Thiomicrospira crunogena

Thiomicrospira crunogena

Material Information

Thiomicrospira crunogena a chemoautotroph with a carbon concentrating mechanism
Dobrinski, Kimberly P
Place of Publication:
[Tampa, Fla]
University of South Florida
Publication Date:


Subjects / Keywords:
Thiomicrospira crunogena
Carbon concentrating mechanism
Carbon fixation
Carbonic anhydrase
Dissertations, Academic -- Biology -- Doctoral -- USF ( lcsh )
bibliography ( marcgt )
non-fiction ( marcgt )


ABSTRACT: Gammaproteobacterium Thiomicrospira crunogena thrives at deep-sea vents despite extreme oscillations in the environmental supply of dissolved inorganic carbon (DIC). Survival in this habitat is likely aided by the presence of a carbon concentrating mechanism (CCM). Though CCMs are well-documented in cyanobacteria, based on this study T. crunogena is the first chemolithoautotroph to have a physiologically characterized CCM. T. crunogena is capable of rapid growth in the presence of 20 micrometers DIC, has the ability to use both extracellular HCO₃ and CO₂, and generates intracellular DIC concentrations 100-fold greater than extracellular, all of which are consistent with a CCM analogous to those present in cyanobacteria. Interestingly, however, the T.crunogena genome lacks apparent orthologs of many of the components of the cyanobacteria CCM (e.g., HCO₃ transporters).However, despite this lack, several candidate genes were identified during genome annotation as likely to play a role in DIC uptake and fixation (three carbonic anhydrase genes: alpha-CA, beta-CA, and csoSCA, as well as genes encoding three RubisCO enzymes: cbbLS, CScbbLS, and cbbM, which encode a cytoplasmic form I RubisCO, a carboxysomal form I RubisCO, and a form II RubisCO, respectively). In order to clarify their possible roles in DIC uptake and fixation, alpha-CA, beta-CA and csoSCA transcription by low-DIC and high-DIC T. crunogena were assayed by qRT PCR, heterologous expression in E. coli, and potentiometric assays of low-DIC and high-DIC T. crunogena. Transcription of alpha-CA and beta-CA were not sensitive to the DIC concentration available during growth.When overexpressed in E.coli, carbonic anhydrase activity was detectable, and it was possible to measure the effects of the classical carbonic anhydrase inhibitors ethoxyzolamide and acetazolamide, as well as dithiothreitol (DTT; recently determined to be a carboxysomal CA inhibitor). The alpha-CA was sensitive to both of the classical inhibitors, but not DTT. Beta-CA was insensitive to all inhibitors tested, and the carboxysomal carbonic anhydrase was sensitive to both ethoxyzolamide and DTT. The observation that the CA activity measureable potentiometrically with intact T. crunogena cells is sensitive to classical inhibitors, but not DTT, strongly suggests the alpha-CA is extracellular. The presence of carbonic anhydrase activity in crude extracts of high-DIC cells that was resistant to classical inhibitors suggests that beta-CA may be more active in high-DIC cells.Incubating cells with ethoxyzolamide (which permeates cells rapidly) resulted in inhibition of carbon fixation, but not DIC uptake, while incubation with acetazolamide (which does not permeate cells rapidly) had no apparent effect on either carbon fixation or DIC uptake. The observations that inhibition of alpha-CA has no effect on DIC uptake and fixation, and that the beta-CA is not transcribed more frequently under low-DIC conditions, make it unlikely that either play a role in DIC uptake and fixation in low-DIC cells. Further studies are underway to determine the roles of alpha-CA and beta-CA in T. crunogena.To assay the entire genome for genes transcribed more frequently under low-DIC conditions, and therefore likely to play a role in the T. crunogena CCM, oligonucleotide arrays were fabricated using the T. crunogena genome sequence. RNA was isolated from cultures grown in the presence of both high (50 mM) and low (0.05 mM) concentrations of DIC, directly labeled with cy5 fluorophore, and hybridized to microarrays. Genes encoding the three RubisCO enzymes present in this organism demonstrated differential patterns of transcription consistent with what had been observed previously in Hydrogenovibrio marinus. Genes encoding two conserved hypothetical proteins were also found to be transcribed more frequently under low-DIC conditions, and this transcription pattern was verified by qRT-PCR. Knockout mutants are currently being generated to determine whether either gene is necessary for growth under low-DIC conditions. Identifying CCM genes and function in autotrophs beyond cyanobacteria will serve as a window into the physiology required to flourish in microbiallydominated ecosystems where noncyanobacterial primary producers dominate.
Dissertation (Ph.D.)--University of South Florida, 2009.
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 139 pages.
General Note:
Includes vita.
Statement of Responsibility:
by Kimberly P. Dobrinski.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
002317648 ( ALEPH )
660880460 ( OCLC )
E14-SFE0003119 ( USFLDC DOI )
e14.3119 ( USFLDC Handle )

Postcard Information



This item has the following downloads:

Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 2200397Ka 4500
controlfield tag 001 002317648
005 20100903173823.0
007 cr cnu|||uuuuu
008 100903s2009 flua ob 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003119
QH307.2 (Online)
1 100
Dobrinski, Kimberly P.
0 245
Thiomicrospira crunogena
h [electronic resource] :
b a chemoautotroph with a carbon concentrating mechanism /
by Kimberly P. Dobrinski.
[Tampa, Fla] :
University of South Florida,
Title from PDF of title page.
Document formatted into pages; contains 139 pages.
Includes vita.
Dissertation (Ph.D.)--University of South Florida, 2009.
Includes bibliographical references.
Text (Electronic dissertation) in PDF format.
ABSTRACT: Gammaproteobacterium Thiomicrospira crunogena thrives at deep-sea vents despite extreme oscillations in the environmental supply of dissolved inorganic carbon (DIC). Survival in this habitat is likely aided by the presence of a carbon concentrating mechanism (CCM). Though CCMs are well-documented in cyanobacteria, based on this study T. crunogena is the first chemolithoautotroph to have a physiologically characterized CCM. T. crunogena is capable of rapid growth in the presence of 20 micrometers DIC, has the ability to use both extracellular HCO and CO, and generates intracellular DIC concentrations 100-fold greater than extracellular, all of which are consistent with a CCM analogous to those present in cyanobacteria. Interestingly, however, the T.crunogena genome lacks apparent orthologs of many of the components of the cyanobacteria CCM (e.g., HCO transporters).However, despite this lack, several candidate genes were identified during genome annotation as likely to play a role in DIC uptake and fixation (three carbonic anhydrase genes: alpha-CA, beta-CA, and csoSCA, as well as genes encoding three RubisCO enzymes: cbbLS, CScbbLS, and cbbM, which encode a cytoplasmic form I RubisCO, a carboxysomal form I RubisCO, and a form II RubisCO, respectively). In order to clarify their possible roles in DIC uptake and fixation, alpha-CA, beta-CA and csoSCA transcription by low-DIC and high-DIC T. crunogena were assayed by qRT PCR, heterologous expression in E. coli, and potentiometric assays of low-DIC and high-DIC T. crunogena. Transcription of alpha-CA and beta-CA were not sensitive to the DIC concentration available during growth.When overexpressed in E.coli, carbonic anhydrase activity was detectable, and it was possible to measure the effects of the classical carbonic anhydrase inhibitors ethoxyzolamide and acetazolamide, as well as dithiothreitol (DTT; recently determined to be a carboxysomal CA inhibitor). The alpha-CA was sensitive to both of the classical inhibitors, but not DTT. Beta-CA was insensitive to all inhibitors tested, and the carboxysomal carbonic anhydrase was sensitive to both ethoxyzolamide and DTT. The observation that the CA activity measureable potentiometrically with intact T. crunogena cells is sensitive to classical inhibitors, but not DTT, strongly suggests the alpha-CA is extracellular. The presence of carbonic anhydrase activity in crude extracts of high-DIC cells that was resistant to classical inhibitors suggests that beta-CA may be more active in high-DIC cells.Incubating cells with ethoxyzolamide (which permeates cells rapidly) resulted in inhibition of carbon fixation, but not DIC uptake, while incubation with acetazolamide (which does not permeate cells rapidly) had no apparent effect on either carbon fixation or DIC uptake. The observations that inhibition of alpha-CA has no effect on DIC uptake and fixation, and that the beta-CA is not transcribed more frequently under low-DIC conditions, make it unlikely that either play a role in DIC uptake and fixation in low-DIC cells. Further studies are underway to determine the roles of alpha-CA and beta-CA in T. crunogena.To assay the entire genome for genes transcribed more frequently under low-DIC conditions, and therefore likely to play a role in the T. crunogena CCM, oligonucleotide arrays were fabricated using the T. crunogena genome sequence. RNA was isolated from cultures grown in the presence of both high (50 mM) and low (0.05 mM) concentrations of DIC, directly labeled with cy5 fluorophore, and hybridized to microarrays. Genes encoding the three RubisCO enzymes present in this organism demonstrated differential patterns of transcription consistent with what had been observed previously in Hydrogenovibrio marinus. Genes encoding two conserved hypothetical proteins were also found to be transcribed more frequently under low-DIC conditions, and this transcription pattern was verified by qRT-PCR. Knockout mutants are currently being generated to determine whether either gene is necessary for growth under low-DIC conditions. Identifying CCM genes and function in autotrophs beyond cyanobacteria will serve as a window into the physiology required to flourish in microbiallydominated ecosystems where noncyanobacterial primary producers dominate.
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
Advisor: Kathleen M. Scott, Ph.D.
Thiomicrospira crunogena
Carbon concentrating mechanism
Carbon fixation
Carbonic anhydrase
Dissertations, Academic
x Biology
t USF Electronic Theses and Dissertations.
4 856


Thiomicrospira crunogena : A Chemoautotroph With a Carbon Concentrating Mechanism by Kimberly P. Dobrinski A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Biology College of Arts and Sciences University of South Florida Major Professor: Kathle en M. Scott, Ph.D. James Garey, Ph.D. Valerie Harwood, Ph.D. John Paul, Ph.D. Date of Approval: July 13, 2009 Keywords: Thiomicrospira crunogena carbon concentrating mechanism, chemoautotroph, carbon fixa tion. carbonic anhydrase Copyright 2009, Kimberly P. Dobrinski


Dedication Thank you Mom (the first scientist in the family) for fun discussions about Biology and all your encouragement. A warm thank you to Dad, Mike, Aunt Sallie and Uncle Jim for unending support. Also thank you Cathy, Joe, Donna and all my family and friends for believing in me. Thank you Sondra for being the friend of a scientist. I give a very special thank you to my beautiful chil dren: Lenna, Jason, Michael (and you too Matt) for all the sacr ifice you endured so that I could follow my dream of becoming a scientist. Thank you Emma for always making me smile! My most special gratitude goes to Jo e who has always believed in me and worked two jobs (sometimes more) to support my science “habit”. Without his love and support a teenage mom could have never achieved a Ph.D. This is all for you!


Acknowledgements I owe interminable gratitude to Dr. Kathleen Scott who provided me with guidance, patience, and unending support. She believed in me enough to let me take on RNA, microarrays and qRT PCR on my own. Because of her belief in me, I worked hard to“push back the frontiers of science”; and it is because of her I believe I can now call myself a scientist. (She also has great engineering skills – she makes a mean flowered arch!) I thank her for all the hard work and all the good times. I would like to thank Dr. Valeri e Harwood for all the knowledge she shared with me inside and outside of the classroom and the confidence she showed in me. I gained from Dr. Ha rwood a great love a nd understanding of Microbiology and also great confidence in myself. Thank you to Dr. John Paul for all that you taught me not only about viru ses and bacteria but also a love of Microbial Ecology. Thank you also to Dr. James Garey for stimulating conversations and kind advice about my work. I give a warm thank you to Amanda Boller, Phaedra Thomas, Kristy Menning, Ishtiaque Quasem, Vedad Delic, Rachel Ross, Chantel Barrett and Kelly Fitzpatrick for good times and hard work on Scott Island, exciting ASM meeti ngs and also for interesting Journal Club discussions. Thank you Jessica Moore for enc ouraging my eukaryotic interests and love of cancer research. I will miss our talks. A special thank you to Sean Yoder and Dr. Steve Enkemann who provided me with a bench to work on


and constructive feedback to my questions. Without their guidance Thiomicrospira crunogena microarrays would have ne ver been a reality. Thank you Dr. Richard Pollenz for always enc ouraging me. Thank you Dr. Jeffrey Yoder for the first year and a half of my Ph .D. I learned a tremendous amount in that time. Thank you Jennifer Montgomery, Matt Buzzeo, and Patoula Panagos for insight and assistance at Yoder lab. Tha nk you to Dr. Lee Adair for giving me my first real glimpse of research and instilling in me a love of science that will carry me through the rest of my life. My work was supported by the Na tional Science Foundation, DOE/JGI and the USDA


i Table of Contents List of Tables iii List of Figures iv Abstract vi Chapter 1 Background 1 Hydrothermal vents 2 Carbon concentrating mechanisms 2 Dissolved inorganic uptake 3 RubisCO 3 Carboxysomes 5 Carbonic anhydrase 6 Thiomicrospira crunogena 6 References 9 Chapter 2 The Carbon Concentrating Mechanism of the Hydrothermal Vent Chemolithoautotroph Thiomicrospira crunogena 14 Abstract 15 Introduction 16 Materials and Methods 18 Results 24 Discussion 29 Acknowledgements 32 References 33 Chapter 3 Expression and Functi on of Three Carbonic Anhydrase Enzymes in Thiomicrospira crunogena 37 Introduction 37 Materials and Methods 40 Results 48 Discussion 53 References 58 Chapter 4 Transcriptone Response in Thiomicrospira crunogena to the Dissolved Inorganic Carbon Concentration 62 Introduction 62 Materials and Methods 64 Results and Discussion 70


ii References 79 Chapter 5 Overall Conclusions 83 References 85 Appendix A The Genome of Deep Sea Vent Chemolithoautotoph Thiomicrospira crunogena XCL-2 89 About the Author End page


iii List of Tables Table 1. Primers and probes used to target T. crunogena carbonic anhydrase genes 46 Table 2. Response of T. crunogena carbonic anhydrase gene transcription to the DIC concentration available during growth 48 Table 3. Activity of heterologously expressed carbonic anhydrase genes from T.crunogena 49 Table 4. Primers and probes used to target T. crunogena conserved hypothetical genes via qRT-PCR 68 Table 5. Genes transcribed mo re frequently in cells grown under high-DIC conditions 72 Table 6. Genes transcribed mo re frequently in cells grown under low-DIC conditions 72 Table 7. Response of conserved hypo thetical gene transcription to changes in growth conditions 76


iv List of Figures Figure 1 Transmission electron micrograph of T. crunogena cells 7 Figure. 2. Steady-state growth rate constants and DIC concentrations for T. crunogena 24 Figure. 3. Carbon fixation rates for T. crunogena under DIC limitation 25 Figure. 4. Carbon fixation rates for T. crunogena harvested from DIC-limited chemostats supplied with CO2 and HCO3 26 Figure. 5. Intracellular DIC accumulation by T. crunogena cultivated under DIC limitation 28 Figure 6. Energy-dependence of intracellular DIC accumulation by T. crunogena 29 Figure 7. (A.) SDS PAGE and (B.) We stern blot depic ting heterologous expression of T.crunogena carbonic anhydrase in E.coli. 49 Figure 8. Effect of acetazolamide and ethoxyzolamide on carbonic anhydrase activity of crude ex tracts prepared from E. coli 50 Figure 9. Carbonic anhydras e activity and inhibition in T. crunogena crude extract. 51 Figure 10. Carbonic anhydrase activity and inhibition in T. crunogena whole cells. 51


v Figure 11. Effect of acetazolamide and ethoxyzolamide on DIC uptake and fixation by T. crunogena 52 Figure 12. Effect of AZA and EZA on the intracellular DIC pool and carbon fixation in in tact lowand high-DIC T. crunogena cells. 53 Figure 13. Model of T. crunogena cell with carbonic anhydrase locations and inhibitor sensitivities 57 Figure 14. A sampling of housekeeping gene s that do not have a measureable change in transcription under lowversus high-DIC conditions 70 Figure 15. Genes that have increased tran scription under high-DIC conditions 74 Figure 16. Genes encoding conserved hypothetica l proteins that ha ve increased transcription under high-DIC conditions 75 Figure 17. Carboxysome genes that ar e transcribed more frequently under low-DIC conditions 75 Figure 18. Transcription of carbonic anhydr ase-encoding genes under lowand high-DIC conditions 77 Figure 19. Genes encoding cons erved hypothetical proteins that have increased transcrip tion under low-DIC conditions 78


vi Thiomicrospira crunogena: A Chemoautot roph With a Carbon Concentrating Mechanism Kimberly P. Dobrinski ABSTRACT Gammaproteobacterium Thiomicrospira crunogena thrives at deep-sea vents despite extreme oscillations in the environmental supply of dissolved inorganic carbon (DIC; =CO2 + HCO3 -+ CO3 -2). Survival in these habitats is likely aided by the presence of a car bon concentrating mechanism (CCM). Though CCMs are well-documented in cy anobacteria, based on this study T. crunogena is the first chemolithoautotroph to have a physiologically characterized CCM. T. crunogena is capable of rapid growth in the presence of 20 M DIC, has the ability to use both extracellular HCO3 and CO2, and generates intracellular DIC concentrations 100-fold greater than ex tracellular, all of which are consistent with a CCM analogous to those present in cyanobacteria. Interestingly, however, the T. crunogena genome lacks apparent ortholog s of many of the components of the cyanobacterial CCM (e.g., HCO3 transporters). However, despite this lack, several candidate genes were identified during genome annotation as likely to play a role in DIC uptake and fixa tion (three carbonic anhydrase genes: -CA CA and csoSCA as well as genes encoding three RubisCO enzymes: cbbLS,


vii CScbbLS, and cbbM which encode a cytoplasmic form I RubisCO, a carboxysomal form I RubisCO, and a fo rm II RubisCO, respectively). In order to clarify their possibl e roles in DIC uptake and fixation, -CA CA and csoSCA transcription by low-DIC and high-DIC T. crunogena were assayed by qRT PCR, hete rologous expression in E. coli, and potentiometric assays of low-DIC and high-DIC T. crunogena Transcription of -CA and -CA were not sensitive to the DIC concentr ation available during growth. When overexpressed in E. coli, carbonic anhydrase activity wa s detectable, and it was possible to measure the effects of the classical carbonic anhydrase inhibitors ethoxyzolamide and acetazolamide, as well as dithiothreitol (DTT; recently determined to be a carboxysomal CA inhibitor). The -CA was sensitive to both of the classical inhibitors, but not DTT, -CA was insensitive to all inhibitors tested, and the carboxysomal carbonic anhydrase was sensitive to both ethoxyzolamide and DTT. The observation that the CA activity measureable potentiometrically with intact T. crunogena cells is sensitive to classical inhibitors, but not DTT, strongly suggests the -CA is extracellular. The presence of carbonic anhydrase activity in crude extracts of high-DIC cells that was resistant to classical i nhibitors suggests that -CA may be more active in highDIC cells. Incubating cells with ethoxyz olamide (which permeates cells rapidly) resulted in inhibition of carbon fixati on, but not DIC uptake, while incubation with acetazolamide (which doe s not permeate cells rapidl y) had no apparent effect on either carbon fixation or DIC uptake. The observations that inhibition of CA has no effect on DIC uptak e and fixation, and that the -CA is not transcribed


viii more frequently under low-DIC conditions, ma ke it unlikely that either play a role in DIC uptake and fixation in low-DIC cells. Further studies are underway to determine the roles of -CA and -CA in T. crunogena To assay the entire genome for ge nes transcribed more frequently under low-DIC conditions, and therefore li kely to play a role in the T. crunogena CCM, oligonucleotide arrays were fabricated using the T. crunogena genome sequence. RNA was isolated from cultures grown in the presence of both high (50 mM) and low (0.05 mM) concentrations of DIC, dir ectly labeled with cy5 fluorophore, and hybridized to microarrays. Genes encodi ng the three RubisCO enzymes present in this organism demonstrated differential pa tterns of transcript ion consistent with what had been observed previously in Hydrogenovibrio marinus Genes encoding two conserved hypothetical pr oteins were also found to be transcribed more frequently under low-DIC conditions, and th is transcription pattern was verified by qRT-PCR. Knockout mutants are curr ently being generated to determine whether either gene is necessary for growth under low-DIC conditions. Identifying CCM genes and function in autotrophs beyond cyanobacteria will serve as a window into the physiology required to flourish in microbiallydominated ecosystems where noncyanobact erial primary producers dominate.


1 Chapter 1 Background Before 1.8 billion years ago (Gyr) atmospheric CO2 concentrations were more than 100 times greater than they ar e today (33). It was in this high CO2 environment that the three domains of lif e diverged (5), and autotrophic members of all three domains provided the inpu t of organic carbon into microbial food webs. Between 2.45–1.85 Gyr ago, cyanobacterial photosynthesis caused atmospheric oxygen levels to rise allowing the shallow oceans to become mildly oxygenated while the deep oceans remained anoxic. Oxygen levels remained at the same levels until 0.54 Gyr ago, when the shallow oceans were oxygenated and the deep oceans fluctuated between oxic and anoxic conditions (18). As oxygen levels increased, a corresponding decrease in CO2 occurred due to cyanobacterial carbon fixation (14) With the drop in atmospheric CO2, organisms that had once thrived in its a bundance now had to adapt to its relative scarcity. Autotrophic microorganisms have successfully adapted, and continue to fulfill the role of primary producer in diverse habitats from hydrothermal vents to acid mine drainage and from terrestrial habitats to the open ocean (14). Substantial variation in the chemistry of these habitats presen ts these organisms with pH values ranging from 1-14, and DIC (dissolved inorganic carbon, = CO2 +


2 HCO3 + CO3 -2) concentrations ranging from extraordinarily abundant (>20 mM) to extremely low (<20 M; 37, 10, 12). Hydrothermal Vents One environment that is particularly challenging due to extreme temporal heterogeneity is the hydrothermal vent e nvironment. In this environment, warm hydrothermal fluid is emitted from cracks in the crust (17). This hydrothermal fluid is anoxic, contains hydrogen gas, hydrogen sulfide, and other reduced compounds (22). It is also acidic (p H ~5; 25) and has an elevated DIC concentration (5-6 mM; 10). When this warm (~30-40C) fluid meets alkaline (pH 8), oxic seawater at the bottom of the ocean (2C), it creates turbulent eddies due to the differences in temperature ( 13, 22). These eddies cause large changes in temperature, and corresponding chemis try (e.g., pH, DIC, sulfide, oxygen), with oscillations occurring over timescal es ranging from seconds to hours (22). Under these conditions the predominant form of DIC is HCO3 -, with concentrations of 5 to 7 mM (13, 22). Th e pH fluctuations cause dramatic ebbs and spikes in CO2 concentrations, which vary from 20 to 2000 M (13). One would expect that this habitat would resu lt in a selective adva ntage for autotrophic organisms having adaptations to maintain a steady supply of CO2. Carbon Concentrating Mechanisms One key adaptation that enhances mi crobial carbon fixation in chronically or episodically low CO2 and/or HCO3 concentrations is a carbon concentrating mechanism (CCM). CCMs have been exte nsively studied in cyanobacteria, but


3 are likely to be common beyond this phylum. Cyanobacteria with CCMs typically demonstrate a hi gher whole-cell affinity for DIC when grown under low DIC conditions (3). Cyanobacteria that are cultivated under low DIC conditions capture HCO3 by using high affinity transporters to deliver it to the cytosol (3). Within the cytosol, this intracellular HCO3 pool is consumed by carboxysomes. Carboxysomes have a protein shell and contain a trace of carbonic anhydrase (CA) which facilitates the conversion of HCO3 to CO2 within the shell (3, 24,39). Carboxysomes are also packed with form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO), whic h fixes the majority of CO2 before it can diffuse back into the cytosol (3). Dissolved Inorganic Carbon Uptake Among cyanobacteria, there ar e three known phylogenetically independent HCO3 transporters. BCT1 is an ABC-transporter (34), while SbtA is a Na+-dependent HCO3 transporter (44). The third transporter, SulP, is evolutionarily related to su lfate transporters (40). Some cyanobacteria have an additional adaptation, CO2 traps, to prevent the loss of DIC transported to the cytosol by these HCO3 transporters. In these cells, any CO2 that escapes from the carboxysomes is reconverted to HCO3 in the cytoplasm, where a thylakoid-associated complex couples CO2 hydration to electron transfer from NAD(P)H to plastoquinone (44, 29, 3). RubisCO


4 A carbon concentrating mechanism ra ises intracellula r inorganic carbon concentrations, which facil itate carbon fixation by R ubisCO, which is a poor catalyst (54). RubisCO is the carboxylase of the Ca lvin-Benson-Bassham (CBB) cycle. This enzyme has rather low kcat values (55) and can use both CO2 and O2 as a substrate (55, 6). The oxygenase r eaction, in which ribulose 1,5-bisphosphate (RuBP) is oxygenated rather than car boxylated, is wasteful for the cell and requires energetic expenditure to regenera te the RuBP necessary to keep the CBB cycle functioning (9). Imperfect as it is, this enzyme is found in a wide variety of microorganisms and can be subdivided into three forms (I – III; 60). Form I RubisCO consists of two subunits (large and small), encoded by cbbL and cbbS, and is further subdivided into four groups (IA – ID; 59, 60). Form IA RubisCO is found in many autotrophic proteobacteria and some marine cyanobacteria (46) while form IB is found in other cyanobacter ia and in green plastids (60). Form IC is found in some facultatively autotrophic proteobacteria (60), while form ID is present in many marine eukaryotic alg ae, including diatoms, coccolithophores, and many dinoflagellates (60). Form II R ubisCO consists of only one type of subunit (CbbM), which is evolutionarily related to the larg e subunit of form I RubisCOs (35, 15, 7, 52, 53, 55). Many microorganisms have multiple RubisCO genes present in their genomes (9, 1, 59). Unlike cyanobacter ia, which only have a single RubisCO enzyme encoded in their genome (11, 23) proteobacteria can have as many as three (59). For example, the obl igate hydrogen-oxidizing chemolithotroph


5 Hydrogenovibrio marinus has three RubisCO enzymes encoded in its genome (59). Two are form IA enzymes, one of which is carboxysomal (59), while one encodes form II RubisCO. The form II gene ( cbbM) is constitutively expressed, though cbbM transcription as well as enzyme concentration decrease when culture DIC concentrations are low (59). The two form IA RubisCO enzymes in H. marinus are also differentially expressed: carboxysomal form IA RubisCO is transcribed under low-DIC conditions, while the non-carboxysomal enzyme is preferentially transcribed unde r high-DIC conditions (59). Carboxysomes Carboxysomes are composed of Rubi sCO, carbonic anhydrase and at least seven other polypeptides which are res ponsible for building the shell surrounding the RubisCO and carbonic anhydrase containe d by these inclusions (6). It has been proposed that the role of the carboxys omal shell is to serve as a selective barrier, allowing the influx of HCO3 – into the carboxysome, while limiting O2 diffusion into the carboxysome, where it prevents O2 inhibition of CO2 fixation by RubisCO (13). Though all share the same function, ca rboxysomes can be divided into two distinct categories: alpha carboxysomes, which contain form IA RubisCO, and have shell peptides distinct from be ta carboxysomes, which contain form IB RubisCO (39, 6). Both alpha and beta carboxysomes have she ll proteins with shared evolutionary history (CsoS1, CcmK, CcmO), but some proteins are unique: in alpha carboxysomes, CsoS2 a nd CsoSCA proteins, which are a shell


6 protein and a carboxysomal CA, do not a ppear to have orthologs in beta carboxysomes, which are distinct from al pha carboxysomes due to the presence of CcmM and CmmN proteins (6). However, the CcmM protein has a domain which is homologous to -CA and form Ib small subunit RubisCO (39). Carbonic Anhydrase Carbonic anhydrase, which can play a major role in DIC uptake and fixation in autotrophic organisms (2, 51, 31), has arisen independently multiple times. Four forms have been described thus far: , and -CA enzymes are widespread among bacteria and are also present in animals (51). -CA is found in plants, bacteria, and archaea (51); this group includes the CsoSCA carbonic anhydrase present in alpha carboxysomes (6, 39). The only -CA that has been biochemically characterized is found in a methanoarchaeon, however, putative CA from sequence analysis have been found in bacteria and archaea (60). –CA is found in marine algae; in dinoflagellate Lingulodinium polyedrum, it plays a role in dissolved inorganic carbon uptake (27) Thiomicrospira crunogena T. crunogena is an obligate chemoautotrophic gamma proteobacterium that was originally isolated from scrapings taken from Riftia pachytila tubeworms at the East Pacific hydrothermal vents ( 21). This mesophilic organism grows best at circumneutral pH (57) and can only us e a limited subset of redox substrates: it is an obligate aerobe that does not denitr ify (21), and can only use reduced sulfur


compoun d 44, 57 ) A s organism CO2 avai l uses the C (appendi x on the ob s low as 2 0 Figure indic a T h enzymes ( d s (thiosulf a s described a to fluctuati o l ability are p C alvin-Bens o x ). It was re s ervation th a 0 M, as wel 1 Transmiss a ting carbox h e genome o ( one -CA, a te, sulfide, o a bove, gro w o ns in temp e p articularly p o n-Bassha m asonable to h a t it is capa b l as the pres ion electron ysomes. M i o f T. crunog e one -CA, a 7 o r elemental w th in the hy d e rature, pH a p roblematic f m cycle and R h ypothesize b le of rapid g ence of car b micrograp h i crograph c o e na does en c a nd one -li k sulfur) as e l d rothermal v a nd DIC (13 f or this org a R ubisCO for that this or g g rowth at co n b oxysomes ( F h of T. cruno o urtesy of M c ode three c a k e carboxys o l ectron don o v ent habitat e 22). The f l a nism, since carbon fixa t g anism has a n centration s F IG. 1; 47). gena cells, w M Bright an d a rbonic anh y o mal CA) w o rs ( 21, 43, e xposes this l uctuations i T. crunoge n t ion a CCM base d s of DIC as w ith arrows d K. Scott. y drase (CA) w hich were n n a d


8 hypothesized to play a role in DIC uptake and fixation (appendix). There are also three RubisCO enzymes, two form IAs a nd one form II, as well as a complete carboxysome operon. The focus of this study was to examine the carbon concentrating mechanism in T. crunogena The T. crunogena CCM was physiologically characterized (Chapter 2; 8) by determining the Ks and Vmax for HCO3 and CO2 uptake by cells grown under DIC-limiting conditions and DIC-replete conditions. The ability of cells to generate elevated intracellular concentrations of DIC, as well as the necessity of th e presence of an el ectron donor for this process, were also measured. The sequence of its genome was then examined to find genes that might play a role in enabling T. crunogena to grow under low DIC conditions (appendix). Three carbonic anhydr ase genes were apparent (one -CA, and two -CA enzymes, one of which is carboxys omal). To examine their function (Chapter 3), these genes were heterologously expressed in E. coli, assayed for activity, and tested for sensitivity to classical carbonic anhydrase inhibitors. T. crunogena cells were grown under low-DI C and high-DIC conditions, and assayed for CA gene transcription via qRT-PCR, and CA enzyme activity and inhibition patterns. The impact of thes e CA enzymes on DIC uptake and fixation was inferred by measuring the impact of CA inhibitors on these parameters. To uncover other genes that could pl ay a role in the CCM, microarrays were used to compare genome-wide gene expression in lowand high-DIC cells (Chapter 4). It was hypothesi zed that genes playing a ro le in the CCM would be


9 transcribed more frequently under low-DIC conditions. Genes that appeared to be transcribed more frequently when assa yed with the microarray were examined further via qRT-PCR. T. crunogena and relatives are able to adap t to low concentrations of DIC during growth. Understanding this adap tation provides insights into how the ancestors of these organisms coped with the historic drop in atmospheric CO2, and also provides insights into the ecophys iology of carbon fixation in the diverse habitats where this process is catalyzed by many phylogenetically and physiologically distinct microorganisms. References 1. Badger, M., Bek, E., (2008). Multiple Rubisco forms in proteobacteria: their functional significance in relation to CO2 acquisition by the CBB cycle. Journal of Experimental Botany 59: 1525-1541. 2. Badger M., Price G. (1994) Th e role of carbonic anhydrase in photosynthesis. Annu Rev Plant Phys iol Plant Mol Biol 45: 369–392. 3. Badger M, Hanson D, Price GD (2002) Evolution and diversity of CO2 concentrating mechanisms in cyanobacteria. Funct Plant Biol 29: 161– 173. 4. Brinkhoff,, T., Sievert, S.M., Kuev er, J., and Muyzer, G. (1999) Distribution and diversit y of sulfur-oxidizing Thiomicrospira spp. at a shallow-water hydrothermal vent in the Aegean Sea (Milos, Greece). Appl. Environ. Microbiol 65: 3843-3849. 5. Brocks, J. J., G. A. Logan, R. Bu ick, and R. E. Summons. 1999. Archean molecular fossils and the ear ly rise of eukaryotes. Science, 285:1033– 1036. 6. Cannon, G., Bradburne, C., Al drich, H., Baker, S., Heinhorst, S., Shively, J. (2001) Microcompartments in Pr okaryotes: Carboxysomes and Related Polyhedra. Appl. Environ. Microbiol 67: 5351–5361. 7. Cleland W., Andrews J., Gutteridge S., Hartman F., Lorimer G.. (1998). Mechanism of Rubisco: the carbamate as general base. Chemical Reviews 98:549–561. 8. Dobrinski, K., Longo, D., Scott, K. (2005) The Carbon-Concentrating Mechanism of the Hydrothermal Vent Chemolithoautotroph Thiomicrospira crunogena. J ournal of Bacteriology, 187 : 5761–5766.


10 9. Dubbs, P., Dubbs, J., Tabita, F. (2004) Effector-Mediated Interaction of CbbRI and CbbRII regulators with target Sequences in Rhodobacter capsulatus. Journal of Bacteriology, 186: 8026–8035. 10. Edwards, K., Bond, P., Gihring, T., Banfield, J. An Archaeal ironoxidizing extreme acidophile importa nt in acid mine drainage. Science, 287: 1796-1799. 11. Dufresne A., Salanoubat M., Parten sky, F., Artiguenave F., Axmann, I., Barbe, V., Duprat, S., Galperin, M., Koonin, E., Le Gal, F., Makarova, K., Ostrowski, M., Oxtas, S., Robe rt, C., Rogozin, I., Scanlan, D., Tandeau de Marsac N., Weissenbach, J ., Wincker, P., Wolf, Y., Hess, W. (2003) Genome sequence of the cyanobacterium Prochlorococcus marinus SS120, a nearly minimal oxyphototrophic genome. PNAS 100:10020-10025. 12. Foti, M., Sorokin, D., Zacharova, E. Pimenov, N., Kuenen, J., Muyzer, G. (2008) Bacterial diversity and activ ity along a salinity gradient in soda lakes of the Kulunda St eppe (Altai, Russia). Extremophiles, 12:133–145. 13. Goffredi, S., Childress, J., Desaulnier s, N., Lee, R., Lallier, F., Hammond, D ( 1997). Inorganic carbon acquisition by the hydrothermal vent tubeworm Riftia pachyptila depends upon high external P-CO2 and upon proton-equivalent ion transport by the worm. J. Exp. Biol ., 200:883–896. 14. Handelsmann, J. (2004). Metagenomics: Application of Genomics to Uncultured Microorganisms. Microbiology and Molecular Biology Reviews, 68: 669–685. 15. Hartman F., Harpel M. (1994). Stru cture, function, regulation and assembly of D-ribulose-1,5-bisphosphat e carboxylase/oxygenase. Annual Review of Biochemistry, 63:197–234. 16. Heinhorst S., Williams E., Fei Cai Murin D., Shively, J., and Cannon, G. (2006). Characterization of the Carboxysomal Carbonic Anhydrase CsoSCA from Halothiobacillus neapolitanus Journal of Bacteriology 188: 8087-8094. 17. Hessler, R., Smithey, W., Boudrias., Ke ller, C., Lutz, R., Childress, J. (1988). Temporal change in megafauna at the Rose Garden hydrothermal vent (Galapagos Rift; ea stern tropical Pacific). Deep-Sea Research, 35: 1681-1709 18. Holland, H. (2006). The oxygenation of the atmosphere and oceans. Philosophical Transactions of the Royal Society B, 361: 903-915. 19. Huber, J., Butterfield, D.A., and Baross, J.A. (2003) Bacterial diversity in a subseafloor habitat followi ng a deep-sea volcanic eruption. FEMS Microbiol. Ecol 43: 393-409. 20. Jannasch HW, Wirsen CO (1979) Ch emosynthetic primary production at East Pacific sea floor spread ing centers. BioSci. 29: 592-598. 21. Jannasch, H., Wirsen, C., Nelson, D., and Robertson, L. (1985). Thiomicrospira crunogena sp. nov., a colorless, sulfur-oxidizing bacterium from a deep-sea hydrothermal vent. Int. J. Syst. Bacteriol. 35: 422-424.


11 22. Johnson, K., Childress, J., Hessler, R., Sakamoto-Arnold, C., and Beehler, C. (1988). Chemical and biological in teractions in the Rose Garden hydrothermal vent field, Glapagos sp reading center. Deep-Sea Research, 35: 1723-1744. 23. Kaneko, T., Sato, S., Kotani, H., Tanaka, A., Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiur a, M., Sasamoto, S., Kimura, T., Hosouchi, T., Matsuno, A., Muraki A., Nakazaki, N., Naruo, K., Okumura, S., Shimpo, S., Takeuchi, C ., Wada, T., Watanabe, A., Yamada, M., Yasuda, M., Tabata, S. (1996) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA research 3:109-136. 24. Kaplan A., Reinhold L. (1999) CO2 concentrating mechanisms in photosynthetic microorganisms. Annu Rev Plant Physiol Plant Mol Biol 50: 539–570. 25. Kaufman, A. & Xiao, S. (2003). High CO2 levels in the Proterozoic atmosphere estimated from analyses of individual microfossils. Nature 425: 279-282. 26. Kelly, D.P., and Wood, A.P. (2001). The chemolithotrophic prokaryotes. URL 27. Lapointe, M., Mackenzie, T., and Morse D. (2008). An External Carbonic Anhydrase in a Free-Livi ng Marine Dinoflagellate May Circumvent Diffusion-Lim ited Carbon Acquisition. Plant Physiology 147:1427-1436. 28. Le Bris, N., Govenar, B., Le Gall, C., Fisher, C. (2006). Variability of physic-chemical conditions in 9 50’N EPR diffuse flow vent habitats. Marine Chemistry, 98: 167-182. 29. Maeda, S, Badger, M., Price, G. ( 2002). Novel gene products associated with NdhD3/D4-containing NDH-1 complexes are involved in photosynthetic CO2 hydration in the cyanobacterium Synechococcus sp. PCC7942. Molecular Microbiology, 43: 425-435. 30. Maeda, S., Price, G., Badger M., Enomoto C., Omata T. (2000). Bicarbonate binding activity of the cm pA protein of the cyanobacterium Synechococcus PCC7942 is involved in activ e transport of bicarbonate. Journal of Biological Chemistry, 275: 20551-20555. 31. Moroney J., Bartlett S., Samuelsson G. (2001) Carbonic anhydrases in plants and algae. Plant Cell Environ 24: 141–153. 32. Muyzer, G., Teske, A., Wirsen, C., and Jannasch, H. (1995). Phylogenetic relationships of Thiomicrospira species and their iden tification in deep-sea hydrothermal vent samples by denaturi ng gradient gel electrophoresis of 16S rDNA fragments. Archives of Micr obiology 164: 165-172. 33. Ohmoto, H., Watanabe, Y. & Kuma zawa, K. (2004). Evidence from massive siderite beds for a CO2-rich atmosphere before ~1.8 billion years ago. Nature 429: 395-399.


12 34. Omata, T., Price, G., Badger M., Okamura, M., Gohta, S., Ogawa, T. (1999). Identification of an ATP-bindi ng cassette transporter involved in bicarbonate uptake in the cyanobacterium Synechococcus sp. strain PCC7942. Proceedings of the National Academy of Sciences 96: 1357113576. 35. Portis, A. Jr. (1992). Regulati on of ribulose 1,5-bisphosphate carboxylase/oxygenase activity. Annual Review of Plant Physiology, 43:415–437. 36. Price G., Badger M. (1989). Expres sion of human carbonic anhydrase in the cyanobacterium Synechococcus PCC7942 creates a high CO2requiring phenotype. Evidence for a cen tral role for carboxysomes in the CO2 concentrating mechanism. Plant Physiology, 91: 505-513. 37. Price G., Coleman J., Badger, M. (1992). Association of carbonic anhydrase activity with carboxysomes isolated from the cyanobacterium Synechococcus PCC7942. Plant Physiology 100: 784 -793. 38. Price, G., Maeda S-I, Omata T., Ba dger M. (2002). Modes of inorganic carbon uptake in the cyanobacterium Synechococcus sp. PCC7942. Functional Plant Biology 29: 131-149. 39. Price, G., SuEltemeyer, D., Klughammer, B., Ludwig, M., Badger, M. (1998). The functioning of the CO2 concentrating mechanism in several cyanobacterial strains: a review of general physio logical characteristics, genes, proteins and recent advances. Canadian Journal of Botany 76: 973-1002. 40. Price, G., Woodger, F., Badger, M ., Howitt, S., Tucker, L., (2004). Identification of a SulP-type bica rbonate transporter in marine cyanobacteria. Proceedings of the National Academy of Sciences, 101: 18228–18233. 41. Raven, J. A. 1991. Implications of i norganic carbon util ization: ecology, evolution, and geochemistry. Can. J. Bot 69:908–923. 42. Raven, J., (2003) Inorganic carbon concentratin g mechanisms in relation to the biology of algae. Photosynthesis Research 77: 155-171. 43. Ruby E., Wirsen C., Jannasch H. (1981). Chemolithotrophic sulfuroxidizing bacteria from the Gala pagos Rift hydrothermal vents. Appl Environ Microbiol 42: 317–324. 44. Ruby E., Jannasch H. (1982). Phys iological characteristics of Thiomicrospira sp. strain L-12 isolated from deep-sea hydrothermal vents. J Bacteriol 149: 161–165. 45. Rye, R., Kuo, P., Holland, H. (1995). Atmospheric carbon dioxide concentrations before 2.2 billion years ago. Nature 378: 603-605. 46. Schneider G., Lindqvist Y., Lundqvi st T. (1990). Crystallographic refinement and structure of ribulos e-1,5-bisphosphate carboxylase from Rhodospirillum rubrum at 1.7 A resolution. Journal of Molecular Biology, 211:989–1008 47. Scott K., Bright M., Fisher C. (1998) The burden of independence: Inorganic carbon utilization strategies of the sulphur chemoautotrophic hydrothermal vent isolate Thiomicrospira crunogena and the symbionts of


13 hydrothermal vent and cold seep vestimentiferans. Cah Biol Mar 39: 379– 381. 48. Shibata, M., Ohkawa, H., Kaneko, T., Fukuzawa, H., Tabata, S., Kaplan, A., Ogawa, T. (2001). Distin ct constitutive and low-CO2induced CO2 uptake systems in cyanobacteria: ge nes involved and their phylogenetic relationship with homologous genes in other organisms. Proceedings of the National Academy of Sciences 98: 11789-11794. 49. Shively, J., Bradburne, C., Aldrich, H ., Bobick, T., Mehlman, J., Jin, S., Baker S. (1998). Sequence homologue s of the carboxysomal polypeptide CsoS1 of the thiobacilli are present in cyanobacter ia and enteric bacteria that form carboxysomes-polyhedral bodies. Canadian Journal of Botany, 76: 906-916. 50. Shively, J., Vankeulen, G., Meijer, W. (1998). Something from almost nothing-carbon dioxide oxa tion in chemoautotrophs. Annual Review of Microbiology 52: 191-230. 51. Smith KS, Ferry JG (2000) Proka ryotic carbonic anhydrases. FEMS Microbiol Rev 24: 335–366 52. Spreitzer R. (1999) Questions abou t the complexity of chloroplast ribulose-1, 5-bisphosphate carboxylase/oxygenase. Photosynthesis Research 60:29–42. 53. Spreitzer R., Salvucci M. (2002) Rubisco: structure, regulatory interactions, and possibil ities for a better enzyme. Annual Review of Plant Biology, 53:449–475. 54. Tabita, F., Satagopan, S., Hanson, T., Kreel N., Scott, S. (2008). Distinct form I, II, III, and IV Rubisco prot eins from the three kingdoms of life provide clues about Rubisco evol ution and structure/function relationships. Journal of Experi mental Botany, 59: 1515-1524. 55. Tabita F. (1999) Microbia l ribulose 1,5-bisphosphate carboxylase/oxygenase: a different perspective. Photosynthesis Research 60:1–28. 56. Tortell, P. 2000. Evolutionary a nd ecological perspectives on carbon acquisition in phytoplankton. Limnol. Oceanogr 45:744–750. 57. Wirsen, C., Brinkhoff, T., Kuever, J., Muyzer, G., Molyneaux, S., Jannasch, H. (1998). Comparison of a ne w Thiomicrospira strain from the Mid-Atlantic Ridge with known hydrothermal vent isolates. Applied and Environmental Microbiology 64:4057-4059. 58. Wharton, D., (2002). Life at the limits: Organisms in extreme environments. Cambridge University Press: UK. 59. Yoshizawa Y, Toyoda K, Arai H, Ishii M, Igarashi Y. (2004) CO2responsive expression and gene or ganization of three ribulose-1,5bisphosphate carboxylase/oxygenase enzymes and carboxysomes in Hydrogenovibrio marinus strain MH-110. J Bacteriol, 186:5685–5691. 60. Zimmerman, S., Ferry, J., Supuran, C. (2007) Inhibition of the Archaeal class (Cab) and -class (Cam) carbonic anhydrases. Current Topics in Medicinal Chemistry 7: 901-908.


14 Chapter 2 The Carbon Concentrating Mechanism of the Hydrothermal Vent Chemolithoautotroph Thiomicrospira crunogena Kimberly P. Dobrinski, Dana L. Longo, and Kathleen M. Scott* Biology Department, University of South Florida, Tampa, FL USA *Corresponding author. Mailing addre ss: 4202 East Fowler Avenue, SCA 110; Tampa, FL 33620; USA. Phone: (813)974-5173. Fax: (813)974-3263. E-mail: Running title: Chemolithoautotrophic carbon concentrating mechanism This chapter has been published as Dobr inski, K.P., Longo, D.L. and K.M. Scott (2005). The Carbon-Concentrating Mech anism of the Hydrothermal Vent Chemolithoautotroph Thiomicrospira crunogena Journal of Bacteriology 187: 5761-5766.


15 Abstract Chemolithoautotrophic bacteria grow in habitats with a variety of dissolved inorganic carbon (DIC) concentra tions, and are likely to have transportrelated adaptations to DIC scarcity. Carbon concentrating mechanisms (CCMs) are present in many species of cyanobacteria, enabling them to grow in the presence of low concentrations of CO2 by utilizing bicarbonate transporters and CO2 traps to generate high intracellular co ncentrations of DIC. Similar CCMs may also be present in many other auto trophic bacteria. The sulfur-oxidizing proteobacterial chemolithoautotroph Thiomicrospira crunogena experiences broad fluctuations in DIC availability at its hydrothermal vent habitat, and may use a CCM to facilitate gr owth during periods of CO2 scarcity. T. crunogena was cultivated in chemostats under DIC limita tion to determine whether it has a CCM. Its KDIC for growth was 0.22 mM, with a max of 0.44 hr-1. In short-term incubations with DI14C, DIC-limited cells had highe r affinities for DIC (0.026 mM) than DIC-sufficient cells (0.66 mM). DIC-limited cells demonstrated an ability to use both extracellular CO2 and HCO3 -, as assayed by isotopic disequilibrium incubations. These cells also accumulated intracellular DIC to concentrations 100X higher than extracellula r, as determined using the silicone oil centrifugation technique. Cells that were not provid ed with an electron donor did not have elevated intracellular DIC con centrations. The inducible changes in whole-cell affinity for DIC, the ab ility to use both extracellular CO2 and HCO3 -, and the energy-dependent generation of el evated intracellular concentrations of DIC are all consistent with the presence of a CCM in T. crunogena.


16 Introduction 2.7 billion years ago, this planet was geochemically, ecologically, and biologically distinct from what it is today. Atmospheric carbon dioxide concentrations were 1-3 orders of magn itude higher (16, 30) Representatives from all three domains of life (Archaea, Bacteria, and Eukarya) were already present and had begun to diversify (3). Confronted with the precipitous fall of atmospheric and oceanic CO2 concentrations in the late Proterozoic, many autotrophic lineages likely responded with adaptations to maintain an adequate supply of CO2 for growth (27, 35). Carbon concentrating mechanisms (CC Ms) can facilitate rapid autotrophic growth in environments where the CO2 and/or HCO3 concentrations are chronically or episodically low. CCMs are present in many species of cyanobacteria, and generate an elevat ed intracellular concentration of HCO3 by using active HCO3 transport (22, 32) and CO2 traps (33). Carboxysomal carbonic anhydrase (EC converts intracellular HCO3 to CO2, which is fixed by ribulose 1,5-bisphosphate carboxylase /oxygenase (Rubisco, EC; 2, 15, 26). The elevated intracellular concentr ations of dissolved inorganic carbon resulting from active transport expedite carbon fixation by Rubisco by enhancing substrate availability and mitigating the Rubisco oxygenase reaction (15). CCMs have not been rigorously st udied for any other prokaryotic autotrophs (e.g., autotrophic Proteobact eria, Planktomycetes, Green Sulfur Bacteria, Aquificales, Archaea). This is su rprising, as CCMs are likely to be quite relevant to primary productivity in th e diverse habitats where autotrophic


17 microorganisms are found. CCMs with similarities to those present in cyanobacteria may be widespread. For example, the recently-sequenced genomes of the photosynthetic -proteobacterium Rhodopseudomonas palustris and the ammonia-oxidizing -proteobacterium Nitrosomonas europaea contain genes for carbonic anhydrase and potential HCO3 transporters (4, 18). Furthermore, it has recently been demonstrated that carboxysomes from the chemolithoautotroph Halothiobacillus neapolitanus contain carbonic anhydrase, and are believed to function similarly to those pres ent in cyanobacteria (34). A CCM could facilitate the growth of chemolithoautotrophs at hydrothermal vents, where there is an e normous degree of sp atial and temporal variability in the concentration of CO2 (9). The hydrothermal vent proteobacterium Thiomicrospira crunogena is an obligate sulfur-oxidizing chemoautotroph that was originally isolat ed from a deep-sea hydrothermal vent habitat where the CO2 concentration oscillates between 20 M and 1 mM, and HCO3 is always the most abundant form of dissolved inorganic carbon (DIC, equal to the sum of CO2, HCO3 -, and CO3 -2; (9, 11). This is one of the fastestgrowing chemoautotrophs, with a doubli ng time as low as one hour (11). It continues to grow rapidly in batch culture even after drawing the concentration of DIC down to less than 20 M, and it has carboxysomes (31). Both characteristics are consistent with the presence of a CCM. Detailed physiological experiments we re undertaken to determine whether this organism has a carbon concentra ting mechanism. Understanding how T. crunogena and other autotrophic microorganisms adapt to low concentrations of


18 DIC during growth is relevant to und erstanding the physiology of these unique organisms, and will provide insights in to the response of autotrophic carbon fixation to changes in global ge ochemistry over Earth history. Materials and Methods Analytical methods and reagents. Dissolved inorga nic carbon (DIC; CO2 + HCO3 + CO3 -2) was quantified with an Agile nt 6890N gas chromatograph equipped with an extractor to permit st ripping dissolved gases from aqueous samples (5). Ammonia (NH3 + NH4 +) was assayed using a commercial colorimetric kit (Sigma Inc.). After soni cating the cells for 30 sec in the presence of glass beads, total protein was measured with a Lowry-type assay (BioRad Inc). The DI14C used to measure carbon up take and fixation rates was purchased as a sterile pH 9.5 solution (2 mCi ml-1, 50 mM DIC, MP Biomedicals Inc.). Upon receipt, 0.5 ml portions were se aled into glass vials with gas-tight gas chromatograph septa, and stored at 4C until use. These stock DI14C solutions had stable counts over the cour se of this study (unpubl. data). Bacterial strains and growth conditions. Thiomicrospira crunogena XCL-2 (1) was cultivated at 25C on liquid and solid TASW media modified from (11). TASW medium consists of artificial seawater supplemented with 40 mM thiosulfate, which T. crunogena utilizes as an electron donor, and NaHEPES to maintain the pH at 8 (100 mM in batch culture, and 10 mM for continuous culture). The strain was maintained long-term in 15% glycerol/TASW medium (v/v) at -80C.


19 Cultivation under nutrient limitation. T. crunogena was cultivated in chemostats (New Brunswick Scientific Bi oFlo 110) to grow the cells under DIC or ammonia limitation. dO2/pH controllers monitored the pH and O2 concentrations in the growth chambers with electrodes, maintaining optimal growth conditions by adding 10N KOH to keep the pH between 7.8 and 8, and by periodically pulsing the growth chamber with O2 gas to maintain its concentration between 3 and 25 M. The growth chamber was supplied with TASW medium (2.5 mM DIC, 6.6 mM (NH4)2SO4) from a 10L reservoir at a range of dilution rates (0.03 – 0.44 hr-1). Measurement of inducible changes in the half-saturation constant for DIC. To determine whether T. crunogena has inducible adaptati ons to cope with lower concentrations of DIC during grow th, DIC-limited and DIC-sufficient (but ammonia-limited) cells were cultivated in chemostats at a dilution rate of 0.1 vessel volume hr-1 and their whole-cell affinities for DIC were measured. For DIC-sufficient cells, the reservoir [DIC] was raised to 10 mM, and the ammonia concentration was dropped from 13.2 mM to 0.5 mM. When the dilution rate was 0.1 vessel volume hr-1, the steady-state [DIC] in the growth chamber was 0.08 mM for DIC-limited cells, and 5.5 mM for DIC-sufficient cells. The growth chamber ammonia concentration for DICsufficient cells was below the limit of detection for the assay used (< 10 M). DIC or ammonia was confirmed to be limiting growth by observing higher bioma ss densities in the growth chamber, assayed as protein concentrations, when either DIC or ammonia concentrations (as appropriate) were raised.


20 To harvest the cells, 150 ml porti ons were removed from the growth chamber and centrifuged (5000 g, 4C, 10 min). Pellets were resuspended in 3 ml TASW medium (for DIClimited cells: trace DIC, 13.2 mM ammonia; for ammonia-limited cells: 5.5 mM DIC and 0.5 mM ammonia), and kept on ice until the experiment was completed (less than 30 mins). 10 l aliquots of the suspended cells were added to 7 glass reac tion vials with stir bars, filled with 1.98 ml TASW medium (pH 8, 0.02 to 10 mM DIC, supplemented with 14C-DIC to a specific activity of 2-40 Ci/mol). Once per minute, over a timecourse of 4 min, a 400 l aliquot was removed from each r eaction vial and injected into a scintillation vial containing 200 l 65C glacial acetic acid. These acidified samples were gently sparged w ith air until dry to remove the 14C-DIC. Scintillation cocktail was added to quantify the organic 14C. Initial activities were measured by injecting 10 l portions of the incubations into scintillation vials containing 3 ml scintillation cocktail plus 50 l -phenethylamine. Bicarbonate and carbon dioxide uptake and fixation. To determine whether DIC-limited cells can use both extracellular bicarbonate and carbon dioxide, DIC-limited cells were cultivated and harvested as described above, and resuspended in DIC-free TASW medium and bubbled with soda lime-treated (carbon dioxide-free) air until [DIC] = 0. Cell suspensions were then placed on ice and gently sparged with carbon dioxide-f ree air until use. Incubations with 14C were conducted as described above, w ith the following modifications. Instead of using DI14C equilibrated at pH 8, an isotopic disequilibrium technique was used, in which either H14CO3 or 14CO2 was added (6). The 14C stock solution was


21 pH 9.5 in distilled water, and therefore < 0.1% CO2, ~30% HCO3 -, and 70% CO3 2. Upon injection into a wellbuffered pH 8 solution, the HCO3 concentration instantaneously jumps to 93% due to protonation of most of the CO3 -2. To prepare dissolved 14CO2, 14C stock solution was added to DIC-free 1 mM H3PO4 in a sealed glass vial and allowed to equilibrate ~30 mins before use to quantitatively convert the DI14C to 14CO2. 10 l aliquots of suspended cells were added to reaction vi als filled with 2 ml DIC-free TASW medium. H14CO3 or 14CO2 were added to the vials to begin the reaction, and timepoints were taken at 10 sec intervals. Upon addition, 14CO2 generates H14CO3 with a half-dehydration time of ~17 sec, while 14CO2 forms from H14CO3 with a half-hydration time of 26 mins (37). Accordingly, incubations in which 14CO2 or H14CO3 was initially added were limited to 20 sec or 40 sec, respectively. Intracellular DIC accumulation and pH. The silicone oil centrifugation method was used to measure the size of the intracellular DIC pool and the intracellular pH (modified from 14). DIC-limited cells were grown and harvested as described above. 0.6 ml eppendorf tubes were prepared containing two immiscible layers of fluid: a dense bottom layer, consisting 20 l of a killing solution (2:1 (v:v) 1M glycine, pH 10:triton) overlain with 65 l of silicone oil (Dow Chemicals SF 1156). Cell suspensions (200 l) were pipetted on top of the silicone oil layer, mixed with radiolabe lled solute, and at timed intervals, were centrifuged for 20 sec. The cells passed th rough the silicone la yer and pelleted in the killing solution, carrying intracellular ra diolabelled solute. Immediately after


22 centrifugation, the tubes were frozen in liquid nitrogen and the bottom layer with the cells was clipped into sc intillation vials containing 200 l glacial acetic acid (for measuring intracellular fixed carbon) or directly into 3 ml scintillation cocktail plus 50 l -phenethylamine (for quantif ying intracellular fixed and inorganic carbon, cell volumes, or pH). For measuring intracellular DIC, TASW medium containing 3 to 240 M DI14C (40 Ci mol-1) was allowed to equilibrate at pH 8 before the experiment. 200 l portions of this solution were pipette d on tope of the silicone layers in eppendorf tubes, and 10 l of suspended cells in DIC-free TASW medium were added. After 30 sec, the tubes were s pun at 14,000 g for 20 sec before freezing and processing, as preliminary timecour se experiments indicated that the intracellular DIC pool was constant after 20 sec. For each concentration of DIC, samples were run in parallel to measur e intracellular DIC plus fixed carbon (clipped into scintillation cocktail alkalinized with -phenethylamine) and fixed carbon (clipped into glacial acetic acid). Values from the samples clipped into glacial acetic acid were subt racted from those clipped into alkalinized scintillation cocktail to calculate the intracellular DIC pool. For estimating intracellular volume, which is necessary for calculati ng intracellular solute concentrations, incubations were al so conducted with 9 Ci ml-1 D-sorbitol ([U-14C], MP Biomedicals) and 3 Ci ml-1 tritiated water (Amersham Biosciences; 14, 29). The intracellular concentrations of both of these substances reached equilibrium before 2 min (unpubl. data). Accordingl y, incubations with sorbitol or tritium were terminated at 2 min by centrifugation.


23 To assess whether DIC accumulation was energy-dependent or simply driven by intracellular alkalinization, the intracellular pH of DIC-limited cells was measured using the silicone oil centri fugation technique described above, with methylamine (ME; methylamine hydrochloride, [14C]; MP Biomedicals Inc). ME has a pKa of 10.7 and accumulates inside ce lls as its positivel y charged, conjugate acid when the cytoplasmic pH is lower th an the extracellular pH (29, 38). ME was added to cell suspensions (pH 8) to an activity of 0.45 Ci ml-1 and allowed to equilibrate for 3 min, which was sufficient time to reach equilibrium concentrations inside the cells (K. Scott, unpubl. data). Parallel incubations with 14C-sorbitol and tritiat ed water were conducted with the cell suspensions to make it possible to estimate the intracellula r concentrations of the ME. Due to concern that ME might be accumulating in the cells via uptake by ammonia permeases (20), intracellular pH was also measured with DMO (dimethyloxazolidine-2,4 dione 5,5 [2-14C]; American Radiolabeled Chemicals; 29, 38). DMO has a pKa of 6.2 (29, 38) and accumulates inside cells as its negatively charged, conjugate base. In cubating cells with DMO under conditions where the extracellular pH is much more alkaline than the intracellular pH prevents DMO from accumulating within the cells. To raise intracellular DMO concentrations, the pH used for incuba tions with this compound was 7.3 instead of 8.0. A second series of incubations with ME were also conducted at pH 7.3. Energy-dependence of intracellular DIC accumulation. Cells were cultivated under DIC-limiting conditions as described above. To prepare them for these experiments, it was necessary to wash them four times with thiosulfate-free


24 artificial seawater medium as this el ectron donor is presen t in their growth medium at a high concentration (40 mM). After the final wash, cells were resuspended in DIC-free, thiosulfate -free medium and put on ice while being gently bubbled with CO2-free air. Silicone oil cen trifugation experiments with radiolabelled DIC were conducted as desc ribed above, at a range of thiosulfate concentrations (0-1 mM). Results Cultivation under DIC limitation. Steady-state exponential growth, confirmed by protein and DIC assays, occu rred after ~6 liters of TASW medium had passed through the 1 liter growth chamber. The steady-state DIC concentrations in the growth chamber were substantially lower than in the reservoir due to consumption by T. crunogena (FIG. 2). A rectangular hyperbola was fitted to the data via the direct linear plot method (8) to estimate the KDIC (0.22 mM) and the max (0.44 hr-1). FIG. 2. Steady-state gr owth rate constants ( ) and dissolved inorganic carbon (DIC) concentrations for T. crunogena cells grown in chemostats under DIC limitation. Using the direct 0 0.1 0.2 0.3 0.4 0.5 0123 DIC (mM) (hr-1)


25 linear plot method (8), a rectan gular hyperbola was generated to model the data (shown as a curve in the figure; KDIC = 0.22 mM; max = 0.44 hr-1). The error bars indicate the standard error of the measurements (n=3). Measurement of inducible changes in the half-saturation constant for DIC. DIC-limited cells had much higher whole-cell affinities for DIC (KDIC = 0.026 mM) than DIC-sufficient cells did (KDIC = 0.66 mM; FIG. 3), which is consistent with inducible changes in tr ansport and/or fixation occurring when cells were growing under DIC-limiting conditions. FIG. 3. Carbon fixation rates for T. crunogena harvested from DIC-limited (solid circles) and DIC-sufficient (ammonia-limited; open circles) chemostats with = 0.1 hr-1. Data are presented with rectangular hyperbolae derived as in (8). For DIC-limited cells, the KDIC (0.026 mM) was lower than for DIC-sufficient cells (KDIC = 0.66 mM). The Vmax for both was similar (133 and 120 nmol min-1 mg protein-1, respectively. The error bars indicate the standard deviations of the slopes. Bicarbonate and carbon dioxide uptake and fixation. T. crunogena demonstrated an ability to use both ex tracellular carbon diox ide and bicarbonate (FIG. 4). Some interconversion of car bon dioxide and bicarb onate did occur over 0 50 100 150 012345 DIC (mM)Carbon fixation rate (nmol min-1 mg protein-1)


26 the timecourse of these experiments and n eeds to be considered when interpreting the results. When 14CO2 was initially added, the H14CO3 formed was unlikely to contribute substantially to the observe d carbon fixation rates, as the initial concentration of CO2 was low (1 to 6 M) relative to the KHCO3(53.6 M, FIG. 4). Carbon fixation rates for T. crunogena harvested from DIC-limited chemostats with = 0.1 hr-1, when supplied with CO2 (A) KCO2 = 1.03 M; Vmax = 97.2 nmol min-1 mg protein-1) or HCO3 (B) KHCO3= 53.6 M; Vmax = 149 nmol min-1 mg protein-1). Data are presented with rectangular hyperbolae derived as in (8). In (B), error bars indi cate the standard deviations of the slopes. Error bars are not presented in (A) since the carbon fixation rates were based on 2 timepoints. FIG. 4. Carbon fixation rates for T. crunogena harvested from DIC-limited chemostats with = 0.1 hr-1, when supplied with CO2 (A) KCO2 = 1.03 M; Vmax = 97.2 nmol min-1 mg protein-1) or 0 50 100 150 HCO3 (mM)Carbon fixation rate (nmol min-1 mg protein-1)B 0 50 100 150 0246 CO2 ( M)Carbon fixation rate (nmol min-1 mg protein-1)A


27 HCO3 (B) KHCO3= 53.6 M; Vmax = 149 nmol min-1 mg protein-1). Data are presented with rectangular hyperbolae derived as in (8). In (B), error bars indicate the standard deviations of the slopes. Error bars are not presented in (A) since the carbon fixation rates were based on 2 timepoints. For the experiments in which H14CO3 was added, the 14CO2 formed from H14CO3 over the 40 sec timecourse probably contributed to the observed carbon fixation rates since the cells demons trate such a high affinity for CO2. To account for this, a pseudo-first-order rate constant for CO2 formation from HCO3 in seawater was used to calcul ate the concentration of CO2 present in the incubations at each timepoint (37). Th e contribution of this CO2 to the measured rates of carbon fixation was estimated using the KCO2 (1.03 M) and Vmax (97.2 nmol min1 mg protein-1) for CO2-dependent carbon fixation. When this estimate of CO2dependent carbon fixation was subtracted from the rates measured in these experiments, the KHCO3was 11 M and the Vmax was 52 nmol min-1 mg protein-1. The data are consistent with bicarbon ate use contributing substantially to growth under DIC limitation. At pH 8 and 80 M DIC, the conditions under which these cells were grown, the bicarbonate concentration was 74 M and the carbon dioxide concentration was ~0.7 M (19). Using the Ks and Vmax values (FIG 3; parameters for HCO3 use corrected as described above) and the Michaelis-Menton equation, the carbon fi xation rates due to bicarbonate and carbon dioxide use are 45 and 39 nmol min-1 mg protein-1, respectively. Whether DIC-sufficient cells also demonstrate an ability to use extrace llular bicarbonate


28 remains to be determined; our manipulations of the DIC concentration in the cell suspensions to prepare them for thes e experiments would likely induce the expression of the same traits observed in DIC-limited cells. FIG. 5. Intracellular DIC accumulation by T. crunogena cultivated under DIC limitation in a chemostat (DIC = 0.1 mM, = 0.1 hr-1). A unity line (dashed; intracellular DIC = extracellular DIC) is presented with the data for comparison, and error bars are the standard errors of the intracellular concentrations (n=3). Intracellular DIC accumulation and pH. Intracellular con centrations of DIC exceeded the extracellular concentra tion by 100X (FIG. 5), consistent with energy-dependent bicarbonate transport a nd accumulation in the cytoplasm. The intracellular pH of T. crunogena is ~7 at an extracellu lar pH of 8 (ME: 6.88 0.10) and 7.3 (ME: 7.03 0.06; DMO: 7.01 0.32; pH std. err., n=3), precluding intracellular alkalinization as the driving force for intracellular DIC accumulation. Energy-dependence of intracellular DIC accumulation. Cells accumulated elevated intracellular concentrations of DIC when thiosulfate was 0 2 4 6 8 10 12 Extracellular DIC (mM)Intracellular DIC (mM)


29 present at concentrations greater than 1 M (FIG. 6). This correlation of DIC accumulation and thiosulfate presence is consistent with intracellular DIC accumulation relying on either the membrane potential or ATP synthesis resulting from thiosulfate oxidation. FIG. 6. Energy-dependence of intracellular DIC accumulation by T. crunogena. Cells were cultivated under DIC limitation with thiosulfate (Na2S2O3) as the electron donor. [DIC]i = intracellular DIC concentration, [DIC]e = extracellular DIC concentratio n (0.1 mM), and error bars indicate the standard error (n=3). Discussion T. crunogena has a CCM that enables it to grow in the presence of low concentrations of CO2 by generating an elevated concentration of intracellular DIC. The results presented here are consistent with active transport of bicarbonate or carbon dioxide playing a role. Active transport could create elevated intracellular DIC concentrations despite the intracellular pH being lower 0 50 100 150 00.010.11101001000 [Na2S2O3] ( M)[DIC]i/[DIC]e


30 than extracellular, and would require the pr esence of thiosulfat e or other electron donor for energy. A CCM may serve to supplement the supply of CO2 available at T. crunogena ’s hydrothermal vent habitat. Te mperature differences between bottom water (2C) and dilute hydrothermal fluid (up to 35C) create turbulent eddies at the vents. In turn, these eddies ar e responsible for seconds-to-hours-long oscillations of environmental CO2 from 1 mM down to ~20 M CO2 (9, 12). During the lower CO2 periods, a CCM would enable T. crunogena to continue to grow rapidly. The CCM present in T. crunogena has many parallels with cyanobacterial CCMs. In both cases, whole-cell affini ties increase in response to the concentration of DIC available during growth. Energy-dependent transport generates an elevated concentration of intracellular DIC which, presumably in T. crunogena as in cyanobacteria, is “harvest ed” by carboxysomes (2, 26, 34). Use of extracellular HCO3 (FIG. 4) is consistent with the presence of HCO3 transporters, and a high cellular affinity for CO2 (1 M) compared to Rubisco (30-140 M for form IA, 100-250 M for form II; 10) may be indicative of an active CO2 uptake system. T. crunogena’ s genome (Scott, unpubl. data) encodes some genes whose products may function similarly to the co mponents of cyanobacterial CCMs. An -type carboxysome operon, which includes an -class carbonic anhydrase gene (34), is present. Additionally, a gene for a SulP-type anion transporter has been


31 found, similar to the SulP-type transporters from marine cyanobacteria that have recently been demonstrated to have HCO3 -transporting activity (24). It is also likely that the T. crunogena CCM will have several features that distinguish it from cyanobacterial CCMs. In contrast to cyanobacteria, whose genomes have a single form IA or form IB Rubisco gene (13, 21, 23, 28), T. crunogena Â’s genome carries three genes for this enzyme (two form IA Rubiscos, one form II Rubisco). The two form I Rubisco genes are expressed when cells are grown under low DIC conditions, while the fo rm II Rubisco gene is preferentially expressed under high DIC conditions (K. Sco tt, unpubl. data), similar to what has been observed for Hydrogenovibrio marinus (36). Also different from cyanobacteria, T. crunogena Â’s genome lacks any apparent homologs for the cyanobacterial bicarbonate transporter genes cmpABCD (22) and sbtA (32), as well as chpX and chpY which encode key components of the cyanobacterial CO2 uptake system (25, 33). It is possible that novel HCO3 and CO2 transporters will be found in this organism, and it will be interesting to determine whether transporter and Rubisco gene expressi on is coordinately regulated. The generation of random and directed knoc kout mutants is underway (Dobrinski and Scott, unpubl. data), with the objec tive of deciphering the mechanism for intracellular DIC accumulation in this organism. T. crunogena is not likely to be the only chemolithoautotroph with a CCM. CCMs may be present in other ch emolithoautotrophs that have a high demand for DIC (e.g., due to rapid growth ra tes), utilize a suffici ently abundant or electronegative electron donor to offset the energetic burden of a CCM, and


32 inhabit an environment with periods of DIC or CO2 scarcity. Mechanistic and genetic studies of CCMs in several lin eages of Bacteria and Archaea has the potential to illuminate how their an cestors coped with the two-orders-ofmagnitude drop in CO2 availability occurring ove r Earth history (16, 30). Autotrophs may have addressed this dilemma with a single solution that was spread by horizontal gene tr ansfer (as Rubisco genes were; 7). Alternatively, each lineage may have come up with a unique solution. It is reasonable to anticipate lineage-specifi c innovation, based on cyanobacterial CCMs. In cyanobacteria, three nonhomologous bicar bonate transporting systems and two forms of carboxysomes are scattered among the different clades (2, 24). Other autotrophs inhabit microhabitats even more disparate than those where cyanobacteria flourish (17), and embrace an astounding degree of phylogenetic and physiological diversity (at least four di visions of Bacteria; Archaea). Perhaps this ecological and phylogenetic diversity is reflected in a genetic and mechanistic diversity of CCMs. Acknowledgements Thanks are due to Douglas Nelson for providing the strain of T. crunogena used for this study, to Gordon Cannon for illuminating discussions, to Stacy Guerin and Darinka Obradovich for expert assist ance with the experiments, to Peter Girguis, Shana Goffredi, and Zoe McCudde n for editing early versions of this manuscript, and to two anonymous reviewers for helpful suggestions. This work was supported in part by a New Researcher Grant (USF).


33 References 1. Ahmad, A., J. P. Barry, and D. C. Nelson. 1999. Phylogenetic affinity of a wide, vacuolate, nitrate-accumulating Beggiatoa sp. from Monterey Canyon, California, with Thioploca spp. Appl. Environ. Microbiol. 65:270-277. 2. Badger, M., D. Hanson, and G. D. Pr ice. 2002. Evolution and diversity of CO2 concentrating mechanisms in cyanobacteria. Functional Plant Biology 29:161-173. 3. Brocks, J. J., G. A. Logan, R. Bu ick, and R. E. Summons. 1999. Archean molecular fossils and the early rise of eukaryotes. Science 285:1033-1036. 4. Chain, P., J. Lamerdin, F. Larimer, W. Regala, V. Lao, M. Land, L. Hauser, A. Hooper, M. Klotz, J. No rton, L. Sayavedra-Soto, D. Arciero, N. Hommes, M. Whittaker, and D. Arp. 2003. Complete genome sequence of the ammonia-oxidizing bacteriu m and obligate chemolithoautotroph Nitrosomonas eruopaea Journal of Bacteriology 185:2759-2773. 5. Childress, J. J. 1984. Metabolic and blood characteristics in the hydrothermal vent tube-worm Riftia pachyptila Mar. Biol. 83:109-124. 6. Cooper, T. G., and D. Filmer. 1969. Th e active species of "CO2" utilized by ribulose diphosphate carboxylase. J ournal of Biological Chemistry 244:1081-1083. 7. Delwiche, C. F., J.D. Palmer. 1996. Rampant horizontal transfer and duplication of rubisco genes in eubact eria and plastids. Mol. Biol. 13:873882. 8. Eisenthal, R., and A. Cornish-Bo wden. 1974. The direct linear plot. Biochemistry Journal 139:715-720. 9. Goffredi, S. K., J. J. Childress, N. T. Desaulniers, R. W. Lee, F. H. Lallier, and D. Hammond. 1997. Inorganic car bon acquisition by the hydrothermal vent tubeworm Riftia pachyptila depends upon high external P-CO2 and upon proton-equivalent ion transp ort by the worm. Journal of Experimental Biology 200:883-896. 10. Horken, K., and F. R. Tabita. 1999. Closely related form I ribulose bisphosphate carboxylase/oxygenase mo lecules that possess different CO2/O2 substrate specificities. Arch ives of Biochemistry and Biophysics 361:183-194. 11. Jannasch, H., C. Wirsen, D. Nelson, and L. Robertson. 1985. Thiomicrospira crunogena sp. nov., a colorless, sulfur-oxidizing bacterium from a deep-sea hydrothermal vent. Int. J. Syst. Bacteriol. 35:422-424. 12. Johnson, K. S., J. J. Childress, and C. L. Beehler. 1988. Short term temperature variability in the Rose Garden hydrothermal vent field. DeepSea Res. 35:1711-1722. 13. Kaneko, T., Y. Nakamura, C. P. Wolk, T. Kuritz, S. Sasamoto, A. Watanabe, M. Iriguchi, A. Ishikawa K. Kawashima, T. Kimura, Y. Kishida, M. Kohara, M. Matsum oto, A. Matsuno, A. Muraki, N. Nakazaki, S. Shimpo, M. Sugimoto, M. Takazawa, M. Yamada, M.


34 Yasuda, and S. Tabata. 2001. Comp lete genomic sequence of the filamentous nitrogen-fixing Cyanob acterium anabaena sp strain PCC 7120. DNA Research 8:205-213. 14. Kaplan, A., M. R. Badger, and J. A. Berry. 1980. Photosynthesis and the intracellular inorganic carbon pool in the bluegreen alga Anabaena variabilis : Response to external CO2 c oncentration. Planta 149:219-226. 15. Kaplan, A., R. Schwarz, J. Lieman -Hurwitz, M. Ronen-Tarazi, and L. Reinhold. 1994. Physiological and mol ecular studies on the response of cyanobacteria to changes in the ambi ent inorganic carbon concentration, p. 469-485. In D. A. Bryant (ed.), The Mol ecular Biology of Cyanobacteria. Kluwer Academic Publishers, The Netherlands. 16. Kaufman, A. J., and S. Xiao. 2003. Hi gh CO2 levels in the Proterozoic atmosphere estimated from analyses of individual microfossils. Nature 425:279-282. 17. Kuenen, J. G., and P. Bos. 1989. Habitats and ecological niches of chemolitho(auto)trophic bacteria, p. 117-146. In H. G. Schlegel and B. Bowien (ed.), Autotrophic Bact eria. Springer-Verlag, Madison. 18. Larimer, F., P. Chain, L. Hauser, J. Lamerdin, S. Malfatti, L. Do, M. Land, D. Pelletier, J. Beatty, A. Lang, F. R. Tabita, J. L. Gibson, T. Hanson, C. Bobst, J. T. y. Torres, C. Peres, F. Harrison, J. Gibson, and C. Harwood. 2004. Complete genome sequence of the metabolically versatile photosynthetic bacterium Rhodopseudomonas palustris Nature Biotechnology 22:55-61. 19. Lewis, E., and D. W. R. Wall ace. 1998. Program developed for CO2 system calculations, ORNL/CDIAC105. Oak Ridge National Laboratory, US Department of Energy, Oak RIdge. 20. Muro-Pastor, M., J. C. Reyes, and F. J. Florencio. 2005. Ammonium assimilation in cyanobacteria Photosynth. Res. 83:135-150. 21. Nakamura, Y., T. Kaneko, S. Sato, M. Mimuro, H. Miyashita, T. Tsuchiya, S. Sasamoto, A. Watanabe K. Kawashima, Y. Kishida, C. Kiyokawa, M. Kohara, M. Matsumot o, A. Matsuno, N. Nakazaki, S. Shimpo, C. Takeuchi, M. Yamada, a nd S. Tabata. 2003. Complete genome structure of Gloeobacter violaceus PCC 7421, a cyanobacterium that lacks thylakoids. DNA Research 10:137-145. 22. Omata, T., G. D. Price, M. R. Badger, M. Okamura, S. Gohta, and T. Ogawa. 1999. Identification of an ATP-binding cassette transporter involved in bicarbonate uptak e in the cyanobacterium Synechococcus sp. strain PCC 7942. Proceedings of th e National Academy of Sciences 96:13571-13576. 23. Palenik, B., B. Brahamsha, L. F, M. Land, L. Hauser, P. Chain, J. Lamerdin, W. Regala, E. Allen, J. Mc Carren, I. Paulsen, A. Dufresne, F. Partensky, E. Webb, and J. Waterbury. 2003. The genome of a motile marine Synechococcus Nature 424:1037-1042. 24. Price, G., F. Woodger, M. Badger, S. Howitt, and L. Tucker. 2004. Identification of a SulP-type bica rbonate transporter in marine cyanobacteria. Proc Natl Acad Sci USA 101:18228-18233.


35 25. Price, G. D., S. Maeda, T. Omata, and M. R. Badger. 2002. Modes of active inorganic carbon uptak e in the cyanobacterium, Synechococcus sp. PCC7942. Functional Plant Biology 29:131-149. 26. Price, G. D., D. Sultemeyer, B. Klughammer, M. Ludwig, and M. Badger. 1998. The functioning of the CO2 concentrating mechanism in several cyanobacterial strains: A review of general physiological characteristics, genes, proteins, and recent advances Canadian Journal of Botany 76:9731002. 27. Raven, J. A. 1991. Implications of i norganic carbon util ization: Ecology, evolution, and geochemistry. Cana dian Journal of Botany 69:908-923. 28. Rocap, G., F. W. Larimer, J. Lamerdin, S. Malfatti, P. Chain, N. A. Ahlgren, A. Arellano, M. Coleman, L. Ha user, W. R. Hess, Z. I. Johnson, M. Land, D. Lindell, A. F. Post, W. Regala, M. Shah, S. L. Shaw, C. Steglich, M. B. Sullivan, C. S. Ting, A. Tolonen, E. A. Webb, E. R. Zinser, and S. W. Chisholm. 2003. Genome divergence in two Prochlorococcus ecotypes reflects oceanic niche differentiation. Nature 424:1042-1047. 29. Rottenberg, H. 1979. The measuremen t of membrane potential and pH in cells, organelles, a nd vesicles, p. 547-569. In S. P. Colowick and N. O. Kaplan (ed.), Methods in Enzymology, vol. 55, New York. 30. Rye, R., P. H. Kuo, and H. D. Holland. 1995. Atmospheric carbon dioxide concentrations before 2.2 billion years ago. Nature 378:603-605. 31. Scott, K. M., M. Bright, and C. R. Fisher. 1998. The burden of independence: Inorganic carbon utiliz ation strategies of the sulphur chemoautotrophic hydrothermal vent isolate Thiomicrospira crunogena and the symbionts of hydrothermal vent and cold seep vestimentiferans. Cah. Biol. Mar. 39:379-381. 32. Shibata, M., H. Katoh, M. Sonoda, H. Ohkawa, M. Shimoyama, H. Fukuzawa, A. Kaplan, and T. Ogawa. 2002. Genes essential to sodiumdependent bicarbonate transport in cy anobacteria. Journal of Biological Chemistry 277:18658-18664. 33. Shibata, M., H. Ohkawa, H. Katoh, M. Shimoyama, and T. Ogawa. 2002. Two CO2 uptake systems in cyanobacteria: four systems for inorganic carbon acquisition in Synechocystis sp. strain PCC6803. Functional Plant Biology 29:123-129. 34. So, A. K., G. S. Espie, E. B. Williams, J. M. Shively, S. Heinhorst, and G. C. Cannon. 2004. A novel evolutionary lineage of carbonic anhydrase (epsilon class) is a component of the carboxysome shell. Journal of Bacteriology 186:623-630. 35. Tortell, P. D. 2000. Evolutionary and ecological perspectives on carbon acquisition in phytoplankton. Limn ology and oceanography 45:744-750. 36. Yoshizawa, Y., K. Toyoda, H. Arai M. Ishii, and Y. Igarashi. 2004. CO2responsive expression and gene or ganization of three ribulose-1,5bisphosphate carboxylase/oxygenase enzymes and carboxysomes in Hydrogenovibrio marinus strain MH-110. Journal of Bacteriology 186:5685-5691.


36 37. Zeebe, R. E., and D. Wolf-Gladrow 2003. CO2 in seawater: Equilibrium, kinetics, isotopes. Elsevier, New York. 38. Zilberstein, D., V. Agmon, S. Schuldiner, and E. Padan. 1984. Escherichia coli intracellular pH, membrane potentia l, and cell growth. J. Bacteriol. 158:246-252.


37 Chapter 3 Expression and Function of Three Carbonic Anhydrase Enzymes in Thiomicrospira crunogena Introduction Thiomicrospira crunogena a deep-sea hydrothermal vent sulfur oxidizing chemoautotroph (17), lives in a spat ially and temporally heterogeneous environment where it experiences broad sw eeps in pH (5 to 8) and dissolved inorganic carbon (DIC; = CO2 + HCO3 + CO3 -2; 2 mM to 7 mM; 12) due to interactions between hydrothermal flui d emitted from the seafloor and the overlaying seawater that perc olates through the fluid and trickles into the earthÂ’s crust (38). This results in turbulent ed dies caused by mixtures between bottom sea water and dilute hydrothermal fluid that results in temperature and chemical changes occurring on a temporal scale from seconds to days (18). These oscillations in pH and DIC result in fl uctuating CO2 concentrations, from 20 to 2000 M (12). To cope with these oscillations in DIC composition and concentration, T. crunogena has a carbon concentrating m echanism (CCM; Chapter 2). T. crunogena can grow rapidly despite DIC concen trations of less than 20 M in batch culture, and when grown at low c oncentrations of DIC, its whole-cell


38 affinity for DIC (0.026 mM) is markedly smaller than when cultivated at high DIC concentrations (0.66 mM; Chapter 2). T. crunogena can use both extracellular CO2 and HCO3 -, and is able to accumulate intracellular DIC to concentrations 100x higher than extracel lular (Chapter 2). The inducible molecular mechanism responsible for gene rating high intracellul ar concentrations of DIC has yet to be characterized. The genome does not encode any apparent orthologs to any of the HCO3 or CO2 transporters that have been characterized in cyanobacteria (appendix, 19, 3). The genome of T. crunogena does encode three carbonic anhydrase (CA) enzymes (one -CA, one -CA, and one -like carboxysomal CA) which may play a role in DIC uptake and fixation (appendix). -CA enzymes are the best biochemically characterized carbonic anhydr ases, are present in animals and are widespread among bacteria (46). -CA enzymes are phylogenetically unrelated to -CA, and are found in plants, bacteria, and archaea (46). The shared ancestry of -CA and -like carboxysomal CA enzymes (CsoSCA) is not apparent based on sequence comparisons; structural compar isons revealed a congruence of form indicative of extremely distant relatedness (42). In sulfur-oxidizing beta proteobacterial autotroph Halothiobacillus neapolitanus, CsoSCA is present in small amou nts in carboxysomes, which are protein-bound inclusions packed wi th RubisCO (ribulose 1,5-bisphosphate carboxylase/oxygenase; 15). CsoSCA converts HCO3 to CO2 within the carboxysome, where it is fixed by RubisCO (15). Given that the csoSCA gene in T. crunogena is present in a carboxysome ope ron (appendix), and carboxysomes


39 are present in this microorganism, it is lik ely that CsoSCA plays a similar role in T. crunogena. Extracellular CA has been implicated in facilitating DIC uptake in a variety of organisms. For example, Chlamydomonas reinhardtii cells, when treated with the CA inhibitors acetazolamide (AZA) and dextran-bound sulfonamide, to which cells are relatively impermeable, are unable to replenish intracellular CO2 levels from extracellular bicarb onate, prevalent at basic pH. Intracellular CO2 pools were not sensitive to these inhibitors when C reinhardtii were incubated at pH 5.1, when extracellular CO2 was abundant (26). In Rhodopseudomonas palustris, growth is inhibited when its periplasmic -CA is inactivated either by AZA or mutation; in either case, growth rates were restored with elevated CO2 concentrations or lower pH (35). The objective of this study was to determine whether the multiple CA enzymes found in T. crunogena are involved in DIC upt ake and fixation. The response of transcription of CA genes to the concentration of DIC available during growth was monitored. To verify that all three genes encoded functional CA enzymes, as well as to charact erize patterns of inhibition, the and carboxysomal CA genes were overexpressed in E.coli CA activity was also measured in T. crunogena cell extracts and in incuba tions with whole cells to infer the cellular location of the en zymes, and carbon fixation and DIC uptake rates were measured in the presence of CA inhibitors to determine whether these processes were affected by CA inactivation.


40 Materials and Methods Analytical methods and reagents DIC was quantified with a gas chromatograph (Chapter 2). Protein concen trations were determined by using the RC DC Protein Assay (Biorad, Hercules, CA). Bacterial strains and cultivation. Thiomicrospira crunogena XCL-2 was cultivated in artificial seawater medi um supplemented with 40 mM thiosulfate and 10mM Na HEPES, pH 8 (‘TASW’; 17, Chapter 2). Cells were grown in chemostats (Bioflo 110, New Brunswick Scientific) under DIC limitation (‘lowDIC cells’: 0.1 mM DIC, 13 mM (NH4)2SO4) or ammonia limitation (‘high-DIC cells’: 50 mM DIC, 0.8 mM (NH4)2SO4). The pH (=8) and oxygen concentration (~20 -100 were maintained in the growth chambers by using pH and O2 electrodes which directed 10 N KOH addition and O2-sparging (pure O2 was used for the low-DIC cells, while 5% CO2, balance O2 was used for the high-DIC cells; Chapter 2). One Shot Mach1TM – T1R and BL21 (DE3) One ShotR E. coli (Invitrogen, Carlsbad, CA) used for transformation and expression studies were cultivated in Luria broth supplemented with the appr opriate antibiotic (see below; 41). Transcription of CA genes in T. crunogena. Thiomicrospira crunogena cells were harvested by centrifugation ( 10,000g, 5 min, 4C), flash frozen in liquid nitrogen, and stored at -80C. RNA was isolated from lowand high-DIC cells by the Ribopure system (Ambion, Austin, TX), and cDNA was reverse transcribed using the Improm II RT sy stem (Promega, Madison, WI), with primers targeting the gene of interest (Table 1). Taqman primers and probe for


41 qRT PCR were designed using Primer Expre ss software (Table 1; ABI, Carlsbad, CA). qRT PCR was carried out with Taqman and the Step One qPCR system (ABI, Carlsbad, CA), using the followi ng parameters as recommended by the manufacturer: a two-step holding stage (50C for 2 min, 95C for 10 min), and a two-step cycling stage (95C for 15 sec, 60C for 1 min, 40 cycles). To verify that amplification efficiencies were similar for primer/probe sets directed against the 16S (=ca librator) and target genes ( -CA, -CA and csoSCA ), qPCR using these primer/probe sets was c onducted on a serial dilution of template cDNA. In all cases, a plot of CT (=CT target CT calibrator, where CT is the qPCR cycle where fluorescence of the reac tion has crossed the value considered to be baseline) versus log [template cDNA ] had a slope of less than 0.1, indicating that primer/probe amplification efficiency was constant for all primer/probe sets (22). To determine the concentration of pr imer/probe and template that resulted in CT values falling within 10-20 cycles, a d ilution series of 16S primer/probe and cDNA concentrations were run. Based on th e results of these experiments, 50 ng of cDNA template, 900 nM primers, and 250 nM probe were used. To verify that the 16S gene was expressed at the same level for both lowand high-DIC cells and was therefore suitable fo r use as a calibrator, the CT value for qPCR directed against 16S in cDNA from lowand hi gh-DIC cells, at a range of template concentrations, was captured. No difference in CT values, and therefore 16S gene expression, between lowand high-DIC cel ls was detected. The amount of 16S RNA in cDNAs from low and high-DIC cells was found to be ~40% of total cDNA used in each qPCR via Megascri pt Reaction (Promega, Madison, WI).


42 Fold differences in transcription be tween lowand high-DIC cells were calculated as 2CT ,where CT= [(CT target CT calibrator)-(CT targetRef CT calibratorRef)], CT target and CT calibrator are the CT values for target and 16S amplification in high-DIC cells, and CT targetRef CT calibratorRef are the corresponding values from low-DIC cells (22). Expression of T. crunogena CA genes in E. coli CA genes and form II RubisCO (negative control) were PCR-amplified from T. crunogena genomic DNA and cloned into the pET SUMO plasmi d (Table 1; Invitrogen, Carlsbad, CA). The construct was then introduc ed into competent One Shot Mach1TM – T1R E. coli Transformants were selected from co lonies growing on Luria plates with 50 g/ml kanamycin, and validated via P CR. Plasmid DNA was isolated with spin columns (Qiagen, Germantown, MD) and transformed into BL21 (DE3) One Shot E. coli for expression. After verifying ge ne presence with PCR, these E. coli cells were cultivated in Luria Broth suppl emented with 1% glucose and 50 g/ml kanamycin. To induce gene expression, once cultures reached an OD600 ~ 0.3, IPTG was added to a final concentration of 1 mM and the cultures were incubated overnight at room temperature while agita ted at 100 rpm, harvested the next day (10,000g, 5 min, 4C), and flash-frozen with liquid nitrogen. To verify target gene expression, samples from each E. coli culture were analyzed via SDS-PAGE (41), followed by Western blotting usi ng antisera directed against the polyhistidine tag added to the amino term inus of the proteins when they are expressed from the pET-SUMO vector (anti-His G-alkaline phosphataseconjugated Antibody, Invitrogen).


43 CA assays and inhibition. E. coli cells expressing T. crunogena CA genes, as well as lowand high-DIC T. crunogena cells, were harvested by centrifugation (10,000g, 5 min., 4C). Cells were resuspended in assay buffer (5 mM HEPES, pH 8.0, 0.1 mM ZnSO4) and sonicated on ice using acid-washed glass beads ( 106 m; Sigma, St. Louis, MO) with 315 second blasts (Sonic Dismembrator Fisher Scientific, Pittsbur gh, PA). Portions of 2 ml crude extract were placed into a 4C reaction vial with a stir bar, and a pH electrode. Once temperature was stable at 4C, 1 ml ice-cold CO2-saturated distilled water was injected, and the pH was monitored. For reactions where inhibitors were used, 2 ml crude extract were stirred for 1 mi n after inhibitor addition, and then CO2 saturated distilled water was added and th e pH was monitored as it fell. Bovine CA (1 g/ml final concentration), used as a positive control, was dissolved in 5 mM HEPES, pH 8.0, 0.1 mM ZnSO4. For a negative control, CA activity was measured in samples that had been autocl aved for 1 hr. Units of activity (U = (tact)/t, where t and tac are the time (in seconds) required for the pH to decrease from 8.0 to7.0 in the sample and autoclaved cont rol, respectively; 4) were calculated and normalized for the protein c oncentration in the assay (U mg-1). For CA assays conducted on whole cells, T. crunogena were harvested via centrifugation (5,000 g, 15 min., 4C) and washed thr ee times in assay buffer that was rendered isosmotic with growth medium by adding NaCl (5 mM HEPES, pH 8.0, 0.1 mM ZnSO4, 65 mM NaCl). Carbon fixation assays and inhibition. To measure the effects of CA inhibitors on DIC uptake and fixation, lowand high-DIC T. crunogena were


44 cultivated in chemostats as describe d above, and a 350 ml portion of culture (OD600 ~0.1) was harvested by centrifuga tion (5,000 g, 15 min., 4C, SLC-1500 rotor, Sorvall RC5C, Waltham, MA). Cells were washed 3 with ice-cold wash buffer (artificial seawater medium, buffered with 10 mM NaHepes pH 8) unsupplemented with thiosulfate or disso lved inorganic carbon, and resuspended to a final volume of 3 ml in this wash buffer. This cell suspension was sparged with soda lime-scrubbed (CO2-free) air for 30 mins to minimize the DIC concentration. A 20 l portion of cell suspension was added to 1.98 ml TASW supplemented with radiolabelled DIC at a range of concentrations (0.07 – 11 mM for low-DIC cells; 0.47 – 43 mM for highDIC cells; specific activity = 2 – 30 Ci/mol). For incubations with inhibitors, 20 l of cell suspension were either added to TASW supplemented with acetazolamide or ethoxyzolamide (250 M) to measure any immediate effects from these compounds, or incubated on ice for one hour in the presence of 250 M inhibitor, and added to TASW brought to this concentration of inhibitor as well. A 4 min timecourse was taken by injecting 0.4 ml portions of the incubation into 0.5 ml gl acial acetic acid in scintillation vials at 1 min intervals. After allowing the 14C-DIC to dissipate ove rnight, scintillation cocktail was added for quantification of the acid-stable 14C via scintillation counting. To measure the effects of acetazo lamide and ethoxyzolamide on DIC uptake, cell suspensions were prepared and sparged with CO2-free air as above. Portions of 10 l cell suspension were added to 200 l TASW, 0.3 mM radiolabelled DIC (10 Ci/mol), which were layered on top of 65 l silicone oil


45 (Dow Chemicals SF 1156) overlaying 20 l killing solution (2:1 (v:v) 1M glycine, pH 10:triton) in a 0.6 ml eppi ndorf tube (Chapter 2). After a 30 sec incubation, these tubes were centrifuged fo r 40 sec and flash-frozen with liquid nitrogen. Cell pellets we re clipped into scintilla tion vials primed with 50 l phenethylamine and 3 ml scintillation cocktail (to measure fixed + intracellular inorganic carbon) or 0.5 ml glacial ace tic acid (to measure fixed, acid-stable carbon). After clipping the pellets into glaci al acetic acid, they were stirred and 14CO2 was allowed to dissipate overnight be fore adding scintillation cocktail. To estimate the intracellular volume, whic h is necessary for calculating the intracellular concentration of DIC, cells were also incubated with 14C-sorbitol (to measure periplasmic volume) and 3H2O (to measure periplasmic + cytoplasmic volume), and centrifuged through silicone oil as described above. Cytoplasmic volume was calculated by subtracting the sorbitol-permeable space from the 3H2O-permeable space (Chapter 2).


46 TABLE 1. Primers and Probes Used to target T. crunogena carbonic anhydrase genes Target (locus tag) Purpose Function Sequence ( 5Â’-3Â’) Location on gene CA (Tcr_1545) cDNA synthesis R primer AATTCGTAAACCGTGTTGGCTCGG 852 qRT PCR F primer GGTCATCGCTATGAATTGTTGCAAT 340 R primer ACCAAGTGCATTTCCATCGGATAAT 467 probe FAM ACGCCTTCAGAACACC MGBNFQ 436 Heterologous expression F primer ATGAAGAAACGGTTTAGCTTT 1 R primer TTAATA AAATTCGTAAACCGTGTTG 858 CA (Tcr_0421) cDNA synthesis R primer AAGCCGTGAATGGCTAGATG 538 qRT PCR F primer GCGGTGGAAATTCTAAAGGTCAAA 271 R primer CTGGGATTGT GTTCTTCCATTGATG 338 probe FAM CACAGCCGTAATGTC MGBNFQ 311 Heterologous expression F primer ATGTGCCATCAATGTGAC 1 R primer TTAGCTATCAGTTGCTCTTAAG 636 csoSCA (Tcr_0841) cDNA synthesis R primer GCTTGCTTGGCCTCACTATC 1027 F primer TCTAAGGCAGACCCTACACATCAA 760 R primer CGCCGCTTTATGGTCATCACT 801 Probe FAM CATGAGCTGCACACCC MGBNFQ 784 Heterologous expression F primer ATGAATCGTTTGAAAAAAAGTCATC 1


47 R primer CTAT GCGGTTCTTTGCTT 1570 16S ( Tcr_R0053 ) cDNA synthesis R primer TTTATGAGATTCGCGCACTG 1206 qRT PCR F primer CGAATATGCTCTACGGAGTAAAGGT 110 R primer CGCGGGCTCATCCTTTAG 157 probe VIC CCCTCTCCTTGGAAGGT MGBNFQ 136 Megascript F primer TAATACGACTCACTATAGGGCGAGTG 1 R primer AAGGGCCATGATGACTTGAC 1129 cbbM (Tcr_0424) Heterologous expression F primer ATGGATCAGTCGAATCGTTATG 1 R primer TTATTTGTG TACGCCCAATTTTTC 1357 aNumbers listed reflect the number of nucleotid es 3Â’ of the start codon of the gene. bFAM and VIC refer to the fluorescent tags while MGB NFQ refer to the major groove binder and non-fluorescent quencher (ABI, Carlsbad, CA). cbbm = form II RubisCO.


48 Results Transcription of CA genes in T. crunogena The transcription of csoSCA was particularly sensitive to the DIC concentration during growth; lowDIC cells had csoSCA RNA levels substantially highe r than high-DIC cells (Table 2). Transcription levels for -CA were similar for lowand high-DIC cells (Table 2). Low-DIC cells may transcribe -CA somewhat less than high-DIC cells do, but the differences were not statis tically significant (Table 2). TABLE 2. Response of T. crunogena carbonic anhydrase gene transcription to the DIC concentration available during growth Gene Fold Increase a CT+ s.d. -CA 1.2 -0.3 + 1.8 -CA 0.39 1.4 + 1.2 csoSCA 173 -7.4 + 1.7 a qRT PCR was carried out on RNA extracted from lowand high-DIC T. crunogena cells using the 16S gene as the calibrator. Fold increase is the frequency of transcription in low-DIC cells divided by the frequency in high-DIC cells. Expression of T. crunogena CA genes in E. coli. When -CA -CA, and csoSCA genes were expressed in E. coli, the proteins they en code were apparent via SDS-PAGE and Western blot anal ysis (Fig. 7), and CA activity was measurable in E. coli cell extracts (Table 3). -CA activity was found to be sensitive to both ethoxyzolamide and acet azolamide (FIG. 8), with activity completely inhibited at ethoxyzolamide con centrations as low as 2.5 M (data not shown).


49 TABLE 3. Activity of heterologously expressed carbonic anhydrase genes from T.crunogena Units mg protein -1 + SDa -CA -CA csoSCA cbbM 79 + 3 7.1 + 0.3 1.24 + 0.02 1.34 + 0.05 a T. crunogena CA genes were individually expressed in E. coli and activity was measured in crude extract. cbbM which encodes a form II ribulose-1,5-bisphosphate carboxylase/ oxygenase, served as a negative control. Results are from three independent trials. -CA activity, however, was insensitive to ethoxyzolamide and acetazolamide (FIG. 8), and neither enzyme was inhibite d by dithiothreitol (data not shown). CsoSCA activity was low, and i nhibited by both ethoxyzolamide and dithiothreitol (FIG. 8), si milar to carboxysomal carboni c anhydrase activity from Halothiobacillus neapolitanus (15). FIG. 7. (A.) SDS PAGE and (B.) Western blot depicting heterologous expression of T.crunogena carbonic anhydrase in E.coli. All were expressed with an amino-terminal polyhistidine tag, which added 13 kDa to the molecular weight of each protein. Lane 1—CbbM, 63 kDa; lane 2—marker;


50 lane 3-CA, 46 kDa; lane 4--CA, 38 kDa; lane 5—CsoSCA, 72 kDa. Cbbm was used as a negative control for all potentiometric assays in E. coli cells. FIG. 8. Effect of acetazolamide (AZA) and ethoxy zolamide (EZA) on carbonic anhydrase activity of crude extracts prepared from E. coli in which (A.) -CA and -CA and (B.) csoSCA from T. crunogena were expressed. [inhibitors] = 250 M for acetazolamide and et hoxyzolamide. Error bars indicate standard error. CA activity and inhibito rs in low and high-DIC T. crunogena. CA activity was measurable in crude extract from T. crunogena cells (FIG. 9). CA activity in crude extracts from low-DIC T. crunogena was completely inhibited by 250 M ethoxyzolamide, but not by dithioth reitol, consistent with this activity being due primarily to -CA. -CA was also very active in cell extracts from high-DIC cells, based on substantial inhibition by ethoxyzolamide. For crude extract from high-DIC cells, some CA activity was resistant to both ethoxyolamide and dithiothreitol, cons istent with the presence of -CA activity (FIG. 9). CA activity in intact cells from low-DIC and high-DIC T. crunogena was completely inhibited by 250 M acetazolamide (FIG. 10). 0 50 100 150 no additionAZA EZA percent of activity CA CA A.


51 FIG. 9. Carbonic anhydrase activity and inhibition in T. crunogena crude extract. CA activity was measured in the presence and absence of dithiothreitol (DTT; 10mM) and ethoxyzolamide (EZA; 250M). Error bars indicate standard error. FIG 10. Carbonic anhydrase activity and inhibition in T. crunogena whole cells. CA activity was measured in the presence and absence of acet azolamide (AZA; 250 M). Error bars indicate standard error. Effect of CA inhibitors on DIC uptake and fixation. For intact T. crunogena cells, ethoxyzolamide had a prounounced and immediate inhibitory effect on carbon fixation rates in bot h lowand high-DIC cells, while acetazolamide did not (FIG. 11). These lo wer carbon fixation rates do not appear to result from inhibition of DIC uptake, as the concentration of intracellular DIC was not measurably affected by either acetazolamide or ethoxyzolamide (FIG. 12). 0 20 40 60 80 100 120 140 160 no addition DTTEZA EZA + DTT percent of activity Low DIC Cells High DIC Cells 0 25 50 75 100 125 no additionAZApercent of activity Low DIC Cells High DIC Cells


52 FIG. 11. Effect of acetazolamide (AZA) and etho xyzolamide (EZA) on DIC uptake and fixation by T. crunogena cells. Inhibitors (250 M) were added to cell suspensions and carbon fixation was measured immediately or after incubating on ice fo r 1 hr. (A.) Cells grown under DIC-limitation (DIC during growth ~ 0.1 mM). (B). Cells grown under NH4 limitation (DIC during growth ~ 60mM). The standard deviation of the carbon fixation is so small relative to the value of the rate that it is too small to see on these figures. 0 0.1 0.2 0.3 0.4 0246810mol C min -1mg protein -1[DIC] (mM) no add'n EZA at 0 AZA at 0 EZA 1 hr AZA 1 hrA. 0 0.1 0.2 0.3 0.4 0204060mol min -1mg protein -1[DIC] (mM)B.


53 FIG. 12. Effect of 250 M acetazolamide (AZA) and ethoxyzolamide (EZA) on the size of the intracellular DIC pool and carbon fixation in intact (A.) lowand (B.) high-DIC T. crunogena cells. T. crunogena were grown under DIC-limitation (DIC ~ 0.1 mM; low-DIC) or NH4 limitation (DIC ~ 60mM; high-DIC). Extracellular [DIC] = 0.3 mM. Error bars indicate standard error. Discussion T. crunogena has multiple CA enzymes (FIG. 13), and it was not clear from the genome sequence whether all of them played a role in DIC uptake and fixation in this organism. Based on the results presented here, only the CsoSCA enzyme is implicated in this process. ranscription levels for csoSCA are greatly enhanced under low-DIC conditions (Table 2), consistent with its role in a carbon 0 1 2 3 4 5 6 7 0 mM TS 40 mM TS AZAEZAmmol/L cytoplasmLow DIC cells Intracellular [DIC] Carbon fixedA. 0 1 2 3 4 5 6 7 0 mM TS 40 mM TS AZAEZAmmol/L cytoplasmHigh DIC cells Intracellular [DIC] Carbon fixedB.


54 concentrating mechanism. It appears th at CsoSCA, which is sensitive to EZA (FIG. 8), plays a role in carbon fixati on, but not DIC uptake, as EZA did not inhibit DIC uptake in intact cells, though it did affect the rate of carbon fixation (FIG. 11). The greater de gree of inhibition of carbon fixation by EZA in low-DIC T. crunogena than in high-DIC cells (40% inhibition and 23% inhibition, respectively) may be due to CsoSCA play ing more of a role in low-DIC cells, which is consistent with enhanced transcription of csoSCA and other carboxysomal genes under low-DIC conditions (data not shown). In contrast to csoSCA CA is equally transcribed in lowand high-DIC cells, and CA enzyme is the dominant carbon ic anhydrase activity measureable in crude extracts from these cells, as CA activity in crude extracts was strongly inhibited by EZA, which targets the CA and CsoSCA, but not by DTT, which inhibits CsoSCA. An analysis of the amino acid sequence of CA with TMHMM (Center for Biological Sequence Analysis, University of Denmark) predicts its location to be periplasmi c, due to an amino-terminal hydrophobic sequence that is likely to be a signal pe ptide. Whole-cell potentiometric assays confirm the location of CA to be either extracellula r or periplasmic, due to CA inhibition by AZA (FIG. 10), which is re latively membrane-impermeable (5,7). Similarly, a periplasmic CA is present in the al phaproteobacterial purple photosynthetic bacterium Rhodopseudomonas palustris. In R. palustris CA functions to convert bicarbonate to CO2, which facilitates CO2 diffusion into the cytoplasm (5). However, in T. crunogena CA does not appear to play a role in


55 DIC uptake, as incubating cells in th e presence of AZA, which inhibits CA, does not have a measurable effect on carbon uptake or fixation (FIGS. 11 and 12). The possibility that CA does not play a role in DIC uptake and fixation is also supported by the genomic context of the CA gene; in T. crunogena the CA is not located in the genome near any other genes whose products are involved in carbon fixation (appe ndix). A possible role in pH homeostasis, as seen for the CA in Helicobacter pylori (6) is unlikely in T. crunogena, as CA is transcribed at similar levels in cells grown at pH 6.5 and 8 (data not shown). Another possible role mi ght be to ‘trap’ CO2 that is diffusing out of T. crunogena cells. Perhaps the CA may be converting periplasmic CO2 into bicarbonate, which is then transported into the cell. However, such a role is not supported by the high rates of DIC uptake and fixation measured for T. crungena incubated in the presence of AZA. Currently the role CA plays in T. crunogena is elusive and merits further investigation. Similar to CA, it does not appear that -CA plays a role in DIC uptake in T. crunogena cells. -CA is transcribed similarly in low and high-DIC cells; if it were a necessary part of the T. crunogena CCM, it would be expected to be transcribed more frequently in low-DIC cells. In fact, -CA activity may be higher in high-DIC cells, as 15% of CA activity is resistant to EZA in crude extract from high-DIC cells, while no CA activity is apparent in crude extract from low-DIC cells treated with th is inhibitor (FIG. 9). A role for -CA in highDIC cells is suggested by its genome context, as the -CA gene is directly downstream from the gene encoding a fo rm II RubisCO (appendix). The form II


56 RubisCO gene is transcribed more freque ntly under high-DIC conditions (data not shown), consistent with what has been noted for Hydrogenovibrio marinus (49), though it does not appear this is the case for the -CA gene. T.crunogena has three distinct CAs and it is clear that CsoSCA is associated with carboxysomes and pl ays a major role in carbon fixation, particularly in low-DIC cells. However, carbon fixation is affected in both lowand high-DIC cells by EZA, which is cons istent with CsoSCA being associated with carbon fixation in both (FIG. 11). Cs oSCA has been shown to be transcribed in both lowand high-DIC cells by Northern blot (data not show n) independent of other genes contained in the carboxysome operon. Indeed a core promoter is present immediately upstream from this gene, indicating that the csoSCA may be independently regulated from th e other carboxysome genes. Both CA and CA appear to be constitutively expresse d; pH does not affect the level of transcription of these genes, and DIC concentration has, at most, a minor ( ) or no ( ) apparent effect. None of the CA enzymes appear to play a role in DIC uptake, as the intracellular DIC concentra tion was not affected by the presence of AZA or EZA (which inhibit CA and CsoSCA; FIGS.8 and 12), and neither CA nor -CA were preferentially expressed in low-DIC cells (Table 2). Knockout mutations of all three CAs are cu rrently underway for a better understanding of the role CA and -CA are fulfilling in T. crunogena T.crunogena and close relatives are ubiquit ous isolates from hydrothermal vents worldwide (48) and experience temporal and spatial changes in DIC availability in situ (12) CsoSCA and carboxysomes facilitate growth during low-


57 CO2 periods. The advantages that the and -CA confer on this organism warrant further study to uncove r their roles in facilitati ng the survival of this deep-sea microorganism. FIG. 13. Model of T. crunogena cell with carbonic anhydrase lo cations and inhibitor sensitivities


58 References 1. Badger, M., Bek, E., (2008). Multiple Rubisco forms in proteobacteria: their functional significance in relation to CO2 acquisition by the CBB cycle. Journal of Experimental Botany 59: 1525-1541. 2. Badger M., Price G. (1994) Th e role of carbonic anhydrase in photosynthesis. Annu Rev Plant Phys iol Plant Mol Biol 45: 369–392. 3. Badger M, Hanson D, Price GD (2002) Evolution and diversity of CO2 concentrating mechanisms in cyanobacteria. Funct Plant Biol 29: 161– 173. 4. Braus-Stromeyer, S., Schnappauf, G., Braus, G., Gossner, A., Drake, H. (1997) Carbonic anhydrase in Acetobacterium woodii and other acetogenic bacteria. Journal of Bacteriology; 179: 7197-7200. 5. Brinkhoff,, T., Sievert, S.M., Kuev er, J., and Muyzer, G. (1999) Distribution and diversit y of sulfur-oxidizing Thiomicrospira spp. at a shallow-water hydrothermal vent in the Aegean Sea (Milos, Greece). Appl. Environ. Microbiol 65: 3843-3849. 6. Bury-Mone’, S., Mendz, G., Ball, G., Thibonnier, M., Stingl, K., Ecobichon, C., Ave’, P., Huerre, M., Lab itne, A., Thiberge, J., De Reuse, H. (2008) Roles of and carbonic anhydrases of Helicobacter pylori in the urease-dependent response to acidity and in colonization of the murine gastric mucosa. Infection and Immunity 76: 497-509. 7. Cannon, G., Bradburne, C., Al drich, H., Baker, S., Heinhorst, S., Shively, J. (2001) Microcompartments in Pr okaryotes: Carboxysomes and Related Polyhedra. Appl. Environ. Microbiol 67: 5351–5361. 8. Coleman, (1991). The molecular and biochemical analyses of CO2concentrating mechanisms in cyanobacteria and microalgae. Plant, Cell and Environment, 14: 861-867. 9. Dionisio, M., Shimada, A., Maruyama, T., Miyachi, S., (1993) Carbonic anhydrase activity of Prochloron sp.i solated from an ascidian host Arch Microbiol 159:1-5. 10. Dou, Z., Heinhorst, S., Williams, E. Murin, E., Shively, J., Cannon, G. (2008) CO2 fixation kinetics of Halothiobacillus neapolitanus mutant carboxysomes lacking carbonic anhydr ase suggest the shell acts as a diffusional barrier for CO2. The Journal of Biological Chemistry 283: 10377-10384. 11. Dufresne A., Salanoubat M., Parten sky, F., Artiguenave F., Axmann, I., Barbe, V., Duprat, S., Galperin, M., Koonin, E., Le Gal, F., Makarova, K., Ostrowski, M., Oxtas, S., Robe rt, C., Rogozin, I., Scanlan, D., Tandeau de Marsac N., Weissenbach, J ., Wincker, P., Wolf, Y., Hess, W. (2003) Genome sequence of the cyanobacterium Prochlorococcus marinus SS120, a nearly minimal oxyphototrophic genome. PNAS 100:10020-10025 12. Goffredi, S., Childress, J., Desaulnier s, N., Lee, R., Lallier, F., Hammond, D ( 1997). Inorganic carbon acquisition by the hydrothermal vent


59 tubeworm Riftia pachyptila depends upon high external P-CO2 and upon proton-equivalent ion transport by the worm. J. Exp. Biol ., 200:883–896. 13. Handelsmann, J. (2004). Metagenomics: Application of Genomics to Uncultured Microorganisms. Microbiology and Molecular Biology Reviews, 68: 669–685. 14. Hartman F., Harpel M. (1994). Stru cture, function, regulation and assembly of D-ribulose-1,5-bi sphosphate carboxylase/oxygenase. Annual Review of Biochemistry, 63:197–234. 15. Heinhorst S., Williams E., Fei Cai Murin D., Shively, J., and Cannon, G. (2006). Characterization of the Carboxysomal Carbonic Anhydrase CsoSCA from Halothiobacillus neapolitanus Journal of Bacteriology 188: 8087-8094. 16. Jannasch HW, Wirsen CO (1979) Ch emosynthetic primary production at East Pacific sea floor spread ing centers. BioSci. 29: 592-598. 17. Jannasch, H., Wirsen, C., Nelson, D., and Robertson, L. (1985). Thiomicrospira crunogena sp. nov., a colorless, sulfur-oxidizing bacterium from a deep-sea hydrothermal vent. Int. J. Syst. Bacteriol. 35: 422-424. 18. Johnson, K., Childress, J., Hessler, R., Sakamoto-Arnold, C., and Beehler, C. (1988). Chemical and biological in teractions in the Rose Garden hydrothermal vent field, Glapagos sp reading center. Deep-Sea Research, 35: 1723-1744. 19. Kaplan A., Reinhold L. (1999) CO2 concentrating mechanisms in photosynthetic microorganisms. Annu Rev Plant Physiol Plant Mol Biol 50: 539–570. 20. Kelly, D.P., and Wood, A.P. (2001). The chemolithotrophic prokaryotes. URL 21. Lapointe, M., Mackenzie, T., and Morse D. (2008). An External Carbonic Anhydrase in a Free-Liv in g Marine D in oflagellate May Circumvent Diffusion-Lim ited Carbon Acquisition. Plant Physiology 147:1427-1436. 22. Livak, K., Schmittgen, T., (2001) Analysis of relative gene expression data using real-time qua ntitative PCR and the 2CT method. Methods, 25: 402-408. 23. Maeda, S, Badger, M., Price, G. ( 2002). Novel gene products associated with NdhD3/D4-containing NDH-1 complexes are involved in photosynthetic CO2 hydration in the cyanobacterium Synechococcus sp. PCC7942. Molecular Microbiology, 43: 425-435. 24. Maeda, S., Price, G., Badger M., Enomoto C., Omata T. (2000). Bicarbonate binding activity of the cm pA protein of the cyanobacterium Synechococcus PCC7942 is involved in act ive transport of bicarbonate. Journal of Biological Chemistry, 275: 20551-20555. 25. Maren, T., (1984) The general physio logy of reactions catalyzed by carbonic anhydrase and their i nhibition by sulfonamides. Ann NY Acad Sci, 429: 568-579.


60 26. Moroney J., Bartlett S., Samuelsson G. (2001) Carbonic anhydrases in plants and algae. Plant Cell Environ 24: 141–153. 27. Muyzer, G., Teske, A., Wirsen, C., and Jannasch, H. (1995). Phylogenetic relationships of Thiomicrospira species and their iden tification in deep-sea hydrothermal vent samples by denaturi ng gradient gel electrophoresis of 16S rDNA fragments. Archives of Micr obiology 164: 165-172. 28. Omata, T., Price, G., Badger M., Okamura, M., Gohta, S., Ogawa, T. (1999). Identification of an ATP-bindi ng cassette transporter involved in bicarbonate uptake in the cyanobacterium Synechococcus sp. strain PCC7942. Proceedings of the National Academy of Sciences 96: 1357113576. 29. Portis, A. Jr. (1992). Regulati on of ribulose 1,5-bisphosphate carboxylase/oxygenase activity. Annual Review of Plant Physiology, 43:415–437. 30. Price G., Badger M. (1989). Expres sion of human carbonic anhydrase in the cyanobacterium Synechococcus PCC7942 creates a high CO2requiring phenotype. Evidence for a cen tral role for carboxysomes in the CO2 concentrating mechanism. Plant Physiology, 91: 505-513. 31. Price G., Coleman J., Badger, M. (1992). Association of carbonic anhydrase activity with carboxysomes isolated from the cyanobacterium Synechococcus PCC7942. Plant Physiology 100: 784 -793. 32. Price, G., Maeda S-I, Omata T., Ba dger M. (2002). Modes of inorganic carbon uptake in the cyanobacterium Synechococcus sp. PCC7942. Functional Plant Biology 29: 131-149. 33. Price, G., SuEltemeyer, D., Klughammer, B., Ludwig, M., Badger, M. (1998). The functioning of the CO2 concentrating mechanism in several cyanobacterial strains: a review of general physiol ogical characteristics, genes, proteins and recent advances. Canadian Journal of Botany 76: 973-1002. 34. Price, G., Woodger, F., Badger, M ., Howitt, S., Tucker, L., (2004). Identification of a SulP-type bica rbonate transporter in marine cyanobacteria. Proceedings of the National Academy of Sciences, 101: 18228–18233. 35. Puskas, L., Inui, M., Zahn, K., Yukawa, H. (2000) A periplasmic, -type carbonic anhydrase from Rhodopseudomonas palustris is essential for bicarbonate uptake. 36. Raven, J. A. 1991. Implications of i norganic carbon util ization: ecology, evolution, and geochemistry. Can. J. Bot 69:908–923. 37. Remko, M., Wilhelm von der Lieth, C ., (2004) Theoretical study of gasphase acidity, pKa, lipoph ilicity,and solubility of some biologically active sulfonamides. Bioorganic & Medicinal Chemistry, 12: 5395–5403. 38. Ruby E., Wirsen C., Jannasch H. (1981). Chemolithotrophic sulfuroxidizing bacteria from the Gala pagos Rift hydrothermal vents. Appl Environ Microbiol 42: 317–324.


61 39. Ruby E., Jannasch H. (1982). Phys iological characteristics of Thiomicrospira sp. strain L-12 isolated from deep-sea hydrothermal vents. J Bacteriol 149: 161–165. 40. Rye, R., Kuo, P., Holland, H. (1995). Atmospheric carbon dioxide concentrations before 2.2 billion years ago. Nature 378: 603-605. 41. Sambrook and Russell (2001) Molecula r Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor Laboratory Press. 42. Sawaya, M., Cannon, G., Heinhorst, S., Tanaka, S., Williams, E., Yeates, T., Kerfeld, C. (2006) The Structure of a -carbonic anhydrase from the carboxysome shell reveals a di stinct subclass with one active site for the price of two. Journal of Biological Chemistry 281: 7546-7555. 43. Shibata, M., Ohkawa, H., Kaneko, T., Fukuzawa, H., Tabata, S., Kaplan, A., Ogawa, T. (2001). Distin ct constitutive and low-CO2induced CO2 uptake systems in cyanobacteria: ge nes involved and their phylogenetic relationship with homologous genes in other organisms. Proceedings of the National Academy of Sciences 98: 11789-11794. 44. Shively, J., Bradburne, C., Aldrich, H ., Bobick, T., Mehlman, J., Jin, S., Baker S. (1998). Sequence homologue s of the carboxysomal polypeptide CsoS1 of the thiobacilli are present in cyanobacter ia and enteric bacteria that form carboxysomes-polyhedral bodies. Canadian Journal of Botany, 76: 906-916. 45. Shively, J., Vankeulen, G., Meijer, W. (1998). Something from almost nothing-carbon dioxide oxa tion in chemoautotrophs. Annual Review of Microbiology 52: 191-230. 46. Smith KS, Ferry JG (2000) Proka ryotic carbonic anhydrases. FEMS Microbiol Rev 24: 335–366. 47. So, A., Espie, G., Williams, E., Sh ively, J., Heinhorst, S., Cannon, G. (2004) A novel evolutionary li neage of carbonic anhydrase ( class) is a component of the carboxysome shell. Journal of Bacteriology, 186: 623630. 48. Wirsen, C., Brinkhoff, T., Kuever, J., Muyzer, G., Molyneaux, S., Jannasch, H. (1998). Comparison of a ne w Thiomicrospira strain from the Mid-Atlantic Ridge with known hydrothermal vent isolates. Applied and Environmental Microbiology 64:4057-4059. 49. Yoshizawa Y, Toyoda K, Arai H, Ishii M, Igarashi Y. (2004) CO2responsive expression and gene or ganization of three ribulose-1,5bisphosphate carboxylase/oxygenase enzymes and carboxysomes in Hydrogenovibrio marinus strain MH-110. J Bacteriol, 186:5685–5691. 50. Zimmerman, S., Ferry, J., Supuran, C. (2007) Inhibition of the Archaeal class (Cab) and -class (Cam) carbonic anhydrases. Current Topics in Medicinal Chemistry 7: 901-908.


62 Chapter 4 Transcriptome response in Thiomicrospira crunogena to the dissolved inorganic carbon concentration Introduction Hydrothermal fluid emitted from cracks in the earthÂ’s tectonic plate system provides reduced chemicals (e.g., H2S, H2, CH4, and Fe+ 2) for use by vent microbes for carbon fixation (14, 30, 8). This deep-sea hydrothermal vent environment, while being one of the most productive ecosystems on the planet (23, 16) also presents challe nges to which vent organi sms must adapt. In this habitat, turbulent eddies of dilute hydro thermal fluid (30C), which has a low pH and carries H2S, mix with bottom seawater (2C ), which is alkaline in pH and carries O2, causing wide fluctuati ons in habitat chemistry (Johnson et al., 1988). The concentration of dissolve d inorganic carbon (DIC = CO2 + HCO3 + CO3 -2; 2 mM to 7 mM) and pH values (~5-8) vary considerably, presenting very divergent concentrations of CO2 (20 2000 M) and HCO3 to the autotrophs growing there (16), which may necessitate adaptations to maintain a steady supply of DIC, despite environmental fluctuations. One such adaptation is a carbon conc entrating mechanism (CCM; Price et al., 2002). Ribulose 1,5-bisphosphate car boxylase/oxygenase (RubisCO), the


63 carboxylase of the CalvinBenson-Bassham cycle, has a low affinity for CO2, and can use both CO2 and O2 as substrates (25). CCMs compensate for the low efficiency of RubisCO and help mini mize the wasteful oxygenase reaction by active HCO3 transport, which generates a high intracellular concentration of this compound (24), and carboxysomes, protein-bou nd inclusions in which a trace of carbonic anhydrase catalyzes the conversion of HCO3 to CO2, which is then fixed by the massive amounts of RubisCO packed within these inclusions (3, 35, 19). CCMs have been well studied in cyanobacter ia and facilitate the growth of these cells under low CO2 conditions. Cyanobacterial CCMs vary among species (4), but typically include high-affinity HCO3 transporters. Thus far, three evolutionarily distinct HCO3 transporters have been uncovered: BCT1, an ABCtype transporter, which is induced unde r carbon limitation (Omata et al., 1999), a Na+-dependent transporter (42), and SulP, which is evolutionarily related to sulfate transporters (38). Hydrothermal vent -proteobacterial chemolithoautotroph Thiomicrospira crunogena has a CCM, which may enable it to grow steadily despite environmental CO2 fluctuations (Chapter 2). T. crunogena utilizes the CalvinBenson-Bassham cycle for CO2 fixation, and grows rapidly even when the culture DIC concentration is below 20 M (Chapter 2). T. crunogena cells cultivated under low DIC conditions are capable of generating intracellular DIC concentrations 100-fold higher than extra cellular (Chapter 2), and can utilize CO2 and HCO3 for carbon fixation. Whole-cell affi nities for DIC respond to the DIC concentration present during growth; when DIC concentrations are low, cell


64 affinities for this substrate are substantially higher (KDIC = 0.026 mM) than when cells are cultivated under elevated DIC concentrations (KDIC = 0.66 mM; Chapter 2). Some components of a typical CCM are apparent in the genome of T. crunogena, but key components are not (append ix). A carboxysome operon is present, which encodes the shel l proteins, carbonic anhydrase ( csoSCA ), and carboxysomal Form I RubisCO. Elsewher e in the genome, two other RubisCO enzymes are encoded (one form I and one form II), as well as an and two -CA genes (including csoSCA) However, no orthologs to the bicarbonate transporters found in cyanobacteria are apparent in the T. crunogena genome (appendix). The objective of this study was to compare the transcriptomes of T. crunogena cultivated under lowand high-DIC conditions to identify the genes whose expression is stimulated by growth under low-DIC conditions, as a step in resolving all of the components of this proteobacterial CCM. Materials and Methods Analytical methods and reagents Quantification of DIC was carried out via gas chromatograph (Chapter 2). Prot ein concentrations were determined by the RC DC Protein Assay (Biorad, Hercules, CA). Bacterial strains and cultivation. Thiomicrospira crunogena XCL-2 was cultivated in artificial seawater medi um supplemented with 40 mM thiosulfate and 10 mM Na HEPES (‘TASW’; Chapter 2, 22). Cells were grown in chemostats (Bioflo 110, New Brunswick Scientific) under DIC limitation (‘low-DIC cells’:


65 0.1 mM DIC, 13 mM (NH4)2SO4, 3.1 mM PO4), ammonia limitation (‘high-DIC cells’: 50 mM DIC, 0.8 mM (NH4)2SO4, 3.1 mM PO4) or phosphate limitation (‘low-PO4’, 50mM DIC, 13 mM (NH4)2SO4, 0.025 mM PO4). In order to maintain the pH (=8) and oxygen concentration (~20 -100 pH and O2 electrodes directed 10 N KOH addition and O2-sparging (pure O2 was used for the low-DIC cells, while 5% CO2, balance O2 was used for the high-DIC cells; Chapter 2). After harvesting by centrif ugation (10,000g, 5 min, 4C), T. crunogena cells were flash frozen in liquid n itrogen, and stor ed at -80C. RNA isolation and transcriptional profiling. Oligonucleotide arrays were fabricated with probes designe d to represent all genes within the T. crunogena genome, with two or three probes pe r gene, and a probe length of 35 nucleotides (Combimatrix, Mukilteo, WA). RNA was isolated from cells grown in six chemostats (three low-DIC and th ree high-DIC) using the Ribopure system (Ambion, Austin, TX). RNA was purifie d further with the RNeasy Minelute cleanup kit (Qiagen, Germantown, MD), wh ich also served to remove EDTA remaining from the Ribopure system, and was eluted in RNAse-free water. One g total RNA was directly labeled for one hour with a Label IT cy5 labeling reaction (Mirus Bio, Madison, WI). Af ter labeling, the RNA underwent EtOH precipitation (5 min at -80C and 30 min centrifugation). The RNA pellet was resuspended in 16 l of water and 4 l fr agmentation buffer (final concentration: 40 mM Tris Acetate pH 8.1, 100 mM KOAc, 30 mM MgOAc). Prior to hybridization, Combimatrix a rrays were rehydrated at 65C with water for 10 min and then incubated at 45C for two hours in prehybridization


66 solution (final concentr ations: 6X SSPE (Lonza Accugene), 0.05% Tween-20, 20mM EDTA, 5X Denhardt’s solution, 100 ng/l herring sperm, 0.05% SDS. Labeled RNA was then added to hybridizat ion solution (final concentrations: 6X SSPE, 0.05% Tween-20, 20mM EDTA, 25% distilled formamide,100 ng/ l herring sperm DNA, 0.04% SDS) and the ar ray was incubated overnight at 45C. Arrays were washed and imaged per Combimatrix CustomArray™ 12K Microarray: Hybridization and Imaging Protocol (Combimatrix, Mukilteo, WA). All arrays used were stripped and rehybr idized for a maximum of three times each, as subsequent stripping and hybridi zation resulted in substantial loss of signal (data not shown). Global normalizing wa s used for all six arrays (three lowDIC, and three high-DIC) to compensate for between-array variation in overall signal strength; to normalize, the averag e signal strength for each array was calculated using fluorescence intensity for al l spots on each array. Spot intensities on all arrays were normalized so that each array would have the same average signal (Combimatrix, Mukilteo, WA). Fold changes were calculated by comparing the average values from 3 low-DIC microarrays to 3 high-DIC microarrays. Quantification of microarray results via qRT-PCR RNA was isolated from lowand high-DIC cells (as well as low-PO4 cells) as above, and cDNA was synthesized via reverse transcription us ing the Improm II RT system (Promega, Madison, WI), with primers targeting the gene of interest (Table 4). Taqman primers and probe for qRT PCR were de signed using Primer Express software (Table 4; ABI, Carlsbad, CA). qRTPCR reactions were assembled by adding


67 primers, probe, and template to Taqman Universal PCR Master Mix and a Step One qPCR system was used to amplify target genes (ABI, Carlsbad, CA), with parameters recommended by the manufacturer (a two-step holding stage (50C for 2 min, 95C for 10 min), and a two-step cy cling stage (95C for 15 sec, 60C for 1 min, 40 cycles). Verification of amplification effi ciencies was carried out with primer/probe sets directed against th e 16S (=calibrator) and target genes ( Tcr_1019, Tcr_1315, Tcr_466, and Tcr_2018 ), and qPCR using these primer/probe sets was conducted on a seri al dilution of template cDNA. The line in which CT (=CT target CT calibrator, where CT is the qPCR cycle where fluorescence of the reaction has crossed the value considered to be baseline) was regressed against log [templ ate cDNA] had a slope of le ss than 0.1, indicating that primer/probe amplification efficiencies we re constant for all primer/probe sets (27). Based on previously described c onditions for optimization of reaction conditions (Dobrinski et al., in prep), 50 ng of cDNA template, 900 nM primers, and 250 nM probe were used. Transcription levels of the 16S gene were invariant for all growth conditions explored he re, verifying its use as a calibrator (Dobrinski et al., in prep). Fold differences in transcription be tween lowand high-DIC cells were calculated as 2CT ,where CT= [(CT target CT calibrator)-(CT targetRef CT calibratorRef)], CT target and CT calibrator are the CT values for target and 16S amplification in high-DIC cells, and CT targetRef CT calibratorRef are the corresponding values from low-DIC cells (Livak and Schmittgen, 2001).


68 TABLE 4. Primers and probes used to target T. crunogena conserved hypothetical genes Locus tag Purpose Function Sequence ( 5Â’-3Â’) Location on gene Tcr_1019 cDNA synthesis R primer ACGCGGTTAGATCCCATTG 206 qRT PCR F primer AGAAAGCCGGCCGCTAAAA 130 R primer CCGGTTC TTCTTTTTCAGGTTGTTT 175 probe FAM CCGGTTGCCAAACAG NFQ 150 Tcr_1315 cDNA synthesis R primer GGTATACGCCAGGTCATTGG 653 qRT PCR F primer CCGTCGGGATTTTGAATGAAACC 427 R primer GGGTTACGCTCAACGCCATAA 468 probe FAM ACGAACCACCAACTTT NFQ 452 Tcr_0466 cDNA synthesis R primer ACGGCACCATCTTTTGTTTC 541 qRT PCR F primer GGGTTTGACCGCATGTATAACGA 343 R primer GATCGTAACGCCACCGAAAC 382 Probe FAM CTGCCGACAGATTTA NFQ 368 Tcr_2018 cDNA synthesis R primer ATATCGGCTTTTGGACAACG 1423


69 qRT PCR F primer GCCGATATCGCTGGTGTAGAATTT 1075 R Primer GTTTTGCCAGGTTGAAGTCGTATT 1117 probe FAM CCAAGCGCCATATTC NFQ 1099 16S ( Tcr_R0053 ) cDNA synthesis R primer TTTATGAGATTCGCGCACTG 1206 qRT PCR F primer CGAATATGCTCTACGGAGTAAAGGT 110 R primer CGCGGGCTCATCCTTTAG 157 probe VIC CCCTCTCCTTGGAAGGT NFQ 136 aNumbers listed reflect the number of nucleotid es 3Â’ of the start codon of the gene. bFAM and VIC refer to the fluorescen t tags while MGB NFQ refer to the major groove binder and non-fluorescent quencher (ABI, Carlsbad, CA). Tcr_1019 Tcr_1315 Tcr_0466 Tcr_2018 are conserved hypothetical proteins. Locus tags represent gene names.


70 Results and Discussion There are many genes present in the T. crunogena genome that appeared likely to play a role in DIC uptake and fixation, including those encoding the carboxysomal components, three RubisCO enzymes (two form I enzymes, one of which is carboxysomal, and one form II), and three carbonic anhydrase enzymes. What was unclear upon annotation was whet her these genes were differentially transcribed, and the molecular mechanis m for generating high intracellular concentrations of DIC (e.g., bicarbonat e transporters; appendix, Chapter 2) 0 0.5 1 1.5 2 2.5 alpha delta b subuni t c subuni t a subuni t high/lowA. 0 0.5 1 1.5 2 2.5 iron-sulfur subuni t cytochrome b Cytochrome c1high/lowB. 0 0.5 1 1.5 2 2.5 IIIIIIhigh/lowcbb3 subunitsC.


71 FIG. 14. A sampling of housekeeping genes that do not have a measureable change in transcription under lowversus high-DIC conditions as determined with mi croarrays. Â’High/lowÂ’ is the fold change in transcription, calculated by dividing the average spot intensity for microarrays hybridized with labeled mRNA purified from high-DIC cells by the spot intensity for those hybridized with labeled mRNA from low-DIC cells. Genes whose results are shown here include those encoding: (A.) subunits of ATP synthase, (B.) subunits of the bc1 complex, (C.) subunits of the cbb3 complex, (D.) subunits of DNA polymerase, and (E.) subunits of RNA polymerase. Two or three probes we re designed to target each ge ne and are illustrated here with individual bars on the graph. Multiple bars per gene represent individual probes for that gene Error bars represent standard error. As expected, transcription levels for housekeeping genes, including ATP synthase, components of the el ectron transport chain (the bc1 complex and the cbb3 complex), RNA and DNA polymerase were similar for lowand high-DIC cells (FIG. 14). However, many other gene s were transcribed at different levels under the different growth conditi ons tested (Tables 5 and 6). 0 0.5 1 1.5 2 2.5 alphadeltaepsilonchihigh/lowD. 0 0.5 1 1.5 2 2.5 alphabetabeta 'omegahigh/lowE.


72 TABLE 5. Fold changes (high/low-DIC) by microarray Gene product Locus tag Probe # Fold Differencea + SD CbbM Tcr_0424 733_767 4.84 + 0.27 925_959 3.42 + 0.39 CbbL Tcr_0427 760_794 5.57 + 1.66 940_974 4.01+ 0.68 CbbS Tcr_0428 23_58 4.80 + 0.81 99_136 4.54 + 0.52 Cons. hyp. protein b Tcr_0466 157_191 6.37 + 1.90 201_235 8.89 + 1.58 501_535 7.35 + 0.67 PII Tcr_1499 165_199 6.83 + 2.17 79_113 7.49 + 2.19 AMT Tcr_1500 502_536 8.18 + 0.77 Cons. hyp. protein b Tcr_2018 2103_2137 3.62 + 0.37 aFold differences are high-DIC fluo rescence values/ low-DIC fluoresc ence values for a particular probe. bConserved hypothetical protein. CbbM = form II RubisCO, CbbL, CbbS = subunits of form I RubisCO, PII = regulatory protein in the glutamine synthesis cascade, AMT = ammonia transporter TABLE 6. Fold changes (low/high-DIC) by microarray Gene product Locus tag Probe # Fold Difference + SDa Phage tail Tcr_0690 91_125 2.23 + 0.01 CScbbL Tcr_0838 1125_1159 4.48 + 0.57 993_1027 5.21 + 0.18 CScbbS Tcr_0839 177_211 9.24 + 0.87


73 59_96 10.70 + 1.47 CsoS2 Tcr_0840 1086_1120 14.33 + 0.05 1582_1616 12.88 + 0.72 1902_1936 2.82 + 0.04 CsoSCA Tcr_0841 1180_1214 3.25 + 0.10 1368_1402 3.72 + 0.04 CSorfA Tcr_0842 113_147 5.06 + 0.25 193_227 4.22 + 0.43 53_88 3.27 + 0.62 CSorfB Tcr_0843 201_235 2.43 + 0.02 65_99 2.73 + 0.03 CsoS1-1 Tcr_0844 26_60 12.78 + 0.41 80_114 6.08 + 0.25 CsoS1-2 Tcr_0845 204_238 19.61 + 0.64 CsoS1-3 Tcr_0846 25_59 14.57 + 0.32 273_307 12.57 + 1.40 BFR Tcr_0847 145_179 4.47 + 0.27 97_131 11.19 + 0.70 Orf2-11 Tcr_0848 129_165 5.49 + 0.18 188_222 3.62 + 0.05 236_271 4.94 + 0.03 Hyp. proteinc Tcr_0851 333_367 2.74 + 0.05 Cons. hyp. protein b Tcr_1019 17_51 2.95 + 0.14 89_126 3.01+ 0.02 Cold Shock Protein Tcr_1057 925_959 2.60 + 0.14 Cons. hyp. protein b Tcr_1315 520_554 3.25 + 0.05 832_866 2.35 + 0.04


74 aFold differences are low-DIC fluo rescence values/ high-DIC fluore scence values for a particular probe. bConserved hypothetical protein. cHypothetical protein. CScbbL, CScbbS = subunits for carboxysomal form I RubisCO. CsoS2, CSorfA, CSorfB, CsoS1-1, CsoS1-2, CsoS1-3, Orf2-11= carboxysome shell proteins. BRF = bacterial peptide chain release factor. CsoSCA = carboxysomal carbon ic anhydrase. Under low-NH4 + (high-DIC) growth conditions, genes associated with a nitrogen starvation response (1) had increas ed transcription leve ls (FIG. 15). This included glutamine synthetase, ammonium transporters Amt I and Amt II, and the regulatory protein PII, which stimulates transcription of the gene encoding glutamine synthetase, as well as post-transl ational modification of this enzyme via adenylation/deadenylation (10, 15). FIG. 15. Genes that have increased transcriptio n under high-DIC conditions, as determined with microarrays. ‘High/low’ is the fold change in transcription, calculated by dividing the average spot intensity for microarrays hybridized with labele d mRNA purified from high-DIC cells by the spot intensity for those hybridized with labeled mRNA from low-DIC cells. Multiple bars per gene represent individual probes for that gene. (A.) Ge nes associated with nitr ogen starvation. (B.) RubisCO genes that are preferentially transcribed under high-DIC conditions, where cbbL = noncarboxysomal form I RubisCO large subunit, cbbS = noncarboxysomal form I RubisCO small subunit, cbbM = form II RubisCO. Error bars represent standard error. The genes encoding the enzyme glutamine synthetase also appeared to have slightly enhanced transcription under th ese conditions, though the fold changes were not statistically si gnificantly different from 2.0. Genes encoding two 0 3 6 9 12glutamine synthetase 1 amt Iamt IIPIIhigh/lowA. 0 3 6 9 12 cbbMcbbLcbbShigh/lowB.


75 conserved hypothe tical proteins, Tcr_0466 and Tcr_2018, were found to have increased transcription under low-NH4 + conditions (FIG. 16, Table 6), as confirmed by qRT PCR (Table 7). The f unction for these conserved hypothetical proteins could not be discerned ba sed on their amino acid sequences. FIG. 16. Genes encoding conserved hypothetical proteins that have increased transcription under high-DIC conditions, as determined with micr oarrays. ‘High/low’ is the fold change in transcription, calculated by dividing the average spot intensity for microarrays hybridized with labeled mRNA purified from high-DIC cells by the spot intensity for those hybridized with labeled mRNA from low-DIC cells. Tcr_0466 and Tcr_2018 are the locus tag designators of the two genes predicted to encode proteins whose function is not possible to infer based on sequence. Multiple bars per gene represent individual probes for that gene Error bars represent standard error. However, both have predicted aminotermi nal signal peptides and an absence of downstream transmembrane helices, sugge sting a periplasmic location. The observation that transcription of thes e genes was insensitive to the DIC concentration when PO4 was the limiting nutrient (Table 7) indicates that stimulated transcription under high-DIC, low-NH4 + conditions was a response to NH4 +-limitation, not DIC abundance (Table 7). 0 5 10 15 Tcr_0466Tcr_2018high/low 0 5 10 15 20 CScbbLCScbbScsoS2csoSCAcsoS1-1low/high


76 FIG. 17. Carboxysome genes that are transcribed more frequently under low-DIC conditions, as determined with microarrays. ‘Low/high’ is the fold change in transcription, calculated by dividing the average spot intensity for microarra ys hybridized with labeled mRNA purified from low-DIC cells by the spot intensity for those h ybridized with labeled mRNA from high-DIC cells. Gene names: CScbbL = large subunit of form I carboxysomal RubisCO, CScbbS = small subunit of form I carboxysomal RubisCO, csoS2 = carboxysome shell protein, csoSCA = carboxysomal carbonic anhydrase, csoS1-1 = carboxysome shell protein. Multiple bars per gene represent individual probes for that gene Error bars represent standard error. Similar to what has been observed in other microorganisms (9, 47), the genes in the carboxysome operon, incl uding the gene encoding carboxysomal carbonic anhydrase ( csoSCA ), were transcribed more frequently under low DIC conditions (FIG. 17; Table 6). RubisCO gene s were also differentially transcribed: the carboxysomal form I had higher transc ription levels under low-DIC conditions while the other two (noncarboxysomal form I RubisCO and form II RubisCO) had increased transcription under high-DIC conditions (FIG. 15). This pattern is consistent with what has been observed in close relative H. marinus a gammaproteobacterial hydrogen-oxidizing autotroph with an identical RubisCO operon structure (47). TABLE 7. Response of T. crunogena conserved hypothetical gene transcription to changes in growth conditions response to low DIC Locus tag foldab CT + s.d. increase response to low NH4 + foldac CT + s.d increase response to low PO4 foldad CT + s.d increase Tcr_1019 4.4 -2.1 + 0.17 Tcr_1315 6.7 2.8 + 0.33 Tcr_0466 202.72 -7.66 + 0.96 0.77 0.37 + 2.26 Tcr_2018 6.95 -2.79 + 1.2 0.69 0.56 + 1.41 a qRT PCR was carried out on RNA ex tracted from lowand high-DIC T. crunogena cells using the 16S gene as the calibrator. b Fold increase is the frequency of transcription in low-DIC cells divided by the frequency in high-DIC cells. c Fold increase is the frequency of transcription in low-NH4 + cells divided by the frequency in high-NH4 + cells. d Fold increase is the frequency of transcription in low-PO4 cells divided by the frequency in high-PO4 cells. Locus tag represents gene name.


77 It is unclear, based on tran scription patterns, whether and -CA play a role in the T. crunogena CCM. CA is transcribed at similar levels under lowand high-DIC conditions (FIG. 18) and does not appear to play a role in DIC uptake and fixation (Dobrinski et al., in prep). The CA gene, though found in the form II RubisCO operon (appendix) does not appear to have increased transcription levels under high-DIC grow th conditions as demonstrated by microarray (FIG. 18) and confirmed by qR T PCR (Dobrinski et al., in prep). FIG. 18. Transcription of carbonic anhydrase-en coding genes under lowand high-DIC conditions as determined with microarrays. ‘Low/high’ is th e fold change in transcription, calculated by dividing the average spot intensity for microarra ys hybridized with labeled mRNA purified from low-DIC cells by the spot intensity for those h ybridized with labeled mRNA from high-DIC cells. csoSCA = carboxysomal carbonic anhydrase. Multiple bars per gene represent individual probes for that gene Error bars represent standard error. Two genes that were transcribe d more frequently under low-DIC conditions ( Tcr_1019 and Tcr_1315) may be novel components of the CCM of T. crunogena (Table 6, Fig. 19). While the f unction of the protein encoded by Tcr_1019 is not possible to infer from its se quence, this protein is predicted to have an aminoterminal signal peptid e without downstream transmembrane alphahelices, and therefore is likely to be localized in the periplasm. Likewise, for 0 0.5 1 1.5 2 2.5 3 3.5 4 -CA -CAcsoSCAlow/high


78 Tcr_1315 function assignment is not possible, but a likely cellular location can be inferred from the predicted amino acid seque nce. It is likely that the protein encoded by this gene would fold into a be ta barrel, and would therefore likely be present in the outer membrane, and has a signal peptide which would facilitate its translocation to the periplas m as a step in reaching its final destination. Knock out studies are under way to determine if e ither protein plays a role in the CCM. FIG. 19. Genes encoding conserved hypothetical proteins that have increased transcription under low-DIC conditions, as determined with micr oarrays. ‘Low/high’ is the fold change in transcription, calculated by dividing the average spot intensity for microarrays hybridized with labeled mRNA purified from low-DIC cells by the spot intensity for those hybridized with labeled mRNA from high-DIC cells. Tcr_1019 and Tcr_1315 are the locus tag designators of two genes predicted to encode proteins whose function is not possible to infer based on sequence. Multiple bars per gene represent individual probes for that gene Error bars represent standard error. A full understanding of how the CC M works in chemoautotrophs is instrumental in gaining insight into how these organisms are successful in environments such as the hydrothermal vents. Furthermore, identifying proteobacterial CCM components in T. crunogena makes it possible to identify them in other microorganisms. Until then, the understanding of DIC uptake and fixation is quite limited in the many nonc yanobacterial autotrophs that fix carbon dioxide in their bizarre challenging habitats. 0 0.5 1 1.5 2 2.5 3 3.5 Tcr_1019Tcr_1315low/high


79 References 1. Arconde’Guy, T., Jack, R., Merrick, M. (2001) PII Signal Transduction Proteins, Pivotal Players in Microbial Nitrogen Control. Microbiology and Molecular Biology Reviews 65: 80-105. 2. Badger, M., Bek, E., (2008). Multiple Rubisco forms in proteobacteria: their functional significance in relation to CO2 acquisition by the CBB cycle. Journal of Experimental Botany 59: 1525-1541. 3. Badger M., Price G. (1994) Th e role of carbonic anhydrase in photosynthesis. Annu Rev Plant Phys iol Plant Mol Biol 45: 369–392. 4. Badger M, Hanson D, Price GD (2002) Evolution and diversity of CO2 concentrating mechanisms in cyanobacteria. Funct Plant Biol 29: 161– 173. 5. Baker, S., Williams, D., Aldrich, H., Gambrell, A., Shively, J. (2000) Identification and localization of the carboxysome peptide Csos3 and its corresponding gene in Thiobacillus neapolitanus. Arch Microbiol 173: 278–283. 6. Brinkhoff,, T., Sievert, S.M., Kuev er, J., and Muyzer, G. (1999) Distribution and diversit y of sulfur-oxidizing Thiomicrospira spp. at a shallow-water hydrothermal vent in the Aegean Sea (Milos, Greece). Appl. Environ. Microbiol 65: 3843-3849. 7. Brocks, J. J., G. A. Logan, R. Bu ick, and R. E. Summons. 1999. Archean molecular fossils and the ear ly rise of eukaryotes. Science, 285:1033– 1036. 8. Campbell, A., Palmer, M., Klinkha mmer, G., Bowers, T., Edmond, J., Lawrence, J., Casey, J., Thompson, G., Humphris, S., Rona, P., Karson, J. (1988) Chemistry of hot spring s on the Mid-Atlantic Ridge, Nature 335: 514-519. 9. Cannon, G., Bradburne, C., Al drich, H., Baker, S., Heinhorst, S., Shively, J. (2001) Microcompartments in Pr okaryotes: Carboxysomes and Related Polyhedra. Appl. Environ. Microbiol 67: 5351–5361. 10. Cheng, J., Johnsson, M., Nordlund, S. (1999) Expression of PII and Glutamine Synthetase Is Regulated by PII, the ntrBC Products, and Processing of the glnBA mRNA in Rhodospirillum rubrum. J Bacteriology, 181:6530-6534. 11. Cleland W., Andrews J., Gutteridge S., Hartman F., Lorimer G.. (1998). Mechanism of Rubisco: the carbamate as general base. Chemical Reviews 98:549–561. 12. Dubbs, P., Dubbs, J., Tabita, F. (2004) Effector-Mediated Interaction of CbbRI and CbbRII regulators with target Sequences in Rhodobacter capsulatus. Journal of Bacteriology, 186: 8026–8035. 13. Dufresne A., Salanoubat M., Parten sky, F., Artiguenave F., Axmann, I., Barbe, V., Duprat, S., Galperin, M., Koonin, E., Le Gal, F., Makarova, K., Ostrowski, M., Oxtas, S., Robe rt, C., Rogozin, I., Scanlan, D., Tandeau de Marsac N., Weissenbach, J ., Wincker, P., Wolf, Y., Hess, W. (2003) Genome sequence of the cyanobacterium Prochlorococcus


80 marinus SS120, a nearly minimal oxyphototrophic genome. PNAS 100:10020-10025 14. Edmond, J., Von Damm, K., McDuff, R ., Measures, (1982) C. Chemistry of hot springs on the East Pacific Ri se and their effluent dispersal, Nature 297: 187-191. 15. Forchhammert, K.,Tandeau De Marsac, N.(1994) The PII Protein in the Cyanobacterium Synechococcus sp. Strain PCC 7942 Is Modified by Serine Phosphorylation and Si gnals the Cellular N-Status. J Bacteriology, 176: 84-91. 16. Goffredi, S., Childress, J., Desaulnier s, N., Lee, R., Lallier, F., Hammond, D ( 1997). Inorganic carbon acquisition by the hydrothermal vent tubeworm Riftia pachyptila depends upon high external P-CO2 and upon proton-equivalent ion transport by the worm. J. Exp. Biol ., 200:883–896. 17. Handelsmann, J. (2004). Metagenomics: Application of Genomics to Uncultured Microorganisms. Microbiology and Molecular Biology Reviews, 68: 669–685. 18. Hartman F., Harpel M. (1994). Stru cture, function, regulation and assembly of D-ribulose-1,5-bisphosphat e carboxylase/oxygenase. Annual Review of Biochemistry, 63:197–234. 19. Heinhorst S., Williams E., Fei Cai Murin D., Shively, J., and Cannon, G. (2006). Characterization of the Carboxysomal Carbonic Anhydrase CsoSCA from Halothiobacillus neapolitanus Journal of Bacteriology 188: 8087-8094. 20. Hessler, R., Smithey, W., Boudrias., Ke ller, C., Lutz, R., Childress, J. (1988). Temporal change in megafauna at the Rose Garden hydrothermal vent (Galapagos Rift; ea stern tropical Pacific). Deep-Sea Research, 35: 1681-1709 21. Jannasch HW, Wirsen CO (1979) Ch emosynthetic primary production at East Pacific sea floor spread ing centers. BioSci. 29: 592-598. 22. Jannasch, H., Wirsen, C., Nelson, D., and Robertson, L. (1985). Thiomicrospira crunogena sp. nov., a colorless, sulfur-oxidizing bacterium from a deep-sea hydrothermal vent. Int. J. Syst. Bacteriol. 35: 422-424. 23. Johnson, K., Childress, J., Hessler, R., Sakamoto-Arnold, C., and Beehler, C. (1988). Chemical and biological in teractions in the Rose Garden hydrothermal vent field, Glapagos sp reading center. Deep-Sea Research, 35: 1723-1744. 24. Kaplan A., Reinhold L. (1999) CO2 concentrating mechanisms in photosynthetic microorganisms. Annu Rev Plant Physiol Plant Mol Biol 50: 539–570. 25. Kaplan, A., Schwarz, R., Lieman -Hurwitz, J., Ronen-Tarazi, M., Reinhold, L. (1994) Physiological an d molecular studies on the response of cyanobacteria to changes in the ambient inorganic carbon concentration, p. 469-485. In D. A. Bryant (ed.), The Molecular Biology of Cyanobacteria Kluwer Academic Pub lishers, The Netherlands.


81 26. Kelly, D.P., and Wood, A.P. (2001). The chemolithotrophic prokaryotes. URL 27. Livak, K., Schmittgen, T., (2001) Analysis of relative gene expression data using real-time qua ntitative PCR and the 2CT method. Methods, 25: 402-408. 28. Maeda, S, Badger, M., Price, G. ( 2002). Novel gene products associated with NdhD3/D4-containing NDH-1 complexes are involved in photosynthetic CO2 hydration in the cyanobacterium Synechococcus sp. PCC7942. Molecular Microbiology, 43: 425-435. 29. Maeda, S., Price, G., Badger M., Enomoto C., Omata T. (2000). Bicarbonate binding activity of the cm pA protein of the cyanobacterium Synechococcus PCC7942 is involved in act ive transport of bicarbonate. Journal of Biological Chemistry, 275: 20551-20555. 30. Michard, G., Albarde, F., Michard, A ., Minster, J., Charlou, J., Tan, N. (1984) Chemistry of solutions fr om the 13N East Pacific Rise hydrothermal site, Earth Planet. Sci. Lett ., 67: 297-307. 31. Moroney J., Bartlett S., Samuelsson G. (2001) Carbonic anhydrases in plants and algae. Plant Cell Environ 24: 141–153. 32. Omata, T., Price, G., Badger M., Okamura, M., Gohta, S., Ogawa, T. (1999). Identification of an ATP-bindi ng cassette transporter involved in bicarbonate uptake in the cyanobacterium Synechococcus sp. strain PCC7942. Proceedings of the National Academy of Sciences 96: 1357113576. 33. Portis, A. Jr. (1992). Regulati on of ribulose 1,5-bisphosphate carboxylase/oxygenase activity. Annual Review of Plant Physiology, 43:415–437. 34. Price G., Badger M. (1989). Expres sion of human carbonic anhydrase in the cyanobacterium Synechococcus PCC7942 creates a high CO2requiring phenotype. Evidence for a cen tral role for carboxysomes in the CO2 concentrating mechanism. Plant Physiology, 91: 505-513. 35. Price G., Coleman J., Badger, M. (1992). Association of carbonic anhydrase activity with carboxysomes isolated from the cyanobacterium Synechococcus PCC7942. Plant Physiology 100: 784 -793. 36. Price, G., Maeda S-I, Omata T., Ba dger M. (2002). Modes of inorganic carbon uptake in the cyanobacterium Synechococcus sp. PCC7942. Functional Plant Biology 29: 131-149. 37. Price, G., SuEltemeyer, D., Klughammer, B., Ludwig, M., Badger, M. (1998). The functioning of the CO2 concentrating mechanism in several cyanobacterial strains: a review of general physiol ogical characteristics, genes, proteins and recent advances. Canadian Journal of Botany 76: 973-1002. 38. Price, G., Woodger, F., Badger, M ., Howitt, S., Tucker, L., (2004). Identification of a SulP-type bica rbonate transporter in marine cyanobacteria. Proceedings of the National Academy of Sciences, 101: 18228–18233.


82 39. Ruby E., Wirsen C., Jannasch H. (1981). Chemolithotrophic sulfuroxidizing bacteria from the Gala pagos Rift hydrothermal vents. Appl Environ Microbiol 42: 317–324. 40. Ruby E., Jannasch H. (1982). Phys iological characteristics of Thiomicrospira sp. strain L-12 isolated from deep-sea hydrothermal vents. J Bacteriol 149: 161–165. 41. Schneider G., Lindqvist Y., Lundqvi st T. (1990). Crystallographic refinement and structure of ribulos e-1,5-bisphosphate carboxylase from Rhodospirillum rubrum at 1.7 A resolution. Journal of Molecular Biology, 211:989–1008 42. Shibata, M., Ohkawa, H., Kaneko, T., Fukuzawa, H., Tabata, S., Kaplan, A., Ogawa, T. (2001). Distin ct constitutive and low-CO2induced CO2 uptake systems in cyanobacteria: ge nes involved and their phylogenetic relationship with homologous genes in other organisms. Proceedings of the National Academy of Sciences 98: 11789-11794. 43. Shively, J., Bradburne, C., Aldrich, H ., Bobick, T., Mehlman, J., Jin, S., Baker S. (1998). Sequence homologue s of the carboxysomal polypeptide CsoS1 of the thiobacilli are present in cyanobacter ia and enteric bacteria that form carboxysomes-polyhedral bodies. Canadian Journal of Botany, 76: 906-916. 44. Shively, J., Vankeulen, G., Meijer, W. (1998). Something from almost nothing-carbon dioxide oxa tion in chemoautotrophs. Annual Review of Microbiology 52: 191-230. 45. Smith K., Ferry J. (2000) Proka ryotic carbonic anhydrases. FEMS Microbiol Rev 24: 335–366. 46. Wirsen, C., Brinkhoff, T., Kuever, J., Muyzer, G., Molyneaux, S., Jannasch, H. (1998). Comparison of a ne w Thiomicrospira strain from the Mid-Atlantic Ridge with known hydrothermal vent isolates. Applied and Environmental Microbiology 64:4057-4059. 47. Yoshizawa Y, Toyoda K, Arai H, Ishii M, Igarashi Y. (2004) CO2responsive expression and gene or ganization of three ribulose-1,5bisphosphate carboxylase/oxygenase enzymes and carboxysomes in Hydrogenovibrio marinus strain MH-110. J Bacteriol, 186:5685–5691.


83 Chapter 5 Overall conclusions It is clear that T. crunogena has a CCM. It is able to grow under extremely low-DIC conditions and change s its whole-cell affinity for DIC in response to the DIC concentration ava ilable during growth (Chapter 2; 8). Extracellular HCO3 and CO2 can both be taken up and fixed by intact T. crunogena cells (Chapter 2; 8). T. crunogena is capable of generating an intracellular DIC concentration 100X its ex tracellular concentration when grown under low-DIC conditions and the ability to generate increased intracellular DIC concentration is energy depe ndent (Chapter 2; 8). Genomic analysis of T. crunogena uncovered some CCM components similar to those that been found in cy anobacteria (appendix). This includes a carboxysome operon which contains genes fo r shell proteins, RubisCO, and CA. However, some CCM components were not apparent from genome analysis; HCO3 transporters orthologous to those pres ent in cyanobacteria are absent. Three CA genes from the genome were examined to determine whether they play a role in the CCM. The -CA is unlikely to play a role as it is equally transcribed under lowand high-DIC condi tions. Functional studi es indicate that inhibition with AZA does not affect DIC uptake and fixation. Therefore, it is unlikely that -CA is fulfilling a role in DIC uptake and fixation (Chapter 3). -


84 CA is also unlikely to play a role in the CCM as it is equally transcribed under low-and high-DIC conditions. Even though the CA gene is found in the form II RubisCO operon (appendix), there does not appear to be significant increased transcription levels for high-DIC gr owth conditions as demonstrated by microarray and confirmed by qRT PCR (Chapt er 3). CsoSCA does play a role in carbon fixation and is transcribed more frequently under low-DIC conditions. Inhibition by EZA results in inhibition of DIC fixation, but not uptake, which is consistent with its role in carboxysomes in assisting CO2 fixation by RubisCO (Chapter 4). Microarrays were used to scan the whole genome for genes transcribed more frequently under low-DIC conditi ons and possibly elucidate the genes responsible for active bicarbonate transpor t. As was expected, the genes in the carboxysome operon were tran scribed more frequently under low-DIC conditions. Genes encoding two conserve d hypothetical proteins ( Tcr_1019 and Tcr_1315 ) were also found to be transcribed mo re frequently under low-DIC conditions Under high-DIC, low NH4 + conditions, the non-carboxysomal form I RubisCO and form II RubisCO genes were transcri bed more frequently. Genes encoding two conserved hypothe tical proteins ( Tcr_0466 and Tcr_2018 ) also appeared to be transcribed more freque ntly under these conditions. Autotrophic microorganisms are found in many phyla. In the Bacteria, they are found in the Cyanobacteria, Prot eobacteria, Firmicutes, Planctomycetes, Green Sulfur Bacteria, Green Nonsulfu r Bacteria, and others. Among Archaea, they are present in both the Crenarchaeota as well as the Euryarchaeota. Based on


85 extensive physiological and geneti c characterization, CCM components (transporters, carboxysomes) can be found encoded in genomes of cyanobacteria. However, CCMs have not been studied in the other phyla. As a result, carboxysomes are the only CCM compone nts that can be found in these noncyanobacterial organisms using genom e data. Finding the CCM genes in T. crunogena will facilitate the discovery of CCM genes in noncyanobacterial autotrophs. This will substantially enhance the understanding of the ecophysiology of carbon fixation and evolut ion of mechanisms to cope with periodic or chronic scarcity of dissolved inorganic carbon. Referemces 1. Badger, M., Bek, E., (2008). Multiple Rubisco forms in proteobacteria: their functional significance in relation to CO2 acquisition by the CBB cycle. Journal of Experimental Botany 59: 1525-1541. 2. Badger M., Price G. (1994) Th e role of carbonic anhydrase in photosynthesis. Annu Rev Plant Phys iol Plant Mol Biol 45: 369–392. 3. Badger M, Hanson D, Price GD (2002) Evolution and diversity of CO2 concentrating mechanisms in cyanobacteria. Funct Plant Biol 29: 161– 173. 4. Brinkhoff,, T., Sievert, S.M., Kuev er, J., and Muyzer, G. (1999) Distribution and diversit y of sulfur-oxidizing Thiomicrospira spp. at a shallow-water hydrothermal vent in the Aegean Sea (Milos, Greece). Appl. Environ. Microbiol 65: 3843-3849. 5. Brocks, J. J., G. A. Logan, R. Bu ick, and R. E. Summons. 1999. Archean molecular fossils and the ear ly rise of eukaryotes. Science, 285:1033– 1036. 6. Cannon, G., Bradburne, C., Al drich, H., Baker, S., Heinhorst, S., Shively, J. (2001) Microcompartments in Pr okaryotes: Carboxysomes and Related Polyhedra. Appl. Environ. Microbiol 67: 5351–5361. 7. Cleland W., Andrews J., Gutteridge S., Hartman F., Lorimer G.. (1998). Mechanism of Rubisco: the carbamate as general base. Chemical Reviews 98:549–561. 8. Dobrinski, K., Longo, D., Scott, K. (2005) The Carbon-Concentrating Mechanism of the Hydrothermal Vent Chemolithoautotroph Thiomicrospira crunogena. J ournal of Bacteriology, 187 : 5761–5766.


86 9. Dubbs, P., Dubbs, J., Tabita, F. (20 04) Effector-Mediated Interaction of CbbRI and CbbRII regulators with target Sequences in Rhodobacter capsulatus. Journal of Bacteriology, 186: 8026–8035. 10. Edwards, K., Bond, P., Gihring, T ., Banfield, J. An Archaeal ironoxidizing extreme acidophile importa nt in acid mine drainage. Science, 287: 1796-1799. 11. Foti, M., Sorokin, D., Zacharova, E. Pimenov, N., Kuenen, J., Muyzer, G. (2008) Bacterial diversity and activ ity along a salinity gradient in soda lakes of the Kulunda St eppe (Altai, Russia). Extremophiles, 12:133–145. 12. Goffredi, S., Childress, J., Desaulnier s, N., Lee, R., Lallier, F., Hammond, D ( 1997). Inorganic carbon acquisition by the hydrothermal vent tubeworm Riftia pachyptila depends upon high external P-CO2 and upon proton-equivalent ion transport by the worm. J. Exp. Biol ., 200:883–896. 13. Heinhorst S., Williams E., Fei Cai Murin D., Shively, J., and Cannon, G. (2006). Characterization of the Carboxysomal Carbonic Anhydrase CsoSCA from Halothiobacillus neapolitanus Journal of Bacteriology 188: 8087-8094. 14. Jannasch HW, Wirsen CO (1979) Ch emosynthetic primary production at East Pacific sea floor spread ing centers. BioSci. 29: 592-598. 15. Jannasch, H., Wirsen, C., Nelson, D., and Robertson, L. (1985). Thiomicrospira crunogena sp. nov., a colorless, sulfur-oxidizing bacterium from a deep-sea hydrothermal vent. Int. J. Syst. Bacteriol. 35: 422-424. 16. Johnson, K., Childress, J., Hessler, R., Sakamoto-Arnold, C., and Beehler, C. (1988). Chemical and biological in teractions in the Rose Garden hydrothermal vent field, Glapagos sp reading center. Deep-Sea Research, 35: 1723-1744. 17. Kaplan A., Reinhold L. (1999) CO2 concentrating mechanisms in photosynthetic microorganisms. Annu Rev Plant Physiol Plant Mol Biol 50: 539–570. 18. Lapointe, M., Mackenzie, T., and Morse D. (2008). An External Carbonic Anhydrase in a Free-Liv in g Marine D in oflagellate May Circumvent Diffusion-Lim ited Carbon Acquisition. Plant Physiology 147:1427-1436. 19. Maeda, S, Badger, M., Price, G. ( 2002). Novel gene products associated with NdhD3/D4-containing NDH-1 complexes are involved in photosynthetic CO2 hydration in the cyanobacterium Synechococcus sp. PCC7942. Molecular Microbiology, 43: 425-435. 20. Maeda, S., Price, G., Badger M., Enomoto C., Omata T. (2000). Bicarbonate binding activity of the cm pA protein of the cyanobacterium Synechococcus PCC7942 is involved in act ive transport of bicarbonate. Journal of Biological Chemistry, 275: 20551-20555. 21. Moroney J., Bartlett S., Samuelsson G. (2001) Carbonic anhydrases in plants and algae. Plant Cell Environ 24: 141–153. 22. Muyzer, G., Teske, A., Wirsen, C., and Jannasch, H. (1995). Phylogenetic relationships of Thiomicrospira species and their iden tification in deep-sea


87 hydrothermal vent samples by denaturi ng gradient gel electrophoresis of 16S rDNA fragments. Archives of Micr obiology 164: 165-172. 23. Identification of an ATP-binding cassette transporter involved in bicarbonate uptake in the cyanobacterium Synechococcus sp. strain PCC7942. Proceedings of the National Academy of Sciences 96: 1357113576. 24. Portis, A. Jr. (1992). Regulati on of ribulose 1,5-bisphosphate carboxylase/oxygenase activity. Annual Review of Plant Physiology, 43:415–437. 25. Price G., Badger M. (1989). Expres sion of human carbonic anhydrase in the cyanobacterium Synechococcus PCC7942 creates a high CO2requiring phenotype. Evidence for a cen tral role for carboxysomes in the CO2 concentrating mechanism. Plant Physiology, 91: 505-513. 26. Price G., Coleman J., Badger, M. (1992). Association of carbonic anhydrase activity with carboxysomes isolated from the cyanobacterium Synechococcus PCC7942. Plant Physiology 100: 784 -793. 27. Price, G., Maeda S-I, Omata T., Ba dger M. (2002). Modes of inorganic carbon uptake in the cyanobacterium Synechococcus sp. PCC7942. Functional Plant Biology 29: 131-149. 28. Price, G., SuEltemeyer, D., Klughammer, B., Ludwig, M., Badger, M. (1998). The functioning of the CO2 concentrating mechanism in several cyanobacterial strains: a review of general physiol ogical characteristics, genes, proteins and recent advances. Canadian Journal of Botany 76: 973-1002. 29. Price, G., Woodger, F., Badger, M ., Howitt, S., Tucker, L., (2004). Identification of a SulP-type bica rbonate transporter in marine cyanobacteria. Proceedings of the National Academy of Sciences, 101: 18228–18233. 30. Raven, J. A. 1991. Implications of i norganic carbon util ization: ecology, evolution, and geochemistry. Can. J. Bot 69:908–923. 31. Ruby E., Wirsen C., Jannasch H. (1981). Chemolithotrophic sulfuroxidizing bacteria from the Gala pagos Rift hydrothermal vents. Appl Environ Microbiol 42: 317–324. 32. Ruby E., Jannasch H. (1982). Phys iological characteristics of Thiomicrospira sp. strain L-12 isolated from deep-sea hydrothermal vents. J Bacteriol 149: 161–165. 33. Rye, R., Kuo, P., Holland, H. (1995). Atmospheric carbon dioxide concentrations before 2.2 billion years ago. Nature 378: 603-605. 34. Schneider G., Lindqvist Y., Lundqvi st T. (1990). Crystallographic refinement and structure of ribulos e-1,5-bisphosphate carboxylase from Rhodospirillum rubrum at 1.7 A resolution. Journal of Molecular Biology, 211:989–1008 35. Scott K., Bright M., Fisher C. (1998) The burden of independence: Inorganic carbon utilization strategies of the sulphur chemoautotrophic hydrothermal vent isolate Thiomicrospira crunogena and the symbionts of

PAGE 100

88 hydrothermal vent and cold seep vestimentiferans. Cah Biol Mar 39: 379– 381. 36. Shibata, M., Ohkawa, H., Kaneko, T., Fukuzawa, H., Tabata, S., Kaplan, A., Ogawa, T. (2001). Distin ct constitutive and low-CO2induced CO2 uptake systems in cyanobacteria: ge nes involved and their phylogenetic relationship with homologous genes in other organisms. Proceedings of the National Academy of Sciences 98: 11789-11794. 37. Shively, J., Bradburne, C., Aldrich, H ., Bobick, T., Mehlman, J., Jin, S., Baker S. (1998). Sequence homologue s of the carboxysomal polypeptide CsoS1 of the thiobacilli are present in cyanobacter ia and enteric bacteria that form carboxysomes-polyhedral bodi es. Canadian Journal of Botany, 76: 906-916. 38. Shively, J., Vankeulen, G., Meijer, W. (1998). Something from almost nothing-carbon dioxide oxation in ch emoautotrophs. Annual Review of Microbiology, 52: 191-230.Smith KS Ferry JG (2000) Prokaryotic carbonic anhydrases. FEMS Microbiol Rev 24: 335–366. 39. Spreitzer R. (1999) Questions abou t the complexity of chloroplast ribulose-1, 5-bisphosphate carboxy lase/oxygenase. Photosynthesis Research, 60:29–42. 40. Spreitzer R., Salvucci M. (2002) Rubisco: structure, regulatory interactions, and possibilities for a better enzyme. Annual Review of Plant Biology, 53:449–475. 41. Tabita, F., Satagopan, S., Hanson, T., Kreel N., Scott, S. (2008). Distinct form I, II, III, and IV Rubisco prot eins from the three kingdoms of life provide clues about Rubisco evol ution and structure/function relationships. Journal of Experi mental Botany, 59: 1515-1524. 42. Tabita F. (1999) Microbia l ribulose 1,5-bisphosphate carboxylase/oxygenase: a different perspe ctive. Photosynthesis Research, 60:1–28. 43. Tortell, P. 2000. Evolutionary a nd ecological perspectives on carbon acquisition in phytoplankt on. Limnol. Oceanogr. 45:744–750. 44. Wirsen, C., Brinkhoff, T., Kuever, J., Muyzer, G., Molyneaux, S., Jannasch, H. (1998). Comparison of a ne w Thiomicrospira strain from the Mid-Atlantic Ridge with known hydrothe rmal vent isolates. Applied and Environmental Microbiology, 64:4057-4059. 45. Wharton, D., (2002). Life at the limits: Organisms in extreme environments. Cambridge University Press: UK. 46. Yoshizawa Y, Toyoda K, Arai H, Ishii M, Igarashi Y. (2004) CO2responsive expression and gene or ganization of three ribulose-1,5bisphosphate carboxylase/oxygenase enzymes and carboxysomes in Hydrogenovibrio marinus strain MH-110. J Bacteriol,186:5685–5691. 47. Zimmerman, S., Ferry, J., Supuran, C. (2007) Inhibition of the Archaeal class (Cab) and -class (Cam) carbonic anhydr ases. Current Topics in Medicinal Chemistry, 7: 901-908. 48.

PAGE 101

89 Appendix A The Genome of Deep Sea Vent Chemolithoautotoph Thiomicrospira crunogena XCL-2

PAGE 102

Appendix A continued 90 The Genome of Deep-Sea Vent Chemolithoautotroph Thiomicrospira crunogena XCL-2 Running head: T. crunogena genome Kathleen M. Scott*1, Stefan M. Sievert2, Fereniki N. Abril1, Lois A. Ball1, Chantell J. Barrett1, Rodrigo A. Blake1, Amanda J. Boller1, Patrick S. G. Chain3,4, Justine A. Clark1, Carisa R. Davis1, Chris Detter4, Kimberly F. Do1, Kimberly P. Dobrinski1, Brandon I. Faza1, Kelly A. Fitzpatrick1, Sharyn K. Freyermuth5, Tara L. Harmer6, Loren J. Hauser7, Michael Hgler2, Cheryl A. Kerfeld8, Martin G. Klotz9, William W. Kong1, Miriam Land7, Alla Lapidus4, Frank W. Larimer7, Dana L. Longo1, Susan Lucas4, Stephanie A. Malfatti3,4, Steven E. Massey1, Darlene D. Martin1, Zoe McCuddin10, Folker Meyer11, Jessica L. Moore1, Luis H. Ocampo Jr.1, John H. Paul12, Ian T. Paulsen13, Douglas K. Reep1, Qinghu Ren13, Rachel L. Ross1, Priscila Y. Sato1, Phaedra Thomas1, Lance E. Tinkham1, and Gary T. Zeruth1 Biology Department, University of South Florida, Tampa, Florida USA1; Biology Department, Woods Hole Oceanographic Institution, Woods Hole, Massachusetts USA2; Lawrence Livermore National Laboratory, Livermore, California USA3; Joint Genome Institute, Walnut Creek, California USA4; Department of Biochemistry, University of Missouri, Columbia, Missouri USA5; Division of Natural Sciences and Mathematics, The Richard Stockton College of New Jersey, Pomona, New Jersey USA6; Oak Ridge National Laboratory, Oak Ridge, Tennessee USA7; Molecular Biology Institute, University of California, Los Angeles, California USA8; University of Louisville, Louisville USA9; The Monsanto Company, Ankeny, IA USA10; Center for Biotechnology, Bielefeld University, Germany11; College of Marine Science, Univ ersity of South Florida, St. Petersburg, Florida USA12; The Institute for Genomic Research, Rockville, Maryland USA13 *Corresponding author. Mailing address: 4202 East Fowler Avenue; SCA 110; Tampa, FL 33620. Phone: (813)974-5173. Fax: (813)974-3263. E-mail:

PAGE 103

Appendix A continued 91 This appendix has been published as Scott, K., Sievert, S., Abril, F., Ball, L., Barrett, C., Blake, R., Boller, A., Chain, P., Clark, J., Davis, C., Detter, C., Do, K., Dobrinski, K., Faza, B., Fitzpatrick, K., Freyermuth, S., Harmer, T., Hauser, L., Hgler, M., Kerfeld, C., Klotz, M., Kong, W., Land, M., Lapidus, A., Larimer, F., Longo, D., Lucas, S., Malfatti, S., Massey, S., Martin, D., McCuddin, Z., Meyer, F., Moore, J., Ocampo Jr., L., Pa ul, J., Paulsen, I., Reep, D., Ren, Q., Ross, R., Sato, P., Thomas, P., Tinkham, L., and G. Zeruth1 (2006). The genome of deep-sea vent chemolithoautotroph Thiomicrospira crunogena XCL-2. PLOS Biology 4: 2196-2212.

PAGE 104

Appendix A continued 92 (Summary) Presented here is the complete genome sequence of Thiomicrospira crunogena XCL-2, representative of ubiquitous chemolithoautotrophic sulfur-oxidizi ng bacteria isolated from deepsea hydrothermal vents. This gamma proteobacterium has a single chromosome (2,427,734 bp), and its genome illustrates many of the adaptations that have enabled it to thrive at vents globally. It has 14 methyl-accepting chemotaxis protein genes, including four that may assist in positioning it in the re doxcline. A relative abundance of CDSs encoding regulatory proteins likely control the expression of genes encoding carboxysomes, mu ltiple dissolved inorganic nitrogen and phosphate transporters, as well as a phosphonate operon, which provide this species with a variety of options for acquiring these substrates from the environment. T. crunogena XCL-2 is unusual among obligate sulfur oxidizing bacteria in relying on the Sox system for the oxidation of reduced sulfur compounds. The genome has characteristics consistent with an obligately chemolithoautotrophic lifestyle, incl uding few transporters predicted to have organic allocrits, and Calvin-Benson-Bassham cycle CDSs scattered throughout the genome.

PAGE 105

Appendix A continued 93 Introduction Deep-sea hydrothermal vent commun ities are sustained by prokaryotic chemolithoautotrophic primary producer s that use the oxi dation of electron donors available in hydrothermal fluid (H2, H2S, Fe+2) to fuel carbon fixation [1,2,3]. The chemical and physical char acteristics of thei r environment are dictated largely by the inte raction of hydrothermal fluid and bottom water. When warm, reductantand CO2-rich hydrothermal fluid is emitted from fissures in the basalt crust, it creates eddies as it mi xes with cold, oxic bottom water. As a consequence, at areas where dilute hy drothermal fluid and seawater mix, a microorganism’s habitat is erratic, os cillating from seconds to hours between dominance by hydrothermal fluid (warm; anoxic; abundant electron donors; 0.02 to > 1mM CO2) and bottom water (2 C; oxic; 0.02 mM CO2) [4,5]. Common chemolithoautotrophic isolates from these “mixing zones” from hydrothermal vents include members of the genus Thiomicrospira a group which originally included all marine, spir al-shaped sulfur oxidizing bacteria. Subsequent analyses of 16S rDNA seque nces have revealed the polyphyletic nature of this group; members of Thiomicrospira are distributed among the gamma and epsilon classes of the Proteobacteria. T.crunogena a member of the cluster of Thiomicrospiras in the gamma class, was originally isolated from the East Pacific Rise [6 ]. Subsequently, T. crunogena strains were cultivated or detected with molecular methods from deep-sea vents in both the Pacific and Atlantic, indicating a global distributi on for this phylotype [7]. Molecular methods in combination with cultivat ion further confirmed the ecological importance of Tms. crunogena and closely related species at deep-sea and shallow-water hydrotherm al vents [8,9]. To provide the energy necessary for ca rbon fixation and cell maintenance, T. crunogena XCL-2 and its close relatives Tms. spp. L-12 and MA-3 are capable of using hydrogen sulfide, th iosulfate, elemental sulfur and sulfide minerals (e.g., pyrite, chalcopyrite) as el ectron donors; the only electron acceptor they can use is oxygen [6,10,11,12]. Given its temporally variable habitat, T. crunogena XCL-2 is likely adapted to cope with oscillations in th e availability of the inorganic nutrients necessary for chemolithoautotrophic growt h. One critical adaptation in this habitat is its carbon concentr ating mechanism [13,14]. Th is species is capable of rapid growth in the presence of low con centrations of dissolved inorganic carbon, due to an increase in cellular affinity for both HCO3 and CO2 under low CO2 conditions [14]. The ability to grow under low CO2 conditions is likely an advantage when the habitat is dominated by relatively low CO2 seawater. Further adaptations in nutrient acquisition and microhabitat sensing are likely to be present in this organism. T. crunogena XCL-2 [15] is the first deep -sea autotrophic hydrothermal vent bacterium to have its genome comp letely sequenced and annotated. Many other autotrophic bacterial genomes have been examined previously, including several species of cyanob acteria (e.g., [16,17], nitrif iers [18], purple nonsulfur

PAGE 106

Appendix A continued 94 [19] and green sulfur [20] photosynthetic bacteria, as well as an obligately chemolithoautotrophic sulfur-oxidizer [ 21] and a hydrogen-oxidizer [22]. These genomes have provided insight into the e volution of autotrophy among four of the seven phyla of Bacteria known to have autotrophic members. The genome of T. crunogena XCL-2 was sequenced to illuminate the evolution and physiology of bacterial pr imary producers from hydrothermal vents and other extreme environments. It was of interest to determine whether any specific adaptations to thrive in an envi ronment with extreme temporal and spatial gradients in habitat geochemistry would be apparent from the genome. It was predicted that comparing its genome both to the other members of the gammaproteobacteria, many of which are pathogenic heterotr ophs, and also to autotrophs from the Proteobacteria and ot her phyla, would provide insights into the evolution and physiology of autotrophs within the Gammaproteobacteria. Further, this genome provides a refe rence point for uncultivated (to date) chemoautotrophic sulfur-oxidizing gammapr oteobacterial symbionts of various invertebrates. Results/Discussion Genome structure T. crunogena XCL-2 has a single chromosome consisting of 2.43 Mbp, with a GC content of 43.1% and a high coding density (90.6 %; Figure 1). The GC skew shifts near the ge ne encoding the DnaA protein (located at ‘noon’ on the circular map; Tcr0001 ), and thus the origin of rep lication is likely located nearby. One region with a deviation from th e average %GC contains a phosphonate operon and has several other features consis tent with its acquisition via horizontal gene transfer (see ‘Phosphor us Uptake’ below). Many genes could be assigned a function with a high degree of confidence (Table 1), and a model for cell function based on these genes is presented (Figure 2). TABLE 1. Thiomicrospira crunogena XCL-2 genome summary Item Value Chromosomes 1 Basepairs 2,427,734 GC content (%) 43.1 % coding 90.6 RNA-encoding genes tRNAs 43 16S-Ile tRNAGAT-Ala tRNATGC-23S-5S RNA operons 3 Genes in each COG category DNA replication, recombination, and repair 113 Transcription 84 Translation, ribosomal structure and biogenesis 153 Posttranslational modificat ion, protein turnover, chaperones 115

PAGE 107

Appendix A continued 95 Energy production and conversion 117 Carbohydrate transport and metabolism 79 Amino acid transport and metabolism 167 Nucleotide transport and metabolism 50 Lipid transport and metabolism 39 Coenzyme transport and metabolism 102 Secondary metabolite bios ynthesis, transport, catabolism 37 Cell wall/membrane/envelope biogenesis 142 Inorganic ion transport and metabolism 120 Cell motility 79 Signal transduction mechanisms 147 Cell cycle control, cell division, chromosome partitioning 18 Intracellular trafficking, secretion, a nd vesicular transport 65 General function 188

PAGE 108

Appendix A continued 96 Three rRNA operons are present, an d two of them, including their intergenic regions, are 100% identical. In the third rRNA operon, the 16S and 5S genes are 100% identical to the othe r two, but the 23S gene has a single substitution. The intergenic regions of this third operon also has several substitutions compared to the other tw o, with three subst itutions between the tRNA-Ile-GAT and tRNA-Ala-TGC genes, six substitutions between the tRNAAla-TGC and 23S genes, and one substitution between the 23S and 5S genes. Having three rRNA operons may provide addi tional flexibility for rapid shifts in translation activity in response to a stocha stic environment, and may contribute to this speciesÂ’ rapid doubling times [6]. Fourty-three tRNA genes were identified by tRNA-scan SE [23] and Search For RNAs. An additional region of the chromosome was identified by Search Fo r RNAs, the 3Â’ end of which is 57% identical with the sequence of the tR NA-Asn-GTT gene, but has a 47 nucleotide extension of the 5Â’ end, and is a likely tRNA pseudogene. Figure 1. Circular map of the Thiomicrospira crunogena XCL-2 genome. The outer two rings are protein-encoding genes, which are color-coded according to COG category. Rings 3 and 4 are tRNA and rRNA genes. Ring 5 indicates the location of a prophage (magenta), phosphonate/heavy metal resistance island (cyan), and four insertion sequences (red; two insertion sequences at 2028543 and 2035034 are superimposed on this figure). The black circle indicates the deviation from the average %G C, and the purple and green circle is the GC

PAGE 109

Appendix A continued 97 skew (= [G-C]/[G+C]). Both the %GC and GC sk ew were calculated using a sliding window of 10,000 bp with a window step of 100. Prophage A putative prophage genome was noted in the T. crunogea chromosome. The putative prophage is 38,090 bp and cont ains 54 CDSs, 21 of which (38.9%) had significant similarity to genes in GenBank. The prophage genome begins with a tyrosine integrase ( Tcr0656 ), and contains a cIlike repressor gene ( Tcr0666 ), features common to lambdoid prophages (Fig ure 3; [24]). These genes define a probable “lysogeny module” [25] and are in the opposite orientation from the rest of the phage genes (the replic ative or “lytic module”). The lytic half of the prophage genome encodes putative genes involved in DNA replication and phage assembly (F igure 3). Beginning with a putative DNA primase ( Tcr0668 ) is a cluster of genes interpre ted to represent an active or remnant DNA replication module (includi ng an exonuclease of DNA polymerase, a hypothetical DNA binding protein, and a terminase large subunit; Tcr0669, 0670, 0672 ). Terminases serve to cut the phage DNA in genome sized fragments prior to packaging. Beyond this are ei ght CDSs of unknown function, and then two CDSs involved in capsid assemb ly, including the portal protein ( Tcr0679 ) and a minor capsid protein ( Tcr0680 ) similar to GPC of Portal proteins are ring-like structures in phage capsids through which the DNA enters the capsid during packaging [26]. In the GPC protein is a peptidase (S49 family) that cleaves the capsid protein from a scaffo lding protein involved in the capsid assembly process [27]. Although no major capsid protein is identifiable from bioinformatics, capsid proteins are of ten difficult to identify from sequence information in marine phages [28]. A cluste r of P2-like putative tail assembly and structural genes follows the capsid assemb ly genes. The general organization of these genes (tail fiber, tail shaf t and sheath, and tape measure; Tcr0691; Tcr0690; Tcr0695; Tcr0698 ) is also P2-like [24]. The co mplexity of these genes (10 putative CDSs involved in tail assembly ) and the strong identity score for a contractile tail sheath protei n strongly argues that this prophage was a member of the Myoviridae ie. phages possessing a contractil e tail. The final gene in the prophage-like sequence was similar to a phage late control protein D, gpD ( Tcr0700 ). In gpD plays a role in the expansio n of the capsid to accommodate the entire phage genome [29].

PAGE 110

Appendix A continued 98 Figure 2. Cell model for Thiomicrospira crunogena XCL-2 with an emphasis on ultrastructure, transport, energy, carbon metabolism, and chemotaxis. Genes encoding virtually all of the steps for the synthesis of nucleotides and amino acid s by canonical pathways are present, and are omitted here for simplicity. Electron transport components are yellow, and abbreviations are: NDH—NADH dehydrogenase; UQ—ubiquinone; bc1—bc1 complex; Sox—Sox system; cytC— cytochrome C; cbb3—cbb3-type cytochrome C oxidase. Me thyl-accepting chemotaxis proteins (MCP) are fuchsia, as are MCP’s with PAS domains or PAS folds. Influx and efflux transporter families with representatives in this genome are indicated on the figure, with the number of each type of transporter in parentheses. ATP-dependent transporters are red, secondary transporters are sky blue, ion channels are light green, and unclassified transporters are purple. Abbreviations for transporter families are as follows: ABC – AT P-binding cassette superfamily; AGCS—Alanine or glycine:cation symporter family; AMT—Ammonium transporter family; APC—amino acidpolyamine-organocation family; ATP syn—ATP synthetase; BASS—Bile acid:Na+ symporter family; BCCT—Betaine/carnitine/choline transporter family; CaCA—Ca2+:cation antiporter family; CDF—cation diffusion facilitator family ; CHR—Chromate ion transporter family; CPA— Monovalent cation:proton antiporter-1, -2, and -3 families; DAACS—Dicarboxylate/amino acid:cation symporter family; DASS—Divalent anion:Na+ symporter family; DMT— Drug/metabolite transporter superfamily; FeoB—Ferrous iron uptake family; IRT—Iron/lead transporter superfamily; MATE—mu ltidrug/oligosaccharidyl -lipid/polysaccharide (MOP) flippase superfamily, MATE family; McsS—Small conduct ance mechanosensitive ion channel family; MFS—Major facilitator superfamily; MgtE—Mg2+ transporter-E family ; MIT—CorA metal ion transporter family; NCS2—Nucleobase:cation symporter-2 family; NRAMP—Metal ion transporter family; NSS—Neurotransmitter:sodi um symporter family; P-ATP—P-type ATPase superfamily; Pit—Inorganic phosphate transporter family; PNaS—Phosphate:Na+ symporter family; PnuC—Nicotamide mononucleotide uptake permease family; RhtB—Resistance to homoserine/threonine family; RND—Resistance-nodulation-cell division superfamily; SSS— Solute:sodium symporter family; SulP—Sulfate permease family; TRAP—Tripartite ATPindependent periplasmic transporter family; TRK—K+ transporter family; VIC—Voltage-gated ion channel superfamily.

PAGE 111

Appendix A continued 99 The high similarity of the CDSs to lambdoid (lysogeny and replication genes) and P2-like (tail module) temp erate coliphages is surprising and unprecedented in marine prophage genomes [30]. A major frustration encountered in marine phage genomics is the low similarity of CDSs to anything in GenBank, making the interpretation of the biologi cal function extremely difficult. The lambdoid siphophages are generally members of the Siphoviridae whereas the P2like phages are Myoviridae which the T. crunogena XCL-2 prophage is predicted to be. Such a mixed heritage is often the result of the modular evolution of phages. The general genomic organization of the T. crunogena XCL-2 prophagelike element (integrase, repressor, DNA replicative genes, terminase, portal, capsid, tail genes) is common to seve ral known prophages, including those of Staphylococcus aureus (ie. Mu50B), Streptococcus pyogenes (prophages 370.3 and 370.2), and Streptococcus thermophilus (prophage O1205; [31]). Figure 3. Prophage genome within the Thiomicrospira crunogena XCL-2 genome. Lysogenic and lytic genes are delineated, as are predicted gene functions. Redox substrate metabolis m and electron transport Genes are present in this genome th at encode all of the components essential to assemble a fully functional Sox-system that performs sulfite-, thiosulfate-, sulfur-, and hydrogen-sulf ide dependent cyto chrome c reduction, namely, SoxXA ( Tcr0604, Tcr0601 ), SoxYZ ( Tcr0603, Tcr0602 ), SoxB ( Tcr1549 ), and SoxCD ( Tcr0156, Tcr0157 ) [32,33]. This well-characterized system for the oxidation of reduced sulfur compounds has been studied in facultatively chemolithoautotrophic, aerobic, thiosulfate-oxidizing alphaproteobacteria, including Paracococcus versutus GB17, Thiobacillus versutus, Starkeya novella and Pseudoaminobacter salicylatoxidans ([32,34] and references therein). This model involve s a periplasmic multienzyme complex that is capable of oxidizing various reduced su lfur compounds completely to sulfate. Genes encoding components of this co mplex have been identified, and it has further been shown that these so-called “ sox ” genes form extensive clusters in the genomes of the aforementione d bacteria. Essential components of the Sox-system have also been identified in genomes of other bacteria known to be able to use reduced sulfur compounds as electron donor s, resulting in the proposal that there might be a common mechanism for sulfur oxi dation utilized by different bacteria [32,34]. Interestingly, T. crunogena XCL-2 appears to be the first obligate

PAGE 112

Appendix A continued 100 chemolithoautotrophic sulfur-oxidizing b acterium to rely on the Sox system for oxidation of reduced sulfur compounds. Figure 4. Phylogenetic relationship of Thiomicrospira crunogena XCL-2 SoxB to sequences of selected bacteria Sequences were aligned usin g the program p ackage MacVector. Neighbor-joining and parsimony trees based on the predicted amino acid sequences were calculated using PAUP 4.0b10. Bootstrap values (1,000 replicates) are given for the neighborjoining (first value) and parsimony analyses (second value). Genome analyses also reveal the presence of a putat ive sulfide:quinone reductase gene ( Tcr1170 ; SQR). This enzyme is present in a number of phototrophic and chemotrophic bacteria and is best characterized from Rhodobacter capsulatus [35]. In this organism it is located on the periplasmic surface of the cytoplasmic membrane, wher e it catalyzes the ox idation of sulfide to elemental sulfur, leading to the depositi on of sulfur outside the cells. It seems reasonable to assume that SQR in T. crunogena XCL-2 performs a similar function, explaining the deposition of su lfur outside the cell under certain conditions (e.g., low pH or oxygen; [36]). The Sox system, on the other hand, is expected to result in the complete oxidati on of sulfide to sulfate. Switching to the production of elemental sulfur rather th an sulfate has the advantage that it prevents further acidification of the me dium, which ultimately would result in cell lysis. An interesting question in th is regard will be to determine how T. crunogena XCL-2 remobilizes the sulfur globules. The dependence on the Sox system, and possibly SQR, for sulfur oxidation differs markedly from the obligately autotrophic sulfuroxidizing betaproteobacterium Thiobacillus denitrificans which has a multitude of pathways for sulfur oxidation, perhaps facilitating this organismÂ’s ability to grow under aerobic and anaerobic conditions [21]. In contrast to the arrangement in f acultatively autotrophic sulfur-oxidizers [34], the sox components in T. crunogena XCL-2 are not organized in a single cluster, but in different parts of this genome: soxXYZA soxB and soxCD In particular, the isol ated location of soxB relative to other sox genes has not been observed in any other sulfur-oxidizing or ganisms. The components of the Sox

PAGE 113

Appendix A continued 101 system that form tight interactions in vivo are collocated in apparent operons (SoxXYZA, SoxCD; [37]), which is cons istent with the ‘molarity model’ for operon function (reviewed in [38]), in which cotranslation from a single mRNA facilitates interactions between tightly-interacting proteins, and perhaps correct folding. Perhaps for obligate chemolithotrophs like T. crunogena XCL-2 that do not have multiple sulfur oxidation systems, in which sox gene expression is presumably constitutive and not s ubject to complex regulation [39], sox gene organization into a single operon may not be strongly evolutionarily selected. Alternatively, the T. crunogena XCL-2 sox genes may not be constitutively expressed, and may instead f unction as a regulon. The confirmation of the presence of a soxB gene in T. crunogena XCL-2 is particularly interesting, as it is a depa rture from previous studies with close relatives. Attempts to PCR-amplify soxB from T. crunogena ATCC 700270 T and T. pelophila DSM 1534T were unsuccessful [40]. In contrast, a newly isolated Thiomicrospira strain obtained from a hydrotherm al vent in the North Fiji Basin, T. crunogena HY-62, was positive, with phylogen etic analyses further revealing that its soxB was most closely related those fr om alphaproteobacteria, such as Silicibacter pomeroyi [40]. The soxB gene from T. crunogena XCL-2 falls into a cluster containing the green-sulfur bacterium Chlorobium and the purple-sulfur gammaproteobacterium Allochromatium vinosum and separate from the cluster containing soxB from S. pomeroyi and T. crunogena HY-62 (Figure 4). This either indicates that T. crunogena XCL-2 has obtained its soxB gene through lateral gene transfer from different organisms, or that the originally described soxB gene in T. crunogena HY-62 was derived from a contaminant. The fact that both soxA and soxX from T. crunogena XCL-2 also group closely with their respective homologs from Chlorobium spp argues for the latter (data not shown). Also, the negative resu lt for the two other Thiomicrospira strains is difficult to explain in light of the observat ion that sulfur oxidation in T. crunogena XCL-2 appears to be dependent on a functiona l Sox system. It is possible that T. crunogena ATCC 700270 T and T. pelophila DSM 1543T also have soxB genes, but that the PCR primers did not targ et conserved regions of this gene. Up to this point, obligate chemolithoautotrophic sulfur oxidizers were believed to use a pathway different from the Sox system, i.e., the SI4 pathway [41] or a pathway that represents basical ly a reversal of dissimilatory sulfate reduction, by utilizing the enzymes dissim ilatory sulfite reduc tase, APS reductase, and ATP sulfurylase [42]. In this cont ext, it is interesting to note that T. crunogena also seems to lack enzymes for the assimilation of sulfate, i.e., ATP sulfurylase, APS kinase, PAPS reducta se, and a sirohaem-containing sulfite reductase, indicating that it depends on reduced sulfur compounds for both dissimilation and assimilation. T. crunogena XCL-2 apparently also lacks a sulfite:acceptor oxidoreductas e (SorAB), an enzyme e volutionarily related to SoxCD that catalyzes the dire ct oxidation of sulfite to su lfate and that has a wide distribution among different su lfur-oxidizing bacteria (Figure S1). The presence of the Sox system and the dependence on it in an obligate chemolithoautotroph also raises the question of the origin of the Sox system Possibly, this system first evolved in obligate autotrophs before it was transferred into facultative

PAGE 114

Appendix A continued 102 autotrophs. Alternatively, T. crunogena XCL-2 might have secondarily lost its capability to grow heterotrophically. Genes for Ni/Fe hydrogenase large and small subunits are present ( Tcr2037; Tcr2038 ), as well as all of the genes necessary for large subunit metal center assembly ( Tcr2035 6; Tcr2039 2043 ) [43]. Their presence and organization into an apparent operon suggest that T. crunogena XCL-2 could use H2 as an electron donor for grow th, as its close relative Hydrogenovibrio does [44,45]. However, attempts to cultivate T. crunogena with H2 as the sole electron donor have not been successful [46]. A requirement for reduced sulfur compounds, even when not used as the primary electron donor, is suggested by the absence of genes encoding the enzyme s necessary for assimilatory sulfate reduction (APS reductase; ATP sulfurylase) which are necessary for cysteine synthesis in the absence of environmental sources of thiosulfate or sulfide. Alternatively, this hydrogenase could act as a reductant si nk under periods of sulfur and oxygen scarcity, when starch de gradation could be utilized to replenish ATP and other metabolite pools (see “Cen tral Carbon Metabolism”, below). The redox partner for the T. crunogena XCL-2 hydrogenase is suggested by the structure of the small subunit, which has two domains. One domain is similar to other hydrogenase small subunits, while the other is similar to pyridine nucleotide-disulphide oxidoreductases and has both an FAD and NADH binding site. The presence of a NADH binding site suggests that th e small subunit itself transfers electrons between H2 and NAD(H), unlike other soluble hydrogenases, in which this activity is mediated by se parate “diaphorase” subunits [43], which T. crunogena XCL-2 lacks. The small subunit does not have the twin arginine leader sequence that is found in periplasmic and membrane-associated hydrogenases [47], suggesti ng a cytoplasmic location for this enzyme. All 14 genes for the subunits of an electrogenic NADH:ubiquinone oxidoreductase (NDH-1) are present ( Tcr0817 0830 ) and are organized in an apparent operon, as in other proteobacter ia [48,49]. A cluster of genes encoding an RNF-type NADH dehydrogenase, which is evolutionarily dis tinct from NDH-1 [50], is present in the T. crunogena XCL-2 genome ( Tcr1031 1036 ), and may shuttle NADH-derived electrons to speci fic cellular processe s (as in [51]). In this species, ubiquinone ferries electrons between NADH dehydrogenase and the bc1 complex; all ge nes are present for its synthesis, but not for menaquinone. Unlike most bacteria, T. crunogena XCL-2 does not synthesize the isopentenyl diphosphate uni ts that make up th e lipid portion of ubiquinone via the deoxyxylulose 5-phosphate pathway. Instead, most of the genes of the mevalonate pathway (HMG-CoA synthase, Tcr1719 ; HMG-CoA reductase, Tcr1717; mevalonate kinase/phosphomevalonate kinase, Tcr1732, Tcr1733; and diphosphomevalonate decarboxylase, Tcr1734 [52]) are present. The single “missing” gene, for acetyl-C oA acetyltransferase, may not be necessary, as HMG-CoA reductase may also catalyze this reaction as it does in Enterococcus faecalis [53]. Interestingly, the mevalonate pathway is found in Archaea, eukaryotes, and is common among gram positive bacteria [52,54]. Thus far, the only other proteobacterium to have this pathway is from the alpha class, Paracoccus zeaxanthinifaciens [55] Examination of unpublished genome data

PAGE 115

Appendix A continued 103 from the Integrated Microbial Genomes webpage (, and queries of Genbank did not uncover evidence for a complete set of genes for the mevalonate pathway in other proteobacteria. The three components of the bc1 comp lex are represented by three genes in an apparent operon, in the typi cal order (Rieske iron-sulfur subunit; cytochrome b subunit; cytochrome c1 subunit; Tcr0991 – 3; [49]). Consistent with its microaer ophilic lifestyle and inability to use nitrate as an electron acceptor [6], the only terminal oxidase present in the T. crunogena XCL-2 genome is a cbb3-type cytochrome c oxidase ( Tcr1963 5 ). To date, Helicobacter pylori is the only other sequenced organism that has solely a cbb3type oxidase, and this has been propose d to be an adaptation to growth under microaerophilic conditions [49], since cbb3-type oxidase has a higher affinity for oxygen than aa3type oxidase does [56]. In searching for candidate cytochrome proteins that f acilitate electron transfer between the Sox system and the bc1 complex and cbb3 cytochrome c oxidase, the genome was analyzed to identi fy genes that encode proteins with heme-coordinating motifs (CxxCH). This search yielded 28 putative hemebinding proteins (Table S1), compared to 54 identified in the genome of T. denitrificans [21]. Thirteen of these genes encode proteins that were predicted to reside in the periplasm, two of which ( Tcr0628; Tcr0628 ) were deemed particularly promising candidates as they met the following criteria: 1) they were not subunits of other cytochrome-containi ng systems, 2) they were small enough to serve as efficient electr on shuttles, 3) they were characterized beyond the level of hypothetical or conserved hypothetical and 4) they were present in Thiobacillus denitrificans which also has both a Sox system as well as cbb3 cytochrome c oxidase, and had not been im plicated in other cellular functions in this organism. Tcr0628 and Tcr0629 both belong to the COG2863 family of cytochromes c553, which are involved in major catabolic pathways in numerous proteobacteria. In terestingly, genes Tcr0628 and Tcr0629 which are separated by a 147-pb spacer that includes a ShineDelgarno sequence, are highly likely paralogues and a nearly identical gene ta ndem was also identified in the genome of T. denitrificans ( Tbd2026, Tbd2027 ). A recent comprehensive phylogenetic analysis of the cytochrome c553 protei ns, including the mono-heme cytochromes from T. crunogena and T. denitrificans revealed existence of a large protein superfamily that also includes proteins in the COG4654 cytochrome c551/c552 protein family (M.G. Klotz and A.B. Hooper, unpublished resu lts). In ammoniaoxidizing bacteria, representatives of this protein superfamily ( NE0102 Neut2204 NmulA0344 in the COG4654 protein family; Noc0751 NE0736 Neut1650 in the COG2863 protein family) ar e the key electron carriers that connect the bc1 complex with complex IV as well as NOx-detoxofying reductases (i.e., NirK, NirS) and oxidases (i.e., cy tochrome P460, cytochrome c peroxidase) involved in nitrifier deni trification ([57] and re ferences therein). In Epsilonproteobacteria such as Helicobacter pylori and hepaticus cytochromes in this family ( jhp1148; HH1517 ) interact with the terminal cytochrome cbb3 oxidase. Therefore, we propose that the expression products of genes Tcr0628 and

PAGE 116

Appendix A continued 104 Tcr0629 likely represent the electronic link between the Sox system and the bc1 complex and cbb3 cytochrome c oxidase in T. crunogena It appears worthwhile to investigate experimentally whether th e small difference in sequence between these two genes reflects an adaptation to binding to interaction partners with sites of different redox potential, namely cytochrome c1 in the bc1 complex and cytochrome FixP (subunit III) in cbb3 cytochrome c oxidase. Given the presence of these electr on transport complexes and electron carriers, a model for electron transport chai n function is presented here (Figure 2). When thiosulfate or sulfide are acting as the electron donor, the Sox system will introduce electrons into the electron transport chain at the level of cytochrome c [32]. Most will be oxidized by the cbb3-type cytochrome c oxidase to create a proton potential. Some of the cytochrome c electrons will be used for reverse electron transport to ubiquinone and NAD+ by the bc1 complex and NADH:ubiquinone oxidoreductase. The NADH created by reverse electron transport must contribute to the cellu lar NADPH pool, for use in biosynthetic pathways. No apparent ort holog of either a membrane-a ssociated [58] or soluble [59] transhydrogenase is pres ent. A gene encoding a NAD+ kinase is present ( Tcr1633 ), and it is possible that it is al so capable of phosphorylating NADH, as some other bacterial NAD+ kinases are [60]. Transporters and nutrient uptake One hundred sixty nine transporter genes from 40 families are present in the T. crunogena XCL-2 genome (Figure 5), comprising 7.7% of the CDSs. This low frequency of transporter genes is similar to other obligately autotrophic proteobacteria and cyanobacteria as well as intracellular pathogenic bacteria such as Xanthomonas axonopodis, Legionella pne umophila, Haemophilus influenzae, and Francisella tularensis (Figure 5; [61,62]). Most heterotrophic gammaproteobacteria have higher trans porter gene frequencies, up to 14.1% (Figure 5), which likely function to assist in the uptake of multiple organic carbon and energy sources, as suggested when tr ansporters for sugars, amino acids and other organic acids, nucleotides and co factors were tallie d (Figure 5).

PAGE 117

Appendix A continued 105 Figure 5. Transporter gene frequencies within the genomes of Thiomicrospira crunogena XCL-2 (marked with an arrow) and other proteobacteria. N. winogradskyi is an alphaproteobacterium, N. europaea is a betaproteobacterium, and N. oceani and M. capsulatus are gammaproteobacteria. Bars for intracellular pathogens are lighter red than the other heterotrophic gammaproteobacteria. Carbon dioxide uptake and fixation T. crunogena XCL-2, like many species of cyanobacteria [63], has a carbon concentrating mechanism, in wh ich active dissolved inorganic carbon uptake generates intracellular concentrations that are as much as 100X higher than extracellular [14]. No apparent homologs of any of the cyanobacterial bicarbonate or carbon dioxide uptake syst ems are present in this genome. T. crunogena XCL-2 likely recruited bicarbon ate and perhaps carbon dioxide transporters from transporter lineages evol utionarily distinct from those utilized by cyanobacteria. Three carbonic an hydrase genes are present (one -class, Tcr1545 ; two -class, Tcr0421, Tcr0841 [64,65,66], one of which ( -class) is predicted to be periplasmic and me mbrane-associated, and may keep the periplasmic dissolved inorganic carbon pool at chemical equilibrium despite selective uptake of carbon di oxide or bicarbonate. One -class enzyme gene is located near the gene for a form II Rubi sCO (see below) and may be coexpressed with it when the cells are grown under high-CO2 conditions. The other -class (formerly -class; [66]) carbonic anhydrase is a member of a carboxysome operon and likely functions in this organismÂ’s carbon concentrating mechanism. Unlike

PAGE 118

Appendix A continued 106 many other bacteria [67], the gene enc oding the sole SulP-type ion transporter ( Tcr1533 ) does not have a carbonic a nhydrase gene adjacent to it. The genes encoding the enzymes of the Calvin-Benson-Bassham (CBB) cycle are all present. Three ribulose 1,5-bisphos phate carboxylase/oxygenase (RubisCO) enzymes are encoded in the genome: two form I (FI) RubisCOs ( Tcr0427-8 and Tcr0838-9 ) and one form II (FII) RubisCO ( Tcr0424 ). The two FI RubisCO large subunit genes are quite similar to eachother, with gene products that are 80% identical at the amino acid level. The FII RubisCO shares only 30% identity in amino acid sequence with both FI enzymes. The operon structure for each of these genes is similar to Hydrogenovibrio marinus [68]: one FI operon includes RubisCO structural genes ( cbbL and cbbS ) followed by genes encoding proteins believed to be impor tant in RubisCO assembly ( cbbO and cbbQ; Tcr429 30 ) [69,70]. The other FI operon is part of an -type carboxysome operon ( Tcr0840-6) [71] that includes carboxysome shell protein genes csoS1 csoS2 and csoS3 (encoding a -class carbonic anhydrase; [65,66]. In the FII RubisCO operon, cbbM (encoding FII RubisCO) is followed by cbbO and cbbQ genes, which in turn are followed by a gene encoding a -class carbonic anhydrase ( Tcr0421 – 3) [64]. Differing from H. marinus the noncarboxysomal FI and FII RubisCO operons are juxtaposed and di vergently transcribe d, with two genes encoding LysR-type regulatory proteins between them ( Tcr0425-6) The genes encoding the other enzymes of the CBB cycle are scattered in the T. crunogena XCL-2 genome, as in H. marinus [68]. This differs from facultative autotrophic proteobacteria, in which these genes are often clustered together and coregulated [72,73,74]. Base d on data from dedicated studies of CBB operons from a few model organisms, it has been suggested that obligate autotrophs like H. marinus do not have CBB cycle genes organized into an apparent operon because these genes are presumably constitutively expressed, and therefore do not need to be c oordinately repressed [68].

PAGE 119

Appendix A continued 107 Figure 6. Calvin-Benson-Bassham cycle gene organization in Proteobacteria. Rubisco genes ( cbbLS and cbbM ) are green, phosphoribulokinase genes ( cbbP ) are red, other genes encoding Calvin-Benson-Bassham cycle enzymes are black, and carboxysome structural genes are gr ey. For species where cbbP is not near cbbLS or cbbM the distance from the Rubisco gene to cbbP in kbp is indicated in parentheses. Thiobacillus denitrificans has two cbbP genes, so two distances are indicated for this sp ecies. Names of organisms that are unable to grow well as organoheterotrophs are boxed. Abbreviations and accession numbers for the 16S sequences used to construct th e cladogram are as follows: A. ehrlichei--Alkalilimnicola ehrlichei, AF406554; Brady. sp.--Bradyrhizobium sp., AF338169; B. japonicum--Bradyrhizobium japonicum, D13430; B. xenovorans--Burkholderia xenovorans U86373; D. aromatica-Dechloromonas aromatica, AY032610; M. magneticum--Magnetospirillum magneticum, D17514; M. capsulatus--Methylococcus capsulatus BATH, AF331869; N. hamburgensis--Nitrobacter hamburgensis L11663; N. winogradskyi--Nitrobacter winogradskyi L11661; N. oceani-Nitrosococcus oceani, AF363287; N. europaea--Nitrosomonas europaea BX321856; N. multiformis--Nitrosospira multiformis L35509; P. denitrificans--Paracoccus denitrificans X69159; R. sphaeroides--Rhodobacter sphaeroides CP000144; R. ferrireducens--Rhodoferax ferrireducens AF435948; R. palustris--Rhodops eudomonas palustris, NC 005296; R. rubrum-Rhodospirillum rubrum D30778; R. gelatinosus--Rubrivivax gelatinosus M60682; S. meliloti-Sinorhizobium meliloti, D14509; T. denitrificans--Thiobacillus denitrificans AJ43144; T. crunogena--Thiomicrospira crunogena AF064545. The cladogram was based on an alignment of 1622 bp of the 16S rRNA genes, and is the most parsimonious tree (length 2735) resulting from a heuristic search with 100 replicate random step-wise addition and TBR branch swapping (PAUP*4.0b10; [113]). Sequences were aligned using ClustalW [114], as implemented in

PAGE 120

Appendix A continued 108 BioEdit. Percent similarities and identities for cbbL, cbbM, and cbbP gene products, as well as gene locus tags, are provided as supporting information (Table S4). Experimental evidence suggests that the CBB cycle is constitutively expressed in T. crunogena XCL-2. This species cannot grow chemoorganoheterotrophically with acetate, glucose, or yeast extract as the carbon and energy source ([10]; Table S2). When grown in the presence of thiosulfate and dissolved inorganic car bon, Rubisco activities were high both in the presence and absence of these organi c carbon sources in the growth medium (Table S3). Many sequenced genomes from autotrophi c bacteria have recently become available and provide a unique opportuni ty to determine whether CBB gene organization differs among autotrophs base d on their lifestyle. Indeed, for all obligate autotrophs, RubisCO genes are not located near the genes encoding the other enzymes of the CBB cycle (Figure 6; Table S4). For example, the distance on the chromosome of these organisms be tween the genes encoding the only two enzymes unique to the CBB cycle, RubisCO ( cbbLS and/or cbbM ) and phosphoribulokinase ( cbbP ), ranges from 139 – 899 kbp in Proteobacteria, and 151 – 3206 kbp in the Cyanobacteria. In contrast, for most facultative autotrophs, cbbP and cbbLS and/or cbbM genes are near eachother (Figure 6); in most cases, they appear to coexist in an ope ron. In the facultative autotroph Rhodospirillum rubrum the cbbM and cbbP genes occupy adjacent, divergently transcribed operons ( cbbRM and cbbEFPT ). However, these ge nes are coordinately regulated, since binding sites for the regulatory protein cbbR are present between the operons [75]; perhaps they are coordi nately repressed by a repressor protein that binds there as well. The lack of CBB enzyme operons in obligate autotrophs from the Alpha-. Beta-, and Gammaproteoba cteria, as well as the cyanobacteria, may reflect a lack of selective pressure fo r these genes to be juxtaposed in their chromosomes for ease of coordinate repr ession during heterotrophic growth. Central carbon metabolism 3-phosphoglyceraldehyde generated by th e Calvin-Benson-Bassham cycle enters the Embden-Meyerhoff-Parnass pathway in the middle, and some carbon must be shunted in both directions to generate the carbon “backbones” for lipid, protein, nucleotide, and cell wall synthe sis (Figure 7). All of the enzymes necessary to direct carbon from 3-phos phoglyceraldehyde to fructose-6-phosphate and glucose are encoded by this genome, as are all of the genes needed for starch synthesis. To convert fructose 1,6-bis phosphate to fructose 6-phosphate, either fructose bisphosphatase or phosphofructokin ase could be used, as this genome encodes a reversible PPi-dependent phosphofructokinase ( Tcr1583 ) [76,77]. This store of carbon could be sent back th rough glycolysis to generate metabolic intermediates to replenish levels of cellular reductant (see below). Genes encoding all of the enzymes necessary to convert 3-phosphoglyceraldehyde to phosphoenolpyruvate and pyruvate are presen t, and the pyruvate could enter the citric acid cycle via pyruvate dehydrogena se, as genes encodi ng all three subunits of this complex are represented ( Tcr1001 3 ) and activity could be measured with

PAGE 121

Appendix A continued 109 cell-free extracts of cultures grown in the presence and absence of glucose (Hgler and Sievert, unpublished data). Figure 7. Models for glycolysis, gluconeogenesis, and the citric acid cycle in Thiomicrospira crunogena XCL-2. Models for central carbon metabolism for cells under environmental conditions with A. sufficient reduce d sulfur and oxygen; B. sulfide scarcity; C. oxygen scarcity; Green arrows represent the two ‘non-canonical’ citric acid cycle enzymes, 2oxoglutarate oxidoreductase (2-OG OR) and malate: quinone oxidoreductase (MQO). All of the genes necessary for an oxidative citric acid cycle (CAC) are potentially present, as in some othe r obligate autotrophs and methanotrophs [18,78]. However, some exceptions from the canonical CAC enzymes seem to be present. The T. crunogena XCL-2 genome encodes neither a 2-oxoglutarate dehydrogenase nor a typical malate dehydr ogenase, but it does have potential substitutions: a 2-oxoacid: acceptor oxidoreductase ( and subunit genes in an apparent operon, Tcr1709 10 ), and malate: quinone-oxidoreductase ( Tcr1873 ), as in Helicobacter pylori [79,80]. 2-oxoacid:acceptor oxidor eductase is reversible, unlike 2-oxoglutarate dehydrogenase, wh ich is solely oxidative [79,81]. An overall oxidative direction for the cycle is suggested by malate: quinone oxidoreductase. This membrane-associa ted enzyme donates the electrons from malate oxidation to the membrane quinone pool and is irreversible, unlike malate dehydrogenase, which donates electrons to NAD+ [80]. The 2-oxoacid:acceptor oxidoreductase shows high similarity to the well-characterized 2oxoglutarate:acceptor oxidoreductase of Thauera aromatica [82], suggesting that it might catalyze the conversion 2-oxoglutrate rather than pyruvate as a substrate. However, cell-free extracts of cells gr own autotrophically in the presence and absence of glucose have neither 2-oxoglutaratenor pyruvate:acceptor oxidoreductase activity (Hgler and Siever t, unpubl. data); th us, the citric acid cycle does not appear to be co mplete under these conditions. A wishbone-shaped reductive citric acid pathway is suggested by this apparent inability to catalyze the interconversion of succinyl-CoA and 2-

PAGE 122

Appendix A continued 110 oxoglutarate. However, even though ge nes are present enc oding most of the enzymes of the reductive arm of the reductive citric acid pathway, from oxaloacetate to succinyl CoA (phosphoenolpyruvate carboxylase, Tcr1521 ; fumarate hydratase, Tcr1384; ; succinate dehydrogena se/fumarate reductase, Tcr2029-31 ; succinyl-CoA synthetase; Tcr1373 4 ), the absence of malate dehydrogenase and malic enzyme genes, and the presence of a gene encoding malate:quinone-oxidoreductase (MQO) sugge sts a blockage of the reductive path as well. A hypothesis for glycolysis/gluconeogen esis/citric acid cycle function is presented here to reconcile these observa tions (Figure 7). Under conditions where reduced sulfur compounds and oxygen are su fficiently plentiful to provide cellular reductant and ATP for the Calvin cycl e and other metabolic pathways, some carbon would be directed from glyceraldehyde 3-phosphate through gluconeogenesis to starch, while some w ould be directed to pyruvate and an incomplete citric acid cycle to meet the cell’s requirements for 2-oxoglutarate, oxaloacetate, and other carbon skeletons. Succinyl-CoA synthesis may not be required, as in most bacteria [83], th is genome encodes the enzymes of an alternative pathway for porphyrin synthesis via 5-amino levulinate (glutamyltRNA synthetase, Tcr1216; glutamyl tRNA reductase, Tcr0390; glutamate 1semialdehyde 2,1 aminomutase; Tcr0888 ). Should environmental conditions shift to sulfide scarcity, cells could continue to ge nerate ATP, carbon skeletons, and cellular reductant by hydr olyzing the starch and sending it through glycolysis and a full oxidative citric acid cycle. Should oxygen become scarce instead, cells could send carbon skeletons derived from starch through the incomplete citric acid cycle and oxidize excess NADH via th e cytoplasmic Ni/Fe hydrogenase, which would also maintain a membrane proton potential via intracellular proton consumption. Clearly, the exact regula tion of the CAC under different growth conditions promises to be an inte resting topic for future research Genes encoding isocitrate lyase and malate synthase are missing, indicating the absence of a glyoxylate cycle, and consistent with this organism’s inability to grow with acetate as the source of carbon (Table S2). Nitrogen uptake and assimilation are de scribed in Protoc ol S1 and Table S5. Phosphorus uptake T. crunogena XCL-2 has all of the genes for the low affinity PiT system ( Tcr0543 4 ) and an operon encoding the high affinity Pst system for phosphate uptake ( Tcr0537 9 ) [84]. T. crunogena XCL-2 may also be able to use phosphonate as a phosphorus s ource, as it has an operon, phnFDCEGHIJKLMNP (Tcr2078 – 90), encoding phosphonate transporters and the enzymes necessary to cleave phosphorus-carbon bonds (Figure 8) This phosphonate operon is flanked on either side by large (>6500bp) 100% identic al direct repeat elements. These elements encode three predicted coding sequences ( Tcr2074 – 6; Tcr2091 3 ): a small hypothetical, and two large (>2500 aa in length) coding sequences with limited similarity to a phage-like integrase present in Desulfuromonas

PAGE 123

Appendix A continued 111 acetoxidans including a domain involved in breaking and rejoining DNA (DBR1, DBR-2). It is interesting to not e that two homologs found in the draft sequence of the high GC (~65%) gammaproteobacterium Azotobacter vinelandii AvOP have a similar gene organization to the large putative integrases DBR1/DBR-2. Directly downstream of the firs t copy of this large repeat element (and upstream of the phosphonate operon) lies another repeat one of the four IS911related IS3-family insertion sequences [85] present in this genome (Figure 1). Along with the presence of th e transposase/integrase gene s and the flanking large repeat element (likely an IS element), th e strikingly different G+C of this entire region (39.6%) and the direct repeats (35.9%) compared to the genome average (43.1%) suggest that this region may ha ve been acquired by horizontal gene transfer. Figure 8. Thiomicrospira crunogena XCL-2 phosphonate operon. The DBR-1 genes are identical to eachother, as are the DBR-2 genes. Gene abbreviations are: DBR-1 and 2 —DNA breaking-rejoining enzymes; hyp —hypothetical protein; phnFDCEGHIJKLMNP —phosphonate operon; chp —conserved hypothetical protein. An asterisk marks the location of a region (within and upstream of tRNA-phe) with a high level of similarity to the 5’ ends of the two direct repeat sequences noted in the figure. The transposase and integrase are actually a single CDS separated by a frameshift. Interestingly, immediately downstream of this island lies another region of comparatively low G+C (39.6%) that encode s a number of products involved in metal resistance (e.g., copper transporte rs and oxidases, heavy metal efflux system). Directly downstream of th is second island lies a phage integrase ( Tcr2121 ) adjacent to two tRNAs, which are known to be common phage insertion sites. Strikingly, there is a high level of sim ilarity between the 5’ region of the first tRNA – and its promoter region – and the 5’ regions of the large repeat elements, particularly the closest elemen t (Figure 8). Taken together, it is proposed that this entire region has been horizontally acquired. Interestingly, it appears that the phosphonate operon from the marine cyanobacterium Trichodesmium erythraeum was also acquired by horizon tal gene transfer [86]. Phylogenetic analyses reveal that the PhnJ protein of T. crunogena XCL-2 falls into a cluster that, with the exception of Trichodesmium erythraeum contains sequences from gammaand betaprote obacteria, with the sequence of Thiobacillus denitrificans another sulfur-oxidizing b acterium, being the closest relative (Figure S2). The potential capability to use phosphonates, which constitute a substantial fraction of dissolved or ganic phosphorus[87], might

PAGE 124

Appendix A continued 112 provide T. crunogena XCL-2 a competitive advantage in an environment that may periodically experience a scarcity of inorganic phosphorous. Any excess phosphate accumulated by T. crunogena XCL-2 could be stored as polyphosphate granules, as polyphosphate kinase and exopolyphosphatase genes are present ( Tcr1891 2 ). Regulatory and signaling proteins Despite its relative metabolic si mplicity as an obligate autotroph, T. crunogena XCL-2 allocates a substantial fract ion of its protein-encoding genes (8.9%) to regulatory and signa ling proteins (Table 2). In order to determine whether this was typical for a mari ne obligately chemolithoautotrophic gammaproteobacterium, the numbers of regulatory and signaling proteinencoding genes from this organism were compared to the only other such organism sequenced to date, Nitrosococcus oceani ATCC 19707 [88]. It was of interest to determine whether the differences in their habitats ( T. crunogena: attached, and inhabiting a stochastic hydrothermal vent environment, vs. N. oceani : planktonic, in a comparatively st able open ocean habitat; [89]) would affect the sizes and compositions of their arsenals of regulatory and signaling proteins. Noteworthy differences be tween the two species include a high proportion of genes with EAL and GGDEF domains in T. crunogena XCL-2 compared to N. oceani (Table 2). These proteins catalyze the hydrolysis and synthesis of cyclic diguanylate, suggesti ng the importance of this compound as an intracellular signaling molecule in T. crunogena XCL-2 [90]. In some species the abundance of intracellular cy clic diguanylate dictates whether the cells will express genes that facilitate an attached vs. planktonic lifestyle [90]. Given that T. crunogena was isolated by collecting scrapings from hydrothermal vent surfaces [6,15], perhaps cyclic digua nylate has a similar function in T. crunogena as well. TABLE 2. Thiomicrospira crunogena XCL-2a and Nitrosococcus oceani ATCC 19707 regulatory and signaling proteins Number: T. crunogena N. oceani 72 104 Transcription/Elongation/Termination Factors 6 9 Sigma Factors 6 11 Anti/Anti-Anti Sigma Factors 6 6 Termination/Antitermination Factors 2 2 Elongation Factors 52 76 Transcription factors 128 75 Signal Transduction proteins Chemotaxis Signal Transduction

PAGE 125

Appendix A continued 113 proteins (27 total, T. crunogena ) 14 1 Methyl-accepting ch emotaxis proteins 2 1 CheA signal transduction histidine kinase 3 2 CheW protein 2 0 Response regulator receiver modulated CheW protein 1 1 MCP methyltransf erase, CheR-type 2 1 Response regulator receiver, CheY 1 1 Response regulator receiver modulated CheB methylesterase 1 0 CheD, stimulates methylation of MCP proteins 1 0 CheZ chemotaxis phosphatase Non-Chemotaxis Signal Transduction (101 total, T. crunogena ) 17 18 Signal Transduction Histidine Kinase 5 0 Diguanylate phosphodiesterase 1 0 Response regulator receiver modulated diguanylate phosphodiesterase 16 0 Diguanylate cyclase 1 2 Response regulator receiver modulated diguanylate cyclase 6 0 Diguanylate cyclase with PAS/PAC sensor 9 4 Diguanylate cyclase/phosphodiesterase 0 1 Periplasmic sensor hybrid histidine kinase and response regulator receiver modulated diguanylate cyclase/phosphodiesterase 7 5 Diguanylate cyclase/phosphodiesterase with PAS/PAC sensor 1 2 Response regulator receiver modulated diguanylate cyclase/phosphodiesterase 2 1 Cyclic nucleotide-binding protein 1 0 Cyclic-AMP phosphodiesterase 0 1 Adenylate/guanylate cyclase 1 4 PTS NTR Regulator proteins 34 29 Miscellaneous 200 179 Total aA list of locus tags for these genes is present in Table S6 Many of these EAL and GGDEF-domain proteins, and other predicted regulatory and signaling prot eins, have PAS domains (Tab le 2; Table S6), which often function as redox and/or oxygen sensors by binding redox or oxygensensitive ligands (e.g., heme, FAD; [91] ). Twenty PAS-domain proteins predicted from T. crunogena XCL-2Â’s genome sequence include 4 methylaccepting chemotaxis proteins (see below), 3 signal transduction histidine kinases, 6 diguanylate cyclases, and 7 diguany late cyclase/phosphodiesterases. N. oceani has 14 predicted gene products with PAS/ PAC domains; notable differences from T. crunogena XCL-2 are an absence of PA S/PAC domain methyl-accepting

PAGE 126

Appendix A continued 114 chemotaxis proteins, and fewer PAS/PAC domain proteins involved in cyclic diguanylate metabolism (7 diguanyla te cyclase/phosphodiesterases). Despite its metabolic and morphological simplicity, T. crunogena XCL-2 has almost as many genes encoding transc ription factors (52) as the cyst and zoogloea-forming N. oceani does (76; Table 2; [89]). Indeed, most free-living bacteria have a considerably lower fre quency of genes encoding regulatory and signaling proteins (5.6% in N. oceani [88] ; 5-6% in other species [19]). Other organisms with frequencies similar to T. crunogena XCL-2 (8.6%) include the metabolically versatile Rhodopseudomonas palustris (9.3%; [19]). Although T. crunogena XCL-2 is not metabolically versat ile, it has several apparent operons that encode aspects of its structure a nd metabolism that are likely to enhance growth under certain environmental conditions (e.g., carboxysomes; phosphonate metabolism; assimilatory nitrate reductas e; hydrogenase). Perhaps the relative abundance of regulatory and signa ling protein-encoding genes in T. crunogena XCL-2 is a reflection of the remarkable te mporal and spatial heterogeneity of its hydrothermal vent habitat. Chemotaxis Genes encoding the structural, re gulatory, and assembly-related components of T. crunogena XCL-2’s polar flagellae are organized into flg ( Tcr1464 77 ) and fla/fli/flh clusters, similar to Vibrio spp. [92]. However, the fla/fli/flh cluster is split into two separate subclusters in T. crunogena XCL-2 ( Tcr0739 – 47; Tcr1431 – 53). Fourteen genes encoding methyl-ac cepting chemotaxis proteins (MCPs) are scattered throughout the genome, whic h is on the low end of the range of MCP gene numbers found in the genomes of gammaproteobacteria. The function of MCPs is to act as nutrient and toxin-sensors that communicate with the flagellar motor via the CheA and CheY prot eins [93]. As each MCP is specific to a particular nutrient or toxi n, it is not surprising that T. crunogena XCL-2 has relatively few MCPs, as its nutritional need s as an autotroph are rather simple. Interestingly, however, the number of MCP genes is high for obligately autotrophic proteobacteria (Tab le 2; Figure 9), particular ly with respect to those containing a PAS domain or fold (Figure 9). The relative abundance of MCPs in T. crunogena XCL-2 may be an adaptation to the sharp chemical and redox gradients and temporal instability of T. crunogena XCL-2 ’ s hydrothermal vent habitat [4].

PAGE 127

Appendix A continued 115 Figure 9. Numbers of methyl-accepting ch emotaxis protein genes in Thiomicrospira crunogena XCL-2 and other proteobacteria. T. crunogena is marked with an arrow. Adhesion A cluster of genes encoding pilin and the assembly and secretion machinery for type IV pili is present ( flp tadE cpaBCEF tadCBD; Tcr1722 30 ). In Actinobacillus actinomycetemcomitans and other organisms, these fimbrae mediate tight adherence to a variety of substrates [94]. T. crunogena was originally isolated from a biofilm [6]. Adhesion within biofilms may be mediated by these fimbrae. Heavy metal resistance Despite being cultivated from a habitat that is prone to elevated concentrations of toxic heavy metals in cluding nickel, copper, cadmium, lead, and zinc [95,96], T. crunogena XCL-2Â’s arsenal of hea vy metal efflux transporter genes does not distinguish it from E. coli and other gammaproteobacteria. It has eleven sets of Resistance-Nodulatio n-Cell Division superfamily (RND)-type transporters, five Cation Diffusion Facilitator family (CDF) transporters, and six P-type ATPases, far fewer than the metal-resistant Ralstonia metallidurans (20 RND, 3 CDF, 20 P-type; [97]), and lack ing the arsenate, cadmium, and mercury

PAGE 128

Appendix A continued 116 detoxification systems present in the ge nome of hydrothermal vent heterotroph Idiomarina loihiensis [98]. To verify this surprising result, T. crunogena XCL-2 was cultivated in the presence of heavy meta l salts to determine its sensitivities to these compounds (Table 3). Indeed, T. crunogena XCL-2 is not particularly resistant to heavy metals; instead, it is more sensitive to them than E. coli [99] Similar results were found for hydrothe rmal vent archaea [100]; for these organisms, the addition of sulfide to the growth medium was found to enhance their growth in the presence of heavy metal salts, and it was suggested that, in situ at the vents, sulfide might “protect ” microorganisms from heavy metals by complexing with metals or forming precipitates with them [100]. Potentially, this strategy is utilized by T. crunogena XCL-2. Alternatively, hydrothermal fluid at its mesophilic habitat may be so dilute th at heavy metal concentrations do not get high enough to necessitate extensiv e adaptations to detoxify them. TABLE 3. Growth-inhibiting concentrati ons (mM) of heavy metals for Thiomicrospira crunogena XCL-2 and Escherichia coli. Heavy metal ion T. crunogenaa E. coli b Hg+2 0.01 0.01 Cu+2 0.02 1 Ag+1 0.02 0.02 Cd+2 0.05 0.5 Co+2 0.1 1 Ni+2 0.1 1 Zn+2 1 1 Cr+2 1 5 Mn+2 2 20 a T. crunogena XCL-2 was cultivated on solid thiosulfate-supplemented artificial seawater media with metal salts added to the final concentration listed (0.01 to 20 mM). For both species, the concentrati on at which growth ceased is listed. bData from [99]. Conclusions Many abilities are apparent from the genome of T. crunogena XCL-2 that are likely to enable this organism to su rvive the spatially and temporally complex hydrothermal vent environment despite its simple, specialized metabolism. Instead of having multiple metabolic pathways, T. crunogena XCL-2 appears to have multiple adaptations to obtain autotrophic substrates. Fourteen methylaccepting chemotaxis proteins presumably guide it to microhabitats with characteristics favorable to its growth, and type IV pili may enable it to live an attached lifestyle once it finds these favor able conditions. A larger-than-expected arsenal of regulatory proteins may enable this organism to regulate multiple mechanisms for coping with variations in inorganic nutrient avai lability. Its three RubisCO genes, three carbonic anhydr ase genes, and carbon concentrating

PAGE 129

Appendix A continued 117 mechanism likely assist in coping with oscillations in environmental CO2 availability, while multiple ammonium tr ansporters, nitrate reductase, lowand highaffinity phosphate uptake systems, and potential phosphonate use, may enable it to cope with uncertain supplies of these macronutrients. In contrast, systems for energy genera tion are more limited, with only one, i.e., Sox, or possibly two, i.e., Sox plus SQR, systems for sulfur oxidation and a single low-oxygen adapted terminal oxidase ( cbb3-type). Instead of having a branched electron transport chain with mu ltiple inputs and outputs, this organism may use the four PAS-domain or –fold me thyl-accepting chemotaxis proteins to guide it to a portion of the chemocline wh ere its simple electron transport chain functions. It is worth noting, in this regard, that Thiobacillus denitrificans, which has several systems for sulfur oxidation, has fewer MCPs than T. crunogena XCL-2 (Figure 9). Differential expression of portions of the citric acid cycle may enable it to survive periods of reduced sulfur or oxygen scarcity during its ‘transit’ to more favorable microhabitats. Up to this point, advances in our understanding of the biochemistry, genetics, and physiology of this bacteriu m have been hampered by a lack of a genetic system. The availability of the genome has provided an unprecedented view into the metabolic potential of this fascinating organism and an opportunity use genomics techniques to address the hypot heses mentioned here and others as more autotrophic genomes become available. Materials and Methods Library construction, sequencing, and sequence quality. Three DNA libraries (with approximate insert sizes of 3, 7, and 35 kb) were sequenced using the whole-genome shotgun method as prev iously described [18]. Paired-end sequencing was performed at the Produc tion Genomics Facility of the Joint Genome Institute (JGI), generating great er than 50,000 reads and resulting in approximately 13X depth of coverage. An additional ~400 finishing reads were sequenced to close gaps and address base quality issues. Assemblies were accomplished using the PHRED/PHRA P/CONSED suite [101,102,103], and gap closure, resolution of repetitive sequen ces and sequence polishing were performed as previously described [18]. Gene identification and annotation. Two independent annotations were undertaken: one by the Genome Analys is and System Modeling Group of the Life Sciences Division of Oak Ridge Na tional Laboratory (ORNL), and the other by the University of Bielefeld Center for Biotechnology (CeBiTec). After completion, the two annotations were subj ected to a side-by-side comparison, in which discrepancies were examined and manually edited. Annotation by ORNL proceeded similarly to [18] and is briefly described here. Genes were predicted using GL IMMER [104] and CRITI CA [105]. The lists of predicted genes were merged with the start site from CRITICA being used when stop sites were identical. The pred icted coding sequences were translated and submitted to a BLAST analysis ag ainst the KEGG database [106]. The

PAGE 130

Appendix A continued 118 BLAST analysis was used to evaluate overl aps and alternative st art sites. Genes with large overlaps where both had good (1e-40) BLAST hits were left for manual resolution. Remaining overlaps were resolved manually and a QA process was used to identify frames hifted, missing, and pseudogenes. The resulting list of predicted coding sequences were translated and these amino acid sequences were used to query the N CBI nonredundant database, UniProt, TIGRFam, Pfam, PRIAM, KEGG, COG, and InterPro databases. PFam and TIGRFam were run with scores > trus ted cutoff scores for the HMMs. Product assignments were made based on the hi erarchy of TIGRFam, PRIAM, Pfam, Smart (part of InterPro), UniProt, KEGG, and COGs. Annotation by CeBiTec began by cal ling genes using the REGANOR strategy [107], which is based on trai ning GLIMMER [104] with a positive training set created by CRITICA [105]. Predicted coding sequences were translated and these amino acid sequences were used to query the NCBI nonredundant database, SwisProt, TIGRFa m, Pfam, KEGG, COG, and InterPro databases. Results were collated an d presented via GenDB [108] for manual verification. For each gene, the list of matches to databases was examined to deduce the gene product. Specific func tional assignments suggested by matches with SwisProt and the NCBI nonredundant database were only accepted if they covered over 75% of the gene length, had an e-value < 0.001, and were supported by hits to curated databases (Pfam or TIGRFam, with scores > trusted cutoff scores for the HMMs), or were consistent with gene context in the genome (e.g., membership in a potential operon with other genes with convincing matches to curated databases). When it was not possi ble to clarify the function of a gene based on matches in SwissProt and the nonr edundant database, but evolutionary relatedness was apparent (e.g., membership in a Pfam with a sc ore > trusted cutoff score for the family HMM), genes were annotated as members of gene families. When it was not possible to infer function or family membership, genes were annotated as encoding hypothetical or conserved hypothetical proteins. If at least three matches from three other speci es that covered >75% of the geneÂ’s length were retrieved from SwissProt and the nonredundant database, the genes were annotated as encoding conserved hypothetical proteins. Otherwise, the presence of a Shine-Dalgarno sequence upstream from the predicted start codon was verified and the gene was annotated as encoding a hypothetical protein. For genes encoding either hypothetical or cons erved hypothetical pr oteins, the cellular location of their potential gene produ cts was inferred based on TMHMM and SignalP [109,110]. When transmembran e alpha helices we re predicted by TMHMM, the gene product was annotated as a predicted membrane protein. When SignalP Sigpep probability and ma x cleavage site prob ability were both >0.75, and no other predicted transmembrane regions were present, the gene was annotated as a predicted peripl asmic or secreted protein. Comparative genomics. All CDSs for this genome were used to query the TransportDB database [111]. Matches we re assigned to transporter families to facilitate comparisons with other organisms within the TransportDB database ( ). To compare operon structure for genes encoding the Calvin-Benson-Bassham cycle, amino acid biosynthesis,

PAGE 131

Appendix A continued 119 phosphonate metabolism, and to find all of the genes encoding methyl-accepting chemotaxis proteins, BLAST-queries of the microbial genomes included in the Integrated Microbial Genomes database were conducted [112]. Comparison of operon structure was greatly facilita ted by using the “Show Neighborhoods” function available on the IMG website ( ). Nucleotide sequence accession number. The complete sequence of the T. crunogena XCL-2 genome is available fr om the nonredundant database (GenBank accession number CP000109).

PAGE 132

Appendix A continued 120 Supplemental figures and tables Supporting protocol S1. Nitrogen uptake and assimilation Thiomicrospira crunogena XCL-2 is capable of growing with nitrate or ammonia as its nitrogen s ource ([6]; K. Scott, unpubl. da ta). Accordingly, it has an apparent operon encoding the co mponents of a NasFED-type nitrate transporter ( Tcr1153 5 ) [115], cytoplasmic assimilatory nitrate ( nasA; Tcr1159) and nitrite reductase ( nirBD; Tcr1157-8) genes, as well as four Amt-family ammonia transporters ( Tcr0954; Tcr1340; Tcr1500; Tcr2151 ). Ammonia originating from environm ental sources or produced from nitrate reduction is incorporated into the T. crunogena XCL-2 organic nitrogen pool by glutamine synthetase and NADP H-dependent glutamate synthase. T. crunogena XCL-2 has three different glutamin e synthetase genes: one encodes a GlnA-type enzyme ( Tcr0536 ) while the others are both GlnT-type ( Tcr1347, Tcr1798 ) [116]. Perhaps these three glutamin e synthetase genes are differentially expressed under different nitrogen conditions. Genes encoding the majority of the en zymes necessary to synthesize all 20 L-amino acids were detected; exceptions and omissions are described here. The first enzyme of aromatic amino acid s ynthesis, 3-deoxy-D-ar abino-heptulosonate 7-phosphate (DAHP) synthetase, is enc oded by a single gene. More commonly, bacteria have 2-3 isoforms of this en zyme, which are differentially regulated by the concentrations of tyrosine, phe nylalanine, and tryptophan [117]. T. crunogena XCL-2 also has a single copy of the ge nes encoding the large and small subunits of acetolactate synthase, whic h is the “gatekeeper” enzyme of valine, leucine, and isoleucine biosynthesis, while E. coli has three isoforms that are differentially sensitive to leucine, valine and isoleucine [118]. It would be of interest to determine whether the single isoforms of these enzymes present in T. crunogena XCL-2 are sensitive to the concentra tion of any of their three amino acid endproducts. Only a single gene was identified for chorismate mutase, as part of a PheA-like bifunctional protein for the production of phenylpyruvate for phenylalanine synthesis. How the prephena te necessary for tyrosine synthesis is supplied is not apparent. The gene encoding 4-hydroxyphenylpyruvate-producing prephenate dehydrogenase ( tyrC) does not appear to be bi functional, as it lacks a domain that could catalyze the chorismate mutase step. Searches for aroQ and aroH -type chorismate mutase genes [119] yielded only pheA. With regard to lysine synthesis, the identity of th e gene encoding N-succinyl-LL-diaminopimelate aminotransferase is not clear. Currently, the gene ( dapC ) encoding this enzyme has only been unambiguously identified in Bordetella pertussis [120]. A BLAST search of the T. crunogena XCL-2 genome with the B. pertussis DapC amino acid sequence di d not yield an apparent homolog. A gene identified as argD is present, which encodes N-acetyl-ornithine aminotransferase, which can al so catalyze the DapC reaction [121]. However, it is unclear whether the argD gene product functions in lysine synthesis, as cell extracts from other species contain a heretofore unidentified enzyme specific to N-succinyl-LL-diaminopimelate whose ge ne locus has not been determined [121].

PAGE 133

Appendix A continued 121 Alanine synthesis is perplexing in this organism, as genes encoding alanine dehydrogenase, alanine-oxo-acid tr ansaminase, alanine transaminase and alanine-glyoxylate transaminase are a ll absent, nor are the enzymes present necessary to synthesize alanine from cysteine. Perhaps one of the many transaminase genes detected, the specific ity of which could not be deduced based on its sequence, is capable of using pyruvate as a substrate. Amino acid degradation capabilities ar e quite limited, as in the obligate chemoautotroph Nitrosomonas europaea [18]. The genome sequence was searched for amino acid-catabolizing en zymes common in other bacteria, and many were lacking. For example, both hi stidine and serine ammonia-lyase are absent. Enzymes necessary for histidine degradation via urocanate or histamine are all absent. Aromatic amino acids ca nnot be degraded, based on the lack of genes encoding tryptophanase, trypto phan monoxygenase, aromatic-L-amino-acid decarboyxlase, aromatic-amino-acid transami nase, tyrosine aminotransferase, or any of the other enzymes necessary to recycle their car bon skeletons through central carbon metabolism. Carbon skeletons from valine, isoleucine, and leucine cannot be routed to central carbon meta bolism via acetyl-CoA or succinyl-CoA, as acyl-CoA dehydrogenase and enoyl-Co A hydratase genes are not present. With the exceptions of glutamine and asparagine, aminoacyl-tRNA synthetases for all amino acids ar e present. Two copies of the gltX gene are present, and it is not possible to de duce whether they have differential specificities for glutamine or glutam ate based on their sequences. In T. crunogena XCL-2 as in other organisms [122], GltX is probably capable of aminoacylating both tRNA(glu) and tRNA(gl n) with glutamate, as glutaminyltRNA synthetase is missing. Genes for the three subunits of a tRNA-dependent amidotransferase (adt) are present, a nd their gene products could convert the glutamyl-tRNA(glu) and as partyl-tRNA(asp) to gl utaminyl-tRNA(gln) and aspartanyl-tRNA(asn). Glycyland phenyl alanyl-tRNA synthetases are present as heterodimeric forms. In addition to a canonical histidinyl-tRNA synthetase gene, a paralog is present ( hisZ ) and may function as a regulat ory protein that interacts with ATP phosphoribosyltransferase, which catalyzes the first step of histidine synthesis [123]. The paralog may act as an intracellular histidine sensor [123]. Two copies of lysyl-tRNA synthetase genes are also present. One is truncated (as in [124]), and may have a different function. The arginine, tryptophan, leucine, an d histidine operons present in the Enterobacteria, Pasteurellales, Vibrionale s, and Alteromonidales are disrupted in T. crunogena (Table S1), as they are in othe r “deeply branching” members of the -Proteobacteria ( Nitrosococcus oceani, Methylococcus capsulatus Bath, and Pseudomonas aeruginosa; K. Scott, unpubl. data). Nucleotide metabolism Genes encoding all of the enzymes necessa ry to synthesize purine and pyrimidine nucleotides are present. However, the salvage enzymes are poorly represented, as in Nitrosomonas europaea [18]. Adenosine and cytidin e deaminases are absent, as are purine or pyrimidine phosphorylases and hydrolases. Since T. crunogena XCL-2 is an obligate autotroph, an extensive arsenal of salvage enzymes may not

PAGE 134

Appendix A continued 122 be necessary, as it probably does not rely on environmental sources of these compounds either for nucleotide synthe sis, or to use as carbon sources. TABLE S1. Proteins with a heme-c oordinating motif (CxxCH) Predicted location Locus tag # Predicted function Cytoplasm Tcr0028 Cyclic diguanylate phosphodiesterase Tcr0157 SoxD Tcr0324 UvrABC system protein A Tcr0387 ThiF family protein Tcr0719 DNA-directed DNA polymerase Tcr0871 Chaperone protein DnaJ Tcr0994 DNA repair protein RadA Tcr1506 Ribonuclease, Rne/Rng family protein Tcr1803 Beta-lactamase family protein Tcr1975 Conserved hypothetical protein Membrane Tcr0993 bc1 complex cytochrome c1 subunit Tcr1963 cbb3 cytochrome c oxidase CcoP subunit Tcr1964 cbb3 cytochrome c oxidase CcoO subunit Tcr0776 Diguanylate cyclase/phosphodiesterase Tcr1187 Hypothetical protein Periplasm Tcr0601 SoxA Tcr0604 SoxX Tcr0111 Thioredoxin-related protein Tcr0865 Di-heme hypothetical protein Tcr1063 Penta-heme hypothetical protein Tcr2105 COG3258 single domain family Tcr1575 COG2010 Ccca protein family; Cu detox.? Tcr2114 “ Tcr1266 Hypothetical protein; similar to Daro3004 and Tbd1840 Tcr1885 Hypothetical small mono-heme cytochrome protein Tcr0952 COG2863 family of cytochromes c553 Tcr0628 “ and likely to transfer electrons to the bc1 complex and cbb3 cytochrome c oxidase Tcr0629 “

PAGE 135

Appendix A continued 123 TABLE S2. Growth of Thiomicrospira crunogena XCL-2 on solid artificial seawater medium supplemented with carbon and electron sourcesa Supplement Air (0.03% CO2) headspace CO2-free air headspace None b Glucose Acetate Yeast extract Thiosulfate + Thiosulfate + glucose + Thiosulfate + acetate + Thiosulfate + yeast extract + aCells were cultivated in chemostats under dissolved inor ganic carbon limitation in artificial seawater medium supplemented with thiosulfate [14], and were spread on solid artificial seawater media suppl emented with thiosulfate and organic carbon sources (40 mM thiosulfate, 0.02% w/v acetate, 0.02% w/v glucose, or 0.1% w/v yeast extract). Two replicates of each plate were made: one set was incubated with an air headspace while the other set was incubated in a BBL Gaspak jar continuously purged with air that had passed through a 30 cm column of soda lime to remove atmospheric CO2. bSymbols indicate the presence (+) and abse nce (-) of growth twelve days after inoculation. TABLE S3. Thiomicrospira crunogena XCL-2 Rubisco activity when grown in the presence and absence of organic carbon a Supplement Rubisco activity ( mol min-1 mg protein-1) None 0.41 0.02 Glucose 0.32 0.04 Acetate 0.36 0.05 Yeast extract 0.42 0.05 aCells were grown in chemostats in ar tificial seawater supplemented with thiosulfate (40 mM) under dissolved i norganic carbon limitation [14], in the presence and absence of organic carbon (0.02% w/v acetate, 0.02% w/v glucose, or 0.1% w/v yeast extract). Cell s were harvested (10,000g, 10 min, 4C),

PAGE 136

Appendix A continued 124 sonicated (three 15-sec sonica tions in the presence of gl ass sonication beads), and assayed for protein [14] and ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) activity [125]. TABLE S4. Percent similarities and i dentities of proteobacterial cbbL, cbbM, and cbbP genes Supplement Rubisco activity ( mol min-1 mg protein-1) None 0.41 0.02 Glucose 0.32 0.04 Acetate 0.36 0.05 Yeast extract 0.42 0.05 aCells were grown in chemostats in ar tificial seawater supplemented with thiosulfate (40 mM) under dissolved i norganic carbon limitation [14], in the presence and absence of organic carbon (0.02% w/v acetate, 0.02% w/v glucose, or 0.1% w/v yeast extract). Cell s were harvested (10,000g, 10 min, 4C), sonicated (three 15-sec sonica tions in the presence of gl ass sonication beads), and assayed for protein [14] and ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) activity [125]. TABLE S5. Amino acid biosynthesis gene organization in Thiomicrospira crunogena XCL-2 vs. Escherichia coli Amino acid E. coli gene clusters T. crunogena gene clusters Arginine argECBHa Genes present individually Tryptophan trpE(GD)(CF)BAb trpEGDC trpFBA Threonine thrABC thrAC thrB Leucine leuABCD leuA leuCDB Ile, leu, val ilvEDA Genes present individually Histidine hisGDC(NB)HAF(IE)c hisGD

PAGE 137

Appendix A continued 125 hisC hisN hisBHAFE hisI aargE is divergently transcribed from GBH btrp(GD) and trp(CF) are gene fusions of trpG and trpD and trpC and trpF respectively. chis(NB) and his(IE) are gene fusions of hisN and hisB and hisI and hisE.

PAGE 138

Appendix A continued 126 TABLE S6. Thiomicrospira crunogena XCL-2 regulatory and signaling proteins Number Item Locus Tag Number (TcrÂ…)a 72 Transcription/Elongati on/Termination Factors 6 Sigma Factors 0747 1205 1771 1806 2134 2156 6 Anti/Anti-Anti Sigma Factors 0730 0972 1038 1390 1225 1478 6 Termination/Antitermination Factors 0126 0283 0769 1122 1151 1396 2 Elongation Factors 0515 0880 52 Transcription factors 0004 0035 0054 0188 0205 0425 0426 0440 0460 0470 0540 0541 0617 0786 0788 0852 0858 0868 0904 0906 0969 1057 1203 1224 1234 1301 1338 1382 1405 1418 1444 1446 1487 1555 1588 1660 1702 1782 1789 1862 1872 1877 1884 1928 1947 2002 2078 2101 2126 2183 2185 2187 128 Signal Transduction proteins Chemotaxis Signal Transduction proteins (27 total) 14 Methyl-accepting chemotaxis proteins 0027 0077 0361 0553 0570 0574 0759 0777 1394 1436 1897 1984 1999 2004 2 CheA signal transduction histidine kinase 0750 1612 3 CheW protein 0728 0751 0755 2 response regulator receiver modulated CheW protein 1271 1476 1 MCP methyltransferase, CheR-type 0757 2 CheY, response regulator receiver 0748 0754 1 response regulator receiver modulated CheB methylesterase 0758 1 CheD, stimulates methylation of MCP proteins 1613 1 CheZ chemotaxis phosphatase 0749

PAGE 139

Appendix A continued 127 Non-Chemotaxis Signal Transduction (102 total) 17 Signal Transduction Histidine Kinase 0005 0066 0189 0226 0542 0905 0968 1040 1041 1202 1383 1445 1913 1924 2068 2180 2189

PAGE 140

Appendix A continued 128 Figure S1. Phylogenetic relationships of SoxC sequences of Thiomicrospira crunogena XCL-2 with SoxC/SorA s equences of selected bacteria. Sequences were aligned using the program package MacVector. Neighbor-joining and parsimony trees based on the predicted amino acid sequences were calculated using PAUP 4.0b10. At the base of the th ree main groups, boots trap values (1,000 replicates) are given for the neighbor-join ing (first value) and parsimony analyses (second value). In (B) bootstra p values are depicted only at the base of the three main groups. A. thaliana represents a plant assimila tive nitrate reductase and D. melanogaster represents a eukaryotic sulfite oxidase.

PAGE 141

Appendix A continued 129 Figure S2. Phylogenetic relationships of PhnJ sequences of Thiomicrospira crunogena with PhnJ sequences of selected bacteria. Sequences were aligned using the program package MacVector. Neighbor-joining and parsimony trees based on the predicted amino acid sequences were calculated using PAUP 4.0b10. Bootstrap valu es (1000 replicates; neighborjoining/parsimony analyses) are depicted onl y at the base of the three main groups and for the branch grouping Tb. denitrificans and T. crunogena.

PAGE 142

Appendix A continued 130 References 1. Karl DM, Wirsen CO, Jannasch HW (1980) Deep-sea primary production at the Galpagos hydrothermal vents. Science 207: 1345-1346. 2. Edwards KJ, Rogers DR, Wirsen CO McCollom TM (2003) Isolation and characterization of novel psychrophi lic, neutrophilic, Fe-oxidizing, chemolithoautotrophic alphaand, gamma-Proteobacteria from the deep sea. Appl Environ Microbiol 69: 2906-2913. 3. Kelley DS, Karson JA, Fruh-Green GL, Yoerger DR, Shank TM, et al. (2005) A serpentinite-hosted ecosystem: The lo st city hydrothermal field. Science 307: 1428-1434. 4. Johnson KS, Childress JJ, Beehler CL (1988) Short term temperature variability in the Rose Garden hydrot hermal vent field. Deep-Sea Res 35: 1711-1722. 5. Goffredi SK, Childress JJ, Desaulnier s NT, Lee RW, Lallier FH, et al. (1997) Inorganic carbon acquisition by the hydrothermal vent tubeworm Riftia pachyptila depends upon high external PCO2 and upon proton-equivalent ion transport by the worm. J Exp Biol 200: 883-896. 6. Jannasch H, Wirsen C, Nelson D, Robertson L (1985) Thiomicrospira crunogena sp. nov., a colorless, sulfur-oxi dizing bacterium from a deepsea hydrothermal vent. Int J Syst Bacteriol 35: 422-424. 7. Wirsen CO, Brinkhoff T, Kuever J, M uyzer G, Molyneaux S, et al. (1998) Comparison of a new Thiomicrospira strain from the Mid-Atlantic Ridge with known hydrothermal vent isolat es. Appl Environ Microbiol 64: 40574059. 8. Muyzer G, A. Teske, C.O. Wirse n, H.W. Jannasch (1995) Phylogenetic relationships of Thiomicrospira species and their identification in deeopsea hydrothermal vent samples by dena turing gradient gel electrophoresis of 16S rDNA fragments. Arch Microbiol 164: 165-172. 9. Brinkhoff T, Sievert SM, Kuever J, M uyzer G (1999) Distri bution and diversity of sulfur-oxidizing Thiomicrospira spp. at a shallow-water hydrothermal vent in the Aegean Sea (Milos, Gr eece). Appl Environ Microbiol 65: 3843-3849. 10. Ruby EG, Wirsen CO, Jannasch HW (1981) Chemolithotrophic SulfurOxidizing Bacteria from the Galapago s Rift Hydrothermal Vents. Appl Environ Microbiol 42: 317-324. 11. Ruby EG, Jannasch HW (1982) P hysiological characteristics of Thiomicrospira sp. strain L-12 isolated from deep-sea hydrothermal vents. J Bacteriol 149: 161-165. 12. Wirsen CO, Brinkhoff T, Kuever J, Muyzer G, Jannasch HW, et al. (1998) Comparison of a new Thiomicrospira strain from the mid-atlantic ridge with known hydrothermal vent isolat es. Appl Environ Microbiol 64: 40574059. 13. Scott KM, Bright M, Fisher CR (1998) The burden of independence: Inorganic carbon utilization strategies of the sulphur chemoautotrophic hydrothermal vent isolate Thiomicrospira crunogena and the symbionts of

PAGE 143

Appendix A continued 131 hydrothermal vent and cold seep ves timentiferans. Cah Biol Mar 39: 379381. 14. Dobrinski KP, Longo DL, Scott KM (2005) A hydrothermal vent chemolithoautotroph with a carbon con centrating mechanism. J Bacteriol 187: 5761-5766. 15. Ahmad A, Barry JP, Nelson DC (1999) Phylogenetic affinity of a wide, vacuolate, nitrate-accumulating Beggiatoa sp. from Monterey Canyon, California, with Thioploca spp. Appl Environ Microbiol 65: 270-277. 16. Dufresne A, Salanoubat M, Partensky F, Artiguenave F, Axmann I, et al. (2003) Genome sequence of the cyanobacterium Prochlorococcus marinus SS120, a nearly minimal oxyphototrophic genome. Proc Natl Acad Sci USA 100: 10020-10025. 17. Palenik B, Brahamsha B, F L, Land M, Hauser L, et al. (2003) The genome of a motile marine Synechococcus Nature 424: 1037-1042. 18. Chain P, Lamerdin J, Larimer F, Rega la W, Lao V, et al. (2003) Complete genome sequence of the ammonia-oxidizing bacterium and obligate chemolithoautotroph Nitrosomonas europaea J Bacteriol 185: 2759-2773. 19. Larimer F, Chain P, Hauser L, Lamerdin J, Malfatti S, et al. (2004) Complete genome sequence of the metabolically versatile photosynt hetic bacterium Rhodopseudomonas palustris Nature Biotechnol 22: 55-61. 20. Eisen JA, Nelson KE, Paulsen IT, Heid elberg JF, Wu M, et al. (2002) The complete genome sequence of Chlorobium tepidum TLS, a photosynthetic, anaerobic, green-sulfur bacterium. Proc Natl Acad Sci USA 99: 95099514. 21. Beller HR, Chain PSG, Letain TE, Chak icherla A, Larimer FW, et al. (2006) The Genome Sequence of the Obligately Chemolithoautotrophic, Facultatively Anaerobic Bacterium Thiobacillus denitrificans J Bacteriol 188: 1473-1488. 22. Deckert G, Warren PV, G aasterland T, Young WG, Lenox AL, et al. (1998) The complete genome of the hyperthermophilic bacterium Aquifex aeolicus Nature 392: 353-358. 23. Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25: 955964. 24. Casjens S (2003) Prophage s and bacterial genomics: What have we learned so far? Molec Mi crobiol 49: 277-300. 25. Lucchini S, Desiere F, Brussow H (1999) Similarly organized lysogeny modules in temperate Siphoviridae fr om low GC content gram positive bacteria. Virology 263: 427-435. 26. Weigele PR, Sampson L, Winn-Staple y D, Casjens SR (2005) Molecular genetics of bacteriophage P22 scaffo lding protein's functional domains. J Molec Biol 348: 831-844. 27. Sanger F, Coulson AR, Hong GF, Hill DF, Petersen GB (1982) Nucleotide sequence of bacteriophage lambda DNA. J Mol Biol 162: 729-773.

PAGE 144

Appendix A continued 132 28. Rohwer F, Segall A, Steward G, Segurit an V, Breitbart M, et al. (2000) The complete genomic sequence of the ma rine phage Roseophage SIO1 shares homology with non-marine phages. Limnol Oceanogr 42: 408-418. 29. Sternberg N, Weisberg R (1977) Packag ing of coliphage lambda DNA. II. The role of gene D protein. J Mol Biol 117: 733-759. 30. Paul JH, Sullivan MB (2005) Marine phage genomics: What have we learned? Curr Opin Biotech 16: 299-307. 31. Canchaya C, Proux C, Fournous G, Bruttin A, Brussow H (2003) Prophage genomics. Microbiol Mo lec Biol Rev 67: 238-276. 32. Friedrich CG, Quentmeier A, Bardischewsky F, Rother D, Kraft R, et al. (2000) Novel genes coding for lith otrophic sulfur oxidation of Paracoccus pantotrophus GB17. J Bacteriol 182: 4677-4687. 33. Rother D, Henrich HJ, Quentmeier A, Bardischewsky F, Friedrich CG (2001) Novel genes of the sox gene cluster, mutagenesis of the flavoprotein SoxF, and evidence for a general sulfur-oxidizing system in Paracoccus pantotrophus GB17. J Bacteriol 183: 4499-4508. 34. Friedrich CG, Bardischewsky F, Rother D, Quentmeier A, Fischer J (2005) Prokaryotic sulfur oxidation. Cu rr Opin Microbiol 8: 253-259. 35. Schutz M, Maldener I, Griesbeck C, Hauska G (1999) Sulfide-quinone reductase from Rhodobacter capsulatus : Requirement for growth, periplasmic localization, and extens ion of gene sequence analysis. J Bacteriol 181: 6516-6523. 36. Javor BJ, Wilmot DB, Vetter RD (1990) pH–Dependent metabolism of thiosulfate and sulfur globules in the chemolithotrophic marine bacterium Thiomicrospira crunogena Arch Microbiol 154: 231–238. 37. Friedrich CG, Rother D, Bardischews ky F, Quentmeier A, Fischer J (2001) Oxidation of Reduced Inorganic Sulfur Compounds by Bacteria: Emergence of a Common Mechanism? Appl Environ Microbiol 67: 28732882. 38. Fani R, Brilli M, Lio P (2005) The or igin and evolution of operons: The piecewise building of the proteobacter ial histidine operon. J Mol Evol 60: 378-390. 39. Price MN, Huang KH, Arkin AP, Alm EJ (2005) Operon formation is driven by co-regulation and not by horizontal gene transfer. Genome Res 15: 809-819. 40. Petri R, Podgorsek L, Imhoff JF (2001) Phylogeny and distribution of the soxB gene among thiosulfateoxidizing bacteria. Fems Microbiol Lett 197: 171-178. 41. Kelly DP, Shergill JK, Lu WP, W ood AP (1997) Oxidative metabolism of inorganic sulfur compounds by bacter ia. Antonie Van Leeuwenhoek Intl J Gen Molec Microbiol 71: 95-107. 42. Nelson DC, Hagen KD (1995) Physiology and Biochemistry of Symbiotic and Free-Living Chemoautotrophic Sulfur Bacteria. Amer Zool 35: 91-101. 43. Schwartz E, Friedrich B (2005) Th e H2-metabolizing prokaryotes. In: Dworkin M, editor. The Prokaryotes: An evolving electronic resource for

PAGE 145

Appendix A continued 133 the microbiological community, release 314, http://linkspringernycom/link/service/books/10125/ New York: Springer-Verlag. 44. Nishihara H, Yaguchi T, Chung SY, Su zuki K, Yanagi M, et al. (1998) Phylogenetic position of an obligately chemoautotrophic, marine hydrogen-oxidizing bacterium, Hydrogenovibrio marinus, on the basis of 16S rRNA gene sequences and two form I RubisCO gene sequences. Arch Microbiol 169: 364-368. 45. Nishihara H, Miyata Y, Miyashita Y, Bernhard M, Pohlmann A, et al. (2001) Analysis of the molecular species of hydrogenase in the cells of an obligately chemolithoautotrophic, mari ne hydrogen-oxidizing bacterium, Hydrogenovibrio marinus Biosci Biotechnol Biochem 65: 2780-2784. 46. Nishihara H, Igarashi Y, Kodama T (1991) Hydrogenovibrio marinus gen. nov., sp. nov., a marine obligately chemolithoautotrophic hydrogenoxidizing bacterium. Int J Syst Bacteriol 41: 130-133. 47. Dross F, Geisler V, Lenger R, Theis F, Krafft T, et al. (1992) The quinonereactive Ni/Fe-hydrogenase of Wollinella succinogenes Eur J Biochem 206: 93-102. 48. Friedrich T, Scheide D (2000) The resp iratory complex I of bacteria, archaea and eukarya and its module common with membrane-bound multisubunit hydrogenases. FEBS Letters 479: 1-5. 49. Smith M, Finel M, Korolik V, Mendz G (2000) Characteristics of the aerobic respiratory chains of the microaerophiles Campylobacter jejuni and Helicobacter pylori Arch Microbiol 174: 1-10. 50. Steuber J (2001) Na+ transl ocation by bacterial NADH:quinone oxidoreductases: an extension to th e complex-I family of primary redox pumps. Biochim Biophys Acta 1505: 45-56. 51. Kumagai H, Fujiwara T, Matsubara H, Saeki K (1997) Membrane localization, topology, and mutual stabilization of the rnfABC gene products in Rhodobacter capsulatus and implications for a new family of energy-coupling NADH oxidoreductase s. Biochemistry 36: 5509-5521. 52. Lange BM, Rujan T, Martin W, Crot eau R (2000) Isoprenoid biosynthesis: The evolution of two ancient and dist inct pathways across genomes. Proc Natl Acad Sci USA 97: 13172-13177. 53. Hedl M, Sutherlin A, Wilding E, M azzulla M, McDevitt D, et al. (2002) Enterococcus faecalis acetoacetyl-coenzyme A thiolase/3-hydroxy-3methylglutaryl-coenzyme A reducta se, a dual-function protein of isopentenyl diphosphate biosynt hesis. J Bacteriol 184: 2116. 54. Wilding EI, Brown JR, Bryant AP, Ch alker AF, Holmes DJ, et al. (2000) Identification, Evolution, and Essentia lity of the Mevalonate Pathway for Isopentenyl Diphosphate Biosynthesis in Gram-Positive Cocci. J Bacteriol 182: 4319-4327. 55. Humbelin M, Thomas A, Lin J, Li J, Jore J, et al. (2002) Genetics of isoprenoid biosynthesis in Paracoccus zeaxanthinifaciens Gene 297: 129139. 56. Preisig O, Zufferey R, Thony-Meyer L, Appleby C, Hennecke H (1996) A high-affinity cbb3 -type cytochrome oxidase terminates the symbiosis-

PAGE 146

Appendix A continued 134 specific respiratory chain of Bradyrhizobium japonicum J Bacteriol 178: 1532-1538. 57. Hooper AB, Arciero DM, Bergmann D, Hendrich MP (2005) The oxidation of ammonia as an energy source in bacteria Dordrecht, the Netherlands: Springer. 58. Jackson JB (2003) Proton transloca tion by transhydrogenase. FEBS Letters 545: 18-24. 59. Boonstra B, French CE, Wainwr ight I, Bruce NC (1999) The udhA Gene of Escherichia coli Encodes a Soluble Pyridine Nucleotide Transhydrogenase. J Bacteriol 181: 1030-1034. 60. Mori S, Kawai S, Shi F, Mikami B, Murata K (2005) Molecular conversion of NAD kinase to NADH kinase thr ough single amino acid residue substitution. J Biol Chem 280: 24104-24112. 61. Paulsen IT, Nguyen L, Sliwinski MK, Rabus R, Saier MH (2000) Microbial genome analyses: comparative transport capabilities in eighteen prokaryotes. J Mol Biol 301: 75-100. 62. Ren Q, Paulsen IT (2005) Comparative an alysis of fundamental differences in membrane transport capabilities in prokaryotes and eukaryotes. PLOS computational biology 1: 190-201. 63. Badger MR, Price GD, Long BM, Woodger FJ (2006) The environmental plasticity and ecological genom ics of the cyanobacterial CO2 concentrating mechanism. J Exp Bot 57: 249-265. 64. Smith KS, Ferry JG (2000) Prok aryotic carbonic anhydrases. FEMS Microbiol Rev 24: 335-366. 65. So AK, Espie GS, Williams EB, Shively JM, Heinhorst S, et al. (2004) A novel evolutionary lineage of carbon ic anhydrase (epsilon class) is a component of the carboxysome sh ell. J Bacteriol 186: 623-630. 66. Sawaya MR, Cannon GC, Heinhorst S, Ta naka S, Williams EB, et al. (2006) The Structure of beta-Carbonic Anhy drase from the Carboxysomal Shell Reveals a Distinct Subclass with One Active Site for the Price of Two. J Biol Chem 281: 7546-7555. 67. Felce J, Saier MH (2004) Carbonic a nhydrase fused to anion transporters of the SulP family: Evidence for a nove l type of bicarbonat e transporter. J Mol Microbiol Biotechnol 8: 169-176. 68. Yoshizawa Y, Toyoda K, Arai H, Is hii M, Igarashi Y (2004) CO2-responsive expression and gene organization of three ribulose-1,5-bisphosphate carboxylase/oxygenase enzymes and carboxysomes in Hydrogenovibrio marinus strain MH-110. J Bacteriol 186: 5685-5691. 69. Hayashi NR, Arai H, Kodama T, Igarashi Y (1997) The novel genes, cbbQ and cbbO located downstream from the RubisCO genes of Pseudomonas hydrogenothermophila affect the conformationa l states and activity of RubisCO. Biochem Bio phys Res Commun 241: 565-569. 70. Hayashi NR, Arai H, Kodama T, Igar ashi Y (1999) The cbbQ genes located downstream of the form I and form II RubisCO genes, affect the activity of both RubisCOs. Biochem Bi ophys Res Commun 266: 177-183.

PAGE 147

Appendix A continued 135 71. Badger M, Hanson D, Price GD (2002) Evolution and diversity of CO2 concentrating mechanisms in cyanob acteria. Funct Plant Biol 29: 161-173. 72. Gibson JL, Tabita FR (1996) The molecular regulation of the reductive pentose phosphate pathway in Prote obacteria and Cyanobacteria. Arch Microbiol 166: 141-150. 73. Kusian B, Bowien B (1997) Organization and regulation of cbb CO2 assimilation genes in autotrophic ba cteria. FEMS Microbiol Rev 21: 135155. 74. Shively JM, Van Keulen G, Meijer WG (1998) Something form almost nothing: carbon dioxide fi xation in chemoautotrophs. Ann Rev Microbiol 52: 191-230. 75. Falcone DL, Tabita FR (1993) Comple mentation analysis and regulation of CO2 fixation gene expression in a ribulose 1,5-bisphosphate carboxylaseoxygenase deletion strain of Rhodospirillum rubrum J Bacteriol 175: 5066-5077. 76. Ding YR, Ronimus RS, Morgan HW (2000) Sequencing, Cloning, and HighLevel Expression of the pfp Ge ne, Encoding a PPi-Dependent Phosphofructokinase from the Extr emely Thermophilic Eubacterium Dictyoglomus thermophilum J Bacteriol 182. 77. Ronimus RS, Morgan HW (2001) The biochemical properties and phylogenies of phosphofructokinases from extremophiles. Extremophiles 5: 357-373. 78. Wood AP, Aurikkoa JP, Kelly DP (2004) A challenge for 21st century molecular biology and biochemistry: what are the causes of obligate autotrophy and methanotrophy? FE MS Microbiol Rev 28: 335-352. 79. Hughes NJ, Clayton C, Chalk P, Kelly D (1998) Helicobacter pylori porCDAB and oorDABC Genes Encode Distinct Pyruvate: Flavodoxin and 2-Oxoglutarate: Acceptor Oxid oreductases Which Mediate Electron Transport to NADP. J Bacteriol 180: 1119-1128. 80. Kather B, K. Stingl, M. Van der Rest K. Altendorf, and D. Molenaar (2000) Another Unusual Type of Citr ic Acid Cycle Enzyme in Helicobacter pylori : the Malate:Quinone Oxidore ductase. J Bacteriol 182: 3204-3209. 81. Gehring U, Arnon DI (1972) Puri fication and Properties of alphaKetoglutarate Synthase from a Phot osynthetic Bacterium. J Biol Chem 247: 6963-6969. 82. Breese K, Boll M, Alt-Morbe J, Sc hagger H, Fuchs G (1998) Genes coding for the benzoyl-CoA pathway of an aerobic aromatic metabolism in the bacterium Thauera aromatica Eur J Biochem 256: 148-154. 83. Jahn D, Verkamp E, Soll D (1992) Glut amyl-transfer RNA: a precursor of heme and chlorophyll biosynthesis. Trends Bioche m Sci 17: 215-218. 84. van Veen HW (1997) Phosphate tran sport in prokaryotes: molecules, mediators and mechanisms. Antonie Van Leeuwenhoek Intl J Gen Molec Microbiol 72: 299-315. 85. Prere MF, Chandler M, Faye t O (1990) Transposition in Shigella dysenteriae : isolation and analysis of IS911, a new member of the IS3 group of insertion sequences. J Bacteriol 172: 4090-4099.

PAGE 148

Appendix A continued 136 86. Dyhrman ST, Chappell PD, Haley ST, Moffett JW, Orchard ED, et al. (2006) Phosphonate utilization by the globa lly important marine diazotroph Trichodesmium. Nature 439: 68-71. 87. Kolowith LC, Ingall ED, Benner R (2001) Composition and cycling of marine organic phosphorus. Limnol Oceanogr 46: 309-320. 88. Klotz MG, Arp DJ, Chain PSG, El-Shei kh AF, Hauser LJ, et al. (2006) The complete genome sequence of th e marine, chemolithoautotrophic, ammonia-oxidizing bacterium Nitrosococcus oceani ATCC19707. Appl Environ Microbiol. In press. 89. Watson SW (1965) Characteristics of a marine nitrifying bacterium, Nitrosocystis oceanus Sp. N. Limnol Oceanogr 10: 274-289. 90. Romling U, Gomelsky M, Galperin MY (2005) C-di-GMP: the dawning of a novel bacterial signalling system Molec Microbiol 57: 629-639. 91. Zhulin I, Taylor B, Dixon R (1997) PA S domain S-boxes in Archaea, bacteria and sensors for oxygen and redox. Trends Biochem Sci 22: 331-333. 92. McCarter LL (2001) Polar Flagellar Mo tility of the Vibrionaceae. Microbiol Mol Biol Rev 65: 445-462. 93. Wadhams GH, Armitage JP (2004) Making sense of it all : Bacterial chemotaxis. Nature Rev Mo lec Cell Biol 5: 1024-1037. 94. Kachlany SC, Planet PJ, DeSalle R, Fine DH, Figurski DH (2001) Genes for tight adherence of Actinobacillus acti nomycetemcomitans : from plaque to plague to pond scum. Trends Microbiol 9: 429-437. 95. Jannasch HW, Mottl MJ (1985) Geomicrobiology of deep-sea hydrothermal vents. Science 229: 717-725. 96. McCollom TM, Shock EL (1997) Geochemical constraints on chemolithoautotrophic metabolism by microorganisms in seafloor hydrothermal systems. Geochi m Cosmochim Acta 61: 4375-4391. 97. Nies DH (2003) Efflux-mediated hea vy metal resistance in prokaryotes. FEMS Microbiol Rev 27: 313-339. 98. Hou S, Saw JH, Lee KS, Freitas TA Belisle C, et al. (2004) Genome sequence of the deep-sea gamma-proteobacterium Idiomarina loihiensis reveals amino acid fermentation as a source of carbon and energy. Proc Natl Acad Sci USA 101: 18036-18041. 99. Nies DH (1999) Microbial heavy-metal resistance. Appl Microbiol Biotechnol 51: 730-750. 100. Edgcomb VP, Molyneaux SJ, Saito MA, Lloyd K, Boer S, et al. (2004) Sulfide ameliorates metal toxicity for deep-sea hydrothermal vent archaea. Appl Environ Micr obiol 70: 2551-2555. 101. Ewing BL, Hillier M, Wendl P, Green P (1998) Basecalling of automated sequencer traces using phred. I. Accu racy assessment. Genome Res 8: 175–185. 102. Ewing B, Green P (1998) Basecalling of automated sequencer traces using phred. II. Error probabilities. Genome Res 8: 186–194. 103. Gordon D, Abajian C, Green P (1998) Consed: a graphical tool for sequence finishing. Genome Res 8: 195–202

PAGE 149

Appendix A continued 137 104. Delcher AL, Harmon D, Kasif S, Wh ite O, Salzberg SL (1999) Improved microbial gene identification with GLIMMER. Nucleic Acids Res 27: 4636-4641. 105. Badger JH, Olsen GJ (1999) CRITICA : coding region identification tool invoking comparative analysis. Molec Biol Evol 16: 512-524. 106. Kanehisa M, Goto S (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res 28: 27-30. 107. McHardy AC, Goesmann A, Puhler A, Meyer F (2004) Development of joint application strategies for two microbi al gene finders. Bioinformatics 20: 1622-1631. 108. Meyer F, Goesmann A, McHardy AC, Bartels D, Bekel T, et al. (2003) GenDB--An open source genome anno tation system for prokaryotic genomes. Nucleic Acids Res 31: 2187-2195. 109. Krogh A, Larsson B, von Heijne G, Sonnhammer ELL (2001) Predicting transmembrane protein topology with a hidden Markov model: Application to complete genom es. J Molec Biol 305: 567-580. 110. Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: Si gnalP 3.0. J Molec Biol 340: 783-795. 111. Ren Q, Kang KH, Paulsen IT (2004) Tran sportDB: a relati onal database of cellular membrane transport system s. Nucleic Acids Res 32: D284-D288. 112. Markowitz VM, Korzeniewski F, Palani appan K, Szeto E, Werner G, et al. (2006) The integrated microbial geno mes (IMG) system. Nucl Acids Res 34: D344-348. 113. Swofford DL (2002) PAUP*. Phylogene tic Analysis Using Parsimony (*and Other Methods). Version 4 ed. Sunderland, Massachusetts: Sinauer Associates. 114. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL X windows interface: Flexible strategies for multiple sequence alignment aided by quality an alysis tools. Nucl Acids Res 25: 4876-4882. 115. Lin JT, Goldman BS, Stewart V (1994) The Nasfedcba Operon for Nitrate and Nitrite Assimilation in Klebsiella pneumoniae M5al. J Bacteriol 176: 2551-2559. 116. Merrick MJ, Edwards RA (1995) Nitroge n control in bacteria. Microbiol Rev 59: 604-622. 117. Jensen RA, Nasser DS, Nester EW ( 1967) Comparative control of a branchpoint enzyme in microorganisms. J Bacteriol 94: 1582-1593. 118. Lawther RP, Wek RC, Lopes JM, Pereir a R, Taillon BE, et al. (1987) The complete nucleotide sequence of the ilvGMEDA operon of Escherichia coli K-12. Nucleic Acids Res 15: 2137-2155. 119. Calhoun D, Bonner C, Gu W, Xie G, Jensen R (2001) The emerging periplasm-localized subclass of AroQ chorismate mutases, exemplified by those from Salmonella typhimurium and Pseudomonas aeruginosa Genome Biol 2: rese arch0030.0031 research0030.0016. 120. Fuchs TM, Schneider B, Krumbach K, Eggeling L, Gross R (2000) Characterization of a Bordetella pertussis Diaminopimelate (DAP)

PAGE 150

Appendix A continued 138 Biosynthesis Locus Identifies dapC a Novel Gene Coding for an NSuccinyl-L,L-DAP Aminotransferase. J Bacteriol 182: 3626-3631. 121. Cox RJ, Wang PSH (2001) Is N-acetylorn ithine aminotransferase the real Nsuccinyl-LL-diaminopimelate aminotransferase in Escherichia coli and Mycobacterium smegmatis ? J Chem Soc-Perkin Transactions 1: 20062008. 122. Akochy PM, Bernard D, Roy PH, Lapoi nte J (2004) Direct glutaminyl-tRNA biosynthesis and indirect aspa raginyl-tRNA biosynthesis in Pseudomonas aeruginosa PAO1. J Bacteriol 186: 767-776. 123. Champagne KS, Sissler M, Larrabee Y, Doublie S, Francklyn CS (2005) Activation of the Hetero-octameric ATP Phosphoribosyl Transferase through Subunit Interface Rearrangement by a tRNA Synthetase Paralog. J Biol Chem 280: 34096-34104. 124. Kong L, Fromant M, Blanquet S, Plateau P (1991) Evidence for a new Escherichia coli protein resembling a lysyltRNA synthetase. Gene 108: 163-164. 125. Scott KM, Schwedock J, Schrag DP Cavanaugh CM (2004) Influence of form IA RubisCO and environmenta l dissolved inorganic carbon on the 13C of the clam-bacterial chemoautotrophic symbiosis Solemya velum Environ Microbiol 6: 1210-1219.

PAGE 151

Appendix A continued 139 Acknowledgments This work was performed under the auspices of the United States Department of Energy by Lawrence Livermore National La boratory, University of California, under contract W-7405-ENG-48. Genome cl osure was funded in part by a USF Innovative Teaching Grant (KMS). SKF, CAK, and KMS gratefully acknowledge support from the United States Department of Agriculture Higher Education Challenge Grants Program (Award # 20053841115876). SMS kindly acknowledges support thr ough a fellowship received from the Hanse Wissenschaftskolleg in Delmenhorst, Germany ( ). MH was supported by a WHOI postdoctoral scholar ship. We would like to thank Hannah Rutherford for her assistance in studies to ascertain the sensitivity of T. crunogena to heavy metals, Marian Arada for her he lp in preparing genomic DNA, Jennifer Mobberly for her assistance with inducing phage, and Shana K. Goffredi and Shirley A. Kowalewski for their thoughtfu l suggestions on this manuscript. Doug Nelson and three anonymous reviewers pr ovided constructive comments that substantially improved the manuscript.

PAGE 152

About the author Kimberly Dobrinski did her undergraduate work at the University of South Florida and graduated December 2000 with a Bachelors of Science degree in Biology. While there she did undergraduate research under Dr. Lee Adair at the University of South Florida Medical School She began her graduate work at the University of South Florida in 2003 unde r the supervision of Dr. Jeffrey Yoder studying immune receptors in zebrafish. In 2004 Dr. Yoder left the university, and Kim moved to the lab of Dr. Kath leen Scott where she used Molecular Biology to explore the adaptation of a carbon concentrating mechanism in a chemoautotrophic bacteria from the hydr othermal vents. While pursuing her graduate degree, she was the recipient of a full scholarship to Cold Spring Harbor’s Advanced Bacterial Genetics Cour se, the University of South Florida’s Distinguished Graduate Ac hievement Award and also was a winner in the 2008 Poster Symposium and Competition “Global Challenges for the 21st Century”. After graduation, Kimberly will continue her love of science in a postdoctoral fellowship under Dr. Kim Brown and Dr. Charles Lee at Harvard Medical School, Brigham Women’s Hospital. She is marri ed to a wonderful husband, Joseph, has three beautiful children: Ilena, Jason and Michael, and one granddaughter, Emma.


Download Options

Choose Size
Choose file type
Cite this item close


Cras ut cursus ante, a fringilla nunc. Mauris lorem nunc, cursus sit amet enim ac, vehicula vestibulum mi. Mauris viverra nisl vel enim faucibus porta. Praesent sit amet ornare diam, non finibus nulla.


Cras efficitur magna et sapien varius, luctus ullamcorper dolor convallis. Orci varius natoque penatibus et magnis dis parturient montes, nascetur ridiculus mus. Fusce sit amet justo ut erat laoreet congue sed a ante.


Phasellus ornare in augue eu imperdiet. Donec malesuada sapien ante, at vehicula orci tempor molestie. Proin vitae urna elit. Pellentesque vitae nisi et diam euismod malesuada aliquet non erat.


Nunc fringilla dolor ut dictum placerat. Proin ac neque rutrum, consectetur ligula id, laoreet ligula. Nulla lorem massa, consectetur vitae consequat in, lobortis at dolor. Nunc sed leo odio.