USF Libraries
USF Digital Collections

Identification and characterization of mitochondrial genome concatemers in AIDS-associated lymphomas and lymphoma cell lines

MISSING IMAGE

Material Information

Title:
Identification and characterization of mitochondrial genome concatemers in AIDS-associated lymphomas and lymphoma cell lines
Physical Description:
xi, 115 leaves : ill.(some col.) ; 28 cm.
Language:
English
Creator:
Bedoya, Felipe
Publication Date:

Subjects

Subjects / Keywords:
Lymphoma, AIDS-Related -- genetics   ( mesh )
Lymphoma, AIDS-Related -- pathology   ( mesh )
DNA, Mitochondrial -- genetics   ( mesh )
DNA Primers   ( mesh )
Cell Line, Tumor   ( mesh )
Base Sequence   ( mesh )
Microscopy, Electron   ( mesh )
Polymerase Chain Reaction   ( mesh )
Mitochondrial DNA
AIDS-related lymphomas
Oncogenic transformation
Leukemogenesis
Mitochondria
Dissertations, Academic -- Molecular Medicine -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: Despite recent advances in the understanding of the molecular bases of hematological malignancies, the specific mechanisms on how they originate and why some subtypes are more prevalent than others still remain to be elucidated. These two important aspects have been even more difficult to analyze when dealing with individuals under immune suppression because other factors must be considered. Questions still remain as to why individuals with AIDS tend to develop lymphoproliferative disorders differently from those observed in individuals under iatrogenic immunosuppressive therapy. Most of lymphomas occurring in transplant recipients are B-cell neoplasias typically associated with Epstein-Barr virus (EBV) infection. In contrast, only about 50% of lymphomas of patients with AIDS are associated with lymphotrophic herpesviruses such as EBV and Kaposi's sarcoma-associated herpesvirus (KSHV).No known infectious agent has been detected in the remaining 50% of AIDS-associated lymphomas, suggesting the involvement of novel viruses or unique molecular mechanisms. Since most oncogenic viruses persist as episomal circular viral genomes in the nuclei of tumor cells, we developed a method to visualize and identify covalently closed circular DNA (cccDNA) in lymphoma samples. Although this study revealed no novel viruses, we identified concatemers of the mitochondrial genome in all lymphoma samples tested. We further studied in detail one AIDS-associated lymphoma (denominated EL) whose mitochondrial DNA primarily consisted of tandem head-to-tail genome duplications. Insertion of cytosine residues was noted in the EL mitochondrial genome sequence near the origin of replication. EL cells responded weakly to Fas-apoptotic stimulus, displayed reduced mitochondrial activity and mass, and produced higher levels of reactive oxygen species (ROS) than control cells.Screening of several other AIDS-associated lymphomas and established lymphoma cell lines revealed a different kind of mitochondrial genome concatemers consisting of interlinks of DNA monomer molecules. Concatemers were not detected in normal T-lymphocytes suggesting an association with neoplastic transformation. This dissertation describes the two distinct types of mitochondrial genome concatemers identified in transformed lymphoid cells and presents a detailed analysis of their structure and implications in cellular homeostasis.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2009.
Bibliography:
Includes bibliographical references.
Statement of Responsibility:
by Felipe Bedoya.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002068009
oclc - 601820902
usfldc doi - E14-SFE0003030
usfldc handle - e14.3030
System ID:
SFS0027347:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader ntm 2200397Ka 4500
controlfield tag 001 002068009
005 20100406144508.0
008 100406s2009 xx a b 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003030
035
(OCoLC)601820902
040
FHJ
c FHJ
049
FHJA
096
WH 525
b B412i 2009
1 100
Bedoya, Felipe.
0 245
Identification and characterization of mitochondrial genome concatemers in AIDS-associated lymphomas and lymphoma cell lines /
by Felipe Bedoya.
260
2009.
300
xi, 115 leaves :
ill.(some col.) ;
28 cm.
500
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2009.
504
Includes bibliographical references.
590
Advisor: Peter Medveczky, M.D.
520
ABSTRACT: Despite recent advances in the understanding of the molecular bases of hematological malignancies, the specific mechanisms on how they originate and why some subtypes are more prevalent than others still remain to be elucidated. These two important aspects have been even more difficult to analyze when dealing with individuals under immune suppression because other factors must be considered. Questions still remain as to why individuals with AIDS tend to develop lymphoproliferative disorders differently from those observed in individuals under iatrogenic immunosuppressive therapy. Most of lymphomas occurring in transplant recipients are B-cell neoplasias typically associated with Epstein-Barr virus (EBV) infection. In contrast, only about 50% of lymphomas of patients with AIDS are associated with lymphotrophic herpesviruses such as EBV and Kaposi's sarcoma-associated herpesvirus (KSHV).No known infectious agent has been detected in the remaining 50% of AIDS-associated lymphomas, suggesting the involvement of novel viruses or unique molecular mechanisms. Since most oncogenic viruses persist as episomal circular viral genomes in the nuclei of tumor cells, we developed a method to visualize and identify covalently closed circular DNA (cccDNA) in lymphoma samples. Although this study revealed no novel viruses, we identified concatemers of the mitochondrial genome in all lymphoma samples tested. We further studied in detail one AIDS-associated lymphoma (denominated EL) whose mitochondrial DNA primarily consisted of tandem head-to-tail genome duplications. Insertion of cytosine residues was noted in the EL mitochondrial genome sequence near the origin of replication. EL cells responded weakly to Fas-apoptotic stimulus, displayed reduced mitochondrial activity and mass, and produced higher levels of reactive oxygen species (ROS) than control cells.Screening of several other AIDS-associated lymphomas and established lymphoma cell lines revealed a different kind of mitochondrial genome concatemers consisting of interlinks of DNA monomer molecules. Concatemers were not detected in normal T-lymphocytes suggesting an association with neoplastic transformation. This dissertation describes the two distinct types of mitochondrial genome concatemers identified in transformed lymphoid cells and presents a detailed analysis of their structure and implications in cellular homeostasis.
2 650
Lymphoma, AIDS-Related
x genetics.
Lymphoma, AIDS-Related
pathology.
DNA, Mitochondrial
genetics.
DNA Primers.
Cell Line, Tumor.
Base Sequence.
Microscopy, Electron.
Polymerase Chain Reaction.
653
Mitochondrial DNA
AIDS-related lymphomas
Oncogenic transformation
Leukemogenesis
Mitochondria
690
Dissertations, Academic
z USF
Molecular Medicine
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3030



PAGE 1

Identification and Characterization o f Mi tochondrial Genome Concatemers i n AIDS A ssociated Lymphomas and Lymphoma Cell Lines by Felipe Bedoya A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Peter Medveczky M.D. Burt Anderson, Ph.D. George Blanck, Ph.D. Edward Seto, Ph.D Date of Approval: June 5, 2009 Keywords: mitochondrial DNA AIDS rel ated lymphomas, oncogenic transformation, leukemog enesis, mitochondria. Copyright 2009 Felipe Bedoya

PAGE 2

Acknowledgements I would like to dedicate this work to all the people who have led me to and through this wonderful and exciting path of scientific research. I want to give special thanks to my mentor Peter Medveczky who has guided me throughout t his project, and from whom I have learned not only some of the fundamental techniques in molecular biology, but also the skills necessary for research conduct scientific writing and data analysis. I want to thank also Maria Medveczky for always being hel pful and for sharing with me her technical knowledge and expertise. Working in their laboratory and sharing with them both ( and their laboratory members ) these past three years has been one of the most enjoyable experiences I have ever had. I am very gra teful with my committee members Drs. Burt Anderson, George Blanck and Edward Seto for their advice and construct ive criticism of my project. Finally, I want to express my gratitu de to all the professors, students and staff whom I have interacted with duri ng my graduate studies They have been essential in my getting to the point where I am now.

PAGE 3

i Table of Contents List of Tables ...................................................................................................... v List of Figures .................................................................................................... v i List of Abbreviations ........................................................................................ v i ii Abstract .............................................................................................................. x Introduction ......................................................................................................... 1 AIDS Associated Lymphomas ................................................................. 1 Mitochondria ............................................................................................ 4 The Mitochondrial G enome ...................................................................... 6 Particularities of the Mitochondrial G enome ............................................ 9 Polyploidy ...................................................................................... 9 Non M endelian (M aternal ) I nheritance .......................................... 9 Evolution R ate ............................................................................. 10 Divergent Genetic C ode .............................................................. 10 Gene O rganization ...................................................................... 11 Mitochondrial DNA T ranscription ........................................................... 14 Mitochondrial DNA Replication .............................................................. 16

PAGE 4

ii Oxidative P hosphorylation ..................................................................... 21 Mitochondrial DNA and C ancer ............................................................. 22 Objectives ......................................................................................................... 25 Materials and Methods ..................................................................................... 27 Primary AIDS Associated Ly mphomas and H uman T C ell Lymphoma Cell Lines ............................................................................ 27 Method for Detection of C ccDNA ........................................................... 27 Southern Blot A nalysis ........................................................................... 28 Synthesis of a 32P] ATP Radiolabeled Probe by 5 E nd L a beling of DNA O ligonucleot ide s ......................................................... 29 Isolation of CccDNA by Alkaline Cell L ysis and CsClEtBr G radient ................................................................................................. 30 C loni n g of Fragments from EL C ccDNA ................................................ 31 Electroporation of C ompetent E. coli and S election of T ransformants ........................................................................................ 32 PCR A nalysis ......................................................................................... 32 DNA S equencing ................................................................................... 35 Electron M icroscopy ............................................................................... 3 5 Flow Cytometry A nalysis fo r Characterization of EL C ells ..................... 36 Flow Cytometry Analysis of Mitochondrial F actors and P roperties .............................................................................................. 36 Mit ochondrial Membrane P otent ial .............................................. 36 Mitochondrial M ass ..................................................................... 37

PAGE 5

iii Production of ROS ...................................................................... 38 Glutathione Levels ...................................................................... 39 Fas I n d uced A poptosis ............................................................... 39 Immortali zation of Normal T C ells Using H erpesvirus saimiri ................ 40 Results ............................................................................................................. 41 Identification of a L arge CccDNA in an AIDS A ssociated L ymphoma (EL) that D oes N ot H ybridize with EBVor KSHVD erived P robes ........................................................................... 41 Phenotypic C haracterization of EL Cells by Flow C ytometry ................. 43 The EL C ccDNA Consists of M itochondrial DNA ................................... 43 The EL CccDNA is Formed by Tandem D uplicated Mitochondrial G enomes ......................................................................... 51 Cytosine Insertions are Present in the Control R egion of the EL Mi t ochondrial DNA ............................................................................ 54 F unctional and Structural M itochondrial Properties of EL C ells ............. 56 Mitochondrial Genome Concatemers are Present in P rimary AIDS Associated Lym p homas and Lymphoma Cell Lines ..................... 56 Mitochondrial Genome Concatemers are A ssociated with Oncogenic T ra nsformati on of Lymphoid C ells ....................................... 61 Statistical A nalysis ................................................................................. 61 Discussion ........................................................................................................ 64 Identification of Mitochondrial Genome C oncatemers in L ymphomas ........................................................................................... 64 Proposed Molecular M echanism s of MtDNA Concatemer F ormation ............................................................................................... 66

PAGE 6

iv Hom o logous Recombination of M tDNA ....................................... 66 MtDNA Replication ...................................................................... 69 C ytosine I nsertio n s in the MtDNA Control Region ................................. 74 Nucleoside A nalog ues Used in the T reatment of AIDS Affect MtDNA S tability ............................................................................ 75 Mitochondrial Genome Concatemers Influence C ellular and Mitochondrial F unctions .................................................................. 77 Increased C ellular ROS .............................................................. 79 Herpesvirus saimiri Immortalized H uman T C ells Contain M it ochondrial Genome C oncatemers ....................................... 80 Proposed Mechanism of Neoplastic T ransformation of Lymphoid C ells b y F ormation and M ai ntenance of M tDNA C oncatemers ............................................................................. 81 Summary and Future D irections ............................................................ 8 5 L iterature C ited ................................................................................................. 87 About the Author ................................................................................... End Page

PAGE 7

v List of Tables T able 1. Classification of AIDS Associated L ymphomas A ccording to WHO ........................................................................... 3 Table 2 Oligonucleotides Used for PCR A mplification and Sequencing of EL CccDNA and M tDNA of Normal T C ells. .............................................................................. 34 Table 3 DNA S equ encing R esults of EL C ccDNA C loning ........................................................................................... 49

PAGE 8

vi List of Figures Figure 1. The M itochondrion ........................................................................... 5 Figure 2. T he H uman M itochondrial G enome ................................................. 8 Figure 3. Schematic Representation of the Mammalian D L oop ................... 13 Figure 4. StrandDisplace ment Model of M ammali an M tDNA R eplication ..................................................................................... 18 Figure 5. StrandCoupled Model of Mammalian M tDNA R eplication ..................................................................................... 20 Figure 6. The Gardella Gel Technique and V isualization of Large C ccDNA in an AIDS Associated L ymphoma S ample (EL) ................................................................................... 42 Figure 7 Southern Blotting A nalysis of EL CccDNA Using Probes S pecific for B oth EBV and KSHV ....................................... 44 Figure 8 EL Cells are CD4+ T L ymphocytes ................................................ 45 Figure 9 Gel E lectrophoresis A nalysis of CsClEtBr Gradient Fractions of T otal EL DNA .............................................. 46 Fi gure 10. Schematic Representation of the M ethod P erf ormed for I solat ion and Analysis of EL C ccDNA ..................... 48 Figure 11. Gel Electrophoresis and Southern B lotting of Purified C ccDNA from EL and Normal T C ells Using MtDNA Derived P robes ....................................................... 50 Figure 12. Electron M icroscopy of EL C ccDNA .............................................. 52

PAGE 9

vii Figu re 1 3 Complete and Partial Bam HI Restriction Digestion of EL C ccDNA .................................................................................... 53 Figure 1 4 Multiple Sequence A lignment A nalysis of C onserved Sequence B ox II (CSBII) R egions from EL and Normal M tDNA ............................................................................... 55 Figure 15 Flow Cytometric Analysis of M itochondrial Physiological and S t ructural P roperties ......................................... 57 Figure 16. Mitochondrial Genome Concatemers are P resent in P rimary AIDS A ssociated L ymphomas and L ymphoma Cell L ines .................................................................... 58 Figure 17 Gel E lectrophoresis and Densitometric A na lyses of C ccDNA from H uman L ymph oma Cell L ines ............................. 60 Figure 18 Southern Blotting Assay of Gardella G el of Herpesvirus saimiri Immortalized T Cells Reveals the Presence of M it ochondrial Genome C oncatemers .................. 62 Figure 19. Densitometric Analysis of M itochondrial DNA from Herpesvirus sai miri I mmortalized and Normal T C ells ............................................................................... 6 3 Figure 20. Schematic Model of MtDNA Configurations Identified in AIDS A ssociated L ymp homas and L ymphoma Cell L ines .................................................................... 65 Figure 21. DNApoleveral Human Tissues and Human Cell L ines (GNF Human Gene Atlas) .................................................................................... 72 Figure 22 MtssB and Twinkle mRNA Levels in S everal H uman T issues and Human C ell L ines (GNF Human Gene Atlas) ............ 73 Figure 23. Inhibition of DNA Polymerase G amma by NRTIs (AZT) .................................................................................. 76 Figure 24 Schematic Diagram of Proposed M echani sm of I nduction of Oncogenic T ransformation by F ormation and M aintenance of M itochondrial G enome C oncatemers .................................................................. 84

PAGE 10

viii List of Abbreviations m Mitochondrial Transmembrane P otential AIDS Acquired Immunodeficiency S yndrome ATP A d enosine T riphosphate AZT Azidothymidine BLAST Basic Local Alignment Search T ool BSA Bovine Serum A lbumin CCC Covalently Closed C ircular CLL Chronic Lymphocytic Leukemi a CMV Cytomegalovirus CNS Central Nervous S ystem CSBII Conserved Sequence B ox II CsCl Cesium Chloride DHE Dihydroethidium DLBCL Diffuse Large B Cell L ymphoma DNA Deoxyribonucleic A cid DNAPOL DNA Polymerase G amma EDTA Ethylenediaminetetraacetic A cid EBV E psteinBarr V irus EtBr Ethidium B romide FCS Fetal C alf S erum HAART Highly Active Antiretroviral T herapy HIV Human Immunodeficiency V irus HL Hodgkins L ymphoma HVS Herpesvirus S aimiri IL Interleukin Kb Kilobases KSHV Kaposis SarcomaAssociated H erpesvirus MNGIE Mitochondrial Neurogastrointestinal E ncephalomyopathy MOI Multiplicity of I nfection MtDNA Mitochondrial DNA NaCl Sodium C hloride NAO 10N Nonyl Acridine O range

PAGE 11

ix NaOH Sodium H ydroxide NIH National Institutes of Health NHL Non Hodgkins L ymphoma OXPHOS Oxidative P hosphorylation PCR Polymerase Chain R eaction PBS Phospate Buffered S aline PEL Primary Effusion Lymphoma PEO Progressive External O phthalmoplegia PHA Phytohemagglutinin PTLD Post Transplant Lymphoproliferative D isorder RNA Ribonucleic A cid rRNA Ribosomal RNA ROS Reactive Oxygen S pecies RT Room T emperature SANDO S ensory Ataxia, Neuropathy, D ysarthria and O phthalmoparesis SDS Sodium Dodecyl S ulfate SNP Single Nucleotide P olymorphism TBE Tris B orateEDTA TE Tris EDTA TMRM Tetramethyl Rhodamine M e t hyl E ster tRNA Transfer RNA UV Ultraviolet WHO World Health Organization

PAGE 12

x Identification and Characterization of Mitochondrial Genome Concatemers in AIDS A ssociated Lymphomas and Lymphoma Cell Lines Felipe Bedoya ABSTRACT Despite recent advances i n the understanding of the molecular bases of hematological malignan cies the specific mechanisms on how they originate and why some subtypes are more prevalent than others still remain to be elucidated. These two important aspects have been even more dif ficult to analyze when dealing with individuals under immune suppression because other factors must be considered. Q uestions still remain as to w hy i ndividuals with AIDS tend to develop lymphoproliferative disorders differently from those observed in indi viduals under iatrogeni c immunosuppressive therapy. M ost of lymphomas occurring in t ransplant recipients are B cell neoplasias ty pically associated with EpsteinBarr virus (E BV) infection In contrast, only about 50% of lymphomas of patients with AIDS ar e associated with lymphotrophic herpesviruses such as EBV and Kaposis sarcomaassociated herpesvirus (KSHV). N o known infectious agent has been detected in the remaining 50% of

PAGE 13

xi AIDS associated lymphomas, suggesting the involvement of novel viruses or uni que molecular mechanisms. Since most oncogenic viruses persist as episomal circular viral genomes in the nuclei of tumor cells, we developed a method to visualize and identify covalently closed circular DNA (cccDNA) in lymphoma samples. Although this study revealed no novel viruses we identified concate mers of the mitochondrial genome in all lymphoma samples tested W e further studied in detail one AIDS associated lymphoma ( denominated EL) whose mitochondrial DNA primarily consisted of tandem headto ta il genome duplications. Insertion of cytosine residues was noted in the EL mitochondrial genome sequence near the origin of replication. EL cells responded weakly to Fas apoptotic stimulus, displayed reduced mitochondrial activity and mass, and produced higher levels of reactive oxygen species (ROS ) than control cells. Screening of several other AIDS associated ly mphomas and established lymphoma cell lines revealed a different kind of mitochondrial genome concatemers consisting of interlinks of DNA monom er molecules. C oncatemers were not detected in normal T lymphocytes suggesting an association with neoplastic transformation. This dissertation describes the two distinct types of mitochondrial genome concatemers identified in transformed lymphoid cells and presents a detailed analysis of their structure and i mplications in cellular homeostasis

PAGE 14

1 Introduction AIDS associated lymphomas After the acknowledgment of HIV as the causative agent of AIDS it was soon recognized that the incidence of l ymphoma in HIV infected patients greatly exceeded that in the general population. The relative risk of nonHodgkins lymphoma (NHL) is increased 60200 fold in individuals with AIDS ( 12, 58, 147) The increased risk of lymphoma has been attributed to mul tiple factors, including the capability of the retrovirus itself to induce transformation ( 86, 101) the cytokine dys regulation and immunosuppression associated with t he disease ( 28, 82) and the opportunistic infections caused by lymphotrophic herpesvir uses such as Epstein Barr virus (EBV) and Kaposis sarcoma associated herpes virus ( KSHV) (16, 89, 136, 209) Several AIDS associated lymphoma subtypes have been classified according to the heterogeneous morphol ogy observed in patients Th e WHO categorizes the HIV associated lymphomas into (1) those also occurring in immunocompetent patients, (2) those occurring more specifically in HIV positive patients, and (3) those also

PAGE 15

2 occurring in patients with other forms of immunosuppression (Table 1). Notably, th e majority of these lymphomas are aggressive B cell neoplasms that also occur in immunocompetent patients ( 17, 148) Highly active antiretr o viral therapy (HAART) has been reported to bot h increase and decrease the inci dence of different lymphoma subtype s. For example, immunoblastic d iffuse large B cell lymphoma ( DLBCL ) was reduced from 38% in the preHAART era to 19% in the post HAART era. Also, primary CNS lymphoma incidence decreased from 28% to 17%. However, this trend has not been observed in all AIDS related lymphomas, centroblastic DLBCL increased from 21% to 44% of cases, and Burkitts lymphoma increased from 4% to 9% ( 43, 135) Several studies have shown that the level of immunosuppression is also associated to the lymphoma subtype that develops in AIDS patients. For instance, Burkitts and centroblastic DLBCL are commonly diagnosed in partially immunodeficient individuals, whereas primary effusion lymphoma (PEL) and immunoblastic DLBCL are most often present in AIDS patients suffering from se vere immunodeficiency ( 16, 63)

PAGE 16

3 1) Lymphoma also occurring in immunocompromised patients Burkitt's and Burkitt's like lymphoma Diffuse large B cell lymphoma (DLBCL) Centroblastic Immunoblastic (including primary CNS lymphoma) Extranodal marginal zone lymphoma of MALT type Peripheral T cell lymphoma Classical Hodgkin's lymphoma (HL) 2) Lymphoma occurring more specifically in HIV positive patients Primary effusion lymphoma (PEL) Plasmablastic lymphoma of the oral cavity t ype 3) Lymphoma also occurring in other immunodeficiency states Polymorphic B cell lymphoma (PTLD like) Table 1. Classification of AIDS associated lymphomas according to WHO.

PAGE 17

4 Mitochondri a Mitochondria are semi autonomous subcellular organelles esse ntial for normal cell physiology and cellular homeostasis ( 196) M itochondria are the only organelles that contain their own genome and protein synthesis machinery p ossibly due to their pr okaryotic endosymbiont ancestry ( 98, 196) They are motile and undergo frequent changes in morphology and number through fusion and fission events. Even in the same cell, mitochondria can adopt a different range of morphologies ( 23, 42) It is in the m itochondria where many important metabolic reactions take place such as the urea cycle, lipid metabolism, steroid hormone and porphyrin synthesis and interconversion of amino acids ( 164, 195) Moreover, mitochondria play a centr al role in complex physiological processes including cellular proliferation, differentiation, apoptosis ( 60, 139, 150) and in cellular processes like glucose sensing, insulin regulation ( 15) cellular Ca2+ and ROS homeostasis ( 123, 176) Hence, it is not surprising that mitochondrial dysfunction has been associated with degenerative diseases, aging and cancer ( 30, 61, 155, 198)

PAGE 18

5 Figure 1. The mitochondrion. Diagram showing energy (ATP) production from oxidative phosphorylation (OXPHOS), reactive oxygen species (ROS) production, and initiation of apoptosis through the mitochondrial permeability transition pore (mtPTP). The OXPHOS complexes, designated I to V, are complex I (N ADH: ubiquinone oxidoreductase), complex II (succi nate: ubiquinone oxidoreductase), complex III (ubiquino l: cytochrome c oxidoreductase), co mplex IV (cytochrome c oxidase), and complex V (H+translocating ATP synthase). Pyruvate from glucose enters the mitochondria via pyruvate dehydrogenase (PDH), generating acetyl CoA, which enters the TCA cycle by combining with oxaloacetate. Lactate dehydrogenase (LDH) converts excess pyruvate to lactate. The voltagedependent anion channel (VDAC) allows passage of small molecules through the inner and outer membrane. VDAC together with ANT and Bax are thought to come together at the mitochondrial inner and outer membrane contact points to create the mitochondrial permeability transition pore ( mtPTP ) The mtPTP interacts with the proapoptotic Bax, anti apoptotic Bcl2 and the benzodiazepine receptor (BD). The opening of the mtPTP is associated with the release of cytochrome c (Cytc) and several proapoptotic factors that interact with and activate cytosolic Apaf 1, which then binds to and activates procaspase9. The act ivated caspase9 then initiates the proteolytic degradation of cellular proteins ending in apoptosis.

PAGE 19

6 The mitochondrial genome The mammalian mitochondrial genome is a covalently closed circular (ccc) duplex DNA (mtDNA) with species specific contour leng t and nucleotide composition range around 16 Kbp ( 41, 98) In humans, the mtDNA encodes 13 genes involved in the respiratory chain: 7 genes for complex I (NADHdehydrogenase ubiquinone reductase) : NADH dehydrogenase subunit 1 (ND1), ND2, ND3, ND4, ND4L, ND5 and ND6; 1 gene for complex III (ubiquinol cytochrome c reductase) : cytochrome b; 3 genes for complex IV (cytochrome c oxidase) : Cytochrome c oxidase subunit 1 (COX1), COX2 and COX3, and 2 genes for complex V (ATP synthetase) : ATPase6 and A tpase8 ( 1) The mtDNA also encodes 22 transfer RNAs, and two ribosomal RNAs known as 12S and 16S rRNAs, that are exclusive for the translation of th e 13 mtDNA protein coding genes All of the peptides and mature transcripts derived from the mtDNA are necessary for the proper function of the oxidative phosphorylation (OXPHOS) machinery, which is the main biochemical pathway for the synthesis of ATP ( 1, 197) In average, 20010,000 copies of mtDNA are present in a single cell depending on cell type and cellular energy demand. At birth, most (if not all) of

PAGE 20

7 the mtDNA copies are identical (homoplasmic) owing to their maternal origin ( 65, 108) However, degenerative cellular processes (i.e. ageing, disease, etc.) have been implicated in the causality of several mitochondrial and mtDNA abnormalities, and vice versa ( 42, 184, 198) U nlike nuclear DNA, the mtDNA is constantly turned over and replicated during the whole cell cycle in normal cells ( 77, 80) To date, a large number and ample variety of mt DNA mutations have been described, and over 200 human disorders are associated with specific point and frameshift mutations, fusions, partial deletions, or depletion of mtDNA. For instance, several mtDNA mutations have been reported recently in human col orectal cancers, and bladder, head, neck and lung tumors ( 14, 27, 30, 73, 95, 184) C linically defined syndromes such as MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke like episodes), MERRF (myoclonus epilepsy and raggedred fibres), and Kearns Sayre syndrome (retinitis pigmentosa, progressive external ophthalmoplegia, ataxia and heart conduction defects) have all been directly associated to atypical mtDNA forms ( 94, 172, 214) .

PAGE 21

8 Figure 2. The human mitochondrial genome. Human mtDNA encoded genes: NADH dehydrogenase subunits of complex I (ND1 N D6 and ND4L), cytochrome b (Cyt b) of complex III, cytochrome c oxidase subunits of complex IV (COX13), ATP synthase subunits 6 and 8 of complex V, rRNAs (12S and 16S ), and tRNAs (indicated by the oneletter amino acid symbol). Also showing control region (D loop) and arrows indicating the promoters for transcription of the heavy (HSP) and light (LSP) strand of mtDNA and the origins of leading (OH) and lagging (OL) st rand replication. Modified from reference 31 .

PAGE 22

9 Particularities of the mitochondrial DNA In comparison to the nuclear genome, several characteristics have been exclusively attributed to the mtDNA : 1) Polyploidy : Most mammalian cells contain hundreds o f mitochondria and each mitochondrion contains several copies (210) of the mtDNA ( 131) It is believed that a single individual has identical copies of the mtDNA; however, mutations can arise and co exist with wild type mtDNA, a phenomenon known as heter oplasmy. Different levels of heteroplasmy have been reported in different cell types and tissues due to random segregation of mitochondria (and mtDNA) at cell division ( 174) In order to produce a particular phenotype (e.g. disease), the level of heteroplasmy has to reach a certain percentage known as the threshold effect, usually around 6080% of total mtDNA ( 44, 152) 2 ) Non mendelian (m aternal ) inheritance: A mammalian oocyte contains ar ound 100 000 copies of the mitochondrial genome large amount of mtDNA in comparison with the mere 100 copies carried in a single sperm cell (most of them surrounding the sperm tail to provide ATP for motility ) ( 175) Therefore, during fertiliz ation, the sperm head (containing the nucleus) is fused

PAGE 23

10 to the egg, and basically no mitochondria are transferred in the process ; the few mitochondria that could enter in the newly form ed zygote are actively eliminated by a ubiquitindependent mechanism ( 180, 208) Recently, new evidence showing that paternal mtDNA can be present in the offspring has been reported, although the mechanism remains unknown ( 93, 167) 3) Evolution rate: There are no histones in the mitochondrion; therefore, the mtDNA is less protected than the nuclear genome ( 168) Moreover, the mtDNA is physically associated with the inner mitochondrial membrane where damaging ROS are present, and less efficient DNA repair mechanisms have been identified in mitochondria ( 168, 177, 206) Together, these reasons explain why the mtDNA has higher mutation rates than the nuclear DNA, and provide a hint on how somatic accumulation of mtDNA mutations can play a role in human aging and disease. On the other hand, single nucleotide polymorphism s (SNPs) in the mtDNA have been mapped and have served as a tool for human population genetics and evolutionary studies ( 62, 201) 4) Divergent genetic code: Mitochondrial genes are translated by a mtDNA restricted translation machinery that utilizes a genetic code distinct from

PAGE 24

11 the universal genetic code. For example, in mammals, UGA rather than a termination codon codes for tryptophan, and AGA and AGG are termination codons instead of encoding arginine ( 7) 5) Gene organization: On e of the main character istics of mammalian mtDNA is its compact gene organization. All the genes are next to each other or separated by a few nucleotides with no introns and no 5 or 3 non coding regions ( 1) In human mtDNA overlapping occurs between genes ATPase 6 and ATPas e 8 (46 nt in common ), and between ND4 and ND4L (7 nt in common ) ( 6) (Figure 2) And for several genes, the termination codon is added by poly adenylation of the mRNA, since it i s not encoded in the mtDNA ( 32) The tRNAs are interspersed between genes and play an important role in RNA processing ( 140) Post transcriptional excision of tRNAs from polycistronic messages is mediated by the mitochondrial RNase P enzyme (encoded in the nucleus). T his process of excision is necessary for the expression of the mitochondrial genomic information ( 45, 189) The overall genetic content and organization of vertebrate mitochondrial genomes is highly conserved; however, the mtDNA sequence and the position of regulatory elements for replication and transcription vary considerably even within a single species ( 168) Two major noncoding regions are present in the

PAGE 25

12 mammalian mtDNA: the D loop and the origin of re plication for the light (L) strand ( OL). The D loop (~1kb) contains the origin of replication for the heavy or H stran d (according to its higher guanine content) and the promoters for both H and Lstrand transcription ( 168, 183) Also, within the D loop highly conserved regions are found throughout several metazoan mtDNAs. They are known as the conse rved sequence boxes (CSB I III) and the terminationassociated sequences (TASs) ( 47, 168) The OL is a 30 nucleotidelong segment at about twothirds of the mtDNA (from OH) that is located inside a tRNA cluster known as the WANCY region (from the amino acids singl e letter nomenclature) (Figure 3) ( 34, 47)

PAGE 26

13 Figure 3. Schematic representation of the mammalian D loop. Diagram s howing the noncoding regulatory D loop and transcription termination regions. Also, the main factors and cis elements involved in mtDNA transcription and replication. DNA polymerase ( DNApol), exclusive for mtDNA replication. T he mitochondrial RNA polymerase (POLRMT) binds to mitochondrial transcription factors (MTFs) bound to regions upstream of promoters for light stra nd (LSP) and heavy strand (HSP1 and HSP2) transcription. RNase P is a ribonucleoprotein that processes the transcripts from LSP to generate the primers for heavy strand replication from its origin (OH). Conserved sequence boxes (CSB I III) and terminatio n associated sequences (TAS) important for transcription and replication of the heavy strand.

PAGE 27

14 Mitochondrial DNA t ranscription In human mtDNA, independent promoter regions for transcription initiation of each strand have been described ( 33) The light strand (lower guanine content) encompass es one promoter region known as LSP, and the heavy strand contains two, HSP 1 and HSP2 ( 32, 33) Polycistronic precursor RNAs (some of them nearly full genome long) are transcribed from both LSP and HSP s by the mitochondrial DNA dependent RNA polymerase ( POLRMT) ( 13) Mature mRNAs and rRNAs are then separated by excision of the tRNAs (flanking all the protein coding genes). Processing of the mitochondrial RNA precursors is carried out by RN ase P. This mechanism of R NA processing has been described as a tRNA punctuation model ( 13, 140, 189) Since POLRMT cannot directly bind DNA and initiate transcription on its own, it requires assi stance from mitochondrial transcription factors (mtTFA and mtTFB) that associate with specific regions upstream of the mtDNA promoters ( 5, 46) Although ubiquitous expression, there is substantial evidence indicating that the mammalian mitochondrial transcription mach inery is differentially regulated throughout tissues ( 48, 161) No tably all the proteins involved in mtDNA transcription and production of mature mt RNAs are encoded in the nuclear genome ( 156)

PAGE 28

15 Since mitochondrial gene expression is essential for OXPHOS, an appealing idea that has not been fully addressed so far is how mtDNA transcription is coordinated with cellular energy demand. Different cell and tissue types have energetic demands that vary according to their phy siological state, which in turn require different rates of mitochondrial biogenesis ( 165, 194) Th e mechanisms that govern mitochondrial biogenesis are poorly understood; however, some factors and pathways have been characterized for specific situations. During cellular proliferation, for example, upregulation of mitochondrial and nuclear genes necess ary for the proper assembly and function of the OXPHOS system have been documented ( 13, 163) This process requires the participation of protein activators such as nuclear respiratory factors 1 and 2 (NRF 1 and NRF 2), CREB, Sp 1 and others ( 160, 162) Eq u ally necessary are coactivators that interact with nuclear DNA binding proteins such as PGC transcription in response to environmental and proliferative signals ( 2, 83, 160) MtDNA transcription has been shown to be also regulated by intracellular ATP levels ( 66, 128, 192) Shuey et al. demonstrated that a sensing mechanism of the amounts of ATP is responsible for the differential expression of mitochondrial transcripts, since ATP is required 15to 20 fold more over the other NTPs for transcription ( 170) Furthermore, recent evidence

PAGE 29

16 shows that differential transcription from LSP versus HSP1 occurs depending on ATP availability, resulting in altered mRNA and rRNA profiles ( 51, 134) Mitochondrial DNA r eplica tion Mitochondria possess a unique protein system devoted exclusively to mtDNA replication. Most of the components of this repertoire have been characterized; however, some elements still remain to be identified since there seems to be no apparent mitoc hondrial counterpart for the corresponding nuclear enzymatic activity (e.g. primase for mtDNA light chain synthesis) ( 46) An important finding in the study of m tDNA is that replication is totally dependent on transcription. This is due to the fact that replication of the heavy strand at the origin (OH) is primed by a short RNA transcribed from the LSP region ( 24, 25) This phenomenon has been demonstrated by several groups. Chang D. et al. showed that using m itochondrial transcription assays in vitro some of the nascent transcripts remain bound to the mtDNA at the OH ( 26) And Kang et al. detected in vivo RNA primed DNA strands using the polymerase chain reaction analysis ( 81)

PAGE 30

17 Although the exac t mechanism is still under intense debate, two major mo dels of mtDNA replication have been proposed ( 31) The first one (in terms of years from publication) is the stranddisplacement replication, and the other is the strandcoupled replication. The stranddisplacement mechanism was initially proposed in 1982 by Clayton et al. from direct observation of purified mtDNA by electron microscopy ( 34) This mode of mtDNA replication resembles to that of bacterial plasmids (e.g. ColE1), but is different from that of chromosomal DNA replication of both eukaryotes and eubacteria. It posits that replication of the heavy (leading) strand initiates at OH and proceeds unidirectionally until it reaches twothirds of the genome, where the origin of the light (lagging) strand (OL) is e xposed on the displaced parental stran d, initiating replication in the opposite direction (Figure 4) This model, also called the asynchronous strand asymmetric replication model introduces the concept of a displacement loop (D loop) observed at high frequency in the purified mtDNA analyzed The D loop was described as a third short heavy DNA strand associated to the parental mtDNA of about 1Kb of length and presumably formed by 5 to 3 mt DNA synthesis arrest at the terminationassociated sequences (TASs) ( 168) D loops of different size have also been detected in mtDNA from other species ( 100, 159) .

PAGE 31

18 Figure 4. Strand displacement model of mammalian mtDNA replication. Closed circular mtDNA enters replication by formation of D loop. Migration of the heavy strand continues unidirectio nally displacing the parental strand until it reaches twothirds of the mtDNA, where the origin for light strand (OL) is exposed initiating replication in the opposite direction.

PAGE 32

19 The strand coupled mechanism of replication was proposed more recently by Jacobs and colleagues ( 70) It is based on the detection of replicative mtDNA intermediates in 2D gels. This technique separates DNA fragments based on size and shape. Therefore, replication intermediates are expected to resolve in predictable ways. In case both DNA strands replicate simultaneously the y tend to form a replication fork, which can be detected as a Y arc in 2D gels Such Y arcs were unambiguously identified when analyzing mtDNA from human placenta and mouse liver, underscoring the exist ence of a strandsynchronous replication mechanism; however, singlestranded intermediates were also detected meaning that a combination, rather than a mutually exclusive mode, of both mechani sms might be present in mammalian mitochondria ( 149) (Figure 5). An interesting observation perhaps is that n ot all genes required for mammalian mtDNA replication have evolved from a prok aryotic ancestor. For example, POLRMT the catalytic s ubunit of mtDNA polymerase ( A ), and the mtDNA helicase ( TWINKLE ) are sim ilar to proteins encoded by bacteriophages of the T odd lineage, which include bacteriophages T3 and T7. Th erefore, it has been proposed that some genes necessary for replication and expression of the mtDNA were acquired from a T odd phage ancest or early in the evolution of eukaryotic organisms, possibly during the time when mitoch ondrial endosymbiosis occurred ( 21, 171) .

PAGE 33

20 Figure 5. Strandcoupled model of mammalian mtDNA replication. Closed circular mtDNA enters replication by formation of a D lo op that facilitates bidirectional polymerization of leading and lagging strands from origin OH (it could also start from OL) at the same time (synchronous). Migration could proceed around the genome with lagging strand replication being the result of mult iple short fragment (Okazaki) synthesis.

PAGE 34

21 Oxidative phosphorylation M itochondria generate energy by oxidizing metabolites derived from our dietary carbohydrates (TCA cycle) and fats ( oxidation) to generate heat and ATP ( Figure 1) ( 198) Embedded in the inner mitochondrial membrane, there is a system of electron carrier complexes, also known as the electron transport chain (ETC). The main function of the ETC is to transfer electrons by a multi step redox process from TCA cycle products (NADH and FADH2) to oxygen, which is reduced to water ( 36, 49, 198) Electrons are initially donated from NADH and FADH2 to complex I (NADH dehydrogenase) or to complex II (succinate dehydrogenase), r espect ively. Ubiquinone (also coenzyme Q or CoQ ) carries these electrons to give ubisemiquinone (CoQH) and then ubiquinol (CoQH2). Ubiquinol transfers its electrons to complex III (ubiquinol:cytochrome c oxidoreductase), which transfers them to cytochro me c, an electron carrier protein located within the intermembrane space. Then cytochrome c carries the electrons to complex IV (cytochrome c oxidase or COX) and finally to O2 to give H2O. In order to transfer electrons, each ETC complex contains multi ple electron carriers. Complexes I, II, and III encompass several ironsulfur (Fe S) centers, whereas complexes III and IV contain the b + c1 and a + a3 cytochromes, respectively ( 169, 199, 200, 202)

PAGE 35

22 The energy released by the flow of electrons throug h the ETC is used to pump protons out of the mitochondrial inner membrane throug h complexes I, III, and IV. The efflux of protons creates a pH gradient and an electrochemical gradient across th e mitochondrial inner membrane. This proton gradient is harnessed by complex V (F0F1 ATP synthase) for ATP production. As protons flow back into the mitochondrial matrix through a proton channel in complex V, ADP and inorganic phosphate ( Pi) are bound, condensed, and released in the matrix as ATP. Then, matrix ATP is exchanged for cytosolic ADP through the adenine nucleotide translocator (ANT) ( Figure 1). As protons flow through the ATP synthase proton channel, the proton gradient is depolarized. Since the ETC is c oupled to ATP synthesis this process is know n as oxidative phosphorylation (OXPHOS) The coupling efficiency of the OXPHOS system determines the efficiency of producing ATP from dietary calories (36, 172, 198, 202) Mitochondria and cancer Cancer cells utilize glycolytic pathways for energy generation while upregulating their aerobic respiratory activity. This metabolic change discovered by Otto Warburg over 60 years ago, was one of the first phenotypic

PAGE 36

23 alterations recognized in cancerous cells that confers a survival advantage ( 59, 204, 215) Wa rburg took advantage of new techniques for simultaneously measuring gas consumption and lactate production in tumor slices either in the presence or absence of oxygen. Surprisingly, in the presence of oxygen, t he rapidly growing tumor cells consumed gluco se at a high er rate and secreted elevated amounts of lactate compared to normal cells ( 204) More recently, Positron Emission Tomography (PET) imaging technique of fast growing and metastatic human cancers using the glucose analogue tracer 18fluorodeoxyg lucose (FDG) has confirmed Warburgs observations ( 57, 119, 129) T he first compelling evidence that mitochondrial dysfunction was associat ed with tumorigenesis was presented less than a decade ago when mutations in succinate dehydrogenase (SDH) or fum arate hydratase (FH), both enzymes of the TCA cycle, were f ound to be initiating events of familial paraganglioma or leiomyoma and of papillary renal cell cancer, respectively ( 10, 188) To demonstrate that mtDNA mutations can also contribute to the oncog enicity of tumors, a known pathogenic mtDNA mutation was introduced into the prostate cancer cell line PC3, which resulted in increased tumorigenicity ( 143) Furthermore, neoplastic transformation has been found to produce marked changes in the expression of both nuclear and mitochondrial OXPHOS genes ( 133, 190) T hese changes have been also proposed to occur

PAGE 37

24 in tumors developed in a tissue specific fashion ( 14, 27, 198) A study performed in Caenorhabditis elegans showed that inactivation of the Cytb (a mtDNA encoded gene) subunit of complex II markedly increases mitochondrial ROS production ( 72) Thus, ROS production appears to be the factor that links mitochondrial defects to neoplastic transformation and metastasis ( 74, 210) However, t he precise me chanism by which mitochondrial RNA and/ or ROS levels increase in cancerous cells still remains unclear ( 35) On the other hand, the direct role that mitochondria play in apoptosis has been extensively studied during the past two decades. For instance, loss of mitochondrial membrane potential is thought to contribute to cell death by disruption of normal mitochondrial function ( 20, 76, 96) Further, mitochondrial outer membrane permeabilization (MOMP) leads to the release of proapoptotic factors such as cytochrome c and AIF. Therefore, s everal MOMP inhibitors (e.g. Bcl 2, Bcl XL, VDAC isomers, hexokinase II) have been described and are currently targeted in the chemotherapeutic treatment of cancer ( 3, 53, 203) .

PAGE 38

25 Obj ectives In comparison to the i mmunocompetent population, AIDS and post transplant patients have a significant increase of developing virus induced cancers L ymphoproliferative disorders (LD) in particular, have been found to be diagnosed more frequently than other ty pes of neoplasias Nevertheless, i t is still unknown why some LD subtypes are more prevalent than others in AIDS versus post transplant patients. The discovery of new viruses associated with cancer during the las t two decades and the immunosuppressive state of these indiv iduals suggest that unidentified infectious agents might be responsible for inducing neoplastic tra nsformation within this context Since herpesviruses ( e.g. KSHV and EBV) ha ve been directly linked to specific cases of LD in humans ( 16, 136, 166) one of our main goals was to determine whether EBV and KSHVnegative AIDS associated lymphomas could be caused by a large DNA virus Since h erpesviruses are maintained as circularized extrachromosomal nuclear genome copies during lat ency ( 37) it was investigated whether these LD samples could contain novel episomal

PAGE 39

26 DNA Despite the fact that no novel DNA was detected in t he samples tested, d imers and concatemers of the mitochondrial genome were identified. Furthermore independent of HIV infection, established lymphoma cell lines also harbored this type of mtDNA. In this dissertation, a detailed analysis of the mtDNA concatemers identified in a case of AIDS associated lymphoma (EL) is presented. This work also shows evidence that f ormation of mtDNA concatemers and dimers are associated with neoplastic transformation by immortali zing normal human T cells with Herpesvirus saimiri Further st u dies on this area might reveal a new avenue for the therapeutic treatment of lymphoma. The following aims were designed for this dissertation project: 1. To characterize the cccDNA identified in a case of EBV and KSHV negative AIDS associated lymphoma (EL). 2. To determine if mitochondrial genome concatemers can influence mitochondrial and cellular function. 3. To determine if mitochondrial genome concatemers are associated with immortalizatio n of normal human T cells with Herpesvirus saimiri

PAGE 40

27 Materials and m ethods Primary AIDS associated lymphomas and human T cell samples Tw elve nonHodgkins lymphoma samples from HIV positive patients were obtained through the Division of Cancer Treatment and Diagnosis at the National Cancer Institute. Sampl es were cultured in RPMI 1640 medium supplemented with 4 mM Lgentamycin. Peripheral blood mononuclear cells were isolated from blood bank donor samples and T cell cultures were obtained by PHA stimulation (10 of mononuclear cells for 3 days then cultured in medium containing 50U/ml of IL 2. Metho d for detection of ccc DNA Live lymphoid or AIDS associated lymphoma cells were selected by Lymphoprep (ProGen), according to manufacturers protocol. 1x106 cells were loaded in each well of a vertical 0.8% agarose gel in 10% Ficoll buffer ( 54) Cell lysis buffer containing 5% Ficoll, 1% SDS, 1mg/ml pronase and

PAGE 41

28 0.05% xylene cyanol green was layered on top of the cell samples. Electrophoresis was carried at 0 .8 V/cm for 3 h then increased to 7.5 V/cm for 15 h at 4C. The gel was stained with 20 l of SYBRGreenTM Nucleic Acid Stain (Lonza Rockland, Inc., Rockland, ME) diluted in 200 ml of 1X TBE buffer for 1 hr. Then, the gel was destained in 10 mM Tris 1 mM EDTA for 30 minutes and the DNA was visualized using a Molecular Dynamics STORM Phosphor Imager (Model 860PC, Amersham Biosciences, Piscataway, NJ). Southern blot analysis Agarose gels containing electrophoresed DNA were consecutively submerged and gently rocked twice for 15 min each in the following solutions: 1) 0.25 M HCl solution for DNA depurination, 2) 1 M NaCl, 0.5 M NaOH solution f or DNA denaturation and residual RNA removal and 3) a n eutralizing sol ution containing 0.5 M Tris HCl (pH 7.0), 1.5 M NaCl. Treated gels were vacuum blotted onto nitrocellulose membranes ( 125) After blotting, the DNA was immobilized on the membrane by baking for 1h in a vacuum oven at 80C. At this point, the membrane could be either used for hybridization or stored at 20C. 10 ml of a prehybridization buffer is added to the membrane at RT for 10 min. The prehybridization buffer contains 50% fo rmamide, 5X SSC (750 mM NaCl, 75 mM sodium citrate), 10X Denhardts

PAGE 42

29 solution (0.2% bovine serum albumin, 0.2% Ficoll 400 and 0.2% polyvinylpyrrollidone), 0.05 M Na3PO4, 0.5 mg/ml salmon sperm (or total E. coli DNA), and 0.1% SDS. 10 ml of hybridization buffer are heated at 100C for 5 min then cooled down to RT. The hybridization buffer consists of 50% formamide, 5X SS C, 1X Denhardts solution, 0.015 M Na3PO4, 0.1 mg/ml salmon sperm 5% dextran sulfate and 0.1% SDS. T he n, prehybridization buffer is removed; the radiolabeled probe is added to the hybridization buffer, mixed and added to the membrane. Hybri dization is performed for 1618 h at RT. The membrane is then washed at RT for 34 times with a solution containing 0.1% SDS and 0.1X SSC. F inally, the membrane is exposed for autoradiography for 16 24 h to a Phosphor Screen and analyzed using a Molecular Dynamics ST ORM Phosphor Imager (Model 860PC, Amersham Biosciences, Piscataway, NJ). Synthesis of a [ 32P ] ATP radiolabeled probe by 5 end labeling of DNA oligonucleotides Human mtDNA derived oligonucleotides ( T able 2) were mixed, at a final concentration of 10 g/ml in 1 X TE buffer (primer mix). Then, the radiolabeled probe was made by adding in an eppendorf tube 1l of primer mix to 1l of 10X T4 polynucleotide kinase buffer, 1 l (10U) of T4 kinase and 7 l of 32P] dATP isotope. The mixture was incubated for 30 min at 37C. Then, 40 l of a

PAGE 43

30 solution (stop buffer) consisting of 20 mM NaCl, 50 m M EDTA 20 mM Tris HCl (pH 7.5), 1% SDS and 0.25% dextran blue, were added. The radiolabeled probe was kept at RT for hybridization. Isolation of ccc DNA by alkaline cell lysis and CsCl EtBr gradient 5x108 cells were centrifuged at 500 x g for 15 min and r esuspended in 10 ml 1X PBS. Five ml of an alkal ine buffer solution containing 50 mM NaCl, 2 mM EDTA, 1% SDS and 30 mM NaOH were added to the cells and the mixture was vortexed for 2 min and incubated at 30C for 30 min. T hen, the mixture was neutralized by addition of M Tris ( pH 7.0) 5 M NaCl. d mixture was incubated at 37C for 30 min. DNA was extracted with an equal volume of 24:24:1 phenol: chloroform :isoamyl alcohol solution followed by extraction with chloroform. DNA was then precipitated by centrifugation at 20,000 rpm at 4C with 2.5 volumes of 95% ethanol DNA was air dried and pellet was r esuspended in a 1X TE solution. Then, c esium chloride ( CsCl) ( 1.55 g/ml final density ) and ethidium bromide (EtBr) (1 /ml final concentration) were added. The mixture was centrifuged at 45,000 rpm in a Beckman L775, VTi 65 rotor for 72 h at 20C. After 3 days, 200 l f ractions from higher dens ity (bottom of the tube) to lower density (top of the tube) were collected i n a 96well plate and aliquots from each fraction were analyzed by electrophoresis in a 0.8% agarose

PAGE 44

31 gel Fractions corresponding to cccDNA were further purified by repeated extractions with 1 volume 5M NaCl isopropanol The mixture containing the cccDNA (stripped of EtBr) was mixed with 2.5 volumes of 95% ethanol, centrifuged at 20,000 x g for 30 min at 4C and the pellet was resuspended in 1X TE buffer. C loning of fragments from EL cccDNA Purified EL cccDNA was electrophoresed in a 0.8% low melting temperature agarose gel for 18 h at 22V, 4C. The gel was stained with SYBRGreenTM and DNA visualized in a UV box. The band corresponding to high MW cccDNA was cut out from the gel and incubated at 65C for 10 min. The cccDNA was purified by phenol/chlor oform extraction and ethan ol precipitation. C loning of EL cccDNA was performed by restriction digestion using the four basecutter endonuclease Mbo I followed by T4ligation to Ba m HI digested and dephosphorylated pBluescript II KS vector. Ligation mixt ure was phenol/chloroform extracted, ethanol precipitated and resuspended in 10 l of nucleasefree water.

PAGE 45

32 Electroporation of competent E. coli and selection of transformants 1 l of l igated DNA was mixed with 10 l of competent E. coli ( ElectroMAX DH1 0 B strain ) and incubated on ice for 10 min. The suspension was put in a 1mm electrodegap cuvette and elec troporated at 1,500 V using an E ppendorf Electroporator 2510. Cells were incubated for 1h at 37C in 500 l of SOC medium (20 g/L bactotryptone, 5 g/L yeast extract, 0.5 g NaCl, 2.5 mM KCl, pH 7.0). Different dilutions of electroporated cells to SOC medium (1:1, 1:10 and 1:100) were plated in agar plates containing ampicillin (100 g/ml final concentration) 5 bromo 4 chloro3 inodlyl D galactopy ranoside (X ml ( prepared in dimethylformamide, DMF), and isopropyl 1 thio D galactopyranoside (IPTG) to a final concentration of 20 mM (prepared in sterile d dH2O) Finally, the plates were incubated overnight at 37C and transformants containing EL cccDNA fragments were selected by bluewhite color screening. PCR analysi s Purified cccDNA was electrophoresed in a low melting temperature 0.8% agarose gel and ran overnight at 4C and 22 V After 16 h, gel staining a nd DNA visualization in a UV box were performed. T he gel fractions containing cccDNA for both monomers and concatemers were cut out and melted at 65C for 10 min, then cccDNA was phenol/chloroform extracted and ethanol

PAGE 46

33 precipitated. Oligonucleotides were used either for amplification or as probes for Southern blotting (Table 2) ( 151) : PCR products were electrophoresed in a 0.8% agarose gel to confirm size ( in comp arison to predicted size from official human mtDNA sequence). Then, PCR products were sequenced and analyzed using CLC Workbench 3. Name Sequence Position (3' end) 2F 5CGATCAACCTCACCACCTCT3 1245 2R 5TGGACAACCAGCTATCACCA3 2007 3F 5GGACTAACCCCTATACCTTCTGC3 1854 3R 5GGCAGGTCAATTTCACTGGT3 2669 4F 5AAATCTTACCCCGCCTGTTT3 2499 4 R 5AGGAATGCCATTGCGATTAG3 3346 5F 5TACTTCACAAAGCGCCTTCC3 3169 5R 5ATGAAGAATAGGGCGAAGGG3 3961 6F 5TGGCTCTTTAACCTCTCCA3 3796 6R 5AAGGATTATGGATGCGGTTG3 4654 7F 5ACTAATTAATCCCCTGGCCC3 4485 7R 5CCTGGGGTGGGTTTTGTATG3 5420 8F 5CTAAC CGGCTTTTTGCCC3 5255 8R 5ACCTAGAAGGTTGCCTGGCT3 6031 9F 5GAGGCCTAACCCCTGTCTTT3 5855 9R 5ATTCCGAAGCCTGGTAGGAT3 6642 10F 5CTCTTCGTCTGATCCGTCCT3 6469 10R 5AGCGAAGGCTTCTCAAATCA3 7315 11F 5ACGCCAAAATCCATTTCACT3 7148 11R 5CGGGAA TTGCATCTGTTTTT3 8095 12F 5ACGAGTACACCGACTACGGC3 7937 12R 5TGGGTGGTTGGTGTAAATGA3 8797 13F 5TTTCCCCCTCTATTGATCCC3 8621 13R 5GTGGCCTTGGTATGTGCTTT3 9397 14F 5CCCACCAATCACATGCCTAT3 9230 14R 5TGTAGCCGTTGAGTTGTGGT3 10130

PAGE 47

34 15F 5TCTCCAT CTATTGATGAGGGTCT3 9989 15R 5AATTAGGCTGTGGGTGGTTG3 10837 16F 5GCCATACTAGTCTTTGCCGC3 10672 16R 5TTGAGAATGAGTGTGAGGCG3 11472 17F 5TCACTCTCACTGCCCAAGAA3 11314 17R 5GGAGAATGGGGGATAGGTGT3 12076 18F 5TATCACTCTCCTACTTACAG3 11948 18R 5 AGAAGGTTATAATTCCTACG3 12772 19F 5AAACAACCCAGCTCTCCCTAA3 12571 19R 5TCGATGATGTGGTCTTTGGA3 13507 20F 5ACATCTGTACCCACGCCTTC3 13338 20R 5AGAGGGGTCAGGGTTCATTC3 14268 21F 5GCATAATTAAACTTTACTTC3 14000 21R 5AGAATATTGAGGCGCCATTG3 149 98 22F 5TGAAACTTCGGCTCACTCCT3 14856 22R 5AGCTTTGGGTGCTAATGGTG3 15978 23F 5TCATTGGACAAGTAGCATCC3 15811 23R 5GAGTGGTTAATAGGGTGATAG3 5 24F 5CACCATTCTCCGTGAAATCA3 16420 24R 5AGGCTAAGCGTTTTGAGCTG3 775 Table 2. Oligonucleotides use d for PCR amplification and sequencing of EL cccDNA and mtDNA of normal Tcells. 3 end positions are relative to the revised Cambridge reference sequence of the human mtDNA available at www.mitomap.org.

PAGE 48

35 DNA sequencing We submitted all EL cccDNA derived c lones and purified PCR products for sequencing to the Molecular Biology core facility at the H. Lee Moffitt Cancer Center and Research Institute. Electron microscopy Mitochondrial DNA samples were prepared for electron microscope imaging using a modified Kle inschmidt protocol ( 99, 213) DNA was mixed with ammonium acetate and cytochrome C, placed on a piece of parafilm to allow a protein monolayer to form. A carbon coat ed electron microscopy grid is put in contact with the surface of the sample. Grids were washed with a solution of 95% ethanol/50 uM uranyl acetate. Grids were then either visualized as is or rotary metal shadowed with tungsten in an Edwards Auto 306 vacuum evaporator. The length of the DNA molecules was confirmed by comparison to plasm ids of known length. The grids were imaged in a Hitachi H7500 TEM equipped with an Advanced Microscopy Techniques XR60 CCD camera. The NIH Image J was used to trace the backbone of the DNA molecules and the DNA length was calculated (EM was performed by Troy Lund and Stephen Jett).

PAGE 49

36 Flow cytometry analysis for characterization of EL cells 1x106 E L cells and normal T cells for controls, were resuspended in 5ml of staining solution containing 1X PBS 0.1% (w/v) NaN3 and 1.0% (w/v) bovine serum albumin ( BSA; fraction V) on ice. Then, cells wer e fluorescently labeled using staining media containing 10 l of each of the FITC conjugated antibodies used and isotype (IgG1 and IgG2) for controls diluted to the appropriate concentrations Cell suspensions w er e analyzed in a BD FACSCaliburTM Flow cytometer M onoclonal mouse or goat anti human antibodies for the following markers were used: CD2, CD15, CD45, C D8, CD10, CD19, CD20, CD22, CD33, HLA DR, CD13, CD14 F low cytometry analysis of m itochondrial factors and properties 1. Mitochondrial membrane potential ( ) dye 20 nm 3,3' dihexyloxacarbocyanine iodide (DiOC6; Molecular Probes, Eugene, OR; excitation: 488 nm, emission: 525 nm). Fluorescence of DiOC6 is oxidationinde ( 182) quantitated by using a potential dependent J aggregate forming lipophilic cation, 5,5',6,6' tetrachloro1,1',3,3' tetraethylbenzimidazolocarbocyanine iodide (JC 1) ( 173) JC 1 selectively incorporates into mitochondria, where it forms

PAGE 50

37 monomers (fluorescence in green, 527 nm) or aggregates, at high transmembrane potentials (fluorescence in red, 590 nm) ( 40, 118, 173) Cells 1 for 15 mi n at 37C before flow cytometry. perchlorate (TMRM) (excitation: 543 nm, emission: 567 nm; Molecular Probes). Co chlorophenylhydrazone (mClCCP; Sigma) for 15 min at 37C resulted in decreased DiOC6, CMXRos, TMRM, and JC 1 fluorescence and served as a ( 9) 2. Mitochondrial mass Mitochondrial mass was monitored by staining with potential insensitive mitochondrial dy es 50 nM nonyl acridine orange (NAO excit ation: 490 nm, emission: 540 nm) or 100 nM MitoTracker greenFM (excit ation: 490 nm, emission: 516 nm ; Molecular Probes). Samples were analyzed on a Becton Dickinson Vantage S/E flow cytometer equipped with an Enterprise II argon laser producing two laser lines (emission of 351364 nm at 60 mW and emission of 488 nm at 350 mW) and a Coherent (Santa Clara, CA) 70C Spectru m kryptonargon laser operated at 200 mW (emission at 647 nm). Dead cells and debris were excluded from the analysis by electronic gating of

PAGE 51

38 forward scatter (FSC) and side scatter (SSC) measurements. Each measurement was carried out on 10,000 cells. 3 Production of ROS Intracellular amounts of ROS were assessed fluorometrically using oxidationsensitive fluorescent probes 5,6carboxy 2',7' dichlorofluoresceindiacetate (DCFH DA), dihydrorhodamine 123 (DHR), and dihydroethidium (hydroethidine, DHE; M olecular Probes, Eugene, OR) as described ( 8, 9) DA for 15 min, or D HE for 15 min. Fluorescence emission from 5,6carboxy 2',7' dichlorofluorescein (DCF; green) or DHR (green) was detected a t a wavelength of 530 30 nm. Fluorescence emissi on from oxidized hydroethidine ethidium (red), was detected at a wavelength of 605 nm. While R123, the fluorescent product of DHR oxidation, binds selectively to the inner mitochondrial membrane, the oxidi zed products of DCFH DA and DHE, ethidium and dichlorofluo rescein (DCF), respectively, remain in the cytosol of living cells. DCF and DHE preferentially detect H2O2 and superoxide (O2 -), respectively ( 19, 90, 153)

PAGE 52

39 4. Glutathione levels Intracellular monochlorobimane (excitation: 380 nm/emission: 461 nm) following similar protocols for cell staining and sample measurements as in ROS assays 5. Fas induced apoptosis Apoptosis was induced wi th Fas Ab CH 1 1 (MBL, Watertown, MA). Briefly, twenty four hours before assays, cells were fed fresh medium and seeded at a density of 2 x 105 cells/ml, and cell death was induced with 50 or 100 ng/ml anti Fas mAb CH 11. Apoptosis was monitored by observing cell shrink age and nuclear fragmentation and was quantified by trypan blue exclusion ( 191) DNA fragmentation during apoptosis was monitored by agarose gel electrophoresis ( 8) Apoptosis was also measured by flow cytometry after concurrent staining with fluoresceinconjugated annexin V (annexin V FITC; R&D Systems, Minneapolis, MN) and propidiu m iodide ( 122, 193) Staining with phycoerythrinconjugated annexin V (annexin V PE; R&D Systems) was used to monitor phosphatidyl serine ( PS) externalization in parallel wit h measurement of ROS levels a fluorescence, respectively. Staining with annexin V alone or in combination with DHR or DiOC6 was conducted in 10mM HEPES (pH 7.4), 140 mM NaCl, and 2.5 mM CaCl2.

PAGE 53

40 Immortalization of normal human T cells using H erpesvirus s aimiri A monolayer of owl monkey kidney (OMK) cells grown in a 100 mm dish were infected with 1x105 pfu/ml of H erpesvirus saimiri (HVS) strain 484 77 for virus propagation ( 127) After 1h post infection, supernatant was removed. Human peripheral blood leukocytes (PBL) were isolated from blood samples by density gradient sedimentation using LymphoprepTM (ProGen) according to manufacturers instructions. Then, PBL were cultured in RPMI 1640 cell media containing 10% fetal calf serum (FC S), 4 mM L glutamine 50 and 0.5 ug/ml of phytohemagglutinin (PHA) for 3 days OMK cells showing cytopathic effect were overlaid with human T cells. Cells were maintained i n complete media with or without 20U/ml of IL 2 for around two more months ( 181) Al though control uninfected cultures usually died around 35 weeks post PHA stimulation, some infected PBL cultures were successfully expanded (e.g. T 484 and 3HB6) After removal of IL2, these cultures continuously grew and were selected for analysis

PAGE 54

41 Results Method for detection of large cccDNA of AIDS associated lymphomas To visualize cccDNA from tumor samples suspensions the vertical gel electrophoresis method of Gardella et al. was modified ( 54) One million cells from each of the t welve AIDS associated lymphoma samples were run in a Gardella gel and the gel was stained with SYBRGreenTM (Figure 6 ). In some of the samples DNA bands migrating between the loading well and linear broken DNA were observed; this range of these gels contains large ( 1525 0 kb ) cccDNA Four AIDS associated lymphoma bands were positive for EBV by Southern hybridization (not shown) and no longer studied. The remaining eight samples were also negative for KSHV. Identification of large cccDNA in an AIDS associated lymp homa (EL) that does not hybridize with EBV or KSHV derived probes To further study the eight EBVand KSHVne gative lymphomas, formation of permanent cell lines was carried out After a period of around 3 months in culture, o ne lymphoma sample ( denominated EL) successfully

PAGE 55

42 Figure 6. The Gardella gel tec hnique and visualization of large cccDNA in an AIDS associated lymphoma sample (EL). One million live cells in 10% Ficoll buffer are loaded into a well of a vertical agarose gel and digest ed by overlaying with a lysis buffer containing SDS and pronase followed by electrophoresis at 22V for 3 h. Then, electrophoresis is set at 70V for 18 h. Finally, the DNA is visualized by staining with SYBR GreenTM. The three different molecular confi gura tion s of DNA are indicated. Right panel shows SYBRGreenTM staining of Gardella gel containing unknown episomal DNA from EL cells (arrow) migrating within the range of large cccDNA.

PAGE 56

43 yielded a cell line while all other EBV/KSHV negative lymphoma samples ev entually died. Gardella g el analysis of EL cells and the derived cell line consistently demonstrated the presence of a large cccDNA unrelated to EBV or KSHV (Figure s 6 and 7 ) Phenotypic characterization of EL cells by flow cytometry EL cells were posi tive for CD3, CD4 and CD45 meaning that they are a CD4+ T cell line Oth er markers teste d were: CD8 (specific for CTLs) CD16 (specific for NK cells, neutrophils, monocytes, and macrophages ) CD19, CD20, CD22 (for B cells) CD33 (for myeloid cells) and H LA DR (for APCs) IgG1 and IgG2 were used as isotype controls (Figure 8 ) The EL cccDNA consists of mitochondrial DNA To determine the sequence of the EL cccDNA the cells were expanded in RPMI 1640 10% FCS without IL2. CccDNA was isolated from EL cells by alkaline lysis followed by centrifugation on a CsCl EtBr density gradient. Fractions of the gradient were collected and separated by low melting agarose gel electrophoresis. Figure 9 shows that the higher CsCl density fractions corresponding to cccDNA contained two discrete bands and the lower density fraction contained smeared linear nuclear DNA as expected.

PAGE 57

44 Figure 7 Southern blotting analysis of EL cccDNA using probes specific for both EBV and KSHV. Total DNA from Gardella gels was transferred onto nitrocellulose membranes for Southern blotting. Radiolabeled probes specific for (A) EBV or (B) KSHV DNA do not hybridize with the large cccDNA identified in EL cells.

PAGE 58

45 Figure 8 EL cells are CD4+ T lymphocytes. Phenotypic ch aracterization of EL cells using flow cytometry analysis show s that EL cells are CD4+ T lymphocytes Other markers tested: IgG2, CD8, CD16, CD19, CD20, CD22, CD33, HLA DR.

PAGE 59

46 Figure 9 Gel electrophoresis analysis of CsCl EtBr gradient fractions of total EL DNA. Episomal cccDNA was purified from EL cells by alkaline lysis and CsCl EtBr gradient centrifugation. Density of gradient fractions decreases from left to right. Fractions were analyzed by agarose gel electrophoresis followed by SYBRGreenTM staining Figure is representative of 7 independent experiments. *High molecular weight genomic DNA; **genomic broken linear DNA front.

PAGE 60

47 DNA was extracted from the molten gel slice corresponding to the two cccDNA bands and digested with restriction endo nuclease Mbo I. The restriction fragments were shotguncloned into the pBluescript vector (Stratagene) and the clones were sequenced and analyzed using BLAST (Figure 10). Results indicated that the clones contained 95% (>300 clones) human mtDNA an d ~5% (~2 0 clones) human chromosomal DNA randomly derived from most human chromosomes, presumably caused by contamination from nuclear DNA during collection of fractions (Table 3) Then, normal T cells were obtained from healthy blood donors and cccDNA was isolated and comp ared with EL DNA. Gel electrophoresis shows that only one band was detected in normal T cells while EL cccDNA contained two bands (Figure 11A) Southern hybridization of this gel using a humanmtDNA probe shows co migrating bands (slightly above the 23 k b marker) in both normal T cell and EL DNA. A slower migrating cccDNA from EL cells also hybridized with the mitochondrial probe (Fig ure 11B ). The se results support our previous data that both forms of EL cccDNA were comprised of mtDNA. Moreover, the data show that EL cells contain some monomeric mtDNA and a larger and more abundant DNA hybridizing with the mtDNA probe.

PAGE 61

48 Figure 10. Schematic representation of the method performed for isolation and analysis of EL cccDNA. 5 x 108 live cells in 10% Ficoll buffer are digested in an alkaline buffer. A solution containing proteinase K is added to the lysate. Total DNA is purified using phenol/chloroform extraction and ethanol precipitation. Purified DNA is then mixed with a solution containing CsCl and EtBr, and ultracentrifuged at 40,000 x g for 72 h. At the end of the centrifugation, the bottom of the tube is perforated with a sterile needle and fractions (from high to low density) are collected in a 96well plate. An aliquot from each fraction is then loaded and run in an agarose gel. The gel is stained using SYBRGreenTM and the fractions containing cccDNA are identified and further purified for cloning.

PAGE 62

49 Chromosome Size of chromosome (Mbp) Number of sequences obtained from EL cccDNA cloning 1 245 2 2 242 8 3 200 2 4 191 2 5 180 6 6 171 2 7 158 none 8 148 2 9 138 3 10 135 none 11 134 none 12 132 none 13 114 1 14 106 2 15 100 none 16 80 none 17 80 1 18 76 none 19 64 1 20 62 none 21 46 none 22 49 none X 154 2 Y 5 8 none mtDNA 0.016 >300 Table 3. DNA sequencing results of EL cccDNA clon ing.

PAGE 63

50 Figure 11. Gel electrophoresis and Southern blotting of purified cccDNA from EL and normal Tcells using mtDNA derived probes. A) SYBRGreenTM staining of purified total cccDNA fractions from EL and normal T cells. B) Southern blotting of DNA (from A) using a probe of radiolabeled human mtDNA specific oligonucleotides. A ) B)

PAGE 64

51 The EL cccDNA is formed by tandem duplicated mitochondrial genomes. Electron microscopy analysi s of 50 molecules from purified EL circular episomal DNA showed superhelical DNA with an average backbone contour (Fig ure 12) Compared to the human mitochondrial genome cccDNA of EL cells consisted mainly of molecules equivalent to duplicated mtDNA. To confirm that the EL episomal DNA is formed by duplicated tandem repeats, inverted repeats or rearranged mitochondrial genomes, full and partial digestion using Bam HI (a mtDNA single cutter restriction enzyme) was performed. Figure 13 shows that complete digestion of EL cccDNA with Bam HI yields one 16.5 kb band. Partial digestion yielded two linear bands of approximately 16.5 and 33 kb corresponding to putative monomers and dimers of mtDNA. These results con firm our electron microscopy and sequencing data that the EL episomal DNA is conformed mainly by duplicated mitochondrial genomes organized in headto tail tandem orientation. Several additional restriction enzyme digestion data also support this conclusi on (not shown).

PAGE 65

52 Figure 12. Electron microscopy of EL cccDNA. The contour length of the concatemeric mtDNA (EL cccDNA) was measured using the Image Processing and Analysis i n Java (ImageJ) software from the NIH. DNA contour length was calculated t o be around 10.3 m. Similar results were obtained measuring the contour length of 50 other molecules. Note: EM was performed by Troy Lund and Stephen Jett.

PAGE 66

53 Figure 13. Complete and partial Bam HI restriction digestion of EL cccDNA. Banding pattern of fully digested EL cccDNA with Bam HI (10U) (mtDNA single cutter) at 30, 60 and 90 min resembles that of linear human mtDNA monomer (16.5 kbp). Right panel shows partial digestion of EL cccDNA with Bam HI (0.1U) stopped at increasing time points (5 s, 10 s, 20 s, 40 s, 1 min, 2min, 5min, 10 min, 20 min, 40 min, 1 h). After 5 min, two bands of linear DNA are observed representing putative human mtDNA monomers and dimers (16.5 and 33 kbp respectively).

PAGE 67

54 Cytosine insertions are present in the c ontrol region of the EL mtDNA To determine whether the EL mtDNA has suffered minor mutations, PCR amplification of purified EL cccDNA followed by DNA sequencing were performed using specific mtDNA derived oligonucleotides covering the entire mitochondrial genome ( T able 2). PCR products of EL and normal T cell DNA were indistinguishable by agarose electrophoresis (not shown) indicating absence of large insertions or deletions. The D loop, which is the main regulatory region of mtDNA replication and trans cription, has a highly conserved C stretch sequence (nt 311 to 315) known as the conserved sequence box II (CSBII) that has been reported as a mutational hotspot in primary tumors ( 158) Figure 14 shows that sequencing of PCR amplified EL mtDNA revealed t wo additional cytosine residues in the monomer and in the dimer within the CSBII near the primer of mtDNA replication. Normal T cells did not contain additional cytosines in the CSBII region as shown in the human mtDNA reference sequence.

PAGE 68

55 Figure 14. Multiple sequence alignment analysis of conserved sequence box II (CSBII) regions from EL and normal mtDNA. Multiple DNA sequence alignments of EL cccDNA (mtDNA concatemers and monomers) and normal mtDNA were performed using ClustalX. Shown, the reg ions from the D loop conserved sequence box II (CSBII, ranging nts 297321) from EL (C): EL mtDNA concatemer EL (M): EL mtDNA monomer normal T cell (M): normal T cell mtDNA, and the human mtDNA reference sequence from NCBI.

PAGE 69

56 Functional and structural mi tochondrial properties of EL cells Figure 15 summarizes various properties of EL cell mitochondria. In comparison with Jurkat cells (selected due to reproducibility throughout experiments and phenotypic si milarity to normal T cells (8)). EL lymphoma cells showed increased ROS and peroxideinduced apoptosis as determined by staining with dihydroethidium (DHE) and AnnexinV Alexa 647, respectively. These results suggest an unstable OXPHOS system in EL cells, since ROS could leak through uncoupled mitochondri al complexes (I V), thus augmenting intrinsic pro apoptotic signals. In contrast, monitoring of TMRM, NAO and AnnexinV Alexa 647 fluorescence indicated that mitochondrial membrane potential, mitochondrial mass and Fas mediated apoptosis were respectively reduced in EL cells. Also, glutathione levels were significantly reduced in EL cells, which could explain the overproduction of ROS in these cells since glutathione works as a biological ROS scavenger ( 64) Mitochondrial genome concatemers are present i n primary AIDS associated lymphomas and lymphoma cell lines Primary AIDS associated lymphomas and lymphoma cell lines were screened for episomal cccDNA using the Gardella technique ( Fig ure 16). Southern hybridization detected two bands in control T cells ; a broader and slower migrating circular form and a faster migrating linear form. However, all

PAGE 70

57 Figure 15. Flow cytometric analysis of mitochondrial physiological and structural properties. Reactive oxygen intermediates (ROI), Fas induced apoptos is, mitochondrial mass, mitochondrial potential and glutathione (GSH) levels in EL lymphoma cells relative to Jurkat T cells used as controls ( 8) Data represent mean SE of 4 independent experiments. P value<0.05.

PAGE 71

58 Figure 16. Mitochondri al genome concatemers are present in primary AIDS associated lymphomas and lymphoma cell lines. Primary AIDS associated lymphoma samples, various lymphoma cell lines and normal peripheral T cell controls were analyzed by t he method of Gardella et al. (54) Southern blotting analysis was performed by using human mtDNA specific radiolabeled primer probes. Samples: AIDS associated lymphomas (2F7, 98001, 98002, EL); human body cavity lymphoma tumor cell line positive for KSHV (BCBL 1); B cell Burkitts lym phoma (Raji); H. saimiri induced rabbit lymphoma (484Th) ( 126) ; non Hodgkins lymphoma positive for EBV and HIV (EBVHIV NHL).

PAGE 72

59 l ymphoma cell lines contained an additional band comigrating with EL cccDNA Therefore, all lymphoma cells encode both monomer and concatemer forms of mitochondrial genomes. Small amounts of broken linear mtDNA were also present in all samples probably due to dying of some cells. The linear mitochondrial bands comigrated with controls indicating lack of tandem duplication of m tDNA. In contrast, EL cells contained a unique larger and very strong DNA band, and a faint smaller linear mitochondrial genome. The smaller one was co migrating with bands from all other cells confirming the presence of small amount of monomers in EL ce lls. Taken together, all lymphoma cell lines encode both mitochondrial genome monomers and concatemers consisting of two monomers probably due to interlinking of two unit length mitochondrial circles. Total cccDNA was also purified by CsCl EtBr density gradients from established human lymphoma cell lines such as K562 (a chronic myeloid leukemia cell line), Raji (an EBV positive Burkitts B cell lymphoma) and Molt3 (an acute T cell lymphoma cell line). Results show that these cell lines also contain mtDN A concatemers, although different monomer/concatemer ratios were observed for each sample. An additional band running lower than monomeric mtDNA was obtained in Raji, possibly caused by the presence of EBV. A bar diagram using relative units from densitometric analysis of the gel shows monomer and concatemer amounts in comparison to EL (Figure 17).

PAGE 73

60 Figure 17. Gel electrophoresis and de nsitometric analysi s of cccDNA from human lymphoma cell lines. Total cccDNA was isolated from EL and establish ed cell lines by alkaline cell lysis and CsClEtBr densit y gradients. 5 l of purified c ccDNA from each sample was electrophoresed in an 0.8% agarose gel for 16 h and stained using SYBRGreenTM then visualized in a UV light box. CccDNA bands (monomers o r concatemers) were quantified by densitometric analysis using Image J and plotted on a bar diagram according to relative densitometric units.

PAGE 74

61 Mitochondrial genome concatemers are associated w ith oncogenic transformation of lymphoid cells Gardella gel a nd Southern blotting analyses show that H saimiriimmortalized human T cells (T 484 and 3HB6) contain DNA bands hybridizing with the mtDNA derived radiolabeled probe. Some bands migrate d slower than the wild type mitochondrial genome, representing mtDNA concatemers. A much fainter band was also detected for normal T cells (Figure 18) Densitometric unit mean values between monomers versus concatemers present per cell sample were statistically significant (P values of 0.009 for T cells, 0.03 for T 484 an d 0.06 for 3HB6). Also, mean values between concatemers present in T cells versus immortalized cell lines were significant (P values <0.05) (Figure 19) Statistical a nalysis Students t test s were performed to evaluate relative units from flow cytome try assays of EL versus control cells to determine significance level of variation in mitochondrial function and factors and to compare densitometric unit mean values of monomers and concatemers and of concatemer relative mean value units in normal versu s H saimiri immortalized T cells. A p value<0.05 was considered as significant.

PAGE 75

62 Figure 18. Southern blotting assay of Gardella gel of H erpesvirus saimiri im mortalized human Tcells reveal s the presence of mitochondrial genome concateme rs. Mitochondrial genome concatemers were identified in H erpesvirus saimiri immortalized T cells (T 484 and 3HB6) using the Gardella technique followed by Southern blotting using mtDNA derived oligonucleotides. Figure is representative of 4 independent ex periments.

PAGE 76

63 Figure 19. Densitometric anal ysis of mitochondrial DNA from H erpesvirussaimiri immortalized and normal Tcells. Mitochondrial DNA bands (from Gardella gels) of H erpesvirus saimiri immortalized (T 484 and 3HB6) and normal T cells were analyzed by densitometry. Shown, mean S.E., and P values of monomer and concatemer mean values for each sample, and of concatemer relative mean value units for i mm ortalized versus normal T cells.

PAGE 77

64 Discussion I dentification of mitochondrial genome concatemers in lymphomas In this study, a method was developed for the visualization of cccDNA in mammalian cells based on a cell lysis method previously described ( 54) This technique requires only 1x106 cells and is ideal for screening large num ber of cell samples. It is rapid, reliable and can be concurrently harnessed for the detection of existing or novel episomes of viruses and for the identificat ion of size alterations such as insertions, deletions and concatemerization of mtDNA. M itochon drial genome concatemers were identified in primary tumor suspension samples obtained from AIDS associated lymphoma patients and in seven established mammalian lymphoma cell lines. These concatemers were found to be conformed of two kinds. All lymphoma c ells, except EL cells, contained mitochondrial genome concatemers as interlinked monomers. In contrast, most EL mitochondrial genomes are comprised of two unit length molecules joined in headto tail configuration as demonstrated by several independent methods such as Gardella gels, mtDNA complete and partial digestions, and electron microscopy (Figure 20).

PAGE 78

65 Figure 20 Schematic model of mtDNA configurations identified in AIDS associated lymphomas and lymphoma cell lines. Normal T cells contain mostly wild type mtDNA (monomers of 16 kb), EL cells contain mostly duplicated mitochondrial genomes (dimers of ~ 32 kb), and concatemers (two or more interlocked mitochondrial genomes, were observed in AIDS associated lymphomas and lymphoma cell lines analyzed.

PAGE 79

66 Proposed m olecular mechanism s of mtDNA concatemer formation Although the specific molecular mechanism for mtDNA concatemer formation remains elusive, a consi derable amount of evidence has been reported on processes associated with mtDNA ma intenance and stability which might be responsible for the formation of mtDNA concatemers in transformed lymphoid cells. T wo mechanisms were proposed: h omologous recombination of mtDNA and mtDNA replication. 1) Homologous recombination of mtDNA H omologous recombination (HR) occurs in all life forms, and is an important mechanism for the repair of damaged DNA and maintenance of chromosomal integrity ( 157, 178) In humans, several cancer prone genetic diseases (e.g. Fanconi anemia and Blooms syndr ome) are associated with HR dysfunction or deficiency ( 84, 178, 179) Moreover mutations in the HR mediators BRCA1 and BRCA2 genes have been associated with familial breast and ovarian cancer ( 75) Although HR of the nuclear genome of eukaryotes h as b een extensively studied, much less is known about HR in mitochondria. M tDNA HR has been documented for a few organisms ( 50, 116, 117) In the yeast Saccharomyces cerevisiae an active process of mtDNA HR has been demonstrated ( 111, 113)

PAGE 80

67 It involves the participation of the mitochondrial homologous recombination protein 1 (Mhr1) in the formation of HR intermediates of mtDNA by pairing ssDNA with homologous dsDNA forming heteroduplex joints ( 113) and the resolution of recombination junctions by the cruc iform cutting endonuclease (Cce1) ( 88) Interestingly, Mhr1dependent formation of concatemeric mtDNA was observed when generating mitochondrial homoplasmic yeast cells ( 112) However, m ammalian homolog ues for either one of these proteins still remain to be identified. A homologue of the bacterial recombinase RecA targeted to mitochondria, has been identified in Arabidopsis thaliana an d other eukaryotes ( 85, 137) Also, a RecA homologue targeted to chloroplasts with HR and repair activity was described ( 22) In humans, RecA homologues such as RAD51and RAD52 have been cloned and are currently under intense investigation; however, despite their important role in nuclear HR, none of these proteins has been found in mitochondria ( 110) Hence, it has been hypothesized that other proteins or mechanisms responsible for mtDNA HR (or a similar process) must be present in mammalian mitochondria ( 4) Several reports have shown that HR can also occur in human tissues. Kraytsberg et al. identified heterologous ( paternal and maternal) mtDNA in muscle tissue of an individual with paternal inheritance of the mitochondrial genome ( 93) Kajander et al. detected mtDNA HR intermediates in human heart muscle ( 78) Campbell and colleagues

PAGE 81

68 demonstrated that a human mitoc hondrial protein related to RecA can catalyze HR of the mtDNA in vitro ( 186) Furthermore, spontaneously immortalized murine and human fibroblasts, and primate and murine established fibroblasts cell lines performed HR at frequencies around 100fold higher than did normal cells ( 187) Therefore, formation of mtDNA concatemers might occur through genetic recombination of monomers of the mitochondrial genome, and represents an appealing model to examine within the lymphoma context. In two seminal papers describing genetic recombination in E. coli, Potter H. et al. showed that DNA molecules of the plasmid ColE1 can be recovered from wild type cells as a set of monomer and multimer size rings ( 145, 146) Moreover, they demonstrated that multimers are a product of genetic recombination since bacterial host cells lacking a functional RecA gene could no longer produce such DNA species ( 146) Finally, they proposed that multimers are the result of the maturation of Holliday intermediates formed between two m onomer plasmid molecules ( 146) The elucidation by Mootha and colleagues of a protein compendium for mammalian mitochondria showed that around 50% of the proteins that form the mitochondrial compartment do not have a bona fide mitochondrial targeting seq uence (MTS) ( 141) Therefore, other mechanism(s) for protein translocation analogous to the TIM TO M system must be present in these

PAGE 82

69 organelles ( 130) The identification of such mechanisms might explain how mostly nuclear proteins such as p53 or STAT3 can take transient residence in mitochondria ( 120, 205) Thus, recombinases that function in the nucleus would also be able to translocate under certain circumstances (e.g. neoplastic transformation, oxidative stress, etc. ) by the same mechanism s and induce the formation of concatemeric mtDNA through genetic recombination. 2) MtDNA replication Two models for mammalian mtDNA replication have been proposed: the stranddisplacement and the strandcoupled models (Figures 4 and 5) ( 31) The strand displaceme nt model was mainly determined by the analysis of replication intermediates using EM ( 34) Due to the presence of two separated origins of replication (OH for the heavy DNA strand, and OL for the light DNA strand), during mtDNA replication, two types of m tDNA progeny have been observed: The first one is a duplex circle with a newly synthesized leading strand, and the other is a gapped circle with a partially formed lagging strand ( 31) In both cases, t he addition of nucleotides and strand ligation at the end of the process of mtDNA replication result in the formation of closed circular mtDNA monomer molecules. Therefore, a defective resolution of mtDNA replication intermediates into mature monomer molecules could result in an increase in the amount of concatemers. However, the presence of headto tail

PAGE 83

70 dimers and concatemers in transformed cells would be more in accordance to replication intermediates observed in the strandcoupled model ( 31, 70) Simultaneous bidirectional migration of newly formed leadi ng and lagging strands would result in circular dsDNA dimeric or concatemeric intermediates that would be then processed to form circular monomers in normal cells It is widely accepted that cells undergoing oncogenic transformation have marked differenc es in mtDNA expression and content ( 68, 190) A prospect study on mtDNA copy number and risk of n onHodgkins lymphoma (NHL) showed that mtDNA amounts are increased in patients with chronic lymphocytic leukemia (CLL), in Burkitt s lymphoma and EpsteinBar r virus trans formed lymphoblastoid cell lines ( 97) Although mtDNA configuration was not determined in this study it is possible that increasing amounts of concatemers were also the reason for the overall mtDNA increase detected in these NHL samples Defects in s everal mtDNA replication factors have been associated to human disorders ( 38) M itochondrial genetic diseases can result fro m defects in mtDNA in the form of deletions, point mutations, or depletion. These mutations may be spontaneous, mater nally inherited, or a result of inherited nuclear defects in genes that maintain the mtDNA ( 38, 39) It is possible that

PAGE 84

71 formation of mtDNA concatemers results also from defects in one or more of these factors in cells undergoing oncogenic transformation. Differential expression of A and B subunits of DNApolssDNA binding factor (MtssB) and t he mtDNA helicase (Twinkle) has been reported in leukocytes and in leukemic cell lines in comparison to other human tissues ( 165) (Figures 21 and 22) Furthermore, m utations and SNPs in the gene encoding the catalytic subunit of the mtDNA polymerase, DNApolbeen associated with such diverse disorders as progressive external o phthalmoplegia ( PEO ) parkinsonism, Alpers syndrome, mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), and sensory ataxic neuropathy, dysarthria, and ophthalmoparesis (SANDO) ( 38, 71, 115) However, to date, the effect that mutations or SNPs in DNApolfactor associated with mtDNA replication) may have during neoplastic transformation has not been addressed.

PAGE 85

72 Figure 21. DNApol tissues and human cell lines (GNF Human Gene Atlas). Transcript levels of subuni ts A and B of DNA polym erase gamma (DNApol ) were determined for several human tissues and cell lines (ref. GNF Human Gene Atlas). H ighlighted with brackets, mRNA levels of normal leukocytes and leukemic c ell lines. To note, DNApol mRNA levels are higher in leukocytes (norma l and cell lines) than in any other human tissue analyzed.

PAGE 86

73 Figure 22. MtssB and Twinkle mRNA levels in several human tissues and human cell lines (from GNF Human Gene Atlas). Transcript levels of mitochondrial singlestranded DNA binding protein (MtssB) and mtDNA helicase (Twinkle) were determined for several hum an tissues and cell lines ( GNF Hu man Gene Atlas). Highlighted with brackets, mRNA levels of normal leukocytes and leukemic cell lines. To note, MtssB and Twinkle mRNA levels are higher in normal leukocytes than in any other human tissue analyzed (including leukemic cell lines).

PAGE 87

74 Cytosine insertions in the mtDNA control region Within the mitochondrial genome, a single major noncoding region known as the D loop contains the mai n regulatory sequences for transcription and replication initiation ( 183) DNAp ol initiates replication at the origin bound with the replication primer, and proceeds along one DNA strand d isplacing the other strand ( 26, 34) In EL mitochondrial DNA, one to two cytosine insertions were present at a highly conserved sequence block ( CSB) within the D loop, known as CSBII. The presence of the mtDNA replication primer next to the CSBII suggests that CSBII might be important during initiation/termination of mtDNA replication, serving as a possible docking site for DNApol ( 46) Nevert heless, the lack of an effective method to study mtDNA mutations or insertions in vivo has hindered further investigation on this phenomenon, which may be attributed to random genetic drift or rapid clonal expansion occurring in cells undergoing oncogenic transformation. Interestingly, insertion of C residues in the CSBII has been described as a frequent event in mtDNA alterations in human tumors ( 158) It could be possible that a higher G C content might affect dissociation of the RNA primer from the DNA affecting termination of DNA replication Also, addition of cytosine residues might increase the basepairing binding strength of both DNA strands influencing mtDNA termination and/or release of nascent molecules from parental mtDNA.

PAGE 88

75 Nucleoside a nalogue s used in the treatment of AIDS affect mtDNA stability Highly active antiretroviral therapy (HAART), which includes nucleoside analogue reverse transcriptase inhibitors (NRTIs) in combination with other agents, has changed AIDS from a lethal illness to a chronic, manageable disease ( 106) Withi n the list of NRTIs a zidothymidine (AZT), a thymidine analog ue that inhibits HIV reverse transcription, has been one of the most widely used antiretroviral drugs in the treatment of AIDS. Due to substrate compet itive inhibition AZT can also function as a DNApol( 121, 144, 212) (F igure 23) AZT treatment could result in the induction of impaired mtDNA replication that could promote the formation of mitochondrial genome concatemers and/or other mtDNA abnormalities, which may be associated to oncogenic transformation in individuals with AIDS. It is also recognized that mitochondrial functions are affected as a result of NRTI therapy ( 109) C ardiac dysfunction, hepatic failure, skeletal myopathy, lactic acidosis wi th defective mtDNA replication, mtDNA depletion and altered mitochondrial ultrastructure have been observed in selected tissues in vivo and i n post HAART patients ( 105, 107)

PAGE 89

76 Figure 23. Inhibition of DNA polymerase gamma by NRTIs (AZT). Diagram shows the structure of the mitochondrion. The nucleoside reverse transcriptase inhibitor, AZT, is phosphorylated by thymidine kinase 2 (TK2), the mitochondrial isoform, thus initiating a series of steps that lead to the formation of the active form. DNApol (e.g. AZT TP) to deple te mtDNA by competitive inhibition with the normal pool of nucleo t ide triphosphates Adapted from reference 106

PAGE 90

77 Mitochondrial genome concatemers influence cellular and mitochondrial functions The mtDNA encodes only 1% of the mit o chondrial proteins; however, it is crucial for mitochondrial stability. The mtDNA encoded genes are essential subunits for OXPHOS system assembly and fun ction. Therefore, the mtDNA is necessary for cellular energy production in the form of ATP through OX PHOS from dietary metabolites ( 172) Variations in the mtDNA are highly detrimental for cellular homeostasis ( 38, 115) Full and p artial deletions of the mtDNA have been reported in several conditions including mitochondrial myopathies ( 69) Kearns Sa yre syndrome ( 104) PEO ( 214) and Pearson syndrome ( 154) More than 200 point mutations and rearrangements of the mtDNA have also been associated with human disease ( 29, 103) and some of them have been directly linked to tumorigenesis ( 18, 27) Penta JS et al. proposed that it is possible that the oxidatively stressed environment of tumors may result in high rates of mtDNA mutations and reduced expression of mtDNA encoded polypeptides ( 142) Strik ingly, mutated mtDNA in tumors has been found as mostly h omoplasmic, meaning that all cells within a tumor carry the same mtDNA mutation, a phenomenon that suggests selective advantage to these mutations ( 138) Recently it was reported that particular mtDNA m utations can contribute to tumo r progression. Cells bearing a mutation in the mtDNA gene encoding

PAGE 91

78 NADH dehydrogenase subunit 6 (ND6), have a defective respiratory complex I and subsequently overproduce ROS that increase metastatic potential ( 73) Nevertheless, dimerization or concatemerization of the mtDN A have not been related to any cellular disorder so far. This dissertati on show s evidence that formation of mtDNA concatemers is associated with changes in mitochondrial function and with neoplastic transformation in lymphoid cells. In this study, s ev eral significant alterations in mitochondrial functions and cellular factors associated with mitochondria in EL cells were identified. Probably the decrease in Fas mediated apoptosis is most noteworthy. It has been shown that tumor cells often escape imm une surveillance by downregulating the Fas pathway or by using it to their advantage ( 91) For example, some tumors increase Fas ligand (FasL) expression to induce apoptosis of infiltrating lymphocytes ( 92) Also, some viruses can promote their propagat ion by expressing Fas inhibitory proteins ( 11, 185) In regards to mtDNA, the cleavage and cytoplasmic release of cytochrome b (a mtDNA encoded protein) has been directly linked to Fas induced apoptosis ( 91) However, more studies are required to evaluat e whether these changes in EL cells are a consequence of malignant transformation or represent the result of mtDNA duplication and mutation.

PAGE 92

79 Increased intracellular ROS The role that intracellular ROS play in cellular biology has been controversial. RO S are highly reactive due to the presence of unpaired valence shell electrons. Therefore, during environmental stress, ROS levels increase ( presumably within the mM range) and cause random deleterious oxidation of macromolecules, a condition known as oxidative stress ( 102, 114) M tDNA is constantly subjected to oxidative damage due to direct exposure to ROS as direct byproducts of OXPHOS This damage results in mutations in the mtDNA, which are associated with aging and various mitochondrial disorders ( 7 9) O n the other hand, the treatment of human cells with hydrogen peroxide results in a transient increase in mtDNA copy number suggesting that ROS can regulate mtDNA replication ( 207) Furthermore, the amount of mtDNA correlates with ROS levels in cell lines carrying different mouse mtDNA haplotypes ( 132) Contrary to their role as inducers of cellular toxicity, s everal lines of evidence have shown that high ROS levels are associated with cell survival by deregulation of the PI3 kinase/Akt pathway dur ing tumorigenesis ( 35, 52) Moreover, m itochondrial ROS could also contribute to neoplastic transform ation, both as a tumor inducer by causing mutations in the nuclear DNA in protooncogenes and tumor suppressor genes and as a tumor promoter through prom oting cellular proliferation ( 198) At low levels (within the

PAGE 93

80 M range), ROS have been f ound to be active mitogens. ROS are presumed to act th r ough in teraction with various kinases including Src kinase, protein kinase C, MAPK and receptor tyrosine kinas es and with several transcription factors such as Fos, Jun and NF B ( 124) A significant reduction of glutathione levels was observed in EL cells This may be associated with the elev ation in ROS production, since glutathione works as a biological scav enger of ROS ( 64) Herpesvirus saimiriimmortal ized human T cells contain mitochondrial genome concatemers In order to determine if cells undergoing transformation were able to produce concatemers of mtDNA simi lar to the ones observed in the primary A IDS associated lymphomas and lymphoma cell lines studied, immortalization of no rmal T cells by infection with H erpesvirus saimiri was performed. T his experimental approach was chosen because it has been successfully used in the past to obtain human, rabbi t and marmoset transformed T cell lines ( 126, 127, 181) Discrete bands of mtDNA concatemers were detected by Southern blotting in the T cell lines T 484 and BH36, immortalized with H. saimiri

PAGE 94

81 Additionally, a fainter band representing a s mall amount of concatemers was also detected in normal T cells. This indicates that the process of formation of concatemers might also take place under normal conditions; however, resolution of concatemers into monomers might be defective in n eoplastica lly transformed c ells resulting in ac cumulation of concatemers Statistical analysi s of relative densitometric unit s shows that the mean values between concatemer and monomer amounts for each sample is significant (P values<0.005). This means that there may be an intri nsic mechanism that keeps total mtDNA amounts (and possibly concatemer/monomer ratios) relatively constant within these cells. Notably, t he higher amount of concatemers in immortalized T cells was also statistically significant (P value<0.002) in comparis on to the much lower levels detected in normal T cells. This implies that formation and maintenance of mtDNA concatemers is a condition associated with immortalization of T cells. However, further experiments would be necessary to determine whether mtDNA concatemers can promote oncogenic transformation of normal cells or if they result as byproducts of cellular growth and proliferation observed in cancer.

PAGE 95

82 Proposed m echanism of neoplastic transformation of lymphoid cells by formation and maintenance of mtDNA concatemers Cellular homeostasis and energy production rel y heavily on mtDNA stability ( 177) Mutations in the mtDNA have long been linked to the development and poor prognosis of various types of cancers ( 14, 27, 55, 73, 138) The physiological significance of mtDNA mutations in cancer cells was demonstrated by introducing a known pathogenic mtDNA mutation into the prostate cancer cell line PC3 via transmitochondrial cybrid fusi ons ( 143) Injection of these mutant and wildtype PC3 cybrids into nude mice gave a dramatic result. The PC3 cells containing the normal base (T8993T) barely grew at all. By contrast, the PC3 cybrids with the mutant base (T8993G) generated rapidly growing tumors that killed the mice ( 143) Staining the cellular nodules from both conditions revealed th at the mutant tumors produced much more ROS than the wildtype nodules Thus, underscoring the generation of increased ROS, associated with mutant mtDNA, in the pathophysiology of cancer ( 143) Neoplastically transform ed cells, however, can also harbor nonmutated mtDNA ( 198) Therefore, the presence of mitochondrial genome concatemers may represent an alternative mechanism of increasing intracellular ROS levels, as detected in EL cells. Recently, Lan Q. et al showed that increased mtDNA copy number was associated with a higher risk of developing nonHodkings

PAGE 96

83 lymphoma (NHL) by analyzing blood samples from 208 NHL and healthy individuals ( 97) This dissertation shows evidence that, independent of configuration, overal l mtDNA levels are increased in AIDS a ssociated lymphomas, in lymphoma cell lines and in immortalized T cells. F ormation of mtDNA concatemers is also associated with higher mtDNA levels observed in the se samples Furthermore, imbalance and lower coupling efficiency of the OXPHOS system have been reported in cells with abnormal mtDNA content ( 67, 211) Defects in OXPHOS have long been known as causative of increased ROS levels ( 49, 56, 87, 102) The diffusion of ROS into the nucleus can then mutate protooncogenes, converting them into f unctional oncogenes. I ncreased cytosolic and nuclear ROS activate a variety of cellular signal transduction factors including NF B, APE1 Fos Jun and tyrosine kinases, which drive the cell into replication. Consequentl y, variations in the mtDNA (content and/or mutations) capabl e of affecting the normal function of the OXPHOS machinery result in chronically increased mitochondrial ROS production, which can act as both a tumor initiator (mutation of proto oncogenes) and tumor promoter (activation of transcription and replication) ( 87, 176, 197) ( Figure 24)

PAGE 97

84 Figure 24. Schematic diagram of proposed mechanism of induction of oncogenic transformation by formation and maintenance of mitochondrial genome concatemers. Cells containing mitochon drial genome concatemers show increased mtDNA levels (Figure 19) and higher ROS production (Figure 15). Neoplastically transformed cells upregulate mtDNA gene expression ( 190) generally resulting in a defective (uncoupled) OXPHOS system ( 14, 73) which can also produce higher ROS levels. ROS can inhibit tumor suppressor factors (p16ink4a, p53) and induce transcription factor activation (AP 1, NF B, APE), which results in cellular proliferation ( 176, 198) .

PAGE 98

85 Finally, these experiments have established a clear correlation between mtDNA concatemerization and malignancy of lymphoid cells. However, it is not clear whether concatemerization is a contributing factor to oncogenesis, or alternatively, a result of continuing growth of immor talized cells. Resolution of these possible alternati ves requires further investigation. Summary and f uture directions T he development of techniques to study cccDNAs has been of importance in the understanding of the etiology of human diseases. T his dissertation describes an experimental approach developed in our laboratory and by which a novel extrachromosomal cccDNA was identified in AID S related lymphomas and lymphoma cell lines. This cccDNA is conformed by concatemers of the mitochondrial genom e. Moreover, by immortalizing normal human lymphocytes with Herpesvirus saimiri, it was demonstrat ed that formation of mitochondrial genome concatemers is associated with oncogenic transformation of lymphoid cells. In order to determine the relationsh ip between formation of mtDNA concatemers and oncogenic transformation, two strategies are proposed. First, the fabrication and study of transmitochondrial cybrids using cells containing

PAGE 99

86 either wild type or concatemeric mtDNA, with similar nuclear backgrounds, will determine whether the presence of concatemers is sufficient to induce neoplastic transformation. And second, the study of T cells immortalized with H erpesvirus saimiri could be useful to demonstrate if mtDNA concatemers are simply byproducts of cellular immortalization. Additionally, an increasing timepoint assay after viral infection is proposed to determine when concatemerization of the mtDNA takes place in these cells. Further studies on the mechanism of formation and biologi cal significan ce of mtDNA concatemers may provide a new avenue in the chemotherapeutic treatment of lymphoma.

PAGE 100

87 Literature cited 1. Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, et al Sequence and organization of the human mitochondrial genome. Nature 1981; 290: 457 65. 2. Andersson U, Scarpulla RC Pgc 1 related coactivator, a novel, serum inducible coactivator of nuclear respiratory factor 1dependent transcription in mammalian cells. Mol Cell Biol 2001; 21: 373849. 3. Armstrong JS Mitochondrial medicine: pharmacological targeting of mitochondria in disease. Br J Pharmacol 2007 ; 151 : 115465. 4. Ashkenas J. Homologous recombination in human mitochondria? Am J Hum Genet 1997 ; 61 : 18. 5. Asin Cayuela J, Gustafsson CM. Mitochondrial transcription and its regulation in mammalian cells. Trends Biochem Sci 2007; 32 : 111 7. 6. Attardi G Animal mitochondrial DNA: an extreme example of genetic economy. Int Rev Cytol 1985; 93 : 93145. 7. Attardi G, Schatz G. Biogenesis of mitochondria. An nu Rev Cell Biol 1988; 4 : 289 333.

PAGE 101

88 8. Banki K, Hutter E, Colombo E, Gonchoroff NJ, Perl A Glutathione levels and sensitivity to apoptosis are regulated by changes in transaldolase expression. J Biol Chem 1996; 271 : 329943001. 9. Banki K, Hutter E, Gonc horoff NJ, Perl A Elevation of mitochondrial transmembrane potential and reactive oxygen intermediate levels are early events and occur independently from activation of caspases in Fas signaling. J Immunol 1999; 162 : 146679. 10. Baysal BE, Ferrell RE, W illett Brozick JE, Lawrence EC, Myssiorek D, Bosch A et al Mutations in SDHD, a mitochondrial complex II gene, in hereditary paraganglioma. Science 2000 ; 287: 848 51. 11. Bertin J, Armstrong RC, Ottilie S, Martin DA, Wang Y, Banks S et al Death effect or domaincontaining herpesvirus and poxvirus proteins inhibit both Fas and TNFR1 induced apoptosis. Proc Natl Acad Sci U S A 1997; 94: 11726. 12. Biggar RJ, Jaffe ES, Goedert JJ, Chaturvedi A, Pfeiffer R, Engels EA Hodgkin lymphoma and immunodeficienc y in persons with HIV/AIDS. Blood 2006; 108 : 3786 91. 13. Bonawitz ND, Clayton DA, Shadel GS Initiation and beyond: multiple functions of the human mitochondrial transcription machinery. Mol Cell 2006; 24 : 81325. 14. Brandon M, Baldi P, Wallace DC Mit ochondrial mutations in cancer. Oncogene 2006; 25 : 464762.

PAGE 102

89 15. Broca C, Brennan L, Petit P, Newsholme P, Maechler P Mitochondriaderived glutamate at the interplay between branchedchain amino acid and glucoseinduced insulin secretion. FEBS Lett 2003; 545 : 16772. 16. Carbone A, Cesarman E, Spina M, Gloghini A, Schulz TF. HIV associated lymphomas and gammaherpesviruses. Blood 2009; 113 : 121324. 17. Carbone A, Gloghini A AIDS related lymphomas: from pathogenesis to pathology. Br J Haematol 2005; 130 : 662 70. 18. Carew JS, Huang P Mitochondrial defects in cancer. Mol Cancer 2002; 1 : 9. 19. Carter WO, Narayanan PK, Robinson JP. Intracellular hydrogen peroxide and superoxide anion detection in endothelial cells. J Leukoc Biol 1994; 55: 253 8. 20. Ce reghetti GM, Scorrano L The many shapes of mitochondrial death. Oncogene 2006; 25 : 471724. 21. Cermakian N, Ikeda TM, Cedergren R, Gray MW Sequences homologous to yeast mitochondrial and bacteriophage T3 and T7 RNA polymerases are widespread throughout the eukaryotic lineage. Nucleic Acids Res 1996 ; 24 : 648 54. 22. Cerutti H, Osman M, Grandoni P, Jagendorf AT A homolog of Escherichia coli RecA protein in plastids of higher plants. Proc Natl Acad Sci U S A 1992; 89: 806872.

PAGE 103

90 23. Chan DC Mitochondria: dynamic organelles in disease, aging, and development. Cell 2006 ; 125 : 124152. 24. Chang DD, Clayton DA Mouse RNAase MRP RNA is encoded by a nuclear gene and contains a decamer sequence complementary to a conserved region of mitochondrial RNA substrate. Cell 1989 ; 56 : 131 9. 25. Chang DD, Clayton DA A novel endoribonuclease cleaves at a priming site of mouse mitochondrial DNA replication. EMBO J 1987 ; 6 : 409 17. 26. Chang DD, Clayton DA Priming of human mitochondrial DNA replication occurs at the li ght strand promoter. Proc Natl Acad Sci U S A 1985 ; 82: 3515. 27. Chatterjee A, Mambo E, Sidransky D Mitochondrial DNA mutations in human cancer. Oncogene 2006; 25: 466374. 28. Cheng SM, Li JC, Lin SS, Lee DC, Liu L, Chen Z et al HIV 1 trans activat or protein induction of suppressor of cytokine signaling 2 contributes to dysregulation of IFN{gamma} signaling. Blood 2009;. 29. Chinnery PF, Howell N, Andrews RM, Turnbull DM Mitochondrial DNA analysis: polymorphisms and pathogenicity. J Med Genet 1999; 36 : 50510. 30. Chinnery PF, Samuels DC, Elson J, Turnbull DM Accumulation of mitochondrial DNA mutations in ageing, cancer, and mitochondrial disease: is there a common mechanism? Lancet 2002; 360: 13235.

PAGE 104

91 31. Clayton DA Mitochondrial DNA replicatio n: what we know. IUBMB Life 2003; 55 : 2137. 32. Clayton DA Replication and transcription of vertebrate mitochondrial DNA. Annu Rev Cell Biol 1991; 7 : 45378. 33. Clayton DA Transcription of the mammalian mitochondrial genome. Annu Rev Biochem 1984; 53: 573 94. 34. Clayton DA Replication of animal mitochondrial DNA. Cell 1982; 28: 693705. 35. Clerkin JS, Naughton R, Quiney C, Cotter TG Mechanisms of ROS modulated cell survival during carcinogenesis. Cancer Lett 2008; 266 : 306. 36. Coenen MJ, van den Heuvel LP, Smeitink JA Mitochondrial oxidative phosphorylation system assembly in man: recent achievements. Curr Opin Neurol 2001; 14 : 77781. 37. Collins CM, Medveczky MM, Lund T, Medveczky PG The terminal repeats and latency associated nuclear ant igen of herpesvirus saimiri are essential for episomal persistence of the viral genome. J Gen Virol 2002; 83 : 226978. 38. Copeland WC Inherited mitochondrial diseases of DNA replication. Annu Rev Med 2008; 59 : 131 46. 39. Copeland WC, Wachsman JT, Johnson FM, Penta JS Mitochondrial DNA alterations in cancer. Cancer Invest 2002 ; 20 : 557 69.

PAGE 105

92 40. Cossarizza A, Franceschi C, Monti D, Salvioli S, Bellesia E, Rivabene R et al Protective effect of N acetylcysteine in tumor necrosis factor alphainduced apoptosis in U937 cells: the role of mitochondria. Exp Cell Res 1995; 220 : 232 40. 41. da Fonseca RR, Johnson WE, O'Brien SJ, Ramos MJ, Antunes A The adaptive evolution of the mammalian mitochondrial genome. BMC Genomics 2008; 9 : 119. 42. Detmer SA, Chan D C Functions and dysfunctions of mitochondrial dynamics. Nat Rev Mol Cell Biol 2007; 8 : 870 9. 43. Diamond C, Taylor TH, Aboumrad T, AntonCulver H. Changes in acquired immunodeficiency syndromerelated nonHodgkin lymphoma in the era of highly active ant iretroviral therapy: incidence, presentation, treatment, and survival. Cancer 2006; 106 : 128 35. 44. Dimauro S, Davidzon G Mitochondrial DNA and disease. Ann Med 2005; 37 : 22232. 45. Doersen CJ, Guerrier Takada C, Altman S, Attardi G Characterization of an RNase P activity from HeLa cell mitochondria. Comparison with the cytosol RNase P activity. J Biol Chem 1985; 260 : 59429. 46. Falkenberg M, Larsson NG, Gustafsson CM DNA replication and transcription in mammalian mitochondria. Annu Rev Biochem 2007 ; 76: 67999.

PAGE 106

93 47. Fernandez Silva P, Enriquez JA, Montoya J Replication and transcription of mammalian mitochondrial DNA. Exp Physiol 2003; 88 : 4156. 48. Fernandez Vizarra E, Enriquez JA, Perez Martos A, Montoya J, Fernandez Silva P Mitochondrial gene expression is regulated at multiple levels and differentially in the heart and liver by thyroid hormones. Curr Genet 2008; 54 : 1322. 49. Fernandez Vizarra E, Tiranti V, Zeviani M Assembly of the oxidative phosphorylation system in humans: what we have learned by studying its defects. Biochim Biophys Acta 2009; 1793 : 200 11. 50. Filipowicz M, Burzynski A, Smietanka B, Wenne R Recombination in mitochondrial DNA of European mussels Mytilus. J Mol Evol 2008; 67: 37788. 51. Gaines G, Rossi C, Attardi G Markedly different ATP requirements for rRNA synthesis and mtDNA light strand transcription versus mRNA synthesis in isolated human mitochondria. J Biol Chem 1987 ; 262 : 190715. 52. Galaris D, Skiada V, Barbouti A Redox signaling and cancer: the role of "labile" iron. Cancer Lett 2008; 266 : 219. 53. Galluzzi L, Larochette N, Zamzami N, Kroemer G Mitochondria as therapeutic targets for cancer chemotherapy. Oncogene 2006; 25 : 481230.

PAGE 107

94 54. Gardella T, Medveczky P, Sairenji T, Mulder C Detection of circ ular and linear herpesvirus DNA molecules in mammalian cells by gel electrophoresis. J Virol 1984; 50: 24854. 55. Gasparre G, Porcelli AM, Bonora E, Pennisi LF, Toller M, Iommarini L, et al Disruptive mitochondrial DNA mutations in complex I subunits ar e markers of oncocytic phenotype in thyroid tumors. Proc Natl Acad Sci U S A 2007 ; 104 : 90016. 56. Gibson BW The human mitochondrial proteome: oxidative stress, protein modifications and oxidative phosphorylation. Int J Biochem Cell Biol 2005; 37: 927 3 4. 57. Gillies RJ, Gatenby RA Adaptive landscapes and emergent phenotypes: why do cancers have high glycolysis? J Bioenerg Biomembr 2007; 39 : 2517. 58. Goedert JJ The epidemiology of acquired immunodeficiency syndrome malignancies. Semin Oncol 2000 ; 2 7 : 390 401. 59. Gogvadze V, Orrenius S, Zhivotovsky B Mitochondria as targets for cancer chemotherapy. Semin Cancer Biol 2009 ; 19 : 57 66. 60. Gottlieb RA Mitochondria: execution central. FEBS Lett 2000; 482 : 6 12. 61. Grandemange S, Herzig S, Martinou JC Mitochondrial dynamics and cancer. Semin Cancer Biol 2009; 19: 506.

PAGE 108

95 62. Green RE, Malaspinas AS, Krause J, Briggs AW, Johnson PL, Uhler C et al A complete Neandertal mitochondrial genome sequence determined by highthroughput sequencing. Cell 2008 ; 134 : 416 26. 63. Grogg KL, Miller RF, Dogan A HIV infection and lymphoma. J Clin Pathol 2007; 60 : 136572. 64. Hayes JD, McLellan LI Glutathione and glutathionedependent enzymes represent a coordinately regulated defence against oxidative stress. F ree Radic Res 1999; 31: 273300. 65. He L, Chinnery PF, Durham SE, Blakely EL, Wardell TM, Borthwick GM et al Detection and quantification of mitochondrial DNA deletions in individual cells by real time PCR. Nucleic Acids Res 2002 ; 30 : e68. 66. Heddi A Stepien G, Benke PJ, Wallace DC Coordinate induction of energy gene expression in tissues of mitochondrial disease patients. J Biol Chem 1999 ; 274 : 2296876. 67. Higuchi M Regulation of mitochondrial DNA content and cancer. Mitochondrion 2007 ; 7 : 537 68. Higuchi M Regulation of mitochondrial DNA content and cancer. Mitochondrion 2007 ; 7 : 537. 69. Holt IJ, Harding AE, MorganHughes JA Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature 1988; 331 : 717 9.

PAGE 109

96 70. Ho lt IJ, Lorimer HE, Jacobs HT Coupled leading and lagging strand synthesis of mammalian mitochondrial DNA. Cell 2000 ; 100 : 515 24. 71. Hudson G, Chinnery PF Mitochondrial DNA polymerase gamma and human disease. Hum Mol Genet 2006 ; 15 Spec No 2: R244 52. 72. Ishii N, Fujii M, Hartman PS, Tsuda M, Yasuda K, SenooMatsuda N et al A mutation in succinate dehydrogenase cytochrome b causes oxidative stress and ageing in nematodes. Nature 1998 ; 394 : 694 7. 73. Ishikawa K, Takenaga K, Akimoto M, Koshikawa N, Yamaguchi A, Imanishi H, et al ROS generating mitochondrial DNA mutations can regulate tumor cell metastasis. Science 2008; 320 : 661 4. 74. Ishikawa K, Takenaga K, Akimoto M, Koshikawa N, Yamaguchi A, Imanishi H, et al ROS generating mitochondrial DNA mutations can regulate tumor cell metastasis. Science 2008; 320 : 661 4. 75. Jasin M Homologous repair of DNA damage and tumorigenesis: the BRCA connection. Oncogene 2002 ; 21 : 8981 93. 76. Jeong SY, Seol DW The role of mitochondria in apoptosis. BMB Rep 2008; 41 : 1122. 77. Kai Y, Takamatsu C, Tokuda K, Okamoto M, Irita K, Takahashi S Rapid and random turnover of mitochondrial DNA in rat hepatocytes of primary culture. Mitochondrion 2006; 6 : 299 304.

PAGE 110

97 78. Kajander OA, Karhunen PJ, Holt IJ, Jacobs HT P rominent mitochondrial DNA recombination intermediates in human heart muscle. EMBO Rep 2001; 2 : 100712. 79. Kang D, Hamasaki N Alterations of mitochondrial DNA in common diseases and disease states: aging, neurodegeneration, heart failure, diabetes, and cancer. Curr Med Chem 2005 ; 12: 42941. 80. Kang D, Hamasaki N Maintenance of mitochondrial DNA integrity: repair and degradation. Curr Genet 2002 ; 41 : 311 22. 81. Kang D, Miyako K, Kai Y, Irie T, Takeshige K In vivo determination of replication origi ns of human mitochondrial DNA by ligationmediated polymerase chain reaction. J Biol Chem 1997 ; 272 : 15275 9. 82. Kedzierska K, Crowe SM Cytokines and HIV 1: interactions and clinical implications. Antivir Chem Chemother 2001 ; 12 : 133 50. 83. Kelly DP, Scarpulla RC Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev 2004; 18 : 357 68. 84. Kennedy RD, D'Andrea AD The Fanconi Anemia/BRCA pathway: new faces in the crowd. Genes Dev 2005; 19: 2925 40. 85. Khazi FR, Edmondson AC, Nielsen BL. An Arabidopsis homologue of bacterial RecA that complements an E. coli recA deletion is targeted to plant mitochondria. Mol Genet Genomics 2003; 269 : 454 63. 86. Killebrew D, Shiramizu B Pathogenesis of HIV associated nonHo dgkin lymphoma. Curr HIV Res 2004; 2 : 21521.

PAGE 111

98 87. Klaunig JE, Kamendulis LM The role of oxidative stress in carcinogenesis. Annu Rev Pharmacol Toxicol 2004; 44 : 23967. 88. Kleff S, Kemper B, Sternglanz R Identification and characterization of yeast mutants and the gene for a cruciform cutting endonuclease. EMBO J 1992; 11: 699704. 89. Knowles DM Etiology and pathogenesis of AIDS related nonHodgkin's lymphoma. Hematol Oncol Clin North Am 2003; 17: 785 820. 90. Kobzik L, Godleski JJ, Brain JD Oxida tive metabolism in the alveolar macrophage: analysis by flow cytometry. J Leukoc Biol 1990; 47: 295 303. 91. Komarov AP, Rokhlin OW, Yu CA, Gudkov AV Functional genetic screening reveals the role of mitochondrial cytochrome b as a mediator of FAS induced apoptosis. Proc Natl Acad Sci U S A 2008; 105 : 14453 8. 92. Krammer PH CD95's deadly mission in the immune system. Nature 2000; 407 : 789 95. 93. Kraytsberg Y, Schwartz M, Brown TA, Ebralidse K, Kunz WS, Clayton DA et al Recombination of human mitochondrial DNA. Science 2004 ; 304: 981. 94. Krishnan KJ, Greaves LC, Reeve AK, Turnbull DM Mitochondrial DNA mutations and aging. Ann N Y Acad Sci 2007 ; 1100: 22740.

PAGE 112

99 95. Kujoth GC, Hiona A, Pugh TD, Someya S, Panzer K, Wohlgemuth SE et al Mitochondrial D NA mutations, oxidative stress, and apoptosis in mammalian aging. Science 2005; 309 : 481 4. 96. Lakhani SA, Masud A, Kuida K, Porter GA,Jr, Booth CJ, Mehal WZ et al Caspases 3 and 7: key mediators of mitochondrial events of apoptosis. Science 2006 ; 311 : 847 51. 97. Lan Q, Lim U, Liu CS, Weinstein SJ, Chanock S, Bonner MR et al A prospective study of mitochondrial DNA copy number and risk of non Hodgkin lymphoma. Blood 2008; 112 : 42479. 98. Lang BF, Gray MW, Burger G Mitochondrial genome evolution and the origin of eukaryotes. Annu Rev Genet 1999; 33: 35197. 99. Lang D, Mitani M Simplified quantitative electron microscopy of biopolymers. Biopolymers 1970; 9 : 373 9. 100. Larizza A, Pesole G, Reyes A, Sbisa E, Saccone C Lineage specificity of the evolutionary dynamics of the mtDNA D loop region in rodents. J Mol Evol 2002; 54 : 14555. 101. Laurence J, Astrin SM Human immunodeficiency virus induction of malignant transformation in human B lymphocytes. Proc Natl Acad Sci U S A 1991 ; 88 : 76359. 102. Lee HC, Wei YH. Oxidative stress, mitochondrial DNA mutation, and apoptosis in aging. Exp Biol Med (Maywood) 2007; 232 : 592 606.

PAGE 113

100 103. Leonard JV, Schapira AH Mitochondrial respiratory chain disorders I: mitochondrial DNA defects. Lancet 2000 ; 355: 299 304. 104. Lestienne P, Ponsot G Kearns Sayre syndrome with muscle mitochondrial DNA deletion. Lancet 1988; 1 : 885. 105. Lewis W Cardiomyopathy, nucleoside reverse transcriptase inhibitors and mitochondria are linked through AIDS and its therapy. Mitoc hondrion 2004; 4 : 141 52. 106. Lewis W, Day BJ, Copeland WC Mitochondrial toxicity of NRTI antiviral drugs: an integrated cellular perspective. Nat Rev Drug Discov 2003 ; 2 : 81222. 107. Lewis W, Levine ES, Griniuviene B, Tankersley KO, Colacino JM, Somm adossi JP et al Fialuridine and its metabolites inhibit DNA polymerase gamma at sites of multiple adjacent analog incorporation, decrease mtDNA abundance, and cause mitochondrial structural defects in cultured hepatoblasts. Proc Natl Acad Sci U S A 1996 ; 93 : 35927. 108. Lightowlers RN, Chinnery PF, Turnbull DM, Howell N Mammalian mitochondrial genetics: heredity, heteroplasmy and disease. Trends Genet 1997 ; 13 : 450 5. 109. Lim SE, Ponamarev MV, Longley MJ, Copeland WC Structural determinants in human DNA polymerase gamma account for mitochondrial toxicity from nucleoside analogs. J Mol Biol 2003; 329 : 4557.

PAGE 114

101 110. Lin Z, Kong H, Nei M, Ma H Origins and evolution of the recA/RAD51 gene family: evidence for ancient gene duplication and endosymbiotic ge ne transfer. Proc Natl Acad Sci U S A 2006 ; 103 : 10328 33. 111. Ling F, Makishima F, Morishima N, Shibata T A nuclear mutation defective in mitochondrial recombination in yeast. EMBO J 1995; 14 : 4090101. 112. Ling F, Shibata T Mhr1pdependent concatem eric mitochondrial DNA formation for generating yeast mitochondrial homoplasmic cells. Mol Biol Cell 2004 ; 15 : 310 22. 113. Ling F, Shibata T Recombinationdependent mtDNA partitioning: in vivo role of Mhr1p to promote pairing of homologous DNA. EMBO J 2 002 ; 21: 473040. 114. Linnane AW, Kios M, Vitetta L. Healthy aging: regulation of the metabolome by cellular redox modulation and prooxidant signaling systems: the essential roles of superoxide anion and hydrogen peroxide. Biogerontology 2007 ; 8 : 445 67. 115. Longley MJ, Graziewicz MA, Bienstock RJ, Copeland WC Consequences of mutations in human DNA polymerase gamma. Gene 2005; 354 : 125 31. 116. Lunt DH, Hyman BC Animal mitochondrial DNA recombination. Nature 1997; 387 : 247.

PAGE 115

102 117. Manchekar M, Scissum Gunn K, Song D, Khazi F, McLean SL, Nielsen BL DNA recombination activity in soybean mitochondria. J Mol Biol 2006; 356 : 288 99. 118. Mancini M, Anderson BO, Caldwell E, Sedghinasab M, Paty PB, Hockenbery DM Mitochondrial proliferation and paradoxical membrane depolarization during terminal differentiation and apoptosis in a human colon carcinoma cell line. J Cell Biol 1997 ; 138 : 44969. 119. Mandelkern M, Raines J Positron emission tomography in cancer research and treatment. Technol Cancer Res Treat 2002 ; 1 : 423 39. 120. Marchenko ND, Zaika A, Moll UM Death signal induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. J Biol Chem 2000; 275 : 16202 12. 121. Martin JL, Brown CE, Matthews Davis N, Reardon JE Eff ects of antiviral nucleoside analogs on human DNA polymerases and mitochondrial DNA synthesis. Antimicrob Agents Chemother 1994; 38: 27439. 122. Martin SJ, Reutelingsperger CP, McGahon AJ, Rader JA, van Schie RC, LaFace DM et al Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl 2 and Abl. J Exp Med 1995; 182 : 154556. 123. McBride HM, Neuspiel M, Wasiak S Mitochondria: more than just a powerhouse. Curr Biol 2006; 16 : R551 60.

PAGE 116

103 124. McCord JM The evolution of free radicals and oxidative stress. Am J Med 2000; 108 : 6529. 125. Medveczky P., Chang C W., Oste C., Mulder C. Rapid Vacuum Driven Transfer of DNA and RNA From Gels to Solid Supports. Biothechniques 1987; 5 : 242. 126. Medveczky MM, Szomolanyi E, Hesselton R, DeGrand D, Geck P, Medveczky PG Herpesvirus saimiri strains from three DNA subgroups have different oncogenic potentials in New Zealand white rabbits. J Virol 1989; 63 : 360 1 11. 127. Medveczky PG, Medveczky MM Expression of interleukin 2 receptors in T cells transformed by strains of Herpesvirus saimiri representing three DNA subgroups. Intervirology 1989; 30 : 213 26. 128. Mehrabian Z, Liu LI, Fiskum G, Rapoport SI, Chandrasekaran K Regulation of mitochondrial gene expression by energy demand in neural cells. J Neurochem 2005; 93: 850 60. 129. Miles KA, Williams RE Warburg revisited: imaging tumour blood flow and metabolism. Cancer Imaging 2008; 8 : 81 6. 130. Mokranjac D, Neupert W Thirty years of protein translocation into mitochondria: unexpectedly complex and still puzzling. Biochim Biophys Acta 2009 ; 1793 : 33 41. 131. Moraes CT What regulates mitochondrial DNA copy number in animal cells? Trends Genet 2001; 17 : 1 99205.

PAGE 117

104 132. MorenoLoshuertos R, AcinPerez R, Fernandez Silva P, Movilla N, Perez Martos A, Rodriguez de Cordoba S et al Differences in reactive oxygen species production explain the phenotypes associated with common mouse mitochondrial DNA variants. Nat Genet 2006; 38 : 12618. 133. Nadege B, Patrick L, Rodrigue R Mitochondria: from bioenergetics to the metabolic regulation of carcinogenesis. Front Biosci 2009; 14 : 4015 34. 134. Narasimhan N, Attardi G Specific requirement for ATP at an early step of in vitro transcription of human mitochondrial DNA. Proc Natl Acad Sci U S A 1987 ; 84 : 407882. 135. Navarro WH, Kaplan LD AIDS related lymphoproliferative disease. Blood 2006; 107 : 13 20. 136. Noguchi K, Fukazawa H, Murakami Y, Takahashi N, Yamagoe S Uehara Y Gamma herpesviruses and cellular signaling in AIDS associated malignancies. Cancer Sci 2007 ; 98 : 128896. 137. Ogawa T, Shinohara A, Nabetani A, Ikeya T, Yu X, Egelman EH et al RecA like recombination proteins in eukaryotes: functions and st ructures of RAD51 genes. Cold Spring Harb Symp Quant Biol 1993; 58 : 567 76. 138. Ohta S Contribution of somatic mutations in the mitochondrial genome to the development of cancer and tolerance against anticancer drugs. Oncogene 2006; 25 : 476876.

PAGE 118

105 139. O hta S A multi functional organelle mitochondrion is involved in cell death, proliferation and disease. Curr Med Chem 2003; 10: 248594. 140. Ojala D, Montoya J, Attardi G tRNA punctuation model of RNA processing in human mitochondria. Nature 1981; 290 : 4704. 141. Pagliarini DJ, Calvo SE, Chang B, Sheth SA, Vafai SB, Ong SE et al A mitochondrial protein compendium elucidates complex I disease biology. Cell 2008 ; 134 : 112 23. 142. Penta JS, Johnson FM, Wachsman JT, Copeland WC Mitochondrial DNA in hu man malignancy. Mutat Res 2001; 488 : 119 33. 143. Petros JA, Baumann AK, Ruiz Pesini E, Amin MB, Sun CQ, Hall J et al mtDNA mutations increase tumorigenicity in prostate cancer. Proc Natl Acad Sci U S A 2005; 102: 719 24. 144. Pinti M, Salomoni P, Coss arizza A Anti HIV drugs and the mitochondria. Biochim Biophys Acta 2006; 1757 : 700 7. 145. Potter H, Dressler D In vitro system from Escherichia coli that catalyzes generalized genetic recombination. Proc Natl Acad Sci U S A 1978 ; 75: 3698702. 146. Po tter H, Dressler D On the mechanism of genetic recombination: the maturation of recombination intermediates. Proc Natl Acad Sci U S A 1977; 74 : 416872. 147. Rabkin CS Epidemiology of AIDS related malignancies. Curr Opin Oncol 1994 ; 6 : 492 6.

PAGE 119

106 148. Raphael M, Borisch B, Jaffe E Lymphomas associated with infection by the human immune deficiency virus (HIV). 2001;: 2603. 149. Reyes A, Yasukawa T, Holt IJ Analysis of replicating mitochondrial DNA by two dimensional agarose gel electrophoresis. Methods M ol Biol 2007; 372: 219 32. 150. Richter C, Kass GE Oxidative stress in mitochondria: its relationship to cellular Ca2+ homeostasis, cell death, proliferation, and differentiation. Chem Biol Interact 1991 ; 77 : 1 23. 151. Rieder MJ, Taylor SL, Tobe VO, Ni ckerson DA Automating the identification of DNA variations using quality based fluorescence resequencing: analysis of the human mitochondrial genome. Nucleic Acids Res 1998; 26: 967 73. 152. Rossignol R, Faustin B, Rocher C, Malgat M, Mazat JP, Letellier T Mitochondrial threshold effects. Biochem J 2003; 370 : 75162. 153. Rothe G, Valet G Flow cytometric analysis of respiratory burst activity in phagocytes with hydroethidine and 2',7' dichlorofluorescin. J Leukoc Biol 1990; 47 : 4408. 154. Rotig A, Cormier V, Blanche S, Bonnefont JP, Ledeist F, Romero N et al Pearson's marrow pancreas syndrome. A multisystem mitochondrial disorder in infancy. J Clin Invest 1990; 86: 16018. 155. Rustin P, Kroemer G Mitochondria and cancer. Ernst Schering Found Sym p Proc 2007; (4): 1 21.

PAGE 120

107 156. Ryan MT, Hoogenraad NJ Mitochondrial nuclear communications. Annu Rev Biochem 2007; 76 : 701 22. 157. San Filippo J, Sung P, Klein H Mechanism of eukaryotic homologous recombination. Annu Rev Biochem 2008; 77 : 22957. 158. Sanchez Cespedes M, Parrella P, Nomoto S, Cohen D, Xiao Y, Esteller M et al Identification of a mononucleotide repeat as a major target for mitochondrial DNA alterations in human tumors. Cancer Res 2001; 61 : 70159. 159. Sbisa E, Tanzariello F, Reyes A, Pesole G, Saccone C Mammalian mitochondrial D loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene 1997; 205 : 125 40. 160. Scarpulla RC Nuclear control of respiratory chain expression by nuclear respiratory factors and PGC 1 related coactivator. Ann N Y Acad Sci 2008; 1147 : 321 34. 161. Scarpulla RC Transcriptional paradigms in mammalian mitochondrial biogenesis and function. Physiol Rev 2008 ; 88 : 611 38. 162. Scarpulla RC Nuclear control of respiratory gene expression in mammalian cells. J Cell Biochem 2006 ; 97 : 673 83. 163. Scarpulla RC Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim Biophys Acta 2002 ; 1576: 1 14.

PAGE 121

108 164. Scharfe C, Lu HH, Neuenburg JK, Allen EA, Li GC, Klopstock T et al Mapping gene associations in human mitochondria using clinical disease phenotypes. PLoS Comput Biol 2009; 5 : e1000374. 165. Schultz RA, Swoap SJ, McDaniel LD, Zhang B, Koon EC, Garry DJ et al Differ ential expression of mitochondrial DNA replication factors in mammalian tissues. J Biol Chem 1998 ; 273 : 344751. 166. Schulz TF KSHV/HHV8 associated lymphoproliferations in the AIDS setting. Eur J Cancer 2001; 37 : 121726. 167. Schwartz M, Vissing J. Pa ternal inheritance of mitochondrial DNA. N Engl J Med 2002 ; 347 : 57680. 168. Shadel GS, Clayton DA Mitochondrial DNA maintenance in vertebrates. Annu Rev Biochem 1997; 66: 409 35. 169. Shoffner JM, Wallace DC Oxidative phosphorylation diseases and mit ochondrial DNA mutations: diagnosis and treatment. Annu Rev Nutr 1994; 14 : 53568. 170. Shuey DJ, Attardi G Characterization of an RNA polymerase activity from HeLa cell mitochondria, which initiates transcription at the heavy strand rRNA promoter and the light strand promoter in human mitochondrial DNA. J Biol Chem 1985 ; 260 : 19528. 171. Shutt TE, Gray MW Bacteriophage origins of mitochondrial replication and transcription proteins. Trends Genet 2006 ; 22: 905.

PAGE 122

109 172. Smeitink J, van den Heuvel L, DiMauro S The genetics and pathology of oxidative phosphorylation. Nat Rev Genet 2001 ; 2 : 342 52. 173. Smiley ST, Reers M, Mottola Hartshorn C, Lin M, Chen A, Smith TW et al Intracellular heterogeneity in mitochondrial membrane potentials revealed by a J a ggregateforming lipophilic cation JC 1. Proc Natl Acad Sci U S A 1991; 88: 36715. 174. St John JC, Amaral A, Bowles E, Oliveira JF, Lloyd R, Freitas M et al The analysis of mitochondria and mitochondrial DNA in human embryonic stem cells. Methods Mol Biol 2006 ; 331 : 347 74. 175. St John JC, Bowles EJ, Amaral A Sperm mitochondria and fertilisation. Soc Reprod Fertil Suppl 2007; 65: 399 416. 176. Starkov AA. The role of mitochondria in reactive oxygen species metabolism and signaling. Ann N Y Acad Sci 2008; 1147 : 37 52. 177. Stuart JA, Brown MF Mitochondrial DNA maintenance and bioenergetics. Biochim Biophys Acta 2006; 1757: 7989. 178. Sung P, Klein H Mechanism of homologous recombination: mediators and helicases take on regulatory functions. Nat Rev Mol Cell Biol 2006; 7 : 739 50. 179. Surralles J, Jackson SP, Jasin M, Kastan MB, West SC, Joenje H Molecular cross talk among chromosome fragility syndromes. Genes Dev 2004; 18: 135970.

PAGE 123

110 180. Sutovsky P, Moreno RD, RamalhoSantos J, Dominko T, Simer ly C, Schatten G Ubiquitin tag for sperm mitochondria. Nature 1999; 402 : 3712. 181. Szomolanyi E, Medveczky P, Mulder C In vitro immortalization of marmoset cells with three subgroups of herpesvirus saimiri. J Virol 1987; 61: 348590. 182. Tanner MK, Wellhausen SR, Klein JB Flow cytometric analysis of altered mononuclear cell transmembrane potential induced by cyclosporin. Cytometry 1993; 14: 5969. 183. Tapper DP, Clayton DA Mechanism of replication of human mitochondrial DNA. Localization of the 5' ends of nascent daughter strands. J Biol Chem 1981; 256 : 510915. 184. Taylor RW, Turnbull DM Mitochondrial DNA mutations in human disease. Nat Rev Genet 2005 ; 6 : 389 402. 185. Thome M, Schneider P, Hofmann K, Fickenscher H, Meinl E, Neipel F et al Viral FLICE inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 1997 ; 386 : 517 21. 186. Thyagarajan B, McCormick Graham M, Romero DP, Campbell C Characterization of homologous DNA recombination activity in normal and immortal mammalian cells. Nucleic Acids Res 1996; 24: 408491.

PAGE 124

111 187. Thyagarajan B, McCormick Graham M, Romero DP, Campbell C Characterization of homologous DNA recombination activity in normal and immortal mammalian cells. Nucleic Acids Res 1996; 24: 408491. 188. Tomlinson IP, Alam NA, Rowan AJ, Barclay E, Jaeger EE, Kelsell D et al Germline mutations in FH predispose to dominantly inherited uterine fibroids, skin leiomyomata and papillary renal cell cancer. Nat Genet 2002; 30 : 40610. 189. Topper JN, Bennet t JL, Clayton DA A role for RNAase MRP in mitochondrial RNA processing. Cell 1992; 70: 1620. 190. Torroni A, Stepien G, Hodge JA, Wallace DC Neoplastic transformation is associated with coordinate induction of nuclear and cytoplasmic oxidative phosphor ylation genes. J Biol Chem 1990; 265 : 20589 93. 191. Trauth BC, Klas C, Peters AM, Matzku S, Moller P, Falk W et al Monoclonal antibody mediated tumor regression by induction of apoptosis. Science 1989 ; 245 : 301 5. 192. Trounce I Genetic control of ox idative phosphorylation and experimental models of defects. Hum Reprod 2000; 15 Suppl 2 : 18 27. 193. Vermes I, Haanen C, Steffens Nakken H, Reutelingsperger C A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on earl y apoptotic cells using fluorescein labelled Annexin V. J Immunol Methods 1995; 184 : 39 51.

PAGE 125

112 194. Villena JA, Carmona MC, Rodriguez de la Concepcion M, Rossmeisl M, Vinas O, Mampel T et al Mitochondrial biogenesis in brown adipose tissue is associated wi th differential expression of transcription regulatory factors. Cell Mol Life Sci 2002; 59: 193444. 195. Wagner BK, Kitami T, Gilbert TJ, Peck D, Ramanathan A, Schreiber SL, et al Largescale chemical dissection of mitochondrial function. Nat Biotechnol 2008; 26: 343 51. 196. Wallace DC Mitochondria as chi. Genetics 2008; 179 : 72735. 197. Wallace DC The mitochondrial genome in human adaptive radiation and disease: on the road to therapeutics and performance enhancement. Gene 2005; 354 : 169 80. 198. Wallace DC A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet 2005; 39 : 359 407. 199. Wallace DC Animal models for mitochondrial disease. Methods Mol Biol 2002; 197 : 3 54 200. Wallace DC Mitochondrial diseases in man and mouse. Science 1999; 283: 14828. 201. Wallace DC Mitochondrial DNA sequence variation in human evolution and disease. Proc Natl Acad Sci U S A 1994 ; 91: 873946. 202. Wallace DC Diseases of the mit ochondrial DNA. Annu Rev Biochem 1992; 61 : 1175212.

PAGE 126

113 203. Wang JL, Zhang ZJ, Choksi S, Shan S, Lu Z, Croce CM et al Cell permeable Bcl 2 binding peptides: a chemical approach to apoptosis induction in tumor cells. Cancer Res 2000; 60 : 1498502. 204. Wa rburg O On the origin of cancer cells. Science 1956; 123 : 309 14. 205. Wegrzyn J, Potla R, Chwae YJ, Sepuri NB, Zhang Q, Koeck T et al Function of mitochondrial Stat3 in cellular respiration. Science 2009 ; 323: 793 7. 206. Wei YH, Lu CY, Lee HC, Pang CY, Ma YS Oxidative damage and mutation to mitochondrial DNA and agedependent decline of mitochondrial respiratory function. Ann N Y Acad Sci 1998; 854 : 15570. 207. Wei YH, Lu CY, Wei CY, Ma YS, Lee HC Oxidative stress in human aging and mitochondrial diseaseconsequences of defective mitochondrial respiration and impaired antioxidant enzyme system. Chin J Physiol 2001 ; 44 : 1 11. 208. Wolff JN, Gemmell NJ Lost in the zygote: the dilution of paternal mtDNA upon fertilization. Heredity 2008; 101 : 429 3 4. 209. Wood C, Harrington W,Jr AIDS and associated malignancies. Cell Res 2005; 15 : 94752. 210. Wu WS The signaling mechanism of ROS in tumor progression. Cancer Metastasis Rev 2006; 25: 695705.

PAGE 127

114 211. Xing J, Chen M, Wood CG, Lin J, Spitz MR, Ma J et al Mitochondrial DNA content: its genetic heritability and association with renal cell carcinoma. J Natl Cancer Inst 2008; 100 : 1104 12. 212. Yamanaka H, Gatanaga H, Kosalaraksa P, MatsuokaAizawa S, Takahashi T, Kimura S et al Novel mutation of hum an DNA polymerase gamma associated with mitochondrial toxicity induced by anti HIV treatment. J Infect Dis 2007; 195 : 141925. 213. Zahn RK, Tiesler E, Kleinschmidt AK, Lang D A preservation and preparation process for desoxyribonucleic acids and their r aw materials. Biochem Z 1962; 336 : 28198. 214. Zeviani M, Antozzi C Mitochondrial disorders. Mol Hum Reprod 1997 ; 3 : 13348. 215. Zhivotovsky B, Orrenius S The Warburg Effect returns to the cancer stage. Semin Cancer Biol 2009; 19: 1 3.

PAGE 128

115 A bout the a uthor Felipe Bedoya completed his undergraduate studies at Unive rsidad de Los Andes in Bogot, Colombia with a Bachelors of Science degree in Chemical Engineering. In 2003 he entered the University of South Florida (USF) as a M asters student in the Colleg e of Medicines Bioinformatics and Computational Biology Program. In 2004, he started as a doctorate student in the Medical Microbiology and Immunology Program at USF ( currently the Molecular Medicine Program). During his matriculation he was awar ded with the Diversity Student Success Predoctoral Fellowship, the Academic Excellence Award and Graduate Educational Opportunity Grant. He is a member of the The Honor Society of Phi Kappa Phi and The National Scholars Honor Society. He has published tw o manuscripts with first authorship, one in the Journal of Immunology (2007) and another in Leukemia Research (2009), which is based on his doctoral research. He was accepted to start his post doctoral training in immunology at The Wistar Institute in Phi ladelphia, PA.