USF Libraries
USF Digital Collections

Thyroid hormone regulation of cholesterol metabolism

MISSING IMAGE

Material Information

Title:
Thyroid hormone regulation of cholesterol metabolism
Physical Description:
xi, 86 leaves : ill. (some col.) ; 28 cm.
Language:
English
Creator:
Boone, Lindsey R
Publication Date:

Subjects

Subjects / Keywords:
Thyroid Hormone Receptors beta   ( mesh )
Thyroid Hormones   ( mesh )
Hydroxymethylglutaryl CoA Reductases   ( mesh )
Cholesterol $x metabolism   ( mesh )
Electrophoretic Mobility Shift Assay   ( mesh )
ATP-Binding Cassette Transporters   ( mesh )
RNA, Small Interfering   ( mesh )
Apolipoprotein A-I   ( mesh )
Rats   ( mesh )
In vivo electroporation
HMG-CoA reductase
Cholesterol efflux
Transcription
ApoA-I
Dissertations, Academic -- Molecular Medicine -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Summary:
ABSTRACT: In this study, we examined the effects of thyroid hormone on regulatory processes of cholesterol metabolism. Specifically, the pathways of cholesterol synthesis and cholesterol efflux were investigated. Hepatic HMG-CoA reductase (HMGR) is the rate-limiting enzyme in cholesterol synthesis. Hypothyroid rats exhibit decreased expression of this gene, which can be induced by subsequent treatment with thyroid hormone. The mechanism of this activation was previously unknown. Utilizing in vivo electroporation, we identified HMGR promoter elements necessary for the induction of HMGR by thyroid hormone. The -316/-321 element, the sterol response element, and nuclear factor-y site were all found to be necessary to induce HMGR promoter activity by thyroid hormone.We used electrophoretic mobility shift assays (EMSA) and chromatin immunoprecipitation (ChIP) studies to demonstrate increased binding of upstream transcription factor-2 (USF-2) to the -316/-321 element in the HMGR promoter in response to thyroid hormone. Finally, co-electroporation of the wild-type HMGR plasmid with siRNA to USF-2, SREBP-2, or NF-Y nearly abolished the T₃ induction as measured by promoter activity. Microarray and real-time PCR analysis demonstrated an induction of the apolipoproteins ApoA-I and ApoA-IV mRNA by T₃. Serum levels of ApoA-I and ApoA-IV proteins were induced by T₃. We collected serum from rats treated with or without T₃ and used these sera in an in vitro macrophage efflux model. We found that T₃ promoted cholesterol efflux via the ABCA1 cholesterol transporter and not via the ABCG1 transporter.We propose that the induction of serum ApoA-I and ApoA-IV by thyroid hormone promotes cholesterol efflux via the ABCA1 cholesterol transporter. Hepatic ABCG5 and ABCG8 are cholesterol transporters that promote biliary secretion of cholesterol. We utilized EMSAs to scan the shared ABCG5/G8 rat promoter for a thyroid hormone response element (TRE). We identified a TRβ binding site at -392/-376 of the ABCG8 promoter. Collectively, these observations provide new insight into the cholesterol-lowering function of thyroid hormone.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2009.
Bibliography:
Includes bibliographical references.
Additional Physical Form:
Also available online.
Statement of Responsibility:
by Lindsey R. Boone.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002068008
oclc - 601820795
usfldc doi - E14-SFE0003089
usfldc handle - e14.3089
System ID:
SFS0027405:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader ntm 2200409Ka 4500
controlfield tag 001 002068008
005 20100406143749.0
008 100406s2009 xx a b 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003089
035
(OCoLC)601820795
040
FHJ
c FHJ
049
FHJA
096
WK 202
b B724t 2009
1 100
Boone, Lindsey R.
0 245
Thyroid hormone regulation of cholesterol metabolism /
by Lindsey R. Boone.
260
2009.
300
xi, 86 leaves :
ill. (some col.) ;
28 cm.
500
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2009.
504
Includes bibliographical references.
590
Advisor: Gene C. Ness, Ph.D.
520
ABSTRACT: In this study, we examined the effects of thyroid hormone on regulatory processes of cholesterol metabolism. Specifically, the pathways of cholesterol synthesis and cholesterol efflux were investigated. Hepatic HMG-CoA reductase (HMGR) is the rate-limiting enzyme in cholesterol synthesis. Hypothyroid rats exhibit decreased expression of this gene, which can be induced by subsequent treatment with thyroid hormone. The mechanism of this activation was previously unknown. Utilizing in vivo electroporation, we identified HMGR promoter elements necessary for the induction of HMGR by thyroid hormone. The -316/-321 element, the sterol response element, and nuclear factor-y site were all found to be necessary to induce HMGR promoter activity by thyroid hormone.We used electrophoretic mobility shift assays (EMSA) and chromatin immunoprecipitation (ChIP) studies to demonstrate increased binding of upstream transcription factor-2 (USF-2) to the -316/-321 element in the HMGR promoter in response to thyroid hormone. Finally, co-electroporation of the wild-type HMGR plasmid with siRNA to USF-2, SREBP-2, or NF-Y nearly abolished the T induction as measured by promoter activity. Microarray and real-time PCR analysis demonstrated an induction of the apolipoproteins ApoA-I and ApoA-IV mRNA by T. Serum levels of ApoA-I and ApoA-IV proteins were induced by T. We collected serum from rats treated with or without T and used these sera in an in vitro macrophage efflux model. We found that T promoted cholesterol efflux via the ABCA1 cholesterol transporter and not via the ABCG1 transporter.We propose that the induction of serum ApoA-I and ApoA-IV by thyroid hormone promotes cholesterol efflux via the ABCA1 cholesterol transporter. Hepatic ABCG5 and ABCG8 are cholesterol transporters that promote biliary secretion of cholesterol. We utilized EMSAs to scan the shared ABCG5/G8 rat promoter for a thyroid hormone response element (TRE). We identified a TR binding site at -392/-376 of the ABCG8 promoter. Collectively, these observations provide new insight into the cholesterol-lowering function of thyroid hormone.
530
Also available online.
2 650
Thyroid Hormone Receptors beta.
Thyroid Hormones.
Hydroxymethylglutaryl CoA Reductases.
Cholesterol $x metabolism.
Electrophoretic Mobility Shift Assay.
ATP-Binding Cassette Transporters.
RNA, Small Interfering.
Apolipoprotein A-I.
Rats.
653
In vivo electroporation
HMG-CoA reductase
Cholesterol efflux
Transcription
ApoA-I
690
Dissertations, Academic
z USF
x Molecular Medicine
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3089



PAGE 1

Thyroid Hormone Regulation of Cholesterol Metabolism by Lindsey R. Boone A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor or Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Gene C. Ness, Ph.D. Duane Eichler, Ph.D. R. Ken Keller, Ph.D. Richard Heller, Ph.D. Doug Cress, Ph.D. Date of Approval: June 23, 2009 Keywords: In vivo electroporation, HMG-CoA reductase, cholesterol efflux, transcription, ApoA-I Copyright 2009, Lindsey R. Boone

PAGE 2

Acknowledgments Though laborious and often unfulfilling, the course of my graduate career was enhanced by the people with whom I had the benefit of working. I sincerely thank my mentor Dr. Gene Ness for his guidance, support, patience, and friendship. He is a driving force in the area of graduate education. I have always known that he desires to educate and develop independent scientists through his lab. I appreciate the selflessness with which he runs his lab and encourages his students. I thank Dr. Bill Lagor for taking me under his wing my first year and patiently teaching me techniques and how to be critical of data. He is honest and direct two traits that receive my deepest admiration. I am grateful to Melissa Niesen for her hard-work and dedication to helping me graduate. The weeks of large sample preparation and analysis were made more endurable by having a partner in misery. I thank Patricia Brooks for her patience and aptitude. It has been a pleasure to work with her in my final months. I thank my committee members for taking time out of their schedules to meet with me independently and guide my research endeavors. I appreciate the guidance and mentorship from Dr. William Marshall. He provided me with a new career outlook and was a strong supporter of my undertakings. I am grateful for my relationships with Laura Pendleton, Dr Brenda Flam, and Dr Karen Corbin. These brilliant women guided me through new techniques, troubleshooting, and the lifestyle of a

PAGE 3

researcher. I am thankful for my friends in the Molecular Medicine department who were supportive, helpful, and sympathetic to the obstacles in grad school: Shara Pantry, Bernadette Ferraro, Sandi Shriver, Jesse Arbuckle, Matt Smith, Helen Chen-Duncan, Andrew Conniff, and Debby Kingsbury. I also thank Matt Smith for his guidance in ChIP assay setup and analysis. His advice was priceless. This research would not have been possible without the financial support we received from the NIH and Florida Department of Health. I am grateful for the support that I have received from my family. My mom supports me in everything I do and provides much-needed optimism. My dad has never questioned my goals and has allowed me to pursue whatever makes me happy. I thank both of my parents for their unending support. I thank my sister Laura for her interest in my work and for her strong support. Even when I saw no end in sight, she compelled me to stay focused and provided constant reassurance. I thank my second family, the Boones, for their interest in my work and for their continued motivation. I also thank them for providing a refuge from the world of science when I needed it most. I am most grateful for my husband Brian. He has witnessed the best and worst of me in this journey. He has listened to countless seminars, read drafts and papers, and most importantly, provided much-needed feedback to help me become a better scientist. All the while, he has been my biggest fan. He is a true inspiration. Finally, I thank God for the many blessings in my life and the opportunity to fulfill this dream of becoming a scientist.

PAGE 4

i Table of Contents List of Tables .........................................................................................................iv List of Figures.........................................................................................................v Abbreviations.......................................................................................................vii Abstract..................................................................................................................x Chapter 1 Introduction.........................................................................................1 Chapter 2 In Vivo Identification of the Mechanism of Thyroid Hormone Activation of HMGR...............................................................................................7 Introduction.................................................................................................8 Materials and Methods.............................................................................10 Plasmid Construction.....................................................................10 Experimental Animals....................................................................13 Electroporation Equipment............................................................14 In Vivo Electroporation..................................................................14 Luciferase Assays.........................................................................15 Serum Preparation and Thyroid Hormone Assay..........................15 Site-Directed Mutagenesis ...........................................................16 Real Time PCR..............................................................................16 Nuclear Extract..............................................................................16 EMSA............................................................................................18 Chromatin Immunoprecipitation....................................................18 siRNA Knockdown Study..............................................................21 Statistical Analyses........................................................................21 Results.....................................................................................................21 Functional Analysis of the HMGR Promoter..................................21 Binding of USF-2 to the HMGR Promoter.....................................26 siRNA Knockdown of Transcription Factors..................................27

PAGE 5

ii Discussion................................................................................................31 Chapter 3 Thyroid Hormone Promotes Macrophage Cholesterol Efflux via ABCA1...........................................................................................................38 Introduction...............................................................................................38 Materials and Methods.............................................................................40 Experimental Animals....................................................................40 HDL and T3 Assays.......................................................................41 RNA Isolation.................................................................................41 Microarray Analysis.......................................................................41 Real Time PCR..............................................................................42 Macrophage Efflux Studies...........................................................42 2D-DIGE........................................................................................43 Results.....................................................................................................44 Hepatic ApoA-1 and ApoA-IV Gene Expression Are Induced by Thyroid Hormone........................................................44 Serum ApoA-1 and ApoA-IV Protein are Induced by Thyroid Hormone...........................................................................45 Thyroid Hormone Promotes Macrophage Cholesterol Efflux via ABCA1...........................................................................47 Discussion................................................................................................50 Chapter 4 Analysis of the ABCG8 Promoter......................................................53 Introduction...............................................................................................53 Materials and Methods.............................................................................54 Electrophoretic Mobility Shift Assay..............................................54 Plasmid Construction.....................................................................54 Experimental Animals and In Vivo Electroporation.......................55 Results.....................................................................................................59 EMSA Analysis of the ABCG8 Promoter.......................................59 TR 1 and RXR Bind the ABCG8 Promoter...............................59 Identification of a TRE at -392/-376...............................................60 The -444/+123 ABCG8 Promoter Plasmid is not Functional

PAGE 6

iii by in vivo Electroporation..............................................................62 Discussion................................................................................................63 Chapter 5 Final Conclusions and Discussion....................................................66 References..........................................................................................................72 About the Author......................................................................................End Page

PAGE 7

iv List of Tables Table 1 Primer sequences used for cloning and site-directed mutagenesis..................................................................................13 Table 2 Primer sequences used for qPCR.................................................17 Table 3 Primer sequences used for EMSA probes....................................20 Table 4 Real-time PCR primers..................................................................44 Table 5 Subset of hepatic thyroid hormone responsive genes identified by microarray analysis...................................................45 Table 6 List of serum proteins induced by thyroid hormone.......................48 Table 7 ABCG8 Promoter EMSA Probes...................................................55 Table 8 ABCG8 Promoter Mutant EMSA Probes.......................................56

PAGE 8

v List of Figures Figure 1. Thyroid Hormone Decreases Serum LDL Cholesterol in Hypothyroid Rat...............................................................................6 Figure 2. In Vivo Electroporation Process....................................................11 Figure 3. In Vivo Imaging of In Vivo Electroporation....................................12 Figure 4. Thyroid Hormone Induces Hepatic HMGR....................................23 Figure 5. -316/-321, SRE, and NF-Y Promoter Elements are Highly Conserved across Species............................................................24 Figure 6. EMSA Analysis of the -325/-307 HMGR Promoter Region...........25 Figure 7. -316/-321, SRE, and NF-Y Promoter Elements are Necessary for the Thyroid Hormone Response............................26 Figure 8. EMSA Analysis of the -316/-321 HMGR Promoter Region...........29 Figure 9. USF-2 Binds to the HMGR Promoter............................................30 Figure 10. USF-2 Binding to the HMGR Promoter is Increased 4-fold in Response to T3..........................................................................31 Figure 11. Real-time PCR Analysis of the Effect of Thyroid Hormone on Transcription Factors that Bind the HMGR Promoter...............32 Figure 12. In Vivo siRNA Knockdown of Hepatic USF-2, SREBP-2, and NF-Y.......................................................................................33 Figure 13. In Vivo siRNA Knockdown Demonstrates the Functional roles of USF-2, SREBP-2, and NF-Y on Hepatic HMGR Promoter Activity...........................................................................34 Figure 14. Real-time PCR Validation of Thyroid Hormone Responsive Hepatic Genes...........................................................46 Figure 15. 2D DIGE of Rat Serum..................................................................47 Figure 16. Thyroid Hormone Increases Macrophage Cholesterol Efflux via the ABCA1 Cholesterol Transporter..............................49

PAGE 9

vi Figure 17. ABCA1 Efflux is Not Mediated by an Increase in Serum HDL cholesterol.............................................................................49 Figure 18. EMSA Analysis of the ABCG8 Promoter.......................................60 Figure 19. TR -1 and RXR Bind the ABCG8 Promoter...............................62 Figure 20. EMSA Analysis of the -420/-371 ABCG8 Promoter Region..........68 Figure 21. The -444/+123 ABCG8 Promoter Plasmid is not Functional by in vivo Electroporation..............................................................63 Figure 22. Combined Actions of Thyroid Hormone on Cholesterol Metabolism....................................................................................67 Figure 23. Proposed Model of HMGR Promoter............................................68 Figure 24. Thyroid Hormone Induces Cholesterol Efflux................................70

PAGE 10

vii Abbreviations ABCA1 ATP-binding cassette transporter A1 ABCA8 ATP-binding cassette transporter A8 ABCD2 ATP-binding cassette transporter D2 ABCG1 ATP-binding cassette transporter G1 ABCG5 ATP-binding cassette transporter G5 ABCG8 ATP-binding cassette transporter G8 ApoA-1 Apolipoprotein A-1 ATF2 Activating transcription factor 2 C/EBPa CCAATEnhancer binding protein a CETP Cholesteryl ester transfer protein ChIP Chromatin immunoprecipitation CRE cyclic AMP response element CYP7A1 Cholesterol 7 alpha-hydroxylase DC Direct current DIGE Differential in gel electrophoresis DR-4 Direct Repeat 4 E4BP4 Nuclear factor, interleukin 3 regulated EDTA ethylenediaminetetraacetic acid ELISA Enzyme-linked immunosorbent assay EMSA Electrophoretic mobility shift assays

PAGE 11

viii ESR1 Estrogen receptor 1 FTF Fetoprotein transcription factor LRH-1 Liver receptor homologue GATA GATA transcription factors HDL High Density Lipoprotein HMG-CoA 3-hydroxy-3-methylglutaryl coenzyme A HMGR HMG –CoA Reductase HSTF1 Fibroblast growth factor 4 Hx Hypophysectomized IDL Intermediate density lipoprotein IREBP1 Iron regulatory element binding protein 1 LCAT Lecithin:cholecterol acyl transferase LDL Low density lipoprotein LDLR Low density lipoprotein receptor LRH1 Liver receptor homologue 1 Mt Mutant NF4a Nuclear factor 4 alpha NF-Y Nuclear factor Y NPC1L1 Niemann-Pick C1 Like 1 PLA2 Phospholipase A2, Group IIA PLTP Phospholipid transfer protein PPARa Peroxisome proliferator activator receptoralpha RCT Reverse cholesterol transport

PAGE 12

ix RXRa Retinoic acid receptor a SCAP SREBP cleavage-activating protein siRNA Small-interfering RNA SF1 Splicing factor-1 SHP Short heterodimer partner SP1 Specificity protein-1 SR-B1 Scavenger receptor B1 SRE Sterol response element SREBP-2 Sterol regulatory element binding protein-2 TSH Thyroid stimulating hormone TR 1 Thyroid hormone receptor beta-1 TRE Thyroid hormone response element USF 2 Upstream transcription factor 2 VLDL Very low density lipoprotein Wt Wild type

PAGE 13

x Thyroid Hormone Regulation of Cholesterol Metabolism Lindsey R. Boone ABSTRACT In this study, we examined the effects of thyroid hormone on regulatory processes of cholesterol metabolism. Specifically, the pathways of cholesterol synthesis and cholesterol efflux were investigated. Hepatic HMG-CoA reductase (HMGR) is the rate-limiting enzyme in cholesterol synthesis. Hypothyroid rats exhibit decreased expression of this gene, which can be induced by subsequent treatment with thyroid hormone. The mechanism of this activation was previously unknown. Utilizing in vivo electroporation, we identified HMGR promoter elements necessary for the induction of HMGR by thyroid hormone. The -316/-321 element, the sterol response element, and nuclear factor-y site were all found to be necessary to induce HMGR promoter activity by thyroid hormone. We used electrophoretic mobility shift assays (EMSA) and chromatin immunoprecipitation (ChIP) studies to demonstrate increased binding of upstream transcription factor-2 (USF-2) to the -316/-321 element in the HMGR promoter in response to thyroid hormone. Finally, co-electroporation of the wildtype HMGR plasmid with siRNA to USF-2, SREBP-2, or NF-Y nearly abolished the T3 induction as measured by promoter activity. Microarray and real-time PCR analysis demonstrated an induction of the apolipoproteins ApoA-I and ApoA-IV

PAGE 14

xi mRNA by T3. Serum levels of ApoA-I and ApoA-IV proteins were induced by T3. We collected serum from rats treated with or without T3 and used these sera in an in vitro macrophage efflux model. We found that T3 promoted cholesterol efflux via the ABCA1 cholesterol transporter and not via the ABCG1 transporter. We propose that the induction of serum ApoA-I and ApoA-IV by thyroid hormone promotes cholesterol efflux via the ABCA1 cholesterol transporter. Hepatic ABCG5 and ABCG8 are cholesterol transporters that promote biliary secretion of cholesterol. We utilized EMSAs to scan the shared ABCG5/G8 rat promoter for a thyroid hormone response element (TRE). We identified a TR binding site at 392/-376 of the ABCG8 promoter. Collectively, these observations provide new insight into the cholesterol-lowering function of thyroid hormone.

PAGE 15

1 Chapter 1 Introduction Cholesterol metabolism can be broadly viewed as the dietary intake or endogenous production of cholesterol and the subsequent utilization of this cholesterol in downstream processes such as cholesterol transport, cell membrane structure, bile acid production, and steroid hormone synthesis. When exogenous cholesterol is ingested through the diet, it travels to the intestine where it is absorbed by enterocytes via the Niemann-Pick C1 Like 1 (NPC1L1) cholesterol transporter and packaged into lipid-rich chylomicrons ( 1, 2 ). The chylomicrons are transported via the bloodstream and converted to chylomicron remnants that are cleared by the liver ( 3 ). Once in the liver, the cholesterol can be repackaged into very low-density lipoproteins (VLDL) and secreted into the bloodstream ( 4 ) or oxidized into bile acids under the control of cholesterol 7 alpha-hydroxylase (CYP7A1) ( 5 ). Additionally, hepatic de novo cholesterol synthesis occurs under the control of HMG-CoA reductase (HMGR) and is the main source of cholesterol secreted from the liver ( 6 ). VLDL secreted into the bloodstream contain triglycerides and cholesterol ( 7 ). The VLDL particles unload triglycerides through interaction with lipoprotein lipase and become intermediate density lipoproteins (IDL) ( 8 ). As the ratio of cholesterol to triglycerides becomes higher, the IDL particles become low density lipoproteins (LDL). LDL particles bind the LDL receptor (LDLR) to unload cholesterol to peripheral tissues or clear

PAGE 16

2 cholesterol from the bloodstream back into the liver ( 9 ). In the presence of excess LDL cholesterol, deposition of cholesterol into the arterial lining can lead to atherosclerosis, which will be discussed in further detail in Chapter 3. High density lipoproteins (HDL) are the smallest and densest of the lipoproteins. HDL are synthesized by the liver and secreted into the bloodstream. Their main function is to transport cholesterol to steroidogenic organs and the liver. They are capable of picking up cholesterol from the cholesterol transporter ATP-binding cassette transporter AI (ABCAI), in the process of cholesterol efflux from macrophages ( 10 ), an antiatherogenic process. The collected cholesterol, in the form of cholesteryl esters, can be removed from the HDL particle indirectly via exchange with the VLDL particle and uptake by the downstream LDL receptor (LDLR) or directly by the HDL receptor scavenger receptor BI (SR-BI) ( 11 ). Important components of the transport lipoproteins are the apolipoproteins. Apolipoproteins are proteins that bind lipids to form lipoproteins. Apolipoprotein A-I is a major component of HDL and is a cofactor for lecithin cholesterolacyltransferase (LCAT), an enzyme that converts free cholesterol to cholesteryl ester ( 12 ). Apolipoprotein B48 and B100 are essential components of VLDL, IDL, and LDL particles and act as ligands for the LDL receptor ( 13 ). Also critical for cholesterol transport are the ATP-binding cassette transporters ABCA1/G1 and ABCG5/G8. ABCA1 has been shown to regulate the process of excess cholesterol efflux from macrophages to the ApoA-I component of HDL

PAGE 17

3 ( 14 ). The ABCG5/G8 transporters function primarily in the intestine and liver and act to limit absorption of dietary cholesterol ( 15 ). Many of the genes involved in cholesterol metabolism are under cholesterol feedback regulation. The sterol regulatory element-binding proteins (SREBP) are sterol-sensing transcription factors of the basic-loop-helix-leucine zipper (bHLH-Zip) family that activate cholesterolgenic genes when sterol levels are low ( 16 ). SREBPs are membrane-bound and must be proteolytically cleaved to act ( 17 ). When sterols are abundant, SREBPs are maintained in the endoplasmic reticulum by SREBP cleavage activating protein (SCAP) and insulin induced gene 1 (INSIG1) ( 18, 19 ). When sterol levels drop, SCAP allows site-1 cleavage to occur by Site-1 protease, which separates the functional domain of SREBP from the regulatory domain ( 17 ). SREBP moves to the Golgi where site2 protease cleavage frees the NH2-terminal bHLH-Zip domain and allows for its transport to the nucleus for transcriptional regulation of target genes ( 20 ). There are three known SREBPS: SREBP-1a and SREBP-1c are produced from a single gene and SREBP-2 is produced from a separate gene ( 20 ). SREBP-1 has been shown to regulate genes involved in fatty acid metabolism while SREBP-2 is known to regulate genes involved in cholesterol metabolism ( 21 ). Due to the necessity of cholesterol in physiological processes, modifications in its metabolism can have deleterious effects. An important controller of cholesterol metabolism is thyroid hormone. A low level of thyroid hormone is clinically diagnosed as hypothyroidism. Patients with hypothyroidism exhibit hyperlipidemia ( 22 ) and are at an increased risk for cardiovascular

PAGE 18

4 disease ( 23 ). Treatment of hypothyroidism with thyroid hormone replacement therapy was shown to result in a less atherogenic lipid profile consisting of decreased plasma LDL cholesterol ( 24 ). Data from an ongoing clinical trial of a thyroid hormone receptor agonist, MB07811, suggests lipid-lowering results in patients with mild hypercholesterolemia ( 25 ). Also, the thyroid hormone mimetic, KB2115, was able to decrease LDL cholesterol levels and stimulate bile acid synthesis ( 26 ). Thus, thyroid hormone is an important component in the field of cardiovascular disease. Thyroid hormone is produced by the follicular cells of the thyroid gland in response to thyroid stimulating hormone (TSH) released from the anterior pituitary. Thyrotropin releasing hormone (TRH) from the hypothalamus stimulates release of TSH from the pituitary ( 27 ). Thyroid hormone inhibits TSH and TRH release from the pitiuitary and hypothalamus as a negative feedback mechanism. Two forms of thyroid hormone exist in the body: thyroxine (T4) and triiodothyronine (T3), which differ in iodine composition. Thyroxine makes up the majority of thyroid hormone in the blood, has a longer half life than T3 and is less potent. Thyroxine is converted to the biologically active form of thyroid hormone, T3, within target cells by deiodinases that remove an iodine molecule ( 28, 29 ). Most thyroid hormone in the blood circulates bound to thyroid binding globulin (TBG), while only the free form has hormonal activity. Thyroid hormones functions mainly to increase metabolism, but also have roles in brain maturation during fetal development, regulation of long bone growth and sensitivity to catecholamines ( 30, 31 ).

PAGE 19

5 The mechanisms of thyroid hormone’s effects on cholesterol metabolism have generally been well studied. Thyroid hormone is known to activate a number of genes involved in cholesterol metabolism including the LDLR ( 32 ), the cholesterol transporter genes ATP-binding cassette G5/G8 (ABCG5/G8) ( 33 ), the rate-limiting enzyme in cholesterol biosynthesis HMGR ( 34 ), the rate-limiting enzyme in bile acid synthesis CYP7AI ( 35 ), and the apolipoproteins ApoA-I and ApoA-IV ( 36 ). Physiological effects of thyroid hormone activation of these genes includes a decrease in circulating LDL cholesterol ( 37 ), a decrease in intestinal absorption of dietary cholesterol ( 33 ), and increased biliary cholesterol secretion ( 38 ). Though clinical utilization of thyroid hormone in treating hypercholesterolemia is not as simple as administering T3 to patients, targeting thyroid hormone receptor-beta agonists to the liver has been shown to reduce cholesterol ( 39 ). Of the effects on gene expression, the mechanism of thyroid hormone activation of HMGR and the result of thyroid activation of ApoA-I and ApoA-IV have not yet been determined. We utilized a hypophysectomized (Hx) SpragueDawley rat model treated thyroid hormone to investigate these areas of cholesterol metabolism. The Hx rax is surgically altered to be hypothyroid with the removal of its pituitary. The absence of a pituitary gland prevents secretion of thyroid stimulating hormone (TSH) and its downstream control of thyroid hormone. The hypothyroid Hx Sprague-Dawley rat demonstrates increased LDL cholesterol, which can be restored with thyroid hormone treatment (Fig. 1). This effect mimics the effect of thyroid hormone on LDL cholesterol observed in

PAGE 20

6 humans and provides a good mammalian model to study cholesterol metabolism. One caveat to this animal model is the disproportionate lipid profile relative to the human profile. Humans maintain a greater proportion of total cholesterol in the LDL fraction whereas most cholesterol is found in the HDL fraction in rat serum ( 40 ). However, the variations in relative proportions of cholesterol do not affect our studies. Of note is the absence of a gallbladder in rats, the organ that stores bile. The herbivorous nature of the rat does not require a large amount of bile to emulsify and absorb ingested animal fats. The rat liver does produce bile, however, and the periportal plexus of bile ductules has been proposed as the bile storage organ ( 41 ). Figure 1. Thyroid Horm one Decreases Serum LDL Chol esterol in Hypothyroid Rat. Serum was collected from normal and hypophysectomized rats treated T3. Total serum serum LDL cholesterol is repor ted. Data are r eported as the mean standard error of the mean for each treatmen t. Statistically significant differences are relative to Hx. For all conditions, n 4 and p<0.05.

PAGE 21

7 Chapter Two In vivo Identification of the Mechanism of Thyroid Hormone Activation of HMGR Introduction Cholesterol metabolism and serum cholesterol levels are profoundly affected by thyroid hormone (T3) status ( 42 ). Key genes that are involved in regulating cholesterol metabolism include: LDL receptor, cholesterol 7 hydroxylase and HMG-CoA reductase (HMGR) ( 43 ). Each of these genes is regulated at the level of transcription by T3 ( 43 ). Significant advances have been made in defining the mechanisms by which T3 regulates LDL receptor and cholesterol 7 hydroxylase ( 44, 45 ). The promoter elements and transcription factors involved in T3 stimulation have been identified for these genes. In contrast, the elements and transcription factors mediating T3 induction of HMGR have not yet been identified. HMGR is the enzyme that catalyzes the rate-limiting step in cholesterol biosynthesis. HMGR is regulated by various mechanisms including hormonal (insulin, glucagon, thyroid hormone) and sterol ( 46-50 ). Hepatic HMGR activity and gene expression is diminished in hypothyroid rats ( 50, 51 ). Subsequent treatment with thyroid hormone (T3) restores HMGR mRNA, protein, and activity to levels actually greater than those observed in normal animals ( 50, 51 ). Notably, there is a considerable lag time for full induction of both mRNA and protein. The greatest levels of induction are measured at 72 to 96 hours post-

PAGE 22

8 treatment, suggesting that the transcriptional response is not a direct effect. Rather it has been shown that both RNA and protein synthesis are required to achieve this T3-mediated induction ( 51 ). The mechanism of thyroid hormone activation of gene transcription has been well-studied. Activation of gene transcription by T3 is usually mediated by thyroid hormone response elements (TRE), often of the DR4 type (AGGTCAnnnnAGGTCA). Typically in liver, the nuclear receptor thyroid receptor beta (TR -1) binds as a heterodimer with retinoic acid receptor (RXR-a) to induce gene transcription in response to T3 ( 52 ). The long lag period for T3induction of hepatic HMGR suggests that T3 may act to increase expression of some other protein, which in turn would activate HMGR transcription through some element other than a TRE. Also, the lack of a consensus TRE in the HMGR promoter required the consideration of non-traditional models of T3 stimulation. Previous reports have identified upstream transcription factor-2 (USF-2), nuclear factor-Y (NF-Y), and the sterol regulatory element binding proteins (SREBP) as being necessary for the T3 response of other genes involved in metabolism ( 53-56 ). USF-2 and NF-Y are ubiquitous transcription factors that function on a variety of genes ( 57, 58 ). Though there has been no previous description of a USF-2 binding site in the HMGR promoter, an earlier report from our lab identified a NF-Y binding site in the proximal promoter of HMGR ( 59 ). The -316/-321 site in the rat HMGR promoter conforms to a DR4 half site

PAGE 23

9 (AGGTCA). Such a site was shown to mediate T3 induction of cholesterol 7 hydroxylase ( 45 ). The HMGR promoter contains a sterol response element (SRE) to which SREBP-2 and SREBP-1 have been shown to bind ( 60, 61 ). SREBP-1 and SREBP-2 are transcription factors that have been shown to function primarily on genes involved in cholesterol, fatty-acid, and triglyceride metabolism ( 46, 60, 6267 ). The SREBP proteins typically interact with nearby transcription factors, such as NF-Y, to control gene transcription ( 66, 68, 69 ). Previous work has shown that hypothyroid mice have decreased levels of mature SREBP-2 protein, which is induced by subsequent T3 treatment ( 70 ). Interestingly, studies have shown that hypothyroid rats treated with either T3 or a combination of bile acid sequestrant and statin exhibit similar inductions of SREBP-2 and HMGR expression ( 70, 71 ), thus further linking SREBP-2 to T3 regulation of HMGR. We hypothesized that the SREBP proteins may cooperate with additional transcription factors to mediate the T3 response. In this report, we utilized in vivo electroporation to characterize the promoter elements and factors necessary for T3 induction of HMGR gene expression. Electroporation subjects membranes to a high-voltage electric field that results in the formation of pores that are large enough to allow DNA to enter the cell ( 72, 73 ). In vivo electroporation allows for introduction of promoterluciferase constructs directly into the liver of live animals ( 74, 75 ). A schematic of the electroporation process is presented in Figure 2. In vivo electroporation results in transfection of hepatocytes within a well-defined region of the liver. In

PAGE 24

10 vivo imaging of electroporation of an HMGR-promoter luciferase construct demonstrates this precision (Fig. 3). The -325/+70 region of the HMGR promoter was determined to be sufficient for the full T3 response. We showed that the transcription factor USF-2 binds to the HMGR promoter in vivo and that USF-2 promoter binding is increased 4-fold by T3. Furthermore, knockdown of USF-2, SREBP-2, and NF-Y by siRNA abolished the T3-mediated induction of HMGR gene expression as measured by promoter activity. Thus, USF-2, SREBP-2, and NF-Y appear to play significant functional roles in mediating T3-induction of hepatic HMGR gene expression. Materials and Methods Plasmid Construction The rat HMGR promoter was amplified to -5683 from a genomic BAC clone (CH230-263N2) from the rat genome using the Expand Long Template PCR System (Roche). The -325/+70 HMGR promoter segments in pGL3-Basic (Promega, Madison, WI) were obtained as previously described ( 59 ). A -5123/+70 promoter fragment was obtained by using the primer sequences listed in Table 1. This PCR product contains a NheI site at both ends for cloning. The -3187/+70 and the -2314/+70 promoter fragments were prepared from this large PCR product and cloned into pGL3-Basic vector using the restriction enzymes MluI and SacI, respectively. All clones were confirmed by restriction analysis and DNA sequencing at the Moffitt Molecular Biology Core Facility (Tampa, FL).

PAGE 25

11 Figure 2. In Vivo Electroporation Process A Liver is exposed; B DNA is injected below the capsule; C Electrode is placed over site of injection and voltage applied to introduce DNA into cell; D Pattern of electrode remains for easy identification of site.

PAGE 26

12 Figure 3. In Vivo Imaging of in vivo electroporation. Fifty mg of wild-type HMGR promoter plasmid was electroporated in the liver of a normal rat. Imaging was performed 24 hours later using Xenogen in vivo Imager.

PAGE 27

13 Experimental Animals Hypophysectomized and normal male Sprague-Dawley rats weighing 125 to 150 g were purchased from Harlan (Indianapolis, IN). Hypophysectomized rats received Tekland Iodine Deficient chow and water ad libitum and were housed in a reverse-cycle light controlled room with a 12-hour light period followed by a 12-hour dark period. The rats were maintained on the Iodine deficient diet for 20 days prior to being used in experiments in order to achieve sufficient turnover of T4. Rats on the iodine deficient diet were given an initial injection of 1.0 mg/kg T3 72 hours prior to electroporation and an additional injection of 0.25 mg/kg T3 24 hours prior to electroporation. The rats were euthanized at the mid-dark period when hepatic HMG-CoA reductase expression is at its diurnal high, 24 hours following electroporation. Table 1. Primer sequences used for cloning and site-directed mutagenesis. Target Sequence (5’ 3’) Plasmid CTGAAGCTATGCTAGCAGCTACAGAAATGGAGCGCTCTTC G -5123/+70 GAGAAGATGCTAGCATCTCAATGGAGGCCACCAAGC SDM CCGTGGTGAGAGATG TGTATTGT CCCGTTCTCCGCCCG SRE CGGGCGGAGAACGGG ACAATACA CATCTCTCACCACGG GCTCTTACGCGTCTGC CTTGAC AATTCTGAGTTCGGGG USF-2 CCCCGAACTCAGAATT GTCAAG GCAGACGCGTAAGAGC GCGGTGCCCGTTCTCCG AAATTTGT CGAGCAGTGGG SP-1 CCCACTGCTCG ACAAATTT CGGAGAACGGGCACCGC GGGCGACCGTTCG GTCATGCTT CCGTCAGGCTGAGCAG CRE CTGCTCAGCCTGACGG AAGCATGAC CGAACGGTCGCCC

PAGE 28

14 Electroporation Equipment. An array of electrodes was used to administer porating direct current pulses (DC) to liver. The electrode array was comprised of a cylindrical molded plastic handle with six 30 gauge acupuncture needles (NA2840, Suzhou Gusu Acupuncture & Moxitustion Appliance Co. Ltd., Japan) protruding from one end. The needles were held in a fixed position at 60 degree intervals in a 0.5 cm diameter circle. The needles extended 7 mm from the end of the handle. The array was custom made at the University of South Florida along with an instrument system to supply voltage to the needles. The instrument system consisted of a Dell Dimensions 8200 personal computer/monitor/keyboard, two mechanical relay boards (PCI-6521; National Instruments, Austin, TX), a DC power supply (9312-PS; Marlin P. Jones and Associates, Lake Park, FL), and LabVIEW software (National Instruments). The LabVIEW software was used to write an application that utilized the computer and relay boards to direct the output from the power supply to the needles in a manner that rotated the applied voltage around the segment of liver delineated by the array. A description of the pulsing order has been previously described ( 76 ). In Vivo Electroporation Ten g of HMG-CoA reductase promoter constructs and mutants ligated to luciferase were directly introduced into the livers of rats by electroporation as recently described ( 74 ) with minor modifications. Renilla luciferase (Promega, Madison, WI) was co-electroporated at a 1:1000 dilution to control for electroporation efficiency. The total volume of injected DNA was 50

PAGE 29

15 l. The 5 mm diameter, six-needle electrode array was used to deliver 6 rectangular DC electric pulses to the tissue. Each pulse had a potential of 75 V and a duration of 150 ms. Pulses were administered with a 150 ms interval between them. The voltage applied to the tissue corresponded to an electric field strength of 150 V/cm. Luciferase Assays Twenty-four hours following electroporation, the livers were harvested and tested for HMG-CoA reductase promoter activity by measuring luciferase activity. Once removed, the electroporated regions of the liver were extracted using a 5 mm cork-borer. Approximately 0.1 g of liver was placed in 600 l of passive lysis buffer (Promega) and homogenized using a tissue disrupter. The lysate was centrifuged at 16,000 g for 5 minutes and the supernatant assayed for luciferase activity using the dual luciferase assay kit from Promega. Luciferase activity was calculated as the average ratio of firefly (reporter) to renilla luciferase for at least 2 injection sites per animal. Serum Preparation and Thyroid Hormone Assay Blood was collected from animals at time of euthanasia and centrifuged at 16,000 g for 5 min. Supernatant (serum) was collected and used for determination of T3. The T3 assay from Calbiotech (Spring Valley, CA) is a solid-phase competitive ELISA. Free T3 in the serum competes with a T3 enzyme conjugate for binding to the anti-T3 monoclonal antibody that coats the assay wells.

PAGE 30

16 Site-Directed Mutagenesis Mutant plasmids were produced using the QuikChange kit from Stratagene (Cedar Creek, TX). The plasmid consisted of the double stranded DNA encoding the promoter with point mutations at the site of the SRE, USF-2 site, NF-Y site, CRE, or SP1-like site. Primer sequences used are listed in Table 1. The NF-Y mutant plasmid was previously prepared ( 59 ). Real Time PCR Total RNA was isolated from rat livers using TRI Reagent (Molecular Research Center, Cincinnati, OH) and resuspended in nuclease-free water. RNA was then DNAse treated using the TURBO DNA-Free Kit (Ambion, Austin, TX). cDNA was prepared using the Reverse Transcription System (Promega) per the manufacturer’s protocol. Primer sequences used are listed in Table 2. mRNA was quantified under the following reaction conditions: 95oC for 5 minutes, followed by 40 cycle of 95oC for 15 seconds, 61oC for 1 minute and melt curve 55oC + 0.5oC each 10 seconds, x 80. All samples were run in duplicate on a Bio-Rad Chromo4 DNAEngine thermal cycler using SYBR green chemistry. Relative mRNA was calculated as a function of the internal control 18s using Ct. Nuclear Extract Nuclei were prepared as previously described by centrifugation through dense sucrose ( 59 ). Nuclei isolated from 2 g of rat liver were resuspended in 1 ml of PBS containing 3 mM MgCl2 and were centrifuged at 3000 x g for 5 min at 4C. Nuclear pellets were resuspended in 300 L of high

PAGE 31

17 salt buffer (420 mM NaCl, 20 mM HEPES, pH 7.9, 1 mM EDTA, 1 mM EGTA, 20% glycerol, 20 mM NaF, 1 mM Na3VO4, 1 mM Na4P2O7, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 1x protease inhibitor mixture (Sigma, St. Louis, MO). Nuclei were lysed by rotating slowly at 4C for 30 minutes. The lysates were then centrifuged at 16,000 x g for 15 min to pellet nuclear debris. The supernatant (nuclear extract) was collected and protein concentrations determined using the BCA Assay from Pierce (Rockford, IL). Table 2. Primer sequences used for qPCR Target Sequence (5’ 3’) qPCR TGTGGGAACGGTGACACTTA HMGR CTTCAAATTTTGGGCACTCA GGATCATCCAGCAGCCTTTGA SREBP-2 ACCGGGACCTGCTGCACCTGT CCCAGGATGTGCTTCAAACAGGAA USF-2 TCCTTCTCCGCTCCACTTCATTGT AAGTTCAGAGAGGCCATGAAGGGA NFY-B TCTGCAGTTATTAACCCAGCCGGT CCATCCAATCGGTAGTAGCG 18s GTAACCCGTTGAACCCCATT ChIP qPCR CCACACTCCAACTCTGACACGGT USF-2 CCGAGCCAACCAATGGCTAGT ACTAGCCATTGGTTGGCTCGG SREBP1/2,NFY CGCCAATAAGGAAGGATCGTCCGAT

PAGE 32

18 EMSA Electrophoretic mobility shift assays were performed as previously described ( 59 ). Briefly, probes corresponding to the wild type (Wt) SRE and mutant (Mt) SRE were generated by annealing two complementary oligonucleotides (Integrated DNA Technologies). Oligonucleotide sequences are listed in Table 3. One pmol of probe was labeled by the Klenow fill-in reaction using 20 Ci of [ -32P] dCTP along with cold 0.125 mM dATP, dGTP, and dTTP. Each probe (25 fmol) was incubated with 2.0 g of rat liver nuclear extract protein in binding buffer (10 mM HEPES, pH 7.9, 25 mM KCl, 0.5 mM EDTA, 50 g/ml poly(dI-dC), 5% glycerol, 0.5 mM DTT, 125 g/ml bovine serum albumin) for 30 minutes at room temperature. Binding reactions were run on a 6% polyacrylamide gel in 0.25x TBE. For antibody supershift experiments, binding reactions were incubated with 1-3 g of antisera for 30 minutes prior to the addition of probe. The antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA): PPAR (sc-9000x), tr -1 (sc-772x), USF2 (sc862x), SF1 (sc-28740x), ESR1 (sc-542x), RXRa (sc-553x), C/EBPa (sc-9314x), USF1 (sc-8983x), USF2 (sc-861x), C/EBP (sc-746x), Sp1 (sc-17824x), HSTF1 (sc-9144x), ATF2 (sc-187), E4BP4 (sc-9550), SHP (sc-15283), FTF/LRH1 (sc5995x), and NFY (sc-7711x). Chromatin Immunoprecipitation Chromatin was prepared and immunoprecipitated using the ChIP-IT Express kit from Active Motif (Carlsbad, CA). The protocol was modified for liver tissue preparation. All named buffers are included in the kit. Equal portions of liver (100 mg total) from 3 rats per

PAGE 33

19 treatment group ( T3) were minced and fixed in 1% formaldehyde for 5 minutes at room temperature. One mL of Glycine Stop-Fix Solution was added to stop fixation and incubated for 5 minutes. Samples were centrifuged for 5 minutes at 720g. The pellets were resuspended in 6 ml scraping solution and centrifuged at 720g for 5 min. The pellets were resuspended in 1.5 ml ice-cold Lysis Buffer supplemented with 7.5 l protease inhibitors (PIC) and 7.5 l PMSF and incubated on ice for 30 minutes. The tissue was homogenized in a Dounce homogenizer for 10 strokes on ice to release the nuclei. The homogenates were then centrifuged at 2400g for 10 min at 4oC to pellet the nuclei. The nuclei were resuspended in 1 ml of Complete Shearing Buffer supplemented with 5 l PIC and disrupted using an Ultrasonic model W-375 sonicator at 40% duty cycle and output control at 3. Sonication was applied 5 times each for 15 seconds on, 30 seconds off, to shear chromatin. Chromatin size was checked by agarose electrophoresis to ensure an average size between 200 and 500 bp. Chromatin was precleared with 35 l of magnetic beads per 500 l chromatin by rotating at 4oC for 30 minutes and collected. Eighty l of chromatin, 3 g of antibody, and 25 l of beads were used for each IP reaction. The antibodies used were: SREBP-2 (Cayman Chemical, #10007663), USF-2 (SCBT, sc-861x), SREBP-1 (SCBT, sc-8984x), NF-Y (SCBT, sc-13045x), and RXR(SCBT, sc-553x). The negative and positive control antibodies were part of the ChIP-IT Kit. The reactions were rotated at 4oC with antibody for 17 hours. Final DNA samples were analyzed by qPCR in triplicate as described above. The relative level of transcription factor binding was quantified by correcting for amount of input DNA

PAGE 34

20 and negative control antibody DNA (background), which were performed in parallel. Relative induction of binding was calculated as the ratio of relative binding of the factor in the Hx +T3 chromatin preparation to the relative binding of the factor in the Hx chromatin preparation. The data are the results of at least 3 independent immunoprecipitation experiments on pooled chromatin samples. PCR products from ChIPs performed with antibodies to USF-2 and NF-Y were also run on a 2% agarose gel to show in vivo binding of these factors. PCR was carried out as described under real-time PCR methods above with the omission of a melt curve. Table 3. Primer sequences used for EMSA probes. Target Sequence (5’ 3’) TGGTGAGAGATGGTGCGGTGCCCGTTCTCCG WT SRE CGATCGGAGAACGGGCACCGCACCATCTCTCACCA TGGTGAGAGATGTGTATTGTCCCGTTCTCCG MT SRE CGATCGGAGAACGGGACAATACACATCTCTCACCA GGAAACACCCTGCAGGTCAAATTCTGAGTTCGGGGTACT WT USF2 CGATGAACTCAGAATTTGACCTGCAGGGTGTTTCC GGAAACACCCTGCCTTGACAATTCTGAGTTC MT USF2 CGATGAACTCAGAATTGTCAAGGCAGGGTGTTTCC GCCTCCCGCCGATTGGCTAGGGGATCGGAC WT NF-Y CGATGTCCGATCCCCTAGCCAATCGGCGGGAGGC GCCTCCCGCCGCGGTTCTAGGGGATCGGAC MT NF-Y CGATGTCCGATCCCCTAGAACCGCGGCGGGAGGC

PAGE 35

21 siRNA Knockdown Study. Following the treatments described previously under Experimental Animals 5 g of SREBP-2 siRNA (Dharmacon cat# L-081475-01), or 20 g of USF-2 siRNA (SABiosciences cat# SIR449799A-C), or NFY siRNA (SABiosciences cat# SIR252807A-C) was co-electroporated with or without 10 g -325/+70 HMGR promoter construct in a final volume of 50 l using at least 2 sites per animal. The electroporated sites were removed 24 hours later using a 5 mm cork-borer. For NF-Y experiments, samples were also removed after 48 hrs. Luciferase assays were performed as described above. qPCR was performed to measure knock down of endogenous USF-2, SREBP-2, or NFY mRNA. Five g of Dharmacon cat# L-096650-01 siRNA was used as the negative control, as electroporation of this siRNA did not knockdown the target gene. Statistical Analyses Data is expressed as the mean +/standard error for a minimum of 3 animals per group. Experimental treatments included hypophysectomized Sprague-Dawley and hypophysectomized Sprague-Dawley rats treated with T3. Results Functional Analysis of the HMGR Promoter We utilized in vivo electroporation in a hypothyroid (Hx) rat model to analyze the regulatory mechanism of T3 induced hepatic HMGR gene expression. Hx rats were treated T3 96 hours before harvest of liver tissue to measure hepatic HMGR gene expression by real-time PCR. HMGR gene expression was induced approximately 2.7-fold by thyroid hormone (Fig. 4A). In

PAGE 36

22 order to define the region of the HMGR promoter necessary for this induction, four promoter-luciferase constructs inclusive of the HMGR promoter from -5683, 3190, -2314, or -325 to +70 bp were generated. The plasmids were electroporated into the livers of Hx rats treated T3. We found that the -325/+70 region was sufficient to induce maximum thyroid hormone stimulation of HMGR promoter activity (Fig. 4B). With this construct, a 2.5-fold induction of HMGR promoter activity was observed in response to T3, which correlates well with the increase observed in mRNA levels. The -325/+70 region of the promoter is highly conserved in mammalian species (Fig. 5). Specifically, the -316/-321 element, the sterol response element (SRE), and the NF-Y binding sites all lie within regions of very high conservation in the HMGR promoter. The element at -316/-321 is a conserved element that serves as a near-consensus binding sequence for a TRE half-site, the USF-2 transcription factor ( 57 ), as well as other common transcription factors ( 77-79 ). USF-2, SREBP-2, and NF-Y have previously been shown to function in T3 regulation of genes such as fatty acid synthase, S14, and carnitine palmitoyltransferase-I ( 53-55 ). Thus, we hypothesized that T3 induction could occur through these sites. In an effort to identify the factor that binds to the -316/-321 region, we performed EMSAs. Figure 6 shows an experiment in which a Wt probe to the 316/-321 region was incubated in a binding reaction with normal rat liver nuclear extract. An unlabeled double-stranded oligonucleotide corresponding to the exact sequence of the Wt with the exception of single nucleotide substitutions

PAGE 37

23 was added in 50x molar excess relative to the radiolabeled probe in the remaining lanes. The sequence at the top of the figure is the wild type promoter sequence, with an arrow highlighting the nucleotide substitution in each lane. The Wt band in Fig. 6 can be efficiently competed away with the cold wild-type competitor (2nd lane). The mutants that were unable to compete away the wildtype binding represent the sequence AGGTCAAA_TCTG. Figure 4. Thyroid Horm one Induces Hepatic HMGR A Real-time PCR analysis of total HMGR mRNA isolated from liv ers of hypophysectomized rats treated T3. B An HMGR promoter construct inclusive of t he -325/+70 region was el ectroporated into the livers of hypophysectomized rats treated T3. Data are reported as the mean standard error of the mean for each promoter construct. Statistically significant differences are relative to Hx with wild-type construct. For all conditions, n 4 and *p<0.05.

PAGE 38

24 We prepared plasmids inclusive of the -325/+70 promoter region (Wt) with point mutations in each of these elements as well as the Sp1-like site at -145/138 and the cAMP response element at -104/-97. The mutated plasmids were then introduced into the livers of Hx rats treated T3 as described previously. Independent mutations in the -316/-321 element, SRE, and NFY binding site resulted in essentially complete loss of the T3 induction (Fig. 7). These data Figure 5. -316/-321, SRE, and NF-Y Promoter El ements are Highly Conserved across Species. Multiple sequence alignment was performed using the CLUSTALW2 tool provided by EMBLEBI. HMGR promoter sequences for H. sapiens R. norvegicus and M. musculus were obtained from GenBank. Nucleotides are labeled from the transcription start site.

PAGE 39

25 suggest that all three elements and their respective transcription factors are necessary for T3-mediated induction of HMGR transcription. Mutations in the SP1-like site and CRE did not abolish the T3 response of the HMGR promoter (data not shown). Figure 6. EMSA Analysis of th e -325/-307 HMGR Promoter Region EMSA of single point mutations in the -325/-307 regi on. 50x competitor probes were used to identify nucleotides that are necessary for binding to occur to the -316/-321 element. The wild-type promoter sequence is listed on top with an arrow pointing to the point mutation in the competitor probe.

PAGE 40

26 Binding of USF-2 to the HMGR Promoter We used the online transcription factor prediction program PROMO to identify a number of potential factors that could bind the -316/-321 sequence ( 80 ). We used nuclear extract prepared from normal rats to perform EMSA antibody supershift experiments with antisera to the transcription factor candidates (Fig. 8). Antisera for RXR and USF-2 produced shifted bands. Interestingly, the TR -1 antisera did not produce a supershift. The USF-2 antibody (sc-861) Figure 7. -316/-321, SRE, and NF-Y Promoter El ements are Necessary for the Thyroid Hormone Response. HMGR promoter cons truct spanning the -325/+70 region (wild-type) as well as constructs with mutations in the -316/-321, SRE, or NFY binding sites were electroporated in to the livers of hypophysectomized rats treated T3 (n 4). Data are reported as the m ean standard error of the mean for each promoter construct. Statistically signifi cant differences are relative to Hx with wild-type construct. *p<0.05

PAGE 41

27 produced a shifted band, while the USF-2 antibody (sc-862) did not. The USF-2 (sc-862) antibody recognizes the C-terminus of USF-2, which functions as the DNA-binding component of the protein, thus preventing the binding of the antibody. To confirm the binding of USF-2 to the HMGR promoter in vivo ChIP analysis was performed on pooled chromatin samples prepared from the livers of Hx + T3 rats. PCR was performed on the immunoprecipitated DNA and products were run on agarose gels for identification. USF-2 was found to bind the HMGR promoter in vivo (Fig. 9). This is the first report of in vivo evidence showing USF2 binding to the HMGR promoter at -316/-321. Chromatin was then prepared in two pools of 3 equal amounts of liver from Hx rats treated T3. ChIP assays were performed and immunoprecipitated DNA analyzed using qPCR to measure the induction of transcription factor binding to the HMGR promoter in response to T3. Most notably, USF-2 binding was induced approximately 4-fold in response to T3 (Fig. 10). The binding of SREBP-2 or NF-Y was not significantly increased in response to T3 treatment. siRNA Knockdown of Transcription Factors In order to better understand the functional necessity of the USF-2, NF-Y, and SREBP-2 transcription factors in the T3 induction of HMGR transcription, we performed in vivo siRNA knockdown assays. We hypothesized that knockdown of these necessary factors would mimic the results of our previous mutations in the HMGR promoter elements and abolish the T3 response as measured by

PAGE 42

28 HMGR promoter activity. In order to determine if siRNA knockdown could be utilized to analyze the functional role of the identified transcription factors, we measured the levels of mRNA for SREBP-2, SREBP-1, USF-2, and NF-Y in response to T3 treatment (Fig. 11). We observed a 1.5-fold induction of SREBP2 mRNA in response to T3 treatment, which correlates with previous reports that SREBP-2 mRNA is transcribed and protein translated in response to T3 treatment ( 70 ). This narrow effect may be sufficient to drive T3 induction of HMGR transcription, as previous studies have shown tight control of SREBP processing ( 81 ). This mechanism is consistent with the long lag period for induction of HMGR and suggests that knockdown of SREBP-2 may decrease induction of HMGR by T3. USF-2, SREBP-1, and NF-Y mRNAs were unchanged in response to T3. USF-2 and NF-Y are ubiquitously expressed and function as transcription factors for a number of unrelated genes ( 57, 58 ), which suggests that they may be less sensitive to hormonal stimuli. The SREBP proteins are more specialized and function primarily on genes involved in fatty-acid and lipid metabolism ( 65 ), which themselves are frequently T3 responsive ( 53, 70 ) siRNA to USF-2, SREBP-2, or NF-Y was electroporated into the livers of Hx + T3 rats. Efficacy of siRNA knockdown was measured by qPCR analysis of endogenous mRNA isolated from individual electroporation sites 24 hours following electroporation. siRNA treatment resulted in maximal knockdown of endogenous USF-2 to 82% of control and SREBP-2 to 51% of control (Fig. 12) within 24 hours. siRNA to NF-Y required a greater period of time to achieve

PAGE 43

29 optimal knockdown, with knockdown to 79% of control achieved at 24 hours and to 24% of control at 48 hours. Figure 8. EMSA Analysis of th e -316/-321 HMGR Promoter Region. A probe corresponding to the -325/-307 promot er region was incubated with 2 g of pooled nuclear extract prepared from the liv ers of normal rats. A. Three g of antibody to potential transcription factors was added to each binding reaction to obtain a supershift of the protein-probe complex. B. Lane 1 shows binding reaction. Lanes 2-7 show the addition of increasing amounts of USF-2 antibody (1-6 g).

PAGE 44

30 Having generated a considerable knockdown of endogenous mRNA, we then co-electroporated the Wt HMGR plasmid with siRNA to each factor. siRNA to USF-2 and SREBP-2 generated knockdown of HMGR promoter activity to 49% or 44% of control, respectively and essentially abolished the T3 response (Fig. 12). This knockdown is consistent with the difference in Wt HMGR promoter activity observed in the Hx rat compared to rats treated with T3 (Fig. 4B). Electroporation of NF-Y siRNA resulted in knockdown of HMGR promoter activity that was highest after 48 hours. The knockdown at 24 hours was to 75% of control compared to 57% of control at 48 hours (Fig. 12). These in vivo knockdown assays indicate functional roles for USF-2, SREBP-2, and NFY in T3 activation of HMGR transcription. Figure 9. USF-2 Binds to the HMGR Promoter. ChIP assays were performed on pooled chromatin prepared from equal portions of liver collected from 3 Hx + T3 rats. Sheared chromatin was immunoprecip itated using the antibodies indicated. Immunoprecipitated DNA was analyzed by PCR and products (220bp) were run on a 2% agarose.

PAGE 45

31 Discussion We utilized in vivo electroporation in a hypothyroid rat model to analyze the regulatory mechanism of T3 induced hepatic HMGR gene expression. Though the effect of T3 on HMGR transcription has been well documented ( 51, 71, 82, 83 ), little is known about the actual molecular mechanism responsible for this regulation. Due to the significant lag time required for induction of HMGR following T3 treatment and the necessity of mRNA and protein synthesis to Figure 10. USF-2 Bi nding to the HMGR Promoter is Increased 4-fold in Response to T3. Two chromatin pools were prepared from equal portions of liver collected from 3 rats in each treatment group ( T3). ChIP was performed for the transcription factors listed. Immunopr ecipitated DNA was analyzed by qPCR in triplicate. Fold-change in binding was calc ulated for at least three separate ChIP experiments as the ratio of Hx + T3 binding to Hx binding. Statistically significant differences are relative to the total input DNA set at 1. *p<0.05

PAGE 46

32 produce the response ( 51 ), we hypothesized that an atypical mechanism may be involved in transcriptional activation. Furthermore, the lack of a consensus TRE in the HMGR promoter suggests that T3 induction occurs via another mechanism. Though we were unable to locate a TRE in the proximal promoter, it may be worthwhile to search intronic sequences for a TRE, as this has been documented for the carnitine palmitoyltransferase-I alpha gene ( 54 ). Figure 11. Real-time PCR Analysis of the Effect of Thyroid Hormone on Transcription Factors that Bind the HMGR Promoter. Total RNA was isolated from livers of hypophysectomized rats treated T3 (n 4). Quantitative real-time PCR was performed to measure relative m RNA levels of USF-2, SREBP-2, NF-Y, and SREBP-1. Statistically significant differ ences are relative to Hx mRNA for each gene. *p<0.05

PAGE 47

33 We measured a 2.5-fold induction of HMGR promoter activity with a Wt plasmid corresponding to the -325/+70 region of the HMGR promoter. This value agrees well with the 2.7-fold induction of HMGR mRNA as measured by qPCR. Analysis of the HMGR promoter out to -5683 bp resulted in no additional increase in HMGR promoter activity. The -325/+70 region of the promoter is highly conserved in mammalian species. Specifically, the USF-2, the SRE, and the NF-Y binding sites all lie within regions of high conservation in the HMGR promoter. This suggests that the mechanism of T3 induction could likely occur through these sites. Also, each of these factors have previously been shown to function in the T3 regulation of genes such as fatty acid synthase, S14, carnitine Figure 12. In Vivo siRNA Knockdown of Hepatic USF-2, SREBP-2, and NF-Y. Total RNA was isolated from the livers of hypophysectomized rats treated with T3 and electroporated with 5 g SREBP-2, 20 g USF-2 or NF-Y siRNA, or saline control (n 3). qPCR was performed to measure relative endogenous mRNA levels of each factor in response to the respec tive siRNA. Saline electroporation was set to 100% as the control for each gene. siRNA knockdowns are presented as a percentage of this control.

PAGE 48

34 palmitoyltransferase-I, acetyl-CoA carboxylase-alpha, and ApoA-V ( 53-55, 84 ). Correspondingly, mutations in each of these elements resulted in essentially complete loss of T3 induction as measured by HMGR promoter activity. The binding of SREBP-1 and SREBP-2 to the HMGR promoter is well established in the literature ( 60, 61 ) and in vitro and iv vivo assays have shown NF-Y to bind the -65/-69 element ( 59, 61 ). However, there has been no report of Figure 13. In Vivo siRNA Knockdown Demonstrates the Functional roles of USF-2, SREBP-2, and NF-Y on Hepa tic HMGR Promoter Activity. An HMGR promoter construct spanning the -325/ +70 region (wild-type) and either 5 g SREBP-2 or 20 g USF-2 or NF-Y siRNA were co -electroporated into the livers of hypophysectomized rats treated with T3. Wild-type promoter activity was set to 100% as the control. siRNA knockdow ns are presented as a percentage of this control. Data are reported as the mean standard error of the mean for each treatment. Statistically significant di fferences are relative to control (n 3). p<0.05, † p<0.10

PAGE 49

35 USF-2 binding to the -316/-321 element. Here we present data that provides in vivo evidence of USF-2 binding to the HMGR promoter. A previous report has shown this sequence to bind the LRH-1/FTF protein to mediate bile acid regulation of HMGR, though we were unable to replicate this binding by EMSA ( 85 ). It is not unusual for USF-2 to regulate genes involved in lipid metabolism, as it has been identified as a regulator of Apolipoprotein A5 ( 84 ) and is associated with familial combined hyperlipidemia ( 86 ). ChIP analyses of a number of transcription factors show that USF-2 promoter binding is increased 4-fold with T3 treatment. It is possible that although USF-2 is bound to the promoter in a basal state, additional USF-2 protein is recruited to the HMGR promoter in response to T3. USF-2 is a member of the evolutionary conserved basic-helix-loop-helix-leucine zipper transcription factor family ( 57 ) that functions as a homodimer or heterodimer with USF-1. The USF proteins function in transcriptional activation via a number of pathways including cooperative interaction with other factors ( 87 ), homoand heterodimerization and DNA looping ( 88 ), and the recruitment of histone modifications ( 89 ). The most likely mechanism is the absence of USF-2 from the Hx HMGR promoter and the subsequent recruitment of a USF-2 dimer or tetramer in response to T3. The binding of other factors assayed was not greatly increased in response to T3 treatment, suggesting that they may be required for basal regulation of the gene, and while not solely responsible for the induction of HMGR transcription, are indeed necessary.

PAGE 50

36 In order to better understand the functional necessity of the USF-2, NF-Y, and SREBP transcription factors in the T3 response of HMGR transcription, we measured their gene expression in response to T3. Real-time PCR analysis of SREBP-2 showed that SREBP-2 mRNA was modestly induced by T3 treatment suggesting that knock down of this target may decrease the induction of HMGR by T3. This narrow effect may be sufficient to drive T3 induction of HMGR transcription, as previous studies have shown tight control of SREBP processing ( 81 ). Real-time PCR analyses of USF-2 and NF-Y did not show an induction of the mRNA for these genes in response to T3 treatment. These factors are ubiquitously expressed and function as transcription factors for a number of unrelated genes ( 57, 58 ), which implies that they may be less sensitive to hormonal stimuli. The SREBP proteins are more specialized and function primarily on genes involved in fatty-acid and lipid metabolism ( 63-66 ), which themselves are frequently T3 responsive ( 53, 70, 90 ). We hypothesized that knockdown of these necessary factors would mimic the results of our previous mutations in the HMGR promoter elements and abolish the T3 response as measured by HMGR promoter activity. We performed in vivo siRNA experiments using the On-TARGETplus SMARTpool siRNAs from Dharmacon or SureSilencing siRNA from SABiosciences. These pools contain four duplexes all designed to target distinct sites within the specific gene of interest, providing high efficiency of knockdown. Following successful knockdown of endogenous targets, we then co-electroporated the Wt HMGR plasmid with siRNA to each factor. siRNA to USF-2, SREBP-2, and NF-Y

PAGE 51

37 essentially abolished the T3 response. This knockdown is consistent with the difference in Wt HMGR promoter activity observed in the Hx rat compared to rats treated with T3. It is pertinent to note that quantification of endogenous mRNA knockdown (Fig. 12) may include hepatocytes that were not transfected with siRNA due to the potential collection of extraneous tissue. This may result in masking of the knockdown effect. In contrast, knockdown of HMGR promoter activity (Fig. 13) is measured by luciferase assay, which only quantifies successfully transfected cells. Thus, discrepancies in relative knockdown between endogenous mRNA and promoter activity are expected. In conclusion, the -325/+70 region of the HMGR promoter appears sufficient for the full T3 response. The newly described element at -316/-321 was shown to bind USF-2 in vivo Binding of USF-2 to this element was markedly increased by T3 treatment. The transcription factors USF-2, SREBP-2, and NF-Y are necessary for the response, as mutations in the elements binding these factors markedly diminished the T3 response. Furthermore, knockdown of USF2, SREBP-2, or NF-Y mRNA was able to nearly eliminate the T3 response, which suggests functional roles for all of these factors in regulating hepatic HMGR promoter activity. Even though T3 did not appear to cause significant increases in binding of SREBP-2 or NF-Y to the HMGR promoter, the decreases observed after siRNA treatment indicate that these factors are also required. Together, these data provide a working model for T3 induction of HMGR gene expression.

PAGE 52

38 Chapter 3 Thyroid Hormone Promotes Macrophage Cholesterol Efflux via ABCA1 Introduction The deposition of excess cholesterol into the arterial lining and subsequent hardening of the arteries is the well-known condition of atherosclerosis. In this disease, circulating plasma LDL particles invade the endothelium and become oxidized ( 91 ). The body’s inflammatory response sends monocytes to the site of invasion that differentiate into macrophages ( 92 ). These macrophages phagocytose the oxidized LDL and are transformed into foam cells, which are retained in the endothelial wall ( 93 ). The accumulation of foam cells leads to the formation of lesions in the arteries known as fatty streaks ( 94 ). These are the first steps of atherosclerosis and are naturally occurring processes that are result from high levels of LDL cholesterol ( 95 ). The cholesterol transport mechanism that opposes this lipid deposition is reverse cholesterol transport (RCT), or cholesterol efflux. RCT is a protective mechanism that lessens the cholesterol burden in atherosclerotic plaques. This process is mediated by lipid-poor circulating plasma HDL particles. HDL particles are synthesized by the liver and secreted into the bloodstream. It has been proposed that through interaction with hepatic ABCAI, the particles are fitted with two to four molecules of ApoA-I ( 96, 97 ). These lipid-poor particles are designated pre-beta HDL ( 98 ). In RCT, pre-beta HDL particles composed

PAGE 53

39 primarily of nascent ApoA-I dock onto the cholesterol transporter ABCAI found in cholesterol-laden macrophages ( 99 ). The ApoA-I c-terminal domain has been shown to be necessary for cell-surface binding and cholesterol efflux from macrophages ( 100 ). This interaction allows for lipidation of ApoAI ( 10 ) via ABCAI and its subsequent transformation to a lipid-enriched particle ( 101, 102 ). The cholesterol transporter ABCG1 has also been implicated in cholesterol efflux to HDL ( 103, 104 ), however ABCA1 was shown to export cholesterol and phospholipid to lipid-free apolipoproteins, while ABCG1 exports cholesterol to phospholipid-containing acceptors and not necessarily apolipoproteins ( 105 ). The pre-beta HDL particles become alpha-HDL particles as they circulate through the bloodstream and collect cholesterol, a process mediated by phospholipid transfer protein (PLTP) and cholesteryl ester transfer protein (CETP) ( 106 ). Given the ability of HDL to facilitate the efflux of cholesterol from macrophages, it is not surprising that increased serum HDL cholesterol correlates with decreased levels of atherosclerosis ( 107 ). This may be due to higher levels of ApoA-I, the cholesterol acceptor on HDL. Treatments with ApoAI mimetics have been shown to increase the formation of pre-beta high-density lipoprotein, increase cholesterol efflux, and reduce lipoprotein oxidation in vitro and improve HDL inflammatory properties in humans with coronary heart disease ( 108 ). Apolipoprotein A-IV is a lesser studied apolipoprotein component of HDL. But like ApoA-I, ApoA-IV has been shown to remove cholesterol from fibroblast

PAGE 54

40 cells ( 109 ), mediate efflux via the ABCA1 transporter ( 110 ), and activate LCAT ( 111 ). Additionally, it has been found to bind hepatocellular plasma membranes ( 112 ). This effect may have important clinical implications, as ApoA-IV functions as a ligand for HDL to bind a hepatic receptor site distinct from apoE-dependent receptors ( 113 ). Previous reports have identified the activation of hepatic ApoA-I and ApoIV by thyroid hormone. While little is known about the effect of this regulation, thyroid hormone was shown to stabilize ApoA-IV mRNA ( 114 ). It is presently not known whether thyroid hormone acts to increase the cholesterol efflux from cells to acceptor HDL. In this study, we investigated the ability of serum from hypothyroid rats treated thyroid hormone to stimulate cellular cholesterol efflux via ABCA1 or ABCG1. Furthermore, we examined the effect of thyroid hormone on serum lipoproteins. Materials and Methods Experimental Animals Hypophysectomized and normal male Sprague-Dawley rats weighing 125 to 150 g were purchased from Harlan (Indianapolis, IN). Hypophysectomized rats received Tekland Iodine Deficient chow and water ad libitum and were housed in a reverse-cycle light controlled room with a 12-hour light period followed by a 12-hour dark period. The rats were maintained on the Iodine deficient diet for at least 21 days prior to being used in experiments in order to achieve sufficient turnover of T4. Rats on the iodine deficient diet were given an initial injection of 1.0 mg/kg T3 72 hours prior to harvest of tissue and an additional injection of 0.25 mg/kg T3 24 hours prior to harvest of tissue.

PAGE 55

41 HDL and T3 Assays Blood was collected and centrifuged at 16,000 x g for 5 min. The supernatant (serum) was collected and used for determinations of HDL, apolipoproteins and T3. HDL levels were measured using the HDL and LDL/VLDL Cholesterol Quantification Kit from BioVision (Cat# K613-100; Mountain View, CA). T3 levels were measured using the Free T3 ELISA from Calbiotech (Cat# F3106T; Spring Valley, CA) RNA Isolation A portion of about 200 mg was quickly excised from the livers of the rats and immediately homogenized in 4 ml of Tri-Reagent from Molecular Research Center (Cincinnati, OH) using a Polytron homogenizer at room temperature. Aortas were removed from the diaphragm to the bifurcation of the iliac arteries. The remainder of the isolation steps was carried out using volumes corresponding to 4x the manufacturer’s recommendations. RNA concentrations were determined by diluting each sample 1:100 and measuring their absorbance at 260nm. Microarray Analysis. Isolated RNA was further purified using the RNeasy kit from Qiagen. To demonstrate that the RNA was indeed free of RNase activity, samples were incubated in water at 42 C for 1 hr and then examined on 1% agarose gels. An identical pattern of bands in unheated and heated samples was obtained showing a lack of RNase activity. Microarray analysis was performed by the Moffitt Core Facility (Tampa, FL) using the Affymetrix

PAGE 56

42 GeneChip instrument system following the protocol established by Affymetrix, Inc. Ten g each of RNA from the livers of 3 Hx and 3 Hx+T3 rats was used in the analysis. The RNA was converted to double-stranded cDNA using an oligo(dT)24 primer containing a T7 RNA polymerase recognition sequence. The product was transcribed into biotin-labeled cRNA using T7 RNA polymerase. The biotinylated cRNA was hybridized to Affymetrix GeneChip Rat Genome 230 Plus 2.0 arrays which detects about 28,000 genes. Multiple oligos are used for each gene with the data averaged. Scanned chip images were analyzed using GeneChip algorithms. Real Time PCR To validate the microarray results, we assessed the expression of a subset of genes using real-time PCR. RNA was DNAse treated using the TURBO DNA-Free Kit (Ambion, Austin, TX). cDNA was prepared using the Reverse Transcription System (Promega) per the manufacturer’s protocol. Primer sequences used are listed in Table 4. mRNA was quantified under the following reaction conditions: 95oC for 5 minutes, followed by 40 cycle of 95oC for 15 seconds, 61oC for 1 minute and melt curve 55oC + 0.5oC each 10 seconds, x 80. All samples were run in duplicate on a Bio-Rad Chromo4 DNAEngine thermal cycler using SYBR green chemistry. Relative mRNA was calculated as a function of the internal control 18s using Ct. Macrophage Efflux Studies. Efflux studies were performed by the lab of George Rothblat (Children’s Hospital of Philadelphia, PA) as previously described ( 115 ).

PAGE 57

43 Briefly, J774 macrophage cells or BHK cells were obtained from Dr. Jack Oram, University of Washington School of Medicine. Cells were grown in 10% FBSDMEM in the presence of antibiotics. Cells were radiolabeled in 2.5% FBSDMEM containing 1 ci/ml 3H-cholesterol and 2mg, 113-818, an ACAT inhibitor using 0.5 ml per well. J774 control cells and J774 cells expressing ABCA1 were treated with 0.3mM cpt-cAMP for 16-18 hours to upregulate ABCA1. BHK cells were treated with 10 nM mifepristone for 16-18 hours to upregulate ABCG1. All efflux medium was prepared using serum from Hx rats treated T3 diluted to 2% in DMEM-HEPES. 2D-DIGE Two dimensional differential in-gel electrophoresis was performed by Applied Biomics (Hayward, CA). Briefly, equal volumes of serum from 3 Hx rats or 3 Hx + T3 rats was combined to form a pool for each treatment. A pool of serum from 2 normal rats was included as a control. Each pool was fluorescently labeled with different CyDye (red, yellow, blue) for downstream visualization. The samples were run on first dimension isoelectric focusing and second dimension SDS-PAGE. Differentially expressed proteins were quantified, cut out, and subjected to in-gel trypsin digestion followed by protein identification by MALDI-TOF mass spectrometry.

PAGE 58

44 Table 4. Real-time PCR Primers Results Hepatic ApoA-I and ApoA-IV Gene Expression are Induced by Thyroid Hormone We performed a microarray analysis on liver RNA isolated from Hx rats treated T3 in order to determine the role of thyroid hormone on hepatic genes involved in cholesterol metabolism. Table 5 shows a list of genes that were found to positively or negatively respond to T3 treatment. The cholesterol transporter ABCG5 and apolipoprotein A-IV showed the greatest T3 activation, 20-fold and 18-fold respectively. Phospholipase A2 showed the greatest decrease at 142-fold less in response to T3. These results were validated by real-time PCR analysis (Fig. 14). ApoA-IV was induced approximately 60-fold and ABCG5 50-fold. Additionally, we quantified the induction of ApoA-I and Target Sequence (5’ 3’) AAA CTC ACC CAG CAG CAG TTT GTG ABCA1 AAG ACC AGG GCG ATG CAA ACA AAG AGA ACT GGT CAA CAA CCC TCC TGT ABCG1 ATC AGG GAC ACC ACT TGG AAG CAA TCC ACT TTG GGC AAA CAG CTG AAC ApoA-I TCC TGT AGG CGA CCA ACA GTT GAA CTT TGC CAA CGA GCT AAA GG ApoA-IV GCT GCT TGT TTC AGG TGT TTC C TGA GCT CTT CCA CCA CTT CGA CAA ABCG5 TGT CCA CCG ATG TCA AGT CCA TGT TGC CCG GGA TGA TAC AGC AGT ABCG8 TTC TGC TCC ATG GAT GAA CAG GGT

PAGE 59

45 ABCG8 in response to T3, as they have been shown to be induced by T3. ApoA-I was induced 8-fold and ABCG8 over 150-fold. Table 5. Subset of hepatic thyroid hormone responsive genes identified by microarray analysis. Serum ApoA-I and ApoA-IV Protein are Induced by Thyroid Hormone The induction of the hepatic mRNA of ApoA-I and ApoA-IV suggested that as more apolipoprotein is synthesized in the liver, additional protein would circulate in the bloodstream. To measure changes in serum protein, we performed 2D DIGE on pooled serum samples from normal and Hx rats treated T3 (Fig. 15). Gel spots that were found to have significant changes (over 2-fold) in response to T3 treatment were trypsin digested and their protein identity determined by MALDI-TOF mass spectrometry. The determined protein sequences were compared to the database and those with high confidence (95100%) are listed in Table 6. Serum ApoA-I was found with 4 modifications and Gene Fold Change ABCG5 + 20 ApoA-IV + 18 Malic Enzyme + 14 ABCB1A + 8 ABCD2 + 7 Leptin Receptor + 6 IRE Binding Protein 1 + 5 ABCC5 + 4 HMGR + 2 LDLR + 2 SCAP + 2 ABCA8 3 Insulin-like Growth Factor 2 BP 3 5 Phospholipase A2, Group IIA 142

PAGE 60

46 increased 5-12–fold, depending on the modification. These modifications appear to primarily affect the charge of the protein. Serum ApoA-IV was found in only one form and was increased 2.4-fold by T3. Fetuin-A, serine protesase inhibitor alpha 1, fibrinogen alpha subunit, and Clu protein were also increased. Interestingly, ApoE was decreased 1.6-6.0 fold in response to T3. Figure 14. Real-time PCR Validation of Thyroid Hormone Responsive Hepatic Genes. A. ABCG5, B. ABCG8, C. ApoA-I, D. A poA-IV. Data are reported as the mean standard error of the mean for each treatment. Statistically significant differences are relative to control (n 3). p<0.05, † p<0.10

PAGE 61

47 Thyroid Hormone Promotes Macrophage Cholesterol Efflux via ABCA1 The evidence for a role for thyroid hormone in cholesterol efflux has not been investigated. Therefore, we conducted cholesterol efflux assays to determine if thyroid hormone could promote cholesterol efflux. Using the J774 murine macrophage cell line or BHK cells, efflux via the ABCA1 or ABCG1 transporter can be measured. Treatment with serum from Hx rats treated T3 Figure 15. 2D DIGE of Rat Serum. Serum was pooled from 3 rats treated T3 and ran on first dimension isoelectric focusing and second dimension SDS-PAGE. Serum pools from Hx+T3 rats were labeled with red CyDye and serum pools from Hx rats was labeled with green CyDye The identities of the individual spots are listed in Table 6.

PAGE 62

48 identified thyroid hormone-mediated cholesterol efflux via ABCA1 (Fig. 16). Thyroid hormone did not induce efflux via ABCG1. HDL cholesterol levels were measured and plotted relative to ABCA1 efflux to identify if the increase in efflux was a result of an increase in total number of HDL particles (Fig.17). There was no correlation between HDL and ABCA1 efflux, suggesting that the increase in cholesterol efflux is an effect independent of HDL particle number. Table 6. List of serum proteins induced by thyroid hormone Spot Protein Fold Change 12 Apolipoprotein A-I + 12.5 5 Fetuin-A + 10.8 44 Apolipoprotein A-I + 8.54 14 Preproapolipoprotein A-I + 7.80 4 Fetuin-A + 6.12 13 Apolipoprotein A-I + 5.02 33 Fetuin-A + 4.57 32 Fetuin-A + 4.12 24 Serine protease inhibitor alpha 1 + 3.61 10 Fibrinogen alpha subunit + 3.48 23 Clu protein + 3.29 22 Clu protein + 2.66 11 Apolipoprotein A-IV + 2.38 18 Apolipoprotein E 3.45 21 Apolipoprotein E 8.62

PAGE 63

49 Figure 17. ABCA1 Efflux is Not Mediated by an Increase in Serum HDL cholesterol. Serum was collected from normal and hypophysectomized rats treated T3. Normalized ABCA1 efflux was plotted relative to serum HDL cholesterol levels for individual serum samples. Figure 16. Thyroid Hormone Increases M acrophage Cholesterol Efflux via the ABCAI Cholesterol Transporter. Serum was collected from normal and hypophysectomized rats treated T3. Relative ABCA1 efflux ( A ) and ABCG1 efflux ( B ) was determined as described in Material and Methods. Data are reported as the mean standard error of the mean for each treatment. Statistically significant differences are relative to Hx. For all conditions, n 4 and *p<0.05.

PAGE 64

50 Discussion The role of thyroid hormone in cholesterol efflux was investigated in Sprague-Dawley hypophysectomized rats treated T3. These hypothyroid rats show moderately increased levels of LDL cholesterol that is markedly decreased with thyroid hormone treatment, similar to the effects observed in humans ( 37, 42 ). We utilized this animal model to mimic the cholesterol transport pathways under thyroid hormone control in the human. We performed microarray analysis on hepatic RNA from Hx rats treated T3 to identify thyroid hormone-responsive genes involved in cholesterol metabolism. Cholesterol-related genes with the greatest inductions were ABCG5 and ApoA-IV. ABCG5 functions as a membrane cholesterol transporter mainly in the liver and small intestine. Though relevant to the entire cholesterol transport process, it is not specifically involved in cholesterol efflux from macrophages. ApoA-IV is an apolipoprotein involved in the transport of cholesterol, predominantly as a member of HDL ( 113 ). ApoA-IV has also been shown to function as an acceptor in cholesterol efflux from macrophages ( 110 ). Phospholipase A2, Group IIA (PLA2) was the only gene significantly down-regulated by thyroid hormone. PLA2 is a small lipolytic enzyme that releases fatty acids from the second carbon of glycerol. PLA2 has been shown to be up-regulated in hepatocytes in response to stress stimuli and secreted from liver cells ( 116 ). More importantly, overexpression of PLA2 in mice increased the incidence of atherosclerotic lesions, decreased plasma HDL, and increased plasma LDL ( 117 ). PLA2 has been identified in atherosclerotic lesions ( 118 ) and

PAGE 65

51 has been suggested to aid in the transformation of macrophages into foam-cells by promoting macrophage LDL uptake ( 119, 120 ). The striking reduction in this gene in response to thyroid hormone suggests an alternative antiatherogenic property of T3. We performed real-time PCR analysis to validate our microarray findings. In addition to the inductions observed in ABCG5 and ApoA-IV, we also identified increases in ABCG8 and ApoA-I. Like ABCG5, ABCG8 is a membrane cholesterol transporter found in the liver and small intestine. ABCG5 and ABCG8 share a bidirectional promoter that is analyzed in the Chapter 4 of this report. ApoA-I is the major apolipoprotein component of HDL. We hypothesized that the increase in hepatic ApoA-IV and ApoA-I led to an increase in cholesterol loading of HDL particles via efflux from the ABCA1 or ABCG1 transporters. We analyzed the rat serum proteins differentially regulated by T3 using 2D-DIGE and downstream mass spectrometric protein analysis. The cholesterol transport proteins with the greatest increases in the T3-treated serum were ApoAI and ApoA-IV. Depending on the posttranslational modification, an increase of up to 12.5-fold was observed for ApoA-I and 2.4 for ApoA-IV. Since the total amount of serum HDL is not increased in response to T3, it may be that the total amount of ApoA-I or ApoA-IV per HDL particle increases. An increase in lipidaccepting apolipoprotein would facilitate the loading of additional cholesterol onto HDL particles, as treatment with ApoA-I mimetic peptides was able to increase cholesterol efflux ( 108 ). Serum ApoE, a component of chylomicrons and IDL and some HDL, was decreased in response to T3 treatment. These results correlate

PAGE 66

52 well with a previous study that demonstrated an increase in serum ApoE in hypothyroid rats ( 121 ). The decrease in ApoE may signify the conversion of more HDL particles to ApoA-I-rich particles capable of accepting cholesterol and the decrease in a need for additional ApoE particles. Finally, the effects of thyroid hormone on cholesterol efflux were examined in two cell lines capable of inducing cholesterol efflux. Cholesterol efflux was increased approximately 2-fold in cells expressing the ABCA1 transporter. There was no increase in efflux in cells expressing the ABCG1 transporter. This is consistent with previous reports that suggest an initial direct interaction between lipid-poor ApoA-I and ABCA1 ( 96 ) that results in the transfer of cholesterol to ApoA-I, followed by further lipidation via ABCG1 ( 103 ). We have provided the first evidence of thyroid hormone induced macrophage cholesterol efflux via the ABCA1 transporter. Based on an analysis of serum protein, is seems that an increase in the amounts of ApoA-I and ApoAIV serum protein in the T3-treated serum in responsible for the additional cholesterol accepting capacity of the associated lipoproteins.

PAGE 67

53 Chapter 4 Analysis of the ABCG8 Promoter Introduction ABCG5 and ABCG8 (ABCG5/G8) are membrane transporters of the ATPbinding cassette transporter superfamily. ABCG5/G8 are half transporters that form heterodimers to become functional ( 122 ). They are expressed primarily in the small intestine and liver and function to limit the uptake of dietary cholesterol from the intestine and promote biliary secretion of cholesterol from the liver ( 123, 124 ). Mutations in these genes have been well-documented to cause sitosterolemia ( 15, 125, 126 ). This disease is characterized by high levels of plasma plant sterols and increased levels of plasma cholesterol. ABCG5/G8 are recognized as the main pathway for sterol secretion into the bile and thus play an important role in cholesterol transport ( 127 ). ABCG5 and ABCG8 are two distinct that genes that lie in a head-to-head orientation and are under the control of a shared, bidirectional promoter ( 128 ). We have minimal knowledge of the regulation of the shared promoter, however liver receptor homologue 1 (LRH-1), nuclear factor 4 alpha (NF4 ), and GATA have been shown to bind to this promoter ( 129, 130 ). There have been no reports on the identification of hormone response elements. ABCG5/G8 are regulated by thyroid hormone. A study of hypophysectomized rats found that intestinal absorption of cholesterol was doubled and could be normalized with thyroid hormone treatment. Also, hepatic

PAGE 68

54 secretion of cholesterol and ABCG5/G8 expression are strongly stimulated in hypophysectomized rats during treatment with thyroid hormone ( 33 ). We aimed to identify the thyroid hormone response elements in the shared ABCG5/G8 promoter using EMSAs and in vivo electroporation. Materials and Methods Electrophoretic Mobility Shift Assay EMSAs were performed as described in Materials and Methods in Chapter 2. Additional probes are listed in Table 7. For antibody supershift experiments, binding reactions were incubated with 3 g of antisera for 30 minutes prior to the addition of probe. The antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA): TR -1 (sc-772x), TR 1 (sc-772x), RXR (sc-553x) Plasmid Construction The rat ABCG8 promoter was amplified to -444/+123 from a genomic BAC clone (CH230-263N2) from the rat genome using the Expand Long Template PCR System (Roche). The -444/+123 promoter segment in pGL3-Basic (Promega, Madison, WI) was obtained using the primer sequences: forward 5’-GAA CCG GGT ACC ATA GGG TGG GAA GCC TA-3’ and reverse 5’GAA CCG GCT AGC GAC CTG CGG TGT TGT-3’. This PCR product contains a KpnI site on the forward primer and NheI site on the reverse primer for cloning into pGL3-Basic. All clones were confirmed by restriction analysis and DNA sequencing at the Moffitt Molecular Biology Core Facility (Tampa, FL).

PAGE 69

55 Experimental Animals and In Vivo Electroporation were performed as described under Materials and Methods in Chapter 2 with the ABCG8 promoter-luciferase plasmid. Table 7. ABCG8 Promoter EMSA Probes Target Sequence (5’ 3’) ACAGAGGGCAGGTGATGGACCAGCCAAGGAA 1 CGATTTCCTTGGCTGGTCCATCACCTGCCCTCTGT TAGACAGGCAGCCCAAAGCCCACAGGCCCAC 2 CGATGTGGGCCTGTGGGCTTTGGGCTGCCTGTCTA GCTGTGGGGTCCCCTTACCTGACGCTGAAGGAC 3 CGATGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC CGCTGAAGGACACATTCAGGACACCTAA 4 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCG TGAATCCTCTGGTGTCCTGTCTGGCTTCA 5 CGATTGAAGCCAGACAGGACACCAGAGGATTCA TTTAGCCAGAGTGTCCTTATCTCGACAAT 6 CGATATTGTCGAGATAAGGACACTCTGGCTAAA CAACACCGCACCTCATGGCTGAGAAGACC 7 CGATGGTCTTCTCAGCCATGACCTGCGGTGTTG CAAGATGAAACTGACCTTTCTTTCCTAC 8 CGATGTAGGAAAGAAAGGTCAGTTTCATCTTG CACAGAATTAGTCCTAGTTCACCAC 9 CGATGTGGTGAACTAGGACTAATTCTGTG AGGACGTTGGGGTTAGGGGAGGACAGTG Malic Enzyme TRE CGATCACTGTCCTCCCCTAACCCCAACGTCCT GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATT CAGGGACACCTAA -420/-371 Wt CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTA AGGGGACCCCACAGC

PAGE 70

56 Table 8. ABCG8 Promoter Mutant EMSA Probes Target Sequence (5’ 3’) TCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 1 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGA G A TGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 2 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACA T C GC G GTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 3 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCAC C GC GCT T TGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 4 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCA A AGC GCTG G GGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 5 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCC C CAGC GCTGT T GGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 6 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCC A ACAGC GCTGTG T GGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 7 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACC A CACAGC GCTGTGG T GTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 8 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGAC A CCACAGC GCTGTGGG T TCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 9 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGA A CCCACAGC GCTGTGGGG G CCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 10 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGG C CCCCACAGC GCTGTGGGGT A CCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 11 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGG T ACCCCACAGC GCTGTGGGGTC A CCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 12 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGG T GACCCCACAGC GCTGTGGGGTCC A CTTACCTGACGCTGAAGGACACATTCAGGACACCTAA 13 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAG T GGACCCCACAGC GCTGTGGGGTCCC A TTACCTGACGCTGAAGGACACATTCAGGACACCTAA 14 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAA T GGGACCCCACAGC GCTGTGGGGTCCCC G TACCTGACGCTGAAGGACACATTCAGGACACCTAA 15 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTA C GGGGACCCCACAGC GCTGTGGGGTCCCCT G ACCTGACGCTGAAGGACACATTCAGGACACCTAA 16 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGT C AGGGGACCCCACAGC GCTGTGGGGTCCCCTT C CCTGACGCTGAAGGACACATTCAGGACACCTAA 17 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGG G AAGGGGACCCCACAGC

PAGE 71

57 Table 8 (Continued). ABCG8 Promoter Mutant EMSA Probes Target Sequence (5’ 3’) GCTGTGGGGTCCCCTTA A CTGACGCTGAAGGACACATTCAGGACACCTAA 18 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAG T TAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTAC A TGACGCTGAAGGACACATTCAGGACACCTAA 19 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCA T GTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACC G GACGCTGAAGGACACATTCAGGACACCTAA 20 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTC C GGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCT T ACGCTGAAGGACACATTCAGGACACCTAA 21 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGT A AGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTG C CGCTGAAGGACACATTCAGGACACCTAA 22 CGATTTAGGTGTCCTGAATGTGTCCTTCAGCG G CAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGA A GCTGAAGGACACATTCAGGACACCTAA 23 CGATTTAGGTGTCCTGAATGTGTCCTTCAGC T TCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGAC T CTGAAGGACACATTCAGGACACCTAA 24 CGATTTAGGTGTCCTGAATGTGTCCTTCAG A GTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACG A TGAAGGACACATTCAGGACACCTAA 25 CGATTTAGGTGTCCTGAATGTGTCCTTCA T CGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGC G GAAGGACACATTCAGGACACCTAA 26 CGATTTAGGTGTCCTGAATGTGTCCTTC C GCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCT T AAGGACACATTCAGGACACCTAA 27 CGATTTAGGTGTCCTGAATGTGTCCTT A AGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTG C AGGACACATTCAGGACACCTAA 28 CGATTTAGGTGTCCTGAATGTGTCCT G CAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGA C GGACACATTCAGGACACCTAA 29 CGATTTAGGTGTCCTGAATGTGTCC G TCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAA T GACACATTCAGGACACCTAA 30 CGATTTAGGTGTCCTGAATGTGTC A TTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAG T ACACATTCAGGACACCTAA 31 CGATTTAGGTGTCCTGAATGTGT A CTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGG C CACATTCAGGACACCTAA 32 CGATTTAGGTGTCCTGAATGTG G CCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGA A ACATTCAGGACACCTAA 33 CGATTTAGGTGTCCTGAATGT T TCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGAC C CATTCAGGACACCTAA 34 CGATTTAGGTGTCCTGAATG G GTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC

PAGE 72

58 Table 8 (Continued). ABCG8 Promoter Mutant EMSA Probes Target Sequence (5’ 3’) GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACA A ATTCAGGACACCTAA 35 CGATTTAGGTGTCCTGAAT T TGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACAC C TTCAGGACACCTAA 36 CGATTTAGGTGTCCTGAA G GTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACA G TCAGGACACCTAA 37 CGATTTAGGTGTCCTGA C TGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACAT G CAGGACACCTAA 38 CGATTTAGGTGTCCTG C ATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATT A AGGACACCTAA 39 CGATTTAGGTGTCCT T AATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTC C GGACACCTAA 40 CGATTTAGGTGTCC G GAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCA T GACACCTAA 41 CGATTTAGGTGTC A TGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAG T ACACCTAA 42 CGATTTAGGTGT A CTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGG C CACCTAA 43 CGATTTAGGTG G CCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGA A ACCTAA 44 CGATTTAGGT T TCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGAC C CCTAA 45 CGATTTAGG G GTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACA A CTAA 46 CGATTTAG T TGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACAC A TAA 47 CGATTTA T GTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACC G AA 48 CGATTT C GGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCT C A 49 CGATT G AGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTA C 50 CGAT G TAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC

PAGE 73

59 Results EMSA Analysis of the ABCG8 Promoter Due to the large induction of ABCG5/G8 expression in response to thyroid hormone, we analyzed the shared promoter for potential thyroid hormone response elements (TREs). We identified 9 elements that could function as TREs based on the canonical direct repeat-4 (DR-4) sequence: AGGTCAnnnnAGGTCA. We used nuclear extract prepared from normal rats to perform EMSA antibody supershift experiments with antisera to TR -1. The TR antibody used in these experiments recognizes TR -1 and was the only functional antibody identified for antibody supershift experiments. Radiolabeled probes corresponding to the potential TREs in the ABCG8 promoter were incubated with nuclear extract in the binding reactions labeled in Figure 18. A probe to the known malic enzyme TRE served as a positive control. The probes corresponding to the -420/-388 and -398/-371 promoter regions showed strong shifted bands in the presence of TR -1 antibody. The probes corresponding to 233/-205 and -88/-60 promoter regions showed weakly shifted bands in the presence of TR -1 antibody. TR-1 and RXR Bind the ABCG8 Promoter The binding reactions that resulted in antibody supershifts were then incubated with antibody to RXR, which heterodimerizes with TR -1 in activation of thyroid hormone responsive genes. The probes corresponding to the -420/-388 and -398/-371 promoter regions showed strong shifted bands in the

PAGE 74

60 presence of either TR -1 or RXR or a combination of both (Fig. 19). The probes corresponding to -233/-205 and -88/-60 promoter regions did not produce strong shifted bands in any of the antibody treatments. Identification of a TRE at -392/-376 In an effort to identify the nucleotides in the -420/-371 promoter region to which TR 1 and RXR bind, we performed EMSAs with a radiolabeled probe to the -420/-371 promoter region. The labeled Wt probe was incubated in a binding reaction with normal rat liver nuclear extract. An unlabeled double-stranded oligonucleotide corresponding to the exact sequence of the Wt with the exception Figure 18. EMSA Analysis of the ABCG8 Promoter. Probes corresponding to the identified promoter regi ons were incubated with 2 g of pooled nuclear extract prepared from the livers of normal rats. Three g of TR antibody, which positively recognizes TR -1, or a negative control TR -1 antibody was added to each binding reaction to obtain a supershift of the pr otein-probe complex. The malic enzyme TRE was used as a positive control.

PAGE 75

61 of single nucleotide substitutions was added in 50x molar excess relative to the radiolabeled probe in the remaining lanes (Fig. 20). The sequence at the top of the figure is the wild type promoter sequence, with an arrow highlighting the nucleotide substitution in each lane. The Wt band in Figure 20 can be efficiently competed away with the cold wild-type competitor (4th lane). The mutants that were unable to compete away the wild-type binding represent the sequence at 392/-376: AGGACAcattcAGGACA. Figure 19. TR -1 and RXR Bind the ABCG8 Promoter. Probes corresponding to the identified promoter r egions were incubated with 2 g of pooled nuclear extract prepared from the livers of normal rats. Three g of TR antibody, which positively recognizes TR -1, or RXR antibody, or a combination of both antibodies, was added to each binding reaction to obtain a supershift of the proteinprobe complex.

PAGE 76

62 The -444/+123 ABCG8 Promoter Plasmid is not Functional by in vivo Electroporation. The promoter region corresponding to the proximal promoter out to -444 was cloned into the pGL3-Basic luciferase plasmid backbone to evaluate the thyroid hormone response by luciferase assay. The plasmid was electroporated in the livers of normal rats and Hx rats treated T3 to determine if this region of the promoter could induce a thyroid hormone response. Unfortunately, this plasmid was not functional and did not produce luciferase activity over background (Fig 21). Figure 20. EMSA Analysis of the -420/-371 ABCG8 Promoter Region EMSA using 50x competitor probes to identify nuc leotides that are necessary for binding to occur to the -420/-371 regi on. The wild-type promot er sequence is listed on top with an arrow pointing to the point mutation in the competitor probe.

PAGE 77

63 Discussion In hypophysectomized (Hx) rats, intestinal absorption of cholesterol is doubled, and treatment with T3 normalizes this effect ( 33 ). The ATP-Binding Cassette (ABC) transporters ABCG5 and ABCG8 function as half-transporters in the intestine and liver to limit intestinal absorption and promote biliary excretion of cholesterol, respectively ( 123, 124 ). Hepatic expression of both genes is diminished in hypophysectomized rats, but is greatly induced (up to 100-fold) by subsequent treatment with thyroid hormone. This suggests that ABCG5/8 function to mediate thyroid hormone-dependent biliary secretion of cholesterol. Figure 21. The -444/+123 ABCG8 Promot er Plasmid is not Functional by in vivo Electroporation. An ABCG8 promoter construct inclusive of the -444/+123 region was electroporated into the liv ers of hypophysectomized rats treated T3. Data are reported as the mean standard error of the mean for each promoter construct.

PAGE 78

64 Due to the drastic induction of these genes by T3, the shared promoter of these genes was analyzed for thyroid hormone response elements (TREs). The intergenic region, including the bidirectional promoter, is heavily conserved ( 128 ) among several species. Multiple sequence alignment and transcription factor prediction algorithms were applied to the sequences to identify potential TREs. Nine regions of high conservation and high probability of TREs were identified. These sequences were analyzed for TR -1 binding ability by EMSA. The -420/371 ABCG8 downstream region showed the strongest shifted bands in the presence of TR -1 antibody. Within this region, the element AGGACAcattcAGGACA was shown to be necessary for binding to occur. Promoter luciferase plasmids were prepared to include this region (-444/+123) and introduced into the livers of Hx rats treated T3 to determine if a thyroid hormone response could be measure by luciferase activity. Unfortunately, the prepared plasmid was not functional and produced no measurable luciferase assay. Consequently, there was no observed T3 response in this plasmid. Additional investigation and cloning of the rat ABCG8 promoter sequence into the pGL3-Basic luciferase backbone did not provide a functional plasmid. A reporter gene inclusive of a 358bp fragment of the murine ABCG5/G8 promoter was also not functional as a promoter plasmid ( 131 ). Cloning of the corresponding human sequence produced a functional promoter activity response ( 128 ). We evaluated the possibility of a reading frame shift in the cloned sequence, but did not find any alterations that would have affected transcription initiation. It is unclear if this short sequence is incapable of

PAGE 79

65 functioning as a minimal promoter or if other transcriptional mechanisms are impaired.

PAGE 80

66 Chapter 5 Final Conclusions and Discussion Thyroid hormone exerts multiple and critical roles in cholesterol metabolism. In general, thyroid hormone has atheroprotective effects that include decreased circulating LDL cholesterol, decreased absorption of dietary cholesterol, and increased biliary secretion of cholesterol (Fig. 22). These effects are the result of thyroid hormone’s direct regulation of a number of hepatic and intestinal genes involved in cholesterol metabolism. We examined the role of thyroid hormone in three areas of cholesterol metabolism: i) hepatic cholesterol synthesis under the control of HMG-CoA reductase, ii) macrophage cholesterol efflux, and iii) ABCG5/G8-mediated biliary secretion of cholesterol. The activation of HMGR by thyroid hormone has been well documented. Throughout previous studies, however, the mechanism facilitating this activation has been largely overlooked. We identified USF-2, SREBP-2, and NF-Y as necessary factors in this activation using in vivo techniques. siRNA coelectroporation studies demonstrated the necessity of these factors in thyroid hormone induction of HMGR promoter activity. Quantitative ChIP analyses suggested that while SREBP-2 and NF-Y are necessary factors for activation, the relative amounts of promoter binding does not change in response to thyroid hormone. However, thyroid hormone was shown to increase the relative binding of USF-2 4-fold. We propose that in the absence of thyroid hormone, USF-2

PAGE 81

67 does not bind the HMGR promoter. Upon thyroid hormone treatment, a dimer or tetramer of USF-2 is recruited to the promoter thus activating HMGR transcription (Fig. 23). Figure 22. Combined Actions of Thyroid Hormone on Cholesterol Metabolism. The atheroprotective effects of thyroid hormone include incr eased biliary secretion of cholesterol, decreased intestinal absorpt ion of cholesterol, and increased hepatic uptake of cholesterol resulting in lower LDL cholesterol levels.

PAGE 82

68 The ability to increase cholesterol efflux presents an intriguing treatment for atherosclerosis. Lipid-poor ApoA-I particles are able to remove cholesterol from atherogenic cholesterol-laden macrophages to be transported to the liver for excretion. A model of selective delipidation of plasma HDL in primates demonstrated decreased atherosclerosis in the presence of lipid-poor ApoA-I ( 132 ). We determined that hepatic ApoA-I and ApoA-IV mRNA are increased by thyroid hormone. This hepatic induction translates to increased serum ApoA-I and ApoA-IV. Correspondingly, macrophage cholesterol efflux is induced via the Figure 23. Proposed Model of HMGR Promoter. In the absence of thyroid hormone USF-2 does not bind the HMGR prom oter (top panel). U pon treatment with thyroid hormone, USF-2 dimerizes and is re cruited to the HMGR promoter, thus stimulating transcription (bottom panel).

PAGE 83

69 ABCA1 transporter and not the ABCG1 transporter in response to thyroid hormone. We propose that the increase in serum ApoA-I and ApoA-IV facilitates the increased cholesterol efflux from macrophages (Fig. 24). These data provide further insight into the mechanisms of thyroid hormone’s atheroprotective effects and potentially provide a therapeutic target for treating atherosclerosis. The Metabasis TR agonist that targets the liver (MB07811) results in a reduction in serum cholesterol and an induction of hepatic T3-responsive genes ( 39 ). Unfortunately, the effects of the agonist on hepatic ApoA-I and ApoA-IV were not examined. It would be interesting, and perhaps beneficial, to determine if a TR agonist is able to increase serum ApoA-I and ApoA-IV with a downstream induction of cholesterol efflux. The area of thyroid hormone-mediated cholesterol efflux is a novel field of study that has the potential to provide success in treating atherosclerosis. Thyroid hormone regulation of biliary cholesterol secretion provides another therapeutic target for hypercholesterolemia. The hepatic ABCG5/G8 cholesterol transporters are activated by thyroid hormone. Using EMSAs, we identified a TR binding site at -392/-376 of the ABCG8 promoter. This TR binding site presents a target for the TR agonist class of therapeutics. It would be advantageous to the field of hypercholesterolemia research to ascertain if the liver-specific TR agonist, MB07811, activates ABCG5/G8. Upregulation of ABCG5/G8 should lead to increased biliary secretion of cholesterol, as was identified in the hypophysectomized rat treated with thyroid hormone ( 33 ).

PAGE 84

70 The future role of thyroid hormone in treating hypercholesterolemia and associated diseases may lie in the design of liver-specific TR agonists or other factors involved in the mechanism of thyroid hormone activation of hepatic genes. We hope that these present data will provide the research community Figure 24. Thyroid Hormone Induces Cholesterol Efflux. Apolipoprotein loading in the absence (upper left grey) and pr esence (lower right white) of thyroid hormone. In the presence of T3, 1) Hepatic ApoA-I and ApoA-IV are induced leading to increased levels of serum A poA-I and ApoA-IV; 2) Lipid-poor HDL particles have a greater capacity to accumulate cholesterol from macrophages via the ABCA1 transporter; 3) Lipid-rich HDL completes the reverse cholesterol transport process by delivering cholestero l to the liver via the LDL receptor pathway.

PAGE 85

71 with additional incentive to develop useful T3 analogs to treat hypercholesterolemia.

PAGE 86

72 References 1. Davis, H. R., Jr., Zhu, L. J., Hoos, L. M., Tetzloff, G., Maguire, M., Liu, J., Yao, X., Iyer, S. P., Lam, M. H., Lund, E. G., Detmers, P. A., Graziano, M. P., and Altmann, S. W. (2004) Niemann-Pick C1 Like 1 (NPC1L1) is the intestinal phytosterol and cholesterol transporter and a key modulator of whole-body cholesterol homeostasis, J Biol Chem 279 33586-33592. 2. Altmann, S. W., Davis, H. R., Jr., Zhu, L. J., Yao, X., Hoos, L. M., Tetzloff, G., Iyer, S. P., Maguire, M., Golovko, A., Zeng, M., Wang, L., Murgolo, N., and Graziano, M. P. (2004) Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption, Science 303 1201-1204. 3. Chappell, D. A., and Medh, J. D. (1998) Receptor-mediated mechanisms of lipoprotein remnant catabolism, Prog Lipid Res 37 393-422. 4. Rustaeus, S., Lindberg, K., Stillemark, P., Claesson, C., Asp, L., Larsson, T., Boren, J., and Olofsson, S. O. (1999) Assembly of very low density lipoprotein: a two-step process of apolipoprotein B core lipidation, J Nutr 129 463S-466S. 5. Gregory, D. H., Vlahcevic, Z. R., Schatzki, P., and Swell, L. (1975) Mechanism of secretion of biliary lipids. I. Role of bile canalicular and microsomal membranes in the synthesis and transport of biliary lecithin and cholesterol, J Clin Invest 55 105-114. 6. Swell, L., and Law, M. D. (1968) Synthesis of serum and sub-cellular liver cholesterol esters in fasted and fed rats, J Nutr 95 141-147. 7. Wetterau, J. R., and Zilversmit, D. B. (1985) Purification and characterization of microsomal triglyceride and cholesteryl ester transfer protein from bovine liver microsomes, Chem Phys Lipids 38 205-222. 8. Marzetta, C. A., Foster, D. M., and Brunzell, J. D. (1990) Conversion of plasma VLDL and IDL precursors into various LDL subpopulations using density gradient ultracentrifugation, Journal of lipid research 31 975-984.

PAGE 87

73 9. Brown, M. S., and Goldstein, J. L. (1984) How LDL receptors influence cholesterol and atherosclerosis, Sci Am 251 58-66. 10. Marcel, Y. L., Ouimet, M., and Wang, M. D. (2008) Regulation of cholesterol efflux from macrophages, Curr Opin Lipidol 19 455-461. 11. Ira Thabrew, R. M. A., and Claire Wicks (2001) Biochemistry for Clinical Medicine Cambridge University Press. 12. Zannis, V. I., Chroni, A., and Krieger, M. (2006) Role of apoA-I, ABCA1, LCAT, and SR-BI in the biogenesis of HDL, J Mol Med 84 276-294. 13. Olofsson, S. O., and Boren, J. (2005) Apolipoprotein B: a clinically important apolipoprotein which assembles atherogenic lipoproteins and promotes the development of atherosclerosis, J Intern Med 258 395-410. 14. Zha, X., Gauthier, A., Genest, J., and McPherson, R. (2003) Secretory vesicular transport from the Golgi is altered during ATP-binding cassette protein A1 (ABCA1)-mediated cholesterol efflux, J Biol Chem 278 1000210005. 15. Lee, M. H., Lu, K., Hazard, S., Yu, H., Shulenin, S., Hidaka, H., Kojima, H., Allikmets, R., Sakuma, N., Pegoraro, R., Srivastava, A. K., Salen, G., Dean, M., and Patel, S. B. (2001) Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption, Nat Genet 27 79-83. 16. Parraga, A., Bellsolell, L., Ferre-D'Amare, A. R., and Burley, S. K. (1998) Co-crystal structure of sterol regulatory element binding protein 1a at 2.3 A resolution, Structure 6 661-672. 17. Brown, M. S., and Goldstein, J. L. (1997) The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor, Cell 89 331-340. 18. Adams, C. M., Goldstein, J. L., and Brown, M. S. (2003) Cholesterolinduced conformational change in SCAP enhanced by Insig proteins and mimicked by cationic amphiphiles, Proceedings of the National Academy of Sciences of the United States of America 100 10647-10652.

PAGE 88

74 19. Sun, L. P., Li, L., Goldstein, J. L., and Brown, M. S. (2005) Insig required for sterol-mediated inhibition of Scap/SREBP binding to COPII proteins in vitro, J Biol Chem 280 26483-26490. 20. Brown, M. S., and Goldstein, J. L. (1999) A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood, Proc Natl Acad Sci U S A 96 11041-11048. 21. Eberle, D., Hegarty, B., Bossard, P., Ferre, P., and Foufelle, F. (2004) SREBP transcription factors: master regulators of lipid homeostasis, Biochimie 86 839-848. 22. O'Brien, T., Dinneen, S. F., O'Brien, P. C., and Palumbo, P. J. (1993) Hyperlipidemia in patients with primary and secondary hypothyroidism, Mayo Clin Proc 68 860-866. 23. Neves, C., Alves, M., Medina, J. L., and Delgado, J. L. (2008) Thyroid diseases, dyslipidemia and cardiovascular pathology, Rev Port Cardiol 27 1211-1236. 24. Martinez-Triguero, M. L., Hernandez-Mijares, A., Nguyen, T. T., Munoz, M. L., Pena, H., Morillas, C., Lorente, D., Lluch, I., and Molina, E. (1998) Effect of thyroid hormone replacement on lipoprotein(a), lipids, and apolipoproteins in subjects with hypothyroidism, Mayo Clin Proc 73 837841. 25. (2008) Metabasis Announces Promising Results from its Phase 1b Clinical Trial for MB07811, its Novel Product Candidate for the Treatment of Hyperlipidemia, in Medical News Today 26. Berkenstam, A., Kristensen, J., Mellstrom, K., Carlsson, B., Malm, J., Rehnmark, S., Garg, N., Andersson, C. M., Rudling, M., Sjoberg, F., Angelin, B., and Baxter, J. D. (2008) The thyroid hormone mimetic compound KB2115 lowers plasma LDL cholesterol and stimulates bile acid synthesis without cardiac effects in humans, Proc Natl Acad Sci U S A 105 663-667. 27. Chiamolera, M. I., and Wondisford, F. E. (2009) Minireview: Thyrotropinreleasing hormone and the thyroid hormone feedback mechanism, Endocrinology 150 1091-1096.

PAGE 89

75 28. McCann, U. D., Shaw, E. A., and Kaplan, M. M. (1984) Iodothyronine deiodination reaction types in several rat tissues: effects of age, thyroid status, and glucocorticoid treatment, Endocrinology 114 1513-1521. 29. Kaplan, M. M. (1984) The role of thyroid hormone deiodination in the regulation of hypothalamo-pituitary function, Neuroendocrinology 38 254260. 30. Robson, H., Siebler, T., Shalet, S. M., and Williams, G. R. (2002) Interactions between GH, IGF-I, glucocorticoids, and thyroid hormones during skeletal growth, Pediatric research 52 137-147. 31. Leonard, J. L. (2008) Non-genomic actions of thyroid hormone in brain development, Steroids 73 1008-1012. 32. Ness, G. C., and Zhao, Z. (1994) Thyroid hormone rapidly induces hepatic LDL receptor mRNA levels in hypophysectomized rats, Arch Biochem Biophys 315 199-202. 33. Galman, C., Bonde, Y., Matasconi, M., Angelin, B., and Rudling, M. (2008) Dramatically increased intestinal absorption of cholesterol following hypophysectomy is normalized by thyroid hormone, Gastroenterology 134 1127-1136. 34. Ness, G. C., Dugan, R. E., Lakshmanan, M. R., Nepokroeff, C. M., and Porter, J. W. (1973) Stimulation of hepatic beta-hydroxy-betamethylglutaryl coenzyme A reductase activity in hypophysectomized rats by L-triiodothyronine, Proc Natl Acad Sci U S A 70 3839-3842. 35. Ness, G. C., Pendelton, L. C., and Zhao, Z. (1994) Thyroid hormone rapidly increases cholesterol 7 alpha-hydroxylase mRNA levels in hypophysectomized rats, Biochim Biophys Acta 1214 229-233. 36. Apostolopoulos, J. J., La Scala, M. J., and Howlett, G. J. (1988) The effect of triiodothyronine on rat apolipoprotein A-I and A-IV gene transcription, Biochem Biophys Res Commun 154 997-1002. 37. Abrams, J. J., and Grundy, S. M. (1981) Cholesterol metabolism in hypothyroidism and hyperthyroidism in man, J Lipid Res 22 323-338.

PAGE 90

76 38. Gebhard, R. L., and Prigge, W. F. (1992) Thyroid hormone differentially augments biliary sterol secretion in the rat. II. The chronic bile fistula model, J Lipid Res 33 1467-1473. 39. Erion, M. D., Cable, E. E., Ito, B. R., Jiang, H., Fujitaki, J. M., Finn, P. D., Zhang, B. H., Hou, J., Boyer, S. H., van Poelje, P. D., and Linemeyer, D. L. (2007) Targeting thyroid hormone receptor-beta agonists to the liver reduces cholesterol and triglycerides and improves the therapeutic index, Proc Natl Acad Sci U S A 104 15490-15495. 40. Vitic, J., and Stevanovic, J. (1993) Comparative studies of the serum lipoproteins and lipids in some domestic, laboratory and wild animals, Comp Biochem Physiol B 106 223-229. 41. Murakami, T., Sato, H., Nakatani, S., Taguchi, T., and Ohtsuka, A. (2001) Biliary tract of the rat as observed by scanning electron microscopy of cast samples, Arch Histol Cytol 64 439-447. 42. Illingworth, D. R., McClung, M. R., Connor, W. E., and Alaupovic, P. (1981) Familial hypercholesterolaemia and primary hypothyroidism: coexistence of both disorders in a young woman with severe hypercholesterolaemia, Clin Endocrinol (Oxf) 14 145-152. 43. Weitzel, J. M., Hamann, S., Jauk, M., Lacey, M., Filbry, A., Radtke, C., Iwen, K. A., Kutz, S., Harneit, A., Lizardi, P. M., and Seitz, H. J. (2003) Hepatic gene expression patterns in thyroid hormone-treated hypothyroid rats, J Mol Endocrinol 31 291-303. 44. Lopez, D., and Ness, G. C. (2006) Characterization of the rat LDL receptor 5'-flanking region, Biochim Biophys Acta 1761 492-500. 45. Shin, D. J., Plateroti, M., Samarut, J., and Osborne, T. F. (2006) Two uniquely arranged thyroid hormone response elements in the far upstream 5' flanking region confer direct thyroid hormone regulation to the murine cholesterol 7alpha hydroxylase gene, Nucleic Acids Res 34 3853-3861. 46. Dooley, K. A., Millinder, S., and Osborne, T. F. (1998) Sterol regulation of 3-hydroxy-3-methylglutaryl-coenzyme A synthase gene through a direct interaction between sterol regulatory element binding protein and the trimeric CCAAT-binding factor/nuclear factor Y, J Biol Chem 273 13491356.

PAGE 91

77 47. Lakshmanan, M. R., Nepokroeff, C. M., Ness, G. C., Dugan, R. E., and Porter, J. W. (1973) Stimulation by insulin of rat liver -hydroxymethylglutaryl coenzyme A reductase and cholesterol-synthesizing activities, Biochem Biophys Res Commun 50 704-710. 48. Ness, G. C. (1983) Regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase, Mol Cell Biochem 53-54 299-306. 49. Dugan, R. E., Ness, G. C., Lakshmanan, M. R., Nepokroeff, C. M., and Porter, J. W. (1974) Regulation of hepatic beta-hydroxy-betamethylglutaryl coenzyme A reductase by the interplay of hormones, Arch Biochem Biophys 161 499-504. 50. Simonet, W. S., and Ness, G. C. (1987) Turnover rates of HMG-CoA reductase mRNA: role of pituitary and thyroid hormones, Biochem Biophys Res Commun 146 1033-1039. 51. Simonet, W. S., and Ness, G. C. (1988) Transcriptional and posttranscriptional regulation of rat hepatic 3-hydroxy-3-methylglutarylcoenzyme A reductase by thyroid hormones, J Biol Chem 263 1244812453. 52. Harvey, C. B., and Williams, G. R. (2002) Mechanism of thyroid hormone action, Thyroid 12 441-446. 53. Yin, L., Zhang, Y., and Hillgartner, F. B. (2002) Sterol regulatory elementbinding protein-1 interacts with the nuclear thyroid hormone receptor to enhance acetyl-CoA carboxylase-alpha transcription in hepatocytes, J Biol Chem 277 19554-19565. 54. Jackson-Hayes, L., Song, S., Lavrentyev, E. N., Jansen, M. S., Hillgartner, F. B., Tian, L., Wood, P. A., Cook, G. A., and Park, E. A. (2003) A thyroid hormone response unit formed between the promoter and first intron of the carnitine palmitoyltransferase-Ialpha gene mediates the liver-specific induction by thyroid hormone, J Biol Chem 278 7964-7972. 55. Jump, D. B., Badin, M. V., and Thelen, A. (1997) The CCAAT box binding factor, NF-Y, is required for thyroid hormone regulation of rat liver S14 gene transcription, J Biol Chem 272 27778-27786.

PAGE 92

78 56. Jump, D. B., Thelen, A. P., and Mater, M. K. (2001) Functional interaction between sterol regulatory element-binding protein-1c, nuclear factor Y, and 3,5,3'-triiodothyronine nuclear receptors, J Biol Chem 276 3441934427. 57. Corre, S., and Galibert, M. D. (2006) USF as a key regulatory element of gene expression, Med Sci (Paris) 22 62-67. 58. Mantovani, R. (1998) A survey of 178 NF-Y binding CCAAT boxes, Nucleic Acids Res 26 1135-1143. 59. Lagor, W. R., de Groh, E. D., and Ness, G. C. (2005) Diabetes alters the occupancy of the hepatic 3-hydroxy-3-methylglutaryl-CoA reductase promoter, J Biol Chem 280 36601-36608. 60. Vallett, S. M., Sanchez, H. B., Rosenfeld, J. M., and Osborne, T. F. (1996) A direct role for sterol regulatory element binding protein in activation of 3hydroxy-3-methylglutaryl coenzyme A reductase gene, J Biol Chem 271 12247-12253. 61. Bennett, M. K., Seo, Y. K., Datta, S., Shin, D. J., and Osborne, T. F. (2008) Selective binding of sterol regulatory element-binding protein isoforms and co-regulatory proteins to promoters for lipid metabolic genes in liver, J Biol Chem 283 15628-15637. 62. Chouinard, R. A., Jr., Luo, Y., Osborne, T. F., Walsh, A., and Tall, A. R. (1998) Sterol regulatory element binding protein-1 activates the cholesteryl ester transfer protein gene in vivo but is not required for sterol up-regulation of gene expression, J Biol Chem 273 22409-22414. 63. Horton, J. D., Goldstein, J. L., and Brown, M. S. (2002) SREBPs: transcriptional mediators of lipid homeostasis, Cold Spring Harb Symp Quant Biol 67 491-498. 64. Horton, J. D., Goldstein, J. L., and Brown, M. S. (2002) SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver, J Clin Invest 109 1125-1131. 65. Amemiya-Kudo, M., Shimano, H., Hasty, A. H., Yahagi, N., Yoshikawa, T., Matsuzaka, T., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Osuga, J.,

PAGE 93

79 Harada, K., Gotoda, T., Sato, R., Kimura, S., Ishibashi, S., and Yamada, N. (2002) Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes, J Lipid Res 43 1220-1235. 66. Nagai, M., Sakakibara, J., Nakamura, Y., Gejyo, F., and Ono, T. (2002) SREBP-2 and NF-Y are involved in the transcriptional regulation of squalene epoxidase, Biochem Biophys Res Commun 295 74-80. 67. Horton, J. D., Shimomura, I., Brown, M. S., Hammer, R. E., Goldstein, J. L., and Shimano, H. (1998) Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2, J Clin Invest 101 2331-2339. 68. Ericsson, J., Jackson, S. M., and Edwards, P. A. (1996) Synergistic binding of sterol regulatory element-binding protein and NF-Y to the farnesyl diphosphate synthase promoter is critical for sterol-regulated expression of the gene, J Biol Chem 271 24359-24364. 69. Ericsson, J., Jackson, S. M., Lee, B. C., and Edwards, P. A. (1996) Sterol regulatory element binding protein binds to a cis element in the promoter of the farnesyl diphosphate synthase gene, Proc Natl Acad Sci U S A 93 945-950. 70. Shin, D. J., and Osborne, T. F. (2003) Thyroid hormone regulation and cholesterol metabolism are connected through Sterol Regulatory ElementBinding Protein-2 (SREBP-2), J Biol Chem 278 34114-34118. 71. Sample, C. E., Pendleton, L. C., and Ness, G. C. (1987) Regulation of 3hydroxy-3-methylglutaryl coenzyme A reductase mRNA levels by Ltriiodothyronine, Biochemistry 26 727-731. 72. Potter, H., Weir, L., and Leder, P. (1984) Enhancer-dependent expression of human kappa immunoglobulin genes introduced into mouse pre-B lymphocytes by electroporation, Proc Natl Acad Sci U S A 81 7161-7165. 73. Potter, H. (2001) Transfection by electroporation, Curr Protoc Immunol Chapter 10 Unit 10 15.

PAGE 94

80 74. Lagor, W. R., Heller, R., de Groh, E. D., and Ness, G. C. (2007) Functional analysis of the hepatic HMG-CoA reductase promoter by in vivo electroporation, Exp Biol Med (Maywood) 232 353-361. 75. Muramatsu, T., Ito, N., Tamaoki, N., Oda, H., and Park, H. M. (2001) In vivo gene electroporation confers nutritionally-regulated foreign gene expression in the liver, Int J Mol Med 7 61-66. 76. Gilbert, R. A., Jaroszeski, M. J., and Heller, R. (1997) Novel electrode designs for electrochemotherapy, Biochim Biophys Acta 1334 9-14. 77. Murad, H., Collet, P., Brunner, E., Schohn, H., Becuwe, P., Devignes, M. D., Dauca, M., and Domenjoud, L. (2007) Immunoselection and characterization of a human genomic PPAR binding fragment located within POTE genes, Biochimie 89 329-336. 78. Zhang, Z., Chen, K., Shih, J. C., and Teng, C. T. (2006) Estrogen-related receptors-stimulated monoamine oxidase B promoter activity is downregulated by estrogen receptors, Mol Endocrinol 20 1547-1561. 79. Malo, M. S., Pushpakaran, P., and Hodin, R. A. (2005) A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor, Biochemical and biophysical research communications 337 490-497. 80. Messeguer, X., Escudero, R., Farre, D., Nunez, O., Martinez, J., and Alba, M. M. (2002) PROMO: detection of known transcription regulatory elements using species-tailored searches, Bioinformatics 18 333-334. 81. Radhakrishnan, A., Goldstein, J. L., McDonald, J. G., and Brown, M. S. (2008) Switch-like control of SREBP-2 transport triggered by small changes in ER cholesterol: a delicate balance, Cell Metab 8 512-521. 82. Ness, G. C. (1991) Thyroid hormone. Basis for its hypocholesterolemic effect, J Fla Med Assoc 78 383-385. 83. Simonet, W. S., and Ness, G. C. (1989) Post-transcriptional regulation of 3-hydroxy-3-methylglutaryl-CoA reductase mRNA in rat liver. Glucocorticoids block the stabilization caused by thyroid hormones, J Biol Chem 264 569-573.

PAGE 95

81 84. Prieur, X., Huby, T., Coste, H., Schaap, F. G., Chapman, M. J., and Rodriguez, J. C. (2005) Thyroid hormone regulates the hypotriglyceridemic gene APOA5, J Biol Chem 280 27533-27543. 85. Datta, S., Wang, L., Moore, D. D., and Osborne, T. F. (2006) Regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase promoter by nuclear receptors liver receptor homologue-1 and small heterodimer partner: a mechanism for differential regulation of cholesterol synthesis and uptake, J Biol Chem 281 807-812. 86. Pajukanta, P., Lilja, H. E., Sinsheimer, J. S., Cantor, R. M., Lusis, A. J., Gentile, M., Duan, X. J., Soro-Paavonen, A., Naukkarinen, J., Saarela, J., Laakso, M., Ehnholm, C., Taskinen, M. R., and Peltonen, L. (2004) Familial combined hyperlipidemia is associated with upstream transcription factor 1 (USF1), Nature genetics 36 371-376. 87. Liu, M., Whetstine, J. R., Payton, S. G., Ge, Y., Flatley, R. M., and Matherly, L. H. (2004) Roles of USF, Ikaros and Sp proteins in the transcriptional regulation of the human reduced folate carrier B promoter, Biochem J 383 249-257. 88. Ferre-D'Amare, A. R., Pognonec, P., Roeder, R. G., and Burley, S. K. (1994) Structure and function of the b/HLH/Z domain of USF, Embo J 13 180-189. 89. West, A. G., Huang, S., Gaszner, M., Litt, M. D., and Felsenfeld, G. (2004) Recruitment of histone modifications by USF proteins at a vertebrate barrier element, Mol Cell 16 453-463. 90. Back, D. W., Wilson, S. B., Morris, S. M., Jr., and Goodridge, A. G. (1986) Hormonal regulation of lipogenic enzymes in chick embryo hepatocytes in culture. Thyroid hormone and glucagon regulate malic enzyme mRNA level at post-transcriptional steps, J Biol Chem 261 12555-12561. 91. Quinn, M. T., Parthasarathy, S., Fong, L. G., and Steinberg, D. (1987) Oxidatively modified low density lipoproteins: a potential role in recruitment and retention of monocyte/macrophages during atherogenesis, Proc Natl Acad Sci U S A 84 2995-2998.

PAGE 96

82 92. Gerrity, R. G. (1981) The role of the monocyte in atherogenesis: I. Transition of blood-borne monocytes into foam cells in fatty lesions, Am J Pathol 103 181-190. 93. Gerrity, R. G. (1981) The role of the monocyte in atherogenesis: II. Migration of foam cells from atherosclerotic lesions, Am J Pathol 103 191200. 94. Stary, H. C., Chandler, A. B., Glagov, S., Guyton, J. R., Insull, W., Jr., Rosenfeld, M. E., Schaffer, S. A., Schwartz, C. J., Wagner, W. D., and Wissler, R. W. (1994) A definition of initial, fatty streak, and intermediate lesions of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association, Circulation 89 2462-2478. 95. Kannel, W. B., Castelli, W. P., Gordon, T., and McNamara, P. M. (1971) Serum cholesterol, lipoproteins, and the risk of coronary heart disease. The Framingham study, Ann Intern Med 74 1-12. 96. Vedhachalam, C., Duong, P. T., Nickel, M., Nguyen, D., Dhanasekaran, P., Saito, H., Rothblat, G. H., Lund-Katz, S., and Phillips, M. C. (2007) Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles, J Biol Chem 282 25123-25130. 97. Timmins, J. M., Lee, J. Y., Boudyguina, E., Kluckman, K. D., Brunham, L. R., Mulya, A., Gebre, A. K., Coutinho, J. M., Colvin, P. L., Smith, T. L., Hayden, M. R., Maeda, N., and Parks, J. S. (2005) Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I, J Clin Invest 115 1333-1342. 98. Lie, J., de Crom, R., Jauhiainen, M., van Gent, T., van Haperen, R., Scheek, L., Jansen, H., Ehnholm, C., and van Tol, A. (2001) Evaluation of phospholipid transfer protein and cholesteryl ester transfer protein as contributors to the generation of pre beta-high-density lipoproteins, Biochem J 360 379-385. 99. Kielar, D., Dietmaier, W., Langmann, T., Aslanidis, C., Probst, M., Naruszewicz, M., and Schmitz, G. (2001) Rapid quantification of human ABCA1 mRNA in various cell types and tissues by real-time reverse transcription-PCR, Clin Chem 47 2089-2097.

PAGE 97

83 100. Burgess, J. W., Frank, P. G., Franklin, V., Liang, P., McManus, D. C., Desforges, M., Rassart, E., and Marcel, Y. L. (1999) Deletion of the Cterminal domain of apolipoprotein A-I impairs cell surface binding and lipid efflux in macrophage, Biochemistry 38 14524-14533. 101. Forte, T. M., Goth-Goldstein, R., Nordhausen, R. W., and McCall, M. R. (1993) Apolipoprotein A-I-cell membrane interaction: extracellular assembly of heterogeneous nascent HDL particles, J Lipid Res 34 317324. 102. Wang, X., Collins, H. L., Ranalletta, M., Fuki, I. V., Billheimer, J. T., Rothblat, G. H., Tall, A. R., and Rader, D. J. (2007) Macrophage ABCA1 and ABCG1, but not SR-BI, promote macrophage reverse cholesterol transport in vivo, J Clin Invest 117 2216-2224. 103. Vaughan, A. M., and Oram, J. F. (2005) ABCG1 redistributes cell cholesterol to domains removable by high density lipoprotein but not by lipid-depleted apolipoproteins, J Biol Chem 280 30150-30157. 104. Nakamura, K., Kennedy, M. A., Baldan, A., Bojanic, D. D., Lyons, K., and Edwards, P. A. (2004) Expression and regulation of multiple murine ATPbinding cassette transporter G1 mRNAs/isoforms that stimulate cellular cholesterol efflux to high density lipoprotein, J Biol Chem 279 4598045989. 105. Jessup, W., Gelissen, I. C., Gaus, K., and Kritharides, L. (2006) Roles of ATP binding cassette transporters A1 and G1, scavenger receptor BI and membrane lipid domains in cholesterol export from macrophages, Curr Opin Lipidol 17 247-257. 106. Bruce, C., Chouinard, R. A., Jr., and Tall, A. R. (1998) Plasma lipid transfer proteins, high-density lipoproteins, and reverse cholesterol transport, Annu Rev Nutr 18 297-330. 107. Reed, D. M., Strong, J. P., Resch, J., and Hayashi, T. (1989) Serum lipids and lipoproteins as predictors of atherosclerosis. An autopsy study, Arteriosclerosis 9 560-564. 108. Van Lenten, B. J., Wagner, A. C., Anantharamaiah, G. M., Navab, M., Reddy, S. T., Buga, G. M., and Fogelman, A. M. (2009) Apolipoprotein A-I mimetic peptides, Curr Atheroscler Rep 11 52-57.

PAGE 98

84 109. Stein, O., Stein, Y., Lefevre, M., and Roheim, P. S. (1986) The role of apolipoprotein A-IV in reverse cholesterol transport studied with cultured cells and liposomes derived from an ether analog of phosphatidylcholine, Biochim Biophys Acta 878 7-13. 110. Remaley, A. T., Stonik, J. A., Demosky, S. J., Neufeld, E. B., Bocharov, A. V., Vishnyakova, T. G., Eggerman, T. L., Patterson, A. P., Duverger, N. J., Santamarina-Fojo, S., and Brewer, H. B., Jr. (2001) Apolipoprotein specificity for lipid efflux by the human ABCAI transporter, Biochem Biophys Res Commun 280 818-823. 111. Steinmetz, A., and Utermann, G. (1985) Activation of lecithin: cholesterol acyltransferase by human apolipoprotein A-IV, J Biol Chem 260 22582264. 112. Weinberg, R. B., and Patton, C. S. (1990) Binding of human apolipoprotein A-IV to human hepatocellular plasma membranes, Biochim Biophys Acta 1044 255-261. 113. Dvorin, E., Gorder, N. L., Benson, D. M., and Gotto, A. M., Jr. (1986) Apolipoprotein A-IV. A determinant for binding and uptake of high density lipoproteins by rat hepatocytes, J Biol Chem 261 15714-15718. 114. Lin-Lee, Y. C., Strobl, W., Soyal, S., Radosavljevic, M., Song, M., Gotto, A. M., Jr., and Patsch, W. (1993) Role of thyroid hormone in the expression of apolipoprotein A-IV and C-III genes in rat liver, J Lipid Res 34 249-259. 115. Asztalos, B. F., de la Llera-Moya, M., Dallal, G. E., Horvath, K. V., Schaefer, E. J., and Rothblat, G. H. (2005) Differential effects of HDL subpopulations on cellular ABCA1and SR-BI-mediated cholesterol efflux, J Lipid Res 46 2246-2253. 116. Crowl, R. M., Stoller, T. J., Conroy, R. R., and Stoner, C. R. (1991) Induction of phospholipase A2 gene expression in human hepatoma cells by mediators of the acute phase response, J Biol Chem 266 2647-2651. 117. Ivandic, B., Castellani, L. W., Wang, X. P., Qiao, J. H., Mehrabian, M., Navab, M., Fogelman, A. M., Grass, D. S., Swanson, M. E., de Beer, M. C., de Beer, F., and Lusis, A. J. (1999) Role of group II secretory phospholipase A2 in atherosclerosis: 1. Increased atherogenesis and

PAGE 99

85 altered lipoproteins in transgenic mice expressing group IIa phospholipase A2, Arteriosclerosis, thrombosis, and vascular biology 19 1284-1290. 118. Menschikowski, M., Kasper, M., Lattke, P., Schiering, A., Schiefer, S., Stockinger, H., and Jaross, W. (1995) Secretory group II phospholipase A2 in human atherosclerotic plaques, Atherosclerosis 118 173-181. 119. Menschikowski, M., Lattke, P., Bergmann, S., and Jaross, W. (1995) Exposure of macrophages to PLA2-modified lipoproteins leads to cellular lipid accumulations, Anal Cell Pathol 9 113-121. 120. Divchev, D., and Schieffer, B. (2008) The secretory phospholipase A2 group IIA: a missing link between inflammation, activated reninangiotensin system, and atherogenesis?, Vasc Health Risk Manag 4 597604. 121. Dory, L., and Roheim, P. S. (1981) Rat plasma lipoproteins and apolipoproteins in experimental hypothyroidism, J Lipid Res 22 287-296. 122. Graf, G. A., Yu, L., Li, W. P., Gerard, R., Tuma, P. L., Cohen, J. C., and Hobbs, H. H. (2003) ABCG5 and ABCG8 are obligate heterodimers for protein trafficking and biliary cholesterol excretion, J Biol Chem 278 48275-48282. 123. Klett, E. L., Lee, M. H., Adams, D. B., Chavin, K. D., and Patel, S. B. (2004) Localization of ABCG5 and ABCG8 proteins in human liver, gall bladder and intestine, BMC Gastroenterol 4 21. 124. Lu, K., Lee, M. H., Hazard, S., Brooks-Wilson, A., Hidaka, H., Kojima, H., Ose, L., Stalenhoef, A. F., Mietinnen, T., Bjorkhem, I., Bruckert, E., Pandya, A., Brewer, H. B., Jr., Salen, G., Dean, M., Srivastava, A., and Patel, S. B. (2001) Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively, Am J Hum Genet 69 278-290. 125. Hubacek, J. A., Berge, K. E., Cohen, J. C., and Hobbs, H. H. (2001) Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia, Hum Mutat 18 359-360.

PAGE 100

86 126. Heimerl, S., Langmann, T., Moehle, C., Mauerer, R., Dean, M., Beil, F. U., von Bergmann, K., and Schmitz, G. (2002) Mutations in the human ATPbinding cassette transporters ABCG5 and ABCG8 in sitosterolemia, Hum Mutat 20 151. 127. Hazard, S. E., and Patel, S. B. (2007) Sterolins ABCG5 and ABCG8: regulators of whole body dietary sterols, Pflugers Arch 453 745-752. 128. Remaley, A. T., Bark, S., Walts, A. D., Freeman, L., Shulenin, S., Annilo, T., Elgin, E., Rhodes, H. E., Joyce, C., Dean, M., Santamarina-Fojo, S., and Brewer, H. B., Jr. (2002) Comparative genome analysis of potential regulatory elements in the ABCG5-ABCG8 gene cluster, Biochem Biophys Res Commun 295 276-282. 129. Freeman, L. A., Kennedy, A., Wu, J., Bark, S., Remaley, A. T., Santamarina-Fojo, S., and Brewer, H. B., Jr. (2004) The orphan nuclear receptor LRH-1 activates the ABCG5/ABCG8 intergenic promoter, J Lipid Res 45 1197-1206. 130. Sumi, K., Tanaka, T., Uchida, A., Magoori, K., Urashima, Y., Ohashi, R., Ohguchi, H., Okamura, M., Kudo, H., Daigo, K., Maejima, T., Kojima, N., Sakakibara, I., Jiang, S., Hasegawa, G., Kim, I., Osborne, T. F., Naito, M., Gonzalez, F. J., Hamakubo, T., Kodama, T., and Sakai, J. (2007) Cooperative interaction between hepatocyte nuclear factor 4 alpha and GATA transcription factors regulates ATP-binding cassette sterol transporters ABCG5 and ABCG8, Mol Cell Biol 27 4248-4260. 131. Lu, K., Lee, M. H., Yu, H., Zhou, Y., Sandell, S. A., Salen, G., and Patel, S. B. (2002) Molecular cloning, genomic organization, genetic variations, and characterization of murine sterolin genes Abcg5 and Abcg8, J Lipid Res 43 565-578. 132. Sacks, F. M., Rudel, L. L., Conner, A., Akeefe, H., Kostner, G., Baki, T., Rothblat, G., de la Llera-Moya, M., Asztalos, B., Perlman, T., Zheng, C., Alaupovic, P., Maltais, J. A., and Brewer, H. B. (2009) Selective delipidation of plasma HDL enhances reverse cholesterol transport in vivo, J Lipid Res 50 894-907.

PAGE 101

About the Author Lindsey Boone received a Bachelor’s Degree with Honors in Chemistry from Jacksonville University in 2005. She joined the Ph.D.-PLUS program at the University of South Florida College of Medicine in 2005 and received an MBA in 2009 as part of the dual-degree program. In 2009 she was selected to give an oral presentation at the USF Health Research Day for which she received the USF Health Vice President's Award for Outstanding Oral Presentation. She has also received competitive travel awards to present her research at several national meetings including the ASBMB Graduate Travel Award (2007 & 2009) and AMSGS Travel Award (2007-2009).