USF Libraries
USF Digital Collections

Microbial population analysis in leachate from simulated solid waste bioreactors and evaluation of genetic relationships...

MISSING IMAGE

Material Information

Title:
Microbial population analysis in leachate from simulated solid waste bioreactors and evaluation of genetic relationships and prevalence of vancomycin resistance among environmental enterococci
Physical Description:
Book
Language:
English
Creator:
Nayak, Bina
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Community structure
DGGE
Methanogens
BOX-PCR
VRE
Dissertations, Academic -- Biology -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Degradation of the several million tons of solid waste produced in the U.S. annually is microbially mediated, yet little is known about the structure of prokaryotic communities actively involved in the waste degradation process. In the first study, leachates generated during degradation of municipal solid waste (MSW) in the presence (co-disposal) or absence of biosolids were analyzed using laboratory-scale bioreactors over an eight-month period. Archaeal and bacterial community structures were investigated by denaturing gradient gel electrophoresis (DGGE) targeting 16S rRNA genes. Regardless of waste composition, microbial communities in bioreactor leachates exhibited high diversity and temporal trends. Methanogen sequences from a co-disposal bioreactor were predominantly affiliated with the orders Methanosarcinales and Methanomicrobiales. Effect of moisture content on indicator organism (IO) survival during waste degradation was studied using culture-based methods. Fecal coliform and Enterococcus concentrations in leachate decreased below detection limits within fifty days of bioreactor operation during the hydrated phase. IOs could be recovered from the bioreactor leachate even after a prolonged dry period. This study advances the basic understanding of changes in the microbial community during solid waste decomposition. The purpose of the second study was to compare the ability of BOX-PCR to determine genetic relatedness with that of the "gold standard" method, 16S rRNA gene sequencing. BOX-PCR typing could clearly differentiate the strains within different Enterococcus species but closely related genera were not as distinguishable. In contrast, 16S rRNA gene sequencing clearly differentiates between closely related genera but cannot distinguish between different strains of Enterococcus species. This study adds to our knowledge of genetic relationships of enterococci portrayed by two separate molecular methods. The incidence of vancomycin resistant enterococci (VRE) in environmental matrices, residential and hospital wastewater was also investigated. Low-level VRE (vanC genotype) were isolated from environmental matrices and residential wastewater. VRE isolates from hospital wastewater were identified as E. faecium and demonstrated resistance to ampicillin, ciprofloxacin and vancomycin (vanA genotype), but sensitivity to chloramphenicol and rifampin. Although no high-level VRE were isolated from surface waters, the high proportion of low-level VRE in environmental matrices is a cause for concern from the public health perspective.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2009.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Bina Nayak.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003226
usfldc handle - e14.3226
System ID:
SFS0027542:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Microbial Population Analysis in Leachate From Simulated Solid Waste Bioreactors and Evaluation of Genetic Relationships and Prevalence of Vancomycin Resistance Among Environmental Enterococci by Bina S. Nayak A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Integrative Biology College of Arts and Sciences University of South Florida Major Professor: Valerie J. Harwood, Ph.D. Daniel V. Lim, Ph.D. Kathleen Scott, Ph.D. Dia ne TeStrake, Ph.D. Degeng Wang, Ph.D. Date of Approval: November 2, 2009 Keywords: community structure, DGGE, methanogens, BOX PCR, VRE. Copyright 2009, Bina S. Nayak

PAGE 2

ACKNOWLEDGEMENTS I would like to express my sincere gratitude to Dr. Valerie J. Harwood and Dr. Diane TeStrake who believed in me and gave me the opportunity to pursue my studies at my own pace while having ample time for my daughter. I also thank my committee members Dr. D aniel Lim, Dr. Kathleen Scott and Dr. Degeng Wang for their guidance, time and support. I would like to express my gratitude to the members of my lab for assisting me with parts of my research and supporting me through difficult times. I would like to ack nowledge my two best friends Katrina Gordon and Stefica Depovic for their love, friendship and encouragement. I would like to extend special thanks to my parents (Shrinivas and Jayashri Nayak) and my siblings for their support, faith and blessings, without which I could not have achieved this degree. Thank you also to my husband Kiran and my sweet daughter, Ruchi, who were extremely co operative throughout my study period and encouraged me to continue my studies even though it took time away from them.

PAGE 3

i TABLE OF CONTENTS LIST OF TABLES ................................ ................................ ................................ .............. v LIST OF FIGURES ................................ ................................ ................................ ........... vi ABSTRACT ................................ ................................ ................................ ...................... vii MICROBIAL POPULATION ANALYSIS IN LEACHATE FROM SIMULATED SOLID WASTE BIOREACTORS ................................ ............................. 1 BACKGROUND ................................ ................................ ................................ .... 1 Waste disposal in landfills ................................ ................................ ............... 1 Leachate characteristics ................................ ................................ ................... 2 Microbial processe s in landfills ................................ ................................ ....... 3 Methanogenesis ................................ ................................ ............................... 5 Microbial characterization of leachate ................................ ............................. 7 Landfill management practices ................................ ................................ ........ 9 Bioreactor studies ................................ ................................ ............................ 9 Research goals ................................ ................................ ............................... 11 References ................................ ................................ ................................ ...... 13 MICROBIAL POPULATION DYNAMICS IN LABORATORY SCALE SOLID WASTE BIOREACTORS IN THE PRESENCE OR ABSENCE OF BIOSOLIDS ................................ ................................ ................................ .... 23 Abstract ................................ ................................ ................................ .......... 23 Introduction ................................ ................................ ................................ .... 24 Materials and Methods ................................ ................................ .................. 26 Bioreactor design ................................ ................................ ...................... 26 Sample processing ................................ ................................ .................... 27 Total microbial concentrations ................................ ................................ 27 Polymerase chain reaction (PCR) for community analysis ...................... 27 Denaturing gradient gel electrophoresis (DGGE) ................................ ..... 28 Cloning and sequence analysis of mcrA gene ................................ .......... 29

PAGE 4

ii Statistical analysis ................................ ................................ ..................... 30 Results ................................ ................................ ................................ ............ 31 Total cell concentrations ................................ ................................ ........... 31 pH of leachate ................................ ................................ ........................... 32 DGGE analysis of microbial communities ................................ ............... 32 Sequence analysis of methanogens ................................ ........................... 34 Discussion ................................ ................................ ................................ ...... 40 Acknowledgements ................................ ................................ ........................ 44 References ................................ ................................ ................................ ...... 45 SURVIVAL OF INDICATOR ORGANISMS DURING WASTE DEGRADATION IN SIMULATED LANDFILL BIOREACTORS ................... 53 Abstract ................................ ................................ ................................ .......... 53 Introduction ................................ ................................ ................................ .... 54 Materials and methods ................................ ................................ ................... 56 Results ................................ ................................ ................................ ............ 60 Hydrated phase ................................ ................................ .......................... 60 Dehydrated phase ................................ ................................ ...................... 63 Discussion ................................ ................................ ................................ ...... 65 References ................................ ................................ ................................ ...... 69 RESEARCH SIGNIFICANCE ................................ ................................ ............. 74 Microbi al community structure ................................ ................................ ..... 74 Methanogen populations ................................ ................................ ................ 75 Survival of indicator organisms during waste degradation ........................... 76 Waste degradation studies ................................ ................................ ............. 76 References ................................ ................................ ................................ ...... 77 EVALUATION OF GENETIC RELATIONSHIPS A ND PREVALENCE OF VANCOMYCIN RESISTANCE IN ENVIRONMENTAL ENTEROCOCCI ................ 79 BACKGROUND ................................ ................................ ................................ .. 79 Identification of enterococci ................................ ................................ .......... 80 ...................... 82 Virulence in enterococci ................................ ................................ ................ 85 Antibiotic resistance in enterococci ................................ ............................... 86 Emergence of VRE ................................ ................................ ........................ 88

PAGE 5

iii VRE in the environment ................................ ................................ ................ 91 Nosocomial VRE ................................ ................................ ........................... 92 Research goals ................................ ................................ ............................... 93 References ................................ ................................ ................................ ...... 94 COMPARISON OF GENOTYPIC AND PHYLOGENETIC RELATIONSHIPS OF ENVIRONMENTAL ENTEROCOCCUS ISOLATES BY BOX PCR TYPING AND 16S rRNA SEQUENCING ........... 117 Introduction ................................ ................................ ................................ .. 117 Materials and methods ................................ ................................ ................. 120 Sample collection and processing ................................ ........................... 120 Sequencing the 16S rRNA gene ................................ ............................. 122 BOX PCR genotyping of enterococci ................................ .................... 123 Results and Discussion ................................ ................................ ................ 124 References ................................ ................................ ................................ .... 133 PREVALENCE OF VANCOMYCIN RESISTANT ENTEROCOCCI IN ENVIRONMENTAL MATRICES AND WASTEWATER .............................. 139 Abstract ................................ ................................ ................................ ........ 139 Introduction ................................ ................................ ................................ .. 140 Materials and methods ................................ ................................ ................. 143 Sampl e collection and processing ................................ ........................... 143 Vancomycin susceptibility testing ................................ .......................... 145 Sequencing the 16S rRNA gene and vanA gene ................................ .... 146 BOX PCR genotyping of enterococci ................................ .................... 148 Screening for virulence factors ................................ ............................... 148 S tatistical analysis ................................ ................................ ................... 149 Results ................................ ................................ ................................ .......... 149 Discussion ................................ ................................ ................................ .... 154 Acknowledgeme nts ................................ ................................ ...................... 157 References ................................ ................................ ................................ .... 158 RESEARCH SIGNIFICANCE ................................ ................................ ........... 171 BOX PCR genotyp ing of enterococci ................................ ......................... 172 Vancomycin resistance in enterococci ................................ ......................... 173 Isolation of VRE from environmental sources ................................ ............ 174

PAGE 6

iv References ................................ ................................ ................................ ........... 175

PAGE 7

v LIST OF TABLES Table 1. Shannon diversity indic es calculated for the DGGE patterns of Archaea and Bacteria ................................ ................................ ................................ ............. 35 Table 2. Frequency of methanogen clones observed in the day 50 and day 218 samples obtained from the co disposal bioreactor. ................................ ................... 38 Table 3 Isolates used in this study listed according to site (Lake Carroll, Hillsborough River and Ben T. Davis beach) and environmental matrix (water, sediment and vegetation). ................................ ................................ ........... 121 Table 4 Primers used in this study. ................................ ................................ ............... 147 Table 5 VRE genotypes observed from environmental water and wastewater samples. ................................ ................................ ................................ ................... 150 Table 6 Low level VRE as a percentage of total enterococci in each matrix (water, sediment, vegetation) at each site. ................................ .............................. 151

PAGE 8

vi LIST OF FIGURES Figure 1. Dendrograms and corresponding principal components analysis of archaeal population structure in (a) MSW and (b) co disposal bioreactors. ............. 36 Figure 2. Dendrograms and corresponding principal components analysis of bacterial population structure in (a) MSW and (b) co disposal bioreactors. ............ 37 Figure 3. Diagram of bioreactor configuration. ................................ ............................... 57 Figure 4. Total cell concentrations (x 10 9 /ml) in leachate during the hydrated phase as measured by BacLight Live/Dead staining. ................................ ............... 61 Figure 5 pH values in duplicate bioreactors (B1 and B2) during the hydrated phase. ................................ ................................ ................................ ........................ 62 Figure 6. Mean concentrations of fecal coliforms (FC) and enterococci (ENC) in leachate sampled we ekly from duplicate bioreactors in the hydrated phase of the experiment. ................................ ................................ ................................ .......... 62 Figure 7 Total cell concentrations (x 10 7 /ml) in leachate from time zero (T 0 ) to twenty four (T 24 ) after rehydratio n of the bioreactor. ................................ ............... 64 Figure 8. Heterotrophic plate counts on R2A agar (aerobic organisms) and anaerobic agar (anaerobic organisms) after bioreactor rehydration. ......................... 64 Figure 9. Dendrogram showing the percent similarity of bacterial DGGE patterns from time zero (T 0 ) to twenty four (T 24 ) after rehydration of the bioreactor. ........... 65 Figure 10. Phylogenetic tree constructed using the neighbor joining algorithm to evaluate the distance between 16S rRNA gene sequences of environmental enterococci. ................................ ................................ ................................ ............. 128 Figure 11 Dendr ogram demonstrating the similarity of BOX PCR patterns of Enterococcus species isolated from environmental matrices. ................................ 132 Figure 12 Dendrogram demonstrating the similarity of BOX PCR patterns of vanA VREF isolated from hospital wastewater, esp positive isolates are underlined. ................................ ................................ ................................ .............. 152

PAGE 9

vii MICROBIAL POPULATION ANALYSIS IN LEACHATE FROM SIMULATED SOLID WASTE BIOREACTORS AND EVALUATION OF GENETIC RELATIONSHIPS AND PREV ALENCE OF VANCOMYCIN RESISTANCE AMONG ENVIRONMENTAL ENTEROCOCCI BINA S. NAYAK ABSTRACT Degradation of the several million tons of solid waste produced in the U.S. annually is microbially mediated, yet little is known about the structure of prokaryotic c ommunities actively involved in the waste degradation process. In the first study, leachates generated during degradation of municipal solid waste (MSW) in the presence (co disposal) or absence of biosolids were analyzed using laboratory scale bioreactors over an eight month period. Archaeal and bacterial community structures were investigated by d enaturing gradient gel electrophoresis (DGGE) targeting 16S rRNA genes. Regardless of waste composition, microbial communities in bioreactor leachates exhibited high diversity and temporal trends. Methanogen sequences from a co disposal bioreactor were predominantly affiliated with the orders Methanosarcinales and Methanomicrobiales Effect of moisture content on indicator organism (IO) survival

PAGE 10

viii during waste degra dation was studied using culture based methods. Fecal coliform and Enterococcus concentrations in leachate decreased below detection limits within fifty days of bioreactor operation during the hydrated phase. IOs could be recovered from the bioreactor leac hate even after a prolonged dry period. This study advances the basic understanding of changes in the microbial community during solid waste decomposition. The purpose of the second study was to compare the ability of BOX PCR to determine genetic relatedne BOX PCR typing could clearly differentiate the strains within different Enterococcus species but closely related genera were not as distinguishable. In contrast, 16S rRNA gene sequencing clearly differentiates between closely related genera but cannot distinguish between different strains of Enterococcus species. This study adds to our knowledge of genetic relationships of enterococci portrayed by two separate molecular methods. The incid ence of vancomycin resistant enterococci (VRE) in environmental matrices, residential and hospital wastewater was also investigated. Low level VRE ( vanC genotype) were isolated from environmental matrices and residential wastewater. VRE isolates from hospi tal wastewater were identified as E. faecium and demonstrated resistance to ampicillin, ciprofloxacin and vancomycin ( vanA genotype), but sensitivity to chloramphenicol and rifampin. Although no high level VRE were isolated from surface waters, the high pr oportion of low level VRE in environmental matrices is a cause for concern from the public health perspective.

PAGE 11

1 MICROBIAL POPULATION ANALYSIS IN LEACHATE FROM SIMULATED SOLID WASTE BIOREACTORS BACKGROUND Waste disposal in landfills The most common pra ctice for disposal of waste generated in countries around the world is landfilling. With increasing global populations, the amount of waste generated each year is growing phenomenally. The world population passed the 6 billion mark at the turn of the centu ry. In the US alone, 254 tons of municipal solid waste (MSW) was generated in 2007 (U.S. EPA 2008) The majority of the waste deposited in landfills is composed of MSW, which includes food waste, yard waste, paper, plastics, metals, glass, rubber, wood, leather, textiles, etc. This waste is comprised of approximately 40 50% cellulose, 12% hemicellulose, 10 15% lignin, and 4% protein (Barlaz et al. 1989) In addition to MSW, other types of wastes that are landfilled include biosolids from wastewater treatment facilities, residues from waste to energy (WTE) and other combustion processes, electronic wastes, construction and demolition wastes. A consequenc e of growing populations in urban areas is the increased production of wastewater, coupled with a decrease in land availability for land application of associated biosolids. Treated and dewatered biosolids are used as fertilizers and soil amendments. The unutilized biosolids are disposed of in landfills (Reinhart 2003) Biosolids are rich in

PAGE 12

2 moisture and nutrients and contain diverse microbial populations that can provide supplementa l inocula for waste degradation reactions (Rivard et al. 1990; Poggi Varaldo 1992) Waste degradation in landfills is a slow, ongoing process occurring over decades and characterized by physicochemical reactions and microbial i nteractions. Leachate characteristics The liquid that percolates through the waste matrix is termed leachate, which solubilizes and mobilizes minerals associated with the waste (Kjeldsen et al. 2002) and also promotes microbially mediated degradation of waste (El Fadel 1999) The composition of leachate is related to the moisture content within landfills and biogeochemical reactions th at occur within the waste matrix. In general, the amount of moisture available to support microbial activity depends on local climatic conditions, e.g. rainfall and temperature, the specific materials deposited in the landfill, and the frequency of leacha te removal and/or recirculation (El Fadel 1999) Among the dominant components of municipal waste are cellulose, hemicellulose, lignin and protein (Barlaz et al 1989) Leachates have been analyzed to determine the amount of dissolved organic matter (recorded as chemical oxygen demand or COD), volatile fatty acids (VFAs), inorganic components such as calcium (Ca 2+ ), magnesium (Mg 2+ ), po tassium (K + ), ammonium (NH 4 + ), iron (Fe 2+ ), sulfate (SO 4 2 ) and hydrogen carbonate (HCO 3 ), heavy metals such as copper, lead nickel and zinc and trace amounts of arsenate, mercury, lithium, etc (Kjeldsen et al. 2002) Due to the differences in waste composition, age and landfilling practices the composition of leachate varies between landfills. The pH of leachate can vary from 4.5 to 9 dep ending on the stage of waste decomposition.

PAGE 13

3 Landfill leachate can carry toxic metabolic products, heavy metals, pharmaceuticals and human pathogens (Mose and Reinthaler 1985; Gerba et al 1995) Leachate contaminat ion of groundwater due to improper waste management practices poses a threat to public health (Christensen et al. 1994; Roling et al. 2001) Leachate pooling at the bottom of the landfill is collected in a network of pipes called the leachate collection system and pumped to a storage tank. The collected leachate is then transported in tankers to a neighboring wastewater treatment plant where it is treated and disposed. Leachate recirculation is practiced in many la ndfills because it provides an additional inoculum of established microbial flora that can boost the rate of the degradation process (Chan 2002) It also reduces the amount of leachate requiring treatment and increases gas production (Reinhart 1996; Warith 1999) In contrast, excessive leachate recirculat ion can result in over saturation of waste and have a toxic effect on sensitive organisms such as methanogens (Reinhart 1996) The frequency and amount of leachate recirculation also plays an important role in the development of certain microbial groups at different time points during waste degradation (Shen et al. 2001) Leachates collected from landfills carry a representative sample of the numerous microorganisms involved in degradat ion of that waste (Gurijala 1993; Pohland and Kim 2000) Studying the microbial community profile of this leachate over a p eriod of time could provide interesting insights into the physical, chemical and biological processes occurring within the landfill. Microbial processes in landfills Landfills provide excellent environments for the development of diverse microbial popul ations due to the wide variety of substrates available to support the physiological requirements of microorganisms. The complexity and composition of microbial

PAGE 14

4 communities in any particular landfill depends on several parameters such as the types of wastes deposited, moisture availability, landfill age and operating practices, toxicity of waste components and their breakdown products, and leachate management practices (Barlaz et al. 1989; Kjeldsen et al. 2002) These parameters have a direct or indirect effect on the pH, dissolved organic and inorganic carbon content, oxidation reduction potential and temperature of the leachate. Waste deposited in landfills is at different stages of degradation depending on the age and depth of the waste. In general, the process of waste degradation is presumed to progress in four stages from the time of deposition till maturation: aerobic, anaerobic, accelerated methane production and decelerated methane production (Barl az et al. 1989) The first stage is dominated by aerobic heterotrophic bacteria that decompose cellulose and consume oxygen and nitrate present in the waste (Pourcher et al. 2001) This results in the production of carbon dioxide and possibly an increase in temperature. After oxygen is a consumed, anaerobic cellulolytic bacteria, i.e., Clostridium spp. and Eubacterium spp., hydrolyze cellulose and hemicellulose into mo nosaccharides that are further fermented to produce alcohols and carboxylic acids (Westlake 1995; Van Dyke and McCarthy 2002; Burrell et al. 2004) Acetogenic bacteria convert these organic acids and alcohols to ace tate, carbon dioxide and hydrogen (Mackie and Bryant 1981) Acetogens can also act as hydrogen oxidizers by reducing carbon dioxide to produce acetate and other low molecular weight organic compounds. Hydrogen has an important role in waste decomposition (Mormile 1996) Hydrogen oxidizing methanogenic Archaea oxidize hydrogen and reduce carbon dioxide to methane (Griffin et al. 1997) Sulfate reducing bacteria (SRB), on the other hand, use

PAGE 15

5 hydrogen as the electron donor and sulfate as the terminal electron acceptor (Daly et al. 2000) These two groups of microorganisms compete for available hy drogen in the landfill waste, which sometimes leads to the inhibition of methanogenesis by the SRBs (Mormile 1996; Raskin 1996) Carbon mineralization by methanogenesis is preferred for landfill functioning because sulfate reducers produce hydrogen sulfide, causing the (Gurijala 1993) Souring of waste reduces the pH and inhibits the activity of methanogens. Methane production and recovery is environmentally and economically desirable due to its usefulness as a biogas for the production of ene rgy in the form of heat and electricity Unfortunately, methane recovery from landfills is affected by waste composition, microbial degradation dynamics and more importantly cost effectiveness. Methane is a potent greenhouse gas and the altenative to recov ering methane, controlling methane emissions, is equally expensive. Methanotrophic bacteria present in the upper oxic region of the landfill use methane as their carbon and energy source and convert it to carbon dioxide (Whalen 1990; Wise et al. 1999) Therefore, in landfills where methane recovery is not an option, methanotrophs play an important role in controlling the emission of methane from landfill sites. Methanogenesis According to the US Environmental Protec tion Agency (EPA), in 2007, MSW landfills were responsible for approximately 23% of methane emissions in the U.S.making them the second largest anthropogenic source of methane (U.S. EPA 2009) Methanogens are classified under the domain Archaea which includes three kingdoms: Euryarchaeota Crenarchaeota and Korarchaeota (Winker and Woese 1991; Barns et al 1996)

PAGE 16

6 Methanogens belong to the kingdom Euryarchaeota and are divided into five orders: Methanosarcinales Methanom icrobiales Methanobacteriales Methanococcales and Methanopyrales (Bapteste et al 2005) Methanogens are a strictly anaero bic, mostly autotrophic group with very diverse 16S rRNA sequences inhabiting varied ecological habitats ranging from the human digestive system to submarine volcanic vents (Ferry 1993) They utilize a limited range of substrates including hydrogen, acetate, formate, methanol and other methylated substrates. Several genome sequencing projects ( Methanobrevibacter smithii Methanococcus maripaludis Methanococcus jannaschii and Methanobacterium thermoautotrophicum ) have a dded to our knowledge of the complex metabolic pathway of methanogenesis (Bult et al 1996; Smith et al 1997; Hendrickson et al 2004; Samuel et al 2007) The most widely studied enzyme of methanogenesis pathways is methyl coenzyme M reductase (MCR), which catalyzes the final step of Methanogenesis whereby the methyl group of methyl S coenzyme M is reduced to methane. The MCR enzyme is comprised of and subunits encoded by the mcrA mcrB and mcrG genes, respe ctively (Bokranz and Klein 1987) The mcrA gene is highly conserved and is the gene that is most frequently used to detect methanogenic activity in varied environments (Lueders et al 2001; Lut on et al 2002; Earl et al 2003; Dhillon et al 2005) Methanogens can be detected and analyzed using molecular techniques such as fluorescence in situ hybridization (FISH) and construction of clone libraries by targeting 16S rDNA (Mori et al 2003) or biomarkers such as methanogen specific DNA sequences (Hales et al 1996; Earl et al 2003; Dhillon et al 2005) Some studies have developed methanogen clone libraries using the primers specific for the ubiquitous 16S

PAGE 17

7 rRNA gene (Huang et al 2003; Mori et al 2003) while others have targeted the mcr gene encoding methyl coenzyme M reductase (MCR) (Hales et al 1996; Nercessian et al 1999) or both (Springer et a l 1995; Lueders et al 2001) Functional genes are used as biomarkers because their higher rates of evolutionary change enhance the ability to resolve sequences at the species level compared to the 16S rRNA gene (B raker et al 2000; Junca and Pieper 2004) Currently, limited information is available regarding the composition of methanogen populations in landfills. The heterogeneous nature of waste makes it impossible to determine the type of substrates used by meth anogens and the amount of methane generated during different stages of waste decomposition. This information could be useful in developing and improving methane management practices to efficiently recover the methane produced in landfills. Microbial charac terization of leachate In several studies, culture based methods such as heterotrophic plate counts have been applied to evaluate microbial numbers in leachates (Barlaz et al. 1989; Boothe et al. 2001) However, the utility of culture based methods to enumerate and characterize environmental microorganisms is limited due to the highly specific and stringent growth requirements or many microorganisms, coupled with the need of many organisms to function as a consortium (Ward et al. 1992; Amann et al. 1995) Results fro m culture based methods yield a biased subset of the total population and are not effective for assessing the microbial community structure (Hugenholtz and Pace 1996) Molecular methods such as fluorescence in situ hybridization (FISH), denaturing gradient gel electrophoresis (DGGE), and sequencing of cloned DNA (clone libraries) have proven to be useful in identifying microbial species and community diversity in landfill waste

PAGE 18

8 (Roling et al. 2001; Huang et al. 2002; Burrell et al. 2004; Huang et al. 2005) Complex community profiles can be statistically analyzed to determine the degree of diversity and levels of similarity among microbial populations in any given microbial ecosystem (Fromin et al. 2002) Microbial ecosystem studies focus on microbial interactions with their environments and changes occurring in the community structures in response to shifts in environmental parameters. The extent of microbial diversity can be effectively captured by molecular biological techniques like genetic fingerprinting, temperature gradient gel electro phoresis (TGGE) and denaturing gradient gel electrophoresis (DGGE) (Muyzer and Smalla 1998) Bands from DGGE and TGGE gels can be excised and used for subsequent sequencing reactions. Comp lex community profiles obtained by using these techniques can be analyzed using statistical programs to determine the degree of diversity and levels of similarity between microbial populations in any given microbial ecosystem (Demba Diallo 2004) Huang et al used cloning and restriction fragment length polymorphism (RFLP) analysis to outline the archaeal community structure in landfill leachate (Huang et al. 2002) The cloning and sequencing approach was also used to study the bacterial diversity in landfill leachate by Huang et al in another experiment (Huang et al. 2005) Roling et al performed cloning and DGGE profiling of landfill leachate polluted aquifers to determine the correlation between the microbial community struct ure and hydrochemistry in the aquifers (Roling et al. 2001) To the best of our knowledge, no previous study has followed changes in archaeal and bacterial DGGE profiles over an extended period as attempted in this study.

PAGE 19

9 Landfill management practices Typical ly, leachate that is formed in landfills flows into leachate collection systems that are installed beneath a drainage layer, and is subsequently either recirculated through the landfill, treated on site, or treated at a wastewater treatment facility. In so me cases, clogging of leachate collection systems can occur and prevent drainage of the landfill, resulting in waste submergence (Fleming et al. 1999) Waste submergence cause s accumulation of toxic compounds, inhibiting microbial activity and slowing waste degradation. Leachate may also leak through compromised pipes and contaminate the groundwater (Fleming et al. 1999) A host of factors have been implicated in the clogging of landfill leachate collection systems including waste characteristics (Cardoso et al 2006) physical chemical parameters (Ledakowicz and Kaczorek 2004; VanGulck 2004) and drainage system design (Rowe 2000b) however, limited information has been reported on the temporal variations of the microbial community structure associated with the clogging phenome non. The deposition of inorganic chemicals such as calcium carbonate and hydroxyapatite, as well as the presence of biofilms presumably result in the phenomenon of clogging of leachate collection systems, thereby reducing the life of the landfill (Rowe 2000a; b; 2002) (area available for waste disposal) and the amount of waste deposited over a period of earthen material and monitored for the next thirty years. Bioreactor studies The heterogeneous nature of the waste deposited in landfills makes it pa rticularly challenging to design sampling strategies and to conduct analysis of leachate

PAGE 20

10 composition. Therefore, several studies have employed the use of laboratory scale bioreactors or lysimeters to simulate the conditions in landfills (Griffin et al 1997; Pohland and Kim 2000; Burrell et al 2004; Fleming 2004; Ledakowicz and Kaczorek 2004; Calli et al 2005) Bioreactors make it possible to control or modify the various factors that influence waste degradation su ch as temperature, moisture and accumulation of toxic compounds. Furthermore, bioreactors facilitate the investigation of the effect of manipulating one or more of these variables on the overall process of waste decomposition. Bioreactors have been employ ed to study the physical, chemical and microbiological changes occurring during the degradation of waste deposited in landfills. Effects of leachate recirculation, seasonal variation, amount of gas generation, development of microbial populations, attenuat ion of pollutants, aerobic versus anaerobic waste degradation and clogging of leachate collection systems have been the focus of several studies. Stessel and Murphy (1992) studied the effect of moisture and air on the rate of degradation with the aim of op timizing the quantities of these two variables to achieve reduction of waste within minimal amount of time (Stessel 1992) A comparison of laborat ory versus in situ field bioreactors conducted in China revealed the feasibility of the use of bioreactors to mimic refuse decomposition in landfills (Youcai et al 2002) Methanotroph community diversity and methane oxidation rates associated with different plant covers were studied in bioreactors by using methanotroph diagnostic microarr ays (Stralis Pavese et al 2004) Burrell et al used methanogenic bioreactors to detect and identify cellulolytic Clostridium populations involved in anaerobic waste degradation (Burrell et al 2004) In spite of the usefulness of bioreactors in reducing and controlling

PAGE 21

11 variables associated with refuse decomposition, it is necessary to corroborate data obtained from bioreactor studies with data from actual landfill operation. Research goals Hypothesis 1: Microbial community structure will vary in bioreactors as a function of waste composition. Methodology 1: Laboratory scale bioreactors were constructed and packed with only MSW or MSW combined with biosolids and ash from waste to energy processes. Leachat e generated in the bioreactors was sampled once every week for a period of eight months and analyzed for total cell concentrations and microbial community structure. Hypothesis 2: Microbial populations in bioreactors will exhibit temporal shifts, reflectin g changes in the community structure with the progression of waste degradation. Methodology 2: DGGE was used to evaluate the community development in terms of dominant members of the Archaea and Bacteria providing a broad snapshot of changes in the microb ial community over an eight month period. Hypothesis 3: Microbial concentrations in bioreactors supplemented with biosolids will be higher than in bioreactors packed with MSW only. Methodology 3: Total microbial concentrations in the leachate sampled from bioreactors with different waste composition were assessed by fluorescence microscopy. Hypothesis 4: Methanogens belonging to many different genera will be identified in the quence diversity of methanogens will decrease.

PAGE 22

12 Methodology 4: Methanogen populations were analyzed from an early (day 50) sample and a late (day 218) sample of leachate by cloning and sequencing of the mcrA gene coding for the alpha subunit of the methyl coenzyme M reductase (MCR) enzyme. Hypothesis 5: Fecal coliforms and enterococci will be present at high concentrations during the initial stages of waste degradation. Other microbial community members such as cellulose degraders, sulfate reducing bacteri a and methanogens will outcompete the indicator organisms as waste degradation progresses. Methodology 5: Survival of indicator organisms such as fecal coliforms and enterococci during the process of waste degradation was studied by membrane filtration o f leachate and indicator organism concentrations in the leachate were evaluated after rehydration of the bioreactor. Novel aspects of this study include the temporal pro filing of Archaea and Bacteria populations using DGGE, identifying and comparing methanogen populations during the initial and later stages of waste decomposition and investigating the survival capability of indicator organisms through the waste degradatio n process. Portions of this work were 107(4): 1330 1339 ).

PAGE 23

13 References Amann, R.I., Ludwig, W. and Schleifer, K.H. (1995) Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 59 143 169. Bapteste, E., Brochier, C. and Boucher, Y. (2005) Higher level classificat ion of the Archaea: evolution of methanogenesis and methanogens. Archaea 1 353 363. Barlaz, M.A., Schaefer, D.M. and Ham, R.K. (1989) Bacterial population development and chemical characteristics of refuse decomposition in a simulated sanitary landfill. A ppl Environ Microbiol 55 55 65. Barns, S.M., Delwiche, C.F., Palmer, J.D. and Pace, N.R. (1996) Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences. Proc Natl Acad Sci U S A 93 9188 9193. Bokranz, M. and Klein, A. (1987) Nucleotide sequence of the methyl coenzyme M reductase gene cluster from Methanosarcina barkeri. Nucleic Acids Res 15 4350 4351. Boothe, D.D.H., Smith, M.C., Gattie, D.K. and Das, K.C. (2001) Characterization of microbial populations in landfil l leachate and bulk samples during aerobic bioreduction. Adv Environ Res 5 285 294. Braker, G., Zhou, J., Wu, L., Devol, A.H. and Tiedje, J.M. (2000) Nitrite reductase genes (nirK and nirS) as functional markers to investigate diversity of denitrifying ba cteria in pacific northwest marine sediment communities. Appl Environ Microbiol 66 2096 2104. Bult, C.J., White, O., Olsen, G.J., Zhou, L., Fleischmann, R.D., Sutton, G.G., Blake, J.A., FitzGerald, L.M., Clayton, R.A., Gocayne, J.D., Kerlavage, A.R., Dou gherty, B.A.,

PAGE 24

14 Tomb, J.F., Adams, M.D., Reich, C.I., Overbeek, R., Kirkness, E.F., Weinstock, K.G., Merrick, J.M., Glodek, A., Scott, J.L., Geoghagen, N.S. and Venter, J.C. (1996) Complete genome sequence of the methanogenic archaeon, Methanococcus jannasch ii. Science 273 1058 1073. Burrell, P.C., O'Sullivan, C., Song, H., Clarke, W.P. and Blackall, L.L. (2004) Identification, detection, and spatial resolution of Clostridium populations responsible for cellulose degradation in a methanogenic landfill leacha te bioreactor. Appl Environ Microbiol 70 2414 2419. Calli, B., Mertoglu, B., Inanc, B. and Yenigun, O. (2005) Methanogenic diversity in anaerobic bioreactors under extremely high ammonia levels. Enz Microb Technol 37 448 455. Cardoso, A.J., Levine, A.D., Nayak, B.S., Harwood, V.J. and Rhea, L.R. (2006) Lysimeter comparison of the role of waste characteristics in the formation of mineral deposits in leachate drainage systems. Waste Manag Res 24 560 572. Chan, G., Chu, LM, Wong, MH (2002) Effects of leacha te recirculation on biogas production from landfill co disposal of municipal solid waste, sewage sludge and marine sediment. Env Pollution 118 393 399. Christensen, T.H., Kjeldsen, P., Albrechtsen, H.J., Heron, G., Nielsen, P.H., Bjerg, P.L. and Holm, P.E (1994) Attenuation of Landfill Leachate Pollutants in Aquifers. Crit Reviews Environ Sci Technol 24 119 202.

PAGE 25

15 Daly, K., Sharp, R.J. and McCarthy, A.J. (2000) Development of oligonucleotide probes and PCR primers for detecting phylogenetic subgroups of su lfate reducing bacteria. Microbiology 146 1693 1705. Demba Diallo, M., Willems, A., Vloemans, N., Cousin, S., Vandekerckhove, T. T., de Lajudie, P., Neyra, M., Vyverman, W., Gillis, M., Van der Gucht, K. (2004) Polymerase chain reaction denaturing gradien t gel electrophoresis analysis of the N2 fixing bacterial diversity in soil under Acacia tortilis ssp. raddiana and Balanites aegyptiaca in the dryland part of Senegal. Environ Microbiol 6 400 415. Dhillon, A., Lever, M., Lloyd, K.G., Albert, D.B., Sogin, M.L. and Teske, A. (2005) Methanogen diversity evidenced by molecular characterization of methyl coenzyme M reductase A (mcrA) genes in hydrothermal sediments of the Guaymas Basin. Appl Environ Microbiol 71 4592 4601. Earl, J., Hall, G., Pickup, R.W., Ri tchie, D.A. and Edwards, C. (2003) Analysis of methanogen diversity in a hypereutrophic lake using PCR RFLP analysis of mcr sequences. Microb Ecol 46 270 278. El Fadel, M. (1999) Leachate recirculation effects on settlement and biodegradation rates in MSW landfills. Environ Technol 20 121 133. Ferry, J.G. (1993) Methanogenesis. Ecology, physiology, biochemistry and genetics. Chapman & Hall, New York, N.Y. Fleming, I.R., Rowe, R.K. and Cullimore, D.R. (1999) Field Observations of clogging in a landfill lea chate colllection system. Can Geotech 36 685 707.

PAGE 26

16 Fleming, I.R., Rowe, R.K. (2004) Laboratory studies of clogging of landfill leachate collection and drainage systems. Can Geotech J/Rev Can Geotech 41 134 153. Fromin, N., Hamelin, J., Tarnawski, S., Roes ti, D., Jourdain Miserez, K., Forestier, N., Teyssier Cuvelle, S., Gillet, F., Aragno, M. and Rossi, P. (2002) Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns. Environ Microbiol 4 634 643. Gerba, C.P., Huber, M.S., Nar anjo, J., Rose, J.B. and Bradford, S. (1995) Occurrence of Enteric Pathogens in Composted Domestic Solid Waste Containing Disposable Diapers. Waste Manag Res 13 315 324. Griffin, M.E., McMahon, K.D., Mackie, R.I. and Raskin, L. (1997) Methanogenic populat ion dynamics during start up of anaerobic digesters treating municipal solid waste and biosolids. Biotechnol Bioeng 57 342 355. Gurijala, K., Suflita JM (1993) Environmental factors influencing methanogenesis from refuse in landfill samples. Environ Sci T echnol 27 1176 1181. Hales, B.A., Edwards, C., Ritchie, D.A., Hall, G., Pickup, R.W. and Saunders, J.R. (1996) Isolation and Identification of Methanogen Specific DNA from Blanket Bog Peat by PCR Amplification and Sequence Analysis. Appl Environ Microbiol 62 668 675. Hendrickson, E.L., Kaul, R., Zhou, Y., Bovee, D., Chapman, P., Chung, J., de Macario, E.C., Dodsworth, J.A., Gillett, W., Graham, D.E., Hackett, M., Haydock, A.K., Kang, A., Land, M.L., Levy, R., Lie, T.J., Major, T.A., Moore, B.C., Porat, I. Palmeiri, A., Rouse, G., Saenphimmachak, C., Soll, D., Van Dien, S., Wang, T., Whitman, W.B., Xia, Q., Zhang, Y., Larimer, F.W., Olson, M.V. and Leigh, J.A. (2004) Complete genome

PAGE 27

17 sequence of the genetically tractable hydrogenotrophic methanogen Methanoc occus maripaludis. J Bacteriol 186 6956 6969. Huang, L.N., Chen, Y.Q., Zhou, H., Luo, S., Lan, C.Y. and Qu, L.H. (2003) Characterization of Methanogenic Archaea in the Leachate of a Closed Municipal Solid Waste Landfill. FEMS Microbiol Ecol 46 171 177. H uang, L.N., Zhou, H., Chen, Y.Q., Luo, S., Lan, C.Y. and Qu, L.H. (2002) Diversity and structure of the archaeal community in the leachate of a full scale recirculating landfill as examined by direct 16S rRNA gene sequence retrieval. FEMS Microbiol Lett 21 4 235 240. Huang, L.N., Zhu, S., Zhou, H. and Qu, L.H. (2005) Molecular phylogenetic diversity of bacteria associated with the leachate of a closed municipal solid waste landfill. FEMS Microbiol Lett 242 297 303. Hugenholtz, P. and Pace, N.R. (1996) Iden tifying microbial diversity in the natural environment: a molecular phylogenetic approach. Trends Biotechnol 14 190 197. Junca, H. and Pieper, D.H. (2004) Functional gene diversity analysis in BTEX contaminated soils by means of PCR SSCP DNA fingerprintin g: comparative diversity assessment against bacterial isolates and PCR DNA clone libraries. Environ Microbiol 6 95 110. Kjeldsen, P., Barlaz, M.A., Rooker, A.P., Baun, A., Ledin, A. and Christensen, T.H. (2002) Present and long term composition of MSW lan dfill leachate: A review. Crit Rev Environ Sci Technol 32 297 336.

PAGE 28

18 Ledakowicz, S. and Kaczorek, K. (2004) Laboratory simulation of anaerobic digestion of municipal solid waste. J Environ Sci Health A Tox Hazard Subst Environ Eng 39 859 871. Lueders, T., Chin, K.J., Conrad, R. and Friedrich, M. (2001) Molecular analyses of methyl coenzyme M reductase alpha subunit (mcrA) genes in rice field soil and enrichment cultures reveal the methanogenic phenotype of a novel archaeal lineage. Environ Microbiol 3 194 204. Luton, P.E., Wayne, J.M., Sharp, R.J. and Riley, P.W. (2002) The mcrA gene as an alternative to 16S rRNA in the phylogenetic analysis of methanogen populations in landfill. Microbiology 148 3521 3530. Mackie, R.I. and Bryant, M.P. (1981) Metabolic Ac tivity of Fatty Acid Oxidizing Bacteria and the Contribution of Acetate, Propionate, Butyrate, and CO(2) to Methanogenesis in Cattle Waste at 40 and 60 degrees C. Appl Environ Microbiol 41 1363 1373. Mori, K., Sparling, R., Hatsu, M. and Takamizawa, K. (2 003) Quantification and diversity of the archaeal community in a landfill site. Can J Microbiol 49 28 36. Mormile, M.R., Gurijala, K.R., Robinson, J.A., McInerney, M.J., Suflita, J.M. (1996) The importance of hydrogen in landfill fermentations. Appl Envir on Microbiol 62 1583 1588. Mose, J.R. and Reinthaler, F. (1985) Microbial Contamination of Hospital Waste and Household Refuse. Zentralblatt Fur Bakteriologie Mikrobiologie Und Hygiene Serie B Umwelthygiene Krankenhaushygiene Arbeitshygiene Praventive Med izin 181 98 110.

PAGE 29

19 Muyzer, G. and Smalla, K. (1998) Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Van Leeuwenhoek 73 127 141. Nercessian, D., Upton, M., Lloyd D. and Edwards, C. (1999) Phylogenetic analysis of peat bog methanogen populations. FEMS Microbiol Lett 173 425 429. Poggi Varaldo, H.M., Oleszkiewicz, J. A. (1992) Anaerobic co composting of municipal solid waste and waste sludge at high total solids l evels. Environ Technol 13 409 421. Pohland, F.G. and Kim, J.C. (2000) Microbially mediated attenuation potential of landfill bioreactor systems. Water Sci Technol 41 247 254. Pourcher, A., Sutra, L., Hebe, I.I., Moguedet, G., Bollet, C., Simoneau, P. and Gardan, L. (2001) Enumeration and characterization of cellulolytic bacteria from refuse of a landfill. FEMS Microbiol Ecol 34 229 241. Raskin, L., Rittman, B.E., Stahl, D.A. (1996) Competition and coexistence of sulfate reducing and methanogenic populati ons in anaerobic biofilms. Appl Environ Microbiol 62 3847 3857. Reinhart, D.R., Al Yousfi, B.A. (1996) The impact of leachate recirculation on municipal solid waste landfill operating characteristics. Waste Manag Res 14 337 346. Reinhart, D.R., Chopra, M B., Sreedharan, A., Koodhathinkal, B., Townsend, T.G. (2003) Design and operational issues related to the co disposal of sludges and biosolids in class I landfills. Report #0132010 03 Florida Center for Solid and Hazardous Waste Management

PAGE 30

20 Rivard, C.J., Vinzant, T.B., Adney, W.S., Grohmann, K. and Himmel, M.E. (1990) Anaerobic Digestibility of 2 Processed Municipal Solid Waste Materials. Biomass 23 201 214. Roling, W.F., van Breukelen, B.M., Braster, M., Lin, B. and van Verseveld, H.W. (2001) Relationsh ips between microbial community structure and hydrochemistry in a landfill leachate polluted aquifer. Appl Environ Microbiol 67 4619 4629. Rowe, R.K., Armstrong, M.D., Cullimore, D.R. (2000a) Mass loading and the rate of clogging due to municipal solid wa ste leachate. Can Geotech J/Rev Can Geotech 37 355 370. Rowe, R.K., Armstrong, M.D., Cullimore, D.R. (2000b) Particle size and clogging of granular media permeated with leachate. J Geotech Geoenviron Eng 126 775 786. Rowe, R.K., VanGulck, J.F., Millward, S.C. (2002) Biologically induced clogging of a granular medium permeated with synthetic leachate. J Environ Eng Sci/Rev gen sci env 1 135 156. Samuel, B.S., Hansen, E.E., Manchester, J.K., Coutinho, P.M., Henrissat, B., Fulton, R., Latreille, P., Kim, K. Wilson, R.K. and Gordon, J.I. (2007) Genomic and metabolic adaptations of Methanobrevibacter smithii to the human gut. Proc Natl Acad Sci United States of America 104 10643 10648. Shen, D.S., He, R., Ren, G.P., Traore, I. and Feng, X.S. (2001) Effect of leachate recycle and inoculation on microbial characteristics of municipal refuse in landfill bioreactors. J Environ Sci (China) 13 508 513.

PAGE 31

21 Smith, D.R., Doucette Stamm, L.A., Deloughery, C., Lee, H., Dubois, J., Aldredge, T., Bashirzadeh, R., Blakely, D ., Cook, R., Gilbert, K., Harrison, D., Hoang, L., Keagle, P., Lumm, W., Pothier, B., Qiu, D., Spadafora, R., Vicaire, R., Wang, Y., Wierzbowski, J., Gibson, R., Jiwani, N., Caruso, A., Bush, D., Reeve, J.N. and et al. (1997) Complete genome sequence of Me thanobacterium thermoautotrophicum deltaH: functional analysis and comparative genomics. J Bacteriol 179 7135 7155. Springer, E., Sachs, M.S., Woese, C.R. and Boone, D.R. (1995) Partial gene sequences for the A subunit of methyl coenzyme M reductase (mcrI ) as a phylogenetic tool for the family Methanosarcinaceae Intl J Syst Bacteriol 45 554 559. Stessel, R., Murphy, RJA (1992) Lysimeter study of the aerobic landfill concept. Waste Manage Res 10 485 503. Stralis Pavese, N., Sessitsch, A., Weilharter, A., Reichenauer, T., Riesing, J., Csontos, J., Murrell, J.C. and Bodrossy, L. (2004) Optimization of diagnostic microarray for application in analysing landfill methanotroph communities under different plant covers. Environ Microbiol 6 347 363. U.S. EPA (200 8) Municipal Solid Waste in the United States: 2007 Facts and Figures. EPA530 R 08 010. U.S. Environmental Protection Agency. Office of Solid Waste (5306P). U.S. EPA (2009) Inventory of U.S. Greenhouse Gas Emissions and Sinks:1990 2007. EPA 430 R 09 004. U.S. Environmental Protection Agency Washington D.C. 20460.

PAGE 32

22 Van Dyke, M.I. and McCarthy, A.J. (2002) Molecular biological detection and characterization of Clostridium populations in municipal landfill sites. Appl Environ Microbiol 68 2049 2053. VanGulc k, J.F., Rowe, R.K. (2004) Evolution of clog formation with time in columns permeated with synthetic landfill leachate. J Contam Hydrol 75 115 139. Ward, D.M., Bateson, M.M., Weller, R. and Ruff Roberts, A. (1992) Ribosomal RNA analysis of microorganisms as they occur in nature. Adv Microb Ecol 12 219 286. Warith, M.A., Zekry, W., Gawri, N. (1999) Effect of leachate recirculation on municipal solid waste biodegradation. Water Qual Res J Can 34 267 280. Westlake, K., Archer, D.B., Boone, D.R. (1995) Diver sity of cellulolytic bacteria in landfill. J Appl Bacteriol 79 73 78. Whalen, S.C., Reeburgh, W.S., Sandbeck, K.A. (1990) Rapid methane oxidation in a landfill cover soil. Appl Environ Microbiol 56 3405 3411. Winker, S. and Woese, C.R. (1991) A definitio n of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics. Syst Appl Microbiol 14 305 310. Wise, M.G., McArthur, J.V. and Shimkets, L.J. (1999) Methanotroph diversity in landfill soil: isolation of novel type I and type II methanotrophs whose presence was suggested by culture independent 16S ribosomal DNA analysis. Appl Environ Microbiol 65 4887 4897. Youcai, Z., Luochun, W., Renhua, H., Dimin, X. and Guowei, G. (2002) A comparison of refuse attenuation in labo ratory and field scale lysimeters. Waste Manag 22 29 35.

PAGE 33

23 MICROBIAL POPULATION DYNAMICS IN LABORATORY SCALE SOLID WASTE BIOREACTORS IN THE PRESENCE OR ABSENCE OF BIOSOLIDS Abstract Aims: Decomposition of solid waste is microbially mediated, yet little i s known about the associated structure and temporal changes in prokaryotic communities. Bioreactors were used to simulate landfill conditions and archaeal and bacterial community development in leachate was examined over eight months. Methods and Results: Municipal solid waste (MSW) was deposited in laboratory bioreactors with or without biosolids and combustion residues (ash). The near neutral pH fell about half a log by day 25, but recovered to ~7.0 by day 50. Cell concentrations in bioreactors containi ng only MSW were significantly higher than those from co disposal bioreactors. A rchaeal and bacterial community structure was analyzed by d enaturing gradient gel electrophoresis (DGGE) targeting 16S rRNA genes, showing temporal population shifts for both d omains mcrA sequences retrieved from a co disposal bioreactor were predominantly affiliated with the orders Methanosarcinales and Methanomicrobiales Conclusion: Regardless of waste composition, microbial communities in bioreactor leachates exhibited hig h diversity and distinct temporal trends. The solid waste filled bioreactors allowed simulation of solid waste decomposition in landfills while also reducing the variables.

PAGE 34

24 Significance and Impact: This study advances the basic understanding of changes in microbial community structure during solid waste decomposition, which may ultimately improve the efficiency of solid waste management. Introduction Disposal of municipal solid waste (MSW) in landfills supports the development of diverse microbial populati ons (Kjeldsen et al. 2002) The composition of microbial communities is influenced by many factors such as the types of wastes deposited, moisture availability, oxidation reduction states, and temperature (Barlaz et al. 1989a; Kjeldsen et al. 2002) Co disposal of waste includes MSW and other types of wastes, including biosolids from wastewater treat ment facilities, ash residues from waste to energy and other combustion processes, electronic wastes, construction and demolition wastes. Understanding microbial population development in landfills over a period of time is challenging due to the complexit y of waste materials deposited and the spatial heterogeneity of landfills. Previous studies have focused on particular aspects of microbial populations in waste degradation processes. G roup specific primers were employed to detect cellulolytic clostridia (Van Dyke and McCarthy 2002) and fungi (Lockhart et al. 2006) in landfill leachate. Quantitative real time PCR was used to study the development of type I methanotrophic communities during composting of organic matter (Halet et al. 2006) and to determine the abundance of cellulolytic Fibrobacter species i n landfills (McDonald e t al. 2008) Sequencing of cloned DNA (clone libraries) was used to study archaeal populations in the leachate of a full scale recirculating landfill and bacterial populations in the leachate of a closed landfill (H uang et al. 2002; Huang et

PAGE 35

25 al. 2005) Several studies have also investigated methanogenic Archaea populations in landfills (Huang et al. 2003; Uz et al. 2003) yet none of them attempted a temporal comparison. Methanogenesis is a process that gen erates useful methane gas during waste degradation in landfills (Barlaz et al. 1989a; Senior et al. 1990) However, methane recovery rates are affected by waste composition, microbial degradation dynamics and econom ic feasibility. Methane is also a potent greenhouse gas and landfills account for 34 % of all methane emissions (U.S. EPA 1999) Methanogens can be detected and analyzed using molecular techniques such as fluorescence in situ hybridi zation (FISH) (Calli et al. 2005) and construction of 16S rDNA clone libraries (Huang et al. 2003; Mori et al. 2003) or biomarkers (Hales et al. 1996; Nercessian et al. 1999; Earl et al. 2003; Dhillon et al. 2005) Functional genes are used as biomarkers because their higher evolutionary rates can enhance the resolution of sequences at the spe cies level compared to the 16S rRNA gene (Braker et al. 2000; Junca and Pieper 2004) Conditions characteristic of solid waste degradation in a landfill were mimiced in bioreactors filled with solid waste and maint ained in the laboratory. The chemical data associated with the study have been published (Cardoso et al. 2006) The microbial data that were collected simultaneously with the chemical data are presented in this work. We hypothesized that the microbial community development would vary in bioreactors with different waste composition. Denaturing gradient gel electrophoresis (DGGE) was used to evaluate the community devel opment in terms of dominant members of the Archaea and Bacteria providing a broad snapshot of changes in the microbial community over an eight month period. Methanogen sequences from leachate samples were obtained using

PAGE 36

26 primers targeting the mcrA gene cod ing for the alpha subunit of the methyl coenzyme M reductase (MCR) enzyme and compared over time. Materials and Methods Bioreactor design Bioreactors were designed to simulate landfill disposal practices in the U.S. They were constructed from 1.4 m tall, 30.5 cm diameter PVC pipes The waste mixtures were hydrated to field capacity and leachate was recirculated daily to simulate rainfall of 8 cm d 1 The leachate collection system was designed to simulate field conditions and consisted of a perforated 32 mm diameter PVC. The leachate collection pipes were surrounded by gravel (50.8 mm) with geotextiles above and below the gravel layers. The drainage system separating the waste from the leachate collection pipe consisted of five inches of granular materia l (25.4 mm gravel or Cholee sand). The bioreactors were operated in duplicate. A diagram of the bioreactor design is presented in our previously published paper (Car doso et al. 2006) Four bioreactors were filled with either MSW alone or MSW co disposed with biosolids and combustion residues from waste to energy facilities. The waste materials were obtained from the North County Resource Recovery Facility in Palm Bea ch County, FL. Duplicate bioreactors were packed with either 100% MSW or 60% MSW co disposed with 30% combustion residues (6% fly ash + 24% bottom ash) and 10% biosolids (comprised of 50% material from drinking water treatment + 50% material from wastewate r treatment).

PAGE 37

27 Sample processing Leachate samples were collected and three milliliters of each sample was filtered through 0.45 m filters and the filters were stored at 20C. Community DNA was extracted from the filters using the Ultraclean Soil DNA Kit (MoBio Laboratories, Inc.) per 20C until further processing (1 week maximum). Total microbial concentrations Duplicate one ml samples of leachate from each bioreactor were individually centrif uged. The cells were washed in sterile phosphate buffered saline (PBS), stained with DAPI (4,6 diamidine 2 phenylindole) (1mg ml 1 DAPI) and filtered through a 0.2 m polycarbonate filter (Millipore). The stained cells were observed under a fluorescent mic roscope using a UV2B filter. Cells from 5 different fields of view were counted and the average was used to calculate the cell concentration ml 1 of sample. Measurements in duplicate samples varied from one another by less than 10%. Polymerase chain reacti on (PCR) for community analysis Direct amplification of the 16S rRNA genes of Archaea using the primer set 344f and 517r was not consistently successful; therefore a nested approach was used. The first round of PCR was performed using the primer set 21f an d 958r (Delong 1992; Pearson et al. 2004) Acetamide was added to a final concentration of 2% (vv 1 ) to increase the specificity of the reaction. PCR conditions were as follows: initial denaturation at 94C for 3 mi n, followed by 30 cycles of denaturation at 94C for 45 s, annealing at 55C for 45 s, extension at 72C for 1 min, and a final extension at 72C for 5 min. This procedure

PAGE 38

28 was followed by a second round of PCR using the Archaea specific forward primer 344f and a universal reverse primer 517r (Bano et al. 2004; Pearson et al. 2004) A 40 bp GC end of the forward primer. Acetamide was excluded from the reactions. Templates were amplified us specificity (Ferrari and Hollibaugh 1999) The archaeal primer sets used in this study amplify both euryarchaeotes and crenarchaeotes and do not amplify non archaeal templates (Delong 1992; Raskin et al. 1994) Methanosarcina acetivorans strain C2A (DSM 283 4) was used as the positive control. Bacterial 16S rRNA genes were amplified using the primer set 1070f and 1392r (Ferris et al. 1996) A 40 bp GC end of the reverse primer. PCR conditions were the same as those used for the first round of archaeal amplification. Escherichia coli ATCC 9637 wa s used as the positive control. Denaturing gradient gel electrophoresis (DGGE) DGGE was carried out using the Bio Rad DCode Universal Mutation Detection System. A 1mm thick 7% (w v 1 ) polyacrylamide gel containing a 40% 65% linear denaturing gradient of formamide and urea (100% denaturant = 7 M urea and 40% (v v 1 ) formamide) was prepared for archaeal community analysis whereas a 45% 60% gradient was used for bacterial community analysis. DGGE standards were created by loading GC clamped PCR products (ap proximately 150 to 300 ng total DNA) of the small subunit rRNA gene from Aiptasia pallida (brown sea anemone) (18S rRNA), Gallus domesticus (chicken) (18S rRNA), Methanosarcina acetivorans strain C2A (DSM 2834) (16S rRNA), Clostridium perfringens (Sigma D5 139) (16S rRNA), Escherichia coli ATCC 9637 (16S rRNA) and Streptomyces fradiae

PAGE 39

29 ATCC 10745 (16S rRNA) mixed with 10 l of loading dye. Two standard lanes were loaded per gel. Approximately 650 to 800 ng (total) of PCR product amplified from leachate sample s was loaded in individual lanes of the gel. Gels were electrophoresed at 47V, 60C for 16 h, stained with SYBR Green I and images were obtained using a Foto/ Analyst Imaging System (Fotodyne Inc). Cloning and sequence analysis of mcrA gene Since co dispo sal (MSW + ash + biosolids) is a widespread method of waste disposal, one of the two co disposal bioreactors was selected for the study of methanogen populations. An early sample of leachate (day 50) and a late sample (day 218) were selected for methanogen population analysis. DNA extracted from the two samples was amplified using the ME1 and ME2 primers (Hales et al. 1996; Nercessian et al. 1999) that target the mcrA gene. PCR conditions were as described previously (Hales et al. 1996) Methanosarcina acetivorans strain C2A (DSM 28 34) was used as the positive control. The day 50 and day 218 ampl icon bands (760 bp) were excised from the gel using a TOPO TA Cloning Kit for Sequencing (Invitrogen, CA) was used for both cloning and The vectors (plasmids) were subsequently transformed into One Shot TOP10 chemically competent Escherichia coli cells (Invitrogen, CA) Cells were gently plated onto Luria broth (LB) agar plates amended with 100 g ml 1 ampicillin and individual colonies were re streaked on new plates. Plasmids were extracted using the FastPlasmid Mini kit (Eppendorf, Hamburg, extracte d plasmids was

PAGE 40

30 amplified using the ME primer set and confirmed by agarose gel electrophoresis. PCR reactions were purified using QIAQuick PCR Purification Kit (Qiagen, Valencia, CA). The Genome Lab DTCS Quick Start Kit (Beckman Coulter, Fullerton, CA) was used for the final sequencing PCR reaction. The amplified DNA was purified, concen trated by System (Beckman Coulter). Sequences were analyzed using BLAST (http://www.ncbi.nlm.nih. gov/BLAST/) to confirm their identities as methanogens. Possible methanogen seq uences were designated JME for clones from the day 50 sample, and DME for clones from the day 218 sample. Statistical analysis Gel images were imported into Bionumerics (Version 3.0, Applied Maths, Belgium) and analyzed using the Dice similarity coefficie nt by constructing unweighted pair group method with arithmetic mean (UPGMA) dendrograms (optimization 1.0%, tolerance 0.5%). Principal components analysis (PCA) was performed using SPSS (SPSS Inc., Chicago, IL) to obtain two dimensional plots showing rela tedness of populations. PCA is a data reduction technique which takes into account all the variables in a given set, determines the patterns of similarities and differences between the variables and expresses the results as a two or three dimensional plot. For fingerprint patterns such as those obtained by DGGE or RFLP, bands are classified as present or absent (binary) and compared by constructing a band matching table (Boon et al. 2002; Caddick et al. 2006) Microb ial concentrations (direct microscopic cell counts) were compared by paired t tests (GraphPad Instat). Shannon diversity index is a measure of the richness (number of

PAGE 41

31 species present in a community) and abundance of any ecological habitat. Shannon diversit y index ( H ) was calculated by using the formula: H = p i log p i calculated as p i = n i / N where n i is the height of a peak and N is the sum of the peak heights of all bands in the densitometric curve (Eichner et al. 1999; Ogino et al. 2001; Haack et al. 2004) Sha nnon indices were calculated for the community profile of each given time point of individual bioreactors and an average of these was reported. Results Total cell concentrations Total cell concentrations (measured by epifluorescence microscopy) in the fi rst month of bioreactor operation increased about an order of magnitude, from 3 x 10 8 cells ml 1 to 3 x 10 9 cells ml 1 in MSW bioreactors and co disposal bioreactors. Cell concentrations dropped after 50 days, then stabilized in all bioreactors except MSW1 Cell concentrations varied only about four fold from bioreactor start up to the termination of the experiment. There was a significant difference between the mean cell concentrations of the two MSW bioreactors calculated over the course of the study (pa ired t test; P < 0.0001). The difference was attributable largely to the increased cell concentrations in the second half of the experiment in MSW1. In contrast, the difference in cell concentrations for the two co disposal bioreactors was not significant ( P > 0.95). Cell concentrations in leachate from MSW bioreactors were significantly greater than those from co disposal bioreactors ( P = 0.048).

PAGE 42

32 pH of leachate The initial increase in microbial numbers in all bioreactors corresponded with an initial decre ase in pH from neutral to 5.5 by day 25. The pH returned to neutral by day 50 and remained neutral till the conclusion of the experiment. DGGE analysis of microbial communities An initial experiment was performed to test the reproducibility of DGGE in the complex matrix of the leachate. Triplicate leachate samples taken within several minutes of one another were analyzed from a selected bioreactor (Co disposal 2). The similarity of the DGGE patterns for triplicate analyses of both archaeal and bacterial co mmunity structure based on 16S rRNA genes were greater than 95%, showing high reproducibility of the method (data not shown). Leachate samples collected on 12 to 15 dates over a period of eight months were subjected to DGGE. The first incidence of detecti on of Archaea by PCR using 16S rRNA genes corresponded to the occurrence of negative oxidation reduction potentials and the presence of volatile acids, indicating anaerobic conditions (Cardoso et al. 2006) on day 25. Inhibition of the PCR was not responsible for the absence of archaeal PCR products in the early leachate samples, as positive control DNA spiked into these leachates was amplified. Archaeal community st ructure Analysis of archaeal DGGE patterns indicates that in all the bioreactors, the initial population changed substantially between start up (day 25) and maturation (day 50) (Figure 1). The data from a representative bioreactor for each treatment (MSW o r co

PAGE 43

33 disposal) are shown in Figure 1a and 1b, respectively. In the MSW bioreactors archaeal community fingerprints over a two month period (day 50 to day 78, designated cluster I) clustered together followed by a substantial change in the community at day 99 (Figure 1a). Cluster II, which includes patterns from day 120 to day 218, denotes a cluster of comparatively similar patterns towards the end of the study. In the co disposal bioreactors, archaeal DGGE patterns after bioreactor start up indicated a more gradual shift in the community structure with less well defined clusters (Figure 1b). Principal components analysis (PCA) of the DGGE patterns also demonstrated temporal shifts in communities (Figure 1a and 1b). Bacterial community structure Analysis of bacterial DGGE patterns revealed that the patterns in MSW bioreactors were clustered in discrete groups of high (>75%) similarity. Cluster I included day 1 to day 25, cluster II day 50 to 99 and cluster III day 169 to 218 (Figure 2a). In contrast, the patt erns in co disposal bioreactors shifted in a more gradual manner (Figure 2b). The data from one bioreactor per treatment are shown in Figure 2; relationships among the patterns of duplicate bioreactors were similar for both MSW and co disposal treatments. PCA results for bacterial community structure also corresponded to the results obtained from the UPGMA dendrograms (Figure 2a and 2b). Microbial community structure was more similar within bioreactors than between bioreactors of the same treatment (data n ot shown). This grouping was consistently observed for Archaea and Bacteria in MSW and co disposal bioreactors. Comparison of communities in MSW vs. co disposal bioreactors did not reveal grouping by treatment

PAGE 44

34 (waste type); thus, factors other than the wa ste composition were most instrumental in determining community structure. Calculation of the Shannon diversity indices revealed a higher apparent diversity of observed archaeal populations (average H = 1.37) in the bioreactors as compared to the bacterial populations (average H = 1.24) (Table 1). Sequence analysis of methanogens Seventeen unique mcrA gene sequences were found out of the thirty seven clones analyzed for the day 50 leachate sample of the co disposal bioreactor (Table 2). The most numericall y dominant clone was closely related to the uncultured methanogen clone RS ME43 isolated from r ice field soil (Lueders et al. 2001) Methanogen clones from the day 50 leachate sample were closely related to the memb ers of Methanosarcinales Methanobacteriales and Methanomicrobiales Twelve unique mcrA gene sequences were found out of the thirty two clones analyzed for the day 218 leachate sample (Table 2). The most dominant clone was closely related to the uncultured methanogen clone MidMcrA114 isolated from the sediment of the Pearl River Estuary (Jiang et al. 2008, unpublished material) All the methanogen clone sequences from the day 218 leachate sample were related to members of the Order Methanomicrobiales.

PAGE 45

35 Table 1 Shannon diversity indices calculated for the DGGE patterns of Archaea and Bacteria Treatment Archaea Bacteria Shannon Diversity index ( H ) MSW1 1.374 1.195 MSW2 1.384 1.218 Co disposal1 1.361 1.241 Co disposal2 1.367 1.296

PAGE 46

36 1a. 1b. Figure 1 Dendrograms and corresponding principal components analysis of archaeal population structure in (a) MSW and (b) co disposal bioreactors. I, II, III and IV denote clusters of similar patterns(> 75% similarity). Note that Archaea were not detected in the leachate before day 25. (Clustering patterns of duplicate bioreactors for both MSW and co disposal were similar). Arrow indicates increasing direction of denaturant and acrylamide gradient from lo wer to higher concentration. II 100 80 60 Day 50 Day 92 Day64 Day 78 Day 99 Day 25 Day 136 Day 169 Day 120 Day 184 Day 204 Day 218 I II I III 100 80 60 Day 50 Day 78 Day 64 Day 92 Day 99 Day 120 Day 136 Day 169 Day 184 Day 25 Day 204 Day 218 IV

PAGE 47

37 2 a. 2b. Figure 2 Dendrograms and corresponding principal components analysis of bacterial population structure in (a) MSW and (b) co disposal bioreactors. I, II, III, IV and V denote clusters o f similar patterns (>75% similarity). (Clustering patterns of duplicate bioreactors for both MSW and co disposal were similar). Arrow indicates increasing direction of denaturant and acrylamide gradient from lower to higher concentration. III II I 100 80 Day 4 Day 11 Day 1 Day 25 Day 64 Day 78 Day 50 Day 92 Day 99 Day 169 Day 184 Day 204 Day 218 100 80 60 IV I V Day 92 Day 99 Day 120 Day 78 Day 50 Day 64 Day 11 Day 25 Day 1 Day 4 Day 184 Day 204 Day 136 Day 169 Day 218 III II

PAGE 48

38 Table 2 Frequency of methanogen clones observed in the day 50 and day 218 samples obtained from the co disposal bioreactor. Clone a, b Putative Group (Order) Closest Relatives % of clone library JME1 (FJ435818) Methanomicrobiales Methanobacter ium sp. MB4 (DQ677519) 3 JME2, 5 7 (FJ435819, FJ435822, FJ435823, FJ435824) Methanomicrobiales Methanocorpusculum parvum (AY260445) 11 JME3 (FJ435820) Methanosarcinales Rice field soil clone RS ME28 (AF313863) 3 JME4,8 (FJ435821, FJ435825) Methanomicro biales Biogas plant clone ATB EN 5737 M022 (FJ226633) 5 JME11 13,15,36 (FJ435826, FJ435827, FJ435828, FJ435830, FJ435849) Methanosarcinales Methanosarcina mazei strain TMA (AB300778) 14 JME14,22 27,30,37,43 (FJ435829, FJ435836, FJ435837, FJ435838, FJ435 839, FJ435840, FJ435841, FJ435844, FJ435850, FJ435854) Methanosarcinales Rice field soil clone RS ME43 (AF313876) 27 JME16,18,19 (FJ435831, FJ435833, FJ435834) Methanosarcinales Methanosarcina sp. HB 1 Subsurface groundwater clone (AB288266) 8 JME17,32 ( FJ435832, FJ435846) Methanosarcinales Methanosarcina barkeri mcrBCDGA (Y00158) 5 JME20 (FJ435835) Methanosarcinales Nankai trough marine sediment core clone NANK ME73121 (AY436550) 3 JME28 (FJ435842) Methanobacteriales Anaerobic digester 3

PAGE 49

39 Clone a, b Putative Group (Order) Closest Relatives % of clone library clone ME_dig80_ 2_15 (DQ680456) JME29 (FJ435843) Methanobacteriales Bovine rumen clone unfaunated mcrA 13 (AB244709) 3 JME31 (FJ435845) Methanosarcinales UASB bioreactor clone GranMCR7M10 (AY937278) 3 JME34 (FJ435847) Methanomicrobiales Cattle manure clone G4INMC365 (DQ262403) 3 JME35 (FJ435848) Methanobacteriales Human fecal sample clone DC_clone mcrA 2 (AM921682) 3 JME38 (FJ435851) Methanosarcinales Upland pasture soil clone SI_18 (DQ994847) 3 JME40 (FJ435852) Methanosarcinales Methanosarcina mazei strain LYC (AB 300782) 3 JME41 (FJ435853) Methanomicrobiales Cattle manure clone G4INMC365 (DQ274999) 3 DME1,35 (FJ435855, FJ435885) Methanomicrobiales Biogas plant clone ATB EN 9759 M148 (FJ226741) 6 DME2,3,8,31 (FJ435856, FJ435857, FJ435862, FJ435881) Methanomicrobi ales Methanocorpusculum parvum (AY260445) 13 DME4,5,7 (FJ435858, FJ435859, FJ435861) Methanomicrobiales Biogas plant clone ATB EN 5737 M022 (FJ226633) 9 DME6,19,30 (FJ435860, FJ435871, FJ435880) Methanomicrobiales Biogas plant clone MARMC548 (DQ260615) 9 DME9 (FJ435863) Methanomicrobiales Methanocorpusculum 3

PAGE 50

40 Clone a, b Putative Group (Order) Closest Relatives % of clone library labreanum Z (CP000559) DME10,20 22 (FJ435864, FJ435872, FJ435873, FJ435874) Methanomicrobiales Lake sediment clone Beu4ME 34 (AY625600) 13 DME11,16 18,25,33,34,38 (FJ435865, FJ435868, FJ435869, FJ 435870, FJ435877, FJ435883, FJ435884, FJ435886) Methanomicrobiales Estuary sediment clone MidMcrA114 (EU681946) 25 DME13 (FJ435866) Methanomicrobiales Methanocorpusculum sp. MSP (AY260446) 3 DME15,27 (FJ435867, FJ435879) Methanomicrobiales Biogas plant c lone F10RTCR23 (DQ261495) 6 DME23 (FJ435875) Methanomicrobiales Sewer clone (EF628141) 3 DME24,26 (FJ435876, FJ435878) Methanomicrobiales Gas condensate contaminated aquifer clone L44B (EU364876) 6 DME32 (FJ435882) Methanomicrobiales Biogas plant clone G8RTCR50 (DQ260503) 3 a All isolates labeled JME denote clones obtained from day 50 sample b All isolates labeled DME denote clones obtained from day 218 sample Discussion The various cells of a landfill generally contain waste that is at different stages of decomposition depending upon waste composition, residence time, moisture, etc., making it difficult to study the progression of microbial population development in the highly

PAGE 51

41 heterogeneous landfill environment. Compared to landfills, bioreactors are sim pler systems that allow better control over the variables that play a role in waste degradation. As a simplified system, bioreactors have been employed in other studies to study microbial community dynamics (Barlaz et al. 1989a) cellulose deg rading Clostridium populations (Burrell et al. 2004) methanogen communities (Griffin et al. 1997) and chemical composition of leachate (Pohl and and Kim 2000; Ledakowicz and Kaczorek 2004) In spite of the attempt to construct parallel (duplicate) bioreactors in this study, cell concentrations in duplicate MSW bioreactors varied significantly over the course of the experiment, while these valu es in co disposal bioreactors, which included biosolids, were similar. The variable cell concentrations between duplicate MSW bioreactors may be attributable to the heterogeneous nature of the waste, which was shredded municipal waste obtained from a landf ill in Palm Beach County, FL. This waste contained paper, plastic, food, and other common components of garbage, and was not standardized. This heterogeneity probably also contributed to the dissimilarity of community profiles in duplicate bioreactors. The se results underscore the complexity of determining the factors that influence processes such as clogging, which can lead to landfill failures and management problems (Rohde and Gribb 1990; Fleming et al. 1999) A c ommon trend seen in all bioreactors was a decrease in pH, which was consistently accompanied by a rise in cell concentrations over the first 25 30 days of the study. This trend reflects the successive processes that typically occur during solid waste degra dation. During the early stages, aerobic and facultative anaerobic heterotrophs decompose organic substrates and quickly exhaust oxygen and nitrate (Barlaz et al.

PAGE 52

42 1989a) Cellulose and hemicellulose comprise a high percentage (45% 60%) of la ndfilled material and are easily biodegradable (Barlaz et al. 1989b) Cellulose degradation is performed by hydrolytic and fermentative bacteria and fungi in the primarily anaerobic conditions of the landfill (Pourcher et al. 20 01; Van Dyke and McCarthy 2002; Burrell et al. 2004; Lockhart et al. 2006; McDonald et al. 2008) Fermentative bacteria use monosaccharides and amino acids to produce alcohols, organic acids, carbon dioxide and hydrogen (Barlaz et al. 1989a) which causes more acidic conditions (lower pH). Methanogens utilize carbon dioxide, hydrogen, acetate, and formate resulting in an increase in pH (Mormile et al. 1996) Removal of acetate by iron reducing bacteria (Frenzel et al. 1999; Lin et al. 2007) and bicarbonates produced by sulfate reducing bacteria (SRBs) (Elliott et al. 1998) could also cause increase in pH of leachates After the initial decrease i n pH at day 25, pH values increased to near neutral and remained at that level through the conclusion of the study. Another common trend among bioreactors was that, irrespective of waste composition (MSW vs. co disposal), archaeal populations exhibited hi gher apparent diversity as assessed by DGGE than the bacterial populations. To the best of our knowledge, no previous study has compared the diversity in 16S rRNA sequences of archaeal vs. bacterial populations in decomposing solid waste. The emergence of a diverse population of Archaea about 25 days after inoculation and its maintenance throughout the study reflects the process of succession and ultimately maturation of the microbial community in the bioreactors. Although DGGE reflects a broad community st ructure, like any other molecular technique, it is subject to biases and errors such as selective amplification, heteroduplex formation and co migration of DNA fragments (Muyzer and Smalla 1998)

PAGE 53

43 However, DGGE is widely employed in ecological studies because it enables quick and convenient comparison of temporal and spatial distributions of the predominant members in a population as compared to other molecular methods such as cloning and se quencing. Analysis of microbial community structure in the laboratory bioreactors revealed temporal shifts of archaeal and bacterial populations in bioreactors regardless of the waste content, suggesting a succession process from an immature to a mature c ommunity. These results concur with other studies that demonstrated succession during solid waste decomposition. For example, a study on composting of MSW using phospholipid fatty acid analysis (PLFA) to identify operational taxonomic units suggested four stages of waste degradation (Herrmann and Shann 1997) Two studies using culture based methods of microbial identification also found population shifts that suggested succession processes (Barlaz et al. 1989a; Boothe et al. 2001) Interestingly, microbial populations in MSW bioreactors were clustered into groups with high similairty, whereas a gradual change was detected in microbial pop ulations from co disposal bioreactors. The diverse inoculum provided by the biosolids may have contributed to the gradual change in community structure for the co disposal bioreactors. Methanogens belong to the archaean kingdom Euryarchaeota (Winker and Woese 1991; Barns et al. 1996) and are divided into five orders: Methanosarcinales Methanomicrobiales Methanobacteriales Methanococcales and Methanopyrales (Bapteste et al. 2005) Our study found representatives from the Methanosarcinales Methanobacteriales and Methanomicrobiales in the initial stages of waste degradation (day 50 samp le). Interestingly, the later stages (day 218 sample) were exclusively dominated by members of the Methanomicrobiales which include genera such as

PAGE 54

44 Methanocorpusculum and Methanoculleus Several of the sequences obtained in this study were most similar to cultured methanogens, e.g. Methanobacterium sp. MB4, Methanosarcina mazei and Methanocorpusculum parvum while others were most similar to sequences obtained from uncultured organisms found in a variety of environments, including biogas plants, rice field s oil, subsurface sediments and the bovine rumen. Previous studies of methanogens in leachate from bioreactors or landfills identified a number of phylogenetic groups including Methanosaeta and Methanobacteriaceae (Calli et al. 2003) Methanomicrobiales ( Methanoculleus and Methanofollis ) and Methanosarcinales ( Methanosaeta and Methanosarcina ) (Uz et al. 2003) Methanosarcina sp., Methanobacterium sp. and Methanocorpusculum sp. were isolated from anaer obic sewage sludge digestors (Bryant and Boone 1987; Raskin et al. 1994; Griffin et al. 1997; Whitehead and Cotta 1999) Despite the great variability in leachate microbial community profiles, the temporal trend in microbial community structure was consistently observed for archaeal and bacterial populations in the simulated solid waste bioreactors. Gaining an understanding of the environmental factors that influence these high diversity communities will require exte nsive research, but this effort is justified by the potential for using this knowledge to improving landfill management practices. Acknowledgements This study was funded by the Hinkley Center for Solid and Hazardous Waste Management, Gainesville, FL.

PAGE 55

45 We th ank Lisa Rhea and Robert Ulrich for help in constructing, maintaining and sampling the bioreactors, and Ee Goh for DNA sequencing. References Bano, N., Ruffin, S., Ransom, B. and Hollibaugh, J.T. (2004) Phylogenetic composition of Arc tic Ocean archaeal assemblages and comparison with Antarctic assemblages. Appl Environ Microbiol 70 781 789. Bapteste, E., Brochier, C. and Boucher, Y. (2005) Higher level classification of the Archaea: evolution of methanogenesis and methanogens. Archaea 1 353 363. Barlaz, M.A., Schaefer, D.M. and Ham, R.K. (1989a) Bacterial population development and chemical characteristics of refuse decomposition in a simulated sanitary landfill. Appl Environ Microbiol 55 55 65. Barlaz, M.A., Schaefer, D.M. and Ham, R.K. (1989b) Mass balance analysis of decomposed refuse in laboratory scale lysimeters. ASCE J Environ Eng 115 342 349 Barns, S.M., Delwiche, C.F., Palmer, J.D. and Pace, N.R. (1996) Perspectives on archaeal diversity, thermophily and monophyly from envir onmental rRNA sequences. Proc Natl Acad Sci U S A 93 9188 9193. Boon, N., De Windt, W., Verstraete, W. and Top, E.M. (2002) Evaluation of nested PCR DGGE (denaturing gradient gel electrophoresis) with group specific 16S rRNA primers for the analysis of ba cterial communities from different wastewater treatment plants. FEMS Microbiol Ecol 39 101 112.

PAGE 56

46 Boothe, D.D.H., Smith, M.C., Gattie, D.K. and Das, K.C. (2001) Characterization of microbial populations in landfill leachate and bulk samples during aerobic b ioreduction. Adv Environ Res 5 285 294. Braker, G., Zhou, J., Wu, L., Devol, A.H. and Tiedje, J.M. (2000) Nitrite reductase genes (nirK and nirS) as functional markers to investigate diversity of denitrifying bacteria in pacific northwest marine sediment communities. Appl Environ Microbiol 66 2096 2104. Bryant, M.P. and Boone, D.R. (1987) Isolation and Characterization of Methanobacterium formicicum Mf. Int J Syst Bacteriol 37 171 171. Burrell, P.C., O'Sullivan, C., Song, H., Clarke, W.P. and Blackall, L .L. (2004) Identification, detection, and spatial resolution of Clostridium populations responsible for cellulose degradation in a methanogenic landfill leachate bioreactor. Appl Environ Microbiol 70 2414 2419. Caddick, J.M., Hilton, A.C., Armstrong, R.A. Lambert, P.A., Worthington, T. and Elliott, T.S. (2006) Description and critical appraisal of principal components analysis (PCA) methodology applied to pulsed field gel electrophoresis profiles of methicillin resistant Staphylococcus aureus isolates. J Microbiol Methods 65 87 95. Calli, B., Mertoglu, B., Inanc, B. and Yenigun, O. (2005) Methanogenic diversity in anaerobic bioreactors under extremely high ammonia levels. Enz Microb Technol 37 448 455. Calli, B., Mertoglu, B., Tas, N., Inanc, B., Yenigun O. and Ozturk, I. (2003) Investigation of variations in microbial diversity in anaerobic reactors treating landfill leachate. Water Sci Technol 48 105 112.

PAGE 57

47 Cardoso, A.J., Levine, A.D., Nayak, B.S., Harwood, V.J. and Rhea, L.R. (2006) Lysimeter compariso n of the role of waste characteristics in the formation of mineral deposits in leachate drainage systems. Waste Manag Res 24 560 572. Delong, E.F. (1992) Archaea in Coastal Marine Environments. Proc Natl Acad Sci U S A 89 5685 5689. Dhillon, A., Lever, M ., Lloyd, K.G., Albert, D.B., Sogin, M.L. and Teske, A. (2005) Methanogen diversity evidenced by molecular characterization of methyl coenzyme M reductase A (mcrA) genes in hydrothermal sediments of the Guaymas Basin. Appl Environ Microbiol 71 4592 4601. Earl, J., Hall, G., Pickup, R.W., Ritchie, D.A. and Edwards, C. (2003) Analysis of methanogen diversity in a hypereutrophic lake using PCR RFLP analysis of mcr sequences. Microb Ecol 46 270 278. Eichner, C.A., Erb, R.W., Timmis, K.N. and Wagner Dobler, I. (1999) Thermal gradient gel electrophoresis analysis of bioprotection from pollutant shocks in the activated sludge microbial community. Appl Environ Microbiol 65 102 109. Elliott, P., Ragusa, S. and Catcheside, D. (1998) Growth of sulfate reducing bacte ria under acidic conditions in an upflow anaerobic bioreactor as a treatment system for acid mine drainage. Water Res 32 3724 3730. Ferrari, V.C. and Hollibaugh, J.T. (1999) Distribution of microbial assemblages in the Central Arctic Ocean Basin studied b y PCR/DGGE: analysis of a large data set. Hydrobiologia 401 55 68.

PAGE 58

48 Ferris, M.J., Muyzer, G. and Ward, D.M. (1996) Denaturing gradient gel electrophoresis profiles of 16S rRNA defined populations inhabiting a hot spring microbial mat community. Appl Enviro n Microbiol 62 340 346. Fleming, I.R., Rowe, R.K. and Cullimore, D.R. (1999) Field observations of clogging in a landfill leachate collection system. Can Geotech J 36 685 707. Frenzel, P., Bosse, U. and Janssen, P.H. (1999) Rice roots and methanogenesis in a paddy soil: ferric iron as an alternative electron acceptor in the rooted soil. Soil Biol Biochem 31 421 430. Griffin, M.E., McMahon, K.D., Mackie, R.I. and Raskin, L. (1997) Methanogenic population dynamics during start up of anaerobic digesters tre ating municipal solid waste and biosolids. Biotechnol Bioeng 57 342 355. Haack, S.K., Fogarty, L.R., West, T.G., Alm, E.W., McGuire, J.T., Long, D.T., Hyndman, D.W. and Forney, L.J. (2004) Spatial and temporal changes in microbial community structure asso ciated with recharge influenced chemical gradients in a contaminated aquifer. Environ Microbiol 6 438 448. Hales, B.A., Edwards, C., Ritchie, D.A., Hall, G., Pickup, R.W. and Saunders, J.R. (1996) Isolation and Identification of Methanogen Specific DNA fr om Blanket Bog Peat by PCR Amplification and Sequence Analysis. Appl Environ Microbiol 62 668 675. Halet, D., Boon, N. and Verstraete, W. (2006) Community dynamics of methanotrophic bacteria during composting of organic matter. J Biosci Bioeng 101 297 30 2. Herrmann, R.F. and Shann, J.F. (1997) Microbial community changes during the composting of municipal solid waste. Microb Ecol 33 78 85.

PAGE 59

49 Huang, L.N., Chen, Y.Q., Zhou, H., Luo, S., Lan, C.Y. and Qu, L.H. (2003) Characterization of Methanogenic Archaea i n the Leachate of a Closed Municipal Solid Waste Landfill. FEMS Microbiol Ecol 46 171 177. Huang, L.N., Zhou, H., Chen, Y.Q., Luo, S., Lan, C.Y. and Qu, L.H. (2002) Diversity and structure of the archaeal community in the leachate of a full scale recircul ating landfill as examined by direct 16S rRNA gene sequence retrieval. FEMS Microbiol Lett 214 235 240. Huang, L.N., Zhu, S., Zhou, H. and Qu, L.H. (2005) Molecular phylogenetic diversity of bacteria associated with the leachate of a closed municipal soli d waste landfill. FEMS Microbiol Lett 242 297 303. Jiang, L.J., Xiao, X. and Chen, J.Q. (2008) Stratified microbial communities involved in methane metabolism along the sediment core of Pearl River Estuary, southern China. Unpublished Junca, H. and Piepe r, D.H. (2004) Functional gene diversity analysis in BTEX contaminated soils by means of PCR SSCP DNA fingerprinting: comparative diversity assessment against bacterial isolates and PCR DNA clone libraries. Environ Microbiol 6 95 110. Kjeldsen, P., Barlaz M.A., Rooker, A.P., Baun, A., Ledin, A. and Christensen, T.H. (2002) Present and long term composition of MSW landfill leachate: A review. Crit Rev Environ Sci Technol 32 297 336.

PAGE 60

50 Ledakowicz, S. and Kaczorek, K. (2004) Laboratory simulation of anaerobic digestion of municipal solid waste. J Environ Sci Health A Tox Hazard Subst Environ Eng 39 859 871. Lin, B., Braster, M., Roling, W.F.M. and van Breukelen, B.M. (2007) Iron reducing microorganisms in a landfill leachate polluted aquifer: Complementing cu lture independent information with enrichments and isolations. Geomicrobiol J 24 283 294. Lockhart, R.J., Van Dyke, M.I., Beadle, I.R., Humphreys, P. and McCarthy, A.J. (2006) Molecular biological detection of anaerobic gut fungi (Neocallimastigales) from landfill sites. Appl Environ Microbiol 72 5659 5661. Lueders, T., Chin, K.J., Conrad, R. and Friedrich, M. (2001) Molecular analyses of methyl coenzyme M reductase alpha subunit (mcrA) genes in rice field soil and enrichment cultures reveal the methanoge nic phenotype of a novel archaeal lineage. Environ Microbiol 3 194 204. McDonald, J.E., Lockhart, R.J., Cox, M.J., Allison, H.E. and McCarthy, A.J. (2008) Detection of novel Fibrobacter populations in landfill sites and determination of their relative abu ndance via quantitative PCR. Environ Microbiol 10 1310 1319. Mori, K., Sparling, R., Hatsu, M. and Takamizawa, K. (2003) Quantification and diversity of the archaeal community in a landfill site. Can J Microbiol 49 28 36. Mormile, M.R., Gurijala, K.R., R obinson, J.A., McInerney, M.J. and Suflita, J.M. (1996) The Importance of Hydrogen in Landfill Fermentations. Appl Environ Microbiol 62 1583 1588.

PAGE 61

51 Muyzer, G. and Smalla, K. (1998) Application of denaturing gradient gel electrophoresis (DGGE) and temperatu re gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Van Leeuwenhoek 73 127 141. Nercessian, D., Upton, M., Lloyd, D. and Edwards, C. (1999) Phylogenetic analysis of peat bog methanogen populations. FEMS Microbiol Lett 173 425 429. Ogino, A., Koshikawa, H., Nakahara, T. and Uchiyama, H. (2001) Succession of microbial communities during a biostimulation process as evaluated by DGGE and clone library analyses. J Appl Microbiol 91 625 635. Pearson, A., Huang, Z., Ingalls, A.E., Romanek, C.S. Wiegel, J., Freeman, K.H., Smittenberg, R.H. and Zhang, C.L. (2004) Nonmarine crenarchaeol in Nevada hot springs. Appl Environ Microbiol 70 5229 5237. Pohland, F.G. and Kim, J.C. (2000) Microbially mediated attenuation potential of landfill bioreactor s ystems. Water Sci Technol 41 247 254. Pourcher, A., Sutra, L., Hebe, I.I., Moguedet, G., Bollet, C., Simoneau, P. and Gardan, L. (2001) Enumeration and characterization of cellulolytic bacteria from refuse of a landfill. FEMS Microbiol Ecol 34 229 241. R askin, L., Poulsen, L.K., Noguera, D.R., Rittmann, B.E. and Stahl, D.A. (1994) Quantification of methanogenic groups in anaerobic biological reactors by oligonucleotide probe hybridization. Appl Environ Microbiol 60 1241 1248. Rohde, J.R. and Gribb, M.M. (1990) Biological and particulate clogging of geotextile/ soil filter systems. Geosynthetic testing for waste containment applications. Amer Soc for Testing and Materials, Philadelphia

PAGE 62

52 Senior, E., Watson Craik, I.A. and Kasali, G.B. (1990) Control/promoti on of the refuse methanogenic fermentation. Crit Rev Biotechnol 10 93 118. U.S. EPA (1999) U.S. Methane Emissions 1990 2020: Inventories, Projections, and Opportunities for Reductions; EPA 430 R 99 013. Environmental Protection Agency Office of Air and R adiation. Uz, I., Rasche, M.E., Townsend, T., Ogram, A.V. and Lindner, A.S. (2003) Characterization of methanogenic and methanotrophic assemblages in landfill samples. Proc R Soc Lond B Biol Sci 270 202 205. Van Dyke, M.I. and McCarthy, A.J. (2002) Molecu lar biological detection and characterization of Clostridium populations in municipal landfill sites. Appl Environ Microbiol 68 2049 2053. Whitehead, T.R. and Cotta, M.A. (1999) Phylogenetic diversity of methanogenic archaea in swine waste storage pits. F EMS Microbiol Lett 179 223 226. Winker, S. and Woese, C.R. (1991) A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics. Syst Appl Microbiol 14 305 310.

PAGE 63

53 SURVIVAL OF INDICATOR ORGANISMS DURING WASTE DEGRADATION IN SIMULATED LANDFILL BIOREACTORS Abstract Landfill waste contains microbial pathogens and fecal indicator organisms (IOs). Solid waste degradation is expected to reduce their populations, yet little is known about the factors that influ ence their persistence in landfills. This study was designed to follow and to determine the fate of IOs in the waste after an extended period of moisture bioreactors packed with municipal solid waste (MSW), combustion residues and biosolids from wastewater treatment facilities. Leachate generated by moistening MSW was sampled weekly for s even months and analyzed for total cells by fluorescence microscopy and for culturable IO concentrations. Total live c ell concentrations in leachate were measured by BacLight staining. They decreased from 1.9 x 10 9 cells/ml to 4.9 x 10 8 cells/ml after seve n months. Fecal coliform concentrations decreased from 6.3 x 10 4 CFU/ml to below detection limits while Enterococcus concentrations decreased from 1 x 10 6 CFU/ml to below detection limits by the end of the second month of bioreactor operation and remained undetectable for the rest of the hydrated phase. Decay rates for fecal coliforms were not significantly different from the decay rates for enterococci in both bioreactors. A one year drying period was followed by rehydration and a 24 h sampling regimen. To tal cell concentrations increased from ~10 7 cells ml 1 immediately after rehydration to ~10 8 cells ml 1 after 24 hours. Hourly changes in the bacterial community structure analyzed by denaturing gradient gel electrophoresis (DGGE)

PAGE 64

54 analysis following rehydr ation revealed a fairly stable, low diversity community. Fecal coliforms and enterococci were detected at low concentrations ( respectively) in the leachate even after the prolonged dry period. The recovery of IOs after prolonged dehydration was unexpected, and raises questions about the fate of pathogens during the process of waste degradation. Introduction The survival and composition of microbial communities in landfills depends on several factors such as waste composition, pH, temperature, toxic metal levels and moisture availability (Boothe et al. 2001) The amount of moisture available to support microbial activity depends on local climatic conditions, i.e. rainfall and temperature, the composition of waste d eposited in the landfill, and the frequency of leachate removal and/or recirculation (El Fadel 1999) The majority of the waste deposited in landfills comprises municipal solid waste (MSW) which includes household wast e, newspapers, glass, and metals (Kjeldsen et al. 2002) Co disposal of ash from waste to energy (WTE) processes and biosolids from wastewater treatment is also practiced in Class I landfills (Reinhart 2003) Biosolids are nutrient and moisture rich and add to the microbial load of the waste. One major concern associated with deposition of biosolids in landfills is the possible presence of pat hogens that have survived the treatment process. Pathogens can also be introduced in landfills from a variety of other sources such as soiled diapers, biomedical waste and pet feces (Peterson 1974; Mose and Reinthale r 1985; Trost and Filip 1985; Gerba et al 1995) Dissemination of human pathogens into the community can occur due to groundwater contamination by landfill leachate. This potential risk is evaluated by

PAGE 65

55 enumerating indicator organisms (IOs) such as fecal coliforms and enterococci in groundwater that may be contaminated by leachate (Rose 2004) Landfills undergo periods of moisture abundance during rainy periods and moisture depriva tion in most climates. Compaction of refuse reduces infiltration of water through the waste layers, thereby pooling less leachate in the collection systems (Tatsi and Zouboulis 2002) and minimizing the probability of leachate contaminating the groundwater. In contrast, heavy r ainfall dilutes toxic compounds in leachate and accelerates refuse decomposition (Wreford et al 2000) but increases the potential for groundwater contaminatio n. This study aims to evaluate the changes in concentrations of the overall microbial population and IOs during moisture rich and moisture deprived conditions. We hypothesize that indicator organisms will persist well in the moisture rich e while being unrecoverable in the moisture phase of waste degradation. For the hydrated phase of the study, bioreactors were constructed and operated in duplicate and the total cell concentrations and IO concentrations in leachate were enumerated for a period of seven months. Due to practical reasons and space restrictions, only one bioreactor was operated for the dehydrated phase of the study. This bioreactor was subjected to a dry period of one year, after which it was rehydrate d and the leachate was tested over a 24 hour period to determine total microbial concentrations, heterotrophic plate counts and IO concentrations. Changes in the bacterial community structure post rehydration were also investigated by denaturing gradient g el electrophoresis (DGGE).

PAGE 66

56 Materials and methods Landfill conditions were simulated in duplicate laboratory scale bioreactors built from 150 cm tall; 20 cm diameter PVC pipes (Figure 3). They were packed with 60% municipal solid waste (MSW), 20% combustio n residues (ash) from waste to energy processes, 10% biosolids from wastewater treatment and 10% sand (inert material) (all measurements by mass). Combustion residues were obtained from the Hillsborough County Resource Recovery Facility (Covanta Hillsborou gh Inc.) at Falkenburg Road, Tampa, FL. Biosolid material (dewatered sludge) was obtained from the Falkenburg Road Advanced Wastewater Treatment Plant in Tampa, FL. The waste mixtures were placed in the bioreactors and hydrated to field capacity with disti lled water, which was held for 24 hours before draining. The bioreactors were rehydrated with a mixture of 2.5 liters of drained leachate and 1 liter of distilled water. Hydrated conditions were maintained by recirculating a mixture of leachate: distilled water (2.5:1) three times a week for seven months. Leachate samples were collected and analyzed weekly during the entire hydrated phase (see below), but were collected more frequently after rehydration of the dehydrated bioreactor (see below). One bioreac tor was randomly chosen for the dehydration study. After a year long dry period, the bioreactor was rehydrated by adding distilled water (20 L) and leachate was sampled every hour for the first eight hours (time zero to time seven) and once at the 24 hour mark.

PAGE 67

57 Figure 3 Diagram of bioreactor configuration. Total microbial concentrations were determined by direct fluorescence microscopy using two staining methods. The more commonly used DAPI (4,6 diamidine 2 phenylin dole) stains the DNA of all cells and does not differentiate between live and dead cells. The Live/Dead BacLight Bacterial Viability kit (Molecular Probes, Invitrogen) includes SYTO 9 that stains both live and dead cells (green fluorescence) and propidium iodide that stains cells with compromised cell membranes (red fluorescence). The advantage of BacLight in differentiating live from membrane damaged cells is counterbalanced by the CAP BASE Leachate Distributor Gas collection fitting Molded PVC Cap 8 holed Vanstone Flanges HDPE Lining Supporting Gravel Base wrapped gra vel 8 holed Blind Flange 8 holed Vanstone Flanges Bi planar Geogrid Separator MID SECTION Waste Mixture Liquid Flow

PAGE 68

58 fact that samples must be observed immediately after staining due to the po tential for sample drying and loss of fluorescence, but this is not the case with DAPI stained slides, which can be stored for later counting. Both staining methods were employed during the hydrated phase of the experiment to compare cell concentrations. D API staining (1mg ml 1 DAPI) was performed as described previously (Nayak et al 2009) Live versus membrane damaged cells were estimated by staining duplicate leachate samples with the instructions. IO concentrations were determined (in duplicate) by standard membrane filtration methods. The volume of leachate filtered was increased from 1 ml in the initial stages of the experiment to 100 ml (25 ml on each of four separate filteres) as the IO concentrations decreased towards the end of the experiment. Filters were placed on mFC agar for fecal coliforms and mEI agar for enterococci (American Public Health Association (APHA) 1998) After incubation for 18 22 hours (U. S. Environmental Protection Agency 1997) blue colonies (fecal coliforms) from mFC agar and colonies w ith blue halo (presumptive enterococci) from mEI agar were enumerated. For the dehydrated phase, it was not feasible to perform BacLight staining due to time restrictions (samples were collected and processed every hour). Total cell concentrations were est imated by DAPI staining and IO concentrations were determined by membrane filtration of 100 ml (50 ml each filtered two times) as described above. To determine if culturable bacteria persisted in the bioreactor after prolonged dehydration, heterotrophic pl Dickinson, MD) for aerobic organisms and anaerobic agar for anaerobic organisms

PAGE 69

59 (Becton Dickinson, MD). R2A agar plates were incubated at room temperature under ambient condi tions for 3 days whereas anaerobic agar plates were incubated in Gas Pak chambers (H 2 + CO 2 ) (Becton Dickinson, MD) for 5 days. Total community DNA was extracted from leachate samples using the Ultraclean Soil DNA Kit (MoBio Laboratories, Inc.) per manufac primer set 1070f and 1392r (Ferris et al. 1996) P CR conditions and the DGGE procedure details are as described previously (Nayak et al 2009) Statistical analysis: Log 10 values of the microbial concentrations (direct microscopic cel l counts) and IO concentrations were compared by paired t tests (GraphPad Instat). The decrease in IO concentrations was biphasic; i.e. there was a steep decline in concentrations from day 1 to day 21 followed by a more gradual decline. Hence the initial d ecay rate was calculated from day 1 to day 21 and the overall decay rate was calculated from day 1 to the last day of IO detection. Decay rates for IOs were calculated using the formula: Decay rate (k) = (log 10 N log 10 N 0 )/ ( t + 1) where N = concentratio n of organisms on day 21 (for initial decay rate) or last day of detection (for overall decay rate) N 0 = concentration of organisms on the first day of the experiment t = day 21 (for initial decay rate) or last da y of detection (for overall decay rate) Paired t tests were performed to compare IO concentrations in duplicate bioreactors by normalizing each concentration to the starting density. Fecal coliform concentrations were normalized to 10 5 CFU ml 1 whereas Ent erococcus concentrations were normalized to 10 6 CFU ml 1

PAGE 70

60 Shannon diversity index ( H ) was calculated by using the formula: H = p i log p i calculated as p i = n i / N where n i is the height of a peak and N is the sum of the peak heights of all bands in the densitometric curve (Eichner et al. 1999; Ogino et al. 2001; Haack et al. 2004) .Shanno n indices were calculated for the community profile of each given time point and an average of these was reported. Results Hydrated phase In the first, hydrated phase of the experiment, total (live + dead) cell concentrations in leachate as calculated by B acLight staining increased from 2.8 x 10 8 cells ml 1 to 2.3 x 10 9 cells ml 1 after the first month and dropped down to 7.0 x 10 8 cells ml 1 by the end of the experiment (Figure 4). BacLight concentrations were slightly but not significantly lower than DAPI concentrations and followed the same trends (data not shown). Live c ell concentrations in bioreactors increased from 2.3 x 10 8 cells ml 1 to 1.9 x 10 9 cells ml 1 after the first month and dropped down to 4.9 x 10 8 cells ml 1 at the end of the seventh mont h (Figure 4). There was no significant difference between the mean cell concentrations (BacLight staining) of the two bioreactors for the total counts ( P = 0.63 ) or live counts ( P = 0.58 ). On an average, 82.3% of total cells (red + green) appeared live thr oughout the hydrated phase. No increasing or decreasing trend was observed in the ratio of live vs. dead cells. pH values in leachate samples from bioreactors dropped from neutral to 5.8 by day 14 of the experiment (Figure 5). The pH returned to neutral b y day 28 and remained neutral till the end of the experiment. Fecal coliform concentrations decreased from 6.3 x 10 4 CFU

PAGE 71

61 ml 1 to below detection limits (<1 CFU ml 1 ), while Enterococcus concentrations decreased from 1 x 10 6 CFU ml 1 to below detection limi ts (<1 CFU ml 1 ) by day 56 of the experiment (Figure 6). There was no significant difference in the fecal coliform concentrations ( P = 0.76) or Enterococcus concentrations ( P = 0.10) in duplicate bioreactors. Initial decay rates (day 1 to 21) for fecal col iforms in each bioreactor were 0.23 and 0.20 and the total decay rates were 0.08 and 0.09. Initial decay rates (day 1 to 21) for enterococci in each bioreactor were 0.23 and 0.21 and the total decay rates were 0.11 and 0.10. Paired t tests were per formed on normalized fecal coliform and Enterococcus concentrations and no significant differences were found in the concentrations of the two IOs ( P = 0.94). Figure 4 Total cell concentrations (x 10 9 /ml) in leachate during the hydrated phase as measured by BacLight Live/Dead staining. Results of duplicate bioreactors (B1 and B2) are presented. Cell concentration x 10 9 / ml

PAGE 72

62 Figure 5 pH values in duplicate bioreactors (B1 and B2) during the hydrated phase. Figure 6 Mean concentrations of fecal coliforms (FC) and enterococci (ENC) in leachate sampled weekly from duplicate bioreactors in the hydrated phase of the exp eriment. Data shown only until culturable cells were no longer detectable in the hydrated phase. log CFU/ ml

PAGE 73

63 Dehydrated phase In the second, dehydrated phase of the experiment total cell concentrations in the leachate increased from 1.5 x 10 7 cells ml 1 at time zero to 2.4 x 10 8 cells ml 1 at 5 hours. Total cell concentrations subsequently stabilized at approximately 1.1 x 10 8 cells ml 1 (Figure 7). Heterotrophic plate counts for culturable aerobic organisms increased from 5.9 x 10 5 CFU ml 1 at time zero to 2 x 10 6 C FU ml 1 at 24 hours (Figure 8). A similar increase was noted for culturable anaerobic organisms, which increased from 6 x 10 3 CFU ml 1 at time zero to 4 x 10 4 CFU ml 1 at 24 hours (Figure 8). Since anaerobic chambers were not used while plating the leachat e, the concentrations do not include any extremely oxygen sensitive anaerobes that may have been present. Fecal coliforms were detected in the leachate five hours after the bioreactor was rehydrated (8 CFU 100 ml 1 ), but not before that time. Twenty four h ours after rehydration, the fecal coliform concentrations increased to 20 CFU 100 ml 1 Enterococci were detected in the leachate three hours after rehydration of the bioreactor (20 CFU 100 ml 1 ). Twenty four hours after rehydration, Enterococcus concentra tions increased to 30 CFU 100 ml 1 DGGE was performed to observe the bacterial community structure in leachate after this prolonged dry period and to determine changes in the community during the next twenty four hours. A shift was observed in the bacteri al community structure (assessed by DGGE) between time zero and the first hour following rehydration, after which the populations were approximately 90% similar (Figure 9). There was a considerable change in the population structure again at the last measu rement (24 hour). The average Shannon diversity index ( H ) for the twenty four period was calculated at 1.04.

PAGE 74

64 Figure 7 Total cell concentrations (x 10 7 /ml) in leachate from time zero (T 0 ) to twenty four (T 24 ) after rehydration of the bioreactor. The line between T 7 and T 24 denotes a time break. Figure 8 Heterotrophic plate counts on R2A agar (aerobic organisms) and anaerobic agar (anaerobic organisms) after bioreactor rehydration. The line between T 7 and T 24 denotes a time break. Cell concentration x 10 7 / ml log CFU/ ml

PAGE 75

65 Figure 9 Dendrogram showing the percent similarity of bacterial DGGE patterns from time zero (T 0 ) to twenty four (T 24 ) after rehydr ation of the bioreactor. The circle denotes a previously undetectable, relatively low GC content band in the 24 th hour sample. Arrow indicates increasing direction of denaturant and acrylamide gradient from lower to higher concentration. Discussion The effect of moisture on the fate of IOs was studied by determining culturable fecal coliform and Enterococcus spp. concentrations in the leachate from laboratory scale bioreactors subjected to moisture rich and moisture deprived conditions. Fecal coliforms a nd enterococci remained detectable for the first 50 days of the hydrated phase, after which they were undetectable till the end of the hydrated phase. The transition of fecal coliforms and enterococci to a viable but non culturable (VBNC) state could expla in the drop in the concentrations below detection level after the first 50 days. During the initial stages of waste degradation cellulose degrading bacteria such as Clostridium spp. and Eubacterium spp. hydrolyze cellulose and hemicellulose into monosaccha rides that are further fermented to produce alcohols and carboxylic acids (Van Dyke and McCarthy 2002; Burrell et al 2004) Accumulation of these metabolic products results in a drop in pH, which could be the stres sors driving IOs into the VBNC state (Oliver 1993; Higgins 100 90 80 70 T2 T3 T4 T5 T6 T7 T1 T24 T0

PAGE 76

66 et al 2007) The decline in the pH of the leachate from neutral to acidic by day 14 corresponds with the initial linear decline in IO concentrations. Feca l coliform decay rates were not significantly different from Enterococcus decay rates and a similar decreasing trend in IO concentrations was observed over a period of time. The decay rates of both IOs demonstrated a biphasic trend wherein a linear decay in concentrations was observed initially and subsequently leveled off until culturable cells were no longer detectable. The IO decay rates observed in our study are comparable to those observed by other studies, although they were measured in different env ironments (Anderson et al 2005; Badgley 2009) Enterococcus populations in freshwater mesocosms demonstrated an initial decay rate of 0.63 and an overall decay rate of 0.02 over a period of two weeks (Badgley 2009) This is in agreement with the biphasic trend of the Enterococcus decay rates observed in our study. In another study, Anderson et al documented decay rates of 0.27 and 0.31 for fecal coliforms and enterococci respectively in freshwater mesocosms inoculated with wastewater (Anderson et al 2005) The IOs persisted for two weeks and four weeks in the water and sediment columns of the mesoc osms, respectively. Both these studies used freshwater as the matrix, which is low in nutrients, and hence the IOs did not persist for long. In comparison, waste is high in nutrients and hence IOs were detected in the leachate samples for about seven week s. The ratio of live to dead cells remained constant throughout the hydrated phase of the study. We hypothesize that the consistent survival of cells over time in the mesocosms is due in part to the high nutrient concentration in the leachate, where one microbial population is constantly replaced by another (succession) resulting in no net increase or decrease in the concentration of live or dead cells.

PAGE 77

67 Few studies have investigated the survival of indicator organisms during the process of waste decomposi tion. Cameron and McDonald reported the early die off of total and fecal coliforms when raw wastewater was mixed in a 9:1 and 1:1 ratio with leachate produced in bioreactors (Cameron and Mcdonald 1977) Since IO survival was determined by mixing wastewater in leachate and not within the bioreactors as part of the waste degradation process, a direct comparison cannot be made with the current study. Deportes et al documented an initial increase in fecal coliform concentrations in raw waste followed by a steady decline (two log decrease per week) within twenty days in an MSW composting plant (Deportes et al 1998) The decrease in pathogen concentrations ( Salmonella Shigella and Ascaris eggs) correlated with the decrease in fecal coliform concentrations but not with the concentrations of total and fecal streptococci. They concl uded that the combined monitoring of indicators and pathogens provides a better measure of the sanitization of waste. In comparison, we did not see an initial increase in fecal coliform concentrations but the decrease in concentrations was comparable with the initial decline (day 1 to day 21) observed in our study. The detection of fecal coliforms and enterococci after one year of dehydration was remarkable and completely unexpected. The recovery of these cells in a culturable state after a prolonged moistu re deprived phase indicates that they can survive, possibly within (Lleo et al 1998) Zaleski et al reported a decr ease in fecal coliform and E. coli concentrations in biosolids even when abundant moisture conditions were maintained (Zaleski 2005) They documented culturable fecal coliforms in biosolids that were moistened ( rainfall) after a desiccation period and attributed it to regrowth due to fecal contamination from birds. The decrease in fecal

PAGE 78

68 coliform concentrations during moisture abundant conditions is in agreement with that observed in our study. In our study, the d etection of fecal coliforms after bioreactor rehydration in our study cannot be attributed to any external influence since the bioreactor was sealed and maintained in the laboratory. Even after a prolonged dry period, the total cell concentrations in the l eachate were lower by just one log as compared to total cell concentrations measured during the hydrated phase. The recovery of culturable aerobic and anaerobic heterotrophs immediately after rehydration is also noteworthy. Changes occurring in the bacter ial population structure in leachate were followed every hour for the first eight hours after rehydration using DGGE to observe the dominant and transient communities and to determine the extent of diversity in the bioreactor community after an extended dr y period. Bacterial populations in the leachate in the twenty four hour time period after rehydration were highly similar. The emergence of a previously undetectable, lower GC content band in the 24 th hour sample (circled in Figure 9) suggests a reviving p opulation in a succession process that will probably continue over time (Nayak et al 2009) In our previous study, we used DGGE to track the bimonthly changes in microbial populations in leachate sampled from frequently hydrated bioreactors (Nayak et al 2009) Bacterial populations exhibited higher diversity (1.37) than those in the current study (1.04) and consider able shifts were observed in the dominant species in the two week period between samples. Here, dehydration of the bioreactor resulted in a reduction of microbial concentrations, which may be coupled with a reduction in population diversity. However, since we did not measure population diversity in the hydrated phase, the change in diversity between the two phases cannot be compared.

PAGE 79

69 Other population studies have employed the Shannon diversity index to calculate the diversity of bacterial communities. For e xample, sulfate reducing bacteria (SRBs) in oxic sediment layers of an oligotrophic lake exhibited lower diversity ( H = 1.83) as compared to anoxic layers ( H = 2.59) (Sass et al. 1998) In another study, high diversity of microbial communities was observed in mercury contaminated soil ( H = 3.48) and was comparabl e to the uncontaminated control ( H = 3.83) (Muller et al 2002) In comparison, we obser ved lower bacterial community diversity in our previous and current bioreactor studies. Landfill waste is high in nutrients but also carries concentrated amounts of toxic metabolic products, heavy metals and pharmaceuticals, which could result in lower pop ulation diversity. This study demonstrated the survival of IOs in a landfill bioreactor even after a prolonged dry period. The implications of these results with respect to the fate of pathogens in the waste should be further explored, as accurate assessme nt of the threat posed by the release of pathogens into groundwater is desirable from the public health perspective. Further research should be conducted to investigate the survival of pathogens during waste degradation and its correlation to the survival of IOs to determine if current monitoring practices are appropriate to protect public health. References American Public Health Association (APHA), A.W.W.A., Water Environment Federation, (1998) Standard methods for the examination of w ater and wastewater (20th ed). Clesceri LS, Greenberg AE, Eaton AD, eds. Washington, DC: American Public Health Association.

PAGE 80

70 Anderson, K.L., Whitlock, J.E. and Harwood, V.J. (2005) Persistence and differential survival of fecal indicator bacteria in subtro pical waters and sediments. Appl Environ Microbiol 71 3041 3048. Badgley, B.D., Thomas, F. I. M., Harwood, V. J. (2009) The effects of submerged aquatic vegetation on the persistence of environmental populations of Enterococcus spp. Unpublished Boothe, D .D.H., Smith, M.C., Gattie, D.K. and Das, K.C. (2001) Characterization of microbial populations in landfill leachate and bulk samples during aerobic bioreduction. Adv Environ Res 5 285 294. Burrell, P.C., O'Sullivan, C., Song, H., Clarke, W.P. and Blackal l, L.L. (2004) Identification, detection, and spatial resolution of Clostridium populations responsible for cellulose degradation in a methanogenic landfill leachate bioreactor. Appl Environ Microbiol 70 2414 2419. Cameron, R.D. and Mcdonald, E.C. (1977) Coliforms and Municipal Landfill Leachate. Journal Water Pollution Control Federation 49 2504 2506. Deportes, I., Benoit Guyod, J.L., Zmirou, D. and Bouvier, M.C. (1998) Microbial disinfection capacity of municipal solid waste (MSW) composting. J Appl Mic robiol 85 238 246. Eichner, C.A., Erb, R.W., Timmis, K.N. and Wagner Dobler, I. (1999) Thermal gradient gel electrophoresis analysis of bioprotection from pollutant shocks in the activated sludge microbial community. Appl Environ Microbiol 65 102 109.

PAGE 81

71 El Fadel, M. (1999) Leachate recirculation effects on settlement and biodegradation rates in MSW landfills. Environ Technol 20 121 133. Ferris, M.J., Muyzer, G. and Ward, D.M. (1996) Denaturing gradient gel electrophoresis profiles of 16S rRNA defined popul ations inhabiting a hot spring microbial mat community. Appl Environ Microbiol 62 340 346. Gerba, C.P., Huber, M.S., Naranjo, J., Rose, J.B. and Bradford, S. (1995) Occurrence of Enteric Pathogens in Composted Domestic Solid Waste Containing Disposable Di apers. Waste Manag Res 13 315 324. Haack, S.K., Fogarty, L.R., West, T.G., Alm, E.W., McGuire, J.T., Long, D.T., Hyndman, D.W. and Forney, L.J. (2004) Spatial and temporal changes in microbial community structure associated with recharge influenced chemic al gradients in a contaminated aquifer. Environ Microbiol 6 438 448. Higgins, M.J., Chen, Y.C., Murthy, S.N., Hendrickson, D., Farrel, J. and Schafer, P. (2007) Reactivation and growth of non culturable indicator bacteria in anaerobically digested biosoli ds after centrifuge dewatering. Water Res 41 665 673. Kjeldsen, P., Barlaz, M.A., Rooker, A.P., Baun, A., Ledin, A. and Christensen, T.H. (2002) Present and long term composition of MSW landfill leachate: A review. Crit Rev Environ Sci Technol 32 297 336 Lleo, M.M., Tafi, M.C. and Canepari, P. (1998) Nonculturable Enterococcus faecalis cells are metabolically active and capable of resuming active growth. Syst Appl Microbiol 21 333 339.

PAGE 82

72 Mose, J.R. and Reinthaler, F. (1985) Microbial Contamination of Hosp ital Waste and Household Refuse. Zentralblatt Fur Bakteriologie Mikrobiologie Und Hygiene Serie B Umwelthygiene Krankenhaushygiene Arbeitshygiene Praventive Medizin 181 98 110. Muller, A.K., Westergaard, K., Christensen, S. and Sorensen, S.J. (2002) The d iversity and function of soil microbial communities exposed to different disturbances. Microb Ecol 44 49 58. Nayak, B.S., Levine, A.D., Cardoso, A. and Harwood, V.J. (2009) Microbial population dynamics in laboratory scale solid waste bioreactors in the p resence or absence of biosolids. J Appl Microbiol 107 1330 1339. Ogino, A., Koshikawa, H., Nakahara, T. and Uchiyama, H. (2001) Succession of microbial communities during a biostimulation process as evaluated by DGGE and clone library analyses. J Appl Mic robiol 91 625 635. Oliver, J.D. (1993) Formation of viable but nonculturable cells. In Starvation in Bacteria (ed. S. Kjelleberg), Plenum Press, New York, pp. 239 272. Peterson, M.L. (1974) Soiled Disposable Diapers Potential Source of Viruses. American Journal of Public Health 64 912 914. Reinhart, D.R., Chopra, M. B., Sreedharan, A., Koodhathinkal, B., Townsend, T.G. (2003) Design and operational issues related to the co disposal of sludges and biosolids in class I landfills. Report #0132010 03 Florid a Center for Solid and Hazardous Waste Management Rose, J.B., Farrah, S. R., Harwood, V. J., Levine, A. D., Lukasik, J., Menendez, P. and Scott, T. M. (2004) Reduction of pathogens, indicator bacteria and alternative indicators

PAGE 83

73 by wastewater treatment and reclamation processes. Final report. Water Environment Research Foundation (WERF) 00 PUM 2T IWA Publishing, London SW1H 0QS, United Kingdom. Sass, H., Wieringa, E., Cypionka, H., Babenzien, H.D. and Overmann, J. (1998) High genetic and physiological dive rsity of sulfate reducing bacteria isolated from an oligotrophic lake sediment. Arch Microbiol 170 243 251. Tatsi, A.A. and Zouboulis, A.I. (2002) A field investigation of the quantity and quality of leachate from a municipal solid waste landfill in a Med iterranean climate (Thessaloniki, Greece). Adv Environ Res 6 207 219. Trost, M. and Filip, Z. (1985) Microbiological Investigations on Refuse from Medical Consulting Rooms and Municipal Refuse. Zentralblatt Fur Bakteriologie Mikrobiologie Und Hygiene Seri e B Umwelthygiene Krankenhaushygiene Arbeitshygiene Praventive Medizin 181 159 172. U. S. Environmental Protection Agency (1997) Method 1600: Membrane filter test methods for enterococci in water. Office of Water, Washington D.C. EPA 821/R 97/004. Van Dyk e, M.I. and McCarthy, A.J. (2002) Molecular biological detection and characterization of Clostridium populations in municipal landfill sites. Appl Environ Microbiol 68 2049 2053. Wreford, K.A., Atwater, J.W. and Lavkulich, L.M. (2000) The effects of moist ure inputs on landfill gas production and composition and leachate characteristics at the Vancouver Landfill Site at Burns Bog. Waste Manag Res 18 386 392.

PAGE 84

74 Zaleski, K.J., Josephson, K. L., Gerba, C. P., Pepper, I. L. (2005) Survival, growth, and regrowth of enteric indicator and pathogenic bacteria in biosolids, compost, soil,and land applied biosolids. J Residuals Sci Tech 2 49 63. RESEARCH SIGNIFICANCE Landfills are massive, subterranean areas where waste is deposited in compact cells over a period of time. Each lateral and vertical section of the landfill is at a different stage of the waste degradation process. The heterogeneous nature of the waste and the variability ng strategies for investigating the microbial communities in the waste. Leachates collected from landfills carry a representative sample of the numerous microorganisms involved in degradation of that waste. The physical, chemical and microbial characterist ics of leachate have been studied in detail by field experiments as well as the construction of laboratory scale bioreactors or lysimeters. Microbial community structure Bioreactors have been used in several studies to mimic waste degradation conditions i n landfills (Pohland and Kim 2000; Cooke 2001; Youcai et al 2002; Ledakowicz and Kaczorek 2004) Bioreactors were used in this study to simulate MSW only and co disposal landfill conditions. Changes in the microbia l community structures, influenced by the presence or absence of biosolids, were investigated by sampling leachate over a period of time. To date, this is the only study that has followed the population changes in both prokaryotic domains ( Archaea and Bact eria ) for such an extended period of time

PAGE 85

75 using denaturing gradient gel electrophoresis (DGGE). Temporal shifts were observed in the archaeal and bacterial populations in bioreactors regardless of the waste content, suggesting a succession process from an immature to a mature microbial community. This study advances the basic understanding of changes in the microbial community structure during solid waste decomposition. Future research efforts could focus on identifying the dominant microbial species durin g specific time intervals with the progression of waste degradation. A better understanding of the microbial community structure in solid waste disposal facilities will allow more effective degradation of waste and management of the infrastructure. Methan ogen populations Methanogenic Archaea are responsible for the generation of methane in landfills. Methanogens are strictly anaerobic and sensitive to changes in pH, temperature, moisture levels etc (Gurijala and Sufl ita 1993; Mormile et al 1996; Shen et al 2001; Mori et al. 2003) Complete anaerobic decomposition of waste is achieved when most of the organic carbon is transformed to methane and carbon dioxide. In this study, methanogen sequences were retrieved from the leachate during the early and late phases of bioreactor operation. Methanogen clones from the early phase were closely related to the members of Methanosarcinales Methanobacteriales and Methanomicrobiales while methanogen clone sequences from the lat e phase were related to members of the Order Methanomicrobiales. Gaining an understanding of the environmental factors that influence the methane production by methanogens will require extensive research, but this effort is justified by the potential for u sing this knowledge to improving methane management practices.

PAGE 86

76 Survival of indicator organisms during waste degradation Compromised leachate collection systems, excessive rainfall or the release of improperly treated leachate into surface waters are some of the ways in which pathogens from landfill leachate can come into contact with the community in general. It is not feasible to analyze treated leachate or groundwater suspected of leachate contamination for all of the various pathogens that could be pres ent. Hence, many studies evaluate the threat posed by leachate borne pathogens by enumerating the indicator organisms in treated leachate (Wreford et al 2000; Tatsi and Zouboulis 2002; Manios and Stentiford 2004) I observed a decline in the culturable concentrations of indicator organisms in bioreactor leachate during moisture rich conditions, which is supported by other such studies (Cameron and Mcdonald 1977; Deportes et a l 1998) Interestingly, I could detect fecal coliforms and enterococci in the leachate even after a prolonged moisture deprived stage. The persistence of indicator organisms in the leachate signifies the potential for pathogen survival and subsequent dis semination into the community in the event of a failure in leachate management and disposal practices. Waste degradation studies The majority of the landfill related studies are conducted on the European continent, where land availability is scarce due to the small land areas of countries, or in Asia, where increasing human population leads to production of vast amounts of waste. Although the land to human ratio in the U.S. is large, it is imperative to establish better landfilling practices in order to con trol problems such as clogging of leachate collection

PAGE 87

77 systems due to mineral deposits and prevent unnecessary waste of land space. This study has added to the existing knowledge of microbial populations in solid waste by tracking the changes in archaeal an d bacterial community structures, which exhibited high diversity and distinct temporal trends. Methanogens actively involved in the early and late stages of waste degradation were sequenced and identified, extending our knowledge of these important fuel pr oducers and agents of greenhouse gas production. The effect of moisture on the fate of indicator organisms was also studied. This research was funded by the Hinkley Center for Solid and Hazardous Waste Management, FL and the information obtained during the study was submitted as a report that can be used to improve landfill management practices. References Cameron, R.D. and Mcdonald, E.C. (1977) Coliforms and Municipal Landfill Leachate. Journal Water Pollution Control Federation 49 25 04 2506. Cooke, A.J., Rowe, R.K., Rittman, B.E., VanGulck, J., Millward, S. (2001) Biofilm growth and mineral precipitation in synthetic leachate columns. J Geotech Geoenviron Eng 849 856. Deportes, I., Benoit Guyod, J.L., Zmirou, D. and Bouvier, M.C. (19 98) Microbial disinfection capacity of municipal solid waste (MSW) composting. J Appl Microbiol 85 238 246. Gurijala, K.R. and Suflita, J.M. (1993) Environmental factors influencing methanogenesis from refuse in landfill samples. Environ Sci Technol 27 1 176 1181.

PAGE 88

78 Ledakowicz, S. and Kaczorek, K. (2004) The effect of advanced oxidation processes on leachate biodegradation in recycling lysimeters. Waste Manag Res 22 149 157. Manios, T. and Stentiford, E.I. (2004) Sanitary aspect of using partially treated l andfill leachate as a water source in green waste composting. Waste Manag 24 107 110. Mori, K., Sparling, R., Hatsu, M. and Takamizawa, K. (2003) Quantification and diversity of the archaeal community in a landfill site. Can J Microbiol 49 28 36. Mormile M.R., Gurijala, K.R., Robinson, J.A., McInerney, M.J. and Suflita, J.M. (1996) The importance of hydrogen in landfill fermentations. Appl Environ Microbiol 62 1583 1588. Pohland, F.G. and Kim, J.C. (2000) Microbially mediated attenuation potential of la ndfill bioreactor systems. Water Sci Technol 41 247 254. Shen, D.S., He, R., Ren, G.P., Traore, I. and Feng, X.S. (2001) Effect of leachate recycle and inoculation on microbial characteristics of municipal refuse in landfill bioreactors. J Environ Sci (Ch ina) 13 508 513. Tatsi, A.A. and Zouboulis, A.I. (2002) A field investigation of the quantity and quality of leachate from a municipal solid waste landfill in a Mediterranean climate (Thessaloniki, Greece). Adv Environ Res 6 207 219. Wreford, K.A., Atwat er, J.W. and Lavkulich, L.M. (2000) The effects of moisture inputs on landfill gas production and composition and leachate characteristics at the Vancouver Landfill Site at Burns Bog. Waste Manag Res 18 386 392. Youcai, Z., Luochun, W., Renhua, H., Dimin, X. and Guowei, G. (2002) A comparison of refuse attenuation in laboratory and field scale lysimeters. Waste Manag 22 29 35.

PAGE 89

79 EVALUATION OF GENETIC RELATIONSHIPS AND PREVALENCE OF VANCOMYCIN RESISTANCE IN ENVIRONMENTAL ENTEROCOCCI BACKGROUND Enteroco cci are ubiquitous in nature and are particularly challenging to study due to the difficulty in differentiating among certain species and strains (Devriese et al 1993; Donabedian et al 1995; Patel et al 1998) Me mbers of the genus Enterococcus are normal inhabitants of the gastrointestinal (GI) tract of mammals and birds. Enterococcus faecalis and Enterococcus faecium are the predominant species of enterococci colonizing the human GI tract. As many as 10 8 colony f orming units (CFU) of enterococci can be found per gram of human feces (Noble 1978) Enterococci are used as regulatory tools (U.S. Environmental Protection Agency 1986) and in microbial source tracking (MST) methods (Harwood et al 2004; Scott et al 2005) as indicators of water quality in fresh and saline waters. Enterococci ha ve been known to persist in environmental waters and have been isolated from food and clinical samples (Eaton and Gasson 2001; Cupakova and Lukasova 2003; Giraffa 2003; Harwood et al 2004) Some enterococci have th e potential to cause infections, especially in immunocompromised humans (Maki and Agger 1988; Svec and Sedlacek 1999) Possession of virulence factors, pathogenicity islands and the capacity to acquire antibiotic re sistance genes make Enterococcus species a formidable group from the public health perspective.

PAGE 90

80 Rapid identification of Enterococcus species in clinical isolates is essential for treatment and prevention of the nosocomial spread of the pathogen. Phenotypi c methods are time consuming and cannot discriminate between some Enterococcus species (Devriese et al 1993) Therefore, DNA based analyses such as genotyping, genetic sequencing and targeting particular genes with specific probes and primers are employed (Malathum et al 1998; Harwood et al 2004; Jackson et al 2004) Methods used to genotype organisms include, but are not limited to, res triction digestion of the chromosomal DNA or targeting Genotyping facilitates identification of variant strains and epidemiological tracking of virulent enterococci to determine their geographic distribution. From an environmental standpoint, enterococcal diversity and prevalence in different habitats can be elucidated by comparison of genotypes. This study was designed with both the environmental and clinical perspective of deter mining the strain distribution and vancomycin resistance of enterococci in local water bodies and wastewater by genotyping, phylogenetic identification and antibiotic susceptibility testing. Identification of enterococci Enterococci are facultatively anaer obic, gram positive, catalase negative cocci. In general, members of the genus are capable of growth at temperatures between 10 to 45C, with an optimum growth temperature of 35C for most species. Some species of the genus Enterocuccus are motile. Growth in broth containing 6.5% NaCl and hydrolysis of esculin in the presence of bile salts are two important phenotypic characteristics used to identify enterococci at the genus level (Facklam et al 1974) Other tests such as production of leucine aminopeptidase (LAP) and hydrolysis of pyrrolidonyl

PAGE 91

81 naphthylamide (PYR) are used to differen tiate enterococci from other gram positive, catalase negative cocci such as those belonging to the genera Leuconostoc/ Weissella and Pediococcus (Facklam and Elliott 1995) They can be differentiated at the species level by phenotypic methods using commercially available kits such as API 20 Strep biochemical te st kits (Sader et al. 1995; Manero and Blanch 1999) MicroScan gram positive identification panel (Iwen et al. 1999) and Biolog microbial ID/ characterization systems (Moore et al. 2006; Graves et al. 2007) Yet, phenotypic identification and classification of enterococci is difficult due to the phenotypic similarity of certain species such as E. gallinarum and E. casseliflavus, E. cecorum and E. columb ae, and E. hirae and E. durans (Devriese et al. 1993) Molecular characterization to the species level has been achieved using DNA DNA reassociation, 16S rRNA gene sequencing and whole cell protein (WCP) analysis (Farrow et al. 1983; Williams et al. 1991; Merquior et al. 1994) Presently, twenty three distinct Enterococcus species have been identified (Jackson et al 2004) Molecular typing methods such as fluorescent internally transcribed spacer region PCR (ITS PCR) (Tyrrell et al. 1997) AFLP typing (Ulrich and Muller 1998) and repetitive extragenic palindrome PCR (REP PCR) (Svec et al. 2005) have also been used in conjunction with phenotypic m ethods for the identification and typing of Enterococcus isolates (Pangallo et al. 2008) Several other molecular techniques use d for typing and speciation of enterococci include tRNA intergenic spacer PCR (t DNA PCR) (Baele et al. 2000) broad range amplification of the 16S rDNA gene (Monstein et al. 1998) randomly amplified polymorphic DNA analysis (RAPD) (Monstein et al. 1998; Quednau et al.

PAGE 92

82 1998) pulsed field gel electrophoresis (PFGE) (Descheemaeker et al. 1997) and BOX PCR (Brownell et al 2007; Hassan et al 2007) Genet that can be used for strain differentiation. Genotyping of enterococci facilitates discrimination of closely re lated species and determination of dominant strains in ecological studies (Brownell et al. 2007; Hassan et al 2007) Supplementing genotype studies with phylogenetic analysis will provide additional information abo ut the relationships among species and strains of enterococci. However, no study has demonstrated that the discrete clusters formed by enterococcal BOX PCR patterns are phylogenetically related species/ strains. This study aims to shed light on the relatio nships between enterococcal species and strains using both genotypic and phylogenetic data. Repetitive DNA sequences have been identified and their presence demonstrated in the genomes of several prokaryotes as well as eukaryotes. DNA repeat sequences hav e been useful in typing certain eukaryotes including protozoan parasites such as Trichomonas vaginalis Giardia lamblia Trypanosoma spp. and Leishmania donovani and non pathogenic organisms such as Paramecium tetraurelia and Saccharomyces cerevisiae (Riley et al. 1991) Palindromic units (PU) or repetitive extragenic palindromes (REP) (Higgins et al. 1982; Gilson et al. 1984; Dimri et al. 1992) and the enterobacterial repetitive intergenic consensus sequences (ERIC) (Sharples and Lloyd 1990; Hulton et al. 1991) are two of th e most well studied DNA repeat sequences in bacteria. These repetitive sequences have been identified in Escherichia coli (Gilson et al. 1984; Hulton

PAGE 93

83 et al. 1991) Salmonella enterica Typhimurium (Hulton et al. 1991) Mycobacterium tuberculosis (Eisenach et al. 1990; Ross et al. 1992) and Neisseria gonorrhoeae (Correia et al. 1986) among others. The presence of repeat DNA elements in prokaryotes is especially intriguing considering the fact that prokaryotic genomes are small and it is generally thought that they cannot afford any waste of coding space. These repeat sequences are postulated to preserve expression (Newbury et al. 1987; Stern et al. 1988) a structural role in chromosomal r earrangements (Stern et al. 1984; Gilson et al. 1986; Gilson et al. 1987) and a role in bacterial virulence (Haas and Meyer 1986) PCR based DNA typing of organisms using primers targeting repetitive DNA elements (known as rep PCR) has proved valuable in diffe rentiating them at the sub species level (Versalovic et al. 1991) The highly reproduc ible and discriminatory nature of this typing technique has resulted in its utilization in epidemiological, agricultural and industrial applications (de Bruijn 1992) The first group of repetitive sequences identif ied in gram positive bacteria was designated BOX elements (Martin et al. 1992) which were initially discovered in Strept ococcus pneumoniae The sequence is highly conserved within its chromosomal intergenic regions. There are approximately 25 copies of BOX elements in the genome of S. pneumoniae. Based on their proximity to the competence specific and virulence related gene s, it is proposed that these elements play a functional role in regulation of genetic transformation and virulence. BOX elements are comprised of boxA, boxB and boxC subunits, which are 59, 45 and 50 base pairs long, respectively and have very low sequence similarity to one another. The boxB subunit can exist alone or as a part of the

PAGE 94

84 BOX group of elements. More than one repeat of the boxB subunit has also been reported in some BOX elements (Martin et al. 1992) The boxA and boxC subunits have been observed to form stable stem loop structures. Among the three subunits, the boxA subunit appears to be the most conserved among d ifferent bacterial species (Koeuth et al. 1995) In bacteria ot her than S. pneumoniae boxA like elements were found to exist independently of boxB like and boxC like subunits. The complete set of BOX elements (boxA, boxB and boxC) have been found only in the genomes of S. pneumoniae and S. agalactiae (Koeuth et al. 1995) About 25 copies of BOX elements have been detected in the se genomes. Several studies have generated BOX PCR patterns from other gram positive bacteria such as Enterococcus spp. (Malathum et al. 1998; Brownell et al. 2007; Pangallo et al. 2008) and Lactobacillus spp. (Gevers et al. 2001) Recent studies have used BOX PCR to produce genotypic dendrograms of enterococcal isolates since fingerprints generated by BOX PCR are reproducible and can differentiate enterococci to the species (Pangallo et al. 2008) and strain (Malathum et al. 1998; Proudy et al. 2008) levels. BOX PCR fingerprinting has been used to type enterococci in ecological studies (Brownell et al. 2007) and MST studies (Brownell et al 2007; Hassan et al 2007) These studies include dendrograms that display population similarities based solely on BOX PCR genotyping. However, no study has demonstrated that BOX PCR patterns of various strains of a particular enterococcal species are more closely related than strains from different species. To increase the precision of the genotyping technique, Johnson et al developed a method using fluorescently labeled primers and internal fluorophore tagged markers that enable

PAGE 95

85 precise alignment of bands within each gel and better normalization of data from different gels (Johnson et al. 2004) This novel method, called the horizontal, fluorophore enhanced, repetitive extragenic palindromic PCR (HFERP) technique, has been used to fingerprint E. coli strains from different sources such as animal feces, soils and environmental waters (Byappanahalli et al. 2006; Hamilton et al. 2006; Ishii et al. 2006; Ksoll et al. 2007) To date, this technique has not been applied to typing of enterococcal isolates. Due to the increased precision of the method compared to c onventional BOX PCR typing, it was chosen in the current study to type enterococci. Virulence in enterococci Enterococci are commensals that inhabit the gastrointestinal tracts of humans and other mammals. It is postulated that commensal enterococci can acquire additional genes on mobile genetic elements, which enable them to cause disease (Gilmore and Ferretti 2003) The virulence traits of E. faecalis strains are more extensively studied compared to the virulence traits of other pathogenic Enterococcus species. E. faecalis strains capable of causing disease frequently possess adhesins that mediate attachment to host cell surfaces (Lowe et al. 1995; Archimbaud et al 2002) Aggregation substance, a surface protein, plays a role in conjugative transfer of a sex pheromone plasmid by binding donor and recipient bacterial cells, but its similarity to eukaryotic fibronectin enables it to bind to integrins on host epithelial cells (Galli 1990, Olmsted 1994). Furthermore, it prevents respiratory burst after phagocytosis, making the organism resistant to the host immune response (Ratika 1999, Sussmuth 2000). It is also known to activate the quorum sensing mechanism that regulates cyto lysin production by Enterococcus faecalis, thereby causing further tissue damage (Chow 1993).

PAGE 96

86 Another cell surface protein expressed by E. faecalis and E. faecium is the enterococcal surface protein (esp). The esp gene, which was initially detected in E. faecalis encodes a protein that is believed to facilitate colonization of the urinary tract and biofilm formation (Shankar et al 1999; Shankar et al 2001; Toledo Arana et al 2001) A variant of the E. faecalis esp gene was later described in clinical isolates of E. faecium (Willems et al 2001; Woodford et al 2001; Leavis et al 2004) The variant esp gene of E. faecium was proposed as a marker of human fecal pollution in environmental waters (Scott et al 2005) Several microbial source t racking (MST) studies have documented the presence of the esp gene in E. faecium isolated from environmental sources and municipal wastewater (McDonald et al 2006; McQuaig et al 2006; Whitman et al 2007; Ahmed et al 2008a; Ahmed et al 2008b) Some E. faecalis strains secrete a toxin called cytolysin that is both hemolytic and bactericidal (Gilmore 1991) The dual action of the cytolysin provides a competitive edge for proliferatio n of the organism in the intestinal epithelium. The enterococcal polysaccharide antigen (Epa) and other capsular carbohydrates may also contribute to evasion of the host immune response (Arduino et al. 1994; Teng et al. 2002) Most E. faecalis strains and some E. faecium strains produce extracellular superoxide, which results in destruction of epithelial cells and deeper tissue invasion (Huycke et al. 1996) Antibiotic resistance in enterococci lactams (penicillins, carbenepems and cephalosporins), aminoglycosides (gentamicin, tobramycin and kanamycin) and glycopeptides (vancomy cin and teicoplanin). Both vancomycin and teicoplanin are glycopeptide antibiotics used to treat infections caused by gram positive

PAGE 97

87 organisms. Glycopeptides inhibit cell wall biosynthesis in gram positive organisms by complexing with the D alanine D alanin e (D Ala D Ala) terminus of the pentapeptide, thereby blocking the subsequent transglycosylation and transpeptidation steps. Vancomycin resistance is achieved by modifying the pentapeptide ending in D Ala D Ala to one ending in a different amino acid such as D Ala D lactate or D Ala D serine (Bugg et al. 1991; Billot Klein et al. 1994) Vancomycin resistance in enterococci is the result of either intrinsic or acquired genes (Rice et al. 1995) The different known genotypes of vancomycin resistance include vanA (main reservoir: E. faecium a lso found in E. faecalis and other species), vanB ( E. faecium E. faecalis ) and vanC ( E. gallinarum E. casseliflavus ) (Arthur and Courvalin 1993) The vanA type of resistance is clinically very important because enterococci possessing this genotype exhibit a high level of resistance to teicopl anin (MIC: 16 512 g/ml) in addition to vancomycin (MIC: 64 1000 g/ml) (Klare et al. 2003) The vanA operon can be located on a plasmid or on the chromosome as a transferable element (usually Tn 1546 or a member of Tn 3 family) (Arthur et al 1993) Approximately sixty percent of the vancomycin resistant enterococci (VRE) isolated in the United States possess the vanA genotype (Clark et al 1993; Deshpande et al 2007) Apart from resistance to multiple antibiotics, there is a possibility of gene transfer from VREs to non resistant strains of enterococci and other organisms (such as Staphylococcus aureus ) (Noble et al. 1992; Rotun et al. 1999; Smith et al. 1999) Vancomycin resistant Staphylococcus aureus (VRSA) strains studied to date have been shown to possess the vanA gene on a Tn 1546 like element (Wei gel et al. 2003; Clark et al. 2005)

PAGE 98

88 vanB is the second most clinically important genotype, conferring moderate to high level resistance to vancomycin (MIC: 4 1000 g/ml) but not teicoplanin. Similar to vanA the vanB operon can be plasmid borne or chr omosomally encoded as a transferable element (Tn 1547 ) (Quintiliani et al. 1993; Evers et al. 1994) vanC is the only intrinsic, chromosomally encoded low level type of resistance (MIC: 2 32 g/ml), which can occur as either vanC1 or vanC2/3 operons (Klare et al. 2003) The vanC genotype is only found in certain species such as E. gallinarum and E. casseliflavus that are generally non pathogenic. Other lesser known genotypes of vancomycin resistance include the vanD vanE and vanG types that are suspected to be chromosomally encoded and non transferable (Cetinkaya et al. 2000) The emergence of multi drug resis tant (MDR) enterococci in clinical settings has amplified the importance of these organisms as nosocomial pathogens. Genetic exchange can lead to the transfer of genes conferring resistance to a wide range of antibiotics such as aminoglycosides, macrolides streptogramins, chloramphenicol and vancomycin. Emergence of VRE Commercial production of vancomycin derived from the actinomycete Amycolatopsis orientalis began in the late 1950s (McCormick 1956) It was initially used for the treatment of all staphylococca l infections but by the mid 1970s it was the drug of choice for the treatment of infections caused by methicillin resistant Staphylococcus aureus (MRSA) (Sande and Johnson 1975) The emergence of vancomycin resistant enter ococci (VRE) in the U.S. and Europe are believed to be the result of different selective pressures. The first clinical incidence of infections caused by VRE were reported from the UK and France in 1986 (Leclercq et a l. 1988; Uttley et al. 1989) The use of the

PAGE 99

89 glycopeptide avoparcin as a growth promoter in animal feed is suspected to be the primary cause of the emergence of VRE in Europe (McDonald et al. 1997) Several studies have shown that the selective pressure exerted by avoparcin results in the development of resistance to vancom ycin in enterococcal strains (Aarestrup 1995; Bager et al. 1997) When the association between the use of avoparcin as feed additive and the growing incidence of VRE was recognized, the practice of using avoparcin i n animal feed was discontinued by the European Union in 1997 (Commission Directive 97/6 EC). After the ban, the prevalence of VRE in the fecal flora of food animals and healthy humans has decreased markedly (Bager et al 1999; Klare et al 1999; Pantosti et al 1999; Hammerum et al 2007) In 1987, one year after the emergence of VRE in Europe, clinical E. faecalis isolates possessing the vanB gene were isolated in a hospital in St. Louis, MO (Uttley et al. 1988) Use of vancomycin to treat infections in US hospitals had increased from approximately 2000 kg in 1984 to 10,000 kg in 1996 (Kirst et al. 1998) The increase in the use of vancomycin to treat infections caused by Clostridium difficile a nd MRSA probably provided the selective pressure for emergence of vancomycin resistant Enterococcus strains (Tenover 2001) According to the National Nosoc omial Infections Surveillance System, the percentage of all nosocomial enterococcal isolates resistant to vancomycin increased from 0.3% to 7.9% between 1989 and 1993 (NNIS 1994) By 1999, the percentage of VRE isolates went up to 25.9% (NNIS 2001) In the 1990s, E. faecalis and E. faecium were the most frequently isolated enterococcal species from clinical samples worldwide (Mutnick et al 2003) E. faecalis was more commonly recovered in comparison to E. faecium at a rati o of 5:1. Recent years have

PAGE 100

90 seen a reversal of this trend, as recovery of E. faecium isolates has been tenfold higher than that of E. faecalis (Deshpande et al 2007; Top et al 2007) The increase in the prevalence of vancomycin resistant E. faecium (VREF) in clinical samples is attributed to the worldwide dissemination of a highly virulent, hospital adapted cluster designated clonal complex (CC) 17 (Klare et al 2005; Treitma n et al. 2005; Willems et al 2005; Leavis et al 2006; Top et al 2008; Valdezate et al 2009) Emergence of this pathogenic lineage of VREF possibly resulted from acquisition of antibiotic resistance genes, virulence factors and pathogenicity islands th rough horizontal gene transfer via plasmids, transposons or chromosomal exchange (Rice et al 1998; Woodford et al 2001) The CC 17 cluster is characterized by resistance to ampicillin and ciprofloxacin and the pr esence of a variant esp gene (Willems et al 2005; Deshpande et al 2007) Many of these isolates have acquired the variant esp gene on a putative pathogenicity island that has been predominantly observed in VREF cl ones associated with disease and/or epidemics and infrequently found in community VREF isolates (Willems et al. 2001; Leavis et al 2004) Genotyping methods such as m ultiple locus variable number tandem repeat (VN TR) analysis (MLVA) or multi locus sequence typing (MLST) have been used for epidemiological surveillance of this cluster and databases of patterns exist for comparison of these patterns worldwide (Klare et al 2005; Werner et al 2007) Recently, some of these strains have demonstrated resistance to chloramphenicol and linezolid; two antibiotics used in the treatment of infections caused by VREF (Potoski et al 2002; Lautenbac h et al. 2004) A combination of quinupristin and dalfopristin is the current drug of choice although some studies have documented resistance against these antibiotics as well (Baysallar et al 2004; Lewis et al 20 05)

PAGE 101

91 VRE in the environment Antibiotic resistant enterococci have been detected in environmental waters, sewage, agricultural runoff, animal feces and feces of healthy human hosts in parts of Europe (Devriese et al 1996; VanderAuwera et al. 1996; Aarestrup et al. 1998; Stobberingh et al. 1999; Gambarotto et al. 2000; Dicuonzo et al. 2001; Guardabassi and Dalsgaard 2004) One study found VanA (high level) VRE in turkeys, turkey farmers, turkey slaughterers and sub urban residents in the Netherlands (Stobberingh et al. 1999) The pulsed field gel electrophoresis (PFGE) patterns of VRE isolates from human and animal origin were different but in some cases, sequences of the vanA containing transposon in both groups were similar, suggesting that the vanA gene is transferable from animal to human associated enterococci or that some VRE strains can colonize animal and human gastrointestinal tracts. VRE exhibiting the VanA phenotype were isolated from seawater, nonagricultural soils and blue mussels in Denmark (Guardabassi and Dalsgaard 2004) High level VRE were readily isolated from the non hospital associated community in European countries including the Netherlands, UK, Germany and Bel gium (Aarestrup and Wegener 1999; Wegener et al. 1999) The high frequency of VRE isolation from the general community indicates that consumption of food products harboring VRE could be a mechanism for VRE dissemina tion (Bates et al. 1994; Jensen et al. 1999) VRE have been isolated from pork samples, minced beef and poultry products in Europe (Klein et al. 1998; van den Braak et al. 199 8) Comparison of Tn 1546 like elements of enterococci isolated from hospital patients and animal feces demonstrated high similarity, indicating the possibility of horizontal gene transfer between isolates from different origins and/ or a common reservoir of resistance genes (Jensen et al. 1998; Woodford et al. 1998)

PAGE 102

92 Avoparcin was never approved for use in animal feed in the US and high level VRE are not commonly isolated from environmental waters or non hospital r elated sources here. Low level VanC VRE have been isolated from chicken (Harwood et al. 2001) and horse (Thal et al. 1995) fecal samples and freshly slaughtered chickens and turkeys (Coque et al. 1996) A recent study found vanA and vanB VRE in marine waters from Washington and California (Roberts et al. 2009) In the US, high level VRE are most commonly isolated from clinical sources (Harwood et al 2001; Harwood et al 2004; Treitman et al 2005) Nosocomial VRE Vancomycin resistant enterococci (VRE), particularly Enterococcus faecalis and Enterococ cus faecium, are notorious for causing nosocomial bacteremia (Noskin et al. 1995; Stosor et al. 1998) endocarditis (Megran 1992) and urinary tract infections (Gross et al. 1976) According to the Centers for Disease Control (CDC), in 2004, one of every three infections in hospital intensive care units were caused by VRE (Cardo et al. 2004) VRE colonization of patients occurs due to prolonged antibiotic usage or exposure to other infected patients (Calfee et al 2003) Such patients can themselves be at risk or may act as a reservoir for the transmission of VRE to other patients and healthcare workers (Crossley 2001; Duckro et al 2005) Immunocompromised, geriatric and organ transplant patients have a higher risk of developing VRE infections than other patients (Bonomo 2000) The emergence of multi drug resistant (MDR) enterococci in clinical settings has amplified the importance of these organisms as nosocomial pathogens.

PAGE 103

93 Research goals Enterococci isolated from water, sediments and vegeta tion of a lake (Lake Carroll), a river (Hillsborough River) and an estuary (Ben T. Davis beach, Tampa Bay) in Florida during one sampling event in summer were typed using the HFERP method and their 16S rRNA genes were sequenced. This process was repeated f or one sampling event in the winter season. Dendrograms illustrating the relatedness of the isolates by BOX PCR and by 16S rRNA sequencing were generated. The purpose of this portion of the study was to compare the ability of BOX PCR to determine genetic r PCR typing is a high throughput and cost effective technique as compared to sequencing analysis for processing a large number of isolates. If the typing results are comparabl e to the results obtained by sequencing, studies involving greater sampling effort can rely on BOX PCR typing to produce reliable estimates of the presence of specific Enterococcus species and the population diversity of the enterococci. Hypothesis: Relati onships projected by the genotypic BOX PCR dendrograms will be similar to those obtained by phylogenetic analysis. Survival studies have demonstrated increased persistence of enterococci in sediments as compared to environmental waters, indicating that se diments may play a role in protecting the organisms from stressors such as elevated temperatures and ultraviolet radiation from the sun (Sherer et al. 1992; Howell et al. 1996; Anderson et al. 2005) Vegetation may possibly play a similar role in providing protection and acting as a reservoir for these organisms. This study aims to investigate the incidence of VRE in environmental matrices with particular emphasis on the clinically important VanA and

PAGE 104

94 VanB phenotypes. Water, sediment and vegetation s amples from two fresh water sites (Lake Carroll and Hillsborough River) and one estuarine site (Ben T Davis beach) and wastewater samples from a treatment plant, septic tanks and a hospital sewer line were subjected to VRE detection and identification. Vancomycin resistance was determined using the agar dilution method by inoculating known concentrations of enterococcal isolates on vancomycin amended media. These results were supplemented by molecular methods such as the det ection of vanA vanB vanC1 and vanC2/3 genes using PCR. Hypothesis: Enterococcus spp. that are resistant to high levels of vancomycin (VanA and VanB phenotype) will be isolated from hospital wastewater. The majority of the enterococci isolated from envir onmental samples and residential wastewater will prove susceptible to vancomycin. References Aarestrup, F.M. (1995) Occurrence of glycopeptide resistance among Enterococcus faecium isolates from conventional and ecological poultry farm s. Microbial Drug Resistance (Larchmont, NY 1 255 257. Aarestrup, F.M., Bager, F., Jensen, N.E., Madsen, M., Meyling, A. and Wegener, H.C. (1998) Surveillance of antimicrobial resistance in bacteria isolated from food animals to antimicrobial growth promo ters and related therapeutic agents in Denmark. APMIS 106 606 622. Aarestrup, F.M. and Wegener, H.C. (1999) The effects of antibiotic usage in food animals on the development of antimicrobial resistance of importance for humans in Campylobacter and Escher ichia coli. Microbes Infect / Institut Pasteur 1 639 644.

PAGE 105

95 Ahmed, W., Stewart, J., Gardner, T. and Powell, D. (2008a) A real time polymerase chain reaction assay for quantitative detection of the human specific enterococci surface protein marker in sewage and environmental waters. Environ Microbiol 10 3255 3264. Ahmed, W., Stewart, J., Powell, D. and Gardner, T. (2008b) Evaluation of the host specificity and prevalence of enterococci surface protein (esp) marker in sewage and its application for sourcing h uman fecal pollution. J Environ Qual 37 1583 1588. Anderson, M.L., Whitlock, J.E. and Harwood, V.J. (2005) Persistence and differential survival of fecal indicator bacteria in subtropical waters and sediments. Appl Environ Microbiol 71 3041 3048. Archimb aud, C., Shankar, N., Forestier, C., Baghdayan, A., Gilmore, M.S., Charbonne, F. and Joly, B. (2002) In vitro adhesive properties and virulence factors of Enterococcus faecalis strains. Res Microbiol 153 75 80. Arduino, R.C., Jacques Palaz, K., Murray, B. E. and Rakita, R.M. (1994) Resistance of Enterococcus faecium to neutrophil mediated phagocytosis. Infect Immunity 62 5587 5594. Arthur, M. and Courvalin, P. (1993) Genetics and Mechanisms of Glycopeptide Resistance in Enterococci. Antimicrob Agents Chemo th 37 1563 1571. Arthur, M., Molinas, C., Depardieu, F. and Courvalin, P. (1993) Characterization of Tn1546, a Tn3 Related Transposon Conferring Glycopeptide Resistance by Synthesis of Depsipeptide Peptidoglycan Precursors in Enterococcus Faecium Bm4147. J Bacteriol 175 117 127.

PAGE 106

96 Baele, M., Baele, P., Vaneechoutte, M., Storms, V., Butaye, P., Devriese, L.A., Verschraegen, G., Gillis, M. and Haesebrouck, F. (2000) Application of tRNA intergenic spacer PCR for identification of Enterococcus species. J Clin M icrobiol 38 4201 4207. Bager, F., Aarestrup, F.M., Madsen, M. and Wegener, H.C. (1999) Glycopeptide resistance in Enterococcus faecium from broilers and pigs following discontinued use of avoparcin. Microb Drug Resistance (Larchmont, NY 5 53 56. Bager, F ., Madsen, M., Christensen, J. and Aarestrup, F.M. (1997) Avoparcin used as a growth promoter is associated with the occurrence of vancomycin resistant Enterococcus faecium on Danish poultry and pig farms. Preventive Veterinary Medicine 31 95 112. Bates, J., Jordens, J.Z. and Griffiths, D.T. (1994) Farm animals as a putative reservoir for vancomycin resistant enterococcal infection in man. J Antimicrob Chemother 34 507 514. Baysallar, M., Kilic, A., Aydogan, H., Cilli, F. and Doganci, L. (2004) Linezolid and quinupristin/dalfopristin resistance in vancomycin resistant enterococci and methicillin resistant Staphylococcus aureus prior to clinical use in Turkey. Int J Antimicrob Agents 23 510 512. Billot Klein, D., Blanot, D., Gutmann, L. and van Heijenoort, J. (1994) Association constants for the binding of vancomycin and teicoplanin to N acetyl D alanyl D alanine and N acetyl D alanyl D serine. The Biochemical Journal 304 ( Pt 3) 1021 1022. Bonomo, R.A. (2000) Multiple antibiotic resistant bacteria in long term care facilities: An emerging problem in the practice of infectious diseases. Clin Infect Dis 31 1414 1422.

PAGE 107

97 Brownell, M.J., Harwood, V.J., Kurz, R.C., McQuaig, S.M., Lukasik, J. and Scott, T.M. (2007) Confirmation of putative stormwater impact on wat er quality at a Florida beach by microbial source tracking methods and structure of indicator organism populations. Water Res 41 3747 3757. Bugg, T.D., Wright, G.D., Dutka Malen, S., Arthur, M., Courvalin, P. and Walsh, C.T. (1991) Molecular basis for van comycin resistance in Enterococcus faecium BM4147: biosynthesis of a depsipeptide peptidoglycan precursor by vancomycin resistance proteins VanH and VanA. Biochemistry 30 10408 10415. Byappanahalli, M.N., Whitman, R.L., Shively, D.A., Sadowsky, M.J. and I shii, S. (2006) Population structure, persistence, and seasonality of autochthonous Escherichia coli in temperate, coastal forest soil from a Great Lakes watershed. Environ Microbiol 8 504 513. Calfee, D.P., Giannetta, E.T., Durbin, L.J., Germanson, T.P. and Farr, B.M. (2003) Control of endemic vancomycin resistant Enterococcus among inpatients at a University Hospital. Clin Infect Dis 37 326 332. Cardo, D., Horan, T., Andrus, M., Dembinski, M., Edwards, J., Peavy, G., Tolson, J., Wagner, D. and Syst, N. (2004) National Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2004, issued October 2004. Am J Infect Control 32 470 485. Cetinkaya, Y., Falk, P. and Mayhall, C.G. (2000) Vancomycin resistant enterococ ci. Clin Microbiol Rev 13 686 707.

PAGE 108

98 Clark, N.C., Cooksey, R.C., Hill, B.C., Swenson, J.M. and Tenover, F.C. (1993) Characterization of glycopeptide resistant enterococci from U.S. hospitals. Antimicrob Agents Chemother 37 2311 2317. Clark, N.C., Weigel, L .M., Patel, J.B. and Tenover, F.C. (2005) Comparison of Tn1546 like elements in vancomycin resistant Staphylococcus aureus isolates from Michigan and Pennsylvania. Antimicrob Agents Chemother 49 470 472. Coque, T.M., Tomayko, J.F., Ricke, S.C., Okhyusen, P.C. and Murray, B.E. (1996) Vancomycin resistant enterococci from nosocomial, community, and animal sources in the United States. Antimicrob Agents Chemother 40 2605 2609. Correia, F.F., Inouye, S. and Inouye, M. (1986) A 26 Base Pair Repetitive Sequence Specific for Neisseria Gonorrhoeae and Neisseria Meningitidis Genomic DNA. J Bacteriol 167 1009 1015. Crossley, K. (2001) Long term care facilities as sources of antibiotic resistant nosocomial pathogens. Current Opinion in Infectious Diseases 14 455 45 9. Cupakova, S. and Lukasova, J. (2003) Agricultural and municipal waste water as a source of antibiotic resistant enterococci. Acta Veterinaria Brno 72 123 129. de Bruijn, F.J. (1992) Use of repetitive (repetitive extragenic palindromic and enterobacteri al repetitive intergeneric consensus) sequences and the polymerase chain reaction to fingerprint the genomes of Rhizobium meliloti isolates and other soil bacteria. Appl Environ Microbiol 58 2180 2187. Descheemaeker, P., Lammens, C., Pot, B., Vandamme, P. and Goossens, H. (1997) Evaluation of arbitrarily primed PCR analysis and pulsed field gel electrophoresis of

PAGE 109

99 large genomic DNA fragments for identification of enterococci important in human medicine. Intl J Syst Bacteriol 47 555 561. Deshpande, L.M., Fr itsche, T.R., Moet, G.J., Biedenbach, D.J. and Jones, R.N. (2007) Antimicrobial resistance and molecular epidemiology of vancomycin resistant enterococci from North America and Europe: a report from the SENTRY antimicrobial surveillance program. Diagnostic Microbiol Infect Dis 58 163 170. Devriese, L.A., Ieven, M., Goossens, H., Vandamme, P., Pot, B., Hommez, J. and Haesebrouck, F. (1996) Presence of vancomycin resistant enterococci in farm and pet animals. Antimicrob Agents Chemother 40 2285 2287. Devrie se, L.A., Pot, B. and Collins, M.D. (1993) Phenotypic identification of the genus Enterococcus and differentiation of phylogenetically distinct enterococcal species and species groups. J Appl Bacteriol 75 399 408. Dicuonzo, G., Gherardi, G., Lorino, G., A ngeletti, S., Battistoni, F., Bertuccini, L., Creti, R., Di Rosa, R., Venditti, M. and Baldassarri, L. (2001) Antibiotic resistance and genotypic characterization by PFGE of clinical and environmental isolates of enterococci. FEMS Microbiol Lett 201 205 2 11. Dimri, G.P., Rudd, K.E., Morgan, M.K., Bayat, H. and Ames, G.F.L. (1992) Physical Mapping of Repetitive Extragenic Palindromic Sequences in Escherichia Coli and Phylogenetic Distribution among Escherichia Coli Strains and Other Enteric Bacteria. J Bact eriol 174 4583 4593.

PAGE 110

100 Donabedian, S., Chow, J.W., Shlaes, D.M., Green, M. and Zervos, M.J. (1995) DNA hybridization and contour clamped homogeneous electric field electrophoresis for identification of enterococci to the species level. J Clin Microbiol 33 141 145. Duckro, A.N., Blom, D.W., Lyle, E.A., Weinstein, R.A. and Hayden, M.K. (2005) Transfer of vancomycin resistant enterococci via health care worker hands. Archives of Internal Medicine 165 302 307. Eaton, T.J. and Gasson, M.J. (2001) Molecular scre ening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl Environ Microbiol 67 1628 1635. Eisenach, K.D., Cave, M.D., Bates, J.H. and Crawford, J.T. (1990) Polymerase Chain Reaction Amplificati on of a Repetitive DNA Sequence Specific for Mycobacterium Tuberculosis. J Infect Dis 161 977 981. Evers, S., Reynolds, P.E. and Courvalin, P. (1994) Sequence of the vanB and ddl genes encoding D alanine:D lactate and D alanine:D alanine ligases in vancom ycin resistant Enterococcus faecalis V583. Gene 140 97 102. Facklam, R. and Elliott, J.A. (1995) Identification, classification, and clinical relevance of catalase negative, gram positive cocci, excluding the streptococci and enterococci. Clin Microbiol R ev 8 479 495. Facklam, R.R., Padula, J.F., Thacker, L.G., Wortham, E.C. and Sconyers, B.J. (1974) Presumptive identification of group A, B, and D streptococci. Appl Microbiol 27 107 113.

PAGE 111

101 Farrow, J.A., Jones, D., Phillips, B.A. and Collins, M.D. (1983) Ta xonomic studies on some group D streptococci. J Gen Microbiol 129 1423 1432. Gambarotto, K., Ploy, M.C., Turlure, P., Grelaud, C., Martin, C., Bordessoule, D. and Denis, F. (2000) Prevalence of vancomycin resistant enterococci in fecal samples from hospit alized patients and nonhospitalized controls in a cattle rearing area of France. J Clin Microbiol 38 620 624. Gevers, D., Huys, G. and Swings, J. (2001) Applicability of rep PCR fingerprinting for identification of Lactobacillus species. FEMS Microbiol Le tt 205 31 36. Gilmore, M.S. (1991) Enterococcus faecalis hemolysin/ bacteriocin. In G M Dunny, P P Cleary, and L L McKay (ed), Genetics and Molecular Biology of Streptococci, Lactococci and Enterococci American Society for Microbiology, Washington DC G ilmore, M.S. and Ferretti, J.J. (2003) Microbiology. The thin line between gut commensal and pathogen. Science (New York, NY 299 1999 2002. Gilson, E., Clement, J.M., Brutlag, D. and Hofnung, M. (1984) A Family of Dispersed Repetitive Extragenic Palindrom ic DNA Sequences in Escherichia Coli. Embo Journal 3 1417 1421. Gilson, E., Clement, J.M., Perrin, D. and Hofnung, M. (1987) Palindromic Units a Case of Highly Repetitive DNA Sequences in Bacteria. Trends in Genetics 3 226 230. Gilson, E., Perrin, D., Clement, J.M., Szmelcman, S., Dassa, E. and Hofnung, M. (1986) Palindromic Units from Escherichia Coli as Binding Sites for a Chromoid Associated Protein. Febs Letters 206 323 328.

PAGE 112

102 Giraffa, G. (2003) Functionality of enterococci in dairy products. Intl J Food Microbiol 88 215 222. Graves, A., Weaver, R.W. and Entry, J. (2007) Characterization of enterococci populations in livestock manure using BIOLOG. Microbiol Res Gross, P.A., Harkavy, L.M., Barden, G.E. and Flower, M.F. (1976) Epidemiology of Nosocomi al Enterococcal Urinary Tract Infection. Am J Medical Sci 272 75 81. Guardabassi, L. and Dalsgaard, A. (2004) Occurrence, structure, and mobility of Tn1546 like elements in environmental isolates of vancomycin resistant enterococci. Appl Environ Microbiol 70 984 990. Haas, R. and Meyer, T.F. (1986) The Repertoire of Silent Pilus Genes in Neisseria Gonorrhoeae Evidence for Gene Conversion. Cell 44 107 115. Hamilton, M.J., Yan, T. and Sadowsky, M.J. (2006) Development of goose and duck specific DNA mark ers to determine sources of Escherichia coli in waterways. Appl Environ Microbiol 72 4012 4019. Hammerum, A.M., Heuer, O.E., Emborg, H.D., Bagger Skjot, L., Jensen, V.F., Rogues, A.M., Skov, R.L., Agerso, Y., Brandt, C.T., Seyfarth, A.M., Muller, A., Hovg aard, K., Ajufo, J., Bager, F., Aarestrup, F.M., Frimodt Moller, N., Wegener, H.C. and Monnet, D.L. (2007) Danish integrated antimicrobial in resistance monitoring and research program. Emerging Infectious Diseases 13 1632 1639. Harwood, V.J., Brownell, M ., Perusek, W. and Whitlock, J.E. (2001) Vancomycin resistant Enterococcus spp. isolated from wastewater and chicken feces in the United States. Appl Environ Microbiol 67 4930 4933.

PAGE 113

103 Harwood, V.J., Delahoya, N.C., Ulrich, R.M., Kramer, M.F., Whitlock, J.E. Garey, J.R. and Lim, D.V. (2004) Molecular confirmation of Enterococcus faecalis and E. faecium from clinical, faecal and environmental sources. Lett Appl Microbiol 38 476 482. Hassan, W.M., Ellender, R.D. and Wang, S.Y. (2007) Fidelity of bacterial sou rce tracking: Escherichia coli vs Enterococcus spp and minimizing assignment of isolates from nonlibrary sources. J Appl Microbiol 102 591 598. Higgins, C.F., Ames, G.F., Barnes, W.M., Clement, J.M. and Hofnung, M. (1982) A Novel Intercistronic Regulatory Element of Prokaryotic Operons. Nature 298 760 762. Howell, J.M., Coyne, M.S. and Cornelius, P.L. (1996) Effect of sediment particle size and temperature on fecal bacteria mortality rates and the fecal coliform/fecal streptococci ratio. J Environ Qual 25 1216 1220. Hulton, C.S.J., Higgins, C.F. and Sharp, P.M. (1991) Eric Sequences a Novel Family of Repetitive Elements in the Genomes of Escherichia Coli, Salmonella Typhimurium and Other Enterobacteria. Molecular Microbiol 5 825 834. Huycke, M.M., Joyc e, W. and Wack, M.F. (1996) Augmented production of extracellular superoxide by blood isolates of Enterococcus faecalis. J Infect Dis 173 743 746. Ishii, S., Ksoll, W.B., Hicks, R.E. and Sadowsky, M.J. (2006) Presence and growth of naturalized Escherichia coli in temperate soils from Lake Superior watersheds. Appl Environ Microbiol 72 612 621. Iwen, P.C., Rupp, M.E., Schreckenberger, P.C. and Hinrichs, S.H. (1999) Evaluation of the revised MicroScan Dried Overnight Gram Positive Identification panel to id entify Enterococcus species. J Clin Microbiol 37 3756 3758.

PAGE 114

104 Jackson, C.R., Fedorka Cray, P.J. and Barrett, J.B. (2004) Use of a genus and species specific multiplex PCR for identification of enterococci. J Clin Microbiol 42 3558 3565. Jensen, L.B., Ahre ns, P., Dons, L., Jones, R.N., Hammerum, A.M. and Aarestrup, F.M. (1998) Molecular analysis of Tn1546 in Enterococcus faecium isolated from animals and humans. J Clin Microbiol 36 437 442. Jensen, L.B., Hammerum, A.M., Poulsen, R.L. and Westh, H. (1999) V ancomycin resistant Enterococcus faecium strains with highly similar pulsed field gel electrophoresis patterns containing similar Tn1546 like elements isolated from a hospitalized patient and pigs in Denmark. Antimicrob Agents Chemother 43 724 725. Johnso n, L.K., Brown, M.B., Carruthers, E.A., Ferguson, J.A., Dombek, P.E. and Sadowsky, M.J. (2004) Sample size, library composition, and genotypic diversity among natural populations of Escherichia coli from different animals influence accuracy of determining sources of fecal pollution. Appl Environ Microbiol 70 4478 4485. Kirst, H.A., Thompson, D.G. and Nicas, T.I. (1998) Historical yearly usage of vancomycin. Antimicrob Agents Chemother 42 1303 1304. Klare, I., Badstubner, D., Konstabel, C., Bohme, G., Clau s, H. and Witte, W. (1999) Decreased incidence of VanA type vancomycin resistant enterococci isolated from poultry meat and from fecal samples of humans in the community after discontinuation of avoparcin usage in animal husbandry. Microbial Drug Resistanc e (Larchmont, NY 5 45 52.

PAGE 115

105 Klare, I., Konstabel, C., Badstubner, D., Werner, G. and Witte, W. (2003) Occurrence and spread of antibiotic resistances in Enterococcus faecium. Intl J Food Microbiol 88 269 290. Klare, I., Konstabel, C., Mueller Bertling, S., Werner, G., Strommenger, B., Kettlitz, C., Borgmann, S., Schulte, B., Jonas, D., Serr, A., Fahr, A.M., Eigner, U. and Witte, W. (2005) Spread of ampicillin/vancomycin resistant Enterococcus faecium of the epidemic virulent clonal complex 17 carrying the g enes esp and hyl in German hospitals. Eur J Clin Microbiol Infect Dis 24 815 825. Klein, G., Pack, A. and Reuter, G. (1998) Antibiotic resistance patterns of enterococci and occurrence of vancomycin resistant enterococci in raw minced beef and pork in Ger many. Appl Environ Microbiol 64 1825 1830. Koeuth, T., Versalovic, J. and Lupski, J.R. (1995) Differential Subsequence Conservation of Interspersed Repetitive Streptococcus Pneumoniae Box Elements in Diverse Bacteria. Genome Res 5 408 418. Ksoll, W.B., I shii, S., Sadowsky, M.J. and Hicks, R.E. (2007) Presence and sources of fecal coliform bacteria in epilithic periphyton communities of Lake Superior. Appl Environ Microbiol 73 3771 3778. Lautenbach, E., Gould, C.V., LaRosa, L.A., Marr, A.M., Nachamkin, I. Bilker, W.B. and Fishman, N.O. (2004) Emergence of resistance to chloramphenicol among vancomycin resistant enterococcal (VRE) bloodstream isolates. Int J Antimicrob Agents 23 200 203.

PAGE 116

106 Leavis, H., Top, J., Shankar, N., Borgen, K., Bonten, M., van Embden J. and Willems, R.J. (2004) A novel putative enterococcal pathogenicity island linked to the esp virulence gene of Enterococcus faecium and associated with epidemicity. J Bacteriol 186 672 682. Leavis, H.L., Willems, R.J., Top, J. and Bonten, M.J. (2006 ) High level ciprofloxacin resistance from point mutations in gyrA and parC confined to global hospital adapted clonal lineage CC17 of Enterococcus faecium. J Clin Microbiol 44 1059 1064. Leclercq, R., Derlot, E., Duval, J. and Courvalin, P. (1988) Plasmi d mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. The New England Journal of Medicine 319 157 161. Lewis, J.S., 2nd, Owens, A., Cadena, J., Sabol, K., Patterson, J.E. and Jorgensen, J.H. (2005) Emergence of daptomycin resistance in Enterococcus faecium during daptomycin therapy. Antimicrob Agents Chemother 49 1664 1665. Lowe, A.M., Lambert, P.A. and Smith, A.W. (1995) Cloning of an Enterococcus Faecalis Endocarditis Antigen Homology with Adhesins from Some Oral Streptococci. I nfect Immunity 63 703 706. Maki, D.G. and Agger, W.A. (1988) Enterococcal bacteremia: clinical features, the risk of endocarditis, and management. Medicine (Baltimore) 67 248 269. Malathum, K., Singh, K.V., Weinstock, G.M. and Murray, B.E. (1998) Repetit ive sequence based PCR versus pulsed field gel electrophoresis for typing of Enterococcus faecalis at the subspecies level. J Clin Microbiol 36 211 215. Manero, A. and Blanch, A.R. (1999) Identification of Enterococcus spp. with a biochemical key. Appl En viron Microbiol 65 4425 4430.

PAGE 117

107 Martin, B., Humbert, O., Camara, M., Guenzi, E., Walker, J., Mitchell, T., Andrew, P., Prudhomme, M., Alloing, G., Hakenbeck, R., Morrison, D.A., Boulnois, G.J. and Claverys, J.P. (1992) A Highly Conserved Repeated DNA Elemen t Located in the Chromosome of Streptococcus Pneumoniae. Nucleic Acids Research 20 3479 3483. McCormick, M.H., Stark, W. M., Pittenger, G. E., Pittenger, R. C. and McGuire, J. M. (1956) Vancomycin, a new antibiotic. I. Chemical and biological properties. Antibiot Annu 1955 1956: 601 611. McDonald, J.L., Hartel, P.G., Gentit, L.C., Belcher, C.N., Gates, K.W., Rodgers, K., Fisher, J.A., Smith, K.A. and Payne, K.A. (2006) Identifying sources of fecal contamination inexpensively with targeted sampling and bac terial source tracking. J Environ Qual 35 889 897. McDonald, L.C., Kuehnert, M.J., Tenover, F.C. and Jarvis, W.R. (1997) Vancomycin resistant enterococci outside the health care setting: prevalence, sources, and public health implications. Emerg Infect Di s 3 311 317. McQuaig, S.M., Scott, T.M., Harwood, V.J., Farrah, S.R. and Lukasik, J.O. (2006) Detection of human derived fecal pollution in environmental waters by use of a PCR based human polyomavirus assay. Appl Environ Microbiol 72 7567 7574. Megran, D.W. (1992) Enterococcal Endocarditis. Clinical Infectious Diseases 15 63 71. Merquior, V.L.C., Peralta, J.M., Facklam, R.R. and Teixeira, L.M. (1994) Analysis of Electrophoretic Whole Cell Protein Profiles as a Tool for Characterization of Enterococcus S pecies. Current Microbiol 28 149 153.

PAGE 118

108 Monstein, H.J., Quednau, M., Samuelsson, A., Ahrne, S., Isaksson, B. and Jonasson, J. (1998) Division of the genus Enterococcus into species groups using PCR based molecular typing methods. Microbiology UK 144 1171 1 179. Moore, D.F., Zhowandai, M.H., Ferguson, D.M., McGee, C., Mott, J.B. and Stewart, J.C. (2006) Comparison of 16S rRNA sequencing with conventional and commercial phenotypic techniques for identification of enterococci from the marine environment. J Appl Microbiol 100 1272 1281. Mutnick, A.H., Biedenbach, D.J. and Jones, R.N. (2003) Geographic variations and trends in antimicrobial resistance among Enterococcus faecalis and Enterococcus faecium in the SENTRY Antimicrobial Surveillance Program (1997 2000) Diagnostic Microbiology and Infectious Disease 46 63 68. Newbury, S.F., Smith, N.H., Robinson, E.C., Hiles, I.D. and Higgins, C.F. (1987) Stabilization of Translationally Active Messenger Rna by Prokaryotic Rep Sequences. Cell 48 297 310. NNIS (1994) S ummary of notifiable diseases, United States. MMWR Morb Mortal Wkly Rep 1994; 43 (53), 51 80. NNIS (2001) National Nosocomial Infections Surveillance (NNIS) System Report, Data Summary from January 1992 June 2001, issued August 2001. Am J Infect Control 2 9 404 421. Noble, C.J. (1978) Carriage of group D streptococci in the human bowel. J Clin Pathol 31 1182 1186.

PAGE 119

109 Noble, W.C., Virani, Z. and Cree, R.G. (1992) Co transfer of vancomycin and other resistance genes from Enterococcus faecalis NCTC 12201 to Sta phylococcus aureus FEMS Microbiol Lett 72 195 198. Noskin, G.A., Peterson, L.R. and Warren, J.R. (1995) Enterococcus faecium and Enterococcus faecalis bacteremia: acquisition and outcome. Clin Infect Dis 20 296 301. Pangallo, D., Drahovska, H., Harichov a, J., Karelova, E., Chovanova, K., Aradska, J., Ferianc, P., Turna, J. and Timko, J. (2008) Evaluation of different PCR based approaches for the identification and typing of environmental enterococci. Antonie Van Leeuwenhoek 93 193 203. Pantosti, A., Del Grosso, M., Tagliabue, S., Macri, A. and Caprioli, A. (1999) Decrease of vancomycin resistant enterococci in poultry meat after avoparcin ban. Lancet 354 741 742. Patel, R., Piper, K.E., Rouse, M.S., Steckelberg, J.M., Uhl, J.R., Kohner, P., Hopkins, M.K ., Cockerill, F.R., 3rd and Kline, B.C. (1998) Determination of 16S rRNA sequences of enterococci and application to species identification of nonmotile Enterococcus gallinarum isolates. J Clin Microbiol 36 3399 3407. Potoski, B.A., Mangino, J.E. and Goff D.A. (2002) Clinical failures of linezolid and implications for the clinical microbiology laboratory. Emerg Infect Dis 8 1519 1520. Proudy, I., Bougle, D., Coton, E., Coton, M., Leclercq, R. and Vergnaud, M. (2008) Genotypic characterization of Enteroba cter sakazakii isolates by PFGE, BOX PCR and sequencing of the fliC gene. J Appl Microbiol 104 26 34.

PAGE 120

110 Quednau, M., Ahrne, S., Petersson, A.C. and Molin, G. (1998) Identification of clinically important species of Enterococcus within 1 day with randomly am plified polymorphic DNA (RAPD). Current Microbiol 36 332 336. Quintiliani, R., Jr., Evers, S. and Courvalin, P. (1993) The vanB gene confers various levels of self transferable resistance to vancomycin in enterococci. J Infect Dis 167 1220 1223. Rice, E. W., Messer, J.W., Johnson, C.H. and Reasoner, D.J. (1995) Occurrence of high level aminoglycoside resistance in environmental isolates of enterococci. Appl Environ Microbiol 61 374 376. Rice, L.B., Carias, L.L., Donskey, C.L. and Rudin, S.D. (1998) Transf erable, plasmid mediated VanB type glycopeptide resistance in Enterococcus faecium Antimicrob Agents Chemother 42 963 964. Riley, D.E., Samadpour, M. and Krieger, J.N. (1991) Detection of variable DNA repeats in diverse eukaryotic microorganisms by a sin gle set of polymerase chain reaction primers. J Clin Microbiol 29 2746 2751. Roberts, M.C., Soge, O.O., Giardino, M.A., Mazengia, E., Ma, G. and Meschke, J.S. (2009) Vancomycin resistant Enterococcus spp. in marine environments from the West Coast of the USA. J Appl Microbiol 107 (1), 300 307 Ross, B.C., Raios, K., Jackson, K. and Dwyer, B. (1992) Molecular cloning of a highly repeated DNA element from Mycobacterium tuberculosis and its use as an epidemiologic tool. J Clin Microbiol 30 942 946.

PAGE 121

111 Rotun, S.S ., McMath, V., Schoonmaker, D.J., Maupin, P.S., Tenover, F.C., Hill, B.C. and Ackman, D.M. (1999) Staphylococcus aureus with reduced susceptibility to vancomycin isolated from a patient with fatal bacteremia. Emerg Infect Dis 5 147 149. Sader, H.S., Biede nbach, D. and Jones, R.N. (1995) Evaluation of Vitek and API 20S for species identification of enterococci. Diagnostic Microbiol Infect Dis 22 315 319. Sande, M.A. and Johnson, M.L. (1975) Antimicrobial therapy of experimental endocarditis caused by Staph ylococcus aureus J Infect Dis 131 367 375. Scott, T.M., Jenkins, T.M., Lukasik, J. and Rose, J.B. (2005) Potential use of a host associated molecular marker in Enterococcus faecium as an index of human fecal pollution. Environ Sci Technol 39 283 287. Sh ankar, N., Lockatell, C.V., Baghdayan, A.S., Drachenberg, C., Gilmore, M.S. and Johnson, D.E. (2001) Role of Enterococcus faecalis surface protein Esp in the pathogenesis of ascending urinary tract infection. Infect Immun 69 4366 4372. Shankar, V., Baghda yan, A.S., Huycke, M.M., Lindahl, G. and Gilmore, M.S. (1999) Infection derived Enterococcus faecalis strains are enriched in esp a gene encoding a novel surface protein. Infect Immun 67 193 200. Sharples, G.J. and Lloyd, R.G. (1990) A novel repeated DNA sequence located in the intergenic regions of bacterial chromosomes. Nucleic Acids Res 18 6503 6508. Sherer, B.M., Miner, J.R., Moore, J.A. and Buckhouse, J.C. (1992) Indicator bacterial survival in stream sediments. J Environ Qual 21 591 595. Smith, T. L., Pearson, M.L., Wilcox, K.R., Cruz, C., Lancaster, M.V., Robinson Dunn, B., Tenover, F.C., Zervos, M.J., Band, J.D., White, E. and Jarvis, W.R. (1999)

PAGE 122

112 Emergence of vancomycin resistance in Staphylococcus aureus Glycopeptide intermediate Staphylococcus aureus working group. N Engl J Med 340 493 501. Stern, M.J., Ames, G.F.L., Smith, N.H., Robinson, E.C. and Higgins, C.F. (1984) Repetitive extragenic palindromic sequences a major component of the bacterial genome. Cell 37 1015 1026. Stern, M.J., Pross nitz, E. and Ames, G.F.L. (1988) Role of the intercistronic region in post transcriptional control of gene expression in the histidine transport operon of Salmonella typhimurium Involvement of REP sequences. Molecular Microbiol 2 141 152. Stobberingh, E ., van den Bogaard, A., London, N., Driessen, C., Top, J. and Willems, R. (1999) Enterococci with glycopeptide resistance in turkeys, turkey farmers, turkey slaughterers, and (sub)urban residents in the south of The Netherlands: evidence for transmission o f vancomycin resistance from animals to humans? Antimicrob Agents Chemother 43 2215 2221. Stosor, V., Peterson, L.R., Postelnick, M. and Noskin, G.A. (1998) Enterococcus faecium bacteremia: does vancomycin resistance make a difference? Archives Internal M edicine 158 522 527. Svec, P. and Sedlacek, I. (1999) Occurrence of Enterococcus spp. in waters. Folia Microbiologica 44 3 10. Svec, P., Vancanneyt, M., Seman, M., Snauwaert, C., Lefebvre, K., Sedlacek, I. and Swings, J. (2005) Evaluation of (GTG)5 PCR f or identification of Enterococcus spp. FEMS Microbiol Lett 247 59 63.

PAGE 123

113 Teng, F., Jacques Palaz, K.D., Weinstock, G.M. and Murray, B.E. (2002) Evidence that the enterococcal polysaccharide antigen gene ( epa ) cluster is widespread in Enterococcus faecalis an d influences resistance to phagocytic killing of E. faecalis Infect Immun 70 2010 2015. Tenover, F.C. (2001) Development and spread of bacterial resistance to antimicrobial agents: An overview. Clin Infect Dis 33 S108 S115. Thal, L.A., Chow, J.W., Mahay ni, R., Bonilla, H., Perri, M.B., Donabedian, S.A., Silverman, J., Taber, S. and Zervos, M.J. (1995) Characterization of antimicrobial resistance in enterococci of animal origin. Antimicrob Agents Chemother 39 2112 2115. Toledo Arana, A., Valle, J., Solan o, C., Arrizubieta, M.J., Cucarella, C., Lamata, M., Amorena, B., Leiva, J., Penades, J.R. and Lasa, I. (2001) The enterococcal surface protein, Esp, is involved in Enterococcus faecalis biofilm formation. Appl Environ Microbiol 67 4538 4545. Top, J., Wil lems, R., Blok, H., de Regt, M., Jalink, K., Troelstra, A., Goorhuis, B. and Bonten, M. (2007) Ecological replacement of Enterococcus faecalis by multiresistant clonal complex 17 Enterococcus faecium Clin Microbiol Infect 13 316 319. Top, J., Willems, R. van der Velden, S., Asbroek, M. and Bonten, M. (2008) Emergence of clonal complex 17 Enterococcus faecium in The Netherlands. J Clin Microbiol 46 214 219. Treitman, A.N., Yarnold, P.R., Warren, J. and Noskin, G.A. (2005) Emerging incidence of Enterococc us faecium among hospital isolates (1993 to 2002). J Clin Microbiol 43 462 463.

PAGE 124

114 Tyrrell, G.J., Bethune, R.N., Willey, B. and Low, D.E. (1997) Species identification of enterococci via intergenic ribosomal PCR (vol 35, pg 1054, 1997). J Clin Microbiol 35 2434 2434. U.S. Environmental Protection Agency (1986) Ambient Water Quality Criteria for Bacteria 1986. Washington, DC: U.S. Environmental Protection Agency. Ulrich, A. and Muller, T. (1998) Heterogeneity of plant associated streptococci as characterized by phenotypic features and restriction analysis of PCR amplified 16S rDNA. J Appl Microbiol 84 293 303. Uttley, A.H., George, R.C., Naidoo, J., Woodford, N., Johnson, A.P., Collins, C.H., Morrison, D., Gilfillan, A.J., Fitch, L.E. and Heptonstall, J. (198 9) High level vancomycin resistant enterococci causing hospital infections. Epidemiology and Infection 103 173 181. Uttley, A.H.C., Collins, C.H., Naidoo, J. and George, R.C. (1988) Vancomycin Resistant Enterococci. Lancet 1 57 58. Valdezate, S., Labayru C., Navarro, A., Mantecon, M.A., Ortega, M., Coque, T.M., Garcia, M. and Saez Nieto, J.A. (2009) Large clonal outbreak of multidrug resistant CC17 ST17 Enterococcus faecium containing Tn5382 in a Spanish hospital. J Antimicrob Chemother 63 17 20. van de n Braak, N., van Belkum, A., van Keulen, M., Vliegenthart, J., Verbrugh, H.A. and Endtz, H.P. (1998) Molecular characterization of vancomycin resistant enterococci from hospitalized patients and poultry products in the Netherlands. J Clin Microbiol 36 192 7 1932.

PAGE 125

115 VanderAuwera, P., Pensart, N., Korten, V., Murray, B.E. and Leclercq, R. (1996) Influence of oral glycopeptides on the fecal flora of human volunteers: Selection of highly glycopeptide resistant enterococci. Journal of Infectious Diseases 173 1129 1136. Versalovic, J., Koeuth, T. and Lupski, J.R. (1991) Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res 19 6823 6831. Wegener, H.C., Aarestrup, F.M., Jensen, L.B., Hammerum A.M. and Bager, F. (1999) Use of antimicrobial growth promoters in food animals and Enterococcus faecium resistance to therapeutic antimicrobial drugs in Europe. Emerg Infect Dis 5 329 335. Weigel, L.M., Clewell, D.B., Gill, S.R., Clark, N.C., McDougal, L.K., Flannagan, S.E., Kolonay, J.F., Shetty, J., Killgore, G.E. and Tenover, F.C. (2003) Genetic analysis of a high level vancomycin resistant isolate of Staphylococcus aureus. Science 302 1569 1571. Werner, G., Klare, I. and Witte, W. (2007) The curren t MLVA typing scheme for Enterococcus faecium is less discriminatory than MLST and PFGE for epidemic virulent, hospital adapted clonal types. BMC Microbiol 7 28. Whitman, R.L., Przybyla Kelly, K., Shively, D.A. and Byappanahalli, M.N. (2007) Incidence of the enterococcal surface protein (esp) gene in human and animal fecal sources. Environmental science & technology 41 6090 6095. Willems, R.J., Top, J., van Santen, M., Robinson, D.A., Coque, T.M., Baquero, F., Grundmann, H. and Bonten, M.J. (2005) Global spread of vancomycin resistant

PAGE 126

116 Enterococcus faecium from distinct nosocomial genetic complex. Emerg Infect Dis 11 821 828. Willems, R.J.L., Homan, W., Top, J., van Santen Verheuvel, M., Tribe, D., Manzioros, X., Gaillard, C., Vandenbroucke Grauls, C.M.J.E ., Mascini, E.M., van Kregten, E., van Embden, J.D.A. and Bonten, M.J.M. (2001) Variant esp gene as a marker of a distinct genetic lineage of vancomycin resistant Enterococcus faecium spreading in hospitals. Lancet 357 853 855. Williams, A.M., Rodrigues, U.M. and Collins, M.D. (1991) Intrageneric relationships of Enterococci as determined by reverse transcriptase sequencing of small subunit rRNA. Research in microbiology 142 67 74. Woodford, N., Adebiyi, A.M., Palepou, M.F. and Cookson, B.D. (1998) Divers ity of VanA glycopeptide resistance elements in enterococci from humans and nonhuman sources. Antimicrob Agents Chemother 42 502 508. Woodford, N., Soltani, M. and Hardy, K.J. (2001) Frequency of esp in Enterococcus faecium isolates. Lancet 358 584.

PAGE 127

117 C OMPARISON OF GENOTYPIC AND PHYLOGENETIC RELATIONSHIPS OF ENVIRONMENTAL ENTEROCOCCUS ISOLATES BY BOX PCR TYPING AND 16S rRNA SEQUENCING Introduction Enterococci are facultatively anaerobic, gram positive, catalase negative cocci that are commonly found in t he gastrointestinal (GI) tract of mammals and birds. Members of the genus Enterococcus are also readily isolated from soil, surface waters, sediments and vegetation associated with surface waters, and sometimes food (Fujioka 1999; Bordalo et al 2002; Giraffa 2003; Anderson et al 2005) Enterococci are used as regulatory tools to assess water quality in fresh and saline waters (U.S. Environmental Protection Agency 1986) Some Enterococcus species possess virulence factors and antibiotic resistance genes and are capable of causing disease (Shankar et al 2001; Teng et al 2002; Rice et al 2003) Vancomycin resistant enterococci (VRE) are important nosocomial pathogens that have been isolated from approximately 30% of the patients in intensive care units in US hospitals (NNIS 2004; Rice et al. 2 004) Accurate identification and classification of the different species belonging to the genus Enterococcus is important for both environmental and clinical studies. Phenotypic methods used to identify Enterococcus species are not very discriminatory or accurate due to the phenotypic similarity of certain species such as E. gallinarum and E. casseliflavus, E. cecorum and E. columbae, and E. hirae and E. durans (Devriese et al. 1993) Therefore, DNA based analyses such as genotyping, genetic sequencing a nd targeting particular genes with specific probes and primers are also employed for the

PAGE 128

118 identification and classification of enterococci (Malathum et al 1998; Harwood et al 2004; Jackson et al 2004) Sequencing identification (Weisburg et al 1991; Clarridge 2004; Harmsen and Karch 2004) The 16S rRNA gene is highly conserved within species and among dif ferent species belonging to the same genus (Woese 1987) Genotyping methods are high throughput and cost effective as compared to sequencing analysis for processing a large number of isolates. that can be used for species and strain differentiation. Environmental studies employ genotyping methods for determination of enterococca l diversity and prevalence in different habitats (Seurinck et al 2003; Anderson et al 2005; Brownell et al 2007; Hassan et al 2007; Pangallo et al 2008) In clinical studies, genotyping facilitates identificat ion of variant strains and epidemiological tracking of virulent enterococci (Malathum et al 1998; Dicuonzo et al 2001; Coque et al 2005; Werner et al 2007) BOX PCR is a genotyping method that amplifies the DNA sequences between highly conserved repetitive sequences called BOX elements (Martin et al 1992) BOX elements are comprised of boxA, boxB and boxC subunits, which are 59, 45 and 50 base pairs long, respectively an d have very low sequence similarity to one another. Among the three subunits, the boxA subunit appears to be the most conserved in different bacterial species (Koeuth et al. 1995) The BOXA2R primer sequence is 22 bp long and was originally derived from the boxA subunit of Streptococcus pneumoniae (Martin et al 1992; Koeuth et al 1995) When BOXA2R sequences in the genome of a bacterial species are targeted in PCR, it results in differently sized amplicons of the DNA sequences between the

PAGE 129

119 interspersed repeats. Separation of these amplicons using gel electroph oresis leads to the development of species or strain specific fingerprint patterns. Diverse BOX PCR patterns are generated due to d istinct differences in the genome organization of bacterial species. Better resolution of inter and intra species diffe rences can be achieved by BOX PCR typing than 16S rRNA sequencing since BOX PCR targets DNA sequences in the entire genome while 16S rRNA sequencing targets a small portion (~1500 bp) of the genome. The evolutionary conservation of BOX elements (similar to that of the 16S rRNA sequences) enables the comparison of genotypic relatedness of bacterial species with their phylogenetic relationships. Several studies have used BOX PCR typing in environmental studies to determine genotypic relationships of enteroco ccal isolates (Brownell et al 2007; Hassan et al 2007) These studies include dendrograms that display population similarities based solely on BOX PCR genotyping. However, no study has demonstrated that the BOX PC R patterns of various strains of a particular enterococcal species are more similar than strains from different species. Supplementing genotype studies with phylogenetic analysis will provide additional comparative information about the relationships among species and strains of enterococci. The purpose of this study was to compare the ability of BOX PCR to determine the genetic relatedness of Enterococcus 16S rRNA gene sequencing. To this aim, enterococ ci were isolated from different matrices (water, sediments and vegetation) of two freshwater sites and one estuarine site in Florida during two separate sampling events in an effort to maximize sampled strain diversity. These isolates were typed using BOX PCR and their 16S rRNA genes were

PAGE 130

120 sequenced. We hypothesized that the relationships projected by the genotypic BOX PCR dendrograms will be similar to those obtained by phylogenetic analysis. Materials and methods Sample collection and processing Water, se diment and vegetation samples were collected during two separate sampling events from Lake Carroll, Hillsborough River and Ben T Davis beach (Tampa Bay). A list of isolates used in this study according to site and isolation matrix is compiled in Table 3. S amples were collected in sterile bottles, maintained at 4 C and processed within 4 hours of collection. Sediment and vegetation samples were diluted 1:10 with phosphate buffered dilution water (0.0425 g L 1 KH 2 PO 4 and 0.4055 g L 1 MgCl 2 ; pH 7.2) (American Public Health Assoc iation (APHA) 1998) and particle associated bacteria were dislodged using sonication (Anderson et al 2005) Microorganisms in water (10ml, 100ml), sediment (2ml, 20ml) and vegetation (2ml, 20ml) samples were concentrated by membrane filtration through 0.45 m pore size filters and the filters were incubated on mEI agar at 41C for 18 22 hours (U. S. Environmental Protection Agency 1997) Individual colonies with a blue halo (presumptive enterococci) were picked using sterile toothpicks and inoculated into Enterococcosel broth (EB) in 96 well microtitre plates. Af ter incubation at 37C for approximately 22 hours, glycerol was added to each well and the EB plate was frozen at 80C until cultures were reanimated. Individual isolates grown in EB were streaked on TSA for further isolation and incubated overnight at 37 C. Individual colonies were picked, inoculated in 2ml of BHI and grown overnight at 37C. DNA was extracted from the broth cultures using the GenElute Bacterial Genomic DNA kit (Sigma

PAGE 131

121 Table 3 Isolates used in this study listed according to site (Lake Carroll, Hillsborough River and Ben T. Davis beach) and environmental matrix (water, sediment and vegetation). Isolate ID Site Source (matrix) LC12W08 Lake Carroll water L C17W08 Lake Carroll water LC1W08 Lake Carroll water LC3W08 Lake Carroll water LC15W07 Lake Carroll water LC28S07 Lake Carroll sediment LC1S07 Lake Carroll sediment LC11S07 Lake Carroll sediment LC24S08 Lake Carroll sediment LC8S07 Lake Carroll sedi ment LC8V08 Lake Carroll vegetation LC1V07 Lake Carroll vegetation HR17W07 Hillsborough River water HR1W07 Hillsborough River water HR30W07 Hillsborough River water HR28W08 Hillsborough River water HR31W07 Hillsborough River water HR11W07 Hillsboro ugh River water HR3W07 Hillsborough River water HR5W07 Hillsborough River water HR8W07 Hillsborough River water HR31S07 Hillsborough River sediment HR26S08 Hillsborough River sediment HR4S07 Hillsborough River sediment HR17S07 Hillsborough River sed iment HR1S08 Hillsborough River sediment HR2S07 Hillsborough River sediment HR25S08 Hillsborough River sediment HR26S07 Hillsborough River sediment HR28S08 Hillsborough River sediment HR9V07 Hillsborough River vegetation HR31V08 Hillsborough River v egetation HR24V08 Hillsborough River vegetation HR6V07 Hillsborough River vegetation HR2V08 Hillsborough River vegetation HR20V07 Hillsborough River vegetation HR17V07 Hillsborough River vegetation HR4V08 Hillsborough River vegetation HR27V08 Hillsb orough River vegetation HR12V07 Hillsborough River vegetation

PAGE 132

122 Isolate ID Site Source (matrix) BD1W07 Ben T Davis beach water BD5W07 Ben T Davis beach water BD8W08 Ben T Davis beach water BD13W08 Ben T Davis beach water BD17W07 Ben T Davis beach water BD20W08 Ben T Davis beach wate r BD11S08 Ben T Davis beach sediment BD31S07 Ben T Davis beach sediment BD8S08 Ben T Davis beach sediment BD28S07 Ben T Davis beach sediment BD5S07 Ben T Davis beach sediment BD9S08 Ben T Davis beach sediment BD29S08 Ben T Davis beach sediment BD25 S07 Ben T Davis beach sediment BD26V08 Ben T Davis beach vegetation BD22V08 Ben T Davis beach vegetation BD1V08 Ben T Davis beach vegetation BD21V08 Ben T Davis beach vegetation BD11V08 Ben T Davis beach vegetation BD9V08 Ben T Davis beach vegetation BD19V08 Ben T Davis beach vegetation Sequencing the 16S rRNA gene DNA e xtracted from individual isolates was amplified using the bacterial universal primers 8f (5' AGA GTT TGA TCM TGG CTC AG 3') and 1492r (5' GGT TAC CTT GTT ACG ACT T 3') (Lane 1991) The PCR mas ter mix was prepared using 13.5l of Jumpstart ReadyMix Taq (Sigma, St. Louis, Missouri), 8.5 l sterile water, 1l of each primer (10 M) and 1l of extracted DNA (5 to 15 g ml 1 adding up to a total volume of 25l). PCR conditions were as follows: initi al denaturation at 94C for 5 min, followed by 20 cycles of 94C for 1 min, 55C for 1 min, 72C for 10 min. PCR products were purified using the QIAQuick PCR Purification Kit (Qiagen, Valencia, CA), and were shipped to Macrogen Corp. (Rockville, MD). Each sample was sequenced in duplicate

PAGE 133

123 using the forward primer 8f and approximately 900 bp of clean sequences were obtained. Sequences were assembled using Sequencher 4.8 (Gene Codes Corp., Ann Arbor, MI) and analyzed using BLAST (http://www.ncbi.nlm.nih.gov/ BLAST/) to confirm their identities. Phylogenetic dendrograms were created using the neighbor joining method and the bootstrap test was carried out with 500 replications (MEGA 4.0, Tempe, AZ). BOX PCR genotyping of enterococci Enterococcus isolates were t yped using the horizontal, fluorophore enhanced, repetitive extragenic palindromic PCR (HFERP) technique (Johnson et al. 2004) Working primer stock was prepared by mixing 0.09 g of unlabeled BOX A2R primer (Malathum et al 1998) (0.68 g l 1 ) per l and 0.03 g of 6 FAM (fluorescein) labeled BOX A2R primer (0.74 g l 1 ) per l. The PCR master mix was prepared using 11.6 l of sterile water, 5x Gitschier buffer (Kogan et al. 1987) 2.5l of 10% DMSO, 1.5 l BOX A2R working primer, 0.4l of 2% BSA, 1mM dNTP mixture, 1l of Taq DNA polymerase and 1l of extr acted DNA, all adding up to a total volume of 25l. The following PCR conditions were used: an initial denaturation at 95C for 7 min, followed by 35 cycles of 90C for 30 s, 40C for 60 s, 65C for 8 min. and a final extension at 65C for 16 min. Enteroco ccus faecium C68 was used as the control strain in PCR and loaded onto individual gels to determine inter gel variability. A ladder plus non migrating loading dye mixture was prepared by mixing 5 l of Genescan 2500 ROX internal lane standard (Applied Bios ystems, Foster City, CA) and 20 l dye (150 mg Ficoll 400 per ml, and 25 mg blue dextran per ml). 12.5 l of individual PCR products was mixed with 3.3 l of the ROX dye mixture, loaded in a 1.5% agarose gel and electrophoresced at 90V for 4 hours. Gel ima ges were scanned

PAGE 134

124 using a Typhoon 8600 Variable Mode Imager (GE Healthcare). BOX PCR gel images were subsequently imported into Bionumerics (Applied Maths, Belgium) and analyzed using the Pearson similarity coefficient by constructing dendrograms using the unweighted pair group method with arithmetic mean (UPGMA) (optimization 1.0%, tolerance 0.5%). BOX PCR patterns were also compared visually to confirm results. Known Enterococcus species, including Enterococcus faecalis ATCC 19433, Enterococcus faecalis AT CC 29212, Enterococcus faecalis ATCC 49383, Enterococcus faecalis ATCC 700802, Enterococcus faecium C68, Enterococcus faecium ATCC 49224 and Enterococcus casseliflavus ATCC 700327 were also sequenced and typed for comparison purposes. Results and Discussio n BOX PCR dendrograms were in good agreement (77%) with the 16S rRNA phylogenetic tree as hypothesized. 16S rRNA sequencing was incapable of differentiating among the known strains of E. faecalis and also among the known strains of E. faecium (Figure 10); however it could discriminate between the two species. The BOXA2R patterns of three known strains of E. faecalis (ATCC 19433, 29212 and 700802) were 95% similar and identical when examined by eye (Figure 11). Minor differences (90%) were observed in the BO XA2R patterns of the two known strains of E. faecium Since BOXA2R patterns of the control strain E. faecium C68 from different gels were 89% similar, patterns with similarity values greater than 89% were considered indistinguishable. BOX PCR typing enabl ed better differentiation of strains within individual environmental Enterococcus species as compared to 16S rRNA gene sequencing (Figures 10 and 11). This can be explained in part by the difference in methodology between 16S

PAGE 135

125 rRNA gene sequencing and BOX P CR typing. The 16S rRNA gene sequence (~1500 bp) has both highly conserved and variable regions and is widely used for determination of taxonomical evolution (Woese 1987) However, the resolution capacity of the 16S rRNA gene is limited when identifying closely related organisms (Fox et al 1992; Stackebrandt and Goebel 1994) 16S rRNA gene sequencing concentrates on a much s maller portion of the genome as compared to BOX PCR. BOX PCR typing targets sequences located between interspersed repetitive DNA elements resulting in amplification products of different sizes that generate a unique genomic fingerprint of individual bacte rial strains. The number and location of bands in the fingerprint depend upon the size of the genome and the number of primer binding sites. Variation in genome sizes among different strains of a particular species leads to generation of multiple strain sp ecific fingerprint patterns. For example, Oana et al mapped the genomes of four strains of E. faecium and reported genome sizes that varied from 2550 to 2995 kb (Oana et al 2002) Therefore, BOX PCR typing can diff erentiate between different strains of the same species better than 16S rRNA sequencing. The 16S rRNA gene sequences of E. faecium and E. mundtii were approximately 98% identical and formed a single cluster in the phylogenetic tree. In contrast, the BOX P CR patterns of E. faecium and E. mundtii demonstrated less than 60% similarity. This demonstrates the ability of BOX PCR genotyping to differentiate between closely related species of enterococci. In a similar study, Rademaker et al compared genotypic rela tionships of Xanthomonas species and strains by BOX PCR with DNA DNA hybridization studies and observed a high correlation between the two methods (Rademaker et al 2000) This observation is in agreement with the h igh correlation

PAGE 136

126 between the genotypic and phylogenetic relationships of Enterococcus spp. observed in our study. In contrast, other studies have found poor correlation between genotypic and phylogenetic methods used to project species/ strain relationships (Tacao et al 2005; Binde et al 2009) The 16S rRNA gene sequence of an environmental strain of Lactococcus garvieae served as an outgroup while constructing the phylogenetic tree (Figure 10). The 16S rRNA sequen ce of Lactococcus garvieae is 11.4 to 11.8% different from that of Enterococcus species (Patel et al 1998) The BOX PCR pattern of Lactococcus garvieae clustered together with other species of enterococci and did n ot form an outgroup in the BOX PCR dendrogram (Figure 11). This indicates that certain closely related genera might not be as distinguishable using BOX PCR typing as they are by 16S rRNA sequencing. Of the 61 isolates sequenced in this study, only one is olate was identified as a non Enterococcus This finding demonstrates the specificity of mEI agar, the medium used for isolation of enterococci from surface waters. In other studies, mEI agar was found to be less specific since organisms belonging to other genera were isolated from environmental samples (Moore et al 2006) bios olids (Viau and Peccia 2009) and clinical samples (Goh et al 2000) along with Enterococcus spp. According to the US Environmental Protection Agency (USEPA), the false positive rate for isolation of non enterococci from environmental samples on mEI agar is 6% (U. S. Environmental Protection Agency 1997; Messer and Dufour 1998) In comparison, we observed a very low false positive rate (1.6%) for isolation of non enterococci from environmental matrices in our study.

PAGE 137

127 A BLAST query was performed on the entire genomes of E. faecium C68 ( ACJQ00000000) and E. faecalis ATCC 700802 (AE016830) with the BOXA2R primer ( ACG TGG TTT GAA GAG ATT TTC G primer sequence appeared 33 times within the genome of E. faecium C68 and 36 times within the genome of E. faecalis ATCC 700802. In the first documentation of BOX elements in Streptococcus pneumoniae the authors noted the presence of 25 BOX sequences in the genome of the organis m. Further analysis of the distance between the BOXA2R sequence segments might be useful in predicting the length of amplicons produced during BOX PCR typing. Genotypic and phylogenetic relationships between Enterococcus species and strains were compared u sing BOX PCR typing and 16S rRNA sequencing, respectively. Although BOX PCR genotyping was found to be more discriminatory at the strain level than 16S rRNA sequencing, the incorrect grouping of some strains with strains belonging to a different species in stead of its own species group raises doubts about the ability of the method to correctly project relatedness of all Enterococcus strains. While studies relying solely on BOX PCR typing should exercise caution while interpreting phylogenetic relationships projected by BOX PCR dendrograms, the method does provide a useful approximation of phylogeny. BOX PCR typing may be an excellent tool for investigating strain diversity but this method should not be employed exclusively for species identification and asso ciation.

PAGE 138

128 Figure 10 Phylogenetic tree constructed using the neighbor joining algorithm to evaluate the distance between 16S rRNA gene sequences of environmental enterococci. E. mundtii/ faecium E. hirae E. gilvus

PAGE 139

129 Figure 10 continued E. casseliflavus/ flavescens E. faecalis

PAGE 140

130 Figure 10 continued E. silesiacus/ moraviensis/ caccae E. faecalis Lactococcus garvieae

PAGE 141

131 Figure 11 Dendrogram demonstrating the similarity of BOX PCR patterns of Enterococcus species isolated f rom environmental matrices. E casseliflavus E. hirae E. casseliflavus/ flavescens E. hirae E. mundtii E. faecium

PAGE 142

132 Figure 11 continued E. silesiacus/ caccae E. silesiacus/ caccae E. hirae E. faecalis E. mundtii E. gilvus E. faecium E. faecalis E. gilvus E. faecium L. garvieae E. gilvus

PAGE 143

133 References American Public Health Association (APHA), A.W.W.A., Water Environment Federation, (1998) Standard methods for the examination of water and wastewater (20th ed). Clesceri LS, Greenberg AE, Eaton AD, eds. Washington, DC: American Public Health Association. Anderson, M.L., Whitlock, J.E. and Harwood, V.J. (2005) Persistence and differential survival of fecal indicat or bacteria in subtropical waters and sediments. Appl Environ Microbiol 71 3041 3048. Binde, D.R., Menna, P., Bangel, E.V., Barcellos, F.G. and Hungria, M. (2009) rep PCR fingerprinting and taxonomy based on the sequencing of the 16S rRNA gene of 54 elite commercial rhizobial strains. Appl Microbiol Biotechnol 83 897 908. Bordalo, A.A., Onrassami, R. and Dechsakulwatana, C. (2002) Survival of faecal indicator bacteria in tropical estuarine waters (Bangpakong River, Thailand). J Appl Microbiol 93 864 871. Brownell, M.J., Harwood, V.J., Kurz, R.C., McQuaig, S.M., Lukasik, J. and Scott, T.M. (2007) Confirmation of putative stormwater impact on water quality at a Florida beach by microbial source tracking methods and structure of indicator organism population s. Water Res 41 3747 3757. Clarridge, J.E., 3rd (2004) Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev 17 840 862, table of contents.

PAGE 144

134 Coque, T.M., Willems, R.J. Fortun, J., Top, J., Diz, S., Loza, E., Canton, R. and Baquero, F. (2005) Population structure of Enterococcus faecium causing bacteremia in a Spanish university hospital: setting the scene for a future increase in vancomycin resistance? Antimicrob Agent s Ch 49 2693 2700. Devriese, L.A., Pot, B. and Collins, M.D. (1993) Phenotypic identification of the genus Enterococcus and differentiation of phylogenetically distinct enterococcal species and species groups. J Appl Bacteriol 75 399 408. Dicuonzo, G., G herardi, G., Lorino, G., Angeletti, S., Battistoni, F., Bertuccini, L., Creti, R., Di Rosa, R., Venditti, M. and Baldassarri, L. (2001) Antibiotic resistance and genotypic characterization by PFGE of clinical and environmental isolates of enterococci. FEMS Microbiol Lett 201 205 211. Fox, G.E., Wisotzkey, J.D. and Jurtshuk, P., Jr. (1992) How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity. Int J Syst Bacteriol 42 166 170. Fujioka, R.S., C. Sian Denton, M. Bo rja, J. Castro, and K. Morphew. (1999) Soil: the environmental source of Escherichia coli J Appl Microbiol Symp Suppl 85:83S 89S. Giraffa, G. (2003) Functionality of enterococci in dairy products. Int J Food Microbiol 88 215 222. Goh, S.H., Facklam, R.R., Chang, M., Hill, J.E., Tyrrell, G.J., Burns, E.C., Chan, D., He, C., Rahim, T., Shaw, C. and Hemmingsen, S.M. (2000) Identification of Enterococcus species and phenotypically similar Lactococcus and Vagococcus species b y reverse

PAGE 145

135 checkerboard hybridization to chaperonin 60 gene sequences. J Clin Microbiol 38 3953 3959. Harmsen, D. and Karch, H. (2004) 16S rDNA for diagnosing pathogens: a living tree. ASM News 70 19 24. Harwood, V.J., Delahoya, N.C., Ulrich, R.M., Kramer M.F., Whitlock, J.E., Garey, J.R. and Lim, D.V. (2004) Molecular confirmation of Enterococcus faecalis and E. faecium from clinical, faecal and environmental sources. Lett Appl Microbiol 38 476 482. Hassan, W.M., Ellender, R.D. and Wang, S.Y. (2007) Fid elity of bacterial source tracking: Escherichia coli vs Enterococcus spp and minimizing assignment of isolates from nonlibrary sources. J Appl Microbiol 102 591 598. Jackson, C.R., Fedorka Cray, P.J. and Barrett, J.B. (2004) Use of a genus and species sp ecific multiplex PCR for identification of enterococci. J Clin Microbiol 42 3558 3565. Johnson, L.K., Brown, M.B., Carruthers, E.A., Ferguson, J.A., Dombek, P.E. and Sadowsky, M.J. (2004) Sample size, library composition, and genotypic diversity among nat ural populations of Escherichia coli from different animals influence accuracy of determining sources of fecal pollution. Appl Environ Microbiol 70 4478 4485. Koeuth, T., Versalovic, J. and Lupski, J.R. (1995) Differential subsequence conservation of inte rspersed repetitive Streptococcus pneumoniae BOX elements in diverse bacteria. Genome Res 5 408 418. Kogan, S.C., Doherty, M. and Gitschier, J. (1987) An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences A pplication to hemophilia A. New Engl J Med 317 985 990.

PAGE 146

136 Lane, D.J. (1991) 16S/23S rRNA sequencing, p.115 148. In E Stackebrandt and M Goodfellow (ed), Nucleic acid techniques in bacterial systematics Wiley, Chichester, United Kingdom Malathum, K., Singh, K.V., Weinstock, G.M. and Murray, B.E. (1998) Repetitive sequence based PCR versus pulsed field gel electrophoresis for typing of Enterococcus faecalis at the subspecies level. J Clin Microbiol 36 211 215. Martin, B., Humbert, O., Camara, M., Guenzi, E., Walker, J., Mitchell, T., Andrew, P., Prudhomme, M., Alloing, G., Hakenbeck, R., Morrison, D.A., Boulnois, G.J. and Claverys, J.P. (1992) A highly conserved repeated DNA element located in the chromosome of Streptococcus pneumoniae Nucleic Acids Res 20 3479 3483. Messer, J.W. and Dufour, A.P. (1998) A rapid, specific membrane filtration procedure for enumeration of enterococci in recreational water. Appl Environ Microbiol 64 678 680. Moore, D.F., Zhowandai, M.H., Ferguson, D.M., McGee, C., Mott, J.B. an d Stewart, J.C. (2006) Comparison of 16S rRNA sequencing with conventional and commercial phenotypic techniques for identification of enterococci from the marine environment. J Appl Microbiol 100 1272 1281. NNIS (2004) National Nosocomial Infections Surve illance (NNIS) System Report, data summary from January 1992 through June 2004, issued October 2004. Am J Infect Control 32 470 485. Oana, K., Okimura, Y., Kawakami, Y., Hayashida, N., Shimosaka, M., Okazaki, M., Hayashi, T. and Ohnishi, M. (2002) Physica l and genetic map of Enterococcus faecium

PAGE 147

137 ATCC19434 and demonstration of intra and interspecific genomic diversity in enterococci. FEMS Microbiol Lett 207 133 139. Pangallo, D., Drahovska, H., Harichova, J., Karelova, E., Chovanova, K., Aradska, J., Feri anc, P., Turna, J. and Timko, J. (2008) Evaluation of different PCR based approaches for the identification and typing of environmental enterococci. Antonie Van Leeuwenhoek 93 193 203. Patel, R., Piper, K.E., Rouse, M.S., Steckelberg, J.M., Uhl, J.R., Koh ner, P., Hopkins, M.K., Cockerill, F.R., 3rd and Kline, B.C. (1998) Determination of 16S rRNA sequences of enterococci and application to species identification of nonmotile Enterococcus gallinarum isolates. J Clin Microbiol 36 3399 3407. Rademaker, J.L., Hoste, B., Louws, F.J., Kersters, K., Swings, J., Vauterin, L., Vauterin, P. and de Bruijn, F.J. (2000) Comparison of AFLP and rep PCR genomic fingerprinting with DNA DNA homology studies: Xanthomonas as a model system. Int J Syst Evol Microbiol 50 Pt 2 665 677. Rice, L.B., Carias, L., Rudin, S., Vael, C., Goossens, H., Konstabel, C., Klare, I., Nallapareddy, S.R., Huang, W. and Murray, B.E. (2003) A potential virulence gene, hylEfm predominates in Enterococcus faecium of clinical origin. J Infect Dis 18 7 508 512. Rice, L.B., Hutton Thomas, R., Lakticova, V., Helfand, M.S. and Donskey, C.J. (2004) Beta lactam antibiotics and gastrointestinal colonization with vancomycin resistant enterococci. J Infect Dis 189 1113 1118.

PAGE 148

138 Seurinck, S., Verstraete, W. and Siciliano, S.D. (2003) Use of 16S 23S rRNA intergenic spacer region PCR and repetitive extragenic palindromic PCR analyses of Escherichia coli isolates to identify nonpoint fecal sources. Appl Environ Microbiol 69 4942 4950. Shankar, N., Lockatell, C.V., Baghdayan, A.S., Drachenberg, C., Gilmore, M.S. and Johnson, D.E. (2001) Role of Enterococcus faecalis surface protein Esp in the pathogenesis of ascending urinary tract infection. Infect Immun 69 4366 4372. Stackebrandt, E. and Goebel, B.M. (1994) A plac e for DNA DNA reassociation and 16S ribosomal RNA sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol 44 846 849. Tacao, M., Alves, A., Saavedra, M.J. and Correia, A. (2005) BOX PCR is an adequate tool for typing Aero monas spp. A Van Leeuw 88 173 179. Teng, F., Jacques Palaz, K.D., Weinstock, G.M. and Murray, B.E. (2002) Evidence that the enterococcal polysaccharide antigen gene (epa) cluster is widespread in Enterococcus faecalis and influences resistance to phagocyt ic killing of E. faecalis Infect Immun 70 2010 2015. U. S. Environmental Protection Agency (1997) Method 1600: Membrane filter test methods for enterococci in water. Office of Water, Washington D.C. EPA 821/R 97/004. U.S. Environmental Protection Agency (1986) Ambient Water Quality Criteria for Bacteria 1986. Washington, DC: U.S. Environmental Protection Agency. Viau, E. and Peccia, J. (2009) Evaluation of the enterococci indicator in biosolids using culture based and quantitative PCR assays. Water Res

PAGE 149

139 W eisburg, W.G., Barns, S.M., Pelletier, D.A. and Lane, D.J. (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173 697 703. Werner, G., Klare, I. and Witte, W. (2007) The current MLVA typing scheme for Enterococcus faecium is less d iscriminatory than MLST and PFGE for epidemic virulent, hospital adapted clonal types. BMC Microbiol 7 28. Woese, C.R. (1987) Bacterial evolution. Microbiol Rev 51 221 271. PREVALENCE OF VANCOMYCIN RESISTANT ENTEROCOCCI IN ENVIRONMENTAL MATRICES AND WA STEWATER Abstract Vancomycin resistant enterococci (VRE) are important nosocomial pathogens whose prevalence in environmental waters is infrequently investigated. Environmental and wastewater samples from Florida (USA) were screened for VRE. Low level VRE (< 32 g ml 1 ) were a proportionally greater fraction of enterococci at freshwater vs. estuarine sites, while high level VRE ( 32 g ml 1 ) were not detected. Between 20% and 61% of the total enterococci isolated from surface water sites were low level VRE Genotype vanC2/3 Enterococcus casseliflavus flavescens dominated environmental VRE populations while vanC1 E. gallinarum was dominant in residential wastewater. High level VRE ( vanA E. faecium ) were only isolated from hospital sewer line samples, and all displayed intermediate resistance to ampicillin and ciprofloxacin but were sensitive to chloramphenicol and rifampin. They also had indistinguishable BOX PCR genotypes. Twenty percent of the nosocomial isolates possessed the virulence associated esp gene

PAGE 150

140 variant that is unique to E. faecium Two esp positive E. faecium strains were isolated from surface waters, but were vancomycin sensitive. Infections caused by low level VRE can be difficult to treat as they sometimes demonstrate vancomycin susceptibility in vitro while being resistant in vivo. While the relative rareness of high level VRE in sources tested other than hospital wastewater is encouraging, the high proportion of low level VRE isolated from surface waters and the preponderance of high level VR E in hospital wastewater are cause for concern and should be the subject of better surveillance. Introduction Enterococci can cause blood stream infections, endocarditis, and urinary tract infections (Gross et al. 19 76; Megran 1992; Pfaller et al. 1998) Vancomycin resistant enterococci (VRE) have been isolated from approximately 30% of the patients in intensive care units in US hospitals (NNIS 2004; Rice et al. 2004) VRE hav e been detected in environmental waters, sewage, agricultural runoff, animal feces and feces of healthy human hosts in parts of Europe (Devriese et al. 1996; VanderAuwera et al. 1996; Aarestrup et al. 1998; Stobberin gh et al. 1999; Gambarotto et al. 2000; Dicuonzo et al. 2001; Guardabassi and Dalsgaard 2004) This widespread prevalence in Europe is mainly attributed to the practice of using the glycopeptide avoparcin in animal feeds for growth promotion (McDonald et al. 1997) In contrast, high level VRE have seldom been repor ted in environmental waters or non hospital related sources in the US (Coque et al. 1996; Harwood et al. 2001) although high level VRE were isolated from marine waters in Washington and California (Roberts et al 2009) Harwood et al isolated vanA VRE from hospital wastewater, whereas chicken fec es and residential wastewater isolates exhibited the low level vanC genotype (Harwood et al. 2001)

PAGE 151

141 Vancomycin resistance in enterococci is attributed to the possession of gene clusters designated vanA ( E. faecium, E. faecalis ), vanB ( E. faecium E. faecalis ) and vanC ( E. gallinarum E. casseliflavus ) (Cetinkaya et al. 2000) vanA and vanB mediated resistance can be plasmid borne or chromosomally encoded as a transferable element (Arthur et al. 1993; Rice et al. 1998) vanA confers high level resistance to vanco mycin (MIC: 64 >1000 g ml 1 ) and teicoplanin (MIC: 16 512 g ml 1 ) while vanB confers moderate to high level resistance to vancomycin only (MIC: 4 1000 g ml 1 ). vanC is an intrinsic, chromosomally encoded, low level type of resistance (MIC: 2 32 g ml 1 ), found in certain species that are generally non pathogenic, but that occasionally cause disease (Cetinkaya et al 2000) Other low level VRE genotypes include vanD vanE and vanG (Fines et al. 1999; Cetinkay a et al. 2000) E. faecalis and E. faecium also possess virulence factors such as adhesins, cytolysins, gelatinase, and serine protease. The esp gene, which encodes the enterococcal surface protein, may facilitate colonization of the urinary tract (Shankar et al 2001) and biofilm formation (Toledo Arana et al 2001; Heikens et al 2007) esp was initially described in clinical E. faecalis isolates (Shankar et al 1999) An esp variant was later discovered in E. faecium isolates from nosocomial infections (Eaton and Gasson 2001; Willems et al 2001) and is now used as a marker of human fecal pol lution in environmental waters (Scott et al 2005) Several PCR methods have been developed for the detection of the E. faecium esp gene in microbial source tr acking (MST) (McDonald et al 2006; McQuaig et al 2006; Brownell et al 2007; Whitman et al 2007; Ahmed et al. 2008a; Ahmed et al 2008b) and clinical studies (Eaton and Gas son 2002; Leavis et al 2003; Coque et al 2005)

PAGE 152

142 Recently a hospital adapted sub population of vancomycin resistant E. faecium (VREF) has been implicated in nosocomial outbreaks in five continents, including North America (Top et al. 2007; Valdezate et al. 2009) Multi locus sequence typing (MLST) revealed a specific genetic lineage of VREF designated clonal complex 17 (CC 17), which is also characterized by intermediate to high resistance to ampicillin and ciprof loxacin (Leavis et al 2006b; Deshpande et al 2007; Top et al 2007) Many of these isolates possess the E. faecium variant esp gene on a putative pathogenicity island (Wille ms et al. 2005; Leavis et al. 2006a; Leavis et al. 2006b; Top et al. 2008) Previous studies have documented the co occurrence of the esp gene with the hyaluronidase ( hyl ) gene in VREF strains (Rice et al 2003; Van kerckhoven et al 2004; Klare et al 2005) The hyl gene is a virulence associated gene that potentially contributes to invasion of the nasopharynx (Rice et al. 2003) The growing incidence of vanA and vanB VRE in fections in hospitals in the US highlights the need for surveillance of the prevalence of VRE in surface waters, as well as associated matrices such as sediments and vegetation, to determine the overall threat to the community. Survival studies have demons trated increased persistence of enterococci in sediments as compared to environmental waters, indicating that sediments may play a role in protecting the organisms from stressors such as elevated temperatures and ultraviolet radiation from the sun (Sherer et al. 1992; Howell et al. 1996; Anderson et al. 2005) Vegetation may play a similar role in providing protection and act as a reservoir for these organisms (Byappanahalli et al 2003; Whitman et al 2003) yet the prevalence of antibiotic resistant bacteria in vegetation and sediment has been infrequently explored (Cordova Kreylos and Scow 2007; Matyar et al 2008)

PAGE 153

143 Enterococci isola ted from environmental water, sediment and vegetation samples as well as residential and hospital wastewater were tested for vancomycin resistance using culture based methods followed by molecular typing. We hypothesized that Enterococcus spp. that are res istant to high levels of vancomycin ( vanA and vanB genotypes) would be isolated from hospital wastewater whereas the majority of the enterococci isolated from environmental samples and residential wastewater will prove susceptible to vancomycin. Materials and methods Sample collection and processing Water, sediment and vegetation samples were collected from Lake Carroll, Hillsborough in West Tampa surrounded completely by University of South Florida's Riverfront Park, downstream of a substantial amount of protected, undeveloped land. The upper bay s species at the freshwater sites were Alternanthera philoxeroides (alligator weed), Egaria densa (Brazilian waterweed), Hydrilla vertic ilata Myriophyllum aquaticum (parrot feather), and Vallisenaria Americana (eel grass) The dominant vegetation species at the estuarine site was Halodule wrightii (shoal grass). Vegetation coverage at all of these sites ranged from moderate to heavy and sediments were composed of fine quartz sand. Samples were collected in sterile bottles, maintained at 4 C and processed within 4 hours of collection. Sediment and vegetation samples were diluted 1:10 with phosphate buffered dilution water (0.0425 g L 1 KH 2 PO 4 and 0.4055 g L 1 MgCl 2 ; pH 7.2)

PAGE 154

144 (American Public Health Association (APHA) 1998) and particle associated bacteria were dislodged using sonication (Anderson et al 2005) Microorganisms i n water (1ml, 10ml), sediment (2ml, 20ml) and vegetation (2ml, 20ml) samples were concentrated by membrane filtration through 0.45 m pore size filters and the filters were incubated on mEI agar at 41C for 18 22 hours (U. S. Environmental Protection Agency 1997) Individual colonies with a blue halo (presumptive enterococci) were picked using sterile toothpicks and inoculated into Enterococcos el broth (EB) in 96 well microtitre plates. After incubation at 37C for approximately 22 hours, glycerol was added to each well and the EB plate was frozen at 80C until cultures were reanimated. Water (100 ml) and sediment (25 ml) samples were also filt ered and the filters incubated on mEI agar with vancomycin (6 g ml 1 ) (to determine the percentage of VRE from the total enterococci). Water (3 liters) and sediment (25 ml) samples were also filtered and the filters incubated on mEI agar with vancomycin ( 32 g ml 1 ) for isolation of high level VRE. Wastewater samples were collected from the Falkenburg Road Advanced Wastewater Treatment Plant in Tampa, FL, from a hospital sewer line and from a septic pump truck (three samples each). Samples were handled as detailed above, but enterococci were isolated as follows. H ospital wastewater samples ( 1 ml and 100 l) were filtered and incubated on mEI agar and mEI agar with vancomycin (6 g ml 1 ) in triplicate (to determine the percentage of VRE from the total entero cocci). Residential and septic pump truck wastewater samples were filtered and filters were incubated on mEI agar (1 ml and 100 l) and mEI agar with 6 g ml 1 vancomycin (10 ml and 25 ml) in triplicate.

PAGE 155

145 Vancomycin susceptibility testing The agar dilutio n screening method was used to screen for VRE (Swenson et al. 1994) Isolates grown in EB were streaked on trypticase soy agar (TSA) for further isolation and incubated overnight at 37C. Individual colonies were inoculated in brain heart infusion (BHI) bro th and grown overnight at 37C. The turbidity of the overnight culture was adjusted to match the 0.5 McFarland standard and 10l of the suspension was spot inoculated on BHI agar with vancomycin (6 g ml 1 ), which might potentially discourage the growth of a few low level vanB and many low level vanC VRE isolates. Isolates displaying growth were further tested by spot inoculation on BHI agar with 32 g ml 1 vancomycin. VRE isolates that grew at 6g ml 1 concentration of vancomycin but did not grow at 32 g ml 1 were reported as LL VRE whereas the VRE isolates that grew at 32 g ml 1 of vancomycin were reported as HL VRE. These results were reconfirmed by amplifying the vancomycin resistance genes of individual isolates. Vancomycin MICs for 50 randomly select ed LL VRE isolates were determined by both agar dilution and broth microdilution methods (4, 6 and 8 g ml 1 vancomycin). DNA was extracted from the overnight broth cultures using the GenElute Bacterial Genomic DNA kit (Sigma Aldrich, St. Louis, MO) as per Genes conferring vancomycin resistance were targeted in a multiplex PCR (Table 4) using extracted DNA from the individual isolates as template (Dutka Malen et al. 1995) Positive controls used include Enterococcus faecalis A256 ( vanA ), Enterococcus faecium C68 ( vanB ), Enterococcus gallinarum ATCC 49573 ( vanC1 ) and Enterococcus casseliflavus ATCC 700327 ( vanC2/3 ). The vancomycin susceptible strain Enterococcus

PAGE 156

146 faecalis ATCC 29212 was used as a negative control. The presence of products of the correct molecular size was confirmed using gel electrophoresis. Isolates identified as HL VRE by multiplex PCR and phenotype on vancomycin amended media were further tested for susceptibility to ampicillin (12, 16 and 20 g ml 1 ) chloramphenicol (6, 8 and 10 g ml 1 ) ciprofloxacin (2, 4 and 6 g ml 1 ) and rifampin (1 and 2 g ml 1 ) as described in the Clinical and Laboratory Standards Institute guidelines using standard breakpoints (Clinical and Laboratory Standards Institute 2006) The choice of antibiotics was based on those identified as therapeutically important by the SENTRY Antimicrobial Surveillance Program (Deshpande et al. 2007) Isolates were tested in triplicate by both the agar dilution and broth microdilution methods. Enterococcus faecalis ATCC 29212 wa s used as a negative control. Vancomycin MICs for HL VRE isolates were determined by both agar dilution and broth microdilution methods (64, 128, 256 and 512 g ml 1 vancomycin). Sequencing the 16S rRNA gene and vanA gene DNA e xtracted from individual iso lates was amplified using the bacterial universal primers 8f and 1492r (Lane 1991) (Table 4) The PCR master mix was prepared using 13.5l of Jumpstart ReadyMix Taq (Sigma, St. Louis, Missouri), 8.5l sterile water, 1l of each primer (10 M) and 1l of extracted DNA (5 15 ng l 1 ) adding up to a total volume of 25l. PCR conditions were as follows: initial denaturation at 94C for 5 min, followed by 20 cycles of 94C for 1 min, 55C for 1 min, 72C for 10 min. PCR products were purified using the QIAQuick PCR Purifica tion Kit (Qiagen, Valencia, CA), and were shipped to Macrogen Corp. (Rockville, MD). Each sample was sequenced in duplicate using the forward primer 8f and approximately 900 bp of clean sequences were

PAGE 157

147 obtained. The vanA gene (~ 640bp) was amplified using p reviously published primers and PCR conditions (Dutka Malen et al. 1995) and the PCR amplicons were sequenced in both forward and reverse directions using the vanA primer set Sequences were assembled using Sequencher 4.8 (Gene Codes Corp., Ann Arbor, MI) and analyz ed using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) to confirm their identities. Table 4 Primers used in this study. Amplified gene Product size (bp) Oligonucleotide sequence Reference vanA 732 A 1 GGGAAAACGACAATTGC A 2 ( GTACAATGCGGCCGTTA Dutka Malen et al, 1995 vanB 635 B 1 ATGGGAAGCCGATAGTC B 2 GATTTCGTTCCTCGACC Dutka Malen et al, 1995 vanC1 822 C 1 GGTATCAAGGAAACCTC C 2 CTTCCGCCATCATAGCT Dutka Malen et al, 1995 vanC2/3 439 D 1 CTCCTACGATTCTCTTG D 2 CGAGCAAGACCTTTAAG Dutka Malen et al, 1995 16S rRNA 1484 8f (5' AGA GTT TGA TCM TGG CTC AG 3') 1492r (5' GGT TAC CTT GTT ACG ACT T 3') Lane, 1991 esp 680 TAT GAA AGC AAC AGC ACA AGT T ACG TCG AAA GTT CGA TTT CC Scott et al, 2005 esp 510 AGATTTCATCTTTGATTCTTGG AATTGATTCTTTAGCATCTGG Leavis et al, 2003 esp 956 TTGCTAATGCTAGTCCACGACC GCGTCAACACTTGCATTGCCGAA Leavis et al, 2003 hyl 661 hyl Efm GAGT AGAGGAATATCTTAGC hyl Efm AGGCTCCAATTCTGT Rice et al, 2003 BOXA2R variable ACG TGG TTT GAA GAG ATT TTC G Malathum et al, 1998

PAGE 158

148 BOX PCR genotyping of enterococci Enterococcus isolates were typed using the horizontal, fluorophore enha nced, repetitive extragenic palindromic PCR (HFERP) technique (Johnson et al. 2004) Working primer stock was prepared by mixing 0.09 g of unlabeled BOX A2R primer (Malathum et al. 1998) (0.68 g l 1 ) per l and 0.03 g of 6 FAM (fluorescein) labe led BOX A2R primer (0.74 g l 1 ) per l. The PCR master mix was prepared using 11.6l of sterile water, 5x Gitschier buffer (Kogan et al. 1987) 2.5l of 10% DMSO, 1.5 l BOX A2R working primer, 0.4l of 2% BSA, 1mM dNTP mixture, 1l of Taq DNA polymerase and 1l of extracted DNA, all adding up to a total volume o f 25l. The following PCR conditions were used: an initial denaturation at 95C for 7 min, followed by 35 cycles of 90C for 30 s, 40C for 60 s, 65C for 8 min. and a final extension at 65C for 16 min. Enterococcus faecium C68 was used as the control str ain in PCR and loaded onto individual gels to determine inter gel variability. A ladder plus non migrating loading dye mixture was prepared by mixing 5 l of Genescan 2500 ROX internal lane standard (Applied Biosystems, Foster City, CA) and 20 l dye (150 mg Ficoll 400 per ml, and 25 mg blue dextran per ml). 12.5 l of individual PCR products was mixed with 3.3 l of the ROX dye mixture, loaded in a 1.5% agarose gel and electrophoresced at 90V for 4 hours. Gel images were scanned using a Typhoon 8600 Variab le Mode Imager (GE Healthcare). Screening for virulence factors Isolates were tested for the presence of the esp and hyl genes encoding the enterococcal surface protein of E. faecium and the hyaluronidase enzyme, respectively. The esp gene was amplified using one primer set employed by microbial source tracking (MST) studies and two sets of primers described in clinical studies (Table 4). The primer set used in

PAGE 159

149 MST studies was described as a proposed marker of human fecal pollution (Scott et al. 2005) The primer set 14F and 12R was used to amplify the esp gene as described previously by Leavis et al (Leavis et al. 2003) Isolates negative for the presence of the esp gene were tested using another primer set esp11 and esp12 to ensure accuracy of results (Leavis et al. 2003) The PCR master mix for amplification of the hyl gene (Table 4) was comprised of 12.5 l of GoTaq Green, 8.5 l of sterile water, 1 l each of 10M forward and reverse primers (Rice et al. 2003) and 2 l of template DNA. PCR conditions were as follows: an initial denaturation at 94C for 3 m in, followed by 35 cycles of 94C for 45 s, 55C for 45 s, 72C for 30 s and a final extension at 72C for 5 min. Enterococcus faecium C68 was used as the positive control and Enterococcus faecalis ATCC 29212 was used as the negative control for detection of both virulence factors. Statistical analysis BOX PCR gel images were imported into Bionumerics (Applied Maths, Belgium) and analyzed using the Pearson similarity coefficient in order to construct dendrograms using the unweighted pair group method with arithmetic mean (UPGMA) (optimization 1.0%, tolerance 0.5%). BOX PCR patterns were also compared visually to confirm results. Differences in the frequency of observation of LL VRE within each matrix between sites were calculated using the chi square test ( GraphPad InStat, La Jolla, USA). Results Vancomycin resistant enterococci isolated from the freshwater sites, Lake Carroll (LC) and Hillsborough River (HR), as well as those isolated from estuarine waters at Ben T

PAGE 160

150 Davis (BTD) beach exhibited the VanC phen otype (henceforth referred to as low level or LL VRE) (Tables 5 and 6). The minimum inhibitory concentration (MIC) of vancomycin for fifty randomly selected LL VRE isolates was 8 g ml 1 The majority of the VRE strains isolated from environmental matrices at the three sites tested positive for the vanC2/3 gene and were identified as E. casseliflavus flavescens (the two species are indistinguishable by small subunit rRNA sequencing). One isolate from LC sediment and one isolate each from BTD water and sedim ent tested positive for the vanC1 gene. No VanA or VanB (high level or HL VRE) phenotypes were isolated from these sites. HL VRE were not d etected even when larger sample volumes were screened on mEI agar with 32 g ml 1 vancomycin, an inhibitory concentra tion for LL VRE. Table 5 VRE genotypes observed from environmental water and wastewater samples. Source No. of isolates typed Genotypes observed % VRE (total Enterococcus concentration) d vanA vanB vanC Lake Carroll 187 a 0 0 124 61 (0.52 x 10 2 ) Hillsborough River 192 a 0 0 100 36 (0.47 x 10 2 ) Ben T Davis beach 188 a 0 0 46 20 (0.21 x 10 2 ) Residential wastewater 25 b,c 0 0 25 1.6 (3.0 x 10 4 ) Hospital wastewater 54 b 25 0 29 35 (4.9 x 10 3 ) a Isolated on mEI (no vancomycin) and screened post isolation b Pre screened for vancomycin resistance on mEI + 6 g ml 1 vancomycin c 20 isolates from WWTP influent and 5 isolates from a septic pump truck d CFU ml 1

PAGE 161

151 The proportion of VRE (VRE as a percentage of total enterococci screened) obser ved in the water, sediment and vegetation samples (hereafter termed matrices) within each surface water site is listed in Table 6. In some cases, i.e. LC water and HR sediment, LL VRE were by far the majority of total enterococci screened. Significant diff erences in the proportion of LL VRE were observed in all site by site comparisons. Significant differences were also observed when each matrix was compared across the three sites. VRE proportions in estuarine waters were markedly and significantly lower t han freshwater for all three matrices. LL VRE proportions for each site were highest in either water or sediment samples, but never vegetation (Table 6). In fact, for the HR and BTD sites, the lowest VRE proportions were observed in vegetation samples. T able 6 Low level VRE as a percentage of total enterococci in each matrix (water, sediment, vegetation) at each site. Source % VRE (total isolates screened) Total Water Sediment Vegetation Lake Carroll 97 (62) 35 (63) 68 (62) 66 (187) Hillsborough River 53 (64) 73 (64) 30 (64) 52 (192) Ben T Davis beach 25 (64) 47 (60) 3 (64) 24 (188) Two isolates from a Hillsborough River vegetation sample carried the variant esp gene that is unique to E. faecium and is associated with hum an feces (Scott et al 2005; Brownell et al 2007) The BOXA2R genotypes of these two isolates were 99% similar

PAGE 162

152 Figure 12 Dendrogram demonstrating the similarity of B OX PCR patterns of vanA VREF isolated from hospital wastewater, esp positive isolates are underlined. and DNA sequencing identified both as E. faecium Both isolates were susceptible to vancomycin and tested negative for vanA vanB and vanC by PCR. 100 98 96 94 92 90 . . . . . . . . . . . . U3A4 U3E6 U3A2 U3A1 UH2 U2B6 U2C7 U2C6 U2C12 U3A6 UC2 UE2 UA2 UF2 UB2 UD2 UA3 UF3 UB3 UE3 UC3 UH3 UG3 UD3 UG2 . . .

PAGE 163

153 Appro ximately 1.6 % of the total enterococci (3 x 10 4 CFU ml 1 ; average of three separate sampling events) isolated from the residential wastewater demonstrated low level vancomycin resistance and carried the vanC1 genotype (Table 5). These LL VRE were identifi ed as E. gallinarum by 16S rRNA gene sequencing No HL VRE were isolated from residential wastewater. Approximately 35% (1.7 x 10 3 CFU ml 1 ) of the enterococci (4.9 x 10 3 CFU ml 1 ; average of three separate sampling events) isolated from the hospital waste water were vancomycin resistant, including both LL VRE and HL VRE (Table 5). Forty six percent of the 54 VRE tested carried the vanA gene and their BOXA2R patterns were 89% similar (Figure 12) while the rest of the isolates demonstrated the vanC1 genotype. Since BOXA2R patterns of the control strain E. faecium C68 were also 89% similar, the vanA VRE BOX patterns were indistinguishable, and may represent clones. Seven vanA VRE isolates chosen at random were sequenced and identified to the species level as E. faecium (GenBank Accession #s GQ489017 to GQ489023) The VREF strains were resistant to intermediate levels of ampicillin (MIC > 16 g ml 1 ) and ciprofloxacin (MIC > 4 g ml 1 ) but sensitive to chloramphenicol (MIC = 8 g ml 1 ) and rifampin (MIC < 2 g ml 1 ) The MIC for vancomycin was 512 g ml 1 The esp gene was detected in 20% (5/ 25) of the VREF isolates, and all three sets of esp primers gave the same result. None of the isolates carried the hyl gene. The vanA gene sequences of esp positive and esp negative VREF isolates were 100% identical as determined by aligning the sequences on BLAST (GenBank Accession #s GQ489012 to GQ489016).

PAGE 164

154 Discussion Water, sediment, and vegetation samples were collected from two freshwater and one estuarine site in Florida for this study, which is the first study to evaluate VRE in vegetation samples and to compare VRE proportions in freshwater vs. estuarine waters and across different matrices. In fact, very few studies in the US have attempted to determine the vancomycin susceptibility of environmental enterococci (Harwood et al 2001; Moore et al 2008; Roberts et al 2009) In our study, LL VRE were readily isolated from modest volumes of environmental water samples (2ml to 100ml) without enrichment or use of vancomycin amended media for the initial screening. Moore et al assessed E. faecalis and E. faecium from ocean waters and sewage in Southern California for vancomycin resistance (Moore et al 2008) by screening on media amended with 16 g ml 1 vancomycin. Under these conditions all isolates were vancomycin susceptible; however, this concentration inhibits most LL VRE. It is therefore not po ssible to compare the frequency of isolation of environmental enterococci from the California study with the current study. Another study reported the detection of HL VRE at public beaches in Washington and California (Roberts et al 2009) The vast majority of LL VRE enterococci were also excluded from this study, since bacteria were s creened on mE agar supplemented with 18 g ml 1 vancomycin. HL VRE were infrequently detected over the eight year study, which is noteworthy because HL VRE had not previously been detected outside hospital or wastewater settings in the US (Roberts et al 2009) In contrast, we found no HL VRE in any environmental water matrix, but a very high proportion of LL VRE. Our samples were collected over a short time period (6 months), and in light of the findings of Roberts

PAGE 165

155 et al. and the prevalence of HL VRE in hospital wastewater, greater efforts toward surveillance of VRE in these waters is ap propriate. The high prevalence of LL VRE observed in the surface waters in this study is a cause for concern from the public health perspective. LL VRE can cause serious infections such as endocarditis, bacteremia and meningitis, particularly in immunoc ompromised patients (Yoshimoto et al 1999; Kurup et al 2001; Reid et al 2001; Dargere et al 2002) A six year survey in a hospital in Japan found LL VRE associated with approximately 12% of all enterococcal bact eremia cases (Koganemaru and Hitomi 2008) Another study found no differences in the severity of illness and mortality rates between E. faecalis bacteremia and LL VRE bacteremia (de Perio et al 2006) Treatment of infections caused by intrinsically resistant LL VRE can be difficult because they sometimes demonstrate vancomycin susceptibility in vitro while being resistant in vivo (Ratan asuwan et al 1999; Reid et al 2001) Recently a strain of E. casseliflavus / gallinarum possessing the vanA gene and one possessing both vanA and vanB genes were isolated from beaches in WA and CA (Roberts et al 2009) Acquisition of high level vancomycin resistance genes by LL VRE is of particular concern because phenotypic identific ation from clinical samples can confound treatment strategy and infection control measures (Dutka Malen et al 1994; Yoshikazu 1996; Coombs et al 1999; Roberts et al 2009) and because they are so prevalent in the environment. The proportion of LL VRE (calculated as percentage of total enterococci) isolated from the environmental matrices was significantly higher than the proportion of LL VRE isolated from the residential wastewater. Although very few vanC E. galli narum were isolated from residential wastewater in Tampa eight years prior to this study, the

PAGE 166

156 difference in screening methods does not permit a direct comparison with the proportion of LL VRE isolated from residential wastewater in the current study (Harwood et al 2001) The only documented isolation of HL VRE from community wastewater in the US is the detection of 49 E. faecium isolates possessing the vanA gene and one possessing the vanB gene from a semiclosed agri food system in Texas (Poole et al 2005) In this study, vanA VREF wit h indistinguishable BOX PCR patterns were consistently isolated from the hospital wastewater during three separate sampling events (at least one month apart). In other studies multiple genotypes of vanA VREF were isolated from clinical samples or hospital wastewater using other typing methods such as pulsed field gel electrophoresis (PFGE) (Thal et al 1998; Ko et al 2005; Kotzamanidis et al 2009) and MLST (Ko et al 2005; Ca plin et al 2008) Differences between genotyping methods could be responsible for the observance of indistinguishable VREF genotypes in our study and multiple VREF genotypes in other studies. BOX PCR typing is not a very discriminatory typing method as e videnced by a difference in the PFGE patterns of a few nosocomial VREF isolated in our study (data not shown). VREF isolates demonstrated high level vancomycin resistance and intermediate resistance to ampicillin and ciprofloxacin and the esp gene was dete cted in some of the isolates; characteristics used to define the hospital adapted CC 17 cluster. Determining the relationship of the VREF strains isolated in this study to VREF isolates belonging to the CC 17 cluster using typing methods such as MLST or m u ltiple locus variable number tandem repeat (VNTR) analysis (MLVA) can be of epidemiological significance (Willems et al 2005; Leavis et al 2006a; Top et al 2008)

PAGE 167

157 Twenty percent of the vanA VREF isolated in this study were esp positive but all isolates were negative for hyl Pantosti et al reported the presence of the esp gene in 94% of clinical VREF isolates but none of them carried the hyl gene (Stampone et al 2005) Som e studies have reported the co occurence of the esp and hyl virulence genes in a small proportion of clinical VREF strains (Klare et al 2005; Novais et al 2005b) whereas others have found both genes in the majorit y of the isolates (Rice et al 2003; Vankerckhoven et al 2004) The association of these virulence factors in VREF seems to vary among populations. VRE can potentially be disseminated into environmental waters by c ompromised sewer systems or improper treatment practices, which poses a health risk for the community (Harwood et al 2001; Iversen et al 2004; Novais et al 2005a) Horizontal transfer of virulence determinants an d antibiotic resistance genes from VRE to other bacteria in the environment has been documented in a number of studies (Schaberg and Zervos 1986; Huycke et al. 1998; Baquero 2004) and the recent finding of an HL VR E E. casseliflavus/ gallinarum strain in WA with high frequencies of in vitro conjugal transfer accentuates this risk (Roberts et al 2009) Surveillance studies should be initiated to monitor the presence of HL VRE in environmental waters and associated matrices. Experiments to explore their ability to survive and proliferate in environ mental matrices are also warranted based on these and other recent findings. Acknowledgements We would like to thank Dr. Lalitagauri Deshpande, JMI Laboratories, North Liberty, Iowa for performing PFGE analysis of our isolates, Advanced Septic T anks for pr oviding septic tank samples and Paul Siddall (Lake Carroll resident) for the use of his property to

PAGE 168

158 access Lake Carroll. In addition we would like to thank Miriam Brownell, Asja Korajkic and Shannon McQuaig (USF Dept. of Integrative Biology) for providing help with sample collection. References Aarestrup, F.M., Bager, F., Jensen, N.E., Madsen, M., Meyling, A. and Wegener, H.C. (1998) Surveillance of antimicrobial resistance in bacteria isolated from food animals to antimicrobial growth p romoters and related therapeutic agents in Denmark. APMIS 106 606 622. Ahmed, W., Stewart, J., Gardner, T. and Powell, D. (2008a) A real time polymerase chain reaction assay for quantitative detection of the human specific enterococci surface protein mark er in sewage and environmental waters. Environ Microbiol 10 3255 3264. Ahmed, W., Stewart, J., Powell, D. and Gardner, T. (2008b) Evaluation of the host specificity and prevalence of enterococci surface protein (esp) marker in sewage and its application f or sourcing human fecal pollution. J Environ Qual 37 1583 1588. American Public Health Association (APHA), A.W.W.A., Water Environment Federation, (1998) Standard methods for the examination of water and wastewater (20th ed). Clesceri LS, Greenberg AE, Ea ton AD, eds. Washington, DC: American Public Health Association. Anderson, M.L., Whitlock, J.E. and Harwood, V.J. (2005) Persistence and differential survival of fecal indicator bacteria in subtropical waters and sediments. Appl Environ Microbiol 71 3041 3048.

PAGE 169

159 Arthur, M., Molinas, C., Depardieu, F. and Courvalin, P. (1993) Characterization of Tn1546, a Tn3 related transposon conferring glycopeptide resistance by synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium Bm4147. J Bacteriol 175 117 127. Baquero, F. (2004) From pieces to patterns: evolutionary engineering in bacterial pathogens. Nat Rev Microbiol 2 510 518. Bordalo, A.A., Onrassami, R. and Dechsakulwatana, C. (2002) Survival of faecal indicator bacteria in tropical estuarine waters (Bangpakong River, Thailand). J Appl Microbiol 93 864 871. Brownell, M.J., Harwood, V.J., Kurz, R.C., McQuaig, S.M., Lukasik, J. and Scott, T.M. (2007) Confirmation of putative stormwater impact on water quality at a Florida beach by microbial sou rce tracking methods and structure of indicator organism populations. Water Res 41 3747 3757. Byappanahalli, M.N., Shively, D.A., Nevers, M.B., Sadowsky, M.J. and Whitman, R.L. (2003) Growth and survival of Escherichia coli and enterococci populations in the macro alga Cladophora (Chlorophyta). FEMS Microbiol Ecol 46 203 211. Caplin, J.L., Hanlon, G.W. and Taylor, H.D. (2008) Presence of vancomycin and ampicillin resistant Enterococcus faecium of epidemic clonal complex 17 in wastewaters from the south co ast of England. Environ Microbiol 10 885 892. Cetinkaya, Y., Falk, P. and Mayhall, C.G. (2000) Vancomycin resistant enterococci. Clin Microbiol Rev 13 686 707.

PAGE 170

160 Clinical and Laboratory Standards Institute (2006) M100 S16, Performance Standards for Antimic robial Susceptibility Testing; Sixteenth Informational Supplement. Wayne, PA7 CLSI. Coombs, G.W., Kay, I.D., Steven, R.A., Pearman, J.W., Bertolatti, D. and Grubb, W.B. (1999) Should genotypic testing be done on all phenotypically vancomycin resistant ent erococci detected in hospitals? J Clin Microbiol 37 1229 1230. Coque, T.M., Tomayko, J.F., Ricke, S.C., Okhyusen, P.C. and Murray, B.E. (1996) Vancomycin resistant enterococci from nosocomial, community, and animal sources in the United States. Antimicrob ial Agents and Chemotherapy 40 2605 2609. Coque, T.M., Willems, R.J., Fortun, J., Top, J., Diz, S., Loza, E., Canton, R. and Baquero, F. (2005) Population structure of Enterococcus faecium causing bacteremia in a Spanish university hospital: setting the s cene for a future increase in vancomycin resistance? Antimicrob Agents Ch 49 2693 2700. Cordova Kreylos, A.L. and Scow, K.M. (2007) Effects of ciprofloxacin on salt marsh sediment microbial communities. ISME J 1 585 595. Dargere, S., Vergnaud, M., Verdon R., Saloux, E., Le Page, O., Leclercq, R. and Bazin, C. (2002) Enterococcus gallinarum endocarditis occurring on native heart valves. J Clin Microbiol 40 2308 2310. de Perio, M.A., Yarnold, P.R., Warren, J. and Noskin, G.A. (2006) Risk factors and outco mes associated with non Enterococcus faecalis non Enterococcus faecium enterococcal bacteremia. Infect Control Hosp Epidemiol 27 28 33.

PAGE 171

161 Deshpande, L.M., Fritsche, T.R., Moet, G.J., Biedenbach, D.J. and Jones, R.N. (2007) Antimicrobial resistance and mole cular epidemiology of vancomycin resistant enterococci from North America and Europe: a report from the SENTRY antimicrobial surveillance program. Diagn Microbiol Infect Dis 58 163 170. Devriese, L.A., Ieven, M., Goossens, H., Vandamme, P., Pot, B., Homme z, J. and Haesebrouck, F. (1996) Presence of vancomycin resistant enterococci in farm and pet animals. Antimicrob Agents Chemother 40 2285 2287. Dicuonzo, G., Gherardi, G., Lorino, G., Angeletti, S., Battistoni, F., Bertuccini, L., Creti, R., Di Rosa, R., Venditti, M. and Baldassarri, L. (2001) Antibiotic resistance and genotypic characterization by PFGE of clinical and environmental isolates of enterococci. FEMS Microbiol Lett 201 205 211. Dutka Malen, S., Blaimont, B., Wauters, G. and Courvalin, P. (199 4) Emergence of high level resistance to glycopeptides in Enterococcus gallinarum and Enterococcus casseliflavus Antimicrob Agents Ch 38 1675 1677. Dutka Malen, S., Evers, S. and Courvalin, P. (1995) Detection of glycopeptide resistance genotypes and ide ntification to the species level of clinically relevant enterococci by PCR. J Clin Microbiol 33 1434. Eaton, T.J. and Gasson, M.J. (2001) Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medica l isolates. Appl Environ Microbiol 67 1628 1635.

PAGE 172

162 Eaton, T.J. and Gasson, M.J. (2002) A variant enterococcal surface protein Esp(fm) in Enterococcus faecium ; distribution among food, commensal, medical, and environmental isolates. FEMS Microbiol Lett 216 269 275. Fines, M., Perichon, B., Reynolds, P., Sahm, D.F. and Courvalin, P. (1999) VanE, a new type of acquired glycopeptide resistance in Enterococcus faecalis BM4405. Antimicrob Agents Ch 43 2161 2164. Gambarotto, K., Ploy, M.C., Turlure, P., Grelaud, C., Martin, C., Bordessoule, D. and Denis, F. (2000) Prevalence of vancomycin resistant enterococci in fecal samples from hospitalized patients and nonhospitalized controls in a cattle rearing area of France. J Clin Microbiol 38 620 624. Gross, P.A., Hark avy, L.M., Barden, G.E. and Flower, M.F. (1976) Epidemiology of nosocomial enterococcal urinary tract infection. Am J Med Sci 272 75 81. Guardabassi, L. and Dalsgaard, A. (2004) Occurrence, structure, and mobility of Tn1546 like elements in environmental isolates of vancomycin resistant enterococci. Appl Environ Microbiol 70 984 990. Harwood, V.J., Brownell, M., Perusek, W. and Whitlock, J.E. (2001) Vancomycin resistant Enterococcus spp. isolated from wastewater and chicken feces in the United States. App l Environ Microbiol 67 4930 4933. Heikens, E., Bonten, M.J. and Willems, R.J. (2007) Enterococcal surface protein Esp is important for biofilm formation of Enterococcus faecium E1162. J Bacteriol 189 8233 8240.

PAGE 173

163 Howell, J.M., Coyne, M.S. and Cornelius, P. L. (1996) Effect of sediment particle size and temperature on fecal bacteria mortality rates and the fecal coliform/fecal streptococci ratio. J Environ Qual 25 1216 1220. Huycke, M.M., Sahm, D.F. and Gilmore, M.S. (1998) Multiple drug resistant enterococc i: the nature of the problem and an agenda for the future. Emerg Infect Dis 4 239 249. Iversen, A., Kuhn, I., Rahman, M., Franklin, A., Burman, L.G., Olsson Liljequist, B., Torell, E. and Mollby, R. (2004) Evidence for transmission between humans and the environment of a nosocomial strain of Enterococcus faecium Environ Microbiol 6 55 59. Johnson, L.K., Brown, M.B., Carruthers, E.A., Ferguson, J.A., Dombek, P.E. and Sadowsky, M.J. (2004) Sample size, library composition, and genotypic diversity among nat ural populations of Escherichia coli from different animals influence accuracy of determining sources of fecal pollution. Appl Environ Microbiol 70 4478 4485. Klare, I., Konstabel, C., Mueller Bertling, S., Werner, G., Strommenger, B., Kettlitz, C., Borgm ann, S., Schulte, B., Jonas, D., Serr, A., Fahr, A.M., Eigner, U. and Witte, W. (2005) Spread of ampicillin/vancomycin resistant Enterococcus faecium of the epidemic virulent clonal complex 17 carrying the genes esp and hyl in German hospitals. Eur J Clin Microbiol Infect Dis 24 815 825. Ko, K.S., Baek, J.Y., Lee, J.Y., Oh, W.S., Peck, K.R., Lee, N., Lee, W.G., Lee, K. and Song, J.H. (2005) Molecular characterization of vancomycin resistant Enterococcus faecium isolates from Korea. J Clin Microbiol 43 230 3 2306.

PAGE 174

164 Kogan, S.C., Doherty, M. and Gitschier, J. (1987) An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences Application to hemophilia A. New Engl J Med 317 985 990. Koganemaru, H. and Hitomi, S. (2008) Bacteremia caused by VanC type enterococci in a university hospital in Japan: a 6 year survey. J Infect Chemother 14 413 417. Kotzamanidis, C., Zdragas, A., Kourelis, A., Moraitou, E., Papa, A., Yiantzi, V., Pantelidou, C. and Yiangou, M. (2009) Character ization of vanA type Enterococcus faecium isolates from urban and hospital wastewater and pigs. J Appl Microbiol 107 997 1005. Kurup, A., Tee, W.S., Loo, L.H. and Lin, R. (2001) Infection of central nervous system by motile Enterococcus : first case report J Clin Microbiol 39 820 822. Lane, D.J. (1991) 16S/23S rRNA sequencing, p.115 148. In E Stackebrandt and M Goodfellow (ed), Nucleic acid techniques in bacterial systematics Wiley, Chichester, United Kingdom Leavis, H.L., Bonten, M.J. and Willems, R.J. (2006a) Identification of high risk enterococcal clonal complexes: global dispersion and antibiotic resistance. Curr Opin Microbiol 9 454 460. Leavis, H.L., Willems, R.J., Top, J. and Bonten, M.J. (2006b) High level ciprofloxacin resistance from point mut ations in gyrA and parC confined to global hospital adapted clonal lineage CC17 of Enterococcus faecium J Clin Microbiol 44 1059 1064.

PAGE 175

165 Leavis, H.L., Willems, R.J., Top, J., Spalburg, E., Mascini, E.M., Fluit, A.C., Hoepelman, A., de Neeling, A.J. and Bon ten, M.J. (2003) Epidemic and nonepidemic multidrug resistant Enterococcus faecium Emerg Infect Dis 9 1108 1115. Lleo Mdel, M., Bonato, B., Benedetti, D. and Canepari, P. (2005) Survival of enterococcal species in aquatic environments. FEMS Microbiol Eco l 54 189 196. Malathum, K., Singh, K.V., Weinstock, G.M. and Murray, B.E. (1998) Repetitive sequence based PCR versus pulsed field gel electrophoresis for typing of Enterococcus faecalis at the subspecies level. J Clin Microbiol 36 211 215. Matyar, F., K aya, A. and Dincer, S. (2008) Antibacterial agents and heavy metal resistance in Gram negative bacteria isolated from seawater, shrimp and sediment in Iskenderun Bay, Turkey. Sci Total Environ 407 279 285. McDonald, J.L., Hartel, P.G., Gentit, L.C., Belch er, C.N., Gates, K.W., Rodgers, K., Fisher, J.A., Smith, K.A. and Payne, K.A. (2006) Identifying sources of fecal contamination inexpensively with targeted sampling and bacterial source tracking. J Environ Qual 35 889 897. McDonald, L.C., Kuehnert, M.J., Tenover, F.C. and Jarvis, W.R. (1997) Vancomycin resistant enterococci outside the health care setting: Prevalence, sources, and public health implications. Emerging Infectious Diseases 3 311 317. McQuaig, S.M., Scott, T.M., Harwood, V.J., Farrah, S.R. an d Lukasik, J.O. (2006) Detection of human derived fecal pollution in environmental waters by use of a PCR based human polyomavirus assay. Appl Environ Microbiol 72 7567 7574. Megran, D.W. (1992) Enterococcal Endocarditis. Clin Infect Dis 15 63 71.

PAGE 176

166 Moore, D.F., Guzman, J.A. and McGee, C. (2008) Species distribution and antimicrobial resistance of enterococci isolated from surface and ocean water. J Appl Microbiol 105 1017 1025. NNIS (2004) National Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2004, issued October 2004. Am J Infect Control 32 470 485. Novais, C., Coque, T.M., Ferreira, H., Sousa, J.C. and Peixe, L. (2005a) Environmental contamination with vancomycin resistant enterococci from hospital sewage in Portugal. Appl Environ Microbiol 71 3364 3368. Novais, C., Sousa, J.C., Coque, T.M. and Peixe, L.V. (2005b) Molecular characterization of glycopeptide resistant Enterococcus faecium isolates from Portuguese hospitals. Antimicrob Agents Ch 49 3 073 3079. Pfaller, M.A., Jones, R.N., Doern, G.V. and Kugler, K. (1998) Bacterial pathogens isolated from patients with bloodstream infection: frequencies of occurrence and antimicrobial susceptibility patterns from the SENTRY antimicrobial surveillance pr ogram (United States and Canada, 1997). Antimicrob Agents Ch 42 1762 1770. Poole, T.L., Hume, M.E., Campbell, L.D., Scott, H.M., Alali, W.Q. and Harvey, R.B. (2005) Vancomycin resistant Enterococcus faecium strains isolated from community wastewater from a semiclosed agri food system in Texas. Antimicrob Agents Chemother 49 4382 4385.

PAGE 177

167 Ratanasuwan, W., Iwen, P.C., Hinrichs, S.H. and Rupp, M.E. (1999) Bacteremia due to motile Enterococcus species: clinical features and outcomes. Clin Infect Dis 28 1175 117 7. Reid, K.C., Cockerill, I.F. and Patel, R. (2001) Clinical and epidemiological features of Enterococcus casseliflavus/flavescens and Enterococcus gallinarum bacteremia: a report of 20 cases. Clin Infect Dis 32 1540 1546. Rice, L.B., Carias, L., Rudin, S ., Vael, C., Goossens, H., Konstabel, C., Klare, I., Nallapareddy, S.R., Huang, W. and Murray, B.E. (2003) A potential virulence gene, hylEfm predominates in Enterococcus faecium of clinical origin. J Infect Dis 187 508 512. Rice, L.B., Carias, L.L., Don skey, C.L. and Rudin, S.D. (1998) Transferable, plasmid mediated VanB type glycopeptide resistance in Enterococcus faecium Antimicrob Agents Ch 42 963 964. Rice, L.B., Hutton Thomas, R., Lakticova, V., Helfand, M.S. and Donskey, C.J. (2004) Beta lactam a ntibiotics and gastrointestinal colonization with vancomycin resistant enterococci. J Infect Dis 189 1113 1118. Roberts, M.C., Soge, O.O., Giardino, M.A., Mazengia, E., Ma, G. and Meschke, J.S. (2009) Vancomycin resistant Enterococcus spp. in marine envir onments from the West Coast of the USA. J Appl Microbiol 107 300 307. Schaberg, D.R. and Zervos, M.J. (1986) Intergeneric and interspecies gene exchange in gram positive cocci. Antimicrob Agents Ch 30 817 822.

PAGE 178

16 8 Scott, T.M., Jenkins, T.M., Lukasik, J. and Rose, J.B. (2005) Potential use of a host associated molecular marker in Enterococcus faecium as an index of human fecal pollution. Environ Sci Technol 39 283 287. Shankar, N., Lockatell, C.V., Baghdayan, A.S., Drachenberg, C., Gilmore, M.S. and Johnson, D.E. (2001) Role of Enterococcus faecalis surface protein Esp in the pathogenesis of ascending urinary tract infection. Infect Immun 69 4366 4372. Shankar, V., Baghdayan, A.S., Huycke, M.M., Lindahl, G. and Gilmore, M.S. (1999) Infection derived Enterococ cus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infect Immun 67 193 200. Sherer, B.M., Miner, J.R., Moore, J.A. and Buckhouse, J.C. (1992) Indicator bacterial survival in stream sediments. J Environ Qual 21 591 595. Sta mpone, L., Del Grosso, M., Boccia, D. and Pantosti, A. (2005) Clonal spread of a vancomycin resistant Enterococcus faecium strain among bloodstream infecting isolates in Italy. J Clin Microbiol 43 1575 1580. Stobberingh, E., van den Bogaard, A., London, N ., Driessen, C., Top, J. and Willems, R. (1999) Enterococci with glycopeptide resistance in turkeys, turkey farmers, turkey slaughterers, and (sub)urban residents in the south of The Netherlands: evidence for transmission of vancomycin resistance from anim als to humans? Antimicrob Agents Chemother 43 2215 2221. Swenson, J.M., Clark, N.C., Ferraro, M.J., Sahm, D.F., Doern, G., Pfaller, M.A., Reller, L.B., Weinstein, M.P., Zabransky, R.J. and Tenover, F.C. (1994) Development of a

PAGE 179

169 standardized screening metho d for detection of vancomycin resistant enterococci. J Clin Microbiol 32 1700 1704. Thal, L., Donabedian, S., Robinson Dunn, B., Chow, J.W., Dembry, L., Clewell, D.B., Alshab, D. and Zervos, M.J. (1998) Molecular analysis of glycopeptide resistant Enteroc occus faecium isolates collected from Michigan hospitals over a 6 year period. J Clin Microbiol 36 3303 3308. Toledo Arana, A., Valle, J., Solano, C., Arrizubieta, M.J., Cucarella, C., Lamata, M., Amorena, B., Leiva, J., Penades, J.R. and Lasa, I. (2001) The enterococcal surface protein, Esp, is involved in Enterococcus faecalis biofilm formation. Appl Environ Microbiol 67 4538 4545. Top, J., Willems, R., Blok, H., de Regt, M., Jalink, K., Troelstra, A., Goorhuis, B. and Bonten, M. (2007) Ecological repla cement of Enterococcus faecalis by multiresistant clonal complex 17 Enterococcus faecium. Clin Microbiol Infect 13 316 319. Top, J., Willems, R., van der Velden, S., Asbroek, M. and Bonten, M. (2008) Emergence of clonal complex 17 Enterococcus faecium in The Netherlands. J Clin Microbiol 46 214 219. U. S. Environmental Protection Agency (1997) Method 1600: Membrane filter test methods for enterococci in water. Office of Water, Washington D.C. EPA 821/R 97/004. Valdezate, S., Labayru, C., Navarro, A., Mant econ, M.A., Ortega, M., Coque, T.M., Garcia, M. and Saez Nieto, J.A. (2009) Large clonal outbreak of multidrug resistant CC17 ST17 Enterococcus faecium containing Tn5382 in a Spanish hospital. J Antimicrob Chemoth 63 17 20.

PAGE 180

170 VanderAuwera, P., Pensart, N., Korten, V., Murray, B.E. and Leclercq, R. (1996) Influence of oral glycopeptides on the fecal flora of human volunteers: Selection of highly glycopeptide resistant enterococci. Journal of Infectious Diseases 173 1129 1136. Vankerckhoven, V., Van Autgaerde n, T., Vael, C., Lammens, C., Chapelle, S., Rossi, R., Jabes, D. and Goossens, H. (2004) Development of a multiplex PCR for the detection of asa1 gelE cylA esp and hyl genes in enterococci and survey for virulence determinants among European hospital i solates of Enterococcus faecium J Clin Microbiol 42 4473 4479. Whitman, R.L., Przybyla Kelly, K., Shively, D.A. and Byappanahalli, M.N. (2007) Incidence of the enterococcal surface protein (esp) gene in human and animal fecal sources. Environ Sci Technol 41 6090 6095. Whitman, R.L., Shively, D.A., Pawlik, H., Nevers, M.B. and Byappanahalli, M.N. (2003) Occurrence of Escherichia coli and enterococci in Cladophora (Chlorophyta) in nearshore water and beach sand of Lake Michigan. Appl Environ Microbiol 69 4714 4719. Willems, R.J., Top, J., van Santen, M., Robinson, D.A., Coque, T.M., Baquero, F., Grundmann, H. and Bonten, M.J. (2005) Global spread of vancomycin resistant Enterococcus faecium from distinct nosocomial genetic complex. Emerg Infect Dis 11 821 828. Willems, R.J.L., Homan, W., Top, J., van Santen Verheuvel, M., Tribe, D., Manzioros, X., Gaillard, C., Vandenbroucke Grauls, C.M.J.E., Mascini, E.M., van Kregten, E., van Embden, J.D.A. and Bonten, M.J.M. (2001) Variant esp gene as a marker of a dist inct

PAGE 181

171 genetic lineage of vancomycin resistant Enterococcus faecium spreading in hospitals. Lancet 357 853 855. Yoshikazu, I., A. Ohno, S. Kashitani, M. Iwata, K. Yamaguchi (1996) Identification of vanB type vancomycin resistance in Enterococcus gallinarum from Japan. J Infect Chemother 2 102 105. Yoshimoto, E., Konishi, M., Takahashi, K., Majima, T., Ueda, K., Murakawa, K., Sakamoto, M., Maeda, K., Mikasa, K., Narita, N., Sano, R., Masutani, T., Ishii, Y. and Yamaguchi, K. (1999) Enterococcus gallinarum se pticemia in a patient with acute myeloid leukemia. Kansenshogaku Zasshi 73 1078 1081. RESEARCH SIGNIFICANCE Members of the genus Enterococcus are commensals that inhabit the gastrointestinal tracts of humans and other mammals. The metabolic flexibility of enterococci facilitates their survival and proliferation in a wide range of environments such as soils, surface waters, sediments and vegetation associated with surface waters and food (Fujioka 1999; Eaton and Gas son 2001; Harwood et al 2004) Accurate identification and classification of enterococci is important for both environmental and clinical purposes. It is difficult to identify some Enterococcus species due to their phenotypic similarity (Devriese et al 1993) Therefore, molecular methods such as genotyping and genetic sequencing are increasingly employed for identification purposes (Malath um et al 1998; Harwood et al 2004)

PAGE 182

172 BOX PCR genotyping of enterococci Genotyping methods have the capacity to process a large number of isolates (high throughput) and are cost effective as compared to sequencing studies. Although BOX PCR fingerprinting has been used to type enterococci in ecological studies (Brownell et al. 2007) and MST studies (Brownell et al 2007; Hassan et al 2007) till date, no study has demonstrated that the discrete clusters formed by enterococcal BOX PCR patterns are phylogenetically related species/ strains. The purpose of this study was to compare the ability of BOX PCR typing to determine genetic relatedness of enterococci with that two freshwater sites and one estuarine site were typed using BOX PCR and their 16S rR NA genes were sequenced. It was hypothesized that the relationships projected by the genotypic BOX PCR dendrograms will be similar to those obtained by phylogenetic analysis. As hypothesized, BOX PCR dendrograms were fairly congruent (77%) with the phylog enetic tree created by 16S rRNA sequencing. The majority of the strains within the different Enterococcus species could be clearly differentiated using BOX PCR typing. In comparison, the resolution capacity of the 16S rRNA gene is limited when identifying closely related Enterococcus species such as E. faecium and E. mundtii The BOXA2R profile of the genus Lactococcus clustered with the BOXA2R patterns of other Enterococcus species whereas it emerged as an outgroup in the phylogenetic tree. This indicates that closely related genera might not be as distinguishable using BOX PCR typing. To the best of my knowledge, this is the first study to shed light on the relationships between enterococcal species and strains using both genotypic (BOX PCR

PAGE 183

173 typing) and phy logenetic (16S rRNA sequencing) data. Although BOX PCR typing is an excellent tool for investigating strain diversity, genotypic studies relying solely on BOX PCR typing should exercise caution while interpreting phylogenetic relationships projected by BOX PCR dendrograms. Vancomycin resistance in enterococci Acquisition of antibiotic resistance genes and virulence determinants through conjugative plasmids and transposons make some Enterococcus species capable of causing disease (Tenover 2001) Enterococc i can be resistant to a wide range of antimicrobial agents such lactams, aminoglycosides and glycopeptides. Vancomycin is a glycopeptide antibiotic used to treat infections caused by gram positive organisms. Vancomycin resistance in enterococci was fi rst reported in 1986 in Europe and has since been isolated from clinical and environmental samples worldwide (Leclercq et al 1988; Uttley et al 1989) The plasmid borne vanA and vanB genes confer moderate to high level vancomycin resistance in enterococci while low level resistance ( vanC1 and vanC2/3 genes) is chromosomally encoded. Vancomycin resistant enterococci (VRE) have been detected in environmental waters, sewage, agricultural runoff, animal feces and fece s of healthy human hosts in parts of Europe (Aarestrup 1995; Devriese et al. 1996) In comparison, VRE are not commonly isolated from environmental waters or non hospital related sources in the US (Coque et al 1996; Harwood et al 2001; Roberts et al 2009) This study investigated the incidence of VRE in the water, sediment and vegetation samples from two freshwater and one estuarine site. Vancomycin susceptibility was deter mined using both culture based (agar dilution method) and molecular (multiplex PCR targeting vancomycin resistance genes)

PAGE 184

174 methods. VRE were also isolated from municipal and hospital wastewater samples. It was hypothesized that enterococci isolated from env ironmental matrices and municipal wastewater would be susceptible to vancomycin whereas vancomycin resistant enterococci would be isolated from hospital wastewater. Isolation of VRE from environmental sources Low level VRE (LL VRE) (< 32 g ml 1 ) isolated from environmental matrices demonstrated the vanC2/3 genotype and were identified as Enterococcus casseliflavus flavescens by 16S rRNA gene sequencing. Although no high level VRE were isolated from surface waters, the high proportion of LL VRE in environm ental matrices is a cause for concern from the public health perspective. LL VRE have the potential to cause disease, particularly in immunocompromised and geriatric patients. Treatment of infections caused by LL VRE can be problematic because they someti mes demonstrate vancomycin susceptibility in vitro while being resistant in vivo. Enterococcus gallinarum ( vanC1 genotype) were isolated from municipal wastewater and were a much lower proportion (1.6%) than the proportion of LL VRE isolated from environme ntal matrices (20% to 60%) Multi drug resistant enterococci with indistinguishable BOX PCR genotypes were isolated from hospital sewer line samples. These isolates were identified as Enterococcus faecium possessing the vanA genotype and resistant to high levels of vancomycin ( MIC = 512 g/ml). They also demonstrated intermediate resistance to ampicillin (MIC > 16 g/ ml) and ciprofloxacin (MIC > 4 g/ ml) Twenty percent of these isolates carried the variant esp gene which may facilitate colonization of t he urinary tract (Shankar et al. 2001) and biofilm formation (Toledo Arana et al. 2001; Heikens et al. 2007) The

PAGE 185

175 detection of the vanA genotype exclusively and the absence o f the vanB genotype in hospital wastewater is an unusual finding. This is one of the few studies in the US that has attempted to determine the vancomycin susceptibility of environmental enterococci. This is also the first study to evaluate VRE in vegetati on samples and to compare VRE proportions in freshwater vs. estuarine waters and across different matrices. Dissemination of high level VRE (HL VRE) into the groundwater or recreational waters due to compromised sewer lines or improper treatment practices poses a health risk for the community. The acquisition of virulence factors and antibiotic resistance genes from HL VRE by LL VRE and other indigenous vancomycin susceptible enterococci accentuates this risk. There is a need for surveillance studies to mon itor the presence of VRE and determine their ability to survive and persist in environmental matrices. References Aarestrup, F.M. (1995) Occurrence of glycopeptide resistance among Enterococcus faecium isolates from conventional and eco logical poultry farms. Microbial drug resistance (Larchmont, NY 1 255 257. Coque, T.M., Tomayko, J.F., Ricke, S.C., Okhyusen, P.C. and Murray, B.E. (1996) Vancomycin resistant enterococci from nosocomial, community, and animal sources in the United States Antimicrob Agents Chemother 40 2605 2609. Devriese, L.A., Ieven, M., Goossens, H., Vandamme, P., Pot, B., Hommez, J. and Haesebrouck, F. (1996) Presence of vancomycin resistant enterococci in farm and pet animals. Antimicrob Agents Chemother 40 2285 22 87.

PAGE 186

176 Devriese, L.A., Pot, B. and Collins, M.D. (1993) Phenotypic identification of the genus Enterococcus and differentiation of phylogenetically distinct enterococcal species and species groups. J Appl Bacteriol 75 399 408. Eaton, T.J. and Gasson, M.J. (2 001) Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl Environ Microbiol 67 1628 1635. Fujioka, R.S., C. Sian Denton, M. Borja, J. Castro, and K. Morphew. (1999) Soil: the environmental source of Escherichia coli J Appl Microbiol Symp Suppl 85:83S 89S. Harwood, V.J., Brownell, M., Perusek, W. and Whitlock, J.E. (2001) Vancomycin resistant Enterococcus spp. isolated from wastewater and chi cken feces in the United States. Appl Environ Microbiol 67 4930 4933. Harwood, V.J., Delahoya, N.C., Ulrich, R.M., Kramer, M.F., Whitlock, J.E., Garey, J.R. and Lim, D.V. (2004) Molecular confirmation of Enterococcus faecalis and E. faecium from clinical, faecal and environmental sources. Lett Appl Microbiol 38 476 482. Heikens, E., Bonten, M.J. and Willems, R.J. (2007) Enterococcal surface protein Esp is important for biofilm formation of Enterococcus faecium E1162. J Bacteriol 189 8233 8240. Leclercq, R., Derlot, E., Duval, J. and Courvalin, P. (1988) Plasmid mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. The New England Journal of Medicine 319 157 161.

PAGE 187

177 Malathum, K., Singh, K.V., Weinstock, G.M. and Murray, B.E. (1998) Repet itive sequence based PCR versus pulsed field gel electrophoresis for typing of Enterococcus faecalis at the subspecies level. Journal of Clinical Microbiology 36 211 215. Roberts, M.C., Soge, O.O., Giardino, M.A., Mazengia, E., Ma, G. and Meschke, J.S. (2 009) Vancomycin resistant Enterococcus spp. in marine environments from the West Coast of the USA. Journal of Applied Microbiology Shankar, N., Lockatell, C.V., Baghdayan, A.S., Drachenberg, C., Gilmore, M.S. and Johnson, D.E. (2001) Role of Enterococcus faecalis surface protein Esp in the pathogenesis of ascending urinary tract infection. Infection and immunity 69 4366 4372. Tenover, F.C. (2001) Development and spread of bacterial resistance to antimicrobial agents: An overview. Clinical Infectious Disea ses 33 S108 S115. Toledo Arana, A., Valle, J., Solano, C., Arrizubieta, M.J., Cucarella, C., Lamata, M., Amorena, B., Leiva, J., Penades, J.R. and Lasa, I. (2001) The enterococcal surface protein, Esp, is involved in Enterococcus faecalis biofilm formatio n. Appl Environ Microbiol 67 4538 4545. Uttley, A.H., George, R.C., Naidoo, J., Woodford, N., Johnson, A.P., Collins, C.H., Morrison, D., Gilfillan, A.J., Fitch, L.E. and Heptonstall, J. (1989) High level vancomycin resistant enterococci causing hospital infections. Epidemiology and Infection 103 173 181.

PAGE 188

ABOUT THE AUTHOR Ruia College of Arts and Sciences in Mumbai, India in 1995. She enrolled in the University of South Flo rida, Tampa, FL in 2002 as a non Department of Biology. Based on her excellent prowess, her committee recommended a change of program towards the Doctorate in Biology degree in Spring 2004. During her Ph.D. program, Bina wor ked on two major projects involving research in landfill microbiology and environmental enterococci. She also worked as a Research Assistant on two projects with governmental funding agencies. She presented her research findings at several Southeastern bra nch (SEB) and General meetings of the American Society for Microbiology (ASM). She was awarded the Tharp Summer Research Fellowship from the USF, Department of Biology. She was employed part time as a teaching assistant for the following courses: General M icrobiology, Determinative Bacteriology and Microbial Physiology.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2009 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003226
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Nayak, Bina.
0 245
Microbial population analysis in leachate from simulated solid waste bioreactors and evaluation of genetic relationships and prevalence of vancomycin resistance among environmental enterococci
h [electronic resource] /
by Bina Nayak.
260
[Tampa, Fla] :
b University of South Florida,
2009.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2009.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Degradation of the several million tons of solid waste produced in the U.S. annually is microbially mediated, yet little is known about the structure of prokaryotic communities actively involved in the waste degradation process. In the first study, leachates generated during degradation of municipal solid waste (MSW) in the presence (co-disposal) or absence of biosolids were analyzed using laboratory-scale bioreactors over an eight-month period. Archaeal and bacterial community structures were investigated by denaturing gradient gel electrophoresis (DGGE) targeting 16S rRNA genes. Regardless of waste composition, microbial communities in bioreactor leachates exhibited high diversity and temporal trends. Methanogen sequences from a co-disposal bioreactor were predominantly affiliated with the orders Methanosarcinales and Methanomicrobiales. Effect of moisture content on indicator organism (IO) survival during waste degradation was studied using culture-based methods. Fecal coliform and Enterococcus concentrations in leachate decreased below detection limits within fifty days of bioreactor operation during the hydrated phase. IOs could be recovered from the bioreactor leachate even after a prolonged dry period. This study advances the basic understanding of changes in the microbial community during solid waste decomposition. The purpose of the second study was to compare the ability of BOX-PCR to determine genetic relatedness with that of the "gold standard" method, 16S rRNA gene sequencing. BOX-PCR typing could clearly differentiate the strains within different Enterococcus species but closely related genera were not as distinguishable. In contrast, 16S rRNA gene sequencing clearly differentiates between closely related genera but cannot distinguish between different strains of Enterococcus species. This study adds to our knowledge of genetic relationships of enterococci portrayed by two separate molecular methods. The incidence of vancomycin resistant enterococci (VRE) in environmental matrices, residential and hospital wastewater was also investigated. Low-level VRE (vanC genotype) were isolated from environmental matrices and residential wastewater. VRE isolates from hospital wastewater were identified as E. faecium and demonstrated resistance to ampicillin, ciprofloxacin and vancomycin (vanA genotype), but sensitivity to chloramphenicol and rifampin. Although no high-level VRE were isolated from surface waters, the high proportion of low-level VRE in environmental matrices is a cause for concern from the public health perspective.
590
Advisor: Valerie J. Harwood, Ph.D.
653
Community structure
DGGE
Methanogens
BOX-PCR
VRE
690
Dissertations, Academic
z USF
x Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3226