USF Libraries
USF Digital Collections

Role of FoxO factors as the nuclear mediator for PTEN-AR antagonism in prostate cancer cells

MISSING IMAGE

Material Information

Title:
Role of FoxO factors as the nuclear mediator for PTEN-AR antagonism in prostate cancer cells
Physical Description:
Book
Language:
English
Creator:
Ma, Qiuping
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
AKT
Androgen
N/c interaction
SRC
Nuclear receptor
Dissertations, Academic -- Pathology and Laboratory Medicine -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: FoxO proteins are transcriptional factors acting downstream of the tumor suppressor PTEN. Their activity is negatively regulated by AKT-mediated phosphorylation. Our previous studies showed a mutual suppression between PTEN and the androgen receptor (AR) in regulating growth and apoptosis in prostate cancer (PCa) cells. We hypothesize that nuclear FoxO proteins are involved in mediating this mutual antagonism. In this dissertation, we report that PTEN inhibits AR activity through FoxO1 and provide evidence for the involvement of FoxO factors in the androgen-mediated suppression of PTEN-induced apoptosis. Our studies identify a novel mechanism for AR inhibition by FoxO1 and demonstrated the participation of FoxO1 in AR inhibition by PTEN. Ectopic expression of active FoxO1 decrease the transcriptional activity of the AR as well as androgen-induced cell proliferation and production of prostate-specific antigen in PCa cells.FoxO1 knock down by RNA interference increased the transcriptional activity of the AR in PTEN intact cells and relieved its inhibition by ectopic PTEN in PTEN null cells. Mutational analysis revealed that FoxO1 region 150-655, which contains the fork head box and C-terminal activation domain, was required for AR inhibition. Mammalian two-hybrid assays demonstrated that the inhibition of AR activity by PTEN through FoxO1 involved the interference of androgen-induce interaction of the N- and C- termini of the AR and the recruitment of the p160 coactivators to the AR N-terminus. In addition to the inhibition of AR by FoxO1, we also demonstrated that PTEN-induced apoptosis is mediated through FoxO factors and that AR inhibited FoxO1 activity by yet-to-be identified downstream target gene. Mutation of AR DNA binding domain partially relieved the inhibition of FoxO1 trasnscriptional activity by androgens.Inhibiton of new protein synthesis abolished the AR-mediated decrease in the mRNA level of FoxO1 target gene. Overall, these studies reveal novel mechanisms for the mutual inhibition of AR and FoxO1 activity and establish FoxO proteins as important nuclear factors that mediate the mutual antagonism between AR and PTEN tumor suppressor in PCa cells.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Qiuping Ma.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 121 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002021460
oclc - 428448684
usfldc doi - E14-SFE0002559
usfldc handle - e14.2559
System ID:
SFS0026876:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 002021460
003 fts
005 20090729142837.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 090729s2008 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002559
035
(OCoLC)428448684
040
FHM
c FHM
049
FHMM
090
RB37 (Online)
1 100
Ma, Qiuping.
0 245
Role of FoxO factors as the nuclear mediator for PTEN-AR antagonism in prostate cancer cells
h [electronic resource] /
by Qiuping Ma.
260
[Tampa, Fla] :
b University of South Florida,
2008.
500
Title from PDF of title page.
Document formatted into pages; contains 121 pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
520
ABSTRACT: FoxO proteins are transcriptional factors acting downstream of the tumor suppressor PTEN. Their activity is negatively regulated by AKT-mediated phosphorylation. Our previous studies showed a mutual suppression between PTEN and the androgen receptor (AR) in regulating growth and apoptosis in prostate cancer (PCa) cells. We hypothesize that nuclear FoxO proteins are involved in mediating this mutual antagonism. In this dissertation, we report that PTEN inhibits AR activity through FoxO1 and provide evidence for the involvement of FoxO factors in the androgen-mediated suppression of PTEN-induced apoptosis. Our studies identify a novel mechanism for AR inhibition by FoxO1 and demonstrated the participation of FoxO1 in AR inhibition by PTEN. Ectopic expression of active FoxO1 decrease the transcriptional activity of the AR as well as androgen-induced cell proliferation and production of prostate-specific antigen in PCa cells.FoxO1 knock down by RNA interference increased the transcriptional activity of the AR in PTEN intact cells and relieved its inhibition by ectopic PTEN in PTEN null cells. Mutational analysis revealed that FoxO1 region 150-655, which contains the fork head box and C-terminal activation domain, was required for AR inhibition. Mammalian two-hybrid assays demonstrated that the inhibition of AR activity by PTEN through FoxO1 involved the interference of androgen-induce interaction of the N- and C- termini of the AR and the recruitment of the p160 coactivators to the AR N-terminus. In addition to the inhibition of AR by FoxO1, we also demonstrated that PTEN-induced apoptosis is mediated through FoxO factors and that AR inhibited FoxO1 activity by yet-to-be identified downstream target gene. Mutation of AR DNA binding domain partially relieved the inhibition of FoxO1 trasnscriptional activity by androgens.Inhibiton of new protein synthesis abolished the AR-mediated decrease in the mRNA level of FoxO1 target gene. Overall, these studies reveal novel mechanisms for the mutual inhibition of AR and FoxO1 activity and establish FoxO proteins as important nuclear factors that mediate the mutual antagonism between AR and PTEN tumor suppressor in PCa cells.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor: Wenlong Bai, Ph.D.
653
AKT
Androgen
N/c interaction
SRC
Nuclear receptor
690
Dissertations, Academic
z USF
x Pathology and Laboratory Medicine
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2559



PAGE 1

Role of FoxO Factors as the Nuclear Mediator for PTEN-AR Antagonism in Prostate Cancer Cells by Qiuping Ma A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology College of Medicine University of South Florida Major Professor: Wenlong Bai, Ph.D. Santo V. Nicosia, M.D. John C.M. Tsibris, Ph.D. Jerry Wu, Ph.D. Don Cameron, Ph.D. Date of Approval: July 9, 2008 Keywords: akt, androgen, n/c interaction, src, nuclear receptor,fkhr Copyright 2008 Qiuping Ma

PAGE 2

Dedication To my parents Yiyun Ma and Shuixian Li

PAGE 3

Acknowledgements Thanks to Dr. Wenlong Bai, my advisor, for his considerate mentorship, insight and support. Thanks to committee members: Drs. Cameron, Nicosia, Tsibris and Wu for their invaluable guidance, suggestion, and encouragement. My appreciation also goes to Dr. Zafar Nawaz for willing to be my outside chair. Thanks to all the faculty, staff and students in the Department of Pathology and Cell Biology, Office of Graduate Affairs for helping me along the way. Thanks to Dr. Tsibris for valuable suggestions on my proposal, paper and dissertation. Thanks to my friends and colleagues for sharing my joy and sadness in my study life. This dissertation and all my success are dedicated to my dear parents: Yiyun Ma and Shuixian Li and my brothers for their life-long loving, unselfish giving and unlimited support.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES.............................................................................................................vi LIST OF FIGURES...........................................................................................................vii ABSTRACT......................................................................................................................i x INTRODUCTION...............................................................................................................1 1. Nuclear Receptor Superfamily............................................................................1 1.1. Classification...........................................................................................1 1.2. Androgens and the Androgen Receptor..................................................4 1.2.1. Androgens......................................................................................4 1.2.2. Androgen Receptor........................................................................4 1.2.2.1. AR Genes Chromosomal Location and Structure.................4 1.2.2.2. AR Protein Structure and Activity..........................................7 1.2.2.2.1. N-terminal Domain.....................................................7 1.2.2.2.2. DNA Bind Domain......................................................8 1.2.2.2.3. Ligand Binding Domain.............................................9 1.2.2.3. Molecular Mechanisms of AR Action.....................................9

PAGE 5

ii 1.2.2.4. Regulation of AR Function..................................................10 1.2.2.4.1. Phosphorylation, Acetylation and Symoylation........10 1.2.2.4.2. Coactivator Binding.................................................11 1.2.2.4.3. AR Nand C-terminal Interaction............................13 1.2.2.5. Androgen-Regulated Genes................................................14 2. PI3K-PTEN-AKT Pathway................................................................................15 2.1. PI3K Activity and Regulation.................................................................15 2.2. PTEN.....................................................................................................20 2.3. AKT.......................................................................................................21 2.4. The FoxO Family of Forkhead Transcription Factors............................22 2.4.1. The Fox Family............................................................................22 2.4.1.1. FoxO Subgroup...................................................................22 2.4.1.1.1. Structure...........................................................................23 2.4.1.1.2. Regulation of FoxO Functions through Multiple Mechanisms................................................................23 2.4.1.1.2.1. Post-Translational Modification of FoxO Proteins ..........................................................23 2.4.1.1.2.1.1. Phosphorylation...........................................24 2.4.1.1.2.1.2. Acetylation...................................................26 2.4.1.1.2.1.3. Ubiquitination...............................................26 2.4.1.1.2.2. FoxO Interacting Proteins......................................27

PAGE 6

iii 2.4.1.1.3. FoxO Functions in Mammalian Cells...............................27 2.4.1.1.4. FoxO and Cancer.............................................................30 3. Prostate Cancer................................................................................................31 3.1. AR and PCa Risk..................................................................................31 3.2. PTEN-AKT-FoxO1 in PCa.....................................................................33 HYPOTHESIS AND OBJECTIVES.................................................................................35 MATERIALS AND METHODS.........................................................................................36 1. Plasmids...........................................................................................................36 2. Cell Culture, Transient Transfections and Reporter Assays..............................37 3. Immunoblotting Analysis .................................................................................39 4. Adenovirus Infection and Colorimetric MTT Assay...........................................40 5. Immunofluorescence and Deconvolutin Imaging..............................................40 6. Northern Blot Analysis.......................................................................................41 7. Reverse Transcriptase-Polymerase Chain Reaction Analysis..........................42 8. Apoptotic Assays...............................................................................................42 RESULTS........................................................................................................................ 44 1. FoxO Factors Inhibit AR Transcriptional Activity.................................................44 1.1. Inhibition of AR activity by FoxO1 .......................................................44 1.2. Inhibition of AR Activity by FoxO3a and FoxO4....................................47 1.3. Involvement of Endogenous FoxO Fcators in AR Inhibition..................47

PAGE 7

iv 2. Defining FoxO1 Domains Involved in AR Repression.......................................50 3. Effect of FoxO1 on Nuclear Localization of AR.................................................54 4. Inhibition of AR N/C Interaction by FoxO1........................................................54 5. FoxO1 Negates the Positive Effect of p160 Coactivators on AR Transcriptional Activity by Blocking p160 Coactivators Interaction with AR NTD................................................................................61 5.1. FoxO1 Represses the Enhancement of AR Transcriptional Acitivity by p160 Coactivators..........................................................................61 5.2. FoxO1 Inhibits p160 Coactivators Interaction with AR NTD....................61 6. Inhibition of AR Activity by FoxO1 Is Not Affected by CAG Repeats.................65 7. Enhancement of AR Activity by Constitutively Active AKT Is Decreaed by FoxO1ca....................................................................................................68 8. FoxO Factors Mediate the AR Suppression by PTEN......................................68 9. FoxO1 Mediates the Negative Effect of PTEN on AR N/C Interaction and AIB1 Recruitment....................................................................................71 10. FoxO1 Suppresses Androgen-Induced Proliferation and PSA Expression in PCa Cells.................................................................................71 11. Working Model for PTEN Inhibition on AR through FoxO1...............................75 12. FoxO1 Inhibition Mediated Through AR Is Diminished by Mutated AR DBD...............................................................................................................75 13. The Effect of AR on Nuclear Localization of the FoxO1 Protein.......................77 14. Decreased mRNA level of FoxO1 Reporter Gene by Androgens Is Alleviated by Inhibiting New Protein Synthesis...................................................................81 15. FoxO Knockdown Inhibits PTEN-Induced Apoptosis........................................81 16. Working Model for AR Inhibition of FoxO1........................................................84

PAGE 8

v DISCUSSION..................................................................................................................86 SUMMARY AND PERSPECTIVES FOR FUTURE STUDIES........................................95 REFERENCES ............................................................................................................101 ABOUT THE AUTHOR........................................................................................End Page

PAGE 9

vi LIST OF TABLES Table 1. FoxO Factors Binding Partners.......................................................................28 Table 2. The Primer Sequences for the Plasmids........................................................38

PAGE 10

vii LIST OF FIGURES Figure 1. Nuclear Receptors Share Common Structure/Function Domains.................2 Figure 2. Genomic Organization and Protein Domains of the AR................................5 Figure 3. Signalling Pathways of PI3K-PTEN-AKT-FoxO...........................................17 Figure 4. Schematic of the Domains in FoxO1...........................................................25 Figure 5. Dose-Dependent Inhibition of AR Activity by FoxO1....................................45 Figure 6. FoxO3a and FoxO4 Also Inhibit AR.............................................................48 Figure 7. Knockdown of FoxO Factors Enhances the AR Activity..............................49 Figure 8. Mapping FoxO1 Domains Required for AR Inhibition..................................52 Figure 9. Lack of an Effect of FoxO1 on AR Cellular Localization..............................55 Figure 10. FoxO1 Suppresses AR N/C Interaction in Mammalian Two-hybrid Assays.....................................................................................................57 Figure 11. FoxO1 Inhibits AR NTD Activity...................................................................60 Figure 12. FoxO1 Represses Enhancement of AR Transcriptional Acitivity by p160 Coactivators....................................................................................62 Figure 13. FoxO1 Blocks AIB1 Recruitment to AR NTD...............................................63 Figure 14. FoxO1 Interacts with AR NTD But Not Coactivators...................................66

PAGE 11

viii Figure 15. AR CAG Repeats Is Not Associated with AR Inhibition by FoxO1..............67 Figure 16. Enhancement of AR Activity by Constitutive Active AKT Is Decreased by FoxO1ca...........................................................................69 Figure 17. FoxO Knockdown Relieves the AR Inhibition by PTEN in Prostate Cells...........................................................................................70 Figure 18. Participation of Endogenous FoxO Factors in PTEN-Induced Suppression of AR N/C Interaction and Coactivators Recruitment.............................................................................................72 Figure 19. Suppression of Biological Activities of the AR in PCa Cells by Nuclear FoxO1.........................................................................................74 Figure 20. A Working Model Depicting the Role of FoxO1 in PTEN-induced AR Inhibition in PCa Cells and Its Suppression by AKT..........................76 Figure 21. Mutation of AR DBD Partially Relieved the Inhibition on FoxO1 Activity.....................................................................................................78 Figure 22. Lack of an Effect of the AR and the ARmut on FoxO1 Cellular Localization.................................................................................80 Figure 23. Decreased Transcription of FoxO1 Reporter Gene by Androgen Is Alleviated by A New Protein Synthesis Inhibitor.......................................82 Figure 24. FoxO Knockdown Suppresses PTEN-Induced Apoptosis...........................83 Figure 25. A Working Model Depicting the Mechanisms of FoxO1 Suppression by Androgens......................................................................85 Figure 26. Model for Roles of Foxo Factors in the Mutual Antagonism between AR and PTEN............................................................................93

PAGE 12

ix Role of FoxO Factors as the Nuclear Mediator for PTEN-AR Antagonism in Prostate Cancer Cells Qiuping Ma ABSTRACT FoxO proteins are transcriptional factors acting downstream of the tumor suppressor PTEN. Their activity is negatively regulated by AKT-mediated phosphorylation. Our previous studies showed a mutual suppression between PTEN and the androgen receptor (AR) in regulating growth and apoptosis in prostate cancer (PCa) cells. We hypothesize that nuclear FoxO proteins are involved in mediating this mutual antagonism. In this dissertation, we report that PTEN inhibits AR activity through FoxO1 and provide evidence for the involvement of FoxO factors in the androgen-mediated suppression of PTEN-induced apoptosis. Our studies identify a novel mechanism for AR inhibition by FoxO1 and demonstrated the participation of FoxO1 in AR inhibition by PTEN. Ectopic expression of active FoxO1 decr ease the transcriptional activity of the AR as well as androgen-induced cell proliferation and production of prostate-specific antigen in PCa cells. FoxO1 knock down by RNA interference increased the transcriptional activity of the AR in PTEN intact cells and re lieved its inhibition by ectopic PTEN in PTEN

PAGE 13

x null cells. Mutational analysis revealed that FoxO1 region 150-655, which contains the fork head box and C-terminal activation domain, was required for AR inhibition. Mammalian two-hybrid assays demonstrated that the inhibition of AR activity by PTEN through FoxO1 involved the interference of androgen-induce interaction of the Nand Ctermini of the AR and the recruitment of the p160 coactivators to the AR N-terminus. In addition to the inhibition of AR by FoxO1, we also demonstrated that PTEN-induced apoptosis is mediated through FoxO factors and that AR inhibited FoxO1 activity by yet-to-be identified downstream target gene. Mutation of AR DNA binding domain partially relieved the inhibition of FoxO1 trasnscriptional activity by androgens. Inhibiton of new protein synthesis abolished the AR-mediated decrease in the mRNA level of FoxO1 target gene. Overall, these studies reveal novel mechanisms for the mutual inhibition of AR and FoxO1 activity and establish FoxO proteins as important nuclear factors that mediate the mutual antagonism between AR and PTEN tumor suppressor in PCa cells.

PAGE 14

1 INTRODUCTION 1. Nuclear Receptor Superfamily Effects of androgens are mediated through the Androgen Receptor (AR) that is a ligand regulated sequence specific transcription factor belonging to the nuclear receptor superfamily. The nuclear receptors are char acterized by a central DNA-binding domain (DBD), which targets the receptor to specific DNA sequences known as hormone response elements. The DBD is composed of two highly conserved zinc fingers that set the nuclear receptors apart from other DNA-binding proteins. The C-terminal half of the receptor encompasses the ligand-binding domai n (LBD), which possesses the essential property of hormone recognition and ensures both specificity and selectivity of the physiologic response (1) (Fig.1) 1.1. Classification The nuclear receptor superfamily can be broadly divided into four classes based on their dimerization and DNA-binding properties (1). Class I receptors include the known steroid hormone receptors, which contain highly conserved DBDs binding to DNA half-sites organized as inverted repeats, moderately conserved LBDs, and divergent

PAGE 15

LBD N C A/B C D E F DBD ARAR Class I: Steroid ReceptorsAR androgen GR glucocorticoid PR progesterone MR mineralcorticoid ER estrogen RXR RXR RAR VDR 1,25-(OH)2-VD3 TR thyroid hormone RAR all-trans RA PPAR , eicosinoids EcRecdysone RXR RXR RXR RXR Class III: DimericOrphan Receptors Class IV: MonomericSteroid Receptors NGFI-BRXR(usp) 9-cis RA COUP/ARP ? HNF-4 ? NGFI-B (CEB-1) ? ELP/SF-1 (Ftz-F1) ?Class II: RXR Heterodimers Figure 1. Nuclear Receptors Share Common Structure/Function Domains. 2

PAGE 16

3 Figure 1. Nuclear Receptors Share Common Structure/Function Domains. A typical nuclear receptor contains a variable N-terminal region (A/B) containing transcriptional activation function 1 (AF-1), a central conserved DBD (C), a variable hinge region (D), a conserved LBD (E) containing activation function 2 (AF-2), and a variable C-terminal region (F), the function of which is poorly understood. Nuclear receptors can be grouped into four classes according to their ligand binding, DNA binding, and dimerization properties: steroid receptors, RXR heterodimers, homodimeric orphan receptors, and monomeric orphan receptors. Shown are representing receptors for each group with the corresponding ligands. Question marks refer to orphan receptors for which ligands are not known. Adapted from Mangelsdorf, D. J. et al.(1)

PAGE 17

N-terminal domains NTD (1-4). Class II receptors heterodimerize with Retinoid X receptor (RXR) and characteristically bind to direct repeats (although some bind to symmetrical repeats as well). Class III receptors bind primarily to direct repeats as homodimers. Class IV receptors typically bind to extended core sites as monomers. Most of the orphan receptors fall into class III and IV categories (1) 1.2. Androgens and the Androgen Receptor 1.2.1. Androgens Testosterone is a Carbon 19 steroid that, together with the more potent 5 -reduced metabolite dihydrotestosterone (DHT), is responsible for male development in utero as well as secondary sexual characteristics, male reproductive function and fertility at puberty and in adult life. The prostate gland depends on androgens for its development and for the maintenance of its integrity. Androgens are also mitogens that stimulate Prostate Cancer (PCa) growth (see below). 1.2.2. Androgen Receptor 1.2.2.1. AR Genes Chromosomal Location and Structure In 1988, human AR complementary DNA was cloned demonstrating that the AR gene is located on chromosome Xq11-12 (5, 6). The gene is oriented with the 5' end toward the centromere and spans 90 kb of DNA containing eight exons that code for a 2,757-base pair (bp) open reading frame within a 10.6-kb mRNA (7, 8). The AR genomic organization is conserved throughout mammalian evolution from rodents to man. Fig.2 4

PAGE 18

1 2 3 4 5 6 7 8 X chromosome q11-12 Intron Exonsize1613 288 145 131 158 155 (Gln)19-23(Pro)9(Gly)16 Amino Acid 1 Transcription Region Protein-Protein Interaction DNA-binding Steroid Binding Dimerization Hsp90 Binding Transactivation? Zn++ Zn++537626 919 NLS AR Gene AR Protein Figure 2. Genomic Organization and Protein Domains of the AR. 5

PAGE 19

6 Figure 2. Genomic Organization and Protein Domains of the AR. The genome spans more than 80 kb that includes the exonic organization shown in the second panel. Location of three codon repeat regions in the first exon that codes for the NTD is shown in the third panel. The diagram of the protein structure demonstrates how the exon organization translates into discrete functional regions of the receptor. N-terminal A/B region (NTD) is encoded by a single large exon (exon 1). It contains the major activation function (AF-1) and is involved in contacting the transcriptional machinery and transcription regulation. A most highly conserved DBD, the central 60-100 amino acids, encoded by exon 2 and 3, containing two zinc fingers, are responsible for targeting the receptor to specific sequences in the genome associated with target genes. A short highly conserved hinge region, containing a bipartite nuclear localization signal (NLS, amino acids 608-625), links the LBD and DBD. A highly conserved LBD, which contains a weaker activation function (AF-2), is encoded by exons 4-8. Adapted from Quigley et al. (9).

PAGE 20

7 illustrates the organization of the AR gene and the domain structure of the protein. The NTD is encoded by a single large exon (exon 1). A most highly conserved DBD, the central 60-100 amino acids, encoded by exon 2 and 3. A short highly conserved hinge region, containing a bipartite nuclear localization signal (NLS, amino acids 608-625), links the LBD and DBD. A highly conserved LBD, which contains a weaker activation function (AF-2) encoded by exons 4-8. 1.2.2.2. AR Protein Structure and Activity 1.2.2.2.1. N-terminal Domain The AR NTD is characterized by a number of amino acid repeat sequences, including polyglutamine (Q), poly-glycine (G) and poly-proline (P). Most noteworthy of these is a CAG triplet repeat that begins at codon 58 and extends for an average of 21 2 repeats (10). The CAG triplet codes for the amino acid glutamine. The length of the CAG repeat unit can affect AR activity and influence PCa risk (see below). Expansion of the AR CAG repeat to a length greater than 40 results in Kennedys disease or spinal and bulbar muscular atrophy, a neurodegenerative condition associated with selective neuronal cell death in brainstem and spinal cord (10, 11). This change leads to a reduction in the ability of the full-length AR or the isolated NTD to activate transcription. Two transactivating functions (AFs) have been characterized in the AR, AF1 in the NTD and AF2 in the LBD. The NTD is the primary effector region that is largely responsible for transactivation whereas AF2 in the LBD appears to be a weak

PAGE 21

8 transactivation domain. Deletion of the LBD from the AR results in a residual N-terminal fragment with constitutive activity nearly equal to the transcriptional activity of the ligand-bound, full-length protein (12-15). This finding is in contrast to what occurs with the closely related estrogen receptor (ER), in which AF2 is the major activation domain and AF1 has variable independent activity (16). The situation in the AR is still more complex, in that two discrete, overlapping activation domains exist in NTD and their usage is context dependent (17). The precise residues and mechanisms that contribute to the AF1 activity of the AR have not been conclusively established. Studies have defined amino acids 142-485 as the AF1 domain. A core region Tau1 (transcription activation unit 1) located between residues 101 and 360 contributes more than 50% of the activity. In contrast, a smaller part of the NTD (amino acids 360-528) is sufficient for the constitutively active AR to induce transcription, whereas Tau5 (amino acid 370-494) contributes more than 50% of activity. However, the size and location of the active TAUs in the human AR NTD are variable, being dependent on the promoter context and presence or absence of the LBD (18, 19). 1.2.2.2.2. DNA Bind Domain Recognition and binding of DNA is achieved by the DBD (amino acid 537-626), which comprises two Zn-binding motifs, with four cysteine residues coordinating each Zn ion. A consensus DNA-binding site, 5-AGGCTCTnnnA/TGTTCT/C-3, is identified as androgen response element (ARE) for DNA binding. Interestingly, this sequence can be

PAGE 22

9 read as an imperfect palindrome or as a direct repeat. In addition, the presence of multiple AREs in a promoter region causes tandem promoter binding and enhancement of AR specificity and action (20). 1.2.2.2.3. Ligand Binding Domain Whereas ER and thyroid hormone receptor (TR) LBDs form dimers in crystal structure, the crystal structure of the ligand-bound AR LBD is monomeric (21). Since there is evidence to suggest that ligand-bound, full-length AR dimerizes in vivo, it is likely that the N-terminal region of AR is important for protein dimerization. In contrast, ligand-induced conformational changes within the LBD are important for the AR Nand C-terminal interaction (N/C interaction) (22, 23). Helices 4, 5, and 10 are the primary AR contact regions for ligand binding. Ligand binding that induces folding of helix 12 to overlie the pocket discloses a groove that binds a region of the NTD. Coactivator molecules can also bind to this groove, but the predominant site for coactivator binding to AR is in the NTD (21, 24, 25) (see below). 1.2.2.3. Molecular Mechanisms of AR Action The process of ligand-induced transformation of the AR is not completely understood, the ligand-free AR exists predominant ly in the cytoplasm, where it is sequestered by binding to chaperone molecules such as heat shock proteins (26). Upon ligand binding: 1) heat shock proteins are dissociated; 2) the AR translocates to the nucleus influenced by the hinge region ; 3) the AR conformation changes; 4) the AR

PAGE 23

10 forms homodimers; 5) post-translational modi fications of the AR occur, such as phosphorylation and acetylation; 6) the AR binds to AREs on the DNA; 7) interaction with specific target proteins, such as TFIIF or Trimethylamine n-oxide (TMAO), results in folding of the AF1 domain and an increase in -helix content.The folding of helix 12 results in the generation of a surface that facilitates further protein-protein interactions. In order to regulate transcription, two general steps must be accomplished: 1) the remodeling of chromatin structure to open up regulatory regions and the promoter and 2) the recruitment of the general transcription machinery to the promoter to enhance transcription initiation and /or elongation. The AR can potentially regulate both these steps, leading to an increase in the level of target gene mRNA. 1.2.2.4. Regulation of AR Function 1.2.2.4.1. Phosphorylation, Acetylation and Sumoylation AR is phosphorylated at a number of sites in response to agonist binding that results in nuclear localization, but usually not in response to antagonists (27, 28). The majority of the identified phosphorylation sites map to the NTD and the AF1 region (29), suggesting that this modification may modulate receptor-dependent transactivation directly. Possible mechanisms could involve alteration in protein-protein interactions and/or in protein structure and stability. AR acetylation is induced by the ligand DHT and by histone deacetylase (HDAC) inhibitors in living cells. Fu et al. reported that acetylation of the AR enhances binding of

PAGE 24

11 the p300 coactivator protein(30). The AR acetylation promotes survival and growth of PCa cells in soft agar and in nude mice and trichostatin A (TSA) augments the transcriptional activity of androgens-ligated AR (31). The HDAC binding protein Smad3 inhibits the activity of the androgens-ligated AR (32, 33). HDAC1 bound to the AR in vivo and HDAC1 binding to the AR is dissociated by the ligand DHT. Recent reports indicate that the AR could be regulated by SUMO (named for small ubiquitin-like modifier protein) modification. AR is sumoylated in vivo at lysine residues 386 and 520. Mutation of both sumoylation sites results in enhancing AR transcriptional potential (34), indicating that SUMO modification plays a negatively regulatory role in modulating AR activity. SUMO-specific proteases, SENP1, profoundly enhances AR-dependent transcription (35). 1.2.2.4.2. Coactivator Binding Transcriptional coactivators are recruited to the promotor through protein-protein interaction with the receptor (36-39). Most known coactivators are complex proteins that harbor multiple activation domains and receptor-interacting domains (40, 41). The best studied group of coactivators is the p160 steroid receptor coactivator family with three family members SRC1 (steroid receptor coactivator 1), AIB1 (amplified in breast cancer-1), TIF2/GRIP1 (the transcription intermediary factor 2, or the human orthologue of glucocorticoid receptor-interacting protein 1). Upon recruitment to the promoters by nuclear receptors, the coactivators affect transcription by modifying the chromatin

PAGE 25

12 structure either by themselves or through the recruitment of cofactors involving histone acetyltransferases (HATs) such as CBP/p300, ATP-dependent chromatin remodeling complexes such as SWI/SNF or PBAF, the mediator complex (Mediator/TRAP/DRIP) and histone methyltransferase such as coactivator-associated arginine methyltransferase 1 (CARM1) (42, 43). The ubiquitin-proteasome pathway enzymes have also been reported to be recruited to the steroid nuclear receptor target gene promoters during transcription. One such enzymes is E6-associated protein (E6-AP), which possesses two independent separable functions; a coactivation function and an ubiquitin-protein ligase activity (44). The three-dimensional structures of the LBDs of the steroid hormone receptors fold into 12 helices that form a ligand-binding pocket. Helices 3, 4, 5, and 12 are the sites of AF2 activity that was discovered by mutational analysis to be important for p160 coactivators binding (24). Coactivator molecules contain a consensus motif LXXLL (L is leucine and X is any amino acid) in a region called the nuclear receptor (NR) box, which binds to the groove in steroid hormone receptors (45, 46). Many of these proteins belong to the steroid receptor coactivator family and bind to the AF2 region in the C terminus of ligand-bound receptors. Whereas TR, for example, interact with coactivators via contact points in the LBD, the AR interacts with the p160 coactivators via two surfaces, one in the LBD domain and one in the NTD. The LBD interacts with the NR box, whereas the NTD has a high affinity

PAGE 26

13 for a specific glutamine-rich region in the p160 coactivators (for example, 1053-1123 in SRC1). Both Tau1 and Tau5 domains are implicated in the recruitment of p160 coactivators (17, 47). p160 coactivators in which the LXXLL motifs are mutated retain most of their coactivator activity for the full-length AR, although they are no longer functional for the isolated LBD. These data suggest that in the native AR the efficient recruitment of coactivators occurs primarily through the NTD (14). The binding site for p160 coactivators includes amino acids 360-494, although additional regions of the AR NTD may contribute to this interaction. In addition to common p160 coactivators, AR is also modulated by AR-selective coactivators such as ARA54, ARA70 (48-50). Even though the mechanism of interaction between AR and coactivators may differ from that of other steroid hormone receptors, coactivators are still essential for AR action in vivo. This is underscored by the observation that the androgen insensitivity syndrome occurred in an individual with a mutation in a coactivator gene and a normal AR gene (51). Overexpression of these coactivators increases AR transactivation at physiological concentrations of adrenal androgen. AR coactivators enhance transactivation of AR several fold and theref ore potentially increase the risk of PCa. 1.2.2.4.3. AR Nand C-terminal Interaction Interaction between the NTD and LBD of the ligand-bound receptor, namely N/C interaction, is essential for AR activity (52-57). The importance of N/C interaction is underscored by the fact that complete androgen insensitivity syndrome can be caused by

PAGE 27

14 missense mutations in helix 12 and in other regions of the LBD that interact with the NTD (9). This interaction facilitates binding of p160 coactivators to AR in a manner independent of the LXXLL NR boxes. Moreover, the N/C interaction stabilizes receptor-ligand interactions and is required for ligand-dependent activation of the receptor. In fact, two pentapeptide regions of the AR NTD, 23FQNLF27 (FXXLF) and 433WHTLF437 (WXXLF), mediate binding of the N terminus to the C-terminal region of AR. 23FQNLF27 interacts with the AF2 groove formed by helices 3, 4, 5, and 12 and competes favorably with LXXLL-containing coactivator proteins for ligand-dependent binding to the LBD (58). The pentapeptide 433WHTLF437 also binds to the C-terminal region but at a site outside the AF2 groove. Substitution of glutamic acid by glutamine at position 888 (E888Q) in the AF2 activation domain (AD) core region in the LBD, markedly decreased the interaction with the NTD. This mutation neither influenced hormone binding nor LBD homodimerization, suggesting a role of the AF2 AD core region in the functional interaction between the NTD and the LBD. 1.2.2.5. Androgen-Regulated Genes Results from DNA microarrays (59-61) have led to the identification of a large number of androgen regulated genes which can be classified into several functional groups, including metabolism, protein chaperoning and trafficking, protein synthesis, secretions, cell cycle and apoptosis, structural and extracellular matrix proteins, and proteins with no known functions. The specific identified androgen-responsive genes

PAGE 28

15 include Prostate Specific Antigen (PSA) (62) (see below), hKLK2 (human prostatespecific kallikrein) (63), which has been proposed as potential biomarkers for PCa (64); NKX3.1 (65), which is a potential tumor suppressor gene for PCa (66-68); probasin (69), prostatein C3 (70), and cyclin D1 (71). PSA is a secreted protein that is abundantly expressed by prostate epithelial cells with serum levels correlating with tumor burden. Serum PSA levels are routinely used by clinicians to monitor treatment responses, prognosis and progression of patients with PCa. A rising titer of serum PSA after an initial response to androgen deprivation is the earliest indication of tumor progression and is correlated with reduced survival. Once serum PSA levels are elevated in the absence of androgens, the average survival time is 2 years. 2. PI3K-PTEN-AKT Pathway 2.1. PI3K Activity and Regulation Phosphatidylinositol (PtdIns) plays a crucial role in signal transduction as the precursor of several second-messenger molecules. Although multiple forms of phosphoinositide 3-kinases (PI3Ks) exist in higher eukaryotes, the class Ia enzymes are primarily responsible for production of D-3 phosphoinositides in response to growth factors (72). The class I family of PI3K is activated downstream of receptor tyrosine kinases (RTK) or G protein-coupled receptors (GPCR). Class Ia enzymes are heterodimers of regulatory and catalytic subunits. The regulatory subunit called p85

PAGE 29

16 proteins maintains the p110 catalytic subunit in a low-activity state in quiescent cells and mediates its activation by direct interaction with phosphotyrosine residues of activated growth factor receptors or adaptor proteins. The activated PI3K converts the plasma membrane lipid phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2 or PIP2) to phosphatidylinositol-3,4,5-trisphosphate(PI(3,4,5)P3 or PIP3). Signaling proteins with pleckstrin-homology (PH) domains accumulate at sites of PI3K activation by directly binding to PIP3. Of particular interest are the protein serine-threonine kinases AKT [also called protein kinase B (PKB)] and phosphoinositide-dependent kinase 1 (PDK1) (Fig.3). Association with PIP3 at the membrane brings these proteins into proximity and facilitates phosphorylation of AKT by PDK1. This phosphorylation stimulates the catalytic activity of AKT. Recently, many activating mutations in the PI3KCA gene (coding for the p110 catalytic subunit of PI3K) have been described to be present in human tumors. Activation of PI3K and AKT are reported to occur in breast (75-77), ovarian (78, 79) and other cancers (80-83). The termination of PI3K signaling by degradation of PI(3,4,5)P3 can be mediated by at least two different types of phosphatases. The Src-homology 2 (SH2)-containing phosphatases (SHIP1 and SHIP2) dephosphorylate the 5 position of the inositol ring to produce PI(3,4)P2. Although this dephosphorylation impairs some signaling downstream of PI3K, PI(3,4)P2 can also mediate PI3K-dependent responses and may mediate events

PAGE 30

PI3K PTEN PIP2 PIP3 AKT FoxO 14-3-3 P P P FoxO 14-3-3 P P P FoxO p27 GADD45 CylcinG2 MnSOD Catalase FasL BIM BCL-6 PUMA PEPCK SCPx G6Pase Oxidativestress resistance Cell-cycle inhibition Apoptosis Metabolism NUCLEUS CYTOPLASM Muscle atrophy atrogin-1 p21 DNA repair GADD45 DDB1 BTG-1 differentiation p21 ppase DegradationRTKGPCR Figure 3. Signalling Pathways of PI3K-PTEN-AKT-FoxO. 17

PAGE 31

18 Figure 3. Signalling Pathways of PI3K-PTEN-AKT-FoxO. In the cytoplasm, PI3K is activated downstream of RTK and GPCR to covert PIP2 to PIP3, leading to AKT activation. PTEN phosphatase antagonizes PI3K by converting PIP3 to PIP2. Localized in the nucleus in the absence of insulin or growth factors, FoxO factors cause cell cycle arrest, stress resistance, and cell death by upregulating a series of key target genes. In the presence of insulin or growth factors, the PI3KAKT pathway is activated. AKT translocates to the nucleus where it directly phosphorylates FoxO transcription factors on three conserved residues. Phosphorylated FoxO factors bind to 14-3-3 proteins, which result in the export of FoxO factors from the nucleus into the the cytoplasm and degradation. The sequestration of FoxO into the cytoplasm inhibits FoxO-dependent transcription and allows cell proliferation, stress sensitivity, and cell survival. Note that this figure does not include all FoxO target genes. p21 andp27: CDK inhibitor; GADD45: growth arrest and DNA damage-inducible protein 45; Cyclin G2: a cyclin that associates with active protein phosphatase 2A and promotes a G1/S-phase cell cycle arrest, CDK2 inhibition and the formation of aberrant nuclei; MnSOD: manganese superoxide dismutase; Catalase: an enzyme that catalyzes the decomposition of hydrogen peroxide into water and oxygen; Atrogin-1: a muscle-specific F-box protein highly expressed during muscle atrophy; FasL: Fas ligand; Bim: pro-apoptotic BH3-only Bcl-2 family member; Puma: p53-upregulated modulator of apoptosis; BTG-1: B-cell translocation gene 1; DDB1: damage-specific DNA-binding

PAGE 32

19 protein 1; PEPCK: phosphoenolpyruvate carboxykinase; G6Pase: glucose-6-phosphatase; SCPx: Sterol carrier protein X-related thiolase. Partly adapted from van der Horst, A.(73) and Baker, S. J. (74).

PAGE 33

20 independent of those stimulated by PI(3,4,5)P3. Another phosphatase is PTEN which dephosphorylates the 3 position of PI(3,4,5)P3 to produce PI(4,5)P2 (See below). 2.2. PTEN The discovery of PTEN/MMAC1 for phosphatase and tensin homolog deleted on chromosome 10 or mutated in multiple advanced cancers were first reported by two groups in 1997 (84, 85). The PTEN gene resides within chromosome region 10q23. Germline mutations of PTEN are found in three related human autosomal dominant disorders, Cowden disease (CD) (86), Lhermitte-Duclos disease (LDD) and Bannayan-Zonana syndrome (BZS) (87), char acterized by tumor susceptibility and developmental defects. Somatic deletions or mutations of PTEN have been identified in a large fraction (12-60%) of a wide variety of tumors, tumor cell lines and xenographs(84, 85). Loss of PTEN is more often associated with advanced stage tumors, such as glioblastoma (88), melanoma (89) and PCa (90, 91). Evidence that PTEN functions as a tumor suppressor genes include: 1) homozygous disruption of PTEN results in ear ly embryonic lethality; 2) heterozygous PTEN mice display hyperplastic-dysplastic changes in the prostate, skin and colon, which are also seen in CD, LDD and BZS. 3) PTEN inactivation enhanced the ability of embryonic stem (ES) cells to generat e tumours in nude and syngeneic mice, due to increased anchorage-independent growth (92); 4) PTEN-deficient immortalized mouse

PAGE 34

21 embryonic fibroblasts exhibit decreased sensitiv ity to cell death in response to a number of apoptotic stimuli, accompanied by consti tutively elevated activity and phosphorylation of AKT, a crucial regulator of cell survival (93). PTEN encodes a dual and protein phosphatase whose main in vivo substrate is PIP3. PTEN suppresses tumor growth by negatively regulating this signal transduction pathway (94). Loss of PTEN function, either in murine ES cells or in human cancer cell lines, results in accumulation of PIP3 mimicking the effect or PI3K activation and triggering the activation of its downstream effectors, PDK1, AKT/PKB and Rac1/Cdc42. 2.3. AKT AKT is a serine-threonine kinase downstream of PTEN/PI3K that has three family members: AKT1, AKT2 and AKT3, which are encoded by three different genes (95). They are ubiquitously expressed, but their levels are variable depending upon the tissue type. The N-terminus of AKT contains a PH domain that binds phospholipids, a central kinase domain, and a regulatory serine phosphorylation site in the C-terminus. AKT activity is regulated by PI(3,4,5)P3, which recruits AKT to the cell membrane, permitting its activation by PDK1(96). Activated PDK1 phosphorylates AKT at T308, activating its serine-threonine kinase activity (100-fold over the basal). Once phosphorylated in T308, further activation occurs by PDK2 (the complex rictor-mTOR or DNA-PK) by phosphorylation at S473. AKT activation stimulates cell cycle progression, survival, metabolism and migration through phosphorylation of many physiology substrates

PAGE 35

22 (96-100). Most of the known protein targets of AKT become inhibited by the phosphorylation event to keep them in inactive states or to promote their degradation. This includes FoxO1, the apoptosis-inducing protein BAD, glycogen synthase kinase 3 (GSK3). 2.4. The FoxO Family of Forkhead Transcription Factors 2.4.1. The Fox Family The winged helix/forkhead class of transcription factors is characterized by a conserved 100-amino-acid, monomeric DBD termed the 'forkhead box' (101). The Forkhead family is present in all eukaryotes. In humans, the Forkhead family is comprised of 39 distinct members, which have been divided into 19 subgroups (Fox for 'Forkhead Box' A to S). Fox transcriptional regulators play a wide range of roles during development, ranging from organogenesis (FoxC) to language acquisition (FoxP) (102). 2.4.1.1. FoxO Subgroup Among the Forkhead family, the FoxO subgroup contains four members (FoxO1/FKHR, FoxO3/FKHRL1, and FoxO4/AFX and FoxO6). FoxO1, FoxO3, and FoxO4 mRNAs are expressed to varying degrees in all tissues in mammals (103-105). FoxO1 mRNA is particularly abundant in adipose tissues, FoxO3 mRNA is highly expressed in the brain, and FoxO4 mRNA is abundant in the heart. FoxO6 mRNA is predominantly expressed in the developing brai n, indicating that FoxO6 may play an important role in the nervous system.

PAGE 36

2.4.1.1.1. Structure FoxO proteins consist of four domains: a highly conserved forkhead DBD, a nuclear localization signal (NLS) located just downstream of DBD, a nuclear export sequences (NES) and a C-terminal transactivation domain. The first 1-150 residues in the NTD of FoxO1 was reported to contain a transactivation function (106). The regions with the highest sequence conservation include the N-terminal region surrounding first AkT/PKB phosphorylation site, the forkhead DBD, the region containing NLS and the part of the C-terminal domain (Fig.4). 2.4.1.1.2. Regulation of FoxO Functions through Multiple Mechanisms 2.4.1.1.2.1. Post-Translational Modification of FoxO Proteins FoxO functions are regulated through post-translational modifications induced by two different but interconnected circuits: the regulation by growth factor (insulin) signalling mainly through PI3KAKT/PKB and a second pathway that is activated by oxidative-stress signalling. In contrast to insulin signalling, oxidative stress induces nuclear translocation of FoxO, which correlates with acetylation, monoubiquitylation (72), JNK-mediated phosphorylation (72) and -catenin binding (107). Although these events correlate with nuclear translocation, the mechanisms that mediate FoxO nuclear translocation remain largely unknown. 23

PAGE 37

24 2.4.1.1.2.1.1. Phosphorylation The FoxO family of transcription factors (except FoxO6) is one of the major direct substrates of the protein kinase AKT in response to cellular stimulation by growth factors or insulin. Phosphorylation of FoxO factors by AKT triggers the rapid relocalization of FoxO proteins from the nucleus to the cytopl asm by binding to 14-3-3 proteins (108, 109). AKT phosphorylates FoxO1, FoxO3, and FoxO4 at three key regulatory sites that are conserved from Caenorhabditis elegans to mammals and are part of a perfect consensus sequence for AKT phosphorylation (RXRXX(S/T)) (110). Thus, FoxO transcription factors integrate a broad range of external stimuli via phosphorylation of three conserved residues by AKT. FoxO6 lacks the third AKT regulatory site and, although it is phosphorylated at the first two sites and inactivated, it does not translocate from the nucleus to the cytoplasm like other FoxO factors. Additional regulatory pathways can also influence FoxO activity such as SGK, a protein kinase related to AKT and recognizes the same consensus sites has been shown to phosphorylate FoxO factors, casein kinase 1 (CK-1), dual-specificity tyrosine-phosphorylated and regulated kinase 1A (DYRK1A), IKK and the RasRal pathway (111). In contrast, phosphorylation of FoxO factors by the MAPK family member, JNK, mammalian sterile 20-like kinase-1 (MST1) in response to stress stimuli, results in the movement of FoxO factors from the cytoplasm to the nucleus.

PAGE 38

AF2 1 156 259 359 371 462 466 596 655 245 275 FK NLS NES LXXLL FoxO1 T24 S256 S319 FoxO3a T32 S253 S315 FoxO4 S193 S256 FoxO6 T26 S184 AF1 Figure 4. Schematic of the Domains in FoxO1. AF1, AF2: transactivation function 1,2; FK: forkhead domain; NLS, nuclear localization signal; NES, nuclear export sequence. LXXLL domain: nuclear receptor interaction domain. Amino acids are for human FoxO1. The posttranslational phosphorylation modifications site numbers for human FoxO family members are also shown. S: serine; T; threonine. 25

PAGE 39

26 2.4.1.1.2.1.2. Acetylation Oxidative stress enhances the histone acetyltransferases (HATs)FoxO interaction, which correlates with the observed increased in FoxO acetylation (112-114). Mammalian FoxOs that are acetylated by HATs are deacetylated in vitro and in vivo by the mammalian homologue of SIR-2.1, SIRT1 (106, 112-119). In addition to SIRT1, other HDACs may regulate FoxO activity because the treatment of cells with TSA induces FoxO acetylation (109-111) and affects FoxO localization (120). The precise role of acetylation and SIRT1 in FoxO regulation are unclear. The effect of deacetylation is target gene specific. The expression of proapoptotic genes is inhibited, while expression of genes that regulate cell cycle arrest ( p27kip) and resistance to oxidative stress ( MnSOD) is increased (112). 2.4.1.1.2.1.3. Ubiquitination Monoubiquitylation strongly increases FoxO transcriptional activity and therefore monoubiquitylated FoxO might represent the fully active form of FoxO. The degradation of FoxO transcription factors is mediated by the ubiquitinproteasome pathway (111, 121-124). For FoxO1 and FoxO3, ubiquitin degradation requires AKT activation and phosphorylation of the AKT regulatory sites. Data from our lab suggest that FoxO1 needs to be present in the cytoplasm to be successfully polyubiquitinated by an E3 ubiquitin ligase and subsequently degraded. The S-phase kinase-associated protein 2 (p45)

PAGE 40

27 (SKP2) ubiquitin ligase is required for FoxO1 proteolysis (122, 124). IKK phosphorylation of FoxO3 at Ser 644 results in ubiquitination and degradation of FoxO3. 2.4.1.1.2.2. FoxO Interacting Proteins The observation that FoxO mutant in which DNA-binding was abolished was still able to effectively regulate a specific subset of target genes suggest that FoxO likely regulates these gene through interaction with other transcription factors (125). Indeed it has become apparent that FoxO proteins are able to associate with a wide variety of diverse transcription factor partners resulting in a far broader spectrum of receptor gene regulations (Table 1) (126). 2.4.1.1.3. FoxO Functions in Mammalian Cells In cell culture-based systems, FoxO1 FoxO3, and FoxO4 behave similarly in biochemical studies, appear to regulate common target genes, and bind to the same target DNA sequence (104, 105, 108, 111, 124). Yet, mouse FoxO knockouts have revealed unique roles for the FoxOs, such as the requirement for FoxO3 in ovarian primordial follicle activation (127, 128) and FoxO1 in vasculogenesis (128, 129). However, while the three FoxOs serve some discrete functions, they likely have significant redundancies, as they are broadly expressed during embryonic development and in adult tissues (105). This family of transcription factors, depending on the promoter context and extracellular conditions, may activate or repress transcription, leading to various functions including metabolism, muscle atrophy, cell cycle repair and detoxification, cell cycle

PAGE 41

Table 1. FoxO Factors Binding Partners 28 -Qu et al. 2007 PPAR (+)Liu ZP et al., 2005 Myocardin+Oh SW et al., 2005 JNK+PuigserverP et al. 2003 PGC1-Seoane et al., 2004 FoxG1+Seoane,J et al. 2004 SMAD(+)Kitamura T et al., 2007 Notch+Yang,Y et al. 2004 FHL2+Yamamura,Y et al. 2006 RUNX3+Almeida M et al. 2007; EssersMA et al. 2005 B-catenin-HuMC et al., 2004 IKK+LehtinenMK et al. 2006 MST1-Van derhorse A et al. 2006 USP7/HAUSP-Brunet A et al. ,1999 14-3-3+/-Brunet A et al. 2004 ; MottaMC et al ,2004 SirT1-Fukuoka M et al 2003 CBP/P300-(-)Li et al. 2003; Fan et al., 2007 AR-(+/-)Schuur,ER et al. 2001; Zhao HH et al. ,2001 ER -(-)Dowell P et al., 2003 PPAR +/-Kim et al., 2005 PR Effect on FoxO( or Partner) Citation Partner -Qu et al. 2007 PPAR (+)Liu ZP et al., 2005 Myocardin+Oh SW et al., 2005 JNK+PuigserverP et al. 2003 PGC1-Seoane et al., 2004 FoxG1+Seoane,J et al. 2004 SMAD(+)Kitamura T et al., 2007 Notch+Yang,Y et al. 2004 FHL2+Yamamura,Y et al. 2006 RUNX3+Almeida M et al. 2007; EssersMA et al. 2005 B-catenin-HuMC et al., 2004 IKK+LehtinenMK et al. 2006 MST1-Van derhorse A et al. 2006 USP7/HAUSP-Brunet A et al. ,1999 14-3-3+/-Brunet A et al. 2004 ; MottaMC et al ,2004 SirT1-Fukuoka M et al 2003 CBP/P300-(-)Li et al. 2003; Fan et al., 2007 AR-(+/-)Schuur,ER et al. 2001; Zhao HH et al. ,2001 ER -(-)Dowell P et al., 2003 PPAR +/-Kim et al., 2005 PR Effect on FoxO( or Partner) Citation Partner

PAGE 42

29 Table 1. FoxO Factors Binding Partners -, inhibition of FoxO, + activation of FoxO; (-) or (+), inhibition or activation of partner protein. Myocardin, a transcriptional coativator of SM gene; BTG-1, a argine methyl transferase; USP7, Ubiquitin-specific Protease; HUPSA, herpevirus-associated ubiquitin-specific protease; CBP, CREB-binding protein; IKK, IkappaB kinase; MST1, Mammalian STE20-like protein kinase 1; JNK, c-Jun N-terminal kinase; PPAR proliferator-activated receptor ; PGC-1 PPAR coactivator-1; SMAD, Small Mothers Against Decapentaplegic; FHL2, Four-and-a-half LIM 2; RUNX3, Runt-related transcription factor 3; PR, progesterone

PAGE 43

arrest, cell differenciation, apoptosis, tumor suppression, and stem cell maitenance (130) (Fig. 3). 2.4.1.1.4. FoxO and Cancer Several lines of evidence indicate that FoxO factors are likely to play a significant role in tumorigenesis: 1) FoxO factors are found at chromosomal translocations in human tumors (rhabdomyosascomas for FoxO1, and acute myeloid leukemias for FoxO3 and FoxO4) (131, 132); 2) FoxO3 is dysregulated in breast cancer (111). The presence of cytoplasmic FoxO3 in breast cancer highly correlates with poor survival; 3) Sustained inhibition of FoxO function is emerging as a critical event in tumourigenesis by PTEN inactivation through mutation or allelic loss (133); 4) FoxO proteins functionally or physically interact with tumor suppressors such as p53 and SMAD (134) or oncogenes such as -catenin (107) or Myc (135); 5) Expre ssion of active forms of FoxO factors reduces tumorigenicity in nude mouse paradigms induced by IKK expression (111) or HER2 oncogene (136); 6) Cells that are deficient for PTEN induce tumorigenesis in nude mice. These tumors are decreased by the expression of a constitutively active form of FoxO1 (125); 7) FoxO1, FoxO3 or FoxO4 nullizygous mice do not have a clear reported increase in tumour-incidence. However, FoxOs probably function redundantly because conditional deletion of Foxo1 Foxo3 and Foxo4 simultaneously results in the development of thymic lymphomas and haemangiom as (137). This confirms that there is 30

PAGE 44

31 functional redundancy among these closely related transcription factors. It is somewhat surprising that the tumor phenotype of these mice is restricted to only certain tissues. 3. Prostate Cancer 3.1. AR and PCa Risk PCa continues to be the most common cancer diagnosis and the second leading cause of cancer deaths in American men (138). PCas that have spread beyond the gland are typically treated with hormone ablation therapy aimed at inducing castrate levels of testosterone or blocking testosterone signaling at the AR. Although surgical castration is effective, the majority of men choose m edical castration with a leutenizing hormone releasing hormone (LHRH) agonist that is often combined with an oral anti-androgen. Castration induces apoptosis in the majority of PCa cells, which translates clinically to improvement in cancer related symptoms and lowering of AR regulated genes including PSA. Clinically PCa progression has been defined in terms of the patient's response to or failure from hormone therapy. The majority of protate cancers (85%) will have an initial favorable response to hormone therapy. However, over time molecular and cellular changes occur, which allow PCa cells to grow despite a physiologically low serum testosterone level. Eventually, these PCas will stop responding to all currently prescribed hormone therapy. At this stage the cancers are described as androgen-independent (AI) or hormone refractory. Chemotherapy will have favorable palliative response in 50-75% of men with AI PCa but most will die from their disease within 1-2 years (139).

PAGE 45

32 Androgens are natural PCa promoter. Studies of eunuchoid individuals have suggested that prostates remain small and hypotrophy that PCa does not develop (140). Moreover, animal models of prostate carcinogenesis require the presence of functioning testes or exogenous androgens to support the development of PCa (141, 142). Transgenic mice engineered for elevated AR expression in the prostate have high turnover of prostatic epithelial cells and develop prostatic intraepithelial neoplasia later in life (143). Different studies have shown that shorter CAG repeat length in the AR NTD is associated with the occurrence of more aggressive PCa (144), earlier age of onset (145, 146), and likelihood of recurrence (147). Intact AR signaling is felt to be necessary for the development of PCa. AR gene amplification has been reported in 25-30% of AI PCa (148-150). Of note the AR amplification was not found in any untreated PCa samples suggesting that AR amplification is involved in the development of AI. AR amplification highlights the strong selective pressure for continued AR signaling as tumors evolve over the course of therapy. The true incidence of AR point mutations in PCa is not known but the literature suggests that they can be found in 20-40% of the cancers. The majority of AR point mutations in PCa have clustered in three areas of the LBD. Mutations in these areas flank the ligand-binding pocket and alter this pocket relative to the wild-type AR to allow binding of ligands other than testosterone or dihydrotestosterone (151) during the

PAGE 46

33 development of AI PCa. The AR is believed to remain an important mediator of growth in AI PCa. 3.2. PTEN-AKT-FoxO1 in PCa Homozygous deletions, frameshift, or nonsense mutations in PTEN in 100% (4/4) of PCa cell lines (84). PTEN mutations have been identified in 10% of all prostate tumors (91, 152, 153) and the loss of heterozygosity (LOH) involving 10q23 is common (49%) in primary prostate carcinomas (154) and occurs in ~60% of advanced PCas (84, 91). Loss of PTEN protein is correlated with pathological markers of poor prognosis in PCa since total absence of PTEN expression correlated with the Gleason score and correlated more significantly with a Gleason score of 7 or higher and with advanced pathological stage (155). The conditional PTEN-/mouse model develops all stages of progressive PCa including invasion, metastasis and AI proliferation (156). PCa cell lines that have been obtained from metastatic lesions (e.g. LNCaP, PC3) or that are strictly AI (e.g. 22RV-1, C4-2) harbour highly active PI3K/AKT signalling (157-159). Phosphorylated AKT is also highly expressed in PCas with high Gleason grade (160) and is an excellent predictor of clin ical PSA failure (161). Chemical inhibitors targeting the catalytic unit of PI3K, such as LY294002 and Wortmanin, induce a potent apoptotic response in most PCa cell lines including LNCaP, LAPC4 and LAPC9 (162).These results collectively demonstrate the significance of upstream PI3K/AKT signalling activity in providing critical signals for progressive PCa.

PAGE 47

34 Amplification of AR occurs in the PTEN-/conditional mouse model (H Wu, lab unpublished observations). In vitro observations by our laboratory have shown a mutual antagonism between PTEN and AR in regulating growth and apoptosis in PCa cells (163). We have also reported an AR-dependent repression of the AKT downstream FoxO1 and FoxO3a function by androgens (164). The repression was believed to be through protein-protein interaction between C-terminal residues 350-655 of FoxO1 and the NTD and LBD of AR. The activated AR blocks FoxOs DNA binding activity and impairs its ability to induce Fas ligand expression and PCa apoptosis and cell cycle arrest. Tindalls group has reported another mechanim by which that androgens induce proteolytic cleavage of FoxO1 at residue Arg537 leading to an inhibitory effect on the transcriptional activity of the intact FoxO protein (165).

PAGE 48

35 HYPOTHESIS AND OBJECTIVES Previous work from our laboratory showed mutual antagonism effects of AR and PTEN on growth and apoptosis of PCa cells (163). We have also reported an AR-dependent repression of FoxO1 and FoxO3a function by androgens (164). These findings led to the hypothesis that FoxO transcription factors mediate the mutual antagonism between AR and PTEN in PCa cells. In order to verify this hypothesis, the study has two specific aims: Aim1. To clarif y whether PTEN inhibits the AR activity through FoxO factors. To persue this aim, we will: 1. Determine whether FoxO factors inhibit AR activity; 2. Examine the mechani sm underlying the AR inhibition by FoxO factors and 3. Test whether FoxO factors participate in the PTEN-induced AR inhibition. Aim2. To investigate whether PTEN induces apoptosis in PCa cells through FoxO and whether androgens suppress PTEN-induced apoptosis by inhibiting FoxO activity. To persue this aim, we will: 1. Test whether PTEN induced-apoptosis requires FoxO factors and 2. Determine whether AR suppresses FoxO activity, and explore other potential mechanisms for the AR repression of FoxO1.

PAGE 49

36 MATERIALS AND METHODS 1. Plasmids AREe1bLuc (163), pCMVhAR (163), GalLuc (163), Gal-VP16 (163), pSG5L-HAPTEN:WT (163), pSG5L-HA-PTEN:G129R (163), pCMV (164), FoxO siRNA (166) PBLuc (167), pT81luc (167), VP16rAR (5-338) (168), PMLBD (168), GalARNT [pAR4G in (18)], AR LBD [pAR5 in (18)], PBINDAIB1 (169), Flag-FoxO1 [Flag-FKHR:WT in (164)], Flag-FoxO1ca [FLAG-FKHR:TSS in (164)], 3xIRS (insulin response sequence) (164) have already been described, VP16 and PM vectors are from Clontech (Mountain View, CA). pCMV5-HA-AKT:T308D,S473D (AKTDD) (170) was a gift from Dr. Alessi, D.R., and pCMV5-HA-AKT:T308A,S473A (AKTAA) (unpublished plasmid) from Dr. Cheng J. ARcagwt, ARcag0, ARcaglong are gifts from Dr. DeFranco D (171). HA-FoxO1ca was constructed by inserting the BamH1/XbaI fragment from Flag-FKHR:TSS (164) into pcDNA3-HA (Invitrogen, Carlsbad, CA). To construct HA-FoxO1ca(1-150), FoxO1:TSS cDNA fragmen t expressing N-terminal 150 amino acids with BamHI and XbaI sites at the 5' and 3' ends of the DNA fragment, respectively, was amplified by PCR. The amplified FoxO1(1-150) fragment was cloned into the BamHI and

PAGE 50

37 XbaI sites of pcDNA3.1 HA vector (Invitrogen). HA-FoxO1ca(150-270), HA-FoxO1ca(1-270), HA-FoxO1ca(150-655), HA-FoxO1ca(150-537), HA-FoxO1ca(256-655) were constructed similarly. The sequences of the upstream and downstream primers are shown in Table 2. pCDNA3.1-Flag-FoxO1caNRmut and HA-FoxO1caH215R were generated by site-directed mutagenesis using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and confirmed by direct sequencing. Flag-FKHR:TSS and HA-FoxO1 were used as the templates for the mutagenesis. The sequences of the upstream and downstream primers to mutate Leu-462, Leu-465 and His-215 of HA-FoxO1ca are shown in Table 2. pCMVhARmut was generated by site-directed mutagenesis using pCMVhAR as the template for the mutagenesis. The sequences of primers are also shown in Table 2. 2. Cell Culture, Transient Transfections and Reporter Assays PC3, COS-7 and DU145 cells were maintained in Dulbecco's modified Eagle's medium (Gibco-BRL, Gaithersburg, MD USA) containing 10% fetal bovine serum (FBS) (Hyclone, Logan, Utah). LNCaP cells were maintained in RPMI 1640 (GibcoBRL) containing 10% FBS. RWPE-1 cells were maintained in KeratinocyteSerum Free medium supplemented with 5 ng/ml human recombinant EGF and 0.05 mg/ml bovine pituitary extract (Gibco-BRL). For reporter and mammalian two-hybrid assays, cells were plated in 6-well plates in medium supplemented with 5% dextran charcoal-stripped fetal calf serum (sFBS)

PAGE 51

38 Table 2: The Primer Sequences for the Plasmids: Uptream 5'-CGGGGGTCACCGGATCCATGGCCGAGGC-3' FoxO1ca(1-150) Downstream 5'-GCGGCGGGACGATCTAGACTAGCGCGGCTGC-3' Uptream 5'-CTCGCGGGGCAGGGATCCAAGAGCAGCTCG-3' FoxO1ca(150-270) Downstream 5'-CTTGGCTCTAGAAGCTCGGCTTCGGCTCTTAG -3' Uptream 5'-CGGGGGTCACCGGATCCATGGCCGAGGC-3' FoxO1ca(1-270) Downstream 5'-CTTGGCTCTAGAAGCTCGGCTTCGGCTCTTAG -3' Uptream 5'-CTCGCGGGGCAGGGATCCAAGAGCAGCTCG-3' FoxO1ca(150-655) Downstream 5'-CGGGCCCTCT AGATCAGCCTGACACC-3' Uptream 5'-CTCGCGGGGCAGGGATCCAAGAGCAGCTCG-3' FoxO1ca(150-537) Downstream 5'-CAGGGGTCTAGAACGCCCGTTAACTGCAGATG-3' Uptream 5'-GGAGAAGAGCTGGATCCATGGACAACAAC-3' FoxO1ca(256-655) Downstream 5'-CGGGCCCTCT AGATCAGCCTGACACC-3' Uptream 5'-GGACTCTTGAAGGAGTGGCCGACTTCTGACTCTC-3' FoxO1caNRmut ( Leu -462) Downstream 5'-GAGA GTCAG AAGTCGGCCACTCCTTCAAGAGTCC-3' Uptream 5'-CTCTGGAAGGAGTGGCTGACTTCTGACTCTC-3' FoxO1caNRmut (Leu 465 ) Downstream 5'-GAGAGTCAGAAG TCAGCCACTCCTTCCAGAG-3' Uptream 5'-GGAAGAATTCAATTCGTCGTAATCTGTCCCTACAC-3' FoxO1caH215R Downstream 5'-GT GTAGGGACAG ATTACGACGAATTGAATTCTTCC-3' Uptream 5'-GAGCTCTCACA TCTGGAAGCGGCAAGGTC-3' pCMVhARmut Downstream 5'-GAAGAAGACCT TGCCGCTTCCAGATGTGA-3'

PAGE 52

39 (Hyclone). 24 h later, cells were transfected by Lipofectamine-plus following the protocol from Invitrogen. Transfected cells were treated with DHT (Sigma, St. Louis, Mo.) or R1881 (NEN Life Science Products, Boston) in medium containing 1% sFBS for 24 h and washed with phosphate-buffered saline (PBS). Cell lysate was prepared as described (163) and luciferase activity determined using the assay systems from Promega Corporation (Madison, WI) following the company's protocol. -gal activity was determined as previously described (163). Results represent at least three independent experiments performed in duplicate and error bars stand for standard deviations. 3. Immunoblotting Analysis To determine the expression of various proteins, cells transfected in parallel to the cells prepared for reporter assays or infected with adenovirus were lysed in modified RIPA buffer containing 50 mM Tris (pH. 7.4), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 1 mM Na3VO4, 1 mM NaF and protease inhibitor mixture (Calbiochem, San Diego, California). The lysate was separated on an 8% or 10% SDS-PAGE and transferred to nitrocellulose membrane. The membrane was probed with antibodies for AR (Santa Cruz Biotechnolog, Inc., Santa Cruz, CA ), FOXO 1 (Santa Cruz, H-128), PTEN (Santa Cruz), HA (Berkeley Antibody Laboratories, HA11), Flag (M2, Sigma), -actin (Sigma), PSA antibody (Santa Cruz), and GFP (Cambridge, MA) and visualized with ECL as described (163).

PAGE 53

40 4. Adenovirus Infection and Colorimetric MTT Assay Recombinant adenovirus expressing GFP-FoxO1TSSA (GFP-FoxO1ca) and GFP control vector were gifts from Dr. J. Milbrandt (172) The recombinant virus were purified on a cesium chloride gradient, titrated, aliquoted, and stored at -80C until further use. For gene delivery, purified adenovirus was added to LNCaP cells at a multiplicity of infection (MOI) of 100 in RPMI medium containing 5% sFBS for 24 h. Infected cells were washed with medium and cultured for 24 h in the same medium containing ethanol (EOH) or 10 nM R1881 before cell extracts were prepared for immunoblotting analyses. For MTT assays, LNCaP cells were plated in RPMI 1640 containing 10% FBS at 5 104 cells/well in 96-well plate and infected with recombinant adenovirus as described above. The cells were treated with EOH or R1881 and MTT assays performed as previously described (163). The absorbance at 595 nm (OD595) was determined with a MRX microplate reader (DYNEX Technologies, Chantilly, VA). For each data point, eight samples were analyzed in parallel. The analyses were repeated two times. Statistical analysis was performed using the independent sample t test. 5. Immunofluorescence Transfected DU145 cells were cultured in 1% sFBS and double-stained with rabit anti-Flag and mouse anti-AR antibodies. Fox O1 and AR expression were detected by goat anti-rabbit IgG conjugated with Alexa Fluor 594 (red) and fluorescein isothiocyanate (FITC; green)-conjugated anti-mouse IgG (Molecular Probes, Eugene, OR), respectively.

PAGE 54

41 Nuclei were counterstained with 4',6diamidino-2-phenylindole (DAPI) (blue) at a concentration of 1.5 mg/ml in the VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, CA). Fluorescent microscopic images were obtained with a Nikon Diaphot microscope using a Photometrix PXL cooled CCD camera. The microscope was equipped with the appropriate filters for three-color imaging of cells and with a motorized stage for obtaining z-series images. 6. Northern Blot Analysis To determine the mRNA level of 3xIRSluc, DU145 cells tranfected with the indicate plamids were incubated with 10nM R1881 and 25 M cycloheximide (Sigma) for 6 h. Total cellular RNA was isolated usiung the Trizol (Invitrogen) following manufactures instruction. Sample containing 20 g total RNA was mixed with the sample buffer (Ambion, Austin, TX), denatured via heating at 65C for 10 min, resolved on 1% agarose/formaldehyde gels, and transferred to a Hybond nylon membrane. The membrane was pre-hybridized at 65C for 4 h with 3xIRSluc-specific probe of 540 bp was generated from pGL2 plasmid with EcoRI and XbaI digestion and Labeled with 32P using random-primed DNA labeling kit (Ambion). Hybridizations were carried out overnight at 65C with 32P-labeled 3xIRSluc probe. Furthermore, filters were exposed to autoradiographic film for 24 h. To test for the uniform loading of the samples, blots were stripped and reprobed using a cDNA probe for the human GAPDH (Ambion).

PAGE 55

42 7. Reverse Transcriptase-Polymerase Chain Reaction Analysis Cells were transfected and treated as for Northern Blot analysis. Total RNA was also isolated as described above. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) was performed using 100 ng total RNA and the SuperScript One-step RT-PCR kit (Invitrogen) in a DNA Engine thermal cycler (MJ Research Inc., Waltham, MA). To avoid amplification of contaminating genomic DNA in RT-PCR, upstream and downstream primers were placed in different exons. The sequences of the 3xIRS-specific primers used were as follows: sense, 5-CCAGGGATTTCAGTCGATGTAC-3; and antisense, 5GTCTCCAGAATGTAGCCATCC3. RT-PCR was performed at 50C for 30 min, 94C for 2 min, 29 cycles at 94C for 15 sec, at 55C for 30 sec, at 68C for 1 min and at 72C for 5 min. The integrity of the RNA used for RT-PCR was confirmed using GAPDH synthesis as a positive control. The amplified RT-PCR products were separated on a 1% agarose gel, stained with ethidium bromide for visualization, and photographed under ultraviolet illumination. 8. Apoptotic Assay Transfected cells were washed with PBS and fixed in 2% paraformaldehyde/PBS at room temperature for 10 min. For the demonstration of apoptotic cells, fixed cells were stained at room temperature for 15 min with DAPI. Green and blue fluorescence were observed with a Leitz Orthoplan 2 Microscope. The apoptotic index of GFP positive cells was determined by scoring 400 GFP-positive cells for chromatin condensation and

PAGE 56

43 apoptotic body formation. Chi Square test of Independence was used to calculate the statistical p-value.

PAGE 57

44 RESULTS 1. FoxO Factors Inhibit AR Transcriptional Activity 1.1. Inhibition of AR activity by FoxO1 To investigate the involvement of FoxO1 in the suppression of AR activity by PTEN, we first tested whether FoxO1 inhibits AR transcriptional activity. In PTEN intact COS-7 cells, wild-type FoxO1 decreased ect opic AR activity on a synthetic ARE-based reporter in a dose-dependent manner (Fig. 5A) without affecting the levels of AR protein (Fig. 5B). In PC3 cells that contain low level of nuclear FoxO factors due to loss of PTEN and the ensuing increase in the kinase activity of AKT, a nuclear FoxO1, FoxO1ca, in which all three AKT phosphorylation sites were mutated to alanines (164), decreased androgen-induced AR activity whereas wild-type FoxO1 had little effect (Fig. 5C). Parallel immunoblotting analyses showed that the wild-type FoxO1 was expressed to a much higher level than FoxO1ca (Fig. 5D), showing the low effect of the wild-type FoxO1 on AR was not due to its insufficient expression. Furthermore, in the absence of AR, FoxO1ca did not decrease basal reporter activity, demonstrating that the inhibition was specific to AR (Fig. 5E).

PAGE 58

0 1 2 3EOH DHT FoxO1ca ( g) --0.1 0.5 1.0 0 1 2 3EOH DHT FoxO1ca ( g) --0.1 0.5 1.0A 0 2 4 6 8 EOH R1881AR Activity (RLU 10-5)A 0 2 4 6 8 EOH R1881 EOH R1881AR Activity (RLU 10-5) AR FoxO1 -actin E AR FoxO1 -actin BFoxO1 ( g) --0.1 0.5 1.0 FoxO1 ( g) --0.1 0.5 1.0 FoxO1ca AR FoxO1 -actin Vector Vector FoxO1ca FoxO1 AR Activity (RLU 10-5) Vector Vector FoxO1 EOH R1881CAR Activity (RLU 10-5) Vector Vector FoxO1 EOH R1881 EOH R1881C D 0 10 20 30 40AR Activity (RLU 10-4)FoxO1ca ( g) --0.5 1.0 -AR ----+ + EOH R1881 EOH R1881E FA R Activity (RLU 10-5) Figure 5. Dose-Dependent Inhibition of AR Activity by FoxO1. 45

PAGE 59

46 Figure 5. Dose-Dependent Inhibition of AR Activity by FoxO1. A COS-7 cells were transfected with 0.5 g AREe1bluc, 50 ng pCMV 50 ng pCMVhAR, and the indicated amounts of Flag-FoxO1 and were treated for 24 h with 10 nM R1881. Reporter activity was determined and normalized to cognate -galactosidase ( -gal) activity. B Lysates of COS-7 cells transfected as in panel A were immunoblotted with antibodies against AR, Flag or -actin. C PC3 cells were transfected with 0.5 g AREe1bluc, 50 ng pCMV 50 ng pCMVhAR, 1 g Flag-FoxO1 or HA-FoxO1ca. Transfected cells were treated for 24 h with 10 nM R1881. Reporter activity was determined as in Figure 5A. D Lysates of PC3 cells transfected as in panel C were immunoblotted with the AR or FoxO1 antibody. Equal amounts of protein were loaded per lane. E, PC3 cells were transfected with the indicated amounts of HA-FoxO1ca with or without AR and reporter activity was determined after treatment with 10 nM R1881. F LNCaP cells were transfected with 0.5 g PBluc, 0.1 g pCMV and the indicated amounts of HA-FOXO1ca. Transfected cells were treated with 100 nM DHT and the activity of endogenous AR was determined and normalized with -gal.

PAGE 60

47 To determine whether FoxO1 also represses the activity of endogenous AR on the promoter of natural androgen target genes, we transfected FoxO1ca into PTEN null, AR positive LNCaP cells (173) and examined its effect on the activity of endogenous AR on the PBluc reporter in which the expression of firefly luciferase gene is under the control of the rat probasin gene promoter containing the proximal ARE (174). As shown in Fig. 5F, the transcriptional activity of the endogenous AR was stimulated by its natural ligand DHT, and FoxO1ca inhibited the activity in a dose-dependent manner. The data suggest that the inhibition by active FoxO1 is not limited to ectopic AR or synthetic AREs. 1.2. Inhibition of AR Activity by FoxO3a and FoxO4 To determine whether the other FoxO family members also repress the activity of AR, the effect of FoxO3a or FoxO4 on AR activity was determined in COS-7 cells. As shown in Fig. 6, wild-type FoxO3a and FoxO4 inhibited the androgen-induced AR activity nearly to the same degree as wild type FoxO1. These data suggest that the effect of FoxO factors on AR transcriptional activity is similar. 1.3. Involvement of Endogenous FoxO Factors in AR Inhibition Next, we investigated whether endogenous FoxO1 in PCa cells is involved in the negative regulation of AR activity. For this, we employed a siRNA plasmid (166) that was effective in knocking down FoxO1, FoxO3a, and FoxO4 in mammalian cells (Fig.7A). In PTEN intact RWPE-1 cells, the FoxO siRNA decreased the expression of endogenous FoxO1 and increased AR activity in a dose-dependent manner without altering the level

PAGE 61

AR FoxO3a FoxO1 -actin AR FoxO1 FoxO4 -actin Vector Vector FoxO1 FoxO4 0 5 10 EOH R1881 EOH R1881AR Activity (RLU 10-5) 0 5 10 15 20 EOH R1881 EOH R1881Vector Vector FoxO1 AR Activity (RLU 10-5) FoxO3a Figure 6. Foxo3a and Foxo4 Also Inhibit AR Activity. A, COS-7 cells were transfected with Flag-FoxO1 or Flag-FoxO4, together with AREe1bluc, pCMV pCMVhAR. Transfected cells were treated for 24 h with 10 nM R1881 and luciferase activity was determined. Lysates of the parallel experiment were subjected to immunoblotting with antibodies against AR, -actin and Flag. B, COS-7 cells were transfected with HA-FoxO1 or HA-FoxO3a, and measured as A. FoxOs were detected with HA11 anti-HA antibody. 48

PAGE 62

FoxO3a FoxO1 -actin U6 control + FoxOsiRNA+ U6 control + FoxOsiRNA+ FoxO4 -actin 0 2 4 6 8 10 FoxO1 siRNA( g) 0 0 0.1 0.4 0.8 U6 Control ( g) 0.8 0.80.7 0.4 0 AR Activity (RLU 10-4)AR FoxO1 -actin EOH DHT B AU6 control + FoxOsiRNA+ U6 control + FoxOsiRNA+ Figure 7. Knockdown of FoxO Factors Enhances the AR Activity. A 293T cells (upper panel) or PC3 cells (lower panel) were transfected with 0.4 g FoxO siRNA or U6 control. 72 h later, cell lysates were immunoblotted with antibodies against FoxO1, FoxO3a, FoxO4 or -actin. B RWPE-1 cells were transfected with 0.5 g AREe1bLuc, 0.1g pCMV 0.1 g pCMVhAR together with the indicated amounts of FoxO siRNA or U6 control. 48 h later, cells were treated with EOH as vehicle control or 10 nM R1881 for 24 h. Reporter activity was determined as in Figure 5A. Cell extracts from parallel transfections were immunoblotted with antibodies against AR, FoxO1, or -actin as indicated. 49

PAGE 63

50 of AR (Fig. 7B). These experiments show that endogenous FoxO factors decrease the transcriptional activity of AR. It is important to note that RWPE-1 is a non-neoplastic human prostate epithelial cell line immortalized by the human papilloma virus, HPV-18. This cell line was described as AR positive and androgen-sensitive for growth (175). In our hands, however, the cell expresses low basal level of AR protein and is androgen insensitive. Androgen-induced transcriptional activity was only detectable when ectopic AR was expressed (data not shown) 2. Defining FoxO1 Domains Involved in AR Repression FoxO1 is a 655 amino acid protein with a short N-terminus, a highly conserved forkhead box necessary for DNA binding, a LXXLL motif and a proline-, acidic residue-, and serine/threonine rich activation domain (AD) (176). To define the FoxO1 domain involved in AR repression, we generated a set of plasmids expressing different regions of FoxO1ca (Fig. 8A) and tested their ability to inhibit the activity of the AR when ectopically expressed in PC3 cells on pT81luc, a reporter gene in which the expression of the firefly luciferase gene is under the control of the complex ARE in the distal region of the rat probasin gene (167). In these assays, FoxO1ca(150-655) decreased AR activity to a similar degree as full length FoxO1ca whereas FoxO1ca(1-150), FoxO1ca(150-270), FoxO1ca(1-270), and FoxO1ca(150-537) did not decrease AR activity (Fig. 8B). FoxO1ca(256-655) increased the AR activity. Parallel immunoblotting analyses showed that the FoxO1ca fragments were expressed to a level either comparable with or higher

PAGE 64

51 than that of full length FoxO1ca, showing that the lack of inhibition by the FoxO1 fragments was not due to insufficient expression (Fig. 8B). Similar results were obtained with endogenous AR on PBluc reporter in LNCaP cells (Fig. 8C). These analyses demonstrate that the inhibition of AR activi ty by FoxO1 requires the forkhead box and the C-terminal activation domain whereas the N-terminal 150 amino acids are nonessential and C-terminal alone may increase the AR activity. p160 coactivators proteins interact with nuclear receptors via short motifs, nuclear receptor or NR box, consisting of the amino acid sequence LXXLL, where X can be any amino acid. The presence of a putative NR box sequence 462LKELL466, close to the C-terminal AD of FoxO1 prompted us to test whether this motif is involved in the AR repression by FoxO1. We generated a mutant FoxO1, FoxO1caNR in which the LKELL motif was mutated to WKEWL, and assessed its ability to inhibit AR in PC3 cell. As shown in Fig. 8D, the mutant FoxO1 inhibited the AR to the same degree as FoxO1ca. Parallel immunoblotting analyses showed that the FoxO1caNR was expressed to a comparable level as FoxO1ca. These analyses show that the putative NR box is not involved in the inhibition of the AR by FoxO1ca Since the FoxO1 inhibition requires the DNA binding domain, it is possible that a FoxO1 target gene mediates the AR inhibition. Although there are multiple ways for FoxO factors to regulate gene expression (125), the primary mechanism is through the binding of forkhead box to insulin response sequence (IRS). To test whether the AR inhibition

PAGE 65

HA-FoxO1caFL 1-150 150-270 1-270 150-537 150-655 256-655 HA-FoxO1caFL 1-150 150-270 1-270 150-537 150-655 256-655 FK LxxLLAD 156-259 462-466 596-655AAR FoxO1ca -actinB 0 5 10 15 20AR Activity (RLU 10-5) FL 1-150 1-270 150-270 150-537 150-655 256-655 Vector Vector EOH R1881 EOH R1881 C 0 10 20 30FL 1-150 1-270 150-270 256-655 AR Activity (RLU 10-4) vector vector EOH R1881150-655C 0 10 20 30FL 1-150 1-270 150-270 256-655 AR Activity (RLU 10-4) vector vector EOH R1881FL 1-150 1-270 150-270 256-655 AR Activity (RLU 10-4) vector vector EOH R1881 EOH R1881150-655D 0 5 10 15 20 25FoxO1 --Ca CaNR AR -actin FoxO1ca AR Activity (RLU 10-5) EOH R1881D 0 5 10 15 20 25FoxO1 --Ca CaNR AR -actin FoxO1ca 0 5 10 15 20 25 0 5 10 15 20 25FoxO1 --Ca CaNR AR -actin FoxO1ca AR Activity (RLU 10-5) EOH R1881 EOH R1881E 0 2 4 6 8FoxO1 --Ca CaH215R AR FoxO1ca -actinAR Activity (RLU 10-5) EOH R1881E 0 2 4 6 8FoxO1 --Ca CaH215R AR FoxO1ca -actin 0 2 4 6 8 0 2 4 6 8FoxO1 --Ca CaH215R AR FoxO1ca -actinAR Activity (RLU 10-5) EOH R1881 EOH R1881 Figure 8. Mapping FoxO1 Domains Required for AR Inhibition. 52

PAGE 66

53 Figure 8. Mapping FoxO1 Domains Required for AR Inhibition. A, A diagram of human FoxO1 fragments. Different fragments corresponding to the indicated amino acids were amplified by PCR, and inserted into pCDNA3.1-HA vector to make a subset of FoxO1ca subclones. FK: forkhead box; AD: activation domain. B Upper panel: PC3 cells were transfected with 0.5 g PT81luc, 50 ng pCMV 50 ng AR, and different amounts of the FoxO1ca fragments. Transfected cells were treated and reporter activity was determined as in Figure 5A. Lower panels: Lysates of PC3 cells transfected with the plasmids, exactly as in the upper panel, were immunoblotted with anti-AR or HA11 antibody. C FoxO1ca fragments were transfected into LNCaP cells together with PBLuc and treated with 10 nM R1881. The activity of endogenous AR was measured as in Figure 5F. D and E, FoxO1ca (CA), FoxO1ca with mutations in the NR box (CaNRmut) or FoxO1ca with mutation in the forkhead box (CaH215R) was transfected together with AR and AREe1bLuc into PC3 cells as in Figure 5C. Reporter assays and immunoblotting analyses were similarl y performed for the indicated proteins.

PAGE 67

54 depends on the ability of FoxO1 to bind IRS elements, we generated a FoxO1 mutant, FoxO1CaH215R, in which a conserved histidine in helix 3 of the forkhead box was mutated to arginine, which was shown to abrogate the ability of FoxO1 to bind IRS (125) and tested its ability to inhibit AR activity. As shown in Fig. 8E, FoxO1CaH215R inhibited AR activity to the same degree as FoxO1ca. These analyses show that the forkhead box and the AD in the C-terminus are required for AR inhibition but the inhibition occurs independently of the putative NR box and the ability of FoxO1 to bind IRS. 3. Effect of FoxO1 on Nuclear Localization of AR Nuclear localization is required for the normal function of AR upon androgen treatment. Thus, we tested whether FoxO1 inhibits AR transcriptional activity by blocking AR nuclear localization. The intracellular distribution of ectopic AR alone or AR coexpression with FoxO1 in PTEN-intact, AR-negative DU145 cells was analyzed by immunoflorescence. As expected, the AR predominantly showed fluorescence in the cytosol with very weak nuclear fluorescence in the absence of the ligand (Fig. 9), whereas androgens induced nuclear translocation. The AR distribution was not altered by FoxO1ca, suggesting that inhibition of AR by FoxO1 is not due to the blockage of AR nuclear localization induced by androgens. 4. Inhibition of AR N/C Interaction by FoxO1 Our previous studies have shown that FoxO1 interacts with both the NTD and LBD of the AR (164), raising the possibility that FoxO1 may inhibit AR activity by

PAGE 68

AR+pCDNA3+EOH AR+pCDNA3+R1881 AR+FoxO1ca+EOH AR+FoxO1ca+R1881 Anti-AR Anti-Flag DAPI Merge Figure 9. Lack of an Effect of FoxO1 on AR Cellular Localization. The immunoflorescence microscopic pictures of the transfected AR and FoxO1ca or vector control in DU145 cells are shown. DU145 cells were transfected with 0.2 g pCMVhAR and 0.3 g Flag-FoxO1ca or a vector control pcDNA3. After a 24 h treatment with 10 nM R1881 or EOH, cells were fixed and double stained with anti-Flag and anti-AR antibodies for the FoxO1ca (red) and AR (green). Cell nuclei were counterstained with DAPI (blue). 55

PAGE 69

56 disrupting the N/C interaction. Accordindly, we tested the effect of FoxO1 on AR N/C interaction in a mammalian two-hybrid assay. As shown in Fig. 10A, cotransfection of AR LBD fused to Gal4DBD (PMLBD) and AR NTD fused to the VP16 (VPARNT) allowed a strong androgen induced activation of the cotransfected Gal4 reporter gene in PC3 cells, which was inhibited slightly by wild ty pe FoxO1 and strongly by FoxO1ca in a dosedependent manner (Fig. 10A). Wild type FoxO1 or FoxO1ca did not decrease the activity of the Gal4 reporter in cells expressing VPARNT or PMLBD alone or in cells expressing both but treated with vehicle (Fig. 10A). These data suggest that one mechanism by which active FoxO1 inhibits the transcriptional activity of AR is to disrupt the androgen induced N/C interaction. Consistent with this idea, the ability of FoxO1 to inhibit AR N/C interaction depended on the protein region 150-655 containing both the forkhead box and the C-terminal AD (Figs. 10B, 10C, 10D), which both were shown earlier to be required to inhibit AR activity. Fig. 10E is the normalized data combining Figs. 10B, 10C, 10D. The fact that FoxO1 interacted with both NTD and LBD regions of AR (164) raises the possibility that FoxO1 may inhibit N/C interaction through its action on either the NTD or the LBD. We found that the activity of PMLBD on Gal4 reporter induced by androgens was not decreased by FoxO1ca (Fig. 10A), implying that FoxO1 is likely to work through its effect on the NTD to inhibit AR. Consistently, the transcriptional activity of the NTD fused to either the Gal4 DBD (Fig. 11A) or its own DBD (Fig. 11B) was inhibited by FoxO1ca.

PAGE 70

VP16+--+----+---PM-+--+----+--PMLBD+-++-++++-+++ VPARNT-++-++++-++++ VP16+--+----+---PM-+--+----+--PMLBD+-++-++++-+++ VPARNT-++-++++-++++ 0 5 10 15 200.2 0.20.20.20.20.01 0.05 0.2 0.20.20.01 0.05 0.2 ( g) FoxO1WTFoxO1caN/C Interaction (RLU 10-4) A EOH R1881 EOH R1881 Vector VP16 PM PMLBD VPARNT FoxO1ca FoxO1ca(1-150) FoxO1ca(150-270) 0 2 4 6N/C Interaction (RLU 10-4) + + + + + + + + + --+++ --+ + + + + + + + + + -+ + + --++ -----BVP16 PM PMLBD VPARNT FoxO1ca FoxO1ca(1-150) FoxO1ca(150-270) 0 2 4 6N/C Interaction (RLU 10-4) + + + + + + + + + --+++ --+ + + + + + + + + + -+ + + --++ -----B 0 2 4 6N/C Interaction (RLU 10-4) + + + + + + + + + --+++ --+++ --+ + + + + + + + + + -+ + + ----++ ---------B 0 10 20N/C Interaction (RLU 10-4) VP16 PM PMLBD VPARNT FoxO1ca FoxO1ca(1-270) + + + + + + + + + + + + + + + + + + 0 10 20N/C Interaction (RLU 10-4) VP16 PM PMLBD VPARNT FoxO1ca FoxO1ca(1-270) + + + + + + + + + + + + + + + + + + -N/C Interaction (RLU 10-4) VP16 PM PMLBD VPARNT FoxO1ca FoxO1ca(1-270) + + + + + + + + + + + + + + + + + + + + -C 57

PAGE 71

0 1 2 3VP16 PM PMLBD VPARNT FoxO1ca FoxO1ca(150-655) FoxO1ca(256-655) + + + + + + + + + --+++ --+ + + + + + + + + + -+ + + --++ ----VP16 PM PMLBD VPARNT FoxO1ca FoxO1ca(150-655) FoxO1ca(256-655) + + + + + + + + + --+++ --+++ --+ + + + + + + + + + -+ + + ----++ --------0 50 100 150 200150-655 FL 1-150 1-270 150-270 256-655 Vector FoxO1caN/C Interaction (% of Control) 0 50 100 150 200150-655 FL 1-150 1-270 150-270 256-655 Vector FoxO1caN/C Interaction (% of Control) N/C Interaction (RLU 10-5) D E Figure 10. FoxO1 Suppresses AR N/C Interaction in Mammalian Two-hybrid Assays. 58

PAGE 72

59 Figure 10. FoxO1 Suppresses AR N/C Interaction in Mammalian Two-hybrid Assays. A PC3 cells were transfected with 0.3 g GalLuc, 0.1 g pCMV 0.1 g VP16, PM, PMLBD, or VPARNT together with the indica ted amounts of wild type FoxO1 or FoxO1ca and treated with EOH or R1881 for 24 h. Luciferase activity was normalized with -gal. B, C D, PC3 cells were transfected as in panel A but with FoxO1ca fragments as indicated. Cells were treated with R1881 and reporter activity was determined. E, Luciferase activity of cells transfected with PMLBD, VPARNT and indicated FoxO1ca fragments from B, C, D were normalized by that of the cells tranfected with PMLBD and VPARNT and vector and plotted in one figure. The N/C interaction value of cells transfected with PMLBD and VPARNT and vector was set as 100%.

PAGE 73

A 0 5 10 15Gal Activity (RLU 10-3)GalARNT FoxO1ca ++ -+ + 0 50 100AR Activity (RLU x 10-3)AR LBD FoxO1ca (g) ++0-0+0.10.5B Figure 11. FoxO1 Inhibits AR NTD Activity. A PC3 cells were transfected with 0.3 g GalARNT, 0.3 g Galluc, 0.1 g pCMV and 0.5 g FoxO1ca (+) or vector (-) as indicated. Luciferase activity was determined 24 h later and normalized with -gal. B PC3 cells were transfected with 0.3 g AR LBD, 0.5 g AREe1bluc, 0.1 g pCMV and 0.5 g FoxO1ca (+) or vector (-) as indicated. The reporter activity was determined 24 h later and normalized with -gal. 60

PAGE 74

61 5. FoxO1 Negates the Positive Effect of p160 Coactivators on AR Transcriptional Activity by Blocking p160 Coactivator Interaction with AR NTD 5.1 FoxO1 Represses the Enhancement of AR Transcriptional Acitivity by p160 Coactivators It is known that the strong activation function in AR NTD is the predominant interface for the binding of p160 coactivators in the presence of androgens (14, 41). If FoxO1 acts through NTD, it is likely to exert a negative effect on the ability of p160 coactivators to increase AR activity. When AIB1 was transfected into LNCaP cells, it increased the transcriptional activity of the endogenous AR induced by DHT as expected (Fig. 12A). Cotransfection of FoxO1ca negated the positive effect of AIB1 in a dose-dependent manner (Fig. 12A). In addition to AIB1, the other two p160 coactivators SRC1 and TIF2 gave similar results (Figs. 12B and 12C), suggesting that the inhibition is commonly applicable to p160 coactivators members. 5.2. FoxO1 Inhibits p160 Coactivator Interaction with AR NTD We next asked whether the interaction of the AR NTD with p160 coactivators is interrupted by FoxO1. As expected, AIB1 interacted with AR NTD in mammalian two-hybrid assay (Fig 13). The interaction was suppressed by FoxO1ca (Fig. 13A) and FoxO1ca (150-655) (Fig. 13C and Fig. 13D) to a similar degree. Conversely, FoxO1 siRNA enhanced the binding of ARNT and AIB1 (Fig. 13B). In agreement with the results from AR transcriptional assays (Fig. 8B and 8C) and the N/C interaction studies, other fragments besides FoxO1ca(150-655) did not inhibit the interaction between AIB1 and

PAGE 75

0 5 10 15 20HA-SRC --+ + FoxO1ca ---+ AR HA FoxO1ca -actin EOH R1881 EOH R1881 EOH R1881 EOH R1881AR Activity (RLU 10-5) 0 5 10 15 20 25 30AIB1 -+ -+ + + + FoxO1ca ---+ ABAR Activity (RLU 10-5) 0 2 4 6 8AR Activity (RLU 10-6)HA-TIF2 --+ + FoxO1ca ---+C Figure 12. FoxO1 Represses Enhancement of AR Transcriptional Activity by p160 Coactivators. A LNCaP cells were transfected with 0.5 g of PBluc, 0.1 g of pCMV 0.1 g of AIB1 and 0, 0.01, 0.2 and 0.5 g of FoxO1ca as indicated and treated with EOH or DHT. Endogenous AR activity was measured and normalized. B, COS-7 cells were transfected with AR and SRC1, together with FoxO1ca or vector control. AREe1bLuc luciferase activity and the expression level of indicated proteins were measured. C, COS-7 cells were transfected with AR and TIF2, together with FoxO1ca or vector control. AREe1bLuc luciferase activity was measured. 62

PAGE 76

VP16 VPARNT PBindAIB1 FoxO1ca FoxO1ca(1-150) FoxO1ca(150-270) FoxO1ca(1-270) FoxO1ca(150-655) FoxO1ca(256-655) 0 50 100 150FL 1-150 1-270 150-270 256-655 Vector 150-655FoxO1caARNT-AIB1 Interaction (% of Control) 0 50 100 150FL 1-150 1-270 150-270 256-655 Vector 150-655FoxO1caARNT-AIB1 Interaction (% of Control) FL 1-150 1-270 150-270 256-655 Vector 150-655FoxO1caARNT-AIB1 Interaction (% of Control) D 0 1 2 3 4 5ARNT-AIB1 Interaction (RLU 10-4)C 0 2 4 6 8ARNT-AIB1 Interaction (RLU 10-6)+ + VP16 PBIND VPARNT PBINDAIB1 FoxO1ca + +-+ -+ ----+ +A+ + + + + + 0 2 4 6 8ARNT-AIB1 Interaction (RLU 10-6)+ + VP16 PBIND VPARNT PBINDAIB1 FoxO1ca + +-+ -+ ----+ +A+ + + + + + -++ + + + + + + + + + + + + + + + + + + + + + + + + + + + + ---------++ ----+-+ ---+ +--------++ ++ 0 5 10+-+VP16 PBind VPARNT PBindAIB1 U6 FoxORNAi ----+-+ ++++ -+ + ++ARNT-AIB1 Interaction (RLU 10-4)B 0 5 10+-+VP16 PBind VPARNT PBindAIB1 U6 FoxORNAi ----+-+ ++++ -+ + ++ARNT-AIB1 Interaction (RLU 10-4)B Figure 13. FoxO1 Blocks AIB1 Recruitment to AR NTD. 63

PAGE 77

64 Figure 13. FoxO1 Inhibits AIB1 Recruitment to AR NTD. A, COS-7 cells were transfected with 0.3 g GalLuc, 0.1 g pCMV 0.1 g VP16, PM, PBINDAIB1, VPARNT and FoxO1ca as indicated. Reporter activity was determined. B, The experiment was performed as in panel A except the replacement of FoxO1ca with FoxO siRNA. C, COS-7 cells were transfected as in panel A but with different FoxO1ca fragments. Reporter activity was determined. D, Luciferase activity of cells transfected with VPARNT and PBINDAIB1 and indicated FoxO1ca fragments from panel C was normalized with that of the cells transfected with VPARNT and PBINDAIB1 to measure the effect of FoxO1 fragments on AR-AIB1 interaction.

PAGE 78

65 AR NTD (Fig. 13C and Fig. 13D). These data suggest that suppression of p160 coactivators binding to AR NTD, as well as AR N/C interaction, represents possible mechanisms for AR inhibition by FoxO1. We envisioned two possible ways by wh ich FoxO1 attenuates the interaction between AR NTD and coactivators. One would involve competition of FoxO1 and AIB1 for the AR NTD. Alternatively, FoxO1 may squel ch the limited coactivators from AR, since both AR and FoxO1 are transcription factors. Mammalian two-hybrid assays showed an interaction of the AR NTD with FoxO1ca(150-655) but not with FoxO1(1-150) (Fig. 14A). Similar assays showed an interaction between FoxO1ca and AR NTD but not AIB1 (Fig. 14B). The increase in GalLuc reporter activity was not due to the enhancement of GalFoxO1ca(150-655) transactivation by AR NTD, because AR LBD that contains the NTD but is not fused to VP16 did not increase the reporter activity. These observations support a competition mechanism instead of the squelching mechanism of action. 6. Inhibition of AR Activity by FoxO1 Is Not Affected by CAG Repeats The AR NTD gene contains a polymorphic CAG repeat sequence. The CAG repeat length has been reported to affect AR activity. We then examined the activity of AR containing different numbers of CAG repeats in PC3 cells. As shown in Fig 15, FoxO1 inhibited the activity of an AR expressing vector without cag repeats (ARcag0) or with long cag repeats (ARcaglong) at the same degree as that of wild-type AR in the same

PAGE 79

0 5 10 15 20ARNT-FoxO1 Interaction (RLU 10-4)+ -+-+--+ --++VP16 PM++ --+ --+-+ +-GalFoxO1(150-655)VPARNTGalFoxO1(1-150)AR LBDA 0 20 40 60 80 100 0 20 40 60 80 100---+ VPARNT ++-+ PBINDAIB1 +-+VPFoxO1ca --+PBIND + -VP16 ---+ VPARNT ++-+ PBINDAIB1 +-+VP --+PBIND + -VP16 ---+ VPARNT ++-+ PBINDAIB1 +-+VPFoxO1ca --+PBIND + -VP16 ---+ VPARNT ++-+ PBINDAIB1 +-+VP --+PBIND + -VP16Gal Activity (RLU 10-4)B Figure 14. FoxO1 Interacts with AR NTD But Not Coactivators. A, COS-7 cells were transfected with 0.3 g GalLuc, 0.1 g pCMV 0.1 g VP16, PBIND, PBINDAIB1, VPARNT or VPFoxO1ca as indi cated. Reporter activity was determined. B COS-7 cells were transfected with 0.3 g GalLuc, 0.1 g pCMV 0.1 g VP16, PM, PBINDAIB1, VPARNT or FoxO1ca as indica ted. Reporter activity was determined. 66

PAGE 80

0 2 4 6 8 10ARcagwt+ + + -----ARcag0 ---+ + + --ARcaglong------+ + + FoxO1ca ( g) 0 0.5 1.0 0 0.5 1.0 0 0.5 1.0AR Activity (RLU 10-6) Figure 15. AR CAG Repeats Is Not Associated with AR Inhibition by FoxO1. PC3 cells were transfected with indicated amount of FoxO1 and AR vectors containing different numbers of CAG repeats together with ARE-luc, pCMV ARcagwt: wild type AR with normal cag repeats; ARcag0: AR without cag repeats; ARcaglong: AR with long cag repeats. Reporter activity was examined after being treated with R1881 for 24 h. 67

PAGE 81

68 backbone vector (ARcagwt). These data suggest that FoxO1 suppresses AR activity regardlee of its number of the CAG repeat. 7. Enhancement of AR Activity by Constitutively Active AKT is Decreaed by FoxO1ca The FoxO family of transcription factors is one of the major direct substrates of the protein kinase AKT in response to cellular stimulation by growth factors or insulin and inactivated by AKT. PTEN is a negative regulator of AKT. This information prompted us to test whether AKT regulates AR activity and whether the regulation is modulated by FoxOs. As shown in Fig 16, a constitutive active AKT, AKTDD, of which the two phosphorylation sites T308 and S473 are mutated to aspartic acid, increased AR activity in PTEN-intact RWPE-1 cells relative to an AKTAA control, of which T308 ans S473 are mutated to alanine, which was suppressed by the expression of FoxO1ca. 8. FoxO Factors Mediate the AR Suppression by PTEN To test the participation of FoxO1 in the suppression of AR activity by PTEN, the effect of active PTEN on AR activity wa s assayed in the presence or absence of FoxO siRNA. Ectopic expression of the active PTEN in PC3 cells decreased AR activity as relative to phosphataseinactive PTEN. Cotransfection of FoxO siRNA relieved the PTEN suppression in a dose-dependent manner. This siRNA decreased the expression of endogenous FoxO1 without altering the level of AR, PTEN and -actin (Fig. 17). These experiments show that endogenous FoxO factors mediate the PTEN inhibition.

PAGE 82

0 5 10 15AR FoxO1ca AKT -actin EOH R1881 AKTDD --+ -+ FoxO1ca ---+ + 0 1 2 3 4 5 EOH R1881 EOH R1881 AKTDD --+ AKTAA ---+AR Activity (RLU 10-5) AR Activity (RLU 10-4)A B Figure 16. Enhancement of AR Activity by Constitutive Active AKT Is Decreased by FoxO1ca. A, RWPE-1 cells were transfected with 0.5g ARE-luc, 0.1g pCMV 0.1g pCMVhAR, together with 0.3 g AKTDD or AKTAA. 48 h post-transfection, the cells were treated with R1881 for another 24 h. Reporter activity was determined as previous. B, RWPE-1 cells were transfected with 0.3 g AKTDD and/or with FoxO1ca, cells were treated and reporter activity was determined as in A. 69

PAGE 83

AR -actin FoxO1 PTEN 0 5 10 15 20 25AR Activity (RLU 10-5) EOH R1881 EOH R1881 MTPTEN -----WTPTEN --+ + + + FoxOsiRNA00 0 0 0.1 0.2 0.4 ( g)U6 Control 0.4 0.40.40.40.3 0.2 0 ( g)-+ Figure 17. FoxO Knockdown Relieves the AR Inhibition by PTEN in Prostate Cells. PC3 cells were transfected with 0.5 g of AREe1bLuc, 0.1 g of pCMV 0.1 g of pCMVhAR, 0.05 g of pSG5L-HA-PTEN:WT (WTPTEN) or pSG5L-HA-PTEN:G129R (MTPTEN) together wi th the indicated amounts of FoxO siRNA or U6 control. 48 h later, cells were treated with EOH as vehicle control or 10 nM R1881 for 24 h. Luciferase activity was determined and normalized to cognate -galactosidase ( -gal) activity. Duplicate samples were analyzed in parallel for each data point and the error bars represent standard deviations. The data were reproduced twice. Cell extracts from parallel transfections were subjected to immunoblotting with antibodies against AR, FoxO1, HA or -actin as indicated. 70

PAGE 84

71 9. FoxO Mediates the Negative Effect of PTEN on AR N/C Interaction and AIB1 Recruitment. So far, we have demonstrated that FoxO mediated the negative effect on AR transcriptional activity and interfered with AR N/C interaction as well as the interaction of the AIB1 coactivator to AR NTD. The next ques tion is whether PTEN inhibits AR activity through these mechanisms. As shown in Fig. 18A, wild-type PTEN significantly decreased AR N/C interaction induced by androgen treatment in PC3 cells as compared to phosphatase-inactive PTEN. More importantly, FoxO siRNA negated the majority of the suppressive effect exerted by PTEN. Similar to the AR N/C interaction, the ability of AIB1 to increase AR transcriptional activity (Fig. 18B) and the interaction between AIB1 and AR NTD (Fig. 18C) were suppressed by wild-type PTEN, which were partially relieved by FoxO siRNA. At the same dose, PTEN did not decrease basal GalLuc activity or the transcriptional activity of PBINDAIB1. These data show that PTEN inhibits AR N/C interaction and AIB1 interaction through FoxO factors. 10. FoxO1 Suppresses Androgen-Induced Proliferation and PSA Expression in PCa Cells. If FoxO1 mediates the inhibition of AR activity and interferes with AR N/C interaction and coactivator recruitment, restoring the expression of active FoxO1 in PTEN null cells in which endogenous FoxO factors are mainly dislocated to cytosol should exert a negative effect on the biological activity of endogenous AR. Indeed, when PTEN-null LNCaP cells were infected, as a control, with a recombinant adenovirus expressing GFP (Ad-GFP), PSA expression was significantly induced by treatment with R1881. In a

PAGE 85

0 10 20 30 40VP16 PM VPARNT PMLBD MTPTEN WTPTEN U6 FoxOsiRNA ++-+ ++N/C Interaction (RLU 10-5)-+ -++-+ +++ ++--+---++ ++ -++ ++ +++ +--+ -+ -+ -++-+ + --+ +-A 0 1 2 3 4MTPTEN WTPTEN AIB1 U6 FoxOsiRNA + +++ + ++ --+ -+--+ -++ +-AR Activity (RLU 10-5) 0 1 2 3 4 0 1 2 3 4MTPTEN WTPTEN AIB1 U6 FoxOsiRNA + +++ + ++ --+ -+--+ -++ +-AR Activity (RLU 10-5)B 0 5 10 15VP16 PBIND VPARNT PBINDAIB1 MTPTEN WTPTEN U6 FoxOsiRNA +AR-AIB1 Interaction (RLU 10-4)+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +C Figure 18. Participation of Endogenous FoxO Factors in PTEN-Induced Suppression of AR N/C Interaction and Coactivators Recruitment. 72

PAGE 86

73 Figure 18. Participation of Endogenous FoxO Factors in PTEN-Induced Suppression of AR N/C Interaction and Coactivators Recruitment. A PC3 cells were transfected with 0.3 g GalLuc, 0.1 g pCMV 0.1 g VP16, PM, PMLBD, or VPARNT, and 0.05 g WTPTEN or MTPTEN together with the indicated amounts of FoxO siRNA or U6 control and treated with 10 nM R1881. AR N/C interaction was determined by measuring the reporter activity. B PC3 cells were transfected with 0.1 g pCMVAR, 0.1 g AIB1 and 0.05 g MTPTEN or WTPTEN together with FoxO siRNA or U6 control. Cells were then treated with 10 nM R1881 and AR activity was determined. C COS-7 cells were transfected as in panel A except that PMLBD was replaced with PBINDAIB1. The interaction between ARNT and AIB1 was determined as in panel A for AR N/C interaction.

PAGE 87

AB P<0.05 100 75 50 37 20 20 AR FoxO1 Tubulin PSA GFP -+ -+ R1881 Ad-GFP Ad-GFP-FoxO1ca 0 0.2 0.4 0.6 0.8 1 1.2 GFP+EOH FOXO+EOH GFP+R1881 FOXO+R1881MTT (OD595)Days of Treatment1 24 0 0.2 0.4 0.6 0.8 1 1.2 GFP+EOH FOXO+EOH GFP+R1881 FOXO+R1881 0 0.2 0.4 0.6 0.8 1 1.2 GFP+EOH FOXO+EOH GFP+R1881 FOXO+R1881MTT (OD595)Days of Treatment1 24 Figure 19 Suppression of Biological Activities of the AR in PCa Cells by Nuclear FoxO1. A, LNCaP cells were infected for 24 h with 100 MOI of Ad-GFP-FoxO1ca or Ad-GFP as control and treated with EOH or 10 nM R1881 for an additional 24 h. Proteins were detected by immunoblotting with the cognate antibody. B LNCaP cells were infected and treated for the indicated times as in panel A. Cell growth was determined by MTT colorimetric assays. Eight samples were analyzed for each data point and the data were reproduced three times. Statistical analyses were performed with standard student t test. Differences in androgeninduced cell growth between cells infected with control and FoxO1ca virus reached statistical significance (P<0.05). 74

PAGE 88

75 parallel experiment, infection with a recombinant adenovirus expressing both GFP and FoxO1ca (Ad-GFP-FoxO1ca) significantly decreased androgen induction of PSA expression (Fig. 19A). This inhibition was not due to a decrease in the level of AR protein expression (Fig. 19A). The comparable expression of the GFP proteins in all the lanes shows that the same number of viral particles was used in the studies. Similar to PSA expression, in LNCaP cells infected with control GFP virus, treatment with R1881 induced an increase in cell numbers as measured in MTT assays. The induction was significantly suppressed (p =0.0017) in cells infected with Ad-GFP-FoxO1ca (Fig. 19B). These analyses demonstrate that in PCa cells, the repression of AR transcriptional activity by FoxO1 can translate into the impaired biological actions of androgens through endogenous AR. 11. Working Model for PTEN Inhibition on AR through FoxO1 So far, our studies support the mechanism (Fig. 20) that PTEN acts through nuclear FoxO factors to disrupt AR N/C interaction and coactivaror recruitment to AR NTD, resulting in decreased transcriptional activity of the AR and the suppression of androgen action. 12. FoxO1 Inhibition Mediated through AR Is Diminished by Mutated AR DBD As discussed in the introduction, two mechanisms have been reported for the AR inhibition of FoxO1 activity. We are interested in studying whether the inhibition also involves an AR downstream taget gene. To test this idea, we first constructed an ARmut

PAGE 89

AF1 AF2FxxLF AF1 AF2FxxLF p160/SRCs FoxO1 p160/SRCs AF1 AF2FxxLF F o x O 1 FoxO1 AKT PTEN Nuclear Export Figure 20. A Working Model Depicting the Role of FoxO1 in PTEN-induced AR Inhibition in PCa Cells and Its Suppression by AKT. The model predicts that a function of nuclear FoxO factors in prostatic cells is to suppress AR N/C interaction and limit AR activation by p160 coactivators and that the negative and positive effects of the coactivators and FoxO factors provide a balance mechanism that keeps AR action in check. During prostatic tumorigenesis, the lost of PTEN results in cytoplasmic localization of FoxO factors owing to increased AKT activity that phosphorylates FoxO factors. This permits unopposed AR to drive prostate epithelial proliferation to a stage that is out of control. The model also predicts that increased expression or activity of AIB1 or AKT, two known prostatic oncogenes, or decreased expression or nuclear activity of FoxO factors themselves will have a similar consequence as the loss of PTEN. 76

PAGE 90

77 expression vector, in which two cysteine residues of AR DBD were mutated. We then compared in DU145 cells the ability to suppress FoxO1 activity of wild-type AR and ARmut using the FoxO luciferase reporter 3xIRSluc, which contains three copies of a FoxO1 response element from the promoter of the insulin-like growth factor-binding protein-1 gene. As this ARmut abolished the AR transcriptional activity on AREe1bLuc reporter (Fig. 21A), this expression of the mutant AR at the same protein level as wild-type AR partially reliev ed the wild-type AR inhibition of FoxO1 (Fig. 21B). Similar data were obtained when replacing FoxO1 with FoxO1ca. 13. The Effect of AR on Nuclear Localization of the FoxO1 Protein FoxO1 activation requires its localization to the nucleus, whereas cytoplasmic FoxO1 is inactive. Thus, we determined whether AR inhibits transcriptional activity of the FoxO1 protein by blocking its nuclear localizati on using immunoflorescence staining. Since the level of endogenous FoxO1 expression is quite low, we tested the AR effect on transfected FoxO1. As shown in Fig. 22, transfected FoxO1ca was retained in the nucleus when cotransfected with wild-type AR treated either with or without androgens. The nuclear localization was not affected if cotranfected with ARmut. Therefore, abolishing AR transcriptional activity does not appear to affect the nuclear localization of the transfected FoxO1ca protein in DU145 cells.

PAGE 91

0 5 10 15 20FoxO1 Activity (RLU 10-5) FoxO1 --+ + + + + + + + AR (g) 0.5 0 0 0.05 0.2 0.5 0 0 0 0 ARmut(g) 00.5 0 0 0 0 0.05 0.2 0.5 1.0FoxO1 AR -actin EOH R1881 EOH R1881AR Activity (RLU 10-5) 0 20 40 60 80AR -+ ARmut--+ EOH R1881AR Activity (RLU 10-5) 0 20 40 60 80AR -+ ARmut--+ EOH R1881 EOH R1881A B Figure 21. Mutation of AR DBD Partially Relieved the Inhibition on FoxO1 Activity. 78

PAGE 92

79 Figure 21. Mutation of AR DBD Partially Relieved the Inhibition on FoxO1 Activity. A, DU145 cells were transfected with 0.5 g AREe1bluc, 50 ng pCMV 0.2 g pCMVhAR or pCMVhARmut. Cells were treated and reporter activity was measured as in Figure 5A. B, Upper panel: DU145 cells were transfected with 0.5 g AREe1bluc, 50 ng pCMV 0.1 g Flag-FoxO1 together with indicate amounts of pCMVhAR or pCMVhARmut. Transfected cells were treated with 10 mM R1881. Reporter activity was determined. Lysates of DU145 cells transfected with the plasmids, exactly as in the upper panel, were immunoblotted with anti-AR, M2, or anti-actin antibody.

PAGE 93

AR+FoxO1ca+EOH AR+FoxO1ca+R1881 ARmut+FoxO1ca+EOH ARmut+FoxO1ca+R1881 Anti-AR Anti-Flag DAPI Merge Figure 22. Lack of an Effect of the AR and the ARmut on FoxO1 Cellular Localization. Immunoflorescence microscopic pictures of the transfected FoxO1 and AR or ARmut in DU145 cells were shown. DU145 cells were cotransfected with 0.3 g Flag-FoxO1ca and 0.2 g pCMVhAR or pCMVhARmut. After a 24 h treatment with 10 nM R1881 or EOH, cells were double-stained with anti-Flag and anti-AR antibodies for the FoxO1ca (red) and AR/ARmut (green). Cell nuclei were counterstained with DAPI (blue). 80

PAGE 94

81 14. Decreased mRNA level of FoxO1 reporter gene by Androgens Is Alleviated by Inhibiting New Protein Synthesis To test whether an androgen targe gene participates in the inhibition of FoxO1, we investigated the effect of activated AR on FoxO1 target gene transcription in the presence or absence of a new protein synthsis inhibitor. We carried out Nothern blot to measure the mRNA level of ecotopic 3xIRSluc, of which the luciferase transcription is induced by FoxO1. As shown in Fig. 23, activated AR decreased the mRNA level of 3xIRSluc (lane 2 compared to lane1). However, cycloheximide (CHX), an inhibitor of protein synthesis, significantly alleviated the decrease. In addition, this observation was confirmed by RT-PCR (Fig. 23B). These data suggest that AR inhibition of the transcritional activity of FoxO1 requires the synthesis of a new protein, presumably an androgen target gene. 15. FoxO Knockdown Inhibits PTEN-Induced Apoptosis Because the expression of PTEN or its downstream FoxO in LNCaP cells induces apoptosis and androgens oppose the functions of both PTEN and FoxO, wenext investigated whether the knockdown of FoxO would make difference in PTEN induced apoptosis. LNCaP cells were transfected with a GFP expression vetor together with wild-type or mutant PTEN, along with FoxO siRNA or U6 control vector. As shown in Fig. 24, apoptotic index, as determined by counting apoptotic cells in 400 green cells per sample, was 37% for cells transfected with WTPTEN and 10% for MTPEN control without androgen treatment. However, although the FoxO siRNA did not completely abolish the PTEN-induced apoptosis, it decreased the WTPTEN-induced apoptotic index to 29% in

PAGE 95

R1881 --+ -+ CHX ---+ + 3XIRS GAPDH 3xIRS -+ + + + AR + + + + + FoxO1ca R1881 -+ -+ 3xIRS + + + + AR + + + + FoxO1ca + + + + GAPDH IRSluc CHX --+ + A B+ + + + + Figure 23. Decreased Transcription of FoxO1 Reporter Gene by Androgens Is Alleviated by A Protein Synthesis Inhibitor. A, DU145 cells were transfected with 3 g 3xIRSluc, 2 g pCMVhAR and 2 g Flag-FoxO1ca. 24 h later, cells were treated with EOH as vehicle control or 10 nM R1881 in the absence or presence of 50 ng/l cyclohemimide (CHX) for 24 h. Total RNA was isolated, and 20 g RNA was subjected to Northern blot analysis to detect the mRNA level of 3xIRSluc and GAPDH control. B, 0.1 g RNA from A was subjected to RT-PCR and the mRNA levels of both 3xIRSluc and GAPDH control were tested. 82

PAGE 96

0 20 40 60 EOH R1881 EOH R1881 MTPTEN + + -WTPTEN --+ + U6 + -+ FoxOsiRNA-+ -+Apoptotic Index (% GFP-positive cells) p<0.05 Figure 24. FoxO Knockdown Suppresses PTEN-Induced Apoptosis. LNCaP cells were transfected with 0.3 g GFP, 0.2 g MTPTEN or WTPTEN and 0.8 g FoxO1 siRNA or U6 control as indicated. 48 h later, cells were treated with EOH or 10 nM R1881 for 24 h. Apoptotic index of GFP-positive cells was determined by scoring 400 GFP-positive cells for chromatin condensation and nuclear fragmentation. Duplicate samples were analyzed and the graph represents two independent experiments. 83

PAGE 97

84 the absence of androgens. These data suggest that FoxO factors plays a major role in the PTEN function. Moreover, in the presence of androgens, activated AR did not protect apoptosis induced by WTPTEN in the absence of FoxOs, suggesting that the AR-mediated protection of cells from apopt osis induced by PTEN is mediated through FoxOs. 16. Woring Model for AR Inhibition of FoxO1 Literatures have reported that AR inhibits FoxOa activity by proteolytic cleavage of FoxO1 at residue Arg537, which generates a dominant negative FoxO1(165), or blockage of FoxOs DNA binding activity by protein-protein interaction between AR and FoxO1 (164). Our studies support the mechanism (Fig. 25) that activated AR produces a yet-to-be identified androgen target gene to inhibit FoxO activity.

PAGE 98

FoxO1 AKT PTEN Nuclear Export AR FoxO1 FoxO1 FoxO1 1 2 x FoxO13 x AR AR AR x AR AR AR Figure 25. A Working Model Depicting the Mechanisms of FoxO1 Suppression by Androgens. The model predicts that activated AR suppresses FoxO activity by at least three possible mechanisms: 1, proteolytic cleavage of FoxO1 at residue Arg537, which generates a dominant negative FoxO1 leading to an inhibition of the activity of the intact FoxO1; 2, blockage of FoxOs DNA binding activity by protein-protein interaction between AR and FoxO1; 3, synthesis of a yet-to-be identified androgen target gene X to inhibit FoxO activity. 85

PAGE 99

86 DISCUSSION As discussed earlier, the loss of PTEN tumor suppressor is an important event during human prostatic tumorigenesis. Our previous studies identified PTEN protein as an AR suppressor that opposes androgen actions in prostate cells through down regulation of AKT (163). The present studies provide multiple lines of evidence to support the mechanism (Fig. 20) that PTEN acts through nuclear FoxO factors to disrupt AR N/C interaction and coactivator recruitment to AR NTD, resulting in decreased transcriptional activity of the AR and suppression of androgen action. First, FoxO1 siRNA relieved the inhibition of AR activity by ectopic PTEN in PTEN-null cells and increased AR activity in PTEN-intact cells. Second, the constitutively nuclear FoxO1 inhibited AR activity in a dose-dependent manner in PTEN-null cells whereas wild-type FoxO1 had little effect. Along with our observation that wild-type FoxO1, FoxO3a and FoxO4 inhibited AR activity in PTEN-intact cells, these data suggest that it is the nuclear FoxO factors that inhibit AR activity. Third, nuclear FoxO1 inhibited AR N/C interaction and AIB1 recruitment to AR NTD. PTEN exerted a similar effect, which was relieved by FoxO siRNA, suggesting that endogenous FoxO factors inhibit N/C interaction and AIB1 binding in a manner sensitive

PAGE 100

87 to PTEN status. Finally, adenovirus-mediated delivery of nuclear FoxO1 into PTEN-null LNCaP cells suppressed androgen-induced PSA production and cell growth, indicating that the inhibition of the transcriptional activity is likely translatable into suppression of the biological actions of androgens by PTEN and FoxO factors. AI PCa cells often display overexpression of coactivator molecules important for AR signaling (177). The model shown in Fig. 20 implies that increased expression or activity of AIB1 or AKT, two known prostatic oncogenes, or decreased expression or nuclear activity of FoxO factors themselves will have a similar consequence on androgen actions in prostate cells as the loss of PTEN. They all expose prostate cells to increase growth stimulation by androgens. During our investigation, two research groups reported the inhibition of AR activity by FoxO1 (178, 179). Dong et al. showed the inhibition without describing the underlying mechanism (178). Fan et al. showed that FoxO1 inhibited AR nuclear localization, subnuclear distribution and DNA binding and yet detected FoxO1 on the promoter of PSA gene together with the AR (179). In our investigation, we found that FoxO1 did not inhibit the AR nuclear localization (Fig. 9). Different from our previous finding that FoxO1 interacted with both AR NTD and the LBD (164), Fan et al.comfirmed that androgen induced interaction with LBD but reported that FoxO1 did not interact with AR NTD, leading to their assumption that the AR inhibition by FoxO1 was due to interaction with AR LBD. It is important to point out that, in their two-hybrid assays, Fan et al. used AR

PAGE 101

88 NTD fused to Gal4 DBD as one of the hybrid molecules to show a lack of FoxO1 interaction with AR NTD. Because AR NTD fused to Gal4 DBD strongly activated GalLuc reporter by itself (Fig. 11A), it is difficult to measure with this construct protein-protein interactions in mammalian two-hybrid assays. More importantly, the two-hybrid assays based on AR NTD fused to Gal4 DBD could not separate two opposing activities of FoxO1: the binding that increases the Gal4 reporter activity and the inhibitory effect of FoxO1 on the transcriptional activity associated with AR NTD, which decreases the reporter activity. Using FoxO1ca (150-655) fused to Gal4 DBD and AR NTD fused to VP16 activation domain, we detected a measurable interaction between FoxO1 and AR NTD. Furthermore, we found that transcriptional activity of AR NTD with its own DBD or Gal4 DBD was inhibited by FoxO1ca whereas the activity of AR LBD fused to Gal4 was neither inhibited by FoxO1ca nor increased by FoxO siRNA (Fig. 11B and data not shown). Unlike other members of the nuclear hor mone receptor family which usually contain a strong AF-2 in their LBD, the recruitment of p160 coactivators to AR is mediated primarily by the AF-1 domain in the NTD (14, 41). The AF-1 is known to exhibit strong constitutive activity and deletion of the LBD creates a molecule that activates androgen target genes to the same extent as the full length receptor in the presence of ligand(12, 14). Consistent with this scheme, our analyses showed that FoxO1 inhibited AIB1 recruitment to the AR NTD. The observations that FoxO1 did not bind to AIB1, that both

PAGE 102

89 FoxO1 and AIB1 bound to AR NTD (Fig. 14 and Fig. 13), and that FoxO1 inhibited the binding of AIB1 to NTD (Fig. 13) support a competition model instead of the squelching mechanism of action. Our mapping analyses showed that the FoxO1 fragment deleted of the forkhead box lost whereas the DNA-binding deficient FoxO1 mutant retained the ability to inhibit AR (Fig. 8E), suggesting that the AR inhibition requires the forkhead box but not the ability of FoxO1 to bind DNA. This is consistent with the competition mechanism. Besides the forkhead box, the ability of FoxO1 to inhibit AR also requires the C-terminal AD since FoxO1ca(150-537), which contains an intact forkhead box but lacks the AD, inhibited neither AR activity on PT81Luc in PC3 cells (Fig. 8B) nor the interaction of AR NTD with SRCs (data not shown). Clearly, neither the N-terminal 1-150 amino acids of FoxO1 nor the putative NR box is required for AR inhibition. The AR N/C interaction makes a major contribution to AR transcriptional activity. It influences receptor dimerization and slows down the dissociation of ligand from LBD as well as AR degradation. Mutations that disrupt AR N/C interactions have been linked to androgen-insensitive syndrome (180, 181). Besides the competition with coactivator recruitment to NTD, our data suggest the disruption of AR N/C interaction as an additional mechanism underlying the AR inhibition by the PTEN-FoxO axis. It is important to note that coactivator recruitment and N/C interaction are two closely related events. p160 coactivators interact with both the NTD and the LBD to bridge the N/C interaction (54, 182, 183) and the efficient recruitment of certain coactivators to the NTD of native AR appears

PAGE 103

90 also to require N/C interaction (14). Consistent with the association of the two events, FoxO domains necessary for inhibition of N/C interaction were also required for the interference with AIB1 binding. Nevertheless, AR N/C interaction was found not to be always required for the transcriptional activity of the AR as ligands that do not support the interaction still activate AR when used at sufficiently high concentrations and peptides that block the N/C interaction do not necessarily i nhibit AR transcriptional activity (184, 185). Mutation in the NTD (I182A/L183A) interfered with the AR N/C interaction and dramatically impaired the activity of full l ength AR but had little effect on the intrinsic transcriptional activity associated with the NTD (14). In Fig. 11, we showed that FoxO1 inhibited the activity of AR NTD, which is clearly free of N/C interaction. The data suggest that the effect of FoxO1 on coactivator recruitment does not depend on N/C interaction in the context of truncated AR. It is important to find out whether the effect of FoxO1 on N/C interaction and coactivatoir recruitment to NTD depend on each other in the context of full length AR. Because PTEN inhibits AKT activity, the function of all AKT substrates is expected to be regulated by PTEN. However, FoxO factors are arguably the best AKT substrates whose role in mediating PTEN action has been consistently demonstrated by both genetic and biochemical analyses, which were proved by their role in PTEN-induced apoptosis in LNCaP cells (Fig. 24). Genetic analyses in C. elegans have shown that Daf-16, the sole worm FoxO factor, acts downstream of PTEN to regulate stress response and longevity (186, 187). Similarly, genetic analysis in mice has placed FoxO3a

PAGE 104

91 downstream of PTEN in controlling the premature follicular activation (127). Our conclusion that nuclear FoxO proteins serve as the mediator for the suppressive effect of PTEN on the AR is consistent with observations that AKT is involved in AR inhibition by PTEN (163) does not directly increase AR activity through receptor phosphorylation at putative AKT sites (29, 188). This conclusion is also consistent with the demonstrated synergy between AR and AKT in PCa progression (189). Based on our initial observation that PTEN inhibited AR activity, we predicted that PTEN deletion would induce prostate tumorigenesis through unopposed action of the AR and contribute to resistance of PCa to androgen ablation therapy (190). This prediction was supported by prostate specific genetic deletion of PTEN in mice (156) and cell lines (191). The current study argues that the depletion of FoxO factors would have a similar effect on AI growth of PCa cells. At least two mechanisms have been described for the AR-mediated inhibition of FoxO1 activity by androgens. One is through the blockage of FoxOs DNA binding activity by protein-protein interaction between AR and FoxO1. The other is through the proteolytic cleavage of FoxO1 at residue Arg537, which generated a dominant negative FoxO1 leading to an inhibition of the activity of the intact FoxO1(165) by androgens. Our further investigation using AR DBD-deficient mutant and protein synthesis inhibitor suggest that AR-mediated inhibition of FoxO1 activity may also involve one of its target proteins. Althoug we have not yet identified this target protein, it might be participating in the acidic proteolytic cleavage of FoxO1 or form a complex with FoxO1 to block FoxOs DNA

PAGE 105

92 binding activity. It is possible that the protein synthesis inhibitor also suppresses new AR protein synthesis and thus relieves the AR inhibition of FoxO. Half-life of AR protein is approximately 6 h in the presence of 10 nM R1881(192). Treated with CHX for 6 h relieved the AR inhibition of FoxO more than two-fold, suggesting other proteins whose half-life less than 6 h might be involved in the AR inhibition of FoxO activity. Fig. 23 should be repeated after treated with CHX for different time points, and AR protein levels should be tested in parellel experiments to rule out the possiblility that the data shown in Fig. 23 is only due to suppression of new AR protein synthesis. Our current studies establish FoxO proteins as important nuclear factors that mediate the mutual antagonism between AR and PTEN tumor suppressor in PCa cells (Fig. 26). On the one hand, the inhibition of AR activity by PTEN through FoxO1 involved the interference of androgen-induce AR N/C interaction and the recruitment of the p160 coactivators to the AR N-terminus. On the other hand, the observations that PTEN fulfilled its biological function such as inducing apoptosis partly through FoxOs and previous information about AR inhibition of PTEN suggest that the suppression of FoxO factors by activated AR might contribute to the AR-mediated inhibition of PTEN action. In addition to the two mechanisms for AR inhibition on FoxO1 reported in the literature, we also suggest that AR-mediated inhibition of FoxO1 activity involves an unknown downstream target protein as a new mechanism.

PAGE 106

Cell Proliferation PCa AR AR AR PTENInsulin/Growth Factor N u c l e a r E x p o r t FoxO1 Gene X FoxO1 FoxO1 PI3K AKT RTK Cell cycle arrest Apoptosis N / C I n te r a c t i o n C o a c ti v a t o r DHT Fig. 26. Model for Roles of Foxo Factors in the Mutual Antagonism between AR and PTEN. (See page 89 for details). 93

PAGE 107

94 FoxO factors have been shown to be deregulated in several tumor types including PCa. The multiple FoxO functions associated with tumor protection including cell cycle arrest, cell death, resistance to oxidative stress and DNA repair, argue strongly for FoxO factors as new therapeutic targets. Much of cancer-related drug discovery has been focused on inhibitors of oncoproteins activated in tumor cells such as Gleevac, the inhibitor of the leukemia-associated BRC/ABL fusion gene product, and Herceptin for HER2 positive breast cancer and the various EGFR inhibitors. Alternatively, developing chemical molecules that act to restore the function of a defective tumor suppressor gene is a more specific strategy. Unlike PTEN expression, which is frequently lost in advanced PCa, multiple FoxO factors are redundantly ex pressed in prostate cells (137). Therefore, restoring the expression of FoxO factors in the nucleus through targeted inhibition of PI3K-AKT pathway would offer a possible approach to oppose androgen-AR action and to sensitize PCa to androgen ablation therapy.

PAGE 108

95 SUMMARY AND THE PERSPECTIVES FOR FUTURE STUDIES PCa is the most common cancer and the second leading cause of cancer deaths in American men. However, the mechanisms underlying the relapse and conversion of the tumor cells to an androgen refractory status after androgen ablation therapy remain unclear. Our studies on how the FoxO transcriptional factors participate in the antagonistic crosstalk between AR and PTEN tumor suppressor in PCa growth and progression reveal FoxOs as a novel molecula r target for intervention to treat advanced PCa or improve the response of PCa patients to androgen ablation therapy. PTEN mutations or deletions have been frequently identified in PCa. PTEN and AR play important roles in prostatic tumorigenesis by exerting opposite effects on the homeostasis of prostatic epithelium. These information lead to our previous work that showed a mutual repression between PTEN and AR in the growth and the apoptosis of PCa cells (163). The FoxO family is an AKT substrate and is inactivated by AKT after cellular stimulation by growth factors or insulin. Mainly though its negative effect on AKT, PTEN acts through FoxO factors to cancer cell growth (193). We have reported an AR-dependent repression of FoxO1 and FoxO3a function by androgens (164). These

PAGE 109

96 findings led to the hypothesis that FoxO transcription factors mediate the mutual antagonism between AR and PTEN tumor suppressor in PCa cells. Based on the data presented in this study, here we first demonstrated repression of the AR activity by FoxOs. Active FoxO1 decreased the AR transcriptional activity on reporters under the control of synthetic or natural AREs. FoxOs knockdown increased AR activity in PTEN-intact cells. The transcriptional inhibition also translated to the inhibition of AR biological function in terms of androgen-induced cell proliferation and production of the AR target protein PSA in PCa cells. More importantly, the data provide evidence to support that PTEN acts through nuclear FoxO factors to suppress AR as FoxO1 siRNA relieved AR inhibition by ectopic PTEN in PTEN null cells. Several investigations have been made to understand the mechanisms for this AR inhibition by FoxOs and PTEN. Mutational analysis revealed that FoxO1 fragment 150-655, which contains the forkhead box and C-terminal activation domain, was required for AR inhibition. Neither the N-terminal 1-150 amino acids of FoxO1 nor the putative NR box was required for AR inhibition. The inhibition of AR neither was due to the nuclear exclusion by FoxO1 nor was asso ciated with posttranscriptional modification such as acetylation. Mammalian two-hybrid assays demonstrated that the inhibition of AR activity by PTEN through FoxO1 involved t he interference of androgen-induce interaction of the Nand C-termini of the AR and the recruitment of the p160 coactivators to the AR N-terminus.

PAGE 110

97 We and another lab (165) have reported the AR inhibition on FoxO1 by two mechanisms. Our current data suggest that PTEN exerts its biological function at least partly through FoxOs since FoxO siRNA attenuated the PTEN-indcued apoptosis. This indicates that AR-mediated suppression of PTEN function might be through the inhibition on FoxOs activity by androgens. We also rev eal a new mechanism for the FoxO inhibition by AR. The observations that AR DBD-deficient mutant partially relieved AR inhibition on FoxO1 trasnscriptional activity and inhibition of new protein synthesis abolished the AR-related decrease in the mRNA level of FoxO1 target gene suggest that AR inhibits FoxO1 activity by producing a downstream target protein. Future study will try to find out this specific AR target gene. There are several goals of future studies. We used mammalian two-hybrid assay to examine the mechanisms for the FoxO inhibition of AR. It would better to corroborate with other techniques such as the pull down assay to show that AR N/C interaction or interaction between AR and AIB1 is suppressed by FoxO factors. Furthermore, our findings are basically presented on the artificial but not endogenous AR target promoters. ChiP analysis should be performed to verify the finding that FoxO1 inhibits AIB1 recruitment to the endogenous AR target pr omoters, such as PSA gene promoter to support that the results are physiologically related. We have shown the suppression of biological activities of endogenous AR by FoxO1 in terms of cell growth and androgen-induced PSA production. It would be important to test whether knockdown of

PAGE 111

98 FoxO1 will relieve the PTEN inhibition of AR biological activities. We have not yet identified the androgen target gene which is involved in the AR inhibition of FoxO1. One approach is to purify the FoxO protein upon androgen treatment in the cells with endogenous AR and to analyze the FoxO interaction proteins by Mass Spectrometry to find out the relative AR regulated gene. As mentioned in the introduction, in cell culture-based systems, FoxO1, FoxO3, and FoxO4 behave similarly. Yet, mouse FoxO knockouts have revealed unique roles for the FoxOs, while the three FoxOs likely have significant redundancies. The differences in phenotypes of FoxO-null mice may be due to different patterns of expression of each FoxO isoform, but may also reflect specific regulations, protein partners, or target genes of these isoforms. Our work is cell line-based. The use of PCa mouse models will likely provide important clues as to whether in vivo loss of PTEN is a direct cause for promoting AR-specific gene activation. And specifically, what are the alterations of AR-specific gene activation and PCa status when loss of the nuclear function of each of the FoxO factor in the mouse model. Future studies should also investigate the correlation among wild type PTEN, AR and nuclear FoxO expression levels in human patient samples, as well as how this correlation relates to the stage or grade of PCa. The wide range of benign to malignant phenotypes mediated by PI3K-PTEN-AKT signaling is consistent with the existence of diverse downstream effectors differentially utilized in conferring neoplastic phenotypes in distinct cell lineages. Among such potential

PAGE 112

99 effectors are AKT phosphorylation targets TSC2, GSK3, and the FoxOs (108, 194, 195). Recently, much attention has been focused on TSC2 and mTOR signaling as mounting pharmacological evidence suggests that mTOR is the prime effector of the PI3K-AKT pathway. Indeed, the potent anti-neoplastic impact of pharmacologic mTOR inhibition raises questions as to the relevance of other AKT targets, particularly the FoxOs, in the development of cancer. However, the demonstration that FoxO inactivation is sufficient to drive development of hemangiomas suggests th at misregulation of the FoxOs is a prime mechanism by which PTEN loss leads to the fo rmation of hemangiomas in these patients, and also suggest that FoxO proteins exert their tumor-suppressive capability in the presence of additional mutations. In support of this view, Bouchard et al. identified Akt-mediated phosphorylation of FoxO proteins as the critical PI3K signaling component that substitutes for oncogenic Ras in Myc-induced proliferation and focus formation in vitro (135). Our cell-based analysis strongly suggests that FoxO factors play prominent roles in the cancer-relevant activities of t he PTEN-PI3K-AKT network and AR in PCa cells, providing the rationale for future drug discovery to restore the nuclear FoxO activity in combination with androgen ablation to suppress AR signaling and prostate tumorigenesis. The approaches to restore nuclear FoxO activity include developing PTEN enzyme analogues, or PI3K inhibitors such as wortmannin and LY294002, or AKT inhibitors, or FoxO mutant proteins whose subcellular localization is restricted to the nucleus. In summary, these studies established a mutual inhibition of AR and FoxO1 activity and

PAGE 113

100 establish FoxO proteins as important nuclear factors that mediate the mutual antagonism between AR and PTEN tumor suppressor in PCa cells. Our studies provide rationale for future investigation of restoring the nuclear expression of FoxO factors through targeted inhibition of PI3K-AKT pathway as a possible approach to oppose androgen-AR action and to sensitize PCa to androgen ablation therapy.

PAGE 114

101 REFERENCES 1. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835-839 2. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889-895 3. Laudet V, Hanni C, Coll J, Catzeflis F, Stehelin D 1992 Evolution of the nuclear receptor gene superfamily. Embo J 11:1003-1013 4. Brinkmann AO, Faber PW, van Rooij HC, Kuiper GG, Ris C, Klaassen P, van der Korput JA, Voorhorst MM, van Laar JH, Mulder E, et al. 1989 The human androgen receptor: domain structure, genomic organization and regulation of expression. J Steroid Biochem 34:307-310 5. Brown CJ, Goss SJ, Lubahn DB, Joseph DR, Wilson EM, French FS, Willard HF 1989 Androgen receptor locus on the human X chromosome: regional localization to Xq11-12 and description of a DNA polymorphism. American journal of human genetics 44:264-269 6. Lubahn DB, Joseph DR, Sullivan PM, Willard HF, French FS, Wilson EM 1988 Cloning of human androgen receptor complementary DNA and localization to the X chromosome. Science 240:327-330 7. Lubahn DB, Brown TR, Simental JA, Higgs HN, Migeon CJ, Wilson EM, French FS 1989 Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proceedings of the National Academy of Sciences of the United States of America 86:9534-9538

PAGE 115

102 8. Tilley WD, Marcelli M, Wilson JD, McPhaul MJ 1989 Characterization and expression of a cDNA encoding the human androgen receptor. Proceedings of the National Academy of Sciences of the United States of America 86:327-331 9. Quigley CA, De Bellis A, Marschke KB, el-Awady MK, Wilson EM, French FS 1995 Androgen receptor defects: historical, clinical, and molecular perspectives. Endocr Rev 16:271-321 10. La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH 1991 Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature 352:77-79 11. McEwan IJ 2001 Structural and functional alterations in the androgen receptor in spinal bulbar muscular atrophy. Biochem Soc Trans 29:222-227 12. Jenster G, van der Korput HA, van Vroonhoven C, van der Kwast TH, Trapman J, Brinkmann AO 1991 Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 5:1396-1404 13. MacLean HE, Warne GL, Zajac JD 1997 Localization of functional domains in the androgen receptor. J Steroid Biochem Mol Biol 62:233-242 14. Alen P, Claessens F, Verhoeven G, Rombauts W, Peeters B 1999 The androgen receptor amino-terminal domain plays a key role in p160 coactivator-stimulated gene transcription. Mol Cell Biol 19:6085-6097 15. Slagsvold T, Kraus I, Bentzen T, Palvimo J, Saatcioglu F 2000 Mutational analysis of the androgen receptor AF-2 (activation function 2) core domain reveals functional and mechanistic differ ences of conserved residues compared with other nuclear receptors. Mol Endocrinol 14:1603-1617 16. Tora L, White J, Brou C, Tasset D, Webster N, Scheer E, Chambon P 1989 The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59:477-487 17. Bevan CL, Hoare S, Claessens F, Heery DM, Parker MG 1999 The AF1 and AF2 domains of the androgen receptor interact with distinct regions of SRC1. Molecular and cellular biology 19:8383-8392

PAGE 116

103 18. Jenster G, van der Korput HA, Trapman J, Brinkmann AO 1995 Identification of two transcription activation units in the N-terminal domain of the human androgen receptor. J Biol Chem 270:7341-7346 19. Simental JA, Sar M, Lane MV, French FS, Wilson EM 1991 Transcriptional activation and nuclear targeting signals of the human androgen receptor. J Biol Chem 266:510-518 20. Nelson CC, Hendy SC, Shukin RJ, C heng H, Bruchovsky N, Koop BF, Rennie PS 1999 Determinants of DNA sequence specificity of the androgen, progesterone, and glucocorticoid receptors: evidence for differential steroid receptor response elements. Mol Endocrinol 13:2090-2107 21. Sack JS, Kish KF, Wang C, Attar RM, Kiefer SE, An Y, Wu GY, Scheffler JE, Salvati ME, Krystek SR, Jr., Weinmann R, Einspahr HM 2001 Crystallographic structures of the ligand-binding domains of the androgen receptor and its T877A mutant complexed with the natural agonist dihydrotestosterone. Proceedings of the National Academy of Sciences of the United States of America 98:4904-4909 22. He B, Wilson EM 2002 The NH(2)-terminal and carboxyl-terminal interaction in the human androgen receptor. Mol Genet Metab 75:293-298 23. Steketee K, Berrevoets CA, Dubbink HJ, Doesburg P, Hersmus R, Brinkmann AO, Trapman J 2002 Amino acids 3-13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor. Eur J Biochem 269:5780-5791 24. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927-937 25. Matias PM, Donner P, Coelho R, Thomaz M, Peixoto C, Macedo S, Otto N, Joschko S, Scholz P, Wegg A, Basler S, Schafer M, Egner U, Carrondo MA 2000 Structural evidence for ligand specificity in the binding domain of the human androgen receptor. Implications for pathogenic gene mutations. J Biol Chem 275:26164-26171

PAGE 117

104 26. Schaufele F, Carbonell X, Guerbadot M, Borngraeber S, Chapman MS, Ma AA, Miner JN, Diamond MI 2005 The structural basis of androgen receptor activation: intramolecular and intermolecular amino-carboxy interactions. Proceedings of the National Academy of Sciences of the United States of America 102:9802-9807 27. Kuiper GG, Brinkmann AO 1995 Phosphot ryptic peptide analysis of the human androgen receptor: detection of a hormone-induced phosphopeptide. Biochemistry 34:1851-1857 28. Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Berrevoets CA, Trapman J 1999 Mechanisms of androgen receptor activation and function. J Steroid Biochem Mol Biol 69:307-313 29. Gioeli D, Ficarro SB, Kwiek JJ, Aaronson D, Hancock M, Catling AD, White FM, Christian RE, Settlage RE, Shabanowitz J, Hunt DF, Weber MJ 2002 Androgen receptor phosphorylation. Regulation and identification of the phosphorylation sites. J Biol Chem 277:29304-29314 30. Fu M, Rao M, Wang C, Sakamaki T, Wang J, Di Vizio D, Zhang X, Albanese C, Balk S, Chang C, Fan S, Rosen E, Palvimo JJ, Janne OA, Muratoglu S, Avantaggiati ML, Pestell RG 2003 Acetylation of androgen receptor enhances coactivator binding and promotes prostate cancer cell growth. Mol Cell Biol 23:8563-8575 31. Fu M, Wang C, Reutens AT, Wang J, Angeletti RH, Siconolfi-Baez L, Ogryzko V, Avantaggiati ML, Pestell RG 2000 p300 and p300/cAMP-response element-binding protein-associated factor acetylate the androgen receptor at sites governing hormone-dependent transactivation. J Biol Chem 275:20853-20860 32. Fu M, Wang C, Wang J, Zhang X, Sakamaki T, Yeung YG, Chang C, Hopp T, Fuqua SA, Jaffray E, Hay RT, Palvimo JJ, Janne OA, Pestell RG 2002 Androgen receptor acetylation governs trans activation and MEKK1-induced apoptosis without affecting in vitro sumoylation and trans-repression function. Mol Cell Biol 22:3373-3388 33. Hayes SA, Zarnegar M, Sharma M, Yang F, Peehl DM, ten Dijke P, Sun Z 2001 SMAD3 represses androgen receptor-mediated transcription. Cancer Res 61:2112-2118

PAGE 118

105 34. Poukka H, Karvonen U, Janne OA, Palvimo JJ 2000 Covalent modification of the androgen receptor by small ubiquitin-like modifier 1 (SUMO-1). Proceedings of the National Academy of Sciences of the United States of America 97:14145-14150 35. Cheng J, Wang D, Wang Z, Yeh ET 2004 SENP1 enhances androgen receptor-dependent transcription through desumoylation of histone deacetylase 1. Mol Cell Biol 24:6021-6028 36. Bevan C, Parker M 1999 The role of coactivators in steroid hormone action. Exp Cell Res 253:349-356 37. Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167-1177 38. Jenster G 1998 Coactivators and corepressors as mediators of nuclear receptor function: an update. Mol Cell Endocrinol 143:1-7 39. Parker MG, White R 1996 Nuclear receptors spring into action. Nat Struct Biol 3:113-115 40. Darimont BD, Wagner RL, Apriletti JW, Stallcup MR, Kushner PJ, Baxter JD, Fletterick RJ, Yamamoto KR 1998 Structure and specificity of nuclear receptor-coactivator interactions. Genes & development 12:3343-3356 41. Ma H, Hong H, Huang SM, Irvine RA, Webb P, Kushner PJ, Coetzee GA, Stallcup MR 1999 Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins. Mol Cell Biol 19:6164-6173 42. Lee YH, Koh SS, Zhang X, Cheng X, Stallcup MR 2002 Synergy among nuclear receptor coactivators: selective requirement for protein methyltransferase and acetyltransferase activities. Mol Cell Biol 22:3621-3632 43. Wang H, Huang ZQ, Xia L, Feng Q, Erdjument-Bromage H, Strahl BD, Briggs SD, Allis CD, Wong J, Tempst P, Zhang Y 2001 Methylation of histone H4 at arginine 3 facilitating transcriptional activation by nuclear hormone receptor. Science 293:853-857 44. Ramamoorthy S, Nawaz Z 2008 E6-associated protein (E6-AP) is a dual function coactivator of steroid hormone receptors. Nuclear receptor signaling 6:e006

PAGE 119

106 45. Glass CK, Rose DW, Rosenfeld MG 1997 Nuclear receptor coactivators. Current opinion in cell biology 9:222-232 46. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. Embo J 15:3667-3675 47. Christiaens V, Bevan CL, Callewaert L, Haelens A, Verrijdt G, Rombauts W, Claessens F 2002 Characterization of the two coactivator-interacting surfaces of the androgen receptor and their relative role in transcriptional control. The Journal of biological chemistry 277:49230-49237 48. Culig Z, Comuzzi B, Steiner H, Bartsch G, Hobisch A 2004 Expression and function of androgen receptor coactivators in prostate cancer. J Steroid Biochem Mol Biol 92:265-271 49. Heinlein CA, Chang C 2002 Androgen receptor (AR) coregulators: an overview. Endocrine reviews 23:175-200 50. Yeh S, Chang C 1996 Cloning and characterization of a specific coactivator, ARA70, for the androgen receptor in human prostate cells. Proceedings of the National Academy of Sciences of the United States of America 93:5517-5521 51. Adachi M, Takayanagi R, Tomura A, Imasaki K, Kato S, Goto K, Yanase T, Ikuyama S, Nawata H 2000 Androgen-insensitivity syndrome as a possible coactivator disease. N Engl J Med 343:856-862 52. Berrevoets CA, Doesburg P, Steketee K, Trapman J, Brinkmann AO 1998 Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor2). Mol Endocrinol 12:1172-1183 53. Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW, Mulder E, Brinkmann AO, Trapman J 1997 Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry 36:1052-1064

PAGE 120

107 54. Ikonen T, Palvimo JJ, Janne OA 1997 Interaction between the aminoand carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821-29828 55. Langley E, Zhou ZX, Wilson EM 1995 Evidence for an anti-parallel orientation of the ligand-activated human androgen receptor dimer. J Biol Chem 270:29983-29990 56. Scheller A, Hughes E, Golden KL, Robins DM 1998 Multiple receptor domains interact to permit, or restrict, androgen-specific gene activation. J Biol Chem 273:24216-24222 57. Zhou ZX, Lane MV, Kemppainen JA, French FS, Wilson EM 1995 Specificity of ligand-dependent androgen receptor stabilization: receptor domain interactions influence ligand dissociation and receptor stability. Mol Endocrinol 9:208-218 58. He B, Kemppainen JA, Wilson EM 2000 FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. J Biol Chem 275:22986-22994 59. Jiang F, Wang Z 2003 Identification of androgen-responsive genes in the rat ventral prostate by complementary deoxyribonucleic acid subtraction and microarray. Endocrinology 144:1257-1265 60. Eder IE, Haag P, Basik M, Mousses S, Bektic J, Bartsch G, Klocker H 2003 Gene expression changes following androgen receptor elimination in LNCaP prostate cancer cells. Mol Carcinog 37:181-191 61. Nelson PS, Clegg N, Arnold H, Ferguson C, Bonham M, White J, Hood L, Lin B 2002 The program of androgen-responsive genes in neoplastic prostate epithelium. Proceedings of the National Academy of Sciences of the United States of America 99:11890-11895 62. Young CY, Montgomery BT, Andrews PE, Qui SD, Bilhartz DL, Tindall DJ 1991 Hormonal regulation of prostate-specific antigen messenger RNA in human prostatic adenocarcinoma cell line LNCaP. Cancer Res 51:3748-3752 63. Murtha P, Tindall DJ, Young CY 1993 Androgen induction of a human prostate-specific kallikrein, hKLK2: characterization of an androgen response element in the 5' promoter region of the gene. Biochemistry 32:6459-6464

PAGE 121

108 64. Partin AW, Catalona WJ, Finlay JA, Darte C, Tindall DJ, Young CY, Klee GG, Chan DW, Rittenhouse HG, Wolfert RL, Woodrum DL 1999 Use of human glandular kallikrein 2 for the detection of prostate cancer: preliminary analysis. Urology 54:839-845 65. Prescott JL, Blok L, Tindall DJ 1998 Isolation and androgen regulation of the human homeobox cDNA, NKX3.1. Prostate 35:71-80 66. Abdulkadir SA, Magee JA, Peters TJ, Kaleem Z, Naughton CK, Humphrey PA, Milbrandt J 2002 Conditional loss of Nkx3.1 in adult mice induces prostatic intraepithelial neoplasia. Mol Cell Biol 22:1495-1503 67. Bhatia-Gaur R, Donjacour AA, Sciavolino PJ, Kim M, Desai N, Young P, Norton CR, Gridley T, Cardiff RD, Cunha GR, Abate-Shen C, Shen MM 1999 Roles for Nkx3.1 in prostate development and cancer. Genes & development 13:966-977 68. Kim MJ, Cardiff RD, Desai N, Banach-Petrosky WA, Parsons R, Shen MM, Abate-Shen C 2002 Cooperativity of Nkx3.1 and Pten loss of function in a mouse model of prostate carcinogenesis. Proceedings of the National Academy of Sciences of the United States of America 99:2884-2889 69. Wilson EM, French FS 1980 Biochemical homology between rat dorsal prostate and coagulating gland. Purification of a major androgen-induced protein. J Biol Chem 255:10946-10953 70. Page MJ, Parker MG 1982 Effect of androgen on the transcription of rat prostatic binding protein genes. Mol Cell Endocrinol 27:343-355 71. Furuya Y, Lin XS, Walsh JC, Nelson WG, Isaacs JT 1995 Androgen ablation-induced programmed death of prostatic glandular cells does not involve recruitment into a defective cell cycle or p53 induction. Endocrinology 136:1898-1906 72. Roy AK, Lavrovsky Y, Song CS, Chen S, Jung MH, Velu NK, Bi BY, Chatterjee B 1999 Regulation of androgen action. Vitam Horm 55:309-352 73. van der Horst A, Burgering BM 2007 Stressing the role of FoxO proteins in lifespan and disease. Nature reviews 8:440-450 74. Baker SJ 2007 PTEN enters the nuclear age. Cell 128:25-28

PAGE 122

109 75. Bachman KE, Argani P, Samuels Y, Silliman N, Ptak J, Szabo S, Konishi H, Karakas B, Blair BG, Lin C, Peters BA, Velculescu VE, Park BH 2004 The PIK3CA gene is mutated with high frequency in human breast cancers. Cancer Biol Ther 3:772-775 76. Campbell IG, Russell SE, Choong DY, Montgomery KG, Ciavarella ML, Hooi CS, Cristiano BE, Pearson RB, Phillips WA 2004 Mutation of the PIK3CA gene in ovarian and breast cancer. Cancer Res 64:7678-7681 77. Kirkegaard T, Witton CJ, McGlynn LM, Tovey SM, Dunne B, Lyon A, Bartlett JM 2005 AKT activation predicts outcome in breast cancer patients treated with tamoxifen. J Pathol 207:139-146 78. Nakayama K, Nakayama N, Kurman RJ, Cope L, Pohl G, Samuels Y, Velculescu VE, Wang TL, Shih Ie M 2006 Sequence mutations and amplification of PIK3CA and AKT2 genes in purified ovarian serous neoplasms. Cancer Biol Ther 5:779-785 79. Xing D, Orsulic S 2005 A genetically defined mouse ovarian carcinoma model for the molecular characterization of pathway-targeted therapy and tumor resistance. Proceedings of the National Academy of Sciences of the United States of America 102:6936-6941 80. Asano T, Yao Y, Zhu J, Li D, Abbruzzese JL, Reddy SA 2004 The PI 3-kinase/Akt signaling pathway is activated due to aberrant Pten expression and targets transcription factors NF-kappaB and c-Myc in pancreatic cancer cells. Oncogene 23:8571-8580 81. Broderick DK, Di C, Parrett TJ, Samuels YR, Cummins JM, McLendon RE, Fults DW, Velculescu VE, Bigner DD, Yan H 2004 Mutations of PIK3CA in anaplastic oligodendrogliomas, high-grade astrocytomas, and medulloblastomas. Cancer Res 64:5048-5050 82. Garcia-Rostan G, Costa AM, Pereira-Castro I, Salvatore G, Hernandez R, Hermsem MJ, Herrero A, Fusco A, Cameselle-Teijeiro J, Santoro M 2005 Mutation of the PIK3CA gene in anaplastic thyroid cancer. Cancer Res 65:10199-10207

PAGE 123

110 83. Okano J, Snyder L, Rustgi AK 2003 Genetic alterations in esophageal cancer. Methods Mol Biol 222:131-145 84. Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH, Parsons R 1997 PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275:1943-1947 85. Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH, Tavtigian SV 1997 Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15:356-362 86. Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, Bose S, Call KM, Tsou HC, Peacocke M, Eng C, Parsons R 1997 Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet 16:64-67 87. Marsh DJ, Dahia PL, Zheng Z, Liaw D, Parsons R, Gorlin RJ, Eng C 1997 Germline mutations in PTEN are present in Bannayan-Zonana syndrome. Nat Genet 16:333-334 88. Rasheed BK, Wiltshire RN, Bigner SH, Bigner DD 1999 Molecular pathogenesis of malignant gliomas. Curr Opin Oncol 11:162-167 89. Wu H, Goel V, Haluska FG 2003 PTEN signaling pathways in melanoma. Oncogene 22:3113-3122 90. Stambolic V, Mak TW, Woodgett JR 1999 Modulation of cellular apoptotic potential: contributions to oncogenesis. Oncogene 18:6094-6103 91. Ali IU, Schriml LM, Dean M 1999 Mutational spectra of PTEN/MMAC1 gene: a tumor suppressor with lipid phosphatase activity. J Natl Cancer Inst 91:1922-1932 92. Di Cristofano A, Pesce B, Cordon-Cardo C, Pandolfi PP 1998 Pten is essential for embryonic development and tumour suppression. Nat Genet 19:348-355

PAGE 124

111 93. Stambolic V, Suzuki A, de la Pompa JL, Brothers GM, Mirtsos C, Sasaki T, Ruland J, Penninger JM, Siderovski DP, Mak TW 1998 Negative regulation of PKB/Akt-dependent cell survival by t he tumor suppressor PTEN. Cell 95:29-39 94. Engelman JA, Luo J, Cantley LC 2006 The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat Rev Genet 7:606-619 95. Datta SR, Brunet A, Greenberg ME 1999 Cellular survival: a play in three Akts. Genes & development 13:2905-2927 96. Kandel ES, Hay N 1999 The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp Cell Res 253:210-229 97. Dahia PL 2000 PTEN, a unique tumor suppressor gene. Endocr Relat Cancer 7:115-129 98. Downward J 2004 PI 3-kinase, Akt and cell survival. Semin Cell Dev Biol 15:177-182 99. Stokoe D 2001 Pten. Curr Biol 11:R502 100. Vivanco I, Sawyers CL 2002 The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2:489-501 101. Kaestner KH, Knochel W, Martinez DE 2000 Unified nomenclature for the winged helix/forkhead transcription factors. Genes & development 14:142-146 102. Lehmann OJ, Sowden JC, Carlsson P, Jordan T, Bhattacharya SS 2003 Fox's in development and disease. Trends Genet 19:339-344 103. Anderson MJ, Viars CS, Czekay S, Cavenee WK, Arden KC 1998 Cloning and characterization of three human forkhead genes that comprise an FKHR-like gene subfamily. Genomics 47:187-199 104. Biggs WH, 3rd, Cavenee WK, Arden KC 2001 Identification and characterization of members of the FKHR (FOX O) subclass of winged-helix transcription factors in the mouse. Mamm Genome 12:416-425

PAGE 125

112 105. Furuyama T, Nakazawa T, Nakano I, Mori N 2000 Identification of the differential distribution patterns of mRNAs and consensus binding sequences for mouse DAF-16 homologues. Biochem J 349:629-634 106. Yang Y, Hou H, Haller EM, Nicosia SV, Bai W 2005 Suppression of FOXO1 activity by FHL2 through SIRT1-mediated deacetylation. Embo J 24:1021-1032 107. Essers MA, de Vries-Smits LM, Barker N, Polderman PE, Burgering BM, Korswagen HC 2005 Functional interaction between beta-catenin and FOXO in oxidative stress signaling. Science 308:1181-1184 108. Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME 1999 Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-868 109. Brunet A, Kanai F, Stehn J, Xu J, Sarbassova D, Frangioni JV, Dalal SN, DeCaprio JA, Greenberg ME, Yaffe MB 2002 14-3-3 transits to the nucleus and participates in dynamic nucleocytoplasmic transport. J Cell Biol 156:817-828 110. Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB, Cohen P 1997 Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol 7:261-269 111. Hu MC, Lee DF, Xia W, Golfman LS, Ou-Yang F, Yang JY, Zou Y, Bao S, Hanada N, Saso H, Kobayashi R, Hung MC 2004 IkappaB kinase promotes tumorigenesis through inhibition of forkhead FOXO3a. Cell 117:225-237 112. Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, Tran H, Ross SE, Mostoslavsky R, Cohen HY, Hu LS, Cheng HL, Jedrychowski MP, Gygi SP, Sinclair DA, Alt FW, Greenberg ME 2004 Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303:2011-2015 113. van der Horst A, Tertoolen LG, de Vries-Smits LM, Frye RA, Medema RH, Burgering BM 2004 FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2(SIRT1). J Biol Chem 279:28873-28879 114. Motta MC, Divecha N, Lemieux M, Kamel C, Chen D, Gu W, Bultsma Y, McBurney M, Guarente L 2004 Mammalian SIRT1 represses forkhead transcription factors. Cell 116:551-563

PAGE 126

113 115. Daitoku H, Hatta M, Matsuzaki H, Aratani S, Ohshima T, Miyagishi M, Nakajima T, Fukamizu A 2004 Silent information regulator 2 potentiates Foxo1-mediated transcription through its deacetylase activity. Proceedings of the National Academy of Sciences of the United States of America 101:10042-10047 116. Fukuoka M, Daitoku H, Hatta M, Matsuzaki H, Umemura S, Fukamizu A 2003 Negative regulation of forkhead transcription factor AFX (Foxo4) by CBP-induced acetylation. Int J Mol Med 12:503-508 117. Kobayashi Y, Furukawa-Hibi Y, Chen C, Horio Y, Isobe K, Ikeda K, Motoyama N 2005 SIRT1 is critical regulator of FOXO-mediated transcription in response to oxidative stress. Int J Mol Med 16:237-243 118. Mahmud DL, M GA, Deb DK, Platanias LC, Uddin S, Wickrema A 2002 Phosphorylation of forkhead transcription factors by erythropoietin and stem cell factor prevents acetylation and their interaction with coactivator p300 in erythroid progenitor cells. Oncogene 21:1556-1562 119. Perrot V, Rechler MM 2005 The coactivator p300 directly acetylates the forkhead transcription factor Foxo1 and stimul ates Foxo1-induced transcription. Mol Endocrinol 19:2283-2298 120. Tang TT, Dowbenko D, Jackson A, Toney L, Lewin DA, Dent AL, Lasky LA 2002 The forkhead transcription factor AFX activates apoptosis by induction of the BCL-6 transcriptional repressor. J Biol Chem 277:14255-14265 121. Matsuzaki H, Daitoku H, Hatta M, Tanaka K, Fukamizu A 2003 Insulin-induced phosphorylation of FKHR (Foxo1) targets to proteasomal degradation. Proceedings of the National Academy of Sciences of the United States of America 100:11285-11290 122. Plas DR, Thompson CB 2003 Akt activation promotes degradation of tuberin and FOXO3a via the proteasome. J Biol Chem 278:12361-12366 123. Aoki M, Jiang H, Vogt PK 2004 Proteasomal degradation of the FoxO1 transcriptional regulator in cells transformed by the P3k and Akt oncoproteins. Proceedings of the National Academy of Sciences of the United States of America 101:13613-13617

PAGE 127

114 124. Huang H, Regan KM, Wang F, Wang D, Smith DI, van Deursen JM, Tindall DJ 2005 Skp2 inhibits FOXO1 in tumor suppression through ubiquitin-mediated degradation. Proc Natl Acad Sci U S A 102:1649-1654 125. Ramaswamy S, Nakamura N, Sansal I, Bergeron L, Sellers WR 2002 A novel mechanism of gene regulation and tumor suppression by the transcription factor FKHR. Cancer Cell 2:81-91 126. Calnan DR, Brunet A 2008 The FoxO code. Oncogene 27:2276-2288 127. Castrillon DH, Miao L, Kollipara R, Horner JW, DePinho RA 2003 Suppression of ovarian follicle activation in mice by the transcription factor Foxo3a. Science 301:215-218 128. Hosaka T, Biggs WH, 3rd, Tieu D, Boyer AD, Varki NM, Cavenee WK, Arden KC 2004 Disruption of forkhead transcription factor (FOXO) family members in mice reveals their functional diversification. Proceedings of the National Academy of Sciences of the United States of America 101:2975-2980 129. Furuyama T, Kitayama K, Shimoda Y, Ogawa M, Sone K, Yoshida-Araki K, Hisatsune H, Nishikawa S, Nakayama K, Nakayama K, Ikeda K, Motoyama N, Mori N 2004 Abnormal angiogenesis in Foxo1 (Fkhr)-deficient mice. J Biol Chem 279:34741-34749 130. Arden KC 2007 FoxOs in tumor suppression and stem cell maintenance. Cell 128:235-237 131. Davis RJ, D'Cruz CM, Lovell MA, Biegel JA, Barr FG 1994 Fusion of PAX7 to FKHR by the variant t(1;13)(p36;q14) translocation in alveolar rhabdomyosarcoma. Cancer Res 54:2869-2872 132. Galili N, Davis RJ, Fredericks WJ, Mukhopadhyay S, Rauscher FJ, 3rd, Emanuel BS, Rovera G, Barr FG 1993 Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet 5:230-235 133. Trotman LC, Alimonti A, Scaglioni PP, Koutcher JA, Cordon-Cardo C, Pandolfi PP 2006 Identification of a tumour suppressor network opposing nuclear Akt function. Nature 441:523-527

PAGE 128

115 134. Seoane J, Le HV, Shen L, Anderson SA, Massague J 2004 Integration of Smad and forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation. Cell 117:211-223 135. Bouchard C, Marquardt J, Bras A, Medema RH, Eilers M 2004 Myc-induced proliferation and transformation require Akt-mediated phosphorylation of FoxO proteins. Embo J 23:2830-2840 136. Yang H, Zhao R, Yang HY, Lee MH 2005 Constitutively active FOXO4 inhibits Akt activity, regulates p27 Kip1 stability, and suppresses HER2-mediated tumorigenicity. Oncogene 24:1924-1935 137. Paik JH, Kollipara R, Chu G, Ji H, Xiao Y, Ding Z, Miao L, Tothova Z, Horner JW, Carrasco DR, Jiang S, Gilliland DG, Chin L, Wong WH, Castrillon DH, DePinho RA 2007 FoxOs are lineage-restricted redundant tumor suppressors and regulate endothelial cell homeostasis. Cell 128:309-323 138. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray T, Thun MJ 2008 Cancer statistics, 2008. CA: a cancer journal for clinicians 58:71-96 139. Savarese DM, Halabi S, Hars V, Akerley WL, Taplin ME, Godley PA, Hussain A, Small EJ, Vogelzang NJ 2001 Phase II st udy of docetaxel, estramustine, and low-dose hydrocortisone in men with hormone-refractory prostate cancer: a final report of CALGB 9780. Cancer and Leukemia Group B. J Clin Oncol 19:2509-2516 140. Wu CP, Gu FL 1991 The prostate in eunuchs. Prog Clin Biol Res 370:249-255 141. Pollard M, Luckert PH, Sporn MB 1991 Prevention of primary prostate cancer in Lobund-Wistar rats by N-(4-hydroxyphenyl)retinamide. Cancer Res 51:3610-3611 142. Pollard M, Luckert PH 1991 The inhibitory effect of 4-hydroxyphenyl retinamide (4-HPR) on metastasis of prostate adenocarcinoma-III cells in Lobund-Wistar rats. Cancer Lett 59:159-163 143. Stanbrough M, Leav I, Kwan PW, Bubley GJ, Balk SP 2001 Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium. Proceedings of the National Academy of Sciences of the United States of America 98:10823-10828

PAGE 129

116 144. Giovannucci E, Stampfer MJ, Krithivas K, Brown M, Dahl D, Brufsky A, Talcott J, Hennekens CH, Kantoff PW 1997 The CAG repeat within the androgen receptor gene and its relationship to prostate cancer. Proceedings of the National Academy of Sciences of the United States of America 94:3320-3323 145. Bratt O, Borg A, Kristoffersson U, Lundgren R, Zhang QX, Olsson H 1999 CAG repeat length in the androgen receptor gene is related to age at diagnosis of prostate cancer and response to endocrine therapy, but not to prostate cancer risk. Br J Cancer 81:672-676 146. Hardy DO, Scher HI, Bogenreider T, Sabbatini P, Zhang ZF, Nanus DM, Catterall JF 1996 Androgen receptor CAG repeat lengths in prostate cancer: correlation with age of onset. J Clin Endocrinol Metab 81:4400-4405 147. Nam RK, Elhaji Y, Krahn MD, Hakimi J, Ho M, Chu W, Sweet J, Trachtenberg J, Jewett MA, Narod SA 2000 Significance of the CAG repeat polymorphism of the androgen receptor gene in prostate cancer progression. The Journal of urology 164:567-572 148. Visakorpi T, Hyytinen E, Koivisto P, Tanner M, Keinanen R, Palmberg C, Palotie A, Tammela T, Isola J, Kallioniemi OP 1995 In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nature genetics 9:401-406 149. Koivisto P, Kononen J, Palmberg C, Tammela T, Hyytinen E, Isola J, Trapman J, Cleutjens K, Noordzij A, Visakorpi T, Kallioniemi OP 1997 Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer research 57:314-319 150. Linja MJ, Savinainen KJ, Saramaki OR, Tammela TL, Vessella RL, Visakorpi T 2001 Amplification and overexpression of androgen receptor gene in hormone-refractory prostate cancer. Cancer research 61:3550-3555 151. Buchanan G, Greenberg NM, Scher HI, Harris JM, Marshall VR, Tilley WD 2001 Collocation of androgen receptor gene mutations in prostate cancer. Clin Cancer Res 7:1273-1281

PAGE 130

117 152. Ittmann MM 1998 Chromosome 10 alterations in prostate adenocarcinoma (review). Oncol Rep 5:1329-1335 153. Abate-Shen C, Shen MM 2000 Molecular genetics of prostate cancer. Genes Dev 14:2410-2434 154. Feilotter HE, Nagai MA, Boag AH, Eng C, Mulligan LM 1998 Analysis of PTEN and the 10q23 region in primary prostate carcinomas. Oncogene 16:1743-1748 155. McMenamin ME, Soung P, Perera S, Kaplan I, Loda M, Sellers WR 1999 Loss of PTEN expression in paraffin-embedded primary prostate cancer correlates with high Gleason score and advanced stage. Cancer Res 59:4291-4296 156. Wang S, Gao J, Lei Q, Rozengurt N, Pritchard C, Jiao J, Thomas GV, Li G, Roy-Burman P, Nelson PS, Liu X, Wu H 2003 Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell 4:209-221 157. Gao N, Zhang Z, Jiang BH, Shi X 2003 Role of PI3K/AKT/mTOR signaling in the cell cycle progression of human prostate cancer. Biochemical and biophysical research communications 310:1124-1132 158. Davies MA, Koul D, Dhesi H, Berman R, McDonnell TJ, McConkey D, Yung WK, Steck PA 1999 Regulation of Akt/PKB activity, cellular growth, and apoptosis in prostate carcinoma cells by MMAC/PTEN. Cancer Res 59:2551-2556 159. Murillo H, Huang H, Schmidt LJ, Smith DI, Tindall DJ 2001 Role of PI3K signaling in survival and progression of LNCaP prostate cancer cells to the androgen refractory state. Endocrinology 142:4795-4805 160. Malik SN, Brattain M, Ghosh PM, Troyer DA, Prihoda T, Bedolla R, Kreisberg JI 2002 Immunohistochemical demonstration of phospho-Akt in high Gleason grade prostate cancer. Clin Cancer Res 8:1168-1171 161. Kreisberg JI, Malik SN, Prihoda TJ, Bedolla RG, Troyer DA, Kreisberg S, Ghosh PM 2004 Phosphorylation of Akt (Ser473) is an excellent predictor of poor clinical outcome in prostate cancer. Cancer Res 64:5232-5236 162. Lin J, Adam RM, Santiestevan E, Freeman MR 1999 The phosphatidylinositol 3'-kinase pathway is a dominant growth factor-activated cell survival pathway in LNCaP human prostate carcinoma cells. Cancer Res 59:2891-2897

PAGE 131

118 163. Li P, Nicosia SV, Bai W 2001 Antagonism between PTEN/MMAC1/TEP-1 and androgen receptor in growth and apoptosis of prostatic cancer cells. J Biol Chem 276:20444-20450 164. Li P, Lee H, Guo S, Unterman TG, Jenster G, Bai W 2003 AKT-independent protection of prostate cancer cells from apoptosis mediated through complex formation between the androgen receptor and FKHR. Mol Cell Biol 23:104-118 165. Huang H, Muddiman DC, Tindall DJ 2004 Androgens negatively regulate forkhead transcription factor FKHR (FOXO1) through a proteolytic mechanism in prostate cancer cells. J Biol Chem 279:13866-13877 166. Lehtinen MK, Yuan Z, Boag PR, Yang Y, Villen J, Becker EB, DiBacco S, de la Iglesia N, Gygi S, Blackwell TK, Bonni A 2006 A conserved MST-FOXO signaling pathway mediates oxidative-stress responses and extends life span. Cell 125:987-1001 167. Kasper S, Rennie PS, Bruchovsky N, Sheppard PC, Cheng H, Lin L, Shiu RP, Snoek R, Matusik RJ 1994 Cooperative binding of androgen receptors to two DNA sequences is required for androgen induction of the probasin gene. J Biol Chem 269:31763-31769 168. Powzaniuk M, McElwee-Witmer S, Vogel RL, Hayami T, Rutledge SJ, Chen F, Harada S, Schmidt A, Rodan GA, Freedman LP, Bai C 2004 The LATS2/KPM tumor suppressor is a negative regulator of the androgen receptor. Mol Endocrinol 18:2011-2023 169. Dutertre M, Smith CL 2003 Ligand-independent interactions of p160/steroid receptor coactivators and CREB-binding protein (CBP) with estrogen receptor-alpha: regulation by phosphorylation sites in the A/B region depends on other receptor domains. Mol Endocrinol 17:1296-1314 170. Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA 1996 Mechanism of activation of protein kinase B by insulin and IGF-1. Embo J 15:6541-6551 171. Jiang H, Nucifora FC, Jr., Ross CA, DeFranco DB 2003 Cell death triggered by polyglutamine-expanded huntingtin in a neuronal cell line is associated with degradation of CREB-binding protein. Hum Mol Genet 12:1-12

PAGE 132

119 172. Modur V, Nagarajan R, Evers BM, Milbrandt J 2002 FOXO proteins regulate tumor necrosis factor-related apoptosis inducing ligand expression. Implications for PTEN mutation in prostate cancer. J Biol Chem 277:47928-47937 173. Ramaswamy S, Nakamura N, Vazquez F, Batt DB, Perera S, Roberts TM, Sellers WR 1999 Regulation of G1 progression by the PTEN tumor suppressor protein is linked to inhibition of the phosphatidylinos itol 3-kinase/Akt pathway. Proceedings of the National Academy of Sciences of the United States of America 96:2110-2115 174. McEwan IJ 2004 Molecular mechanisms of androgen receptor-mediated gene regulation: structure-function analysis of the AF-1 domain. Endocr Relat Cancer 11:281-293 175. Bello D, Webber MM, Kleinman HK, Wartinger DD, Rhim JS 1997 Androgen responsive adult human prostatic epithelia l cell lines immortalized by human papillomavirus 18. In: Carcinogenesis; 1215-1223 176. Zhao HH, Herrera RE, Coronado-Heinsohn E, Yang MC, Ludes-Meyers JH, Seybold-Tilson KJ, Nawaz Z, Yee D, Barr FG, Diab SG, Brown PH, Fuqua SA, Osborne CK 2001 Forkhead homologue in rhabdomyosarcoma functions as a bifunctional nuclear receptor-interacting protein with both coactivator and corepressor functions. J Biol Chem 276:27907-27912 177. Gregory CW, He B, Johnson RT, Ford OH, Mohler JL, French FS, Wilson EM 2001 A mechanism for androgen receptor-mediated prostate cancer recurrence after androgen deprivation therapy. Cancer Res 61:4315-4319 178. Dong XY, Chen C, Sun X, Guo P, Vessella RL, Wang RX, Chung LW, Zhou W, Dong JT 2006 FOXO1A is a candidate for the 13q14 tumor suppressor gene inhibiting androgen receptor signaling in prostate cancer. Cancer Res 66:6998-7006 179. Fan W, Yanase T, Morinaga H, Okabe T, Nomura M, Daitoku H, Fukamizu A, Kato S, Takayanagi R, Nawata H 2007 Insulin-like growth factor 1/insulin signaling activates androgen signaling through direct interactions of Foxo1 with androgen receptor. J Biol Chem 282:7329-7338

PAGE 133

120 180. Thompson J, Saatcioglu F, Janne OA, Palvimo JJ 2001 Disrupted aminoand carboxyl-terminal interactions of the androgen receptor are linked to androgen insensitivity. Molecular endocrinology (Baltimore, Md 15:923-935 181. Ghali SA, Gottlieb B, Lumbroso R, Beitel LK, Elhaji Y, Wu J, Pinsky L, Trifiro MA 2003 The use of androgen receptor amino/carboxyl-terminal interaction assays to investigate androgen receptor gene mutations in subjects with varying degrees of androgen insensitivity. The Journal of clinical endocrinology and metabolism 88:2185-2193 182. Shen HC, Buchanan G, Butler LM, Prescott J, Henderson M, Tilley WD, Coetzee GA 2005 GRIP1 mediates the interaction between the aminoand carboxyl-termini of the androgen receptor. Biol Chem 386:69-74 183. Hsu CL, Chen YL, Ting HJ, Lin WJ, Yang Z, Zhang Y, Wang L, Wu CT, Chang HC, Yeh S, Pimplikar SW, Chang C 2005 Androgen receptor (AR) NH2and COOH-terminal interactions result in the differential influences on the AR-mediated transactivation and cell growth. Mol Endocrinol 19:350-361 184. Chang CY, McDonnell DP 2002 Evaluation of ligand-dependent changes in AR structure using peptide probes. Mol Endocrinol 16:647-660 185. Kemppainen JA, Langley E, Wong CI, Bobseine K, Kelce WR, Wilson EM 1999 Distinguishing androgen receptor agonists and antagonists: distinct mechanisms of activation by medroxyprogesterone acetate and dihydrotestosterone. Mol Endocrinol 13:440-454 186. Larsen PL, Albert PS, Riddle DL 1995 Genes that regulate both development and longevity in Caenorhabditis elegans. Genetics 139:1567-1583 187. Ogg S, Ruvkun G 1998 The C. elegans PTEN homolog, DAF-18, acts in the insulin receptor-like metabolic signaling pathway. Mol Cell 2:887-893 188. Nan B, Snabboon T, Unni E, Yuan XJ, Whang YE, Marcelli M 2003 The PTEN tumor suppressor is a negative modulator of androgen receptor transcriptional activity. J Mol Endocrinol 31:169-183

PAGE 134

121 189. Xin L, Teitell MA, Lawson DA, Kwon A, Mellinghoff IK, Witte ON 2006 Progression of prostate cancer by synergy of AKT with genotropic and nongenotropic actions of the androgen receptor. Proceedings of the National Academy of Sciences of the United States of America 103:7789-7794 190. Taplin ME, Balk SP 2004 Androgen receptor: a key molecule in the progression of prostate cancer to hormone independence. J Cell Biochem 91:483-490 191. Jiao J, Wang S, Qiao R, Vivanco I, Watson PA, Sawyers CL, Wu H 2007 Murine cell lines derived from Pten null prostate cancer show the critical role of PTEN in hormone refractory prostate cancer development. Cancer Res 67:6083-6091 192. Kemppainen JA, Lane MV, Sar M, Wilson EM 1992 Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. Specificity for steroids and antihormones. J Biol Chem 267:968-974 193. Greer EL, Brunet A 2005 FOXO transcription factors at the interface between longevity and tumor suppression. Oncogene 24:7410-7425 194. Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA 1995 Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378:785-789 195. Inoki K, Li Y, Zhu T, Wu J, Guan KL 2002 TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nature cell biology 4:648-657

PAGE 135

About the Author Qiuping Ma received her M.D. degree in Beijing Medical University, China in 1997 and a M.S. in Gynecologic Oncology fr om Sun Yat-sen University of Medical Sciences, China in 2001. She was a resident in the Department of Internal Medicine of the Second Affiliated Hospital of Guangdong Medical School from 1997-1998 and the Department of Ob/Gyn of the Sun Yat-sen Memorial Hospital from 1998-2002. Ma entered the Ph.D. program at Dr. Wenlong Bais laboratory in the department of Pathology and Cell Biology at the University of South Florida in 2002. She has several publications and participated in the 90th Annual Meeting of the Endocrinology in 2008. She is a member of the American Cancer Association and the Endocrine Society, repectively.