USF Libraries
USF Digital Collections

Co-transcriptional splicing and functional role of pkc beta in insulin-sensitive l6 skeletal muscle cells and 3t3-l1 adi...

MISSING IMAGE

Material Information

Title:
Co-transcriptional splicing and functional role of pkc beta in insulin-sensitive l6 skeletal muscle cells and 3t3-l1 adipocytes
Physical Description:
Book
Language:
English
Creator:
Kleiman, Eden
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
PGC1alpha
PPARgamma
GLUT4
Akt
MTORC2
Dissertations, Academic -- Medical Sciences -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: PKCbetaII is alternatively spliced during acute insulin stimulation in L6 skeletal muscle cells. This PKCbetaII isoform is critical in propagating GLUT4 translocation. PKCbeta protein and promoter dysfunction correlate with human insulin resistance. TZD treatment ameliorates whole-body insulin-resistance. Its primary target is adipocyte PPARgamma, which it activates upon binding. This causes both altered circulating serum FFA concentrations and adipokine secretion profile. How TZDs affect the intracellular signaling of skeletal muscle cells is unknown. RT-PCR and Western blot analysis showed that TZDs elevated PKCbetaII by a process that involves co-transcriptional splicing. PGC1alpha overexpression most closely resembled TZD treatment by increasing PKCbetaII protein levels and keeping PKCbetaI levels relatively constant. Use of a heterologous PKCbeta promoter driven PKCbeta minigene demonstrated that PPARgamma could regulate the PKCbeta promoter, but whether this is direct or indirect is unclear. SRp40 splicing factor has been shown to dock onto the PGC1alpha CTD and influence splicing. SRp40, through overexpression and silencing, appears to play a part in PKCbeta promoter regulation. PKCbeta promoter regulation was also studied in 3T3-L1 cells. TZDs were experimentally shown to have no role in PKCbeta promoter regulation despite PPARgamma activation. Chromatin immunoprecipitation assays revealed PU.1 as a putative PKCbeta transcription factor that can cross-talk with the spliceosome, possibly through SRp40 which was also associated with the PKCbeta promoter. 3T3-L1 adipocyte differentiation revealed a novel developmentally-regulated switch from PKCbetaI to PKCbetaII, using western blot and Real-Time PCR analysis. Pharmacological inhibition of PKCbetaII using CGP53353 and LY379196 blocked 3H2-deoxyglucose uptake and revealed a functional role for PKCbetaII in adipocyte ISGT. CGP53353 specifically inhibited phosphorylation of PKCbetaII Serine 660 and not other critical upstream components of the insulin signaling pathway. Subcellular fractionation and PM sheet assay pointed to PKCbetaII-mediated regulation of GLUT4 translocation to the PM. Co-immunoprecipitation between PKCbetaII and GLUT4 allude to possible direct interaction. Western blot and immunofluorescence assays show PKCbetaII activity is linked with Akt Serine 473 phosphorylation, thus full Akt activity. Western blot and co-immunoprecipitation suggested that insulin caused active mTORC2 to directly activate PKCbetaII. Data support a model whereby PKCbetaII is downstream of mTORC2 yet upstream of Akt, thereby regulating GLUT4 translocation.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2009.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Eden Kleiman.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003236
usfldc handle - e14.3236
System ID:
SFS0027552:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2009 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003236
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Kleiman, Eden.
0 245
Co-transcriptional splicing and functional role of pkc beta in insulin-sensitive l6 skeletal muscle cells and 3t3-l1 adipocytes
h [electronic resource] /
by Eden Kleiman.
260
[Tampa, Fla] :
b University of South Florida,
2009.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2009.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: PKCbetaII is alternatively spliced during acute insulin stimulation in L6 skeletal muscle cells. This PKCbetaII isoform is critical in propagating GLUT4 translocation. PKCbeta protein and promoter dysfunction correlate with human insulin resistance. TZD treatment ameliorates whole-body insulin-resistance. Its primary target is adipocyte PPARgamma, which it activates upon binding. This causes both altered circulating serum FFA concentrations and adipokine secretion profile. How TZDs affect the intracellular signaling of skeletal muscle cells is unknown. RT-PCR and Western blot analysis showed that TZDs elevated PKCbetaII by a process that involves co-transcriptional splicing. PGC1alpha overexpression most closely resembled TZD treatment by increasing PKCbetaII protein levels and keeping PKCbetaI levels relatively constant. Use of a heterologous PKCbeta promoter driven PKCbeta minigene demonstrated that PPARgamma could regulate the PKCbeta promoter, but whether this is direct or indirect is unclear. SRp40 splicing factor has been shown to dock onto the PGC1alpha CTD and influence splicing. SRp40, through overexpression and silencing, appears to play a part in PKCbeta promoter regulation. PKCbeta promoter regulation was also studied in 3T3-L1 cells. TZDs were experimentally shown to have no role in PKCbeta promoter regulation despite PPARgamma activation. Chromatin immunoprecipitation assays revealed PU.1 as a putative PKCbeta transcription factor that can cross-talk with the spliceosome, possibly through SRp40 which was also associated with the PKCbeta promoter. 3T3-L1 adipocyte differentiation revealed a novel developmentally-regulated switch from PKCbetaI to PKCbetaII, using western blot and Real-Time PCR analysis. Pharmacological inhibition of PKCbetaII using CGP53353 and LY379196 blocked [3H]2-deoxyglucose uptake and revealed a functional role for PKCbetaII in adipocyte ISGT. CGP53353 specifically inhibited phosphorylation of PKCbetaII Serine 660 and not other critical upstream components of the insulin signaling pathway. Subcellular fractionation and PM sheet assay pointed to PKCbetaII-mediated regulation of GLUT4 translocation to the PM. Co-immunoprecipitation between PKCbetaII and GLUT4 allude to possible direct interaction. Western blot and immunofluorescence assays show PKCbetaII activity is linked with Akt Serine 473 phosphorylation, thus full Akt activity. Western blot and co-immunoprecipitation suggested that insulin caused active mTORC2 to directly activate PKCbetaII. Data support a model whereby PKCbetaII is downstream of mTORC2 yet upstream of Akt, thereby regulating GLUT4 translocation.
590
Advisor: Denise R. Cooper, Ph.D.
653
PGC1alpha
PPARgamma
GLUT4
Akt
MTORC2
690
Dissertations, Academic
z USF
x Medical Sciences
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3236



PAGE 1

Co-Transcriptional Splicing a nd Functional Role of PKC in Insulin-Sensitive L6 Skeletal Muscle Cells and 3T3-L1 Adipocytes by Eden Kleiman A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Denise R. Cooper, Ph.D. George Blanck, Ph.D. Duane Eichler, Ph.D. Niketa A. Patel, Ph.D. Eric Bennett, Ph.D. Date of Approval: September 29, 2009 Keywords: PGC1 PPAR GLUT4, Akt, mTORC2 Copyright 2009, Eden Kleiman

PAGE 2

ACKNOWLEDGEMENTS For serving as my advisor, being my fr iend and always challenging my scientific thinking, I would like to extend my gratitude to Dr. Denise R. Cooper. I would also like to thank everyone else in the lab including Dr Niketa Patel, Hercules Apostolatos, Dr. Kun Jiang, Dr. Pengfei Li, Dr. Tomar Ghan sah, Bill Long, Gay Carter and Jim Watson for their help in constructive criticism of experimental designs and protocols. Besides Dr. Cooper and Dr. Patel, I want to thank other members of my committee, Dr. Duane Eichler, Dr. George Bl anck, Dr. Eric Bennett, for taking time to assist me in completing my dissertation. I want to acknowledge Dr. Daniel P. Kelly for agreeing to be my outside chair and taki ng the time to read my dissertation. I would really like to thank Dr. Gower at the VA Medical Center for his letter of recommendation and allowing me to use his fac ilities. Use of his equipment was crucial in obtaining data from the 3T3-L1 cell line. Hi s graduate student, Abdel Alli, was also of great help in troubles hooting problems. None of the confocal microscopy data would have been possible without the assistance of Dr. Byeong Cha at the Lisa Muma Weitz Advanced Microscopy and Cell Imaging Core Laboratory. His expertise was paramount in designing experiments as well as teaching me how to use the equipment.

PAGE 3

Thank you Kathy Zahn for helping me with my multiple waivers every semester and helping me stay on course for the disse rtation. Thank you to Andrew Conniff for helping with orders and student fee payments. Last but not least, I appreciate the fu nding sources that enabled me to do this research. They are the American Heart Asso ciation, the National Inst itute of Health and the Department of Veterans Affairs.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES...............................................................................................................v LIST OF FIGURES...........................................................................................................vi ABBREVIATIONS.............................................................................................................x ABSTRACT....................................................................................................................xvi i INTRODUCTION...............................................................................................................1 Protein Kinase C: Brief History...............................................................................1 Signaling and Physiolocial Impact...........................................................................1 PKC Family and Structure.......................................................................................2 PKC Gene..............................................................................................................6 PKC V5 Domain....................................................................................................6 PKC Tissue Expression............................................................................................7 PKC Size..................................................................................................................9 PKC Activation........................................................................................................9 PKC Intracellular Distribution...............................................................................15 PKC Anchoring Proteins and Substrates...............................................................16 PKC Promoter......................................................................................................18 PKC Inhibitors.......................................................................................................19 Glucose Transporter 4............................................................................................23 Akt..........................................................................................................................2 8 Insulin Signaling and Involveme nt of PKC, GLUT4 and Akt...............................34

PAGE 5

ii Peroxisome Proliferator-Activated Recpeptor ....................................................51 Thiazolidinediones.................................................................................................57 Peroxisome Proliferator-Activated Receptor Coactivator 1 ............................60 Serine/Arginine-rich Proteins................................................................................64 PU.1/Spi1...............................................................................................................68 Co-transcriptional Splicing....................................................................................68 Experimental Procedures...................................................................................................92 Cell Culture............................................................................................................92 Overexpression/Minigene Transient Transfection.................................................93 siRNA Knockdown in L6 Skeletal Muscle Cells..................................................94 siRNA Knockdown in 3T3-L1 Adipocytes...........................................................94 Oil Red O Staining.................................................................................................95 Cloning the Minigene............................................................................................95 Mutation of Putative PKC minigene PPRE.........................................................98 RT-PCR..................................................................................................................99 Silver Staining......................................................................................................102 Agarose Gel.........................................................................................................103 Western Blot Analysis.........................................................................................103 Co-immunoprecipitation......................................................................................104 Real-time PCR.....................................................................................................104 Glucose Uptake....................................................................................................105 Subcellular Fractionation.....................................................................................105 Plasma Membrane Sheet Assay...........................................................................106

PAGE 6

iii GLUT4 Exofacial Loop Transloca tion/Fusion Immunofluorescence Assay....................................................................................................................107 Immunofluorescence Meas ure of pAkt Ser473...................................................107 RESULTS........................................................................................................................ 109 TZDs and Alternative Sp licing (A) Hela cells.....................................................109 TZDs and Alternative Splicing (B) Vascular Smooth Muscle Cells...................110 TZDs and Alternative Splicing (C ) L6 Skeletal Muscle Cells............................110 PKC II mRNA Regulated by Overexpression of PPAR PGC1 and SRp40...................................................................................................................111 Functionality of PGC1 C-terminal Domain.......................................................112 TZDs Influence PKC Expression Level and Alternative Splicing ...................112 Hypothesis #1: TZDs Co-trans criptionally Regulate PKC Gene Expression............................................................................................................112 Role of Overexpressed PPAR on PKC Protein Levels....................................113 Role of Overexpressed PGC1 on PKC Protein Levels....................................114 Effect of siRNA Knockdown of PPAR PGC1 and SRp40 on PKC II mRNA....................................................................................................114 Generation of Heterologous PKC Promoter-driven PKC Minigene...............115 Effect of TZD on PKC Minigene.......................................................................115 PPAR -mediated PKC Transcriptional Regul ation: Direct vs. Indirect?...............................................................................................................115 Role of TZDs in 3T3-L1 PKC II Expression......................................................116 Discovery of Novel Differentiation-regulated PKC Alternative Splicing in 3T3-L1 adipocytes.............................................................................118 Real-Time PCR Confirms PKC II Adipogenesis Protein Expression Patterns.................................................................................................................119

PAGE 7

iv Use of Distal PKC II polyA Tail During Adipogenesis.....................................119 Hypothesis #2: PKC II Can Regulate GLUT4 Expression.................................120 Regulation of PKC Promoter During 3T3-L1 Differentiation...........................120 Hypothesis #3: Developm ental Regulation of PKC Splicing by PU.1..............122 Linking PKC II with 3T3-L1 Adipocyte Insulin-stimulated Glucose Transport..............................................................................................................122 CGP53353 Specificity.........................................................................................123 Hypothesis #4: PKC II Regulates 3T3-L1 Adipocyte ISGT in Part via GLUT4 Trafficking or GLUT4 Fusion..........................................................123 Subcellular Fractionation Points to a Role for PKC II in GLUT4 Translocation........................................................................................................124 PM Sheet Assay Affirms a Role for PKC II in GLUT4 Translocation..............125 PKC II Regulation of Akt Activity.....................................................................126 Immunofluorescence Conf irms Role for PKC II in Phosphorylation of Akt S473..............................................................................................................127 PKC II Downstream of mTORC2 but Upstream of Akt....................................128 Insulin-stimulated Binding of PKC II to mTORC2............................................129 Insulin-stimulated Binding of PKC II to Akt......................................................129 Co-immunoprecipitation Between PKC II and GLUT4.....................................129 DISCUSSION..................................................................................................................183 REFERENCES................................................................................................................210 ABOUT THE AUTHOR.......................................................................................End Page

PAGE 8

v LIST OF TABLES Table 1. PKC Isoform Tissue/Cell Expression...................................................................8 Table 2. PKC Isoform Size.................................................................................................9 Table 3. PKC Isoform Activators.....................................................................................13 Table 4. PKC Promoter Transcription Factors...............................................................19 Table 5. PKC Inhibitors....................................................................................................20 Table 6. LY379196 Inhibitor IC50 spectrum.....................................................................21 Table 7. CGP53353 Inhibitor IC50 spectrum....................................................................22

PAGE 9

vi LIST OF FIGURES Figure 1. Proposed effects of protein kinase C activation................................................70 Figure 2. Domain structure of PKC isoforms...................................................................71 Figure 3. PKC pseudosubstrate autoinhibition.................................................................72 Figure 4. PKC secondary structure.................................................................................73 Figure 5. PKC alternative splicing and al ternative polyadenylation..............................74 Figure 6. PKC isoform phosphorylation sites...................................................................75 Figure 7. Biphasic cPKC translocation in shortand long-term exposure to agonists....................................................................................................................... .......76 Figure 8. Spatial, temporal and conformation regulation of cPKC..................................77 Figure 9. The main pathways of DAG generation and catalysis......................................78 Figure 10. Agonist-induced membrane phospholipid degradation for acute and sustained PKC activation............................................................................................79 Figure 11. GLUT family PM insertion structure..............................................................80 Figure 12. GLUT4 trafficking itinerary............................................................................81 Figure 13. Proposed GLUT4 comp artments and trafficking............................................82 Figure 14. Domain structure of mammalian PKB/Akt isoforms......................................83 Figure 15. Mechanism of Akt activation..........................................................................84 Figure 16. Functional role of Akt in various tissues.........................................................85 Figure 17. Mechanism of mTORC activation...................................................................86 Figure 18. Model for insulin signaling.............................................................................87 Figure 19. Generalized structure for PPAR 1 and PPAR 2.............................................88 Figure 20. Ligand-dependent transc activation and ac tive repression...............................89

PAGE 10

vii Figure 21. Improved insulin sensitivity via TZD mediated adipocyte PPAR activation..................................................................................................................... .......90 Figure 22. Human PGC1 protein structure.....................................................................91 Figure 23. TZD Pioglitazone mimics insulin s effect of increased PKC II exon inclusion in HeLa cells............................................................................................131 Figure 24. Pioglitazone increases PKC II exon inclusion in A10 vascular smooth muscle cells.........................................................................................................132 Figure 25. Pioglitazone combined with insulin synergistically increases PKC II exon inclusion in L6 skeletal muscle cells.........................................................133 Figure 26. Pioglitazone treatment a nd SRp40 overexpression mimic insulin s upregulation of PKC II protein levels.............................................................................134 Figure 27. Overexpression of PPAR PGC1 and SRp40 individually or in combination are able to increase PKC II protein expression..........................................135 Figure 28. CTD of PGC1 is necessary for PKC II exon inclusion..............................136 Figure 29. TZDs Rosiglitazone a nd Pioglitazone stimulate PKC co-transcriptional splicing................................................................................................137 Figure 30. Hypothetical model of TZD mechanism.......................................................138 Figure 31. PPAR overexpression increases both PKC I and PKC II protein levels......................................................................................................................... .......139 Figure 32. Ligand-binding domain is necessary for PPAR mediated upregulation of PKC II protein levels.............................................................................140 Figure 33. PGC1 overexpression mimics TZD stimulation of PKC II co-transcriptional splicing................................................................................................141 Figure 34. PPAR or PGC1 knockdown reduces basal PKC II mRNA......................142 Figure 35. SRp40 knockdown results in lower basal PKC II protein levels..................143 Figure 36. PCR on rat genomic DNA.............................................................................144 Figure 37. BII-BI fragment digested and inserted into the pTNT cloning vector..........145

PAGE 11

viii Figure 38. pCMVTNT vector used for mammalian cell expression..............................146 Figure 39. BII-BI fragments cloned into pCMVTNT vector for mammalian cell expression................................................................................................................ ..147 Figure 40. Multiple mi nigene products...........................................................................148 Figure 41. Chimeric intron removed...............................................................................149 Figure 42. PCR generates BII-BI frag ment with different overhangs............................150 Figure 43. Predicted splicing events fr om CMVTNT BII-BI ss1 clone (-CI)................151 Figure 44. Products observed after tr ansfection of CMVT NT BII-BI ss1 clones......................................................................................................................... ......152 Figure 45. Cloning ss4 frag ment into ss1 vector............................................................153 Figure 46. Replacing CMV promoter with human PKC promoter...............................154 Figure 47. Truncatation of full length PKC promoter..................................................155 Figure 48. PKC promoter-driven expression of BII and BI minigene products...........156 Figure 49. TPA induces transcription of PKC promoter minigene..............................157 Figure 50. TZD induces co-transcr iptional splicing of minigene...................................158 Figure 51. PKC promoter responsive to PPAR overexpression.................................159 Figure 52. PPAR does not target putative DR2 on PKC promoter of minigene....................................................................................................................... ....160 Figure 53. 3T3-L1 differentiation...................................................................................161 Figure 54. PKC splicing is develo pmentally regulated................................................162 Figure 55. Rosiglitazone has no effect on developmentally regulated PKC splicing....................................................................................................................... ......163 Figure 56. 3T3-L1 PKC (and other PKC isoform) protein expression during differentiation................................................................................................................ ...164 Figure 57. Differentiating 3T3-L1 PKC II mRNA expression mimics protein expression..................................................................................................................... ...165

PAGE 12

ix Figure 58. Differentiating 3T3-L1 adipoc ytes use distal polyA tail for PKC II alternative splicing........................................................................................................... 166 Figure 59. Differentiated 3T3-L1 adipocytes not transfectable......................................167 Figure 60. 3T3-L1 transcription factor mRNA expression during adipogenesis............168 Figure 61. PU.1 expression through adipocyte differentiation.......................................169 Figure 62. ChIP of mouse PKC promoter.....................................................................170 Figure 63. PKC II inhibition via CGP53353 attenuates adipocyte glucose uptake......................................................................................................................... ......171 Figure 64. PKC inhibition via LY379196 attenu ates adipocyte glucose uptake......................................................................................................................... ......172 Figure 65. CGP53353 specifically targets PKC II phosphorylation..............................173 Figure 66. GLUT4 transloc ation is blocked by PKC II inhibition................................174 Figure 67. PM sheet assay confirms PKC II role in GLUT4 translocation...................175 Figure 68. PKC II may affect organization of GLUT4..................................................176 Figure 69. Effect of PKC II inhibition on Akt phosphorylation....................................177 Figure 70. PKC II inhibition abolishes phosphory lation of Akt Serine 473 and its subcellular locations.............................................................................................178 Figure 71. CGP53353 treatment does not alter mTORC2 activation.............................179 Figure 72. PKC IIInsulin-dependent binding of PKC II with mTORC2.....................180 Figure 73. Insulin-depe ndent binding of PKC II with phospho Akt S473...................181 Figure 74. Co-IP of GLUT4 and PKC II ......................................................................182 Figure 75. Hypothetical model for PKC II-regulated ISGT via Akt activation in 3T3-L1 adipocytes.......................................................................................................209

PAGE 13

x ABBREVIATIONS 15-d-PGJ2 15-deoxy prostaglandin J2 MEM Minimum essential medium alpha AF-2 Activation function-2 AGC cAMP-dependent, cGMP-dep endent and protein kinase C AICAR Aminoimidazole carboxamide ribonucleotide AKAP A kinase anchoring protein AMPK 5 AMP-activated protein kinase APPL1 Adaptor protein, phosphotyros ine interaction, PH domain and leucine zipper containing 1 APS Adaptor protein containing a PH and SH2 domain ARF ADP-ribosylation factor AS160 Akt substrate of 160kDa ASM Acid sphingomyelinase aPKC Atypical PKC C3G CRK SH3-binding GEF Ca2+ Calcium CaMK Calcium/calmodulin-dependent protein kinase CAP Cbl-associated protein CAPP Ceramide-activ ated protein phosphatase

PAGE 14

xi CBP CREB binding protein cDNA Complementary DNA C/EBP CAAT/enhancer binding proteins CIP4 Cdc42-interacting protein 4 Clk1 CDC-like kinase 1 cPKC Classical PKC CREB Cyclic-AMP-responsive-element-binding protein CTD C-terminal domain CTE C-terminal extension DAG Diacylglycerol DAPI 4 ,6-diamidino-2-phenylindole DBD DNA-binding domain DEPTOR dishevelled, egl-10, pleckstrin domains and interacts with mTOR DGK Diacylglycerol kinase DMEM Dulbecco s modified eagle medium DOC2B Double C2-like domains, beta DR1 Direct repeat 1 DV-GSC Dispersed vesicular GLUT4 storage compartment EGFR Epidermal growth factor receptor ER Endoplasmic reticulum ERK Extracellular signal-related kinase ESE Exon splicing enhancer ESS Exon splicing silencer

PAGE 15

xii Fe2+ Ferrous iron FFA Free fatty acid FOXO1 Forkhead box O1 FRAP FKBP12-rapamycin-associated protein GAP GTPase activating protein GEF Guanyl nucleotide-exchange factor GGA Golgi-localized -ear-containing arf-binding protein GLUT4 Glucose transporter 4 G6Pase Glucoe-6-phosphatase GS Glycogen synthase GSK3 Glycogen synthase kinase 3 GSV GLUT4 storage vesicle HAT Histone acetyltransferase HETE 12and 15-hydroxyeicosatetraenoic acid hnRNP Heterogeneous nuclear RNP HODE 9and 13-hydroxyoctadecadienoic acid HSL Hormone-sensitive lipase IGF Insulin-like growth factor IL Interleukin IFN Interferon IP3 Inositol triphosphate IR Insulin receptor IRAP Insulin responsive aminopeptidase

PAGE 16

xiii IRM Insulin-responsive motif ISE Intronic splicing enhancer ISGT Insulin stimulated glucose transport ISR2 Insulin substrate receptor 2 ISS Intronic splicing silencer LBD Ligand-binding domain LDM Low density microsome LPA Lysophosphatidic acid LPAAT Lysophosphatidic acid acyltransferases MAGUK Membrane-associated guanylate kinase MAPK Mitogen-acti vated protein kinase MEF2C Myocyte-enhancer factor 2C MEK MAP kinase kinase mRNA Messenger RNA mTORC2 Mammalian target of rapamycin complex 2 Myo1c Myosin 1c NCoR Nuclear repressor co-repressor NFB Nuclear factorB nPKC Novel PKC NO Nitric oxide NO2-LA Nitrolinoleic acid NO2-OA Nitrooleic acid NDM Nonsense-mediated decay

PAGE 17

xiv PA Phosphatidic acid PAP Phosphatidic acid phosphorylase PC Phosphatidyl choline PDGF Platelet derived growth factor PDK1 3-phosphoinositide-dependent protein kinase 1 PEPCK Phosphoenolpyruvate carboxykinase PGC1 Peroxisome proliferator-activated receptor coactivator 1 PH Pleckstrin homology PHLPP PH domain leucine-ri ch repeat protein phosphatase PI3K Phosphoinositide-3-kinase PIAS1 Protein inhibitor of STAT1 PICK1 Protein interacting with C kinase 1 PIKfyve Phosphoinositide kinase for five position containing a fyve finger PIP2 Phosphatidylinositol (4,5)-biphosphate PI(3)P Phosphatidylinositol 3-phosphate PIP3 Phosphatidylinositol (3,4,5)-triphosphate PKA Protein kinase A PKC Protein kinase C PKD Protein kinase D PKM Protein kinase M PLA Phospholipase A PLC Phospholipase C PLD Phospholipase D

PAGE 18

xv PM Plasma membrane PMA Phorbol 12-myristate 13-acetate PP1 Type-1 phosphatase PPAR Peroxisome proliferator-activated receptor PPRE PPAR response element PR-GSC Perinuclear reticula r GLUT4 storage compartment PRAS40 Proline-rich Akt substrate 40 kDa PROTOR Protein obs erved with Rictor PTB Phosphotyrosine-binding PTPase Protein tyrosine phosphatases PTEN Phosphatase and tensin homolog PYR Polypyrimidine tract RabGDI Rab GDP dissociation inhibitor RACK Receptor for activated C kinase 1 RAPTOR Regulatory-associ ated protein of mTOR Rheb Ras homolog enriched in brain RICTOR Rapamycin insensitive companion of mTOR RIP140 Nuclear receptor interacting protein 1 RNAPII RNA polymerase II RRM RNA recognition motif RS Arginine/serine RUVBL2 RuvB-like protein 2 RXR Retinoid X receptor

PAGE 19

xvi S6K1 S6 kinase 1 SAG 1-steroyl-2-ar achidonoyl-sn-glycerol SCAMP Secretory carrier-asso ciated membrane proteins SEG 1-steroyl-2-eic osapentaenoyl-glycerol SDG 1-steroyl-2-doxosahexaaenoyl-sn-glycerol SH2 or SH3 Src homology SHIP2 SH2-containing 5 -inositol phosphatase SIN1 Stress-activated-protein-kinase-interacting protein 1 siRNA Small interfering RNA SMS Sphingomyelin synthase SNARE Soluble N-ethylmalemide-sensi tive factor att achment protein (SNAP) Receptor snRNP Small nuclear ribonucloprotein SRC Steroid receptor co-activator STICKS Substrates that interact with C kinase T2DM Diabetes mellitus type 2 TGN Trans -Golgi network TNF Tumor necrosis factor TSC1 or TSC2 Tuberous sclerosis complex protein TV Tubulo-vesicular TZD Thiazolidinedione VAMP2 Vessicle-associated membrane protein 2 VSMC Vascular smooth muscle cell

PAGE 20

xvii CO-TRANSCRIPTIONAL SPLICING A ND FUNCTIONAL ROLE OF PKC IN INSULIN-SENSITIVE L6 SKELETA L MUSCLE CELLS AND 3T3-L1 ADIPOCYTES Eden Kleiman ABSTRACT PKC II is alternatively spliced during acute insulin stimulation in L6 skeletal muscle cells. This PKC II isoform is critical in propa gating GLUT4 translocation. PKC protein and promoter dysfunction correlate with human insulin resistance. TZD treatment ameliorates whole-body insulin-resistance. Its pr imary target is adipocyte PPAR which it activates upon binding. This caus es both altered circulating serum FFA concentrations and adipokine secretion pr ofile. How TZDs affect the intracellular signaling of skeletal muscle cells is u nknown. RT-PCR and Western blot analysis showed that TZDs elevated PKC II by a process that involves co-transcriptional splicing. PGC1 overexpression most closely resemb led TZD treatment by increasing PKC II protein levels and keeping PKC I levels relatively constant. Use of a heterologous PKC promoter driven PKC minigene demonstrated that PPAR could regulate the PKC promoter, but whether this is di rect or indirect is unclear. SRp40 splicing factor has been shown to dock onto the PGC1 CTD and influence splicing. SRp40, through overexpression and silencing, appe ars to play a part in PKC promoter regulation. PKC promoter regulation was also studi ed in 3T3-L1 cells. TZDs were experimentally shown to have no role in PKC promoter regulation despite PPAR

PAGE 21

xviii activation. Chromatin immunoprecipitation as says revealed PU.1 as a putative PKC transcription factor that can cross-talk with the spliceosome possibly through SRp40 which was also associated with the PKC promoter. 3T3-L1 adipocyte differentiation revealed a novel developmenta lly-regulated switch from PKC I to PKC II, using western blot and Real-Time PCR analysis Pharmacological inhibition of PKC II using CGP53353 and LY379196 blocked [3H]2-deoxyglucose uptake a nd revealed a functional role for PKC II in adipocyte ISGT. CGP53353 speci fically inhibited phosphorylation of PKC II Serine 660 and not other critical upstr eam components of the insulin signaling pathway. Subcellular fractionation a nd PM sheet assay pointed to PKC II-mediated regulation of GLUT4 translocation to th e PM. Co-immunoprecipitation between PKC II and GLUT4 allude to possible direct intera ction. Western blot and immunofluorescence assays show PKC II activity is linked with Akt Seri ne 473 phosphorylation, thus full Akt activity. Western blot and co -immunoprecipitation suggested that insulin caused active mTORC2 to directly activate PKC II. Data support a model whereby PKC II is downstream of mTORC2 yet ups tream of Akt, thereby regul ating GLUT4 translocation.

PAGE 22

1 INTRODUCTION Protein Kinase C: Brief History P rotein K inase C (PKC) was discovered by Nishizuka and coworkers as a histone protein kinase isolated from the rat brain that could be activated by limited proteolysis [1], Ca2+ and (phospho)lipids [2] or phorbol esters and phospholipids [3]. D ia cylg lycerol (DAG), an early product of signal-induced inositol phospholipid breakdown, enhanced the affinity of PKC for calci um and thereby activating it [4 ]. Phorbol esters, which promoted tumors, were able to substitute fo r DAG in PKC activation [3]. This activation by phorbol esters was believed to be the reason PKC was a tumor promoter [5; 6], bringing it to the forefront on cancer research [7]. Early biochemical studies and purifications indicated PKC re presented a group of several is oenzymes [8]. The major breakthrough came from cloning cDNAs of PKC isoforms, mostly from brain cDNA libraries. PKC cDNA has been cloned from vari ous sources including bovine, human, rat and mouse [9]. Signaling and Physiolocial Impact PKC s role in signal transduction was first demonstrated in release of serotonin from platelets [10; 11]. A variety of agonist-induced cellular responses involve PKC including hormones, neurotransmitters and some growth factors [12]. One of the main pathways activated by PKC is the MEK-ERK pathway which promotes proliferation and differentiation [13]. However, there are ma ny other signaling cascades of which PKC is

PAGE 23

2 at the epicenter. Figure 1 illustrates th e many proposed effects of protein kinase C activation [14]. In cancer signaling, PKC is also involved in cellular adhesion. This allows for cancer cell invasion via integrin binding, activation of meta lloproteinases and expression of extracellular matrix proteins Inhibition of PKC reduces invasiveness [14]. A PKC selective inhibitor, Enzastaurin, has recentl y been evaluated for its potential as an anticancer agent in lung cancer [15]. PKC is also involved in the PI3K-Akt pa thway [14]. This places PKC in the middle of the insulin signaling cascade. PK C is involved in insulin-stimulated glucose uptake as a downstream effector of PI3K-PDK1 [16]. As pr oof of its central role in insulin signaling, PKC dysregulatio n is associated with many diabetic complications such as diabetic nephropathy, diabetic retinopat hy and cardiovascular disease [17; 18]. PKC Family and Structure The Protein Kinase C family are serine/th reonine kinases that are members of the AGC (cA MP-dependent, cG MP-dependent, and protein kinase C ) family of protein kinases which have structural features in common (includes PKA, PKB and PKC). AGC kinases contain highly conserved catalytic domains (motifs required for ATP/substratebinding and catalysis) and a regul atory domain that keeps th at enzyme in an inactive conformation. PKC regulatory domains occ upy the amino terminal and contain an autoinhibitory pseudosubstrate domain (s equence where alanine substitutes for serine/threonine phosphoacceptor site) and two distinct plasma membrane targeting modules, C1 and C2. PKC isoforms are clas sified based on differences in their amino terminal regulatory domain (Figure 2) and cofactor requirement [14; 19; 20; 21].

PAGE 24

3 The PKC family comprises 10 isozymes a nd their splice variants grouped into 3 classes based on co-factor requirement [21]. C onventional PKC (cPKC) isoforms include , I and alternatively spliced II. Starting at the N-termin al, cPKCs are allosterically regulated by the pseudosubstrate which as mentioned before resembles a substrate binding domain [20]. This was discovered by using peptides based on the sequence and showed that they were effective competitive inhibitors of PKC [22]. Activation of PKC (and downstream signaling) necessitates the re lease of the pseudos ubstrate domain from the kinase core (Figure 3) [6; 23]. Antibodies targeting the pseudosubstrate dom ain resulted in co-factor independent PKC activation [24]. PKC is resistant to proteolysis when inactive (pseudosubstratekinase core binding) but highl y sensitive to proteolysis in the pseudosubstrate domain (specific Arginine within) when active. The activation of PKC is dependent on pseudosubstrate unmasking [25]. cPKCs cont ain a C1 domain that binds DAG/PMA. The C1 domain consists of tandem (roughly 50) residue sequences, named C1A and C1B. C1A and C1B domains both have a zinc finger (Zn2+) held by 6 cysteines and 2 histidines. This is used for DAG/phorbol es ter binding [19]. The C1B domain contains a Tyrosine at position 22 making it a weak DAG responder [21]. The C2 domain binds calcium and subsequently binds anio nic/acidic phospholipids [19]. Ca2+ is bound by a sandwich structure composed of eight -strands creating two flat sheets connected with a short helix hinge. This sandwich can bind 2-3 calcium ions. It is this positively charged ion that helps inte ract with negatively char ged phospholipids such as phosphatidylserine [26]. The double positive symbol (Figure 2) in the cPKC C2 domain represents a basic patch (located in the distal area of the Ca2+-dependent lipid binding

PAGE 25

4 site) that specifically recognizes PIP2 and distinguishes cPKC from other PKCs (among other things) in terms of activation [21]. N ovel PKC s (nPKCs) include , / or / could be further subdivided based on stru ctural features. nPKCs have C1 and C2 domains, however, the order is switched rela tive to cPKCs (Figure 2). The nPKC C2 domain (C2-like) lacks the acidic residues ne cessary for calcium binding. This is the main pharmacological difference between cP KCs and nPKCs. As shown in Table 3, nPKCs are maximally activated by DAG/PM A and phosphatidylseri ne without the requirement for calcium [19]. nPKCs have stronger DAG responsiveness compared to cPKCs due to a tryptophan at position 22 (Figure 2) in the C1B domain [21]. A typical PKC s (aPKCs) include / They lack a calcium sensitive C2 domain and have an atypical C1 domain with only one cysteine-rich membrane-tar geting structure that binds PIP3 or ceramide (not DAG or PMA). Upstream of the C1 domain is a PB1 domain that mediates interactions with other PB1-contai ning scaffolding proteins such as PAR-6 and MEK5. The activity of aPKCs are regulated mainly by protein-prot ein interactions and PDK-1 mediated phosphorylation [19]. The PKC ATP-binding domain (C 3) contains a lobe with -sheets with a glycinerich ATP-binding loop with the consensus GXG XXG. It has an invariant lysine which structures the enzyme for phosphoryl-transfer. The C4 domain is predominantly helical and contains the activation loop se gment that positions magnesium and peptide substrates for catalysis. In between the C3 and C4 lobes of the kinase domain, there is a “gatekeeper” residue (methionine in PKC II) that controls access to a cavity in the ATP binding pocket. The V5 domain contai ns highly conserved priming/regulatory

PAGE 26

5 phosphorylation sites (discussed in further deta il below) that play a crucial role in structuring the catalytic pocket [19]. PKC and are considered by some to constitute a fourth class of PKCs named P rotein K inase D [20]. Initially, human PKD (PKC ) was discovered followed by the murine ortholog PKD [27; 28]. PKD is a serine /threonine kinase that consists of an Nterminal regulatory domain and a C-terminal catalytic domain. The N-terminal domain has 2 cysteine-rich, zinc finger-like motifs and a p leckstrin h omology (PH) domain. Cys1 and Cys2 domains (Figure 2) bind DAG/PMA with high affinity [29]. The PH domain is involved in protein:protein inte ractions as well as PH domain-dependent autoinhibitory intramolecular interactions that maintain the enzyme in an inactive state with low basal activity in re sting cells. An interesting connection exists between PKD and nPKCs. nPKCs activate PKD by phosphorylat ing them at highly conserved serine residues in the activation loop which relieves autoinhibition [30]. PKD2 and PKD3 have also recently been added to the list. PKD is distinct from PKC with respect to structural and enzymatic properties. Fo r instance, PKD does not phosphorylate many bona-fide PKC substrates. PKD family members have been grouped into the ca lcium/calm odulin-dependent protein k inase (CaMK) based on catalytic domain structure and substrate specificity. Ho wever, unlike CaMK, PKDs are activated indirectly by calcium th rough DAG production [29]. Recently, another group of PKCs has been discovered. P rotein kinase C-r elated k inase (PRK) consists of at least three members, PRK1-3. PRKs are insensitive to Ca2+, DAG and phorbol esters but can be activated by limited proteolysis and phospholipids. Both PRK1 and PRK2 can bind activated RhoA GTPase proteins, which increases their

PAGE 27

6 activity. This binding o ccurs in the HR1 domain. It is composed of three repeats of a 55 amino acid motif. In PRK1, the first HR1 re peat (HR1a) binds to activated GTP-RhoA complex but not to the inactive GDP-bound fo rm. HR1b is the second motif and binds (less affinity) to either active of inactive RhoA. The HR1c rep eat does not bind RhoA and its function is unknown [31; 32]. PKC Gene PKC I and PKC II are derived from alternative splicing of the same pre-mRNA from the same gene (16p11.2 in humans). Th e region of splicing that determines the isoform is the V5 region. Rat and rabbit PKC I and PKC II cDNAs encode proteins composed of 671 and 673 amino acids, respectivel y. The difference in the C-terminal V5 exon is a PKC I product that is 50 amino acids and a PKC II product that is 52 amino acids (Figure 4) [33; 34]. This is also the case for human PKC [35]. Figure 5 depicts the possible products arising from PKC alternative splicing [33; 36]. Splice sites 1 & 2 are shown. However, it is predicted that additional splice sites are possible. These additional splice site s may be involved in conferring additional stability for the mature RNA (unpublished observation). The stop codon in the PKC II exon prevents the PKC I exon from being translated (Fi gure 4 & 5). The intronic SRp40 binding site binds phosphorylat ed SRp40 (Figure 4). This splicing factor promotes PKC II exon inclusion [37; 38]. PKC V5 Domain Since PK I and PKC II are identical up to the V5 re gion, then it is logical that this domain distinguishes the two isoforms in terms of subcellular location (at rest and activated) and function, even within the same cell type [19]. A classic example was

PAGE 28

7 deciphered by the Cooper lab. In BC3H-1 my ocytes, insulin treatment induced the alternative splicing of the PKC II exon. Within 15 minutes of insulin treatment, basal PKC I was replaced by the PKC II isoform. It was hypothesized that PKC II, as opposed to PKC I, had a more significant role in glucose uptake. Subsequent overexpression of PKC II in NIH-3T3 cells resulted in enhanced insulin-stimulated glucose uptake [39]. PKC II s unique role was further confirmed by experiments utilizing a C-terminal truncated PKC II that acted as a dominant negative and pharmacologic inhibition via CGP53353 (a specific PKC II inhibitor). Both mutant PKC II and CGP53353 inhibited L6 skeletal mu scle insulin-stimulat ed glucose uptake [40]. Another example of diametrically opposed PKC isoform function is in A10 vascular smooth muscle cel ls (rat). Here, PKC I stimulates A10 growth while PKC II inhibits A10 growth [41]. Distinct locali zations are possible as well based on the V5 region. In cardiomyocytes, PKC I localizes to the cytosol and perinuclear region and translocates to the nucleus following PMA treatment. PKC II associates with fibrillar cytoskeletal structures at rest and translocates to the cell periphery and perinuclear region upon PMA treatment. Here, PKC II co-localizes with RACK1 [42]. The V5 region shows specificity in its substrate targets. For instance, PKC II activates PLD, whereas PKC I does not [19]. PKC Tissue Expression Select mammlian cells and tissues are liste d below (Table 1) to give a general overview of PKC isoforms expression (either mRNA or protein detection) [11; 12; 43; 44; 45; 46; 47; 48; 49; 50; 51; 52]. Dis tibution may vary between species.

PAGE 29

8 Table 1. PKC Isoform Ti ssue/Cell Expression PKC isoform Cell /Tissue I II / Brain + + + + + + ? + ? ? ? Central Nervous Tissue + + + + + + + + + + Heart + + + + + + + + + ? Small Intestine ? ? ? + ? ? ? ? + ? Kidney + + + + + ? + ? ? + Liver + + + + + ? + + + ? Airways Smooth Muscle + + + + + + + + + + Lung + + + + + + + + + + Neutrophil + + + + ? ? + ? ? ? Monocyte + + + + + + + + Macrophage + + + + + + + + Eosinophile + + + + + + + Platelet + + + + + ? + + ? ? TLymphocyte + + + + + + + ? ? ? BLymphocyte + + + + + + + ? ? ? Vascular Smooth Muscle + + + + + + ? ? + ? Retina + + + + + ? + ? ? ? Spleen + + + + + + ? ? + ? Testis + + + + + ? + ? + ? Ovary + + + + + ? + ? + ? Pancreas + + + ? + ? ? ? + ? Thymus + + + ? ? ? ? ? ? Fibroblast + + + + + ? + ? ? + Skeletal muscle + + + + + + + + + + Adipocyte + + + + + + + + + + +

PAGE 30

9 PKC Size [12] Table 2. PKC Isoform Size I II (L) Amino Acids 672 671 673 697 673 737 683 707 592 586 Daltons 76,7 99 76,79 0 76,93 3 78,36 6 77,51 7 83,47 4 77,97 2 81,57 1 67,74067,200 PKC Activation Newly translated PKCs are unphosphor ylated and associated with the cytoskeleton. Maturation (catalytic compet ence) must take place in order for PKC to translocate to the plasma membrane [53]. Before this maturation, interaction with the plasma membrane is very weak [19]. Using PKC II as a model, physiological stimuli initiate one of three phosphorylations nece ssary for catalytic competence (Figure 6). First, threonine 500 in the act ivation loop is phosphorylated by PDK1. This is the ratelimiting step in the processing of PKC [20]. This phosphorylation aligns the active site with the downstream sites. Next, Threonine 641 is phosphorylated in the proline-rich turn motif via mTORC2 [54; 55]. Phosphoryla tion at this site lo cks the protein in a catalytically competent, thermally stable a nd phosphatase-resistant conformation. Also, this phosphorylation may serve as a docking pad for protein interactions [20]. Based on the sequence surrounding this motif, 14-3-3 prot ein is speculated to bind. Lastly, the hydrophobic motif is autophosphorylated at Se rine 660 (S660). This hydrophobic site is the least conserved among PKCs. This phosphor ylation is not essen tial for function, but without it they have less ther mal stability and increased phosph atase sensitivity [20]. It should be noted that m ammalian t arget o f r apamycin c omplex 2 (mTORC2) is involved

PAGE 31

10 in PKC s intrinsic kinase activity by regulating phosphorylation of the turn motif which leads to autophosphorylation at the hydrophobic motif [21; 56]. Once the C-terminal serine and threonines are phosphorylated, PKC II assumes its mature conformation. Subsequent dephos phorylation at Threonine 500 (T500) would not alter its mature status. However, dephosphor ylation at the turn motif abolishes kinase activity. The three phosphoryla tion sites are conserved s uggesting most PKCs undergo similar processing. The exceptions would be aPKCs. The aPKCs have a glutamic acid instead of serine and threoni ne in the hydrophobic motif. PKC for example, T505 in the activation loop is not re quired because of the nega tive charge brought about by Glutamic acid at residue 500. Ultimately these phosphorylations are required for intracellular localizati on of PKCs [53]. In the traditional model of PKC activation, agonists promote phosphoinositide hydrolysis to produce DAG and IP3 generation which mobilizes calcium. Calcium, a soluble ligand, binds to the C2 domain to increase PKC s affinity for P hosphatidylS erine (PS). This interaction is relatively weak, however, once anchored to membranes the C1A domain interacts with DAG. The intera ction between C1A and DAG would not be possible if it were not for PS binding to C2 which disrupts an electrostatic C1A/C2 interdomain binding. The C1A domain now pe netrates the lipid bilayer to bind DAG. When both C1A and C2 domains are engage d with the membrane, the pseudosubstrate domain is expelled from the substratebinding pocket which facilitates full PKC activation [19; 57]. DAG is thought to induce membrane alterations (inverted miscelles) improving the hydrophobic interaction with proteins that can integrate with the plasma membrane [58].

PAGE 32

11 The traditional model of PKC activation was thought to be punctuated by cytoplasmic to plasma membrane translocation. However, this is no t the case with every PKC isoform. PKCs can be targeted to many intracellular locations for activation [53]. Again, using PKC II as an example, translocation to the plasma membrane is initiated by acute PLC-derived DAG accumulation. However, in cells that di splay a biphasic DAG response, catalytically active PKC II is released from the plasma membrane to go to the pericentron region (subset of recycling endosomes containing small GTPase Rab11) [59; 60]. Pericentronic localiza tion is due to PLD-derived DAG (Figure 7). PKC II at this location can control the trafficking of continuously recycling membrane signaling proteins such as caveolin-1. PKC II pericentron accumulation can be inhibited by PP1 (p rotein p hosphatase I ) stimulation via ceramide PP1 dephosphorylates PKC II at the activation loop [19]. A detailed overview of cPKC activation is shown in Figure 8. was inserted to remind the reader that mTORC2 doe s not constitutively phosphorylate PKC II in all cases. It has been shown in m ouse e mbryonic f ibroblasts (MEFs) that this is the case [54; 55]. However, our data concerning 3T3L1 adipocytes suggests that mTORC2 phosphorylation is mediated by insulin [52]. It has also been reported that in HEK293 cells, mTORC2 is activated via insulin stimula tion [61]. This would suggest that whether cPKCs are constitutively or agonist-induced phos phorylated depends on the cell type. As stated above, DAG can be produced by disparate mechanisms. De novo synthesis is one way DAG is induced (Fi gure 9). There are two main pathways for this biosynthesis. One is from glycerol -3-phosphate as a result of triacylglycerol mobilization. The other is use of dihydroxy acetone-3-phosphate, which is a glycolysis

PAGE 33

12 intermediate. These two precursors undergo several modifications. These include two acylation steps that give rise to l ysophosp hatidic a cid (LPA) and then phosphatidic acid (PA). PA can subsequently be transformed into DAG through PA p hosphohydrolases (PAPs) [58]. DAG production in response to stimuli has many facets (Figure10). Acute DAG is produced via agonist-induced hydrolysis of p hosphatidyli nositol 4,5bisp hosphate PIP2 by PLC. PLD-mediated hydrolysis of p hosphatidylc holine (PC) produces another type of DAG [53]. The initial DAG (PLC-dependent) is polyunsaturated and consists of the following three types; 1-s teroyl-2-a rachidonoyl-sng lycerol (SAG), 1-s teroyl-2-d oxosahexaaenoyl-sn-g lycerol (SDG) and 1-s teroyl-2e icosapentaenoyl-g lycerol (SEG) [62; 63; 64]. PKC is otypes are differentially activated by DAGs. SDG activates PKC and PKC most powerfully. PKC I is activated by SDG and SEG rather than SAG [53]. PLDderived DAG is monounsaturated or saturated [64]. Polyunsaturated DAG is frequen tly transient with sustained DAG being predominantly monounsaturated (generally sc -2 acyl group) [65]. To generate DAG, PLD hydrolyzes phosphatidylcholine to PA a nd choline. PA is a bioreactive lipid whereas choline is not thought to participiate in in tracellular signaling [66]. PLD-derived PA is further processed by p hosphatidic a cid p hosphohydrolases (PAPs) into DAG (1palmitoyl 2-oleoyl-sn-glycerol). DAG can be converted back to PA via phosphorylation by d iacylg lycerol k inases (DGKs). In addition, PA can be deacylated by phospholipase A2 (PLA) to form monoacylated LysoPA. Lyso PA can also be converted back to PA by lysophosphatidic acid acyltransferases (L PAAT) [67; 68]. PLA hydolization of phospholipids can also liberate free fatty acid s [12]. Fatty acids activate PKCs in an isotype-specific manner [53; 69]. PKC (along with and ) are activated by fatty

PAGE 34

13 acids with carbon lengths between C13 and C18 in vitro Cis unsaturated fatty acids including oleic, linolenic, arachadonic and docosahexaenoi c acids are all produced from phospholipids via PLA. These fatty acids allow PKC to exhibit almost full activity in the presence of Ca2+ concentrations less than 1 M. This effect is enhanced by the copresence of DAG [12; 70; 71]. PC can al so be converted to DAG by two other routes besides PLD-derived. One is a PC-PLC cat alyzed pathway that releases choline phosphate to produce DAG. The other is th e conversion of ceramide to sphingomyelin catalyzed by s phingom yelin s ynthase (SMS). SMS manufac tures sphingomyelin from phsophatidylcholine by catalyzing replacement of a glycerol molecular by ceramide, resulting in the release of DAG [58; 65]. The following table (Table 3) summarizes the main activators of the various PKC isoforms [12; 20; 72; 73; 74; 75; 76; 77; 78] (activation may vary across species and cell/tissue type): Table 3. PKC Isoform Activators I II (L) PS + + + + + + + + + + Ca2+ + + + + DAG + + + + + + + + FFA + + + + + + ? + + + LysoPC + + + + + + ? + + + Tyrosine phosphorylation can mediate PK C activation in the absence of PS. PKC I, , and can be tyrosine phosphorylated i nduced by hydrogen peroxide [79]. In skeletal muscle, PKC undergoes insulin-induced tyrosine phosphorylation (activation) directly via Src ty rosine kinase which leads to i nsulin r eceptor (IR) activation [80]. Almost all PKCs can be proteolytically cleaved at the V3 region by the calciumactivated protease calpain to produce a cofactor independent free catalytic subunit known

PAGE 35

14 as p rotein k inase M (PKM). Calpain exists as two di stinct isoforms that have a low ( ) and high (m) requirement for Ca2+, millimolar and micromolar respectively [43; 81]. Even though proteolysis is normally responsib le for PKC downregula tion, cleavage at the hinge region renders PKC constitutively active [82]. All PKCs except PKC contain PEST sequences (hydrophilic polypeptid e segments enriched in proline (P ), glutamic acid (E ), serine (S ) and threonine (T )) that target them for degradation by the ubiquitin/proteosome pathway. Dephosphorylation of actived PKCs predisposes them to this degradation pathway [43; 83; 84]. Oxidation is another way to regulate PKC activity. PKCs isolated from tissues have been shown to be oxidized by a va riety of agents including peroxide, Nchlorosuccinimide and periodate This oxidation requires Fe2+ and the resultant PKC is constitutively active. For oxidized cPKCs, Ca2+ and phospholipids are not required for this type of activation [43; 85]. Oxidati on can also negatively re gulate PKC activity. Nchlorosuccinimide and hydrogen peroxide reduce phorbol ester binding to PKC, indicating oxidation of the C1A domain [86]. Oxidation represents a unique type of regulation whereby initial oxi dation causes constitutive ac tivity and further oxidation causes inactivation [43]. Yet another mode of activity regulation is nitrosylation. PKC contains thiol residues which may serve as substrates for S-nitrosylation. PKC disulphide bridge formation following nitrosylated thiols resu lt in irreversible inactivation and loss of phorbol ester binding. S-nitrosylation also pr events calpain access to PKC [43; 81; 87; 88]. It was reported that 100 M peroxynitrite leads to ty rosine nitration of PKC II and PKC [89].

PAGE 36

15 Steroid hormone binding has also been s hown to activate certain PKC isoforms. The C2 domain of PKC binds aldosterone whereas the C2 domain of both PKC and PKC bind 17 -estradiol. Both interactions re sult in PKC activation [90]. PKCs , and are activated by 1 ,25-dihydroxyvitamin D3. In this instance, the C1 domain (most likely the zinc fingers) is responsible for bi nding, not the C2 domain. This interaction mediates a steroid hormone ra pid “non-genomic” response [91]. PKC Intracellular Distribution The traditional model of PKC subcellular localization comes from studies of PKC In this model, PKC is cytosolic in the basal state. Upon activation, it translocates to the plasma membrane. Howeve r, this is an oversimplification since PKC isoforms are not restricted to these two compartments. As mentioned above, PKC II translocates from the plasma membrane to the pericentron in a biphasic manner [19]. PMA induced ceramide (formed from the salv age pathway) prevents translocation of PKC II to the pericentron (a.k.a. juxtanuclear compartment) [92]. PKCs can also translocate to specialized membrane compartmen ts such as lipid raft s or caveolae. Lipid rafts and caveolae contain sphingolipids, chol esterol, saturated fa tty acids and signaling proteins. The differences between the two are that lipid rafts do not contain caveolin and caveolae do not contain glycosyl-phosphatidylin ositol-anchored proteins. Caveola form flashlike invaginations in the PM by oligomer ization and association with lipid rafts. Caveola are detergent-resistant as opposed to lipid rafts. PKC and PKC exert their signaling effect through these domains. PKC is involved in ceramide production. Ceramide is formed in lipid rafts an d is involved in raft fusion. PKC activates a cid s phingom yelinase (ASM) which hydrolyzes sphingol myelin to ceramide [93; 94; 95].

PAGE 37

16 This ceramide accumulation at the plasma memb rane leads to recruitment and activation of PKC [96]. Several cell lines have cPKCs and nPKCs (both activated and resting) recovered in the caveolae fr action [19; 97; 98]. The Golgi complex is another area where PKC can localize. For example, PKC and PKC (both ceramide activated) induce apopto sis from the Golgi [99; 100]. PKC modulates secretion (via binding to RACK substrate) from the Golgi complex [19; 101]. I nterl eukin-3 (IL-3) treatment has b een shown to induce PKC I and PKC II nuclear localization in hematopoi etic cells [102]. PKC localizes to the ER, nuclear membrane and the Golgi upon PMA treatment and serum starvation [103]. PKC activated by phorbol esters causes mitochondr ial translocation from the cytoplasm, which causes cytochrome c release and subsequent apopt osis in human U-937 myeloid leukemia cells [104]. Lastly, PKC II can localize to the cytoskeleton (F -actin) which in turn increases its autophosphorylation [105]. Clearly, PKC intracellular lo calization is dependent on many factors including isoform, cell type, agonist treatment, et c. Therefore, their direct effect (as well as indirect) w ould seem to extend to nearly every intracellular organelle. PKC Anchoring Proteins and Substrates The first anchoring protein discovered th at could localize PKC near its intended substrate was RACK1 (R eceptor for a ctivated C k inase 1). RACK1 specifically binds activated PKC II with a Kd of 1nM in vitro This binding specifici ty is due to the V5 region (as well as the C2 domain) of PKC II which differs from PKC I (as mentioned above). However, RACK1 is not a substrate for PKC II. This interaction allows for proper localization and targeting of the substrate [106; 107; 108; 109]. An example of altered subcellula r localization would be TCDD (2,3,7,8-T etrac hlorod ibenzop -d ioxin)

PAGE 38

17 activation of RACK1 in cereb ellar granule cells. This activation causes RACK1-PKC II association and subsequent PKC II translocation from the cytosol to membrane fraction [110]. Another important example of PKC II-RACK1 interaction that has implications for insulin signaling is found in CHO cells. Here, PMA or dopamine D2 receptor agonist induced PKC II activation causes its associati on with RACK1 and subsequent translocation to the Golgi apparatus. Th is movement is inhibited by PLC inhibitor ET18OCH3 [111]. As mentioned above, PLC is needed to generate DAG and IP3 (inositol triphosphate) for PKC activation. An example of a PKC II substrate would be lamin B. During proliferative stimuli in human promyelocytic (H L60) leukemia cells, activated PKC II (via n uclear m embrane a ctivation f actor (NMAF)) transloc ates to the nucleus and phosphorylates lamin B which leads to mitotic nuclear enve lope membrane breakdown [112]. Recently, PKC II was shown to phosphorylate substrate MARCKS (m yristoylated a lanine-r ich C k inase s ubstrate), perpetuating skel etal muscle cell ISGT (i nsulin-s timulated g lucose t ransport) [113]. An example for PKC II that would include both the anchor and substrate comes from cardiac myoctes. Here, activated PKC II translocates from the cytosol to the plasma membrane as well as the perinucleus where it binds RACK1. This association brings PKC II near the L-type calcium channels where it can phosphorylate and inhibit the channel [114; 115]. Regulati on of L-type calcium channels is important for insulin release from pancreatic islet cells [116].

PAGE 39

18 Anchoring proteins regulate PKC distribution but do not necessarily have to bind activated PKCs. Unphosphorylated, phosphoryl ated but inactive a nd phosphorylated and active PKCs are all targets. RACKs may bind active phosphorylated PKCs, but CG-NAP anchoring protein binds and localizes newly synthesized ( unphosphorylated) PKC to the Golgi/centrosome [117]. AKAP (A K inase A nchoring P rotein) position phosphorylated inactive PKCs near the s ubstrate [118]. STICKs (S ubstrates T hat I nteract with C K inase) bind phosphorylated inactive PKCs and then release them following their phosphorylation [119]. PICK1 (P rotein I nteracting with C K inase 1 ) has been shown to bind activated PKC positioning it for eventual phos phorylation of GluR2 (AMPA-type glu tamate r eceptor subunit 2 ) which results in GluR2 releas e from synaptic anchors and in receptor transport from th e synaptic membrane [120]. PKC Promoter Much of the knowledge of PKC promoter comes from the work of Hannun lab. Here, up to 2200 bp upstream of the human transc riptional start site was analyzed. The region near the start site is very GC-rich (>80%) and lack s identifiable TATA or CAAT boxes. TATA and CAAT elements are found further upstream at -530 and -395, respectively. This is reverse of the normal order. The most important area for promoter activity was -111 to -40. Some of the factors identified in this study are included in the following table (Table 4):

PAGE 40

19 Table 4. PKC Promoter Transcription Factors Factor Binding site PKC promoter location Oct BP ATGCAAAT ATGCAAAT (-76) Sp1 GGGCGG GGGCGG (-94,-63) E12/47 GCAGGTGG GCAGCTGG (-110, -26, +18) AP2 CCCCACCCC CCCCACCCC (-330) CTF/NF-1 GCCAAT CCAAT (-395) AP1 TGAGTCA TGAGTGAC (-442) TFIID TATAAA TATAAA (-530) Another important discovery is that phorbol esters tr anscriptionally up-regulate the PKC promoter (basal promoter element) in K562 erythroleukemia cells. Upregulation of the PKC promoter may be a way for phorbol esters to relieve the negative regulation that they have on PKC protein down-regulation [121]. The PKC promoter and its regulators need more illumination. Th is is especially paramount given that a functional PKC promoter polymorphism in humans ha s been linked to insulin resistance with reduced expression of PKC II [122]. PKC Inhibitors PKCs are attractive targets for therapeutic intervention given their various cellular roles. However, the plethra of intera cting proteins and many secondary messenger systems coupled with cellular and tissue-sp ecific variability for each PKC isozyme renders specific drug targeting difficult. The following table (Table 5) from Twelves et al. represents the main PKC inhibitors in use today [14]:

PAGE 41

20 Table 5. PKC Inhibitors Drug Class Admin Specificity Status PMA Phorbol ester Intravenou s Non-specific PKC activator; in a phase I trial in haematological malignancy Staurosporine Indolocarbazole Intravenou s Poor specificity, inhibits other Ser/Thr and Tyr kinases Preclinical PKC412 (midospaurin) Indolocarbazole Oral PKCs , , : also inhibits Tyr pathways Potentiates treatment with doxorubicin or vinblastine; in phase II trials UCN01 Indolocarbazole Intravenou s cPKCs>nPK Cs Potentiates treatment with cisplatin, mitomycin C, camptothecin or 5FU; in phase II trials Go6976 Indolocarbazole Intravenou s cPKCs>nPK Cs Byrostatin 1 Macrocyclic lactone Intravenou s Activates cPKCs & nPKCs Acts as antagonist in presence of agonist Potentiates treatment with cytosine arabinoside, paclitaxel, tamoxifen or vincristine Tamoxifen Nonsteroidal anti-oestrogen Oral PKCs , non selective Bisindoylmalei mide Indolocarbazole Oral PKC Used in treatment of diabetic retinopathy LY317615 (enzasautaurin) Indolocarbazole Oral PKC Potentiates treatment with gemcitabine, 5FU, cisplatin or radiotherapy ISIS3521 (aprinocarsen) Antisense oligo Intravenou s PKC Phase I and Phase II trials ISIS9606 Antisense oligo Intravenou s PKC Not developed further in clinic Other pertinent drugs incl ude Ruboxistaurin (LY333531) which is a macrocyclic bisindolymaleimide drug developed by Eli Lill y being being tested for use as therapy in

PAGE 42

21 diabetic macular oedema and other diabetic angiopathies, including diabetic retinopathy, diabetic peripheral neuropathy and diabetic nephropathy [123]. It is a competitive reversible inhibitor of PKC [124]. LY379196 is an anal og of LY33531 which will be used in studies detailed in the RESULTS section. The following table (Table 6) represents the IC50 spectrum for LY379196 [125]: Table 6. LY379196 Inhibitor IC50 Spectrum Enzyme IC50 ( M) PKC 0.6 PKC I 0.05 PKC II 0.03 PKC 0.6 PKC 0.7 PKC 5 PKC 48 PKC 0.3 Cyclic AMP Kinase >100 Ca2+ -calmodulin Kinase 5 Casein Kinase >100 Src Tyrosine Kinase 4.4 The other PKC inhibitor used is CGP 53353 (4,5-Bis(4-fluoroanilino)phthalimide) synthesized by Novartis. It is a selective inhi bitor of both E pidermal G rowth F actor R eceptor (EGFR) as well as PKC II. The following table represents the IC50 spectrum for CGP53353 [126]:

PAGE 43

22 Table 7. CGP53353 Inhibitor IC50 Spectrum CGP53353 IC50 ( M) EGF receptor intracellular domain 0.7 v-abl kinase >50 c-src kinase 50 c-lyn kinase >150 c-fgr kinase >150 Csk >100 TPK-I1B kinase >150 Cyclic AMP-dependent protein kinase >500 Phosphorylase kinase >500 Protein kinase CK-1 >200 Protein kinase CK-2 >200 Cdc2/cyclin B >10 PKC 1.9 PKC I 3.8 PKC II 0.41 PKC 22 PKC >500 PKC >500 PKC >500 PKC >500 The Mochly-Rosen lab has been working on drugs that disrupt protein interaction domains. First generation drugs were short peptides that bound to specific PKC RACKs to disrupt anchoring and subsequent func tion of PKC isozymes. Second generation peptide design inhibits PKC binding to its subs trate. This is expected to block the function related to phosphoryla tion of that substrate withou t affecting PKC translocation, binding to RACK or phosphorylation of anot her substrate. These peptides are 6-10 amino acids long and are derived from one of the interacting domains thereby blocking the association of two proteins. Even though the binding surface for PKC is large and flat, these peptides are highly selective and e ffective. They serve as potential drugs in treating human disease [26].

PAGE 44

23 Glucose Transporter 4 Glucose is a fundamental source of energy for eukaryotic cells [127]. It is the precursor for the synthesis of glycoprotei ns, triglycerides and glycogen as well as providing an important source of energy by ge nerating ATP through glycolysis. Glucose is polar so it does not readily cross the hydrophobic plasma membrane. Therefore, specialized carriers are needed to bring glucose into the cell [128]. The uptake of glucose into a cell involves a family of transport proteins called GLUTs (glu cose t ransporter) which shuttle sugar across th e cell surface [127]. GLUT4 is the major insulin-responsive glucose tran sporter. GLUT4 is highly expressed in striated muscle and adipose tissue. It is responsible for postprandial removal of glucose from the circulation [127; 129]. In the basal stat e, GLUT4 slowly but continuously cycles between the plasma membrane and other intrac ellular compartments. Only 5% of total GLUT4 is localized at the plasma membrane in the basal state. Insulin treatment (or exercise in the case of skeletal muscle) induces an acute response where within 2-3 minutes, GLUT4 exocytosis dramatically incr eases concomitant with a small decrease in endocytosis. At this point, 50% of the GLUT4 have been relocated to the plasma membrane. Removal of the insulin signal subs equently decreases the rate of exocytosis and the trafficking of GLUT4 returns to basa l status [127; 129; 130; 131]. Exocytosis and endocytosis occur without the need fo r continuing protein synthesis [132]. I nsulins timulated g lucose t ransport (ISGT) due to i rregularities in GLUT4 trafficking is severely disrupted in type 2 diabetes [130]. GLUT4, like other GLUTs (13 known), is a 12 transmembrane domain-containing protein [133]. Figure 11 shows GLUT insertion structure in the plasma membrane [127].

PAGE 45

24 GLUT4 is widely dispersed to many organell es throughout the cell. These include the plasma membrane, sorting endosomes recycling endosomes, the TGN ( t rans -G olgi n etwork) and vesicles that mediate th e movement of GLUT4 between these compartments [127]. Molecular regulation of GLUT4 via insulin involves several discrete steps (Figure 12) [134]. The first step would be biogenesis of G LUT4 s torage v esicles (GSVs). This is where the majority of GLUT4 is found and where the majority of GLUT4 translocates following insulin treatment (ske letal muscle and 3T3-L1 adip ocytes) [135]. The second step would be translocation. Translocation is thought to i nvolve cytoskeletal elements such as actin and microtubules [134]. In 3T3-L1 adipocytes, cortical actin remodeling/polymerization and well as actin co met tailing (representative of actin-based motility) on GLUT4-containing vesicles was cri tical for insulin-stimulated translocation [136; 137]. Also in 3T3-L1 adipocytes, the kinesin motor (moving toward plus end [plasma membrane] of microtubule) was crit ical for GLUT4 translocation [138]. The third step is tethering. This is a low-affinity interaction between GSVs and the plasma membrane arbitrated by a tether ing complex [134]. Tethering i nvolves what is referred to as the “exocyst complex.” This complex is responsible for the initial interaction of GLUT4 vesicles with the plasma membrane in 3T3-L1 adipocytes. Exo70, Sec6 and Sec8 are some of the recently identified com ponents of the exocyst complex [139]. The fourth step is docking. This is the assembly of the trans SNARE (s oluble N ethylmalemide-sensitive factor a ttachment p rotein (SNAP) Re ceptor) complex. It is the final committed step before fusion between GSVs and the plasma membrane [134]. In 3T3-L1 adipocytes, VAMP2 (v esicle-a ssociated m embrane p rotein 2 ) and

PAGE 46

25 VAMP3/cellubrevin represent v-SNARE protei ns (protein complexes in the vesicle compartment) and syntaxin 4 represents tSNARE proteins (recept or complex at the plasma membrane) [140]. The fifth step is fusi on. This is where the lipid bi-layers of the GSV and the PM amalgamate [134]. Frohman et al. has shown that activated PLD1 (p hosphol ipase D 1 ) plays a rate-limiting step in insulin-stimulated fusion of GSVs with the PM in 3T3-L1 adipocytes [141]. Corr oborating this finding is the observation that PA (product of PLD1 mediated hydrolysis ) serves as an anchor for mammalian components of the SNARE complex [142]. PA has also been purported to act as a fusogenic lipid by lowering the activati on energy for membrane bending during generation and expansion of fusion pores [ 143]. PA is also capable of activating phosphatidylinositol 4-phosphate 5-kinase thereby increasing the levels of phosphatidylinositol 4,5-bisphosphate, critical for exocytosis [141]. In L6 skeletal muscle cells, insulin-stimulated PKC II causes retention of PLD1 at the PM and subsequent fusion of GLUT4 [ 113]. GLUT4 can translocate and fuse with both caveolae and non-caveolar lipid ra fts [144]. The sixth step is endocytosis [134]. GLUT4 has been shown to be internalized via c lathrin-m ediated e ndocytosis (CME). This has been demonstrated in 3T3-L1 adipocytes and L6 myotubes [132]. Inte restingly, caveolae associated GLUT4 internalized faster than noncaveolar lipid raft af ter removal of insulin [144]. 3T3-L1 adipocytes have been used as th e gold standard for GLUT4 trafficking. In these cells, GLUT4 is mostly located in the perinuclear region a nd the cytoplasm to a lesser extent [134; 145]. Insu lin induces a 10-fold increase in glucose uptake. Rat adipocytes have an even greater response ( 20-fold increase in glucose uptake) whereas

PAGE 47

26 human adipocytes only respond with a 2-3 fold increase in insulin-stimulated glucose uptake. In L6 myotubes (the only skelet al muscle cell line that expresses GLUT4), GLUT4 is expressed mostly in perinuclea r regions as well as being dispersed along discrete bodies in the cytosol. Insulin induces a 2-fold increase in glucose uptake in this cell line [145]. In 3T3-L1, as mentioned above, most GLUT4 reside in GSVs near the TGN. Even before GLUT4 is expressed in differe ntiated adipocytes, th ere is a reservoir compartment (what will eventually be the GSV). A protein called i nsulin-r esponsive a minop eptidase (IRAP) is localized to this st orage compartment and has very similar trafficking to that of GLUT4. Once GLUT 4 is expressed, it enters this storage compartment [130]. Regardless of whethe r insulin stimulation has occurred or not, GLUT4 and IRAP are not retained at th e plasma membrane. They are rapidly internalized with half ti mes of 3-10 minutes [130; 146]. GSV formation requires G olgilocalized -ear-containing A rf-binding protein (GGA) in order to sort GLUT4 from the TGN [147]. Sortilin (also pa rt of the TGN and endosomal membrane) is also necessary for GSV formation as well as for GLUT4 prot ein stability [148]. Sortilin most likely serves as the cargo adaptor linking GLUT4 to GGA coated transport vesicles. Sortillin does this by binding to GGA s VHS cargo-binding domain with its VHS consensus binding motif (DxxLL) [129]. In differentiating adipocytes, sortillin is expressed prior to GLUT4 [148]. The GLUT4 N-terminal FQQI domain and C-terminal LL domain are both required for proper trafficking of GLUT4. The FQQI domain is important in transferring GLUT4 away from the endosome system [149]. The LL domain is important in shuttling

PAGE 48

27 GLUT4 between the TGN and GSVs [150]. Both domains are required for proper endocytosis [130]. Traffick ing steps of GLUT4 can be summarized by Figure 13 [130]. It is important to note that the p erinculear r eticular G LUT4 s torage c ompartment and d ispersed v esicular G LUT4 s torage c ompartment are further sub-cl assifications of GSVs. It is also noteworthy to point out th at v-SNARE VAMP2 (i n addition to IRAP) colocalizes with GLUT4 in PR-GSC. The ratio between the two proteins is kept fairly constant in the DV-GSC. This would suggest a role for VAMP2 in direct fusion with the PM [151]. aPKCs have been suggested to serine phosphorylate VAMP2, possibly localizing GSVs at sites of actin remode ling and subsequent PM insertion [152]. Figure 13 is not a hundred percent accepted model. There are two main models concerning GLUT4 storage and cycling in 3T 3-L1 adipocytes [153]. Model 1 (which more closely resembles Figure 13) assert s that GLUT4 from every compartment eventually reaches the PM in the basal state, GLUT4 intracellular storage is dynamic and that GSV is distinct from the transferrin-posi tive TGN [154]. Model 1 also asserts that insulin promotes two routes for GLUT4 mobilization towards the PM. The direct route comes from the GSV. The indirect route goes from the GSV to the ERC to the PM [153]. The two routes possible to get to the PM are supported by the presence of VAMP2 in insulin-dependent GLUT4 recycling [140; 155]. Model 2 proposes that only a fraction of GLUT4 reaches the PM in the basal state, th at insulin increases GLUT4 amount available for translocation, and that part of the tr ansferrin receptor nega tive GLUT4 compartment interfaces with the TGN [156]. Increasing in sulin causes more GLUT4 to accumulate at the non-cycling pool, which is then transloc ated to the PM through a single exit route (GSVs to PM). The non-cycling pool contai ns few “latent GLUT4 molecules” which are

PAGE 49

28 not mobilized in response to insulin. It is hypothesized that these latent GLUT4 molecules are synthesized early in cellular life and exhibit non-insulin responsiveness [157]. The main differences between the two models are the extent to which GLUT4 recycles in the basal state, the presence of a static/latent pool of GLUT4, the TGN being a storage site for GLUT4 and the number of routes insulin-stimulated GLUT4 can take to get to the PM [153]. Akt Protein Kinase B (Akt) belongs to a family of ubiquitously expressed serine/threonine kinases that was discovere d by cloning using a probe specific for PKA [158]. Akt shares 65% homology with PKA and 77% homology with PKC. Three mammalian isoforms exist, (1), (2), (3) (Figure13), which are products of different genes [159]. The three isoforms shar e 90% homology between each other [160]. All three isoforms contain an N-terminal PH domain, which is a roughly 100 amino acid domain that can bind phospha tidylinositol lip ids (e.g. PIP2) as well as PKC and other proteins during signaling [161] Downstream of the PH do main is the catalytic domain and finally the C-terminal domain [159]. Rat Akt3 contains a truncated C-terminal domain whereas human Akt3 contains a full-length C-terminal domain [160; 162]. Akt was identified as an oncogene earl y on. First, Akt1 amplification was detected in gastric adenocarcinoma [163]. It was then shown that Akt2 was amplified in two ovarian carcinoma cell lines [164]. The breakthrough in Akt research came using the PI3K inhibitor, wortmanin. This led to th e discovery that Akt was a downstream target of PI3K activated by PDGF and EGF [165; 166]. The lipid-bindi ng PH domain of Akt was essential for this PI3K-m ediated activation in response to these ligands [166].

PAGE 50

29 Binding of the PH domain to lipids is not th e only way Akt is activated. Phosphatase inhibitor experiments showed that Akt activity was controlled by reversible phosphorylations on both serine and threon ine residues [167]. The next step was showing that insulin stimulation resulted in Akt phosphorylation at residues T308 and S473 [168]. At this point, complete Akt ac tivation necessitates lipi d binding via the PH domain as well as phosphorylation by at least one upstream kinase. Previous observations indicate that Ak t kinase activity requires PI 3K and that Akt is potently activated by products of PI3K, PIP2 and PIP3. This led to the discovery of PDK1 (3p hosphoinositide-d ependent protein k inase 1 ) [169]. This ended up being the kinase which is responsible for phosphorylation of Akt at T308. However, the kinase responsible for phosphorylating Akt on S473 has remained controversial and only recently been proposed (mTORC2). Mutation of either T308 or S473 in Akt1 does not prevent the other residue from being phosphoryl ated in response to insulin, suggesting the phosphorylations can occur independently [170]. Akt phosphor ylated at only the PDK1 site has 10% of the act ivity compared to when it is phosphorylated at both T308 and S473 [171]. However, the threshol d of activity required for substrate phosphorylation may differ so that Akt phosphor ylated at only T308 may be sufficiently active to phosphorylate certain targets [172]. Figure 15 illust rates the mechanism of Akt activation [57; 169; 173; 174; 175]. A cont roversial additional pathway for Akt activation has been proposed for skeletal musc le cells. In this two-step model for Akt activation, insulin trigge rs the assembly of -arrestin-2, c-Src and Akt. This allows c-Src to phosphorylate Akt on Tyrosine 315 (Y 315) and Y326 which is required for downstream phosphorylations of Akt at S473 an d T308. This may not apply to fat cells

PAGE 51

30 because in muscle and liver, but not fat, -arrestin-2 expression is reduced ~50% in insulin-resistant an imal models [176]. As with any kinase, there is a mechanism to tu rn it on as well as one to turn it off. Recently discovered PHLPP proteins put the brakes on Akt and PKC activation. PHLPP is a Ser/Thr-specific phosphatase (PH domain l eucine-rich repeat p rotein p hosphatase). Once Akt is phosphorylated, its activity no long er relies on secondary messengers. In contrast, PKC is only active when bound to DAG. Dephosphorylation of PKC would promote degradation [177]. PHLPP1 a nd PHLPP2 specifically dephosphorylate the hydrophobic motif (S473) of Akt, resulting in decreased activity. PHLPP needs the PDZbinding motif in order to accomplish this dephosphorylation [177]. PHLPP1 and PHLPP2 dephosphorylate the hydrophobic motif of cPKCs and nPKCs but not aPKCs because they contain a Glutamic acid at this position [171]. As alluded to earlier, cells deficient in the mTORC2 complex have decreased PKC phosphorylation at the hydrophobic motif which suggests that this co mplex contributes to phosphorylation of PKC at this site [178]. This possibly puts PHLPP in opposition of mTORC2 [177]. There is abundant evidence that Akt play s a role in insulin-dependent glucose disposal by directing GLUT4 vesicles to the PM. Initially it was reported that insulin rapidly and persistently activates Akt in tradi tional target tissues such as muscle and fat [179]. The connection between Akt and insulin s metabolic actions was firmly established when constitutively active Akt mimi cked insulin in eliciting high levels of glucose transport and GLUT4 translocation in ad ipocytes in the absence of insulin [180]. More specifically, insulin causes Akt associa tion with GLUT4 vesicles in rat adipocytes which results in phosphorylation of associated proteins [181; 182]. Suspected proteins

PAGE 52

31 phosphorylated by Akt include sortilin and SCAMPs (s ecretory c arrier-a ssociated m embrane p roteins) which are involved in membra ne trafficking and fusion of GLUT4 [182]. SNARES are also thought to be an im portant Akt substrate [183]. Inhibiting Akt activity by antibodies, substrate peptides a nd dominant-negative constructs partially blocks insulin-stimulated GLUT4 transloc ation in fat and muscle [184; 185]. Insulin is responsible for a host of outco mes, besides glucose homeostasis, that are mediated at least in part via Akt. For instance, insulin mediat es vasodilation of blood vessels promoting peripheral tissu e glucose disposal [186]. Akt is able to exert its effect here by phosphorylating/activa ting endothelial nitric oxi de (NO) synthase, thus increasing NO production [187]. Insulin mediates protein synthesis in mu scle and fat cells by enhancing initiation and elongation steps in protein translation. Evidence suggests that Akt modulates the activity of translational com ponents [179]. Constitutively active Akt increases protein synthesis in L6 muscle cells and 3T3-L1 ad ipocytes [188; 189]. Insulin-stimulated protein synthesis is blocked by dominant inhi bitory Akt mutant in 3T3-L1 adipocytes [190]. Lipogenesis (converting incoming sugar to fa tty acids) is an insulin regulated event. Akt is thought to play a crucial role by inhibiting GSK-3 (g lycogen s ynthase k inase 3 ). GSK-3 normally phosphorylates ATP citr ate lyase (decreasing its activity), an enzyme that catalyzes the conversion of c itrate and CoA to acetyl-CoA and oxaloacetate in the cytosol. This step is a major source for the biosynthesis of fatty acids, cholesterol and acetylcholine [191]. In addition, Akt also increases the transcription of fatty acid synthase, an enzyme that catalyzes seve ral steps converting malonyl-CoA and acetyl-

PAGE 53

32 CoA to long-chain fatty acids [192]. Constitu tively active Akt has been shown to induce high levels of lipogenesis in quiescent 3T3-L1 ad ipocytes [193]. At the same time Akt is turning on genes for lipogenesis, it has been repo rted to help block li polysis in adipocytes by inhibiting h ormone-s ensitive l ipase (HSL). HSL is activated by PKA phosphorylation, and PKA activity is activated by cAMP. Use of a dominant-negative mutant as well as constitutively active kinase showed Akt reduces cAMP concentrations by stimulating cyclic nucleotide phosphodi esterase PDE-3B via phosphorylation [193; 194]. Insulin promotes glycogen synthesis from th e glucose that is driven into the cell. It does this by activating g lycogen s ynthase (GS) which adds glucosyl groups to growing polysaccharide chains, which is the final step in glycogen synthesis. Akt is able to exert its effect on this pathway. GS is ne gatively regulated by C-terminal serine phosphorylations by GSK3. Akt is able to i nhibit GSK3, thus relieving the inhibitory phosphorylation and activating GS [179]. In adipocytes, a GSK3 mutant that is insensitive to Akt results in insulin-stim ulated GS suppression [195]. Similarily, constitutively active Akt in L6 skeletal mu scle dramatically blocks GSK3 activity and can activate GS without insuli n. In the same cells type, dominant-negative Akt resulted in over 50% inhibition of insulin-st imulated GS activation [189; 196]. Blood sugar levels are maintained by in sulin through promotion of glucose uptake as well as suppressing hepatic glucose output. The liver is the main organ to respond to insulin in terms of reducing its glucose produc tion. Akt is thought play a role here by suppressing glycogenolysis but pr omoting glycogen synthesis ( likely similar to skeletal muscle and fat). Akt may exert influence on PEPCK (p hosphoe nolp yruvate

PAGE 54

33 c arboxyk inase) and G6Pase (g lucose-6 -p hosphatase ). PEPCK catalyzes the early committed step in gluconeogensis and G6Pase regulates the terminal step for both gluconeogenesis and glycogenolysis before glucose is released from the liver. There is still controversy as to whether Akt really inhi bits these genes [179]. Very recently, Akt activation was shown to stimulate APPL1 (A daptor protein, p hosphotyrosine interaction, P H domain and l eucine zipper containing 1 ), which potentiates insulin-stimulated inhibition of hepatic glucose output [197]. In 3T3-L1 adipocytes, th e interaction of Akt with APPL1 is required for insulin-stimula ted GLUT4 translocation, even though insulin causes their disso ciation [198]. A role for Akt in pancreatic cells has also been proposed. This is because pancreatic regeneration is a ssociated with an increase in IRS2 and activated Akt in proliferating duct cells [199]. Ov erexpression of active Akt1 in cells of transgenic mice leads to a significant expansion of -cell mass (cell number and cell size) [200]. Insulin signaling via PI3K and Akt was critical in preventing ER stress and thus cell dysfunction [201]. As if Akt did not do enough, it has also recently been implicated (Akt1) in adipocyte differentiation [202]. Figure 16 summ arizes the pivotal role Akt plays across various tissues [179]. Physiological relevance of Akt in insulin resistance, and thus T2DM, extends beyond cell culture. Akt activity has been found to be reduced in adipocytes [203] and muscle [204] obtained from T2DM patients However, there have also been antagonizing reports that Akt activity is norma l from diabetic muscle tissue where PI3K activity is reduced [205]. These contradictory findings ha ve also been reported in rodent

PAGE 55

34 models of obesity and insulin resistance [179] Mice with adipocyte insulin resistance had been found to have reduced IRS and PI3K ac tivity but normal Akt activity [206]. In Zucker rats that were insulin resistant obese activation of PI3K was much more impaired than either Akt1 or Akt2. In adipocytes, Akt2 activation actually increased slightly [207]. Etiology of T2DM is not well understood and this may have something to do with the heterogeneity of results. However, target ed disruption of Akt2 (expressed highly in muscle and fat) in mice presents a phe notype resembling human impaired glucose tolerance [208]. Akt2 knockout mice displa y severe impairment in whole-body glucose disposal [179]. Interestingly, Akt1 knockout mice do not display insulin resistance [209]. This suggests distinct physiological roles for different Akt isoforms. Akt can regulate alternative splicing by acting as an SR protein kinase and directly phosphorylating the RS domain [210]. This has a ma jor impact on the insulin signaling cascade as Akt can phosphoryl ate SRp40 [211] thus regulating PKC alternative splicing. Akt can also regula te other SR kinases such as Clk/Sty (C DC-l ike k inase 1 ) (LAMMER family of protein kinases) givi ng it an even broade r role in insulinmediated alternative splicing [212]. Insulin Signaling and Involveme nt of PKC, GLUT4 and Akt To give a broad general overview, in sulin signaling involves two distinct branches. One defined by the Rho-family GTPase TC10 (also referred to as CAP/Cbl pathway) and the other by p hosphatidyli nositol 3 -k inase (PI3K) [213] Briefly, the i nsulin r eceptor (IR) is a member of the family of transmembrane recep tors with intrinsic tyrosine kinase activity [214]. Some or all of the insulin receptor is constitutively bound to lipid rafts [215]. The mature IR is composed of two extra-cellular and two

PAGE 56

35 transmembrane -subunits disulfide linked into an 22-heterotetrameric structure [216]. Alternative splicing gives rise to two IR isoforms, IR-A and IR-B [216]. IR-A is expressed in the developing fetu s as well as adult pancreatic -cells, whereas IR-B is expressed in adult muscle, adipose and liver. IR-A is regulated by IGF-II (i nsulin-like g rowth f actor-II ) whereas IR-B is regulated by insulin. Insulin binds to the extracellular -subunits which induces a conformational cha nge that allosterically regulates the intracellular -subunit tyrosine kinase domain. Ensu ing is a series of intermolecular trans-autophosphorylations generating multip le phospho-tyrosine sites [133; 216]. Tyrosine phosphorylation at th e juxtamembrane Y960 is required for binding IRS1-4. This is important for propagating the insu lin signaling cascade. Phosphorylation at Y1146, Y1150, Y1151 in the kinase activati on domain relieves pseudosubstrate inhibition further enhancing the tyrosine kinase activity [216]. Other scaffolding proteins recruited to the IR are Gab1, Shc, SIRPS, Cb l and APS [133]. IRS2 knockout cells show a major defect in insulin-stimulated glucose tr ansport [217]. IRS is ab le to bind IR via its C-terminal PH domain and p hosphot yrosine-b inding domain (PTB) [218]. This facilitates binding to PI3K, which has a pivotal role in metabolic and mitogenic actions of insulin and IGF1 [219]. Because of PI3K s crucial role in propagating the insulin signaling pathway, it deserves further digression. PI3Ks catalyze the transfer of the -phosphate of ATP to the D3 position of phosphoinositides. PI3Ks can be grouped into th ree classes based on substrate specificity [220]. Only class I PI3Ks have been shown to activate Akt in cells. In cells, class I PI3Ks prefer PtdIns(4,5)P2 as a substrate. The resulting PtdIns(3,4,5)P3 can then go on to give rise to PtdIns(3,4)P2 via 5 inositol phosphatases. Cla ss I PI3Ks are heterodimers

PAGE 57

36 made up of a roughly 110 kDa cat alytic subunit (p110) and an ad aptor/regulatory subunit. Class I PI3Ks that bind tyrosine kinases and heterotrimeric G-protein coupled receptors are referred to as Class IA and Class IB PI 3Ks respectively. Class IA PI3Ks are diverse with three catalytic p110 isoforms (p110 p110 and p110 each encoded by different genes) and seven adaptor proteins (generated by alternative splicing of three genes: p85 p85 and p55 ) [170]. The p85 adapter subunit, starti ng from the N-terminus, contains a S rc h omology 3 (SH3) domain, a b reakpoint-cluster-region h omology (BH) domain flanked by two proline-rich regions and two C-terminal SH2 domains spaced by an i nterSH2 (iSH2) region. The iSH2 mediates tig ht binding between p85 to the catalytic subunit [221; 222; 223]. The catalytic subunit po ssesses intrinsic serine kinase activity. The regulatory subunit p85 S608 can be phosphorylated by the p110 catalytic subunit which reduces lipid kina se activity [224]. P110 can not phosphorylate regulatory subunits but can undergo autophosphoryaltion [ 224]. As far as insulin stimulation is concerned, class IA PI3K activation is acco mplished by translocation to the plasma membrane and binding with its two SH2 domain s (one N-terminal, the other C-terminal) to tyrosine-phosphorylated pYMXM and pYXXM motifs on IRS [220; 225]. As mentioned, PI3K produces PIP3, which binds to the PH domain of a variety of signaling molecules altering th eir activity and/or subcel lular localization [226]. Phosphatidylinositol-3-phosphates regulate three main classes of signaling effectors: the AGC family of serine/thre onine protein kinases (which include PKCs), guanine nucleotide-exhange proteins of the Rho fa mily of GTPases and the TEC family of tyrosine kinases. PI3K might also activat e the mTOR/FRAP pathway and be involved in PLD1 regulation, which leads to hydrolysis of phosphatidylcholine a nd increases in PA

PAGE 58

37 and DAG [225; 227]. The best character ized AGC target of PI3K is p hosphoinositided ependent k inase 1 (PDK1), one of the serine kinase s that phosphorylates and activates Akt. PDK1 has an N-terminal kinase doma in and a C-terminal PH domain which has a higher affinity ( in vitro ) for PtdIns(3,4,5)P3 and PtdIns(3,4)P2 than other PIs such as PtdIns(4,5)P2. Its affinity for PIs is higher than that of Akt [170]. PDK1 was discovered for its ability to phosphorylate Akt Thr 308 in vitro [169]. In unstimulated cells, PDK1 is mainly cytosolic with relatively little PM lo calization [228]. With agonist stimulation (e.g. insulin) PDK1 phosphorylates Akt1 on T308 and the equivalent residues in Akt2,3. This phosphorylation of Akt is enhanced over 10 00-fold in the presence of lipid vesicles containing miniscule am ounts of PtdIns(3,4,5)P3 or PtdIns(3,4)P2 but not PtdIns(4,5)P2 or other PIs [169]. Akt binds with it s PH domain to PtdIns(3,4,5)P3 or PtdIns(3,4)P2 which alters its conformation so that T308 becomes accessible to PDK1 [170]. For a long time, there was no consensus as to the identity of the kinase “PDK2” or “hydrophobic motif kinase” responsible for S473 phosphorylation of Akt. Several candidates had been proposed including PDK1, i ntegrin-l inked k inase (ILK) and Akt itself and DNA-PKcs. However, the identity of the kinase complex responsible has now been firmly established as mTORC2 [174; 229] Due to the pertinen ce of mTOR in this study, it necessitates further digression. mTOR is a member of the p hosphoi nositide 3-k inase-related k inase (PIKK) family of proteins [230]. mTOR is a targ et of rapamycin, a macrolide antibiotic and immunosuppresent of the phosphoinositide kinase family. The mTOR kinase exists in two complexes, mTORC1 and mTORC2. mTORC1 consists of mTOR, mLST8, RAPTOR (r egulatory-a ssociated p rotein of mTOR ) and PRAS40 (p roline-r ich A kt

PAGE 59

38 s ubstrate 40 kDa). RAPTOR positively regulates mTOR activity and acts as a scaffold recruiting mTORC1 substrates. PRAS40 negatively regulates mTORC1 activity depending on its phosphorylation state. [231]. Activated mTOR can phosphorylate PRAS40 relieving mTORC1 of substrate compe tition [232]. The best known targets of mTORC1 include ri bosomal protein S6 k inases (S6K1 and S6K2 in mammals) and e ukaryotic i nitiation f actor 4E (eIF-4E)-b inding p rotein 1 (4E-BP1). S6K1 is activated by phosphorylation and regulates ribosomal prot ein translation and ribosome biogenesis. S6K1 also acts as a feedback inhibitor of in sulin induced PI3K-Akt pathway. It does this by directly phosphorylating and inhibiting IR S1 on S270. Phosphorylation of 4E-BP1 by mTOR decreases 4E-BP1 affinity for eIF-4E leading to translation of cap-dependent mRNAs [231; 233]. The mTORC2 protein complex c onsists of mTOR, RICTOR (r apamycin i nsensitive c ompanion of mTOR ), mLST8/G L (m ammalian LST8 /G -protein -subunit l ike protein), SIN1 (s tress-activated-protein-kinase-in teracting protein 1 ) and Protor (prot ein o bserved with R ictor) (collectively called mTORC2). Rapamycin acutely inhibits mTORC1 but is needed for much longer incubations to have an effect on mTORC2 [234]. mTORC2 can phosphorylate Akt S473 in 3T3-L1 adipocytes. This along with phosphorylation of T308 results in fully activated Akt [174; 234; 235]. mTORC2 also phosphorylates Akt at the turn motif T450 [54; 55]. mTORC2 regulates organization of the actin cytoskel eton through phosphorylation of PKC [236]. SIN1 maintains mTORC2 complex integrity ther eby regulating phosphor ylation of Akt S473 [229; 237]. It is not known how the intera ction between mTORC2 and Akt is facilitated [238]. Alternative spli cing of mSin1 gives rise to at le ast five isoforms, three of which

PAGE 60

39 assemble into mTORC2 to generate three distinct mTORC2s. Two of these mTORC2s are regulated by insulin [239]. mTORC2 is also regulated by two tumor suppressors called t uberous s clerosis c omplex protein 1 and 2 (TSC1 and TSC2). Within the TSC1TSC2 complex, TSC1 stabilizes TSC2, while TSC2 acts as a G TPase a ctivating p rotein (GAP) for the small GTPase Rheb (R as h omolog e nriched in b rain). GTP bound Rheb activates mTORC1 which is involved in pr omoting cell growth a nd proliferat ion through its main substrate ribosomal S6 kinases (S 6K1 and S6K2). The mTORC1 complex is inhibited if the TSC1-TSC2 complex is ac tive by stimulating the conversion of RhebGTP to Rheb-GDP. The TSC1/TSC2 comple x activates mTORC2 and thus Akt in a manner that is independent of Rheb, mTO RC1 and mTORC1-mediated feedback effects on PI3K. Endogenous TSC1 and TSC2 co-i mmunoprecitate with exogenously expressed mTOR [234; 240]. However, the TSC1-T SC2 complex can only associate with mTORC2, not mTORC1 [240]. In response to growth factors, Akt phosphorylates TSC2 directly. Phosphorylatio n of TSC2 impairs the ability of the TSC1-TSC2 complex to act as a GAP towards Rheb, which allows Rheb-GTP to accumulate and potently activate mTORC1. This will eventually lead to ne gative regulation of Akt because activated mTORC1 will target S6K1/2 which will block insulin signaling as mentioned above [234]. DEPTOR (d ishevelled, e gl-10, p leckstrin (DEP) domains and interacts with mTOR ) is an mTOR interacting protein whos e expression is negatively regulated by mTORC1 and mTORC2. DEPTOR normally functions to inhibit mTORC1 and mTORC2 pathways. However, when overe xpressed, it relieves th e negative feedback inhibition of Akt, thus caus ing Akt activation [241].

PAGE 61

40 Many additional factors c onverge on mTORC1 (including mTORC2) thereby regulating protein synthesis as well as in sulin signaling. Akt phosphorylates TSC2 at S939, S981 and T1462. The serine phosphorylati ons allow binding of the cystolic anchor 14-3-3. This disrupts binding between TSC1 and TSC2. Akt can phosphorylate PRAS40 at T246 resulting in dissociation of PRAS40 fr om mTORC1. PRAS40 is also a substrate of both mTORC1 and mTORC2. S183 and S 221 are phosphorylation residue targets of mTORC1 and mTORC2, respectively. TNF signaling to Akt, induces IKK (i nhibitor of nuclear factorB k inase ), which is able to activate Raptor and thus mTORC1. IKK also downstream of TNF signaling pathway, is able to inhibit TSC1 by phosphorylation at S487 and S511 [230]. mTOR is able to sense cellular energy levels by monitoring cellular the ATP:AMP ratio via AMP -activated protein k inase (AMPK) [242]. Cellular stress activa tes AMPK, especially when AMP levels are high. AMPK (phosphorylated and activated by LKB1) phos phorylates TSC2 at S1345, increasing its GAP activity towards RheB-GTP, inhibiti ng mTORC1. AMPK can also phosphorylate Raptor at S792, leading to 143-3 binding and inhibition of mTORC1 [230]. The Wnt pathway, involved in cell growth control, is linked to mT ORC1 activation. Wnt signaling inhibits GSK3 GSK3 phosphorylates and inhibits TSC2 on S1341 and S1337 (after priming phosphorylation of TSC2 on S1345 by AMPK). Akt and RSK (r ibosomal S 6 k inase) can also phosphor ylate and inhibit GSK3 Hypoxic conditions work to inactive mTORC1 through h ypoxia-i nducible f actor 1 (HIF1 ) and REDD1. REDD1 competes with TSC2 for 14-3-3 binding. Low nutrient conditions inhibit mTORC1. Rag proteins (Ras small GTPases comprised of four memb ers) are capable of activating mTORC1 in an amino acid sensitive manner. RAG protei ns form heterodimers of RAGA or RAGB

PAGE 62

41 with RAGC or RAGD. Duri ng conditions where there are sufficient amino acids GTPbound RAG complex activates mTORC1, likely by changing the subce llular localization of mTORC1 and bringing it into close pr oximity with RheB. The Ras-ERK pathway activates mTORC1 by phosphorylating TS C2 at S664 and S1798 by ERK and RSK (r ibosomal S 6 k inase), respectively. RSK can also activate Raptor via phosphorylations at S719, S721 and S722. Some of the ma ny pathways converging on mTORC1 are displayed in Figure 17 [230; 242]. The conversion of PA from PC by PLD1 is integral for both mTORC1 and mTORC2 activation. Structural studies ha ve shown that PA binds to the FRB (F KBP r apamycin b inding) domain of mTOR. PA is in co mpetition for this site with rapamycin which is associated with FKBP12 (F K506 b inding p rotein 12 ). PLD1 through PA facilitates formation of mTOR complexes. mTORC2 binds PA more strongly than mTORC1 which explains why higher concentrat ions of rapamycin are needed to inhibit mTORC2 versus mTORC1 [243]. Growth factors stimulate mTORC2 ac tivity with some mTORC2 subunits undergoing phosphorylation. The kinases res ponsible for these phosphorylations are unknown. There is preliminary evidence that Ras may be responsible for some of these phoshorylations [238]. mTORC1 and mTORC2 activity can be distinguished based on the phosphorylation status of mTOR. Activated mTOR is phosphorylated between its catalytic domain and FATC (F rap, A TM, T RRAP, C -terminal) domain near the Cterminus at T2446, S2448 and S2481 [61]. T2 446 is phosphorylated in response to nutrient availability [244]. mTORC1 is predominantly phosphorylated on S2448 while

PAGE 63

42 mTORC2 is predominantly phosphorylated at S2481. S2481 is a rapamycin-insensitive autophosphorylation s ite [61; 245]. Activated Akt has many target substrates involved in glucos e homeostasis. SNARE associated protein synip has been identified as an Akt substrate. Phosphorylation of synip via Akt might allow for insulin-dependent dissociation of synip from syntaxin 4 which would allow SNAR E pairing between syntaxin 4 and VAMP2 thereby facilitating GSV fusion with the PM in adipocytes [246; 247]. A very promising Akt substrate was identified using a phos phor Ser/Thr Akt substrate (PAS) antibody. This protein was AS160 (A kt s ubstrate of 160 kDa), originally named TBD1D4 [246]. AS160 is abundant in muscle and adipose tissu es [246; 248]. There are six putative Akt substrate motifs on mouse AS160. In 3T3-L1 adipocytes, insulin stimulated (likely through Akt) phosphorylation in five of th e six putative Akt substrate motifs (S318, S341, S570, S588, T642, T751) [249]. In musc le cells, insulin, AMPK agonists or contractile activity have been shown to cause AS160 and GLUT4 translocation [250]. AS160 contains two N-terminal PTB do mains and a C-terminal Rab-GAP (Rab G TPasea ctivating p rotein) domain. This led to the hypothesis that Akt-mediated AS160 phosphorylation (and inactivation) regulates GL UT4 translocation via regulation of GAP activity towards Rab proteins [251]. A s econd Rab-GAP substrate of Akt is TBC1D1 (t re-2/USP6, B UB2, c dc1 6 d omain family member 1 ), which regulates insulin-stimulated GLUT4 trafficking [252]. RUVBL2 (RuvB -l ike protein 2 ) has been identified as an AS160 substrate critical for insulin-stimu lated phosphorylation of AS160 in 3T3-L1 adipocytes [253]. The current thinking is th at Rab-GAP activity pr omotes hydrolysis of GTP to GDP by Rab proteins on GSVs. In the inactive form, GDP-bound Rabs are

PAGE 64

43 unable to cause GLUT4 transloc ation to the PM. However, with insulin treatment, AS160 is phosphorylated which leads to inactiv ity of Rab-GAP. This would enable GSV-associated Rabs to load up on GTP and el icit GLUT4 translocation. So far, the Rab14 isoform has emerged as the most likel y Rab responsible for GLUT4 translocation in 3T3-L1 adipocytes [252]. Rab 10 has also been implicated in adipose cells [254]. In L6 muscle cells, the AS160-substrate Rab8A isoform seems to be involved in GLUT4 translocation [255]. Rab8A and Rab10 are both able to bind myosin Va and Vb, molecular motors responsible for localization of Rabs and GLUT4 translocation [254]. Munc18c is a putative target of Akt-controlled Rab activity. Munc18c is a member of the S ec1p/M unc18 (SM) family of proteins. Munc18c is thought to keep syntaxin4 (tSNARE) in a closed conformation. Rab ac tivity causes dissociati on of Munc18c from syntaxin4 allowing syntaxin4 to interact with VAMP2 (v-SNARE) and SNAP23 (23 kDa s yn aptosomal-a ssociated p rotein) (t-SNARE) [129; 183]. Recent in vitro experiments also point to a Mucn18c ro le in fusion by anchoring VAMP to syntaxin [129]. In adipocytes AS160 phosphorylation at Thr642 promotes interaction with 14-33 protein. This interaction is critical in in sulin-stimulated (Akt-dependent) suppression of AS160 s inhibitory role in GLUT4 translocation in adipocytes [252; 256]. 14-3-3 binding to AS160 in L6 cells is not enhanced as a result of insulin-stimulation. However, AMPKmediated phosphorylation of AS160 Ser 237 did enhance binding [257]. Using the same PAS antibody mentione d above, phosphoinositide 5-kinase PIKfyve (p hosphoi nositide k inase for five position containing a Fyve finger) was identified as a potential Akt substrate. It is phosphorylated at S318 (inactivated) in

PAGE 65

44 response to insulin. This effect is bloc ked by wortmannin. Inactivated PIKfyve is associated with enhanced insulin-sti mulated GLUT4 translocation [258]. In addition to Akt and its downstream effectors, PKC / is downstream targets of PI3K signaling that have been suggested to play a role in in sulin-induced GLUT4 translocation [259; 260; 261]. However, there is some controversy as to PKC / s role in insulin-stimulated GLUT4 translocation [262]. After phosphorylation of PKC / by PDK1, it is recruited to lipid rafts in a TC10-dependent manner via Par3 and Par6. Par6 and PKC / both contain PB1 (P hox and B em1 ) domains required for heterodimer complex formation. Par3 has three PDZ doma ins that specifically bind to both Par6 and PKC / [263]. Before moving on to the other half of th e insulin pathway, it s hould be noted that PI3K activation can be attenuated by PIP3 dephosphorylation via 3 phosphatases such as PTEN (p hosphatase and ten sin homolog) [264] or 5 phosphatases such as SHIP2 (SH 2containing 5 -i nositol p hosphatase 2 ) [265]. PTEN action on PIP3 yields phosphatidylinositol 4,5-bisphosphate whereas SHIP2 action on PIP3 yields phosphatidylinositol 3,4-bisphosphate [152]. Both PTEN and SHIP2 can negatively regulate insulin signaling [266; 267]. However, in 3T3-L1 adipocytes, PTEN, and not SHIP2, is able to inhibit PI3K -dependent insulin signaling [ 268]. Insulin action can also be attenuated by p rotein t yrosine p hosphatases (PTPases) which catalyze dephosphorylation of the receptor a nd its substrates (e.g. IRS). The most prevalent is the cytoplasmic PTP1B. PTP1B-/mice are resistant to diet-i nduced obesity [225]. In L6 skeletal muscle cells, Ghosh et al. have shown that c eramide-a ctivated p rotein p hosphatase (CAPP) is able to dephosphoryl ate Akt and SRp40 resulting in decreased

PAGE 66

45 PKC II alternative splicing. The PP1-like CAPP in this case, is stimulated by TNF which in turn stimulates de novo and hydrolysis pathways of ceramide generation. This ceramide allosterically activates th e CAPP responsible for suppressing PKC II expression [269]. The other pathway critical for insulin-s timulated glucose upta ke is the CAP/Cbl pathway. Upon insulin stimulation, Cbl is phosphorylated with the help of APS (a daptor protein containing a P H and S H2 domain). APS has a PH domain required for membrane localization and an SH2 domain that interacts with the phos phorylated receptor. APS needs to be phosphorylated in order to recruit Cbl. It interacts with an atypical SH2 domain of Cbl. APS and Cbl are recruited to the receptor as dimers. Once at the insulin receptor, Cbl is tyrosine phosphorylated in the C-terminus. This tyrosine phosphorylation also requires another adaptor protein, CAP (C bl-a ssociated p rotein). CAP interacts with Cbl through a C-terminal SH3 domain [136; 270]. Once Cbl has been phosphorylated, Cbl-CAP dissociate from th e receptor and translocate to lipid raft/caveolae microdomains in the PM. This is mediated by interact ion of the CAP SoHo (so rbin ho mology) domain with flotillin [271]. Lipid raft-bound Cbl recruits another adaptor protein named CrkII. An SH2 doma in of CrkII interacts with phospho-Cbl. CrkII forms a constitutive complex with C3G (C RK SH3 -binding g uanyl nucleotideexchange factor (GEF)). C3G (acting as an insulin-stimulated GEF) catalyzes the exchange of GTP for GDP for the G protein TC10 [272]. TC10 has a C-terminal CAAX sequence specifying farnesylation and palmitoyl ation responsible for targeting to lipid rafts [273]. TC10 localization to lipid rafts (caveolin posi tive) is required for insulininduced activation [273; 274]. Activated TC10 provides a second signal to GLUT4 in

PAGE 67

46 parallel with activation of the PI3K pathwa y [272]. This may i nvolve stabilization of cortical actin, critical for GLUT4 translocati on [225]. Rac is the G protein equivalent to TC10 in skeletal muscle cells that is res ponsible for actin remodeling [275]. Several effectors of TC10 have been proposed. One is CIP4 (C dc42-i nteracting p rotein 4 ) which contains 1 FCH domain, 2 coiled-coil domai ns and 1 SH3 domain. The FCH domain (part of larger F-BAR domain) interacts wi th microtubules, the F-BAR domain regulates membrane curvature and the second coiled-co il domain interacts with GTP-bound TC10. In addition, CIP4 interacting proteins in clude Gapex-5, a RasGAP and VPS9 domaincontaining protein that functions as a g uanine nucleotide e xchange f actor (GEF) for Rab31. Rab31 is a Rab5 subfamily GTPase involved in TGN-to-endosome trafficking. Insulin recruits the CIP4/Gap ex-5 complex to the PM decreasing Rab31 activity in 3T3L1 adipocytes [276]. Rab31 may possibly func tion in retention of GSVs, therefore, inhibition of Rab31 would allow for release of this GLUT4 population [129]. Gapex-5 is also part of the TC10/Gapex-5/Rab5 axis that mediates insulin-s timulated production of p hosphati dylinositol 3 -p hosphate [PI(3)P]. PI(3)P is an important regulator of GLUT4 vesicle trafficking, regulating translocation of GSVs to the PM To accomplish this TC10 (via Gapex-5) must activate Rab5, a multifunctional GTPase that recruits a network of effectors regulating internaliz ation of proteins from the cell surface, homotypic fusion of early endosomes, formati on of clathrin-coated vesicles and motility of early endosomes on microtubules. Phos phoinositide synthesis and turnover are also regulated by Rab5 via recruitment of two distinct PI3-kinases, VSP34 and PI3K-p110 as well as PI phosphatases including ty pe II PI5-phosphatase and type 1 PI(3,4)P2 4phosphatase. Because spatial and temporal distribution of phosphoinositides is critical

PAGE 68

47 for ISGT, Rab5 is a critical regulator of insulin action. In order to accomplish Rab5 activation, several upstream processes must occur. Gapex-5 is bound to Rab31 (active) in the unstimulated state which promotes intracellular retention of GLUT4. Insulin activates TC10 which recruits CIP4/Gapex-5 to the PM. Dissociation of Gapex-5 from Rab31 (now inactive) allows for GLUT4 tran slocation to begin. At the PM, Gapex-5 (likely acting as a GEF) activates Rab5 by causing dissocation of Rab5 from RabGDI (Rab G DP d issociation i nhibitor). Rab5, which is now GTP loaded (active), can assist in ISGT [277; 278]. TC10 also interacts with Exo70, a component of the exocyst complex. This is important for tethering and doc king of secretory vesicles. Additional components of the exocyst complex are Sec3, Sec5, Sec6, Sec 8, Sec10, Sec15, Exo84 and the C-terminal of a protein called Snapin which binds to the coiled-coil domain of Exo70. This complex is necessary for glucose uptake in 3T3-L1 adi pocytes [152; 279]. Other factors important for propagating TC10-regulated tetheri ng and docking include SAP97, a MAGUK (m embrane-a ssociated gu anylate k inase) family member. Sec8 associates with the PDZ domain of SAP97 and recruits it to lipid ra fts. SAP97 is expressed in lipid rafts (localization not influenced by insulin) and anchors the exocyst complex to lipid rafts [215]. The exocyst complex is non-fusogeni c. Fusion involves the SNARE complex which is capable of inducing the fusion r eaction. This includes VAMP2 (v-SNARE on GSVs) and Syntaxin4 (t-SNARE) and SNAP 23 (t-SNARE). Syntaxin4 interacting partners are Munc18c, Synip and Tomosyn, all of which appear to i nhibit syntaxin from binding VAMP or SNAP. Insulin-dependent Akt2 phosphorylation of Synip on S99 leads to dissociation of Synip from sy ntaxin4, allowing for assembly of SNARE-

PAGE 69

48 complex. Activated PKC complexes with 80K-H and Munc18c to promote VAMP2 binding to syntaxin4 that e nhances GLUT4 fusion. This suggests both a negative and positive regulatory effect of Munc18c. PLD1 product, phosphatidic acid (PA) accelerates the rate of fusion when incorporated with the syntaxin/SNAP23 acceptor membrane [129]. DOC2B (do uble C2 -like domains, b eta), a SNARE related protein, is a very recent discovery. It is a positive SNARE regul ator of insulin-stimulated GLUT4 fusion. It has two C2 domains and translocates to the PM during insulin treatment in a Ca2+ dependent manner [280] TC10 is also thought to influence act in cytoskeleton dynamics. 3T3-L1 adipocytes contain cortical ac tin that lines the surface of th e PM. This cortical actin contains punctate filamentous F-actin that em anate from the organized caveolae-rosettes where TC10 is segregated. This F-actin structur e is referred to as Cav-actin. Interference with TC10 abolished cav-actin formation. TC10 is thought to re gulate both Cav-actin and cortical actin structures [281]. The organization of F-act in is entirely different in myotubes, which are present as stress fibers running longitudinally [152]. It is also thought that TC10 influences ma ssive actin polymerization in the peri-nuclear regions via downstream effector N-WASP protein (n eural W iscott-A ldrich s yndrome p rotein). TC10, along with caveolins and flotillin, is de tected in the TGN endosomes localized in the peri-nuclear regions. Th is region (as mentioned above) is implicated as a major storage site for GSV in 3T3-L1 adipoc ytes [282; 283]. TC10 inhibition using c. difficile toxin B completely shuts down both cortical actin and peri-nuclear actin rearrangements and greatly reduces insulin-stimulated GL UT4 translocation [ 284]. N-WASP protein contains a VCA (V erprolin, c ofilin, a cidic) domain. When N-WASP is bound to TC10,

PAGE 70

49 the VCA domain is exposed and activa tes the Arp2/3 complex resulting in de novo actin polymerization in response to extracellula r stimuli [285]. This actin polymerization (actin comet-tails) is the driving force for ve sicle movement and is involved in membrane trafficking events [286]. Activated TC10 di fferentially regulates two distinct population of F-actin in 3T3-L1 adipocytes. It depolym erizes cortical F-actin beneath the PM and greatly increases F-actin polymerizat ion in the perinuclear region [282]. Insulin stimulation causes GSVs to migrate toward cortical actin along microtubules. The kinesin motor thought to be responsible for this is KIF5B (ki nesin f amily member 5B ). KIF5B is responsible for tran sporting GSVs along microtubules in a PI3K independent manner in 3T3-L1 adipoc ytes [287]. Work from several groups has helped to bridge the myosin motor, actin cytoskeleton and the exocyst complex as it relates to 3T3-L1 GLUT4 translocation to th e PM. After GSVs have migrated along microtubules, translocation re quires both the actin cytoskeleton and the rapid movement of GLUT4 along linear tracks wh ich is likely mediated by molecular motors. A key component of the molecular motor near ac tin filaments is the unconventional myosin Myo1c (Myo sin 1c ) protein which is present in GSVs Myo1c functions independent of PI3K and helps control the movement of GSVs to the PM [288]. Myo1c travels along the actin cable in order to reach the PM. This will likely take GSVs to F-actin where TC10 (and the exocyst complex) is located [136]. GTPase RalA mediates the coordination between Myo1c and the exocyst complex. RalA that is GTP-loaded (via insulin) interacts with the exocyst complex. RalA interact ion with Myo1c is GTP-independent. Calmodulin binds GSVs and modulates th e association between RalA and Myo1c through IQ motifs in a manner that depends on calcium-bound calm odulin. Myo1c may

PAGE 71

50 recognize RalA as a cargo recep tor on GSVs [289]. CaMKII (ca lcium/calm odulindependent k inase II )-mediated phosphorylation of Myo1c is necessary for ISGT to proceed. Myo1c phosphorylation is associated with elevated 14-3-3 binding and reduced calmodulin binding [290]. Binding of 14-3-3 to Myo1c does not i nhibit its ATPase activity (which it obtained vi a phosphorylation). Insulin ca uses a calcium influx just below the plasma membrane which activates CaMKII. Interestingly, Rictor associates with Myo1c during insulin signaling and may pr ovide a link for the regulated interaction of Myo1c and actin [291]. The interacti on between Rictor and Myo1c is insulin independent. Their association is necessa ry for phosphorylation of actin filament regulatory protein paxillin and promotes cortical actin remo deling [292]. In addition to Myo1c, myosin Va and myosin Vb are also actin-based motors implicated in GLUT4 trafficking. Va is phos phorylated by Akt2, enhancing it s association with actin [152]. Vb can bind Rab8A which is critical for lo calization of Rab8A and GLUT4 translocation [254]. How GSVs associate with the cytoskel eton (cortical actin mesh) is not clearly known. A prime candidate is -act in in 4 (ACTN4). This protein is found only within remodeled actin but not along filaments in uns timulated cells. Insulin promotes colocalization of actin filaments, ACTN4 and GLUT4 as well as physical association between GLUT4 and ACTN4. It is thought that insulin-stimula ted release of TUG (t ether, containing a U BX domain, for G LUT4) from GLUT4 enable s its interaction with ACTN4 [152]. TUG is responsible for seque stration of GLUT4 in GSVs in unstimulated 3T3-L1 adipocytes [293; 294]. The preceding insulin signaling cascades as it relates to glucose uptake are illustrated in Figure 18 [129; 133; 17 5; 225; 252; 276; 289; 290; 293; 295].

PAGE 72

51 Peroxisome Proliferator-Activated Recpeptor P eroxisome p roliferator-a ctivated r eceptors (PPARs) are me mbers of the nuclear hormone receptor superfamily of transcripti on factors that exist as three isoforms. PPAR is expressed mainly in brown adipose tissue, liver, kidney, heart and skeletal muscle and plays a major role in lipid catabolism [296]. PPAR expressed in many tissues, is involved in lipid metabolis m and energy utilization [297]. PPAR exists as two isoforms, PPAR 1 and PPAR 2 resulting from alterna tive promoter usage and mRNA splicing. PPAR 1 is more ubiquitously expressed, whereas PPAR 2 is to be found mainly in adipocytes. PPAR 2 is critical for adipogenesis and regulates genes involved in lipid storage and glucose metabolism. To list a few; acyl-CoA oxidase, aP2, PEPCK, malic enzyme, leptin, resistin, lipopr otein lipase and adipone ctin [296; 298]. PPAR 1 has also shown to have some adipogenic action but not as much as PPAR 2 [299]. PPAR 3 has also been observed. Its expression seems to be confined to macrophages [300]. The structure of PPAR is shown in Figure 19 [297; 301]. At the N-terminal end of PPAR is the AF-1 region which is a ligand-independent a ctivation f unction (AF-1) domain. The AF-1 domain can functionally sy nergize with the AF-2 domain [302]. The AF-1 region contains serine and threonine residues that can be phosphorylated. For example, MAPK (m itogen-a ctivated p rotein k inase) family member ERK (e xtracellular signal-r egulated protein k inase) can phosphorylate PPAR at serine112 and cause inhibition of transcriptio nal activation [303]. After the AF-1 domain is the D NA-b inding d omain (DBD). G lucocorticoid r eceptor (GR) DBD is the current model repres enting the nuclear receptor superfamily.

PAGE 73

52 Briefly, DBD folds into a globular domain made up of two nonequivalent zinc-finger structures. Each zinc atom is coordinated by four cyteines. The zi nc-finger structure is necessary for DNA-binding activity [304]. Important are two -helices. The N-terminal helix (P-box) directly inte racts with the major groove of each DNA half-site (base specific contact). The C-terminal helix aids in stabilization. Residues that make up the dimmer interface are located in the C-termin al zinc finger (D-box) (Figure 19) [301]. DNA binding is coupled to stru ctural changes necessary for heterodimer formation. Heterodimerization depends on helica l unfolding which occurs in the C -t erminal e xtension (CTE) of the DBD. In the case of t hyroid r eceptor (TR), two helices within the CTE are crucial for DNA binding and heterodimer assembly. A helix in the T-box completes the heterodimeri c interface with the second zinc-finger helix of r etinoid X r eceptor (RXR). A helix in the A-box ma kes extensive contacts with the DNA [301]. Next is the l igand b inding d omain (LBD). It is composed of many 12 -helical globular domains. These domains form three anti-parallel helical sheets that combine to make an -helical sandwich. The ligand binding pocket is located in the interior of this structure. Binding strength and specif icity are based on hydr ophobic interactions, hydrogen bonding and the steric size and shap e of the binding pocket. For hormone receptors, the smaller the size the more discer ning the binding pocket is towards ligands [301]. PPAR has a relatively disordered pocket to accommodate different ligands [305]. At the end of the LBD is the ligand-dependent a ctivation f unction (AF-2) that can bind coactivators. The coactivator interface of this domain is a hydrophobic groove formed by several helices of the LBD including helix 12 ( called AF-2 helix). Coactivators can bind this groove through a LXXLL motif [301]. Agonists re gulate LBD-coactivator

PAGE 74

53 interactions by modulating both LBD and he lix 12 conformations. Non-agonist bound PPAR would inactivate the LBD causing it to exist in many conformations, few of which are the active [306]. Corepressor binding to PPAR can also inhibit coactivator recruitment. Corepressors also contain LXXLL binding motifs enabling them to bind to the groove formed by the LBD and helix 12. However, unlike coactivators, the corepressor binding motif forms a long three-tu rn helix sterically blocking helix 12 from obtaining an active conformation [307]. Furt her stabilization of the LBD-corepressor complex occurs via antagonist ligand binding. This prevents helix 12 from gaining an active conformation as well as creates a la rger binding surface for the corepressor LXXLL motif [301]. PPAR heterodimerizes with RXR alpha (RXR ) to regulate transcription of PPAR -responsive genes. PPAR /RXR heterodimers bind to d irect r epeats (DR) of the consensus sequence (AGGTCA) separated by a single nucleotide sequence (DR1) called the PP AR R esponse E lement (PPRE). PPAR binds to the 5 half site while RXR binds to the 3 half site (polarity) [296; 308]. Th e PPRE contains an additional AAACT motif upstream of the DR1 [309]. Gene rally, PPREs reside in upstream enhancer regions as opposed to the proximal promoter [310]. The heterodimer binds to the PPRE in a head-to-tail orientation, allowing them to accommodate small changes in the number of nucleotides spacing the two he xanucleotides [301]. In fact binding of the heterodimer pair has been observe d in DR0 and DR2 PPRE s [311]. The heterodimer pair is able to bind to DNA without ligand activation. However, gene activation is inhibited due to the binding of corepressors. Upon ligand binding, co repressors are released and coactivators are recruited leading to tran scriptional activation [309].

PAGE 75

54 The PPAR -RXR complex structure was recently reported. In PPAR the CTE forms significant DNA interactions and is fo llowed by two helical segments that reach the LBD. The RXR CTE forms one of the dimer contacts with the PPAR DBD. Otherwise, RXR has no secondary structure which may be the reason it can promiscuously bind other nuclear receptors. Both DBDs have -helices that directly bind to the half sites. Hydrog en-bonding occurs between the DBD and the major groove of the half-sites. The PPAR LBD and DBD are closely positioned whereas the RXR LBD and DBD are far apart with the space between them being occupied by PPAR LBD. PPAR LBD is the target of most drugs sin ce it is the centerpiece around which all other domains are positioned. Polarity (as mentioned above) is mainly determined by the PPAR CTE s affinity for the 5 flanking sequence. Another determinant of polarity is that both receptors have tight binding between their DBDs. Both DBDs have -helices that can bind with the half sites. Hydrogen-bonding occurs between the DBD and major groove of the half sites. PPAR makes more base and phosphate backbone contacts than RXR The PPAR hinge region also has extensive DNA inte ractions, binding to the upstream AAACT sequence. Besides the DBD-DBD interface, an additional dimer interface is created by the two LBDs. A third in terface occurs between PPAR LBD and the DBD CTE region of RXR Heterodimerized PPAR has a “Y ” shaped pocket in its LBD that binds ligands. As alluded to before, the active conformation for the PPAR -RXR have their helix 12 properly positioned by ligands thereby facili tating coactivator docking. Coactivator binding is far from other protein-protein inte raction sites. The PPRE is also far from

PAGE 76

55 coactivator binding. This suggest s that in order to recruit promoter-specific coactivators, PPREs may have to cooperat e with other promoter elem ents [309]. Adding more complexity is the fact that an intact PP RE is not required for heterodimer binding and subsequent activation for some PPREs [296] A phenomenon called the phantom effect has been reported whereby an RXR ligand can cause dissociation of corepressors and recruitment of coactivators. Here, the bindi ng of a ligand to one receptor can cause a similar activating conformational change in the other receptor. The RXR-RAR (r etinoic a cid r eceptor) heterodimer has reported to undergo this type of activation [312]. However, it has not been observed yet for the PPAR heterodimer. Polyunsaturated fats and their meta bolites have been identified as PPAR ligands although none have established physiological relevance. Th e best characterized is 15 d eoxy p rostaglandin J2 (15-d-PGJ2). It binds PPAR with a Kd (dissociation constant) in the low micromolar range and can activate PPAR target genes at conc entrations near the Kd. The problems with this ligand are that it has never b een shown to exist in vivo and it may not be specific to PPAR [313; 314]. Other na tural ligands of PPAR include component of oxidized low-de nsity lipoprotein 9and 13-h ydroxyo ctad ecadie noic acid (HODE) and 12and 15-h ydroxye icosat etrae noic acid (HETE) [313]. Recently, unsaturated nitrated fatty acids (nitroal kenes) have been shown to activate PPAR Specifically, n itrol ino leic a cid (NO2-LA) and n itroo leic a cid (NO2-OA) are potent PPAR activators. They can activate PPAR -dependent transcription in the nanomolar range [315]. The regioisomer 12-NO2-LA was identified as the most potent with an IC50 (0.41-0.6 M) comparable to synthetic PPAR agonist Rosiglitazone (IC50 = 0.25 M)

PAGE 77

56 [316]. Lysophosphatidic acid has also b een suggested to be an endogenous PPAR ligand [317]. PPAR shares many of the same coactivators with other members of the nuclear receptor family. These include CBP/p300, the SRC family, TRAP220, PGC1 etc. [318]. Some coactivators, such as PGC1 can bind in a ligand-independent manner [319]. Despite this, PGC1 s activating role for PPAR displays gene selec tivity. Some of the corepressors capable of suppressing PPAR activity include SMART, NCoR and RIP140 (nuclear r eceptor i nteracting p rotein1 ) [318]. The general mechanism for PPAR associated gene regulation is show n in Figure 20 [320]. Ligand bound PPAR heterodimer activates target promoters wher eas without ligand activ ation the heterodimer is bound by corepressors that repress target promoters [320]. Another mode of PPAR mediated gene suppression is called liganddependent transrepression. This involves repression of pro-inflammatory genes such as n uclear f actorB (NFB). Here, activated PPAR monomer blocks the clearance of the corepressor complex. The mechanism is not precisely defined but is thought to involve ligand-dependent association with PIAS1 (p rotein i nhibitor of S TAT1 ). PIAS1 binding would induce SUMOylation of the PPAR LBD which would enable it to maintain NCoR (n uclear repressor cor epressor) on the promoter of inflammatory genes [297]. One of the most critical functions for PPAR is being the “master” regulator of adipogenesis. The adipocyte is at the nexus of energy balance and whole-body lipid homoestasis. PPAR is induced during the differentiati on from fibroblasts to adipocytes (both white and brown fat) [298; 318]. Adipose cells can not form without PPAR PPAR advances adipogenesis by inducing a tr anscriptional cascade that includes such

PAGE 78

57 members as C AAT/e nhancer b inding p roteins (C/EBP) [318]. Adipogenesis initially starts by induction of C/EBP and C/EBP These proteins bind to the PPAR promoter and induce its expression [321]. PPAR upon ligand activation, i nduces expression of target genes involved in li pogenesis and adipogenesis. It also activates C/EBP which can positively regulate PPAR expression [318]. C/EBP can not induce adipogenesis without PPAR [299]. Many genes are i nvolved in lipogenesis and insulin sensitivity which have PPREs. Of interest is GLUT4, wh ich is responsible for attaining full insulin responsiveness. Deletion of PPAR in mature adipocytes leads to lipodystrophy and insulin resistance [322]. PPAR 2 deletion in obese and insu lin-resistant ob/ob mice leads to decreased fat mass, severe insulin resistance and dyslipidemia [323]. Thiazolidinediones T hiaz olid inediones (TZDs) are a class of drugs that are used to treat T2DM by reversing insulin resistance in target tissu es and reduce hyperinsulinemia [324]. Today, two members of this drug class, rosiglitaz one and pioglitazone, ar e currently approved by the FDA to treat T2DM [318]. Lehmann et al was the first to discover that TZDs were direct ligands for PPAR [325]. TZDs are believed to in crease insulin sensitivity mainly through binding PPAR There are three main reasons for this. First, clinical potencies of different TZDs correlate with potency of PPAR activation [326; 327]. Second, nonTZD agonists for PPAR also improve insulin sensitivity [328]. Third, mutations in PPAR in humans are associated with insulin resistance [322; 329; 330]. Current evidence suggests th at adipose tissue is the consequen tial tissue target responsible for TZD beneficial effects (Figure 21). The “lip id steal” hypothesis has been used to explain the mechanism of TZD. The rationale is as follows. Type 2 diabetes

PAGE 79

58 correlates with increased plasma f ree f atty a cids (FFA) and their in appropriate deposition on liver and skeletal muscle [318; 331; 332]. FFA and t rig lyceride (TG) accumulation in skeletal muscle translates to insulin re sistance and compromised systemic glucose homeostasis [333]. N onalcoholic f atty l iver d isease (NALFD) has a high correlation with the metabolic syndrome (which includes insu lin resistance) [334]. White fat cell PPAR activation is believed to boost it s capacity to store dietary FF As. As a consequence, the FFAs are turned into fat deposits and partitio ned away from tissues thereby enhancing peripheral tissue insulin sensitivity. Consiste nt with this model, TZDs lower circulating FFA levels [335]. It has also been proposed that TZDs exert their anti-diabetic effect through modulation of cytokine expression. The “lipid steal” contends that the primar y site of TZD action is adipose tissue. This is evidenced by a study s howing that the presence of w hite a dipose t issue (WAT) is necessary for TZDs effects to materialize. Ho wever, in this study, TZDs was still able to reduce circulating lipid levels in mice suggest ing other sites may play a role in lipid removal via fatty acid oxidation etc. [336]. Also, adipose specific PPAR knockdown mice do not respond to TZD treatment. In th is study, TZDs were not able to lower plasma FFAs without adipose tissue that expressed PPAR [322]. Compensatory mechanisms such as oxidation may kick in when WAT is not around. Another question that arises from the “ lipid steal” hypothesis is whether there is adipose hyperplasia or hypert rophy. In cultured cells, PPAR agonists induce adipogenesis. Patients taking TZDs tend to gain weight, some of which is attributable to an increase in fat mass [337]. This might seem at odds with he lping improve insulin sensitivity. However, TZDs simulate fat cel l differentiation of smaller, more insulin-

PAGE 80

59 sensitive adipocytes that promote adipocyt e glucose uptake [338; 339]. In addition, the added adipocyte load is predominantly in the subcutaneous fat with a slight decrease in visceral fat [338; 340]. Individuals with upper-body (central) obesity (excess subcutaneous abdominal and especially visc eral fat) tend to be have metabolic and cardiovascular complications [341] This can partly be explained due to the fact that visceral fat is more lipolytically active. This means excess FFAs are released from triglyceride stores into the circulation. This is compounded by the fact that visceral fat drains directly into the hepatic portal vei n, thereby delivering FFA to the liver causing hepatic insulin resistance [ 341]. The excess FFA will also reach skeletal muscle [338]. There is another mechanism by which activated PPAR can induce whole-body insulin sensitivity which does not contradict “lipid steal.” This involves alteration of the adipokines secreted from adipocytes. One of the most critical is adiponectin. Adiponectin is produced exclusiv ely from adipocytes and is a direct target for regulation by PPAR [342]. TZDs induce adiponectin mRNA a nd plasma protein levels in rodents and humans [343]. Further, TZDs induce a pref erential switch to the high molecular weight adiponectin (as opposed to the low molecular weight type), which is the active form responsible for reducing serum glucos e levels [344]. In mice, adiponectin treatment leads to suppression of hepatic gl ucose output and improved glucose disposal [345]. Mice lacking adiponectin display impa ired TZD responses [346]. TZD activation of PPAR can also repress expression of ad ipokines inversely related to insulin sensitivity. These include t umor n ecrosis f actor (TNF) and resistin which are thought to cause insulin resistance [347].

PAGE 81

60 Skeletal muscle is the largest importer of glucose. TZD ability to improve overall insulin sensitivity must affect skeletal muscle glucose uptake. However, PPAR has very limited expression levels in skeletal muscle. This means that the TZD effect is likely indirect. The “lipid steal” hypothesis would explain this th rough less circulating FFA and increased insulin sensitizing adipokines. Liver also express low levels of PPAR and its activation in liver is associated with steatosis. However, overall TZD benefits most likely outweigh this si de effect [318]. Another area of PPAR activation affected by TZDs is macrophages. Infiltration of adipocytes by macrophages is thought to l ead to increased inflammatory factors that cause insulin resistance such as IL-1 TNF and IL-6. PPAR is induced during the differentiation of monocytes into macrophage s and is highly expr essed in activated macrophages [348]. Macrophages can underg o activation to inflammatory (M1) macrophages which are charac terized by production of IFN(I nterf eron ) and IL-12. They can also undergo alternative activat ion to anti-inflammatory M2 macrophages characterized by the production of arginase I and IL-10 [348]. Macrophage-specific PPAR expression was shown to inhibit infla mmation and increase insulin sensitivity (muscle and liver) as well as reduce athero sclerotic lesion size [349; 350]. Figure 21 illustrates the global as well as molecular insu lin sensitizing benefits of TZD action on the major TZD target tissues. Peroxisome Proliferator-Activated Receptor Coactivator 1 P eroxisome proliferator-activated receptor c oactivator 1 (PGC1 ) was originally identified as the coactivator of PPAR [319]. PGC1 has since been shown to increase the transcriptional activity of PPAR and variety of nuclear receptor families

PAGE 82

61 including oestrogen receptor, retinoid X receptor, m ineraloc orticoid r eceptor (MCR), g lucocorticoid r eceptor (GR), l iver X r eceptor (LXR), p regnane X r eceptor (PXR), the c onsititutive a ndrostane r eceptor (CAR), vitamin D and thyroid hormone receptor families [351; 352]. PGC1 can also bind unliganded nucle ar receptors such as PPAR orphan h epatocyte n uclear f actor (HNF) 4 f arnesoid X r eceptor (FXR), and oe strogenr elated r eceptor (ERR) [352; 353]. PGC1 also targets non-nucle ar receptors involved in the insulin signaling pathway including FOXO1 (fo rkhead box O1 ), whose activation is required for gluconeogensis [354]. Most receptor binding takes place through PGC1 s three LXXLL (L1-L3) motifs (Figure 22). The L3 motif mark s the beginning of the n egative r egulatory (NR) regions which aids in anchoring to PPAR [352]. Recently, Li et al. showed that rosiglitazone-stimulated PPAR has a preference for the PGC1 ID1 motif (L1 aa 144-148). This combin ed with the fact that PGC1 expression increases with Rosiglitazone treatment (via coactivation of PPAR on the PGC1 promoter), suggests that the interaction between PPAR and PGC1 is critical in mediating TZD benefits [355; 356]. After the PGC1 NR region is the central hinge region (amino acids 400-500), which contains the tetrapeptide DHDY. This is the host cell factor docking site [352]. Of interest, PGC1 has the MADS box transcripti on enhancer factor (MEF) 2C binding site which is required for coactivation of GLUT4 [357]. Besides being a powerful tran scriptional coactivator, PGC1 can also bind h istone a cetylt ransferase (HAT)-containing proteins at their N-terminal such as CBP, p300 and SRC-1 [358]. HATs acetylate histones and remodel chromatin allowing access for factors of transcription. Conc omitant with recruitment of transcription activators, PGC1 is able displace repressor proteins such as h istone d eac etylase (HDAC) and s mall

PAGE 83

62 h eterodimer p artner (SHP) [359; 360]. The C-terminal region of PGC1 binds the mediator complex (TRAP/DRIP complex) wh ich is responsible fo r coupling pre-mRNA splicing and transcription due to its Ser/Ar g-rich domain as well as its RNA binding domain [361; 362]. PGC1 s C-terminal region also has two RS domains (to bind SR proteins) and an RRM domain. Binding to SR proteins influences splice site selection during splicing. The RRM is implicated in th e control of translati onal elongation as well as splicing. Both the RS and RRM synergize with the n uclear l ocalization s equence (NLS) in translocating PGC1 to the nucleus [363]. PGC1 is diffusely distributed in the nucleoplasm including nuclear speckle s, where hypophosphorylated inactive SR proteins concentrate [362]. Just like the RS of other proteins (e.g. SR p proteins), those of PGC1 harbor several Akt consensus site (RXRXXS/T) [352]. SRp40, for example, (which can bind to PGC1 ) can be phosphorylated in this manner and participates in alternative splicing of PKC II in an insulin-dependent mann er [211; 362]. The ability of PGC1 to bind proteins involved in transcrip tion and splicing suggests that it is a key mediator of co-transcriptiona l gene processing [362]. PGC1 affects alternative splicing only when it is recruited to complexes th at interact with ge ne promoters [362]. Coactivation of mitochondrial gene transcription factors allows PGC1 (as well as PGC1 ) to stimulate mitochondrial biogenesis. Some of the most critical are NRF-1, NRF-2, PPAR PPAR ERR and TR [364]. NRF-1 and NRF-2 are not only targets as transcription factors but their gene s are subject to regulation by PGC1 These genes are able to simulate the expression of m itochondrial t ranscription f actor A (Tfam), a mitochondrial matrix protein necessary for re plication and transcri ption of mitochondrial

PAGE 84

63 DNA [365]. Control of both nuc lear and mitochondrial genes leads to increased activity in fatty-acid -oxidation, Krebs cycle, and ox idative phos phorylation (OXPHOS) [364]. White fat cells are needed for energy st orage while brown fat cells are used for energy dissipation. PPAR is needed for formation of brown fat and white fat. TZD stimulation has even been shown to promote the differentiation of brown fat [366]. PGC1 was discovered to turn on adaptive therm ogenesis in brown fat. These processes include fuel intake, mitochondrial fattyacid oxidation and heat production through u nc oupling p rotein-1 (UCP1). PRDM16 is a coregulat or necessary and sufficient for brown fat cell differentiation. PR DM16 dramatically increases PGC1 expression, UCP1 and other brown fat genes. PGC1 and PGC1 exhibit complementary function during brown fat differentiation through genes such as UCP1 as well as mitochondrial biogenesis. However, after development of brown fat, PGC1 and PGC1 do not always share complementarity in terms of function. For instance, PGC1 regulates cold inducible UCP1 in mature brown fat, PGC1 does not. Recently, LRP130 has been shown to be critical for the co mplementary actions of the PGC1 s during brown fat development [367]. Exercise training promotes switching of muscle type fiber. It increases the number of type I and type IIA muscle fibe rs which are red in a ppearance and contain a large number of mitochondria, more myoglobin and vascularization than type II B and type IIX muscle fibers. The former muscle type are resistant to fatigue and contract slower with a low peak force [368]. Enduran ce training or strength training both result in the release of calcium from the sarcoplasmic re ticulum. This activates several important transcription factors such as c yclic-A MP-responsive-e lement-b inding protein (CREB),

PAGE 85

64 m yocyte-e nhancer f actor 2C (MEF2C) and MEF2D, and members of the n uclear f actor of a ctivated T cells (NFAT) family. These fact ors lead to an increase in PGC1 which is probably involved in modulating metabolic fl uxes in skeletal muscle in response to a decrease in ATP and altered fuel demands [369; 370]. PGC1 s interaction with AMP activated protein k inase (AMPK) may mediate these me tabolic fluxes. Activated AMPK phosphorylates PGC1 and induces de novo synthesis of additional PGC1 [370; 371]. Transgenic mice encoding PGC1 in skeletal muscle at levels of those in type I muscle fibers, show a definite switch towards both t ypeI and type IIA muscle fiber [372]. These fibers are more resistant to fatigue than wild-type mice and are characterized by an increase in mitochondrial density and function, increased oxidative metabolism, increased expression of myofibrillar proteins ch aracteristic of type I and type IIA muscle fibers [372]. PGC1 also increases glucose uptake which leads to an increase in glycogen stores post-exercise for future expe nditure [373]. Substrate usage for energy shifts to fatty-acid oxidation [374]. Mi ce with skeletal muscle ablation of PGC1 have more type IIB and type IIX (glycolytic) mu scle fibers and a lowe r capacity for endurance exercise compared with wild -type mice [375]. There is wide variation in the PGC1 expression in people s human muscle. This may have implications in terms of susceptibility to metabolic diseases such as insulin-re sistance [376]. Serine/Arginine-rich Proteins Ser ine/arg inine-rich (SR) proteins are spli cing factors characterized by their arg inine/ser ine (RS) dipeptide rich domain [377 ]. SF2/ASF was the first SR protein identified [378]. The term SR protein was coined following identification of RS domain-containing proteins using the anti body mAb 104. These SR proteins were bound

PAGE 86

65 to active sites of RNA polymerase II transcri ption [379]. Those SR proteins were SRp20, SRp40, SRp55 and SRp75, named after their molecular mass on an SDS/PAGE gel [380]. SR proteins have a modular structure with one or two c opies of an N-terminal RRM (R NA r ecognition m otif) that provides RNA-binding sp ecificity (SRp40 has two RRMs). The C-terminal RS domain facilitates protei n-protein interactions that bring the SR proteins to the spliceosome [381; 382]. On ce localized to pre-mRNA, SR proteins can make contact via the BP (b ranch p oint) and the 5 ss (splice site) [363; 383]. Also in the RS domain repertoire is th e ability to act as an n uclear l ocalization s equence (NLS) which shuttles SR proteins into the nucleus via the SR protein nucle ar import receptor, transportin-SR [384; 385]. Classical SR proteins include SF2/ASF, SC35, SRp20, SRp75, SRp40, SRp55, 9G8. The criteria used to define classical SR proteins are structur al similarity, dual function in constitutive and alte rnative splicing, presence of a phosphoepitope recognized by mAb104 and purification using magnesium ch loride [377]. Add itional SR proteins have been classified as well as SR-related pr oteins that may have additional roles besides splicing such as chromatin remodeling, transc ription and cell cycle progression [386]. SR proteins are concentrated in nu clear speckles and are recruited to RNA p olymerase II (RNAP II) during transcription [387]. Interactions between SR-related proteins and the CTD (C-terminal domain) of RNAPII have been re ported [388]. Also, SR proteins are among the hundreds of protei ns present in the RNAPII complex [389]. SC35 has recently been reported to promote RN AP II elongation in certain genes. This demonstrates the potential of SR proteins to couple transcription and splicing, even bidirectionally [390]. The importance of th e transcriptional mach inery in splicing has

PAGE 87

66 produced a kinetic co-transcriptional coupling model whereby the rate of transcriptional elongation determines splice site selection, and this rate is partia lly determined by the recruitment of splicing factors to the CTD of RNAP II [391]. SR proteins influence splicing by binding to ESE s and ISEs (e xonic and i ntronic s plicing e nhancers) or ESSs and ISSs (e xonic and i ntronic s plicing s ilencers). Binding of SR protein to ESEs prevents exon skipping [392]. Cooper et al. has shown SRp40 binds to an ISE downstream of the PKC II exon and promotes insulin-stimulated PKC II exon inclusion [38]. Two models have been proposed to explai n how SR proteins regulate exon inclusion. The recruitment model proposes that ESE-bound SR proteins recruit and stabilize binding of U1 snRNP (s mall n uclear r ibon uclop rotein) at the 5 ss as well as U2AF65 at the 3 ss [393]. This is referred to as exon definition [394]. In the second model, inhibitor model ESE-bound SR proteins anta gonize activity of hnRNP-ESE recognition. The hnRNP (h eterogeneous n uclear RNP ) family of proteins binds RNA and is known to negatively regulate alternat ive splicing [377]. In addition to these two models, it has been shown that SR proteins can form a network of protein-protein interactions spanning the intr on boundries early in spliceosomal assembly. They can also bind ISEs at the branch point to promote pre-spliceosomal assembly [363; 383]. SRrelated proteins can recruit U4/U6.U5 trisnRNP to the pre-spliceosome via the RS domain [395]. SR proteins can also function in mR NA processing, mRNA nuclear export, NMD (n onsense-m ediated d ecay) and translation [377]. Some of these processes are partly aided by nuclear SR proteins local ized in nuclear speckles [396]. A subset of SR proteins (SF2/ASF, SRp20 and 9G8) are able to shut tle between the nucleus and the cytoplasm

PAGE 88

67 that can further progress these processes [396]. Increased ex pression of SRp40, along with others, is implicated in nuclear aspects of NMD [397]. SR protein phosphorylation dynamics ha ve an important part in pre-mRNA splicing. The RS domain of SR proteins is heavily phosphorylated on serine residues [377]. This regulates both s ubcellular localizatio n and activity. Phosphorylation of the RS domain in SF2/ASF stimulates protei n-protein binding with other RS domaincontaining splicing factors such as U1-70K [398]. Dephosphorylation of SR and SRrelated proteins is required for the splicing reaction to pr ogress [399]. Insulin-induced PKC II alternative splicing occurs as a resu lt of SRp40 phosphorylation by Akt [211]. The phosphorylation status of the RS domain is important in postsplicing activ ities of SR proteins. A hypophosphorylat ed RS domain is needed for the interaction of nucleocytoplasmic shuttling of SR proteins with TAP/NFX1 nuclear export receptor [400]. SR protein kinase s re-phosphorylate the RS doma ins enabling reentry into the nucleus [401]. Both shuttling and non-shut tling SR proteins a ssociate with the premRNA when hyperphosphorylated. Non-shuttling SR proteins are released after initial spliceosomal assembly. Dephosphorylation of the RS domain determines the sorting within the nucleus. Shuttling SR prot eins are likely dephos phorylated during the transition from prespliceosomal complexes (E and A) to mature spliceosomal complexes (B and C). The shuttling SR protein may remain bound to aid in RNA export. Shuttling SR proteins must be dephosphor ylated to be moved to the cytoplasm. Shuttling and non-shuttling SR proteins are recycled via different pathways [402].

PAGE 89

68 PU.1/Spi1 PU.1/Spi1 is a hematopoietic-specific ETS (E 26 t ransformation-s pecific) family member transcription factor involved in the development of all hematopoietic lineages [403]. ETS proteins are ch aracterized by a conserved 85residue domain that binds DNA. This domain recognizes pur ine-rich sequences containing 5 -(A/T)GGA(A/T)-3 consensus. ETS proteins can tolerate variati on in the flanking bases [404]. PU.1 is able to partner with spliceosomal proteins [405]. One such factor is TLS (t ranslocated in l ipos arcoma) which binds PU.1 in vivo TLS is an RNA-binding protein that influences the choice of alternative splice sites by favoring the selection of the proximal 5 -splice site of E1A pre-mRNA. In, addition the C-te rminal region of TLS can bind SR proteins which will also influence splicing [406]. The DBD of Spi-1 is able to interact with poly(A) + RNAs and homoribonucleotide poly (G) polymers. However, it does not have RNA recognition specificity [405; 407]. Co-transcriptional Splicing Pre-mRNA processing (capping, splicing a nd cleavage/polyadenylation) can be tightly coupled to transcription through R NA polymerase II allowing for much greater efficiency, both spatially and energetically [ 408]. However, co-transcriptional splicing is not obligatory. Introns can not serve as splicing substrates until both the 3 and the 5 ends are synthesized. Therefore, the time it takes for RNA pol II to synthesize each intron, defines a minimal time and distance along the gene where splicing factors can be recruited and spliceosomes formed. The time th at it takes for RNA pol II to reach the end of the TU (t ranscription u nit) defines the maximal time that splicing could occur cotranscriptionally [409]. Introns in the 5 part of the transcript will likely be co-

PAGE 90

69 transcriptionally spliced. However, modulation of RNAP II elongation rates by transcriptional activators influen ces alternative splicing [408]. Co-transcriptional splicing occurs due to RNA pol II being ab le to recruit both transcription and splicing factors by acting as a landing pad. In particular, the CTD of RNA pol II plays a central role in the c oupling process. Dynamic changes in CTD phosphorylation play a role in RNA processing. Transcriptional activ ation of RNA pol II results in recruitment of splicing factors to sites of transcription [408]. This does not occur if the CTD is mutated [387]. Promoter identity is critical in determ ining alternative splici ng. Factors recruited to the promoter affect the type of SR proteins recruited [408]. PGC1 as mentioned before, is a pertinent example because it can bind SRp40 [362]. Promoters, through the factors they recruit, also a ffect RNA pol II elongation rates. This is important because a slower pol II elongation rate or internal pauses favors in clusion of alternative exons where there is a weak 3 ss upstream of a strong 3 ss [408]. It has been suggested that the rate of RNA synthesis aff ects its secondary structure whic h in turn affects splicing. This model suggests that pre-mRNA is free to fold within a limited timeframe after transcription [410].

PAGE 91

VEGFR2 G-protein coupled recepto r CPI-17 PLC 1 PLC IP3 SRC / / IKK ABL Figure 1 Proposed effects of protein kinaseC activation The PKC family influences many pathways. Some isozymescan be activated by several different pathways, such as calcium or DAG production. Others are activated by one pathway such as ceramide. Many iso zymeshave overlapping substrate specificities in vitro and thus may interact to control signaling pathways that mediate cell-cycle contro l, proliferation, apoptosis, cellular adhesion and metastasis. NF B DNA replication, transcription and growth Ceramide / HDAC7 MLCP DAG Ca2+ I/II I/II GSK I/II Calmodulin MLCK I/II RAF1 MEK1/2 ERK1/2

PAGE 92

C1B PS C2 C3 C4 C3 C4 C3 C4 N CV1 V2 V3 V4V5Hinge DAG/phorbol ester binding Ca2+/ Phospholipid binding ATP binding Substrate binding Regulatory domain Catalytic domain cPKC: I, II, C2-like C1A N C1B PS C1A nPKC: , aPKC: / PKC: /D, w Y PB1 C1 CV5 CV5 V1 NV1 V4 V4 V2 V3 V3 PSV2 C4 C PH Cys2 Cys1 Figure 2 Domain structure of PKC isoforms PKCs have a conserved kinase domain (blue) and ATP binding domain (turqoise) and more variable regulatory domains. All PKC regulatory domains (exceptPKCD,v) have a pseudosubstrate motif (yellow) upstream of the C 1 domain (light blue). C1 domains bind DAG/PMA in cPKCs & nPKCs. aPKC C1 can not bind DAG/PMA. C2 domain (dark green) binds Ca2+and phospholipids in cPKCs. nPKC C2-like domain does not bind Ca2+. The Hinge region (cPKC, nPKC, aPKC) separates the regulatory and catalytic domain and can be cleaved (scissors). aPKC PB1 (orange) domain is for protein:protein interaction. PK CD PH domain (red) is involved in protein:protein interactions. ++ (cPKC C2) represents a basic patch that recognizes PIP2. W (tryptophan nPKC C1B) residue confers high DAG/PMA affinity. Tyrosine (Y in cPKCC1B) residue can be phosphorylated in place of phosphatidylseri ne binding.

PAGE 93

V3 V1 V5 V1 V5 V2 V4 V2 V4 C1 C1 C4 C4 Zn fingers Phosphatidyl serine DAG PMA Calphostin C C2C3 Calpain Ca2+ ATP Staurosporine Activation Pseudosubstrate motif Substrate C2 C3 V3 Figure 3 PKC pseudosubstrate autoinhibition Newly synthesized PKC is unfolded with the pseudosubstrate unbound to the substrate binding domain. However, upon phosphorylation, PKC adopts a closed conformation (left). Signals causing PKC engagement with i ts C1 and C2 domains results in pseudosubstrate release, allowing downstream signaling (right).

PAGE 94

V1 C1 V2 C2 V3 C3 V4 C4 1V5 1V5 673 aa 671 aa C4 II I AATAAA ATTAAA Figure 4 PKC secondary structure. Rat PKC gene structure (top). Close up of the C-terminal region (middle). The approximate sizes of intronsand exonsare given. Polyadenylation sites are designated AATAA for PKC II and ATTAAA for PKC I. Stop codon (TAA) 159bp into PKC II exon. Possible splice site 2 is shown. Close up of PKC II exonand 3UTR (lower). CATG/GTGACAT and CATG/GTGGCAT define the exon/intron junction of splice site 1 & 2, respectively. Polypyrimidinetract (pyr) between ss1 and ss2 is a 30bp pyrimidine-rich tract important for spliceosomeassembly. Black dots represent short (10-14bp) purine-rich splicing enhancers. Stem loop structure reflects 44bp AUUUA stem loop structure. SRp40 depicts binding site for phosphorylated SRp40. ExonSplicing Enhancer (ESE) represents a 38bp purine-rich exonsplicing enhancer. >3kb1.7kb4kb700bp ss2 TAA100bp 216kb Pyr ~136kb CATG/GTGACATCATG/GTGGCAT SRp40 ESE

PAGE 95

C4 II I AATAAA ATTAAA ss2 Figure 5 PKC alternative splicing and alternative polyadenylation 4 possible splice variants (I-IV) from rat brain are shown. Splice variant I reflects mature PKC I mRNA. Splice variant II reflects mature PKC II mRNA. Splice variant III reflects mature PKC II mRNA with additional splice site. Splice variant IV reflects PKC II mRNA from alternative polyadenylationselection. C4 II I C4 I C4 II I C4 IIAATAAA ATTAAA ATTAAA ATTAAA I II III IV

PAGE 96

C1A PS C1B C2 Kinase Domain N C PPP 500641660 Activation loop Turn motifHydrophobic motif II 484 DFGMCKENIWDG-VTTK T FCGTPDYIAPEII 628 NFDRFFTRHPPVL TPPDQEVIRNIDQS ---EFEGFSFVNSEFLKPEVKS 481 DFGMCKEHMMDG-VTTR TFCGTPDYIAPEII 625 NFDKFFTRGQPVL TPPDQLVIANIDQS ---DFEGF SYVNPQFVHPILQSAV I484 DFGMCKENIWDG-VTTK TFCGTPDYIAPEII 629 NFDKEFTRQPVEL TPTDKLFIMNLDQN ---EFAGF SYTNPEFVINV 498 DFGMCKENVFPG-STTR T FCGTPDYIAPEII 642 NFDKFFTRAAPAL TPPDRLVLASIDQA ---DFQGF TYVNPDFVHPDARSPTSPVPVPVM 489 DFGMCKENIF-GENRAS TFCGTPDYIAPEIL 630 NFDPEFLNEKPQL SFSDKNLIDSMDQT ---AFKGF SFVNPKYEQFLE 550 DFGMCKEGILNG-VTTT TFCGTPDYIAPEIL 697 NFDQDFTREEPVL TLVDEAIVKQINQE ---EFKGF SYFGEDLMP 394 DYGMCKEGLGPGD-TTS TFCGTPNYIAPEIL 547 NFDTQFTSEPVQL TPDDEDAIKRIDQS ---EFEGF EYINPLLLSTEESV /L 496 DFGMCKEGICNG-VTTA TFCGTPDYIAPEIL 642 NFDPDFIKEEPVL TPIDEGHLPMINQD ---EFRNF SYVSPELQP 522 DFGMCKENML-GDAKTN TFCGTPDYIAPEIL 663 NFDKEFLNEKPRL SFADRALINSMDQN ---MFRNF SFMNPGWSG / 387 DYGMCKEGLRPGD-TTS TFCGTPNYIAPEIL 542 NFDSQFTNEPVQL T PDDDDIVRKIDQS ---EFEGF EYINPLLMSAEECV Figure 6 PKC isoform phosphorylation sites Alignment of activation loop, turn motif and hydrophobic motif phosphorylation sites in PKC isozymes. PKC II structure is shown on top along with residues of phosphorylation. Below is an alignment of PKC isoform phosphorylation sites.

PAGE 97

Figure 7 Biphasic cPKC translocation in short-and long-term exposure to agonists (A) Activation of either G protein-coupled receptor or tyrosine kinase receptor (e.g. insulin receptor) leads to activation of PLC and subsequent hydrolysis of PIP2to membrane-bound DAG and soluble IP3. IP3leads to an elevation of Ca2+which then recruits PKC to the plasma membrane where it binds DAG and PS in the presence of Ca2+and becomes activated. Activated PKC can then phosphorylate target substrates. PKCs return to the cytosol within 120s, which correlates with the metabolism and loss of DAG and the autophosphorylation of PKC C-terminus. (B) In chronic PKC stimulation, s timulation of receptors leads to activation of PLD. PLD cleaves PC to generate PA and free choline. PA can be converted to DAG via PAP. This type of DAG (mimicked by long term PMA treatment) is stable in the plasma membrane for over 1 hour and induces prolonged PKC translo cation. PKC can translocate (among other areas) to a novel juxtanuclear compartment, termed the pericentron.AB

PAGE 98

membrane NC2C1 PH C 1. Phosphorylation N C hydrophobic motif 660 turn motif 641 activation loop 550 Ca2+ PS DAGSignals causing lipid hydrolysis N PIP2 PDK1 NC2C1 mTORC2C constitutive agonist evokedC D o wn s t r e a m s i g n a l i n g PHLPP 2. Translocation N C N C RINCK Ub degradation 3. Dephosphorylation HSP70 re-phosphorylation Figure 8. Spatial, temporal and conformational regulation of cPKC Newly synthesized cPKCassociates with PM in an open conformation in which the pseudosubstrate(orange rectangle) is dislodged from the substrate-binding cavity on the kinasedomain (green circle). The upstream kinase, PDK1 (light blue circle with rectangular PH domain) is docked on the C-terminal tail and initiat es phosphorylationat the activation loop (Thr500 in PKC II). This is followed by mTORC2 mediated phosphorylationat the turn motif (Thr 641 in PKC II) and then autophosphorylationof the hydrophobic motif (Ser 660 in PKC II). Fully phosphorylatedmaturePKC is released into the cytosolin a closed conformation in which the pseudosubstrateoccupies the substrate-binding cavity, thereby inhibiting the kinase (bottom left). External signals causing hydrolysis of phosphatidylinositol4,5 bisphosphate(PIP2) cause PKC translocation to the PM. Binding of Ca2+to the C2 domain (red) recruits PKC to the PM via a low-affinity interaction where the C1 (brown) domain binds DAG. The C1 domain (post calcium binding) also interacts with PIP2and phosphatidylserine. Engagement of both C1 and C2 domains on the PM results in pseudosubstraterelease allowing downstream signaling to take place. This membrane translocation is reversible determined by second messenger levels. The membrane-bound PKC conformation is highly sensitive to phosphatases. Prolonged exposure in this conform ation results in dephosphoryolationof PKC by PH domain Leucine-rich repeat protein phosphatase(PHLPP) (red) as well as PP2A which can potentially lead to degradation. Binding of Hsp70 (dark yellow)to the dephosphorylatedturn motif on the PKC C-terminus causes stabilization and the ability to be re-phosphorylated, thus re-entering the pool of signaling-competent PKC. The phosphorylati onstep is constitutive* and the translocation and dephosphorylationare agonist-induced. PKC that is not rescued by Hsp70 is ubiquitinate dby E3 ligases(e.g. RINCK) and degraded.

PAGE 99

Figure 9. The main pathways of DAG generation and catalysis DAG is inside the blue box (dashed). The principle enzymes involved are green. The enzymes dependent of extracellular signaling are circled. Groups that are changed during the reaction are shown in red (OH is hydroxyl; R, R and R are fatty acids; P is a phosphogroup). The three-carbon backbone is in black. AT, acyltransferase; CDP, cytidine diphosphate; CEPT`, choline/ethanolamine phosphotransferase1; CPT1, cholinephosphotransferase; DGAT, diacylglycerolacyltransfer ase; TAG, triacylglycerol; MAG, monoacylglycerol; LPA, lyso-phosphatidicacid; PLA, phospholipaseA; PAP, phosphatidicacid phosphohydrolase; LPP, lipid phosphate phosphatase; LPAAT, lysophosphatidicacid acyltransferase; DGK, diacylglycerolkinase; PLD phospholipaseD; PLC, phospholipaseC; DGK, diacylglycerolkinase; SMS, sphingomyelinsynthase; SM, sphingomyelin. OH-O PDHAP DHAP AT R-O PAcylDHAP OH OH P R OH PG3P LPA G3P AT R R PLPA AT PA R R P-XPhospholipid X= Ethanolamine Choline Inositol Serine PLD X PLC P-XO C H2-O-C-R O C H-O-C-R C H2OH DAG PAP LPP DGK R R P-CholinePtdCho R R P-SerinePtdSer Serine Choline Serine Ethanolamine R R P-EthanolaminePtdEtn CEPT1 CEPT1 CPT1 +CDP-choline +CDP-ethanolamine SM SMS Ceramide R R P-P-CytidineCDP-DAG R R P-GlycerolPhosphatidylglycerol R R P-GlycerolPtdIns +G3P +Inositol +Phosphatidylglycerol R R P-Glycerol-PCardiolipin R R OH R OH R OH OHMAG DAG lipase R or R OH R RDGAT +R PLA

PAGE 100

Agonist PIP2 IP3 PhospholipaseC PC PhospholipaseD PhospholipaseA2 DAG FFAs LysoPC PKC + Ca2+ Potentiation Figure 10 Agonist-induced membrane phospholipiddegradation for acute and sustained PKC activation PhospholipaseC is responsible for acute DAG production by converting phosphatidyl4,5 bisphosphate(PIP2) to inositol1,4,5-triphosphate (IP3). Phosphatidylcholine(PC) is the starting material for sustained agonist-induced DAG production. PhospholipaseD converts PC to D AG. PhospholipaseA2 hydrolysis ofPC generates free fatty acids (FFAs) or lysophosphatidylcholine(LysoPC). These products help potentiate PKC activation in the presence of DAG. Cellular responses

PAGE 101

Figure 11.GLUT family PM insertion structure There are 13 GLUT family members. All span the plasma membrane 12 times with both amino-and carboxyl-termini cytosolic. GLUT4 belongs to Class I GLUTs(1-4) which are glucose transporters. Class II GLUTs(5, 7 9, and 11) are fructose transporters. Class III GLUTs(6, 8, 10, 12 and HMIT1) are structurally atypical and poorly defined. This dia gram shows a homology plot between GLUT1 and GLUT4. Residues shown in red are unique to GLUT4.

PAGE 102

Figure 12 GLUT4 trafficking itinerary GLUT4 trafficking can be divided into six discreet steps. 1)Budding [biogenesis of GLUT storage vesicles (GSVs)], 2) Movement, 3) Tethering, 4) Docking, 5) Fusion and 6) endocytosis.1 2 3 4 5 6

PAGE 103

Figure 13 Proposed GLUT4 compartments and trafficking GLUT4 (purple) and other rapidly recycling proteins such as transferrin receptors (red) are removed from the plasma membrane in clathrin-coated vesicles and enter the endosomesystem (1). Depending o n celltype, this recycling endosomalsystem can be both beneath the plasma membrane and perinuclear. GLUT4 can either enter the endos omal recycling compartment (2) or be sorted away from tranferrinreceptors and shuttled to the perinuclearreticular GLUT4 storage com partment [PR-GSC] (3). The PR-GSC is similar to the Trans -Golgi network (TGN) (5) but has a more restricted population of stored proteins. GLUT4 is in constant flux between the PR-GSC and the dispersed vesicular GLUT4 storage compartment [DV-GSC] (4). The DV-GSC is avail able for quick fusion with the PM. Newly synthesized GLUT4 from the TGN mostly goes to the PR-GSV. The PR-GSV can become saturated and is available within the endosomesystem for rapid translocation in response to insulin. MutatedGLUT4 (alterations in target ing domains) are targeted to the late endosomesand lysosomes(6). Black arrows indicate trafficking steps that lead to GLUT4 storage. This includes the biosynthetic route (TGN) as well as from the PM via the endosomesystem. Red arrows indicate probable route from storage to the PM and the route stimulated by insulin. Blue arrows indicate possible route of GLUT4 from storage to the endosomesand to the PM. Gre en arrows indicate routes mutant GLUT4 might take if it can not be retained in the PR-GSC or endosomecompartment.

PAGE 104

K179 T308 S473 K180 T309 S474 K177 T305 PH Catalytic C-terminal /1 /2 /3 Figure14 Domain structure of mammalian PKB/Aktisoforms The N-terminal region contains the PH domain. The lysine (K) indicates the residue involved in catalysis. Regulatory phosphorylationsin the catalytic and C-terminal domain are indicated. S472

PAGE 105

Insulin stimulation/signals generating PIP3 PIP2 PIP3 extracellular Figure 15.Mechanism of Aktactivation Newly synthesized Akt(light blue circle) is phosphorylatedon the turn motif (Thr450 in Akt1) in an mTORC2 (dark orange) dependent manner. Signals generating phosphatidylinositol-3,4,5-triphosphate (PIP3) engage AktPH domain at the PM. Now the Aktactivation loop (Thr308) is exposed leading to PDK1 mediated phosphorylationand subsequent phosphorylationof hydrophobic motif (Ser 473) via mTORC2. Fully phosphorylatedAktis locked in an active conformation and translocatesthroughout the cell influencing downstream signaling (bottom right). Signaling isterminated by dephosphorylationof the lipid second messengers ( via PTEN) and direct dephosphorylationof Akt. PHLPP (red) directly dephosphorylatesthe hydrophobic motif. Protein phosphastase2 (PP2A) (red) has been shown to dephosphorylateThr308. Whether phosphorylationof Thr308 or Ser 473 comes first is still being debated. It has recently been proposed that Ser 473 precedes phosphorylationof Thr308. p85 p110 PI3K PTEN constitutive agonist evoked P HN CAkt/PKB mTORC2 N CAkt/PKB turn motif 450 N C PDK1 PH 1. Translocation 2. Phosphorylation 3. Dephosphorylation N C mTORC2 PP2A PHLPP hydrophobic motif 473 activation loop 308 d o w n s t r e a m s i g n a l i n g

PAGE 106

LiverGluconoegenesis Glycogenesis Glycogenolysis MuscleGlucose transport Glycogenesis Protein synthesis Alternative splicing AdipocyteGlucose transport Protein synthesis Lipogenesis Lipolysis Differentiation Pancreas -cell growth Insulin secretion Figure 16 Functional role of Aktin various tissues The role of Aktin liver, pancreas, muscle and adipocyteis shown. Images courtesy of iStockphoto.com.

PAGE 107

IRS1 PI3K PIP2 PIP3 PDK1 Akt 308 473 mTOR mTOR Rictor mSIN1 mLST8 Protor1 Raptor PRAS40 mLST8mTORC1 mTORC2 RAGA-RAGB RAGC-RAGD GTP RAGA-RAGB RAGC-RAGD GDP Amino Acids TSC1 TSC2 mTOR Rictor mSIN1 mLST8 Protor1 Rheb GTP Rheb GDP FKBP12 rapamycin S6K1 S270 4E-BP eIF4E GSK3 Cellular stress AMP AMPK Wnt LKB1 IKK Growth factors Ras Raf MEK ERK RSK IKK Insulin, IGF-1, TLR ligands Figure 17.Mechanism of mTORC activation mTORC1 phosphotransferase activity is stimulated by GTP-bound RHEB. RHEB is negatively regulated by the TSC heterodimer complex. TSC2 converts RHEB to its GDP-bound form (inactive). Amino acids cause t he Rag protein complex to be in its GTP (active) form and subsequently activate mTORC1. The PI3K-Akt, Ras-ERK and IKK pathways conver ge and activate mTORC1 by inhibiting the TSC complex or PRAS40. RSK kinase and IKK can activate mTORC1. The AMPK and GSK3 pathways negatively regulate mTORC1 by activating TSC2. AMPK can also directly inhibit Raptor. Both mTORC1 and mTORC2 can tur n off PRAS40 inhibition of mTORC1. Activated by growth factors, mTORC2 is the kinase complex responsible for phosphorylating Akt on Serine 473 and thus full Akt activation. However, by activatingmTORC1, mTORC2 causes a negative feedback loop that will blunt the PI3K-Akt signaling pathway. This is because mTORC1 activates S6K1 which will phosphorylate and inhibit IRS1. Downstream target s of mTORC1 are components of the translational machinery. mTORC1 ispotently inhibited by rapamycin. Green arrows indicate activat ion. Red arrows indicate inhibition.

PAGE 108

PInsulin Receptor IRS PIP3 PIP3 PI3K Akt PDK1 P P mTORC2 P PKC GLUT4GLUT4 storage vesicle par3 par6 Rab-GDP Rab-GTP 14-3-3 P P APS CAP Crk C3GTC10 GTP CIP4 Exo70 sec6 sec8 Cbl flotillin caveolin Figure 18.Model for insulin signaling PI3K and TC10 signaling pathways converge on GLUT4 storage vesicles to cause their translocation, docking, tethering and fusion with the PM. Green arrows indicate activation. Red arrows indicate inactivation. Black oval arrows indicate change in activity level. PHLPP VAMP2 syntaxin4 PKC SNAP23 Munc18c 80K-H TSC2 TSC1AS160 TBC1D1 AS160 TBC1D1 C a M RalA M y o 1 cActin cableGTP 14-3-3 C a M K I I Gapex-5 Rab31 GDP Rab31 GTP P P P P P P GLUT4GLUT4 storage vesicle VAMP2 Microtubules KIF5B Vb VaF-actin ACTN4 Rab5 GDP RabGDI Rab5 GTP PI(3)PPIP2 Rictor TUG

PAGE 109

AF-1 AF-1 N N DBD DBD Hinge Hinge LBD LBD AF-2 AF-2 C C 1 1 137 107181 211319 289 505 475 mPPAR 2 mPPAR 1 P-box Helix-1 D-box Helix-2 CTE T-box A-box Figure 19 Generalized structure of PPAR 1 and PPAR 2 Starting at the N-terminus, the AF-1 domain is a ligand-independent transcriptional activation function domain. Then the DNA-binding domain consisting of two highly conserved zinc-finger motifs. In the middle is a hinge region allowing flexibility for PPAR to dimerizeand bind DNA. Next is the ligand-binding domain (LBD) which has a second dimerizationinterface. Finally, the liganddependent activation function domain (AF-2). Numbers on top indicate amino acid number. Below is the detailed structure of the DBD.

PAGE 110

PPAR RXR Coactivator complexes PPAR RXR Corepressor complexesDNA-binding domain PPAR ligand Ligand-binding domain HDAC PPRE PPRE Figure 20 Ligand-dependent transactivation and active repression PPAR heterodimerizes with RXR (A) In the presence of ligands (natural or synthetic), PPAR binds to coactivator complexes which result in the activation of target genes. (B) In the absence of ligands, PPAR associates with corepressor complexes on target genes. These corepressors that also include histone deacetylases (HDACs) which lead to active repression of the promoter.AB

PAGE 111

Figure 21 Improved insulin sensitivity via TZD mediated adipocytePPAR activation TZD activation of PPAR leads to lipid storage in adipose tissue through target gene activation. Adipokinesecretion profile (center blue box) is also altered leading to increased peripheral tissue insulin sensitivity. Overall effects of reduced serum FFAsand beneficial adipokinesinclude reduced hepatic glucose output and increased skeletal muscle glucose uptake. PPAR also siphons macrophages towards an antiinflammatory M2 phenotype and reduces their infiltration into fat. Reprinted with permission, from the Annual Review of Biochemistry Volume 77 2008 by Annual Reviews www.annualreviews.org

PAGE 112

AD P P RS RS NL RRM 1 798 HCBDEAD box PPAR NRF-1 FXR L1L2L3 TRAP220 U1-70K SR proteins USF1/USF2 Figure22 Human PGC1 protein structure The N-terminal region contains the activation domain (AD). Two of the LXXLL motifs are present in the AD. The third LXXLL motif lies in the negative regulatory region. After L3 there are three p38 MAPK phosphorylationsites located within the negative regulatory (NR) region. Hostcell factor (HCB) is in a region that binds MEF2C protein. A novel DEAD box is located in human PGC1 (not mouse or rat). Directly downstream of the DEAD box are two putative casein kinase(CK) phosphorylationsites (CK1 and CK2). Rat and mouse contain only CK2. RS protein interaction domains followed by a nuclear localization (NL) signal and the RNA recognition motif (RRM). The C-terminal region has been shown to bind the TRAP220 mediator complex, splicing factors (U1-70K) and some transcription factors. MEF2C FOXO1 HNF4 CAR ERR GR, TR, LXR RXR, PPAR MR, ER, CAR, HNF4 SRC-1/CBP ERR MYBBP1a NR PPP

PAGE 113

92 EXPERIMENTAL PROCEDURES Cell Culture Mouse 3T3-L1 preadipocytes obtained from American Type Tissue Culture repository, ATCC (Manassas, VA) were maintained and passaged as preconfluent cultures in DMEM high glucose 4.5g/L (Inv itrogen, Carlsbad, CA) with 10% newborn calf serum (Sigma-Aldrich, St. Louis, MO) at 37oC and 10% CO2. Once confluent, cells were differentiated (day 0) in DMEM high glucose with 10% fetal bovine serum (Atlas Biological, Fort Collins, CO), 10 g/mL bovine insulin (Sigma), 1mM dexamethasone (Sigma), and 0.5mM isobutyl-1-methylxanthine (Sigma). On day 2, media was replaced with DMEM high glucose, 10% FBS, and bovi ne insulin. Day 4 and afterwards, cells were cultured in DMEM high glucose plus 10% FBS. Media was changed every two days. Prior to insulin treatment for gl ucose uptake or other assay, 4 hour serum starvation was accomplished by using DMEM high glucose without FBS. L6 rat skeletal myoblasts (obtained fro m Dr. Amira Klip, The Hospital for Sick Children, Toronto, Canada) were grown in MEM (Invitrogen) with 10% FBS to confluence at 37oC and 5% CO2. Myoblasts were fused into myotubes by changing media to MEM with 2% FBS for 2-4 days post confluence. Serum starvation was accomplished by using MEM for 6 hours.

PAGE 114

93 Rat aortic vascular smooth muscle cel ls (A10, ATCC CRL 1476) were grown in DMEM low glucose with 10% FBS at 37oC and 5% CO2. Once confluency was reached, cell synchronization was achieved by serum de privation (with 0.5% FBS) for 48 hours. HeLa cells (ATCC CCL-2) were grown in MEM (Invitrogen) with 10% FBS until confluent at 37oC and 5% CO2. Serum starvation was ach ieved by incubation with MEM (no serum) for 6 hours. Overexpression/Minigene Transient Transfection Transient transfection was accomplished using Trans IT-LT1 transfection reagent (Mirus Bio Corporation, Madison, WI) according to manufacturer s protocol. Briefly, L6 cells were cultured in 6-well plates until 60-75% confluent. 250 L serum-free MEM was mixed with 2.5 L Trans IT-LT1transfection reagent per 1 g DNA. DNA was added to this mixture and incubated for 30 minutes at room temperature. Trans IT-LT1 Reagent – DNA complex was added to cells (with comp lete growth medium) and incubated for 48-72 hours. Plasmids used were as follows: Gene of Interest Donor ID # pcDNA3.1/myc-His A vector control Invitrogen V800-20 PPAR Addgene Inc., (Cambridge MA) 8895 PPAR E499Q Addgene 8896 PGC1 Addgene 1026 PGC1 delta CTD Addgene 1030 SRp40 cDNA Dr. Rebecca Taub PMID: 9199345 SRp40 (myc) Hercules Apostolatos PMID: 15684423 HRS (myc) Hercules Apostolatos N/A pCMV GFP Addgene 11153

PAGE 115

94 siRNA Knockdown in L6 Sk eletal Muscle Cells L6 skeletal muscle cells were grown in 6-well plates. Cells were ready for transfection at 60-75% confluency. In one tube (per well), 5 L siPORT Neo FX Transfection Reagent (Applied Biosystems/Ambion, Austin, TX) was mixed with 95 L MEM (no serum). This was incubated 10 minutes room temperature. In another tube, RNA and MEM (no serum) were combined up to 100 L. Two tubes were mixed and incubated 10 minutes. siPORT Neo FX – RNA solution was added to cells. MEM (no serum) was added to a final volume of 2.5mL. After 6-8 hours, media was replaced with serum containing MEM. Gene silenced Species 5 – 3 Silencer siRNA (Ambion) Sense Sequence PPAR (ID#197812) Rat GCAUUUGUAUGACUCAUACtt PGC1 (ID#114748) Human GCCAACACUCAGCUAAGUUtt SRp40 (ID#198849) Rat GCUCUUUUAUAACUAAACGtt Silencer Negative Control #1 siRNA (#4611) Rat, Mouse, Human Proprietary siRNA Knockdown in 3T3-L1 Adipocytes Transfection of differentiated 3T3-L1 ad ipocytes was attempted using DeliverX Plus siRNA Reagent Solution (Panomics Inc., Fremont, CA). Day 8 3T3-L1 adipocytes were trypsinized and thinned on a 6-well plate. Transfection was performed the next day. The following is for transfection of 1 well of a 6-well plate. The siRNA working stocks were prepared in one tube by adding siRNA and Buffer-1 up to 50 L. The DeliverX Plus siRNA Transfection Reagent was sonicated (P/N DX0400, Panomics) for 5 minutes before usage to achieve a homogene ous solution. In another tube, 8 L DeliverX Plus

PAGE 116

95 siRNA Transfection Reagent and 42 L Buffer-2 were combined. This second tube was vortexed and sonicated for 5 minutes as befo re. The two tubes were combined, vortexed and incubated at 37oC for 20 minutes. 100 L Buffer-1 and 100 L Buffer-2 were added to the siRNA-DeliverX Plus Transfection Reagen t mixture. Just prior to usage, cells were washed several times with DMEM high glucose (no serum) to remove traces of serum. 300uL mixture was added to each well along with an additional 300 L DMEM high glucose (no serum) and incubated for 4 hours. After, 1mLof DMEM high glucose with 10% FBS was added. Medium was changed the next day. Knockdown was assessed at time points described. This tran sfection protocol was al so attempted on cells not trypsinized (100% confluent) without success. Gene Silenced Species 5 – 3 Silencer Select siRNA (Ambion) Sense Sequence PKC II Mouse CAAUCAGAAUUCGAAGGAUtt (Custom) PKC II Mouse AGAGCUAAGUAGAUCCGUAtt (Custom) Silencer Select Negative Control #1 siRNA (#4390843) Rat, Mouse, Human Proprietary Oil Red O Staining 3T3-L1 adipocytes were cultured on cham ber slides and fixed with 10% formalin in PBS, washed with PBS, and stained fo r 1 hour at room temperature with 0.15% Oil Red O (Sigma) (60:40 mix of isopropanol and water). Slides were evaluated for the accumulation of lipid droplets. Cloning the Minigene Construction of the PKC heterologous minigene wa s initiated by Hercules Apostolatos (H.A.). PCRs were performe d on rat cell DNA extracts to obtain the II and

PAGE 117

96 I exonic sequence and their flanking intronic sequence (as depicted in Figure 36). The primers (sequences listed with rest of pr imers) used and the products (visualized in Figure 36) obtained are summarized in the following table (performed by H.A.): Primer pair Restriction Enzymes (RE) Inserted 5 intronic length (not including RE) Exon length 3 intronic length (not including RE) Total size BII sense & ss1 antisense 5 XhoI, 3 BamHI 103bp 216bp 80bp 399bp BII sense & ss2 antisense 5 XhoI, 3 BamHI 103bp 216bp 120bp 439bp BII sense & ss3 antisense 5 XhoI, 3 BamHI 103bp 216bp 346bp 665bp BII sense & ss4 antisense 5 XhoI, 3 BamHI 103bp 216bp 684bp 1003bp BI sense & BI antisense 5 BamHI, 3 XbaI 422bp 150bp 7bp 579bp BII and BI fragments were digested w ith BamHI and ligated to produce a BII-BI fragment with relevant flanking intronic seque nce (H.A.). These fragments were in turn digested with XhoI and XbaI (H.A.). Th e pTNT cloning vector (Promega, Madison, WI #L5610) was also digested with XhoI and XbaI (H.A.). The BII-BI fragments, now with overhangs were ligated into the pTNT cloni ng vector (Figure 37)(H.A. and E.K.). The resulting vectors were used by H.A. to perform in vitro transcripion/splic ing assays. For use in mammalian cells, the BII-BI fragments would have to be cloned into a vector containing a promoter responsive to mammalia n cells. The pCMVTNT vector (Promega, #L5620) was used (Figure 38 & 39). The BII-BI fragments inside the pTNT vector were digested with XhoI and XbaI as was the pCMVTNT vector. The two were ligated. pCMVTNT BII-BI ss3 was tested by transfecting it into L6 skeletal muscle cells. However, using the CMV_FP1 and CMVRP1 primers (sequence listed below), many products were observed (Figure 40) due to the presence of a chimeric intron and T7-SP6-

PAGE 118

97 -globin exon within the pCMVTNT vector (Figure 41). To bypass this obstacle, pCMVTNT BII-BI plasmids were cut with BbsI and XhoI (Figure 40). The BII-BI fragments inside the pCMVTNT vector were PCRed out by using BbsI_CMV_F and ss1ss4 reverse primers (sequence listed below). This PCR fragment was digested with BbsI and XbaI and ligated to the digested pC MVTNT BII-BI vector (F igure 42). Of the resultant clones pCMVTNT BII-BI ss1 and ss4 (m inus the chimeric intron) were tested. Both the resultant ss1and ss4 clones were tran sfected into L6 skeletal muscle cells and resulted in appropriate splice products (Figure 43 & 44) using CMV_FP1 & B1R3 primers (sequence listed below). The ss4 clone was the most desired clone because it had the most intronic sequence thereby allo wing for more potential SR protein binding analysis. Because the ss4 sp lice products were in low a bundance, the decision was made to use the more responsive ss1 plasmid and re clone the additional splice sites into the ss1 clone (Figure 45). pCMVTNT ss4 was P CRed using BbsI_CMV_F & ss4 antisense primers to release the BII half of the ss4 fragment. Before this experiment could proceed, an additional BamHI located on the pC MVTNT ss1, had to be eliminated. This was done by starting from scratch and digest ing the original pCMVTNT vector with BamHI. This was blunted by Klenow fill-in and blunt ligated. The ss1 fragment was recloned from the pTNT ss1 vector as befo re (Figures 45). Now the PCR product and the pCMVTNT ss1 (-Chimeric intron) were di gested with BbsI and BamHI. The two were ligated. The resultant vector, pCMV TNT ss4 (-CI, -BamHI), was proven to be functional. To study the relationship between the PKC promoter and gene splicing, the CMV promoter was replaced with the human PKC promoter (Figure 46). To do this, PCR was

PAGE 119

98 performed using bprom_5 and bprom_AS primer s (sequence listed below) on Construct 5 PKC promoter Luciferase vector [121]. Th e resultant PCR product contained 2243bp of the human PKC promoter including the transcriptiona l and translational start site. The PCR product and pCMVTNT ss4 (-CI, -BamHI) we re digested with BsrGI and PstI, then ligated. The resultant vector was na med Bprom 2243 BII-BI ss4 (Figure 46). A subsequent truncated version was made to study a putative PPRE. To do this Bprom BIIBI ss4 was digested with BsrGI and SacI rest riction enzymes, then subsequently blunted and relegated. The resultant clone was na med Bprom 1143 BII-BI ss4 (Figure 47). Both Bprom clones were verified by restriction digestion and sequencing (Moffitt Cancer Center Sequencing Core). The splice produc ts of Bprom 2243 BII-BI ss4 were compared to that of the vector with the CMV pr omoter by sequencing and were found to be identical (Figure 48). Mutation of Putative PKC Minigene PPRE Mutation of the putative PPR E within the minigene PKC promoter was accomplished using the QuikChange Lightni ng Site Directed Mutagenesis kit #210515 (Stratagene, La Jolla, CA) according to ma nufacturer manual. The putative PPRE was a DR2 (direct repeat with 2 base pa irs separating). The putative PKC promoter DR2 was 5 – AGCTCA TCAGTTCA – 3 This DR2 PPRE was -1848bp upstream of the PKC transcript start sequence as defined by Ve ga Human TransView. The mutagenic forward primer named DR2_60_sense had the sequence of 5 – AAG GCA GGA TGT GGG CTG TGA GCT TCC CTT GTG TCA GTT CA A AGG AAA TCT ACT TCA GCA – 3 (red font denoting mutated nucleotides). Th e mutagenic reverse primer was named DR2_60_anti with a sequence of 5 – TGC TGA AGT AGA TTT CCT TTG AAC TGA

PAGE 120

99 CAC AAG GGA AGC TCA CAG CCC ACA TCC TGC CTT – 3 The resultant clone was named Bprom 2243 DR2 mut BII-BI ss4. RT-PCR RNA was extracted using RNA Bee (Tel Test Inc., Friendswood, TX), according to manufacturer s protocol. Reverse Tr anscriptase was performed using Omniscript RT kit (Qiagen, Valencia, CA, #205113) according to manufacturer s protocol. PCR was performed using rTaq PCR kit (#R001A, Taqara Bio Inc., Japan). Primers used for PCR reactions were as follows: Gene of Interest Species Primer Direction 5 – 3 Primer Sequence Overhang PKC II & PKC I (endogenous) Rat Forward GGC GTA TCC CAA GTC CAT GTC TA PKC II & PKC I (endogenous) Rat Reverse GGG TTA GTA TAC GAG AAG CCA GC PKC II only (endogenous) Rat Forward ATG AAA CTG ACC GAT TTT AAC TTC CTG PKC II only (endogenous) Rat Reverse CGG AGG TCT ACA GAT CTA CTT AGC TCT PGC1 Rat Forward CCC ACG ACT CCT CCT CAT AAA GC PGC1 Rat Reverse GGC GCT CTT CAA TTG CTT TCT GC PPAR Rat Forward GGC CCA CCA ACT TCG GAA TCA GC PPAR Rat Reverse CCG CCA ACA GCT TCT CCT TCT CG SRp40 Rat Forward CGC AGA CCT CGA AAT GAT AGA CG SRp40 Rat Reverse CGC CAC CCA CTT GAA GGA TAC TAC C PKC promoter Human Forward TTC TGT ACA GTT TAA CAG TAT CTG GAA C PKC promoter Human Reverse TTA CTG CAG GGG CTG TCA CTC GCC CAG CTG CTG GFP Forward CGT GCA GTG CTT CAG CCG CTA

PAGE 121

100 CC GFP Reverse CGG CGG CGG TCA CGA ACT CCA GC GATA 2 Mouse Forward CCG GGC TCT CCT GGT GTC TCT TAC GATA 2 Mouse Reverse GGC GGG CAC ATA GGA GGG ATA GG RUNX1 Mouse Forward CGG CCT CTC GCT ACC ACA CCT AC RUNX1 Mouse Reverse TCA GCT CAG TAG GGC CGC CAC AC HnrnpG Mouse Forward CCG GGA AAC CAA CAA ATC AAG AG HnrnpG Mouse Reverse CGT GGT GGA CCC CCG TAG CTA TC MZF1 Mouse Forward GCT TTG CCC ATG CCC TTG TAC TC MZF1 Mouse Reverse CGC CAC ACA CGA ACG GTC TCT C Nkx2-5 Mouse Forward GGG CGG ATA AAA AAG AGC TGT GC Nkx2-5 Mouse Reverse TGG GGT AGG GGT AGG CGT TGT AG Prrx2 Mouse Forward GCT CGC CGT GTC AAC CTC AGT G Prrx2 Mouse Reverse GAT GGA GAA AAG GCA CGG GAG AG AP2 Mouse Forward CCC CGC CCT ACC AGC CTA TCT AC AP2 Mouse Reverse TTC CGC CAC CGT GAC CTT GTA C GATA 1 Mouse Forward CG C CCA CTG ACC ATG AGG AAA G GATA 1 Mouse Reverse CCG GTG GGG AAG GAG GTT GTA G GATA 3 Mouse Forward CGG CCA CTC CAG TCC TCA TCT C GATA 3 Mouse Reverse CGG GTC TGG ATG CCT TCT TTC TTC SpiB Mouse Forward GGG GG A TGT GTG GCA GAG GTA TG SpiB Mouse Reverse CGG CCA GGG CTA CAC AGA GAA AC Spi1 Mouse Forward TTC CAG TTC TCG TCC AAG CAC AAG Spi1 Mouse Reverse GGG CGA CGG GTT AAT GCT ATG G

PAGE 122

101 FOXC1 Mouse Forward TGC CCC GGA CAA GAA GAT CAC TG FOXC1 Mouse Reverse CCG TTC TCC GTC TTG ATG TCC TG GAPDH Mouse Forward GAT GAT GGA GGA CGT GAT GG GAPDH Mouse Reverse GGC TGC AGG AGA AGA AAA TG GLUT4 Mouse Forward CGG TTC CTC ATT GGC GCC TAC TC GLUT4 Mouse Reverse CGA CTC GAA GAT GCT GGT TGA ATA G -actin Rat Forward GTG GGC CGC TCT AGG CAC CAA -actin Rat Reverse CTC TTT GAT GTC ACG CAC GAT TTC -actin promoter Mouse Forward AGC CAC AAA CCA AAG AGA GGG AC -actin promoter Mouse Reverse GTC AAT CAC CTT ACC TGG CTT AC PKC promoter 7091 Mouse Forward GTG TTA GCT TGC TTG AGG GTG TC PKC promoter 6903 Mouse Reverse GGA AAG GTA CCA CAA CTA AAA CAG PKC promoter 4384 Mouse Forward GTG TTG CCT GCA TTG GAG AGT AC PKC promoter 4183 Mouse Reverse CAC AAA CAA CAA AGC AGA ATA GC PKC promoter 1440 Mouse Forward GAC CGA ATG AGA CAG TGC ACA AG PKC promoter 1271 Mouse Reverse CCT GG T GTT GAG TTT AGC ATC TG PKC promoter -676 Mouse Forward TCC GGA TGA GTG ACA ATG AAA GC PKC promoter -492 Mouse Reverse CCA GCA ATG ACC AAA CGC CTA AG PKC C4B2 Mouse Forward TTA TAA ACC AAA AGC TTG TGG GCG PKC B2i Mouse Reverse GGA GG G ATT CCC TCT AGG GCA AAG CAG CC PKC B1 Mouse Reverse GGG AGT CAG TTC CAC AGG CTG CC

PAGE 123

102 Minigene primers BII sense Rat Forwar d GGG CTC GAG GAA AAA CCA CAC CCG GTT CC XhoI Ss1 antisense Rat Reverse CTA GAG TGG CCA TGT TTC AGT GAT CAA AT BamHI Ss2 antisense Rat Reverse GTT TGG AGC CAT CTT CGA GGT GAT CAA AT BamHI Ss3 antisense Rat Reverse CA T TCT TCC ACC TTC CCG GCT GAT CAA AT BamHI Ss4 antisense Rat Reverse CAT TTG GCA CTG TTC TTA GAT GAT CAA AT BamHI Bbs_CMV_F pCMV TNT Forward GCG AAG ACT CTT GCG AAA AAC CAC ACC CGG TTC C BbsI BI sense Rat Forward CTC GGA TCC ACA GGC GTT GTC ATT GAG TT BamHI BI antisense Rat Reverse CA T TAA TGT GTA GGT GAA TGT CTA GAC CA XbaI Bprom_5 Human Forward TTC TGT ACA GTT TAA CAG TAT CTG GAA BsrGI/ Bsp1407I Bprom_AS Human Reverse TTA CTG CAG GGG CTG PstI CMV_FP1 pCMV TNT Forward AGC TTT ATT GCG GTA GTT TAT C T7flgFP5 pCMV TNT Forward CAC CTG CAG AAG TTG GTC GTT AGG CAC TGG G CMV_RP1 pCMV TNT Reverse GGC CGC CCG GGT CGA CTC TAG B1R3 Rat Reverse AGT TTG TCA GTG GGA GTC AG Silver Staining 6% polyacrylamide (using 40% Acry lamide/Bis cat# 1610146 from Bio-Rad Laboratories, Hercules, CA) gel was prepare d. Samples were run on gel and put in 10% ethanol (Fisher) for 3 minutes. The ethanol wa s replaced with 1% nitric acid (Fisher) for 3 minutes. Gel was then rinsed three times with water and soaked in 0.1% silver nitrate (Sigma) for 10 minutes. After a quick wash with water, gel was developed using 6% sodium carbonate (Fisher) with 0.2% formalde hyde 37% solution (Fisher). Reaction was terminated with addition of 10N glacial acetic acid (Fisher).

PAGE 124

103 Agarose Gel 1% agarose gel (Fisher Scientific, Ag arose Molecular Biology Grade cat# BP1356) was made with ethidium bromide to detect nucleic acids. Western Blot Analysis Cell lysates were combined with 2X Laem mli Buffer (Bio-Rad Laboratories) with additional SDS up to 8%. Lysates were subjected to 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Gel proteins were electrophoretically transferred to Hybond-C Extra nitrocellulose membranes (Ame rsham, Piscataway, NJ). Membranes were blocked with Tris-buffered saline (B io-Rad), 0.05% Tween 20 (Bio-Rad) containing 5% nonfat dried milk, and then incubated w ith primary and secondary antibodies. The only exception was when probing for PKC II, where pig gelatin (Bio-Rad) was used for the blocking (3%), primary (1%) and seconda ry (1%). Detection was performed using SuperSignal West Pico Chemiluminescent substrate (Pierce Biotechnology, Rockford, IL). Antibodies used are as follows: PKC C-19, PKC C-20, PKC C-17, PKC I C-16, pPKC II/ Ser660, pPKC Thr 410, Akt1/2/3 H-136, pAkt1/2/3 Thr308, GLUT4 sc1608 (Santa Cruz Biotechnology In c., Santa Cruz, CA), PPAR 81B8, pIR Tyr 1150/1151, PKC #2056, phospho mTOR Serine 2481, PGC1 3G6, PU.1 9G7, pAkt Ser473 #4058, Adiponectin C45B10 (Cell Signaling, Boston, MA), GLUT4 C-Terminus 07-1404 (Millipore, Billerica, MA), -actin A5441, anti-flag M2 (Sigma). PKC II (NH2–(GC) EGFSFVNSEFLKPEVKS-COOH), SRp40 ( NH2-(GC) EVTFADAHRPKLNE-COOH), and SRp55 NH2-(GC) GERVIVEHARGPRRDRDCOOH) were raised by BioSynthesis Inc. (Lewisville, TX) and pur ified using Nab Protein A Pl us Spin Kit (Pierce #89948). Film bands were quantified using UnScan software (Silk Scientific, Orem, UT).

PAGE 125

104 Co-immunoprecipitation 3T3-L1 adipocytes were harvested with Cell Lysis Buffer (Cell Signaling #9803) with added protease inhibitors (Sigma Fast Protease Inhibitor Tablet, Sigma). 500 g cell lysate was pre-cleared with 50 L Protein A Magnetic Beads #S1425S (New England Biolabs, NEB, Ipswich, MA) for 1 hour 4oC with rotation. This step eliminated nonspecific binding of protein to magnetic beads. Lysate was separated from beads using Magnetic Separation Rack (#S1506S, NEB). 5 g PKC II antibody (sc-210, Santa Cruz) or GLUT4 (sc-7936, Santa Cruz) was incuba ted with pre-cleared lysate O/N 4oC with rotation. Lysates were now incubated with 50 L Protein A Magnetic Beads for 1 hour 4oC. Magnetic field was applied to separa te beads from unbound lysate. Beads were washed three times with cell lysis buffer. 75 L 2X Laemmli Buffer (Bio-Rad) with DTT was added to the beads. Samples were boile d for 10 minutes and loaded onto a 10% SDS PAGE gel. Real-time PCR Real-Time PCR reactions were performed using TaqMan Universal PCR MasterMix (Applied Biosystems (AB) In c., Foster City, CA, #4304437) according to manufacturer s protocol. Vi c-labeled mouse -actin was the endoge nous control (AB, #4352341E). PKC II primers and probe were custom made from AB. Forward primer 5 GGAGATTCAGCCACCTTATAAACCA 3 Reverse primer 5 GGTGGATGGCGGGTGAAAA 3 Fam-labeled probe (PKC 2/PKC 1 junction) 5 TTCGCCCACAAGCTT 3 Real-Time PCR was analyzed on the ABI PRISM 7900HT Sequence Detection System (AB).

PAGE 126

105 Glucose Uptake [3H]2-deoxyglucose uptake into differentia ted 3T3-L1 cells was measured in sixwell plates [411]. Briefly, cells were seru m starved with DMEM high glucose for 4 h. Media was then changed to 1mL Kreb s-Ringer HEPES (121mM NaCl; 4.9mM KCl; 1.2mM MgSO4; 0.33mM CaCl2; 12mM HEPES, pH 7.4) CGP53353 (Novartis, Basel, Switzerland) for 30 min 100nM pig insulin (Sigma) for 15 min. [3H]2-deoxyglucose (1 Ci per well) was added for another 4 min. The reaction was termin ated by addition of KRH with 25mM D-glucos e (Sigma) containing 10 M cytochalasin B (Sigma). Cells were washed, lysed with 0.1% sodium dodecy l sulfate, and radioa ctivity was counted using a Beckman Coulter LS 6500 Multi-Purpose Scintillation Counter Carrier-specific uptake was obtained by subtrac ting nonspecific diffusion of [3H]2-deoxyglucose into the cells in the presence of 10 M cytochalasin B. Counts were normalized to protein concentration using the BCA protein assay (Pierce). Subcellular Fractionation Subcellular fractionation was performed essentially by the method of Elmendorf et al. [412]. Three 25cm plates of cells we re used per condition in order to generate enough protein yield for the PM fractions. Af ter treatment, cells were rinsed with HEPES-EDTA-sucrose (HES) buffer. All subsequence steps were performed at 4oC. Each plate was scraped in 2mL HES bu ffer with 1X protease (Sigma) and 1X phosphatase (Sigma) inhibitors. This was followed by dounce homogenizing with 50 strokes using a Potter-Elvehjem grinder. The homogenate was cen trifuged at 19,000 g for 20 min. The resulting s upernatant was centrifuged at 41,000 g for 20 min. The highdensity microsomal fraction (HDM) pellet was resuspended in HES buffer. The

PAGE 127

106 supernatant was centrifuged at 180,000 g for 75 min, yielding the low-density microsomal (LDM) fraction pellet. The pell et from the initial 19,000 g spin was layered onto 1.12M sucrose cushion in HES buffer and centrifuged 100,000 g for 60 min. This yielded a white band at the interface [pla sma membrane (PM) fraction] and pellet consisting of nuclei/mitochondria (M/N fractio n). The PM fraction was resuspended in HES buffer and pelleted at 40,000 g for 20 min. Protein levels in each fraction were quantified using the BCA protein assay (Pierce). Plasma Membrane Sheet Assay 3T3-L1 cells were differentiated to da y 8 on BD BioCoat Collagen Type I 8-well CultureSlides. PM sheets were obtained using a modified protocol of Olson et al. [140]. Cells were swelled with three rinses of hypotonic buffer (23mM KCl, 10mM HEPES, 2mM MgCl2, 1mM EGTA [pH 7.5]). Swollen cells were sonicated and washed two times with sonication buffer (70mM KCl, 30mM HEPES, 5mM MgCl2, 3mM EGTA, 1mM dithiothreitol, 0.1mM PMSF [pH7.5]). PM sheets were fixed with 2% formaldehyde (70mM KCl, 30mM HEPES (pH7.5), 5mM MgCl2, and 3mM EGTA) at room temperature 20 min. Fixed membranes were quenched 15 min at 25oC in 100mM glycine-PBS (pH7.5). PM sheets were rins ed three times PBS and blocked 5% donkey serum (Sigma) 4oC O/N. They were then incuba ted with GLUT4 C-20 (Santa Cruz #1608) 1 hour, washed three times in PBS and incubated with donkey anti goat Alexa Fluor 488 secondary antibody (Molec ular Probes). PM sheets we re washed three times in PBS and incubated 15 min with Deep Re d Cell Mask Plasma Membrane Stain (Molecular Probes) as an intern al marker of membrane amo unt. Stained PM sheets were

PAGE 128

107 visualized with Leica SP2 laser confocal mi croscope and analyzed using Leica Confocal Software (Leica Microsystems Wetzlar GmbH, Germany). GLUT4 Exofacial Loop Translocatio n/Fusion Immunofluorescence Assay 3T3-L1 cells were differentiated to day 8 to day 12 on BD BioCoat Collagen Type I 8-well CultureSlides. This experiment was modeled after that of Yashamoti et al. [413]. After treatment, cells were washed quickly with PBS buffer and fixed with 4% formaldehyde 15 minutes room temperature. Cells were washed three times with PBS and incubated O/N 4oC with goat GLUT4 N-20 antibody (sc-1606 Santa Cruz) diluted in 3% donkey serum. Cells were washed th ree times with PBS and incubated 45 minutes with donkey anti-goat Alexa Fluor 594 (Molecula r Probes) diluted in 3% donkey serum. Cells were washed three times with PBS, dr ied completely and mixed with Vectashield mounting media with DAPI (Vector Laborator ies, Inc., Burlingame, CA) just before coverglass application. Cells were imaged and analyzed as mentioned in the plasma membrane sheet assay. Experiment was al so attempted by incubating live cells with primary antibody immediately after treatment for 30 minutes (with or without Cell Mask Plasma Membrane Stain, Molecular Probes), fixing 15 minutes after treatment and then incubating with secondary. This was done because even without detergent, GLUT4 antibody was penetrating the plas ma membrane. However, even with these modification, GLUT4 antibody was still able to pe netrate the plasma membrane. Immunofluorescence Measure of pAkt Ser473 3T3-L1 cells were differentiated to day 8 through day 12 on BD BioCoat Collagen Type I 8-well CultureSlides. After treatment, cells were washed quickly with PBS buffer and fixed with 4% formaldehyde 15 minutes room temperature. Cells were

PAGE 129

108 then blocked 60 min 1% BSA blocking soluti on with 0.05% saponin. Cells were then incubated with pAkt Serine 473 Antibody (#4058, Cell Signaling) in blocking buffer 4oC O/N. After washing three times with PBS, cells were incubated with combination of antirabbit Alexa Fluor 568 Secondary Antibody (#A11011, Molecular Probes), TO-PRO-3 nucleic acid stain (Molecul ar Probes) and RNase A ( #19101, Qiagen) 45 minutes, room temperature in the dark. The RNase A di gested the RNA so only the DNA (thus the nucleus) will show. Cells were washed fi ve times for five minutes with PBS. Vectashield mounting media w ithout DAPI (Vector Labs) was applied. Approximately 10 arbitrary fields were pict ured per condition. Experiment was repeated four times. Images in figure were processed using Image J software. Z-stack series from each field were stacked and shown as Z projection with maximum intensity.

PAGE 130

109 RESULTS TZDs and Alternative Splicing (A) Hela Cells TZDs are a class of drugs used for th e treatment of non-insulin dependent diabetes mellitus. The molecular target of these drugs is PPAR The main tissue target is adipose, which has robust PPAR expression. PPAR activation in this cell type leads to overall increased insulin sensitivity in peripheral insulin sensitive tissues. Insulin resistance occurs despite qualitatively and quantitatively normal insulin receptors. Therefore, the mechanism for increased glucos e disposal lies downs tream of the insulin receptor [414]. Initial experiments focuse d on determining whether there was a link between TZD treatment and increas ed alternative splicing of PKC II, which had been shown to be involved in mediating insulin-stim ulated glucose uptake in skeletal muscle cells [36; 40; 113]. The HeLa cervical cancer ce ll line was first tested. Cells were grown to confluency and serum starved for 6 hours. Cells were either treated with 50nM of bovine insulin or 1 M Pioglitazone for 24 hours. Piogl itazone was able to mimic the effects of insulin (30 min) on PKC alternative splicing. Relativ e to control, both insulin and Pioglitazone treated cells were able to regulate PKC such that PKC I mRNA decreased concomitant with increased PKC II mRNA expression (Figure 23). This was also novel in that it showed that HeLa cells e xpressed insulin receptors and that they were insulin responsive.

PAGE 131

110 TZDs and Alternative Splicing (B ) Vascular Smooth Muscle Cells TZDs increase insulin sensitivity in insulin-r esistant patients and animal models. However, they also beget other benefits th at may not be mutually exclusive to one another. These benefits include lower bl ood glucose, decreased circulating free fatty acids and triglycerides, lower blood pressu re, reduced inflammatory markers, and reduced atherosclerosis [313]. PPAR is expressed in vascul ar endothelial cells and v ascular s mooth m uscle c ells (VSMCs). Proliferation and migration of VSMCs are essential in the progression of atherosclerosis. Infla mmation is considered a key stimulator of this proliferation and migration. PPAR activation can suppress the expression of TNF -induced expression of inflammatory genes such as VCAM-1, MCP1 and fractalkine via inhibition of NF B [415]. Yamamoto et al. has shown that PKC II expression is associated with decreased VSMC proliferation [41]. A possible link between TZDs and PKC II mediated effects on VSMCs was examined. Figure 24 shows A10 rat VSMCs treated with 1 M Pioglitazone for 26 hours increased the mRNA expression of PKC II while decreasing the mRNA expression of PKC I. However, A10 cells proved difficult to culture and synchronize. The focus turned to L6 rat skeletal muscle cells which represent the main insulin responsive tissue re sponsible for glucose disposal. These cells divide and differentiate rapidly making them an ideal cell line. TZDs and Alternative Splicing (C ) L6 Skeletal Muscle Cells Skeletal muscle represents a major in sulin-reponsive tissue where most glucose disposal occurs. TZDs result in improved whole-body glucose disposal which includes skeletal muscle [416]. However, it is unclear whether this effect on skeletal muscle is a result of indirect actions such as lowe ring FFAs or TZDs can actually exert effects on

PAGE 132

111 skeletal muscle signaling. Thus, a possi ble link between TZDs and skeletal muscle signaling was explored. Using L6 cells, 1 M Pioglitazone for 24 hours was able to mimic 100nM bovine insulin for 30 minutes in terms of PKC II mRNA expression (Figure 25). When Pioglitazone and insulin were combined, there was a synergistic increase in PKC II mRNA expression. Pr otein expression of PKC II revealed a similar trend whereby 1 M Pioglitazone was able to mimic 45 or 60 minutes of 100nM bovine insulin (Figure 26). SRp40 overexpressi on was also able to increase PKC II expression. Three SRp40 constructs were used. After th is experiment, only the construct donated by Dr. Rebecca Taub was used. This data is in concurrence with previous Cooper lab data showing SRp40 enhancement of PKC II alternative splicing [ 37; 38; 211]. RT-PCR detection of PKC I using primers for both PKC I and PKC II was sporadic and not reliable. PKC II mRNA Regulated by Overexpression of PPAR PGC1 and SRp40 Since the main target of TZDs is PPAR overexpression of PPAR was next assessed along with overexpression of PGC1 and SRp40. PGC1 expression favors the slow twich, oxidative muscle fiber type [372] and this fiber type has increased insulinstimulated glucose uptake [417] Possible regulation of PKC via PGC1 would explain the enhanced ability for glucose uptake musc les obtain during TZD treatment. As shown in Figure 27, overexpression of PPAR PGC1 and SRp40 and combinations of the three resulted in increased mRNA expression of PKC II compared to control. The combination of all three constructs may ha ve been too much and thus created an imbalance. This is maybe why th ere is a slight decrease in PKC II levels compared with combinations of two constructs.

PAGE 133

112 Functionality of PGC1 C-terminal Domain PGC1 upregulation of PKC II mRNA necessitated the question of which domain was critical in mediating this effect The C-terminal domain was thought to be the critical effector because it provided th e bridge between nuclear receptors and the mediator complex as well as serving as a land ing pad for splicing factors [361]. In fact, SRp40 has been confirmed to bind PGC1 [362]. Figure 28 shows that overexpression of CTD mutant PGC1 led to a decrease in PKC II mRNA expression (compared with control) versus wild-type PGC1 which resulted in an expected increase in PKC II mRNA in L6 cells. TZDs Influence PKC Expression Level and Alternative Splicing Since PGC1 is able to participate in both tr anscription and splicing, it seemed reasonable that TZD treatment may work in a similar mechanism in relation to the PKC gene. L6 cells were treated with either 1 M Pioglitazone or Rosiglitazone for 24 hours. Both TZDs were able to increase the protein expression of PKC II while keeping PKC I relatively constant (Figure 29). This suggest ed TZDs could influence transcription and splicing preferentially selecting the PKC II isoform. Rosiglitazone seemed to perform even better than Pioglit azone in terms of PKC II induction. Hypothesis #1: TZDs Co-transcriptionally Regulate PKC Gene Expression Data obtained up to this point led to th e hypothesis that TZDs were able to cotranscriptionally regulate the PKC gene, thereby mimicking the insulin signaling cascade (Figure 30). This woul d result in increased transcription as well as increased alternative splicing that would favor the PKC II isoform. This phenomenon would come to fruition via TZD-mediated activation of PPAR PGC1 would bind PPAR Even

PAGE 134

113 though PPAR does not have to be active to bind PGC1 PPAR activation would be required for PKC promoter activation. PPAR -bound PGC1 C-terminal domain would serve as a landing pad for splicing factors that have a positive regulatory effect on PKC II exon inclusion. These splicing factors w ould eventually be dropped off to the CTD of RNA polymerase II. Selective SR protein recruitment (e.g. SRp40) would result in RNA polymerase II pausing at the weak PKC II 3 splice site (intr onic sequence just before PKC II exon). This pause would result in enhanced recognition of the weak splice site and thus greater PKC II exon inclusion. TZD treatme nt could regulate factors downstream of the insulin signaling pathwa y, bypassing upstream insulin signaling that may be dysfunctional in the insulin -resistant or diabetic state. Role of Overexpressed PPAR on PKC Protein Levels The ability of PPAR overexpression to induce PKC co-transcripional splicing was assessed. 1 or 3 g PPAR cDNA construct was transfected into L6 cells for 72 hours. Figure 31 shows that PPAR overexpression (regardless of dosage) was able to increase protein expression of both PKC I and PKC II isoforms. However, this is not the same mechanism of control as compared with TZD treatment. PPAR expression appears to exert more of a transcriptional effect on the PKC gene since PKC I is increased too. The ligand-dependent AF2 tran scriptional activator domain appears to be necessary for the increase in PKC II protein levels. Overexpr ession of an AF2 mutated PPAR construct resulted in an increase in PKC I protein expression but no increase in PKC II protein expression (Figure 32).

PAGE 135

114 Role of Overexpressed PGC1 on PKC Protein Levels PGC1 overexpression was utilized to determ ine whether it could more closely mimic the effects of TZD tr eatment in terms of PKC co-transcriptional splicing in L6 cells. As shown in Figure 33, PGC1 overexpression (both 2 and 4 g) mimicked TZD treatment and resulted in increased PKC II protein expression while PKC I protein expression was little cha nged. Establishing PGC1 overexpression was difficult. The flag antibody did not work for this tagged protein and the endogenous PGC1 antibody could barely be detected. Effect of siRNA Knockdown of PPAR PGC1 and SRp40 on PKC II mRNA A knockdown strategy using 24 hour transf ected siRNA was next employed to determine whether endogenous levels of PPAR PGC1 or SRp40 are influential in generating PKC II. In Figure 34, knockdown of PPAR and PGC1 resulted in reduced PKC II mRNA levels. In the case of PPAR knockdown, PKC II mRNA levels went further down with 24 hour treated 1 M Rosiglitazone. However, this may be due to experimental design. Since the drug was added near the time of transfection, the transfection reagent may have reacted with Rosiglitazone causing a change in L6 signaling. Rosiglitazone trea tment could not rescue PKC II mRNA levels in PGC1 knockdown cells. Figure 35 shows that SRp40 is necessary for PKC II alternative splicing. This had been pr edicted based on earlier Cooper lab data but had not been shown with SRp40 siRNA. Again, Rosiglitazo ne treatment was unable to rescue PKC II mRNA levels most likely because of the same experimental design flaws described above. Even Rosiglitazone with scrambled siRNA had no effect on PKC II, suggesting inhibition of the drug by th e transfection reagent.

PAGE 136

115 Generation of Heterologous PKC Promoter-driven PKC Minigene To determine whether PPAR had a direct effect (via binding) on the PKC promoter, a heterologous PKC minigene was created as outlined in the Experimental Procedures section and illustrated in Figur es 36-48. This ultimately resulted in a minigene that had the BI and BII exons with sufficient flanking intronic sequences. In addition, the minigene was under the control of 2243bp of the human PKC promoter. Figure 48 shows that this PKC minigene was functional si nce transcriptional products mimicked those of the CMV promoter constr uct. The BI and BII mRNA products were confirmed by sequencing The minigene was also shown to be responsive to 2nM phorbol ester treatment (Figure 49). TPA activ ated the promoter and increased both BI and BII products. GFP expression is used to assess transfection efficiency because its expression is not governed by TPA treatment. Effect of TZD on PKC Minigene TZD treatment results in co-trans criptional splicing of endogenous PKC To assess if this effect was related to a direct effect on the PKC promoter, the minigene was transfected for 48 hours and concomitan tly the cells were treated with 1 M Pioglitazone for 24 hours as seen in Figure 50. Pioglitaz one was able to directly affect the PKC promoter and increase alternative splicing. The result is drama tically increased BII minigene product. PPAR -mediated PKC Transcriptional Regulation: Direct vs. Indirect? Logical progression led to co-trans fection of the minigene and PPAR to assess whether PPAR may be able to bind to a putative PPRE on the PKC promoter. The minigene construct without the PKC promoter co-transfected with PPAR had no effect

PAGE 137

116 on either the BI or BII minigene products. Conversely, the minigene construct with the PKC promoter co-trans fected with PPAR had a dramatic effect on both minigene products (Figure 51). The only caveat of this ex periment is that vector control was able to increase the BI minigene product. This ma y be due to unintended effects of the control vector on the PKC promoter. Still, PPAR overexpression was able to elicit expression of the BII minigene product. Co mpared with vector control, PPAR decreased minigene BI expression. This da ta indicates that PPAR affects the PKC promoter and regulates alternative splicing as well as transcription. To test whether there was a direct binding between PPAR and the PKC promoter, the truncated PKC promoter minigene construct was utilized. Within the upstream region of the PKC promoter insert, there is a putative DR2 PPRE as described in Experimental Procedures. From bioinfor matic analysis (Nuclear Hormone Receptor Scan software), this putative PPRE wa s the most promising of the 2243 PKC promoter sequence. The truncated PKC promoter construct lack ed this DR2 PPRE. PPAR was co-transfected with both PKC promoter constructs. Fi gure 52 revealed that PPAR was not acting through this putative DR2 PPRE. Either PPAR was acting on a more distal PPRE or PPAR was affecting the PKC promoter indirectly through regulation of other transcription factor or coactivators. Role of TZDs in 3T3-L1 PKC II Expression It was determined that the mouse 3T3-L1 pre-adipocyte cells might be a better system for examining effects of TZDs on PKC co-transcriptional splicing in 3T3-L1 mouse pre-adipocyte cells. This cell m odel seemed a good candidate because during differentiation into adip ocytes, they express high levels of PPAR which is the target of

PAGE 138

117 TZDs [418; 419; 420]. In additi on, 3T3-L1 cells synthesize PPAR agonists such as 15dPGJ2 [421] and a yet to be identified potent ligand that materializ es at the onset of differentiation, lasts 48 hours, then disappears [422]. Figure 53 a-d demonstrated 3T3-L1 differentiation (day 0 to day 6) using phase contrast microscopy. Figure 53 e-h depicted accumulation of lipid droplets (red) from day 4 to day 6 via Oil Red O staining. Oil Red O is a fat soluble dye (lysochrome) that stai ns triglycerides. The purpose of this stain was to confirm differentiation protocol befo re proceeding to further experimentation. The first experiment in 3T3-L1 cells focused on establishing a link between TZD treatment and PKC co-transcriptional splicing base d on the experiments performed in L6 skeletal muscle cells. As depicted in Figure 54, differentiating 3T 3-L1 cells at day 4 and 6 were chosen for TZD treatment. It was known that by day 4, copious amounts of PPAR were expressed. Because culture conditions had not yet been completely established, both low and high glucose media were used. 1 M rosiglitazone for 24 hours activated PPAR The evidence of this is that the level of PPAR (both 1 and 2) decrease with Rosiglitazone treatment. PPAR activation via TZDs increased PPAR proteasomal degradation. This effect is not necessarily dependent on transcript ional activation but is dependent on the AF2 domain [423]. PPAR activation had no discernable effect on either PKC I or PKC II protein levels on day 4 or day 6. However, there was a dramatic change in the expression of PKC isoforms during the span of these two days. From day 4 to day 6, PKC II expression increased over 6.6 fold while PKC I expression was reduced roughly 1.5 fold. This data was c onsistent with a report stating that the expression of PKC (no isoform distinction) increa sed at least 10 fold from pre-

PAGE 139

118 adipocytes to adipocytes [419]. This app eared to be a novel fi nding which represented developmentally regulated PKC co-transcriptional splicing. Discovery of Novel Differentiation-regulated PKC Alternative Splicing in 3T3-L1 Cells The experiment was repeated but include d more days of differentiation. Figure 55 shows that again, 1 M Rosiglitazone failed to change the ratio of PKC isoforms during differentiation even though PPAR was being activated. But it was clear that PKC II was heavily induced during differentiation while PKC I was concomitantly decreased. PPAR and GLUT4 both served as markers of adipocyte differentiation. This experiment was again repeated (without TZD treatment) but probed for additional proteins of interest. Figure 56 spans from day 0 to day 12. PKC was regulated as before. PKC II expression peaks at day 8 and th en expression plateaus. PKC has a similar expression pattern as PKC II with very low levels at day 0, peaks at day 8 and then plateaus. Longer exposures of the PKC blot revealed possible additional splice variants. Seven splice variants have been reported in mice testis [424]. From the 20 sec exposure, four putative PKC splice variants were visible. From the 15 min exposure, the remaining three putative PKC splice variants were visible. Phospho PKC II/ antibody probing was very interesting. Th is antibody detects the phospho epitope of PKC II S660 and PKC S662. The band displayed was al most certainly that of phospho PKC PKC was not expressed on day 0 and should not be phosphorylated regardless of the day in the absence of external stimuli such as insuln. PKC has been reported to undergo biphasic serum-mediated phosphor ylation in fibroblasts [425]. PKC peaked at day 2 then tappers off. This was consistant with the literature which states that PKC is

PAGE 140

119 downregulated during adipogenesis [426]. PKC also has a similar expression pattern to that of PKC II. However, its expression was very low in the early days with a dramatic jump from day 6 to day 8. After day 8, there was a precipitous fall in PKC expression. Initially, PKC was reported to be only in the brain and spinal cord [11]. However, a recent paper has described PKC expression in 3T3-F442A cells [48]. We believe this to be the first report of PKC expression in 3T3-L1 cells. PKC expression steadily increased during adipogenesis p eaking at day 6, afterwhich is precipitously drops. This pattern is similar to that desc ribed by Ways et al.[426]. PPAR GLUT4 and adiponectin are used as markers of differentiation. -actin indicates relativ ely equal loading. Real-Time PCR Confirms PKC II Adipogenesis Protein Expression Patterns Real-Time PCR following the mRNA expression pattern of PKC II during adipogenesis revealed a similar expression prof ile to protein with a peak at day 6 then plateauing (Figure 57). Real-Time PCR was also performed using primers specific for PKC I but this was unsuccessful. Hence, PK C isozyme-specific expression, with peaks of PKC II, PKC and PKC were a hallmark of adipocyte differentiation. Use of Distal PKC II polyA Tail During 3T3-L1 Differentiation The PKC II mRNA transcript has two possible polyA tails to use as reported [427] and illustrated in Figure 5. To determ ine which polyA tail was used by adipocytic PKC II, RT-PCR was performed with indicated primers (Figure 58) that distinguish polyA tail usage. RNA was collected from bot h day 0 and day 8 3T3-L1 cells. Only the PKC II transcript containing the distal polyA tail showed up. GAPDH is a housekeeping gene used as a loading control and PPAR indicates adipocyte differentiation.

PAGE 141

120 Hypothesis #2: PKC II Can Regulate GLUT4 Expression Previous Cooper lab data had shown that knockdown of PKC II in L6 skeletal muscle cells resulted in reduced GLUT4 prot ein expression levels ( unpublished). In 3T3L1 cells, PKC II and GLUT4 expression appear at roughly the same time. It was thought that PKC II may regulate GLUT4 expression. To test this hypothe sis, knockdown of PKC II would be necessary. Transfection of one of two PKC II specific silencer select siRNA was attempted using siRNA transfection reagents from Ambion (siPORT NeoFX), Mirus Bio (TransIT-TKO) and Panomics (DeliverX Plus). In the case of DeliverX Plus, this reagent is supposedly tailored for differentiated 3T3-L1 adipocytes. However, none of the above reagents gave any significant knockdown of PKC II (Figure 59). Further re search into the literature revealed that differentiated 3T 3-L1 adipocytes are notoriously difficult to transfect if not impossible [428; 429]. Electroporation is also no t feasible for this cell line with very low efficiency and low cell survival. Lentiviral transduction has been reported to have success [430]. However, there is onl y one available construct for the PKC II. Due to this uncertainty, this aim was put on hold. Regulation of PKC Promoter During 3T3-L1 Differentiation Differentially regulated PKC alternative splicing suggests an important role for PKC II in adipogenesis and adipocyt e function. Therefore, the f actors that regulate this differential alternative sp licing necessitated further inspection. The mouse PKC promoter was examined for putative transc ription factors that also had expression patterns similar or opposite (for negative regulator s) to those of PKC II during adipogenesis. Figure 60 shows RT-PCR of RN A samples from day 0 to day 6 for factors

PAGE 142

121 that had their respective cons ensus binding sites on the PKC promoter. AP2, also known as f atty a cid-b inding p rotein 4 (FABP4), is responsible for fatty acid transport in adipocyte. It is a marker of terminal adi pocyte differentiation. It can also influence transcription. Interestingly, FABP4 can cooperate with PPAR to regulate gene expression [431]. GATA1 is a transcription f actor that can inhib it PU.1 transcriptional activity [432]. GATA2 (assayed for later) and GATA3 are transcription factors known to inhibit adipocyte differentiation [433]. Su rprisingly, GATA3 expression goes up even though it is supposed to inhibit differentia tion. hnRNP G can influence alternative splicing [434] and is downregulat ed at least ten fold from th e pre-adipocyte to adipocyte stage [419]. RUNX1 is a transcription factor that was reveal by a chromatin immunoprecipitation screen to bind the human PKC promoter [435]. MZF-1 is a transcription factor belongi ng to the Kruppel family of zinc finger proteins [436]. Figure 61 shows RT-PCR and protein expr ession of PU.1. PU.1 was considered the most promising transcription factor due its many putative consensus binding sites blanketing the PKC promoter as well as its confirmed role in bridging transcription and splicing [405]. PU.1 has been re ported to inhibit the differe ntiation of 3T3-L1 cells in concert with GATA2. Howeve r, this was done using overexpression systems which may indicate threshold dynamics. In this sa me paper, PU.1 mRNA and protein expression were shown to increase over the course of di fferentiation which is consistent with data shown in Figure 61 [437]. Also shown in Fi gure 61 is the protein expression of SRp40, a splicing factor that could possibly contribute to PKC alternative splicing during adipogenesis based on its role in L6 skeletal muscle cells [37; 38; 211]. SRp55, another

PAGE 143

122 splicing factor that is regulated by insulin [38], may influence PKC alternative splicing (unpublished). Using the Chromatin Immunoprecipitation assay, PU.1 is shown to bind the 3T3L1 PKC promoter at various spots at both day 0 and day 8. SRp40 seems to also display affinity for the PKC promoter (Figure 62). This led to a third hypothesis. Hypothesis #3: Developmental Regulation of PKC Splicing by PU.1 PU.1 would be able to bind the PKC promoter during the course of 3T3-L1 adipocyte differentiation and influenc e the developmental regulation of PKC alternative splicing. It would accomplish this by recrui ting coactivators (while simultaneously displacing corepressors), which would then bind splicing factors such as SRp40 that would ultimately result in the PKC II exon inclusion. The next step would have been to knockdown PU.1 during differentiation and assess PKC mRNA and protein levels. However, due to the extreme difficulties in transfecting differentiated 3T3L1 cells (as mentioned above), this aim was postponed. Linking PKC II with 3T3-L1 Adipocyte Insulin -stimulated Glucose Transport At the same time, the possibility of PKC II regulation of glucose uptake in 3T3L1 adipocytes, was being explored. Previous studies show that PKC II was critical in mediating glucose uptake in skeletal muscle cells, another insulin-s ensitive tissue [40]. CGP53353 is an inhibitor of cPKCs with greatest affinity for PKC II (see Table 7). It was anticipated that the inhibitor might provide evidence of a role for PKC II in 3T3-L1 adipocyte ISGT. Figure 63a is a dose curve showing 50 M CGP53353 attained an 85% inhibition of ISGT compared to insulin alone in 3T3-L1 adipocytes day 8 to day 12. Figure 63b shows this 50 M dose within a complete experiment with control and drug

PAGE 144

123 control. CGP53353 inhibited ISGT over 6 fold compared to insulin alone. Drug alone had no effect on basal glucose uptake levels comp ared with control. In addition to this, LY379196, another PKC selective inhibitor, was used. Figure 64a is a dose curve showing that LY379196 (with insu lin) can inhibit ISGT at 50 M. Next, both 25 and 50 M LY379196 were able to significantly i nhibit ISGT (3 fold and ~4.3 fold respectively) with no effect on basa l glucose uptake (Figure 64b). CGP53353 Specificity A kinase assay via western blot was next pursued to affirm that CGP53353 was specifically inhibiting PKC II and not other critical insulin signaling effectors. Figure 65 shows that insulin caused phosphorylation of both PKC II S660 and insulin receptor Y1150/1151. Only PKC II S660 phosphorylation is inhibi ted with drug. The antibody targeting PKC II also targets phospho PKC S662 (thick lower band). Phospho PKC migrates at 78kDa on the gel whereas phospho PKC II migrates at 80kDa on the gel. Large gels were run longer in order to obtain reasonable separation between the two bands. The phosphorylation status of PKC PKC and the insulin receptor were unaffected by the drug. Total PKC II levels remained constant. This led to the last hypothesis. Hypothesis #4: PKC II Regulates 3T3-L1 Adipocyte ISGT in Part via GLUT4 Trafficking or GLUT4 Fusion PKC II s ability to regulate ISGT in adipoc ytes was likely due to an effect on GLUT4 translocation or late-stage GLUT4 fusi on. The rationale be hind this was a report demonstrating the ability of PKC II to phosphorylate Akt at S473 [438]. Fully active Akt is required for late stage GLUT4 transl ocation [184]. Also, in 3T3-L1 adipocytes,

PAGE 145

124 PLD1 mediates GLUT4 fusi on to the PM [141]. PKC II (not PKC I) has been shown to bind and activate PLD1. PLD1 activity caused PKC II (not PKC I) to translocate to a juxtanuclear subset of recycling endosomes (presumably where GLUT4 is located) [439]. In skeletal muscle cells, PLD1 membrane lo calization is regulated via insulin-stimulated PKC II [113]. Subcellular Fractionation Points to a Role for PKC II in GLUT4 Translocation To test whether GLUT4 transloca tion was being affected by CGP53353 inhibition, subcellular fractio nation assays were performe d. As shown in Figure 66, insulin caused a redistribution of GLUT4 from the low-density microsomes (LDM) to the plasma membrane (PM). Without insulin st imulation, GLUT4 remained in the LDM. Addition of CGP53353 dramatical ly blocked insulin-stimulated GLUT4 translocation to the PM. Cytoplasmic fractions were also western blotted and probed for -actin to show that protein concentrations measured by the BCA protein assay were accurate. It also shows that cell death was not responsible for the trends observed. Numerous other proteins were tested as intern al controls of protein loadi ng. For the PM fraction, insulin receptor, TNF Receptor 1 & 2, APMAP (a dipocyte p lasma m embrane a ssociated p rotein) were tested. For the LDM fraction, IR S1 levels were tested. However, insulin and/or CGP53353 treatment affected the expressi on and/or stability of these proteins and thus they could not be used as cont rols. In addition to cell surface GLUT4, phosphorylated GLUT4 was assessed by probi ng the PM fraction for pGLUT4 S488 (Santa Cruz). Earlier reports indicated that PM GLUT4 C-terminal phosphoserine is reduced in insulin-stimulated rat adipocyt es. This has led to speculation that phosphorylation of the GLUT4 C-terminus may actually inhibit its intrinsic activity

PAGE 146

125 [440]. We were intere sted to see if PKC II inhibition altered GLUT4 s phosphorylation status and likely its folding/ binding partners. However, we were unable to detect any phospho GLUT4. This was also the case in whole cell lysate. Other methods are needed to increase antibody sensitivity. PM Sheet Assay Affirms a Role for PKC II in GLUT4 Translocation A second method was sought to definitively link PKC II to GLUT4 translocation. The PM sheet assay (Figure 67) reveals a simila r trend to that of s ubcellular fractionation in 3T3-L1 adipocytes day 8 to day 12. Insulin treatment illuminated GLUT4 staining (Figure 67b). However, this staining wa s abrogated (~3.8 fold) when treated with CGP53353 (Figure 67d). Staining with Deep Red Cell Mask Plasma Membrane Stain shows relatively equal PM protein content (Figure 67e-h). The merger of insulinstimulated GLUT4 can be seen with PM proteins (Figure 67j). Hence, PKC II is likely regulating adipocyte ISGT through regul ation of GLUT4 translocation. In addition to regulating GLUT4 translocation, PKC II was believed to regulate GLUT4 fusion to the PM. This was because PKC II can bind and activate PLD1 which is responsible for insulin-stimulated GLUT4 fusion to the PM [19; 141]. Immunofluorescence was used to measure GL UT4 that had fused to the PM. When GLUT4 is fused to the membrane, there is a large exofacial N-terminal loop that protrudes into the extracellula r space (Figure 11). Sant a Cruz Biotechnology has an antibody that recognizes this e xofacial loop. The protocol fo r this experiment was based on that performed by Fulcher et al. [413] (Experimental Procedures). Formaldehyde fixed cells were incubated with the an tibody with no permeabilizing detergents. However, the antibody was still able to pene trate the PM and stai n the entire cell.

PAGE 147

126 Despite this, there was a suttle trend. Insulin was often able to aggregate GLUT4 near the nucleus, possibly the perinuc lear region where GLUT4 reside s before translocating to the PM in an insulin-dependent manner (Figure 68b). CGP53353 treatment prevented this formation resulting in a more dispersed localization around the nuc leus (Figure 68d). PKC II (and possibly other cPKCs) may have a ro le in basal state and insulin-stimulated GLUT4 intracellular trafficking. Bioinforma tic analysis of GLUT4 protein sequence revealed a putative PKC phosphorylati on site beside the C-terminal i nsulin-r esponsive m otif (IRM), LXXLXPDEX(D/E). The GLUT4 IRM has been shown to be crucial for insulin-stimulated GLUT4 redistribution to the PM [441]. Anot her attempt to use immuno-fluorescence was made by first incubati ng the live pre-formaldehyde fixed cells with the GLUT4 antibody followed by fixation (fixation was also attempted after secondary antibody). The antibody was still ab le to penetrate the PM. Primary or secondary antibodies that are bulkier must be made in order to perform this assay. The GLUT4 exofacial loop can be gl ycosylated (Figure 11). N-gl ycosylation at this site (possibly mediated by Golgin-160) may be necessa ry for ISGT [442]. It is possible that the antibody was made to recognize only the unglycosylated loop. This would mean a new antibody that recognizes that glycosylated loop woul d have to be raised and developed. PKC II Regulation of Akt Activity As mentioned earlier, activ ated Akt is required for GLUT4 translocation [184]. PKC II has been shown to regulate Akt S 473 (S473) phosphorylation in a cell and stimulus-specific manner [438]. To that extent, we investigated whether PKC II could regulate Akt activity in 3T3-L1 adipocytes. Insulin treatment induced the dramatic

PAGE 148

127 appearance of T308 and S473 phosphoryla tion (Figure 69). CGP53353 treatment decreased S473 phosphorylation over 17 fol d. Phosphorylation of T308 remained relatively constant with CGP53353 treatment. This was consistent with the literature where T308 is regulated by PDK1 (via insulin) and S473 is regulated by a separate PDK2 (possibly PKC II) and that S473 phosphorylation is not dependent on T308 phosphorylation [174; 175; 229]. It is important to note that PKC II may be regulating phosphorylation of mouse Akt1 at S473, Akt2 at S474, Akt3 at S472 or any combination thereof since this antibody recognizes the phosphorylated hydrophobic motif of all three Akt isoforms. From here on, Akt phosphorylation at the hydrophobic motif will be referred to as Akt S473 since the anti body was labeled as phospho Akt S473. Immunofluorescence Confirms Role for PKC II in Phosphorylation of Akt S473 To confirm PKC II as a possible PDK2 that regulates Akt S473 phosphorylation, immunofluorescence was performe d on 3T3-L1 adipocytes from day 8 to day 12. Insulin stimulated dramatic staining of phospho Akt S 473 (Figure 70b) as expected. PM staining as well as intracellular aggregation staining n ear the nucleus was apparent. Treatment with CGP53353 eliminated staining of phos pho Akt S473 (Figure 70d). DAPI staining for nuclei could not be used because th e short wavelengths caused high background fluorescence of CGP53353 drug. TO-PRO3 was used to avoid this problem with an emission spectrum around 633nm. TO-PRO3 st ains nucleic acid, DNA and RNA. In order to select for DNA (nucleus), incuba tion of TO-PRO3 was performed along with RNaseA treatment (Figure 70e-h).

PAGE 149

128 PKC II Downstream of mTORC2 but Upstream of Akt The mTORC2 complex was shown by Sarbassov et al. to regulate phosphorylation of Akt S473 [174]. Phos phorylation of mTOR kinase at S2481 distinguishes activated mTORC2 from mTOR C1 [61]. However, it is known that mTORC2 is also responsible for phosphorylation of PKC II/PKC at the turn motif which allows the kinases to undergo aut ophosphorylation at the hydrophobic motif [54; 55]. This suggested that PKC II is activated by mTORC2 and then goes on phosphorylate Akt S473, thus fully activating Akt. Figure 71 shows insulin stimulated mTORC2 activation via phosphorylation of mT OR S2481. Insulin has been shown to similarily activate mTORC2 in HEK293 cells [61]. CGP53353 treatm ent did not alter the phosphorylation status of mTOR S2 481. This indicated that PKC II was likely downstream of mTORC2. Integrating the role of mTORC2 represen ted a more mechanistic overview of how PKC II was exerting its effects. Before mTORC2 was pursued, another promising putative PKC II substrate was examined. PLD1 is cr itical in 3T3-L1 adipocyte ISGT by enabling fusion of GLUT4 to the PM [141]. PKC II is capable of phosphorylating and activating PLD1 [19]. Using two commer cial antibodies for both PLD1 and phospho PLD1, detection was attempted by western bl otting whole cell lysate s, western blotting PM and cytosolic fractions and immunofluorescence. An in vitro PLD1 activity assay (Amplex Red, Invitrogen) was al so performed. None of these experiments could detect PLD1 or its activity. This could have been due to low abundance of PLD1 or low PLD1 anitgenicity or low stoichiometric activity.

PAGE 150

129 Insulin-stimulated Binding of PKC II to mTORC2 Data from Figure 71 showed that PKC II (using Santa Cruz antibody for IP which is different than the custom made PKC II antibody used in Figures 56 & 65) was likely being activated by mTORC2 before ha ving the capability to phosphorylate Akt S473. Co-immunoprecipitation showed that insu lin stimulated direct binding between PKC II and mTORC2 (Figure 72 lane 3). Th is binding was dramatically reduced by CGP53353-mediated inhibition of PKC II (lane 5). Immunoblotting for PKC II with the same antibody used for co-immunoprecipitati on was unsuccessful. Several additional antibodies were utilized without success including a mouse PKC II antibody (Sigma P2584) and a mouse PKC antibody (PKC A-9 Santa Cruz #17804) that recognizes all PKC isoforms. Perhaps PKC II is extremely sensitive to degradation or antigenicity is severely reduced upon cell lysis. Insulin-stimulated Binding of PKC II to Akt Figure 73 provides preliminary evidence that PKC II is able to bind Akt. PKC II co-immunoprecipitates with Akt that is phos phorylated at S473 suggesting that PKC II could be the kinase that directly phosphorylates Akt at S473. The membrane was reprobed with PKC II. This was unsuccessful due to reasons discussed. The conditions for the reverse co-immunoprecipitation are being worked out. Co-immunoprecipitation Between PKC II and GLUT4 Co-immunoprecipitation was performe d to assess possible binding of PKC II to GLUT4. As mentioned earlier, bioinformatic analysis indicated multiple PKC substrate sites spanning murine GLUT4. Akt had been shown to bind GLUT4-containing vesicles and then phosphorylate their component proteins in response to insulin [182]. It was

PAGE 151

130 hypothesized that PKC II could act in a similar fashion. Figure 74 shows that IP with PKC II resulted in increased GLUT4 band intens ity compared to rabbit IgG control. However, probing for PKC II (after IPing with PKC II) yielded nothing, which was expected. IP with GLUT4 an tibody was able to pick up PKC II and this was stimulation independent. GLUT4 band intensity for this wa s weak but still slightly higher than IgG control. Whole cell lysate probing for GLUT4 using the specified antibody was unsuccessful. This was unexpected for GLUT4 and is probably due to using an antibody different than the one used on other blots. Re peating this assay yiel ded similar results. This experiment still leaves open the possibility that PKC II is able to directly influence insulin-stimulated GLUT4 trafficking, po ssibly through phosphoryl ation of vesicle component proteins in additi on to regulating Akt activity.

PAGE 152

Figure 23. TZD Pioglitazonemimics insulins effect of increased PKC IIexoninclusion in HeLacells HeLacells were grown as described and serum starved for 6 hours. Cells were treated with either 50nM bovine Insulin (15 or 30 minutes) or 1 M Pioglitazone 22 hours. Total RNA was extracted followed by RT-PCR using the endogenous PKC II-PKC Iprimers (compatible with rat). Samples were run on a PAGE gel and silver stained. Experiment was repeated twice. I0 I15 I30 PKC II PKC I PioRT-PCR:

PAGE 153

Pio-+ PKC II PKC I Figure 24. Pioglitazoneincreases PKC IIexon inclusion in A10 vascular smooth muscle cells. A10 cells were grown as described and serum starved for 48 hours. 26 hours prior to harvesting, cells were treated 1 M Pioglitazone26 hours. Total RNA was extracted followed by RT-PCR using the endogenous PKC II-PKC Iprimers or -actinprimers. Samples were run on a PAGE gel and silver stained. -actin RT-PCR:

PAGE 154

Figure 25. Pioglitazonecombined with insulin synergistically increases PKC IIexon inclusion in L6 skeletal muscle cells L6 skeletal muscle cells were grown as described and serum starved 6 hours prior to treatment with 100nM bovine insulin (15 or 30 minutes). For wells treated with 1 M Pioglitazone24 hours, treatment began 24 hours before harvesting. Pioglitazonewas re-added to appropriate wells during serum starvation. (a) Total RNA was extracted followed by RT-PCR using the endogenous PKC II-PKC Iprimers (compatible with rat). Samples were run on a PAGE gel and silver stained. (b) Graphical representation of PKC IImRNA expression in arbitrary scan units derived from pixels. Experiment was repeated twice. PKC II -actin Ins 0 15 30 -30 Pio---+ + Contr ol Ins 15m Ins 30m Pi o Ins 30m + Pio 0 20000 40000 60000 80000PKC II(a) (b)RT-PCR:

PAGE 155

Figure 26. Pioglitazonetreatment and SRp40 overexpressionmimic insulins upregulationof PKC IIprotein levels (a) L6 skeletal muscle cells were grown as described and serum starved for 6 hours. Cells were either treated with 100nM bovine insulin (15, 30, 45 or 60 minutes), treated with 1 M Pioglitazone24 hours (re-added after serum starvation) or transfectedwith 1.6 g SRp40 (constructs). Protein was harvested and western blot performed. (b) Graphical representation of PKC IIprotein levels in arbitrary units. Ins 0 15 30 45 60 ---Pio-----+ --PKCII -actin SRp40 ------TaubmycHRSmyc I ns 0 Ins 15 Ins 30 I ns 45 Ins 60 P io SRp40 SRp4 0 HRS 0 100000 200000 300000 400000PKC II(a) (b) IB:

PAGE 156

Figure 27. Overexpressionof PPAR PGC1 and SRp40 individually or in combination are able to increase PKC IIprotein expression. (a)L6 skeletal muscle cells were transfectedwith 2ug of either PPAR PGC1 or SRp40 (name construct for SRp40) for 48 hours. Total RNA was extracted followed by RT-PCR using PKC IIonly primers or -actinprimers. Samples were run on a PAGE gel and silver stained. (b) Graphical representation of PKC IIprotein levels in arbitrary units.PPAR PGC-1 SRp40 PKC II -actin C ont rol PPAR + PGC1 PPAR + S R p4 0 + PGC1 P PA R PGC1 S R p4 0 0 20000 40000 60000 80000 100000PKC II(a) (b)RT-PCR:

PAGE 157

C o n t r o l P P A R P G C 1 P G C C T DPKC II -actin Figure 28 CTD of PGC1 is necessary for PKC II exoninclusion L6 cells were transiently transfectedwith transfectionreagent alone, 2 g PPARg, PGC1-a, or PGC CTD for 48 hours as indicated above. (a) Total RNA was extracted followed by RT-PCR using endogenous PKCbIIspecific primers. PCR for b-actinserves as an internal control. (b) Graphical representation of PKC II mRNA expression in arbitrary units. Control P P A R P G C 1 C T D P G C 0 100000 200000 300000 400000PKC II(a) (b)RT-PCR:

PAGE 158

Figure 29. TZDsRosiglitazoneand Pioglitazonestimulate PKC cotranscriptional splicing (a) L6 skeletal muscle cells were treated with either DMSO vehicle control, 1 M Rosiglitazoneor 1 M Pioglitazonefor 24 hours. Protein was harvested and western blot was performed. Experimentwas repeated two times. (b) Graphical representation of PKC II/PKC Iprotein levels in arbitrary units.DMSO -+ -ROSI --+ PIO ---+ PKC II PKC I -actin C o nt rol DMSO R osi Pio 0.0 0.2 0.4 0.6 0.8 1.0PKC II/PKC I(a) (b) IB:

PAGE 159

Figure 30. Hypothetical model of TZD mechanism Pioglitazonewould activate PPAR allowing it to bind to the PKC PPRE. PPAR would recruit PGC1 which would then serve as a landing pad for SRp40 and other splicing factors, thereby influencing the alternative splicing of PKC

PAGE 160

PKC II PKC I -actin PPAR --1 3 VC -+ -Figure 31. PPAR overexpressionincreases both PKC Iand PKC IIprotein levels (a) L6 skeletal muscle cells were transfectedwith either 3 g vector control, 1 g PPAR or 3 g PPAR for 72 hours. Whole cell lysatewas run on gel for western blot detection. Experiment was repeated two times. (b) Graphical representation of PKC II/Actinprotein levels in arbitrary units. (c) Graphical representation of PKC I/Actin protein levels in arbitrary units. Control VC g 1 P P A R g 3 P P A R 0.0 0.5 1.0 1.5PKC II/Actin C o n t rol VC PP A Rg 1mg PPARg 3mg 0.0 0.5 1.0 1.5 2.0PKC I/Actin(a) (b) (c) IB:

PAGE 161

Figure 32. Ligand-binding domain is necessary for PPAR mediated upregulationof PKC IIprotein levels (a) L6 skeletal muscle cells were transfectedwith either 2 g vector control, PPAR or mutant PPAR E499Q for 72hrs. Protein was harvested and western blot was performed. PPAR E499Q is a mutant in the AF2 domain. It binds PPAR ligandswith comparable affinity as wild-type, but no ligand-dependent transcriptional activation. (b) Graphical representation of PKC II/Actinprotein levels in arbitrary units. (c) Graphical representation of PKC I/Actinprotein levels in arbitrary units. PKC II PKC I Flag -actin PPAR --+ E499Q ---+ VC -+ -C ont rol V C P P A R E 4 9 9 Q P P A R 0 1 2 3 4PKC II/Actin Control V C P P A R E 4 9 9 Q P P A R 0.0 0.2 0.4 0.6 0.8PKC I/Actin(a) (b) (c) IB:

PAGE 162

PKC II PGC1 PKC I -actin PGC1 --2 4 VC -+ -Figure 33. PGC1 overexpressionmimics TZD stimulation of PKC IIco-transcriptional splicing (a) L6 skeletal muscle cells were transfected72 hours with 4 g vector control, 2 or 4 g PGC1 Whole cell lysatewas run on gel for western blot detection. Experiment was repeated two times. (b) Graphical representation of PKC II/PKC Iprotein levels in arbitrary units. Cont r ol V C g 2 g 4 0.0 0.2 0.4 0.6 0.8 1.0PKC II/PKC I(a) (b) IB:

PAGE 163

-actin PKC II PPAR PGC1 PPAR siRNA----+ + PGC1 siRNA--+ + -Scrambled siRNA+ + ---Rosiglitazone-+ -+ -+ (a)RT-PCR: Figure 34 PPAR or PGC1 knockdown reduces basal PKC II mRNA L6 skeletal muscle cells were transfected with 10nM of either scrambled siRNA, PPAR siRNAor PGC1 siRNAfor 24 hours and concomitantly treated 1uM Rosiglitazonefor 24 hours. (a) Total RNA was harvested followed by RT-PCR using specified primers. PKC II was detected using primers that detected endogenous PKC II & PKC I. (b) Graphical representation of PKC II protein expression levels in arbitrary units. Sc r am b le d Scram b led + Rosi s i P G C 1 + R o s i s i P G C 1 s i P P A R + R o s i s i P P A R 0 50000 100000 150000PKC II(b)

PAGE 164

-actin SRp40 PKC II Figure 35 SRp40 knockdown results in lower basal PKC II protein levels. L6 skeletal muscle cells were transfectedwith 10nM scrambled siRNAor SRp40 siRNAfor 24 hours and concomitantly treated 1uM Rosiglitazone for 24 hours. (a) Total RNA was harvested followed by RT-PCR. PKC II was detected using primers that detected endogenous PKC II & PKC I. (b) Graphical representation of PKC II protein expression levels in arbitrary units.SRp40 siRNA--+ + ScrambedsiRNA+ + -Rosiglitazone-+ -+ S cr Scr + Ros i si S R p40 siSRp4 0 + R o si 0 10000 20000 30000 40000 50000PKC II(a) (b)RT-PCR:

PAGE 165

Rat genome 1q36 II exon I exon II exon II exon II exon II sense II -sense ss1 ss2 ss3 ss4 I sense I -sense ss1 ss2 ss3 ss4 BamHI I exon I exon I exon Figure 36 PCR on rat genomic DNA. PCR yielded the PKC II and PKC I exonswith their respective flanking intronic sequences.

PAGE 166

II exon II exon 216bp 150bp 3ss5ss 3ss BP BP PPT PPT pTNT cloning vector Figure 37. The BII-BI fragment digested and inserted into the pTNTcloning vector.

PAGE 167

Figure 38. pCMVTNTvector used for mammalian cell expression.

PAGE 168

II I ss3 pTNT XhoI XbaI XhoI XbaI pCMVTNT Figure 39. BII-BI fragments cloned into pCMVTNTvector for mammalian cell expression.

PAGE 169

Figure 40. Multiple minigeneproducts L6 skeletal muscle cells were transfectedfor 48 hours 0.7ug GFP or 2ug CMVTNT BIIBI ss3 (Mss3) and treated 100nM bovine insulin for indicated time points. RNA was extracted followed by RT-PCR using CMV_FP1 and CMV_RP1 primers. Product prediction to the right represents best guess. BII* represents a possible BII product wi th an additional splice site(s) or has a cryptic splice site. BI BII unspliced BII* GFP + ----Ins --60 45 30 15 M ss3 -+ + + + + primers

PAGE 170

CMV promoter T7 SP6 -globin 5ss 3ss BPChimeric Intron II I BP BP 5ss 3ss 3ss Poly-A AMPr 5ss 3ss ? ? XhoI XbaI BbsI Figure 41. Chimericintronremoved Chimericintronremoved from the CMVTNT BII-BI clones via digestion.

PAGE 171

5ss II IBP BP5ss3ss 3ss AMPr CMV promoter Poly-A XbaI BbsI XbaI BbsI pCMVTNT vector Figure 42. PCR generates BII-BI fragment with different overhangs PCR was performed on CMVTNT BII-BI clones to lift out the BII-BI fragments with BbsIrestriction site on the 5 end and a XbaIrestriction site on the 3 end. These were then inserted into the CMVTNT vectors missing their chimericintrons.

PAGE 172

II I 5UTR 3UTR I 5UTR 3UTR 5ss II I BP BP5ss3ss 3ss AMPr CMV promoter Poly-A Figure 43. Predicted splicing events from CMVTNT BII-BI ss1 clone (-CI) Two main hypothetical products, BII (top right) and BI (bottom right) are shown from CMVTNT BII-BI ss1 clone without chimericintron(-CI).

PAGE 173

Figure 44. Products observed after transfectionof CMVTNT BII-BI clones L6 skeletal muscle cells were transfectedwith 0.7ug GFP 1.5ug pCMVTNT(-CI) BII-BI ss1 (Mss1) or pCMVTNT(-CI) BII-BI ss4 (Mss4). In addition each well was serum starved and treated with 100nM bovine insulin 60 min. Total RNA was extracted followed by RT-PCR using CMV_FP1& B1R3 primers. 54oC or 52oC was used as the annealing temperature. GFP BI BII unknown 1Kb+ Mss1Mss4 Mss1Mss4 GFP 54oC 52oC

PAGE 174

pCMVTNT II I ss4 BbsI BamHI II CMV TnT BamHI II I BP BP AMPr CMV promoter Poly-A 5ss 3ss 3ss 5ss Figure 45. Cloning ss4 fragment into ss1 vector BamHIsite was removed from the original pCMVTNTvector. BIIBI ss1 was re-cloned into the pCMVTNTvector, again losing the chimericintron. Now, the ss4 fragment was lifted out via PCR and inserted into the pCMVTNTBII-BI ss1 vector.

PAGE 175

2200bp PKC Promoter II I BP BP AMPr CMV promoter Poly-A 5ss 3ss 3ss 5ss 2200bp PKC Promoter Figure 46. Replacing CMV promoter with human PKC promoter Human PKC promoter was lifted out from another a Luciferasevector using PCR and then cloned into the pCMVTNT(-BamHI, -CI) BII-BI ss4 vector.

PAGE 176

II I BP BP AMPr Poly-A 5ss 3ss 3ss 5ss 2 2 0 0 b p P K C P r o m o t e r II I BP BP AMPr Poly-A 5ss 3ss 3ss 5ss 1 1 4 2 b p P K C P r o m o t e r 2200bp PKC Promoter BsrGI SacI Figure 47. Truncation of full length PKC promoter The full length PKC promoter was truncated via digestion and blunt ligation.

PAGE 177

II I 5UTR 3UTR I 5UTR 3UTR CMV Beta Figure 48. PKC promoter-driven expression of BII and BI minigeneproducts L6 skeletal muscle cells were transfectedwith either 2 g CMVTNT (-)BamHIBII-BI ss4 or prom 2243 BIIBI ss4 for 48 hours. RNA was harvested and RT-PCR was performed for both PKC beta minigene products using CMV_FP1 and CMV_RP1 primers. Product legend is shown to the right. Product identity was confirmed by sequencing.RT-PCR:

PAGE 178

GFP + + + Minigene-+ + TPA --+ Ethanol -+ II I (a)RT-PCR: Figure 49. TPA induces transcription of PKC promoter minigene L6 skeletal muscle cells were transfectedwith GFP expression vector prom 2243 BII-BI ss4 vector for 48 hours. Additionally, one plate was treated for 24hrs with 2nM TPA (phorbolester) dissolved in ethanol. (a) Total RNA was extracted followed by RT-PCR using T7flgFP5 & CMV_RP1 primers. PCR for GFP shows transfection efficiency. (b) Graphical representation of BII expression in arbitrary units. (c) Graphical representation of BI expression in arbitrary units. No Minigene E t han ol T PA 0 200000 400000 600000 800000 1000000PKC II No M inigene E t ha n ol TPA 0 100000 200000 300000 400000PKC I(b) (c)

PAGE 179

Contr o l Pio DMSO 0 20000 40000 60000PKC II PIO -+ DMSO --+ II I GFP Figure 50.TZD induces co-transcriptional splicing of minigene L6 skeletal muscle cells transfectedwith prom 2243 BII-BI ss4 vector for 48 hours and were treated with either DMSO solvent control (24hrs) or 1uM Pioglitazone(24hrs). (a) RNA was harvested followed by RT-PCR using CMV_FP1 & B1R3 primers. GFP was a measure of transfectionefficiency. (b) Graphical representation of BII express ion in arbitrary units. (c) Graphical representation of BI expression in arbitrary units. Control Pio DMSO 0 100000 200000 300000 400000 500000PKC I(a) (b) (c)RT-PCR:

PAGE 180

PPAR GFP BI BII CMV TNT (-) BamHI BII-BI ss4 CMV TNT (-) BamHI BII-BI ss4 Luc5 VC -+ --+ PPAR --+ --+ Figure 51 PKC promoter responsive to PPAR overexpression L6 skeletal muscle cells transfected48 hours with 0.5 g GFP either 2.5 g CMVTNT BII-BI ss4 or 2.5 g Bprom2243 BII-BI ss4 1 g PPAR or 1 g vector control. RNA was harvested followed by RT-PCR using CMV_FP1 & B1R3 primers.RT-PCR:

PAGE 181

II I GFP PPAR G FP + + + + + + PPAR -+ + -+ + Full length promoter Truncated promoter (a)RT-PCR: Control P P A R P P A R Co ntrol P P A R P P A R 0 100000 200000 300000PKC I Contr ol P P A R P P A R C ont rol P P A R P P A R 0 100000 200000 300000 400000 500000PKC II(b) (c) Figure 52. PPAR does not target putative DR2 on PKC promoter of minigene L6 skeletal muscle cells were transfectedwith GFP, prom 2243 BII-BI ss4 or prom 1143 BII-BI ss4 2 g PPAR .(a) Total RNA was extracted followed by RT-PCR using CMV_FP1 & B1R3 primers. GFP shows transfection efficiency. (b) Graphical representation of BII expression in arbitrary units. (c) Graphical representation of BI expression in arbitrary units.

PAGE 182

Day0Day2Day4Day6 Figure 53. 3T3-L1 differentiation (a-d) Phase contrast of 3T3-L1 differentiating cells from day 0 to day 6. (e-h) Oil red O staining of 3T3-L1 differentiating cells from day 0 to day 6. (a) (b) (c) (d) (e) (f) (g) (h)

PAGE 183

PKC II PKC I PPAR 2 PPAR 1 -actin Glucose HG HGLG LGHG HGLG LG Rosi-+ -+ -+ -+ DAY 4 DAY 6 (a) IB: Day4 Day6 0 20000 40000 60000*PKC II D a y 4 Day6 0 50000 100000 150000 200000 250000*PKC I(b) (c) Figure 54. PKC splicing is developmentally regulated 3T3L1 pre-adipocytecells were cultured in DMEM high (4.5g/L) or low (1g/L) glucose for 4 or 6 days and treated 24 hours with 1 M Rosiglitazone. (a) Whole cell lysatewas extracted followed by Western blot analysis. (b) Graphical representation of PKC II protein expression in arbitrary units. (c) Graphical representation of PKC I protein expression in arbitrary units.

PAGE 184

Figure 55: Rosiglitazonehas no effect on developmentally regulated PKC splicing 3T3L1 pre-adipocytecells were cultured in DMEM low glucose (1g/L) for 0 to 8 days treated 24hrs with 1 M Rosiglitazone. Whole cell lysatewas extracted followed by Western blot analysis.Day 0 2 2 4 4 6 6 8 Rosi--+ -+ -+ PKC II PKC I PPAR 2 PPAR 1 GLUT4 -actin IB:

PAGE 185

GLUT4 PKC I PKC II -actin PPAR 1 PPAR 2 Day 0 2 4 6 8 10 12 (a) PKC PKC 5 sec PKC 20sec PKC 15min PKC pPKC II(Ser660)/ (Ser662) PKC Adiponectin IB: 0 2 4 6 8 10 1 2 0.0 0.5 1.0 1.5 2.0* * **DayPKC II/Actin(b) 0 2 4 6 8 10 1 2 0.0 0.5 1.0 1.5PKC I/Actin* * * *Day(c) Figure 56. 3T3-L1 PKC (and other PKC isoform) protein expression during differentiation. (a) 3T3-L1 pre-adipocyteswere differentiated from day 0 through day 12. Whole cell lysates(50 g protein) from each day were run on an SDS-PAGE gel and probed with the indicated antibodies via western blotting. Experiments wererepeated three times. (b) Graphical representation shows PKC II/actin, where represents a statistically significant increase in PKC IIprotein level as compared with day 0 using arbitrary units. (c) Graphical representation of PKC I/actin, where* represents a statistically significant decrease in PKC Iprotein level as compared with day 0 using arbitrary untis. Unpaired t-test (p<0.05) was performed using Prizm5 (GraphPadSoftware, Inc., LaJolla, CA, USA).

PAGE 186

Figure 57. Differentiating 3T3-L1 PKC II mRNA expression mimics protein expression 3T3-L1 preadipocyteswere differentiated from day 0 through day 10. 2 g from each day was used for reverse transcription. Real Time analysis was performed using arbitraryunits as described in Materials and Methods. represents a statistical significance in terms of fold change of PKC II/actinmRNA compared to day 0 using unpaired t-test, p<0.05. Experiment was repeated three times. % Basal * * 0 2 4 6 8 10 0 500 1000 1500Day of Differentiation

PAGE 187

Figure 58 Differentiating 3T3-L1 adipocytesuse distal polyAtail for PKC II alternative splicing RNA of 3T3-L1 pre-adipocytes (Day 0) and 3T3-L1 adipocytes(Day 8) were extracted. RT-PCR from 2 g RNA was performed using indicated primers. C4B2 indicates the forward primer spanning the C4 exonPKC II exonjunction. B2i indicates the reverse primer binding on the intronicsequence downstream of the PKC II exonbut upstream of the proximal polyAtail. B1 indicates the reverse primer that binds on the PKC I exon. C4 C4 PKC II PKC II PKC IAAAAAD a y 0 D a y 8 C4B2B2i C4B2-B2i C4B2-B1 PPAR GAPDH AAAAAC4B2B1 RT-PCR:

PAGE 188

Figure 59.Differentiated 3T3-L1 adipocytesnot transfectable Day 5 3T3-L1 adipocytes were transfectedwith 10nM siRNAtargeting PKC II and harvested on Day 8. Lysateswere run on SDS-PAGE gel and immunoblottedwith indicated antibodies.C o n t r o lPanomics 10nM si71690 C o n t r o lMirus 10nM si71690 PKC II -actin IB:

PAGE 189

RUNX1 HnrnpG GATA1 GATA3 AP2 Mzf1 Figure 60. 3T3-L1 transcription factor mRNA expression during adipogenesis 3T3-L1 cell RNA was harvested on the indicated day of differentiation. 2 g RNA was used for RT-PCR using primers for the gene indicated on the right side. Day 0 2 4 6 RT-PCR:

PAGE 190

PU.1 -actin Day 0 2 4 6 8 10 Day 0 2 4 6 8 10 12 PU.1 SRp40 Figure 61. PU.1 expression through adipocytedifferentiation Day 0 through Day 10 adipocyteswere harvested for RT-PCR. Day 0 through Day 12 adipocyteswere harvested for Western Blot analysis. 2 g RNA was used for RT-PCR with primers for the product specified. 50 g protein was loaded on SDS-PAGE and probed with indicated antibodies. SRp55 IB:RT-PCR:

PAGE 191

Day0 Day8 Day0 Day8 Day8 Day0 Day0 Day8 Day0 Day8N e gA M L 1 P U 1 G a t a 1 G a t a 2 S R p 4 0 I n p u t-7091 to -6903 -4384 to -4183 -1440 to -1271 -676 to -492 -actin Figure 62 ChIPof mouse PKC promoter Day 0 pre-adipcoytesand Day 8 adipocytes were harvested for ChIPanalysis as mentioned in Materials and Methods. Antibodies corresponding to the names given at the top of the figure were used to assess transcription factor binding. Left Y axis numbers represent the forward and reverse primer positions relative to the PKC 1 transcript start as defined by Vega Mouse TransView(Mouse Genome Informatics, MGI). All PCRswere performed with the same amount of cycles, primers and template.PCR:

PAGE 192

0 10 20 30 40 50 60 0 10 20 30 40 50 60 70 80 90 M CG53353% glucose uptake inhibition Control Insuli n 53 53 w/Insul i n 0.0 2.5 5.0 7.5 10.0* pmol/mgxmin(b) (a) Figure 63. PKC IIinhibition via CGP53353 attenuates adipocyteglucose uptake Day 8 to day 12 3T3-L1 adipocyteswere serum starved for 4 hrs, 30 min 50 M CGP53353, 15 min 100nM insulin. Glucose uptake assay was performed as described in Methods and Materials. (a) Dose curve shows the percentage decrease in glucose uptake when comparing insulin vs. drug with insulin. ( b) Graphical representation of 50 M treatment where represents a statistically significant decrease (using arbitrary units) in glucose uptake comparing insulin vs. drug with insulin, using unpaired t-test, p<0.05. Experiments were repeated three times.

PAGE 193

C o nt r ol I nsulin M L Y 2 5 M w / I L Y 2 5 M L Y 5 0 M w / I L Y 5 0 0 200 400 600* pmol/mgxmin Figure 64. PKC inhibition via LY379196 attenuates adipocyteglucose uptake. Day 8 3T3-L1 adipocyteswere serum starved for 4 hrs, 30 min 25 or 50 M LY379196, 15 min 100nM insulin. Glucose uptake assay was performed as described in Methods and Materials. (a) Dose curve shows the effect of increasing drug concentrations on glucose uptake comparing insulin vs. drug with insulin. (b) Effect of 25 or 50 M drug concentrations on glucose uptake. In both graphs, represents a statistically significant decrease in glucose uptake (using arbitrary units) comparing insulin vs. drug with insulin, using unpaired t-test, p<0.05. Experiments wer e repeated three times. In s LY 100nM + In s M + I n s L Y 1 M + I n s L Y 5 M + I n s L Y 1 0 M + I n s L Y 5 0 0 100 200 300 400* pmol/mgxmin(b) (a)

PAGE 194

pIR Tyr1150/1151 pPKC Thr410 PKC II pPKC Ser662 pPKC II Ser660 C o n t r o l I n s u l i n 5 3 5 3 w / I n s -actin C o ntro l Insulin 53 53 w/I n s u l i n 0.00 0.02 0.04 0.06* pPKC 2/pPKC (b) (a) Figure 65. CGP53353 specifically targets PKC IIphosphorylation Day 8 3T3-L1 adipocyteswere serum starved for 4 hrs, 30 min 50 M CGP53353, 15 min 100nM insulin. (a) Whole cell lysateswere run on an SDS-PAGE gel and probed with respective antibodies. (b) Graphical representation shows the ratio of pPKC II/pPKC where is a statistically significant decrease comparing insulin vs. drug with insulin using unpaired t-test, p<0.05. Experiments were repeated three times. IB:

PAGE 195

C o n t r o lPM IB: GLUT4 CytoIB: -actinI n s u l i n 5 3 5 3 w / I n s C o n t r o l I n s u l i n 5 3 5 3 w / I n s C o n t r o l I n s u l i n 5 3 5 3 w / I n s LDM IB: GLUT4 C ont r ol Insulin 53 53 w / I nsul i n 0 10000 20000 30000 40000 50000* PM GLUT4 Cont r ol Insu l in 5 3 53 w/Insu l in 0 50000 100000 150000* LDM GLUT4(a) (b) (c) (d) (e) Figure 66. GLUT4 translocation is blocked by PKC II inhibition Day 8 3T3-L1 adipocyteswere serum starved for 4 hrs, 30 min 50M CGP53353, 100nM insulin 15 min. Subcellularfractionation was performed as described. 5 g for each sample of each fraction (a,b,c) was loaded onto a SDS-PAGE gel and immunoblotted. Graphical representation of PM GLUT4 (d) and LDM GLUT4 (e), where represents a statistically significant change (using arbitrary units) comparing insulin vs. drug with insulin using an unpaired t-test, p<0.05. Experiments were repeated on three occasions with similar results.

PAGE 196

Control Insulin 53 53 w/InsGLUT4 PM Merge(a) (e) (b)(c)(d) (f)(g) (h) (i) (j) (k)(l) Contro l In sul i n 53 53 w / I n sulin 0.0 0.5 1.0 1.5* GLUT4/PM(m) Figure 67. PM sheet assay confirms PKC IIrole in GLUT4 translocation. Day 8 to day 12 3T3-L1 adipocyteswere serum starved for 4 hrs, 30 min 50 M CGP53353, 100nM insulin 15 min. PM sheets were obtained as described in Experimental Procedures. (a-d) Green staining represents GLUT4. (e-h) Red staining represents PM. (i-l) Colocalization(yellow) is the merger of GLUT4 and PM stain ing. Five to ten arbitrary fields per condition were obtained, the averagebeing shown. Images shown here are the representative single o ptical section from z-series sections taken at average 0.2 mstep. (m) Graphical representation shows a statistically significant decrease (using arbitrary units) in GLUT4 over PM staining comparing insulin vs. drug withinsulin using an unpaired t-test (*, p<0.05). Experiment was r epeated three times.

PAGE 197

ControlInsulin 53 53 w/InsN-terminal GLUT4 DAPI Merger Figure 68 PKC II may affect organization of GLUT4 Day 8 Day 12 3T3-L1 adipocyteswere treated 50uM CGP53353 30 min 100nM pig insulin 15 min. Cells were fixed and stained as described. Red staining represents N terminal GLUT4. Blue (DAPI) staining represents the nucleus. (i) (j) (k)(l) (e) (f)(g)(h) (a) (b) (c)(d)

PAGE 198

Akt1/2/3 pAkt1/2/3 Thr308 C o n t r o l I n s u l i n 5 3 5 3 w / I n s -actin pAktSer473 Con t rol Insulin 53 53 w/Insulin 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1 1.2* pAkt/total Akt(b) (a) Figure 69. Effect of PKC II inhibitionon Aktphosphorylation Day 8 3T3-L1 adipocyteswere serum starved for 4 hrs, 30 min 50 M CGP53353, 100nM insulin 15 min. (a) Whole cell lysateswere run on an SDS-PAGE gel and probed with respective antibodies. (b) Graphical depiction of pAkt/total Akt, where black bars represent pAktSerine 473 / total Aktand white bars represent pAktTh reonine 308 / total Akt. represents a statistically significant inhibition (using arbitrary units) of phosphorylationof Aktat Serine 473 comparing insulin vs. drug with insulin using unpaired t-test, p<0.05. Experiments were repeated three times. IB:

PAGE 199

Figure 70 PKC II inhibition abolishes phosphorylationof AktSerine 473 and its subcellularlocations Day 8 Day 12 3T3-L1 adipocyteswere treated 50 M CGP53353 30 min 100nM pig insulin 15 min. Cells were fixed and stained as described. (a-d) Red staining represents pAkt473. (e-h) Blue staining indicates DNA. (i-l) Colors were merged.Control Insulin 53 53 w/Ins (i) (j) (k) (l) (e) (f) (g) (h) (a) (b) (c) (d)pAkt473 TO-PRO-3 Merge r

PAGE 200

C o n t r o l I n s u l i n 5 3 5 3 w / I n sphosphomTOR Serine 2481 -actin C on t rol Insulin 53 53 w/ In s u lin 0.0 0.2 0.4 0.6phospho mTOR 2481/ -actin(a) (b) Figure 71 CGP53353 treatment does not alter mTORC2 activation Day 8 3T3-L1 adipocyteswere treated 50uM CGP53353 30 min 100nM pig insulin 15 min. (a) Lysatewere run on a SDS-PAGE gel and western blotted with indicated antibodies. (b) Graphical representation of two independent experiments (measured using arbitrary units) using unpaired t-test, p<0.05. IB:

PAGE 201

I g G C o n t r o l I n s u l i n 5 3 5 3 w / I n s IP: PKC II sc210 IB: phospho mTORSerine 2481 Figure 72 Insulin-dependent binding of PKC II with activated mTORC2. Day 8 3T3-L1 adipocyteswere treated 50uM CGP53353 30 min 100nM pig insulin 15 min. Lysatewas harvested under non-denaturing conditions and co-immunoprecipitatedwith antibody listed. Co-immunoprecipitatedproteins were combined with Laemmlisbuffer and boiled. Samples were run on a SDS-PAGE gel and western blotted with indicated antibody.

PAGE 202

I g G C o n t r o l I n s u l i n 5 3 5 3 w / I n s IP: PKC II sc210 IB: phosphoAktS473 Figure 73. Insulin-dependent binding of PKC II with phosphoAktS473 Day 8 3T3-L1 adipocytes were treated 50uM CGP53353 30 min 100nM pig insulin 15 min. Lysatewas harvested under nondenaturing conditions and co-immunoprecipitatedwith antibody listed. Co-immunoprecipitatedproteins were combined with Laemmlisbuffer and boiled. Samples were run on a SDS-PAGE gel and western blotted with indicated antibody.

PAGE 203

W C L R a b b i t I g G C o n t r o l I n s u l i n 5 3 5 3 w / i n s C o n t r o l I n s u l i n 5 3 5 3 w / i n sIB:PKC II sc210 IB:GLUT4 sc1608IP:rIgGIP:PKC IIsc210IP:GLUT4 sc7936 Figure 74 Co-IP of GLUT4 and PKC II. Day 8 3T3-L1 adipocyteswere treated 50uM CGP53353 30 min 100nM pig insulin 15 min. Lysatewas harvested under non-denaturing conditions and co-immunoprecipitatedwith antibodies listed. Co-immunoprecipitatedproteins were combined with Laemmlisbuffer and boiled. Samples were run on a SDS-PAGE gel and western blotted with indicated antibodies.

PAGE 204

183 DISCUSSION The major findings of my research are: 1) TZDs may be able to regulate cotranscriptional splicing of PKC in rat L6 skeletal muscle cells; 2) PGC1 also seems to be able to mimic TZD’s effect on PKC co-transcriptional sp licing; 3) the PGC1 Cterminal domain is necessary for bridging PKC transcription and splicing; 4) 3T3-L1 cells developmentally regulate PKC expression where PKC II increases during adipogenesis and PKC I decreases during adipogenesis ; 5) PU.1 binds to the PKC promoter in 3T3-L1 adipocytes and may be responsible for developmental switching between the two isoforms; 6) PKC II is critical for ISGT by regulating GLUT4 translocation; and 7) PKC II (being downstream of activ ated mTORC2) regulates GLUT4 translocation by directly phosphorylating and fully ac tivating Akt at Serine 473. Thiazolidinediones have been used si nce 1997 to treat hyperglycemia in type 2 diabetes. Currently, Pioglitazone and Rosigl itazone are the only co mpounds licensed for type 2 diabetic patients. [443] TZDs work by decreasing insulin resistance. To elicit their insulin-sensitizing effect s, TZDs directly activate PPAR They seem to do this by primarily working on adipose tissue even though the major effect on insulin-sensitization occurs in skeletal muscle. This is in part due to altered free fatty acid supply. By activating adipocyte PPAR TZDs promote differentiation of adipose tissue that is smaller and more responsive to insulin, pr e-dominantly subcutaneously. In addition, TZDs reduce the output of inflammatory TNF and FFAs while in creasing output of

PAGE 205

184 adiponectin which increases peripheral insulinsensitivity [338]. TZDs have also shown benefit to the vasculature. Rat VSMCs undergo reduced migration and proliferation in response to TZD treatment [444]. Ya mamoto et al. showed that PKC isoforms have opposing functions in A10 VSMCs. PKC I was associated with accelerated cell doubling time and increased S phase cell population whereas PKC II was associated with attenuation of cell doubling time a nd delayed entry into S phase [ 41]. Patel et al. showed that acute hyperglycemia, which aggrevat es cardiovascular ti ssue injury, posttranscriptionally destabilizes PKC II mRNA [445; 446]. Here, we show that TZD treatment is able to regulate a lternative splicing, favoring the PKC II isoform (Figure 24). PPAR expression in VSMCs is associat ed with growth inhibition and differentiation through a GATA-6 dependent tr anscriptional mechan ism [447]. Whether PPAR is mediating the observed effects on VSMC PKC alternative splicing, remains to be seen. L6 cells represent a good model to study insulin signaling because skeletal muscle accounts for the majority of post-prandial gluc ose disposal [420]. 24 hour treatment of 1 M Pioglitazone mimicked insulin s effect on PKC II exon inclusion, even synergizing when combined with insulin stimulation (Fi gure 25). Western blotting confirmed that 24 hours 1 M Pioglitazone was able to stimulate PKC II protein expression to a similar extent as insulin (Figure 26). This is si gnificant because the mechanism, in which TZD benefits skeletal muscle signaling, as it pe rtains to glucose disposal, remains unknown [448]. PKC II is a critical regulato r of L6 ISGT [40; 113]. TZD treatment could possibly bypass a defective upstream insu lin signaling pathway to upregulate PKC II expression. Since TZD treatment is supposed ly ineffective at lowering serum glucose

PAGE 206

185 levels in the absence of insulin [414], TZDs could enhance L6 insulin sensitivity by priming cells with PKC II. This may lower the threshol d of insulin signaling required for full PKC II activation and thus ISGT. It is ev en possible that some alternatively spliced PKC II, as a result of TZD stimulation, could become activated by another pathway in the absence of insulin and therefor e clear serum glucose in the basal state. Non-insulin stimulated PKC (another PKC isoform involved in GLUT4 translocation) activation and basal glucose upt ake were increased in adipocytes with Rosiglitazone treatment [449]. Rosiglitazone ha s been shown to enhance acute 5 AMP-Activated Protein Kinase mediated glucose uptake (i nsulin independent) in muscle and adipose tissue of high-fat fed rats [ 450]. Contraction-stimulated mu scle glucose uptake is normal in type 2 diabetics and signals through the AMPK pathway. AMPK (stimulated by muscle contraction as well as hypoxia, ischaemi a, heat shock, decreased pH, glycolysis inhibition, and by uncouplers of oxidative phospho rylation) can stimulate skeletal muscle glucose uptake in the absence of insulin and through a PI3K independent pathway. aPKCs have been shown to have a role in AICAR (a minoi midazole ca rboxamide r ibonucleotide)-stimulated glucose uptake in bo th L6 cells and in isolated rat muscle [451]. PKC has been ruled out as a possible medi ator of contraction-mediated glucose uptake in mouse skeletal muscle cells. However, due to the fact that cPKC inhibitors inhibit contraction-stimulated glucose uptake [452], other cPKC isoforms such as PKC II can not be ruled out. It is possible that TZDs could syne rgize with skeletal muscle contraction-mediated glucose uptake in part by having PKC II bioavailability which could be a downstream target of AMPK.

PAGE 207

186 Overexpression of PPAR PGC1 and SRp40 all resulted in increased PKC II mRNA and protein levels (Figures 26, 27, 31, 33). K nockdown using siRNA further stressed the importance of these factors in PKC II exon inclusion (Figure 34-35). Overexpression of the PPAR E499Q mutant resulted in reduced PKC II protein expression with no effect on PKC I levels (Figure 32). This PPAR mutant can bind ligands with affinity equal to wild-t ype but can not undergo ligand-dependent transcriptional activation. However, PKC I expression is unaffected which suggests that basal transcriptional activity in this case is independent of PPAR ligands. The most plausible explanation for this is that the overexpressed PPAR is becoming transcriptionally active via its AF1 domain. PPAR activation depends on the conformation of its C-terminal AF2 helix. Li gands such as TZDs lock the AF2 in an active conformation. The active AF2 confor mation forms a charge-clamp pocket that interacts with the LXXLL motif of co activators. On the other hand, PPAR in known to have high basal ligand-independent activity [453]. Fibroblast overexpression of PPAR without a functional ligand binding domain was s till able to drive adipogenesis. It is possible that when PPAR was overexpressed, there is a th reshold that when crossed may relieve the requirement for ligand activati on [454]. There is no evidence of PPAR ligands being produced in cultured skeletal muscle cells; although it can not be ruled out (different medium could make a difference). Even in adipose tissue, which abundantly expresses PPAR endogenous ligands remain poorly ch aracterized [455]. The structure of ligand-free PPAR assumes both active and inactive conformations. The active conformation may be favored by increased amounts of PPAR coactivators, such as PGC1 which can bind PPAR in the absence of ligands [453]. To explain why the

PAGE 208

187 PPAR E499Q mutant prevented PKC II expression even though the ligand binding is likely not needed for transcri ptional activation of the PKC promoter, the mutation must affect the ability of coactivators to bind PPAR Coactivators such as SRC-1/NCoA-1, CBP/p300, pCAF, TRAP220 and PGC1 can activate PPAR in a ligand-dependent as well as ligand-independent manner. These coactivators dock on PPAR on the AF2 or helix 12 region of the LBD and this bi nding shows sequence conservation [456]. Without exogenous ligands, sk eletal muscle cell PPAR is required for normal rates of fatty acid uptake [457] s uggesting that forced PPAR expression will be active. It is possible that either the mutant PPAR disrupts the sequence recognition of the coactivator or it alters the folding/conformation of PPAR such that it can not bind certain coactivators or oscillate between th e active-inactive confor mations. In either case, this would prevent it from binding co activators that might potentially recruit splicing factors to influence PKC alternative splicing. Hypothesis #1 asserted that PPAR would influence PKC alternative splicing by directly binding to a PPRE located on the PKC promoter. In order to test this, we devised a heterologous PKC minigene transcriptionall y regulated by 2243bp of the human PKC promoter (Figures 36-48). Initial experiments showed promising results whereby PPAR was able to influence both BI and BII exon inclusion when the plasmid had the PKC promoter as opposed to the CMV promoter (Figure 51). However, deletion of the putative DR2 proved to have no effect on overexpressed PPAR s influence on the PKC promoter (Figure 52). It is possi ble that other putative PPREs that were overlooked might have been better candida tes. This is unlikely because the other candidates were inverted repe ats or everted repeats which are not standard PPREs.

PAGE 209

188 PPREs have been known to be located far away from the transcriptiona l start site [455]. The PKC promoter insert may have been too sh ort and would therefore not harbor the actual PPRE. To make matters more complicated, PPAR exhibits promiscuity in binding to the PPRE as opposed to RXR which can not tolerate deviation from the consensus sequence. The first three bases of the 5 half site appear to be more critical than the last three for PPAR recognition [296]. The 2243bp of the human PKC promoter insert may contain more putative PPREs (possibly even DR1s) if the emphasis was put on only the 3 half site. PPAR is still possibly a major pl ayer in regulating the PKC promoter in skeletal muscle cells. Despite being dete cted by RT-PCR (Figure 34), PPAR expression is notoriously low in skeletal muscle. In addition, PPAR does not account for all skeletal muscle benefits via TZD trea tment. Muscle-specific PPAR deficient mice that are insulin resistant still resp ond to TZD treatment [457]. The coactivators and other activators present in skeletal muscle may alter the stoichiometry of PPAR such that very little is needed. An interesting point discussed by Lefterova et al. is that in some genes, PPAR is constitutively associated with coactivators, leading to high levels of transcription [455]. Overexpressed PPAR in skeletal muscle cells may be constitutively bound to a coactivator on the PKC promoter causing constitutive co-transcriptional splicing. One experiment that would have given a more complete picture is PPAR overexpression combined with TZD treatmen t. The combined TZD treatment would ensure PPAR activation. However, one cav eat with this is that PPAR may not be activated in the same manner. TZD is c onsidered a full agonist [300]. For argument s

PAGE 210

189 sake, we ll ascribe PPAR overexpression as a partial agon ist. A partial agonist is a compound that at saturating concentrations produces activity below that of saturating concentrations of a full agonist. It is im portant to note that partial agonists do not increase the interaction of PPAR with corepressors. Depending on the level of activation, PPAR will differentially bind coactivators. By causing PPAR to become selective in terms of the coact ivators it recruits, partial a gonists will allow the induction of some but not all PPAR target genes. This is the concept behind “s elective PPAR m odulators” (SPPAR M). This is the idea that future PPAR agonists will modulate the metabolic genes necessary and sufficient for insulin sensitization while not affecting genes involved in fat accretion and other side effects (e.g. edema) associated with TZD treatment [300]. PA-082 was a novel partial agonist of PPAR which selectively recruited PGC1 This drug was able to prevent Rosiglitazone-driven triglyceride accumulation in mouse stem cells. At the same time, PA-082 was also able to induce mRNAs of insulin signaling components and adipogenic differentiation pathways [458]. The point of this is that TZD activation of overexpressed PPAR may have caused PPAR to associate with competing coactivator s which may have hinde red its ability to stimulate PKC alternative splicing. Overexpressed PPAR on its own may be able to bind coactivators, without competition, that promote PKC alternative splicing. The benefits of TZDs in skeletal mu scle are largely independent of PPAR [443]. A much more tantalizing prospect is TZD me diating its skeletal muscle effect through PGC1 PGC1 overexpression is able to closely mi mic TZD treatment in terms of its effects on PKC co-transcriptional splicing in muscle. 1 M Rosiglitazone and Pioglitazone for 24 hours were able to increase overall transcription yet select the PKC II

PAGE 211

190 isoform through alternative splicing (Figure 29). PGC1 was able to elicit a similar trend (Figure 31), keeping PKC I constant while increasing PKC II exon inclusion. Although PGC1 protein expression was very difficult to dete ct by western blotting it is said to be expressed heavily in skeletal muscle [459]. This problem with detection could be due to the L6 cell line. PGC1 protein expression in rat skelet al muscles is highly correlated with mitochondrial density and oxidative capac ity. Muscles that express PGC1 switch from a type IIb (fast twitch) mu scle fiber type to a fast twit ch type IIa and type I (slow twitch) which contain more mitochondria and exhibit higher rates of oxidative metabolism [376; 459]. In addition, PGC1 expression increases muscle glycogen stores via increased glucose transport (also invol ves increased GLUT4 expression), suppression of glycolytic flux and by inhibition of glyc ogen degradation pathway (down-regulation of glycogen phosphorylase levels and activity). Muscles with forced expression of PGC1 (similar to exercise-induced expression of PGC1 ) energize by fatty acid oxidation instead of glycolysis [357; 373]. Of interest here is the fact that PGC1 controls glucose uptake. This could provide an explanation as to why PGC1 would regulate PKC cotranscriptional splicing. PKC II is crucial in L6 insulin si gnaling. C-terminal deletion PKC II mutant expression as well as pha rmacological inhibition using PKC II-specific CGP53353 (1 M) revealed that PKC II was crucial for insulin-s timulated glucose uptake [40]. PKC II mediates these effects thr ough MARCKS phosphorylation, increased membrane PLD1 and cytoskeletal remodeling [113]. If TZD stimulation in skeletal muscle cells were exerti ng their effect through PGC1 it could do so either through increased expression (coactiv ation) or increased activity /disabling repression. The former has been demonstrated in mous e primary brown adipocytes and 3T3-L1

PAGE 212

191 adipcoytes. This regulation occurs via PPAR -mediated transcriptional activation on the PGC1 promoter PPRE [356]. Even though PPAR in L6 cells is expressed in small quantities, it is still po ssible that TZD-mediated PPAR transcriptional activation could induce increased PGC1 expression. Or TZD stimulation in skeletal muscle may activate other transcription factors (which may even be coactivated by PGC1 ) that will lead to increased PGC1 protein levels. TZDs may also alter the activity of PGC1 p38 stressactivated MAPK phosphorylates PGC1 at three residues (T262, S265, and T298) in the negative regulatory domain. These phosphorylat ions lead to dissociation of repressorbound p160MBP. Ultimately, PGC1 becomes more stable with increased half-life as well as possessing increased transcriptional activity [353; 460]. TZDs are capable of activating p38 inde pendent of PPAR in rat GN4 liver epithelial cells [461]. Glucose uptake in insulin resistant skeletal muscle ce lls in restored by TZD treatment in part by activation of p38 [462]. PGC1 activity can be regulated by means other than phosphorylation. Methylation via PRMT1 (p rotein arg inine m ethyltransferase 1 ) has been shown to positively regulate PGC1 transcriptiona l activity [463]. Acetylation (nicotinamide-induced) has been repo rted to negatively regulate PGC1 transcriptional activity (albeit in liver cells) [464]. TZD-induced PGC1 activation may affect cotranscriptional splicing of PKC It is important to mention that the PGC1 and TZD effect on splicing needs to be confir med showing RNA data from both PKC I and PKC II isoforms. Until then, it is possible that both treatments increase only PKC II mRNA translation. In th at scenario both PKC transcripts could be transcriptionally upregulated while splicing remained unaffect ed. Although unlikely, it is even possible

PAGE 213

192 that the treatments aid in selectively stabilizing the PKC II mRNA versus the PKC I mRNA. PGC1 s cited involvement in alte rnative splicing is anot her reason why it is an attractive PKC modulator. Monsalve et al evinced the role of PGC1 CTD in bridging transcription and splicing. The CTD contains two RS domains and an RRM domain (Figure 22). The RRM is required for inducti on of target genes. In the basal state, PGC1 co-localizes with SR protei ns at nuclear speckles. PGC1 through its RS domain is able to bind SR proteins, most prominently SRp40. Upon activation (phosphorylation), both PGC1 and SR proteins alter their intracellular location within the nucleus to sites of active mRNA synthesis. These proteins end up being part of the hyperphosphorylated RNA polymerase II complex. It was shown that PGC1 (via CTD deletion) was able to modulat e splicing of a fibronectin mi nigene [362]. The CTD of PGC1 is critical in mediat ing its effect on PKC alternative splicing (Figure 28). Cooverexpression of PGC1 and the PKC minigene would provide more insight as to PGC1 s role in PKC alternative splicing. SRp40 overe xpression in another Cooper lab PKC minigene (BII exon only) stimulates insulin-induced exon inclusion [37]. In vivo insulin induces Akt-mediated SRp40 phosphorylation which stimulates PKC II exon inclusion (assayed by RT-PCR) by direct bi nding to a SRp40-binding motif [38; 211]. Here, we further demonstrate that SR p40 overexpression leads to increased PKC II protein expression (Figure 26) and knocking down SRp40 decreases PKC II exon inclusion (Figure 35). It should be no ted that the degree of SRp40 knockdown would more closely mirror the knockdown of PKC II if the number of SRp40 PCR cycles were reduced. As far as hypothesis #1 is concer ned (Figure 30), it is possible that TZD

PAGE 214

193 treatment activates PGC1 which recruits SRp40 (w ould likely have to be phosphorylated) via PGC1 s CTD. SRp40 would then a ssociate with the RNAPII CTD and influence splice site se lection of the nascent PKC pre-mRNA. However, the transcription factor that would initially bind PGC1 to the promoter is even less certain. With respect to the minigene, it is possibl e that not enough SRp40 was available even if PPAR was bound to the minigene PKC promoter or even if PGC1 was able to coactivate the minigene PKC promoter. It is also possible that some sort of stimulation that promoted endogenous SRp40 hyperphosphorylat ion may be needed for translocation and coactivator docking. Overexpression of SRp40 may induce its phosphorylation by increasing the probability of interacting with an SR kinase such as Akt or Clk or possibly increasing splicing of certain SR kinase genes (personal speculation). This could explain why combined overexpression with either PPAR or PGC1 resulted in higher endogenous PKC II mRNA levels than when overexpressed alone (Figure 27). Work on skeletal muscle signaling has revealed PGC1 as the most promising potential target of TZDs. Both PGC1 and PKC II expression are associated with enhanced skeletal muscle ISGT. Future experiments would focus on establishing whether PGC1 is able to associate with the endogenous PKC promoter in skeletal tissue (via ChIP assay). Assessing PGC1 ’s activity levels with TZD treatment would also give insight into whether its coactivation ab ility was enhanced as well as its ability to bind SR proteins (e.g. phosphorylated RS domain). Knocking out PGC1 expression (via siRNA transient transfection) and then treating with TZDs would reveal whether PGC1 is necessary for the TZD effect on PKC co-transcriptional splicing.

PAGE 215

194 Additionally, performing a ChIP assay with the PGC1 antibody would confirm indirect binding of PGC1 to the PKC promoter. 3T3-L1 pre-adipocytes were next us ed to assess possible TZD-mediated PKC co-transcriptional splicing. When differentiated prope rly, 3T3-L1 cells become adipocytes. Differentiation t echnique was verified by phase contrast microscopy as well as oil red O staining. A conscious effect was made to avoid DMSO in dissolving the differentiation compounds Dexamethasone and IB MX (insulin was dissolved in water). This is because the action of DMSO is associated with increased expression of PKC , isoenzymes and alternative splicing [121; 465] For reasons that are apparent in the results section, use of DMSO could have cal led into question the observed effects of differentiation-regulated PKC alternative splicing (as well as differentiation-regulated transcription of PKC and ). Ethanol was instead used to dissolve the two compounds mentioned. Glucose concentrations in the media were also examined. Most papers use high glucose media to culture and differentiate 3T3L1 cells. But because we were looking at PKC II expression, this presented a potential problem. Pate l et al. had reported that hyperglycemia can post-transcri ptionally dest abilize PKC II mRNA (but not PKC I mRNA) in A10 VSMCs and primary human aorta cultures [466]. This is the reason why both low and high glucose DMEM media wa s tested initially. If high glucose destabilized PKC II expression, then low glucose media would be opted for. However, neither media had an effect on 3T3-L1 adipocyte PKC II expression during development (Figure 54-55). Therefore, we chose to stick with the mainstream culture media.

PAGE 216

195 The 3T3-L1 cell line is an ideal mode l for studying fat cell development and signaling since results in 3T3L1 adipocytes have repeatedly been confirmed in mouse models [467]. During differentiation, many gene s are programmed to initiate or cease. cDNA microarray analysis of 3T3-L1 cells show PKC expression at least ten fold higher in 3T3-L1 adipocytes versus 3T3-L1 fibrobl asts [419]. This suggested a role for PKC in adipogenesis and other adipocyte metabolic functions. Our results confirm that PKC is regulated during 3T3-L1 differentiation (Figur e 56-57). However, Guo et al. did not address which PKC isoform was upregulated over ten fo ld. We believe this to be the first example of differentiation-regulated PKC alternative splic ing, whereby PKC I starts off as the predominant 3T3-L1 pre-ad ipocyte isoform and is later replaced during differentiation with the PKC II isoform. This form of regulation is almost certainly disparate from the type of PKC alternative splicing that occu rs in L6 skeletal muscle cells within 15 min of insulin trea tment [39]. The fact that PKC II protein expression peaks at day 8, the same time when robust lipid droplets can be observed under the microscope, suggests that PKC II could be involved in adipogenesis. This could explain why protein and mRNA levels of PKC II dip after peaking. PKC II may be critical for terminal differentiation. Once this occurs, PKC II may be needed in lesser amounts. As far as the mRNA of day 8 and day 10 falling be low day 4, this could be explained by the fact that a single PKC II mRNA strand may be more freque ntly translated after terminal differentiation. As to why PKC II mRNA peaks at day 6 (Figure 56) and PKC II protein peaks at day 8 (Figure 57), this could be explained by differe nces in technique sensitivities or other factors such as microRNAs regulating pr otein translation. Figure 58 indicates that the distal polyA ta il (located downstream of the PKC I exon) is used for

PAGE 217

196 both PKC I and PKC II mRNA expression. This may add stability to the mRNA transcript. The expression pattern of PKC and (Figure 56) were congruent with expression patterns reported by McGowan et al. [426]. PKC s expression pattern is a non-sequitur for a kinase confirmed to play a major role in 3T3-L1 adipocyte insulin signaling [127; 129; 133; 145; 153; 283]. It is possible that heightened PKC expression is needed for adipogenesis and then returns to a level that can still support insulinstimulated GLUT4 translocation. PKC (with all its possible isoforms) may also function in promoting adipogenesis based on its expression pattern. PKC s function in skeletal muscle primary cultures suggests that it c ould provide a negative feedback to insulin receptor tyrosine kinase activity [468]. The expression pattern of PKC to our knowledge, has not been reported in this ce ll line. It too could be involved in differentiation but its expression rises and falls so precipitously from day 6 to day 8 and then from day 8 to day 10 respectively, that it may only be needed for the terminal phase of adipogenesis. PPAR 2 and PPAR 1 (which can compensate if PPAR 2 is deficient) are essential for adipogenesis [455] and th eir presence confirms proper adipogenesic signaling. Adiponectin is also a marker of adipocytes. GLUT4 protein expression (Figure 56) signals the beginning of insulin responsiveness. PKC II and GLUT4 protein expression are very similar. Based on pr evious data from the Cooper lab in which PKC II knockdown resulted in reduced GLUT4 pr otein expression, it was hypothesized (#2) that PKC II could affect GLUT4 e xpression/stability. Our inability to transfect 3T3-L1 adipoc ytes prevented this hypothesis from going any further. Factors that could in fluence differentiation-regulated PKC alternative splicing were next examined. As mentione d in the Results sec tion, PU.1 was the lead

PAGE 218

197 candidate because it had consen sus binding sites covering the PKC promoter as well as being a factor that could regulate alternat ive splicing. PU.1 interacts with proteins containing RNA binding motifs. One of these proteins is TLS/FUS, whose C-terminal domain contains three RNA recognition motif s (RRMs) and two arginine glycine-rich regions (RGGs). The RGG2-3 domain is capab le of recruiting SR proteins [469]. We hypothesized that if PU.1 bound the PKC promoter during differe ntiation, it could select the SR proteins, and therefore the PKC isoform, based on coactivat or recruitment. ChIP assays revealed that PU.1 is likely associated with the PKC promoter. It was bound to several spots on the promoter, although usually stronger on day 0 than on day 8. Several possibilities exist as to PU.1 s function on the promoter. First, it could be a stimulator or repressor of PKC alternative splicing depending on wh ich site it occupies. Second, even though PU.1 overexpression has been shown to in hibit overall 3T3-L1 differentiation, it could be transcriptionaly repr essive with respect to most adipogenic genes (allowing for adipogenesis) but active with respect to PKC This would explain why 3T3-L1 adipocytes continue to express PU.1 (Fi gure 61) even though it has anti-adipogenic properties when overexpressed [437]. Als o, as mentioned in the Results section, overexpression of PU.1 in 3T3-L1 must be in terpreted with caution as this may have caused PU.1 to cross a threshold expression le vel to where it became anti-adipogenic. PU.1 may behave like PPAR By this I mean that the binding of PU.1 to the PKC promoter (whether day 0 or day 8) may be th e same for a given site but its activation may change due to differentiatial coactivator recr uitment or post-translational modifications. This change in activity may not be possible at day 0 due to the lack of a certain factor that can only be expressed when the proper adipogenic signals are present.

PAGE 219

198 To our surprise, SRp40 pr ecipitated with the PKC promoter. There were noticeable differences between day 0 and da y 8 depending on the region. Regardless, association with the PKC promoter upstream of the transc riptional start site poses the possibility that SRp40 is r ecruited via transcription f actors and coactivators during transcription. According to the literature, this is possibl e as long as SRp40 is serine phosphorylated prior to arrival [470]. GATA2, like PU.1, is also a known antiadipogenic protein. Its expres sion could not be verified using RT-PCR, however, it did appear in the ChIP assay showing binding pr eferences based on whether it was day 0 or day 8. Of interest, from -4384 to -41 83, GATA2 was bound strongly on day 0 and not day 8. Perhaps, PKC needs this site to be free of GATA2 in order to accomplish alternative splicing. GATA1 and AML1 did not bind in this assay, even though AML1 did bind in a previous assa y. AML1/RUNX1 has been confirmed to bind the human PKC promoter in U937 cells [435]. Perhap s the AML1 antibody had lost potency or minute changes in cell culture conditions alte red intracellular signaling to the point where AML1 could no longer bind the PKC promoter. Due to difficulties in transfecting 3T3-L1 adipocytes, PU.1 could not be knocked down so we could not test directly whether PU.1 is needed for PKC alternative splicing (hypothesis #3). Despite this, we moved on to test the physiologica l relevance of PKC II with respect to ISGT. Establ ishing a connection between PKC II and ISGT would be very significant. Adipose tissue accounts for only a fraction of glucose disposal after a meal (~10-15%) with muscle accounting for mu ch of the remainder. However, global glucose homeostasis depends on adipocytes. This is not only based upon increased or decreased adiposity but on the GLUT4 signaling inside the adipocyte [420]. Adipocyte

PAGE 220

199 GLUT4 signaling has effects on circulating se rum adiponectin, an ad ipokine crucial for peripheral insulin sensitivity [471]. Ad ipose–specific overexpression of GLUT4 has been reported to reverse insulin resistance and diabetes in mice lacking muscular GLUT4 [472]. Adipose-selectiv e targeting of the GLUT4 gene in mice impairs insulin action in muscle and liver [473]. Regulation of ad ipocyte GLUT4 affects not only adipocyte glucose uptake but global glucose ho meostasis. The fact that PKC II is critical in skeletal muscle ISGT begs the question as to whether it holds a similar role in adipocytes. Several lines of independent experimentati on support the notion that insulin-dependent GLUT4 translocation is similar or identical in skeletal muscle and ad ipocytes [474; 475]. In both cases, insulin-dependent GLUT4 tran slocation is PI3K dependent [476]. To establish this connection, experiments we re modeled after Chalfant et al. using PKC II pharmacologic inhibition and [3H]2-deoxyglucose uptake [40]. 50 M CGP53353 was able to significantly inhibi t adipocyte ISGT (Figure 63). 25 M LY379196 was also able to significantly inhibi t adipocyte ISGT (Figure 64). Use of both inhibitors has culminated in a narrow list of possible glucose uptake effectors. According to the IC50 spectrum (in nM) of CGP53353, 50 M will inhibit PKC II (IC50=0.41), PKC I (IC50=3.8), PKC (IC50=1.9), PKC (IC50=22) and EGFR (IC50=0.7) [126]. Beyond 50 M, CGP53353 will not inhibit any other PKC isoform including PKC which is considered the predominant PKC isoform in volved in 3T3-L1 adipocyte ISGT [127]. Glucose uptake assays were performed on day 8 or later. At this point there is virtually no PKC I protein expression relative to day 0 (Figur e 56). It is unlikel y that it plays a significant role in glucose uptake. In a ddition, there is no documented role for PKC I in insulin-stimulated glucose uptake in any cell line [40; 477]. CGP53353 at 20 M is able

PAGE 221

200 to inhibit ISGT by roughly 45%. Combined with the reality that intracellular concentrations of the drug are likely much lower than 20 M, PKC can be ruled out as a major drug target. Use of the LY379196 di d not help to further eliminate cPKC isoforms. However, the fact that 25 M was able to significantly inhibit ISGT confirmed that there may be a novel PKC isoform involved in ISGT other than PKC (IC50=48 M). LY379196 also helped to eliminate EGFR from possible CGP53353 effectors since LY379196 does not inhibit this protein [125]. EGFR is downregulated during 3T3-L1 differentiation and was not considered to be a factor in ISGT [478]. PKC (IC50=0.7) would also be inhibited by LY379196 However, inhibition of PKC activity does not inhibit glucose transport in 3T3-L1 adi pocytes [479]. Both drugs inhibit PKC with IC50s close to that of PKC II and for this reason, PKC can not be completely excluded. On the other hand, PKC has been shown to negatively regulate the insulin receptor tyrosine kinase activity by inte racting with IRS1 [480]. Angiontensin II inhibits insulininduced Akt activation through PKC in VSMCs [481]. Hence, it would explain why 3T3-L1 cells downregulate PKC during the course of ad ipogenesis and it is thus unlikely that CGP53353 is mediating its effects through PKC [426]. This leaves PKC II as the best candidate. Hypothesis #4 asserted that PKC II would regulate adi pocyte ISGT through GLUT4 translocation or GLUT4 fusion. In L6 cells, Chappell et al. showed that CGP53353 at 1 M, a dose specific for PKC II, was able to prevent GLUT4 fusion by isolating PM fractions [113]. This resu lt hinted at the possibility that PKC II regulated vesicle fusion but it was also assumed that th is effect was due to inhibition of GLUT4 translocation. It is worth while to address the issue that the role of PKC II in ISGT is

PAGE 222

201 controversial. Several papers have been published for and against a role for PKC II in ISGT regulation. The use of C-terminal mutant PKC II and CGP53353 in L6 cells has already been described [40]. In addition, LY379196 (at 3 X 10-8 mol/l) was able to inhibit ISGT in 6 day-old cultured myotubes [ 482]. Interestingly, the same inhibitor was used to make the case that cPKCs could not regulate L6 ISGT [483]. However, the same group also showed that PKC PKC and PKC were activated by insulin in 3T3-L1 cells [484]. This would suggest that PKC has some role in insulin signaling. Systemic knockout of mouse PKC was reported to have no effect on glucose homeostasis in both fat and skeletal muscle tissue [485] This supposedly ruled out PKC II as a player in fat or muscle GLUT4 trafficking. However, caution must be exer cised when drawing conclusions from systemic knockouts. Sy stemic knockout of GLUT4 has only mild perturbations in glucose home ostasis even though it is the bona fide transporter in insulin-sensitive tissues. Tissue selective ta rgeting of GLUT4, however, has dramatic effects on ISGT [486]. Adipocytespecific inducible knockout of PKC II (future project) needs to be performed to definitively determine the role of PKC II in adipocyte ISGT. However, work done here lays a foundation providing preliminary ev idence that indeed, PKC II (or at the very least cPKC) is involved in GLUT4 translocation (possibly fusion) and adipogenesis. First, specificity of CGP53353 was dete rmined using western blot analysis (Figure 65). Phosphorylati on of insulin receptor, PKC and PKC were not altered. It was important to rule out PKC as this PKC isoform is involved in GLUT4 translocation [127; 153]. PKC activation involves PDK1 mediat ed Thr410 phosphorylation. Based on the literature we assumed this would be in sulin-stimulated [487]. As is obvious, every

PAGE 223

202 condition demonstrated pPKC Thr410. Activation of PKC has been reported through other stimuli including glucose in rat adipocytes [488]. Th e major activation pathway of PKC is PI3K-manufactured PIP3. PDK1 binds with high affinity to PIP3 in order to phosphorylate PKC PKC isolated from bovine kidne y is phosphorylated via PI3Kmediated PIP3 in response to growth f actors [489]. Interestingly, Alessi et al. have shown that PDK1 isolated from unstimulated or insulin-stimulated cells possess the same activity towards the Akt target and others. In 293 cells, insuli n stimulation did not change the phosphorylation status of PDK 1. It is proposed that PDK1 could be constitutively active and that it is the subs trate that needs to undergo a conversion in order to become phosphorylated [490]. In this same cell line, ceramide was shown to activate PKC in vitro [491]. 3T3-L1 adipocyte ceramide is associated with non-insulin dependent glucose uptake. Ceramide can stim ulate PI3K in 3T3-L1 cells [492]. Perhaps PKC also has a role in basal glucose uptak e and this necessitates its constitutive phosphorylation. Phosphorylation of PKC S660 (hydrophobic motif) was dramatically reduced with drug treatment with total PKC protein levels remaining constant. We also attempted to assess the phos phorylation status of PKC (even though it is almost certainly inhibited as well ) by using a Cell Signaling pPKC / II (T638/641) antibody. Only one band materialized and since we did not possess a peptide inhibitor at the time, this data could not be interpreted. Antibodies for pPKC were not practical as they crossreact with pPKC II. pPKC II (T641) (Abcam) was also probed for but there was too much background. The dosage used for CGP53353 also needs to be addressed. Differentiating 3T3L1 adipocytes develop impermeable cell memb ranes. During differentiation, more than

PAGE 224

203 90% of the adipocyte population have redu ced junctional permeability [493]. This is almost certainly the reason why pharmacol ogic inhibition can only be achieved by spiking the dosage. Multiple investigators ha ve used high drug concentrations in 3T3L1 adipocytes to block intr acellular signaling. For example, PD-98059 at 50 M was used to inhibit MEK activity and 100 M naringenin to inhibit PI3K in 3T3-L1 adipocytes [494]. LY294002 at 50 M was used to inhibit PI3K activity [495]. SP600125 at 50 M was used to inhibition J NK activity and LY294002 at 100 M was used to inhibit PI3K activity [496]. These are concentrations at l east 10-fold higher than what is required in skeletal muscle to block signaling. CGP53353 administration abrogated GL UT4 translocation as evidenced by subcellular fractionation and PM sheet assa ys (Figure 66-67). This implicates PKC II as a critical regulator of adi pocyte ISGT. In addition, PKC II may also have a role in “priming” GLUT4 for translocation. Figure 68 (b & d) shows that insulin is able to concentrate a pool of GLUT4, near what could possibly be the TGN. CGP53353 treatment causes GLUT4 to become more dispersed around the nucleus. This may implicate PKC II in insulin-stimulated GLUT4 traffick ing leading up to translocation. This data lends credence to part of Mode l 2 (Intro) concerning GLUT4 trafficking which states that insulin causes more GLUT4 to accumulate at a non-cycling pool near the TGN, which will translocate to the PM dire ctly. Co-immunoprecip itation suggests that PKC II may be able to influence GLUT4 directly or act on the GSVs to direct trafficking (Figure 73). There are at least two discrete signali ng pathways involved in insulin-regulated GLUT4 translocation in muscle and fat cells The first involves PI3K and the second

PAGE 225

204 involves the proto-oncogene c-Cbl. The two targets of PI3K th at have been identified are serine/threonine kinase Akt and PKC PI3K activates Akt by generating phosphoinositides in the inner leaflet of the plas ma membrane. Akt docks to this through a pleckstrin homology domain bringing it in close proximity with PDK1 [127]. The mechanism of PKC activation is not known although it may involve dissociation from 14-3-3 proteins among other things [19]. Recent reviews describe PI3K signaling diverging into two post-PDK pathways [133; 145; 254; 283; 497]. One pathway diverges to an atypical PKC pathway shown to be cr ucial for activation of glucose transport in both muscle and fat cells. The other Akt dependent pathway leads to AS160 phosphorylation. Five of six AS160 c onsensus Akt phosphorylation sites are phosphorylated in response to insulin [ 498]. These phosphorylations render AS160 s GAP domain inactive making it unable to negati vely regulate Rab proteins. This allows Rab-dependent GLUT4 transloca tion to occur [497]. Using western blot analysis and immunofluorescent staining, CGP53353 selec tively inhibited Akt phosphorylation at S473 while phosphorylation at T308 rema ined undisturbed (Figure 69-70). Immunofluorescent staining shows strong insuli n-dependent recruitment of Akt to the PM as well as intracellular deposits that coul d be part of the GSV trafficking itinerary (Figure 70). This da ta suggests that PKC II could be upstream of Akt during insulin signaling. This is not unusual sin ce it has been reported that PKC II mediates Akt S473 phosphorylation in a cell type a nd stimulus-specific event [438]. The importance of Akt in ISGT can not be overstated. James et al. reported that in 3T3-L1 adipocytes, fully active Akt is involved in a la te stage insulin-induced GLUT4 translocation to the PM. This latter process involves docking and fusion of GLUT4 vesicles with the PM [499].

PAGE 226

205 Constitutively active Akt stimulated glucose uptake and GLUT4 translocation in 3T3-L1 adipocytes [180]. A kinase inactive, phosphor ylation deficient Akt resulted in almost complete loss of L6 cell surface GLUT4 [185]. A similar strategy was used to verify Akt s role in promoting insulin-stimulated cel l surface GLUT4 in rat adipocytes [500]. More direct influence of Akt on GLUT4 has come from studies showing that insulin increases association of Akt2 with GSVs and this leads to phosphorylation of GSV component proteins [181; 182]. The functional consequence of this interaction, by use of fusion constructs with Akt and GLUT4, results in insulin-stimulated GLUT4 translocation to th e PM [501]. PKC II, through Akt could direct GLUT4 traffic. If Akt were to mimic GLUT4 localization, then PKC II indirectly causes more GLUT4 to be available near the TGN for direct tr anslocation to the PM (Figure 68). The mTORC2 complex is responsible for Akt S473 phosphorylation and thus full activation in 3T3-L1 adipocyt es. Phosphorylation of S473 results in the interaction between the hydrophobic motif and the N-terminal lobe leading to activation [174; 175; 229]. mTORC2 can be distinguished from mTORC1 based on residue phosphorylation of mTOR serine/threonine kinase. mTOR phosphorylation at S2481 defines the activate mTORC2 complex [61]. To resolve the apparent discrepancy that PKC II was needed for S473 phosphorylation (in our model) and ye t mTORC2 was the kinase responsible for this (throughout most of the literature), we used CGP53353 inhibition to assess its effect on mTORC2 activity. Figure 71 depicts an insignificant change in mTORC2 S2481 phosphorylation (and thus activity) when trea ted with CGP53353. This suggested few possibilities. One was that PKC II was downstream of mTORC2 and it was really PKC II that was phosphorylating Akt S473 in this cell line. Another pos sibility was that

PAGE 227

206 PKC II associated with the mTORC2 complex a nd was needed for substrate specificity. These assertions are re asonable given that PKC II is phosphorylated at the turn motif by mTORC2 in MEF cells [54]. In addition, the phosphorylation of Akt via mTORC2 has not been shown to be direct [502]. Through co-immunoprecipitation, we provide evidence that the turn mo tif phosphorylation of PKC II is associated with direct binding of mTOR (part of mTORC2) (Figure 72). This association increases with insulin treatment compared to contro l (lane 3 vs. lane 2) and is dramatically reduced with CGP53353 drug treatment (lane 3 vs. lane 5). PKC II would then go on to autophosphorylate itself and subsequently phosp horylate Akt. Preliminary data is shown that suggests that this interaction between PKC II and Akt is possible (Figure 73). There is ample circumstan tial evidence connecting PKC II to GLUT4 translocation and ISGT alluded to throughout the in troduction. PKC II can be localized to the pericontron to play a role in hormone responses by c ontrolling the trafficking of recycling endosomes containing Rabs. PKC II can translocate to the pericentron in a biphasic DAG response that depends on PLD-de rived DAG [19]. 3T3-L1 adipocytes undergo this biphasic DAG reponse [479]. PKC II (not PKC I) can activate PLD (involved in GLUT4 fusion) [19]. It is impor tant to note that it is the PLD1 isoform which is activated by cPKCs in response to insulin. The PLD2 isoform has high basal activity and is not stimulated to the sa me extent by PKC family members, ARF (A DPr obosylation f actor) and Rho [503]. 3T3-L1 adip ocytes express both PLD isoforms which are confined to LDM as detected by Mi llar et al. Within the LDM fraction, PLD2 is associated with intracellular membranes whereas PLD1 is associated with IRS1 and PI3K [504]. Other reports have PLD1 at th e perinuclear vesicles and PLD2 at the PM

PAGE 228

207 [505]. Subcellular lo calization of PLD needs further investigation. In HEK293 cells, PKC and PLC are both involved in insulin-stimu lated PLD1 and PLD2 activation [503]. H uman p ulmonary a rtery e ndothelial c ells (HPAEC) require PKC for PLD2 activation which then go es on to activate PKC [506]. In human colon cancer cells, a PKC/Ras/ERK/NF B-pathway is responsible for PLD1 (not PLD2) activation [507]. Lastly, in the human-airway epithelial cell line (CFNPE9o-), Src and PKC are needed for PLD1 activation [508]. Clearly, many fact ors converge on PLD isoforms to regulate their activity as well as localization. Celltype and agonist-type likely dictate which factors are utilized. Therefore, if PKC II was needed for PLD1 activation in 3T3-L1 adipocytes, other factors could compensate by either activating PL D1 or the cell could switch to PLD2. PKC II binds to and is activatd by F-act in where it has been shown to phosphorylate many cytoskeletal-associated proteins in vitro including adducin, MARCKs, troponin, and vimentin. PKC II association with F-actin resulted in a 5-fold increase in F-actin phosphoryla tion, indicating F-actin is a PKC II substrate [105]. Disruption of F-actin in 3T3-L1 cells, via cytochalasin D, depol ymerizes actin thus inhibiting GLUT4 translocation and ISGT. The dynamic rearrangements of F-actin and the actin based cytoskeleton play a critical role in insulin-sti mulated GSV translocation to the PM [283]. As mentioned earlier, PKC II can phosphorylate Akt S473 in a cell and stimulus dependent manner [438]. Data presented l eads to a final model whereby the insulin signaling cascade in 3T3-L1 adipocytes resu lts in mTORC2 activation. This leads to direct mTORC2-mediated PKC II phosphorylation and activation. PKC II will then

PAGE 229

208 phosphorylate and fully activate Akt (S473). Fully active Akt perpetuates the insulin signaling cascade eventually culminating in GLUT4 translocation and ISGT. Active PKC II may also act on GLUT4 or GSV components to positively regulate ISGT. Figure 75 represents a proposed model of 3T3-L1 ad ipocyte insulin signaling that is dependent on PKC II activity. Future directions would incl ude studying other potential contributors (e.g. AKAP and/or mTORC2 components) in the binding between mTORC2 and PKC II. Development of an inducible constr uct that specifica lly targets the PKC II exon would allow assessment of its role duri ng adipogenesis as we ll as confirm PKC II’s role in GLUT4 translocation and ISGT.

PAGE 230

Akt Figure 75 Hypothetical model for PKC II-regulated ISGT via Aktactivation in 3T3-L1 adipocytes Differentiated 3T3-L1 adipocytes are stimulated by insulin. Subsequent insulin receptor tyrosinekinaseactivity recruits IRS leading to PI3K generated PIP3 which sequesters both PDK1 and Aktthrough their PH domains. Preceding PM localization, Aktis phosphorylatedat Threonine450 by a mechanism that depends on mTORC2. Whether this is a direct phosphorylationby mTORC2 or involves PKC II is uncertain. Once PM bound, PDK1 phosphorylatesAktat Threonine308 as well as PKC II at Threonine500. Activated mTORC2 (which may require Ras-mediated phosphorylation) includes mTOR, Rictor, Protor, Sin1, mLST8, phosphatidicacid (PA) and the TSC1/TSC2 complex. Since PKC II can bind and activate PLD1 in select cells, the possibility exists that PKC II is involved in a positive feedback loop for enhanced insulin-stimulated mTORC2 activation by indirectly generating PA. However, in spite of PKC II inhibition, mTORC2 may still be able to assemble due to other positive regulators of PLD1. High basal PLD2 activity could also compensate. Serine 2481 phosphorylationof mTORduring insulin stimulation distinguishes mTORC2 activity allowing it to directly phosphorylatePKC II at Threonine641 leading to PKC II autophosphorylationat Serine 660. After PM translocation and pseudosubstraterelease, fully active PKC II phosphorylatesAktat Serine 473. Aktis now fully active and able to elicit GLUT4 translocation to the PM culminating in glucose import. PKC II may also be able to act on GLUT4, or components of the GLUT4 storage vesicles, directly. IRS PI3K PtdIns(4,5)P2 PIP3 PH PH PDK1 T308 S473Insulin stimulation Protor mLST8 Sin1 Rictor mTOR active mTORC2 S2481 PKC II T641 T500 S660 TSC1/2 PC PA Ras ? PLD1 T450 GLUT4

PAGE 231

210 REFERENCES [1] M. Inoue, A. Kishimoto, Y. Takai, and Y. Nishizuka, Studies on a cyclic nucleotideindependent protein kinase and its proenzyme in mammalian tissues. II. Proenzyme and its activation by calcium-de pendent protease from rat brain. J Biol Chem 252 (1977) 7610-6. [2] Y. Takai, A. Kishimoto, U. Kikkawa, T. Mori, and Y. Nishizuka, Unsaturated diacylglycerol as a possible messenger fo r the activation of calcium-activated, phospholipid-dependent protein kinase system. Biochem Biophys Res Commun 91 (1979) 1218-24. [3] M. Castagna, Y. Takai, K. Kaibuchi, K. Sano, U. Kikkawa, and Y. Nishizuka, Direct activation of calcium-activated, phospholip id-dependent protein kinase by tumorpromoting phorbol esters. J Biol Chem 257 (1982) 7847-51. [4] Y. Takai, A. Kishimoto, Y. Iwasa, Y. Kawahara, T. Mori, and Y. Nishizuka, Calciumdependent activation of a multifunctional protein kinase by membrane phospholipids. J Biol Chem 254 (1979) 3692-5. [5] C.L. Ashendel, The phorbol ester recepto r: a phospholipid-regulated protein kinase. Biochim Biophys Ac ta 822 (1985) 219-42. [6] A. Azzi, D. Boscoboinik, and C. Hensey, The protein kinase C family. Eur J Biochem 208 (1992) 547-57. [7] E.M. Griner, and M.G. Kazanietz, Protein kinase C and other diacylglycerol effectors in cancer. Nat Rev Cancer 7 (2007) 281-94. [8] K.P. Huang, H. Nakabayashi, and F.L. Huang, Isozymic forms of rat brain Ca2+activated and phospholipid-dependent prot ein kinase. Proc Natl Acad Sci U S A 83 (1986) 8535-9. [9] H. Hug, and T.F. Sarre Protein kinase C isoenzymes: divergence in signal transduction? Biochem J 291 ( Pt 2) (1993) 329-43. [10] K. Kaibuchi, Y. Takai, M. Sawamura, M. Hoshijima, T. Fujikura, and Y. Nishizuka, Synergistic functions of protein phosphor ylation and calciu m mobilization in platelet activation. J Bi ol Chem 258 (1983) 6701-4. [11] C.A. Kanashiro, and R.A. Khalil, Si gnal transduction by protein kinase C in mammalian cells. Clin Exp Pharmacol Physiol 25 (1998) 974-85. [12] Y. Nishizuka, Intracellu lar signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258 (1992) 607-14. [13] H.J. Mackay, and C.J. Twelves, Protei n kinase C: a target for anticancer drugs? Endocr Relat Cancer 10 (2003) 389-96. [14] H.J. Mackay, and C.J. Twelves, Targeti ng the protein kinase C family: are we there yet? Nat Rev Cancer 7 (2007) 554-62.

PAGE 232

211 [15] R.S. Herbst, Y. Oh, A. Wagle, and M. Lahn, Enzastaurin, a protein kinase Cbetaselective inhibitor, and its potential a pplication as an anticancer agent in lung cancer. Clin Cancer Res 13 (2007) s4641-6. [16] C.M. Taniguchi, B. Emanuelli, and C.R. Kahn, Critical nodes in signalling pathways: insights into insulin actio n. Nat Rev Mol Cell Biol 7 (2006) 85-96. [17] N. Das Evcimen, and G.L. King, The role of protein kinase C activation and the vascular complications of diabet es. Pharmacol Res 55 (2007) 498-510. [18] H. Noh, and G.L. King, The role of protein kinase C activ ation in diabetic nephropathy. Kidney Int Suppl (2007) S49-53. [19] S.F. Steinberg, Structural basis of protein kinase C isoform function. Physiol Rev 88 (2008) 1341-78. [20] A.C. Newton, Protein kina se C: structural and spatial regulation by phosphorylation, cofactors, and macromolecular inte ractions. Chem Rev 101 (2001) 2353-64. [21] L.L. Gallegos, and A.C. Newton, Spatiotemporal dyna mics of lipid signaling: protein kinase C as a paradi gm. IUBMB Life 60 (2008) 782-9. [22] C. House, and B.E. Kemp, Protein kina se C contains a pseudos ubstrate prototope in its regulatory domain. Science 238 (1987) 1726-8. [23] J.W. Orr, L.M. Keranen, and A. C. Newton, Reversible exposure of the pseudosubstrate domain of protein kinase C by phosphatidylserine and diacylglycerol. J Biol Chem 267 (1992) 15263-6. [24] M. Makowske, and O.M. Rosen, Comple te activation of protein kinase C by an antipeptide antibody directed against the pseudosubstrat e prototope. J Biol Chem 264 (1989) 16155-9. [25] J.W. Orr, and A.C. Newton, Intrapeptide re gulation of protein kina se C. J Biol Chem 269 (1994) 8383-7. [26] E.N. Churchill, N. Qvit, and D. Mochly-Rosen, Rationally designed peptide regulators of protein kinase C. Tr ends Endocrinol Metab 20 (2009) 25-33. [27] F.J. Johannes, J. Prestle, S. Eis, P. Oberhagemann, and K. Pfizenmaier, PKCu is a novel, atypical member of the protein kinase C family. J Biol Chem 269 (1994) 6140-8. [28] A.M. Valverde, J. Sinnett-Smith, J. Va n Lint, and E. Rozengur t, Molecular cloning and characterization of protein kinase D: a target for diacylg lycerol and phorbol esters with a distinctive catalytic dom ain. Proc Natl Acad Sci U S A 91 (1994) 8572-6. [29] M. Avkiran, A.J. Rowland, F. Cuello, and R.S. Haworth, Protein kinase d in the cardiovascular system: emerging roles in he alth and disease. Circ Res 102 (2008) 157-63. [30] V.O. Rybin, J. Guo, and S.F. Steinber g, Protein kinase D1 autophosphorylation via distinct mechanisms at Ser744/Ser748 and Ser916. J Biol Chem 284 (2009) 233243. [31] H. Mellor, and P.J. Parker, The exte nded protein kinase C superfamily. Biochem J 332 ( Pt 2) (1998) 281-92. [32] R.H. Palmer, and P.J. Parker, Expre ssion, purification and ch aracterization of the ubiquitous protein kinase C -related kinase 1. Biochem J 309 ( Pt 1) (1995) 31520.

PAGE 233

212 [33] Y. Ono, U. Kikkawa, K. Ogita, T. Fujii, T. Kurokawa, Y. Asaoka, K. Sekiguchi, K. Ase, K. Igarashi, and Y. Nishizuka, E xpression and properties of two types of protein kinase C: alternative splicing from a single gene. Science 236 (1987) 1116-20. [34] Y. Ono, T. Kurokawa, T. Fujii, K. Ka wahara, K. Igarashi, U. Kikkawa, K. Ogita, and Y. Nishizuka, Two types of compleme ntary DNAs of rat brain protein kinase C. Heterogeneity determined by altern ative splicing. FEBS Lett 206 (1986) 34752. [35] K. Kubo, S. Ohno, and K. Suzuki, Primary structures of human protein kinase C beta I and beta II differ only in their C-term inal sequences. FEBS Lett 223 (1987) 13842. [36] C.E. Chalfant, J.E. Watson, L.D. Bisnau th, J.B. Kang, N. Patel, L.M. Obeid, D.C. Eichler, and D.R. Cooper, Insulin regu lates protein kinase CbetaII expression through enhanced exon inclusion in L6 sk eletal muscle cells. A novel mechanism of insulinand insulin-like gr owth factor-i-induced 5' spli ce site selection. J Biol Chem 273 (1998) 910-6. [37] N.A. Patel, H.S. Apostolatos, K. Mebe rt, C.E. Chalfant, J.E. Watson, T.S. Pillay, J. Sparks, and D.R. Cooper, Insulin regula tes protein kinase CbetaII alternative splicing in multiple target tissues: de velopment of a hormonally responsive heterologous minigene. Mol Endocrinol 18 (2004) 899-911. [38] N.A. Patel, C.E. Chalfant, J.E. Watson, J.R. Wyatt, N.M. Dean, D.C. Eichler, and D.R. Cooper, Insulin regulates alternativ e splicing of protein kinase C beta II through a phosphatidylinositol 3-kinase-dependent path way involving the nuclear serine/arginine-rich splicing factor, SRp40, in skeletal muscle cells. J Biol Chem 276 (2001) 22648-54. [39] C.E. Chalfant, H. Misc hak, J.E. Watson, B.C. Winkler, J. Goodnight, R.V. Farese, and D.R. Cooper, Regulation of alternativ e splicing of protein kinase C beta by insulin. J Biol Chem 270 (1995) 13326-32. [40] C.E. Chalfant, S. Ohno, Y. Konno, A.A. Fisher, L.D. Bisnauth, J.E. Watson, and D.R. Cooper, A carboxy-terminal deletion mutant of protein kinase C beta II inhibits insulin-stimulated 2-deoxyglucose uptake in L6 ra t skeletal muscle cells. Mol Endocrinol 10 (1996) 1273-81. [41] M. Yamamoto, M. Acevedo-Duncan, C.E. Chalfant, N.A. Patel, J.E. Watson, and D.R. Cooper, The roles of protein kinase C beta I and beta II in vascular smooth muscle cell proliferation. Exp Cell Res 240 (1998) 349-58. [42] M.H. Disatnik, G. Buraggi, and D. Moch ly-Rosen, Localization of protein kinase C isozymes in cardiac myocytes. Exp Cell Res 210 (1994) 287-97. [43] B.L. Webb, S.J. Hirst, and M.A. Giemby cz, Protein kinase C isoenzymes: a review of their structure, regulation and role in regulating airways smooth muscle tone and mitogenesis. Br J Pharmacol 130 (2000) 1433-52. [44] C. Borner, S.N. Guadagno, D. Fabbro, and I.B. Weinstein, Expression of four protein kinase C isoforms in rat fibrobla sts. Distinct subcellular distribution and regulation by calcium and phorbol es ters. J Biol Chem 267 (1992) 12892-9.

PAGE 234

213 [45] M. Horovitz-Fried, T. Brutman-Barazani, D. Kesten, and S.R. Sampson, Insulin increases nuclear protein kinase Cdelta in L6 skeletal muscle cells. Endocrinology 149 (2008) 1718-27. [46] R.M. Palmer, R.M. Nieto, G.E. Lobley, P. Da Silva, A. Thom, and M.G. Thompson, Translocation of protein kina se C isoforms in rat muscle in response to fasting and refeeding. Br J Nutr 81 (1999) 153-7. [47] J. Boczan, S. Boros, F. Mechler, L. K ovacs, and T. Biro, Diffe rential expressions of protein kinase C isozymes during pro liferation and differentiation of human skeletal muscle cells in vitro. Acta Neuropathol 99 (2000) 96-104. [48] I. Fleming, S.J. MacKenzie, R.G. Vernon, N.G. Anderson, M.D. Houslay, and E. Kilgour, Protein kinase C is oforms play differential ro les in the regulation of adipocyte differentiation. Bioc hem J 333 ( Pt 3) (1998) 719-27. [49] E.U. Frevert, and B.B. Kahn, Protein kinase C isoforms epsilon, eta, delta and zeta in murine adipocytes: expression, subce llular localization an d tissue-specific regulation in insulin-resis tant states. Biochem J 3 16 ( Pt 3) (1996) 865-71. [50] T. Imamura, J. Huang, I. Usui, H. Sat oh, J. Bever, and J.M. Olefsky, Insulin-induced GLUT4 translocation involves protein kinase C-lambda-mediated functional coupling between Rab4 and the motor prot ein kinesin. Mol Cell Biol 23 (2003) 4892-900. [51] J.K. Kim, J.J. Fillmore, M.J. Sunshine B. Albrecht, T. Higa shimori, D.W. Kim, Z.X. Liu, T.J. Soos, G.W. Cline, W.R. O'Brien, D.R. Littman, and G.I. Shulman, PKC-theta knockout mice are protected from fat-induced insulin resistance. J Clin Invest 114 (2004) 823-7. [52] E. Kleiman, G. Carter, T. Ghansah, N.A. Patel, and D.R. Cooper, Developmentally spliced PKCbetaII provides a possible li nk between mTORC2 and Akt kinase to regulate 3T3-L1 adipocyte insulin-stimula ted glucose transport. Biochem Biophys Res Commun 388 (2009) 554-9. [53] Y. Shirai, and N. Saito, Activation m echanisms of protein kinase C: maturation, catalytic activation, and targ eting. J Biochem 132 (2002) 663-8. [54] V. Facchinetti, W. Ouya ng, H. Wei, N. Soto, A. Lazorchak, C. Gould, C. Lowry, A.C. Newton, Y. Mao, R.Q. Miao, W.C. Sessa, J. Qin, P. Zhang, B. Su, and E. Jacinto, The mammalian target of rapa mycin complex 2 controls folding and stability of Akt and protein kina se C. EMBO J 27 (2008) 1932-43. [55] T. Ikenoue, K. Inoki, Q. Yang, X. Z hou, and K.L. Guan, Essential function of TORC2 in PKC and Akt turn motif phosphorylation, maturation and signalling. EMBO J 27 (2008) 1919-31. [56] E. Jacinto, and A. Lorberg, TOR regula tion of AGC kinases in yeast and mammals. Biochem J 410 (2008) 19-37. [57] A.C. Newton, Lipid activa tion of protein kinases. J Lipid Res 50 Suppl (2009) S26671. [58] S. Carrasco, and I. Merida, Diacylgl ycerol, when simplicity becomes complex. Trends Biochem Sci 32 (2007) 27-36. [59] K.P. Becker, and Y.A. Hannun, cPKC -dependent sequestration of membranerecycling components in a subset of recycling endosomes. J Biol Chem 278 (2003) 52747-54.

PAGE 235

214 [60] J. Idkowiak-Baldys, K.P. Becker K. Kitatani, and Y.A. Hannun, Dynamic sequestration of the recycling compartmen t by classical protein kinase C. J Biol Chem 281 (2006) 22321-31. [61] J. Copp, G. Manning, and T. Hunter TORC-specific phosphorylation of mammalian target of rapamycin (mTOR): phospho-Se r2481 is a marker for intact mTOR signaling complex 2. Can cer Res 69 (2009) 1821-7. [62] S. Madani, A. Hichami, A. Legrand, J. Belleville, and N.A. Khan, Implication of acyl chain of diacylglycerols in activation of different isoforms of protein kinase C. FASEB J 15 (2001) 2595-601. [63] T.R. Pettitt, A. Martin, T. Horton, C. Liossis, J.M. Lord, and M.J. Wakelam, Diacylglycerol and phosphatidate gene rated by phospholipases C and D, respectively, have distinct fatty acid compositions and functions. Phospholipase D-derived diacylglycerol does not activate protein kinase C in porcine aortic endothelial cells. J Bi ol Chem 272 (1997) 17354-9. [64] T.R. Pettitt, and M.J. Wakelam, Bomb esin stimulates distinct time-dependent changes in the sn-1,2-diradylglycerol mo lecular species profile from Swiss 3T3 fibroblasts as analysed by 3,5-dinitroben zoyl derivatization and h.p.l.c. separation. Biochem J 289 ( Pt 2) (1993) 487-95. [65] M.J. Wakelam, Diacylglycerol--when is it an intracellular messenger? Biochim Biophys Acta 1436 (1998) 117-26. [66] S.L. Pelech, and D.E. Vance, Regul ation of phosphatidylcholine biosynthesis. Biochim Biophys Ac ta 779 (1984) 217-51. [67] G.M. Jenkins, and M.A. Frohman, Phospho lipase D: a lipid centric review. Cell Mol Life Sci 62 (2005) 2305-16. [68] D.N. Brindley, and D.W. Waggoner, Phosphatid ate phosphohydrolase and signal transduction. Chem Phys Lipids 80 (1996) 45-57. [69] Y. Nishizuka, Protein kinase C and lipid signaling for sustained cellular responses. FASEB J 9 (1995) 484-96. [70] S.G. Chen, and K. Murakami, Synergisti c activation of type III protein kinase C by cis-fatty acid and diacylglycerol. Bi ochem J 282 ( Pt 1) (1992) 33-9. [71] K. Kasahara, and U. Kikkawa, Distinct effects of saturated fatty acids on protein kinase C subspecies. J Biochem 117 (1995) 648-53. [72] D. Dey, D. Basu, S.S. Roy, A. Bandyopa dhyay, and S. Bhattacharya, Involvement of novel PKC isoforms in FFA induced de fects in insulin signaling. Mol Cell Endocrinol 246 (2006) 60-4. [73] K. Eitel, H. Staiger, J. Rieger, H. Mischak, H. Brandhorst, M.D. Brendel, R.G. Bretzel, H.U. Haring, and M. Kellerer, Protein kinase C de lta activation and translocation to the nucle us are required for fatty acid-induced apoptosis of insulin-secreting cells. Di abetes 52 (2003) 991-7. [74] W.W. Lin, S.H. Chang, and S.M. Wang, Roles of atypical protein kinase C in lysophosphatidic acid-induced type II ad enylyl cyclase activation in RAW 264.7 macrophages. Br J Pharmacol 128 (1999) 1189-98. [75] S. Seewald, U. Schmitz, C. Seul, Y. Ko, A. Sachinidis, and H. Vetter, Lysophosphatidic acid stimulates protein kinase C isoforms alpha, beta, epsilon,

PAGE 236

215 and zeta in a pertussis toxin sensitive pa thway in vascular smooth muscle cells. Am J Hypertens 12 (1999) 532-7. [76] G.A. Scott, M. Arioka, and S.E. Jacobs, Lysophosphatidylcholine mediates melanocyte dendricity through PKCzeta ac tivation. J Invest Dermatol 127 (2007) 668-75. [77] P. Chaudhuri, S.M. Colles, P.L. Fox, and L.M. Graham, Protein kinase Cdeltadependent phosphorylation of syndecan-4 regulates cell migration. Circ Res 97 (2005) 674-81. [78] T. Pulinilkunnil, D. An, P. Yip, N. Ch an, D. Qi, S. Ghosh, A. Abrahani, and B. Rodrigues, Palmitoyl lysophosphatidylchol ine mediated mobilization of LPL to the coronary luminal surface requires PKC activation. J Mol Cell Cardiol 37 (2004) 931-8. [79] H. Konishi, M. Tanaka, Y. Takemura, H. Matsuzaki, Y. Ono, U. Kikkawa, and Y. Nishizuka, Activation of prot ein kinase C by tyrosine phosphorylation in response to H2O2. Proc Natl Acad Sci U S A 94 (1997) 11233-7. [80] T. Rosenzweig, S. Aga-Mizrachi, A. Bak, and S.R. Sampson, Src tyrosine kinase regulates insulin-induced activation of prot ein kinase C (PKC) delta in skeletal muscle. Cell Signal 16 (2004) 1299-308. [81] M. Michetti, F. Salamino, E. Melloni, a nd S. Pontremoli, Revers ible inactivation of calpain isoforms by nitric oxide. Biochem Biophys Res Commun 207 (1995) 1009-14. [82] J.P. Hatton, F. Gaubert, J.P. Cazenave and D. Schmitt, Microgravity modifies protein kinase C isoform translocation in the human monocytic cell line U937 and human peripheral blood T-cells. J Cell Biochem 87 (2002) 39-50. [83] H.W. Lee, L. Smith, G.R. Pettit, and J.B. Smith, Bryostatin 1 and phorbol ester down-modulate protein kinase C-alpha and -epsilon via the ubiquitin/proteasome pathway in human fibroblasts. Mol Pharmacol 51 (1997) 439-47. [84] M. Rechsteiner, and S.W. Rogers, PEST sequences and regulat ion by proteolysis. Trends Biochem Sci 21 (1996) 267-71. [85] B.G. Allen, J.E. Andrea, and M.P. Wa lsh, Identification and characterization of protein kinase C zeta-immunoreactive pr oteins. J Biol Chem 269 (1994) 2928898. [86] R. Gopalakrishna, and W.B. Anderson, Susceptibility of protein kinase C to oxidative inactivation: loss of both phosphotransferase activity and phorbol diester binding. FEBS Lett 225 (1987) 233-7. [87] R. Gopalakrishna, Z.H. Chen, and U. Gundimeda, Nitric oxide and nitric oxidegenerating agents induce a re versible inactivation of prot ein kinase C activity and phorbol ester binding. J Biol Chem 268 (1993) 27180-5. [88] R. Gopalakrishna, Z.H. Chen, and U. Gundimeda, Modifications of cysteine-rich regions in protein kinase C induced by oxidant tu mor promoters and enzymespecific inhibitors. Meth ods Enzymol 252 (1995) 132-46. [89] L.T. Knapp, B.I. Kanterewicz, E.L. Hayes, and E. Klann, Peroxynitrite-induced tyrosine nitration and inhibition of protein kinase C. Biochem Biophys Res Commun 286 (2001) 764-70.

PAGE 237

216 [90] R. Alzamora, L.R. Brown, and B.J. Harv ey, Direct binding and activation of protein kinase C isoforms by aldosterone and 17be ta-estradiol. Mol Endocrinol 21 (2007) 2637-50. [91] S.J. Slater, M.B. Kelly, F.J. Taddeo, J. D. Larkin, M.D. Yeager, J.A. McLane, C. Ho, and C.D. Stubbs, Direct activation of protein kinase C by 1 alpha,25dihydroxyvitamin D3. J Biol Chem 270 (1995) 6639-43. [92] K.P. Becker, K. Kitatani, J. Idkowi ak-Baldys, J. Bielawski, and Y.A. Hannun, Selective inhibition of juxt anuclear translocation of protein kinase C betaII by a negative feedback mechanism involving ceramide formed from the salvage pathway. J Biol Chem 280 (2005) 2606-12. [93] R.G. Parton, and K. Simons, The multiple faces of caveolae. Nat Rev Mol Cell Biol 8 (2007) 185-94. [94] Y.H. Zeidan, and Y.A. Hannun, Activ ation of acid sphingomyelinase by protein kinase Cdelta-mediated phosphoryla tion. J Biol Chem 282 (2007) 11549-61. [95] X.A. Li, W.V. Everson, and E.J. Smart, Caveolae, lipid rafts, and vascular disease. Trends Cardiovasc Med 15 (2005) 92-6. [96] G. Muller, M. Ayoub, P. Storz, J. Rennecke, D. Fabbro, and K. Pfizenmaier, PKC zeta is a molecular switch in signal tr ansduction of TNF-alpha, bifunctionally regulated by ceramide and arachidonic acid. EMBO J 14 (1995) 1961-9. [97] C. Mineo, Y.S. Ying, C. Chapline, S. Jaken, and R.G. Anderson, Targeting of protein kinase Calpha to caveola e. J Cell Biol 141 (1998) 601-10. [98] V.O. Rybin, X. Xu, and S.F. Steinberg, Ac tivated protein kinase C isoforms target to cardiomyocyte caveolae : stimulation of local protein phosphorylation. Circ Res 84 (1999) 980-8. [99] A. Schultz, M. Ling, and C. Larsson, Id entification of an amino acid residue in the protein kinase C C1b domain crucial for its localization to the Golgi network. J Biol Chem 279 (2004) 31750-60. [100] T. Kajimoto, Y. Shirai, N. Sakai, T. Yamamoto, H. Matsuzaki, U. Kikkawa, and N. Saito, Ceramide-induced apoptosis by translocation, phosphorylation, and activation of protein kinase Cdelta in the Golgi complex. J Biol Chem 279 (2004) 12668-76. [101] M. Csukai, C.H. Chen, M.A. De Matteis, and D. Mochly-Rosen, The coatomer protein beta'-COP, a selective binding protein (RACK) for protein kinase Cepsilon. J Biol Chem 272 (1997) 29200-6. [102] M. Mason-Garcia, R.E. Harlan, C. Mallia, J.R. Jeter, Jr., H.B. Steinberg, C. Fermin, and B.S. Beckman, Interleukin-3 or erythr opoietin induced nuclear localization of protein kinase C beta isoforms in hemat opoietic target cells. Cell Prolif 28 (1995) 145-55. [103] A. Maissel, M. Marom, M. Shtutm an, G. Shahaf, and E. Livneh, PKCeta is localized in the Golgi, ER and nuclear e nvelope and translocates to the nuclear envelope upon PMA activation and seru m-starvation: C1b domain and the pseudosubstrate containing frag ment target PKCeta to the Golgi and the nuclear envelope. Cell Signal 18 (2006) 1127-39. [104] P.K. Majumder, P. Pandey, X. Sun, K. Cheng, R. Datta, S. Saxena, S. Kharbanda, and D. Kufe, Mitochondrial translocation of protein kinase C delta in phorbol

PAGE 238

217 ester-induced cytochrome c release and apoptosis. J Biol Chem 275 (2000) 21793-6. [105] G.C. Blobe, D.S. Stribl ing, D. Fabbro, S. Stabel, and Y.A. Hannun, Protein kinase C beta II specifically binds to and is ac tivated by F-actin. J Biol Chem 271 (1996) 15823-30. [106] J.W. Walker, Protein scaffolds, lipid domains and substrate recognition in protein kinase C function: implications for rational drug design. Handb Exp Pharmacol (2008) 185-203. [107] D. Mochly-Rosen, Localiz ation of protein kinases by anchoring proteins: a theme in signal transduction. Science 268 (1995) 247-51. [108] D. Mochly-Rosen, B.L. Smith, C.H. Ch en, M.H. Disatnik, and D. Ron, Interaction of protein kinase C with RACK1, a receptor for activated C-kinase: a role in beta protein kinase C mediated signal tran sduction. Biochem Soc Trans 23 (1995) 596600. [109] E.G. Stebbins, and D. Mochly-Rosen, Binding specificity for RACK1 resides in the V5 region of beta II protein kina se C. J Biol Chem 276 (2001) 29644-50. [110] H.G. Lee, S.Y. Kim, E.J. Choi, K.Y. Park, and J.H. Yang, Translocation of PKCbetaII is mediated via RACK-1 in the neuronal cells following dioxin exposure. Neurotoxicology 28 (2007) 408-14. [111] D. Ron, Z. Jiang, L. Yao, A. Vagt s, I. Diamond, and A. Gordon, Coordinated movement of RACK1 with activated betaIIPKC. J Biol Chem 274 (1999) 2703946. [112] S.D. Walker, N.R. Murray, D.J. Burns, and A.P. Fields, Protein kinase C chimeras: catalytic domains of alpha and beta II pr otein kinase C contain determinants for isotype-specific function. Proc Na tl Acad Sci U S A 92 (1995) 9156-60. [113] D.S. Chappell, N.A. Patel, K. Jiang, P. Li, J.E. Watson, D.M. Byers, and D.R. Cooper, Functional involvement of protei n kinase C-betaII and its substrate, myristoylated alanine-rich C-kinase s ubstrate (MARCKS), in insulin-stimulated glucose transport in L6 rat skeletal muscle cells. Diabetologia (2009). [114] D. McHugh, E.M. Sharp, T. Scheuer, and W.A. Catterall, Inhibition of cardiac Ltype calcium channels by protein kinase C phosphorylation of two sites in the Nterminal domain. Proc Natl Acad Sci U S A 97 (2000) 12334-8. [115] Z.H. Zhang, J.A. Johnson, L. Chen, N. El-Sherif, D. Mochly-Rosen, and M. Boutjdir, C2 region-derived peptides of beta-protein kinase C regulate cardiac Ca2+ channels. Circ Res 80 (1997) 720-9. [116] S.N. Yang, and P.O. Berggren, The role of voltage-gated calcium channels in pancreatic beta-cell physiology and pathophysiology. Endocr Rev 27 (2006) 62176. [117] M. Takahashi, H. Mukai, K. Oishi, T. Isagawa, and Y. Ono, Association of immature hypophosphorylated protein kinase cepsilon with an anchoring protein CG-NAP. J Biol Chem 275 (2000) 34592-6. [118] T.M. Klauck, M.C. Faux, K. Labudda, L. K. Langeberg, S. Jaken, and J.D. Scott, Coordination of three signaling en zymes by AKAP79, a mammalian scaffold protein. Science 271 (1996) 1589-92.

PAGE 239

218 [119] S. Jaken, Protein kinase C isozymes a nd substrates. Curr Opin Cell Biol 8 (1996) 168-73. [120] J.L. Perez, L. Khatri, C. Chang, S. Srivastava, P. Osten, and E.B. Ziff, PICK1 targets activated protein kinase Calpha to AMPA receptor clusters in spines of hippocampal neurons and reduces surface levels of the AMPA-type glutamate receptor subunit 2. J Neurosci 21 (2001) 5417-28. [121] L.M. Obeid, G.C. Blobe, L.A. Karolak, and Y.A. Hannun, Cloning and characterization of the major promoter of the human protein kinase C beta gene. Regulation by phorbol esters. J Biol Chem 267 (1992) 20804-10. [122] M.A. Osterhoff, S. Heuer, M. Pfeiffer, J. Tasic, S. Kaiser, F. Isken, J. Spranger, M.O. Weickert, M. Mohlig, and A.F. Pf eiffer, Identification of a functional protein kinase Cbeta prom oter polymorphism in huma ns related to insulin resistance. Mol Genet Metab 93 (2008) 210-5. [123] Ruboxistaurin: LY 333531. Drugs R D 8 (2007) 193-9. [124] H. Ishii, M.R. Jirousek, D. Koya, C. Taka gi, P. Xia, A. Clermont, S.E. Bursell, T.S. Kern, L.M. Ballas, W.F. Heath, L.E. Stramm, E.P. Feener, and G.L. King, Amelioration of vascular dysfunctions in diabetic rats by an oral PKC beta inhibitor. Scien ce 272 (1996) 728-31. [125] H. Sone, B.K. Deo, a nd A.K. Kumagai, Enhancement of glucose transport by vascular endothelial growth factor in reti nal endothelial cells. Invest Ophthalmol Vis Sci 41 (2000) 1876-84. [126] E. Buchdunger, H. Mett, U. Trinks, U. Regenass, M. Muller, T. Meyer, P. Beilstein, B. Wirz, P. Schneider, P. Traxler, and et al., 4,5-bis(4fluoroanilino)phthalimide: A selective inhi bitor of the epidermal growth factor receptor signal transduction pathway with potent in vivo antitumor activity. Clin Cancer Res 1 (1995) 813-21. [127] N.J. Bryant, R. Govers, and D.E. Ja mes, Regulated transport of the glucose transporter GLUT4. Nat Rev Mo l Cell Biol 3 (2002) 267-77. [128] A.L. Olson, and J.E. Pessin, Structur e, function, and regulation of the mammalian facilitative glucose transporter gene family. Annu Rev Nutr 16 (1996) 235-56. [129] J.C. Hou, and J.E. Pessin, Ins (endoc ytosis) and outs (exocytosis) of GLUT4 trafficking. Curr Opin Cell Biol 19 (2007) 466-73. [130] G.D. Holman, and I.V. Sandoval, Moving the insulin-regulated glucose transporter GLUT4 into and out of storage. Trends Cell Biol 11 (2001) 173-9. [131] J.E. Pessin, D.C. Thurmond, J.S. Elmendorf, K.J. Coker, and S. Okada, Molecular basis of insulin-stimulated GLUT4 vesi cle trafficking. Location! Location! Location! J Biol Ch em 274 (1999) 2593-6. [132] C.N. Antonescu, M. Foti, N. Sauvonnet, and A. Klip, Ready, set, internalize: mechanisms and regulation of GLUT4 endocytosis. Biosci Rep 29 (2009) 1-11. [133] R.T. Watson, M. Kanzaki, and J.E. Pessi n, Regulated membrane trafficking of the insulin-responsive glucose transporter 4 in adipocytes. Endocr Rev 25 (2004) 177-204. [134] M. Larance, G. Ramm, and D.E. James, The GLUT4 code. Mol Endocrinol 22 (2008) 226-33.

PAGE 240

219 [135] M. Hashiramoto, and D.E. James, Ch aracterization of insu lin-responsive GLUT4 storage vesicles isolated from 3T3-L1 adipocytes. Mol Cell Biol 20 (2000) 41627. [136] M. Kanzaki, and J.E. Pessin, Insulin-stim ulated GLUT4 translocation in adipocytes is dependent upon cortical actin rem odeling. J Biol Chem 276 (2001) 42436-44. [137] M. Kanzaki, R.T. Watson, A.H. Khan, and J.E. Pessin, Insulin stimulates actin comet tails on intracellular GLUT4-containing compartments in differentiated 3T3L1 adipocytes. J Biol Chem 276 (2001) 49331-6. [138] M. Emoto, S.E. Langille, and M.P. Czec h, A role for kinesin in insulin-stimulated GLUT4 glucose transporter translocation in 3T3-L1 adipocytes. J Biol Chem 276 (2001) 10677-82. [139] M.A. Ewart, M. Clarke, S. Kane, L.H. Chamberlain, and G.W. Gould, Evidence for a role of the exocyst in insulin-stimulated Glut4 trafficking in 3T3-L1 adipocytes. J Biol Chem 280 (2005) 3812-6. [140] A.L. Olson, J.B. Knight, and J. E. Pessin, Syntaxin 4, VAMP2, and/or VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors for insulin-stimulated GLUT4 transloca tion in adipocytes. Mol Cell Biol 17 (1997) 2425-35. [141] P. Huang, Y.M. Altshuller, J.C. H ou, J.E. Pessin, and M.A. Frohman, Insulinstimulated plasma membrane fusion of Glut4 glucose transporter-containing vesicles is regulated by phospholipas e D1. Mol Biol Cell 16 (2005) 2614-23. [142] M.L. Wagner, and L.K. Tamm, Recons tituted syntaxin1a/SNAP25 interacts with negatively charged lipids as measured by lateral diffusion in planar supported bilayers. Biophys J 81 (2001) 266-75. [143] E.E. Kooijman, V. Chupin, B. de Kr uijff, and K.N. Burger, Modulation of membrane curvature by phosphatidic acid and lysophosphatidic acid. Traffic 4 (2003) 162-74. [144] T. Yuan, S. Hong, Y. Yao, and K. Liao, Gl ut-4 is translocated to both caveolae and non-caveolar lipid rafts, but is partially internalized through caveolae in insulinstimulated adipocytes. Cell Res 17 (2007) 772-82. [145] M. Ishiki, and A. Klip, Minireview: recent developments in the regulation of glucose transporter-4 tra ffic: new signals, locations, and partners. Endocrinology 146 (2005) 5071-8. [146] J. Yang, and G.D. Holman, Comp arison of GLUT4 and GLUT1 subcellular trafficking in basal and insulin-stimulated 3T3-L1 cells. J Biol Chem 268 (1993) 4600-3. [147] R.T. Watson, A.H. Khan, M. Furukawa, J.C. Hou, L. Li, M. Kanzaki, S. Okada, K.V. Kandror, and J.E. Pessin, Entry of newly synthesized GLUT4 into the insulin-responsive storage compartment is GGA dependent. EMBO J 23 (2004) 2059-70. [148] J. Shi, and K.V. Kandror, Sortilin is essential and sufficient for the formation of Glut4 storage vesicles in 3T3-L1 adipocytes. Dev Cell 9 (2005) 99-108. [149] D.R. Melvin, B.J. Mars h, A.R. Walmsley, D.E. James, and G.W. Gould, Analysis of amino and carboxy terminal GLUT-4 ta rgeting motifs in 3T3-L1 adipocytes using an endosomal ablation techniqu e. Biochemistry 38 (1999) 1456-62.

PAGE 241

220 [150] S. Martinez-Arca, V.S. Lalioti, and I.V. Sandoval, Intrace llular targeting and retention of the glucose transporte r GLUT4 by the perinuclear storage compartment involves distinct carboxyl-t ail motifs. J Cell Sci 113 ( Pt 10) (2000) 1705-15. [151] G. Ramm, J.W. Slot, D.E. James, and W. Stoorvogel, Insulin recruits GLUT4 from specialized VAMP2-carrying vesicl es as well as from the dynamic endosomal/trans-Golgi network in rat adipocytes. Mol Biol Cell 11 (2000) 407991. [152] H. Zaid, C.N. Antonescu, V.K. Randha wa, and A. Klip, Insulin action on glucose transporters through molecular switches, tracks and tethers. Biochem J 413 (2008) 201-15. [153] C.B. Dugani, and A. Klip, Glucose transporter 4: cycling, compartments and controversies. EMBO Rep 6 (2005) 1137-42. [154] O. Karylowski, A. Zeigerer, A. Cohen, and T.E. McGraw, GLUT4 is retained by an intracellular cycle of vesicle formation and fusion with endosomes. Mol Biol Cell 15 (2004) 870-82. [155] L.B. Martin, A. Shewan, C.A. Mill ar, G.W. Gould, and D.E. James, Vesicleassociated membrane protein 2 plays a specific role in the insulin-dependent trafficking of the facilitative glucose tr ansporter GLUT4 in 3T3-L1 adipocytes. J Biol Chem 273 (1998) 1444-52. [156] A.C. Coster, R. Govers, and D.E. Jame s, Insulin stimulates the entry of GLUT4 into the endosomal recycling pathway by a quantal mechanism. Traffic 5 (2004) 763-71. [157] R. Govers, A.C. Coster, and D.E. Ja mes, Insulin increases cell surface GLUT4 levels by dose dependently dischargi ng GLUT4 into a cell surface recycling pathway. Mol Cell Biol 24 (2004) 6456-66. [158] P.F. Jones, T. Jakubowicz, and B.A. Hemmings, Molecular cloning of a second form of rac protein kina se. Cell Regul 2 (1991) 1001-9. [159] I. Galetic, M. Andjelkovic, R. Meier, D. Brodbeck, J. Park, and B.A. Hemmings, Mechanism of protein kinase B activation by insulin/insulin-like growth factor-1 revealed by specific inhibitors of pho sphoinositide 3-kinase--significance for diabetes and cancer. Pharmacol Ther 82 (1999) 409-25. [160] P.F. Jones, T. Jakubowicz, F.J. Pito ssi, F. Maurer, and B.A. Hemmings, Molecular cloning and identification of a serine/threonine protein kinase of the secondmessenger subfamily. Proc Natl Ac ad Sci U S A 88 (1991) 4171-5. [161] R.J. Haslam, H.B. Koide, and B. A. Hemmings, Pleckstrin domain homology. Nature 363 (1993) 309-10. [162] D. Brodbeck, P. Cron, and B.A. Hemmin gs, A human protein kinase Bgamma with regulatory phosphorylation sites in the activation loop and in the C-terminal hydrophobic domain. J Biol Chem 274 (1999) 9133-6. [163] S.P. Staal, Molecular cloning of the akt oncogene and its human homologues AKT1 and AKT2: amplification of AKT1 in a primary human gastric adenocarcinoma. Proc Natl A cad Sci U S A 84 (1987) 5034-7. [164] J.Q. Cheng, A.K. Godwi n, A. Bellacosa, T. Taguchi, T.F. Franke, T.C. Hamilton, P.N. Tsichlis, and J.R. Testa, AKT2, a putative oncogene encoding a member of a

PAGE 242

221 subfamily of protein-serine /threonine kinases, is am plified in human ovarian carcinomas. Proc Natl Acad Sci U S A 89 (1992) 9267-71. [165] B.M. Burgering, and P.J. Coffer, Protei n kinase B (c-Akt) in phosphatidylinositol3-OH kinase signal transducti on. Nature 376 (1995) 599-602. [166] T.F. Franke, S.I. Yang, T.O. Chan, K. Datta, A. Kazlauskas, D.K. Morrison, D.R. Kaplan, and P.N. Tsichlis, The protein ki nase encoded by the Akt proto-oncogene is a target of the PDGF-activated pho sphatidylinositol 3-kinase. Cell 81 (1995) 727-36. [167] M. Andjelkovic, T. Jakubowicz, P. Cron, X.F. Ming, J.W. Han, and B.A. Hemmings, Activation and phosphorylati on of a pleckstrin homology domain containing protein kinase (RAC-PK/PKB) promoted by serum and protein phosphatase inhibitors. Proc Na tl Acad Sci U S A 93 (1996) 5699-704. [168] D.R. Alessi, M. Andjelkovic, B. Ca udwell, P. Cron, N. Morrice, P. Cohen, and B.A. Hemmings, Mechanism of activation of protein kinase B by insulin and IGF1. EMBO J 15 (1996) 6541-51. [169] D.R. Alessi, S.R. James, C.P. Downes A.B. Holmes, P.R. Gaffney, C.B. Reese, and P. Cohen, Characterization of a 3phosphoinositide-dependent protein kinase which phosphorylates and activates protei n kinase Balpha. Curr Biol 7 (1997) 261-9. [170] B. Vanhaesebroeck, and D. R. Alessi, The PI3K-PDK1 conn ection: more than just a road to PKB. Biochem J 346 Pt 3 (2000) 561-76. [171] T. Gao, J. Brognard, and A.C. Ne wton, The phosphatase PHLPP controls the cellular levels of protein kinase C. J Biol Chem 283 (2008) 6300-11. [172] M.C. Mendoza, and J. Blenis, PHLPPi ng it off: phosphatases get in the Akt. Mol Cell 25 (2007) 798-800. [173] D.P. Brazil, and B.A. Hemmings, Ten y ears of protein kinase B signalling: a hard Akt to follow. Trends Biochem Sci 26 (2001) 657-64. [174] D.D. Sarbassov, D.A. Guertin, S.M. A li, and D.M. Sabatini, Phosphorylation and regulation of Akt/PKB by the rict or-mTOR complex. Science 307 (2005) 1098101. [175] J.R. Bayascas, and D.R. Alessi, Re gulation of Akt/PKB Ser473 phosphorylation. Mol Cell 18 (2005) 143-5. [176] J. Stockli, and D.E. James, Insulin action under arrestin. Cell Metab 9 (2009) 2134. [177] J. Brognard, and A.C. Newton, PHLiPPing the switch on Akt and protein kinase C signaling. Trends Endocrinol Metab 19 (2008) 223-30. [178] D.A. Guertin, D.M. Stevens, C.C. Thor een, A.A. Burds, N.Y. Kalaany, J. Moffat, M. Brown, K.J. Fitzgerald, and D.M. Sa batini, Ablation in mice of the mTORC components raptor, rictor, or mLST8 re veals that mTORC2 is required for signaling to Akt-FOXO and PKCalpha, but not S6K1. Dev Cell 11 (2006) 859-71. [179] E.L. Whiteman, H. Cho, and M.J. Bir nbaum, Role of Akt/protein kinase B in metabolism. Trends Endocrinol Metab 13 (2002) 444-51. [180] A.D. Kohn, S.A. Summers, M.J. Bi rnbaum, and R.A. Roth, Expression of a constitutively active Akt Ser/Thr kinase in 3T3-L1 adipocytes stimulates glucose uptake and glucose transpor ter 4 translocation. J Biol Chem 271 (1996) 31372-8.

PAGE 243

222 [181] M.R. Calera, C. Martinez, H. Liu, A. K. Jack, M.J. Birnbaum, and P.F. Pilch, Insulin increases the association of Akt2 with Glut4-containi ng vesicles. J Biol Chem 273 (1998) 7201-4. [182] T.A. Kupriyanova, and K.V. Kandror, Ak t-2 binds to Glut4-co ntaining vesicles and phosphorylates their component proteins in response to insulin. J Biol Chem 274 (1999) 1458-64. [183] D.E. James, MUNC-ing around with insulin action. J Clin Invest 115 (2005) 21921. [184] M.M. Hill, S.F. Clark, D.F. Tucker M.J. Birnbaum, D.E. James, and S.L. Macaulay, A role for protein kinase Bb eta/Akt2 in insulin-stimulated GLUT4 translocation in adipocytes. Mo l Cell Biol 19 (1999) 7771-81. [185] Q. Wang, R. Somwar, P.J. Bilan, Z. Liu, J. Jin, J.R. Woodgett, and A. Klip, Protein kinase B/Akt participates in GLUT4 translocation by insulin in L6 myoblasts. Mol Cell Biol 19 (1999) 4008-18. [186] R.R. Shankar, Y. Wu, H.Q. Shen, J. S. Zhu, and A.D. Baron, Mice with gene disruption of both endothelial and neuronal nitric oxide syntha se exhibit insulin resistance. Diabetes 49 (2000) 684-7. [187] D. Fulton, J.P. Gratton, T.J. McCabe, J. Fontana, Y. Fujio, K. Walsh, T.F. Franke, A. Papapetropoulos, and W.C. Sessa, Regul ation of endothelium-derived nitric oxide production by the protein ki nase Akt. Nature 399 (1999) 597-601. [188] E. Hajduch, D.R. Alessi B.A. Hemmings, and H.S. Hundal, Constitutive activation of protein kinase B alpha by membrane ta rgeting promotes glucose and system A amino acid transport, protein synthesis, and inactivation of glycogen synthase kinase 3 in L6 muscle ce lls. Diabetes 47 (1998) 1006-13. [189] K. Ueki, R. Yamamoto-Honda, Y. Ka buragi, T. Yamauchi, K. Tobe, B.M. Burgering, P.J. Coffer, I. Komuro, Y. Akanuma, Y. Yazaki, and T. Kadowaki, Potential role of protein kinase B in insulin-induced glucose transport, glycogen synthesis, and protein synthesis. J Biol Chem 273 (1998) 5315-22. [190] T. Kitamura, W. Ogaw a, H. Sakaue, Y. Hino, S. Kuroda, M. Takata, M. Matsumoto, T. Maeda, H. Konishi, U. Kikkawa, and M. Kasuga, Requirement for activation of the serine-threonine kinase Akt (protein kinase B) in insulin stimulation of protein synthesis but not of glucose transport. Mol Cell Biol 18 (1998) 3708-17. [191] I.A. Potapova, M.R. El-Maghrabi, S.V. Doronin, and W.B. Benjamin, Phosphorylation of recombin ant human ATP:citrate lyase by cAMP-dependent protein kinase abolishes homo tropic allosteric regulation of the enzyme by citrate and increases the enzyme activity. Allost eric activation of ATP:citrate lyase by phosphorylated sugars. Bioc hemistry 39 (2000) 1169-79. [192] C.N. Wang, L. O'Brien, and D.N. Bri ndley, Effects of cell-permeable ceramides and tumor necrosis factor-alpha on insu lin signaling and glucose uptake in 3T3L1 adipocytes. Diabetes 47 (1998) 24-31. [193] A.D. Kohn, F. Takeuchi, and R.A. Roth, Akt, a pleckstrin homology domain containing kinase, is activated primar ily by phosphorylation. J Biol Chem 271 (1996) 21920-6.

PAGE 244

223 [194] T. Kitamura, Y. Kitamura, S. Kuroda, Y. Hino, M. Ando, K. Kotani, H. Konishi, H. Matsuzaki, U. Kikkawa, W. Ogawa, and M. Kasuga, Insulin-induced phosphorylation and activation of cyclic nucleotide phosphodiesterase 3B by the serine-threonine kinase Akt. Mol Cell Biol 19 (1999) 6286-96. [195] S.A. Summers, A.W. Kao, A.D. Kohn, G.S. Backus, R.A. Roth, J.E. Pessin, and M.J. Birnbaum, The role of glycogen synt hase kinase 3beta in insulin-stimulated glucose metabolism. J Biol Chem 274 (1999) 17934-40. [196] M. Takata, W. Ogawa, T. Kitamura, Y. Hino, S. Kuroda, K. Kotani, A. Klip, A.C. Gingras, N. Sonenberg, and M. Kasuga, Re quirement for Akt (protein kinase B) in insulin-induced activation of glycog en synthase and phosphorylation of 4EBP1 (PHAS-1). J Biol Chem 274 (1999) 20611-8. [197] K.K. Cheng, M.A. Iglesias, K.S. Lam, Y. Wang, G. Sweeney, W. Zhu, P.M. Vanhoutte, E.W. Kraegen, and A. Xu, APPL1 potentiates insulin-mediated inhibition of hepatic glucose production and alleviates diabetes via Akt activation in mice. Cell Metab 9 (2009) 417-27. [198] T. Saito, C.C. Jones, S. Huang, M.P. Czech, and P.F. Pilch, The interaction of Akt with APPL1 is required for insulin-stimu lated Glut4 translocation. J Biol Chem 282 (2007) 32280-7. [199] T.L. Jetton, Y.Q. Liu, W.E. Trotma n, P.W. Nevin, X.J. Sun, and J.L. Leahy, Enhanced expression of insulin receptor substrate-2 and activation of protein kinase B/Akt in regenerating pancrea tic duct epithelium of 60 %-partial pancreatectomy rats. Diab etologia 44 (2001) 2056-65. [200] R.L. Tuttle, N.S. Gill, W. Pugh, J.P. Lee, B. Koeberlein, E.E. Furth, K.S. Polonsky, A. Naji, and M.J. Birnbaum, Regulation of pancreatic beta -cell growth and survival by the serine/threonine protein kinase Akt1/PKBalpha. Nat Med 7 (2001) 1133-7. [201] T. Matsuda, Y. Kido, T. Uchida, and M. Kasuga, Reduced insulin signaling and endoplasmic reticulum stress act synergistica lly to deteriorate pa ncreatic beta cell function. Kobe J Med Sci 54 (2008) E114-21. [202] S.J. Yun, E.K. Kim, D.F. Tucker, C. D. Kim, M.J. Birnbaum, and S.S. Bae, Isoform-specific regulation of adipocyt e differentiation by Akt/protein kinase Balpha. Biochem Biophys Res Commun 371 (2008) 138-43. [203] C.M. Rondinone, E. Carvalho, C. We sslau, and U.P. Smith, Impaired glucose transport and protein kinase B activati on by insulin, but not okadaic acid, in adipocytes from subjects with Type II diabetes mellitus. Diabetologia 42 (1999) 819-25. [204] A. Krook, R.A. Roth, X.J. Jiang, J. R. Zierath, and H. Wallberg-Henriksson, Insulin-stimulated Akt kinase activity is reduced in skeletal muscle from NIDDM subjects. Diabetes 47 (1998) 1281-6. [205] Y.B. Kim, S.E. Nikoulina, T.P. Ci araldi, R.R. Henry, and B.B. Kahn, Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle in type 2 diabetes. J Clin Invest 104 (1999) 733-41.

PAGE 245

224 [206] S.T. Nadler, J.P. Stoehr, M.E. Rabag lia, K.L. Schueler, M.J. Birnbaum, and A.D. Attie, Normal Akt/PKB with reduced PI3K activation in insulin-resistant mice. Am J Physiol Endocrinol Metab 281 (2001) E1249-54. [207] Y.B. Kim, O.D. Peroni, T.F. Franke, and B.B. Kahn, Divergent regulation of Akt1 and Akt2 isoforms in insulin target ti ssues of obese Zucker rats. Diabetes 49 (2000) 847-56. [208] H. Cho, J. Mu, J.K. Kim, J.L. Thor valdsen, Q. Chu, E.B. Crenshaw, 3rd, K.H. Kaestner, M.S. Bartolomei, G.I. Shulman, and M.J. Birnbaum, Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 292 (2001) 1728-31. [209] H. Cho, J.L. Thorvaldsen, Q. Chu, F. Feng, and M.J. Birnbaum, Akt1/PKBalpha is required for normal growth but dispen sable for maintenance of glucose homeostasis in mice. J Bi ol Chem 276 (2001) 38349-52. [210] M. Blaustein, F. Pelisch, T. Tanos, M. J. Munoz, D. Wengier, L. Quadrana, J.R. Sanford, J.P. Muschietti, A.R. Kornblih tt, J.F. Caceres, O.A. Coso, and A. Srebrow, Concerted regulation of nucl ear and cytoplasmic activities of SR proteins by AKT. Nat Struct Mol Biol 12 (2005) 1037-44. [211] N.A. Patel, S. Kaneko, H.S. Apostola tos, S.S. Bae, J.E. Watson, K. Davidowitz, D.S. Chappell, M.J. Birnbaum, J.Q. Cheng, and D.R. Cooper, Molecular and genetic studies imply Akt-mediated signa ling promotes protein kinase CbetaII alternative splicing via phosphorylation of serine/arginine-rich splicing factor SRp40. J Biol Chem 280 (2005) 14302-9. [212] K. Jiang, N.A. Patel, J.E. Watson, H. Apostolatos, E. Kleiman, O. Hanson, M. Hagiwara, and D.R. Cooper, Akt2 regulat ion of Cdc2-like kinases (Clk/Sty), serine/arginine-rich (SR) protein phosphor ylation, and insulin-induced alternative splicing of PKCbetaII messenger rib onucleic acid. Endocrinology 150 (2009) 2087-97. [213] R.T. Watson, and J.E. Pessin, Bridgi ng the GAP between insulin signaling and GLUT4 translocation. Trends Biochem Sci 31 (2006) 215-22. [214] A. Ullrich, and J. Schlessinger, Signa l transduction by receptors with tyrosine kinase activity. Cell 61 (1990) 203-12. [215] M. Inoue, S.H. Chiang, L. Chang, X.W. Chen, and A.R. Saltiel, Compartmentalization of the exocyst comple x in lipid rafts cont rols Glut4 vesicle tethering. Mol Biol Cell 17 (2006) 2303-11. [216] J. Lee, and P.F. Pilch, The insulin r eceptor: structure, func tion, and signaling. Am J Physiol 266 (1994) C319-34. [217] D.J. Withers, J.S. Gutierrez, H. Towery, D.J. Burks, J.M. Ren, S. Previs, Y. Zhang, D. Bernal, S. Pons, G.I. Shulman, S. Bonner-Weir, and M.F. White, Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391 (1998) 900-4. [218] D.J. Withers, and M. White, Perspect ive: The insulin signaling system--a common link in the pathogenesis of type 2 diabetes. Endocrinology 141 (2000) 1917-21. [219] P.R. Shepherd, B.T. Nave, and K. Siddl e, Insulin stimulation of glycogen synthesis and glycogen synthase activity is bloc ked by wortmannin and rapamycin in 3T3L1 adipocytes: evidence for the involv ement of phosphoinositi de 3-kinase and p70 ribosomal protein-S6 kinase. Bi ochem J 305 ( Pt 1) (1995) 25-8.

PAGE 246

225 [220] M.P. Wymann, and L. Pirola, Structur e and function of phosphoinositide 3-kinases. Biochim Biophys Acta 1436 (1998) 127-50. [221] J.A. Escobedo, S. Navankasattusas, W. M. Kavanaugh, D. Milfay, V.A. Fried, and L.T. Williams, cDNA cloning of a novel 85 kd protein that has SH2 domains and regulates binding of PI3-ki nase to the PDGF beta-re ceptor. Cell 65 (1991) 75-82. [222] M. Otsu, I. Hiles, I. Gout, M.J. Fr y, F. Ruiz-Larrea, G. Panayotou, A. Thompson, R. Dhand, J. Hsuan, N. Totty, and et al ., Characterization of two 85 kd proteins that associate with receptor tyrosine kinases, mi ddle-T/pp60c-src complexes, and PI3-kinase. Cell 65 (1991) 91-104. [223] E.Y. Skolnik, B. Margolis M. Mohammadi, E. Lowenste in, R. Fischer, A. Drepps, A. Ullrich, and J. Schlessinger, Cloni ng of PI3 kinase-associated p85 utilizing a novel method for expression/cloning of targ et proteins for receptor tyrosine kinases. Cell 65 (1991) 83-90. [224] C.L. Carpenter, K.R. Auger, B.C. Duckworth, W.M. Hou, B. Schaffhausen, and L.C. Cantley, A tightly associated seri ne/threonine protein kinase regulates phosphoinositide 3-kinase activity. Mol Cell Biol 13 (1993) 1657-65. [225] A.R. Saltiel, and C.R. Kahn, Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414 (2001) 799-806. [226] S.E. Lietzke, S. Bose, T. Cronin, J. Klarlund, A. Chawla, M.P. Czech, and D.G. Lambright, Structural basis of 3-ph osphoinositide recognition by pleckstrin homology domains. Mol Cell 6 (2000) 385-94. [227] Y. Sun, Y. Fang, M.S. Yoon, C. Zhang, M. Roccio, F.J. Zwartkruis, M. Armstrong, H.A. Brown, and J. Chen, Phospholipase D1 is an effector of Rheb in the mTOR pathway. Proc Natl Acad Sci U S A 105 (2008) 8286-91. [228] K.E. Anderson, J. Coadwe ll, L.R. Stephens, and P.T. Hawkins, Translocation of PDK-1 to the plasma membrane is im portant in allowing PDK-1 to activate protein kinase B. Cu rr Biol 8 (1998) 684-91. [229] R.C. Hresko, and M. Mueckler, mT OR.RICTOR is the Ser473 kinase for Akt/protein kinase B in 3T3-L1 adip ocytes. J Biol Chem 280 (2005) 40406-16. [230] X.M. Ma, and J. Blenis, Molecular m echanisms of mTOR-mediated translational control. Nat Rev Mol Ce ll Biol 10 (2009) 307-18. [231] L. Kopelovich, J.R. Fa y, C.C. Sigman, and J.A. Crow ell, The mammalian target of rapamycin pathway as a potential targ et for cancer chemoprevention. Cancer Epidemiol Biomarkers Prev 16 (2007) 1330-40. [232] L. Wang, T.E. Harris, and J.C. Lawr ence, Jr., Regulation of proline-rich Akt substrate of 40 kDa (PRAS40) function by mammalian target of rapamycin complex 1 (mTORC1)-mediated phosphorylation. J Biol Chem 283 (2008) 15619-27. [233] J. Zhang, Z. Gao, J. Yin, M.J. Quon, a nd J. Ye, S6K directly phosphorylates IRS-1 on Ser-270 to promote insulin resistance in response to TNF-(alpha) signaling through IKK2. J Biol Chem 283 (2008) 35375-82. [234] J. Huang, and B.D. Manning, A complex interplay between Akt, TSC2 and the two mTOR complexes. Biochem Soc Trans 37 (2009) 217-22. [235] L.R. Pearce, X. Huang, J. Boudeau, R. Pawlowski, S. Wullschleger, M. Deak, A.F. Ibrahim, R. Gourlay, M.A. Magnuson, and D.R. Alessi, Identification of Protor as

PAGE 247

226 a novel Rictor-binding component of mTOR complex-2. Biochem J 405 (2007) 513-22. [236] D.D. Sarbassov, S.M. Ali, D.H. Kim, D.A. Guertin, R.R. Latek, H. ErdjumentBromage, P. Tempst, and D.M. Sabatin i, Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleto n. Curr Biol 14 (2004) 1296-302. [237] E. Jacinto, V. Facchinetti, D. Liu, N. Soto, S. Wei, S.Y. Jung, Q. Huang, J. Qin, and B. Su, SIN1/MIP1 maintains ricto r-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell 127 (2006) 125-37. [238] D.A. Guertin, and D.M. Sabatini, Defi ning the role of mTOR in cancer. Cancer Cell 12 (2007) 9-22. [239] M.A. Frias, C.C. Thoreen, J.D. Jaffe, W. Schroder, T. Sculley, S.A. Carr, and D.M. Sabatini, mSin1 is necessary for Akt/ PKB phosphorylation, and its isoforms define three distinct mTORC2 s. Curr Biol 16 (2006) 1865-70. [240] J. Huang, C.C. Dibble, M. Matsuzaki, and B.D. Manning, The TSC1-TSC2 complex is required for proper activati on of mTOR complex 2. Mol Cell Biol 28 (2008) 4104-15. [241] T.R. Peterson, M. Laplante, C.C. T horeen, Y. Sancak, S.A. Kang, W.M. Kuehl, N.S. Gray, and D.M. Sabatini, DEPTOR is an mTOR inhibitor frequently overexpressed in multiple myeloma cells and required for their survival. Cell 137 (2009) 873-86. [242] T. Weichhart, and M.D. Saemann, The multiple facets of mTOR in immunity. Trends Immunol 30 (2009) 218-26. [243] A. Toschi, E. Lee, L. Xu, A. Garcia N. Gadir, and D.A. Foster, Regulation of mTORC1 and mTORC2 complex assemb ly by phosphatidic acid: competition with rapamycin. Mol Cell Biol 29 (2009) 1411-20. [244] S.W. Cheng, L.G. Fryer, D. Carl ing, and P.R. Shepherd, Thr2446 is a novel mammalian target of rapamycin (mTO R) phosphorylation site regulated by nutrient status. J Biol Chem 279 (2004) 15719-22. [245] R.T. Peterson, P.A. Beal, M.J. Com b, and S.L. Schreiber, FKBP12-rapamycinassociated protein (FRAP) autophosphorylates at serine 2481 under translationally repressive conditions. J Bi ol Chem 275 (2000) 7416-23. [246] J. Min, S. Okada, M. Kanzaki, J.S. El mendorf, K.J. Coker, B.P. Ceresa, L.J. Syu, Y. Noda, A.R. Saltiel, and J.E. Pessin, Synip: a novel insulin-regulated syntaxin 4-binding protein mediating GLUT4 translocation in adipocytes. Mol Cell 3 (1999) 751-60. [247] E. Yamada, S. Okada, T. Saito, K. Ohsh ima, M. Sato, T. Tsuchiya, Y. Uehara, H. Shimizu, and M. Mori, Akt2 phosphorylates Synip to regulate docking and fusion of GLUT4-containing vesicles J Cell Biol 168 (2005) 921-8. [248] E.B. Taylor, D. An, H.F. Kramer, H. Yu, N.L. Fujii, K.S. Roeckl, N. Bowles, M.F. Hirshman, J. Xie, E.P. Feener, and L.J. Goodyear, Discovery of TBC1D1 as an insulin-, AICAR-, and contraction-stimulat ed signaling nexus in mouse skeletal muscle. J Biol Chem 283 (2008) 9787-96.

PAGE 248

227 [249] H. Sano, S. Kane, E. Sano, C.P. Miinea, J.M. Asara, W.S. La ne, C.W. Garner, and G.E. Lienhard, Insulin-stimulated phos phorylation of a Rab GTPase-activating protein regulates GLUT4 translocat ion. J Biol Chem 278 (2003) 14599-602. [250] M.D. Bruss, E.B. Arias, G.E. Lienhard, and G.D. Cartee, Increased phosphorylation of Akt substrate of 160 kDa (AS160) in rat skeletal muscle in response to insulin or contractil e activity. Diabetes 54 (2005) 41-50. [251] S. Kane, H. Sano, S.C. Liu, J.M. As ara, W.S. Lane, C.C. Garner, and G.E. Lienhard, A method to identify serine ki nase substrates. Akt phosphorylates a novel adipocyte protein with a Rab GTPa se-activating protein (GAP) domain. J Biol Chem 277 (2002) 22115-8. [252] K. Sakamoto, and G.D. Holman, Em erging role for AS160/TBC1D4 and TBC1D1 in the regulation of GLUT4 traffic. Am J Physiol Endocrinol Metab 295 (2008) E29-37. [253] X. Xie, Y. Chen, P. Xue, Y. Fan, Y. Deng, G. Peng, F. Yang, and T. Xu, RUVBL2, a novel AS160-binding protein, regula tes insulin-stimulated GLUT4 translocation. Cell Res (2009). [254] A. Klip, The many ways to regulate glucose transporter 4. Appl Physiol Nutr Metab 34 (2009) 481-7. [255] S. Ishikura, P.J. Bilan, and A. Klip, Rabs 8A and 14 are targets of the insulinregulated Rab-GAP AS160 regulating GLUT 4 traffic in muscle cells. Biochem Biophys Res Commun 353 (2007) 1074-9. [256] G. Ramm, M. Larance, M. Guilhaus, a nd D.E. James, A role for 14-3-3 in insulinstimulated GLUT4 translocation through its interaction with the RabGAP AS160. J Biol Chem 281 (2006) 29174-80. [257] J.A. Chavez, W.G. Roach, S.R. Keller, W. S. Lane, and G.E. Lie nhard, Inhibition of GLUT4 translocation by Tbc1d1, a Rab GT Pase-activating protein abundant in skeletal muscle, is partially relieved by AMP-activated protein kinase activation. J Biol Chem 283 (2008) 9187-95. [258] D.C. Berwick, G.C. Dell, G.I. Welsh, K. J. Heesom, I. Hers, L.M. Fletcher, F.T. Cooke, and J.M. Tavare, Protein kinase B phosphorylation of PIKfyve regulates the trafficking of GLUT4 vesicl es. J Cell Sci 117 (2004) 5985-93. [259] G. Bandyopadhyay, M.L. Standaert, U. Kikkawa, Y. Ono, J. Moscat, and R.V. Farese, Effects of transiently expresse d atypical (zeta, lambda), conventional (alpha, beta) and novel (delta, epsilon) protein kinase C isoforms on insulinstimulated translocation of epitope-ta gged GLUT4 glucose transporters in rat adipocytes: specific interchangeable eff ects of protein kina ses C-zeta and Clambda. Biochem J 337 ( Pt 3) (1999) 461-70. [260] K. Kotani, W. Ogawa, M. Matsumot o, T. Kitamura, H. Sakaue, Y. Hino, K. Miyake, W. Sano, K. Akimoto, S. Ohno, a nd M. Kasuga, Requirement of atypical protein kinase clambda for insulin stimula tion of glucose uptake but not for Akt activation in 3T3-L1 adipocytes Mol Cell Biol 18 (1998) 6971-82. [261] M.L. Standaert, L. Galloway, P. Ka rnam, G. Bandyopadhyay, J. Moscat, and R.V. Farese, Protein kinase C-zeta as a down stream effector of phosphatidylinositol 3kinase during insulin stimulation in rat adipocytes. Potential role in glucose transport. J Biol Ch em 272 (1997) 30075-82.

PAGE 249

228 [262] M. Tsuru, H. Katagiri, T. Asano, T. Yamada, S. Ohno, T. Ogihara, and Y. Oka, Role of PKC isoforms in glucose transpor t in 3T3-L1 adipocytes: insignificance of atypical PKC. Am J Physiol Endocrinol Metab 283 (2002) E338-45. [263] M. Kanzaki, S. Mora, J.B. Hwang, A.R. Saltiel, and J.E. Pessin, Atypical protein kinase C (PKCzeta/lambda) is a convergent downstream target of the insulinstimulated phosphatidylinositol 3-kina se and TC10 signaling pathways. J Cell Biol 164 (2004) 279-90. [264] T. Maehama, and J.E. Dixon, PTEN: a tumour suppressor that functions as a phospholipid phosphatase. Trends Cell Biol 9 (1999) 125-8. [265] X. Pesesse, S. Deleu, F. De Smedt, L. Drayer, and C. Erneux, Identification of a second SH2-domain-containing protein clos ely related to the phosphatidylinositol polyphosphate 5-phosphatase SHIP. Bi ochem Biophys Res Commun 239 (1997) 697-700. [266] S. Clement, U. Krause, F. Desmedt, J.F. Tanti, J. Behrends, X. Pesesse, T. Sasaki, J. Penninger, M. Doherty, W. Malaisse, J. E. Dumont, Y. Le Marchand-Brustel, C. Erneux, L. Hue, and S. Schurmans, The lip id phosphatase SHIP2 controls insulin sensitivity. Nature 409 (2001) 92-7. [267] N. Nakashima, P.M. Sharma, T. Imam ura, R. Bookstein, and J.M. Olefsky, The tumor suppressor PTEN negatively regul ates insulin signaling in 3T3-L1 adipocytes. J Biol Chem 275 (2000) 12889-95. [268] X. Tang, A.M. Powelka, N.A. Soria no, M.P. Czech, and A. Guilherme, PTEN, but not SHIP2, suppresses insulin signali ng through the phosphatidylinositol 3kinase/Akt pathway in 3T3-L1 adip ocytes. J Biol Chem 280 (2005) 22523-9. [269] N. Ghosh, N. Patel, K. Jiang, J.E. Watson, J. Cheng, C.E. Chalfant, and D.R. Cooper, Ceramide-activated protein phosphata se involvement in insulin resistance via Akt, serine/arginine-rich protein 40, and ribonucleic acid splicing in L6 skeletal muscle cells. Endocrinology 148 (2007) 1359-66. [270] A.R. Saltiel, and J.E. Pessin, Insulin signaling in microdomains of the plasma membrane. Traffic 4 (2003) 711-6. [271] C.A. Baumann, V. Ribon, M. Kanzaki, D.C. Thurmond, S. Mora, S. Shigematsu, P.E. Bickel, J.E. Pessin, and A.R. Sa ltiel, CAP defines a second signalling pathway required for insulin-stimulated glucose transport. Nature 407 (2000) 2027. [272] S.H. Chiang, C.A. Baumann, M. Kanzaki, D.C. Thurmond, R.T. Watson, C.L. Neudauer, I.G. Macara, J.E. Pessin, and A.R. Saltiel, Insulin-stimulated GLUT4 translocation requires the CAP-dependent activation of TC10. Nature 410 (2001) 944-8. [273] R.T. Watson, S. Shigematsu, S.H. Chiang, S. Mora, M. Kanzaki, I.G. Macara, A.R. Saltiel, and J.E. Pessin, Lipid raft micr odomain compartmentalization of TC10 is required for insulin signaling and GLUT4 translocation. J Cell Biol 154 (2001) 829-40. [274] R.T. Watson, M. Furukawa, S.H. Chia ng, D. Boeglin, M. Kanzaki, A.R. Saltiel, and J.E. Pessin, The exocytotic traffick ing of TC10 occurs through both classical and nonclassical secretory tr ansport pathways in 3T3L1 adipocytes. Mol Cell Biol 23 (2003) 961-74.

PAGE 250

229 [275] L. JeBailey, A. Rudich, X. Huang, C. Di Ciano-Oliveira, A. Kapus, and A. Klip, Skeletal muscle cells and adipocytes di ffer in their reliance on TC10 and Rac for insulin-induced actin remodeling. Mol Endocrinol 18 (2004) 359-72. [276] I.J. Lodhi, S.H. Chiang, L. Chang, D. Vollenweider, R.T. Watson, M. Inoue, J.E. Pessin, and A.R. Saltiel, Gapex-5, a Rab31 guanine nucleotide exchange factor that regulates Glut4 trafficking in adipocytes. Cell Metab 5 (2007) 59-72. [277] I.J. Lodhi, D. Bridges, S.H. Chiang, Y. Zhang, A. Cheng, L.M. Geletka, L.S. Weisman, and A.R. Saltiel, Insulin stimulates phosphatidylinositol 3-phosphate production via the activation of Rab5. Mol Biol Cell 19 (2008) 2718-28. [278] H. Horiuchi, A. Gine r, B. Hoflack, and M. Zerial, A GDP/GTP exchangestimulatory activity for the Rab5-RabGDI complex on clathrin-coated vesicles from bovine brain. J Biol Chem 270 (1995) 11257-62. [279] M. Inoue, L. Chang, J. Hwang, S.H. Ch iang, and A.R. Saltiel, The exocyst complex is required for targeting of Glut4 to the plasma membrane by insulin. Nature 422 (2003) 629-33. [280] N. Fukuda, M. Emoto, Y. Nakamori, A. Taguchi, S. Miyamoto, S. Uraki, Y. Oka, and Y. Tanizawa, DOC2B: a novel syntaxin -4 binding protein mediating insulinregulated GLUT4 vesicle fusion in ad ipocytes. Diabetes 58 (2009) 377-84. [281] M. Kanzaki, and J.E. Pessin, Caveolin -associated filamentous actin (Cav-actin) defines a novel F-actin structure in ad ipocytes. J Biol Ch em 277 (2002) 25867-9. [282] M. Kanzaki, R.T. Watson, J.C. Hou, M. Stamnes, A.R. Salti el, and J.E. Pessin, Small GTP-binding protein TC10 differentially regulates two dis tinct populations of filamentous actin in 3T3L1 adipoc ytes. Mol Biol Cell 13 (2002) 2334-46. [283] M. Kanzaki, Insulin receptor signals regulating GLUT4 translocation and actin dynamics. Endocr J 53 (2006) 267-93. [284] I. Just, J. Selzer, M. Wilm, C. von Eichel-Streiber, M. Mann, and K. Aktories, Glucosylation of Rho proteins by Clostrid ium difficile toxin B. Nature 375 (1995) 500-3. [285] R. Rohatgi, L. Ma, H. Miki, M. Lop ez, T. Kirchhausen, T. Takenawa, and M.W. Kirschner, The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell 97 (1999) 221-31. [286] J. Taunton, B.A. Rowning, M.L. Coughlin, M. Wu, R.T. Moon, T.J. Mitchison, and C.A. Larabell, Actin-dependent prop ulsion of endosomes and lysosomes by recruitment of N-WASP. J Cell Biol 148 (2000) 519-30. [287] S. Semiz, J.G. Park, S.M. Nicoloro, P. Furcinitti, C. Zhang, A. Chawla, J. Leszyk, and M.P. Czech, Conventional kinesin KIF5B mediates insulin-stimulated GLUT4 movements on microtubul es. EMBO J 22 (2003) 2387-99. [288] A. Bose, A. Guilherme, S.I. Robida, S.M. Nicoloro, Q.L. Zhou, Z.Y. Jiang, D.P. Pomerleau, and M.P. Czech, Glucose transp orter recycling in response to insulin is facilitated by myosin Myo1c. Nature 420 (2002) 821-4. [289] X.W. Chen, D. Leto, S.H. Chiang, Q. Wa ng, and A.R. Saltiel, Activation of RalA is required for insulin-stimulated Glut4 traffi cking to the plasma membrane via the exocyst and the motor protein M yo1c. Dev Cell 13 (2007) 391-404. [290] M.F. Yip, G. Ramm, M. Larance, K. L. Hoehn, M.C. Wagner, M. Guilhaus, and D.E. James, CaMKII-mediated phosphorylation of the myosin motor Myo1c is

PAGE 251

230 required for insulin-stimulated GLUT4 tran slocation in adipoc ytes. Cell Metab 8 (2008) 384-98. [291] G.D. Holman, and K. Sakamoto, Regulat ing the motor for GLUT4 vesicle traffic. Cell Metab 8 (2008) 344-6. [292] G.N. Hagan, Y. Lin, M.A. Magnuson, J. Avruch, and M.P. Czech, A Rictor-Myo1c complex participates in dynamic cortical actin events in 3T3-L1 adipocytes. Mol Cell Biol 28 (2008) 4215-26. [293] C. Yu, J. Cresswell, M.G. Loffler, and J.S. Bogan, The glucose transporter 4regulating protein TUG is essential for highly insulin -responsive glucose uptake in 3T3-L1 adipocytes. J Bi ol Chem 282 (2007) 7710-22. [294] J.S. Bogan, N. Hendon, A.E. McKee, T.S. Tsao, and H.F. Lodish, Functional cloning of TUG as a regulator of GLUT4 glucose transporter trafficking. Nature 425 (2003) 727-33. [295] L. Chang, S.H. Chiang, and A.R. Saltiel, Insulin signaling and the regulation of glucose transport. Mo l Med 10 (2004) 65-71. [296] K.A. Temple, R.N. Cohen, S.R. Wondi sford, C. Yu, D. Deplewski, and F.E. Wondisford, An intact DNA-binding domain is not required for peroxisome proliferator-activated receptor gamma (PPARgamma) binding and activation on some PPAR response elements. J Biol Chem 280 (2005) 3529-40. [297] A.C. Li, and W. Palinski, Peroxisome proliferator-activated receptors: how their effects on macrophages can lead to th e development of a new drug therapy against atherosclerosis. Annu Rev Pharmacol Toxicol 46 (2006) 1-39. [298] P. Tontonoz, E. Hu, R.A. Graves, A. I. Budavari, and B.M. Spiegelman, mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8 (1994) 1224-34. [299] E.D. Rosen, C.H. Hsu, X. Wang, S. Sakai, M.W. Freema n, F.J. Gonzalez, and B.M. Spiegelman, C/EBPalpha induces adi pogenesis through PPARgamma: a unified pathway. Genes Dev 16 (2002) 22-6. [300] L. Gelman, J.N. Feige, and B. Desvergne, Molecular basis of selective PPARgamma modulation for the treatment of Type 2 diabetes. Biochim Biophys Acta 1771 (2007) 1094-107. [301] D.L. Bain, A.F. Heneghan, K.D. C onnaghan-Jones, and M.T. Miura, Nuclear receptor structure: implications for function. Annu Rev Physiol 69 (2007) 201-20. [302] G.S. Takimoto, L. Tung, H. Abdel-Hafiz, M.G. Abel, C. A. Sartorius, J.K. Richer, B.M. Jacobsen, D.L. Bain, and K.B. Ho rwitz, Functional properties of the Nterminal region of progesterone receptors and their mechanistic relationship to structure. J Steroid Bioc hem Mol Biol 85 (2003) 209-19. [303] M. Adams, M.J. Reginato, D. Sh ao, M.A. Lazar, and V.K. Chatterjee, Transcriptional activation by peroxisome pr oliferator-activated receptor gamma is inhibited by phosphorylation at a consensus mitogen-activated protein kinase site. J Biol Chem 272 (1997) 5128-32. [304] L.P. Freedman, B.F. Luisi, Z.R. Kors zun, R. Basavappa, P.B. Sigler, and K.R. Yamamoto, The function and structure of the metal coordination sites within the glucocorticoid receptor DNA binding domain. Na ture 334 (1988) 543-6.

PAGE 252

231 [305] Y. Hamuro, S.J. Coales, J.A. Morrow, K.S. Molnar, S.J. Tuske, M.R. Southern, and P.R. Griffin, Hydrogen/deuterium-exch ange (H/D-Ex) of PPARgamma LBD in the presence of various modulat ors. Protein Sci 15 (2006) 1883-92. [306] B.A. Johnson, E.M. Wilson, Y. Li, D.E. Moller, R.G. Smith, and G. Zhou, Ligandinduced stabilization of PPARgamma monitored by NMR spectroscopy: implications for nuclear receptor ac tivation. J Mol Biol 298 (2000) 187-94. [307] H.E. Xu, T.B. Stanley, V.G. Montana, M.H. Lambert, B.G. Shearer, J.E. Cobb, D.D. McKee, C.M. Galardi, K.D. Plunket, R.T. Nolte, D.J. Parks, J.T. Moore, S.A. Kliewer, T.M. Willson, and J.B. Stimmel, Structural basis for antagonistmediated recruitment of nuclear co-repr essors by PPARalpha. Nature 415 (2002) 813-7. [308] I.J. A, E. Jeannin, W. Wahli, and B. Desvergne, Polarity and specific sequence requirements of peroxisome proliferator -activated receptor (PPAR)/retinoid X receptor heterodimer binding to DNA. A func tional analysis of the malic enzyme gene PPAR response element. J Biol Chem 272 (1997) 20108-17. [309] V. Chandra, P. Huang, Y. Hamuro, S. Raghuram, Y. Wang, T.P. Burris, and F. Rastinejad, Structure of the intact PP AR-gamma-RXRnuclear receptor complex on DNA. Nature 456 (2008) 350-6. [310] P. Tontonoz, E. Hu, J. Devine, E.G. Beale, and B.M. Spiegelman, PPAR gamma 2 regulates adipose expression of the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 15 (1995) 351-7. [311] M. Okuno, E. Arimoto, Y. Ikenobu, T. Nishihara, and M. Imagawa, Dual DNAbinding specificity of peroxisome-pro liferator-activated receptor gamma controlled by heterodimer formation with retinoid X receptor alpha. Biochem J 353 (2001) 193-8. [312] I.G. Schulman, C. Li, J.W. Schwabe, and R.M. Evans, The phantom ligand effect: allosteric control of tran scription by the retinoid X re ceptor. Genes Dev 11 (1997) 299-308. [313] S.Z. Duan, C.Y. Ivashchenko, M.G. Us her, and R.M. Mortensen, PPAR-gamma in the Cardiovascular Syst em. PPAR Res 2008 (2008) 745804. [314] E.D. Rosen, and B.M. Spiegelma n, PPARgamma : a nuclear regulator of metabolism, differentiation, and cell gr owth. J Biol Chem 276 (2001) 37731-4. [315] F.J. Schopfer, Y. Lin, P.R. Baker, T. Cui, M. Garcia-Barrio, J. Zhang, K. Chen, Y.E. Chen, and B.A. Freeman, Nitroli noleic acid: an endogenous peroxisome proliferator-activated receptor gamma ligand. Proc Natl Acad Sci U S A 102 (2005) 2340-5. [316] R.L. Alexander, M.W. Wright, M.J. Gorczynski, P.K. Smitherman, T.E. Akiyama, H.B. Wood, J.P. Berger, S.B. King, and C. S. Morrow, Differential potencies of naturally occurring regioiso mers of nitrolinoleic acid in PPARgamma activation. Biochemistry 48 (2009) 492-8. [317] C. Zhang, D.L. Baker, S. Yasuda, N. Makarova, L. Balazs, L.R. Johnson, G.K. Marathe, T.M. McIntyre, Y. Xu, G.D. Prestwich, H.S. Byun, R. Bittman, and G. Tigyi, Lysophosphatidic acid induces neointima form ation through PPARgamma activation. J Exp Med 199 (2004) 763-74.

PAGE 253

232 [318] P. Tontonoz, and B.M. Spiegelma n, Fat and beyond: the diverse biology of PPARgamma. Annu Rev Biochem 77 (2008) 289-312. [319] P. Puigserver, Z. Wu, C.W. Park, R. Graves, M. Wright, and B.M. Spiegelman, A cold-inducible coactivator of nuclear recep tors linked to adaptive thermogenesis. Cell 92 (1998) 829-39. [320] H. Takano, and I. Komuro, Peroxisome proliferator-activated receptor gamma and cardiovascular diseases. Circ J 73 (2009) 214-20. [321] Z. Wu, N.L. Bucher, and S.R. Farm er, Induction of peroxisome proliferatoractivated receptor gamma during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBPbeta, C/ EBPdelta, and glucocorticoids. Mol Cell Biol 16 (1996) 4128-36. [322] W. He, Y. Barak, A. Hevener, P. Ols on, D. Liao, J. Le, M. Nelson, E. Ong, J.M. Olefsky, and R.M. Evans, Adipose-specifi c peroxisome prolif erator-activated receptor gamma knockout causes insulin re sistance in fat and liver but not in muscle. Proc Natl Acad Sc i U S A 100 (2003) 15712-7. [323] G. Medina-Gomez, S.L. Gray, L. Ye tukuri, K. Shimomura, S. Virtue, M. Campbell, R.K. Curtis, M. Jimenez-Linan, M. Blount, G.S. Yeo, M. Lopez, T. Seppanen-Laakso, F.M. Ashcroft, M. Or esic, and A. Vidal-Puig, PPAR gamma 2 prevents lipotoxicity by controlling adipos e tissue expandability and peripheral lipid metabolism. PLoS Genet 3 (2007) e64. [324] R.R. Henry, Thiazolidin ediones. Endocrinol Metab Clin North Am 26 (1997) 55373. [325] J.M. Lehmann, L.B. Moore, T.A. Sm ith-Oliver, W.O. Wilkison, T.M. Willson, and S.A. Kliewer, An antidiabetic thiazoli dinedione is a high affinity ligand for peroxisome proliferator-activated rece ptor gamma (PPAR gamma). J Biol Chem 270 (1995) 12953-6. [326] T.M. Willson, J.E. Cobb, D.J. Cowan, R. W. Wiethe, I.D. Correa, S.R. Prakash, K.D. Beck, L.B. Moore, S.A. Kliewer, and J.M. Lehmann, The structure-activity relationship between peroxisome prolifer ator-activated receptor gamma agonism and the antihyperglycemic activity of th iazolidinediones. J Med Chem 39 (1996) 665-8. [327] T.M. Willson, M.H. Lambert, and S.A. K liewer, Peroxisome proliferator-activated receptor gamma and metabolic diseas e. Annu Rev Biochem 70 (2001) 341-67. [328] B.R. Henke, S.G. Blanchard, M.F. Br ackeen, K.K. Brown, J.E. Cobb, J.L. Collins, W.W. Harrington, Jr., M.A. Hashim, E.A. Hull-Ryde, I. Kaldor, S.A. Kliewer, D.H. Lake, L.M. Leesnitzer, J.M. Lehm ann, J.M. Lenhard, L.A. Orband-Miller, J.F. Miller, R.A. Mook, Jr., S.A. Noble, W. Oliver, Jr., D.J. Parks, K.D. Plunket, J.R. Szewczyk, and T.M. Willson, N-(2 -Benzoylphenyl)-L-tyrosine PPARgamma agonists. 1. Discovery of a novel seri es of potent antihyperglycemic and antihyperlipidemic agents. J Med Chem 41 (1998) 5020-36. [329] I. Barroso, M. Gurnell, V.E. Crowle y, M. Agostini, J.W. Schwabe, M.A. Soos, G.L. Maslen, T.D. Williams, H. Lewis, A. J. Schafer, V.K. Chatterjee, and S. O'Rahilly, Dominant negative mutations in human PPARgamma associated with severe insulin resistance, diabetes me llitus and hypertension. Nature 402 (1999) 880-3.

PAGE 254

233 [330] M. Agostini, E. Schoenmakers, C. Mitc hell, I. Szatmari, D. Savage, A. Smith, O. Rajanayagam, R. Semple, J. Luan, L. Ba th, A. Zalin, M. Labib, S. Kumar, H. Simpson, D. Blom, D. Marais, J. Schwabe, I. Barroso, R. Trembath, N. Wareham, L. Nagy, M. Gurnell, S. O'Rahilly, and K. Chatterjee, Non-DNA binding, dominant-negative, human PPARgamma mutations cause lipodystrophic insulin resistance. Cell Metab 4 (2006) 303-11. [331] S.M. Rangwala, and M.A. Lazar, Per oxisome proliferator-activated receptor gamma in diabetes and metabolism. Trends Pharmacol Sci 25 (2004) 331-6. [332] J.M. Ye, N. Dzamko, M.E. Cleasby, B.D. Hegarty, S.M. Furler, G.J. Cooney, and E.W. Kraegen, Direct demonstration of lipid sequestration as a mechanism by which rosiglitazone prevents fatty-acid-induced insulin resistance in the rat: comparison with metformin. Diabetologia 47 (2004) 1306-13. [333] R. Sinha, S. Dufour, K.F. Petersen, V. LeBon, S. Enoksson, Y.Z. Ma, M. Savoye, D.L. Rothman, G.I. Shulman, and S. Ca prio, Assessment of skeletal muscle triglyceride content by (1)H nuclear magne tic resonance spectroscopy in lean and obese adolescents: relationshi ps to insulin sensitivity, total body fat, and central adiposity. Diabetes 51 (2002) 1022-7. [334] S.S. Sundaram, P. Zeitler, and K. Nadeau, The metabolic syndrome and nonalcoholic fatty liver disease in children. Curr Opin Pediatr (2009). [335] G. Boden, C. Homko, M. Mozzoli, L. C. Showe, C. Nichols, and P. Cheung, Thiazolidinediones upregulate fatty acid uptake and oxidati on in adipose tissue of diabetic patients. Diabetes 54 (2005) 880-5. [336] L. Chao, B. Marcus-Samuels, M.M. Ma son, J. Moitra, C. Vinson, E. Arioglu, O. Gavrilova, and M.L. Reitman, Adipose tissu e is required for the antidiabetic, but not for the hypolipidemic, effect of thi azolidinediones. J Clin Invest 106 (2000) 1221-8. [337] H.E. Lebovitz, Differentiating members of the thiazolidinedione class: a focus on safety. Diabetes Metab Res Rev 18 Suppl 2 (2002) S23-9. [338] J. Wilding, Thi azolidinediones, insulin resistan ce and obesity: Finding a balance. Int J Clin Pract 60 (2006) 1272-80. [339] B.M. Spiegelman, PPAR-gamma: adi pogenic regulator and thiazolidinedione receptor. Diabetes 47 (1998) 507-14. [340] F.M. Martens, F.L. Visseren, J. Lemay, E.J. de Koning, and T.J. Rabelink, Metabolic and additional vascular effects of thiazolidinediones. Drugs 62 (2002) 1463-80. [341] P. Arner, Not all fat is alike. Lancet 351 (1998) 1301-2. [342] A.H. Berg, T.P. Combs, and P.E. Scherer, ACRP30/adiponectin: an adipokine regulating glucose and lipid metabolism. Trends Endocrinol Metab 13 (2002) 849. [343] J.G. Yu, S. Javorschi, A.L. Hevener, Y.T. Kruszynska, R.A. Norman, M. Sinha, and J.M. Olefsky, The effect of thiazolidin ediones on plasma adiponectin levels in normal, obese, and type 2 diabetic subjects. Diabetes 51 (2002) 2968-74. [344] U.B. Pajvani, M. Hawkins, T.P. Combs, M.W. Rajala, T. Doebber, J.P. Berger, J.A. Wagner, M. Wu, A. Knopps, A.H. Xia ng, K.M. Utzschneider, S.E. Kahn, J.M. Olefsky, T.A. Buchanan, and P.E. Schere r, Complex distribution, not absolute

PAGE 255

234 amount of adiponectin, correlates with thiazolidinedione-mediated improvement in insulin sensitivity. J Bi ol Chem 279 (2004) 12152-62. [345] T. Yamauchi, J. Kamon, Y. Minokoshi, Y. Ito, H. Waki, S. Uchida, S. Yamashita, M. Noda, S. Kita, K. Ueki, K. Eto, Y. Akanuma, P. Froguel, F. Foufelle, P. Ferre, D. Carling, S. Kimura, R. Nagai, B. B. Kahn, and T. Kadowaki, Adiponectin stimulates glucose utilization and fa tty-acid oxidation by activating AMPactivated protein kinase. Nat Med 8 (2002) 1288-95. [346] A.R. Nawrocki, M.W. Rajala, E. To mas, U.B. Pajvani, A.K. Saha, M.E. Trumbauer, Z. Pang, A.S. Chen, N.B. R uderman, H. Chen, L. Rossetti, and P.E. Scherer, Mice lacking adiponectin show d ecreased hepatic insulin sensitivity and reduced responsiveness to peroxisome pr oliferator-activated receptor gamma agonists. J Biol Ch em 281 (2006) 2654-60. [347] C.M. Steppan, S.T. Bailey, S. Bhat, E.J. Brown, R.R. Banerjee, C.M. Wright, H.R. Patel, R.S. Ahima, and M.A. Lazar, Th e hormone resistin links obesity to diabetes. Nature 409 (2001) 307-12. [348] P. Tontonoz, L. Nagy, J.G. Alvarez, V.A. Thomazy, and R.M. Evans, PPARgamma promotes monocyte/macrophage differentia tion and uptake of oxidized LDL. Cell 93 (1998) 241-52. [349] V.R. Babaev, P.G. Yancey, S.V. Ryzhov, V. Kon, M.D. Breyer, M.A. Magnuson, S. Fazio, and M.F. Linton, Conditional knockout of macrophage PPARgamma increases atherosclerosis in C57BL/6 and low-density lipoprotein receptordeficient mice. Arterioscler Thro mb Vasc Biol 25 (2005) 1647-53. [350] A.L. Hevener, J.M. Olefsky, D. Re ichart, M.T. Nguyen, G. Bandyopadyhay, H.Y. Leung, M.J. Watt, C. Benner, M.A. Febbraio, A.K. Nguyen, B. Folian, S. Subramaniam, F.J. Gonzalez, C.K. Gl ass, and M. Ricote, Macrophage PPAR gamma is required for normal skeletal mu scle and hepatic insulin sensitivity and full antidiabetic effects of thiazolidine diones. J Clin Invest 117 (2007) 1658-69. [351] R.B. Vega, J.M. Huss, and D.P. Ke lly, The coactivator PGC-1 cooperates with peroxisome proliferator-activated recept or alpha in transcriptional control of nuclear genes encoding mitochondrial fa tty acid oxidation enzymes. Mol Cell Biol 20 (2000) 1868-76. [352] S. Soyal, F. Krempler, H. Oberkof ler, and W. Patsch, PGC-1alpha: a potent transcriptional cofactor involved in the pathogenesis of type 2 diabetes. Diabetologia 49 (2006) 1477-88. [353] P. Puigserver, and B.M. Spiegelman, Peroxisome proliferator-activated receptorgamma coactivator 1 alpha (PGC-1 alpha ): transcriptional coactivator and metabolic regulator. Endocr Rev 24 (2003) 78-90. [354] P. Puigserver, J. Rhee, J. Donovan, C.J. Walkey, J.C. Yoon, F. Oriente, Y. Kitamura, J. Altomonte, H. Dong, D. Accili, and B.M. Spiegelman, Insulinregulated hepatic gluconeogenesis th rough FOXO1-PGC-1alpha interaction. Nature 423 (2003) 550-5. [355] Y. Li, A. Kovach, K. Suino-Powell, D. Martynowski, and H.E. Xu, Structural and biochemical basis for the binding selectivity of peroxisome proliferator-activated receptor gamma to PGC-1alpha. J Biol Chem 283 (2008) 19132-9.

PAGE 256

235 [356] E. Hondares, O. Mora, P. Yubero, M. R odriguez de la Concepcion, R. Iglesias, M. Giralt, and F. Villarroya, Thiazolidine diones and rexinoids induce peroxisome proliferator-activated receptor-coactivator (PGC)-1alpha gene transcription: an autoregulatory loop controls PGC-1alpha expression in adipocytes via peroxisome proliferator-activated receptor-ga mma coactivation. Endocrinology 147 (2006) 2829-38. [357] L.F. Michael, Z. Wu, R.B. Cheatham, P. Puigserver, G. Adelmant, J.J. Lehman, D.P. Kelly, and B.M. Spiegelman, Restoration of insulin-sensitive glucose transporter (GLUT4) gene expression in muscle cells by the transcriptional coactivator PGC-1. Proc Natl A cad Sci U S A 98 (2001) 3820-5. [358] P. Puigserver, G. Adelmant, Z. W u, M. Fan, J. Xu, B. O'Malley, and B.M. Spiegelman, Activation of PPARgamma coact ivator-1 through transcription factor docking. Science 286 (1999) 1368-71. [359] L.J. Borgius, K.R. Steffensen, J.A. Gustafsson, and E. Treuter, Glucocorticoid signaling is perturbed by the atypical orphan receptor a nd corepressor SHP. J Biol Chem 277 (2002) 49761-6. [360] H.P. Guan, T. Ishizuka, P.C. Chui, M. Lehrke, and M.A. Lazar, Corepressors selectively control the transcriptional activity of PPARgamma in adipocytes. Genes Dev 19 (2005) 453-61. [361] A.E. Wallberg, S. Yamamura, S. Ma lik, B.M. Spiegelman, and R.G. Roeder, Coordination of p300-mediated chromatin remodeling and TRAP/mediator function through coactivator PGC-1a lpha. Mol Cell 12 (2003) 1137-49. [362] M. Monsalve, Z. Wu, G. Adelmant, P. Puigserver, M. Fan, and B.M. Spiegelman, Direct coupling of transc ription and mRNA processi ng through the thermogenic coactivator PGC-1. Mol Cell 6 (2000) 307-16. [363] H. Shen, J.L. Kan, and M.R. Green, Ar ginine-serine-rich domains bound at splicing enhancers contact the branc hpoint to promote prespliceosome assembly. Mol Cell 13 (2004) 367-76. [364] J. Lin, C. Handschin, and B.M. Spie gelman, Metabolic cont rol through the PGC-1 family of transcription coactiv ators. Cell Metab 1 (2005) 361-70. [365] J.V. Virbasius, and R.C. Scarpu lla, Activation of the human mitochondrial transcription factor A gene by nuclear resp iratory factors: a potential regulatory link between nuclear and mito chondrial gene expression in organelle biogenesis. Proc Natl Acad Sci U S A 91 (1994) 1309-13. [366] E.D. Rosen, P. Sarraf, A.E. Troy, G. Bradwin, K. Moore, D.S. Milstone, B.M. Spiegelman, and R.M. Mortensen, PPAR gamma is required for the differentiation of adipose tissue in vi vo and in vitro. Mol Cell 4 (1999) 611-7. [367] M.P. Cooper, M. Uldry, S. Kajimura, Z. Arany, and B.M. Spiegelman, Modulation of PGC-1 coactivator pathways in br own fat differentiation through LRP130. J Biol Chem 283 (2008) 31960-7. [368] M. Fluck, and H. Hoppeler, Molecular basis of skeletal muscle plasticity--from gene to form and function. Rev Phys iol Biochem Pharmacol 146 (2003) 159-216. [369] D.A. Hood, I. Irrcher, V. Ljubicic, and A.M. Joseph, Coordination of metabolic plasticity in skeletal musc le. J Exp Biol 209 (2006) 2265-75.

PAGE 257

236 [370] C. Handschin, and B.M. Spiegelman, The role of exercise and PGC1alpha in inflammation and chronic dis ease. Nature 454 (2008) 463-9. [371] S. Jager, C. Handschin, J. St-Pierre, and B.M. Spiegelman, AMP-activated protein kinase (AMPK) action in skeletal mu scle via direct phosphorylation of PGC1alpha. Proc Natl Acad Sc i U S A 104 (2007) 12017-22. [372] J. Lin, H. Wu, P.T. Tarr, C.Y. Zhang, Z. Wu, O. Boss, L.F. Michael, P. Puigserver, E. Isotani, E.N. Olson, B.B. Lowell, R. Bassel-Duby, and B.M. Spiegelman, Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature 418 (2002) 797-801. [373] A.R. Wende, P.J. Schaeffer, G.J. Park er, C. Zechner, D.H. Han, M.M. Chen, C.R. Hancock, J.J. Lehman, J.M. Huss, D.A. McClain, J.O. Holloszy, and D.P. Kelly, A role for the transcriptional coactivator PGC-1alpha in muscle refueling. J Biol Chem 282 (2007) 36642-51. [374] C.R. Benton, D.C. Wright and A. Bonen, PGC-1alpha-m ediated regulation of gene expression and metabolism: implications for nutrition and exercise prescriptions. Appl Physiol Nutr Metab 33 (2008) 843-62. [375] C. Handschin, S. Chin, P. Li, F. Liu, E. Maratos-Flier, N.K. Lebrasseur, Z. Yan, and B.M. Spiegelman, Skeletal muscle fi ber-type switching, exercise intolerance, and myopathy in PGC-1alpha muscle-speci fic knock-out animals. J Biol Chem 282 (2007) 30014-21. [376] A. Bonen, PGC-1alpha-i nduced improvements in skeletal muscle metabolism and insulin sensitivity. Appl Phys iol Nutr Metab 34 (2009) 307-14. [377] J.C. Long, and J.F. Caceres, The SR pr otein family of splicing factors: master regulators of gene expres sion. Biochem J 417 (2009) 15-27. [378] A.R. Krainer, G.C. C onway, and D. Kozak, Purifica tion and characterization of pre-mRNA splicing factor SF2 from HeLa cells. Genes Dev 4 (1990) 1158-71. [379] M.B. Roth, C. Murphy, and J.G. Gall, A monoclonal antibody that recognizes a phosphorylated epitope stains lampbrush ch romosome loops and small granules in the amphibian germinal vesicle. J Cell Biol 111 (1990) 2217-23. [380] A.M. Zahler, W.S. Lane, J.A. Stolk, and M.B. Roth, SR pr oteins: a conserved family of pre-mRNA splicing fact ors. Genes Dev 6 (1992) 837-47. [381] J.D. Kohtz, S.F. Jamison, C.L. Will, P. Zuo, R. Luhrmann, M.A. Garcia-Blanco, and J.L. Manley, Protein-protein interact ions and 5'-splice-site recognition in mammalian mRNA precursors. Nature 368 (1994) 119-24. [382] J.Y. Wu, and T. Mania tis, Specific interactions betw een proteins implicated in splice site selection and regulated al ternative splicing. Cell 75 (1993) 1061-70. [383] H. Shen, J.L. Kan, C. Ghigna, G. Biamonti, and M.R. Green, A single polypyrimidine tract binding protein (P TB) binding site mediates splicing inhibition at mouse IgM exons M1 and M2. RNA 10 (2004) 787-94. [384] J.F. Caceres, T. Misteli, G.R. Screaton, D.L. Spector, and A.R. Krainer, Role of the modular domains of SR proteins in subnuclear localizati on and alternative splicing specificity. J Ce ll Biol 138 (1997) 225-38. [385] N. Kataoka, J.L. Bachorik, and G. Dreyfuss, Transportin-SR, a nuclear import receptor for SR proteins. J Cell Biol 145 (1999) 1145-52.

PAGE 258

237 [386] L. Boucher, C.A. Ouzounis, A.J. Enright, and B.J. Blencowe, A genome-wide survey of RS domain proteins. RNA 7 (2001) 1693-701. [387] T. Misteli, J.F. Caceres, and D.L. Spector, The dynamics of a pre-mRNA splicing factor in living cells. Nature 387 (1997) 523-7. [388] A. Yuryev, M. Patturajan, Y. Litingt ung, R.V. Joshi, C. Gentile, M. Gebara, and J.L. Corden, The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginin e-rich proteins. Proc Natl Acad Sci U S A 93 (1996) 6975-80. [389] R. Das, J. Yu, Z. Zhang, M.P. Gygi, A.R. Krainer, S.P. Gygi, and R. Reed, SR proteins function in coupling RNAP II transcription to pre-mRNA splicing. Mol Cell 26 (2007) 867-81. [390] S. Lin, G. Coutinho-Mansfield, D. Wang, S. Pandit, and X.D. Fu, The splicing factor SC35 has an active ro le in transcriptional elonga tion. Nat Struct Mol Biol 15 (2008) 819-26. [391] M. de la Mata, C.R. Alonso, S. Kadener, J.P. Fededa, M. Blaustein, F. Pelisch, P. Cramer, D. Bentley, and A.R. Kornblih tt, A slow RNA polymerase II affects alternative splicing in vi vo. Mol Cell 12 (2003) 525-32. [392] E.C. Ibrahim, T.D. Schaal, K.J. Hertel R. Reed, and T. Mani atis, Serine/argininerich protein-dependent suppression of exon skipping by exonic splicing enhancers. Proc Natl Acad Sci U S A 102 (2005) 5002-7. [393] B.R. Graveley, K.J. He rtel, and T. Maniatis, The role of U2AF35 and U2AF65 in enhancer-dependent splicing. RNA 7 (2001) 806-18. [394] B.L. Robberson, G.J. Cote, and S.M. Be rget, Exon definition may facilitate splice site selection in RNAs with multiple exons. Mol Cell Biol 10 (1990) 84-94. [395] R.F. Roscigno, and M.A. Garcia-Blanc o, SR proteins escort the U4/U6.U5 trisnRNP to the spliceosome. RNA 1 (1995) 692-706. [396] A.I. Lamond, and D.L. Spector, Nuclear speckles: a model for nuclear organelles. Nat Rev Mol Cell Biol 4 (2003) 605-12. [397] Z. Zhang, and A.R. Krai ner, Involvement of SR prot eins in mRNA surveillance. Mol Cell 16 (2004) 597-607. [398] S.H. Xiao, and J.L. Ma nley, Phosphorylation of the ASF/SF2 RS domain affects both protein-protein and prot ein-RNA interactions and is necessary for splicing. Genes Dev 11 (1997) 334-44. [399] W. Cao, S.F. Jamison, and M.A. Garcia-Blanco, Both phosphorylation and dephosphorylation of ASF/SF2 are required for pre-mRNA splic ing in vitro. RNA 3 (1997) 1456-67. [400] Y. Huang, T.A. Yario, and J.A. Stei tz, A molecular link between SR protein dephosphorylation and mRNA export. Pr oc Natl Acad Sci U S A 101 (2004) 9666-70. [401] J.H. Ding, X.Y. Zhong, J.C. Hagopian, M. M. Cruz, G. Ghosh, J. Feramisco, J.A. Adams, and X.D. Fu, Regulated cellular partitioning of SR protein-specific kinases in mammalian cells. Mo l Biol Cell 17 (2006) 876-85. [402] S. Lin, R. Xiao, P. Sun, X. Xu, and X.D. Fu, Dephosphorylati on-dependent sorting of SR splicing factors during mRNP maturation. Mol Cell 20 (2005) 413-25.

PAGE 259

238 [403] G. Huang, P. Zhang, H. Hi rai, S. Elf, X. Yan, Z. Chen, S. Koschmieder, Y. Okuno, T. Dayaram, J.D. Growney, R.A. Shivdasani, D.G. Gilliland, N.A. Speck, S.D. Nimer, and D.G. Tenen, PU.1 is a major downstream target of AML1 (RUNX1) in adult mouse hematopoiesis. Nat Genet 40 (2008) 51-60. [404] G.M. Poon, and R.B. Macgregor, Jr., Base coupling in sequence-specific site recognition by the ETS domain of muri ne PU.1. J Mol Biol 328 (2003) 805-19. [405] C. Guillouf, I. Gallais, and F. Mo reau-Gachelin, Spi-1/PU.1 oncoprotein affects splicing decisions in a promoter bind ing-dependent manner. J Biol Chem 281 (2006) 19145-55. [406] L. Yang, L.J. Embree, S. Tsai, and D.D. Hickstein, Oncoprotein TLS interacts with serine-arginine proteins involved in RNA splicing. J Biol Chem 273 (1998) 27761-4. [407] M. Hallier, A. Tavitian, and F. Mor eau-Gachelin, The transc ription factor Spi1/PU.1 binds RNA and interferes with the RNA-binding protein p54nrb. J Biol Chem 271 (1996) 11177-81. [408] A.R. Kornblihtt, M. de la Mata, J.P. Fededa, M.J. Munoz, and G. Nogues, Multiple links between transcription a nd splicing. RNA 10 (2004) 1489-98. [409] K.M. Neugebauer, On the importance of being co-transcriptional. J Cell Sci 115 (2002) 3865-71. [410] L.P. Eperon, I.R. Grah am, A.D. Griffiths, and I. C. Eperon, Effects of RNA secondary structure on alternative splicing of pre-mRNA: is folding limited to a region behind the transcribing RNA polymerase? Cell 54 (1988) 393-401. [411] J. Shi, and K.V. Kandror, Study of glucose uptake in adipose cells. Methods Mol Biol 456 (2008) 307-15. [412] J.S. Elmendorf, Fractionation analysis of the subcellular distribution of GLUT-4 in 3T3-L1 adipocytes, Methods Mol Med, 2003, pp. 105-11. [413] F.K. Fulcher, B.T. Smith, M. Russ, a nd Y.M. Patel, Dual role for myosin II in GLUT4-mediated glucose uptake in 3T3L1 adipocytes. Exp Cell Res 314 (2008) 3264-74. [414] M.J. Reginato, and M.A. Lazar, Mech anisms by which Thiazolidinediones Enhance Insulin Action. Trends Endoc rinol Metab 10 (1999) 9-13. [415] S.Z. Duan, M.G. Usher, and R. M. Mortensen, PPARs: the vasculature, inflammation and hypertension. Curr Op in Nephrol Hypertens 18 (2009) 128-33. [416] J.R. Zierath, J.W. Ryder, T. Doebber, J. Woods, M. Wu, J. Ventre, Z. Li, C. McCrary, J. Berger, B. Zhang, and D.E. Moller, Role of skeletal muscle in thiazolidinedione insulin sensitizer (PPARgamma agonist) action. Endocrinology 139 (1998) 5034-41. [417] J.R. Zierath, and J.A. Ha wley, Skeletal muscle fiber type: influence on contractile and metabolic properties. PLoS Biol 2 (2004) e348. [418] F.M. Gregoire, C.M. Smas, and H.S. Sul, Understanding adipocyte differentiation. Physiol Rev 78 (1998) 783-809. [419] X. Guo, and K. Liao, Analysis of gene expression profile during 3T3-L1 preadipocyte differentiation. Gene 251 (2000) 45-53. [420] E.D. Rosen, and B.M. Spiegelman, Adipoc ytes as regulators of energy balance and glucose homeostasis. Nature 444 (2006) 847-53.

PAGE 260

239 [421] M.A. Mazid, A.A. Chowdhury, K. Nagao, K. Nishimura, M. Jisaka, T. Nagaya, and K. Yokota, Endogenous 15-deoxy-Delta(12,14 )-prostaglandin J(2) synthesized by adipocytes during maturation phase contri butes to upregulation of fat storage. FEBS Lett 580 (2006) 6885-90. [422] I. Tzameli, H. Fang, M. Ollero, H. Shi, J.K. Hamm, P. Kievit, A.N. Hollenberg, and J.S. Flier, Regulated production of a peroxisome proliferator-activated receptor-gamma ligand during an early phase of adipocyte differentiation in 3T3L1 adipocytes. J Biol Chem 279 (2004) 36093-102. [423] S. Hauser, G. Adelmant, P. Sarraf, H.M. Wright, E. Mueller, and B.M. Spiegelman, Degradation of the peroxisome proliferat or-activated receptor gamma is linked to ligand-dependent activation. J Biol Chem 275 (2000) 18527-33. [424] T. Kawaguchi, Y. Niino, H. Ohtaki, S. Kikuyama, and S. Shioda, New PKCdelta family members, PKCdeltaIV, deltaV, de ltaVI, and deltaVII are specifically expressed in mouse testis. FEBS Lett 580 (2006) 2458-64. [425] K. Kitamura, K. Mizuno, A. Etoh, Y. Akita, A. Miyamoto, K. Nakayama, and S. Ohno, The second phase activation of protein kinase C delta at late G1 is required for DNA synthesis in serum-induced cell cycle progression. Ge nes Cells 8 (2003) 311-24. [426] K. McGowan, J. DeVente, J.O. Carey, D. K. Ways, and P.H. Pekala, Protein kinase C isoform expression during the differentia tion of 3T3-L1 preadipocytes: loss of protein kinase C-alpha isoform correla tes with loss of phorbol 12-myristate 13acetate activation of nuclear factor ka ppaB and acquisition of the adipocyte phenotype. J Cell Physiol 167 (1996) 113-20. [427] Y. Liu, W. Su, E.A. Thompson, M. Le itges, N.R. Murray, and A.P. Fields, Protein kinase CbetaII regulates its own expression in rat intestinal epithelial cells and the colonic epithelium in vivo. J Biol Chem 279 (2004) 45556-63. [428] T. Hosono, H. Mizuguchi, K. Katayama, N. Koizumi, K. Kawabata, T. Yamaguchi, S. Nakagawa, Y. Watanabe, T. Mayumi, and T. Hayakawa, RNA interference of PPARgamma using fiber-modified ade novirus vector efficiently suppresses preadipocyte-to-adipocyte differentiation in 3T3-L1 cells. Gene 348 (2005) 15765. [429] D.J. Orlicky, J. DeGregori, and J. Sc haack, Construction of stable coxsackievirus and adenovirus receptor-expressing 3T3L1 cells. J Lipid Res 42 (2001) 910-5. [430] F. Carlotti, M. Bazuine, T. Kekarain en, J. Seppen, P. Pognonec, J.A. Maassen, and R.C. Hoeben, Lentiviral vectors efficien tly transduce quiescent mature 3T3-L1 adipocytes. Mol Ther 9 (2004) 209-17. [431] A. Chmurzynska, The multigene family of fatty acid-binding proteins (FABPs): function, structure and polymorphi sm. J Appl Genet 47 (2006) 39-48. [432] P. Zhang, G. Behre, J. Pan, A. Iwam a, N. Wara-Aswapati, H.S. Radomska, P.E. Auron, D.G. Tenen, and Z. Sun, Negativ e cross-talk between hematopoietic regulators: GATA proteins repress PU.1. Proc Natl Acad Sci U S A 96 (1999) 8705-10. [433] Q. Tong, G. Dalgin, H. Xu, C.N. Ti ng, J.M. Leiden, and G.S. Hotamisligil, Function of GATA transcription factors in preadipocyte-adipocyte transition. Science 290 (2000) 134-8.

PAGE 261

240 [434] B. Heinrich, Z. Zhang, O. Raitskin, M. Hiller, N. Benderska, A.M. Hartmann, L. Bracco, D. Elliott, S. Ben-Ari, H. Soreq, J. Sperling, R. Sperling, and S. Stamm, Heterogeneous Nuclear Ribonucleoprotein G Regulates Splice Site Selection by Binding to CC(A/C)-rich Regions in Pre-mRNA. J Biol Chem 284 (2009) 1430315. [435] B.A. Hug, N. Ahmed, J.A. R obbins, and M.A. Lazar, A chromatin immunoprecipitation screen re veals protein kinase Cb eta as a direct RUNX1 target gene. J Biol Chem 279 (2004) 825-30. [436] X. Luo, X. Zhang, W. Shao, Y. Yin, a nd J. Zhou, Crucial roles of MZF-1 in the transcriptional regulati on of apomorphine-induc ed modulation of FGF-2 expression in astrocytic culture s. J Neurochem 108 (2009) 952-61. [437] F. Wang, and Q. Tong, Transcription fact or PU.1 is expressed in white adipose and inhibits adipocyte differe ntiation. Am J Physiol Cell Physiol 295 (2008) C213-20. [438] Y. Kawakami, H. Nishimoto, J. Kitaur a, M. Maeda-Yamamoto, R.M. Kato, D.R. Littman, M. Leitges, D.J. Rawlings, and T. Kawakami, Protein kinase C betaII regulates Akt phosphorylation on Ser-473 in a cell typeand stimulus-specific fashion. J Biol Chem 279 (2004) 47720-5. [439] K.P. Becker, and Y.A. Hannun, Isoenzym e-specific translocati on of protein kinase C (PKC)betaII and not PKCbetaI to a juxt anuclear subset of recycling endosomes: involvement of phospholipase D. J Biol Chem 279 (2004) 28251-6. [440] J.E. Reusch, K.E. Sussman, and B. Dr aznin, Inverse relationship between GLUT-4 phosphorylation and its intrinsic acti vity. J Biol Chem 268 (1993) 3348-51. [441] X.M. Song, R.C. Hresko, and M. Mueckle r, Identification of amino acid residues within the C terminus of the Glut4 glucose transporter that are essential for insulin-stimulated redistribution to th e plasma membrane. J Biol Chem 283 (2008) 12571-85. [442] D. Williams, S.W. Hicks, C.E. Macham er, and J.E. Pessin, Golgin-160 is required for the Golgi membrane sorting of the insulin-responsive gl ucose transporter GLUT4 in adipocytes. Mo l Biol Cell 17 (2006) 5346-55. [443] C.E. Quinn, P.K. Hamilton, C.J. Lockha rt, and G.E. McVeigh, Thiazolidinediones: effects on insulin resistance and the car diovascular system. Br J Pharmacol 153 (2008) 636-45. [444] N. Marx, U. Schonbeck, M.A. Lazar P. Libby, and J. Plutzky, Peroxisome proliferator-activated receptor gamma activators inhibit gene expression and migration in human vascular smooth mu scle cells. Circ Res 83 (1998) 1097-103. [445] N.A. Patel, D.C. Eichler, D.S. Cha ppell, P.A. Illingworth, C.E. Chalfant, M. Yamamoto, N.M. Dean, J.R. Wyatt, K. Mebert, J.E. Watson, and D.R. Cooper, The protein kinase C beta II exon confer s mRNA instability in the presence of high glucose concentrations. J Biol Chem 278 (2003) 1149-57. [446] M. Yamamoto, M. Acevedo-Duncan, C.E. Chalfant, N.A. Patel, J.E. Watson, and D.R. Cooper, Acute glucose-induced downr egulation of PKC-betaII accelerates cultured VSMC proliferation. Am J P hysiol Cell Physiol 279 (2000) C587-95. [447] M. Abe, K. Hasegawa, H. Wada, T. Morimoto, T. Yanazume, T. Kawamura, M. Hirai, Y. Furukawa, and T. Kita, GATA-6 is involved in PPARgamma-mediated

PAGE 262

241 activation of differentiated phenotype in human vascular smooth muscle cells. Arterioscler Thromb Va sc Biol 23 (2003) 404-10. [448] J.K. Kim, J.J. Fillmore, O. Gavrilova, L. Chao, T. Higashimori, H. Choi, H.J. Kim, C. Yu, Y. Chen, X. Qu, M. Haluzik, M.L. Reitman, and G.I. Shulman, Differential effects of rosiglitazone on skel etal muscle and liver insulin resistance in A-ZIP/F-1 fatless mice. Diabetes 52 (2003) 1311-8. [449] M.L. Standaert, Y. Kanoh, M.P. Sajan, G. Bandyopadhyay, and R.V. Farese, Cbl, IRS-1, and IRS-2 mediate effects of ro siglitazone on PI3K, PKC-lambda, and glucose transport in 3T3/L1 adi pocytes. Endocrinology 143 (2002) 1705-16. [450] J.M. Ye, N. Dzamko, A.J. Hoy, M.A. Iglesias, B. Kemp, and E. Kraegen, Rosiglitazone treatment enhances acute AMP-activated protein kinase-mediated muscle and adipose tissue glucose uptake in high-fat-fed rats. Diabetes 55 (2006) 2797-804. [451] N. Musi, and L.J. Goodyear, AMP-activ ated protein kinase and muscle glucose uptake. Acta Physiol Scand 178 (2003) 337-45. [452] T.E. Jensen, S.J. Maarbjerg, A.J. Rose M. Leitges, and E.A. Richter, Knockout of the predominant conventional PKC isof orm, PKC{alpha}, in mouse skeletal muscle does not affect contraction-stim ulated glucose uptake. Am J Physiol Endocrinol Metab (2009). [453] H.E. Xu, and Y. Li, Ligand-depende nt and -independent regulation of PPAR gamma and orphan nuclear receptors. Sci Signal 1 (2008) pe52. [454] C.J. Walkey, and B.M. Spiegelman, A fu nctional peroxisome proliferator-activated receptor-gamma ligand-binding domain is no t required for adipogenesis. J Biol Chem 283 (2008) 24290-4. [455] M.I. Lefterova, and M.A. Lazar, New developments in adipogenesis. Trends Endocrinol Metab 20 (2009) 107-14. [456] G. Castillo, R.P. Brun, J.K. Rosenfie ld, S. Hauser, C.W. Park, A.E. Troy, M.E. Wright, and B.M. Spiegelman, An adipogenic cofactor bound by the differentiation domain of PPA Rgamma. EMBO J 18 (1999) 3676-87. [457] A.W. Norris, M.F. Hirshman, J. Yao, N. Jessen, N. Musi, L. Chen, W.I. Sivitz, L.J. Goodyear, and C.R. Kahn, Endogenous pe roxisome prolifer ator-activated receptor-gamma augments fatty acid uptake in oxidative muscle. Endocrinology 149 (2008) 5374-83. [458] E. Burgermeister, A. Schnoebelen, A. Fl ament, J. Benz, M. Stihle, B. Gsell, A. Rufer, A. Ruf, B. Kuhn, H.P. Marki, J. Mizrahi, E. Sebokova, E. Niesor, and M. Meyer, A novel partial agonist of per oxisome proliferator-activated receptorgamma (PPARgamma) recruits PPARgam ma-coactivator-1alpha, prevents triglyceride accumulation, and potentiates insulin signaling in vitro. Mol Endocrinol 20 (2006) 809-30. [459] H. Liang, and W.F. Ward, PGC-1alpha: a key regulator of energy metabolism. Adv Physiol Educ 30 (2006) 145-51. [460] M. Fan, J. Rhee, J. St-Pierre, C. Hands chin, P. Puigserver, J. Lin, S. Jaeger, H. Erdjument-Bromage, P. Tempst, and B.M. Spiegelman, Suppression of mitochondrial respiration through recrui tment of p160 myb binding protein to PGC-1alpha: modulation by p38 MAPK. Genes Dev 18 (2004) 278-89.

PAGE 263

242 [461] O.S. Gardner, C.W. Shiau, C.S. Chen, and L.M. Graves, Peroxisome proliferatoractivated receptor gamma-indepe ndent activation of p38 MAPK by thiazolidinediones involves calcium/calm odulin-dependent protein kinase II and protein kinase R: correla tion with endoplasmic reticulum stress. J Biol Chem 280 (2005) 10109-18. [462] N. Kumar, and C.S. De y, Restoration of impaired p38 activation by insulin in insulin resistant skeletal muscle cells treated with thiazolidinediones. Mol Cell Biochem 260 (2004) 55-64. [463] C. Teyssier, H. Ma, R. Emter, A. Kr alli, and M.R. Stallcup, Activation of nuclear receptor coactivator PGC-1alpha by ar ginine methylation. Genes Dev 19 (2005) 1466-73. [464] J.T. Rodgers, C. Lerin, W. Haas, S.P. Gygi, B.M. Spiegelman, and P. Puigserver, Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 434 (2005) 113-8. [465] L. Bolduc, B. Labrecque, M. Cordeau, M. Blanchette, and B. Chabot, Dimethyl sulfoxide affects the selec tion of splice sites. J Biol Chem 276 (2001) 17597-602. [466] N.A. Patel, C.E. Chalfant, M. Yama moto, J.E. Watson, D.C. Eichler, and D.R. Cooper, Acute hyperglycemia regulates transcription and posttranscriptional stability of PKCbetaII mRNA in vasc ular smooth muscle cells. FASEB J 13 (1999) 103-13. [467] C. Pantoja, J.T. Huff, and K.R. Yamamoto, Glucoc orticoid signaling defines a novel commitment state during adipogenesis in vitro. Mol Biol Cell 19 (2008) 4032-41. [468] L. Braiman, A. Alt, T. Kuroki, M. Ohba, A. Bak, T. Tennenbaum, and S.R. Sampson, Insulin induces specific interac tion between insulin receptor and protein kinase C delta in primary cultured skel etal muscle. Mol Endocrinol 15 (2001) 565-74. [469] L. Delva, I. Gallais, C. Guillouf, N. Denis, C. Orvain, and F. Moreau-Gachelin, Multiple functional domains of the oncoproteins Spi-1/PU.1 and TLS are involved in their opposite splicing effects in erythroleukemic cells. Oncogene 23 (2004) 4389-99. [470] T. Misteli, J.F. Caceres, J.Q. Clemen t, A.R. Krainer, M.F. Wilkinson, and D.L. Spector, Serine phosphorylation of SR protei ns is required for their recruitment to sites of transcription in vivo. J Cell Biol 143 (1998) 297-307. [471] M.W. Rajala, and P.E. Scherer, Minireview: The adip ocyte--at the crossroads of energy homeostasis, inflammation, and athe rosclerosis. Endocrinology 144 (2003) 3765-73. [472] E. Carvalho, K. Kotani, O.D. Pe roni, and B.B. Kahn, Adipose-specific overexpression of GLUT4 reverses insulin resistance and diabetes in mice lacking GLUT4 selectively in muscle. Am J P hysiol Endocrinol Metab 289 (2005) E55161. [473] E.D. Abel, O. Peroni, J. K. Kim, Y.B. Kim, O. Boss, E. Hadro, T. Minnemann, G.I. Shulman, and B.B. Kahn, Adipose-selectiv e targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 409 (2001) 729-33.

PAGE 264

243 [474] K.V. Kandror, L. Coderre, A.V. Pus hkin, and P.F. Pilch, Comparison of glucosetransporter-containing vesicles from rat fat and muscle tissues: evidence for a unique endosomal compartment. Bi ochem J 307 ( Pt 2) (1995) 383-90. [475] T. Ploug, B. van Deurs, H. Ai, S.W. Cushman, and E. Ralston, Analysis of GLUT4 distribution in whole skelet al muscle fibers: identifi cation of distinct storage compartments that are recruited by insulin and muscle contractions. J Cell Biol 142 (1998) 1429-46. [476] L.L. Tortorella, and P.F. Pilch, C2 C12 myocytes lack an insulin-responsive vesicular compartment de spite dexamethasone-induced GLUT4 expression. Am J Physiol Endocrinol Metab 283 (2002) E514-24. [477] D.R. Cooper, J.E. Watson, N. Patel, P. Illingworth, M. Acevedo-Duncan, J. Goodnight, C.E. Chalfant, and H. Mischak, Ectopic expression of protein kinase CbetaII, -delta, and -epsilon, but not -b etaI or -zeta, provide for insulin stimulation of glucose uptake in NI H-3T3 cells. Arch Biochem Biophys 372 (1999) 69-79. [478] E. Pagano, and J.C. Calvo, ErbB2 and EGFR are downmodulated during the differentiation of 3T3-L1 preadipoc ytes. J Cell Biochem 90 (2003) 561-72. [479] A.G. Kayali, D.A. Austin, and N.J. Webs ter, Rottlerin inhibits insulin-stimulated glucose transport in 3T3-L1 adipocyt es by uncoupling mitochondrial oxidative phosphorylation. Endocri nology 143 (2002) 3884-96. [480] F. Oriente, F. Andreozzi, C. Romano, G. Perruolo, A. Perfetti, F. Fiory, C. Miele, F. Beguinot, and P. Formisano, Protein ki nase C-alpha regulates insulin action and degradation by interacting with insulin receptor substrate-1 and 14-3-3 epsilon. J Biol Chem 280 (2005) 40642-9. [481] E.D. Motley, K. Eguchi, C. Gardner, A.L. Hicks, C.M. Reynolds, G.D. Frank, M. Mifune, M. Ohba, and S. Eguchi, Insulin -induced Akt activation is inhibited by angiotensin II in the vascul ature through protein kinase C-alpha. Hypertension 41 (2003) 775-80. [482] L. Braiman, L. Sheffi-Friedman, A. Bak, T. Tennenbaum, and S.R. Sampson, Tyrosine phosphorylation of specific protei n kinase C isoenzymes participates in insulin stimulation of glucos e transport in primary cultures of rat skeletal muscle. Diabetes 48 (1999) 1922-9. [483] G. Bandyopadhyay, M.L. Standaert, L. Galloway, J. Moscat, and R.V. Farese, Evidence for involvement of protein ki nase C (PKC)-zeta and noninvolvement of diacylglycerol-sensitive PKCs in insulin -stimulated glucose transport in L6 myotubes. Endocrinology 138 (1997) 4721-31. [484] G. Bandyopadhyay, M.L. Standaert, L. Zhao, B. Yu, A. Avignon, L. Galloway, P. Karnam, J. Moscat, and R.V. Farese, Activ ation of protein kinase C (alpha, beta, and zeta) by insulin in 3T3/L1 cells. Tr ansfection studies suggest a role for PKCzeta in glucose transport. J Biol Chem 272 (1997) 2551-8. [485] M.L. Standaert, G. Bandyopadhyay, L. Galloway, J. Soto, Y. Ono, U. Kikkawa, R.V. Farese, and M. Leitges, Effects of knockout of the protein kinase C beta gene on glucose transport and glucos e homeostasis. Endocrinology 140 (1999) 4470-7.

PAGE 265

244 [486] A. Zisman, O.D. Peroni, E.D. Abel, M.D. Michael, F. Mauvais-Jarvis, B.B. Lowell, J.F. Wojtaszewski, M.F. Hirshman, A. Virkamaki, L.J. Goodyear, C.R. Kahn, and B.B. Kahn, Targeted disruption of the gluc ose transporter 4 selectively in muscle causes insulin resistance and glucose intolerance. Nat Med 6 (2000) 924-8. [487] M.L. Standaert, G. Bandyopadhyay, Y. Kanoh, M.P. Sajan, and R.V. Farese, Insulin and PIP3 activate PKC-zeta by m echanisms that are both dependent and independent of phosphorylation of activation loop (T410) and autophosphorylation (T560) sites. Biochemistry 40 (2001) 249-55. [488] G. Bandyopadhyay, M.P. Sajan, Y. Kanoh, M.L. Standaert, M.J. Quon, B.C. Reed, I. Dikic, and R.V. Farese, Glucose ac tivates protein kinase C-zeta /lambda through proline-rich tyrosine kinase-2, ex tracellular signal-re gulated kinase, and phospholipase D: a novel mechanism fo r activating glucose transporter translocation. J Biol Chem 276 (2001) 35537-45. [489] T. Hirai, and K. Chida, Protein kina se Czeta (PKCzeta): activ ation mechanisms and cellular functions. J Biochem 133 (2003) 1-7. [490] D.R. Alessi, Discovery of PDK1, one of the missi ng links in insulin signal transduction. Colworth Medal Lecture. Biochem Soc Trans 29 (2001) 1-14. [491] N.A. Bourbon, J. Yun, and M. Kester, Cera mide directly activates protein kinase C zeta to regulate a stress-activated protei n kinase signaling complex. J Biol Chem 275 (2000) 35617-23. [492] J. Mei, C.N. Wang, L. O'Brien, and D.N. Brindley, Cell-permeable ceramides increase basal glucose incorporation into triacylglycerols but decrease the stimulation by insulin in 3T3-L1 adipoc ytes. Int J Obes Relat Metab Disord 27 (2003) 31-9. [493] R. Azarnia, and T.R. Russell, Cyc lic AMP effects on cell-to-cell junctional membrane permeability during adipocyte differentiation of 3T3-L1 fibroblasts. J Cell Biol 100 (1985) 265-9. [494] A.W. Harmon, D.S. Paul and Y.M. Patel, MEK inhibitors impair insulinstimulated glucose uptake in 3T3-L1 ad ipocytes. Am J Physiol Endocrinol Metab 287 (2004) E758-66. [495] D. DePaolo, J.E. Reusch, K. Carel, P. Bhuripanyo, J.W. Leitner, and B. Draznin, Functional interactions of phosphatidylinos itol 3-kinase with GTPase-activating protein in 3T3-L1 adipocytes. Mol Cell Biol 16 (1996) 1450-7. [496] J. Yan, Z. Gao, G. Yu, Q. He, J. We ng, and J. Ye, Nuclear corepressor is required for inhibition of phosphoenolpyruvate carboxykinase expression by tumor necrosis factor-alpha. Mol Endocrinol 21 (2007) 1630-41. [497] J.T. Brozinick, Jr., B. A. Berkemeier, and J.S. Elmendorf, "Actin"g on GLUT4: membrane & cytoskeletal components of insulin action. Curr Diabetes Rev 3 (2007) 111-22. [498] R.T. Watson, and J.E. Pessin, GLUT4 tr anslocation: the last 200 nanometers. Cell Signal 19 (2007) 2209-17. [499] E.M. van Dam, R. Govers, and D.E. James, Akt activation is required at a late stage of insulin-induced GLUT4 transloca tion to the plasma membrane. Mol Endocrinol 19 (2005) 1067-77.

PAGE 266

245 [500] L.N. Cong, H. Chen, Y. Li, L. Zhou, M.A. McGibbon, S.I. Taylor, and M.J. Quon, Physiological role of Akt in insulin-stimulated translocation of GLUT4 in transfected rat adipose cells. Mol Endocrinol 11 (1997) 1881-90. [501] P.H. Ducluzeau, L.M. Fletcher, G. I. Welsh, and J.M. Tavare, Functional consequence of targeting protein kinase B/Akt to GLUT4 vesicles. J Cell Sci 115 (2002) 2857-66. [502] D.R. Alessi, L.R. Pearce, and J.M. Garcia-Martinez, New insights into mTOR signaling: mTORC2 and beyond. Sci Signal 2 (2009) pe27. [503] R. Slaaby, G. Du, Y.M. Altshuller, M.A. Frohman, and K. Seedorf, Insulin-induced phospholipase D1 and phospholipase D2 ac tivity in human embryonic kidney-293 cells mediated by the phospholipase C gamma and protein kinase C alpha signalling cascade. Bioche m J 351 Pt 3 (2000) 613-9. [504] C.A. Millar, T.J. Jess, K.M. Saqi b, M.J. Wakelam, and G.W. Gould, 3T3-L1 adipocytes express two isoforms of p hospholipase D in dist inct subcellular compartments. Biochem Biophys Res Commun 254 (1999) 734-8. [505] G. Du, P. Huang, B.T. Liang, and M. A. Frohman, Phospholipase D2 localizes to the plasma membrane and regulates angiot ensin II receptor e ndocytosis. Mol Biol Cell 15 (2004) 1024-30. [506] I. Gorshkova, D. He, E. Berdyshev, P. Usatuyk, M. Burns, S. Kalari, Y. Zhao, S. Pendyala, J.G. Garcia, N.J. Pyne, D.N. Br indley, and V. Natarajan, Protein kinase C-epsilon regulates sphingosine 1-phospha te-mediated migration of human lung endothelial cells through activation of phospholipase D 2, protein kinase C-zeta, and Rac1. J Biol Chem 283 (2008) 11794-806. [507] D.W. Kang, M.H. Park, Y.J. Lee, H.S. Kim, T.K. Kwon, W.S. Park, and S. Min do, Phorbol ester up-regulates phospholipase D1 but not phospholipase D2 expression through a PKC/Ras/ERK/NFkappaB-depende nt pathway and enhances matrix metalloproteinase-9 secretion in colo n cancer cells. J Biol Chem 283 (2008) 4094104. [508] A. Ghelli, A.M. Porcelli, A. Facchin i, S. Hrelia, F. Flamigni, and M. Rugolo, Phospholipase D1 is threonine-phosphorylat ed in human-airway epithelial cells stimulated by sphingosine-1-phosphate by a mechanism involving Src tyrosine kinase and protein kinase Cd elta. Biochem J 366 (2002) 187-93.

PAGE 267

ABOUT THE AUTHOR Eden Kleiman received his Bachelor s degree in Biology from the University of South Florida in 2002. He entered the Ph.D program in spring 2004 and began working with Dr. Denise Cooper in the Departme nt of Molecular Medicine (formerly Biochemistry and Molecular Biology) in summ er 2004. He presented his research four times at the Annual Endocrine Society Meeting. Three of these were poster presentations and summer 2006 he gave a formal presentati on. He was awarded an Endocrine Society Travel Award in 2006 followed by an Endoc rine Society Fellows & Students Day Workshop Award in 2007. From 2006 to 2008, he received financial support for his research through an American Heart Associ ation Pre-Doctoral Fellowship Florida Affiliate Award. He published his first author paper in a prestigious scientific journal and was also co-author on another high-imp act publication during his tenure as a Ph.D. candidate.