USF Libraries
USF Digital Collections

Systematic analysis of structure-function relationships of conserved sequence motifs in the NADH-binding lobe of cytochr...

MISSING IMAGE

Material Information

Title:
Systematic analysis of structure-function relationships of conserved sequence motifs in the NADH-binding lobe of cytochrome b₅ reductas
Physical Description:
xvii, 240 leaves : ill. (some col.) ; 28 cm.
Language:
English
Creator:
Roma, Glenn W
Publication Date:

Subjects

Subjects / Keywords:
Cytochrome-B(5) Reductase   ( mesh )
NADH, NADPH Oxidoreductases   ( mesh )
Flavin-Adenine Dinucleotide   ( mesh )
Molecular Structure   ( mesh )
Methemoglobinemia   ( mesh )
Rats   ( mesh )
Flavoprotein
Transhydrogenases
Oxidoreductases
Methemoglobinemia
Mutagenesis
Dissertations, Academic -- Biochemistry and Molecular Biology -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: NADH:Cytochrome b₅ Reductase (cb5r) catalyzes the reduction of the ferric iron (Fe³⁺) atom of the heme cofactor found within cytochrome b₅ (cb5) by the reduction of the FAD cofactor of cb5r from reducing equivalents of the physiological electron donor, reduced nicotinamide adenine dinucleotide (NADH). Cb₅r is characterized by the presence of two domains necessary for proper enzyme function: a flavin-binding domain and a pyridine nucleotide-binding domain. Within these domains are highly conserved "motifs" necessary for the correct binding and orientation of both the NADH coenzyme and the FAD cofactor. To address the importance of these conserved motifs, site-directed mutagenesis was utilized to generate a series of variants of residues located within the motifs to allow for the full characterizations.Second, naturally occurring recessive congenital methemoglobinemia (RCM) mutants found in proximity to these highly conserved motifs were analyzed utilizing site-directed mutagenesis. In addition, a canine variant of the cb5r soluble domain was cloned, generated and characterized and compared with the WT rat domain. The canine construct showed a high degree of sequence homology to that of the corresponding human and rat sequences. Characterization of the canine variant indicated that it possessed comparable functional characteristics to the rat variant. Investigation of the pyrophosphate-associating residues, Y112 and Q210, indicated that each played a role in the proper association and anchoring of NADH to the enzyme. The RCM type I mutants, T116S and E212K, caused a moderate decrease in efficiency of the enzyme. The presence of both mutations interact synergistically to generate a more substantially decreased function.Analysis of the "¹⁸⁰GtGitP¹⁸⁵" NADH-binding motif and the preceding residue G179 revealed that these residues are vital in enabling proper NADH association. The residues of this motif were shown to be important in determining nucleotide specificity and properly positioning the NADH and flavin cofactor for efficient electron transfer. RCM variants A178T and A178V were shown to decrease catalytic efficiency or protein stability respectively, leading to disease phenotype. Analysis of the NADH-binding motif "²⁷³CGxxxM²⁷⁸" indicated that this motif facilitates electron transfer from substrate to cofactor and is important in release of NAD⁺ from the enzyme after electron transfer.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
Additional Physical Form:
Also available online.
Statement of Responsibility:
by Glenn W. Roma.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002067974
oclc - 601468666
usfldc doi - E14-SFE0002558
usfldc handle - e14.2558
System ID:
SFS0026875:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader ntm 2200397Ka 4500
controlfield tag 001 002067974
005 20100406105423.0
008 100406s2008 xx a b 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002558
035
(OCoLC)601468666
040
FHJ
c FHJ
049
FHJA
096
QU 140
b R756s 2008
1 100
Roma, Glenn W.
0 245
Systematic analysis of structure-function relationships of conserved sequence motifs in the NADH-binding lobe of cytochrome b reductas
by Glenn W. Roma.
260
2008.
300
xvii, 240 leaves :
ill. (some col.) ;
28 cm.
500
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2008.
504
Includes bibliographical references.
520
ABSTRACT: NADH:Cytochrome b Reductase (cb5r) catalyzes the reduction of the ferric iron (Fe) atom of the heme cofactor found within cytochrome b (cb5) by the reduction of the FAD cofactor of cb5r from reducing equivalents of the physiological electron donor, reduced nicotinamide adenine dinucleotide (NADH). Cbr is characterized by the presence of two domains necessary for proper enzyme function: a flavin-binding domain and a pyridine nucleotide-binding domain. Within these domains are highly conserved "motifs" necessary for the correct binding and orientation of both the NADH coenzyme and the FAD cofactor. To address the importance of these conserved motifs, site-directed mutagenesis was utilized to generate a series of variants of residues located within the motifs to allow for the full characterizations.Second, naturally occurring recessive congenital methemoglobinemia (RCM) mutants found in proximity to these highly conserved motifs were analyzed utilizing site-directed mutagenesis. In addition, a canine variant of the cb5r soluble domain was cloned, generated and characterized and compared with the WT rat domain. The canine construct showed a high degree of sequence homology to that of the corresponding human and rat sequences. Characterization of the canine variant indicated that it possessed comparable functional characteristics to the rat variant. Investigation of the pyrophosphate-associating residues, Y112 and Q210, indicated that each played a role in the proper association and anchoring of NADH to the enzyme. The RCM type I mutants, T116S and E212K, caused a moderate decrease in efficiency of the enzyme. The presence of both mutations interact synergistically to generate a more substantially decreased function.Analysis of the "GtGitP" NADH-binding motif and the preceding residue G179 revealed that these residues are vital in enabling proper NADH association. The residues of this motif were shown to be important in determining nucleotide specificity and properly positioning the NADH and flavin cofactor for efficient electron transfer. RCM variants A178T and A178V were shown to decrease catalytic efficiency or protein stability respectively, leading to disease phenotype. Analysis of the NADH-binding motif "CGxxxM" indicated that this motif facilitates electron transfer from substrate to cofactor and is important in release of NAD from the enzyme after electron transfer.
530
Also available online.
590
Advisor: Michael J. Barber, D.Phil.
2 650
Cytochrome-B(5) Reductase.
NADH, NADPH Oxidoreductases.
Flavin-Adenine Dinucleotide.
Molecular Structure.
Methemoglobinemia.
Rats.
653
Flavoprotein
Transhydrogenases
Oxidoreductases
Methemoglobinemia
Mutagenesis
690
Dissertations, Academic
z USF
x Biochemistry and Molecular Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2558



PAGE 1

Systematic Analysis of Structure-Function Relationships of Conserved Sequence Motifs in the NADH-Binding Lobe of Cytochrome b5 Reductase by Glenn W. Roma A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Biochemist ry and Molecular Biology College of Medicine University of South Florida Major Professor: Michael J. Barber, D.Phil. Ronald K. Keller, Ph.D. Duane Eichler, Ph.D. Eric S. Bennett, Ph.D. Date of Approval: July 15, 2008 Keywords: flavoprotein, transhydrogenase s, oxidoreductases, methemoglobinemia, mutagenesis. Copyright 2008, Glenn W. Roma

PAGE 2

This work is dedicate d to my mother, Linda Roma and my father, Ralph Roma. Thank you for a life time of support and belief.

PAGE 3

ACKNOWLEDGEMENTS I would like to thank Profe ssor Michael J. Barber, D.Phil. for offering me the opportunity to achieve this goa l. His guidance, input, dire ction, and, most importantly, his support, have allowed me to succeed. A special thank you to my dissertation committee members, Professor Duane C Eichler, Ph.D., Professor Larry P. Solomonson, Ph.D., Professor Eric Bennett, Ph.D., and my committee chairperson Professor Ronald K. Keller, Ph.D., for all of your instruction, constructive criticism, ideas, input, and always offering your encouragement to me. To my friend and former lab mate, Louis J Crowley PhD., for your guidance and assistance when I first entered the la b, and your input and honesty in professional and personal matters To Joshua Smith, for your invaluable assistance in keeping the lab working effici ently, helping keep me sane when things became hectic and overwhelming, and for bein g a true friend and brother. To Jamie Melichar, for your assistance in running experiments and collec ting valuable data. To my parents, Linda and Ralph Roma, for your consta nt love, vigilance, support, and belief in me my whole life, and for providing an envi ronment that helped encourage and push me on to accomplish all that I can. And to my wonderful girlfriend, Jessica Provenzano, for you constant support and interest in my conf using science world and for the love and companionship you have given me over the year s and that I look forward to enjoying for the rest of our lives.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES iii LIST OF FIGURES v LIST OF ABBREVIATIONS xi ABSTRACT xvi 1. INTRODUCTION 1 Electron Transfer 1 Methemoglobin 2 History of Methemoglobinemia 4 Cytochrome b 5 Reductase 6 Recessive Congenital Methemoglobinemia 11 Crystal Structure of Cytochrome b 5 Reductase 14 Cytochrome b 5 Reductase Sequence Homology 15 Sequence Motifs in the FNR Family of Flavoprotein Oxidoreductases 20 Research Aims and Approaches 21 2. MATERIALS AND METHODS 28 Materials 28 Molecular Biology Reagents 28 Microbiology and Protei n Purification Reagents 28 Enzyme Assay and Spectroscopy Reagents 29 Methods 30 Protein Expression and Purification 30 Site-Directed Mutagenesis 32 Homology Modeling 34 Ultra-violet and Visible Absorbance Spectroscopy 35 Ultra-violet and Visible Circ ular Dichroism Spectroscopy 35 Fluorescence Spectroscopy 36 Steady-State Enzyme Kinetics 36

PAGE 5

ii Spectral Binding Constant Determination by Differential Spectroscopy 37 Thermal Stability Measurements 38 Determination of Flavin Oxidation-Reduction Potential 38 3. RESULTS AND DISCUSSION 40 Expression and Characterization of a Functional Canine Variant 40 of Cytochrome b 5 Reductase Analysis of residues, Y112 and Q 210, involved in anchoring of the 65 pyrophosphate backbone of NAD + Characterization of the Type I Recessive Congenital Methemoglobinemia Mutants T116S and E212K 93 Mutagenesis of conserved residue G179: Role in Pyridine Nucleotide 107 Specificity Systematic analysis of the conserved NADH binding motif 180 GxGxxP 185 127 Properties of the Type I recessive congenital methemoglobinemia mutants A178T and A178V 169 The role of the NADH binding motif 273 CGxxxM 278 182 4. CONCLUSIONS AND FUTURE AIMS 217 REFERENCES 226 APPENDICES 237 Appendix A 238 Appendix B 239 Appendix C 240 ABOUT THE AUTHOR End Page

PAGE 6

iii LIST OF TABLES Table 1. Compounds Capable of Generating Methemoglobin 3 Table 2. Levels of Methemoglobin Concentration and Symptoms 13 Table 3. Oligonucleotide primers used to amplify the full-length canine cb 5 r cDNA sequence. 42 Table 4. Purificati on of canine cb5r 45 Table 5. NAD(P)H:FR and NADH: BR kinetic constants obtained for canine and rat cb5r 52 Table 6. Spectroscopic binding consta nts obtained for canine cb5r in the presence of various pyridine nucleotides. 55 Table 7. NADH:FR Kinetic Cons tants and Thermal Stability (T 50 ) Values for the Y112 Series of Variants 73 Table 8. NADH:FR Kinetic Cons tants and Thermal Stability (T 50 ) Values for the Q210 Series of Variants. 74 Table 9. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the Y112 Series Variants. 82 Table 10. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the Q210 Series Variants 83 Table 11. NADH:FR Kinetic Consta nts and Thermal Stability (T 50 ) Values for the Type I RCM Associated Mutants T116S, E212K, and T116S/E212K 96 Table 12. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for Type I RCM mutants T116S, E212K and T116S/E212K 98 Table 13. NAD(P)H:FR and NADH: BR kinetic constants obtained for G179 mutants 115

PAGE 7

iv Table 14. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the G179 Series Variants 118 Table 15. NADH:FR Kinetic Consta nts and Thermal Stability (T 50 ) Values for the GtGitP Alanine Variants. 133 Table 16. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the GtGitP Alanine Variants. 138 Table 17. NADH:FR Kinetic Consta nts and Thermal Stability (T 50 ) Values for the G180P, T181I/S, G182P, I183F/L/M, T184H/S/V, and P185G Variants 147 Table 18. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E ) Obtained for the G180P, T181I/S, G182P, I183F/L/M,T184H/S/V, and P185G Variants. 155 Table 19. NADH:FR Kinetic Cons tants and Thermal Stabiilty (T 50 ) Values of Type I RCM Associated Mutants A178T and A178V 173 Table 20. Spectral Binding Constants ( K s ) and Midpoint Potentials (E ) Obtained for the Type I RCM Associated Mutants A178T and A178V. 176 Table 21. NADH:FR Kinetic Consta nts and Thermal Stability (T 50 ) Values Obtained for the Alanine Variants of the CGpppM Motif 190 Table 22. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E ) Obtained for the Alanine Vara ints of the CGpppM Motif 195 Table 23. NADH:FR Kinetic Consta nts and Thermal Stability (T 50 ) Values Obtained for the C273M/S, G274P/S A-insertion and G-insertion Variants of the CGpppM Motif 201 Table 24. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E ) Obtained for the C273M/S G274P/S, A-insertion and G-insertion Variants of the CGpppM Motif 205

PAGE 8

v LIST OF FIGURES Figure 1. Structure of the Human DIA1 Gene that Encodes Cytochrome b 5 Reductase 8 Figure 2. Mechanism of Cytochrome b 5 Reductase Mediated Cytochrome b 5 Reduction 9 Figure 3. New Model of the Reaction Sequence of Cytochrome b 5 Reductase 10 Figure 4. Clinical Indications of Cyanosis as a Result of Increased Levels of Methemoglobin in the Blood 12 Figure 5. The Tertiary Structure of Rat Cytochrome b 5 Reductase 16 Figure 6. The Structure of the F AD-Binding Domain of Cytochrome b 5 Reductase 17 Figure 7. The Structure of the Hinge Region of Cytochrome b 5 Reductase 18 Figure 8. The Structure of the NA DH-Binding Domain of Cytochrome b 5 Reductase 19 Figure 9. Alignment of Conserve d Flavin and NADH-Binding Motifs of Various Enzymes Belonging to the FNR Family of Flavoprotein Transhydrogenases 23 Figure 10. Complete Nucleotide Sequence of Canine cb5r 44 Figure 11. SDS-PAGE and MALDI-TOF mass spectrometric analyses of canine cb5r diaphor ase domain expression. 47 Figure 12. Ultra-Violet, Vi sible, and Circular Dichroism Spectra Obtained for the Canine cb5r Variant. 49 Figure 13. Thermal Stability Profile Obta ined for the Canine cb5r Variant. 51

PAGE 9

vi Figure 14. Differential Spectra Ob tained Following Binding of Various Pyridine Nucleotides to the Canine cb5r Variant. 53 Figure 15. Oxidation-Reduction Midpoint Potentials Obtained for the FAD Prosthetic Group in the Canine cb5r Variant. 57 Figure 16. Comparison of the Predicte d Structure of the Canine cb5r Diaphorase Domain with the Corresponding Human and Rat Diaphorase Domain Structures. 63 Figure 17. Electrostatic in teractions of amino acid residues Y112 and Q210 With NAD + bound to cytochrome b 5 reductase. 67 Figure 18. Ultra-Violet, Vi sible, and Circular Dichroism Spectra Obtained for the Y112 Series of cb5r Variants. 70 Figure 19. Ultra-Violet, Vi sible, and Circular Dichroism Spectra Obtained for the Q210 Series of cb5r Variants. 71 Figure 20. Thermal stability profiles Obtained for the Y112 and Q210 Series of Variants. 76 Figure 21. Spectroscopic Titrations of Wild Type cb5r and the Y112 Series of Variants in the Presence of H 4 NAD. 78 Figure 22. Spectroscopic Titrations of Wild Type cb5r and the Y112 Series of Variants in the Presence of NAD + 79 Figure 23. Spectroscopic Titrations of Wild Type cb5r and the Q210 Series Variants in the Presence of H 4 NAD and NAD + 81 Figure 24. Oxidation-Reduction Midpoi nt Potentials for the FAD Prosthetic Group in the Wild-T ype cb5r and the Y112 Series of cb5r Variants. 84 Figure 25. Oxidation-Reduction Midpoi nt Potentials for the FAD Prosthetic Group in the Wild-T ype cb5r and the Q210 Series of cb5rVariants. 85 Figure 26. Structures of WT cb5r and the Y112D Variant with FAD Generated in silica 88 Figure 27. Structures of WT cb5r and the Q210R Variant with FAD Generated i n silica 91

PAGE 10

vii Figure 28. Ultra-Violet, Vi sible, and Circular Dichroism Spectra Obtained for the RCM Type I Associated Mutants T116S, E212K, and T116S/E212K 94 Figure 29. Temperature Stability Profile s Obtained for the Type I RCM Associated Mutants T116S, E212K, and T116S/E212K 97 Figure 30. Spectroscopic Titrations Obta ined for the Type I RCM Associated Mutants T116S, E212K, and T116S/E212K in the Presence of H 4 NAD and NAD + 100 Figure 31. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the Wild-Type cb5r and the Type I RCM Associated Mutants T116S, E212K, and T116S/E212K. 103 Figure 32. Structural Model of cb5r Showing Position of Residues T116 and E212 104 Figure 33. Multiple Sequence Al ignment of cb5r Primary Structures 107 Figure 34. Structural Model of G179 and the GxGxxP Motif 109 Figure 35. Ultra-Violet, Vi sible, and Circular Dichroism Spectra Obtained for the G179 Series of cb5r Variants. 111 Figure 36. Spectroscopic Titrations Ob tained for the G179 Series of cb5r Variants in the Presence of H 4 NAD and NAD + 117 Figure 37. Oxidation-Reduction Midpoi nt Potentials for the FAD Prosthetic Group in the G179 Series of cb5r Variants 120 Figure 38. Electrostatic Interacti on of Amino Acid Residues G180, T181, and G182 with NAD + Bound to Cytochrome b 5 Reductase. 127 Figure 39. Electrostatic Interaction of Amino Acid Residues T184 and P185 with FAD Bound to Cytochrome b 5 Reductase 128 Figure 40. Ultra-Violet, Vi sible, and Circular Dichroism Spectra Obtained for the WT cb5r and the GtGitP Alanine Variants. 132 Figure 41. Thermal Stability Profiles Ob tained for the WT cb5r and the GtGitP Alanine Variants. 134

PAGE 11

viii Figure 42. Spectroscopic Titrations Obtained for the WT cb5r and the GtGitP Alanine Variants in the Presence of H 4 NAD. 137 Figure 43. Spectroscopic Titrations Obtained for the WT cb5r and the GtGitP Alanine Variants in the Presence of NAD + 140 Figure 44. Oxidation-Reduction Midpoi nt Potentials for the FAD Prosthetic Group in the GtGitP Alanine Variants. 142 Figure 45. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the WT cb5r and the T184H, T184S, and T184V cb5r Variants. 145 Figure 46. Thermal Stability Prof iles of WT cb5r and Selected Variants of the GtGitP Motif. 149 Figure 47. Spectroscopic Titrations Obtained for the WT cb5r and Selected Variants of the G tGitP Motif in the Presence of H 4 NAD. 152 Figure 48. Spectroscopic Titrations Obtained for the WT cb5r and Selected Variants of the G tGitP Motif in the Presence of NAD + 154 Figure 49. Oxidation-Reduction Midpoi nt Potentials for the FAD Prosthetic Group in the WT cb5r and Selected Variants of the GtGitP Motif. 156 Figure 50. Structures of WT cb5r and G180A and G180P Variants with NAD + Generated in silica 159 Figure 51. Structures of WT cb5r and G182A and G182P Variants with NAD + Generated in silica 162 Figure 52. Structure of WT cb5r re sidue P185 in Association with NAD + and FAD Generated in silica 164 Figure 53. Structures of WT cb5r re sidue T181 and Variant T181S in Association with NAD + Generated in silica 166 Figure 54. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the WT cb5r and the RCM Type I Associated Variants A178T and A178V. 171

PAGE 12

ix Figure 55. Thermal Stability Profiles of the Type I RCM Associated Variants A178T and A178V. 174 Figure 56. Spectroscopic Titrations Ob tained for the WT cb5r and the Type I RCM Associated Variants A178T and A178V in the Presence of H 4 NAD and NAD + 177 Figure 57. Oxidation-Reduction Midpoi nt Potentials for the FAD Prosthetic Group in the WT cb5r and the Type I RCM Associated Variants A178T and A178V. 179 Figure 58. Structures of WT cb5r Residue A178 and RCM Variants A178Tand A178V Generated in silica 181 Figure 59. Electrostatic Interacti on of the CGpppM Motif with NAD + 184 Figure 60. Ultra-Violet, Vi sible, and Circular Dichroism Spectra Obtained for the WT cb5r and the Alan ine Variants of the CGpppM Motif. 187 Figure 61. Thermal Stability Profiles Obtained for the WT cb5r and the Alanine Variants of the CGpppM Motif. 189 Figure 62. Spectroscopic Titrations Ob tained for the WT cb5r and the Alanine Variants of the CG pppM Motif in the presence of H 4 NAD. 192 Figure 63. Spectroscopic Titrations Ob tained for the WT cb5r and the Alanine Variants of the CGpppM Motif in the presence of NAD + 194 Figure 64. Oxidation-Reduction Midpoi nt Potentials for the FAD Prosthetic Group in the WT c b5r and the CGpppM Alanine Variants. 195 Figure 65 Ultra-Violet, Vi sible, and Circular Dichroism Spectra Obtained for the WT cb5r and the cb5r Variants C273S, C273M, G274P, G274S, A insertion, and G insertion. 198 Figure 66. Thermal Stability Profiles Obtained for the WT cb5r and the cb5r Variants C273S, C273M, G274P, G274S, A insertion, and G insertion. 200

PAGE 13

x Figure 67. Spectroscopic Titrations Ob tained for the WT cb5r and the cb5r Variants C273S, C273M, G274P, G274S, A insertion, and G insertion in the Presence of H 4 NAD. 203 Figure 68. Spectroscopic Titrations Ob tained for the WT cb5r and the cb5r Variants C273S, C273M, G274P, G274S, A insertion, and G insertion in the Presence of NAD + 204 Figure 69. Oxidation-Reduction Midpoi nt Potentials for the FAD Prosthetic Group in the WT cb5r and cb5r Variants C273S, C273M, G274P, G274S, A insertion, and G insertion. 206 Figure 70. Enzyme Inhibition Assessment in the Presence of NAD + for the M278A, A-insertion, a nd G-insertion Variants. 209 Figure 71. Structures of WT cb5r and cb5r variants G274A, G274P and G274S with NAD + Generated in silica 213

PAGE 14

xi LIST OF ABBREVIATIONS A alanine angstrom (1 = 0.1 nm) ADP adenosine-5-diphosphate ADP-ribose adenosine-5-diphosphoribose Amp ampicillin APAD + 3-acetylpyridine adenine dinucleotide (oxidized) APHD + acetylpyridine hypoxanthine dinucleotide (oxidized) ATP adenosine-5-triphosphate bp base pair C cysteine CaCl 2 calcium chloride cb5 cytochrome b 5 cb5r cytochrome b 5 reductase CD circular dichroism CPK Corey, Pauling, and Kultun (molecular coloring scheme) D aspartate DEAE diethylaminoethyl E glutamate

PAGE 15

xii EDTA ethylenediaminetetraacetic acid EtBr ethidium bromide F phenylalanine FAD flavin adenine dinucleotide FADH flavin adenine dinucleotide, semiquinone FADH 2 flavin adenine dinucleotide, dihydroquinone FMN flavin mononucleotide FNR ferredoxin:NADP + reductase FPLC fast protein liquid chromatography g gram G glycine H histidine H 4 NAD tetrahydronicotinamide adenine dinucleotide I isoleucine IPTG isopropyl-thio-galactoside IR infrared K lysine k cat turnover number K d dissociation constant K m Michaelis constant, pseudofirst order binding constant K s spectral binding constant Kan kanamycin KPi potassium phosphate

PAGE 16

xiii L leucine LB Luria broth M methionine MALDI-TOF matrix-assisted laser desorption ionization-time of flight metHb methemoglobin MgCl 2 magnesium chloride MOPS 3-( N -Morpholino) propanesulfonic acid mV millivolt MW molecular weight m/z mass/charge ratio M micro molar N asparagine NaCl sodium chloride NAD + -nicotinamide adenine dinucleotide (oxidized) -NAD + -nicotinamide adenine dinucleotide (oxidized) -NAD + 1,N6-ethenonicotinamide ad enine dinucleotide (oxidized) o-NAD + nicotinamide adenine dinucleotid e bis(dialdehyde) (oxidized) NADH -nicotinamide adenine dinucleotide (reduced) NADH:BR NADH:cytochrome b 5 reductase NADH:FR NADH:ferricyanide reductase NHD + 3-nicotinamide hypoxanthine dinucleotide nm nanometer

PAGE 17

xiv NR nitrate reductase OH hydroxyl group P proline PAAD + 3-pyridinealdehyde adenine dinucleotide PAGE polyacrylamide gel electrophoresis PCA + 3-pyridine carboxylic acid (oxidizied) PCR polymerase chain reaction PDR phthalate dioxygenase reductase Pfu Pyrococcus furiosus PMSF phenylmethylsulfonyl fluoride Q glutamine R arginine S serine SDS sodium dodecyl sulfate SHE standard hydrogen electrode SOB sterile osmotic broth T threonine TB terrific broth T 50 thermal stability constant TNAD + thionicotinamide adenine dinucleotide Tris-HCl tris(hydroxymethyl) am inomethane-hydrochloric acid UV ultraviolet V valine

PAGE 18

xv W tryptophan WT wild type Y tyrosine

PAGE 19

xvi Systematic Analysis of Struct ure-Function Rela tionships of Conserved Sequence Motifs in the NADH-Binding Lobe of Cytochrome b 5 Reductase Glenn W. Roma ABSTRACT NADH:Cytochrome b 5 Reductase (cb5r) catalyzes the reduction of the ferric iron (Fe 3+ ) atom of the heme cofact or found within cytochrome b 5 (cb5) by the reduction of the FAD cofactor of cb 5 r from reducing equivalents of the physiological electron donor, reduced nicotinamide adenine dinucleotide (NADH). Cb5r is characterized by the presence of two domains necessary for prope r enzyme function: a flavin-binding domain and a pyridine nucleotide-binding domain. Within these domains are highly conserved motifs necessary for the correct binding and orientation of both the NADH coenzyme and the FAD cofactor. To address the importance of these cons erved motifs, site-directed mutagenesis was utilized to generate a series of variants of residues located within the motifs to allow for the full characterizations. Second, naturally occurring r ecessive congenital methemoglobinemia (RCM) mutants found in proximity to these highly conserved motifs were analyzed utilizing site-dir ected mutagenesis. In additio n, a canine variant of the cb5r soluble domain was cloned, gene rated and characterized and

PAGE 20

xvii compared with the WT rat domain. The canine construct showed a high degree of sequence homology to that of the corresponding human and rat sequences. Charact erization of the canine variant indicated that it possessed comparable functional ch aracteristics to the rat variant. Investigation of the pyrophosphate-associating residues, Y112 and Q210, indicated that each played a role in the pr oper association and anc horing of NADH to the enzyme. The RCM type I mutants, T116S and E212K, caused a moderate decrease in efficiency of the enzyme. The presence of bo th mutations interact synergistically to generate a more substantially decreased function. Analysis of the 180 GtGitP 185 NADH-binding motif and the preceding residue G179 revealed that these residues are vital in enabling proper NADH association. The residues of this motif were s hown to be important in dete rmining nucleotide specificity and properly positioning the NADH and flavin cofactor for efficien t electron transfer. RCM variants A178T and A178V were shown to decrease catalytic efficiency or protein stability respectively, leading to disease phenotype. Analysis of the NADH-binding motif 273 CGxxxM 278 indicated that this motif facilitates electron transfer from substrate to cofactor and is importa nt in release of NAD + from the enzyme after electron transfer.

PAGE 21

1 1. INTRODUCTION Electron Transfer Electron transfer is the process by wh ich one electron moves from one atom or molecule to another. It is a mechanistic representation of the thermodynamic principle of oxidation-reduction. Numerous biological processes are dependent upon the proper transfer of electrons, including photosynthesi s and respiration. Additionally, pathways involved in metabolism and detoxificati on are dependent upon appropriate electron transfer reactions. Regardless of the intended f unction, the ability of the cell to harness the energy from dietary and storage molecules is depende nt upon converting energetic raw materials of macromolecules to a usable form. To this end, cells use a limited number of molecules to c ouple reactions. Most notabl e of these molecules are nucleotides such as ATP/ADP, NAD(P)/NADP(H), and FAD/FADH 2 The reducing power of these latter molecules is used to drive many reactions in anabolic pathways in the cell that would not normally occur due to unfavorable energy requirements. In biological systems, the majority of enzymes involved in electron transfer reactions do so by the use of cofactor molecules and coenzymes which alter the electrostatic potential of the enzymes active site. These com ponents span a la rge range of redox potentials, enabling them to carry out a large vari ety of processes within and equally widely varied number of envir onments and conditions. Electron transfer

PAGE 22

2 reactions often utilize transition metal co mplexes, though many examples of organic molecules are now known. Common cofactors util ized to carry out el ectron transfer in cells include metal compounds such as Fe-S clusters, hemes and other porphyrin ring structures, and highly conjugated ring like t hose present in flavin nucleotides. Many complex electron transfer systems maximize the ability to move energy by clustering several such cofactors within a multi-center complex. Electrons are free to move through the electrochemical gradient by passing from one factor to the next. In other cases, systems show less efficiency by having separate compartments, but are able to interact with a variety of donor and acceptor molecules. Multiple examples of enzymes of each condition exist. Indeed, the list would be quite long. Virtually every oxidation or reduction reaction that occurs in the cell is cat alyzed and regulated by an electron transfer protein. In general, electron transfer proteins serve to co uple energetically unfavorable endergonic reactions to energy releasing exergonic reactions. Methemoglobin Methemoglobin is the form of hemoglobin in which the iron atom of the heme prosthetic group is present in the oxidized, or ferric (Fe 3+ ) state, compared to the reduced, or ferrous (Fe 2+ ) state found in normal hemoglobin. For tetrameric hemoglobin, this corresponds to a four-electr on loss. Since methemoglobin is incapable of binding molecular oxygen this results in a loss of biological functi on of the hemoglobin molecule. Observations from as early as the nine teenth century showed that methemoglobin could be generated in red blood cells in a variety of ways. Table I illustrates the assortment of toxic compounds that, when ingested, generate varying levels of

PAGE 23

3 methemoglobin depending on the nature of th e compound. This is typical in third-world countries where poor water suppl ies and living conditi ons often lead to high levels of nitrates in common well water sources [1]. Methemoglobin is also generated as a result of a reaction to certain drugs that are used in treating patients for various conditions including dapsone, local anesthetics, a nd anti-malarial drugs [2]. Additionally, methemoglobin is produced as a result of certain hereditary disorders. Table I. Compounds Capable of Generating Methemoglobin. Acetanlid Chlorates Lidocaine Hydrochloride Phenacitin Alloxan Chloroquine Naphthalene Phenytoin Aniline dyes Dapsone Nitrates Pyridium Aromantic Amines Dimethyl Sulfoxide Nitric Oxide Resorcinol Arsine Dimethyltoluidine Nitrites Rifampin Benzene Derivatives Dinitrophenol Nitrofuran Silver Nitrate Benzocaine Ferricyanide Nitroglycerine Sulfasalazine Bivalent Copper Flutamide Nitrophenol Sulfonamides Bismuth Subnitrate Hydroxylamine Nitrosobenzene Trinitrotoluene The steady-state levels of methemoglobin w ithin normal erythrocytes is very low, corresponding to <1% total hemoglobin, i ndicating that the capacity to reduce methemoglobin far exceeds the rate of hemoglobin oxidation [3]. Methemoglobin homeostasis shows that electrons for methem oglobin reduction are generated in a variety of reactions. Primarily amongst these is the glycolytic path way, which generates reducing equivalents in the form of NADH. However, the rapid re duction of methemoglobin by non-glycolytic substrates suggests that additional pathways may be involved with the generation of NADH, perhaps in response to elevate levels of methemoglobin. The steady-state levels of methemoglobin are a co nsequence of the meth emoglobin-reducing reactions as well as the methemoglobin-g enerating reactions in erythrocytes.

PAGE 24

4 Concentrations of methemoglobin in erythr ocytes can become elevated as a result of accelerated oxidation or decreased reduction resulting from either environmental factors such as those descri bed earlier or from heredita ry abnormalities. The most frequent cause of methemoglobinemia is rapid oxidation resulting from ingestion of toxic compounds which are oxidants, or give rise to oxidants, such as peroxide and oxygen radicals, during their metabolism [3]. Methemoglobinemia also arises from oxidation of mutant hemoglobin belonging to the hem oglobin M class [4]. Methemoglobinemia resulting from decreased rates of reduction is most commonly the result of a deficiency in cytochrome b 5 reductase (cb5r) found in circulating erythrocytes. The most infrequent cause of decreased methemoglobin reduction has been attributed to deficiency in cytochrome b 5 (cb5) [5]. These latter two cases form the basis of the disease known as recessive congenital methemoglobinemia (RCM). History of Methemoglobinemia Methemoglobinemia stemming from decrea sed functionality of cb5r, now known as recessive congenital methemoglobinemia (RCM ), is an extremely rare disorder that has been under investigation for over one year and the French physician, Francios, detailed an individual with long-standing cyanosis lacking any obvious signs of cardiac or pulmonary abnormalities [6]. Another vita l piece of the puzzle was determined in 1891 when it was first suggested that meth emoglobin was reduced to hemoglobin in circulating erythrocytes [7]. Forty years la ter, while describing a familial incidence of idiopathic cyanosis, Hitzenberger suggested the possibility of congenital, familial methemoglobinemia [8].

PAGE 25

5 These key findings and others culminated in the classic investigations performed by Quentin Gibson at Queen's University, Belf ast. Gibsons patients were two brothers, Russell and Fred Martin from Banbridge in Northern Ireland. The brothers presented with a blue appearance. At the time, Dr. James Deeny, a local physician, advocated the use of ascorbic acid in the treatment of h eart disease, and his work demonstrated the benefits of vitamin C [9]. When Russell was treated with vitamin C, the cyanosis was ameliorated and he turned pink. Although D eeny assumed that he had corrected an underlying heart condition, cardiologists coul d find no cardiac abnormality in either brother. The physiologist Henry Barcroft ca rried out a detailed study of these cases during treatment and found elevated levels of methemoglobin [10]. Following this, Quentin Gibson conducted further work which correctly identified the pathway involved in the reduction of methemoglobin. This was the first description of an hereditary trait involving a specific enzyme deficiency [11] In 1959, Scott and Griffith identified a normal human erythrocitic enzyme that catalyzed methemoglobin reduction in the pr esence of reduced nicotinamide adenine dinucleotide (NADH). They called this enzy me diaphorase [12]. Following further analyses, this enzyme wa s given additional names, including NADH-dehydrogenase, NADH-methemoglobin reductase, NADH-meth emoglobin-ferricyanide reductase, or NADH-ferricyanide reductase. It was also dem onstrated at this time that a deficiency in this enzyme resulted in hereditary methemogl obinemia. This deficiency was observed in diverse populations including At habaskan Indians (Eskimos) of Alaska [13] and Navajo Indians [14], as well as an isolated commun ity, the blue Fugates living in the BlueRidge Mountains of Kentucky [15]. It wa s later demonstrated that a generalized

PAGE 26

6 deficiency of cb5r occurred in cases of me themoglobinemia with mental retardation. The enzyme may be identical to NADH diaphorase. Leukocytes of patients with neurological disorder lack cb5r, whereas the enzyme is normal in others. [16]. Previously, NADH-cb5r (cb5r) and was shown to be involved, w ith the participation of cytochrome b 5 in methemoglobin reduction within erythr ocytes [17]. The combined cb5r -c b 5 redox system is the most important for the conversion of methemoglobin to hemoglobin in circulating erythrocytes, and the activity of this system is dramatically reduced in the erythrocytes of patients described with enzymopenic hereditary methemoglobinemia, or RCM. Cytochrome b 5 Reductase NADH:Cytochrome b 5 reductase (cb5r, EC 1.6.6.2) is a member of the ferredoxin:NADP + reductase super-family of flavopr otein transhydrogenases [18] which catalyze the transfer of reducing equivalent s between nicotinamide dinucleotides and one electron carriers. Notable members of this family include ferredoxin:NADP + reductase (FNR) [19], plant and fungal NAD(P)H:nitrat e reductase [20], NADPH: cytochrome P450 reductase [21], NADPH:sulphite reductase, phthalate dioxygenase reductase [22], and nitric oxide synthase [23]. The enzyme s found within this flavoprotein family have been demonstrated to possess distinct struct ural domains responsible for flavin-binding and pyridine nucleotide-binding. Cytochrome b 5 reductase catalyzes the single electron reduction of ferricytochrome b 5 to ferrocytochrome b 5 using the reduced pyridine nucleotide NADH as the physiological electron donor. The rate-limiting step in catalysis has been identified as a hydride ion transfer step involving the donation of one proton and two electrons from the nicotinamide moiety of NADH to the oxidized FAD prosthetic

PAGE 27

7 group of cb5r [24]. Additionally, in mammalian species, microsomal and cytosolic cb5r isozymes provide reducing equivalents for a variety of physiologically important metabolic processes that include methemogl obin reduction [17, 25], fatty acid elongation and desaturation [26], cholesterol biosynthesi s [27] and the cytochrome P450-mediated hydroxylations of steroid hormones and xenobiot ics [28], such as the reaction catalyzed by cytochrome P450 3A4 [29] and the reduction of N -hydroxylamine [30]. Recently, it has been shown to be part of the microsomal cytochrome b 5 reductase-cytochrome b 5 pathway directly involved in the reductive detoxi fication of arylhydroxylamine carcinogens in human liver [31]. Cytochrome b 5 reductase is encoded by the DIA1 gene (Figure 1), located on the human chromosome 22q13-qter [33, 34]. It tran scribes two isoforms of cb5r by the use of alternative promoters [16, 35]. Each isoform is localized to separate regions of the cell and thus perform separate functions. The first isoform is the microsomal isozyme generated through the transcrip tion of all 9 exons of the DIA1 gene. The microsomal isozyme comprises 300 amino acid residues with a molecular weight of ~34 kDa. This isozyme, primarily localized to the cytosoli c face of the endoplasmic reticulum, is also found associated with the mitochondrial, nuc lear, and plasma membranes of somatic cells. The amino terminal 25 amino acids of the isozyme are primarily hydrophobic [36, 37] allowing for the microsomal associati on. Additionally, a myristoylation signature sequence has been shown to be present in this 25 amino acid region, believed to be involved in cb5rs membrane association [38]. The microsomal form of the enzyme accounts for the majority of the transcribed prot ein and is responsible for the majority of the electron transfer reacti ons described above, excluding methemoglobin reduction.

PAGE 28

1a1b23456789 35 1a23456789 3 23456789 3 55A.B.C. Membrane-bound cb5r (ubiquitous)Soluble cb5r (erythrocyte) Figure 1. Structure of the Human DIA1 Gene that Encodes Cytochrome b 5 Reductase. The DIA1 gene (A) is composed of exons 1-9 [32]. There are two alternate transcription start sites, 1a and 1b, which yield the two isoforms of cb5r. (B) Represents the membrane-bound cb5r isoform containing exon 1a-9, but not 1b, and consists of 300 amino acids (GAQLCFVF), including the myristoylation signature in exon 1a. (C) Represents the soluble cb5r isoform containing exons 2-9, but not exon 1, and consisting of the 275 amino acids that comprise the diaphorase domain (LFQRCFVF). The second isoform corresponds to the soluble, truncated form of cb5r. It is comprised of only exons 2-9 of the DIA1 gene producing a 275 amino acid residue soluble form of cb5r, having a mass of ~31kDa. It is this form that is found primarily in circulating erythrocytes and is responsible, via interaction with cb5, for the reduction of methemoglobin to hemoglobin [17, 39]. In 1992, it was demonstrated that this truncated isoform is produced by the use of alternative promoter/alternate exons: the full length membrane-binding transcript is generated from an upstream housekeeping promoter, while the erythrocyte transcript originates from a downstream, erythroid-specific promoter [40]. Later, it was shown that the soluble form contains a non-coding new first exon located between the first 2 exons of the human cb5r gene previously identified. In addition, this new first exon shares 62% homology with the first exon and its 3-prime-flanking intron sequences of rat erythroid-specific b5R mRNA, whereas the 5-prime flanking region of the new first exon possesses features of a housekeeping gene [41]. 8

PAGE 29

The mechanism of electron transfer for the soluble form of cb5r from the physiological substrate, NADH and the FAD cofactor of cb5r is shown in Figure 2. In this schematic, two electrons are first transferred from NADH to FAD by a hydride ion NADH + 2cb5(Fe3+) cb5rox(FAD)NAD++ H++ 2cb5(Fe2+) cb5rred (FADH2)A.B.NADH E-FADE-FAD--NAD+ H+e-E-FAD-.NAD+ e-NAD+ (1) Figure 2. Mechanism of Cytochrome b 5 Reductase Mediated Cytochrome b 5 Reduction. (A) represents the chemical reaction (equation 1) catalyzed by cb5r (B) illustrates the mechanism of cb5r transfer where each electron (e ) reduces one molecule of cb 5 [42]. (H ) transfer. The two-electron reduced enzyme-NAD + complex (E-FADH NAD + ) then transfers one electron to each of two separate molecules of cb5 (E-FAD NAD + ), which returns the reduced enzyme to its oxidized state [43]. The reduction of FAD by NADH has been determined to be the rate-limiting step in the electron transfer process catalyzed by cb5r [44-46]. In the porcine variant of cb5r it was also determined that the binding of NAD + stabilized the anionic red semiquinone of FAD [47, 48]. Further studies by Meyer et al. showed that binding of NAD + also modulates the electron transfer to cb5 [49], demonstrating the importance of the anionic red semiquinone form of cb5r (E-FAD NAD + ) in the catalytic process. Recent studies by Iyanagi et al. generated a 9

PAGE 30

new scheme for the electron transfer sequence of cb5r involving the neutral blue semiquinone form and the oxidized enzyme-NADH-NAD + ternary complex (Figure 3) [43]. E-FAD-NADH-NAD+E-FAD-NADHE-FAD-NADH*E-FADH--NAD+NAD+E-FADNADHH-transferNADHE-FAD-NAD+E-FAD---NAD+E-FADH-NAD+e-H+e(i)(ii)(iii)(iv)(v)(vi)(vii)(viii) Figure 3. New Model of the Reaction Sequence of Cytochrome b 5 Reductase. This new model represents the reaction sequence of cytochrome b 5 reductase containing the neutral blue semi-quinone form and the oxidized enzyme-NADH-NAD + ternary complex as intermediates [43]. This scheme involves the following seven-step process: (i) formation of the oxidized enzyme-NADH complex (E-FAD-NADH), (ii) conversion of E-FAD-NADH to a form that has the ability to transfer a hydride ion (E-FAD-NADH), (iii) hydride (H ) transfer from NADH to FAD, (iv) the first one-electron transfer from the two-electron reduced enzyme complex (E-FADH -NAD + ), (v) rapid conversion of the neutral blue semiquinone form (E-FADH -NAD + ) to the anionic red semiquinone form (E-FAD -NAD + ), (vi) the second one-electron transfer from E-FAD -NAD + (vii) formation of the oxidized enzyme-NADH-NAD + ternary complex (E-FAD-NADH-NAD + ) by binding of NADH, and finally (viii) release of NAD + 10

PAGE 31

Recessive Congenital Methemoglobinemia The efficiency of oxygen transport from the lungs to the extremities cannot occur without a properly functioning cb5r cb5 electron transport system. A result of alterations to this system causes a deficiency in methemoglobin reduction and leads to the manifestation of the disease methemoglobinemia. The first sign of the onset of this disease is the characteristic bluish coloration of the skin illustrated in Figure 4. This coloration is common in newborns since the methemoglobin reducing capacity of their erythrocytes is only 50-60% that of an adult and this medical condition is commonly known as blue baby syndrome. The disease can arise from various environmental as well as genetic factors. AB Figure 4. Clinical Indications of Cyanosis as a Result of Increased Levels of Methemoglobin in the Blood (A) This patient has the characteristic darkened or chocolate brown lips, which occurs when methemoglobin levels reach 10-20% total hemoglobin [50]. (B) A patient with drug-induced methemoglobinemia causing the noticeable bluish coloration of the skin (right) [51]. This disease, now classified as recessive congenital methemoglobinemia (RCM, OMIM 250800), arises from defects related to cb5r functionality and was the first disease to be directly associated with enzyme deficiency [52]. The most common cause of 11

PAGE 32

12 recessive congenital methemoglobinemia (RCM) is a deficiency in the function of cb5r. This function is critical since elevated levels of methemoglobinemia give rise to cellular hypoxia, which results in death when levels of methemoglobin reach 70% or greater. Levels of methemoglobin concentration w ith corresponding symptoms are shown in Table II. Individuals with RCM are unable to effectively control the increasing levels of reduced methemoglobin continuously being formed through the deoxygenation of hemoglobin in circulating erythroc ytes. Defects in the expressi on of cb5r give rise to two major clinical-biochemical classifications of methemoglobinemia, simply known as type I and type II, which are classified based on the patient pathophysiology. Type I RCM, exhibited by the majority of patients, is due primarily to a deficiency of the soluble form of cb5r found in circulating erythrocytes. This form of methemoglobinemia is inherited in an au tosomal recessive pattern. Though exhibited worldwide, type I RCM has been shown to be endemic in certain populations including the Athabaskan Alaskans, Navajo Indians, and Yakutsk natives of Siberia. Those individuals with type I RCM have methemogl obin concentrations ranging between 10 to 40%. The predominant symptom of type I RCM is a well-tolerated cyanosis that may result in additional mild complaints such as headaches, fatigue, and shortness of breath during exercise. Life expectancy of these patients is unaffected. Type II RCM represents a significantly more severe form of the disorder and occurs in less than 10-15% of patients where the de fect is attributed to a generalized cb5r deficiency, which includes the membrane-associated form present in somatic cells [3]. Type II RCM results in severe developmenta l abnormalities including mental retardation, microcephaly, opisthotonus, strabismus, and generalized hypertonia often leading to

PAGE 33

13 premature death [12, 53, and 54]. A third form of RCM, type III, which occurs with a substantially lower frequency, has been associated with a deficiency of c b 5 (OMIM 250790) [5]. Table II. Levels of Methemoglobin Concentration and Symptoms. % Methemoglobin Diagnosis 0-3% Normal 3-10% Possible slight discoloration of skin. 10-20% Relatively asymptomatic, cyanosis is prevalent. 30-40% Constant headache, lightheadedness, weakness, and confusion. 40-50% Dyspnea, Lethargy, palpitations. and chest pain. 50-60 Acidosis, arrhythmias, bradycardia, hypoxia, seizures, and coma. >70% Death Both forms of RCM stem from the transcript of one gene, the DIA1 gene, coding for cb5r. Due to this fact, the difference in severity of the resultant phenotypes of type I and type II must be due to the underlying effect that the mutation has on the function of the mature protein. It is because of this that it is believed that patients presenting with the less severe type I methemoglobinemia are pr oducing the gene product at a normal rate, however the resulting protein is unstable. Since mature red blood cells cannot synthesize proteins, they are affected, wh ereas other somatic cells are able to continuously replace the cb5r as it degrades in the cell. Mutations that give rise to type I RCM tend to be single amino acid substitutions. Conversely, in patients expressing type II, mutations in the DIA1 gene tend to introduce premature stops or deletions of amino acids or even an entire exon. These alterations give rise to decreased e xpression or reduced catalytic activity of cytochrome b 5 reductase and the deficiency is ubiquitous. Thus far, about 40

PAGE 34

14 amino acid mutations have been identified within the DIA1 gene giving rise to either type I or type II methemoglobinemia [35, 42, 55-57]. Crystal Structure of Cytochrome b 5 Reductase High resolution crystal stru ctures of the soluble, diaphorase domain of R. norvegicus cb5r have been solved in both the absence (2.0 PDB 1I7P) and presence (2.3 PDB 1IB0) of bound NAD + [58] (Figure 5). The stru ctures possessed a classical two domain arrangement, containing an am ino terminal FAD-binding lobe (amino acid residues I33-R142) and a carboxy-terminal NADH-binding lobe (amino acid residues K172-F300). Residues G148-V171 comprise th e linker or hinge region, a 28 amino acid residue segment that forms a three stranded, anti parallel -sheet demonstrated to be of critical importance in determining correct orientation of the two lobes and modulation of electron transfer between that of the FADand NADH-binding domain [59, 60]. The amino-terminal FAD-binding domain (Figure 6) is comprised of a sevenstranded anti-parallel -barrel, labeled as F 1-F 7, oriented towards the si -face of the flavin isoalloxazine ring and capped by a single -helix found in the FAD-binding domain. A majority of the interactions with the FADprosthetic group occur via the adenine dinucleotide moiety of the flavin and with a long loop of the FAD-binding domain which is comprised of amino acid residues K110-K125 forming a lid and is situated between F 6 and the -helix. The hinge or linker region (Figure 7) is situated between the FAD-binding and NADH-binding domains and is comprised of a three-stranded anti-parallel -sheet structure designated as H 1-H 3. Studies of this linker region by Davis et al. [60]

PAGE 35

15 demonstrated that it is this linker region which is actively involved in properly orienting the FADand NADH-binding lobes of cb5r for efficient electron transfer and suggested that any disruption wi thin the conformation of the -sheet architecture would lead to a significant de crease in catalysis. The NADH binding domain (Figure 8) is composed of a canonical Rossman fold [61] formed by 3 / / layers arranged into a five-stranded parallel -sheet that is oriented towards the re -face of the isoalloxazi ne ring of the FAD prosthetic group. The isoalloxazine ring is the only region of the FADcofactor that forms interactions via hydrogen bonds between the NADH-binding site and the isoalloxazine ring. This occurs through the FAD-binding domain loop strands F 3 and F 4 (amino acid residues P92K110) and the NADH-binding domain N 1-N A (amino acid residues T181-T184). Cytochrome b 5 Reductase Sequence Homology Cytochrome b 5 reductase sequences, or those of closely related homologs, have been identified within the genomes of a di verse array of eukaryotic organisms that include fungi ( M. alpine ) [62], yeast ( S. cerevisiae) [63], plants ( A. thaliana ) [64], nematodes ( C. elegans ) [65] insects ( D. melogaster ) [66], fish ( D. rerio ) [67], amphibians ( X. laevis ) [68], birds ( G. gallus ) [69] and mammals ( R. norvegicus ) [70]. Multiple sequence alignments have revealed extensive primary structure conservation within cb5r homologs with the most diverse sequences, corresponding to those of H. sapiens [71] and P. yoelii [23], retaining approximately 25% sequence identity. Cytochrome b 5 reductase variants have been isolated from a limited number of eukaryotic sources. The major ity of the early studies util ized enzymes isolated from

PAGE 36

Figure 5. The Tertiary Structure of Rat Cytochrome b 5 Reductase. The 2.0 resolution X-ray crystal structure derived from soluble recombinant rat liver cb5r (PDB 1IB0) [58] is illustrated as a schematic model where the red portions represent -helices, the yellow ribbons with directional arrows represent -sheet structures, and the green tubes are indicative of random coils and flexible loop structures. The FAD cofactor (left) and NAD + (right) are shown in stick configurations with standard CPK coloration. 16

PAGE 37

F1FADF1bF6 F1a F2F5LidF3F4 Figure 6. The Structure of the FAD-Binding Domain of Cytochrome b 5 Reductase. A view of the N-terminal FAD-binding domain of rat cb5r (PDB 1IB0) [58] with FAD bound. The re-face of the isoalloxazine ring faces towards the right. FAD is shown in stick configuration with standard CPK coloration. The polypeptide backbone is shown in green with the single -helix in red and -sheets colored yellow and are labeled accordingly. 17

PAGE 38

F6 N1 H1H2H3 Figure 7. The Structure of the Hinge Region of Cytochrome b 5 Reductase. A view of the hinge region of rat cb5r (PDB 1IB0) [58] located between the FAD and NADH-binding domains. The polypeptide backbone is shown in green with the single -helix in red and -sheets colored yellow and are labeled accordingly. 18

PAGE 39

NAD+NDNC N2NBN5N4NAN3N1 Figure 8. The Structure of the NADH-Binding Domain of Cytochrome b 5 Reductase. C-terminal NADH-binding domain of rat cb5r (PDB 1IB0) [58] with NAD + bound. NAD + is shown in stick configuration with standard CPK coloration. The polypeptide backbone is shown in green with the single -helix in red and -sheets colored yellow and are labeled accordingly. 19

PAGE 40

20 either bovine or porcine liver [38 47]. More recently, an array of recombinant expression systems have been developed for the production of several cb5r varian ts that include the soluble, diaphorase domains of the human [73], bovine [74], porcine [43] and rat [75] enzymes. The recombinant forms have been generated using an array of suitable expression vectors which resulted in various amino-terminal modifications, such as the addition of a poly-histidine tag [75] or glutathione S -transferase [76]. All the recombinant cb5r variants have been isolat ed as functional enzymes with a range of NADH:ferricyanide reductase specific activities ( k cat ) that have varied from 368 s -1 for the human enzyme [76] to 1060 s -1 for the bovine variant [74]. Standardization of these kinetic parameters across the various comm only used animal systems, along with additional parameters such as thermal stabil ity, redox potentials, and spectral properties, would be of benefit to univ ersalize the information, there by giving a rational foundation on which further investig ations could be based. Sequence Motifs in the FNR Family of Flavoprotein Oxidoreductases. Through a sequence alignment uti lizing the X-ray crystal stru cture of spinach ferredoxinNADP + reductase [77], a family of flavin-d ependent oxidoreductases have been identified which include: cytochrome b 5 reductase, cytochrome P-450 reductase, methionine synthase re ductase, ferredoxin:NADP + reductase, as well as many others. Of significant interest was the patt ern of conserved residues dete cted within the flavinand nucleotide-binding domains char acteristic of the FNR supe r-family (Figure 9). The structural motif of members of the FNR fam ily is that of a two-domain module with one binding the flavin and the other binding the pyr idine nucleotide. In regards to function,

PAGE 41

21 the FNR family is typically classified by the two electron reduction of a flavin prosthetic group (FAD/FMN) by a pyridine dinucleotide coenzyme (NAD(P)H), followed by the sequential transfer of electrons in one electron reactions with carriers. An additional feature of the proteins found within the FN R super-family is the varying levels of complexity based on the stru ctural domains and modulati on of electron transfer. Cytochrome b 5 reductase and FNR are examples of the simplest members of the FNR family in that they each consist of only tw o domains and reduce mol ecules which are able to bind and then rapidly disasso ciate following electron transfer In contrast, cytochrome P450 reductase, su lfite reductase, and PDR represent more complex enzymes. Although the structures also consist of two domains, the one-electron acceptor molecule is actually fused to the two-domain core by a linker region. Fina lly, the most complex members of the FNR family contain addi tional sequences and prosthetic groups indicative of more than three structural domains. These enzymes include: nitrate reductase and nitric oxide synthase. The conservation of the RxY T S xx S N , G R xx S T , GxGxxP, and CGxxx-M sequence motifs found within the members of the FNR flavoprotein family, clearly demonstrates the importance of these structural motifs towards the interactions of flavincofactor and pyridine nucleoti de binding and utilization. Research Aims and Approaches The general goal of this research was to gain further insight into the roles of the conserved motifs found within cytochrome b 5 reductase that are involved in NADHbinding. To achieve this objective, analyses of the residues directly forming these motifs

PAGE 42

22 Figure 9. Alignment of Conserved FlavinBinding and NADH-Binding Motifs from Various Enzymes Belonging to th e FNR Family of Flavoprotein Transhydrogenases. Each of the published amino acid sequences was obtained from the GenBank protein database [ 78] with the corresponding acce ssion number and reference. The superscripted numbers indicate the amino ac id positions of the first and last residue of each motif within the fulllength sequence of each protein. Abbreviations are: CB5R cytochrome b 5 reductase, NR, nitrate reductase, FNR, ferredoxin:NADP+ reductase, CPR, cytochrome P450 reductase, NOS, n itric oxide synthase, PDR, phthalate dioxygenase reductase, MSR, methionine syntha se reductase, SR, sulfite reductase, FHG, flavohemoglobin, B5B5R, cytochrome b 5 -cytochrome b 5 reductase fusion protein, ETP, electron transfer protein, NDR, naphtha lene dioxygenase reductase, PH, phenol hydroxylase, NFR, NADPH:flavin reducta se, CDPGR, CDP-glucose dehydratase reductase, CMR, p-cymene monooxygenase reductase, XMR, xylene monooxygenase reductase, NMR, nitrotoluene monooxygenase reductase, DQMR, dihydorquinoline monooxgenase reductase, MMOR, meth ane monooxygenase reductase, ADR, anthranilate dioxygenase reduc tase, TDR, toluate dioxygenase reductase, BDR, benzoate dioxygenase reductase, HBDR, hydroxybenzoa te dioxygenase reductase, NQR1, Na + translocating NADH:quinone reductase 1, UNK1, unknown M. loti gene product, UNK2, unknown Halobacterium sp. NRC-1 gene product, HYPR, hypothetical Xanthobacter reductase.

PAGE 43

23 Enzyme Motif 1 Motif 2 Motif 3 Motif 4 GenBank Accession/Ref CB5R 91 RPYTPVS 97 125 GKMS 128 181 GTGIT-P 186 274 CGPPP-M 279 NP_620232 / [34] NR 722 RAYTPPS 728 755 GVMS 758 805 GTGIT-P 810 898 CGPPP-M 903 P23312 / [79] FNR 139 RLYSIAS 145 176 GVCS 179 217 GTGIA-P 222 318 CGLKG-M 323 P10933 / [80] CPR 454 RYYSIAS 460 488 GVAT 491 534 GTGVA-P 539 629 CGDARNM 635 P16435 / [81] NOS 1178 RYYSISS 1184 1214 GVCS 1217 1255 GTGIA-P 1260 1354 CGDVT-M 1359 P29475 / [82] PDR 51 RNYSLSN 57 83 RGGS 87 123 GIGIT-P 128 202 CGPRPLM 208 Q05182 / [22] MSR 478 RPYSCAS 484 514 GVCT 517 573 GTGIA-P 578 677 CGDKANM 683 Q9UBK8 / [83] SR 386 RLYSIAS 392 420 GASS 423 461 GTGIA-P 466 552 CGDANRM 558 P38038 / [84] FHG 204 RQYSLTR 210 227 GQVS 230 268 GVGQT-P 273 362 CGPVGFM 368 P24232 / [85] B5B5R 289 KPYTPVS 295 323 GLFT 326 364 GTGFT-P 369 458 CGPTPFT 464 NP_596918 / [86] ETP 56 RCYSITS 62 80 GRVS 83 120 GSGIA-P 125 203 CGPEPFM 209 BAA12809 / direct submission NDR 142 RPYSMAG 148 165 GRVT 168 206 GTGLA-P 211 295 CGAPA-M 300 AAD02134 / [87] PH 149 RAFSLAN 155 173 GAAT 176 214 GSGLSSP 220 306 CGPPP-M 311 AAA25944 / [88] NFR 58 RPFSMAS 64 77 GASE 80 123 GTGFSYA 129 212 AGRFE-M 217 AAN83224 / [89] CDPGR 141 RSYSIAN 147 164 GQMS 167 204 GTGFA-P 209 292 CGSPV-M 297 P26395 / [90] CMR 159 RSYSFAN 165 185 GEFT 188 225 GSGLA-P 230 315 CGPPP-M 320 AAB62300 / [91] XMR 160 RSYSFAT 166 184 GIFS 187 224 GTGLA-P 229 315 CGPPP-M 320 AAB70826 / direct submission NMR 161 RSYSFSA 167 185 GVFS 188 225 GTGLA-P 230 316 CGPPP-M 321 AAC38360 / [92] DQMR 155 RSYSPSS 161 179 GAMS 182 221 GTGLA-P 226 310 CGPQP-M 315 CAA73201 / [93] MMOR 159 RSYSPAN 165 183 GRFS 186 224 GTGLA-P 229 314 CGPPG-M 319 P22868 / [94] ADR 154 RSYSFAN 160 178 GVMS 181 218 GTGLS-A 223 307 CGPPP-M 312 AAC34815 / [95] TDR 153 RAYSFSS 159 176 GLMS 179 216 GTGLA-P 221 304 CGPPP-M 309 AAD31449 / direct submission BDR 166 RSYSFSS 172 189 GKMS 192 229 GTGIA-P 234 317 CGPVP-M 322 P07771 / [96] HBDR 152 RAYSYSS 158 175 GKMS 178 215 GTGLA-P 220 305 CGPPP-M 310 Q51603 / [97] NQR1 222 KAYSLAS 228 259 GVCS 262 298 GAGSSFG 304 401 CGPPLHN 407 Q9Z723 / [98] UNK1 168 RLYLVST 174 201 GSSP 204 383 GIGIT-P 388 471 SGPQA-M 476 NP_107088 / [99] UNK2 51 RYYTLSS 57 102 GEPS 105 112 GPGVG-P 117 188 CGAATDA 194 NP_279534 / [100] HYPR 142 RAYSVAN 148 166 GAGT 169 207 GSGLA-P 212 297 AGPAP-M 302 CAA09916 / [101] Consensus RxY T S xx S N Gxx S T (FAD) Rxx S N (FMN) GxGxxP CGxxx-M

PAGE 44

24 as well as naturally occurring methemoglobinemia variants which occur in proximity to these motifs were investigated. This was car ried out by determining desired mutations of the residues under consideration. The desired va riants were then gene rated utilizing sitedirected mutagenesis of an affinity-tagged R. norvegicus cytochrome b 5 reductase construct [102]. Each cb5r va riant generated was then subs equently characterized using biophysical, potentiometric, and enzymological techniques. Additional insight was obtained through comparison of enzymatic properties of the wild type isoform of R. norvegicus cytochrome b 5 reductase to that of C. familiaris. The initial specific aim was to generate an expression constr uct of the canine variant of cytochrome b 5 reductase and compare the biophysical and enzymological properties of the resultant recombinant enzyme to those of the previously established rat isoform. Completion of a survey sequence of the canine (boxer) ge nome [103] resulted in the identification of two putative cb5r sequences based upon sequence conservation with the products of the human and mouse genomes. Analysis of the two sequences indicated the putative protei ns had equivalent carboxyl-termini. However, the aminoterminal sequences exhibited marked heter ogeneity to other mamma lian cb5r sequences. The generation and expression of a full le ngth canine cb5r cDNA containing the membrane associated amino acids was carried out to investigate the discrepancies in the sequence homology between the canine va riants reported in GenBank (XM_531708, ENSCAFP000000000953) and that of the rodent and human sequences, thus confirming the primary sequence of the canine variant. Additionally, a viable protein containing only the 275 amino acid catalytic diaphorase do main of the canine isoform was generated and purified to homogeneity to investigate the structural and functional parameters of the

PAGE 45

25 canine cb5r and compare the results to those of the rodent isoform. The second specific aim was directed at the elucidation of the roles of two residues, tyrosine 112 (Y112) and glutamin e 210 (Q210), in the correct binding and orientation of NADH to cb5r and thereby correct function of the enzyme. Through the analysis of the crystal structure of cytochrome b 5 reductase (PDB 1IB0) it was shown that these two residues are found on opposite sides of the binding cleft for NADH and that each of these residues formed a hydrogen bond interaction with the pyrophosphate backbone of NAD + Because of this, it was hypothesi zed that the residues would act to properly orient and anchor the NADH into position for efficient electron transfer. Additionally, two naturally occu rring type I RCM variants are found in proximity to these residues, with one variant located near e ach residue. The variants, T116S and E212K, have both been detected in patients with RCM Upon inspection of the crystal structure of cb5r, each of these residue s were found on the external su rface of the protein and did not interact with either the flavin or NAD H environments. Thus, we proposed that the effects of these mutations were likely to be m oderate in nature and occur as a result of effects on nearby residues and structures. In order to better unders tand the causation of the pathology of these RCM variants, as well as the roles played by the nearby pyrophosphate associated residues, a series of variants were generated and analyzed for their effects on various functional parameters. Specific aim three focused on th e highly conserved NADH-binding motif 180 GxGxxP 185 Analysis of the crystal structure of cb5r allowed for visualization of the importance of this motif in the proper orientat ion of the NADH substrate. This motif is located at the N-terminus of the 16-residue helical segment N 1. The leading three

PAGE 46

26 residues, along with the preceding residue G 179, form a compact segment that effectively reverses the direction of the polypeptide backbone, generating a flattened surface against which the NAD + can reside. The two conserved glycine residues, corresponding to G180 and G182, participate in hydrophobic contacts with the ni cotinamide portion of the pyridine nucleotide substrate, while th e intervening residue, T181, forms a hydrogen bond interaction with the nico tinamide ribose. T181, togeth er with residue P185, also contributes to the hydrophobic interactions of the environment surrounding the isoalloxazine ring of the FAD cofactor, with which residue T184 forms two hydrogen bonds. The high level of interact ion of the residues of this mo tif with both the cofactor and substrate suggest a pivotal role for this motif in the proper functioning of cb5r. Additionally, the preceding residue, G179, s hows a high level of homogeneity amongst FNR family members, suggesting it too has a critical role in th e association of NADH with cb5r. To further access the importa nce of this region of cb5r, the naturally occurring type I RCM mutants A178T a nd A178V were also characterized. The fourth specific aim of this rese arch involved the investigation of the conserved 273 CGxxxM 278 motif which is located w ithin the NADH-binding domain of cb5r and is involved in the regulation of NADH-binding. While the residues comprising this motif do not form any direct electr ostatic or hydrogen bond c ontacts with the bound NAD + the residues form a loop that provid es an extensive framework of hydrophobic contacts that could orient the nicotinamide portion of the reduced pyridine nucleotide for subsequent efficient hydride transfer to the FAD prosthetic group. Residue C273 has been suggested to be important in facilitating elec tron transfer or in maintaining proper NADH-binding and orientation (104 ). The conserved glycine of the motif, corresponding

PAGE 47

27 to G274, forms two critical hydrogen bonds with bound NAD + Previous studies have been conducted giving additional preliminary insight into the role this motif may play. Analysis of the type II RCM variant M272de monstrated that the proper placement of this motif is vital to the proper functioning of the enzyme and the analysis of the type I RCM variant P275L suggested that, at least in part, this motif func tions as a scaffold around which NADH lays for proper orientation [105]. These initial findings suggested that the 273 CGxxxM 278 motif is essential in proper orientation of the NADH substrate to facilitate proper electron tran sfer. By analyzing additional variants of these residues, a clearer picture could be obtai ned as to the function that these residues contribute.

PAGE 48

28 2. MATERIALS & METHODS MATERIALS Molecular Biology Reagents Restriction enzymes were purchased from New England Biolabs (Beverly, MA). Plasmid preparation and agarose gel extraction kits were purchased from Qiagen Inc. (Valencia, CA). Oligonucleotide primers were obtained from Integrated DNA Technologies (Coralville, IA). Native Pfu and Pfu Turbo Polymerases and Epicurian coli BL21(DE3)-RIL cells were obtained from St ratagene (La Jolla, CA). The pET-23b vector was purchased from Novagen (Madis on, WI). T4 DNA ligase was purchased from Promega (Madison, WI). Rapid DNA lig ation kits were purchased from Roche Scientific (Palo Alto, CA). Triton X-100 and Hot Start Micro 50 PCR tubes were obtained from Molecular-Bio Products Inc. (San Diego, CA). DMSO and pCMB were obtained from Sigma Chemical Co. (St. L ouis, MO). The Molecular Biology Core Facility at the H. Lee Moffitt Cancer Center and Research Institute performed nucleotide sequencing. Microbiology and Protein Purification Reagents Plastic and glassware were purchased from Fisher Scientific (Pittsburg, PA), VWR International (Suwannee, GA), and Midwest Scientific (St. Louis, MO). Tryptone

PAGE 49

29 and yeast extract were obtained from EM Science (Gibbstown, NJ) and Ultrol grade MOPS buffer was purchased from Calbiochem (La Jolla, CA). IPTG and Ampicillin were obtained from Research Products International (Mt. Prospect, IL). Ni-NTA agarose was purchased from Qiagen Inc. (Valencia, CA). PMSF was purchased from Sigma Chemical Co. (St. Louis, MO). Enzyme Assay and Spectroscopy Reagents Chemicals including NADH, NAD + 5-ADP-agarose, 2-ADP, ADP-ribose, AMP, a-NAD + e-NAD + APAD + APHD + NADPH, NHD + nicotinamide; NMN + oNAD + PCA, PCAAD + PAAD + PMSF, TNAD + K 3 Fe(CN) 6 glucose, FAD, bovine serum albumin, potassium phosphate, riboflavin, ferric citrate, trifl uoroacetic acid and Tris base were purchased from Sigma Chemical Co. (St. Louis, MO). Tetrahydronicotinamide adenine dinucleotides (H 4 -NAD and H 4 -NADP) were synthesized according to the protocol descri bed by Murataliev and Feyereisen [106] by bubbling molecular hydrogen through a stirred solution of 100 mM NAD + or NADP + contained in 50 mM Tris-HCl buffer, pH 8.0, in the presence of palladium catalyst (5 mg/mL). Sinapinic acid (3,5-dimethoxy-4hydroxy cinnamic acid) was purchased from Aldrich Chemical Co. (Milwaukee, WI).

PAGE 50

30 METHODS Protein Expression and Purification Expression of the wild-type and mutant c b 5 r or NCR variants were accomplished using E. coli BL21(DE3)-RIL cells harboring eith er the pH4CB5R [1 02], or mutant constructs. Cells were grown aerobically in TB media supplemented with riboflavin (100 M), ferric citrate (100 M), and ampicillin (125 M) overnight at 37 C, and recombinant protein expression was induced by addition of IPTG (0.4 mM) followed by an additional 6-8 h incubation at 25 C. The cells were pell eted by centrifugation (5000xg, 10 min.), resuspended in lysis bu ffer (50 mM Tris-HCl, containing 300 mm NaCl and 5 mM imidazole, pH 8.0) and disrup ted by sonication in the presence of PMSF (1.2 mg/ml). Lysates were clarified by centrifugation (30,000xg, 30 min.) at 4 o C followed by incubation with Ni-NTA agarose with gent le agitation (1 ml matrix/10 ml lysate) for up to 1h at 4 C. The His-tagged-(c b 5 r or NCR)-Ni-NTA matrix suspension was collected by centrifugation (1000xg, 5 min.), washed twice with 25 mM phosphate buffer, containing 300 mM NaCl and 5 mM imid azole, pH 8.0 and transferred to a chromatography column (2.5 x 10 cm). Bound proteins were eluted with 25 mM phosphate buffer, containing 300 mM NaCl and 250 mM imidazole, pH 8.0. Fractions were pooled, assayed for NADH:FR activity a nd concentrated centr ifugally using 10,000 MWCO concentrators (Fischer Scientific, Pittsburg, PA). Fi nal purification was achieved by size-exclusion FPLC using either a Superdex 75 or Superdex 200 column (1 x 30 cm) equilibrated with 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. Fractions exhibiting NADH:FR activity were p ooled, concentrated, beaded and stored

PAGE 51

31 under liquid N 2 until required. Wild -type NCR concentrations were estimated using 413nm = 130 cm -1 mM -1 and wild-type c b 5 r concentrations were estimated using 461nm = 10.6 cm -1 mM -1 The recombinant soluble, heme domain of rat cytochrome b 5 was produced as described by Beck-von Bodman et al ., [107] using an expre ssion construct provided by Dr. Steven Sligar (University of Illinois, Urbana, IL). Briefly, E. coli BL21(DE3) cells harboring the pUC18 expression construct, which contained a codon-optimized gene encoding the soluble heme-containing domain of rat c b 5 were grown overnight at 37 C in TB medium supplemented with ferric citrate (100 M) and ampicillin (125 M). Protein expression was induced at 25 C by addition of IPTG (0.4 mM), and the cells were harvested 8 hours later by centrifugation, yielding pink pellets. Lysis of the cells was achieved as described for c b 5 r. During fractionation of the cleared lysate, however, c b 5 was precipitated by 95% (w/v) (NH 4 ) 2 SO 4 The pellet was resuspended in the minimum volume of low ionic strength phosph ate buffer and dialy zed twice against a large volume of the same buffer before separation on DE52 anion exchange chromatographic media. Elution was achieved by a gradient of 0-1M NaCl before final purification by FPLC on a Superdex 75 10/30 HR column. Red fractions containing c b 5 protein were pooled, concentrated, beaded, and stored under liquid N 2 SDS-polyacrylamide gel electrophoresis was performed as described by Laemmli [108] using 12.5% acrylamide/bis-acrylamide gels. 2-5 g of protein was solubilzed in up to 30 L of SDS loading buffer (10 mM Tris-H Cl, pH 6.8, containing 1% SDS, 10% glycerol, 1 mM DTT, and 0.1% bromophenol blue) by boiling in water for 5 minutes before loading the gel. Gels were run at 150 volts in SDS running buffer (25 mM Tris-

PAGE 52

32 HCl, pH 8.3, containing 192 mM glycine, 0.1% SDS) until the blue dye front traversed the gel. Gels were stained with Coomassie Brilliant Blue dye to visualize protein bands. Site-directed Mutagenesis The pH4CB5R [102] expressi on construct was specifica lly mutagenized using a modification of the Stratagene QuikChange (La Jolla, CA) protocol. Mutagenic Oligonucleotide Primer Design Complimentary oligonucleotide primer s (30-40 mers) containing the desired codon change as well as a silent mutation (e ither inserting or deleting a restriction enzyme recognition sequence) were designed using the Primer Generator program ( http://www.med.jhu.edu/medcenter/primer/primer.cgi ) [109]. The sense strand annealing primers used in the construction of the various mutant proteins are listed in Appendices A, B and C. Vector Polymerase Chain Reaction Vector PCR was performed using Pfu Turbo polymerase (1.25 units) in the presence of cloned Pfu buffer (20 mM Tris-HCl, pH 8.8 containing 2 mM MgSO 4 10 mM KCl, 10 mM (NH 4 ) 2 SO 4 0.1% Triton X-100, and 0.1 mg/ml nuclease-free BSA) containing 10 ng vector DNA (p H4CB5R or pH6NCR), 125 ng of each synthetic primer, 5% DMSO, and 200 M dNTPs with cycling parameters (20 cycles) of 1 min at 94 C, 1 min at 55 C, 10 min at 68 C. DpnI restriction enzyme was adde d directly to the cooled PCR reaction tube following the PCR cycling reaction to cleave only the methylated

PAGE 53

33 template DNA. This step greatly reduced the percentage of wild-type background transformants. PCR products were subsequently purified using th e Qiagen PCR Cleanup Kit. Products were eluted in 30 L of sterile elution bu ffer and stored at -20 C until ready for use. Preparation of Competent Cells and Linear DNA Transformation Competent E. coli DH5 cells were prepared according to the protocol by Yuckenberg et al. [110] for storage at -70 C. In brief, an overnight culture of bacteria, grown in LB, was used to inoculate a fresh 250 mL culture. The culture was incubated with shaking until an O.D. 600nm of approximately 0.9 was reached. Cells were then harvested by centrifugation at 0 C and washed in a solution of ice-cold 100 mM MgCl 2 Cells were again harvested and re suspended in ice-cold 100 mM CaCl 2 where they were then incubated on ice for 90 minutes. Cells were finally harvested and resuspended in 85 mM CaCl 2 containing 15% glycerol before being snap frozen in liquid N 2 and stored at -80 C prior to use. This protocol was also used for the preparation of all other competent E. coli strains. Competent E. coli DH5 cells were transformed w ith linear DNA constructs according to the protocol provided with the Quikchange Mutagenesis Kit (Stratagene) Frozen cells were thawed slowly on ice and 50 L aliquots were transf erred to sterile 15 mL polypropylene conical tubes ma intained on ice. Up to 10 L of the purified linear DNA construct was mixed carefully with the cells by swirling the pipette tip as the DNA was expelled. The mixture was then incubate d on ice for 20 minutes before being heat-

PAGE 54

34 shocked at 42 C for 45 seconds and then returned to ice for 2 more minutes. Finally, 1 mL of SOB media was added and the cells were allowed to recover for 1 hour at 37 C with gentle shaking before being plat ed on the appropriate selection media. Mutagenic Screen by DNA Restriction Digest Following overnight incubation at 37 C on ampicillin-containing SOB-agar plates, colonies were subcultu red into 5 mL of liquid SOB media, containing ampicillin (125 M). Clones were analyzed and screened fo r the silent mutations, introduced during mutagenesis, by restriction enzyme digesti on using the appropriate enzymes listed in Table 3 and 4. Each digest was separated using polyacrylamide gel electrophoresis or agarose gel electrophoresis and the restric tion pattern visualized by ethidum bromide staining of the gel. Figure 14 illustrates the result of a typical gel observed during screening of mutants. Muta nt constructs exhibiting th e predicted pattern that differentiated them from the wild-type cons truct were verified by nucleotide sequencing in both the forward and reverse directions. Positive constructs were subsequently used to transform competent E. coli BL21(DE3)-RIL cells to pro liferate the generation of the mutant enzymes. Homology modeling The structure of the canine cb5r variant and point mutation vari ants of rat cb5r were generated using the automated comp arative protein modeling server SWISSMODEL [111] utilizing the first approach mode since the query sequence and the templates shared an average of 95.6% sequen ce identity. The X-ray coordinates of rat

PAGE 55

35 cb5r (PDB ID: 1IP7; 90. 7% identity) and rat cb5r complexed with NAD + (PDB ID: 1IB0) [58] t ogether with those of the erythrocytic form of H. sapiens cb5r (PDB ID: 1UMK; 92.9% identity) [112] were used as templates. The modeling results were analyzed using the program What If to veri fy the fidelity of the calcul ated structure [113], and were visualized using the molecular modeli ng software Web Lab Viewer Pro [114]. Ultraviolet and Visible Absorbance Spectroscopy Absorbance spectra in the far (190-250 nm) and near UV (250-350 nm), visible (360-750 nm), and near IR (750-1000 nm) wave length range were obtained for wild type and mutant enzymes using a Hewlett Packard (Agilent Technologies, Palo Alto, CA) 8453 diode-array spectrophotometer u tilizing micro-cuvettes of 200 L capacity and with 1 cm path length. Ultraviolet and Visible Circu lar Dichroism Spectroscopy UV and visible CD spectra were obta ined using a JASCO (Easton, MD) J710 spectropolarimeter calibrated for both signal intensity and wavelength maxima using an aqueous solution of d-10-camphosulfonic acid [115]. UV CD spectra were obtained in 10 mM phosphate buffer, containing 0.1 mM EDTA pH 7.0 using a cylindrical quartz cell of 0.1 cm path length (300 l total volume) while visible CD spectra were obtained in 10 mM MOPS buffer, containing 0.1 mM EDTA, pH 7.0 using a 1 cm path length cell (90 l total volume). All spectra were corrected for the appropriate buffer contributions and are expressed in terms of molar ellipticities (M -1 cm -1 ).

PAGE 56

36 Fluorescence Spectroscopy Fluorescence spectra were obtained using a Shimadzu Scientific Inst. Inc. RF5301PC spectrofluorophotometer. Excitation and emission spectra were obtained using a slit width of 3 nm and emission and exci tation wavelengths of 520 nm and 450 nm, respectively. Following acquisition of the wild type and mutant spectra, the enzymes samples were heated to 100 o C for 30 min, centrifuged to rem ove protein aggregates and the corresponding spectra for the liberated F AD were subsequently recorded. All spectra were corrected for the appropriate buffer contribution. Steady-State Enzyme Activities NADH:FR and NADH:CR activitie s were determined at 25 C under conditions of constant ionic strength and pH in 116 mM MOPS buffer ( = 0.05), containing 0.1 mM EDTA, pH 7.0, while NADH:BR activ ities were determined at 25 C under conditions of constant ionic strength and pH in 10mM potassium phosphate buffer ( = 0.01), containing 0.1mM EDTA, pH 7.0. NADH:FR activities were typically determined as the decrease in absorbance at 340 nm in the presence of NAD(P)H (250 M) and ferricyanide (500 M). NADH:BR activity was determined as the increase in absorbance at 423 nm in the presence of NADH (250 M) and rat c b 5 (30 M). All substrates were quantitated spectroscopically using the established calculated molar extinction coefficients for NADH, H 4 NAD, NAD + c b 5 2-5, and ADP-ribose (Siegel 1959, Beck von Bodman 1986, The Merck Index 1989, Muratali ev 2000). Activities are expressed as initial rates for the oxidation of NAD(P)H ( mol of NAD(P)H consumed/min/nmol FAD). Initial rate data at varying NAD(P)H, ferricyanide, or c b 5 concentrations were

PAGE 57

37 analyzed using the software ENZFIT (Els evier Biosoft, Fergus on, MO) to determine apparent k cat and K m values. Spectral Binding Constant Determin ation by Differential Spectroscopy Spectral binding constants, K s for various NADH analogs were determined by differential spectroscopic titrations as described by Sancho and Gomez-Moreno [116] and Barber et al [117]. A Shimadzu UV2501-PC was used to measure the difference spectra of samples in matched split -cell quartz cuvettes with 0.439 cm pathlength and 2.5 ml capacity. Enzyme and NADH analogs were suspended in 10mM phosphate buffer, pH 7.0, containing 0.1mM EDTA for all spectral dete rminations. All analog concentrations were determined spectrophotometrically using previously published extinction coefficients. The reference cuvette contained 50 M enzyme (as determined by FAD concentration) in the front compartment and analog-titrated buffer in the rear compartment. The sample cuvette co ntained analog-titrated enzyme (50 M) in the front compartment and buffer in the rear compartm ent. The appropriate buffer was added to the enzyme compartment of the reference c uvette to correct for the dilution caused by analog addition to the enzyme compartment of the sample cuvette. Following sample addition, each compartment was stirred brie fly to insure thorough mixing. Spectra were then recorded over the wave length range from 300-800 nm de pending on the titration. The magnitude of the absorbance change was determined for each spectrum via peak to trough subtraction in order to compensate for any baseline drift between spectra.

PAGE 58

38 Absorbance changes were plotted versus nucle otide concentration and the resulting plots were fit to the hyperbolic equation: Absorbance = Absorbance max *[nucleotide] / [ K s + (nucleotide)] in order to determine the spectral binding constant ( K s ), which was defined as the concentration of analog at which half maximal spectral perturbation was observed. Thermal Stability Measurements Thermal stabilities of wild type and mutant enzymes were determined as described by Trimboli et. al [93] by monitoring both the re lease of the FAD prosthetic group, as indicated by the change in flav in fluorescence, and the loss of NADH:FR activity over the temperature range from 0-100 C. Determination of Flavin Midpoint Potential Flavin oxidation-reduction midpoint potentials were determined by dye equilibration using the method of Massey [118]. Xanthine (30 M) and xanthine oxidase (50 nM) were used to reduce a mixture of enzyme (40 M FAD) and the indicator dye, phenosafranine (15 M, E 0 = -252mV) in 100 mM phosphat e buffer containing 0.1 mM EDTA, first made anaerobic by repeated evac uation and flushing with oxygen-free argon. Benzyl viologen (6 M) and methyl viologen (1 M) were included to facilitate equilibration of the system. Visible absorbance spectra were collected over the course of each 3-hour equilibration. Flavin reduction was monitored at 410 nm while phenosafranine reduction was monitored at 530 nm. E 0 values were calculated by

PAGE 59

39 graphical analysis of the plot [log (ox)/(red)] phenosafranine versus [log (ox)/(red)] FAD using the published midpoint potential of phenosafranine of mV [117].

PAGE 60

40 3. RESULTS AND DISCUSSION Expression and Characterization of a F unctional Canine Variant of Cytochrome b 5 Reductase Cytochrome b 5 reductase sequences have been id entified within the genomes of a diverse array of eukaryotic organisms rangi ng from fungi and pl ants to insects and nematodes to several different vertebrates. Multiple sequence alignments demonstrated extensive primary structure conservation am ong these sequences. Of these various genomes, only a limited number have had the cb5r variant isolated. The human, bovine, porcine, and rat enzyme variants have been developed into recombinant expression systems, all of which have been isolated as functional enzymes with a range of NADH:ferricyanide reductase specific activities ( k cat ) that have varied from 368 s -1 for the human enzyme [76] to 1060 s -1 for the bovine variant [74]. Within the pharmaceutical industry, dogs re present the most extensively utilized non-rodent species in preclinical xenobiotic safety studies. However, little information is generally available concerning either the sp ecific metabolic roles of various enzymes within the species or evaluative studies that compare and contrast the specific activities of individual enzymes with their human or mo re frequently studied rodent orthologs. Completion of a survey sequence of the canine (boxer) genome [118] has resulted in the identification of two putative cb5r sequences based upon sequence conservation

PAGE 61

41 with the products of the hu man and mouse genomes. Automa ted computational analyses using GNOMON identified an ORF of 1441 bp on chromosome 10 encoding a 355 residue protein (GenBank XM_531708) while Ge neWise identified an ORF of 906 bp coding for 301 amino acid residues (Ensemble ENSCAFP 00000000953 ). While both sequences indicated the putativ e proteins retained equivale nt carboxyl-terminal residues, the amino-terminal sequences exhibited marked heterogeneity with little similarity to other mammalian cb5r primary structures. To confirm the primary structure of a can ine variant of cb5r and to compare and contrast the functional properties of a recombin ant form of the enzyme with those of the corresponding rat enzyme, we have cloned, expressed and characterized the soluble diaphorase domain of canine cb5r from beagle lung tissue. Alignment of fifty, full-length translat ed amino acid sequences deposited in GenBank [119] that embrace known members of the cb5r flavoprot ein family from a variety of diverse organisms indicated that seven sequences, corresponding to those from mammalian (human, monkey, steer, pig, rat a nd mouse) and avian (chicken) sources encompassed a group of conserved sequences that comprised 301 residues with aminoand carboxyl-terminal sequences of MGAQLS and R M C R F A V T F, respectively. In contrast, predicted primary structures availa ble for canine variants of cb5r suggested amino and carboxyl-terminal sequences of MSLHLF and RCFAF (XM_531708) and MGLSLS and RCFAF (ENSCAFP00 00000000953 ), respectively. To accurately define the primary structure of canine cb5r, we constructed the oligonucleotide primers shown in Table 3, that corresponded to the various predicted amino-terminal sequences and the conserved carboxyl-termi nal sequence. Extensive PCR an alyses revealed that an

PAGE 62

appropriately sized product of approximately 906 bp could only be obtained using Primers 3 and 4, indicating MGAQLS and RCFAF to be the correct aminoand carboxyl-terminal sequences, respectively, of the microsomal variant of canine cb5r. Table 3. Oligonucleotide primers used to amplify the full-length canine cb5r cDNA sequence. Primer Sequence a 42 1 5A CCC ATG TCC CTG CAC CTC TTC CAT CTC CAG -3 NMet Ser Leu His Leu Phe His Leu Gln 2 5CGC CAC ATG GGT CTG TCC TTG TCA TTT CAG -3 NMet Gly Leu Ser Leu Ser Phe Gln 3 5CAC ATG GGG GCC CAG CTG AGC ACG -3 NMet Gly Ala Gln Leu Ser Thr 4 5GC TTC GCC TTC TGA TGG CCA GGC GC -3 NCys Phe Ala Phe *** a Additional nucleotides were included in the primers as either 5 or 3 extensions for PCR purposes. To confirm the full-length canine cb5r cDNA sequence, the ~906-bp PCR product was purified and sequenced in both the forward and reverse directions and yielded the nucleotide sequence shown in Figure 10. The translated amino acid sequence indicated a full-length protein comprising 301 residues that exhibited marked sequence similarity to the corresponding human (92.7% similarity) and rat (89.7% similarity) cb5r variants. Following the successful cloning of the full-length canine cb5r cDNA, further rounds of PCR utilizing the primers described in Methods were used to construct an appropriate pET-based expression vector for the production of a six-histidine-tagged variant of the soluble, diaphorase domain of the enzyme using an identical strategy to that

PAGE 63

43 Figure 10. Complete nucleotide sequence of canine cb5r The cDNA sequence corresponding to the 903-bp full-length, membrane-associated form of canine cb5r ( Cf ) is shown together with the corresponding deduced amino acid sequence. Also shown are the corresponding human ( Hs ) and rat ( Rn ) cb5r primary sequences (GenBank accession numbers P00387 and P20070). Amino acid residues that are not conserved between the three sequences are indicated in red. The amino-terminal myristylation signature sequence is shown in italic s while the conserved flavoprotein transhydrogenase sequence motifs that are involved in either flavinbinding and selectivity or NADH bi nding, are shown underlined. Also shown underlined in bold italics is residue I33 which corresponds to the initial residue used for heterologous expression of the histidine-tagged soluble diaphorase domain in E. coli For consistency, amino acid residues are numbered beginning w ith the amino-terminal residue of the mature protein (G1).

PAGE 64

44 1 atgggggcccagctcagcacgctcggccacgtggtcctctccccagtctggttcctctat 60 Cf M G A Q L S T L G H V V L S P V W F L Y 19 Hs M G A Q L S T L G H M V L F P V W F L Y Rn M G A Q L S T L S R V V L S P V W F V Y 61 aacctgctcatgaagctgttccagcgctcgaccccggccatcacccttgagagcccggac 120 Cf N L L M K L F Q R S T P A I T L E S P D 39 Hs S L L M K L F Q R S T P A I T L E S P D Rn S L F M K L F Q R S S P A I T L E N P D 121 atcaagtacccactgcggctcatcgacaaggaggttatcaaccatgacacccggcggttc 180 Cf I K Y P L R L I D K E V I N H D T R R F 59 Hs I K Y P L R L I D R E I I S H D T R R F Rn I K Y P L R L I D K E I I S H D T R R F 181 cgcttcgctctgccgtcgccccagcacatcctgggcctcccagtcggccagcacatctac 240 Cf R F A L P S P Q H I L G L P V G Q H I Y 79 Hs R F A L P S P Q H I L G L P V G Q H I Y Rn R F A L P S P Q H I L G L P I G Q H I Y 241 ctctcagctcggatcgatggaaacctggtcattcggccctacacgcccgtctccagtgac 300 Cf L S A R I D G N L V I R P Y T P V S S D 99 Hs L S A R I D G N L V V R P Y T P I S S D Rn L S T R I D G N L V I R P Y T P V S S D 301 gatgacaaaggctttgtggacctggtcatcaaggtttacttcaaagacacccatcccaag 360 Cf D D K G F V D L V I K V Y F K D T H P K 119 Hs D D K G F V D L V I K V Y F K D T H P K Rn D D K G F V D L V V K V Y F K D T H P K 361 tttcctgctggagggaagatgtcccagtacctggaaagcatgaagattggagacaccatt 420 Cf F P A G G K M S Q Y L E S M K I G D T I 139 Hs F P A G G K M S Q Y L E S M Q I G D T I Rn F P A G G K M S Q Y L E N M N I G D T I 421 gagttccggggcccgaatggactgctggtctaccagggcaaaggaaagtttgccatccgt 480 Cf E F R G P N G L L V Y Q G K G K F A I R 159 Hs E F R G P S G L L V Y Q G K G K F A I R Rn E F R G P N G L L V Y Q G K G K F A I R 481 ccagacaagaagtccaaccccatcatcaagacggtgaagtctgtcggcatgatcgccgga 540 Cf P D K K S N P I I K T V K S V G M I A G 179 Hs P D K K S N P I I R T V K S V G M I A G Rn A D K K S N P V V R T V K S V G M I A G 541 ggaaccggcatcaccccgatgctgcaggtgatccgtgccatcatcaaagacccacacgac 600 Cf G T G I T P M L Q V I R A I I K D P H D 199 Hs G T G I T P M L Q V I R A I M K D P D D Rn G T G I T P M L Q V I R A V L K D P N D 601 cccaccgtgtgccacctactatttgccaaccagactgagaaggacatcctgctgcggccc 660 Cf P T V C H L L F A N Q T E K D I L L R P 219 Hs H T V C H L L F A N Q T E K D I L L R P Rn H T V C Y L L F A N Q S E K D I L L R P 661 gagctggaggaactgcggaatgaacattctgctcgcttcaagctctggtacacagtggac 721 Cf E L E E L R N E H S A R F K L W Y T V D 239 Hs E L E E L R N K H S A R F K L W Y T L D Rn E L E E L R N E H S S R F K L W Y T V D 721 aaagccccagaagcctgggactacagccagggcttcgtaaatgaagagatgatccgggac 780 Cf K A P E A W D Y S Q G F V N E E M I R D 259 Hs R A P E A W D Y G Q G F V N E E M I R D Rn K A P D A W D Y S Q G F V N E E M I R D 781 caccttccacctccagaggaggagccgctgatactgatgtgtggacccccgcccatgatc 840 Cf H L P P P E E E P L I L M C G P P P M I 279 Hs H L P P P E E E P L V L M C G P P P M I Rn H L P P P G E E T L I L M C G P P P M I 841 cagtatgcctgcctgcccaacctggaccgcgtgggccaccccaaggagcgctgcttcgcc 900 Cf Q Y A C L P N L D R V G H P K E R C F A 299 Hs Q Y A C L P N L D H V G H P T E R C F V Rn Q F A C L P N L E R V G H P K E R C F T 901 ttctga Cf F 300 Hs F Rn F

PAGE 65

previously developed for production of the corresponding histidine-tagged rat cb5r diaphorase domain [102]. The Cfh 6 cb5r plasmid encoding the soluble, diaphorase domain of canine cb5r, corresponding to residues I33 to F300, was used to transform E. coli BL21(DE3)-RIL cells The cells were disrupted by sonication and the canine cb5r purified to homogeneity by a combination of metal-affinity chromatography and gel filtration FPLC as previously described [102]. Evaluation of the expression yield of the diaphorase domain (Table 4) indicated that the protein was very efficiently expressed yielding approximately 32 mg of purified protein per L of bacterial culture, which represents the highest level of Table 4. Purification of canine cb5r. a units = moles NADH consumed/min. Fraction Total Protein (mg) Volume (mL) Activity NADH:FR (units a ) Specific Activity NADH:FR (units/mg) Yield (%) Lysate Ni-NTA Agarose Superdex 75 260 63 32 21.5 5.5 1.5 615 501 476 6.2 8.0 14.9 100 82 77 expression of a cb5r variant to date. The application of the simple two-step purification protocol revealed the diaphorase domain was purified to apparent homogeneity as evident by the presence of a single protein band following SDS-PAGE analysis of the final FPLC fraction as shown in Figure 11, which indicated a molecular mass (M r ) of approx. 32 kDa, as anticipated from the deduced amino acid sequence. MALDI-TOF mass spectrometry (Figure 11) confirmed a molecular mass (m/z) of 31,364 for the purified 45

PAGE 66

46 protein, in excellent agreem ent with the value of 31,391 calculated for the apoprotein from the deduced primary sequence. The oxidized form of the purified C. familiaris cb5r diaphorase domain was yellow in color indicating the incorporation of a flavin prosthetic group which was subsequently confirmed by MALDI-TOF mass sp ectrometry by the presence of a peak in the low mass range at 798 (m/z) that iden tified FAD as the sole prosthetic group. UV/visible absorbance spectra were obtaine d for oxidized samples of the purified canine enzyme and were compared with th e spectra obtained for the corresponding rat domain in Figure 12A. The canine cb5r diapho rase domain exhibited spectra comparable to those that have been prev iously obtained for other cb5r variants, including the human and rat enzymes [71, 12 0] that are characterized by an absorption maximum detected at 273 nm in the UV region of the spectrum, a nd a peak at 461 nm with an associated pronounced shoulder in the range of 485-500 nm in the visible region of the spectrum, the latter peak attributable to protein-bound flavin. The A 273 nm/462 nm absorbance ratio of the canine enzyme was within the range 5.5 + 0.2 which was comparable to values previously obtained for rat cb5r (5.6+ 0.2) [120], indicating a full comple ment of the FAD prosthetic group. To assess the secondary structural content of the canine cb5r diaphorase domain, CD spectra were recorded in the UV wavelength range (190-300 nm). As shown in Fig. 12B, the canine protein exhibited positive CD from 190-210 nm and negative CD from 210-250 nm with the spectrum retaining both positive and negative intensities very similar to that of the rat domain. The absen ce of any significant differences between the spectra of the canine and rat proteins suggest ed conservation of the secondary structure

PAGE 67

kDa S AB 50 37 25 47 220 110 2 500 0 3000 0 3500 0 4 000 0 m/z Figure 11. SDS-PAGE and MALDI-TOF mass spect rometric analyses of canine cb5r diaphorase domain expression. Upper panel: A sample (2 g protein) obtained from the final FPLC gel filtration in the canine cb5r diaphoras e domain isolation procedure analyzed using a 15% polyacryl amide gel as described in Methods. Individual lanes correspond to: S, protein mo lecular weight standards with indicated molecular masses; A, purified recombinant canin e cb5r. B, purified recombinant rat cb5r. Lower panel: MALDI-TOF mass spectrum obtaine d for a purified sample (10 pmole) of canine cb5r in the presence of sinapinic acid.

PAGE 68

48 architecture and that none of the amino acid substitutions had any substantial effects on the folding of the protein. Visible CD spectroscopy was utilized to examine the environment of the FAD prosthetic group. As shown in Figure 12C, the canine cb5r diaphorase domain exhibited a visible CD spectrum that was virtually indi stinguishable from that of the corresponding rat domain and indicated that none of the am ino acid substitutions had any significant effect on the conformation of the bound chromo phore. Previous spectroscopic analyses of cb5r variants containing alte red residues that ar e involved in FADbinding, such as Y93 [121] and S127 [122], have rev ealed visible CD to be a se nsitive indicato r of flavin conformation changes. The extent of quenching of the intrinsi c fluorescence due to the FAD prosthetic group of cb5r has also proven to be a sensitive indicator of the re tention of the native flavin environment. To probe the flavin fluorescence quenching of the canine cb5r variant, both excitation a nd emission fluorescence spectra we re recorded prior to and following heat denaturation of the recombinan t protein. Prior to denaturation, canine cb5r quenched the intrinsic flavin fluorescence by 96%, equivalent to that of the rat cb5r protein. To examine the influence of the various amino acid substituti ons on the stability of the resulting protein, ther mal denaturation profiles were generated for the canine cb5r diaphorase by measuring both changes in th e intrinsic flavin fluorescence emission intensity ( ex =450 nm, em =523 nm) and retention of NADH:FR activity following incubation of the protein at temperatures ranging from 0 C (Figure 13). Changes in the intrinsic fluorescence of th e cofactor or the retention of NADH:FR activity following

PAGE 69

Figure 12. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the Canine cb5r Variant. (A) UV/visible absorption spectra were obtained for an oxidized sample of canine cb5r (1.7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. The inset shows an expanded region of the visible spectrum where the flavin prosthetic group makes a major contribution. Individual spectra correspond to canine (___) and rat (.) cb5r. (B) UV CD spectra were recorded using enzyme samples (7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. (C) Visible CD spectra were recorded using enzyme samples (50 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. Line styles shown in B and C are the same as those depicted in A. 49

PAGE 70

50 thermal denaturation, was an effective indicator of the stability of the core structure of the protein. T 50 values (the temperature at which 50% of maximum fluorescence or 50% retention of NADH:FR activity was detected) of 57 C were observed which could be compared with the same values obtained fo r the corresponding rat domain, suggesting the canine and rat variants exhibited compar able protein folding and bound the flavin prosthetic group with similar affinities. Initial-rate kinetic analyses were pe rformed for the canine diaphorase cb5r domain to evaluate the effects of the va rious residue substitutions on both NAD(P)H and cytochrome b 5 (cb5) utilization. Values derived for the various ki netic constants for both the NAD(P)H:FR and NADH:BR activities are give n in Tables 5A and 5C respectively. The canine enzyme exhibited k cat s of 767 and 600 s -1 for the NADH:FR and NADH:BR activities with K m values of 7, 8 and 12 M for NADH, ferricyanide and cb5 respectively. As predicted by the conserved glycine, aspartate and phenylalanine residues at positions 179, 239 and 251 in the primary sequence, the canine diaphorase domain showed the same degree of specificity for NADH compared to NADPH, as previously described for the rat domain [123 124]. The value for the NAD(P)H specificity constant (defined as ratio of { k cat / K m NADPH }/{k cat / K m NADH }) listed in Table 5C, which reflect the magnitudes of the individual k cat and K m values obtained fo r both NADH and NADPH, respectively, was observed to be comparable to that observed for rat cb5r, indicating the canine enzyme retained a si milar preference for NADH as the physiological reductant. To compare the interaction of the canine cb5r variant with various pyridine nucleotides and probe the effect of alterati ons and deletion of the nicotinamide moiety, differential spectroscopy was utilized to monitor complex formation. Examples of

PAGE 71

alterations of the flavin visible absorbance difference spectrum are shown in Fig. 14. The formation of spectrally-detectable complexes were observed for the diaphorase domain during titrations with H 4 NAD, NAD + ADP-ribose and a variety of NAD + analogs, including APAD + PAAD + and NHD + Figure 13. Thermal Stability Profile Obtained for the Canine cb5r Variant. Oxidized samples of canine cb5r and the human and rat variants (18-20 M FAD) were incubated at the indicated temperatures and aliquots were withdrawn and assayed for both residual NADH:FR activity (open symbols) and intrinsic flavin fluorescence (closed symbols) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0, the latter using excitation and emission wavelengths of 450 nm and 523 nm, respectively. Excitation and emission spectra were scaled relative to that of a sample of free FAD at the equivalent concentration which was assigned a fluorescence intensity of 100%. The plots correspond to canine (, ) and rat (, ) cb5r, respectively. T 50 values correspond to 57 C for both canine and rat cb5r. 51

PAGE 72

Table 5. NAD(P)H:FR and NADH:BR kinetic constants obtained for canine and rat cb5r. A. NADH:FR Variant k cat (s -1 ) K m NADH (M) k cat /K m NADH (s -1 M -1 ) K m Fe(CN)6 (M) Canine 767 + 10 7+ 1 1.1+ 0.2x10 8 8+ 1 Rat 800+ 17 6+ 1 1.4+ 0.3x10 8 8+ 1 B. NADPH:FR Nucleotide Specificity Constant Variant k cat (s -1 ) K m NADPH (M) k cat /K m NADPH (s -1 M -1 ) a Canine 50+ 3 1040+ 33 4.8+ 0.4x10 4 4.4x10 -4 Rat 33+ 5 924+ 15 3.6+ 0.3x10 4 2.6x10 -4 a The nucleotide specificity constant, is defined as the ratio {(k cat /K m NADPH )/(k cat /K m NADH )}. C. NADH:BR Variant k cat (s -1 ) K m cyt b 5 (M) k cat /K m cyt b 5 (s -1 M -1 ) Canine 600+ 20 12+ 3 5.4+ 1.5x10 7 Rat 600+ 17 12+ 2 5.2+ 1.0x10 7 For H 4 NAD, the tetrahydronicotinamide derivative did not function as a hydride donor when substituted for NADH in either the NADH:FR or NADH:BR cb5r assays [111, 120] but provided a valuable tool for estimating the binding affinity for NADH. The H 4 -nucleotide is a close isosteric analogue and is assumed to involve the same contacts at the active site as NADH, but lacks the positive charge on the nicotinamide ring that is present on NAD + The spectral changes observed following H 4 NAD binding 52

PAGE 73

were identical to those previously detected for the corresponding titrations of the rat enzyme and yielded positive absorbance changes with maxima at 421, 449 and 481 nm Figure 14. Differential Spectra Obtained Following Binding of Various Pyridine Nucleotides to the Canine cb5r Variant. Difference spectra were obtained for canine cb5r (50 M FAD) in 20 mM MOPS buffer, containing 0.1 mM EDTA, pH 7.0 following titrations with either (A) H 4 NAD or (B) PAAD + as described in Methods. The insert panels correspond to plots of the magnitudes of the observed spectral perturbations (peak to trough measurements at the indicated wavelengths) versus ligand concentration. The corresponding K s values are given in Table 4. (C) The final difference spectra obtained for NAD + (.), ADP-ribose ( __ __ ), ADP ( ---), AMP ( -.-.) Nicotinamide ( _ ) and NMN + ( -..-..) (D) Final spectra obtained for the NAD + -analogs -NAD + ( ___ ), TNAD + ( ), PAAD + ( _ ), -NAD + ( -.-.), APHD + ( -..-..), NHD + ( --) and PCAAD + ( __ __ ). 53

PAGE 74

54 and negative absorption changes at 396, 466 and 497 nm, respectively. The value obtained for the spectroscopic binding constant (K s ), shown in Table 6, was comparable to that obtained for rat cb5r. For the binding of NAD + and the various NAD + analogs, differential flavin spectra were observed for 13 of the 15 analogs examined. NAD + binding yielded the largest spectral perturbation observed for any of the compounds tested, with positive absorbance maxima at 407 nm and 509 nm an d negative absorbance maxima at 456 nm and 487 nm, respectively. The K s value of 788 M was identical to that obtained for the rat domain. Deletions of portions of the NAD + structure (Fig. 14) resulted in significant changes in both the lineshape and intensity of the resulting difference spectra. Removal of the nicotinamide ring effectively abolis hed the absorbance changes from 380 to 440 nm; however difference spectra were still observed for 5-ADP-ribose, 5-ADP and AMP, although the intensity of the difference spectra decreased as the NAD + molecular was truncated. Only minimal spectral changes were detected with NMN + For the various NAD + -analogs, the greatest spectral perturbations were observed for TNAD + with positive maxima at 405 and 48 5 nm and negative maxima at 389, 441 and 463 nm, respectively. PAAD + also effected significant spectral perturbations while -NAD + had the least effect. The magnitude of the spectral changes was inversely proportional to the value of the spectroscopic binding constants ( K s ). The analog binding studies also revealed the importance of the two amino substituents on either the adenine or nicotinamide moieties on influencing NAD + affinity. Substitution of the nicotinamide amino group by a methyl group (APAD + ), resulted in an 11-fold increase in analog affinity while removal of the group (PAAD + ) only increased affinity by 40%. In contrast,

PAGE 75

55 substitution of the adenine amino moiety by a hydroxyl (NHD + ), decreased affinity by50%, reinforcing the important role of the adenine moiety in NAD + binding. Table 6. Spectroscopic binding constants obtained for canine cb5r in the presence of various pyridine nucleotides. Nucleotide Canine cb5r K s ( M) Rat cb5r a K s ( M) Chlorella K i ( M) NR b G (kcal.Mol -1 ) H 4 NAD APAD + ADP-ribose ADP -NAD PAAD + AMP TNAD + NAD + APHD + PCAAD NHD + -NAD + o-NAD + PCA + NMN + Nicotinamide 67 + 5 71 + 7 77 + 6 165 + 12 297 + 11 540 + 24 587 + 29 590 + 34 549 + 36 1007 + 94 1260 + 31 1350 + 156 2005 + 250 7898 + 924 >31000 + 1000 ND ND 45 + 10 100 + 20 553 + 30 1390 750 2040 6340 740 5010 6490 2170 2300 4650 4480 1150 4660 4070 11760 5.688 5.653 5.605 5.154 4.806 4.474 4.403 4.400 4.229 4.084 3.951 3.910 3.676 2.865 <2.056 a Spectroscopic binding constants for rat cb5r were taken from Marohnic et al. [123]. b Inhibition constants for Chlorella nitrate reductase (NR) taken from Trimboli and Barber [125] *ND indicates that the spectroscopic binding constant could not be determined, due to insufficient spectral change.

PAGE 76

56 To examine whether the thermodynamic properties of the flavin prosthetic group were similar to those of th e corresponding rat enzyme, potentiometric titrations were performed using the dye equilibration method for the canine cb5r diaphorase domain in the presence of phenosafranine (E o = -252 mV) as indicator. Flavin midpoint potentials (E o , n=2) were determined for the enzyme alone and in complex with NAD + Spectra obtained during representative titrations of canine cb5r in the absence and presence of NAD + are shown in Fig. 15A and B, respectivel y. Qualitative analysis of the individual spectra obtained from the various titratio ns indicated that the majority of the phenosafranine was reduced prior to FAD reduc tion in canine cb5r in the absence of any pyridine nucleotide, suggesting the flavin midpoi nt potential was more negative than that of phenosafranine. In contrast, analysis of the spectra obtained for the protein in the presence of NAD + revealed that the majority of the flavin was reduced prior to the dye, suggesting that complex formation significantly perturbed the flavin midpoint potentials to values more positive than that for phenosafranine. Spectra obtained from the redox titration of canine cb5r in the presence of NAD + also revealed the formation of the characteristic charge-transfer complex resu lting in the increased absorbance in the 700800 nm region of spectrum. The flavin redox potentials (n =2) for canine cb5r alone or in the presence of NAD + were determined from the Nernst semi-log plots shown in Fig. 15C. The standard midpoint potentials obtained for the FAD/FADH 2 couple in both the native enzyme (E o = -273 mV) and in the enzyme-NAD + complex (E o = -190 mV) were significantly different, spanning a range of 83 mV.

PAGE 77

Figure 15. Oxidation-Reduction Midpoint Potentials Obtained for the FAD Prosthetic Group in the Canine cb5r Variant. Reductive dye-equilibration titrations of canine cb5r (40 M FAD) were performed as described under Methods in 100 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0 in the presence of phenosafranine (15 M, E o = -252 mV) as the indicator dye [117]. Individual spectra were collected at 30-90 sec intervals during the time course of the titrations. Upper Panels: representative spectra obtained during titrations of canine cb5r in the (A) absence and (B) presence of 2 mM NAD + are shown (a limited number of spectra are shown for clarity). (C) Nernst plots obtained for the FAD/FADH 2 couple (n=2) of the canine and rat cb5r variants. Canine cb5r in the absence (, E o =-273 + 5 mV) and presence of NAD + (; E o =-190+ 5 mV); rat cb5r in the absence (, Eo=-272 + 5 mV) and presence of NAD + (; E o =-191 + 5 mV). 57

PAGE 78

58 Summary of Expression and Characterizati on of a Functional Canine Variant of Cytochrome b 5 Reductase These results provide the first documented insights into the structure and function of a catalytically-active canine variant of microsomal cb5r. Utilizing a consensus sequence developed from an alignment of se veral higher eukaryotic cb5r primary structures, we constructed PCR primers that could be used to amplify either the fulllength, membrane-associated cb5r nucleotide sequence or that of a truncated, soluble form of the cb5r diaphorase domain comprising 258 residues (I33 to F300), equivalent to those previously used to develop a heterol ogous expression system for the rat variant [102]. The PCR results obtained using the prim ers designed to genera te the full-length cDNA confirmed that the first six residues of the amino-terminal sequence of the membrane-associated canine cb5r corresponde d to the residues GAQLST which were identical to the corre sponding residues of both the human and rat enzymes. In addition, the first three residues, GAQ, indicated the presence of a ProSite signature sequence [126], that suggested the mature, membrane-asso ciated protein would be myristylated, as previously demonstrated fo r the steer protein [38]. The primary sequence of the full-length membrane-associated form of canine cb5r shared maximum similarity with the corresponding sequence of the human enzyme at 92.7% compared to 89.7% similarity to th e corresponding rat sequence. Examination of the canine sequence revealed the presence of four conserved sequence motifs that are associated with flavin binding ( 91 RxY T S xx S N 97 ), FAD/FMN selectivity ( 124G R xx S T 127 ) and NADH-binding ( 180 GxGxxP 185 and 273 CGxxxM 278 ) that have been identified as diagnostic for members of the FNR family of flavoprotein transhydrogenases [127].

PAGE 79

59 Comparison of the results obtained fr om the spectroscopic, kinetic, thermodynamic and stability studies confirme d predictions generate d from the pair-wise sequence alignments that the structural a nd functional properties of the recombinant canine cb5r diaphorase domain were directly comparable to those of the corresponding rat domain. The ability to generate both dom ains using identical expression systems and characterize their biophysical properties unde r equivalent conditions revealed that in addition to identical spectrosc opic properties, the two cb5r variants exhi bit identical kinetic properties including catalytic efficiency, affinities for both the reducing and oxidizing substrates and specificity for NAD(P)H. The equivalence in the kinetic properties is particularly significant and s uggests that other cb5r variants exhibiting conserved sequences should retain comparable kinetic properties. Our preliminary results obtained using an identical Danio cb5r expression system, the Danio cb5r diaphorase domain shares 70.8% and 69.8% sequence sim ilarity with the canine and rat domains, respectively, have confirmed this predic tion. In addition to th e conserved kinetic properties, the oxidation-reduction potentials of the FAD prosthetic groups were equivalent indicating a conserve d flavin-binding environment. The binding studies performed utiliz ing a variety of NADHand NAD + -analogs have provided further insight into the role s of the different portions of the pyridine nucleotide that are critical to regulating re ducing substrate/product a ffinity as indicated by perturbation of the flavin prosthetic gr oups visible spectrum. The results obtained from the titrations using NAD + and various NAD + -fragments confirm that the greatest spectral changes were produced by the binding of NAD + and that the positively-charged nicotinamide moiety was primarily responsible for the spectral perturbations, since ADP-

PAGE 80

60 ribose and ADP were effective i nhibitors but affected only m odest spectral changes. In contrast, examination of the various NAD + -analogs revealed a dive rse array of spectral changes with TNAD + producing the most dramatic effect s. There appeared to be a good correlation between the magnitude of the sp ectral changes and the affinity for the NAD + analog. The nicotinamide portion alone, in the form of NMN + also affected only modest spectral changes owing to its very low binding constant coup led with the requirement for the presence of the AD P moiety to firmly anchor the i nhibitor in the correct orientation. These results were confirmed by comparis on of the binding constants obtained for H 4 NAD ( K s = 67 M) and ADP-ribose ( K s = 77 M) which indicated the presence of the nicotinamide moiety conferred only a modest increase in substrate affinity. In addition, loss of the ribose moiety resulted in a 2-fold decrease in affinity. In contrast to the binding constants obtained for the majority of the NAD + -analogs, which were substantially greater than the values dete rmined for ADP-ribose and ADP, the binding constant observed for APAD + was very similar in magnit ude to that obtained for H 4 NAD, despite the presence of the positively charge d nicotinamide moiety, suggesting that this analog may bind in a different conformation th an the remaining analogs. Similar results have been obtained from binding studies using a variety of NADP + analogs and the related flavoprotein, cytochrome P450 reductase [106] which shares substantial structural similarity in the FADand pyrid ine nucleotide-binding sites. Combination of the results obtained with the canine enzyme and the various NAD + -analogs with those obtained from muta genesis studies of the corresponding rat cb5r diaphorase domain regard ing residue side-chain substi tutions and their effects of NAD(P) + specificity [123], provides im portant insights into struct ural features regulating

PAGE 81

61 pyridine nucleotide binding. The results of the binding studies indicat ed that the magnitudes of the spectralbinding constants obtained for the various NAD + -analogs showed the same general transition as the results previously obtai ned for the closely related FAD-containing diaphorase domain of assimilatory NADH:n itrate reductase (NR) which were obtained using classical inhib itor-binding kinetic st udies (Table 6) [125] reinforcing the striking structural similarity between the diaphoras e domains of cb5r and NR that has been suggested by X-ray crys tallographic studies. To evaluate the structural organization of the canine cb5r soluble, diaphorase domain, comparative modeling wa s utilized to predict the tertiary structure of the recombinant protein. Homology modeling, utilizing the experimental structures determined for recombinant forms of the ra t diaphorase domain in the absence (PDB = 1I7P) and in the presence (PDB = 1IB0) of NAD + [58] and the erythrocytic variant of human cb5r (PDB = 1UMK) [112] yielded a model that was nearly identical to that of the human domain and very similar to that of the rat domain, as revealed by the structural overlay shown in Figure 16. Comparison of th e backbone structures indicated the canine model and the human and rat structures were nearly identical ove r the lengths of the entire polypeptide backbones w ith only minor differences among the three structures. The most notable difference was seen between th e canine and human stru ctures and the rat structure. This difference is confined to a small region of the sequence comprising residues P263 to L269. In the canine and human cb5r proteins, this region includes the sequence 263 PPEEEPL 269 while the rat sequence corresponds to 263 PPGEETL 269 . The substitution of a glycine residue at position 265 in the rat protein introduces a

PAGE 82

62 substantial deviation in the c onformation of the backbone within this region, resulting in the disruption of the short -helical region between P264 and E266 in the human and canine structures and the introduction of a -bend between helix N 3 and -strand N 5 in the rat NADH-binding lobe. However, this sequence region is not directly involved in any contacts with the FAD pros thetic group or either of the physiological substrates, NADH or cb5, and is unlikely to significantly affect the cat alytic efficiency of the enzyme, in agreement with the results of the initial-rate kinetic studies. A number of mutations of the human cb5r sequence have been re ported that give rise to RCM [128]. Examination of the can ine sequence indicated that all of the approximately 40 residues that have been identifi ed so far as giving rise to either the type I or type II forms of RCM were conserved within the canine sequence with the exception of E227 which corresponds to K227 in the hum an variant. Thus, studies of the individual methemoglobinemia mutations in canine cb5r w ould be expected to be directly relevant to the human variant. Comparative studies of the endogenous activ ity of cb5r have been applied as a predictor of an organisms capacity to convert methemoglobin to hemoglobin and have been used as an important component in evaluating the anti-cyan ide effectiveness of various methemoglobin formers as potential prophylactics to minimize the effects of cyanide toxicity. Cytochrome b5 reductase is the rate-limiting enzyme controlling the toxicokinetics of methemoglobin reduction, e ffectively regulating the anti-cyanide efficacy of methemoglobin formers. While cb5r activity has been determined in humans and a diverse array of animal species incl uding chimpanzee, baboon, horse, steer, sheep, goat, kangaroo, wallaby, dog, cat, rabbit, guin ea pig, rat, mice, and platypus [129-131],

PAGE 83

Figure 16. Comparison of the Predicted Structure of the Canine cb5r Diaphorase Domain with the Corresponding Human and Rat Diaphorase Domain Structures. The structure of the canine cb5r diaphorase domain, corresponding to residues T30 to F300, was predicted using SWISS-MODEL as described in Methods. The diagram shows the canine structure model (cyan ribbon) as a ribbon representation superimposed on the corresponding structures of the human (yellow ribbon; PDB ID: 1UMK) and rat (green ribbon, PDB ID: 1IB0) proteins. Also shown are the FAD prosthetic group and the NAD + product in stick configuration using the CPK coloring scheme. 63

PAGE 84

64 systematic evaluations of cb5r activity in di fferent species have been primarily limited to non-human primates and have focused on de termining hemolysate enzyme activities using the NADH:ferricyanide assay [132] in contrast to evaluating the specific activity of the enzyme using the physiological NADH:cytochrome b5 assay. Limited in vivo comparative studies of cb5r functionality in hamsters, rodents and Beagles [50] has suggested that the erythr ocytic concentrations of the enzyme are significantly lower in dogs th an in the other mammals based upon conventional activity assays and PAGE studies and that the decrea sed concentrations of cb5r confer a high degree of susceptibility of Beagle erythrocytes to methemoglobin form. The results presented in this work confirm these initial resu lts and indicate that it is changes in cb5r protein levels in dogs, rather than decreased specifi c activity that predisposes canines to cyanosis.

PAGE 85

65 Analysis of residues, Y112 and Q210, invol ved in anchoring of the pyrophosphate backbone of NAD + Multiple sequence alignments of the cb5r sequences from a wide variety of species, ranging from simple single cellular organisms to more complex members of the avian and mammalian classes reveal a gr eat number of highly conserved residues, indicating that these particular residues play a vital role in proper enzymatic function, thus were conserved through evolution. This taken in combinati on with crystallography studies of the rat variant of cb5r [58] iden tifies two residues distinct from the highly conserved motif regions found in members of the flavoprotein transhydrogenases [127], that appear to play a role in the correct interaction of cb5r with its physiological substrate NADH. Based on X-ray crystallographic studi es of rat cb5r in the presence of NAD + (PDB ID = 1IB0), residues Y112 and Q210 were shown to form hydrogen bond linkages with oxygens in the nicotinamide and adenine pyrophosphates of NAD + respectively as shown in Figure 17. These interactions appeared to serve to anchor the NAD + into position from the external side of the FADand NADH-binding pocket. Residue Y112 is located in lid region of cb5r comprised of residues Y112K125. The flavin ADP moiety made extensive in teractions with residues in this lid forming a hydrophobic pocket that housed the ad enine moiety, specifically between the planar rings of Y112 and F12 0. Additionally, the location of Y112 in the FAD binding domain of cb5r makes it unique in that it is the only residue of the FAD-binding domain to directly inte ract with NADH/NAD + forming a hydrogen bond interaction between NO2 of the nicotinamide pyrophosphate of NAD + and the hydroxyl group of the tyrosine side chain. It was previously determined th at, in the type II RCM variant S127P, the O

PAGE 86

66 Figure 17. Electrostatic Interaction of Amino Acid Residues Y112 and Q210 with NAD + Bound to Cytochrome b 5 Reductase. (A) Ligplot [99] of 1IB0. C, O, N, and P atoms are represented as white, blue, red, and vi olet spheres, respectively, while covalent bonds are violet sticks within NAD + and orange sticks within amino acid residues of the NADH-binding lobe. Hydrogen bo nds are drawn as green dash ed lines with distances between atoms labeled. Residues cont ributing to hydrophobic interactions are represented as arcs with rays and colored red. (B) Structural model of cb5r with NAD + and residues Y112 and Q210 show n in stick representation. (C) Enlarged view of the NADH binding pocket (atoms colored in CPK).

PAGE 87

A B C Y112 Q210 NAD + 67

PAGE 88

68 atom of residue S127 was within hydrogen bond ing distance of the amide nitrogen atom of Y112 and may assist in stabilizing this loop confor mation. A major conformational change in the lid region noted in the X-ray crystal structure of S127P was proposed to be partially due to the removal of the interaction of the side chain of S127 with the amide nitrogen atom of Y112 [122]. In order to further probe th e role of Y112, a series of variants were created as described in Methods utiliz ing the original four-histi dine tagged cb5r expression construct and the correspondi ng oligonucleotide primers lis ted in Appendix A. In multiple sequence alignments, Y112 is shown to be both ubiquitously conserved across species variants as well as highly conserved among members of the FNR family. Thus, the variants generated co rresponded to a survey of alternate amino acid residues that cover the general prope rties of the side chains, allowing for investigation of polarity, char ge, and steric interference on the overall structure and function of cb5r. The varian ts generated consisted of Y 112A, Y112D, Y112F, Y112H, and Y112L. Residue Q210 is located at the carboxy terminus of -strand N 2. The NE2 of the glutamine side chain forms a hydrogen bond with AO2 of the adenosine pyrophosphate of NAD + Through multiple sequence alignments Q210 has been shown to be highly conserved across FNR family members and among species variants. To further probe the role of Q210, a series of mutants were generated as described in Methods and Materials, utilizing the original four-histid ine tagged cb5r expression construct and the corresponding oligonucleotide primers lis ted in Appendix A. These mutants corresponded to alternate residues that occur in the same residue position within

PAGE 89

69 additional GenBank sequences of other members of the FNR superfamily and cb5r variants. These variants consist of Q210A, Q210R, and Q210 V. The fidelity of each variant was confirmed by nucleotide sequencing in both forward and reverse directions and the mu tant proteins were then recombinantly expressed in BL21 (DE3)-RIL cells. Purifi cation to homogeneity was carried ou t through the utilization of a co mbination of Ni-NTA affinity and gel filtration chromatography for the mutant proteins, all being expressed at leve ls comparable to that of the WT domain as observed by the appearance of single protei n bands following SDS-PAGE analysis. UV/visible absorption spectra were obtained for oxidized samples of each of the purified variants together w ith WT cb5 and are presented in Figure 18A (Y112 series) and Figure 19A (Q210 series). Both series of mutants displayed spectra comparable to that of the WT domain, attrib utable to protein-bound flavin with an aroma tic absorption maxima detected at 272 nm in the UV region of the spectrum and a peak at 461 nm with a pronounced shoulder within the range of 485-500 nm in the visible region of the spectrum. The absorption ratios (A 276 /A 461 ) for each viable mutant were within a range of 5.5 to 5.9 which indicated a full flavin complement. To examine the effects of each mutation upon the secondary structure of the protein, UV circular dichroism spectra were determined in the UV wavelength range (190 300 nm). As shown in Figures 18B and 19B all of the generated mutants displayed line shapes comparable to WT cytochrome b 5 reductase with positive CD from 190-210 nm and negative spectra from 210-250 nm, with minor alterations in the intensity of the negative deflections of the spec tra. Alterations may indicate an adverse structural change within the overall -helical or -sheet components of the two variants. However, due to

PAGE 90

A B C Figure 18. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the Y112 Series of cb5r Variants. (A) Oxidized samples of WT and mutant cb5rs (20M), (B) 7M, and (C) 60M FAD in 10mM phosphate with 0.1mM EDTA, pH 7.0 buffer. The inset shows an expanded region of the visible spectrum where the flavin cofactor makes a major contribution. Individual spectra correspond to ( ____ ) H 4 cb5r; ( ____ ____ ) Y112A; ( __ __ __ ) Y112D; ( _ _ ) Y112F; ( __ __ ) Y112H and ( __ . __ ) Y112L. 70

PAGE 91

A B C Figure 19. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the Q210 Series of cb5r Variants. (A) Oxidized samples of WT and mutant cb5rs (20M), (B) 7M, and (C) 60M FAD in 10mM phosphate with 0.1mM EDTA, pH 7.0 buffer. The inset shows an expanded region of the visible spectrum where the flavin cofactor makes a major contribution. Individual spectra correspond to ( ____ ) H 4 cb5r; ( ____ ____ ) Q210A; ( __ __ ) Q210R; ( __ . __ ) and Q210V. 71

PAGE 92

72 the minimal nature of these alterations, it is more likely a result of the noise reduction process involved with analysis of the data. In order to examine the flavin environment of each variant, visible CD spectra were obt ained as shown in Figure 18C and 19C. Representative spectra demonstrated that each variant retained a similar line shape to that of WT cb5r, processing positive maxima at 310 and 390 nm and negati ve maxima at 460 and 485 nm. Again, minor alterations were obs erved in the intensity of both the positive and negative deflections, mostly attributable to noise reduction. To establish effects of the a lterations of the side chains on the catalytic function of the enzyme, initial-rate kinetic parameters fo r NADH:FR assays were determined for the WT cb5r and for each purified variant. The values obtained for the NADH:FR assays for the Y112 and Q210 series of va riants are presented in Tabl es 7 and 8, respectively. For the Y112 series, the NADH catalytic efficiencies ( k cat / K m NADH ) were at least moderately decreased for all variants, having values that ranged between 2 and 27% compared to WT cb5r, with Y112D yielding the lowest catalyt ic efficiency (Table 7). The observed decrease on overall catalytic efficiency was attributable to both a decreased k cat for each of the variants (>50% in all cases) as well as a decrease in substrate affinity, with observed K m NADH of each mutant being 2-2.5 times greater than that of WT cb5r. Most notable of the results was Y112D, which had the most profound effect on catalytic efficiency, reducing it to 2% of WT activity. For the Q210 series, the NADH catalytic efficiencies ( k cat / K m NADH ) for all variants were decreased with values that ranged between 21 and 47% compared to WT cb5r, with Q210A yielding the lowest catalyt ic efficiency (Table 8). Th e decrease in efficiency was again due equally to decreased affinity for s ubstrate and decreased rate of turn-over.

PAGE 93

73 Table 7. NADH:FR Kinetic Constants and Thermal Stability (T 50 ) Values for the Y112 Series of cb5r Variants. NADH:FR cb5r Variant k cat K m NADH K m FeCN6 k cat /K m NADH (s -1 ) (M) (M) (s -1 M -1 ) T 50 (C) WT H4cb5r Y112A Y112D Y112F Y112H Y112L 800 21 6 1 8 1 1.4 0.3 x 108 325 5 12 0.3 7 1 2.8 0.1 x 107 45 2 15 2.6 8 1 3.1 0.7 x 106 400 17 11 0.9 8 1 3.7 0.5 x 107 333 28 10 1.1 7 1 3.4 0.7 x 107 397 20 11 1.2 8 1 3.8 0.6 x 107 56.1 51.4 51.2 54.3 56.3 57.2 Protein stability was evaluated by monitoring the thermal NADH:FR inactivation profile coupled with the increase in intrinsi c flavin fluorescence and emission intensity of each of the variants which was compared to values obtained for WT cytochrome b 5 reductase. The results obtained for the thermal denaturation profiles and changes in intrinsic flavin fluorescence are shown in Figure 20. For the Y112 variants, T 50 values (the temperature at which 50% of maxi mum fluorescence and 50% retention of NADH:FR activity was detected) indicated a s lightly decreased protein thermal stability for Y112A, D, and F as compared to the T 50 value of 56 C for WT cb5r, whereas the values for both the Y112H and Y112L variants were comparable to WT (Table 7). Similar results occurred for the Q210 variants with all three having slightly decreased values compared to WT (Table 8). Overall, these results indicated alteration to either of these residue results in a decrea sed stability of the protein.

PAGE 94

74 Table 8. NADH:FR Kinetic Cons tants and Thermal Stability (T 50 ) Values for the Q210 Series of cb5r Variants. NADH:FR cb5r Variant k cat K m NADH K m FeCN6 k cat / K m NADH (s -1 ) (M) (M) (s -1 M -1 ) T 50 (C) WT H 4 cb5r Q210A Q210R Q210V 800 21 6 1 8 1 1.4 0.3 x 10 8 437 42 15 1.5 8 1 2.9 0.6 x 10 7 510 5 8 0.3 7 1 6.6 0.3 x 10 7 565 17 13 1.8 8 1 4.3 0.7 x 10 7 56.1 52.7 52.9 52.3 From the kinetic data obtai ned it was demonstrated that each of the variants generated displayed an elevated K m NADH for both the Y112 and Q210 variants, on the order of 2 fold as compared to WT cb5r fo r most variants. To further establish the binding affinity of the substrate NADH and the product NAD + spectroscopic binding constants were determined ut ilizing differential spectroscopy. As stated in Methods the is osteric analog 1,4,5,6-tetrahydro-NAD (H 4 NAD) was utilized as an alternative substrate analog to evaluate the affinity for the physiological substrate NADH [106]. Differe ntial spectroscopy was used to monitor complex formation during titrations with either H 4 NAD or the physiological product NAD + The results are shown in Figures 21 and 22 for Y112 and in Figure 23 for the Q210 variants. In the case of Y112, spectra obtained for each of the titrations carried out in the presence of H 4 NAD displayed a line shape comparable to WT cb5r with varying intensities of the negative maxima at 395nm Values observed for the spectroscopic binding constant ( K s ) for the H 4 NAD titrations, shown in Table 9, demonstrated that the binding affinity for each of the variants wa s not significantly alte red, with the exception of Y112D, which had a value approximately 9 times greater than that of WT cb5r.

PAGE 95

75 Figure 20. Thermal Stability Profiles of the Y112 and Q210 Series of Variants. Oxidized samples of cb5r variants and WT H 4 cb5r (5 M FAD) were incubated at the indicated temperatures, and aliquots were withdrawn an d assayed for both residual NADH:FR activity (closed symbols) and intrinsic flavin fluorescence (open symbols) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0 using excitation and emission wavelengths of 450 nm and 523 nm, re spectively. (A) Points correspond to: ( ) H 4 cb5r; ( ) Y112A; ( ) Y112D; ( ) Y112F; ( ) Y112H; and ( x ) Y112L. (B) Points correspond to: ( ) H 4 cb5r; ( ) Q210A; ( ) Q210R; and ( ) Q210V

PAGE 96

76

PAGE 97

77 While little alteration for the affinity for the substrate analog H 4 NAD was observed for the Y112 series of variants, the spectra obtained in the NAD + titrations demonstrate a high level of alteration in both degree of affinity and in conformation of binding. As seen in Figure 21, all variants, with the excepti on of Y112H, demonstrated an altered line shape in the titration spectra. Moreover, the spectra for Y112A, D, F, and L were more reminiscent of the spectra obtained for WT enzyme in the presence of H 4 NAD. Additionally, the intensities of the differen tial spectra were greatly diminished in comparison to WT enzyme. The K s values were markedly altered for all variants, displaying an moderately enhan ced binding affinity for the NAD + product in the case of Y112A and Y112L, while the Y112F, Y112H, and most no table the Y1112D variants demonstrated dramatically increased values as compared to WT cb5r (Table 9). These results are in good agreement with the kinetic values obtained in that the substrate H 4 NAD is still able to bind efficiently, but at a decreased affinity. In respect to affinity for the product NAD + the altered conformation indicat ed by the differing line shape of the spectra indicates improper orientation le ading to decreased tu rnover as evidenced by the decreased k cat values for the NADH:FR assays. For the Q210 series of variants, titra tions carried out in the presence of H 4 NAD yield spectra retaining the line shape shown in titrations of WT enzyme. Values obtained for the K s for H 4 NAD were comparable to that of WT (Table 10), w ith Q210R showing an increased affinity for substrate. Results obtained for titrations in the presence of NAD + showed that all variants maintained the same line shape as that for WT. Q210A showed a K s value on par with WT, whereas values for Q210R and Q210V indicated and increased affinity for substrate (Table 10).

PAGE 98

Figure 21. Spectroscopic Titrations of WT cb5r and the Y112 Series of Variants in the Presence of H 4 NAD. Titrations of all mutants (50M) were performed in split cell optical cuvettes in 10mM phosphate buffer containing 0.1mM EDTA, pH 7.0 at 23 C. Difference spectra were recorded following the addition of solution containing H 4 NAD (5mM). The inset panel corresponds to a plot of the magnitude of the spectral perturbations at the indicated wavelengths versus pyridine nucleotide concentration where a difference spectrum was observed. Plots of the relative absorbance changes observed are as follows: (A) H 4 cb5r; (B) Y112A; (C) Y112D; (D) Y112F; (E) Y112H; and (F) Y112L. 78

PAGE 99

Figure 22. Spectroscopic Titrations of WT cb5r and the Y112 Series of Variants in the Presence of NAD + Titrations of all mutants (50M) were performed in split cell optical cuvettes in 10mM phosphate buffer containing 0.1mM EDTA, pH 7.0 at 23 C. Difference spectra were recorded following the addition of solution containing NAD + (30mM). The inset panel corresponds to a plot of the magnitude of the spectral perturbations at the indicated wavelengths versus pyridine nucleotide concentration where a difference spectrum was observed. Plots of the relative absorbance changes observed are as follows: (A) H 4 cb5r; (B) Y112A; (C) Y112D; (D) Y112F; (E) Y112H; and (F) Y112L. 79

PAGE 100

80 Figure 23. Spectroscopic Titrations of WT cb5r and the Q210 Series of Variants in the Presence of H 4 NAD and NAD + Titrations of all muta nts (50M) were performed in split cell optical cuvettes in 10mM phos phate buffer containing 0.1mM EDTA, pH 7.0 at 23 C. Difference spectra were recorded following the addition of solution containing H 4 NAD (5mM) (A, C, E, G) NAD + (30mM) (B, D, F, H). Th e inset panel corresponds to a plot of the magnitude of the spectral pertur bations at the indicated wavelengths versus pyridine nucleotide concentration where a di fference spectrum was observed. Plots of the relative absorbance changes observed are as follows: (A, B) H 4 cb5r; (C, D) Q210A; (E, F) Q210R; and (G, H) Q210V.

PAGE 101

81

PAGE 102

82 Table 9. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the Y112 Series Variants. E FAD/FADH2 (mV) cb5r Variant K s H4NAD K s NAD+ (M) (M) -NAD + +NAD + WT H 4 cb5r Y112A Y112D Y112F Y112H Y112L 45 10 37 4 414 47 69 9 28 3 56 4 553 30 359 62 7958 410 2234 242 2808 267 313 50 -271 -271 -261 -269 -266 -271 -190 -219 -201 -193 -217 -197 Effects of potential structural changes on the properties of the flavin prosthetic group were examined by determining oxidatio n-reduction potentials for the FAD cofactor utilizing dye-equilibration titrations in the presence of phenosafranine (E = -252 mV) as described in Methods [117]. Flavin midpoint potentials (E n = 2) for the FAD/FADH 2 couple were determined for the varian ts alone and in the presence of NAD + The flavin redox potentials (n = 2) for the WT cytochrome b 5 reductase and generated variants for the FAD/FADH 2 couple were determined from th e Nernst semi-log plots of the log ([oxidized]/[reduced]) FAD versus potential (mV) and are shown in Figures 24 and 25 for the Y112 and Q210 series resp ectively, with the standard midpoint potential values obtained for each shown in Tables 9 and 10, respectively. For the standard flavin midpoint potentials of the Y112 va riants in the absence of NAD + all potentials were nearly identical to that of the WT domain, indicating that the introduction of structural alterations of these variants did not have a dramatic effect on the environment of the FAD as inferred from flavin midpoint potential. In the presence of NAD + however, the resulting midpoint potentials of the variants, with the exception of Y112A, were more

PAGE 103

83 negative than that of the WT domain (-191m V), having a value more comparable to the value obtained for the midpoint potential of fr ee flavin (-220 mV) [133]. Similar results were noted for the Q210 series, w ith values in the absence of NAD + being similar to that of WT and values in the presence of NAD + being midway between the expected value for WT and that of free flavin. Table 10. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the Q 210 Series Variants. E FAD/FADH2 (mV) cb5r Variant K s H4NAD K s NAD+ (M) (M) -NAD + +NAD + WT H 4 cb5r Q210A Q210R Q210V 45 10 78 5 22 3 64 8 553 30 578 42 48 8 205 29 -271 -277 -271 -271 -191 -210 -204 -206

PAGE 104

Figure 24. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the WT cb5r and Y112 cb5r Variants. Reductive dye titrations were performed at 25 C as described in Materials and Methods using phenosafranine as the indicator dye in 100 mM phosphate buffer containing 0.1 mM EDTA, pH 7.0. Nernst plots in the absence (A) and presence (B) of 2 mM NAD + Plots correspond to () H 4 cb5r; () Y112A; () Y112D; () Y112F; ()Y112H; and (x) Y112L. 84

PAGE 105

Figure 25. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the WT cb5r and Q210 cb5r Variants. Reductive dye titrations were performed at 25 C as described in Materials and Methods using phenosafranine as the indicator dye in 100 mM phosphate buffer containing 0.1 mM EDTA, pH 7.0. Nernst plots in the absence (A) and presence (B) of 2 mM NAD + Plots correspond to () H 4 cb5r; () Q210A; () Q210R; and () Q210V. 85

PAGE 106

86 Summary of Analysis of residues, Y112 and Q210, involved in anchoring of the pyrophosphate backbone of NAD + Multiple sequence alignments have demonstrated that residues Y112 and Q210 have a high level of conservation, occurri ng with only a few exceptions across cb5r proteins from divergent species as well as amongst the members of the FNR family of transhydrogenases. This fact, coupled with the implication of both residues in interactions with the pyrophosphate backbone of bound NAD + as demonstrated by X-ray crystallographic studies of the ra t variant of cb5r in the presen ce of the substrate, indicate that these two residues poten tially play a vital role in proper structure-function interactions yielding proper enzymatic activity of cb5r. The location of Y112 in the vital FAD associated lid region further suggests that this residue in particular may function in some way to ensure proper orientation of both the cofactor and the coenzyme. In order to fully elucidate the role of each residue, a series of variants were generated corresponding to naturally occurr ing substitutions observed within the FNR superfamily or in variants of cb5r from di vergent species. These included Y112A, D, F, H, and L and Q210A, R, and V. The data pres ented here provides further insight into the role of these two residues towards correct orie ntation and binding of the NADH substrate. While both series of variants generated impaired functionality of cb5r to some level, the Y112 variants appeared to demonstrate a greater impact than the Q210 variants. Additionally, among the Y112 varian ts, the greatest impact was noted in the substitution of the native residue with residues carrying a charge, either positive (H) or negative (D). Substitution of residue Y112 with any of th e chosen residue alterations resulted in some degree of impaired function, regardless of side chain characterist ics. In general an

PAGE 107

87 approximate 2 fold decrease in substrate affinity coupled with an approximate 2 fold decrease in rate of turnover was observed for all subs titutions in regards to NADH:FR activity. A notable exception to this was the Y112D variant which had a much more profound impact on the turnover rate. These data indicate that changing the side chain at position 112 causes a mild impairment in th e binding of NADH, via disruption of the anchoring effect of the hydroxyl group found on the tyrosine side chain. The introduction of a negative charge into this position greatly affected the ability of the protein to not only properly associate with NADH; it directly impacted the ability of the protein to properly function. This is due to disruption of the electrostatic environment near the FAD. While absorbance spectra and circular dichroism analyses indicate that the flavin environment was not affected, the introduction of the negative charge would impact the ability of FAD to properl y accept electrons from the NADH. Analysis of an in silico model of Y112 in relation to FAD compared to that of Y112D, suggest ed that the adenine moiety of FAD in situated close to and a ssociates with Y112. In the WT protein, analysis indicated a moderate positive char ge toward the backbone portion of Y112 with the end of the side chain having a mildly ne gative charge. This polarity compliments the charge dispersal on the aden ine moiety of FAD. The proposed model of D112 in association with FAD indicates a highly nega tive region being introduced into a pocket of positive charges found in the FAD. The introduction of this level of strong negative charge into a region normally occupied by a mild electronegativ e charge would be sufficient to disrupt the electron transfer properties of FAD, rendering it unable to efficiently accept electrons from NADH. This would support the drastic effects observed

PAGE 108

FAD FAD D112 Y112 B A Figure 26. Structures of WT cb5r and the Y112D Variant with FAD Generated in silica. The molecular model of cb5r displaying the charged surfaces of (A) residue Y112 and (B) cb5r variant Y112D in association with FAD generated utilizing the automated comparative protein modeling server SWISS-MODEL [111] and analyzed using the molecular modeling software Web Lab Viewer Pro [134]. This model represents a surface representation of cb5r in complex with FAD (1IB0 ) where the acidic residues are red, basic residues are blue, and neutral residues are displayed as white clouds. seen on the k cat value for Y112D, being one-twentieth that of WT and the midpoint potential in the presence of NAD + being comparable to that of free flavin. These effects may also be indirect, with alterations of the Y112 residue affecting nearby residues in the lid region responsible for proper FAD incorporation. Additionally, the presence of the negative charge from the carboxylic acid side chain would prevent the NADH from associating correctly. This latter fact is made more evident by the 10-fold+ greater spectral binding constants for H 4 NAD and NAD + Of notable importance is the fact that all substitutions at residue Y112 resulted in altered and/or diminished differential spectra when titrated with NAD + This indicates 88

PAGE 109

89 that the hydroxyl group of Y 112 is important to properly or ient the product. In its absence, the NAD + adopts an altered conformation fo r binding. Despite this fact, the differential spectra for the variants in the presence of H 4 NAD retained similar line shape to WT, with only diminished intensities. This indicates that the isosteric analog was bound similar in the variant. Unlike Y112, residue Q210 demonstrated a moderately higher level of tolerance to substitutions made to the si de chain. In the case of all va riants, catalytic efficiency was decreased, but not to the magn itude observed in Y112. Intere stingly, affinity for binding of substrate, as indicated by both the K m value from NADH:FR assays and the K s values in the presence of H 4 NAD and NAD + was increased in the case of Q210R. From in silica modeling of the cb5r structure with th e Q210R mutation we observed that the positive charge on the WT residue centered in the area between the pyrophosphate and adenine moieties of NAD + would be diminished in the Q210R variant. This change might result in a decrease in the attraction in this area, but would not eliminate it entirely, thus not decreasing the binding co nstants associated with it. Furthermore, the distal end of the side chain in Q210R redirects away from the NAD + as compared to the WT. This would decrease any physical/steric obstruction that would exist in the native structure, thereby allowing for easier access of NAD + to the environment, explaining the increased affinity observed for Q210R. Q210V also showed an increased affinity for NAD + as determined by differential spectroscopy, which was also likely due to the decreased steric hindrance from the shortened side chain. Due to the greater affinity shown for NAD + in both Q210R and V, we conducted inhibitio n assays in the presence of NAD + The resulting K i values (data not shown) for the Q 210R and Q210V variants (639 M and 677

PAGE 110

90 M respectively) were not significantly diffe rent than the value for WT cb5r (675 M), indicating that the decreased catalytic effici ency was not due to product inhibition, and instead likely results from misalignment between the cofactor and substrate.

PAGE 111

NAD Q210 A NAD R210 B Figure 27. Structures of WT cb5r and the Q210R Variant with FAD Generated in silica. The molecular model of cb5r displaying the charged surfaces of (A) residue Q210 and (B) cb5r variant Q210R in association with FAD generated utilizing the automated comparative protein modeling server SWISS-MODEL [111] and analyzed using the molecular modeling software Web Lab Viewer Pro [134]. This model represents a surface representation of cb5r in complex with FAD (1IB0 ) where the acidic residues are red, basic residues are blue, and neutral residues are displayed as white clouds. 91

PAGE 112

92 Characterization of the Type I Recessive Congenital Methemoglobinemia Mutants T116S and E212K In proximity to the two highly conserved NAD + phosphate backbone binding residues, Y112 and Q210, are two additional residues of which naturally occurring mutants have been identified that result in a diagnosis with type I Recessive Congenital Methemoglobinemia. These naturally occurr ing mutations are T116S and E212K, both originally discovered in patients of African American decent. Previous studies first iden tified a transversion of C-to-G at co don 116 in exon 5 of cb5r, resulting in a T116S mutant, which was found in two unrelated African American methemoglobinemic patients. Further anal ysis demonstrated that not only did both patients have the variant, their asymptomatic relatives as well as unselected healthy African-American controls with normal enzymatic function were also either heterozygous or homozygous for th is substitution, with an al lelic frequency of 0.23 [135]. The T116S mutation was not, however, f ound in Caucasian, Asian, Indo-Aryan, of Arabic subjects tested, thus suggesting that this was a high frequency polymorphism unique to African American populations. To date, however, no selective advantage has been linked to the presence of this polymorphism [135]. Further studies were carried out on one of the patients having the T116S mutation. The patient was found to also be homozygous for a G to A transition in exon 8 at codon 212 resulting in the amino acid substitution E212K. The patients mother was also shown to be heterozygous fo r this mutation, and displayed decreased enzymatic activity. Unlike the T116S mutation, analysis indicate d that among 62 African-American and 54 unselected white individuals, the E212K muta tion occurred only in the propositus and her

PAGE 113

93 mother, indicating that E212K is not a polymorphism. The combination of a polymorphism and a single pathogenic mutati on has been shown to result in disease phenotypes in the case of fatal familial insomn ia, Creutzfeld-Jacob disease, and primary hyperoxaluria type I. Thus it is possible that the E212K mutation is alone causative of RCM type I in the patient, or it may interact with the T116S, and this combination leads to the disease phenotype [135]. To further elucidate the effects of the naturally o ccurring T116S polymorphism and the E212K mutation on the functioning of c b5r, a series of variants were generated including T116S, E212K and a double mutant T116s/E212K as described in Methods and Materials, utilizing the original four-h istidine tagged cb5r expression construct and the corresponding oligo nucleotide primers listed in Appendix A. These variants were characterized on the basis of kinetic, spect ral, and thermal stability parameters. UV/visible absorbance spectra were obtai ned for oxidized samples of the purified RCM variants T116S, E212K, and T116S/E212K and were compared with the spectra obtained for the corresponding WT domain in (F igure 28A). All three variants exhibited spectra identical to that of the WT do main, characterized by absorption maximum detected at 273 nm in the UV range of the spectrum, and a peak at 461 nm with an associated pronounced shoulder in the range of 485-500 nm in the visible region of the spectrum, the latter peak attributable to proteinbound flavin. The A 273 nm /A 461 nm absorbance ratios of the variants were within the range of 5.9 0.2, comparable to values previously obtained for WT rat cb5r of 5.7 0.2 [121], indicating a full complement of the FAD prosthetic group. To assess any alterations in the secondary st ructural content of the different type I

PAGE 114

Figure 28. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the RCM Type I Associated Mutants T116S, E212K and T116S/E212K (A) UV/visible absorption spectra were obtained for oxidized samples of cb5r and the T116S, E212K and T116S/E212K mutants at equivalent flavin concentrations (1.7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. The inset shows an expanded region of the visible spectrum where the flavin prosthetic group makes a major contribution. Individual spectra correspond to WT cb5r ( ____ ); T116S (-----); E212K ( -.-.); and T116S/E212K (-..-..-); (B) UV CD spectra were recorded using enzyme samples (7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. (C) Visible CD spectra were recorded using enzyme samples (50 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. Line styles shown in B and C are the same as those depicted in A. 94

PAGE 115

95 RCM cb5r variants, circular dichroism spectra were recorded in the UV wavelength range (190-300 nm). As shown in Figure 28B, all three variants exhibited positive CD spectra from 190-210 nm and negative CD sp ectra from 210-250 nm with the spectra retaining both positive and negative intensitie s very similar to that of the WT domain. The absence of any significant differences betw een the spectra of the various mutants and the WT domain suggested conservation of th e secondary structure architecture and that none of the amino acid substitutions or dele tions had any substantial effects on the folding of the protein. Visi ble CD spectroscopy was utilized to examine the environment of the FAD prosthetic group. As shown in Figure 28C, al l three variants generated exhibited visible CD spectra that were virtua lly indistinguishable fr om that of WT cb5r, indicating that none of the amino acid substi tutions had any significant effect on the conformation of the bound FAD prosthetic group. To assess the effect of the mutations on the catalytic function of the enzyme, initial rate kinetic parameters for NADH:FR a ssays were determined for the WT cb5r and for each purified variant. The values obtai ned for the NADH:FR assays are presented in Table 11. Of the three mutations, the doub le mutant T116S/E212K demonstrated the greatest decrease in both k cat and K m NADH retaining approximately 31% of WT catalytic efficiency (k cat / K m NADH ) with the individual mutations T116S and E212K retaining 45% and 37% of WT efficiency respectively. The observed decrease on overall catalytic efficiency was attributable to both moderate decreases of the k cat as well as a decrease in substrate affinity, with observed K m NADH of each mutant being 1-1.5 times greater than that of WT enzyme. To examine the influence of the various amino acid substitutions on protein

PAGE 116

96 stability, the thermal NADH:FR inactivation profile coupled with the increase in intrinsic flavin fluorescence and emission intensity of e ach of the variants was monitored and was compared to values obtained for WT enzyme. The results obtained for the thermal denaturation profiles and changes in intrinsic flavin fluorescence are shown in Figure 29. Changes in the intrinsic fluorescence of th e cofactor or the retention of NADH:FR activity following thermal denaturation was an effective indicator of the stability of the core structure of the protein. T 50 values (the temperature at which 50% of maximum fluorescence and 50% retention of NADH:FR activ ity was detected) are reported in Table 11 and ranged from of 49.6 C for the T116S/E212K mutant to a high of 55.5 C for the T116S variant as compared to a T 50 of 56 C obtained for WT cb5r. Table 11. NADH:FR Kinetic Consta nts and Thermal Stability (T 50 ) Values for the Type I RCM Associated Mutant s T116S, E212K, and T116S/E212K NADH:FR cb5r Variant k cat K m NADH K m FeCN6 k cat / K m NADH (s -1 ) (M) (M) (s -1 M -1 ) T 50 (C) WT H 4 cb5r T116S E212K T1116S/E212K 800 17 6.0 1 8 1 1.4 0.3 x 10 8 676 11 10.8 0.8 8 1 6.4 0.6 x 10 7 546 10 10.5 0.9 7 1 5.2 0.5 x 10 7 498 23 11.4 0.9 8 1 4.4 0.6 x 10 7 56.1 55.5 51.2 49.6 Differential spectroscopy was used to ev aluate the effect of the RCM mutations on the binding affinity for both the isosteric NADH analog H 4 NAD and NAD + As shown in Figure 30, both of the individual muta tions resulted in similar line shapes for the spectra in both titrations, and exhibited moderately increas ed affinity, as indicated by decreased K s values, for both titrated compounds (T able 12). The T116S/E212K double

PAGE 117

% Fluorescence Intensity Figure 29. Temperature Stability Profiles Obtained for the Type I RCM Associated Mutants T116S, E212K, and T116S/E212K. Oxidized samples of WT H 4 cb5r (5 M FAD) and cb5r RCM variants were incubated at the indicated temperatures, and aliquots were withdrawn and assayed for both residual NADH:FR activity (closed symbols) and intrinsic flavin fluorescence (open symbols) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0 using excitation and emission wavelengths of 450 nm and 523 nm, respectively. Points correspond to (,) H 4 cb5r; (, ) T116S; (, ) E212K; and (, ) T116S/E212K mutant showed lineshape and K s value comparable to that of WT for the H 4 NAD titration. In titrations with NAD + however, a diminished intensity was noted in the titrated spectra, while maintaining similar line shape. The binding constant again, was significantly decreased (187M compared to 553M for WT) indicating increased 97

PAGE 118

98 affinity for the product. Effects of potential structural changes on the properties of the flavin prosthetic group were examined by determining the oxidation-reduction poten tials for the FAD cofactor as described in the Methods section. Flavin midpoint potentials (E n = 2) for the FAD/FADH 2 couple were determined for the vari ants alone and in the presence of NAD + Spectra obtained during a representative titration of the WT cb5r protein are shown in Figure 31. With out the addition of NAD + to the titration, each of the mutations demonstrated midpoint potential s equivalent to that of WT, ranging from -272mV to 266mV. In the presence of NAD + however, all the mutations had midpoint values that ranged from -208mV to -200 mV, showing a positiv e shift, as was observed for WT cb5r. Values for midpoints at reported in Table 12. Table 12. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the Type I RCM muta nts T116S, E212K and T116S/E212K E FAD/FADH2 (mV) cb5r Variant K s H4NAD (M) K s NAD+ (M) -NAD + +NAD + WT H 4 cb5r T116S E212K T116S/E212K 45 10 37 12 20 2 56 3 553 30 261 23 88 6 187 13 -271 -269 -266 -272 -191 -200 -205 -208

PAGE 119

99 Figure 30. Spectroscopic Titrations of WT cb5r and the Type I RCM Mutants T116S, E212K, and T116S/E212K in the presence of H 4 NAD and NAD + Titrations of all mutants (50 M) were performed in split cell optical cuvettes in 10mM phosphate buffer containing 0.1mM EDTA, pH 7.0 at 23 C Difference spectra were recorded following the addition of solution containing H 4 NAD (5mM) (A, C, E, G) NAD + (30mM) (B, D, F, H). The inset panel corresponds to a plot of the magnitude of the spectral perturbations at the indicated wavelengths versus pyridine nucleotide concentration where a difference spectrum was observed. Plots of the relative absorbance changes observed are as follows: (A, B) WT cb5r; (C, D) T116S; (E, F) E212K; and (G, H) T116S/E212K.

PAGE 120

100

PAGE 121

101 Summary of the Characterization of the Ty pe I Recessive Congen ital Methemoglobinemia Mutants T116S and E212K Previous investigations by Prchal et al. [135] identified two unique point mutations in the DIA 1 gene of individuals of African American decent displaying disease phenotype for Type I RCM. The two mutations correspond to two di stinct amino acid substitutions in the cb5r protein, T 116S and E212K, with one individual being homozygous for both mutations. After furthe r investigation incl uding samples from a large pool of unselected individuals of diverse ethnic back grounds, it was concluded that, while the E212K mutation was unique to indi viduals expressing a disease phenotype, the T116S mutation was a polymorphism, occurri ng in approximately 20% of healthy African American subjects, bu t not found in subjects of di fferent ethnic backgrounds [135]. Thus, it is likely that the E212K mutation is the causat ive agent in the presentation of RCM in the patient. The data here furt her investigated the properties of E212K, as well as T116S and a double mutant T1116S/E212K in order to determine the nature of these variants and how their contributi on to the presentation of the disease. Both residues are located on the external surface of the cb5r protein as shown in Figure 32. Neither residue is involved in a ny contacts between th e protein and its cofactor or substrate. Thus, any effect on the catalytic function of the enzyme would likely be the result of alterations to interactions betw een residues, protein stru cture, or stability. Analysis of the structure of the mutant s through the use of UV/Visible absorbance and circular dichroism spectro scopy indicated that the mutant s did not differ significantly in overall secondary structure fr om the WT protein, and incor porated the FAD cofactor in a similar manner. Initial-rate kinetic studies indicated that the mutants maintained greater

PAGE 122

102 than 50% of the rate of turn -over exhibited by the WT enzy me, and did not significantly differ in the binding affinity for substrate as indicated by similar K m values. In addition, differential spectroscopy i ndicated that each of the three mutants bound H 4 NAD, a nonreactive analog of NADH, in a ma nner similar to WT and with equal or greater affinity. The mutants did, however, differ from WT in two significant properties. First, thermal stability studies, monitoring decrease of activity and increase of intrinsic fluorescence as a function of increasing temperature, showed that each of the mutations, not just E212K or the double mutant, re sulted in decreased stability, with T 50 values significantly lower than that of WT, particularly in the cas e of the double mutation. This would indicate a potential causation for th e disease phenotype. Since circulating erythrocytes do not generate additional copies of proteins during their lifespan, proteins with a decreased stability would degrade over time and thus not be able to properly and efficiently carry out their functions. This is a common cause for type I RCM, which is limited to dysfunction in the soluble c b5r found in circulat ing erythrocytes. The second notable difference found in al l the mutants as co mpared to WT, was an increased affinity for NAD + as shown in differential spectroscopy. While the line shapes for the spectra resulting from titration with increasing amounts of NAD + were similar to that of WT, each of the th ree mutant proteins exhibited lower K s values, suggesting that they were able to bind NAD + more efficiently than WT. This suggests the possibility of competitive inhibition of catalytic function The premise that E212K is itself sufficient to elicit the disease phenotype observed in a homozygous individual having the mutation is plausible. The mutation clearly does decrease the catalyt ic properties of the protein, al beit only moderately, which

PAGE 123

103 Figure 31. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the WT cb5r and the Type I RCM Associated Mutants T116S, E212K, and T116S/E212K. Reductive dye titrations were performed at 25 C as described in Materials and Methods using phenosafranine as the indicator dye in 100 mM phosphate buffer containing 0.1 mM EDTA, pH 7.0. Nernst plots in the absence (A) and presence (B) of 2 mM NAD + Plots correspond to () H 4 cb5r; () T116S; () E212K; and () T116S/E212K

PAGE 124

would likely invoke the minor phenotypic presentation of symptoms seen in the patient; the patient had slightly elevated methemoglobin levels and exhibited enzyme activity close to that of a heterozygous individual. Additionally, the decreased stability generated by the E212K mutation likely adds to the presentation, limiting the amount of partially functional protein available to reduce methemoglobin. The stability issue is potentially due to the introduction of a lysine which can become involved in cross linkages in the protein, destabilizing interactions among residues leading to a less thermally stable protein overall. This alteration to structure is likely only minor, as no significant changes in CD spectra were noted, but enough to cause the decrease in stability. E212 T116 Figure 32. Structural Model of cb5r Showing Position of Residues T116 and E212. Ribbon depiction of the tertiary structure of WT cb5r. Residues T116 and E212 are presented in CPK form. Residues are located on the external surface of the protein outside the FAD and NADHbinding pocket. 104

PAGE 125

105 Most interesting of the re sults, however, is the fact that the T116S substitution, reported as a polymorphism that occurs in 20% of the African American population, was also responsible for causing decreased functiona lity of the protein. The results for T116S were along the same degree of severity as the E212K mutation. Th e main difference appeared in the stability of the variant, with T116S demonstrating a thermal stability equivalent to that of WT. Since the T116S variant is not unstable, it would not degrade in the circulating erythrocytes, and thus not generate the same level of presentation as the E212K mutation. This could explain why individuals with the polymorphism appear healthy and without signs of methemoglobi nemia. The combination of the T116S substitution with E212K does how ever increase the detrimental effects of both mutations. The proposition that the presence of the polymorphism T116S in conjunction with the mutation E212K may potentially increase th e effect of the mutation was analyzed by characterization of a double mutant containing both substitutions. Similar results were observed for the double mutant as were obs erved in the E212K variant, with the detrimental effects to catalytic efficiency and stability presenting to an even greater degree than with the E212K substitution alone Again, it would seem that the greatest impact of the mutations is in decreasing the stability of the protein, decreasing the life span of the protein in the erythrocytes.

PAGE 126

106 Mutagenesis of conserved residue G179: Ro le in Pyridine Nucleotide Specificity Within the cb5r primary structure, four sequence motifs have been identified that are involved in either flavin binding (RxY T S xx S N ) and FAD/FMN selectivity (Gxx S T ), or reduced pyridine nu cleotide binding (GxGxxP and CGxxxxM) [22, 136] together with several residues that have been shown to regulate NADH/NADPH sepcificity [123]. One of th e conserved motifs involved in pyridine nucleotide binding corresponds to the six amino acid residue motif, GxGxxP, that comprises residues G180 to P185 in the carboxyl-terminal lobe of rat cb5r (Figure 33). However, structural studies have identified a number of additional residues that also surr ound this motif in the primary sequence and which are potentially involved in regulating nucleotide binding, including G179, which is obligatorily conserved in all cb5r primary structures identified to date with the exception of the outer mitochondrial membrane form of S. cerevisiae cb5r [137]. Within the X-ray structure of the rat c b5r diaphorase domain (PDB=1I7P), G179 has been shown to be located at the terminus of the strand N 1, which is part of a sixstranded parallel -sheet motif, and just prior to the start of the helix N which comprises residues G180 to K195, both of which comprise part of the pyridine nucleotide-binding lobe [58]. Residues G179 to G182 form a compact four residue segment of the sequence that effectively reverses the directi on of the polypeptide backbone and initiate s the start of the -helical segment. In addition, analysis of the diaphorase domain structure ob tained in complex with NAD + (PDB=1IB0) has revealed that while G179 provides no direct electrostatic or hydrogen bond contacts with either the nicotinamide or ribose moieties of the bound NAD + the two conserved glycine residues

PAGE 127

in the adjacent GxGxxP motif, corresponding to G180 and G182, do participate in Species Sequence Accession # H. sapiens 173 SVGMIAG GTGITPMLQVIRAI 193 NP_000389 B. taurus 173 SVGMIAG GTGITPMLQVIRAI 193 P07514 S. scrofa 145 SVGMIAG GTGITPMLQVIRAI 163 1NDH R. norvegicus 173 SVGMIAG GTGITPMLQVIRAV 193 P20070 M. musculus 176 KLGMIAG GTGITPMLQLIRAI 197 NP_084063 G. gallus 127 HLGMIAG GTGITPMLQLIRHI 147 XP_416445 D. rerio 176 SLGLIAG GTGITPMLQLIRDI 196 AAH45880 I. furcatus 173 HLGMIAG GTGITPMLQIIRGI 193 CK408748 X. laevis 173 HLGMIAG GTGITPMLQLIRAI 193 BC045265 D. melanogaster 184 RVNMIAG GTGITPMLQLAREV 204 NM_168479 A. gambiae 229 QVGLIAG GTGITPMLQLIREV 249 XM_309347 C. elegans 182 HLSMIAG GTGITPMLQVIAAI 202 NP_504638 S. japonicum 177 RVNMICG GSGITPMFQLLSYI 197 AAP05890 A. thaliana 155 AFGMLAG GSGITPMFQVARAI 175 T52470 C. maxima 189 HIGMIAG GTGITPMLQVIDAI 209 AAK69398 Z. mays 153 AFGMLAG GSGITPMFQVARAI 173 AAD17694 O. sativa 179 QIGMIAG GTGITPMLQVVRAI 199 AK071324 M. acuminata 38 DIGMIAG GTGITPMLQVIKAI 58 AAR88781 S. pombe 168 HFGMIAG GTGITPMLQIIRAV 188 NP_587852 N. crassa 175 HFGMVAG GTGITPMLQVIRAI 195 XP_322302 M. alpina 165 AIGMIAG GTGLTPMLQIIRAI 185 AB020034 L. major 167 AYAAIAG GTGITPILQIIHAI 187 CAB92390 G. zeae 142 KIGLIAG GTGITPMFQVIRAV 162 BAC66099 D. disciodeum 161 SIGMLAG GTGITPMLQVIKAI 181 EAL64774 P. falciparum 220 HIVMIAG GTGMTPFFRLINHL 240 CAD52795 S. cerevisiae 186 HLGMIAG GTGIAPMYQIMKAI 206 CAA86908 S. cerevisiaeOM 161 SITLLGA GTGINPLYQLAHHI 181 P36060 :: :*:*::*: :: 107 Figure 33. Multiple sequence alignment of cb5r primary structures. Various eukaryotic cb5r amino acid sequences deposited in GenBank were retrieved, aligned using the CLUSTAL X algorithm and the alignment optimized for maximum sequence conservation. Only the portions of the sequences surrounding the conserved pyridine nucleotide-binding GxGxxP motif are shown for clarity. Beginning and ending residue numbers within the translated GenBank sequences are indicated by superscripts while the conserved glycine residue corresponding to G179 in R. norvegicus cb5r is shown in bold face and underlined. The consensus sequence is also shown below with identical residues indicated by * and similar residues indicated by :. S. cerevisciaeOM corresponds to the sequence of the outer mitochondrial form of S. cerevisciae cb5r.

PAGE 128

108 hydrophobic contacts with the nicotinamide por tion of the pyridine nucleotide substrate (Figure 34). The GxGxxP pyridine nucleotide-bind ing motif is conserved in all other members of the ferredoxin:NADP + reductase superfamily of flavoprotein transhydrogenases, including th e prototypical member, FNR [22] However, the nature of the residue preceding the motif exhibits some heterogeneity, although amino acids with primarily hydrophobic side chains appear to comprise the most frequently utilized residues. Further, studies of the determinants of coenzyme specificity in Anabaena PCC7119 FNR have indicated that amino acid resi dues that are not directly situated in the 2-phosphate NADP + interacting region, such as T155 (w hich is equivalent to G179 in cb5r), may influence NADP + /NAD + selectivity [138]. To probe the role of G179 in cb5r structure and function, mutant constructs encoding for the variants G179A, P, T, a nd V were generated through site-directed mutagenesis as described in M ethods utilizing the original four-histidine tagged cb5r expression construct and the corresponding oligo nucleotide primers listed in Appendix B. The selected amino acid residues (A, P, T and V) have been shown to commonly occur at the equivalent positions within other members of the FNR superfamily. The goal of these mutations was to examine the effects of these substitutions on the spectroscopic and thermodynamic properties of the FAD prosth etic group and inte ractions with the physiological reducing substrate, NADH. Mutant constructs encoding the four diffe rent cb5r variants, G179A, P, T and V, which corresponded to the most frequently en countered amino acid re sidues occurring at positions corresponding to G179 in the FN R superfamily of pyridine nucleotide-

PAGE 129

dependent flavoprotein transhydrogenases, were generated through directed mutagenesis of the original four-histidine tagged cb5r construct. Nucleotide sequencing confirmed the NAD + T184 T181 G182 G180 G179 I183 P185 Figure 34. Structural Model of G179 and the GxGxxP Motif. Schematic diagram of a portion of the R. norvegicus cb5r X-ray crystal structure (PDB = 1IB0) showing the arrangements of the amino acids that comprise the conserved GxGxxP motif and residue G179 that precedes the motif. Amino acid residues are shown in ball and stick representation using the CPK color scheme while the appropriate portion of the peptide backbone is displayed as a ribbon diagram. The location of the complexed NAD + is shown in stick representation using the CPK color scheme. 109

PAGE 130

110 fidelity of each construct and each of the mutant proteins was subsequently expressed in the E. coli strain BL21(DE3)-RIL and purified to homogeneity by Ni-chelate chromatography and gel filtration FPLC. Eval uation of the expressi on yields of the various mutants indicated that all four G179 variants were expressed at levels comparable to that of the WT domain. All four mutant s were purified to appa rent homogeneity as evident by the presence of single protein bands following SDS-PAGE analysis of the various mutants, which also indicated molecula r masses comparable to that of the native enzyme (M r approx. 32 kDa). The oxidized forms of all four purified G179 variants were yellow in color indicating the incorporation of a flavin prosthetic group a nd confirming that G179 did not provide backbone or side-chain contacts that we re essential for the st able incorporation of the flavin prosthetic group in to any of the cb5r variants. UV/visible absorbance spectra were obtaine d for oxidized samples of each mutant and WT cb5r and are compared in Figur e 35A. The G179A, G179P G179T and G179V variants each exhibited spectra comparable to that of the WT enzyme with an aromatic absorption maximum detected at 270 nm in th e UV region of the spectrum, and a peak at 461 nm with an associated pronounced shoulder in the range of 485-500 nm in the visible region of the spectrum, attri butable to protein-bound flavin. None of the mutant visible spectra were blue-shifted with respect that of the WT protein, as has been previously demonstrated for mutations of other residue s, such as R91P [102] and Y93H [1221], suggesting that none of the G179 substitu tions had any significant influence on the spectroscopic properties of the FAD. Blue sh ifts in the visible absorbance spectra of flavoproteins have previously been attribut ed to changes in the hydrophilicity of the

PAGE 131

flavin environment near the N(5) locus of the isoalloxazine ring Figure 35. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the G179 Series of cb5r Variants. (A) UV/visible absorption spectra were obtained for oxidized samples of cb5r and the various G179 mutants at equivalent flavin concentrations (1.7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. The inset shows an expanded region of the visible spectrum where the flavin prosthetic group makes a major contribution. Individual spectra correspond to WT cb5r ( ____ ); G179A ( ----); G179P ( .. ); G179T ( -.-.) and G179V ( -..-..-). (B) UV CD spectra were recorded using enzyme samples (7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. (C) Visible CD spectra were recorded using enzyme samples (50 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. Line styles shown in B and C are the same as those depicted in A. 111

PAGE 132

112 [139, 140]. Absorbance ratios (A 280 nm/461 nm ) were within the range 6.1 + 0.2 for all four mutants and were comparable to that obtaine d for WT cb5r indicating a full complement of the FAD prosthetic group. To assess the secondary structural content of each of the mutant enzymes, CD spectra were recorded in the UV wavelength range (190-300 nm). As shown in Figure 35B, all of the cb5r variants exhibited pos itive CD from 190-210 nm and negative CD from 210-250 nm with all the spectra retaining both positive and nega tive intensities very similar to that of the WT domain. The abse nce of any significant di fferences between the spectra of the WT and mutant proteins suggested conservation of the secondary structure architecture and that none of the G179 resi due substitutions had an y deleterious effects on the folding of the diaphorase domain. Visible CD spectroscopy was utilized to examine the environment of the FAD prosthetic group. As shown in Figure 35C, all four mutants exhibited visible CD spectra that were virtually indistinguishable from that of the WT domain and indicated that none of the amino acid substitutions had any si gnificant effect on the conformation of the bound chromophore. Previous spectroscopic analyses of cb5r mutants containing altered residues that are involved in FAD-binding, such as S127 [122], have revealed visible CD to be a sensitive i ndicator of flavin conformation changes. The extent of quenching of the intrinsi c fluorescence due to the FAD prosthetic group of cb5r has also proven to be a sensitive indicator of the re tention of the native flavin environment. To probe the flavin fluorescence quenching of the various G179 mutants, both excitation and emission fluor escence spectra were r ecorded prior to and following heat denaturation of the various mutants. Prior to denaturation, WT cb5r and

PAGE 133

113 the G179 variants quenched the flavin fluor escence to varying degr ees ranging from 95% for the WT enzyme to only 60% for the G1 79V variant, with the G179A, P, and T variants being quenched 89% 81%,and 68% respectively. To examine the influence of the various G179 residue substitutions on the stabilities of the resulting proteins, therma l denaturation profiles were generated for WT cb5r and each of the mutant proteins by m easuring both changes in the intrinsic flavin fluorescence emission intensity ( em =523 nm) and retention of NADH:FR activity following incubation of the proteins at temperatures ranging from 0 C. Changes in the intrinsic fluorescence of the cofactor or the retention of NADH: FR activity following thermal denaturation was an effective indicator of the stability of the core structure of the protein. T 50 values (the temperature at which 50% of maximum fluorescence or 50% retention of NADH:FR activity was detected) increased in the order G179A < G179P < G179T < WT < G179V with all variants exhibiting T 50 values in the range between 52 and 57 C, which suggested that none of the substitutions had a dramatic effect on the thermal stability of flavin bindin g. The G179T variant exhibited a T 50 value of approximately 54 C, in good agreement with the value of 55 C obtained for WT cb5r. The A and P variants exhi bited slightly lowered T 50 values at 53 C and 52 C respectively, while the V mutation caused an increase in the value to 57 o C, suggesting a potential small increase in stability. These results suggested that substitution of G179 with alanine, proline, threonine or valine residues had only modest effects on the thermal stability of the diffe rent cb5r variants. Initial-rate kinetic analyses were perf ormed on all four cb5r G179 mutants to evaluate the effects of the various residue substitutions on NAD(P)H utilization. Values

PAGE 134

114 derived for k cat and K m for both NADH:FR and NADPH:FR activities of the various mutants are given in Table 13A and 13B respectively together with the corresponding values obtained for WT cb5r. With the exception of the G 179A variant which retained 70% of WT activity with a corresponding four-fold decrease in affin ity for NADH, the remaining three variants exhibited both substantially decreased NADH: FR activities and NADH affinities with the G179V variant showing the most dramatic changes. NADH catalytic efficiencies, as indicated by k cat / K m NADH were observed to decrease in the order WT > G179A > G179P > G179T > G179V with the G179V varian t retaining only 0.01 % of the NADH:FR efficiency of the WT protei n. In contrast, NADPH:FR efficiencies, as indicated by the values of k cat / K m NADPH were only modestly altered and increased in the order G179P < G179V < G179T < WT < G179A with the G179A mutant exhibiting the smallest increase in NADPH:FR efficiency, correspond ing to approximately 8%, when compared to the WT protein. It should be noted that while none of the G179 variants displayed the desired properties of rapid tu rnover of NADPH together wi th a high Michaelis constant for NADH, the G179V variant exhibited both significantly decreased activity with NADH coupled with a substantial decrease in NADH affinity combined with an increased affinity for NADPH. However, the values for the NAD(P)H specificity constant (defined as the ratio of {k cat / K m NADPH }/{ k cat / K m NADH }) listed in Table 15, and whic h reflect the magnitudes of the individual k cat and K m values obtained for both NAD H and NADPH, were observed to increase in the order WT < G179A < G 179P < G179T < G179V. As anticipated, the relatively conservative substitution of G179 with alanine had the lowest impact on

PAGE 135

Table 13. NAD(P)H:FR and NADH:BR kinetic constants obtained for G179 mutants. A. NADH:FR cb5r Variant k cat (s -1 ) K m NADH (M) k cat /K m NADH (s -1 M -1 ) K m Fe(CN)6 (M) WT H 4 cb5r 800+ 17 6+ 1 1.4+ 0.3x10 8 8+ 1 G179A G179P G179T G179V 595 + 18 42 + 2 33 + 2 12 + 1 25 + 2 595 + 40 662 + 37 1077 + 78 2.3+ 0.2x10 7 7.1+ 0.8x10 4 5.1+ 0.5x10 4 1.1+ 0.2x10 4 8 + 1 7 + 1 8 + 1 7 + 1 B. NADPH:FR Nucleotide Specificity Constant cb5r Variant k cat (s -1 ) K m NADPH (M) k cat /K m NADPH (s -1 M -1 ) a WT H 4 cb5r 33+ 5 924+ 15 3.6+ 0.3x10 4 2.6x10 -4 G179A G179P G179T G179V 48 + 8 17 + 3 12 + 2 8 + 1 1360 + 322 2317 + 702 507 + 145 375 + 25 3.9 + 0.2x10 4 8.4 + 0.4x10 3 2.6 + 0.1x10 4 2.2 + 0.1x10 4 1.7x10 -3 1.2x10 -1 5.1x10 -1 1.9x10 0 a The nucleotide specificity constant, is defined as the ratio {(k cat /K m NADPH )/(k cat /K m NADH )}. C. NADH:BR Variant k cat (s -1 ) K m cyt b 5 (M) WT H 4 cb5r 600 + 17 12 + 2 G179A G179P G179T G179V 245 + 17 10 + 1 18 + 2 17 + 2 8 + 1 1 + 0.1 43 + 2 107 + 8 altering the degree of NAD(P)H selectivity, corresponding to only an approximately 7-fold increase in NADPH selectivity. This can be contrasted with increases of 304-fold 115

PAGE 136

116 and 462-fold for the G179P and G179T vari ants, respectively, whereas the greatest increase in NADPH selectivity, correspondi ng to 7,692-fold enhancement, was observed for the G179V mutant. To compare the interactions of the va rious G179 variants and WT cb5r with various pyridine nucleotides, differential spec troscopy was utilized to monitor complex formation. Alterations of the flavin visibl e absorbance spectrum, shown in Figure 36, were detected for the WT enzyme during titrations with H 4 NAD and NAD + but not with H 4 NADP or NADP + These tetrahydronico tinamide derivatives do not function as hydride donors when substituted for NADH in either the NADH:FR or NADH:BR cb5r assays but are valuable tools for examini ng the binding affinity for NADH and NADPH, respectively. Both H 4 -nucleotides are close isosteric analogues and are assumed to involve the same contacts at the active site as NADH or NADPH, but lack the positive charge on the nicotinamide ring that is present on NAD + and NADP + respectively. In contrast, for the G179 mutants, spectral differences indicatin g detectable complexes were only observed for the G179A variant with H 4 NAD, yielding a K s of 238 M, which may be compared with the corresponding value of 85 M obtained for WT cb5r. Values for the K s determinations are given in Table 14. These results suggested that pyridine nucleotides containing a 2-phosporyl groups were most readily accommodated by the G179V variant. That the WT cb5r showed no detectable complex formation with any of the 2-phosphor ylated nucleotides suggests a significant role for G179 in discriminating between NADH and NADPH. To examine whether substitution of G179 influenced NAD(P)H utilization through modulation of the flavin oxidation-reduction midpoint potential, potentiometric

PAGE 137

titrations were performed using the dye equilibration method for WT cb5r and the different G179 variants in the presence of phenosafranine (E o = -252 mV) as indicator. Flavin midpoint potentials (E o , n=2) were determined for the enzymes alone and in Figure 36. Spectroscopic Titrations Obtained for the G179 Series of Variants in the Presence of H 4 NAD and NAD + Difference spectra were obtained for both WT cb5r and the selected G179 mutants at equivalent flavin concentrations (50 M FAD) in 20 mM MOPS buffer, containing 0.1 mM EDTA, pH 7.0 following titrations with either H 4 NAD (left panels) or NAD + (right panels) as described in Methods. (A and B) WT cb5r; (C and D) G179A; (E and F) G179T. G179P and G179V gave spectra identical to G179T. The insert panels correspond to plots of the magnitudes of the observed spectral perturbations (peak to trough measurements at the indicated wavelengths) versus ligand concentration. The corresponding K s values are given in Table 16. 117

PAGE 138

118 complex with NAD + Qualitative analysis of the individual spectra obtained from the various titrations indicated that the majority of the phenosafranine was reduced prior to FAD reduction for all four G179 variants and WT cb5r in the absence of any pyridine nucleotide, suggesting the flavin midpoint pot entials were more negative than that of phenosafranine, for all the cb5r variants exam ined. Analysis of the spectra obtained for the G179A and G179P variants and WT cb5r in the presence of NAD + revealed that the majority of the flavin was reduced prior to the dye, suggesting that complex formation significantly perturbed the flavin midpoint potentials to values more positive than that for phenosafranine for these three protei ns. In contrast, the presence of NAD + had less effect on the titration behavior of the G179T and G 179V variants, suggesting little perturbation or modulation of the FAD redox potential. Table 14. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the G 179 Series Variants E FAD/FADH2 (mV) cb5r Variant K s H4NAD (M) K s NAD+ (M) -NAD + +NAD + WT H 4 cb5r G179A G179P G179T G179V 45 10 238 33 ND a ND a ND a 553 30 1083 260 ND a ND a ND a -271 -272 -270 -271 -274 -191 -208 -224 -254 -262 a ND indicates that the spectroscopic bindi ng constant could not be determined, due to insufficient spectral change. The flavin redox potentials (n=2) for the different G179 variants and WT cb5r alone or as the enzyme-nucleotide complex we re determined from the Nernst semi-log

PAGE 139

119 plots shown in Figure 37B and C. The sta ndard midpoint potentials obtained for the FAD/FADH 2 couple in both the WT enzyme (E o = -272 mV) and the different G179 variants (E o = -270 mV to -274 mV) were approximat ely equivalent for all five proteins in the absence of any pyridine nucleotide, th e values spanning a range of only 4 mV. In contrast, significant differences in flavin midpoint potential were observed for the WT cb5r and the G179 variants in the presence of NAD + In the presence of NAD + the redox potential of the FAD/FADH 2 couple in the WT enzyme was positively-shifted by 78 mV (E o = -193 mV) which may be compared to the values of -207 mV for the G179A variant, -225 mV for G179P, -254 mV for G179T and -263 mV for G179V, respectively, illustrating that the progressively decreased affinity for NAD + observed in the G179 variants was reflected in progressively smalle r perturbations of the flavin redox potential. Values obtained for the midpoint potentials both in the absence and presence of NAD + are given in Table 14.

PAGE 140

A B Figure 37. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the G179 Series of cb5r Variants. Reductive dye-equilibration titrations of WT and the different G179 variants of cb5r (40 M FAD) were performed as described under Methods. Individual spectra were collected at 2-3 min intervals during the time course of the titrations. (B) Nernst plots obtained for the FAD/FADH 2 couple (n=2) are shown for the titrations of the various G179 mutants and correspond to WT cb5r (), G179A (), G179P (), G179T () and G179V (). (C) Nernst plots obtained for the FAD/FADH 2 couple (n=2) in the presence of NAD + (2 mM) are shown for the titrations of the various G179 mutants and correspond to WT cb5r (), G179A (), G179P (), G179T () and G179V () 120

PAGE 141

121 Summary of Mutagenesis of conserved residue G179: Role in Pyridine Nucleotide Specificity The preceding results provide the first doc umented insights into the role of G179 in maintaining both the structure and function of cb5r and contribute additional evidence to support a role for this residue (or its equi valent) in modulating the pyridine nucleotide selectivity within the fl avoprotein transhydrogenase superfamily of enzymes. A multiple alignment of the 50 currently known cb5r prim ary structures deposited in GenBank revealed that of the approximate ly 275 residues that comprise the flavinand NADH-binding domains together with the intervening hinge re gion, G179 represents one of only thirteen conserved residues within the cb5r sequences, suggesting a potentially important role in functionality. Of the thirteen residues, four (Y93, T94, P95 and G124) and seven (G179, G180, G182, P18 5, N209, I215 and G274) are distributed throughout the FADand NADH-binding lobes, respectively, while two (G143 and P144) are present in the connecti ng hinge region. Several of these conserved residues are components of the four sequence motifs that are characteristic of the flavoprotein transhydrogenase family and have been th e subject of previous studies that have contributed to our understanding of the roles of individual residue s such as Y93 [121], T94 [43] and P144 [120]. To probe the role of G179 in substrate binding, hydrid e transfer, and NADH/NADPH discrimination, we have substituted the glycine residue with alternate amino acids that are primarily found at the equivalent position in other members of the FNR superfamily. Analysis of 1293 sequences that contain the NAD binding 1 domain, identified within the Pfam database (PF 00175) [141] and that contain the conserved

PAGE 142

122 GxGxxP nucleotide-binding motif, revealed that only a limited number of different residues were observed at the position preced ing this motif, which corresponded to G179 in cb5r. Proteins containing the NAD binding 1 domain exhibited a marked preference for residues that were either proline, thre onine or alanine, in addition to the dominant residue, glycine. The results of our mutagene sis studies revealed that substitution of G179 primarily affected the kinetic properties of th e enzyme with no significant adverse effects on the properties of the FAD chromophore. Absorption and CD spectra and FAD/FADH 2 redox potentials in the absence of NAD + for all four G179 varian ts were comparable to those of WT cb5r, as would be anticipat ed for mutations limited to the NADH-binding lobe. In contrast, the four amino acid subst itutions, A, P, T and V, were observed to adversely impact NADH utilization, both in terms of decreasing k cat and increasing K m with the magnitude of the perturbations greatest for the P,T and V substitutions. The changes in NADH affinity were also refl ected in the absence of spectral changes observed during the H 4 NAD and NAD + titrations and the more modest shifts in the flavin redox potential in the presence of NAD + The crystal structure of the cb5r-NAD + complex [58], has revealed that G179 is situated approximately 4-5 distant from the nucleotide opposite the pyrophosphate moiety and in a cleft formed by the ribityl and ribose moieties of NAD + G179 is not involved in any direct contacts with the pyridine nucleotide, suggesting that side chain substitutions should not adversely impact s ubstrate utilization. Ho wever, G179 and G180 comprise part of a tight 180 o turn within the polypeptide bac kbone that is situated at the apex of strand N 1 within the NADH-binding lobe and which precedes helix N 1 which

PAGE 143

123 forms part of the GxGxxP motif. Strand N 1 also makes extensive contacts with strand N 5, which comprises part of the second cons erved pyridine nucle otide-binding motif corresponding to residues C 273 to M278 (CGxxxM). This motif contains the activesite cysteine residue considered to be cr itical for accurately positioning the nicotinamide moiety prior to efficient hydrid e transfer [104]. Analysis of the crystal structure indicates that the close packing of side chains in this region effectivel y precludes accommodation of side chains other than that of glycine, a nd to a limited extent that of alanine, and that substitution by more bulky groups, such as those of P, T or V, would potentially result in distortion of the backbone configuration in the region of this turn that would be accompanied by displacement of the side chai n of C273 with concomitant decreases in both activity and substrate affinity. While the results of our mutational studies could be adequately described in terms of potential alterations in the positioning of residues comprising the two conserved pyridine nucleotide-binding motifs, th e observed changes in NADH/NADPH discrimination were less obvious. Our pr ior studies of NADH/NADPH discrimination have been limited to evaluating the contributions of D239 and F251 [123] towards regulating pyridine nucleotide specificity. Analyses of a series of both single and double mutants revealed that while F251 contributed modestly to specifici ty, construction of a D239T variant resulted in an approximately 40,000-fold increase in the efficiency of NADPH versus NADH utilization. In contrast, the results generated by our G179 mutants revealed the greatest increase in NADPH/ NADH discrimination, corresponding to an approximately 8,000-fold increase, wa s achieved for the G179V variant.

PAGE 144

124 Both sequence and structural analyses have indicated that several residues participate in NAD(H)/NADP(H) discrimination within the FNR superfamily. Changes in NAD(P)(H) specificity have been described fo r other constituents including FNR [142], cytochrome P450 reductase [143] and assimila tory nitrate reductase [144, 145], with the latter the only example of pyridine nucleot ide coenzyme studies that examined both NADHand NADPH-specific isoforms of the enzyme. For nitrate reductase, mutagenesis of two residues, S920 and R932 in the NADPH-specific isoform, resulted in a 7.3x10 4 fold change in nucleotide specificity whereas substitutions of the same residues in the NADH-specific isoform resulted in only a 6.2x10 3 fold alteration in selectivity. However, these studies of FNR family memb ers have primarily focused on residues that specifically interact with the 2-phosphor yl group while additional amino acid residues clearly participate in regulating pyridine nucleotide selectivity. Sequence alignments of FNR family members indicate that most of the constituents that favor NADP(H) as a substrate primarily contain the sequence T P V GxGxxP whereas those that utilize NAD(H) retain a glycine prior to the motif. Mutational studies of the re sidue prior to the GxGxxP motif, corresponding to G179 within cb5r, have previously been limited to analyses of T155 in Anabaena PCC7119 ferredoxin:NADP + reductase [138]. In FNR, the hydroxyl group of T155 has been suggested to function in NADP + /NAD + selectivity by participating in a H-bond network that is involved in mainta ining the correct backbone arch itecture of a loop comprising residues 261-268 (CGLRGMEE) within the nucleotide-binding lobe that is required for correctly orienting the bound NADP + for hydride transfer. Generation of the T155G variant revealed displacement of this loop together with an increased affinity for NAD +

PAGE 145

125 and decreased affinity for NADP + Within cb5r and other NAD(H)-utilizing FNR variants, an alternate arrangement of the H-bond network is observe d, together with a hairpin-like loop structure, corresponding to residues 272 to 280 (CGPPPMIQ), rich in proline residues. The organizati on of this proline-rich region would be disrupted by T, P or V substitutions at G179, resulting in NA DH binding in an altered conformation that both decreased NADH activity and affinity wher eas the catalytic e fficiency with NADPH would potentially remain unchanged. The cu rrent work complements the studies of Anabaena FNR and illustrates that mutating th e residue preceding the GxGxxP motif can alter pyridine nucleotide specificity in favor of ei ther NAD(H) or NADP(H) with varying degrees of efficiency. Finally, it should be noted that the e fforts to alter the NADH/NADPH specificity of cb5r have not generated changes of the magnitude produced for some other dehydrogenases, such as S. cerevisiae format dehydrogenase, where construction of the D196A/Y197R double mutant resulted in a 2,500,000-fold change in NAD + /NADP + specificity [146]. However, it is clear that for cb5r, residues positioned both at the pyridine nucleotide-binding site, such as D 239 [123] and some distance away, including G179, can each have a profound impact on NAD(P)H selectivity, suggesting that multiple mutations may be required to effectively reverse the enzymes pyridine nucleotide selectivity.

PAGE 146

126 Systematic analysis of the co nserved NADH binding motif 180 GxGxxP 185 In all members of the FNR family, a highly conserved motif of three residues, corresponding to GxGxxP, can be identified, and has been shown to be involved in the binding and association of the enzyme with NA D(P)H. Analysis of the crystal structure of cb5r allows for visualization of the impor tance of this motif in the proper orientation of the NADH substrate. Located at the amino-terminus of the 16-residue helical segment N 1, this motif plays a vital role in co rrectly aligning an d positioning the NADH for efficient electron transfer. Th e leading three resi dues, along with the preceding residue G179, form a compact segment that effectively reverses the direction of the polypeptide backbone, generating a f lattened surface against which the NAD + can position. The three ubiquitously conserved residues of this motif each participate in hydrophobic interactions with the nicotina mide portion of the pyridine nucleotide substrate, in the case of G180 and G182 (Figure 38), or, in the case of P185, the isoalloxazine ring of the FAD cofactor (Fig ure 39). These interactions in conjunction with the tendency for glycine and proline residu es, in general, to play roles in organizing and directing the backbone structure of polypeptides, suggest that the major part that the GxGxxP motif plays in cb5r function is as a scaffolding around which the NADH substrate is able to orient in order to result in efficient electron transfer. In addition to the three ubiquitously cons erved residues of this motif, the three intervening residues, T181, I183, and T184, each show a high level of conservation, with only a minor few substitutions seen in the sequences of other cb5r variants or in other members of the FNR family. X-ray crystallogr aphic studies of cb5r in the presence of NAD + have indicated that both T181 and T184 form potentially crucial hydrogen bonds

PAGE 147

Figure 38. Electrostatic Interaction of Amino Acid Residues G180, T181, and G182 with NAD + Bound to Cytochrome b 5 Reductase. Ligplot [99] of 1IB0. C, O, N, and P atoms are represented as white, blue, red, and violet spheres, respectively, while covalent bonds are violet sticks within NAD + and orange sticks within amino acid residues of the NADH-binding lobe. Hydrogen bonds are drawn as green dashed lines with distances between atoms labeled. Residues contributing to hydrophobic interactions are represented as arcs with rays and colored red. Referenced residues highlighted with red circle. with the substrate and cofactor respectively. The side chain of T181 forms a hydrogen bond interaction with nicotinamide ribose of NAD + (Figure 38), while T184 forms two side chain hydrogen bonds with the O4 and N5 atoms of the isoalloxazine ring of FAD (Figure 39). Additionally, the T94 equivalent in porcine cb5r (T66) has previously been shown to be involved in the stabilization of semiquinone intermediates within the 127

PAGE 148

reaction mechanism of cb5r [43]. This residue lies within 4.02 of residue T184, and also forms a backbone hydrogen bond to N5 of the isoalloxazine ring of FAD. Additional mutagenesis studies of T94 demonstrated that substitution of this residue hinders the release of a proton from the N5 position necessary for efficient electron transfer and proper cb5r function. The similar natures of the residues suggest that T184 may play role similar to T94 in the actions of cb5r [105]. Figure 39. Electrostatic Interaction of Amino Acid Residues T184 and P185 with FAD Bound to Cytochrome b 5 Reductase Ligplot [99] of 1IB0. C, O, N, and P atoms are represented as white, blue, red, and violet spheres, respectively, while covalent bonds are violet sticks within NAD + and orange sticks within amino acid residues of the NADH-binding lobe. Hydrogen bonds are drawn as green dashed lines with distances between atoms labeled. Residues contributing to hydrophobic interactions are represented as arcs with rays and colored red. Referenced residues highlighted with red circle. 128

PAGE 149

129 Finally, residue I183 does not form any inte ractions with either the FAD cofactor or the NAD + as shown by x-ray crystallography. While this could indicate a limited, if any, role for the residue, its high level of c onservation and tendency to be substituted by residues of similar structure and side chain characteristic s (valine and leucine) would suggest that the presence of non-polar residu e at this position is necessary for proper activity of cb5r, potential through affects, or lack there of, on nei ghboring residues in the tertiary structure. Overall, the high level of interaction of the residues of this motif with both the cofactor and substrate suggest a pivotal role for this motif in the proper functioning of cb5r. To probe the characteris tics of the individual residues of this motif and the role they play in the function of cb5r, a series of substitution mutants were generated for each residue. Initial studies centered on an alanine scanning of the motif, in which each residue was individually substituted with alanine, generating six variants for characterization. Following the alanine scan, additional variants were generated based on one of two criteria. For the ubiquitously cons erved residues, the substitutions were based upon the characteristic na ture of the side chains and the proposed structural role of the residues. For the intervening residues, va riants were based upon naturally alternate residues that occur naturally in equivalent positions in other cb5r variants or in members of the FNR family. The mutants generated and characterized for this aim were G180A, G180P, T181A, T181I, T181S, G182A, G182P, I183A, I183F, I183l, I183M, T184A, T184H, T184S, T184V, P185A, and P185G.

PAGE 150

130 Characterization of Alanine Substitution Mutants of 180 GtGitP 185 Mutant constructs encoding for the variants G180A, T181A, G182A, I183A, T184A and P185A were generated through s ite-directed mutagenesi s as described in Methods utilizing the original four-histidine tagged cb5r expression construct and the corresponding oligonucleotide pr imers listed in Appendix B. Nucleotide sequencing in both directions confirmed the correct sequence and proper introduction of each mutation, and each variant was further expressed in the E. coli strain BL21 (DE3)-RIL and purified to homogeneity via Ni-NTA agarose chro matography and size exclusion FPLC. Expression yields for each of the variants were comparable to that of WT cb5r. Purification to homogeneity was furthe r confirmed by SDS-PAGE analysis as demonstrated by the appearance of single protein bands, which displayed molecular masses comparable to that of WT cb5r (M r = 31 kDa). UV/visible absorption spectra were obtained for oxidized samples of WT cb5r and each of the variants generated and are shown in Figure 40A. With the exception of T184A, each of the variants displayed absorpti on spectra comparable to that of the WT domain characterized by an aromatic abso rption maxima at 272 nm in the UV region and peaks in the visible regi on at 386, 460, and a pronounced shoulder at 485 nm, all characteristic of simple fla voproteins, suggesting that none of the variants generated had any significant effects on the spectroscopic properties of th e flavin prosthetic group. T184A, however, demonstrated an alte red spectrum, with a blue-shifted max of 457 nm compared to that of the WT cb5r visible max of 461 nm. Shifts within the visible absorption spectra of flavoproteins have prev iously been attributed to changes in the hydrophilicity of the flavin e nvironment near the N(5) locu s of the isoalloxazine ring

PAGE 151

131 [102]. The absorption ratios (A 276 /A 461 ) for each viable mutant were within a range of 5.5 to 5.9 which indicated a full flavin complement. To establish the effects of each mutation upon the secondary structure of the oxidized protein, far UV CD sp ectra were recorded in th e range of 190 nm for each variant and WT cb5r. As shown in Figure 40 B, spectra of all of the mutants correlated well to the WT domain by displaying positiv e CD maxima at 196 nm and negative maxima at 222 nm, indicating that the mu tations introduced had no effect on the secondary structure char acteristics of the folded protein. The visible CD spectra of all the variants, with the exception of T184A, again di splayed spectra comparab le to that of WT cb5r, indicating that these mutations did not ge nerate alterations in the environment of the FAD-cofactor. As shown in Figure 40C, repr esentative spectra demonstrated that each variant retained a similar line shape as that of WT cb5r with positive maxima at 310 and 390 nm and negative maxima at 460 and 485 nm The spectrum for T184A demonstrated a similar line shape to WT, with the negative maxima shifting similarly to the shift seen in the UV-Visible Absorbance spectra. In order to determine how the GtGitP alanine variants affected the overall catalytic efficiency, initial-rate kinetic analyses were performed as described in Methods. Kinetic values obtained from th ese assays are reported in Table 15. As expected, all of the generated variants resu lted in a decreased specific activity when compared to WT cb5r, though over a wide rang e. For the NADH:FR assays the catalytic efficiencies, k cat / K m NADH for the variants were determined to range from 1.9 to 45.7% that of the catalytic efficiency of the WT do main. The large range of effects resulted in most cases from a combination of decr eased turnover and decreased affinity.

PAGE 152

Figure 40. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the WT cb5r and the GtGitP Alanine Variants. (A) Oxidized samples of WT and mutant cb5rs (10 M), (B) (7 M), and (C) (60 M) FAD in 10 mM phosphate with 0.1 mM EDTA, pH 7.0 buffer. The inset shows and expanded region of the visible spectrum where the flavin cofactor makes a significant contribution. Individual spectra correspond to ( ____ ) H 4 cb5r; ( ____ ____ ) G180A; ( __ __ __ ) T181A; ( _ _ ) G182A; ( . . ) I183A; ( __.__.__ ) T184A; and ( __. .__. .__ ) P185A. 132

PAGE 153

133 G182A, notably, increased the affi nity for substrate, having a K m equal to two-thrids that of WT cb5r. There was a defi nite trend showing that the ubi quitously conserved residues had a great impact on the rate of turnover than the intervening residues. This trend did not necessarily apply to the affects on K m however, as negative impa ct was seen in all mutants with the exception of G182. Table 15. NADH:FR Kinetic Consta nts and Thermal Stability (T 50 ) Values for the GtGitP Alanine Variants. NADH:FR T 50 cb5r Variant k cat K m NADH K m FeCN6 k cat / K m NADH (s -1 ) (M) (M) (s -1 M -1 ) (C) WT H 4 cb5r G180A T181A G182A I183A T184A P185A 800 17 6 1 8 1 1.4 0.3 x 10 8 178 15 68 4.3 7 1 2.6 0.4 x 10 6 487 8 20 1.1 7 1 2.4 0.2 x 10 7 288 7 4.5 0.3 7 1 6.4 0.6 x 10 7 640 7 12.7 0.9 7 1 5.1 0.4 x 10 7 341 12 7.8 0.1 7 1 4.4 0.2 x 10 7 47 2 15.6 1.2 8 1 3.0 0.3 x 10 6 56 52.5 53.8 52.2 51.6 53.5 51.7 To analyze the overall protein stabi lity of each of the variants, thermal denaturation profiles were generated utilizing thermal NADH:FR profiling in tandem with the loss of intrinsic flavin fl uorescence emission quenchi ng, following incubation of the proteins at temperatures ranging from 0-100 C. Changes in the intrinsic fluorescence of the FAD prosthetic group monitored togeth er with the retention of NADH:FR activity following thermal denaturation yielded a T 50 value, the temperature at which there is 50% of maximum fluorescence or 50 % retention of NADH:FR activ ity. The resulting graphs are presented in Figure 41. All variants demonstrated slightly decreased T 50 values ranging from 51.6 to 53.8C for the I183A and T 181A mutants respectively (Table 15).

PAGE 154

Though decreased, these values are still comparable to WT cb5r T 50 of 55C, only suggesting slight decrease in stability. Figure 41. Thermal Stability Profiles Obtained for the WT cb5r and the GtGitP Alanine Mutants. Oxidized samples of G180A, T181A, G182A, I183A, T184A, and P185A and WT H 4 cb5r (5 M FAD) were incubated at the indicated temperatures, and aliquots were withdrawn and assayed for both residual NADH:FR activity (closed symbols) and intrinsic flavin fluorescence (open symbols) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0 using excitation and emission wavelengths of 450 nm and 523 nm, respectively. Points correspond to: (,) H 4 cb5r; (, ) G180A; (, ) T181A; (, ) G182A; (, ) I183A; (hexagon) T184A; and (+) P185A. As demonstrated through the kinetic analyses, each of variants displayed an affect on the affinity of the enzyme for the NADH substrate. Thus, spectral binding constants were determined for each of the mutants utilizing differential spectroscopy in order to compare the affinities for both the substrate NADH and product NAD + As described in 134

PAGE 155

135 Methods, the NADH isosteric analog H 4 NAD was utilized to monitor complex formation and establish a spectral binding cons tant [106]. Differential spectroscopy was utilized to monitor complex formati on during titrations with either H 4 NAD or NAD + The results are illustrated in Figures 42 and Figure 43. For each of the variants, the titrations performed in the presence of H 4 NAD yielded spectra with altered line shape compared to that of WT cb5r (Figure 41). The alterations ranged in magnitude, with G180A, G182A, and T184A showing the most drastic alterations, adopting line shapes characteristic of ADP-Ribose, APAD + and NAD + respectively. Less drastic alterations were noticed in T181A, I182A, and P185A, each having spectra reminiscent of WT in the presence of H 4 4NAD, with alterations confined to the 450 to 500nm region. These alterations presented shifted positive maxima at ~415nm (T181A) or ~450nm (I1183A and P185A) compared to the WT spectra po ssessing positive maxima spectra at ~480nm. The line shapes appeared to be hybrids of H 4 NAD with other NAD + analogs, including PAAD + (T181A) and ADP-ribose (I183A). Titrations performed with the varian ts in the presence of the product NAD + again produced spectra with line shapes differing from that of WT (Figure 42). In the cases of G182A I183A T184A and P185A, the major difference was not as much in the line shape as it was in the magnitude between spectra of increasing concentration of titrant. G182A and T184A retained spectra most similar to that of WT, while I183 and P185A showed a significant decrease in the magnitude of the deflections. In addition to the decreased magnitude, the spectra of P185A were also some what sim ilar to that of WT in the presence of APHD + Spectra for G180A and T181A were dr astically different than that of WT, having spectra more comparable to WT titrations with 5-ADP (G180A) or only

PAGE 156

136 Figure 42. Spectroscopic Titrations Obtain ed for the WT cb5r and the GtGitP Alanine Variants in the Presence of H 4 NAD. Titrations of all mutants (50M) were carried out as previously described in 10mM phosphate buffer containing 0.1mM EDTA, pH 7.0 at 23 C. Difference spectra were recorded following the addition of solution containing H 4 NAD (5mM). The inset panel corresponds to a plot of the magnitude of the spectral perturbations at the indicated wa velengths versus pyridine nucleotide concentration where a difference spectrum was observed. Plots of the relative absorbance changes observed are as follows: (A) WT H 4 cb5r; (B) G180A; (C) T181A; (D) G182A; (E) I183A; (F) T184A; and (G)P185A

PAGE 157

137

PAGE 158

138 marginally similar to titration with PAAD + (T181A). The values obtained for the respective binding constants ( K s ) for all variants are given in Table 16. Interestingly, the K s values obtained for the variants in the presence of H 4 NAD were 1-2 times greater than that of the WT cb5r value of 45 M, indicating an affinity an d mode of binding similar to the WT domain. Additionally, P185A demo nstrated increased affinity, with a K s value less than that of WT. A greater effect was observed in the titrations performed in the presence of NAD + with the variants, excluding T184A, yielding K s values of >3-fold higher than WT. Table 16. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E o ) Obtained for the GtGitP Alanine Variants. K s E FAD/FADH2 (mV) cb5r Variant K s H4NAD (M) K s NAD+ (M) -NAD + +NAD + WT H 4 cb5r G180A T181A G182A I183A T184A P185A 45 80.3 62.5.9 74.1.4 114 106.8 34.4 533 1974 1760 802 1817 400 800 -271 -265 -270 -265 -265 -265 -270 -191 -220 -202 -233 -214 -217 -214 To examine the effects of the structural changes on the flavin prosthetic group of each variant, oxidation-reduction potentials for the FAD cofactor were determined utilizing the dye-equilibrati on potentiometric titration me thod for WT cb5r and the GtGitP mutants in the presence of phenosafranine (E = -252 mV). Flavin midpoint

PAGE 159

139 Figure 43. Spectroscopic Titrations Obtain ed for the WT cb5r and the GtGitP Alanine Variants in the Presence of NAD + Titrations of all mutants (50M) were carried out as previously described in 10mM phosphate buffer containing 0.1mM EDTA, pH 7.0 at 23 C. Difference spectra were recorded following the addition of solution containing NAD + (30mM). The inset pane l corresponds to a plot of the magnitude of the spectral perturbations at the indicated wa velengths versus pyridine nucleotide concentration where a difference spectrum was observed. Plots of the relative absorbance changes observed are as follows: (A) WT H 4 cb5r; (B) G180A; (C) T181A; (D) G182A; (E) I183A; (F ) T184A; and (G)P185A

PAGE 160

140

PAGE 161

141 potentials (E n=2) for the FAD/FADH 2 couple were determined both in the absence and presence of NAD + from the linear Nernst plots of the log [FAD ox /FAD red ] versus the potential (mV) and are shown in Figure 44. Values established fo r all redox potentials are shown in Table 16. Analysis of the midpoint potentials of the alan ine variants in the absence of any pyridine nucleotide indica ted that FAD reduction occurred after the reduction of phenosafranine, resulting in values comparable to that of WT cb5r, within the + 5mV standard error. Midpoint titrations carried out in the presence of NAD + all displayed a more negative shift in the redox behavior for all of the variants yielding values ranging from -220 for G180A to -202 fo r T181A. These values are similar to the reported value of -220 mV for that of free flavin [133].

PAGE 162

Figure 44. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the GtGitP Alanine Variants. Reductive dye titrations were performed at 25 C as described in Materials and Methods using phenosafranine as the indicator dye in 100 mM phosphate buffer containing 0.1 mM EDTA, pH 7.0. Nernst plots in the absence (A) and presence (B) of 2 mM NAD + Plots correspond to () H 4 cb5r; () G180A; () T181A; () G182A; () I183A; (x) T184A; and (+) P185A. 142

PAGE 163

143 Characterization of additional structural variants of the GtGitP NADH-binding motif of cb5r As stated above, various substitutions of the residues of the GtGitP motif were generated in order to further define the roles that the individual residues as well as the collective motif play in the functioning of cb5r. Following the alanine screening study described above, additional mutations were cr eated based upon the structural quality of the naturally occurring residue (in the ca se of G180, G182, and P185) or based upon alternative naturally occurring residues in FNR family members or in species variants of cb5r based on multiple sequence alignments (in the case of T181, I183 and T184). In the interest of clarity, only data from the residue s that generated a significant effect on cb5r structure or function as compared to WT or that are representative of multiple results have been reported in the following figures. The values of the spectral, kinetic, thermal stability and electrochemistry parameters for all generated variants are reported in the respective tables and in the text. Mutant constructs encoding the variants G180P, T181I, T181S, G182P, I183F, I183L, I183M, T184H, T184S, T184V, and P1 85G were generated through site-directed mutagenesis as described in M ethods utilizing the original four-histidine tagged cb5r expression construct and the corresponding oligo nucleotide primers listed in Appendix B. Nucleotide sequencing in both directions confirmed the correct sequence and proper introduction of each mutation, and each variant was further expressed in the E. coli strain BL21 (DE3)-RIL and purified to homogeneity via Ni-NTA agarose chromatography and size exclusion FPLC. Expression yields for each of the variants were comparable to that of WT cb5r. Purification to homogeneity wa s further confirmed by SDS-PAGE analysis

PAGE 164

144 as demonstrated by the appearance of singl e protein bands, which displayed molecular masses comparable to that of WT cb5r (M r = 31 kDa). UV/visible absorption spectra were obtained for oxidized sa mples of WT cb5r and each of the variants. Selected spect ra are shown in Figure 45A. With the exception of T184H and V, each of the variants displayed absorp tion spectra comparable to that of the WT domain by an aromatic absorption maxima at 272 nm in the UV region and peaks in the visible region at 386, 460, and a pronounced sh oulder at 485 nm, all characteristic of simple flavoproteins, suggesting that none of the variants generated had any significant effects on the spectrosco pic properties of the flavin pros thetic group. The T184 variants, however, demonstrated an alte red spectrum, with shifted max of 463 and 459 nm for the T184H and T184 V variants, respectively, as compared to that of the WT cb5r visible max of 461 nm. These shifts were similar to that seen in the T184A mutant, as well as that seen in T94H [105], and again reflect previously reported results attributable to changes in the hydrophili city of the flavin environment near the N(5) locus of the isoalloxazine ring [102]. The absorption ratios (A 276 /A 461 ) for each viable mutant were within a range of 5.5 to 5.9 which in dicated a full flavin complement. In order to establish the effects of each mutation upon the secondary structure of the oxidized protein, far UV CD spectra were recorded in the range of 190 nm for each variant and WT cb5r. Spectra of all of the mutants correlated well to the WT domain by displaying positive CD maxima at 196 nm and negative maxima at 222 nm, indicating that the mutations introduced had no effect on the secondary structure characteristics of the folded protein. As with the T184A mutant, the T184H variant was the only variant that demonstrated visible CD spectra significantly different than

PAGE 165

Figure 45. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the Wild-Type and the T184H, T184S, and T184V cb5r Variants. (A) Oxidized samples of WT and mutant cb5rs (10 M), (B) (7 M), and (C) (60 M) FAD in 10 mM phosphate with 0.1 mM EDTA, pH 7.0 buffer. The inset shows and expanded region of the visible spectrum where the flavin cofactor makes a significant contribution. Individual spectra correspond to ( ____ ) H 4 cb5r; ( __ __ __ ) T184H; ( ____ ____ ) T184S; and ( __. .__. .__ ) T184V. T184S spectra are representative of the spectra of variants not shown. 145

PAGE 166

146 that of WT cb5r, having an altered line shap e as well has shifted negative maxima in the 450-470nm range, indicating that this mutation generated alterations in the environment of the FAD-cofactor. Additionally, T184H s howed an effective removal of the positive maxima at 310nm, further indicating pertur bations to the FAD binding region. Figure 45B and C depicts selected spectra to hi ghlight the effects on the above described characteristics. In each panel, the spectrum for T184S variant represents the spectra of the additional mutants investigated, each bei ng comparable to WT cb5r. Also included are the T184H and T184V variants which show ed altered spectra. Representative spectra of the additional mutants demonstrated that each variant retained a similar line shape to that of WT cb5r with positive maxima at 310 and 390 nm and negative maxima at 460 and 485 nm. In some cases the magnitude of the positive of negative deflections were mildly altered, but not to a significant extent. In order to determine how the GtGitP alanine variants affected the overall catalytic efficiency, initial-rate kinetic analyses were performed as described in Methods. Kinetic values obtained from th ese assays are reported in Table 17. As expected, all of the generated variants resu lted in a decreased specific activity when compared to WT cb5r, though over a wide rang e. For the NADH:FR assays the catalytic efficiencies, k cat / K m NADH for the variants were determined to range from <.1% to 47.9% of the catalytic efficiency of the WT domain. The large range of effects resulted in most cases from a combination of decreased turnove r and decreased affinity. The introduction of a proline residue at G180 or G182 had dr astic effects and the rate of turnover of substrate, though only mild effects on bindi ng of substrate. I183M and T184H both caused a significant decrease in affinity for substrate, with K m values 6 times that of WT

PAGE 167

147 cb5r. In both cases, this was accompanied by a d ecrease in the rate of activity, especially in the case of T184H. T184V also showed a significant decrease in k cat as compared to WT. Table 17. NADH:FR Kinetic Cons tants and Thermal Stability (T 50 ) Values Obtained for the G180P, T181I/S, G182P, I183F/L/M, T184H/S/V, and P185G Variants. NADH:FR T 50 cb5r Variant k cat K m NADH K m FeCN6 k cat / K m NADH (s -1 ) (M) (M) (s -1 M -1 ) (C) WT H 4 cb5r G180P T181I T181S G182P I183F I183L I183M T184H T184S T184V P185G 800 17 6 1 8 1 1.4 0.3 x 10 8 0.28 0.03 17 4.3 8 1 1.7 0.4 x 10 4 310 8.3 22 1.1 7 1 1.4 0.1 x 10 7 655 18.3 13.6 0.3 7 1 4.8 0.3 x 10 7 0.07 .01 7.9 0.9 7 1 8.6 0.2 x 10 3 2 30 11.7 10 0.1 8 1 2.3 0.1 x 10 7 617 20.0 11.8 1.2 8 1 5.3 0.8 x 10 7 608 28.3 37.2 0.3 7 1 1.6 0.2 x 10 7 24.2 2.3 31.9 0.9 7 1 7.7 0.1 x 10 5 785 23.3 14.4 0.1 8 1 5.5 0.6 x 10 7 52.3 3.83 5.1 1.2 8 1 1.0 0.1 x 10 7 208 5.0 3.1 1.2 7 1 6.7 0.9 x 10 7 56.0 52.1 53.2 50.8 51.5 45.1 48.4 44.5 53.2 52.1 56.2 49.9 To analyze the overall protein stability of each of the variants, thermal denaturation profiles were generated utilizing thermal NADH:FR profiling in tandem with the loss of intrinsic flavin fl uorescence emission quenchi ng, following incubation of the proteins at temperatures ranging from 0-100 C. Changes in the intrinsic fluorescence of the FAD prosthetic group monitored togeth er with the retention of NADH:FR activity following thermal denaturation yielded a T 50 value, the temperature at which there is 50% of maximum fluorescence or 50% retention of NADH:FR activity. All variants

PAGE 168

148 demonstrated varied levels of decr eased temperature stabilities with T 50 values ranging from 44.5.6 to 56.2C for the I183M and T184V mutants respectively (Table 17). The I183 variants seemed to elicit the greatest effect on the thermal stability, with all substitutions causing a 5 to 12C decrease in T 50 value. The graphs of the T 50 data for the I183 series of variants are shown in Figur e 46. Additionally, the graphs of T181S and T184H are shown to illustrate the range obtained for the remaining variants. As demonstrated through the kinetic anal yses, several variants displayed altered affinities for substrate. To further investig ate this alterations, spectral binding constants were determined for each of the mutants utilizing differential spectroscopy in order to compare the affinities for both the substrate NADH and product NAD + As described in Methods, the NADH isosteric analog H 4 NAD was utilized to monitor complex formation and establish a spectral binding cons tant [106]. Differential spectroscopy was utilized to monitor complex formati on during titrations with either H 4 NAD or NAD + The results are illustrated in Figur es 47 and Figure 48 respectively. Titrations performed in the presence of H 4 NAD yielded spectra with a line shape similar to that of WT cb5r for the majority of the variants. The T181S, T184H/S/V, and P185G variants each showed spectra very similar to that of WT, with magnitude differences being the main disparity among th e spectra. The I183 series of variants demonstrated an altered line shape that had qua lities similar to that of WT in the presence of H 4 NAD. I183L and I183M generated spectra that were similar to H 4 NAD between 380 and 420nm, but was more similar to WT in the presence of NAD + in the region of 420 to 480nm. This hybrid quali ty to the spectra i ndicated an altered mode of binding. I183F generated spectra similar to that of WT titrated with NHD + G180P, G182P and

PAGE 169

Figure 46. Thermal Stability Profiles of Wild-Type cb5r and Selected Variants of the CGpppM Motif. Oxidized samples of each variant and WT H 4 cb5r (5M FAD) were incubated at the indicated temperatures, and aliquots were withdrawn and assayed for both residual NADH:FR activity (closed symbols) and intrinsic flavin fluorescence (open symbols) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0 using excitation and emission wavelengths of 450 nm and 523 nm, respectively. Selected variants shown for clarity. The graphs of T181S and T184 represent the boundaries of the range within which the remaining variants fit. The I183 variants demonstrated the most significant impact on thermal stability. Points correspond to: (,) H 4 cb5r; (, ) T181SA; (, ) I183F; (, ) I183L; (, ) I183M; and (x) T184H. T181I each generated spectra that were significantly different that that of WT titrated with H 4 NAD. The spectra of T181P was nearly identical to that of T181A in the presence of H 4 NAD, differing only in magnitude. G180P and G182P each generated spectra unlike any other previously analyzed NAD + analog, suggesting a drastic alteration 149

PAGE 170

150 to the binding environment for NADH. The values obtained for the respective binding constants ( K s ) for all variants are given in Table 18. Titrations performed for the varian ts in the presence of the product NAD + again produced diverse spectra with lin es shapes both similar to and differing from that of WT. Residues T181S, I183F/L/M, T184S, and P185G each generated spectra that mirrored that of WT cb5r titrated with NAD + differing mainly in magnitude of positive and negative deflections only, with mi nor alterations in the overall line shape of the spectra. T184H generated spectra similar to that expected for H 4 NAD, only differing in the absence of the negative maxima at 395nm. The remaining variants each generated unique spectra significantly different from WT, with the excep tion of G180P, which failed to generate a spectroscopically-active species during the titration within detectable concentrations. T181I again generated spectra similar to that obtained from T181A. The spectra generated for G182P in the presence of NAD + showed a high level of similarity to the spectra it generated in the presence of H 4 NAD. T184V generated spectra appearing as hybrids of the spectra obtained for WT in the presence of NAD + with spectra from titrations with PAAD + The values obtained for the respective binding constants ( K s ) for all variants are given in Table 18. To examine the effects of the structural changes on the flavin prosthetic group of each variant, oxidation-reduction potentials for the FAD cofactor were determined utilizing the dye-equilibrati on potentiometric titration me thod for WT cb5r and the GtGitP mutants in the pres ence of phenosafranine (E = -252 mV). Flavin midpoint potentials (E n=2) for the FAD/FADH 2 couple were determined both in the absence and presence of NAD + from the linear Nernst plots of the log [FAD ox /FAD red ] versus the

PAGE 171

151 Figure 47. Spectroscopic Titrations Ob tained for the WT cb5r and Selected Variants of the GtGitP Motif in the Presence of H 4 NAD. Titrations of all mutants (50M) were carried out as previously described in 10mM phosphate buffer containing 0.1mM EDTA, pH 7.0 at 23 C. Difference spectra were recorded following the addition of solution containing H 4 NAD (5mM). The inset panel corresponds to a plot of the magnitude of the spectral perturbations at the indicated wavelengt hs versus pyridine nucleotide concentration where a difference spec trum was observed. Plots of the relative absorbance changes observed are as follows: (A) WT H 4 cb5r; (B) G180P; (C) T181I; (D) G182P; (E) I183F; (F) I183L; and (G) T184S (representative of spectra of variants not shown)

PAGE 172

152

PAGE 173

153 Figure 48. Spectroscopic Titrations Ob tained for the WT cb5r and Selected Variants of the GtGitP Motif in the Presence of NAD + Titrations of all mutants (50M) were carried out as previously described in 10mM phosphate buffer containing 0.1mM EDTA, pH 7.0 at 23 C. Difference spectra were recorded following the addition of solution containing NAD + (30mM). The inset panel co rresponds to a plot of the magnitude of the spectral perturbations at the indicated wavelengt hs versus pyridine nucleotide concentration where a difference spec trum was observed. Plots of the relative absorbance changes observed are as follows: (A) WT H 4 cb5r; (B) G180P; (C) T181I; (D) G182P; (E) T184H; (F) T184V; a nd (G) T181S (representative of spectra of variants not shown)

PAGE 174

154

PAGE 175

155 potential (mV). Variants yielding significant alterations to the midpoints are shown in Figure 49. Graphs of the midpoint determin ation for P185G are representative of the majority of the variants. Values establishe d for all redox potentials are shown in Table 18. Analysis of the midpoint potentials of the variants in the absence of NAD + indicated that FAD reduction occurred after the reduction of phenosafranine, resulting in values comparable to that of WT cb5r, within the + 5mV standard error. Midpoint titrations carried out in the presence of NAD + resulted in values that were more negative, as compared to WT, for the majority of the va riants, with values ranging from -228 for G180P to -196 for T181S. Table 18. Spectral Binding Constants ( K s ) and Standard Midpoint Potentials (E ) Obtained for the G180P, T181I/S, G182P I183F/L/M, T184H/S/V, and P185G cb5r Variants. K s E FAD/FADH2 (mV) cb5r Variant K s H4NAD (M) K s NAD+ (M) -NAD + +NAD + WT H 4 cb5r G180P T181I T181S G182P I183F I183L I183M T184H T184S T184V P185G 45 10 370 16.7 72.5 7.9 63.3 3.4 211 12 29.7 3.2 35.7 1.9 36.3 2.1 35.1 2.2 24.8 1.9 62.6 5.1 22.6 3.1 533 30 ND a 1387 124 308 5.1 544 89 29 1.5 154 19 113 14 103 4.9 233 17 810 23 55 1.6 -271 -275 -271 -272 -275 -276 -276 -275 -276 -276 -275 -271 -191 -227 -203 -196 -210 -209 -206 -201 -228 -198 -217 -209 a ND indicates that the spectroscopic binding constant could not be determined, due to insufficient spectral change.

PAGE 176

Figure 49. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the Wild-Type cb5r and Selected Variants of the GtGitP Motif. Reductive dye titrations were performed at 25 C as described in Methods using phenosafranine as the indicator dye in 100 mM phosphate buffer containing 0.1 mM EDTA, pH 7.0. Nernst plots in the absence (A) and presence (B) of 2 mM NAD + Plots correspond to (A) () H 4 cb5r; () G180P; () G182P; () I183L; () T184H; (x) T184V; and (+) P185G. (B) () H 4 cb5r; () G180P; () T181S; () G182P; () I183F; (x) T184H; and (+) P185G. 156

PAGE 177

157 Summary of Systematic analysis of the conserved NADH binding motif 180 GxGxxP 185 Glycine and proline residues each confer structural qualities to the backbone of polypeptides. Glycine, lacking a side chain, al lows for a high level of rotational freedom in the backbone, allowing a polypeptide mo re rotational freedom and conferring a plastic like quality to the prot ein. Additionally, the lack of side chain eliminates steric problems, and allow for openness in a protei n useful, for example, in allowing substrate to contact and bind appropriately to a protein. Proline residues, being secondary amines, possess a distinctive cyclical structure to th e side chain which confers a exceptional level of conformational rigidity to a protein. Ther efore, the presence of the residues in a highly conserved protein domain indicates that the structural characteristics imbued by the residues are essential for proper function. Using c b5r as a model, we can see that, in part, the function of the GxGxxP motif in cb5r and other FNR family members would be to create a perch onto which the NADH can sit to be positioned for efficient electron transfer with the flavin cofactor. Homo logy modeling of the mutants of G180 (Figure 50) and G182 (Figure 51) further demonstrates how the distinct individual characteristics of glycine residues confer the necessary structural features for the proper association of NADH. From these models, it is evident that th e slightest alterations to the side chain at position 180 or 182, as demonstrated by alanine substitutions of these residue (Figures 50B and 51B), cause electrostatic interfer ence with the proper fitting of the NAD + molecule into the binding site. This effect is intensified in the proline substitutions (Figures 50C and 51C), where actual physical st eric hindrances can be noted. In the case of G180, the effect appears mostly directed toward the pyrophosphate moiety of NAD + potentially repositioning the nicotinami de and/or adenine moieties, whereas

PAGE 178

158 Figure 50. Structures of WT cb5r a nd G180A and G180P Variants with NAD + Generated in silica The molecular model of cb5r displa ying the charged surfaces of (A) residue G180 (blue stick) (B) cb5r variant G180A (green stick) and (C) cb5r variant G180P (magenta stick) in association with NAD + generated utilizing the automated comparative protein modeling server SWI SS-MODEL [111] and analyzed using the molecular modeling software Web Lab Viewer Pro [134]. Model depicts surface representation of the residue in transp arent wire mesh display style and NAD + in transparent display style. Models genera ted from cb5r in complex with FAD and NAD + (1IB0) where the acidic residues are red, basi c residues are blue, and neutral residues are white.

PAGE 179

A B C 159

PAGE 180

160 alterations of G182 appear to affect the nico tinamide moiety direc tly. This observation is further supported by the differential spectr oscopy results. For G180A, spectra obtained from titrations with NAD + were similar to those of WT c b5r titrated with 5-ADP. Since 5-ADP is a structural analog of NAD + lacking the ribose of the adenine moiety and the nicotinamide ring, a variant demonstrating spec tra similar in appearance to it indicates that the variant is affecting the proper orientation of the NAD + preventing either of those groups from properly fitting. The lack of detect able spectral difference for G180P again further indicates that placement of any obstruction in the 180 position prevents the substrate from being able to properly bind. The G182 variants again showed a correlation between the molecula r modeling and the differentia l spectroscopy in that the spectra obtained for both G182A and G182P titrated with NAD + were mirror images of the spectra of WT with ADP-ribose. This si milarity indicates that the substitutions at position 182 do indeed affect the proper association of NAD + by affecting the aligning of the nicotinamide moiety. As this is the por tion of the molecule i nvolved in the electron transfer reaction with FAD, incorrect or ientation of the ni cotinamide ring would drastically decrease the catalytic efficiency of the enzyme. This was evidenced in the NADH:FR assays for these residue s, yielding catalytic efficiencies less than 1% that of WT. From this we can conclude that the two glycine residues of GxGxxP motif are vital to the proper placement of the NADH to ensure correct interaction of the nicotinamide moiety with th e isoalloxazine ring of FAD. The other conserved residue in the GxG xxP motif, P185, appears to be important in maintaining the structural in tegrity of the secondary struct ure of cb5r in the proximity of the pyridine nucleotide binding pocket. Substitutions of this residue did not show any

PAGE 181

161 Figure 51. Structures of WT cb5r a nd G182A and G182P Variants with NAD + Generated in silica The molecular model of cb5r displa ying the charged surfaces of (A) residue G182 (blue stick) (B) cb5r variant G182A (green stick) and (C) cb5r variant G182P (magenta stick) in association with NAD + generated utilizing the automated comparative protein modeling server SWI SS-MODEL [111] and analyzed using the molecular modeling software Web Lab Viewer Pro [134]. Model depicts surface representation of the residue in transp arent wire mesh display style and NAD + in transparent display style. Models genera ted from cb5r in complex with FAD and NAD + (1IB0) where the acidic residues are red, basi c residues are blue, and neutral residues are white.

PAGE 182

A B C 162

PAGE 183

163 negative impact on the ability to associate and bind to NADH. In fact, substitution of this position with glycine resulted in enhanced binding affinity as shown by a 2-fold increase in K m NADH in the NADH:FR assay and increased K s values in the titration with H 4 NAD, indicating that the relaxing affects of glyc ine residue on the rigidity of the backbone structure allowed for the NADH to associat e better. This, however, was actually a negative consequence overall, as it prev ented the proper alignment of the NADH and FAD resulting in highly diminished catalytic activity. A structural model of P185 and its position in relation to NAD + and FAD is shown in Figure 52. The isoalloxazine ring is in proximity of the proline residue. Substituti ng the proline with a glycine would remove the electrostatic interactions allowing mo re openness to the binding pocket of NADH and FAD. This would explain the ability of the mutants to bind NADH with higher affinity. Further evidence of the structural importance of P185 is shown in the decreased stability observed in thermal denaturation stud ies. The relaxing of the backbone resulting from substitution of the proline caused the FAD cofactor to become more open to the environment, and as a result more easily removed, as demonstrated by an average T 50 value 5 C lower than WT. The effects of substitutions of residue I183 on the function of cb5r also result from structural perturbations, however with a decreased magnitude as compared to substitution of P185. Except in the cas e of I183F, the substitutions examined demonstrated a mild decrease in rate of turnover NADH. Additionally, with the exception of I183M, the substitutions only mildly decreased substrate affinity. Both of these substitutions represent non-conserve d mutations in resp ect to side chain characteristics. Introduction of an aromatic ring (I183F) or a polar sulfur group (I183M),

PAGE 184

Figure 52. Structure of WT cb5r residue P185 in Association with NAD + and FAD Generated in silica. The molecular model of cb5r displaying the charged surfaces of P185 in association with NAD + and FAD generated utilizing the automated comparative protein modeling server SWISS-MODEL [111] and analyzed using the molecular modeling software Web Lab Viewer Pro [134]. Model depicts surface representation of the residue in transparent wire mesh display style and NAD + and FAD in transparent display style. Models generated from cb5r in complex with FAD and NAD + (1IB0) where the acidic residues are red, basic residues are blue, and neutral residues are white. 164

PAGE 185

165 produced a more severe impact on cataly tic activity than th e smaller non-polar substitutions (I183A/L). This indicated that the effect of these mutations resulted from the physical structure of the side chain. The side chain of I 183 extends toward neighboring residues A178 and F207. Introduc tion of a large aromatic ring in this location would result in steric conflicts among these residues, causing an alteration in the local tertiary structure, sufficient to affect the functioning of the protein. Additionally, the substitution with methionine at this pos ition introduces a sulfur group near residue T184, disrupting its association with FAD. Th e main impact of the substitution of I183 occurs as a result of decreased stability as shown by the thermal dena turation results. All substitutions lead to a decrease in T 50 values ranging from 6-12 o C. While not directly involved with catalytic functi on or substrate binding, the pr esence of a small non-polar residue at position 183 is clearly required to assure folding into the proper tertiary structure allowing for effi cient activity of cb5r. The potential importance of residues T181 and T184 are self-evident from studies of the X-ray crystal structure of cb5r. Since the residues are involved in hydrogen bond formation with the substrate and cofactor, re spectively, T181 and T 184 should be vital in maintaining proper catalytic activity of the enzyme. The results of the characterization support such a hypothesis. In the case of T181, it is evident that the polarity of the residue is vital to correct function. Substitution with serine yielded only mild impairments across all spectral and catalytic parameters. Because the hydroxyl group of serine would face in the opposite direction of that of threonine, the distance from the N3 oxygen of the nicotinamide ribos e is increased by 1.07, and bond formation is impaired Figure 53. Replacement of non polar residue co mplete eliminates the ability of bond

PAGE 186

A B Figure 53. Structures of WT cb5r residue T181 and Variant T181S in Association with NAD + Generated in silica. The molecular model of cb5r displaying (A) residue T181 (green stick representation and (B) Variant T181S (blue stick representation) in association with NAD + generated utilizing the automated comparative protein modeling server SWISS-MODEL [111] and analyzed using the molecular modeling software Web Lab Viewer Pro [134]. Model indicates distance of the side chain oxygen (red stick) of each residue to the N3 oxygen of NAD + ribose. NAD + depicted in stick formation with CPK coloring. Models generated from cb5r in complex with FAD and NAD + (1IB0). 166

PAGE 187

167 formation, resulting in more drastic impairme nts. In the case of both T181A and T181I, the affinity for substrate was decreased, with K m values 3 times greater than that of WT. Additionally, both bound H 4 NAD in altered conformations indicating that the presence of a threonine residue and its hydroxyl gr oup are necessary for aligning NADH properly into the binding site. The similarity of the resulting differential spectra for both variants in to the spectra obtained for WT titrated with PAAD + which lacks the N7 nitrogen of NAD + points to the possibility that the s ubstitutions cause the NADH to adopt an orientation causing this nitrogen to be out of position. As th is nitrogen is involved in the electron transfer proc ess between NADH and FAD, alterati on of its position would lead to inefficient transfer. We proposed that substation of residue T184 would have a sign ificant effect on the environment of the FAD cofactor of cb5r and this was clearly demonstrated in the spectral shifts observed in both UV/Visi ble absorbance and circular dichroism spectroscopy studies. In addition, substitution of T184 resulted in drastically decreased rates of turnover. The reason for these obs ervation is the removal of two hydrogen bonds to the isoalloxazine ring of FAD. T184 forms bond with O4 and N5 of the FAD ring system, the latter of which is the location to which one hydrogen is added in the electron transfer process. Removal of this intera ction, demonstrate through the T184A variant, results in a moderately decreased catalytic e fficiency, likely due to destabilization of the NAD + -FAD semiquinone intermediate in a manner similar to that of T94 [43]. T184H yielded more drastic effects on the rate of turnover, decreasing it by 35-fold as compared to WT. The introduction of a large positive residue in this locatio n would more severely alter the electron tr ansfer process than merely rem oving the bond normally present. The

PAGE 188

168 alteration in the FAD environment was further confirmed by th e results of the oxidation/reduction poten tial of the FAD/FADH 2 couple which yielded a midpoint potential comparable to that of free flav in (-220 mV) in the absence and presence of NAD + indicating an unfavorable electron transfer environment. Little effect was seen on the ability to associate with NADH or H 4 NAD, indicating that the decrease in catalytic efficiency and electron transfer is mainly due to the missing stabil izing presence of the threonine side chain.

PAGE 189

169 Properties of the Type I recessive congenital methemoglobinemia mutants A178T and A178V. Preceding the highly conserved 180 GxGxxP 185 NADH-binding motif is an equally highly conserved residue of which two mutations have been identified which lead to clinical presentation of Type I RCM in two patients. The first of these mutations arises from a G535A mutation in exon 6 of the DIA1 gene. The mutation has been found in two unrelated individuals. The first patient was a newborn girl of Nort h African origin who presented with severe cyanosis, having low methemoglobin (metHb) reductase levels and 31% metHb in her circulating erythrocytes. Th e mutation predicts an A178T substitution. This substitution occurs in the N 2 sheet immediately preceding the NADH specificity/binding motif. The patient wa s found to be homozygous for the mutation, with both parents being heterozygous and presenting with normal metHb levels but decreased enzyme activity. No neurolog ical abnormalities were noted by age of 9 months, leading to diagnosis as Type I RCM [147]. The second patient was a male newborn of Turkish decent. He was cyanotic within one hour of birth, and had a metHb concentration of 25%. The pa tient responded well to treatment with methylene blue (0.5 mg/kg), reducing metHb levels to 2%. A s econd rise in metHb le vels was successful treated with ascorbic acid (20mg/kg/day), br inging the levels back down to 5-10%. No neurologic impairment was noted by age of 8 m onths, the age at the time of study [148]. In both cases, DNA samples from a pool of unrelated individuals were analyzed for the presence of the mutation. The mutation was not found in any of the additional subjects, and thus was determined to not be a polymorphism.

PAGE 190

170 In another patient, a C to T substitution was discovered at the second position of codon 178 in exon 6 leading to a replacement of A178 by valine. The patient, 29 years old at time of study, was of Thai origin a nd was first diagnosed at age 4. Born to a healthy mother, the patient was born full term and had been cyanotic since birth. Her only elder brother is healthy without cyanosis. Preliminary investigat ions indicated that the mutant retained near WT activity and substrate affinity, noting little difference between the two. Thermal stability studies indi cated that the mutant was less stable than the WT enzyme, and thus was concluded to be the causative agent for the cyanosis. As with the A178T mutation, the A178V mutation was looked for in additional individuals and ruled out as being a polymorphism [149]. The identification of the A178V mutation along with the finding of the A179T mutation, t ogether with the reported mutations at codon 204 [150, 151], make codons 179 and 204 the only ones within the cb5r gene where more than one mutation has been identified. To further elucidate the effects of the naturally occurring A178T and A178V mutations on the functioning of cb5r, varian ts of each mutation were generated as described in Methods, utilizing the orig inal four-histidine tagged cb5r expression construct and the corresponding oligonucleotide primers list ed in Appendix B. These variants were characterized on the basis of kinetic, spectral, and thermal stability parameters. UV/visible absorbance spectra were obtai ned for oxidized samples of the purified RCM variants A178T and A178V and were co mpared with the spectra obtained for the corresponding WT domain (Figure 54A). All three variants exhibited spectra identical to that of the WT domain, char acterized by absorption maximum detected at 273 nm in the

PAGE 191

171 Figure 54. Ultra-Violet, Visible, and Circular Dichroism Spectra Obtained for the Wild-Type and the RCM Type I Associated Variants A178T and A178V. (A) UV/visible absorption spectra were obtained for oxidized samples of cb5r and the A178T and A178V mutants at equivalent flavin concentrations (1.7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. The inset shows an expanded region of the visible spectrum where the flavin prosthetic group makes a major contribution. Individual spectra correspond to WT cb5r ( ____ ); A178T (---); and A178V ( .. .. ); (B) UV CD spectra were recorded using enzyme samples (7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. (C) Visible CD spectra were recorded using enzyme samples (50 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0. Line styles shown in B and C are the same as those depicted in A.

PAGE 192

172 UV range of the spectrum, and a peak at 461 nm with an associated pronounced shoulder in the range of 485-500 nm in the visible region of the spectrum, the latter peak attributable to proteinbound flavin. The A 273 nm /A 461 nm absorbance ratios of the variants were within the range of 5.9 0.2, comparable to values previously obtained for WT rat cb5r of 5.7 0.2 [121], indicating a full co mplement of the FAD prosthetic group. To assess any alterations in the secondary structural content of the different type I RCM cb5r variants, circular dichroism spectra were recorded in the UV wavelength range (190-300 nm). As shown in Figure 54B, all three variants e xhibited positive CD spectra from 190-210 nm and negative CD sp ectra from 210-250 nm with the spectra retaining both positive and negative intensitie s very similar to that of the WT domain. The A178T variant produced a spectrum with increased magnitude of the negative CD component. The absence of any significant di fferences between the spectra of various mutants and the WT domain suggested c onservation of the secondary structure architecture and that none of the amino acid substitutions or deletions had any substantial effects on the folding of the protein. Vi sible CD spectroscopy was utilized to examine the environment of the FAD prosth etic group. As shown in Figure 54C, all three variants generated exhibited visible CD spectra that were virt ually indistinguishable from that of WT cb5r, indicating that none of the amino acid substitutions had any significant effect on the conformation of the bound FAD prosthetic group. To assess the effect of the mutations on the catalytic function of the enzyme, initial-rate kinetic constants for the NADH:FR activity were determined for the WT cb5r and for each purified variant. The values obtained for the NADH:FR activities are presented in Table 19. Of the two mutati ons, the A178T variant demonstrated the

PAGE 193

173 greatest decrease in both k cat and K m NADH retaining approximately 34% of WT catalytic efficiency (k cat / K m NADH ). Decreased functionality was observed for bot h the rate of turn over and the affinity for substrate, having both parameters decreased by approximately 60% when compared to WT. The impact of th e A178V variant was less severe in nature, retaining 64% of WT efficiency, and a near equivalent rate of turnover to that of the WT enzyme. Table 19. NADH:FR Kinetic Constants and Thermal Stability (T 50 ) Values of the Type I RCM Associated Mutants A178T and A178V NADH:FR T 50 cb5r Variant k cat K m NADH K m FeCN6 k cat / K m NADH (s -1 ) (M) (M) (s -1 M -1 ) (C) WT H 4 cb5r A178T A178V 800 17 6.0 1 8 1 1.4 0.3 x 10 8 493 8.3 10.4 0.8 7 1 4.8 0.4 x 10 7 763 3.3 8.6 0.9 7 1 8.9 0.3 x 10 7 56.1 55.0 49.2 To examine the influence of the various amino acid substitutions on protein stability, the thermal NADH:FR inactivation profile coupled with the increase in intrinsic flavin fluorescence and emission intensity of e ach of the variants was monitored and was compared to values obtained for the WT en zyme. The results obtained for the thermal denaturation profiles and changes in intrinsic flavin fluorescence are shown in Figure 55. Changes in the intrinsic fluorescence of th e cofactor or the retention of NADH:FR activity following thermal denaturation was an effective indicator of the stability of the core structure of the protein. T 50 values (the temperature at which 50% of maximum fluorescence and 50% retention of NADH:FR activ ity was detected) are reported in Table

PAGE 194

19. A178T demonstrated equivalent stability as compared to WT while A178V proved to be less stable, having a T 50 value 7 C lower than that of WT. Differential spectroscopy was used to evaluate the effect of the RCM mutations on the binding affinity for both the isosteric NADH analog H 4 NAD and NAD + As shown in Figure 56, both of the mutations resulted in similar line shapes for the spectra obtained from the titrations with H 4 NAD, with minor alterations detected in the 415Figure 55. T Thermal Stability Profiles of the Type I RCM Associated Variants A178T and A178V. Oxidized samples of WT H 4 cb5r (5 M FAD) and cb5r RCM variants were incubated at the indicated temperatures, and aliquots were withdrawn and assayed for both residual NADH:FR activity (closed symbols) and intrinsic flavin fluorescence (open symbols) in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0 using excitation and emission wavelengths of 450 nm and 523 nm, respectively. Points correspond to (,) H 4 cb5r; (, ) A178T; and (, ) A178V 174

PAGE 195

175 490nm region. Both mutants exhibited an increased K s value, with A178V being only slightly elevated and A178T bei ng 2 fold higher when compared to WT cb5r (Table 20). In the case of titration with NAD + both mutations maintained a similar line shape to that of WT, however, at rath er diminished intensities. The resulting spectral binding constants followed the same pattern seen in the H 4 NAD titrations, with A178V having a value equivalent to WT and A1178T having a value 3 times that of WT (Table 20) Potential effects of structural changes on the properties of the flavin prosthetic group were examined by determining the oxidation-reduction poten tials for the FAD cofactor as described in the Methods section. Flavin midpoint potentials (E n = 2) for the FAD/FADH 2 couple were determined for the varian ts alone and in the presence of NAD + Spectra obtained during a representative titration of the WT cb5r protein are shown in Figure 57. In the absence of NAD + each of the mutations exhibited midpoint potentials equivalent to that of WT, with values of -275 and -276mV for the A178T and A178V mutants respectively. In the presence of NAD + however, both mutations demonstrated a positive shift in the midpoint pot ential, but not to the same extent seen in the WT domain in the presence of NAD + with values of -212mV and -201 mV for the A178T and A178V mutants resp ectively. Midpoint values are reported in Table 20.

PAGE 196

176 Summary of Properties of the Type I re cessive congenital methemoglobinemia mutants A178T and A178V. Previous investigations [ 147-149] identified two unique point mutations in the DIA 1 gene of individuals of North African and Turkish decent (A178T) and from Thai decent (A178V) displaying disease phenotype for Type I RCM. The two mutations resulted from single point mutations in the DIA1 gene coding for c b5r protein, and were found to be unique to the patients, and not polymorphisms in the respective populations. Analysis of the structure of the mutants through the use of UV/ Visible absorbance and circular dichroism spectro scopy indicated that the mutant s did not differ significantly in overall secondary structure from the WT protein, and incorporated the FAD co-factor in a similar conformation. Initial-rate kineti c studies indicated that the mutants retained greater than 50% of the rate of turn-ove r exhibited by the WT enzyme, and did not significantly differ in the binding affinity for the reducing substrate as indicated by similar K m NADH values. Differential spectroscopy i ndicated that the A178V mutant bound Table 20. Spectral Binding Constants ( K s ) and Standard Midpoint Obtained for the Type I RCM Associated Muta nts A178T and A178V. K s (M) E FAD/FADH2 (mV) cb5r Variant K s H4NAD K s NAD+ -NAD + +NAD + WT H 4 cb5r A178T A178V 45 10 55 5 49 5 553 30 1530 37 545 1 -271 -275 -276 -191 -212 -201

PAGE 197

Figure 56. Spectroscopic Titrations Obtained for the WT cb5r and the Type I RCM Associated Variants A178T and A178V in the Presence of H 4 NAD and NAD + Titrations of all mutants (50M) were performed in split cell optical cuvettes in 10mM phosphate buffer containing 0.1mM EDTA, pH 7.0 at 23 C. Difference spectra were recorded following the addition of a solution of H 4 NAD (5mM) (A, C, E) or NAD + (30mM) (B, D, F). The inset panel corresponds to a plot of the magnitude of the spectral perturbations at the indicated wavelengths versus pyridine nucleotide concentration where a difference spectrum was observed. Plots of the relative absorbance changes observed are as follows: (A, B) WT cb5r; (C, D) A178T; and (E, F) A178V. 177

PAGE 198

178 H 4 NAD in a conformation similar to WT and w ith equal or affinity. However, the A178T mutant, while binding the analog in a similar conformation, did so with a decreased affinity. In titrations with NAD + the results indicated hi gh level of similarity between the A178V mutant and WT enzyme, with the A178T mutant again showing a decreased affinity for the produc t. Midpoint potential determ inations further highlighted the similarity between A178V and WT and the difference between A178T and WT. The potential in the presence of NAD + for A178T was closer to that of free flavin than to WT, suggesting inefficiency in the ability to tran sfer electrons in the mutant. A178V also showed a more negative poten tial in the presence of NAD + as compared to WT, but to a lesser degree, a fact mirrored in its retention of catalytic efficiency similar to that of WT as shown by the NADH:FR assays. From this data, it can be concluded that it is the presence of the polar hydroxyl group on the side chain of A178T that resulted in the decrease in activity. From homology modeling studies, we ge nerated structures of each mutant to compare to WT to illustrate what potential effects would occur, as shown in Figure 58. The introduction of the threonin e side chain caused an electrostatic interference with th e backbone of I183 (Figure 58B). The introduction of a negative charge in this region would cau se an alteration in the helical structure, as evidenced by the increased negative maxima seen in the circular dichroism spectra in the far UV region. While not a major alteration, it is strong enough to cause a displacement in the nearby GxGxxP motif preventing the subs trate from binding in the appropriate orientation. While differential sp ectroscopy indicated that A178T bound H 4 NAD similarly to WT, the slight alterations seen in the 415-490nm area indicate a minor alteration in the conformation of the comple x. Thus, we proposed that the causative

PAGE 199

Figure 57. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the WT cb5r and the Type I RCM Associated Variants A178T and A178V. Reductive dye titrations were performed at 25 C as described in Materials and Methods using phenosafranine as the indicator dye in 100 mM phosphate buffer containing 0.1 mM EDTA, pH 7.0. Nernst plots in the absence (closed symbols) and presence (open symbols) of 2 mM NAD + Plots correspond to (,) H 4 cb5r; (, ) A178T; and (, ) A178V. agent of RCM in the case of the A178T mutation is a result of a minor displacement of the correct orientation of the NADH binding motif GxGxxP, leading to inefficient electron transfer from the bound NADH. Since this is a minor alteration, the overall effect results in a type I RCM. Correlating with previous studies [149], the A178V mutant retained the catalytic properties of the WT protein, with only slightly decreased efficiency. The main 179

PAGE 200

180 difference observed in the A178V mutant wa s in its thermal stability. The mutation proved to be less stable than WT as dete rmined by thermal dena turation. Having a T 50 value 7 C lower than WT, the mutant protein would not be able to remain efficient in circulating erythrocytes, thus le ading to a mild cyanotic phenotype in patients. In other cells of the body, degraded protein would be able to be cleared and newly translated protein, with efficiency similar to that of th e WT, would be able to compensate. Thus, as concluded by Higasa et. al. [149], the A178V results in type I RCM simply due to destabilization effects. However, homology modeling did not yield any indication as to where this destabilizing effect would occur. The most likely cause is again an affect on I183. As shown in Figure 58C, the presence of the branched side chain of valine could sterically hinder the neighboring I183 resi due, alterations of which have been demonstrated to lead to decreased thermal stability. To more accurately determine the cause of the destabilization, a crystal structure of the mutant enzyme would facilitate comparison of the A178V and WT structures.

PAGE 201

181 A B C Figure 58. Structures of WT cb5r Residue A178 and RCM Variants A178T and A178V Generated in silica. The molecular model of cb5r displaying (A) residue A178 (B) Variant A178T and (C) Variant A178V in association with NAD + generated utilizing the automated comparative protein modeling server SWISS-MODEL [111] and analyzed using the molecular modeling software Web Lab Viewer Pro [134]. The model indicates electrostatic surfaces of the residues in relation to residue I183. Residues and NAD + depicted in stick formation with CPK coloring. Models generated from cb5r in complex with FAD and NAD + (1IB0).

PAGE 202

182 The role of the NADH binding motif 273 CGxxxM 278 Within the cb5r primary structure, several sequence motifs have been identified that are involved in either flavin binding ( 91 RxY T S xx S N 97 ) or FAD/FMN specificity ( 124G R XX S T 127 ) or function in modulating re duced pyridine nucleotide binding ( 180 GxGxxP 185 and 273 CGxxxM 278 ). The second of these conserved motifs that are involved in regulating pyridin e nucleotide affinity, corre sponds to a six amino acid 273 CGpppM 278 residue motif that comprises the re sidues C273 to M278 in the carboxylterminal lobe of rat cb5r (Figure 59). Analysis of the structure of the diaphorase domain complexed with NAD + (PDB ID=1IB0) has revealed that the majority of the residues comprising the conserved CGxxxM motif do not provide any direct el ectrostatic or hydrogen bond contacts with either the nicotinamide or ri bose moieties of the bound NAD + with the notable exception of G274. However, the resi dues do form a loop connecting N 4 with the final helical return in the NADH binding domain. This loop is generated by three sequential proline residues which effectively i nduce a kink into the backbone of the pr otein, causing an immediate redirection and initiating the fo llowing helical structure (Figure 59B). Additionally, the residues in this motif provide an extensive framework of hydrophobic contacts that are involved in binding the reducing substrate, NADH, specifically orienting the nicotinamide portion of the reduced pyrid ine nucleotide for subsequent efficient hydride transfer to the FAD pr osthetic group (Figure 59A). Within the CGxxxM motif, the conserved glycine, corresponding to G274, forms two critical hydrogen bonds with bound NAD + its backbone oxygen binding with the N7 nitrogen of the nicotinamide moiety. Also, C273 has been suggested to be important in maintaining equilibrium

PAGE 203

183 Figure 59. Electrostatic Interaction of the CGpppM Motif with NAD + (A) Ligplot [99] of 1IB0. C, O, N, and P atoms are represented as white, blue, red, and violet spheres, respectively, while covalent bonds are violet sticks within NAD + and orange sticks within amino acid residues of th e NADH-binding lobe. Hydrogen bonds are drawn as green dashed lines with distances betw een atoms labeled. Residues contributing to hydrophobic interactions are repres ented as arcs with rays a nd colored red. Residues of the motif are circled in red. (B) Schematic diagram of a portion of the R. norvegicus cb5r X-ray crystal structur e (PDB code IIB0) showing the ar rangements of the amino acids that comprise the conserved CGPxxxM mo tif Amino acids and the complexed NAD + are shown in stick representation usi ng the CPK color scheme. Hydrogen bonds are drawn as dashed green lines. Secondary stru cture of the protein is shown using line ribbon scheme, colored according to secondary structure with helices colored red, sheets colored blue, and turns colored white.

PAGE 204

A NAD + M278 C273 B 184

PAGE 205

185 between the unstacked configuration of bound NADH and the charge transfer complex [104]. To probe the role of this conserved motif in cb5r structure and function and to examine the effects of substituting these re sidues on the enzymes function, we have applied site-directed mutagenesis of the H4cb5r construct using the corresponding oligonucleotide primers listed in Appendix C as described in Methods as a tool to replace or alter the properties of each residue. This was done in two stages. First, the individual residues were each replaced with alanine (alanine-scanning mutagenesis). The resulting mutants were examined on the basis of the effects of thes e substitutions on the spectroscopic properties of the FAD prosthetic group and the interactions of cb5r with the physiological substrate, NADH. Based on the results of the alanine-scanning, additional mutants were constructed and again analyzed using the same parameters to give further insight into the function of the individual resi dues as well as the motif in its entirety. These additional variants consisted of th e four substitution mutations C273M, C273S, G274P, and G274S and two insertion mutations in which an alanine or glycine was inserted between residues P277 and M278. These single residue inse rtion mutants were generated as a result of other members of th e FNR superfamily, such as cytochrome P450 reductase and methionine synthase reductase exhibiting a motif with the structural CGxxxxM configuration.

PAGE 206

186 Mutant constructs encoding the C273A G274A, P275A, P276A, P277A, and M278A c ular dichroism (CD) spectra were recorded in the UV wavelength range (190 nm). As shown in Fig. 60B, the alanine variants exhibited positive CD from 190 to 210 nm and negative CD from 210 to 250 nm with the spectra retaining both positive and negative intensitie s very similar to those of the WT domain. The absence of any significant differences be tween the spectra of the WT and mutant Characterization of Alanine Substitution Mutants of the 273 CGpppM 278 motif cb5r variants, corresponding to th e residues in the c onserved CGPPPM sequence motif, were generated using site-dir ected mutagenesis of the original fourhistidine tagged cb5r constr uct. Dideoxy sequencing confir med the fidelity of the constructs. The mutant proteins were subseque ntly expressed in the E. coli strain BL21(DE3)-RIL and purified by metalchelate af finity chromatography and gel filtration FPLC. Evaluation of the expression yield of the variants indicated an expression efficiency comparable to that of the WT cb5r domain, indicating production of stable protein products which could be purified to apparent hom ogeneity as indicated by the presence of single protein bands following SDSPAGE analysis (results not shown). UV/visible absorbance spectra were obtai ned for both the oxidized samples of the alanine variants and WT cb5r as a contro l and are presented in Fig 60A. All of the variants exhibited spectra comparable to that of the WT enzyme with aromatic absorption maximum observed at 273 nm in the UV region of the spectrum, and peaks at 461 nm with an associated pronounced shoulder in the range of 485 nm in the visible region of the spectrum, attributable to protein-bound flavin. To compare the secondary structural char acteristics of the alanine variants with that of the WT protein, cir

PAGE 207

Figure 60. UV/Visible Absorption and CD Spectra of WT cb5r and the Alanine Mutants of the CGpppM Motif. (A) UV/vis absorption spectra were obtained for oxidized samples of cb5r and the various mutants at equivalent flavin concentrations (1.7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA at pH 7.0. The inset shows an expanded region of the visible spectrum where the flavin prosthetic group makes a major contribution. Individual spectra correspond to WT cb5r ( ___ ), C273A ( __ __ ___ _ _.._ _....... ), G274A (), P275A (------), P276A (), P277A ( ), M278A (----.) (B) UV CD spectra were recorded using enzyme samples (7 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA at pH 7.0. (C) Visible CD spectra were recorded using enzyme samples (50 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA at pH 7.0. Line styles shown in B and C are the same as those depicted in A. 187

PAGE 208

188 proteins suggested the conser vation of secondary structure and that the alanine residue substitutions had no deleterious effects on th e folding of the diaphorase domain. Similar results were observed for the corresponding visible CD spectra. Circular dichroism measurements were performed in the near -UV/visible range (300 nm) in order to probe possible effects of the mutations on bot h flavin conformation and polarity of the prosthetic group microenvironment. As show n in Fig. 60C, the spectra of the mutants were unperturbed when compared to that of WT cb5r, exhibiting positive maxima at 310 and 390 nm and negative maxima at approximately 460 and 485 nm,. suggesting no significant change in either the polarity of th e flavin environment or the conformation of the bound prosthetic group. To examine the influence of the residue substitutions on the stability of the resulting proteins, thermal denaturation profil es were generated for the alanine variants and WT cb5r by measuring changes in both intrinsic flavin fluorescence emission (Figure 61A) and retention of NADH:ferricy anide reductase ac tivity (Figure 61B) following incubation of the proteins at te mperatures ranging from 0 to 100 C. The temperature (T50) at which 50% of maximum fluores cence was detected or 50% of the proteins NADH:FR activity was retained, were e ffective indicators of the stability of the ith T50 values core structure of the protein. Each of the va riants displayed a reduced thermal stability related to that of the WT (Table 21) with G274A maintaining a T 50 value of 53 C, comparable to that of WT cb5r, followe d by the variants C 273A, P276A, and P277A variants which were approximately 4 C lower than that of WT cb5r suggesting that these residue substitutions had a moderate effect on the thermal stability. The most severally affected variants of the NADH-binding motif were P275A and M278A, w

PAGE 209

of 49 C and 46 C, respectively. These more significant decreases suggest that the alanine substitutions at amino acid residues P275 and M278 severely affected the overall stability of the protein. Figure 61. Thermal Stability Profiles Obtained for the WT cb5r and the Alanine P276A, P277A, M278A, and WT Hcb5r (5M FAD) were incubated at the indicated activity and intrinsic flavin fluorescence in 10 mM phosphate buffer, containing 0.1 mM Variants of the CGpppM Motif. Oxidized samples of C273A, G274A, P275A, 4temperatures, and aliquots were withdrawn and assayed for both residual NADH:FR EDTA, pH 7.0 using excitation and emission wavelengths of 450 nm and 523 nm, respectively. Points correspond to: () H 4 cb5r; () C273A; () G274A; () P275A; () P276A; (x) P277A; (+) M278A. As a measure of catalytic efficiency, NADH:FR activities were determined for the WT cb5r and alanine variants. Kinetic constants derived from these assays are reported in 189

PAGE 210

190 e for a cysteine at residue 273 had th e most deleterious affect on the enzymes catalytic activity, showing a 38-fo ld decrease as compared to WT enzyme. P275A resulted in the most moderate aff ects on catalytic activity, having maintianed a kcat comparable to that of WT, indicating tur nover was not significan tly inhibited in the variant. Table 21. NADH:FR Kinetic Cons tants and Thermal Stability (T50) Values Obtained for the Alanine Variants of the CGpppM Motif. NADH:FR T50 Table 21. All variants exhibited a decreased NADH:FR turn -over rate when compared to that of WT cb5r, with C273A and G274A being the most severely affected. The substitution of an alanin cb5r Variant kcat Km NADH Km FeCN6 kcat/ Km NADH (s-1) (M) (M) (s-1 M-1) (C) WT H4cb5r C273A G274A P275A P276A P277A M278A 800 17 6.0 1 8 1 1.4 0.3 x 108 20 1.0 9.4 0.8 8 1 2.3 0.4 x 106 88 2.1 65 2.1 8 1 1.4 0.3 x 106 750 50 22 0.8 8 1 3.5 0.5 x 107 650 22 14 1.1 8 1 4.8 0.8 x 107 617 9.4 34 1.1 8 1 1.8 0.1 x 107 202 10 24 1.0 8 1 8.4 0.8 x 10656.1 51.0 53.2 49.1 50.9 50.7 46.3 Binding efficiency, as determined by examining the Michaelis constants ( K m ), demonstrated a decreased affinity for NADH for all variants. G274A demonstrated the most significant impact, having a K m value 10-fold greater than that of WT protein, in dicating a significant decrease in the affin ity for the reducing subs trate. The additional variants exhibited K m s as shown in Table 21. The C273A demonstrated a K m near that of WT cb5r, suggesting substrate affinity was not significantly affect ed. In contrast, the

PAGE 211

191 ults suggested that the lower catalytic efficien cy observed for the mutants was e result of both the decreased affinity for, and decreased utilization of NADH. ties for either NADH or AD+, spectral binding constants ( Ks) were determined using differential spectroscopy. Representative spectra obtained from the titr the alanine variants and the WT enzyme with either H4N esply. With the excep A sl change followingion o m titration wD+. P ane shape similar to that of WT, ienges for nalysis. The binding constants for H4NAD suggested that C273A and P277A bound the s 4 Titrations of the C273A, P 276A, and P277A variants with NAD+ generated lineshape similar to WT cb5r, but with decreas ed positive and negative intensities. P275A exhibited spectral changes of greatly dimini shed intensity. Variants G274A and M278 exhibited insufficient spectral change to dete rmine the spectroscopic binding constants Michaelis constant for the artif icial electron acceptor, ferricyanide, was similar to that of WT cb5r, suggesting that the mutation did not affect the bind ing of the oxidizing substrate. Catalytic efficiency, reflected in the k cat / K m NADH value, was decreased in all variants as compared to WT cb5r. The effect of the G274A substitution was most notable, the variant retaining only 0.3% of WT cb5r NADH:FR catalytic efficiency. These res th To confirm the effects of th e alanine substitutions on the affini N ations of AD or NAD + are shown in Figures 62 and 63 r ective tion of G 274 all the variants demo nstrated some degree of pectra the addi t f H 4 NAD (Figure. 63). C273A exhibite d a spectru similar to the ith NA 275A, P276A, P277A, and M278 all demonstr ted li with diminished intensities. G274A had insuffic nt cha a substrate more efficiently than WT, with K values of 40 M and 35 M H NAD respectively.

PAGE 212

Figure 62. Spectroscopic Titrations Obtained for the WT cb5r and the Alanine Varianobtained for the C273A, G274A, P275A 4 ts of the CGpppM Motif in the presence of H 4 NAD. Difference spectra were P276A, P277A, and M278A cb5rmutants at equivalent flavin concentrations of (50 M FAD) in 20 mM MOPS buffer, containing 0.1 mM EDTA, pH 7.0 following titrations with HNAD as described in Methods. The insert panels correspond to plots of the magnitudes of the observed spectral perturbations (peak to trough measurements at the indicated wavelengths) versus ligand concentration. The corresponding Ks values are given in Table 22. 192

PAGE 213

193 for NAD+. The binding constants (Table 22) for NAD+ suggest all variants that exhibited spectral changes bind product better than WT, with the exception of P275A which had a Ks of 1,048 M. Table 22. Spectral Binding Constants ( Ks) and Standard Midpoint Potentials (E ) Obtained for Alanine Variants of the CGpppM Motif. Ks (M) E FAD/FADH2(mV) cb5r Variant Ks H4NADKs NAD+-NAD++NAD+ WT H4cb5r C273A G274A P275A P276A P277A M278A 45 10 40 3 ND* 165 36 152 14 35 3 65 2 553 30 131 9 ND* 1048 441 247 25 213 11 314 21 -271 -268 -271 -268 -271 -277 -273 -191 -225 -221 -193 -200 -201 -223 *ND indicates that the spectroscopic binding constant could not be determined, due to insufficient spectral change. Potential effects of structural changes on the properties of the flavin prosthetic group were examined by determining the oxidation-reduction poten tials for the FAD cofactor as described in the Methods section. Flavin midpoint potentials (E n = 2) for the FAD/FADH2 couple were determined for the vari ants alone and in the presence of NAD+. The flavin redox potentials (n = 2) fo r the WT cb5r and the variants for the mutations demonstrated only a slight FAD/FADH 2 couple were determined from the Nernst semi-log plots of the log ([oxidized]/[reduced]) FAD versus potential (mV) and are shown in Figure 64. Without the addition of NAD + to the titration, all variants demonstrated midpoint potentials equivalent to that of WT, with values of ranging form -277 and -268 mV. In the presence of NAD+ however, the C273A, G274A and M278A

PAGE 214

Figure 63. Spectroscopic Titrations Obtained for the WT cb5r and the Alanine Variants of the CGpppM Motif in the presence of NAD + Difference spectra were obtained for the C273A, G274A, P275A, P276A, P277A, and M278A cb5rmutants at equivalent flavin concentrations of (50 M FAD) in 20 mM MOPS buffer, containing 0.1 mM EDTA, pH 7.0 following titrations with NAD+ as described in Methods. The insert panels correspond to plots of the magnitudes of the observed spectral perturbations (peak to trough measurements at the indicated wavelengths) versus ligand concentration. The corresponding K s values are given in Table 22. 194

PAGE 215

Figure 64. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the WT cb5r and the CGpppM Alanine Variants. Reductive dye titrations were performed at 25 C as described in Materials and Methods using phenosafranine as the indicator dye in 100 mM phosphate buffer containing 0.1 mM EDTA, pH 7.0. Nernst plots in the absence (A) and presence (B) of 2 mM NAD + Plots correspond to () H 4 cb5r; () C273A; () G274A; () P275A; (x+ ) P276A; () P277A; and () M278A. 195

PAGE 216

196 degree of positive shift in the midpoint poten tial, resulting in midpoint potentials near that of free flavin. The three proline subs titutions did result in a positive shift, having midpoint potentials within 10 mV of that for WT in the presence of NAD+. Midpoint values are reported in Table 22.

PAGE 217

197 utagenesis using the oligonucleotide primers listed in ppendix C. Evaluation of the expression yiel d of the variants indicated an expression efficiency comparable to that of the WT c b5r domain for most of the variants indicating production of a stable protein product which could be purif ied to apparent homogeneity as indicated by the presence of a single pr otein band following SDSPAGE analysis (results not shown). Variants C273M and C273S displayed lower expression efficiency, but were still purified to apparent homoge neity as indicated by a single band following SDS-PAGE. UV/visible absorbance spect ra were obtained for both the oxidized variants and WT cb5r as a control and are presented in Figure 65A. All of th e variants exhibited spectra comparable to that of the WT en zyme with an aromatic absorption maximum observed at 273 nm in the UV region of the spectrum, and a peak at 461 nm with an associated pronounced shoulder in the range of 485 nm in the visible region of the spectrum, attributable to protein-bound flavin. To compare the secondary structural arrangement of the variants with that of the WT protein, circular dichroism (CD) spectr a were recorded in the UV wavelength range (190 nm). As shown in Figure 65B, the vari ants exhibited positi ve CD from 190 to 210 nm and negative CD from 210 to 250 nm with the spectra retaini ng a line shape very similar to that of the WT domain. The intens ities of the negative CD maxima at 222 nm were increased in the case of the C273S and A insertion variants, indicating potential Characterization of the C273M/S, G274P/S A-insertion, and G-insertion variants. Mutant constructs encoding the C273S C273M, G274P, G274S, P277alanine insertion (A-insertion), and P277glycine inse rtion (G-insertion) cb5r variants, were generated using site-directed m A

PAGE 218

r Dichroism Spectra Obtained for the WT cb5r and the cb5r Variants C273S, C273M, G274P, G274S, A insertion, and G insertioand the various mutants at equivalent flavin concentrations (1.7 M FAD) in 10 mM region of the visible spectrum where the flavin prosthetic group makes a major ), G274P (------), G274S (), A insertion ( ), G insertion (----.) (B) UV CD containing 0.1 mM EDTA at pH 7.0. (C) Visible CD spectra were recorded using enzyme Line styles shown in B and C are the same as those depicted in A. Figure 65. Ultra-Violet, Visible, and Circula n. (A) UV/Visible absorption spectra were obtained for oxidized samples of cb5r phosphate buffer, containing 0.1 mM EDTA at pH 7.0. The inset shows an expanded contribution. Individual spectra correspond to WT cb5r ( ___ ), C273S ( __ __ __ ), C273M ( _ _.._ _.......spectra were recorded using enzyme samples (7 M FAD) in 10 mM phosphate buffer, samples (50 M FAD) in 10 mM phosphate buffer, containing 0.1 mM EDTA at pH 7.0. 198

PAGE 219

199 minor alterations of secondary structure. The absence of any significant differences between the line shape of the spectra of the WT and the remaining mutant proteins suggested the conservation of secondary stru cture and that the residue substitutions had no significant deleterious effects on the folding of the diaphorase domain. Circular dichroism measurements were performed in the near-UV/visible range (300 nm) in order to probe possible e ffects of the mutation on both flavin conformation and polarity of the prosthetic group microenvironment. As shown in Figure 65C, the mutants maintained a line shape similar to that of WT cb5r, exhibiting positive maxima at 310 and 390 nm and negative ma xima at approximately 460 and 485 nm. The intensities of these maxima, however, differe d from that of the WT domain, indicating potential alterations in either the polarity of the flavin environment or the conformation of the bound prosthetic group. To examine the influence of the residue substitutions on the stability of the resulting protein, thermal denaturation profile s were generated for both variants and WT cb5r (Figure 66). Each varian t displayed a reduced thermal stability relative to that of WT (Table 23). G274S, A insertion, and G insertion maintaining T50 values of 54 C, 53 ecrease in NADH:FR C., and 55 C respectively, co mparable to that of WT cb5r, The C273M, G274P, and C273S variants were on average 4 C lowe r than that of WT, suggesting that these residue substitutions had a slight effect on the thermal stability. The T 50 values for each variant are given in Table 23. As a measure of catalytic efficiency, NA DH:FR activities were determined for the WT cb5r and all variants. Kinetic constants derived from these assays are reported in Table 23, and indicated that all the variants exhibited a marked d

PAGE 220

turn-over compared to that of WT cb5r, with G274P being the most severely affected, showing a 1200-fold decrease when compared to WT cb5r. The remaining variants exhibited increasing k cat values on the order of: G274P
PAGE 221

201 idizing substrate. Table 23. NADH:FR Kinetic Cons tants and Thermal Stability (T50) Values Obtained for the C273M/S, G274P/S, A-ins ertion and G-insertion Variants of the CGpppM Motif. NADH:FR T50 demonstrated a Km near that of WT at 10 um, suggesting substrate affinity was not significantly affected. The Michaelis consta nt for the artificial electron acceptor, ferricyanide, was similar to that of WT cb5r for all variants, suggesting that the mutation did not affect the binding of the ox cb5r Variant kcat Km NADH Km FeCN6 kcat/ Km NADH (s-1) (M) (M) (s-1 M-1) (C) WT H4cb5r C273M C273S G274P G274S A-insert G-insert 800 17 6.0 1 8 1 1.4 0.3 x 108 213 4.1 10 1 7 1 2.1 0.2 x 107 10 4.1 17 2 8 1 6.0 0.7 x 105 0.62 0.1 74 4 8 1 8.5 0.2 x 103 67 3.2 76 2 7 1 8.8 0.6 x 105 17 1.4 571 22 8 1 2.9 0.4 x 104 22 1.1 689 33 7 1 3.2 0.4 x 10456.1 52.0 52.2 51.1 54.1 53.8 55.3 Catalytic efficiency, reflected in the kcat/ Km NADH value, was markedly decreased in utants was the resu all variants as compared to WT cb5r, with the exception of C273M which retained 15% of WT cb5r NADH:FR catalytic efficiency. The effect of the glycine to proline substitution at residue 274 on the overall NADH: FR catalytic efficiency of the enzyme was most significant, retain ing only 0.006% of WT cb5r N ADH:FR catalytic efficiency. These results suggested that the lower catalytic efficien cy observed for the m lt of both the decreased affinity for, and decreased utilization of NADH. To determine the effects of the mutations on NADH and NAD + binding, spectral binding constants (K s ) were determined using differential spectroscopy as discussed

PAGE 222

202 de monstrated a line shape similar that of WT, with diminished intensitie s. The remaining variants had insufficient able manner to WT, with a Ks values of 70 M H4NAD. Perturbations of the flavin visible absorbance spectrum were only detectable for the WT enzy73M, the A-insertio on var in tresence of NAD+ (Figure 68). For h NA d in spectra wi e C, G274P, and G274ts ex etroscopic binding cr th tshown in Table 24, obtained for NAD suggested all variants that ex hibited spectral changes bind produc+emi-log plots o+ above. Representative spectra obtained from th e titrations of the va riants and the WT enzyme with either H 4 NAD or NAD + are shown in Figures 67 a nd 68 respectively. With the exception of C273M, none of the variants demonstrated spectra l changes following the addition of H 4 NAD, as shown in Figure 67. C273M to changes for analysis. The binding constants for H 4 NAD suggest that C273M binds the substrate in a compar me, C2 n, sertiiants and th e G-in he p each of these va riants, complex formation wit D+ resulte th severe ly d creased intensity w ith reference to WT cb5r. The 273S S varian hibited insufficient sp ectral change to determin spec onstants fo e various pyridine nuc leotides. The binding cons ants, + t better than WT. Potential effects of structural changes on the properties of the flavin prosthetic group were examined by determining the oxidation-reduction poten tials for the FAD cofactor as described in the Methods section. Flavin midpoint potentials (E n = 2) for the FAD/FADH 2 couple were determined for the vari ants alone and in the presence of NAD The flavin redox potentials (n = 2) for the WT cytochrome b 5 reductase and generated variants for the FAD/FADH 2 couple were determined from the Nernst s f the log ([oxidized]/[reduced]) FAD versus potential (mV) and are shown in Figure 69. In the absence of NAD all variants demonstrated midpoint potentials equivalent to

PAGE 223

Figure 67. Spectroscopic Titrations Obtained for the WT cb5r and cb5r Variants H C273S, C273M, G274P, G274S, A insertion, and G insertion in the Presence of titrations with HNAD as described in Methods. The insert panels correspond to plots the indicated wavelengths) versus ligand concentration. The corresponding K values are 4 NAD. Difference spectra were obtained for the various C273S, C273M, G274P, G274S, A insertion, and G insertion cb 5 mutants at equivalent flavin concentrations of (50 M FAD) in 20 mM MOPS buffer, containing 0.1 m EDTA, pH 7.0 following 4 of the magnitudes of the observed spectral perturbations (peak to trough measurements at s given in Table 24. 203

PAGE 224

Figure 68. Spectroscopic Titrations Obtained for the WT cb5r and cb5r Variants C273S, C273M, G274P, G274S, A insertion, and G insertion in the Presence of NAD + Difference spectra were obtained for the various C273S, C273M, G274P, G274S, A insertion, and G insertion cb 5 mutants at equivalent flavin concentrations of (50M FAD) in 20 mM MOPS buffer, containing 0.1 m EDTA, pH 7.0 following titrations with NAD + as described in Methods. The insert panels correspond to plots of the magnitudes of the observed spectral perturbations (peak to trough measurements at the indicated wavelengths) versus ligand concentration. The corresponding K s values are given in Table 24. 204

PAGE 225

205 that of WT, with values of ranging from -272 to -265 mV In the presence of NAD+ however, all the mutations failed to have a significant positive shift in the mi dpoint potential, resulting in midpoint potentials near or mo re negative than that of free flavin. These results clearly indicated that these amino acid substitutions significantly affect the ability of NADH to bind in the proper orientation for effi cient electron transfer. The Table 24. Spectral Binding Constant ( Ks) and Standard Midpoint Potentials (E ) Obtained for the C273M/S, G274P/S, A-ins ertion and G-insertion Variants of the CGpppM Motif. Ks (M) E FAD/FADH2(mV) cb5r Variant Ks H4NADKs NAD+-NAD++NAD+ WT H4cb5r C273M C273S G274P G274S A-insert G-insert 45 10 70 9 ND* ND* ND* ND* ND*554 30 267 24 ND* ND* ND* 170 37 182 31 -271 -268 -272 -272 -272 -269 -265 -191 -254 -255 -232 -257 -243 -234 *ND indicates that the spectroscopic binding constant could not be determined, due to insufficient spectral change.

PAGE 226

Figure 69. Oxidation-Reduction Midpoint Potentials for the FAD Prosthetic Group in the WT cb5r and cb5r Variants C273S, C273M, G274P, G274S, A insertion, and G insertion. Reductive dye titrations were performed at 25 C as described in Materials and Methods using phenosafranine as the indicator dye in 100 mM phosphate buffer containing 0.1 mM EDTA, pH 7.0. Nernst plots in the absence (A) and presence (B) of 2 mM NAD+. Plots correspond to () H4cb5r; () C273M; () C273S; () G274P; () G274S; (x) A-insertion; and (+) G-insertion. 206

PAGE 227

207 values obtained for the midpoint potential s of the variants ar e reported in Table 24. The differential spectroscopy st udies in the presence of NAD+ for both insertion variants as well as the M278A demonstrated a marked incr ease in the affinity for NAD+. Based on this, and the decrease in catalytic e fficiency and rate of turnover of substrate seen in the three variants, we proposed that these mutants are dele terious due to product inhibition. To further probe the properties of product inhi bition, initial rate enzyme kinetics were performed in the presence of varying concentrations of NAD+ to determine if the competitive inhibition properties of the NAD+ product was capable of giving rise to the alterations observed in the overall catalytic efficiencies and Ks values of these variants. As shown in Figure 70, the Lineweaver-Burke plot s obtained for WT cb5r and the M278A, A-insertion and G-insertion mutants all displayed a model of competitive inhibition represented by a single intercept at the y -axis showing no change in Vmax in the presence of varying concentrations of NAD+. Ki values [ x -intercept = -( Ki)] were established for the WT cytochrome b5 reductase and corresp onding variants through the secondary plot of the Km values for each assay against th at of the concentration of the NAD+ inhibitor. The Ki values obtained which corresponded to 675, 349, 193, and 120 M for the WT domain, M278A, A-insertion an d G-insertion variants, respectively. The results were in good agreement with the catalytic efficiencies and Ks values obtained and onfirmed that NAD+ is not able to disassociate from the complex efficiently and thus c acts as an inhibitor in the cb5r reaction pathway.

PAGE 228

208 A-insertion, and G-insertion Variants. Panels A-D represent the Lineweaver-Burke concentrations of NAD Concentrations of NAD correspond to ( ) 0 M; ( ) 50 M; M; ( ) 25 M; ( ) 50 M; ( ) 100 M; ( ) 250 M; and ( +) 500 M for panels [B ( ) 100 M; and ( ) 500 M for panel (D) [G-insertion]. Panel (E) represents a replot the concentration of inhibitor (NAD ) where the inhibition constant ( Ki) can be Figure 70. Enzyme Inhibition As sessment in the Presence of NAD + for the M278A, plots obtained from the initia l rate kinetic analyses in the presence of various + +( ) 100 M; ( ) 250 M; () 500 M; and ( +) 1000 M for panel (A) [WT cb5r]; ( ) 0 and C] [M278A and A-inser tion], respectively, and ( ) 0 M; ( ) 25 M; ( ) 50 M; of the observed K m NADH determined from each Lineweaver-Burke plot in (A-D) versus +determined by the equation: x -intercept = -( K i ), and the y -intercept = K m

PAGE 229

E 209

PAGE 230

210Summary of the Role of NADH binding motif 273CGxxxM278 The product of the DIA1 gene, the flavoprotein cytochrome b5 reductase, has been shown to be a critical enzyme in mammalian metabolism since an extensive number of mutations have been identified in the gene that result in the disease recessive congenital methemoglobinemia. Of the over forty mutations that have been identified, the majority correspond to individual amino acid substitutions or deletions, in addition to a number of nucleotide alterations that result in the presence of either premature stop codons (truncation mutants) or incorrect gene processing. These mutations in the DIA1 gene have been classified as producing either the type I or type II forms of RCM. The former are the more benign form of the disease with cyanosis representing the dominant symptom, while in contrast, the latter variant is physiologically more severe resulting in impaired neurological development and finally death. Previous studies of the majority of the known cb5r methemoglobinemia mutants that utilized a novel cb5/cb5r fusion protein (NCR) have indicated that the variants that impact the NADH-binding site are some of the most compromised mutants in terms of the level of retained specific activity. Of the four primary sequence motifs that have been found to be characteristic of the pyridine nucleotide transhydrogenase family of flavoproteins, the carboxy-terminal CGxxxM motif is one of two motifs involved in pyridine nucleotide binding. It is clear from the x-ray structure obtained for the WT cb5r that adverse effects involving the CGxxxM motif are unavoidable if substitutions of the conserved C, G or M residues occur. Alterations in the nature of the amino acid side chains of residues in the CGxxxM motif have been shown to account for the substantially-weakened binding of NADH to the various alanine variants, when compared to the NADH-affinities of the WT

PAGE 231

211 e nicotinamide moiety and hydrop proteins. If the combination of hydrogenbonding to th hobic interactions between NAD(H) and th is motif are a significant factor in modulating NADH binding, then any perturbation of the mol ecular structure surrounding this binding site would adve rsely affect the affinity fo r NADH, and prediction that is verified by the results obtained for th e various alanine-scanning variants. In the WT protein, the hydrophobic C273 si de chain is positioned approximately 4.2 A o from the si face of the FAD isoalloxazine ring system, and is in van der Waals contact with the nicotinamide moiety of NAD + This suggested the pos sibility that C273 is involved in contro lling the equilibrium between the unstacked configuration of bound NADH and the charge transfer complex. In the C273A variant, the absence of a thiol side chain would be expected to result in an incorrect orient ation of the bound NADH that would decrease the rate of el ectron transfer and reduce catalytic efficiency. Furthermore, the presence of the sulfur gr oup in the C273M was unable to recover the activ ity seen in the C273A, indicating that the positioning of the sulfur is key to allowing the NADH to adopt the correct orientation for efficient enzymatic activity. The G274 residue of the native cb5r is found participatin g in hydrogen bonding between the backbone oxygen of the residue with the nitrogen N7 of the nicotinamide moiety. Substitutions of this residue would result in minor deviations of the backbone which would affect this hydrogen bond formation. The introduction of even the small side chain methyl group of alanine to this pos ition could result in a physical hindrance to the binding of NADH, or cause the NADH to misalign in the binding pocket, placing the nicotinamide moiety in a position incompatible with electron transf er. The substitution of the various amino acids described in the data indicated that th ese newly introduced

PAGE 232

212 ne affecting the downst sical obstructions to the bining side chains of increasing size and, in the case of proline and serine, additional characteristics, such as rigidity and pol arity, may result in a sterically hindered environment, consequently disrupting the hyd rogen bonding. Figure 71 illustrates these effects. G274P introduces a high level of conformational rigidity via the secondary amine structure of its side chain. This cause s a kink in the peptide backbo ream orientation of the protein. In th e immediate vicinity, it also introduces a physical hindrance to the binding of NADH, though to a lesser extent than previously seen in the G180P and G182P mutations. The position of the proline oxygen backbone would also likely shift slightly further away from the N7 nitrogen of the nicotinamide ring, altering the hydrogen bond formation be tween the two atoms. The severe deleterious effect of the mutation on the cataly tic efficiency demonstrates the impact that these collective effects have. In additi on, the G274A and G274S substitutions cause equally severe deleterious effects on the catalytic activity through decreasing turnover efficiency and diminishing binding affinity of the substrate through similar processes of altering the hydrogen bonding distance and introducing phy d area. Moreover, the inability to main tain spectral differences for each of the substitutions further indicates a disruption of the hydrogen bonding es sential for substrate binding. The role of the three sequential proline residues proved to be important, but not vital, to the proper function of the enzyme, in as far as that the removal of the proline without replacement by a large si de chain, in this case the al anine substitutions, did not drastically impact the catalytic spectroscopic, thermal stab ility, or electron transfer properties of the protein. It is important to note, however, that residue P275, though in

PAGE 233

213 A B C D Figure 71. Structures of WT cb5r and cb5r variants G274A, G274P and G274S surfaces of (A) residue G274 (B) cb5r variant G274A (C) cb5r variant G274Pand (D) iant G274S in association with NAD+ generated utilizing the automated comparative protein modeling server SWISS-MODEL [111] and analyzed using the molecurepresentation of the residue and NADin transparent display style. Distance between green. Models generated from cb5r in complex with FAD and NAD (1IB0). this study the least affected by substitution, has been identified as a site of a mutation leading to type I RCM. The proline to leucine substitution was observed to have no with NAD + Generated in silica. The molecular model of cb5r displaying the charged cb5r var lar modeling software Web Lab Viewer Pro [134]. Model depicts surface + N7 nitrogen of the nicotinamide and the backbone oxygen of each residue are shown in +

PAGE 234

214detectable effects on either the spectroscopic or thermodynamic properties of the flavin prosthetic group in the absence of NAD+. In addition, protein folding and stability were unaffected by the mutation. In contrast, the proline to leucine substitution exhibited a profound effect on both the affinity of cb5r for the reducing substrate and its catalytic efficiency. The substitution P275L was shown through homology modeling to create a hump leading to steric hindrance preventing NADH from properly seating into the binding pocket [105]. The role methonine 278 plays in enzyme activity and substrate binding can be appreciated by examining the effects of a substitution of the residue. M278A exhibits a moderate decrease in rate of turnover. The increased Km for NADH coupled with a increase in Ks for H4NAD suggested that M278 plays a role in modulating the binding of substrate. Further, the lack of decrease of intensity of spectral changes upon the addition of NAD+, coupled with an increased spectral binding constant, indicated a change in binding affinity caused by substitution of M278. To further examine the role of the residue, insertion mutants were generated which caused M278 to be shifted downstream one residue, placing it out of its native an in the case of WT, indicating a preference for the product in the case of both insertion mutants. Additionally, NADH:FR assays in the presence of NAD demonstrated that all three mutants had increased inhibition constants for NAD as register. Regardless of the inserted residue, the effect of the insertion was to decrease the rate of turnover to approximately 3% of WT, as well as decrease the affinity for substrate by 90 fold on average. While no noticeable changes were observed upon the addition of H 4 NAD, the addition of NAD + yielded spectral changes at lower concentrations of NAD + th ++

PAGE 235

215 ple, a small reorientation of the -helical region following the CGxx itors (and in some cases activators) because compared to WT, indicating that the decreased turnover rate is at least in part, the result of product inhibition. Thus, it is possibl e that M278 functions in release of NAD + after transfer of electrons to th e flavin prosthetic group. Secondary effects could also play a role in the reduced affinity of the various CGxxxM variants for NADH. Such effe cts could be propagated through small displacements in the neighboring loops which make up nearby sections of the NADH binding site. For exam xM motif could reduce the space av ailable for binding the adenine moiety, forcing some reorganization of the loop cont aining F251, the stacking residue for adenine in the WT. The possible contribution of secondary eff ects of this kind coul d be investigated by measuring the affinity of phosphorylated ad enenines for the site. In cb5r homologues, such as cytochrome P450 reductase and ferredoxin:NADP + reductase, partial NADPH analogs such as 2-AMP and 2,5-ADP are in hib they compete with NADPH. The FAD and pyridine nucleotide binding sites in these enzymes have features which cb5r l acks, including a stacking residue supplied by the carboxyl-terminal region for the FAD is oalloxazine and interdomain hydrogen bonds to the pyridine nucleotide. While the substitution of the individual residues in the CGxxxM motif were anticipated to have a substantial impact on the K m for NADH owing to the perturbation of the position of the subsequent residues that correspond to C273 to M278, they were not anticipated to have any s ubstantial impact on the sp ectroscopic or thermodynamic properties of the flavin pr osthetic group. As expected, none of the CGxxxM motif

PAGE 236

216 uted opp osite the isoalloxazine ring would different degrees of severity. substitution mutants adversely affected the wavelength maxima determined for the FAD prosthetic group in either the visible absorp tion or CD spectra. This result demonstrated that altering the nature of amino acid residues sita not be expected to have a significan t effect on the redox properties of the flavin prosthetic group, a prediction that was test ed by performing oxidati on-reduction titrations for the various mutants, and is also reflected in the turn-over value of the variants. Overall, the results of these studies i ndicate the important contribution of the residues that comprise the CGxxxM redu ced pyridine nucleotide-binding motif and suggest that any naturally occurring mutations in these residues are likely to be manifest in RCM with

PAGE 237

217 into the highly conserved m ts with substitutions of amino acid residues found within the conserved motifs based on alternative residues observed to occur at the same position in othe r members of the FNR family as well as within other species, structural difference among between residues, removal or addition of polar groups, and the introduction of positive charges. The second approach incorporated the analyses of naturally o ccurring recessive congenital methemoglobinemia mutants that are locate d within, or in close proximity t o, the conserved motifs. Through this method of characterization, we were able to establish a role for each of the previously uncharacterized amino acid residues found in the NADH-binding motifs in addition to suggest the molecular basis for the disease for each of the RCM variants. The construction and characterization of the canine cytochrome b5 reductase protein was also designed in order to compare and contrast the differences and similarities in structure and function among mammalian protein variants. 4. CONCLUSIONS AND FUTURE DIRECTIONS These studies were designed to provide a dditional structural a nd functional insight o tifs found within cytochrome b 5 reductase, and other members of the FNR super-family with respect to the mode of NADH-binding and the enzymes catalytic function. Th is objective was accomplished using two approaches. The first approach involved the generation of an array of cb5r varian

PAGE 238

218 Previous studies on the human, bovine, and porcine variants of cb5r have ated discrepancies in th e kinetic constants of proteins that would otherwise appear primary structure of these different variants retained a high level of sequence sim av in cofactor and the reduced substrate, properties is particularly elucid to be nearly identical in nature. The ilarity among the residues, a nd demonstrated conserved sequence motifs involved in binding of its fl NADH. With the sequencing of the dog genome, potential gene transcripts had been identified that maintained sequence similari ty to the cb5r sequence. The theoretical sequences for the canine cb5r variant indicate d a high level of dissimilarity in the amino terminal portion of the sequence. Th is work was designed to examine these dissimilarities as well as provide a comp arison of the characte rization of the gene products from two mammalian species, under id entical conditions, in an effort to determine the differences and similarities in their structural and f unctional parameters. In constructing the canine vari ant, it was shown that the dissimilarity in the amino terminus reported in the orig inal GenBank sequence was in error, and likely due to incorrect sequencing. The canine variant retained a primary st ructure nearly identical to that of the rat and hu man variants, with a small degree of disagreement with each sequence at a limited number of residues. Comparison of the results obtained from the spectroscopic, kinetic, and thermal stability studies confirmed predictions generated from the pair-wise sequence alignments that the structural and functional properties of the recombinant canine cb5r diaphorase domain shoul d be directly comparable to those of the corresponding rat domain. The similarity in the kinetic

PAGE 239

219 signific of conservation of these residues within FNR family members and other cb5r sequen o showed Additionally, the double mutant T116S/E212K, was generate d and characterized to ant and suggests that ot her cb5r variants exhibiting similarly conserved sequences should exhibit comparable kinetic properties. Analysis of the crystal structure of c b5r reveled that two residues, Y112 and Q210, formed hydrogen bonds with the pyrophosphate backbone of NAD + forming an anchoring attachment from the external surf ace of the protein. This, combined with the high level ces, suggested that these residues may play a vital role in the correct binding with NADH and, consequently, efficien t electron transfer with c b5r. This work examined several substitutions of each residue to determine the importance of the residues and their potential roles in enzyme structure and f unction. Characterization of the variants indicated that the hydroxyl group of Y112 was necessary for binding NADH in the proper orientation. Substitution of this residue resulted in moderately decreased kinetic constants, indicating inefficient transfer of reducing equivalents. The Q210 variants als a decrease in function, however to a lesser degree, indicating that Y112 is more critical in orienting the reduced substrate than Q210. Proximal to the two pyrophos phate associating residues are two residues shown to be mutated in patients presenting with type I RCM. The two mutations, corresponding to T116S and E212K, were detected in the sa me patient presenting with cyanosis and increased serum methemoglobin concentratio ns. The T116S mutation had previously been demonstrated to occur in approximat ely 27% of the African American population, and thus was identified as a po lymorphism. These individual variants were investigated to determine the causative nature of each muta nt leading to the presentation of disease.

PAGE 240

220 r otein. For the T116S variant, the affects were m these residues are shown to form hydrop further elucidate the condition of the patient. Subsequent characterization revealed that both mutations affected the function of the p ild, but still significan t enough to cause a disease cond ition. Catalytic efficiency was decreased by half, and the ability to tran sfer electrons was shown to be somewhat impaired. Similarly, E212K showed impaired function, to a slightly greater extent than the T116S variant. Most notable was the de crease in stability of the E212K mutation, which is likely the causative agent in the presentation of RCM for the patient, as protein in the circulating erythrocytes gradually br eaks down overtime and cannot be replaced. The double mutant showed an even great decrease in functionality, indicating that the T116S does indeed add to the e ffects of the E212K mutation. Multiple sequence alignments of FNR family members and cb5r sequences revealed that several structural motifs exist that are vital for the binding and association of flavin cofactors and pyridine nucleotide substrates. One of these motifs, corresponding to 180 GtGitP 185 in cb5r, is located in th e NADH-binding lobe of cb5r. Based on analysis of the x-ray crystal stru cture, hobic interactions and direct connectio ns with both the FAD cofactor and the NAD + molecule associated with cb5r. The ge neral structural nature of the conserved residues of this motif suggested that a vital ro le for this motif is to form a scaffold onto which the NADH can bind to properly align for subsequent electron transfer. Additionally, the two threonine residues located in the motif, T181 and T184, bind to NAD + and FAD, respectively, aiding in the proper positioning of each group. Furthermore, T184 binds to N5 of the isoall oxazine ring of FAD, the location of one of the electrons in the reduced FAD. Substitution of the residue of this region with

PAGE 241

221 emonstrated in the reduced erma structural alternatives as well as naturally occurring alternate residues in the FNR family members confirmed the importance of each re sidue. Both G180 and G182 are necessary to provide a relatively clear area around which the NADH can bind in order to properly position the nicotinamide portion of the molecu le. Proline substitution of each of these residues resulted in displacement of the nicotinamide moiety, decreasing catalytic efficiency. Likewise, the prol ine residue, P185, confers struct ural rigidity in the middle of the helix N 1. Removal of the resi due removes the necessary structural needs to maintain the proper folding in the immediate region of the residue. A higher degree of openness is generated as a result, allowing for better a ssociation of NADH, but not in the proper orientation. The st ructural importance is further d thl stability seen in the variants of this residue. I183, likewise, causes structural integrity, with substitution leading to decreas ed stability while maintaining a moderate level of catalytic ability of WT. This was e xpected, as this residue does not participate in any direct interaction with the FAD or NAD + groups, but is located in a structural component leading to the stab ility of the protein and the proper orientation of both groups. The OH group of T181 was shown to be vital in anchoring the NADH in the proper orientation to align th e N7 nitrogen of the nicotin amide ring for the subsequent electron transfer. This was demonstrated by differential spectrosc opy of the variants T181A and T181I adopting a line shape similar to PAAD + which lacks this nitrogen. Substitution of T184 demonstrated a great im pact upon the association of FAD and on the function of the protein. T184 interacts with FAD in two locations, one of which is the site of a hydrogen added during the reduction reaction. Removal of the OH group caused a destabilizing effect on the semiquinone intermediate, decreasing catalytic

PAGE 242

222 efficiency. Replacement with histidine caused even more severe impairment, causing the mutant to have a midpoint potential about equal to that of free flavin. Preceding the GxGxxP motif is another hi ghly conserved glycine residue G179. This residue helps to form the transition in th e helical structure of the motif. It is highly conserved among FNR family members and ac ross species sequences. The function of this residue was investigated by replacement w ith naturally occurri ng alternate residues and characterized for kinetic, spectral and thermal stability properties. It was shown that replacement of this residue lead to decreased affinity for substrate and decreased catalytic function. Substitution with alanine caused the least deleterious effects on the function of the protein while the other substitutions, (P T, and V) effectively caused NADH to be unable to efficiently bind. Interestingly t hough, substitution with valine lead to increased affinity of NADPH over NADH, indicating that this residue plays a role in substrate specificity. Immediately preceding G179 is another re sidue, A178, which has been shown to be occur as two distinct mutations, A178T a nd A178V, that result in presentation of type I RCM. Presentation in each patient was mostly restricted to cyanosis with elevated methemoglobin levels. Both were shown to be distinct mutations and not polymorphisms. Previous studies of A178V demonstrated that the variant maintained near WT catalytic function, and only differed by having a lower th ermal stability than WT. To further explore the effects of these mutations on th e function of cb5r, the two mutants were generated and characterized based on kinetic, spectral, and thermal stability properties and compared to WT. It was shown that, as previously reported, the A178V mutant maintained near WT activity, though not to the extent as previously reported.

PAGE 243

223 n of protein in the circulat interactions with the bound NAD+ properly orienting it into the binding pocket. Additionally, the only alteration was a decreased stability to temperature, indicating that the causative nature of disease of this mutant is a result of degradatio ing erythrocytes. A178T, on the ot her hand, demonstrated equivalent stability, yet showed a more significant decrease in kinetic function. The presence of the OH group of A178T causes electros tatic and/or steric interf erence of the neighboring GxGxxP motif, leading to dysfunction. This interference leads to decreased ability to bind NADH properly and thus decreases catal ytic activity. Though greater than the effects of A178V, the A178T mutation is itself mild, and thus would likely not cause severe consequences in the patient. The second conserved motif present in th e FNR family members and specifically in cb5r is the 273 CGpppM 278 motif. As shown from x-ra y crystallography this motif, while not directly associating with NAD + generates an extensive framework of hydrophobic The only direct bondi ng occurs between the back bone of residue G274 and the N7 of the nicotinamide of NAD + To investigate the importance of this motif, variants were generated based upon side chain properties of each residue to determine what role each play. Additionally, two insertion mutants were created to investigate the presence of an additional residue in this motif that o ccurs in several member of the FNR family. Characterization of these residues indicated that each of the three sequential proline residues are necessary to generate the correct orientation of the tertiary structure of the protein in the proximal vicinity, allowing the ne cessary rigidity to generate a kink in the protein changing its direction and initiating a helical structure. Alterations of these residues yield mildly decreased function of the protein, but not to a significant extent as

PAGE 244

224 hydrogen bonding with the NAD+ nicotinamide N7. Second other mutations did. The presence and positi on of the sulfur group of C273 was shown to be important to the function of the enzyme as removal or repositioning of the group, as done by C273A and C273M variants respectively, yielded drastically diminished activity. Likewise, the presence of G274 was shown to be vital to the proper orientation of NADH. Introduction of any side chain to this region resulted in the in ability of NADH to effectively bind to cb5r, and in effect prevented the protei n from functioning, with the G274P mutant retaining less that .01% catalytic efficiency of WT. The effect seems to result from three different e ffects. First, the movement of the backbone altered the position of the oxygen involved in ly, the presence of additional atoms on th e side chains of any residue substituted in this region could genera te a physical obstacle toward the binding of NADH. Finally, in the case of proline, introduction of rigidity at this position would result in alteration of the folding of the protein in the immedi ate region, generating potential downstream effects that lead to decreased function, as well as affectin g the nearby structural motifs GxGxxP also involved in the binding of NADH and the proper placement of the nicotinamide moiety. The alanine substitution combined with the two insertion mutants shed light on the function of M278. The results demonstrated that the decrease in catalytic efficiency was coupled with an increased affinity for binding of NAD + Inhibition st udies indicated that these mutants had lower inhibition constants than WT, indicating that NAD + was not dissociating form the enzyme as well as it does in WT. This suggests that M278 potentially plays gate keepi ng role in the process of as sociating with substrate and dissociating product.

PAGE 245

225 These data provide valuable insight into th e structural and func tional properties of the highly conserved motifs of cytochrome b 5 reductase that are involved in NADHbinding and orientation as well as a determinat ion of the molecular basis of the disease recessive congenital methemoglobinemia. These results support logical conclusions based on the kinetic, spectral, thermodynamic, and molecular modeling properties of each of the generated variants. Th e data presented in this rese arch provided a broad analysis of the motif using alanine scanning as well as specifically tailored substitutions to provide information on the structural and cata lytic role of each individual residue. However, in order to complete this work and suppor t our conclusions crys tal structures of several of the variants, both in the absence and presence of NAD + should be obtained. This would provide the most c oncrete evidence to support the conclusions presented in this work.

PAGE 246

226 congenitale sans causeapparante. Bull. Acad. Roy. 4 : pp. 698. 7. Diitrich, P. (1891) Ueber methamoglobinbildende Gifte Naunyn-Schmiedbergs. Arch. Exp. athol. Pharmocol 29: pp. 247. 8. Hitzenberger, K. (1932) Autoto xische zyanose (intraglubulare methamoglobinamie). Wien. Arch. Inn. Med. 23: pp. 85. 9. Deeney, J.; Murdock, E.T. and Rogan, J.J.. (1943) Familial idopathic methaemoglobinemia British Medical Journal. I : pp. 721-23. 10. Barcroft, H.; Gibson, Q.H.; Harrison, D.C. and McMurray, J. (1945) Familil idiopathic methemoglobinemia and its treatment with ascorbic acid. Clin.Sci 5: pp. 145 11. Gibson, Q.H. (1948) The reduction of methaemoglobin in red blood cells and studies on the cause of idiopathic methaemoglobinaemia. Biochem. J. 42: pp. 1323. 12. Scott, E.M. and Griffith, I.V. (1959) The enzyme defect of hereditary methemoglobinemia: Diaphorase. Biochim. Biophys. Acta 34 : pp. 584. 13. Scott, E.M. (1960) The relation of diaphorase of human erythrocytes to inheritance of methemoglobinemia. J. Clin. Invest 39: pp. 1176. 14. Balsamo, P.; Hardy, W.R.; and Scott, E.M. (1964) Hereditary methemoglobinemia due to diaphorase deficiency in Navajo Indians. J. Pediatr. 65: pp. 298. 15. Cawein, Madison, et. al. (1964) Here ditary diaphorase deficiency and methemoglobinemia. Arch. of Int. Med. REFERENCES 1. Gupta, S.K.; Gupta, R.C.; Gupta, A.B. ; Seth, A.K.; Bassin, J.K.; Gupta, A. and Sharma, M.L. (2001) Recurrent diarrhea in children living in areas with high levels of nitrate in drinking water. Arch. Environ. Health. 56: pp. 369-73. 2. Rehman, H.U. (2001) Methemoglobinemia. West. J. Med. 175 : pp. 193-96. 3. Jaffe, E.R and Hultquist, D.E. (2001) The Molecular and Molecular Basis of Inherited Disease 8 th Ed. C.R. Scriver, A.L. Beaudet, W.S. Sly, and D. Valle (eds.) McGraw Hill, New York. pp. 4555-70. 4. Da Silva S.S.; Sajan I.S.; and U nderwood III, J. P. (2003) Congenital methemoglobinemia: a rare cause of cyanosis in th e newborn--a case report. Pediatrics 112 : pp.158-61. 5. Hegesh E.; Hegesh, J. and Kaftory, A. (1986) Congenital methemoglobinemia with a deficiency of cytochrome b 5 N. Engl. J. Med 314: pp. 757. 6. Francios (1845) Cas de cyanose Med Belg

PAGE 247

227 Leroux, A.; Junien C.; Kaplan, J. and Ba mberger J. (1975) Generalised deficiency of cytochrome b5 reductase in congen ital methaemoglobinaemia with mental retardation. Nature. 258: pp. 619-20. Hultquist, D.E. and Passon, P.G. (1971) Catalysis of methaemoglobin reduction by erythrocyte cytochrome b5 and cytochrome b5 reductase. Nat. New Biol. 229: pp. 252-54. 8. Hyde, G.E.; Crawford N.M. and W.H. Call. (1991) The sequence of squash NADH:nitrate reductase and its relationship to the sequences of other flavoprotein oxidoreductases. A family of flavoprot ein pyridine nucleotide cytochrome 22. 26. 5 5es, J. Biol. Chem 252: pp. 68-73. 16. 17. 1 mpbe reductases. J Biol Chem 266: pp. 23542-7. 19. Karplus, P.A. and C.M. Bruns. (1994) Structure-function re lations for ferredoxin reductase J Bioenerg Biomembr 26: pp. 89-99. 20.Campbell, W.H. and K.R. Kinghorn. (1990) Functional domains of assimilatory nitrate reductases and nitrite reductases. Trends Biochem Sci. 15: pp. 315-9. 21. Wang, M.; Roberts D.L.; Paschke R.; Shea, T. M.; Masters B.S. and Kim, J. J. (1997) Three-dimensional structure of NADPH-cytochrome P450 reductase: prototype for FMNand FAD-containing enzymes. Proc Natl Acad Sci U S A 94: pp. 8411-6. Correll, C.C.; Ludwig, M.L.; Burns, C. M. and Karplus P.A. (1993) Structural prototypes for an extended family of flavoprotein reductases: comparison of phthalate dioxygenase reductase with ferredoxin reductase and ferredoxin. Protein Sci 2: pp. 2112-33. 23. Lu, G.; Campbell, W.H.; Schneider, G. a nd Lindqvist, Y. (1994) Crystal structure of the FAD-containing frag ment of corn nitrate reductase at 2.5 A resolution: relationship to other fl avoprotein reductases. Structur 2: pp. 809-21. 24. Strittmatter, P. (1965) The reaction sequen ce in electron transfer in the reduced nicotinamide adenine dinucleotide-cytochrome b5 reductase system J Biol Chem 240: pp. 4481-7. 25. Kitao, T.; Sugita, Y.; Yoneyama, Y. ; and Hattori, K. (1974) Methemoglobin reductase (cytochrome b 5 reductase) deficiency in congenital methemoglobinemia. Blood 44: pp. 879-84 Oshino, N.; Imai, Y. and Sato, R. (1971) A function of cytochrome b in fatty acid desaturation by rat liver microsomes, J. Biochem. (Tokyo) 69: pp. 155-67. 27. Reddy, V.V.; Kupfer, D. and Caspi E. (1977) Mechanism of C-5 double bond introduction in the biosynthesis of cholesterol by rat liver microsomes. J Biol Chem 252: pp. 2797-801. 28. Hildebrandt, A. and R.W. Estabrook. (1971) Evidence for the participation of cytochrome b 5 in hepatic microsomal mixed-function oxidation reactions. Arch Biochem Biophys 143: pp. 66-79. 29. Loughran, P.A.; Roman, L.J.; Miller, R.T. and Masters, B.S.S. (2001) The kinetic and spectral characterization of the E. coli-expressed mammalian CYP4A7: cytochrome b effects vary with substrate, Arch. Biochem. Biophys 385: pp. 31121. 30. Pugh, E.L. and Kates, M. (1977) Direct de saturation of eicosatr ienoyl lecithin to arachidonoyl lecithin by rat liver microsom

PAGE 248

228 me b5. Chem Res Toxicol. 19: pp. 1366-73. hrome b5 reductase gene. Gene. 80: p. 353-61 34. (1988) Two transcripts encode rat 35. ue, J. and Sakaki, Y. (1990) 13. 37. P.; Rogers, M.J. and Spatz, L. (1972) The binding of cytochrome b5 38. ce of the membrane-binding domain, J. Biol. Chem 39. for two non-myristylated forms of NADH-cytochrome b5 41. e ne expressed ubiquitously in human 42. keshita, 78: pp. 3580-89. 45. cleotide with cytochrome b-5 reductase J Biol Chem 238: pp. 2213-19. 31. Kurian, J.R.; Chin, N.A.; Longlais, B.J.; Hayes, K.L. and Trepanier L.A. (2006) Reductive detoxification of arylhyd roxylamine carcinogens by human NADH cytochrome b5 reductase and cytochro 32. Tomatsu, S.; Kobayashi, Y.; Fukumaki, Y. ; Yubisui, T.; Orii, T. and Sakaki, Y. (1989) The organization and the comple te nucleotide sequence of the human NADH-cytoc 33. Bull, P.C.; Shepard E.A.; Povey, S.; Sa ntisteban I. and Ph illips I.R. (1988) Cloning and chromosomal mapping of huma n cytochrome b5 reductase (DIA1). Ann Hum Genet 52: pp. 263-8. Pietrini, G.; Carrera, P. and Borgese, N. cytochrome b5 reductase. Proc Natl Acad Sci U S A 85: pp. 7246-50. Kobayashi, Y.; Fukumaki, Y.; Yubisui, T.; Ino Serine-proline replacement at residu e 127 of NADH-cytochrome b5 reductase causes hereditary methemoglobi nemia, generalized type. Blood. 75: p. 140836. Spatz, L. and Strittmatter, P. (1971) A form of cytochrome b 5 that contains an additional hydrophobic sequence of 40 amino acid residues. Proc. Natl. Acad. Sci. U S A. 68: pp. 1042-6. Strittmatter, to liver microsomes. J. Biol. Chem 247: pp. 7188-94. Ozols, J.; Carr, S.A. and Stritmatter, P. (1984) Identification of the NH2-terminal blocking group of NADH-cytochrome b5 re ductase as myristic acid and the complete amino acid sequen 259, pp. 13340-54. Kuma, F. (1981) Properties of meth emoglobin reductase and kinetic study of methemoglobin reduction. J Biol Chem 256: pp. 5518-23. 40. Pietrini, G.; Aggujaro, D.; Carrera, P.; Ma lyszko, J.; Vitale, A. and Borgese, N. (1992) A single mRNA, transcribed from an alternative, erythroid-specific, promoter, codes reductase. J. Cell. Biol. 117 : pp. 975-86. Du, M.; Shirabe, K. and Takeshita, M. (1997) Identification of alternative first exons of NADH-cytochrome b5 reductase g cells. Biochem. Biophys. Res. Commun. 235: pp. 779-83. Shirabe, K.; Yubisui, T.; Borgese, N.; Tang, C.Y.; Hultquist, D.E. and Ta M. (1992) Enzymatic instability of NADH-cytochrome b5 reductase as a cause of hereditary methemoglobinemia type I (red cell type). J Biol Chem 267: pp. 20416-21. 43. Kimura, S.; Kawamura, M. and Iyanagi, T. (2003) Role of Thr(66) in porcine NADH-cytochrome b5 reductase in catalysis and control of the rate-limiting step in electron transfer. J Biol Chem 2 44. Strittmatter, P. (1962) Direct hydrogen tr ansfer from reduced pyridine nucleotides to microsomal cytochrome b5 reductase J Biol Chem 237: pp. 3250-54. Strittmatter, P. (1963) The interacti on of reduced pyridin e-aldehyde adenine dinu

PAGE 249

229 transfer in 46. Strittmatter, P. (1965) The reaction sequen ce in electron transfer in the reduced nicotinamide adenine dinucleotide-cytochrome b5 reductase system. J Biol Chem 240: pp. 4481-7. 47. Iyanagi, T. (1977) Redox properties of microsomal reduced nicotinamide adenine dinucleotide-cytochrome b5 reductase and cytochrome b5, Biochemistry 16: pp. 2725-30. 48. Iyanagi, T.; Watanabe, S. and Anan K.F. (1984) One-electron oxidation-reduction properties of hepatic NADH-cytochrome b5 reductase. Biochemistry. 23: pp. 1418-25. 49. Meyer, T.E.; Shirabe, K.; Yubisui, T.; Takeshita, M.; Bes, M.T.; Cusanovich, M.A. and Tollin, G. (1995) Transient kineti cs of intracomplex electron the human cytochrome b5 reductase-c ytochrome b5 system: NAD+ modulates protein-protein binding and electron transfer. Arch Biochem Biophys 318: pp. 457-64. 50. McCarty, K. (2001) Methem oglobinemia: Feeling Blue? http://www.mc.uky.edu/ahec/skyahec/methem-CE.htm 51. ersity of Virgin ia Health System Clinical Service Kell, S. (2003) Univ http://www.healthsystem.virginia.edu/in ternet/medtox/images/methemoglobinemi a.jpg 52. Gibson, Q.H. (1948) The reduction of methaemoglobin in red blood cells and studies on the cause of idiopathic methaemoglobinaemia. Biochem. J 42: pp. 1323. Worster-Drought, C 53. .; White, J. C. and Sa rgent, F. (1953) Familial, idiopathic ytochrome B5 reductase 56. ; Shirabe, K.; Takeshita, M. ; Kobayashi, Y.; Fukumaki, Y.; Sakaki, Y. 57. tion found in the 3' domain of tent. Biochemistry 40: pp. 13574-82. methaemoglobinaemia associated with mental deficiency and neurological abnormalities Brit. Med. J. 2: pp. 114-8. 54. Aalfs, C. M.; Salieb-Beugelaar, G. B. ; Wanders, R. J. A.; Mannens, M.M.A.M. and Wijburg, F. A. (2000) A case of methemoglobinemia type II due to NADHcytochrome b5 reductase deficiency: de termination of the molecular basis. Hum. Mutat. 16: pp. 18-22,. 55. Katsube, T.; Sakamoto, N.; Kobayahis, Y.; Seki, R.; Hirano, M.; Tanishima, K.; Tomada, A.; Takazakura, E.; Yubisui, T.; Takeshita, M; Sakaki, Y. and Fukumaki, Y. (1991) Exonic point muta tions in NADH-c genes of homozygotes for hereditary methemoglobinemia, types I and III: putative mechanisms of tissue-dependent enzyme deficiency. Am J Hum Genet 48: pp. 799-808. Yubisui, T. and Takano, T. (1991) Structural role of serine 127 in the NADH-binding site of human NADH-cytochrome b5 reductase. J Biol Chem 266: pp. 66-70. Jenkins, M.M. and Prchal, J.T. (1996) A novel muta NADH-cytochrome b5 reductase in an African-American family with type I congenital methemoglobinemia. Blood 87: pp. 2993-99. 58. Bewley, M.C.; Marohnic, C.C. and Barber, M.J. (2001) The structure and biochemistry of NADH-dependent cytoch rome b5 reductase are now consis

PAGE 250

230 other flav in-dependent reductases. FEBS Lett 361 : pp. 97-100. lorida. 62. i, E.; Kobayashi, M. and Sh imizu, S. (1999) Identification of an 63. B. and Rajandream, M.A. (1994) GenBank Direct Submission 64. mi, T. and Ohta, D. (1999) p.353-62. d Ahringer, J. (2003) System atic functional analysis of the Caenorhabditis 66. 68. Dyn. 225: pp. 384-91. 70. era, P. and Borgese, N. (1988) Two transcripts encode rat 71. a NADH72. site Plasmodium yoelii 73. as an alpha-thrombin-cleavable fused protein in Escherichia coli Biochem. Biophys. Acta 1008: pp. 189-92. 59. Nishida, H.; Inaka, K. and Miki, K. ( 1995) Specific arrangement of three amino acid residues for flavin-b inding barrel structures in NADH-cytochrome b5 reductase and the 60. Davis, C.A. (2004) Sytematic Analysis of Recessive Congenital Methemoglobinemia: Molecular Basis for Disease. Ph.D. dissertation, University of South F 61. Rossmann, M.G.; Moras, D. and Olsen, K.W. (1974) Chemical and biological evolution of nucleotide-binding protein. Nature. 250 : pp. 194-9. Sakuradan NADH-cytochrome b(5) reductase gene from an arachidonic acid-producing fungus, Mortierella alpina 1S-4, by sequencing of the encoding cDNA and heterologous expression in a fungus, Aspergillus oryzae Appl. Environ. Microbiol. 65 : 3873-79. Barrell, CAA86908. Fukuchi-Mizutani, M.; Mi zutani, M.; Tanaka, Y.; Kusu Microsomal electron transfer in higher plants: cloning and heterologous expression of NADH-cytochrome b 5 reductase from Arabidopsis Plant Physiol 119: p 65. Kamath, R.S.; Fraser, A.G.; Dong, Y.; Poulin, G.; Durbin, R.; Gotta, M.; Kanapin, A.; Le Bot, N.; Moreno, S.; Sohrmann, M.; Welchman, D.P.; Zipperlen, P. an elegans genome using RNAi, Nature 421: pp. 231-7. Adams, M.D.; Celniker, S.E.; Gibbs, R. A.; Rubin, G.M. and Venter, C.J. (2000) GenBank Direct Submission NM_168479 67. Strausberg, R. (2003) GenBank Direct Submission BC045880. Klein, S.L.; Strausberg, R.L.; Wagner, L.; Pontius, J.; Clifton, S.W. and Richardson, P. (2002) Genetic and genomic tools for Xenopus research: The NIH Xenopus initiative, Dev 69. Boardman, P.E.; Bonfield, J.K.; Br own, W.R.A.; Carder, C.; Chalk, S.E.; Croning, M.D.R.; Davies, R.M.; Francis, M.D.; Grafham, D.V.; Hubbard, S.J.; Humphray, S.J.; Hunt, P.J.; Maddison, M. ; McLaren, S.R.; Niblett, D.; Overton, I.M.; Rogers, J.; Scott, C.E.; Taylor, R.G.; Tickle, C. and Wilson, S.A. (2004) GenBank Direct Submission BX950830. Pietrini, G.; Carr cytochrome b 5 reductase, Proc. Natl. Acad. Sci. U.S.A 85: pp. 7246-50. Yubisui, T.; Naitoh, Y.; Zenno, S.; Ta mura, M.; Takeshita, M. and Sakaki, Y. (1987) Molecular cloning of cDNAs of human liver and placent cytochrome b 5 reductase, Proc. Natl. Acad. Sci. U.S.A. 84: pp. 3609-13. Carlton, J.M.; Angiuoli; S.V.; Carucci, D.J.; et. al. (2002) Genome sequence and comparative analysis of the model rodent malaria para yoelii Nature 419: pp. 512-9. Shirabe, K.; Yubisui, T. and Take shita, M. (1989) Expression of human erythrocyte NADH-cytochrome b5 reductase

PAGE 251

231 75. tic domain of rat hepatic cytochrome b5 reductase, Protein 76. ung-Amritt, P.; 77. ctase: prototype for a structurally novel flavoenzyme 78. et al. (1994) GenBank. Nucleic Acids Res 1994. 22: pp. 3441-4. 80. d from cotton Biochem Biophys Res Commun 36: pp. 947-50. is highly expressed in skeletal muscle. eth ionine synthase reductase, a 84. of cysI a nd cysH and a model for the -37. 86. rologous 63-75. 74. Strittmatter, P.; Kittler, J.M.; Coghill, J.E. and Ozols, J. (1992) Characterization of lysyl residues of NADH-cytochrome b5 re ductase implicated in charge-pairing with active-site ca rboxyl residues of cytochrome b5 by site-directed mutagenesis of an expression vector for the flavoprotein, J Biol Chem 267: pp. 2519-23. Barber, M. J. and Quinn, G. B. (1996) High-level expression in Escherichia coli of the soluble, cataly Expr. Purif. 8: pp. 41-7. Higasa, K.; Manabe, J-I.; Yubisui, T.; Sumimoto, H.; P Tanphaichitr, V.S.; and Fukumaki, Y. ( 1998) Molecular basis of hereditary methaemoglobinaemia, types I and II: two novel mutations in the NADHcytochrome b5 reductase gene, Br. J. Haematol 103: pp. 922-30. Karplus, P.A.; Daniels, M.J. and Herri ott, J.R. (1991) Atomic structure of ferredoxin-NADP+ redu family. Science. 251: pp. 60-6. Benson, D.A. 79. Prosser, I.M. and C.M. Lazarus. (1990) Nucleotide sequence of a spinach nitrate reductase cDNA. Plant Mol Bio l. 15 : pp. 187-90. Newman, D.J.; Ihle, J.N. and Dure, L 3rd; (1969) Chemical composition of a ferredoxin isolate 81. Haniu, M.; McManus, M.E.; Birkett, D.J. ; Lee, T.D. and Shively J.E.. (1989) Structural and functional analysis of NADPH-cytochrome P-450 reductase from human liver: complete sequence of human enzyme and NADPH-binding sites. Biochemistry 28: pp. 8639-45. 82. Nakane, M.; Schmidt, H.H.; Pollock, J.S.; Frstermann, U. and Murad, F. (1993) Cloned human brain nitric oxide synthase FEBS Lett 316: pp. 175-80. 83. Leclerc, D.; Wilson, A.; Dumas, R.; Gafuik, C.; Song, D.; Watkins, D.; Heng, H.H.; Rommens, J.M.; Scherer, S.W.; Rosenblatt, D.S. and Gravel, R.A. (1998) Cloning and mapping of a cDNA for m flavoprotein defective in pa tients with homocystinuria. Proc Natl Acad Sci U S A 95: pp. 3059-64. Ostrowski, J.; Wu, J.Y.; Rueger, D.C.; Miller, B.E.; Siegel, L.M. and Kredich, N.M.. (1989) Characterization of the cysJIH regions of Salmonella typhimurium and Escherichia coli B. DNA sequences siroheme-Fe4S4 active center of sulfite reductase hemoprotein based on amino acid homoloy with spinach nitrite reductase. J Biol Chem 264 : pp. 15726 85. Plamann, M.D. and G.V. Stauffer, (1983) Characterization of the Escherichia coli gene for serine hydroxymethyltransferase. Gene 22: pp. 9-18. Davis, C.A.; Dhawan, I.K.; Johnson, M.K. and Barber, M.J. (2002) Hete expression of an endogenous rat cytoch rome b(5)/cytochrome b(5) reductase fusion protein: identification of histidin es 62 and 85 as the heme axial ligands. Arch Biochem Biophys 400: pp 87. Bosch, R.; Garcia-Valdes, E. and Moore E.R. (1999) Genetic characterization and evolutionary implications of a chromo somally encoded naphthalene-degradation upper pathway from Pseudomonas stutzeri AN10. Gene 236: pp. 149-57.

PAGE 252

232 89. ucture 90. antiago, F.; Lee, S.J.; Romana, L.K. and Reeves P.R. 91. Bacteriol 178 : 92. itrotoluene and toluene in Pseudomonas sp. strain the flavin domain of spinach 94. ) 95. ioxygena se and the benABC-encoded benzoate 96. es of the Acinetobacter calcoaceticus benABC genes 97. rom Pseudomonas cepacia 2CBS. J Bacteriol 177: pp. 667-5. 99. biol 65 : pp. 1589-95. 88. Nordlund, I., Powlowski, J. and Shi ngler, V. (1990) Complete nucleotide sequence and polypeptide analysis of multicomponent phenol hydroxylase from Pseudomonas sp. strain CF600. J Bacteriol 172: p. 6826-33. Welch, R.A.; Burland V.; Blattner, F.R.; et al. (2002) Extensive mosaic str revealed by the complete genome sequence of uropathogenic Escherichia coli. Proc Natl Acad Sci U S A 99: p. 17020-24. Jiang, X.M.; Neal, B.; S (1991) Structure and sequence of th e rfb (O antigen) gene cluster of Salmonella serovar typhimurium (strain LT2). Mol Microbiol 1991. 5: pp. 695-713. Eaton, R.W. (1996) p-Cumate catabolic pathway in Pseudomonas putida Fl: cloning and characteriza tion of DNA carrying the cmt operon. J pp. 1351-62. James, K.D. and P.A. Williams. (1998) ntn genes determining th e early steps in the divergent catabolism of 4-n TW3 J Bacteriol. 180 : pp. 2043-49. 93. Trimboli, A.J.; Quinn, G.B.; Smith, E.T. and Barber, M.J. (1996) Thiol modification and site directed mutagene sis of NADH:nitrate reductase Arch Biochem Biophys 331: pp. 117-26. Stainthorpe, A.C., Lees, V.; Salmond, G.P.; Dalton, H. and Murrell, J.C. (1990 The methane monooxygenase gene cluster of Methylococcus capsulatus (Bath) Gene 91: pp. 27-34. Bundy, B.M.; Campbell, A.L. and Neidle E.L. (1998) Similarities between the antABC-encoded anthranilate d dioxygenase of Acinetobacter sp. strain ADP1. J Bacteriol 180 : pp. 4466-74. Neidle, E.L.; Hartnett, C.; Ornston, L. N.; Bairoch, A.; Rekik, M. and Harayama, S. (1991) Nucleotide sequenc for benzoate 1,2-dioxygenase reveal evolutionary relationships among multicomponent oxygenases J Bacteriol. 173 : pp. 5385-95. Haak, B.; Fetzner, S. and Lingens, F. (1995) Cloning, nucleotide sequence, and expression of the plasmid-encoded genes for the two-component 2-halobenzoate 1,2-dioxygenase f 98. Kalman, S.; Mitchell, W.; Marathe, R.; Lammel, C.; Fan, J.; Hyman, R.W.; Olinger, L.; Grimwood, J.; Davis, R.W.; and Stephens R.S. (1999) Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nat Genet. 21: pp. 385-9. Kaneko, T.; et al. (2000) Complete ge nome structure of the nitrogen-fixing symbiotic bacterium Mesorhizobium loti. DNA Res 7: pp. 331-8. 100.Ng, W.V., et al., Genome sequence of Halobacterium species NRC-1 Proc Natl Acad Sci U S A 97: pp. 12176-81. 101. Zhou, N.Y.; Jenkins, A.; Chan Kwo Chio, C.K. and Leak, D.J. ( 1999). The alkene monooxygenase from Xanthobacter strain Py2 is closely related to aromatic monooxygenases and catalyzes ar omatic monohydroxylation of benzene, toluene, and phenol. Appl Environ Micro 102.Marohnic, C.C. and Barber M.J. (2001) Arginine 91 is not essential for flavin incorporation in hepatic cy tochrome b(5) reductase. Arch Biochem Biophys 389: pp. 223-33.

PAGE 253

233 nce 301: pp. 1898104. reductase studied by site-directed 105. e motifs 106. .B. and R. Feyereisen, (2000) Interaction of NADP(H) with 107. 986) Synthesis, bacterial expression, and 108. ssembly of the 109. tion of oligonucleotides for site-directed mutagenesis 110. ors. 111. s 31: pp. 3381-5. 114. 103. Kirkness, E.F.; Bafna, V.; Halpern, A.L.; Levy, S.; Remington, K.; Rusch, D.B.; Delcher, A.L.; Pop, M.; Wang, W.; Fraser, C.M. and Venter, J.C. (2003) The Dog Genome: Survey Sequencing and Comparative Analysis, Scie 903. Shirabe, K.; Yubisui, T.; Nishino, T. and Takeshita, M. (1991) Role of cysteine residues in human NADH-cytochrome b 5 mutagenesis. Cys-273 and Cys-283 are lo cated close to th e NADH-binding site but are not catalytically essential. J. Biol. Chem 266: pp. 7531-36. Crowley, Louis J. (2007) Structure-func tion studies of conserved sequenc of cytochrome b5 reductase. Ph.D. dissert ation, University of South Florida. (Publication No. AAT 3260053). Murataliev, M oxidized and reduced P450 reductase during catalysis. Studies with nucleotide analogues. Biochemistry. 39: pp 5066-74 Beck von Bodman, S., et al., (1 mutagenesis of the gene coding for mammalian cytochrome b5. Proc Natl Acad Sci U S A 83: pp. 9443-7. Laemmli, U.K. (1970) Cleavage of structur al proteins during the a head of bacteriophage T4. Nature. 227: pp. 680-5. Turchin, A. and Lawler, J.F. Jr. (1999) The primer generator: a program that facilitates the selec Biotechniques 26: pp. 672-6. Yuckenberg, P.D.; Witney, F.; Geisselsoder, J. and McClary, J. (1991) Sitedirected in vitro mutagenesis using ur acil-containing DNA a nd phagemid vect Directed Mutagenesis: A Pratical Approach, ed. M.J. McPherson. New York: Oxford University Press. Schwede, T.; Kopp, J.; Guex, N. and Peitsch, M.C. (2003) SWISS-MODEL: an automated protein homology-modeling server. Nucl. Acids Re 112.Bando, S.; Takano, T.; Yubisui, T.; Shirab e, K.; Takeshita, M. and Nakagawa, A. (2004) Structure of human erythr ocyte NADH-cytochrome b5 reductase, Acta Crystallogr. D Biol. Crystallogr 60 : pp. 1929-1934. 113. Vriend, G. (1990) WHAT IF: A molecula r modeling and drug design program, J. Mol. Graph. 8: pp. 52-56. Accelrys. DS Viewer Pro Software suite 2004 [cited; http://www.accelrys.com] 115. Chen, G.C. and Yang, J.T. (1977) Two-point calibration of circular dichrometerwith d-10 camphorsulfonnic acid. Anal. Letter 10 : pp. 1195-1207. ubstrates Arch Biochem Biophys 288 : pp.231117. 9-66. 116. Sancho, J. and Gomez-Moreno, C. ( 1991) Interaction of ferredoxin-NADP + reductase from Anabaena with its s 8. Barber, M.J. and G.B. (2001) Qui nn, Production of a recombinant hybrid hemoflavoprotein: engineering a func tional NADH:cytochrome c reductase. Protein Expr Purif 23 : pp. 348-58. 118. Massey, V. (1991) A simple method for the determination of redox potentials. Flavins and Flavoproteins S.R. B. Curti, and G. Zanetti, Editor. de Gruyter: Berlin. pp. 5

PAGE 254

234 121. P, and R159*. 122. the si -face residues, prolin e 92 and tyrosine 93, 123. tant of Cytochrome b5 Reductase that 124. M.C. and Ba rber, M.J. (2003) Engineering and ductase, Biochemistry 44: pp. 13467-76. 127. Bucher P. and Bairoch A. (2004) Recent improvements 128. al : pp. 61. 131 in 132 llagher, C.H.; Kuchel, P.W. and Agar N.S. (1995) Comparitive study of the 133 iqi, N.J.; Puri, S.K. and Pandey, V.C. (2002) 81-85. 119. Kirkness, E.F.; Bafna, V.; Halpern, A.L.; Levy, S.; Remington, K.; Rusch, D.B.; Delcher, A.L.; Pop, M.; Wang, W.; Fraser, C.M. and Venter, J.C. (2003) The Dog Genome: Survey Sequencing and Comparative Analysis, Science 301: pp. 18981903. 120. Benson, D.A.; Karsch-Mizrachi, I.; Lipm an, D.J.; Ostell, J. and Wheeler, D.L. (2005) Nucl. Acids Res. 33: pp. D34-D38. Davis, C.A.; Crowley, L.J. and Barber, M. J. (2004) Cytochrome b5 reductase: the roles of the recessive congenital meth emoglobinemia mutants, L148 Arch Biochem Biophys 431: pp. 233-44. Marohnic, C.C.; Crowley, L.J.; Davis, C.A.; Smith, E.T. and Barber, M.J. (2005) Cytochrome b 5 reductase: Role of in structure and catalysis, Biochemistry 44: pp. 2449-61. Bewley, M.C.; Davis, C.A.; Marohnic, C.C; Taormina, D. and Barber, M.J. (2003) The Structure of the S127P Mu Causes Methemoglobinemia Shows the AMP Moiety of the Flavin Occupying the Substrate Binding Site, Biochemistry 42: pp. 13145-51. Marohnic, C.C.; Bewley, characterization of a NADPH-util izing cytochrome b5 reductase. Biochemistry 42: pp. 11170-82. 125. Roma, G.W.; Crowley, L.J.; Davis, C.A. and Barber, M. J. (2005), Mutagenesis of glycine 179 modulates both ca talytic efficiency and reduced pyridine nucleotide specificity in cytochrome b 5 re 126. Trimboli, A.J. and Barber, M.J. (1994) Assimilatory nitrate reductase: Reduction and inhibition by NADH/NAD + analogs, Arch. Biochem. Biophys. 315: pp. 48-53. Hulo N.; Sigrist C.J.A.; Le Saux V.; Langendijk-Genevaux P.S.; Bordoli L.; Gattiker A.; De Castro E., to the PROSITE database. Nucl. Acids Res 32: pp. 134-7 Correll, C.C.; Ludwig, M.L.; Bruns, C.M. and Karplus, P.A. (1993) Structur prototypes for an extended family of flavoprotein reducta ses: Comparison of phthalate dioxygenase reductase with ferredoxin reductase and ferredoxin, Prot. Sci. 2, 2112-2131. 129. M.J. Percy; McFerran, N.V. and La ppin, T.R.J. (2005) Disorders of oxidized haemoglobin Blood Revs 19 130. Agar, N.S. and Harley, J.D. (1972) Er ythrocitic methemoglobin reductases of various mammalian species Experientia 28: pp. 1248. Lo S.C.L. and Agar N.S. (1986) NADH-methemoglobulin reductase activity the erythrocytes of newborn and adult mammals. Experientia 42: pp. 1264. Whittington, A.T.; Parkinson, A.L.; Spencer, P.B.S.; Grigg, G.; Hinds, L.; Ga antioxidant defense systems in the eryt hrocytes of Australian marsupials and montremes Comp. Biochem. Physiol 10C : pp. 267. Srivastava, S.; Alhomida, A.S.; Sidd Methemoglobin reductase activity and in vitro sensitivity towards oxidant induced methemoglobinemia in Swiss mice and Beagle dogs erythrocytes, Mole. Cell. Biochem. 232: pp.

PAGE 255

235 135. M.M. and Prchal, J.T. (1996) A novel mutation found in the 3' domain of pp. 2993 137. hatz,G. (1994) Incomplete arrest in the 138. al, T.; Sanz-Aparicio, J.; 139. and physical properties, 140. -Ghany, A.G.; Bross, P.; Nandy, A.; Rasched, I. and Ghisla, S. 142. .; Sanz-Aparicio, J. and 143. Porter, T. D. (2002) Modification of the nucleotide cofactorgenesis of recombinant 146. e dehydrogenase from 147. Blood. 97: pp1106-14 134. Chen, L., et al. (1993) Purification and characteriz ation of an NADH-rubredoxin oxidoreductase involved in the utiliza tion of oxygen by Desulfovibrio gigas. Eur J Biochem 216: pp. 443-8. Jenkins NADH-cytochrome b5 reductase in an African-American family with type I congenital methemoglobinemia. Blood 87: 136. Dym, O. and Eisenberg, D. (2001) Sequence-structure analysis of FADcontaining proteins, Prot. Sci. 10: pp. 1712-28. Hahne,K.; Haucke,V.; Ramage,L. and Sc outer membrane sorts NADH-cytochrome b 5 reductase to two different submitochondrial compartments, Cell 79: pp. 829-39. Medina, M.; Luquita, A.; Tejero, J.; Herm oso, J.; Mayor Grever, K. and Gomez-Moreno, C. (2001) Pr obing the determinants of coenzyme specificity in ferredoxin-NADP + reductase by site-directed mutagenesis, J. Biol. Chem 276: pp. 11902-12. Mller, F. (1991) Free flavins: Synthe ses, chemical Chemistry and Biochemistry of Flavoenzymes Vol. 1 (F. Mller editor), CRC Press, Boca Raton, 1-60 Kuchler, B.; Abdel (1999) Biochemical characterization of a variant human medium-chain acyl-CoA dehydrogenase with a disease-associated mutation localized in the active site, Biochem. J. 337: pp. 225-30 141. Bateman, A., Coin, L., Durbin, R., Finn, R.D., Hollich, V., Griffiths-Jones, S., Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E.L.L., Studholme, D.J., Yeats, C. and Eddy, S.R. (2004) The Pfam protein families database, Nucl. Acids Res. 32: pp. D138-D141 Hermoso, J.A.; Mayoral, T.; Faro, M.; Gomez-Moreno, C Medina, M. (2002) Mechanisms of coenzy me recognition and binding revealed by crystal structural analysis of ferredoxin-NADP + reductase complexed with NADP + J. Mol. Biol 319 : pp. 1133-42 Elmore, C. L. and binding site of cytochrome P-450 reduc tase to enhance turnover with NADH in vivo J. Biol. Chem. 277: pp. 48960-4 144. Shiraishi, N.; Croy, C.; Kaur, J. and Campbell, W. H. (1998) Engineering of pyridine nucleotide specificity of nitrat e reductase: Muta cytochrome b reductase fragment of Neurospora crassa NADPH:Nitrate reductase, Arch. Biochem. Biophys. 358: pp. 104-15 145. Barber, M. J. (2000) Alte red pyridine nucleotide spec ificity of spinach nitrate reductase, FASEB J. 14: pp. A1416 Serov, A. E., Popova, A. S., Fedorc huk, V. V. and Tishkov, V. I. (2002) Engineering of coenzyme specificity of format Saccharomyces cerevisiae, Biochem. J. 367: pp. 841-7 Dekker J., et. al. (2001) Seven new mutations in the nicotinamide adenine dinucleotide reducedcytochrome b5 reductase gene leading to methemoglobinemia type I

PAGE 256

236 Novel Missense Mutations in the NADH-Cytochrome 149. ry methaemoglobinaemia, 148. Kugler W., Pekrun A., Laspe P., Erdlenbruch B. and Lakomek M. (2001) Molecular Basis of Recessive Congenita l Methemoglobinemia, Types I and II: Exon Skipping and Three b 5 Reductase (Diaphorase 1) Gene Human Mutation: Mutation in Brief. pp. 402 Higasa K., Manabe J. Yubisui T., Sumimo to H., Pung-Amritt P., Tanphaichitr V. S. and Fukumaki Y. (1998) Molecular basis of heredita types I and II: two novel mutati ons in the NADH-cytochrome b 5 reductase gene. British Journal of Haematology. 103 : pp. 922-30

PAGE 257

237 APPENDICES

PAGE 258

238 Appendix A ist of oligonucleotide primers used to generate the Y112, T116, Q210, and E212K ariants. Nucleotides underlined and in bold encode the mutated bases generated to troduce the proper mutation. Silent mutations in italics add (+) or eliminate (-) the indicated restriction site. Mutation Primer Sequence (5 3) Restriction Site Y112A* GTG GTC AAG GTT GCA L v in TTC AAG GAC ACG + Bsm I Y112D GTG GTC AAG GTT G AC TTC AAG GAC ACG + Hinc II Y112F* GTG GTC AAG GTT T T C TTC AAG GAC ACG + Mbo II Y112H GTG GTC AAG GTT C AC TTT AAA GAC ACG + Dra I Y112L* GTG GTC AAG GTT CT C TTC AAG GAC ACG + Mbo II T116A C TTC AAG GAC G CG CAT CCC AAG + Hga I T116S* GTT TAC TTC AAG GA T T CG CAT CCC AAG + Tfi I Q210A* CTT TTC GCC AAC GC G TCC GAG AAA GAC + Afl III Q210R* CTT TTC GCC AAC C G G TCC GAG AAA GAC + Age I Q210V* CTT TTC GCC AAC GT G TCC GA G AAA GAC + Afl III E212A CC AAC CAG TCC G C G AAA GAC ATC C + BstU I E212K* GCC AAC CAG TCC A AA AAA GAC ATC CTG Hpy188I

PAGE 259

Appendix B 239 restriction site. List of oligonucleotide primers used to generate the A178, G179, G180, T181, G182, I183, T184, and P185 variants Nucleotides underlined and in bold encode the mutated bases generated to introduce the proper mutation. Silent mutations in italics add (+) or eliminate (-) the indicated Mutation Primer Sequence (5 3) Restriction Site A178T GTA GGC ATG ATC A C T GGA GGG ACA GGC +Bcl I A178V GTA GGC ATG ATT G TG GGA GGG ACA GGC -HpyCH4 V G179A ATG ATT GCA G CT GGG ACA GGC ATC ACC +Pvu II G179P ATG ATT GCT CC A GGG ACA GGC ATC ACC +Bpm I *ACC G1 79T ATG ATT GCA GGG ACA GGC ATC ACC +Nci I G179V ATG ATT GCC G TG GGG ACA GGC ATC ACC +Btg I G1 80AATG ATT GCA GGA G C G ACA GGC ATC ACC -Mnl I G180P ATG ATT GCA GGA CC G ACA GGC ATC AC +Ava II T181A ATG ATT GCA GGA GGG G CA GGC ATC ACC +Mwo I *C T1 81I ATG ATT GC GGA GGG TUC GGC ATC ACC +Msp I T181S ATG ATT GCC GGA GGG T CA GGC ATC ACC +Msp I G182A* GCA GGA GGG ACA GC C ATC ACC CCA ATG -SfaN I G182P GCA GGA GGG ACA CC C ATC ACC CCA ATG -SfaN I I183A* GGA GGG ACA GGC GC C ACC CCA ATG CTG -SfaN I I183F GGA GGG ACA GGC T TC ACC CCA ATG CTG -SfaN I I183L GGA GGG ACA GGC C TC ACC CCA ATG CTG -SfaN I I183M GGA GGG ACA GGC ATG ACC CCA ATG CTG -SfaN I T184A* GGG ACA GGC ATC G CC CCA ATG CTG CAG -Msl I T184H GG ACA GGC ATC CA C CCA ATG CTG C -Msl I T184S* GGG ACA GGC ATC T CC CCA ATG CTG CAG -Msl I T184V GGG ACA GGC ATC GT C CCA ATG CTG CAG -Msl I P185A* GGG ACA GGC ATC ACC G CA ATG CTG CAG +BsrD I P185G GGG ACA GGC ATC ACC GG A ATG CTG CAG +BsaW I

PAGE 260

Appendix C 240ction site. List of oligonucleotide primers used to generate the C273, G274, P275, P276, P277, M278, A-insertion, and G-insertion variants Nucleotides underlined and in bold encode the mutated bases generated to introduce the proper mutation. Silent mutations in italics add (+) or eliminate (-) the indicated restri Mutation Primer Sequence (5 3) Restriction Site C273A CTG ATA CTG ATG GCG GGA CCC CCA CCG +BsmF I C273M CTG ATA CTG ATG ATG GGC CCA CCA CCG +Apa II *A C2 73S CTG ATA CTG ATG G C GGA CCC CCA CCG B I +Bsr G274A CTG ATA CTG ATG TGT G C A CCC CCA CCG -Ava II G274P CTG ATA CTG ATG TGT CC A CCC CCG CCG -Fau I G274S CTG ATT CTG ATG TGT TC A CCC CCA CCG +Tfi I P275A CTG ATG TGT GGG G CC CCA CCG ATG ATC +Apa I *G P2 76A ATG TGT GGA CCG CA CCG ATG ATC CAG I -Ban P277A TGT GGA CCC CCA G C A ATG ATC CAG TTT +BsrD I M2 78A GGA CCC CCA CCG GC G AT CAG TTT GCC I T-Tfi A ins GGA CCC CCA CCG GCC ATG ATC CAG TTT +Eae I G ins GGA CCC CCA CCG GGC ATG ATC CAG TTT +Nci I

PAGE 261

ABOUT THE AUTHOR Glenn William Roma was bor n Mount Vernon, NY and was raised in Hudson, Florida. With a predisposition to understanding science, Glenn embarked on a successful academic career, with the end goal of studying veterinary medicine. After graduating at the head of his high school class, Glenn attend the Univ ersity of Florida in 1997 majoring in Microbiology and Cell Scienc es. During his time there, he developed a strong interest in biochemistry as well as in education. He received a Bachelor of Science degree in Microbiology and Cell Science from the Univer sity of Florida in 2000, with minors in Chemistry and Zoology. Shortly after gra dutating, Glenn began teaching high school chemistry and biology. He then decided to return to the world of academia and pursue his doctorate degree. He enrolled in the Gr aduate Program in Medical Sciences at the University of South Florida, College of Medi cine in the Department of Biochemistry and Molecular Biology in 2003. He found a home in the lab of Michael Barber, D.Phil and has enjoyed a productive career as a graduate student under Dr. Barber’s tutelage. Glenn hopes to attain an appointed position in a ma jor university in the Pacific Northwest, or work in the developmental field of biotechnology.