HAI assay (Tables 5-1, 5-2). Sarasota County had a total of 17 chic kens seroconvert during 2005, with eight birds that seroconverted dur ing the countys active part icipation in the Arbovirus Isolation Network. None of these seroconvers ions were detected at targeted sites. Consequently, evaluation of the effectiveness of virus isolation/detection from confirmed sentinel chicken seroconversions could not be assessed. However, no virus was detected or isolated from 38 processed swabs collected from sero-negative birds (Tables 5-1, 5-2). These results suggested that confirmed sero conversions were either not effective at predicting the location of hot zones of arbovirus transmi ssion activity or the time delay

PAGE 470

445 until confirmed results were repor ted was too late for arbovirus isolation/detection in this county. As a result, routine serological testing of sentinel chicken se ra was a much more reliable indicator of previous arbovirus infection than det ection of the virus on cloacal swabs in 2005. During 2006, five counties participated in the Arbovirus Isolation Network and performed targeted sample collection from se ntinel chicken sites. Lee County had a total of 15 chickens seroconvert during 2006. Howe ver, none of these birds seroconverted during the two week time period of the count ys active participation in the Arbovirus Isolation Network. Conseque ntly, evaluation of the effectiveness of virus isolation/detection from confirmed sentin el chicken seroconversions could not be assessed. However, no virus was detected or isolated from 22 processed swabs collected from sero-negative birds (Tables 5-1, 5-3). For Lee County, the limited collection time (two weeks) and the biweekly sample collect ion of the flocks contributed to the poor success of the targeted strate gy in this county. Notably, 11 sentinels seroconverted to SLEV following the discontinuation of targeting. In contrast to Lee County, the BOL-Tampa requested that Orange County collect cloacal swabs over a two week period based on transmission activity in a neighboring mosquito control district. Orange County had a total of five sentinel seroconversions in 2006, including three chickens that seroconvert ed during the countys active participation and collection of cloacal swabs. However, none of these conversions occurred at targeted sites. It is interesti ng that activity in a neighboring distri ct was useful for targeting sample collection in Orange County; however, this strategy was not adequate for the precision

PAGE 471

446 that appears to be required for specific targ eting of chicken flocks at fixed locations (Tables 5-1, 5-3). In Pasco County, the opposite scenario occurred and no new sentinel chicken seroconversions were detected after the BO L-Tampa requested the agency to initiate targeted sample collection. Consequently, evaluation of the effectiveness of virus isolation/detection from confirmed sentin el chicken seroconversions could not be assessed. However, no virus was detected or isolated from 20 processed swabs collected from sero-negative birds (Tables 5-1, 5-3). Arbovirus transmission activity was thus highly focal and sporadic in Pasco C ounty during 2006, with only two confirmed seroconversions. For future studies it is recommended for cloacal swab collection be discontinued after two months, if no new se roconversions are detected in a county. Volusia County collected samples for one month at four sites, but similar to Pasco County, no new seroconversions were detect ed during targeted sampling. Despite six seroconversions prior to targeted sampling, the only other confir med seroconversion in Volusia County that year occurred three months after sampling was discontinued. However, sentinel chicken flocks in Volusi a County were targeted based on experimental MIA results for the detection of virus-speci fic IgM antibodies in chicken sera. The MIA is currently in development at the BOL-Tamp a for the detection of seroconversions to both flaviviruses (WNV, SLEV) and alphaviruses (EEEV). Based on the results from Volusia County, the detection th reshold was set too low and was not a true measure of transmission activity. The assay was far t oo sensitive and MIA-positive sera were not confirmed in the MAC-ELISA (i.e. false-posi tives). Consequentl y, evaluation of the effectiveness of virus is olation/detection from confirmed sentinel chicken

PAGE 472

447 seroconversions could not be assessed. Howeve r, no virus was detected or isolated from 48 processed swabs collected from sero-negative birds (Tables 5-1, 5-3). During 2006, Sarasota County participated in the Arbovirus Isolation Network for a second year. Sarasota County had a total of eight chickens seroc onvert during the year, with seven chickens that seroconverted duri ng the countys active pa rticipation in this study. However, only four of these birds were targeted for sample collection at the time of seroconversion. In contrast to the count ys earlier targeted approach in 2005, virus was isolated from all four of these birds during 2006. In addition, West Nile virus was cultured and novel flavivirus viral RNA was detected (but not cultured) from three additional birds. Interestingly, West Nile virus was not detected in any of the sentinels in Sarasota County after April of that year and the birds infected with a novel flavivirus also failed to seroconvert in the HAI assay (Tables 5-1, 5-4). The Sarasota County Mosquito Control District only altered two components of its targeted sample collection in 2006. The mo st important factor th at increased arbovirus isolation success appeared to be timing of sample collection at the sites. Instead of waiting for a seroconversion to be confirmed prior to targeted collection, the agency immediately initiated sample collection at s ites based on sentinel chickens that were reported positive in the HAI assay. In less than one week, samples were collected from other birds at a positive site based on a non-confirmed seroconversion for one bird in the flock. As a result, timing of targeted sample collection appeared to be an extremely important component for successful arbovirus is olation from sentinel chicken sites with recent evidence of transmission activity. MACELISA confirmed test results were often not reported until samples had already been collected from sentinel chicken sites during

PAGE 473

448 the next week, so targeted sample collect ion began after seven days from the first indication of activity (at the earliest). The second change to the procedure used by Sarasota County was that the agency did not discontinue sample coll ection at targeted s ites. In 2005, the county had collected samples from several sites for one month, but no new seroconversions were detected at those sites and sampling was discontinued. Four days later a chicken seroconverted at one of the sites. This experience prompted the agen cy to continuously targ et a site for sample collection after it was confirme d positive. However, all of the arbovirus isolates were collected at sites that were immediately targeted following a positive sentinel seroconversion detected in the HAI assay. C onsequently, it is recommended that future studies target sites base d on consistent positive results in the HAI assay. For Sarasota County, targeted sample co llection and virus isolation from these chickens was as effective at the detection of arbovirus infections as serological methods,. At Site 001, a novel flavivirus was discovered that was not de tected with the traditional HAI assay. However, these sites would not have been targeted without the use of serology assays to first identify hot zones of transmission activity. The success of this agencys targeted strategy for collection of samples has provided a blue print for future arbovirus isolation studies in Florida and ot her states with active sentinel chicken programs. It should be noted that the routine collection of cloacal swabs from sentinel chickens for the surveillance of arbovirus transmission activity is not recommended based on this limited study, where sera and cloa cal swabs were not tested in parallel for detection of arboviruses. Pr evious experimental studies indicate that viremia and

PAGE 474

449 shedding of arboviruses in the feces occurs over a short time peri od (fecal shedding: range 2-6 days post-inoculat ion) in chickens [Senne et al 2000; Langevin et al 2001]. Consequently, this short window of opportunity for the dete ction of infection is not preferable over the detection of antibodies to the virus, which remain elevated for at least two weeks or longer following infection (Calisher et al 1986a, b, & c; Martin et al 2000). These finding are supported by this study that also detected fecal shedding of arboviruses over a short time period. Since th ese birds were exposed to the virus naturally, the exact date of infection is unknown and a true estimate of the duration of fecal shedding could not be determined. Cloacal shedding of the arboviruses for a period longer than two days was only detected in two birds. One of these birds was dually infected with WNV and SLEV. West Nile virus was isolated from cloacal swabs co llected seven days apar t, slightly extending the range noted above from expe rimental studies. In addition, St. Louis encephalitis virus was isolated nine days following the initial is olation of WNV (Day 0) in the same bird. Interestingly, it is posited that SLEV was the first infection for this bird based on serology results (Fang and Reisen, 2006; Patiris et al 2008). Consequently, this bird may have experienced an acute infection lasti ng from 9 to 15 days (Table 5-8), with no clinical symptoms and full recovery (healthy wh en relocated at the end of the season). A second bird shed flaviviral RNA at two time points, separated by 21 days, but infectious virus was not cultured from these swabs. In addition, cl oacal swabs collected seven and 14 days post-isolation were negative for viral RNA and infectious virus. This finding may is similar to the WN/SLE dually infected bird discussed above, where

PAGE 475

450 Table 5-8 Duration of Arbovirus Shedding from the Cloacae of Naturally Infected Chickens During 2005-2006, cloacal swabs were collecte d from sentinel chickens naturally exposed to arboviruses. The duration of arbovirus shedding in the feces is s hown in the time course below (exact date of infection is unknown). Day 0 indicates the first date of ar bovirus detection/isolation for each chicken, wher e dates are relative to the time of isolation (pre or post-isolation). The time to sero conversion (HAI+) from isolation/detecti on of the virus has also been provided. Duration of Arbovirus Shedding in the Feces of Sentinel Chickens (Cloacal Swabs) Days County Bird # Age (weeks) -6 0 2 4 6 7 9 14 21 Virus Cultured? Time to Seroconvert Orange 846 40 neg EEE EEE n/c ne g n/c neg n/c n/c No 8 DPI 870 40 neg EEE EEE n/c n/c n/ c n/c n/c n/c No Negative Manatee 1773 64 n/c WNV n/c neg n/c n/c n/c n/c n/c Yes 28 DPI 1714 65 neg WN n/c n/c neg n/c n/c neg n/c No Negative 1695 65 n/c WN n/c n/c neg n/c n/c neg n/c No Negative Sarasota 8-003-R 52 n/c WNV n/c n/c n/c WNV SLEV neg n/c Yes 0 14 DPI 8-005-B 52 n/c WNV n/c n/c n/c neg n/c neg neg Yes Negative 9-005-B 55 n/c SLEV n/c n/c n/c neg n/c neg neg Yes 0 7 DPI 9-004-G 55 neg FLAVI n/c n/c n/c neg n/c neg neg No Negative 9-000-W 56 neg FLAVI n/c n/c n/c neg n/c neg FLAVI No Negative Abbreviations: neg = negative, n/c = not coll ected, DPI = day post viru s detection/isolation.

PAGE 476

451 a decline in IgM antibody titers may have corr esponded to late shedding of SLEV in the feces. Perhaps the flavivirus positive bird also developed an IgM immune response that decayed after two weeks, allowing for the vira l RNA to be detected in the feces 21 days after the first detection (Table 5-8). Interestingly, WNV infection in a mouse model deficient in CD4+ T helper cells found that mice produced IgM antibodies by 5 da ys post-infection, as found for wild type (control) mice infected with the virus. However, virus-specific IgG antibody production was significantly blunted throughout the cour se of infection, unlike control mice. Notably, the neutralizing activity of serum anti bodies was not affected by the depletion of CD4+ T cells (Siati and Diamond, 2006). This study may partially explain the similar pattern observed for the absence of total an tibody (IgG + IgM) production (HAI negative) in sentinel chickens follow ing infection with the novel flavivirus strains. In addition, the early IgM production but late rising total antibody produced in Bird 1773 (a nearly identical immune response to WNV, Manatee County) may be linked to the old age of these chickens and impaired T cell function. While this does not explain the lack of total antibody production for all of the birds that virus was de tected/isolated, one hypothesis may propose that other factors (smaller am ount of virus inoculated, limited viremic phase) were also involved plus the age of the chicken pr evented total antibody production (Table 5-8). Impact of Retrospective Processing on Arbovirus Characterization A targeted testing strategy was implemented by the BOL-Tampa to process and perform molecular detection/virus isolation assays on submitted cloacal swabs to conserve resources. Sample s were retrospectively proc essed based on presumptive

PAGE 477

452 seroconversions in the HAI assay for sentin el chickens (Figures 4-11 and 4-12). Since wild bird sera were not collected for evalua tion in the HAI assay, all wild bird cloacal swabs were immediately processed and tested. Although this st rategy for sentinel chicken cloacal swabs efficiently conserve d resources, it was not effective as a surveillance tool. Earlie r detection of arboviruse s prior to confirmati on of serology results may have been possible in Sarasota County in 2006 (Figure 4-20), if swabs were processed upon arrival at the laboratory. C onsequently, the retrospective processing method was only effective for la ter identificati on and molecular epidem iology analysis of circulating arbovirus strains and not for imme diate surveillance of arbovirus activity. Prospective processing of cloacal swab samples would have triggered more intensive surveillance efforts for the novel flavivirus strain identified at Site 001 in Sarasota County (Figures 3-9 and 4-20). For example, the BOL-Tampa requested additional sera samples from chickens loca ted at Site 004 in December to re-assess serology profiles from birds that had not se roconverted at the end of 2006. Despite the isolation of WNV three times from two birds, none of the birds in this flock developed detectable antibody to West Nile virus. On e bird was dually infected with WNV and SLEV and developed detect able antibody to SLEV. Cloacal swabs collected from Site 001 were not processed until 2007, when Sarasotas sentinel chicken program had st opped for the year and the chickens removed from the program (lost to follow-up). If thes e samples had been processed before the end of 2006, additional sera and cloacal swab samp les would have been requested from the flock. Unfortunately, the initial sera samples collected on the same dates as the cloacal swabs had been discarded because the birds failed to produce antibodies detected by the

PAGE 478

453 SLEV-group antigen in the HAI assay. It is unknown if the two chickens with novel flavivirus strains produced detectable antibodies later during the course of infection. Prospective processing and early identification of these strains would also have allowed for preservation of the trapped mosquitoes collected at Site 001 and 004 (Figures 5-6 and 5-7) for virus detection/isolation studies in the mosquito vector. The agency would have been requested to maintain a cold chain for these trapped mosquitoes from collection to arrival at the laboratory. This novel flavivirus strain may have also infected chickens in other targeted flocks (or non-targeted sites el sewhere) but may not have been detected, if the birds also failed to seroconvert. The retrospective pro cessing strategy did not process swabs from negative sites, a strategy th at was implemented in 2005 following testing of one hundred (negative) samples; sites were only assayed if HAI positive seroconversions were detected. Currently, there are 364 and 809 cloaca l swabs that have not been tested for 2005 and 2006, respectively. A future project is planned to analyze swabs collected at some of these sites without seroconversions to identify if other arbovirus strains were missed. It is interesting to note that Lee County is near Saraso ta County to the south and had extensive sentinel seroc onversions to SLEV during the same time period (Figure 416). These chickens may also have been infect ed with a South American strain of SLEV, as detected in Sarasota County. It is unknown if co-circulation of the novel flavivirus strains also occurred at these sites in Lee County (as seen at Site 001 in Sarasota) due to the retrospective processing st rategy and the discontinuation of targeted sampling by the agency prior to these seroconversions.

PAGE 479

454 Recommendations for Arbovirus Surveillance Methods Recommendations for future studies have frequently been made throughout this discussion. However, this section will summ arize what has been learned during the implementation of an Arbovirus Isolation Network for the targeted collection of arboviruses from sentinel chickens and wild (re habilitated) birds in Florida. This study focused on the natural history of St. Louis en cephalitis virus and attempted to isolate the virus in its natural setting from avian (primar ily chicken) hosts to model the wild bird amplification cycle. Wild birds admitted to wildlife rehabilitation centers were also sampled based on symptoms characteristic of WNV arbovirus infec tions. SLEV has not been cultured in Florida since the introducti on of West Nile virus to the state in 2001 (Stark & Kazanis, 2002-2007). Diagnosis of animal infection (including sentinel chicken) is usually identified by the pres ence of virus-specific antibod ies in serum and is rarely diagnosed by virus isolation (Reisen, 2003). Consequently, this was not going to be a simple task in the absence of human cases and/ or epizootic activity, a pattern that is seen most years, when St. Louis encephalitis virus is maintained in an enzootic mosquito-wild bird cycle in Florida (Day, 2001). Although serological testing is the most utilized method for the surveillance of arboviruses and detection of transmission activity, the molecular epidemiology of circulating strains cannot be assessed without isolation of the arboviral genome. Unlike previous studies that have pe rformed targeted collection for St. Louis encephalitis virus during or following the identific ation of human cases (Rocco et al 2005; Diaz et al 2006), this study attempted to isolate the virus in avian hosts during enzootic transmission activity in Florida. First, local agencies that participated in the Sentinel

PAGE 480

455 Chicken Program were invited to participat e in the Arbovirus Isol ation Network for the targeted collection of samples from sentin el flocks. The success in recruiting these agencies (10 out of 14) to participate in th e project was likely due to the long-standing success of the Sentinel Chicken Arbovirus Surveillance Program and collaboration with the BOL-Tampa. Wildlife rehabilitation centers were also receptive to the program and submitted samples from certain species (known amplifying hosts) and birds with encephalitic symptoms (Appendix H) for virus isolation/detection a ssays. Overall, the enthusiastic response of the partner agenci es and the level of participation exceeded expectations. The targeted strategy used in this stu dy relied heavily on serology testing of sentinel chicken sera to identify hot zones of arbovirus transmission based on seroconversions, detected by the HAI, MAC-ELISA and PRNT assays. During the study period, targeted sampling of sites with each method was used. Confirmation of a SLEV seroconversion in the PRNT often required up to 22 days following the original collection date of the sample. As a result, S LEV was not isolated from three sites in 2005 that were targeted with this method. In a ddition, MAC-ELISA results were routinely used to target active transmission sites in both 2005 and 2006, with a shorter turn around time than the PRNT for initiation of targeted sampling at a hot zone. Results for the MACELISA were reported 7-9 days following the collection date of a serum sample that screened positive in the HAI assay (Table 5-4). This introduced an unavoidable time delay from the first evidence of transmission activity (HAI positive result) until targeted sample collection was started at the site. Nevertheless, arbovirus isolations and/or detections were made with this method, including WNV and EEE viral RNA.

PAGE 481

456 In contrast, Sarasota County used positive seroconversions detected in the HAI (screening) assay to target sentinel chicken flocks in 2006. This method limited the time delay needed for confirmation of HAI results, so that targeted collection of samples from chickens occurred at two sites within one w eek of the original sera collection date. A single SLEV isolate was cultured from each s ite. One SLEV isolate from Site 004 was collected from a dually infected WNV and SLEV chicken. Interestingly, WNV seroconversions had not been detected in th is region for six months, nor did two birds develop WNV-specific IgM antibodies following is olation of the virus, as tested at the end of the transmission season. Complete ge nome sequencing of these WNV strains is planned to identify if mutations in the genome (especially the envelope) may have encoded for an altered envel ope protein, which is the major antigenic determinant in eliciting host neutralizing antibodies (McMinn, 1997). The second SLEV isolate was collected at a different site 12 days later following the initial detection of a sen tinel seroconversion in the HAI assay. In addition, targeted sample collection at Site 001 result ed in the detection of two novel flavivirus strains. Although these flavivirus infections were not detected by the HAI assay, the site was first targeted based on a positive HAI serology re sult for another bird. Therefore, the HAI assay is recommended for targeted sample colle ction at sites with transmission activity to maximize arbovirus isolation recovery while controlling cost. As shown in this study, these sites may also have co-circulation of other flavivirus strains that are not detected by the HAI assay. These findings require additi onal study to assess the frequency of cocirculating Flaviviridae viruses in Flor ida, including WNV, SLEV and a novel flavivirus Both SLEV strains shared the highest nucle otide sequence homology to South American

PAGE 482

457 strains of the virus, which may play an important role in the transmission and maintenance of SLEV in Florida. Nonetheless, a weak HAI positive result (R, reactive, or 1:10) does not always confirm and may be a false positive due to non-specific reactive factors in the serum, variability in blood collection techniques, et c. Consequently, initiation of targeted sampling at a site based on weak HAI resu lts should be implemented with care, especially during the low season when prevalence of the disease is extremely low. However, during peak SLEV transmission m onths, it is recommended that cloacal swab samples be collected from all chickens in the flock as quickly as possible following detection of a sentinel seroconversion (1 :20, 1:40) in the HAI assay. In addition, retrospective processing of cloacal swabs is recommended during months with low transmission activity. Howeve r, prospective processing is recommended during peak transmission months, as co-circulating arboviruses may be present at a targeted site. Early detection of these arboviruses could then allo w for additional ecological investigations at or near the site, including the collection of trapped mosquitoes and/or wild birds for sera and cloacal swab collection fo r virus isolation assays. The recommendation for inclusion of sentinel chickens with positive seroconversions for cloacal sw ab collection is based on the fact that SLE virus was isolated from birds that had strong total antibody (HA I), IgM antibody (MAC-ELISA) and strong serum neutralizing antibody (PRNT) titers to SLEV. Consequently, it may be possible to isolate virus from birds with recent HAI sero conversions. Although virus was not isolated in Hillsborough County from birds that were confirmed positive by MACELISA, the pilot sites did not have chickens that had recently sero converted in the HAI

PAGE 483

458 assay (but were not yet confirmed) to eval uate this hypothesis. Additional studies are needed to evaluate the efficiency of recove ry of arboviruses from sentinel chickens that screen positive in the HAI assay. Wild birds admitted to rehabilitation cente rs were also triaged based on symptoms (Komar et al 2003; Brault et al 2004) and known amplifying host species (CDC, 2007g) for inclusion in the study. A total of 87 swabs were collected from five centers located throughout Florida, as well as from the Florida Fish and Wildlife Conservation Commission that investigated wild bird mortality events. Despite targeted sampling of these birds, no virus was detected or isolat ed. Although sampling of clinic admitted birds was successful in one study for WNV (Nemeth et al 2007a), the sample size included in this study was not adequate to detect SLEV or WNV, where prevalence was low in Florida during 2006 (as compared to high pr evalence in Colorado when the study was conducted). Recommendations for future wild bird studies would suggest that rehab centers swab all birds that ar e admitted, especially since SLEV infection does not usually cause clinical signs of illness (Reisen, 2003) In addition, the ecology of wild bird transmission cycle that occurs at or near active sentinel chickens sites would also be interesting to study. These studies would be able to evaluate flavivirus strains present in the avian amplifying host and correlate these fi ndings to strains de tected in sentinel chickens. Based on the results of this study, cloacal swabs are the recommended sample collection method for detection of viruses from adult chickens. They are a low resource, effective method for arbovirus isolation from birds (Komar et al 2002; Brennan, 2003). However, processing techniques and molecula r detection methods, including choice of

PAGE 484

459 primers/probes for viral amplification, shoul d be validated prior to testing of field collected samples. For example, a panel of North and South American reference and two recent strains of St. Louis encephalitis viru s were detected with the standard SLEA TaqMan primer-probe set (n=20) [Lanciotti and Kerst, 2001]. However, the SLEB primer-probe set failed to detect six South American strains of the virus (30%) due to nucleotide substitutions in both the probe and forward/reverse primer annealing sites (as shown for three strains) [Figure 5-1]. These base substitutions had an importan t impact on molecular detection methods of South American strains of SLEV, which re quired additional gel-based RT-PCR assays and sequencing for confirmation. Prior to this study, a sample that did not confirm with the SLEB primer-probe set would be consider ed negative; such false-negative molecular surveillance results have not been previously reported due to the low prevalence of SLEV since the introduction of WNV. South American strains of SLEV ha ve indirectly been shown to circulate periodically in the s outheastern United States, based on their phylogenetic placement in North American linea ges. Consequently, other states with arbovirus surveillance pr ograms in the southeast may also need to modify their current molecular detection testing algorithm for the confirmation of St. Louis encephalitis virus strains with the gel-based membrane/envelope and complete envelope primers developed specifically to detect SLEV strains (Lanciotti and Kerst, 2001; Kramer and Chandler, 2001, respectively). A successful arbovirus survei llance program incorporates several tools for the detection of transmission activity and no one method has been found to be superior for all regions of the United States (CDC, 2003Aa) Consequently, some states perform

PAGE 485

460 surveillance on infection rates in mosquito populations instea d of seroconversion rates in sentinel chickens (CDC, 1993; CDC, 2003Aa). In Florida, early warning of transmission activity has been detected by sentinel chicken seroconversions (Blackmore et al 2003; Butler and Stark, 2005). As a result, this sero logical method was chosen for targeting of active arbovirus transmission. Then, local agen cies performed sample collection for the isolation of arboviruses during the weekly scheduled sampling of the flock resulting in the isolation and/or detection of several arboviruses, including two South American strains of SLEV and two novel flavivirus strains. This arbovirus isolation study was funded by a grant to develop a pilot program for the isolation of arboviruses (especially SLEV) in Florida for molecular epidemiology analysis. The project lasted for two years and successfully isol ated several arbovirus strains, but should be evaluated for co ntinued use as a molecular epidemiology surveillance tool due to its e xpense. Several new questions we re raised about the natural history of SLEV and WNV in Florida that will require additional arbovirus isolation attempts on a larger scale and from the mos quito-wild bird amplifying hosts in future studies. Currently, this network is not activel y targeting sites due to decreased funding at the BOL-Tampa for the surveillance and study of West Nile virus and other pathogenic arboviruses in Florida. Additional funding supp ort would be required to offer testing of field collected samples at no cost to local agencies for diagnosis of infection and/or isolation of arboviruses fo r phylogenetic analysis. Conclusions of the Impact of WNV on the Natural History of SLEV in Florida Recently, extensive arbovirus studies in th e United States, conducted in the field and in the laboratory, have focused on severa l aspects of West Nile virus infections,

PAGE 486

461 including epidemiology, ecology (bird and mo squito), abiotic environmental factors (temperature, rainfall), su rveillance systems, and viru s pathogenesis (genotypic and phenotypic determinants) to describe the rapid spread and virulence associated with the virus once introduced into a nav e geographic territory. Yet, th e majority of these studies have largely ignored the impact or potential influence that the introduction of this closely related virus may have on St. Louis encephalitis virus in the United States. Two other states (Texas and California) have reported concerns about WNV a nd SLEV coexisting in the same region (Lillibridge et al 2004; Fang and Reisen, 20 06), with a report of the noted disappearance of SLEV following in troduction of WNV in California (Fang and Reisen, 2006). The same phenomenon was noted in Florida, where SLEV virtually disappeared in 2002 following the introduc tion of WNV (Stark and Kazanis, 2001). These concerns motivated the inception of this project to assess the impact of West Nile virus on the natural history of SLEV in Florida. Will the viruses peacefully co-exist or will one virus dominate the other as they both compete for shared mosquito vectors, habitat and amplifying hosts? While this study was not ecology based, the Florida Sentinel Chicken Program has served as a model of natural arbovirus amplification and disease transmission in the wild birdmosquito populations since 1978 (Nelson et al 1983). This system has successfully detected epizootic amplification of West Nile virus and provided early warning of transmission activity prior to clini cal cases of the disease (Blackmore et al 2003; Butler and Stark, 2005). During this st udy period, the rate of sentinel chicken seroconversions to West Nile virus and St. Louis encephalitis virus were evaluated in 2005 and 2006. These

PAGE 487

462 rates indicated that the amplif ication of West Nile virus has a considerable impact on the subsequent amplification cycle and transm ission of St. Louis encephalitis virus. Early season transmission of WNV, during June th rough August, modulates the rate of SLEV transmission late in the season from September through October. WNV activity predominated in 2005 w ith over 400 sentinel seroconversions; however, only five confirmed SLEV seroconversions were detect ed in nearly 4,000 sentinel birds. In contrast, WNV transmission activity to sent inel chickens was very low in 2006, which resulted in more sentinel se roconversions (n=40) to SLEV than detected for WNV (n=30) that year. For the first time since the introduction of WNV into Florida, the rate of SLEV seroconversions exceeded WNV (Figures 47 and 4-8). Consequently, the sentinel chicken program provides indirect evidence for the influence of WNV on SLEV, as these viruses compete for shared avian amplifying hosts. These findings are supported by experime ntal evidence, where WNV infections appear to prevent subsequent SLEV infecti ons in wild birds (hous e finches) by inducing sterilizing immunity in the avian host. In cont rast, previous infecti on with SLEV did not result in sterilizing immunity, which allowed fo r a subsequent WNV infection in the wild bird host with high titered viremia capable of infecting mosquitoes (Fang and Reisen, 2006). As a result, Fang and Reisen (2006) c oncluded that prior in fection with WNV in wild bird primary amplifying hosts may si gnificantly impact and decrease St. Louis encephalitis virus amplification and transmissi on cycles, where these viruses coexist. The long term impact of West Nile vi rus transmission in Florida is unknown, where enzootic circulation of several arboviruses (SLEV, EEEV, HJV, and Californiagroup) occurs each year. However, surveillanc e data indicates that WNV has established

PAGE 488

463 enzootic transmission foci and will continue to be a public health concern in the state (Stark and Kazanis, 2001-2007). Genetic a nd phenotypic studies of these viruses, especially St. Louis encephalitis virus, are cr itically necessary becau se they can identify variations in a virus that may impact its virulence, mosquito infectivity, and disease potential. As a result, this study aimed to investigate SLEV strain differences prior to and following the introduction of West Nile virus in 2001. However, SLEV has not been isolated in culture since th e introduction of WNV in Flor ida. An Arbovirus Isolation Network was formed and local agencies in th e central and southern region of the state were recruited to participate, as SLEV transm ission is historically the most active in these regions of Florida (Figure 3-1). During the study period, eight county agenci es actively targeted sentinel chicken flocks for arbovirus isolation studies. Six strain s of West Nile virus were detected (n=2) or cultured (n=4) from cloacal swabs, two strains of St. Louis en cephalitis virus were cultured from a site with concurrent WNV transmission in 2006, three novel flavivirus strains were detected (but not cultured) at one site with concurrent SLEV transmission (Sarasota), and four strains of Eastern Equine Encephalitis vi rus were detected (but not cultured) from one county (Orange) in 2005. Flavivirus strains were then characterized in genotypic and phenotypic studie s. Molecular epidemiology an alysis of these strains served two purposes: i) identification of th e origin and potential virulence of arbovirus strains as a surveillance tool in Florida, and ii) study the accumulation of mutations (evolution) of SLEV in Florida over five d ecades. The isolation of strains of West Nile virus from sentinel chickens in 2005 and 2006 were also compared to a small number of reference strains collected in Florida during 2001, 2002, and 2005.

PAGE 489

464 For this study, the impact of West Nile virus on the natural history of St. Louis encephalitis virus was investigated at the genomic level. Selective and competitive pressures on these closely related viruses th at coexist in the same primary amplifying mosquito and avian host populations were hypothe sized to potentially en hance the rate of evolution in SLEV from st rains isolated prior to the introduction and widespread transmission of West Nile viru s in Florida. The complete en velope region was chosen for analysis due to its important biological functions and the extensive number (n=90) of envelope sequences submitted to GenBank [McMinn, 1997; Kramer and Chandler, 2001; Twiddy and Holmes, 2003]. In fact, the total num ber of sequences submitted for SLEV is approximately ten times less (n=225) when co mpared to West Nile virus, its more intensely studied counterpart with 2395 submitted sequences [as of March 25, 2008]. Nevertheless, nucleotide sequence analysis on two SLEV strains isolated in Sarasota County in 2006 indicated the viruses were of South American (Brazil) origin. Prior to this study, no biologic evidence existed for the circulation of South American strains in the United States desp ite indirect evidence for the introduction of strains from Brazil, Mexico, and Panama th at share close nucleo tide sequence homology to North American clades (Table 2-2). Inte restingly, this study ha s not only shown the introduction of a Brazilian strain of SLEV in 2006, but also an earlier introduction of another Brazilian strain collected in 1972 fr om the panhandle region of Florida. These strains represent the first reported detection of South American strains of SLEV in North America. Phylogenetic analysis of different regions of the viral genomes also confirmed the BLASTN results (Appendix I). Three methods were used to draw phylogenetic trees, with all trees placing the 2006 strains within Lineage VA or Lineage VB for the 1972

PAGE 490

465 isolate (maximum parsimony method shown in Figure 5-4). In addition, all three of the introduced strains share highest sequence ident ity to Brazilian isolat es that have been characterized as highly virule nt in mouse models (Monath et al 1980). These results confirm that the introduction of SLEV from Brazil in 2006 was not an isolated event, as one strain was al so collected during fi eld studies in 1972. Consequently, the 2006 isolates do not repres ent a recent extension of the geographic range of Brazilian strains of SLEV. Instea d, these findings have more significance for the periodic re-introduction and maintena nce of SLE virus in Florida and other southeastern states. Recent out breaks of severe disease in Argentina and Brazil suggest that the prevalence and appa rent attenuation of SLEV in the tropics may be underreported due to differential diagnosis of dengue virus for most cases (Diaz et al 2006; Mondini et al 2007a). As a result, these outbreaks should not be igno red by Florida and the continental United States as migratory birds could transport th e disease north during spring migration, which occurs during peak transmission of arboviruses in Central and South America (January through March) [Dupuis et al 2003, 2005]. Conversely, fall bird migration southward occurs during peak SLEV transmission activity in Florida (October November) that likely carri es and seeds the virus into Central and South America (Kramer and Chandler, 2001), as shown for WNV (Deardorff et al 2006). Therefore, outbreaks of SLEV and WNV transcend geogr aphic and national bounda ries to spread these viruses throughout the Americas. However, a larger impact may be felt in Florida (and North America) due to a largely non-immune population to flaviviruses unlike the population found in South America, where dengue antibodies may provide cross-

PAGE 491

466 protection and prevent SLEV (Bond, 1969; Bond and Hammon, 1970) or WNV infection (Gubler, 2007). The impact of West Nile virus on the rate of evolution of th ese South American strains of SLEV has been thought to be minima l, due to the fact that WNV has not been detected in Brazil through March 2008. In addition, multiple sequence alignment of the FLS569 and FLS650 strains with other Nort h and South American SLEV envelope sequences only identified one unique nuc leotide base substitution, a non-synonymous mutation that resulted in a single predicted am ino acid change. However, the most direct impact of West Nile virus on th e natural history of St. Louis encephalitis virus in Florida may be the potential for recombination and ra pid evolutionary change as both viruses are now co-circulating in the region. It is r ecommended that arb ovirus isolation and molecular epidemiology studies become a vital part of arbovirus surveillance programs in Florida to monitor such a trend and imple ment appropriate prevention and control measures should it occur. While recombinati on was not detected in either the FLS545 (WNV) or FLS569 (SLEV) strains, the identi fication of a sentinel chicken with a dual infection of SLEV and WNV in Sarasota County indicates that it may only be a matter of time before a West Louis virus is detected. Based on these results, the three strains (two WNV, one SLEV) collected from this chicken were challenged with homo logous polyclonal neutra lizing antibodies and several plaque clones were picked to identify if mixed populations of WNV and SLEV were present on a single swab. The results were inconclusive, as real-time RT-PCR (TaqMan) assays detected two clonal population types. Th e dominant genotype was detected (i.e. WNV for FLS545) for the majo rity of clones picked, but several clones

PAGE 492

467 were also cross-reactive to both WNV and SLEV. Cross-reactive detection and confirmation of WNV and SLEV in the TaqMan assay (as shown for FLS502 clones, Table 4-4) had not previously been noted at the BOL-Tampa in seven years of real-time RT-PCR testing for both viruses. While S LEV was not detected alone from a WNV positive swab (or vice versa), these cross-re active findings suggest the possibility of a mixed population or perhaps a combined virus. Additional sequencing of these crossreactive clonal viruses is recommended to fully evaluate these results. While recombination between WNV and SLEV has not been proven in this study, the detection of a chicken with a dual infection raises the concern that these viruses may be mixing in the wild bird-mosquito populations and r ecombination may occur in the future. Interestingly, WNV was isolat ed from another chicken at this site but the bird failed to raise detectable antibody titers to th e virus. Consequently, there was no serologic evidence of WNV co-circulation in the region based on sentinel chicken seroconversions. In addition, no confirmed WNV seroconversio ns were detected in counties bordering Sarasota County to the north or south despite seroconversions to SLEV late in the season, in Manatee and Lee counties, respectively. A single WNV seroconversion was detected in Sarasota and Manatee coun ties in April and single sero conversion on August 21 in Lee County. The seroconversion in Lee County wa s the closest time point to the RT-PCR detection of the virus on cloaca l swabs in Sarasota County ~ 45 days later. These results indicate that the virus was present during the early season amplification in Manatee and Sarasota Counties, but was not detected much later in the season in Sarasota County despite its isolation from cl oacal swabs. Further studies are needed to address these findings in both the wild bird amplifying hosts and sentinel chickens where the impact of

PAGE 493

468 co-circulation of WNV and S LEV during early and late s eason transmission can be compared. Additional questions for future study were also raised in the detection of a novel flavivirus in Sarasota County that also co-cir culated with South American SLEV and WNV in the region. Unlike the other arboviruse s collected from Sarasota County, this strain did not replic ate (produce detectable cpe) in Vero cell culture. Several RT-PCR primer sets failed to amplify regions of this virus, includ ing the full envelope and NS5 fragments. However, three gel-based primer sets did produce an amplicon for sequencing. Interestingly, the strain was identified as SLEV in the membrane/envelope region, but as WNV in the capsid/prM and 3NS5 regions. None of these primer sets overlapped. Primer sets that targeted 1500bp segments of the virus failed to produce amplicons. The SLEV region of the virus closely matched other Tampa Bay SLEV strains despite the detection of Brazilian SLEV circulating at the site. The WNV region was identified as homologous to Old World strains in the capsi d region, but North American strains in the 3NS5 region. The inoculation of the novel flavivirus strains into susceptible hosts is planned for virus isolation a nd subsequent complete genom e sequencing to resolve the exact phenotype and genotype of this strain, as well as to confirm the current molecular results. Little is known on the specific molecular de terminants of SLEV that contribute to its epidemiology, where enzootic strains are markedly different from those isolated during epidemics (Trent et al 1980; Kramer & Chandler, 2001) This study has identified the possibility that South American strain s of SLEV introduced to Florida may cocirculate with enzootic North American strains, as well as with West Nile virus. The

PAGE 494

469 SpAn9398 strain of SLEV was isolated in January 1968 from a wild rodent (Akodon arviculoides ) in Brazil. Phylogenetic analysis of the envelope region placed it in Lineage IIA, which also contains isolates made in Texas, Kentucky and Florida (Kramer and Chandler, 2001). One year later, four strains of SLEV were isolated from Cx. nigripalpus (n=3) and one raccoon (n=1) in Polk County, Fl orida where 3 human cases were reported in a sporadic outbreak. Based on the molecular results of th is study, it appears that the SpAn9398 Brazilian strain was introduced into Florida where it may have rapidly evolved or cocirculated with North American enzootic strains, producing the new 1969 Florida strain genotype (69M1143 and L695121.05). (Figure 5-4). In fact, the researchers at the ERC in Tampa proposed that this outbreak resulted from the introduction of an exotic agent (Wellings, Lewis and Pierce, 1972). Sequenci ng of additional regions of the SpAn9398 strain (only the envelope gene has been submitted to GenBank as of March 25, 2008: http://www.ncbi.nlm.nih.gov/sites/entrez ?db=nuccore&cm d=search&term=SpAn9398 ) and the Florida 1969 strains may provide insi ght into the relationship between these isolates of SLEV. In summary, the natural history of St. Louis encephalitis virus in Florida appears to be closely tied to South American strains of the virus. Further research is needed to elucidate the mechanisms that contribute to the shift from an enzootic cycle (and genotype) into epidemic transmi ssion of North American strain s of the virus. The role of the distinct genotypes of South American stra ins in either of these cycles is unknown, but the proven introduction (and re-introduction) of SLEV proposes a mechanism for the continued maintenance of the virus. The diverse ecosystem in South America and

PAGE 495

470 particularly the Amazon region of Brazil allows for evolution of th e virus with periodic seeding (by migrating birds) of these strains into the United States, where a large proportion of the population has no immunity to the virus. The recent introduction of West Nile vi rus to Florida in 2001 also has had a tremendous impact on the natural history of SLEV, where SLEV virtually disappeared for two years following the widespread distri bution of WNV in the state. Experimental wild bird studies by Fang and Reisen (2006) and surveillance data in Florida supports the hypothesis of early season transmission of West Nile virus, with resulting sterilizing immunity in primary avian amplifying hosts, as an important factor in preventing the subsequent amplification and transmission of St. Louis encephalitis virus. Consequently, these closely related flaviviruses must compete for shared resources as they co-exist in the same region. As a result, dual infection of avian and mosquito hosts is possible (as shown in this study for chickens). Further st udies in wild bird and mosquito populations are recommended to identify the frequency of this occurrence that may promote the recombination of these highly pathogenic arboviruses. Surveillance programs are critical for early detection of arbovirus transmission activity to protect public health and virus isolation strategies can be used to detect genotypic changes in the virus that may impact its virulence, mosquito infec tivity, and disease potential.

PAGE 496

471 Summary of Study Findings Aim One The study resulted in the successful esta blishment of an Arbovirus Isolation Network for the field collection of sa mples for arbovirus detection and/or isolation. Collaborators in cluded ten county mosquito control districts, five wildlife rehabilitation center s and six state agencies. The BOL-Tampa requested nine county mo squito control agencies to target sentinel chicken sites based on results of routine weekly surveillance activity; eight agencies implemented sample collec tion within one week of request. Five wildlife rehabilitation centers also submitted samples based on bird species (amplifying host) and/or symptoms indi cative of an arbovirus infection during 2006. Aim Two Three serology assays (HAI, MAC-ELISA PRNT) were utilized to target sampling of active sent inel chicken flocks based on seroconversion surveillance data. This strategy for collection of clo acal swabs at sites with recent arbovirus transmission activity (hot zones) enab led the isolation of WNV, SLEV, and EEE viral RNA from adult chickens. Fifteen arboviruses were detected and/or isolated by molecular and cell culture assays, including two SLEV isolates, identification of a dual infection (WNV and SLEV) in a single bird, and detection of a novel flavivirus. The HAI test used for screening sentin el chicken sera for arbovirus-specific antibodies resulted in the shortest time delay (3 days) for initiation of targeted

PAGE 497

472 sample collection and the highest number of arbovirus isolations from sentinel chickens. Initiation of cloacal sw ab sampling after a single positive seroconversion at a site in Sarasota County, 2006, resulted in detection of both virus and concurrent seroconversio n in other birds of that flock. Confirmation of HAI results in the MAC-ELISA or PRNT resulted in an additional 7 or 22 days from the date of seroconversi on until targeted sample collection began at an active site, respectively. MAC-ELISA targeted collection resulted in detection and/or isolati on of WNV and EEE viral RNA. However, targeted sample collection based on PRNT results for SLEV did not isolate/detect virus in cloacal swabs from confirmed activ e sites (due to sporadic transmission and/or effective vector control efforts). Despite the collection of cloacal swabs (n=84) from wild birds, no virus was detected/isolated. Targeted sampling of w ild bird species was not effective at wildlife rehabilitation ce nters based on known amplif ying host species and/or symptoms indicative of arbovi rus infection, such as w eakness. A larger sample size of rehabilitated birds is recommende d for future studies to improve virus isolation and surveillance fo r arboviruses in this statew ide resource of naturally exposed wild bird populations, as shown in Colorado (Nemeth et al 2007). Seasonal timing of WNV transmission had an important impact on the subsequent transmission of SLEV in Florida. In 2005, early season amplification of WNV appeared to prevent the later amplificati on of SLEV in the late summer to early fall months, when SLEV tends to reac h peak transmission activity (CDC, 1993). In contrast, the relative absence of W NV activity in 2006 may have allowed for

PAGE 498

473 the subsequent amplification of SLEV which resulted in a higher number of SLEV sentinel chicken seroconvers ions than detected for WNV. Aim Three Serologic methods for the detection of virus-specific antibodies in sentinel chicken sera were highly effective fo r targeting active sites of arbovirus transmission. Delayed production of tota l antibody (detected by the HAI assay) following WNV infection was noted for one chicken, aged 64 weeks at the time of virus isolation. In addition, six chickens failed to seroconvert in three counties (including Manatee) as detected by the HAI assay despite the isolation and/or detection of arboviruses on cl oacal swabs. It is sugge sted that advanced age and/or altered immune response of thes e chickens may have influenced the primary immune response (production of total antibodies) following arbovirus infection in these birds may have allowed them to escape detection in the HAI assay Dual infection of SLEV and WNV was detected in one sentinel chicken. Serologic assays indicated that the bi rds primary immune response produced SLEV-specific antibodies only following thes e infections. The concept of original antigenic sin suggests that the bird was likely not co-infected with WNV; instead, the WNV infection followed the SLEV infection, which resulted in a boosted immune response (total antibody titers) to SLEV and no elevation of WNVspecific antibodies over 14 days. Interestingly, molecular detection of WNV from cloacal swabs was the only evidence of co-circulation of WNV in Sarasota County during October 2006 (not detected by serology).

PAGE 499

474 Real-time RT-PCR (TaqMan) detection of six South American strains of SLEV (Brazil and Trinidad) was impacted by nucle otide substitutions in the forward and reverse primer and probe a nnealing sites in the envel ope/NS1 region. The current molecular testing algorithm would have re ported these strains negative, as they were only confirmed by end-point RT-P CR, sequencing of the PCR product and virus isolation in cell culture. Recommenda tions include the re-design of a second SLEV-specific TaqMan RT-PCR primer-pr obe set for the detection of all known South American strains of SLEV, as well as confirmation of SLEV strains with the NS5 gel-based primer set to identify origin of the virus as North or South American. Cloacal swabs were shown to be more effective than blood samples collected from sentinel chickens in 2005 for the detection of arboviruses. Low level, transient viremia in birds lasts from onl y one to five days following infection (Reisen et al 1994; Patiris et al 2008) and viremia was not detected with the experimental design (targeted sample collection based on seroconversions) employed for blood collecti on in the current study. Aim Four Three strains of SLEV isolated in Fl orida (including two strains during 2006) were identified as South Amer ican in origin (Brazil). These strains represent the first reported isolation of South American SLEV in North America, which corroborates indirect evidence of SA S LEV circulation in the United States by phylogenetic analysis (Kramer and Chandler, 2001).

PAGE 500

475 Interestingly, the phenotypes of the FL S569 and FLS650 South American strains of SLEV were different from each other de spite a nearly identical genotype in the regions of the viral genome analyzed for this study. Large and small pinpoint plaques were identified in FLS569 (from a chicken with a dual infection of WNV), whereas only small pi npoint plaques were identi fied in FLS650. Plaques were picked from both strains; howev er, only FLS569 produced cross-reactive results in TaqMan RT-PCR for SLEV and WNV in some of the clones picked for FLS569 (larger plaque sizes). TaqMan RT-PCR of plaques picked for FLS650 only detected SLEV (pinpoint plaques). Strain differences were identified in SLEV isolated from the last five decades. A pattern of nucleotide substitutions in the envelope region (n=15) was detected in the 1990 epidemic strains of SLEV that we re not shared by other Florida isolates. However, this pattern was also present in strains of SLEV that coincided with human cases in Texas and Tennessee based on multiple sequence alignment of the envelope region. Phylogenetic analysis of the envelope and partial NS5 regions of Florida isolates identified that two SLEV strains (FLS 569 and FLS650) collected from sentinel chickens in 2006 were placed in Lineage VA, whereas the FL72 strain collected from an opossum in 1972 was placed in Lineage VB. The detection of these South American strains indicates that Brazilian strains of SLEV were introduced and reintroduced to Florida during the la st 30 years. In addition, the 1989-1990 epidemic strains of SLEV collected duri ng the last large outbreak in the United States clustered separately from the other Florida strains of SLEV analyzed in this

PAGE 501

476 study. Novel flavivirus strains were isolated from one site with circulation of the FLS650 SA strain of SLEV. However, phyl ogenetic analysis revealed that these novel strains clustered with the North Amer ican strains of SLEV and not in the South American lineages. In contrast to SLEV, ph ylogenetic analysis of WNV strains indicated limited divergence of Florida isolat es since the introduction of the virus to the state in 2001 (capsid/prM and partial NS5 regions). The novel flavivirus strains clustered with Old World isolates in the capsid/prM region, with a low bootstrap support value (92%). However, analysis of an in ternal portion of th e WNV genome in the 3 NS5 region indicated the FL694 cluste red with North American strains of WNV (bootstrap support 99%). Complete ge nome sequencing of these strains is recommended to elucidate both the SLEV and WNV components of this virus. Aim Five In this study, serological methods proved to be the most effective surveillance tool for identification of arbovirus transmission activity in sentinel chickens as compared to virus isolation/detection from cloacal swabs. For example, WNV was isolated from only one out of 14 chickens in Manatee County that seroconverted and were targeted duri ng 2005. However, in Sarasota County during 2006, virus was isolated from all f our birds that seroconverted that were also targeted for cloacal swab collection. In addition, the virus isolation strategy identified the co-circulation of WNV ( not detected serologically) and novel flaviviruses. Consequently, detection of seroconversions in sentinel chicken flocks remains the gold standard for de tection of arbovirus transmission activity

PAGE 502

477 in Florida, but virus isolation is a va luable technique to enhance arbovirus surveillance and identification of the origin and potential virule nce of circulating strains. The impact of WNV on SLEV has been demonstrated with sentinel chicken seroconversion rates during this study pe riod. Seroconversion rates to WNV early in the year (June through August) appeared to influence subsequent amplification and transmission of SLEV during the late summer to early fall months during 2005 in Florida. In 2006, the number of seroconversions to WNV (n=30) were lower than the number of chickens that seroconverted to SLEV (n=40) for the first time since the introduction of the WN vi rus in 2001. Consequently, limited early season WNV activity appeared to allow for the later amplification and transmission of SLEV. In conclusion, WNV also has the potential to directly impact the natural history of SLEV through recombination and rapid evolutionary change as both viruses now co-circulate in the same region. The iden tification of a sentinel chicken with a dual infection of SLEV and WNV indicates that it may only be a matter of time before West Louis virus is det ected. Virus isolation and molecular epidemiology studies are recommended to enhance arbovirus surveillance in Florida to monitor such a trend and imple ment appropriate prevention and control measures should it occur.

PAGE 503

478 REFERENCES Aaskov J, Buzacott K, Field E, Lowry K, et al (2007). Multiple recombinant dengue type 1 viruses in an isolate from a dengue patient. J Gen Virol 88(12):3334-40. Aitken THG, Downs WG, Spence L, Jonkers AH (1964). St Louis Encephalitis Virus Isolations in Trinid ad, West Indies, 1953-1962. Am J Trop Med Hyg 13:450-451. Allen R, Taylor SK, Sulkin SE (1970). Studies of Arthropod-borne Virus infections in Chiroptera. 8. Evidence of Natural St. Louis Encephalitis Virus Infection in Bats. Am J Trop Med Hyg 19(5):851-859. Applied Biosystems (2001). Real Time PCR vs. Traditi onal PCR. Available from URL: http://www.appliedbiosystems.com/s upport/tutorials/pdf/r tpcr_vs_tradpcr.pdf Aquino VH, Anatriello E, Gonalves PF et al (2006). Molecular epidemiology of dengue type 3 virus in Brazil and Paraguay, 2002-2004. Am J Trop Med Hyg 75(4):710-5. Azizan A, Sweat J, Espino C, et al (2006). Differential proinflammatory and angiogenesis-specific cytokine producti on in human pulmonary endothelial cells, HPMEC-ST1.6R infected with dengue-2 and dengue-3 virus. J Virol Methods. 138(1-2):211-7. Baleotti FG, Moreli ML, Figueiredo LT (2003). Brazilian Flavivirus Phylogeny Based on NS5. Mem Inst Oswaldo Cruz 98(3):379-82. Ball LA (2001). In Fields Virology, Vol 1, Fourth Edition. Knipe DM and Howley PM, ed. Replication Strategies of RNA Viruses. Lippincott, Williams, and Wilkins, Philadelphia, PA. 105-118. Batista WC, Kashima S, Marques AC and Figueiredo LT (2001). Phylogenic Analysis of Brazilian Flavivirus Using Nucleotide Sequences of Parts of NS5 Gene and 3 Non-coding Regions. Virus Res 75(1):35-42. Beasley DW, Davis CT, Guzman H, et al (2003). Limited Evolution of West Nile Virus Has Occurred During its Southwesterl y Spread in the United States. Virology 309:190-195.

PAGE 504

479 Beasley DW, Davis CT, Estrada-Franco J, et al (2004). Complete Genome Sequence of a West Nile Virus Isolate From Mexi co and Identificati on of an Attenuating Mutation. Emerg Infect Dis 10(12):2221-2224. Beasley DW (2005). Recent advances in the molecula r biology of West Nile virus. Curr Mol Med 5:835-850. Beaty BJ, Calisher CH, and Shope RE (1989). In Diagnostic procedures for viral, rickettsial and chlamydial infections Schmidt, NJ and Emmons, RW, eds. Arboviruses, chapter 24. American Public Health A ssociation, Washington, DC. Bell RL, Christensen B, Ho lguin A, Smith O (1981). St. Louis Encephalitis: A Comparison of Two Epidemics in Harris County, Texas. Am J Pub Health 71(2):168-170. Benjamini E, Coico R, and Sunshine G (2000). Immunology: A Short Course, Fourth ed. John Wiley & Sons, New York, USA. Bernard KA, Maffei JG, Jones SA, et al (2001). West Nile Virus Infection in Birds and Mosquitos, New York State, 2000. Emerg Infect Dis 7:679-685. Berthet F, Zeller HG, Drouet M, et al (1997). Extensive Nucleotide Changes and Deletions Within the Envelope Gene of Euro-African West Nile Viruses. J Gen Virol 78:22932297. Bigler B (1999). St. Louis Encephalitis. Available from URL: http://www.doh.state.fl.us/disease_ctr l/epi/htopics/reports/slepres2.pdf Bigler WJ, Ventura AK, Lewis AL, et al (1974). Venezuelan Equine Encephalitis in Florida: Endemic Virus Circ ulation in Native Rodent P opulations of Everglades Hammocks. Am J Trop Med Hyg 23(3): 513-521. Bigler WJ, Lassing E, Buff E, et al (1975). Arbovirus Surveillance in Florida: Wild Vertebrate Studies 1965-1974. J Wildlife Dis 11:348-356. Bigler WJ, Lassing EB, Buff EE, et al (1976). Endemic Eastern Equine Encephalitis in Florida: a Twenty-year Analysis, 1955-1974. Am J Trop Med Hyg 25(6):884-890. Blackmore CG, Stark LM, Jeter WC, et al (2003). Surveillance results from the first West Nile virus transmissi on season in Florida, 2001. Am J Trop Med Hyg 69(2):141-50. Blitvich BJ, Fernandez-Salas I, Contreras-Cordero JF, et al (2004). Phylogenetic Analysis of West Nile Viru s, Nuevo Leon State, Mexico. Emerg Infect Dis 10(7):1314-1317.

PAGE 505

480 Bond JO, Hammon WM, Lewis AL, et al (1966). California Group Arboviruses in Florida and Report of a New Strain, Keystone Virus. Public Health Rep 81(7): 607-613. Bond J (1969). St. Louis Encephalitis and Dengue Fever in the Caribbean Area: Evidence of Possible Cross-protection. Bull Wld Hlth Org 40:160-163. Bond JO and Hammon WM (1970). Epidemiologic Studies of Possible Cross Protection Between Dengue and St. Louis Encephalitis Arboviru ses in Florida. Am J Epidemiol 92(5):321-329. Bowen GS, Monath TP, Kemp GE, K erschner JH, and Kirk LJ (1980). Geographic Variation Among St. Louis Encephalitis Vi rus Strains in the Viremic Responses of Avian Hosts. Am J Trop Med Hyg 29(6): 1411-1419 Bowen RA and Nemeth NM (2007). Experimental Infections With West Nile Virus. Curr Opin Infect Dis 20(3):293-297. Brault AC, Langevin SA, Bowen RA, et al (2004). Differential Virulence of West Nile Strains for American Crows. Emerg Infect Dis 10(12):2161-2168. Brennan BM (2003). Comparative Analysis of Cloacal Swabs and Heart Tissue from Naturally Infected Corvids for West N ile Virus Detection. M.S.P.H Thesis, College of Public Health, University of South Florida. Brogdon WG, McAllister JC (1998). Insecticide Resistance and Vector Control. Emerg Infect Dis 4:605-613 Burke DS and Nisalak A (1982). Detection of Japanese Encephalitis Virus Immunoglobulin M Antibodies in Serum by Antibody Capture Radioimmunoassay. J Clin Micro 14:353-361. Burke DS and Monath TP (2001). Flaviviruses. In Fields Virology, Fourth Edition. Knipe and Howley, eds. 1043-1125. Calisher CH, Maness KSC, Lord RD, Coleman PH (1971). Identification of Two South American Strains of Eastern E quine Encephalitis Virus From Migrant Birds Captured on the Mississippi Delta. Am J Epidemiol 94:172-178. Calisher CH, El-Kafrawi AO, Mahmud MIA, et al (1986a). Complex-Specific Immunoglobulin M Antibody Patterns in Humans Infected with Alphaviruses. J Clin Micro 23(1):155-159.

PAGE 506

481 Calisher CH, Berardi VP, Muth DJ, Buff EE (1986b). Specificity of Immunoglobulin M and G Antibody Responses in Humans Infected with Eastern and Western Equine Encephalitis Viruses: Application to Rapid Serodiagnosis. J Clin Micro 23(2):369-372. Calisher CH, Freemount HN, Vesley WL, et al (1986c). Relevance of Detection of Immunoglobulin Class M Antibody Res ponse in Birds Used for Arbovirus Surveillance. J Clin Microbiol 24(5):770-774. Calisher CH (1994). Medically Important Arboviruses of the United States and Canada. Clin Micro Rev 7(1):89-116. Calisher CH, Blair CD, Bowen MD, et al (2001). Identification of Arboviruses and Certain Rodent-Borne Viruses: Reevaluation of the Paradigm. Emerg Infect Dis 7(4):756-758. Calisher, HC and Gould EA (2003). Taxonomy of the Virus Family Flaviviridae Adv Virus Res 59:1-19. Campbell J, Hore DE (1975). Isolation of Murray Valley encephalitis virus from Sentinel chickens. Aust Vet J. 51(1):1-3. Casals J and Brown LV (1954). Hemagglutination with arthropod-borne viruses. J Exp Med 99:429-449. Casals J (1957). The arthropod-borne group of animal viruses. Tr NY Acad Sc 19:219235. Centers for Disease Control and Prevention (1993). Guidelines for Arbovirus Surveillance Programs in the United States. Available from URL: http://www.cdc.gov/nci dod/dvbid/arbor/arboguid.pdf Centers for Disease Control and Prevention (2003a). Epidemic/Epizootic West Nile Virus in the United States: Revised Guidel ines for Surveillance, Prevention, and Control. Available from URL: http://www.cdc.gov/ncidod/dvbid/westnile/resources/wnv-guidelines-aug-2003.pdf Centers for Disease Control and Prevention (2003b ). Local transmission of Plasmodium vivax malaria--Pal m Beach County, Florida, 2003. MMWR Morb Mortal Wkly Rep 52(38):908-11. Centers for Disease Control and Prevention (2004a). All About Hantaviruses: Virology. Available from URL: http://www.cdc.gov/ncidod/diseases/h anta/hps/nofra mes/phys/virology.htm

PAGE 507

482 Centers for Disease Control and Prevention (2004b). West Nile Virus: Entomology. Available from URL: http://www.cdc.gov/ncidod/dvbi d/westnile/insects.htm Centers for Disease Control and Prevention (2004c). West Nile Virus: Clinical Description. Available from URL: http://www.cdc.gov/ncidod/dvbid/westni le/clinicians/clindesc.htm #fever Centers for Disease Control and Prevention (2005a). Map: Global Distribution of Arboviral Encephalitides. Available from URL http://www.cdc.gov/ncidod/ dvbid/arbor/worldist.pdf Centers for Disease Control and Prevention (2005b). La Crosse Encephalitis Fact Sheet. Available from URL http://www.cdc.gov/ncidod/dvbid/arbor/lacfact.htm Centers for Disease Control and Prevention (2005c). Information on Arboviral Encephalitides. Available from URL: http://www.cdc.gov/ncidod/dvbid/arbor/arbdet.htm Centers for Disease Control and Prevention (2007a). Yellow Fever: Chapter 4, Yellow Book. Available from URL: http://wwwn.cdc.gov/travel/yellowBookCh4-YellowFever.aspx Centers for Disease Control and Prevention (2007b). West Nile Virus: Vertebrate Ecology. Available from URL: http://www.cdc.gov/ncidod/dvbid/ w estnile/birds&mammals.htm Centers for Disease Control and Prevention (2007c). Figure: Arbovirus Transmission Cycle. Available from URL: http://www.cdc.gov/ncidod/dvbid/arbor/schemat.pdf Centers for Disease Control and Prevention (2007d). West Nile Virus: Entomology. Mosquito Species as updated on Ap ril 13, 2007. Available from URL: http://www.cdc.gov/ncidod/dvbid/westnile/m osquitoSpecies.htm Centers for Disease Control and Prevention (2007e). West Nile Virus: Statistics, Surveillance, and Control. Archiv e of Human Cases through 2006. Available from URL: http://www.cdc.gov/ncidod/dvbid/westni le/surv&controlCaseCount06_detailed.ht m Centers for Disease Control and Prevention (2007f). West Nile Virus: BackgroundVirus History and Distribu tion. Available from URL: http://www.cdc.gov/ncidod/ dvbid/w estnile/background.htm

PAGE 508

483 Centers for Disease Control and Prevention (2007g). West Nile Virus: Vertebrate Ecology. Bird Species as updated on Ap ril 19, 2007. Available from URL: http://www.cdc.gov/ncidod/dvbid/ w estnile/birdspecies.htm Centers for Disease Control and Prevention (2007h). Influenza: The Disease. Available from URL: http://www.cdc.gov/flu/about/disease.htm Centers for Disease Control and Prevention (2007i). Map: Human Saint Louis Encephalitis Cases by State, 1964-2006. Available from URL http://www.cdc.gov/ncidod/dvbid/arbor/images/SLE_Map.jpg Centers for Disease Control and Prevention (2007j). St. Louis Encephalitis Fact Sheet. Available from URL http://www.cdc.gov/ncidod/dvbid/sle/Sle_FactSheet.html Centers for Disease Control and Prevention (2007k). St. Louis Encephalitis: Symptoms. Available from URL http://www.cdc.gov/ncidod/dvbid/sle/Sle_Symptoms.html Centers for Disease Control and Prevention (2007 l ). St. Louis Encephalitis by State. Available from URL http://www.cdc.gov/ncidod/dvbid/sl e/resources/SLEtablebystate.pdf Chamberlain, RW, Ssudia PH, Coleman PH, Beadle LD (1964) Vector Studies in the St. Louis Encephalitis Epidemic, Tampa Bay Area, Florida, 1962. Am J Trop Med Hyg 13(3):456-461. Chambers TJ, Hahn CS, Galler R, Rice CM (1990). Flavivirus Genome Organization, Expression, and Replication. Annu Rev Micro 44:649-688. Chandler LJ and Nordoff NG (1999). Identification of Genetic Variation Among St. Louis Encephalitis Virus Isolates Using Single-Strand Conformation Polymorphism Analysis. J Virol Methods 80(2): 169-178. Channock RM, and Sabin AB (1953). The hemagglutinin of St. Louis encephalitis virus. J Immunol 70:271-316. Channock RM, and Sabin AB (1954a). The hemagglutinin of Western Equine encephalitis virus: Recovery, pr operties, and use for diagnosis. J Immunol 73:337-351. Channock RM, and Sabin AB (1954b). The hemagglutinin of West Nile virus: Recovery, properties and antigenic relationships. J Immunol 73:352-362.

PAGE 509

484 Chantler J, Wolinsky JS, and Tingle A (2001). In Fields Virology, Vol 1, Fourth Edition. Knipe DM and Howley PM, eds. Rubella Virus. Lippincott, Williams, and Wilkins, Philadelphia, PA. 963-990. Chappell WA, Sasso DR, Toole RF, Monath TP (1971). Labile Serum Factor and Its Effect on Arbovirus Neutralization. Applied Microbiology 21(1):79-83. Charrel RN, Levy N, Tesh RB, Chandler LJ (1999). Use of Base Excision Sequence Scanning for Detection of Genetic Variat ions in St. Louis Encephalitis Virus isolates. J Clin Microbiol 37(6):1935-40. Charrel RN, Brault AC, Gallian P, et al (2003). Evolutionary Relationship Between Old World West Nile Virus Strains Evidence for Viral Gene Flow Between Africa, the Middle East, and Europe. Virology 315:381-388. Cilnis MJ, Kang W, Weaver SC (1996). Genetic conservation of Highlands J Viruses. Virology 218(2):343-351. Ciota AT, Ngo KA, Lovelace AO et al (2007a). Role of the mutant spectrum in adaptation and replicatio n of West Nile virus. J Gen Virol. 88(3):865-74. Ciota AT, Lovelace AO, Ngo KA, et al (2007b). Cell-specific Adaptation of Two Flaviviruses Following Serial Passa ge in Mosquito Cell Culture. Virology 357:165-174. Ciota AT, Lovelace AO, Jones SA et al (2007c). Adaptation of two flaviviruses results in differences in genetic hetero geneity and virus adaptability. J Gen Virol 88(9):2398-406. Clarke DH and Casals J (1958). Techniques for hemagglutination and hemaglutination-inhibition with arthropod-borne viruses. Am J Trop Med & Hyg 7:561-573. Coleman PH, Lewis AL, Schneider NJ, Work TH (1968). Isolations of St. Louis Encephalitis Virus From Post-mortem Tissues of Human Cases in the 1962 Florida Epidemic. Am J Epidemiol 87(3):530-538. Condit CC (2001). In Fields Virology, Vol 1, Fourth Edition. Knipe DM and Howley PM, eds. Principles of Virology. Lippincott, Williams, and Wilkins, Philadelphia, PA. 19-51. Crill DW and Chang JG (2004). Localization and Characterization of Flavivirus Envelope Glycoprotein Cross-Reactive Epitopes. J Virology 78(24): 1397513986.

PAGE 510

485 Davis CT, Beasley DWC, Guzman H, et al (2003). Genetic Variation Among Temporally and Geographically Distinct West Nile Virus Isolates Collected in the United States During 2001 and 2002. Emerg Infect Dis 9:1423-1429. Davis CT, Beasley DWC, Siirin M, et al (2004). Emergence of Attenuated West Nile Virus Isolates in Texas, 2003. Virology 330:342-350. Davis CT, Ebel GD, Lanciotti RS, et al (2005). Phylogenic Analysis of North American West Nile Virus Isolates 2001-2004: Evidence for the Emergence of a Dominant Genotype. Virology 342:252-265. Davis CT, Li L, May FJ, et al (2007a). Genetic Stasis of Dominant West Nile Virus Genotype, Houston, Texas. Emerg Infect Dis 13(4):601-604. Davis CT, Galbraith SE, Zhang S, et al (2007b). A combination of naturally occurring mutations in North American West Nile virus nonstructural pr otein genes and in the 3' untranslated region alters virus phenotype. J Virol 81(11):6111-6. Day JF (1989). The Use of Sentinel Chickens for Arbovirus Surveillance in Florida. J. Fl. Anti-Mosq. Assoc. 60:56-61. Day JF and Curtis GA (1989). Influence of Rainfall on Culex nigripalpus (Diptera:Culicidae) Blood-feeding Behavi or in Indian River County, Florida. Ann Entomol Soc Am 82:32-37. Day JF, Curtis GA, Edman JD (1990). Rainfall-directed Oviposition Behavior of Culex nigripalpus (Diptera:Culicidae) and its Influe nce on St. Louis Encephalitis Virus Transmission in Indian River County, Florida. J Med Entomol 27:43-50. Day JF and Curtis GA (1993). Annual Emergence Patterns of Culex nigripalpus Females Before, During, and After a Widesp read St. Louis Encephalitis Epidemic in South Florida. J Am Mosq Contr Assoc 9:249-253. Day JF, Storrs EE, Stark LM, et al (1995) Antibodies to St. L ouis Encephalitis Virus in Armadillos From Southern Florida. J Wildlife Dis 31(1):10-14. Day JF and Stark LM (1999). Avian Serology in a St. Louis Encephalitis Epicenter Before, During and After a Widespread Epidemic in South Florida, USA. J Med Entomol 36:614-624. Day JF and Stark LM (2000). Frequency of Saint Louis Encephalitis Virus in Humans From Florida, USA: 1990-1999. J Med Entomol 37:626-633 Day JF (2001). Predicting St. Louis Encephalitis Virus Epidemics: Lessons From Recent, and Not So Recent, Outbreaks. Annu Rev Entomol 46:111-138.

PAGE 511

486 Deardorff E, Estrada-Franco J, Brault AC, et al (2006). Introductions of West Nile virus strains to Mexico. Emerg Infect Dis 12(2):314-8. de Madrid AT and Porterfield JS (1974). The Flaviviruses (group B arboviruses): a Crossneutralization Study. J Gen Virol 23:91-96. de Souza Lopes O, de Abreu Sacchetta L, Coimbra TL et al (1979). Isolation of St. Louis Encephalitis Virus in South Brazil. Am J Trop Med Hyg. 28(3):583-5. Diaz LA, Re V, Almiron WR, et al (2006). Genotype III Saint Louis Encephalitis Virus Outbreak, Argentina, 2005. Emerg Infect Dis 12(11): 1752-1754. Dorman (1998). What is Molecular Epidemiology? Available from URL: http://www.pitt.edu/~kkr/molepi.html dos Santos CLS, Sallum MAM, Franco HM Oshiro FM, and Rocco IM (2006). Genetic Characterization of St. Louis Ence phalitis Virus Isolated from Human in Sao Paulo, Brazil. Mem Inst Oswaldo Crus, Rio De Janeiro 101(1): 57-63. Dow RP, Coleman PH, Meadows KE, and Work TH (1964). Isolation of St. Louis Encephalitis Viruses from Mosquitoes in the Tampa Bay Area of Florida During the Epidemic of 1962. Am J Trop Med Hyg 13(3): 462-468. Drake JW and Holland JJ (1999). Mutation Rates Among RNA Viruses. Proc Natl Acad Sci 96:13910-13913. Duermeyer W, Wielaard F, Vanderveen J (1979). A New Principle for the Detection of Specific IgM Antibodies Applied in an ELISA for Hepatitis. Am J Med Virol 4:25-32. Dunbar MR, Cunningham MW, Roof JC (1998). Seroprevalence of Selected Disease Agents From Free-ranging Black Bears in Florida. 34(3):612-619. Dupuis AP II, Marra PP, Kramer LD (2003). Serologic evidence of West Nile virus transmission, Jamaica, West Indies. Emerg Infect Dis. 2003 9(7):860-3. Dupuis AP II, Marra PP, Reitsma R et al (2005). Serologic evidence for West Nile virus transmission in Puerto Rico and Cuba. Am J Trop Med Hyg. 73(2):474-6. Early E, Peralta PH, Johnson K (1967). A Plaque Neutralization Method for Arboviruses. Proc Soc Exp Biol Med 25:741-747. Ebel GD, Carricaburu JE, Young DS, et al (2004). Genetic and Phenotypic Variation of West Nile Virus in New York, 2000-2003. Am J Trop Med Hyg 71(4):493-500.

PAGE 512

487 Edison M, Komar N, Sorhage F, et al (2001). Crow Deaths as a Sentinel Surveillance System for West Nile Virus in the Northeastern United States, 1999. Emerg Infect Dis 7:615-620. Estrada-Franco JG, Navarro-Lopez R, Beasley DWC, et al (2003). West Nile Virus in Mexico: Evidence of Widespread Circulation Since July 2002. Emerg Infect Dis 9:1604-1607. Fang Y and Reisen WK (2006). Previous Infection with West Nile or St. Louis Encephalitis Viruses Provides Cross Pr otection During Reinfection in House Finches. Am J Trop Med Hyg 75(3):480-485. Florida Department of Health, Bureau of Community and Environmental Health (2002). Mosquito-borne disease summary report for 2002. Available at URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/data/2002/AnnualArboviral-Activity-Summary-for-2002.pdf Florida Department of Health, Bureau of Community and Environmental Health (2007). Surveillance and Control of Sel ected Arthropod-borne Diseases in Florida, 2007 Guidebook. Available from URL: http://www.doh.state.fl.us/environment/com munity/arboviral/pdf_files/UpdatedAr boguide.pdf Florida Fish and Wildlife Conservation Commision [FWC] (2007). About the FWC, Programs. Available from URL: http://myfwc.com/About/index.htm Florida Wildlife Rehabilitators Association [FWRA] (2007). Rehabilitation in Florida. Available from URL: http://www.fwra.org/rehab/ Gainer JH, Winkler WG, Lewis AL et al (1964). Isolations of St. Louis Encephalitis Virus from Domestic Pigeons, Columbia Livia. Am J Trop Med Hyg. 13:472-4. Gascuel, O and Steel, M (2006). Neighbor-joining revealed. Mol Biol Evol 23(11):1997 2000. Gaunt MW, Sall AA, de Lamballerie X, et al (2001). Phylogenic Relationships of Flaviviruses Correlate With Their Epidemiology, Disease Association and Biogeography. J Gen Virol 82:1867-1876. Gibson UE, Heid CA, Williams PM (1996). A Novel Method for Real Time Quantitative RT-PCR. Genome Res 6:995-1001 Giladi M, Metzkor-Cotter E, Marti DA, et al (2001). West Nile Encephalitis in Israel. Emerg Infect Dis 7:654-658.

PAGE 513

488 Gould EA, de Lamballerie X, Zanotto PM, Holmes EC (2003). Origins, Evolution, and Vector/Host Coadaptations Within the Genus Flavivirus. Adv Virus Res 59:277-314. Gould HL and Fikrig E (2004). West Nile Virus: a Growing Concern? J Clin Invest 113(8):1102-1107. Griffin DE (2001). In Fields Virology, Vol 1, Fourth Edition. Knipe DM and Howley PM, eds. Alphaviruses. Lippincott Williams & Wilkins, Philadelphia, PA. 917962. Gritsun TS, Gould EA (2007). Origin and evolution of 3'UTR of flaviviruses: long direct repeats as a basis for the forma tion of secondary st ructures and their significance for virus transmission. Adv Virus Res 69:203-48. Gubler DJ, and Roehrig JT (1998). In Topley and Wilsons Microbiology and Microbial Infections, Vol 1, Virology. Mahy BWJ, Collier L, eds. Arboviruses (Togaviridae and Flaviviridae). Oxford University Press, New York, 29:579600. Gubler DJ (2001). Human Arbovirus Infections Worldwide. Ann NY Acad Sc 951:1324. Gubler DJ (2002). The Global Emergence/Resurgence of Arboviral Diseases as Public Health Problems. Arch Med Res 33:330-342. Gubler DJ (2007). The Continuing Spread of West Nile Virus in the Western Hemisphere. Clin Infect Dis 45:1039-46. Haller LC (2005). Development of a Microsphere-ba sed Immunoassay for the Detection of IgM Antibodies to West Nile Virus and St. Louis Encephalitis Virus in Sentinel Chicken Sera. M.S.P.H Thesis, College of Public Health, University of South Florida. Hayes CG (2001). West Nile Virus: Uganda, 1937, to New York City, 1999. Ann NY Acad Sci 951:25-37. Hayes EB, Komar N, Nasci RS, et al (2005a). Epidemiology and Transmission Dynamics of West Nile Virus Disease. Emerg Infect Dis 11(8):1167-1173. Hayes EB, Sejvar JJ, Zaki SR, et al (2005b). Virology, Pathology, and Clinical Manifestations of West Nile Virus Disease. Emerg Infect Dis 11(8):1174-1179. Hayes EB and Gubler DJ (2006). West Nile Virus: Epidemiology and Clinical Features of an Emerging Epidemic in the United States. Annu Rev Med 57:12.1-12.14.

PAGE 514

489 Heid CA, Stevens J, Livak KJ, Williams PM (1996). Real Time Quantitative PCR. Genome Res 6:986-994. Hess AD, Cherubin CE, LaMotte LC (1963). Relation of Temperature to Activity of Western and St. Louis Encephalitis Viruses. Am J Trop Med Hyg 12:657-667. Hofman H, Frisch-Niggemeyer W, Heinz F (1979). Rapid Diagnosis of TBE by Means of Enzyme-Linked I mmunosorbent Assay. J Gen Virol 42:505-511. Holden P, Muth D, Shriner RB, (1966). Arbovirus Hemagglutination-inhibiting in Avian Sera: Inactivation With Protamine Sulfate. Am J Epidemiol 84:67-73. Holmes EC, Worobey M, Rambaut A (1999). Phylogenic Evidence for Recombination in Dengue Virus. Mol Biol Evol 16:405-409. IHGSC, International Human Genome Sequencing Consortium (2004). Finishing the Euchromatic Sequence of the Human Genome. Nature 431: 931-945. Innis MA, Myambo KB, Gelf and DH, Brow MA (1988). DNA Sequencing With Thermus Aquaticus DNA Polymerase and Direct Sequencing of Polymerase Chain Reaction-Amplified DNA. Proc Natl Adv Sci USA 85: 9436-9440. Ito M, Yamada K, Takasaki T et al (2007). Phylogenetic analysis of dengue viruses isolated from imported dengue patients: possible aid for determining the countries where infections occurred. J Travel Med. 14(4):233-44. Jacobson ER, Ginn PE, Troutman JM, et al (2005). West Nile Virus Infection in Farmed American Alligators (Alligat or mississippiensis) in Florida. J Wildl Dis 41(1):96-106. Jamnback TL, Beaty BJ, Hildreth SW, et al (1982). Capture Immonoglobulin M Systems for Rapid Diagnosis of La Cr osse (California Encephalitis) Virus Infections. J Clin Micro 16:577-580. Jenkins GM, Rambaut A, Pybus OG, et al (2002). Rates of Molecular Evolution in RNA Viruses: a Quantitativ e Phylogenic Analysis. J Molec Evol 54:156-165. Jennings WL, Allen RH, Lewis AL (1966). Western Equine Encephalitis in a Florida Horse. Am J Trop Med Hyg 15(1): 96-97. Jennings WL, Kathein RA, Lewis AL, Bond JO (1967). Encephalitis in Horses in Hillsborough County, Florida, 1964. Am J Vet Res 28(125): 965-970. Jennings WL, Lewis AL, Sather GE, Pierce LV, Bond JO (1970). Tamiami Virus in the Tampa Bay Area. Am J Trop Med Hyg 19(3): 527-536.

PAGE 515

490 Jerzak G, Bernard KA, Kramer LD et al (2005). Genetic variation in West Nile virus from naturally infected mosquitoes and birds suggests quasispecies structure and strong purifying selection. J Gen Virol. 86(8):2175-83. Johnson AJ, Langevin S, Wolff KL, Komar N (2003). Detection of Anti-West Nile Virus Immunoglobulin M in Chicken Serum by an Enzyme-Linked Immunosorbent Assay. J Clin Micro 41(5): 2002-2007. Johnson AJ, Noga AJ, Kosoy O, et al (2005). Duplex Microsphere-Based Immunoassay for the Detection of Anti-West Nile Virus and Anti-St. Louis Encephalitis Virus Immunoglobulin M antibodies. Cl Diag Lab Imm 12(5): 566-574. Johnson NA (2007). Cladistics and Classification. In Chapter Three: Evolution and Phylogenetics. Rediscovering Biology, Online Textbook. Available at URL: http://www.learner.org/channel/cour ses/biology/textbook/compev/com pev_3.html Karabatsos N (1985). International Catalogue of Arboviruses, including certain other viruses of vertebrates. American Societ y of Tropical Medicine and Hygiene. San Antonio, Texas. Kellar KL, Kalwar RR, Dubois KA, Crouse WD, et al (2001). Multiplexed Fluorescent Bead-Based Immunoassays for Quantification of Human Cytokines in Serum and Culture Supernatants. Cytometry 45:27-36. Kilpatrick AM, Kramer LD, Jones MJ, et al (2006). West Nile Virus Encephalitis in North America Are Driven by Shifts in Mosquito Feeding Behavior. Plos Biol 4(4):e82 King NJC, Getts DR, Getts MT, et al (2007). Immunopathology of Flavivirus Infections. Immunol Cell Biol 85:33-42 Kipp AM, Lehman JA, Bowen RA, et al (2006). West Nile Virus Quantification in Feces of Experimentally Infected American and Fish Crows. Am J Trop Med Hyg 75(4):688-690. Klee AL, Maidin B, Edwin B, et al (2004). Long-term Prognosis for Clinical West Nile Virus Infection. Emerg Infect Dis 10:1405-11. Klenk K and Komar N (2003). Poor replication of West Nile virus (New York 1999 strain) in three reptilian and one amphibian species. Am J Trop Med Hyg 69(3):260-2. Klenk K, Snow J, Morgan K, et al (2004). Alligators as West Nile virus amplifiers. Emerg Infect Dis 10(12):2150-2155.

PAGE 516

491 Komar N (2001). West Nile Virus Surveillance Using Sentinel Birds. Ann NY Acad Sci 951: 58-73. Komar N, Lanciotti R, Bowen R et al (2002). Detection of West Nile virus in oral and cloacal swabs collected from bird carcasses. Emerg Infect Dis. 8(7):741-2. Komar N (2003). West Nile Virus: Epidemiology and Ecology in North America. Adv Virus Res 61:185-234. Komar N, Langevin S, Hinten S, et al (2003). Experimental Infection of North American Birds with the New York 1999 Strain of West Nile Virus. Emerg Infect Dis 9(3):311-322. Kramer LD, Presser SB, Hardy JL, Jackson AO (1997). Genotype and Phenotype Variation of Selected Saint Louis Encephali tis Viral Strains Isolated in California. Am J Trop Med Hyg 57(2):222-229. Kramer LD and Chandler LJ (2001). Phylogenic Analysis of th e Envelope Gene of St. Louis Encephalitis Virus. Arch Virol 146:2341-2355. Kramer LD and Shi P-Y (2007). West Nile Virus. Lancet Neurol 6: 171-181. Kuno G, Chang GJ, Tsuchiya KR, et al (1998). Phylogeny of the Genus Flavivirus J Virol 72(1):73-83. Kuno G (2001). Persistence of Arboviruses and Antiv iral Antibodies in Vertebrate Hosts: its Occurrence and Impacts. Rev Med Virol 11:165-190. Kuno G and Chang G-J J (2005). Biological Transmission of Arboviruses: Reexamination of and New Insights into Components, Mechanisms, and Unique Traits as Well as Their Evolutionary Trends. Clin Microbiol Rev 18(4): 608-637. LaDeau SL, Kilpatrick AM, Marra PP (2007). West Nile Virus Emergence and Large-Scale Declines of Nort h American Bird Populations. Nature 447(7145):710-713. Lambert AJ, Martin DA, Lanciotti RS (2003). Detection of North American Eastern and Western Equine Encephalitis Viruses by Nucleic Acid Amplification Assays. J Clin Microbiol 41: 379-385. Lanciotti RS, Roehrig JT, Deubel VS, et al (1999). Origin of the West Nile Virus Responsible for an Outbreak of En cephalitis in the No rtheastern U.S. Science 286:2333-2337.

PAGE 517

492 Lanciotti RS, Kerst AJ, Nasci RS, et al (2000). Rapid Detection of West Nile Virus From Human Clinical Specimens, Fiel d Collected Mosquitoes, and Avian Samples by a TaqMan Reverse Transcriptase-PCR Assay. J Clin Microbiol 38(11): 4066-4072. Lanciotti RS and Kerst AJ (2001). Nucleic Acid Sequence-Based Amplification Assays for Rapid Detection of West Nile and St. Louis Encephalitis Viruses. J Clin Microbiol 39(12): 4506-4513. Lanciotti RS, Ebel GD, Deubel V, et al (2002). Complete Genome Sequences and Phylogenetic Analysis of West Nile Virus Strains Isolated From the United States, Europe and The Middle East. Virology 298:96-105. Lanciotti RS (2003). Molecular Amplification Assays for the Detection of Flaviviruses. Adv Virus Res 61: 67-99. Lanciotti RS, Kosoy OL, Laven JJ, et al (2007). Chikungunya Virus in US Travelers Returning from India, 2006. Em erg Infect Dis 13(5):764-767. Langevin SA, Bunning M, Davis B, Komar N (2001). Experimental Infection of Chickens as Candidate Sentin els for West Nile Virus. Emerg Infect Dis 7(4):726729. Langevin SA, Brault A, Panella NA, et al (2005). Variation of West Nile Virus Strain Virulence for House Sparrows (Passer domesticus ). Am J Trop Med Hyg 72:99102. Leis AA, Stokie DS, Polk JL, et al (2002). A Poliomyelitis-like Syndrome From West Nile Virus Infection. N Engl J Med 347:1279-1280. Lewis AL, Jennings WL, Schneider NJ (1964). The First Isolation of St. Louis Encephalitis Virus From Mosquitoes in Florida. Proc Soc Exp Biol Med 116: 961963. Lewis AL, Hammon WM, Sather GE, et al (1965). Isolations of a California Group Arbovirus From Florida Mosquitoes. Am J Trop Med Hyg 14(3): 451-455. Lillibridge KM, Parsons R, Randle Y, et al (2004). The 2002 Introduction of West Nile Virus Into Harris County, Texas, an Ar ea Historically Endemic For St. Louis Encephalitis. Am J Trop Med Hyg 70(6):676-681. Lindenbach BD and Rice CM (2001). In Fields Virology, Vol 1, Fourth Edition. Knipe DM and Howley PM, eds. Flaviviridae: The Viruse s and Their Replication. Lippincott, Williams, and Wilkin s, Philadelphia, PA. 991-1041.

PAGE 518

493 Lindenbach BD and Rice CM (2003). Molecular Biology of Flaviviruses. Adv Virus Res 59: 23-61. Lindsey HS, Calisher CH, Mathews JH (1976). Serum Dilution Neutralization Test for California Group Virus Identification and Serology. J Clin Micro 4(6):503-510. Lord CC and Day JF (2001). Simulation Studies of St. Louis Encephalitis and West Nile Viruses: the Impact of Bird Mortality. Vector Borne Zoonotic Dis 1(4):317329. Luby JP, Sulkin SE, Sanford JP (1969). The Epidemiology of St. Louis Encephalitis: A Review. Annual Reviews Med 20:329-349 Lumsden LL (1958). St. Louis Encephalitis in 1933. Ob servations on Epidemiological Features. Public Health Rep 73:340-353. Marciniak C, Sorosky S and Hynes C (2004). Acute Flaccid Paralysis Associated With West Nile Virus: Motor and Func tional Improvement in 4 Patients. Arch Phys Med Rehabil 85:1933-1938. Marra PP, Griffing SM, McLean RG (2003). West Nile Virus and Wildlife Health. Emerg Infect Dis 9:898:899. Martell M, Gomes J, Esteban JI, et al (1999). High-Throughput Real-Time Reverse Transcription-PCR quantificati on of Hepatitis C Virus RNA. J Clin Microbiol 37: 327-332. Martin DA, Muth DA, Brown T, et al (2000). Standardization of Immunoglobulin M Capture Enzyme-Linked I mmunosorbent Assays for Routine Diagnosis of Arboviral Infections. J Clin Microbiol 38(5):1823-1826. Mayo MA and Pringle CR (1998). Virus Taxonomy 1997. J Gen Virol 79:649-657. McHugh TM, Viele MK, Chase ES, Recktenwald DJ (1997). The Sensitive Detection and Quantitation of Antibody to HCV by using a mircosphere-based immunoassay and flow cytometry. Cytometry 29(2):106-112. McLean RG and Bowen GS (1980). Vertebrate hosts. In St. Louis Encephalitis. Monath TP ed. American Public Health Association, Washington, DC. 381-450. McLean RG, Mullenix J, Kers chner J and Hamm J (1983). The House Sparrow ( Passer domesticus) as a Sentinel for St Louis Encephalitis. Am J Trop Med Hyg 32:1120-1129.

PAGE 519

494 Mullis, KB and Faloona, FA (1987). Specific Synthesis of DNA in Vitro Via a Polymerase-catalyzed Chain Reaction. Methods Enzymol. 155:335-350. McLean RG, Ubico SR, Docherty DE, et al (2001). West Nile Virus Transmission and Ecology in Birds. Ann NY Acad Sci 951: 54-57. McMinn PC (1997). The Molecular Basis of Viru lence of the Encephalitogenic Flaviviruses. J Gen Virol 78:2711-2722. Meehan PJ, Wells DL, Paul W, et al (2000). Epidemiological Features of and Public Health Response to a St. Louis Ence phalitis Epidemic in Florida, 1990-1. 125(1):181-188. Meyer RP, Hardy JL, Reisen WK (1990). Diel Changes in Adult Mosquito Microhabitat Temperatures and Their Rela tionship to the Extrinsic Incubation of Arboviruses in Mosquitoes in Kern County, California, USA. J Med Entomol 27:607-614. Monath TP (1979). Arthropod-borne Encephaliti des in the Americas. Bul World Health Org 57(4):513-533. Monath TP (1980). Epidemiology. In St. Louis Encephalitis. M onath TP, ed. American Public Health Associat ion, Washington, DC. 239-312. Monath TP, Cropp CB, Bowen GS, et al (1980). Variation in Virulence for Mice and Rhesus Monkeys Among St. Louis Encephal itis Virus Strains of Different Origin. Am J Trop Med Hyg 29(5): 948-962. Monath TP, Nystrom RR, Bailey RE, et al (1984). Immunoglobulin M Antibody Capture Enzyme-Linked Immunosorbent Assay for Diagnosis of St. Louis Encephalitis. J Clin Microbiol 20(4):784-790. Mondini A, Cardeal ILS, Lazaro E, et al (2007a). Saint Louis Encephalitis Virus, Brazil. Emerg Infect Dis 13(1):176-178. Mondini A, Bronzoni RV, Cardeal IL, dos Santos TM, et al (2007b) Simultaneous infection by DENV-3 and SLEV in Brazil. J Clin Virol 40(1):84-86. Morales MA, Barrandeguy M, Fabbri C, et al (2006). West Nile Virus Isolation from Equines in Argentina, 2006. Emerg Infect Dis 12(10): 1559-1561. Morris T, Robertson B, and Gallagher M (1996). Rapid Reverse Transcription-PCR Detection of Hepatitis C Virus RNA in Serum by Using the TaqMan fluorogenic Detection System. J Clin Microbiol 34: 2933-2936.

PAGE 520

495 Nelson DB, Kappus KD, Janowski HT, et al (1983). St. Louis encephalitisFlorida 1977. Patterns of a widespread outbreak. Am J Trop Med Hyg 32:412-416. Nemeth N, Kratz G, Edwards E, et al (2007). Surveillance for West Nile Virus in Clinic-Admitted Raptors, Colorado. Emerg Infect Dis 13(2):305-307. Nichol ST, Rowe JE, Fitch WM (1993). Punctuated equilibrium and positive Darwinian evolution in vesicular stomatitis virus. Proc Natl Acad Sci USA. 15;90(22):10424-8. Ogata M and Byrne RJ (1961). Relationships between eastern and western equine encephalitis viruses as demonstrated by the hemagglutination-inhibition antibody response of experimentally infected chickens. Am J Vet Res. 22:266-70. Oglivie, M (2001). Molecular Techniques Should Not Now Replace Cell Culture in Diagnostic Virology laboratories. Reviews in Medical Virology 11:351-354. O'Leary DR, Marfin AA, Montgomery SP, et al (2004). The Epidemic of West Nile Virus in the United States, 2002. Vector Borne Zoonotic Dis 4(1):61-70. Olson JG, Scott TW, Lorenz LH, Hubbard JL (1991). Enzyme Immunoassay for Detection of Antibodies Against East ern Equine Encephalitis Virus in Sentinel Chickens. J Clin Micro 29(7):1457-1461. Papin JF, Vahrson W, and Dittmer DP (2004). SYBR Green-Based Real-Time Quantitative PCR Assay for Detection of West Nile Virus Circumvents FalseNegative Results Due to Strain Variability. J Clin Microbiol 42(4): 1511-1518. Payne AF, Binduga-Gajewska I, Kauffman EB et al (2006). Quantitation of flaviviruses by fluorescent focus assay. J Virol Methods. 134(1-2):183-9. Pealer LN, Marfin AA, Petersen LR, Lanciotti RS, et al (2003). Transmission of West Nile virus through blood transfusi on in the United States in 2002. N Engl J Med. 349(13):1236-45. Peleman R (2004). New and Re-emerging Infectious Diseases: Epidemics in Waiting. Curr Opin Anaesthesiol 17:265-270. Pierce DA (2003). Real Time PCR: The TaqMan Method. Available from URL: http://www.bio.davidson.edu/Courses/Mo lbio/MolStudents/spring2003/Pierce/rea ltimepcr.htm Quick DT, Smith AG, Lewis AL, et al (1965). California Encephaliti s Virus Infection: A Case Report. Am J Trop Med Hyg 14(3): 456-459.

PAGE 521

496 Rappole JH, Derrickson SR and Hubalek Z (2000). Migratory Birds and Spread of West Nile Virus in the Western Hemisphere. Emerg Infect Dis 6(4): 319-328. Reeves WC and Hammon WM (1962). Epidemiology of the Arthropod-borne Viral Encephalitis in Kern C ounty, California, 1943-1952. Univ Calif Berkley Publ Health 4:1-257. Reisen WK, Presser SB, Lin J, et al (1994). Viremia and Serological Responses in Adult Chickens Infected with Wester n Equine Encephalitis and St. Louis Encephalitis Viruses. J Am Mosq Control Assoc 10(4):549-555. Reisen WK and Chiles RE (1997). Prevalence of Antibodies to Western Equine Encephalitis and St. Louis Encephalitis Viruses in Residents of California Exposed to Sporadic and Cons istent Enzootic Transmission. Am J Trop Med Hyg 57:526-529. Reisen WK, Chiles RE, Kramer LD, et al (2000a). Method of Infection Does Not Alter Response of Chicks and House Finches to Western Equine Encephalitis and St. Louis Encephalitis Viruses. J Med Entomol 37(2):250-258. Reisen WK, Lundstrom JO, Scott TW, et al (2000b). Patterns of Avian Seroprevalence to Western Equine Encephalitis and St. L ouis Encephalitis Viruses in California, USA. J Med Entomol 37:507-527. Reisen WK, Lothrop HD, Chiles RE, et al (2002). Persistance and Amplification of St. Louis Encephalitis Virus in the Coachella Valley of California. J Med Entomol 39(5):793-805. Reisen WK (2003). Epidemiology of St. L ouis Encephalitis Virus. Adv Virus Res 61:139-183. Reisen WK, Chiles RE, Martinez VM, et al (2003). Experimental Infection of California Birds With Western Equine Encephalitis and St. Louis Encephalitis Viruses. J Med Entomol 40(6):968-982. Reisen WK, Chiles RE, Martinez VM, et al (2004a). Encephalitis Virus Persistence in California Birds: Experimental Infections in Mourning Doves ( Zenaidura macroura) J Med Entomol 41:462-466. Reisen W, Lothrop H, Chiles R, et al (2004b). West Nile Virus in California. Emerg Infect Dis 10(8):1369-1378. Reisen WK, Fang Y, Martinez VM (2005). Avian Host and Mosquito (Diptera: Culicidae) Vector Competence Determine th e Efficiency of West Nile and St. Louis Encephalitis Virus Transmission. J Med Entomol 42(3):367-375.

PAGE 522

497 Reisen WK, Fang Y, Martinez VM (2006). Effects of Temperature on the Transmission of West Nile Virus by Culex tarsalis (Diptera: Culicidae). J Med Entomol 43(2):309-317. Reisen WK, Fang Y, Lothrop HD, et al (2006). Overwintering of West Nile Virus in Southern California. J Med Entomol 43(2):344-355. Reisen WK and Hahn DC (2007). Comparison of Immune Responses of Brown-headed Cowbird and Related Blackbirds to We st Nile and Other Mosquito-borne Encephalitis Viruses. J Wildl Dis 43(3):439-449. Rice CM, Lenches EM, Eddy SR, et al (1985). Nucleotide Sequence of Yellow Fever Virus: Implications for Flavivir us Gene Expression and Evolution. Science 229: 726-733. Rocco IM, Santos CLS, Bisordi I, et al (2005). St. Louis Encephalitis Virus: First Isolation from a Human in Sao Paulo State, Brazil. Rev Inst Med Trop S Paulo 47(5): 281-285. Roehrig JT, Mathews JH and Trent DW (1983). Identification of epitopes on the E glycoprotein of Saint Louis encephalitis virus using monoclonal antibodies. Virology 128(1): 118. Roggendorf M, Heinz F, Deinhardt F, Kunz C (1981). Serologic Diagnosis of Acute Tick-Borne Encephalaits by Demonstrati on of Antibodies of the IgM Class. J Med Virol 7:41-50. Sabattini MS, Monath TP, Mitchell CJ, et al (1985). Arbovirus Investigations in Argentina, 1977-1980. Historical Aspect s and Descriptions of Study Sites. Am J Trop Med Hyg 34:937-944. Sabin AB, and Buescher, EL (1950). Unique physico-chemical properties of Japanese B encephalitis virus hemagglutinin. Proc Soc Exp Biol Med 74:222-230. Sabin AB (1951). Hemagglutination by Viruses Aff ecting the Human Nervous System. Fed Proc 10:573-578. Saiki RK, Gelfand DH, Stoffel S, et al (1988). Primer-directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase. Science 239:487491. Saitou, N and Nei, M (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Evol Biol 4(4):406-425.

PAGE 523

498 Samuel MA and Diamond MS (2006). Pathogenesis of West Nile Virus Infection: a Balance Between Virulence, Innate and Adaptive Immunity, and Viral Evasion. J Virol 80(19): 9349-9360. Sanders MA, Blumberg, and Haymaker, W (1953). Polyradiculopathy in Man Produced by St. Louis Encephalitis Virus (SLE). South Med J 46:606-608. Sanger F and Coulson AR (1975). A Rapid Method for Determining Sequences in DNA by Primed Synthesis with DNA Polymerase. J Mol Biol 94(3): 441-448. Sardelis MR, Turell MJ, Do hm DJ, OGuinn ML (2001). Vector Competence of Selected North American Culex and Coquillettidia Mosquitoes for West Nile Virus. Emerg Infect Dis 7(6):1018-1022 Sather GE, Lewis AL, Jennings W, Bond JO, Hammon WM (1970). Sawgrass Virus: A Newly Described Arbovirus in Florida. Am J Trop Med Hyg 19(2): 319-326. Savage HM, Ceianu C, Nicolescu G, et al (1999). Entomologic and Avian Investigations of an Epidemic of West Nile Fever in Romania, 1996, with Serologic and Molecular Characteriza tion of a Virus From Mosquitoes. Am J Trop Med Hyg 61:600-611. Schlesinger S and Schlesinger MJ (2001). In Fields Virology, Vol 1, Fourth Edition. Knipe DM and Howley PM, eds. Togaviridae: The Viruses and Their Replication. Lippincott, Williams, and Wilkin s, Philadelphia, PA. 895-916. Schmitz H, von Deimling V, Fleming B (1980). Detection of IgM Antibodies to CMV Using an Enzyme-Labelled Antigen. J Gen Virol 50:59-68. Schwab PM (1968). Economic Cost of St. Louis Encephalitis Epidemic in Dallas, Texas, 1966. Public Health Rep 83:860-866. Scott TW, and Weaver SC (1989). Eastern equine en cephalitis virus: epidemiology and evolution of mosquito transmission. Adv Virus Res 37:277328. Scott TW, Wright SA, Eldridge BF and Brown DA (2001). Cost Effectiveness of Three Arbovirus Surveillance Me thods in Northern California. J Am Mosq Control Assoc 17:118-123. Sejvar JJ, Bode AV, Curi el M, Marfin AA (2004). Post-infectious Encephalitis Associated with St. Louis Encephalitis Virus Infection. Neurology 63:1719-1721. Shaman J, Day JF, Stieglitz M (2002). Drought-Induced Amplification of Saint Louis Encephalitis Virus, Florida. Emerg Infect Dis 8:575-580.

PAGE 524

499 Shaman J, Day JF, Stieglitz M (2003a). St. Louis Encephalitis Virus in Wild Birds During the 1990 South Florida Epidemic: the Importance of Drought, Wetting Conditions, and the Emergence of C ulex nigripalpus to Arboviral Amplification and Transmission. J Med Entomol 40:547-554. Shaman J, Stieglitz M, Zebiak S, et al (2003b). A Local Forecast of Land Surface Wetness Conditions Derived From Seasonal Climate Predictions. J Hydromet 4:611-626. Shaman J, Day JF, Stieglitz M, et al (2004). Seasonal Forecast of St. Louis Encephalitis Transmission, Florida. Emerg Infect Dis 10(5):802-809. Shaman J, Day JF, Stieglitz M (2004). The Spatial-Temporal Distribution of Drought, Wetting and Human Cases of St. Louis Encephalitis Virus in Southcentral Florida. Am J Trop Med Hyg 71(3):251-261. Shaman J, Day JF, Stieglitz M (2005). Drought-Induced Amplification and Epidemic Transmission of West Nile Virus in Southern Florida. J Med Entomol 42(2):134141. Shroyer DA (1991). The 1990 Florida Epidemic of St. Louis Encephalitis: Virus Infection Rates in Culex nigripalpus J Fla Mosq Control Assoc 62:69-71. Sitati EM and Diamond MS (2006). CD4+ T-cell responses are required for clearance of West Nile virus from the central nervous system. J Virol 80(24):12060-9. Snapinn KW, Holmes EC, Young DS, et al (2007). Declining Growth Rate of West Nile Virus in North America. J Virol 81(5):2531-2534. Spinsanti LI, Re VE, Diaz MP, Contigiani MS (2002). Age-related Seroprevalence Study for St. Louis Encephalitis in a Population From Cordoba, Argentina. Rev Inst Med Trop Sao Paulo 44(2):59-62. Spinsanti L, Basquiera AL, Bulacio S, et al (2003). St. Louis Encephalitis in Argentina: The First Case Reported in the Last Seventeen Years. Emerg Infect Dis 9(2): 271273. Stark LM and Kazanis D (2001). Florida Department of Health. Arbovirus Surveillance: Annual Summary Report, 2001. Available from URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm Stark LM and Kazanis D (2002). Florida Department of Health. Arbovirus Surveillance: Annual Summary Report, 2002. Available from URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm

PAGE 525

500 Stark LM and Kazanis D (2003). Florida Department of Health. Arbovirus Surveillance: Annual Summary Report, 2003. Available from URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm Stark LM and Kazanis D (2004). Florida Department of Health. Arbovirus Surveillance: Annual Summary Report, 2004. Available from URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm Stark LM and Kazanis D (2005). Florida Department of Health. Arbovirus Surveillance: Annual Summary Report, 2005. Available from URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm Stark LM and Kazanis D (2006). Florida Department of Health. Arbovirus Surveillance: Annual Summary Report, 2006. Available from URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm Stark LM and Kazanis D (2007). Florida Department of Health. Arbovirus Surveillance: Annual Summary Report, 2007. Available from URL: http://www.doh.state.fl.us/environment/c omm unity/arboviral/survey-info.htm Storch GA (2001). In Fields Virology, Vol 1, Fourth Edition. Knipe DM and Howley PM, eds. Diagnostic Virology. Lippincott, Williams, and Wilkins, Philadelphia, PA. 439-531. Sulkin SE, Sims RA, Allen R (1966). Isolation of St. Louis Encephalitis Virus From Bats (Tadarida b. mexicana) in Texas. Science 152(3719):223-225. Sweet BH, and Sabin AB (1954). Properties and antigenic relationships of hemagglutinins associated with the dengue viruses J Immunol 73:363-373. Tamura K, Dudley J, Nei M and Kumar S (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software version 4.0. Mol Biol Evol 24:1596-1599. Tanaka M (1993). Rapid identification of flavivirus using the polymerase chain reaction. J Virol Methods. 41(3):311-22. Taylor DJ, Meadows KE, Lewis AL, Bond JO (1968). Arbovirus Vector Surveillance Following the 1962 St. Louis Encephalitis Epidemic in the Tampa Bay Area. Mosquito News 28(1):42-45. Tesh RB, Travassos da Rosa APA, Guzman H, et al (2002). Immunization with Heterologous Flaviviruses Protective Ag ainst Fatal West Nile Encephalitis. Emerg Infect Dis 8:245-261.

PAGE 526

501 Tolou H, Couissinier-Paris P, Durand JP, et al (2001). Evidence for Recombination in Natural Populations of Dengue Virus Type 1 Based on the Analysis of Complete Genome Sequences. J Gen Virol 82:1283-1290. Trainer DO and Hoff GL (1971). Serologic Evidence of Arbovi rus Activity in a Moose Population in Alberta. J Wildlife Dis 7:118-119. Trainor NB, Crill WD, Roberson JA et al (2007). Mutation analysis of the fusion domain region of St. Louis encep halitis virus envelope protein. Virology. 360(2):398-406. Trent DW, Monath TP, Bowen GS, et al (1980). Variation Among Strains of St. Louis Encephalitis Virus: Basis for a Ge netic, Pathogenic, and Epidemiologic Classification. Ann NY Acad Sci 354:219-237. Trent DW, Grant JA, Vorndam AV, and Monath TP (1981). Genetic Heterogeneity Among Saint Louis Encephalitis Virus Isol ates of Different Geographic Origin. Virology 114: 319-332. Trent DW, Kinney RM, Johnson BJ, et al (1987). Partial Nucleotide Sequence of St. Louis Encephalitis Virus RNA: Structural Proteins, NS1, ns2a, and ns2b. Virology 156:293-304. Trevejo RT and Reeves WC (2005). Antibody Response to Culex tarsalis Salivary Gland Antigens Among Sentinel Chickens in California. Am J Trop Med Hyg 72(4):481-487. Tsai, TF and Mitchell CJ (1989). In The Arboviruses: Epidemiology and Ecology. Monath TP, ed. St. Louis Encephalitis. CRC Press, Boca Raton, Florida. 431-458. Tung YC, Lin KH, Chang K et al (2008). Phylogenetic study of dengue-3 virus in Taiwan with sequence anal ysis of the core gene. Kaohsiung J Med Sci. 24(2):5562. Turell MJ, OGuinn ML, Jones JW, et al (2005). Isolation of Viruses From Mosquitoes (Diptera: Culicidae) Collected in the Amazon Basin Region of Peru. J Med Entomol 42(5):891-898. Twiddy SS and Holmes EC (2003). The Extent of Homologous Recombination in Members of the Genus Flavivirus. J Gen Virol 84: 429-440. United States Geological Survey[USGS] (2007). West Nile Virus Historical Disease Maps: Bird. Available from URL: http://diseasemaps.usgs .gov/wnv_historical.htm l

PAGE 527

502 Vaughn DW, Green S, Kalayanarooj S et al (2000). Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. J Infect Dis. 181(1):2-9. Vignali DA (2000). Multiplexed Particle-Based Flow Cytometric Assays J Immunol Methods 243:243-255. Villari P, Spielman A, Komar N, et al (1995). The Economic Burden Imposed by a Residual Case of Eastern Encephalitis. Am J Trop Med Hyg 52(1):8-13. Watson JT, Pertel PE, Jones RC, et al (2004). Clinical Characteristics and Functional Outcomes of West Nile Fever. Ann Intern Med 141:360-365. Weaver SC, Rico-Hesse R, Scott TW, et al (1992). Genetic Diversity and Slow Rates of Evolution in New World Alphaviruses. Curr Top Microbiol Immunol 176:99-117. Weaver SC, Hagenbaugh A, Bellew LA, et al (1994). Evolution of Alphaviruses in the Eastern Equine Encephalitis Complex. J Virol 68(1):158-169. Weaver SC, Kang W, Shirako Y, et al (1997). Recombinational History and Molecular Evolution of Western Equine En cephalitis Complex Alphaviruses. J Virol 71(1):613-623. Weaver SC and Barrett ADT (2004). Transmission Cycles, Host Range, Evolution and Emergence of Arboviral Disease. Nature Rev 2:789-801. Wegbreit J and Reisen WK (2000). Relationship Among Weather, Mosquito Abundance and Encephalitis Virus Activ ity in California: Kern County 19901998. J Am Mosq Control Assoc 16:22-27. Wellings FM, Lewis AL, Pierce LV (1972). Agents Encountered During Arboviral Ecological Studies: Tampa Bay Area, Florida, 1963 to 1970. Am J Trop Med Hyg 21(2):201-213. Worobey M and Holmes EC (1999). Evolutionary Aspects of Recombination in RNA Viruses. J Gen Virol 80:2535-2543. Zanotto PM, Gao GF, Gritsum T, et al (1995). An Arbovirus Cline Across the Northern Hemisphere. Virology 210:152-159. Zanotto PM, Gibbs MJ, Goul d EA, Holmes EC (1996a). A Reevaluation of the Higher Taxonomy of Viruses Based on RNA Polymerases. Virology 210:152-159.

PAGE 528

503 Zanotto PM, Gould EA, Gao GF, et al (1996b). Population Dynamics of Flaviviruses Revealed by Mol ecular Phylogenies. Proc Natl Acad Sci 93:548-553. Zohrabian A, Meltzer MI, Ratard R, et al (2004). West Nile Virus Economic Impact, Louisiana, 2002. Emerg Infect Dis 10(10):1736-1744. Zohrabian A, Hayes EB, Petersen LR (2006). Cost-effectiveness of West Nile Virus Vaccination. Emerg Infect Dis 12(3):375-380.

PAGE 529

504 APPENDICES

PAGE 530

505 APPENDIX A Media Components Abbreviations Description BSA Bovine Serum Albumin EMEM Minimal Eagl e Media, Earles Salts FCS Fetal Calf Serum HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HMEM Minimal Eagle Media, Hanks Salts L15 Leibowitz Media NCS Newborn Calf Serum Outgrowth Media to Passage Vero Cells Reagent ml Vendor Catalog Number 1X HMEM 1X L15 NCS (inactivated) Penicillin (200,000 U/ml) Streptomycin (200 mg/ml) Amphotericin B (2.5 mg/ml) Kanamycin (50 mg/ml) 45.0 45.0 10.0 0.1 0.1 0.1 0.1 Sigma Sigma HyClone Sigma Sigma Sigma Sigma M-1018 L-4386 SH30118.03 P-7794 S-9137 A-9258 K-1377 Liquid Maintenance Media to Maintain Vero Cells After Inoculation Reagent ml Vendor Catalog Number 1X EMEM NCS (inactivated) Penicillin (200,000 U/ml) Streptomycin (200 mg/ml) Amphotericin B (2.5 mg/ml) Kanamycin (50 mg/ml) HEPES (1 M) 100.0 2.0 0.1 0.1 0.1 0.1 1.0 Sigma HyClone Sigma Sigma Sigma Sigma Sigma M-1018 SH30118.03 P-7794 S-9137 A-9258 K-1377 H-4034

PAGE 531

506 APPENDIX A: (CONTINUED) Media-Agar Overlay for Plaque A ssay and PRNT (First Overlay) Reagent ml Vendor Catalog Number 10X EMEM Sterile Reagent Grade H2O L-glutamine (200 mM) NaHCO3 (8.8%) FCS (inactivated) HEPES (1 M) Penicillin (200,000 U/ml) Streptomycin (200 mg/ml) Amphotericin B (2.5 mg/ml) Kanamycin (50 mg/ml) 10.0 32.9 1.0 2.5 2.0 1.2 0.1 0.1 0.1 0.1 Sigma --Sigma Sigma HyClone Sigma Sigma Sigma Sigma Sigma M-0275 ----G-7513 S233-500 SH30070.03 H-4034 P-7794 S-9137 A-9258 K-1377 Warm media to 37C. Prepare agarose overlay (below) in a 2x larger flask. Autoclave agarose/H2O mixture below for 15 min, 121 PSI. Remove from autoclave and cool gel in a 37C water bath until warm to the touch. Aseptically combine media into th e flask with agarose overlay. SeaKem Agarose Sterile Reagent Grade H2O 2.0 g 50.0 ml Cambrex ------50004 -----Media-Agar Overlay for Plaque Assay and PRNT (Second Overlay) Reagent ml Vendor Catalog Number 10X EMEM Sterile Reagent Grade H2O L-glutamine (200 mM) NaHCO3 (8.8%) FCS (inactivated) HEPES (1 M) Penicillin (200,000 U/ml) Streptomycin (200 mg/ml) Amphotericin B (2.5 mg/ml) Kanamycin (50 mg/ml) Neutral Red (0.33 mg/ml) 10.0 32.5 1.0 2.5 2.0 1.2 0.1 0.1 0.1 0.1 0.4 Sigma --Sigma Sigma HyClone Sigma Sigma Sigma Sigma Sigma Sigma M-0275 ----G-7513 S233-500 SH30070.03 H-4034 P-7794 S-9137 A-9258 K-1377 N-2889 Warm media to 37C. Prepare agarose overlay (below) in a 2x larger flask. Autoclave agarose/H2O mixture below for 15 min, 121 PSI. Remove from autoclave and cool gel in a 37C water bath until warm to the touch. Aseptically combine media into the flask with agarose overlay. SeaKem Agarose Sterile Reagent Grade H2O 1.0 g 50.0 ml Cambrex ------50004 -----

PAGE 532

507 APPENDIX A: (CONTINUED) Biology Field Diluent (BFD) Reagent ml Vendor Catalog Number 1X HMEM FCS (inactivated) Penicillin (200,000 U/ml) Streptomycin (200 mg/ml) Amphotericin B (2.5 mg/ml) Kanamycin (50 mg/ml) 90 10 0.1 0.1 0.1 0.1 Sigma HyClone Sigma Sigma Sigma Sigma M-1018 SH30070.03 P7794 S9137 A9258 K1377 Bovine Serum Albumin (BSA) Stock Solution (10%) Reagent g/ml Vendor Catalog Number BSA 1X EMEM 10.0 g 90.0 ml Millipore Sigma 81-066-4 M-0275 Dissolve BSA in 1X EMEM, filter sterilize. QS to 100.0 ml Serum Virus Diluent (SVD) Reagent ml Vendor Catalog Number 1X EMEM BSA Stock Solution (10%) FCS (non-inactivated) HEPES (1 M) Penicillin (200,000 U/ml) Streptomycin (200 mg/ml) Amphotericin B (2.5 mg/ml) Kanamycin (50 mg/ml) 81.0 10.0 8.0 1.0 0.1 0.1 0.1 0.1 Sigma Millipore HyClone Sigma Sigma Sigma Sigma Sigma M-0275 81-066-4 SH30070.03 H-4034 P7794 S9137 A9258 K1377

PAGE 533

508 APPENDIX B Serologic Assay and Virus Specific Reagents Hemagglutination Inhibition Assay Antigens Strain Date Prepared SLEV Antigen EEEV Antigen SLEV TBH 28 EEEV D64-837 11/04, 04/06 11/04 Note: Antigens prepared at the Florida Department of Health, Tampa Laboratory. IgM Antibody Capture ELISA (Chicken) Virus & Negative Antigens Strain Date Prepared Vendor Catalog Number WNV Mouse Brain Antigen SLEV Mouse Brain Antigen EEEV Mouse Brain Antigen Normal Mouse Brain Antigen WN Eg101 SMB SLE TBH 28 EEE D64-837 NMB 02/06/03 ----11/05/04 ----FDOH-TL CDC FDOH-TL CDC NA M29797 NA M29714 Antibodies Strain Vendor Catalog Number Capture Antibody (goa t anti-chicken) Conjugate Antibody 6B6C-1 ( Flavivirus group peroxidase conjugated monoclonal antibody) Conjugate Antibody 2A2C-3 ( Alphavirus group peroxidase conjugated monoclonal antibody) -----SLE MSI-7 WEE McMillian MP Biomedicals CDC CDC 64395 VS2338 VS2371 Vendors: CDC antigens obtained from the Centers for Disease Control and Prevention, Fort Collins, Colorado. FDOH-TL antigens prepared at the Flor ida Department of Health, Tampa Laboratory.

PAGE 534

509 APPENDIX B: (CONTINUED) Plaque Reduction Neutralization Test Virus Strain Passage Date Prepared WNV SLEV EEEV HJV Eg101 TBH 28 D64-837 64A-1519 SM2, Vero 2 SM2, Vero 3 SM11, Vero 1 SM11, Vero 2 SM8, BGM 2, Vero 1 SM4, BGM 1, Vero 1 10/21/04 04/11/06 10/21/04 04/11/06 01/15/05 01/15/05 Note: Viruses prepared at the Florida Depa rtment of Health, Tampa Laboratory. See Appendix I for all media reagents needed for the PRNT assay.

PAGE 535

510 APPENDIX C Cloacal Swab Sampling Criteria & Protocol for Wild Rehabilitated Birds The swab samples will be screened for WNV and SLEV. Additional viruses (such as Eastern Equine Encephalitis, California & Highlands J) may also be added to the panel based on other types of surveillance da ta (e.g. dead bird, sentinel chicken) in the sampling region. Please note that this proj ect is experimental and results will be returned as quickly as possible. Packing List 1. Each box contains 2 coolers, 2 room temperature gel packs, 40 swabs, ziplock bags, 1 copy of the submittal form, the sample protocol, and 2 shipping address labels. 2. The cloacal swab culture tubes may re main at room temperature until the sample is collected. Freeze provided gel packs until needed for shipment to lab. Sample Criteria 1. Please do N OT swab all birds that are admitted to the facility. Do NOT swab birds that are at the facility only as a result of accidental/intentional humaninduced trauma. 2. Targeted species include: raptors, wading & water birds, and blue jays/mourning doves/grackles. Please swab these bird species, if they meet criteria #1. 3. Also, swab birds with potential arbovirus infections based on the following symptoms: a. CNS symptoms (i.e. encephalitis) rega rdless of species (indicate CNS on paperwork). b. Weakness, lethargy, shaking and co nvulsions, anorexia, weight loss, unusual posture, ruffled feathers, inabili ty to hold head upright, ataxia. 4. Swab each bird only ONCE as so on as possible after admittance. Sample Protocol 1. Wear appropriate PPE while swabbing the birds (gloves & gown, m ask if possible). 2. Each pre-sterilized culture swab pack contains: 2 cotton-tipped applicators & a single culture tube. Only one applicator is necessary per bird (you may discard the second). 3. Label swab culture tube with the Swab Collection Date, Bird # and Facility Name in the space provided on the tube for each bird that is swabbed. 4. Locate and swab cloacae with one applicator. Wet most of cotton tip!

PAGE 536

511 APPENDIX C: (CONTINUED) 5. Sheath the swab in the separate culture tube and return the bird to its cage. 6. Immediately freeze the culture tubes (+ swab) after sample collection in provided ziplock bags for storage. Keep tubes frozen at -70C until shipment to the laboratory. 7. Please return tubes (in ziplock bags) to lab in provided cooler boxes with frozen gel packs within 2 weeks of colle ction date. Ship overnight. The samples must remain cold at all times in order to preserve the virus. 8. Please enter Swab Collection Date, Bird #, and Site (where bird was found, if available) on the form provided for each bird & submit with each box If submitting more than one sample at a time, multiple entries per page are recommended. 9. Results for samples will be emailed once molecular and culture assays are completed.

PAGE 537

512 APPENDIX C: (CONTINUED) Arbovirus Surveillance: Detection and Virus Isolation (Submittal Form) Arbovirus Surveillance of R ehab Birds from Cloacal Swabs County Reported http://wld.fwc.state.fl.us/bird / __yes ___no Contact Name E-mail: Organization Phone: ( ) Address Fax: ( ) Address For DoH Tampa Laboratory Use Only City/State/zip Date Received Specimen Collection Data Collecti on date Bird # Site/Address of Collection OR GPS Coordinates Species of bird DoH LAB # Molecular Assay Results Virus Isolation Result Please send cloacal swabs to: Florida Department of Health, Bureau of Laboratories, 3602 Spectrum Blvd., Tampa, FL 33612-9401, Attention: Virology (B)

PAGE 538

513 APPENDIX C: (CONTINUED) Cloacal Swab Sampling Criteria and Protocol for Arbovirus Isolation from Sentinel Chickens Sample Criteria 1. Do not sample all sites in the countyplease only swab sentinel chickens at sites where arboviral activity has recently been detected (within 1-2 weeks). 2. Swab all chickens that have not yet seroconverted at that positive site. 3. Do not swab any confirmed positive sentinels at the site. 4. Please swab the negative chickens when they are bled for the HAI assay. 5. Continue to swab the negative sentinels at the site for 4-8 weeks. 6. If possible, swab the sentinels twi ce a week to improve probability of arbovirus isolation. 7. This project is experimental and resu lts will be returned as quickly as possible. Swab Protocol 3. Enter th e Bird #, Site, and Date in the space provided on the swab culture label for each sentinel that is swabbed. Also, enter this information for each swab on virus isolation/detection paperwork to be submitted to laboratory. 4. On the Arbovirus Surveillance Serology submittal paperwork for the HAI test, enter the letter S in the Comments s ection if a swab is also submitted for testing on that bird. 5. Wear appropriate PPE while swabbing the birds (gloves & gown, mask if possible). 6. Collect the blood for serology testing prior to swabbing the sentinel. 7. Next, locate and swab the cloacae with the viral culturette swab provided. Attempt to wet most of the cotton applicator. 8. Re-sheath the swab and return th e sentinel chicken to its cage. 9. For swabs with a green top (Cat. No. 261514), use both hands to apply pressure to the bottom of the culturette and crack the amber liquid at the base. This will release the media to preserve the sample. For swabs with a red top (Cat. No. 220221), sheathe applicators in viral culture tube by immersing cotton swabs in the media, break base of plastic applicator at score lines, and cap tube. 10. Keep swabs as cold as possible in the fi eld (on ice packs) and freeze them @ -70C until shipment to the laboratory. Ship overnight on dry ice. 11. Results for the swabs will be emailed once molecular and cell culture assays are completed.

PAGE 539

514 APPENDIX C: (CONTINUED) Arbovirus Surveillance: Detection and Virus Isolation (Submittal Form) Bureau of Laboratories phone: Tampa Branch Laboratory fax: 3602 Spectrum Boulevard Tampa, FL 33612 email: Arbovirus Surveillance of Sentinel Chickens from Blood & Swabs County page_____ of________ Contact Name Address Telephone For Laboratory use only Fax: Date Received: e-mail MA Date Reported: VI Date Reported: Specimen Collection Data Coll. date Bird # Site New LAB Number MA Result VI Result Comments 1 2 3 4 5 6 7 8 9 10 11 12 This form must accompany all blood & cloacal swab specimens submitted for vi rus detection/isolation. Submitter should fill out left side of form completely. DO NOT SKIP LINES when listing collected specimens If bird is new to the flock or first time bled, place an X in the New column. Please Do not write below this line

PAGE 540

515 APPENDIX D Master Mix Components fo r RT-PCR and Sequencing Real Time One-Step RT-PCR (TaqMan) for ABI 7000 System Component [Final Conc] Volume Stock Concentration RNase/DNase-free H20 2X Universal PCR Master Mix 50 pmol Primer (forward) 50 pmol Primer (reverse) 7.5 pmol Probe 10X Multiscribe & RNase Inhibitor Mix Template 17.7 l 25.0 l 0.5 l 0.5 l 0.3 l 1.0 l 5.0 l n/a Proprietary 100 M (100 pmol/l) 100 M (100 pmol/l) 25 M (25 pmol/l) Proprietary n/a Total 50.0 l Real Time One-Step RT-PCR (TaqMan) for ABI 7500 System Component [Final Conc] Volume Stock Concentration RNase/DNase-free H20 2X Universal PCR Master Mix 25 pmol Primer (forward) 25 pmol Primer (reverse) 3.75 pmol Probe 10X Multiscribe & RNase Inhibitor Mix Template 6.35 l 12.5 l 0.25 l 0.25 l 0.15 l 0.5 l 5.0 l n/a Proprietary 100 M (100 pmol/l) 100 M (100 pmol/l) 25 M (25 pmol/l) Proprietary n/a Total 25.0 l SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity Component [Final Conc] Volume Stock Concentration RNase/DNase-free H20 2X Reaction Mix 100 pmol Primer (forward) 100 pmol Primer (reverse) SS III RT-PCR Platinum Taq HiFi Mix 16U RNasin (RNase Inhibitor) Template 20.6 l 25.0 l 0.5 l 0.5 l 1.0 l 0.4 l 2.0 l n/a Proprietary 200 M (200 pmol/l) 200 M (200 pmol/l) Proprietary 40 units/l n/a Total 50.0 l

PAGE 541

516 APPENDIX D: (CONTINUED) Nucleotide Sequencing Reaction Component [Final Conc] Volume Stock Concentration RNase/DNase-free H20 40 pmol Primer DTCS Master Mix Template (variable) (8.0 x)l 2.0 l 8.0 l x l n/a 20 M (20 pmol/l) Proprietary n/a Total 20.0 l Thermal Cycler Parameters Real Time One-Step RT-PCR (T aqMan) for ABI 7000/7500 Systems Stage 1 Stage 2 Stage 3 1 cycle 1 cycle Step 1: 45 cycles 95C 15 seconds Step 2: 1 cycle 48C 30 minutes 95C 10 minutes 60C 1 minute Run Mode: 9600 Emulation SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity 1 cycle 40 cycles 1 cycle 50C 30 minutes 95C 5 minutes 94C 20 seconds 55C 30 seconds 68C 3 minutes 72C 20 minutes 4C Nucleotide Sequencing Reaction 35 cycles 96C 20 seconds 42C 20 seconds 60C 3 minutes 4C

PAGE 542

517 APPENDIX E COMPREHENSIVE ARBOVIRUS SURVEILLANCE MAPS (2005) EEEV Comprehensive Surveillance (2005) Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/environment/community/arboviral /maps-arboviral.html#2005

PAGE 543

518 APPENDIX E: (CONTINUED) WNV Comprehensive Surveillance (2005) Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/environment/community/arboviral /maps-arboviral.html#2005

PAGE 544

519 APPENDIX E: (CONTINUED) SLEV WEEKLY SURVEILLANCE ACTIVITY (2005) Note: A comprehensive map was not generated for SLEV in 2005. August 21 August 27 Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/env ironment/community/arbovir al/maps-sentinel.htm#2005

PAGE 545

520 APPENDIX E: (CONTINUED) SLEV WEEKLY SENTINEL SURVEILLA NCE ACTIVITY (2005), Continued September 25 October 1 Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/env ironment/community/arbovir al/maps-sentinel.htm#2005

PAGE 546

521 APPENDIX E: (CONTINUED) SLEV WEEKLY SENTINEL SURVEILLA NCE ACTIVITY (2005), Continued October 9 October 15 Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/env ironment/community/arbovir al/maps-sentinel.htm#2005

PAGE 547

522 APPENDIX E: (CONTINUED) SLEV WEEKLY SENTINEL SURVEILLA NCE ACTIVITY (2005), Continued October 23 October 29 Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/env ironment/community/arbovir al/maps-sentinel.htm#2005

PAGE 548

523 APPENDIX F COMPREHENSIVE ARBOVIRUS SURVEILLANCE MAPS (2006) EEEV Comprehensive Surveillance (2006) Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/environment/community/arboviral /maps-arboviral.html#2006

PAGE 549

524 APPENDIX F: (CONTINUED) WNV Comprehensive Surveillance (2006) Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/environment/community/arboviral /maps-arboviral.html#2006

PAGE 550

525 APPENDIX F: (CONTINUED) SLEV Comprehensive Surveillance (2006) Map appears courtesy of the DOH-BCEH Open access is available at http://www.doh.state.fl.us/environment/community/arboviral /maps-arboviral.html#2006

PAGE 551

526 APPENDIX G SENTINEL CHICKEN ARBOSEROLOGY RESULTS BIRD 8-003-R (Sarasota County, Site 004) Arboserology Test Results for Sera Collected from Bird 8-003-R Assay Type Day 0 (Serum 1) Day 7 (Serum 2) Day 14 (Serum 3) HAI 40 40 40 WN SLE WN SLE WN SLE MAC-ELISA MIA Screen (Adj) MIA Confirm (Adj) PRNT 1.0 3.69 0.43 <10 3.9 32.5 2.71 40 0.9 2.73 0.42 <10 2.40 15.6 1.54 40 0.79 1.91 QNS* QNS 1.46 11.5 QNS QNS *QNS= quantity not sufficient.

PAGE 552

527 APPENDIX G: (CONTINUED) BIRD 9-005-B (Sarasota County, Site 001) Arboserology Test Results for Sera Collected from Bird 9-005-B Assay Type Day 0 (Serum #1) Day 7 (Serum #2) HAI 40 40 WN SLE WN SLE MAC-ELISA MIA Screen (Adjusted) MIA Confirm (Adjusted) PRNT* 2.15 2.28 NT <10 17.0 27.26 NT 40 1.40 1.55 NT NT 5.86 11.07 NT NT *NT = Not Tested

PAGE 553

528 APPENDIX H WILD BIRD SPECIES Number of Cloacal Swabs Submitted for Each Bird Species by Wildlife Rehabilitation Centers and the Florida Fish & Wildlife Conservation Commission SPECIES NUMBER Anhinga 1 Bald Eagle 1 Barred Owl 9 Black Vulture 3 Brown Pelican 1 Chicken 1 Coopers Hawk 3 Common Grackle 1 Common Loon 1 Double Crested Cormorant 4 Duck 1 Eastern Screech Owl 4 Feral Pigeon 4 Great Horned Owl 3 Great American Egret 1 Great Blue Heron 1 Great White Heron 1 Green Heron 1 Ibis 2 Laughing Gull 9 Magnificent Frigate Bird 1 Mockingbird 1 Osprey 6 Pelican 1 Permanent Ring Collar Dove 1 Red Hawk 1 Ringed-Turtle Dove 6 Ring-neck Duck 1 Red-shouldered Hawk 7 Red-tailed Hawk 3 Ruddy Turnstone 1 Sora 2 Tern 1 Turkey Vulture 1 Wurde-Manns Heron 1 Yellow Crown Night Heron 1 Total Species = 36 Total Swabs = 87

PAGE 554

529 APPENDIX I BLASTN Results for St. Louis Encephalitis Virus Strains FL52 FL52 Envelope Accession Description Max score Query coverage E value Max ident EF158066.1 St. Louis encephalitis virus strain GHA-3 2796 100% 0.0 97% EF158059.1 St. Louis encephalitis virus strain 65 V 310 2780 100% 0.0 97% AF205509.1 St. Louis encephalitis virus strain Parton 2776 98% 0.0 97% AF205505.1 St. Louis encephalitis virus strain GHA-3 2765 98% 0.0 97% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 2763 100% 0.0 97% FL52 NS5 Accession Description Max score Query coverage E value Max ident EF158059.1 St. Louis encephalitis virus strain 65 V 310 1748 99% 0.0 97% EF158055.1 St. Louis encephalitis virus strain TBH 28 1748 99% 0.0 97% EF158049.1 St. Louis encephalitis virus strain 904.3 1736 99% 0.0 97% EF158070.1 St. Louis encephalitis virus strain Parton 1725 99% 0.0 97% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 1725 99% 0.0 97% FL52 SLEC Accession Description Max score Query coverage E value Max ident EF158055.1 St. Louis encephalitis virus strain TBH 28 645 99% 0.0 99% EF158066.1 St. Louis encephalitis virus strain GHA-3 636 100% 2e-179 98% EF158059.1 St. Louis encephalitis virus strain 65 V 310 636 100% 2e-179 98% EF158070.1 St. Louis encephalitis virus strain Parton 630 100% 9e-178 98% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 630 100% 9e-178 98% FL52 3NC Accession Description Max score Query coverage E value Max ident DQ525916.1 St. Louis encephalitis virus strain Kern217 1011 100% 0.0 96% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 981 96% 0.0 96% AF242895.1 St. Louis encephalitis virus polyprotein gene 503 49% 4e-139 96% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 455 45% 1e-124 96% AY632544.1 St. Louis encephalitis virus polyprotein gene 448 49% 2e-122 93%

PAGE 555

530 APPENDIX I: (CONTINUED) TBH-28 TBH-28 Envelope Accession Description Max score Query coverage E value Max ident EF158055.1 St. Louis encephalitis virus strain TBH28 3001 100% 0.0 99% AF205469.1 St. Louis encephalitis virus strain Tbh28 2985 99% 0.0 99% AF205468.1 St. Louis encephalitis virus strain P15 2968 99% 0.0 99% EF158059.1 St. Louis encephalitis virus strain 65 V 310 2863 100% 0.0 98% AF205470.1 St. Louis encephalitis virus strain 65v310 2852 99% 0.0 98% TBH-28 NS5 Accession Description Max score Query coverage E value Max ident EF158055.1 St. Louis encephalitis virus strain TBH 28 1810 100% 0.0 99% EF158059.1 St. Louis encephalitis virus strain 65 V 310 1766 100% 0.0 98% EF158050.1 St. Louis encephalitis virus strain MSI 7 1727 100% 0.0 97% EF158049.1 St. Louis encephalitis virus strain 904.3 1727 100% 0.0 97% AF013416.1 St. Louis encephalitis virus strain MSI-7 NS5 1727 100% 0.0 97% TBH-28 SLEC Accession Description Max score Query coverage E value Max ident EF158055.1 St. Louis encephalitis virus strain TBH 28 651 99% 0.0 99% EF158066.1 St. Louis encephalitis virus strain GHA-3 641 100% 0.0 99% EF158059.1 St. Louis encephalitis virus strain 65 V 310 641 100% 0.0 99% EF158070.1 St. Louis encephalitis virus strain Parton 636 100% 2e-179 98% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 636 100% 2e-179 98% TBH-28 3NC Accession Description Max score Query coverage E value Max ident DQ525916.1 St. Louis encephalitis virus strain Kern217 1011 99% 0.0 97% DQ359217.1 St. Louis encephalitis virus isolate MSI965 97% 0.0 96% AF242895.1 St. Louis encephalitis virus polyprotein gene 520 49% 4e-144 97% AY632544.1 St. Louis encephalitis virus polyprotein gene 464 49% 2e-127 94% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 444 45% 2e-121 96%

PAGE 556

531 APPENDIX I: (CONTINUED) FL72 FL72 Envelope Accession Description Max score Query coverage E value Max ident EF158053.1 St. Louis encephalitis virus strain BeAn 246262 2904 100% 0.0 98% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 2865 100% 0.0 97% AF205483.1 St. Louis encephalitis virus strain bean246262 2854 98% 0.0 98% AF205484.1 St. Louis encephalitis virus strain beh203235 2843 98% 0.0 98% EF158054.1 St. Louis encephalitis virus strain 75 D 90 2782 100% 0.0 96% FL72 NS5 Accession Description Max score Query coverage E value Max ident EF158053.1 St. Louis encephalitis virus strain BeAn 246262 1792 100% 0.0 98% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 1705 100% 0.0 96% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 1703 100% 0.0 96% EF158054.1 St. Louis encephalitis virus strain 75 D 90 1642 100% 0.0 95% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 1631 100% 0.0 95% FL72 SLEC Accession Description Max score Query coverage E value Max ident EF158048.1 St. Louis encephalitis virus strain BeAr 23379 616 99% 3e-173 98% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 610 99% 1e-171 98% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 593 99% 1e-166 97% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 571 99% 6e-160 96% EF158054.1 St. Louis encephalitis virus strain 75 D 90 560 99% 1e-156 95% FL72 3NC Accession Description Max score Query coverage E value Max ident DQ525916.1 St. Louis encephalitis virus strain Kern217 985 99% 0.0 96% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 922 95% 0.0 95% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 484 46% 1e-133 98% AF242895.1 St. Louis encephalitis virus polyprotein gene 468 47% 1e-128 95% AY632544.1 St. Louis encephalitis virus polyprotein gene 457 47% 3e-125 95%

PAGE 557

532 APPENDIX I: (CONTINUED) FL85a FL85a Envelope Accession Description Max score Query coverage E value Max ident EF158059.1 St. Louis encephalitis virus strain 65 V 310 1836 100% 0.0 99% EF158055.1 St. Louis encephalitis virus strain TBH 28 1808 100% 0.0 98% AF205470.1 St. Louis encephalitis virus strain 65v310 1796 97% 0.0 99% EF158066.1 St. Louis encephalitis virus strain GHA-3 1792 100% 0.0 98% M16614.1 St. Louis encephalitis virus viral polyprotein 1786 100% 0.0 98% FL85a NS5 Accession Description Max score Query coverage E value Max ident EF158059.1 St. Louis encephalitis virus strain 65 V 310 1792 100% 0.0 98% EF158055.1 St. Louis encephalitis virus strain TBH 28 1770 100% 0.0 97% EF158050.1 St. Louis encephalitis virus strain MSI 7 1742 100% 0.0 97% AF013416.1 Saint Louis encephalitis virus strain MSI-7 NS5 1742 100% 0.0 97% EF158070.1 St. Louis encephalitis virus strain Parton 1720 100% 0.0 96% FL85a SLEC Accession Description Max score Query coverage E value Max ident EF158055.1 St. Louis encephalitis virus strain TBH 28 699 100% 0.0 99% EF158059.1 St. Louis encephalitis virus strain 65 V 310 688 100% 0.0 98% EF158070.1 St. Louis encephalitis virus strain Parton 682 100% 0.0 98% EF158066.1 St. Louis encephalitis virus strain GHA-3 682 100% 0.0 98% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 682 100% 0.0 98% FL85a 3NC Accession Description Max score Query coverage E value Max ident DQ525916.1 St. Louis encephalitis virus strain Kern217 1007 99% 0.0 97% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 944 95% 0.0 96% AF242895.1 St. Louis encephalitis virus polyprotein gene 497 48% 2e-137 97% AY632544.1 St. Louis encephalitis virus polyprotein gene 442 48% 8e-121 94% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 427 45% 2e-116 95%

PAGE 558

533 APPENDIX I: (CONTINUED) FL85b FL85b Envelope Accession Description Max score Query coverage E value Max ident EF158059.1 St. Louis encephalitis virus strain 65 V 310 2961 100% 0.0 99% AF205470.1 St. Louis encephalitis virus strain 65v310 2913 98% 0.0 99% EF158055.1 St. Louis encephalitis virus strain TBH 28 2889 100% 0.0 98% EF158050.1 St. Louis encephalitis virus strain MSI 7 2883 100% 0.0 98% AY289618.1 St. Louis encephalitis virus strain MSI7 2883 100% 0.0 98% FL85b NS5 Accession Description Max score Query coverage E value Max ident EF158059.1 St. Louis encephalitis virus strain 65 V 310 1783 99% 0.0 98% EF158055.1 St. Louis encephalitis virus strain TBH 28 1760 99% 0.0 98% EF158050.1 St. Louis encephalitis virus strain MSI 7 1733 99% 0.0 97% AF013416.1 Saint Louis encephalitis virus strain MSI-7 1733 99% 0.0 97% EF158070.1 St. Louis encephalitis virus strain Parton 1705 99% 0.0 97%

PAGE 559

534 APPENDIX I: (CONTINUED) FL90a FL90a Envelope Accession Description Max score Query coverage E value Max ident EF158052.1 St. Louis encephalitis virus strain V 2380-42 2916 100% 0.0 98% EF158057.1 St. Louis encephalitis virus strain 78 A 28 2900 100% 0.0 98% AF205498.1 St. Louis encephalitis virus strain 83V4953 2881 98% 0.0 98% AF205499.1 St. Louis encephalitis virus strain PV1-2419 2880 98% 0.0 98% AF205500.1 St. Louis encephalitis virus strain 98V3181 2870 98% 0.0 98% FL90a NS5 Accession Description Max score Query coverage E value Max ident EF158052.1 St. Louis encephalitis virus strain V 2380-42 1705 100% 0.0 98% EF158057.1 St. Louis encephalitis virus strain 78 A 28 1694 100% 0.0 98% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 1683 100% 0.0 98% EF158051.1 St. Louis encephalitis virus strain GMO 94 1655 100% 0.0 98% EF158059.1 St. Louis encephalitis virus strain 65 V 310 1628 100% 0.0 97%

PAGE 560

535 APPENDIX I: (CONTINUED) FL90b FL90b Envelope Accession Description Max score Query coverage E value Max ident AF205498.1 St. Louis encephalitis virus strain 83V4953 2881 100% 0.0 98% AF205499.1 St. Louis encephalitis virus strain PV1-2419 2880 99% 0.0 98% EF158052.1 St. Louis encephalitis virus strain V 2380-42 2876 100% 0.0 98% AF205500.1 St. Louis encephalitis virus strain 98V3181 2870 100% 0.0 98% EF158057.1 St. Louis encephalitis virus strain 78 A 28 2859 100% 0.0 98% FL90b NS5 Accession Description Max score Query coverage E value Max ident EF158052.1 St. Louis encephalitis virus strain V 2380-42 1781 100% 0.0 97% EF158057.1 St. Louis encephalitis virus strain 78 A 28 1770 100% 0.0 97% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 1748 100% 0.0 97% EF158051.1 St. Louis encephalitis virus strain GMO 94 1725 100% 0.0 96% EF158055.1 St. Louis encephalitis virus strain TBH 28 1692 100% 0.0 96% FL90b 3NC Accession Description Max score Query coverage E value Max ident DQ359217.1 St. Louis encephalitis virus isolate MSI-7 961 99% 0.0 97% DQ525916.1 St. Louis encephalitis virus strain Kern217 950 99% 0.0 96% AF242895.1 St. Louis encephalitis virus polyprotein gene 499 52% 5e-138 96% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 462 47% 6e-127 97% AY632544.1 St. Louis encephalitis virus polyprotein gene cds 449 52% 5e-123 93%

PAGE 561

536 APPENDIX I: (CONTINUED) FL90c FL90c Envelope Accession Description Max score Query coverage E value Max ident EF158052.1 St. Louis encephalitis virus strain V 2380-42 2918 100% 0.0 98% EF158057.1 St. Louis encephalitis virus strain 78 A 28 2902 100% 0.0 98% AF205498.1 St. Louis encephalitis virus strain 83V4953 2881 98% 0.0 98% AF205499.1 St. Louis encephalitis virus strain PV1-2419 2880 98% 0.0 98% AF205500.1 St. Louis encephalitis virus strain 98V3181 2870 98% 0.0 98% FL90c NS5 Accession Description Max score Query coverage E value Max ident EF158052.1 St. Louis encephalitis virus strain V 2380-42 1759 100% 0.0 98% EF158057.1 St. Louis encephalitis virus strain 78 A 28 1748 100% 0.0 98% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 1731 100% 0.0 98% EF158051.1 St. Louis encephalitis virus strain GMO 94 1703 100% 0.0 97% EF158059.1 St. Louis encephalitis virus strain 65 V 310 1670 100% 0.0 97%

PAGE 562

537 APPENDIX I: (CONTINUED) FL90d FL90d Envelope Accession Description Max score Query coverage E value Max ident EF158052.1 St. Louis encephalitis virus strain V 2380-42 2911 99% 0.0 98% EF158057.1 St. Louis encephalitis virus strain 78 A 28 2889 99% 0.0 98% AF205499.1 St. Louis encephalitis virus strain PV1-2419 2878 98% 0.0 98% AF205498.1 St. Louis encephalitis virus strain 83V4953 2868 98% 0.0 98% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 2857 99% 0.0 97% FL90d NS5 Accession Description Max score Query coverage E value Max ident EF158052.1 St. Louis encephalitis virus strain V 2380-42 1790 100% 0.0 98% EF158057.1 St. Louis encephalitis virus strain 78 A 28 1773 100% 0.0 98% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 1751 100% 0.0 97% EF158051.1 St. Louis encephalitis virus strain GMO 94 1729 100% 0.0 97% EF158059.1 St. Louis encephalitis virus strain 65 V 310 1696 100% 0.0 96% FL90d 3NC Accession Description Max score Query coverage E value Max ident DQ525916.1 St. Louis encephalitis virus strain Kern217 1002 99% 0.0 96% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 972 95% 0.0 97% AF242895.1 St. Louis encephalitis virus polyprotein gene 488 48% 1e-134 97% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 462 45% 6e-127 97% AY632544.1 St. Louis encephalitis virus polyprotein gene 438 48% 1e-119 94%

PAGE 563

538 APPENDIX I: (CONTINUED) BR64 BR64 Envelope Accession Description Max score Query coverage E value Max ident EF158053.1 St. Louis encephalitis virus strain BeAn 246262 2876 99% 0.0 97% EF158054.1 St. Louis encephalitis virus strain 75 D 90 2870 99% 0.0 97% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 2854 99% 0.0 96% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 2837 99% 0.0 96% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 2837 99% 0.0 96% BR64 NS5 Accession Description Max score Query coverage E value Max ident EF158053.1 St. Louis encephalitis virus strain BeAn 246262 1668 100% 0.0 96% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 1663 100% 0.0 96% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 1646 100% 0.0 96% EF158054.1 St. Louis encephalitis virus strain 75 D 90 1646 100% 0.0 96% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 1626 99% 0.0 96%

PAGE 564

539 APPENDIX I: (CONTINUED) BR69 BR69 Envelope Accession Description Max score Query coverage E value Max ident EF158054.1 St. Louis encephalitis virus strain 75 D 90 2730 100% 0.0 96% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 2724 100% 0.0 96% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 2719 100% 0.0 96% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 2697 100% 0.0 96% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 2693 100% 0.0 96% BR69 NS5 Accession Description Max score Query coverage E value Max ident EF158053.1 St. Louis encephalitis virus strain BeAn 246262 1637 100% 0.0 95% EF158054.1 St. Louis encephalitis virus strain 75 D 90 1624 100% 0.0 95% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 1618 100% 0.0 95% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 1613 100% 0.0 95% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 1607 100% 0.0 94% BR69 SLEC Accession Description Max score Query coverage E value Max ident EF158056.1 St. Louis encephalitis virus strain TRVL 9464 617 99% 7e-174 98% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 617 99% 7e-174 98% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 612 99% 3e-172 97% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 595 99% 3e-167 96% EF158054.1 St. Louis encephalitis virus strain 75 D 90 584 99% 7e-164 96% BR69 3NC Accession Description Max score Query coverage E value Max ident DQ525916.1 St. Louis encephalitis virus strain Kern217 881 98% 0.0 95% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 870 98% 0.0 95% AF242895.1 St. Louis encephalitis virus polyprotein gene 470 51% 3e-129 96% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 464 50% 2e-127 97% AY632544.1 St. Louis encephalitis virus polyprotein gene 448 51% 2e-122 94%

PAGE 565

540 APPENDIX I: (CONTINUED) TR58 TR58 Envelope Accession Description Max score Query coverage E value Max ident EF158048.1 St. Louis encephalitis virus strain BeAr 23379 2784 100% 0.0 97% EF158054.1 St. Louis encephalitis virus strain 75 D 90 2767 99% 0.0 96% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 2761 100% 0.0 96% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 2756 100% 0.0 96% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 2750 99% 0.0 96% TR58 NS5 Accession Description Max score Query coverage E value Max ident EF158053.1 St. Louis encephalitis virus strain BeAn 246262 1746 100% 0.0 98% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 1718 100% 0.0 97% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 1718 99% 0.0 97% EF158054.1 St. Louis encephalitis virus strain 75 D 90 1679 100% 0.0 97% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 1668 100% 0.0 96%

PAGE 566

541 APPENDIX I: (CONTINUED) TR62 TR62 Envelope Accession Description Max score Query coverage E value Max ident EF158048.1 St. Louis encephalitis virus strain BeAr 23379 2719 86% 0.0 96% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 2713 86% 0.0 96% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 2708 86% 0.0 96% EF158054.1 St. Louis encephalitis virus strain 75 D 90 2708 86% 0.0 96% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 2697 86% 0.0 95% TR62 NS5 Accession Description Max score Query coverage E value Max ident EF158053.1 St. Louis encephalitis virus strain BeAn 246262 1727 99% 0.0 97% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 1716 99% 0.0 97% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 1700 99% 0.0 96% EF158054.1 St. Louis encephalitis virus strain 75 D 90 1650 99% 0.0 96% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 1639 99% 0.0 95% TR62 SLEC Accession Description Max score Query coverage E value Max ident EF158048.1 St. Louis encephalitis virus strain BeAr 23379 614 100% 9e-173 97% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 608 100% 4e-171 97% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 603 100% 2e-169 97% EF158067.1 St. Louis encephalitis virus strain BeAn 247377 569 100% 2e-159 95% EF158054.1 St. Louis encephalitis virus strain 75 D 90 558 100% 5e-156 94% TR62 3NC Accession Description Max score Query coverage E value Max ident DQ525916.1 St. Louis encephalitis virus strain Kern217 929 99% 0.0 94% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 900 95% 0.0 94% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 464 45% 2e-127 97% AF242895.1 St. Louis encephalitis virus polyprotein gene 429 47% 6e-117 93% AY632544.1 St. Louis encephalitis virus polyprotein gene 418 47% 1e-113 92%

PAGE 567

542 APPENDIX I: (CONTINUED) FLS569 FLS569 Envelope Accession Description Max score Query coverage E value Max ident EF158067.1 St. Louis encephalitis virus strain BeAn 247377 2885 100% 0.0 98% EF158054.1 St. Louis encephalitis virus strain 75 D 90 2880 100% 0.0 98% AF205478.1 St. Louis encephalitis virus strain bean242587 2854 98% 0.0 98% AF205479.1 St. Louis encephalitis virus strain 75d90 2832 98% 0.0 98% AY135514.1 St. Louis encephalitis virus strain Coav 405 2820 98% 0.0 98% FLS569 NS5 Accession Description Max score Query coverage E value Max ident EF158067.1 St. Louis encephalitis virus strain BeAn 247377 1718 100% 0.0 97% EF158054.1 St. Louis encephalitis virus strain 75 D 90 1718 100% 0.0 97% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 1591 100% 0.0 95% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 1576 100% 0.0 95% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 1563 100% 0.0 94% FLS569 SLEC Accession Description Max score Query coverage E value Max ident EF158067.1 St. Louis encephalitis virus strain BeAn 247377 641 100% 0.0 99% EF158054.1 St. Louis encephalitis virus strain 75 D 90 630 100% 9e-178 98% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 597 100% 1e-167 96% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 592 100% 4e-166 96% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 586 100% 2e-164 96% FLS569 3NC Accession Description Max score Query coverage E value Max ident DQ525916.1 St. Louis encephalitis virus strain Kern217 929 100% 0.0 95% DQ359217.1 St. Louis encephalitis virus isolate MSI-7 918 100% 0.0 95% AF242895.1 St. Louis encephalitis virus polyprotein gene 479 51% 6e-132 95% AF246796.1 St. Louis encephalitis virus Be H 355964 NS5 470 48% 4e-129 97% AY632544.1 St. Louis encephalitis virus polyprotein gene cds 457 51% 3e-125 93%

PAGE 568

543 APPENDIX I: (CONTINUED) FLS650 FLS650 Envelope Accession Description Max score Query coverage E value Max ident EF158067.1 St. Louis encephalitis virus strain BeAn 247377 2902 100% 0.0 98% EF158054.1 St. Louis encephalitis virus strain 75 D 90 2896 100% 0.0 98% AF205478.1 St. Louis encephalitis virus strain bean242587 2867 98% 0.0 98% AF205479.1 St. Louis encephalitis virus strain 75d90 2844 98% 0.0 98% AY135514.1 St. Louis encephalitis virus strain Coav 405 2828 98% 0.0 98% FLS650 NS5 Accession Description Max score Query coverage E value Max ident EF158067.1 St. Louis encephalitis virus strain BeAn 247377 1738 100% 0.0 98% EF158054.1 St. Louis encephalitis virus strain 75 D 90 1738 100% 0.0 98% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 1605 100% 0.0 95% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 1589 100% 0.0 95% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 1585 99% 0.0 95% FLS650 SLEC Accession Description Max score Query coverage E value Max ident EF158067.1 St. Louis encephalitis virus strain BeAn 247377 619 56% 4e-174 98% EF158054.1 St. Louis encephalitis virus strain 75 D 90 608 56% 8e-171 97% EF158056.1 St. Louis encephalitis virus strain TRVL 9464 575 56% 8e-161 96% EF158053.1 St. Louis encephalitis virus strain BeAn 246262 569 56% 4e-159 95% EF158048.1 St. Louis encephalitis virus strain BeAr 23379 564 56% 2e-157 95%

PAGE 569

544 APPENDIX J BLASTN Results for West Nile Virus Strains FLWN01a FLWN01a WNA Accession Description Max score Query coverage E value Max ident AY289214.1 West Nile virus strain TVP 8533 562 100% 3e-157 99% EU155484.1 West Nile virus strain OK03 556 100% 1e-155 99% EF657887.1 West Nile virus strain 3356K VP2 556 100% 1e-155 99% DQ983578.1 West Nile virus strain FLO3-FL2-3 556 100% 1e-155 99% EF530047.1 West Nile virus strain 3356.2.1.1 556 100% 1e-155 99% FLWN01a NS5 Accession Description Max score Query coverage E value Max ident EF657887.1 West Nile virus strain 3356K VP2 1748 100% 0.0 98% EF571854.1 West Nile virus strain 385-99 1748 100% 0.0 98% AY848696.2 West Nile virus strain 385-99 1748 100% 0.0 98% AY848695.2 West Nile virus strain 385-99 1748 100% 0.0 98% AY848697.2 West Nile virus strain 385-99 1748 100% 0.0 98%

PAGE 570

545 APPENDIX J: (CONTINUED) FLWN01b FLW01bWNA Accession Description Max score Query coverage E value Max ident DQ291155.1 West Nile virus from cr ow envelope protein 749 99% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 745 100% 0.0 99% DQ666451.1 West Nile virus isolate BSL13-2005 745 100% 0.0 99% DQ666448.1 West Nile virus isolate BSL5-2004 745 100% 0.0 99% DQ666472.1 West Nile virus isolate BSL6-2005 745 100% 0.0 99% FLWN01b NS5 Accession Description Max score Query coverage E value Max ident DQ080072.1 West Nile virus isolate FL232 1712 99% 0.0 96% DQ431697.1 West Nile virus isolate 03-113FL 1707 99% 0.0 96% AF533540.1 West Nile virus polyprotein precursor 1707 99% 0.0 96% EF657887.1 West Nile virus strain 3356K VP2 1701 99% 0.0 96% EF571854.1 West Nile virus strain 385-99 1701 99% 0.0 96%

PAGE 571

546 APPENDIX J: (CONTINUED) FLWN02a FLWN02a WNA Accession Description Max score Query coverage E value Max ident AY289214.1 West Nile virus strain TVP 8533 745 100% 0.0 99% DQ291155.1 West Nile virus from crow envelope 743 99% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 739 100% 0.0 99% DQ666451.1 West Nile virus isolate BSL13-2005 739 100% 0.0 99% DQ666448.1 West Nile virus isolate BSL5-2004 739 100% 0.0 99% FLWN02a NS5 Accession Description Max score Query coverage E value Max ident EF657887.1 West Nile virus strain 3356K VP2 1844 100% 0.0 99% EF571854.1 West Nile virus strain 385-99 1844 100% 0.0 99% AY848696.2 West Nile virus strain 385-99 1844 100% 0.0 99% AY848695.2 West Nile virus strain 385-99 1844 100% 0.0 99% AY848697.2 West Nile virus strain 385-99 1844 100% 0.0 99%

PAGE 572

547 APPENDIX J: (CONTINUED) FLWN02b FLWN02b WNA Accession Description Max score Query coverage E value Max ident DQ005530.1 West Nile virus isolate FDA-BSL5-2003 745 100% 0.0 99% AF375044.1 West Nile virus isolate WN_0247 745 100% 0.0 99% AF375042.1 West Nile virus isolate WN_0043 745 100% 0.0 99% DQ291155.1 West Nile virus from cr ow envelope protein 743 99% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 739 100% 0.0 99% FLWN02b NS5 Accession Description Max score Query coverage E value Max ident DQ080072.1 West Nile virus isolate FL232 1857 100% 0.0 99% DQ431697.1 West Nile virus isolate 03-113FL 1851 100% 0.0 99% AF533540.1 West Nile virus polyprotein precursor 1851 100% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 1845 100% 0.0 99% EF571854.1 West Nile virus strain 385-99 1845 100% 0.0 99%

PAGE 573

548 APPENDIX J: (CONTINUED) FLWN05a FLWN05a WNA Accession Description Max score Query coverage E value Max ident AY289214.1 West Nile virus strain TVP 8533 684 100% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 678 100% 0.0 99% DQ983578.1 West Nile virus strain FLO3-FL2-3 678 100% 0.0 99% EF530047.1 West Nile virus strain 3356.2.1.1 678 100% 0.0 99% DQ666451.1 West Nile virus isolate BSL13-2005 678 100% 0.0 99% FLWN05a NS5 Accession Description Max score Query coverage E value Max ident DQ431707.1 West Nile virus isolate 04-237NM 1808 100% 0.0 98% DQ431706.1 West Nile virus isolate 04-236NM 1808 100% 0.0 98% DQ431704.1 West Nile virus isolate 04-219CO 1808 100% 0.0 98% DQ431702.1 West Nile virus isolate 04-216CO 1808 100% 0.0 98% DQ080070.1 West Nile virus isolate TVP9115 1808 100% 0.0 98%

PAGE 574

549 APPENDIX J: (CONTINUED) FLWN05b FLWN05b WNA Accession Description Max score Query coverage E value Max ident DQ291155.1 West Nile virus from cr ow envelope protein 754 99% 0.0 100% EF657887.1 West Nile virus strain 3356K VP2 750 100% 0.0 99% DQ666451.1 West Nile virus isolate BSL13-2005 750 100% 0.0 99% DQ666448.1 West Nile virus isolate BSL5-2004 750 100% 0.0 99% DQ666472.1 West Nile virus isolate BSL6-2005 750 100% 0.0 99% FLWN05b NS5 Accession Description Max score Query coverage E value Max ident DQ431705.1 West Nile virus isolate 04-233ND 1812 100% 0.0 98% DQ431701.1 West Nile virus isolate 04-214CO 1812 100% 0.0 98% DQ431694.1 West Nile virus isolate 03-22TX 1812 100% 0.0 98% DQ080061.1 West Nile virus isolate TWN496 1812 100% 0.0 98% AY646354.1 West Nile virus from USA 1812 100% 0.0 98%

PAGE 575

550 APPENDIX J: (CONTINUED) FLM38 FLM38 WNA Accession Description Max score Query coverage E value Max ident DQ005530.1 West Nile virus isolate FDA-BSL5-2003 745 100% 0.0 99% AF375044.1 West Nile virus isolate WN_0247 745 100% 0.0 99% AF375042.1 West Nile virus isolate WN_0043 745 100% 0.0 99% DQ291155.1 West Nile virus from crow envelope 743 99% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 739 100% 0.0 99% FLM38 NS5 Accession Description Max score Query coverage E value Max ident DQ431698.1 West Nile virus isolate 03-120FL 1823 100% 0.0 98% DQ431705.1 West Nile virus isolate 04-233ND 1820 100% 0.0 98% DQ431701.1 West Nile virus isolate 04-214CO 1820 100% 0.0 98% DQ431694.1 West Nile virus isolate 03-22TX 1820 100% 0.0 98% DQ080061.1 West Nile virus isolate TWN496 1820 100% 0.0 98%

PAGE 576

551 APPENDIX J: (CONTINUED) FLS502 FLS502 WNA Accession Description Max score Query coverage E value Max ident DQ005530.1 West Nile virus isolate FDA-BSL5-2003 745 100% 0.0 99% AF375044.1 West Nile virus isolate WN_0247 745 100% 0.0 99% AF375042.1 West Nile virus isolate WN_0043 745 100% 0.0 99% DQ291155.1 West Nile virus from cr ow envelope protein 743 99% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 739 100% 0.0 99% FLS502 NS5 Accession Description Max score Query coverage E value Max ident DQ431698.1 West Nile virus isolate 03-120FL 1849 100% 0.0 99% DQ431705.1 West Nile virus isolate 04-233ND 1845 100% 0.0 99% DQ431701.1 West Nile virus isolate 04-214CO 1845 100% 0.0 99% DQ431694.1 West Nile virus isolate 03-22TX 1845 100% 0.0 99% DQ080061.1 West Nile virus isolate TWN496 1845 100% 0.0 99%

PAGE 577

552 APPENDIX J: (CONTINUED) FLS504 FLS504 WNA Accession Description Max score Query coverage E value Max ident DQ005530.1 West Nile virus isolate FDA-BSL5-2003 745 100% 0.0 99% AF375044.1 West Nile virus isolate WN_0247 745 100% 0.0 99% AF375042.1 West Nile virus isolate WN_0043 745 100% 0.0 99% DQ291155.1 West Nile virus from cr ow envelope protein 743 99% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 739 100% 0.0 99% FLS504 NS5 Accession Description Max score Query coverage E value Max ident DQ431698.1 West Nile virus isolate 03-120FL 1842 100% 0.0 99% DQ431705.1 West Nile virus isolate 04-233ND 1838 100% 0.0 99% DQ431701.1 West Nile virus isolate 04-214CO 1838 100% 0.0 99% DQ431694.1 West Nile virus isolate 03-22TX 1838 100% 0.0 99% DQ080061.1 West Nile virus isolate TWN496 1838 100% 0.0 99% FLS504 WNB Accession Description Max score Query coverage E value Max ident EU155484.1 West Nile virus strain OK03 501 100% 6e-139 100% EF657887.1 West Nile virus strain 3356K VP2 501 100% 6e-139 100% DQ983578.1 West Nile virus strain FLO3-FL2-3 501 100% 6e-139 100% EF571854.1 West Nile virus strain 385-99 501 100% 6e-139 100% DQ431705.1 West Nile virus isolate 04-233ND 501 100% 6e-139 100%

PAGE 578

553 APPENDIX J: (CONTINUED) FLS545 FLS545 WNA Accession Description Max score Query coverage E value Max ident DQ005530.1 West Nile virus isolate FDA-BSL5-2003 734 100% 0.0 99% AF375044.1 West Nile virus isolate WN_0247 734 100% 0.0 99% AF375042.1 West Nile virus isolate WN_0043 734 100% 0.0 99% DQ291155.1 West Nile virus from cr ow envelope protein 732 99% 0.0 99% EF657887.1 West Nile virus strain 3356K VP2 728 100% 0.0 98% FLS545 NS5 Accession Description Max score Query coverage E value Max ident DQ431698.1 West Nile virus isolate 03-120FL 1825 100% 0.0 98% DQ431705.1 West Nile virus isolate 04-233ND 1821 100% 0.0 98% DQ431701.1 West Nile virus isolate 04-214CO 1821 100% 0.0 98% DQ431694.1 West Nile virus isolate 03-22TX 1821 100% 0.0 98% DQ080061.1 West Nile virus isolate TWN496 1821 100% 0.0 98%

PAGE 579

554 APPENDIX K BLASTN Results for Novel Flavivirus Virus Strains FLS649 FLS649 WNA Accession Description Max score Query coverage E value Max ident AM404308.1 West Nile virus strain PTRoxo 669 100% 0.0 98% EU081844.1 West Nile virus strain Egypt 101 669 100% 0.0 98% AY944239.1 West Nile virus isolate WNI68856B 669 100% 0.0 98% AF260968.1 West Nile virus strain Eg101 669 100% 0.0 98% AF130363.1 West Nile virus strain 96-1030 664 100% 0.0 98% FLS649 SLEC Accession Description Max score Query coverage E value Max ident EF158055.1 St. Louis encephalitis virus strain TBH 28 564 100% 9e-158 97% EF158066.1 St. Louis encephalitis virus strain GHA-3 553 100% 2e-154 97% EF158059.1 St. Louis encephalitis virus strain 65 V 310 553 100% 2e-154 97% EF158070.1 St. Louis encephalitis virus strain Parton 547 100% 9e-153 96% EF158065.1 St. Louis encephalitis virus strain TNM 4-711 547 100% 9e-153 96%

PAGE 580

555 APPENDIX K: (CONTINUED) FLS694 FLS694 WNA Accession Description Max score Query coverage E value Max ident AM404308.1 West Nile virus strain PTRoxo ete genome 725 100% 0.0 99% EU081844.1 West Nile virus strain Egypt 101 725 100% 0.0 99% AY944239.1 West Nile virus isolate WNI68856B 725 100% 0.0 99% AF260968.1 West Nile virus strain Eg101 725 100% 0.0 99% AF130363.1 West Nile virus strain 96-1030 719 100% 0.0 99% FLS694 WNB Accession Description Max score Query coverage E value Max ident EU155484.1 West Nile virus strain OK03 501 100% 6e-139 100% EF657887.1 West Nile virus strain 3356K VP2 501 100% 6e-139 100% DQ983578.1 West Nile virus strain FLO3-FL2-3 501 100% 6e-139 100% EF571854.1 West Nile virus strain 385-99 501 100% 6e-139 100% DQ431710.1 West Nile virus isolate 04-244CA 501 100% 6e-139 100% FLS694 SLEC Accession Description Max score Query coverage E value Max ident EF158066.1 St. Louis encephalitis virus strain GHA-3 628 99% 3e-177 98% EF158055.1 St. Louis encephalitis virus strain TBH 28 625 99% 4e-176 98% EF158057.1 St. Louis encephalitis virus strain 78 A 28 623 99% 2e-175 98% EF158059.1 St. Louis encephalitis virus strain 65 V 310 617 99% 7e-174 97% EF158070.1 St. Louis encephalitis virus strain Parton 612 99% 3e-172 97%

PAGE 581

556 APPENDIX L Multiple Sequence Alignment: WNV Capsid/prM Region West Nile Virus Strains Capsid/prM Region: WNAE Primer Set Nucleotide Alignment #MEGA !Title WNA ClustalW 1.6; !Format DataType=Nucleotide CodeTable=Standard NSeqs=18 NSites=409 Identical=. Missing=? Indel=-; !Domain=Data property=Coding CodonStart=1; #FLM38 TTT GTG TTG GCT CTC TTG GCG TTC TTC AGG TTC ACA GCA ATT GCT CCG [279] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLS545 ... ... G.. ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLS649 ---------------------------.. ... ... [279] #FLS694 ------... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [279] #Kunjin ... ... ... ... ... ... ... ..T ..T ... ... ..G ... ... ... ... [279] #MVE ... ... ... ... ... ..A ..T ... ... ... ..T ... ... C.. ..C ... [279] #JE ..C ... C.. ... ..T A.C A.. ... ... .A. ... ... ... T.A ..C ... [279] #Kern217 ..C A.A C.A ..C A.. C.. A.A ... ... C.A ..T ... ..T C.A CAG ..A [279] #FLM38 ACC CGA GCA GTG CTG GAT CGA TGG AGA GGT GTG AAC AAA CAA ACA GCG [327] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #FLS649 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #FLS694 ... ... ... ... ... ... ... ... ... K.. ... ... ... ... ... ... [327] #FLWN01a ... ... ... ... ... ... ..G ... ... ... ... ... ... ... ... ... [327] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #FLWN02a ... ... ... ... ... ... ..G ... ... ... ... ... ... ... ... ... [327] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #FLWN05a ... ... ... ... ... ... ..G ... ... ... ... ... ... ... ... ... [327] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [327] #Kunjin ... ..G ... ... ... ... ... ... ... A.. ... ... ... ... ... ... [327] #MVE ... AAG ..C T.. A.. AGG ..C ... .AG A.C ... ... ..G AC. ..G ..C [327] #JE ... AAG ..G C.T T.A .GC ... ... .A. .CA ... G.A ..G AGT GTG ..A [327] #Kern217 ..T GAG ..G C.. AA. CGC A.. ... ..G .C. ... G.. ... AG. ..G ..A [327]

PAGE 582

557 APPENDIX L: (CONTINUED) #FLM38 ATG AAA CAC CTT CTG AGT TTT AAG AAG GAA CTA GGG ACC TTG ACC AGT [375] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #FLS649 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #FLS694 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #FLWN01a ... ... ... ... ... ... ..C ... ... ... ... ... ... ... ... ... [375] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #FLWN02a ... ... ... ... ... ... ..C ... ... ... ... ... ... ... ... ... [375] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #FLWN05a ... ... ... ... ... ... ..C ... ... ... ... ... ... ... ... ... [375] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [375] #Kunjin ... ... ..T ..C ... ... ..C ... ... ... ... ..A ... ... ... ... [375] #MVE ... ... ..T ..G ACC ... ... ... ..A ... T.. ..A ..A C.. .TT GA. [375] #JE ... ... ..T ... ACT ... ..C ..A CGA ... ..T ..A ..A C.C .TT GAC [375] #Kern217 T.. ... ... ..G AAC G.A ... ..A CGT ..C ..C ..A T.. A.. CTA GAC [375] #FLM38 GCT ATC AAT CGG CGG AGC TCA AAA CAA AAG AAA AGA GGA GGA AAG ACC [423] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLS649 ... ... ... ... ... ... ... ... ... ... W.. ... ... ... ... ... [423] #FLS694 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [423] #Kunjin ... ... ..C ... ... ... ... ... ..G ... ..G ... ... ... ... ... [423] #MVE .TG G.G ..C AAA A.. G.. AA. ... ... ... ... ... ..T ..C .G. CTT [423] #JE ..C G.G ..C AA. ... G.. AG. ..G ... ..C ... ... ... ... ..C .TG [423] #Kern217 A.C ... ..C ... ... --C.. .GC A.G ... .G. G.. ..G ACC .GA T.G [423] #FLM38 GGA ATT GCA GTC ATG ATT GGC CTG ATC GCC AGC GTG GGA GCA GTT ACC [471] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [471] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [471] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [471] #FLS649 ... ... ... ... ... ... R.. T.. ... ... ... ... ... ... ... ... [471] #FLS694 ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... ... [471] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [471] #FLWN01b ... .C. ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [471] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [471] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [471] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [471] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [471] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [471] #WNEgypt ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... ... [471] #Kunjin ... ... ... T.. ... ... ... T.. ..T ..T G.. ... ... ... ..C ..T [471] #MVE ATG C.C ATT T.. ... C.G ATT GGA T.T ... ----.CT ..C T.A .AG [471] #JE T.G C.C ..G AG. T.. GCA .TT A.C ..A ... T.. .CA ... ..C A.G .AG [471] #Kern217 TTG C.C .G. T--.. GC. .CG ..A ..T .GA CTG .C. A.T T.. T.G CAG [471]

PAGE 583

558 APPENDIX L: (CONTINUED) #FLM38 CTC TCT AAC TTT CAA GGG AAG GTG ATG ATG ACG GTA AAT GCT ACT GAC [519] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [519] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [519] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [519] #FLS649 ... ... ... ..C ... ... ... ... ... ... ..T ... ... ..C ... ... [519] #FLS694 ... ... ... ..C ... ... ... ... ... ... ..T ... ... ..C ... ... [519] #FLWN01a ... ... ... ..C ... ... ... ... ... ... ... ... .R. ... ... ... [519] #FLWN01b ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [519] #FLWN02a ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [519] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [519] #FLWN05a ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [519] #FLWN05b ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [519] #WNNY99 ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [519] #WNEgypt ... ... ... ..C ... ... ... ... ... ... ..T ... ... ..C ... ... [519] #Kunjin ... ..C ... ... ... ... ... ... ... ... ... ..G ..C ... ... ... [519] #MVE ..T ..C .C. ..C ..G ..C ... A.A ... ... ..T ..G ..C ... ..G ... [519] #JE T.G ..A ..T ..C ..G ... ... C.T T.. ... ..C ..C ..C AA. ..G ..T [519] #Kern217 T.A ..A .C. .A. ..G ... ..A ... T.A ... T.A A.C ..C AAG ... ... [519] #FLM38 GTC ACA GAT GTC ATC ACG ATT CCA ACA GCT GCT GGA AAG AAC CTA TGC [567] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #FLS649 ... ... ..C ... ... ... ... ... ... ... ... ... ... M.T ... ... [567] #FLS694 ... ... ..C ... ... ... ... ... ... ... ... ... ... ..T ... ... [567] #FLWN01a ... ... ... ... ... ... ..------------------[567] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [567] #WNEgypt ... ... ..C ... ... ... ... ... ... ... ... ... ... ..T ... ... [567] #Kunjin ... ... ..C A.T ... ... ..A ... ..G ..C ... ... ... ... ..G ... [567] #MVE A.T G.T ... ..G ... G.C ... ... ..C C.G AAG ... CCC ..T .A. ... [567] #JE A.T G.. ..C ..T ... GT. ... ..C ..C T.A AAA ... G.. ... AG. ..T [567] #Kern217 .CT CA. AGC .C. ..A .AC ... ..T .GT ..C AAC ... GCA ... ACT ... [567] #FLM38 ATT GTC AGA GCA ATG GAT GTG GGA TAC ATG TGC GAT GAT ACT ATC ACT [615] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [615] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [615] #FLS545 ... ... ... ... ... ... ... ..G ... ... ... ... ... ... ... ... [615] #FLS649 ... ... ... ... ... ..C ... .KG ... ... ..T ... ... ... ... ..C [615] #FLS694 ... ... ... ... ... ..C ... ..G ... ... ..T ... ... ... ... ..C [615] #FLWN01a --------------------------------[615] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [615] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [615] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [615] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... .-------[615] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [615] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [615] #WNEgypt ... ... ... ... ... ..C ... ..G ... ... ..T ... ... ... ... ..C [615] #Kunjin ... ... ... ..T ... ... ... ..G C.. ... ..T ... ... ... ... ..C [615] #MVE TGG A.T C.. ..C ..T ..C A.T ... .TT ... ..T ... ..C ..C ... ... [615] #JE TGG ... C.G ... ..C ..C ..C ..C ..T ... ..T ..G ..C ... ... ..G [615] #Kern217 ... ..G ..G ..T C.A ... ... ..G GT. ... ... A.A ... GAC ... ..A [615]

PAGE 584

559 APPENDIX L: (CONTINUED) #FLM38 TAT GAA TGT CCA GTG CTG TCG GCT G [640] #FLS502 ... ... ... ... ... ... ... ... [640] #FLS504 ... ... ... ... ... ... ... ... [640] #FLS545 ... ... ... ... ... ... ... ... [640] #FLS649 ... ... ... ... ... ... ... .-[640] #FLS694 ... A.. ... ... ... ... ... --[640] #FLWN01a ----------------[640] #FLWN01b ... ... ... ... ... ... ... ... [640] #FLWN02a ... ... ... ... ... ... ... ... [640] #FLWN02b ... ... ... ... ... ... ... ... [640] #FLWN05a ----------------[640] #FLWN05b ... ... ... ... ... ... ... ... [640] #WNNY99 ... ... ..C ... ..A ... ... ... [640] #WNEgypt ... ... ... ... ... ... ... ... [640] #Kunjin ... ... ... ... ... T.. ... ..C [640] #MVE ... ... ..C ..G AAA T.. GAA AG. [640] #JE ..C ... ... ..T AA. ..C A.C ATG [640] #Kern217 ..C CTG ..C ... ... ..T ..A ..G [640]

PAGE 585

560 APPENDIX L: (CONTINUED) West Nile Virus Strains Capsid/prM Region: WNAE Primer Set Amino Acid Alignment !Domain=Data; #FLM38 FVLALLAFFR FTAIAPTRAV LDRWRGVNKQ TAMKHLLSFK KELGTLTSAI [128] #FLS502 .......... .......... .......... .......... .......... [128] #FLS504 .......... .......... .......... .......... .......... [128] #FLS545 ..V....... .......... .......... .......... .......... [128] #FLS649 -------------...... .......... .......... .......... [128] #FLS694 ---....... .......... .....?.... .......... .......... [128] #FLWN01a .......... .......... .......... .......... .......... [128] #FLWN01b .......... .......... .......... .......... .......... [128] #FLWN02a .......... .......... .......... .......... .......... [128] #FLWN02b .......... .......... .......... .......... .......... [128] #FLWN05a .......... .......... .......... .......... .......... [128] #FLWN05b .......... .......... .......... .......... .......... [128] #WNNY99 .......... .......... .......... .......... .......... [128] #WNEgypt .......... .......... .......... .......... .......... [128] #Kunjin .......... .......... .....S.... .......... .......... [128] #MVE .......... ...L...K.L MR..KS...T ......T... ......IDVV [128] #JE .....IT..K ...L...K.L .G..KA.E.S V.....T... R.....ID.V [128] #Kern217 .I..I.T... ...LQ..E.L KR...A.D.R ..L...NG.. RD..SMLDT. [128] #FLM38 NRRSSKQKKR GGKTGIAVMI GLIASVGAVT LSNFQGKVMM TVNATDVTDV [178] #FLS502 .......... .......... .......... .......... .......... [178] #FLS504 .......... .......... .......... .......... .......... [178] #FLS545 .......... .......... .......... .......... .......... [178] #FLS649 ........?. .......... ?......... .......... .......... [178] #FLS694 .......... .......... .......... .......... .......... [178] #FLWN01a .......... .......... .......... .......... ..?....... [178] #FLWN01b .......... .....T.... .......... .......... .......... [178] #FLWN02a .......... .......... .......... .......... .......... [178] #FLWN02b .......... .......... .......... .......... .......... [178] #FLWN05a .......... .......... .......... .......... .......... [178] #FLWN05b .......... .......... .......... .......... .......... [178] #WNNY99 .......... .......... .......... .......... .......... [178] #WNEgypt .......... .......... .......... .......... .......... [178] #Kunjin .......... .......F.. ....G..... .......... .........I [178] #MVE .K.GK..... ..RLMLIF.L IGF.--A.LK ..T....I.. ......IA.. [178] #JE .K.GR..N.. ..NMWL.SLA VI..CA..MK .......LL. ...N..IA.. [178] #Kern217 ...-PSK.RG .TRSLLG--A A..GLASSLQ ..TY....L. SI.K..AQSA [178] #FLM38 ITIPTAAGKN LCIVRAMDVG YMCDDTITYE CPVLSA [214] #FLS502 .......... .......... .......... ...... [214] #FLS504 .......... .......... .......... ...... [214] #FLS545 .......... .......... .......... ...... [214] #FLS649 .........? .........? .......... .....[214] #FLS694 .......... .......... .........K .....[214] #FLWN01a ..------------------------------[214] #FLWN01b .......... .......... .......... ...... [214] #FLWN02a .......... .......... .......... ...... [214] #FLWN02b .......... .......... .......... ...... [214] #FLWN05a .......... .......... ....----------[214] #FLWN05b .......... .......... .......... ...... [214] #WNNY99 .......... .......... .......... ...... [214] #WNEgypt .......... .......... .......... ...... [214] #Kunjin .......... .......... H......... ...... [214] #MVE .A...PK.P. Q.WI..I.I. F......... ..K.ES [214] #JE .V...SK.E. R.W...I... ...E...... ..K.TM [214] #Kern217 .N..S.N.A. T.....L... V..K.D...L ...... [214]

PAGE 586

561 APPENDIX M Multiple Sequence Alignment: WNV NS5 (3) Region West Nile Virus Strains NS5 (3): WNBE Primer Set Nucleotide Alignment #MEGA !Title WNB ClustalW 1.6; !Format DataType=Nucleotide CodeTable=Standard NSeqs=9 NSites=271 Identical=. Missing=? Indel=-; !Domain=Data property=Coding CodonStart=1; #FLS694 ACC TAC GCC CTA AAC ACT TTC ACC AAC CTG GCC GTC CAG CTG GTG AGG [9553] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9553] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9553] #WNEgypt ... ... ..T ... ... ..C ... ... ... ... ... ... ... T.. ... ... [9553] #WNTX02 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9553] #WNFL03 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9553] #WNMexico ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9553] #WNHungary ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9553] #Kern217 ..A ..T ... ..G ... ..C ... ... ... ... ... ..T ..A ... A.A ..A [9553] #FLS694 ATG ATG GAA GGG GAA GGA GTG ATT GGC CCA GAT GAT GTG GAG AAA CTC [9601] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9601] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9601] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9601] #WNTX02 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9601] #WNFL03 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9601] #WNMexico ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9601] #WNHungary ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9601] #Kern217 TGC ... ..G .CT ... ..G ... G.A .AT GAG ... ..C A.T AC. .G. G.G [9601] #FLS694 ACA AAA GGG AAA GGA CCC AAA GTC AGG ACC TGG CTG TTT GAG AAT GGG [9649] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9649] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9649] #WNEgypt ... ..G ..A ... ... ..T ... ... ... ... ... ... ... ... ... ... [9649] #WNTX02 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9649] #WNFL03 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9649] #WNMexico ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9649] #WNHungary ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9649] #Kern217 .G. CTT ..A CGG TTG G.. ... .CG GTC GAG ... ... AGG A.. ... ..A [9649]

PAGE 587

562 APPENDIX M: (CONTINUED) #FLS694 GAA GAA AGA CTC AGC CGC ATG GCT GTC AGT GGA GAT GAC TGT GTG GTA [9697] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9697] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9697] #WNEgypt ..G ... ... ... ... ... ... ... ... ..C ... ... ... ... ... ... [9697] #WNTX02 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9697] #WNFL03 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9697] #WNMexico ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9697] #WNHungary ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [9697] #Kern217 CCT ... C.. T.G ... A.A ... ..A ..G ... ..G ..C ... ... ..T ..G [9697] #FLS694 AAG CCC CTG GAC GAT CGC TTT GCC ACC TCG CTC CAC TTC CTC AAT GCT [9745] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9745] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9745] #WNEgypt ... ... ..A ..T ..C ... ..C ... ... ..T ... ... ... ... ..C ..C [9745] #WNTX02 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9745] #WNFL03 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9745] #WNMexico ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9745] #WNHungary ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9745] #Kern217 ..A ..A A.T ..T ..C A.A ... ... ..T G.A ... ... ..T ... ..C AAC [9745] #FLS694 ATG TCA AAG GTT CGC AAA GAC ATC CAA GAG T [9776] #FLS504 ... ... ... ... ... ... ... ... ... ..[9776] #WNNY99 ... ... ... ... ... ... ... ... ... ... [9776] #WNEgypt ... ... ... ... ... ... ..T ... ..G ... [9776] #WNTX02 ... ... ... ... ... ... ... ... ... ... [9776] #WNFL03 ... ... ... ... ... ... ... ... ... ... [9776] #WNMexico ... ... ... ... ... ... ... ... ... ... [9776] #WNHungary ... ... ... ... ... ... ... ... ... ... [9776] #Kern217 ... ... ... A.C A.A ..G ... ..T ..G ... [9776]

PAGE 588

563 APPENDIX M: (CONTINUED) West Nile Virus Strains NS5 (3): WNBE Primer Set Amino Acid Alignment #MEGA !Title Translated WNB ClustalW 1.6; !Format DataType=Protein NSeqs=9 NSites=90 Identical=. Missing=? Indel=-; !Domain=Data; #FLS694 TYALNTFTNL AVQLVRMMEG EGVIGPDDVE KLTKGKGPKV RTWLFENGEE [3219] #FLS504 .......... .......... .......... .......... .......... [3219] #WNNY99 .......... .......... .......... .......... .......... [3219] #WNEgypt .......... .......... .......... .......... .......... [3219] #WNTX02 .......... .......... .......... .......... .......... [3219] #WNFL03 .......... .......... .......... .......... .......... [3219] #WNMexico .......... .......... .......... .......... .......... [3219] #WNHungary .......... .......... .......... .......... .......... [3219] #Kern217 .......... ....I.C..A ...VDE..IT RVRL.RLA.A VE..RK..P. [3219] #FLS694 RLSRMAVSGD DCVVKPLDDR FATSLHFLNA MSKVRKDIQE [3259] #FLS504 .......... .......... .......... .........[3259] #WNNY99 .......... .......... .......... .......... [3259] #WNEgypt .......... .......... .......... .......... [3259] #WNTX02 .......... .......... .......... .......... [3259] #WNFL03 .......... .......... .......... .......... [3259] #WNMexico .......... .......... .......... .......... [3259] #WNHungary .......... .......... .......... .......... [3259] #Kern217 .......... ......I... ...A.....N ...I...... [3259]

PAGE 589

564 APPENDIX N Multiple Sequence Alignments: SLEV Envelope Region St. Louis Encephalitis Virus Strains Envelope Region: F880/B2586 Primer Set Nucleotide Alignment #MEGA !Title Envelope ClustalW 1.6; !Format DataType=Nucleotide CodeTable=Standard NSeqs=19 NSites=1633 Identical=. Missing=? Indel=-; !Domain=Data property=Coding CodonStart=1; #FL52 AGA GTG GTC TTT GTG ATC ATG CTG ATG CTG ATT GCT CCG GCA TAC AGC [ 963] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [ 963] #FL72 ... .K. T.. ... ... ... ... ... ... T.. ... ..C ..A ... ... ... [ 963] #FL85a ... ... T.. ... ... ... ... ... ... ... ..G ... ... ... ... ... [ 963] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... .S. ... ... [ 963] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [ 963] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [ 963] #FL90b ------... ..S ... ... ... ... ... ..G ... ... ... ... ... [ 963] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [ 963] #FL90d ... ... T.. ... ... ... ... ... ... ... ..G ... ... ... ... ... [ 963] #FLS569 ... ... ... ... ... ... ... ... ... T.. ... ..C ... ... ... ... [ 963] #FLS650 ... ... ... ... ... ... ... ... ... T.. ... ..C ... ... ... ... [ 963] #TR58 ... ... ... ... ... ... ... ... ... T.. ... ..C ... ... ... ... [ 963] #TR62 ... ... ... ... ... ... ... ... ... A.. ..G ..C ... K.. ... ... [ 963] #BR64 ... ... ... ... ... ... ... ... ... T.. ... ..C ... ... ... ... [ 963] #BR69 ... ... ... ... ... ... ... ... ... T.. ... ..C ... ... ... ... [ 963] #Kern217 ... ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... [ 963] #WNNY99 ... ..T ..G ... ..C G.G C.A T.. C.T T.. G.G ..C ..A ..T ... ... [ 963] #WNEgypt C.. ..T ..G ..C ..T G.G C.A ... C.C T.. G.G ... ..A ..C ... ... [ 963] #FL52 TTC AAC TGT TTG GGA ACA TCA AAC AGG GAC TTT GTC GAG GGA ACC AGC [1011] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... [1011] #FL72 ..T ..T ... C.. ... ... ... ... ... ... ..C ... ..A ..G G.. ... [1011] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... [1011] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... [1011] #FL89 ... ..T ... ... ... ... ... ... ... ... ... ... ... ..R G.. ... [1011] #FL90a ... ..T ... ... ... ... ... ... ... ... ... ... ... ... G.. ... [1011] #FL90b ... ..T ... ... ... ... ... ... ... R.. ... ... ... ... G.. ... [1011] #FL90c ... ..T ... ... ... ... ... ... ... ... ... ... ... ... G.. ... [1011] #FL90d ... ..T ... ... ... ... ... ... ... ... ... ... ... ... G.. ... [1011] #FLS569 ... ..T ... ... ... ... ... ... ... ..T ..C ..T ..A ..G G.. ... [1011] #FLS650 ... ..T ... ... ... ... ... ... ... ..T ..C ..T ..A ..G G.. ... [1011] #TR58 ..T ..T ... C.. ... ... ... ... ... ... ..C ... ..A ..G G.. ... [1011] #TR62 ..T ..T ... C.. ... ... ... ... ... ... ..C ... A.R ..G G.. ... [1011] #BR64 ..T ..T ... ... ... ... ... ... ... ... ..C ... ..A ..G G.. ..T [1011] #BR69 ..T ..T ... C.A ... ... ... ... ... ... ..C ... A.A ..G G.. ... [1011] #Kern217 ... ... ... C.. ... ... ... ... ... ... ... ... ... ... G.. ..T [1011] #WNNY99 ... ... ..C C.T ... .TG AGC ... ..A ... ..C T.G ..A ... GTG TCT [1011] #WNEgypt ..T ... ..C C.T ... .TG AGC ... ..A ... ..C T.A ... ... GTG TCT [1011]

PAGE 590

565 APPENDIX N: (CONTINUED) #FL52 GGG GCA ACA TGG ATT GAC TTG GTA CTT GAA GGG GGA AGC TGT GTT ACA [1059] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1059] #FL72 ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ..C ... [1059] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1059] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1059] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1059] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1059] #FL90b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1059] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1059] #FL90d ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1059] #FLS569 ... ... ... ... ..C ... ... ... ... ... ..A ... ... ... ..C ... [1059] #FLS650 ... ... ... ... ..C ... ... ... ... ... ..A ... ... ... ..C ... [1059] #TR58 ... ... ... ... ... ..T ... ... ... ... ..A ... ... ... ..C ... [1059] #TR62 ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ..C ... [1059] #BR64 ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ..C ... [1059] #BR69 ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ..C ... [1059] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1059] #WNNY99 ..A ... ... ... G.G ..T ... ..T ..C ... ..C .AC ... ..C ..G ..T [1059] #WNEgypt ..A ... ... ... G.G ..T ... ..T ..C ... ..C .AC ... ... ..G ..C [1059] #FL52 GTG ATG GCA CCA GAG AAA CCA ACA CTG GAC TTC AAA GTG ACG AAG ATG [1107] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... .T. ... ... [1107] #FL72 ... ... ... ... ... ... ... ... T.. ... ... ... ... .T. ... ... [1107] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... .T. ... ... [1107] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... .T. ... ... [1107] #FL89 ... ... ... ... ... ... ... ... ... ... ..T ... ... .T. ... ... [1107] #FL90a ... ... ..G ... ... ... ... ... ... ... ..T ... ... .T. ... ... [1107] #FL90b ... ... ... ... ... ... ... ... ... ... ..T ... ... .T. ... ... [1107] #FL90c ... ... ..G ... ... ... ... ... ... ... ..T ... ... .T. ... ... [1107] #FL90d ... ... ..G ... ... ... ... ... ... ... ..T ... ... .T. ... ... [1107] #FLS569 ... ... ... ... ... ... ... ... T.A ... ... ... ..A .T. ... ... [1107] #FLS650 ... ... ... ... ... ... ... ... T.. ... ... ... ..A .T. ... ... [1107] #TR58 ... ... ... ... ... ... ... ... T.. ... ... ... ... .T. ... ... [1107] #TR62 ..A ... ... ... ... ... ... ... T.. ... ... ... ... .T. ... ... [1107] #BR64 ... ... ... ... ... ... ... ... T.. ... ... ... ... .T. ... ... [1107] #BR69 ... ... ... ... ... ... ... ... T.. ... ... ... ... .T. ... ... [1107] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ..G ... .T. ... ... [1107] #WNNY99 A.C ... T.T AAG ..C ..G ..T ..C A.C ..T G.G ..G A.. .T. ..T ... [1107] #WNEgypt A.C ... T.T AAG ..C ..G ..T ..C A.C ..T G.G ..G A.. .T. ..T ... [1107]

PAGE 591

566 APPENDIX N: (CONTINUED) #FL52 GAG GCT ACC GAG TTA GCC ACT GTG CGT GAG TAT TGT TAC AAA GCA ACC [1155] #TBH-28 ... ... ... ... ... ... ... ... ... A.. ... ... ..T G.. ... ... [1155] #FL72 ... ..C ..G ... ... ..T ..C ... ... ... ... ..C ... G.. ... ... [1155] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... ... [1155] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... ... [1155] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... ... [1155] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... ... [1155] #FL90b ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... ... [1155] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... ... [1155] #FL90d ... ... ... ... ... ... ... ... ... ... ... ... ... R.. ... ... [1155] #FLS569 ... ..C ..G ... ... ..T ... ... ... ... ... ..C ... G.. ... ... [1155] #FLS650 ... ..C ..G ... ... ..T ... ... ... ... ... ..C ... G.. ... ... [1155] #TR58 ... ..C ..G ... ... ..T ... ... ... ... ..C ..C ... G.. ... ... [1155] #TR62 ... ... ..G ... ... ..T ... ... ... ... ... ..C ... R.. ... ... [1155] #BR64 ... ..C ..G ... ... ..T ... ... ... ... ... ..C ... G.. ... ... [1155] #BR69 ... ..C ..G ... ..G ..T ... ... ..C ... ... ..C ... ... ... ... [1155] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... ... [1155] #WNNY99 ... ..G G.. A.C C.G ..A GAG ..C ..C AGT ... ..C ..T TTG ..T ... [1155] #WNEgypt ... ..C G.. A.C C.G ..A GAG ..C ..C AGT ... ..C ..T CTG ..C ... [1155] #FL52 TTG GAC ACG CTG TCA ACA GTG GCA AGA TGC CCC ACA ACA GGA GAG GCG [1203] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ..T [1203] #FL72 ... ... ... ... ... ... ... ... ... ..T ... ... ..G ... ..A ..C [1203] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ..T [1203] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ..T [1203] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ..T [1203] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ..T [1203] #FL90b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ..T [1203] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ..T [1203] #FL90d ... ... ... ... ... ... ... ... ... ... ... ..M ... ... ..A ..T [1203] #FLS569 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ..T [1203] #FLS650 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ..T [1203] #TR58 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ..T [1203] #TR62 ... ... ... ... ..G ... ... ... ... ..T ... ... ... ... ..A ..T [1203] #BR64 ... ... ..A ... ... ... ... ... ... ..T ... ... ..G ... ..A ..T [1203] #BR69 ... ... ... ... ... ... ... ... ... ..T ... ... ..G ... ..A ..T [1203] #Kern217 ... ... ... ... ... ... ... ... ..G ... ..T ... ... ... ... ..T [1203] #WNNY99 G.C AG. GAT ..C ..C ..C AAA ..T GCG ... ..G ..C .TG ... ..A ..T [1203] #WNEgypt G.C AG. GAT ..C ..C ..C AAA ..T GCG ... ..G ..T .TG ... ..A ..T [1203]

PAGE 592

567 APPENDIX N: (CONTINUED) #FL52 CAC AAC ACC AGA AGG AGT GAC CCA ACA TTT GTC TGC AAA AGA GAT GTT [1251] #TBH-28 ... ... ... .A. ... ... ... ... ... ... ... ... ... ... ... ... [1251] #FL72 ... ... ... .AG ... ... ... ... ... ..C ... ... ... ... ... ... [1251] #FL85a ... ... ... .A. ... ... ... ... ... ... ... ... ... ... ... ... [1251] #FL85b ... ... ... .A. ... ... ... ... ... ... ... ... ... ... ... ... [1251] #FL89 ... ... ... .A. ... ... ... ... ... ... ... ..T ... ... ... ... [1251] #FL90a ... ... ... .A. ... ... ... ... ... ... ... ..T ... ... ... ... [1251] #FL90b ... ... ... .A. ... ... ... ... ... ... ... ..T ... ... ... ... [1251] #FL90c ... ... ... .A. ... ... ... ... ... ... ... ..T ... ... ... ... [1251] #FL90d ... ... ... .A. ... ... ... ... ... ... ... ..T ... ... ... ... [1251] #FLS569 ... ... ... .AG ... ... ... ... ... ... ... ... ... ... ... ... [1251] #FLS650 ... ... ... .AG ... ... ... ... ... ... ... ... ... ... ... ... [1251] #TR58 ... ... ... .AG ... ... ... ... ... ..C ... ... ... ... ... ... [1251] #TR62 ... ... ... .AG ... ... ..T ... ... ..Y ... ... ... ... ... ... [1251] #BR64 ... ... ... .AG ... ... ... ... ... ..C ... ... ... ... ... ... [1251] #BR69 ... ... ... .AG ... ... ... ... ... ... ... ... ... ... ... ... [1251] #Kern217 ... ... ... .A. ... ... ... ... ... ... ... ... ... ... ... ... [1251] #WNNY99 ... ..T GA. .A. C.T GC. ... ... G.T ... ..G ... .G. CA. .GA ..G [1251] #WNEgypt ... ..T GA. .A. C.T GC. ... ... G.T ... ..G ..T ... CA. .GA ..A [1251] #FL52 GTA GAC CGC GGA TGG GGC AAC GGA TGT GGT CTG TTT GGA AAA GGG AGC [1299] #TBH-28 ..G ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... [1299] #FL72 ... ... ..T ... ... ..T ... ... ... ... ... ... ... ... ..A ... [1299] #FL85a ..G ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... [1299] #FL85b ..G ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... [1299] #FL89 ..G ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... [1299] #FL90a ..G ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... [1299] #FL90b ..G ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... [1299] #FL90c ..G ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... [1299] #FL90d ..G ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... [1299] #FLS569 ..G ... ..T ... ... ... ... ... ... ..C ... ... ... ... ..A ... [1299] #FLS650 ..G ... ..T ... ... ... ... ... ... ..C ... ... ... ... ..A ... [1299] #TR58 ..G ..T ..T ... ... ... ... ... ... ... ... ... ... ... ..A ... [1299] #TR62 ..G ... ..T ... ... ..T ... ... ... ... ... ... ... ..G ..A ... [1299] #BR64 ..G ... ..T ... ... ..T ... ... ... ... ... ... ... ... ..A ... [1299] #BR69 ..G ... ..T ... ... ..T ... ... ... ... ... ... ... ... ..A ... [1299] #Kern217 ..G ... ... ... ... ..T ... ... ... ..C ... ... ... ... ... ... [1299] #WNNY99 ..G ... A.G ..C ... ... ... ..C ..C ..A ..A ... ..C ... ..A ... [1299] #WNEgypt ..G ... A.G ..T ... ... ... ..C ... ..A ..A ... ..T ... ..A ... [1299] #FL52ATTGACACATGCGCAAAGTTCACATGCAAAAACAAGGCAACAGGGAAG[1347]

PAGE 593

568 APPENDIX N: (CONTINUED) #FL52 ATT GAC ACA TGC GCA AAG TTC ACA TGC AAA AAC AAG GCA ACA GGG AAG [1347] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1347] #FL72 ... ... ... ... ..G ... ..T .T. ... ..G ... ... ... ... ... ... [1347] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1347] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1347] #FL89 ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [1347] #FL90a ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [1347] #FL90b ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [1347] #FL90c ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [1347] #FL90d ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... ... [1347] #FLS569 ... ... ... ... ..G ... ... ... ... ..G ... ... ... ... ... ... [1347] #FLS650 ... ... ... ... ..G ... ... ... ... ..G ... ... ... ... ... ... [1347] #TR58 ... ... ... ... ..G ... ..T ... ... ..G ... ... ... ... ... ... [1347] #TR62 ... ... ... ... ..G ... ..T ... ... ..G ... ... ... ... ... ... [1347] #BR64 ... ... ... ... ..G ... ... ... ... ..G ... ... ... ... ... ... [1347] #BR69 ... ... ... ... ..G ... ... ... ... ..G .G. ... ... ... ... ... [1347] #Kern217 ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... ... [1347] #WNNY99 ... ... ... ... ..C ..A ..T G.C ... TCT .C. ... ... .T. ..A .GA [1347] #WNEgypt ... ... ... ... ..C ..A ..T G.C ..T TCT .C. ... ... ... ..A .GA [1347] #FL52 ACA ATC TTG AGA GAA AAC ATC AAG TAC GAG GTT GCA ATT TCT GTG CAT [1395] #TBH-28 ..G ... ... ... ... ... ... ... ..T ... ... ... ..C .T. ... ... [1395] #FL72 ... ... C.. ..G ... ... ... ... ... ... ..C ... ... .T. ... ... [1395] #FL85a ..G ... ... ... ... ... ... ... ..T ... ... ... ..C .T. ... ... [1395] #FL85b ..G ... ... ... ... ... ... ... ..T ... ... ... ..C .T. ... ... [1395] #FL89 ... ... ... ... ... ... ... ... ... ... ..C ... ... .T. ... ... [1395] #FL90a ... ... ... ... ... ... ... ... ... ... ..C ... ... .T. ... ... [1395] #FL90b ... ... ... ... ... ... ... ... ... ... ..C ... ... .T. ... ... [1395] #FL90c ... ... ... ... ... ... ... ... ... ... ..C ... ... .T. ... ... [1395] #FL90d ... ... ... ... ... ... ... ... ... ... ..C ... ... .T. ... ... [1395] #FLS569 ... ... C.. ..G ... ... ... ... ..T ... ..C ... ... .T. ... ... [1395] #FLS650 ... ... C.. ..G ... ... ... ... ..T ... ..C ... ... .T. ... ... [1395] #TR58 ... ... C.. ..G ... ... ... ... ... ... ..G ..G ... .T. ... ... [1395] #TR62 ... ... C.. ..G ... ... ... ... ... ... ..G ... ... .T. ... ... [1395] #BR64 ... ... C.. ..G ... ... ... ... ... ... ..C ... ... .T. ... ... [1395] #BR69 ... ... C.. ..G ... ... ... ... ... ... ..C ... ... .T. ... ... [1395] #Kern217 ..G ... ... ... ... ... ... ... ..T ... ... ... ... .T. ... ... [1395] #WNNY99 ..C ... ... .A. ..G ..T ... ... ... ..A ..G ..C ... .T. ..C ... [1395] #WNEgypt ..C ..T C.. .A. ..G ... ... ... ... ..A ..G ..T ..C .T. ..C ... [1395]

PAGE 594

569 APPENDIX N: (CONTINUED) #FL52 GGT TCA ACG GAC TCC ACA TCA CAT GGC AAT TAC TTT GAG CAG ATT GGG [1443] #TBH-28 ... ... ... ... ... ..G ... ... ... ... ... .C. ... ... ... ... [1443] #FL72 ... ... ... ... ... ..G ... ... ... ..C ... ... ... ..A ... ... [1443] #FL85a ... ... ... ... ... ..G ... ... ... ... ... .C. ... ... ..C ... [1443] #FL85b ... ... ... ... ... ..G ... ... ... ... ... ... ... ... ..C ... [1443] #FL89 ... ... ... ... ... ..G ... ... ... ... ... .Y. ... ... ... ... [1443] #FL90a ... ... ..A ... ... ..G ... ... ... ... ... .C. ... ... ... ... [1443] #FL90b ... ... ... ... ... ..G ... ... ... ... ... .C. ... ... ... ... [1443] #FL90c ... ... ... ... ... ..G ... ... ... ... ... .C. ... ... ... ... [1443] #FL90d ... ... ... ... ... ..G ... ... ... ... ... .C. ... ... ... ... [1443] #FLS569 ... ... ... ..T ..T ..G ... ... ... ... ... .C. ... ..A ... ..A [1443] #FLS650 ... ... ... ... ..T ..G ... ... ... ... ... .C. ... ..A ... ..A [1443] #TR58 ... ... ... ... ... ..G ... ... ... ... ..T ... ... ..A ... ... [1443] #TR62 ... .Y. ... K.. ... ..G A.. ... ... ... ..T .C. ... ..A ... ... [1443] #BR64 ... ... ... ... ... ..G A.. ... ..T ... ..T .C. ... ..A ... ..A [1443] #BR69 ... ... ... ... ... ..G A.. ... ..T ... ..T .Y. ... ..A ... ... [1443] #Kern217 ... ... ... ... ..T ..G ... ... ... ... ... .C. ... ... ... ... [1443] #WNNY99 ..A C.. ..T ACT GTG GAG ..G ..C ..A ..C ... .CC ACA ... G.. ..A [1443] #WNEgypt ..A C.. ..C ACT GTG GAG ..G ... ..A ..C ... CCC ACA ... ... ... [1443] #FL52 AAA AAC CAA GCG GCT AGA TTC ACC ATA AGT CCG CAA GCA CCG TCT TTT [1491] #TBH-28 ... ... ... ... ..C ... ... ... ... ..C ... ... ... ... ... ... [1491] #FL72 ... ... ... ... ... ... ... ... ... ..C ... ... ... ..A ... ... [1491] #FL85a ... ... ... ... ... ... ... ... ... ..C ... ... ... ... ... ... [1491] #FL85b ... ... ... ... ... ... ... ... ... ..C ... ... ... ... ... ... [1491] #FL89 ... ... ... ..A ... ..G ... ... ... ..C ... ... ... ... ... ..C [1491] #FL90a ... ... ... ..A ... ..G ... ... ... ..C ... ... ... ... ... ..C [1491] #FL90b ... ... ... ..A ... ..G ... ... ... ..C ... ... ... ... ... ..C [1491] #FL90c ... ... ... ..A ... ..G ... ... ... ..C ... ... ... ... ... ..C [1491] #FL90d ... ... ... ..A ... ..G ... ... ... ..C ... ... ... ... ... ..C [1491] #FLS569 ... ... ... ..A ... ... ... ... ... ..C ... ... ... ..A ... ... [1491] #FLS650 ... ... ... ..A ... ... ... ... ... ..C ... ... ... ..A ... ... [1491] #TR58 ... ... ... ..A ... ... ... ... ... ... ... ... ... ..A ..C ... [1491] #TR62 ... ... ... ..A ... ... ... ... ... ... ... ... ... ..A ..C ..C [1491] #BR64 ... ... ... ..A ... ... ... ... ... ..C ... ... ... ..A ... ... [1491] #BR69 ... ... ... ..A ... ... ... ... ... ..C ... ... ... ..A ... ... [1491] #Kern217 ... ... ... ... ... ... ... ... ... ..C ... ... ... ... ..C ... [1491] #WNNY99 GCC .CT ..G ..A .GG ... C.. .G. ..C .C. ..T GCG ..G ..T ..A .AC [1491] #WNEgypt GCC .CT ..G ..A .GG ... ... .G. ..C .C. ..T GCG ..G ..T ..A .AC [1491]

PAGE 595

570 APPENDIX N: (CONTINUED) #FL52 ACG GCT AAC ATG GGC GAG TAT GGA ACA GTT ACC ATT GAT TGT GAA GCA [1539] #TBH-28 ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... ... [1539] #FL72 ... ..C ... ... ... ... ... ... ... ..C ... ... ..C ... ... ... [1539] #FL85a ... ... ... ... ... ... ... ... ..G ... ... ... ... ... ... ... [1539] #FL85b ... ... ... ... ... ... ... ... ..G ... ... ... ... ... ... ... [1539] #FL89 ... ..C ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1539] #FL90a ... ..C ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1539] #FL90b ... ..C ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1539] #FL90c .T. ..C ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1539] #FL90d ... ..C ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1539] #FLS569 ... ... ..T ... ... ... ... ... ... ... ... ... ..C ... ... ... [1539] #FLS650 ... ... ..T ... ... ... ... ... ... ... ... ... ..C ... ... ... [1539] #TR58 ... ... ... ... ... ... ... ..G ... ..C ... ... ..C ... ... ... [1539] #TR62 ... ..C ... ... ... ... ... ... ... ..C ... ... ..C ... ... ... [1539] #BR64 ... ... ... ... ... ... ..C ... ... ..C ..T ... ..C ... ... ... [1539] #BR69 ... ... ... ... ... ... ..C ... ... ..C ... ... ..C ... ... ... [1539] #Kern217 ... ..C ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1539] #WNNY99 ..A CTA ..G C.T ..A ..A ... ... GAG ..G ..A G.G ..C ... ... C.. [1539] #WNEgypt ..A CTA ..A C.T ..A ... ... ... GAG ..G ..G G.G ..C ... ... C.. [1539] #FL52 AGA TCA GGA ATT AAC ACG GAG GAT TAT TAT GTC TTC ACT GTC AAG GAG [1587] #TBH-28 ... ... ... ..C ... ... ... ... ..C ... ... ... ... ... ... ... [1587] #FL72 ... ... ... ..C M.. ..A ... AC. ... ... ... ..T ..A ... ... ... [1587] #FL85a ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [1587] #FL85b ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [1587] #FL89 ... ... ... ..C ... ... ... ... ..C ... ... ... ... ... ... ... [1587] #FL90a ... ... ... ..C ... ... ... ... ..C ... ... ... ... ... ... ... [1587] #FL90b ... ... ... ..C ... ... ... ... ..C ... ... ... ... ... ... ... [1587] #FL90c ... ... ... ..C ... ... ... ... ..C ... ... ... ... ... ... ... [1587] #FL90d ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [1587] #FLS569 ... ... ... ..C ... ..A ..A ..C ... ... ... ..T ..A ... ... ... [1587] #FLS650 ... ... ... ..C ... ..A ..A ..C ... ... ... ..T ..A ... ... ... [1587] #TR58 ... ... ... ..C ... ..A ..A ..C ... ... ... ..T ..A ... ... ... [1587] #TR62 ... ... ... ..C ... ..A ..A ... ..C ... ... ... ..A ... ... ... [1587] #BR64 ... ... ... ..C ... ..A ..A ..C ..C ... ... ..T ..A ... ... ... [1587] #BR69 ... ... ... ..C ... ..A ..A ..C ..C ... ... ..T ..A ... ... ... [1587] #Kern217 ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [1587] #WNNY99 C.G ... ..G ... G.. ..C A.T .CA ..C ..C ..G A.G ... ..T GGA ACA [1587] #WNEgypt C.. ... ..G ... G.. ..C A.T .CA ..C ..C ..G A.G ... ... GGA ACA [1587]

PAGE 596

571 APPENDIX N: (CONTINUED) #FL52 AAG TCA TGG CTA GTG AAC AGG GAC TGG TTT CAC GAC TTG AAC CTT CCA [1635] #TBH-28 ... ... ... ... ... ... ... ..T ... ..C ... ... ... ... ... ... [1635] #FL72 ... ... ... ... ... ..T ... ..T ... ... ... ..T C.. ... ... ... [1635] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1635] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1635] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1635] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1635] #FL90b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1635] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1635] #FL90d ... ... ... ... ... .M. ... ... ... ... ... ... ... ... ... ... [1635] #FLS569 ... ... ... ... ... ..T ... ..T ... ... ... ..T C.. ... ... ... [1635] #FLS650 ... ... ... ... ... ..T ... ..T ... ... ... ..T C.. ... ... ... [1635] #TR58 ... ... ... ... ... ..T ... ... ... ... ... ..T M.. ... ... ... [1635] #TR62 ... ... ... ... ... ..T ... ..T ... ... ... ..T C.. ... ... ... [1635] #BR64 ... ... ... ... ..A ..T ... ..T ... ... ... ..T C.. ... ... ... [1635] #BR69 ... ... ... ... ..T ..A TA. .GA ... ..C ... ..T C.. ... ... ... [1635] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1635] #WNNY99 ... A.G .TC T.G ..C C.T C.T ..G ... ..C ATG ... C.C ... ..C ..T [1635] #WNEgypt ... A.G .TC T.G ..C C.T C.T ..G ... ... ATG ... C.C ... ..C ..C [1635] #FL52 TGG ACG AGC CCT GCC ACA ACT GAT TGG CGC AAC AGA GAA ACA CTG GTG [1683] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1683] #FL72 ... ... ... ... ... ... ... ... ... ... ... ... ... ... T.. ... [1683] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1683] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1683] #FL89 ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [1683] #FL90a ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [1683] #FL90b ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [1683] #FL90c ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [1683] #FL90d ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [1683] #FLS569 ... ... ... ... ... ... ... ..C ... ..T ... ... ... ... ... ... [1683] #FLS650 ... ... ... ... ... ... ... ..C ... ..T ... ... ... ... Y.. ... [1683] #TR58 ... ..A ... ... ... ... ... ..C ... ... ... ... ... ... Y.. ... [1683] #TR62 ... ... ... ... ... ... ... ..C ... ... ... ..G ... ... T.. ... [1683] #BR64 ... ... ... ... ... ... ..C ..C ... ... ..T ... ... ... T.. ... [1683] #BR69 ... ... ... ... ..T ... ... ..C ... ... ... ... ... ... T.. ... [1683] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1683] #WNNY99 ... .GC ..T G.. .GA .GT ... .TG ... A.G ... ... ..G ..G T.A A.. [1683] #WNEgypt ... .GC ..T G.C .GA .GC ... .TG ... A.G ... ... ..G ..G T.. A.. [1683]

PAGE 597

572 APPENDIX N: (CONTINUED) #FL52 GAA TTT GAG GAA CCG CAT GCC ACC AAG CAA ACT GTA GTC GCC CTA GGA [1731] #TBH-28 ... ... ... ... ... ..C ... ... ... ..G ... ... ..A ... ... ... [1731] #FL72 ... ... ..A ... ..A ... ... ... ... ... ... ..G ..T ... ... ..C [1731] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... [1731] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... [1731] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1731] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1731] #FL90b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1731] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1731] #FL90d ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1731] #FLS569 ... ... ..A ... ..A ..C ... ... ... ... ... ..G ..T ... ... ..C [1731] #FLS650 ... ... ..A ... ..A ..C ... ... ... ... ... ..G ..T ... ... ..C [1731] #TR58 ... ... ..A ... ..A ... ... ... ... ... ... ..G ..T ... Y.. ..C [1731] #TR62 ... ... ..A ... ..A ... ... ... ... ... ... ..G ... ... ... ..C [1731] #BR64 ... ... ..A ... ..A ... ... ... ..A ... ... ..G ... ... ... ..C [1731] #BR69 ... ... ..A ... ..A ... ... ... ... ... ... ..G ... ... ... ..C [1731] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ..A ... ... ... [1731] #WNNY99 ..G ... ... ... ..A ..C ... ..G ... ..G T.. ..G A.A ..A T.G ..C [1731] #WNEgypt ..G ... ... ... ..A ..C ... ..G ... ..G T.. ..G A.A ..A T.G ..C [1731] #FL52 TCG CAA GAA GGT GCC CTG CAC ACA GCA TTG GCC GGA GCC ATT CCG GCC [1779] #TBH-28 ..A ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ... [1779] #FL72 ... ... ... ..A ... ... ... ... ... C.. ... ... ... ... ..A ... [1779] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ... [1779] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..A ... [1779] #FL89 ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ..A ... [1779] #FL90a ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ..A ... [1779] #FL90b ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ..A ... [1779] #FL90c ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ..A ... [1779] #FL90d ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ..A ... [1779] #FLS569 ... ... ... ..A ... ... ... ... ... C.. ..T ... ... ... ..A ... [1779] #FLS650 ... ... ... ..A ... ... ... ... ... C.. ..T ... ... ... ..A ... [1779] #TR58 .Y. ... ... ..A ..T Y.. ... ... ... C.. ... ... ... ... ..A ... [1779] #TR62 ... ... ... ..A ... ... ... ... ... C.. ... ... ... ... Y.A ... [1779] #BR64 ... ... ... ..A ... ... ... ... ... C.. ... ... ... ... ..A ... [1779] #BR69 ... ... ... ..A ... ... ... ... ... ... .ST ... ... ... Y.A ... [1779] #Kern217 ... ... ... ... ... ... ... ... ... ... ..T ... ..T ... ..A ... [1779] #WNNY99 ..A ... ..G ..A ..T ... ..T CA. ..T ... ..T ... ... ... ..T .TG [1779] #WNEgypt ..A ... ..G ..A ..T ... ..T CA. ..T ... ..T ... ... ... ..T .TG [1779]

PAGE 598

573 APPENDIX N: (CONTINUED) #FL52 ACT GTT AGC AGC TCA ACC CTA ACC TTG CAA TCA GGG TAT CTG AAA TGC [1827] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... C.. ... ... ... [1827] #FL72 ... ... ... ... ..M ... T.. ... ... ... ... ... C.C T.. ..G ... [1827] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... C.. ... ... ... [1827] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... C.. ... ... ... [1827] #FL89 ... ... ... ... ... ... ..C ... ... ... ... ... C.. T.. ... ... [1827] #FL90a ... ... ... ... ... ... ..C ... ... ... ... ... C.. T.. ... ... [1827] #FL90b ... ... ... ... ... ... ..C ... ... ... ... ... C.. T.. ... ... [1827] #FL90c ... ... ... ... ... ... ..C ... ... ... ... ... C.. T.. ... ... [1827] #FL90d ... ... ... ... ... ... ..C ... ... ... ... ... C.. TK. ... ... [1827] #FLS569 ... ... ... ... ..C ..T T.. ... ... ... ... ... C.C T.. ..G ... [1827] #FLS650 ... ... ... ... ..C ..T T.. ... ... ... ... ... C.C T.. ..G ... [1827] #TR58 ... ... ... ... ..C ... T.. ... C.. ... ... ... C.C T.. ..G ... [1827] #TR62 ... ... ... ... ..C ... T.. ... Y.A ... ... ... C.C T.. ..G ... [1827] #BR64 ... ... ... ... ..C ... T.. ... ... ... ..G ... C.C T.. ..G ..T [1827] #BR69 ... ... ... ... ..C ... T.. ... .G. ... ... ... C.C T.. ..G ..T [1827] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... C.. ... ... ... [1827] #WNNY99 GAA T.. TCA ... AAC ..T G.C .AG ... ACG ..G ..T C.. T.. ..G ..T [1827] #WNEgypt GAA T.. TCA ... AAC ..T G.C .AG ... AC. ..G ..T C.. T.. ..G ..T [1827] #FL52 AGA GCT AAG CTT GAC AAG GTC AAA ATC AAG GGA ACG ACA TAT GGT ATG [1875] #TBH-28 ... ..C ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1875] #FL72 ... ..C ... ... ... ... ... ... ... ..R ... ..A ... ... ..C ... [1875] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1875] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1875] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1875] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1875] #FL90b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1875] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1875] #FL90d ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1875] #FLS569 ... ..C ... ... ... ... ... ... ... ..A ... ..A ... ... ... ... [1875] #FLS650 ... ..C ... ... ... ... ... ... ... ..R ... ..A ... ... ... ... [1875] #TR58 ... ..C ... ... ... ... ... ... ... ..A ... ... ... ... ..C ... [1875] #TR62 ... ..C .R. ... ... ... ... ... ... ... ... ..A ... ... ..C ... [1875] #BR64 ... ..C ... ... ... ... ... ... ... ..A ... ..A ... ..C ..C ... [1875] #BR69 ... ..C .G. ... ... ... T.. ... ... ... ... ..A ... ..C ..C ... [1875] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... [1875] #WNNY99 ... .TG ... A.G ..A ..A T.G C.G T.G ... ... ..A ..C ... ..C G.C [1875] #WNEgypt ... .TG ... A.G ..A ..A T.G C.G T.G ... ... ..A ..C ..C ..C G.C [1875] #FL52TGTGACTCTGCCTTCACCTTCAGCAAGAACCCAACTGACACAGGGCAT[1923]

PAGE 599

574 APPENDIX N: (CONTINUED) #FL52 TGT GAC TCT GCC TTC ACC TTC AGC AAG AAC CCA ACT GAC ACA GGG CAT [1923] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C [1923] #FL72 ... ... ... ..G ... ... ... ... ... ... ... G.. ... ... ... ... [1923] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C [1923] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C [1923] #FL89 ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... [1923] #FL90a ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... [1923] #FL90b ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... [1923] #FL90c ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... [1923] #FL90d ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... [1923] #FLS569 ... ... ... ..G ..T ... ... ... ... ... ... G.. ... ... ... ... [1923] #FLS650 ... ... ... ..G ..T ... ... ... ... ... ... G.. ... ... ... ... [1923] #TR58 ... ... ... ..G ... ... ... ... ..A ... ... G.. ... ... ... ... [1923] #TR62 ... ... ... ..G ... ... ... ... ... ... ... G.. ... ... ... ... [1923] #BR64 ... ... ... ..G ... ... ... ... ... ... ... G.. ... ... ... ... [1923] #BR69 ... ... ... ..G ..T ... ... ... ... ... ... G.. ... ... ... ... [1923] #Kern217 ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... ..C [1923] #WNNY99 ... TCA AAG ..T ... .AG ..T CTT GG. .CT ..C G.A ... ... ..T ..C [1923] #WNEgypt ... TCA AAG ..T ... .AG ..T CTT GGA .CT ..C G.A ... ... ..C ..C [1923] #FL52 GGG ACA GTG ATT GTG GAA CTG CAG TAC ACT GGA AGC AAC GGA CCC TGC [1971] #TBH-28 ... ... ... ... ... ... ... ... ..T ..C ... ..T ... ... ... ... [1971] #FL72 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..T [1971] #FL85a ... ... ... ... ... ... T.. ... ..T ... ... ... ... ... ... ... [1971] #FL85b ... ... ... ... ... ... T.. ... ..T ... ... ... ... ... ... ... [1971] #FL89 ... ... ... ... ..A ... ... ..A ..T ... ... ... ... ... ... ... [1971] #FL90a ... ... ... ... ..A ... ... ... ..T ... ... ... ... ... ... ... [1971] #FL90b ... ... ... ... ..A ... ... ... ..T ... ... ... ... ... ... ... [1971] #FL90c ... ... ... ... ..A ... ... ... ..T ... ... ... ... ... ... ... [1971] #FL90d ... ... ... ... ..A ... ... ... ..T ... ... ... ... ... ... ... [1971] #FLS569 ... ... ..A ... ... ... T.. ..A ... ... ... ..T ... ... ... ... [1971] #FLS650 ... ... ..A ... ... ... T.. ..A ... ... ... ..T ... ... ... ... [1971] #TR58 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1971] #TR62 ... ... ... ... ... ... T.. ... ... ... ... ... ... ... ... ..T [1971] #BR64 ... ... ... ... ..A ... ... ... ... ... ... ... ... ... ... ... [1971] #BR69 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1971] #Kern217 ... ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... [1971] #WNNY99 ..C ..T ... G.G T.. ... T.. ... ... ... ..C .CG G.T ... ..T ... [1971] #WNEgypt ..C ..T ..A G.G T.. ... T.. ... ... ... ..C .CG G.T ... ..T ... [1971]

PAGE 600

575 APPENDIX N: (CONTINUED) #FL52 CGG GTT CCC ATT TCC GTG ACT GCA AAC CTC ATG GAC TTG ACA CCG GTT [2019] #TBH-28 ..A ... ... ..C ... ... ... ... ... ... ... ..T ... ... ... ... [2019] #FL72 ... ... ... ... ... ... ..C ... ... ... ... ... ... ... ... ... [2019] #FL85a ..A ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [2019] #FL85b ..A ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [2019] #FL89 ... ... ... ..C ..T ... ..C ... ... ... ... ... ..A ... ... ... [2019] #FL90a ... ... ... ..C ..T ... ..C ... ... ... ... ... ..A ... ... ... [2019] #FL90b ... ... ... ..C ..T ... ..C ... ... ... ... ... ..A ... ... ... [2019] #FL90c ... ... ... ..C ..T ... ..C ... ... ... ... ... ..A ... ... ... [2019] #FL90d ... ... ... ..C ..T ... ..C ... ... ... ... ... ..A ... ... ... [2019] #FLS569 ... ... ... ... ... ... ..A ... ... ... ... ... ... ... ... ... [2019] #FLS650 ... ... ... ... ... ... ..A ... ... ... ... ... ... ... ... ... [2019] #TR58 ... ... ... ... ... ... ... ... ... ... ... ... ... ..G ... ..G [2019] #TR62 ... ... ... ... ... ... ... ... ... ... ... ... ... ..G ... ... [2019] #BR64 ... ... ... ... ... ... ..A ... ... ... ... ... ... ..G ... ... [2019] #BR69 ... ... ... ... ... ... ..A ... ... ... ... ... ... ..G ... ... [2019] #Kern217 ..A ... ... ..C ... ... ... ... ... ... ... ..T ... ... ... ... [2019] #WNNY99 AAA ... ..T ..C ..G TCA GTG ..T TCA T.G .AC ... C.A ..G ..A ..G [2019] #WNEgypt AAA ... ... ..C ..G TCA GTG ..T TCA T.G .AC ... C.A ..G ..A ..G [2019] #FL52 GGA AGA TTG GTC ACG GTC AAT CCC CTT ATA AGC ACA GGG GGA GCG AAC [2067] #TBH-28 ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FL72 ... ... ... ..T ... ... ... ... T.. ... ... ..G ... ... ... ... [2067] #FL85a ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FL85b ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FL89 ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FL90a ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FL90b ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FL90c ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FL90d ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FLS569 ... ... ... ..T ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #FLS650 ... ... ... ..T ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #TR58 ... ... ... ..T ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #TR62 ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #BR64 ... ... ... ..T ... ... ... ... T.. ... ... ... ... ... ... ... [2067] #BR69 ... ... ... ..T ... ... ... ... T.C ... ... ... ... ... ... ... [2067] #Kern217 ... ... C.. ... ... ... ... ..T T.. ... ... ... ... ... ... ... [2067] #WNNY99 ..C ... ... ... ..T ... ..C ..T T.. G.T TCA GTG .CC ACG ..C ... [2067] #WNEgypt ..C ..G ... ... ..T ... ..C ... T.. G.T TCA GT. .CC ACG ..C ..T [2067]

PAGE 601

576 APPENDIX N: (CONTINUED) #FL52 AAC AAG GTC ATG ATT GAA GTT GAA CCA CCC TTC GGC GAT TCT TAC ATC [2115] #TBH-28 ... ... ... ... ..C ... ... ... ... ..T ... ... ... ... ... ... [2115] #FL72 ... ... ... ... ..C ... ... ..G ... ... ... ... ... ... ... ... [2115] #FL85a ... ... ... ... ..C ... ..C ... ... ... ... ... ..C ... ..T ... [2115] #FL85b ... ... ... ... ..C ... ..C ... ... ... ... ... ..C ... ..T ... [2115] #FL89 ... ... ..T ... ..C ... ... ... ... ... ... ... ... ... ... ... [2115] #FL90a ... ... ..T ... ..C ... ... ... ... ... ... ... ... ... ... ... [2115] #FL90b ... ... ..T ... ..C ... ... ... ... ... ... ... ... ... ... ... [2115] #FL90c ... ... ..T ... ..C ... ... ... ... ... ... ... ... ... ... ... [2115] #FL90d ... ... ..T ... ..C ... ... ... ... ... ... ... ... ... ... ... [2115] #FLS569 ... ... ... ... ..C ... ... ... ... ... ... ..T ..C ... ... ... [2115] #FLS650 ... ... ... ... ..C ... ... ... ... ... ... ..T ..C ... ... ... [2115] #TR58 ... ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... [2115] #TR62 ... ... ... ... ..C ... ... ... ... ..T ... ... ... ... ... ... [2115] #BR64 ... ... ... ... ..C ... ..C ... ... ... ... ... ... ... ... ... [2115] #BR69 ... ... ... ... ..C ... ..C ... ... ... ... ... ... ... ... ... [2115] #Kern217 ... ... ... ... ..C ... ... ... ... ... ..T ... ... ... ... ... [2115] #WNNY99 GCT ... ... C.. ... ... T.G ... ... ... ..T ..A ..C ..A ... ..A [2115] #WNEgypt GC. ... ... C.. ... ... T.G ... ... ... ..T ..A ..C ..A ... ..A [2115] #FL52 GTC GTC GGA AGA GGC ACC GCC CAG ATT AAC TAC CAC TGG CAC AAA GGG [2163] #TBH-28 ... ... ... ... ... ... A.. ... ... ... ... ... ... ..T ... .A. [2163] #FL72 ... ... ... ... ..T ... A.. ..A ..C ... ... ... ... ... ... .A. [2163] #FL85a ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... .A. [2163] #FL85b ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... .A. [2163] #FL89 ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... .AA [2163] #FL90a ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... .AA [2163] #FL90b ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... .AA [2163] #FL90c ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... .AA [2163] #FL90d ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... .AA [2163] #FLS569 ... ... ... ... ... ... A.. ..A ..C ... ... ... ... ... ... .A. [2163] #FLS650 ... ... ... ... ... ... A.. ..A ..C ... ... ... ... ... ... .A. [2163] #TR58 ... ... ... ... ... ... A.. ..A ..C ... ... ... ... ... ... .A. [2163] #TR62 ... ... ... ... ..T ... A.. ..A ..C ... ... ... ... ... ... .A. [2163] #BR64 ... ... ... ... ... ... A.. ..A ..C ..T ... ... ... ... ... .A. [2163] #BR69 ... ... ... ... ... ... A.. ..A ..C ... ... ... ... ... ... .A. [2163] #Kern217 ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... .AA [2163] #WNNY99 ..G ..G ..C ... ..A GAA CAA ... ..C ..T C.. ..T ... ... ..G TCT [2163] #WNEgypt ..G ..G ..C ... ..A GAA CAA ... ... ..T C.. ..T ... ... ..G TCT [2163]

PAGE 602

577 APPENDIX N: (CONTINUED) #FL52 GGA AGC AGC ATT GGG AAG GCT TTG GCG ACC ACA TGG AAA GGA GCC CAA [2211] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2211] #FL72 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ... [2211] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2211] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2211] #FL89 ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [2211] #FL90a ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [2211] #FL90b ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [2211] #FL90c ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [2211] #FL90d ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... [2211] #FLS569 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ... [2211] #FLS650 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ... [2211] #TR58 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ... [2211] #TR62 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ... [2211] #BR64 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ... [2211] #BR69 ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ..A ... [2211] #Kern217 ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... ... [2211] #WNNY99 ... ... ... ... ..C ..A ..C ..T A.A ... ..C CTC ... ... ..G ..G [2211] #WNEgypt ... ... ... ... ..C ..A ..C ..C A.A ... ..C CTC ... ..G ..G ..G [2211] #FL52 CGG CTA GCC GTC TTA GGG GAT ACA GCG TGG GAC TTT GGA TCT GTT GGA [2259] #TBH-28 ... ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #FL72 ... ... ... ... ..G ... ..C ... ... ... ... ..C ... ..C A.. ... [2259] #FL85a ... ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #FL85b ... ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #FL89 ..A ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #FL90a ..A ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #FL90b ..A ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #FL90c ..A ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #FL90d ..A ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #FLS569 ..A ... ... ... ..G ... ..C ... ... ... ... ..C ... ..C A.. ... [2259] #FLS650 ..A ... ... ... ..G ... ..C ... ... ... ... ..C ... ..C A.. ... [2259] #TR58 ... ... ... ... ..G ... ..C ... ... ... ... ... ... ..C A.. ... [2259] #TR62 ... T.. ... ... ..G ..A ..C ... ... ... ... ..C ... ..C A.. ... [2259] #BR64 ... ... ... ... ..G ... ..C ... ... ... ... ..C ... ..C A.. ... [2259] #BR69 ... ... ... ... ..G ... ..C ... ... ... ... ..C ... ..C A.. ... [2259] #Kern217 ... ... ... ... ... ... ..C ... ... ... ... ... ... ... A.. ... [2259] #WNNY99 A.A ... ... .CT C.. ..A ..C ... ..T ... ... ... ... ..A ... ... [2259] #WNEgypt A.A T.. ... .C. C.. ..A ... ... ..T ... ... ... ... ..A ... ... [2259]

PAGE 603

578 APPENDIX N: (CONTINUED) #FL52 GGA GTT TTC AAT TCA ATT GGC AAA GCT GTC CAC CAA GTC TTC GGA GGA [2307] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ..T ..Y ... ... [2307] #FL72 ... ..C ... ... ... ..C ... ... ... ... ... ... ... ..T ... ..G [2307] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [2307] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [2307] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [2307] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [2307] #FL90b ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [2307] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [2307] #FL90d ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [2307] #FLS569 ... ..C ..T ... ... ..C ... ... ... ... ... ... ..T ..T ... ..G [2307] #FLS650 ... ..C ..T ... ... ..C ... ... ... ... ... ... ..T ..T ... ..G [2307] #TR58 ... ..C ... ... ... ..C ... ... ... ... ... ... ..T ..T ... ..G [2307] #TR62 ... ..C ... ... ... ..C ... ..G ... ... ... ... ..T ..T ... ..G [2307] #BR64 ... ..C ..T ... ... ..C ... ... ... ..G ... ... ..T ..T ... ..G [2307] #BR69 ... ..C ... ... ... ... ... ... ... ..G ... ... .YT ..T ... ..G [2307] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... [2307] #WNNY99 ..G ..G ... .CC ... G.. ..G ..G ... ... ..T ... ..G ... ... ... [2307] #WNEgypt ..G ..G ... .CC ... G.G ..G ..G ... ... ..T ... ..G ..T ..T ... [2307] #FL52 GCG TTC AGG ACT CTG TTC GGG GGA ATG TCC TGG ATC ACA CAG GGA CTA [2355] #TBH-28 ... ... ... ... ..A ... ... ... ... ... ... ... ... ... ... ... [2355] #FL72 ..A ... ... ..C ... ... ... ... ... ... ... ... ... ... ... T.G [2355] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2355] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2355] #FL89 ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... ..G [2355] #FL90a ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... ..G [2355] #FL90b ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... ..G [2355] #FL90c ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... ..G [2355] #FL90d ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... ..G [2355] #FLS569 ..A ... ... ... ... ... ..A ... ... ... ... ... ... ... ... T.. [2355] #FLS650 ..A ... ... ... ... ... ..A ... ... ... ... ... ... ... ... T.. [2355] #TR58 ..A ... ... ... ... ... ... ... ... ... ... ... ... ... ... T.. [2355] #TR62 ..A ... ... ... ... ... ... ... ... ... ... ... ... ... ... T.. [2355] #BR64 ..A ... ... ... ... ... ... ... ... ... ... ... ... ... ... T.. [2355] #BR69 ..A ... ... ... ... ... ... ... ... ..T ... ... ... ... ... T.. [2355] #Kern217 ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... ... [2355] #WNNY99 ..A ... C.C T.A ... ... ..A ..C ... ... ... ..A ..G ..A ... T.G [2355] #WNEgypt ..A ... C.C T.A ... ... ..A ..C ... ..T ... ..A ..G ..A ... T.G [2355]

PAGE 604

579 APPENDIX N: (CONTINUED) #FL52 CTT GGA GCC CTT CTC CTG TGG ATG GGG TTG CAG GCC CAC GAC AGG AGC [2403] #TBH-28 ... ... ..T ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #FL72 ... ... ... ... ... T.. ... ... ... ... ... ... .G. ... ... ... [2403] #FL85a ... ... ..T ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #FL85b ... ... ..T ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #FL89 ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #FL90a ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #FL90b ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #FL90c ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #FL90d ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #FLS569 ... ... ..T ... ... T.. ... ... ... ... ... ... .GT ... ... ... [2403] #FLS650 ... ... ..T ... ... T.. ... ... ... ... ... ... .GT ... ... ... [2403] #TR58 ... ... ... ... ... T.. ... ... ... ... ... ... .G. ... ... ... [2403] #TR62 ... ... ... ... ... T.. ... ... ... ... ... ... .G. ... ... ... [2403] #BR64 ... ... ... ... ... T.. ... ... ... ... ... ... .G. ... ... ... [2403] #BR69 ... ... ... ... ... T.. ... ... ... ... ... ... .G. ... ... ... [2403] #Kern217 ... ... ..T ... ... ... ... ... ... ... ... ... .G. ... ... ... [2403] #WNNY99 ..G ..G ..T ..C ..G T.. ... ... ..C A.C A.T ..T .GT ..T ... TC. [2403] #WNEgypt ..G ..G ..T ..G ..G T.. ... ... ..C A.C A.T ..T .GT ... ... TC. [2403] #FL52 ATC TCG CTG ACT CTA CTG GCT ATC GGA GGG ATT CTC ATC TTT CTG GCA [2451] #TBH-28 ... ... ... ... ... ... ... G.. ... ... ... ... ..T ... ... ... [2451] #FL72 ... ... T.. ..C ... ... ... G.T ... ... ... ..A ... ... ..A ..G [2451] #FL85a ... ... ... ... ... ... ... G.. ... ... ... ... ... ... ... ... [2451] #FL85b ... ... ... ... ... ... ... G.. ... ... ... ... ... ... ... ... [2451] #FL89 ..T ... T.. ... ... ... ... G.. ... ..A ... ... ... ... ... ... [2451] #FL90a ..T ... T.. ... ... ... ... G.. ... ..A ... ... ... ... ... ... [2451] #FL90b ..T ... T.. ... ... ... ... G.. ... ..A ... ... ... ... ... ... [2451] #FL90c ..T ... T.. ... ... ... ... G.. ... ..A ... ... ... ... ... ... [2451] #FL90d ..T ... T.. ... ... ... ... G.. ... ..A ... ... ... ... ... ... [2451] #FLS569 ..T ... ... ... ... ... ... G.T ... ... ... ..G ... ... ..A ..G [2451] #FLS650 ..T ... ... ... ... ... ... G.T ... ... ... ..G ... ... ..A ..G [2451] #TR58 ... ... ... ..C ... ... ... G.T ... ... ... ..A ... ..C ..A ..G [2451] #TR62 ... ... ... ..C ... ... ... G.T ... ... ... ..A ... ... ..A ..G [2451] #BR64 ... ... T.. ... ... ... ... G.T ... ... ... ..A ... ... ..A ..G [2451] #BR69 ... ... T.. ... ... ... ..C G.T ... ... ... T.A ... ... ..A ..G [2451] #Kern217 ... ... ... ... ... ... ... G.T ... ... ... ..T ... ... ... ... [2451] #WNNY99 ..A G.T ..C ..G T.T ..C ..A G.T ... ..A G.. ..G C.. ..C ..C T.C [2451] #WNEgypt ..A G.T ..C ..G T.T ..C ..A G.T ... ... G.. T.G C.. ... ..C T.C [2451]

PAGE 605

580 APPENDIX N: (CONTINUED) #FL52 ACC AGC GTG CAA GCC GAT TCG GGA TGT GCA ATT GAC CTA CAA CGA CGT [2499] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2499] #FL72 ... ... ... ... ..T ... ... ... ... ... ... ... ..G ... ... ... [2499] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... T.. ... ... ... [2499] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... T.. ... ... ... [2499] #FL89 ... ... ..A ... ... ..C ... ... ... ... ... ... ... ... ... ... [2499] #FL90a ... ... ..A ... ... ..C ... ... ... ... ... ... ... ... ... ... [2499] #FL90b ... ... ..A ... ... ..C ... ... ... ... ... ... ... ... M.. ... [2499] #FL90c ... ... ..A ... ... ..C ... ... ... ... ... ... ... ... ... ... [2499] #FL90d ... ... ..A ... ... ..C ... ... ... ... ... ... ... ... ... ... [2499] #FLS569 ... ... ... ... ..T ... ... ... ... ... ... ... T.. ... ... ... [2499] #FLS650 ... ... ... ... ..T ... ... ... ... ... ... ... T.. ... ... ... [2499] #TR58 ... ..T ... ... ..T ... ... ... ... ... ... ... ... ... ... ... [2499] #TR62 ... ..T ... ... ..T ..C ... ... ... ... ... ... ... ... ... ... [2499] #BR64 ... ..T ... ... ..T ... ... ... ... ... ... ... ... ... ... ... [2499] #BR69 ... ..T ... ... ..T ... ... ... ... ... ... ... ... ... ... ... [2499] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2499] #WNNY99 GTG .A. ... ..C ..T ..C A.T ..G ... ..C ..A ... A.C AGC ..G .AA [2499] #WNEgypt GTG .A. ... ..C ..T ..C A.T ... ... ..C ..A ... A.C AGC ..G .AG [2499] #FL52 GAA TTG AAA TGT GGA GGA GGC ATC TTC GTG TAC AAC GAC GTT GAG AAG [2547] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2547] #FL72 ... ... ... ... ... ... ... ... ... ... ... ..T ... ..C ... ... [2547] #FL85a ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [2547] #FL85b ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [2547] #FL89 ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [2547] #FL90a ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [2547] #FL90b ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ----[2547] #FL90c ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [2547] #FL90d ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ..[2547] #FLS569 ... ... ... ... ... ... ... ... ... ... ... ..T ... ..C ... ... [2547] #FLS650 ... ... ... ... ... ... ... ... ... ... ... ..T ... ..C ... ... [2547] #TR58 ... ... ... ... ... ... ... ... ... ... ... ..T ..T ..C K.. ..[2547] #TR62 ... ... ... ... ... ... ... ... ... ... ... ..T ... ..C ... ..C [2547] #BR64 ... ... ... ... ... ... ... ... ..T ... ... ..T ..T ..C ... ... [2547] #BR69 ... ... ... ... ... ... ... ... ... ... ... ..T ..T ..C ... ... [2547] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [2547] #WNNY99 ..G C.. .G. ... ... A.T ..A G.G ... A.A C.. ..T ..T ..G ... GCT [2547] #WNEgypt ..G C.. .G. ... ... A.T ..A G.G ... A.A C.. ..T ..T ..G ... GCT [2547]

PAGE 606

581 APPENDIX N: (CONTINUED) #FL52 T [2548] #TBH-28 [2548] #FL72 [2548] #FL85a [2548] #FL85b [2548] #FL89 [2548] #FL90a [2548] #FL90b [2548] #FL90c [2548] #FL90d [2548] #FLS569 [2548] #FLS650 [2548] #TR58 [2548] #TR62 A [2548] #BR64 [2548] #BR69 [2548] #Kern217 [2548] #WNNY99 [2548] #WNEgypt [2548]

PAGE 607

582 APPENDIX N: (CONTINUED) St. Louis Encephalitis Virus Strains Envelope Region: F880/B2586 Primer Set Amino Acid Alignment #MEGA !Title Translated Envelope ClustalW 1.6; !Format DataType=Protein NSeqs=19 NSites=544 Identical=. Missing=? Indel=-; !Domain=Data; #FL52 RVVFVIMLML IAPAYSFNCL GTSNRDFVEG TSGATWIDLV LEGGSCVTVM [356] #TBH-28 .......... .......... .......... A......... .......... [356] #FL72 .?F....... .......... .......... A......... .......... [356] #FL85a ..F....... M......... .......... A......... .......... [356] #FL85b .......... ...?...... .......... A......... .......... [356] #FL89 .......... .......... .........? A......... .......... [356] #FL90a .......... .......... .......... A......... .......... [356] #FL90b ---.?..... M......... .....?.... A......... .......... [356] #FL90c .......... .......... .......... A......... .......... [356] #FL90d ..F....... M......... .......... A......... .......... [356] #FLS569 .......... .......... .......... A......... .......... [356] #FLS650 .......... .......... .......... A......... .......... [356] #TR58 .......... .......... .......... A......... .......... [356] #TR62 .........M M..?...... ........?. A......... .......... [356] #BR64 .......... .......... .......... A......... .......... [356] #BR69 .......... .......... ........K. A......... .......... [356] #Kern217 .......... .......... .......... A......... .......... [356] #WNNY99 .....VL.L. V......... .M.....L.. V.....V... ...D....I. [356] #WNEgypt .....VL.L. V......... .M.....L.. V.....V... ...D....I. [356] #FL52 APEKPTLDFK VTKMEATELA TVREYCYKAT LDTLSTVARC PTTGEAHNTR [406] #TBH-28 .......... .M........ ...K...E.. .......... .........K [406] #FL72 .......... .M........ .......E.. .......... .........K [406] #FL85a .......... .M........ .......E.. .......... .........K [406] #FL85b .......... .M........ .......E.. .......... .........K [406] #FL89 .......... .M........ .......E.. .......... .........K [406] #FL90a .......... .M........ .......E.. .......... .........K [406] #FL90b .......... .M........ .......E.. .......... .........K [406] #FL90c .......... .M........ .......E.. .......... .........K [406] #FL90d .......... .M........ .......?.. .......... .?.......K [406] #FLS569 .......... .M........ .......E.. .......... .........K [406] #FLS650 .......... .M........ .......E.. .......... .........K [406] #TR58 .......... .M........ .......E.. .......... .........K [406] #TR62 .......... .M........ .......?.. .......... .........K [406] #BR64 .......... .M........ .......E.. .......... .........K [406] #BR69 .......... .M........ .......... .......... .........K [406] #Kern217 .......... .M........ .......E.. .......... .........K [406] #WNNY99 SKD...I.V. MMN...AN.. E..S...L.. VSD...K.A. ..M.....DK [406] #WNEgypt SKD...I.V. MMN...AN.. E..S...L.. VSD...K.A. ..M.....DK [406]

PAGE 608

583 APPENDIX N: (CONTINUED) #FL52 RSDPTFVCKR DVVDRGWGNG CGLFGKGSID TCAKFTCKNK ATGKTILREN [456] #TBH-28 .......... .......... .......... .......... .......... [456] #FL72 .......... .......... .......... .....I.... .......... [456] #FL85a .......... .......... .......... .......... .......... [456] #FL85b .......... .......... .......... .......... .......... [456] #FL89 .......... .......... .......... .......... .......... [456] #FL90a .......... .......... .......... .......... .......... [456] #FL90b .......... .......... .......... .......... .......... [456] #FL90c .......... .......... .......... .......... .......... [456] #FL90d .......... .......... .......... .......... .......... [456] #FLS569 .......... .......... .......... .......... .......... [456] #FLS650 .......... .......... .......... .......... .......... [456] #TR58 .......... .......... .......... .......... .......... [456] #TR62 .....?.... .......... .......... .......... .......... [456] #BR64 .......... .......... .......... .......... .......... [456] #BR69 .......... .......... .......... ........S. .......... [456] #Kern217 .......... .......... .......... .......... .......... [456] #WNNY99 .A..A...RQ G......... .......... .....A.ST. .I.R...K.. [456] #WNEgypt .A..A....Q G......... .......... .....A.ST. ...R...K.. [456] #FL52 IKYEVAISVH GSTDSTSHGN YFEQIGKNQA ARFTISPQAP SFTANMGEYG [506] #TBH-28 .......F.. .......... .S........ .......... .......... [506] #FL72 .......F.. .......... .......... .......... .......... [506] #FL85a .......F.. .......... .S........ .......... .......... [506] #FL85b .......F.. .......... .......... .......... .......... [506] #FL89 .......F.. .......... .?........ .......... .......... [506] #FL90a .......F.. .......... .S........ .......... .......... [506] #FL90b .......F.. .......... .S........ .......... .......... [506] #FL90c .......F.. .......... .S........ .......... ..M....... [506] #FL90d .......F.. .......... .S........ .......... .......... [506] #FLS569 .......F.. .......... .S........ .......... .......... [506] #FLS650 .......F.. .......... .S........ .......... .......... [506] #TR58 .......F.. .......... .......... .......... .......... [506] #TR62 .......F.. .?.?..T... .S........ .......... .......... [506] #BR64 .......F.. ......T... .S........ .......... .......... [506] #BR69 .......F.. ......T... .?........ .......... .......... [506] #Kern217 .......F.. .......... .S........ .......... .......... [506] #WNNY99 .......F.. .P.TVE.... .ST.V.AT.. G.LS.T.A.. .Y.LKL.... [506] #WNEgypt .......F.. .P.TVE.... .PT...AT.. G..S.T.A.. .Y.LKL.... [506]

PAGE 609

584 APPENDIX N: (CONTINUED) #FL52 TVTIDCEARS GINTEDYYVF TVKEKSWLVN RDWFHDLNLP WTSPATTDWR [556] #TBH-28 .......... .......... .......... .......... .......... [556] #FL72 .......... ..?..T.... .......... .......... .......... [556] #FL85a .......... .......... .......... .......... .......... [556] #FL85b .......... .......... .......... .......... .......... [556] #FL89 .......... .......... .......... .......... .......... [556] #FL90a .......... .......... .......... .......... .......... [556] #FL90b .......... .......... .......... .......... .......... [556] #FL90c .......... .......... .......... .......... .......... [556] #FL90d .......... .......... .........? .......... .......... [556] #FLS569 .......... .......... .......... .......... .......... [556] #FLS650 .......... .......... .......... .......... .......... [556] #TR58 .......... .......... .......... ......?... .......... [556] #TR62 .......... .......... .......... .......... .......... [556] #BR64 .......... .......... .......... .......... .......... [556] #BR69 .......... .......... .........K *G........ .......... [556] #Kern217 .......... .......... .......... .......... .......... [556] #WNNY99 E..V...P.. ..D.NA...M ..GT.TF..H .E..M..... .S.AGS.V.. [556] #WNEgypt E..V...P.. ..D.NA...M ..GT.TF..H .E..M..... .S.AGS.V.. [556] #FL52 NRETLVEFEE PHATKQTVVA LGSQEGALHT ALAGAIPATV SSSTLTLQSG [606] #TBH-28 .......... .......... .......... .......... .......... [606] #FL72 .......... .......... .......... .......... ..?....... [606] #FL85a .......... .......... .......... .......... .......... [606] #FL85b .......... .......... .......... .......... .......... [606] #FL89 .......... .......... .......... .......... .......... [606] #FL90a .......... .......... .......... .......... .......... [606] #FL90b .......... .......... .......... .......... .......... [606] #FL90c .......... .......... .......... .......... .......... [606] #FL90d .......... .......... .......... .......... .......... [606] #FLS569 .......... .......... .......... .......... .......... [606] #FLS650 ....?..... .......... .......... .......... .......... [606] #TR58 ....?..... .......... ?.?....?.. .......... .......... [606] #TR62 .......... .......... .......... ......?... ......?... [606] #BR64 .......... .......... .......... .......... .......... [606] #BR69 .......... .......... .......... ..?...?... ......W... [606] #Kern217 .......... .......... .......... .......... .......... [606] #WNNY99 .....M.... ......S.I. .........Q .......VEF ..N.VK.T.. [606] #WNEgypt .....M.... ......S.I. .........Q .......VEF ..N.VK.T.. [606]

PAGE 610

585 APPENDIX N: (CONTINUED) #FL52 YLKCRAKLDK VKIKGTTYGM CDSAFTFSKN PTDTGHGTVI VELQYTGSNG [656] #TBH-28 H......... .......... .......... .......... .......... [656] #FL72 H......... ...?...... .......... .A........ .......... [656] #FL85a H......... .......... .......... .......... .......... [656] #FL85b H......... .......... .......... .......... .......... [656] #FL89 H......... .......... .......... .......... .......... [656] #FL90a H......... .......... .......... .......... .......... [656] #FL90b H......... .......... .......... .......... .......... [656] #FL90c H......... .......... .......... .......... .......... [656] #FL90d H?........ .......... .......... .......... .......... [656] #FLS569 H......... .......... .......... .A........ .......... [656] #FLS650 H......... ...?...... .......... .A........ .......... [656] #TR58 H......... .......... .......... .A........ .......... [656] #TR62 H.....?... .......... .......... .A........ .......... [656] #BR64 H......... .......... .......... .A........ .......... [656] #BR69 H.....R... F......... .......... .A........ .......... [656] #Kern217 H......... .......... .......... .......... .......... [656] #WNNY99 H....V.ME. LQL......V .SK..K.LGT .A.......V L......TD. [656] #WNEgypt H....V.ME. LQL......V .SK..K.LGT .A.......V L......TD. [656] #FL52 PCRVPISVTA NLMDLTPVGR LVTVNPLIST GGANNKVMIE VEPPFGDSYI [706] #TBH-28 .......... .......... ......F... .......... .......... [706] #FL72 .......... .......... ......F... .......... .......... [706] #FL85a .......... .......... ......F... .......... .......... [706] #FL85b .......... .......... ......F... .......... .......... [706] #FL89 .......... .......... ......F... .......... .......... [706] #FL90a .......... .......... ......F... .......... .......... [706] #FL90b .......... .......... ......F... .......... .......... [706] #FL90c .......... .......... ......F... .......... .......... [706] #FL90d .......... .......... ......F... .......... .......... [706] #FLS569 .......... .......... ......F... .......... .......... [706] #FLS650 .......... .......... ......F... .......... .......... [706] #TR58 .......... .......... ......F... .......... .......... [706] #TR62 .......... .......... ......F... .......... .......... [706] #BR64 .......... .......... ......F... .......... .......... [706] #BR69 .......... .......... ......F... .......... .......... [706] #Kern217 .......... .......... ......F... .......... .......... [706] #WNNY99 ..K....SV. S.N....... ......FV.V AT..A..L.. L......... [706] #WNEgypt ..K....SV. S.N....... ......FV.V AT..A..L.. L......... [706]

PAGE 611

586 APPENDIX N: (CONTINUED) #FL52 VVGRGTAQIN YHWHKGGSSI GKALATTWKG AQRLAVLGDT AWDFGSVGGV [756] #TBH-28 ......T... .....E.... .......... .......... ......I... [756] #FL72 ......T... .....E.... .......... .......... ......I... [756] #FL85a ......T... .....E.... .......... .......... ......I... [756] #FL85b ......T... .....E.... .......... .......... ......I... [756] #FL89 ......T... .....E.... .......... .......... ......I... [756] #FL90a ......T... .....E.... .......... .......... ......I... [756] #FL90b ......T... .....E.... .......... .......... ......I... [756] #FL90c ......T... .....E.... .......... .......... ......I... [756] #FL90d ......T... .....E.... .......... .......... ......I... [756] #FLS569 ......T... .....E.... .......... .......... ......I... [756] #FLS650 ......T... .....E.... .......... .......... ......I... [756] #TR58 ......T... .....E.... .......... .......... ......I... [756] #TR62 ......T... .....E.... .......... .......... ......I... [756] #BR64 ......T... .....E.... .......... .......... ......I... [756] #BR69 ......T... .....E.... .......... .......... ......I... [756] #Kern217 ......T... .....E.... .......... .......... ......I... [756] #WNNY99 .....EQ... H....S.... ...FT..L.. .....A.... .......... [756] #WNEgypt .....EQ... H....S.... ...FT..L.. .....A.... .......... [756] #FL52 FNSIGKAVHQ VFGGAFRTLF GGMSWITQGL LGALLLWMGL QAHDRSISLT [806] #TBH-28 .......... .?........ .......... .......... ..R....... [806] #FL72 .......... .......... .......... .......... ..R....... [806] #FL85a .......... .......... .......... .......... ..R....... [806] #FL85b .......... .......... .......... .......... ..R....... [806] #FL89 .......... .......... .......... .......... ..R....... [806] #FL90a .......... .......... .......... .......... ..R....... [806] #FL90b .......... .......... .......... .......... ..R....... [806] #FL90c .......... .......... .......... .......... ..R....... [806] #FL90d .......... .......... .......... .......... ..R....... [806] #FLS569 .......... .......... .......... .......... ..R....... [806] #FLS650 .......... .......... .......... .......... ..R....... [806] #TR58 .......... .......... .......... .......... ..R....... [806] #TR62 .......... .......... .......... .......... ..R....... [806] #BR64 .......... .......... .......... .......... ..R....... [806] #BR69 .......... ?......... .......... .......... ..R....... [806] #Kern217 .......... .......... .......... .......... ..R....... [806] #WNNY99 .T.V...... .......S.. .......... .........I N.R....A.. [806] #WNEgypt .T.V...... .......S.. .......... .........I N.R....A.. [806]

PAGE 612

587 APPENDIX N: (CONTINUED) #FL52 LLAIGGILIF LATSVQADSG CAIDLQRREL KCGGGIFVYN DVEK [850] #TBH-28 ...V...... .......... .......... .......... .... [850] #FL72 ...V...... .......... .......... .......... .... [850] #FL85a ...V...... .......... .......... .......... .... [850] #FL85b ...V...... .......... .......... .......... .... [850] #FL89 ...V...... .......... .......... .......... .... [850] #FL90a ...V...... .......... .......... .......... .... [850] #FL90b ...V...... .......... ......?... .......... ..-[850] #FL90c ...V...... .......... .......... .......... .... [850] #FL90d ...V...... .......... .......... .......... ...[850] #FLS569 ...V...... .......... .......... .......... .... [850] #FLS650 ...V...... .......... .......... .......... .... [850] #TR58 ...V...... .......... .......... .......... ..?[850] #TR62 ...V...... .......... .......... .......... ...N [850] #BR64 ...V...... .......... .......... .......... .... [850] #BR69 ...V...... .......... .......... .......... .... [850] #Kern217 ...V...... .......... .......... .......... .... [850] #WNNY99 F..V..V.L. .SVN.H..T. ....IS.Q.. R..S.V.IH. ...A [850] #WNEgypt F..V..V.L. .SVN.H..T. ....IS.Q.. R..S.V.IH. ...A [850]

PAGE 613

588 APPENDIX O Multiple Sequence Alignment: SLEV Membrane/Envelope St. Louis Encephalitis Virus Strains Membrane/Envelope Region: SLEC Primer Set Nucleotide Alignment #MEGA !Title SLEC ClustalW 1.6; !Format DataType=Nucleotide CodeTable=Standard NSeqs=13 NSites=356 Identical=. Missing=? Indel=-; !Domain=Data property=Coding CodonStart=1; #FL52 TAG CCG ACG GTC AAT CTC TGT GCA GCA TCA TGG AGA TTC CAC ACT GGC [776] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [776] #FL72 ... ... ... ... ... ... ... ... ... ... C.. ... YYM ... ... ... [776] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... YYM ... ... ... [776] #FLS569 ... T.. G.. ... ... T.. ... ... ... ... C.. ... C.. ... ... ... [776] #FLS649 ----. ... ... ... ... ... ... ... .T. .T. G.. ... ... .A. ... [776] #FLS650 .T. ... ... ... ... ... ... ... ... ... C.. ... C.. ... ... ... [776] #FLS694 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [776] #TR62 ... ... ... ... ... ... ... ... ... ... ... ... C.. ... ... ... [776] #BR69 ... ... ... ... ... ... ... ... ... ... C.. ... C.. ... ... ... [776] #Kern217 ... ... ... ... ... T.. ... ... ... C.. ... ... ... ... ... ... [776] #WNNY99 C.. T.. GA. ... .C. GA. A.. ... .AC A.. C.. ... AAG ... T.. A.. [776] #WNEgypt ... ... GA. ... .C. GA. A.. ... .AC A.. ... ... AAG ... T.. A.. [776] #FL52 AAC AAA GAA CAC GCC ATG GTT GGA CAC CGT GAA AAC CAC CAA ATA CTT [824] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [824] #FL72 ... ... ... ... ... ... .C. A.. ... ... ... ... ... T.. G.. ... [824] #FL85a ... ... ... ... ... ... .C. ... ... ... ... ... ... ... ... ... [824] #FLS569 ... ... ... ... ... ... .C. ... ... ... A.. ... ... ... G.. ... [824] #FLS649 ... ... ... ..A ... ... ... ... ... ... ... ... ... ... ... ... [824] #FLS650 ... ... ... ... ... ... .C. ... ... ... A.. ... ... ... G.. ... [824] #FLS694 ... ... ... ... ... ... ... ... ... ... ... ... ... ... G.. ... [824] #TR62 ... ... ... ... ... ... .C. A.. ... T.. ... ... ... T.. G.. ... [824] #BR69 ... ... ... ... ... ... .C. ... ... ... ... ... ... ... G.. ... [824] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [824] #WNNY99 G.A C.. ... GGG .G. T.. .A. ... ..G .AC C.. GG. ... A.G G.. T.. [824] #WNEgypt G.A C.. ... GGG .G. T.. .A. ... ..G .AC C.. GG. T.. A.G G.. T.. [824] #FL52 GAC AAA AGT CGA AAA CTG GGT TTT GCG CAA TCC TGG ATA TGC CCT AGT [872] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [872] #FL72 ... ... ... ... ... ... ... .C. ... ... ... C.. ... ... ... ... [872] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... C.. ... ... [872] #FLS569 ... ... ... T.. ... ... ... CC. ... ... ... ... ... ... ... ... [872] #FLS649 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [872] #FLS650 ... ... ... T.. ... ... ... CC. ... ... ... ... ... ... ... ... [872] #FLS694 ... ... ... T.. ... ... ... .C. ... ... ... ... ... ... ... ... [872] #TR62 ... ... ... ... ... ... ... .C. ... ... ... C.. ... ... ... ... [872] #BR69 ... ... ... ... ... ... ... .C. ... ... ... C.. ... ... ... ... [872] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [872] #WNNY99 .GT ... .AC A.. .TC A.. .A. C.. .A. G.. C.. ... ... ... ... G.. [872] #WNEgypt .GT ... .AC A.. .TC A.. .A. C.. .A. G.. C.. C.. ... ... ... G.. [872]

PAGE 614

589 APPENDIX O: (CONTINUED) #FL52 TGC GCT GGC GAT TGG ATG GAT GCT AGG TAG CAA CAA CAC ACA GAG AGT [920] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [920] #FL72 ... ... ... ... ... ... ... ... G.. C.. ... ... ... ... ... ... [920] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [920] #FLS569 ... A.. ... ... ... ... ... ... ... C.. ... ... ... ... ... ... [920] #FLS649 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [920] #FLS650 ... A.. ... ... ... ... ... ... ... C.. ... ... ... ... ... ... [920] #FLS694 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [920] #TR62 ... ... ... ... ... ... ... ... ... C.. T.. ... ... ... ... ... [920] #BR69 ... ... ... ... ... ... ... ... ... C.. ... ... ... ... ... ... [920] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [920] #WNNY99 G.. AGC C.T C.. ... T.. ... ... T.. G.. ... ..C ..T G.. ... ... [920] #WNEgypt G.. AGC C.T C.. ... T.. ... ... T.. A.. ... ..C ..T G.. .C. ... [920] #FL52 GGT CTT TGT GAT CAT GCT GAT GCT GAT TGC TCC GGC ATA CAG CTT CAA [968] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [968] #FL72 ... ... ... ... ... ... ... .T. ... ... C.. A.. ... ... ... T.. [968] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [968] #FLS569 ... ... ... ... ... ... ... .T. ... ... C.. ... ... ... ... ... [968] #FLS649 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [968] #FLS650 ... ... ... ... ... ... ... .T. ... ... C.. ... ... ... ... ... [968] #FLS694 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [968] #TR62 ... ... ... ... ... ... ... .T. ... ... C.. ... ... ... ... T.. [968] #BR69 ... ... ... ... ... ... ... .T. ... ... C.. ... ... ... ... T.. [968] #Kern217 ... T.. ... ... ... ... ... ... ... ... ... ... ... ... ... ... [968] #WNNY99 T.. G.. ... CG. GC. AT. .C. TT. .G. G.. C.. A.. T.. ... ... ... [968] #WNEgypt T.. G.. C.. TG. GC. A.. .C. CT. .G. G.. ... A.. C.. ... ... T.. [968] #FL52 CTG TTT GGG AAC ATC AAA CAG GGA CTT TGT CGA GGG AAC CAG CGG GGC [1016] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [1016] #FL72 T.. .C. ... ... ... ... ... ... ... C.. ... A.. GG. ... ... ... [1016] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [1016] #FLS569 T.. ... ... ... ... ... ... ... T.. C.. T.. A.. GG. ... ... ... [1016] #FLS649 ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [1016] #FLS650 T.. ... ... ... ... ... ... ... T.. Y.. T.. A.. GG. ... ... ... [1016] #FLS694 T.. ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... [1016] #TR62 T.. .C. ... ... ... ... ... ... ... C.. ... A.. GG. ... ... ... [1016] #BR69 T.. .C. A.. ... ... ... ... ... ... C.. ... A.. GG. ... ... ... [1016] #Kern217 ... .C. ... ... ... ... ... ... ... ... ... ... .G. ... T.. ... [1016] #WNNY99 ... CC. T.. ..T GAG C.. ... A.. ... CT. G.. A.. .GT GTC T.. A.. [1016] #WNEgypt ... CC. T.. ..T GAG C.. ... A.. ... CT. A.. ... .GT GTC T.. A.. [1016]

PAGE 615

590 APPENDIX O: (CONTINUED) #FL52 AAC ATG GAT TGA CTT GGT ACT TGA AGG GGG AAG CTG TGT TAC AGT GAT [1064] #TBH-28 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1064] #FL72 ... ... ... ... ... ... ... ... ... A.. ... ... ... C.. ... ... [1064] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1064] #FLS569 ... ... ... C.. ... ... ... ... ... A.. ... ... ... C.. ... ... [1064] #FLS649 ... ... ... ... ... ... ... ... ... ... ... G.. ... ... .---[1064] #FLS650 ... ... ... C.. ... ... ... ... ... A.. ... ... ... C.. ... ... [1064] #FLS694 ... ... ... ... ... ... ... ... ... ... ... ... ... Y.. ... ... [1064] #TR62 ... ... ... ... ... ... ... ... ... A.. ... ... ... C.. ... A.. [1064] #BR69 ... ... ... ... ... ... ... ... ... A.. ... ... ... C.. ... ... [1064] #Kern217 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [1064] #WNNY99 ... ... .G. G.. T.. ... T.. C.. ... C.A C.. ... C.. G.. TA. C.. [1064] #WNEgypt ... ... .G. G.. T.. ... T.. C.. ... C.A C.. ... ... G.. CA. C.. [1064] #FL52 GGC ACC AGA GAA ACC AAC AC [1112] #TBH-28 ... ... ... ... ... ... .. [1112] #FL72 ... ... ... ... ... ... .T [1112] #FL85a ... ... ... ... ... ... .. [1112] #FLS569 ... ... ... ... ... ... .T [1112] #FLS649 -------------[1112] #FLS650 ... ... ... ... ... ... .. [1112] #FLS694 ... ... ... ... ... ... .[1112] #TR62 ... ... ... ... ... ... .T [1112] #BR69 ... ... ... ... ... ... -[1112] #Kern217 ... ... ... ... ... ... .. [1112] #WNNY99 .T. TAA G.. C.. G.. T.. CA [1112] #WNEgypt .T. TAA G.. C.. G.. T.. CA [1112]

PAGE 616

591 APPENDIX O: (CONTINUED) St. Louis Encephalitis Virus Strains Membrane/Envelope Region: SLEC Primer Set Amino Acid Alignment #MEGA !Title Translated SLEC ClustalW 1.6; !Format DataType=Protein NSeqs=13 NSites=118 Identical=. Missing=? Indel=-; !Domain=Data; #FL52 *PTVNLCAAS WRFHTGNKEH AMVGHRENHQ ILDKSRKLGF AQSWICPSCA [293] #TBH-28 .......... .......... .......... .......... .......... [293] #FL72 .......... R.?....... ..AR.....* V........S ...R...... [293] #FL85a .......... ..?....... ..A....... .......... .....R.... [293] #FLS569 .SA..F.... R.L....... ..A...K... V....*...P .........T [293] #FLS649 --.......L LG..N....Q .......... .......... .......... [293] #FLS650 L......... R.L....... ..A...K... V....*...P .........T [293] #FLS694 .......... .......... .......... V....*...S .......... [293] #TR62 .......... ..L....... ..AR.C...* V........S ...R...... [293] #BR69 .......... R.L....... ..A....... V........S ...R...... [293] #Kern217 .....F...P .......... .......... .......... .......... [293] #WNNY99 QSE.TDS.DT R.K.SSEQ.G GLD.QHQG.K VFG.N.IMDL EEP....GGS [293] #WNEgypt ..E.TDS.DT ..K.SSEQ.G GLD.QHQGYK VFG.N.IMDL EEPR...GGS [293] #FL52 GDWMDAR*QQ HTESGLCDHA DADCSGIQLQ LFGNIKQGLC RGNQRGNMD* [343] #TBH-28 .......... .......... .......... .......... ..S....... [343] #FL72 ......GQ.. .......... .V..PS...* .S.......R .RG....... [343] #FL85a .......... .......... .......... .......... ..S....... [343] #FLS569 .......Q.. .......... .V..P..... ........FR *RG......R [343] #FLS649 .......... .......... .......... .......... ..S....... [343] #FLS650 .......Q.. .......... .V..P..... ........F? *RG......R [343] #FLS694 .......... .......... .......... .......... ..S....... [343] #TR62 .......Q*. .......... .V..P....* .S.......R .RG....... [343] #BR69 .......Q.. .......... .V..P....* .SR......R .RG....... [343] #Kern217 .......... .....F.... .......... .S........ ..S.W..... [343] #WNNY99 RH.L..WE.H .A..CV.RAI AFGGPSL... .PW.EQ.R.L GRSVWS..GG [343] #WNEgypt RH.L..WK.H .AA.CVRCAT ALGG.SL..* .PW.EQ.R.L ..SVWS..GG [343]

PAGE 617

592 APPENDIX O: (CONTINUED) #FL52 LGT*RGKLCY SDGTRETN [361] #TBH-28 .......... ........ [361] #FL72 .....R...H ........ [361] #FL85a .......... ........ [361] #FLS569 .....R...H ........ [361] #FLS649 .......V.. -------[361] #FLS650 .....R...H ........ [361] #FLS694 .........? ........ [361] #TR62 .....R...H .N...... [361] #BR69 .....R...H ........ [361] #Kern217 .......... ........ [361] #WNNY99 F.SR.RQ.RD YHV*GQAY [361] #WNEgypt F.SR.RQ..D HHV*GQAY [361]

PAGE 618

593 APPENDIX P Multiple Sequence Alignment: Flavivirus NS5 Region West Nile Virus Strains NS5 Region: Fu1/cfd3 Primer Set Nucleotide Alignment #MEGA !Title NS5 ClustalW 1.6 WN; !Format DataType=Nucleotide CodeTable=Standard NSeqs=15 NSites=1006 Identical=. Missing=? Indel=-; !Domain=Data property=Coding CodonStart=1; #FLM38 -----CA AGG GAA GCA GAG CCA TTT GGT TCA TGT GGC TCG GAG CTC [9130] #FLS502 -----.. ... ... ... ... ... ... ... ... ... ... ... ... ... [9130] #FLS504 -----.. ... ... ... ... ... ... ... ... ... ... ... ... ... [9130] #FLS545 GAA AGG C.. ... ... ... ... ... ... ... ... ... ... ... ... ... [9130] #FLWN01a GAA AGG C.. ... ... ... ..A ... ... ... ... ... ... ... ... ... [9130] #FLWN01b --------------------------------[9130] #FLWN02a -----.. ... ... ... ... ... ... ... ... ... ... ... ... ... [9130] #FLWN02b -----.. ... ... ... ... ... ... ... ... ... ... ... ... ... [9130] #FLWN05a -AA AGG C.. ... ... ... ... ... ... ... ... ... ... ... ... ... [9130] #FLWN05b -AA AGG C.. ... ... ... ... ... ... ... ... ... ... ... ... ... [9130] #WNNY99 GAA AGG C.. ... ... ... ... ... ... ... ... ... ... ... ... ... [9130] #WNEgypt GAA AGG CT. ... ... ... ... ... .A. ... ... ... ... ... ... ... [9130] #Kunjin GGA AAG C.. ... ... ... .G. ... .C. ... .T. ... ... .G. ... ... [9130] #JE GAA AAG C.. ... ... ... .G. ... ... ... ... ... ... .T. ... .A. [9130] #MVE GAA AGG C.. ... ... ... ... ... .C. ... ... ... ... .G. ... .CA [9130] #FLM38 GCT TTC TGG AGT TCG AGG CTC TGG GTT TTC TCA ATG AAG ACC ACT GGC [9178] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9178] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9178] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9178] #FLWN01a ... ... ... ... ... ... ... G.. ... ... ... ... ... ... ... ... [9178] #FLWN01b ----------------. ... ... ..T C.C ... ... ... ... [9178] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9178] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9178] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9178] #FLWN05b ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9178] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9178] #WNEgypt ... ... ... ... ... .A. ... ... .C. ... .T. .C. ... ... ... ... [9178] #Kunjin ... .C. .A. ... .T. ... ... ... .C. ... .T. ... .G. ... ... ... [9178] #JE .G. A.. .A. ... .T. .A. ..T ... .G. .C. .G. ... ... ... .T. ... [9178] #MVE .A. .CT ... ... .T. .A. ... .A. .A. .C. ... ... ... ... .T. ..A [9178] #FLM38 TTG GAA GAA AGA ACT CAG GAG GAG GTG TCG AGG GCT TGG GCC TCC AAA [9226] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #FLWN01b .A. T.. ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9226] #WNEgypt ... ... ... ... ... ... ... .C. .G. ... ... ... ... ... ... ... [9226] #Kunjin ... ... ... ... ... .G. .G. .C. .G. ... ... .TC ... ... ... .G. [9226] #JE .GA .CC ..G ... .T. ... ... .T. .A. .G. .A. ... C.. ..G ... ... [9226] #MVE .GA .T. ..G ... .T. ... ... ... .A. .T. .A. .AG CT. .TA .T. .G. [9226]

PAGE 619

594 APPENDIX P: (CONTINUED) #FLM38 AAC TGG GTT ACA TCC TGC GTG AAG TTG GCA CCC GGC CTG GGG GCA AGA [9274] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... .C. ... ... ... [9274] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9274] #WNEgypt ... ... ... .T. .T. ... ... ... ... ... ... .A. ... .A. ... ... [9274] #Kunjin ..T .A. .C. ... ... ... ... ... ... ... ... .A. .C. .A. ... GA. [9274] #JE .G. .A. .A. ... ... .C. ... .CA .A. CAG GAA A.. AA. .A. .G. .A. [9274] #MVE .G. ... .A. ... ..T ..A .A. .T. .G. CTC AAA A.. ... .A. .G. .A. [9274] #FLM38 TCT ATG CTG ATG ACA CAG CTG GCT GGG ACA CCC GCA TCA CGA GAG CTG [9322] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #FLWN01b .T. ... ... ... ... ... ... .G. ... ... ... ... ... ... ... ... [9322] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9322] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... .T. ... ... ... [9322] #Kunjin ... .C. ... ... ... ... .C. .T. ... ... ... ... ... .A. ... ... [9322] #JE .G. .C. ... ... .T. .C. .C. .G. ... ... .TA .A. .T. .C. ..A ... [9322] #MVE .T. ... .C. ... ... ... ... .T. ... ... ... ... ... .AC A.. ... [9322] #FLM38 ACT TGG AAA ATG AAG CTA AGG TGC TTG AGT TGC TTG ATG GGG AAC ATC [9370] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9370] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9370] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9370] #FLWN01a ... ... ... ... ... ... ... ... ... ..C ... ... ... ... ... ... [9370] #FLWN01b ... ... ... ... .G. ... ... ... ... ..C ... ... ... ... ... ... [9370] #FLWN02a ... ... ... ... ... ... ... ... ... ..C ... ... ... ... ... ... [9370] #FLWN02b ... ... ... ... ... ... ... ... ... ..C ... ... ... ... ... ... [9370] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... .G. ... [9370] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9370] #WNNY99 ... ... ... ... ... ... ... ... ... ..C ... ... ... ... ... ... [9370] #WNEgypt ..C ... ... ... ... ... ... .T. ... ... ... .G. ... ... ... ... [9370] #Kunjin ..C ... .G. ... ... .C. ... .T. ... ... ..T .G. .C. ... .G. .C. [9370] #JE ... .A. ... ... ... ... ... ... .G. ..C .C. .A. .C. .T. ... .C. [9370] #MVE ..C .T. .G. .C. ... ... .A. .T. .G. ... ..A .G. .A. .T. .G. .G. [9370] #FLM38 GGC GTC TTG CCA GGG CCA TCA TTG AGC TCA CCT ATC GTC ACA AAG TTG [9418] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9418] #WNEgypt ... ... ... .T. ... ... ... ... ... ... ... ... ... ... ... ... [9418] #Kunjin ... .C. .G. ... ... ... ... ... ... ... ... ... .C. ... ... .A. [9418] #JE .CA TG. .C. ..C .A. ... .A. ... .A. .G. .T. .CA .G. ... ... .G. [9418] #MVE ..A C.T .G. .A. .A. .A. ... ... ... .G. .A. .CA .G. ... ... .G. [9418]

PAGE 620

595 APPENDIX P: (CONTINUED) #FLM38 TGA AAG TGA TGC GCC CGG CTG CTG ATG GAA GAA CCG TCA TGG ATG TTA [9466] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #FLWN05a .A. ... ... ... ... ... ... ... ... ... ... ... .T. ... ... ... [9466] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9466] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .C. [9466] #Kunjin ... .G. .A. ... ... ... ... ... ... ... ... ... ... ... .C. .C. [9466] #JE .C. .G. .C. ..A .A. .T. .A. .A. .A. ... AG. ... .G. ... .C. .G. [9466] #MVE .C. .G. .C. ... ... ... .A. ... GA. ... AG. .T. .G. ... ... .C. [9466] #FLM38 TCT CCA GAG AAG ATC AGA GGG GGA GTG GAC AAG TTG TCA CCT ACG CCC [9514] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #FLWN05a .T. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9514] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .T. [9514] #Kunjin ... ... .G. ... .C. ... .A. .A. ... .G. ... ... ... ... ... .T. [9514] #JE .A. .A. ... ... ... .A. ... ... ... ... .G. .G. ... .T. .T. .T. [9514] #MVE .T. .AC .C. ... ... .A. .A. .A. ... ... ... .A. .G. ... .T. .TT [9514] #FLM38 TAA ACA CTT TCA CCA ACC TGG CCG TCC AGC TGG TGA GGA TGA TGG AAG [9562] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9562] #WNEgypt ... ... .C. ... ... ... ... ... ... ..T ... ... ... ... ... ... [9562] #Kunjin ... ... .C. .T. ... ... ... .T. ... .AT ... ... .A. ... ... ... [9562] #JE .T. ... ... ... .G. ..A .T. .T. ... ... .C. .C. ..C ... ... .G. [9562] #MVE ... ... .A. ... ... ..A .C. .T. .G. .AT ... .T. .AC .C. ... ... [9562] #FLM38 GGG AAG GAG TGA TTG GCC CAG ATG ATG TGG AGA AAC TCA CAA AAG GGA [9610] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9610] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... .G. .A. [9610] #Kunjin .A. .G. .T. ... .C. ... ... ... ... ... ... ... ... ... .G. ... [9610] #JE CT. .G. .G. .C. ... .A. ..C .GC .CT ... .AC .G. .AC .C. G.A AA. [9610] #MVE CC. ... CG. .C. .A. .T. ... ... .CA .T. .A. GCA .TG A.. GGA AA. [9610]

PAGE 621

596 APPENDIX P: (CONTINUED) #FLM38 AAG GAC CCA AAG TCA GGA CCT GGC TGT TTG AGA ATG GGG AAG AAA GAC [9658] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9658] #WNEgypt ... ... .T. ... ... ... ... ... ... ... ... ... ... .G. ... ... [9658] #Kunjin ... .G. ... .G. .T. .A. ... ... ... C.. ... ... ... .G. ... ... [9658] #JE .CA AGA TAG CT. ... ... ... ... .C. ... ... ... .A. .G. .G. ..G [9658] #MVE .GA A.T TTG C.. ..C .C. .A. ... .T. ... ... .C. CA. ... ... ..G [9658] #FLM38 TCA GCC GCA TGG CTG TCA GTG GAG ATG -AC TGT GTG GTA AAG CCC CTG [9706] #FLS502 ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... ... [9706] #FLS504 ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... ... [9706] #FLS545 ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... ... [9706] #FLWN01a ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... ... [9706] #FLWN01b ... ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... [9706] #FLWN02a ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... ... [9706] #FLWN02b ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... ... [9706] #FLWN05a .T. ... ... ... ... ... ... ... ... -.. ... ... ... ... ... ... [9706] #FLWN05b ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... T.. [9706] #WNNY99 ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... ... [9706] #WNEgypt ... ... ... ... ... ... .C. ... ... -.. ... ... ... ... ... ..A [9706] #Kunjin ... ... ... ... ... ... ... ... ... -.. ... ... ... ... ... T.. [9706] #JE .G. C.A .G. ... .GA ... .C. ... .C. -.. ... ..C ..C ... ..G ... [9706] #MVE .GC AG. ... ... ... .T. ... .T. ... -.. ... ..T ..C ..A ..A T.. [9706] #FLM38 GAC GAT CGC TTT GCC ACC TCG CTC CAC TTC CTC AAT GCT ATG TCA AAG [9754] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9754] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9754] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9754] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9754] #FLWN01b C.. ... ... ... ... ... ... ... ... ... ... ... ..C ... ... ... [9754] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9754] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ..C ... ... ... [9754] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9754] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9754] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9754] #WNEgypt ..T ..C ... ..C ... ... ..T ... ... ... ... ..C ..C ... ... ... [9754] #Kunjin ..T ... ... ... ... ... ..T ... ... ..T ... ..C ..C ... ... ... [9754] #JE ..T ..C A.A ..C ... ..G G.C ... ... ... ... ..C ..A ... ... ... [9754] #MVE ..T ... A.A ... T.. ..T G.T T.G ..T ... T.G ..C ..C ... ... ... [9754] #FLM38 GTT CGC AAA GAC ATC CAA GAG TGG AAA CCG TCA ACT GGA TGG TAT GAT [9802] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9802] #WNEgypt ... ... ... ..T ... ..G ... ... ... ... ... ... ... ... ... ..C [9802] #Kunjin ..G ... ..G ... ... ... ... ... ... ..A ... ..C ... ... ... ... [9802] #JE ..C A.A ... ... ... ... ..A ... ..G ..T ..G CA. ..C ... C.C ..C [9802] #MVE ..G A.A ... ... ... ..G ... ... ... ..C ... CAA ..C ... ... ..C [9802]

PAGE 622

597 APPENDIX P: (CONTINUED) #FLM38 TGG CAG CAG GTT CCA TTT TGC TCA AAC CAT TTC ACT GAA TTG ATC ATG [9850] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9850] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9850] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9850] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9850] #FLWN01b ... ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... [9850] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9850] #FLWN02b ... ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... [9850] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9850] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9850] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9850] #WNEgypt ... ... ... ... ... ..C ... ..G ... ... ... ... ... ..A ... ... [9850] #Kunjin ... ... ..A ... ... ..C ..T ... ... ..C ... ... ... C.. ... ... [9850] #JE ... ... ..A ... ..C ..C ... ..T ... ... ..T CAG ..G A.T G.G ... [9850] #MVE ... ..A ..A ..C ..C ..C ..T ..G ..T ... ... CAG ... G.C ... ... [9850] #FLM38 AAA GAT GGA AGA ACA CTG GTG GTT CCA TGC CGA GGA CAG GAT GAA TTG [9898] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9898] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ..C ... C.. [9898] #Kunjin ... ... ... ... ... ... ... AC. ... ... ... ..G ... ... ..G ..A [9898] #JE ... ... ... ..G .GT A.A ..C ..C ..G ..T A.. ... ... ... ..G ... [9898] #MVE ... ... ..G ..G ..C T.. ... ..G ..C ... A.. ... ... ..C ..G C.. [9898] #FLM38 GTA GGC AGA GCT CGT ATA TCT CCA GGG GCC GGA TGG AAC GTC CGC GAC [9946] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9946] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9946] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9946] #FLWN01a ... ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... [9946] #FLWN01b ... ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... [9946] #FLWN02a ... ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... [9946] #FLWN02b ... ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... [9946] #FLWN05a ... ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... [9946] #FLWN05b ... ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... [9946] #WNNY99 ... ... ... ... ..C ... ... ... ... ... ... ... ... ... ... ... [9946] #WNEgypt ... ... ... ... ..C ..T ... ... ... ... ... ... ... ... ..T ... [9946] #Kunjin ..G ... ... ... ..C ..C ..C ... ... ..T ... ... ..T ..T ..A ... [9946] #JE A.. ... ..G ... ..C ..C ..C ... ..A ..T ... ... ..T ..G AAG ... [9946] #MVE A.T ..A ... ..A ..A ... ..C ..T ..C T.A ... ... ... ... A.G ... [9946] #FLM38 ACT GCT TGT CTG GCT AAG TCC TAT GCC CAG ATG TGG CTG CTT CTG TAC [9994] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9994] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9994] #FLS545 ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #FLWN01a ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #FLWN01b ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #FLWN02a ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #FLWN02b ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #FLWN05a ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #FLWN05b ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #WNNY99 ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #WNEgypt ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9994] #Kunjin ... ... ..C T.A ..C ..A ..T ... ..T ... ... ... T.. ..C ... ... [9994] #JE ..A ... ..C T.. ..C ..A G.A ... ..A ... ... ... ..A ..C ..A ... [9994] #MVE ..G ..A ..C T.A ..A ..A G.A ... ..A ... ... ... ..T G.G T.. ... [9994]

PAGE 623

598 APPENDIX P: (CONTINUED) #FLM38 TTC CAC AGA AGA GAC CTG CGG CTC ATG GCC AAC GCC ATT TGC TCC GCT [10042] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10042] #WNEgypt ... ... ... ... ... ... ... ..A ... ... ... ... ... ... ... ... [10042] #Kunjin ... ... ... ... ..T ... ... T.G ... ... ... ... ..C ... ..T ..C [10042] #JE ... ..T C.T ..G ... T.. ..T ... ... ..A ..T ..G ... ... ..A ..A [10042] #MVE ... ..T C.. C.G ..T ... ..C ..G ... ... ... ... ..A ... ..T T.A [10042] #FLM38 GTC CCT GTG AAT TGG GTC CCT ACC GGA AGA ACC ACG TGG TCC ATC C [10088] #FLS502 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #FLS504 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #FLS545 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #FLWN01a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #FLWN01b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #FLWN02a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #FLWN02b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #FLWN05a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #FLWN05b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #WNNY99 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #WNEgypt ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [10088] #Kunjin ..A ... ..A ..C ... ... ... ..T ... ... ... ..A ... ... ... [10088] #JE ..G ..A ... G.. ... ..G ..C ..A ..C ..G ..A T.C ... ..A ..A [10088] #MVE ... ..A ..T G.C ... ..T ..A ... ..C ..G ..T ..T ... ... ... [10088]

PAGE 624

599 APPENDIX P: (CONTINUED) West Nile Virus Strains NS5 Region: Fu1/cfd3 Primer Set Amino Acid Alignment #MEGA !Title Translated NS5 ClustalW 1.6 WN; !Format DataType=Protein NSeqs=15 NSites=335 Identical=. Missing=? Indel=-; !Domain=Data; #FLM38 ---REAEPFG SCGSELAFWS SRLWVFSMKT TGLEERTQEE VSRAWASKNW [3080] #FLS502 ---....... .......... .......... .......... .......... [3080] #FLS504 ---....... .......... .......... .......... .......... [3080] #FLS545 ERP....... .......... .......... .......... .......... [3080] #FLWN01a ERP....... .......... ...G...... .......... .......... [3080] #FLWN01b ----------------------...L.. ..**...... .......... [3080] #FLWN02a ---....... .......... .......... .......... .......... [3080] #FLWN02b ---....... .......... .......... .......... .......... [3080] #FLWN05a -RP....... .......... .......... .......... .......... [3080] #FLWN05b -RP....... .......... .......... .......... .......... [3080] #WNNY99 ERP....... .......... .......... .......... .......... [3080] #WNEgypt ERL.....Y. .......... .K..A.LT.. .........A G......... [3080] #Kunjin GKP...G.S. L..W...S*. L...A.L.R. .......RGA G..V...R.* [3080] #JE EKP...G... ...L.HGI*. LK..GS*... I.*A..I..V EWK.R...S* [3080] #MVE ERP.....S. ...W.PDS.. LK.*DS.... I.*V..I... ELKELVFRS. [3080] #FLM38 VTSCVKLAPG LGARSMLMTQ LAGTPASREL TWKMKLRCLS CLMGNIGVLP [3130] #FLS502 .......... .......... .......... .......... .......... [3130] #FLS504 .......... .......... .......... .......... .......... [3130] #FLS545 .......... .......... .......... .......... .......... [3130] #FLWN01a .......... .......... .......... .......... .......... [3130] #FLWN01b .......... ....F..... .G........ ....R..... .......... [3130] #FLWN02a .......... .......... .......... .......... .......... [3130] #FLWN02b .......... .......... .......... .......... .......... [3130] #FLWN05a .......... P......... .......... .......... ....S..... [3130] #FLWN05b .......... .......... .......... .......... .......... [3130] #WNNY99 .......... .......... .......... .......... .......... [3130] #WNEgypt .IF......D .E........ ......L... .......F.. .W.......L [3130] #Kunjin A........D PE.E.T.... PV.....Q.. ..R..P.F.. .WT.ST.AW. [3130] #JE D..S.T*QES KEGKCT..IP PG..LELP.. .*......W. S*TV.TACS. [3130] #MVE D..*EMWLKS .EGKF.P... .V.....HK. .LRT..KFW. *WKVSS.LWQ [3130] #FLM38 GPSLSSPIVT KL*K*CARLL MEEPSWMLSP EKIRGGVDKL SPTP*TLSPT [3180] #FLS502 .......... .......... .......... .......... .......... [3180] #FLS504 .......... .......... .......... .......... .......... [3180] #FLS545 .......... .......... .......... .......... .......... [3180] #FLWN01a .......... .......... .......... .......... .......... [3180] #FLWN01b .......... .......... .......... .......... .......... [3180] #FLWN02a .......... .......... .......... .......... .......... [3180] #FLWN02b .......... .......... .......... .......... .......... [3180] #FLWN05a .......... .......... ....L...F. .......... .......... [3180] #FLWN05b .......... .......... .......... .......... .......... [3180] #WNNY99 .......... .......... .......... .......... .......... [3180] #WNEgypt .......... .......... .......S.. .......... ...L..P... [3180] #Kunjin ........A. .*.R...... ......TS.. G.T.EE.G.. ...L..PL.. [3180] #JE E.*.N*LTG. .WSRS*DLQQ K.R.*.T*YQ ...K....RW .LMLL...R. [3180] #MVE EQ...*HTG. .WSRS...Q. E.RL*..SFH A..KEE...* *.ML..H... [3180]

PAGE 625

600 APPENDIX P: (CONTINUED) #FLM38 WPSSW*G*WK GKE*LAQMMW RNSQKGKDPK SGPGCLRMGK KDSAAWLSVE [3230] #FLS502 .......... .......... .......... .......... .......... [3230] #FLS504 .......... .......... .......... .......... .......... [3230] #FLS545 .......... .......... .......... .......... .......... [3230] #FLWN01a .......... .......... .......... .......... .......... [3230] #FLWN01b .......... .......... .......... .......... .......... [3230] #FLWN02a .......... .......... .......... .......... .......... [3230] #FLWN02b .......... .......... .......... .......... .......... [3230] #FLWN05a .......... .......... .......... .......... ..L....... [3230] #FLWN05b .......... .......... .......... .......... .......... [3230] #WNNY99 .......... .......... .......... .......... .......... [3230] #WNEgypt .......... .......... ....RE..L. .........R ........A. [3230] #Kunjin .L.N..E... ERV.S..... ....R..G.R LE.......R .......... [3230] #JE LL..SS...R LRGS.DHST. NSYPEKTR*L ....S...ER RE*PG.R.A. [3230] #MVE SLCN.LDS.. P.RS*V..TL KALKGKRNLQ .AH.F..TQ. .ECS...L.V [3230] #FLM38 M-CVVKPLDD RFATSLHFLN AMSKVRKDIQ EWKPSTGWYD WQQVPFCSNH [3280] #FLS502 .-........ .......... .......... .......... .......... [3280] #FLS504 .-........ .......... .......... .......... .......... [3280] #FLS545 .-........ .......... .......... .......... .......... [3280] #FLWN01a .-........ .......... .......... .......... .......... [3280] #FLWN01b .Y......H. .......... .......... .......... .......... [3280] #FLWN02a .-........ .......... .......... .......... .......... [3280] #FLWN02b .-........ .......... .......... .......... .......... [3280] #FLWN05a .-........ .......... .......... .......... .......... [3280] #FLWN05b .-........ .......... .......... .......... .......... [3280] #WNNY99 .-........ .......... .......... .......... .......... [3280] #WNEgypt .-........ .......... .......... .......... .......... [3280] #Kunjin .-........ .......... .......... .......... .......... [3280] #JE T-........ ....A..... .......... .....H..H. .......... [3280] #MVE .-........ ..S.A..... .......... .....Q.... .......... [3280] #FLM38 FTELIMKDGR TLVVPCRGQD ELVGRARISP GAGWNVRDTA CLAKSYAQMW [3330] #FLS502 .......... .......... .......... .......... .......... [3330] #FLS504 .......... .......... .......... .......... .......... [3330] #FLS545 .......... .......... .......... .......... .......... [3330] #FLWN01a .......... .......... .......... .......... .......... [3330] #FLWN01b .......... .......... .......... .......... .......... [3330] #FLWN02a .......... .......... .......... .......... .......... [3330] #FLWN02b .......... .......... .......... .......... .......... [3330] #FLWN05a .......... .......... .......... .......... .......... [3330] #FLWN05b .......... .......... .......... .......... .......... [3330] #WNNY99 .......... .......... .......... .......... .......... [3330] #WNEgypt .......... .......... .......... .......... .......... [3330] #Kunjin .......... ...T...... .......... .......... .......... [3330] #JE .Q.IV..... SI........ ..I....... ......K... ....A..... [3330] #MVE .Q.V...... .......... ..I....... .S........ ....A..... [3330] #FLM38 LLLYFHRRDL RLMANAICSA VPVNWVPTGR TTWSI [3365] #FLS502 .......... .......... .......... ..... [3365] #FLS504 .......... .......... .......... ..... [3365] #FLS545 .......... .......... .......... ..... [3365] #FLWN01a .......... .......... .......... ..... [3365] #FLWN01b .......... .......... .......... ..... [3365] #FLWN02a .......... .......... .......... ..... [3365] #FLWN02b .......... .......... .......... ..... [3365] #FLWN05a .......... .......... .......... ..... [3365] #FLWN05b .......... .......... .......... ..... [3365] #WNNY99 .......... .......... .......... ..... [3365] #WNEgypt .......... .......... .......... ..... [3365] #Kunjin .......... .......... .......... ..... [3365] #JE .......... .......... ...D...... .S... [3365] #MVE .V........ .........S ...D...... ..... [3365]

PAGE 626

601 APPENDIX P: (CONTINUED) St. Louis Encephalitis Virus Strains NS5 Region: Fu1/cfd3 Primer Set Nucleotide Alignment #MEGA !Title NS5 ClustalW 1.6 SLE; !Format DataType=Nucleotide CodeTable=Standard NSeqs=19 NSites=1006 Identical=. Missing=? Indel=-; !Domain=Data property=Coding CodonStart=1; #FL52 GAA AGG CTA AAG GAA GCA GAG CCA TTT GGT ACA TGT GGT TGG GAG CTC [9120] #TBH-28 .G. ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... [9120] #FL72 .G. ... .C. ... ... ... ... .T. .C. ... .T. ... ..C .A. ... ... [9120] #FL85a .G. ... ... ... .C. ... ... ... ... ... ... ... ... ... ... ... [9120] #FL85b .GG ... ... .-. .C. ... ... ... ... ... ... ... ... ... ... ... [9120] #FL89 .GG ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9120] #FL90a .GG ... ... .G. --. ... ... ... ... ... ... ... ... ... ... ... [9120] #FL90b .G. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9120] #FL90c .GG ... ... .G. --. ... ... ... ... ... ... ... ... ... ... ... [9120] #FL90d .G. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9120] #FLS569 .G. ... .C. ... ... ... .G. .T. .C. ... ... ... ..C .A. ... ... [9120] #FLS650 .GG ... .C. .-. ... ... .G. .T. .C. ... ... ... ..C .A. ... ... [9120] #TR58 .GG ... .C. ... ... ... ... .T. .C. ... ... ... ..C .A. ... ... [9120] #TR62 .G. ... .A. ... ... ... ... .T. .C. ... ... ... ..C .A. ... ... [9120] #BR64 .GG ... .C. .-. ... ... ... ... .C. ... ... ... ..C ... ... .C. [9120] #BR69 .G. ... .C. ... ... ... ... ... .C. ... ... ... ..C .A. ... .C. [9120] #Kern217 .G. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9120] #Rocio .G. .A. ... .G. .C. ..C .C. ... ... ... .T. ... ..C ... .G. .AA [9120] #Ilheus .G. ... .A. .G. ... ... ... ... .C. ... ... ... ..C .T. ... ..A [9120] #FL52 GGT TTT TGG AGT TTG AAG CCC TCG GGT TCC TAA ATG AAG ACC ATT GGA [9168] #TBH-28 ... .C. ... ... ... ... ... ... ... ... ... ... ... ... .C. ... [9168] #FL72 ... ... ... ... ... .G. .T. ... ... .T. ... ... ... .T. .C. ... [9168] #FL85a ... .C. ... ... ... ... ... ... ... ... ... ... ... ... .C. ... [9168] #FL85b ... .C. ... ... ... ... ... ... ... ... ... ... ... ... .C. ... [9168] #FL89 ... .C. ... ... ... ... ... ... ... ... ... ... ... .T. .C. ... [9168] #FL90a ... .C. ... ... ... ... ... ... ... ... ... ... ... .T. .C. ... [9168] #FL90b ... .C. ... ... ... ... ... ... ... ... ... ... ... .T. .C. ... [9168] #FL90c ... .C. ... ... ... ... ... ... ... ... ... ... ... .T. .C. ... [9168] #FL90d ... .C. ... ... ... ... ... ... ... ... ... ... ... .T. .C. ... [9168] #FLS569 ... ..C ... ... ... .G. ... ... ... .T. ... ... ... .T. .C. ... [9168] #FLS650 ... ..C ... ... ... .G. ... ... ... .T. ... ... ... .T. .C. ... [9168] #TR58 ... ... ... ... ... .G. .T. ... ... .T. ... ... ... .T. .C. ... [9168] #TR62 ... ... ... ... ... .G. .T. ... ... ... ... ... ... .T. .C. ... [9168] #BR64 ... ... ... ... ... .G. ... ... ... .T. ... ... ... .T. .C. ... [9168] #BR69 ... ..C ... ... ... .G. ... ... ... .T. ... ... ... .T. .C. ... [9168] #Kern217 ... .C. ... ... ... ... ... .T. ... ... ... ... ... ... .C. ... [9168] #Rocio ... ..C .T. ... .C. ... .G. ... .A. .T. .C. ... ... ... .C. ... [9168] #Ilheus .A. .C. ... .A. ... ... .A. .G. .C. .T. ... ... ... ... ... ... [9168]

PAGE 627

602 APPENDIX P: (CONTINUED) #FL52 TGA GCC GCG AGA ACT CCT ATG GAG GAG TTG AGG GGA AAG GAC TCC AGA [9216] #TBH-28 ... ... ... ... ... ... ... ... ... .C. ... ... ... ... ... ... [9216] #FL72 ... ... ... ... ... .AC ... ... ... ... ... ... ... ... ... .A. [9216] #FL85a ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9216] #FL85b ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... [9216] #FL89 ... ... ... ... ... ... .C. ... ... ... ... ... ... ... ... ... [9216] #FL90a ... ... ... ... ... ... .C. ... ... ... ... ... ... ... ... ... [9216] #FL90b ... ... ... ... ... ... .