USF Libraries
USF Digital Collections

Novel roles for B-Raf in mitosis and cancer

MISSING IMAGE

Material Information

Title:
Novel roles for B-Raf in mitosis and cancer
Physical Description:
Book
Language:
English
Creator:
Borysova, Meghan E. K
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
SiRNA
Spindle
Centrosome
Kinetochores
Aneuploidy
Dissertations, Academic -- Cancer Biology -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: The MAP kinase pathway is well known for its key roles in regulating cell proliferation and cell cycle progression. MAP kinases have also been implicated in mitotic functions, however these functions are less-well understood. Recent studies from our laboratory used Xenopus egg extracts to identify B-Raf as an essential activator of the MAPK cascade during mitosis. Therefore, the first objective of my dissertation research was to determine if B-Raf has functional significance during mitosis in human somatic cells. Using RNA interference against B-Raf and various immunofluorescence techniques, I show that B-Raf: (1) localizes to and is phosphorylated at a key mitotic structure, (2) is critical for proper mitotic spindle assembly and chromatin congression, (3) is important for the engagement of microtubules with kinetochores during mitosis, and (4) is necessary for activation of the spindle assembly checkpoint. It has been demonstrated that B-Raf is a prominent oncogene, constitutively activated in the vast majority of melanomas and other cancers. I hypothesized that oncogenic B-Raf expression perturbs mitosis and causes aneuploidy. First, we show that oncogenic B-Raf expression correlates with mitotic abnormalities in human melanoma cells and that spindle defects are induced when oncogenic B-Raf is ectopically expressed. Further, using FISH and karyotype analysis, I demonstrate that oncogenic B-Raf drives aneuploidy and chromosome instability in primary, immortalized, and tumor cells. In summary, my dissertation studies elucidate novel roles for B-Raf in mammalian mitosis. In addition, my studies show for the first time that oncogenic B-Raf disrupts mitosis causing chromosomal instability. I propose that oncogenic B-Raf-induced chromosome instability contributes to tumorigenesis.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2009.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Meghan E. K. Borysova.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 155 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002029124
oclc - 436873091
usfldc doi - E14-SFE0002899
usfldc handle - e14.2899
System ID:
SFS0027216:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Novel Roles for B-Raf in Mitosis and Cancer by Meghan E. K. Borysova A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cancer Biology Graduate School University of South Florida Major Professor: Thomas M. Guadagno, Ph.D. Gary Reuther, Ph.D. Alvaro Monteiro, Ph.D. Huntington Potter, Ph.D. Andrew Aplin, Ph.D. Date of Approval: April 3, 2009 Keywords: siRNA, spindle, centr osome, kinetochores, aneuploidy Copyright 2009, Meghan E. K. Borysova

PAGE 2

To my husband, my parents, my siblings and my children. It is you who have made me who I am .

PAGE 3

ACKNOWLEDGEMENTS I would like to thank my thesis advisor, Tom Guadagno, for a terrific project and 5 years of mentorship. Dr. Guadagno has grea t scientific instinct s. He always knows when a project is promising and his belief in th e end-point does not wa iver in the face of scientific challenges. I would like to th ank the present and former members of the Guadagno lab for support and assistance. I thank my committee members, Drs. Gary Reuther, Alvaro Monteiro and Huntington Po tter, for their availability, guidance and support. I especially thank Gary Reuther who has not only served as my scientific advisor, but has extended himself as a frie nd throughout my time in graduate school. I thank Dr. Andrew Aplin for traveling to Flor ida and serving as the outside chairperson for my defense. I would like to thank Ken Wright, the Cancer Biology, Ph.D. program director, for his outstanding me ntorship and leadership. The scientific and personal wellbeing of the students is alwa ys Kens priority. I thank Cathy Gaffney for all of her kindness, support and assistance. I thank the other graduate students, particularly my classmates, for their friendship, drive and determination. I woul d like to thank the members of the Moffitts micr oscope core facility (Ed Seijo, Mark Lloyd, Joe Johnson and Nancy Burke); they have added to the br eadth and depth to my microscopy studies. I would like to thank my favorite scientist my husband, Sergiy Borysov for his brilliance, wit, humor and endl ess hours of scientific discussion and debate. And finally, I thank my children, for they have been the greatest inspiration, motivation and gratification during my time in th e Cancer Biology, Ph.D. program.

PAGE 4

i TABLE OF CONTENTS LIST OF FIGURES ........................................................................................................... iv LIST OF ABBREVIATIONS ........................................................................................... vii ABSTRACT ...................................................................................................................... xi CHAPTER 1: BACKGROUND AND INTRODUCTION .................................................1 Mitosis......................................................................................................................1 Stages of Mitosis ..........................................................................................1 Organization of the Mitotic Spindle ............................................................7 Spindle Assembly Checkpoint .....................................................................9 MAPK Pathway .....................................................................................................13 MAPK Cascade ..........................................................................................13 Regulation and Functions of the ERK 1/2 Pathway ..................................14 Mitotic Roles of ERK 1/2 ..........................................................................15 B-Raf Kinase ..........................................................................................................20 B-Raf Protein Structure ..............................................................................20 B-Raf Activation ........................................................................................21 B-Raf Functions .........................................................................................24 B-Raf as a Mitotic MEK Kinase ................................................................25 MAPK Pathway in Tumorigenesis ........................................................................26 EGFR, Ras and MKPs in Human Cancers.................................................26 B-Raf in Human Cancers ...........................................................................27 B-Raf as an Oncogene ...............................................................................29 Mitosis and Cancer ................................................................................................30 Types of Genomic Instability.....................................................................31 Mitosis and Aneuploidy .............................................................................32 Causal Role for Aneupl oidy in Tumorigenesis ..........................................33 Hypotheses and Dissertation Statement .................................................................37 CHAPTER 2: SUBCELLULAR B-RAF LOCALIZATION ..........................................39 Introduction ............................................................................................................39 Results ....................................................................................................................40 B-Raf Localizes to Mitotic Structures .......................................................40 B-Raf is Detected at the Mitotic Spindle .......................................40 B-Raf Interacts with Spindle Microtubules ...................................43 B-Raf Localizes to the Centrosomes ..............................................45

PAGE 5

ii B-Raf is Phosphorylated on Se rine 599 and Threonine 602 at Mitotic Structures.................................................................................49 Phosphorylated B-Raf localizes to the Centrosomes .....................49 Phosphorylated B-Raf localizes to Condensed Chromatin ............53 Phosphorylated B-Raf localizes to the Kinetochores .....................57 Conclusions ............................................................................................................59 CHAPTER 3: B-RAF PERFORMS CRITICAL MITOTIC FUNCTIONS .....................60 Introduction ............................................................................................................60 Results ....................................................................................................................61 B-Raf Contributes to Mitotic Spindle Assembly in Xenopus Egg Extracts ................................................................................................61 Spindle Assembly is Compromised in the Absence of B-Raf in Xenopus Egg Extracts ..........................................................61 B-Raf is Necessary for Spindl e Formation and Chromosome Congression in Human Somatic Cells .................................................63 Knockdown of B-Raf by siR NA Inhibits Proper Spindle Formation and Chromosome Congression ...............................63 C-Raf is Dispensable for Normal Spindle Assembly ....................64 B-Raf Regulates Microtubule-Kinetochore Engagement ..........................68 CENP-E Levels are Elevated at the Kinetochores in the Absence of B-Raf .....................................................................68 Microtubules are not Cold Stable in the Absence of B-Raf ...........69 B-Raf Regulates the Spindl e Assembly Checkpoint .................................73 Cells Cycle through Mitosis in the Absence of B-Raf ...................73 Induced Spindle Assembly Checkpoint is Compromised in the Absence of B-Raf ...............................................................74 B-Raf Depleted Cells Exit Metaphase Prematurely .......................79 Kinetochore Localization of Mad2 and Bub1 is Inhibited in the Absence of B-Raf ...............................................................79 Conclusions ............................................................................................................81 CHAPTER 4: ONCOGENIC B-RAF DISRUPTS MITOSIS AND CAUSES CHROMOSMAL INSTABILITY ...............................................................................82 Introduction ............................................................................................................82 Results ....................................................................................................................83 B-RafV600E Expression Promotes Mitotic Abnormalities in Melanoma Cells ...................................................................................83 B-RafV600E Status in Melanoma Cells is Associated Mitotic Abnormalities ...........................................................................84 B-RafV600E Promotes Spindle Abnormalities and Centrosome Amplification in Human Melanoma Cells ...........84 B-RafV600E Drives Aneuploidy and Ch romosomal Instability in SbCl2 Melanoma Cells ........................................................................88 B-RafV600E Induces Aneuploidy in SbCl2 Melanoma Cells ..........88

PAGE 6

iii B-RafV600E Drives Chromosome Instability in SbCl2 Melanoma Cells .......................................................................90 B-RafV600E Induces Rapid Aneuploidy in Primary Human Cells ..............95 B-RafV600E Rapidly Induces Aneuploidy in Primary Human Melanocytes .............................................................................95 B-RafV600E Rapidly Induces Aneuploidy in hTERT Immortalized Mammary Epithelial Cells .................................96 Conclusions ............................................................................................................99 CHAPTER 5: DISCUSSION ..........................................................................................100 B-Raf Performs Critical F unctions during Mitosis ..............................................100 MAPK Mitotic Functions ........................................................................100 B-Raf Localizes to the Cytoplasm during Interphase in Human Somatic Cells .....................................................................................101 B-Raf Localizes to Mitotic Struct ures in Human Somatic Cells .............102 B-Raf Regulates Mitotic Functi ons in Human Somatic Cells .................105 Oncogenic B-Raf Deregulates Mi tosis Causing Aneuploidy and Chromosomal Instability ................................................................................110 Cellular Effects of Oncogenic B-Raf .......................................................110 B-RafV600E Expression Drives Mitotic Abnormalities .............................113 B-RafV600E Causes Chromosomal Instability ...........................................114 Relevance for Therapeutics ..................................................................................118 Summary ..............................................................................................................120 CHAPTER 6: MATERIALS AND METHODS ............................................................122 Cell Culture and Cell Synchronization ................................................................122 Transfections and Retroviral Infections ...............................................................123 Immunoblot Analysis ...........................................................................................124 Microtubule Depolymerizati on by Cold Treatment .............................................125 Nocodazole-Induced Microtubule Depolymerization ..........................................125 Immunocytochemistry .........................................................................................126 Chromosome Isolations .......................................................................................127 Fluorescence in situ Hybridization (FISH) Analysis and Metaphase Spreads ...........................................................................................................127 Microscopy ..........................................................................................................128 Spindle Assembly in Xenopus Egg Extracts ........................................................130 REFERENCES ................................................................................................................131 ABOUT THE AUTHOR ....................................................................................... End Page

PAGE 7

iv LIST OF FIGURES Figure 1. Stages of mitosis ..........................................................................................2 Figure 2. The mitotic spindle ......................................................................................5 Figure 3. The spindle assembly checkpoint ..............................................................12 Figure 4. MAPK functions and localization during mitosis ......................................16 Figure 5. Raf family members ...................................................................................22 Figure 6. B-Raf localizes to the m itotic spindle in NIH 3T3 cells ............................41 Figure 7. B-Raf localizes to the mitotic spindle in HFF cells ...................................42 Figure 8. B-Raf is detected at the spindle apparatus during mitosis in HFF cells ....................................................................................................44 Figure 9. B-Raf interacts with the spindle microtubules in HFF cells ......................46 Figure 10. B-Raf spindle localizati on is disrupted when microtubules are depolymerized with nocodazole ...........................................................47 Figure 11. B-Raf co-pellets with mi crotubules isolated from M phase Xenopus egg extracts..................................................................................48 Figure 12. B-Raf localizes to the centrosomes in NIH3T3 cells .................................50 Figure 13. B-Raf localizes to th e centrosomes in HFF cells .......................................51 Figure 14. B-Raf localizes to th e centrosomes throughout the cell cycle ...........................................................................................................52 Figure 15. B-Raf is phosphorylated at key mitotic structures .....................................54 Figure 16. Phosphorylated B-Ra f localizes to the condensed chromosomes .............................................................................................55

PAGE 8

v Figure 17. Phosphorylated BRaf localizes to the perichromosomal sheath .........................................................................................................56 Figure 18. Phosphorylated B-Raf local izes to the kine tochores during mitosis ........................................................................................................58 Figure 19. Immunodepletion of B-Raf from Xenopus egg extracts ............................62 Figure 20. B-Raf contributes to spindle assembly in Xenopus egg extracts ...............62 Figure 21. Downregulation of B-Raf by siRNAs ........................................................65 Figure 22. B-Raf contributes to proper spindle assembly in human somatic cells ........................................................................................................... 66 Figure 23. C-Raf is not necessary for assembly of the mitotic spindle .......................67 Figure 24. Kinetochore bound CENP-E le vels following downregulation of B-Raf ..........................................................................................................70 Figure 25. Microtubules are not cold-s table in the absence of B-Raf .........................72 Figure 26. Cells do not enter mitotic arrest in the absence of B-Raf ..........................75 Figure 27. Cells do not maintain a spindl e checkpoint arrest in the absence of B-Raf ..........................................................................................................76 Figure 28. B-Raf depleted ce lls exit mitotic arrest in the presence of taxol ...............77 Figure 29. Cells prematurely exit metaphase in the absence of B-Raf .......................78 Figure 30. Mad2 and Bub1 kinetochore localization is inhibited in the absence of B-Raf ........................................................................................80 Figure 31. Aberrant chroma tin congression in B-RafV600E positive melanoma cells ............................................................................................................85 Figure 32. Aberrant mitotic spindle formation and chromatin congression in melanoma cells ectopically expressing B-RafV600E ....................................86 Figure 33. SbCl2 melanoma cells are near diploid .....................................................89 Figure 34. Exogenous expression of B-RafV600E in SbCl2 cells ..................................91 Figure 35. Aneuploidy induced by B-RafV600E in SbCl2 cells .....................................92

PAGE 9

vi Figure 36. Change in chromoso me number generated by 4 and 6 weeks of B-RafV600E expression ................................................................94 Figure 37. Aneuploidy induced by B-RafV600E in primary human melanocytes................................................................................................97 Figure 38. Aneuploidy induced by B-RafV600E in immortalized primary epithelial cells ............................................................................................98 Figure 39. Model for B-Raf mediated mitosis ..........................................................121

PAGE 10

vii LIST OF ABBREVIATIONS Apc Adenomatosis polyposis coli APC Anaphase promoting complex APC/C Anaphase promoting complex/cyclosome Bad Bcl-xL/Bcl-2-associated death promotor BCA Bicinchoninic acid BE11 siRNA to B-Raf exon 11 BE3 siRNA to B-Raf exon 3 Bim Bcl2 interacting mediator of cell death BRCA Breast Cancer gene BSA Bovine serum albumin Bub Budding uninhibited by benzimidazoles cAMP Cyclin adenosine monophosphate CAS Cellular apoptosis susceptibility Cdc Cell division cycle Cdk Cyclin-dependent kinase CENP-E Centromere-associated protein E CHAPS 3[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate CIN Chromosomal Instability CR Conserved region CRD Cysteine rich domain CREST Calcinosis, Raynaud phenomenon, Esophageal dysmotility, Sclerodactyly, and Telangiectasia CSF Cytostatic factor DAPI 4,6-diamidino-2-phenylindole

PAGE 11

viii DMSO Dimethylsulfoxide DNA Deoxyribonucleic acid EDTA Ethylene diamine tetraacetic acid EGF Epidermal growth factor EGFR Epidermal growth factor receptor EGTA Ethylene glycol bis(aminoet hylether)-N,N,N',N'-tetraacetic acid ERK Extracellular signal-regulated kinase FISH Fluorescence in situ hybridization G1 Gap 1 phase G2 Gap 2 phase GDP Guanosine diphosphate GFP Green fluorescent protein GTP Guanosine triphosphate HeLa Henrietta Lacks HEM Human epidermal melanocytes HFF Human foreskin fibroblast HIF Hypoxia inducible factor HME Human mammary epithelial Hsp Heat shock protein hTERT Human telomerase reverse transcriptase IgG Immunoglobulin G JNK Jun N-terminal kinase K-fibers Kinetochore-fibers Mad Mitotic arrest deficient MAPK Mitogen-activa ted protein kinase MEK MAPK/ERK kinase MEKK MAPK/ERK kinase kinase MIN Microsatellite instability MKP MAPK phosphatase MMP Matrix metalloproteinases MMR Mismatch repair

PAGE 12

ix M-phase mitosis Mps Mono-polar spindle MT Microtubules MTOC Microtubule organizing center NEB Nuclear Envelope Breakdown Nek NIMA-related kinase NER Nucleotide excision repair NIH National Institutes of Health NIN Nucleotide excision repa ir-associated instability NGF Neural Growth Factor PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline Phospho Phosphorylated PMSF Phenylmethanesulphonylfluoride PTC Papillary thyroid cancer PVDF Polyvinylidene fluoride Raf Rapidly accelerated fibrosarcoma Rap Ribosome associated protein Ras Rat sarcoma RBD Ras binding domain RNA Ribonucleic acid Rsk Ribosomal S6 kinase SAC Spindle assembly checkpoint Scr Scrambled control SDS Sodium dodecyl sulfate Ser Serine shRNA Small (short) hairpin RNA siRNA Small interfering RNA S-phase DNA synthesis phase TGF Transforming growth factor Thr Threonine

PAGE 13

x TuRC Tubulin ring complex Tyr Tyrosine UV Ultraviolet V600E Valine-600-Glutamic acid WT Wild-type

PAGE 14

xi Novel Roles for B-Raf in Mitosis and Cancer Meghan E. K. Borysova ABSTRACT The MAP kinase pathway is well known for its key roles in regulating cell proliferation and cell cycle progression. MA P kinases have also been implicated in mitotic functions, however these functions ar e less-well understood. Recent studies from our laboratory used Xenopus egg extracts to identify B-Raf as an essential activator of the MAPK cascade during mitosis. Therefore, the first objective of my dissertation research was to determine if B-Raf has functional significance during mitosis in human somatic cells. Using RNA interference against BRaf and various immunofluorescence techniques, I show that B-Raf: (1) localizes to and is phosphoryla ted at a key mitotic structure, (2) is critical for proper mitoti c spindle assembly and chromatin congression, (3) is important for the engagement of micr otubules with kinetochores during mitosis, and (4) is necessary for activation of the spindle assembly checkpoint. It has been demonstrated that B-Raf is a prominent oncogene, constitutively activated in the vast majority of melanom as and other cancers. I hypothesized that oncogenic B-Raf expression perturbs mitosis and causes aneuploidy. First, we show that oncogenic B-Ra f expression correlates with mitotic abnormalities in human melanoma cells and that spindle defects are induced when

PAGE 15

xii oncogenic B-Raf is ectopically expressed. Furt her, using FISH and karyotype analysis, I demonstrate that oncogenic B-Raf drives aneuploidy and chromosome instability in primary, immortalized, and tumor cells. In summary, my dissertation studies elucidate novel roles for B-Raf in mammalian mitosis. In addition, my studies show for the first time that oncogenic B-Raf disrupts mitosis causing chromosomal instab ility. I propose th at oncogenic B-Rafinduced chromosome instability contributes to tumorigenesis.

PAGE 16

1 CHAPTER 1 BACKGROUND AND INTRODUCTION Mitosis The cell cycle is the order of processes by which a cell duplicates and divides its DNA equally into two identical daughter cells. The cell cycle consists of temporally coordinated interphase (G1, S, G2 phases) and mitosis (prophase, metaphase, anaphase and telophase). During interphase cells prepare for mitosis through cell growth, DNA duplication and nutrient accumulation. Mitosis is the ultimate stage in the cell cycle during which the cell parti tions its chromosomes and subsequently divides its cytoplasmic components into two identic al and distinct daughter cells. Stages of Mitosis Mitosis is an irreversible process whose stages have traditionally been described by gross structural and behavi or changes documented by light microscopists. Modern use of fluorescence microscopy has aided in the identification of mitotic stages (Fig. 1). Proteins and enzymatic activities which regulate these morphological changes and their transitions serve as biochemical marker s for some of the mitotic phases. Entry into mitosis directly follows the la tter part of the second gap (G2) phase during which cells can be reversib ly arrested in response to va rious stresses [1]. Passage through late G2 serves as a point of no retu rn and marks the termin ation of interphase

PAGE 17

Interphase Prophase Metaphase Anaphase Telophase Figure. 1 Stages of mitosis a. Interphase cells have polymerized microtubules, and th e decondensed chromatin resides within the nucleus surrounded by a nuclear membrane. b. Prophase is the first stage of m itosis; microtubules are depolymerized from their interphase stage, the DNA begins to condense, the nuclear envelope is broken down and th e two centrosomes migrate to opposite poles. c. During metaphase, condensed chromosomes align at the metaphase plate and the bipolar spindle is formed. d. In anaphase, the spindle pulls the chromosomes in a polewar d directions. e. During te lophase/cytokinesis, the DNA is partitioned into two distinct regions, the nuclear envelopes reform and the cell pinches off into two daughter cells. 2

PAGE 18

3 and the beginning of mitosis. The phases of mitosis are most frequently referred to as prophase, prometaphase and metaphase the st ages of early mitosi s; and anaphase and telophase the phases of mitotic exit. Prophase is the initiating stage of mitosis. It is traditionally de fined as the point at which condensing chromosomes are first vi sible in the membrane-bound nucleus when observed by light or fluorescence micros copy. As well during prophase, the two centrosomes (the mother centrosome is dupl icated during S-phase) move to opposite poles of the cell [2] where they initiate mi crotubule nucleation into focal arrays called asters[3]. Centrosomes and asters are visi ble via fluorescence microscopy. Prophase is accompanied by the nuclear accumulation and activ ation of cyclin B-Cdk1 (also termed M-phase promoting factor, MPF), the master regulator of mitosis [4-9]. Cyclin B-Cdk1 remains active throughout prophase, prometapha se and metaphase and, therefore, serves as a biochemical marker of early mitosis. It has been shown that Cyclin B-Cdk1 regulates chromosome condensation through direct phosphorylation of the condensin complexes [10-12]. Estimates reveal that DNA is compacted 1000-2000 fold over interphase chromosomes [13] and chromoso me condensation is generally completed during prophase. The significance of pr ophase events cannot be understated. Chromosomes condensation reve als the centromeres upon which the attachment sites for spindle microtubules are assembled. Cent rosome segregation is crucial for the organization of a bipolar spindl e. Aster formation serves to properly position the mitotic spindle. Prophase ends and prometaphase is initiated when nuclear envelope breakdown become visible by light microscopy. Nu clear envelope breakdown is largely a consequence of phosphorylation of nuclear la mins by the Cyclin B-Cdk1 complex [14].

PAGE 19

4 The nuclear membrane fragments into small vesicles which are eventually fuse during telophase to form the new intact nuclei. Br eakdown of the nuclear envelope permits the chromosomes to physically associate with the polymerizing microtubules. Each chromosome has two sister kinetochores, one on each of the fused sister chromatids. During prometaphase kinetochores attach to the microtubules emanating from both poles of the developing spindle [15]. A spindle checkpoint arrest prevents anaphase onset until all kinetochores are fully engaged [16] Following full engagement, kinetochore associated motor proteins di rect the movement of attached chromosomes toward the spindle poles. Spindle microtubule growth acts as an opposing force that pulls the chromosomes toward the center of the mitotic sp indle [17]. Eventually the forces balance thus aligning the chromosomes at the spindle equa tor, called the metaphase plate. It is at this point of chromosome congression that the cell has entered metaphase. During metaphase chromosomes are aligned at the equator of an organized, fully formed, bipolar spindle (Fig. 2). Cyclin BCdk1 remains active during metaphase. Sister chromatids remain fused by cohesin complexes at the region of the centromere [18-20]. Metaphase ends and anaphase is initiate d when sister chromatids are disjoined. Sister chromatid segregation results from the abrupt and s ynchronous degradation of the cohesin molecules that hold them together [ 21-23]. The onset of anaphase occurs when the anaphase promoting complex/cyclosome (APC/C) becomes active. APC/C is an E3 ubiquitin ligase which targets a number of mito tic substrates includi ng securin and Cyclin B, for proteasome mediated de struction [24]. The destruction of secu rin allows for the activation of separase which subsequently cl eaves the cohesin molecu les [25]. After the dissolution of cohesin, kinetoch ore microtubules begin to shorten and kinetochore forces

PAGE 20

Figure. 2 The mitotic spindle The bipolar spindle apparatus fo rmed during mitosis has several key features: a. microtubules polymerize from the centrosomes to the kinetochores; b. the ki netochores are a proteinaceous structure to which the microtubules attach; c. the centrosomes are the microtubule organizing center (MTOC) of mammalian cells. 5

PAGE 21

6 result in poleward movement of the chromatid s. This movement is detectable by light microscopy and is termed early anaphase or anaphase A which culminates when the chromatids reach the poles. Late anaphase or anaphase B then ensues during which time poleward microtubules elongate thus the entire spindle elongates, thereby partitioning the chromatids further apart [15]. Rapid degradation of cyclin B is the most commonly used biochemical marker for anaphase and leads to the hallmarks of telophase. Telophase is the final stage of mitosis during which the chromosomes and cytoplasm are ultimately divided [15]. It is during this stage that the nuclear envelopes reform around both sets of chromosome s, the chromosomes decondense, the microtubules return to an interphase state and the cell is divided into two daughter cells. All of these features are dete ctable through light and fluores cence microscopy. It is due to the destruction of cyclin B-Cdk1 that components of the nuclear envelope and chromosomes no longer undergo phosphorylation, thereby permitting the reformation of the envelope and decondensation of chromo somes. Simultaneously, an actin-myosin contractile ring positioned beneath the plasma membrane causes the membrane to invaginate at the former site of the meta phase plate creating a cleavage furrow in the cytoplasm. Following nuclear envelope refo rmation, the contractile ring pinches the cell in half at the furrow, thus allowing for the equal separation of the cytoplasm, a process termed cytokinesis. The completion of cytoki nesis gives rise to tw o daughter cells both of which are in the beginni ng stage of interphase.

PAGE 22

7 Organization of the Mitotic Spindle The mitotic spindle is the structural and functional unit of the cell that is responsible for the mitotic partitioning the duplicated chromosome pairs. While the structure of the spindle apparatus cha nges continually throughout mitosis, the quintessential metaphase spindle is fusiform elliptical in shape, having tapered spindle poles and a wide midzone. The basic elements of the mitotic spindle are the centrosomes and the microtubules (Fig. 2). While not primary components of the spindle, chromosomes and kinetochores are necessary for the structural formation of the spindle apparatus. The spindle poles serve as the micr otubule organizing cent ers (MTOC) that initiate the formation of the mitotic sp indle. In animal cells, the MTOCs are centrosomes, organelles cont aining a pair of orthogonally arranged centrioles surrounded by protein rich pericentriolar materi al, including pericentrin, ninein, -tubulin and others [26-29]. The single centrosome of the cell is duplicated during S-phase. Early in mitosis, Nek2 kinase promotes the migration of the two centrosomes to opposite poles of the cell [30-33]. -tubulin and other members of the gamma complex protein family form hundreds of ring-shaped -tubulin ring complexes per centrosome ( -TuRC). -tubulin is required for microtubule nucleation [34, 35] and, while the exact mechanism is not completely understood, -TuRCs are most likely the site s of microtubule nucleation [3638]. Microtubule polymers are composed of and -tubulin dimers whose orientation in the polymerized microtubule gives microtubul es their polarity. The opposing ends of microtubules have different tubulin-polymer izing properties and orientations in the

PAGE 23

8 mitotic spindle. The relatively static minus ends of the mi crotubules interact with the pericentriolar material of the centrosome and the highly dynamic plus ends extend away from the centrosome [39, 40]. These intrinsi c features of polarity and dynamic instability are what give the microtubules the abili ty to form the mitotic spindle. At least three types of mi crotubules comprise the mitotic spindle, all of which emanate from the MTOC. Astral microtubules are organized in ra dial arrays around both centrosomes. They connect the spindle poles to the cortex of a mitotic cell, thus, are critical for proper positioning of the mitotic spindle and mark the site for subsequent cell division [41]. Interpolar microtubules pol ymerize toward the poles opposite of their nucleation. They terminate in the body of the spindle where so me of them interact with the plus ends of antiparallel in terpolar microtubules thus giving the spindle stability [42]. During late anaphase, the interpolar mi crotubules polymerize and slide thereby elongating the spindle. Finally, the plus ends of kinetochore fibers (K-fiber), comprised of 20-30 microtubules [43, 44], associat e with, and are captured by, the outer kinetochores of the chromosomes, thus connecting the chromosomes to the mitotic spindle [41, 45]. During early anaphase, th e kinetochore microtubules shorten forcing the attached chromosomes to move in th e direction of the spindle poles. The centromeres of the chromosomes are specific regions of repetitive DNA sequences, which are critical for proper organiza tion of the mitotic spindle. First, they are the site of fusion between the chromatids thus creating a visible constriction site in metaphase chromosomes. Secondly, they are also the sites where two identical proteinaceous structures called the kinetoch ores assemble and function. Kinetochores

PAGE 24

9 serve as the sites of microtubule engagement as well as the location of the spindle assembly checkpoint. Accurate positioning and function of the centrosomes, microtubules and chromosomes are necessary for the proper fo rmation of the metaphase spindle. A properly formed spindle is fusiform in stru cture with sister chromatids bioriented and symmetrically arranged at the spindle equato r. Achieving this arrangement prior to anaphase is critical in order to ensure equal segregation of chromosomes, thereby maintaining the genomic integr ity of both daughter cells. Spindle Assembly Checkpoint In order to prevent chromosomal missegr egation from occurring, anaphase must not proceed until all kinetochores are engage d in an amphitelic (bipolar) fashion. A cellular surveillance mechanis m called the spindle assembly checkpoint (SAC) ensures that anaphase onset is delaye d until all chromosomes have achi eved bipolar attachments. [16, 46, 47]. The process by which kinetochores capture K-fibers is largely a stochastic event based on their own chance interactions. In br ief, one sister kinetochore becomes engaged with K-fibers of the spindle, generati ng a monotelic chromosomal attachment. Subsequently the second sister kinetochore captures microtubules from the opposite pole and the chromosome becomes bioriented. Th is somewhat random process can result in syntelic attachments where K-fi bers from one pole engage wi th both sister kinetochores. As well, merotelic attachments can take plac e in which case K-fibe rs from opposite poles

PAGE 25

10 engage with one sister kinetochore. Th erefore, monotelic attachments occur as a transitional state prior to achieveme nt of bipolar engagement [48]. Syntelic kinetochore-microtubule a ttachments cause chromosomes to be positioned near one pole and such attachments elicits the SAC [49]. Merotelic attachments are bipolar by definition, cause chromosomes to align at the metaphase plate and do not elicit a SAC. The mechanism by which the syntelic chromosome orientation is reversed is not understood. However, it has been proposed that Aurora B kinase is instrumental in reversing maloriented atta chments [50-54] by phosphorylating targets that cause rapid microtubule turn-over at the ki netochores [55], after which amphitelic attachments are free to take place. On the biochemical level the metaphase-a naphase transition is driven by the E3 ubiquitin ligase activity of the APC/C which ta rgets securin and cyclin B for proteasomal degradation. The SAC functions as a sensory mechanism by detecting unattached kinetochores and as an effector by inhibiti ng the activation of the anaphase promoting complex/cyclosome (APC/C) (Fig. 3). The na ture of the wait an aphase signal is not completely understood. However, it is widely accepted that the SAC protein complexes assembled at unattached kinetochores early in mitosis and negatively regulate activation of the APC/C, thus preventing anaphase onset [56-60]. A large complex of proteins incl uding Mad1, Mad2, BubR1, Bub1, Bub3, Mps1 and Aurora B, comprise the core spindle checkpoint proteins in yeast [61-64] and mammalian cells [65-67]. It is evident that the proteins of SAC require kinetochore localization and function as large multi-componential protein complexes.

PAGE 26

11 Aurora B [68-70] and Mps1 [71-73] are required for recruitm ent and localization of all other checkpoint proteins to the kine tochores. The current model for SAC activity suggests that kinetochore bound Mad1 and Mad2 form a complex which can then bind Cdc20, the activator of APC/C [74-78] and th e key target of the SAC [79]. However, Cdc20 binding by the Mad1-Mad2 complex is insufficient for inactivating APC/C. BubR1/Mad3 and Bub3 are all required for fu ll inhibition of the APC/C [80, 81]. The BubR1 complex appears to synergize [ 59] with the Mad1-Ma d2-Cdc20 complex by forming a supercomplex that can fully inhibit the APC/C. Several other proteins have been shown to be involved in the SAC, including the ROD-SWILCH complex [82], p31 [83-85], cyclin B-Cdk1 [86, 87], NEK2 [88] and pololike kinase-1 (PLK1) [89]. The contribution of these proteins to the SAC is not well understood. The activity of the spindle assembly checkpoint is essential for preventing chromosome missegregation and aneuploidy [90, 91]. The presence of a single unattached kinetochore is sufficient to activ ate the SAC and the SAC is not turned off until every kinetochore has formed fully saturated (25-30 microtubules) bipolar microtubule attachments.

PAGE 27

Fig. 3 The spindle assembly checkpoint 12

PAGE 28

13 MAPK Pathway The mitogen activated protein kinase (MAPK) pathway is highly conserved from yeast to humans [92, 93]. MA PK signaling integrates a va riety of extracellular and intracellular signals to control a broad spectrum of cellular processes including proliferation, survival, stress response and apoptosis [93]. A nu mber of cooperating molecular mechanisms regulate the cascade in order to ensure signaling specificity. MAPK Cascade The basic structure of the MAPK cascade is a module consisting of three kinases which sequentially activate one another through phosphoryla tion events. The most upstream kinases in the cascade are the serine /threonine kinases, MAP kinase kinase kinases or MAPKKK (MAP3K). Upon th eir own activation, MAP3Ks phosphorylate and activate the second kinase in the modul e, MAP kinase kinase or MAPKK (MAP2K) [93, 94]. MAP2Ks are defined as dual-specifi city kinases, for upon their activation, they in turn phosphorylate a Thr-X-Tyr motif in the third cascade member, MAP kinase or MAPK [93, 95]. Substrates of MAPK include transcription factors, phospholipases and cytoskeleton-associat ed proteins. The family of MAP3Ks, MAP2Ks and MAPK s is large, with at least 20 different members of the mammalian MAPK family identi fied to date [96]. The four most well described MAPK cascades are named for thei r relative MAPKs. Jun amino-terminal kinases (JNKs) primarily serve in the response to cellular stress. p38 is also activated in

PAGE 29

14 response to cell stresses and plays a role in cytokine production in hematopoietic cells, cytokine-stimulated proliferation and apoptos is. ERK5 is the l east well known MAPK cascade [93] and it has been suggested that ER K5 regulates cell surviv al and proliferation [97, 98]. The most well studied MAPK pathway is extracellular signa l-regulated kinases 1 and 2 (ERK 1/2). Regulation and Functions of the ERK 1/2 Pathway The ERK 1/2 cascade is implicated primarily in cellular proliferation, differentiation, cell cycle regul ation and cell survival [ 93]. ERK 1/2 phosphorylates many known targets including transcription f actors Elk1 [99], c-Fos [100] and p53 [101], all of which play a role in cellular proliferation and transformation. As well, ERK targets include the S6 kinase p90/ RSK [102], phospholipase A2 [103], EGFR [93] and several microtubule-associated proteins [103]. Activation of the ERK 1/2 cascade in re sponse to mitogen stimulation has been well studied. During cell cycle entry activation of the ERK1/2 cascade is triggered by engagement and oligomerization of extracellu lar growth factor receptors [104] which in turn, stimulates the conversion of Ras, a small GTP-ase, from its GDP-bound inactive form to an active GTP-bound form [96, 105]. GTP-bound Ras mediates the translocation of the MAP3K, Raf-1, to the membrane where it is activated by a yet undefined, phosphorylation mechanism [106]. Raf-1 activat es MEK which transmits the signal to ERK1/2. Activated ERK1/2 phosphorylates cytoplasmic targets or tr anslocates into the nucleus where it phosphorylates transcription factors which promote S-phase progression [96, 105].

PAGE 30

15 Mitotic Roles of ERK 1/2 It is well established that ERK 1/2 regulat es the G1/S transition in response to mitogen stimulation [96, 105]. A large but lesser known body of evidence suggests that the ERK 1/2 pathway regulates various mito tic functions including entry and exit from mitosis, spindle assembly, the spindle assembly checkpoint and Golgi apparatus fragmentation (Fig. 4). Despite a growi ng body of evidence supporting mitotic roles for ERK 1/2, a firm role for ERK 1/2 in mamma lian mitosis has not been established. Early evidence supporting a mitotic role for ERK 1/2 came from studies in Xenopus egg extracts where it was shown that p42 (the Xenopus ERK 2 homologue) is activated during M-phas e [107-110]. As well, ERK activity during mitosis in NIH 3T3 and HeLa cells is detectable via western bl ot analysis using antibodies that recognize activated ERK [111]. Importantly, reports using immunofl uorescence microscopy support the early conclusions from Xenopus egg extracts that ERK is activ ated during mitosis. Several groups have demonstrated that in mammalia n cells small pools of active ERK 1/2 and MEK 1/2 are localized to the kinetochores and spindle po les throughout mitosis and to midbody during cytokinesis [112-11 4] (Fig. 4). Activated p42 has also been shown to localize to mitotic spindles in Xenopus egg extracts [115] as we ll as in fertilized sea urchin eggs [116].

PAGE 31

Fig. 4 MAPK functions and localization during mitosis 2006 Sergiy I. Borysov 16

PAGE 32

17 Functional studies have revealed roles for ERK 1/2 in mitotic entry in mammalian cells but not in Xenopus egg extracts. In mammalian cells, expression of dominantnegative MEK [117], treatment with MEK inhibitors [111, 117] and RNA interference (RNAi) of MEK 1/2 and ERK 1/2 [118] all i nduce a G2/M cell cycle arrest. As well, such conditions decrease nucle ar translocation of cyclin B-Cdk1 and delay and reduce its activation [111, 117, 118]. Such data supports a role for ERK 1/2 in Cdk1 activation and entry into mitosis in mammalian cells. Howe ver, cyclin B-Cdk1 is not affected by the depletion of p42 from Xenopus egg extracts [110, 119]. To the contrary, constitutive activation of p42 in this system inhibits cyc lin B-Cdk1 and delays entry into mitosis [120, 121]. Further, evidence in Xenopus egg extracts revealed that p42 activates Wee1 kinase which directly phosphorylates and inactivates cyclin B-Cdk1 [122]. However, differences in the requirement of MAPK activity in mitotic entry between mammalian cells and Xenopus egg extracts, may be explained by thei r inherently differe nt cell cycles. Indeed, while the cell cycle of somatic ce lls follows a classic G1-S-G2-M cycle, Xenopus egg extracts recapitulate the embryonic cell cy cle, which is comprised only of S and M phases, with no gap phases in between. Therefore, Xenopus egg extracts may not possess an active G2 phase molecular mechanism. T hus, a role for ERK 1/2 during mitotic entry remains disputable. ERK 1/2 has been implicated in assembly of the mitotic spindle in several model systems. Early work in mammalian cell cultu re showed that ERK 1/2 associates with [123] and phosphorylates components of the cytoskeleton [124-126], and it has been demonstrated that ERK 1/2 negatively regulates tubulin polymerization in Xenopus egg extracts [108, 115]. Immunodepletion of p42 or pharmacological inhibition of its

PAGE 33

18 activation causes abnormal mito tic spindles to form in Xenopus egg extracts [115]. As well, inhibition of ERK 1/2 disrupts formati on of the mitotic spindle in mammalian cells [115] and in sea urch in eggs [116]. It has been suggested that ERK 1/2 re gulates spindle assembly through regulation of a mitotic motor protein CE NP-E. CENP-E is necessary for the establishment of chromosome-microtubule attachment and, th erefore, is critical for proper spindle formation. It has been demonstrated in mammalian cells that CENP-E is a mitotic substrate of ERK2, which phosphorylates CENP -E on sites that mediate its association with kinetochores [114]. In cycling Xenopus egg extracts, blockade of mitotic p42 activation shortens the duration of mitosis [119]. Along with kineto chore localization of ERK 1/2 in mammalian cells, this data suggests a pot ential role for ERK in regul ation of the SAC. Indeed, maintenance of an induced spindle assembly checkpoint arrest is compromised in p42 depleted [109] or p42 inhibited [127] Xenopus egg extracts. As well, loss-of-function mutations in Drosophila s rolled/MAPK gene caused th e abrogation of a colchicine induced mitotic arrest in Drosophila larvae [128]. Several reports have implicated MAPK in the regulation of SAC. As mentioned above, the SAC arrest depends on several checkpoint proteins including BubR1, Bub3 and Mad2 binding to Cdc20 to inhibit activat ion of the anaphase promoting complex (APC/C). Using Xenopus egg extracts it was shown that during mitotic arrest MAPK phosphorylates Cdc20 on sites that increase its affinity for BubR1, Bub3 and Mad2 and negatively regulate the APC/C [129]. Another report demonstrated that MAPK phosphorylates Mps1, a critical SAC kinase, and this phosphorylation is necessary for

PAGE 34

19 kinetochore localization of SAC proteins in Xenopus egg extracts [73]. Therefore, it has been proposed that ERK 1/2 is involved in regulating the SAC. Supportive of an ERK 1/2 mitotic ro le in mammalian cells are studies demonstrating that constitutive activation of MAPK via expression of v-mos or v-ras expression in mouse fibroblasts causes cells to fail cytokinesis and become binucleated [130, 131]. This indicates that ERK inactivation is necessary prior to cytokinesis. However, further studies will be necessary in order to definitively establish that ERK 1/2 regulate this critical mitotic stage. Fragmentation of the Golgi apparatus duri ng mitosis is an essential process and it is thought to be a method for partitioning Golg i membranes equally in both daughter cells [132]. It has been shown that mitotically activated MEK1 (the upstream activator of ERK1) localizes to Golgi membranes in late prophase [133, 134] and that Raf-1 activation of MEK1 is required for mitoti c Golgi fragmentation [133, 135, 136]. Further studies demonstrated that Golgi fragmentati on is mediated through an unusual, truncated ERK isoform, ERK1c [137, 138]. ERK1c is re gulated in an M-phase specific manner, becoming phosphorylated and localizing to the Golgi during early m itosis [138]. These findings indicate that activati on of ERK 1/2 pathway during mitosis may differ from its S-phase activation. In summary, ERK1/2 and their activators, MEK 1/2, localize to key mitotic structures in Xenopus egg extracts and in cells grown in culture. Functional studies reveal that ERK 1/2 plays roles in a variety of mito tic functions. While a role for ERK 1/2 in Golgi fragmentation has been established in mammalian cells, roles in spindle assembly

PAGE 35

20 formation and the spindle assembly checkpoint have primarily been studied in the system of Xenopus egg extracts. B-Raf Kinase Raf kinases are serine/threonine kinases whose activities regulate a variety of cellular processes incl uding growth, prolifer ation, survival, differentiation and apoptosis [96, 139, 140]. The Raf family consists of A-Raf, B-Raf and C-Raf (Raf-1), which function as MAP3Ks. Nearly all reported Raf functions re sult from activation of the MAPK cascade. Rafs share significant sequence id entity and are structur ally similar. In spite of some similarities, Rafs have some significant differences in their regulation, tissue distribution and developmental functi ons. While C-Raf is the prototypic Raf kinase, B-Raf has emerged as the most potent activator of MAPK signaling. B-Raf Protein Structure B-Raf, A-Raf and C-Raf share a basic three-domain architecture including conserved domains, CR1, CR2 and CR3 (Fig. 5). CR1 and CR2 are embedded within the N-terminal regulatory portion of Rafs, and CR3 resides in the C-terminal kinase domain. CR1 contains a Ras binding domain (RBD) and a cysteine rich domain (CRD) [141, 142], both of which provide interacting sites fo r upstream regulators such as Ras and Rap1 [143]. The CR2 domain contai ns a negatively regulatory pho sphorylation site [144-146] and a 14-3-3 binding phospho-epitope [147]. The CR3 domain is the kinase domain, comprised of the N-region and the activati on loop, both of which contain phospho-sites

PAGE 36

21 that regulate Raf activity. Unlike A-Raf and C-Raf, B-Raf contains a unique N-terminal domain, the significance of which is unknow n. While A-Raf and C-Raf genes are transcribed into one transcript, B-Raf is alte rnatively spliced, generating several different B-Raf isoforms [148, 149]. The 95 KD isoform is the largest and most commonly studied and the significance of the sm aller isoforms is not understood. B-Raf Activation Raf kinases are activated by similar and di stant mechanisms. It is believed that the N-terminal regulatory domain of Rafs bi nd to the C-terminal kinase domain, creating a closed conformation which renders the kinase domain inaccessible for activation [150]. Phosphorylation events and pr otein-protein interactions disrupts the N-terminal-Cterminal interactions, opening the Raf protei n which prepares it for activation [142, 143, 151-155]. However, there are unique aspects to B-Rafs regulation which explains its potent MEK kinase activity.

PAGE 37

Fig. 5 Raf family members 22

PAGE 38

23 B-Raf requires a lower dose of regula tory phosphorylation than does C-Raf for its activation. Following Ras-mediated st imulation, C-Raf requires two stages of phosphorylation events including Ras and S RC mediated phosphorylation of Ser-338 and Tyr-341 in the N-region [156-159] and Ras me diated phosphorylation of Thre-491 and Ser-494 in the activation loop [140]. B-Raf, however, does not require phosphorylation within the N-region due to the presence of a constitutive phosphorylation on Ser-335 and a phospho-mimicking aspartic acid at residue 448 [158]. Therefore, Ras mediated activation of B-Raf requires phosphoryla tion of Thr-599 and Ser-602 within the activation loop [160] It has been proposed that th e constitutive presence of negative charges in the N-region of B-Raf inhibits the interaction between the regulatory and catalytic domains, rendering an open conformation [161]. These differences account for a higher basal level activity in B-Raf than C-Raf. Rafs are further regulated on the level of protein-protein in teractions including direct interactions with Ras, Rap1 [162167], MEK [149, 162-167] and C-Raf [168]. While C-Raf and B-Raf both interact with Rap1, Rap1 mediates activation of B-Raf while it inhibits C-Raf and downstream MAPK signaling [163, 167, 169]. As well, BRaf and C-Raf both directly associate with MEK, however, B-Raf has a higher binding affinity to MEK than does C-Raf or A-Raf [ 170], which may account for the fact that BRaf is a stronger activator of MEK than C-Ra f or A-Raf [158, 160]. It has also been shown that B-Raf heterodimeri zes with C-Raf, and is requ ired for activation of C-Raf [171, 172]. While B-Raf/C-Raf heterodimers possess higher kinase activity than both respective monomers [168], B-Raf can be sufficiently activated by Ras alone [161].

PAGE 39

24 B-Raf Functions Analysis of Raf family members in knoc k-out mice has revealed that A-Raf, BRaf and C-Raf all play essential roles in embryogenesis. Disruption of B-Raf causes embryonic lethality resulting from apoptotic death of differentiated endothelial cells [173]. Disruption of C-Raf leads to aber rations in lung development and A-Raf knockout mice generate neurological and intest inal abnormalities [173, 174]. Knock-out studies also reveal th at B-Raf and C-Raf alleles can part ially compensate for one another and exhibit some functi onal redundancy [174]. Early studies revealed via northern blotti ng that B-Raf expres sion was restricted to tissues of the brain, testes and fetal membranes [175, 176]. However, the use of improved protein detection techniques demonstr ated that B-Raf is ubiquitously expressed at low levels in most tissues with perhaps highest expression in the brain. Subcellular localization of B-Raf has excl usively been reported as cy toplasmic, however, a thorough analysis of B-Raf subcellular local ization has yet to be published. Analyses of B-Rafs specific cellular f unctions have been studied either in comparison with C-Raf and A-Raf, or relative to its oncogenic functions. It was shown that B-Raf and A-Raf, but not C-Raf exhibi t sustained activation by neuronal growth factor (NGF) in PC12 cells [177], and epiderma l growth factor (EGF ) activated all three Raf isoforms. cAMP leads to activation of B-Raf in a Rap1/B-Raf dependent manner in neurons, whereas C-Raf is i nhibited by cAMP [165, 178, 179]. It is widely presumed that B-Raf functions duri ng S-phase in non-neuronal cells, however B-Rafs non-

PAGE 40

25 neuronal functions have not been well studied nor distinguis hed from the functions of CRaf. B-Raf as a Mitotic MEK Kinase It has been shown that ERK is activated during mitosis and co ntributes to normal mitotic functions. A recent report from our laboratory demonstrated that B-Raf is the MAP3K (MEK kinase) responsible for mitotic activation of the MAPK pathway in Xenopus egg extracts [180]. It was shown that BRaf is activated in an M-phase specific manner and is required for the mitotic activ ation of the MEK/MAPK pathway. As well, the authors demonstrated that cyclinBCdk1 directly phosphorylates B-Raf and contributes to its activation during mitosis [181], suggesting that B-Raf activation at mitosis is mediated through mechanisms distinct from those that regulate MAPK signaling in response to mitogens. Further, it was shown that MAPK regulates B-Raf through negative feedback phosphorylation, whic h is presumed to ensure transient activity of B-Raf during mitosis in Xenopus egg extracts [180]. In summary, B-Raf is a member of the Ra f family of kinases, but it stands out due to its unique structural and functional f eatures. Cumulative evidence from the recent decade demonstrates that B-Raf is a major ac tivator of the ERK 1/2 cascade. As well, novel functions have been ascribed to B-Raf. In particular, studies in Xenopus egg extracts have shown that B-Raf regul ates the mitotic activation of MAPK.

PAGE 41

26 MAPK Pathway in Tumorigenesis It has long been recognized that the MAPK cascade is a key regulator of cellular proliferation and survival. Thus, its c ontinuous signaling could lead to cellular transformation. Indeed, the MAPK pathway is hyperactivated in approximately 30% of human tumors. Four well studied mechanisms of ERK activation in human tumors include mutations in the epidermal growth factor receptor (EGFR), Ras, the mitogenactivated protein kinase phospha tases (MKPs) and B-Raf. EGFR, Ras and MKPs in Human Cancers The epidermal growth factor (EGF) a nd its receptor, EGFR [182, 183] signals through Ras activating the MAPK pathway [184]. It has be come well rec ognized that EGFR is an oncogene [185-188] and is highly expressed in human cancers and correlated with poor prognosis [189]. EGFR is frequen tly overexpressed or mutationally activated [190] in breast, lung and head and neck can cers, glioblastomas, bladder, colorectal, ovarian and prostate cancers [191-195]. As well, transf orming growth factor alpha (TGF ), an EGFRs ligand, is upregulated in a wide variety of transformed cells [196198] thus causing persistent stimulation of EGFR. Ras proteins are a family of small GTPa ses that are upstream activators of Rafs and therefore activators of th e MAPK cascade [199]. In norma l quiescent cells, Ras is in its GDP-bound inactive form. Following stimul ation by EGF or other factors, Ras is transformed into its GPT-bound active form wh ich then binds to and stimulates the activation of Rafs. Ras is converted to its oncogenic form by missense mutations that render the proteins to be constitutively GTP-bound and active [200]. Since oncogenic

PAGE 42

27 Ras cannot be inactivated, it drives activ ation of the Raf-MEK-ERK cascade in a stimulus-independent manner. Oncogenic Ras occurs in 30% of hu man tumors including 90% of pancreatic cancers, 50% of colon a nd thyroid cancers, 30% of lung cancers and myeloid leukemias, and 15% of melanomas [200-202]. Recently it has come to light that se veral mitogen-activated protein kinase phosphatases (MKPs), negative regulators of th e MAPK signaling, are involved in tumorigenesis [203]. MKPs are mutated in tu mors of the breast, lung, prostate, ovaries, pancreas, liver and gastrointestinal tract. Overexpression of several MPKs is observed in tumors and correlates with poor outcome a nd progression [204-206], thus serving as a prognostic marker [207]. However, in se veral tumors, MKPs are down regulated or grossly underexpressed [208, 209] Growth of tumors in nude mice from Ha-ras transformed cells was greatly delayed when MKP expression was induced, supporting a tumor suppressor role for MKPs [210]. While the mechanis ms of MKP deregulation are not yet fully understood, it has been shown that hypermethyla tion leads to loss of MKP-3 expression in pancreatic cancers [211]. B-Raf in Human Cancers Members of the Raf family were first iden tified as viral oncogenes causing tumors in mice and chickens [212-215]. C-Raf activit y is increased in response to hyperactivated EGFR or Ras, however, to date B-Raf is the only Raf kinase that is known to be mutated in human cancers. Two decades of testing human tumors fo r Raf mutations was largely unsuccessful until a fruitful, high-throughput screen of n early 1000 human tumor samples identified B-

PAGE 43

28 Raf missense mutations in many human cancers [216]. Activating B-Raf point mutations were discovered in nearly 70% of melanomas, 40% of pap illary thyroid carcinomas [217219]; 14% of ovarian cancers, 14% of liver cancers, 12% of colore ctal tumors, 11% of gliomas, 9% of sarcomas a to a lesser exte nt in other lymphomas, leukemias, breast, lung and liver carcinomas, totaling 8% of all tumors sampled [216]. While more than 30 missense mutations were identified, all in the kinase domain of B-Raf, 80% of the mutations were accounted for by a single Valine to Glutamic acid substitution at residue 600, B-RafV600E [216]. Melanomas by far accounted for the highest percentage of B-Raf mutations, in which over 90% of the mutations were represented with the V600E substitution. Ras mutations account for 15% of melanomas, however, Ras and B-Raf mutations are mutually exclusive in the vast majority of tumors, suggesting that Ras and B-Raf transform melanocytes through similar mechanisms. As well, it has been shown that 80% of benign nevi harbor a B-RafV600E mutation [220], thereby implicating B-Raf in the early stages of transformation. A dditional studies have shown that a paracentric inversion within chromosome 7 creates a fusion protein between a portion of the AKAP9 gene and the ki nase domain of B-Raf rendering B-Raf constitutively active [221]. This rearrange ment is found at a low frequency (1%) of sporadic thyroid papillary carcinomas, however its prevalence is 11% among thyroid papillary carcinomas that developed in childre n as a result of exposure to radiation from the Chernobyl explosion. Finally, le ss commonly noted are B-Raf copy number amplifications which occur most often in thyroid follicular adenomas (25%) and thyroid follicular carcinomas (35%) [222].

PAGE 44

29 B-Raf as an Oncogene The most common mutation in B-Raf, V600E is flanked by a threonine at residue 599 and Serine at residue 602, both of whic h require phosphorylation for Ras mediated activation [160]. It is ther efore conjectured that the negative charge acquired by substituting glutamic acid for valine suffices as a phospho-mimic capable of activating BRaf [216]. Indeed, the vast majority of mutations in B-Raf were demonstrated to be activating mutations, with B-RafV600E exhibiting a 10.7 fold increas e in its kinase activity in vitro over wild-type B-Raf. The activating mutations increased endogenous ERK activation in cell cultu re, as tested by levels of ERK1/2 phosphorylation, whereas overexpression of wild-type B-Raf did not increase ERK1/2 phosphorylation [223]. Interestingly, four rare B-Raf mutatio ns found in tumors [216] have reduced in vitro kinase activity [224] despite activating ERK in cells. It was shown that three of these exogenously expressed mutants, interact w ith and activate endogenous wild-type C-Raf, which then activates ERK [224]. Consistent with its elevated kinase activity, it was shown that B-RafV600E is capable of inducing transformation in NIH3 T3 cells [216] and immortalized mouse melanocytes [223] in an ERK dependent manne r. Further, transformation of melanoma cells expressing B-RafV600E was reversed upon downregulation of B-Raf [225, 226]. Additionally, it was shown that immort alized melanocytes expressing B-RafV600E form tumors in nude mice. Consistent with the presence of B-RafV600E mutations in 80% of benign nevi, transgenic ze brafish expressing B-RafV600E formed benign nevi [227]. However, B-RafV600E induced formation of invasive melanomas in zebrafish, only when expressed on a p53 deficient background. A conditional B-RafV600E knock-in mouse

PAGE 45

30 model produces hematopoietic displasia and skin polyps [228]. Transgenic mouse models targeting B-RafV600E to melanocytes [229] or the lung [230] rapidly develop benign nevi or adenomas, respectivel y, but rarely develop melanomas or adenocarcinomas unless combined with the loss of tumor suppressors Pten, TP53 or Ink4a/Arf. However, targ eted expression of B-RafV600E to the thyroid serves as a tumor initiator and promoter, resulting in rapid accumulation of parathyroid carcinomas (PTC) that closely reflect human PTCs [231]. Therefore, B-RafV600E is capable of transforming immortalized cells and causing benign tumo r formation in several animal models. However, its role in tumor progression vari es amongst tumor types, requiring additional mutations for full transformation to occur. In summary, MAPK signaling has been imp licated in a high percentage of human tumors. Hyperactivity of the Ras-Raf-ME K-ERK pathway is achieved by mutations on various levels including the upstrea m activator EGFR, its ligand, TGF activating mutations in Ras and deregulation of MPKs Most notably, B-Raf is constitutively activated in a wide variety of cancers wh ich depend on oncogenic B-Raf expression for proliferation and survival. 80% of benign ne vi harbor oncogenic BRaf, suggesting that it is an early transformation event. Mitosis and Cancer It has long been recogniz ed that human tumors are genetically unstable. Nucleotide-level genomic instability and gene mutations are well established causes of tumorigenesis. However, the form of genetic instability most frequently observed in

PAGE 46

31 cancers is mitotically driven chromosoma l aneuploidy. Mounting evidence supports a causal role for chromosomal aneuploidy in tu morigenesis, therefore, understanding how mitosis drives aneuploidy in human tumors has become a critical question of modern cancer biology. Types of Genomic Instability Human disease is largely attributed to genetic alterations [232]. Mutations in genes which repair or divide the genome cause cells to continuously acquire genomic changes over time rendering them genomically unstable. The two categories of genomic instability include nucleotide-level instabilitie s and mitotically driven aneuploidy [232]. The human genome contains thousands of microsatellites, short sequences of DNA that are tandemly repeated 10 to 100 tim es [233]. Microsatellites are highly susceptible to DNA replication errors, whic h are repaired by the highly conserved DNA mismatch repair (MMR). Mutations in MMR genes and occasionally mutations in the nucleotide excision repair (N ER) genes [234] increase the rate of genomic mutations leading to microsatellite instability (MIN), the most common type of nucleotide-level genomic instability [232]. MIN occurs in approximately 13% of sporadic colorectal, endometrial and gastric cancer s [235, 236]. It is widely accepted that MIN drives tumorigenesis [237]. Normal human cells contain 46 chromoso mes. Deviation in chromosome number is referred to as aneuploidy. Gains and losses of whole chromosomes, gene amplifications and deletions and chromosomal rearrangements and are all forms of aneuploidy [232, 235, 237]. Embryogenic aneuploi dy is typically lethal and when viable,

PAGE 47

32 causes disease such as Down, Edward and Pa taus syndromes [238]. However, nearly every tumor cell exhibits aneuploidy and the va st majority of tumor cells are genetically unstable [239]. Continual chromosomal gains and losses, a form of genomic instability termed chromosomal instability (CIN), is the most common form of aneuploidy in tumors [232, 237, 239]. Nearly all tumors th at do not exhibit MIN are ch romosomally unstable, often containing gross structural changes such as translocations, deletions and amplifications [237], as determined by classic and mode rn karyotype analyses. Structural rearrangements in the absence of whole-chromosomal instability are a well accepted cause of tumorigenesis, such as the BCR-AB L translocation that drives some cases of chronic myelogenous leukemias [240]. The ro le of CIN in tumorigenesis is less well defined. Some have argued that chromo somal aneuploidy is a side-effect of tumorigenesis. However, correlative evid ence and direct experimental results have demonstrated that chromosomal aneuploidy co ntributes to cellular transformation and cancer development. Mitosis and Aneuploidy For well over a century it has been dem onstrated that aneuploidy results from errors in cell division [241]. Some of th e mitotic defects which cause aneuploidy include multipolar spindle formation, defects in chromosome cohesion, spindle-microtubule misattachments, and a weakened sp indle assembly checkpoint [242]. Cells that form multi-polar spindles undergo chromosomal missegregation. It is believed that multi-polar spindles result from defects in the duplication, segregation and

PAGE 48

33 maturation of centrosomes. Indeed, Aurora A amplification [243] or inactivation of p53 [244], BRCA1 and BRCA2 [245-2 48] or mitotic motor prot ein Eg5 cause errors in centrosomal duplication or se gregation leading to spindl e malformation and aneuploid daughter cells. Defects in the cohesion of chromosomes have been shown to cause aneuploidy. Inactivation of securin or separase homologues in budding and fission yeast generates hypoploidy [249-251]. As well, deletion of s ecurin from human cancer cells induces high levels of CIN [252]. Another potential mechanism for aneupl oidy lies within faulty kinetochoremicrotubule engagement. Merotelic a ttachments occur upon inhibition of the chromosomal passenger complex that corrects kinetochore-microtubule attachment errors [253]. As well, truncated forms of the ad enomatous polyposis coli protein generate CIN by disrupting kinetochore-microt ubule attachments [254-256]. An insufficiently performing spindle assembly checkpoint is also implicated in the production of aneuploidy [ 257]. Mice with reduced le vels of Mad2 [258], BubR1 [259] or Bub3 [260] have a def ective SAC and are prone to th e acquisition of aneuploidy. While Mad2, BubR1 and Bub3 have roles thr oughout the cell cycle, CENP-E functions exclusively during mitosis [261]. Therefore, it is significant that reduction in CENP-E levels compromises the SAC and causes aneuploidy in vitro [262] and in mice [263]. Causal Role for Aneuploidy in Tumorigenesis Aneuploidy is the most common feature found amongst tumors and is considered a hallmark of cancer [237]. Some of the earliest cancer biolog ists proposed that

PAGE 49

34 aneuploidy causes tumorigenesis [264-266]. It is now widely accepted that changes in gene expression lead to tumorigenesis [267]. Despite arguments that aneuploidy is a benign consequence of transformation [268], mo dern biology suggests that mutations in genes that regulate cell divisi on drive aneuploidy, which is ultimately the means for generating changes in gene expression that lead to tumorigenesis [232, 235, 269, 270]. Tumor development results from accumulated changes in gene expression. Some have argued that the accumulation of a few somatic mutations is sufficient to cause transformation [271]. However, mathematical modeling predicts that the acquisition of sufficient numbers of changes cannot be achieved solely by the acquisition of spontaneous mutations [272]. Mathematical models also predict that the onset of genomic instability is an early and necessary event in tumor development [235]. In fact, allelic loss occurs in extremel y small polyps in early stage colorectal cancers [273], and aneuploidy is present in precancerous lesion s of the cervix, head and neck, esophagus and bone marrow [274]. Human tumors gain and lose chromosomes at a rate of 10-100 times higher than normal cells [239]. Average tumors of the colon, prostate and breast have lost 25% of their alleles [ 232] and exhibit heterogeneity due to continual genomic changes [275]. It has been demonstrated that a larg e number of CIN colorectal tumors cannot adequately activate their spi ndle assembly checkpoint [276]. In fact, a large proportion of human tumors display misexpression of genes that regulate the SAC. BubR1 and Mad1 are frequently misregulated in a num ber of human cancers [261]. Mad2 was found to be transcriptionally overexpre ssed in several tumor types including hepatocellular, lung and inte stinal carcinomas, B cell lymphomas and several others

PAGE 50

35 [277]. Mutational inactivation of Bub1 or BubR1 have been observed in colon cancers [276]. Several tumor types, including pitu itary adenomas and mammary and pulmonary adenocarcinomas, exhibit overexpression of s ecurin [278-280]. Other genes that regulate mitosis such as Apc, BRCA1 and BRCA2 are misregulated in a number colorectal, duodenal, breast, ovarian, colon and pancreatic cancers [261]. Direct evidence has demonstrated that an euploidy can drive tumorigenesis. In 2007, it was reported that cells from Mad2 tran sgenic mice become highly aneuploid and develop a wide variety of tumors including liver and lung carcinomas, sarcomas and lymphomas [277]. The mice developed whol e chromosomal aneuploidy and structural chromosomal abnormalities, as shown by g-banding analysis. Immunofluorescence studies demonstrated that Mad2 cells exhi bit lagging chromosomes and chromosome bridges during mitosis a str ong indication that mitotic erro rs were the driving factor behind the acquisition of aneuploidy. As well, it was shown that transient Mad2 expression is sufficient for long-term tumo r development, suggesting that aneuploidy induced by Mad2, rather than Mad2 itself, was necessary for tumor maintenance. Further direct evidence that aneuploidy is tumorigenic comes from studies in mice with reduced CENP-E levels [263]. These studies are particularly significant since the role of CENP-E is exclusively relegated to mitosis. Mice heterozygous for CENP-E exhibit whole chromosomal aneuploidy, in the absence of structural abnormalities, as shown by spectral karyotyping. Lagging a nd pole-associated chromosomes were detectable in 40% of cells is olated from CENP-E heterozygo us mice, implicating mitotic errors as the cause of aneuploidy. Afte r a long latency period, these mice develop splenic lymphomas and lung adenomas at a ra te of 10%, comparable to the number of

PAGE 51

36 smokers who develop lung cancer. The long late ncy period indicates that a small subset of the aneuploid cells have th e potential to dr ive transformation. In the presence of other aneuploidy-inducing carcinogens, CENP-E he terozygous mice had a reduced incidence of tumorigenesis, indicating that a significan tly high level of aneuploidy is incompatible with life [261]. In summary, mitosis must be accurately executed in order to preserve the genomic integrity of a cell. Mitotic proteins whose misregulation drives aneuploidy in vitro are frequently misexpressed in human tumors. Nearly all tumors are aneuploid and genomically unstable from an early stage in tumor development and the degree of aneuploidy is directly correlated with the stage of tumorigenesi s. As well, direct studies of Mad2 and CENP-E confirm that mitotica lly induced aneuploidy is tumorigenic in mice. Together, these observations support the assertion that mi sexpression of spindle assembly proteins promote aneuploidy, whic h can contribute to tumorigenesis.

PAGE 52

37 Hypothesis and Dissertation Statement Recently, it has come to light that B-Raf is a prominent oncogene, mutated in a wide spectrum of tumors includ ing nearly 70% of melanomas. Oncogenic B-Raf is also expressed in 80% of benign nevi, indicating that it plays an early role in tumori genesis. It is crucial to understand the molecular mech anism by which oncogenic B-Raf contributes to tumorigenesis. The cellular mechanisms through which oncogenic B-Raf may drive transformation are beginning to be appreciated. However, more work is needed in order to understand the full effects of oncogenic B-Raf. It is well accepted that B-Raf is the most potent activator of MAPK signaling [158, 160]. The MAPK pathway is a critical signal transduction pathway necessary for cellular proliferation, cell surv ival, stress response and apopt osis [93]. MAPK signaling is also involved in the re gulation of mitosis [108-110, 113, 114, 119, 134]. Interestingly, B-Raf has been reported to activat e MAPK signaling during mitosis in Xenopus egg extracts [180], however, little is known about B-Raf functions in human cells. I hypothesize that B-Raf regulates mitotic functions in human somatic cells and that oncogenic B-Raf disrupts mito sis, leading to aneuploidy To address these hypotheses, I conducte d loss-of-function experiments in cell cultures in order to evaluate the contribution of B-Raf to mitosis. Further, I introduced oncogenic B-Raf into cancer, immortalize d, and primary cells, evaluating the cells mitoses and analyzing their karyotypes.

PAGE 53

38 The results of my thesis work demonstrate that B-Raf regulates several critical mitotic functions and that oncogenic B-Raf perturbs mitosis, driving aneuploidy and chromosomal instability.

PAGE 54

39 CHAPTER 2 SUBCELLULAR B-RAF LOCALIZATION Introduction Regulatory functions of MAPK signali ng are mediated in large part by the subcellular localization of MAPK pathway members. Active forms of MEK and ERK localize to the cytoplasmic comp artment in order to phosphoryla te substrates localized at the cytoskeleton structures and they transl ocate into the nucleus to regulate gene expression by phosphorylating transcriptional factors [281, 282]. During mitosis, active MEK and ERK colocalize to the mitotic spindl e poles, the kinetochores, the midzone of the anaphase spindle and the te lophase bridge during cytokine sis [112]. Little has been published on the subcellular localization of B-Raf with the exception of its localization throughout the cell body of post-mitotic neural cells [283]. B-Raf is itself regulated by phosphorylation events. Ra s mediated activation of B-Raf requires phosphorylation on two key resi dues (Ser 599 and Thr 602) in B-Rafs kinase domain. Evaluating the localization of dually phosphorylated B-Raf can give clues to the cellular posi tioning of active B-Raf.

PAGE 55

40 Results B-Raf Localizes to Mitotic Structures MEK and ERK, members of the MAPK signaling cascade, localize to mitotic structures when activated by phosphorylation. Work from our laboratory has revealed that B-Raf is critical for mitotic activa tion of the MAPK cascade and its activity is regulated in an M phase-dependent manner [180 ]. Therefore it stands to reason that BRaf might also exhibit mitosis-specific localization. B-Raf is Detected at the Mitotic Spindle In order to test whether B-Raf locali zes to the mitotic spindle apparatus, immunofluorescence studies were carried out in cycling NI H 3T3 cells (Fig. 6), MCF-7 cancer cells (data not shown) and human foresk in fibroblast (HFF) ce lls (Fig. 7) using a monoclonal alpha-tubulin antibody to stain the mitotic spindle, DAP I to visualize the chromosomes and a commercially available, polyclonal antibody against B-Raf. This antibody recognizes a single, 95 kD protein ba nd in corresponding cel lular lysates (data not shown). B-Raf was excl usively detected in the cytoplasmic compartment of interphase cells. Interestingly, as shown in HFF cells, at the onset of mitosis or prophase (as determined by chromosome condensation an d aster formation), B-Raf localizes to the nuclear region. As cells enter metaphase, B-Ra f becomes highly enriched in the region of the mitotic spindle and the spindle poles and to the spindle and midzone during anaphase. This was most evident upon u tilizing a threshold analysis, which distinguishes the areas containing the highest relative le vels of B-Raf staining. In la te telophase and cytokinesis, the B-Raf staining pattern was mostly confined to the cytoplasmic compartment, as it was

PAGE 56

Figure 6. B-Raf localizes to the mitotic spindle in NIH 3T3 cells a. Immunofluorescence staining of e ndogenous B-Raf protein. a. B-Raf; b threshold analysis depict ing regions of strong B-Ra f enrichment; c. overlay -tubulin to visualize the spindle (red) and DNA (blue); Images were acquired at 100X magnification, scale bar represents 3m, arrows depict mitotic cells. 41

PAGE 57

Fig. 7 B-Raf localizes to the mitotic spindle in HFF cells Top Panel: Immunofluorescence in as ynchronous HFF cells of endogenous BRaf protein (green) Bottom Panel: Overlay of B-Raf threshold (green), tubulin (red) and DNA stained with DAPI (blue). Images were acquired at 100X magnification. 42

PAGE 58

43 during interphase. The enrichment of B-Raf staining at the metaphase spindle region was also observed using a mouse monoclonal BRaf antibody, indicating that the staining pattern from the two antibodies reflects th e detection of B-Raf protein. Neither the isotype control for the polyclonal (Rabbit Ig G) nor monoclonal (Mouse IgG2b) generated any appreciable st aining pattern. To further ascertain whether B-Rafs mito tic staining co-localizes to microtubule spindle structures, I used confocal microscopy to acquire 0.45 m z-sections throughout HFF cells. The results demonstrate that B-Raf staining was restricted to the confocal sections containing spindle microtubules a nd condensed chromosomes (Fig.8). Strong BRaf staining appears at the spindle poles and the spindle midzone in cells undergoing metaphase and anaphase, respectively. View ing metaphase cells down the spindle pole axis permits us to visualize B-Raf along the ra dial microtubules and at the spindle poles. Thus, B-Raf localization is enriched at the spindle apparatus during mitosis in somatic tissue culture cells. B-Raf Interacts with Spindle Microtubules Immunofluorescence staining demo nstrates that B-Raf is en riched at the region of the mitotic spindle, and therefore B-Raf may be directly associated with the microtubules of the spindle apparatus. In order to address this question, entire z-series of immunofluorescence images of B-Raf and the m itotic spindle were analyzed with Imaris Bitplane 3D blind deconvolution followed by processing with the ImarisColoc module to isolate, visualize and quantify region overlap. These analyses demonstrated that a portion

PAGE 59

B-Raf Spindle DNA Overlay Metaphase Metaphase y-axis Anaphase Figure 8. B-Raf is detected at the spindle apparatus during mitosis in HFF cells Confocal microscopy of HFF cells stai ned with antibodies against endogenous B-Raf (red), -tubulin to visualize the spindle (green) and DNA stained with DAPI (blue). Images represent 0.48m along the z-axis from within a z-series. 44

PAGE 60

45 of B-Raf directly colocalizes with the polym erized microtubules of the spindle (Fig. 9), suggesting that B-Raf directly intera cts with the spindle microtubules. In order to validate the Imaris data, HFF and HeLa cells were exposed to nocodazole in order to depolymerize the micr otubules. Cells were stained with tubulin and B-Raf antibodies and the B-Raf stai ning pattern was assessed by fluorescence microscopy. As shown in Figure 10, the stai ning pattern of B-Ra f corresponding to the metaphase spindle was radically altered upon no codazole treatment indicating that B-Raf localization at metaphase reflects its asso ciation with the spi ndle microtubules. Based on the same principals of nocodazole function, we performed a biochemical experiment in Xenopus egg extracts to determine if B-Raf interacts with polymerized microtubules during mitosis and if the interaction is disrupted when microtubules are depolymerized by nocodazo le. As shown in Figure 11, B-Raf and polymerized microtubules are associated in a pelleted fraction of egg extracts and the association is decreased when microtubules are depolymerized with nocodazole. B-Raf Localizes to the Centrosomes Based on the immunofluorescence thres hold analyses and confocal data demonstrating an abundance of B-Raf at the spindle poles during mitosis, I decided to analyze mitotic cells for B-Raf colocalizati on to the centrosome. The centrosome is comprised of an abundance of proteins concentr ated into two centriole s. The centrosome and its associated proteins can be detect ed following a brief detergent extraction of soluble proteins. NIH 3T3 or HFF cells were briefly extracted with CHAPS

PAGE 61

Fig. 9 B-Raf interacts with the spindle microtubules in HFF cells Confocal images of B-Raf and the spindle were analyzed using Imaris Bitplane 3D blind deconvolution. Following deconvolution, resulting stack was processed with ImarisColoc module to isolate, visualize and quantify region overlap. Green represents -tubulin, red is background B-Raf staining and yellow represents areas where B-Raf and microtubules interact. 46

PAGE 62

HFF Cells Overlay DNA Spindle B-Raf D N HeLa Cells D N Fig. 10 B-Raf spindle localization is disrupted when microtubules are depolymerized with nocodazole HFF and HeLa cells were treated fo r two hours with nocodazole to induce destabilization of microtubules. Cells were fixed with 4% paraformaldehyde and processed for immunostain ing of B-Raf (green) and -tubulin (red), and DAPI was used to detect DNA ( blue ) D=DMSO ; N=Nocodazole. 47

PAGE 63

Fig. 11 B-Raf co-pellets with microtubules isolated from M phase Xenopus egg extracts Spindle microtubules structures formed in mitotic Xenopus egg extracts, in the absence or presence of 10 ng/ l nocodazole, were pe lleted through a 40% glycerol buffered cushion as previously described (Horne Guadagno, 2003). The microtubule pellet and its associated proteins were resuspended in SDS sample buffer, separated by 10% SDS-PAGE, and subjected to immunoblot analysis for -tubulin and BRaf. 48

PAGE 64

49 detergent, fixed with 4% paraformaldehyde stained for B-Raf, tubulin and DAPI to visualize the chromosomes. The results showed that throughout the cell cycle the majority of B-Raf was removed by CHAPS extr action with the exception of two discrete pairs of foci on opposite sides of the aligned chromosomes, a distinct centriolar staining pattern (Fig. 12). To confirm that B-Raf colo calizes directly with the centrioles, cells were costained with B-Raf and centrin, a centr iole marker, followed by confocal analysis of 0.45 m Z-sections. Both pairs of foci co-l ocalized precisely w ith centrin in both NIH3T3 (Fig. 12) and HFF (Fig. 13) cells duri ng mitosis. As shown in Fig. 14, B-Raf is present at the centrosome throughou t the cell cycle. Hence, we conclude that a detergentresistant pool of B-Raf is tightly associated with the centrioles in mammalian cells. B-Raf is Phosphorylated on Serine 599 and Threonine 602 at Mitotic Structures B-Raf is dually phosphorylated at cons erved residues Thr599 and Ser602 during Ras-mediated activation (Zhang and Guan, 2000), therefore dual phosphorylation of BRaf suggests that B-Raf is active and capable of phosphorylating downstream targets. To determine whether B-Raf is phosphorylated at these two residues during mitosis, HFF cells were subjected to immunostaining with a monoclonal alpha-tubulin antibody, a phospho-B-Raf (Thr599/Ser602) antibody a nd DAPI to visualize the DNA. Phosphorylated B-Raf Localiz es to the Centrosomes During interphase, phospho-B-Raf (Thr599/ Ser602) staining was weakly visible at the centrosome and the remainder of th e cells is devoid of phospho-B-Raf staining, however, a notable staining pattern of phospho-B-Raf (Thr 599/Ser602) was detectable

PAGE 65

Figure 12 B-Raf localizes to the centrosomes in NIH 3T3 cells Immunofluorescence of endogenous B-Raf prot ein. Cells were incubated with 1% CHAPS containing buffer, prior to fixation, in order to wash away soluble proteins and retain insol uble proteins and proteins tightly associated with insoluble structures. Cells were stained with antibodies against endogenous B-Raf (green ), centrin to visualize the centrosome (red) and DNA (blue). Images were acquired at 100X magni fication, scale bar represents 3m. Centrioles are magnified 4X in the outset panel. 50

PAGE 66

51 Figure 13 B-Raf localizes to the centrosomes in HFF cells Immunofluorescence of endogenous B-Ra f protein. Cells were incuba ted with 1% CHAPS containing buffer, prior to fixation, in order to wash away soluble proteins and reta in insoluble proteins and proteins tightly associated with insoluble st ructures. Cells were stained with antibodies agai nst endogenous B-Raf (green), centrin to visualize the centrosome (re d) and DNA (blue). Images were acquired at 100X magnification. Centrioles are ma gnified 5X in the outset panel.

PAGE 67

Figure 14 B-Raf localizes to the ce ntrosomes throughout the cell cycle Immunofluorescence of endogenous B-Raf protein. Cells were incubated with 1% CHAPS containing buffer, prior to fixation, in order to wash away soluble proteins and retain insoluble proteins and pr oteins tightly associated with insolu ble structures. Cells were stained with antibodies against endogenous B-Raf (green), -tubulin to visualize the spindle (red) and DNA (blue). Ima g es were acquired at 100X ma g nification. 52

PAGE 68

53 during all stages of mitosis (F ig. 15). At prophase, the onset of mitosis, strong phosphoB-Raf staining was detectable at the centrosomes and remained at the spindle poles throughout metaphase and anaphase. This staining pattern was nearly identical to the non-phosphorylated B-Raf centrosomal staining. Additionally, phospho-B-Raf (Thr599/Ser602) staining was detected at the spindle midzone in cells undergoing anaphase and, at the midbody in late te lophase cells undergoing cytokinesis. Collectively, these results indicate that pool s of active B-Raf localiz e to specific spindle structures including the centr osomes during cell division. Phosphorylated B-Raf Localizes to Condensed Chromatin While phospho-B-Raf (Thr599/Ser602) staini ng was exclusively detected at the centrosome during interphase, staining became prominent at the nuclear region containing condensed chromoso mes during prophase, in ag reement with the staining pattern for total B-Raf protein (Fi g. 7). During metaphase, phospho-B-Raf (Thr599/Ser602) staining was concentrat ed at regions surrounding the aligned chromosomes (Fig. 15). The perichromosomal space is the region that directly encircles each condensed chromosome. Many proteins localize to the perichromosomal space during mitosis and the functions of these pr oteins and the perichromosomal region have not been fully defined. However, it has been shown that several components that localize to the perichromosomal space are involved in mitotic functions such as chromosome condensation, decondensation, mitotic progre ssion, cytokinesis and nuclear envelope reformation following exit from mitosis. In order to directly address whether B-Raf is phosphorylated in a perichromosomal fash ion, chromosomes were isolated from

PAGE 69

Figure 15 B-Raf is phosphorylated at key mitotic structures HFF cells were immunostained fo r phospho-B-Raf using a phospho-B-Raf (Thr599/Ser602) antibody (b.). Microtubul es and DNA (a.) were detected with anti-tubulin antibody and DAPI. Images were captured at 100X magnification. Overlay is shown in c and d d is ma gnified 4X. Scale bar represents 10 m. Arrows point to the centrosomes and the midbody. 54

PAGE 70

Figure 16 Phosphorylated B-Raf localizes to the condensed chromosomes Phospho-B-Raf (Thr599/Ser602) loca lizes to the perichromosoma l space during metaphase, but not interphase. Chromosomes were isolated from HeLa cells treated with nocodazole for 2 hrs and subjected to immunostaining and visualized with confocal microscopy. Kinetochores were visualized with CREST antiserum (red); green foci represent phosphoB-Raf staining. Shown are single 0.45 M sections from within a z-series of a metaphase cell. A metaphase cell is shown in the center of each panel surrounde d by three interphase cells, in which no colocalization is observed. 55

PAGE 71

Figure 17 Phosphorylated B-Raf locali zes to the perichromosomal sheath Phospho-B-Raf (Thr599/Ser602) localizes to the perichromosomal sheath during metaphase, but not interphase. Images from figure 18 were analyzed using Imaris doconvolution software and a 3D isosurface model was rendered. Kinetochores were visualized with CREST antiserum (red); green foci represent phospho-B-Raf and chromosomes are shown in blue (DAPI). A metaphase cell is shown in the center and an interphase cells, in which no colocalization is observed, to the bottom left of the panel. Joseph Johnson created this image. 56

PAGE 72

57 interphase and metaphase cells, spun onto coverslips and stained with DAPI and the phospho-B-Raf antibody. Confocal micros copy revealed that phospho-B-Raf (Thr599/Ser602) encircles each individual chromosome during metaphase, whereas no chromatin associated staining was detected in interphase cells (Fig. 16). The perichromosomal staining is further supported by rendering a three-dimensional isosurfacing model of th e chromosomes (Fig. 17). Phosphorylated B-Raf localiz es to the Kinetochores Confocal imaging of B-Raf staining in HFF cells revealed discrete foci detectable along the metaphase plate of aligned chromo somes (Fig. 8, metaphase) reminiscent of kinetochores. A view along the spindle pole ax is (Fig. 8, metaphase y-axis) showed these foci appeared as a ring-like structure that co-localized at the juncture where spindle microtubules meet the aligned chromosomes, typi cally the site of the kinetochores. Close inspection phospho-B-Raf (Thr599/Ser602) stai ning revealed the appearance of foci overlapping with chromosomes during metaphase and anaphase (Fig. 15, row d). To determine whether these foci were localized at kinetochores, metaphase chromosomes were isolated from nocodazole-treated HFF cells, fixed and adhered to coverslips. Chromosomes were subjected to immunofluorescence analysis Co-staining with the kinetochore marker CREST antiserum a nd phospho-B-Raf showed that phospho-B-Raf foci overlap directly with ev ery pair of kinetochores of metaphase chromosomes (Fig. 18, metaphase). In contrast, interphase nuclei demonstrated no kinetoc hore colocalization of phospho-B-Raf (Fig. 18, interphase). These results demonstrate that phospho-B-Raf (Thr599/Ser602) co-localizes with the kinetochores during metaphase.

PAGE 73

Figure 18 Phosphorylated B-Raf localizes to the kinetochores during mitosis Phospho-B-Raf (Thr599/Ser602) staine d foci co-localize to kinetochores at metaphase, but not interphase, chromosomes. Chromosomes were isolated from HeLa cells treated with nocodazole for 2 hrs and subjected to imm unostaining and visualized with confocal microscopy. Kinetochores were visualized with CREST antiserum (red); green foci represent phospho-B-Raf staining. Shown are single 0.45 M sections from within a z-series of a meta p hase cell. 58

PAGE 74

59 Conclusions Prior to my studies, reports on the subcellular localization of B-Raf were limited strictly to the cytoplasm of interphase neurons. My re sults demonstrate that B-Raf localization and phosphorylation is cell-cycle specific. Specifically, B-Raf localizes to and is phosphorylated at mitotic structures many of which are known to play a critical role in the accuracy and timing of mitosis.

PAGE 75

60 CHAPTER 3 B-RAF PERFORMS CRITICAL MITOTIC FUNCTIONS Introduction Previous studies from ou r laboratory show a role for MAPK in promoting the formation and stability of the mitotic spi ndle [115]. Specifically, blocking MEK activity or depleting p42 MAPK from Xenopus egg extracts inhibits spindle assembly and leads to the generation of aberrant half spindles, a portion with unfocused poles, and microtubule (MT) asters. Moreover, when mammalian cells are treated during late G2 and M phases with the pharmacological MEK inhibitor U1026, a high frequency of spindle abnormalities and misaligned chromo somes is observed indicating that MEK signaling is also important for spindle functions in somatic cells. A role for B-Raf in activating the MAPK cascade during mitosis has been suggested from studies in Xenopus egg extracts that mimic the early embryonic cell cycles of S and M phases [180]. As well, it has been reported that peaks of B-Raf activity are detected at M phase and early G1 phase during the cell cycle of HeLa cells [134], but hard evidence for B-Raf having a role in regulating mitosis in somatic cells ha d not been described. The studies described in this chapter show evidence for mitotic func tions of B-Raf at mito sis in human somatic cells.

PAGE 76

61 Results B-Raf Contributes to Mitotic Spindle Assembly in Xenopus Egg Extracts Work from our laboratory has shown th at proper mitotic spindle assembly in Xenopus egg extracts requires ERK phosphorylati on. In the same system, we have shown that B-Raf is the MEK kinase which activates ERK signaling during mitosis. BRaf and ERK activities do not re gulate S-phase functions in Xenopus egg extracts, as they are strictly relegated to mitosis. These da ta suggests that B-Ra f may regulate spindle assembly in Xenopus egg extracts through direct effects on mitosis. Spindle Assembly is Compromised in the Ab sence of B-Raf in Xenopus Egg Extracts Xenopus egg extracts are a powerful biochemical system for studying the regulation of spindle assembly. Antibodies can be used to efficiently immunodeplete endogenous proteins and spindl e assembly can be monitored. As shown in figure 19, BRaf protein in Xenopus CSF-arrested egg extracts is immunodepleted using B-Raf antibodies but not rabbit IgG mock control. Metaphase spindle formation was monitored by the addition of rhodamine labeled tubulin in both mockand B-Raf-depleted extracts. Formation of spindles in mock-depleted egg extracts oc curred properly, as shown, exhibiting bipolar spindles with focused poles and well-organized microtubules (Fig. 20). In contrast, the depletion of B-Raf from e gg extracts disrupted spindle assembly, resulted in unfocused spindle poles and splayed sp indle structures. Se veral monopolar, half spindle structures were also formed as well as structures lacking organized microtubules and containing misaligned chromosomes. Thes e results indicate that B-Raf is required for mediating proper spindle assembly in Xenopus egg extracts.

PAGE 77

Figure 19 Immunodepletion of B-Raf from Xenopus egg extracts CSF-arrested Xenopus egg extracts were depleted of endogenous B-Raf protein with B-Raf specific antibodies. Extracts were activated into S phase (S) with 0.4 M Ca+2 addition and cycled into M phase (M) with nondegradab le cyclin B. Figure 20 B-Raf contributes to spindle assembly in Xenopus egg extracts Extracts were prepared as in figure 20. Rhodamine labeled -tubulin was added to visualize spindle assembly and DNA was stained with Hoechst buffer. Images were taken on 100X magnification. 62

PAGE 78

63 B-Raf is Necessary for Spindle Formation and Chromosome Congression in Human Somatic Cells Our preliminary studies in Xenopus egg extracts suggest a role for B-Raf in the regulation of mitotic spindle assembly. Immunofluorescence data suggests that active forms of B-Raf reside at m itotic structures in human somatic cells. Therefore I investigated whether B-Raf regulates the as sembly of the mitotic spindle in human somatic cells. Knockdown of B-Raf by siRNA Inhibits Proper Spindle Formation and Chromosome Congression To determine if B-Raf regulates spindle assembly in human somatic cells, two independent 21-base pair RNA duplexes corr esponding to conserved B-Raf sequences in exon 11 (BE11), and exon 3 (BE3) were utili zed to downregulate BRaf Spindles of mitotic cells were subsequently analyzed via immunofl uorescence microscopy. siRNAs were transfected individually into human fo reskin fibroblast (HFF) cells and HeLa cells (data not shown). A 21-base pair scramb led sequence was used as a control. Transfection of the BE11 or BE3 siRNAs le d to an 80-95% reduction of B-Raf protein levels in HFF cells within 72 hours as assess ed by immunoblot (Fig. 21). The scrambled control siRNA had no apparent effects on spindle morphology (Fig. 22). However, knockdown of B-Raf with the BE11 or BE3 siRNA resulted in pleiotropic spindle abnormalities in 80-90% of the mitotic cells an alyzed from at least eight independent experiments. Three general groups of abnor mal spindle phenotypes were observed: 49% with abnormal spindle morphology, including unfocused poles, 29% with shortened

PAGE 79

64 spindle structures, and 22% with microtubule bundles. In the scrambled control cells, chromosome congressed in an organized, linear fashion at the metaphase plate in nearly 90% of cells. In contrast, chromosome alignm ent at the metaphase plate was perturbed in the vast majority of B-Raf depleted cells. Cells exhibited chromosomes throughout the region of the metaphase plate, along the perimeter of the mitotic spindle structures, at the spindle poles, and encircling en tire spindle structures. Thus, our data suggest that B-Raf is critical for proper spindle formation a nd chromosome congression in human somatic cells. C-Raf is Dispensable for Normal Spindle Assembly Previous studies suggested that C-Raf (R af-1) might play a ce ll cycle role at the G2/M transition [118, 284, 285]. Therefore, we also examined the consequences of reducing C-Raf protein levels in HFF cells. We transfected a 21-base pair RNA duplex (siRNA) specifically targeting C-Raf into hum an foreskin fibroblast (HFF) cells. A 21base pair scrambled sequence was used as a co ntrol. Transfection of HFF cells with the C-Raf specific siRNA led to an 85% or greater reduction of C-Raf, but not B-Raf, after 48-72 hr (Fig. 23, A). In contrast to the phenotypic abnormalities generated in B-Raf knockdown cells, spindle morphology and chromosome alignment appeared completely normal in C-Raf depleted HFF cells as evaluated by immunofluorescence microscopy (Fig. 23, B). Thus, we conclude that C-Raf is not required for proper spindle formation or chromosome congression in somatic tissue culture cells.

PAGE 80

Figure 21 Downregulation of B-Raf by siRNAs HFF cells were transfected with scrambled siRNA (SCR) or siRNAs targeting sequences within exons 11 or 3 of B-Raf (BE11 or BE3, respectively) and analyzed 48-72 hours posttransfection. Western an alysis probing for B-Raf or -tubulin (loading control). 65

PAGE 81

Figure 22 B-Raf contributes to proper sp indle assembly in human somatic cells HFF cells were transfected with scrambled siRNA (SCR) or siRNAs targeting B-Raf (BE11 or BE3) and analyzed 72 hours post-transfection. P hotos are representative of typical abnormalities observed in spindle (red) morphology and chromosome (blue) congression. 50-100 spindle structur es were analyzed in each of 8 experiments for each siRNA. Images were acqui red at 60X magnification; scale bar represents 5 M. 66

PAGE 82

A. B. Figure 23 C-Raf is not necessary for assembly of the mitotic spindle Knockdown of C-Raf by siRNA has no effect on spindle assembly or DNA a lignment. HFF cells were transfected with a scramble d control siRNA (SCR), BRaf specific siRNA, or C-Raf specific siRNA and analyzed 72 hours post-transfection. (A) Western analysis probing for C-Raf or -tubulin (loading control). (B) Mitotic spindle and DNA alignment appear normal in C-Raf-depleted cells transfected with siRNA. Results are representative of at least three independent experiments. Images were acquired at 60X magnification; scale bar represents 5 M. 67

PAGE 83

68 B-Raf Regulates Microtubule-Kinetochore Engagement Metaphase is the stage of mitosis during which chromosomes align in the metaphase plate, equidistant from each cen trosome, a process termed chromosome congression. Chromosome congression is preceded by and dependent upon the bipolar attachment of spindle microtubules to the kinetochores of each chromosome, otherwise known as microtubule-kinetochore engagement or microtubule capture. Microtubule capture depends on the coordination of protei ns which localize to the kinetochores. Following the downregulation of B-Raf, ce lls exhibit aberrancies in both spindle assembly and chromosome congression. One explanation for the lack of chromosome congression could be that mi crotubule-kinetochore engagement is impaired in the absence of B-Raf. The localization data demonstrates that B-Raf localizes to and is phosphorylated at the kinetochores, suggesting that B-Raf may indeed play a role in kinetochore mediated functions. CENP-E Levels are Elevated at the Kinetochores in the Absence of B-Raf In order to determine whether the mi crotubules and kinetochores are engaged following siRNA downregulation of B-Raf, cells were analyzed for the presence of an engagement marker. The CENP-E motor prot ein is essential for microtubule capture by kinetochores and for regulating subsequent microtubule-kinetochore dynamics [286]. It has also been established that the levels of CENP-E bound to th e kinetochores during early mitotic stages is increas ed three to five fold when microtubules are unattached to kinetochores [286]. While the significance of this increase is not fully understood,

PAGE 84

69 kinetochore associated CENP-E levels serv e as a marker of mi crotubule-kinetochore engagement. HeLa and HFF cells were transfected with B-Raf or scramble control siRNAs as previously described. 72 hours post-transf ection, it was determined that the B-Raf knock-down cells exhibited the aforem entioned phenotypic abnormalities. A corresponding set of scrambled control and B-Raf knock-down cells were subjected to immunostaining for CENP-E and the kinetochore marker, CREST. Cells were imaged via confocal microscopy and 3dimentional z-series projections were used to quantify the CENP-E colocalized with the kinetochor es. While CENP-E was present at the kinetochores in the scrambled control cells, levels of kinetochore bound CENP-E increased by an average of 3.8 fold in cells transfected with the B-Raf siRNA (Fig. 24). The B-Raf knock-down cells that were anal yzed exhibited chromosomal misalignment. Microtubules are not Cold Stabl e in the Absence of B-Raf Cells transfected with B-Raf siRNA di splay misaligned chromosomes and have elevated CENP-E, a marker for impaired microtubule capture. Microtubule polymerization from tubulin dimers is a dyna mic and reversible process. Polymerized spindle microtubules are cold-s table when the microtubules plus ends are attached to kinetochores and conversely they are co ld-labile when unengaged. The classic experiment to directly assess whether spindle microtubules are engaged with kinetochores is to perform a cold-m icrotubule depolymerization assay. To do this, I downregulated B-Raf usi ng siRNA as described above and cells subsequently were plated on coverslips in tissue dishes. 72 hour s posttransfection,

PAGE 85

Figure 24 Kinetochore bound CENP-E levels following downregulation of B-Raf Quantitation of CENP-E bound to the ki netochores. (A) HeLa cells were transfected with a SCR contro l siRNA or siRNA targeting B-Raf (BE11) and 72 hours post-transfection cells were stained for DNA (blue), kinetochore (red), CENP-E (green). (B ) CENP-E that localizes directly with kinetochores was quantified. 70

PAGE 86

71 the tissue culture dishes on which the cells were plated were subjected to cold by incubation on ice for several minutes. Cells were then fixed, stained for alpha-tubulin and DNA, and their microtubules were anal yzed by immunofluorescence microscopy. The scrambled control cells exhibited norma l chromosome congression spindle assembly (Fig. 25). Following cold treatment, the microtubules of the c ontrol cells remained polymerized. (The cells exhi bited the anticipated morphologi cal changes associated with cold). The cells in which B-Raf was tran sfected exhibited misa ligned chromosomes and abnormal spindles. When subjected to cold treatment nearly 100% of these microtubules underwent complete and rapid depolymerization, thus demonstrating an absence of kinetochore-microtubule engagement in these cells.

PAGE 87

Figure 25 Microtubules are not cold -stable in the absence of B-Raf HFF cells were transfected with a scrambled siRNA (siSCR) or a B-Raf targeting siRNA (siBRaf). 72 hours post-transfection cells were e xposed to ice for 10 minutes to depolymerize unengaged microtubules. Cells were then fixe d with 4% paraformaldehyd and stained for DNA (blue) and -tubulin (green). B-Raf depleted cells re tained few to no polymerized microtubules, demonstrating that those cells had few to no microtubules engaged with kinetochores. 72

PAGE 88

73 B-Raf Regulates the Spindle Assembly Checkpoint The spindle assembly checkpoint (SAC) arre sts cells in mitosis prior to anaphase until all sister chromatid pairs are attached at the mitotic spindle. Activation of the SAC is dependent upon the activities of proteins which localize to the kinetochores. B-Raf itself localizes to and is dually phosphorylated at the kinetochores exclusively during mitosis. B-Raf depleted cells generate abnormal spindle structures and misaligned chromosomes and have deficien cies in microtubule-kinetoch ore engagement. Regardless of such dramatic mitotic defects, B-Raf deplet ed cells continue to proliferate over a 3-4 day period similar to control cells treated w ith scrambled siRNA. Therefore, we asked whether the spindle assembly checkpoint is functional in ce lls that are lacking B-Raf. Cells Cycle through Mitosis in the Absence of B-Raf It is anticipated that cells will arrest in mitosis if they have defects in spindle assembly. To address whether B-Raf deplet ed cells arrest at the spindle assembly checkpoint, control and B-Raf depleted cells were counted and scored as being in interphase or mitosis based on their flat tened or rounded morphology, respectively. The percentage of rounded cells following BRaf downregulation wa s not significantly increased over cells in the control group (Fig. 26, A). Cyclin B levels peak during metaphase a nd drop off rapidly to initiate anaphase, therefore Cyclin B levels serve as a bioche mical marker of mitosi s, specifically of metaphase. We analyzed Cyclin B levels, via western blot analysis, in cells transfected with the scrambled control siRNA or a BRaf specific siRNA 72 hours post-transfection.

PAGE 89

74 Levels of cyclin B were not increased in th e B-Raf depleted cells relative to SCR control cells (Fig. 26, B). Together, these data indicate that 72 hour s of downregulation of B-Raf does not lead to a spindle assembly checkpoint arre st despite the notable induction of spindle abnormalities and the impairment of microtubule-kinetochore engagement. Induced Spindle Assembly Checkpoint is Compromised in the Absence of B-Raf Downregulation of B-Raf drives significant mitotic abnormalities that persist without induction of a SAC, suggesting that B-Raf may be necessary for SAC function. In order to determine whether B-Raf is requ ired for activation of the SAC, scrambled control or B-Raf downregulated cells were subjected to a classic SAC challenge with microtubule poisons. HFF and HeLa cells were challenged with nocodazole or taxol in order to induce a SAC 48 hours after transfection with scra mbled control or B-Ra f siRNAs. After 24 hours of challenge cells were anal yzed for their capacity to arre st in mitosis. Cells were lysed and subjected to western bl ot analysis to evaluate Cycl in B levels as a biochemical marker of a spindle assembly arrest. Cyclin B level are reduced to nearly undetectable levels in cells depleted of B-Raf upon challe nge nocodazole or taxol (Fig. 27) confirming that an artificially induced SAC is not fully functional in the abse nce of B-Raf. Live imaging microscopy of taxol treated cells conf irmed that scrambled control cells entered and remained in a rounded morphological state consistent with the expected induction of metaphase arrest, whereas B-Raf deplet ed cells acquired a flattened morphology following a brief rounded state induced by taxol, indicative of a breached arrest (Fig. 28).

PAGE 90

Figure 26 Cells do not enter mitotic arrest in the absence of B-Raf HFF cells were transfected with a scrambled or B-Raf targeting siRNA. (A) Mitotic cells were scored based on round morphology. (B) Cells were lysed and probed for B-Raf, the mitotic marker, c y clin B and total ERK for a reference. 75

PAGE 91

Figure 27 Cells do not maintain a spindle checkpoint arrest in th e absence of B-Raf HFF cells were transfected with scrambled or BRaf targeting siRNAs for 48 hours followed by a nocodazole challenge for 24 hours. Cells were lysed and probed for B-Raf, the mitotic marker, cyclin B and total ERK. 76

PAGE 92

Time spent in mitosis Time spent in mitosis Figure 28 B-Raf depleted cells exit mitotic arrest in the presence of taxol HeLa cells were transfected with scrambled control or B-Raf targeting siRNAs for 48 hours and then treated with 50nM taxol in 0.1% DMSO for 24 hours during which time cells were imaged using live imaging phase contrast microscopy. (A) 20 (SCR) or 17 (BE11) individual cells were analyzed for their time spent in mitosis. (B) On average, BRaf depleted (BE11) cells spent significantly less time in mitosis relative control cells. 77

PAGE 93

Figure 29 Cells prematurely exit metaphase in the absence of B-Raf HeLa cells were transfected with scrambled or B-Raf siRNAs for 48 hour s and live imaging performed for the following 24 hours. (A) Images were collected every 1 min over a 24 hr period at 20X magnificati on. Mitosis starts at nuclear envelope breakdown (NEB) and ends at cytokinesis. The data was compiled from at least 35 cells per condition from 2 independent experiments and is graphed (B) as the average +/standard error. 78

PAGE 94

79 B-Raf Depleted Cells Exit Metaphase Prematurely To directly test whether the SAC is compromised in BRaf depleted cells, scrambled control or B-Raf depleted HeLa cells were subject to live imaging phasecontrast microscopy for 24 hours. The total dur ation of mitosis was scored from nuclear envelope breakdown (NEB) through cytokinesis. HeLa cells treate d with B-Raf siRNA accelerated faster through mitosis than SCR control cells, averaging 66 vs. 83 min, respectively (Representative photo Fig. 29, A). Closer inspection re vealed that B-Rafdepleted cells remained in metaphase on av erage 24 minutes less th an non-depleted cells (Fig. 29, B). In contrast, timing through anaphase-telophase wa s not significantly affected in B-Raf siRNA-treated HeLa cells, although a modest delay in cytokinesis was consistently observed. These results, imply th at the spindle checkpoi nt is suppressed in HeLa cells depleted of B-Raf. Kinetochore Localization of Mad2 and Bub1 is Inhibited in the Absence of B-Raf Published data in Xenopus egg extracts has indicate d ERK signaling regulates the requisite kinetochore localization of key spi ndle assembly checkpoint proteins. Since BRafs only known functions are regulated via ERK, we postulated that B-Raf regulates localization of SAC proteins to the kinetochores. To test this possibility, kinetochore localization of spindle checkpoint proteins Bub1 and Mad2 was analy zed in control and B-Raf depleted cells. To do this, metaphase chromosomes were isolated from colcemidtreated HeLa cells, immunostained for th e kinetochore marker, CREST, and Bub1 or Mad2. In chromosomes isolated from scramble d siRNA transfected ce lls, localization of Bub1 and Mad2 at CREST-stained kinetochores was readily detectab le (Fig. 30). In

PAGE 95

Figure 30 Mad2 and Bub1 kinetocho re localization is inhibited in the absence of B-Raf HeLa cells were transfected with a scrambled (SCR) or B-Raf specific (BE11) siRNA for 72 hours prior to chromosomal isolation. Kinetochore localization of Bub1 (B) and Mad2 (C) was analyzed using immunofluorescence on isolated chromo somes. DNA is stained with DAPI (blue), kinetochores are stained with CREST (red), Bub1 and Mad2 are shown in g reen. 80

PAGE 96

81 contrast, Bub1 and Mad2 immunostaining was gr eatly diminished or undetectable at the kinetochores of HeLa cells treated with th e B-Raf siRNA, demonstr ating that B-Raf is necessary for proper localizati on of critical spindle assembly checkpoint proteins, Bub1 and Mad2. Since kinetochore lo calization of spindle checkpoint proteins is an indication of SAC activation, we conclude that B-Ra f is critical for SAC activation. Conclusions Our lab previously demonstrated that B-Raf regulates MAPK signaling during mitosis in Xenopus egg extracts. However, B-Ra f had no known functional role in mitosis in Xenopus egg extracts or in mammalian cel ls. The work described in this chapter demonstrates that B-Raf is necessary for proper spindle assembly in Xenopus egg extracts and in human somatic cells. Chro matin congression is severely impaired upon B-Raf downregulation in human cells a nd we show evidence suggesting that microtubules are not fully engaged with the kine tochores in the absence of B-Raf. While such grave mitotic errors ought to elicit a spindle assembly checkpoint arrest, I have demonstrated B-Raf depleted cells accel erate faster through mitosis and bypass the spindle assembly checkpoint. We conclude th at B-Raf contributes to several critical mitotic functions includi ng spindle assembly, chroma tin congression, microtubule capture and activation of spindle assembly checkpoint.

PAGE 97

82 CHAPTER 4 ONCOGENIC B-RAF DISRUPTS MI TOSIS AND CAUSES CHROMOSOMAL INSTABILITY Introduction Mutationally activated B-Raf is detect ed in ~8% of human cancers with a particularly high frequency in melanoma (60-70%), colo rectal (15-20%), papillary thyroid (35-50%), and ovarian (30%) cancers [216, 217, 287-291]. The B-RafV600E mutant accounts for at least 90% of all B-Raf mutations detected to date which renders BRaf into a constitutively active state [216, 224]. As such, B-RafV600E sustains 10-fold higher levels of ERK activity in melanoma cells [292]. Ectopic B-RafV600E expression transforms immortalized NIH 3T3 fibroblas ts and mouse melanocytes in culture [216, 223, 226, 293, 294] and is required for melano ma cell prolifera tion, survival, and melanoma tumor growth and vascular development in vivo [226, 295, 296]. Together, these finding underscore crucial roles for BRaf in tumorigenesis. How oncogenic B-Raf is required for tumorigenesis remains poor ly understood. Part of the transforming activities of B-RafV600E may occur through subverting adhesion-dependent G1 phase controls for cyclin D1 expression and p27 down-regulation [297, 298] and suppressing anoikis in melanoma cells [299, 300].

PAGE 98

83 Aneuploidy is a widely recognized trait of many human cancers and is associated with tumor progression and poor prognosis [301, 302]. Aneuploidy results from mitotic errors in chromosome segregation due to defects in the spindle assembly checkpoint (SAC) and centrosome amplification [242, 303]. It is widely believe d that aneuploidy itself can be a transforming event through th e generation and selection of chromosomal profiles that favor cell growth, resistance to cell death and metastatic potential. Human melanomas are highly aneuploidy. In fact, changes in DNA copy number are detected in greater than 95% of human primary me lanomas [304, 305] suggesting that early oncogenic events contribute to the onset of aneuploidy. We have demonstrated that B-Raf regulates mitotic functi ons that are required to ensure proper chromosomal segregation and th e genomic fidelity of the cell. In this chapter, we explore the possi bility that the most common oncogenic mutation in B-Raf, V600E, contributes to mitotic defects lead ing to the acquisition of aneuploidy. Results B-RafV600E Expression Promotes Mitotic Abnormalities in Melanoma Cells B-Raf plays a critical role in the regu lation of spindle formation, microtubulekinetochore engagement and activation of the spindle assembly checkpoint in human somatic cells. This prompted us to ask wh ether the constitutively active oncogenic form of B-Raf, carrying a V600E mutation, might have adverse effects at mitosis.

PAGE 99

84 B-RafV600E Status in Melanoma Cells is Associated Mitotic Abnormalities To address the possibility that B-RafV600E may have adverse effects on mitosis, mitotic events in A375 and SK-MEL28 mela noma cells, that are known to harbor BRafV600E mutations, were analyzed by immunoflu orescence microscopy. In parallel, we examined mitoses in WM35, SbCl2, and SK-M EL5 melanoma cell lines expressing wild type B-Raf. Normal mitotic spindles were de tected in at least 90% of the mitotic figures examined in melanoma cells with wild type B-Raf (Fig. 31). In contrast, abnormal spindles with misaligned chromosomes were observed at a high frequency (70-85%) in both A375 and SK-MEL28 cells (Fig. 31). Thes e results indicate that melanoma cells carrying B-RafV600E mutations are more prone to forming aberrant mitotic spindle structures during cell division. B-RafV600E Promotes Spindle Abnormalities and Centrosome Amplification in Human Melanoma Cells Based on the correlative findings be tween oncogenic B-Raf expression and mitotic abnormalities, we hypothesized that the constitutively active B-RafV600E mutant was responsible for causing the abnormal mitoses observed in the mutant B-Raf melanoma cells. In experiments carried out in the Guadagno lab, by Yongping Cui, BRafV600E was introduced into SK-MEL-5 human melanoma cells with a wild type B-Raf background. Cells were infected via a retrovirus using a pBabe-puro-B-RafV600E vector or the corresponding empty vect or control. Expression of the recombinant B-RafV600E mutant was confirmed by western analysis (Fig. 32, A) and led to elevated phospho-ERK levels as previously reported [306]. Stri kingly, SK-MEK-5 melano ma cells transduced

PAGE 100

Figure 31 Aberrant chromatin congression in B-RafV600E positive melanoma cells Panel of human melanoma cell lines during mitosis containing wild type (WT) or mutant (V600E) B-Raf. Microtubul e spindles and DNA were detected by staining with a -tubulin antibody and DAPI, respectively. Magnification is 63X. (B) Graphs show the percent of normal versus abnormal spindles in human melanoma cells at mitosis (n=200). 85

PAGE 101

Figure 32 Aberrant mitotic spindle fo rmation and chromatin congression in melanoma cells ectopically expressing B-RafV600E SK-MEL5 melanoma cells were transfect ed with pGST, pGST-B-Raf, or pGSTB-RafV600E plasmid DNAs. (A) Western blot analysis and (B) immunofluorescence staining of mitotic spindles a nd centrosomes. DNA was detected by DAPI staining. (C) Graph of data from Sbcl2 and SK-MEL5 cells. 200 mitotic figures were analyzed for each condition per experiment. Scale bar, 5 M. This figure was contributed by Yongping Cui, Ph.D. 86

PAGE 102

87 with pBabe-B-RafV600E, but not with pBabe alone (empty vector), displayed pleiotropic spindle abnormalities in ~76% of mitotic figures examined by fluorescence microscopy (Fig. 32, B & C). These abnormalities include abnormal spindle morphology, multi-polar spindles and misaligned chromosomes. Similar results were obtained in SbCl2 melanoma cells transf ected with pGST-B-RafV600E constructs but not pGST empty vector (data not shown). The abnormal spindle phenot ypes were not due to over-expression of B-Raf protein per se as ectopic expression of wild type B-Raf in SK-MEL5 cells had little effect on spindle formation. Hence, expression of constitutively active B-RafV600E promotes spindle abnormalities in melanoma cells. Abnormal numbers of centrosomes often arise in tumor cells resulting in multipolar aberrant spindle structur es [303]. A portion of mitotic spindles displayed multiple poles in melanoma cells transfected with B-RafV600E (Fig. 32, B). To confirm whether this reflects the presence of extr a centrosomes, parental and B-RafV600E-modified melanoma cells were subjected to immunostaining with an anti-tubulin antibody. Depending on the phase of the cell cycle, G1 (unduplicated) or G2 (duplicated) centrosomes were typically det ected in either parental or vector control SK-MEL-5 cells with fewer than 5% containing greater than 2 centrosomes (Fig. 32, C). In contrast, supernumerary centrosomes (as indicated by -tubulin stained foci) were detected in ~30% of interphase cells for both SbCl 2 and SK-MEL5 cell lines containing the BRafV600E mutant. Co-staining of microtubules with a -tubulin antibody revealed multipolar spindles at mitosis in cells c ontaining supernumerary centrosomes. This represented about half of the abnormal sp indles. The remaining abnormal spindles

PAGE 103

88 contained two centrosomes suggesting that B-RafV600E also perturbs spindle formation independent of centrosome amplification. B-RafV600E Drives Aneuploidy and Chromoso me Instability in SbCl2 Melanoma Cells The results shown here demonstrate that exogenous B-RafV600E expression promotes spindle abnormalities and centrosomal amplification in human melanoma cells. While a large number of these ce lls die, some of these cells are retained in the population despite the severity of mitotic abnormalitie s. It stands to reason that errors in chromosome segregation errors may have occu rred in these cells, lead ing to aneuploidy. Since these experiments demonstrate that B-RafV600E drives mitotic abnormalities in cells, which continue to divide, I decided to dete rmine if the chromosomal composition of these cells is changing over time. Such insights are significant since chromosomal instability gives rise to a karyotypica lly varied population of cells thereby providing a pool for selection of cells that have tumori genic and metastatic potential. B-RafV600E Induces Aneuploidy in SbCl2 Melanoma Cells Most tumor cells and cell lines exhibit aneuploidy, therefore I screened several melanoma cell lines for their chromosomal number via metaphase spread analysis. SbCl2 cells isolated from an early primary tu mor are genomically stable with a mode of 46 chromosomes (Fig. 33). In order to test whether B-RafV600E can induce aneuploidy in this genomically stable cancer cell line, cells were retrovirally infected with a pBabe-BRafV600E vector or the corresponding empty vector control and positively expressing cells

PAGE 104

B. A. Figure 33 SbCl2 melanoma cells are near diploid (A) Metaphase spreads were perf ormed on SbCl2 cells and the chromo somes were stained with DAPI and pseudocolored green for contrast. (B) 50 meta phase spreads were counted and the chromosomal distribution s are shown. The upper panel indicated the number of chromo somes each cell contains and the lower panel shows the percentage of cells containing 46 chromosomes or <>46 chromosomes. 89

PAGE 105

90 were selected for two weeks in puromycin containing media. Immunofluorescence and western blot analysis was performed to confirm exogenous B-Raf expression and activation of ERK (Fig. 34, A & B). Fluores cence in situ hybridization (FISH) was performed on the cells to eval uate their ploidy. In the em pty vector control cells, 5.5% and 9.5% of interphase nuclei displayed le ss than or greater th an two signals for centromere probes to chromosomes 2 or 8, respectively (Fig. 35, A), which is consistent with SbCl2 having a mode of 46 ch romosomes. In contrast, B-RafV600E expressing SbCl2 cells exhibited aneuploidy at a frequency of 16.5% in chromosome 2 and 20.5% in chromosome 8 in (Fig. 35, A). This data dem onstrates a role for constitutively active BRafV600E in promoting aneuploidy in tumor cells. B-RafV600E Drives Chromosome Instabili ty in SbCl2 Melanoma Cells B-RafV600E expression causes significant leve ls of aneuploidy in SbCl2 melanoma cells as demonstrated via FISH analysis. It is anticipated that the persistence of spindle abnormalities in these cells would continue to generate segregation errors and perpetually change the chromosomal content of the cells. Therefore, SbCl2 cells were used to test whether B-RafV600E expression can induce chromosomal instability. SbCl2 cells were retrovirally infected and sele cted for expression of B-RafV600E or an empty vector control as described above. The kar yotypes of individual cells we re evaluated to assess the precise number of chromosomes per cell. To evaluate the karyotype, metaphase spreads were prepared, chromosomes were stained with DAPI and counts were performed on 100 cells per sample. A mode of 46 chromosome s was observed in the vector control SbCl2 cells two weeks post-infection (Fig. 35, B). As expected in cell culture 50% of the

PAGE 106

Figure 34 Exogenous expression of B-RafV600E in SbCl2 cells Retroviral expression of B-RafV600E or empty vector control in SbCl2 melano ma cells that endogenously express WT B-Raf. (A) Immunofluorescence staining of DNA (blue), tubulin (red) and B-Raf (green). Threshold is lowered until endogenous B-Raf is undetect able in empty vector control. (B )Western analysis of cell lysates prepared from control (empty vector) or B-RafV600E overexpressing Sbcl2 cells. 91

PAGE 107

Figure 35 Aneuploidy induced by B-RafV600E in SbCl2 cells SbCl2 melanoma cells that endogenously expr ess WT B-Raf were retrovirally infected to expression of B-RafV600E or empty vector control. (A) Percentage of 200 nuclei per condition, that scored positive for aneuploidy by FISH analysis with probes to either chromosome 2 or 8. p-values for chromosomes 2 and 8 are <0.001 and <0.005, respectively. Photos of FISH analysis using centromere probes specific to chromosomes 2 (red, 2R) and 8 (green, 8G). Yellow arrows point to nuclei positive for aneuploidy. (B and C) Percent dist ribution and representative examples of chromosome numbers obtained from at least 50 metaphase spreads. Chromosomes were detected by staining with DAP I and imaged at 100X magnification. 92

PAGE 108

93 control cells had some degree of aneuploidy, ranging from 29 to 48 chromosomes per cell. In contrast, expression of B-RafV600E resulted in the complete absence of a chromosomal mode, with aneuploidy in 94% of the cells (Fig. 35, C). B-RafV600E expressing cells exhibited a large dist ribution of chromoso mes ranging from 15-87 chromosomes per cell. These results demons trate that SbCl2 cells became aneuploid due to expression of B-RafV600E. In order to determine if the population of B-RafV600E cells are chromosomally unstable, cells were allowed to continue pr oliferating and their karyotypes were reevaluated at later time point. 52% and 48% of the control cells maintained 46 chromosomes at week four (Fig. 36, A) and week six (Fig. 36, B), respectively, and the chromosomal variability ranged from 30 to 51 chromosomes per cell. Thus the mode and the chromosomal variability in the control cel ls did not change significantly over time. B-RafV600E cells continued to be highly aneuploid with only ~5% having 46 chromosomes. However, the chromosomal di stribution was sharply reduced from 15-87 chromosomes per cell at two weeks post-infec tion to 18-52 at four weeks (Fig. 36, C) and 15-49 at 6 weeks (Fig. 36, D). This dem onstrates that the population of B-RafV600E cells is chromosomally unstable with an increas e in the percentage of hypoploidy cells over time.

PAGE 109

A. Figure 36 Change in chromosome number generated by 4 and 6 weeks of B-RafV600E expression SbCl2 melanoma cells endogenously expressing WT B-Raf were retrovirally infected to expression of B-RafV600E or empty vector control. (A) Karyotype of cells cultured for 4 weeks in the presence of the pBabe puro empty vector. (B) Karyotype of cells cultured for 6 weeks in the presence of the pBabe puro empty vector. (C) Karyotype of cells cultured for 4 weeks in the presence of the pBabe puro B-RafV600E vector. (D) Karyotype of cells cultured for 6 weeks in the presence of the pBabe puro B-RafV600E vector. 50 cells per condition were analyzed. B C. D. 94

PAGE 110

95 B-RafV600E Induces Rapid Aneuploidy in Primary Human Cells We have demonstrated the emergence of aneuploidy in SbCl2 melanoma cells. While this is significant, it raises two important mechanistic questions. First, B-RafV600E positive SbCl2 cells were selected for over a minimum of 2 weeks time. This could be sufficient time for the cells to generate ch anges which could indi rectly be driving aneuploidy. Secondly, SbCl2 cells are alrea dy transformed prior to the introduction of oncogenic B-Raf, and could therefore possess alterations that allow for the generation and survival of aneuploid cells. Therefore it is important to test whether B-RafV600E can induce aneuploidy rapidly in cells of a primary nature. B-RafV600E Rapidly Induces Aneuploidy in Primary Human Melanocytes In order to determine if B-RafV600E is capable of inducing aneuploidy in nontransformed cells, we evaluated the potential for oncogenic B-Raf to initiate aneuploidy in primary human melanocytes (HEM cells). Melanocytes are the cell of origin in melanoma development. This is a particular ly relevant model considering that B-Raf is mutated into its oncogenic form in nearly 70% of melanomas and is mutated 80% of benign nevi of mela nocytic origin. To examine whether B-RafV600E expression can cause aneuploidy in HEM cells, I transiently transfected the cells with the p-Babe-B-RafV600E vector, or the corresponding empty vector control, using a high-efficienc y, high-viability elect roporation tr ansfection method. Transfection efficiency was monitore d by visualizing GFP fluorescence of a cotransfected GFP-containing plas mid and was found to be approximately 90%. Cells were permitted to divide for 96 hours after transfec tion, the equivalent two cell division cycles,

PAGE 111

96 and then subjected to FISH analysis using centromeric probes against chromosomes 3 and 10. A low background of 4.5 and 5.5% an euploidy was observed in non-transfected or empty vector (control) transfected cell, respectively (Fig. 37). Strikingly, 44% of nuclei from primary human melanocytes exhib ited aneuploidy in either chromosome 3 or 10 following exogenous expression of B-RafV600E (Fig. 37). Therefore, we conclude that oncogenic B-RafV600E is sufficient to rapidly indu ce aneuploidy in primary human melanocytes. B-RafV600E Rapidly Induces Aneuploidy in hT ERT Immortalized Mammary Epithelial Cells While B-Raf is mutated in the vast majority of melanomas, it is as well mutated and expressed in its oncogenic form in severa l other tumor types including colorectal and liver cancers, sarcomas and gliomas. In orde r to confirm that the induction of aneuploidy by B-RafV600E was not specific to HEM cells, I tested the effects of B-RafV600E expression in human mammary epithelia l cells immortalized with human telomerase (hTERT HME1s). hTERT HME1 cells were transfec ted and evaluated as described above for HEM cells. As scored via FISH analysis 7.0 and 6.5% of non-transfected or empty vector (control) transfected cells (Fig. 38) are aneuploi dy in chromosomes 3 or 10. However, hTERT HME1 cells transfected with B-RafV600E exhibited aneuploidy in 39.5% of the nuclei, results nearly identical to the results in HEM cells (Fi g. 39). Therefore, we conclude that oncogenic B-RafV600E is sufficient to rapidly induce aneuploidy in multiple, non-transformed human cell lines.

PAGE 112

A. B.Figure 37 Aneuploidy induced by B-RafV600E in primary human melanocytes B-RafV600E or empty vector plasmids were transfected into early passage hTERT-HME1 s 96 hours post-transfection, interphase FISH analysis was performed using probes to chromosomes 3 (red) and 10 (green), (A) representative pictures are shown. (B) Percent aneupl oidy detected in non-transfected (no TF), vector alone (Empty), and B-RafV600E. Percent aneuploidy by FISH analysis was calculated from 200 nuclei. 97

PAGE 113

Figure 38 Aneuploidy induced by B-RafV600E in immortalized primar y human epithelial cells B-RafV600E or empty vector plasmids were transfected into early passage hTERT-HME1 s 96 hours post-transfection, interphase FISH analysis was performed using probes to chromosomes 3 (red) and 10 (green), (A) representative pictures are shown. (B) Percent aneupl oidy detected in non-transfected (no TF), vector alone (Empty), and B-RafV600E. Percent aneuploidy by FISH analysis was calculated from 200 nuclei. A. B. 98

PAGE 114

99 Conclusions B-Raf is mutated into a constitutively active oncogenic form in an extraordinarily high percentage of melanomas and other cancers. Therefore, understanding the mechanisms by which B-Raf elicits its oncogenic effects is of great significance. Prior to my work the transforming activities of oncogeni c B-Raf have been exclusively limited to interphase related roles including cell cycle entry, adhesion controls and resistance to anoikis. The results from this chapter dem onstrate for the first time that expression of oncogenic B-Raf, V600E, causes mitotic abno rmalities when expressed in melanoma cells. B-RafV600E subsequently causes melanoma cells to become aneuploid, and destabilizes their genome. As well, expression of B-RafV600E generates rapid aneuploidy in primary human melanocytes and primary immortalized mammary epithelial cells. From this data, we conclude that oncogeni c B-Raf, V600E, drives mitotic abnormalities, aneuploidy and chromosomal instability.

PAGE 115

100 CHAPTER 5 DISCUSSION The key discoveries of this dissertation are the novel findings that B-Raf regulates critical functions in mammalian cell mitosis, and that oncogenic B-Raf perturbs mitosis and directly causes aneuploidy. Together, the results of my thesis research expand our understanding of mitoti c regulation and highlight the signi ficance of B-Raf overactivation in tumorigenesis. B-Raf Performs Critical Functions during Mitosis In the studies described herein, a comb ination of immunocytochemistry and RNA interference was used to assess potential func tions for B-Raf at mitosis in human somatic cells. Immunofluorescence st udies demonstrate that B-Raf localizes to key mitotic structures. Consistently, func tional studies demonstrate that B-Raf expression is critical for allowing proper spindle formati on, chromosome congression, microtubulekinetochore engagement and sp indle checkpoint function. Thes e are the first studies that link B-Raf to mitotic functions in human somatic cells. MAPK Mitotic Functions It has long been known that MAPK signa ling regulates several functions in mammalian cell mitosis including mitotic entry [111, 117, 118] and exit [130, 131],

PAGE 116

101 spindle assembly [115] and Golgi apparatus fragmentation [135, 136, 307]. Studies in Xenopus egg extracts have suggested that MAPK regulates the spindle assembly checkpoint [73, 129]. However, beyond mitotic entry, a role for th e MAPK cascade in mammalian cell mitosis had not been firmly established. Work from our lab demonstrated that B-Raf is the MEK kinase that activates the MAPK cascade during mitosis in Xenopus egg extracts [180], however, pr ior to my studies it was not known whether B-Raf had functional roles in mitosis. B-Raf Localizes to the Cytoplasm during Interphase in Human Somatic Cells It has long been thought that B-Raf is a cytoplasmic prot ein that gets transiently recruited to the plasma membrane for Ras mediated activation upon stimulation by mitogens. Using epifluorescen ce, we confirm that during interphase B-Raf exhibits cytoplasmic localization, and nuclear excl usion, (Fig. 7). While cytoplasmic B-Raf staining appears to be diffuse, upon close inspec tion, it appears that B-Raf is most highly concentrated in the perinuclear area. Fu rther, I have found that B-Raf distinctly colocalizes with the early endosome during in terphase (data not shown). While we did not investigate the significance of these locali zation patterns, they are consistent with a study demonstrating that endosome asso ciated Rap1 activates prolonged MAPK signaling through B-Raf in response to neural growth factor ( NGF) [308]. It is tempting to speculate that within endosomes B-Raf undergoes Rap1 mediated activation. Further analyses would be required in order to make any substant ial claims regarding B-Rafs perinuclear and endosomal localization.

PAGE 117

102 B-Raf Localizes to Mitotic Structures in Human Somatic Cells Prior to the study presented here, B-Raf wa s thought to reside exclusively in the cytoplasm. Using epifluores cence and confocal microscopy, I show that a portion of BRaf becomes associated with distinct mitotic structures in human foreskin fibroblast (HFF) cells (Fig. 7, 8). Duri ng prophase, B-Raf undergoes a dramatic relocation to the nuclear region, a portion of B-Ra f is detected at the spindle apparatus and B-Raf is tightly associated with the centrosomes (Figs. 7, 8, 14). B-Rafs presence at the spindle is most prominent during metaphase at which time it can be detected at the spindle poles, spindle microtubules, and kinetochores. This mitotic staining pattern of BRaf is not cell line specific as we detected simila r staining at the mitotic spindle in several other cell lines including mouse NIH 3T3 fibroblasts (Fig. 6, 13 ). We propose that a portion of B-Raf is directly associated with th e microtubules during interphase, as seen by the reticular perinuclear staining pattern (Fig. 7), and during mitosi s as suggested by several experiments in human cells and Xenopus egg extracts (Fig. 9, 10, 11). This would account for B-Rafs re-localization to the pr ophase nuclear region, where the microtubule organizing centers reside, and its enrichment at the metaphase spindle. B-Raf is enriched at the spindle and spindle midzone duri ng metaphase and anaphase, respectively. Colocalization of B-Raf to these key mitotic st ructures suggests that it has a role in spindle formation and spindle dynamics during mito sis. This data indicates that a portion of B-Raf is temporally and spatially regul ated at the spindle apparatus throughout the phases of mitosis.

PAGE 118

103 Phosphorylation of Thr599 and Ser602 is critical for Ras-mediated B-Raf activation [160]. During interphase phospho-B-Raf (Thr599 Ser602) is largely undetectable with the exception of weak centrosomal staining. At the onset of mitosis, however, phospho-B-Raf (Thr599/Ser 602) is prominently localized to the nuclear region of condensing chromosomes (Fig. 15), which overlaps with the temporary localization of active Cyclin B-Cdk1 [309]. Thus, this localization pattern is consis tent with the idea that mitotic B-Raf is activated in a Cyc lin B Cdk1 dependent manner [181]. PhosphoB-Raf (Thr599 Ser602) is readily detectable at the centrosomes througho ut mitosis. This corresponds to the localization of active forms of MEK and ERK [112, 114]. As well, phospho-B-Raf (Thr599 Ser602) is detectable in the region of condensing chromatin throughout mitosis and is distinctly localized to the perichromosomal space (Fig. 16, 17). B-Raf is also phosphorylated at the midbody during telopha se/cytokinesis, likewise, active MEK and ERK localize to the midbody during telophase [112, 114]. Activated forms of MEK and ERK have also been shown to localize to mitotic kinetochores. Upon inspection of the isolated chromosomes, it is shown that phospho-B-Raf colocalizes precisely at the kinetochores of metaphase cells, whereas kinetochore localization is absent during interphase (Fig. 18). These resu lts indicate that pools of B-Raf are active at the spindle apparatus during mitosis. These pools colocalize with active forms of MEK and ERK, indicating that B-Raf activates MA PK signaling at discrete mitotic sites. Further research is necessary to determine wh ether different mitotic B-Raf is activated in one location and transported to various destin ations or if the p ools are independently activated.

PAGE 119

104 The kinase that phosphorylates B-Raf at the Thr599 Ser602 residues is unknown. It would be interesting to determine whether phosphorylation of B-Raf is executed by the same kinase throughout interphase and mitosis. Interestingly, work performed in the cellfree system of Xenopus egg extracts showed that Cyclin B-Cdk1 directly associates with and phosphorylates Xenopus B-Raf at a Ser144 [181], a site conserved in human B-Raf. This phosphorylation event is necessary, but no t sufficient for its activation at mitosis. Development of phospho-Ser144 specific antibodie s will help to elucidate whether this phosphorylation occurs in somatic cells a nd whether B-Raf phosphorylated at Ser144 associates with mitotic structures. Our results showing that pools of active B-Raf on mitotic st ructures are in agreement with a previous study detecting a sm all peak of B-Raf activity at mitosis of synchronized HeLa cells [134]. Taken toge ther, these data sugge st that B-Raf may function during mitosis in human somatic cells. Specifically, these data imply that during mitosis B-Raf may be involved in regulating spindle assembly and spindle, chromosome condensation, microtubule-kinetochore attachment, the spindle assembly checkpoint, anaphase and cytokinesis. Although it was not addressed in my thes is studies, I observed a pronounced distribution of B-Raf in the re gion around the mitotic spindle, which may overlap with the localization of the fragme nted Golgi and endoplasmic reticulum during mitosis. Therefore, it is possible that B-Raf as well activates ERK signaling necessary for mitotic fragmentation of Golgi network.

PAGE 120

105 B-Raf Regulates Mitotic Functi ons in Human Somatic Cells B-Rafs mitotic localization is strongly suggestive of a functional role during mitosis. In my thesis studies, I tested whet her B-Raf functions at mitosis in human cells by using siRNA to selectively deplete B-Raf from cells. Knockdown of B-Raf, but not Raf-1, had pleiotropic effects on spindle form ation and chromatin congression in human somatic cells (Fig. 22, 23). A minimum of 80% of the mitotic figures examined from B-Raf-depleted cells display various spindle abnormalities including unfocused spindle poles and alterations in spindle morphology (Fig. 22). Corroborati ng these results is immunofluorescence detection of B-Raf at various structures of the spindle apparatus during mitosis. A portion of B-Raf appears to interact directly with the spindle micr otubules and a pool of B-Raf is detectable specifically at the centrioles after pre-extraction with CHAPS detergent (Fig. 14). However, reduction of B-Raf did not appear to have an effect on centrosome duplication or separation (unpub lished observations). Instead, a high frequency (40-50%) of aberrant spindles with unfocused poles was observed. Similarly, Xenopus egg extracts treated with the ME K inhibitor, U0126 exhibited several phenotypically abnormal spindle structures including monastral structures lacking condensed chromatin [115]. Together, these findings support a possible role for the BRaf/MEK/ERK pathway in mediating spindle pole focusing. This might occur through regulation via ERK-mediated phosphorylation of one of the various regulators implicated in spindle pole functions including dynein, NuMA, Aurora A, and Xklp2. Alternatively, B-Raf signaling may target structural compone nts of the centrosome that are necessary for the maturation or focusing of spindle poles.

PAGE 121

106 Chromosome alignment at the metaphase plate was dramatically altered in the majority of B-Raf-depleted cells (Fig. 22). As well, NIH3T3 cells treated with the U0126 inhibitor exhibited abnormal spindles incl uding those with una ttached chromosomes [115]. Chromosome alignment is dependent upo n microtubule capture and the subsequent countering forces that pull chromosomes poleward. Thus, the observation that chromosomes are misaligned in the absence of B-Raf could be due to direct defects in microtubule-kinetochore engagement. Alte rnatively or additi onally, chromosomal misalignment could manifest as a result from a precipitous exit from metaphase, in other words, a defective SAC that gives insuffici ent time for proper chromosome congression. In accordance with both of these options, phospho-B-Raf (Thr599/Ser602) is readily detectable at mitotic kinetochores (Fig. 18) the site of microtubule engagement and the SAC. Through analysis of a marker for impaired microtubule-kinetochore engagement, my data indicates that microtubules are not en gaged with kinetochores in the absence of B-Raf (Fig. 24) and this is confirmed th rough direct analysis of the microtubulekinetochore attachments (Fig. 25). CENP-E is the only protein identified to date that directly facilitates microtubul e-kinetochore engagement. Thus, it can be proposed that BRaf signaling governs CENP-Es mitotic func tions. Indeed, it is known that mitotic phosphorylated MAPK interacts with CENP-E and that MAPK can phosphorylate CENPE on sites that regulate CENP-Es in teraction with microtubules [114].

PAGE 122

107 Another possible mechanism by which B-Raf affects chromosome congression is that B-Raf regulates the duration of metaphase, necessary for permitting proper chromosomal alignment. Indeed, results fr om imaging mitotic progression in live cells depleted of B-Raf support this possibilit y. On average, B-Raf siRNA treated cells entered anaphase 24 min earlier than cont rol SCR-treated cells, displaying a 33% reduction in the duration of the prometa phase/metaphase period (Fig. 29). Despite the absence of microtubule-ki netochore attachments and chromosome misalignment, B-Raf depleted cells continue to divide for at least 120 hours with no indication of widespread mitotic arrest (Fi g. 26). These observati ons suggest that the SAC is defective in the absence of B-Raf. Bub1 and Mad2 are critical spindle checkpoint proteins, whose kinetochore localization is a strong indicator of spindle checkpoint activation [286]. As shown in figure 31, kinetochore localization of Bub1 and Mad2 is blocked upon B-Raf depletion. Furthermore, B-Raf depleted cells do not maintain an SAC when challenged with taxol (Fig. 28) and live-cell imaging showed that the depletion of B-Raf leads to a shortening of the period from prometaphase to anaphase, which is consistent with having a defective spindle checkpoint (Fig. 29). These results strongly implicate B-Raf as a re gulator of the SAC. Mps1 is an essential component of th e SAC network [310, 311] and functions to localize spindle-chec kpoint proteins Bub1, Mad1, and Ma d2 to unattached kinetochores [70, 73, 310]. Interestingl y, it was shown that the Xenopus homologue of Mps1 is phosphorylated by MAPK in Xenopus egg extracts at Serine-844, and this phosphorylation is necessary for kinetochore localization of Mps1 and other spindle

PAGE 123

108 checkpoint proteins [73]. Impor tantly, recent data from our laboratory demonstrates that Mps1 is indeed a target of B-Raf signali ng [312]. Specifically, it was shown that B-Raf associates with Mps1 in vivo and directs its MAPK-dependent phosphorylation and kinetochore localization during mitosis. Ther efore, we speculate that B-Raf mediated phosphorylation of Mps1 is important for sp indle checkpoint functions. While beyond the scope of this study, it will be important to dissect the contribut ions of phosphorylation events that regulate mitotic f unctions of Mps1. Finally, MAP kinase has been reported to phosphorylate other critical regulators of the spindle checkpoint, Bub1 [313] and Cdc20 [129], indicating that B-Raf signaling at mito sis may target multiple components of the spindle checkpoint network via MAPK. We propose that B-Raf elicits its mitotic effects through MAPK signaling. This is supported by the colocalization of B-Raf, MEK and ERK to the spindle poles and kinetochores. However, we cannot preclude the possibility that B-Raf may have MAPK independent mitotic functions. This could be addressed by analyzing B-Rafs mitotic functions in cells with compromised MEK1/2, the only identified dow n-stream target of B-Raf which directly activates ERK 1/2. B-Raf signals through MAPK to regulate ge ne transcription during interphase. Therefore, it can be proposed that B-Raf indirectly affects spindle assembly and chromosome congression rather than having a di rect effect on mitosi s. To address this question, we utilized Xenopus egg extracts where B-Raf and MAPK activities are strictly limited to mitosis. Indeed, B-Raf depletion from Xenopus egg extracts results in dramatic effects on spindle assembly and DNA alignment (Fig. 20), suggesting that B-Raf directly

PAGE 124

109 regulates mitosis in this system. Together with the localization of B-Raf to mitotic structures cell culture, we propose that B-Ra f directly regulates mitosis in mammalian cells. Besides its kinase activity, B-Raf may also function as a scaffold protein. Based on results shown here, we cannot exclude that some or all of B-Rafs mitotic functions are executed via scaffolding capacity. To a ddress this concern directly, one would need to compare WT and kinase dead B-Raf-driven mitotic phenotypes in cells depleted of endogenous B-Raf. In summary, our results reveal several mitotic roles for B-Raf including proper spindle formation, chromatin congression, mi crotubule capture, and the spindle assembly checkpoint. It is feasible to propose that these functions are all independent or interdependent. In the most interdependent example, one could suggest that B-Raf is necessary for proper functioning of the SA C, in the absence of which, microtubule capture is mitigated, thereby inhibiting chromosome congression and perturbing the arrangement of spindle microtubules. Howeve r, since B-Raf localizes to several key mitotic structures including the kinetochores, centrosomes and microtubules, I would propose that mitotic B-Raf signaling is importa nt for regulating seve ral mitotic functions through independent mechanisms. For inst ance, B-Raf signaling may regulate the SAC through Mps1 and microtubule-kinetochore attachment through CENP-E. A thorough analysis of MAPK substrates at mitosis woul d potentially reveal other effectors of B-Raf signaling that regulate its mitotic functions.

PAGE 125

110 Spindle assembly, chromatin congression and the SAC are all critical mitotic elements necessary for proper chromosome segregation. While I did not perform karyotype analysis on B-Raf depl eted cells, it is likely that these cells become aneuploid and chromosomally unstable. The demonstration that B-Raf regulates critical mitotic functions opens a new avenue in addre ssing how oncogenic B-Raf contributes to tumorigenesis. Oncogenic B-Raf Deregulates Mitosis Causing Aneuploidy and Chromosomal Instability Aneuploidy is a hallmark of cancer and it is associated with tumor progression and poor clinical prognosis [301, 302] and has a causal role in tumorigenesis [263, 277, 314]. As described previously, B-Raf is overactivated in the majority of human melanomas [216]. My studies presented in this section, demonstrate that the main activating B-Raf mutation deregulates mitosis and provokes aneuploidy. Cellular Effects of Oncogenic B-Raf The vast majority of oncogenic B-Raf mutations cause consti tutive activation of the MAPK cascade. Prior to a nd during my thesis studies, a variety of experiments have revealed several cellular roles through which B-RafV600E may elicit its oncogenic effects including cell survival, anc horage independent cell cycl e progression, and invasion. However, the question of how B-Raf contributes to tumorigenesis is not fully understood. Soon after the 2002 discovery that B-Raf is mutated in a wide variety of tumors, it was demonstrated that oncoge nic B-Raf, specifically B-RafV600E, is necessary for cell

PAGE 126

111 survival in B-RafV600E expressing cells. siRNA and sh RNA-mediated downregulation of B-RafV600E causes inhibition of ERK signaling and induces cell cycle arrest and apoptosis in cultured cancer cells [225, 226, 315]. Normal cells require adhesion for signali ng and survival [316]. Loss of adhesion causes normal cells to undergo anoikis, whereas tumor cells develop the capacity to resist anoikis [317]. B-RafV600E expression is necessary for anoikis resistance in melanoma cells [299] and this is dependent on B-RafV600Es negative regulation of pro-apoptotic proteins Bad a nd Bim [300]. In addition to anoikis, normal cells di e when they are subjected to a low-oxygen environment. In contrast, the central tumo r zone is hypoxic and tumor cells must evolve mechanisms for survival under such conditions [318]. It has been shown that B-RafV600E induces expression of hypoxia inducible factor-1 (HIF-1 ) and its expression is essential for melanoma cell survival in a hypoxic tumor-l ike environment [319]. Together, these data demonstrate that B-RafV600E mediates survival in melanoma cells. In addition to cell survival, B-RafV600E appears to regulate cell cycle progression in an anchorage independent manner. In normal human melanocytes anchorage to an extracellular matrix is necessary for growth factor activation of ERK1/2, which leads to induction of cyclin D1 and downregulation of p27Kip1, both key events in G1 to S phase progression [298, 320]. B-RafV600E expression in melanoma cells causes constitutive expression of cyclin D1 and down regulation of p27Kip1, in the absence of cellular adhesion and growth factors [297]. Growth arrest concurrent with a decrease in expression of cyclins D1 and D3 was observed following downregulation of B-RafV600E in human melanoma cells [226, 298]. Brn-2, a transcription fact or involved in the

PAGE 127

112 proliferation of melanoma cells [321], was also downregulated following siRNA mediated reduction of B-RafV600E [322]. Besides its role in progression from G1 to S phase, recent evidence suggests that B-RafV600E regulates the G2 to M phase progre ssion. Required for melanoma growth is Skp2 [297], an E3 ubiquitin ligase that targ ets multiple proteins for degradation, thus promoting the G2-M phase transition [323-328]. In melanoma cells B-RafV600E induces expression of Skp2, suggesting that B-RafV600E mediates entry into mitosis [329]. A hallmark feature of tumor cells is the acquired ability to invade nearby tissues [330]. It has been shown that B-RafV600E upregulates expression of several matrix metalloproteinases (MMPs) [331, 332], whic h are known to mediate invasion through cleavage of extracellu lar matrix components [333]. Using a matrigel assay, it was shown that downregulation of B-RafV600E decreases the invasive potential of PTCs. Additionally, it has been demonstrated that the actin cy toskeleton and focal adhesion in melanoma cells is disrupted by B-RafV600E expression through MAPK activation of Rnd3 [334]. Such results implicate B-RafV600E in the promotion of tumor invasion. These studies demonstrate several mechanisms through which B-RafV600E drives cell cycle progression and surv ival under tumorigenic conditions. However, B-RafV600E expression and its downstream effectors are not sufficient for transformation to occur. It is widely speculated that loss of tumor suppressors, such as p16INK4a, must accompany BRafV600E for tumorigenesis to occur. My th esis studies demonstrate that B-RafV600E causes widespread genomic changes through disr egulation of mitosis. Such a mechanism could provide the heterogene ity through which other necessary genomic changes could arise.

PAGE 128

113 B-RafV600E Expression Drives Mitotic Abnormalities B-RafV600E can transform immortalized me lanocytes and mouse fibroblasts in vitro [216, 223, 225] but how it exerts its oncogenic effects has b een an important area of study. Our studies investigated the mitotic effects of oncogenic B-RafV600E in cultured human melanoma cells. Data from these st udies show for the first time that B-RafV600E induces pleiotropic spindle abnormalities, chromosome misalignment and supernumerary centrosomes (Fig. 32). A high incidence of spindle abnormalities, similar to those observed from ectopic expression of the B-RafV600E mutant, were also found in melanoma cells carrying endogenous B-RafV600E mutations but not in wild type B-Raf melanoma cells (Fig. 31) [335]. Thus, we conclude that oncogenic B-RafV600E abrogates mitosis in human melanoma cells. The spindle abnormalities induced by B-RafV600E include a high percent of multipolar spindles due to cells having 3 or more centrosomes. As well, B-RafV600E causes abnormalities in spindle assembly a nd chromosome alignment independent of centrosomal amplification in approximately 50% of abnormal mitoses. The mechanisms that generate these abnormalities have yet to be defined. One possibility is that BRafV600E deregulates the proteins involved in microtubule capture, thereby leading to the observed abnormalities. Analyzing the mitotic localization and substrates of B-RafV600E would shed light on these mechanisms. Like B-RafV600E, expression of oncogenic Ha-ras induces mitotic abnormalities in mouse NIH3 T3 cells, including multipolar spindles and misaligned chromosomes, and it has been proposed that oncogenic Ras deregulates

PAGE 129

114 spindle assembly [131]. It is exceedingly rare for Ras and B-Raf mutations to coincide in human tumors, therefore suggesting that they elicit overlapping effects. In the absence of B-Raf the SAC is not full activated, thus causing early mitotic exit and most likely errors in the chromosome segregation. C onsistent with this, recent studies from the Guadagno laboratory demonstrated that B-RafV600E signaling promotes hyper-activation of the spindle checkpoint causing a delay in mitotic progression [306]. This is mediated, at least in part, thro ugh Mps1, a known target of MAPK signaling. Depleting cells of Mps1 by siRNA allevi ates the checkpoint effects induced by BRafV600E [306]. It is also possible that, due to B-Rafs uncontrollable high activity, it targets unusual substrates, yet to be iden tified. Interestingly, published evidence indicates that both an unde r-activated and over-activated SAC compromises the timing and quality of chromosome segregation dur ing anaphase leading to generation of aneuploid cells [263, 276, 277, 314]. We pr opose that by over-ac tivating the SAC, oncogenic B-RafV600E induces aneuploidy. In contrast to our studies, on cogenic Ras has been shown to shorten a nocodazole-induced SAC in rat thyroid cells, and it does this in a MAPK independent manner [231]. These data suggest that oncogenic Ras may regulate the SAC through different mechanisms than B-RafV600E. B-RafV600E Expression Causes Chromosomal Instability It is well understood that mitotic errors drive aneuploidy. Ther efore, it was not surprising that aneuploidy resulted fro m the mitotic abnormalities generated by introducing the B-RafV600E mutant into SbCl2 melanoma ce lls (data not shown) and SKMEL5 melanoma cells (Figur e 32). Many of the B-RafV600E-expressing cells died,

PAGE 130

115 probably due to losses of v ital chromosomes. However, experiments in SbCl2 cells showed that many cells continued to surviv e and proliferate for 4-6 weeks of extended culturing. These cells continue d to exhibit abnormal chromosomes numbers that changed over time and failed to establish a stable karyotype, as evident by the absence of a chromosomal mode (Fig. 35, 36). Indeed this data is supported by previously published findings that induced B-RafV600E expression in rat thyroid cells increases micronuclei formation 2-fold, indicating that chromosomes or chromosome fragments are lost during mitosis [336]. Interestingly, the vast majority of B-RafV600E-expressing SbCl2 cells were hypoploid, the significance of which remains to be addressed. Hypoploidy is thought to arise from loss of chromosomes to micronuc lei [337], a result of mitotic abnormalities that generate lagging chromosomes. Oncogenic Ras expression causes lagging chromosomes and micronuclei formation in NIH3T3 cells harboring mutant p53 [338] and in rat thyroid cells [339], in a MAPK dependent manner. This suggests that BRafV600E and oncogenic Ras generate mitotic ab normalities that lead to aneuploidy. However, a role for Ras in mitosis ha s not been confirmed in human cells. The mechanisms by which B-RafV600E drives chromosomal instability have yet to be elucidated. One possibility involves Mps1, a spindle checkpoint kina se identified as a potential target downstream of the B-Ra f/MEK/ERK signaling pathway [73, 306, 312]. Mps1 levels are elevated by constitutive B-RafV600E signaling in melanoma cells, which allows for hyper-activation of the spindle checkpoint [306]. A hyper-activated spindle checkpoint could, in turn, contribute to chro mosome segregation errors that lead to aneuploidy. Consistent with this proposal elevated levels of Mad2 expression are

PAGE 131

116 observed in various tumors defective in the Rb pathway [340] and are sufficient to induce chromosome instability, aneuploidy, and tumorigenesis in mice [277]. It was shown that immortaliz ation itself can indirectly cause aneuploidy [270]. It was therefore proposed that aneuploidy-causi ng agents must induce aneuploidy in preimmortalized cells in order to fully meet the criteria as an aneuploidogen [232]. My results have shown that B-RafV600E induced aneuploidy in hTER T-immortalized epithelial cells (Fig. 38), thereby confirming B-RafV600E as a direct mediator of CIN. The results described here further sh ow that oncogenic B-RafV600E is sufficient to rapidly induce aneuploidy in primary human melanocytes (Fig. 37). Together, these results indicate that B-RafV600E-induced CIN could be a mechanism for induction of aneuploidy in both melanomas and other human cancers carry activating B-Raf mutations. A large proportion (~82%) of benign ne vi harbor activating B-Raf mutations [220] lending to the idea that B-Raf activation is an early and critical step in the development of melanocytic neop lasia. While genetic eviden ce supports an early role for B-RafV600E in nevi formation [227], sustained B-RafV600E activity is also associated with oncogene-induced senescence [341, 342], explai ning why most nevi never develop into invasive melanomas and remain dormant over long periods of time. We speculate that induction of aneuploidy in proliferating mela nocytes creates additional genetic changes, which, if tolerated, contribute to melanoma initia tion. This would be in line with several reports showing that additional mutations in melanoma susceptibility genes (i.e. p16INK4a, ARF, PTEN) are needed to cooperate with oncogenic B-Raf (or Ras) to allow for melanoma initiation [341].

PAGE 132

117 Several studies would further help confirm a role for B-RafV600E induced aneuploidy in tumorigenesis. First, karyotyp ic evaluation of benign nevi harboring the BRafV600E mutation would reveal whether the on cogene induces aneuploidy early in tumorigenesis. Since my studies in prim ary melanocytes and immortalized primary epithelial cells demonstrated that B-RafV600E induces rampant aneuploidy after only 2 cell divisions, I would predict that some beni gn nevi are aneuploid. However, this study would have to be conservatively analyzed, since only a minority of benign nevi ever proceed to melanomas. It is perhaps feasible that B-RafV600E induces senescence in the majority of nevi, prior to the selection of a large number of aneuploid cells. It would also be of interest to determ ine whether the initia l aneuploidy induced by B-RafV600E, in human primary melanocytes or immortalized epithelial cells, is sufficient for transformation. These experiments coul d be conducted utilizing an inducible BRafV600E vector, such as an estrogen receptor B-RafV600E-fusion. Once B-RafV600E induces aneuploidy in ce lls, expression of B-RafV600E could be turned off and surviving cells would be selected and grown in soft agar. It would be predicted that the majority of cells would depend to B-RafV600E expression for survival. However, a minority of cells could acquire the proper combination of ane uploidy to become capable of survival and colony formation. Mathematical modeling, su ch as is available through Moffitt Cancer Centers Integrated Mathematical Oncology gr oup, would be a useful tool in determining how well these experiments reflect a clin ical model for melanoma progression. Aneuploidy induced by mitotic errors leads to CIN in nearly all cases reported [232]. The effects of CIN cannot be unders tated as it gives rise to a continuously

PAGE 133

118 changing gene expression pattern. Frequent changes in the genomic profile of cells within a population allow for rapid Darwinian adaptation to the intraand extracellular environment. Thus, selection of the appropr iate combinations of CIN can not only drive tumorigenesis, but may provide a mechanism for generating cells cap able of invasion, metastasis and drug resistance. Relevance for Therapeutics The most common treatment modality for melanomas is tumor resection alone or in combination with immunotherapy, chemot herapy or radiation for advanced stage disease. Therapies target ed against B-Raf or B-RafV600E, its oncogenic form, have recently been tested in clinical trials, however, most have not shown strong efficacy as single agents [343]. Rational efforts have turn ed toward combination therapies, targeting multiple signal transduction pathways or combining B-Raf inhibitors with chemotherapeutic agents. In fact, unpublished data from our lab (not reviewed in this thesis) demonstrates that sequent ial use of placitaxol and a B-RafV600E inhibitor synergize to induce caspase-dependent cell death. A nother rational therapeutic strategy employs the use of geldanamycin derivatives, since it has been shown that B-RafV600E stability is Hsp90 dependent, while WT B-Ra f stability is independent of Hsp90 [344]. As with other efforts, this appears to be most benefi cial in combination w ith other agents [345]. It is interesting to speculate on how our findings might contribute to the development of cancer therapeutics for use against B-RafV600E positive tumors. Classic chemotherapeutic agents and some modern ra tionally developed drugs target mitosis as an effective means of killing cancer cells. In elegant and elaborate live-imaging studies,

PAGE 134

119 it was recently shown that these agents induce mitotic cell death via caspase-dependent mechanisms, which are dependent upon a prol onged, cyclin B-induced mitotic arrest [346]. Therefore, I would pr opose that development of agen ts that stabilize cyclin B combined with a caspase activator would s ynergize with existing drugs in many tumor types, including B-RafV600E-positive tumors. My work and the work of others from the Guadagno lab [306, 312] have demonstrated th at B-Raf regulates the SAC and that BRafV600E generates an extended SAC. While we have not directly demonstrated that BRafV600E stabilizes cyclin B, such stabili ty could enhance the efficacy of chemotherapeutic agents, thus ar guing against the use of B-RafV600E inhibitors. Aneuploidy is another interesting feature of tumor cells that may be useful to consider in the treatment of cancers. Aneuploi dy exists in nearly all solid tumors and is directly driven in primary cells through B-RafV600E, an early mutation in many tumors. It is reasonable to speculate that aneuploidydriven intratumoral heterogeneity would frequently lead to drug resistan ce even with the most appropriately targeted therapies. It has recently been proposed that aneuploidy not only drives tumorigenesis, but can be protective [263] when aneuploidy drives sp ecific combinations of gene expression. While 96 hours of B-RafV600E expression generates viable aneuploid cells, the majority of cells are not viable after prolonged expression of B-RafV600E, thus supporting the idea that some or most aneuploidy is not tolerated long-term. Ther efore, it may be feasible to utilize known aneuploidogens to induce a wide -spread intolerable aneuploidy load in an effort to kill tumor cells.

PAGE 135

120 Summary Mitosis is a complex and critical stage of the cell cycle. While mitosis has been studied for well over a century, the player s and the consequences are still being elucidated and debated. Likewise, the can cer biology field has ge nerated volumes of data; however, we still have much to lear n about tumorigenesis. B-Raf has been identified as an oncogene in a strikingly high number of tumors and it has therefore become fundamental to understand how it cont ributes to cancer. Through the work in this thesis, I have demonstrated that B-Raf is necessary for regulating mitosis, the cell cycle stage that maintains the cells genomic integrity. Genomic changes provide cells with the capacity to acquire new features a nd new functions. It is quite feasible that advantageous changes are selected to prom ote tumor initiation, progression, metastasis and drug resistance. Therefore, our findings that oncogenic B-Raf disregulates mitosis and drives genomic instability open a new pa th for understanding how B-Raf contributes to tumorigenesis (Fig. 39).

PAGE 136

Figure. 39 Model for B-Raf mediated mitosis B-Raf regulates critical mitotic functi ons which lead to proper chromosomal segregation thus maintaining the dipl oid nature of the daughter cells. Contitutively active B-RafV600E disregulates mitosis thereby causing missegregation of chromosomes and produc ing aneuploid daughter cells. a. BRaf regulates the MAPK pathway; B-RafV600E overactives the MAPK pathway; b. B-Raf signaling regulates spindle assembly and kinetochore functions including microtubule-kin etochore engagement and the spindle assembly checkpoint; B-RafV600E disregulates these functions; c. Proper mitosis leads to proper anaphase onset and accurate chro mosome segregation; disregulated mitosis causes premature anaphase onset and lost and missegregated chromosomes; d. Proper chromosomes se gregation generates diploid daughter cells whereas missesgregation caused by B-RafV600E renders the daughter cells aneuploid. 121

PAGE 137

122 CHAPTER 6 MATERIALS AND METHODS Cell Culture and Cell Synchronization Human foreskin fibroblasts (HFF), HeLa and NIH3T3 cells were cultured in DMEM (Gibco) containing 10% newborn calf serum (Gibco) and 46g/ml gentamycin. Cells were synchronized at G2/M with 50nM taxol in 0.1% DMSO for 30 hours and treated with 30M U0126 or 0.1% DMSO for 6 hours prior to cell collection. SK-MEL5, SK-MEL28, and A375 human melanoma cell line s were obtained from American Type Culture Collection (ATCC, Manassas, VA) and maintained in Dulbeccos modified Eagles medium supplemented with 10% fetal bovine serum (FBS). SK-MEL5 cells are wild type for B-Raf, while SK-MEL28 and A375 cells carry B-RafV600E mutations [216, 292]. Sbcl2 and WM35 melanoma cells, origin ally derived from early radial growth phase primary melanomas, were obtained prev iously from M. Herlyn (Wistar Institute, Philadelphia, PA). Sbcl2 and WM35 cells are wild type for B-Raf and were grown in 2% tumor media (4:1 mix of MC DB153/L15 media, 2% FBS, 5 g/ml insulin, 1 mM CaCl2). To further confirm the absence of an activ ating mutation in B-Ra f, phospho-ERK levels were assessed for SK-MEL5, Sbcl2, and WM35 melanoma cells switched to 0.5% FBS for 24 hr. All three melanoma cell lines exhibited minimal ERK activity whereas SKMEL28 and A375 (both containing B-RafV600E mutations) cells showed robust levels of

PAGE 138

123 phospho-ERK (data not shown). Human Mammar y Epithelial cells im mortalized with human telomerase (hTertHME1 cells), were gifted to us by Hun tington Potter at the Johnnie B. Byrd Alzheimers Center and Resear ch Institute at the University of South Florida (Tampa, FL). Cells were cultured in MEGM media from Lonza. Primary Human Epidermal Melanocytes (HEM) were purchased from ScienCell Research Laboratories and cultured in Melanocyte Medium from Scie nCell. Primary cells were transfected using the Nucleofector system from Amaxa, now part of Lonza, using kits V and NHEM for hTertHME1 and HEM, respectively. Ce lls were co-transfected with GFP for assessment of transfection efficiency. Transfections and Retroviral infections Cells were grown to approximately 70% de nsity in 12-well plates and transfected with 21-mer double stranded o ligo short interfering RNAs (siRNAs) to human B-Raf specific sequences at exon 11 (BE11) [AAAGAATTGGATCTGGATCAT] or exon 3 (BE3) [AAGCTAGATGCACTCCAACAA] or, to C-Raf specific sequence [AATAGTTCAGCAGTTTGGCTA] obtained from Qiagen. A scrambled siRNA for BRaf or C-Raf sequences was used in parallel as a control. siRNAs were used at 110 nM. 488 -conjugated scrambled oligo was used to verify transfection efficiency. By 48-72 hours, protein levels for B-Raf or C-Raf decreased 85-95% as confirmed by Western blotting. pBabe-puro and pBabe-puro-B-RafV600E retroviral vectors were a generous gift from Dr. Daniel Peeper (The Netherlands Ca ncer Institute). Re troviral vectors were transfected into HEK 293T replication-de fective packaging cells for retrovirus

PAGE 139

124 production. Melanoma cells were infect ed with pBabe-puro or pBabe-B-RafV600E retroviruses as described a nd selected in puromycin (0.8 g/ml) for up to 10 days. Puromycin-resistant colonies were pooled and checked for ectopic B-RafV600E expression by immunoblot analysis. Human melanocytes or hTERT-HME ce lls were transfected using the Nucleofector system from Amaxa. Tran sfection efficiencies were monitored by evaluating green fluorescent cells following co -transfection with pMaxGFP vector from Amaxa. Immunoblot Analysis Cells grown in 12-well or 6-well dishes were washed with PBS and scrape-lysed in ice-cold TNES buffer containing proteas e and phosphatase inhibitors (50mM TrisCl pH 7.4, 1% NP40, 2mM EDTA, 100mM NaCl, 20g/ml aprotenin, 20g/ml leupeptin, 500M PMSF, 40mM -glycerophosphate, 500M Na3VO4, 20mM NaF), incubated on ice for 30 minutes and centrifuged for 30 minut es at 14Xg at 4. Supernatants were analyzed for protein concentrations were de termined by a BCA protein assay (Pierce) and analyzed by a spectrophotomete r (BioRad). Cell lysates we re separated by SDS-PAGE, and electrotransferred onto P VDF, 0.45m membranes. Memb ranes were blocked in 5% milk/0.15% Tween 20 for 1h at room temperat ure, incubated with primary antibodies against B-Raf and -tubulin (detailed above ), total ERK, C-Raf (BD Transduction labs), CAS (BD Transduction Labs), Cyclin B (Santa Cruz) and Beta-actin (Abcam) diluted in 5% milk/0.15% Tween 20 for 1h at room temperature and washed 3X in 0.15% Tween 20/PBS. Membranes were incubated for 1h at room temperature with goat anti-mouse

PAGE 140

125 (Jackson ImmunoResearch Laboratories) or goat anti-rabbit (Sigma) alkaline phosphatase-conjugated secondary antibodies diluted in 5% milk/0.15% Tween 20, washed 4X in 0.15% Tween 20/PBS, incubated for 5 minutes in alkaline phosphatase buffer pH 9.5, 5 minutes in CDP-Star chem iluminescence substrate (Roche Diagnostic) and exposed to blue sensitive autoradiography X-Ray film (Molecular Technologies). Band densitometry data was performed using Image Quant analysis. Microtubule Depolymerizati on by Cold Treatment For cold-induced microtubule depolymerizat ion, cells transfected with B-Raf or control (scrambled) siRNA were grown on coverslips in 35 mm dishes. Media was removed, replaced with ice-cold media, and dishes were subsequently incubated on ice for 10 minutes to induce depolymerization of unattached kinetochore-microtubules. Cells were then fixed in 4% paraformaldehyde and processed for immunocytochemistry as described above. Nocodazole-Induced Microtubule Depolymerization HFF and HeLa cells were grown overnight on coverslips. Nocodazole was added at 125ng/mL (HFF) or 25ng/mL (HeLa) for 2 hours at 37 to depolymerize microtubules. Immunofluorescence was performe d as described above. CSF extracts were generated from unfertilized Xenopus oocytes as described below and activated into S-phase using 0.4mM CaCl2 and cycled into a stable mitotic state with addition of equal volume of CSF extract. Reactions were incubated in the

PAGE 141

126 presence of 200/l sperm DN A for 75 minutes at 24C to allow for spindle formation alone, with DMSO or with 10ng/l nocodazo le. Microtubules were fixed and spun down as previously described [115]. The pelle t was resuspended in SDS sample buffer, separated by 10% SDSPAGE, and immunoblotted for -tubulin and B-Raf. Immunocytochemistry Cells grown on glass coverslips were fixed at 4 in 4% paraformaldehyde, permeabilized with 0.5% triton-X-100 and bl ocked in 2% BSA. Alternatively, cytoplasmic proteins were solubilized us ing 1% CHAPS in PHEM buffer containing protease and phosphatase inhibitors (60mM Pipes, 25mM Hepes pH 6.9, 10mM EGTA, 4mM MgSO4, 1g/ml aprotenin, 1g/ml leupeptin, 1M pepstatin, 50mM glycerophosphate, 200M Na3VO4) for 60 seconds at room temp erature, fixed at 4 in 4% paraformaldehyde and blocked in 2% BSA. Cells were incubate d in 2% BSA for one hour with primary antibodies against B-Raf (Santa Cruz or Upstate), -tubulin (Sigma) or Centrin (kindly provided by Je ffrey Salisbury at Mayo Clinic), washed 3X in PBS, incubated in 2% BSA for one hour with 488 or 594 Alexa Fluor secondary antibodies (Molecular Probes) and washed 3X in PBS. Cells were mounted with Prolong Gold containing DAPI (Mol ecular Probes). To visualize B-Raf at the centrioles, cytoplasmic proteins were pre-extracted using 1% CHAPS in PHEM buffer containing protease and phosphata se inhibitors (60 mM Pipes, 25 mM Hepes pH 6.9, 10 mM EGTA, 4 mM MgSO4, 1 g/ml aprotenin, 1 g/ml leupeptin, 1 M pepstatin, 50 mM -glycerophosphate, 200 M Na3VO4) for 60 seconds at room temperature, fixed at 4 C in 4% paraformaldehyde and blocked in 2%

PAGE 142

127 BSA. Pre-extracted cells were then in cubated with a C-terminal peptide B-Raf polyclonal antibody (sc-166) obtained from Sa nta Cruz Biotechnology (Santa Cruz) and co-stained with a mouse monoclonal cen trin antibody kindly provided by Jeffrey Salisbury (Mayo Clinic, Rochester) to visualize centrioles. Chromosome Isolations Cells were treated with 1g/mL colcem id for 2 hours, harvested by trypsinization and washed with PBS. Cells were swolle n in 75mM KCL for 10 minutes at 37 and subsequently spun onto polylysine coated c overslips at 1800rpm for 8 minutes. Cells were immersed in KCM buffer containi ng 120mM KCl, 20mM NaCl, 10mM Tris-HCl ph7.5, 0.5mM EDTA and 0.1% Triton-X for 10 minutes at room temperature. Immunostaining was carried out at room temp erature. Cells were exposed to primary antibodies against phospho-B-Raf (Santa Cr uz) and CREST (Antibodies Incorporated) diluted in 2% BSA in KCM for one hour, washed twice with KCM followed by 488 or 594 Alexa Fluor secondary antibodies (Molecular Probes) and washed 2X with at room temperature. Immunostaining was performed as described above except BSA and antibodies were diluted KCM buffer and cells were washed in KCM buffer followed by one final wash with PBS prior to mo unting coverslips as described above. Fluorescence in situ Hybridization (FISH) Analysis and Metaphase Spreads Cells were treated with 1g/mL colchicine for 2 hours, harvested by trypsinization and washed with PBS. Cells were swollen in 65mM KCL for 5 minutes at 37, fixed in cold acetic acid/ methanol for 5 minutes at 4 dropped onto slides and dried

PAGE 143

128 at room temperature. For metaphase spread s, cells were then stained with DAPI and viewed with a Nikon E800 fluorescence micr oscope with a 60x/1.40NA plan apo oil immersion objective. Images were captured with a Roper Coolsnap HQ CCD camera and processed with Metamorph 5.0 and Adobe Photoshop 6.0 software. FISH analysis on hTertHME1 and HEM cells were carried ou t 96 hours post-transfection. For FISH analysis, slides were stained with Cytocell enumeration probes against chromosomes 2 or 3, and 8 or 10, conjugated with FITC or Cy3.5, respectively (Rai nbow Scientific). Staining was carried out according to the manufacturers protocol. FISH samples were viewed with a fully automated, upright Zei ss AxioImagerZ.1 microscope with a 20X objective, and DAPI, FITC and Rhodamine filter cubes. Images were produced using the AxioCam MRm CCD camera and Axiovision vers ion 4.5 software suite. P-values were calculated using a 2-sample test for equality of proportions with continuity correction. Microscopy Fluorescent images of mitotic figures were viewed with a Nikon E800 fluorescence microscope with a 60X/1.40NA plan Apo or 100X/1.3NA plan Fluor oil immersion objective. Images were capture d with a Roper Coolsnap HQ CCD camera controlled with Metamorph software 5.0, saved as Tif. files, and transferred into Adobe Photoshop 8.0 software for final processing. Phospho-B-Raf images were viewed on a fully automated, upright Zeiss Axio-Imager Z.1 microscope with a 63X/1.40NA oil immersion objective and images were produ ced using the AxioCam MRm CCD camera and Axiovision version 4.5 software suite. Confocal images were captured through a 63X/1.40NA oil immersion objective using a DMI6000 inverted Leica TCS SP5 tandem

PAGE 144

129 scanning microscope. Images and Z-st acks were produced with three cooled photomultiplier detectors and the LAS AF version 1.5.1.889 software suite. Phase contrast images of nocodazole-treated HeLa cells were acquired on a Nikon TE 2000-s microscope using a 20X objective lens. Time-lapse live imaging of HeLa cells was performed with an inverted Nikon TE2000-S using a 20X 0.4NA Ph1 phase lens (Nikon). An FCS2 closed chamber system (Bioptechs, Inc., Butler, PA, USA) was used to infuse media and CO2 at a rate of 5 mL per hour. Phase-contrast images were captured once per minute using a Retiga 1300 (QImaging Corporation, Canada) camera a nd IPLab 3.61 (BD Biosciences) software. Images were saved individually as Tif. files and incorporated into Image Pro Plus 6.2 (Media Cybernetics, Inc) to generate sequence file time lapse movies. The mass projections were 16 images taken through th e Z dimension every 0.4um. Images were projected over one another in Maximum Projection to illustra te depth of field through the cell. The signal was enhanced using opacity (transparency) to demonstrate colocalization between B-Raf and microtubules. The CENP-E, CREST mass projection wa s rendered 360 degrees around the yaxis to display colocalization in all 3 dimensions (x, y, z). For CENP-E, CREST colocalization, Samples were viewed with a Leica DMI6000 inverted microscope, TCS SP5 confocal scanner, and a 63X/1.40NA Pl an Apochromat oil immersion objective (Leica Microsystems). 405 Diode, 488 Argon, a nd 594 HeNe laser lines were applied to excite the samples and tunable filters were used to minimize crosstalk between fluorochromes. Image sections at 0.5 m were captured with photomultiplier detectors and prepared with the LAS AF software ve rsion 1.6.0 build 1016 (Leica Microsystems).

PAGE 145

130 Images of colocalized pixels were prepared with LAS AF software and analyzed for CENPE intensity using Image Pro Plus 4.5 (Media Cybernetics, Maryland). The Imaris deconvolution images were cr eated by processing z stack images generated by the confocal microscope through AutoDeblur deconvolution software (Mediacybernetics Inc.) using de fault settings. The resulti ng z-stack images were then imported into Imaris version 5.5 (Bitplane Inc. ). 3D isosurface re nderings were created by adjusting the intensity thresholds for each color channel. Spindle Assembly in Xenopus Egg Extracts Cytostatic factor (CSF) arrested extracts were prepared from unfertilized Xenopus eggs and spindle assembly reactions were preformed as described [347], except that extracts were cycled into mitosis using recombinant nonde gradable cyclin B (75 nM final). Rhodamine-labeled bovine brain tubu lin (Cytoskeleton) was added to a final concentration of 0.15 g/l in extracts to visualize microtubul es. B-Raf (Santa Cruz) or IgG control (Sigma) antibodies were used fo r immunodepletions from CSF extracts prior to their activation and cycling. To monitor spindles and associated chromosomes, 2 l of extract and 1 l of Hoechs t/fixative (25% glycerol, 7.4% formaldehyde, 0.1 mM Hepes pH 7.5, 4 g/ml bisbenzimide) were applied to a microscope slide and examined by immunofluorescence.

PAGE 146

131 REFERENCES 1. Pines, J., and Rieder, C.L. (2001). Re-s taging mitosis: a contemporary view of mitotic progression. Nature cell biology 3, E3-6. 2. Fukasawa, K. (2002). Introduc tion. Centrosome. Oncogene 21, 6140-6145. 3. Mitchison, T., Evans, L., Schulze, E., and Kirschner, M. (1986). Sites of microtubule assembly and disassembly in the mitotic spindle. Cell 45, 515-527. 4. Kishimoto, T., Kuriyama, R., Kondo, H., and Kanatani, H. (1982). Generality of the action of various maturation-promoti ng factors. Experimental cell research 137, 121-126. 5. Lohka, M.J. (1989). Mitotic control by metaphase-promoting factor and cdc proteins. Journal of cell science 92 ( Pt 2) 131-135. 6. Masui, Y., and Markert, C.L. (1971). Cy toplasmic control of nuclear behavior during meiotic maturation of frog oocyte s. The Journal of experimental zoology 177, 129-145. 7. Nurse, P. (1990). Universal control m echanism regulating onset of M-phase. Nature 344, 503-508. 8. Sunkara, P.S., Wright, D.A., and Rao, P.N. (1979). Mitotic factors from mammalian cells induce germinal ve sicle breakdown and chromosome condensation in amphibian oocytes. Pro ceedings of the National Academy of Sciences of the United States of America 76, 2799-2802. 9. Wasserman, W.J., and Smith, L.D. (1978). The cyclic behavior of a cytoplasmic factor controlling nuclear membrane breakdown. The Journal of cell biology 78, R15-22. 10. Kimura, K., Cuvier, O., and Hirano, T. (2001). Chromosome condensation by a human condensin complex in Xenopus egg extracts. The Journal of biological chemistry 276, 5417-5420. 11. Kimura, K., Hirano, M., Kobayashi, R ., and Hirano, T. (1998). Phosphorylation and activation of 13S condensin by Cdc2 in vitro. Science (New York, N.Y 282, 487-490. 12. Kimura, K., and Hirano, T. (2000). Dual roles of the 11S regulatory subcomplex in condensin functions. Proceedings of the National Academy of Sciences of the United States of America 97, 11972-11977. 13. Li, G., Sudlow, G., and Belmont, A.S. (1998). Interphase cell cycle dynamics of a late-replicating, he terochromatic homogeneously staining region: precise choreography of condensation/decondensation and nuclear positioning. The Journal of cell biology 140 975-989.

PAGE 147

132 14. Dessev, G., Iovcheva-Dessev, C., Bischoff, J.R., Beach, D., and Goldman, R. (1991). A complex containing p34cdc2 and cyclin B phosphorylates the nuclear lamin and disassembles nuclei of clam oocytes in vitro. The Journal of cell biology 112, 523-533. 15. Geoffrey M. Cooper, R.E.H. (2004). Th e Cell A Molecular Approach, 3rd Edition Edition, (Sunderland: Sinaue r Associates, Inc.). 16. Rieder, C.L., Schultz, A., Cole, R., and Sluder, G. (1994). Anaphase onset in vertebrate somatic cells is controlled by a checkpoint that monitors sister kinetochore attachment to the sp indle. The Journal of cell biology 127, 13011310. 17. Hayden, J.H., Bowser, S.S., and Rieder, C.L. (1990). Kinetochores capture astral microtubules during chromosome attachme nt to the mitotic spindle: direct visualization in live newt lung cel ls. The Journal of cell biology 111, 1039-1045. 18. Nasmyth, K., Peters, J.M., and Uhlma nn, F. (2001). Splitting the chromosome: cutting the ties that bind sister ch romatids. Novartis Foundation symposium 237, 113-133; discussion 133-118, 158-163. 19. Panizza, S., Tanaka, T., Hochwagen, A., Eisenhaber, F., and Nasmyth, K. (2000). Pds5 cooperates with cohesin in maintain ing sister chromatid cohesion. Curr Biol 10, 1557-1564. 20. Waizenegger, I.C., Hauf, S., Meinke, A ., and Peters, J.M. (2000). Two distinct pathways remove mammalian cohesin from chromosome arms in prophase and from centromeres in anaphase. Cell 103, 399-410. 21. Hauf, S., Waizenegger, I.C., and Pete rs, J.M. (2001). Cohesin cleavage by separase required for anaphase and cy tokinesis in human cells. Science (New York, N.Y 293 1320-1323. 22. Nasmyth, K., Peters, J.M., and Uhlma nn, F. (2000). Splitting the chromosome: cutting the ties that bind sister chromatids. Science (New York, N.Y 288, 13791385. 23. Uhlmann, F., Wernic, D., Poupart, M.A., Koonin, E.V., and Nasmyth, K. (2000). Cleavage of cohesin by the CD clan proteas e separin triggers anaphase in yeast. Cell 103, 375-386. 24. Castro, A., Bernis, C., Vigneron, S., Labbe, J.C., and Lorca, T. (2005). The anaphase-promoting complex: a key fact or in the regulation of cell cycle. Oncogene 24, 314-325. 25. Yanagida, M. (2000). Cell cycle mechanisms of sister chromatid separation; roles of Cut1/separin and Cut2/securin. Genes Cells 5, 1-8. 26. Luders, J., and Stearns, T. (2007). Microtubule-organizing centres: a reevaluation. Nature reviews 8, 161-167. 27. Mazia, D. (1984). Centrosomes and mito tic poles. Experimental cell research 153, 1-15. 28. Moritz, M., Braunfeld, M.B., Guenebaut, V., Heuser, J., and Agard, D.A. (2000). Structure of the gamma-tubulin ring complex: a template for microtubule nucleation. Nature cell biology 2, 365-370. 29. Oakley, B.R., Oakley, C.E., Yoon, Y., and Jung, M.K. (1990). Gamma-tubulin is a component of the spindle pole body that is essential for microtubule function in Aspergillus nidulans. Cell 61, 1289-1301.

PAGE 148

133 30. Bahe, S., Stierhof, Y.D., Wilkinson, C.J., Leiss, F., and Nigg, E.A. (2005). Rootletin forms centriole-associated f ilaments and functions in centrosome cohesion. The Journal of cell biology 171, 27-33. 31. Bahmanyar, S., Kaplan, D.D., Deluca, J.G., Giddings, T.H., Jr., O'Toole, E.T., Winey, M., Salmon, E.D., Casey, P.J., Nels on, W.J., and Barth, A.I. (2008). betaCatenin is a Nek2 substrate involved in centrosome separation. Genes & development 22, 91-105. 32. Fry, A.M., Descombes, P., Twomey, C ., Bacchieri, R., and Nigg, E.A. (2000). The NIMA-related kinase X-Nek2B is re quired for efficient assembly of the zygotic centrosome in Xenopus l aevis. Journal of cell science 113 ( Pt 11), 19731984. 33. Fry, A.M., Meraldi, P., and Nigg, E.A. (1998). A centrosomal function for the human Nek2 protein kinase, a member of the NIMA family of cell cycle regulators. The EMBO journal 17, 470-481. 34. Wiese, C., and Zheng, Y. (1999). Gamma-tubulin complexes and their interaction with microtubule-organizing centers. Curre nt opinion in structural biology 9, 250259. 35. Zheng, Y., Wong, M.L., Alberts, B., and Mitchison, T. (1995). Nucleation of microtubule assembly by a gamma-tubu lin-containing ring complex. Nature 378, 578-583. 36. Moritz, M., Braunfeld, M.B., Fung, J.C., Sedat, J.W., Alberts, B.M., and Agard, D.A. (1995). Three-dimensiona l structural characteriza tion of centrosomes from early Drosophila embryos. The Journal of cell biology 130, 1149-1159. 37. Moritz, M., Braunfeld, M.B., Sedat, J. W., Alberts, B., and Agard, D.A. (1995). Microtubule nucleation by gamma-tubulin-c ontaining rings in the centrosome. Nature 378, 638-640. 38. Vogel, J.M., Stearns, T., Rieder, C.L ., and Palazzo, R.E. (1997). Centrosomes isolated from Spisula solidissima oocytes contain rings and an unusual stoichiometric ratio of alpha/beta tubulin. The Journal of cell biology 137, 193202. 39. Karsenti, E. (1991). Mitotic spindle morphogenesis in animal cells. Seminars in cell biology 2, 251-260. 40. Kirschner, M., and Mitchison, T. (1986). Beyond self-assembly: from microtubules to morphogenesis. Cell 45, 329-342. 41. Wittmann, T., Hyman, A., and Desai, A. (2001). The spindle: a dynamic assembly of microtubules and motors. Nature cell biology 3, E28-34. 42. Mastronarde, D.N., McDonald, K.L ., Ding, R., and McIntosh, J.R. (1993). Interpolar spindle microtubules in PTK cells. The Journal of cell biology 123 1475-1489. 43. Biggins, S., and Walczak, C.E. (2003). Captivating capture: how microtubules attach to kinetochores. Curr Biol 13, R449-460. 44. Rieder, C.L. (1982). The formation, structure, and composition of the mammalian kinetochore and kinetochore fiber. International revi ew of cytology 79, 1-58. 45. Kotwaliwale, C., and Biggins, S. (2006). Microtubule capture: a concerted effort. Cell 127, 1105-1108.

PAGE 149

134 46. Gorbsky, G.J., and Ricketts, W.A. (1993). Differential expression of a phosphoepitope at the kineto chores of moving chromoso mes. The Journal of cell biology 122, 1311-1321. 47. Rieder, C.L., Cole, R.W., Khodjakov, A., and Sluder, G. (1995). The checkpoint delaying anaphase in response to chromo some monoorientation is mediated by an inhibitory signal produced by unattached kinetochores. The Journal of cell biology 130, 941-948. 48. Rieder, C.L., and Salmon, E.D. (1998). The vertebrate cell kinetochore and its roles during mitosis. Trends in cell biology 8, 310-318. 49. Cimini, D., Moree, B., Canman, J. C., and Salmon, E.D. (2003). Merotelic kinetochore orientation occurs freque ntly during early mitosis in mammalian tissue cells and error correc tion is achieved by two different mechanisms. Journal of cell science 116, 4213-4225. 50. Cimini, D. (2007). Detection and correcti on of merotelic kine tochore orientation by Aurora B and its partners. Cell cycle (Georgetown, Tex 6, 1558-1564. 51. Girdler, F., Gascoigne, K.E., Eyers, P.A ., Hartmuth, S., Crafter, C., Foote, K.M., Keen, N.J., and Taylor, S.S. (2006). Valid ating Aurora B as an anti-cancer drug target. Journal of cell science 119, 3664-3675. 52. Hauf, S., Cole, R.W., LaTerra, S., Zimmer, C., Schnapp, G., Walter, R., Heckel, A., van Meel, J., Rieder, C.L., and Pe ters, J.M. (2003). The small molecule Hesperadin reveals a role for Aurora B in correcting kine tochore-microtubule attachment and in maintaining the spindl e assembly checkpoint. The Journal of cell biology 161, 281-294. 53. Kapoor, T.M., Lampson, M.A., Hergert, P., Cameron, L., Cimini, D., Salmon, E.D., McEwen, B.F., and Khodjakov, A. (2006). Chromosomes can congress to the metaphase plate before biorie ntation. Science (New York, N.Y 311, 388-391. 54. Mistry, H.B., MacCallum, D.E., Jack son, R.C., Chaplain, M.A., and Davidson, F.A. (2008). Modeling the temporal evolut ion of the spindle assembly checkpoint and role of Aurora B kinase. Proceedings of the National Academy of Sciences of the United States of America 105, 20215-20220. 55. Kelly, A.E., and Funabiki, H. (2009) Correcting aberrant kinetochore microtubule attachments: an Aurora Bcentric view. Current opinion in cell biology 21, 51-58. 56. Hardwick, K.G., Johnston, R.C., Smit h, D.L., and Murray, A.W. (2000). MAD3 encodes a novel component of the spindl e checkpoint which in teracts with Bub3p, Cdc20p, and Mad2p. The Journal of cell biology 148, 871-882. 57. May, K.M., and Hardwick, K.G. (2006). Th e spindle checkpoint. Journal of cell science 119, 4139-4142. 58. Musacchio, A., and Salmon, E.D. (2007). The spindle-assembly checkpoint in space and time. Nature reviews 8, 379-393. 59. Sudakin, V., Chan, G.K., and Yen, T.J. (2001). Checkpoint inhibition of the APC/C in HeLa cells is mediated by a complex of BUBR1, BUB3, CDC20, and MAD2. The Journal of cell biology 154 925-936. 60. Yen, T.J., and Kao, G.D. (2005). Mito tic checkpoint, aneuploidy and cancer. Advances in experimental medicine and biology 570, 477-499.

PAGE 150

135 61. Hoyt, M.A., Totis, L., and Roberts, B.T. (1991). S. cerevisiae genes required for cell cycle arrest in response to loss of microtubule function. Cell 66, 507-517. 62. Johnson, V.L., Scott, M.I., Holt, S.V., Hussein, D., and Taylor, S.S. (2004). Bub1 is required for kinetochore localizati on of BubR1, Cenp-E, Cenp-F and Mad2, and chromosome congression. Journal of cell science 117, 1577-1589. 63. Li, R., and Murray, A.W. (1991). Feedback control of mitosi s in budding yeast. Cell 66, 519-531. 64. Winey, M., Goetsch, L., Baum, P., and Byers, B. (1991). MPS1 and MPS2: novel yeast genes defining distinct steps of spindle pole body duplication. The Journal of cell biology 114, 745-754. 65. Bharadwaj, R., and Yu, H. (2004). The spindle checkpoint, aneuploidy, and cancer. Oncogene 23, 2016-2027. 66. Musacchio, A., and Hardwick, K.G. ( 2002). The spindle checkpoint: structural insights into dynamic signalling. Nature reviews 3, 731-741. 67. Yu, H. (2002). Regulation of APC-Cd c20 by the spindle checkpoint. Current opinion in cell biology 14 706-714. 68. Chen, R.H., Shevchenko, A., Mann, M ., and Murray, A.W. (1998). Spindle checkpoint protein Xmad1 recruits Xmad2 to unatta ched kinetochores. The Journal of cell biology 143 283-295. 69. Sharp-Baker, H., and Chen, R.H. ( 2001). Spindle checkpoint protein Bub1 is required for kinetochore localiza tion of Mad1, Mad2, Bub3, and CENP-E, independently of its kinase activ ity. The Journal of cell biology 153, 1239-1250. 70. Vigneron, S., Prieto, S., Bernis, C., Labbe J.C., Castro, A., and Lorca, T. (2004). Kinetochore localization of spindle ch eckpoint proteins: who controls whom? Molecular biology of the cell 15, 4584-4596. 71. Jones, M.H., Huneycutt, B.J., Pearson, C.G., Zhang, C., Morgan, G., Shokat, K., Bloom, K., and Winey, M. (2005). Chemical genetics re veals a role for Mps1 kinase in kinetochore attachme nt during mitosis. Curr Biol 15 160-165. 72. Winey, M., and Huneycutt, B.J. (2002) Centrosomes and checkpoints: the MPS1 family of kinases. Oncogene 21, 6161-6169. 73. Zhao, Y., and Chen, R.H. (2006). Mp s1 phosphorylation by MAP kinase is required for kinetochore localization of spindle-checkpoint proteins. Curr Biol 16, 1764-1769. 74. De Antoni, A., Pearson, C.G., Cimini, D., Canman, J.C., Sala, V., Nezi, L., Mapelli, M., Sironi, L., Faretta, M., Salmon, E.D., et al. (2005). The Mad1/Mad2 complex as a template for Mad2 activati on in the spindle assembly checkpoint. Curr Biol 15 214-225. 75. Howell, B.J., Moree, B., Farrar, E.M., Stewart, S., Fang, G., and Salmon, E.D. (2004). Spindle checkpoint protein dynamics at kinetochores in living cells. Curr Biol 14, 953-964. 76. Shah, J.V., Botvinick, E., Bonday, Z., Furnari, F., Berns, M., and Cleveland, D.W. (2004). Dynamics of centromere and kinetochore proteins; implications for checkpoint signaling and silencing. Curr Biol 14, 942-952. 77. Vink, M., Simonetta, M., Tran sidico, P., Ferrari, K., Mapelli, M., De Antoni, A., Massimiliano, L., Ciliberto, A., Faretta, M., Salmon, E.D., et al. (2006). In vitro

PAGE 151

136 FRAP identifies the minimal requireme nts for Mad2 kinetochore dynamics. Curr Biol 16, 755-766. 78. Yu, H. (2006). Structural activation of Mad2 in the mitotic spindle checkpoint: the two-state Mad2 model versus the Mad2 template model. The Journal of cell biology 173, 153-157. 79. Hwang, L.H., Lau, L.F., Smith, D.L., Mistrot, C.A., Hardwick, K.G., Hwang, E.S., Amon, A., and Murray, A.W. (1998). Budding yeast Cdc20: a target of the spindle checkpoint. Science (New York, N.Y 279, 1041-1044. 80. Fang, G. (2002). Checkpoint protein BubR 1 acts synergistically with Mad2 to inhibit anaphase-promoting comple x. Molecular biology of the cell 13, 755-766. 81. Tang, Z., Bharadwaj, R., Li, B., and Y u, H. (2001). Mad2-Inde pendent inhibition of APCCdc20 by the mitotic checkpoin t protein BubR1. Developmental cell 1, 227-237. 82. Karess, R. (2005). Rod-Zw10-Zwilch: a ke y player in the spindle checkpoint. Trends in cell biology 15 386-392. 83. Habu, T., Kim, S.H., Weinstein, J., and Matsumoto, T. (2002). Identification of a MAD2-binding protein, CMT2, and its ro le in mitosis. The EMBO journal 21, 6419-6428. 84. Mapelli, M., Filipp, F.V., Rancati, G., Massimiliano, L., Nezi, L., Stier, G., Hagan, R.S., Confalonieri, S., Piatti, S., Sa ttler, M., et al. (2006). Determinants of conformational dimerization of Mad2 a nd its inhibition by p31comet. The EMBO journal 25, 1273-1284. 85. Xia, G., Luo, X., Habu, T., Rizo, J ., Matsumoto, T., and Yu, H. (2004). Conformation-specific binding of p31(come t) antagonizes the function of Mad2 in the spindle checkpoint. The EMBO journal 23 3133-3143. 86. D'Angiolella, V., Mari, C., Nocera, D., Rametti, L., and Grieco, D. (2003). The spindle checkpoint require s cyclin-dependent kina se activity. Genes & development 17, 2520-2525. 87. Yudkovsky, Y., Shteinberg, M., Listovsky, T., Brandeis, M., and Hershko, A. (2000). Phosphorylation of Cdc20/fizzy negatively regulates the mammalian cyclosome/APC in the mitotic checkpoint Biochemical and biophysical research communications 271, 299-304. 88. Du, J., Cai, X., Yao, J., Ding, X., Wu, Q ., Pei, S., Jiang, K., Zhang, Y., Wang, W., Shi, Y., et al. (2008). The mitotic checkpoint kinase NEK2A regulates kinetochore microtubule attach ment stability. Oncogene 27, 4107-4114. 89. Tang, J., Erikson, R.L., and Liu, X. (2006). Checkpoint kinase 1 (Chk1) is required for mitotic progression through negative regulation of polo-like kinase 1 (Plk1). Proceedings of the National Academy of Sciences of the United States of America 103 11964-11969. 90. Cimini, D., Howell, B., Maddox, P., Khodjakov, A., Degrassi, F., and Salmon, E.D. (2001). Merotelic kinetochore or ientation is a major mechanism of aneuploidy in mitotic mammalian tissue cells. The Journal of cell biology 153 517-527. 91. Salmon, E.D., Cimini, D., Cameron, L.A ., and DeLuca, J.G. (2005). Merotelic kinetochores in mammalian tissue cells. Philosophical transactions of the Royal Society of London 360, 553-568.

PAGE 152

137 92. English, J., Pearson, G., Wilsbacher, J., Swantek, J., Karandikar, M., Xu, S., and Cobb, M.H. (1999). New insights into th e control of MAP kinase pathways. Experimental cell research 253, 255-270. 93. Widmann, C., Gibson, S., Jarpe, M.B., and Johnson, G.L. (1999). Mitogenactivated protein kinase: conservation of a three-kinase module from yeast to human. Physiological reviews 79, 143-180. 94. Siow, Y.L., Kalmar, G.B., Sanghera, J.S ., Tai, G., Oh, S.S., and Pelech, S.L. (1997). Identification of two essential phosphorylated threonine residues in the catalytic domain of Mekk1. Indirect activation by Pak3 and protein kinase C. The Journal of biological chemistry 272, 7586-7594. 95. Gartner, A., Nasmyth, K., and Ammerer, G. (1992). Signal transduction in Saccharomyces cerevisiae requires tyro sine and threonine phosphorylation of FUS3 and KSS1. Genes & development 6, 1280-1292. 96. Pearson, G., Robinson, F., Beers Gibson, T., Xu, B.E., Karandikar, M., Berman, K., and Cobb, M.H. (2001). Mitogen-activ ated protein (MAP) kinase pathways: regulation and physiological f unctions. Endocrine reviews 22, 153-183. 97. Dong, F., Gutkind, J.S., and Larner, A. C. (2001). Granulocyte colony-stimulating factor induces ERK5 activation, which is differentially regulated by proteintyrosine kinases and prot ein kinase C. Regulation of cell prolif eration and survival. The Journal of biological chemistry 276, 10811-10816. 98. Kato, Y., Tapping, R.I., Huang, S., Watson, M.H., Ulevitch, R.J., and Lee, J.D. (1998). Bmk1/Erk5 is required for cell pro liferation induced by epidermal growth factor. Nature 395, 713-716. 99. Gille, H., Strahl, T., and Shaw, P.E. ( 1995). Activation of ternary complex factor Elk-1 by stress-activated protein kinases. Curr Biol 5, 1191-1200. 100. Murphy, L.O., Smith, S., Chen, R.H., Fingar, D.C., and Blenis, J. (2002). Molecular interpretation of ERK signal duration by immediate early gene products. Nature cell biology 4, 556-564. 101. Milne, D.M., Campbell, D.G., Caudwell, F.B., and Meek, D.W. (1994). Phosphorylation of the tumor suppressor protein p53 by mitogenactivated protein kinases. The Journal of biological chemistry 269, 9253-9260. 102. Lin, L.L., Wartmann, M., Lin, A.Y., Knopf, J.L., Seth, A., and Davis, R.J. (1993). cPLA2 is phosphorylated and activated by MAP kinase. Cell 72, 269-278. 103. Seger, R., and Krebs, E.G. (1995). The MAPK signaling cascade. Faseb J 9, 726735. 104. Yarden, Y., and Schlessinger, J. (1987). Self-phosphorylation of epidermal growth factor receptor: evidence for a model of intermolecular allosteric activation. Biochemistry 26, 1434-1442. 105. Kolch, W. (2000). Meaningful rela tionships: the regulation of the Ras/Raf/MEK/ERK pathway by protein in teractions. The Biochemical journal 351 Pt 2, 289-305. 106. Wellbrock, C., Karasarides, M., and Ma rais, R. (2004). The RAF proteins take centre stage. Nature reviews 5, 875-885. 107. Gotoh, Y., Moriyama, K., Matsuda, S., Okumura, E., Kishimoto, T., Kawasaki, H., Suzuki, K., Yahara, I., Sakai, H., and Nishida, E. (1991). Xenopus M phase

PAGE 153

138 MAP kinase: isolation of its cDNA and activation by MPF. The EMBO journal 10, 2661-2668. 108. Gotoh, Y., Nishida, E., Matsuda, S., Shiina, N., Kosako, H., Shiokawa, K., Akiyama, T., Ohta, K., and Sakai, H. (1991). In vitro effects on microtubule dynamics of purified Xenopus M phase-activated MAP kinase. Nature 349 251254. 109. Minshull, J., Sun, H., Tonks, N.K., and Murray, A.W. (1994). A MAP kinasedependent spindle assembly checkpoi nt in Xenopus egg extracts. Cell 79 475486. 110. Takenaka, K., Gotoh, Y., and Nishida, E. (1997). MAP kinase is required for the spindle assembly checkpoint but is disp ensable for the normal M phase entry and exit in Xenopus egg cell cycle extr acts. The Journal of cell biology 136, 10911097. 111. Roberts, E.C., Shapiro, P.S., Nahreini, T.S., Pages, G., Pouyssegur, J., and Ahn, N.G. (2002). Distinct cell cycle timing requirements for extracellular signalregulated kinase and phosphoinositide 3-ki nase signaling pathways in somatic cell mitosis. Molecular and cellular biology 22, 7226-7241. 112. Shapiro, P.S., Vaisberg, E., Hunt, A.J., Tolwinski, N.S., Whalen, A.M., McIntosh, J.R., and Ahn, N.G. (1998). Activation of the MKK/ERK pathway during somatic cell mitosis: direct interactions of active ERK with kinetochores and regulation of the mitotic 3F3/2 phosphoantigen. J Cell Biol 142 1533-1545. 113. Willard, F.S., and Crouch, M.F. (2001). MEK, ERK, and p90RSK are present on mitotic tubulin in Swiss 3T3 cells: a role for the MAP kinase pathway in regulating mitotic exit. Cellular signalling 13, 653-664. 114. Zecevic, M., Catling, A.D., Eblen, S.T., Renzi, L., Hittle, J.C., Yen, T.J., Gorbsky, G.J., and Weber, M.J. (19 98). Active MAP kinase in mitosis: localization at kinetochores and associat ion with the motor protein CENP-E. The Journal of cell biology 142 1547-1558. 115. Horne, M.M., and Guadagno, T.M. (2003). A requirement for MAP kinase in the assembly and maintenance of the mitotic spindle. The Journal of cell biology 161, 1021-1028. 116. Zhang, W.L., Huitorel, P., Glass, R., Fe rnandez-Serra, M., Arnone, M.I., Chiri, S., Picard, A., and Ciapa, B. (2005). A MAPK pathway is involved in the control of mitosis after fertilization of the sea urchin egg. Developmental biology 282 192206. 117. Wright, J.H., Munar, E., Jameson, D.R., Andreassen, P.R., Margolis, R.L., Seger, R., and Krebs, E.G. (1999). Mitogen-activated protein kinase kinase activity is required for the G(2)/M transition of the cell cycle in mammalian fibroblasts. Proceedings of the National Academy of Scie nces of the United States of America 96, 11335-11340. 118. Liu, X., Yan, S., Zhou, T., Terada, Y., a nd Erikson, R.L. (2004). The MAP kinase pathway is required for entry into mitosis and cell survival. Oncogene 23, 763776. 119. Guadagno, T.M., and Ferrell, J.E., Jr. (1998). Requirement for MAPK activation for normal mitotic progression in Xenopus egg extracts. Science (New York, N.Y 282, 1312-1315.

PAGE 154

139 120. Bitangcol, J.C., Chau, A.S ., Stadnick, E., Lohka, M.J., Dicken, B., and Shibuya, E.K. (1998). Activation of the p42 mitoge n-activated protei n kinase pathway inhibits Cdc2 activation and entry into M-phase in cycling Xenopus egg extracts. Molecular biology of the cell 9, 451-467. 121. Walter, S.A., Guadagno, T.M., and Ferre ll, J.E., Jr. (1997). Induction of a G2phase arrest in Xenopus egg extracts by activation of p42 mitogen-activated protein kinase. Molecu lar biology of the cell 8, 2157-2169. 122. Walter, S.A., Guadagno, S.N., and Ferrell J.E., Jr. (2000). Activation of Wee1 by p42 MAPK in vitro and in cycling xenopus egg extracts. Molecular biology of the cell 11, 887-896. 123. Reszka, A.A., Seger, R., Diltz, C.D., Krebs, E.G., and Fischer, E.H. (1995). Association of mitogen-activated pr otein kinase with the microtubule cytoskeleton. Proceedings of the National Academy of Sciences of the United States of America 92, 8881-8885. 124. Hoshi, M., Ohta, K., Gotoh, Y., Mori, A., Murofushi, H., Sakai, H., and Nishida, E. (1992). Mitogen-activated-protein-kinase-catal yzed phosphorylation of microtubule-associated proteins, mi crotubule-associated protein 2 and microtubule-associated protei n 4, induces an alteration in their function. European journal of biochemistry / FEBS 203, 43-52. 125. Ray, L.B., and Sturgill T.W. (1987). Rapid stimulation by insulin of a serine/threonine kinase in 3T3-L1 adipocytes that phosphorylates microtubuleassociated protein 2 in vitro. Proceedings of the National Academ y of Sciences of the United States of America 84, 1502-1506. 126. Verlhac, M.H., de Pennart, H., Maro, B., Cobb, M.H., and Clarke, H.J. (1993). MAP kinase becomes stably activated at metaphase and is associated with microtubule-organizing centers during me iotic maturation of mouse oocytes. Developmental biology 158 330-340. 127. Chau, A.S., and Shibuya, E.K. (1999). Inactivation of p42 mitogen-activated protein kinase is required for exit from M-phase after cyclin destruction. The Journal of biological chemistry 274, 32085-32090. 128. Inoue, Y.H., and Glover, D.M. (1998). Involvement of the rolled/MAP kinase gene in Drosophila mitosis: interact ion between genes for the MAP kinase cascade and abnormal spindle. Mol Gen Genet 258, 334-341. 129. Chung, E., and Chen, R.H. (2003). Phosphorylation of Cdc20 is required for its inhibition by the spindle checkpoint. Nat Cell Biol 5, 748-753. 130. Fukasawa, K., and Vande Woude, G.F. (1997). Synergy between the Mos/mitogen-activated protein kinase pathway and loss of p53 function in transformation and chromosome instab ility. Molecular and cellular biology 17, 506-518. 131. Saavedra, H.I., Fukasawa, K., Conn, C.W., and Stambrook, P.J. (1999). MAPK mediates RAS-induced chromosome in stability. The Journal of biological chemistry 274, 38083-38090. 132. Warren, G. (1993). Membrane partitioni ng during cell division. Annual review of biochemistry 62, 323-348.

PAGE 155

140 133. Colanzi, A., Sutterlin, C., and Malhotra, V. (2003). RAF1-activated MEK1 is found on the Golgi apparatus in late propha se and is required for Golgi complex fragmentation in mitosis. The Journal of cell biology 161, 27-32. 134. Harding, A., Giles, N., Burgess, A., Ha ncock, J.F., and Gabrielli, B.G. (2003). Mechanism of mitosis-specific ac tivation of MEK1. J Biol Chem 278, 1674716754. 135. Acharya, U., Mallabiabarrena, A., Acharya, J.K., and Malhotra, V. (1998). Signaling via mitogen-activated protein ki nase kinase (MEK1) is required for Golgi fragmentation during mitosis. Cell 92, 183-192. 136. Sutterlin, C., Hsu, P., Mallabiabarrena, A., and Malhotra, V. (2002). Fragmentation and dispersal of the pericentriolar Golgi complex is required for entry into mitosis in mammalian cells. Cell 109, 359-369. 137. Aebersold, D.M., Shaul, Y.D., Yung, Y., Yarom, N., Yao, Z., Hanoch, T., and Seger, R. (2004). Extracellular signal-re gulated kinase 1c (ERK1c), a novel 42kilodalton ERK, demonstrates unique modes of regulati on, localization, and function. Mol Cell Biol 24, 10000-10015. 138. Shaul, Y.D., and Seger, R. (2006). ER K1c regulates Golgi fragmentation during mitosis. J Cell Biol 172, 885-897. 139. Chong, H., Lee, J., and Guan, K.L. (2001). Positive and negative regulation of Raf kinase activity and function by phosphorylation. The EMBO journal 20, 3716-3727. 140. Chong, H., Vikis, H.G., and Guan, K.L. (2003). Mechanisms of regulating the Raf kinase family. Cellular signalling 15, 463-469. 141. Daum, G., Eisenmann-Tappe, I., Fries, H.W., Troppmair, J., and Rapp, U.R. (1994). The ins and outs of Raf kinases. Trends in biochemical sciences 19 474480. 142. Morrison, D.K., and Cutler, R.E. (1997) The complexity of Raf-1 regulation. Current opinion in cell biology 9, 174-179. 143. Chuang, E., Barnard, D., Hettich, L., Zhang, X.F., Avruch, J., and Marshall, M.S. (1994). Critical binding a nd regulatory interactions between Ras and Raf occur through a small, stable N-terminal doma in of Raf and specific Ras effector residues. Molecular and cellular biology 14, 5318-5325. 144. Guan, K.L., Figueroa, C., Brtva, T.R ., Zhu, T., Taylor, J., Barber, T.D., and Vojtek, A.B. (2000). Negative regulation of the serine/threonine kinase B-Raf by Akt. The Journal of biological chemistry 275, 27354-27359. 145. Morrison, D.K., Heidecker, G., Rapp, U.R., and Copeland, T.D. (1993). Identification of the major phosphorylation sites of the Raf-1 kinase. The Journal of biological chemistry 268, 17309-17316. 146. Zimmermann, S., and Moelling, K. (1999). Phosphorylation and regulation of Raf by Akt (protein kinase B). Science (New York, N.Y 286, 1741-1744. 147. Michaud, N.R., Fabian, J.R., Mathes, K. D., and Morrison, D.K. (1995). 14-3-3 is not essential for Raf-1 function: identi fication of Raf-1 proteins that are biologically activated in a 14-3-3and Ras-independent manner. Molecular and cellular biology 15, 3390-3397.

PAGE 156

141 148. Barnier, J.V., Papin, C., Eychene, A., Lecoq, O., and Calothy, G. (1995). The mouse B-raf gene encodes multiple protein isoforms with tissue-specific expression. The Journal of biological chemistry 270, 23381-23389. 149. Papin, C., Eychene, A., Brunet, A., Pa ges, G., Pouyssegur, J., Calothy, G., and Barnier, J.V. (1995). B-Raf protein is oforms interact with and phosphorylate Mek-1 on serine residues 218 and 222. Oncogene 10, 1647-1651. 150. Heidecker, G., Huleihel, M., Clevela nd, J.L., Kolch, W., Beck, T.W., Lloyd, P., Pawson, T., and Rapp, U.R. (1990). Muta tional activation of c-raf-1 and definition of the minimal transforming sequence. Molecular and cellular biology 10, 2503-2512. 151. Jaumot, M., and Hancock, J.F. (2001). Protein phosphatases 1 and 2A promote Raf-1 activation by regulating 14 -3-3 interactions. Oncogene 20, 3949-3958. 152. Kubicek, M., Pacher, M., Abraham, D., P odar, K., Eulitz, M., and Baccarini, M. (2002). Dephosphorylation of Ser-259 regulates Raf-1 me mbrane association. The Journal of biological chemistry 277, 7913-7919. 153. Nassar, N., Horn, G., Herrmann, C., Scherer, A., McCormick, F., and Wittinghofer, A. (1995). The 2.2 A crystal structure of the Ras-binding domain of the serine/threonine kinase c-Raf1 in complex with Rap1A and a GTP analogue. Nature 375, 554-560. 154. Okada, T., Hu, C.D., Jin, T.G., Kariya, K., Yamawaki-Kataoka, Y., and Kataoka, T. (1999). The strength of interaction at the Raf cysteine -rich domain is a critical determinant of response of Raf to Ras family small GTPases. Molecular and cellular biology 19, 6057-6064. 155. Vojtek, A.B., Hollenberg, S.M., and Cooper, J.A. (1993). Mammalian Ras interacts directly with the seri ne/threonine kinase Raf. Cell 74, 205-214. 156. Diaz, B., Barnard, D., Filson, A., MacD onald, S., King, A., and Marshall, M. (1997). Phosphorylation of Raf1 serine 338-serine 339 is an essential regulatory event for Ras-dependent activation a nd biological signali ng. Molecular and cellular biology 17, 4509-4516. 157. Fabian, J.R., Daar, I.O., and Morrison, D.K. (1993). Critical tyrosine residues regulate the enzymatic and biological act ivity of Raf-1 kinase. Molecular and cellular biology 13, 7170-7179. 158. Mason, C.S., Springer, C.J., Cooper, R.G., Superti-Furga, G., Marshall, C.J., and Marais, R. (1999). Serine and tyrosine phosphorylations cooperate in Raf-1, but not B-Raf activation. The EMBO journal 18, 2137-2148. 159. Marais, R., Light, Y., Paterson, H.F., and Marshall, C.J. (1995). Ras recruits Raf1 to the plasma membrane for activa tion by tyrosine phospho rylation. The EMBO journal 14, 3136-3145. 160. Zhang, B.H., and Guan, K.L. (2000). Ac tivation of B-Raf kinase requires phosphorylation of the conserved residues Thr598 and Ser601. The EMBO journal 19, 5429-5439. 161. Marais, R., Light, Y., Paterson, H.F., Mason, C.S., and Marshall, C.J. (1997). Differential regulation of Raf-1, A-Raf, and B-Raf by oncogenic ras and tyrosine kinases. The Journal of biological chemistry 272, 4378-4383.

PAGE 157

142 162. Berruti, G. (2000). A novel rap1/B-Raf/14-33 theta protein complex is formed in vivo during the morphogenetic differentiati on of postmeiotic male germ cells. Experimental cell research 257, 172-179. 163. Houslay, M.D., and Kolch, W. (2000). Cell-type specific integration of cross-talk between extracellular signal-regulated kinase and cAMP signaling. Molecular pharmacology 58, 659-668. 164. Papin, C., Denouel, A., Calothy, G., and Eychene, A. (1996). Identification of signalling proteins interacting with B-Raf in the yeast two-hybrid system. Oncogene 12, 2213-2221. 165. Vossler, M.R., Yao, H., York, R.D., Pan, M.G., Rim, C.S., and Stork, P.J. (1997). cAMP activates MAP kinase and Elk1 through a B-Rafand Rap1-dependent pathway. Cell 89, 73-82. 166. Yamamori, B., Kuroda, S., Shimizu, K., Fukui, K., Ohtsuka, T., and Takai, Y. (1995). Purification of a Ras-dependent m itogen-activated prot ein kinase kinase kinase from bovine brain cy tosol and its identification as a complex of B-Raf and 14-3-3 proteins. The Journal of biological chemistry 270, 11723-11726. 167. York, R.D., Yao, H., Dillon, T., Ellig, C. L., Eckert, S.P., McCleskey, E.W., and Stork, P.J. (1998). Rap1 mediates sustai ned MAP kinase activation induced by nerve growth factor. Nature 392, 622-626. 168. Rushworth, L.K., Hindley, A.D., O'Neil l, E., and Kolch, W. (2006). Regulation and role of Raf-1/B-Raf heterodimeri zation. Molecular a nd cellular biology 26, 2262-2272. 169. Bos, J.L., de Rooij, J., and Reedquist, K.A. (2001). Rap1 signalling: adhering to new models. Nature reviews 2, 369-377. 170. Papin, C., Denouel-Galy, A., Laugier, D ., Calothy, G., and Eychene, A. (1998). Modulation of kinase activ ity and oncogenic properti es by alternative splicing reveals a novel regulatory mechanism for B-Raf. The Journal of biological chemistry 273, 24939-24947. 171. Mizutani, S., Koide, H., and Kaziro, Y. (1998). Isolation of a new protein factor required for activation of Raf-1 by Ha-Ras : partial purification from rat brain cytosols. Oncogene 16, 2781-2786. 172. Weber, C.K., Slupsky, J.R., Kalmes, H.A., and Rapp, U.R. (2001). Active Ras induces heterodimerization of cR af and BRaf. Cancer research 61, 3595-3598. 173. Wojnowski, L., Zimmer, A.M., Beck, T.W., Hahn, H., Bernal, R., Rapp, U.R., and Zimmer, A. (1997). Endothelial apoptos is in Braf-deficient mice. Nature genetics 16, 293-297. 174. Wojnowski, L., Stancato, L.F., Larner, A.C., Rapp, U.R., and Zimmer, A. (2000). Overlapping and specific functions of Br af and Craf-1 proto-oncogenes during mouse embryogenesis. Mechanisms of development 91, 97-104. 175. Storm, S.M., Cleveland, J.L., and Rapp, U.R. (1990). Expression of raf family proto-oncogenes in normal mouse tissues. Oncogene 5, 345-351. 176. Wadewitz, A.G., Winer, M.A., and Wo lgemuth, D.J. (1993). Developmental and cell lineage specificity of raf family ge ne expression in mouse testis. Oncogene 8, 1055-1062.

PAGE 158

143 177. Wixler, V., Smola, U., Schuler, M., a nd Rapp, U. (1996). Differential regulation of Raf isozymes by growth versus di fferentiation inducing factors in PC12 pheochromocytoma cells. FEBS letters 385, 131-137. 178. MacNicol, M.C., and MacNicol, A.M. ( 1999). Nerve growth factor-stimulated BRaf catalytic activity is refractory to inhibition by cAMP-dependent protein kinase. The Journal of biological chemistry 274, 13193-13197. 179. Ohtsuka, T., Shimizu, K., Yamamori, B., Kuroda, S., and Takai, Y. (1996). Activation of brain B-Raf protein kinase by Rap1B small GTP-binding protein. The Journal of biological chemistry 271, 1258-1261. 180. Borysov, S.I., Cheng, A.W., and Guadagno, T.M. (2006). B-Raf Is Critical For MAPK Activation during Mitosis and Is Regulated in an M Phase-dependent Manner in Xenopus Egg Extracts. J Biol Chem 281 22586-22596. 181. Borysov, S.I., and Guadagno, T.M. (2008). A novel role for Cdk1/cyclin B in regulating B-raf activation at mito sis. Molecular biology of the cell 19, 29072915. 182. Cohen, S. (1965). The stimulation of epidermal proliferation by a specific protein (EGF). Developmental biology 12, 394-407. 183. Cohen, S., Carpenter, G., and King, L ., Jr. (1980). Epidermal growth factorreceptor-protein kinase interactions. Co -purification of receptor and epidermal growth factor-enhanced phosphorylation activity. The Journal of biological chemistry 255, 4834-4842. 184. Yarden, Y., and Sliwkowski, M.X. (2001). Untangling the ErbB signalling network. Nature reviews 2, 127-137. 185. Downward, J., Yarden, Y., Mayes, E., Scrace, G., Totty, N., Stockwell, P., Ullrich, A., Schlessinger, J., and Waterf ield, M.D. (1984). Close similarity of epidermal growth factor receptor and verb-B oncogene protein sequences. Nature 307, 521-527. 186. Lin, C.R., Chen, W.S., Kruiger, W., St olarsky, L.S., Weber, W., Evans, R.M., Verma, I.M., Gill, G.N., and Rosenfel d, M.G. (1984). Expression cloning of human EGF receptor complementary DNA: ge ne amplification and three related messenger RNA products in A431 cel ls. Science (New York, N.Y 224, 843-848. 187. Ullrich, A., Coussens, L., Hayflick, J.S., Dull, T.J., Gray, A., Tam, A.W., Lee, J., Yarden, Y., Libermann, T.A., Schlessinge r, J., et al. (1984). Human epidermal growth factor receptor cDNA sequence a nd aberrant expression of the amplified gene in A431 epidermoid carcinoma cells. Nature 309, 418-425. 188. Xu, Y.H., Ishii, S., Clark, A.J., Sullivan, M., Wilson, R.K., Ma, D.P., Roe, B.A., Merlino, G.T., and Pastan, I. (1984). Huma n epidermal growth factor receptor cDNA is homologous to a variety of RNAs overproduced in A431 carcinoma cells. Nature 309, 806-810. 189. Ozanne, B., Richards, C.S., Hendler, F ., Burns, D., and Gusterson, B. (1986). Over-expression of the EGF receptor is a hallmark of squamous cell carcinomas. The Journal of pathology 149, 9-14. 190. Grandis, J.R., and Sok, J.C. (2004). Signaling through the epidermal growth factor receptor during the developm ent of malignancy. Pharmacology & therapeutics 102, 37-46.

PAGE 159

144 191. Grandis, J.R., Zeng, Q., Drenning, S.D., and Tweardy, D.J. (1998). Normalization of EGFR mRNA levels followi ng restoration of wild-type p53 in a head and neck squamous cell carcinoma cell line. International journal of oncology 13, 375-378. 192. Moscatello, D.K., Holgado-Madruga, M ., Godwin, A.K., Ramirez, G., Gunn, G., Zoltick, P.W., Biegel, J.A., Hayes, R. L., and Wong, A.J. (1995). Frequent expression of a mutant epidermal grow th factor receptor in multiple human tumors. Cancer research 55, 5536-5539. 193. Nishikawa, R., Ji, X.D., Harmon, R.C., Lazar, C.S., Gill, G.N., Cavenee, W.K., and Huang, H.J. (1994). A mutant epiderma l growth factor receptor common in human glioma confers enhanced tumori genicity. Proceedings of the National Academy of Sciences of the United States of America 91, 7727-7731. 194. Rusch, V., Baselga, J., Cordon-Cardo, C., Orazem, J., Zaman, M., Hoda, S., McIntosh, J., Kurie, J., and Dmitrovsky, E. (1993). Differential expression of the epidermal growth factor receptor and its ligands in primary non-small cell lung cancers and adjacent benign lung. Cancer research 53, 2379-2385. 195. Salomon, D.S., Brandt, R., Ciardiello, F., and Normanno, N. (1995). Epidermal growth factor-related peptides and their receptors in human malignancies. Critical reviews in oncology/hematology 19, 183-232. 196. Gangarosa, L.M., Sizemore, N., Graves-D eal, R., Oldham, S.M., Der, C.J., and Coffey, R.J. (1997). A raf-independent epid ermal growth factor receptor autocrine loop is necessary for Ras transformation of rat intestinal epithelial cells. The Journal of biological chemistry 272, 18926-18931. 197. McCarthy, S.A., Samuels, M.L., Pritchard, C.A., Abraham, J.A., and McMahon, M. (1995). Rapid induction of heparin-binding epidermal growth factor/diphtheria toxin receptor expression by Raf and Ras oncogenes. Genes & development 9, 1953-1964. 198. Schulze, A., Lehmann, K., Jefferies, H.B., McMahon, M., and Downward, J. (2001). Analysis of the transcriptional pr ogram induced by Raf in epithelial cells. Genes & development 15, 981-994. 199. Mitin, N., Rossman, K.L., and Der, C. J. (2005). Signaling interplay in Ras superfamily function. Curr Biol 15, R563-574. 200. Roberts, P.J., and Der, C.J. (2007) Targeting the Raf-MEK-ERK mitogenactivated protein kinase cascade for the treatment of cancer. Oncogene 26, 32913310. 201. Bos, J.L. (1989). ras oncogenes in hu man cancer: a review. Cancer research 49, 4682-4689. 202. Malumbres, M., and Barbacid, M. (2003). RAS oncogenes: the first 30 years. Nat Rev Cancer 3, 459-465. 203. Wu, G.S. (2007). Role of mitogen-activat ed protein kinase phosphatases (MKPs) in cancer. Cancer metastasis reviews 26, 579-585. 204. Loda, M., Capodieci, P., Mishra, R., Ya o, H., Corless, C., Grigioni, W., Wang, Y., Magi-Galluzzi, C., and Stork, P.J. (1996). Expression of mitogen-activated protein kinase phosphatase-1 in the early phases of human epithelial carcinogenesis. The American journal of pathology 149, 1553-1564. 205. Vicent, S., Garayoa, M., Lopez-Pi cazo, J.M., Lozano, M.D., Toledo, G., Thunnissen, F.B., Manzano, R.G., and M ontuenga, L.M. (2004). Mitogen-

PAGE 160

145 activated protein kinase phosphatase-1 is overexpressed in non-small cell lung cancer and is an independent predictor of outcome in patients. Clin Cancer Res 10, 3639-3649. 206. Wang, H.Y., Cheng, Z., and Malbon, C. C. (2003). Overexpression of mitogenactivated protein kinase phosphatases MKP1, MKP2 in human breast cancer. Cancer letters 191, 229-237. 207. Denkert, C., Schmitt, W.D., Berger, S., Reles, A., Pest, S., Siegert, A., Lichtenegger, W., Dietel, M., and Haupt mann, S. (2002). Expression of mitogenactivated protein kinase phosphatase-1 (MKP-1) in primary human ovarian carcinoma. Internationa l journal of cancer 102, 507-513. 208. Manzano, R.G., Montuenga, L.M., Dayton, M ., Dent, P., Kinoshita, I., Vicent, S., Gardner, G.J., Nguyen, P., Choi, Y.H., Tr epel, J., et al. (2002). CL100 expression is down-regulated in advanced epithe lial ovarian cancer a nd its re-expression decreases its malignant potential. Oncogene 21, 4435-4447. 209. Rauhala, H.E., Porkka, K.P., Tolonen, T.T., Martikainen, P.M., Tammela, T.L., and Visakorpi, T. (2005). Dual-s pecificity phosphatase 1 and serum/glucocorticoid-regulated kinase are downregulated in prostate cancer. International journal of cancer 117, 738-745. 210. Marchetti, S., Gimond, C., Roux, D., Goth ie, E., Pouyssegur, J., and Pages, G. (2004). Inducible expression of a MA P kinase phosphatase-3-GFP chimera specifically blunts fibroblast growth and ras-dependent tumor formation in nude mice. Journal of cellular physiology 199, 441-450. 211. Xu, S., Furukawa, T., Kanai, N., Sunamu ra, M., and Horii, A. (2005). Abrogation of DUSP6 by hypermethylation in human pancreatic cancer. Journal of human genetics 50, 159-167. 212. Calogeraki, I., Barnier, J.V., Eychene, A., Felder, M.P., Calothy, G., and Marx, M. (1993). Genomic organization and nucle otide sequence of the coding region of the chicken c-Rmil(B-raf-1) proto-on cogene. Biochemical and biophysical research communications 193, 1324-1331. 213. Eychene, A., Barnier, J.V., Apiou, F., Dutrillaux, B., and Calothy, G. (1992). Chromosomal assignment of two human B-ra f(Rmil) proto-oncogene loci: B-raf-1 encoding the p94Braf/Rmil and B-raf-2, a processed pseudogene. Oncogene 7, 1657-1660. 214. Jansen, H.W., Trachmann, C., and Bister, K. (1984). Structural relationship between the chicken protooncogene c-mil and the retroviral oncogene v-mil. Virology 137 217-224. 215. Sutrave, P., Bonner, T.I., Rapp, U.R., Jansen, H.W., Patschinsky, T., and Bister, K. (1984). Nucleotide sequence of avian retroviral oncogene v-mil: homologue of murine retroviral oncogene v-raf. Nature 309, 85-88. 216. Davies, H., Bignell, G.R., Cox, C., Stephe ns, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M.J., Bottomle y, W., et al. (2002). Mutations of the BRAF gene in human cancer. Nature 417, 949-954. 217. Ciampi, R., and Nikiforov, Y.E. (2005). A lterations of the BRAF gene in thyroid tumors. Endocrine pathology 16, 163-172. 218. Soares, P., Trovisco, V., Rocha, A.S., Feijao, T., Rebocho, A.P., Fonseca, E., Vieira de Castro, I., Cameselle-Teijeir o, J., Cardoso-Oliveira, M., and Sobrinho-

PAGE 161

146 Simoes, M. (2004). BRAF mutations typical of papillary thyroid carcinoma are more frequently detected in undifferentiate d than in insular and insular-like poorly differentiated carcinomas. Virchows Arch 444, 572-576. 219. Trovisco, V., Vieira de Cast ro, I., Soares, P., Maximo, V., Silva, P., Magalhaes, J., Abrosimov, A., Guiu, X.M., and Sobrinho-Simoes, M. (2004). BRAF mutations are associated with some hi stological types of papillary thyroid carcinoma. The Journal of pathology 202, 247-251. 220. Pollock, P.M., Harper, U.L., Hansen, K. S., Yudt, L.M., Stark, M., Robbins, C.M., Moses, T.Y., Hostetter, G., Wagner, U., Kakareka, J., et al. (2003). High frequency of BRAF mutations in nevi. Nat Genet 33, 19-20. 221. Ciampi, R., Knauf, J.A., Rabes, H.M ., Fagin, J.A., and Nikiforov, Y.E. (2005). BRAF kinase activation via chromosomal r earrangement in radiation-induced and sporadic thyroid cancer. Cell cycle (Georgetown, Tex 4, 547-548. 222. Ciampi, R., Zhu, Z., and Nikiforov, Y. E. (2005). BRAF copy number gains in thyroid tumors detected by fluorescen ce in situ hybridi zation. Endocrine pathology 16 99-105. 223. Wellbrock, C., Ogilvie, L., Hedley, D., Karasarides, M., Martin, J., NiculescuDuvaz, D., Springer, C.J., and Marais, R. (2004). V599EB-RAF is an oncogene in melanocytes. Cancer Res 64, 2338-2342. 224. Wan, P.T., Garnett, M.J., Roe, S.M., L ee, S., Niculescu-Duvaz, D., Good, V.M., Jones, C.M., Marshall, C.J., Springer, C. J., Barford, D., et al. (2004). Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of BRAF. Cell 116, 855-867. 225. Calipel, A., Lefevre, G., Pouponnot, C ., Mouriaux, F., Eychene, A., and Mascarelli, F. (2003). Mutation of B-Ra f in human choroidal melanoma cells mediates cell proliferation and transf ormation through the MEK/ERK pathway. J Biol Chem 278 42409-42418. 226. Hingorani, S.R., Jacobetz, M.A., Robert son, G.P., Herlyn, M., and Tuveson, D.A. (2003). Suppression of BRAF(V599E) in human melanoma abrogates transformation. Cancer Res 63, 5198-5202. 227. Patton, E.E., Widlund, H.R., Kutok, J.L., Kopani, K.R., Amatruda, J.F., Murphey, R.D., Berghmans, S., Mayhall, E.A., Trav er, D., Fletcher, C.D., et al. (2005). BRAF mutations are sufficient to promote nevi formation and cooperate with p53 in the genesis of melanoma. Curr Biol 15, 249-254. 228. Mercer, K., Giblett, S., Green, S., Lloyd, D., DaRocha Dias, S., Plumb, M., Marais, R., and Pritchard, C. (2005). Expression of endogenous oncogenic V600EB-raf induces prolif eration and developmental defects in mice and transformation of primary fibroblasts. Cancer research 65, 11493-11500. 229. Dankort, D., Curley, D.P., Cartlidge, R.A., Nelson, B., Karnezis, A.N., Damsky Jr, W.E., You, M.J., Depinho, R.A., Mc Mahon, M., and Bosenberg, M. (2009). Braf(V600E) cooperates with Pten loss to induce metastatic melanoma. Nature genetics. 230. Dankort, D., Filenova, E., Collado, M., Serrano, M., Jones, K., and McMahon, M. (2007). A new mouse model to explore th e initiation, progression, and therapy of BRAFV600E-induced lung tumors. Genes & development 21, 379-384.

PAGE 162

147 231. Knauf, J.A., Ma, X., Smith, E.P., Zhang, L., Mitsutake, N., Liao, X.H., Refetoff, S., Nikiforov, Y.E., and Fagin, J.A. ( 2005). Targeted expression of BRAFV600E in thyroid cells of transgen ic mice results in papillary thyroid cancers that undergo dedifferentiation. Cancer research 65, 4238-4245. 232. Lengauer, C., Kinzler, K.W., and Vogels tein, B. (1998). Genetic instabilities in human cancers. Nature 396, 643-649. 233. Hsieh, P., and Yamane, K. (2008). DNA mismatch repair: molecular mechanism, cancer, and ageing. Mechanisms of ageing and development 129, 391-407. 234. Wood, R.D. (1996). DNA repair in eukar yotes. Annual review of biochemistry 65, 135-167. 235. Nowak, M.A., Komarova, N.L., Sengupta, A., Jallepalli, P.V., Shih Ie, M., Vogelstein, B., and Lengauer, C. (2002). Th e role of chromoso mal instability in tumor initiation. Proceedings of the Nationa l Academy of Sciences of the United States of America 99, 16226-16231. 236. Perucho, M. (1996). Cancer of the mi crosatellite mutator phenotype. Biological chemistry 377, 675-684. 237. Jallepalli, P.V., and Lengauer, C. (2 001). Chromosome segregation and cancer: cutting through the mystery. Nat Rev Cancer 1, 109-117. 238. McNally, R.J., Rankin, J., Shirley, M.D., Rushton, S.P., and Pless-Mulloli, T. (2008). Space-time analysis of Down syndr ome: results consistent with transient pre-disposing contagious agent. In ternational journal of epidemiology 37, 11691179. 239. Lengauer, C., Kinzler, K.W., and Vogels tein, B. (1997). Genetic instability in colorectal cancers. Nature 386, 623-627. 240. Nowell, P.C. (1997). Genetic alterations in leukemias and lymphomas: impressive progress and continuing complexity. Cancer genetics and cytogenetics 94, 13-19. 241. Bignold, L.P., Coghlan, B.L., and Jersmann, H.P. (2006). Hansemann, Boveri, chromosomes and the gametogenesis-rela ted theories of tumours. Cell biology international 30, 640-644. 242. Kops, G.J., Weaver, B.A., and Cleveland, D.W. (2005). On the road to cancer: aneuploidy and the mitotic checkpoint. Nat Rev Cancer 5, 773-785. 243. Zhou, H., Kuang, J., Zhong, L., Kuo, W.L., Gray, J.W., Sahin, A ., Brinkley, B.R., and Sen, S. (1998). Tumour amplified ki nase STK15/BTAK induces centrosome amplification, aneuploidy and transformation. Nature genetics 20, 189-193. 244. Fukasawa, K., Choi, T., Kuriyama, R., Rulong, S., and Vande Woude, G.F. (1996). Abnormal centrosome amplification in the absence of p53. Science (New York, N.Y 271 1744-1747. 245. Daniels, M.J., Wang, Y., Lee, M., and Venkitaraman, A.R. (2004). Abnormal cytokinesis in cells deficient in the br east cancer suscepti bility protein BRCA2. Science (New York, N.Y 306, 876-879. 246. Deng, C.X. (2002). Roles of BRCA1 in centrosome duplication. Oncogene 21, 6222-6227. 247. Tutt, A., Gabriel, A., Bertwistle, D., Connor, F., Paterson, H., Peacock, J., Ross, G., and Ashworth, A. (1999). Absence of Brca2 causes genome instability by chromosome breakage and loss associated with centrosome amplification. Curr Biol 9, 1107-1110.

PAGE 163

148 248. Wang, R.H., Yu, H., and Deng, C.X. ( 2004). A requirement for breast-cancerassociated gene 1 (BRCA1) in the sp indle checkpoint. Proceedings of the National Academy of Sciences of the United States of America 101, 1710817113. 249. McGrew, J.T., Goetsch, L., Byers, B ., and Baum, P. (1992). Requirement for ESP1 in the nuclear division of Sacchar omyces cerevisiae. Molecular biology of the cell 3, 1443-1454. 250. Uzawa, S., Samejima, I., Hirano, T., Tanaka, K., and Yanagida, M. (1990). The fission yeast cut1+ gene regulates spindle pole body duplication and has homology to the budding yeast ESP1 gene. Cell 62 913-925. 251. Yamamoto, A., Guacci, V., and Koshland, D. (1996). Pds1p is required for faithful execution of anaphase in the yeast, Saccharomyces cerevisiae. The Journal of cell biology 133 85-97. 252. Jallepalli, P.V., Waizenegge r, I.C., Bunz, F., Langer, S., Speicher, M.R., Peters, J.M., Kinzler, K.W., Vogels tein, B., and Lengauer, C. (2001). Securin is required for chromosomal stability in human cells. Cell 105 445-457. 253. Gassmann, R., Carvalho, A., Henzing, A.J., Ruchaud, S., Hudson, D.F., Honda, R., Nigg, E.A., Gerloff, D.L., and Earn shaw, W.C. (2004). Borealin: a novel chromosomal passenger required for stabilit y of the bipolar mitotic spindle. The Journal of cell biology 166 179-191. 254. Fodde, R., Kuipers, J., Rosenberg, C., Sm its, R., Kielman, M., Gaspar, C., van Es, J.H., Breukel, C., Wiegant, J., Giles, R.H., et al. (2001). Mutations in the APC tumour suppressor gene cause chromoso mal instability. Nature cell biology 3, 433-438. 255. Fodde, R., Smits, R., and Clevers, H. (2001). APC, signal transduction and genetic instability in colorectal cancer. Nat Rev Cancer 1, 55-67. 256. Kaplan, K.B., Burds, A.A., Swedlow, J.R., Bekir, S.S., Sorger, P.K., and Nathke, I.S. (2001). A role for the Adenomatous Polyposis Coli protein in chromosome segregation. Nature cell biology 3, 429-432. 257. Wassmann, K., and Benezra, R. (2001) Mitotic checkpoints: from yeast to cancer. Current opinion in genetics & development 11, 83-90. 258. Michel, L.S., Liberal, V., Chatterjee, A ., Kirchwegger, R., Pasche, B., Gerald, W., Dobles, M., Sorger, P.K., Murty, V.V., and Benezra, R. (2001). MAD2 haploinsufficiency causes premature anapha se and chromosome instability in mammalian cells. Nature 409, 355-359. 259. Dai, W., Wang, Q., Liu, T., Swamy, M ., Fang, Y., Xie, S., Mahmood, R., Yang, Y.M., Xu, M., and Rao, C.V. (2004). Slippa ge of mitotic arrest and enhanced tumor development in mice with BubR1 haploinsufficiency. Cancer research 64, 440-445. 260. Babu, J.R., Jeganathan, K.B., Baker, D.J., Wu, X., Kang-Decker, N., and van Deursen, J.M. (2003). Rae1 is an essent ial mitotic checkpoint regulator that cooperates with Bub3 to prevent chromosome missegreg ation. The Journal of cell biology 160, 341-353. 261. Weaver, B.A., and Cleveland, D.W. (2007) Aneuploidy: instig ator and inhibitor of tumorigenesis. Cancer research 67 10103-10105.

PAGE 164

149 262. Weaver, B.A., Bonday, Z.Q., Putkey, F.R ., Kops, G.J., Silk, A.D., and Cleveland, D.W. (2003). Centromere-associated prot ein-E is essential for the mammalian mitotic checkpoint to prevent aneuploi dy due to single chromosome loss. The Journal of cell biology 162 551-563. 263. Weaver, B.A., Silk, A.D., Montagna, C ., Verdier-Pinard, P., and Cleveland, D.W. (2007). Aneuploidy acts both oncogenically and as a tumor suppressor. Cancer cell 11, 25-36. 264. Boveri, T. (1902). Ueber mehrpolige Mitosen als mittel zur Analyse des Zellkerns. Vehr. d. phys. med. Ges. zu Wurzburg NF (available in English translation at http://8e.devbio.com /article.php?ch=4&id=24) 265. Boveri, T. (1914). Zur Frage der Entstehung maligner Tumoren. Translation Boveri M. The origin of malignant tumors. Baltimore: Williams and Wilkins; 1929. 266. Hansemann, D.v. (1890). Ueber asymmetr ische Zelltheilung in Epithelkrebsen und deren biologische Bedeutung. Virchows Arch Path Anat 119, 299-326. 267. Vogelstein, B., Fearon, E.R., Hamilton, S.R., Kern, S.E., Preisinger, A.C., Leppert, M., Nakamura, Y., White, R., Smits, A.M., and Bos, J.L. (1988). Genetic alterations during colorectal-tumor deve lopment. The New England journal of medicine 319, 525-532. 268. Zimonjic, D., Brooks, M.W., Popescu, N., Weinberg, R.A., and Hahn, W.C. (2001). Derivation of human tumor cells in vitro without widespread genomic instability. Cancer research 61, 8838-8844. 269. Duesberg, P., Li, R., Fabarius, A., and Hehlmann, R. ( 2006). Aneuploidy and cancer: from correlation to causati on. Contributions to microbiology 13, 16-44. 270. Li, R., Yerganian, G., Duesberg, P., Kr aemer, A., Willer, A., Rausch, C., and Hehlmann, R. (1997). Aneuploidy correlated 100% with chemical transformation of Chinese hamster cells. Proceedings of the National Academy of Sciences of the United States of America 94, 14506-14511. 271. Hahn, W.C., Counter, C.M., Lundberg, A. S., Beijersbergen, R.L., Brooks, M.W., and Weinberg, R.A. (1999). Creation of hu man tumour cells with defined genetic elements. Nature 400, 464-468. 272. Loeb, L.A. (1991). Mutator phenotype may be required for multistage carcinogenesis. Cancer research 51, 3075-3079. 273. Shih, I.M., Zhou, W., Goodman, S.N., Lengauer, C., Kinzler, K.W., and Vogelstein, B. (2001). Evidence that genetic instability occurs at an early stage of colorectal tumorigenesis. Cancer research 61, 818-822. 274. Ried, T., Heselmeyer-Haddad, K., Blege n, H., Schrock, E., and Auer, G. (1999). Genomic changes defining the genesis, progression, and malignancy potential in solid human tumors: a phenotype/genotype correlation. Genes, chromosomes & cancer 25, 195-204. 275. Mertens, F., Johansson, B., and Mite lman, F. (1994). Isochromosomes in neoplasia. Genes, chromosomes & cancer 10, 221-230. 276. Cahill, D.P., Lengauer, C., Yu, J., Riggi ns, G.J., Willson, J.K., Markowitz, S.D., Kinzler, K.W., and Vogelstein, B. (1998). Mutations of mito tic checkpoint genes in human cancers. Nature 392, 300-303.

PAGE 165

150 277. Sotillo, R., Hernando, E., Diaz-Rodrigu ez, E., Teruya-Feldstein, J., CordonCardo, C., Lowe, S.W., and Benezra, R. (2007). Mad2 overexpression promotes aneuploidy and tumorigenesis in mice. Cancer Cell 11, 9-23. 278. Dominguez, A., Ramos-Morales, F., Ro mero, F., Rios, R.M., Dreyfus, F., Tortolero, M., and Pintor-Toro, J.A. ( 1998). hpttg, a human homologue of rat pttg, is overexpressed in hematopoietic neoplasms. Evidence for a transcriptional activation function of hPTTG. Oncogene 17, 2187-2193. 279. Heaney, A.P., Singson, R., McCabe, C.J., Nelson, V., Nakashima, M., and Melmed, S. (2000). Expression of pitu itary-tumour transforming gene in colorectal tumours. Lancet 355, 716-719. 280. Saez, C., Japon, M.A., Ramos-Morales, F., Romero, F., Segura, D.I., Tortolero, M., and Pintor-Toro, J.A. (1999). hpttg is over-expressed in pi tuitary adenomas and other primary epithelial neoplasias. Oncogene 18, 5473-5476. 281. Torii, S., Nakayama, K., Yamamoto, T ., and Nishida, E. (2004). Regulatory mechanisms and function of ERK MAP kinases. J Biochem (Tokyo) 136, 557561. 282. Treisman, R. (1996). Regulation of tr anscription by MAP kinase cascades. Curr Opin Cell Biol 8, 205-215. 283. Morice, C., Nothias, F., Konig, S., Vernie r, P., Baccarini, M., Vincent, J.D., and Barnier, J.V. (1999). Raf-1 and B-Raf prot eins have similar regional distributions but differential subcellular localizati on in adult rat brain. Eur J Neurosci 11, 19952006. 284. Hayne, C., Tzivion, G., and Luo, Z. (2000). Raf-1/MEK/MAPK pathway is necessary for the G2/M transition in duced by nocodazole. The Journal of biological chemistry 275, 31876-31882. 285. Ziogas, A., Lorenz, I.C., Moelling, K., a nd Radziwill, G. (1998). Mitotic Raf-1 is stimulated independently of Ras and is active in the cytoplasm. The Journal of biological chemistry 273, 24108-24114. 286. Hoffman, D.B., Pearson, C.G., Yen, T.J ., Howell, B.J., and Salmon, E.D. (2001). Microtubule-dependent change s in assembly of microt ubule motor proteins and mitotic spindle checkpoint proteins at Pt K1 kinetochores. Molecular biology of the cell 12, 1995-2009. 287. Kumar, R., Angelini, S., Czene, K., Sauroja, I., Hahka-Kemppinen, M., Pyrhonen, S., and Hemminki, K. (2003). BRAF muta tions in metastatic melanoma: a possible association with clinical outcome. Clin Cancer Res 9, 3362-3368. 288. Libra, M., Malaponte, G., Navolanic, P.M ., Gangemi, P., Bevelacqua, V., Proietti, L., Bruni, B., Stivala, F., Mazzarino, M.C., Travali, S., et al. (2005). Analysis of BRAF mutation in primary and metastatic melanoma. Cell Cycle 4, 1382-1384. 289. Nikiforova, M.N., Kimura, E.T., Gandhi M., Biddinger, P.W., Knauf, J.A., Basolo, F., Zhu, Z., Giannini, R., Salvat ore, G., Fusco, A., et al. (2003). BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas aris ing from papillary carcinomas. J Clin Endocrinol Metab 88, 5399-5404. 290. Singer, G., Oldt, R., 3rd, Cohen, Y., Wang, B.G., Sidransky, D., Kurman, R.J., and Shih Ie, M. (2003). Mutations in BRAF and KRAS characterize the

PAGE 166

151 development of low-grade ovarian ser ous carcinoma. J Natl Cancer Inst 95, 484486. 291. Young, J., Barker, M.A., Simms, L.A., Walsh, M.D., Biden, K.G., Buchanan, D., Buttenshaw, R., Whitehall, V.L., Arnold, S., Jackson, L., et al. (2005). Evidence for BRAF mutation and variable levels of microsatellite instability in a syndrome of familial colorectal cancer. Clin Gastroenterol Hepatol 3, 254-263. 292. Satyamoorthy, K., Li, G., Gerrero, M.R., Brose, M.S., Volpe, P., Weber, B.L., Van Belle, P., Elder, D.E., and Herlyn, M. (2003). Constitutive mitogen-activated protein kinase activation in melanoma is mediated by both BRAF mutations and autocrine growth factor stimulation. Cancer Res 63, 756-759. 293. Calipel, A., Lefevre, G., Pouponnot, C ., Mouriaux, F., Eychene, A., and Mascarelli, F. (2003). Mutation of B-Ra f in human choroidal melanoma cells mediates cell proliferation and transf ormation through the MEK/ERK pathway. J Biol Chem. 294. Karasarides, M., Chiloeches, A., Hayward, R., Niculescu-Duvaz, D., Scanlon, I., Friedlos, F., Ogilvie, L., Hedley, D., Mart in, J., Marshall, C.J., et al. (2004). BRAF is a therapeutic target in melanoma. Oncogene 23, 6292-6298. 295. Hoeflich, K.P., Gray, D.C., Eby, M.T., Ti en, J.Y., Wong, L., Bower, J., Gogineni, A., Zha, J., Cole, M.J., Stern, H.M., et al. (2006). Oncogenic BRAF is required for tumor growth and maintenance in melanoma models. Cancer Res 66, 9991006. 296. Sharma, A., Trivedi, N.R., Zimmerman, M.A., Tuveson, D.A., Smith, C.D., and Robertson, G.P. (2005). Mutant V599EB-R af regulates growth and vascular development of malignant melanoma tumors. Cancer Res 65, 2412-2421. 297. Bhatt, K.V., Hu, R., Spofford, L.S ., and Aplin, A.E. (2007). Mutant B-RAF signaling and cyclin D1 regulate Cks1/S -phase kinase-ass ociated protein 2mediated degradation of p27Kip1 in human melanoma cells. Oncogene 26, 10561066. 298. Bhatt, K.V., Spofford, L.S., Aram, G. McMullen, M., Pumiglia, K., and Aplin, A.E. (2005). Adhesion control of cyclin D1 and p27Kip1 levels is deregulated in melanoma cells through BRAFMEK-ERK signaling. Oncogene 24, 3459-3471. 299. Boisvert-Adamo, K., and Aplin, A.E. (2006). B-RAF and PI-3 kinase signaling protect melanoma cells from anoikis. Oncogene 25, 4848-4856. 300. Boisvert-Adamo, K., and Aplin, A.E. (2008). Mutant B-RAF mediates resistance to anoikis via Bad and Bim. Oncogene 27, 3301-3312. 301. Risques, R.A., Moreno, V., Ribas, M., Marcuello, E., Capella, G., and Peinado, M.A. (2003). Genetic pathways and genome-wide determinants of clinical outcome in colorectal cancer. Cancer research 63, 7206-7214. 302. Zhou, W., Goodman, S.N., Ga lizia, G., Lieto, E., Ferrar accio, F., Pignatelli, C., Purdie, C.A., Piris, J., Morris, R., Harris on, D.J., et al. (2002). Counting alleles to predict recurrence of early-stage colorectal cancers. Lancet 359 219-225. 303. Fukasawa, K. (2007). Oncogenes and tum our suppressors take on centrosomes. Nat Rev Cancer 7, 911-924. 304. Bastian, B.C., LeBoit, P.E., Hamm, H., Brocker, E.B., and Pinkel, D. (1998). Chromosomal gains and losses in prim ary cutaneous melanomas detected by comparative genomic hybridization. Cancer Res 58, 2170-2175.

PAGE 167

152 305. Bastian, B.C., Olshen, A.B., LeBoit, P.E., and Pinkel, D. (2003). Classifying melanocytic tumors based on DNA copy number changes. Am J Pathol 163 1765-1770. 306. Cui, Y., and Guadagno, T.M. (2008). B-Raf(V600E) signaling deregulates the mitotic spindle checkpoint through stabil izing Mps1 levels in melanoma cells. Oncogene 27, 3122-3133. 307. Colanzi, A., Deerinck, T.J., Ellisman, M.H., and Malhotra, V. (2000). A specific activation of the mitogen-activated protein kinase kinase 1 (MEK1) is required for Golgi fragmentation during mitosi s. The Journal of cell biology 149, 331-339. 308. Wu, C., Lai, C.F., and Mobley, W.C. (2001). Nerve growth factor activates persistent Rap1 signaling in endosomes. J Neurosci 21, 5406-5416. 309. Huo, L.J., Yu, L.Z., Liang, C.G., Fan, H.Y., Chen, D.Y., and Sun, Q.Y. (2005). Cell-cycle-dependent subcellu lar localization of cyclin B1, phosphorylated cyclin B1 and p34cdc2 during oocyte meiotic maturation and fertilization in mouse. Zygote 13, 45-53. 310. Abrieu, A., Magnaghi-Jaulin, L., Kahana, J.A., Peter, M., Castro, A., Vigneron, S., Lorca, T., Cleveland, D.W., and Labbe J.C. (2001). Mps1 is a kinetochoreassociated kinase essential for the vertebrate mitotic checkpoint. Cell 106 83-93. 311. Stucke, V.M., Sillje, H.H., Arnaud, L., and Nigg, E.A. (2002). Human Mps1 kinase is required for the spindle a ssembly checkpoint but not for centrosome duplication. Embo J 21, 1723-1732. 312. Borysova, M.K., Cui, Y., Snyder, M., and Guadagno, T.M. (2008). Knockdown of B-Raf impairs spindle formation and the mitotic checkpoint in human somatic cells. Cell Cycle 7, 2894-2901. 313. Chen, R.H. (2004). Phosphorylation and activation of Bub1 on unattached chromosomes facilitate the spindle checkpoint. Embo J 23, 3113-3121. 314. Diaz-Rodriguez, E., Sotillo, R., Schvartzman, J.M., and Benezra, R. (2008). Hec1 overexpression hyperactivates the mito tic checkpoint a nd induces tumor formation in vivo. Proceedings of the National Academy of Sciences of the United States of America 105, 16719-16724. 315. Salvatore, G., De Falco, V., Salerno, P., Nappi, T.C., Pepe, S., Troncone, G., Carlomagno, F., Melillo, R.M., Wilhelm, S.M., and Santoro, M. (2006). BRAF is a therapeutic target in aggressive thyroid carcinoma. Clin Cancer Res 12 16231629. 316. Giancotti, F.G., and Tarone, G. (2003). Positional control of ce ll fate through joint integrin/receptor protein kinase signaling. Annual review of cell and developmental biology 19 173-206. 317. Frisch, S.M., and Francis, H. (1994) Disruption of epithelial cell-matrix interactions induces apoptosi s. The Journal of cell biology 124 619-626. 318. Kunz, M., and Ibrahim, S.M. (2003). Molecular responses to hypoxia in tumor cells. Molecular cancer 2, 23. 319. Kumar, S.M., Yu, H., Edwards, R., Chen, L., Kazianis, S., Brafford, P., Acs, G., Herlyn, M., and Xu, X. (2007). Mutant V600E BRAF increases hypoxia inducible factor-1alpha expression in melanoma. Cancer research 67, 3177-3184.

PAGE 168

153 320. Conner, S.R., Scott, G., and Aplin, A.E. (2003). Adhesion-depe ndent activation of the ERK1/2 cascade is by-passed in mela noma cells. The Journal of biological chemistry 278, 34548-34554. 321. Vance, K.W., and Goding, C.R. (2004). The transcription network regulating melanocyte development and melanoma. Pigment cell research / sponsored by the European Society for Pigment Cell Resear ch and the International Pigment Cell Society 17, 318-325. 322. Goodall, J., Wellbrock, C., Dexter, T.J ., Roberts, K., Marais, R., and Goding, C.R. (2004). The Brn-2 transcription fact or links activated BRAF to melanoma proliferation. Molecu lar and cellular biology 24, 2923-2931. 323. Bornstein, G., Bloom, J., Sitry-Shev ah, D., Nakayama, K., Pagano, M., and Hershko, A. (2003). Role of the SCFSkp2 ubi quitin ligase in the degradation of p21Cip1 in S phase. The Journa l of biological chemistry 278, 25752-25757. 324. Carrano, A.C., Eytan, E., Hershko, A., and Pagano, M. (1999). SKP2 is required for ubiquitin-mediated degradation of th e CDK inhibitor p27. Nature cell biology 1, 193-199. 325. Kamura, T., Hara, T., Kotoshiba, S., Yada, M., Ishida, N., Imaki, H., Hatakeyama, S., Nakayama, K., and Na kayama, K.I. (2003). Degradation of p57Kip2 mediated by SCFSkp2-dependent ubiquitylation. Proceedings of the National Academy of Sciences of the United States of America 100, 1023110236. 326. Mendez, J., Zou-Yang, X.H., Kim, S.Y., Hidaka, M., Tansey, W.P., and Stillman, B. (2002). Human origin recognition co mplex large subunit is degraded by ubiquitin-mediated proteolysis after init iation of DNA replication. Molecular cell 9, 481-491. 327. Nakayama, K., Nagahama, H., Minamish ima, Y.A., Matsumoto, M., Nakamichi, I., Kitagawa, K., Shirane, M., Tsunemats u, R., Tsukiyama, T., Ishida, N., et al. (2000). Targeted disruption of Skp2 resu lts in accumulation of cyclin E and p27(Kip1), polyploidy and centrosome ove rduplication. The EMBO journal 19, 2069-2081. 328. Tsvetkov, L.M., Yeh, K.H., Lee, S.J., Sun, H., and Zhang, H. (1999). p27(Kip1) ubiquitination and degrada tion is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Curr Biol 9, 661-664. 329. Hu, R., and Aplin, A.E. (2008). Skp2 regulates G2/M progression in a p53dependent manner. Molecular biology of the cell 19, 4602-4610. 330. Hanahan, D., and Weinberg, R.A. ( 2000). The hallmarks of cancer. Cell 100 5770. 331. Frasca, F., Nucera, C., Pellegriti, G., Gangemi, P., Attard, M., Stella, M., Loda, M., Vella, V., Giordano, C., Trimarchi, F., et al. (2008). BRAF(V600E) mutation and the biology of papillary thyroid cancer. Endocrine-related cancer 15, 191-205. 332. Mesa, C., Jr., Mirza, M., Mitsutake, N., Sartor, M., Medvedovic, M., Tomlinson, C., Knauf, J.A., Weber, G.F., and Fagi n, J.A. (2006). Conditional activation of RET/PTC3 and BRAFV600E in thyroid cells is associated with gene expression profiles that predict a preferential role of BRAF in extracellular matrix remodeling. Cancer research 66, 6521-6529.

PAGE 169

154 333. Coussens, L.M., Fingleton, B., and Matrisian, L.M. (2002). Matrix metalloproteinase inhibitors and cancer: trials and tribulations. Science (New York, N.Y 295 2387-2392. 334. Klein, R.M., Spofford, L.S., Abel, E.V ., Ortiz, A., and Aplin, A.E. (2008). B-RAF regulation of Rnd3 participates in ac tin cytoskeletal and focal adhesion organization. Molecular biology of the cell 19, 498-508. 335. *Cui, Y., *Borysova, M.E., Guadagno, T.M. (*authors contributed equally to this work) (Under Review). Oncogenic B-Ra fV600E induces spindle abnormalities, supernumerary centrosomes, and aneuploi dy in human melanocytic cells. PNAS. 336. Mitsutake, N., Knauf, J.A., Mitsutake, S., Mesa, C., Jr., Zhang, L., and Fagin, J.A. (2005). Conditional BRAFV600E expression induces DNA synthesis, apoptosis, dedifferentiation, and chromosomal instab ility in thyroid PCCL3 cells. Cancer research 65, 2465-2473. 337. Ford, J.H., Schultz, C.J., and Correll, A.T. (1988). Chromosome elimination in micronuclei: a common cause of hypoploidy. Am erican journal of human genetics 43, 733-740. 338. Denko, N.C., Giaccia, A.J., Stringer, J. R., and Stambrook, P.J. (1994). The human Ha-ras oncogene induces genomic instability in murine fibroblasts within one cell cycle. Proceedings of the National Academ y of Sciences of the United States of America 91, 5124-5128. 339. Saavedra, H.I., Knauf, J.A., Shirokawa, J.M., Wang, J., Ouyang, B., Elisei, R., Stambrook, P.J., and Fagin, J.A. (2000) The RAS oncogene induces genomic instability in thyroid PCCL3 cells via the MAPK pathway. Oncogene 19, 39483954. 340. Hernando, E., Nahle, Z., Juan, G., Diaz-Rodriguez, E., Alaminos, M., Hemann, M., Michel, L., Mittal, V., Gerald, W., Ben ezra, R., et al. (20 04). Rb inactivation promotes genomic instability by uncoupling cell cycle progression from mitotic control. Nature 430, 797-802. 341. Michaloglou, C., Vredeveld, L.C., Mooi, W.J., and Peeper, D.S. (2008). BRAF(E600) in benign and maligna nt human tumours. Oncogene 27, 877-895. 342. Michaloglou, C., Vredeveld, L.C., Soe ngas, M.S., Denoyelle, C., Kuilman, T., van der Horst, C.M., Majoor, D.M., Sha y, J.W., Mooi, W.J., and Peeper, D.S. (2005). BRAFE600-associated senescence-lik e cell cycle arrest of human naevi. Nature 436, 720-724. 343. Smalley, K.S., and Flaherty, K.T. (2009) Integrating BRAF/MEK inhibitors into combination therapy for melanoma. British journal of cancer 100, 431-435. 344. da Rocha Dias, S., Friedlos, F., Light, Y., Springer, C., Workman, P., and Marais, R. (2005). Activated B-RAF is an Hsp90 c lient protein that is targeted by the anticancer drug 17-allylamino-17-demethoxygeldanamycin. Cancer research 65, 10686-10691. 345. Fukuyo, Y., Inoue, M., Nakajima, T., Higa shikubo, R., Horikoshi, N.T., Hunt, C., Usheva, A., Freeman, M.L., and Horikoshi, N. (2008). Oxidative stress plays a critical role in inactivating mutant BRA F by geldanamycin derivatives. Cancer research 68, 6324-6330.

PAGE 170

155 346. Gascoigne, K.E., and Taylor, S.S. (2008) Cancer cells display profound intraand interline variation following prolonge d exposure to antimitotic drugs. Cancer cell 14, 111-122. 347. Desai, A., Murray, A., Mitchison, T.J ., and Walczak, C.E. (1999). The use of Xenopus egg extracts to study mitotic spindle assembly and function in vitro. Methods Cell Biol 61, 385-412.

PAGE 171

ABOUT THE AUTHOR Meghan Borysova was born in Chicago, Illinois in 1973. She grew up in Michigan and in 1994, she moved to Tucson, Arizona where she began her scientific career. Meghan received her Bachelors degree in Molecu lar and Cellular Biology from the University of Arizona where she worked as a researcher for eight years. In 2003, Meghan moved to Tampa entering Moffitt Cancer Centers Cancer Biology, Ph.D. program in 2004. Imaging is Meghans favorite scientific medium. Meghan is a wife and devoted mother. Meghan and her family enjoy long walks on the waterfront, gardening, and going to park s. Meghan and her husband enjoy the arts and exploring new foods. Meghan loves to ba ke, write in the childrens journals, run a Mommy listserv, and read about science and politics. Meghans future plans are to develop a car eer in Cancer Imaging and to enjoy her enriching, fulfilling family life.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 2200397Ka 4500
controlfield tag 001 002029124
005 20091009123359.0
007 cr mnu|||uuuuu
008 090916s2009 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0002899
035
(OCoLC)436873091
040
FHM
c FHM
049
FHMM
090
RC254.6 (Online)
1 100
Borysova, Meghan E. K.
0 245
Novel roles for B-Raf in mitosis and cancer
h [electronic resource] /
by Meghan E. K. Borysova.
260
[Tampa, Fla] :
b University of South Florida,
2009.
500
Title from PDF of title page.
Document formatted into pages; contains 155 pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2009.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
3 520
ABSTRACT: The MAP kinase pathway is well known for its key roles in regulating cell proliferation and cell cycle progression. MAP kinases have also been implicated in mitotic functions, however these functions are less-well understood. Recent studies from our laboratory used Xenopus egg extracts to identify B-Raf as an essential activator of the MAPK cascade during mitosis. Therefore, the first objective of my dissertation research was to determine if B-Raf has functional significance during mitosis in human somatic cells. Using RNA interference against B-Raf and various immunofluorescence techniques, I show that B-Raf: (1) localizes to and is phosphorylated at a key mitotic structure, (2) is critical for proper mitotic spindle assembly and chromatin congression, (3) is important for the engagement of microtubules with kinetochores during mitosis, and (4) is necessary for activation of the spindle assembly checkpoint. It has been demonstrated that B-Raf is a prominent oncogene, constitutively activated in the vast majority of melanomas and other cancers. I hypothesized that oncogenic B-Raf expression perturbs mitosis and causes aneuploidy. First, we show that oncogenic B-Raf expression correlates with mitotic abnormalities in human melanoma cells and that spindle defects are induced when oncogenic B-Raf is ectopically expressed. Further, using FISH and karyotype analysis, I demonstrate that oncogenic B-Raf drives aneuploidy and chromosome instability in primary, immortalized, and tumor cells. In summary, my dissertation studies elucidate novel roles for B-Raf in mammalian mitosis. In addition, my studies show for the first time that oncogenic B-Raf disrupts mitosis causing chromosomal instability. I propose that oncogenic B-Raf-induced chromosome instability contributes to tumorigenesis.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor: Thomas M. Guadagno, Ph.D.
653
SiRNA
Spindle
Centrosome
Kinetochores
Aneuploidy
690
Dissertations, Academic
z USF
x Cancer Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.2899