USF Libraries
USF Digital Collections

Microarray analysis of Streptococcus mutans and Actinomyces viscosus in homologous and heterologous culture

MISSING IMAGE

Material Information

Title:
Microarray analysis of Streptococcus mutans and Actinomyces viscosus in homologous and heterologous culture
Physical Description:
Book
Language:
English
Creator:
Horton, Steven Andrew
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
RNA isolation
Hybridization
Procedure development
Gene expression
Bacterial interaction
Dissertations, Academic -- Biology -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: The oral pathogen Streptococcus mutans is a known etiological agent for dental root decay and coronal caries. It has been hypothesized, but not yet proven, that S. mutans expression of virulence genes in dental plaque may be influenced by its interaction with co-aggregating partners, notably Fusobacterium nucleatum and Actinomyces viscosus. Investigation of the suitability of mixed cultures of S. mutans with F. nucleatum versus S. mutans with A. viscosus proved that A. viscosus was a better target in the present laboratory setting. Furthermore, A. viscosus, a causative agent of mandible osteomyelitis and endocarditis, has been shown to have direct interaction ability with S. mutans. DNA microarray analysis was used in the present study to investigate the influence of co-aggregation with A. viscosus on the expression of S. mutans genes. Microarrays have been used successfully in the analysis of differential gene expression in S. mutans as a function of culture conditions, such as in biofilms versus planktonic states. This technology however, has not yet been applied to the analysis of homologous versus heterologous cultures. The present study was conducted in order to identify potential problems associated with the application of microarray analysis to mixed cultures. The data obtained encourage the further testing of microarrays for the analysis of heterologous cultures of oral bacteria.
Thesis:
Thesis (M.S.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Steven Andrew Horton.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 96 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002001092
oclc - 319538101
usfldc doi - E14-SFE0002570
usfldc handle - e14.2570
System ID:
SFS0026887:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam Ka
controlfield tag 001 002001092
003 fts
005 20090428140156.0
006 m||||e|||d||||||||
007 cr mnu|||uuuuu
008 090428s2008 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002570
035
(OCoLC)319538101
040
FHM
c FHM
049
FHMM
090
QH307.2 (Online)
1 100
Horton, Steven Andrew.
0 245
Microarray analysis of Streptococcus mutans and Actinomyces viscosus in homologous and heterologous culture
h [electronic resource] /
by Steven Andrew Horton.
260
[Tampa, Fla] :
b University of South Florida,
2008.
500
Title from PDF of title page.
Document formatted into pages; contains 96 pages.
502
Thesis (M.S.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
3 520
ABSTRACT: The oral pathogen Streptococcus mutans is a known etiological agent for dental root decay and coronal caries. It has been hypothesized, but not yet proven, that S. mutans expression of virulence genes in dental plaque may be influenced by its interaction with co-aggregating partners, notably Fusobacterium nucleatum and Actinomyces viscosus. Investigation of the suitability of mixed cultures of S. mutans with F. nucleatum versus S. mutans with A. viscosus proved that A. viscosus was a better target in the present laboratory setting. Furthermore, A. viscosus, a causative agent of mandible osteomyelitis and endocarditis, has been shown to have direct interaction ability with S. mutans. DNA microarray analysis was used in the present study to investigate the influence of co-aggregation with A. viscosus on the expression of S. mutans genes. Microarrays have been used successfully in the analysis of differential gene expression in S. mutans as a function of culture conditions, such as in biofilms versus planktonic states. This technology however, has not yet been applied to the analysis of homologous versus heterologous cultures. The present study was conducted in order to identify potential problems associated with the application of microarray analysis to mixed cultures. The data obtained encourage the further testing of microarrays for the analysis of heterologous cultures of oral bacteria.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor: My Lien Dao, Ph.D.
653
RNA isolation
Hybridization
Procedure development
Gene expression
Bacterial interaction
690
Dissertations, Academic
z USF
x Biology
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2570



PAGE 1

Microarray Analysis of Streptococcus mutans and Actinomyces viscosus in Homologous and Heterologous Cultures by Steven Andrew Horton A thesis submitted in partial fulfillment o f the requirements for the degree of Master of Science Department of Bi ology College of Arts and Sciences University of South Florida Major Professor: My Lien Dao, Ph.D. Daniel Lim, Ph.D. Kristina Schmidt, Ph.D. Date of Approval: July 15, 2008 Keywords: RNA isolation, hybridization, procedure development, gene expressi on, bacterial interaction Copyright 2008 Steven Horton

PAGE 2

This manuscript is dedicated to my wife and family.

PAGE 3

ACKNOWLEDGEMENTS I would like to acknowledge the members of my committee, Drs. My Lien Dao, Daniel Lim and Kristina Schmidt for t he guidance and patience they provided during the writing of this thesis and for the encouragement along the way. I would also like to acknowledge Sean Yoder and the Microarray Core Facility at Moffitt Cancer Center for their support with the microarray p rocedure and scanning processes. The J. Craig Venter Institute/The Institute for Genomic Research (Rockville, MD) is much appreciated for providing the opportunity to take on this project by providing the Streptococcus mutans gene chips and software for d ata analysis During this project, Dr. L indsey Shaw has been a tremendous help and source of encouragement, and deserves my thanks Finally, I would like to thank Dr. Thomas Han (Dana Farber Cancer Institute, Harvard Medical School Boston, MA) for the h elp he generously provided with protein immunogenicity analysis.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES i v LIST OF FIGURES v ABSTRACT v i BACKGROUND 1 RESEARCH DESIGN AND METHODS 9 Bacterial Strains and Culture Conditions 9 Chem icals and Reagents 9 Analysis of the Influence of Co aggregating Bacteria on the expression of S. mutans Virulence Factors 10 Development of S. mutans F. nucleatum Co aggregates 10 Development of S. mutans A. viscosus Co aggregates 1 2 DNA sequencing 1 2 Purification of Plasmid DNA from E. coli 13 Gene Amplification by the Polymerase Chain Reaction (PCR) 13 Agarose Gel Electrophoresis 14 Sequence Alignment and Protein Characterization 1 4 Potential Protein Immuno genicity 15 RNA Isolation and Purification 1 6 RNA Extraction Using Hot Acidic Phenol 16 Modified DNA Protocol 17 Ajdic and Pham Method 18

PAGE 5

ii Purification of Extracted RNA 20 Microarray Labeling 21 Microarray Hybridization 2 3 Microarray Description and Analysis 2 6 TIGR Spotfinder 2 7 TIGR Microarray Data Analysis System ( MIDAS ) 2 8 RESULTS 29 Development of F. nucleatum Culture Conditions 29 Development of S. mutans F. nucleatum Coaggregates 30 Establishment of S. mutans A. viscosus Coaggregates 30 DNA sequence analysis of smcol 2 31 26 Alignment of the deduced amino acid sequence of SmCol 2 of S. mutans GS 5 with that of SMU.759 of S. mutans UA 159 34 2 9 Analysis of SmC ol 2 Potential Immunogenicity 35 Microarray Analysis of S. mutans Monoculture and S. mutans A. viscosus Mixed Culture 36 31 RNA Isolation 37 32 Reverse Transcriptio n and Microarray Hybridization 4 1 Scanning of Hybridized Arrays 43 Data Analysis of Gene Expression, Mixed versus Mono Bacterial Cultures 45 DISCUSSION 51 REFERENCES 61

PAGE 6

iii APPENDICES 66 54 Appendix I. Microarray Data SM/MIX2 67 55

PAGE 7

iv LIST OF TABLES TABLE 1. PCR Conditions for smcol2 Amplification 13 TABLE 2. Putative epitopes in Smcol 2 3 6 TABLE 3 Example Hot Phenol Extraction Results 3 8 TABLE 4 Example Ri boPure Kit Extraction Results 40 TABLE 5 Example RNA Reverse Transcription and Labeling Data 43 TABLE 6 Upregulated S. mutans Genes from Mixed Culture 47 TABLE 7. Downregulated S. mutans Genes from Mixed Culture 48 TABLE 8. Downregulated Virulence Genes 49

PAGE 8

v LIST OF FIGURES FIGURE 1. Staining of S. mutans and F. nucleatum aggregates by the USF D method 32 FIGURE 2. DNA Sequence of smcol2 Insert 34 FIGURE 3. Deduced SmCol 2 Protein Sequence A lignment 35 FIGURE 4. Immunogenicity Plot 3 6 FIGURE 5. Agar ose Gel of Degraded Total RNA 38 FIGURE 6. Agaro se Gel Partially Degraded RNA 40 FIGURE 7. Hybridized Microarrays 4 5

PAGE 9

vi MICROARRAY ANALYSIS OF STREPTOCOCCUS MUTANS AND ACTINOMYCES VISCOSUS IN HOMOLOGOUS AND HETEROL OGOUS CULTURES Steven Horton ABSTRACT The oral pathogen Streptococcus mutans is a known etiological agent for dental root decay and coronal caries. It has been hypothesized, but not yet proven, that S. mutans expression of virulence genes in dental p laque may be influenced by its interaction with co aggregating partners, notably Fusobacterium nucleatum and Actinomyces viscosus Investigation of the suitability of mixed cultures of S. mutans with F. nucleatum versus S. mutans with A. viscosus proved t hat A. viscosus was a better target in the present laboratory setting. Furthermore, A. viscosus, a causative agent of mandible osteomyelitis and endocarditis, has been shown to have direct interaction ability with S. mutans DNA microarray analysis was u sed in the present study to investigate the influence of co aggregation with A. viscosus on the expression of S. mutans genes. Microarrays have been used successfully in the analysis of differential gene expression in S. mutans as a function of culture co nditions, such as in biofilms versus

PAGE 10

vii planktonic states. This technology however, has not yet been applied to the analysis of homologous versus heterologous cultures. The present study was conducted in order to identify potential problems associated with the application of microarray analysis to mixed cultures. The data obtained encourage the further testing of microarrays for the analysis of heterologous cultures of oral bacteria.

PAGE 11

1 BACKGROUND Streptococcus mutans is a proven prin cipal organism in dental plaque and is a causative agent of both coronal caries and root caries (54) S. mutans has been isolated from carious lesions and sites of root degradation (54, 58) and shown to express a multitude of factors contributing to its pathogenicity. For instance factors contribu ting to tooth colonization include surface proteins binding to salivary glycoproteins in tooth pellicle, glucan synthesizing and glucan binding proteins (20, 51) fimbrial attachments and biofilm formation (17) collagen binding (53) and collagen degradin g activity (25) S. mutans is found in dental plaque, a multigenic dental biofilm. The role of biofilm fo rmation in caries disease is a known requisite and more than 500 bacterial species are found in dental plaque (43) Oral biofilms are multi specie s, multilayered aggregations of bacteria joined together by an assortment of carbohydrate and pro tein links. These oral bacteria adopt a variety of roles within the biofilm community, being essential for individual survival as well as functioning as a coo perative consortium (14) In nature, bacteria grow most successfu lly as a community of aggregated cells. This growth pattern,

PAGE 12

2 while relatively new to scientific study, is the manner in which many microorganisms have evolved and survived through the millennia (14) Bacteria growing as biofilms obtain certain advantages such as having increased survivorship against antibiotics as comp ared to planktonic bacteria (39) and increased protection from host immune defense (9) Changes in virulence of bacteria involved in oral biofi lms (plaques) is attributed to changes in gene expression (47) In the process of tooth colonization and biofilm formation, S. mutans up regulates the expression of a group of glucosyltransferases enzymes catalyzing soluble and insoluble glucan synthesis (59) Production of water insoluble glu can polymers is responsible for the tight adherence of the bacteria to the enamel surface, following the initial attachment of oral streptococci to salivary pellicle, a matrix formed by an assortment of salivary proteins, food debris, and bacterial by prod ucts (14, 15) This sets the framework for other bacteria to aggregate onto the initial colonizers and build up the bacterial community in biofilm (59) These initial colonizers are then joined by bridge' organisms to a broad array of other oral bacteria, designated late colonizers (29) The bridge organisms, among which Fusobacterium nucleatum is a key connector of S. mutans with the late colonizers, appear to create favorable microenvironments inside the biofilm for species with varying oxygen tolerance (8) Late colonizers also join the community via their

PAGE 13

3 interaction s with both initial and bridge organisms (14) Within the bacterial community, commu nication between aggregated members of the same species and between co aggregated inter bacterial species takes place and is presumed to enhance biofilm development as well to mediate a communal response to external stimuli (29) Direct contact, as seen with Fusobacterium species and Streptococcus forming corn cob like structures provides an interesting model of co aggregation and bacterial interaction (29) Additionally, other forms of metabolic communication may exist in dental plaque. Increased production of lactic acid, a normal byproduct of cellular metabolic activity ter med acidogenesis, is an example of enhanced cariogenicity as a function of communal bacterial activities (6, 13) A further understanding of gene expression as a function of inter species coaggregation between pathogenic oral bacteria in dental plaque is a key step towards the developme nt of methods to prevent and treat diseases associated with bacterial activities in biofilms. S. mutans, F. nucleatum and A. viscosus are three bacteria commonly found in dental plaques isolated from human carious lesions, both of the root and of the tooth surface (1, 7, 19, 41, 57) While the virulence factors of these organisms have been extensively analyzed in monocult ures, the effects that these oral pathogens have on each other have yet to be determined.

PAGE 14

4 Previous studies of A. viscosus a Gram positive rod associated with oral and cardiac disease, showed that this organism caused carious lesions in the presence or absence of S. mutans in gnotobiotic rat models (52) It has also been shown to directly cause the formation of carious lesions in human dental root sections in in vitro studies (27) With the utilization of glycogen as a carbohydrate storage molecule, Actinomyces spp. are able to maintain a localized acidic pH and promote carious lesion by the continuou s production of acid (31) Fusobacterium nucleatum a kn own agent of periodontal disease (37) is also found in carious dentin sites from patient samples (23) As previously mentioned, this b acterium plays a significant role in biofilm formation due to its expansive interspecies binding abilities. It has been shown to aggregate with the vast majority of oral genera, including Streptoccocus and Actinomyces spp (30) Dental root decay, or root caries, occurs after gum lin e recession and the subsequent exposure of dentin, a tissue rich in collagen type I, which then becomes susceptible to degradation by bacterial collagenases (16) Collagenolytic activity in pathogenic bacteria was originally characterized in Clostridium histolyticum which produces a number of zinc metalloproteases (26) The initial discovery of C. histolyticum collagenase, ColH, aided in the understanding the role of bacteria in root car ies by unveiling a key virulence factor responsible

PAGE 15

5 for the degradation of structural collagen, creating an open lesion for further bacterial attack and spreading. S. mutans was subsequently observed to have collagen binding properties (53) as well as collagenolytic activity (25) S. mutans collagenolytic activity was first observed by Rosengren et al. (46) in 1976. In the Dao laboratory, S. mutans collagenolytic activity was further characterized in 1997. S. mutans was proven to degrade FALGPA, a synthetic peptide mimicking collagen substrate, and th e bacteria were able to migrate through the collagen Type I containing placental tissue in in vitro studies (25) Later the S. mutans wall associated protein A, (WapA) was found to have a collagen binding region, and demonstrated to display a specific collagen binding activity (21) A dditionally, two putative collagenase genes from S. mutans GS 5, designated smcol 1 and smol 2, were cloned into pET/100 D and pBAD TOPO TA vectors (Invitrogen) and the recombinant proteins were confirmed to have the ability to degrade both denatured and native collagen fibrils (24) ). While the genomic analysis of smcol 1 w as completed and a rabbit antibody was prepared against the protein, the DNA sequence analysis of smcol2 has yet to be performed for comparison of both the gene and deduced amino acid sequence between S. mutans strain GS 5 and strain

PAGE 16

6 UA159, of which the wh ole genomic sequence has been established and widely used as a reference cariogenic strain (2) To study how bacteria in mixed aggregates behave because of their interaction, one approach is to analyze their gene expression in homologous versus heterologous cultures. Microarray technology became prominent in the scientific commu nity in the early 2000s, and redesigned the way genetic analysis is approached. The mass sampling ability of microarrays can offer insights at the genomic and transcriptomic levels, into events occurring in a given organism under specified perturbation. DNA microarray technology is based on nucleic acid nucleic acid hybridization, with one strand being fixed to a stationary surface, usually glass or silicon (18) Trad itionally, DNA arrays are microscope slides coated with a poly lysine, amino silane, or amino reactive layer to increase both slide surface hydrophobicity and strength of the bonded DNA ( 48) The non stationary strand, often referred to as "the target", is labeled with a fluorescent marker, and then allowed to pair with identical strands on the array, and the number of labeled strands bound at a particular spot can be quantified with a f luorescent array scanner (18) The numbers of probes, bound to the surface of the array, can be as many as tens of thousands, allowing very dense arrays to monitor every open reading fra me (ORF) in a genome. By collecting RNA, or mRNA from a culture of cells,

PAGE 17

7 labeling it and hybridizing it to the bound probes, a snap shot can be taken of the global expression levels of each gene in the genome. Currently, researchers use microarrays for a variety of purposes, from profiling gene expression difference in several cancer lines (5) to w ater quality analysis (35) investigating evolutionary inheritance using single nucleotide polymorphisms (55) to using newly developed protein arrays for kinase substrate identification (36) While differential expression analysis of S. mutans has been successfully perf ormed in the past, mostly between biofilm and planktonic stages (50) it is not yet known if the method could be applied to the analysis of S. mutans in mixed culture. Beside the S. mutans gene chips and so ftware needed for the performance of microarray data analysis that can be obtained from the J. Craig Venter Institute (JVCI), formerly The Institute for Genomic Research (TIGR) (Rockville, MD), other necessary elements need to be considered including (1) s election of a coaggregating partner for S. mutans that is amenable to in vitro studies in existing laboratory settings; (2) identification of known S. mutans virulence factors for use as controls in order to validate anticipated microarray data. The specific aim of the present study was to investigate whether or not microarray analysis could be applied to detect the influence of co

PAGE 18

8 aggregating bacteria on the expression of S. mutans virulence factors. Toward this aim, three tasks have been identifie d as follows: 1. Identification of a co aggregating partner for microarray analysis 2. Identification of virulence factors to use as references to validate microarray data 3. Performance of microarray analysis

PAGE 19

9 RESEARCH DESIGN AND METHODS Bacterial S trains an d C ulture C onditions S. mutans UA159 and A. viscosus 31647 were obtained from American Type Culture Collection (Manassas, VA), and were cultured in Bacto BHI broth (Sigma) at 5% CO 2 F. nucleatum strain 25586 was obtained from the American Type Cultur e Collection ( ATCC ) and was cultured in ATCC media 1490 Modified chopped meat media at 15% CO 2 Chemicals and Reagents RNEasy RNA Mini kit and MinElute PCR Purification kits were obtained from Qiagen Inc. (Valencia, CA) and used in accordance with manufacturers protocols. Superscript III Reverse Transcriptase, RNaseOUT Recombinant Ribonuclease Inhibitor, Random Hexamers and 100mM dNTP set PCR grade were used for reverse transcription and were obtained from Invitrogen Life Technologies (Carlsbad, CA) Cy3 and Cy5 mono Reactive Dye Packs were obtained from Amersham Biosciences/GE Healthcare (Piscataway, NJ). The 5 (3 aminoallyl) dUTP set was obtained from Sigma Aldrich Co. (St. Louis, MO) and

PAGE 20

10 was used during reverse transcription. All other reagents w ere obtained from Fisher Scientific (Pittsburg, PA) or Ambion (Austin, TX) unless otherwise specified. Analysis of the I nfluence of C o aggregating B acteria on the E xpression of S. mutans V irulence F actors Aggregating bacteria in the oral cavity are r esponsible for dental disease. Since S. mutans gene expression differed between the planktonic and biofilm stages, it is speculated that differential gene expression in multigenic bacterial community should also be present. While co aggregation of dental plaque bacteria was demonstrated in in vitro studies, not much is known in regard to whether or not a change in gene expression occurred in this process. In order to ultimately be able to study community gene expression in dental plaque and identify the expression of cariogenic determinants, a preliminary study was conducted to evaluate S. mutans in vitro co aggregation with a known bacterial partner in dental plaque. The bacteria tested included F. nucleatum and A. viscosus Development of S. mutans F. nucleatum Co aggregates S. mutans GS 5 and F. nucleatum 25586, respectively an early colonizer and a bridge colonizer, were cultured separately or together,

PAGE 21

11 and observed for the formation of aggregates. Bacteria were cultured in Brain Heart Infusion ( BHI) broth supplemented with 2% sucrose, a condition known to promote homologous S. mutans aggregation. One hundred ml of each of an overnight culture of S. mutans and F. nucleatum were used to inoculate separately and together 50 ml of BHI+S The cultur es were incubated in an anaerobic jar with BD GasPak TM EZ, Anaerobe container system with indicator and in a 5% CO 2 incubator at 37 o C T he tubes were periodically observed for the formation of aggregates in monocultures and co aggregates in mixed cultures Ten ml of each cell suspension were then applied to a microscope slide and stained by the USF D stain consisting of Ponceau S and Stains all dyes (USF Patented ) for observation at X400 magnification. This method was selected due to the ability of the d ye Stains all to form a stable complex with Ponceau S and to differentially stain various macromolecule (49) thus a llowing the detection of aggregates of different composition. Differences in bacterial aggregate depth and coloration between the three samples ( S. mutans aggregates, F. nucleatum aggregates, and the S. mutans F. nucleatum co aggregates) were anticipated to indicate the result of differential gene expression.

PAGE 22

1 2 Development of S. mutans A. viscosus C oaggregates S. mutans UA159 and A viscosus 31647 was obtained from American Type Culture Collection (Manassas, VA), and were cultured in Bacto BHI broth at 5% CO 2 Individual overnight cultures were centrifuged at 3,220 x g using an Eppendorf 5810 R centrifuge for five minutes, and the pellet was cultured for four hours in 40 ml of fresh BHI broth. The cultures were centrifuged again and the bacterial pell et was cultured a second time in 40 ml fresh medium for four hours. After the second incubation, the bacterial cells were centrifuged, decanted and re suspended in fresh BHI. Each individual culture was then split in order to obtain the following: 20 ml of each culture in two separate tubes, and in combination into another tube. All three cultures were then incubated for four hours as before, and then the cells were immediately harvested by centrifugation and the pellets were used for RNA isolation. Thi s experiment was designed to obtain an enrichment of bacteria at mid log phase. Aggregation and co aggregation of bacteria were observed and analyzed as described above. DNA S equencing Pr eviously our lab identified and cloned a U 32 putative collag enase from S. mutans GS 5, and the ability of the recombinant enzyme to

PAGE 23

13 degrade native collagen was demonstrated ( 10 ). In order to confirm the identity of the cloned gene, sequence analysis was performed in the present study. Purification of Plasmid DNA from E. coli Plasmid DNA was isolated from the previously prepared recombinant E. coli TOP 10 clone harboring the plasmid pBAD TOPO TA cloning vector containing smcol 2 using the Perfectprep Plasmid Midi kit (Eppendorf). Gene Amplification by the Polymerase Chain Reaction (PCR) The i solated plasmid was then used as a template for the amplification of smcol 2 by PCR using a primer set designed based on the pBAD TOPO TA vector sequence upstream (pBAD Forward) and downstream from the cloned smcol2 (pBAD Reverse). Primer design was performed and produced by Operon Biotechnologies. The sequence of pBAD Forward primer was 5 ATGCCATAGCATTTTTATCC 3', and that of pBAD Reverse primer was 5 GATTTAATCTGTATCAGG 3. PCR conditions are described in table 1

PAGE 24

14 Table 1 PCR conditions for the A mplification of C loned smcol 2 Agarose Gel Electrophoresis The PCR products were analyzed by agarose gel electrophoresis using 1% agarose gel in TAE buffer (Sigma) in order to confirm the anticipated size band. Once confirmed, the DNA band was exci sed from the gel using the Qiagen MinElute Gel Extraction Kit and protocol from the manufacturer. The DNA obtained and pBAD primers were then sent to the Molecular Biology Core Facility at the H. Lee Moffitt Cancer Center and Research Institute on campus for sequencing. Sequence Alignment and Protein Characterization The protein sequence of the insert was deduced using the ExPASy Translate Tool and was then submitted for a protein blast (blastp) search at NCBI for alignment with that of the SMU.759 gene in the S. mutans UA159 genomic sequence. Initial denaturation 95 o C for 3 min Amplification by 30 cycles of (1,2, and 3) 1. Denaturation 2. Annealing 3. Extension 94 o C for 30 sec 45 o C for 30 sec 72 o C for 1 min F inal extension 72 o C for 10 min

PAGE 25

15 Potential Protein Immunogenicity To evaluate the potential immunogenicity of SmCol 2, a ntigenicity and immunogenicity analysis of the translated protein sequence were carried out using the method dev eloped by Kolaska r and Tongaonkar (28) Briefly, the method determines B cell epitopes using a combination of factors such as hydrophilicity, elasticity, surface accessibility, exposed surface and antigenicity. RNA Isolation and Purification Several methods of RN A isolation were used in the present study. Initially, a modified Hot Phenol Chloroform RNA Extraction method was used in accordance with TIGR protocols. Another method was created from the DNA extraction protocol developed by Dr. Lindsay Shaw ( Departmen t of Biology, Cell Biology, Microbiology and Molecular Biology, USF) utilizing mechanical shearing and phenol/chloroform for extraction. Finally, following the protocol by Ajdic, (3) total RNA was isolation using Ambion's RiboPure kit. All methods utilized the Qiagen RNEasy Mini kit for RNA purification. RNA Extraction Using Hot Acidic Phenol Following the protocol of Peterson et. al (44) bacterial cultures were grown for the appropri ate time an d harvested. Phenol, adjusted

PAGE 26

16 to pH 4.3 with 0.1M citrate buffer, was preheated in a boiling water bath for 10 minutes prior to collection. Cultures were then mixed at a 1:1 ratio and vigorously hand shaken for 20 seconds. Culture phenol solutions were incubated for 10 minutes in the boiling water bath, with periodic mild hand shaking 32 ml of the mixtures were carefully transferred into Nalgene Oakridge 40 ml high speed Teflon centrifuge tubes, and cooled on ice. To each of the tubes, 8 ml of chloro form was added and then shaken for extraction. The tubes were transferred to the Sorval GSA RC 5B centrifuge and centrifuged in a Sorval/Dupont SS 34 rotor at 10,000 x g for 10 minutes at 4¡ C The resulting supernatant was measured and extracted with on e volume of acid phenol chloroform (1:1) in a new tube. The extracted solutions were then centrifuged at 10,000 x g for 10 minutes at 4¡ C Supernatant from each sample was collected and adjusted to 0.3 M sodium acetate. One volume of isopropanol was ad ded to precipitate the RNA. Tubes were kept overnight at 20 ¡ C and then centrifuged at 10,000 x g for 20 minutes. The tubes were decanted and pellets were washed with 75% ethanol then allowed to air dry. Pellets were dissolved in a 50l solution of DEPC treated water with 150 units of RNAseOUT (Invitrogen), a ribonuclease inhibitor, per milliliter. RNEasy solutions were immediately added and the RNEasy Cleanup Protocol was carried out. Fifty units of RNAseOUT were added to the elu t ed RNA to inhibit

PAGE 27

17 degradation. RNA concentr ation was measured using a spectrophotometer (NanoDrop ND 1000). RNA quality was determined by electrophoresis on 1% agarose gel. Presence of two intact bands representing the 16s and 23s ribosomal RNA was used as an indicator of no RNase degradation activity. Modified DNA Protocol The modified Shaw protocol started with approximately 2 x 10 9 bacterial cells grown for the appropriate time, in typically 1 2 ml of bacterial culture. These cells were collecte d and centrifuged for 1 min at 3,220 x g at room temperature the supernatant was discarded and the pellet was re suspended in 1.75 ml of phenol pH 4.3. This sample was transferred to 2 ml locking cap tubes (Fisher) filled with 250 l of 0.1 mm glass zirc onium beads. Samples were then subjected to three times one minute homogenizations at 15 second intervals using a Mini BeadBeater 1 (BioSpec) The short buffer time was designed to air cool both the samples and equipment. Tubes were then centrifuged for five minutes at 10,000 x g at room temperature and supernatant fractions transferred to fresh 1.5 ml tubes One tenth volume of chloroform was added, tubes were vortexed briefly and the two phases were allowed to separate at room temperature for 10 minut es. Tubes were centrifuged for five minutes at 10,000 x g and

PAGE 28

18 the aqueous phase was transferred to new 1.5 ml tube s One volume of isopropanol was added and the tubes were gently hand mixed for 15 seconds. Samples were then incubated for 15 minutes at 80 ¡ C to precipitate the RNA. The precipitated RNA was then centrifuged in an Eppendorf 5804R for 10 minutes at 10, 000 x g at 4 ¡ C. The supernatant was discarded and pellets were gently washed with 70% molecular biology grade ethanol. RNA was re suspended in 50 l of DEPC treated water and treated twice with 1 l of Turbo DNase (Ambion) (Dnase I) following the manufacturer protocols to remove residual DNA contamination. RNA was then purified using Qiagen RNEasy columns as described by the manufacturer Ajdic and Pham Procedure RNA was also isolated us ing the method described by A j d ic & Pham (3) utilizin g Ambion's RiboPure # Bacteria kit. Briefly, 2 x 10 9 bacterial cells were obtained by centrifugation as above from fresh cultures a nd re suspended in 350 l of ice c old RNAwiz (Ambion supplied ). Cell suspensions were added to 0.5 ml screw top centrifuge tubes (supplied by the manufacturer) filled with 250 l of 0.1 mm zirconia beads. Screw cap tubes were disrupted either by three times one minute consecutive homogen izations using a BioSpec Products Mini BeadBeater 1 or by a 10 minute homogenization with tubes taped

PAGE 29

19 flat onto a FisherBrand Vortex Genie 2. Samples were then centrifuged at 4 ¡ C for five minutes and the sup ernatants were transferred to a new Ambion RNase F ree 1.5 ml tube (Ambion cat. #12450) The cell lysate was extracted with 0.2 volume of chloroform and vortex mixed briefly After a 10 minute bench top incubation at room temperature tub es were centrifuges at 10,000 x g at 4 ¡ C for five minutes and the supernatants were extracted to a fresh 1.5 ml RNase free tube (Ambion) Next, 0.5 volume of 100% ethanol w as added to each sample. Solutions were then transferred onto the filter cartridges inside 2.0 ml collection tubes (both supplied in the kit). Tube s were then centrifuged at 100 x g for two minutes and flow through fractions were collected and reapplied to the filter cartridge and re centrifuged. Filters were washed using 700 l of Wash Solution 1, centrifuged for one minute at 10,000 x g and the fl ow through fraction was discarded. F ilters were washed with 500 l of Wash Solution 2/3 and centrifug ed for 1 min at 10,000 x g, discarding flow through. This step was repeated with another 500 l of Wash Solution 2/3. The filters were dried by centrifug ing for one minute at 10,000 x g and then the cartridges were transferred to new 2.0 ml collection tubes. RNA was eluted by adding 25 l of Elution Solution that was preheated to 95 ¡ C to the center of each filter, followed by incubation at room temperatur e for one minute The tubes were centrifuged for one

PAGE 30

20 minute at 10,000 x g and the elution step was repeated with another 25 l of 95 ¡ C preheated Elution Solution. To remove DNA contamination, samples were then treated with Turbo DNase supplied with the kit at a concentration of 2U (1l) per 50l of sample To begin DNase digestion, 1/9 volume of 10X DNase Buffer and 4 l of DNase 1 were added to each sample. Tubes were gently mixed and then incubated at 37 ¡ C for 30 minutes. Following incubation, DNase Inactivation reagent was added, at 1/9 volume of the original RNA sample, to the samples and gently mixed for two minutes. The tubes were then centrifuged at 10,000 x g for two minutes and the RNA containing supernatant fractions were transferred to fres h tubes. Purification of Extracted RNA The manufacturer s RNA Clean Up protocol was followed with several modifications. This modified protocol was obtained from the Microarray Core Facility at Moffitt Cancer Center, Tampa, FL and the additions/ch anges to the protocol are described herein. During step 3, the sample was applied to the column and incubated for 2 min. Caps were opened slightly and centrifuged for 1 min at 100 x g. The flow through was collected and reapplied to the RNeasy Column. T he reapplied sample was incubated for 2 min, and then centrifuged at 100

PAGE 31

21 x g for 1 min. The remainder of the manufacturers protocol was followed as described. Microarray Labeling Following TIGR standard operating procedures M007 and M009 (http://pf grc.jcvi.org/index.php/microarray/protocols.html), the isolated RNA was reverse transcribed, labeled, and hybridized to the microarrays. Briefly, 2 g of purified RNA was incubated with RNaseOUT, Random Hexamers 3g/l (Invitrogen) and DEPC water (Ambion), at 70 ¡ C for 10 minutes in 1.5 ml RNase Free tubes. Samples were snap frozen and then centrifuged briefly at 1000 x g to collect the condensate. The RNA and primers were mixed with reverse transcriptase and buffers and then incubated overnight for 16 hou rs in a 42 ¡ C water bath enclosed in foil covered hybridization chambers (Corning; Cat #2551). The reaction was halted with 10 l of both 0.5 M EDTA, 1 M NaOH. Samples were mixed and incubated in a 65 ¡ C water bath for 15 minutes. Condensation was collect ed and 25 l 1 M Trizma (pH 7.0) was added to neutralize pH. To remove unincorporated amino allyl dUTPs and free amines, samples were filtered through a MinElute PCR Purification column (Qiagen). Newly prepared phosphate wash buffer ( 5 mM KPO 4 pH 8.0 80 % EtOH) and phosphate elution buffer ( 4 mM KPO 4 pH 8.5) were prepared as

PAGE 32

22 described in the protocol and were used in this purification step to avoid contamination with the free amines present in the Qiagen reagents. Following the kit's procedure with the previously mentioned modifications, a final elution volume of the amino allyl incorporated cDNA was 60 l. The eluate was dried in a Savant Speed Vac Concentrator for 45 minutes at room temperature The dried cDNA pellets were re suspended in 4.5 l of 0 .1 M sodium carbonate buffer, pH 9.3 by gently pipetting for several minutes. After the addition of 4.5 l of either the prepared Cy3 or Cy5 dye (TIGR #M007) to the sample, the tubes were incubated at room temperature for 2 hours, after which time 35 l of 100 mM NaOAc pH 5.2 were added to each sample. The labeled probes were then purified using the MinElute columns and the supplied reagents to obtain a final purified probe volume of 100 l. Undiluted samples were analyzed using the BioRad SmartSpec Plus UV Spectrophotometer at 260nm to determine cDNA concentration, 550nm for determination of Cy3 incorporation, and 650nm for determination of Cy5 incorporation. E quations provided by TIGR were used to probe quality control. Following analysis, differentiall y labeled (Cy3 or Cy5) samples to be hybridized on a single array were combined and concentrated using a Savant Speed Vac Concentrator for 45 minutes at room temperature Probes were stored at 80¡C until use if not used immediately.

PAGE 33

23 Microarray Hybridizat ion Following TIGR protocol M008 the microarray hybridization was performed. Briefly, 50 ml of prehybridization buffer (5x SSC, 0.1% SDS, 1% BSA) was prepared for each five slides and filtered through a 0.22 m Mini Miser Filter (Corning). The filtere d solution was transferred to a clean Coplin jar (VWR) and incubated in a 42¡C water bath for 10 minutes. Slides were carefully inserted into the jar face up following the incubation and incubated in the water bath for 90 minutes. After the prehybridizat ion was complete, Coplin jars were carefully emptied of prehybridization buffer while keeping the slides inside. Not allowing slides to dry, the Coplin jar was filled with DI/MilliQ water quickly and shaken liberally by hand at 30 second intervals. Followi ng each interval, the water was replaced and this process repeated six times or until discard water was free of bubbles. A glass staining dish was filled with DI/MilliQ water and the slides were quickly transferred, by using forceps on the slide barcode, into the pmol nucleotides = {OD 260 volume (in l) (37ng/ l) (1000pg/ng)} (324.5 pg/pmol) pmol Cy3 = OD 550 volume ( in l) 0.15 pmol Cy5 = OD 650 volume (in l) 0.25 # nucleotides/dye incorporated = pmol cDNA pmol Cy dye

PAGE 34

24 submerged slide holder within the staining dish. Slides were placed on a rotary shaker and agitated gently for two minute intervals. Between intervals, DI/MilliQ water was replaced quickly, not allowing slides to dry. This process was repeated until ~two liters of water was used. Once two liters of water had rinsed the slides, the staining dish was drained and filled with isopropanol (Fisher) and slides were agitated gently for two minutes. Following the isopropanol rinse, the slides were brou ght to the Eppendorf 5804R refrigerated centrifuge with a counterbalanced A 2 DWP flat plate rotor adaptor. The glass slide holder was quickly transferred onto the empty flat plate, which was covered with paper towel, and the centrifuge was immediate star ted at ~1000rpm and run at room temperature for 10 minutes. Unspotted slides were used further while spotted slides were washed and dried until clean. One milliliter of hybridization buffer was freshly made (40% formamide, 5x SSC, 0.1% SDS, 0.6 g/ l Salmon Sperm DNA). The buffer was syringe filtered through a 0.45 m filter, then the Salmon Sperm DNA was added. The completed hybridization buffer was used (60 l) to resuspend the dried or frozen probes, and the remainder was set aside for later use. The probes were resuspended by vortexing for 20 seconds, heating the mixture in a 95¡C water bath for 5 minutes,

PAGE 35

25 vortexing again for 20 seconds, and heating the probe again for 5 additional minutes. Dried, prehybridized arrays were inserted face up in to the gasket lined bottom of a hybridization chamber (Corning). Lifterslips Brand coverslips were cleaned with compressed air and placed bevel side down over the array portion of the microarray slide. Re suspended probes were gently applied to the lower edges of the Lifterslip, allowing for even, bubble free distribution under the coverslip. Fifteen l of unused hybridization solution was added to each of the internal wells within the hybridization chamber to prevent slide drying during incubation. Cha mbers were sealed, wrapped in tinfoil and submerged face up in a 42¡C water bath for 16 hrs. Following hybridization, low stringency buffer was heated to 55¡C before use and 1ml of 100mM DTT was added to each 1L of wash buffer (low 2x SSC, 0.1% SDS, medium 0.1x SSC, 0.1% SDS, and high 0.1x SSC). A clean glass staining dish was filled with preheated low stringency buffer. Slides were carefully removed from the hybridization chambers and transferred individually into the staining dish (without sl ide holder). Slides were held with gloved hands and shaken submerged in low stringency buffer until the coverslips released. Care was taken not to scratch the surface of the microarray with the floating coverslip. Following coverslip detachment, slides

PAGE 36

26 were quickly and carefully transferred into a glass slide holder inside a tinfoil covered staining dish, filled with low stringency buffer. Once all slides had been transferred into second staining dish, the dish, covered in tin foil, was placed onto a ro tary shaker and gently agitated for five minutes. Following this rinse step, the low stringency buffer was replaced and the slides continued washing for five additional minutes. Following this second rinse, low stringency buffer was replaced with medium stringency buffer and the cycle was completed twice. Following the medium stringency cycles, high stringency buffer was used twice to rinse the slides. After the high stringency buffer had been cycled twice, the glass slide holder containing the slides w as dipped several times in clean DI/MilliQ water and then the slides were immediately dried as previously described. Following drying, the slides were immediately scanned on a Perkin Elmer ScanArray Express 5000. Microarray Description and Analysis Schott 70mer oligonucleotide arrays were obtained from the The Institute for Genomic Research/ J. Craig Venter Institute (Rockville, MD) as part of the NIAID Pathogen Functional Genomics Resource Center (Bethesda, MD). The arrays are imprinted with 1948 o ligonucleotides with four replicates of each ORF within the sequenced genome of S. mutans UA159 represented. After hybridization, the

PAGE 37

27 slides were scanned using a Perkin Elmer/GSI Lumonics Scan array 5000 at the Microarray Core Facilities at the H. Lee Mof fitt Cancer Center and Research Institute. There a Dell Inspiron Desktop was used with ScanExpress software to read the slide images. Images were scanned at 5 m resolution generating digital image files around 120 130 mb. Photomultiplier tube (PMT) va lues for the scanner were originally set at 75, however they were adjusted as needed to obtain appropriate background and signal levels. Scanned images were analyzed using the Spotfinder program from the TM4 Software Suite created at JCVI. Spotfinder Slide images were loaded in Cy3/Cy5 pairs into the software. Grids were constructed using the specifications from the TIGR website on the array geometry. Major arrays and sub arrays were aligned manually with detailed attention to correctly placing s pots in the center of each sub array block. To overcome deficiencies in slide spotting precision, grid rotation and spacing adjustments were made as needed. In the gridding and processing window, the otsu segmentation method otsu (40) was selected and default minimum and maximum spot sizes were used. After processing, the grid quality

PAGE 38

28 was assessed in the quality control windo w, readjustments were made as needed. Data was saved as MEV file. TIGR Microarray Data Analysis System (MIDAS) MIDAS software was used for normalization and statistical analysis. After Spotfinder, the output MEV files were loaded into MIDAS for da ta normalization. The data sets were subjected to locfit (LOESS) normalization and then to standard deviation regularization. The default parameters were used for both of these functions. A slice analysis, a user dependent z score filtering based on desir ed log 2 ratios, was also performed to identify putatively over expressed genes. Default settings were also used with this function. Output MEV files were then analyzed using Microsoft Excel 2004.

PAGE 39

29 RESULTS Development of F. nucleatum culture condi tions At the start of this project, three different F. nucleatum strains were investigated for possible use with the S. mutans gene expression study. Lyophilized F. nucleatum strains 10953, 25586 and 23726 were obtained from ATCC and cultured using a BBL GasPak An a erobe System. Early attempts to grow the bacteria were met with some difficulty. Using the medium #1490 recommended by ATCC, consisting of a modified chopped meat medium failed to revive the lyophilized bacteria. Many alternative media typ es were identified for potential F. nucleatum growth (13, 41, 45) Ultimately, it was BHI supplemented with 0.25% glutamate (BHI+G) (4) that was used for F. nucleatum propagation as S. mutans also grows readily in BHI+G. The reduction/oxidation indicator Resazurin (Sigma) wa s added to each medium type to monitor oxidation levels as an indicator of medium usability. Once the medium became oxidized, its color changed from dark blue to red, and it was discarded. As expected for an obligate anaerobe, the oxidation level of the medium is critical for F. nucleatum growth. These bacteria were quickly rendered unresponsive once

PAGE 40

30 removed from an anaerobic chamber, making propagation difficult and resource intensive. It is noteworthy that pre reduced medium apparently repressed the gr owth of S. mutans making it difficult to optimize the growth of both bacteria. During the weekly F. nucleatum propagation attempts, it was discovered that unmodified BHI supported the growth of F. nucleatum 25586 and prereducing the media was not necessa ry. This observation could be explained by a selection for more oxygen tolerant F. nucleatum 25586 bacteria through the weekly propagation. However, more studies are needed to understand these casual observations in more detail. Development of S. mutans F. nucleatum Aggregates Cultivation of S. mutans in BHI containing 2% sucrose promoted the attachment of the b acteria to glass culture flasks at approximately 20h post incubation, followed by detachment as aggregates upon standing. The same culture c onditions were applied to F. nucleatum with and mixed S. mutans F. nucleatum cultured in parallel with similar results Staining of the bacterial aggregates from the three cultures with the USF D stain showed differences in morphology and coloration, a re sult of Stains all dye coloration on different macromolecules. (Fig.1). As anticipated from two different bacteria in term of morphology, size and composition, F. nucleatum and S.

PAGE 41

31 mutans aggregates were readily recognizable. S. mutans (Fig.1A) appeared a s clumps of cocci stained in deep purple red, whereas F. nucleatum (Fig.1B) aggregates showed clumps of long, thin, fusiform rod s stained in light pink. Establishment of S. mutans A. viscosus Coaggregation Since cultures of F. nucleatum could not be optimized in an anaerobic jar utilizing gas generating sachets, another bacterium co aggregating with S. mutans in dental plaque was evaluated as possible partner for mixed culture expression analysis. A. viscosus was chosen for its proven interaction wit h S. mutans as reported (32 34) and its growth potential in BHI (11) Lyophilized A. visc osus 31647, obtained from ATCC, was initially revived in 5ml of Todd Hewitt Broth and was propagated using Bacto BHI media. A. viscosus displayed thick mucoid aggregates in both homologous and heterologous broth cultures after 24 hours. The aerobic toler ance of the organism was suitable for culturing in a 5% CO 2 atmosphere. DNA Sequence Analysis of smcol 2 Previously, the Dao lab cloned the S. mutans GS 5 smcol 2 gene into the pBAD TOPO TA vector (Invitrogen) plasmid and began a preliminary analy sis of the translated proteins enzymatic activity (10)

PAGE 42

32 Figure 1 Staining of S. mutans and F. nucelatum aggregates by the USF D method. (1A) S mutans showing deeply stained aggregates of cocci; (1B) F. nucleatum showing aggregates of light pink fusiform rods; (1C) S. mutans F. nucleatum co aggregates embedded in a st icky matrix A B C

PAGE 43

33 However, confirmatory sequencing of the cloned genes identity was not yet carried out to validate the previous study. To verify the identity of the insert and confirm its orientation within the pBAD expression plasmid, the plasmid was sequenced using pBAD specific primers : 20mer forward primer : 5' ATGCCATAGCATTTTTATCC 3'. 18mer reverse primer: 5' GATTTAATCTGTATCAGG 3'. Samples were sequenced at the Moffitt Core Facility and two output fluorescence chromatograms were obtained from the Moffitt core sequencing facilities, from both the forward and reverse sequencing directions. These chromatograms were used as an input for Finch TV (Geospiza), a chromatogram viewer application and the sequences were output into fasta fo rmat text files. After combining the forward and reverse sequences a 781bp consensus sequence was obtained. This sequence covers approximately 84% of the homologous SMU.759 gene (927bp) of S. mutans UA159. Matching at 99% ( 778 / 781 ) bases with the homo logous SMU.759, with one point mutation at base 106, resulting in a subsequent amino acid substitution, and two silent mutations were documented at bases 324 and 640 of the sequenced insert New primers starting midpoint in the gene will be used to verify the identity of the base s closest to the 3' and 5' ends of the insert in a future study.

PAGE 44

34 Figure 2. BLAST alignment of the DNA sequence of the cloned S. mutans GS 5 smcol2 vs. S. mutans UA159 SMU.759 Alignment of the D educed A mino A cid S equence of SmCol 2 of S. mutans GS 5 with that of SMU.759 of S. mutans UA 159 The deduced partial protein sequence was 260 residues in length. A blastp search using the protein sequence confirmed the homology with NP_721176, of S. mutans UA159, matching at 2 5 9 / 260 residues The

PAGE 45

35 single difference is a glutamate residue in place of a lysine residue at position 36, resulting from a nucleic acid single substitution. Figure 3. Deduced Amino Acid Sequence of S. mutans GS 5 Smcol2 Insert Aligned with Smcol2 of S. m utans UA159 Using the BLASTP Search Algorithm Analysis of SmCol 2 Potential Immunogenicity To determine if SmCol 2 could be used in a vaccine against dental root caries, the Kolaskar Tongaonkar a ntigenicity criteria for potential B cell epitopes was a pplied Using physiochemical properties (flexibility, hydrophilicity, accessibility) of exp erimentally known epitopes, an antigenicity plot was generated (Figure 4) and candidates for immunogenic regions of the protein were identified (Table 2)

PAGE 46

36 Figure 4. Antigenicity Plot of the Protein encoded by smcol2 Average antigenic propensity with all values> 1.0 being considered potentially antigenic (Han, TK, Personal Communication). Microarray Analysis of S. mutans Monoculture and S. muta ns A. viscosus Mixed Culture As previously mentioned above, interaction between these two bacteria has been thoroughly documented yet its translation into genetic expression changes has not yet been fully investigated. Analyzing the global gene expres sion patterns of organisms is a procedure that is now widely available by using microarray technology. Table 2 Identification of Potential Epitopes in SmCol2

PAGE 47

37 As recent st udies have indicated, DNA mi croarrays are a useful tool for examining gene expression in different growth conditions of the same bacterium (50) however the use of this technology towards multispecies gene expression analysis remains untested due to apparent obstacles associated with co cultures, which might favor the growth of one over the other (42) Attempting to avoid this problem, our studies were designed to focus on the interaction between bacteria in mid log phase an d minimal time for duplication. Mid log phase (3 4hrs) was also selected based on findings that smcol1 and smcol2 were expressed at that growth stage in microarray analysis (Ajdic, D., Personal Communication). RNA Isolation Following the recommenda tion set forth by TIGR protocol M007 (revision 0.3), a hot phenol extraction described by Peterson et al. (44) was initially used for RNA isolation. This method required the use of 40ml, chloroform resistant, Teflon high speed centrifuge tubes and boiling acid phenol. The resulting pellets usually contained large amounts of protein along with the nucleic acid, which was removed during RNeasy Clean Up as is noticed in Table 3 below.

PAGE 48

38 Example Hot Phenol Extraction Results (Me asured Using Nanodrop ND 1000) Sample Concentration After Extraction (100 l) Concentration After RNeasy Clean up (using ~20 l (100 g) of orig. sample A260/280 Before Clean Up A260/280 After Clean Up Purified Isolated RNA SM 4.47 g/ l 134.87 ng/ l 1.04 2 .10 10.51 g AV 4.43 g/ l 146.65 ng/ l 1.04 1.98 11.44 g MIX1 4.53 g/ l 148.96 ng/ l 1.08 2.04 11.62 g MIX2 4.46 g/ l 79.21 ng/ l 1.40 1.93 6.18 g This method required the pouring of 20ml of bacterial culture into 20 ml boiling acid phenol a hazardous procedure. The isolated RNA in this extraction was used for cDNA reverse transcription and ultimately microarray hybridization. This method was not preferable due to the potentially harmful effects it may have on the researcher and lengthy procedure time. Other methods were explored to find a suitable replacement. A new method was sought, and given the success of a DNA extraction method developed in the Shaw Laboratory (USF Biology CM M), this method was adopted The procedure used mechan ical disruption as its primary source of cell lysis, rather than only a phenol based chemical approach. This was hypothetically advantageous for two reasons, first the method was Table 3 Analysis of Hot Phenol Extracted RNA Figure 5 Degraded Purified RNA on a 1% Agarose Gel. Each lane represents a replicate culture of S. mutans UA159 total RNA

PAGE 49

39 faster, allowing for less time RNA could be degraded by native or introduced RNases; secondly it reduced culture volume due to size restrictions in the disruption equipment. This method allowed for the use of smaller cultures since the bead homogenizations were carried out in 2.0 ml tubes, and required approximately 2.0 x 10 9 bac terial cells for sufficient RNA yields. The RNA collected from this method however, was significantly degraded, as determined through gel electrophoresis seen in Figure 5. The smears represent highly degraded RNA, with no observable 16S or 23S rRNA bands. While the method rapidly isolated nucleic acid, the method still requires optimization in order to obtain intact RNA, devoid of contaminating ribonucleases. The final method, described by Ajdic et al. (3) involved a similar method of mechanical disruption as seen in the previous method and included the use of RNAwiz (Ambion), a TRI Reagent homolog. Using the Ambion RiboPure Bacteria kit, samples were homogenized using 0.1mm zirconia beads, were phenol extracted w ith RNAwiz, and filtered using glass fiber columns. The RiboPure kit also included DNA free reagents for optional DNA digestion, which were used during each extraction. Results of a typical RiboPure extraction are detailed in Table 4

PAGE 50

40 The final extraction method quickly isolated nucleic acid, however partial RNA degradation was still observed when analyzed by agarose gel electrophoresis ( Figure 6) Figure 6 Partially degraded RNA obtained with RiboPure Kit. Figure 3. Partially degraded RNA obtained with RiboPure Kit. RNA Samples 1 and 2 are independent Isol ation Attempts. Table 4 Typical RiboPure Extraction Results with DNA free Treatment from 2.0 x 10 9 B acterial cells

PAGE 51

41 The 260nm/280n m absorbance ratio demonstrates a relatively pure RNA sample was isolated and although the amount of RNA degradation appeared to decrease from the previous method as noted by the presence of faint 16s and 23s ribosomal bands. Further optimization is still needed to perfect the procedure in order to visualize strong, distinct ribosomal bands absent of degraded RNA migrated at the bottom of the gel. Reverse Transcription and Microarray Hybridization To prepare targets for microarray hybridization, the hot acidic phenol isolation method was used to extract total RNA from S. mutans A. viscosus & mixed cultures. The RNeasy purified RNA was reverse transcribed using amino allyl dNTPs to prepare for an esterification reaction between the aa cDNA and the cya nine dyes. These targets were then hybridized to stationary oligonucleotides bound to the glass microarray slide. During the reverse transcription reaction and the cDNA labeling step, particular concentrations and ratios were sought for ideal hybridizati on based to the TIGR protocol recommendatio ns. Greater than 800 pmol of Cyanine dye incorporation and a ratio of nucleotides to dye less than 20 were targets described in TIGR protocol M007 and best for hybridization and signal measurement. Total RNA samp les of 2 g were reverse

PAGE 52

42 transcribed using a 2:1 aa dUTP to dTTP 25mM labeling mix, (due to S. mutans genomic 36.81% GC content) and labeled with cyanine dyes. Following reverse transcription, samples were processed through MinElute columns (Qiagen) to rem ove any remaining RNA or free nucleotides. These samples were then cyanine labeled. Cy3 labels aa cDNA with a higher efficiency than Cy5, due to its smaller size thus avoiding any steric hindrance. This hindrance reduces the coupling ability of the Cy5 dye to the cDNA, resulting in a lower labeling efficiency compared to Cy3. Due to the sensitivity of the cyanine dyes to light and ozone, exposure to both was minimized. The use of Lifterslips Brand cover slips, compared to traditional style glass cover slips, aided in introducing the labeled cDNA hybridization mixture onto the slide bound oligonucleotides in an even manner, avoiding the creation of disrupting bubbles on the microarray surface. Slides were washed after overnight hybridization and scanned promptly. The hot acidic phenol RNA isolation method detailed above was used and RNA was purified following the RNEasy Clean Up (Qiagen). It was concentrated under vacuum centrifugation to facilitate its use in the protocol where RNA sample volume i s restricted to a maximum of 15.5 l for 2 g of nucleic acid. The results of th e reverse transcription and Cyanine l abeling are detailed below in Table 5

PAGE 53

43 Table 5 RNA Reverse Transcription and Labeling Total RNA Reverse Transcrip tion and Labeling Results ( Reached TIGR Targets for Hybridization ) Sample Purified RNA Conc. A 260 Min Eluted pmol cDNA in sample A 550 (Cy3) or A 650 (Cy5) pmol dye in sample Ratio of pmol cDNA/pmol dye SM 636.70 ng/ l 1.460 16,647.15 1.350/550nm 900.0 18.50 AV 954.62 ng/ l 1.890 21,550.08 1.653/650nm 661.2 32.59 MIX1 699.90 ng/ l 1.171 13,351.93 1.005/500nm 670.0 19.92 MIX2 423.70 ng/ l 1.334 15,210.48 1.618/650nm 647.2 23.5 Although only one sample (SM: S. mutans single culture) met b oth conditions and the MIX1 ( S. mutans / A. viscosus co culture) sample met one of the ideal numbers, the experiment was moved forward as a technique learning experience. T hese labeled targets were paired S. mutans SM/Co culture MIX2 (Cy3/Cy5) and A. viscos us AV/Co culture MIX1 (Cy5/Cy3) and each mixture hybridized to a S. mutans UA159 genomic microarray. Scanning of Hybridized Microarrays The scanned microarrays using the hybridized SM/MIX2 & AV/MIX1 mixture s are shown in Figure 7 below. The SM/MIX2 mixture was anticipated to hybridize with success do to its composition more aligned with the predetermined TIGR guidelines The AV/MIX1 mixture, with less than target dye and cDNA quantities was expected Table 5 Sample SM: S. mutans AV: A. viscosus, MIX1 /2: Duplicate S. mutans & A. viscosus co cultures. (Note MIX1&2 are duplicates derived from a single mixed culture, purified on separate RNeasy Columns.)

PAGE 54

44 to display weaker hybridization but still produce a strong enough signal for measurement Since the number of picomoles of Cy dye was above 500, previous communications with TIGR staff indicated that the hybridization would yield measurable signal. In Figure 7 only the SM/MIX2 array could be measured. Visible green and red dots in a regimented, grid lined pattern throughout the slide demonstrate the visualization of a properly hybridized TIGR S. mutans genomic microarray. The AV/MIX1 array, covered in random sized and spaced dots displays random, non sp ecific binding, as demonstrated through the absence of the ordered, grid aligned spots as seen on the SM/MIX2 array. While some background signal is essential for analysis software to quanti fy signal levels, excessive non specific binding can hide properly hybridized targets, skewing results, or demonstrate unsuccessful hybridization as in this situation.

PAGE 55

45 Figure 7. Hybridized Schott S. mutans UA159 Oligonucleotide Microarrays. On the left, the SM/MIX2 array shows specific target probe hybridization. Th e AV/MIX1 array on the right demonstrates random, nonspecific target binding. Analysis of Gene Expression Data S. mutans UA159 and A. viscosus were cultured alone and co cultured in BHI broth for gene expression analysis using Schott printed oligonu cleotide microarrays The data obtained were normalized using

PAGE 56

46 LOESS standardization (12) and standard deviation regularization to help re move array printer head bias and other mechanical deviation. A slice analysis' was then performed which gave us the log 2 ratio of the normalized signal intensities for the probes. This is a non statistical low level analysis for assessing changes in gene expression based on the averages of four replicate spots on the array. The data obtained (Appendix I) was organized based on highest positive and lowest negative log 2 ratios in order to gauge potential gene expression changes. The data shown in Tables 6, 7 and 8 respectively represent potentially upregulated S. mutans genes, potentially downregulated genes, and potentially differentially expressed virulence genes responsible for collagenase production, genetic competency, and bacteriocin production. These groups were chosen for their role in S. mutans pathogenicity (56) and could be the subject of further study following data validation

PAGE 57

47 Table 6. Potentially Upregulated S. mutans Genes Locus ID # Annotated Gene Identity Gene Log 2 Ratio Symbol 2069 putative integral membrane protein 1.969 1590 intracellular alp ha amylase amyA 1.927 1654c putative acetyltransferase 1.781 1652 putative methylated DNA -protein cysteine S methyltransferase ogt 1.651 611 putative ATP dependent RNA helicase, DEAD box family 1.496 1860 30S ribosomal protein S6 rs6 1.487 657 puta tive MutG mutG 1.459 1495 galactose 6 phosphate isomerase, subunit LacB lacB 1.436 311 PTS system, sorbitol (glucitol) phosphotransferase enzyme IIC2 1.418 1790c putative transcriptional regulator 1.410 1326 putative peptide chain release factor (RF 2) rf2 1.336 2141 glucose inhibited division protein homolog GidA gidA 1.251 2030 putative transcriptional regulator CtsR ctsR 1.230 1170 putative cytochrome C biogenesis protein ccdA 1.140 1692 pyruvate formate lyase activating enzyme pflA 1.104 1824 c putative transcriptional regulator 1.089 15 putative cell division protein FtsH ftsH 1.086 1079c putative ABC transporter, ATP binding protein 1.053 1150 putative transporter, trans membrane domain bacteriocin immunity protein 1.044 1012c putative transcriptional regulator 1.024 1509 putative transcriptional regulator rgg 1.021 951 putative amino acid permease 1.020 1139c conserved hypothetical protein; possible methylase 1.016

PAGE 58

48 Table 7. Potentially Downregulated S. mutans Genes Locus ID # Annotated Gene Identity Gene Log 2 Ratio Symbol 302 conserved hypothetical protein; putative membrane protein 2.153 1606 putative SsrA binding protein homolog smpB 1.869 540 peroxide resistance protein Dpr dpr 1.363 676 NADP dependent glycera ldehyde 3 phosphate dehydrogenase gapN 1.361 1913c putative immunity protein, BLpL like 1.334 257 putative transmembrane protein, permease OppC oppC 1.330 2000 50S ribosomal protein L17 rl17 1.278 1709 putative potassium uptake protein trkH 1.24 3 650 putative alanyl tRNA synthetase (alanine -tRNA ligase) 1.235 186 putative metal dependent transcriptional regulator sloR 1.178 1556 putative methionine aminopeptidase A ampM 1.151 1672 putative ATP dependent Clp protease, proteolytic subunit clpP 1.131 148 putative alcohol acetaldehyde dehydrogenase adhE 1.122 913 putative NADP specific glutamate dehydrogenase 1.106 1821c putative glutamyl tRNA (Gln) amidotransferase subunit C 1.087 479 RNA polymerase associated protein RpoZ, omega s ubunit rpoZ 1.081 1843 sucrose 6 phosphate hydrolase scrB 1.071 819 putative large conductance mechanosensitive channel mscL 1.067 1366c putative ABC transporter; ATP binding protein 1.050 359 translation elongation factor G (EF G) 1.044 2023c 30S ribosomal protein S19 1.041 1383 putative 3 isopropylmalate dehydrogenase leuB 1.036 818 30S ribosomal protein S21 1.022 1308 putative translation initiation inhibitor; aldR regulator homolog aldR 1.017

PAGE 59

49 Table 8. Potentially Down regulated V irulence G enes A. Genes A ssociated with B acteriocin P roduction Mutacin (Bacteriocin) Production Gene Symbol Log 2 Ratio transcriptional regulator; repressor (HrcA) of class I heat shock genes hrcA 0.386 putative alcohol acetaldehyde dehydrogenase adhE 1 .122 primosomal replication factor Y (primosomal protein N') priA 0.562 putative phosphoglucomutase pgm 0.576 putative histidine kinase CovS; VicK homolog covS 0.163 FoF1 membrane bound proton translocating ATPase, alpha subunit atpd 0.502 putativ e PTS system, trehalose specific IIABC component pttb 0.396 B. Genes A ssociated with C ompetence Competency Gene Symbol Log 2 Ratio putative response regulator of the competence regulon, ComE; response regulator of sakacin A production comE 0.928 putative histidine kinase of the competence regulon, ComD comD 0.632 putative ABC transporter ComYB; probably part of the DNA transport machinery comYB 0.182 serine protease HtrA HtrA 0.130 putative response regulator CiaR CiaR 0.313 putative deoxyr ibose phosphate aldolase, DERA deoc 0.541 putative ABC transporter lpp 0.427

PAGE 60

50 C. G enes E ncoding C ollagen B inding or C ollagenases Collagenase and Collagen Binding Gene Symbol Log 2 Ratio cell wall associated protein precursor WapA wapA 0.583 Smcol1 U32 peptidase, collagenase col1 0.399 Smcol2, U32 peptidase, collagenase col2 0.131

PAGE 61

51 DISCUSSION The interactions of S. mutans with F. nucleatum and A. viscosus in cariogenic plaques have been well documented (29, 34, 42) and t he effects of co aggregation on increasing bacterial pathogenicity have also been shown (8, 11, 29, 38, 42) This study was completed to better understand if through the use of microarray technology, we can further our understanding of how bacterial interactions affect gene expression. Analysis of single species aggregates versus dual species co aggregates of S. mutans F. nucleatum showed distinctive differences in morphology and staining by the USF D method, thus supporting the use of F. nucleatum as a co aggregation partn er in mixed biofilm studies of S. mutans gene expression. Initial cultures were performed using GasPak gas generating sachets in compact container systems. While the GasPak system met the demands of the bacterium during growth, F. nucleatum was sensitive to the exposure of high airflow aerobic conditions inside the bio safety cabinet during sub culture steps This resulted in our repeated inability to propagate these bacteria effectively A n anaerobic environmental chamber is re q uired for optimal growth a nd effective culture manipulation s.

PAGE 62

52 Considering that the strict anaerobic requirements for the growth and maintenance of F. nucleatum could not be met in current laboratory settings, A. viscosus was used in subsequent experiments. Both A. viscosus and S mutans grew well in BHI medium, thus facilitating their manipulations. A. viscosus as mentioned previously is a suitable candidate in the analysis of mixed oral cultures, most importantly because the interaction between these two cariogenic bacteria has been so thoroughly documented (11, 34, 42) Furthermore, a surface lipoprotein has been identified in S. mutans GS 5 as having some homology with a S. gordonii surface protein involved in the binding of this bacterium to A. viscosus Indeed, subsequent experimentation demonstrated that the S. mutans lipoprotein also bound to A. viscosus (unpublished data). A culture protocol was developed in the present study in order to analyze the inter action between S. mutans and A. viscosus and later used in microarray analysis. While working on the selection of a suitable partner for S. mutans in mixed culture studies, we also worked on the selection of S. mutans virulence factors for future use in the validation of microarray data when available. A number of virulence factors were cloned from the cariogenic S. mutans strain GS 5 and characterized in the Dao laboratory including: the sucrose dependent aggregation and

PAGE 63

53 adherence factor wall associate d protein A (WapA) that also has collagen binding properties (21) a lipoprotein (LPP) with A. viscosus bindi ng activity, the key enzyme deoxyribose aldolase (DERA) catalyzing the utilization of DNA as a source of carbon and energy (22) and two collagenase enzymes, Smcol 1 and Smcol 2, of the U32 family wit h the ability to catalyze the degradation of collagen type I, a matrix present in dentin (10, 24, 25) WapA, Lpp, and DERA of S. mutans GS 5 were found to be identical to the corresponding proteins in S. mutans UA159, of which the genomic sequence was used in the preparation of m icroarray slides used in the present study. While the analysis of the first collagenase Smcol 1 was completed (10) the gene encoding the second enzyme Smcol 2 had yet to be confirmed. In the present study, smcol 2 was isolated from the E. coli recombinant clone for DNA sequenc ing. The sequence obtained was the result of a single pair of sequencing primers, located directly adjacent to the TOPO TA cloning sites found in the pBAD expression plasmid. The resulting sequence contained only 84% coverage of the homologous gene from S. mutans UA159. The residues closest to the 3' and 5' end were unable to be identified with this single primer pair. When the obtained sequence was compared to the genomic sequence of the corresponding UA159 gene, a 99% identity was found. Since 84% of the cloned insert matched the reference gene, smcol2 was considered

PAGE 64

54 usable in the validation of microarray data generated with gene chips prepared based on S. mutans UA159 genomic sequence. Additional data were also obtained indicating the potential immun ogenicity of Smcol 2. This information supports the preparation of antibody to Smcol 2, which will also be useful in the validation of microarray data. Considering that S. mutans collagenase activity appeared to be dependent on growth conditions (25) the prospect of finding differences in the expression of this enzyme in single versus mixed S. mutans cultures is p romising. Thus, the analysis of Smcol 2 in the present study has generated valuable information for not only microarray analysis, but also for research on dental root decay as Sm c ol 2 is one important contributing factor. A key step in microarray analysis of gene expression is the extraction of stable RNA. In t he present study, the method described by Peterson et al. (44) was first used as recommended by TIGR This method utilized boiling hot phenol as well as high speed centr ifugation in chloroform resistant Nalgene tubes. Initial RNA isolation efforts were successful but the method was time consuming; therefore other protocols were tested in order to facilitate the handling of the large number of anticipated samples. Isola tion of RNA by Zirconia bead homogenization was determined to be the most effective in terms of time savings when implemented using Ambion's RiboPure RNA

PAGE 65

55 isolation kit, as described by Ajdic et al (3) Only some slight mo difications appeared to be necessary to minimize RNA degradation, such as the use of higher concentrations of RNAse inhibitor. Each method required individual development of specific skills and techniques that could be mastered with more practice, but over all t he hot phenol method by Peterson et al. (44) yielded testable RNA. All RNA samples that were isolated were subjected to Qiagen RNeasy column purification. It was observed during experimentation that the RNeasy colu mn purification was responsible for the low recovery of intact RNA. It was determined that either the columns had deteriorated due to aging past their expiration date by two months, or that one of the reagent bottles was contaminated with RNAse, resulting in the degraded quality of purified RNA. Indeed, the RNA instability issue that belabored our efforts was solved by using reagents from a newly purchased kit and allowed us to obtain the data used for the microarray experiment. Problems arose with the m icroarray hybridization procedure B ased on spectrophotometric analysis high quality targets were c reated from reverse transcribed amino allyl labeled RNA however they did not hybridize. Thus, although we met the specifications set by TIGR in regard to nucleotide labeling and incorporation, successful hybridization and measurement was not assured. Thorough

PAGE 66

56 consultation with TIGR support was obtained ; however the exact step or steps responsible for the observed behavior remain unidentified. Perhaps the problem could be solved with the use of new reagents and by determining optimal conditions for hybridization. The project was originally started with F. nucleatum due to the availability of F. nucleatum microarrays and genomic sequence. The data collected would then be statistically normalized using a series of corrections within the TIGR TM4 software suite. Collecting sound data while using S. mutans and A. viscosus present ed a new challenge given th at the A. viscosus genomic sequenc e and corresponding m icroarrays were not yet available Potentially, homologous transcripts could register false positive data and without a genome spanning array specific for A. viscosus, meaningful conclusions from data collected would prove difficult. T he current study wa s continued as the exploratory aim of the present research could still be met. Data was collected from the hybridized microarray we created in this study. The slice analysis demonstrated a potential c hange in several virulence factor genes with between tw o and four fold differences in S. mutans gene expression being noted between single versus mixed cultures. These results are stated as potential because the statistical significance of the findings cannot be determined. Since only one pair of samples was successfully labeled, hybridized and

PAGE 67

57 measured, the Significance Analysis of Microarrays (SAM) could not be performed. This analysis is dependent on at least three microarrays and would have revealed the significance, if any, of the findings. The degree o f the changes observed is difficult to put into a critical context. However, recent studies published data with similar log 2 expression change ratios. Indeed, Shemesh et al. (50) demonstrated that over 12% of genes within S. mutans UA159 were found to significantly differ their expression based on growing in planktonic or biofilm cultures. In this study, reported genes that varied in log 2 expression ratios between 0.70 & 3.35 in the positive ( upregulated) direction and 0.70 & 2.46 in the negative (downregulated) direction were the focus of discussion. Several genes within the data presented in this study fall within these criteria. With an apparent minimum log 2 ratio of 0.70, 49/62 genes p resented in tables 6 8 lay within this criterion. While data cannot be statistically signified, the data are encouraging, and the approach should be further pursued, if only to repeat the experiment for additional data. If supporting, our results from a future attempt would be convincing arguments in our request to JCVI/TIGR to include A. viscosus in the list of pathogenic bacteria worthy of genomic sequencing and microarray development. This addition would increase the ability of researchers to study S. mutans and A. viscosus coaggregation on gene expression.

PAGE 68

58 Future studies should take into consideration the recommendations by Palmer et al. (42). The interactions between the two bacteria should be first identified through directly observing the coaggre gation mediating components. With the use of fluorescent tagged antibodies, the authors proposed a remedy for the ambiguous nature and the influx of new variables that a co culture introduces into the experimental design. By focusing on a single interact ive pair of surface molecules or secreted receptor compounds, researchers can focus on the influence a particular interaction may cause. By combining this with the global monitoring of gene expression changes through the use of microarray technology, a mo re direct association between coaggregation and gene expression influence can be made. By studying a single effect of a S. mutans and A. viscosus coaggregation interaction, future studies can be optimized. A more effective and direct approach could be acc omplished by creating a glass bead immobilized A. viscosus surface molecule of interest and monitoring the global expression effects its introduction into a S. mutans culture has. Currently, the experimental design leaves many variables open that can lead to inconclusive data. The current approach would force the researchers to work in reverse by identifying a particular phenotype rather than taking a more direct approach.

PAGE 69

59 Future work using the microarray technology detailed herein should begin with a t horough, detailed experimental design with controls being run prior to experimentation. Suggested controls to implement include the use of dye swaps to accurately gauge Cy dye binding efficiency with a particular organisms reverse transcribed RNA. Dye sw aps can and should be used with the data analysis software to more accurately normalize scanned arrays. In the event that arrays are not available for each organism involved in a co aggregation study, those different organisms should be tested against eac h array for the presence of homologous probes that might be specific for more than one species. This situation would prevent any meaningful data due to falsely positive signals. Also, when designing a future experiment, careful monitoring of bacterial co ncentrations should be paramount. In a mixed culture, the use of species specific fluorescent antibodies and a confocal microscope would allow the researcher to better count and record the bacterial composition throughout the growth period. By understand ing the ratio of bacteria interacting together, a better understanding of gene expression data can be achieved. With different bacterial ratios, gene expression may be altered. In summary, the present study has contributed to a better understanding of mic roarray technology, where laboratory experimentations and the computer generation and analysis of data

PAGE 70

60 play equally important roles. In regard to S. mutans in heterologous cultures, it is clear that microarray analysis should be included in future studies Technical problems were found resolvable and future challenges using microarray technology have been identified in the present study and discussed.

PAGE 71

61 REFERENCES 1. Aamdal Scheie, A., W. M. Luan, G. Dahlen, and O. Fejerskov. 1996. Plaque pH and microflora of dental plaque on sound and carious root surfaces. J Dent Res 75: 1901 8. 2. Ajdic, D., W. M. McShan, R. E. McLaughlin, G. Savic, J. Chang, M. B. Carson, C. Primeaux, R. Tian, S. Kenton, H. Jia, S. Lin, Y. Qian S. Li, H. Zhu, F. Najar, H. Lai, J. White, B. A. Roe, and J. J. Ferretti. 2002. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci U S A 99: 14434 9. 3. Ajdic, D., and V. T. Pham. 2007. Global transcriptional a nalysis of Streptococcus mutans sugar transporters using microarrays. J Bacteriol 189: 5049 59. 4. Bachrach, G., G. Rosen, M. Bellalou, R. Naor, and M. N. Sela. 2004. Identification of a Fusobacterium nucleatum 65 kDa serine protease. Oral Microbiol Immunol 19: 155 9. 5. Bai, F., J. Feng, Y. Cheng, J. Shi, R. Yang, and H. Cui. 2006. Analysis of gene expression patterns of ovarian cancer cell lines with different metastatic potentials. Int J Gynecol Cancer 16: 202 9. 6. Barnard, J. P., and M. W. Stinson. 1999. Influence of environmental conditions on hydrogen peroxide formation by Streptococcus gordonii. Infect Immun 67: 6558 64. 7. Bowden, G. H. 1990. Microbiology of root surface caries in humans. J Dent Res 69: 1205 10. 8. Bradshaw, D. J., P. D. Marsh, C. Alliso n, and K. M. Schilling. 1996. Effect of oxygen, inoculum composition and flow rate on development of mixed culture oral biofilms. Microbiology 142 ( Pt 3): 623 9. 9. Burne, R. A. 1998. Oral streptococci... products of their environment. J Dent Res 77: 445 52 10. Carson, V. 2006. Cloning and analysis of putative collagenases of the U32 family in Streptococcus mutans and Streptococcus agalactiae (Group B Streptococcus). University of South Florida, Tampa

PAGE 72

62 11. Clarkson, B. H., D. Krell, J. S. Wefel, J. Crall, a nd F. F. Feagin. 1987. In vitro caries like lesion production by Streptococcus mutans and Actinomyces viscosus using sucrose and starch. J Dent Res 66: 795 8. 12. Cleveland, W. S., Grosse, E., Shyu, W.M.,. 1992. Local Regression models In T. J. Hastie (ed.) In Statistical Models in S. Wadsworth & Brooks/Cole, Pacific Grove, CA. 13. Darenfed, H., D. Grenier, and D. Mayrand. 1999. Acquisition of plasmin activity by Fusobacterium nucleatum subsp. nucleatum and potential contribution to tissue destruction durin g periodontitis. Infect Immun 67: 6439 44. 14. Davey, M. E., and A. O'Toole G. 2000. Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev 64: 847 67. 15. Duan, Y., E. Fisher, D. Malamud, E. Golub, and D. R. Demuth. 1994. Calcium bin ding properties of SSP 5, the Streptococcus gordonii M5 receptor for salivary agglutinin. Infect Immun 62: 5220 6. 16. Dung, T. Z., and A. H. Liu. 1999. Molecular pathogenesis of root dentin caries. Oral Dis 5: 92 9. 17. Fontana, M., A. J. Dunipace, G. K. St ookey, and R. L. Gregory. 1999. Intranasal immunization against dental caries with a Streptococcus mutans enriched fimbrial preparation. Clin Diagn Lab Immunol 6: 405 9. 18. Gabig, M., Wgrzyn, G.,. 2001. An introduction to DNA chips: principles, technology applications and analysis. Acta Biochimica Polonica 48: 615 622. 19. Hahn, C. L., W. A. Falkler, Jr., and G. E. Minah. 1993. Correlation between thermal sensitivity and microorganisms isolated from deep carious dentin. J Endod 19: 26 30. 20. Hajishengallis G., T. Koga, and M. W. Russell. 1994. Affinity and specificity of the interactions between Streptococcus mutans antigen I/II and salivary components. J Dent Res 73: 1493 502. 21. Han, T. K., C. Zhang, and M. L. Dao. 2006. Identification and characterizati on of collagen binding activity in Streptococcus mutans wall associated protein: a possible implication in dental root caries and endocarditis. Biochem Biophys Res Commun 343: 787 92. 22. Han, T. K., Z. Zhu, and M. L. Dao. 2004. Identification, molecular cl oning, and sequence analysis of a deoxyribose aldolase in Streptococcus mutans GS 5. Curr Microbiol 48: 230 6. 23. Hoshino, E. 1985. Predominant obligate anaerobes in human carious dentin. J Dent Res 64: 1195 8.

PAGE 73

63 24. Ioannides, M. 2004. Detection, cloning an d analysis of a u32 collagenase in streptococcus mutans gs 5. University of South Florida, Tampa. 25. Jackson, R. J., D. V. Lim, and M. L. Dao. 1997. Identification and analysis of a collagenolytic activity in Streptococcus mutans. Curr Microbiol 34: 49 54. 26. Jung, C. M., O. Matsushita, S. Katayama, J. Minami, J. Sakurai, and A. Okabe. 1999. Identification of metal ligands in the Clostridium histolyticum ColH collagenase. J Bacteriol 181: 2816 22. 27. Kaufman, H. W., J. J. Pollock, and A. J. Gwinnett. 1988. Microbial caries induction in the roots of human teeth in vitro. Arch Oral Biol 33: 499 503. 28. Kolaskar, A. S., and P. C. Tongaonkar. 1990. A semi empirical method for prediction of antigenic determinants on protein antigens. FEBS Lett 276: 172 4. 29. Kol enbrander, P. E. 2000. Oral microbial communities: biofilms, interactions, and genetic systems. Annu Rev Microbiol 54: 413 37. 30. Kolenbrander, P. E., R. N. Andersen, and L. V. Moore. 1989. Coaggregation of Fusobacterium nucleatum, Selenomonas flueggei, Se lenomonas infelix, Selenomonas noxia, and Selenomonas sputigena with strains from 11 genera of oral bacteria. Infect Immun 57: 3194 203. 31. Komiyama, K., and R. L. Khandelwal. 1992. Acid production by Actinomyces viscosus of root surface caries and non car ies origin during glycogen synthesis and degradation at different pH levels. J Oral Pathol Med 21: 343 7. 32. Kuramitsu, H. K., and A. Paul. 1980. Role of bacterial interactions in the colonization of oral surfaces of Actinomyces viscosus. Infect Immun 29: 8 3 90. 33. Lamont, R. J., D. R. Demuth, C. A. Davis, D. Malamud, and B. Rosan. 1991. Salivary agglutinin mediated adherence of Streptococcus mutans to early plaque bacteria. Infect Immun 59: 3446 50. 34. Lamont, R. J., and B. Rosan. 1990. Adherence of mutans streptococci to other oral bacteria. Infect Immun 58: 1738 43. 35. Lemarchand, K., L. Masson, and R. Brousseau. 2004. Molecular biology and DNA microarray technology for microbial quality monitoring of water. Crit Rev Microbiol 30: 145 72. 36. Meng, L., G. A. Michaud, J. S. Merkel, F. Zhou, J. Huang, D. R. Mattoon, and B. Schweitzer. 2008. Protein kinase substrate identification on functional protein arrays. BMC Biotechnol 8: 22.

PAGE 74

64 37. Moore, W. E., and L. V. Moore. 1994. The bacteria of periodontal diseases. P eriodontol 2000 5: 66 77. 38. Ochiai, K., T. Kurita Ochiai, Y. Kamino, and T. Ikeda. 1993. Effect of co aggregation on the pathogenicity of oral bacteria. J Med Microbiol 39: 183 90. 39. Olson, M. E., H. Ceri, D. W. Morck, A. G. Buret, and R. R. Read. 2002. Biofilm bacteria: formation and comparative susceptibility to antibiotics. Can J Vet Res 66: 86 92. 40. Otsu, N. 1979. A Threshold Segmentation Method from Gray Level Histograms. IEEE Transactions on Systems, Man and Cybernetics 9: 62 66. 41. Ozaki, K., T. M atsuo, H. Nakae, Y. Noiri, M. Yoshiyama, and S. Ebisu. 1994. A quantitative comparison of selected bacteria in human carious dentine by microscopic counts. Caries Res 28: 137 45. 42. Palmer, R. J., Jr., S. M. Gordon, J. O. Cisar, and P. E. Kolenbrander. 200 3. Coaggregation mediated interactions of streptococci and actinomyces detected in initial human dental plaque. J Bacteriol 185: 3400 9. 43. Paster, B. J., S. K. Boches, J. L. Galvin, R. E. Ericson, C. N. Lau, V. A. Levanos, A. Sahasrabudhe, and F. E. Dewhi rst. 2001. Bacterial diversity in human subgingival plaque. J Bacteriol 183: 3770 83. 44. Peterson, S., R. T. Cline, H. Tettelin, V. Sharov, and D. A. Morrison. 2000. Gene expression analysis of the Streptococcus pneumoniae competence regulons by use of DNA microarrays. J Bacteriol 182: 6192 202. 45. Rogers, A. H., J. Chen, P. S. Zilm, and N. J. Gully. 1998. The behaviour of Fusobacterium nucleatum chemostat grown in glucose and amino acid based chemically defined media. Anaerobe 4: 111 6. 46. Rosengren, L., and B. Winblad. 1976. Proteolytic activity of Streptococcus mutans (GS 5). Oral Surg Oral Med Oral Pathol 42: 801 9. 47. Schembri, M. A., K. Kjaergaard, and P. Klemm. 2003. Global gene expression in Escherichia coli biofilms. Mol Microbiol 48: 253 67. 48. Sc hena, M., D. Shalon, R. Heller, A. Chai, P. O. Brown, and R. W. Davis. 1996. Parallel human genome analysis: microarray based expression monitoring of 1000 genes. Proc Natl Acad Sci U S A 93: 10614 9. 49. Sharma, Y., C. M. Rao, S. C. Rao, A. G. Krishna, T. Somasundaram, and D. Balasubramanian. 1989. Binding site conformation dictates the color of the dye stains all. A study

PAGE 75

65 of the binding of this dye to the eye lens proteins crystallins. J Biol Chem 264: 20923 7. 50. Shemesh, M., A. Tam, and D. Steinberg. 200 7. Differential gene expression profiling of Streptococcus mutans cultured under biofilm and planktonic conditions. Microbiology 153: 1307 17. 51. Stinson, M. W., D. C. Jinks, and J. M. Merrick. 1981. Adherence of Streptococcus mutans and Streptococcus sang uis to salivary components bound to glass. Infect Immun 32: 583 91. 52. Stosser, L., S. Kneist, W. Grosser, and W. Kunzel. 1989. [Root caries -a rat model]. Zahn Mund Kieferheilkd Zentralbl 77: 655 8. 53. Switalski, L. M., W. G. Butcher, P. C. Caufield, and M. S. Lantz. 1993. Collagen mediates adhesion of Streptococcus mutans to human dentin. Infect Immun 61: 4119 25. 54. Tanzer, J. M., J. Livingston, and A. M. Thompson. 2001. The microbiology of primary dental caries in humans. J Dent Educ 65: 1028 37. 55. Tin g, J. C., E. D. Roberson, N. D. Miller, A. Lysholm Bernacchi, D. A. Stephan, G. T. Capone, I. Ruczinski, G. H. Thomas, and J. Pevsner. 2007. Visualization of uniparental inheritance, Mendelian inconsistencies, deletions, and parent of origin effects in sin gle nucleotide polymorphism trio data with SNPtrio. Hum Mutat 28: 1225 35. 56. Tsang, P., J. Merritt, T. Nguyen, W. Shi, and F. Qi. 2005. Identification of genes associated with mutacin I production in Streptococcus mutans using random insertional mutagenes is. Microbiology 151: 3947 55. 57. Van der Reijden, W. A., N. Dellemijn Kippuw, A. M. Stijne van Nes, J. J. de Soet, and A. J. van Winkelhoff. 2001. Mutans streptococci in subgingival plaque of treated and untreated patients with periodontitis. J Clin Perio dontol 28: 686 91. 58. van Strijp, A. J., T. J. van Steenbergen, and J. M. ten Cate. 1997. Bacterial colonization of mineralized and completely demineralized dentine in situ. Caries Res 31: 349 55. 59. Yamashita, Y., W. H. Bowen, R. A. Burne, and H. K. Kuram itsu. 1993. Role of the Streptococcus mutans gtf genes in caries induction in the specific pathogen free rat model. Infect Immun 61: 3811 7.

PAGE 76

66 APPENDICES

PAGE 77

67 APPENDIX I Microarray Data SM/MIX2 Locus Number Putati ve Function Locus ID Log2 Ratio 302.00 conserved hypothetical protein; putative membrane protein 2.153 1606.00 putative SsrA binding protein homolog smpB 1.870 1912c hypothetical protein 1.742 1909c hypothetical protein 1.644 1906c hypothe tical protein 1.540 1781.00 conserved hypothetical protein 1.389 1479.00 conserved hypothetical protein 1.368 540.00 peroxide resistance protein Dpr dpr 1.364 676.00 NADP dependent glyceraldehyde 3 phosphate dehydrogenase gapN 1.361 1913c puta tive immunity protein, BLpL like 1.334 257.00 putative transmembrane protein, permease OppC oppC 1.331 1641c conserved hypothetical protein 1.329 2105.00 hypothetical protein 1.288 2000.00 50S ribosomal protein L17 rl17 1.279 1908c hypothetica l protein 1.245 1709.00 putative potassium uptake protein TrkH trkH 1.244 650.00 putative alanyl tRNA synthetase (alanine -tRNA ligase) 1.235 473.00 conserved hypothetical protein 1.206 1902c hypothetical protein 1.188 186.00 putative metal d ependent transcriptional regulator sloR 1.179 2043c conserved hypothetical protein 1.178 178.00 conserved hypothetical protein 1.169 1910c hypothetical protein 1.160 1914c hypothetical protein 1.159 1556.00 putative methionine aminopeptidase A ampM 1.152 1205c hypothetical protein 1.133 1672.00 putative ATP dependent Clp protease, proteolytic subunit clpP 1.131 148.00 putative alcohol acetaldehyde dehydrogenase adhE 1.122 1719c conserved hypothetical protein 1.114 913.00 putative N ADP specific glutamate dehydrogenase 1.107 1872c conserved hypothetical protein 1.102 753.00 conserved hypothetical protein 1.089 1821c putative glutamyl tRNA (Gln) amidotransferase subunit C 1.087 479.00 RNA polymerase associated protein RpoZ, omega subunit rpoZ 1.081 1655c hypothetical protein 1.075 1843.00 sucrose 6 phosphate hydrolase scrB 1.071 819.00 putative large conductance mechanosensitive channel mscL 1.068 339.00 hypothetical protein 1.055 1366c putative ABC transporter; ATP binding protein 1.051 359.00 translation elongation factor G (EF G) 1.045 2023c 30S ribosomal protein S19 1.041 1697c conserved hypothetical protein 1.038 1383.00 putative 3 isopropylmalate dehydrogenase leuB 1.036 818.00 30S ribosomal pr otein S21 1.023 1308.00 putative translation initiation inhibitor; aldR regulator homolog aldR 1.017 453.00 conserved hypoyhetical protein 1.013 1249c hypothetical protein 1.012 1869.00 putative thioredoxin trxA 1.005

PAGE 78

68 722.00 hypothetical prote in 0.996 411c conserved hypothetical protein 0.992 1988c putative DNA binding protein 0.990 1546.00 conserved hypothetical protein 0.990 409.00 conserved hypothetical protein 0.988 831.00 conserved hypothetical protein 0.982 1073.00 putat ive formyl tetrahydrofolate synthetase fthS 0.981 1802c conserved hypothetical protein 0.979 2012.00 30S ribosomal protein S8 rs8 0.976 34.00 putative phosphoribosylformylglycinamide cyclo ligase (AIRS); phosphoribosyl aminoimidazole synthetase purM 0.968 1903c hypothetical protein 0.968 721.00 conserved hypothetical protein 0.965 1231c hypothetical protein 0.963 1665.00 putative branched chain amino acid ABC transporter, ATP binding protein livF 0.963 1705.00 hypothetical protein 0.95 1 1473c putative oxidoreductase 0.943 2127.00 putative succinate semialdehyde dehydrogenase 0.935 1537.00 putative glycogen biosynthesis protein GlgD glgD 0.935 697.00 putative translation initiation factor IF3 0.933 1917.00 putative response r egulator of the competence regulon, ComE; response regulator of sakacin A production comE 0.929 770c putative manganese transporter 0.928 155.00 polyribonucleotide nucleotidyltransferase pnpA 0.927 1564.00 putative glycogen phosphorylase glgP 0.916 609.00 putative 40K cell wall protein precursor 0.915 1603.00 putative lactoylglutathione lyase lguL 0.913 187c conserved hypothetical protein 0.912 1538.00 putative glucose 1 phosphate adenylyltransferase; ADP glucose pyrophosphorylase glgC 0.9 10 2077c conserved hypothetical protein 0.908 805c putative amino acid ABC transporter, ATP binding protein 0.899 2147c conserved hypothetical protein 0.898 154.00 30S ribosomal protein S15 0.897 1014.00 hypothetical protein 0.895 1904c hyp othetical protein 0.895 1623c conserved hypothetical protein 0.889 1279c putative cell division protein (cell shape determining protein) 0.884 1762c conserved hypothetical protein 0.883 2090c conserved hypothetical protein 0.878 1510.00 puta tive phenylalanyl tRNA synthetase (beta subunit) syfB 0.877 139.00 conserved hypothetical protein 0.874 882.00 multiple sugar binding ABC transporter, ATP binding protein, MsmK msmK 0.870 323.00 putative glycerol 3 phosphate dehydrogenase gpsA 0.86 9 1831.00 putative L asparaginase aspG 0.865 1774c tRNA Thr 0.863 1038c putative response regulator 0.863 502.00 conserved hypothetical protein 0.862 804.00 hypothetical protein 0.861 1472.00 putative single strand DNA specific exonuclease R ecJ recJ 0.860 636.00 putative N acetylglucosamine 6 phosphate isomerase 0.859

PAGE 79

69 2152c conserved hypothetical protein 0.859 911c hypothetical protein 0.857 1783.00 putative prolyl tRNA synthetase proS 0.856 2007.00 50S ribosomal protein L15 rl15 0.853 1638c hypothetical protein 0.852 1613c conserved hypothetical protein 0.851 1357.00 putative transposase fragment 0.849 475.00 conserved hypothetical protein 0.849 390.00 hypothetical protein 0.844 32.00 phosphoribosylpyrophosphate amidotransferase purF 0.843 806c putative glutamine ABC transporter, permease protein 0.842 534.00 putative phosphoribosyl anthranilate transferase trpD 0.842 2001.00 DNA directed RNA polymerase, alpha subunit rpoA 0.838 765.00 NADH oxidase/alkyl hydroperoxidase reductase peroxide forming 0.836 764.00 alkyl hydroperoxide reductase ahpC 0.833 1664c putative acetoin utilization protein, acetoin dehydrogenase 0.833 1925c conserved hypothetical protein 0.831 1209c hypothetical protein 0.83 0 1138.00 putative ABC transporter, phosphate binding protein pstS 0.828 1803c hypothetical protein 0.827 1763c conserved hypothetical protein 0.826 1819.00 putative glutamyl tRNA (Gln) amidotransferase subunit B gatB 0.826 325.00 putative dUTPa se 0.825 2116.00 putative osmoprotectant amino acid ABC transporter, ATP binding protein opuCa 0.821 1849.00 putative deoxycytidylate deaminase comEB 0.819 1337c putative alpha/beta superfamily hydrolase 0.818 2112.00 glucan binding protein A, Gb pA gbpA 0.817 1798c conserved hypothetical protein 0.817 366.00 NADPH dependent glutamate synthase (small subunit) gltB 0.816 93c hypothetical protein; putative transposase fragment 0.815 66.00 conserved hypothetical protein 0.815 1243.00 puta tive low temperature requirement A protein 0.810 392c conserved hypothetical protein 0.808 613.00 hypothetical protein 0.807 629.00 putative manganese type superoxide dismutase, Fe/Mn SOD sod 0.803 1758c conserved hypothetical protein 0.802 1 365c hypothetical protein; possible permease 0.802 388.00 putative integral membrane protein; possible branched chain amino acid permease 0.799 457.00 hypothetical protein 0.798 1792c hypothetical protein 0.795 2138.00 putative replicative DNA helicase (DNA polymerase III delta prime subunit) dnaC 0.792 277.00 hypothetical protein 0.792 554.00 conserved hypothetical protein ylmF 0.791 1766c hypothetical protein 0.791 518.00 conserved hypothetical protein 0.790 947.00 putative dihydr ofolate reductase dfrA 0.787 143c putative polypeptide deformylase 0.786 2137c conserved hypothetical protein 0.785 1278c conserved hypothetical protein 0.784

PAGE 80

70 1324.00 putative cell division protein FtsX ftsX 0.781 279.00 hypothetical protein 0.780 2024c 50S ribosomal protein L4 0.779 441.00 putative transcriptional regulator 0.779 1991.00 putative membrane carboxypeptidase, penicillin binding protein 1b pbp1b 0.779 822.00 DNA dependent RNA polymerase sigma subunit; major sigma factor (sigma 70/42) rpoD 0.778 1390.00 conserved hypothetical protein 0.775 1277.00 putative DNA gyrase subunit B gyrB 0.774 955.00 conserved hypothetical protein 0.773 1533.00 FoF1 membrane bound proton translocating ATPase, a subunit atpG 0.769 10 03.00 putative glucose inhibited division protein gid 0.768 353.00 conserved hypothetical protein 0.768 91.00 peptidyl prolyl isomerase RopA (trigger factor) ropA 0.767 1787c putative secreted protein 0.767 1313c putative ATP dependent DNA helica se; DNA polymerase III, epsilon subunit (3' 5' exonuclease) 0.767 998.00 putative ABC transporter, periplasmic ferrichrome binding protein 0.765 125.00 conserved hypothetical protein 0.763 1971c putative thioredoxin H1 0.761 1307c conserved hyp othetical protein 0.760 923.00 putative ABC transporter, ATP binding protein 0.760 11.00 conserved hypothetical protein 0.760 2037.00 putative trehalose 6 phosphate hydrolase TreA treA 0.759 227c conserved hypothetical protein 0.758 1557c con served hypothetical protein 0.758 1454c putative membrane protein; possible permease 0.757 1444c conserved hypothetical protein 0.753 1930.00 putative cytoplasmic membrane protein; LemA like protein lemA 0.748 1800c conserved hypothetical protei n 0.748 924.00 thiol peroxidase tpx 0.748 1091.00 hypothetical protein; possible cell wall protein, WapE wapE 0.740 1515.00 conserved hypothetical protein CovX (VicX) covX 0.740 10.00 conserved hypothetical protein 0.739 1063.00 putative ABC tr ansporter, ATP binding protein, proline/glycine betaine transport system opuAa 0.739 1084.00 putative protoporphyrinogen oxidase hemK 0.736 1768c hypothetical protein 0.735 1961c putative PTS system, sugar specific enzyme IIA component 0.733 67.0 0 putative acyltransferase 0.733 672.00 isocitrate dehydrogenase idh 0.731 123.00 DNA polymerase III, alpha subunit 0.730 1173.00 putative O acetylhomoserine sulfhydrylase cysD 0.729 420.00 putative ribosomal protein 0.729 1750c hypothetical p rotein 0.727 1975c conserved hypothetical protein; possible membrane protein 0.726 1776c conserved hypothetical protein 0.726 1764c conserved hypothetical protein 0.722 714.00 translation elongation factor EF Tu 0.721 1838.00 preprotein tran slocase subunit SecA secA 0.720 768c conserved hypothetical protein 0.718

PAGE 81

71 530c conserved hypothetical protein 0.716 2031.00 putative translation elongation factor TS eftS 0.711 610.00 cell surface antigen SpaP spaP 0.711 2128.00 putative dihydr oxy acid dehydratase 0.706 2078c conserved hypothetical protein 0.705 412c putative Hit like protein involved in cell cycle regulation 0.704 1723c conserved hypothetical protein 0.703 2086.00 putative competence and damage inducible protein Cin A cinA 0.702 1609c putative membrane protein involved in protein secretion, SecG 0.702 597.00 penicillin binding protein 2b pbp2b 0.700 1943.00 putative leucyl tRNA synthetase syl 0.698 974.00 putative spermidine/putrescine ABC transporter, permea se protein potB 0.698 1561.00 putative potassium uptake system protein TrkB trkB 0.698 1945.00 hypothetical protein 0.697 1545c conserved hypothetical protein 0.697 1599.00 putative transcriptional regulator; possible antiterminator celR 0.696 2004.00 putative translation initiation factor IF 1 if1 0.695 2117.00 putative osmoprotectant ABC transporter; permease protein opuCb 0.693 1090.00 conserved hypothetical protein 0.693 713.00 putative cell division protein FtsW ftsW 0.692 1791c co nserved hypothetical protein 0.690 2149c putative ABC transporter, ATP binding protein; possible cobalt transport system 0.690 1240c putative nitroreductase 0.690 834.00 conserved hypothetical protein 0.686 1736.00 putative acetyl CoA carboxyla se biotin carboxylase subunit accC 0.685 389.00 conserved hypothetical protein 0.684 2025.00 50S ribosomal protein L3 rl3 0.683 1745c putative transcriptional regulator 0.683 1721c putative diaminopimelate decarboxylase 0.681 1210.00 putative DNA topoisomerase IV, subunit B parE 0.676 2098.00 putative arginyl tRNA synthase argS 0.676 251.00 conserved hypothetical protein; possible ABC transporter, membrane component 0.675 1830c conserved hypothetical protein 0.675 2143c putative tRNA 0.674 1197.00 tRNA Arg 0.672 1317c hypothetical protein 0.670 614.00 hypothetical protein 0.665 1862.00 hypothetical protein 0.665 2074.00 putative anaerobic ribonucleoside triphosphate reductase nrdD 0.664 2084c conserved hypothetical pro tein 0.663 1524c conserved hypothetical protein 0.663 462.00 conserved hypothetical protein 0.662 925.00 hypothetical protein 0.660 471.00 conserved hypothetical protein 0.659 1529.00 FoF1 membrane bound proton translocating ATPase, gamma su bunit atpC 0.658 901.00 putative poly(A) polymerase papS 0.658 1127.00 putative 30S ribosomal protein S20 rs20 0.657 226c putative transposase 0.655 361.00 phosphoglycerate kinase pgk 0.655

PAGE 82

72 1757c conserved hypothetical protein 0.653 1977c put ative transcriptional regulator 0.652 394c conserved hypothetical protein 0.650 1634c conserved hypothetical protein 0.649 1082.00 putative serine hydroxymethyltransferase glyA 0.646 1535.00 glycogen phosphorylase phsG 0.644 855.00 conserved h ypothetical protein 0.644 1256c hypothetical protein 0.644 1974.00 putative pyrroline carboxylate reductase proC 0.642 1881c putative ABC transporter, ATP binding protein 0.642 1080c conserved hypothetical protein; possible transposon related pr otein 0.641 975.00 putative spermidine/putrescine ABC transporter, permease protein potC 0.641 950.00 putative GTP binding protein 0.639 59.00 adenylosuccinate lyase purB 0.639 1777.00 putative ribonucleotide reductase protein, Nrd nrdI 0.638 1 207.00 similar to mobilization/cell filamentation proteins fic 0.637 1653.00 putative D 3 phosphoglycerate dehydrogenase serA 0.635 996.00 putative ABC transporter, permease protein; possible ferrichrome transport system 0.635 1386.00 putative uridi ne kinase urk 0.635 757.00 hypothetical protein 0.635 1104c conserved hypothetical protein; phosphoglycerate mutase like protein 0.634 1714c hypothetical protein 0.634 1770.00 putative valyl tRNA synthetase syv 0.633 1916.00 putative histidine kinase of the competence regulon, ComD comD 0.633 421.00 translation initiation factor 2 0.631 1728.00 putative transcription elongation factor GreA greA 0.630 448.00 hypothetical protein 0.630 1342.00 putative bacitracin synthetase 1; BacA bacA 1 0.627 1122.00 putative cytidine deaminase cdd 0.624 235.00 conserved hypothetical protein 0.623 973.00 putative spermidine/putrescine ABC transporter, ATP binding protein potA 0.621 571.00 hypothetical protein 0.621 649.00 conserved hypotheti cal protein 0.621 27.00 putative acyl carrier protein; AcpP; ACP acpP 0.621 1363c putative transposase 0.620 2047.00 putative PTS system, glucose specific IIABC component ptsG 0.619 2083c hypothetical protein 0.617 692.00 hypothetical protein 0.616 1627.00 50S ribosomal L11 protein rl11 0.615 776.00 conserved hypothetical protein 0.615 1610.00 50S ribosomal protein L33 rl33 0.614 1618.00 diacylglycerol kinase dagK 0.613 2157.00 inosine monophosphate dehydrogenase guaB 0.613 466.00 cysteine aminopeptidase C pepC 0.610 400.00 putative secreted esterase 0.610 1797c conserved hypothetical protein 0.610 1020.00 putative citrate lyase CilB, citryl CoA lyase, beta subunit cilB 0.609 1789c conserved hypothetical protein 0.609

PAGE 83

73 1452.00 alpha acetolactate synthase alsS 0.609 70.00 putative threonine synthase thrC 0.608 446.00 putative glycyl tRNA synthetase (beta subunit) sygB 0.607 1095.00 putative choline ABC transporter, osmoprotectant binding protein opuBc 0.606 1217c putative ABC transporter, amino acid binding protein 0.605 1920.00 phosphoglycerate dehydrogenase pgdA 0.604 949.00 ATP dependent protease Clp, ATPase subunit ClpX clpX 0.604 1996.00 putative isopentenyl monophosphate kinase ipk 0.603 484.00 putat ive serine/threonine protein kinase pknB 0.603 65.00 putative protein tyrosine phosphatase 0.603 413.00 putative ABC transporter, ATP binding protein 0.602 333.00 hypothetical protein 0.601 514.00 putative transcriptional regulator 0.601 1845 .00 putative transcription termination factor nusB 0.599 1002.00 putative DNA topoisomerase I topA 0.597 1888.00 hypothetical protein; possible transposase fragment 0.596 469.00 putative recombination protein U recU 0.596 56.00 conserved hypotheti cal protein 0.596 1017.00 putative oxaloacetate decarboxylase, sodium ion pump subunit oadB 0.595 1211.00 conserved hypothetical protein 0.595 1238c conserved hypothetical protein 0.594 1531.00 FoF1 membrane bound proton translocating ATPase, de lta subunit atpE 0.592 1029.00 conserved hypothetical protein 0.590 523.00 conserved hypothetical protein 0.589 840c hypothetical protein 0.589 9.00 conserved hypothetical protein 0.588 588.00 conserved hypothetical protein 0.588 222c hypo thetical protein; possible integrase fragment 0.587 2028.00 levansucrase precursor; beta D fructosyltransferase sacB 0.586 229.00 conserved hypothetical protein 0.586 1338c putative permease; possible multidrug efflux transporter 0.585 1542c con served hypothetical protein 0.584 987.00 cell wall associated protein precursor WapA wapA 0.583 402.00 pyruvate formate lyase pfl 0.583 41.00 hypothetical protein 0.582 1846c conserved hypothetical protein 0.580 2052c hypothetical protein 0. 579 1715c conserved hypothetical protein 0.579 291.00 transketolase tkt 0.579 1059.00 hypothetical protein, SatC satC 0.578 662.00 conserved hypothetical protein; possible membrane protein 0.577 1044c putative pseudouridylate synthase 0.577 1 077.00 putative phosphoglucomutase pgm 0.576 248.00 putative ABC transporter, membrane protein 0.574 1680c hypothetical protein 0.573 1635.00 putative UDP N acetylglucosamine pyrophosphorylase glmU 0.573 775c conserved hypothetical protein; possi ble integral membrane protein 0.572 1907.00 hypothetical protein 0.572 1738.00 putative biotin carboxyl carrier protein of acetyl CoA carboxylase bccP 0.571

PAGE 84

74 1779c putative RNA methyltransferase 0.569 1874.00 putative signal peptidase I lepC 0.5 69 1566.00 putative maltose operon transcriptional repressor malR 0.568 587.00 conserved hypothetical protein 0.568 283.00 hypothetical protein 0.568 2029.00 class III stress response related ATP dependent Clp protease, ATP binding subunit clpC 0 .566 179.00 conserved hypothetical protein 0.566 63c conserved hypothetical protein 0.565 965.00 homoserine dehydrogenase 0.565 1755c conserved hypothetical protein 0.565 1227.00 putative purine nucleoside phosphorylase deoD 0.563 1622.00 pu tative peptide methionine sulfoxide reductase pmsR 0.562 480.00 primosomal replication factor Y (primosomal protein N') priA 0.562 487.00 putative response regulator 0.559 2058.00 putative transcriptional regulator 0.559 1191.00 6 phosphofructoki nase pfk 0.557 1706.00 conserved hypothetical protein 0.556 1451.00 putative alpha acetolactate decarboxylase aldB 0.556 225c hypothetical protein 0.555 1629c putative cell division protein; DNA segregation ATPase 0.555 2019.00 50s ribosomal p rotein L29 rl29 0.554 8.00 putative transcription repair coupling factor trcF 0.553 326.00 conserved hypothetical protein 0.553 481.00 putative methionyl tRNA formyltransferase 0.552 849.00 50S ribosomal protein L27 0.552 933.00 putative amino acid ABC transporter, periplasmic amino acid binding protein 0.552 1841.00 putative PTS system, sucrose specific IIABC component scrA 0.550 241c putative ABC transporter, ATP binding protein; amino acid transport system 0.549 1.00 chromosomal repl ication initiator protein, DnaA dnaA 0.548 455.00 putative penicillin binding protein 2X pbp2x 0.548 1786.00 putative undecaprenyl pyrophosphate synthetase uppS 0.548 1222.00 putative orotidine 5' decarboxylase PyrF pyrF 0.547 332.00 conserved hypo thetical protein 0.546 53.00 conserved hypothetical protein 0.543 232.00 acetolactate synthase, small subunit ilvH 0.543 1948.00 putative preprotein translocase subunit SecE secE 0.542 1123.00 putative deoxyribose phosphate aldolase deoC 0.541 2091c DNA mismatch repair protein 0.540 24.00 putative amino acid aminotransferase 0.539 551.00 cell division protein FtsA ftsA 0.538 464.00 putative nicotinate phosphoribosyltransferase 0.538 1520.00 putative ABC transporter, glutamine binding protein 0.537 756.00 conserved hypothetical protein 0.537 223c hypothetical protein 0.536 1717c conserved hypothetical protein 0.536 1929.00 putative protease HtpX, heat shock protein htpX 0.535 2033c tRNA Cys 0.534 1820c putative glutamyl tRNA(Gln) amidotransferase A subunit 0.534 1639.00 putative methionyl tRNA synthetase metS 0.533 1344c putative malonyl CoA acyl carrier protein transacylase 0.533

PAGE 85

75 1968c conserved hypothetical protein 0.532 2118.00 putative ABC transporter; osm oprotectant binding protein, glycine betaine/carnitine/choline ABC transporter opuCc 0.531 355.00 putative CMP binding factor 0.529 128.00 putative acetoin dehydrogenase (TPP dependent), E1 component beta subunit adhB 0.529 245.00 putative negative regulator of genetic competence MecA mecA 0.529 410.00 putative transcriptional regulator brpA 0.527 525.00 putative ABC transporter, ATP binding protein 0.526 1541.00 putative pullulanase pulA 0.525 871.00 putative fructose 1 phosphate kinase pfk B 0.524 853.00 putative lipoprotein signal peptidase lspA 0.524 1426c putative phospho sugar mutase 0.524 1733c putative SNF helicase 0.524 2087.00 putative 3 methyl adenine DNA glycosylase I tagI 0.524 2071.00 putative anaerobic ribonucleotide reductase activating protein 0.523 1395c hypothetical protein 0.520 967.00 putative folyl polyglutamate synthetase folC 0.520 1088.00 putative thiamine biosynthesis lipoprotein apbE 0.519 1051.00 putative iron sulfur cofactor synthesis protein; NifS family 0.518 298.00 conserved hypothetical protein 0.518 1192.00 DNA polymerase III, alpha chain dnaE 0.517 1414c conserved hypothetical protein 0.517 48.00 putative phosphoribosylamine glycine ligase; phosphoribosyl glycinamide synthetase (GARS) purD 0.515 486.00 putative histidine kinase 0.515 1834.00 putative alanine racemase alr 0.514 1415c putative phosphatases involved in N acetyl glucosamine catabolism 0.513 1835.00 putative acyl carrier protein synthase; AcpS acpS 0.513 4 0.00 conserved hypothetical protein 0.510 1037c putative histidine kinase 0.510 1716c conserved hypothetical protein 0.509 1568.00 putative maltose/maltodextrin ABC transporter, sugar binding protein MalX malX 0.508 1878.00 putative PTS system, mannose specific component IIC ptnC 0.508 1801c putative GTP binding protein 0.508 1096.00 putative ABC transporter, ATP binding protein, choline transporter opuBa 0.507 54.00 putative amino acid recemase 0.507 247.00 putative ABC transporter, AT P binding protein 0.506 858.00 putative aspartate transcarbamoylase pyrB 0.506 1624.00 putative ribosome recycling factor rrf1 0.505 1839.00 mannose 6 phosphate isomerase manA 0.503 1530.00 FoF1 membrane bound proton translocating ATPase, alpha su bunit atpD 0.503 2027.00 putative transcriptional regulator 0.503 957.00 50S ribosomal protein L10 0.502 522.00 conserved hypothetical protein 0.501 1601.00 putative phospho beta glucosidase bgl 0.501 385.00 putative glycoprotein endopeptidase 0.500 424.00 negative transcriptional regulator, CopY copY 0.500 2011.00 50S ribosomal protein L6 (BL10) rl6 0.500

PAGE 86

76 1314.00 conserved hypothetical protein 0.499 83.00 heat shock protein DnaJ (HSP 40) dnaJ 0.499 2140c conserved hypothetical prot ein 0.498 173.00 putative ppGpp regulated growth inhibitor 0.496 157.00 putative serine acetyltransferase; serine O acetyltransferase cysE 0.496 1976c hypothetical protein 0.495 899.00 conserved hypothetical protein 0.495 2146c hypothetical p rotein 0.495 1230c conserved hypothetical protein 0.493 575c putative membrane protein 0.493 1346.00 putative thioesterase BacT bacT 0.493 516.00 conserved hypothetical protein 0.493 1727.00 putative inner membrane protein 0.493 2120c puta tive 3 methyladenine DNA glycosylase 0.492 1742c putative trans 2 enoyl ACP reductase 0.491 1419.00 putative transcriptional regulator 0.491 2104a 50S ribosomal protein L32 0.491 1522.00 putative amino acid ABC transporter, integral membrane pr otein glnP 0.490 1109c putative integral membrane protein; possible permease 0.489 1617.00 GTP binding protein; Era homolog era 0.488 596.00 phosphoglyceromutase pmgY 0.487 843.00 conserved hypothetical protein 0.486 1649.00 putative exodeoxyri bonuclease III exoA 0.485 1581.00 DNA polymerase III, gamma/tau subunit dnaX 0.482 305.00 hypothetical protein 0.482 470.00 conserved hypothetical protein 0.481 1053.00 conserved hypothetical protein 0.480 467.00 penicillin binding protein 1a; membrane carboxypeptidase pbp1a 0.480 1955.00 putative co chaperonin GroES groES 0.479 1058.00 conserved hypothetical protein, SatD satD 0.479 2057c putative cadmium transporting ATPase; P type ATPase 0.479 648.00 putative protease maturation pro tein precursor prtM 0.479 2142.00 putative sugar phosphate isomerase rpiB 0.478 1548c putative histidine kinase 0.477 1854.00 conserved hypothetical protein 0.477 914c conserved hypothetical protein 0.475 963c conserved hypothetical protein; p utative deacetylase 0.475 1361c putative transcriptional regulator (TetR family) 0.475 1246c putative transcriptional regulator 0.474 234.00 threonine dehydratase ilvA 0.474 716.00 putative peptidoglycan branched peptide synthesis protein; alani ne adding enzyme; beta lactam resistance factor MurN murN 0.473 463.00 putative thioredoxin reductase (NADPH) trxB 0.473 1450.00 putative amino acid permease 0.473 844.00 conserved hypothetical protein 0.473 1615c conserved hypothetical protein 0.471 542.00 putative glucose kinase glk 0.471 1005.00 glucosyltransferase SI gtfC 0.469 821.00 putative DNA primase dnaG 0.467 89c putative nitrite transporter 0.466 2088.00 putative Holliday junction DNA helicase RuvA ruvA 0.466 287.00 putat ive ComB, accessory factor for ComA 0.466

PAGE 87

77 84.00 putative tRNA pseudouridine synthase A truA 0.465 1765c hypothetical protein 0.464 1588c putative hexosyltransferase 0.464 2072c conserved hypothetical protein; possible acetyltransferase 0.463 335.00 argininosuccinate lyase 0.463 1459c hypothetical protein 0.463 1292c conserved hypothetical protein 0.463 699.00 50S ribosomal protein L20 0.462 2100c conserved hypothetical protein 0.462 2006.00 putative preprotein translocase SecY p rotein secY 0.461 106c tRNA Thr 0.461 600c conserved hypothetical protein 0.460 1853.00 conserved hypothetical protein 0.459 558.00 isoleucine tRNA synthetase 0.459 1573.00 putative S adenosylmethionine synthetase metK 0.459 252.00 hypothet ical protein 0.459 991.00 putative ribonucleotide reductase 0.458 39.00 conserved hypothetical protein 0.456 367.00 hypothetical protein 0.456 1384.00 putative 2 isopropylmalate synthase leuA 0.456 358.00 30S ribosomal protein S7 0.456 883 .00 dextran glucosidase DexB dexB 0.456 1315c putative ATP binding protein 0.455 1043c putative phosphotransacetylase 0.451 36.00 conserved hypothetical protein 0.450 162c hypothetical protein 0.448 1475c conserved hypothetical protein 0.44 7 1132.00 aminopeptidase N, PepN pepN 0.446 1743.00 putative acyl carrier protein acp 0.446 1855.00 hypothetical protein 0.446 164.00 putative tRNA/rRNA methyltransferase 0.445 1848.00 hypothetical protein 0.444 170.00 30S ribosomal protein S 9 0.444 921.00 putative transcriptional regulator 0.443 500.00 putative ribosome associated protein 0.443 1312.00 aspartate aminotransferase aspB 0.442 1143c putative macrolide efflux protein 0.442 35.00 putative phosphoribosylglycinamide for myltransferase (GART) purN 0.441 2155.00 conserved hypothetical protein 0.441 2.00 putative DNA polymerase III, beta subunit d 0.439 801.00 putative GTP binding protein 0.438 1662.00 putative DNA polymerase III, delta subunit holB 0.438 1442c c onserved hypothetical protein 0.438 1923c conserved hypothetical protein 0.437 1115.00 lactate dehydrogenase ldh 0.437 1137.00 putative phosphate ABC transporter, permease protein pstC1 0.436 1502c conserved hypothetical protein 0.436 1695.00 putative ABC transporter, ATP binding protein; possible molybdenum transport system 0.436 845.00 conserved hypothetical protein 0.435 1521.00 putative amino acid ABC transporter, permease protein 0.434 202c hypothetical protein 0.434 1388.00 pu tative RNA helicase 0.433

PAGE 88

78 1114.00 DNA gyrase A subunit gyrA 0.433 357.00 30S ribosomal protein S12 0.433 1660c conserved hypothetical protein 0.432 331.00 putative transcriptional regulator 0.432 1076.00 putative membrane protein 0.431 989 .00 aspartate semialdehyde dehydrogenase asd 0.431 800.00 hypothetical protein 0.431 1528.00 FoF1 membrane bound proton translocating ATPase, beta subunit atpB 0.430 297.00 DNA polymerase I (POL I) polI 0.430 33.00 hypothetical protein 0.429 15 92.00 putative dipeptidase PepQ pepQ 0.429 2158c putative tryptophanyl tRNA synthetase 0.428 2035.00 conserved hypothetical protein; possible bacteriocin immunity protein 0.428 872.00 putative PTS system, fructose specific enzyme IIABC component 0.428 1121c putative ABC transporter 0.427 675.00 phosphoenolpyruvate:sugar phosphotransferase system enzyme I, PTS system EI component 0.426 96.00 putative DNA directed RNA polymerase, delta subunit rpoE 0.426 1474c conserved hypothetical protein 0.425 246.00 putative glycosyl transferase N acetylglucosaminyltransferase), RgpG rgpG 0.425 1488c conserved hypothetical protein 0.425 1172c conserved hypothetical protein 0.425 419.00 conserved hypothetical protein 0.425 1626.00 50S riboso mal protein L1 rl1 0.425 717.00 putative peptidoglycan branched peptide synthesis protein MurM murM 0.423 356.00 purine operon repressor purR 0.423 342.00 conserved hypothetical protein 0.423 1565.00 putative 4 alpha glucanotransferase malQ 0.423 368c conserved hypothetical protein 0.423 1679c conserved hypothetical protein 0.423 2026c 30S ribosomal protein S10 0.421 1276c putative septation ring formation regulator 0.420 966.00 homoserine kinase 0.420 1081c conserved hypothetical protein 0.418 564.00 conserved hypothetical protein 0.417 1445c putative ABC transporter, ATP binding protein 0.416 620.00 hypothetical protein 0.416 329.00 conserved hypothetical protein 0.415 549.00 putative MurG; undecaprenyl PP MurNAc pe ntapeptide UDPGlcNAc GlcNAc transferase murG 0.415 1075.00 putative DNA/pantothenate metabolism flavoprotein dfp 0.415 1656.00 putative phosphoserine aminotransferase serC 0.414 1393c conserved hypothetical protein 0.414 1676c putative membrane pr otein 0.413 701c conserved hypothetical protein; putative integral membrane protein 0.413 1190.00 pyruvate kinase pykF 0.412 627.00 conserved hypothetical protein 0.412 1188.00 putative signal peptidase lepB 0.411

PAGE 89

79 779.00 putative 3 dehydroquin ate synthase aroB 0.411 1174.00 ATP dependent DNA helicase pcrA 0.411 1311.00 putative asparaginyl tRNA synthetase asnS 0.409 1245c conserved hypothetical protein 0.408 1689.00 putative D alanyl carrier protein dltC 0.406 1517.00 putative respon se regulator CovR; VicR homolog covR 0.406 1539.00 putative 1,4 alpha glucan branching enzyme glgB 0.405 483.00 putative phosphoprotein phosphatase (pppL protein) 0.405 735.00 hypothetical protein 0.405 2097.00 hypothetical protein 0.404 960.0 0 50S ribosomal protein L7/L12 0.404 1970c putative phenylalanyl tRNA synthetase, beta subunit 0.404 418.00 putative transcription factor NusA nusA 0.404 26.00 putative fatty acid/phospholipid synthesis protein plsX 0.403 1389.00 conserved hypoth etical protein pckA 0.403 399.00 conserved hypothetical protein 0.401 408.00 putative permease 0.401 1215.00 putative uracil DNA glycosylase ung 0.401 761.00 putative protease 0.400 1669.00 putative ABC transporter, branched chain amino acid b inding protein livK 0.399 61.00 putative transcriptional regulator 0.399 1799.00 putative nicotinate mononucleotide adenylyltransferase nadD 0.398 416.00 tRNA Ser 0.398 318.00 putative hippurate hydrolase 0.397 2038.00 putative PTS system, tre halose specific IIABC component pttB 0.397 1598.00 putative PTS system, cellobiose specific IIA component ptcA 0.395 1519.00 putative amino acid ABC transporter, ATP binding protein glnQ 0.395 2148c conserved hypothetical protein; possible cobalt per mease 0.394 51.00 putative phosphoribosylaminoimidazole carboxylase, ATPase subunit purK 0.392 348.00 putative histidine triad (HIT) hydrolase 0.392 1402c conserved hypothetical protein 0.391 898.00 conserved hypothetical protein 0.391 1232c conserved hypothetical protein 0.390 5.00 conserved hypothetical protein 0.389 940c putative hemolysin III 0.389 1767c hypothetical protein 0.389 1086.00 putative thymidine kinase kitH 0.388 828.00 putative polysaccharide ABC transporter, ATP binding protein rgpD 0.388 145.00 conserved hypothetical protein 0.387 80.00 transcriptional regulator; repressor (HrcA) of class I heat shock genes hrcA 0.387 1602.00 putative NAD(P)H flavin oxidoreductase 0.387 939.00 putative dehydrogenase (F MN dependent family protein) 0.386 1336.00 conserved hypothetical protein PksD, involved in polyketide synthesis pksD 0.386 671.00 citrate synthase citZ 0.385 993.00 putative GTP binding protein 0.384 1305c conserved hypothetical protein 0.384 814.00 putative MutT like protein mutT 0.383 1050.00 putative phosphoribosylpyrophosphate synthetase, PRPP synthetase krpS 0.383 703c conserved hypothetical protein; possible membrane protein 0.382

PAGE 90

80 816.00 putative aminotransferase 0.381 1896c hy pothetical protein 0.381 2085.00 recombination protein RecA recA 0.381 1702c putative phosphatase 0.381 1214.00 putative dihydroorotase pyrC 0.380 1493.00 tagatose 1,6 bisphosphate aldolase lacD 0.379 830.00 RgpFc protein rgpF 0.376 185.00 hy pothetical protein 0.375 674.00 phosphoenolpyruvate:sugar phosphotransferase system HPr ptsH 0.374 546.00 putative GTP binding protein 0.374 1946.00 hypothetical protein 0.374 1826.00 putative aminotransferase yfbQ 0.373 1309c putative glycero l dehydrogenase 0.372 336.00 putative ribonuclease P protein component rnpA 0.372 1731.00 putative UDP N acetyl muramate alanine ligase murC 0.371 1597c conserved hypothetical protein 0.371 1018.00 hypothetical protein 0.370 1712c conserved hy pothetical protein 0.370 60.00 DNA alkylation repair enzyme 0.369 1416c putative mutator protein MutT 0.368 1106c conserved hypothetical protein; phosphoglycerate mutase like protein 0.368 1753c conserved hypothetical protein 0.368 1922.00 p utative chromosome replication protein dnaB 0.368 1226c conserved hypothetical protein 0.367 2056.00 tRNA Lys 0.365 593.00 putative ferric uptake regulator protein FurR furR 0.364 321.00 conserved hypothetical protein; possible membrane protein 0.362 1611c putative permease; possible multi drug resistance efflux pump 0.361 1135.00 putative phosphate ABC transporter, ATP binding protein pstB 0.361 2008.00 50S ribosomal protein L30 rl30 0.360 1299c putative acetate kinase 0.360 922.00 p utative ABC transporter, ATP binding protein 0.360 1794c hypothetical protein 0.358 1666.00 putative branched chain amino acid ABC transporter, ATP binding protein livG 0.358 1730c putative acetyltransferase 0.356 689.00 hypothetical protein 0 .355 842.00 putative thiamine biosynthesis protein thiI 0.355 2014.00 30S ribosomal protein S14 rs14 0.354 562.00 ATP dependent protease ClpE clpE 0.352 543.00 conserved hypothetical protein 0.350 1628.00 conserved hypothetical protein 0.349 6 68c ribonucleotide reductase, large subunit 0.349 1208c hypotheical protein 0.348 2003a 50S ribosomal protein L36 0.348 621c conserved hypothetical protein 0.348 85.00 putative phosphomethylpyrimidine kinase thiD 0.347 1992.00 putative tyrosy l tRNA synthetase tyrS 0.346 785.00 putative shikimate kinase aroK 0.346 1396.00 glucan binding protein C, GbpC gbpC 0.345 1057.00 conserved hypothetical protein, SatE satE 0.345 1754c conserved hypothetical protein 0.345

PAGE 91

81 340.00 50S ribosomal pr otein L34 0.345 1022.00 conserved hypothetical protein, CitG homolog citG2 0.344 163c hypothetical protein 0.343 1228c conserved hypothetical protein, possible amidotransferase 0.343 848.00 conserved hypothetical protein 0.343 2050c putative methyltransferase 0.343 1850.00 putative aminopeptidase P pepP 0.342 1699c conserved hypothetical protein 0.342 42.00 conserved hypothetical protein 0.342 992.00 hypothetical protein 0.342 1409c putative transcriptional regulator 0.341 159 3c putative CDP diglyceride synthetase 0.341 1729c putative aminodeoxychorismate lyase (fragment) 0.341 926.00 conserved hypothetical protein; possible GTP pyrophosphokinase 0.340 635.00 conserved hypothetical protein 0.339 646.00 putative phos phatase 0.338 472.00 conserved hypothetical protein; possible N6 adenine specific DNA methylase 0.338 2150c putative ABC transporter; ATP binding protein; possible cobalt transport system 0.338 2135c 30S ribosomal protein S4 0.338 1895c hypothe tical protein 0.337 857.00 putative uracil permease 0.337 1367c conserved hypothetical protein 0.337 1645.00 putative tellurite resistance protein 0.336 773c lysyl tRNA synthetase 0.336 595.00 putative dihydroorotate dehydrogenase; dihydroor otate oxidase pyrD 0.336 698.00 50S ribosomal protein L35 0.335 586.00 conserved hypothetical protein 0.335 555.00 conserved hypothetical protein ylmG 0.334 1437.00 putative UDP N acetylglucosamine 2 epimerase epsC 0.334 31.00 hypothetical prot ein 0.334 1877.00 putative PTS system, mannose specific component IIAB ptnA 0.334 183.00 putative Mn/Zn ABC transporter sloB 0.333 832.00 hypothetical protein 0.333 1345c putative peptide synthetase similar to MycA 0.333 16.00 putative amino a cid permease 0.332 1112c conserved hypothetical protein 0.332 881.00 sucrose phosphorylase, GtfA gtfA 0.331 1141c conserved hypothetical protein 0.330 990.00 putative dihydrodipicolinate synthase dapA 0.329 1074.00 putative flavoprotein involv ed in panthothenate metabolism 0.329 1381.00 putative 3 isopropylmalate dehydratase, small subunit leuD 0.328 568.00 putative amino acid ABC transporter, ATP binding protein 0.328 860.00 carbamoylphosphate synthetase, large subunit pyrAB 0.327 20 17.00 50S ribosomal protein L14 rl14 0.327 1334.00 putative phosphopantetheinyl transferase sfp 0.327 1732c conserved hypothetical protein 0.327 1713c conserved hypothetical protein 0.325 841.00 putative aminotransferase 0.324 1614.00 putative formamidopyrimidine DNA glycosylase fpg 0.324 86.00 conserved hypothetical protein 0.324

PAGE 92

82 936.00 putative amino acid ABC transporter, ATP binding protein 0.324 1142c putative arsenate reductase 0.323 2020.00 50S ribosomal protein L16 rl16 0.322 1255c hypothetical protein 0.320 1391c hypothetical protein 0.319 1562.00 putative potassium uptake protein TrkA trk 0.319 435.00 putative N acetylglucosamine 6 phosphate deacetylase 0.317 599.00 putative D alanine D alanine ligase 0.317 92 9c conserved hypothetical protein 0.316 1632.00 putative MTA/SAH nucleosidase pfs 0.316 1708.00 putative potassium uptake system protein TrkA trkA 0.316 1420.00 putative oxidoreductase 0.315 1873.00 putative ribonuclease rnh3 0.315 1600.00 puta tive PTS system, cellobiose specific IIB component ptcB 0.314 158.00 putative cysteinyl tRNA synthetase cysS 0.314 1129.00 putative response regulator CiaR ciaR 0.313 2159.00 putative ABC transporter, ATP binding protein 0.313 434.00 hypothetical protein 0.312 2066c putative transmembrane protein 0.312 2139c 50S ribosomal protein L9 0.311 214c hypothetical protein 0.310 119.00 putative alcohol dehydrogenase class III adh 0.310 1832.00 hypothetical protein 0.308 478.00 putative guan ylate kinase kguA 0.308 396.00 putative glycerol uptake facilitator protein glpF 0.306 1261c putative phosphoribosyl ATP pyrophosphohydrolase 0.306 864.00 putative ABC transporter, permease component 0.306 284.00 hypothetical protein 0.305 122 9.00 putative purine nucleoside phosphorylase punA 0.305 285.00 hypothetical protein 0.305 915c conserved hypothetical protein 0.304 1532.00 FoF1 membrane bound proton translocating ATPase, b subunit atpF 0.303 1297.00 conserved hypothetical prot ein 0.303 1268.00 putative imidazoleglycerol phosphate dehydratase hisB 0.302 786.00 putative prephenate dehydratase pheA 0.302 1871c conserved hypothetical protein 0.302 1304c conserved hypothetical protein 0.301 2018.00 30S ribosomal protein S17 rs17 0.301 1526c conserved hypothetical protein 0.297 1956c hypothetical protein 0.297 1089.00 conserved hypothetical protein 0.296 1339.00 putative bacitracin synthetase bacD 0.296 754.00 HPr(serine) kinase/phosphatase 0.294 99.00 fru ctose 1,6 biphosphate aldolase fbaA 0.294 1636c conserved hypothetical protein 0.293 327.00 putative DNA repair protein 0.291 1589c putative hexosyltransferase 0.291 307.00 glucose 6 phosphate isomerase pgi 0.290 846.00 50S ribosomal protein L 21 0.289 1428c conserved hypothetical protein 0.289 124.00 putative transcriptional regulator (MarR family) 0.288 13.00 putative cell cycle protein 0.287 2042.00 dextranase precursor dexA 0.285

PAGE 93

83 341.00 putative deoxyribonuclease 0.285 850.0 0 conserved hypothetical protein 0.284 1620.00 putative phosphate starvation induced protein PhoH phoH 0.284 589.00 putative DNA binding protein 0.284 1527.00 FoF1 membrane bound proton translocating ATPase, epsilon subunit atpA 0.282 1836.00 put ative DAHP synthase; phospho 2 dehydro 3 deoxyphosphoheptonate aldolase aroG 0.282 1694c putative permease 0.282 7.00 putative peptidyl tRNA hydrolase pth 0.279 2104.00 conserved hypothetical protein; possible integral membrane protein 0.279 1061 .00 putative DNA binding protein ylxM 0.277 1298.00 50S ribosomal protein L31 rl31 0.277 742.00 conserved hypothetical protein 0.276 1558c putative acetyltransferase 0.276 781.00 putative prephenate dehydrogenase 0.276 338.00 putative RNA bind ing protein, Jag family 0.275 1247.00 putative enolase eno 0.275 1060.00 signal recognition particle protein subunit, Ffh ffh 0.271 777.00 putative 3 dehydroquinate dehydratase aroD 0.271 381c conserved hypothetical protein 0.271 1747c putative phosphatase 0.271 337.00 conserved hypothetical protein; putative membrane protein 0.270 863.00 putative ABC transporter, ATP binding protein 0.269 1460.00 putative dTDP 4 keto L rhamnose reductase rmlC 0.267 1761c conserved hypothetical protei n 0.267 184.00 putative ABC transporter, metal binding lipoprotein; surface adhesin precursor; saliva binding protein; lipoprotein receptor LraI (LraI family) sloC 0.266 573.00 conserved hypothetical protein 0.264 352.00 putative ribulose phosphate 3 epimerase 0.264 1741.00 putative malonyl CoA (acyl carrier protein) transacylase fabD 0.262 1221.00 putative orotate phosphoribosyltransferase PyrE pyrE 0.262 447.00 conserved hypothetical protein 0.259 550.00 putative cell division protein Ft sQ (DivIB) ftsQ 0.259 1066.00 putative GMP synthase guaA 0.258 1633c conserved hypothetical protein 0.258 1847.00 putative translation elongation factor P efp 0.257 1828.00 conserved hypothetical protein 0.255 1322.00 putative acetoin dehydroge nase budC 0.254 1990.00 DNA dependent RNA polymerase, beta subunit rpoB 0.254 1019.00 putative citrate lyase, gamma subunit cilG 0.252 1919.00 conserved hypothetical protein sapR2 0.252 87.00 conserved hypothetical protein 0.251 1387.00 putative oxidoreductase 0.251 1572.00 putative UDP N acetylglucosamine 1 carboxyvinyl transferase murZ 0.251 73.00 conserved hypothetical protein 0.250 2073c conserved hypothetical protein 0.250 1412c putative ABC transporter, membrane protein subunit a nd ATP binding protein 0.248 2016.00 50S ribosomal protein L24 rl24 0.248 824.00 dTDP 4 keto L rhamnose reductase 0.247

PAGE 94

84 1710c conserved hypothetical protein 0.246 2002.00 30S ribosomal protein S11 rs11 0.246 1069c hypothetical protein 0.245 351.00 conserved hypothetical protein 0.245 1136.00 putative phosphate ABC transporter, permease protein pstC 0.244 2044.00 putative stringent response protein, ppGpp synthetase relA 0.244 1823.00 putative pyrazinamidase/nicotinamidase pncA 0.244 233.00 ketol acid reductoisomerase ilvC 0.244 1718.00 putative glutamate racemase murI 0.243 919c putative ATPase, confers aluminum resistance 0.243 917c putative 6 pyruvoyl tetrahydropterin synthase 0.243 1045c conserved hypothetical protein 0.242 1400c conserved hypothetical protein 0.242 97.00 tRNA Leu pyrG 0.242 1785.00 putative phosphatidate cytidylyltransferase synthase) cdsA 0.242 531.00 putative chorismate mutase 0.241 2079c conserved hypothetical protein 0.241 433.00 puta tive transcriptional regulator 0.240 782.00 conserved hypothetical protein 0.240 328.00 putative carbonic anhydrase 0.240 244.00 putative undecaprenol kinase (bacitracin resistance protein) bacA 0.237 1760c conserved hypothetical protein 0.237 1382.00 putative 3 isopropylmalate dehydratase, large subunit leuC 0.237 427.00 putative copper chaperone copZ 0.236 1028.00 putative hydrolase or acyltransferase 0.236 1693.00 putative hemolysin hlyX 0.235 1021.00 putative citrate lyase, alfa s ubunit cilA 0.235 1958c putative PTS system, mannose specific IIC component 0.235 887.00 galactose 1 P uridyl transferase, GalT galT 0.234 696.00 putative cytidylate kinase 0.234 557.00 putative cell division protein DivIVA divIVA 0.233 364.00 glutamine synthetase type 1; glutamate -ammonia ligase glnA 0.233 1591.00 catabolite control protein A, CcpA ccpA 0.232 1972c conserved hypothetical protein 0.232 2040.00 putative transcriptional regulator; repressor of the trehalose operon treR 0. 232 2067.00 putative stress response protein; possible glycosyltransferase involved in cell wall biogenesis csbB 0.231 1291c putative chorismate mutase 0.230 556.00 conserved hypothetical protein ylmH 0.230 517.00 putative phosphopantetheine adenyl yltransferase; lipopolysaccharide core biosynthesis protein 0.229 1667.00 putative branched chain amino acid ABC transporter, permease protein livM 0.228 552.00 putative cell division protein FtsZ ftsZ 0.228 1773c hypothetical protein 0.228 2060. 00 putative transcriptional regulator (LysR family) 0.227 1870.00 putative DNA mismatch repair protein MutS2 mutS2 0.226 349.00 dimethyladenosine transferase 0.225 723.00 putative calcium transporting ATPase; P type ATPase 0.224 1341c putative g ramicidin S synthetase 0.224 780.00 putative chorismate synthase aroC 0.223 669c putative glutaredoxin 0.220

PAGE 95

85 1995c putative transcriptional regulator 0.220 172.00 conserved hypothetical protein; putative cell growth regulatory protein 0.218 8 66.00 conserved hypothetical protein 0.218 2003.00 30S ribosomal protein S13 rs13 0.217 2165.00 putative SpoJ 0.216 1465c conserved hypothetical protein; replication protein DnaD like 0.215 746c conserved hypothetical protein 0.215 953c putat ive transcriptional regulator/aminotransferase 0.214 68.00 hypothetical protein 0.214 1013c putative Mg2+/citrate transporter 0.214 1555c conserved hypothetical protein 0.213 2010.00 50S ribosomal protein L18 rl18 0.213 1739.00 putative 3 oxo acyl (acyl carrier protein) synthase fabF 0.213 728.00 putative oxidoreductase 0.212 156.00 conserved hypothetical protein 0.212 745.00 putative drug export protein; multidrug resistance protein lmrB 0.212 977.00 putative transcriptional antiterm inator LicT (fragment) licT 0.211 81.00 heat shock protein GrpE (HSP 70 cofactor) grpE 0.210 1233.00 putative phosphopentomutase deoB 0.210 1204.00 topoisomerase IV, subunit A parC 0.210 422.00 ribosome binding factor A 0.209 23.00 phosphoribosy l pyrophosphate synthetase (PRPP synthetase) prs 0.208 2036.00 putative peptidase pepO 0.208 199c hypothetical protein 0.207 2053c hypothetical protein 0.207 1782.00 16S ribosomal RNA 0.207 198c putative conjugative transposon protein 0.206 1814.00 putative histidine kinase, ScnK homolog scnK 0.205 942.00 putative hydroxymethylglutaryl CoA reductase mvaA 0.204 1219c conserved hypothetical protein 0.203 2107c hypothetical protein 0.202 2049c conserved hypothetical protein 0.202 1 59.00 conserved hypothetical protein 0.202 1303c putative dipeptidase 0.201 268.00 adenylosuccinate synthetase purA 0.201 1434c putative glycosyltransferase 0.200 859.00 putative carbamoyl phosphate synthetase, small subunit pyrA 0.199 833.00 putative glycosyltransferase 0.198 1724c putative rRNA methylase 0.197 1578.00 putative biotin operon repressor birA 0.197 865.00 30S ribosomal protein S16 0.196 1507c hypothetical protein 0.195 1085.00 putative peptide chain release factor 1 rf1 0.194 1993.00 putative ABC transporter, zinc permease protein adcB 0.194 317.00 putative tetrahydrodipicolinate succinylase 0.193 1179c putative amino acid ABC transporter, permease protein 0.193 12.00 conserved hypothetical protein 0.192 37.00 putative phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase purH 0.192 1494.00 tagatose 6 phosphate kinase lacC 0.192 1340.00 putative surfactin synthetase bacA2 0.192 1851.00 putative excinuclease ABC (subunit A) uvr A 0.192

PAGE 96

86 838.00 glutathione reductase gshR 0.192 2136c hypothetical protein 0.191 1360c hypothetical protein 0.190 709.00 conserved hypothetical protein 0.189 220c hypothetical protein 0.188 1300c conserved hypothetical protein 0.185 1272 .00 putative histidyl tRNA synthetase hisZ 0.185 829.00 putative glycosyltransferase rgpE 0.184 1040c putative oxidoreductase, short chain dehydrogenase/reductase 0.183 363.00 transcriptional regulator; glutamine synthetase repressor glnR 0.183 10 39c putative lipopolysaccharide glycosyltransferase 0.183 243.00 conserved hypothetical protein 0.182 1918.00 putative membrane associated protein DedA dedA 0.181 1394.00 putative GTP binding protein lepA 0.180 1062.00 putative ABC transporter, p roline/glycine betaine permease protein opuAb 0.180 1046c putative GTP pyrophosphokinase 0.178 1989.00 DNA dependent RNA polymerase, beta' subunit rpoC 0.176 407.00 conserved hypothetical protein 0.175 1461.00 putative glucose 1 phosphate thymidy ltransferase rmlA 0.175 1239.00 putative dipeptidase pepV 0.174 1422.00 putative pyruvate dehydrogenase E1 component beta subunit) pdhB 0.173 670.00 aconitate hydratase; aconitase citB 0.173 647.00 putative methyltransferase 0.173 835.00 conserv ed hypothetical protein; possible membrane protein 0.172 747c conserved hypothetical protein; putative permease 0.171 274.00 putative hexulose 6 phosphate isomerase 0.170 403.00 putative DNA damage inducible protein P 0.170 1690.00 integral mem brane protein possibly involved in D alanine export dltB 0.169 854.00 putative pseudouridylate synthase 0.167 6.00 putative GTP binding protein 0.167 1241.00 putative excinuclease ABC (subunit C) uvrC 0.167 1883.00 conserved hypothetical protein 0.167 261c putative transcriptional regulator 0.167 743.00 conserved hypothetical protein 0.167 744.00 putative cell division protein FtsY; signal recognition particle (docking protein) ftsY 0.166 2075c conserved hypothetical protein 0.166 24 9.00 putative NifS protein homologue, class V aminotransferase nifS 0.165 2092c conserved hypothetical protein 0.165 886.00 galactokinase, GalK galK 0.165 275.00 putative L ribulose 5 phosphate 4 epimerase 0.165 826.00 rhamnosyltransferase rgpB 0.164 1516.00 putative histidine kinase CovS; VicK homolog covS 0.163 820.00 conserved hypothetical protein 0.163 624.00 putative 1 acylglycerol 3 phosphate O acyltransferase 0.163 718c conserved hypothetical protein 0.162 1200.00 tRNA Tyr rs1 0.162 1296.00 putative glutathione S transferase 0.162 541.00 conserved hypothetical protein 0.161 1865.00 putative A/G specific DNA glycosylase mutY 0.158 1621c conserved hypothetical protein 0.157

PAGE 97

87 1735.00 putative acetyl CoA carboxylase beta subunit accD 0.156 1775c hypothetical protein 0.156 489.00 putative polyribonucleotide nucleotidyltransferase (general stress protein 13) 0.155 1216c putative amino acid ABC transporter, permease protein 0.155 581.00 putative exodeoxyribonuclea se VII, small subunit 0.155 1323.00 conserved hypothetical protein; possible hydrolase 0.155 1282.00 tRNA Arg 0.154 1223.00 putative dihydroorotate dehydrogenase B pyrDB 0.152 823.00 conserved hypothetical protein 0.151 1052.00 conserved hypo thetical protein 0.150 795.00 conserved hypothetical protein; probable esterase 0.149 827.00 putative polysaccharide ABC transporter, permease protein rgpC 0.149 1119c putative sugar ABC transporter, permease protein 0.149 1616c conserved hypoth etical protein 0.148 76.00 putative N acetyl muramidase 0.148 496.00 putative cysteine synthetase A; O acetylserine lyase cysK 0.148 442.00 conserved hypothetical protein 0.147 1036.00 hypothetical protein 0.147 18.00 tRNA Ser 0.147 255.00 putative oligopeptide ABC transporter, substrate binding protein OppA oppA 0.147 354.00 conserved hypothetical protein 0.146 700c putative phosphoglycerate mutase like protein 0.146 1213c putative 5' nucleotidase precursor 0.143 1259.00 conserv ed hypothetical protein; possible restriction endonuclease 0.143 948.00 conserved hypothetical protein 0.143 1064c putative transcriptional regulator (GntR family) 0.142 976.00 putative ABC transporter, periplasmic spermidine/putrescine binding pr otein potD 0.141 968.00 putative GTP cyclohydrolase I 0.140 209c hypothetical protein 0.140 450.00 putative gamma glutamyl phosphate reductase proA 0.139 1837.00 putative DAHP synthase; phospho 2 dehydro 3 deoxyphosphoheptonate aldolase aroH 0.1 38 1886.00 putative seryl tRNA synthetase sys 0.137 2093.00 putative transcriptional regulator of arginine metabolism argR 0.136 1427c conserved hypothetical protein 0.134 1476c putative GTP binding protein 0.133 561c putative hydrolase (MutT fa mily) 0.132 759.00 putative protease 0.132 1118c putative ABC sugar transporter, permease protein 0.131 1372c hypothetical protein 0.130 927.00 putative response regulator 0.130 1513.00 putative chromosome segregation ATPase; SMC protein smc 0.130 934.00 putative amino acid ABC transporter, permease protein 0.129 1625.00 putative uridylate kinase pyrH 0.129 928.00 putative histidine kinase 0.128 1795c conserved hypothetical protein 0.127 1325.00 putative ABC transporter, ATP bind ing component ftsE 0.127 2061.00 hypothetical protein 0.126 1691.00 putative D alanine D alanyl carrier protein ligase dltA 0.125

PAGE 98

88 300.00 putative tRNA guanine transglycosylase; queuine tRNA ribosyltransferase tgt 0.125 1294.00 putative flavodoxin flaW 0.124 1525.00 putative UDP N acetylglucosamine 1 carboxyvinyltransferase murA 0.123 1120.00 putative sugar ABC transporter, ATP binding protein 0.121 521.00 conserved hypothetical protein 0.121 769.00 conserved hypothetical protein 0.120 1840.00 putative fructokinase scrK 0.117 997.00 putative inorganic ion ABC transporter, ATP binding protein; possible ferrichrome transport system 0.117 695.00 conserved hypothetical protein 0.117 941c conserved hypothetical protein 0.117 1435c hypothetical protein 0.115 1293c conserved hypothetical protein 0.114 660.00 putative histidine kinase SpaK 0.113 930c putative transcriptional regulator 0.111 1284c conserved hypothetical protein 0.109 1220c conserved hypothetical protein 0.109 474.00 putative autoinducer 2 production protein LuxS luxS 0.109 1490.00 6 phospho beta galactosidase lacG 0.108 1534.00 FoF1 membrane bound proton translocating ATPase, c subunit atpH 0.107 1499.00 putative exonuclease RexA rexA 0.107 1335 c putative enoyl (acyl carrier protein) reductase 0.106 879.00 multiple sugar binding ABC transporter, permease protein MsmF msmF 0.104 1467.00 putative adenine phosphoribosyltransferase apt 0.103 567.00 putative glutamine ABC transporter, permease component 0.103 1189c conserved hypothetical protein 0.102 482.00 putative RNA binding Sun protein; possible rRNA methylase sunL 0.101 2063.00 putative ferrochelatase (protoheme ferro lyase) hemZ 0.101 969.00 dihydropteroate synthase folP 0.100 1078c putative ABC transporter, ATP binding protein 0.099 1102.00 6 phospho beta glucosidase ascB 0.099 369c conserved hypothetical protein 0.098 1083c conserved hypothetical protein 0.097 815.00 putative amino acid transporter, amino acid bind ing protein 0.095 1967.00 putative single stranded DNA binding protein ssb2 0.094 135.00 putative transcriptional regulator mleR 0.094 21.00 putative cell shape determining protein MreD mreD 0.093 547.00 conserved hypothetical protein 0.092 862 .00 conserved hypothetical protein; putative permease 0.091 465.00 NAD(+) synthetase (nitrogen regulatory protein) nadE 0.090 755.00 putative prolipoprotein diacylglycerol transferase 0.090 1921.00 putative DNA replication protein; primosome compon ent (helicase loader) dnaI 0.090 802.00 conserved hypothetical protein 0.089 456.00 putative undecaprenyl phosphate UDP MurNAc pentapeptide transferase mraY 0.089 707c putative endolysin 0.087 1054.00 putative glutamine amidotransferase 0.087 117c conserved hypothetical protein 0.084 1681c conserved hypothetical protein 0.082 796.00 conserved hypothetical protein 0.081

PAGE 99

89 109.00 conserved hypothetical protein; possible permease (efflux protein) 0.081 304.00 putative deaminase 0.081 638.00 putative 16S pseudouridylate synthase 0.081 1163c putative ABC transporter, ATP binding protein 0.080 817.00 putative amino acid transporter, amino acid binding protein 0.079 330.00 putative glutamyl tRNA synthetase gltX 0.078 259.00 puta tive oligopeptide ABC transporter, ATP binding protein OppF oppF 0.077 1023.00 putative pyruvate carboxylase/oxaloacetate decarboxylase, alpha subunit pycB 0.077 825.00 putative RgpAc; glycosyltransferase rgpA 0.077 322c glucose 1 phosphate uridylylt ransferase 0.076 74.00 conserved hypothetical protein 0.073 242c putative amino acid ABC transporter, permease protein, glutamine transport system 0.071 1999c conserved hypothetical protein 0.070 962.00 putative dehydrogenase 0.067 1457.00 p utative dTDP glucose 4,6 dehydratase rmlB 0.066 130.00 putative dihydrolipoamide dehydrogenase adhD 0.066 118c putative esterase 0.066 788.00 putative RNA methyltransferase 0.066 320.00 putative 5 formyltetrahydrofolate cyclo ligase 0.064 1185 .00 PTS system, mannitol specific enzyme IIBC component mtlA1 0.063 1536.00 putative starch (bacterial glycogen) synthase glgA 0.062 488.00 putative hydrolase 0.062 528c conserved hypothetical protein 0.061 1722c putative integral membrane protei n 0.059 711.00 conserved hypothetical protein 0.056 667.00 putative ribonucleotide reductase, small subunit nrdG 0.056 1432c putative endoglucanase precursor 0.055 82.00 heat shock protein, DnaK (HSP 70) dnaK 0.054 140.00 putative glutathione reductase 0.054 2099c conserved hypothetical protein 0.053 1574c conserved hypothetical protein 0.053 1852.00 putative magnesium/cobalt transport protein 0.051 137.00 malolactic enzyme mleS 0.051 1514.00 putative ribonuclease III rnc 0.050 281.00 hypothetical protein 0.049 1965c putative histidine kinase 0.048 114.00 putative PTS system, fructose specific IIBC component 0.048 169.00 50S ribosomal protein L13 0.047 1937.00 putative carbon nitrogen hydrolase cnhA 0.047 1443c puta tive tributyrin esterase 0.046 1177c putative ABC transporter, glutamine binding protein 0.045 236c putative transcriptional regulator 0.045 1861c hypothetical protein 0.044 1009.00 putative histidine kinase 0.044 506.00 putative type II res triction endonuclease 0.043 813.00 hypothetical protein; putative transcriptional regulator 0.041 1740.00 putative 3 oxoacyl acyl carrier protein reductase / 3 ketoacyl acyl carrier protein reductase fabG 0.041 598.00 putative recombination protein RecM recM 0.040

PAGE 100

90 1973.00 putative glutamyl aminopeptidase; endo 1,4 beta glucanase pepA 0.039 1942c putative amino acid binding protein 0.038 1480.00 hypothetical protein 0.036 988.00 putative cardiolipin synthase 0.035 984.00 hypothetical pro tein 0.034 583.00 putative hemolysin 0.032 350.00 tRNA Leu 0.031 570.00 putative ferrous ion transport protein B feoB 0.027 1464c conserved hypothetical protein 0.024 271.00 putative PTS system, enzyme IIB component ptxB 0.023 1133.00 putat ive phosphate transport system regulatory protein phoU 0.023 856.00 putative pyrimidine operon regulatory protein pyrR 0.022 956.00 putative Clp like ATP dependent protease, ATP binding subunit clp 0.017 712.00 putative phosphoenolpyruvate carboxylas e capP 0.017 278.00 hypothetical protein 0.017 935.00 putative amino acid ABC transporter, permease protein 0.017 1253c hypothetical protein 0.016 869.00 putative thioredoxin reductase trxB2 0.014 461.00 putative amino acid ABC transporter, AT P binding protein 0.013 144c putative transcriptional regulator 0.012 1596.00 putative PTS system, cellobiose specific IIC component ptcC 0.011 1924.00 response regulator GcrR for glucan binding protein C gcrR 0.009 1737.00 putative 3 hydroxymyri stoyl (acyl carrier protein) dehydratase fabZ 0.007 414.00 putative ABC transporter, permease protein 0.005 2126c putative purine nucleoside phosphorylase 0.004 72.00 conserved hypothetical protein 0.003 1969c putative transcriptional regulator 0.001 2005.00 putative adenylate kinase adk 0.002 888.00 UDP galactose 4 epimerase, GalE galE 0.002 1436c hypothetical protein 0.004 1941.00 putative membrane lipoprotein atmB 0.005 1563.00 putative cation transporting P type ATPase PacL pacL 0.006 1423.00 putative pyruvate dehydrogenase, TPP dependent E1 component alpha subunit pdhA 0.006 994.00 putative ribonuclease HII rnh 0.008 1978.00 putative acetate kinase ackA 0.010 2108c putative transcriptional regulator 0.011 344.00 hypothetical pro tein 0.012 569.00 putative ferrous ion transport protein A feoA 0.013 958.00 hypothetical protein 0.013 1936c conserved hypothetical protein 0.014 50.00 putative phosphoribosylaminoimidazole carboxylase, catalytic subunit purE 0.014 167.00 hypothet ical protein 0.015 258.00 putative oligopeptide ABC transporter, ATP binding protein OppD oppD 0.015 2065.00 putative UDP glucose 4 epimerase 0.018 25.00 putative DNA repair protein RecO recO 0.022 2021.00 30S ribosomal protein S3 rs3 0.025 889.00 p utative penicillin binding protein, class C; fmt like protein pbpX 0.026 454.00 putative cell division protein ftsL 0.027 673.00 conserved hypothetical protein 0.028

PAGE 101

91 691.00 putative tripeptidase (peptidase T) pepT 0.029 529.00 hypothetical protein 0. 030 1818c hypothetical protein 0.030 1979c conserved hypothetical protein 0.030 1047c hypothetical protein 0.031 1306c conserved hypothetical protein 0.032 204c hypothetical protein 0.036 1264.00 putative imidazoleglycerol phosphate synthase, cy clase subunit hisF 0.038 1688.00 putative extramembranal protein, DltD protein dltD 0.040 1265.00 putative phosphoribosyl formimino 5 aminoimidazole carboxamide ribonucleotide isomerase hisA 0.041 1016.00 putative acetyl CoA carboxylase, biotin carboxyl carrier subunit bcc 0.041 1257c conserved hypothetical protein 0.043 1644c hypothetical protein 0.044 778.00 putative shikimate 5 dehydrogenase aroE 0.044 787.00 putative transcriptional regulator 0.047 1668.00 putative branched chain amino acid A BC transporter, permease protein livH 0.048 524.00 putative ABC transporter, ATP binding protein 0.048 1659c conserved hypothetical protein 0.050 2009.00 30S ribosomal protein S5 rs5 0.051 165.00 conserved hypothetical protein 0.052 946.00 putative permease 0.053 1631.00 putative peptidyl prolyl cis trans isomerase 0.054 1491.00 PTS system, lactose specific enzyme IIBC EIIBC LAC) lacE 0.055 532.00 putative anthranilate synthase, alpha subunit trpE 0.056 1673.00 uracil phosphoribosyltransferase upp 0.056 1957.00 putative PTS system, mannose specific IID component 0.057 1746c putative enoyl CoA hydratase 0.059 1180.00 putative alkylphosphonate uptake protein phnA 0.063 1687.00 putative manganese dependent inorganic pyrophosphatase ppaC 0.06 4 895.00 possible DNA damage inducible protein 0.065 250.00 putative nitrogen fixation like protein, NifU nifU 0.065 1523.00 putative membrane nuclease EndA endA 0.066 75.00 putative D alanyl D alanine carboxypeptidase 0.068 260.00 conserved hypothe tical protein 0.070 983.00 putative transcriptional regulator bglC 0.072 30.00 putative phosphoribosylformylglycinamidine synthase, (FGAM synthase) purL 0.072 1329c putative transposase 0.073 55.00 hypothetical protein 0.075 1178c putative amino ac id ABC transporter, ATP binding protein 0.077 1349.00 hypothetical protein 0.091 582.00 putative farnesyl diphosphate synthase 0.092 1397c conserved hypothetical protein 0.093 391c conserved hypothetical protein 0.095 1748.00 16S ribosomal RNA ak h 0.095 1947.00 putative transcription antitermination factor nusG 0.099 175.00 hypothetical protein 0.105 1187.00 glucosamine fructose 6 phosphate aminotransferase glmS 0.107 264.00 conserved hypothetical protein 0.109 1113.00 putative sortase srtA 0.111 1071c conserved hypothetical protein 0.112

PAGE 102

92 680.00 putative gamma carboxymuconolactone decarboxylase subunit 0.113 622c conserved hypothetical protein 0.113 1931.00 putative glucose inhibited division protein gidB 0.114 228.00 putative alkali ne shock protein homolog 0.115 231.00 acetolactate synthase, large subunit (AHAS) ilvB 0.115 52.00 conserved hypothetical protein 0.116 1234.00 putative ribose 5 phosphate isomerase A rpiA 0.117 1267c hypothetical protein 0.117 161.00 putative tran scriptional regulator 0.119 393.00 conserved hypothetical protein 0.121 752.00 conserved hypothetical protein 0.122 634.00 putative S adenosylmethionine -tRNA ribosyltransferase isomerase queA 0.122 537.00 putative tryptophan synthase, beta subunit trpB 0.123 138.00 putative malate permease 0.127 2164.00 serine protease HtrA htrA 0.131 715.00 triosephosphate isomerase 0.131 690.00 hypothetical protein 0.132 1140c conserved hypothetical protein 0.132 1879.00 putative PTS system, mannose spec ific component IID 0.133 1042.00 conserved hypothetical protein; inner membrane protein 0.134 256.00 putative oligopeptide transport system, permease protein OppB oppB 0.134 793.00 conserved hypothetical protein 0.137 1270.00 putative histidinol deh ydrogenase hisD 0.138 1206c hypothetical protein 0.140 1951c conserved hypothetical protein 0.141 1151c conserved hypothetical protein 0.148 1867c putative alcohol dehydrogenase 0.149 758c conserved hypothetical protein 0.150 1196c conserved hyp othetical protein 0.150 1949.00 putative membrane carboxypeptidase, penicillin binding protein 2a pbp2a 0.154 1218.00 putative amidase nylA 0.156 870.00 putative transcriptional regulator of sugar metabolism 0.160 943c putative hydroxymethylglutaryl CoA synthase 0.160 799c conserved hypothetical protein 0.165 1703c conserved hypothetical protein 0.165 1108c conserved hypothetical protein 0.166 1897.00 putative ABC transporter, ATP binding protein 0.166 460.00 putative amino acid ABC transpor ter, permease 0.166 572.00 putative tetrahydrofolate dehydrogenase/cyclohydrolase folD 0.167 1250c hypothetical protein 0.168 29.00 putative phosphoribosylaminoimidazole succinocarboxamide synthase SAICAR synthetase 0.169 702c putative transcription al regulator 0.171 1134c putative phosphate ABC transporter, ATP binding protein 0.177 1100c putative permease 0.179 360.00 extracellular glyceraldehyde 3 phosphate dehydrogenase gapC 0.179 49.00 hypothetical protein 0.180 1985.00 putative ABC tra nsporter ComYB; probably part of the DNA transport machinery comYB 0.182 536.00 putative phosphoribosyl anthranilate isomerase trpF 0.185 1068c putative ABC transporter, ATP binding protein 0.185

PAGE 103

93 1026.00 hypothetical protein 0.186 961.00 conserved hy pothetical protein 0.186 1550c conserved hypothetical protein; possible integral membrane protein 0.191 64.00 Holliday junction DNA helicase RuvB ruvB 0.193 299c putative bacteriocin peptide precursor 0.193 1856c conserved hypothetical protein 0.19 4 196c putative transfer protein 0.194 176.00 hypothetical protein 0.194 415.00 conserved hypothetical protein 0.197 1582c conserved hypothetical protein 0.210 533.00 putative anthranilate synthase, beta subunit trpG 0.210 1034c putative integras e/recombinase; XerC like 0.217 276c hypothetical protein 0.217 1744.00 putative 3 oxoacyl [acyl carrier protein] synthase III fabH 0.217 2134.00 putative transcriptional regulator 0.219 891.00 type I restriction modification system DNA methylase hsd M 0.220 1144.00 putative tRNA pseudouridine 5S synthase truB 0.221 1224.00 putative dihydroorotate dehydrogenase, electron transfer subunit pyrK 0.221 1882c hypothetical protein 0.225 2102.00 histidyl tRNA synthetase (histidine -tRNA ligase) hisS 0.23 0 1661c putative signal peptidase II 0.231 1734.00 putative acetyl CoA carboxylase alpha subunit accA 0.233 909.00 putative permease 0.238 560c conserved hypothetical protein 0.238 1438c putative Zn dependent protease 0.243 343.00 hypothetical pr otein 0.244 1547c putative response regulator 0.248 182.00 putative ABC transporter, ATP binding protein; possible iron and/or manganese ABC transport system sloA 0.253 303.00 conserved hypothetical protein 0.253 972.00 putative UDP N acetylenolpyru voylglucosamine reductase murB 0.254 1289c putative permease, chloride channel 0.258 272.00 putative PTS system, enzyme IIA component ptxA 0.262 1651.00 putative arsenate reductase 0.270 1483c conserved hypothetical protein 0.275 852.00 putative tr anscriptional regulator; CpsY like protein 0.276 1512.00 putative phenylalanyl tRNA synthetase (alpha subunit) syfA 0.276 719c conserved hypothetical protein 0.280 449.00 putative gamma glutamyl kinase proB 0.281 180.00 putative oxidoreductase; possi ble fumarate reductase 0.286 1675.00 putative cystathionine gamma synthase; possible bifunctional enzyme metB 0.287 1424.00 putative dihydrolipoamide dehydrogenase pdhD 0.287 1960c putative PTS system, mannose specific IIB component 0.288 1489.00 con served hypothetical protein, LacX lacX 0.289 2154c putative peptidase 0.289 485.00 conserved hypothetical protein 0.291 1940c putative peptidase, AtmC; ArgE/DapE/Acy1 family protein 0.291 1124.00 putative pyrimidine nucleoside phosphorylase pdp 0.30 1 585.00 DNA repair protein RecN recN 0.305 1286c putative permease; multidrug efflux protein 0.306

PAGE 104

94 741.00 conserved hypothetical protein 0.306 916c conserved hypothetical protein 0.310 1788c putative bacterocin transport accessory protein, Bta 0. 311 417.00 conserved hypothetical protein 0.314 1711.00 putative pseudouridylate synthase B, large subunit rluB 0.316 513.00 hypothetical protein 0.319 803c putative ABC transporter, ATP binding protein 0.319 2119.00 putative osmoprotectant ABC tra nsporter; permease protein opuCd 0.330 1612c conserved hypothetical protein 0.332 1784c putative Eep protein homolog; possible membrane associated Zn dependent proteases 0.335 959c hypothetical protein 0.335 784.00 5 enolpyruvylshikimate 3 phosphate synthase aroA 0.335 270.00 putative PTS system, membrane component; possible ribulose monophosphate PTS pathway enzyme IIC sgaT 0.337 378.00 hypothetical protein 0.337 2032.00 30S ribosomal protein S2 rs2 0.338 970.00 putative dihydroneopterin aldola se folA 0.342 1964c putative response regulator 0.342 880.00 multiple sugar binding ABC transporter, permease protein MsmG msmG 0.342 706c conserved hypothetical protein 0.344 847c hypothetical protein 0.346 971.00 putative 2 amino 4 hydroxy 6 hydr oxymethylpteridine pyrophosphokinase folK 0.346 160.00 conserved hypothetical protein; possible metallopeptidase 0.349 127.00 putative acetoin dehydrogenase (TPP dependent), E1 component alpha subunit adhA 0.352 301.00 conserved hypothetical protein 0 .352 641.00 putative oxidoreductase 0.354 1184c putative transcriptional regulator, antiterminator 0.355 1637c hypothetical protein 0.356 1375c hypothetical protein 0.363 868.00 putative tRNA methyltransferase trmD 0.365 1295.00 putative adenosin e deaminase add 0.370 851.00 conserved hypothetical protein 0.372 875c putative transposase, IS150 like 0.373 88c conserved hypothetical protein; possible mechanosensitive ion channel 0.373 92c hypothetical protein; putative transposase fragment 0. 374 1670c conserved hypothetical protein 0.375 900.00 putative dihydrodipicolinate reductase dapB 0.379 1273.00 putative histidinol phosphate aminotransferase hisC 0.379 14.00 putative hypoxanthine guanine phosphoribosyltransferase hprT 0.381 1492.00 PTS system, lactose specific enzyme IIA EIIA LAC) lacF 0.383 2151.00 putative phosphotidylglycerophosphate synthase pgsA 0.386 553.00 conserved hypothetical protein ylmE 0.388 630.00 hypothetical protein 0.391 771c hypothetical protein 0.397 1905c putative bacteriocin secretion protein 0.402 1097c putative transcriptional regulator protein 0.410 639.00 putative acetyltransferase 0.418 616.00 hypothetical protein 0.419

PAGE 105

95 548.00 putative D glutamic acid adding enzyme MurD; UDP N acetylmuramoylal anine -D glutamate ligase murD 0.426 905.00 putative ABC transporter, ATP binding protein 0.437 1619c conserved hypothetical protein 0.448 902.00 putative ABC transporter, ATP binding protein 0.452 878.00 multiple sugar binding ABC transporter, suga r binding protein precursor MsmE msmE 0.453 286.00 putative ABC transporter, ATP binding protein ComA 0.471 195c hypothetical protein; similar to ORF 5 of bacteriophage SPP1 0.481 1316c hypothetical protein 0.487 503c hypothetical protein 0.491 72 0.00 conserved hypothetical protein; possible Na+/solute symporter 0.509 1935c conserved hypothetical protein 0.520 1822.00 putative aspartyl tRNA synthetase gatA 0.525 1421.00 putative dihydrolipoamide acetyltransferase, E2 component pdhC 0.528 1430 .00 putative cobyric acid synthase CobQ cobQ 0.530 986c hypothetical protein 0.542 166.00 hypothetical protein 0.557 1570.00 putative maltose/maltodextrin ABC transporter, MalG permease malG 0.581 1811.00 putative bacteriocin component ScnF homolog, putative ABC transporter, ATP binding protein scnF 0.582 94c hypothetical protein; putative transposase fragment 0.583 1804c hypothetical protein 0.595 1105c putative phosphoglycerate mutase like protein 0.600 789.00 conserved hypothetical protein 0.602 602.00 putative sodium dependent transporter 0.609 141.00 conserved hypothetical protein 0.614 1353.00 putative transposase 0.620 1067c putative ABC transporter, permease protein 0.662 1358.00 putative transposase fragment 0.692 535.00 put ative indoleglycerol phosphate synthase trpC 0.696 2076c hypothetical protein 0.703 181.00 putative mevalonate kinase 0.738 1463c conserved hypothetical protein 0.766 1646c conserved hypothetical protein, possible hemolysis inducing protein 0.786 2055.00 putative acetyltransferase 0.820 174c conserved hypothetical protein 0.821 1417c putative oleoyl acyl carrier protein thioesterase 0.862 451.00 hypothetical protein 0.867 798c hypothetical protein 0.881 1571.00 putative ABC transporter, ATP binding protein, MsmK like protein 0.886 1817c putative maturase related protein 0.890 1934c putative cobalt ABC transporter, ATP binding protein 0.896 290.00 conserved hypothetical protein 0.901 1809.00 putative bacteroiocin operon protein Scn G homolog scnG 0.927 538.00 putative tryptophan synthase, alpha subunit trpA 0.931 1663.00 putative thymidylate kinase kthY 0.940 938.00 putative phosphomevalonate kinase 0.978 438c putative (R) 2 hydroxyglutaryl CoA dehydratase activator related prot ein 0.983 1139c conserved hypothetical protein; possible methylase 1.017

PAGE 106

96 951.00 putative amino acid permease 1.021 1509.00 putative transcriptional regulator rgg 1.022 1012c putative transcriptional regulator 1.025 574c putative membrane protein 1.027 1999c conserved hypothetical protein 1.036 1150.00 putative transporter, trans membrane domain bacteriocin immunity protein 1.045 1506c conserved hypothetical protein 1.046 1079c putative ABC transporter, ATP binding protein 1.054 440.00 hyp othetical protein 1.055 15.00 putative cell division protein FtsH ftsH 1.086 1824c putative transcriptional regulator 1.090 1107c conserved hypothetical protein 1.093 1692.00 pyruvate formate lyase activating enzyme pflA 1.105 1007.00 putative ABC transporter, permease protein 1.134 1700c conserved hypothetical protein; possible LrgB family protein 1.139 1170.00 putative cytochrome C biogenesis protein ccdA 1.141 1152c conserved hypothetical protein 1.178 1154c hypothetical protein 1.200 20 30.00 putative transcriptional regulator CtsR ctsR 1.230 2141.00 glucose inhibited division protein homolog GidA gidA 1.252 1642c conserved hypothetical protein 1.263 1377c conserved hypothetical protein 1.268 545.00 hypothetical protein 1.308 120. 00 50S ribosomal protein L28 1.323 1486c conserved hypothetical protein 1.331 1326.00 putative peptide chain release factor (RF 2) rf2 1.337 1790c putative transcriptional regulator 1.411 311.00 PTS system, sorbitol (glucitol) phosphotransferase enz yme IIC2 1.419 1495.00 galactose 6 phosphate isomerase, subunit LacB lacB 1.436 657.00 putative MutG mutG 1.460 1456c hypothetical protein 1.474 1860.00 30S ribosomal protein S6 rs6 1.488 611.00 putative ATP dependent RNA helicase, DEAD box family 1.496 1648c hypothetical protein 1.497 1652.00 putative methylated DNA -protein cysteine S methyltransferase ogt 1.651 1654c putative acetyltransferase 1.782 2048.00 hypothetical protein 1.872 1590.00 intracellular alpha amylase amyA 1.927 2069.00 putative integral membrane protein 1.970 217c hypothetical protein 2.017 896.00 conserved hypothetical protein 2.060 2054c conserved hypothetical protein 2.177 1319c conserved hypothetical protein 2.277 151.00 hypothetical protein 2.414 58.00 hypothetical protein 2.517 1155.00 hypothetical protein 2.544 1553c hypothetical protein 2.633