USF Libraries
USF Digital Collections

Stable carbon isotope discrimination by form IC rubisCO from Rhodobacter sphaeroides

MISSING IMAGE

Material Information

Title:
Stable carbon isotope discrimination by form IC rubisCO from Rhodobacter sphaeroides
Physical Description:
Book
Language:
English
Creator:
Thomas, Phaedra
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Carboxylation
Calvin-Benson-Bassham cycle
Alphaproteobacteria
Autotroph
Fractionation
Dissertations, Academic -- Biology -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Variations in the relative amounts of ¹²C and ¹³C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against ¹³C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating the stable carbon isotopic composition (δ¹³C = {¹³C/¹²Csample/¹³C/¹²Cstandard - 1} X 1000) of biomass. Six different forms of ribulose 1,5-bisphosphate carboxylase/oxygenase or RubisCO (IA, IB, IC, ID, II, and III), the carboxylase of the Calvin-Benson-Bassham cycle (CBB), are utilized by algae and autotrophic bacteria that rely on the CBB cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs.Isotopic discrimination, expressed as ε values (={¹²k/¹³k - 1} X 1000; ¹²k and ¹³k = rates of ¹²C and ¹³C fixation) range from 18 to 29⁰/₀₀, explaining the variation in biomass δ¹³C values of autotrophs that utilize these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides. The purpose of this work is to determine the ε value for the form IC RubisCO enzyme from R. sphaeroides. Under standard conditions (pH 7.5 and 5 mM DIC), form IC RubisCO had an ε value of 29⁰/₀₀.Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of δ¹³C values of organisms fixing carbon via the Calvin-Benson-Bassham cycle. These results are helpful for determining the degree to which CBB cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.
Thesis:
Thesis (M.S.)--University of South Florida, 2008.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Phaedra Thomas.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 70 pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002021212
oclc - 427646938
usfldc doi - E14-SFE0002611
usfldc handle - e14.2611
System ID:
SFS0026928:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 2200397Ka 4500
controlfield tag 001 002021212
005 20090724124039.0
007 cr mnu|||uuuuu
008 090724s2008 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002611
035
(OCoLC)427646938
040
FHM
c FHM
049
FHMM
066
(S
090
QH307.2 (Online)
1 100
Thomas, Phaedra.
0 245
Stable carbon isotope discrimination by form IC rubisCO from Rhodobacter sphaeroides
h [electronic resource] /
by Phaedra Thomas.
260
[Tampa, Fla] :
b University of South Florida,
2008.
500
Title from PDF of title page.
Document formatted into pages; contains 70 pages.
502
Thesis (M.S.)--University of South Florida, 2008.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor: Kathleen M. Scott, Ph.D.
520
ABSTRACT: Variations in the relative amounts of C and C in microbial biomass can be used to infer the pathway(s) autotrophs use to fix and assimilate dissolved inorganic carbon. Discrimination against C by the enzymes catalyzing autotrophic carbon fixation is a major factor dictating the stable carbon isotopic composition (C = {[C/Csample/C/Cstandard] 1} X 1000) of biomass. Six different forms of ribulose 1,5-bisphosphate carboxylase/oxygenase or RubisCO (IA, IB, IC, ID, II, and III), the carboxylase of the Calvin-Benson-Bassham cycle (CBB), are utilized by algae and autotrophic bacteria that rely on the CBB cycle for carbon fixation. To date, isotope discrimination has been measured for form IA, IB, and II RubisCOs.Isotopic discrimination, expressed as values (={[k/k] 1} X 1000; k and k = rates of C and C fixation) range from 18 to 29/, explaining the variation in biomass C values of autotrophs that utilize these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manganese-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, and extremely metabolically versatile organisms such as Rhodobacter sphaeroides. The purpose of this work is to determine the value for the form IC RubisCO enzyme from R. sphaeroides. Under standard conditions (pH 7.5 and 5 mM DIC), form IC RubisCO had an value of 29/.Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic discrimination makes it possible to constrain the range of C values of organisms fixing carbon via the Calvin-Benson-Bassham cycle. These results are helpful for determining the degree to which CBB cycle carbon fixation contributes to primary and secondary productivity in microbially-dominated food webs.
653
Carboxylation
Calvin-Benson-Bassham cycle
Alphaproteobacteria
Autotroph
Fractionation
690
Dissertations, Academic
z USF
x Biology
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2611



PAGE 1

Stable Carbon Isotope Discrimi nation by Form IC RubisCO from Rhodobacter sphaeroides by Phaedra Thomas A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science Department of Biology College of Arts and Sciences University of South Florida Major Professor: Kathle en M. Scott, Ph.D. Valerie J. Harwood, Ph.D. John H. Paul, Ph.D. Date of Approval: July 16, 2008 Keywords: carboxylation, Calvin-Benson-Bassham cycle, alphaproteobacteria, autotroph, fractionation Copyright 2008, Phaedra Thomas

PAGE 2

Acknowledgements The funding for this graduate research was made possible by the NSF FGLSAMP Bridge to the Doctorate Program at the Un iversity of South Florida (Award HRD # 0217675) and NSF Biological Oceanogra phy (Award# OCE-0327488, to K.M.S). Special thanks are given to the graduate rese archers in Dr. Scott’s lab, as well as to Dr. Robert Michener at the Boston University St able Isotope Lab for analyzing our samples via mass spectrometry, and to Dr. F. Robert Tabita for providing the Form IC RubisCO enzyme.

PAGE 3

Table of Contents List of Tables ii List of Figures iii Abstract iv Chapter One: Introduction 1 The Calvin Cycle 1 Other Autotrophic Pathways 3 Elucidating autotrophic pathways from contemporary & ancient environmental samples 6 Stable carbon isotope ratios and 13C values 7 Enzymatic isotope discrimination 10 Chapter Two: Isotope Discri mination by Form IC RubisCO 12 Experimental Procedures 16 Results 18 Discussion 20 Chapter Three: Conclusion 25 Experiments with Form ID RubisCO 25 References 27 Appendices 31 Appendix A: Table of RubisCO values from Ralstonia eutropha 32 Appendix B: Manuscript on form ID RubisCO value from Emiliania huxleyi 33 Appendix C: Manuscript on form ID RubisCO value from Skeletonema costatum 45 Appendix D: Abstract from Publication of Thiomicrospira crunogena XCL-2 genome 65 Appendix E: Abstract from Publication of Sulfurimonas denitrificans genome 68 i

PAGE 4

List of Tables Table 1 The distribution of autotrophi c pathways among the domains of life 5 Table 2 RubisCO values determined fr om nine independent experiments with the Rhodobacter sphaeroides enzyme 19 Table 3 values from form I and II RubisCO enzymes 20 Table 4 13CCO2 and 13Cbiomass values from autotrophic organisms whose RubisCO values have been determined 22 Table A-1 RubisCO values determined fr om two independent experiments with the IC enzyme from Ralstonia eutropha 33 Table B-1 values of different RubisCO forms 37 Table C-1 values of different forms of RubisCO that have been measured with kinetic isotope experiments 61 ii

PAGE 5

List of Figures Figure 1. The RubisCO reaction in the Calvin-Benson-Bassham (CBB) Cycle 2 Figure 2. Zero-point energy diagram of 12C and 13C carbon dioxide 8 Figure 3. Minimum evolution tr ee of RubisCO large subunit ( cbbL ) nucleotide sequences 15 Figure 4. Changes in the concentration ( ) and 13C ( ) of dissolved inorganic carbon (DIC) vs. time for Rhodobacter sphaeroides RubisCO 18 Figure 5. Natural log-transf ormed isotope ratios (R= 13C/12C) and concentrations of dissolved inorganic carbon (DIC) during carbon fixation by form IC RubisCO 19 Figure 6. Whole-organism isotopic discrimination ( 13CCO2 13Cbiomass) versus enzymatic isotopic discrimination (RubisCO values). 22 Figure 7. 13C values of atmospheric CO2 and biomass from organisms using different pathways of autotrophy 23 Figure B-1. Isotope fractionation by E. huxleyi RubisCO 39 Figure C-1. Isotope frac tionation of DIC as CO2 is consumed by S. costatum RubisCO and spinach RubisCO 55 Figure C-2. The consumption of DIC over time by S. costatum RubisCO 56 Figure C-3. Radiometric a ssay of partially purified S. costatum RubisCO 57 Figure C-4. Phylogenetic tree of sele cted RubisCO large subunit genes ( rbcL ) 58 Figure D-1. PloS Biology Open Access License 67 Figure E-1. American Society for Microbiology permission document 70 iii

PAGE 6

Stable Carbon Isotope Discrimination by Form IC RubisCO from Rhodobacter sphaeroides Phaedra J. Thomas ABSTRACT Variations in the relative amounts of 12C and 13C in microbial biomass can be used to infer the pathway(s) autotrophs us e to fix and assimilate dissolved inorganic carbon. Discrimination against 13C by the enzymes catalyz ing autotrophic carbon fixation is a major factor dictating the stable carbon is otopic composition ( 13C = {[13C/12Csample/13C/12Cstandard] – 1} X 1000) of biomass. Si x different forms of ribulose 1,5-bisphosphate carboxylase/oxygenase or Ru bisCO (IA, IB, IC, ID, II, and III), the carboxylase of the Calvin-Benson-Bassham cycle (CBB), are utilized by algae and autotrophic bacteria that rely on the CBB cy cle for carbon fixation. To date, isotope discrimination has been measured for fo rm IA, IB, and II RubisCOs. Isotopic discrimination, expressed as values (={[12k/13k] – 1} X 1000; 12k and 13k = rates of 12C and 13C fixation) range from 18 to 29‰, expl aining the variation in biomass 13C values of autotrophs that utilize these enzymes. Isotope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine mangane se-oxidizing bacteria, some nitrifying and nitrogen-fixing bacteria, a nd extremely metabolically ve rsatile organisms such as Rhodobacter sphaeroides The purpose of this work is to determine the value for the iv

PAGE 7

form IC RubisCO enzyme from R. sphaeroides Under standard conditions (pH 7.5 and 5 mM DIC), form IC RubisCO had an value of 22.9‰. Sampling the full phylogenetic breadth of RubisCO enzymes for isotopic di scrimination makes it possible to constrain the range of 13C values of organisms fixing carb on via the Calvin-Benson-Bassham cycle. These results are helpful for determ ining the degree to which CBB cycle carbon fixation contributes to primary and secondary productivity in micr obially-dominated food webs. v

PAGE 8

Chapter One Introduction The Calvin Cycle The Calvin-Benson-Bassham (CBB) cycl e is the most common carbon-fixing pathway for autotrophic organisms. It is pr esent in plants, alg ae, cyanobacteria, and proteobacteria, and has recently been found in firmicutes (3). The CBB cycle consists of the dark reaction of photosynthesis in which CO2 is incorporated into organic compounds for the biosynthetic needs of the organism. It consists of three stages: carbon fixation, reduction, and regeneration (1). RubisCO (Ribulose 1,5-bisphosphate carboxy lase/oxygenase) is the carbon-fixing enzyme in the Calvin cycle (48). The RubisCO reaction involves the catalytic conversion of one molecule of ribulo se 1,5-bisphosphate (RuBP), via carboxylation, into two molecules of phosphoglyceric acid (PGA) (Figur e 1). This comprises the carbon fixation step of the Calvin cycle. The products of th e RubisCO reaction can be shuttled into other metabolic pathways and used to form amino acids and other precursors for biosynthesis. RubisCO is a relatively nonselective enzyme that can utilize both carbon dioxide and oxygen as substrates (18). There are four main forms of RubisCO, form I, II, III, and IV that differ substantially in their amino acid sequences (see below; 48). Form I RubisCO is 1

PAGE 9

present in cyanobacteria, proteobacteria, and most plastids, and can be further subdivided, based on amino acid sequences, into forms IA, IB, IC, and ID. Form II is found in some proteobacteria and dinoflagellate s, and the Form III enzyme is present in some archaea. Form IV RubisCO is widespr ead in bacteria and is not active as a carboxylase (49). Figure 1. The RubisCO reaction in the Calvin-Benson-Bassham (CBB) Cycle. Catalytically active form I RubisCO consis ts of eight large subunits (encoded by the cbbL gene) and eight small subunits (encoded by the cbbS gene), while form II and III consist of a single type of subunit that is hom ologous to form I large subunits (48). The amino acid sequences of form I large subunits and II RubisCOs are quite divergent, with only ~23% sequence similarity (34). With in the form I RubisCOs, the amino acid sequences of the large subunits of form IA and IB RubisCOs are approximately 80% similar, as are the form IC and ID Ru bisCOs, while the IA/IB cluster has only 2

PAGE 10

approximately 60% sequence similarity with th e IC/ID cluster (34, 48) Consistent with these differences in sequence, each form has different specificities for CO2 and O2. Form I RubisCOs have a higher specificity for CO2 than O2, compared to the form II enzymes (48, 49). However, despite these differences in the primary structures of the four main forms, the active site responsib le for the carboxylation of CO2 and the oxygenation of O2 is conserved across the various RubisCOs (48). Other Autotrophic Pathways There are three other autotrophic pathways present in microorganisms in addition to the CBB cycle. In the reverse citric ac id cycle (rTCA), acetyl-CoA is formed by splitting citrate that was produced by reversing the citric acid cycle so that it operates in a carboxylating, reductive directi on (20). The acetyl-CoA is reductively carboxylated to pyruvate, which is shuttled into other central metabolic pathways (20). The three key enzymes responsible for the reverse rotation of the oxidative citric acid cycle are ATP citrate lyase, 2-oxoglutarate: ferredoxin oxidoreductase, and fumarate reductase (20). The acetyl-CoA pathway (AcCoA) produ ces acetyl-coA via sequential reduction of carbon dioxide. This molecule is reduced to the level of a methyl group while attached to a cofactor, followed by acetyl-CoA synthase-mediated condensation of this methyl group with a second carbon that has been re duced from the level of carbon dioxide to carbon monoxide via carbon monoxide dehydrogenase (CODH) (40). The 3hydroxypropionate cycle (3-HPP), which is th e most recently discovered pathway for carbon fixation, functions by carboxylating ace tyl-CoA and converting it to propionylCoA with 3-hydroxyproprionate as an intermediate (52). The key enzyme for this cycle 3

PAGE 11

is malonyl-CoA reductase, which reduces mal onyl-CoA, an initial product of acetyl-CoA carboxylation, to 3-hydroxypropionate (19). Propionyl-CoA undergoes carboxylation, forming malyl-CoA, which further divides into acetyl-CoA and glyoxylate (52). Autotrophic pathways cannot be pred icted based on the host organism’s phylogeny (Table 1). The rTCA cycle is found in a variety of auto trophic bacteria and archaea, Chlorobium sp ., sulfur-reducing Crenarchaeota ( Thermoproteus and Pyrobaculum ), sulfate-reducing bacteria ( Desulfobacter ), as well as microaerophilic and hyperthermophilic hydrogen-oxi dizing bacteria like Aquifex sp and Hydrogenobacter sp (20). The acetyl-CoA pathway occurs in autotrophic sulfate-reducing bacteria, methanogens, and acetogenic bacteria (11). The acetyl-CoA pathway has also been studied in Spirochaetes like Treponema primitia (14). The 3-hydroxypropionate cycle operates in the green nonsulfur bacterium, Chloroflexus aurantiacus and autotrophic Crenarchaeota (19). The autotrophic pathways presented in Ta ble 1 differ in two important ways: their sensitivity to oxygen (O2) and their energetic requirement s. The rTCA cycle and the acetyl-CoA pathway are sensitive to oxygen, due to the extreme oxygen sensitivity of pyruvate: ferredoxin oxidoreductase, which is responsible for car boxylating acetyl-CoA (rTCA and acetyl-CoA pathways), as we ll as CODH (acetyl-CoA pathway), which explains why these alternative methods of fixing CO2 predominate in anaerobic environments (4, 50). The Calvin cycle and the 3-hydroxyproprionate cycle are both less sensitive to oxygen (Thauer, 2007). 4

PAGE 12

Table 1. The distribution of autotrophic pathways among the domains of life. *Only divisions with autotrophic members ar e listed. †It has not been determined whether Treponema primitia is an autotroph. Abbrevia tions: Calvin-Benson-Bassham cycle = CBB, reductive citric acid cycle = rTCA, acetyl-CoA pathway = Ac-CoA, and 3hydroxypropionate cycle = 3-HPP. Domain Division* Pathway(s) Bacteria Proteobacteria CBB, rTCA Cyanobacteria (Eukarya Plants) CBB Chloroflexi 3-HPP Chlorobi rTCA Aquificae rTCA Firmicutes CBB, Ac-CoA Planctomycetes Ac-CoA Spirochaetes Ac-CoA† Archaea Crenarchaeota rTCA, 3-HPP Euryarchaeota Ac-CoA, CBB? All of the carbon fixation pathways discussed require NADPH, ferredoxin, or other intracellular electron-s huttling cofactors as electr on donors, except the acetyl-CoA pathway, which uses H2 as its donor and is the only known autotr ophic pathway that yields metabolic energy instead of consuming it. This is because it directly couples the removal of electrons from H2, and transfers these electrons to CO2 for the creation of membrane potential (11). The Calvin cycle is the most energetically expensive method of fixing carbon, due to multiple dephosphorylati on events necessary to regenerate RuBP 5

PAGE 13

from 3-PGA, followed by the rTCA cycle, and acetyl-CoA pathway (28). Autotrophs that are primarily found in low-oxygen envir onments often use alternatives to the CBB cycle because they demand less energy to synthe size an equivalent am ount of biomass. However, in oxic environments, the CBB cycl e dominates due to its relative stability under these conditions (28). Elucidating autotrophic pathways from contemporary and ancient environmental samples It is interesting to resolve which path ways are in operation in contemporary and ancient environments because it gives us insight into the history of carbon cycling. Identifying the autotrophic pathways operating in ancient environments can help clarify whether the CBB cycle has always been the dominant carbon-fixing pathway. In order to determine which pathways ar e operating in a part icular contemporary environment, enzyme and nucleic acid assays can be used. If sufficient biomass is present, assays for enzymes diagnostic for the different pathways can be used; e.g. RubisCO for the CBB cycle (48), ATP citrate lyase for the rTCA cycle (20), CODH for the acetyl-CoA pathway (40), and malonyl-C oA reductase for the 3-hydroxyproprionate cycle (19). If insufficient bi omass is available for enzyme assays, nucleic acid-based approaches (e.g., Southern & Northern blots; PCR) can be utilized to identify which autotrophic CO2-fixing pathways are in operation. The cbbL or cbbM genes for form I or II RubisCO can be used as indicators of Calv in Cycle presence in a target organism; genes encoding the enzymes diagnostic for other autotrophic pathways, (see above) can be utilized as markers for the presence of those pathways. 6

PAGE 14

However, enzyme assays and nucleic acidbased techniques do not work for fossil samples, as these macromolecules are not pr esent in appreciable quantities. Instead, isotope measurements can be used, since 12C and 13C contents persist throughout geological time. Stable carbon isotope com positions of organic compounds extracted from fossil sediments can help identify wh ich autotrophic pathway dominated the input of carbon into a particular ecosystem (42, 27). Stable carbon isotope ratios and 13C values Three isotopes of carbon ex ist: two stable isotopes (12C and 13C), and radioactive 14C. 12C is more abundant in nature than 13C, which is ~1‰ of all carbon. The relative amounts of 12C and 13C in a sample are expressed as 13C values, in parts per thousand (‰): 13C = ({Rsample/Rstandard} – 1) x 1000, where the limestone, PeeDee Belemnite, is the standard (31, 27), and R = 13C/12C. A more negative 13C value indicates that there is less 13C in the sample (it is ‘isotopically depleted’). Conversely, a more positive 13C indicates that more 13C is present in the sample (it is ‘isotopically enriched’) (31). 13C values vary greatly. The 13C value of atmospheric CO2 is ~-8‰, while the 13C of inorganic carbon dissolved in seaw ater is between ~2‰ and ~1‰ (41, 21, 23). Biomass 13C values are more isotopically deplet ed than these inorganic carbon sources, due to the relative weakness of bonds to 12C, compared to 13C. Since the zero-point energy of bonds to 13C is lower than the zero-point energy of bonds to 12C, compounds containing 12C tend to react more quickly than those containing 13C (Figure 2) (29). As a result, autotrophs fix 12CO2 more rapidly than 13CO2 and their biomass has more negative 13C values (6). Since autotroph biomass is isotopically depleted relative to source CO2, 7

PAGE 15

so is the biomass of the heterotrophs that consume them (17). Figure 2. Zero-point energy diagram of 12C and 13C carbon dioxide. The 13C of C3 plants that use the CBB cycl e is -18-30‰; this great degree of isotope depletion relative to atmospheric CO2 is largely due to s ubstantial fractionation by RubisCO during carbon fixation (17). The 13C of C4 plants is -8‰ to -20‰. These values are more positive than C3 plants b ecause the enzymes responsible for the initial fixation of carbon into C4 compounds do not fr actionate to the same degree as RubisCO does (17). The 13C value of marine photoautotrophs su ch as algae is between -18 and 28‰, but is generally more toward the isotopical ly enriched end of this range (13). They can be isotopically enriched due to a vari ety of factors, includ ing carbon-concentrating mechanisms (CCMs) and diffusi ve limitation (DL) (22). In the case of both CCMs and DL, the isotopic enrichment of intracellular biomass is due to isotopic enrichment of intracellular CO2. This isotopic enrichment of intracellular CO2 is due to low rate of CO2 efflux from the cells, compared to the rate of 8

PAGE 16

influx and fixation. In the case of a cell with a CCM, the rate of influx is high, due to the activities of multiple bicarbonate transporters Intracellular bicarbonate is converted to CO2 by carbonic anhydrase. The majority of CO2 is fixed by RubisCO. The CO2 remaining is isotopically enri ched. Cells with CCMs typically have mechanisms to prevent the efflux of this pool of intracellular CO2, which prevents the isotopic signature from CO2 fractionation by RubisCO from being wiped away by rapid exchange of intracellular CO2 with extracellular dissolved inorga nic carbon (22). Likewise, cells experiencing DL have a very low rate of CO2 efflux, since diffusive limitation of CO2 supply to the cell resu lts in extraordinarily low intr acellular concen trations of CO2 (22). The differences in 13C values among C3, C4, and marine organisms make it possible to trace carbon through food webs (17), drawi ng on the adage that you are what you eat. The 13C-content of fossil organic carbon has be en used as evidence for biological carbon fixation. In some fossil samples, both organic and inorganic carbon are preserved, providing a means to measure isotope discrimination between inorganic ( 13C = ~2‰) and organic carbon ( 13C = -25‰), billions of years ago (42). The level of isotopic discrimination between organic and inorga nic carbon in these samples cannot be achieved by a/biological processes, it is onl y possible via enzyme discrimination during autotrophic carbon fixation (42). Based on the li mited data available from cultures, the level of isotope discrimination observed in thes e fossil biomass samples is consistent with the CBB cycle and acetyl-CoA pathway. Ho wever, hypotheses about which autotrophic pathways may be operating are weakened by lim ited sampling; it is still not possible to predict, with confidence, the 13C values expected for each pathway. 9

PAGE 17

Enzymatic isotope discrimination The value is a measure of isotope discri mination by an enzyme; in this case, RubisCO. Biomass 13C values from organisms using the CBB cycle are almost always more negative than source CO2 (39), but different RubisC O enzymes fractionate to varying degrees due to slight differences in th e structure of their active site (15). Isotope fractionation is described as a discrimination factor ( ; = {[12k/13k] –1} X 1000, where 12k and 13k = the rates of 12C and 13C fixation (15). Epsilon values ( ) for enzymes are calculated by measuring the change in the isotopic composition of the substrate pool as an enzyme reaction progresses. More isotop ically selective enzymes will leave behind relatively more 13CO2, while less isotopically selective enzymes (with smaller values) will leave behind less 13CO2. For RubisCO enzymes, the isotopic com position of dissolved inorganic carbon (DIC) is monitored; changes in the 13C of DIC can be described using the Rayleigh distillation equation: (R/R1) = (C/C1)1/ –1, where R is the isotope ratio of the DIC, C is the DIC concentration, and both R1 and C1 represent the correspondi ng quantities present at the beginning of the experiment (45). The is Rr/Rp; Rr is the isotope ratio of available reactant, and Rp is the isotope ratio of th e product, and is equal to 12k/13k (45). values should affect the 13C values of autotroph biomass. Large values should result in more negative biomass 13C values, while small values should result in more positive biomass 13C values, because a less isotopically selective enzyme should fix more 13CO2. The values for forms IA, IB, and II R ubisCO enzymes are currently known ( = 1829‰). However, the values for forms IC and ID RubisCOs have not been measured, 10

PAGE 18

which makes it impossible to predict the range of 13C values expected for organisms using the CBB cycle, which really limits the interpretation of the 13C values from contemporary and ancient samples. The purpose of this research is to determine values for the form IC RubisCO enzymes. Form IC RubisCOs have not been explored yet and knowing their values will impact the fields of microbial ecology and biogeochemistry because it will help to constrain the range of 13C values expected for organisms using the CBB cycle. 11

PAGE 19

Chapter Two Isotope Discrimination by Form IC RubisCO It is of interest to ascertain whic h carbon-fixing pathways are operating in contemporary and ancient microbially-dominat ed habitats, as the pathways differ in energetic expense and cofactor requirements (1 1), which in turn influence the ecology of the organisms. It is not possible to colle ct biochemical and/or nucleic acid-based evidence for pathway presence in the case of fo ssil biomass samples. Variations in the relative amounts of 12C and 13C in autotrophic microbial biomass, expressed as 13C values (= {[Rsample/Rstandard] – 1} X 1000; Rsample = 13C/12Csample, Rstandard = 13C/12CPeeDeeBelemnite), can be used to gather information about the metabolic pathway(s) used by these organisms. For autotrophs, 13C values can also be used to ascertain the rate of CO2 exchange between the cell and the envir onment, to determine the source of the CO2, and to elucidate environmental factors influencing carbon fixation (17). Indeed, the broad range of 13C values collected for autotrophic microorganisms ( 13C = -8‰ to 35‰) has been utilized as evidence for the inte rplay of these factors. However, in order for the influence of the above factors to be rigorously evaluated, the baseline fractionation by the carboxylase(s) responsible for carbon fixation must be measured (8, 11, 13, 17, 33, 43). 12

PAGE 20

Autotrophs that utilize the Calvin-Bens on-Bassham cycle (CBB autotrophs), have a diversity of RubisCO (ribulose 1,5-bis phosphate carboxylase/oxygenase) enzymes that catalyze the carboxylation of ribulose 1,5-bisphosphate (RuBP) to form two molecules of phosphoglyceric acid (PGA; 47). RubisCO exists in six different forms that are catalytically active as carboxylases (IA, IB, IC, ID, II, and III; Figure 3). Form I RubisCO is present in cyanob acteria (IA, IB), some prote obacteria (IA, IC), most chloroplasts (IB, ID) (48), and the firmicute Sulfobacillus acidophilus (IC/ID) (3). Catalytically active form I RubisCO consists of eight large subunits (encoded by the cbbL gene) and eight small subunits (encoded by the cbbS gene). Form II is found in proteobacteria and some dinoflagellates, and form III is present in some archaea (48). Both form II and III enzymes consist of a single type of subunit, evolutionarily related to the large subunits of form I RubisCO (48). Given the divergent forms of RubisCO, it is not surprising that RubisCO enzymes discriminate against 13CO2 to different degrees. Isotope discrimination ( ={[12k/13k] – 1} X 1000; 12k and 13k = rates of 12C and 13C fixation) (15) has been measured in a limited number of form IA, IB, and II enzymes, and ranges from 18 to 29‰ (44, 15, 36, 37, 38, 46). Since the value is roughly equal to the difference between the 13C of the CO2 source from which the RubisCO is drawing (intracellular CO2) and the 13C of the CO2 that it fixes (15, 44), he terogeneity in RubisCO values is likely to be responsible for at least 10‰ of the 13C scatter observed in CBB autotrophs Prior to this study, it was impossible to predict whether form IC RubisCO enzymes would have values similar to those measured for form IA, IB, & II RubisCOs. 13

PAGE 21

Our long-term objective is to sample the full phylogenetic breadth of RubisCO enzymes and be able to constrain the 13C values expected for CBB autotrophs from ancient and contemporary ecosystems. Isot ope discrimination by form IC RubisCO has not been measured, despite the presence of this enzyme in many proteobacteria of ecological interest, including marine manga nese-oxidizing bacteria (5, 32), some nitrifying and nitrogen-fixi ng bacteria, and soil microorganisms like the extremely metabolically versatile bacterium, Rhodobacter sphaeroides (48; Fig.3). Rhodobacter sphaeroides is an -proteobacterium capable of nonoxygenic photolithoautotrophic growth and photoheterotr ophic growth (35). This organism has two RubisCO enzymes: a form IC RubisCO and a form II RubisCO (12). In this organism, the two forms of RubisCO are differe ntially expressed in response to a variety of growth conditions, e.g. CO2 concentration (10). In orde r to be able to detect the isotope signature of organisms using form IC RubisCO for carbon fixation, we measured the value for R. sphaeroides RubisCO using the high-precision substrate depletion method (15, 36, 43). 14

PAGE 22

IC/ID 15 Rhodobacter sphaeroidesATCC17025 Stappia aggregataIAM12614 Paracoccus denitrificansPD1222 Xanthobacter autotrophicusPy2 Xanthobacter autotrophicus Methylibium petroleiphilumPM1 Ralstonia eutrophaH16 Ralstonia eutropha Burkholderia xenovoransLB400 Burkholderia phymatumSTM815 Bradyrhizobium japonicumUSDA110 Bradyrhizobium japonicum Oligotropha carboxidovorans Bradyrhizobium spBTAi1 Nitrobacter hamburgensisX14 Rhodopseudomonas palustrisCGA009 Rhodopseudomonas palustrisBisB18 Aurantimonas spSI859A1 Mnoxidizing bacteriumSI859A1 Roseovarius spHTCC2601 Acidiphilium cryptumJF5 Nitrosospira sp40KI Emiliania huxleyi Porphyridium aerugineum Phaeodactylum tricornutum Cylindrotheca sp Thalassiosira pseudonana Thalassiosira nordenskioeldii Sulfobacillus acidophilus Nitrobacter winogradskyi Nitrosomonas spENI11 Solemya velum Prochlorococcus marinus MIT 9313 Synechococcus sp WH 8102 Chromatium vinosum Spinacia oleracea Trichodesmium erythraeum Nostoc punctiforme Synechococcus elongatus PCC 6301 Archaeoglobus fulgidus Methanococcus jannaschii Methanosarcina acetivorans Thiobacillus denitrificans Thiomicrospira crunogena Rhodobacter capsulatus Rhodobacter sphaeroides II 100 99 100 57 99 100 100 98 70 63 72 100 100 100 99 100 74 100 100 100 100 64 100 100 99 98 45 87 58 99 100 59 57 38 98 92 54 77 57 56 92 20 31 0.1 IC ID IA IB III II

PAGE 23

Figure 3. Minimum evolution tree of RubisCO large subunit ( cbbL ) nucleotide sequences. The nucleotide sequences obtained from GenBank were translated to amino acid sequences and aligned based on the am ino acid sequences using BIOEDIT (16). The alignments were examined to make cer tain that active site s and other conserved regions were properly aligned. Nucleotid e sequences were used to assemble a phylogenetic tree with MEGA 3.1 software, us ing the Kimura 2-parameter nucleotide model with 1000 replicates for ca lculating bootstrap values (24). Experimental Procedures Form IC enzyme was cloned from Rhodobacter sphaeroides expressed in Escherichia coli and purified using standard HPLC protocols (25, 18). The purity of the enzyme was monitored by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and stained with coomassie blue (25). RubisCO values were determined by using the substrate depletion method, in which a buffered solution of RubisC O, carbonic anhydrase (CA), ribulose 1,5bisphosphate (RuBP), and dissolved inorganic car bon is sealed in a gastight syringe (44). The value is calculated from the changes in the 13C value of the dissolved inorganic carbon pool as it is consumed by RubisCO (44). RuBP was s ynthesized enzymatically to minimize the concentration of inhibitory is omers present in commercially-available RuBP (44, 46). Fresh RuBP was stored at –70C and used within one week of synthesis. Form IC RubisCO was prepared for th e reaction by desalti ng it into RubisCO buffer (25 mM MgCl2, 10 mM dithiothreitol, 50 mM Bicine, 5 mM NaHCO3, pH 7.5), using PD-10 columns (Amersham Biosciences, NJ). 20 mL of reaction buffer (RubisCO buffer without NaHCO3) was sparged with N2 and 1 mg of bovine carbonic anhydrase (CA) was added. This solution was filter-sterilized and loaded into a glass gastight syringe sealed with a septum (44). Filter-sterilized NaHCO3 (final concentration of 5 16

PAGE 24

mM) and RubisCO (~1 mg/mL) were added to the reaction syringe and activated for 1015 minutes. The reaction was st arted by injecting fresh RuBP (~5 mM) into the syringe, and was maintained at 25C. Reaction progress was monitored by removi ng samples and injecting them into a gas chromatograph (9) to measure the disso lved inorganic carbon c oncentration (DIC, = CO2 + HCO3 + CO3 -2). Over the time course of the reaction, samples were removed from the reaction syringe, acidified with 43% phosphoric acid, and injected into a vacuum line to cryodistill the DIC (44). The cryodistilled DIC samples were sent to the Boston University Stable Isotope Facility for measurement of the 13C of the DIC. values were derived from the DIC concentrations and the 13C values of the DIC as calculated in Scott et al (45). A modified version of the Rayleigh distillation equation was used: ln(RDIC) = {(1/ C) -1} x ln[DIC] + ln{(RDIC0/[DIC]0) (1/ C – 1)} where RDIC = 13C/12C of DIC at a particular timepoint RDIC0 = RDIC at the first timepoint [DIC] = concentration of DI C at a particular timepoint [DIC]0 = [DIC] at the first timepoint C = RHCO3 -/RCO2 from Mook et al ., (30) = k12/k13 = kinetic isotope effect for CO2 The values were calculated from the slope of this line ( = ( 1) 1000), and data from multiple runs were averaged using Pitman Estimators (45). 17

PAGE 25

Results As expected, carbon fixation by form IC RubisCO of R. sphaeroides results in isotopic enrichment of the remaining dissolv ed inorganic carbon (F igure 4, Figure 5). The value for this enzyme is 22.9‰ with a 95% confidence interval of 21.4-24.7‰ (Table 2). Rhodobacter sphaeroides RubisCO is less isotopically selective than spinach RubisCO ( = 27.5‰ when incubated under identical conditions) (2). Figure 4. Changes in the concentration ( ) and 13C ( ) of dissolved inorganic carbon (DIC) vs. time for Rhodobacter sphaeroides RubisCO sealed in a sterile, gastight syringe in buffer with ribulose 1,5-bisphosphate and carbonic anhydrase (see Experimental Procedures for details). 18 -4 -2 0 2 4 6 8 10 0123456Time (hrs.)13C0 1 2 3 4 5 6[DIC], mM

PAGE 26

-4.495 -4.487 -4.479 -4.471 11.11.21.31.41.51.61.7 lnDIClnR Figure 5. Natural log-tran sformed isotope ratios (R= 13C/12C) and concentrations of dissolved inorganic carbon (D IC) during carbon fixation by form IC RubisCO. Results from nine independent experiments are show n, and each is depicted with a different symbol. The initial isotope ratio and con centration of DIC varied slightly between experiments; for clarity, data from all expe riments have been normalized to have the same initial DIC concentration and isotope ratio. Table 2. RubisCO values determined from nine independent experiments with one enzyme preparation of the R. sphaeroides enzyme 19 Experiment # value (‰) # of Timepoints 1 29.6 7 2 24.4 6 3 24.1 7 4 21.0 7 5 22.7 7 6 24.3 8 7 24.7 8 8 22.6 8 9 24.1 7

PAGE 27

Discussion This is the first determination of an value from a Form IC RubisCO, and it falls within the range of values measured for other RubisCO enzymes (Table 3). Its value is statistically indistinguishab le from form IA enzymes, fo rm IB from the cyanobacterium Anacystis nidulans as well as from form II RubisCO from Rhodospirillum rubrum However, R. sphaeroides RubisCO has an value significantly highe r than that of the form II RubisCO from the gammaproteobacter ial endosymbiont of th e hydrothermal vent tubeworm, Riftia pachyptila and significantly smaller than the value of spinach RubisCO (Table 3). Table 3. values from form I and II RubisCO enzymes Species Form of RubisCO value (‰) {95% C.I.} Solemya velum symbiont IA 24.5 Prochlorococcus marinus MIT 9313 IA 24.0 Spinacia oleracea IB 29 Anacystis nidulans IB 22 Rhodobacter sphaeroides IC 22.9 {21.4-24.7} Riftia pachyptila symbiont II 19.5 Rhodospirillum rubrum II 22 The 13C value of R. sphaeroides biomass, when it fixes carbon with form IC RubisCO, can be predicted from the RubisCO value. Organisms that fix carbon with IC enzymes, should they all fr actionate similarly to the R. sphaeroides enzyme, are likely to 20

PAGE 28

have biomass 13C values similar to other CBB autotrophs whose RubisCO values have been determined. When an organisms’ whole-cell isotop ic discrimination ( 13CCO2 13Cbiomass) is plotted against its RubisCO value, it is apparent that organisms fixing carbon via RubisCOs with larger values fractionate carbon to a greater extent (Table 4, Figure 6). Since the R. sphaeroides RubisCO has an value similar to the enzyme from R. rubrum it is likely that w hole-cell discrimination by R. sphaeroides is comparable to that observed in R. rubrum when grown autotrophically. Indeed, biomass 13C values for R. sphaeroides can be predicted from the R. rubrum and R. sphaeroides values, as well as R. rubrum whole-cell isotope discrimination: R rubrum = 22‰ R sphaeroides = 22.9‰ For R. rubrum 13CCO2 13Cbiomass = 12.3‰ Since R sphaeroides R rubrum = 0.9‰, For R. sphaeroides predicted biomass = 13CCO2 13Cbiomass 12.3 + 0.9 = 13.2‰ If 13CCO2 -8‰, then 13CR.sphaeroides -8‰ 13.2‰ = -21.2‰ 21

PAGE 29

Table 4. 13CCO2 and 13Cbiomass values from autotrophic organisms whose RubisCO values have been determined Species 13CCO2 (‰) 13Cbiomass (‰) Riftia pachyptila symbiont -6.6 to -7.8 -9 to -16 Solemya velum symbiont -14 to -18 -30 to -35 C3 plants (Spinach) -8 -22 to -30 Rhodospirillum rubrum -11.3 -23.6 Figure 6. Whole-organism isotopic discrimination ( 13CCO2 13Cbiomass) versus enzymatic isotopic discrimination (RubisCO values). The predicted biomass value for Rhodobacter sphaeroides assumes whole-cell fractionation similar to R. rubrum (see Discussion for details), and the predicted ra nge (whiskers on graph) assumes changes in whole-organism isotopic discrimination sim ilar to what has been observed in other organisms in response to changes in CO2 supply and/or demand. 22

PAGE 30

A biomass 13C value of -21.2‰ would place R. sphaeroides and other form IC autotrophs within the range of 13C values observed for other CBB autotrophs, but would allow them to be distinguished from or ganisms using alternative carbon fixation pathways. Their 13C values should be more negativ e than what is expected for organisms using the rTCA or 3-hydroxypropionate cycles for carbon fixation, but not the acetyl-CoA pathway (17; Figure 7). Figure 7. 13C values of atmospheric CO2 and biomass from autotrophic organisms using the 3-hydroxyproprionate pathway (3-HPP), th e reverse citric aci d cycle (rTCA), the acetyl-CoA pathway, and the C3-Calvin Benson Bassham cycle (C3-CBB). Future work with Form IC RubisCO will involve sampling the full phylogenetic breadth of Form IC RubisCOs to de termine whether all Form ICs have values that fall within the range obser ved for other RubisCO values. In order to sample the full phylogenetic spectrum of this group, values could be measured for RubisCOs from, for example, Burkholderia xenovorans LB400 and Roseovarius sp. HTCC 2601, as these two enzymes are present in IC clades distinct from the clade containing R. sphaeroides 23

PAGE 31

RubisCO (Figure 3). B. xenovorans LB400 is an aerobic soil microbe capable of degrading polychlorinated biphenyls (7). Burkholderia sp. have a great number of carbon metabolism genes that indicate the presence of different pathways for assimilating carbon, giving this strain an edge, ecologically (7). Roseovarius sp. HTCC 2601 is an aerobic, alphaproteobacterial is olate found in seawater collected from the Sargasso Sea, and is a member of the Roseobacter clade, which is important in the marine sulfur cycle (26, 51). This clade is res ponsible for degrading dimethyl sulfoniopropionate (DMSP) to methanethiol (51). It would also be of great interest to measure the value of RubisCO from the firmicute, Sulfobacillus acidophilus S. acidophilus is most peculiar because it is an outlier from the Form IC a nd ID clades (Figure 3). Sulfobacillus species oxidize mineral sulfides and prefer environments with a high concentration of CO2, and their use of this RubisCO substrate reveals much about the biogeochemical function of these acidophiles (3). Elucidating the degree of isotopic discrimination by form IC enzymes, broadly sampled, would make it possible to use stable carbon isotope analyses to learn more about the role form IC RubisCOs play in the environment and the global carbon cycle. 24

PAGE 32

Chapter Three Conclusion Rhodobacter sphaeroides IC RubisCO has an value of 22.9‰, which is within the range measured for other RubisCOs. Th is implies that some CBB autotrophs using form IC enzymes can be predicted to have 13C values similar to those previously measured in CBB autotrophs. Preliminary experiments have been conducted with form IC RubisCO from Ralstonia eutropha and this enzyme appears to have an value of 26.6‰ (see Appendix table A-1), though replicate experiments are necessary to verify this measurement. Experiments with Form ID RubisCO values have also recently been colle cted for form ID RubisCOs from the phytoplankton species, Skeletonema costatum and Emiliania huxleyi The ID RubisCOs have values that are lower than the value from R. sphaeroides RubisCO ( = 11.1‰ for E. huxleyi ; = 18.6‰ for S. costatum ; see appendix). The diatom, S. costatum and coccolithophore, E. huxleyi are a major part of the phytoplankton community and contribute substantially to primary pr oductivity in the oceans. The small values reveal that their ID RubisCOs are le ss isotopically selective for 13CO2 compared to other RubisCO enzymes. The values also provide a mechan ism for the levels of isotopic enrichment observed in these organisms, and marine organic carbon in general. 25

PAGE 33

It is apparent that IC/ID R ubisCOs have a broad range of values (11.1‰ to 22.9‰). Currently, it is impossible to predict values for RubisCO enzymes based on primary, secondary, tertiary, or quaternary stru cture. At this point, one must measure them, in the hope that at some poi nt it will be possible to correlate values with primary structure or other features of these enzymes. 26

PAGE 34

References 1. Bassham, J. A. 1971. Photosynthetic carbon metabolism. Proceedings of the National Academies of Sciences of the United States of America 68 (11):28772882. 2. Boller, A. J., Thomas, P. J., Cavanaugh, C. M., and Scott, K. M. in prep. A New Low for RubisCO. 3. Caldwell, P. E., MacLean, M. R., and Norris, P. R. 2007. Ribulose bisphosphate carboxylase activity and a Calvin cycle gene cluster in Sulfobacillus species. Microbiology 153 :2231-2240. 4. Campbell, B. J., Stein, J. L., and Cary, S. C. 2003. Evidence of chemolithoautotrophy in the bacter ial community associated with Alvinella pompejana a hydrothermal vent polychaete. Applied and Environmental Microbiology 69 (9):5070-5078. 5. Caspi, R., Haygood, M. G., and Tebo, B. M. 1996. Unusual ribuolose-1,5bisphosphate carboxylase/oxygenase genes from a marine manganese-oxidizing bacterium. Microbiology 142 :2549-2559. 6. Chanton, J. P. and Lewis, F. G. 1999. Plankton and disso lved inorganic carbon isotopic composition in a ri ver-dominated estuary: Ap alachicola Bay, Florida. Estuaries 22 (3A):575-583. 7. Denef, V. J., Park, J., Tsoi, T. V., Rouillard, J. -M., Zhang, H., Wibbenmeyer, J. A., Verstraete, W., Gulari E., Hashsham, S. A., and Tiedje, J. M. 2004. Biphenyl and Benzoate Metabolism in a Genomic Context: Outlining Genome-Wide Metabolic Networks in Burkholderia xenovorans LB400. Applied and Environmental Microbiology 70 (8):4961-4970. 8. Des Marais, D. J. 2001. Isotopic Evolution of the Biogeochemical Carbon Cycle During the Precambrian. In John W. Valle y and David R. Cole (eds.) Stable Isotope Geochemistry, Reviews in Microbiology and Geochemistry. Mineralogical Society of Am erica, Washington, D. C. 43 :555-578. 9. Dobrinski, K. P., Longo, D. L., and Scott, K. M. 2005. The carbonconcentrating mechanism of the hydr othermal vent chemolithoautotroph Thiomicrospira crunogena Journal of Bacteriology 187 (16):5761-5766. 10. Dubbs, J. M. and Tabita, F. R. 1998. Two functionally distinct regions upstream of the cbb1 operon of Rhodobacter sphaeroides regulate gene expression. Journal of Bacteriology 180 (18):4903-4911. 11. Fuchs, G. 1989. Alternative Pathways of Autotrophic CO2 Fixation. In H.G. Schlegel and B. Bowien (eds.) Autotrophic Bacteria Science & Technology Press pp.365-382. 27

PAGE 35

12. Gibson, J. L. and Tabita, F. R. 1977. Different molecular forms of D-ribulose1,5-bisphosphate carboxylase from Rhodopseudomonas sphaeroides Journal of Biological Chemistry 252 (3):943-949. 13. Goericke, R., Montoya, J. P., and Fry, B. 1994. Physiology of isotopic fractionation in algae and cyanobacteria. In Kate Lajtha and Robert H. Michener (eds.) Methods in Ecology: Stable Isotopes in Ecology and Environmental Science. Blackwell Scientific Cambridge, MA. pp.187-221. 14. Graber, J. R. and Breznak, J. A. 2004. Physiology and nutrition of Treponema primitia an H2/CO2-acetogenic spirochete from termite hindguts. Applied and Environmental Microbiology 70 (3):1307-1314. 15. Guy, R. D., Fogel, M. L., and Berry, J. A. 1993. Photosynthetic Fractionation of the Stable Isotopes of Oxyge n and Carbon. Plant Physiology 101 :37-47. 16. Hall, T. 2007. BioEdit version 7.0.9. Ibis Biosciences. Carlsbad, CA. Website: http://www.mbio.ncsu.edu/BioEdit/bioedit.html. 17. Hayes, J. M. 2001. Fractionation of the isot opes of carbon and hydrogen in biosynthetic processes. In John W. Va lley and David R. Cole (eds.) Stable Isotope Geochemistry, Reviews in Microbiology and Geochemistry. Mineralogical Society of Am erica, Washington, D. C. 43 :225-278. 18. Horken, K. M. and Tabita, F. R. 1999. Closely related form I ribulose bisphosphate carboxylase/oxygenase mol ecules that possess different CO2/O2 substrate specificities. Archives of Bioche mistry and Biophysics 361 (2):183-194. 19. Hgler, M., Menendez, C., Schgger, H., and Fuchs, G. 2002. MalonylCoenzyme A reductase from Chloroflexus aurantiacus a key enzyme of the 3hydroxproprionate cycle for autotrophic CO2 fixation. Journal of Bacteriology 184 (9):2404-2410. 20. Hgler, M., Wirsen, C.O., Fuchs, G., Taylor, C. D., and Sievert, S. M. 2005. "Evidence for autotrophic CO2 fixation via the reductiv e tricarboxylic acid cycle by members of the subdivision of proteobacteria." Journal of Bacteriology 187 (9):3020-3027. 21. Inoue, H. and Sugimura, Y. 1985. Carbon isotopic fractionation during the CO2 exchange process between air and se a water under equilibrium and kinetic conditions. Geochimica et Cosmochimica Acta 49 :2453-2460. 22. Kaplan, A. and Reinhold, L. 1999. CO2 concentrating mechanisms in photosynthetic microorganisms. Annual Review of Plant Physiology and Plant Molecular Biology 50 :539-570. 23. Kroopnick, P. M. 1985. The distribution of 13C of CO2 in the world oceans. Deep-Sea Research 32 (1):57-84. 24. Kumar, S., Tamura, K., and Nei, M. 2004. Mega 3: Integrated Software for Molecular Evolutionary Genetic An alysis and Sequence Alignment. Briefings in Bioinformatics 5 :150-163. 25. Lee, B. and Tabita, F. R. 1990. Purification of recombinant ribulose-1,5bisphosphate carboxylase/oxygenase large s ubunits suitable for reconstitution and assembly of active L8S8 enzyme. Biochemistry 29 :9352-9357. 28

PAGE 36

26. Lee, K., Choo, Y. -J., Giovannoni, S. J., and Cho, J. -C. 2007. Maritimibacter alkaliphilus gen. nov., sp. nov., a genome-sequen ced marine bacterium of the Roseobacter clade in the order Rhodobacterales International Journal of Systematic and Evol utionary Microbiology 57 :1653-1658. 27. Madigan, M. T., Takigiku, R., Lee, R. G., Gest, H., and Hayes, J. M. 1989. Carbon isotope fractionation by thermoph ilic phototrophic sulfur bacteria: evidence for autotrophic growth in natural populations. Applied and Environmental Microbiology 55 (3):639-644. 28. McCollom, T. M. and Amend, J. P. 2005. A thermodynamic assessment of energy requirements for biomass synt hesis by chemolithoautotrophic microorganisms in oxic and anoxic environments. Geobiology 3 :135-144. 29. Meckenstock, R. U., Morasch, B., Griebler, C., and Richnow, H. H. 2004. Stable isotope fractionation analysis as a tool to monitor biodegradation in contaminated acquifers. Journal of Cont aminant Hydrology 75 :215-255. 30. Mook, W. G., Bommerson, J. C., and Staverman, W. H. 1974. Carbon isotope fractionation between dissolved bicar bonate and gaseous carbon dioxide. Earth and Planetary Science Letters 22 :169-176. 31. Pardue, J. W., Scalan, R. S., Van Baalen, C., and Parker, P. L. 1976. Maximum carbon isotope fractionation in photosynthesis by blue-green algae and a green alga. Geochimica et Cosmochimica Acta 40 :309-312. 32. Paul, J. H., Alfreider, A., and Wawrik, B. 2000. Microand macrodiversity in rbcL sequences in ambient phytoplankton populat ions from the southeastern Gulf of Mexico. Marine Ecology Progress Series 198 :9-18. 33. Peterson, B. J. and Fry, B. 1987. Stable Isotopes in Ecosystem Studies. Annual Review of Ecology and Systematics 18 :293-320. 34. Pichard, S. L., Campbell, L., and Paul, J. H. 1997. Diversity of the ribulose bisphosphate carboxylase/oxygenase form I gene ( rbcL ) in natural phytoplankton communities. Applied and Environmental Microbiology 63 (9):3600-3606. 35. Qian, Y. and Tabita, F. R. 1996. A global signal transduc tion system regulates aerobic and anaerobic CO2 fixation in Rhodobacter sphaeroides Journal of Bacteriology 178 (1):12-18. 36. Robinson, J. J., Scott, K. M., Swanson, S. T., O'Leary, M. H., Horken, K., Tabita, F. R., and Cavanaugh, C. M. 2003. Kinetic isotope effect and characterization of form II RubisCO fr om the chemoautotrophic endosymbionts of the hydrothermal vent tubeworm Riftia pachyptila Limnology and Oceanography 48 (1):48-54. 37. Roeske, C. A. and O'Leary, M. H. 1984. Carbon isotope effects on the enzymecatalyzed carboxylation of ribulose bisphosphate. Biochemistry 23 :6275-6284. 38. Roeske, C. A. and O'Leary, M. H. 1985. Carbon isotope effect on carboxylation of ribulose bisphosphate catalyzed by ribulosebisphosphate carboxylase from Rhodospirillum rubrum Biochemistry 24 :1603-1607. 39. Ruby, E. G., Jannasch, H. W., and Deuser, W. G. 1987. Fractionation of stable carbon isotopes during chemoautotrophic gr owth of sulfur-oxidizing bacteria. Applied and Environmental Microbiology 53 (8):1940-1943. 29

PAGE 37

40. Russell, M. J. and Martin, W. 2004. The rocky roots of the acetyl-CoA pathway. Trends in Biochemical Sciences 29 (7):358-363. 41. Saurer, M., Siegwolf, R., Borella, S., and Schweingruber, F. 1998. Environmental information from st able isotopes in tree rings of Fagus sylvatica In Beniston, M. and Innes, J. L. (eds ). The Impacts of Climate Variability on Forests. Germany, Springer Press Berlin. pp.241–254. 42. Schidlowski, M., Hayes, J. M., and Kaplan, I. R. 1983. Isotopic inferences of ancient biogeochemistries: carbon, sulfur, hydrogen, and nitrogen. In Schopf, J. W. (ed). Earth’s Earliest Biosphere: Its Origin and Evolution: Princeton, New Jersey, Princeton University Press. pp.149–186. 43. Scott, K. M. 2003. A 13C-based carbon flux model fo r the hydrothermal vent chemoautotrophic symbiosis Riftia pachyptila predicts sizeable CO2 gradients at the host-symbiont interface. Environmental Microbiology 5 (5):424-432. 44. Scott, K. M., Schwedock, J., Schrag, D. P., and Cavanaugh, C. M. 2004a. Influence of form IA RubisCO and e nvironmental dissolved inorganic carbon on the 13C of the clam-chemoautotroph symbiosis Solemya velum Environmental Microbiology 6 (12):1210-1219. 45. Scott, K. M., Lu, X., Cavanaugh, C. M., and Liu, J. 2004b. Optimal methods for estimating kinetic isotope effects from different forms of the Rayleigh distillation equation. Geochimica et Cosmochimica Acta 68 (3):433-442. 46. Scott, K. M., Henn-Sax, M., Harmer, T. L., Longo, D. L., Frame, C. H., and Cavanaugh, C. M. 2007. Kinetic isotope effect and biochemical characterization of form IA RubisCO from the marine cyanobacterium Procholorococcus marinus MIT 9313. The American Society of Limnology and Oceanography 52 (5):21992204. 47. Tabita, F. R. 1988. Molecular and cellular re gulation of autotrophic carbon dioxide fixation in microorganisms. Microbiological Reviews 52 (2):155-189. 48. Tabita, F. R. 1999. Microbial ribulose 1,5-bisp hosphate carboxylase/oxygenase: A different perspective. Photosynthesis Research 60 :1-28. 49. Tabita, F. R., Satagopan, S., Hanson, T. E., Kreel, N. E., and Scott, S. S. 2008. Distinct form I, II, III, and IV Rubisc o proteins from the three kingdoms of life provide clues about Rubisco evoluti on and structure/func tion relationships. Journal of Experimental Botany 59 (7):1515-1524. 50. Thauer, R. K. 2007. A fifth pathway of carbon fixation. Science 318 :1732-1733. 51. Tripp, H. J., Kitner, J. B., Schwalbach, M. S., Dacey, J. W. H., Wilhelm, L. J., and Giovannoni, S. J. 2008. SAR11 marine bacter ia require exogenous reduced sulphur for growth. Nature 452 :741-744. 52. van der Meer, M. T. J., Schouten, S., van Dongen, B. E., Rijpstra, W. I. C., Fuchs, G., Damst, J. S. S., de Leeuw, J. W., and Ward, D. M. 2001. Biosynthetic controls on the 13C contents of organic components in the photoautotrophic bacterium Chloroflexus aurantiacus The Journal of Biological Chemistry 276 (14):10971-10976. 30

PAGE 38

Appendices 31

PAGE 39

Appendix A: Table of RubisCO values from Ralstonia eutropha Table A-1. RubisCO values determined from two inde pendent experiments with the IC enzyme from R. eutropha 32 Experiment # value (‰) # of Timepoints 1 27.1 7 2 26.2 8 Average value = 26.6 ‰

PAGE 40

Appendix B: Manuscript on Form ID RubisCO value from Emiliania huxleyi A New Low for RubisCO (To be submitted to Science) Amanda J. Boller1, Phaedra J. Thomas1, Colleen M. Cavanaugh2, and Kathleen M. Scott1* 1Biology Department, University of South Florida, Tampa, Florida 33620, USA. 2Department of Organismic and Evolutiona ry Biology, Harvard University, Cambridge Massachussetts 02138, USA. *To whom correspondence should be addressed. E-mail: kscott@cas.usf.edu One-sentence summary The first high-precision measurement of stable carbon isotopic discrimination by form ID RubisCO, responsible for a substa ntial portion of marine carbon fixation, is reported here and indicates that this enzyme has a shockingly small fractionation factor, providing a mechanistic explanation for 13C-enrichment in ma rine organic carbon. 33

PAGE 41

Appendix B (Continued) ABSTRACT The 13C content of carbon is used to iden tify sources and sinks in the global carbon cycle. One enduring mystery is why the 13C content of marine organic carbon is relatively high. We tested the hypot hesis that marine organic carbon 13C enrichment is due to reduced isotopic discrimination dur ing carbon fixation by form ID RubisCOs (ribulose 1,5-bisphosphate carboxylase/oxygena se), found in a subs tantial portion of marine algae responsible for oceanic carbon fixation. Here, form ID RubisCO from coccolithophore Emiliania huxleyi discriminated substantially less against 13CO2 than other RubisCO enzymes ( =11.1‰). Reduced discrimination by form ID RubisCO may be a major factor dictating the high 13C content of marine organic carbon, necessitating re-evaluation of how biological 13C values are integrated into global primary productivity models. 34

PAGE 42

Appendix B (Continued) Stable carbon isotope analyses are criti cal to the identification and modeling of global carbon cycle sources and sinks. On e key sink is marine carbon fixation (1), and phytoplankton 13C values ( 13C = [(Rsample/Rstd)-1] x1000, where R=13C/12C) have been used to untangle trophic links and to estimate in situ growth rates (2). However, phytoplankton 13C values vary widely (-16 to -36‰; (2), and the factors responsible for this variation, as well as their relatively 13C-enriched 13C values compared to terrestrial C3 plants (3), are poorly understood. Given the substantial role that phytoplankton play in the global carbon cycle, this conceptual ga p compromises not only th e interpretation of phytoplankton 13C values, but also introduces uncer tainty into carbon cycle modeling (4). While some variation in phytoplankton 13C values is clearly due to carbon concentrating mechanisms, C4 pathways, a nd diffusive limitation (5 ), the effect of isotopic discrimination by different form s of RubisCO (ribulose 1,5-bisphosphate carboxylase/oxygenase), the CO2 fixing enzyme of the Calvin-Benson-Bassham cycle, has not been widely considered. Instead, 13C analyses of oceanic primary productivity typically assume that isotopic discrimina tion by phytoplankton RubisCO is similar in extent to that of spinach RubisCO (e.g., (610). This assumption is untenable, however, as prior studies have shown that different fo rms of RubisCO discriminate to a greater or lesser extent against 13C (4, 11-16). There are three know n forms of RubisCO (I, II, and III), which share as little as 25% in ami no acid sequence identity, vary widely in KCO2 35

PAGE 43

Appendix B (Continued) and Vmax values, and display dramatic differences in tertiary and quate rnary structure (17, 18). Form I enzymes are further subdivided into four subforms (IA – ID), whose amino acid sequences can differ by as much as 40% (17, 18). Marine algae fix carbon using at least four different RubisC O forms: IA in marine Synechococcus and Prochlorococcus spp., IB in algae with green plastids (and te rrestrial plants), ID in ‘non-green’ algae (coccolithophores, diatoms, rhodophytes, and so me dinoflagellates), and II in peridinincontaining dinoflage llates (19). Isotopic discrimination, expressed as values ( = (RCO2/Rfixed – 1) x 1000), have been measured for only three forms of R ubisCO using high-precisi on methods (Table B1). While values vary consider ably, RubisCO forms IA and B ( = 22 29‰) discriminate to a greater extent than form II ( = 18 – 22‰) (4, 11-16). Given the prevalence of form ID RubisCO in dominant marine primary producers, many of which are used as model organisms for study in cult ure, determination of isotope discrimination by this enzyme is critical for the inte rpretation of environmental and culture 13C values, and in turn for global modeling efforts, paleo-oceanography, and other studies using 13C values. Here, we characterized and determined the value of form ID RubisCO from a model marine alga, the coccolithophore Emiliania huxleyi CCMP 374. Coccolithophores, whose massive blooms in the North Atlantic and Pacific oceans are visible from space (20, 21), fix CO2 via form ID RubisCO (22) and play a major role as primary producers and in jetti soning carbon to the ocean floor (23). The 36

PAGE 44

Appendix B (Continued) minute calcium carbonate plates (coccoliths) that cover coccolithophore cells enhance inorganic and organic carbon export from surf ace waters by ballasting fecal pellets into which they are packed (24, 25). In culture, the biomass 13C values of Emiliania huxleyi vary widely, from -9.71 to -38.6‰ (6, 7, 10, 26, 27) While some of this heterogeneity is likely due to variation in study st rains and growth conditions, these 13C values cannot be rigorously interpreted without a RubisCO value. Table B-1. values of different RubisCO forms, = RCO2/Rfixed – 1) x 1000 Form Organisms value (‰)* Reference IA Marine cyanobacteria and gammaproteobacteria 24 – 22.4 (4, 16) IB Terrestrial plants and freshwater cyanobacteria 21 – 30.3 (11, 13, 15) ID Marine coccolithophore Emiliana huxleyi 11.1 This study II Alphaand gammaproteobacteria 17.8 – 23.0 (12-15) RubisCO KCO2 and values In order to obtain sufficient Emiliana huxleyi Form ID RubisCO for determination of kinetic parameters and is otope fractionation (~20 mg per value experiment), 100 L of E. huxleyi CCMP 374 cultures were harvested and RubisCO was partia lly purified from sonicated cells via NH4SO4 precipitation (28). Carboxylase activity was verified to be 37

PAGE 45

Appendix B (Continued) due exclusively to RubisCO based on incuba tions in the presence and absence of the substrate ribulose 1,5-bisphosphate (RuBP; (28). To characterize E. huxleyi RubisCO activity, its Michaelis-Menten constants (KCO2 and Vmax) were measured radiometrically as in (29). The value of E. huxleyi RubisCO was measured by the high-precision substrate depletion method, in which the concentration and isotopic composition of dissolved inorganic carbon are measured as they are consumed by RubisCO (4, 16, 28). The value was calculated using a modified ve rsion of the Rayleigh distillation equation and Pitman estimators to calculate th e least-biased average (28, 30). E. huxleyi RubisCO Michaelis-Menten constants ( KCO2 = 111 +/40 M; Vmax = 146 +/102 nmol/minmg, calculated from five independent experiments) were quite different than those measured for other fo rm ID enzymes from diatoms and rhodophytes (KCO2 = 5 – 60 M; Vmax = 670 – 1670 nmol/minmg; (31, 32). The larger KCO2 value for the Emiliania huxleyi RubisCO may necessitate a car bon concentrating mechanism with active transport of dissolved inorganic carbon into the cells, since the concentration of CO2 in seawater is only ~20 M (33). The lower Vmax value reflects the labile nature of this enzyme. E. huxleyi form ID RubisCO had an astonishingly low value of 11.1‰ (95% CI: 9.8 12.6‰; Figure B-1), substantially smaller than any other RubisCO measured to date (Table B-1). values from replicate experiment s were very consistent, falling within a 3.1‰ range (Figure B-1). Spinach fo rm IB RubisCO, used as a control and 38

PAGE 46

Appendix B (Continued) incubated under identical condi tions to those used for the E. huxleyi enzyme, had an value of 27.5‰ (95% CI: 24.0 – 30.9‰; Figure B-1), similar to previously reported values (4, 11, 13). This is the first high-precision value to be measured for any eukaryotic algae of ecosystem-level importance; the peculiarity of its value highlights how little we know about the RubisCO enzymes responsible for marine primary productivity. Figure B-1. Isotope fractionation by E. huxleyi RubisCO. R is the isotope ratio (13C/12C) of dissolved inorganic carbon (DIC) and [DIC] is its con centration. Solid symbols ( , and ) correspond to independent incubations of E. huxleyi RubisCO, with = 10.8‰, 11.1‰, 11.8‰, and 13.9‰, respectively. Open symbols ( , and ) correspond to independent incubations of spinach RubisCO, with = 28.3‰, 28.2‰, and 27.2‰, respectively. 39

PAGE 47

Appendix B (Continued) Implications for interpreting 13C values from environmental samples and phytoplankton cultures This remarkably small RubisCO value (11.1‰) suggests a novel explanation for the isotopically enriched 13C values typically observed for marine phytoplankton and the food webs they support. An enzymatic basis for these values must now be considered. Indeed, phytoplankton collected from environmental samples demonstrate whole-cell isotope discrimination values ( p, = [RCO2/Rbiomass – 1] 1000) that span this RubisCO value. Samples collected from marine environments worldwide have values of p ranging from 7 to 19‰ (7, 34, 35). For environmental samples dominated by E. huxleyi reported p values are 0-14‰ (calculated dire ctly from biomass; (36) and 7-19‰ (calculated from E. huxleyi alkanones, assuming a constant fractionation between alkanones and biomass; (7). Using th e (incorrect) assumption of a RubisCO value of 29‰, these p values suggest the isotope-enric hing effects of carbon concentrating mechanisms or C4 pathways. However, given the small RubisCO value measured here, it is not necessary to invoke these mechanisms to explain 13C-enriched biomass. Similar to ocean samples, p values from E. huxleyi culture studies are small and reasonably consistent with the measured RubisCO value. In many of these studies, the 13C of dissolved inorganic carbon ( 13CDIC), and not the 13CCO2, is reported. Therefore, to calculate p from these culture studies, the equilibrium isotope effect between dissolved CO2 and HCO3 (= bc, = 1000 [{RCO2/RHCO3-}1]; = -10‰ at 15C; (37) was 40

PAGE 48

Appendix B (Continued) used to calculate the 13CCO2 from 13CDIC. Based on these studies, p ranges from 218‰ for Emiliania huxleyi (6, 10, 38, 39). One potential fa ctor that could be influencing the p value is the form of inorganic carbon tr ansported, since there is an equilibrium isotope effect between HCO3 and CO2, which causes CO2 to be isotopically depleted relative to HCO3 (37). It is clear that E. huxleyi alters its pattern of inorganic carbon uptake in response to growth c onditions (40). Perhaps smaller p values are the result of reliance on extracellular HCO3 -, while larger p values may result from CO2 utilization. Deciphering the form(s) of dissolved inorga nic carbon taken up by this organism under different growth conditions is instrumental in developing a mechanistic understanding for the changes in dissolved inorganic car bon abundance and composition that accompany E. huxleyi blooms, which in turn determine whether these blooms are sources or sinks of atmospheric and dissolved CO2. The unexpectedly low value of E. huxleyi RubisCO highlights the necessity of collecting RubisCO values from other organisms, in order to uncover any phylogenetic patterns in isotope discrimination. At this point, given the sma ll numbers of enzymes examined (2 form IA’s; 2 form IB’s; 1 form ID; 2 form II’s) it is ir responsible to suggest ‘typical’ values for different forms of RubisCO, or even for RubisCO enzymes in general. Particularly with respect to the interpretation of marine 13C values, and to refine models of the global carbon cycle that rely on these 13C values, it is necessary to determine whether form ID RubisCO enzyme s from other algae of ecosystem-level 41

PAGE 49

Appendix B (Continued) importance (e.g., diatoms, rhodophytes) have low values. Factors such as carbon concentrating mechanisms, inorganic carbon supply and demand, and C4 pathways clearly exert an influence on the 13C values of algal biomass (38, 41-43), but more measurements of RubisCO values are critical to discern their significance. 42

PAGE 50

Appendix B (Continued) References 1. W. H. Schlesinger. 1997. in Biogeochemistry: An analysis of global change W. H. Schlesinger, Ed. (Academi c Press, San Diego) pp. 291-341. 2. K. H. Freeman. 2001. in Stable Isotope Geochemistry J. W. Valley, D. R. Cole, Eds. (Mineralogical Society of America, Washington, DC) pp. 579-605. 3. R. H. Michener, D.M. Schell. 1994. in Stable isotopes in ecology and environmental science K. Lajtha, R.H. Michener, Ed. (Blackwell Scientific Publications, Cambridge, MA) pp. 138-157. 4. K. M. Scott, J. Schwedock, D. P. Schrag, C. M. Cavanaugh. 2004. Environ Microbiol 6 :1210. 5. R. Goericke, J. P. Montoya, B. Fry. 1994. in Stable Isotopes in Ecology and Environmental Science K. Lajtha, R. H. Michener, Eds. (Blackwell Scientific Publications, Boston) pp. 187-221. 6. P. A. Thompson, S. E. Calvert. 1995. Limnol Oceanogr 40 :673. 7. R. R. Bidigare et al. 1997. Global biogeochemical cycles 11 :279. 8. E. A. Laws, P. A. Thompson, B. N. Popp, R. R. Bidigare. 1998. Limnology and oceanography 43 :136. 9. E. A. Laws, B. N. Popp, N. Cassar, J. Tanimoto. 2002. Functional Plant Biology 29 :323. 10. B. Rost, I. Zondervan, U. Riebesell. 2002. Limnol Oceanogr 47: 120. 11. C. A. Roeske, M. H. O'Leary. 1984. Biochemistry 23 :6275. 12. C. A. Roeske, M. H. O'Leary. 1985. Biochemistry 24: 1603. 13. R. D. Guy, M. L. Fogel, J. A. Berry. 1993. Plant Physiol 101: 37. 14. J. J. Robinson et al. 2003. Limnol Oceanogr 48: 48. 15. D. B. McNevin, M. R. Badger, H. J. Kane, G. D. Farquhar. 2006. Funct. Plant Biol 33 : 1115. 16. K. M. Scott, M. Henn-Sax, D. Longo, C. M. Cavanaugh. 2007. Limnol Oceanogr 52 :2199. 17. G. M. Watson, F. R. Tabita. 1997. FEMS Microbiol Lett 146: 13. 18. F. R. Tabita et al. 2007. Microbiol and Molec Biol Rev 71: 576. 19. F. R. Tabita. 1999. Photosynth Res 60 :1. 20. Y. Dandonneau, Y. Montel, J. Blanchot, J. Giraudeau, J. Neveux. 2006. Deep-Sea Res. I 53 :689. 21. H. Siegel, T. Ohde, M. Gerth, G. Lavik, T. Leipe. 2007. Continental Shelf Res. 27: 258. 22. M. V. S. Puerta, T. R. Bachvaroff, C. F. Delwiche. 2005. DNA Research 12 :151. 23. E. Paasche. 2002. Phycologia 40 :503. 24. S. Honjo. 1976. Mar. Micropaleontol. 1: 65. 25. P. Ziveri, B. deBernardi, K. Bauma nn, H. M. Stoll, P. G. Mortyn. 2007. Deep Sea Res. II 54: 659. 43

PAGE 51

Appendix B (Continued) 26. A. M. Johnston. 1996. Mar. Ecol. Progr. Ser. 132: 257. 27. U. Reibesell, A. T. Revill, D. G. Holdsworth, J. K. Volkman. 2000, Geochim Cosmochim Acta 64 :4179. 28. Materials and methods are availa ble as supporting material on Science Online. 29. J. Schwedock et al. 2004. Arch Microbiol 182: 18. 30. K. M. Scott, X. Lu, C. M. Cavanaugh, J. Liu. 2004. Geochim Cosmochim Acta 68 :433. 31. B. A. Read, F. R. Tabita. 1992. Biochemistry 31 :519. 32. K. Horken, F. R. Tabita. 1999. Archives of Biochemistry and Biophysics 361: 183. 33. R. E. Zeebe, D. Wolf-Gladrow. 2003. CO2 in seawater: Equilibrium, kinetics, isotopes D. Halpern, Ed., Elsevier Oceanogr aphy Series (Elsevier, New York) pp. 346. 34. I. Bentaleb et al. 1998. Journal of Marine Systems 17: 39. 35. H. Kukert, U. Riebesell. 1998. Mar Ecol Prog Ser 173: 127. 36. A. Benthien et al. 2007. Geochimica et cosmochimica acta 71 :1528. 37. W. G. Mook, J. C. Bommerson, W. H. Staverman. 1974. Earth Plan Sci Let 22 :169. 38. K. R. Hinga, M. A. Arthur, M. E. Q. Pilson, D. Whitaker. 1994. Global biogeochemical cycles 8 :91. 39. U. Riebesell, A. T. Revill, D. G. Holdsworth, J. K. Volkman. 2000. Geochim Cosmochim Acta 24 :4179. 40. B. Rost, U. Riebesell, D. Sultemeyer. 2006. Limnol Oceanogr 51: 12. 41. E. A. Laws, R. R. Bidigare, B. N. Popp. 1997. Limnol Oceanogr 42: 1552. 42. A. S. Fielding et al. 1998. Can J Bot 76 :1098. 43. J. R. Reinfelder, A. M. L. Kraepiel, F. M. M. Morel. 2000. Nature 407 :996. 44

PAGE 52

Appendix C: Manuscript on Form ID RubisCO value from Skeletonema costatum Isotopically less selective RubisCO from the diatom Skeletonema costatum A.J. Boller1, P.J. Thomas1, C.M. Cavanaugh2, and K.M. Scott1 1University of South Florida, Tampa, Florida 33620; 2Harvard University, Cambridge, Massachusetts 02138 Acknowledgments Funding for this project was received from NSF Biologi cal Oceanography OCE0327488 (to K.M.S). Special thanks are give n to undergraduate researchers Kelly Fitzpatrick and Michelle Echeva rria who contributed to grow ing cell cultures as well as data collection. Thanks are also given to Sidney K. Pierce and his experimental writing class for editorial assistance. 45

PAGE 53

Appendix C (Continued) ABSTRACT Form ID ribulose-1,5-bisphosphate car boxylase/oxygenase (RubisCO) is present in several major oceanic primary producers that grow in large blooms. These large blooms may be one of the causes of 13C enriched marine carbon because these organisms use an isotopically less selective form of RubisCO for carbon fixation. The purpose of this study is to determine the isotopic discrimination and KCO2 of Skeletonema costatum RubisCO, and to compare its large subunit gene ( rbcL ) with form ID rbcL genes from other organisms. We found th e isotopic discrimination of S. costatum RubisCO is 18.5‰ and its KCO2 is 90 (+/20) M. Comparatively, this form ID RubisCO is isotopically less selective than forms IA and IB RubisCOs (22-29‰), which are also present in some oceanic primary producers. However, the ID RubisCO from the coccolithophore, Emiliana huxleyi (11.1‰) is the most non-selec tive RubisCO measured. Since ID RubisCOs are less selective against 13C, the isotopic discrimination by form ID RubisCO must be considered when making carbon cycl e models or biological food chain models using 13C values. Consequently, current carbon m odels could miscalculate global carbon fixation. 46

PAGE 54

Appendix C (Continued) Diatoms are major primary producers in the ocean and contribute at least a quarter of inorganic carbon fixed each year (10). Most diatoms live in pelagic marine and freshwater ecosystems, but can also be found at the water-sediment interface. In areas of nutrient upwelling, large blooms of diat oms quickly dominate the phytoplankton communities (18) because they contain high proportions of growth machinery that allows for exponential growth (1). Because of their larger cell size and abundance, diatoms form the base of bloom associated food webs. Skeletonema costatum is a common, global member of the plankton community in temper ate areas, and therefor e, is a good candidate for further investigation into diatom carbon fixation kinetics. At least five forms of ribulos e-1,5-bisphosphate carboxylase/oxygenase (RubisCO) catalyze carbon fixation in the mari ne organisms. Form IB RubisCO is the most extensively studied because it is present in eukaryotic green chloroplasts from algae to land plants. Other forms of RubisCO, preval ent in marine organisms, include form ID RubisCO, which is present in eukaryotic or ganisms with non-green chloroplasts, such as coccolithophores, rhodophytes, and diatoms ( 31), and form IA, IC, and II RubisCO, which are present in diverse marine prokar yotes (4, 21, 30). Different forms of RubisCO are found in diverse intrace llular environments, and hence have evolved varying structural and kinetic properti es to fit their individual c onditions (29). However, most carbon cycle models are based on properties a ssociated with IB RubisCO, even though other forms of RubisCO are ma jor contributors to carbon fi xation, particularly in the marine environment. 47

PAGE 55

Appendix C (Continued) Stable carbon isotope compositions ( 13C values) of phytoplankton biomass have been used to infer the physical and physio logical factors influencing carbon fixation in the ocean (15). 13C values are determined by measuring amounts of 13C and 12C in biomass and comparing the ratio to a limest one standard (19). The main influence of 13C values measured in phytoplankton biomass is the selectivity of 13C by the RubisCO. However, physical factors, such as disso lved inorganic carbon (DIC) pool composition and nutrient availability, as well as physiological factors, such as growth rate and type of carbon concentrating mechanism (CCM) utilized, can also influence the 13C value of marine phytoplankton (15). However, the effects of differe nt factors on the 13C biomass values are difficult to interpret without the initial baseline isotopic selectivity from RubisCO. The isotopic selectivity of very few RubisCOs have been measured to date; therefore, other forms of RubisCO need to be examined to be able to correctly identify factors which play a role in biomass composition. Most biological models assume Ru bisCOs isotopic discrimination ( value; = RCO2/Rfixed – 1) x 1000)) is ~25‰ (12). This m odel value is reasonable when using values from terrestrial plan ts, cyanobacteria, and bacteria l chemolithoautotrophs, with values ranging from 18-29‰ (14, 21, 22, 23, 26). However, the very isotopically nonselective ID RubisCO fr om the coccolithophore, Emiliana huxleyi differs greatly from the model value ( = 11.8‰) (2). 48

PAGE 56

Appendix C (Continued) If all ID RubisCO are is otopically non-sele ctive, carbon models based on an isotopic discrimination of 25‰ will underestimate the amount of 13C cycled, therefore miscalculating total carbon fixa tion. Therefore, to determine if form ID RubisCOs have similar carbon fixation kinetic parameters, th e kinetic isotopic effect (KIE) and the KCO2 of S. costatum RubisCO was measured. Skeletonema costatum RubisCO large subunit gene ( rbc L) was also sequenced and compared to other ID RubisCOs from various organisms. Methods Cell Culture Methods Skeletonema costatum cultures were purchased from the Provasoli-Guillard National Center for Culture of Marine Phytoplankton (CCMP1332; West Boothbay Harbor, Maine). The cells were grown in f/2 medium with silica (13) at 18-22C, under constant illumination. One L of f/2 media was inoculated with 5 mL of cell culture. After one week of growth, the 1 L culture was added to 4 L of fresh media for another week of growth with aeration. RubisCO purification from S. costatum RubisCO was extracted and partially purif ied from frozen cell cultures using ammonium sulfate preci pitation. For all purification steps, samples were kept at 4C. Cells were harvested from the 5L cultures by centrifugation (5000g, 15min), flash-frozen in liquid nitrogen, and stored at -80C. Ce ll pellets were resuspended in lysis buffer [20mmol L-1 Tris pH 7.5, 10mmol L-1 MgCl2, 5mmol L-1 NaHCO3, 1mmol L-1 EDTA, 49

PAGE 57

Appendix C (Continued) and 1mmol L-1 dithiothreitol (DTT)] per gram of pe llet, sonicated twice for 30 sec with glass beads, and centrifuged (5000g, 15 min). (NH4)2SO4 was added to the supernatant to a final concentration of 30% saturation, and pr oteins were allowed to precipitate for 15 min. After centrifugation (5000g, 15 min), the pellet was disc arded and the supernatant was brought to 50% (NH4)2SO4 saturation. Proteins that precipitated at 30-50% (NH4)2SO4 saturation were collec ted by centrifugation and dissolved in BBMD buffer (50mmol L-1 Bicine pH7.5, 25mmol L-1 MgCl2, 5mmol L-1 NaHCO3, and 1mmol L-1 DTT). The partially purified proteins were desalted with an anion exchange column (HiPrep 26/10 desalting column; Amersham Bi osciences, New Jersey, USA) equilibrated and eluted with BBMD buffer. The elutant wa s monitored at 280nm and peaks that had an absorbance of 0.5 or higher were collected (<15ml). RubisCO activity assays RubisCO activity in partially purified protein extracts was monitored by the incorporation of 14CO2 into 3-phosphoglycerate (PGA). Pu rified RubisCO extracts were added to the assay buffer [50 mmol L-1 Bicine, pH 8.0, 10 mmol L-1 MgCl2, 1 mmol L-1 EDTA, 5mmol L-1 DTT, and 25 mmol L-1 NaH14CO3 55 mCi/mmol bicarbonate (MP Biomedicals, Irvine CA)] in a 1:2 ratio a nd pre-incubated for 15 min. Reactions were started by the addition of 1 mmol L-1 RuBP (Sigma R0878, USA). At 330 sec intervals, one third of the sample was removed from th e reaction mix and added to acetic acid to stop the reaction. After the samples were dried by sparging with air, scintillation cocktail (Fisher Scientific, USA) was added to the samp les. Assays lacking RuBP were performed 50

PAGE 58

Appendix C (Continued) as a control for background CO2 fixation. RubisCO isotope discrimination by kinetic isotope effect (KIE) Using the partially purified protein from S. costatum the kinetic isotope effect (KIE) of RubisCO was measured at pH 7.5 us ing the high-precision substrate depletion method (7, 26). Previous KIE were perfor med at pH 8.5 (14, 22), however, the optimal pH for partially purified S. costatum RubisCO is pH 7.5. To test the effects of the altered parameter on KIE’s, control experiments us ing spinach RubisCO were also conducted. The reaction was prepared by sparging BBMD buffer with N2 to minimize CO2 and O2 concentration, and 1mg/25mL of bovi ne erythrocyte carbonic anhydrase (CA; Sigma 3934, USA) was added to maintain DIC at chemical and isotopic equilibrium. Approximately 5mL of partially purified R ubisCO was added to the BBMD buffer, filter sterilized (0.45m), and loaded into a heat-s terilized, septum-sealed 25 mL glass gastight syringe with a stir bar. Ribulose 1,5-bis phosphate (RuBP), substrate for RubisCO, was enzymatically synthesized from ribose 5phosphate using spinach phosphoriboisomerase (PRI; Sigma P9752-5KU) and purified phosphor ibulokinase (PRK)(26). After allowing the RubisCO to pre-incubate for 15 min at 25C, filter-sterilized (0.22 m) RuBP (~100 mmoles) was injected into the gastig ht syringe to begin the reaction. The concentration and 13C value were measured as the CO2 was consumed by the RubisCO reaction. Samples were removed at 8 time intervals from the reaction syringe based on the decrease of the DIC con centration. Triplicate samples were acidified in a gas tight syringe with 43% phosphoric acid (1:4 ratio) to termin ate the reaction and 51

PAGE 59

Appendix C (Continued) convert the DIC to CO2. The [DIC] of the triplicate sa mples was measured using a gas chromatograph (HP/Agilent 5890A, USA) (7). The remaining sample was injected into gas-tight syringes with 43% phosphoric acid (1:1 ratio). Using a vacuum line, the CO2 was cryodistilled from the sample and sent to Boston University Stable Carbon Isotope Laboratory (Robert Michen er) to determine their 13C values using a gas inlet mass spectrometer (7). Five independent KIE’s were pe rformed using partially purified S. costatum RubisCO and three independent reactions were completed usi ng spinach RubisCO (10mg; Sigma R8000), for a pos itive control. The average values for the KIE’s were calculated using the Pitman estimator with a 95% confidence interval (25). To ensure alternate carboxylases were not fixing CO2, KIE experiments with S. costatum RubisCO were also run without RuBP and without RuBP + 5 mmol L-1 3-PGA for negative controls (Sigma P8877, USA). KCO2 measurements The KCO2 and Vmax of S. costatum RubisCO were measured radiometrically (17, 24). The assay buffer (50 mM Bicine, pH 7.5, 30 mM MgCl2, 0.4 mM RuBP, 1 mM DTT) was prepared with low CO2 and O2 concentrations as in Schwedock et al., (2004). Eight different incubations were conducted w ith DIC ranging from 0.2 to 14 mM in glass vials primed with stir bars and sealed under a N2 headspace with gas-tight septa. Before the reaction was started, 25 mmol NaH14CO3 (SA = 55 mCi/mmol bicarbonate) along with bovine erythrocyt e carbonic anhydrase (40 g/mL; Sigma C3934), to maintain CO2 52

PAGE 60

Appendix C (Continued) and HCO3 in chemical equilibrium, was added to each vial. Partially purified S. costatum RubisCO in BBMD buffer that lacked RuBP was added to assay buffer, immediately before the reaction was started. To begin a re action, RuBP was injected into a vial, and samples were removed with a gastight sy ringe at 1 min intervals over a 4 min time course. These samples were immediately inje cted into scintillation vials containing glacial acetic acid to remove all 14CO2 and collect acid stable 14C. The samples were sparged with air and left for approximately 6 hours to ensure samples were completely dry before scintillation cocktail was adde d. The initial activity of each incubation was measured by injecting 10 l samples into scintillation cocktail containing phenylethylamine (sx10-1000 Fisher Scie ntific, USA) to trap the NaH14CO3. Both acid stable 14C samples and the initial acti vities were measured via scintillation counting. Five independent experiments were conducted, and carbon fixation followed the MichaelisMenten response curve. KCO2 and Vmax values for the five experiments were estimated from the carbon fixation rates usi ng direct linear plots (9). Cloning and sequencing of the RubisCO large subunit gene ( rbcL ) DNA was purified from S. costatum cells using the CTAB method (11). Primers for the S. costatum rbc L gene were designed from a partial rbc L sequence (6) and purchased from Invitrogen (USA). Primers used to replicate the first half of the gene (1bp 840 bp) include the forward primer (GGGTTACTGGGATGCTTCATACAC) and reverse primer (CCAACAGCTTTAGCATAC TCAGCAC). The primers used to replicate the second half of the gene (560bp 1428bp) include forward primer 53

PAGE 61

Appendix C (Continued) (GGAAGGTATTAACCGTG CATCAGC) and reverse primer (TCTGTTTGCAGTTGGTGTTTCAGC). The tw o RubisCO gene sequences were replicated with PCR, using the above primer s, and the PCR product was ligated into the pCR2.1 vector using TA Cloning Kit (I nvitrogen, 45-0046; California, USA). The plasmids with RubisCO gene inserts were transformed into One Shot TOP10 cells and grown on plates with Luria broth agar w ith 100g/ml ampicillin, 50 g/ml kanamycin, and spread with X-gal. Colonies which had th e plasmid + insert were grown in liquid LB overnight and the plasmids were purified us ing the QIAprep Spin Miniprep Kit (Qiagen, 12125; California, USA). Three different purif ied plasmids for each of the two RubisCO gene inserts were sent for sequencin g (Macrogen, Maryland, USA). A consensus sequence was made using repetitive nucleotides from the three sequenced plasmid inserts. Phylogenetic Analysis A phylogenetic analysis of th e large subunit RubisCO gene ( rbcL ) from S. costatum and other form ID rbcL genes from diverse organisms was accomplished using a maximum parsimony tree with rbcL sequences obtained from NCBIBLAST nucleotide searches. Sequences were aligne d and a maximum parsimony tree, with 1500 replicates, was constructed us ing MEGA 4.0 software (28). Results The five independent incubations of S. costatum RubisCO had values of 19.0‰, 18.6‰, 19.7‰, 15.9‰ and 20.2‰, respectively (Figure C-1). The average value calculated using the Pitman estimator was 18.5‰ (95% CI: 17.0-19.9‰). Three spinach 54

PAGE 62

Appendix C (Continued) RubisCO incubations had values of 28.3‰, 28.2‰, and 27.2‰, with a Pitman average value of 27.5‰ (95% CI: 24.0 – 30.9‰; Figur e C-1) that was within range of previously published values. In order to further characterize S. costatum RubisCO activity, its KCO2 was measured radiometrically in oxygen-free incubations. The KCO2 and Vmax were calculated from five independent experiments and found to be 90 (+/20) M and 15.6 (+/5.8) nmol/min* mg, respectively. Figure C-1. Isotopic fractionation of di ssolved inorganic carbon (DIC) as CO2 is consumed by S. costatum RubisCO and spinach RubisCO. The slope of the line is used to estimate the value for each organism. Since partially purif ied extracts of S. costatum RubisCO were used in the KIE, controls for alternative ca rboxylase activity were run. KI E incubations with RuBP showed a decrease in [DIC] over time, which is consistent with S. costatum RubisCO catalyzing the carbon fixation in these a ssays (Figure C-2). Conversely, control experiments, which did not c ontain RuBP, showed no change of [DIC] in the reaction 55 -4.491 -4.488 -4.485 -4.482 -4.479 -4.476 -4.473 -4.47 -4.467 0.80.911.11.21.31.41.5 ln[DIC mmol L-1]lnR ( 13C /12C ) S.costatum 1 S.costatum 2 S.costatum 3 S.costatum 4 S.costatum 5 Spinach 4 Spinach 2 Spinach 3

PAGE 63

Appendix C (Continued) syringe. DIC also was constant in the RuBP -free incubations that contained 3-PGA. A more sensitive bicarbonate 14C activity assay performed on partially purified enzyme also showed carboxlyation occurring only in the presence of Ru BP. Therefore, RubisCO was the only active carboxylase in the part ially purified extracts (Figure C-3). Figure C-2. The consumption of DIC over time by S. costatum RubisCO. Incubations that included RuBP (solid symbols) were used to calculate the value of S. costatum RubisCO. In absence of RuBP, (open symbol s) no DIC was consumed even with 3PGA included in the incubation. 56 0 1 2 3 4 5 6 0246810 Time (hr)DIC [mM] S. costatum 1 S. costatum 2 S. costatum 3 S. costatum 4 S. costatum 5 no RuBP no RuBP + PGA

PAGE 64

Appendix C (Continued) Figure C-3. Radiometric assa y of partially purified S. costatum RubisCO. Assays were conducted in the presence and abse nce of RuBP to confirm that all detectable carboxylase activity was due to RubisCO. Since the isotopic discrimination of fo rm ID RubisCOs differ, a phylogenetic analysis was completed to identify if the ID RubisCO rbcL genes are divergent. In the maximum parsimony tree, the rbcL genes formed clades, which included diatoms, coccolithophores, and rhodophytes (Figure C-4). Higher bootstrap values at the base of the clades differentiate the rbcL genes based on their phylogenetic groups. Furthermore, the rhodophyte rbcL genes group with the diatoms genes, while the coccolithophore rbcL genes formed a separate branch. The form IC rbcL genes formed a separate group away from the ID RubisCO genes. 57 0 2 4 6 8 10 02468101214 Time (min)Carbon Fixation (nmol ) With RuBP Without RuBP

PAGE 65

Thalassiosira pseudonana Skeletonema costatum Cylindrotheca sp. Phaeodactylum tricornutum Lyrella hennedyi Thalassionema frauenfeldii Purpureofilum apyrenoidigerum Gelidium pusillum Polysiphonia stricta Polysiphonia morrowii Emiliania huxleyi Isochrysis sp. Chrysochromulina hirta Platychrysis sp. Ralstonia eutropha Rhodobacter sphaeroides 100 100 57 37 99 92 89 95 99 99 75 84 73Appendix C (Continued) Figure C-4. Phylogenetic analysis of se lected RubisCO large subunit genes ( rbcL ). Sequences were aligned using the maximu m parsimony method (MEGA software). The numbers next to the branches represents th e number of times, of the 1500 bootstrap trials, that the associated taxa cl ustered together as shown. Discussion Skeletonema costatum RubisCO is less selective against 13C; consequently, providing a basis for enriched 13C marine carbon biomass. The carbon isotope compositions of S. costatum biomass correlate with the selectivity of its RubisCO, having 13C values ranging from -16.8 to -27.6‰. (3, 16). The higher (-16.8‰) 13C biomass values can be attributed pr imarily to carbon fixation of bi carbonate carbon by the less selective RubisCO. At marine pH values, bicarbonate (HCO3 -) is the main form of DIC 58 Diatoms Rhodophytes Coccolithophores IC RubisCO

PAGE 66

Appendix C (Continued) in the ocean; however, RubisCO fixes DIC in the form of CO2 (5). To cope with the paucity of CO2 in the environment, some ma rine autotrophs will convert HCO3 into CO2 using carbonic anhydrase (CA). Organisms, that use HCO3 as a main carbon source, have higher 13C biomass values because HCO3 is isotopically enriched compared CO2. Even though S. costatum RubisCO is less isotopically selective, its biomass has less 13C than expected, with 13C values as low as -27.6‰ (3). Low 13C values could be attributed to S. costatum RubisCO using a carbon source depleted in 13C, such as isotopically depleted CO2 (-8‰). Furthermore, carbon-c oncentrating mechanisms (CCM) could also play a role in low biomass 13C values. In diatoms, the internal DIC concentration can reach 3.5 times higher than ex ternal DIC concentrations (20). This high internal concentra tion is not achievabl e strictly though CO2 diffusion, which is indicative of a CCM; however, the exact CCM used by S. costatum is unknown. The CCM may consist of active transport of CO2 or HCO3 into the cell as well as CA to carry out the interconversion of the two substrates ( 20). The CCM could actively transport less 13C into the cell for RubisCO to fix, also causing low 13C biomass values in S. costatum Once the exact mechanism of S. costatum ’s CCM is elucidated, the isotopic effect associated with the CCM can be investigated. Because of their bloom life style, organisms, such as diatoms and coccolithophores that have a less selective form ID Rubi sCO, can greatly alter the 13C of oceanic biomass. In areas of nutrient upwelling, large blooms of phytoplankton can trigger the larval spawning of grazing zoopl ankton (27). Consuming organisms with ID 59

PAGE 67

Appendix C (Continued) RubisCO causes the zooplankton biomass to become rich in 13C. Furthermore, diatoms are very efficient at exporting carbon to the sea floor because the cells are larger and heavier, which enhance sinking rates; therefore, increasing the amount of 13C in deep waters (8). An increase in oceanic biomass 13C values can be caused by zooplankton grazing and increased vertical carbon flux of diatoms. With rising atmospheric CO2 values, it is essential to have accurate carbon cycle modeling. Although isotopic discrimination by di fferent forms of RubisCO vary between organisms, most carbon models assume th at all RubisCOs discriminate against 13CO2 to the same degree (12). Form ID RubisCOs, including S. costatum and E. huxleyi are isotopically less selective than other forms of RubisCO (Table C-1), calling for changes in current modeling equations. However, rhodophytes, another major phylogenetic group with ID RubisCO, also need to be investigated to unders tand the full range of isotopic fractionation by ID RubisCO. Collecting isot opic fractionation data from RubisCO of diverse organisms will allow for more inclusiv e carbon models that will generate better estimations of global carbon fixation. 60

PAGE 68

Appendix C (Continued) Table C-1. Epsilon values of different forms of RubisCO that have been measured with kinetic isotope experiments. Taxon Form of RubisCO value (‰) Solemya velum symbiont IA 24.5 Prochlorococcus marinus MIT9313 IA 24.0 Spinacia oleracea IB 29.0 Anacystis nidulans IB 22.0 Rhodobacter sphaeroides IC 22.9 Skeletonema costatum ID 18.6 Emiliana huxleyi ID 11.1 Riftia pachyptila symbiont II 19.5 Rhodospirillum rubrum II 22.0 61

PAGE 69

Appendix C (Continued) References 1. Arrigo, K. R. 2005. Marine microorganisms and global nutrient cycles. Nature 437: 349-355. 2. Boller, A. J., Thomas, P. J., Cavanaugh, C. M., and Scott, K. M. in prep. A New Low for RubisCO. 3. Burkhardt, S., U. Riebesell, and I. Zondervan. 1999. Stable carbon isotope fractionation by marine phytopl ankton in response to daylength, growth rate, and CO2 availability. Marine Ecology-Progress Series 184: 31-41. 4. Caspi, R., M. G. Haygood, and B. M. Tebo 1996. Unusual ribulose 1,5bisphosphate carboxylase/oxygenase genes from a marine manganese oxidizing bacterium. Microbiology 142: 2549-2559. 5. Cooper, T. G., and D. Filmer 1969. The active species of "CO2" utilized by ribulose diphosphate carboxylase. Journal of Biological Chemistry 244: 10811083. 6. Daugbjerg, N., Andersen, R.A 1997. A molecular phylogeny of the heterokont algae based on analyses of chlor oplast-encoded rbcL sequence data. J. Phycol 33: 1031-1041. 7. Dobrinski, K. P., D. L. Longo, and K. M. Scott 2005. A hydrothermal vent chemolithoautotroph with a carbon concentrating mechanism. J Bacteriol 187: 5761-5766. 8. Dugdale, R. C., and F. P. Wilkerson 1998. Silicate regulation of new production in the equatorial Pacific upwelling. Nature 391: 270-273. 9. Eisenthal, R., and A. Cornish-Bowden 1974. The direct linear plot. Biochemistry Journal 139: 715-720. 10. Falkowski, P.G. and Raven, J.A. 1997. Aquatic Photosynthesis. In Carbon acquisition and Assimilation. Boston: Bl ackwell Scientific Publication, pp. 128162. 11. Feil, W. S., and H. Feil 2004. Bacterial genomic DNA isolation using CTAB. DOE Joint Genome Institute (JGI). 12. Goericke, R., J. P. Montoya, and B. Fry 1994. Physiology of isotopic fractionation in algae and cyanobacteria, pp. 187-221. In K. Lajtha and R. H. Michener (eds.), Stable Isotopes in Ecology and Environmental Science. Blackwell Scientific Publications. 13. Guillard, R. R., and J. H. Ryther 1962. Studies of Marine Planktonic Diatoms .1. Cyclotella Nana Hustedt, and Det onula Confervacea (Cleve) Gran. Canadian Journal of Microbiology 8: 229. 14. Guy, R. D., M. L. Fogel, and J. A. Berry 1993. Photosynthetic fractionation of the stable isotopes of oxygen and carbon. Plant Physiol 101: 37-47. 15. Hayes, J. M 2001. Fractionation of carbon and h ydrogen isotopes in biosynthetic processes, pp. 225-277. In J. W. Valley and D. R. Cole [eds.], Stable Isotope Geochemistry. The Mineralogi cal Society of America. 62

PAGE 70

Appendix C (Continued) 16. Hinga, K. R., M. A. Arthur, M. E. Q. Pilson, and D. Whitaker 1994. Carbon isotope fractionation by marine phytopla nkton in culture: The effects of CO2 concentration, pH, temperature, and species. Global biogeochemical cycles 8: 91102. 17. Horken, K., and F. R. Tabita 1999. Closely related form I ribulose bisphosphate carboxylase/oxygenase mol ecules that possess different CO2/O2 substrate specificities. Archives of Bioche mistry and Biophysics 361: 183-194. 18. Nielsen, T. G., and B. Hansen 1995. Plankton community structure and carbon cycling on the western coast of Greenland during and after the sedimentation of a diatom bloom. Marine Ecology Progress Series 125: 239-257. 19. O'leary, M. H., S. Madhavan, and P. Paneth 1992. Physical and chemical basis of carbon isotope fractionation in plants. Plant, Cell, and Environment 15: 1099-1104. 20. Roberts, K., E. Granum, R. C. Leegood, and J. A. Raven 2007. Carbon acquisition by diatoms. Photosynth Research 93: 79-88. 21. Robinson, J. J. et. al 2003. Kinetic isotope effect a nd characterization of form II RubisCO from the chemoautotrophic e ndosymbionts of the hydrothermal vent tubeworm Riftia pachyptila Limnol Oceanogr 48: 48-54. 22. Roeske, C. A., and M. H. O'leary 1984. Carbon isotope effects on the enzymecatalyzed carboxylation of ribulose bisphosphate. Biochemistry 23: 6275-6284. 23. Roeske, C. A., and M. H. O'leary 1985. Carbon isotope eff ect on carboxylation of ribulose bisphosphate catalyzed by ribulosebisphosphate carboxylase from Rhodospirillum rubrum Biochemistry 24: 1603-1607. 24. Schwedock, J. et. al. 2004. Characterization and e xpression of genes from the RubisCO gene cluster of the ch emoautotrophic symbiont of Solemya velum: cbbLSQO Arch Microbiol 182: 18-29. 25. Scott, K. M., X. Lu, C. M. Cavanaugh, and J. Liu 2004a. Optimal methods for estimating kinetic isotope effects from di fferent forms of the Rayleigh distillation equation. Geochim Cosmochim Acta 68: 433-442. 26. Scott, K. M., J. Schwedock, D. P. Schrag, and C. M. Cavanaugh 2004b. Influence of form IA RubisCO and e nvironmental dissolved inorganic carbon on the 13C of the clam-bacterial ch emoautotrophic symbiosis Solemya velum Environ Microbiol 6: 1210-1219. 27. Starr, M., J. C. Therriault, G. Y. Conan, M. Comeau, and G. Robichaud 1994. Larval Release in a Sub-Euphotic Z one Invertebrate Triggered by Sinking Phytoplankton Particles. Journal of Plankton Research 16: 1137-1147. 28. Tamura, K., J. Dudley, M. Nei, and S. Kumar 2007. MEGA 4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Molecular Biology and Evolution pp. 1596-1599. 63

PAGE 71

Appendix C (Continued) 29. Tcherkez, G. G. B., G. D. Farquhar, and T. J. Andrews 2006. Despite slow catalysis and confused substrate sp ecificity, all ribulose bisphosphate carboxylases may be nearly perfectly optimized. Proceedings of the National Academy of Sciences of th e United States of America 103: 7246-7251. 30. Watson, G. M. F. and F. R. Tabita 1996. Regulation, unique gene organization, and unusual primary structure of ca rbon fixation genes from a marine phycoerythrin-containing cyanobacterium. Plant Molecular Biology 32: 11031115. 31. Watson, G. M. F. and F. R. Tabita 1997. Microbial ribulose 1,5-bisphosphate carboxylase/oxygenase: A molecule fo r phylogenetic and enzymological investigation. Fems Microbiology Letters 146: 13-22. 64

PAGE 72

Appendix D: Abstract from Publication of Thiomicrospira crunogena XCL-2 genome The Genome of Deep-Sea Vent Chemolithoautotroph Thiomicrospira crunogena XCL-2 Kathleen M. Scott*1, Stefan M. Sievert2, Fereniki N. Abril1, Lois A. Ball1, Chantell J. Barrett1, Rodrigo A. Blake1, Amanda J. Boller1, Patrick S. G. Chain3,4, Justine A. Clark1, Carisa R. Davis1, Chris Detter4, Kimberly F. Do1, Kimberly P. Dobrinski1, Brandon I. Faza1, Kelly A. Fitzpatrick1, Sharyn K. Freyermuth5, Tara L. Harmer6, Loren J. Hauser7, Michael Hgler2, Cheryl A. Kerfeld8, Martin G. Klotz9, William W. Kong1, Miriam Land7, Alla Lapidus4, Frank W. Larimer7, Dana L. Longo1, Susan Lucas4, Stephanie A. Malfatti3,4, Steven E. Massey1, Darlene D. Martin1, Zoe McCuddin10, Folker Meyer11, Jessica L. Moore1, Luis H. Ocampo Jr.1, John H. Paul12, Ian T. Paulsen13, Douglas K. Reep1, Qinghu Ren13, Rachel L. Ross1, Priscila Y. Sato1, Phaedra Thomas1, Lance E. Tinkham1, and Gary T. Zeruth1 Biology Department, University of S outh Florida, Tampa, Florida USA1; Biology Department, Woods Hole Oceanographic Inst itution, Woods Hole, Massachusetts USA2; Lawrence Livermore National Labora tory, Livermore, California USA3; Joint Genome Institute, Walnut Cr eek, California USA4; Department of Biochemistry, University of Missouri, Columbia, Missouri USA5; Division of Natural Sciences and Mathematics, The Richard Stockton College of New Jersey, Pomona, New Jersey USA6; Oak Ridge National Laboratory, Oak Ridge, Tennessee USA7; Molecular Biology Institute, University of California, Los Angeles, California USA8; University of Louisville, Louisville USA9; The Monsanto Company, Ankeny, IA USA10; Center for Biotechnology, Bielefeld University, Germany11; College of Marine Science, University of South Florida, St. Petersburg, Florida USA12; The Institute for Genomic Research, Rockville, Maryland USA13 *Corresponding author. Mailing address: 4202 East Fowler Ave nue; SCA 110; Tampa, FL 33620. Phone: (813) 974-5173. Fax: (813) 974-3263. E-mail: kscott@cas.usf.edu Citation: Scott, K. M., Sievert, S. M., Abril, F. N., Ball, L. A., Barrett, C. J., et. al. 2006. The genome of deep-sea vent chemolithoautotroph Thiomicrospira crunogena XCL-2. PloS Biology 4 (12):e383. DOI: 10.1371/ journal.pbio.0040383. 65

PAGE 73

Appendix D (Continued) ABSTRACT Presented here is the comp lete genome sequence of Thiomicrospira crunogena XCL-2, representative of ubiquitous chemolit hoautotrophic sulfur-oxidizing bacteria isolated from deep-sea hydrothermal vents. This gammaproteobacterium has a single chromosome (2,427,734 bp), and its genome illustra tes many of the adaptations that have enabled it to thrive at vents globally. It has 14 methyl-accepting chemotaxis protein genes, including four that may assist in positioning it in the redoxcline. A relative abundance of CDSs encoding regulatory protei ns likely control the expression of genes encoding carboxysomes, multiple dissolved inorganic nitrogen and phosphate transporters, as well as a phosphonate operon, wh ich provide this species with a variety of options for acquiring these subs trates from the environment. T. crunogena XCL-2 is unusual among obligate sulfur oxidizing bacteria in relying on the Sox system for the oxidation of reduced sulfur compounds. The ge nome has characteristics consistent with an obligately chemolithoautotrophic lifestyle including few transporters predicted to have organic allocrits, and Calvin-BensonBassham cycle CDSs sc attered throughout the genome. 66

PAGE 74

Appendix D (Continued) Figure D-1. PloS Biology Open Access Li cense for use of the above abstract. 67

PAGE 75

Appendix E: Abstract from Publication of Sulfurimonas denitrificans genome Genome of the Epsilonproteob acterial Chemolithoautotroph Sulfurimonas denitrificans Stefan M. Sievert‡*1, Kathleen M. Scott‡*2, Martin G. Klotz3, Patrick S. G. Chain4,5, Loren J. Hauser6, James Hemp7, Michael Hgler1,8, Miriam Land6, Alla Lapidus5, Frank W. Larimer6, Susan Lucas5, Stephanie A. Malfatti4,5, Folker Meyer9, Ian T. Paulsen10#, Qinghu Ren10, Jrg Simon11, and the USF Genomics Class2, Biology Department, Woods Hole Ocea nographic Institution, Woods Hole, Massachusetts1; Biology Department, University of South Florida, Tampa, Florida2; Departments of Biology and Microbiology & Immunology, University of Louisville, Louisville, Kentucky3; Lawrence Livermore National Labo ratory, Livermore, California4; Joint Genome Institute, Walnut Creek, California5; Oak Ridge National Laboratory, Oak Ridge, Tennessee6; Center for Biophysics and Comput ational Biology, University of Illinois at Urbana-Cha mpaign, Urbana, Illinois7; Leibniz-Institut fr Meereswissenschaften, Kiel, Germany8; Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, Illinois9; The Institute for Genomic Research, Rockville, Maryland10; Institute of Molecular Bios ciences, Johann Wolfgang Goethe University, Frankfurt am Main, Germany11 Kathryn Bailey, Erik Diaz, Kelly Ann Fitz patrick, Bryan Glover, Natasha Gwatney, Asja Korajkic, Amy Long, Jennifer M. Mobbe rley, Shara N. Pantry, Geoffrey Pazder, Sean Peterson, Joshua D. Quintanilla, Robe rt Sprinkle, Jacqueline Stephens, Phaedra Thomas, Roy Vaughn, M Joriane Weber, Lauren L. Wooten ‡SMS and KMS contributed equally to this work. Corresponding authors. SMS: Mailing a ddress: WHOI; Watson Building 207, MS#52; Woods Hole, MA 02543. Phone: (508) 289-2305. Fax: (508) 457-2076. E-mail: ssievert@whoi.edu. KMS: Mailing address: 4202 East Fowler Avenue, SCA 110; Tampa, FL 33620. Phone: (813) 974-5173. Fax (813) 974-3263. E-mail: kscott@cas.usf.edu Citation: Sievert, S. M., Scott, K. M., Klotz, M. G., Chain, P. S. G., Hauser, L. J., et. al. 2008. Genome of the epsilonprote obacterial chemolithoautotroph Sulfurimonas denitrificans Applied and Environmental Microbiology 74 (4):1145-1156. American Society for Mi crobiology. All rights reserved. 68

PAGE 76

Appendix E (Continued) ABSTRACT Sulfur-oxidizing epsilonproteobacteria ar e common in a variety of sulfidogenic environments. These autotrophic and mixotrophi c sulfur-oxidizing bacteria are believed to contribute substantially to th e oxidative portion of the globa l sulfur cycle. In order to better understand the ecology and roles of sulfur-oxidizing epsilonproteobacteria, in particular the widespread genus Sulfurimonas in biogeochemical cy cles, the genome of Sulfurimonas denitrificans DSM1251 was sequenced. This genome has many features, including a larger size (2.2 Mbp) that suggest a greater degree of metabolic versatility or responsiveness to the en vironment than most of the other sequenced epsilonproteobacteria. A branched electron transport chain is a pparent, with genes encoding complexes for the oxidation of hydrogen, reduced sulfur compounds, and formate, and the reduction of nitrate a nd oxygen. Genes are present for a complete, autotrophic reductive citric acid cycle. Ma ny genes are present that could facilitate growth in the spatially and temporally heterogeneous sediment habitat from where Sulfurimonas denitrificans was originally isolated. Many resistance-nodulationdevelopment-family transporter genes (11 to tal) are present, several of which are predicted to encode heavy metal efflux transp orters. An elaborate arsenal of sensory and regulatory protein-encoding genes is in place, as well as ge nes necessary to prevent and respond to oxidative stress. 69

PAGE 77

Appendix E (Continued) Figure E-1. American Society for Microbio logy permission document for use of the above abstract from the AEM publication. 70