USF Libraries
USF Digital Collections

The role of neuroinflammation in regulating the age-related decline in neurogenesis

MISSING IMAGE

Material Information

Title:
The role of neuroinflammation in regulating the age-related decline in neurogenesis
Physical Description:
vi, 96 leaves : ill. ; 29 cm.
Language:
English
Creator:
Bachstetter, Adam D
Publication Date:

Subjects

Subjects / Keywords:
Aging   ( mesh )
Neurogenesis   ( mesh )
Microglia   ( mesh )
Neurogenic Inflammation   ( mesh )
Fetal Blood   ( mesh )
Interleukin-1beta   ( mesh )
Chemokine CX3CL1   ( mesh )
Microglia
Interleukin-1-beta
Cord blood
Fractalkine
CX3CR1
Dissertations, Academic -- Molecular Pharmacology and Physiology -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Adult neurogenesis, is a lifelong process by which relatively few cells are added into two restricted regions of the brain. Integration of the cells into the existing neuronal circulatory, with the unique properties involved in the maturation of these cells, is possibly critical to the acquisition and retrieval of new memories. With the chronological aging of the organism a process of cellular senescence occurs throughout the body; a portion of which is independent of primary alterations to the stem cells; instead, it appears to be dependent on the environment where the cells reside, and is in part regulated by inflammation. Microglia, the resident immune cells in the brain, are neuroprotective but chronic activation of the microglia, such as the chronic activation that occurs with advanced age, can promote neurotoxic inflammation.However, it not clear if the aged-related increase in neuroinflammation is at least partly responsible for the aged related decrease in neurogenesis. To address the involvement in neuroinflammation in regulating neurogenesis we used 3 different potential therapeutically relevant manipulations. The first was a targeted approach directed at disrupting the synthesis of Interleukin-1beta (IL-1B), which is a proinflammatory cytokine that is consistently found elevated in the aged brain. The second was a cell therapy approach in which human umbilical cord blood cells were injected into the systemic circulation. The final approach was directed at a chemokine system, fractalkine/CX3CR1, which has been shown as an important paracrine signal, from neurons that regulates the activation state of microglia. While the three approaches used to manipulate, aging-rodent model system were different, a consistent finding was reached in all three studies.In the aged brain, microglia which are the predominate produces of IL-1B, negatively regulate neurogenesis. When IL-1B is decreased or microglia activation is decreased, neurogenesis can be partially restored in the aged brain. The results of these studies, demonstrate a key role for microglia in regulating the neurogenic neiche, which are amendable to therapeutic manipulations.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2009.
Bibliography:
Includes bibliographical references.
Statement of Responsibility:
by Adam D. Bachstetter.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002324022
oclc - 668992187
usfldc doi - E14-SFE0002874
usfldc handle - e14.2874
System ID:
SFS0027191:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader ntm 2200397Ka 4500
controlfield tag 001 002324022
005 20101007100328.0
008 101007s2009 flua ob 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002874
035
(OCoLC)668992187
040
FHJ
c FHJ
049
FHJA
096
WL 102.5
b B1245r 2009
1 100
Bachstetter, Adam D.
4 245
The role of neuroinflammation in regulating the age-related decline in neurogenesis /
by Adam D. Bachstetter.
260
2009.
300
vi, 96 leaves :
ill. ;
29 cm.
500
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2009.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
520
ABSTRACT: Adult neurogenesis, is a lifelong process by which relatively few cells are added into two restricted regions of the brain. Integration of the cells into the existing neuronal circulatory, with the unique properties involved in the maturation of these cells, is possibly critical to the acquisition and retrieval of new memories. With the chronological aging of the organism a process of cellular senescence occurs throughout the body; a portion of which is independent of primary alterations to the stem cells; instead, it appears to be dependent on the environment where the cells reside, and is in part regulated by inflammation. Microglia, the resident immune cells in the brain, are neuroprotective but chronic activation of the microglia, such as the chronic activation that occurs with advanced age, can promote neurotoxic inflammation.However, it not clear if the aged-related increase in neuroinflammation is at least partly responsible for the aged related decrease in neurogenesis. To address the involvement in neuroinflammation in regulating neurogenesis we used 3 different potential therapeutically relevant manipulations. The first was a targeted approach directed at disrupting the synthesis of Interleukin-1beta (IL-1B), which is a proinflammatory cytokine that is consistently found elevated in the aged brain. The second was a cell therapy approach in which human umbilical cord blood cells were injected into the systemic circulation. The final approach was directed at a chemokine system, fractalkine/CX3CR1, which has been shown as an important paracrine signal, from neurons that regulates the activation state of microglia. While the three approaches used to manipulate, aging-rodent model system were different, a consistent finding was reached in all three studies.In the aged brain, microglia which are the predominate produces of IL-1B, negatively regulate neurogenesis. When IL-1B is decreased or microglia activation is decreased, neurogenesis can be partially restored in the aged brain. The results of these studies, demonstrate a key role for microglia in regulating the neurogenic neiche, which are amendable to therapeutic manipulations.
590
Advisor: Paula C. Bickford, Ph.D.
653
Microglia
Interleukin-1-beta
Cord blood
Fractalkine
CX3CR1
2 650
Aging.
Neurogenesis.
Microglia.
Neurogenic Inflammation.
Fetal Blood.
Interleukin-1beta.
Chemokine CX3CL1.
0 690
Dissertations, Academic
z USF
x Molecular Pharmacology and Physiology
Doctoral.
773
t USF Electronic Theses and Dissertations.
856
u http://digital.lib.usf.edu/?e14.2874



PAGE 1

The Role of Neuroinflammation in Regulating the Age-Related Decline in Neurogenesis by Adam D. Bachstetter A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Medicine Department of Molecular Pharmacology and Physiology College of Medicine University of South Florida Major Professor: Paula C. Bickford, Ph.D. Carmelina Gemma, Ph.D. David Morgan, Ph.D. Keith Pennypacker, Ph.D. Chad Dickey, Ph.D. Alison Willing, Ph.D. Date of Approval: Feburary 23, 2009 Keywords: microglia, interleukin-1-beta, cord blood, fractalkine, cx3cr1 Copyright 2009, Adam D. Bachstetter

PAGE 2

i Table of Contents List of Tables iv List of Figures v Abstract vi Introduction 1 Non-Cell-Autonomous Changes Regulating Neurogenesis 2 Inflammation in Aging and Disease 3 Cytokines 3 IL-1 3 Chemokines 4 Fractalkine/CX3CR1 5 Microglia 6 Age Related Alterations in Adaptive Immunity 8 Human Umbilical Cord Blood Cells as a Potential Theraputic 9 Conclusion 10 Paper I: Blockade of Caspase-1 Increases Neurogenesis in the Aged Hippocampus 12 Abstract 12 Introduction 12 Material and Methods 15 Animals 15 Surgical procedure and treatments 15 BrdU staining procedure 15 OX-6 staining procedure 15 Stereology 16 Stereologic estimation of the total number of OX-6 immunolabeled cells 17 Immunofluorescence procedure 17 Statistical analysis 17 Results 18 Chronic administration of Ac-YVAD -CMK increases the number of BrdUpostive cells in the subgranule cell layer of the hippocampus 18 Determination of neuronal and glial phenotypes of BrdU labeled cells in the subgranule cell layer of the hippocampus 18 Ac-YVAD-CMK decrease microglia activation 19 Discussion 19 Acknowledgements 21 Paper II: Peripheral Injection of Human Umbili cal Cord Blood Stimulates Neurogenesis in the Aged Rat Brain 27 Abstract 27 Introduction 27 Material and Methods 29 Cell preparation 29 Animals 29 Tissue collection and processing 30 BrdU Immunohistochemistry 30 Doublecortin and OX-6 Immunohistochemistry 30

PAGE 3

ii Immunofluorescence 31 Human Nuclei immunofluorescence 31 Quantification and imaging: 31 Statistical analysis 32 Results 32 Human umbilical cord blood mononuclear cells (UCBMC) stimulate proliferation of the senescent hippocampal neural stem cell 32 Neurogenesis is stimulated in the aged hippocampus following UCBMC treatment 32 A decrease in microglia activation following UCBMC correlates with the increase in neurogenesis. 33 Discussion 34 Conclusions 36 Abbreviations 36 Competing interests 36 Authors' contributions 36 Acknowledgements 36 Paper III: Fractalkine is an Im portant Regulator of Adult Hi ppocampal Neur ogenesis 40 Abstract 40 Introduction 41 Material and Methods 42 Animals 42 Surgical procedure 42 Thymidine analog labeling 42 Tissue collection and processing 43 Real-Time RT-PCR 43 Immunohistochemistry and Immunofluorescence 44 Quantification and imaging 45 Statistical analysis 45 Results 45 CX3CR1-deficient mice have decreased hippocampal NPC proliferation and neurogenesis 45 Proliferation of NPCs is decreased by -CX3CR1 treatment in young but not middle aged or old rats 46 FKN reversed the age-related de crease in neurogenesis, but had no effect in young or middle aged rats. 46 FKN treatment in aged rats mainly affects proliferation 47 Expression of FKN in the rat hippocampus 47 CX3CR1 blocking antibody increased IL-1 48 IL-1 mediates the effects of -CX3CR1 treatment 48 CX3CR1 blocking antibody decreased survival of cells born prior to treatment 49 FKN is necessary to maintain microglia in an unactivated state 50 Discussion 51 Conclusions 54 Conclusions: The Role of neuroinflammation in regulating the age-related decline in neurogenesis: could restoring the balance rescue neural plasticity 64 Introduction 64 Adult neurogenesis 64 Adult neurogenesis and memory are they related? 65 Neurogenesis and aging: is neurogenesis involved in age-related cognitive decline 66 Where do we put all these new neurons? 66 Microglia Regulation of cell death in developmental and adult neurogenesis 67

PAGE 4

iii Inflammation and adult neurogenesis 69 Age-related cognitive impairment: is it a numbers game? 70 Conclusion 71 References Cited 73 About the Author End Page

PAGE 5

iv List of Tables Table 1: Percentage of each phenotype with respect to the number of BrdUlabeled cells. 22

PAGE 6

v List of Figures Figure 1: Microglia: protective or harmful? 11 Figure 2: Inflammation decreases basal hippocampal neurogenesis. 23 Figure 3: Inhibition of caspase-1 atte nuates the decrease in hippocampal neurogenesis associated with aging. 24 Figure 4: Representative conf ocal micrograph of BrdU-labeled newborn cells. 25 Figure 5: Inhibition of caspase-1 signific antly reduced microglia activation. 26 Figure 6: Proliferation is increased in aged rats following UCBMC treatment. 37 Figure 7: 15 days after a UCBMC treatment neurogenesis is increase in aged rats. 38 Figure 8: The decrease in microglia activation correlates with neurogenesis. 39 Figure 9: CX3CR1GFP/GFP mice have diminished hippocampal neurogenesis. 55 Figure 10: Proliferation is decreased by a-CX3CR1 56 Figure 11: FKN reverses the age-relat ed decrease in neurogenesis. 57 Figure 12: FKN exerts proliferat ive effects in aged rats. 58 Figure 13: Expression of FKN in the hippocampus. 59 Figure 14: CX3CR1 blocking antibody increases hippocampal IL-1 levels. 60 Figure 15: IL-1Ra reverses the effects of a-CX3CR1. 61 Figure 16: CldU colocalizes with NeuN 62 Figure 17: FKN signaling regulates microglia activation. 63 Figure 18: How neuroinflammation can modulate adult hippocampal neurogenesis. 72

PAGE 7

vi The Role of Neuroinflammation in Regulating the Age-Related Decline in Neurogenesis Adam D. Bachstetter ABSTRACT Adult neurogenesis, is a lifelong process by which relatively few cells are added into two restricted regions of the brain. Integration of t he cells into the existing neuronal circulatory, with the unique properties involved in the maturation of these cells, is possibly critical to the acquisition and retrieval of new memories. With the chronological aging of the organism a process of cellular senescence occurs throughout the body; a portion of which is independent of primary alterations to the stem cells; instead, it appears to be dependent on the environment where the cells reside, and is in part regulated by inflammation. Microglia, the resident immune cells in the brain, are neuroprotective but chroni c activation of the microglia, such as the chronic activation that occurs with advanced age, can pr omote neurotoxic inflammation. However, it not clear if the aged-related increase in neuroinflammati on is at least partly responsible for the aged related decrease in neurogenesis. To address t he involvement in neuroinflammation in regulating neurogenesis we used 3 different potential therapeutic ally relevant manipulations. The first was a targeted approach directed at disrupt ing the synthesis of Interleukin-1 (IL-1 ), which is a proinflammatory cytokine that is consistently found elevated in the aged brain. The second was a cell therapy approach in which human umbilical co rd blood cells were injected into the systemic circulation. The final approach was directed at a chemokine system, fractalkine/CX3CR1, which has been shown as an important paracrine signal, from neurons that regulates the activation state of microglia. While the three approaches used to manipulate, aging-rodent model system were different, a consistent finding was reached in all three studies. In the aged brain, microglia which are the predominate produces of IL-1 negatively regulate neurogenesis. When IL-1 is decreased or microglia activation is decreased, neurogenesis can be partially restored in the aged brain. The results of these studies, demonstrate a key role for microglia in regulating the neurogenic neiche, which are amendable to therapeutic manipulations.

PAGE 8

1 Introduction Aging is the backdrop in which many neurodege nerative disease occur, including Alzheimer's disease (AD), Parkinson’s disease (PD), and am yotrophic lateral sclerosis (ALS). As our population ages, there is a pressing need to dev elop therapeutic interventions for age-related neurodegenerative diseases. Not only is this true fo r the patient, but also for the sake of those who will care for those suffering from a neurodegenerative disease. Alterations in neural plasticity are associ ated with aging; however recent studies have demonstrated that the age-related alterations in neural plasticity are due to regional synaptic alterations and not neuron loss (for review see: (Burke and Barnes, 2006)). One aspect of neural plasticity is adult neurogenesis. Adult neurogenesis is the term used for a process, first described in 1965, which results in the addition of new neur ons in the adult brain (Altman and Das, 1965a). The addition of new neurons is complementary to synaptogenesis, and adds another form of neural plasticity. Neurogenesis is one of the pos sible mechanisms that could be utilized, as a potential ‘reservoir’ of neural plasticity, to in crease the quality of life of our aging population. However, it is an important to consider when designing therapeutic strategies for our aging population, with and without neurodegenerative diseases, that alterations occur to neural plasticity as a result of age, and therefore the res ponse to a therapeutic may be less efficacious in the elderly. Adult neurogenesis has been found in humans as old as 72 years of age (Eriksson et al., 1998). However, considerably less is known about adult neurogenesis in humans compare to rodents. In rodents, adult neurogenesis has no w been extensively studied, and it is now well accepted that neurogenesis occurs in at l east two germinal centers in the brain, the subventricular zone (SVZ) and the subgranlar zone (SGZ) of the hippocampal dentate gyrus (DG) (for review see: (Ming and Song, 2005; Zhao et al., 2008)). The process of Adult Neurogenesis There are five phases of hippocampal neurogen esis: (1) The first phase is proliferation of neural stem/progenitor cells (NPCs) which occurs in a region called SGZ, which is defined as a two cell diameter band occurring on the hilus side of the granule cell layer (GCL). (2) The second phase is the survival of the proliferating NPCs. During this phase the number of surviving neurons can vary greatly depending on the strain of animals used and can be as great as ~ 75% or a few as 25% of the amount of proliferating cells (Kempermann et al., 1997a). (3) The third phase, occurring in concert with the second phase, is the differentiation of the newly born cells. In this phase the majority of cells do become neurons, with a smaller percentage becoming astrocytes

PAGE 9

2 and oligodendrocytes. (4) The fourth phase involves migration of the neurons into the GCL; with most of the migration occurring around the firs t week (Kempermann et al., 2003a). (5) Finally, the fifth phase involves the functional maturation of t he neurons in the granule cell layer which occurs around four weeks of age, but some cells may take weeks or even months longer to fully mature (van Praag et al., 2002). It has also been demonstra ted that those adult born neurons that survive after 4 weeks will likely be present at least 11 months later (Kempermann et al., 2003a). The majority of the decrease in neurogenesis with age appears to occur mostly in the first phase through a decrease in proliferation (Drapeau and Nora Abrous, 2008). Survival of the newly born cells appears to be unaffected by age. Maturation of the new born cells, particularly in developing a mature neuronal phenotype and migrating into the GCL, does seem to be affected by age (Drapeau and Nora Abrous, 2008). Non-Cell-Autonomous Changes Regulating Neurogenesis In many pathological conditions, including AD and PD, neurogenesis is dramatically affected by the pathology (Hoglinger et al., 2004; Verret et al., 2007; Zhang et al., 2007; Nuber et al., 2008). Neurogenesis is also significantly dec reased with age (Kuhn et al., 1996; Kempermann et al., 2002; Kronenberg et al., 2006a). The majority of the suppression of neurogenesis with age appears to be a function of the microenvironm ent(niche) and is not NPC autonomous (reviewed in:(Zhao et al., 2008). Moreover, the pool of NPCs appears to be intact with respect to the total numbers of available NPCs (Hattiangady and She tty, 2008), providing more evidence that that the neurogenic niche is at least partly responsi ble for the decrease in neurogenesis with age. Cellular senescence has been known to occur with age since the 1960s (Hayflick and Moorhead, 1961), but the importance of the cellula r senescence within the aged stem cell niche has only recently become an area of active inte rest. A clear example of the importance of the extrinsic or systemic influences on the stem ce ll niche was demonstrated in the stem cells that are found in the muscle, called satellite cells. Like the neural stem cells, the satellite cells in the muscle lose the potential to regenerate damaged tissue with age. In an elegant experiment, when aged rats were exposed to the systemic environm ent of a young rat by parabiosis the satellite cells were rejuvenated in the aged rats as demonst rated by an increase in t he proliferation rate. Conversely, in young rats the exposure to the ci rculation of the aged rats caused a decrease in the regenerative potential of the satellite cell s (Conboy et al., 2005), again supportive of an extrinsic/circulating factor that is influencing the proliferation of the stem cells in the aged animals. It is not clear whether the mechanism involved in the effect in the muscle would hold true in the brain, but the implication is t hat the aged environment is detrimental to stem cell function. This also holds true for even the most pluripotent of stem cells: the embryonic stem cells. When embryonic stem cells are transplanted into aged ti ssue they are not able to repair damaged tissue as well as when transplanted into young tissue (Carlson and Conboy, 2007)

PAGE 10

3 Many changes occur to the aged organisms which are known to negatively impact neurogenesis (for review see (Drapeau and Nora Ab rous, 2008)). However, there is little known about the role of neuroinflammation in regulati ng the age-related decline in neurogenesis. Neuroinflammation is known to negatively impact neurogenesis (Ekdahl et al., 2003; Monje et al., 2003). It is known that neuroinflammation is elevated in aging and AD (Akiyama et al., 2000; Krabbe et al., 2004). The following chapters will begin to clarify the role of neuroinflammation in the age-related decline in neurogenesis. Inflammation in Aging and Disease Inflammation is an active process with the purpo se of removing or inactivating potentially damaging agents or damaged tissue. The inflammatory response is typified acutely by pain, heat, redness, swelling, and loss of function. Follo wing removal of the ‘danger signal’, a second pathway is initiated with the role of tissue re modeling. In the central nervous system (CNS) the inflammatory process must be well controlled. Sinc e the majority of the CNS lacks the potential to replace lost cells, an inflammatory response could be devastating resulting in neural tissue loss. In general, inflammation is a beneficial with the pr imary result of removing the noxious agent and remodeling the adjacent tissue. When inflammation is not well regulated following response to ‘danger signals’ a chronic pathology will result. It has been clearly shown that in the CNS there is a marked increase in inflammatory activity associated with aging (Bodles and Barger, 2004; Joseph et al., 2005; Mrak and Griffin, 2005). It is le ss clear what causes this inflammatory state. Cytokines Cytokines are low molecular weight proteins, with diverse biological activity due to the various target cells and multiple response. Level s of specific cytokines expressed in the brain increase as a function of age, even in the absence of a pathologic stimulus. For example, there is a progressive increase in the expression of interl eukin (IL)-1 and microglia activation with aging in patients without a neurological disease (Roubenoff et al., 1998; Wilson et al., 2002), but to a lesser extend then in patients with AD (Griffin et al ., 1989). IL-6 levels also increase in the mouse brain with advancing age (Godbout and Johnson, 200 4). In the cerebellum of aged rats, tumor necrosis factor(TNF) gene expression is dramatically increased compared to young rats (Gemma et al., 2002). Immune response-related mo lecules and their receptors are expressed throughout the brain, and recent research suggests that brain-derived immune factors disrupt normal physiology and contribute to cognitive and behavioral dysfunction in neurologic disease (Lynch, 1998; Pugh et al., 1999; Rachal Pugh et al., 2001; Barrientos et al., 2002). IL-1 IL-1 is one of the main inflammatory cy tokines found in the CNS involved in neuroinflammation (Shaftel et al., 2008). IL-1 is constitutively expressed in the brain, synthesized by neuronal and/or glial cells, and rele ased in response to a variety of stimuli, including immune system activation (Benveniste, 1992; Rothwell et al., 1997) and in AD (Mrak

PAGE 11

4 and Griffin, 2001). IL-1 is a proinflammatory cytokine init ially synthesized as an inactive precursor that is cleaved by caspase-1 to genera te the biologically mature 17-kDa form. In rodents the enzymatic activity of caspase-1 is increased with normal aging (Gemma et al., 2005), but mRNA expression is not altered (Sheng et al., 2001). Virtually every cell type is affected by binding of IL-1 to the high affinity receptor, IL-1RI (Rothwell et al., 1997; Dinarello, 1998). The IL-1 receptor expression is high in the hippocampus as indicated by binding studies (Farrar et al., 1987; Takao et al., 1990). The IL-1 family comprises three known ligands: IL-1 IL-1 and IL-1ra. The biologic activity of IL-1 is dependent on its interaction with IL-1RI and recruitmen t of the IL-1 receptor accessory protein (IL1Racp) (Sims, 2002). IL-1ra binds to IL-1RI but fails to associate with IL-1Racp, thereby acting as a highly selective competitive receptor inhibi tor. The only known function of IL-1ra is to antagonize the biologic activity of IL-1. IL-1 is a potent suppressor of neurogenesis but it is not completely clear how IL-1 achieves this effect. IL-1 has been shown in vitro to be able to induce apoptosis in NPCs via phosphorylation of the st ress-activated protein kinase/Jun-amino-terminal kinase (SAPK/JNK) pathway (Wang et al., 2007), thereby having a direct effect on the survival of the new born neurons. The NFB/I pathway also seems to be critical in regulating the effects of IL-1 on proliferation, possibly by de creasing Cyclin D1 expression (Koo and Duman, 2008). IL-1 in NPCs cultures also seemed to slightly favor di fferentiation into an astrocyte linage as determined by the marker GFAP (Wang et al., 2007). IL-1 is not alone in being able to directly affe ct NPC. Recently, Iosif et al. (2006) has shown that the inflammatory cytokine TNFcan also assert a direct effect on NPC proliferation. TNF receptor 1 (TNF-R1) appears to have a regulat ory function by blocking proliferation during inflammation. This action occurs directly at t he progenitor cells which express both TNF-R1 and TNF-R2. TNF-R2 appears to play a neuroprotective role; although, its function is a little less clear than that of TNF-R1 (Iosif et al., 2006). Chemokines Chemokines are small molecule (8-14 kDa) proteins that are classically defined as chemotactic cytokines initially studied because of their role in leukocyte trafficking. Chemokines are classified into 4 subfamilies – C; CC; CXC and CX3C – by the position of the conserved cysteine residues near the NH2 terminus region of the protein (B acon et al., 2002). The receptors, by which chemokines exert their effects, ar e of the seven-transmembrane-domain G-proteincoupled receptor (GPCR) family. Chemokine GPCRs belongs to the class A rhodopsin-like family, with the majority of the receptors being G i as indicated by the ability of pertussis toxin (PTX) to inhibit the response of the receptors (Murphy, 1996). The extracellular NH2 terminus and the three extracellular loops act to bind the chem okine ligand. The three intracellular loops and Cterminus act in signal transduction (Mellado et al., 2001).

PAGE 12

5 Fractalkine/CX3CR1 In contrast to many other chemokines, fractalkine (FKN; CX3CL1; neurotactin) binds and activates a single receptor, CX3CR1. Interactions between FKN and CX3CR1 contribute to maintaining microglia in a resting phase, and parti ally controlling microglia induced neurotoxicity (Cardona et al., 2006). FKN acts in vitro as an anti-inflammatory molecule by down-regulating IL1 TNF, and IL-6 production (Zujovic et al., 2000; Zujovic et al., 2001). FKN can therefore, act as a bridge between neurons and microglia, to regulate cytokine production and neuroinflammation. FKN is the only known member of the CX3C chemokine family (Bacon et al., 2002). FKN is unique among chemokines; with cell surface presentation of the N-terminal chemokine domain by a glycolated mucin-like stalk, that is anchored to membrane with a transmembrane and Cterminal cytoplasmic domain (Bazan et al., 1997; Pan et al., 1997). The chemokine domain can be shed from the mucin stalk by a constituti ve expressed metalloproteinase 10 (ADAM10) (Hundhausen et al., 2003), or by an inducible cleavage by TNF-a converting enzyme (TACE / ADAM17) (Garton et al., 2001). FKN is not expres sed on peripheral blood leukocytes (Bazan et al., 1997; Pan et al., 1997). FKN is expressed on endothelial cells(Bazan et al., 1997), epthelial cells (Lucas et al., 2001), smooth muscle cells (Ludwig et al., 2002), dendritc cells (Papadopoulos et al., 1999) and neurons (Pan et al., 1997; Ha rrison et al., 1998). FKN is most robustly expressed in the CNS (Harrison et al., 1998). In isolated primary cultures neurons RT-PCR showed FKN mRNA to be highest in neurons; however, low levels were detected in microglia and astrocytes (Nishiyori et al., 1998). In the CNS, FKN is predominantly expres sed on neurons and is one of only two chemokines that is constitutively expressed by neurons, the other be ing stromal cell-derived factor-1 (SDF-1; CXCL12). SDF-1 is monomeri c like FKN (Crump et al., 1997; Mizoue et al., 1999). Recently it has been shown that SDF-1 has an important role in directly regulating adult neurogenesis (Bhattacharyya et al., 2008; Kolodziej et al., 2008). It is not currently know if FKN might have a similar role in regulating neurogenesis. FKN also has a higher affinity for its receptor (CX3CR1) then other chemokine receptor ligand pairs (Haskell et al., 2001). The exclusive receptor for FKN is a PTX sensitive GPCR, named CX3CR1. Predominate expression of CX3CR1 in the CNS is found on microglia, which suggest a paracrine regulation of microglia by neurons (Harrison et al., 1998). However, expression of the receptor, is not sufficient to determine activity following ligation. In CD14+ moncoctyes less then 2% of cells that express CX3CR1 migrated to soluble FKN (Imai et al., 1997). Moreover, of all the CX3CR1+ cells only 10% of the cells became activated after exposure to soluble FKN (Imai et al., 1997). The adhesion properties of FKN appear to be independent of signaling via the GPCR as PTX was no effect on adhesion (Imai et al., 1997). The expression of CX3CR1 includes a subset of dendritic cells and natural killer cells,

PAGE 13

6 peripheral blood monocytes and tissue macrophages including microglia (Jung et al., 2000). In the CNS, CX3CR1 expression in vivo is limited to immune cells, namely microglia and not astrocytes or neurons (Cardona et al., 2006; Combadiere et al., 2007). However, CX3CR1 expression has been shown in cultured neurons. Moreover, in vitro FKN via CX3CR1 was able to reduce excitotoxic cell death induced by glutamate and neurotoxicity induced by gp120IIIB +, an HIV envelope glycoprotein (Meucci et al., 2000; Tong et al., 2000; Limatola et al., 2005). Recent evidence has shown a role for CX3CR1 polymorphisms in the pathogenesis of age-related macular degeneration (Tuo et al., 2004; Combadiere et al., 2007). There are at least two common coding polymorphsims, V249I and T280M, in the CX3CR1 gene (Faure et al., 2000; McDermott et al., 2001; Moatti et al., 2001), as well as, a single nucleotide poymorphims in the promoter region of CX3CR1 (DeVries et al., 2003). The two SNPs CX3CR1 with a strong linkage disequilibrium include: (1) A SNP at condon 249 that causes a switch from valine to isoleucine (V249I). The other SNP results in a switch from threonine to methionine at codon 280 (T280M). The M280/I249 variant caused reduced function of the receptor, including decreased adhesion, signaling and chemotaxis (McDermott et al., 2003). The M280/I249 variant is also associated with reduced risk for athe rosclerosis. Moreover, in aged CX3CR1-/but not in aged CX3CR1+/+ or young CX3CR1-/there was in age-related accumula tion of microglia that led to retinal neurodegeneration in the CX3CR1-/(Combadiere et al., 2007). FKN/CX3CR1 signaling has been shown to be neuroprotective in a number of brain injury models (Cardona et al., 2006). The neuroprotective role of CX3CR1 has recently been questioned in a model of focal cerebral ischemia where CX3CR1-/mice had a worse outcome following the transient middle cerebral artery occlusion (MCAO) whereas, FKN-/mice had improved outcome following MCAO (Soriano et al., 2002; Denes et al., 2008). The results of this study may not disprove the role of CX3CR1 in neuroprotection, but instead provide more supporting evidence of the diverse role of microglia and macrophages. Following a short dramatic neuronal insult, such as an MCAO, a more robust early immune response may be protective to the insult. This is in comparison to a prolonge d neurodegenerative condition such as AD or PD. Moreover, as the blood brain barrier (BBB) is br oken by the MCAO a di fferent complement of immune cells may be recruited to the injury co mpared to a neurodegenerative condition with an intact BBB. Microglia Microglia are always surveying the mi croenvironment, and once they sense the appropriate signals such as neuronal damage the ce lls will hone to the site of damage (Davalos et al., 2005; Nimmerjahn et al., 2005). As the resident innate immune cells in the CNS, microglia constitutively express surface receptors that trigger or amp lify the innate immune response, including toll-like receptors, complement recept ors, cytokine receptors, chemokine receptors, major histocompatibility complex (MHC) II, and other s (Aloisi, 2001). The main cell type in the

PAGE 14

7 CNS that is responsible for immunity is the mi croglia. Lipopolysaccharides (LPS) is an endotoxin that is part of the outer membrane of gram-negativ e bacteria. LPS up-regulates the production of IL-1 by microglia (Lee et al., 1993). Cytokines such as IL-1 and TNFcan also act in an autocrine or paracrine manner to increase the production of IL-1 by microglia (Lee et al., 1993). Astrocytes can also be stimulated by IL-1 but not by LPS, to produce TNFand IL-6. However, the production of cytokines by astrocytes is less than that of microglia (Lee et al., 1993). Therefore, while astrocytes and neurons can make inflammatory mediators, the microglia are the main source of inflammatory cytokines (Aloisi, 2001). However, the role of microglia is not de structive. Upon detection of homeostatic disturbance, microglia rapidly respond by inducing a protective immune response. The protective immune response begins with a transient upregulation of inflammatory molecules, including proinflammatory cytokines, such as TNF, IL-1, and IL-6 and IL-12 (Gao et al., 2002; Mantovani et al., 2004). This is followed by a protec tive phase that is immunomodulatory and neuroprotective. The protective phase includes neurotrophic factors such as brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), and insulin-like growth factor 1 (IGF-1) (Miwa et al., 1997; Batchelor et al., 1999; Nakajima and Kohsaka, 2004). Thus, microglia remove cells damaged from acute injury and protect CNS functions. Microglia are neither pro-neurogenic or anti-neurogenic but their influence on neurogenesis is dependent on their activation state of ei ther ‘classically’ activa ted or ‘alternatively’ activated (Battista et al., 2006; Butovsky et al., 2006b) (figure 1). Much like what has been proposed for peripheral macrophages, microglia are very pleiotropic. Microglia, can become ‘classically’ activated as defined by the release of pro-inflammatory cytokines (e.g. TNFand IL1 ) (Giulian et al., 1986; Griffin et al., 1989). Once in this ‘classically’ acti vated, pro-inflammatory state, microglia are associated with further produc tion of these pro-inflammatory cytokines, ROS, chemokines, and matrix metalloproteases, result ing in cell death of invading cells and tissue destruction, and type-I inflammation (Mantovani et al., 2007). A second type of microglia are those that are activated by such things as IL-4 and TGF and are called ‘alternatively’ activated or in an ‘M2’ state (following the TH1/TH2 classi fication of T-helper cells) (Mantovani et al., 2007). Compare to the ‘M1’ or ‘classically’ activated stat e, microglia in the ‘M2’ state can be protective (Mantovani et al., 2004). When microglia are in th is ‘M2’ state there is little release of proinflammatory cytokines and they are resistant to activation by agents such as LPS (Mantovani et al., 2007). Alternatively activated macrophages promote extracellular matrix formation and angiogenesis (Mantovani et al., 2007). A third type of microglia is one that becomes dysfunctional with age. The senescent microglia are not able to respond appropriately to stimuli and may exacerbate neuroinflammation (Schwartz et al., 2006a; Streit, 2006a). Isolated microglia from aged mice have elevated basal expression of TNF, IL-1 IL-6, and TGF 1 (Sierra et al., 2007). When stimulated the mice were stimulated with LPS, the isolated microglia from aged mice

PAGE 15

8 produced more of the proinflammatory cytokines TNF, IL-1 IL-6, then the young LPS stimulated mice, but the LPS fold change in cytoki ne production in aged mice was equal to that in young mice. Therefore, microglia from aged anima ls can respond to an inflammatory challenge the same as young mice, but the baseline of cyto kine expression is elevated (Sierra et al., 2007). Age Related Alterations in Adaptive Immunity There is also a decrease in immunological function in the periphery (Miller, 1996; Goronzy and Weyand, 2005). It appears that the age of the T-cell when it first encounters an antigen will determine if a memory response is ac hieved. For example, T-cells from aged rats were able to maintain memory function acquir ed when they were young, but were not able to acquire new memory formation; this was most lik ely due to a lack of proliferative ability (Haynes et al., 2003). Furthermore, aged nave CD4 T-cell s could be stimulated by exogenous IL-2 to induce memory, but once the IL-2 was removed the memory was lost (Haynes et al., 2003). Even as most T-cell function declines with age, the CD4+CD25+ T regulatory (Treg) cells are still able to suppress the activity of young CD4+CD25T helper (Teff/Th) (Nishiok a et al., 2006). Even more important, the CD4+CD25T-cells not only become unresponsive with age they also become suppressive limiting the immune response (Shimizu and Moriizumi, 2003). The CNS does have a reservoir to drain anti gen in the cervical lymph nodes (Cserr and Knopf, 1992). The recruitment of leukocytes can al so take place in postcapillary venules (Hickey, 2001). It has been shown that there are changes to structure and function of the blood-brainbarrier (BBB) as a result of age, which causes an increase in perme ability (Mooradian, 1988, 1994; Morita et al., 2005). Normally, in a young adult in the absence of disease, there is a clear demarcation between the peripheral immune syst em, innate and adaptive, and the CNS immune system with its ‘lone sentinel,’ the microglia. Following an acute stimulation such as a traum atic injury or ischemia, the protective status of the CNS is revoked and peripheral immune cells (dendritic cells and T-cells) can enter into the CNS. The consequences of the invading peripheral immune cells are to either, clear debris and rebuild damaged tissue or exacerbate t he injury. T-cells can be involved in governing the immune response (Kim et al., 2007). T-cell resp onse may act by altering the activity of the microglia and this response is important to ma intain neurogenesis (Kipnis et al., 2004; Butovsky et al., 2006a; Butovsky et al., 2006b; Schwartz et al., 2006a) Injury is not the only time that this immu ne privilege is revoked, in aging you can also find invasion of T-cells and dendritic cells (Sti chel and Luebbert, 2007). Occurring as early as 12 months of age in rats, dendritic cells and Tcells can be found in the brain. These peripheral immune cells, which are absent in young adult ra ts, are found widely distributed throughout the aged rat brain, and are particularly associated with white matter tracks (Stichel and Luebbert, ; Bulloch et al., 2008). What causes this invasion of peripheral immune cells is not entirely known.

PAGE 16

9 The increase of microglia presenting an tigen, as shown by expression of major histocompatibility complex Class II (MHC II), as well as, an increase in the peripheral immune systems professional antigen presen ting cells (dendritic cells) in the aged brain, may be a useless response as the T-cells don’t appear able to re spond to the antigen. The presentation of antigen to T-cells by APCs is futile, as the T-cells do not appear able to respond to the antigen. The lack of an immune response appears to lead to tolerance of T-cells and continued activation of APC, and this futile response could be producing a positive feedback loop of chronic inflammation. Human Umbilical Cord Blood Cells as a Potential Therapeutic The mononuclear fraction of human umbilical cord blood (HUCB) contains a number of cell types including, B-Cells, and T-Cells, monocyt es, as well as, mesenchymal and endothelial progenitor cells. HUCB is also a source of CD34+ hematopoietic stem cells (Bender et al., 1991; Ho et al., 1996; Wu et al., 1999). HUCB cells, particularly the CD34+ stem cells, have in animal models of stroke provided multiple benefits adding in the function recovery after the infarct (Chen et al., 2001; Saporta et al., 2003; Willing et al., 2003; Taguchi et al., 2004; Vendrame et al., 2004; Vendrame et al., 2005; Vendrame et al., 2006b) While HUCB CD34+ stem cell have the potential to differentiate into neurons in vitro when these cells are transplanted into the brain few survive. Previously immunohistochemical analysis direct ed towards a human nuclear antigen (HuNu) has found few HuNu positive cells surviving after t he transplant and the small number of surviving HUCB cells in the brain rules out a direct replac ement of the lost cells as a mechanism for the beneficial effects of HUCB cells (Chen et al., 2001; Vendrame et al., 2004). Taguchi et al. (2004) showed that some of the functional re covery after stroke provided by CD34+ cells was due to enhancement of both neurogenesis and angiogenesi s (Taguchi et al., 2004). The article by Taguchi et al. (2004) is concerned with the neuroge nesis occurring post-stroke in regions of the brain considered non-neurogenic (Taguchi et al., 2004). The effects of HUCB seem to be due to a regul ation of the microenvir onment of the brain, through releasing tropic factors or reducing inflammation and not by direct replacement of cells. It was recently demonstrated that a systemic injection of HUCB ce lls could suppress inflammation in the brain inflammatory response after stroke Moreover, the effects of HUCB cells seemed to shift the cytokine expression from a Th1 respon se to a Th2 response (Vendrame et al., 2004; Vendrame et al., 2005; Vendrame et al., 2006b). Be sides the immune modulatory effects, HUCB cells also produce a number of trophic factors including but not limited to, vascular endothelial growth factor, nerve growth factor, and cytokine colony stimulating factor-1, thrombopoietin, and IL-11 (Suen et al., 1994; Taguchi et al., 2004; Vendrame et al., 2004). Conclusion Neurogenesis is an important means of neural pl asticity that is diminished with increasing age. Neurogenesis from endogenous NPC may provid e an alternative to transplantation of stem cells as a means to replace damaged neural tissue after brain injury, such as stroke, or as a

PAGE 17

10 result of a neurodegenerative condition. A growi ng body of research shows that neurogenesis may occur in ‘non-neurogenic’ regions as a resu lt of a stroke or neurodegenerative disease (Kokaia and Lindvall, 2003). There is also the ho pe of recruiting neural stem cells, from the neurogenic regions of the brain to replace damaged cells after injury (Bernal and Peterson, 2004). Before either strategy of using neurogene sis as a therapeutic source of new cell can be implemented, a better understanding of the regulation of neurogenesis is necessary. During aging and exacerbated in AD, a state of chronic inflammation occurs (Bodles and Barger, 2004; Joseph et al., 2005; Mrak and Griffin, 2005). Inflammation, while not the only cause for the decrease in neurogenesis with age, is very important in regulating neurogenesis (Ekdahl et al., 2003; Monje et al., 2003). To harness the poten tial of neurogenesis to help in brain repair a better understanding of the mechanism of how inflammation is regulating neurogenesis is necessary. While a loss of trophic factors and incr eased corticosteroids are important contributors to the aged niche and have been extensively reviewed (Drapeau and Nora Abrous, 2008) the focus of following chapters of this dissertation ar e limited to the role of inflammation in regulating stem cell function in the aged neurogenic niche.

PAGE 18

11 Fig.1. Microglia: protective or harmful? Microglia are normally in a resting state in which they are actively surveying the microenv ironment of the brain. The micr oglia are resting in the sense that they are not performing effector functions su ch as producing inflammatory mediators like IL1 and TNF When microglia are producing inflammatory mediators the microglia would be considered in a ‘classically activated state or ‘T H1’ state. Microglia can also become ‘alternatively activated’ in such a way that they produce growth factors, such as IGF-1 and TGF The ‘alternatively activated’ microglia can support tissue remodeling and repair. Beyond releasing signaling molecules, microglia also have an important role in phagocytosis. The role of microglia, as protective or harmful, depends upon the ability of the microglia to switch from the different activation states at the appropriate time. Unders tanding how and when to turn microglia ‘on’ or ‘off’ is an important future direction of research This is especially the case with aging where microglia are most need for remodel and repair and to remove damaged cells and misfolded proteins. With age microglia may lose the ability to perform these important effector functions making the aged brain more susceptible to injury and insult.

PAGE 19

12 Paper I Blockade of Caspase-1 Increases Neurogenesis in the Aged Hippocampus Carmelina Gemma 1,2, Adam D. Bachstetter 1, Michael J. Cole 1, Matthew Fister 1, Charles Hudson 2 and Paula C. Bickford 1,2 1 Center of Excellence for Aging and Brain Repair, Dept. of Neurosurgery University of South Florida, 12901 Bruce B. Downs Blvd., Tampa, FL, 33612, USA 2 James A. Haley VA Hospital, 13000 Bruce B. Downs Blvd., Tampa, FL, 33612, US Abstract Adult hippocampal neurogenesis dramatically decreases with increasing age, and it has been proposed that this decline contributes to age -related memory deficits. Central inflammation contributes significantly to the decrease in neur ogenesis associated with aging. Interleukin-1 is a proinflammatory cytokine initially synthesized as an inactive precursor that is cleaved by caspase-1 to generate the biologically active mature form. Whether IL-1 affects neurogenesis in the aged hippocampus is unknown. Here we analyzed cells positive for 5`-bromo-deoxy-uridine (BrdU, 50 mg/kg) in animals in which cleavage of IL-1 is inhibited by the caspase-1 inhibitor AcYVAD-CMK (10 pmol). Aged (22 mo) and young (4 mo) rats received Ac-YVAD-CMK for 28 d intracerebroventricularly through a brain infusi on cannula connected to an osmotic minipump. Starting on day 14, animals received a daily inject ion of BrdU for 5 consecutive days. Unbiased stereology analyses performed 10 d after the last in jection of BrdU revealed that the total number of newborn cells generated over a 5-d period was higher in young rats compared to aged rats. In addition, there was a 53% increa se in the number of BrdU-lab eled cells of the aged Ac-YVADCMKtreated rats compared to aged controls. Immunofluorescence studies were performed to identify the cellular phenotype of BrdU labeled cell s. The increase in BrdU-positive cells was not due to a change in the proportion of cells expressing neuronal or glial phenotypes in the subgranular zone. These findings demonstrate th at the intracerebroventri cular administration of Ac-YVAD-CMK reverses the decre ase in hippocampal neurogenesis associated with aging. Introduction Neurogenesis occurs throughout life, predominant ly in the subgranular zone (SGZ) of the dentate gyrus in the hippocampal formation and in the subventricular zone (SVZ) (Altman and Das, 1965b; Cameron et al., 1993; Eriksson et al ., 1998; Gage, 2002; Lie et al., 2004; Mackowiak et al., 2004; Christie and Cameron, 2006). Neural stem cells in the SGZ give rise to progenitor

PAGE 20

13 cells that migrate into the granule cell layer and differentiate into neuronal or glial phenotypes. Newly generated hippocampal granule cells acquire the morphologic and biochemical properties of neurons, develop synapses on their cell bodies and dendrites, and extend axonal projections along mossy fibers into the hippocampal CA3 region (Hastings and Gould, 1999; Markakis and Gage, 1999; Carlen et al., 2002). These newly gen erated granule neurons are electrically active, fire action potentials, and receive synaptic i nput (Cameron and McKay, 2001; van Praag et al., 2002; Schmidt-Hieber et al., 2004; Overstr eet-Wadiche et al., 2006; Overstreet-Wadiche and Westbrook, 2006) and survive for an extende d period of time (Altman and Das, 1965b). A multitude of factors have been shown to regul ate the production of new neurons in the adult hippocampus. For example, the rate of neur ogenesis decreases with increasing age (Seki and Arai, 1995; Kuhn et al., 1996; Lichtenwalner et al., 2001; Bizon and Gallagher, 2003). Several lines of evidence suggest a correlati on between adult neurogenesis and learning, and it has been proposed that a decline in hippocampal neurogenesis contributes to a physiologic decline in brain function (Gould et al., 1999b; Ambrogini et al., 2000; Kempermann and Gage, 2002; Bizon and Gallagher, 2003; Drapeau et al., 2003; Leuner et al., 2004; Bruel-Jungerman et al., 2005). New and important insights as to the production of new neurons may affect hippocampal-dependent memory ability have been provided by behavioral experiments performed using the Morris water-maze task, which is a hippocampal-dependent memory task used to analyze spatial memory. The learning performance in the water-maze task is characterized by two consecutive phases: an early phase during which the learning performance reaches 80% and a late phase during which the learning performance decreases to 20% after which a stable baseline is reached. Importantly, it has recently been shown that spatial learning in both young and aged rats increases the survival of cells generated before the learning (Gould et al., 1999b)but decreases the survival of cells born during the early phase of learning (Lemaire et al., 2000; Shors et al., 2001; D obrossy et al., 2003; Drapeau et al., 2007). Thus, it seems that the new born cells generated before training may be at the critical period of sensitivity to be rescued by learning. On the other hand, cells generated during the early phase of learning may be too young to be rescued. In rats, numerous conditions that increase adult hippocampal neurogenesis are associated with an increase in learning performan ce (Luine et al., 1994; de Quervain et al., 1998; Bizon and Gallagher, 2003; Drapeau et al., 2003; Mirescu and Gould, 2006). For example, decreases in glucocorticoid levels, which ar e elevated in aged rats, increases neurogenesis (Gould et al., 1998) and spatial memory in the water-maze (Drapeau et al., 2003). Furthermore, injection of N-methyl-D-aspartate receptor ant agonists into aged rats significantly improves memory deficits and increases neurogenesis (Camer on et al., 1995; Nacher et al., 2001; Nacher et al., 2003; Nacher and McEwen, 2006; Nacher et al., 2007). Finally, insulin-like growth factor, fibroblastgrowth factor -2, and endothelial-growth factor decrease with aging, and administration

PAGE 21

14 of these trophic factors increas es neurogenesis in the hippocampus (Beck et al., 1995; O'Kusky et al., 2000; Cheng et al., 2001; Zaman and Shetty, 2002). Likewise, an enriched environment, exercise and caloric restriction or dietary s upplementation with blueberries improve age-related memory deficits and increase neurogenesis (Paylor et al., 1992; Kempermann et al., 1997b, 1998; van Praag et al., 1999; Kempermann et al., 2002; Casadesus et al., 2004; Olson et al., 2006). These observations suggest that the age-re lated decrease in neurogenesis is due to a global, age-related alteration in the microenvironment of the brain. Recent reports indicate that brain inflammation negatively influences adult hi ppocampal neurogenesis (Ekdahl et al., 2003; Monje et al., 2003). Intracortical infusion of lipopolysaccharides (LPS), a potent activator of the inflammatory response, induces an 85% reduction in the number of new neurons in the dentate gyrus SGZ (Ekdahl et al., 2003; Monje et al., 2003) Systemic administration of minocycline, which inhibits microglial activation, restores L PS-induced decreases in neurogenesis. In addition, tumor necrosis factor (TNF ) is involved in the regulation of adult hippocampal neurogenesis (Iosif et al., 2006). Interleukin-1 (IL-1 ) is a proinflammatory cytokine involved in the pathogenesis of several acute and chronic neurod egenerative diseases. There is extensive evidence that IL-1 is constitutively expressed in the br ain, synthesized by neuronal and/or glial cells, and released in response to a variety of stimuli, including immune system activation (Benveniste, 1992; Rothwell et al., 1997). High brain levels of IL-1 are also correlated with natural aging and the development of cognitive dysfunction (Rachal P ugh et al., 2001; Lynch, 2002; Yirmiya et al., 2002). For example, context ual fear conditioning, a hippocampal-dependent memory task, is impaired in aged rats, and admin istration of a nonsteroidal anti-inflammatory drug, sulindac, reversed the impairment and decreased IL-1 levels (Mesches et al., 2004). Almost every cell type is affected by IL-1 acting through its high affinity receptor, IL-1RI (Rothwell et al., 1997; Dinarello, 1998). Binding studies indicate that the hippocampus contains the highest density of IL-1 binding sites (Farrar et al., 1987; Takao et al., 1990). Interleukin-1 is synthesized as an inactive precursor that is cleaved by the protease caspase-1 to generate the mature 17kDa form. Caspases are a family of pr oteases that have a critical role in apoptosis and inflammation and are also implicated in cognition. The caspase family includes inflammatory caspases (caspase-1, 4, 5, 11, and 12), initiator caspases (2, 8, 9, and 10), and executioner caspases (caspase-3, 6, and 7). Caspase-1 (IL-1 converting enzyme) is constitutively expressed in macrophages and microglia and is involved in the activation of both apoptosis and inflammation through the production of IL-1 Caspase-1 inhibition has shown extraordinary promise in multiple disease models. For ex ample, in cerebral ischemia, caspase-1 is neuroprotective by reducing apoptosis and decr easing the production of proinflammatory cytokines (Rabuffetti et al., 2000). Recently we demonstrated that caspase-1 inhibition significantly improves hippocampal-dependent c ontextual memory function by inhibiting IL-1

PAGE 22

15 TNF and caspase-3 activity in the hippocampus (Gould et al., 1999b). Here we demonstrate that inhibition of caspase-1 activity increase d hippocampal neurogenesis in the aged brain. Material and Methods Animals. All experiments were performed in accordan ce with the National Institutes of Health Guide and Use of Laboratory Animals. Surgical procedure and treatments. The study used male Fischer 344 rats (NIA contract colony, Harlan Sprague Dawley, Indi anapolis, IN). Rats were housed in pairs and maintained in environmentally controlled chambe rs on a 12:12-h light-dark cycle at 21 1 C. Food and water were provided ad libitum We used groups of 8 aged (20 mo) or 8 young (4 mo) rats (4 subgroups = old caspase -1 inhibitor (Ac-YVAD-CMK), old controls, young Ac-YVAD-CMK, young controls). The rats were implanted intr acerebroventricularly (icv) with a brain infusion cannula in the left lateral ventricle and an osmotic minipump (Alzet, Model 2004 pumping rate, 0.25 l/h; total volume 200 l) for 28 d. Before implantation, the pumps were incubated in sterile saline for at least 48 h at 37 C to prime the pumps. For implantati on, rats were anesthetized with isofluorane and placed into a stereotaxic frame. A guide cannula was stereotaxically implanted in the left ventricle (AP = -1.0 mm; ML = 1.6 mm, DV = -3.5) and connected to the osmotic minipump, which was inserted subcutaneously. Pumps were weighed before implantation and at the end of the experiment to ensure complete deliver y of their content. The caspase-1 inhibitor, Ac-YVAD-CMK (10 pmol/200 l; Calbiochem, La Jolla, CA), was injected (0.25 l/h) through the cannula which was connected to the filled minipump. The infusion started the day of the surgery and continued for 28 d. Control animals receiv ed the same volume of 0.6% DMSO (Sigma Aldrich, St. Louis, MO) in saline. Rats rece ived a daily injection of BrdU (Sigma; 50 mg/kg ) once a day for 5 d beginning on 14 d after surgery. Ra ts were sacrificed 10 d following the last injection of BrdU (28d post-surgery). Rats were then perfused transcardially with saline followed by 4% paraformaldehyde in PBS. The brains we re removed and postfixed overnight and then moved to 30% sucrose in PBS prior to sectioning on a cryostat. BrdU staining procedure : Cryostat sections were cut in the sagittal plane (40 m), collected in a cryoprotectant solution (30% ethylene glycol, 30% glycerol in 0.01 M PBS), and stored at –20 C until processed. In preparati on for an unbiased stereologic estimate of neuronal numbers, an initial tissue section was selected r andomly at one anatomic border of the brain region to be examined. Thereafter, every 3rd se ction throughout the anatomic region of interest was used for each staining series. For the i mmunohistochemistry staining procedure, selected sections were floated individually in plastic multiw ell carriers with nylon net bottoms. Free-floating sections (40 m) were pretreated with 50% formamide/2X SSC (0.3 M NaCl, 0.03 M sodium citrate) at 65C for 2 h, rinsed in 2X SSC, inc ubated in 2 N HCL for 30 min at 37C, and washed with borate buffer (pH 8.5). After washing with PBS three times, endogenou s peroxidase activity

PAGE 23

16 was quenched by incubating in 0.3% H2O2 solution, followed by a 1h incubation in blocking solution (0.1 M PBS supplemented with 3% nor mal horse serum and 0. 25% Triton X-100). Sections were then incubated overnight with mouse-anti-rat-BrdU (1:50; Roche) in PBS supplemented with 3% normal horse serum and 0. 1% Triton X-100. Sections were washed and biotinylated secondary antibody (1:200; Vect or Laboratories, Burlingame, CA) in PBS supplemented with 3% normal horse serum and 0.1% Triton X-100 was applied for 1 h. The sections were incubated for 60 min in avidin-bioti n substrate (ABC kit, Vector Laboratories). All sections were incubated for 3 min in DAB solution (Vector Laboratories). Sections were mounted onto glass slides and coverslipped with mounting medium. OX-6 staining procedure : Immunohistochemistry was performed on every six section throughout the dentate gyrus. Free-floating sections were processed individually for immunoreactivity to the MHC Class II Ia antibody OX-6 in plastic 24-well plates (Corning, Inc., Corning, NY). Sections were rinsed in 0.1 M PBS, pH 7.4. Three 5-min washes were conducted between steps except where indicated. Control sections not exposed to primary or secondary antibodies were prepared simultaneously. After equ ilibrating tissue sections in washing solution, endogenous peroxidase acti vity was quenched by incubating the sections in 0.1M PBS containing 0.3% H2O2 for 15 min. Background labeling was bl ocked by 1 h incubation in PBS containing 10% normal horse serum and 0.05% TX-100. Sect ions were then incubated overnight with mouse-anti-ratOX-6 (Pharmingen, San Diego, CA; 1:750) in PBS containing 3% horse serum and 0.025% TX-100. After incubation in prim ary antibody, the sections were washed and incubated for 60 min in biotinylated horse antimouse secondary antibody (Vector Laboratories, Burlingame, CA; 1:300) diluted in washing soluti on containing 3% normal horse serum and 0.3% TX-100. Sections were then incubated for 90 min in avidin-biotin “ABC Elite” substrate (Vector Laboratories, Burlingame, CA). The sections were then rinsed three times for 10 min each in PBS. Color development was performed in a standar dized manner such that all sections were developed in the same reagents for identical periods of time to allow for comparisons of fiber staining intensity. All sections were incubat ed for 3 min in diaminobenzidine solution (Vector Laboratories). Sections were mounted onto glass slides and cover slipped with aqueous mounting medium. Stereology BrdU cells were examined with a Nikon Eclipse 600 microscope and quantified using Stereo Investigator software, Versio n 6 (MicroBrightField, Colchester, VT). Cells were counted within two cell diameters below t he SGZ using the optical fractionator method of unbiased stereologic cell counting (West et al., 1991). The sampling was optimized to count at least 250 cells per animal with error coefficient s of less than 0.07. Each counting frame (75 x 75 m) was placed at an intersection of the lines forming a virtual grid (100 x 100 m), which was randomly generated and placed by the software within the outlined structure.

PAGE 24

17 Stereologic estimation of the total nu mber of OX-6 immunolabeled cells: The dentate gyrus was outlined and analyzed. OX-6 posit ive cells in the dentate gyrus were counted using the optical fractionator method of unbiased stereologic cell counting techniques. Optical disectors were 100 m x 100 m. The sampling was optimized to sample at least 150 counted cells per animal. Each counting frame was placed at an intersection of the lines forming a virtual grid (200 m x 200 m) that was randomly generated and randomly placed by the software within the outlined structure. OX-6 labeled cells were counted using a 60X oil lens (NA 1.4) and were included in the measurement only when they came in to focus within the disector (disector height of 20 m and the average thickness of mounted sect ions was 30 m; thickness was measured at random intervals throughout every section and estimated by the software program). Immunofluorescence procedure: Immunofluorescence double labeling was performed to determine the phenotype of BrdU positive cells. Tissues were pretreated with 2 N HCL for 2 h at room temperature, washed, and incubated in blocking solu tion (0.1 M PBS containing 10% goat serum and 0.3% Triton X-100) for 1 h at room temperature. Tissues were then incubated in rat anti-BrdU (1:400; Accurate Chemical, Westbury NY) overnight at 4C. Tissues were rinsed three times in PBS and goat anti -rat secondary antibody conju gated to Alexa 594 (1:800; Molecular Probes, Eugene, OR) was applied for 1 h. Following 6 washes, one of the following primary antibodies was applied overnight at 4C: ra bbit anti-GFAP (1:500; Dako, Carpinteria, CA), mouse anti-NeuN (1:100; Chemicon, Temecula, CA), TuJ1 (1:800; Covance), rabbit cleaved caspase -3 (1:100; Cell Signaling, Danvers MA). Tissues were washed three times with PBS and species-appropriate secondary antibody conjugat ed to Alexa 488 (Molecular Probes) was applied for 2 h at a 1:200 dilution (anti-GFAP secondary was applied for 1 h at a dilution of 1:800). Following six washes in PBS, tissues were mount ed on slides and covers lipped using Vectashield (Vector Labs). To calculate the percentage of each phenotype with respect to the number of BrdU-labeled cells, the total number of BrdU-labeled cells and their respective phenotypes for each animal were scored in at least six or more sect ions of a one-in-six series. The results from each section were summed, and the percent age for each marker was calculated. These percentages were then expressed as the average of 4 to 6 animals. Colocalization of BrdUpositive cells with GFAP, TuJ1, NeuN, and caspase-3 was validated using a DMI6000 inverted Leica TCS SP5 tandem scanning confocal microscope with a 63x/1.40NA oil immersion objective. 405 diode, 488 Argon and 546 laser lines were applied to excite the samples using AOBS line switching to minimize crosstalk between fluorochr ome. Images and Z-stacks were produced with three cooled photomultiplier detectors and t he LAS AF version 1.5.1.889 software suite. Statistical analysis: Data are expressed as the mean standard error of the mean (SEM). Analyses were performed using a two-way ANOVA followed by Fisher’s LSD post-hoc analysis to identify significant effects. Differences were considered significant at p 0.05; ** p

PAGE 25

18 0.001. A two tail unpaired t-test was performed to i dentify significant differences in the number of 0X-6 immunolabeled cells between aged treated and aged control rats. Results Chronic administration of Ac-YVAD-CMK increases the number of BrdU-postive cells in the subgranule cell layer of the hippocampus. We previously demonstrated that infusion of the caspase-1 inhibitor Ac-YVAD-C MK significantly ameliorates impairment of hippocampal-dependent memory by decreasing casp ase-1 and caspase-3 activity, as well as protein levels of IL-1 and TNF in the aged rat hippocampus compared to controls (Gemma et al., 2005).The aim of the present study was to in vestigate whether the age-dependent increase in hippocampal IL-1 affects the age-related decrease in hippocampal neurogenesis. The effects of a 28 -d infusion of Ac-YVAD-CMK (10 pmol) on cell differentiation in the SGZ in young (4 mo) and aged (20 mo) F344 rats was determined by analyzin g 5’-bromo-deoxy-uridine (BrdU) staining 10 dafter the last BrdU injection. Figure 2 show s that BrdU labeled cells in both young and aged rats were primarily located on the border of the granule cell layer. Unbiased stereologic quantification of total BrdU -labeled cells in t he SGZ revealed that the number of newborn cells generated over a period of 5 d was much higher in young than in aged rats. The results were subjected to a 2 (age: young, aged) X 2 (treatmen t: saline, caspase-1 inhibitor) factorial ANOVA (Fig. 3). There was a significant effect of age (F (1, 13) = 76.84, p < .001), but no significant effect of treatment (F (1, 13) = 1.13, p = .306). Further, the age X treatment interaction was not statistically significant (F (1, 13) = 2.37, p = .148). Although the interaction was not statistically significant, the means clearly indicate that the response of the aged animals was different from that of the young animals to caspase-1 inhibition. The lack of interaction was likely due to the fact there was no treatment effect in the young animals and therefore the interaction itself was not that strong. Despite the lack of a significant intera ction, we compared the treatment effects for the young and aged animals separately, but corrected fo r multiple comparisons because the original interaction was not statistically significant. T he results confirmed that there was no treatment effect in the young animals (F (1, 6) = .06, P < = .822), but the effect in the aged group was statistically significant (F (1, 7) = 19.13, P = .003). There was an increase of 53% in the number of BrdU labeled cells in the SGZ of aged rats compared to aged controls. This was a substantial increase in neurogenesis, however, it was only 39% of the neurogenesis observed in young control rats. Determination of neuronal and glial phenotypes of BrdU labeled cells in the subgranule cell layer of the hippocampus. We then determined the phenotype of the newly born cells using the neural nuclear protein NeuN and immature neural marker TuJ1. We found that there was no difference in the proportion of BrdU – labeled cells expressing neuronal or glial phenotype in the SGZ between aged treated and aged control rats (Fig. 4). Our analysis

PAGE 26

19 revealed that 54% of BrdU labeled cells in the aged control animals expressed NeuN, while the percentage of BrdU/NeuN positive cells in the aged treated rats increased to 73% (Tab. 1). The immature neural marker TuJ1 was expressed in 43% of BrdU labeled cells in aged treated rats and 38% of cells in aged control rats. We then examined if there was a change in the glial phenotypes. We found that very few BrdU-labeled cells were positive for glial fibrillary acidic protein (GFAP; 4% control rats and 3% treated rats). Because BrdU is a marker of DNA synthesis, there is a possibility that BrdU label ed cells are undergoing apoptotic cell death; thus, to investigate this possibility, we double-labeled the BrdU cells with caspase-3 We found that only 6.5% and 5% of BrdU positive cells expres sed caspase-3 in the control and treated rats respectively. When the percentage of each phenotype was summed, it revealed a number greater than 100%, indicating that cell s express more than one phenotype. Ac-YVAD-CMK decrease microglia activation. Because IL-1 activates microglia and activated microglia produce IL-1 we explored whether the Ac-YVAD-CMK-induced increase in neurogenesis was accompanied by changes in microglial activation. Microglia were identified by OX-6 a marker for the major histocompatibility complex class II antigen expressed by activated microglia. Stereological counting was performed on OX-6 labeled cells ex pressed in the dentate gyrus. The stereologic cell count of OX-6 positive cells revealed that caspase-1 inhibition caused a significant decrease in the number of OX-6 positive cells in the aged treated dentate gyrus compared to controls (Fig. 5; p <0.01). Interestingly, as shown in Figure 5B and 5C, a clear morphological difference in the OX-6 positive cells phenotype was observed between treated and non-treated animals. In the non-treated animals microglia were characterized by highly ramified branching, indicating an activated state. In t he treated animals, microglia were characterized by long thin branches which indicate a more quiescent and resting state. We were unable to detect enough OX-6 positive cells in the hippocampus of yo ung animals to perform a stereologic study. Discussion The present study explored whethe r the age-related increase in IL-1 contributes to the decrease in hippocampal neurogenesis associated with aging. To examine this hypothesis, we used the irreversible caspase-1 inhibitor AcYVAD-CMK to block caspase-1 activity, which is known to be responsible for the production of the active mature form of IL-1 Consistent with the results of previous studies (Seki and Arai 1995; Kuhn et al., 1996; Gould et al., 1998; Lichtenwalner et al., 2001; Bizon and Gallagher, 2003), we show that neurogenesis is dramatically reduced in aged animals. In addi tion, we provide new evidence that chronic inhibition of caspase-1 activity increases t he number of newborn cells in aged SGZ. The percentage of the newly generated cells in t he aged treated SGZ that differentiated into neural phenotypes, such as NeuN and TuJ1, however, rema ins similar to that observed in aged control animals. This finding is in agreement with previous data showing that newly born cells in the aging dentate gyrus have a normal neuronal fate (Rao et al., 2006; Hattiangady and Shetty,

PAGE 27

20 2008). Whether the increase in neurogenesis observed in the present study is due to an increase in cell proliferation or to protection and surv ival of the newly gene rated neurons cannot be explained by the present data. Future studies looking at cell proliferation will help us to clarify this point. Consistent with the detrimental role of inflammation on adult neurogenesis, Monje et al. (2003) reported that systemic adm inistration of LPS in adult female rats inhibits hippocampal cell proliferation and this effect is completely bl ocked by the administrati on of a non-steroidal antiinflammatory drug. Upregulation of IL-1 and activation of microglia occur during normal aging and accompany many neurodegenerative diseases. Co ncomitant with an increase in neurogenesis in aged treated rats, we observed a decrease in t he number of activated microglia in the dentate gyrus. A negative correlation between the degree of inflammation, indicated by the activation of microglia, and the number of newborn neurons was previously reported (Ekdahl et al., 2003; Monje et al., 2003). Thus, a decrease in microglial activation could also account for the restorative effect of caspase-1 inhibition on neuro genesis. We observed a dramatic increase in the number of BrdU labeled cell in the SGZ of aged treated rats compared to controls. Even with this substantial increase, however, neuroge nesis remained substantially lower (39%) than in young control rats. This finding raises the que stion of whether neurogenesis is functionally important. Interesting, the same dose of Ac -YVAD -CMK completely reverses the impaired cognition associated with aging (Gemma et al ., 2005). Recently Rao et al (2006) demonstrated that the largest decrease in hippocampal neur ogenesis occurs between 7.5 months and 12 months of age, which corresponds to the perio d of adult-to-middle age, and there is a small decline from 12 to 24 months of age (Rao et al ., 2006). The authors suggest that there may be a threshold of minimal levels of neurogenesis that oc curs in the adult brain below which declines in neurogenesis become detrimental, such as that ob served at 24 months of age. If this hypothesis is correct the increase in neurogenesis observed in this report, although not back to that observed in very young animals, may be sufficient to cross above the threshold of minimal neurogenesis allowing for proper function of the adult brain. In light of the results presented in this study, we postulate that the increase in newborn neurons induced by caspase-1 inhibition might stimulate endogenous mechanisms responsible for behavioral improvement. Multiple mechanisms might underlie the effe ct of caspase-1 activity on hippocampal neurogenesis in the aged brain. In a previous re port, we have shown that the administration of Ac-YVAD-CMK at the same dose used in the pres ent study induced a 70% decrease of caspase1 activity and a 50% reduction of IL-1 protein in the hippocampus of aged rats (Gemma et al., 2005). One possibility is that the increased numbe r of newborn neurons observed here is due to the inhibition of IL-1 The effect of IL-1 most likely depends on several factors. For example, IL-1 activation triggers a cascade of molecular event s that culminates in the alteration of other

PAGE 28

21 proinflammatory cytokines, activation of pros taglandins, increases in glucocorticoids, and activation of apoptosis. All these factors have be en shown to decrease neurogenesis. Thus, we cannot rule out the possibility that more than one mechanism is responsible for the beneficial effects of caspase-1 inhibition on neurogenesis. Caspase-1 is involved in the activation of both apoptosis and inflammation. One important issue is whether the neuroprotective effects of caspase-1 inhibition on neurogenesis proceed exclusively via a cytokine-dependent pathw ay or whether its involvement in apoptosis is more critical. We previously demonstrated that the inhibition of caspase-1 decreases hippocampal IL-1 levels and caspase-3 activity (Gemma et al., 2005). Whether the decrease in caspase-3 activity is a downstream effect of IL-1 inhibition or whether caspase-1 directly regulates caspase-3 activity cannot be determined in the present experiments Thus, the possibility that the neuroprotective effects of ca spase-1 inhibition are a net consequence of a decrease in apoptosis cannot be ruled out. However, the observation that caspase-1 knockout mice develop normally, with no apparent physi ologic or morphologic aberrations, however, suggests that caspase-1 has no major role in programmed cell death during development Although the results presented here show a clear e ffect of the caspase-1 inhibitor Ac-YVAD-CMK on hippocampal neurogenesis, it is important to point out that in the present study we did not measure the hippocampal activity of caspase1 or the hippocampal protein levels of IL-1 after the administration of Ac-YVAD-CMK; thus, we can only assume that the administration of AcYVAD-CMK led to a decrease in the caspase-1 activity which led to a decrease in IL-1 protein levels. Thus, additional effects of Ac-YVAD-CMK in the brain may be respon sible for the increase in hippocampal neurogenesis. Indeed, it has been sh own Ac-YVAD-CM can exert neuroprotective effects without affe cting caspase-1 activity and IL-1 levels. For example, the administration of Ac-YVAD-CMK counteract the gp-120-i nduced cytosolic cyto chrome c elevation without affecting IL-1 levels (Corasaniti et al., 2005). Furthermore, Ac-YVAD-CMK has been shown to protect against oxygen and glucose d eprivation-induced cell death in organotypic cultures of rat hippocampal slices independently from IL-1 inhibition (Ray et al., 2000). In conclusion, the findings in the present study demon strated that the chronic intracerebroventricular administration of Ac-YVAD-CMK reverses the age -dependent decrease in hippocampal neurogenesis. Further studies need to be conducted in order to investigate in more detail the molecular and cellular mechanism underlying the effect of Ac-YVAD-CMK on hippocampal neurogenesis in the age rats. Acknowledgements This work was supported by the National Institutes of Health (AG024165A, AG04418) and the VA Medical Research Service. We wish to thank Dr. Small Brent for his assistance in the statistical analyses of the results presented in this work. This work was supported in part by the

PAGE 29

22 Analytic Microscopy Core facility at the H. Lee Mo ffitt Center and Research Institute. We wish to thank Dr. Daniel Peterson for his valuable advises in the stereological analysis of the neurogenesis data. Table 1: To calculate the percentage of each phe notype with respect to the number of BrdU-labeled cells, the total number of BrdU la beled cells and their respective phenotypes were scored in six or more sections of a one-in six series were scored. The percentages were then expressed as an average of 4 to 6 animals. Expressed as percentage of BrdU

PAGE 30

23 Figure 2. Inflammation decreases basal hippocampal neurogenesis. Immunohistochemical staining for BrdU positiv e cells (20X) in the dentate gyrus after 28 d intracerebroventricular in fusion of vehicle or Ac-YVAD-CMK in young control rats and aged rats. A. Young control rats; B. Aged control rats ; C. Aged treated rats. BrdU was injected intraperitoneally once a day for 5 consecutive day s, and the rats were killed 10 d after the last injection of BrdU. Note the presence of BrdU immunoreactive nuclei located in the subgranular zone. The number of BrdU-positive cells was dramatically lower in aged rats.

PAGE 31

24 Figure 3. Inhibition of caspase-1 at tenuates the decrease in hippocampal neurogenesis associated with aging. Stereologic quantification using an optical fractionator of BrdU-positive cells in young and aged rats follo wing 28 d intracerebroventricular infusion of vehicle or Ac-YVAD-CMK. The results were subj ected to a 2 (age: young, old) X 2 (treatment: saline, caspase-1 inhibitor) factorial ANOVA. The results indicate a significant effect of age (F (1, 13) = 76.84, p < .001), but no significant effect of treatment (F (1, 13) = 1.13, p = .306). Further, the age X treatment interaction was not stat istically significant (F (1, 13) = 2.37, p = .148). Multiple comparison of Ac-YVAD-CMK effect for the young and aged rats re vealed that there was no treatment effect in the young animals (F (1, 6) = .06, p = .822), but the effect in the old group was statistically significant (F (1, 7) = 19.13, p = .003).

PAGE 32

25 Figure 4. Representative confocal micrograph of BrdU-labeled newborn cells (BrdU, red) and their respective phenotypes (green) in the subgranular zone. A, B and C. Overview of GFAP, NeuN and TuJ1 expression in the SGZ. D and E. Single confonfocal plane of the same cell, showing co-l ocalization of NeuN+ (g reen), BrdU+ (red) and BrdU+/NeuN+ (orange) cells and TUJ1+ (green), BrdU+ (red) and BrdU+/Tu J1+ (orange), in the SGZ of Ac-YVAD-CMK treated rats. Newly formed double-labeled neurons are visualized by using confocal microscopy in an orthogo nal projection composed of 25 optical z -planes (0.5mm thick).

PAGE 33

26 Figure 5. Inhibition of caspase-1 significantl y reduced microglia activation. A Stereologic quantification using an optical fractionator of the number of OX-6 positive cells in the dentate gyrus of aged control and aged AC-YDAV-CMK treated rats. B and C are representative photomicrograph of OX-6 pos itive staining (10X) in the dentate gyrus of aged control rats (B) and AC-YVAD-CMK treated rats (C). Note the mor phological difference of OX-6 positive cells between treated and non treated animals.

PAGE 34

27 Paper II Peripheral injection of human umbilical cord blood stimulates neurogenesis in the aged rat brain Adam D. Bachstetter1,2, Mibel M. Pabon 1,2, Michael J. Cole2, Charles E. Hudson3, Paul R. Sanberg1,2,4, Alison E. Willing1,2, Paula C. Bickford 1,2,3 and Carmelina Gemma1,2,3 1Department of Molecular Pharmacology and Physiol ogy, University of South Florida, College of Medicine, Tampa, FL 33612, USA 2Department of Neurosurgery, C enter of Excellence for Aging a nd Brain Repair, University of South Florida, College of Medicine, Tampa, FL 33612, USA 3James A. Haley Veterans Administration Hospital, Tampa, FL 33612, USA 4Saneron CCEL Therapeutics Inc., Temple Terrace, FL 33617, USA Abstract Neurogenesis continues to occur throughout life but dramatically decreases with increasing age. This decrease is mostly related to a decline in proliferative activity as a result of an impoverishment of the microenv ironment of the aged brain, in cluding a reduction in trophic factors and increased inflammation. We det ermined that human umbilical cord blood mononuclear cells (UCBMC) given peripherally, by an intravenous injection, could rejuvenate the proliferative activity of the aged neural stem/progenito r cells. This increase in proliferation lasted for at least 15 days after the delivery of the UC BMC. Along with the increase in proliferation following UCBMC treatment, an increase in neur ogenesis was also found in the aged animals. The increase in neurogenesis as a result of UCBMC treatment seemed to be due to a decrease in inflammation, as a decrease in the number of activated microglia was found and this decrease correlated with the increase in neurogenesis. The results demonstrate that a single intravenous injection of UCBMC in aged rats can signific antly improve the micro environment of the aged hippocampus and rejuvenate the aged neural st em/progenitor cells. Our results raise the possibility of a peripherally administered cell t herapy as an effective approach to improve the microenvironment of the aged brain. Introduction Aging is accompanied by a process of cellu lar senescence that occurs throughout the body, resulting in a decrease in the regenerative pot ential of the stem cell pools (Collado et al., 2007). In the brain there are two stem cell pools, one residing in the subventricular zone (SVZ), and the other in the subgranular zone (SGZ) of t he dentate gyrus of the hippocampus. As in other

PAGE 35

28 stem cell pools such as the hemapoietic pool in the bone marrow or the satellite stem cells in the muscle, the stem cells in the brain lose there ca pacity to generate new cells with age (Kuhn et al., 1996; Cameron and McKay, 1999; Kronenberg et al ., 2006b). In the brain it appears that the decrease in neurogenesis is a result of a decrease in proliferation of the stem cells and not due to a loss of the cells (Hattiangady and Shetty, 2006). In the muscle it has been shown that the stem cells can be rejuvenated by exposure of the cells to the systemic environment of a young animal through parabiosis (Conboy et al., 2005). Even though it has been known since the 1960s that a cellular senescence occurs with age (Hayflick and Moorhead, 1961), it is less clear if this cellular senescence leads to an aging phenotype, particularly to the age related cognitive decline. However, it is clear that the process of cellular senescence that occurs with age is an important mechanism to protect against cancer. There are a number of tumor-supressor genes, including p53 and p16ink4A which respond to cellular stressors to induce senescence (Campisi, 2005). It has recently been sh own that knocking out p16ink4A can restore the proliferative potential of the aged neural stem cells (Molofsky et al ., 2006), but the animals have decreased longevity due to tumor formation (Beausejour and Campisi, 2006). This demonstrates the important balance that oncogenes play in protecting or ganisms from cancer, but with the negative consequence of inducing an aging state of cellular senescence. An effective target to lessen the amount of senescence might be the cellular stressors that accumulate with age which include telomere shorting (Collado et al., 2007), oxidat ive stress (Harman, 1956; Ames and Shigenaga, 1992; Ames et al., 1993), inflammation (Blalock et al., 2003), increased corticosteroid levels (Sapolsky, 1992), and a decrease in a number of trophic factors including brain-derived neurotrophic factor (BDNF), vascular endothelial growth factor (VEGF), Insulin-like Growth Factor-1 (IGF-1) and fibroblast growth factor 2 (F GF-2) (Hattiangady et al., 2005; Shetty et al., 2005). A potent cellular stressor that is increase d with age is inflammation. Recently, our laboratory has shown that reducing neuroinflammati on in aged rats by blocking the conversion of pro-IL-1 to IL-1 through inhibition of the converting enzyme caspase-1 rescued some of the age-related decrease in neurogenesis (Gemma et al., 2007a) and resulted in an improvement in cognitive function (Gemma et al., 2005). We believed that human umbilical cord blood mononuclear cells (UCBMC) may have a similar potenti al to restore some of the loss in capacity of the neural stem/progenitor cells ability to proliferate and differentiate into neurons. In an animal model of stroke, UCBMC administered intravenously have reduced infarct volume and improved functional recovery on behavioral measures (Vendrame et al., 2004). The effects of UCBMC have been attributed to changes in the microenvironment of the brain, through the release of trophic factors or by reducing infla mmation, and not by a direct replacement of cells (Borlongan et al., 2004; Vendrame et al., 2005; Newman et al., 2006). UCBMC contains a number of cell types including B-Cells and T-Cells, as well as, mesenchymal and endothelial

PAGE 36

29 progenitor cells. UCBMC is also a rich source of CD34+ hematopoietic stem cells (Bender et al., 1991; Ho et al., 1996; Wu et al., 1999). It was recent ly demonstrated that a systemic injection of UCBMC cells could suppress inflammation in the br ain following stroke. Moreover, the effects of UCBMC cells seemed to shift the cytokine expression from a Th1 response to a Th2 response (Vendrame et al., 2004; Vendrame et al., 2005; Vendrame et al., 2006a). In addition to the immune modulatory effects, UCBMC cells also produce a number of trophic factors including, but not limited to, VEGF, nerve growth factor, and cytokine colony stimulating factor-1, thrombopoietin, and IL11 (Suen et al., 1994; T aguchi et al., 2004; Vendrame et al., 2004). The goal of the present study was to det ermine if UCBMC could stimulate the endogenous stem/progenitor cells to regenerate new cells. To this end, young and aged rats were intravenously administered a single dose of UCBMC to determine if UCBMC could increase proliferation of the neural stem/progenitor cells as well as to determine if there would be an effect on neurogenesis in the aged rats. This study provi des insight into how the aged stem cell niche could be rejuvenated. Furthermore, as the UCBMC are administered minimally invasively this study raises the possibility of a clinica lly applicable therapeutic for the aged brain. Material and Methods Cell preparation: Cryopreserved human umbilical cord blood mon onuclear cells (UCBMCs) were obtained from Saneron CCEL Therapeutics, Inc. (Tampa, FL, USA). Cryopreserved Human peripheral blood cells (PBMC) (mononuclear fraction) were obtained from AllCells, LLC (Emeryville, CA, USA). Just prior to intravenous (i.v.) injection, the UCBMC or PBMC were thawed into media (Hanks' balanced salt solution, HBSS, Gibco) at 37C, washed, and the number of viable cells was determined using the trypan blue exclusion method (Vendrame et al., 2005). Cell viability ranged from 85 to 88%. Cell concentration was adjusted to 106 viable cells/500 l. Rats were then anesthetized with 3% isofluorane and randomly chosen to receive a single i.v. injection via the penile vein of UCBMC at a dose 106 cells shown most effective in a stroke model (Newman et al., 2006), 106 PBMC, or media for both the aged and young rats. Animals: All experiments were conducted in accordan ce with the National Institute of Health Guide and Use of Laboratory Animals, and we re approved by the Institutional Animal Care and Use committee of the Universi ty of South Florida, College of Medicine. Male Fisher 344 (F344) rats (NIA contract colony, Harlan Spra gue Dawley, Indianapolis, IN), were pair-housed in environmentally controlled conditions (12:12h li ght:dark cycle at 211C) and provided food and water ad lib Two age groups of animals young (3 months old) and aged (20 months old) were used in this study. The mean life span of the F344 rats is approximately 29 months with a maximal life span of 36 months (Coleman et al., 1977). Rats were then divided in three groups. Group 1 received 50 mg/kg of bromodeoxyuridine (5bromo-2-deoxyuridine, BrdU; Sigma, St. Louis, MO, USA), intraperitoneal (i.p.) twice a day

PAGE 37

30 beginning 24 hours the injection of UCBMC, and we re sacrificed the subsequent day. Rats in group 2 received BrdU (50 mg/kg, i.p.) twice a day, beginning fourteen days after the administration of UCBMC and were sacrificed on t he following day. Rats in Group 3 received BrdU (50 mg/kg, i.p.) for five consecutive day s, beginning the day after the administration of UCBMC and were the sacrificed day fifteen. Tissue collection and processing: The rats were anesthetized with pentobarbital (50 mg/kg, i.p.). Blood was collected by cardiac punctu re and smears were made of the blood to look for the presence of the transplanted cells. The rats were transcardiac perfusion with phosphatebuffered (PB), followed by 4% paraformaldehyde in PB. The brains were postfixed in 4% paraformaldehyde for 12 h, after which they were transferred into 30% sucrose in phosphatebuffered saline (PBS) for at least 16 h, and stored at 4C. Exhaustive caudal sections of the left hemisphere were made, at 40 m using a Microm cryostat (Ric hard-Allan Scientific, Kalamazoo Michigan) and stored in cryoprotectant at 4C. BrdU Immunohistochemistry: All immunohistochemical staining was conducted on free-floating sections for every sixth section for the entire hippocampus beginning with a random start and including sections before and after the hi ppocampus to ensure that the entire structure was sampled; with one exception, in the aged animals from group 3 a one in three series was stained to allow for sampling of an adequate number of BrdU+ cells. For BrdU staining, sections were pretreated with 50% formamide/2X SSC (0.3 M NaCl, 0.03M sodium citrate) at 65C for 2 hours, rinsed in 2X SSC, incubated in 2N HCL for 30 minutes at 37C, washed with borate buffer (pH 8.5), then PBS. This was followed by quenc hing endogenous per oxidase activity in 0.3% H2O2 solution in 30% methanol; then one hour in blocking solution (0.1M PBS supplemented with 3% normal horse serum and 0.25% Triton X-100: PBS-TS); followed by incubation overnight with mouse-anti-rat-BrdU (1:100; Roc he) in PBS-TS. The following day the sections we re washed and then incubated for one hour in a biotinylated se condary antibody (1:200; Vector Laboratories, Burlingame, CA) in PBS-TS; then washed before on e hour incubation in av idin-biotin substrate (ABC kit, Vector Laboratories, Burlingame, CA); and then washed before 10 minutes incubation in DAB solution (Vector Laboratories, Burlingame, CA). Sections were then mounted onto glass slides and coverslipped with mounting medium. Doublecortin and OX-6 Immunohistochemistry: Doublecortin (DCX) is a marker of migrating neurons that is expressed for approximat ely three weeks after the cell is born and has been shown to be a reliable indicator of neurogenesis (Rao and Shetty, 2004; Couillard-Despres et al., 2005). For DCX immunohistochemistry a polyclonal goat antibody raised against human DCX (1:200; SC-8066, Santa Cruz biotechnology, Santa Cruz, CA, USA) was used following a similar protocol to BrdU except the antigen retrieval steps were omitted and Goat serum (Vector Laboratories, Burlingame, CA) was used instead of horse serum. For OX-6 immunohistochemistry a monoclonal antibody dire cted against the rat major histocompatibility II

PAGE 38

31 (MHCII) (RT1B, Becton, Dickinson Pharmingen, San Diego, CA, USA) was used at a concentration of 1:750 in place of the other prim ary antibodies all other steps were the same. Immunofluorescence: Tissues were pretreated with 2N HCL for 2 hours at room temperature, washed, and incubated in blocking solution (0.1M PBS containing 10% goat serum and 0.3% Triton X-100) for 1 hour at room temper ature. Tissues were then incubated in rat antiBrdU (1:400; Accurate Chemical, Westbury, NY ) and additional primary antibodies [anti-GFAP (1:500; Dako, Carpinteria, CA), mouse anti-NeuN (1:100; Chemicon, Temecula, CA), mouse antiTUJ1 (1:800; Convance, Berkeley, CA)], overnight at 4C. Tissues were then rinsed 3 times in PBS and the appropriate seco ndary antibody conjugated to an Alexafluor probe (Molecular Probes, Eugene, OR) wa s applied for 2 hour. Following 6 wash es in PBS, tissues were mounted on slides and coverslipped using Vectashield (Vector Labs, Burlingame, CA). Human Nuclei immunofluorescence: To detect for the presence of the transplanted cells, blood smears and tissue sections were st ained with a mouse monoclonal antibody that recognizes Human Nuclei antigen (HuNu) (MAB 128 1; 1:50; Chemicon, Temecula, CA ), and does not react with rat nuclei. Prior to incubat ion overnight at 4C in the HuNu antibody, the samples were washed in PBS and incubated in bl ocking solution (0.1M PBS containing 10% goat serum and 0.3% Triton X-100) for 1 hour at room temperature. The HuNu antibody was visualized by secondary antibody conjugated to an Alexaf luor probe (Molecular Probes, Eugene, OR). Quantification and imaging: To determine cell numbers the optical fractionator method of unbiased stereological cell counting techniques (West et al., 1991) was used with a Nikon Eclipse 600 microscope and quantified using Ster eo Investigator software (MicroBrightField, Colchester, VT). For the proliferation st udy, because of the low number of BrdU+ cell in the aged animals the virtual grid and counting frame were both 125 m x 125 m in order to count all the cells that were present in the section. For a ll other counts sampling was optimized to count at least 200 cells per animal with error coeffici ents less than 0.07. Outli nes of the anatomical structures were done using a 10x/0.45 objective and cell quantification was conducted using a 60x/1.40 objective. OX-6+ cells were counted in the entire dentate gyrus including the subgranular zone (SGZ: defined as a two cell diameter band on both sides of the granular cell layer (GCL)). All other cell counts were done in t he SGZ/GCL. The phenotype of the BrdU+ cells were analyzed using an inverted Zeiss LSM 510 confocal microscope with a 40x/1.30NA oil immersion objective. Argon and HeNe laser lines in conjunction with 488 and 555 band pass filters were applied to excite the samples using line switching to mini mize crosstalk between fluorochromes. Images and Z-stacks were produced with dual photomulti plier detectors and the LSM 5 version 3,2,0,115 software suite, and optical Z stacks where created at 2 m intervals throughout the 40 m of the sections with a guard region of 2 m excluded from top and bottom of the Z stack. The Z stacks were rotated in all planes to verify double labeling.

PAGE 39

32 Statistical analyses: Data are presented as mean cell number SEM. Statistical analysis was performed using an unpaired, two-side t -test, or a one-way ANOVA followed by a Tukeys post-hoc test. p <0.05 was considered to be significant. Results Human umbilical cord blood mononuclear cells (UCBMC) stimulate proliferation of the senescent hippocampal neural stem cell In the first of a series of experiments we wanted to determine if UCBMC given intravenously coul d stimulate the proliferation of the endogenous stem/progenitor cells in the hippocampus. We chose to study proliferation as a slowing of the cell cycle and a decrease in proliferation seems to be most affected with age when compared to the ability of the cells to survive and differentiate into neurons which appears to occur at relatively the same rate in young animals (Rao et al., 2005). T he effect of a single intravenous injection of UCBMC on cell proliferation in the granule cell layer in young (3-months old ) or aged (20-months old) F344 rats was determined by analyzing BrdU st aining 24 hours after the BrdU injections (48 hours following UCBMC injection). Using the optical fractionator method of design based stereology (West et al., 1991), we found that in the aged animals there was a significant increase (t(9)= 4.256; p < 0.005) in the number of BrdU+ cells in the UCBMC group (2504 227.3 n=5) compared to the animals that received media alone (1549 82.07 n=6) (Figure 6A). In young animals there was no significant effect of the UCBMC treatment (data not shown). To determine if there might be a prolonged effect on proliferation in the aged F344 rats BrdU injections were given 14 days after the UCBMC treatment. Figure (6E) shows the effect of a single intravenous injection of UCBMC on the number of cells t hat incorporated BrdU on day 14. Stereological analysis revealed that in the aged UCBMC-treated ra ts there was a significant increase in the number of BrdU+ cells (t(12)= 3.468; p < 0.01) (2357 149. 4 n=6) compared to the media-treated group (1548 176.9 n=4). Neurogenesis is stimulated in the aged hippocampus following UCBMC treatment. To determine if UCBMC would also stimulate neu rogenesis in the aged rats, doublecortin (DCX) immunostaining was examined. Counting the number of DCX+ cells in the SGZ/GCL, we found a significant increase (t(16)= 2.188; p < 0.05) in the number of DCX+ cells in the aged rats 15 days after a single i.v. injection of the UCBMC (2619 212.6 n=9) compared to animals that received media alone (1843 283.9 n=9) (Figure 7A). To confirm the results obtained by DCX, and to determine if there was any change in the ability of the proliferating cells to differentiate following a UCBMC treatment, we injected the animals with Br dU (50mg/kg) for five days beginning 24 hours after our i.v. treatment. Quantifying the number of BrdU+ cells in the SGZ/GCL using the optical fractionator method of design based stereology we found a similar increase in the number of BrdU+ cells in the aged UCBMC treated group as was found using the neurogenic marker DCX (Figure 7A-D). In aged rats, there was a significant increase (F(2, 14) = 10.94, p < 0.005) in the number of BrdU+ cells generated over a period of five day s following a single i.v. injection of

PAGE 40

33 UCBMC (2772 263.3 n=5) compared to the rats that received media alone (1498 206.1 n=5); as determined by the Tukey’s Multiple Comparis on Test (p<0.01). In this experiment, we also included a group that was injected with adult human peripheral blood mononuclear cells (PBMC) as a control for the effect of delivering cells. The PBMC group was determined to have significantly fewer BrdU+ cells (1712 171.2 n=5) than the UCBMC treated group (p<0.01), but this was not significantly different from the gr oup that received media alone (Figure 7E-H). As with the results of the proliferation study, y oung rats showed no significant effect of UCBMC treatment (data not shown). To determine if t he treatment with UCBMC might alter the phenotype of the newborn cells, we double labeled with the antibodies to Tuj1, NeuN and GFAP. While exhaustive sampling was not conducted, 50 BrdU+ cells were analyzed from each rat (4 rats per group) using confocal microscopy for each marker and there did not appear to be any change in phenotype due to the treatment (Figure 7I-J). To confirm that the increase in neurogenesis was from the endogenous stem/progenitor cells, sectio ns were stained for HuNu to look for the presence of the transplanted cells in the brain. Cells positive for the HuNu were found in the blood smears of the rats that were treated with UCBMC, but no HuNu immunoreactive cells were found in the hippocampus of the rats (data not shown). A decrease in microglia activation followi ng UCBMC correlates with the increase in neurogenesis. Using the optical fractionator method of design based stereology, we counted the number of OX-6+ cells in the dentate gyrus 15 days after a single UCBMC injection; this was at the same time point that we observed an increase in DCX+ cells and BrdU+ cells. OX-6 is a marker for MHCII and presumably stains for microg lia in an activated, proinflammatory state. In aged rats, we found that 15 days after the UCBMC treatment there was a significant decrease (t(12)= 2.699; p < 0.05) in the total number of activated OX-6+ microglia in the UCBMC group (678.7 155.3 n=7) compared to the media c ontrol (1217 128.0 n=8) (Figure 8A). The decrease in OX-6+ microglia negatively correlated with the number of DCX+ cells (Spearman r(15)= -0.6429; p<0.01) (Figure 3E). Morphologically the OX-6+ cells expressed two main phenotypes (see Figure 8F). Type 1 microglia appear to be in a more quiescent state based on morphology Type 2 microglia were thought to represent a more activated state. The ty pe 1 microglia make up the majority of the OX6+ cells in the dentate gyrus and were found to be significantly decreased (u npaired t(12)= 2.791; p < 0.05) in aged rats following UCBMC treatment (426.6 117.0 n=7) compared to controls (842.4 94.67 n=8) (Figure 8G). The type 2 micr oglia, while representing a smaller percentage of the total OX-6+ microglia, were significantly reduced (t(12)= 3.281; p < 0.01) to a greater extent by the UCBMC treatment (53.30 13.27 n=7) compar ed to controls (212.9 43.82 n=8) than the total microglia (Figure 8H). Fifteen days after the UCBMC treatment, there was a 4 fold change in the number of type 2 OX-6+ microglia, whereas there was only a 1.8 fold change in the total

PAGE 41

34 number of OX-6+ microglia. It appears that the highly activated microglia are being reduced to a greater extent by the UCBMC treatment, although all OX-6+ microglia are affected. Discussion The present study explored whether human umbilical cord blood mononuclear cells (UCBMC) could improve the neuro genic niche of the aged brain and stimulate the endogenous stem/progenitor cells to generate new neurons. As determined by stereological analysis of both DCX and BrdU, a single peripherally administer ed injection of UCBMC appeared to stimulate neurogenesis. The finding that the administrati on of UCBMC also increased the number of proliferative cells generated within 24 hours followi ng the treatment, suggests that the increase in neurogenesis observed in this study may be a conseq uence of an increase in proliferation rather than changes in differentiation or survival of newly generated cells. To support this hypothesis, it will be important to allow more time for the cells to fully mature and then determine if there is still no change in the phenotype of the BrdU+ cells. It will also be important to determine what effect UCBMC have on the survival of the BrdU+ cells. In addition, it was determined that UCBMC were able to increase cell proliferation for at least fifteen days in the aged rats. This sugges ts that the UCBMC may have a beneficial effect on the microenvironment of the aged brain. In support of this hypothesis we show that coinciding with an increase in neurogenesis in the aged treat ed rats, there was a decrease in the number of activated microglia in the dentate gyrus. A negative correlation between the degree of inflammation as indicated by the activation of microglia and the number of newborn neurons has been previously described (Ekdahl et al., 2003). Cons istent with previous studies showing that UCBMC have the potential to reduce neuroinflamm ation (Vendrame et al., 2004; Rao et al., 2005; Vendrame et al., 2005; Vendrame et al., 2006a) in the aged brain, we did find that neurogenesis correlated with the number of activated microg lia, suggesting that UCBMC were stimulating neurogenesis by decreasing microglia activation. Although other possibilities cannot be excluded, since UCBMC could be having multiple effects including increasing trophic support as previously published (Suen et al., 1994; Taguchi et al., 2004; Vendrame et al., 2004). UCBMC have been shown to reduce neuroinflammation (Vendrame et al., 2004; Rao et al., 2005; Vendrame et al., 2005; Vendrame et al., 2006a) and, consistent with previous studies, we show here that the peripherally administer ed UCBMC do have anti-inflammatory properties. It appears that one of the factors t hat leads to the negative regulation of neural stem cells is inflammation (Ekdahl et al., 2003; Monje et al., 2003; Battista et al., 2006). A primary source of inflammation in the CNS is from the macrophages/microglia which can produce a wide array of cytotoxic factors, including proinflammatory cytokines such as tumor necrosis factor (TNF), IL-1, IL-6 and IL-12 (Gao et al., 2002; Mantovani et al., 2004). With age, microglia shift from a quiescent state into an active proinflammatory state. It is not clear if this change in activation state is in response to injury, infection, or debris or if it is due to dysregulated cytokine levels. Another

PAGE 42

35 possibility recently proposed, is that microglia becoming senescent and this leads to them becoming dysfunctional (Schwartz et al ., 2006b; Streit, 2006b). It has previously been demonstrated in models of induced inflammation through the use of LPS or radiation, a dramatic decrease in proliferation and neurogenesis occur, and when the inflammation is alleviated the replicative potential of the stem cells returns (E kdahl et al., 2003; Monje et al., 2003). This effect is likely a protective mechanism so that the DNA is not exposed to the noxious inflammatory environment which could damage the replicating DN A. This correlation also imparts support to the hypothesis that UCBMC stimul ate neurogenesis by decreasing inflammation, particularly the activation state of microglia. Ho wever, it does not rule out t he possibility that UCBMC may be acting on multiple targets, with microglia only representing one part of the total mechanism. While UCBMC do seem to have an effect on micr oglia, it is not clear how this occurs. A number of studies have shown that T-cells appear to act on macrophages/microglia to cause them to adopt a phenotype that is ‘pro-repair’ (i.e the macrophages/microglia: clear debris, buffer toxic compounds, and produce growth factors), without being pro-inflammatory (i.e. producing TNF, NO, or COX-2) and this effect can promote neurogenesis and be neuroprotective (Shaked et al., 2004; Butovsky et al., 2006c; Ziv et al., 2006a; Ziv et al., 2006b; Ziv et al., 2007). As T-cells are a major fraction of UCBMC, it is possible t hat the nave T-cells in the UCBMC are able to induce a protective T-cell mediated response in the aged rats, since adult PBMC did not have an effect. Alternatively, the CD34+ stem cells in the UCBMC may be involved. Taguchi et al. (Taguchi et al., 2004) has shown that CD34+ stem cells can increase both angiogenesis and neurogenesis as part of the protective mechanism ag ainst stroke. From the results of the current study it can not be determined if the effects of t he UCBMC are a result of direct action on the brain or though peripheral effect. However, the fa ct that we did not detect any immunoreactivity for human nuclei in the brains of the UCBMC-tr eated rats raises the pos sibility that the UCBMC may be acting through a peripheral mechanism Moreover, the observation that the adult PBMC did not alter hippocampal neurogenesis ruled out the possibility of a non-specific effect due to an influx of cells, supporting our belief that the in crease in neurogenesis, which occurred following treatment with UCBMC was not due to an influx of cells but was specific to UCBMC. The present study did not attempt to determi ne if decreasing senescence of the neural stem cells could reverse the cognitive decline with age. There is still much debate surrounding the role of neurogenesis in learning and memory (Gould et al., 1999a; Shors et al., 2001; Shors et al., 2002; Merrill et al., 2003; Leuner et al., 2006; Kee et al., 2007) and whether cellular senescence of the stem cell pool with age leads to an aging phenotype. While not a goal of the current study, it will be important to determine if the rejuvenation of the aged stem/progenitor cell pool can reverse the age-related cognitive decline. In summary, this study demonstrates that a single peripheral injection of UCBMC could stimulate the endogenous neural stem/progenitor ce lls to increase proliferation. We also

PAGE 43

36 determined that the UCBMC were able to improv e the microenvironment of the aged brain by reducing the number of activated microglia, and this reduction is correlated with an increase in neurogenesis. Further work will be important to determine the mechanism of action of UCBMC in the aged rats, including the possible role of the i mmune system in a T-cell mediated response, as well as the affects of angiogenesis via the CD34+ stem cells. It will also be important in future experiments to determine the durati on that a single injection of UCB MC will elevated proliferation in aged rats. Not only do the results of this study provide novel insight into the state of the aged stem cell niche, the ability of the UCBMC to exer t their effects while being administered minimally invasively may make translation to the clinical setting more likely. For this reason it will be important in future studies to determine the most efficacious dose and dosing regimen. Nevertheless, this is the first time that a system ic injection of hematopoietic cells has been shown to restore the regenerative potent ial of the aged brain, providing a novel insight into how the regenerative potential of the aged stem cell niches could be restored. Conclusions The results demonstrate that a single intravenous injection of UCBMC in aged rats can significantly improve the micr oenvironment of the aged hippocampus and rejuvenate the aged neural stem/progenitor cells. Our results raise the possibility of a peripherally administered cell therapy as an effective approach to improv e the microenvironment of the aged brain. Abbreviations GCL (granular cell layer), PBMC (peripheral blood mononuclear cells), UCBMC (umbilical cord blood mononuclear cells), SGZ (subgranular zone) Competing interests PCB, AEW are consultants to Saneron CCE L Therapeutics Inc (SCTI). PRS is a cofounder of SCTI. AEW & PRS are inventors of UCBMC related patents applications. Authors' contributions ADB, PRS, AEW, PCB, CG designed rese arch. ADB, MMP, MJC, CEH, CG performed research. ADB wrote paper. All authors read and approved the final manuscript. Acknowledgements This work was supported by: NIH grant R21AG024165 (CG), PO1AG04418 (PCB), and R01AG020927(AEW); The US Veterans Administrati on Medical Research Service; In part by, the Analytic Microscopy Core Facility at the H. Lee Moffitt Cancer Center and Research Institute. The UCBMC were generously donated by Saneron CCEL Therapeutics Inc. Thanks are due to Ning Chen, and Craig T. Ajmo Jr., for their technical assistance.

PAGE 44

37 Figure 6: Proliferation is increased in aged rats following UCBMC treatment. To determine if UCBMC could stimulat e proliferation of the hippocam pal neural progenitor/stem cells rats received two i.p. injections of BrdU (50 mg/kg) and were sacrifice the following day. (A) Quantification of the BrdU immunoreactive cell in the SGZ/GCL in aged rats 2 days after the UCBMC treatment showed that there was a signific ant (p<0.005) increase in the number of BrdU immunoreactive cells. (B,C) Photomicrographs of the dentate gyrus of a media-treated rat (B) and a UCBMC-treated rat (C) shows the BrdU staining in those animals sacrificed 2 days after the treatment. (D)The arrow in C points to a cluster of BrdU immunoreactive cells from the UCBMCtreated rat shown in D at higher magnification. (E) To determine how long proliferation might remain elevated injections of BrdU (50 mg/kg) began 14 days after the treatment. Quantification of the BrdU immunoreactive cells determine that the UCBMC-treated gr oup had significantly (p<0.01) more cells in the SGZ/GCL then the animals that received media alone. (F,G) BrdU staining of the media-treated (F) and the UCBMC-tre ated (G) animals in the dentate gyrus of the hippocampus 15 days after the treatment. (H) Arrow in G points to cells shown at higher magnification in H. (scale bar for B,C, F,G is 100m; scale bar for D,H is 25m)

PAGE 45

38 Figure 7: 15 days after a UCBMC treatment neurogenesis is increase in aged rats. To determine if UCBMC treatment could stimulate neurogenesis aged F344 rats were sacrificed and immunohistochemical stained for DCX and BrdU. (A) A significant increase (p<0.05) in the number of DCX+ cells, quantified in the SGZ/GCL, was found in the UCBMC treated rats. (B,C) Photomicrographs show the dentate gyrus demonst rating the DCX immunohistochemistry in the media-treated (B) and UCBMC-treat ed (C) rats. (D) A higher magn ification photomicrograph of area indicated in C shows a number of DCX+ cells showing the different morphologies of the cells. (E) The results obtained with DCX were conf irmed by BrdU. BrdU was injected i.p. for five consecutive days after the single injection of UCB MC. 10 days after the last injection of BrdU the animals were sacrificed. Compare to both a media control as well as an human adult peripheral blood (PBMC) control the UCBMC treated animals had significantly more BrdU+ cells (p<0.01). (F,G,H) Photomicorgaphs of dentate gyrus show s BrdU immunohistochemistry in the mediatreated (F), PBMC-treated (G) and UCBMC-treat ed (H) rats. (I,J) Immunofluorescence was conducted to determine the phenotype of the BrdU+ cells. (I) An example of the cells double labeled with BrdU+/NeuN+ (I; shown in orthogonal projection) and BrdU+/TUJ1+ (J; shown using maximum projection). (scale bar for B,C, F,G,H is 100m; scale bar for D is 25m)

PAGE 46

39 Figure 8: The decrease in microglia activation correlates with neurogenesis. 15 days after the UCBMC treatment a significant redu ction (p<0.05) was found in the number of OX6+ cells in the dentate gyrus of the aged rats (A ). (B,C) Photomicrograp hs are shown of the hippocampus of media-treated (C) and UCBMC-t reated (C) rats. (D) A higher magnification photomicrograph of area indicated by arrow in B. (E) A significant negative correlation (p<0.01) was found between the number of OX-6+ cells and the amount of neurogenesis as determine by the number of DCX+ cells. (F) The OX-6+ were further characterized based on morphology. The cell on the left represents a typical ‘Type 1’ cell t he cell on the right represents a typical ‘Type 2’ cell. Both ‘Type 1’ (p<0.05; G) and ‘Type 2’ (p<0.01; H) OX-6+ cells were significantly reduced in the aged animals following UCBMC treatment, but there was a greater reduction in ‘Type 2’ cells amounting to a four fold change. (scale bar for B,C is 200m; scale bar for D is 25m).

PAGE 47

40 Paper III Fractalkine and CX3CR1 regulate hippocampa l neurogenesis in adult and aged rats. Adam D. Bachstetter1,2, Josh M. Morganti2, Jennifer Jernberg2, Andrea Schlunk2, Staten H. Mitchell3, Kaelin W. Brewster2, Charles E. Hudson3, Michael J Cole2, Jeffrey K. Harrison4, Paula C. Bickford1,2,3, and Carmelina Gemma1,2,3 1Department of Molecular Pharmacology and Physiol ogy, University of South Florida, College of Medicine, Tampa, FL 33612, USA 2Department of Neurosurgery, C enter of Excellence for Aging a nd Brain Repair, University of South Florida, College of Medicine, Tampa, FL 33612, USA 3James A. Haley Veterans Administration Medical Center, Tampa, FL 33612. 4Department of Pharmacology and Therapeutics, Un iversity of Florida, College of Medicine, Gainesville, FL 32610-0267, USA. Abstract Cellular senescence occurs throughout the body during chronological aging of an organism. A portion of senescence is independent of primary alterations to the stem cells, and is dependent on the environment where the cells resi de. While microglia have neuroprotective capacities, their chronic activation can promote neurotoxic inflammation, thereby contributing detrimental effects to the neural stem cell niche. The causes of age-related increases in microglial activation and neuroinflammation are currently not well understood. Neuronally-expressed fractalkine (FKN), acting via interaction with its receptor CX3CR1, can suppress excessive microglia activation. To address the role of this chemokine system in hippocampal neurogenesis, we examined the impact of interfering with FKN/CX3CR1 interactions in young and old rodents. Disruption of FKN/CX3CR1 signaling in young adult rodents decr eased survival and proliferation of neural progenitor cells. These anti-neurog enic effects, resulting from loss of CX3CR1 function, were reversed by IL-1 antagonism. Aged rats had decreased levels of hippocampal FKN protein although interruption of CX3CR1 function in these animals did not affect neurogenesis. Moreover, delivery of exogenous FKN reversed the age-related decrease in hippocampal neurogenesis in aged rats but did not produce any effects in young animals. The results suggest that FKN/CX3CR1 signaling has a regulatory role in modulating hippocampal neurogenesis via mechanisms that involve indirect modifica tion of the niche environment. As elevated neuroinflammation is associated with many age-related neurodegenerative diseases, enhancing

PAGE 48

41 FKN/CX3CR1 interactions could provide an alte rnative therapeutic approach to slow neurodegeneration, while also minimizing non -specific immunosuppressive responses. Introduction Adult neurogenesis is a lifelong process, cont inuing even in elderly humans (Eriksson et al., 1998). However, studies in rodents have dem onstrated a continual age-related decline in neurogenesis (Rao et al., 2006; Ben Abdallah et al., 2008). An extensive list of neurogenic regulators has been identified, many of which change as a result of aging (Drapeau and Nora Abrous, 2008) making a unified theory to account for the age-related decrease in neurogenesis unlikely. Yet, the potential importance of neurogene sis in some affective (Sahay and Hen, 2007) and cognitive behaviors (Drapeau and Nora Abrous, 2008) as well as endogenous tissue repair mechanisms, makes further investigation of neur ogenic regulators warranted. Seminal studies demonstrated that microglia can be detrimental to neurogenesis (Ekdahl et al., 2003; Monje et al., 2003). Proinflammatory cytokines, including IL-1 IL-6, and TNF, have been shown to act directly on neural stem/progenitor cells (NPC )(Monje et al., 2003; Iosif et al., 2006; Koo and Duman, 2008). Microglia are pleiotropic, and can also support neurogenesis through the production of growth factors (Ziv and Schwartz, 2008). Therefore the involvement of microglia in the neurogenic niche is not clear, as microglia can both increase and decrease neurogenesis. Until recently, neurons were believed to be submis sive to the effects of microglia; however, a number of neuronal signals were found that can regulate microglia activation (Biber et al., 2007), suggesting a neuron-microglia dialog. One neuronally derived signal that has been shown to be important in regulating the neurotoxic affects of microglia is the chemokine fractalkine (FKN; CX3CL1; neurotactin). In contrast to many other chemokines, FKN binds and activates a single receptor, CX3CR1. Although there is some debate concerning the cell types expressing these two molecules, in vivo FKN is principally expressed on neurons while CX3CR1 is found on microglia (Harrison et al., 1998; Cardona et al., 2006; Lauro et al., 2008). Previous reports est ablish that interactions between FKN and CX3CR1 contribute to maintaining microglia in a resting ph ase, partially controlling their neurotoxicity. FKN acts in vitro as an anti-inflammatory molecule by down-regulating IL-1 TNF and IL-6 production (Zujovic et al., 2000; Zujovic et al., 2001). FKN can also elicit neuroprotective effects on pure neuronal cultures (Meucci et al., 1998; Meucci et al., 2000; Tong et al., 2000). Moreover, mRNA and protein expression of CX3CR1 were found in isolated NPCs (Ji et al., 2004; Krathwohl and Kaiser, 2004). With age there is an increase in the number of activated microglia, which can suppress neurogenesis (Gemma et al., 2007b; Bachstetter et al., 2008). We hypothesized that, as a consequence of aging, FKN signaling becomes disr egulated, which leads to increased microglial activation and decreased neurogenesis. Our findi ngs demonstrate for the first time that FKN/CX3CR1 signaling is critical for the regulation of hippocampal neurogenesis.

PAGE 49

42 Materials and Methods Animals. All experiments were conducted in accord ance with the National Institute of Health Guide and Use of Laboratory Animals, and we re approved by the Institutional Animal Care and Use committee of the University of South Florida, College of Medicine or the University of Florida as appropriate. CX3CR1-deficient (CX3CR1GFP/GFP) mice, backcrossed to the C57BL/6 background for greater than 10 generations we re obtained from JAX Laboratories (Bar Harbor, Maine). Colonies of the CX3CR1+/GFP and CX3CR1GFP/GFP mice were maintained at the University of Florida. Four-month-old male CX3CR1+/GFP and CX3CR1GFP/GFP littermates were used in the experiments. Male Fisher 344 (F344) rats (NIA contract colony, Harlan Sprague Dawley, Indianapolis, IN), were pair-housed in environmen tally controlled conditions (12:12 h light:dark cycle at 21 1C) and provided food and water ad libitum. Three age groups of rats used in this study included: young (3 months old), middle ag ed (12 months old) and aged (22 months old). Animals were excluded from the study if they became jaundiced, had pituitary tumors, or developed post-surgery infections. Surgical procedure. For all surgical procedures, rats were anaesthetized with isofluorane. For intracerebroventricular infusion a guide cannula was stereotaxically implanted in the left ventricle (AP, 1.0; ML, 1.6; DV, 3.5 mm) and connected to an osmotic minipump, which was inserted subcutaneously. For the first 7 day s all rats received an osmotic minipump (Alzet Model, 2001: pumping rate, 1.0 L/h; total volume, 200 L) filled with sterile saline, to allow time for the rats to heal before drug treatment was st arted. After the first 7 days, a mid-scapular incision was made and the saline pump was swit ched for the treatment pump for either an additional 7 days (Alzet Model, 2001: pumping rate, 1.0 L/h; total volume, 200 L), 14 days (Alzet Model, 2002: pumping rate, 0.5 L/h; total volume, 200 L), or 28 days (Alzet Model, 2004: pumping rate, 0.25 L/h; total volume, 200 L). The treatments used in this study included: (1) rabbit-anti rat CX3CR1 blocking antibody ( -CX3CR1) (10g per day; Torrey Pines Biolabs, San Diego, CA; Cat no. TP 501)(Milligan et al., 2004); (2) rabbit non-immune IgG (10g per day; Sigma-Adrich; Cat no. I-5006); (3) recombinant rat FKN (aa 22-100) chemokine domain (30ng per day R & D systems, Inc.; Cat no. 568-FR/CF)(Milligan et al., 2004). (4) r-metHu IL-1Ra (10g per day; Amgen, Thousand Oaks CA). For controls, the proteins were heat-inactivated for 45 minutes in a water bath at 90oC. Thymidine analog labeling. Following the time line in Figure 2A animals received two intraperitoneal (i.p.) injections of one or more thymidine analogs with a 12 hour interval. Bromodeoxyuridine (BrdU) (5-bromo-2-deoxyuridine; Sigma, St. Louis, MO) was injected at dose of 50 mg/kg. Equimolar solutions, to be equivalent to the 50 mg/kg of BrdU, were prepared from chlorodeoxyuridine (CldU) (42.5 mg/kg; Sigma, St. Louis, MO) and iododeoxyuridine (IdU) (57.5 mg/kg; MP Biomedicals) as previously described(Vega and Peterson, 2005).

PAGE 50

43 Tissue collection and processing. For immunohistochemistry studies animals were anaesthetized with pentobarbital (50 mg/kg, i.p.). The rats were transcardially perfused with phosphate-buffered saline (PBS), followed by 4% paraformaldehyde in phosphate-buffered. The brains were postfixed in 4% paraformaldehyde fo r 12 h, after which they were transferred into 30% sucrose in PBS for at least 16 h at 4C. Exhau stive sagittal sections of the left hemisphere were made at 40 m using a Microm cryostat (Richard-A llan Scientific, Kalamazoo Michigan) and stored in cryoprotectant at 4C. For biochemic al experiments, animals were deeply anaesthetized with isofluorane before decapitation. The brai n was quickly removed and the brain regions were dissected. Hippocampal tissues were dissected from both hemispheres and collected separately. In animals that received treatment, only the hemis phere that received the treatment was used. In nave animals, both hemispheres were included. Homogenization of tissues was performed using an ultrasonic cell disrupter, in a 1:10 weight/volume of ice cold cell lysis buffer (Cell Signaling Technology, Inc.; Danvers, MA; Cat no. 9803) and phenylmethylsulphonyl fluoride, 1 mm (Sigma, St. Louis, MO). Samples were centrifuged at 21,000 g at 4 C for 15 min and supernatant was collected. Determination of total protein, using a Bradford protein assay (BIO-RAD Laboratories, Hercules, CA, USA) and an enzyme-linked immuno sorbent assay (ELISA) were performed on the same day to avoid repetitive thawing of samples. The ELISA for both rat IL-1 (eBioscience, Inc.; San Diego, CA; cat no. 88-6010-22) and rat FKN (RayBiotech, Inc.; Norcross GA; Cat no. ELRFractalkine-001C) were performed using a commercially available kit following the manufacturer's protocol. Real-Time RT-PCR. Dissected tissues stored at -80oC were used for RNA isolation using RNeasy mini-columns (Qiagen; Cat no. 74104) with on-column DNase treatment (Qiagen; Cat no. 79254) according to the manufacturer’s prot ocol. RNA quantity was determined and normalized using Quant-iT™ RiboGreen RNA Assay Kit (Inv itrogen; Cat no. R11490). Integrity of the RNA was confirmed on an agarose gel assessing the 18s and 28s rRNA bands. Reverse transcription (RT) was done following the manufacturer’s pr otocol using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Cat no. 4368814). A no template and a no RT control were conducted to control for contamination. qPCR reaction was perf ormed using SYBR Green PCR Master Mix (Applied Biosystems; Cat no. 43 09155) following the manufacturer’s protocol, with the exception of variable annealing temperatures (55oC-65oC) as determined most optimal during primer validation. A melt curve beginning at 55oC and increasing by 0.5oC to 95oC every 10 sec with fluorescence measured at each interval A single peak in the melt curve was used to check for a single product. A standard curve that covers 3 logs was made of pooled cDNA from all the rats and used each plate to check the e fficiency of the reaction as determined by the slope of the standard curve and to assess plate to plate variations. All samples were run in triplicate. The primers that were used included; Rp l19 (NM_031103; sense: AATCGCCAATGCCAACTC; antisense: CCCTTCCTCTTCCCTATGC) as the refe rence gene, to normalize the expression of

PAGE 51

44 FKN (NM_134455; sense: CGAGTTCTGCTGTCTACCAATCTG; antisense: GAAGTGGTGGACGCTTGAGTAG). Relative gene expression was calculated by the 2CT method. Immunohistochemistry and Immunofluorescence. Except where specifically indicated, standard staining procedures were conducted on free-floating sections using every sixth section for the entire hippocampus beginning with a random start and including sections before and after the hippocampus to ensure that the entire structure was sampled. The standard staining procedures used began with 0.3% H2O2 solution in 30% methanol to block endogenous peroxidase activity (this step wa s omitted for immunofluorescence). Sections were blocked in 10% normal serum from the species that secondary antibody was raised in, with the addition of 0.1% Triton X-100. Sections were incubated, wi th primary antibody diluted in 3% normal serum with 0.1% Triton X-100, overnight at 4C. For immunohistochemistry biotinylated secondary antibodies were diluted in 3% normal serum with 0.1% Triton X-100 and were incubated for 2 hours at room temperature. For immunofluores cence appropriate secondary antibody conjugated to an Alexafluor probe (Molecular Probes, Eugene, OR) was applied for 2 hours. For immunohistochemistry, enzyme detection was done us ing avidin-biotin substrate (ABC kit, Vector Laboratories, Burlingame, CA) followed by color development in diaminobenzidine solution (Sigma, St. Louis, MO). For BrdU, sections were pretreated with 50% formamide/2 SSC (0.3 M NaCl, 0.03 M sodium citrate) at 65C for 2 hours, rinsed in 2 SSC, incubated in 2N HCL for 30 minutes at 37C, and washed with borate buffer (pH 8.5). For IdU and CldU, sections were pretreated 2N HCL for 20 minutes at 37C followed by a wash in borate buffer (pH 8.5). BrdU was detected using a mouse anti-BrdU (1:100; Roc he; Indianapolis IN; Cat no.11 170 376 001, clone BMC 9318). CldU was detected with rat anti-BrdU (Accurate Chemicals, Westbury, NY Cat no OBT003 clone: BU1/75 (ICR1)). For IdU, mouse anti-BrdU (Becton Dickinson Bioscience, San Jose, CA; Cat no.347580, clone B44), was used at a dilution of 1:500. Doublecortin (DCX) is a marker of migrating neurons that is expressed for approximately three weeks after the cell is born and has been shown to be a reliable indicator of neurogenesis(Rao and Shetty, 2004; CouillardDespres et al., 2005). For DCX immuno-detection, incubation in primary antibody was done for 36 hours at 4C using a polyclonal goat antibody Cterminus of human DCX (1:200; SC-8066, Santa Cruz biotechnology, Santa Cruz, CA, USA). Ki67 is expressed in cells G1 through M phase of the cell cycle (Scholzen and Gerdes, 2000). For detec tion of Ki67, a rabbit anti-human Ki67 antibody (NCL-Ki67p; Novocastra Labor atories/Vision BioSystems, Newcastle upon Tyne, UK) was used at a dilution of 1:500. Mature neurons were st ained with the marker NeuN (1:100; Chemicon, Temecula, CA). For OX-6 immuno detection a monoclonal antibody directed against the rat major histocompatibility II (MHCII) (RT1B, Becton, Dickinson Pharmingen, San Diego, CA, USA) was used at a concentration of 1:750. For microglia analysis in mice, two antibodies were used; mouse major histocompatibility II(I-A/I-E, Bect on, Dickinson Pharmingen, San Diego, CA, USA;

PAGE 52

45 Cat no. 556999 Clone: M5/114.15.2); and rat ant i-mouse CD45 (AbD Serotec; Raleigh, NC; 1:10,000; Clone: YW62.3; Cat no. MCA1031G). De tection of FKN was acomplished using a goat anti-rat polyclonal antibody that recognizes the c hemokine domain of FKN at a concentration of 1:100 (R&D Systems; Minneapolis, MN; Cat no. AF537). Quantification and imaging: To determine cell numbers, the optical fractionator method of unbiased stereological cell counting techniques (West et al., 1991) was used with a Nikon Eclipse 600 microscope and quantified using Ster eo Investigator software (MicroBrightField, Colchester, VT). Due to the low number of BrdU+, CldU+, Idu+, and DCX+ cells in the aged animals, the virtual grid and counting frame were both 125 m x 125 m in order to count all the cells that were present in the section. For a ll other counts, sampling was optimized to count at least 200 cells per animal with error coeffici ents less than 0.07. Outli nes of the anatomical structures were done using a 10x/0.45 objective and cell quantification was conducted using a 60x/1.40 objective. An Olympus FluoView FV100 0 confocal microscope was used for all Immunofluorescence photomicrographs, only linear adjustments (brightness and contrast) were made to the figures. When quantification of percent age of positive cells was determined, Z stacks were created at 1 m intervals throughout the 40 m of the sections with a guard region of 2 m excluded from top and bottom of the Z stack. The Z stacks were rotated in all planes to verify double labeling. Statistical analyses: Data are presented as meanSEM. Statistical analysis was performed using an unpaired, two-side t -test, or a one-way ANOVA followed by unpaired t-test. Correlations were tested using a Pearson product-moment correlation coefficient. A value of p <0.05 was considered to be significant. Results CX3CR1-deficient mice have decreased hippocampal NPC proliferation and neurogenesis. Previous studies suggest that CX3CR1 suppresses the neurotoxic effects of activated microglia (Cardona et al., 2006). Howeve r, in the absence of a neurotoxic insult, CX3CR1GFP/GFP mice lack any obvious phenotype, and appear to have normal brain development (Jung et al., 2000; Cook et al., 2001; Haskell et al., 2001). To date, no studies have investigated whether loss of CX3CR1 signaling results in changes in adult neurogenesis. To begin to address this issue, the number of DCX+ cells in the subgranular zone (SGZ) and granular cell layer (GCL) of the dentate gyrus in CX3CR1-expressing and deficient mice were quantified using the optical fractionator method of design based stereology. A significant decrease (t(9)=3.857; p=0.0062) in the number of DCX+ cells in the CX3CR1GFP/GFP mice was found as compared to the CX3CR1+/GFP mice (Fig. 10A). To determine if this decrease might be due to reduced proliferation, mice were injected twice (8 hours interval) with BrdU (50mg/kg) and the mice were euthanized on the following day. Quantification of the number of BrdU+ cells revealed a significant decrease (t(13)=2.513; p=0.026) in the number of BrdU+ cells in the CX3CR1GFP/GFP mice compared to the

PAGE 53

46 CX3CR1+/GFP mice (Fig. 10B). Figure 1C shows that CX3CR1+ cells (green) were widely distributed in the dentate gyrus, with a typical appearance of ramified microglia. The CX3CR1+ cells in the SGZ had a morphological appearance of microglia and were located in close proximity to the NPC. To determine whether neurons or astrocytes also expressed CX3CR1, sections from CX3CR1+/GFP mice and CX3CR1GFP/GFP mice were stained for GFAP (blue), BrdU (red), and NeuN (Magenta) (Fig. 10D) and for DCX (red) (Fig.10E-F). Colocalization of GFP with GFAP, NeuN, or DCX was not observed. Colocalization of BrdU and GFP was rarely seen, and most likely represented proliferating micr oglia and not expression of CX3CR1 on a NPC. Figure 10F-G shows CX3CR1+ cells adjacent to the DCX+ cells, with the CX3CR1+ cell processes interdigitating with the DCX+ cells (Fig. 10F) suggesting an important ce ll-to-cell regulation of the NPCs and the maturation and survival of the adult born neurons. Proliferation of NPCs is decreased by -CX3CR1 treatment in young but not middle aged or old rats. To develop a pharmacological model of decreased FKN signaling, a blocking antibody to CX3CR1 was employed. This model allowed for transient loss of signaling as compared to the mouse model that, as a resu lt of the permanent developmental loss of FKN signaling, might evoke compensatory mechanisms. To determine if blocking of CX3CR1 would cause a decreased NPC proliferat ion and neurogenesis as seen in the mouse model, we infused blocking antibody to CX3CR1 for 7 days via an osmotic minipump to the left lateral ventricle. Young adult rats (3 months old), middle aged rats (12 months old) and old aged rats (22 months old) were injected with BrdU on the 6th day of treatment. The animals were euthanized on the following day and sections of the hippocampus we re evaluated for proliferation and short-term survival of the NPCs. Quantification of the number of BrdU+ cells in the SGZ showed a significant decrease (t(10)=4.688; p=0.0009) in the number of BrdU+ cells in the -CX3CR1-treated rats compared to the non-immune IgG-treated animals (F ig.11A). To confirm the BrdU results, the number of Ki-67+ cells were quantified in the SGZ. A significant decrease (t(5)=3.596; p=0.0156) was found in the number of Ki-67+ cells in the -CX3CR1-treated rats compared to the nonimmune IgG-treated animals (Fig.11B). This was also confirmed by quantif ication of the number of DCX+ cells. In the young adult rats a signifi cant decrease in the number of DCX+ cells was found following treatment for 7 days with -CX3CR1 (t(5)=2.629; p=0.0466)( Fig.11C). However no significant differences in the number of BrdU+ cells (Fig.11A), Ki-67+ cells (Fig.11B), or in the number of DCX+ cells (.Fig.11C), were found in the middle aged rats or old aged rats following treatment with the blocking antibody. FKN reversed the age-related decrease in neurogenesis, but had no effect in young or middle aged rats. To further investigate whether FKN/CX3CR1 signaling could modulate hippocampal neurogenesis, we treated the three different age groups of rats with 30ng/d of recombinant rat FKN. Following the same protocol used for the -CX3CR1 study, FKN was continuously infused into the left ventricle by an osmotic minipump for 7 days. In the first

PAGE 54

47 experiment, BrdU was injected 6 days following the beginning of the FKN treatment and the animals were euthanized on day 7 (Fig.12A). A significant increase (t(10)=2.639; p=0.0248; Fig.12B) in the number of BrdU+ cells in the aged rats treated with FKN was found as compared to the aged rats treated with heat-inactivated (HI)-F KN (Fig.12A). Quantification of the number of DCX+ cells in the aged rats after 7 days of FKN treatment indicated no significant difference between the two groups (Fig 12C). In the y oung adult and middle aged rats, FKN treatment did not produce any measurable changes in the number BrdU+ cells (Fig.13A), or in the number of DCX+ cells (Fig.13B). FKN treatment in aged rats mainly affects proliferation. To determine whether the disruption in FKN/CX3CR1 signaling induced changes in prolifer ation or survival of the newly born cells, we used a multiple thymidine analog approach. Both CldU and IdU were used to date new born cells at 2 different time points (see ti meline Fig.12A). FKN was delivered via an osmotic minipump to the left lateral ventricle for 15 days. One day prior to the beginning of the treatment aged rats were injected with CldU (b.i.d.; 42.5 mg/kg; equimolar to BrdU). IdU was injected on day 6 (b.i.d.; 57.5 mg/kg; equimolar to BrdU), allowing an additional 7 days of treatment to measure the effect of treatm ent on the survival of IdU+ cells. Stereological quantification using an optical fractionator demonstrated no effect of FKN treatment in the number of CldU+ cells (Fig 12D). In contrast, there was a significant increase (t(7)=3.831; p=0.0065; Fig.12E) in the number of IdU+ cells in the FKN-treated rats compared to the HI-FKN-treated rats. By comparing the number of BrdU+ cells in the first experiment to the number of IdU+ cells in the second experiment it is possible to determine if there were combin ed effects on survival and proliferation following treatment, or if these effects were limited to pr oliferation. In the aged rats, FKN increased the number of IdU+ cells. Comparison of the number of IdU+ cells to the number of BrdU+ cells, demonstrated that FKN treatment increased the survival by about 18%, but these changes were within 95% confidence interval (FKN 82.7 %16.45%; HI-FKN 64.7%21.0%; meanSD). The number of DCX+ cells was quantified to determine if the increased number of BrdU+ and IdU+ cells translated to an increase in DCX+ cells. After 14 days of treatment there was a significant increase (t(8)=2.945; p=0.0116; Fig.12 H) in the number of DCX+ cells in the FKN group compared to the HI-FKN group. The increase in the number of IdU+ cells was found to significantly correlate with the number of DCX+ cells (Pearson r=0.933; p=0.0002; Fig 12I). Expression of FKN in the rat hippocampus. As we were able to reverse the agerelated decline in neurogenesis through the additi on of recombinant FKN in the aged rats, we hypothesized that FKN might be altered with age. FKN levels in hippocampal tissue homogenates from young and aged rats were analyzed by ELISA. A significant decrease (t(16)=4.374; p=0.0005; Fig. 12A) in the level of FKN protein in the aged rats, compared to the young rats, was evident. However, mRNA levels of FKN were unalter ed in the aged rats compared to the young rats (Fig.13B). We further investigated the protein loca lization of FKN in the dentate gyrus. Figure 13C

PAGE 55

48 shows a photomicrograph of staining with DAPI (b lue), FKN (green), and Tuj1 (red). While FKN was abundantly expressed on the cell bodies of presumable neurons in the GCL, FKN staining was not found on Tuj1+ cells. Moreover, photomicrograph s of Ki-67 (red) and FKN (green) (Fig.13D,E) also demonstrated a lack of FKN ex pression on the proliferating cells. These data indicated that FKN is not expressed on immature neuronal cells; however, it is not clear exactly when FKN begins to be expressed on neurons. CX3CR1 blocking antibody increased IL-1 To determine whether inhibition of CX3CR1 activity would lead to an increase in IL-1 protein levels, the CX3CR1 blocking antibody was infused in young rats for 28 days via an os motic minipump. The 28 day time point was chosen to ensure that if there was a difference in IL-1 levels, the difference would be large enough to be easily detected by a standard ELISA. In Figure 15, we found that there was a significant effect in the amount of IL-1 following treatment for 28 days with the CX3CR1 blocking antibody (F(2,16)=16.89; p=0.0002). Compared to either the saline treated rats (t(11)=5.179; p=0.0003) or the non-immune IgG treated rats (t(7)=2.630; p=0.0339) the -CX3CR1 treated rats had a significant elevation in IL-1 The saline treated rats and the non-immune IgG treated rats were also significantly different from each other (t(10)=4.064; p=0.0023). Nevertheless, the data indicates that the pharmacological antagonism of CX3CR1 leads to increased production of IL-1 IL-1 mediates the effects of -CX3CR1 treatment. To determine if the anti-proliferative effects of the CX3CR1 blocking antibody were dependent on IL-1 young rats were infused with IL-1 receptor antagonist (IL-1Ra) along with either the -CX3CR1 or non-immune IgG, following the same 7 day protocol as described earlier. A One-Way ANOVA revealed a significant effect (F(3,17)=5.476; p=0.0081) in the number of BrdU+ cells (Fig.16A). To determine if the addition of IL1Ra could have an effect on NPC proliferation a comparison was made between the non-immune IgG groups that received an active IL-1Ra or a heat-inactivated (HI)-IL1Ra. No difference was found as a result of IL-1Ra, suggesti ng that antagonizing the effects of IL-1 in the control rats that received the non-immune IgG did not alter pr oliferation (IgG+IL-1R a n=6; IgG+HI-IL1Ra n=4). The next comparison was made between the rats that received a heat-inactivated IL-1Ra along with the either the -CX3CR1 or IgG. A significant decrease (t(7)=3.499; p=0.010) was found in the number of BrdU+ cells in the rats that received the -CX3CR1 compared to the IgG group ( -CX3CR1+HI-IL-1Ra 4236422.6 n=5). The results of this comparison replicate the findings in Fig.11B, demonstrating that without, an active IL-1Ra, treatment with -CX3CR1 decreases proliferation of NPCs. A significant decrease was also found between the -CX3CR1+HI-IL1Ra treated group and the non-immune IgG treated gr oup that received the active IL-1Ra (t(9)=3.373; p=0.0082). Finally, to determine if the effects of the blocking antibody were mediated through IL1 we compared the rats that received the blocking antibody along with the active or inactive IL1Ra. In the -CX3CR1 treated rats the addition of IL-1Ra was able to prevent the decrease in proliferation that occurred following treatment with the -CX3CR1. There was a significant

PAGE 56

49 difference in the number of BrdU+ cells (t(9)=4.220; p=0.0022); such that, the rats which received the blocking antibody with the inactive IL-1Ra had fewer cells than the rats that received the blocking antibody and an active IL-1Ra ( -CX3CR1+IL1Ra n=6; -CX3CR1 HI-IL-1Ra n=5). The effects on proliferation following treatment with -CX3CR1 appear to be mediated through IL-1 as the IL-1Ra was able to completely attenuate the decrease in proliferation following treatment with -CX3CR1. To determine if IL-1 also mediated the decrease in neurogenesis found after treatment with -CX3CR1, the number of DCX+ cells was quantified in the rats that received IL-1Ra along with -CX3CR1 or non-immune IgG. After seven days of treatment a significant effect was found (F(3,15)=7.615; p=0.0025)(Fig.16B). To confirm the results from the two earlier experiments in the, CX3CR1GFP/GFP mice, and the initial experiment in ra ts, that demonstrated that loss of CX3CR1 function caused a decrease in the number of DCX+ cells, a comparison was made between the rats that received the inactive IL-1Ra along with the -CX3CR1 or non-immune IgG. A significant (t(7)=2.441; p=0.0447) reduction in the number of DCX+ cells was found in the rats that received the heat-inactivated IL-1Ra+ -CX3CR1 group compared to the matching non-immune IgG group (HI-IL-1Ra+ -CX3CR1 n=5; HI-IL-1Ra+IgG n=4). Rats that received the active IL-1Ra along with -CX3CR1 showed the significant (t(8)=2.441; p=0.0358) decrease in the number of DCX+ cells induced by -CX3CR1 was prevented by the addition of IL-1Ra (IL-1Ra+ -CX3CR1 n=5). Rats that received the IL-1Ra with -CX3CR1 were not significantly di fferent than the IgG+HI-IL-1Ra group with respect to the number of DCX+ cells. The results demonstrate that the decrease in DCX+ cells following blocking antibody treatment was mediated through IL-1 An unexpected finding was the physiological role of IL-1 in regulating neurogenesis. When the IL-Ra was given to the non-immune IgG group (IL1Ra+IgG n=5) a significant reduction in the number of DCX+ cells was found compared to the non-immune IgG group that received the heatinactivated IL-1Ra (t(7)=6.573; p=0.0003). As there was not a significant decrease in proliferation in the IL-1Ra+IgG group the DCX data suggests that a physiological level of IL-1 is important for the survival of the DCX+ cells, a similar finding was previous ly reported (Spulber et al., 2008). The number of BrdU+ cells (green) that were also DCX+ (red) were quantified (Fig.16C), and no differences in the number of BrdU+/DCX+ cells was found between any of the groups in the percentage of double-labeled cells (81.75%6.3%). CX3CR1 blocking antibody decreased survival of cells born prior to treatment. After seven days of -CX3CR1 treatment, the number of DCX+ cells was significantly decreased in the young adult rats (Fig.16B). The decrease in DCX+ cells could be due to decreased proliferation, as measured at day six (Fig.16A). Alternatively, treatment with -CX3CR1 could also decrease the survival of the immature neur ons leading to a decrease in DCX+ cells. To determine if CX3CR1 treatment affected survival of cells born prior to treatment, CldU was injected one day before the beginning of the 14 days of infusion of non-immune IgG or -CX3CR1. Figure 2A

PAGE 57

50 shows the different time points that were co mpared. Quantification of the number of CldU+ cells demonstrated a significant decrease (t(7)=3.566; p=0.0091; Fig. 16D) in the number of CldU+ cells. After 14 days of treatment, in the rats that received -CX3CR1 fewer of the cells that were born the day before treatment began su rvived compared to the non-immune IgG group. Figure 17 shows CldU+/NeuN+ cells in the non-immune IgG group (Fig.17A) and -CX3CR1 group (Fig.17B). The preceding experiments demonstrated that -CX3CR1 treatment decreased proliferation of NPCs. To determine if -CX3CR1 treatment could alter the survival of cells born during the treatment, IdU was injected on day six of a 14 day of treatment. Day six was chosen so that a comparison could be made between the number of IdU+ cells and BrdU+ cells quantification from the earlier ex periment (Fig.16A). In the -CX3CR1 treatment group significantly (t(7)=2.506; p=0.0406; Fig. 16E) fewer IdU+ cells were found compared to the nonimmune IgG. To determine if there was an effect on survival or if the effects were limited to proliferation, the number of BrdU+ cells were compared to the number of IdU+ cells. Comparisons of BrdU+ to IdU+ revealed no difference between the treatment groups ( -CX3CR1 49.6%10.11%; IgG 50.7%7.9%; m ean SD), demonstrating that the decrease in the number of IdU+ cells was due to a decrease in proliferation and not survival. A decrease in survival was seen in the cells born prior to treatment. Thes e results suggest, that following treatment with CX3CR1, the niche environment becomes unfavorable fo r the survival of the new born cells, and the cells born before the change in environment die. After the change in environment, there is a decrease in proliferation but not survival as the number of cells born is limited to what the environment can support. The changes in the ni che environment translated to a decrease in neurogenesis in the -CX3CR1 group. In rats that were treat ed for 14 days, a significant decrease (t(7)=2.690; p=0.0311; Fig. 16F) was found in the number of DCX+ cells in the -CX3CR1 group compared to the non-immune IgG treated group. FKN is necessary to maintain microglia in an unactivated state. FKN/CX3CR1 has been proposed to maintain microglia in a quiescent resting state. The expression of MHC Class II on microglia is induced when the cell becomes activated. To determine if microglia became activated following the CX3CR1 blocking antibody treatment, t he number of cells expressing MHC Class II was quantified using the marker OX-6. In the young adult rats the entire hippocampus was used as the region of interest in order to sample a large enough population of cells, due to the few OX-6+ cells in young adult control rats. Following 7 days (F(3,18)=3.644; p=0.0326; Fig.18A) or 15 days (t(8)=2.653; p=0.0291; Fig.18B) of treatment there was a significant effect in the number of OX-6+ cells. At 7 days, the group of ra ts that were treated with the -CX3CR1 and the heat-inactivated IL-1Ra (HI-IL-1Ra+ -CX3CR1; n=5) had significantly more OX-6+ cells compared to the non-immune IgG treated rats with either the inactive IL-1Ra (HI-IL-1Ra+IgG; n=5) (t(8)=2.591; p=0.0321) or active IL-1Ra (IL-1Ra+IgG; n=5) (t(8)=2.412; p=0.0423). The group

PAGE 58

51 that received the -CX3CR1 blocking antibody along with the active IL-1Ra was not significantly different from any of the other groups (IL-1Ra+ -CX3CR1; n=6). At 15 days a similar significant increase in the number OX-6+ cells was found in the -CX3CR1 treated group compared to the non-immune IgG treated group Aging is associated with increased activation of microglia. We hypothesized that a portion of the microglia activation might be a result of a decreased inhibitory signa ling by FKN. To test this hypothesis, we quantified the number of OX-6+ cells in SGZ/GCL only. In the aged rats there was a large enough population of OX-6+ cells in this region of interest to sample adequate number of cells following treatment with FKN or HI-FKN. After 14 days (Exp.2) of FKN treatment, a significant decrease in the number of activated OX-6+ cells was found (t(8)=3.030; p=0.0163; Fig.18C) in the FKN group compared to the HI -FKN group. Previous studies have shown a negative correlation between the number of activated microglia and the amount of new cells that are born (Ekdahl et al., 2003; Bachstetter et al ., 2008); a correlation analysis was conducted to determine if similar effect was observed followi ng FKN treatment. In the aged rats, after 14 days of treatment with FKN, the number of OX-6+ cells was found to signific antly negatively correlate (r(9)=-0.7425; p=0.0219; Fig.18D) with the number of IdU+ cells (Exp.2; Fig.12E). We did not find a significant correlation between the number of CldU+ cells or DCX+ cells and the number of OX-6+ cells (data not shown). Furthermore, in aged rats treated for 7 days with FKN we did not find any differences in the number of OX-6+ cells (data not shown). Discussion Two questions were addressed by the present study: Is CX3CR1/FKN signaling important for maintaining adult hippocampal neurogenesis? Could a disruption in CX3CR1/FKN signaling contribute to the age-related decline in neurogen esis? We demonstrated three main findings: first, loss of function of CX3CR1 in young adult rodents, mice and rats, resulted in a significant decrease in hippocampal neurogenesis; second, administration of exogenous FKN reversed the decline in neurogenesis associated with aging; third, IL-1Ra protected against the decrease in hippocampal neurogenesis induced by blocking CX3CR1 function. Our results suggest that neurons which are the major producers of FKN, and microglia which express CX3CR1 are actively involved in a cross-talk to regulate the production of new neurons. During development the expression of FKN in the brain has been shown to increase nearly 10 fold in four week old mice compared to one day old mice (Labrada et al., 2002). In our study, we found that FKN expression was absent on imma ture neurons, suggesting that FKN might be important in protecting mature neurons from the consequences of overactive microglia. It is also possible that mature neurons, through an indirect mechanism, could communicate with microglia to regulate the addition of new neurons into the mature circuit. This could occur via IL-1 decreasing the proliferation of t he NPCs. Furthermore, FKN might also be involved in the removal of apoptotic cells, as FKN has been shown to enh ance phagocytosis of apoptotic cells (Fuller and

PAGE 59

52 Van Eldik, 2008). Removal of apoptotic cells is an important mechanism to make room for new cells to be added, and to prevent secondary necros is of the apoptotic cell which occurs if dead cells are not quickly removed. FKN is anchored to the cell membrane, but can be cleaved off the membrane by metalloproteinase 10 (ADAM10) (Hundhausen et al., 2003) or by TNF-a converting enzyme (TACE / ADAM17)(Garton et al., 2001). FKN sig naling, when decreased beyond a physiological level, as in the case of young rats treated with -CX3CR1, was observed to decrease neurogenesis. On the other hand, when FKN signaling was already decreased, as we observed in the aged control rats, a further loss did not a ffect neurogenesis. Similarly in the young control rats, in which FKN levels are normal, additi on of exogenous FKN did not alter neurogenesis. However, our current study doesn’t address if the membrane or shed form of FKN might have unique roles in regulating neurogenesis. Therefore, future studies are warranted to discern if there are different mechanisms of actions produced by the different forms of FKN. CX3CR1/FKN signaling is proposed to keep microglia in a non-proinflammatory state (Cardona et al., 2006), as inhibition of FKN/CX3CR1 function has been shown to increase microglial activation and increase production of TNF and IL-1 (Zujovic et al., 2000; Mizuno et al., 2003; Cardona et al., 2006). We found that inhibition of FKN/CX3CR1 function increased microglia activation. This finding is in agreement with our hypothesis that disruption of CX3CR1 function leads to an increase in microglia activation, which could be ultimately responsible in negatively regulating neurogenesis. However, we did not find increas ed microglia activation as measured by MHC-II expression, in the CX3CR1GFP/GFP mice compared to the heteroz ygote littermates (data not shown). A possible explanation could be that permanent loss of CX3CR1 since birth results in compensatory changes in the expression of ce ll surface markers of microglia activation. An additional discrepancy was found in the aged rats treated with FKN for 7 days, where we saw an increase in proliferation but no changes in the number of MHC-II+ cells, or DCX+ cells. Thus, it is possible that FKN does not exert its effect directly through microglia. Alternatively, alterations in MHC-II expression may not be the best indicator of the activation state of microglia induced by alteration in FKN/CX3CR1 axis. This may be bec ause MHC-II expression can occur in activated microglia which can be classically activated to produ ce pro-inflammatory cytokines, as well as in microglia that are alternatively activated to produce growth factor and anti-inflammatory cytokines. However after 14 days of FKN treatme nt there was a significant reduction in the number of MHC class II+ cells. Furthermore, we found a negat ive correlation between the number of MHC-II+ cells with the number of IdU+ cells. While we cannot rule out the possibility that other pathways are involved in the effect s observed in our study, our data in aged rats strongly indicate that FKN/CX3CR1 suppression of microglia activation, at least in part, modulates hippocampal neurogenesis in aged rats. Aging is associated with chronically elevated levels of IL-1 in the hippocampus (Gemma

PAGE 60

53 and Bickford, 2007). IL-1 has been shown to act directly at the NPC via the IL-1R1 to block cell cycle progression and thereby decrease prolif eration (Koo and Duman, 2008). Moreover, we have recently shown that reducing the levels of IL-1 in aged rats is able to reverse some of the age-related decreases in neurogenesis (Gemma et al., 2007b). CX3CR1 regulates the PI3K pathway in microglia resulting in inhibiting the production of IL-1 (Re and Przedborski, 2006). We found disruption of FKN signaling by a blocking antibody to the FKN receptor CX3CR1 caused an increased production of IL-1 In the young adult rats we found that IL-1Ra completely reversed the decrease in proliferat ion and neurogenesis that resulted after blocking CX3CR1, suggesting that the effects of FKN on NP C proliferation are mediated through inhibition of IL-1 Several studies have shown that FKN can have direct effects on neurons in vitro (Meucci et al., 1998; Meucci et al., 2000; Tong et al., 2000) Using the GFP expression in the CX3CR1+/GFP mice we found that the receptor for CX3CR1 was not found on neurons in the GCL, which confirmed earlier findings in vivo that found CX3CR1 expression only in microg lia (Harrison et al., 1998; Jung et al., 2000; Cardona et al., 2006). Moreover, it has been recently s hown that the survival effects of FKN on primary neuron al culture wa s dependent on microglia (Lauro et al., 2008). These results suggest that FKN ac ts via the microglia expressed CX3CR1 to regulate IL-1 which then acts on the NPCs and neurons. The second major finding of this study is an age-related disruption of FKN/CX3CR1 signaling. Cardona et al. (06) demonstrated in a number of models of neurodegeneration that loss of neuron-microglia interactions by disruption of FKN/CX3CR1 signaling results in increased microglia neurotoxicity and an associated worsen ing in disease pathology. It is unclear if the disregulation of FKN signaling observed in our st udy is a cause or consequence of the increased activation of microglia and neuroinflammation that occurs as a result of normal aging. Levels of FKN in aged control rats were decreased in the hippocampus compared to young adult rats. The lack of alteration in FKN mRNA suggests that post-translational changes are responsible for the age-related decrease in FKN. T herefore, as a result of norma l aging, the alterations in FKN/CX3CR1 signaling are mostly likely a result of ch anges in ligand levels or post-translational processing and not alterations to the receptor as administration of exogenous FKN restored the age-related loss in neurogenesis. A ge-related changes in the FKN/CX3CR1 axis have been characterized in other scenarios. There are at least two common single nucleotide polymorphisms in the promoter region of CX3CR1 which cause reduced CX3CR1 function, including decreased adhesion, signaling, and chemotaxis of CX3CR1+ cells. These polymorphisms have been associated with reduced risk for atherosclerosis (McDermott et al., 2003) and increased risk of age-related macular degeneration (Tuo et al., 2004; Combadiere et al., 2007). Moreover, our results are in agreement with data obtained in Alzheimer’s disease patients in which lower levels of soluble plasma FKN were correlated with lower mini-mental

PAGE 61

54 status examination score(Kim et al., 2008). Additionally, APP trans genic mice showed a decrease in neuronal levels of FKN at 9 months of age (Duan et al., 2008). Conclusion Microglia have been demonstrated to be both pro and anti-neurogenic depending upon their activation state. This study demonstrates t hat neurons may actively regulate microglia in the neurogenic niche, and are not necessa rily passive actors to the effects of microglia. However with age, the dialog between neuron and microglia vi a FKN appears to be disrupted, but can be can be re-established through the addition of recombinant FKN. Inflammation is believed to be a contributing factor to the pathogenesis of a number of neurodegenerative diseases, many of which are age-related, including: Alzheimer’s disease, Parkinson’s disease, and age-related macular degeneration. Understanding the mechanism by which age-related alterations in the inflammatory response contribute to the prog ression of the aforementioned neurodegenerative diseases is key to developing therapeutic inte rventions for the age-re lated neurodegenerative condition.

PAGE 62

55 Figure 9: CX3CR1GFP/GFP mice have diminished hippocampal neurogenesis. (A) Unbiased stereology revealed a significant decrease (p=0.0062) in the number of DCX+ cells in the hippocampus of adult male CX3CR1GFP/GFP mice (n=5) compared to heterozygote control (n=4). (B) Quantification of the number of cells that were proliferating during the proceeding 24 hours, as determined by the incorporation of Br dU, was significantly fewer (p=0.026) in the CX3CR1GFP/GFP mice (n=9) compared to control (n=6). (C) CX3CR1 (GFP) and dapi (blue), demonstrate the localization of the CX3CR1 cells in the dentate gyrus. (D) Localization of CX3CR1 (GFP) cells was not found in NeuN+ cells (magenta) or in GFAP+ cells (blue), and only rarely in BrdU+ cells (red). (E). Low power photomicrograph of DCX+ cells (red) and CX3CR1 (GFP) cells are also shown in higher power in ma ximum projection of confocal z-stack (F) Arrow indicated CX3CR1 (GFP) cells that are in cl ose proximity to the DCX cells.

PAGE 63

56 Figure 10: Proliferation is decreased by -CX3CR1. Three ages of male F344 rats were treated with CX3CR1 or the IgG control for 7 days via an osmotic minipump to the left lateral ventricle. On day 6 of treatment BrdU was injected twice 8 hours apart. The animals were sacrificed on day 7. (A) Quantification of the number of BrdU+ cells in the subgranular zone, in the young adult rats revealed a significant decrease (***p=0.0009) in the number of adult young rats following -CX3CR1 (n=6) compare to IgG control (n=6). In the middle aged rats and the aged rats there was no significant differences in the number of BrdU+ cells in the IgG control group compare to the -CX3CR1 treated group. (B) The decrease in BrdU+ cells in the young rats treated with -CX3CR1 (n=4) compare to IgG control (n=3) was confirmed by Ki-67, as a significant decrease was also found in the number of Ki-67+ cells (*p=0.0156). Confirming the BrdU data, in the aged rats no difference in the number of Ki-67+ cells was found. (C) The number of DCX+ cells was also found to be significantly decreased (*p=0.0466) in the young adult rats following -CX3CR1 treatment ( CX3CR1 n=3; IgG n=4), but no effect was found in the middle aged rats or old aged.

PAGE 64

57 Figure 11: FKN reverses the agerelated decrease in neurogenesis. (A) Timeline: In experiment 1 treatment lasted for 7 days, with injections of BrdU occurring at day 6. In experiment 2, treatment lasted for 14 days, with injections of CldU occurring at day -1 and injections of IdU occurring at day 6. BrdU was used to study the affects of the treatment on proliferation of hippocampal NPC. CldU was used to study the affects of treatment on the cells born prior to the treatment. IdU was used to study the affects of survival of the cells born after treatment and to make direct comparisons with BrdU data. (B) A significant increase (p=0.0248) in proliferation (FKN n=6; HI-FKN n=6) but not in the number of DCX+ cells (FKN n=4; HI-FKN n=6) (C) was found in the aged treated with FKN for 7 days. (D) In the second experiment, in the cells born before treatment began (labeled with CldU) and lived for 15 days no difference was found between groups (FKN n=5; HI-FKN n=4). When the cells were labeled at the same time point as BrdU (B) with IdU a significant increase (p=0.0065; E) in number of IDU+ cells was found in the FKN treated group (FKN n=5; HI-FKN n=4), (H) which appeared to translated to the significant increase (p=0.0116) in the DCX+ as the two makers were strongly correlated (r=0.933; p=0.0002) (I).

PAGE 65

58 Figure 12: FKN exerts proliferative effects in aged rats. Rats were injected with BrdU on day 6 of a 7 day treated of FKN (30ng/d) or a heat-inactivated (HI)-FKN control. (A). No differences were found in the number of BrdU+ cells in the young or middle aged animals between treatment groups. As shown in figure 2B, in the aged rats a significant increase in the number of Brdu+ cells was found (p=0.0248) in the FKN treated rats compare to the control rats. (B) Quantification of DCX+ cells demonstrated an absence of a treatment effect in all three ages after 7 days of treatment. BrdU and DCX data from the 22 mo old rats was also presented in Fig 2B and 2C respectively, and was re-present ed in the supplementary data for comparison purposes.

PAGE 66

59 Figure 13: Expression of FKN in the hippocampus. Quantification of protein (A) and mRNA (B) levels of FKN in the hippocampus of young adult and aged rat, demonstrated a significant decrease in protein levels of FKN (p=0 .0005) (n=9 per group), but not in mRNA levels (n=6 per group). (C) FKN expres sion (green) was not found on Tuj1+ (red) cells, but was expressed on the majority of the cells (dapi: bl ue) in the GCL. (D) and (E), shows low and high magnification respectively, of Ki-67 staining (r ed) and FKN staining (green), with dapi (blue). Similar to the Tuj1+ cells, the Ki-67+ cells also lack FKN expression.

PAGE 67

60 Figure 14: CX3CR1 blocking antibody increases hippocampal IL-1 levels. In 3 month old male rats treated for 28 days with the blocking antibody we found a significant increase in IL-1 protein levels compared to non-immune IgG or Saline control animals. (††p=0.0023 Saline vs. IgG) (***p=0.0003 saline vs. -CX3CR1) (*p=0.039 IgG vs. -CX3CR1) (Saline n=8; IgG n=4; a-CX3CR1 n=5).

PAGE 68

61 Figure 15: IL-1Ra reverses the effects of CX3CR1. To determine if the decrease neurogenesis caused by blocking antibody to -CX3CR1 was mediated by IL-1 we infused IL-1Ra along with the blocking antibody for 7 days of treatment. On day 6, young adults rat were injected with BrdU. Gray bars are the groups that received heatinactivated IL-1Ra. White bars are groups that received active IL1Ra. (A) In the -CX3CR1/HI-IL1ra group, there was significantly fewer BrdU+ cells then the three other groups which were not different from each other. (B) IL1ra blocked the decrease in DCX+ cells caused by -CX3CR1. In the non-immune IgG group IL-1Ra (white) caused a significant decrease in the number of DCX+ cells compared to the IL-1Ra inactive control (grey). (C) A representative photomicrograph of the BrdU (gr een) and DCX (red) double labeling. Following the 14 day infusion paradigm (see Fig.3A), (D) we fo und a significant (p=0.0091) decrease in the number of CldU+ cells which were born the day before we started infusion in the -CX3CR1 (n=4) compared to the non-immune IgG group (n=5). (E ) In the 14 day experiment, a significant decrease (p=0.0406) was also found in the number of IdU+ cells in the -CX3CR1 (n=4) compared to the non-immune IgG group (n=5). (F) Quantification of the number of DCX+ cells also demonstrated a significant (p=0.0311) decrease following treatment in the -CX3CR1 (n=4) compared to the non-immune IgG group (n=5).

PAGE 69

62 Figure 16: CldU colocalizes with NeuN. CldU+ cells (red) were found to co-localize with NeuN+ cells (green) in the IgG treated group (A) and -CX3CR1 treated group (B).

PAGE 70

63 Figure 17: FKN signaling regulates microglia activation. Quantification of the number of OX-6+ cell, which is a marker for MHC class II, (A ) we found in the rats that received the blocking antibody with an inactive IL-1Ra (gray) a significant increase in the number of OX-6+ cells compared to the two non-immune IgG grou ps. (B) After 15 days of blocking antibody treatment in the young rats a similar sign ificant increase in the number of OX-6+ cells was found in the young -CX3CR1 treated rats (n=5) compared to the non-immune IgG treated rats (n=5). (C) In the aged rats after 14 days of treatment with FKN a significant decreased (p=0.0163) the number of OX-6+ cells was found in the -CX3CR1 treated rats (n=6) compared to the nonimmune IgG treated rats (n=4). (D) The number of OX-6+ cells was also found to significantly correlated with the number of IDU+ cells(r(9)=-0.7425; p=0.0219)

PAGE 71

64 Conclusions : The Role of neuroinflammation in regulating the age-related decline in neurogenesis: could restoring the balance rescue neural plasticity Introduction Deteriorations in cognitive function occur as a consequence of growing old in the absence of clear neurological damage or diseas e. Aging is the background in which many neurodegenerative diseases manifest; therefore, in understanding of the age-related alterations that occur in the central nervous system (CNS ) are an important consideration when developing therapeutic interventions for age-related neurode generative diseases. A ge-associated memory impairments, should not be considered unavoidable. On it’s on merit, strategies for ‘successful’ aging’ are worthy of scientific investigation. The hippocampus is critical structure fo r normal memory functions. Alterations in neural plasticity, not cell loss, appear to be responsible for the age-related alterations in hippocampal dependent cognitive function. There are numerous subtle age-related alterations in neural plasticity (for review see: (Burke and Barnes, 2006)). Adult neurogenesis is one form of neural plasticity that is dramatically limited with age. Adult neurogenesis The majority of the neurons in the adult centra l nervous system (CNS) are postmitotic. In the absence of pathology, neurons are believed to remain postmi totic, and survive thought the lifespan of the organism. However, an ongoing neurogenesis continues to occur in two germinal centers of the CNS: the subvent ricular zone (SVZ), and the subgranular zone (SGZ) of the dentate gyrus (DG) of the hippocampus. Adult neurogenesis is a process that involves a continuum of developmental stages. The final result of the process is that a few newly born cells are added to the existing neuronal circuitry. A dult hippocampal neurogenesis occurs in a region called the SGZ, which is roughly defined as a tw o cell diameter band on the hilus side of the granule cell layer (GCL). Proliferation of the neur al stem/progenitor cells (NPCs) produces a pool of immature cells, the majority of which will be come neurons. Following the generation of the daughter cell, the postmitotic cell goes through an early survival phase. During this phase the number of surviving neurons can vary greatly depending on the stra in of animals used and can be

PAGE 72

65 as great as ~ 75% or as few as 25% of the am ount of proliferating cells (Kempermann et al., 1997c). Moreover, in the young adult rodent, most of the regulation of neurogenesis occurs in the early survival phase and not in the proliferat ive phase (Kempermann et al., 2006). The newly born cells the majority of which do become neuron s, go through a migratory phase (Kempermann et al., 2003b), which occurs while the cells are be coming functionally mature. The adult-born neurons become morphologically and physiologically fully mature and indistinguishable by 6 to 8 weeks after birth in the young adult rodent (van Pr aag et al., 2002; Esposito et al., 2005; Zhao et al., 2006; Toni et al., 2008). Finally, an additional phase of neurogenesis appears to be the eventual death of the cell, as a c ontinual turnover of cells both ma ture and immature is necessary to 'make room' for the addition of more cells. Adult neurogenesis and memory are they related? The addition of new neurons into the hippocampus, a region of the brain important for learning and memory, has elicited interest in understanding if and how the addition of new neurons would contribute to cognitive functi on (Leuner et al., 2006; Aimone et al., 2009). However, the involvement of neurogenesis, in cognitive function is complex. Correlations, between genetic and environmental alterations, were initially used to justify the importance of neurogenesis in cognitive function. For example environmental enrichment (EE) has been shown to enhance memory and increase neurogenesis (Kempermann et al., 1997b). However, following irradiation to block neurogenesis, the behavio r improvements of EE on spatial learning in the Morris water maze (MWM) was found to be independent of neurogenesis (Meshi et al., 2006). In a subsequent experiment that used irradiation to block neurogenesis without EE, blocking neurogenesis was found to impair contextual fear conditioning with no effect on MWM (Saxe et al., 2006). Using an inducible mouse model in wh ich NPC are selectively eliminated by overexpressing the pro-apoptotic protein Bax only in nestin expressing cells found that neurogenesis was required for MWM but nor for contextual fear conditioning (Dupret et al., 2008). Often the contradictions in fact support the role of neurogenesis in cognition. A recent study by Dupret et al (2007) demonstrated that not only is the addition of new neurons into the hippocampal circuit important for cognition but so is the removal of granule cells important for cognition (Dupret et al., 2007). Like the hippocampus, several thousand newly generated neurons are added to the olfactory bulb (OB) (Lledo and Lagier, 2006). In the OB, learning of olfactory information also appears to be coupled to the survival of some newly generated neurons and the removal of others (Mouret et al., 2008). Despite the often contradictory findings, numerous studies have shown that the de novo production of neurons in the hippocampus is phys iologically relevant for cognitive function (For review see: (Leuner et al., 2006; Drapeau and Nora Abrous, 2008)). From the numerous studies that have been done the involvement of neurogenesis in cognitive function can be classified into 3 groups: 1) effects on proliferation, 2) effect s on survival, and 3) effects on cell death. It appears

PAGE 73

66 that alterations in one or more of these 3 as pects of neurogenesis can impact cognition. Neurogenesis and aging: is neurogenesis involved in age-related cognitive decline. Neurogenesis appears to continue throughout the lifespan, however studies in rodents describe a nearly linear decline in neurogenesis as a function of age. Despite the thousands of new neurons that are born every day in the y oung adult hippocampus, with age a greater then 40 fold decrease can be seen in the number of new neurons that are added into the aged hippocampus. A peak in neurogenesis occurs during adolescents, after which point, there is a continuous decline in neurogenesis until senescence when very few new cells are added to the aged brain (Ben Abdallah et al., 2008). The decline in neurogenesis has led to speculation concerning the contribution of neurogenesis to the impairments in cognit ive function that occur during normal aging? A troubling issue arises in that the decline in neurogenesis well precedes any age-related cognitive decline. The largest de crease in neurogenesis occurs between 7.5 months and 12 months of age in rats (Rao et al., 2006). A threshold hypothesis has been presented to account for this discrepancy. T he basic concept of the hypothesis is that the decrease in neurogenesis with age does not impact cognition until the level of neurogenesis reaches some physiologically minimum number of cells. Drapeau et al. (2003) addressed this thresh old hypothesis by using aged rats that are ‘good’ or ‘bad’ learners. Not all aged rats have cogn itive-impairment, at least as measured by the spatial learning task of the Morris water maze (Gal lagher et al., 1993). Numerous studies over the years have used the natural variation in cognitive function in aged rats to investigate if there are differences in between the rats that demonstrat e impaired cognition compare to the rats whose cognitive performance is equal to that of a young rat. Drapeau et al (2003) exploited these natural variations in cognitive function to ask the question if neurogenesis could be involved in age induced cognitive impairments. The results of thei r study demonstrated that rats that were defined as being cognitively un-impaired had increased pr oliferation of the NPC and more neurogenesis then cognitively impaired rats. However, while t he cognitively intact rats had more neurogenesis than the impaired rats, the cognitively intact ra ts still had great deal less neurogenesis then the young rats. Moreover, in the young rats then am ount of neurogenesis did not correlated with cognitive performance (Drapeau et al., 2003). The resu lts of Drapeau et al. (2003) were directly contradicted by Bizon et al. (2004) who showed t hat the aged cognitively impaired rats had more neurogenesis (Bizon et al., 2004). Moreover, other reports have showed that neurogenesis does not correlate with spatial learning (Bizon and Gallagher, 2003; Merrill et al., 2003). Where do we put all these new neurons? An estimated 9000 new neurons are added each day to the hippocampus (cammeron and Mckay 2001), but the total number of neurons in the hippocampus has been shown to be stable over the entire lifespan, including in elderly. From the first month of life, to one year of age the number of granule cells in the dentate gyrus does increase in rodents (Bayer et al., 1982).

PAGE 74

67 However the increase in size is no where near the amount that would be expected, based upon the number of cells born in the SGZ. Moreover despite the decrease in neurogenesis with age the total number of granule cells does not decre ase in the aged rat. Therefore it appears that tissue homeostasis (total number of granule ce lls) in the dentate gyrus appears to be tightly regulated. To maintain tissue homeostasis n eurogenesis must be coupled to a process of programmed cell death (PCD). This process oc curs in tissues thoughtout the body, but until discovery of adult neurogenesis, the central nerv ous system (CNS) was believed to be exempt from this process. In fact, excluding disease or injury, the neurons we are born with are presumed to be the same neurons that we will die with. However, in the hippocampus and in the SVZ neurons are born every day, requiring the homeost atic death and removal or older neurons in these two neurogenic regions (Biebl et al., 2000). BCL-2 (B-Cell Leukemia 2) is the prototypical member of the Bcl-2 family of apoptotic regulatory proteins. BCL-2 is an anti-apoptotic protein. The balance between the pro vs antiapoptotic BCL-2 family members following an apoptotic stimuli determines if the cell lives or dies (Oltvai et al., 1993). Bax and Bak are two of the m any members of the proapoptotic of the BCL-2 family. Using neuronal cell cultures from Bak-/-Bax-/mice it was found that NPC require Bak and Bid to induce excitotoxic PCD; whereas, mature neurons do not require Bak and Bid to induce PCD (Lindsten et al., 2003). Sun et al. (04) was t he first to investigate the biochemical pathways that regulate the PCD in adult-born neurons, th rough the use of Bax deficient mice. The Bax deficiency resulted in an absence of apoptosis in the adult DG, without any alterations in the production of new neurons. In the wild type mi ce the number of neurons in the DG remained stable from 2 months to 12 months of age. In comparison, there was an age-dependent increase in the number of cells in the DG in the Bax defic ient mice (Sun et al., 2004). Kuhn et al. (05) replicated the findings of Sun et al. (04) throug h the overexpression of BCL-2 in transgenic (Tg) mice The overexpression of BCL-2 reduced by did not completely block apoptosis. The increase in neurogenesis was also not as dramat ic as that seen following Bax deficiency. The total number of cells in the GCL was also incr eased in the BCL-2 Tg mice (Kuhn et al., 2005). The BCL-2 Tg mice have also been shown to hav e cognitive deficits (Rondi-Reig et al., 2001). These results support the notion that the loss of neurons is important for cognition (Dupret et al., 2007). Microglia Regulation of cell death in developmental and adult neurogenesis Microglia are immune cellular component and t he professional phagocyte of the brains. Recognition of pathogen associated molecular patte rn (PAMPs) and is recognized by microglia pattern-recognition receptors (PRR). The most common PAMP used experimentally, particularly in neuroscience research, is lipopolysacchari de (LPS). LPS a major component of the outer membrane of gram-negative bacteria and is us ed to induce inflammation in the CNS to understand the involvement of the immunity in a par ticular condition. LPS can be very useful, as a

PAGE 75

68 way to induce a replicable and specific immune response. However, LPS induces a microbial defense immunity, resulting in the activati on of pro-inflammatory pathways, producing inflammatory mediators including cytokines and chemokines. The response to eliminate the ‘danger signals’ does not discriminate and will also cause damage to the uninfected tissue. Besides the PRRs, microglia also express a number of scavenger receptors that are involved in the recognition and removal of dead cells and other cellular debris; such as A In many ways the process of adult neurogenesi s recapitulates events during embryonic development. During development of the nervous sy stems, in excess of neurons are born then ultimately survive into adulthood. (Oppenheim, 1991). It has been hypothesized that during development the excess of cells are produced to allow for a competition between the newly born neurons for trophic support from other neurons a nd glia (Oppenheim, 1991). The competition for trophic support, results in a proportion of the cells being eliminated. The ‘pruning’ of the excess cells, presumably by some form of PCD, l eaves the cell which received the adequate trophic support to survive and be integrated in the neuro nal circuit (Oppenheim, 1991). A similar process is believed to occur during adult neurogenesis as well. During development the dead cells are recognize d and removed phagocytes. In the brain the dead cells are recognized by microglia and are removed (Mallat et al., 2005). The primary ‘eat-me’ signal expressed by dying cells is pho sphatidylserine (PS) on the outer leaflet of the plasma membrane of the apoptotic cells (Fadok et al., 1992). Severe developmental brain malformations occur if microglia are not able to recognize PS due to genetic deletion of PS receptor (Li et al., 2003). Some the ‘eat-me’ si gnals expressed by dying cells are shared with PAMP, and have therefore been called, apoptot ic cell associated molecular pattern (ACAMPs)(Savill et al., 2002). While both PAMPs and ACAMPs are recognized by the macrophage through the PRR, the response by t he macrophage is distinct. Recognition of a PAMPs by a macrophage promote an inflammatory response; whereas, recognition of an ACAMP inhibits inflammation (Stuart and Ezekowitz, 2005). Th is is important for the ‘silent’ removal of the apoptotic cells (Medzhitov, 2008). To ensure healthy cells are not the victims of over active microglia, healthy cells present an additional class of inhibitory signals which have been called ‘don’t eat me’ signals or self associated molecular patterns (SAMP). The SAMPs expressed by neurons include CD200, CD47, and fractalkine among others. Microglia are not only involved the phagocytosis of the apoptotic cells, but also contribute to demise of the apoptotic cells. If the dying cell does not present the ‘kill-me’ signals, PCD can be stopped and the cells will survive (Hoeppner et al., 2001; Reddien et al., 2001). During development two models have shown that microglia responded to the 'kill-me' signal presented by neurons with a respiratory release of ROS to kill the cells. This has been shown in the cerebellum and the hippocampus (Marin-Teva et al., 2004; Wa kselman et al., 2008). In the hippocampus the

PAGE 76

69 process was CD11b and DAP12 mediated (Wakselm an et al., 2008). As described earlier, the removal of excess neurons is important to cognit ive function as the addition of neurons. Microglia have an important role in the removal (pruning) of excess neurons. Inflammation and adult neurogenesis Two seminal studies, published simultaneousl y, a number of years ago showed that inflammation tightly regulates neurogenesis (Ekd ahl et al., 2003; Monje et al., 2003). Ekdahl et al. (03) used LPS that they delivered into the co rtex continuously by an osmotic mini pump. After 28 days of LPS there was a dramatic activation of ED-1+ cells. ED-1 (CD68) is a member of the scavenger receptors, which is highly expres sed on monocytes and some tissue macrophages. The expression of ED-1 on microglia is nor mally absent, but can be induced following an inflammatory insult, which is what was found after 28 days of intracortical infusion of LPS. In the young adult rat, LPS-induced inflammation resulted in an 85% reduction in the number of new neurons born during the inflammatory insult (Ekdahl et al., 2003). Monje et al. (03) also found that LPS given systemically also cause in in crease in microglia activation and a decrease in neurogenesis, which could be prevented by the nonsteroidal anti-inflammatory drug (NSAID) indomethacin. Toll-like receptor (TLR)-4 is the spec ific receptor for LPS. Expression of TLR-4 in CNS glial cells was found to be limited to microglia (Lehnardt et al., 2002). NPC and mature neurons have been shown to express TLR-4 (Rolls et al., 2007; Tang et al., 2007); thus, it is possible that the anti-neurogenic effects of LPS could be independent of microglia. While TLRs (particularly TLR-4) often acts a co-receptor in many immune responses, the immune response to bacteria, virus, or parasite, is quite different then that started from tissue damage. Monje et al (03) found that inflammation was also at least in part responsible for the decrease in neurogenesis after irradiation. Following irradiation there was an increase in microglia activation that could be prevented by treatment with NSAID. The treatment with the NSAID was also able to prevent anti-neurogeneic e ffects of irradiation. Microglia besides being responsible for protecting the CNS from inv ading pathogens, are also important for removing cellular debris. Microglia are the prof essional phagocytes of the brain. Microglia would appear to be the optimal cell to regulate neurogenesis. Microglia perform 3 key functions that would make them key in regulating neurogenesis. First microglia have the potential to be neurotoxic thoug h the production of reactive oxygen species thereby being involved in the removal of mature or immature cells(Marin-Teva et al., 2004; Wakselman et al., 2008). Microglia are also important for the phago cytosis of the dead cells (Mallat et al., 2005). The second way that microglia can be involved in regulating neurogenesis is through the production of cytokines. This is partic ularly true for the key innate cytokines IL-1 and TNF, with activated microglia being the major source of TNFand IL-1 in the CNS (Gebicke-Haerter, 2001)(Shaftel et al., 2008). At low concentrations TNF, induced proliferation of NPC, but at higher concentrations TNFinduced PCD (Bernardino et al., 2008). NPC cultures have been

PAGE 77

70 shown to have constitutively express the TNFRI and TNFRII (R. E. Iosif et al., 2006). TNFinduced apoptosis in the NPC is dependent on TNFRI (Sheng et al., 2005). IL-1 can also directly suppress neurogenesis by blocking the production of cyclic dependent kinesis (Iosif et al., 2006; Koo and Duman, 2008). Inflammation also alters the way the new neurons integrate into the existing neuronal circuit (Jakubs et al., 2008). T he third way in which microglia can regulate neurogenesis is by a pro-repair/ pro-neurogenic mechanism. Microglia are able to produce a number of growth factors including IGF-1 and BDNF which have been shown to promote neurogenesis (For review see:(Ziv and Schwartz, 2008)). Age-related cognitive impairment: is it a numbers game? The dramatic decrease in neurogenesis with age has led to much speculation concerning the extent in which the decline in neurogenesis c ontributes to age-related cognitive impairments. During the 1990’s, when adult neurogenesis was accepted by the scientific community the commonly held view was the total number of newly formed mature neurons would correlate with cognitive performance. To this end, the age-relat ed decline in the total number of new neurons was believe to, at least impart contribute to the cognitive decline that occurs during the course of normal aging. As discussed earlier, the result of Drapeau et al. (2003) suggest the total number of new neurons may indeed be critical for cognitive performance. However, it has become increasingly clear that in the young adult where t he addition of new neurons is in abundance, it is not so much that total number of cells that is important, but the experience-dependent regulation of addition and removal of neurons that is important for certain types of cognitive function. The same dynamic holds true in the aged brain, where rats that are aged-unimpaired demonstrate experiences dependent addition and remova l of new neurons (Drapeau et al., 2007). The primary cause for the decrease in neurogenesis in aging is due to a decrease in proliferation of the NPC (Hattiangady and Shetty, 2008). During development an excess of cells are born with the ‘fittest’ cell surviving. A simila r process occurs in young adult, where the majority of the experience-dependent regulation of neurogenes is occurs as a result of survival of the ‘fittest’ cell. If an ‘unfit’ cell is forced to surviv e by inhibiting PCD memory has been shown to be impaired (Dupret et al., 2007). What about with age where the majority of the regulation of the number of new neurons occurs at the proliferati on stage and not at the su rvival phase? Could the change at which point neurogenesis is regulated be responsible for the age-related cognitive decline? With fewer cells, there is less competition, which could allow the survival of an ‘unfit’ cell. There is no direct experimental evidence to support or reject either hypothesis. However, Bizon et al. (2004) found that aged-impaired rats had more new neurons. The results of Bizon et al. (2004) has led to the suggestion that neurogenesis is not involved in neurogenesis. However, in alternative hypothesis of the findings of Bizon et al. (2004) could be that in the aged-impaired rats ‘unfit’ cells survive. The survival of ‘unfit’ cells could be a compensatory mechanism in the aged impaired rats to overcome for losses in other fo rms of synaptic plasticity. Alternatively, the aged-

PAGE 78

71 impaired rats may be deficient in the removal of ‘ unfit’ cells resulting in abnormal connections that impair memory. Conclusion It is known that with aging and age-related neu rodegenerative diseases there is a state of chronic inflammation. The cause of the chroni c inflammation in aging is not clear. However, the age-related increase inflammation has been shown to impair neurogenesis by decreasing proliferation, survival, and integration of new born neurons. The experience dependent, integration and removal of neurons, appears to be important for cognitive attributes of neurogenesis (Aimone et al., 2009). It is plausible, that with age inflammation alters the ability of the new neurons to properly integrate into t he existing neuronal circuit in an experiencedependent manner. The total number of new neur ons may not be the best predictor of the involvement of neurogenesis in age-related cogniti ve impairment. Alternatively, the ability of the new neuron to be regulated in an experience-depe ndent manner appears most important for the neural plasticity afforded by neurogenesis. The previous three chapters, demonstrated, that inflammation does contribute to the age-related decline in neurogenesis. Figure 19 demonstrates a cartoon summary of the findings of the previous three chapters. In the future, it would be informative to determine if restoring the infl ammatory balance in humans could forestall agerelated cognitive impairments.

PAGE 79

72 Figure 18: How neuroinflammation can modul ate adult hippocampal neurogenesis.

PAGE 80

73 References Cited Aimone JB, Wiles J, Gage FH (2009) Computational influence of adult neurogenesis on memory encoding. Neuron 61:187-202. Akiyama H, Barger S, Barnum S, Bradt B, B auer J, Cole GM, Cooper NR, Eikelenboom P, Emmerling M, Fiebich BL, Finch CE, Frautschy S, Griffin WS, Hampel H, Hull M, Landreth G, Lue L, Mrak R, Mackenzie IR, McGeer PL, O'Banion MK, Pachter J, Pasinetti G, Plata-Salaman C, Rogers J, Rydel R, Shen Y, Streit W, Strohmey er R, Tooyoma I, Van Muiswinkel FL, Veerhuis R, Walker D, Webster S, Wegrzyniak B, Wenk G, Wyss-Coray T (2000) Inflammation and Alzheimer's disease. Neurobiol Aging 21:383-421. Aloisi F (2001) Immune function of microglia. Glia 36:165-179. Altman J, Das GD (1965a) Post-natal origin of microneurones in the rat brain. Nature 207:953956. Altman J, Das GD (1965b) Autoradiographic and hi stological evidence of postnatal hippocampal neurogenesis in rats. J Comp Neurol 124:319-335. Ambrogini P, Cuppini R, Cuppini C, Ciaroni S, Cecc hini T, Ferri P, Sartini S, Del Grande P (2000) Spatial learning affects immature granule cell su rvival in adult rat dentate gyrus. Neurosci Lett 286:21-24. Ames BN, Shigenaga MK (1992) Oxidants are a major contributor to aging. Ann N Y Acad Sci 663:85-96. Ames BN, Shigenaga MK, Hagen TM (1993) Oxidants, antioxidants, and the degenerative diseases of aging. Proc Natl Acad Sci U S A 90:7915-7922. Bachstetter AD, Pabon MM, Cole MJ, Hudson CE, Sanberg PR, Willing AE, Bickford PC, Gemma C (2008) Peripheral injection of human umbilical cord blood stimulates neurogenesis in the aged rat brain. BMC Neurosci 9:22. Bacon K, Baggiolini M, Broxmeyer H, Horuk R, Li ndley I, Mantovani A, Maysushima K, Murphy P, Nomiyama H, Oppenheim J, Rot A, Schall T, Tsang M, Thorpe R, Van Damme J, Wadhwa M,

PAGE 81

74 Yoshie O, Zlotnik A, Zoon K (2002) Chemokine/ch emokine receptor nomenclature. J Interferon Cytokine Res 22:1067-1068. Barrientos RM, Higgins EA, Sprunger DB, Watkins LR, Rudy JW, Maier SF (2002) Memory for context is impaired by a post context exposure injection of interleukin-1 beta into dorsal hippocampus. Behav Brain Res 134:291-298. Batchelor PE, Liberatore GT, Wong JY, Porritt MJ, Frerichs F, Donnan GA, Howells DW (1999) Activated macrophages and microglia induce dopami nergic sprouting in the injured striatum and express brain-derived neurotrophic factor and glial cell line-derived neurotrophic factor. J Neurosci 19:1708-1716. Battista D, Ferrari CC, Gage FH, Pitossi FJ (2006) Neurogenic niche modulation by activated microglia: transforming growth factor beta increase s neurogenesis in the adult dentate gyrus. Eur J Neurosci 23:83-93. Bayer SA, Yackel JW, Puri PS (1982) Neurons in the rat dentate gyrus granular layer substantially increase during juvenile and adult life. Science 216:890-892. Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, Greaves DR, Zlotnik A, Schall TJ (1997) A new class of membrane-bound chemokine with a CX3C motif. Nature 385:640-644. Beausejour CM, Campisi J (2006) Ageing: balan cing regeneration and cancer. Nature 443:404405. Beck KD, Powell-Braxton L, Widmer HR, Valverde J, Hefti F (1995) Igf1 gene disruption results in reduced brain size, CNS hypomyelination, and loss of hippocampal granule and striatal parvalbumin-containing neurons. Neuron 14:717-730. Ben Abdallah NM, Slomianka L, Vyssotski AL, Li pp HP (2008) Early age-related changes in adult hippocampal neurogenesis in C57 mice. Neurobiol Aging. Bender JG, Unverzagt KL, Walker DE, Lee W, V an Epps DE, Smith DH, Stewart CC, To LB (1991) Identification and comparison of CD34-positive cells and their subpopulations from normal peripheral blood and bone marrow using multicolor flow cytometry. Blood 77:2591-2596. Benveniste EN (1992) Inflammatory cytokines within the central nervous system: sources, function, and mechanism of action. Am J Physiol 263:C1-16. Bernal GM, Peterson DA (2004) Neural stem ce lls as therapeutic agents for age-related brain repair. Aging Cell 3:345-351.

PAGE 82

75 Bernardino L, Agasse F, Silva B, Ferreira R, Grade S, Malva JO (2008) Tumor necrosis factoralpha modulates survival, proliferation, and neu ronal differentiation in neonatal subventricular zone cell cultures. Stem Cells 26:2361-2371. Bhattacharyya BJ, Banisadr G, Jung H, Ren D, Cronshaw DG, Zou Y, Miller RJ (2008) The chemokine stromal cell-derived fa ctor-1 regulates GABAergic inputs to neural progenitors in the postnatal dentate gyrus. J Neurosci 28:6720-6730. Biber K, Neumann H, Inoue K, Boddeke HW ( 2007) Neuronal 'On' and 'Off' signals control microglia. Trends Neurosci 30:596-602. Biebl M, Cooper CM, Winkler J, Kuhn HG (2000) Analysis of neurogenesis and programmed cell death reveals a self-renewing capacity in t he adult rat brain. Neurosci Lett 291:17-20. Bizon JL, Gallagher M (2003) Production of new ce lls in the rat dentate gyrus over the lifespan: relation to cognitive decline. Eur J Neurosci 18:215-219. Bizon JL, Lee HJ, Gallagher M (2004) Neurogenesis in a rat model of age-related cognitive decline. Aging Cell 3:227-234. Blalock EM, Chen K-C, Sharrow K, Herman JP, Porter NM, Foster TC, Landfield PW (2003) Gene Microarrays in Hippocampal Aging: Stat istical Profiling Identifies Novel Processes Correlated with Cognitive Impairment. In, pp 3807-3819. Bodles AM, Barger SW (2004) Cytokines and the aging brain what we don't know might help us. Trends Neurosci 27:621-626. Borlongan CV, Hadman M, Sanberg CD, Sanberg PR (2004) Central nervous system entry of peripherally injected umbilical cord blood cells is not required for neuroprotection in stroke. Stroke 35:2385-2389. Bruel-Jungerman E, Laroche S, Rampon C (2005) New neurons in the dentate gyrus are involved in the expression of enhanced long-term memory following environmental enrichment. Eur J Neurosci 21:513-521. Bulloch K, Miller MM, Gal-Toth J, Milner TA, Gottfried-Blackmore A, Waters EM, Kaunzner UW, Liu K, Lindquist R, Nussenzweig MC, Stei nman RM, McEwen BS (2008) CD11c/EYFP transgene illuminates a discrete network of dendritic cell s within the embryonic, neonatal, adult, and injured mouse brain. J Comp Neurol 508:687-710. Burke SN, Barnes CA (2006) Neural plasticity in the ageing brain. Nat Rev Neurosci 7:30-40.

PAGE 83

76 Butovsky O, Koronyo-Hamaoui M, Kunis G, O phir E, Landa G, Cohen H, Schwartz M (2006a) Glatiramer acetate fights against Alzheimer' s disease by inducing dendritic-like microglia expressing insulin-like growth factor 1. Proc Natl Acad Sci U S A 103:11784-11789. Butovsky O, Ziv Y, Schwartz A, Landa G, Tal palar AE, Pluchino S, Martino G, Schwartz M (2006b) Microglia activated by IL-4 or IF N-gamma differentially induce neurogenesis and oligodendrogenesis from adult stem/progenitor cells. Mol Cell Neurosci 31:149-160. Butovsky O, Ziv Y, Schwartz A, Landa G, Tal palar AE, Pluchino S, Martino G, Schwartz M (2006c) Microglia activated by IL-4 or IFN[gamma] differentially induce neurogenesis and oligodendrogenesis from adult stem/progenitor cells. Molecular and Cellular Neuroscience 31:149-160. Cameron HA, McKay RDG (1999) Restoring produc tion of hippocampal neurons in old age. Nat Neurosci 2:894-897. Cameron HA, McKay RD (2001) Adult neurogenesis produces a large pool of new granule cells in the dentate gyrus. J Comp Neurol 435:406-417. Cameron HA, McEwen BS, Gould E (1995) Regulat ion of adult neurogenesis by excitatory input and NMDA receptor activation in the dentate gyrus. J Neurosci 15:4687-4692. Cameron HA, Woolley CS, McEwen BS, Gould E (1 993) Differentiation of newly born neurons and glia in the dentate gyrus of t he adult rat. Neuroscience 56:337-344. Campisi J (2005) Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell 120:513-522. Cardona AE, Pioro EP, Sasse ME, Kostenko V, Cardona SM, Dijkstra IM, Huang D, Kidd G, Dombrowski S, Dutta R, Lee JC, Cook DN, Jung S, Lira SA, Littman DR, Ransohoff RM (2006) Control of microglial neurotoxicity by the fr actalkine receptor. Nat Neurosci 9:917-924. Carlen M, Cassidy RM, Brismar H, Smith GA, Enqui st LW, Frisen J (2002) Functional integration of adult-born neurons. Curr Biol 12:606-608. Carlson ME, Conboy IM (2007) Loss of stem cell regenerative capacity within aged niches. Aging Cell 6:371-382. Casadesus G, Shukitt-Hale B, Stellwagen HM, Zhu X, Lee HG, Smith MA, Joseph JA (2004) Modulation of hippocampal plasticity and c ognitive behavior by short-term blueberry supplementation in aged rats. Nutr Neurosci 7:309-316.

PAGE 84

77 Chen J, Sanberg PR, Li Y, Wang L, Lu M, Willing AE, Sanchez-Ramo s J, Chopp M (2001) Intravenous administration of human umbilical cord blood reduces behavioral deficits after stroke in rats. Stroke 32:2682-2688. Cheng CM, Cohen M, Tseng V, Bondy CA (2001) En dogenous IGF1 enhances cell survival in the postnatal dentate gyrus. J Neurosci Res 64:341-347. Christie BR, Cameron HA (2006) Neurogenesis in the adult hippocampus. Hippocampus 16:199207. Coleman GL, Barthold W, Osbaldiston GW, Fost er SJ, Jonas AM (1977) Pathological changes during aging in barrier-reared Fischer 344 male rats. J Gerontol 32:258-278. Collado M, Blasco MA, Serrano M (2007) Cellular senescence in cancer and aging. Cell 130:223233. Combadiere C, Feumi C, Raoul W, Keller N, Rodero M, Pezard A, Lavalette S, Houssier M, Jonet L, Picard E, Debre P, Sirinyan M, Deterre P, Ferroukhi T, Cohen SY, Chauvaud D, Jeanny JC, Chemtob S, Behar-Cohen F, Sennlaub F (2007) CX 3CR1-dependent subretinal microglia cell accumulation is associated with cardinal featur es of age-related macular degeneration. J Clin Invest 117:2920-2928. Conboy IM, Conboy MJ, Wagers AJ, Girma ER, We issman IL, Rando TA (2005) Rejuvenation of aged progenitor cells by exposure to a young systemic environment. Nature 433:760-764. Cook DN, Chen SC, Sullivan LM, Manfra DJ, Wiek owski MT, Prosser DM, Vassileva G, Lira SA (2001) Generation and analysis of mice lacking the chemokine fractalkine. Mol Cell Biol 21:31593165. Corasaniti MT, Russo R, Amantea D, Gliozzi M, Siviglia E, Stringaro AR, Malorni W, Melino G, Bagetta G (2005) Neuroprotection by the caspase-1 inhibitor Ac-YVAD-(acyloxy)mk in experimental neuroAIDS is independent from IL -1beta generation. Cell Death Differ 12 Suppl 1:999-1001. Couillard-Despres S, Winner B, Schaubeck S, Aigner R, Vroemen M, Weidner N, Bogdahn U, Winkler J, Kuhn HG, Aigner L (2005) Doublecortin expression levels in adult brain reflect neurogenesis. Eur J Neurosci 21:1-14. Crump MP, Gong JH, Loetscher P, Rajarathnam K, Amara A, Arenzana-Seisdedos F, Virelizier JL, Baggiolini M, Sykes BD, Clark-Lewis I (1997 ) Solution structure and basis for functional activity of stromal cell-deriv ed factor-1; dissociation of CXCR4 activation from binding and inhibition of HIV-1. EMBO J 16:6996-7007.

PAGE 85

78 Cserr HF, Knopf PM (1992) Cervic al lymphatics, the blood-brain ba rrier and the immunoreactivity of the brain: a new view. Immunol Today 13:507-512. Davalos D, Grutzendler J, Yang G, Kim JV, Z uo Y, Jung S, Littman DR, Dustin ML, Gan WB (2005) ATP mediates rapid microglial response to local brain injury in vivo. Nat Neurosci 8:752758. de Quervain DJ, Roozendaal B, McGaugh JL (1998) Stress and glucocorticoids impair retrieval of long-term spatial memory. Nature 394:787-790. Denes A, Ferenczi S, Halasz J, Kornyei Z, Ko vacs KJ (2008) Role of CX3CR1 (fractalkine receptor) in brain damage and inflammation induc ed by focal cerebral ischemia in mouse. J Cereb Blood Flow Metab 28:1707-1721. DeVries ME, Cao H, Wang J, Xu L, Kelvin AA, R an L, Chau LA, Madrenas J, Hegele RA, Kelvin DJ (2003) Genomic organization and evolution of the CX3CR1/CCR8 chemokine receptor locus. J Biol Chem 278:11985-11994. Dinarello CA (1998) Interleukin-1, interleukin-1 receptors and interleukin-1 receptor antagonist. Int Rev Immunol 16:457-499. Dobrossy MD, Drapeau E, Aurousseau C, Le Moal M, Piazza PV, Abrous DN (2003) Differential effects of learning on neurogenesis: learning in creases or decreases the number of newly born cells depending on their birth dat e. Mol Psychiatry 8:974-982. Drapeau E, Nora Abrous D (2008) Stem cell review series: role of neurogenesis in age-related memory disorders. Aging Cell 7:569-589. Drapeau E, Montaron MF, Aguerre S, Abrous DN (2007) Learning-induced survival of new neurons depends on the cognitive status of aged rats. J Neurosci 27:6037-6044. Drapeau E, Mayo W, Aurousseau C, Le Moal M, Piazza PV, Abrous DN (2003) Spatial memory performances of aged rats in the water maze predict levels of hippocampal neurogenesis. Proc Natl Acad Sci U S A 100:14385-14390. Duan RS, Yang X, Chen ZG, Lu MO, Morris C, Winblad B, Zhu J (2008) Decreased fractalkine and increased IP-10 expr ession in aged brain of APP(swe) transgenic mice. Neurochem Res 33:1085-1089. Dupret D, Revest JM, Koehl M, Ichas F, De Gior gi F, Costet P, Abrous DN, Piazza PV (2008) Spatial relational memory requires hippoca mpal adult neurogenesis. PLoS ONE 3:e1959.

PAGE 86

79 Dupret D, Fabre A, Dobrossy MD, Panatier A, Rodriguez JJ, Lamarque S, Lemaire V, Oliet SH, Piazza PV, Abrous DN (2007) Spatial learning depends on both the addition and removal of new hippocampal neurons. PLoS Biol 5:e214. Ekdahl CT, Claasen JH, Bonde S, Kokaia Z, Lindva ll O (2003) Inflammation is detrimental for neurogenesis in adult brain. Proc Natl Acad Sci U S A 100:13632-13637. Eriksson PS, Perfilieva E, Bjork-Eriksson T, Alborn AM, Nordborg C, Peterson DA, Gage FH (1998) Neurogenesis in the adult human hippocampus. Nat Med 4:1313-1317. Esposito MS, Piatti VC, Laplagne DA, Morgenst ern NA, Ferrari CC, Pitossi FJ, Schinder AF (2005) Neuronal differentiation in the adult hippocampus recapitulates embryonic development. J Neurosci 25:10074-10086. Fadok VA, Voelker DR, Campbell PA, Cohen JJ, Br atton DL, Henson PM (1992) Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J Immunol 148:2207-2216. Farrar WL, Kilian PL, Ruff MR, Hill JM, Pert CB (1987) Visualization and characterization of interleukin 1 receptors in brain. J Immunol 139:459-463. Faure S, Meyer L, Costagliola D, Vaneensbe rghe C, Genin E, Autran B, Delfraissy JF, McDermott DH, Murphy PM, Debre P, Theodorou I, Combadiere C (2000) Rapid progression to AIDS in HIV+ individuals with a structural vari ant of the chemokine receptor CX3CR1. Science 287:2274-2277. Fuller AD, Van Eldik LJ (2008) MFG-E8 regulates microglial phagocytosis of apoptotic neurons. J Neuroimmune Pharmacol 3:246-256. Gage FH (2002) Neurogenesis in the adult brain. J Neurosci 22:612-613. Gallagher M, Burwell R, Burchinal M (1993) Se verity of spatial learning impairment in aging: development of a learning index for performanc e in the Morris water maze. Behav Neurosci 107:618-626. Gao HM, Jiang J, Wilson B, Zhang W, Hong JS, Liu B (2002) Microglial activation-mediated delayed and progressive degeneration of rat nigral dopaminergic neurons: relevance to Parkinson's disease. J Neurochem 81:1285-1297. Garton KJ, Gough PJ, Blobel CP, Murphy G, Greaves DR, Dempsey PJ, Raines EW (2001) Tumor necrosis factor-alpha-converting enzyme (ADAM17) mediates the cleavage and shedding of fractalkine (CX3CL1). J Biol Chem 276:37993-38001.

PAGE 87

80 Gemma C, Bickford PC (2007) Interleukin-1beta and caspase-1: players in the regulation of agerelated cognitive dysfunction. Rev Neurosci 18:137-148. Gemma C, Fister M, Hudson C, Bickford PC (2 005) Improvement of memory for context by inhibition of caspase-1 in aged rats. Eur J Neurosci 22:1751-1756. Gemma C, Mesches MH, Sepesi B, Choo K, Holmes DB, Bickford PC (2002) Diets enriched in foods with high antioxidant activity reverse ageinduced decreases in cerebellar beta-adrenergic function and increases in proinflammator y cytokines. J Neurosci 22:6114-6120. Gemma C, Bachstetter AD, Cole M, Fister M, Hudson C, Bickford PC (2007a) Blockade of Caspase-1 Increases Neurogenesis in the A ged Hippocampus. Eur J Neurosci:In press. Gemma C, Bachstetter AD, Cole MJ, Fister M, Hudson C, Bickford PC (2007b) Blockade of caspase-1 increases neurogenesis in the aged hippocampus. Eur J Neurosci 26:2795-2803. Giulian D, Baker TJ, Shih LC, Lachman LB (1986) Interleukin 1 of the central nervous system is produced by ameboid microglia. J Exp Med 164:594-604. Godbout JP, Johnson RW (2004) Interleukin-6 in the aging brain. J Neuroimmunol 147:141-144. Goronzy JJ, Weyand CM (2005) T cell development and receptor diversity during aging. Curr Opin Immunol 17:468-475. Gould E, Tanapat P, Hastings NB, Shors TJ ( 1999a) Neurogenesis in adulthood: a possible role in learning. Trends Cogn Sci 3:186-192. Gould E, Tanapat P, McEwen BS, Flugge G, Fuchs E (1998) Proliferation of granule cell precursors in the dentate gyrus of adult monkeys is diminished by stress. Proc Natl Acad Sci U S A 95:3168-3171. Gould E, Beylin A, Tanapat P, Reeves A, Shors TJ (1999b) Learning enhances adult neurogenesis in the hippocampal form ation. Nat Neurosci 2:260-265. Griffin WS, Stanley LC, Ling C, White L, MacL eod V, Perrot LJ, White CL, 3rd, Araoz C (1989) Brain interleukin 1 and S-100 immunoreactivity are elevated in Down syndrome and Alzheimer disease. Proc Natl Acad Sci U S A 86:7611-7615. Harman D (1956) Aging: a theory based on free ra dical and radiation chemistry. J Gerontol 11:298-300.

PAGE 88

81 Harrison JK, Jiang Y, Chen S, Xia Y, Maciejewsk i D, McNamara RK, Streit WJ, Salafranca MN, Adhikari S, Thompson DA, Botti P, Bacon KB, Feng L (1998) Role for neuronally derived fractalkine in mediating interactions between neurons and CX3CR1-expressing microglia. Proc Natl Acad Sci U S A 95:10896-10901. Haskell CA, Hancock WW, Salant DJ, Gao W, Csizmadia V, Peters W, Faia K, Fituri O, Rottman JB, Charo IF (2001) Targeted deletion of CX(3)CR1 reveals a role for fractalkine in cardiac allograft rejection. J Clin Invest 108:679-688. Hastings NB, Gould E (1999) Rapid extension of axons into the CA3 region by adult-generated granule cells. J Comp Neurol 413:146-154. Hattiangady B, Shetty AK (2006) Aging does not alter the number or phenotype of putative stem/progenitor cells in the neurogenic regi on of the hippocampus. Neurobiol Aging. Hattiangady B, Shetty AK (2008) Aging does not alter the number or phenotype of putative stem/progenitor cells in the neurogenic region of the hippocampus. Neurobiol Aging 29:129-147. Hattiangady B, Rao MS, Shetty GA, Shetty AK (2005) Brain-derived neurotrophic factor, phosphorylated cyclic AMP response element binding protein and neuropeptide Y decline as early as middle age in the dentate gyrus and CA1 and CA3 subfields of the hippocampus. Experimental Neurology 195:353-371. Hayflick L, Moorhead PS (1961) The serial cultivat ion of human diploid cell strains. Exp Cell Res 25:585-621. Haynes L, Eaton SM, Burns EM, Randall TD, Sw ain SL (2003) CD4 T cell memory derived from young naive cells functions well into old age, but memory generated from aged naive cells functions poorly. Proc Natl Acad Sci U S A 100:15053-15058. Hickey WF (2001) Basic principles of immunolog ical surveillance of the normal central nervous system. Glia 36:118-124. Ho AD, Young D, Maruyama M, Corringham RE, Mason JR, Thompson P, Grenier K, Law P, Terstappen LW, Lane T (1996) Pluripotent and lineage-committed CD34+ subsets in leukapheresis products mobilized by G-CSF, GM -CSF vs. a combination of both. Exp Hematol 24:1460-1468. Hoeppner DJ, Hengartner MO, Schnabel R (2001) Engulfment genes cooperate with ced-3 to promote cell death in Caenorhabditis elegans. Nature 412:202-206. Hoglinger GU, Rizk P, Muriel MP, Duyckaerts C, Oertel WH, Caille I, Hirsch EC (2004) Dopamine depletion impairs precursor cell proliferation in Parkinson disease. Nat Neurosci 7:726-735.

PAGE 89

82 Hundhausen C, Misztela D, Berkhout TA, Broadway N, Saftig P, Reiss K, Hartmann D, Fahrenholz F, Postina R, Matthews V, Kallen KJ, Rose-John S, Ludwig A (2003) The disintegrinlike metalloproteinase ADAM10 is involved in cons titutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1-mediated cell-cell adhesion. Blood 102:1186-1195. Imai T, Hieshima K, Haskell C, Baba M, Nagi ra M, Nishimura M, Kakizaki M, Takagi S, Nomiyama H, Schall TJ, Yoshie O (1997) Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell 91:521-530. Iosif RE, Ekdahl CT, Ahlenius H, Pronk CJ, Bond e S, Kokaia Z, Jacobsen SE, Lindvall O (2006) Tumor necrosis factor receptor 1 is a negative regulator of progenitor proliferation in adult hippocampal neurogenesis. J Neurosci 26:9703-9712. Jakubs K, Bonde S, Iosif RE, Ekdahl CT, Kokaia Z, Kokaia M, Lindvall O (2008) Inflammation regulates functional integration of neurons born in adult brain. J Neurosci 28:12477-12488. Ji JF, He BP, Dheen ST, Tay SS (2004) Expres sion of chemokine receptors CXCR4, CCR2, CCR5 and CX3CR1 in neural progenitor cells isol ated from the subventricular zone of the adult rat brain. Neurosci Lett 355:236-240. Joseph JA, Shukitt-Hale B, Casadesus G, Fisher D (2005) Oxidative stress and inflammation in brain aging: nutritional considerations. Neurochem Res 30:927-935. Jung S, Aliberti J, Graemmel P, Sunshine MJ, Kreutzberg GW, Sher A, Littman DR (2000) Analysis of fractalkine receptor CX(3)CR1 fu nction by targeted deletion and green fluorescent protein reporter gene insertion. Mol Cell Biol 20:4106-4114. Kee N, Teixeira CM, Wang AH, Frankland PW (2007) Preferential incorporation of adultgenerated granule cells into spatial memory netwo rks in the dentate gyrus. Nat Neurosci 10:355362. Kempermann G, Gage FH (2002) Genetic deter minants of adult hippocampal neurogenesis correlate with acquisition, but not probe trial perfor mance, in the water maze task. Eur J Neurosci 16:129-136. Kempermann G, Kuhn HG, Gage FH (1997a) Genet ic influence on neurogenesis in the dentate gyrus of adult mice. Proc Natl Acad Sci U S A 94:10409-10414. Kempermann G, Kuhn HG, Gage FH (1997b) More hippocampal neurons in adult mice living in an enriched environment. Nature 386:493-495.

PAGE 90

83 Kempermann G, Kuhn HG, Gage FH (1997c) Gene tic influence on neurogenesis in the dentate gyrus of adult mice. In, pp 10409-10414. Kempermann G, Kuhn HG, Gage FH (1998) Experie nce-induced neurogenesis in the senescent dentate gyrus. J Neurosci 18:3206-3212. Kempermann G, Gast D, Gage FH (2002) Neuroplast icity in old age: sustained fivefold induction of hippocampal neurogenesis by long-term envir onmental enrichment. Ann Neurol 52:135-143. Kempermann G, Gast D, Kronenberg G, Yamagu chi M, Gage FH (2003a) Early determination and long-term persistence of adult-generated new neurons in the hippocampus of mice. Development 130:391-399. Kempermann G, Gast D, Kronenberg G, Yamagu chi M, Gage FH (2003b) Early determination and long-term persistence of adult-generated new neurons in the hippocampus of mice. In, pp 391-399. Kempermann G, Chesler EJ, Lu L, Williams RW, Gage FH (2006) Natural variation and genetic covariance in adult hippocampal neurogenesis. Proc Natl Acad Sci U S A 103:780-785. Kim KD, Zhao J, Auh S, Yang X, Du P, Tang H, Fu YX (2007) Adaptive immune cells temper initial innate responses. Nat Med 13:1248-1252. Kim TS, Lim HK, Lee JY, Kim DJ, Park S, Lee C, Lee CU (2008) Changes in the levels of plasma soluble fractalkine in patients with mild cognitive impairment and Alzheimer's disease. Neurosci Lett 436:196-200. Kipnis J, Avidan H, Caspi RR, Schwartz M (2004) Du al effect of CD4+CD25+ regulatory T cells in neurodegeneration: a dialogue with microglia. Proc Natl Acad Sci U S A 101 Suppl 2:1466314669. Kokaia Z, Lindvall O (2003) Neurogenesis after ischaemic brain insults. Curr Opin Neurobiol 13:127-132. Kolodziej A, Schulz S, Guyon A, Wu DF, Pfeiffer M, Odemis V, Hollt V, Stumm R (2008) Tonic activation of CXC chemokine receptor 4 in immatu re granule cells supports neurogenesis in the adult dentate gyrus. J Neurosci 28:4488-4500. Koo JW, Duman RS (2008) IL-1beta is an esse ntial mediator of the antineurogenic and anhedonic effects of stress. Proc Natl Acad Sci U S A 105:751-756.

PAGE 91

84 Krabbe KS, Pedersen M, Bruunsgaard H (2004) In flammatory mediators in the elderly. Exp Gerontol 39:687-699. Krathwohl MD, Kaiser JL (2004) Chemokines pr omote quiescence and survival of human neural progenitor cells. Stem Cells 22:109-118. Kronenberg G, Bick-Sander A, Bunk E, Wolf C, Ehninger D, Kempermann G (2006a) Physical exercise prevents age-related decline in precurso r cell activity in the mouse dentate gyrus. Neurobiol Aging 27:1505-1513. Kronenberg G, Bick-Sander A, Bunk E, Wolf C, Ehninger D, Kempermann G (2006b) Physical exercise prevents age-related decline in precurso r cell activity in the mouse dentate gyrus. Neurobiology of Aging 27:1505-1513. Kuhn HG, Dickinson-Anson H, Gage FH (1996) Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci 16:2027-2033. Kuhn HG, Biebl M, Wilhelm D, Li M, Friedlander RM, Winkler J (2005) Increased generation of granule cells in adult Bcl-2-overexpressing mice: a role for cell death during continued hippocampal neurogenesis. Eur J Neurosci 22:1907-1915. Labrada L, Liang XH, Zheng W, Johnston C, Levine B (2002) Age-dependent resistance to lethal alphavirus encephalitis in mice: analysis of gene ex pression in the central nervous system and identification of a novel inte rferon-inducible protective gene, mouse ISG12. J Virol 76:1168811703. Lauro C, Di Angelantonio S, Cipriani R, Sobrero F, Antonilli L, Brusadin V, Ragozzino D, Limatola C (2008) Activity of adenosine receptors type 1 Is required for CX3CL1-mediated neuroprotection and neuromodulation in hippocampal neurons. J Immunol 180:7590-7596. Lee SC, Liu W, Dickson DW, Brosnan CF, Berman JW (1993) Cytokine production by human fetal microglia and astrocytes. Differential induction by lipopolysaccharide and IL-1 beta. J Immunol 150:2659-2667. Lehnardt S, Lachance C, Patrizi S, Lefebvre S, Follett PL, Jensen FE, Rosenberg PA, Volpe JJ, Vartanian T (2002) The toll-like receptor TLR4 is necessary for lipopolysaccharide-induced oligodendrocyte injury in the CNS. J Neurosci 22:2478-2486. Lemaire V, Koehl M, Le Moal M, Abrous DN (2 000) Prenatal stress produces learning deficits associated with an inhibition of neurogenesis in the hippocampus. Proc Natl Acad Sci U S A 97:11032-11037.

PAGE 92

85 Leuner B, Gould E, Shors TJ (2006) Is there a link between adult neurogenesis and learning? Hippocampus 16:216-224. Leuner B, Mendolia-Loffredo S, Kozorovitskiy Y, Samburg D, Gould E, Shors TJ (2004) Learning enhances the survival of new neurons beyond t he time when the hippocampus is required for memory. J Neurosci 24:7477-7481. Li MO, Sarkisian MR, Mehal WZ, Rakic P, Flavell RA (2003) Phosphatidylserine receptor is required for clearance of apoptotic cells. Science 302:1560-1563. Lichtenwalner RJ, Forbes ME, Bennett SA, Lynch CD, Sonntag WE, Riddle DR (2001) Intracerebroventricular infusion of insulin-like growth factor-I ameliorates the age-related decline in hippocampal neurogenesis. Neuroscience 107:603-613. Lie DC, Song H, Colamarino SA, Ming GL, Gage FH (2004) Neurogenesis in the adult brain: new strategies for central nervous system di seases. Annu Rev Pharmacol Toxicol 44:399-421. Limatola C, Lauro C, Catalano M, Ciotti MT, Bert ollini C, Di Angelantonio S, Ragozzino D, Eusebi F (2005) Chemokine CX3CL1 protects rat hippocampal neurons against glutamate-mediated excitotoxicity. J Neuroimmunol 166:19-28. Lindsten T, Golden JA, Zong WX, Minarcik J, Ha rris MH, Thompson CB (2003) The proapoptotic activities of Bax and Bak limit the size of the neural stem cell pool. J Neurosci 23:11112-11119. Lledo PM, Lagier S (2006) Adjusting neurophysiological computations in the adult olfactory bulb. Semin Cell Dev Biol 17:443-453. Lucas AD, Chadwick N, Warren BF, Jewell DP, Gordon S, Powrie F, Greaves DR (2001) The transmembrane form of the CX3CL1 chemokine fr actalkine is expressed predominantly by epithelial cells in vivo. Am J Pathol 158:855-866. Ludwig A, Berkhout T, Moores K, Groot P, Chapman G (2002) Fractalkine is expressed by smooth muscle cells in response to IFN-gamma and TNF-alpha and is modulated by metalloproteinase activity. J Immunol 168:604-612. Luine V, Villegas M, Martinez C, McEwen BS (1994) Stress-dependent impairments of spatial memory. Role of 5-HT. Ann N Y Acad Sci 746:403-404. Lynch MA (1998) Age-related impairment in long-te rm potentiation in hippocampus: a role for the cytokine, interleukin-1 beta? Prog Neurobiol 56:571-589.

PAGE 93

86 Lynch MA (2002) Interleukin-1 beta exerts a myriad of effects in the brain and in particular in the hippocampus: analysis of some of these actions. Vitam Horm 64:185-219. Mackowiak M, Chocyk A, Markowicz-Kula K, We dzony K (2004) Neurogenesis in the adult brain. Pol J Pharmacol 56:673-687. Mallat M, Marin-Teva JL, Cheret C (2005) Phagocytosis in the developing CNS: more than clearing the corpses. Curr Opin Neurobiol 15:101-107. Mantovani A, Sica A, Locati M (2007) New vist as on macrophage differentiation and activation. Eur J Immunol 37:14-16. Mantovani A, Sica A, Sozzani S, Allavena P, Ve cchi A, Locati M (2004) The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 25:677-686. Marin-Teva JL, Dusart I, Colin C, Gervais A, v an Rooijen N, Mallat M (2004) Microglia promote the death of developing Purkinje cells. Neuron 41:535-547. Markakis EA, Gage FH (1999) Adult-generated neurons in the dentate gyrus send axonal projections to field CA3 and are surrounded by synaptic vesicles. J Comp Neurol 406:449-460. McDermott DH, Halcox JP, Schenke WH, Waclaw iw MA, Merrell MN, Epstein N, Quyyumi AA, Murphy PM (2001) Association between polymor phism in the chemokine receptor CX3CR1 and coronary vascular endothelial dysfunction and atherosclerosis. Circ Res 89:401-407. McDermott DH, Fong AM, Yang Q, Sechler JM, Cu pples LA, Merrell MN, Wilson PW, D'Agostino RB, O'Donnell CJ, Patel DD, Murphy PM (2003) Chemokine receptor mutant CX3CR1-M280 has impaired adhesive function and correlates with prot ection from cardiovascular disease in humans. J Clin Invest 111:1241-1250. Medzhitov R (2008) Origin and physiological roles of inflammation. Nature 454:428-435. Mellado M, Rodriguez-Frade JM, Manes S, Martinez AC (2001) Chemokine signaling and functional responses: the role of receptor dimerization and TK pathway activation. Annu Rev Immunol 19:397-421. Merrill DA, Karim R, Darraq M, Chiba AA, Tuszynski MH (2003) Hippocampal cell genesis does not correlate with spatial learning ability in aged rats. J Comp Neurol 459:201-207. Mesches MH, Gemma C, Veng LM, Allgeier C, Young DA, Browning MD, Bickford PC (2004) Sulindac improves memory and increases NMDA receptor subunits in aged Fischer 344 rats. Neurobiol Aging 25:315-324.

PAGE 94

87 Meshi D, Drew MR, Saxe M, Ansorge MS, David D, Santarelli L, Malapa ni C, Moore H, Hen R (2006) Hippocampal neurogenesis is not requi red for behavioral effects of environmental enrichment. Nat Neurosci 9:729-731. Meucci O, Fatatis A, Simen AA, Miller RJ (200 0) Expression of CX3CR1 chemokine receptors on neurons and their role in neuronal survival. Proc Natl Acad Sci U S A 97:8075-8080. Meucci O, Fatatis A, Simen AA, Bushell TJ, Gray PW, Miller RJ (1998) Chemokines regulate hippocampal neuronal signaling and gp120 neurotoxicity. Proc Natl Acad Sci U S A 95:1450014505. Miller RA (1996) The aging immune system: primer and prospectus. Science 273:70-74. Milligan ED, Zapata V, Chacur M, Schoeniger D, Biedenkapp J, O'Connor KA, Verge GM, Chapman G, Green P, Foster AC, Naeve GS, Maier SF, Watkins LR (2004) Evidence that exogenous and endogenous fractalkine can induce sp inal nociceptive facilitation in rats. Eur J Neurosci 20:2294-2302. Ming GL, Song H (2005) Adult neurogenesis in the mammalian central nervous system. Annu Rev Neurosci 28:223-250. Mirescu C, Gould E (2006) Stress and a dult neurogenesis. Hippocampus 16:233-238. Miwa T, Furukawa S, Nakajima K, Furukawa Y, Kohsaka S (1997) Lipopolysaccharide enhances synthesis of brain-derived neurotrophic factor in cultured rat microglia. J Neurosci Res 50:10231029. Mizoue LS, Bazan JF, Johnson EC, Handel TM (1999) Solution structure and dynamics of the CX3C chemokine domain of fractalkine and its in teraction with an N-terminal fragment of CX3CR1. Biochemistry 38:1402-1414. Mizuno T, Kawanokuchi J, Numata K, Suzu mura A (2003) Production and neuroprotective functions of fractalkine in the centra l nervous system. Brain Res 979:65-70. Moatti D, Faure S, Fumeron F, Amara Mel W, Seknadji P, McDermott DH, Debre P, Aumont MC, Murphy PM, de Prost D, Combadiere C (2001) Poly morphism in the fractalkine receptor CX3CR1 as a genetic risk factor for coronary artery disease. Blood 97:1925-1928. Molofsky AV, Slutsky SG, Joseph NM, He S, Par dal R, Krishnamurthy J, Sharpless NE, Morrison SJ (2006) Increasing p16INK4a expression decreases forebrain progenitors and neurogenesis during ageing. Nature 443:448-452.

PAGE 95

88 Monje ML, Toda H, Palmer TD (2003) Inflammatory blockade restores adult hippocampal neurogenesis. Science 302:1760-1765. Mooradian AD (1988) Effect of aging on t he blood-brain barrier. Neurobiol Aging 9:31-39. Mooradian AD (1994) Potential mechanisms of the age-related chang es in the blood-brain barrier. Neurobiol Aging 15:751755; discussion 761-752, 767. Morita T, Mizutani Y, Sawada M, Shimada A (2 005) Immunohistochemical and ultrastructural findings related to the blood--brain barrier in t he blood vessels of the cerebral white matter in aged dogs. J Comp Pathol 133:14-22. Mouret A, Gheusi G, Gabellec MM, de Chaumont F, Olivo-Marin JC, Lledo PM (2008) Learning and survival of newly generated neurons: when time matters. J Neurosci 28:11511-11516. Mrak RE, Griffin WS (2001) Interleukin-1, neuroi nflammation, and Alzheimer's disease. Neurobiol Aging 22:903-908. Mrak RE, Griffin WS (2005) Glia and their cytokines in progression of neurodegeneration. Neurobiol Aging 26:349-354. Murphy PM (1996) Chemokine receptors: structur e, function and role in microbial pathogenesis. Cytokine Growth Factor Rev 7:47-64. Nacher J, McEwen BS (2006) The role of N-me thyl-D-asparate receptors in neurogenesis. Hippocampus 16:267-270. Nacher J, Rosell DR, Alonso-Llosa G, McEwen BS (2001) NMDA receptor antagonist treatment induces a long-lasting increase in the number of proliferating cells, PSA-NCAM-immunoreactive granule neurons and radial glia in the adult rat dentate gyrus. Eur J Neurosci 13:512-520. Nacher J, Alonso-Llosa G, Rosell DR, McEwen BS (2003) NMDA receptor antagonist treatment increases the production of new neurons in the aged rat hippocampus. Neurobiol Aging 24:273284. Nacher J, Varea E, Miguel Blasco-Ibanez J, Go mez-Climent MA, Castillo-Gomez E, Crespo C, Martinez-Guijarro FJ, McEwen BS (2007) N-methyl-d -aspartate receptor expression during adult neurogenesis in the rat dentate gyrus. Neuroscience 144:855-864. Nakajima K, Kohsaka S (2004) Microglia: neuropro tective and neurotrophic cells in the central nervous system. Curr Drug Targets Ca rdiovasc Haematol Disord 4:65-84.

PAGE 96

89 Newman MB, Willing AE, Manresa JJ, Sanberg CD, Sanberg PR (2006) Cytokines produced by cultured human umbilical cord blood (HUCB) cells: Implications for brain repair. Experimental Neurology 199:201-208. Nimmerjahn A, Kirchhoff F, Helmchen F (2005) Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 308:1314-1318. Nishioka T, Shimizu J, Iida R, Yamazaki S, Sakaguchi S (2006) CD4+CD25+Foxp3+ T cells and CD4+CD25-Foxp3+ T cells in aged mice. J Immunol 176:6586-6593. Nishiyori A, Minami M, Ohtani Y, Takami S, Ya mamoto J, Kawaguchi N, Kume T, Akaike A, Satoh M (1998) Localization of fractalkine and CX3C R1 mRNAs in rat brain: does fractalkine play a role in signaling from neuron to microglia? FEBS Lett 429:167-172. Nuber S, Petrasch-Parwez E, Winner B, Winkler J, von Horsten S, Schmidt T, Boy J, Kuhn M, Nguyen HP, Teismann P, Schulz JB, Neumann M, Pi chler BJ, Reischl G, Holzmann C, Schmitt I, Bornemann A, Kuhn W, Zimmermann F, Servadio A, Riess O (2008) Neurodegeneration and motor dysfunction in a conditional model of Parkinson's disease. J Neurosci 28:2471-2484. O'Kusky JR, Ye P, D'Ercole AJ (2000) Insulin-like growth factor-I promotes neurogenesis and synaptogenesis in the hippocampal dentate gy rus during postnatal development. J Neurosci 20:8435-8442. Olson AK, Eadie BD, Ernst C, Christie BR (2006) Environmental enrichment and voluntary exercise massively increase neurogenesis in t he adult hippocampus via dissociable pathways. Hippocampus 16:250-260. Oltvai ZN, Milliman CL, Korsmeyer SJ (1993) Bcl2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74:609-619. Oppenheim RW (1991) Cell death during develop ment of the nervous system. Annu Rev Neurosci 14:453-501. Overstreet-Wadiche LS, We stbrook GL (2006) Functional maturation of adult-generated granule cells. Hippocampus 16:208-215. Overstreet-Wadiche LS, Bens en AL, Westbrook GL (2006) Delayed development of adultgenerated granule cells in dentate gy rus. J Neurosci 26:2326-2334. Pan Y, Lloyd C, Zhou H, Dolich S, Deeds J, Gonzal o JA, Vath J, Gosselin M, Ma J, Dussault B, Woolf E, Alperin G, Culpepper J, Gutierre z-Ramos JC, Gearing D (1997) Neurotactin, a membrane-anchored chemokine upregulated in brain inflammation. Nature 387:611-617.

PAGE 97

90 Papadopoulos EJ, Sassetti C, Saeki H, Yamada N, Kawamura T, Fitzhugh DJ, Saraf MA, Schall T, Blauvelt A, Rosen SD, Hwang ST (1999) Frac talkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol 29:2551-2559. Paylor R, Morrison SK, Rudy JW, Waltrip LT, Wehner JM (1992) Brief exposure to an enriched environment improves performance on the Morris water task and increases hippocampal cytosolic protein kinase C activity in young rats. Behav Brain Res 52:49-59. Pugh CR, Nguyen KT, Gonyea JL, Fleshner M, Wakins LR, Maier SF, Rudy JW (1999) Role of interleukin-1 beta in impairment of contextual fear conditioning caused by social isolation. Behav Brain Res 106:109-118. Rabuffetti M, Sciorati C, Tarozzo G, Clementi E, Manfredi AA, Beltramo M (2000) Inhibition of caspase-1-like activity by Ac-Tyr-Val-Ala-A sp-chloromethyl ketone induces long-lasting neuroprotection in cerebral ischemia thr ough apoptosis reduction and decrease of proinflammatory cytokines. J Neurosci 20:4398-4404. Rachal Pugh C, Fleshner M, Watkins LR, Maier SF, Rudy JW (2001) The immune system and memory consolidation: a role for the cyto kine IL-1beta. Neurosci Biobehav Rev 25:29-41. Rao MS, Shetty AK (2004) Efficacy of doublecorti n as a marker to analyse the absolute number and dendritic growth of newly generated neurons in the adult dentate gy rus. Eur J Neurosci 19:234-246. Rao MS, Hattiangady B, Shetty AK (2006) The window and mechanisms of major age-related decline in the production of new neurons within the dentate gyrus of the hippocampus. Aging Cell 5:545-558. Rao MS, Hattiangady B, Abdel-Rahman A, Stanley DP, Shetty AK (2005) Newly born cells in the ageing dentate gyrus display normal migration, survival and neuronal fate choice but endure retarded early maturation. Eur J Neurosci 21:464-476. Ray AM, Owen DE, Evans ML, Davis JB, Benham CD (2000) Caspase inhibitors are functionally neuroprotective against oxygen glucose deprivat ion induced CA1 death in rat organotypic hippocampal slices. Brain Res 867:62-69. Re DB, Przedborski S (2006) Fractalkine: mo ving from chemotaxis to neuroprotection. Nat Neurosci 9:859-861. Reddien PW, Cameron S, Horvitz HR (2001) Phagocytosis promotes programmed cell death in C. elegans. Nature 412:198-202.

PAGE 98

91 Rolls A, Shechter R, London A, Ziv Y, Ronen A, Levy R, Schwartz M (2007) Toll-like receptors modulate adult hippocampal neurogenesis. Nat Cell Biol 9:1081-1088. Rondi-Reig L, Lemaigre-Dubreuil Y, Montecot C, Muller D, Martinou JC, Caston J, Mariani J (2001) Transgenic mice with neuronal overexpression of bcl-2 gene present navigation disabilities in a water task. Neuroscience 104:207-215. Rothwell N, Allan S, Toulmond S (1997) The role of interleukin 1 in acute neurodegeneration and stroke: pathophysiological and therapeutic im plications. J Clin Invest 100:2648-2652. Roubenoff R, Harris TB, Abad LW, Wilson PW, Dalla l GE, Dinarello CA (1998) Monocyte cytokine production in an elderly population: effect of age and inflammation. J Gerontol A Biol Sci Med Sci 53:M20-26. Sahay A, Hen R (2007) Adult hippocampal neuro genesis in depression. Nat Neurosci 10:11101115. Sapolsky RM (1992) Do glucocorticoid concentration s rise with age in the rat? Neurobiol Aging 13:171-174. Saporta S, Kim JJ, Willing AE, Fu ES, Davis CD Sanberg PR (2003) Human umbilical cord blood stem cells infusion in spinal cord injury : engraftment and beneficial influence on behavior. J Hematother Stem Cell Res 12:271-278. Savill J, Dransfield I, Gregory C, Haslett C (2002) A blast from the past: clearance of apoptotic cells regulates immune responses. Nat Rev Immunol 2:965-975. Saxe MD, Battaglia F, Wang JW, Malleret G, David DJ, Monckton JE, Garcia AD, Sofroniew MV, Kandel ER, Santarelli L, Hen R, Drew MR (200 6) Ablation of hippocampal neurogenesis impairs contextual fear conditioning and synaptic plasticity in the dentate gyrus. Proc Natl Acad Sci U S A 103:17501-17506. Schmidt-Hieber C, Jonas P, Bischofberger J ( 2004) Enhanced synaptic plasticity in newly generated granule cells of the adult hippocampus. Nature 429:184-187. Scholzen T, Gerdes J (2000) The Ki-67 protein: from the known and the unknown. J Cell Physiol 182:311-322. Schwartz M, Butovsky O, Bruck W, Hanisc h U-K (2006a) Microglial phenotype: is the commitment reversible? Trends Neurosci 29:68-74.

PAGE 99

92 Schwartz M, Butovsky O, Bruck W, Hanisc h U-K (2006b) Microglial phenotype: is the commitment reversible? Trends in Neurosciences 29:68-74. Seki T, Arai Y (1995) Age-related production of new granule cells in the adult dentate gyrus. Neuroreport 6:2479-2482. Shaftel SS, Griffin WS, O'Banion MK (2008) The role of interleukin-1 in neuroinflammation and Alzheimer disease: an evolving persp ective. J Neuroinflammation 5:7. Shaked I, Porat Z, Gersner R, Kipnis J, Schwar tz M (2004) Early activation of microglia as antigen-presenting cells correlates with T cell-medi ated protection and repair of the injured central nervous system. J Neuroimmunol 146:84-93. Sheng JG, Mrak RE, Jones RA, Brewer MM, Zhou XQ McGinness J, Woodward S, Bales K, Paul SM, Cordell B, Griffin WS (2001) Neuronal DNA damage correlates with overexpression of interleukin-1beta converting enzyme in APPV717F mice. Neurobiol Aging 22:895-902. Sheng WS, Hu S, Ni HT, Rowen TN, Lokensgard JR, Peterson PK (2005) TNF-alpha-induced chemokine production and apoptosis in human neur al precursor cells. J Leukoc Biol 78:12331241. Shetty AK, Hattiangady B, Shetty GA (2005) Stem /progenitor cell proliferation factors FGF-2, IGF-1, and VEGF exhibit early decline during the co urse of aging in the hippocampus: role of astrocytes. Glia 51:173-186. Shimizu J, Moriizumi E (2003) CD4+CD25T ce lls in aged mice are hyporesponsive and exhibit suppressive activity. J Immunol 170:1675-1682. Shors TJ, Townsend DA, Zhao M, Kozorovitskiy Y, Gould E (2002) Neurogenesis may relate to some but not all types of hippocampal-dependent learning. Hippocampus 12:578-584. Shors TJ, Miesegaes G, Beylin A, Zhao M, Rydel T, Gould E (2001) Neurogenesis in the adult is involved in the formation of trace memories. Nature 410:372-376. Sierra A, Gottfried-Blackmore AC, McEwen BS, Bulloch K (2007) Microglia derived from aging mice exhibit an altered inflammatory profile. Glia 55:412-424. Sims JE (2002) IL-1 and IL-18 receptors, and their extended family. Curr Opin Immunol 14:117122.

PAGE 100

93 Soriano SG, Amaravadi LS, Wang YF, Zhou H, Yu GX, Tonra JR, Fairchild-Huntress V, Fang Q, Dunmore JH, Huszar D, Pan Y (2002) Mice deficient in fractalkine are less susceptible to cerebral ischemia-reperfusion injury. J Neuroimmunol 125:59-65. Spulber S, Oprica M, Bartfai T, Winblad B, Schultzberg M (2008) Blunted neurogenesis and gliosis due to transgenic overexpression of human so luble IL-1ra in the mouse. Eur J Neurosci 27:549-558. Stichel CC, Luebbert H (2007) Inflammatory proces ses in the aging mouse brain: participation of dendritic cells and T-cells. Neurobiol Aging 28:1507-1521. Streit WJ (2006a) Microglial senescence: does the brain's immune system have an expiration date? Trends Neurosci 29:506-510. Streit WJ (2006b) Microglial senescence: does the brain's immune system have an expiration date? Trends in Neuros ciences 29:506-510. Stuart LM, Ezekowitz RA (2005) Phagocytosis : elegant complexity. Immunity 22:539-550. Suen Y, Lee SM, Schreurs J, Knoppel E, Cair o MS (1994) Decreased macrophage colonystimulating factor mRNA expression from activa ted cord versus adult mononuclear cells: altered posttranscriptional stability. Blood 84:4269-4277. Sun W, Winseck A, Vinsant S, Park OH, Kim H, Oppenheim RW (2004) Programmed cell death of adult-generated hippocampal neurons is medi ated by the proapoptotic gene Bax. J Neurosci 24:11205-11213. Taguchi A, Soma T, Tanaka H, Kanda T, Nish imura H, Yoshikawa H, Tsukamoto Y, Iso H, Fujimori Y, Stern DM, Naritomi H, Matsuyama T (2004) Administration of CD34+ cells after stroke enhances neurogenesis via angiogenesis in a mouse model. J Clin Invest 114:330-338. Takao T, Tracey DE, Mitchell WM, De Souza EB (1 990) Interleukin-1 receptors in mouse brain: characterization and neuronal localiz ation. Endocrinology 127:3070-3078. Tang SC, Arumugam TV, Xu X, Cheng A, Mughal MR, Jo DG, Lathia JD, Siler DA, Chigurupati S, Ouyang X, Magnus T, Camandola S, Mattson MP ( 2007) Pivotal role for neuronal Toll-like receptors in ischemic brain injury and functio nal deficits. Proc Natl Acad Sci U S A 104:1379813803. Tong N, Perry SW, Zhang Q, James HJ, Guo H, Brooks A, Bal H, Kinnear SA, Fine S, Epstein LG, Dairaghi D, Schall TJ, Gendelman HE, Dewhurst S, Sharer LR, Gelbard HA (2000) Neuronal fractalkine expression in HIV-1 encephalitis: roles for macrophage recruitment and neuroprotection in the central nervou s system. J Immunol 164:1333-1339.

PAGE 101

94 Toni N, Laplagne DA, Zhao C, Lombardi G, Ribak CE, Gage FH, Schinder AF (2008) Neurons born in the adult dentate gyrus form functional syna pses with target cells. Nat Neurosci 11:901907. Tuo J, Smith BC, Bojanowski CM, Meleth AD, Ge ry I, Csaky KG, Chew EY, Chan CC (2004) The involvement of sequence variation and expression of CX3CR1 in the pathogenesis of age-related macular degeneration. FASEB J 18:1297-1299. van Praag H, Christie BR, Sejnowski TJ, Gage FH (1999) Running enhances neurogenesis, learning, and long-term potentiation in mice. Proc Natl Acad Sci U S A 96:13427-13431. van Praag H, Schinder AF, Christie BR, Toni N, Palmer TD, Gage FH (2002) Functional neurogenesis in the adult hippocampus. Nature 415:1030-1034. Vega CJ, Peterson DA (2005) Stem cell proliferat ive history in tissue revealed by temporal halogenated thymidine analog discrimination. Nat Methods 2:167-169. Vendrame M, Gemma C, Pennypacker KR, Bickford PC, Davis Sanberg C, Sanberg PR, Willing AE (2006a) Cord blood rescues stroke-induced changes in splenocyte phenotype and function. Experimental Neurology 199:191-200. Vendrame M, Gemma C, Pennypacker KR, Bickford PC, Davis Sanberg C, Sanberg PR, Willing AE (2006b) Cord blood rescues stroke-induced changes in splenocyte phenotype and function. Exp Neurol 199:191-200. Vendrame M, Cassady J, Newcomb J, Butler T, Pennypacker KR, Zigova T, Sanberg CD, Sanberg PR, Willing AE (2004) Infusion of human umbilical cord blood cells in a rat model of stroke dose-dependently rescues behavioral deficit s and reduces infarct volume. Stroke 35:23902395. Vendrame M, Gemma C, de Mesquita D, Collier L, Bickford PC, Sanberg CD, Sanberg PR, Pennypacker KR, Willing AE (2005) Anti-inflammatory effects of human cord blood cells in a rat model of stroke. Stem Cells Dev 14:595-604. Verret L, Jankowsky JL, Xu GM, Borchelt DR, Rampon C (2007) Alzheimer's-type amyloidosis in transgenic mice impairs survival of newbo rn neurons derived from adult hippocampal neurogenesis. J Neurosci 27:6771-6780. Wakselman S, Bechade C, Roumier A, Bernard D, Triller A, Bessis A (2008) Developmental neuronal death in hippocampus requires the microglial CD11b integrin and DAP12 immunoreceptor. J Neurosci 28:8138-8143.

PAGE 102

95 Wang X, Fu S, Wang Y, Yu P, Hu J, Gu W, Xu XM, Lu P (2007) Interleukin-1beta mediates proliferation and differentiation of multipotent neural precursor cells through the activation of SAPK/JNK pathway. Mol Ce ll Neurosci 36:343-354. West MJ, Slomianka L, Gundersen HJ (1991) Unbi ased stereological estimation of the total number of neurons in thesubdivisions of the rat hi ppocampus using the optical fractionator. Anat Rec 231:482-497. Willing AE, Lixian J, Milliken M, Poulos S, Zigov a T, Song S, Hart C, Sanchez-Ramos J, Sanberg PR (2003) Intravenous versus intr astriatal cord blood administration in a rodent model of stroke. J Neurosci Res 73:296-307. Wilson CJ, Finch CE, Cohen HJ (2002) Cytoki nes and cognition--the case for a head-to-toe inflammatory paradigm. J Am Geriatr Soc 50:2041-2056. Wu AG, Michejda M, Mazumder A, Meehan KR, Menendez FA, Tchabo JG, Slack R, Johnson MP, Bellanti JA (1999) Analysis and characterizati on of hematopoietic progenitor cells from fetal bone marrow, adult bone marrow, peripheral blood, and cord blood. Pediatr Res 46:163-169. Yirmiya R, Winocur G, Goshen I (2002) Brain in terleukin-1 is involved in spatial memory and passive avoidance conditioning. Neurobiol Learn Mem 78:379-389. Zaman V, Shetty AK (2002) Combined neurot rophic supplementation and caspase inhibition enhances survival of fetal hippocampal CA3 cell grafts in lesioned CA3 region of the aging hippocampus. Neuroscience 109:537-553. Zhang C, McNeil E, Dressler L, Siman R (2007 ) Long-lasting impairment in hippocampal neurogenesis associated with amyloid deposition in a knock-in mouse model of familial Alzheimer's disease. Exp Neurol 204:77-87. Zhao C, Deng W, Gage FH (2008) Mechanisms and functional implications of adult neurogenesis. Cell 132:645-660. Zhao C, Teng EM, Summers RG, Jr., Ming GL, Gage FH (2006) Distinct morphological stages of dentate granule neuron maturation in the adult mouse hippocampus. J Neurosci 26:3-11. Ziv Y, Schwartz M (2008) Immune-based regulation of adult neurogenesis: implications for learning and memory. Brain Behav Immun 22:167-176. Ziv Y, Avidan H, Pluchino S, Martino G, Schw artz M (2006a) Synergy between immune cells and adult neural stem/progenitor cells promotes functional recovery from spinal cord injury. Proc Natl Acad Sci U S A 103:13174-13179.

PAGE 103

96 Ziv Y, Ron N, Butovsky O, Landa G, Sudai E, Greenberg N, Cohen H, Kipnis J, Schwartz M (2006b) Immune cells contribute to the maintenance of neurogenesis and spatial learning abilities in adulthood. Nat Neurosci 9:268-275. Ziv Y, Finkelstein A, Geffen Y, Kipnis J, Sm irnov I, Shpilman S, Vertkin I, Kimron M, Lange A, Hecht T, Reyman KG, Marder JB, Schwartz M, Yoles E (2007) A novel immune-based therapy for stroke induces neuroprotection and supports neurogenesis. Stroke 38:774-782. Zujovic V, Benavides J, Vige X, Carter C, Taupin V (2000) Fractalkine modulates TNF-alpha secretion and neurotoxicity induced by microglial activation. Glia 29:305-315. Zujovic V, Schussler N, Jourdain D, Duverger D, Taupin V (2001) In vivo neutralization of endogenous brain fractalkine increases hippocampal TNFalpha and 8-isoprostane production induced by intracerebroventricular inje ction of LPS. J Neuroimmunol 115:135-143.

PAGE 104

About the Author Adam D. Bachstetter received his Bachelor’s degree in Psychology & Criminology from Capital University, Columbus, Ohio in 2001. During undergraduate years, Adam worked in the laboratory of Ronald F. Mervis, where he co nducted morphometric analyses of Golgi stained neurons in aging, Alzheimer’s disease, and AI DS dementia. After receiving his undergraduate degree, Adam worked as Lab Manager and Senior Re search Associate in the laboratory of Dr. Mervis until he began graduate school at the Univer sity of South Florida in 2005. Adam, joined the laboratory of Dr. Paula Bickford, where he comp leted his Ph.D. work looking at the role of neuroinflammation, in aging and age-related neu rodegenerative diseases. Adam successfully defended his Doctoral dissertation in spring of 2009 at the University of South Florida.