USF Libraries
USF Digital Collections

Characterization of nprc and its binding partners

MISSING IMAGE

Material Information

Title:
Characterization of nprc and its binding partners
Physical Description:
Book
Language:
English
Creator:
Alli, Abdel
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
AHNAK1
Arrestins
Calcium
Phospholipase C
Phosphorylation
Dissertations, Academic -- Molecular Medicine -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: The C type natriuretic peptide receptor (NPRC), also known as NPR3 is a widely expressed single transmembrane-spanning protein. NPRC functions as a homodimer at the cell surface for the metabolic clearance of a broad range of natriuretic peptides from circulation. The intracellular domain of NPRC is coupled to inhibitory G proteins and is involved in mediating signal transduction. In order to further elucidate the role of NPRC in signal transduction, a proteomic approach was taken to identify putative protein binding partners for NPRC in different cell-types. An interrogation of the molecular association between NPRC and its identified protein binding partner(s) was carried out in different cell types to identify the specific interacting domains. The physiological role of the association between NPRC and its protein binding partner(s) were investigated in situ. Furthermore, NPRC is subject to post translation modifications, including glycosylation and phosphorylation. Although evidence suggests NPRC is phosphorylated on serine residues, the specific amino acid residues that are phosphorylated and the kinases responsible for their phosphorylation has yet to be determined. A recombinant GST-NPRC fusion protein, polyclonal NPRC antibody, kinase prediction algorithm, and several phosphospecific and substrate motif antibodies were utilized to characterize the phosphorylation state of NPRC in vitro.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2009.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Abdel Alli.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003292
usfldc handle - e14.3292
System ID:
SFS0027608:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Characterization of NPRC and Its Binding Partners by Abdel A. Alli A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: William R. Gower, Jr., Ph.D. Denise R. Cooper, Ph.D. David L. Vesely, MD, Ph.D. Larry P. Solomonson, Ph.D. Date of Approval: November 2, 2009 Keywords: AHNAK1, arrestins, calc ium, phospholipase C, phosphorylation Copyright 2009, Abdel A. Alli

PAGE 2

i Table of Contents List of Tables v List of Figures vi List of Abbreviations xii Abstract xvii Introduction 1 Natriuretic Peptides 1 Natriuretic Peptide Receptors 5 -arrestins 11 G proteins 14 Adenylyl Cyclase 15 AHNAK1/Desmoyokin 17 Arachidonic Acid 20 Phospholipase C 23 Calcium Signaling 24 Adipogenesis 25 Protein Kinases and Phosphatases 28 Cell-cell Junctions 30 RGM1 34 3T3-L1 34 AoSMCs 35 Recombinant Proteins 35

PAGE 3

ii Central Hypothesis and Specific Aims 40 Specific Aim 1 40 Specific Aim 2 40 Specific Aim 3 40 Specific Aim 4 40 Specific Aim 5 40 Chapter 1: Development of a Polyclonal Antibod y (JAH84) For Investigations of NPRC 48 Background 49 Materials and Methods 50 Results 56 Discussion 58 Chapter 2: Protein Binding Partners of NPRC 67 Background 68 Materials and Methods 69 Results 74 Discussion 80 Chapter 3: Role of NPRC in Signal Transduction 111 Background 112 Materials and Methods 113 Results 118 Discussion 125 Chapter 4: Post-Translational Modifications of NPRC 161 Background 162 Materials and Methods 163

PAGE 4

iii Results 169 Discussion 175 Chapter 5: Potential Functions of AHNAK1 193 Background 194 Materials and Methods 195 Results 197 Discussion 199 References 211 Appendices 235 Appendix A: EMBOSS alignment needle program results of AHANK1 and AHNAK2 236 Appendix B: Reverse and forw ard sequence for pACT-NPRC and pBIND-NPRC 239 Appendix C: Sequence for pACT-arrestin and pBIND-arrestin 240 Appendix D: Reverse and forw ard sequence for pBIND-AHNAK1 240 Appendix E: Reverse and forwar d sequence for AHNAK1 construct 2 241 Appendix F: Construction of pACT and pBIND AHNAK1 fusion proteins 242 Appendix G: Construc tion of pGEX4T3NPRC 243 Appendix H: Sequence for rat GST-NPRC 243 Appendix I: Primers used with the QuikChange site-directed mutagenesis kit 244 Appendix J: Site-directe d mutagenesis reaction 244 Appendix K: Cycling parameters for site-directed mutagenesis

PAGE 5

iv reaction 245 Appendix L: Ligation reaction for construction of pACT and pBIND AHNAK1 245 Appendix M: Restriction digest r eaction for verification of pACT and pBIND AHNAK1 245 Appendix N: Reactions and parame ters for the subcloning of rat NPRC into pGEX4T3 246 Appendix O: Transfection reagents used for delivery of plasmid DNA or siRNA 247 Appendix P: Relevant publications 248 About the Author End Page

PAGE 6

v List of Tables Table 1 Natriuretic Peptides and their receptors in disease 39 Table 2 Protein expression of natriuretic peptide recepto rs in various cell lines 39 Table 3 Location of the gene coding for the NPRs 40 Table 4 Sequences for siRNAs used in various experiments 135 Table 5 Solubilization and purification scheme for GST-NPRC 182 Table 6 Various antibodies used to charact erize the phosphorylation state of NPRC 182 Table 7 Prediction of NPRC phosphorylation by PKA using the pkaPS algorithm 182

PAGE 7

vi List of Figures Figure 1 Amino acid structure of the natriuretic peptides. 41 Figure 2 Paradigm of natriuretic peptide synthesis and release. 42 Figure 3 Topology of the natriuretic peptide receptors (NPRs). 43 Figure 4 Diagram showing the role of G proteins in signal transduction. 44 Figure 5 Reactions catalyzed by various enzymes. 45 Figure 6 Role of the second messengers IP3, DAG, and Ca2+ in the phosphatidylinositol system. 46 Figure 7 Phase-contrast microscopy of the cell lines used in the various studies of NPRC. 47 Figure 8 Sequence alignment of the in tracellular domain of NPRC from various species. 61 Figure 9 Western blot analysis showing cross-reactivity of various polyclonal antibodies against NPRC. 62 Figure 10 Western blot and densitometric analyses of flag-NPRC using JAH84 antibody. 63 Figure 11 Coomassie blue stained gel (grayscale) after immunoprecipitation of NPRC with JAH84. 64 Figure 12 Western blot analysis of en dogenous NPRC protein expression using JAH84 antibody. 65 Figure 13 Immunofluorescence of RGM1 cells using JAH84. 66 Figure 14 Schematic of the far Wester n (protein overlay assay) technique. 87

PAGE 8

vii Figure 15 Representation of constructs used in the mammalian two-hybrid dual luciferase assay. 88 Figure 16 Sequence alignment of the 37 amino acid cytoplasmic domain of human and rat NPRC. 89 Figure 17 In vitro IP-Western demonstrating the association between NPRC and arrestins. 90 Figure 18 Effect of NPRC occupancy on its association with -arrestins. 91 Figure 19 In vitro GST pulldown assay showing specificity of -arrestin isoforms for NPRC. 92 Figure 20 Model illustrating the hypothesized role of -arrestin 1/2 in mediating NPRC signaling. 93 Figure 21 Molecular association of NPRC and AHNAK1 in AoSMC. 94 Figure 22 Molecular association of NPRC and AHNAK1 in RGM1 cells. 95 Figure 23 Molecular association of NPRC and AHNAK1 in 3T3-L1 cells. 96 Figure 24 Identification of AHNAK1 domains that associate with NPRC in AoSMC cells. 97 Figure 25 Specificity of the association between NPRC and AHNAK1. 98 Figure 26 The role of phosphorylatio n in the association between NPRC and AHNAK1. 99 Figure 27 Effect of NPRC occupancy on the association between NPRC and AHNAK1. 100 Figure 28 Expression of endogenous AHNAK1 and NPR proteins. 101 Figure 29 Expression of endogenous PLC proteins in various cell lines. 102 Figure 30 Assessment of the differentiation of 3T3-L1 cells. 103 Figure 31 Regulation of AHNAK1 and NPR pr otein expression from day 0 to 6 of 3T3L1 cell differentiation. 104

PAGE 9

viii Figure 32 Regulation of AHNAK1 and NPR protein expression from day 8 to 12 of 3T3-L1 cell differentiation. 105 Figure 33 Endogenous expression of AHNAK1 and NPRC proteins in mouse adipose tissues. 106 Figure 34 The effect of AHNAK1 translocation in response to PMA treatment in RGM1 cells. 107 Figure 35 Immunofluorescence showing the effect of increased [Ca2+]e on AHNAK1 translocation in 3T3-L1 preadipocytes. 108 Figure 36 Knockdown of NPRC protein in 3T3-L1 preadipocytes. 109 Figure 37 Role of NPRC knockdown on AHNAK1 subcellular localization. 110 Figure 38 Response to ET-1 in A-10 VSMCs. 136 Figure 39 Intracellular Ca2+ mobilization in quiescent AoSMC in response to 1 M AA. 137 Figure 40 Intracellular Ca2+ mobilization in quiescent AoSMC in response to 25 M. AA. 138 Figure 41 Intracellular Ca2+ mobilization in quiescent AoSMC in response to 25 M AA in calcium free medium. 139 Figure 42 Intracellular Ca2+ mobilization in quiescent AoSMC in response to 1 M TG. 140 Figure 43 Intracellular Ca2+ mobilization in quiescent AoSMC in response to 100 M AA. 141 Figure 44 Intracellular Ca2+ mobilization in quiescent AoSMC in response to 25 M PMA. 142 Figure 45 Intracellular Ca2+ mobilization in quiescent AoSMC in response to 1 M cANF. 143 Figure 46 Intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 100 M AA. 144

PAGE 10

ix Figure 47 Intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 25 M AA. 145 Figure 48 Intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 25 M AA in the absence of extracellular Ca2+. 146 Figure 49 Intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 1 M TG. 147 Figure 50 Intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 1 M PMA. 148 Figure 51 Intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 25 M PMA. 149 Figure 52 Effect of NPRC knockdown on intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 25 M PMA. 150 Figure 53 Effect of overexpression of an pBINDAHNAK1 construct on intracellular Ca2+ mobilization in quiescent 3T3-L1 pr eadiocytes in response to 1 M PMA. 151 Figure 54 Effect of overexpression of an pBINDAHNAK1 construct on intracellular Ca2+ mobilization in quiescent 3T3-L1 pr eadiocytes in response to 25 M PMA. 152 Figure 55 Effect of AHNAK1 knockdown on intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 25 M PMA. 153 Figure 56 Effect of AHNAK1 knockdown on intracellular Ca2+ mobilization in quiescent day 2 differentiated 3T3-L1 preadipocytes in response to 25 M PMA. 154 Figure 57 Intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes pretreated with AACOCF3 in response to 25 M PMA. 155

PAGE 11

x Figure 58 Intracellular Ca2+ mobilization in quiescent 3T3-L1 preadiocytes in response to 1 M cANF. 156 Figure 59 Comparisons of various intracellular Ca2+ experiments. 157 Figure 60 Proposed role of NPRC in intracellular Ca2+ mobilization through AHNAK1 and AA. 158 Figure 61 Western blot and densitometric analyses showing the effect of increased [Ca2+]e on AHNAK1 translocation in 3T3-L1 preadipocytes. 159 Figure 62 Effect of increased [Ca2+]e on [Ca2+]i mobilization in 3T3-L1 preadipocytes. 160 Figure 63 Construction of recombinant GST-NPRC. 183 Figure 64 Optimization of expressi on conditions of GST-NPRC. 184 Figure 65 Coomassie blue stained gel show ing the purification of GST-NPRC. 185 Figure 66 Confirmation of the sequence of GST-NPRC. 186 Figure 67 Determination of the molecula r weight of GST-NPRC under native PAGE conditions. 187 Figure 68 Spontaneous versus ligand-i nduced dimerization of GST-NPRC. 188 Figure 69 Predicted secondary structure for GST-NPRC. 189 Figure 70 Phosphorylation consensus sequences within the intracellular domain of rat NPRC. 190 Figure 71 In vitro phosphorylation of GST-NPRC. 191 Figure 72 Identification of putative residues and kinases involved in NPRC phosphorylation. 192 Figure 73 Schematic of the junctiona l complex of epithelial cells. 202 Figure 74 Colocalization of AHNAK1 and ZO-2 proteins in confluent RGM1 cells. 203 Figure 75 Subcellular localization of AHNAK1 in RGM1 cells. 204 Figure 76 Schematic illustrating the va rious sections of the stomach. 205

PAGE 12

xi Figure 77 Histochemical analysis of representative tissue sections from healthy human organ stomach donors. 206 Figure 78 Western blot analysis of endogenous AHNAK1, NPRA, and NPRC protein expression in healthy human stomach. 207 Figure 79 Immunohistochemistry analysis of endogenous AHNAK1 in healthy human stomach. 208 Figure 80 Knockdown of AHNAK1 protein in RGM1 cells. 209 Figure 81 In vitro permeability assay de monstrating the role of AHNAK1 in maintaining paracellular cellular permea bility and the barrier properties of RGM1 cells. 210

PAGE 13

xii List of Abbreviations 7MSRs seven membrane spanning receptors AA arachidonic acid AJ adherens junctions AngII angiotensin II ANP atrial natriuretic peptide AoSMC Aortic Vascular Smooth Muscle Cell BNP B-type natriuretic peptide BCA bicinchoninic acid BSA bovine serum albumin cPLA2 cytosolic Ca2+ dependent phospholipase A2 CASM coronary artery smooth muscle cells CD circular dichroism CNP C-type natriuretic peptide cAMP cyclic adenosine monophosphate cANF/cANP ANP analog des-[Glu18Ser19Gly20Leu21Gly22]-ANF-(4-23)-NH2 CYP cytochrome P450 monooxygenase DAG diacylglycerol DAPI 4',6-diamidino-2-phenylindole DDA dideoxyadenosine DIC differential interference contrast DMEM Dulbecco’s modified Eagle’s medium

PAGE 14

xiii DMSO dimethyl sulfoxide DNP dendroaspis natriuretic peptide DTT dithiothreitol EC endothelial cell ECD extracellular domain EDTA ethylenediaminetetraacetic acid EET epoxyeicosatrienoic acids EGF epidermal growth factor ET-1 Endothelin-1 FABP Fatty acid binding protein FBS fetal bovine serum FSK forskolin FITC fluorescein isothiocyanate FGF Fibroblast growth factor GAPDH glyceraldehyde-3-phosphate dehydrogenase GAPs GTPase activating proteins GDI Guanosine nucleotide dissociation inhibitors GDP guanosine diphosphate GEFs guanine nucleotide exchange factors Gi inhibitory guanine nucleotide regulatory protein GPCR G protein-coupled receptors GRKs G protein-coupled receptor kinases Gs stimulatory guanine nucleotide regulatory proteins GST Glutathione Stransferase GTP guanosine-5'-triphosphate

PAGE 15

xiv GUK guanylate kinase HBSS Hanks’ balanced salt solution HRP horseradish peroxidase IB inclusion body IBMX 3-isobutyl-1-methylxanthine ICa,L L-type Ca2+ current ICD intracellular domain IF intermediate filament IGF-1 insulin-like growth factor 1 IHD ischemic heart disease IHC immunohistochemistry Ig immunoglobulin IL-6 interleukin 6 IMAC immobilized metal affinity chromatography IP Immunoprecipitation IP3 inositol (1,4,5)-triphosphate iPLA2 cytosolic Ca2+ independent phospholipase A2 IPTG isopropyl -D-1-thiogalactopyranoside JAM junctional adhesion molecule kDa kilodalton KP kaliuretic peptide LANP long-acting natriuretic peptide LT leukotrienes MBP maltose binding protein mAb monoclonal antibody MAGUK membrane associated guanylate kinase

PAGE 16

xv MBP maltose binding protein MEF Mouse embryonic fibroblast mGluRs metabotropic glutamate receptors MS mass spectrometry MPER mammalian protein extraction reagent MWM molecular weight marker NCBI National Center for Biotechnology Information NP natriuretic peptide NEP neutral endopeptidase 24.11 NPRA natriuretic peptide receptor A NPRB natriuretic peptide receptor B NPRC natriuretic peptide receptor C NSAID non-steroidal anti-inflammatory drug pAb polyclonal antibody PEG polyethylene glycol PBS phosphate buffered saline PDGF platelet-derived growth factor PGE2 prostaglandin E2 PI Phosphatidylinositol PIP2 phosphatidylinositol 4,5-bisphosphate PKA cAMP-dependent protein kinase PKB protein kinase B PKC protein kinase C PHD Pleckstrin homology domain PHLPP PH domain leucine-rich repeat protein phosphatase

PAGE 17

xvi PLC phospholipase C PMSF phenylmethylsulphonyl fluoride PPAR peroxisome proliferator-activated receptors Pref-1 preadipocyte factor-1 PG prostaglandin RACKs receptors for activated C-kinase RGM1 rat gastric mucosa SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis SH3 Src homology 3 siRNA small interfering RNA SMC smooth muscle cell smMLCK smooth muscle myosin light chain kinase SOC store-operated calcium sPLA2 secretory phospholipase A2 TBS tris-buffered saline TG thapsigargin TJ tight junction TGF transforming growth factor TMD transmembrane domain TNFtumor necrosis factor Trx thioredoxin VD vessel dilator VEGF vascular endothelial growth factor WB western blot ZO zonula occludens

PAGE 18

xvii Characterization of NPRC and Its Binding Partners Abdel A. Alli ABSTRACT The C type natriuretic peptide receptor (NPRC), also known as NPR3 is a widely expressed single transmembrane-spanning prot ein. NPRC functions as a homodimer at the cell surface for the metabolic clearance of a broad range of natriuretic peptides from circulation. The intracellular domain of NPRC is coupled to inhibitory G proteins and is involved in mediating signal tran sduction. In order to furthe r elucidate the role of NPRC in signal transduction, a proteomic approach was taken to identify putative protein binding partners for NPRC in different cell-t ypes. An interrogation of the molecular association between NPRC and its identified pr otein binding partner(s ) was carried out in different cell types to identify the specific interacting domains The physiological role of the association between NPRC and its protei n binding partner(s) were investigated in situ Furthermore, NPRC is subject to post translation modifications, including glycosylation and phosphorylation. Although evidence suggests NPRC is phosphorylated on serine residues, the specific amino acid residues that are phosphorylated and the kinases responsible for their phosphorylation has yet to be determined. A recombinant GST-NPRC fusion protein, polyclonal NPRC antibody, kinase prediction algorithm, and several phosphospecific and substr ate motif antibodies were util ized to characterize the phosphorylation state of NPRC in vitro

PAGE 19

Introduction Natriuretic Peptides Natriuretic peptides (NPs) are a family of hormones, which include atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), C-type natriuretic peptide (CNP), dendroaspis natriureti c peptide (DNP), and urodilatin [1, 2]. ANP, BNP, CNP, and DNP each contain a conserved 17-ami no acid ring structure (Figure 1). Upon secretion, proANP (amino acids 1-126) is clea ved by the serine protease corin [3] into an N-terminus fragment (amino acids 1-98) a nd a C-terminus fragment (amino acids 99126) in equimolar amounts [4]. Long-acti ng natriuretic peptide (LANP) (amino acids 130), vessel dilator (VDL) (amino acids 31), and kaliuretic peptide (KP) (amino acids 79) originate from the N-terminus, while ANP (amino acids 99) originates from the C-terminus of the prohormone [5, 6]. Upon secretion proBNP (ami no acids 1-108) is cleaved by furin [7], into an N-terminus fragment (amino acids 1-76) and a C-terminus fragment (amino acids 77-108) [7]. A paradi gm for the synthesis and processing of ANP [5] and BNP [8] is shown in Figure 2. Although they are also produced in other tissues, ANP is primarily secreted by atrial myocytes, while BNP is secreted by bot h the atria and ventricles of the heart [9, 10]. ANP is released from th e secretory granules in response to an increase in wall stretch and/or pressure [11], or in response to various fa ctors including catecholamines, glucocorticoids, angiotensin II and endothelin [12]. For ex ample, endothelin-1 (ET-1) was shown to induce ANP secretion in ventricular cardiomyocytes through an

PAGE 20

intracellular signaling pathway mediated by the ETA receptor involving the production of cAMP and the activation of an nifedipine-sensitive calcium channel [13]. Rebsamen et al. also demonstrated that the mechanism in which ET-1 induced ANP secretion involved calcium influx instead of calcium releas e from intracellula r stores [13]. ANP and BNP play an important physiologi cal role in promoting natriuresis and diuresis, inhibiting reni n and aldosterone release, and di rectly influence blood pressure and body fluid homeostasis [14-16]. NPs have been shown to inhibit adenylyl cyclase and decrease cAMP levels in various tissues [17], suppress vascular smooth muscle cell growth [18], inhibit DNA synthesis in cardiac fibroblasts [19], and inhibit cell proliferation in several different cell types through the generation of cyclic guanosine monophosphate (cGMP) [20-23]. NPs have been shown to induce apoptosis in cardiac myocytes [24] and in endothelial cells (E C) [25]. NPs were shown to affect the electrophysiology of the heart [26, 27] and cen tral nervous system [28, 29], and muscle relaxation in the gastrointest inal system [30, 31]. CNP, which lacks the carboxyl-terminal ta il, is not known to be natriuretic, although it does possess vasore laxant activity [32, 33]. CN P complements the endocrine actions of ANP and BNP to lower blood volume and pressure, and has a paracrine role in the regulation of vascular t one [33]. CNP is abundantly produced in the vascular endothelium, and because it does not circulate in large amounts as does ANP and BNP, it is thought to function locally in an autocrin e/paracrine way [33]. CNP induces vasodilatation though activation of the B type na triuretic peptide receptor (NPRB) or the C type natriuretic peptide receptor (NPRC) and hyperpolarization of vascular smooth muscle [34]. Evidence has shown that th e responses of CNP mediated through NPRB

PAGE 21

result in stimulation of EC, but attenuation of smooth muscle cells [35, 36]. CNP has been shown to be an important regulator of endochondral ossification and a major phenotype of CNP-deficient mice is dwarfism, as demonstrated by shortened long bones [37, 38]. Several groups have demonstrated that CNP stimu lates bone growth primarly through increased proliferation, mineralization, and extracellular matrix synthesis [37, 39, 40]. Also, Agoston et al. demonstrated the ability of CNP to stimulate endochondral bone growth through expansion of the hypert rophic zone of the growth plate [41]. NPs are efficiently removed from the circulation by binding to na triuretic peptide clearance receptor NPRC [42] or by hydrolysis by the enzyme ne prilysin or neutral endopeptidase (NEP) [43]. Several distinct phenotypes have been observed for various NPs or NPRs using mouse models, as indicated in Table 1. The overexpression of ANP [44] or NPRA [45] induces a dose-dependent decrease in arteri al blood pressure. The deletion of ANP [46] or NPRA [47, 48] in mice leads to cardiac hypertrophy and sudden de ath. The deletion of CNP or NPRB in mice leads to severe dwar fism [37], while deletion of NPRC results in skeletal overgrowth [49]. Plasma concentrations of ANP and BNP ma y be considered usef ul biomarkers of cardiac function [50, 51], since their concentrations increase in res ponse to volume and pressure overload of the heart [11, 52-56]. Accordingl y, ANP and BNP secretion is significantly elevated during cardiac failure and their plasma concentrations are proportional to the severity of the condition [52-56]. Resistance to th e natural effects of NPs occurs in cardiac failu re, especially in patients with the most advanced disease, but short-term infusions in patients ha ve beneficial e ffects [57, 58].

PAGE 22

NPs are also capable of regulating va rious digestive functions. Sabbatini et al. showed ANP and CNP play a role in stimulatin g pancreatic fluid and protein secretion in a dose-dependent manner when administered intr avenously in rats [59] The activation of NPRC was shown to mediate specific effects of ANP and CNP in the digestive system. CNP was shown to increase amylase secretio n in response to NPRC activation and subsequent stimulation of phospholipase C (PLC) in pancreatic acinar cells [60]. At low doses, ANP was found to stim ulate bicarbonate, decrease chloride output, and enhance secretin-induced pancre atic secretion in pancreatic duct cells [61]. At high doses, ANP was found to decrease secretin-induced panc reatic secretion through inhibition of adenylyl cyclase activity [61]. ANP and CN P were shown to inhi bit spontaneous and sodium dehydrocholate induced bile secret ion upon administration into rats [62]. Moreover, ANP was shown to play a role in the regulation of gastric acid secretion through a vagal pathway and also through a pa racrine/autocrine path way [63]. ANP was found to increase gastric acid secretion in rats through a vagal-dependent mechanism when administered into rats intracer ebroventricularly [ 64]. However, ANP demonstrated a biphasic effect when administer ed into rats intravenously, as low doses of ANP enhances vagally stimulated gastric se cretion and high doses of ANP decreases vagally stimulated gastric secretion [65]. Also, a feedback mechanism has been suggested between ANP and somatostatin. In rat antrum and fundus, ANP was found to stimulates somatostatin secretion through th e activation of NPRA, while somatostatin inhibits ANP secretion [66, 67].

PAGE 23

Natriuretic Peptide Receptors One class of natriuretic peptide receptor s (NPRs) constitutes the guanylyl cyclasecoupled receptors NPRA and NPRB [68-75]. NPRA preferentially binds ANP and BNP (ANP>BNP>>CNP), while NPRB is more selective for CNP (CNP>>ANP>BNP) [7678]. The topology of NPRA and NPRB include a large extrac ellular domain (ECD), a single transmembrane domain (TMD), and an intracellular domain (ICD) consisting of kinase-homology regulatory domain (KHD), and a guanylyl cyclase domain (GCD) [79] (Figure 3). At the ba sal state, the KHD interacts with the GCD to suppress its activity and upon ligand binding guanylyl cycl ase activity is elevated, resulting in the conversion of guanosine triphosphat e (GTP) to cGMP [79]. Vari ous desentizati ng agents and conditions have been reported to inhibit the guanylyl cyclase-coupled receptors by decreasing their phosphorylati on state [80], as phosphorylati on is required for their activation [81]. The other class of NPRs constitutes th e non-guanylyl cyclase-coupled receptor NPRC. The topology of NPRC consists of a large ECD of ~440 amino acids, a single TMD, and a short 37 amino acid ICD [82]. NPRC exists as monomers and disulfidelinked homodimers with a relative molecu lar mass of approximately 66 kDa and 130 kDa, respectively [82]. Stru ctural analysis of NPRC by truncation and site-directed mutagenesis studies, followed by binding assays provided evid ence that the monomeric form of NPRC is capable of binding NPs with high affinity [83]. Two isoforms, of 67 and 77 kDa, have been identified and both ha ve been reported to form disulfide-linked homodimers and have high affinities for ANP and the NPRC selective agonist, ANP

PAGE 24

analog des-[Glu18Ser19Gly20Leu21Gly22]-ANF-(4-23)-NH2 (cANF) [84]. The location of the genes coding for the NPRs is described in Table 3. NPRC is the most promiscuous of the NP Rs and the stoichiometry of the ligandreceptor complex is 1:2 [85]. NPRC has much broader specificity and also binds small peptide analogs [86]. NPRC is widely expresse d in a wide range of cells and tissues and represents the majority of the population of NPRs in vivo [82]. NPRC protein expression has been reported in human breast adenocarcinoma cells [87] human pancreatic adenocarcinoma cells [88], human renal carci noma cells [89], human prostate carcinoma cells [90], human medullary thyroid carcinoma cells [91], human glioblastoma cells [92], human colon adenocarcinoma cells [93], hu man melanoma cells [94], human ovarian adenocarcinoma (HTB-161) cells, human angi osarcoma cells [95], human small cell lung carcinoma (SHP77) cells [96, 97], rat A-10 VSMCs [98], normal rat gastric mucosa (RGM1) cells [99], rat aortic smooth muscle (RASM) cells [99], pancreatic alpha cells [100], human aortic smooth muscle cells (A oSMCs) [99], mouse 3T 3-L1 preadipotytes and adipoctyes [99]. A summary of the expr ession profile for the NPRs in various cell lines is shown in Table 2. The primary function of NPRC is the meta bolic clearance of NPs from circulation [82]. Upon ligand binding, the NPRC-lig and complex undergoes endocytosis via clathrin-coated pits, which is thought to be dependent on the integrity of the cytoplasmic domain of NPRC [101]. The complex then dissociates intracellularly in endosomes, followed by hydrolysis of ligand in lysomes and rapi d recycling of rece ptor back to the cell surface [102]. NPRC locally modulates the physiological effects of the NP system by regulating the availability of NPs at their target organs [49]. Another mechanism for

PAGE 25

the metabolic clearance of NPs from circul ation is mediated by NEP. Several groups have investigated effects of simultaneously blocking each or both the NPRC and NEP NP degradative pathways in normal animals. Rademaker et al. [103] Chiu et al. [104], and Kukkonen et al. [105] reported the NPRC and NEP syst ems have an additive effect for the clearance of NPs from circulation. Charles, C et al. [106] and Wegner et al. [107] demonstrated the NPRC and NEP systems can work in concert or synergistically to modulate the clearance of NP s from circulation. The extracellular ligand binding domain of NPRC contains seve ral glycosylation sites [108]. The crystal structures of NPRC bound and unbound to ligand suggest glycosylation plays a role in the structural stab ilization of the receptor and an indirect role in binding activity [109]. NPRC expression has been demonstrated to be affected under various conditions and by a variety of factors. Sarzani et al. demonstated fasting inhibi ts natriuretic peptides clearance receptor expression in rat adipose tissue [110]. Chabrier et al. reported a decrease in NPR density in response to an giotensin II (Ang II) in rat vascular smooth muscle cells (VSMCs) [111]. Similarly, Yasimoto et al. showed Ang II treatment decreased NPRC mRNA levels in cultured ra t aortic smooth muscle cells, while NPRA and NPRB were not affected [112]. Boumati et al. showed endothelin (ET-1) treatment attenuated NPRC protein expressi on in A-10 SMCs [113]. Kishimoto et al. demonstrated that norepinephrine or isoproterenol downregulates NPRC density mediated by the activation of the -adrenergic receptor, as the effect was blocked only by a -selective adrenergic antagonist and not by 1 or 2 or 1 adrenergic antagonists in rat VSMCs [114]. Agui et al. demonstrated the differential regulation of NPR in response to

PAGE 26

transforming growth factor1 (TGF1) treatment of murine thymic stromal cells, as NPRC expression was augmented and NPRA and NPRB expression was attenuated [115]. However, Sun et al. found that platelet-derived gr owth factor BB (PDGF-BB) and fibroblast growth factor (F GF-1 and FGF-2) treatments downregulated NPRC mRNA in pulmonary arterial smooth muscle cells [116]. Itoh et al. showed dehydration causes decrease in NPRA, NPRB, a nd NPRC mRNA expression in rat glomeruli, as the effect was proposed to be attributed to a lower ci rculating levels of ANP [117]. Ardaillou et al. demonstrated glucocorticoids upregulate NPRC protein expressi on in cultured human mesangial cells [118]. Lu et al. reported vasonatrin peptide can decrease the expression of NPRC in cardiac fibroblasts and m yocytes under both air-control and hypoxic condition, and the effect is mediated by an incr ease in intracellular cGMP [119]. Several groups have demonstrated NPRC expressi on is regulated by ANP itself. Hirata et al. reported downregulation of ANP receptors in VSMCs in response to ANP exposure [120]. Arejian et al. showed nitric oxide attenuates the expression of natriuretic peptide receptor C in rat aortic vascular smooth muscle cells [121]. Gower et al. showed prostaglandin E(2) (PGE(2) and transforming growth factor (TGF) can decrease NPRC mRNA and protein expression in RGM1 cells [122]. Multiple groups have shown that acute and chronic hypoxia cause the downre gulation of NPRC gene expression and binding in rat lung without aff ecting other NPRs [123-125]. Sun et al. demonstrated that NPRC mRNA expression is downregulated in the lungs of hypoxia-adapted mice [125] and rats [124] in response to increased circulating levels of ANP, while NPRA and NPRB mRNA levels were not affected. This grou p later demonstrated that dietary salt supplementation is able to downregulate NPRC mRNA levels in the kidneys of wild-type

PAGE 27

mice and mice with insertion inactivation of the ANP gene independently of endogenous ANP levels, but had no effect on NPRA or NPRB mRNA levels [126]. These findings were consistent with findings from Nagase et al. who demonstrated that NPRC gene expression was selectively atte nuated in the kidney by chronic salt loading in Dahl saltsensitive and salt-resistant rats, whereas expression of NPRA and NPRB expression was not affected [127]. The regulation of NPRC in diseas e has also been documented. Luk et al. showed NPRC is downregulated in chronic renal failure rat glomeruli, and is the result of ANFstimulated cGMP respons es [128]. Yoshimoto et al. demonstrated NPRC mRNA expression is downregulated in the aorta fr om stroke prone spontaneously hypertensive rats, while NPRA mRNA expression was upr egulated [112]. Similarly, NPRC mRNA expression was found to be downregulated in th e aorta [129], as well as in the lung, renal cortex of DOCA-salt hypertensive rats,whi le ANP levels were elevated [124]. NPRC is an atypical G protein coupled receptor (GPCR), because it lacks the seven transmembrane spanning domains that is a hallmark of traditional serpentine or heptahelical GPCRs [130]. NPRC is c oupled to the inhibitory G protein, Gi [31, 82]. NPRC was shown to be negatively coupled to adenylyl cyclase in cultured atrial and ventricular cardiocytes [131133]. The cytoplasmic domain of rat NPRC was shown to contain Gi activator sequences that inhibit adenylyl cyclase activity [134, 135]. NPRC is coupled to adenylyl cyclase inhibition via subunits [134] and PLC3 activation via subunits of Gi1 and Gi2 [31]. The ability of NPRC to i nhibit adenylyl cyclase has been suggested to contribute to the attenuation of PGE2-production of lipopolysaccharideactivated macrophages and redu ces COX-2-protein and -mRNA levels [136], astrocyte

PAGE 28

proliferation [137], and produc tion and release of endothelin from EC [138]. Johnson et al. and Kanwal et al. demonstrated NPRC mediates i nhibition of adenylyl cyclase and neurotransmission through cANF in nerve grow th factor-treated PC12 cells [139, 140]. Mouawad et al. has shown a possible cross-talk that may exist between the adenylyl cyclase pathway and the PLC path way in A-10 VSMCs, as the NPRC induced inhibition of adenylyl cyclase and decreased levels of cAMP contributes to NPRC mediated stimulation of PI turnover [141]. They also showed that the cANF (4-23) induced increased in IP3 production was further increas ed by the cAMP inhibitor dideoxyadenosine (DDA) and wa s inhibited by the cAMP indu cing agent forskolin (FSK) [141]. NPRC has also been implicated in the modulation of other signaling pathways. Murthy et al. has shown NPRC activation by cANF(4-23) can result in the activation of constitutive nitric oxid e synthase (NOS) via Gi 1 and Gi 2 in gastrointestinal smooth muscle [30]. Prins et al. has demonstrated cANF (4-23) can inhibit platelet-derived growth factor (PDGF) and endo thelin-3 stimulated mitoge n-activated protein kinase (MAPK) activity in astrocytes [142]. Furthermore, NPRC binding to CNP or cANF has been shown to inhibit L-type Ca2+ current (ICa,L) without modulating other voltage-gated Ca2+ currents in mouse atrial, ventricular, and sinoatrial node m yocytes [26, 143]. The coupling of NPRC to various signa ling pathways has provided a mechanism for additional roles of NPRC. For example, several reports have shown NPRC mediates ANP-inhibition of vascular smooth muscle cell proliferation [144] and endothelial cell proliferation [145]. In a nother report, NPRC was found to mediate cANF induced antiproliferative effect s in multiple different neuroblasto ma cell lines [146]. Also, the

PAGE 29

cAMP inhibition mediated by NPRC has been shown to modulate endothelial cell permeability in coronary EC [147]. NPRC wa s suggested to be implicated in vascular remodeling and angiogenesis, as cANF was found to inhibit ET and hypoxia-stimulated vascular endothelial cell gr owth factor (VEGF) transcription and production in VSMCs [148]. The complete absence of NPRC in mi ce by homologous recombin ation results in skeletal abnormalities, characterized by hunc hed backs, dome-shaped skulls, decreased weight, and elongated femurs, tibias, metatars al, digital bones, vertebral bodies, and body length [149]. Jaubert et al. reported that three mutations involve the Npr3 gene encoding for NPRC, as well as an NPRC knockout re sults in a mouse skeletal-overgrowth phenotype, thus implicating a role for NPs in bone growth [149]. The three mutations reported to be within the extrace llular domain of NPRC included an lgj2J allele displaying a C toT transition at position 283, resulting in a stop codon; a stri allele showing a C to A transversion at position 502, leading to an asparagines to histidine substitution; an lgj allele exhibiting an in-frame 36-bp dele tion between position 195 and 232, causing a truncated protein by 12 amino acids [149]. -arrestins The arrestin family consist of cone arrestin [150], visu al arrestin [151], arrestin 1 [152], and arrestin 2 [153]. Cone arrestin and visual arrestin are almost exclusively expressed in the retina and regulat e photoreceptor function, whereas the -arrestins are virtually ubiquitously expressed and regulate most GPCRs, or seven membrane spanning

PAGE 30

receptors (7MSRs) [154-157]. The -arrestins bind to agonist-activated cell surface GPCRs phosphorylated by G prot ein-coupled receptor kinases (GRKs) and mediate their homologous desensitization and internalization [158, 159]. The GRK family consists of seven different genes and the seven GRK me mbers are divided into three subfamilies [160]. The first subfamily of GRKs consist of GRK1 and -7, the second subfamily of GRKs consist of the pleckstrin homology domai n-containing GRK2 and -3, and the third subfamily of GRKs consist of constitutive ly membrane bound GRK4, -5, and -6 [161]. Upon GPCR stimulation and activation by agonist, GRKs phosphorylate GPCRs on serine and threonine residues within the carboxyl-terminal tail and/or the third cytoplasmic loop [130, 162-165]. GPCR phosphorylation by GR Ks significantly enhances the affinity of the receptor fo r arrestins, but it is the binding of the -arrestins to the GPCR that leads to the actual homol ogous desensitization [154, 166, 167]. In contrast to homologous desensitizati on mediated by GRK phosphorylation and -arrestin binding, heterologous desensitiz ation of GPCRs is not depe ndent on agonist occupancy and instead is mediated by phosphorylation with in the cytoplasmic loops and C-terminal tail domains of GPCRs by second-messenge r-dependent protein kinases, including protein kinase A and protein kinase C [168]. In addition to their role in desensitization of GPCRs, arrestins act as adapter proteins to target GPCRs to clathrin-coated pits for endocytosis [ 154]. The ability of arrestins to function as adapter proteins to target GPCRs to components of the clathrindependent endocytic machinery is a ttributed to two motifs within the -arrestins. The first motif involves the binding of an LIEF sequence located between residues 374 and 377 of -arrestin 2 [169], to a region between amino acid residues 89 and 100 of the N

PAGE 31

terminal domain of the clathrin heavy chai n. The other motif i nvolves the binding of arrestins to the 2 adaptin subunit of the heterotetram eric AP-2 adaptor complex through an RxR sequence located between amino acid residues 394 to 396 of -arrestin 2 [170]. The endocytic function of -arrestin 1 and 2 are differentially regulated. The endocytic function of -arrestin 1 is mediated by ERK1 a nd ERK2 phosphorylation [171], while the endocytic function of -arrestin 2 is mediated by ubiqu itination catalyzed by the E3 ubiquitin ligase Mdm2 in response to a gonist binding of the GPCR [172]. The deubiquitinating enzyme ubiqui tin-specific protease 33 (U SP33) was found to bind to beta-arrestins, resulting in deubiquitinati on of beta-arrestins [ 173]. The USP33 and Mdm2 function reciprocally and allow for beta-arrestin complex stability or lability, respectively [173]. This process of sequestra tion contributes to th e attenuation of GPCR signaling and resensitizati on and downregulation of th e GPCR [154]. Receptor downregulation involves a decrease in the density of cell surface receptors and is a slow process that occurs over a pe riod of hours to days [154, 157] In contrast, receptor desensitization involves a tempor ary loss of receptor responsiveness to agonist and is a rapid process that begins within seconds of agonist binding [154, 157]. Receptor resensitization requires dephos phorylation of the r eceptor and the dissociation of the ligand [154]. Multiple studies support the re quirement for receptor internalization for resensitization of many GPCRs [174, 175]. Furthermore, the -arrestins can confer enzy matic activities upon GPCRs by binding directly to signal tr ansduction associated proteins including Src family kinases and components of the MAP kinase and ER K1/2 signaling cascades [154]. The binding of -arrestin to Src is mediated by interactio n between the proline-rich PXXP motifs of

PAGE 32

amino acid residues 88-91 and 121-124 of the N terminal domain of -arrestin 1 and the Src homology (SH) 3 domain of the kinase [154]. One role of the -arrestin-Src complex is to modulate GPCR endocytosis. The three major classes of MAP kinases of mammalian cells include the ERKs, which play a role in the control of the G0-G1 cell cycle, and the JNKs and p38/HOG1, which play a role in the regulatio n of growth arrest and apoptosis [154]. Activated MAP kina ses phosphorylate various cytoplasmic, membrane, and nuclear substrates. The ability of -arrestins to serve as scaffolds for MAP kinases allows for the targeting of MAP kinases to specific subcellular locations, increased signaling efficiency, and the damp ening of cross talk between MAP kinase cascades [154]. Accordingly, the -arrestins have significant implications for cellular processes such as chemotaxis and apoptosis [176]. G proteins Guanine nucleotide regulatory proteins (G-proteins) are a fa mily of GTP-binding proteins that are involved in second messenge r signaling cascades [177]. G proteins may refer to two different families of proteins, the Ras subfamily of small GTPases (small Gproteins) and the heterotrimeric G-proteins (large G-proteins). Small GTPases are homologous to the subunit of heterotrimeric G-protei ns [178]. The G-protein is active when bound to GTP and inactive when bound to GDP. The cognate G-protein is activated upon activatio n of guanine nucleotide exchange factors (GEFs) [179-183], and inactivated upon activation of GTPase activating proteins (GAPs) [184-188]. Guanosine nucleotide dissociation inhibitors (GDI) [189] keep small GTPases in the inactive state. Heterotrimeric G-proteins consist of , and subunits [190-194]. There are three

PAGE 33

distinct forms of G i from different genes, and four forms of G s from splicing of a single gene [194]. In the resting state, G is bound to GDP and associates with G [192]. The GDP bound heterotrim er is coupled to surface receptors, which increases the receptors affinity for ligand [192]. Upon lig and binding, the activated receptor acts as a guanine nucleotide exchange f actor by activating the heterotrimer and increasing the rate of GDP to GTP exchange on G [192]. The exchange triggers dissociation of G from G and the receptor [192]. G GTP and G then activate differe nt signaling pathways and effector proteins including adenylyl cyclase [195197] and PLC [195, 198-200]. Upon disassociation between ligand and rece ptor, intrinsic GTPa se activity of G hydrolyzes the GTP to GDP and the inactive GDP bound G associates with G to begin a new cycle. Bacterial toxins are useful tools for iden tifying and investigating the role of G proteins. Pertussis toxin and cholera toxi n are known to covalently modify the subunits of G proteins by ADP-ribosylating specific am ino acid residues [201] Pertussis toxin attenuates the effect of Gi [202, 203], while cholera toxin irreversibly activates the Gs protein resulting in stimulati on of adenylyl cyclase [202, 204]. The role of various G proteins in mediating adenylyl cyclase an d phospholipase C signal transduction is shown in Figure 4. Adenylyl cyclase There are at least nine isoforms of memb rane associated adenylyl cyclase (AC) and one isoform of soluble AC [205] that cu rrently exist, and each is characterized by distinct biochemical properties and tissue di stribution. The AC isoforms are subdivided

PAGE 34

into five distinct families based on their amino acid sequence similarity and functional characteristics [205-207]. The Ca2+ CaM-sensitive forms include AC1, AC3, and AC8 [205-207]. The G stimulatory forms include AC 2, AC4, and AC7 [205-207]. The Ca2+ and G i sensitive isoforms include AC5 and AC6 [205-207]. The most divergent membrane bound AC isoform is AC9 and is high ly insensitive to the diterpene forskolin [205-207]. The overall most divergent AC isof orm is the soluble AC isoform and it maintains similarities to the cyclases found in cyanobacteria [205]. The ACs hydrolyzes ATP to produce pyrophosphate and the sec ond messenger cyclic AMP (cAMP) [206, 207](Figure 5). Elevated levels of pyrophos phate can force AC into a product-bound conformation and inhibit the activity of AC [206, 207]. AC consists of six transmembrane segments and two catalytic dom ains that extend into the cytoplasm [206, 207]. With the exception of the soluble AC isoform, all othe r AC isoforms are inhibited by adenosine analogs, or P-site inhibitors [208]. P-site i nhibitors inhibit AC activity without competing with ATP binding [208], but instead by binding to a conformation of the enzyme that closely resembles the product bound state, or posttra nsition state [209]. While all membrane bound AC isoforms are e xpressed in excitable tissues, such as neurons and muscle, AC1 and AC3 are expresse d exclusively in the brain [210] and the soluble form of AC is ubiquitously expressed with high levels in sperm cells [211]. Each AC isoform is activated by alpha subunits of G proteins and some have been found to be activated by various other molecules including forskolin. Non-physiological concentrations of Ca2+in the mM range inhibit all AC isoforms, but AC5 and AC6 are inhibited by concentrations of Ca2+ in the M range from cap acitative entry [212] epinephrine, glucagon, prostaglandin, prosta glandin E2 (PGE2), adenosine are known to

PAGE 35

activate AC through membrane-bound receptors. Unlike the membrane bound AC isoforms, the soluble AC isoform is unrespons ive to hormones, G proteins, and forskolin and its biochemical activity is de pendent on the divalent cation Mn2+ [211]. Furthermore, the soluble AC isoform displays approximately a 10-fold lower affinity for substrate [213] than the membrane associated AC isof orms [214]. The intr acellular domain of G protein coupled receptors interact with the GDP bound heterotr imeric G proteins, resulting in the displaceme nt of bound GDP by GTP and the dissociation of the GTP bound G subunit and the G dimer [206, 207]. The GTP bound G s family stimulates AC, while the GTP-bound G i family inhibits AC [206, 207]. AHNAK1/Desmoyokin AHNAK, meaning giant in He brew or also referred to as Desmoyokin [215] is a large phosphoprotein of approximately 700 kDa [216]. A second AHNAK1-like protein located on chromosome 14q32, AHNAK2, has been iden tified [217]. The amino terminal domain of AHNAK2 is predicted to contai n a PDZ domain [217]. AHNAK1 is encoded by a single exon located on human chromosome 11q12 [218]. AHNAK1 is composed of three distinct structural doma ins: a short amino terminus domain of 251 amino acids, a large central domain of 4,392 amino acids characterized by 39 highly conserved repeating units each of 126 amino acids, and a large carboxy terminus domain of 1000 amino acids [216]. AHNAK1 expression increases in the Go stage of the cell cycle, as quiescent cells contain higher levels of AHNAK1 protein. Among variou s human cell line s, Shtivelman et al. reported AHNAK1 downregulation in neuroblastoma cells, Burkitt lymphomas, and

PAGE 36

small cell lung carcinom as [216]. Gentil et al. observed AHANK1 is widely expressed in smooth muscle cells, skeletal muscle, m yoepithelium, and myof ibroblasts [219]. However, Gentil et al. did not observe significant AHNA K1 staining in cells having secretory functions such as the glandular ep ithelium of the mammary gland, the salivary gland, the stomach, the prostate or the exocrine and endoc rine pancreas [219]. Kingsley et al. reported AHNAK1 expression in extrae mbronic tissue, mesenchymal cells of the branchial artery, and nasal epithelia and skin [220] Salim et al. found AHNAK1 expression in developing and adult rat peripheral nervous system [221]. AHNAK1 expression was found in small and medium-sized neurons and satellite cells of dorsal root ganglia and Schwaan cells [221]. Matza et al. found strong AHNAK1 expression in CD4+ T cells and less expression in th ymocytes [222]. The carboxy terminal domain of AHNAK1 was found to contain nuclear localization sequences and a nuc lear export signal [223]. Th e subcellular localization of AHNAK1 is cell type dependent, as AHNAK1 has been described to be restricted predominantly to cell nuclei and Golgi apparatuses of nonepi thelial cells and cytoplasmic or plasma membrane-associated in epithe lial cells [216] or upon PKC activation or increase in extracellula r calcium [224]. Sussman et al. reported phosphorylation of AHNAK1 by PKB contributes its nuclear exclusion in epithelial cells, and that AHNAK1 translocates from the cytosol to the cytoso lic side of the plasma membrane during the formation of cell-cell contact and epithe lial polarity development [225]. Benaud et al. reported that the translocation is regulated by Ca2+ dependent cell-cell adhesion and is a reversible process [226]. Hashimoto et al. reported AHNAK1 translocates from the cytosol to the plasma membrane in respons e to increased extracellular calcium in

PAGE 37

keratinocytes [224]. AHNAK1 demonstrated a predominantly nuclear distribution in low calcium medium and both a nuclear and cy toplasmic distributi on in normal calcium medium [224]. AHNAK1 has been implicated in several different cell type specific functions including neuroblast differentiation [216], tumorigenesis [227], epidermal cell adhesion [228], Ca2+ homeostasis regulation [229], regulated exocytosis [230], skeletal muscle regeneration [231], regulation of cell memb rane cytoarchitecture [226], maintaining blood brain barrier properties [232], regulation of L-type ca lcium channels [233, 234], modulation of DNA ligase IV-mediated double-s tranded ligation [235], T cell calcium signaling [222, 236], and act ivation of phopholipase C 1 in the presence of Tau or arachidonic acid (AA) [237-239]. Matza et al. proposed AHNAK1 helps regulate membrane localization of L-type calcium channels during T ce ll activation [236]. Benaud et al. showed down-regulation of AHNAK1 affects the cell membrane cytoarchitecture of epithelia l cells [226]. In addition, AHNAK1 was found to be widely distributed in EC with blood-brain barrier pr operties and was found to co-localize to the TG protein ZO-1 [232]. These findings suggest a role for AHNAK1 in the regulation of cell adhesion and permeability. Since par acellular permeability and intramembrane diffusion of various components between th e apical and basolateral membranes of epithelial cells is attributed to TJs, the expression and ro le of AHANK1 in establishing such junctions have been investigated [ 219]. AHNAK1 has also been identified as a novel autoantigen in systemic lupu s erythematosus [240]. Skoldberg et al. has shown AHNAK1 contains distinct cleavage sites for granzyme B and caspase-3 [240]. Since a hallmark of many autoantigens in systemic auto immune disease is the efficient cleavage

PAGE 38

by granzyme B to produce fragments distinct from those produced during other forms of apoptosis, AHNAK1 was suggested to be a target of the immune system in autoimmune disease. AHNAK1 has been shown to associate with several different proteins including the calcium and zinc-binding pr otein S100b [229], the regulatory 2 subunit of L-type calcium channels [233], G-actin [241], PL C [237], and PKC [239]. The carboxylterminal domain AHNAK1 has also been found to associate with a ty pe of vesicles called enlargosomes, a new population of calcium regu lated vesicles capable of fast exocytosis [230, 231]. Phospho analysis revealed AHNAK1 is phosphorylated on serine and threonine residues, and subsequent studies showed it is a substrate of PKA, PKB, and PKC in vitro AHNAK1 was reported to cons ist of eight potential in vitro phosphorylation sites for PKA [233], six potential in vitro phosphorylation sites for PKC [234], and seven potential in vitro phosphorylation sites for casein kina se II [234]. Ph osphorylation of AHNAK1 is important for its subcellula r localization and function. AHNAK1 phosphorylation decreases when cells are made quiescent. Phosphor ylation of serine 5535 of AHNAK1 by PKB results in nuclear excl usion in MDCK and HeLa cells [225]. The binding affinity between the C1 domain of AHNAK1 and the 2 subunit of L-type calcium channels decreases by approxim ately 50% upon PKA phosphorylation [233]. Arachidonic Acid Arachidonic acid (AA) is a polyunsatura ted fatty acid with four double bonds, in which by iself or its metabolites serves multiple roles in living cells [242]. AA and its

PAGE 39

metabolites (e.g. eicosanoids) function as modu lators to suppress inflammation [243]. The concentration of AA in re sting cell is generally describe d as being low [244]. AA is amphipathic in nature, as its hydrophobic tail ca n remain in a lipid b ilayer, while its polar carboxyl group can emerge into the extr acellular aqueous environment [244]. Additionally, the amphipathic natu re of AA allows it to readily bind to proteins such as serum albumin [245]. Fatty ac id binding proteins (FABPs) [ 246] and fatty acid transport proteins (FATPs) [247-251] allow for cellu lar uptake of AA. Liberated AA is metabolized by the cyclooxygenase (COX), lipoxygenase (LO), and cytochrome P450 monooxygenase (CYP) enzymatic pathways [252, 253]. The COX pathway converts AA into prostaglandins (PGs) and is clinical re levant since it is the main target for nonsteroidal anti-inflammatory drugs (N SAIDs) [254]. Three COX isoforms exist [255], where COX-1 is virtually ubiquitiously expressed in most tissues and COX-2 is thought to be an inducible isoform upregulated by inflammatory stimuli [254, 256-260]. The LO pathway converts AA into leukotrienes (LT), and the lipoxygenases demonstrate regiospecificity during intera ction with substrates [261]. Accordingly, the LOs have been designated as arachidonate 5-, 8, 12-, 15-lip oxygenase (5-LOX, 8-LOX, 12-LOX, and 15-LOX) [244, 262, 263]. In EC, the CYP path way metabolizes arachid onic acid to four regioisomeric epoxyeicosatrienoic acids, which are then rapidly hydrolyzed to dihydroxyeicosatrienoic acids [264, 265]. Many of the bioactivities of AA is from its conversion to bioactive products such as prostaglandins by oxygenases [242]. The extracellular release of AA allows for the ex change of AA between cells and certain cell types further release AA in response to exogenous AA. AA is known to regulate transcription factors, including the activation of peroxisome-activated receptors (PPARs)

PAGE 40

[242]. The hydrolysis of phospholipids by phospholipase A2 (PLA2) is the primary pathway leading to AA production [266, 267]. Activation of PLA2 is tightly regulated at both the transcriptional and posttranslat ional levels. The secretory (sPLA2), cytosolic Ca2+ dependent (cPLA2), and cytosolic Ca2+ independent (iPLA2) are three types of PLA2s [266]. The sPLA2 enzymes have a molecular mass of between 13-19 kDa and lack specificity for arachidonate co ntaining phospholipids [268]. The sPLA2 enzymes are stored in the secretory granules and released upon the activation of cells, and can increase the activity of cPLA2 in cell types including EC. Several EC functions, including migration, proliferation, viab ility, barrier maintenance, a dherence, and generation of bioactive mediators are affected by AA metabolites [243]. The cPLA2 enzymes have a molecular mass of greater than 60 kDa an d preferentially hydrolyze arachidonate containing phospholipids [269]. The cPLA2 enzymes are constitutively expressed in most cells and tissues. The iPLA2 enzymes have a molecular mass of approximately 85 kDa and are not selective for arachidonate containing phospholipids [270]. Stimulation of cells with pro-inflammatory cytokines and growth factors re sults in increased expression of cPLA2 a nd sPLA2 [266]. AACOCF3, a trifluoromethyl ketone analog of AA, is a potent inhibitor of cPLA2 [271]. Alternatively, AA can be released from membrane phospholipids form hydrolysis of DAG catalyzed by two DAG-lipase [272]. A few reports have provided evidence for a positive correlation between the amount of AA in adipose tissue and the risk of ischemic heart disease (IHD) [273]. Furthermore, AA concentrations in adipose tissue have been found to be positively correlated with body mass index, which is a risk factor fo r myocardial infarction [273].

PAGE 41

Phospholipase C PLC PLC PLC and PLC are four main subfamilies of PLC [238]. There are four members of the PLC subfamily, and each are activated by or subunits of the heterotrimeric G-proteins in resp onse to agonist binding [198, 238]. PLC 1 exist as alternatively spliced variants 1a and 1b and each show differen tial tissue distribution and expression [238]. PLC 2 is highly expressed in cells of hematopoeitic origin and is implicated in leukocyte signaling and host defenses [238]. PLC 3 is widely expressed with high levels in granule cells and the pituitary gland [238]. PLC 4 exist as alternatively splice variants with the PLC 4b variant having a unique 10 residue peptide instead of the 162 amino acid carboxy-terminal [238]. PLC 3 is the only isoform that is essential as homologous disruption of the PLC 3 gene is lethal for mice early in development [238]. However, null mutations of the other isoforms each result in a phenotype representative of the specialized role of that specific isof orm [238]. There are two members of the PLC subfamily, and each contains two types of SH domains and is believed to be regulated by tyrosine phosphoryl ation following bindi ng to either growth factor activated receptor kinases or to cytosolic tyrosine kinases of the src family [238]. Alternatively, lipid-derived second messengers ha ve been shown to activate this isozyme [238]. There are four members of the PLC subfamily and they are activated by Ras and Rho GTPases and contains both guanine nucleotide exchange factor (GEF) and RA (Ras associating) domains [238]. PLC hydrolyzes phosphatidylin ositol 4,5-biphosphate (PIP2) to generate the water soluble inositol 1,4,5-triphosphate (IP3), which is released into the cytosol and the hydrophobic DAG, which is re leased into the membrane [238]. IP3 triggers calcium release from intracellu lar calcium stores through binding to IP3

PAGE 42

receptors, while DAG is known to ac tivate PKC [238, 274]. Both IP3 and DAG are important second messengers in various signaling pathways (Figure 6). Moreover, activation of PLC is a key ev ent in cellular signal trans duction involved in cell growth, metabolism, secretion, a nd proliferation [238] Calcium Signaling Calcium is a ubiquitous and universal se cond messenger that plays an important role in the regulation of a wi de range of cellular processe s [275]. As a second messenger calcium is known to influence cell growth and proliferation [276-283], differentiation [284-287], survival and death [288-291]. Ce lls posses the necessary machinery to regulate both [Ca2+]e and [Ca2+]i with accuracy and precision by directional Ca2+ transport across the plasma membrane and across membranes of intracellular organelles (e.g. endoplasmic reticulum). The second messenger function of Ca2+ extends beyond inside the cell, as many cells express cell surface sensors for Ca2+. The best characterized Ca2+ sensor is the extracellular-Ca2+ sensing receptor (CaR), a GPCR that is able to respond to divalent and trivalent metal ions including Ca2+, Mg2+, Zn2+ and Gd3+, extracellular amino acids, and various polycations [292]. ACaR is abundantly expressed in epithelial cells glial cells, and central and peripheral neurons [293]. CaR couples to various intracellular signal transduction cascades upon activation by ligand [294-297]. CAR is coupled to G q/G 11 to stimulate intracellular PLC/IP3/Ca2+ signaling, and through PTX-sensitive G i to interrupt cAMP production [292, 298]. CaR is also linked to AA production activation of the MAP kinase pathways [292]. Ca2+ may act as paracrine messenger via CaR, since

PAGE 43

CaRs of neighboring cells are able to respond to changes in [Ca2+]e as a consequence of [Ca2+]I signaling. Moreover, Ca2+ may act as an autocrine messenger, as export of Ca2+ following intracellular Ca2+ spiking upon activation of CaR has been reported. Several other membrane proteins have been reported to respond to [Ca2+]e. The metabotropic glutamate receptors (mGluRs), a G-protein c oupled receptor that is sensitive to [Ca2+]e is expressed predominantly in the central ner vous system [299]. Hemichannels of adjacent cells that form gap junctions have been reported to be highly responsive to small decreases in [Ca2+]e [300]. Ion channels, includi ng the ASIC1a/ASIC1b, proton-gated cation channels are responsive to fluctuations in [Ca2+]e [301]. An increase in [Ca2+]I may occur from an influx of extracellular calcium via channels in the plasma membrane or from de pletion of intracellular calcium stores. In non-excitable cells, a biphasic increase in [Ca2+]I may occur from store-operated calcium entry (SOC) (also known as capacitative calc ium entry) as calcium store depletion triggers an influx of extracellular calcium [293]. SOC helps to replenish intracellular calcium stores and activate various physiological processes [293]. Adipogenesis Adipose tissue is a type of specialized connective tissue that is composed of several cell types incl uding fibroblasts, macrophages, EC and adipocytes [302]. White and brown adipocytes derive from fibroblastic precursor cells and constitute the two forms of adipose tissue found in mammals [303 ]. Brown adipose tissue, which acquires its color from vascularization and densely packed mitochondria, is believed to function as a defense against cold and protection agains t obesity, but the physiological significance

PAGE 44

of brown adipose tissue has been less charact erized than white ad ipose tissue [302]. Adipose tissue store energy in the form of triglycerides and secretes a variety of hormones termed adipokines [302]. Adipokines such as adiponectin, leptin, interleukin 6 (IL-6), tumor necrosis factor (TNF), adipsin, visfatin, and le ptin are involved in the regulation of energy metabol ism [302]. The dysfunction of adipokine production may contribute to the pathogenesis of diseases associated with energy metabolism including insulin resistance and type 2 diabetes [302]. The function of adipose tissue is disregul ated in obesity [304], which has been linked with an increase risk of various diseases includ ing cancer, heart disease, hypertension, stroke, and diabetes [305]. Sinc e obesity is characte rized by an excess of adipose tissue, pharmacological approaches to modulate adipogenesis, the development of adipocytes from preadipocytes is an attrac tive solution to this disorder. However, the medical benefits from the direct reduction of adipogenesis is not ye t clearly understood. For example, stimulators of adipogenesis are used clinically to reduce hyperglycemia in patients with type 2 diabet es [302]. Also, it would seem increasing brown fat adipogenesis would be beneficial Adipogenesis involves a cascade of even ts leading to the development of adipocytes from preadipocytes. The core cons tituents of the initial cascade include the CCAAT/enhancer-binding protein (C/EBP ) and C/EBP transcription factors [306]. The core constituents of the second cascade incl ude the peroxisome proliferator-activator receptor (PPAR ) and C/EBP transcription factors [306]. The C/EBP family members belong to the basic-leucine zipper class of transcription fact ors [306]. The PPAR is a member of the nuclear receptor family and exis t as two protein isoforms from alternative

PAGE 45

splicing at the 5 end of the gene [307]. The PPAR 2 isoform contains 30 additional amino acids at the amino terminus and is highly specific for fat cells [308]. PPAR is activated upon binding of ligands to its carboxy terminal domain ligand binding domain [307]. In a model by Rosen and Spiegelman, C/EBP and C/EBP induces the expression of PPAR which in turn activates C/EBP [302]. PPAR and C/EBP are believed to act synergistically to activat e differentiation gene expression [307, 309]. Furthermore, the ADD1/SREBP1 transcription factor has been linked to the activation of PPAR by inducing its expression and promoting the production of endogenous PPAR ligand [307]. In comparison with other cell lineages, th e differentiation of preadipocytes into mature adipocytes in vitro closely mimics and recapitulate s many of the key features of adipogenesis in vivo These features include cell growth cessation, morphological changes, lipid accumulation, and sensitivity to various hormones including insulin [302]. Several extracellular and intra cellular signals, including various hormones growth factors have been shown to influence preadipocyt e determination, preadipocyte growth, and terminal differentiation. In sulin is known to i nduce differentiation and increase lipid accumulation, although preadipocytes express lo w, if any levels of insulin receptors [302]. Accordingly, the effect of insulin on di fferentiation was found to be the result of cross-activation of the insulinlike growth factor 1 (IGF-1) receptor [302]. Activation of preadipocyte IGF-1 receptors by IFG-1 or pharmacological doses of insulin results in the activation of several distinct transduction pa thways, including ras and akt, which activate adipogenesis via unknown effectors [302]. Fu rthermore, glucocorticoids are known to induce adipocyte differentiation [306]. Glucocorticoids can be administered in the form

PAGE 46

of dexamethasone and activate the glucocortic oid receptor, which belongs to the same superfamily as PPAR [118, 306]. Glucocorticoids have been shown to reduce expression of the negative regulator of adipogenesis, preadipocyte facto r-1 (pref-1) [302]. Inhibition of adipogenesis involves the act ivation of MAPK by various cytokines, including TNFand IL-1 and growth factors, incl uding PDGF, FGF, and EGF. MAPK phosphorylates PPAR leading to repression of differentiation [302]. Protein Kinases and Phosphatases Protein phosphorylation plays an important role in many physiological processes and is often disregulated in various pathol ogical conditions. A protein kinase is responsible for the transfer of terminal phosphate of ATP to a hydroxyl group on a protein, while a protein phospha tase is responsible for removal of the phosphate by hydrolysis. Protein kinases and phosphatases have been implicaed in various diseases and are major drug targets [310]. The cAMP-dependent protein kinase, or protein kinase A (PKA) is a serine/threonine kinase that is composed of two catalyt ic subunits and a regulatory subunit dimer [311]. The kinase is rendere d inactive when the tw o catalytic subunits associate with the regulatory subunit to form a tetrameric complex [311]. The kinase becomes active when the intracellular signali ng molecule cAMP binds to the regulatory subunit and facilitates dissoci ation of the complex [311]. The two forms of the heterotetrameric PKA holoenzyme are the type I (RI and RI dimer) and type II (RII and RII dimer) PKA holoenzymes [312]. Type I PKA is predominantly cytoplasmic, while type II is known to associate with vari ous cellular structures and organelles [313].

PAGE 47

The localization of PKA and ot her signaling enzymes is depende nt on its interaction with A-kinase anchoring proteins (AKAPs) [314]. The AKAPs play an important role in the coordination of signaling complexes by conn ecting upstream activators with downstream targets [314]. PKB, also known as Akt, is a serine/threonine kinase that is activated in the phosphoinositide-3 kinase (PI3K)-dependent pathway [315]. PKB exist as , isoforms, each of which are encoded by separate genes [315]. PKB possesses a Pleckstrin homology domain (PHD), which binds to phosphoinositides with high affinity. PKB has been implicated in cell survival, cell cycle, metabolism, and angiogenesis and tumor development. The PH domain leucinerich repeat protein phosphatase (PHLPP) is the phosphatase responsible for dephosphorylat ing the hydrophobic motif of PKB [316]. PKB serves a protective role against a poptosis in response to mitochondrial damage, as its activation has b een found to reduce ischemia-reperfusion and hypoxia/reoxygenationinduced apoptosis in neuronal cells and in cardiomyoc ytes by inhibiting the release of cytochrome c the activation of caspase-3 a nd caspase-9 [317, 318]. The PKC family consists of 10 isozymes that are organized in to three subclasses according to their second messenger mode of regulation [319]. The conventional PKC isozymes, 1/ 2, and respond to DAG and Ca2+ [319] The novel isozymes, , respond only to DAG [319]. The atypical isozymes , respond to neither to Ca2+ nor DAG [319]. A given PKC isozyme can direct ly oppose the function of another isozyme. For example, PKC is known to be proapoptotic a nd anti-prolifera tive, while PKC is known to be anti-apoptotic and proliferative [ 319]. All members of the PKC family have a conserved C-terminal kinase core and an N-terminal regulatory moiety [319-321]. The

PAGE 48

regulatory moiety is responsible for maintaining the enzyme in an autoinhibited state in the absence of a second messenger, targeting the enzyme to specific cellular sites, and mediating protein-protein interactions [319321]. PKC translocates from the cytosol to the plasma membrane in response to the gene ration and subsequent binding of the lipid second messengers, Ca2+ and DAG [319-321]. Increases in intracellular c oncentrations of these second messengers resu lts in activation of PKC, wh ile decreases in these second messengers results in inactivation of PKC [ 319-321]. The C1, C2 and C-terminal tail of PKC help to mediate protein-pr otein interactions. PKC can in teract with various binding partners to target it to di fferent signaling pathways [319-321] Receptors for activated Ckinase (RACKs), which serve as adaptors for various proteins are responsible for binding to the C2 domain of activated PKC and regula ting its activity [319]. Activated PKC that is in the open conformation is susceptible to phosphatases, proteoly sis, and degradation [319]. Dephosphorylation at the activation loop, turn motif, and hydrophobic motif renders PKC inactive [321]. Ch ronic activation of PKC by treatment with phorbol esters and bryostatins results in the loss in en zymatic activity and dow n-regulation of the enzyme [321]. Maturation of PKC is de pendent on phosphorylati on at the activation loop, allows for autophosphorylation at th e C-terminus, correctly positions residues required for catalysis, and reveal s access to the substrate binding site [321]. Cell-cell junctions The formation and integrity of cell-cell contacts is important for establishing and maintaining the permeability barrier property of endothelial and epit helial cells [322].

PAGE 49

Cell-cell contacts between epithelial cells are attributed to the junctional complex, which contains gap junctions, desmosomes, adherens junctions (AJs), and TJs [322, 323]. Gap junctions metabolically and electrica lly couple neighboring cells together by allowing the passage of second messengers ions, and small molecules between cytoplasms of adjacent cells [324]. Gap junc tions are formed by two unrelated families of proteins, the connexins and the pannexins [324]. Connexin proteins are similar in structure as they contain four transmembrane domains that are connected by two extracellular loops and form the wall or pore of the channels [324]. The connexin proteins are also composed of cytoplasmic N and C terminal domains and a cytoplasmic loop that links the second and third transmembrane domains [324]. Desmosomes help hold epithelial cells t ogether and provide anchoring sites for intermediate filaments [325] Desmosomal cell-cell att achment is mediated by the transmembrane glycoproteins of the cadherin superfamily, desmoglein and desmocollin [326, 327], in which three known tissue specific isoforms ex ist for each protein [328]. The cytoplasmic domains of desmoglein and desmocollin connect to intermediate filaments through desmosomal proteins such as plakoglob in, while the extracellular domains connect with their counterparts in adjacent cells [327, 328 ]. The cell type specific intermediate filament (IF) proteins are arranged into several different sequence homology classes [329]. Classes I and II repr esent the acidic and basic cytokeratins, respectively [329]. Class III in clude vimentin, desmin, glial fi brillary acidic protein, and peripherin [329]. Class IV include -internexin and neurofilame nt triplet proteins, and nestin [329]. Class V include th e nuclear lamins [329].

PAGE 50

AJs play an important role in maintaining endothelial and epithelial paracellular permeability [330]. In addition AJs promote cel l-cell communication and transfer signals between cells that regulate cell shape and po larity, mediate contac t inhibition of cell growth, and increase resistance to apoptosis [330]. The two major pr otein complexes that exist at AJs of epithelial cells include the cadherin-catenin complex and the nectin-afadin complex [331, 332]. The cadherin-cate nin complex is composed of the Ca2+ dependent adhesion E-cadherin molecule and the armadillo repeat domain containing family of proteins, p120ctn and / -catenin [331, 332]. The nectin-a fadin complex is composed of the Ca2+ independent nectin molecule and the PDZ afadin protein [331, 332]. AJs may signal by binding to growth factor receptors and modulate their downstream pathways and internalization, recruit transcriptional co-factors, and activate signaling mediators [331, 332]. Furthermore, AJs play a vital role during development and appear to be dynamic structures during morphogenesis and in resting cells [331, 332]. TJs functions as a permeability barrier and separates the apical and basolateral membrane domains [333]. The biosynthesis of TGs is affected by various signal transduction pathways. Prot eins including G proteins, PLC, calmodulin and second messengers including Ca2+ and cAMP are import ant for the assembly of TJs [323]. Three major classes of integral membrane proteins exist at TJs of epithelial and EC. The first class consist of tricellulin, claudins, and occludin all of which contain cytoplasmic Nterminal and C-terminal domains, two ex tracellular loops, and four transmembrane domains [323, 333]. Claudins constitute the TJ intercellular strands and mediate calcium independent cell-cell adhesion [323, 333]. Claudins directly intera ct with peripheral PDZ domain containing zonula occluden (ZO) proteins, including ZO-1, ZO-2, and ZO-3

PAGE 51

[323, 333]. The ZOs belong to the membra ne associated guanylylkinase (MAGUK) family of proteins, which c ontain a core structure of at least one PDZ domain, a SH3 domain, and a guanylylkinase ( GUK) domain [334]. In addition to being present at the TJs of epithelial and EC, ZOs ar e also present in nonepithelia l cells such as astrocytes, fibroblasts, and Schwann cells [335]. Mammalian ZOPs consist of ZO-1, ZO-2, and ZO3 proteins. ZO-1, a 220 kD a protein and is highly hom ologous to ZO-2, a 160-kDa protein, and two proteins were found to co-pre cipitate in epitheli al cells [333, 335, 336]. However, the C-terminus of ZO-1 and ZO-2 diverges at the C-terminus and ZO-2 contains an alternativ ely spliced region, the -motif [333, 337]. As previously mentioned, the AHNAK1 protein was shown to co-localize with ZO-1 in EC with bloodbrain properties [232]. ZO-3, a 130-kDa protein, which was or iginally descri bed as p130, shows high homology to ZO-1 and ZO-2 but contains a unique proline-rich region [333, 334]. ZO-3 directly in teracts with ZO-1 and the cytoplasmic domain of occludin, but not ZO-2 [333, 334]. Occludin may serve a role in the regulation of various signaling cascades attributed to the formation of TJs. At the TJ occludin direct ly interacts with the ZO-1, ZO-2, and ZO-3 proteins [333]. Occludin indirectly interacts with the actin cytoskeleton and junctional adhesion molecules (JAMs) by interacting with ZO proteins [333]. JAMs contain a single transmembr ane domain, a cytoplasmic tail, and an extracellular domain, which contain two Iglike motifs [333]. The second class consists of Ig-SF members and include JAM-A, CA R, CLMP, ESAM, and JAM4, all of which contain two Ig-like domains [ 323, 333]. The third class consists of a homologue of the Drosophila Crumbs proteins, Crumbs3 (CRB3), which cont ains a short extracellular domain and a short cytoplasmic domain [323, 333]. In addition to interacting with

PAGE 52

claudins, occludin, and junctio nal adhesion molecule the ZO Ps also associate with various cytoplasmic proteins of less defined function [333, 338-340]. RGM1 The rat gastric mucosal (RGM1) cell line (Figure 7C), established by Dr. H. Matsui at the Institute of Physical and Chemical Science (RIKEN) Cell Bank and Institute of Clinical Medicine, Univ ersity of Tsukuba, Tsukuba, Japan are nontransformed and immortalized gastric surfac e epithelial cells [341] RGM1 cells were found to be an excellent model to inve stigate gastric epithelial restoration in vitro [342]. 3T3-L1 The establishment of the 3T3-L1 mouse cell line from a continuous strain of 3T3 cells by Green and colleague s is a commonly used model to study adipocyte physiology [343-345]. Undifferentiated, or 3T3-L1 preadipocytes have a fibroblast-like morphology (Figure 7D), but can be differentiated to have an adipocyt e-like phenotype and morphology with the signet ring appearance of adipose cells. 3T3-L1 adipocytes recapitulate many of the endocrine and metabolic functions of mature adipocytes in vivo [343-345]. Differentiated 3T3L1 cells (Figure 7D) are sensitive to lipogenic and lipolytic hormones and drugs, in cluding insulin, epinephrine, and isoproterenol [343]. 3T3-L1 cells can be spontaneously converted into adipocytes when maintained in culture with fetal bovine serum alone [345]. Alternative means of triggering spontaneous differentiation of fibroblasts into adipocyt es include the expression of constitutively active Akt kinase [346], bisphenol A treatment. The most effective method to induce

PAGE 53

differentiation is to treat confluent cultures of 3T3-L1 cells with a combination of insulin, DEX, and MIX [347]. AoSMC Vascular smooth muscle cells (VSMCs) are important for pr oviding structural support VSMCs are characterized by the expr ession of various smooth muscle isoforms of structural genes involved in contra ction, including smooth muscle myosin heavy chains (smMHCs), smooth muscle calponin (smCalponin), smooth muscle -actin (sm actin), smooth muscle myosin lig ht chain kinase (smMLCK), and -tropomyosin [348, 349]. The proliferation, differe ntiation or change in regula tion of VSMCs may contribute to the pathogenesis of atherosclerosis, rest enosis and diabetic a ngiopathy [350]. Human aortic vascular smooth muscle cell s (AoSMCs) are shown in Figure 7E. Recombinant Proteins Manufactured proteins are useful for va rious biomedical app lications including small molecule drug discovery and the producti on of therapeutic proteins and vaccines [351]. A renewable source of protein is also useful for other applications such as antibody generation and purification [352], prot ein structure determination [353], proteinprotein interactions studies [354], and post-translational modifications studies. Recent advancements leading to the better understanding of transcri ption, translation, and protein folding in Escherichia coli (E. coli) has made it the system of choice for recombinant protein production

PAGE 54

Production of recombinant prot eins involves subcloning the gene of interest into an expression vector that is under the control of an inducible promoter. High-throughput purification of human proteins from bacteria has been acco mplished [355]. Advantages of using a bacterial system for protein production includ e rapid growth, high protein yields, practicality, and lower cost compared to mammalian, insect, or yeast cultures. Shortcomings of using a bacterial system for protein production include the lack of specialized post-translational modifications, the absence of eukaryotic chaperones, the lack of specific co-factors, th e inability of the protein to fo rm complexes or associations with other proteins, and the failure of the prot ein to be targeted to subcellular locations. One or a combination of these limitations ma y contribute to protei n aggregation and/or protein mis-folding. Furthermore, membrane proteins such as receptors often pose difficulties in the expression and purification of bacterial systems because of their hydrophobicity [356, 357]. A number of differe nt approaches to manipulate various expression parameters are commonly used to circumvent these problems. For example, reducing the cultivation temperature, reduci ng the amount of expres sion inducer, and the coexpression of various chaperones are common strategies to minimize protein misfolding [358]. A typical approach to e nhancing the solubility of the overexpressed protein in the host bacteria is the incorporation of a solub ility enhancing tag such as maltose binding protein (MBP), thioredoxin (Trx), and GST [355, 359, 360]. Additional advantages of inclusion of a fusion tag include the larger size fusion protein containing a greater number of potentially immunogenic epitopes for antibody generation [361], a means of purification, and the ability to immob ilize the fusion protein in various assays.

PAGE 55

The overexpression of foreign proteins in bacteria usually results in the production of insoluble aggregates termed inclusion bodies (IBs). IBs are the result of an unbalanced equilibrium between solubilization and in vivo protein aggregation [362]. The formation of inclusion body proteins are often thought to be bi ologically in active and therefore discarded. However, multiple reports have suggested that aggregation of bacterial inclusion bodies does not imply biologically inactiv ation of proteins [363, 364]. In fact, the incorporation of the overexpressed foreign protein into bacterial inclusion bodies has been described to be advantageous for several reasons [360]. The recombinant protein may be protected from proteolysis within the inclusion bodies, enriched in the inclusion bodies, and ma y not be lethal to the host cell when overexpressed. There have been numerous reports of refo lding of various proteins including enzymes and receptors form bacterial inclusion bodies. Kiefer et al. reported efficient refolding of GST-GPCR-His fusion pr oteins from bacteria l inclusion bodies [365]. The procedure involve d solubilization of the in clusion body fusion protein complex, transfer into a neutral detergent, t hombin cleavage of the GST, and purification on a nitrilotriacetic acid column [365]. Fra ngioni and Neel reported efficient recovery of enzymatically active nontransmembrane tyro sine phosphatase GST fusion proteins from bacterial inclusion bodies [366]. The proce dure involved solubilizing the fusion proteins with an empirically determined molar ratio of the ionic detergent N-laurylsarcosine (sarkosyl) and the non-ionic detergent Trit ion X-100 and purifica tion over glutathione agarose beads. In one report, the comp lexity of inclusion body aggregates were analyzed and separated into subclasses based on their ma ss [367]. The aggregates of

PAGE 56

lower complexity were found to be more e fficiently recovered in the presence of molecular chaperones. The main disadvantages of using a bact erial system for overexpressing a foreign protein of interest include the loss of posttranslational modifications and protein folding. The distinct differences in protein processi ng between bacterial and eukaryotic systems contribute to the lack of conservation of posttranslational modifi cations and protein folding of eukaryotic proteins when overexp ressed in a bacterial system. Membrane proteins are overexpressed in the cytoplasmic membrane of bacteria, while they are overexpressed in the endoplasmic reticulum me mbrane of eukaryotes [368]. Also, the rate of polypeptide elongation and the rate of protein folding are co nsiderably higher in prokaryotes than in eukaryotes, which may contribute to protein misfolding [368]. Differences in lipid composition and lack of chaperone proteins between prokaryotic and eukaryotic systems may also contribute to pr otein misfolding [368]. Glycosylation is often required for correct fold ing of eukaryotic membrane proteins, but bacterial cells such as E. coli do not have the ability to glycosylate proteins [368]. The lack of chaperone proteins, glycosylation machinery, differences in lipid compositions, and the lack chaperone proteins does not eliminate b acterial cells from being used as a host for the production of functional eukaryotic membra ne proteins [368]. If desired, it is possible to utilize active kinases to posttranslational modify the protein in vitro after expression and purification from bacterial cells. Similarly, it is possible the target protein may spontaneously adopt its native confirmation after being expresse d and purified from the bacterial cells, since its st ructure is largely determined by its amino acid sequence. In

PAGE 57

other cases, artificial membra nes may be used to induce folding of certain membrane proteins overexpressed in bact erial cells. Table 1. Natriuretic Peptides and their receptors in disease Genotype Phenotype Reference ANP/BNP ++ Arterial hypotension [44] ANP -/Salt-sensitive hypertension, [46] pulmonary hypertension BNP -/Cardiac fibrosis [46] CNP -/Dwarfism [37] NPRA ++ Arterial hypotension [45 ] NPRA -/Cardiac hypertrophy and fibrosis, [47, 48] salt-resistant hypertension NPRB -/Seizure attacks, infertility [37] NPRC -/Hypotension, skeletal deformations [49] Phenotypes seen in mouse models. ++ re presents overexpression, -/represents deletion Table 2. Protein expression of natriuretic peptide receptors in various cell lines Cell line Assay NPRA NPRB NPRC NIH 3T3 WB + + ++ 3T3-L1 WB/IHC + + ++ RGM1 WB/IHC +++ A-10 WB +++ + +++ AoSMC WB/IHC +++ +++ ++ HeLa WB/IHC ++ +++ +++ PANC WB ++ ++ ++ HEK 293 WB + + ++ TC1 WB + + ++ AR42J WB + + + BON WB + + + HCT-15 WB + + ++ HCC-1428 WB + + + HPAC WB + + + KATO III WB + + + Min6 WB + + ++ MS1VEGF WB + + + NCI-N87 WB + + + SHP-77 WB + + ++ + represents low, ++ represents moderate, and +++ represents high immunoreactivity using polyclonal anti-NPRA, NPRB, or NPRC antibodies.

PAGE 58

Table 3. Location of the gene coding for the NPRs Mouse Rat Human NPRA 3 47.6 cM 2q34 1q21-q22 NPRB 4 21.5 cM 5q22 9p21-p12 NPRC 15 6.7 cM 2q16 5p14-p13 Central Hypothesis : NPRC is an atypical G protein coupl ed receptor that associates with various proteins, and plays an impor tant role in signal transduction. Specific Aim #1: To identify novel NPRC protein bindi ng partners in va rious cell lines. Specific Aim #2: To confirm the molecular associ ation and identify the specific interacting domains between NPRC and arrestins and AHNAK1 Specific Aim #3: To determine the role of NPRC in AHNAK1 mediated calcium signaling Specific Aim #4: To characterize the phos phorylation state of NPRC Specific Aim #5: To identify novel or put ative roles of AHNAK1

PAGE 59

H2N G l H2N H 2 N Ph G l Gl Cy Cy Gl Le SerBNPAs Ar Lle Ph Gl Cy CyANPAs Ar Lle H 2 N Ph Gl Cy D N P As Ar Lle COOH H2N Ph Gl As COOH Gl Gl Le Ser Gl Cy Le Ser D N P Gl Cy Cy Le SerCNP A r Lle GlCOOH Figure1.Aminoacidstructureofthenatriureticpeptides.ANP (28aminoacids),BNP(32aminoacids),CNP(22aminoacids), andDNP(38aminoacids)shareasimilar17-aminoacid disulfiderin g structureCOOH g

PAGE 60

C Figure 2. Paradigm of natriuretic peptide synthesis and release A: ANP; B: BNP; C: CNP

PAGE 61

Figure3.Topologyofthenatriureticpeptidereceptors (NPRs).NPRA,NPRB,andNPRCaresingle transmembranespanningreceptorsandeachcontainsalarge extracellularligandbindingdomain(LBD).NPRAandB containakinasehomologydomain(KHD),hingeregion (HR),andaguanylylcyclasedomain(GCD).NPRCis devoidoftheKHD,HR,andGCD.Instead,NPRCcontains ashort37aminoacid(a.a.)intracellulardomain.

PAGE 62

Figure4.DiagramshowingtheroleofGproteinsinsignal transduction.ReceptorssignalingthroughGqactivatePLC enzymesresultinginthehydrolysisofphosphatidylinositol-4,5bisphosphate (PIP ) generating diacylglycerol (DAG) and bisphosphate (PIP 2 ) generating diacylglycerol (DAG) and inositol-1,4,5-triphosphate(IP3).IP3bindstoreceptorsof intracellularstoresandCa2+isreleased.Thesecondmessengers Ca2+andDAGbindtoandactivatePKC.Receptorssignaling throughGiinhibitadenylylcyclase,resultingindecreasedlevels ofcAMP,anddecreasedactivityofPKA.Receptorssignaling through Gs activate adenylyl cyclase resulting in increased levels through Gs activate adenylyl cyclase resulting in increased levels ofcAMP,andincreasedactivityofPKA.

PAGE 63

Figure 5. Reactions catalyzed by (A) adenylyl cyclase and (B) phospholipase C

PAGE 64

Figure6.RoleofthesecondmessengersIP3,DAG,andCa2+inthephosphatidylinositolsystem.Afterhormonebindstoa specificreceptor,thereceptor-hormonecomplexcatalyzes GTP-GDPexchangeonGq,andactivatesit.ActiveGq activatesPLC,whichthencleavesphosphatidyl-inositol4,5bisphosphatetoIP3andDAG.IP3bindstospecificreceptors 2 ontheendoplasmicreticulum,releasingsequestere d Ca 2 +.DAG andCa2+activatesPKCattheplasmamembranePKC phosphorylatesproteinstoproducecellularresponsestothe hormone.

PAGE 65

Figure7.Phase-contrast microscopyofthecelllines usedinthevariousstudiesof NPRC.(A)A-10cellswere purchasedfromtheATCC andculuredinDMEMhigh glucosesupplementedwith10 %FBSandmaintaineda t 37 C,5%CO2inahumidified incubator.(B)HeLacells werepurchasedfromthe ATCCandculturedinDMEM highglucosemedia supplementedwith10%FBS and maintained at 37 C 5 % and maintained at 37 C 5 % CO2inahumidified incubator.(C)RGM1cells wereobtainedfromDr. HirofumiMatsuiandcultured inDMEM/HamsF-12growth mediasupplementedwith 10%FBSandmaintainedat 37C,5%CO2ina humidifiedincubator.(D) 3T3-L1cellswerepurchased fromtheATCCandcultured inDMEMhighglucosemedia supplementedwith10% newborncalfserumand maintained at 37 C 10 % CO 2 maintained at 37 C 10 % CO 2 inahumidifiedincubator.(E) hAoSMCwerepurchased fromLonzaandculturedinin smoothmusclegrowthmedia supplementedwithinsulin, hFGF-gentamicin/ amphotericin-B,FBS,hEFG andmaintaineda t 37C,5% CO2inahumidifiedincubator. ForpanelsA-D,subconfluent cellsareshownintheleft panelsandconfluentcellsare shownintherightpanels.

PAGE 66

Chapter 1: Development of a Polyclonal Antib ody (JAH84) For Investigations of NPRC

PAGE 67

Background Currently, there are very few commercially available antibodies for NPRC. The few commercial antibodies against NPRC that are available demonstrate limited species cross-reactivity, high background, and poor a pplicability. The only antibody that has been validated for cross-reactivity between multiple species and for use in multiple immunoassays including immunoprecip itation, immunoblotting, and immunohistochemistry is a polyclonal an tibody established several years ago by Fujishige et al. [369]. Antibodies are useful tool s to probe for protein expression, regulation, post-translational modification, in teraction, and function. Therefore, there was an urgent need to create an antibody ag ainst NPRC that was readily available and would crossreact with different species an d could be used to perform different immunoassays in order to allow for various studies of NPRC.

PAGE 68

Materials and Methods Reagents and antibodies All cell culture plasticwar e was purchased from Nalg e Nunc (Rochester, NY). Precast gels (7.5% resolving with 4% st acking), 10X Tris-buffered saline (TBS), Laemmli sample buffer, Precision plus prot ein dual color standard s, and horseradish peroxidase conjugated goat anti-rabbit sec ondary antibody were purchased from Bio-Rad (Hercules, CA). Colloidal coomassie blue stain was purchased from Genomic Solutions, Inc. (Ann Arbor, MI). 10X phosphate buffere d saline (PBS) was purchased from Fisher Scientific (Fair Lawn, NJ). Protein G agarose was purchased from Upstate Biotechnologies (Lake Placid, NY). Mammalia n protein extraction reagent (M-PER), Halt Protease and Phosphatase Inhibitor, Super Signal West Pico Chemiluminescent Substrate, BCA (bicinchoninic acid) protein assays reagents, and Restore Western blot stripping buffer were purchased from Pierce (Rockford, IL). Anti-NPRC antibody directed against the 37 COOH-terminal ami no acids of rat NPRC was kindly provided by Dr. K. Omori (Kansai Medical University, Os aka, Japan) [369]. -actin antibody and anti-mouse secondary antibody were purchased from Sigma (St. Louis, MO). Hybond-C extra nitrocellulose membranes and Hyperf ilm ECL were purchased from Amersham Biosciences (Piscataway, NJ). Ponceau Red solution was purchased from Sigma. All other chemicals were purchased from Sigma unless otherwise noted. Texas Red/ FITCstreptavidin, anti-rabbit/antimouse biotinylated secondary antibodies, and Vectashield mounting medium with or without 4,6-diamidino-2-phenylindole hydrochloride (DAPI) were purchased from Vector Laboratories (Burlingame, CA).

PAGE 69

Cell Lines and Cell Culture Human aortic vascular smooth muscle cells (AoSMC) were purchased from Lonza (Walkersville, MD) and were cultured in smooth muscle cell basal medium (SmBM) (Lonza) supplemented with SmGM-2 SingleQuots (Lonza). All other cell lines were purchased from the American type culture collection (ATCC) (Manassas, VA). SHP77 cells were culture d in RPMI 1640. NIH 3T3, HEK293, CCL13, PANC, and HeLa cells were cultured in high glucose Dulbeccos modified Eagles medium (DMEM) (Gibco Invitrogen; Grand Island, NY). RGM1 cells were cultured in DMEM/F12 Medium (Gibco). With the exception of Sm BM, all other media were supplemented with 1X antibiotic/antimycotic (Gibco) and 10% fetal bovine serum (Atlanta Biologicals; Norcross, Atlanta). All cell lines were maintained at 37C in a 5% CO2 humidified atmosphere. Only low passaged cells of less th an 25 passages were used for experiments. Polyclonal Antibody Production A synthetic peptide corresponding to the la st 26 amino acids of the cytoplasmic domain of human NPRC was used as the immunogen. The first amino acid of this peptide, a threonine, was replaced with a cy steine and the peptid e was conjugated to Keyhole Limpet Hemocyanin (KLH). White New Zealand rabbits were immunized with the conjugated synthetic pe ptide (BIO-SYNTHESIS, INC.; Lewisville, TX). SDS-PAGE and Immunoblotting Proteins were harvested from cells cultu red in 100 mm tissue culture dishes by scraping and collecting the lysate in the pr esence of M-PER. Proteins were harvested

PAGE 70

from 50 mg pieces of tissue by moderate hom ogenization in the presence of tissue protein extraction reagent M-PER. All protein lysate s were supplemented with Halt Protease and Phosphatase Inhibitors. Protein was quantified using BCA reagents and 25 g of protein from cell or tissue lysate prepared in Laemmli sample buffer was loaded onto a 7.5% gradient polyacrylamide precast gel and subjecte d to SDS-PAGE for 4 hrs. Proteins were electrically transferred onto nitrocellulose membranes at 100 V in Towbin buffer for 75 minutes. In order to confir m the transfer of proteins, membranes were stained with Ponceau red solution. The membranes were destained by washing with 1X TBS and then blocked in 5% (w/v) nonfat milk in 1X TBS at room temperature (RT) for 1 hr. Membranes were washed with 1X TBS and then incubated with anti-NPRC (JAH84; 1:1000 dilution) polyclonal antibody in 5% BS A in TBS at RT for 2 hrs. Membranes were washed and then incubated with horsera dish peroxidase conjugated goat anti-rabbit secondary antibody (1:3000 dilution) in blocking solution (5% (w/v) nonfat milk in 1X TBS) at RT for 1 hr. Membranes were wa shed with 1X TBS a nd immunoreactive bands were detected by SuperSignal West Pico chemiluminescent substrate and developed using Hyperfilm-ECL. As an internal cont rol membranes were stripped using Restore Western blot stripping buffe r and reprobed with anti-actin (1:1000 dilution) and antimouse secondary antibody (1:25000 dilution). Precision plus protein dual color standards were used as molecular weight markers. Immunohistochemistry of Para ffin-embedded Tissue Samples Paraffin embedded tissues were sectioned and mounted on Superfrost Plus (+) glass slides. The slides were subject to deparaffini zation, hydration, and antigen

PAGE 71

retrieval. The slides were subject to thr ee exchanges of xylene, two exchanges of 100% ethanol, two exchanges of 95% ethanol, and a single exchange of 80% ethanol, 70% ethanol, 60% ethanol, and reagent grade water for 5 min durations. The slides were then subject to a series of four microwave sessi ons in 10 mM citrate buffer (pH 6.0) for 5 min durations. The slides were rinsed with r eagent grade water for 10 min and then rinsed with 1X PBS for 10 min. The slides were blocked in 8% filtered normal goat serum in 1X PBS at RT for 30 min. The slides were then incubated with anti-NPRC (JAH84; 1:250) polyclonal antibody in blocking solution at RT for 90 min. The slides were washed in 1X PBS and then incubated with anti-rabbit biotinylated secondary antibody (Vector Laboratories; Burlingame, CA) dilute d in PBS and filtered normal goat serum at RT for 30 min. The slides were wahed in 1X PBS and then incubated with FITCconjugated streptavidin (Vector Laboratories) (1:50 dilution ) in 1X PBS at RT for 30 min. The slides were washed, covers liped, and mounted with mounting media containing DAPI in Vectashield medium. Immunofluorescence of Cultured Cells AoSMC, SHP77, HEK293, CCL13, PANC, and HeLa cells were cultured on type 1 collagen coated chamber slides. At 70% c onfluency, cells were washed with PBS, and then fixed at -20 C for 5 minutes in MeOH/Acetone (1:1). Fixed cells were washed with PBS, and then blocked and stained as follo ws. Slides were incubated at RT for 30 minutes in blocking solution (8% filtered nor mal goat serum diluted in PBS), and then incubated at RT for 90 minutes with a polyclonal primary antibody (diluted in blocking solution). Slides were washed and incubated at RT for 30 minut es with anti-rabbit

PAGE 72

biotinylated secondary antibody. Slides were washed and incubated at RT for 30 minutes in the dark in a solution of Texas Red-conjug ated streptavidin (diluted in PBS). Slides were incubated at RT for 30 minutes in a second blocking solution (8% filtered normal horse serum diluted in PBS) and then incuba ted at RT for 90 minutes with a monoclonal primary antibody (diluted in blocking solution). Slides were washed and incubated at RT for 30 minutes with anti-mouse biotinylated secondary antibo dy. Slides were washed and incubated at RT for 30 minutes in the dark in a solution of FITC-conjugated streptavidin (diluted in PBS). Finally, slides were washed and coverslips were applied with mounting media containing DAPI in Vectashield medium. Immunoprecipitation Proteins were harvested fr om 100 mm tissue culture dishes as described above. After quantification by the BCA assay, 200 g of protein was incubated with 4 l of antiNPRC (JAH84) polyclonal antibody with end-over-end mixing at 4 C for 2 hrs. The resulting complexes were incubated with 40 l of prewashed 50% protein G agarose slurry with end-over-end mixing at 4 C for 4 hrs. The immunocomplex was washed four times with ice cold PBS and bound proteins were eluted by boiling for 5 minutes in Laemmli sample buffer. Eluted proteins were analyzed by SDS-PAGE and Coomassie blue staining. MS Gel bands were excised from Coomassie stained gels. The gel bands were subjected to in-gel tryptic di gestion, liquid extraction of the gel fragments, followed by

PAGE 73

LC-MS/MS on an LTQ mass spectrometer (Thermo Electron Corporation, Waltham, MA) with an LC packing ultimate dual gr adient nano-LC system (Dionex, Sunnyvale, CA) (Proteomics Department at the Moffitt Cancer Center, Tampa FL). The Mascot algorithm (Matrix Science, London UK) was used to search the collect ed data against the nonredundant rodentia database at the national center for biotechnology information (NCBInr). Transient Transfection of FLAG-NPRC FLAG-NPRC was transfected into COS7 cells using Lipofectamine reagents (Invitrogen; Carlsbad, CA) according to the ma nufactures instructions. Briefly, cells were seeded in 100 mm dishes and the ce lls were transfected after reaching 70% confluency. The Lipofectamine diluted in OptiMEM medium was added dropwise to the plasmid DNA (10 g/dish) diluted in OptiM EM medium and the complex was briefly incubated at room temperature before ad ding it dropwise to the cells. Cells were maintained in complete growth medium and cultured for at least 48 hours before harvesting the cells for protein. Statistics Results are expressed as the mean SEM. Statistical significance was set at p <0.05. Student's paired t test was us ed to compare data from two groups.

PAGE 74

Results Polyclonal Antibody Production Multiple sequence alignments of the intracellar domain of NPRC reveals high homology between various different species (F igure 8). Multiple polyclonal antibodies were created against NPRC (JAH84 and JA H85) (Figure 9), and each appeared to recognize different epitopes of the target an tigen and have different crossreactivities among different species (Figure 9). JAH84 and JAH85 each demonstrated a titer of 1:12,800 and the IgG concentration of each was approximately 2.5 mg/mL after purification and after the addi tion of sodium azide. Monitoring transient transfec tion of Flag-NPRC to confir m specificity of JAH84 To demonstrate specificity of JAH84, th e transfection effici ency of FLAG-NPRC was determined by immunoblotting with JAH 84 and analyzing the immunoreactive bands by densitometry. COS7 cells were transfec ted with a FLAG-NPR C construct and the transfection efficiency was assessed by im munoblot and densitometric analysis using JAH84 or established anti-NPRC antibody. The presence of an immunoreactive band at 66 kDa corresponding to mock tran sfection, and at least a threefold increase in a band at the same molecular weight, but corres ponding to FLAG-NPRC was observed after probing with JAH84 (Figure 10). In addition to evaluating the ability of JAH84 to be used in Western blotting, it was evaluated to be used in immunoprecipitation studies (Figure 11). Several putative NPRC bindi ng partners were pulled down with JAH84 (Figure 11). These proteins are identified in the next Chapter.

PAGE 75

JAH84 confirms NPRC is the most widely and abundantly expressed NPR subtype Several normal and abnormal cell lines, corresponding to various tissue origins of mouse, rat, and human species were scre ened for NPR protein expression by Western blot analysis and/or immunoflourescence. While using rabbit po lyclonal antibodies against NPRA, NPRB, or NPRC, NPRC is sh own to be the most widely and highly expressed NPR subtype across se veral different cell lines of various species (Table 2). Western blots, performed using JAH84 show NPRC is expressed in mouse heart, lung, kidney, liver, and pancreas (F igure 12A) and expressed in cell lines corresponding to human aortic vascular muscle derived cells small cell lung carcinoma cancer-derived cells, embryonic kidney derived cells, hepatocy te-derived liver cell s, and pancreatic ductal adenocarcinoma cancer-deriv ed cells (Figure 12B). JAH84 is applicable for immunohist ochemistry analysis Since antibodies are assay specific in addi tion to being species specific, the ability of JAH84 to be used in various different im munoassays was investigated. In addition to being able to crossreact with NPRC proteins from various different species by Western blot analysis and pull-down putative NPRC binding partners by immunoprecipitation, JAH84 was able to detect NPRC protein in RGM1 cells by immunofluorescence (Figure 13).

PAGE 76

Discussion Initial attempts to produce a monoclonal antibody to NPRC were unsuccessful. However, multiple polyclonal antibodies to NPRC were produced and assessed for applicability, sensitivity, specificity, and crossreactivity. Of th ese antibodies, JAH84 detected NPRC protein by multiple immunoassa ys, was sensitive and specific, and crossreacted with multiple species. Polyclonal antibodies generally cost le ss to produce and have a much faster overall turnaround time for production than monoclonal antibodies. Although polyclonal antibodies may be less specific, and are limited in quantity by the lif espan and size of the host animal, they have a wider range of potential applications than do monoclonal antibodies. One advantage of using a pol yclonal antibody inst ead of a monoclonal antibody in an immunoassay su ch as immunoprecipitation is a polyclonal antibody is more likely to recognize multiple epitopes of the antigen with varying affinities. It is favorable to have an antibody recognize multi ple epitopes while attempting to capture protein binding partners by immunoprecipitation. If the antibody is capable of recognizing multiple epitopes it may be possible to capture a protein-protein interaction if one or more of the antigenic epitopes ar e masked by the binding sites between the proteins of interest. Another advantage of using a pol yclonal antibody in a typical immunoassay such as immunoblotting for screen ing cell lines or tissues for protein expression is there is a greater likelihood the prot ein of interest will be detected if it is readily susceptible to proteolysis or is posttranslationally modified. Polyclonal antibodies are generally not homogenous in nature as are monoclonal antibodies, and

PAGE 77

because they can recognize different epitopes of the antigen, slight changes of the protein are generally tolerated. The unique cytoplasmic domain of NP RC as an immunogen was targeted because of the high degree of homology of the extracellular and tr ansmembrane domains between NPRA, NPRB, and NPRC. Since it is possible to predict antigenic determinants of a protein largely from its amino acid sequence, the entire cytoplasmic domain of NPRC was analyzed prior to designing the immunogen. The cytoplasmic domain was found to be antigenic enough to use as an im munogen, based on various immunogenic determinants. The double bands that are present in im munoblots corresponding to some of the various tissue or cel l lysates, indicates the JAH84 antibody dete cts total NPRC protein, including both unmodified and posttranslationally modified forms. NPRC has been reported to be phosphorylated on serine residues [370], although the specific residues that are phosphorylated and the kina ses that are responsible for phosphorylating them have not yet been identified. The double bands at 66 kDa that were observed in some immunoblots and immunoprecipitation experi ments may be attributed to NPRC phosphoryation, since only a single band is sometimes observed in the absence of phosphatase inhibitors. Moreover, the multip le bands that were observed in Western blots could also be attributed to other postranlational modifications su ch as glycosylation. The undiluted JAH84 antibody with supplemented with a bacteriostat, 0.05% sodium azide, to preserve its integrity. Several different buffers were tested for dilution of JAH84 for immunoblotting, and determin ed optimal dilutions for immunoblotting, immunohistochemistry, and immunoprecipitation. A typical attribute of polyclonal

PAGE 78

antibodies is high backgr ound. Antibodies that pro duce high background in immunoassays such as immunohistochemistry and immunoblotting af ter blocking with a common agent may require affinity purificatio n prior to use. J AH84 presented little background in immunostaining of cells and ti ssues and only a few nonspecific bands in immunoblotting. There was no need to affinity purify our JAH84 antibody prior to its use in various immunoassays. Antibodies are indispensable tools that are commonly used in several different applications in biological re search. As an alternative to detecting NPRC expression by Northern blotting, in situ hybridization, and PCR, the antibody presented in this report, JAH84, may be used as a valu able tool to confirm NPRC protein expression by various immunoassays. JAH84 offers several attract ive advantages including high sensitivity, high specificity, cross-react ivity between multiple species, low background, minimal optimization, and applicability for disc overy or confirmatory purposes.

PAGE 79

Figure8.SequencealignmentoftheintracellulardomainofNPRC fromvariousspecies.Shadedareasindicatehighlyconserved aminoacidresidues.Thesourceofeachofthepartialsequences shownforNPRCcanbetracedfromtheaccessionnumbersgiven ontheleft.

PAGE 80

Figure9.Westernblotanalysisshowingcross-reactivity ofvariouspolyclonalantibodiesagainstNPRC.The immunoreactivebandat75kDainpanelA,wasfurther identifiedasNPRC,asthebandwasexcisedandsubjectto tt li f ti idtifiti Th massspec t rome t ryana l ys i s f o r pro t e i n id en tifi ca ti on. Th e topbandsinpanesA,B,andCmaybenonspecific.

PAGE 81

Figure10.Westernblotanddensitometric analysisofflag-NPRCusingJAH84 ibd i ibl (A) ant ib o d y.Representat i ve i mmuno bl ot (A) anddensitometricanalysis(B)ofFLAGNPRC72hoursaftertransienttransfection ofCOS7cells.Theimmunoblotforactin demonstratesequalloading.

PAGE 82

1 2 3 4 4 5 6 anti-NPRC IgG IgG Figure11.Coomassiebluestainedgel(grayscale)after immunoprecipitationofNPRCwithJAH84.Fromleftto right(MolecularWeightMarkers(MWMs),RGM1Whole CellLysate(WCL),Immunoprecipitation(IP)withJAH84, Control(proteinGagarosebeadsalone).Sixputative NPRCbindingproteinsareindicatedbyarrows.

PAGE 83

Figure12.Westernblotanalysisofendogenous NPRC ti i i JAH 84 tibd NPRC pro t e i nexpress i onus i ng JAH 84 an tib o d y. Representativeimmunoblotsshowningendogenous NPRCproteinexpressioninvariousmousetissues (A)andinvarioushumancelllines(B). Correspondingimmunoblotsforactindemonstrate equalloading.POSITIVEreferstowholecelllysate positive control positive control

PAGE 84

X X Control 40 DAPI 40 X 4 40X 4 0X JAH8 4 DAPI 4 Figure13.ImmunofluorescenceofRGM1cellsusingJAH84. A:Negativecontrolshowingnoappreciablepositivestainingin theabsenceofspecificantibody.B:Nuclearstainingof(A) withDAPIC:Strongpositivestainingisobservedwhenusing JAH 84 at a dilution of 1 : 250 D : Nuclear staining of (C) with JAH 84 at a dilution of 1 : 250 D : Nuclear staining of (C) with DAPI.

PAGE 85

Chapter 2: Protein Binding Partners of NPRC

PAGE 86

Background NPRC may no longer be considered a bi ologically silent receptor with the only purpose being the clearance of NPs from circ ulation. As mentioned earlier, there have been several reports from different groups that have provided evidence of NPRC modulating signaling pathways through G i. In order to futher investigate the role of NPRC in mediating signali ng transduction through G i or independent of G i, a proteomic approach was taken to identify novel protein binding pa rtners for NPRC in various cell types. The identification of these novel protein-prot ein associations were confirmed by different methods. The mol ecular associations were characterized in vitro before investigating their functional significance in situ using various cell lines that express endogenos NPRC, as me ntioned earlier.

PAGE 87

Materials and Methods Reagents and antibodies In addition to the reagents and antibodies mentioned in the previous chapter, the following reagents and antibodies were purch ased or acquired as described. JAH84 antibody was from our laboratory [371], -arrestin polyclonal antibody was kindly provided by Dr. R.J. Lefkowitz (Howard Hughes Medical Institute and Duke University Medical Center, Durham, North Carolina), polyclonal AHNAK1 antibody was kindly provided by Dr. Hannelore Haase (Max Delb rck Center, Berlin, Germany), monoclonal AHNAK1 antibody was purchased from Abnova (Taipei City, Taiwan), -actin antibody was purchased from Sigma (St. Louis, MO). Hybond-C extra nitrocellulose membranes and Hyperfilm ECL were purchased from Amer sham Biosciences (Piscataway, NJ). All other chemicals were purchased from Sigm a unless otherwise noted. Collagen Type 1 cellware culture slides were purchased from BD Biosciences (Bedford, MA). Cell Lines and Cell Culture In addition to various cell lines mentioned in the previous chapter, the rat gastric mucosa cell line (RGM1) was acquired from Dr. Hirofumi Matsui (Riken, Japan) and cultured in a 1:1 mixture of Dulbecco's Modi fied Eagle's Medium and Ham's Nutrient F12 (DMEM/F12) supplemented with 10% Fetal Bovine Serum (FBS; Atlanta Biologicals) and 100 U/ml penicillin, 100 g/ml st reptomycin, and 25 ng/ml fungizone ( GIBCO Invitrogen; Grand Island, NY). Cells were grown to confluent monolayers in 100 mm tissue culture dishes or chamber slides at 37C in a humidified incubator with an atmosphere of 5 % CO2

PAGE 88

Immunoprecipitation Two hundred g of total protein cell lysate was incubated with a 1:250 dilution of anti-arrestin polyclonal anti body, anti-NPRC polyclonal an tibody (OMORI or JAH84 as indicated) or anti-AHNAK1 polyclonal antibody at 4 C for 2-4 hrs with end-over-end mixing. Complexes were incubated with a 1:10 dilution of prew ashed 50% protein G agarose slurry at 4 C for 4-6 hrs with end-over-end mixi ng. Beads were washed 4X with ice cold M-PER. Immune complexes were el uted in 1X SDS sample buffer and analyzed by SDS-PAGE and Coomassie st aining or Western blotting. SDS-PAGE, Western blotting, and Densitometric analyses SDS-PAGE and Western blot ting was performed as described in the previous Chapter. Densitometry of the immunor eactive bands was performed using the ImageQuant software version 5.2 (M olecular Dynamics, Sunnyvale, CA). Recombinant fusion protein production cDNA fragments encoding various AHNAK1 domains were a kind gift from Dr. Takashi Hashimoto (Keio University School of Medicine, Tokyo, Japan). Domains were AHNAK N (residues 2-252), AHNAK M (residue s 821-1330), AHNAK C1 (residues 4646-5145), and AHNAK C2 (residues 5146-5643) GST-AHNAK N, GST-AHNAK M, GST-AHNAK C1, and GST-AHNAK C2 were ki ndly provided by Dr. Silvre M. van der Maarel (Leiden University Medical Center, Leiden, Netherlands) [231]. All constructs were confirmed by DNA sequencing. Plasmi ds were transformed into competent E. coli BL21 (DE3) (Amersham Biosciences) for expression. Positive clones were grown in

PAGE 89

2XYT kanamycin medium (16g/L tryptone, 10 g/ L yeast extract, 5g/L NaCl, pH 7.0) at 37 C. Isopropyl-d-thiogalactoside (IPTG) induction was perform ed at an optical density (OD600) of 0.4 by adding IPTG to a final concentration of 0.01 M. GST-AHNAK N was obtained by traditional methods and GST-AH NAK M, C1, C2 were solubilized from inclusion bodies, as described in Chapter 4. Bacterial cells were lysed by sonication, and the fusion protein was batch pur ified using Glutathione Sepha rose 4B. Purity of the fusion protein was analyzed by SDS-PAGE and Co omassie blue staining. Identity of the fusion protein was confirmed by Western blotting and by mass spectrometry (MS) analysis (Proteomics Dept. at the Moffitt Cancer Center, Tampa FL). GST pull-down assay Two hundred g of total protein cell lysate was incubated together with 25 g of purified GST-arrestin 1, GST-arrestin 2, GST-AHNAK1 N, GST-AHNAK1 M, GST-AHNAK1 C1, or GST-AHNAK1 C2 (as described above) or 25 g of purified GST protein at 4 C for 2 hrs with end-over-end mixing. The resulting complexes were incubated with 40 l of prewashed 75% glutathi one Sepharose slurry at 4 C for 4 hrs with end-over-end mixing. Beads were washed 4X with 1 mL of ice cold GST lysis buffer (200 mM NaCl, 20 mM Tris-Cl (pH 8.0) 1 mM ethylenediaminetetraacetic acid (EDTA) (pH 8.0), 0.5% Igepal CA-630, 25 g/mL phenylethylsulfonyl fluoride (PMSF), 2 g/ l aprotinin, 1 g/ l leupeptin, 0.7 g/mL pepstatin). Bound proteins were eluted with 50 l of 20 mM reduced glutathione in 50 mM Tris-Cl (pH 8.0) and then analyzed by SDS-PAGE and Western blotting.

PAGE 90

Overlay binding assay (far-Western) 25 g of cell lysate was separated by SDSPAGE and blotted onto nitrocellulose membranes. The blots were blocked in 5% BSA 1X PBS for 1 hr at RT. The membranes were overlaid with purified GST or GST-NPRC (see Chapter 4) in blocking solution for 2 hours at RT, washed with 1X PBS, and probed for GST. A schematic of the overlay binding assay, or far-Western blot is illustrated in Figure 14. Mammalian two hybrid and dual-luciferase assay The mammalian two-hybrid and the dual-luciferase reporter assay system (CheckMate; Promega, Madison, Wis) was op timized for investigating the assocaiton between NPRC and -arrestins or NPRC and AHNAK1 in situ A schematic of the mammalian two hybrid assay is illustrated in Figure 15. For the mammalian two-hybrid assay, two positive control vectors that encode and express two proteins known to interact in vivo Id and MyoD, were in cluded in the assay kit for use as pBIND-Id (GAL4-Id) and pACT-MyoD (VP16-MyoD) fusion constructs. In order to confirm the association between NPRC and -arrestins or AHNAK1 in situ pACT NPRC and pBIND NPRC, pACT -arrestin1 and pBIND -arrestin1, pACT AHNAK1 and pBIND AHNAK1 constructs were created as shown in Appendix B-F. Between 48 to 72 hrs after transfection, the cells we re lysed with 1X passive ly sis buffer (Promega) and the activities of firefly ( Photinus pyralis ) and Renilla ( Renilla reniformis ) Luciferases were measured sequentially. The activity of the fi refly luciferase reporte r was measured first by adding Luciferase assay reagent II (LAR II) to generate a luminescent signal. After quantifying the firefly luminescence, the reaction was quenched, and the Renilla

PAGE 91

luciferase reaction was initiated simultaneously by adding Stop & Glo reagent to the same sample. Statistics Results are expressed as the mean SE of three independent experiments, as indicted. Repeated measures ANOVA was conducted and statistical significance was set at p<0.05. Here, by convention, p <0.05, **p<0.005, ***p<0.0005. Students t -test was used to compare two groups and one-way ANOVA was used to compare multiple groups.

PAGE 92

Results The cytoplamic domain of NPRC contains consensus sequence binding motifs for arrestin The 37 amino acid cytoplamic domain of both rat and human NPRC contains at least a single consensus sequence binding motif for -arrestin, as shown in Figure 16. The binding motif consists of a serine or threonine residue followed by any four to five amino acids followed by a serine or threoni ne residue, (-S/TX4-5S /T) [372]. Although no GRK phosphorylation motifs were identified within the cytoplas mic domain of NPRC, several putative PKA, PKB, and PKC phosphoryl ation sites were identified using motif scanner (http://scansite.mit.edu/motifscan_seq.phtml) and NetPhos 2.0 (www.cbs.dtu.dk/services/NetPhos) (Figure 16). NPRC associates with -arrestin in vitro Preliminary immunopreci pitation studies were performed using -arrestin specific antibody to pull-down -arrestin and its protein bind partners in A-10 VSMCs. Subsequent SDS-PAGE analysis of the elutants from the -arrestin immunoprecipitation studies, revealed several putativ e protein binding partners for -arrestin as indicated by Ponceau staining. Probing the membranes with an antibody against NPRC revealed an immunoreactive band at 66 kDa, corresponding to NPRC (Figure 17 A ). Similary, arrestins were also shown to associate with NPRC in vitro in HeLa cells as indicated by immunoprecipitation studies (Figure 17 B ). Mouse embryonic fibroblasts (MEF) lacking -arrestin 1, -arrestin 2, or both -arrestin 1 and -arrestin 2 were evaluated for NPRC expression as they could serve as a nonspecific control while performing

PAGE 93

immunoprecipitation studies. Interestingly, Western blot analysis revealed NPRC is expressed in each of the MEF cell lines, with the exception for MEF -arrestin knockout 1 (Figure 17 C ). The in vitro association between NPRC and -arrestins is dependent on NPRC occupancy Next, additional immunopreci pitation studies were performed to determine if NPRC associates with -arrestin in NIH 3T3 cells and if the associatio n was dependent on receptor occupancy. NIH-3T3 cells were tr eated with 1 M cANF for 0, 2, 5, and 20 minutes before harvesting the cells for protei n, in the presence of phosphatase inhibitiors in order to perform IP-Western blot an alysis. The association between NPRC and arrestins was significantly augmented with the treatment of cANF over time, as indicated by increasing intensity of the immuoreactive band at 66 kDa corresponding to NPRC shown in Figure 18. NPRC predominantly associates with -arrestin 1 in vitro Afterwards, the ability of NPRC to associate with -arrestins in RGM1 cells and specificity of the -arrestin isoform involved in the association was investigated. GSTarrestin 1 and 2 were expresse d and purified, and then used as bait proteins in GST pulldown assays. GST-arrestin 1 was found to be the pre dominant isoform to be associated with NPRC in vitro although -arrestin 2 was also able to pull-down NPRC in RGM1 cells, but to a lesser extent (Figure 19).

PAGE 94

NPRC associates with AHNAK1 isoform 1 In order to identiy other putative NP RC binding partners and to confirm the association between NPRC and -arrestins, NPRC was im munoprecipitated from AoSMC or RGM1 cell lysates. The elutants were electrically separated by SDS-PAGE, and the resulting bands from Coomassie blue st ained gels were excised and subjected to MS analysis for protein iden tification. While using either AoSMC or RGM1 cell lysates as a source of the prey protein, Coomassie stained gels revealed several bands representing putative NPRC associating prot eins, including a high molecular weight double band above 250 kDa. Fo r experiments utilizing AoSMC lysate, Mascot results of the excised double band revealed multiple si gnature peptides corresponding to human AHNAK1 isoform 1 (Figure 21). Similarly, for experiments utilizing RGM1 lysate, Mascot results of the excised double band revealed multiple signature peptides corresponding to rat AHNAK1 isoform 1 (Figure 22). Als o, NPRC was found to associate with AHANK in 3T3-L1 preadipocytes (Figure 23). The ability of at least AHNAK1 isoform 1 to associate with NPRC was corroborated by IP Western blot analysis, while utilizing a polyclonal anti body against the carboxy terminal domain of AHNAK1, which is known to differ between the two AHNAK1 isoforms. A band corresponding to NPRC was observed af ter immunoprecipitating AHNAK1 with this antibody from AoSMC, RGM1, or 3T3-L1 lysates and probing for NPRC with a polyclonal antibody against the cytoplasmic dom ain of NPRC, as demonstrated in Figure 21C, 22C, and 23C respectively.

PAGE 95

The C1 Domain of AHNAK1 1 associates with NPRC The association between NPRC and AHANK1 was corroborated in AoSMCs by expression and purifying GST fusion proteins sp ecific to each of the distinct functional domains of AHNAK1, (i.e. AHNAK1 N (ami no terminal residues 2-252), AHNAK1 M (central repeat unit resi dues 821-1330), and two carboxy terminal domains (AHNAK1 C1, residues 4646-5145 and AHNAK1 C2, residue s 5146-5643), as shown in Figure 24) and then performing GST pull-down assays. Ve rification of molecular weight and purity of GST-AHNAK1N, GST-AHNAK1M, GST-AHNAK1C1, and GS T-AHNAK1C2 was determined by SDS-PAGE followed by Coomassie blue staining and direct Western blot analysis for GST (Fig 24 B C ). Thereafter, in vitro GST pull-down assays were performed using cell lysate from AoSMCs and the purified GS T-AHNAK1 fusion proteins. Only GST-AHNAK1C1 was able to pull-down NPRC (Figure 24D ). In similar experiments, GST-AHNAK1C1 was not able to pull-down NPRA or NPRB, and in other experiments, NPRA and NPRB specific antib odies also failed to pull-down AHNAK1 (Figure 25). Phosphorylation and occupancy of NPRC is not required for it to associate with AHNAK1 Unphosphorylated GST-NPRC was overlaid on nitrocellulose membranes containing endogenous AHNAK1 fro m phosphatase treated or unt reated RGM1 lysate. In the presence or absence of phosphatase i nhibitors, GST-NPRC was able to bind to AHNAK1 (Figure 26). GST pull-down assays demonstrated NPRC occupancy by ligand was not necessary for it to associate with AHNAK1. RGM1 cells pretreated with the

PAGE 96

NPRC agonist cANF for increas ing periods of time did not augment the association between NPRC and AHNAK1 (Figure 27). Experssion of AHNAK1, NPRs, G i and PLC isoforms in 3T3-L1, AoSMCs, and RGM1 cells Endogenous protein expression levels of AHNAK1 and NPRC were assessed in the cell lines intended for use in the investigation of the role of the association between NPRC and AHNAK1. Both AHNAK1 and NPRC are coexpressed in 3T3-L1 preadipocytes, RGM1 cells, and AoSMCs (F igure 28). NPRA and NPRB proteins are expressed in 3T3-L1 preadipocytes and AoSM Cs, but are not expressed in RGM1 cells (Figure 28). Because AHNAK1 and NPRC are known to activate different isoforms of PLC, these cell lines were screened for expression of various PLC isoforms. Interestingly, 3T3-L1 preadipocytes, RGM1 cells, and AoSMCs do express various levels of endogenous PLC 1, but do not express any a ppreciable levels of PLC 2, and do express various levels of endogenous PLC 3 (Figure 29). Also, the expression of G i was investigated in these cell lines since NPRC is known to couple to G i, which could potentially be involved in the functi on role between NPRC and AHNAK1. G i was found to be expressed in HeLa cells, AoSM Cs, RGM1 cells, and 3T3-L1 preadipocytes (Figure 29D). NPRC and AHNAK1 are differentially expressed during mouse adipogenesis The progression of the differentiation of 3T 3-L1 cells into mature adipocytes was monitored every other day by phase-contrast microscopy and Oil Red O staining for the

PAGE 97

accumulation of lipid droplets (Figure 30 A B ). At each corresponding day, protein expression of the NPRs, AHNAK1, and PPAR were assessed by Wester n blot analyses. There were no significant changes in NP RA or NPRB protein expression during the course of differentiation for days 0-6 (Figure 31B C ). However, AHNAK1 protein expression significantly decreased (Figure 31 A E ) and NPRC protein expression significantly increased fr om days 0-6 (Figure 31D F ). The differential regulation of AHNAK1 and NPRs proteins during the course of 3T3-L1 differentiation was confirmed in later stages of differentiation of 3T3-L1 preadipocytes and also in mouse adipose tissues. NPRA and NPRB prot ein expression was low and constant in days 8-12, while NPRC protein expression was high and constant for days 8-12 of 3T3-L1 differentiation (Figure 32), and in adipose tissues from three diffe rent mouse donors for AHNAK1 and NPRs (Figure 33). Translocation of AHNAK1 from the nucleus to the plasma membrane Various determinants were investigat ed for the translocation of AHNAK1 from the nucleus to the plasma membrane. The addition of PMA resulted in a subtle increase in AHNAK1 translocation from the nucleus to the cytoplasm (Figure 34). A switch in medium containing low calcium to medium containing high calcium resulted in AHNAK1 translocation from the nucleus to the plasma membrane of 3T3-L1 preadipocytes (Figure 35). siRNA mediat ed knockdown of NPRC resulted in AHNAK1 accumulation in the nucleus a nd less AHNAK1 associated w ith the plasma membrane (Figure 36, 37).

PAGE 98

Discussion Two different types of scaffolding/ad aptor proteins were identified as novel binding partners of NPRC. The -arrestins, which are known to associate with the intracellular domains of various cell surface receptor s [372] were found to associate with NPRC in vitro AHNAK1, a large and versatile protei n implicated in a wide range of functions was also found to associate NPRC in vitro and in situ Many biological processes are governed or dependent on protein-protein interactions. The interaction of two or more proteins may directly or indirectly affect various cellular functions by different means including altering the specificity of a protein for its substrate, altering the kinetic propert ies of an enzyme, targeting the protein for degradation, and coupling th e protein to downstream si gnaling pathways. The interactions between proteins arise from the physical in teractions between specific regions on the surface of the pr oteins. The association or dissociation between proteins may be dependent on various physiological co nditions. Protein-protein interactions may be stable or transient in nature and either type of interaction may be strong or weak and fast or slow. Transient pr otein-protein interactions, wh ich are temporary, are more prevalent in nature and are also more diffi cult to study than stable protein-protein interactions because the interacting protei ns may dissociate during the study. Both the association between NPRC and -arrestins and the association between NPRC and AHNAK1 may be considered to be weak and transient. The bait-prey system is commonl y used to investigate protein-protein interactions. By convention, th e bait protein is the known prot ein or protein of interest that is used to capture the prey protein or unknown protein binding partner. The two

PAGE 99

phases of protein-protein investigations are th e discovery and the confirmation phases. It may be useful to use an endogenous source for the bait and/or prey proteins, in which both native proteins are func tional to allow for physiol ogical relevant findings. Conversely, it may be beneficial to use an artificial source for th e bait and/or prey proteins to confirm a previous ly identified protein-protein a ssociation because it allows for the ability to work with a larger quant ity of the protein than would normally be expressed in the endogenous environment, and it reduces complexities that would arise from additional interacting protein bindi ng partners present in the endogenous environment. NPRC is known to couple to Gi and participate in the activation of the PLC cascade and inhibition of the adenyyl cyclase cascade, but the direct association between NPRC and putative protein binding partners that would mediate its role in signal transduction cascades has not been identified. Therefore, a proteomic approach to identify putative protein binding partners of NPRC was carried out in various cell lines, in which NPRC was shown to be expressed. The cell lines were used as model systems to subsequently decipher the physiological role of NPRC and its protein binding partners. Initial co-IP studies identified the -arrestins as being putative binding partners for NPRC in vitro The association between GPCRs and -arrestins has significant implications because the 7TMRs represent the largest a nd most versatile family of membrane receptors. Consequently, 7TMRs regulate meta bolism, secretion, cell shape, motility electrical activity in response to wide range of hormones and stimuli and are therefore the most common target of therapeutic drugs [373].

PAGE 100

The ability of NPRC to associate with -arrestins could contribute to the regulation of NPRC protein and the regulation of NPRC signaling. Phosphorylation and activation of NPRC by ligand bi nding may result in the recruitment and interaction of cytosolic -arrestins. The association between NPRC and -arrestins may result in the complex binding to components of the clathrin endocytic mach inery, leading to downregulation, or a decrease in the number of NPRC molecules at the cell surface. Alternatively, the association between NPRC and -arrestins may result in homologous desensitization, as the associ ation precludes the coupling be tween NPRC and Gi, leading to termination of signaling by G protein effect ors. Moreover, the ability of NPRC to associate with -arrestins may implicate NP mediated activation of NPRC in in other signaling cascades in additi on to AC and PLC, since -arrestins are known to function as adaptor proteins. Since the AHNAKs, AHNAK1 and AHNAK2, are known to possess differences between the amino and carboxy terminal domains the utilization of a polyclonal antibody against the carboxy terminal domain of AH NAK1 was expected to pull-down AHNAK1 and not cross-react with AHANK 2 in immunoprecipitation experi ments. Although immunoprecipitating AHNAK1 with this antibod y and probing for NPRC cannot be used to definitively determine th e specific interacting AHNAK1 isoform, it was used to demonstrate the ability of at leas t AHNAK1 to associate with NPRC in vitro In order to identify the specific AHNAK1 isoform that associates with NPRC, NPRC was immunoprecipitated from AoSM C or RGM1 cell lysates and the bands on Coomassie blue stained gels representing putative NP RC associated proteins were excised and subject to MS analysis for protein iden tification. The elutants from the NPRC

PAGE 101

immunoprecipitation experiments may have contained AHNAK1, AHNAK2, or AHNAK-like proteins. However, Mascots resu lts revealed multiple signature peptides corresponding only to AHANK1, thus confirming AHNAK1 and not AHNAK 2 associates with NPRC. After determining AHNAK1 associates with NPRC in vitro GST pull-down assays utilizing distinct functional domain s of AHANK1 as GST fu sion proteins were performed in order to identify the specific AHNAK1 domain that associates with NPRC in vitro Although it was theoretically possible for any of the four distinct and functional domains of AHNAK1 to interact with NP RC, GST pull-down assays only revealed AHANK1 C1 as being able to pull-down NP RC from an AoSMC lysate. Identification of the AHNAK1 domain that interacts w ith NPRC was necessary for the design and construction of AHNAK1 fusi on proteins for investigating the role of molecular association in mediating calcium signaling in situ as AHNAK1 is an extraordinary large protein and if used in its entirety, w ould most likely pose major difficulties in experiments involving transf ection. Therefore, only a por tion of AHNAK1 containing several repeating units and th e carboxy terminal domain of AHNAK1 were used to create a pBIND-AHNAK1 fusion protein. Several repeating units of AHNAK1 were included because these segments are necessary for the binding and activation of PLC and the carboxy terminal domain of NPRC were incl uded because this domain was shown to interact with NPRC. Several attributes were cons idered for the selection of a suitable cell line for the functional interrogation of the association between NPRC and AHNAK1 in situ In addition to expressing endoge nous NPRC, AHNAK1, and PLC 1 proteins, the cell line

PAGE 102

needed to tolerate transfection of siR NAs for knockdown of NP RC and AHNAK1 or plasmid DNA for overexpression of an AHNAK1 fusion protein. Preliminary studies for the optimization of transient transfecti on of the AHNAK1 fusion protein presented difficulties in RGM1 cells and in AoSMCs, while desirable transfection efficiencies were achieved in 3T3-L1 preadipocytes using the Fugene method. Th e cell line also needed to tolerate loading with the calcium indicator dye Fluo-3, respond to various exogenous agents in the micro molar range, and be suitable for real time live cell confocal microscopy imaging studies for motoring changes in intracellular ca lcium mobilization. AoSMCs and 3T3-L1 cells met these requir ements and responded to various exogenous agents used as positive controls (e.g. ET-1) or used as a loading control (e.g. ionomycin). However, RGM1 cells did not tolerate Fluo-3 loading nor did it respond to any of the positive controls or loading control. As shown in Figure 31, NPRC and AHNAK1 protein expression is inversely propor tional over the course of differention of 3T3-L1 preadipocytes into mature adipocytes after insulin, dexamethasone, and IBMX treatment. While both NPRC and AHNAK1 pr oteins are expressed in 3T 3-L1 preadipocytes and in the early stages of differentiation, NPRC protein is overexpressed and AHNAK1 protein is attenuated in mature adipocytes. Future studies may be performed to determine if NPRC and AHNAK1 protei ns are directly affected by insulin, dexamethasone, and IBMX treatment. Since 3T3-L1 pread ipocytes express both NPRC and AHNAK1 proteins, tolerate transient transaction of siRNAs and plasmid DNA, and tolerate loading with Fluo-3 AM these cells were used for all in situ studies involving transient transfection of either si RNAs or plasmid DNA.

PAGE 103

Haase e t al. investigated the role of the C1 domain of AHNAK1 in the signal transduction pathway between the beta-adrenergic receptor and the L-type Ca2+ channel [374]. The association between th e C1 domain of AHNAK1 and the 2 subunit was shown to be dependnet on PKA phosphorylation of both proteins, as the binding affinity decreased approximately 50% upon PKA phosphorylation of both protein partners [374]. Haase et al. suggested that the C1 domain of AHNAK1 operates as a phosphorylationdependent suppressor of the L-type Ca2+ channel, and liberation of this suppression results in more available 2 subunit to associate with the L-type Ca2+ channel, resulting in enhanced current density [374]. Furthermore, in another report Haase et al reported the carboxy terminal domain of AHNAK1 as the interacting domain for the regulatory subunit of L-type Ca2+ channels and for F-actin and sugge sted that this domain links the Ca2+ channels to the actin-based cytoskeleton. Lee et al showed the M domain of AHNAK1, consisting of the rep eating units of AHNAK1 functi on as a scaffolding motif networking PLC-gamma and PKC-alpha [239]. Wh ile considering the di stinct structural domains of AHNAK1 and the reports of sp ecific AHANK1 domains to interact with other proteins, the ability of the C1 domain of AHANK1 to associate with NPR-C is structurally and functionally revelvant. It is plausible that the extraordinary size and conformation of AHNAK1 contribu tes to its distinct structural domains to be positioned or accessible for the direct in teraction with its various protein binding pa rtners. For example, the C1 domain of AHNAK1 was found to associate presumably, with the intracellular domain of NPRC. It may be expe cted and conceivalble for either the amino terminal domain or the carboxy terminal domain of AHANK1 to associate with NPRC and not the middle reigon of AHNAK1, since it is likely to be occupied after forming a

PAGE 104

complex with PLC and PKC. Furthermore, due to the carboxy terminal domain of AHNAK1 being considerably larger and contai ning more putative binding regions than the amino terminal domain of AHNAK1, it would seem more likely for the carboxy terminal domain of AHNAK1 to associate with NPRC than it would for the amino terminal domain of AHANK1 to associate with NPRC.

PAGE 105

kDa 250 150 R F P H e ar t Lung S t o m ac h K i d ne y G S T1 2 3 4 5 6 100 75 50 37 GST Recombinant protein IgG 37 Peroxidase conjugate Protein NCM Figure14.Schematicofthefar-Western(proteinoverlayassay)technique. Proteinsfromvariouscelllines/tissues,theRecombinantFusionProtein (RFP)thatwillbeusedtoprobeforputativeprotein-proteininteractions, andtheunfusedGlutathioneSTransferase(GST)proteinareloadedonto separatelanesofapolyacrylamidegelsothatlanes1-6,lanes7-12,and lanes13-18areanalogous.ProteinsareseparatedbySDSPAGEandthen electricallytransferredontoaNitrocelluloseMembrane(NCM).The NCM is cut in three identical strips to allow for two far Westerns and one NCM is cut in three identical strips to allow for two far Westerns and one Westerntoberuninparallel.TwooftheNCMstripsareoverlaidwith eitherRFPorGST(forfar-Westerns)andthethirdNCMstripisincubated withaspecificantibodyforthepreyprotein.Forfar-Westernsa peroxidaseconjugatedantiGSTantibodyisusedtodetectaninteraction betweentheRFPandthepreyprotein.Theproteininteractionis confirmedbytheabsenceofasignalinthefar-WesternblotusingGSTas the p robean d by the p resenceofasi g nalfo r the p re y p roteininthe p y p g py p Westernblotusingaspecificantibody.Inthisfigurethe100kDaRFP boundtoa55kDapreyproteinpresentinheart,stomach,andkidney,but notlung.Ascontrols,theperoxidaseconjugatedanti-GSTantibodybound totheRFPinlane1andtoGSTat26kDainlane6.

PAGE 106

Figure15.Representationofconstructsusedinthemammaliantwo hybriddualluciferaseassay.ThereporterconstructisdesignatedpG5 Luc,positivecontrolsknowtointeractaredesignatedpACT-MyoDand pBIND-ID,negativeemptyvectorsaredesignatedpACTandpBIND,and expressionconstructsinclude pACT-AHNAK1C2,pBIND-AHNAK1C2, pACT-NPRC,an d pBIND-NPRC. B. Experimentsdemonstrating functionalityoftheassaybasedonthefoldinductionoftheinteraction betweenpBIND-IDwithpACT-MyoDcomparedtothecontrols.

PAGE 107

Human NPR-C RKK Y RI T IERR T QQEE S NLGKHRELRED S IR S HF S VA R K K Y R I T I E R R T Q Q E E S N L G K H R E L R E D S I R S H F S V A Rat NPR-C RKK Y RI T IERR N H QEE S N I GKHRELRED S IR S HF S VA (-S/TX4-5S/T-) (-S/TX4-5S/T-) R K K Y R I T I E R R N H Q E E S N I G K H R E L R E D S I R S H F S V A (-S/TX4-5S/T-) Thr507:Ser 529:Ser 532:Ser 535: PKC:(RXTXXR) (RXXS)(RS) PKC: (RXTXXR) (RXXS) (RS) PKA: (RXT) (RXXS) PKG: (RXT) (RXXS) (RXXXS) Figure16.Sequencealignmentofthe37aminoacid cytoplasmicdomainofhumanandratNPRC.Twoindependent consensus sequence binding motifs for arrestin ( S/TX 4 5 S/T) consensus sequence binding motifs for arrestin ( S/TX 4 5 S/T) areshownforhumanNPRCandonesuchmotifisshownforrat NPRC.SeveralconsensussequencesforproteinkinaseC,A, andGareshownforbothhumanandratNPRC.

PAGE 108

Figure17.InvitroIP-Westerndemonstratingtheassociation betweenNPRCand -arrestins.A:A-10VSMC;B:HeLa cells;C:WesternblotshowingNPRCexpressionindifferent arrestinmouseembryonicfibroblastknockouts.IgGHCrefers totheheavychain(50kDa)ofreducedandSDS-denatured rabbitIgG POSITIVEreferstopositivecontrolconsistingof wholecelllysatefro m NIH3T3cells.

PAGE 109

Figure18.EffectofNPRCoccupancyonitsassociationwith -arrestins.NIH3T3cellsweretreate d with1 McANFfo r theindicatedtimes, -arrestinwasimmunoprecipitatedfrom thelysate,andOmorianti-NPRCantibodywasusedtoprobe forNPRCprotein.POSITIVEreferstopositivecontrol consistingofwholecelllysatefromNIH3T3cells. NEGATIVEreferstonegativecontrolinwhich -arrestin specificantibodywasomittedandthenonspecificbindingof theproteinGagarose b eadswasassesse d .IgGHCrefersto heavychainofimmunoglobulinG.

PAGE 110

Figure19.InvitroGSTpulldownassayshowingspecificityof arrestinisoformsforNPRC.GSTArrestin1,GSTArrestin2, GST,orbeadsalonewereusedtopulldownNPRCfromRGM1 celllysate.TheblotswereprobedforNPRC.POSITIVErefers topositivecontrolofwholecelllysatefromRGM1cells.

PAGE 111

Figure20.Modelillustratingthehypothesizedroleof -arrestin 1/2inmediatingNPRCsignaling.Natriureticpeptidesbindand activatethemembraneboundphosphorylatedNPRChomodimer. Thereafter,cytosolic -arrestinisrecruitedandbindstospecific consequencesequenceswithintheC-terminaldomainof NPRC. -arrestinisshown(bluedottedlines)todesensitize NPRC signaling by uncoupling the receptor from Gi and further NPRC signaling by uncoupling the receptor from Gi and further Gproteindependentsignaling.TheassociationofNPRCwith arrestinisshowntointernalizeanddownregulateNPRC(orange dottedline).TheassociationofNPRCwith -arrestinisshown (greenlines)toactivateothersignalingcascadesincludingthatof MAPKandERK. Inhibitoryguaninenucleotide-regulatory protein (Gi) 3 5 cyclic adenosine monophosphate (cAMP) protein (Gi) 3 5 cyclic adenosine monophosphate (cAMP) inositoltriphosphate(IP3),diacylglycerol(DAG),calciumions (Ca2+),phospholipaseC(PLC),mitogenactivatedprotein kinase(MAPK)andextracellularsignal-regulatedkinase(ERK).

PAGE 112

Figure21.MolecularassociationofNPRCandAHNAK1in AoSMC. (A) Coomassiebluestainingofimmunoprecipitates fromAoSMClysateusinganti-NPRCantibody(JAH84) revealedahighmolecularweightdoublebandwitha molecularweightabove250kDa. (B) MASCOTresultsofthe exciseddoublebandindicatedin(A)revealedmultiple signaturepeptidescorrespondingtohumanAHNAK1isoform 1 (C) f ii f ASC l 1 (C) I P Westerno f i mmunoprec i pates f ro m A o S M C l ysate usinganti-NPRCantibodyprobingforAHNAK1protein(top) orNPRCprotein(bottom).InpanelsAandCPOSITIVE referstopositivecontrolcons istingofwholecelllysateand NEGATIVEreferstonegativecontrolinwhichNPRCspecific antibodywasomittedandthenonspecificbindingofthe protein G agarose beads was assessed The labeled bands are protein G agarose beads was assessed The labeled bands are AHNAK1(1),NPRC(2),andIgG(3).Dataarerepresentative ofatleastthreeindependentexperiments.

PAGE 113

Figure22.MolecularassociationofNPRCandAHNAK1in RGM1cells. (A) Coomassiebluestainingof immnoprecipitates from RGM 1 lsate sing anti NPRC imm u noprecipitates from RGM 1 l y sate u sing anti NPRC antibodyrevealedahighmolecularweightdoublebandwitha molecularweightabove250kDa. (B) MASCOTresultsofthe exciseddoublebandindicatedin(A)revealedmultiple signaturepeptidescorrespondingtoratAHNAK1isoform1. (C) IPWesternofimmunoprecipatesfromRGM1lysateusing anti NPRC antibody probing for AHNAK 1 protein (top) or anti NPRC antibody probing for AHNAK 1 protein (top) or NPRCprotein(bottom).InpanelsAandCPOSITIVErefersto positivecontrolconsistingofw holecelllysateandNEGATIVE referstonegativecontrolinwhichNPRCspecificantibodywas omittedandthenonspecificbindingoftheproteinGagarose beadswasassessed.ThelabeledbandsareAHNAK1(1), NPRC ( 2 ), an d I g G ( 3 ) .Dataarere p resentativeofatleastthree ( ), g ( ) p independentexperiments.

PAGE 114

IP: anti-NPRC IP: anti-NPRC WB: anti-AHNAK1 IP:anti NPRC Figure23.MolecularassociationofNPRCandAHNAK1in 3T3-L1cells. (A) CoomassiebluestainedgelandIPWestern confirming the association between NPRC and AHNAK 1 in IP: anti NPRC WB: anti-NPRC confirming the association between NPRC and AHNAK 1 in 3T3-L1cells. (B) IPWesternconfirmingtheassociation betweenNPRCandAHNAK1in3T3-L1preadipocytes.In panelsAandBPOSITIVEreferstopositivecontrolconsisting ofwholecelllysateandNEGATIVEreferstonegativecontrol inwhichNPRCspecificantibodywasomittedandthe nons p ecific b indin g ofthe p roteinGa g arose b eadswas p g p g assessed.ThelabeledbandsareAHNAK1(1).Dataare representativeofatleastthreeindependentexperiments.

PAGE 115

Figure24.IdentificationofAHNAK1domainsthatassociate withNPRCinAoSMCcells. ( A ) A schemeofthemolecular () structureofhumanAHNAK1andthelocationofGSTfusion proteinfragmentsAHNAK1N(aa2-252),AHNAK1M(aa8211330),andAHNAK1C(aa4642-5643).TheC-terminaldomain wasdividedintotwoseparatefragmentsC1(aa4646-5145)and C2(aa5146-5643). (B) Coomassiebluestainingofpurified GST-AHNAK1domains. (C) DirectWesternblotofpurified GST-AHNA K 1domainsreveale d thepresenceofasingle b an d foreachofthepurifiedAHNAK1fusionproteins. (D) Invitro GSTpull-downassayusingAoSMClysateandpurifiedGST fusionproteinscorrespondingtoeachoftheAHNAK1domains orGSTaloneshoweddirectinteractionbetweenGSTAHNAK1C1andNPRC.

PAGE 116

WB:AHNAK1 Figure25.Specificityoftheassociation betweenNPRCandAHNAK1.IPWesternsshowingNPRCandnotNPRA orNPRBspecificantibodiesareableto lld AHNAK 1 WB: AHNAK1 pu lld own AHNAK 1

PAGE 117

F F AHNAK1 AHNAK1 in vitro overlay binding assay WB: anti-NPRC Figure26.Theroleofphosphorylationintheassociationbetween NPRCandAHNAK1.(A)Coomassiebluestainingofpurified GST-NPRCrevealedthepresenceofasingleband.(B) Invitro overlaybindingassayofratgastricmucosacelllysatetreatedwith orwithoutphosphataseinhibitors(PI)andoverlaidwithGSTNPRC d bd f GST fid bidi f NPRC NPRC an d pro b e d f o r GST con fi rme d bi n di ngo f NPRC to AHNAK1(arrow).

PAGE 118

in vitro GST pull-down assay GST-AHNAK1C1 WB:anti NPRC Figure27.EffectofNPRCoccupancyontheassociation betweenNPRCandAHNAK1. Invitro GSTpull-downassay afte r p reincubationofRGM1cellswith1 McANFfo r the WB: anti NPRC p indicatedtimeintervals.

PAGE 119

Figure28.ExpressionofendogenousAHNAK1 andNPRsproteins.HeLa,AoSMC,RGM1,and 3T3-L1cellsexpressendogenousAHNAK1 protein (A) an d NPRCprotein (D). HeLa, AoSMC,and3T3-L1cellsexpressNPRAprotein (B) andNPRBprotein (C) .Blotsare representativeofatleastthreeindependent experiments.POSITIVEreferstopositivecontrol consistingofwholecelllysatefromA-10cells

PAGE 120

Figure29.ExpressionofendogenousPLCandG i proteinsinvariouscelllines.HeLa,AoSMC,RGM1,and 3T3-L1cellsexpressvaryinglevelofendogenousPLC 1 (A) ,noPLC 2 (B), varyinglevelsofPLC 3(C),and i ll f G i (D) Blt tti f t vary i ng l eve l so f G i (D) Bl o t sarerepresen t a ti veo f a t leastthreeindependentexperiments.POSITIVErefersto positivecontrolconsistingofwholecelllysatefromNIH 3T3cellsforpanelsA,C,andDorwholecelllysatefrom RamoscellsforpanelB.

PAGE 121

Figure30.Assessmentofthedifferentiationof3T3-L1cells.A: Phase-contrastmicroscopy.B:OilRedOStainingatthe indicateddays.C:Westernblotofperoxisomeproliferatoractivate d rece p to r ( PPAR ) p roteinex p ressionasamarke r of p ( ) p p differentition

PAGE 122

Figure31.RegulationofAHNAK1andNPRprotein expressionfromday0to6of3T3-L1celldifferentiation. AHNAK1(A)proteinexpressiondecreases,NPRA(B)and NPRB (C) protein expression remain constant and NPRC (D) NPRB (C) protein expression remain constant and NPRC (D) proteinexpressionincreaseswithdifferentiationof3T3-L1 preadipocytes.Thedensitometricanalysisforthedecreasein AHNAK1proteinexpressionisshowninpanelE.The densitometricanalysisfortheincreaseinNPRCprotein expressionisshowninpanelF.POSITIVEreferstopositive control consisting of 3 T 3 L 1 whole cell lysate from day 2 of control consisting of 3 T 3 L 1 whole cell lysate from day 2 of 3T3-L1preadipocytedifferentiation.Studentst-testwasused tocomparetwogroups.Here,byconvention*P<0.05, **P<0.005,***P<0.0005

PAGE 123

Figure32.RegulationofAHNAK1andNPRprotein expressionfromday0to12of3T3-L1celldifferentiation. AHNAK1(A),NPRA(B),NPRB(C),andNPRC(D) ti i d t fth d i pro t e i nexpress i on d oesno t f ur th e r d ecreaseo r i ncrease beyondday8ofdifferentiationof3T3-L1preadipocytes. PanelEshowsPPAR proteinexpressionasapositive controlfordifferentiationof3T3-L1preadipocytesinto matureadipocytes.

PAGE 124

WB: anti-AHNAK1 WB: anti-NPRC WB: anti-PPAR WB: anti-actin Figure33.EndogenousexpressionofAHNA K 1an d NPRC proteinsinmouseadiposetissue.Lowornoappreciablelevels ofAHNAK1proteinandhighlevelsofNPRCproteinwere detectedinadiposetissuefromthreedifferentmousedonors.

PAGE 125

Figure34.Theeffec t ofAHNA K 1translocationinresponsetoPMA treatmentinRGM1cells. (A) Sucrosegradientcentrifugation analysisofthetranslocationofAHNAK1proteininresponsetoPMA treatment. (B) AHNAK1proteindemonstratesmoreofa cytoplasmicdistributionandlessof anucleardistributionwithPMA treatment.NPRCwasprobedforasamembranemarker,LaminA/C wasprobedforasanuclearmarker,andGAPDHwasprobedforasa cytoplasmicmarker.Blotsarerepresentativeofatleastthree independentexperiments.

PAGE 126

Figure35.Immunofluorescenceshowingtheeffectof increased [Ca 2 + ]e on AHNAK 1 translocation in 3 T 3 L 1 increased [Ca 2 + ]e on AHNAK 1 translocation in 3 T 3 L 1 preadipocytes.3T3-L1preadipoc yteswereinitiallyculturedin mediumcontainingnormalCa2+(1.8mM)andwerethen switchedtomediumcontaininghighCa2+(7.2mM)and culturedforanadditional6hoursbeforefixingthecellsand stainingforAHNAK1.Theleftcolumnshowsthemerged image the middle column shows Texas red staining for image the middle column shows Texas red staining for AHNAK1,andtherightcolumnshowsnuclearcounterstaining withDAPI

PAGE 127

Figure36.KnockdownofNPRCproteinin3T3-L1 preadipocytes.A:Westernblotanalysisinwhichthearrow indicatesamarketedreductioninNPRCprotein;B: densitometricanalysisof(A).MOCKreferstotheuseof nontargetingsiRNAinsteadofNPRCSMARTpoolsiRNA.The topbandinpanelAisnonspecificandthebottombandat66 kD d t NPRC H b ti *P< 0 05 kD acorrespon d s t o NPRC H ere, b yconven ti on *P< 0 05 **P<0.005,***P<0.0005

PAGE 128

Figure37.RoleofNPRCknockdownonAHNAK1subcellular localizationin3T3-L1preadipocytes.A:Sucrosegradient ifi li f h li f AA 1 i centr if ugat i onana l ys i so f t h etrans l ocat i ono f A HN AK 1 prote i n inresponsetoNPRCknockdown.B:Densitometricanalysisof (A).NPRAwasprobedforasamembranemarker,laminA/C wasprobedforasanuclearmarker,andGAPDHwasprobedfor asacytoplasmicmarker.Blotsarerepresentativeofatleast threesimilarindependentexperiments.InpanelA,mockrefers to the use of nontargeting siRNAs instead of NPRC SMART to the use of nontargeting siRNAs instead of NPRC SMART poolsiRNAs.POSITIVEreferstopositivecontrolconsistingof wholecelllysatebeforesubcellularfractionationofthelysate. Studentst-testwasusedtocomparetwogroups.Here,by convention*P<0.05,**P<0.005,***P<0.0005

PAGE 129

Chapter 3: Role of NPRC in Signal Transduction

PAGE 130

Background As demonstrated in the previous ch apter, NPRC associates with AHNAK1 in various cell types. Both proteins are know n to activate specific isoforms of PLC, as described earlier. Although AHNAK1 has b een implicated in calcium signaling, its ability to associate w ith and modulate various proteins directly involved in maintaining calcium homeostasis is dependent on AHNAK1s recruitment/t ranslocation to the plasma membrane. Therefore, the hypothesis is NPRC recruits and anchors AHNAK1 to the plasma membrane, where AHNAK1 serves as a receptor for AA and binds to and activates PLC 1. Accordingly, a system to monitor tr ansient changes in the second messenger downstream of the PLC signali ng cascade, intracellular Ca2+, was employed to test this hypothesis. After demonstrati ng a functional system to meas ure small real time changes in intracellular Ca2+ mobilization in live cells, the physio logical role and significance of the association between NPRC and AHNAK1 was investigated in situ Furthermore, functional implications from the intracellular Ca2+ mobilization mediated by the association between NPRC and AHNAK1 were proposed for each cell type investigated.

PAGE 131

Materials and Methods Reagents and antibodies In addition to the reagents and antibodies mentioned in the previous chapters, the following reagents and antibodies were purch ased or acqueired as described. Glass bottom culture dishes were purchased from MatTek (Ashland, MA). All other cell culture plasticware was purchased from Nalg e Nunc (Rochester, NY). Fluo-3 AM dye was purchased from Molecular Probes (Eugene, OR) All other chemicals were purchased from Sigma (St. Louis, MO) unless otherwise noted. G i antibody was kindly provided by Dr. Dave Manning (University of Pennsylvania, Philadelphia, PA), NPRA and NPRB polyclonal antibodies were kindly provided by Dr. David L Garbers, University of Texas Southwestern, Dallas, TX), PLC 3, PLC 1, PLC 2, GAPDH, Lamin A/C, and PPAR antibodies were purchased from Cell Signaling Technology (Danvers, MA). Cell lines and cell culture In addition to the cell lines mentioned in the previous chapters, the 3T3-L1 cell line was purchased from the American Type Culture Collection (Manassas, VA). All other cell culture media, antibiotic/antimycotic, and calcium-free Hank's balanced salt solution (HBSS) were purchased from GIBCO Invitrogen (Grand Island, NY). Only low passage cells were used for experiments.

PAGE 132

3T3-L1 preadipocyte differentiation 3T3-L1 preadipocytes were cultured in high glucose DMEM Medium supplemented with 10% Newborn Calf Serum (NCS) (Sigma) and maintained at 37 C in a 10% CO2 humidified atmosphere. At confluen cy, 3T3-L1 preadipocytes were treated with 10 g/mL insulin, 0.25 M dexamethasone, and 0.5 mM 3-isobutyl-1methylxanthine (IBMX), cultured in high glucose DMEM Medium supplemented with 10% FBS and maintained at 37 C in a 10% CO2 humidified atmosphere. Culture medium was replaced 48 hrs after differentia tion with fresh culture medium containing insulin and supplemented with 10% FBS. Cu lture medium was replaced every 48 hrs thereafter with fresh culture medium supplemented with 10% FBS Oil Red O Staining 3T3-L1 cells cultured to 70% confluency on chamber slides were fixed with 10% formalin in PBS, washed with 1X PBS, and stained for 1 hr at room temperature (RT) with 0.15% Oil Red O (60:40 mix of isopropanol and water). Slides were evaluated microscopically for the accumulation of lipid droplets. SDS-PAGE, Western blotti ng, and Densitometric analyses SDS-PAGE and Western blotting was perf ormed as described in Chapter 1, but with the following modifications. Briefly, twenty five g of protein was separated by electrophoresis for 8 hours at 25 V on 7.5% gr adient polyacrylamide gels. Separated proteins were electrically transferred onto Hybond-C extra nitrocellulose membranes for 75 minutes at 100 V in Towbin buffer. Transf erred proteins were stained with Ponceau

PAGE 133

solution to confirm the transfer of the bands, destained with 1X TBS, and then blocked in 5% (w/v) nonfat powdered milk in 1X TBS at RT for 1 hour. Membranes were washed with 1X TBS and then incubated with an ti-AHNAK1 or anti-NPRB antibody at a dilution of 1:500, or anti-NPRA antibody at a dilution of 1:4000, or anti NPRC, G i, PLC 3, PLC 1, PLC 2, GAPDH, Lamin A/C at a dilution of 1:1000 in 5% BSA in TBS at 4C overnight. Membranes were washed with 1X TBS and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody (BioRad) at a dilution of 1:3000 in blocking solution at RT fo r 60 minutes. Immunoreactive bands were detected by SuperSignal West Pico chem iluminescent substrate according to the manufactures instructions and developed us ing Hyperfilm-ECL. As a loading control, membranes were probed for -actin at a dilution of 1:10000. Densitometric analysis was performed as described in th e previous chapter. Confocal fluorescence imaging and measurement of Intracellular Calcium Cells were cultured in complete growth media (containing calcium and FBS or NCS) in 35mm glass bottom culture dishes. At 70% confluency, cells were made quiescent by serum deprivation for 6 hrs. Cells were washed with calcium-free HBSS, loaded with the calcium-sensitive Fluo-3 AM dye at a final concentration of 10 M in extracellular solution (complete growth media) and incubated at 37 C for 20 minutes. Cells were washed with calcium-free HBSS and returned to extracellular solution (complete growth media unless otherwise no ted) for 10 minutes to allow for deesterification of the dye. A confocal imagi ng system (Leica) equipped with an inverted microscope, an Argon 488 laser, and a 63 X 1.4NA objective lens was used to record

PAGE 134

calcium fluorescence at RT. The excitation wavelength of the laser was set at 488 nm and the emission wavelength for monitoring fluorescence was set at 520-580nm. Images were acquired at a rate of 1 frame every 2.5 seconds and recorded with LASAF software. A field of at least 12 cells was chosen and focused in differential interference contrast (DIC) mode. After measuring base line fluorescence for 2 minutes, 100 l of vehicle was added directly to the extracellular solution and fluorescence intensity was measured for an additional 2 minutes. Thereafter, 100 l of the test agent wa s added and fluorescence intensity was measured for 2 minutes. Cells were then stimulated with 10 M ionomycin to confirm equivalent loading. Sucrose density gradient centrifugation Confluent 3T3-L1 cells were harvested from 100 mm tissue culture dishes for protein in TES buffer (20 mM Tris HC l pH 7.4, 1 mM EDTA, 255 mM sucrose) supplemented with protease inhibitors. The protein lysate was su bjected to moderate sonication and then centrifuged at 17 000 X g for 45 min at 4 C. The supernatant was collected and contained the cytosolic fraction. The pellet was resuspended in 0.5 mL TES buffer and layered on 0.3 mL of a 1.12 M su crose cushion and then centrifuged at 250 000 X g for 30 min at 4 C in a TL 55 sw inging bucket rotor. The resulting supernatant layer was carefully removed a nd discarded. The intermediate layer was carefully collected and contained the membrane fraction. The bottom layer was then carefully removed and discarded. The pellet was resuspended in 100 l of TES buffer and contained the nuclear fraction. Each fraction was quantified by the BCA assay and

PAGE 135

subjected to SDS-PAGE and Western blot an alysis using specific subcellular marker antibodies. Transfection of siRNA and constructs 3T3-L1 cells were transfected with siGenome SMARTpool reagents (Dharmacon; Lafayette, CO) specific for mouse NPRC, AHNAK1, or nontargeting siRNA using DharmaFECT3 transfection reagent (Dharmac on; Lafayette, CO) according to the manufacturers instructions. The different si RNA used in various experiments are listed in Table 10. Cells were harvested 72 hr s after transfection a nd protein knockdown was determined by Western blot and densitometric analysis. 3T3-L1 cells were transfected with pBINDAHNAK1 using FuGENE 6 accordi ng to the manufactures instructions. Cells were harvested 72 hours af ter transfection. Transfection efficiency was assessed by performing luciferase assays according to the manufactures instructions. Statistics Results are expressed as the mean SD. Repeated measures ANOVA was conducted for confocal microscopy experiment s. Statistical significance was set at p <0.05

PAGE 136

Results Optimization of a system to measure intracellular Ca2+ mobilization in situ Endothelin-1 (ET-1) is one of the most potent endogenous vasoconstricting agents known [375] and is also known to bind to its receptors on vascular smooth muscle cells (VSMCs) and subsequently raise the intracellular free Ca2+ concentration ([Ca2+]i) [376]. Since A-10 VSMCs have been reported to respond to ET-1 treatment with a rapid and transient increase in intracellular Ca2+ [377], this system was used in parallel to optimize a system to monitor realtime changes in intracellular Ca2+ mobilization of Fluo-3 loaded cells by confocal microscopy. The addition of 1 M of ET-1 to quiescent A-10 VSMCs stimulated a rapid and transient increase in intracellular Ca2+ compared to background fluorescence, as shown in Figure 38. There was between a two-fold to three-fold increase in intracellular Ca2+ of the eight randomly selected cells, when compared to baseline fluorescence and after normalizing to bac kground fluorescence. An increase in intracellular Ca2+ is observed in AoSMCs in response to exogenous AA Next, the human equivalent to the ra t A-10 VSMC line, the AoSMC line, was used to investigate the effect of exogenous AA on intracellular Ca2+ mobilization. Quiescent AoSMCs failed to respond to 1 M exogenous AA (Figure 39), but did respond with a four to ten-fold increase in in tracellular Ca2+ in response to 10 M ionomycin in the presence of extracellular Ca2+ (Figure 40). Quiescent AoSMCs also responded with approximately a threefold increase in intracellular Ca2+ in response to 25 M AA, and subsequently responded to ionomycin treatment in the presence of extracellular Ca2+ (Figure 40A,B).

PAGE 137

Calcium is released from intracellular Ca2+ stores in response to AA in AoSMCs or 3T3L1 cells In order to determine if the source of increase of intracellular Ca2+ in AoSMCs was from the release of Ca2+ from intracellular Ca2+ stores or an influx of extracellular Ca2+, AoSMCs were stimulated with 25 M AA in the absence of extracellular Ca2+ and changes in intracellular Ca2+ were monitored over time. The exclusion of Ca2+ from the extracellular medium did not affect the increase in intracellular Ca2+ in response 25 M AA, as shown in Figure 41. In order to confirm the souce of increase in intracellular Ca2+ was from intracellular Ca2+ stores, AoSMCs were stimulated with 1 M of Thapsigargin (TG), then ionomycin (Figure 42), and follo wed by AA and PMA (data not recorded). TG stimulation inhibited the AA or PM A induced release of intracellular Ca2+ increase. Effect on intracellular Ca2+ in AoSMCs in response to increasing concentration of exogenous AA The fold increase in intracellular Ca2+ in quiescent AoSMCs did not quadruple after quadrupling the concentration of exogenous AA. Only a moderate increase in intracellular Ca2+ in AoSMCs was observed after increasing the concentration of exogenous AA from 25 M to 100 M (Figures 40 and 43). Interestingly, the response to the same concentration of ionomycin was significantly decreased after increasing the concentration of exogenous AA from 25 M to 100 M (Figures 40 and 43).

PAGE 138

Effect on intracellular Ca2+ in AoSMCs in response to PMA Since PMA has previously been sh own to increase intracellular Ca2+ in NIH 3T3 cells, the abilty of PMA to induce an increase in intracellular Ca2+ was evaluated in AoSMCs. As shown in Figure 44, PMA was able to stimulate an increase in intracellular Ca2+ in AoSMCs. Addition of cANF fails to indu ce an increase in intracellular Ca2+ in AoSMCs Since NPRC activation is known to activate PLC 3, the ability of NPRC activation by ligand binding to elicit an increase in intracellular Ca2+ in AoSMCs was investigated. The addition of 1 M of th e specific NPRC agonist cANF to quiescent AoSMCS did not result in any appreciable increase in intracellular Ca2+, but the same cells later responded to 10 M ionomycin (Figure 45). Effect on intracellular Ca2+ in 3T3-L1 preadipocytes in response to AA or PMA Because AoSMCs could not easily be transfected with various expression constructs or siRNAs, the 3T3-L1 cell line was used to a ssess the physiological significance and role of the association between NPRC and AHNAK1 in mediating the increases in intracellular Ca2+ in response to AA or PMA. 3T3-L1 preadipocytes responded with an increas e in intracellular Ca2+ in response to exogenous AA (Figure 46 and 47).

PAGE 139

Calcium is released from intracellular Ca2+ stores in response to AA in 3T3-L1 cells In order to determine if the sour ce of increase of intracellular Ca2+ in 3T3-L1 preadipocytes was from the release of Ca2+ from intracellular Ca2+ stores or an influx of extracellular Ca2+, 3T3-L1 preadipocytes were stimulated with 25 M AA in the absence of extracellular Ca2+ and changes in intracellular Ca2+ were monitored over time. The exclusion of Ca2+ from the extracellular medium di d not affect the increase in intracellular Ca2+ in response 25 M AA, as shown in Figure 48. In order to confirm the souce of increase in intracellular Ca2+ was from intracellular Ca2+ stores, 3T3-L1 preadipocytes were stimulated with 1 M of TG, then ionomycin (Figure 49), and followed by AA and PMA (data not recorded). TG stimulation inhibited the AA or PMA induced release of intracellular Ca2+ increase. Effect on intracellular Ca2+ in 3T3-L1 preadipocytes in response to PMA 3T3-L1 preadipocytes were used for assessing the physiological significance between NPRC and AHNAK1 because they are more similar to NIH 3T3 cells and can be transfected with better efficiency than differentiated 3T-L1 adipocytes. Accordingly, an increase in intracellular Ca2+ was observed in 3T3-L1 pread ipocytes in response to PMA in a dose dependent manner (Figures 50, 51). siRNA mediated knockdown of NPRC results in attenuation of the observed increase in intracellular Ca2+ in response to PMA The role of NPRC in potentiating the AHNAK1 mediated AA-dependent intracellular Ca2+ mobilization was demonstrated by siRNA mediated knockdown of

PAGE 140

NPRC in 3T3-L1 preadipocytes. A statistically significant decrease in intracellular Ca2+ in response to 25 M PMA was observed for cells transfected with siRNA targeting NPRC compared to untreated cells (Figures 52 and 59). Overexpression of an AHNAK1 construct re sults in augmentation of the observed increase in intracellular Ca2+ in response to PMA In order to demonstrate a role for AHNAK1 for the increase in intracellular Ca2+ observed in 3T3-L1 preadipocytes and to s how the response was not exclusively from PMA or AA, an AHNAK1 construct was created and transfected into 3T3-L1 preadipocytes (Appendix D-F, I-M). The AHNAK1 construct, pBIND-AHNAK1, consisted of the carboxy terminal domain of AHNAK1 and several repeating segments of AHANK, and the vector itsel f coded for luciferse, which was used to monitor transfection effeciency. A statistically significant augmentation of the increase in intracellular Ca2+ in response to PMA was observed in 3T3-L1 preadipoc ytes transfected with the pBIND-AHNAK1 construct compared to untreated preadipocytes (Figures 53 and 54). siRNA mediated knockdown of AHNAK1 result s in attenuation of the observed increase in intracellular Ca2+in response to PMA The role of AHNAK1 in mediating the AA-dependent intracellular Ca2+ mobilization was further corroborated by siRNA mediated knockdown of AHNAK1 in 3T3-L1 preadipocytes. A statistically si gnificant decreases in intracellular Ca2+ in

PAGE 141

response to 25 M PMA was observed for cells transfected with siRNA targeting AHNAK1 compared to untreated cells (Figures 55, 56, and 59). cPLA2 is required for the AHNAK1 mediated intracellular Ca2+ mobilization in 3T3-L1 cells In order to show the increases in intracellular Ca2+ were a result of endogenous AA released in response to PMA, 3T3-L1 preadipocytes were pr etreated with the specific cPLA2 inhibitor AACOCF3 for 5 minutes. Afterw ards, the cells were stimulated with 25 M PMA. A significant attenuation in th e response to PMA was observed when cells pretreated with AACOCF3 (Figures 57, 59) we re compared to untreated cells (Figures 50, 59). Addition of cANF fails to induce an increase in intracellular Ca2+ in 3T3-L1 preadipocytes Since NPRC activation is known to activate PLC 3, the ability of NPRC activation by ligand binding to elic it an increase in intracellular Ca2+ in 3T3-L1 preadipocytes was investigated. The additi on of 1 M of the specific NPRC agonist cANF to quiescent 3T3-L1 preadipocytes did not result in any appreciable increase in intracellular Ca2+, but the same cells later responded to 10 M ionomycin (Figure 58).

PAGE 142

AHNAK1 translocates to the plasma membrane in response to an increase in extracellular Ca2+ Since AHNAK1s ability to execute Ca2+ signaling is determined by its presence at the plasma membrane, the translocation of AHNAK1 from the nucleus to the plasma membrane was investigated in 3T3-L1 pr eadipocytes. The switching of 3T3-L1 preadipocytes from medium containing normal Ca2+ to high Ca2+ resulted in AHNAK1 in less AHNAK1 present in the nucleus, as s hown by subcellular fraction studies, and subsequent Western blot and densitometric an alysis (Figure 61A,B). Accordingly, the translocation of AHNAK1 to th e cytoplasm and plasma memb rane resulted in abrogation of the increase in intracellular Ca2+ in response to PMA stimul ation (Figure 62).

PAGE 143

Discussion The role of NPRC in mediating AHNAK1 calcium signaling in the presence of AA was investigated in AoSMCs and in 3T3L1 preadipocytes. Th e roles of NPRC and AHNAK1 in the presence of exogenous AA or through PMA induced release of endogenous AA from lipid bilayers was investig ated by monitoring real time changes in intracellular Ca2+ mobilization in live fluo-3 loaded quiescent cells. The roles of NPRC and AHNAK1 in intracellular Ca2+ mobilization were corroborated by siRNA mediated knockdown of each protein or by overexpression of an AHNAK1 construct. Moreover, subcellular fraction studies demonstrated NPRC plays a role in determining the subcellular localization of AHNAK1 protein. The 3T3-L1 cell line is an excellent model for the study of adipogenesis at the cellular level [343-345]. The re sults presented here suggest a functional role for NPRC and AHNAK1 in the regulation of mouse adipogenesis. Interstingly, NPRC and AHNAK1 protein expression was shown to be inversely proportional during differentiation of 3T3-L1 preadipocytes in to mature adipocytes. However, the coexpression of NPRC and AHNAK1 proteins in the early st ages of differentitaon may suggest a role for the association be tween NPRC and AHNAK1 in promoting adipogenesis. Interestingly, the role of intracellular Ca2+ in 3T3-L1 preadipocytes has been investigated by other gr oups. For example, increasing levels of intracellular Ca2+ were reported to have an inhib itory effect in the early stages of differentiation of 3T3-L1 preadipocytes into adipocytes [378]. Nt ambi and Takova demonstrated that Ca2+ mobilization repressed the synthesis of an intermediate involved in DNA replication to prevent the expression of transc ription factors required for di fferentiation [378]. A report

PAGE 144

by Jensen et al. provided evidence for high [Ca2+]e attenuating adipogeneis in 3T3-L1 preadipocytes [379]. Jensen et al. reported the direct role of [Ca2+]e in attenuating adipogenesis in 3T3-L1 preadipocytes was in part the result of i nhibition of the C/EBP and PPAR 2 transcription factors [379] Both transcription fact ors have been shown in other reports to positively modulate adipogeni c gene transcription [380, 381]. This group also observed that increases in [Ca2+]e also interfered with th e normal down-regulation of the transcription factor Pref-1, which is downregulated in differentiated 3T3-L1 preadipocytes and overexpressed in undifferentiated 3T3-L1 pr eadipocytes [381]. Jensen et al provided compelling evidence that demons trated calcium specifically inhibited differentiation by showing in parallel experiments that the divalent cation MgCl2 used to offset the changes in osmolarity associated with the use of CaCl2 did not inhibit 3T3-L1 differentiation [379]. Consistent with the findings of both Ntambi and Takova [378] and Jensen et al. [379] AHNAK1 translocation to the pl asma membrane in response to elevated levels of extracellular calcium result ed in augmentation of intracellular calicum mobilization with the addition of PMA in 3T3-L1 preadipocytes (Figure 62). Taken together, the results presented here may suggest the association between NPRC and AHNAK1 could have an inhibitory effect in the early stages of differentiation of mouse preadipocytes into mature adipocytes. Howe ver, additional studies that actually monitor markers of differentiation, such as PPAR expression or the accumulation of lipid droplets would be necessary to as certain this theory. Several groups have re ported increases in [Ca2+]e modulate cell proliferation of various cell types [382-385]. As previously mentioned, calcium plays an important role in cell survival and death. Chronic elevated levels of intracellular calicum are toxic to

PAGE 145

various cell types. In accord ance with findings from Jensen et al. increasing [Ca2+]e by itself did not chronically elevate [Ca2+]i as there was no significant change in Ca2+ released from intracellular stores after TG treatment [379]. Also, similar to findings from Jensen et al. ., increasing the levels of extracellula r calcium did not affect cell number or viability according to trypan blue staining. Interestingly, Jensen et al presented data that showed elevated levels of [Ca2+]e did not acutely or chronically impact [Ca2+]i in 3T3-L1 preadipocytes [379]. This finding is in co ntrast to the finding presented here for the translocation of AHNAK1 to the pl asma membrane upon increases in [Ca2+]e. However, the AHNAK1 induced mobilization of [Ca2+]i is dependent on AA or PMA mediated release of AA, which was not tested in the study by Jensen et al. [379]. Intracellular Ca2+ was reported to exert a biphasi c regulatory role in human adipocyte differentiation and lipid filling, as increasing levels of intracellular Ca2+ were found to inhibit differentiation and lipid filling in the early stages and promotion of differentiation and lipid filling in the late stages of human adipocyte differentiation [386] Up to 48 hours of differentiation of human adipocyte differentiation, Shi et al. showed increasing Ca2+ causes a significant inhibition in PPAR expression, but during 48 to 72 hours of human adipocyte differentiation increasing Ca2+ causes a significant increase in PPAR expression [386]. PPAR expression was proposed to directly induce late differentiation gene expression, including that of fatty acid synthase (FAS), steroyl-CoA desaturase (SCD-1), and phosphoenol-p yruvate carboxykinase (PEPCK) [386]. Moreover, Shi et al. proposed intracellular Ca2+ may work synergistically with various differentiation transcriptional factors to stim ulate late differentiation gene expression [386]. In other reports, in creases in intracellular Ca2+ from the stimulation of voltage-

PAGE 146

mediated calcium channels were found to promote triglyceride accumulation in mouse and human adipocytes by stimulating lipogene sis and suppressing lipolysis [304, 387]. The increases in intracellular Ca2+ were found to induce the e xpression and activity of FAS and inhibit both basal and agonist-stimulated lipolysis in mouse and human adipocytes [387]. Taken together, the numerous reports in the literature describing the role for [Ca2+]i or [Ca2+]e in modulating rodent or human adipocyte differentiation are largely limited to the in vitro state. Additional in vivo studies should be performed to demonstrate the role of [Ca2+]i or [Ca2+]e levels in body fat accumulation and its link to associated diseases. TG (Tg), an endoplasmic reticulum Ca2+ ATPase inhibitor is a useful means to test various Ca2+ dependent intracellular functions since it rapidly elevates [Ca2+]I. Tg was used to test the source of increase in [Ca2+]I in response to AA or PMA in 3T3-L1 preadipocytes transfected with NPRC or AH NAK1 specific siRNA. After depleting intracellular calcium stores with Tg, the addition of exogenous AA to 3T3-L1 preadipocytes or AoSMC failed to elicit an increase in [Ca2+]I, suggesting the source of increase in [Ca2+]I was from release of Ca2+ from intracellular stores and not an influx of Ca2+ from the extracellular solution. Simila rly, the addition of exogenous AA to either 3T3-L1 preadipocytes or AoSMC resulted in a ra pid and transient increase in intracellular calcium in cells cultured in the presence or absence of calcium in the extracellular medium, further suggesting the source of increase was from the release of Ca2+ from intracellular stores. The association between NPRC and AHNAK1 in human AoSMCs and the

PAGE 147

observed increase in intracellular Ca2+ in response to AA or PMA seen in human AoSMCs may also have implications for vascul ar diseases attributed to vascular smooth muscle cell proliferation, migr ation, and apoptosis. Also, it is well established that intracellular calcium mobilization is crucia l for VSMC contractility. Vascular smooth muscle contraction is triggered by an increase in intracellular Ca2+ concentration [388]. The accepted mechanism for VSMC contractility in cludes a series of steps, which begins with Ca2+ binding to calmodulin (CaM) to form the Ca2+-CaM complex. The Ca2+-CaM complex binds to and activates myosin light chain kinase (MLCK). The activated MLCK then catalyzes the phosphorylation of the re gulatory myosin light chain (MLC), which triggers myosin-actin interaction, leading to the shortening of muscle and generation of force. The decrease in intracellular Ca2+ results in the dephosphorylation of myosin by myosin phosphatase, resulting in muscle relaxa tion [389]. Furthermore, it was reported that smooth muscle contra ction is regulated by Ca2+ sensitization, suggesting Ca2+ dependent contractions may occur at lower Ca2+ concentration than expected [390]. Ca2+ sensitization may result in an increase in ML C phosphorylation due to reduced activity of myosin phosphatase. A major pathway for smooth muscle contraction involves an increase in intracellular Ca2+ from the opening of voltage-dependent L-type Ca2+ channels in response to membrane depolar ization through high concentrations of extracellular K+ [391]. Another major pathway for smooth muscle contraction involves an increase in intracellular Ca2+ from release of Ca2+ from intracellular calcium stores after G-protein coupled activ ation of PLC in response to various agonist [391]. Accordingly, hypercontraction is known to cause vascular diseases including increased systemic blood pressure, acute vasospasm, an d microcirculatory ischemia [392-394].

PAGE 148

Therefore, abnormal VSMC contractility may contribute to abnorma l vascular tone and disorders of blood pressure regulati on, including hype rtension [395]. The ratiometric indicators, low-affinity indicators, long-wavelength indicators, and indicator-dextran conjugates are among the various different types of fluorescent Ca2+ indicators currently available. Fura -2 and indo-1 are the most widely used ratiometric indicators and both require ultr aviolet excitation. Ra tiometric indicators produce an excitation or emission spect ral shift upon ion binding and allows for calibration of the ratio of fluorescence intensit ies measured at two different wavelengths. The excitation of these probes only by UV light results in significantly less interference than fluorescent compounds excited by visi ble wavelength. Ratiometric indicators prevent variations from artifacts including photobl eaching, non-uniform loading of the indicator, and variable cell thickness, whic h would contribute to misinterpretation in changes of Ca2+ concentrations. Low-affinity indicators are useful for detecting intracellular Ca2+ levels in the micromolar range. Lowaffinity indicators have faster ion dissociation rates to allow for the ability to better track rapid Ca2+ flux kinetics. Longwavelength indicators are useful for photoa ctivateable caged probes, and argon-ion laser-based confocal microscopes and flow cytometers. Examples of long-wavelength indicators include fluo-3, fluo4, rhod-2, and x-rhod-1, and the fura-2 analog fura-red Dextran-linked indicators are conjugated to water-soluble dextrans and exhibit long-term intracellular retention and little vacuolar sequestration. De xtran-linked indicators are particularly useful for measuring Ca2+ concentrations in plant and fungal cells. There are several selection criteria for calcium indicators including the mode of measurement, dissociation constant (Kd), and the form of the indicator. The mode of measurement is

PAGE 149

determined by whether qualitative or quantitativ e ion concentration da ta is desired. The Kd is determined by the Ca2+ concentration range of interest. The form of the indicator is determined by the method of cell loading and the requirements for intracellular distribution and retention of th e indicator. Indicators are av ailable in salt, acetoxymethyl (AM) ester or dextran form. Some fluores cent indicators are cell impermeant, while others are derivatized with an AM that is cell permeable. The AM form of the fluorescent indicator is designed to passively diffuse across cell membranes to inside the cell, where esterases cleave off the AM gr oup leading to a cell-impermeant indicator [396]. Furthermore, the final intrace llular concentration of the hydrolyzed Ca2+ indicator is dependent on factors including the concentr ation and type of indicator, number and type of cells loaded, and loadi ng time and temperature [396]. The Ca2+-sensitive fluorescent indicator fluo-3 was chosen to measure intracellular Ca2+ in situ Fluo-3 is a newer generation of fluorescent Ca2+ indicator dyes that offers several advantages. Potentia l problems with fluores cent indicators include compartmentalization, intracellular bufferi ng, autofluorescence, autofluorescence, and cytotoxicity. Fluo-3 has a higher Kd to allow for more sensitive measurements at higher [Ca2+]i in stimulated cells, and has a higher quan tum yield to allow for measurement of [Ca2+]i at lower cytosolic concentrations of the dye. Ca2+ indicators such as fluo-3 have been widely used to monitor transient increases in intracellular Ca2+ due to Ca2+ release from intracellular stores through IP3 receptors [397-400]. Fluo 3 is especially useful for monitoring small changes in Ca2+ inside the cell and results in a fluorescence intensity increase of approximately 200 times when bound to calcium co mpared to unbound dye [401]. Confocal microsc opy is often utilized to investigate localized Ca2+ fluorescence

PAGE 150

events due to its small depth of field, which minimizes the accumulation of out-of-focus light [402]. The ability to mon itor changes in intracellular Ca2+ in real-time in live fluo-3 labeled cells by confocal microscopy allo ws for collection and interpretation of physiologically relevant data. Although millions of cells were cultured in glass bottom tissue culture dishes for these experiment s, under 63X magnificati on, a typical field consist of between 8-12 3T3-L1 preadipoc yte cells and between 6-10 human AoSMCs under subconfluent conditions. Cells were synchronized, or made quiescent prior to imaging or the addition of any test agent by serum deprivation for 6 hours. Thereafter, the cells were loaded with the calcium i ndicator fluo-3 at 37 C, washed, and then returned to completed growth medium and incubated at 37 C to allow for deesterification of the dye. The cells were then allowed to equilibrate at room temperature prior to real time confocal imag ing performed at room temperature. Cells were observed and focused in differential in terference contrast mode, while changes in fluorescent intensities were measured in response to various agents. In order to eliminate the possibility of the vehicle eliciting the observed effect, a short baseline was established, the vehicle itself was added directly to the cells, and the cells were monitored for 2 minutes. In each case, the vehicle, either DMSO diluted in HBSS without calcium or oxygen de pleted water failed to elic it a response. Thereafter, the test agent was added directly to the cell s and another short base line was established before the addition of ionomycin, which serv ed as a loading control. Changes in intracellular Ca2+ were monitored in real time and imag es were collected at a rate of no faster than 1 frame/second to prevent photobleaching. The fluorescence intensity, measured in arbitrary units, in response to the test agent was normalized to the

PAGE 151

background fluorescence. In order to compensa te for fluctuations due to focusing, data from every 25 time points were analyzed and the mean fluorescence of at least 8 independent cells were plotted as a f unction of time. Several factors were taken into consider ation prior to the transfection of plasmid DNA into eukaryotic cells, in order to mini mize the possibility of disrupting cellular mechanisms and increase the abil ity to generate phys iologically relevant data and achieve high transfection efficiency. Endotoxins are known to redu ce transfection efficiency and subsequent protein expression le vels. The levels of endotoxins that are released during the cell lysis step of plasmi d preparation may vary in bact erial lysates. Endotoxin-free plasmid preparation kits were utlilzed to minimize the presence of endotoxins when transfecting plasmid DNA into mammalian ce lls. Cytotoxicity, a measurement of cell death was monitored during the transfection of mammalian cells. In addition to carefully selecting a transfection reagent characteristic of possessing low cytoxi city, the quantity of transfection reagent used was kept to a mi nimum. Off-target effects may include unintended up-regulation or down-regulation of genes within transfected cells. Of the various transfection reagents used (Appendix O), the nonliposomal transfection reagent FuGENE6 provided the highest transfecti on efficiency of pBINDAHNAK1 into 3T3L1 cells. The use of FuGENE6 also allo wed for convenient delivery of the plasmid DNA, as it is highly efficient both in the pr esence and absence of serum and reduced the amount of time and effort by eliminating many handling steps. Because most DNA transfection reagents are incompatible with siRNA, DharmaFECT transfection reagent was used to transfect a p ool of siRNAs into 3T3-L1 and RGM1 cells.

PAGE 152

For either transient transfection of plasmid DNA or siRNA, transfection efficiency was determined by fluorescent micr oscopy and Western blot and densitometric analysis. To allow the cells to incorporate and process the plasmid DNA or siRNA, transfection efficiency was assessed betw een 48 and 72 hours after transfection. Since the pBINDAHNAK1 construct codes for a luciferase gene, transfection efficiency of pBINDAHANK was also assesse d by performing luciferase assays. Transfection reactions of plasmid DNA or siRNA were performed in the absence of antibiotic and antimycotic, as preliminary optimization experi ments demonstrated the presence of either antibiotic or antimycotic significant reduced transfection efficiency. Due to AHNAK1s extraordinary large size, a portion cont aining the carboxy terminal domain and several repeating units were used to create a fusion protein for transient transfection into mammalian cel ls. The truncated AHNAK1 protein was subcloned into a pACT and pBIND v ector to generate a VP16AHNAK1 or pACTAHNAK1 and GAL4AHNAK1 or pB INDAHNAK1. The desired AHNAK1 portion was subcloned into both the empty pACT and pBIND vectors because some constructs may demonstrate directionality depending on the insert. Although mice completely lacking AHNAK1 do not appear to show a change in cardiac function, it is possible AHNAK2 may compensate for the deficiency in AHNAK1 production. Future studies using mouse em bryonic fibroblasts deficient in AHNAK1, AHNAK2, and both AHNAKs will be necessary to determine the functional role and phenotype of AHNAK1 disregulation. Furthe rmore, there are no alternative spliced variants of AHNAK1, since AHNAK1 is enco ded by an intronless gene. The AHNAKs contain distinct features that allow them to function as multipurpose scaffolding proteins.

PAGE 153

AHNAK1 contains a PI3 kinase-related regu latory site, while AHNAK2 contains a PDZ domain, and both AHNAKs contain multiple hi ghly conserved repeating units [217]. Another attribute of the AHNAKs that may a llow them to function as scaffolding proteins is their ability to translocate from the nucleus to the plasma membrane of the cell upon various stimuli and posttranslation modifica tion (e.g. phosphorylation). Table 4. Sequences for siRNAs used in various experiments Target Sequence Mouse NPR3 UGGACGACAUAGUGCGCUA Mouse NPR3 AGCACAAGGACACGGAAUA Mouse NPR3 CAAGCUAAACUAAGCGUAU Mouse NPR3 GGUCUACAGCGACGACAAA Mouse AHNAK1 GUGCCACCAUCUACUUUGA Mouse AHNAK1 CCGUAG CUCUGAAGUGGUU Mouse AHNAK1 GAAGUUG CACCGUAAAGGG Mouse AHNAK1 UGACCC AGUUGCUGAAUAC Individually listed ON-TARGETplus set of si RNA reagents. NPR3 represents NPRC. DharmaFECT 1 or DharmaFECT 3 transfection regents were used to deliver siRNA into cells.

PAGE 154

ET-1 Figure38.ResponsetoET-1inA-10VSMCs.A:Tracesfrom eightrandomlyselectedcellsrespondto1MET-1witha id d i i i illl C 2 + h i rap id an d trans i ent i ncrease i n i ntrace ll u l a r C a 2 + .T h etrans i ent increaseinintracellularCa2+wasmeasuredbyplottingthe meanfluorescenceintensityasafunctionoftime(sec)andwas comparedtobackgroundfluorescence(greentrace).B:The actualcellsshowninthetracesinpanelAareoutlinedinpanel B,withthegreensquarerepresentingbackgroundfluorescence.

PAGE 155

Figure39.IntracellularCa2+mobilizationinquiescentAoSMC inresponseto1MAA.Superimposedtracesshowingfluo3fluorescenceplottedasafunctionoftime,inwhicheach colortracerepresentsanindividualcell.AoSMCpre-loaded withFluo-3AMwerestimulatedwithvehicle(Veh)andthen arachidonicacid(AA)inthepresenceofextracellularCa2+. Fluorescentintensitywascomparedtobackground fluorescence.

PAGE 156

Figure40.IntracellularCa2+mobilizationinquiescentAoSMCinresponseto 25MAA.A:Superimposedtracesshowingfluo-3fluorescenceplottedasa functionoftime,inwhicheachcolortracerepresentsanindividualcell.B: Linegraphshowingfluo-3fluorescenceintensityplottedasafunctionoftime f iht ll i hih 25 ti it f i td t 1 f o r e i g ht ce ll s, i nw hi c h every 25 ti me p o i n t s f ro m i magescap t ure d a t 1 frame/secondwereplottedasmean+/-SEasafunctionoftime.AoSMCpreloadedwithFluo-3AMwerestimulatedwithVeh,AA,andthenionomycin (Ion)inthepresenceofextracellularCa2+.Fluorescentintensitywas comparedtobackgroundfluorescence.

PAGE 157

Figure41.IntracellularCa2+mobilizationinquiescentAoSMCinresponse to25MAAincalciumfreemedium.A:Superimposedtracesshowing fluo-3fluorescenceplottedasafunctionoftime,inwhicheachcolortrace represents an individual cell B : Line graph showing fluo 3 fluorescence represents an individual cell B : Line graph showing fluo 3 fluorescence intensityplottedasafunctionoftimeforeightcells,inwhichevery25 timepointsfromimagescapturedat1frame/secondwereplottedas mean+/-SEasafunctionoftime.AoSMCpre-loadedwithFluo-3AM werestimulatedwithVeh,AA,andthenIonintheabsenceofextracellular Ca2+.Fluorescentintensitywascomparedtobackgroundfluorescence.

PAGE 158

Figure42.IntracellularCa2+mobilizationinquiescentAosmcin responseto1MTG.A:Superimposedtracesshowingfluo-3 fluorescenceplottedasafunctionoftime,inwhicheachcolortrace representsanindividualcell.B:Linegraphshowingfluo-3 fluorescenceintensit y p lottedasafunctionoftimefo r eigh t cells,in whichevery25timepointsfromimagescapturedat1frame/second wereplottedasmean+/-SEasafunctionoftime.AoSMCpre-loaded withFluo-3AMwerestimulatedwithVeh,thapsigargin(TG)andthen IonintheabsenceofextracellularCa2+.Fluorescentintensitywas comparedtobackgroundfluorescence.

PAGE 159

Figure43.IntracellularCa2+mobilizationinquiescentAoSMCinresponse to 100 M AA A : Superimposed traces showing fluo 3 fluorescence to 100 M AA A : Superimposed traces showing fluo 3 fluorescence plottedasafunctionoftime,inwhicheachcolortracerepresentsan individualcell.B:Linegraphshowingfluo-3fluorescenceintensity plottedasafunctionoftimeforeightcells,inwhichevery25timepoints fromimagescapturedat1frame/secondwereplottedasmean+/-SEasa functionoftime.AoSMCpre-loadedwithFluo-3AMwerestimulated withVeh,AA,andthenIoninthepresenceofextracellularCa2+. Fluorescentintensitywascomparedtobackgroundfluorescence.

PAGE 160

Figure44.IntracellularCa2+mobilizationinquiescentAoSMCin responseto25MPMA.A:Superimposedtracesshowingfluo-3 fluorescence plotted as a function of time in which each color trace fluorescence plotted as a function of time in which each color trace representsanindividualcell.B:Line graphshowingfluo-3fluorescence intensityplottedasafunctionoftimeforeightcells,inwhichevery25 timepointsfromimagescapturedat1frame/secondwereplottedas mean+/-SEasafunctionoftime.AoSMCpre-loadedwithFluo-3AM werestimulatedwithVeh,Phorbol12-myristate-13-acetate(PMA),and thenIoninthepresenceofextracellularCa2+.Fluorescentintensitywas comparedtobackgroundfluorescence.

PAGE 161

Figure45.IntracellularCa2+mobilizationinquiescentAoSMCin responseto1McANF.A:Superimposedtracesshowingfluo-3 fluorescence plotted as a function of time in which each color trace fluorescence plotted as a function of time in which each color trace representsanindividualcell.B:Line graphshowingfluo-3fluorescence intensityplottedasafunctionoftimeforeightcells,inwhichevery25 timepointsfromimagescapturedat1frame/secondwereplottedas mean+/-SEasafunctionoftime.3T3-L1preadipocytespre-loadedwith Fluo-3AMwerestimulatedwithVeh,des[Gln18,Ser19,Gly20,Leu21, Gly22]-ANP(4-23)-NH2(cANF),andthenIoninthepresenceof extracellularCa2+.Fluorescentintensitywascomparedtobackground fluorescence.

PAGE 162

AA AA Figure46.IntracellularCa2+mobilizationinquiescent3T3-L1 preadiocytesinresponseto100MAA.A:Superimposed tracesshowingfluo-3fluorescenceplottedasafunctionoftime, inwhicheachcolortracerepresentsanindividualcell.B:Line graphshowingfluo-3fluorescenceintensityplottedasa functionoftimeforeightcells,inwhichevery25timepoints from images captured at 1 frame/second were plotted as from images captured at 1 frame/second were plotted as mean+/-SEasafunctionoftime.3T3-L1preadipocytespreloadedwithFluo-3AMwerestimulatedwithVeh,AA,andthen IoninthepresenceofextracellularCa2+.Fluorescentintensity wascomparedtobackgroundfluorescence.

PAGE 163

Figure47.IntracellularCa2+mobilizationinquiescent3T3-L1 preadiocytesinresponseto25MAA.A:Superimposedtraces showingfluo-3fluorescenceplottedasafunctionoftime,inwhich eachcolortracerepresentsanindividualcell.B:Linegraphshowing fluo-3fluorescenceintensityplottedasafunctionoftimeforeight cells,inwhichevery25timepointsfromimagescapturedat1 frame/secondwere p lottedasmean+/-SEasafunctionoftime.3T3L1preadipocytespre-loadedw ithFluo-3AMwerestimulatedwith Veh,AA,andthenIoninthepresenceofextracellularCa2+. Fluorescentintensitywascomparedtobackgroundfluorescence.

PAGE 164

Figure48.IntracellularCa2+mobilizationinquiescent3T3-L1 preadiocytesinresponseto25MAAintheabsenceofextracellularCa2+. A:Superimposedtracesshowingfluo-3fluorescenceplottedasafunction oftime,inwhicheachcolortracerepresentsanindividualcell.B:Line graphshowingfluo-3fluorescenceintensityplottedasafunctionoftime foreightcells,inwhichevery25timepointsfromimagescapturedat1 f/d lttd +/ SE fti f ti 3 T 3 L 1 f rame / secon d were pl o tt e d asmean +/ SE asa f unc ti ono f ti me. 3 T 3 L 1 preadipocytespre-loadedwithFluo-3AMwerestimulatedwithVeh,AA, andthenIonntheabssenceofextracellularCa2+.Fluorescentintensity wascomparedtobackgroundfluorescence.

PAGE 165

Figure49.IntracellularCa2+mobilizationinquiescent3T3-L1preadiocytes inresponseto1MTG.A:Superimposedtracesshowingfluo-3 fluorescenceplottedasafunctionoftime,inwhicheachcolortrace representsanindividualcell.B:Linegraphshowingfluo-3fluorescence intensity p lottedasafunctionoftimefo r eigh t cells,inwhichevery25time pointsfromimagescapturedat1frame/secondwereplottedasmean+/-SE asafunctionoftime.3T3-L1preadipocytespre-loadedwithFluo-3AM werestimulatedwithVeh,TGandthenIonintheabssenceofextracellular Ca2+.Fluorescentintensitywascomparedtobackgroundfluorescence.

PAGE 166

Figure50.IntracellularCa2+mobilizationinquiescent3T3-L1 preadiocytesinresponseto1MPMA.A:Superimposed tracesshowingfluo-3fluorescenceplottedasafunctionoftime, inwhicheachcolortracerepresentsanindividualcell.B:Line graphshowingfluo-3fluorescenceintensityplottedasa function of time for eight cells in which every 25 time points function of time for eight cells in which every 25 time points fromimagescapturedat1frame/secondwereplottedas mean+/-SEasafunctionoftime.3T3-L1preadipocytespreloadedwithFluo-3AMwerestimulatedwithVeh,PMA,and thenIoninthepresenceofextracellularCa2+.Fluorescent intensitywascomparedtobackgroundfluorescence.

PAGE 167

Figure51.IntracellularCa2+mobilizationinquiescent3T3-L1preadiocytes inresponseto25MPMA.A:Superimposedtracesshowingfluo-3 fluorescenceplottedasafunctionoftime,inwhicheachcolortrace representsanindividualcell.B:Linegraphshowingfluo-3fluorescence intensity plotted as a function of time for eight cells in which every 25 time intensity plotted as a function of time for eight cells in which every 25 time pointsfromimagescapturedat1frame/secondwereplottedasmean+/-SE asafunctionoftime.3T3-L1preadipocytespre-loadedwithFluo-3AM werestimulatedwithVeh,PMA,andthenIoninthepresenceof extracellularCa2+.Fluorescentintensitywascomparedtobackground fluorescence.

PAGE 168

Figure52.EffectofNPRCknockdownonintracellularCa2+mobilizationin quiescent3T3-L1preadiocytesinresponseto25MPMA.A: Superimposed traces showing fluo 3 fluorescence plotted as a function of Superimposed traces showing fluo 3 fluorescence plotted as a function of time,inwhicheachcolortracerepresentsanindividualcell.B:Linegraph showingfluo-3fluorescenceintensityplottedasafunctionoftimeforeight cells,inwhichevery25timepointsfromimagescapturedat1frame/second wereplottedasmean+/-SEasafunctionoftime.3T3-L1preadipocytes pre-loadedwithFluo-3AMwerestimulatedwithVeh,PMA,andthenIonin thepresenceofextracellularCa2+.Fluorescentintensitywascomparedto backgroundfluorescence.

PAGE 169

Figure53.EffectofoverexpressionofanpBINDAHNAK1constructon intracellularCa2+mobilizationinquiescent3T3-L1preadiocytesinresponse t 1 M PMA A Sid t hi fl 3 fl lttd t o 1 M PMA A : S uper i mpose d t racess h ow i ng fl uo3 fl uorescence pl o tt e d asafunctionoftime,inwhicheachcolortracerepresentsanindividualcell. B:Linegraphshowingfluo-3fluorescenceintensityplottedasafunctionof timeforeightcells,inwhichevery25timepointsfromimagescapturedat1 frame/secondwereplottedasmean+/-SEasafunctionoftime.3T3-L1 preadipocytespre-loadedwithFluo-3AMwerestimulatedwithVeh,PMA, andthenIoninthepresenceofextracellularCa2+.Fluorescentintensitywas com p aredto b ack g roundfluorescence. p g

PAGE 170

Figure54.EffectofoverexpressionofanpBINDAHNAK1constructon intracellula r Ca2+mobilizationinquiescen t 3T3-L1 p readiocytesinresponse to25MPMA.A:Superimposedtracesshowingfluo-3fluorescence plottedasafunctionoftime,inwhicheachcolortracerepresentsan individualcell.B:Linegraphshowingfluo-3fluorescenceintensityplotted asafunctionoftimeforeightcells,inwhichevery25timepointsfrom imagescapturedat1frame/secondwereplottedasmean+/-SEasafunction oftime.3T3-L1preadipocytespre-loadedwithFluo-3AMwerestimulated with Veh PMA and then Ion in the presence of extracellular Ca 2+ with Veh PMA and then Ion in the presence of extracellular Ca Fluorescentintensitywascomparedtobackgroundfluorescence.

PAGE 171

Figure55.EffectofAHNAK1knockdownonintracellularCa2+mobilizationinquiescent3T3-L1preadiocytesinresponseto25MPMA. A:Superimposedtracesshowingfluo-3fluorescenceplottedasafunction oftime,inwhicheachcolo r tracerepresentsanindividualcell.B:Line graphshowingfluo-3fluorescenceintensityplottedasafunctionoftimefor eightcells,inwhichevery25timepointsfromimagescapturedat1 frame/secondwereplottedasmean+/-SEasafunctionoftime.3T3-L1 preadipocytespre-loadedwithFluo-3AMwerestimulatedwithVeh,PMA, andthenIoninthepresenceofextracellularCa2+.Fluorescentintensitywas comparedtobackgroundfluorescence.

PAGE 172

Figure56.EffectofAHNAK1knockdownonintracellularCa2+mobilizationinquiescentday2differentiated3T3-L1preadipocytesin res p onseto25 MPMA.A:Su p erim p osedtracesshowin g fluo-3 p pp g fluorescenceplottedasafunctionoftime,inwhicheachcolortrace representsanindividualcell.B:Linegraphshowingfluo-3fluorescence intensityplottedasafunctionoftimeforeightcells,inwhichevery25time pointsfromimagescapturedat1frame/secondwereplottedasmean+/-SE asafunctionoftime.3T3-L1preadipocytespre-loadedwithFluo-3AM werestimulatedwithVeh,PMA,andthenIoninthepresenceof extracellularCa2+.Fluorescentintensitywascomparedtobackground fl fl uorescence.

PAGE 173

Figure57.IntracellularCa2+mobilizationinquiescent3T3-L1preadiocytes pretreatedwithAACOCF3inresponseto25MPMA.A:Superimposed tracesshowingfluo-3fluorescenceplottedasafunctionoftime,inwhich eachcolortracerepresentsanindividualcell.B:Linegraphshowingfluo-3 fluorescence intensity plotted as a function of time for eight cells, in which fluorescence intensity plotted as a function of time for eight cells, in which every25timepointsfromimagescapturedat1frame/secondwereplottedas mean+/-SEasafunctionoftime.3T3-L1preadipocytespre-loadedwith Fluo-3AMwerestimulatedwithVeh,PMA,andthenIoninthepresenceof extracellularCa2+.Fluorescentintensitywascomparedtobackground fluorescence.

PAGE 174

Figure58.IntracellularCa2+mobilizationinquiescent3T3-L1preadiocytes inresponseto1McANF.A:Superimposedtracesshowingfluo-3 fluorescenceplottedasafunctionoftime,inwhicheachcolortrace representsanindividualcell.B:Linegraphshowingfluo-3fluorescence intensityplottedasafunctionoftimeforeightcells,inwhichevery25time pointsfromimagescapturedat1frame/secondwereplottedasmean+/-SE asafunctionoftime.3T3-L1preadipocytespre-loadedwithFluo-3AM werestimulatedwithVeh,cANF,andthenIoninthepresenceof extracellularCa2+.Fluorescentintensitywascomparedtobackground fluorescence.

PAGE 175

** 25 3.0 *** ** 1.5 2.0 2 5 n ce (F/Fo) r y Units) * 0.5 1.0 Fluoresce n (Arbitra r 0.0 Figure 59. Comparisons of various intracellular Ca2+ experiments

PAGE 176

Figure60.ProposedroleofNPRCinintracellularCa2+mobilizationthroughAHNAK1andAA.AHNAK1 translocatesfromthenucleustotheplasmamembraneupon various stimuli The C 1 domain of AHNAK 1 associates with various stimuli The C 1 domain of AHNAK 1 associates with thecytoplasmictailofNPRC.AHNAK1istetheredbyNPRC totheplasmamembrane,whereitfunctionsasareceptorfor AAliberatedfrommembranephospholipidbilayersbycPLA2. Together,AHNAK1andAA,potentiatethereleaseof intracellularCa2+fromERstores.Thehighlyconservedcentral repeating units of AHNAK 1 have been reported to bind to PKC repeating units of AHNAK 1 have been reported to bind to PKC PKCisknowntoactivatecPLA2.Thecentralrepeatingunitsof AHNAK1havealsobeenreportedtodirectlybindtoand activatePLC 1inthepresenceofAA.TheactivationofcPLA2byPKCresultsinthereleaseofAA,whiletheactivationof PLC 1byAHNAK1andfreeAAresultsintheproductionof IP 3 .IP 3 triggersCa2+releasefromintracellularCa2+stores 3 3 throughbindingtoIP3receptors

PAGE 177

Figure61.Westernblotanddensitome tricanalysisshowingtheeffectof increasing[Ca2+]eonAHNAK1translocationin3T3-L1preadipocytes.A: Westernblotanalysisaftersubcellu larfractionof3T3-L1preadipocytes showinglessAHANK1inthenuclearfractionandmoreAHNAK1inthe membranefractionafterswitching3T3-L1preadipocytrsfromnormalto highCa2+.B:Densitometricanalysisof(A).3T3-L1preadipocyteswere initially cultured in medium containing normal Ca 2+ ( 1 8 mM) and were initially cultured in medium containing normal Ca ( 1 8 mM) and were thenswitchedtomediumcontaininghighCa2+(7.2mM)andculturedfor anadditional6hoursbeforefixingthecellsandperformingsubcellular fractionexperiments.CTRLreferstowholecelllysatecontrol,CYT referstocytosolicfraction,MEMreferstomembranefraction,andNUC referstonuclearfraction.

PAGE 178

Figure62.Effectofincreased[Ca2+]eon[Ca2+]i biliti i 3 T 3 L 1 dit 3 T 3 L 1 mo bili za ti on i n 3 T 3 L 1 prea di pocy t es. 3 T 3 L 1 preadipocyteswereinitiallyculturedinmedium containingnormalCa2+(1.8mM)andwerethen switchedtomediumcontaininghighCa2+(7.2mM)and culturedforanadditional6hoursbeforeloadingthe cellswithFluo-3AMandmonitoringchangesin[Ca2+]I. 3 T 3 L 1 preadipocytes pre loaded with Fluo 3 AM were 3 T 3 L 1 preadipocytes pre loaded with Fluo 3 AM were stimulatedwithvehicle(Veh),Phorbol12-myristate-13acetate(PMA),andthenionomycin(Ion)inthe presenceofextracellularCa2+.Fluorescentintensity wascomparedtobackgroundfluorescence.

PAGE 179

Chapter 4: Post-Translational Modifications of NPRC

PAGE 180

Background As mentioned earlier, NPRC undergoes va rious posttranslational modifications. However, the role of these postranslationa l modifications in me diating the structure and/or function of NPRC are either controversial or have not been thoroughly investigated. Therefore, in addition to the creating and characterizing a polyclonal antibody against NPRC (please refer to Chapter 1), a recombinant GST-NPRC fusion protein was created to investigate the requirement of glycosylation for NPRC dimerization, identify putative phosphorylation sites of NPRC, and ascertain the kinases responsible for the phosphoryla tion. The identification of phospho-acceptor residues and kinases responsible for the phosphorylation is a prerequisite for determining the significance of phosphorylation in context to a specific cellular process, such as NPRC mediated clearance of NPs from circul ation, turnover of NPRC protein, and NPRC mediated signal transduction. In addition, the sequence and kinetics of phosphorylation and dephosphorylation events can be investigated using a combination of phosphospecific antibodies and various es tablished methodologies.

PAGE 181

Materials and Methods Reagents and antibodies In addition to the reagents and antibodies mentioned in the previous chapters, the following reagents and antibodies were purchas ed or acquired as described. Precast gels (5%, 7.5%, and 10% resolving with 4% st acking) were purchased from Bio-Rad (Hercules, CA). Plasmid pGEX-4T3, E. coli strain BL21, Glutathione-Sepharose 4B medium, and Hyperfilm-ECL were purchas ed from Amersham Pharmacia Biotech (Piscataway NJ). GelCode Phosphoprotein Stain Reagent Set was purchased from Pierce (Rockford, IL). All other chemicals were purchased from Sigma (St. Louis, MO) unless otherwise noted. Cell Culture and cell lysate preparation Rat gastric mucosal (RGM1) epithelial cells were cultured and harvested for protein as previously described in Chapter 2. Plasmid constructi on of GST-NPRC GST-NPRC was prepared as previously described for GST-arrestins and the various GST-AHNAK1 domains, but with the following modifications. The cDNA fragment (NM 012868 ) encoding rat C type natriuretic peptide receptor (rNPRC) (kindly provided by Dr. David Lowe, Genentech, San Francisco, CA ) was subcloned into a pGEX4T3 expression vector between EcoR1 si tes and confirmed by restriction analysis and DNA sequencing (Molecular Biology Core facility at the H Lee Moffitt Cancer

PAGE 182

Center and Research Institute; Tampa, FL). The reactions and parameters for subcloning rat NPRC into pGEX4T3 are shown in Appendix N. Preparation of competent E.coli cells Competent BL21 cells were prepared using the DMSO method according to Chung et al. [403], with modifications. Briefly, si ngle colonies were used to inoculate 50 mL LB in a 250 mL erlenmeyer flask and then grown at 37 C with shaking at 225 rpm. Cells were grown to an OD600 of 0.4, harvested by centrifugation at 2500 g for 15 minutes at 4 C, and resuspended in 5 mL of ice cold TSS buffer (LuriaBertani (LB) broth with 10% (w/v) polyethy lene glycol (PEG), 5% (v/v ) dimethyl sulfoxide (DMSO), 50 mM MgCl2, pH 6.5). Single use aliquots of the competent cells were frozen at -80 C for use within 3 months. Expression of GST-NPRC The constructed expression vector was transformed into the host cell E. coli BL21 (DE3) strain for expression. Transformants we re selected by growth on LB agar plates containing 100 g/mL ampicillin. Single isolated col onies were used to inoculate 5 mL of 2XYTA medium (16g/L tryp tone, 10 g/L yeast extract, 5g/L NaCl, pH 7.0, containing 100 g/mL ampicillin) and grown at 37 C with shaking at 225 rpm for 12 hours. The starter culture was diluted 1:100 into fresh prewarmed 2XYTA. At an OD600 of 0.3 to 0.6, isopropyl-d-thiogalactoside (IPTG) was adde d to a final concentration of 0.1 mM to 1 mM for induction of the lac promoter.

PAGE 183

Solubilization of GST-NPRC from inclusion bodies Recombinant fusion protein was solubili zed from inclusion bodies according to Frangioni and Neel (17), with modifications. Briefly, bacterial cells were harvested at 5000 g for 10 minutes at 4 C. The supernatant was removed and the pellet was washed once with a volume of ice cold 1X PBS (1/15 the original culture volume) (Table 5). The pellet was resuspended in a volume of ice co ld STE buffer (10 mM Tris HCl, pH 8.0, 1 mM EDTA, 150 mM NaCl) (1/50th the original culture volume) (Table 5). A volume of lysozyme from chicken egg white was added (1/5000th the original culture volume) (Table 5) followed by a 15 minute incubation on ice. A volume of freshly prepared dithiothreitol (DTT) (1M) and Sarkosyl (10% w/v) was added (1/5000th and 1/350th the original culture volume, respectively) (Table 5) and then mixed by i nversion three times. The lysate was sonicated twice for 5 second intervals and then centrifuged at 13000 rpm for 15 minutes to pellet cellula r debris. The supernatant wa s transferred to a new tube and a volume of 10% Triton X-100 and STE was added (1/125th and 1/25th the original culture volume, respectively) (Table 5) and al lowed to incubate at room temperature for 30 minutes. Batch purification of GST-NPRC A volume of prewashed 50% glutathione Se pharose 4B slurry (1/100 the lysate volume) (Table 5) was added to the lysate and incubated at 4 C for 45 minutes with endover-end rocking. Bound proteins were coll ected by centrifugation at 500 g for 2 minutes. The complex was washed twice with a volume of ice cold 1X PBS (10X the initial slurry volume) (Table 5). Protein was eluted by resuspending the complex in a

PAGE 184

volume of elution buffer (1/1000 the culture volume) (50 mM Tris-HCl, 10 mM reduced glutathione, pH 8.0) (Table 5), incubating for 30 minutes at 4 C with end-over-end rocking, and collecting the supernatant afte r centrifugation for 2 minutes at 500 g. The elution step was repeated twice and the resulting fractions were pooled. Identification of GST-NPRC Purity of the fusion protein was anal yzed by SDS-PAGE and Coomassie blue staining using Colloidal Coomassie blue st ain according to manufactures instructions (Genomic Solutions; Ann Arbor, MI). The NPRC portion of the fusion protein was identified by indirect Western blot anal ysis for NPRC usi ng a polyclonal antibody (JAH84) directed against the carboxy termin al tail of NPRC. The GST portion of the fusion protein was identified by direct Western blot analysis for GST using peroxidase conjugated anti-GST polyclonal an tibody (Sigma; St. Louis, MO) Estimation of MW of GST-NPRC using a molecular weight marker kit and Ferguson plots The electrophoretic mobilities of GST-NPRC and the different molecular weight markers were determined after subjecting them to electrophoresis on a set of gels of increasing polyacrylamide concentrations. Ther eafter, the retardation coefficients of each protein were determined from the slope of the plot of the log of the electrophoretic mobilities against the percent gel concentra tions. Next, the logarithm of the negative slope was plotted against the logarithm of th e molecular weight of the fusion protein and

PAGE 185

the molecular weight markers, and the resulting linear plot was used to estimate the molecular weight of GST-NPRC. MS of GST-NPRC MS was performed to confirm the identity of the recombinant fusion protein (Proteomics Department at the Moffitt Cancer Center, Tampa Fl). Briefly, the gel band was subjected to in-gel tryptic digestio n followed by liquid extraction of the gel fragments. LC-MS/MS was used to analyze collected peptides and was performed on an LTQ mass spectrometer (Thermo Electron Co rporation, Waltham, MA) with an LC packings ultimate dual gradient nano-LC sy stem (Dionex, Sunnyvale, CA). The Mascot algorithm (Matrix Science, London UK) was used to search the collect ed data against the nonredundant rodentia database at the National Center fo r Biotechnology Information (NCBInr) with the following parameters: peptide mass tolerance, 2.5 DA; MS/MS ion mass tolerance, 0.8 DA; allowing up to 2 misse d cleavages. Significa nt hits, defined by Mascot probability analysis and hits that exc eeded the arbitrarily set acceptance threshold were regarded as positive identifications. Circular dichroism of GST-NPRC CD spectra were obtained using a JA SCO (Easton, MD) J710 spectropolarimeter calibrated for signal intensity and wavelength maxima using an aqueous solution of d-10camphosulfonic acid. UV CD spectra were obtained in 10 mM phosphate buffer, containing 0.1 mM EDTA, pH 7.0, using a cylindrical quartz cell of 0.1 cm path length (300 L total volume), while visible CD spect ra were obtained in 10 mM MOPS buffer,

PAGE 186

containing 0.1 mM EDTA, pH 7.0, using a cell of 1 cm path length (90 L total volume). All spectra were corrected for the appropriate buffer contribu tions and expressed in terms of molar ellipticities (M-1 cm-1). In vitro phosphorylation of GST-NPRC GST-NPRC immobilized on glutathione Sepharose 4B beads was incubated with 200 g of RGM1 cell lysate in kinase buffer (50 mM Tris [pH 7.4], 10 mM MgCl2, 5 mM DTT, 2 mM ATP) for a total volume of 300 l, and incubated at 30C for 1 hr. The beads were rinsed three times with 1X PBS be fore the addition of 150 l of elution buffer (50 mM Tris-HCl, 10 mM reduced glutathione, pH 8.0). Detection of phosphorylated proteins Recombinant GST-NPRC fusion protein or RGM1 protein lysate was subjected to SDS-PAGE, then gels were stained using the GelCode Phosphoprotein Stain reagent set according to the manufactures instructions. Alternatively, proteins were transferred to nitrocellulose membranes and then membranes were probed with phosphospecific and substrate motif antibodies to id entify phosphorylation of proteins. Overlay binding assay Overlay binding assays were performed as described in Chapter 2, but instead the membranes were overlaid with purified GST or GST-NPRC in blocking solution for 2 hours at RT, washed with 1X PBS, and probed for GST.

PAGE 187

Results Construction, expression, and purification of GST-NPRC In order to create a fusion protein th at would maintain the signaling function mediated by the carboxy terminal domain of NP RC, the GST tag was strategically placed on the amino terminal end of the full length sequence of rat NPRC (Figure 63). Several expression conditions of GSTNPRC, including temperature of bacterial cultivation, optical density of bacteria upon IPTG induction, IPTG concentrati on, and duration of IPTG induction were considered. Expre ssion of GST-NPRC was favored at a higher temperature with IPTG induction at a lower optical density (Figure 64). Attempts to prevent misfolding of GST-NPRC by reducing the rate of expressi on of GST-NPRC by culturing the bacteria harboring the fusion protein at 30 C instead of 37 C resulted in less product, as indicated by the bands at 75 kDa in Coomassi e stained gels. The expression of GST-NPRC appear ed to be 5-fold less at 30 C than at 37 C, as indicated by densitometric analysis. Despite the inclusion of the GST tag to facilitate solubilization of GST-NPRC, a desirable yield of purified fusion protein co uld not be achieved by traditional methods. Overexpression of the foreign protein in th e bacteria resulted in aggregation and formation of insoluble inclusion bodies. Th e fusion protein was found exclusively within intracellular inclusion bodies and represented approximately 10% of total bacterial proteins as indicated by densitometric anal ysis. Therefore, a similar approach as originally described by Fra ngioni and Neel [366] to reco ver our fusion protein from bacterial inclusion bodies was taken. GST-NPRC was able to be purified to

PAGE 188

homogeneity, as indicated by a single band of an apparent molecu lar weight of 75 kDa (Figure 65). Next, the purity of GST-NPRC wa s confirmed and the NPRC portion demonstrated to be intact by MS analysis. MASCOT re sults only revealed several signature peptides co rresponding to rat NPRC and full seque nce coverage from the amino terminal domain to the carboxy terminal domain of NPRC observed (Figure 66A). However, MASCOT results did not reveal se quence coverage for the GST moiety. The expected size of GST-NPRC was between 86 and 92 kDa, since NPRC is known to have a molecular mass of between 60 and 66 kDa an d GST is known to have a molecular mass of 26 kDa. Predicted and Observed MW of GST-NPRC A GST-NPRC fusion prot ein was constructed using th e entire sequence of rat NPRC. The molecular weight of GST is 26 kDa and the molecular of rat NPRC is between 60 and 66 kDa. Therefore, the pred icted MW of GST-NPRC is between 86 and 92 kDa. SDS-PAGE analysis of purified GST-NPRC and subsequent indirect Western blot analysis probing for NPRC resulted in an immunoreactive band at 75 kDa (Figure 66B). Similarly, direct West ern blot analysis probing fo r GST also resulted in an immunoreactive band at 75 kDa (Figure 66C). Native PAGE analysis of purified GST-NPRC resulted in a high molecular weight Coomassie blue stained band above 120 kDa, as indicated by a Native PAGE molecular weight marker kit. The molecular wei ght of the band corre sponding to GST-NPRC observed in the Native PAGE studies was th en estimated by using a protein molecular

PAGE 189

weight marker kit and Ferguson plots. Th e estimated molecular weight of GST-NPRCs approximately 150 kDa (Figure 67). Dimerization of GST-NPRC does not require receptor occupancy The GST tag of GST-NPRC was removed by thrombin cleavage prior to investigating the dimerization of NPRC in vitro An immunoreactive band at 66 kDa band corresponding to NPRC was detected after 18 hours of thrombin cleavage (Figure 66D). The ability of the NPRC agonist, cANF to induce dimerization of NPRC resulting from thrombin cleavage of GST-NPRC was evaluated. The addition of cANF in increasing concentrations did not augment the observed dimerization of NPRC and the primary sequence of NPRC was sufficien t for its spontaneous dimerization in vitro (Figure 68). The observed and theoretical secondary stru ctures of GST-NPRC are in agreement The GST moiety of GST-NPRC has the pot ential to dimerize by itself, although it is unlikely since a large portion of the tag of GST-NPRC is prematurely cleaved during the purification process. In order to determine if thrombin cleavage of GST-NPRC was necessary, the ability of the GST moiety to e ffect the secondary and tertiary structure of GST-NPRC was investigated. The amino acid sequences of GST and of rat NPRC were used to perform secondary structure predic tions analysis. Circ ular Dichroism (CD) revealed a minima negative peak at 215 fo llowed by an immediate positive peak, as indicated by the far UV CD spectra in Figure 69A. The peak profile within the region of 260 of the spectra demonstrated the fusion protein was not globular and maintained a

PAGE 190

defined tertiary structure. The results from the CD analysis were in agreement with the proportions of and structures from the PSIPRED prot ein structure prediction server shown in Figure 69B. The intracellular domain of NPRC cont ains putative phosphorylation consensus sequences The intracellular domain of rat NPRC c ontains several puta tive phosphorylation consensus sequences, as shown in Figure 70. Two PKA, two PKB, and one PKC phosphorylation sites were identified within the 37 ami no acid intracellular domain of rat NPRC. Immobilized GST-NPRC can be phosphorylated in vitro using a crude RGM1 cellular lysate The ability to phosphorylate GST-NPRC in vitro using a crude lysate from RGM1 cells was investigated. While immob ilized to glutathione Sepharose 4B beads, GST-NPRC was subject to RGM1 lysate at increasing concentrations and increasing periods of time. Compared to untreated GST-NPRC, the addition of increasing concentrations of RGM1 lysate for increasing periods of time did not affect the ability to purify the fusion protein to hom ogeneity (Figure 71A). However, compared to untreated GST-NPRC, incubation of GST-NPRC with 600 g of phosphatase inhibitor treated RGM1 lysate in the presence of ATP fo r 1 hr resulted in a phosphostained band corresponding to 75 kDa (Fig. 71 B ).

PAGE 191

Rat NPRC does not exist as a constitutiv ely phosphorylated prot ein in RGM1 cells The various different antibodies used to investigate the phosphorylation state of NPRC are listed in Table 6. A polycl onal phospho-Thr antibody, which recognizes phosphorylated Thr residues, but also phospho Ser residues was in initial e xperiments to determine if NPRC exist as a constitutively phosphorylated protein in vivo A polyclonal NPRC specific antibody was used to immunoprecipitate NPRC from an RGM1 cell lysate treated with or wit hout phosphatase inhibito rs and was then probed for phosphorylated Thr and Ser residues using the polyclonal phosp ho-Thr antibody. In parallel experiments, the polyclonal phospho Thr antibody was used to immunoprecipitate total phosphorylated proteins from the RGM1 cell lysate treated with or without phosphatase inhibitors and specific NPRC antibody was used to pr obe for NPRC. Immunoreactive bands corresponding to phosphorylated NPRC were markedly reduced in the absence of phosphatase inhibitors, as shown in Figure 72. In other experiments a monoclonal phospho Thr specific antibody, which only detect s phosphorylated Thr residues was also used to probe for phosphorylated Thr resi dues after immunopreci pitation NPRC with NPRC specific antibody. Accordingly, the monoclonal phospho Thr specific antibody was used to immunoprecipitate total phosphorylated proteins from the RGM1 cell lysate treated with or wit hout phosphatase inhibito rs and NPRC specific antibody was used to probe for NPRC. In each case, NPRC ph osphorylation at threonine residues was essentially nondetectable in the absence of phosphatase inhi bitors after probing with a phosphospecific antibody that recognizes only phosphorylated threon ine residues (Figure 72A ).

PAGE 192

Rat NPRC is a substrate for PKA In order to determine if NPRC was a s ubstrate for a specific kinase, NPRC was immunoprecipitated from the RGM1 cell lysa te and probed for phosphorylation using PKA, PKB, and PKC substrat e motif antibodies (Table 6). Probing for phosphorylation with PKB and PKC substrate motif antibodie s did not reveal any immunoreactive bands corresponding to NPRC. However, probing for phosphorylation with a PKA substrate motif antibody did reveal an immunoreactiv e band at 66 kDa corresponding to NPRC that was markedly reduced in the abse nce of phosphate inhibitors (Figure 72 C ). However, immunoreactive NPRC bands of equal intensity were detected after probing NPRC with specific NPRC antibody from both phosphatase treated and untreated RGM1 cell lysates (Figure 72 D ). Rat NPRC is phosphorylated on Thr 505 Global phosphorylation of NPRC by PKA was investigated using a PKA consensus sequence prediction algorithm, pkaPS [404]. Six distinct phosphorylation sites were identified over the entire sequence of ra t NPRC (Table 7). However, only one of these sites included a threonine residue, Thr 505 (Table 7).

PAGE 193

Discussion A recombinant GST-NPRC fusion protein was created and used to investigate posttranslational modifications of NPRC. The expected molecular mass of GST-NPRC was predicted to be between 86 and 92 kDa, since NPRC is known to have a molecular mass of between 60 and 66 kDa and GST is know n to have a molecular mass of 26 kDa. However, Western blot analysis consistently revealed an immunoreac tive band at 75 kDa, using a polyclonal antibody agai nst the cytoplasmic domain of NPRC (Figure 66B). Accordingly, a GST peroxidase antibody al so revealed an imm unoreactive band at 75 kDa (Figure 66 C ). Although it was apparent th e GST-NPRC fusi on protein was truncated, it was immediately apparent that the GST fusion tag and not the NPRC parent protein was most likely trunc ated, since each of the polyclonal antibody against NPRC used in the Western blot analysis is against the a region within the last 37 amino acids of the carboxy terminal domain of NPRC. Thromb in cleavage of GST-NPRC revealed an immunoreactive band at approximately 66 kDa (Figure 66 D ), which was also observed in Western blots of uncleaved GST-NPRC, sugges ting the fusion protein may be cleaved as a result of proteolysis. Since the entire sequence of GST was used to create the peroxidase conjugated GST antibody it was expected the antibody would recognize multiple epitopes of GST. It was also expe cted that the presence of only a few amino acids of GST would be necessary for recogni tion of this antibody. MS sequence analysis revealed multiple signature peptides corresponding to rat NPRC spanning from the first amino acid at the amino terminal domain to the last amino acid of the carboxy terminal domain of NPRC.

PAGE 194

Since proteins are neither uniform in charge/mass ratio nor in shape, the molecular weight of GST-NPRC was assessed in parallel with molecular weight standards while performing non-denaturing native polyacrylamide gel electrophoresis (PAGE), as described by others [405, 406]. The estimation of the molecular weight of GST-NPRC by this method minimized the influence of charge/mass ratio, but conformational differences between GST-NP RC and the molecular weight standards could influence an accurate estimation. Fer guson plots and a protein molecular weight marker kit were also used to further confirm NPRC was intact by indirectly estimating the molecular weight of GST-NPRC (Figure 67). Because all proteins have the same backbone, the nature of the side chains comprising the backbone determines the overall three-dimensional structure of the protein. In some cases, the primary structure of a protein alone may be sufficient to dictate the three-dimensional shape or tertiary structure of the protein. In other cases, protein chap eronins may induce protein folding. It was expected that in the absence of -mercaptoethanol, S-S bridges will remain intact and a mixture of GST-NPRC monomer and GST-NPRC homodimers, formed from spontaneous dimerization would be present after performing native PAGE. Although the exact site of cleavage of GST could not be determined by these methods, the truncation of the GST moiety was not a concern since it was removed by thrombin cleavage in some experiments. The molecular design of GST-NPRC involve d using the entire coding sequence of rat NPRC instead of a partial sequence, because the original intent was to be able to study global posttranslational modifi cations of NPRC. Endogenous NPRC exists as a monomer and a disulfide-linked homodimer [82, 83], but the dimeric structure of NPRC is not

PAGE 195

necessary for ligand binding activity [83]. It is generally thought that the cytoplasmic domain of NPRC is phosphorylated upon lig and binding [370]. Under non-denaturing native-PAGE conditions dimerization of GS T-NPRC (Figure 68) or NPRC alone in both the absence and presence of increasing amounts of the NPRC ligand, cANF was observed. In addition to us ing the GST-NPRC fusion protei n as a tool to study the phosphorylation state of NPRC, it could also be used to study the importance of glycosylation of NPRC for its ability to dimerize, bind ligand, and mediate signal transduction. NPRC undergoes N terminal glycosylation as its extracellular (ECD) contains multiple N-linked glycosylation s ites, but the role of NPRC glycosylation remains controversial. Glycosylation and li gand binding are thought to contribute to the homodimerization and subsequent activation of NPRC. Furthermore, ligand induced dimerization of single transmembrane spanning receptors, such as cytokine receptors and growth factor receptors appear to be a general mechan ism for receptor activation and downstream signaling [407, 408]. Multiple gro ups have shown glycosylation of NPRA and NPRB is important for lig and binding [409, 410]. Heim et al. demonstrated that inhibition of N -glycosylation of NPRA by tunicamycin did not alter the ability of ANP, but did affect ANP analogs to bind to rat glio ma cells stably transfected with NPRA and activate guanylyl cyclase [411]. Fenrick et al. showed lower guanylyl cyclase activity after deglycosylation of NPRB compared to fully glycosylated receptor [409]. Independent from its role in modulating ligand binding, glycosylation does not appear to be required for distribution of NPRs to the cell surface [409, 410]. Glycosylation of NPRC has not been shown to be a prerequisi te for its ligand binding. Preliminary results suggest N terminal glycosylation of NPRC is not required for NPRC homodimerization,

PAGE 196

since GST-NPRC spontaneously dimerized in vitro and the addition of ligand, in increasing amounts did not further enhance the dimerization (Figure 68). This finding suggests the primary sequence of NPRC al one is sufficient for its dimerization in vitro Furthermore, because GST-NPRC completely lacks glycosylation, as this posttranslational modification is absent in E. coli, GST-NPRC could provides a simplified means to investigate the requireme nt of glycosylation for the NPRC activation and function. Several methods exist for prediction of the secondary structure of various proteins. The de novo PSIPRED [412, 413], JNET [414] and PHD [415] secondary structure prediction programs are among the be st secondary structure prediction methods available and can achieve a performance or Q3 score of between 75-77% [416] These methods utilize BLAST searches of the non-redundant protein sequence database to obtain evolutionary information which is then fed into a multi-layered feed-forward neural network to acquire sequence/structure patterns, which are subsequently used to predict the secondary structure of the query protein [417]. Since mammalian posttranslational modi fications including phosphorylation are absent in bacteria, the GST-NPRC fusion protein may be useful for the investigation of phosphorylation events of NPRC. MS and site-directed mu tagenesis are commonly used to investigate the phosphorylation state of a protein. Alternat ively, the availability of phosphospecific antibodies can be used to probe for protein phosphorylation. Phosphorylation motif antibod ies are useful resources for the identification and characterization of the phosphor ylation state of a protein. Consensus sequences are commonly used as substrate specificity dete rminants for protein kinases [418]. The

PAGE 197

carboxy terminal domain of NPRC is rich in serine and threonine residues and consensus sequence motifs for PKA, PKB, and PKC. In one report, NPRC was shown to be phosphorylated exclusively on seri ne residues in rat aortic sm ooth muscle cells. It is possible multiple serine residues of NP RC are phosphorylated simultaneously or sequentially by one or more kinases. In ag reement with a recent report, evidence is provided here for the phosphorylation of Thr 505 of NPRC in RGM1 cells. The discrepancy between the phoshor ylated residues of NPRC ma y be attributed to the phosphorylation state of NPRC be ing species and cell type de pendent. A future study that may be performed to confirm the phosphorylation of NPRC at Thr 505 include mutating Thr 505 to an Ala and then performing in vitro phosphorylation assays, while comparing the mutant construct to wildtype NPRC. The functional significance of the phosphorylation of NPRC at Thr-505 in RGM1 cells may be evaluated by utilizing the mutant construct and wildtype NPRC, while performing I125 ligand binding experiments after transiently transfecting and radiolabe ling RGM1 cells to assess the clearance function of NPRC. Similarly, ot her cell lines, capable of bei ng transiently transfected can be used to determine the role of phosphorylation of NPRC at Thr-505. Phosphorylation of Thr-505 of NPRC may have significant implications because it is within the intracellular domain of NPRC. The intracellular domain of NPRC has been reported to contain G protein activator sequences and par ticipate in signal tran sduction. Therefore, the functional significance of the phosphorylation of NPRC at Thr-505 on NPRC signaling mediated by Gi or independent of Gproteins (i.e. via AHNAK1) can be studied while utilizing the mutant construct and wild type NPRC. Although this is the first report of phosphorylation of NPRC at Thr-505 by P KA, NPRC has been reported to be

PAGE 198

phosphorylated on Thr-505 by PKG [419]. Th e Thr-505 residue of NPRC was reported to be part of a consensus sequence for phosphorylation by cGMP-dependent protein kinase (PKG) [419]. After expression of various NPRC mutants into COS-1 cells, desensitization by PKG was found to be mediated by phosphorylation of Thr-505 of NPRC [419]. In order to identify the kinase responsible for phosphorylation of Thr-505 substrate motif antibodies for various kinases were utilized. Only a PKA substrate motif antibody and not PKB or PKC substrate motif antibodies resulted in immunoreactive bands after immunoprecipatating NPRC from RGM1 lysate with NPRC specific antibody. PKA phosphorylates protei ns on Serine (Ser) and Threonine (Thr) residues within the motif Arg-X-X-Ser/Thr, where X may represent any amino acid residue. The motif is not absolute and some variations in basic residues and spacing are allowed. It has been reported that the 2nd or 3rd position prior to the phosphorylated serine or threonine should be occupied by an arginine. Several algorithms exist for predicting putative PKA phosphorylation sites. The pkaPS algorithm was used because it offers both high sensitivity and specificity for pred icting PKA phosphorylati on sites of a given protein sequence based on various parameters. PkaPS was used to identify all putative PKA phosphorylation sites within the entire sequence of rat NP RC. Of the six predicted phosphorylation sites (Table 7), only amino acid 505 contained a Thr residue. Since the phospho-Thr specific antibody used in IP-W estern blot analyses only recognizes phosphorylated Thr residues and does not cros s-react with phosphorylated Ser residues, Thr-505 of rat NPRC is most likely phosphorylated by PKA. NPRC may be phosphorylated on multiple residues, but does not exist as a constitutively phosphorylated

PAGE 199

protein in RGM1 cells, since treatment of RGM1 lysate w ith phosphatase inhibitors was necessary to achieve phosphorylation. MS is routinely used to identify phosphor ylation sites of a protein of interest. However, the ability to accurately detect phosphorylated residues is dependent on the abundance of the phosphorylation. Therefore, it was not suprising th at the MS approach to detect phosphorylation of NP RC failed, since there is no evidence of NPRC being abundantly phosphorylated. The ability to dete ct NPRC phosphorylati on by MS in future experiments can be improved by incorpor ating a separation technique, such as immobilized metal affinity chromatography (IM AC). The IMAC method may be used to enrich for phosphopeptides that are present at low amounts and is therefore useful for a more accurate identification of phosphoryl ation sites by LC-MS/MS. Furthermore, protein phosphorylation is dynamic and constantly changes over time. As shown in Figure 72, NPRC does not exist as a cons titutively phosphorylated protein and most likely undergoes a series of phosphorylation a nd dephosphorylation events. This finding may be used to troubleshoot future experiments, in which a specific kinase may be overexpressed in the cell line of interest by transient transfection, or the cells may be treated with an activator of a specific kinase in order to enha nce the phosphorylation. Future studies will be necessary to determine if this phosphorylation is conserved in other species and to determine sequential phosphorya ltion and dephosphorylation events. Additional studies will also be n ecessary to determine if PKA phosphorylation of NPRC is necessary for receptor homodimeri zation, activation, desensitization, and/or internalization.

PAGE 200

Table 5. Solubilization and purification scheme for GST-NPRC Culture volume 60 mL culture 500 mL culture Centrifugation (5000 g for 10 min. at 4 C) 1X PBS wash buffer 4 mL 33 mL Resuspension buffer (STE) 1.2 mL 10 mL Lysozyme 12 l 100 l 1M DTT 12 l 100 l 10% Sarkosyl 170 l 1.43 mL Sonication (2X for 5 sec. intervals) Centrifugation (3000 rpm for 15 min. at room temp.) 10% Triton X-100 480 l 4 mL STE 2.4 mL 20 mL Incubation (30 min. at room temp.) Elution Glutathione Sepharose Bed Volume 30 l 240 l Glutathione elution buffer 60 l 500 l 1X PBS wash buffer (2X) 300 l 2.4 mL Approx. GST-NPRC yield 30 g 200 g Approximate volumes for a 60 mL cultu re and 500 mL culture are provided Table 6. Various antibodies us ed to characterize the phosphory lational state of NPRC Antibody Specificity/Sensitivity Motif Source JAH84 Total NPRC None Our laboratory Phospho-Thrpolyclonal Phospho-Try, Ser, Thr None Cell Signaling Phospho-Thrmonoclonal Phospho-Thr None Cell Signaling Phospho-PKA Substrate Phospho-Ser, Thr (RRXS/T) Cell Signaling Phospho-PKB (Akt) Substrate Phospho-Ser, Thr (R/K)X(R/K)XX(T/S) Cell Signaling Phospho-PKC Substrate Phospho-Ser (R/K)X(S)(Hyd)(R/K) Cell Signaling Table 7. Prediction of NPRC phosphorylation by PKA using the pkaPS algorithm Position Residue Score Profile 193 S 0.04 0.82 337 S 0.31 1.08 441 S 0.65 1.09 505 T 0.41 0.74 527 S 0.14 0.81 533 S 0.18 0.40

PAGE 201

rat NPRC pGEX-4T3-NPRC GST LBD TMD ICD COOH GST LBD TMD ICD COOH rat NPRCFigure63.ConstructionofrecombinantGST-NPRC. SchematicofthepGEX4T3-NPRCconstructand di f GS C h lid bidi di d oma i nso f GS T-NPR C .T h e li gan d bi n di ng d oma i n (LBD),transmembranedomain(TMD),and intracellulardomain(ICD)ofNPRCaredepicted

PAGE 202

SDS-PAGEFigure64.OptimizationoftheexpressionconditionsofGSTNPRC.Coomassiebluestainedgelillustratingtheeffectsof temperature,celldensity,andIPTGconcentrationonthe expressionofGST-NPRC.Thearrowindicatesexpressionof th GST NPRC fi ti Lt btid f E th e GST NPRC f us i onpro t e i n. L ysa t eswereo bt a i ne d f rom E coli BL21cellstransformedwiththepGEX4T3-NPRC construct.Lane1,unstainedmolecularweightmarkers (MWM).CTRLinlane2referstocontrol,inwhichlysate frompGEX4T3emptyvectorwascomparedtolysatefrom pGEX4T3-NPRC(GST-NPRC)asshownineachoftheother indicated lanes indicated lanes

PAGE 203

kDa SDS-PAGEFigure65.Coomassiebluestainedgelshowingthepurification ofGST-NPRC.Lane1,unstainedmolecularweightmarkers (MWM).Lane2,purifiedfraction(PRFD)ofGST-NPRC. Lane3,control(CTRL)inwhichlysatefromemptyvecto r was purifiedinparallelwithlysatefrombacteriaharboringtheGSTNPRCconstruct.

PAGE 204

Figure66.ConfirmationofthesequenceofGST-NPRC. (A) Sequence alignment/MascotresultsfromLC-MS/MS.Matchedpeptidesareitalicized inred. (B) IndirectWesternblotshowinganimmunoreactivebandofan apparentmolecularmassof75kDausinganti-NPRCantibody.Thebandat 66kDafromRGM1lysateandpurifiedGST-NPRCcorrespondstotheGSTNPRCfusionproteininwhichGSTi struncatedandNPRCisintact. (C) Dit Wt blt hi iti bd f t Di rec t W es t ern bl o t s h ow i ngan i mmunoreac ti ve b an d o f anapparen t molecularmassof75kDausingaperoxidaseconjugatedantiGSTantibody. (D) IndirectWesternblotshowinganimmunoreactivebandofanapparent molecularmassofapproximately60k DaafterthrombincleavageofGSTNPRC.

PAGE 205

Figure67.GrayscaleofCoomassiebluestainedgelsusedto determinethemolecula r wei g htofGST-NPRCunde r native g PAGEconditions.Rf=distanceofproteinmigration/distanceof trackingdiemigration.A:5%gel;B:7.5%gel;C:10%gel

PAGE 206

cANF kDa 132 66 NATIVE-PAGE Figure68.Spontaneousversusligandinduceddimerizationof ofGST-NPRC.NativePAGE(nonreducingandnondenaturing conditions)analysisofGST-NPRCusinga10%TrisHClgel andafterCoomassiebluestaining.Lane1,albumindimerat 132kDaandmonomerat66kDa.Lane2,control(CTRL)of untreated GST NPRC Lanes 3 5 incubation of GST NPRC untreated GST NPRC Lanes 3 5 incubation of GST NPRC withincreasingamountsofcANF.GST-NPRCwasableto dimerizespontaneouslyindependentofligand.

PAGE 207

Figure69.PredictedsecondarystructureforGST-NPRC. (A) Far UV CD spectra ; the region around 260 indicates the protein Far UV CD spectra ; the region around 260 indicates the protein hasadefinedtertiarystructureandisnotglobular.Theminima at215followedbyanimmediatepositivepeakindicatesthe proteinismainlyhelical. (B) PSIPREDproteinstructure predictionserverresultsforratGST-NPRC.

PAGE 208

Figure70.Phosphorylationconsensussequenceswithinthe intracellulardomainofratNPRC.Twophosphorylation co n se n sus seque n ces a r e s h ow nf or PKA two p h osp h o r y l at i o n consensus sequences are shown for PKA, two phosphorylation consensussequencesareshownforPKB,andone phosphorylationconsensussequenceisshownforPKC

PAGE 209

Figure71.InvitrophosphorylationofGST-NPRC (A) Lane1, molecula r wei g htmarke r ( MWM ) .Lane2 untreate d control g () (CTRL).Lanes3-5,purificationofGST-NPRfusionprotein afterincubatingthefusionprotein,immobilizedonglutathione Sepharose4BbeadswithincreasingamountsofRGM1cell lysate(200,400,or600g,respectively)for30mininthe presenceofATP.Lanes6-8,purificationofGST-NPRCfusion proteinafterincubatingthefusionprotein,immobilizedon glutathioneSepharose4B b eadsfo r increasingtimeintervals(15 min,30min,1hour,respectively)with400gofRGM1lysate inthepresenceofATP. (B) PhosphostainedgelafterSDSPAGE,inwhichGST-NPRCwastreatedwithorwithout400g RGM1lysateandATPfor1hour.

PAGE 210

Figure72.IdentificationofputativeresiduesandkinasesinvolvedinNPRC phosphorylation. (A) IPWesternblotanalysisafterimmunoprecipatating NPRCfromRGM1wholecelllysate(WCL)treatedwithphosphatase inhibitors(+PI)andprobingwithphospho-Thrspecificantibodyrevealedan immunoreactive band at 66 kDa The immunoreactive band at 66 kDa was immunoreactive band at 66 kDa The immunoreactive band at 66 kDa was absentafterimmunoprecipatatingNPRCfromuntreated(-PI)RGM1lysate andprobingwithphospho-Thrspecificantibody (B) Similarly,IPWestern blotanalysisafterimmunoprecipatatingwithNPRCspecificantibodyand probingwithNPRCspecificantibodyr evealedanimmunoreactivebandat 66kDa. (C) IPWesternblotanalysisafterimmunoprecipatatingNPRC fromRGM1lysatetreatedwithphosphataseinhibitorsandprobingwitha PKAsubstratemotifantibodyrevealedanimmunoreactivebandat66kDa. Theimmunoreactive b anda t 66kDawasattenuatedafte r immunoprecipatatingNPRCfromuntreatedRGM1lysateandprobingwith PKAsubstratemotifantibody. (D) Similarly,IPWesternblotanalysisafter immunoprecipatatingwithNPRCspecificantibodyandprobingwithNPRC specificantibodyrevealedanimmunoreactivebandat66kDa.

PAGE 211

Chapter 5: Potential Functions of AHNAK1

PAGE 212

Background As mentioned earlier, the AHNAK family of proteins has been implicated in several different cell-type de pendent functions, and there ma y be other possible functions that are still unknown. While considering th e versatity of AHNAK1 to serve as an adaptor/scaffolding protein and its abilty to a ssociate with a wide range of proteins, the identification of AHNAK1 protein expression in diffe rent cell types is a preliminary step for discovering novel functions of this pr otein. As demonstrated earlier, AHNAK1 associates with NPRC in RGM1 cells. Since AHNAK1 is a barr ier protein and the RGM1 cell line demonstrates barrier type pr operties, the role of AHNAK1 in modulating the paracellular permeability of normal rat gast ric epithelial cells was investigated. Also, the expression profile of AHNAK1 in normal human stomach organ donors was investigated to correlate the findings from studies in which the RGM1 cell line was used as a model system and to further elucidate th e functional significance of AHNAK1.

PAGE 213

Materials and Methods Reagents and antibodies In addition to the reagents and antibodies mentioned in the previous chapters, the following reagents and antibodies were purchased or acqueired as described. ZO-2 antibody was purchased from Cell Signaling Technologies. Cell culture RGM1 cells were cultured as described in Chapter 2. SDS-PAGE, Western blotting, and densitometric analysis SDS-PAGE, Western blotting, and densitometric analyses were performed as described in the previous chapters. Immunohistochemistry and immunofluorescence Immunohistochemistry and immunofluores cence was performed as described in Chapter 1, but with the following modifications. ZO-2 antibody was used at a dilution of 1:250. Sucrose density-gradient centrifugation Sucrose density-gradient centrifugation studies were performed exactly as described in Chapter 3.

PAGE 214

siRNA Transfection AHNAK1 specific SMARTpool siRNAs (Table 4) or negative control nontargeting siRNA were purchased from Dhar macon (Lafayette, CO). siRNAs were transfected into RGM1 cells using Dharma FECT Transfection Reagent (Dharmacon) according to the manufactures instructions. In vitro Cell Permeability Assay Permeation of fluorescein isothiocyanate (FITC)-dextran (MW: 2000 kD) across RGM1 monolayers was assessed by in vitro Permeability Assay kit (Millipore, Billerica, MA) according to the manufactures instructio ns, but with the modifications. Briefly, RGM1 cells were transfected with nontargeting siRNA or AHNAK1 specific SMARTpool siRNA and allowed to reach conflu ency. As controls, permeation of FITCdextran was also assessed across collagen co ated inserts without an RGM1 monolayer, and across RGM1 monolayers treated with 50 M EDTA for 20 minutes. Statistical analysis Results are presented as mean SEM. St atistical analyses were performed using Student's t test or one-way ANOVA. All data are representative of at least two independent experiments.

PAGE 215

Results AHNAK1 colocalizes with ZO-2 in confluent RGM1 cells In order to determine if AHNAK1 could affect the integrity of the junctional complex of epithelial cells (Figure 73), colocalization of AH NAK1 and ZO-2 was initially investigated. Both AHNAK1 and ZO -2 were found to colocalize along the cell boundary of confluent RGM1 cells, as shown in Figure 74A. Strong AHNAK1 immunoreactivity, using polyclonal AHNAKC2 antibody (Figure 74B) and strong ZO-2 immunoreactivity, using monoclonal ZO-2 antibody (Figure 74C) was observed after staining RGM1 cells cultured on type 1 collagen chamber slides. AHNAK1 is predominantly plasma membrane bound in confluent RGM1 cells Subcellular fraction studies and Western bl ot analysis reveal ed AHNAK1 protein expression in the cytoplasmic, membrane, and nuclear fraction (Figure 75A). PanCadherin was probed for as a membrane mark er, Lamin A/C was probed for as a nuclear marker, and GAPDH was probed fo r as a cytoplasmic marker (Figure 75A). The highest level of AHNAK1 protein expression was f ound in the cytoplasmic fraction (Figure 75A). Immunofluorescence staining revealed strong cytoplasmic and membrane staining for AHNAK1, but very weak nuclear stai ning for AHANK1 (Figure 75B). AHNAK1 is expressed in various regions of healthy human stomach organ donors As shown in the schematic shown in Figure 76, the stomach is composed of various types of cells that perform specialized functions. Haematoxylin and eosin (H&E) staining and PAS/alcian blue staining demonstrated tissue samples taken from three

PAGE 216

different human organ stomach donors were no rmal and were from healthy individuals (Figure 77). Western blot analysis demons trated AHNAK1 expression in the antrum and body of three different human organ stomach donors (Figure 78A). Actin was probed for as a loading control (Figure 78A). Immunohi stochemical analysis revealed AHNAK1 is expressed at the basolateral plasma membra ne in surface epithelia l cells (Figure 79). Also, immunohistochemical analysis showed AHNAK1 is expressed in the capillaries and muscle of the stomach (Figure 79). AHNAK1 protein knockdown results in in creased paracellular permeability As demonstrated by Western blot (Figure 80A) and densitometric analysis (Figure 80B), transfection of siRNAs targeting AHNAK1 into RGM1 cells resulted in approximately a 50% knockdown in AHNAK1 protein. The knockdown in AHNAK1 protein resulted in increased permeability to FITC-Dextran in confluent RGM1 cells (Figure 81). The increased permeability to FITC-Dextran seen after siRNA mediated knockdown of AHNAK1 protein was greater than the increased perm eability to FITCDextran observed after EDTA treatme nt of RGM1 cells in adjacent wells (Figure 81).

PAGE 217

Discussion AHNAK1 is a versatile protein that has been implicated in several cell-type dependent functions. Novel findings pr esented here for AHNAK1 include AHNAK1 protein expression in normal rat gastric mucosal cells and in surface epithelial cells of the antrum and body of healthy human stomach organ donors, AHNAK1 co-expression with ZO-2 in confluent RGM1 cells, and incr eased paracellular permeability with siRNA mediated knockdown of AHNAK1 protein in RGM1 cells. Gentil et al. demonstrated the co-localization of AHNAK1 with ZO-1 in the brain [232]. The co-localization of AHNAK1 with ZO -1 or other ZOs in other tissues has not been reported. This may in part be due to AHNAK1 and the different ZOs being highly tissue specific and serving nonredundant functions. The evidence provided here for the expression of AHNAK1 in RGM1 cells and its association with ZO-2 may have significant implications. An important function of gastric epithelial cells is to provide a protective barrier and selective permeability of various substances between the external and internal compartments of the stomach. Paracellular permeability and intramembrane diffusion of various components between th e apical and basolateral membranes of epithelial cells is attributed to TGs. TJs are a majo r component of the junctional complex of epithelial cells (Figure 73) and are com posed of different types of transmembrane proteins, which connect to the cytoskeleton via adaptor/scaffold proteins including the ZOs. Therefore, the association with AHNA K1 with ZO-2 may affect the integrity of TGs of normal gastric epith elial cells. AHNAK1 does not possess any transmembrane domains, and therefore its expression and function is not at the site of the TGs located between epithelial cells, but in stead is mostly likely nuclear and/or cytoplamic. Although

PAGE 218

AHNAK1 was found to co-localiz e with ZO-2 at the cell boundary in confluent RGM1 cells, additional experiments will be necessary to determine if AHNAK1 associates with ZO-2 in the nucleus, which could prevent its translocation to the plasma membrane, where it binds to the cytoplasmic C termin i of junctional transm embrane proteins and link them to the actin cytoskeleton. The ex istance of ZO-2 in the nucleus has been reported, as Traweger et al. identified the localization of ZO-2 to the nucleus of migratory EC and subconfluent epithelial cells in response to environmental stress [420]. The function of AHNAK1 protien may be dependent on its ability to translocate from the nucleus to the plasma membrane The cell type-dependent subcellular distribution of AHNAK1 is likely attributed to AHNAK1s ability to translocate from the nucleus to the plasma membrane. For ex ample, in epithelial cells AHNAK1 has been shown to translocate from the nucleus to the plasma membrane in response to an increase in extracellular Ca2+ or stimulation of PKC [224]. Furthermore, AHNAK1s ability to associate with the plasma membrane may be due to N-myristoylation, as AHNAK1 contains nine potential in vitro N-myristolyation sites, in which N-myristoylation promotes membrane association [234]. In addition to being cell type-dependent, it is also plausible that AHNAK1s recruitm ent to the plasma membrane is cell cycle-dependent, as the phosphorylation state of AHNAK1 is subs tantially repressed in quiescent cells and its expression increases in the Go stage of the cell cycle [421]. The organization and integrity of epithe lial cells is crucia l for its function. Benaud et al. showed down-regulation of AHNAK1 affects the cell membrane cytoarchitecture of epithelial cells [226] A report by Hieda et al. provided evidence of desmoyokin/AHNAK1 being restrict ed to the desmosome of bovine snout epidermis and

PAGE 219

was suggested to play an role in plaque assembly [228]. Salim et al reported a role for AHNAK1 in the establishment of cell-matrix contacts of Schwann cells [221]. Taken together, these findings may suggest a role for AHNAK1 in the regulation of epithelial cell adhesion and permeability. Although this is the first report of AHNA K1 expression in surface epithelial cells of the stomach, Gentil et al. reported AHNAK1 positive staining in the muscularis mucosae and smooth muscle layers in the stom ach of adult mice [219] Similar to Gentil et al,. AHNAK1 expression in the muscularis mucosae and smooth muscle in the stomach of healthy human organ donors was observed (Figure 79). There are several explanations for AHNAK1 not previously be ing observed in the different secretory epithelial cells of the stomach. A difference in species, the use of different antibodies, and epitope accessibility are some explanat ions for the discrepancies in AHNAK1 immunoreactivity in the stomach. In addition to providing a selective barrier, the epithelium signals to innate immune cells in the mucosa to combat infection and repair wounds [422]. The gastric mucosal barrier is routinely exposed to tr auma, and since gastric mucosal restoration involves cell migration and proliferation (23), AHNAK1 may also serve a role in mediating each of these processes. The non-transformed RGM1 cell line was found to be an excellent model to investigat e gastric epithelial restoration in vitro [342], as it displays a tight phenotype in vitro Therefore, the RGM1 cell line is suitable for the determination of epithelial-regeneration and permeability changes in future studies.

PAGE 220

Figure73.Schematicofthejunctionalcomplexofepithelial cells.Thetightjunctions(TJs)constitutethemostapical componentofthejunctionalcomplex.Theadherensjunctions (Ajs)anchorsthecellstogetherthroughCa2+-dependentcell adhesionmolecules.Thedesmosomesjunctionsholdcells togethe r an d provideanchoringsitesfo r intermediate filaments.Gapjunctionsallowsmallmoleculestopassfrom thecytoplasmsofneighboringcells.

PAGE 221

MERGEAHNAK1C2 MERGE AHNAK1C2 (FITC) Fi74CllitifAHNAK1dZO 2tii ZO-2 NUCLEI (Texas Red) (DAPI) Fi gure 74 C o l oca li za ti on o f AHNAK1 an d ZO 2 pro t e i ns i n confluent RGM1 cells.DAPI was used to counterstain nuclei. Negative control (omission of AHNAK1 specific antibody)

PAGE 222

Figure75.SubcellularlocalizationofAHNAK1inRGM1 cells.B:ImmunofluorescentstainingofRGM1cellsusing antibodyspecificforAHNAK1C2illustratesthepresenceof AHNAK 1 (FITC green) predominanlty localized in the AHNAK 1 (FITC green) predominanlty localized in the cytoplasmandattheplasmamembrane.DAPIwasused tocounterstainthenucleus.Negativecontrol(omissionof AHNAK1specificantibody)

PAGE 223

Figure76.Schematicillustratingthevarioussectionsofthe stomach.Eachsectioniscomposedofdifferentcellswith ilid fi spec i a li ze d f unct i ons.

PAGE 224

Figure77.Histochemicalanalysisofrepresentativetissue sectionsfromhealthyhumanorganstomachdonors.Human stomach antrum (A) and body (B) ; Haematoxylin and Eosin (H stomach antrum (A) and body (B) ; Haematoxylin and Eosin (H andE)(left)PAS/AlcianBluestaining(right)

PAGE 225

Figure78.WesternblotanalysisofendogenousAHNAK1, NPRA d NPRC ti i i hlth h NPRA ,an d NPRC pro t e i nexpress i on i n h ea lth y h uma n stomach..(A)Immunoblotanalysisshowing(A)AHNAK1; (B)NPRA;(C)NPRCproteinexpressionindifferentregions fromthreehealthyhumanorganstomachdonors

PAGE 226

Figure79.Immunohistochemi stryanalysisofendogenous AHNAK1inhealthyhumanstomach.A:Negativecontrol (stainingintheabsenceofAHNAK1specificantibody);B: AHNAK1proteinimmunoreactivityinsurfaceepithelialcells ( SEC ) an d atthe b asolateral p lasmamembrane ( BPM ) ; C: () p () ; AHNAK1proteinimmunoreacivityincapillaries(C);D: AHNAK1proteinimmunoreactivityinmusclefibers(MF)from themuscularismucosae;E:AHNAK1proteinimmunoreactivity inthelaminapropriabutnotinthecellsofthegastricgland (GG)

PAGE 227

Figure 80 Knockdown of AHNAK 1 protein in RGM 1 cells Figure 80 Knockdown of AHNAK 1 protein in RGM 1 cells A:WesternblotanalysisofAHNAK1aftersiRNA knockdown.B:Densitometricanalysisof(A).MOCKrefers totheuseofnontargetingsiRNAinsteadofAHNAK1 SMARTpoolsiRNA.

PAGE 228

RFUs) 60000 70000 r escence Units ( 30000 40000 50000 60000 Relative Fluo r 0 10000 20000 Figure81.Invitropermeabilityassaydemonstratingtheroleof AHNAK1inmaintainingparacellularcellularpermeabilityand the b arrie r p ro p ertiesofRGM1cells.Each g rou p was p erformed pp gp p intriplicatesandtheresultsshownarerepresentativeoftwo independentexperiments.Controlsshownincludetheabsence ofacellmonolayer,EDTAtreatmentfor20minutes,andtheuse ofnontargeting(NT)siRNAinsteadofAHNAK1SMARTpool siRNA.

PAGE 229

References 1. Daniels, L.B. and A.S. Maisel, Natriuretic peptides. J Am Coll Cardiol, 2007. 50(25): p. 2357-68. 2. Wilkins, M.R., J. Redondo, and L.A. Brown, The natriuretic-peptide family. Lancet, 1997. 349(9061): p. 1307-10. 3. Wu, F., et al., Processing of pro-atrial natriure tic peptide by corin in cardiac myocytes. J Biol Chem, 2002. 277(19): p. 16900-5. 4. Yandle, T.G., Biochemistry of nat riuretic peptides. J Intern Med, 1994. 235(6): p. 561-76. 5. Vesely, D.L., et al., Atrial natriuretic hormone, vessel dilator, long-acting natriuretic hormone, and kaliuretic hormone decrease the circulating concentrations of CRH, corticotropin, and cortisol. J Clin Endocrinol Metab, 2001. 86(9): p. 4244-9. 6. Vesely, D.L., Natriuretic peptides and acute renal failure. Am J Physiol Renal Physiol, 2003. 285(2): p. F167-77. 7. Sawada, Y., et al., Stretch-induced hypertrophic growth of cardiocytes and processing of brain-type natriuretic peptide are controlled by proproteinprocessing endoprotease furin. J Biol Chem, 1997. 272(33): p. 20545-54. 8. Martinez-Rumayor, A., et al., Biology of the natriuretic peptides. Am J Cardiol, 2008. 101(3A): p. 3-8. 9. de Bold, A.J., B.G. Bruneau, and M.L. Kuroski de Bold, Mechanical and neuroendocrine regulation of the endocrine heart. Cardiovasc Res, 1996. 31(1): p. 7-18. 10. de Bold, A.J., Tissue fractionation studies on the relationship between an atrial natriuretic factor and specific atrial granules. Can J Physiol Pharmacol, 1982. 60(3): p. 324-30. 11. de Bold, A.J., et al., A rapid and potent natriuretic response to intravenous injection of atrial myocardial extract in rats. Reprinted from Life Sci. 28:89-94, 1981. J Am Soc Nephrol, 2001. 12(2): p. 403-9; disc ussion 403-8, 408-9. 12. Ruskoaho, H., Atrial natriuretic peptide: sy nthesis, release, and metabolism. Pharmacol Rev, 1992. 44(4): p. 479-602. 13. Rebsamen, M.C., et al., Role of cAMP and calcium influx in endothelin-1-induced ANP release in rat cardiomyocytes. Am J Physiol, 1997. 273(5 Pt 1): p. E922-31. 14. Levin, E.R., D.G. Gard ner, and W.K. Samson, Natriuretic peptides. N Engl J Med, 1998. 339(5): p. 321-8. 15. Bonow, R.O., New insights into the cardiac natriuretic peptides. Circulation, 1996. 93(11): p. 1946-50. 16. Cheung, B.M. and C.R. Kumana, Natriuretic peptides--relevance in cardiovascular disease. Jama, 1998. 280(23): p. 1983-4.

PAGE 230

17. Anand-Srivastava, M.B. and G.J. Trachte, Atrial natriuretic factor receptors and signal transduction mechanisms. Pharmacol Rev, 1993. 45(4): p. 455-97. 18. Hutchinson, H.G., et al., Mechanisms of natriuretic-peptide-induced growth inhibition of vascular smooth muscle cells. Cardiovasc Res, 1997. 35(1): p. 15867. 19. Cao, L. and D.G. Gardner, Natriuretic peptides inhibit DNA synthesis in cardiac fibroblasts. Hypertension, 1995. 25(2): p. 227-34. 20. Garg, U.C. and A. Hassid, Nitric oxide-generating vasodilators and 8-bromocyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J Clin Invest, 1989. 83(5): p. 1774-7. 21. Vesely, B.A., et al., Four peptides decrease th e number of human pancreatic adenocarcinoma cells. Eur J Clin Invest, 2003. 33 (11): p. 998-1005. 22. Dong, M.Q., et al., [Comparison of inhibitory effects of three natriur etic peptides on the proliferation of pulmonary arte ry smooth muscle cells of rats]. Sheng Li Xue Bao, 2000. 52(3): p. 252-4. 23. Hamad, A.M., S.R. Johnson, and A.J. Knox, Antiproliferative effects of NO and ANP in cultured human airway smooth muscle. Am J Physiol, 1999. 277(5 Pt 1): p. L910-8. 24. Wu, C.F., N.H. Bishopric, and R.E. Pratt, Atrial natriuretic peptide induces apoptosis in neonatal rat cardiac myocytes. J Biol Chem, 1997. 272 (23): p. 14860-6. 25. Suenobu, N., et al., Natriuretic peptides and nitr ic oxide induce endothelial apoptosis via a cGMP-dependent mechanism. Arterioscler Thromb Vasc Biol, 1999. 19(1): p. 140-6. 26. Rose, R.A., A.E. Lomax, and W.R. Giles, Inhibition of L-type Ca2+ current by Ctype natriuretic peptide in bullfrog atri al myocytes: an NPR-C-mediated effect. Am J Physiol Heart Circ Physiol, 2003. 285(6): p. H2454-62. 27. Rose, R.A. and W.R. Giles, Natriuretic peptide C recept or signalling in the heart and vasculature. J Physiol, 2008. 586(2): p. 353-66. 28. Rose, R.A., et al., C-type natriuretic peptide inhib its L-type Ca2+ current in rat magnocellular neurosecretory cells by activating the NPR-C receptor. J Neurophysiol, 2005. 94(1): p. 612-21. 29. Trachte, G.J., et al., C-type natriuretic peptide ne uromodulates via "clearance" receptors. Am J Physiol, 1995. 268(4 Pt 1): p. C978-84. 30. Murthy, K.S., et al., G protein-dependent activation of smooth muscle eNOS via natriuretic peptide clearance receptor. Am J Physiol, 1998. 275(6 Pt 1): p. C1409-16. 31. Murthy, K.S., et al., G(i-1)/G(i-2)-dependent signaling by single-transmembrane natriuretic peptide clearance receptor. Am J Physiol Gastrointest Liver Physiol, 2000. 278(6): p. G974-80. 32. Barletta, G., et al., Low-dose C-type natriuretic peptide does not affect cardiac and renal function in humans. Hypertension, 1998. 31(3): p. 802-8. 33. Pham, I., et al., Renal and vascular effects of Ctype and atrial natriuretic peptides in humans. Am J Physiol, 1997. 273(4 Pt 2): p. R1457-64.

PAGE 231

34. Chauhan, S.D., et al., Release of C-type natriuret ic peptide accounts for the biological activity of endothelium-d erived hyperpolarizing factor. Proc Natl Acad Sci U S A, 2003. 100(3): p. 1426-31. 35. Komatsu, Y., et al., Regulation of endothelial produc tion of C-type natriuretic peptide in coculture with vascular smoot h muscle cells. Role of the vascular natriuretic peptide system in vascular growth inhibition. Circ Res, 1996. 78(4): p. 606-14. 36. Yamahara, K., et al., Significance and therapeutic po tential of the natriuretic peptides/cGMP/cGMP-dependent protein kinase pathway in vascular regeneration. Proc Natl Acad Sci U S A, 2003. 100 (6): p. 3404-9. 37. Chusho, H., et al., Dwarfism and early death in mice lacking C-type natriuretic peptide. Proc Natl Acad Sci U S A, 2001. 98(7): p. 4016-21. 38. Komatsu, Y., et al., Significance of C-type natri uretic peptide (CNP) in endochondral ossification: analys is of CNP knockout mice. J Bone Miner Metab, 2002. 20(6): p. 331-6. 39. Mericq, V., et al., Regulation of fetal rat bone growth by C-type natriuretic peptide and cGMP. Pediatr Res, 2000. 47(2): p. 189-93. 40. Yasoda, A., et al., Natriuretic peptide regulation of endochondral ossification. Evidence for possible roles of the C-type natriuretic peptide/guanylyl cyclase-B pathway. J Biol Chem, 1998. 273(19): p. 11695-700. 41. Agoston, H., et al., C-type natriuretic peptide regulates endochondral bone growth through p38 MAP kinase-depe ndent and -independent pathways. BMC Dev Biol, 2007. 7: p. 18. 42. Maack, T., et al., Physiological role of silent recept ors of atrial natriuretic factor. Science, 1987. 238(4827): p. 675-8. 43. Roques, B.P., et al., Neutral endopeptidase 24.11: structure, inhibition, and experimental and clinical pharmacology. Pharmacol Rev, 1993. 45(1): p. 87-146. 44. Steinhelper, M.E., K.L. Cochrane, and L.J. Field, Hypotension in transgenic mice expressing atrial natriuretic factor fusion genes. Hypertension, 1990. 16(3): p. 301-7. 45. Oliver, P.M., et al., Natriuretic peptide receptor 1 expression influences blood pressures of mice in a dose-dependent manner. Proc Natl Acad Sci U S A, 1998. 95(5): p. 2547-51. 46. John, S.W., et al., Blood pressure and flu id-electrolyte bal ance in mice with reduced or absent ANP. Am J Physiol, 1996. 271(1 Pt 2): p. R 109-14. 47. Lopez, M.J., et al., Salt-resistant hypertension in mice lacking the guanylyl cyclase-A receptor for atrial natriuretic peptide. Nature, 1995. 378(6552): p. 658. 48. Lopez, M.J., D.L. Garbers, and M. Kuhn, The guanylyl cyclase-deficient mouse defines differential pathways of natriuretic peptide signaling. J Biol Chem, 1997. 272(37): p. 23064-8. 49. Matsukawa, N., et al., The natriuretic peptide clearance receptor locally modulates the physiologic al effects of the natr iuretic peptide system. Proc Natl Acad Sci U S A, 1999. 96 (13): p. 7403-8. 50. Tsutamoto, T., et al., Attenuation of compensation of endogenous cardiac natriuretic peptide system in chronic he art failure: prognostic role of plasma

PAGE 232

brain natriuretic peptide concentration in patients with chronic symptomatic left ventricular dysfunction. Circulation, 1997. 96(2): p. 509-16. 51. Ellinor, P.T., et al., Discordant atrial natriuretic peptide and brain natriuretic peptide levels in lone atrial fibrillation. J Am Coll Cardiol, 2005. 45(1): p. 82-6. 52. Dries, D.L., Relevance of molecular forms of brain natriuretic peptide for natriuretic peptide research. Hypertension, 2007. 49(5): p. 971-3. 53. Mukoyama, M., et al., Increased human brain natriur etic peptide in congestive heart failure. N Engl J Med, 1990. 323(11): p. 757-8. 54. Mukoyama, M., et al., Brain natriuretic peptide as a novel cardiac hormone in humans. Evidence for an exquisite dual na triuretic peptide system, atrial natriuretic peptide and br ain natriuretic peptide. J Clin Invest, 1991. 87(4): p. 1402-12. 55. Lang, C.C., et al., Effect of haemodialysis on plasma levels of brain natriuretic peptide in patients with chronic renal failure. Clin Sci (Lond), 1992. 82(2): p. 127-31. 56. Naruse, M., et al., Atrial and brain natriuretic peptides in cardiovascular diseases. Hypertension, 1994. 23(1 Suppl): p. I231-4. 57. Cody, R.J., et al., Atrial natriuretic factor in no rmal subjects and heart failure patients. Plasma levels and renal, hor monal, and hemodynamic responses to peptide infusion. J Clin Invest, 1986. 78(5): p. 1362-74. 58. Crozier, I.G., et al., Haemodynamic effects of atrial peptide infusion in heart failure. Lancet, 1986. 2(8518): p. 1242-5. 59. Sabbatini, M.E., et al., Atrial natriuretic factor stimulates exocrine pancreatic secretion in the rat through NPR-C receptors. Am J Physiol Gastrointest Liver Physiol, 2003. 285(5): p. G929-37. 60. Sabbatini, M.E., et al., C-type natriuretic peptide enhances amylase release through NPR-C receptors in the exocrine pancreas. Am J Physiol Gastrointest Liver Physiol, 2007. 293(5): p. G987-94. 61. Sabbatini, M.E., et al., Atrial natriuretic factor negatively modulates secretin intracellular signaling in the exocrine pancreas. Am J Physiol Gastrointest Liver Physiol, 2007. 292(1): p. G349-57. 62. Sabbatini, M.E., et al., NPR-C receptors are involved in C-type natriuretic peptide response on bile secretion. Regul Pept, 2003. 116(1-3): p. 13-20. 63. Sabbatini, M.E., et al., C-type natriuretic peptide stimulates pancreatic exocrine secretion in the rat: role of va gal afferent and efferent pathways. Eur J Pharm acol, 2007. 577(1-3): p. 192-202. 64. Puurunen, J. and H. Ruskoaho, Vagal-dependent stimulation of gastric acid secretion by intracerebroven tricularly administered atrial natriuretic peptide in anaesthetized rats. Eur J Pharmacol, 1987. 141(3): p. 493-5. 65. Stapelfeldt, W., et al., Effect of naloxone on vagally-induced gastric acid secretion in rats. Neuropeptides, 1988. 12(1): p. 13-20. 66. Gower, W.R., Jr., et al., Atrial natriuretic peptide gene expression in the rat gastrointestinal tract. Biochem Biophys Res Commun, 1994. 202(1): p. 562-70. 67. Gower, W.R., Jr., et al., Regulation of atrial natriure tic peptide gene expression in gastric antrum by fasting. Am J Physiol Regul Inte gr Comp Physiol, 2000. 278(3): p. R770-80.

PAGE 233

68. Schulz, S. and S.A. Waldman, The guanylyl cyclase family of natriuretic peptide receptors. Vitam Horm, 1999. 57: p. 123-51. 69. Garbers, D.L., The guanylyl cyclase receptors. Zygote, 2000. 8 Suppl 1: p. S24-5. 70. Drewett, J.G. and D.L. Garbers, The family of guanylyl cyclase receptors and their ligands. Endocr Rev, 1994. 15(2): p. 135-62. 71. Yuen, P.S. and D.L. Garbers, Guanylyl cyclase-linked receptors. Annu Rev Neurosci, 1992. 15: p. 193-225. 72. Garbers, D.L., Guanylyl cyclaselinked receptors. Pharmacol Ther, 1991. 50(3): p. 337-45. 73. Wedel, B.J. and D.L. Garbers, New insights on the f unctions of the guanylyl cyclase receptors. FEBS Lett, 1997. 410(1): p. 29-33. 74. Garbers, D.L., Guanylyl cyclase receptors and their endocrine, paracrine, and autocrine ligands. Cell, 1992. 71(1): p. 1-4. 75. Garbers, D.L. and D.G. Lowe, Guanylyl cyclase receptors. J Biol Chem, 1994. 269(49): p. 30741-4. 76. Potter, L.R., S. Abbey-Hosch, and D.M. Dickey, Natriuretic peptides, their receptors, and cyclic guanosine monophosphate-dependent signaling functions. Endocr Rev, 2006. 27(1): p. 47-72. 77. Koller, K.J., et al., Selective activation of the B natri uretic peptide receptor by Ctype natriuretic peptide (CNP). Science, 1991. 252(5002): p. 120-3. 78. Suga, S., et al., Receptor selectivity of natriuretic peptide family, atrial natriuretic peptide, brain natriuretic peptide, and C-type natriuretic peptide. Endocrinology, 1992. 130(1): p. 229-39. 79. Potter, L.R. and T. Hunter, Guanylyl cyclase-linked natriuretic peptide receptors: structure and regulation. J Biol Chem, 2001. 276 (9): p. 6057-60. 80. Potthast, R. and L.R. Potter, Phosphorylation-dependent regulation of the guanylyl cyclase-linked natriur etic peptide receptors. Peptides, 2005. 26(6): p. 1001-8. 81. Potter, L.R. and T. Hunter, Identification and characterization of the phosphorylation sites of the guanylyl cyclase-linked natriuretic peptide receptors A and B. Methods, 1999. 19(4): p. 506-20. 82. Anand-Srivastava, M.B., Natriuretic peptide recept or-C signaling and regulation. Peptides, 2005. 26(6): p. 1044-59. 83. Itakura, M., H. Suzuki, and S. Hirose, Structural analysis of natriuretic peptide receptor-C by truncation and site-directed mutagenesis. Biochem J, 1997. 322 ( Pt 2) : p. 585-90. 84. Brown, J. and Z. Zuo, Receptor proteins and biological effects of C-type natriuretic peptides in the renal glomerulus of the rat. Am J Physiol, 1994. 266(4 Pt 2): p. R1383-94. 85. Ogawa, H., et al., Crystal structure of hormonebound atrial natriuretic peptide receptor extracellular domain: rotation mechanism for transmembrane signal transduction. J Biol Chem, 2004. 279 (27): p. 28625-31. 86. Scarborough, R.M., et al., Truncated atrial natri uretic peptide analogs. Comparison between receptor binding and stimulation of cyclic GMP accumulation in cultured vasc ular smooth muscle cells. J Biol Chem, 1986. 261(28): p. 12960-4.

PAGE 234

87. Vesely, D.L., et al., Four cardiac hormones eliminate up to two-thirds of human breast cancers in athymic mice. In vivo 2007. 21(6): p. 973-8. 88. Vesely, D.L., et al., Elimination of up to 80% of human pancreatic adenocarcinomas in athymic mice by cardiac hormones. In vivo 2007. 21(3): p. 445-51. 89. Vesely, B.A., et al., Urodilatin and four cardiac hor mones decrease human renal carcinoma cell numbers. Eur J Clin Invest, 2006. 36(11): p. 810-9. 90. Vesely, B.A., et al., Four peptide hormones' specific decrease (up to 97%) of human prostate carcinoma cells. Eur J Clin Invest, 2005. 35(11): p. 700-10. 91. Eichelbaum, E.J., et al., Four cardiac hormones eliminate up to 82% of human medullary thyroid carcinoma cells within 24 hours. Endocrine, 2006. 30(3): p. 325-32. 92. Vesely, B.A., et al., Four cardiac hormones eliminate 4-fold more human glioblastoma cells than th e green mamba snake peptide. Cancer Lett, 2007. 254(1): p. 94-101. 93. Gower, W.R., et al., Four peptides decrease human colon adenocarcinoma cell number and DNA synthesis via cyclic GMP. Int J Gastrointest Cancer, 2005. 36(2): p. 77-87. 94. Vesely, B.A., et al., Four cardiac hormones cause ce ll death of melanoma cells and inhibit their DNA synthesis. Am J Med Sci, 2007. 334(5): p. 342-9. 95. Vesely, B.A., et al., Primary malignant tumors of the heart: four cardiovascular hormones decrease the number and DNA sy nthesis of human angiosarcoma cells. Cardiology, 2006. 105(4): p. 226-33. 96. Vesely, B.A., et al., Five cardiac hormones decrease the number of human smallcell lung cancer cells. Eur J Clin Invest, 2005. 35 (6): p. 388-98. 97. Eichelbaum, E.J., et al., Cardiac and kidney hormones cure up to 86% of human small-cell lung cancers in mice. Eur J Clin Invest, 2008. 38(8): p. 562-70. 98. Anand-Srivastava, M.B., Downregulation of atrial natriuretic peptide ANP-C receptor is associated with alterations in G-protein expression in A10 smooth muscle cells. Biochemistry, 2000. 39(21): p. 6503-13. 99. Alli, A.A. and W.R. Gower, Jr., The C type natriuretic peptide receptor tethers AHNAK1 at the plasma membrane to potentiate arachidonic acid induced calcium mobilization. Am J Physiol Cell Physiol, 2009. 100. Burgess, M.D., et al., C-type natriuretic peptide receptor expression in pancreatic alpha cells. Histochem Cell Biol, 2009. 132(1): p. 95-103. 101. Cohen, D., et al., Molecular determinants of the clearance function of type C receptors of natriuretic peptides. J Biol Chem, 1996. 271(16): p. 9863-9. 102. Nussenzveig, D.R., J.A. Lewicki, and T. Maack, Cellular mechanisms of the clearance function of type C recepto rs of atrial natriuretic factor. J Biol Chem, 1990. 265(34): p. 20952-8. 103. Rademaker, M.T., et al., Clearance receptors and endopeptidase: equal role in natriuretic peptide metabolism in heart failure. Am J Physiol, 1997. 273 (5 Pt 2): p. H2372-9. 104. Chiu, P.J., et al., Influence of C-ANF receptor and neutral endopeptidase on pharmacokinetics of ANF in rats. Am J Physiol, 1991. 260(1 Pt 2): p. R208-16.

PAGE 235

105. Kukkonen, P., O. Vuolteenaho, and H. Ruskoaho, Basal and volume expansionstimulated plasma atrial natriuretic peptide concentrations and hemodynamics in conscious rats: effects of SCH 39.370, an endopeptidase inhibitor, and C-ANF-(423), a clearance receptor ligand. Endocrinology, 1992. 130(2): p. 755-65. 106. Charles, C.J., et al., Clearance receptors and endopeptidase 24.11: equal role in natriuretic peptide metabolism in conscious sheep. Am J Physiol, 1996. 271 (2 Pt 2): p. R373-80. 107. Wegner, M., D. Ganten, and J.P. Stasch, Neutral endopeptidase inhibition potentiates the effects of natriuretic peptides in renin transgenic rats. Hypertens Res, 1996. 19(4): p. 229-38. 108. Stults, J.T., et al., The disulfide linkages and glycosylation sites of the human natriuretic peptide receptor-C homodimer. Biochemistry, 1994. 33(37): p. 1137281. 109. He, X., et al., Allosteric activation of a spring-lo aded natriuretic peptide receptor dimer by hormone. Science, 2001. 293(5535): p. 1657-62. 110. Sarzani, R., et al., Fasting inhibits natriuretic peptides clearance receptor expression in rat adipose tissue. J Hypertens, 1995. 13(11): p. 1241-6. 111. Chabrier, P.E., et al., Regulation of atrial natriur etic factor receptors by angiotensin II in rat vascular smooth muscle cells. J Biol Chem, 1988. 263 (26): p. 13199-202. 112. Yoshimoto, T., et al., Angiotensin II-dependent down-regulation of vascular natriuretic peptide type C receptor ge ne expression in hypertensive rats. Endocrinology, 1996. 137(3): p. 1102-7. 113. Boumati, M., Y. Li, and M.B. Anand-Srivastava, Modulation of ANP-C receptor signaling by endothelin-1 in A-10 smooth muscle cells. Arch Biochem Biophys, 2002. 401(2): p. 178-86. 114. Kishimoto, I., et al., Natriuretic peptide clearance receptor is transcriptionally down-regulated by beta 2-adrenergic stimul ation in vascular smooth muscle cells. J Biol Chem, 1994. 269(45): p. 28300-8. 115. Agui, T., et al., Opposite actions of transforming gr owth factor-beta 1 on the gene expression of atrial natriuretic peptid e biological and clearance receptors in a murine thymic stromal cell line. J Biochem, 1995. 118(3): p. 500-7. 116. Sun, J.Z., et al., Tyrosine kinase receptor activation inhibits NPR-C in lung arterial smooth muscle cells. Am J Physiol Lung Cell Mol Physiol, 2001. 281(1): p. L155-63. 117. Itoh, K., et al., Gene regulation of atrial natriur etic peptide A, B, and C receptors in rat glomeruli. Exp Nephrol, 1999. 7(4): p. 328-36. 118. Ardaillou, N., et al., Dexamethasone upregulates ANP C-receptor protein in human mesangial cells w ithout affecting mRNA. Am J Physiol, 1996. 270(3 Pt 2): p. F440-6. 119. Lu, S.Y., et al., Down-regulation of C-type natriuretic peptide receptor by vasonatrin peptide in cardiac myocytes and fibroblasts. Acta Pharmacol Sin, 2004. 25(4): p. 424-30. 120. Hirata, Y., et al., Regulation of atrial natriuretic peptide receptors in cultured vascular smooth muscle cells of rat. Biochem Biophys Res Commun, 1986. 138(1): p. 405-12.

PAGE 236

121. Arejian, M., Y. Li, and M.B. Anand-Srivastava, Nitric oxide attenuates the expression of natriuretic peptide recep tor C and associated adenylyl cyclase signaling in aortic vascular smoot h muscle cells: role of MAPK. Am J Physiol Heart Circ Physiol, 2009. 296(6): p. H1859-67. 122. Gower, W.R., Jr., et al., Identification, regulation and an ti-proliferative role of the NPR-C receptor in gastric epithelial cells. Mol Cell Biochem, 2006. 293(1-2): p. 103-18. 123. Klinger, J.R., et al., Downregulation of pulmonary atrial natriuretic peptide receptors in rats exposed to chronic hypoxia. J Appl Physiol, 1994. 77(3): p. 1309-16. 124. Li, H., et al., Selective downregulation of ANP-clearance-receptor gene expression in lung of rats adapted to hypoxia. Am J Physiol, 1995. 268(2 Pt 1): p. L328-35. 125. Sun, J.Z., et al., Hypoxia reduces atrial natriuret ic peptide clearance receptor gene expression in ANP knockout mice. Am J Physiol Lung Cell Mol Physiol, 2000. 279(3): p. L511-9. 126. Sun, J.Z., et al., Dietary salt supplementation se lectively downregulates NPR-C receptor expression in kidney independently of ANP. Am J Physiol Renal Physiol, 2002. 282(2): p. F220-7. 127. Nagase, M., et al., Role of natriuretic peptide receptor type C in Dahl saltsensitive hypertensive rats. Hypertension, 1997. 30(2 Pt 1): p. 177-83. 128. Luk, J.K., E.F. Wong, and N.L. Wong, Downregulation of atrial natriuretic factor clearance receptors in experimental chronic renal failure rats. Am J Physiol, 1995. 269(3 Pt 2): p. H902-8. 129. Naruse, M., et al., [Pathophysiological significance of the natriuretic peptide system: receptor subtype as another key factor]. Nippon Yakurigaku Zasshi, 1998. 112(3): p. 147-54. 130. Lefkowitz, R.J., Seven transmembrane receptors: something old, something new. Acta Physiol (Oxf), 2007. 190(1): p. 9-19. 131. Anand-Srivastava, M.B. and M. Cantin, Atrial natriuretic fa ctor receptors are negatively coupled to adenylate cyclas e in cultured atrial and ventricular cardiocytes. Biochem Biophys Res Commun, 1986. 138(1): p. 427-36. 132. Anand-Srivastava, M.B., A.K. Srivastava, and M. Cantin, Pertussis toxin attenuates atrial natriuretic factor-mediated inhibition of adenylate cyclase. Involvement of inhibitory guanine nucleotide regulatory protein. J Biol Chem, 1987. 262(11): p. 4931-4. 133. Anand-Srivastava, M.B., P.D. Sehl, and D.G. Lowe, Cytoplasmic domain of natriuretic peptide receptor-C inhibits adenylyl cyclase. Involvement of a pertussis toxin-sensitive G protein. J Biol Chem 1996. 271(32): p. 19324-9. 134. Pagano, M. and M.B. Anand-Srivastava, Cytoplasmic domain of natriuretic peptide receptor C constitutes Gi activator sequences that inhibit adenylyl cyclase activity. J Biol Chem, 2001. 276(25): p. 22064-70. 135. Zhou, H. and K.S. Murthy, Identification of the G prot ein-activating sequence of the single-transmembrane natriuretic peptide receptor C (NPR-C). Am J Physiol Cell Physiol, 2003. 284(5): p. C1255-61.

PAGE 237

136. Kiemer, A.K., et al., Inhibition of cyclooxygenase2 by natriuretic peptides. Endocrinology, 2002. 143(3): p. 846-52. 137. Levin, E.R. and H.J. Frank, Natriuretic peptides inhibit rat astroglial proliferation: mediation by C receptor. Am J Physiol, 1991. 261(2 Pt 2): p. R4537. 138. Hu, R.M., et al., Atrial natriuretic peptide inhibi ts the production and secretion of endothelin from cultured endothelial ce lls. Mediation through the C receptor. J Biol Chem, 1992. 267(24): p. 17384-9. 139. Johnson, B.G., G.J. Trachte, and J.G. Drewett, Neuromodulatory effect of the atrial natriuretic factor clearance recep tor binding peptide, cANF(4-23)-NH2 in rabbit isolated vasa deferentia. J Pharmacol Exp Ther, 1991. 257(2): p. 720-6. 140. Drewett, J.G., R.J. Ziegler, and G.J. Trachte, Neuromodulatory effects of atrial natriuretic peptides correlate with an i nhibition of adenylate cyclase but not an activation of guanylate cyclase. J Pharmacol Exp Ther, 1992. 260(2): p. 689-96. 141. Mouawad, R., Y. Li, and M.B. Anand-Srivastava, Atrial natriuretic peptide-C receptor-induced attenuation of adenylyl cyclase signaling activates phosphatidylinositol turnover in A 10 vascular smooth muscle cells. Mol Pharmacol, 2004. 65(4): p. 917-24. 142. Prins, B.A., et al., Atrial natriuretic peptide inhi bits mitogen-activated protein kinase through the clearance receptor. Potential role in the inhibition of astrocyte proliferation. J Biol Chem, 1996. 271 (24): p. 14156-62. 143. Rose, R.A., et al., Effects of C-type natri uretic peptide on ionic currents in mouse sinoatrial node: a role for the NPR-C receptor. Am J Physiol Heart Circ Physiol, 2004. 286(5): p. H1970-7. 144. Cahill, P.A. and A. Hassid, Clearance receptor-binding at rial natriuretic peptides inhibit mitogenesis and proliferation of rat aortic smooth muscle cells. Biochem Biophys Res Commun, 1991. 179(3): p. 1606-13. 145. Itoh, H., et al., Atrial natriuretic pol ypeptide as a novel antigrowth factor of endothelial cells. Hypertension, 1992. 19(6 Pt 2): p. 758-61. 146. Lelievre, V., et al., Proliferative actions of natriuretic peptides on neuroblastoma cells. Involvement of guanylyl cyclase and non-guanylyl cyclase pathways. J Biol Chem, 2001. 276(47): p. 43668-76. 147. Hempel, A., et al., Atrial natriuretic peptide clea rance receptor participates in modulating endothelial permeability. Am J Physiol, 1998. 275 (5 Pt 2): p. H181825. 148. Pedram, A., et al., Vasoactive peptides modulate vasc ular endothelial cell growth factor production and endothelial cell proliferation and invasion. J Biol Chem, 1997. 272(27): p. 17097-103. 149. Jaubert, J., et al., Three new allelic mouse mutations that cause skeletal overgrowth involve the natriuretic peptide receptor C gene (Npr3). Proc Natl Acad Sci U S A, 1999. 96 (18): p. 10278-83. 150. Murakami, A., et al., X-arrestin: a new retinal arrestin mapping to the X chromosome. FEBS Lett, 1993. 334(2): p. 203-9. 151. Shinohara, T., et al., Primary and secondary structure of bovine retinal S antigen (48-kDa protein). Proc Natl Acad Sci U S A, 1987. 84(20): p. 6975-9.

PAGE 238

152. Lohse, M.J., et al., beta-Arrestin: a protein that regulates beta-adrenergic receptor function. Science, 1990. 248(4962): p. 1547-50. 153. Attramadal, H., et al., Beta-arrestin2, a novel member of the arrestin/betaarrestin gene family. J Biol Chem, 1992. 267(25): p. 17882-90. 154. Luttrell, L.M. and R.J. Lefkowitz, The role of beta-arrestins in the termination and transduction of G-protein-coupled receptor signals. J Cell Sci, 2002. 115(Pt 3): p. 455-65. 155. Pierce, K.L., R.T. Premont, and R.J. Lefkowitz, Seven-transmembrane receptors. Nat Rev Mol Cell Biol, 2002. 3(9): p. 639-50. 156. Lefkowitz, R.J., A magnificent time with the "magnificent seven" transmembrane spanning receptors. Circ Res, 2003. 92(4): p. 342-4. 157. Lefkowitz, R.J., K.L. Pierce, and L.M. Luttrell, Dancing with different partners: protein kinase a phosphorylation of seven membrane-spanning receptors regulates their G prot ein-coupling specificity. Mol Pharmacol, 2002. 62(5): p. 971-4. 158. Shenoy, S.K. and R.J. Lefkowitz, Seven-transmembrane receptor signaling through beta-arrestin. Sci STKE, 2005. 2005(308): p. cm10. 159. Ahn, S., et al., Desensitization, internalization, and signaling functions of betaarrestins demonstrated by RNA interference. Proc Natl Acad Sci U S A, 2003. 100(4): p. 1740-4. 160. Reiter, E. and R.J. Lefkowitz, GRKs and beta-arrestins: roles in receptor silencing, trafficki ng and signaling. Trends Endocrinol Metab, 2006. 17(4): p. 159-65. 161. Premont, R.T., et al., Identification, purifica tion, and characterization of GRK5, a member of the family of G pr otein-coupled receptor kinases. J Biol Chem, 1994. 269(9): p. 6832-41. 162. Yang, W. and S.H. Xia, Mechanisms of regulation and function of G-proteincoupled receptor kinases. World J Gastroenterol, 2006. 12(48): p. 7753-7. 163. Sobierajska, K., H. Fabczak, and S. Fabczak, [Mechanisms of regulation and function of G-protein coupled receptor kinases]. Postepy Biochem, 2005. 51(4): p. 421-9. 164. Pitcher, J.A., N.J. Freedman, and R.J. Lefkowitz, G protein-coupled receptor kinases. Annu Rev Biochem, 1998. 67: p. 653-92. 165. Palczewski, K. and J.L. Benovic, G-protein-coupled receptor kinases. Trends Biochem Sci, 1991. 16(10): p. 387-91. 166. Zidar, D.A., et al., Selective engagement of G prot ein coupled receptor kinases (GRKs) encodes distinct f unctions of biased ligands. Proc N atl Acad Sci U S A, 2009. 106(24): p. 9649-54. 167. Violin, J.D. and R.J. Lefkowitz, Beta-arrestin-biased ligands at seventransmembrane receptors. Trends Pharmacol Sci, 2007. 28(8): p. 416-22. 168. Lefkowitz, R.J., G protein-coupled receptor kinases. Cell, 1993. 74(3): p. 409-12. 169. Krupnick, J.G., et al., Arrestin/clathrin interaction. Localization of the clathrin binding domain of nonvisual arre stins to the carboxy terminus. J Biol Chem, 1997. 272(23): p. 15011-6.

PAGE 239

170. Laporte, S.A., et al., The interaction of beta-arrestin with the AP-2 adaptor is required for the clustering of beta 2-adren ergic receptor into clathrin-coated pits. J Biol Chem, 2000. 275(30): p. 23120-6. 171. Lin, F.T., et al., Feedback regulation of beta-arres tin1 function by extracellular signal-regulated kinases. J Biol Chem, 1999. 274 (23): p. 15971-4. 172. Shenoy, S.K., et al., Regulation of receptor fate by ubiquitination of activated beta 2-adrenergic receptor and beta-arrestin. Science, 2001. 294(5545): p. 130713. 173. Shenoy, S.K., et al., Beta-arrestin-dependent signaling and trafficking of 7transmembrane receptors is reciprocally regulated by the deubiquitinase USP33 and the E3 ligase Mdm2. Proc Natl Acad Sci U S A, 2009. 106 (16): p. 6650-5. 174. Sibley, D.R., et al., Phosphorylation/dephosphorylati on of the beta-adrenergic receptor regulates its functional coupli ng to adenylate cyclase and subcellular distribution. Proc Natl Acad Sci U S A, 1986. 83(24): p. 9408-12. 175. Ferguson, S.S., Evolving concepts in G proteincoupled receptor endocytosis: the role in receptor dese nsitization and signaling. Pharmacol Rev, 2001. 53 (1): p. 124. 176. DeWire, S.M., et al., Beta-arrestins and cell signaling. Annu Rev Physiol, 2007. 69: p. 483-510. 177. Ali, N. and D.K. Agrawal, Guanine nucleotide binding re gulatory proteins: their characteristics and identification. J Pharmacol Toxicol Methods, 1994. 32(4): p. 187-96. 178. Macara, I.G., et al., The Ras superfamily of GTPases. Faseb J, 1996. 10(5): p. 625-30. 179. Feig, L.A., Guanine-nucleotide exchange factors: a family of positive regulators of Ras and related GTPases. Curr Opin Cell Biol, 1994. 6(2): p. 204-11. 180. Schmidt, A. and A. Hall, Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes Dev, 2002. 16(13): p. 1587-609. 181. Olson, M.F., Guanine nucleotide exchange factors for the Rho GTPases: a role in human disease? J Mol Med, 1996. 74(10): p. 563-71. 182. Overbeck, A.F., et al., Guanine nucleotide exchange factors: activators of Ras superfamily proteins. Mol Reprod Dev, 1995. 42(4): p. 468-76. 183. Quilliam, L.A., et al., Guanine nucleotide exchange factors: activators of the Ras superfamily of proteins. Bioessays, 1995. 17(5): p. 395-404. 184. Scheffzek, K. and M.R. Ahmadian, GTPase activating proteins: structural and functional insights 18 years after discovery. Cell Mol Life Sci, 2005. 62(24): p. 3014-38. 185. Gamblin, S.J. and S.J. Smerdon, GTPase-activating proteins and their complexes. Curr Opin Struct Biol, 1998. 8(2): p. 195-201. 186. Ross, E.M., G protein GTPase-activating pr oteins: regulation of speed, amplitude, and signaling selectivity. Recent Prog Horm Res, 1995. 50: p. 207-21. 187. Bollag, G. and F. McCormick, GTPase activating proteins. Semin Cancer Biol, 1992. 3(4): p. 199-208. 188. Donovan, S., K.M. Shannon, and G. Bollag, GTPase activating proteins: critical regulators of intracellular signaling. Biochim Biophys Acta, 2002. 1602(1): p. 23-45.

PAGE 240

189. Turner, S.J., et al., Effects of lovastatin on Rho isoform expression, activity, and association with guanine nucleo tide dissociation inhibitors. Biochem Pharmacol, 2008. 75(2): p. 405-13. 190. Marrari, Y., et al., Assembly and trafficking of heterotrimeric G proteins. Biochemistry, 2007. 46(26): p. 7665-77. 191. Johnston, C.A. and D.P. Siderovski, Receptor-mediated activation of heterotrimeric G-proteins: current structural insights. Mol Pharmacol, 2007. 72(2): p. 219-30. 192. Oldham, W.M. and H.E. Hamm, Structural basis of functi on in heterotrimeric G proteins. Q Rev Biophys, 2006. 39(2): p. 117-66. 193. Hampoelz, B. and J.A. Knoblich, Heterotrimeric G proteins: new tricks for an old dog. Cell, 2004. 119(4): p. 453-6. 194. Hildebrandt, J.D., Role of subunit diversity in signaling by heterotrimeric G proteins. Biochem Pharmacol, 1997. 54(3): p. 325-39. 195. Hunt, T.W., R.C. Carroll, and E.G. Peralta, Heterotrimeric G pr oteins containing G alpha i3 regulate multiple effector enzymes in the same cell. Activation of phospholipases C and A2 and inhibition of adenylyl cyclase. J Biol Chem, 1994. 269(47): p. 29565-70. 196. Rebois, R.V., et al., Heterotrimeric G proteins form stable complexes with adenylyl cyclase and Kir3.1 channels in living cells. J Cell Sci, 2006. 119(Pt 13): p. 2807-18. 197. Wittpoth, C., et al., Regions on adenylyl cyclase that are necessary for inhibition of activity by beta gamma and G(ialpha) s ubunits of heterotrimeric G proteins. Proc Natl Acad Sci U S A, 1999. 96(17): p. 9551-6. 198. Wing, M.R., et al., Activation of phospholipase C-ep silon by heterotrimeric G protein betagamma-subunits. J Biol Chem, 2001. 276(51): p. 48257-61. 199. Jiang, H., D. Wu, and M.I. Simon, Activation of phospholipase C beta 4 by heterotrimeric GTP-binding proteins. J Biol Chem, 1994. 269 (10): p. 7593-6. 200. Katz, A., D. Wu, and M.I. Simon, Subunits beta gamma of heterotrimeric G protein activate beta 2 is oform of phospholipase C. Nature, 1992. 360(6405): p. 686-9. 201. Domenighini, M., et al., Computer modelling of the NAD binding site of ADPribosylating toxins: active-site st ructure and mechanism of NAD binding. Mol Microbiol, 1991. 5(1): p. 23-31. 202. Merritt, E.A. and W.G. Hol, AB5 toxins. Curr Opin Struct Biol, 1995. 5(2): p. 165-71. 203. el Baya, A., et al., Pertussis toxin. Entry into cells and enzymatic activity. Adv Exp Med Biol, 1997. 419: p. 83-6. 204. Chinnapen, D.J., et al., Rafting with cholera toxin: endocytosis and trafficking from plasma membrane to ER. FEMS Microbiol Lett, 2007. 266 (2): p. 129-37. 205. Sunahara, R.K. and R. Taussig, Isoforms of mammalian adenylyl cyclase: multiplicities of signaling. Mol Interv, 2002. 2(3): p. 168-84. 206. Hanoune, J. and N. Defer, Regulation and role of ade nylyl cyclase isoforms. Annu Rev Pharmacol Toxicol, 2001. 41: p. 145-74. 207. Nowak, J.Z. and J.B. Zawilska, [Adenylyl cyclase--isoforms, regulation and function]. Postepy Hig Med Dosw, 1999. 53(2): p. 147-72.

PAGE 241

208. Dessauer, C.W. and A.G. Gilman, The catalytic mechanism of mammalian adenylyl cyclase. Equilibrium binding and ki netic analysis of P-site inhibition. J Biol Chem, 1997. 272(44): p. 27787-95. 209. Dessauer, C.W., et al., The interactions of adenyla te cyclases with P-site inhibitors. Trends Pharmacol Sci, 1999. 20(5): p. 205-10. 210. Xia, Z., et al., The type III calcium/calmodulin-sensitive adenylyl cyclase is not specific to olfactory sensory neurons. Neurosci Lett, 1992. 144 (1-2): p. 169-73. 211. Buck, J., et al., Cytosolic adenylyl cyclase define s a unique signaling molecule in mammals. Proc Natl Acad Sci U S A, 1999. 96(1): p. 79-84. 212. Chiono, M., et al., Capacitative Ca2+ entry exclusi vely inhibits cAMP synthesis in C6-2B glioma cells. Evidence that phy siologically evoked C a2+ entry regulates Ca(2+)-inhibitable adenylyl c yclase in non-excitable cells. J Biol Chem, 1995. 270(3): p. 1149-55. 213. Braun, T., Purification of soluble form of adenylyl cyclase from testes. Methods Enzymol, 1991. 195: p. 130-6. 214. Johnson, R.A. and I. Shoshani, Preparation and use of "P"-site-targeted affinity ligands for adenylyl cyclases. Methods Enzymol, 1994. 238: p. 56-71. 215. Hashimoto, T., et al., Desmoyokin, a 680 kDa keratinocyte plasma membraneassociated protein, is ho mologous to the protein en coded by human gene AHNAK. J Cell Sci, 1993. 105 ( Pt 2) : p. 275-86. 216. Shtivelman, E., F.E. Cohen, and J.M. Bishop, A human gene (AHNAK) encoding an unusually large protein with a 1 .2-microns polyionic rod structure. Proc Natl Acad Sci U S A, 1992. 89 (12): p. 5472-6. 217. Komuro, A., et al., The AHNAKs are a class of giant propeller-like proteins that associate with calcium channel proteins of cardiomyocytes and other cells. Proc Natl Acad Sci U S A, 2004. 101(12): p. 4053-8. 218. Kudoh, J., et al., Localization of the human AHNAK/desmoyokin gene (AHNAK) to chromosome band 11q12 by somatic cell hybrid analysis and fluorescence in situ hybridization. Cytogenet Cell Genet, 1995. 70 (3-4): p. 218-20. 219. Gentil, B.J., et al., Expression of the giant prot ein AHNAK (desmoyokin) in muscle and lining epithelial cells. J Histochem Cytochem, 2003. 51(3): p. 339-48. 220. Kingsley, P.D., et al., Subtractive hybridization reveal s tissue-specific expression of ahnak during embryonic development. Dev Growth Differ, 2001. 43(2): p. 13343. 221. Salim, C., et al., The giant protein AHNAK invo lved in morphogenesis and laminin substrate adhesion of myelinating Schwann cells. Glia, 2009. 57 (5): p. 535-49. 222. Matza, D., et al., Requirement for AHNAK1-mediated calcium signaling during T lymphocyte cytolysis. Proc Natl Acad Sci U S A, 2009. 106(24): p. 9785-90. 223. Nie, Z., et al., C-Terminus of desmoyokin/AHNAK protein is responsible for its translocation betw een the nucleus and cytoplasm. J Invest Dermatol, 2000. 114(5): p. 1044-9. 224. Hashimoto, T., et al., Regulation of translocation of the desmoyokin/AHNAK protein to the plasma membrane in keratinocytes by protein kinase C. Exp Cell Res, 1995. 217(2): p. 258-66.

PAGE 242

225. Sussman, J., et al., Protein kinase B phosphorylates AHNAK and regulates its subcellular localization. J Cell Biol, 2001. 154(5): p. 1019-30. 226. Benaud, C., et al., AHNAK interaction with the annexin 2/S100A10 complex regulates cell membr ane cytoarchitecture. J Cell Biol, 2004. 164(1): p. 133-44. 227. Zuber, J., et al., A genome-wide survey of RAS transformation targets. Nat Genet, 2000. 24(2): p. 144-52. 228. Hieda, Y., S. Tsukita, and S. Tsukita, A new high molecular mass protein showing unique localization in desmosomal plaque. J Cell Biol, 1989. 109(4 Pt 1): p. 1511-8. 229. Gentil, B.J., et al., The giant protein AHNAK is a sp ecific target for the calciumand zinc-binding S100B protein: potential implications for Ca2+ homeostasis regulation by S100B. J Biol Chem, 2001. 276(26): p. 23253-61. 230. Borgonovo, B., et al., Regulated exocytosis: a novel widely expressed system. Nat Cell Biol, 2002. 4(12): p. 955-62. 231. Huang, Y., et al., AHNAK, a novel component of th e dysferlin protein complex, redistributes to the cytoplasm with dysf erlin during skeletal muscle regeneration. Faseb J, 2007. 21(3): p. 732-42. 232. Gentil, B.J., et al., Specific AHNAK expression in brain endothelial cells with barrier properties. J Cell Physiol, 2005. 203(2): p. 362-71. 233. Haase, H., et al., Signaling from beta-adrenocepto r to L-type calcium channel: identification of a novel cardiac protein kinase A target possessing similarities to AHNAK. Faseb J, 1999. 13(15): p. 2161-72. 234. Hohaus, A., et al., The carboxyl-terminal region of ahnak provides a link between cardiac L-type Ca2+ channels and the actin-based cytoskeleton. Faseb J, 2002. 16(10): p. 1205-16. 235. Stiff, T., et al., AHNAK interacts with the DNA ligase IV-XRCC4 complex and stimulates DNA ligase IV-med iated double-stranded ligation. DNA Repair (Amst), 2004. 3(3): p. 245-56. 236. Matza, D., et al., A scaffold protein, AHNAK1, is required for calcium signaling during T cell activation. Immunity, 2008. 28(1): p. 64-74. 237. Sekiya, F., et al., AHNAK, a protein that bind s and activates phospholipase Cgamma1 in the presence of arachidonic acid. J Biol Chem, 1999. 274 (20): p. 13900-7. 238. Rhee, S.G., Regulation of phosphoinositide-specific phospholipase C. Annu Rev Biochem 2001. 70: p. 281-312. 239. Lee, I.H., et al., AHNAK-mediated activation of phospholipase C-gamma1 through protein kinase C. J Biol Chem, 2004. 279 (25): p. 26645-53. 240. Skoldberg, F., et al., Identification of AHNAK as a novel autoantigen in systemic lupus erythematosus. Biochem Biophys Res Commun, 2002. 291(4): p. 951-8. 241. Haase, H., et al., The carboxyl-terminal ahnak domain induces actin bundling and stabilizes muscle contraction. Faseb J, 2004. 18(7): p. 839-41. 242. Brash, A.R., Arachidonic acid as a bioactive molecule. J Clin Invest, 2001. 107(11): p. 1339-45. 243. Bogatcheva, N.V., et al., Arachidonic acid cascade in endothelial pathobiology. Microvasc Res, 2005. 69(3): p. 107-27.

PAGE 243

244. Brash, A.R., et al., Molecular cloning of a se cond human 15S-lipoxygenase and its murine homologue, an 8S-lipoxygenas e. Their relationship to other mammalian lipoxygenases. Adv Exp Med Biol, 1999. 447: p. 29-36. 245. Spector, A.A., Structure and lipid binding prop erties of serum albumin. Methods Enzymol, 1986. 128: p. 320-39. 246. Abumrad, N., C. Coburn, and A. Ibrahimi, Membrane proteins implicated in longchain fatty acid uptake by mammalian cells: CD36, FATP and FABPm. Biochim Biophys Acta, 1999. 1441(1): p. 4-13. 247. Pohl, J., et al., Role of FATP in parenchymal cell fatty acid uptake. Biochim Biophys Acta, 2004. 1686(1-2): p. 1-6. 248. Stahl, A., A current review of fatty acid transport proteins (SLC27). Pflugers Arch, 2004. 447(5): p. 722-7. 249. Dutta-Roy, A.K., Cellular uptake of long-chain fatty acids: role of membraneassociated fatty-acid-binding/transport proteins. Cell Mol Life Sci, 2000. 57(10): p. 1360-72. 250. Glatz, J.F., et al., Role of membrane-associated and cytoplasmic fatty acidbinding proteins in cellula r fatty acid metabolism. Prostaglandins Leukot Essent Fatty Acids, 1997. 57(4-5): p. 373-8. 251. Van Nieuwenhoven, F.A., G.J. Van der Vusse, and J.F. Glatz, Membraneassociated and cytoplasmic fatty acid-binding proteins. Lipids, 1996. 31 Suppl : p. S223-7. 252. Levick, S.P., et al., Arachidonic acid metabolism as a potential mediator of cardiac fibrosis associated with inflammation. J Immunol, 2007. 178(2): p. 641-6. 253. Capdevila, J.H., J.R. Falck, and J.D. Imig, Roles of the cytochrome P450 arachidonic acid monooxygenases in the c ontrol of systemic blood pressure and experimental hypertension. Kidney Int, 2007. 72(6): p. 683-9. 254. Marnett, L.J., et al., Arachidonic acid oxygenation by COX-1 and COX-2. Mechanisms of catalysis and inhibition. J Biol Chem, 1999. 274(33): p. 22903-6. 255. Chandrasekharan, N.V., et al., COX-3, a cyclooxygenase-1 variant inhibited by acetaminophen and other analgesic/antipyr etic drugs: cloning, structure, and expression. Proc Natl Acad Sci U S A, 2002. 99(21): p. 13926-31. 256. Feng, L., et al., Cloning two isoforms of rat cyclooxygenase: differential regulation of their expression. Arch Biochem Biophys, 1993. 307(2): p. 361-8. 257. Johnson, J.L., et al., Purification and characterization of prostaglandin H synthase-2 from sheep placental cotyledons. Arch Biochem Biophys, 1995. 324(1): p. 26-34. 258. Kennedy, B.P., et al., Cloning and expression of rat prostaglandin endoperoxide synthase (cyclooxyg enase)-2 cDNA. Biochem Biophys Res Commun, 1993. 197(2): p. 494-500. 259. Masferrer, J.L., et al., Selective inhibition of inducible cyclooxygenase 2 in vivo is antiinflammatory and nonulcerogenic. Proc Natl Acad Sci U S A, 1994. 91(8): p. 3228-32. 260. O'Neill, G.P. and A.W. Ford-Hutchinson, Expression of mRNA for cyclooxygenase-1 and cyclooxygenase-2 in human tissues. FEBS Lett, 1993. 330(2): p. 156-60.

PAGE 244

261. Ding, X.Z., R. Hennig, and T.E. Adrian, Lipoxygenase and cyclooxygenase metabolism: new insights in treatment and chemoprevention of pancreatic cancer. Mol Cancer, 2003. 2: p. 10. 262. Yamamoto, S., H. Suzuki, and N. Ueda, Arachidonate 12-lipoxygenases. Prog Lipid Res, 1997. 36(1): p. 23-41. 263. Kuhn, H. and S. Borngraber, Mammalian 15-lipoxygenases. Enzymatic properties and biological implications. Adv Exp Med Biol, 1999. 447: p. 5-28. 264. Oltman, C.L., et al., Epoxyeicosatrienoic acids and dihydroxyeicosatrienoic acids are potent vasodilators in the c anine coronary microcirculation. Circ Res, 1998. 83(9): p. 932-9. 265. Weintraub, N.L., et al., Potentiation of endotheliu m-dependent relaxation by epoxyeicosatrienoic acids. Circ Res, 1997. 81(2): p. 258-67. 266. Burke, J.E. and E.A. Dennis, Phospholipase A2 structure/function, mechanism, and signaling. J Lipid Res, 2009. 50 Suppl : p. S237-42. 267. Burke, J.R., et al., BMS-229724 is a tight-binding inhibitor of cytosolic phospholipase A2 that acts at the lipid/water interfa ce and possesses antiinflammatory activity in skin inflammation models. J Pharmacol Exp Ther, 2001. 298(1): p. 376-85. 268. Boyanovsky, B.B. and N.R. Webb, Biology of secretory phospholipase A2. Cardiovasc Drugs Ther, 2009. 23(1): p. 61-72. 269. Xing, M. and P.A. Insel, Protein kinase C-dependent activation of cytosolic phospholipase A2 and mitogen-activated pr otein kinase by alpha 1-adrenergic receptors in Madin-Darby canine kidney cells. J Clin Invest, 1996. 97(5): p. 130210. 270. Hooks, S.B. and B.S. Cummings, Role of Ca2+-independ ent phospholipase A2 in cell growth and signaling. Biochem Pharmacol, 2008. 76(9): p. 1059-67. 271. Street, I.P., et al., Slowand tight-binding inhibitors of the 85-kDa human phospholipase A2. Biochemistry, 1993. 32(23): p. 5935-40. 272. Piomelli, D., Arachidonic acid in cell signaling. Curr Opin Cell Biol, 1993. 5(2): p. 274-80. 273. Hjelte, L.E. and A. Nilsson, Arachidonic acid and ischemic heart disease. J Nutr, 2005. 135(9): p. 2271-3. 274. Rebecchi, M.J. and O.M. Rosen, Stimulation of polyphosphoinositide hydrolysis by thrombin in membrane s from human fibroblasts. Biochem J, 1987. 245(1): p. 49-57. 275. Berridge, M.J., P. Lipp, and M.D. Bootman, The versatility and universality of calcium signalling. Nat Rev Mol Cell Biol, 2000. 1(1): p. 11-21. 276. El Boustany, C., et al., Capacitative calcium entry and transient receptor potential canonical 6 expression control human hepatoma cell proliferation. Hepatology, 2008. 47(6): p. 2068-77. 277. Lipskaia, L., J.S. Hulot, and A.M. Lompre, Role of sarco/endoplasmic reticulum calcium content and calcium ATPase acti vity in the control of cell growth and proliferation. Pflugers Arch, 2009. 457 (3): p. 673-85. 278. Schwarz, E.C., et al., Calcium dependence of T cell proliferation following focal stimulation. Eur J Immunol, 2007. 37(10): p. 2723-33.

PAGE 245

279. McCord, A.M., J. Cuevas, and B.E. Anderson, Bartonella-induced endothelial cell proliferation is mediated by release of calcium from intracellular stores. DNA Cell Biol, 2007. 26 (9): p. 657-63. 280. Wilkerson, M.K., et al., Inositol trisphosphate recepto r calcium release is required for cerebral artery sm ooth muscle cell proliferation. Am J Physiol Heart Circ Physiol, 2006. 290(1): p. H240-7. 281. Munaron, L., S. Antoniotti, and D. Lovisolo, Intracellular calcium signals and control of cell prolifera tion: how many mechanisms? J Cell Mol Med, 2004. 8(2): p. 161-8. 282. Antoniotti, S., et al., Control of endothelial cell proliferation by calcium influx and arachidonic acid metabolism: a pharmacological approach. J Cell Physiol, 2003. 197(3): p. 370-8. 283. Fiorio Pla, A. and L. Munaron, Calcium influx, arachido nic acid,and control of endothelial cell proliferation. Cell Calcium, 2001. 30(4): p. 235-44. 284. Huang, R., et al., B cell differentiation factor-induced human B cell maturation: stimulation of intracellular calcium release. Cell Immunol, 1995. 164(2): p. 22733. 285. Morley, P. and J.F. Whitfield, The differentiation inducer, dimethyl sulfoxide, transiently increases the intracellular calcium ion concentration in various cell types. J Cell Physiol, 1993. 156(2): p. 219-25. 286. Black, B.L. and J.E. Smith, Regulation of goblet cell diffe rentiation by calcium in embryonic chick intestine. Faseb J, 1989. 3(14): p. 2653-9. 287. Pillai, S., et al., Uncoupling of the calcium-sensing mechanism and differentiation in squamous carcinoma cell lines. Exp Cell Res, 1991. 192(2): p. 567-73. 288. Rong, Y. and C.W. Distelhorst, Bcl-2 protein family members: versatile regulators of calcium signaling in cell survival and apoptosis. Annu Rev Physiol, 2008. 70: p. 73-91. 289. Schroter, A., et al., Nitric oxide applications prior and simultaneous to potentially excitotoxic NMDA-evoked calcium transients: cell death or survival. Brain Res, 2005. 1060(1-2): p. 1-15. 290. Zhou, G. and G. Zhang, [Indomethacin induces apoptosis of K562 cells through activation of caspases and elevation of intracellular free calcium]. Zhonghua Xue Ye Xue Za Zhi, 2001. 22(5): p. 241-4. 291. Zhang, Q.H., H.P. Sheng, and T.T. Loh, bcl-2 protects HL-60 cells from apoptosis by stabilizing their in tracellular calcium pools. Life Sci, 2001. 68(25): p. 287383. 292. Hofer, A.M., Another dimension to calcium signaling: a look at extracellular calcium. J Cell Sci, 2005. 118(Pt 5): p. 855-62. 293. Brown, E.M., The extracellular Ca2+-sensing receptor: central mediator of systemic calcium homeostasis. Annu Rev Nutr, 2000. 20: p. 507-33. 294. Riccardi, D. and G. Gamba, The many roles of the calcium-sensing receptor in health and disease. Arch Med Res, 1999. 30(6): p. 436-48. 295. Riccardi, D., Calcium ions as extracellular, first messengers. Z Kardiol, 2000. 89 Suppl 2: p. 9-14. 296. Riccardi, D. and D. Maldonado-Perez, The calcium-sensing receptor as a nutrient sensor. Biochem Soc Trans, 2005. 33(Pt 1): p. 316-20.

PAGE 246

297. Riccardi, D., et al., Novel regulatory aspects of the extracellular Ca2+-sensing receptor, CaR. Pflugers Arch, 2009. 458(6): p. 1007-22. 298. Ward, D.T., Calcium receptor-mediated intracellular signalling. Cell Calcium, 2004. 35(3): p. 217-28. 299. Hermans, E. and R.A. Challiss, Structural, signalling and re gulatory properties of the group I metabotropic glutamate recepto rs: prototypic family C G-proteincoupled receptors. Biochem J, 2001. 359(Pt 3): p. 465-84. 300. Quist, A.P., et al., Physiological role of gap-junctional hemichannels. Extracellular calcium-dependent isosmotic volume regulation. J Cell Biol, 2000. 148(5): p. 1063-74. 301. Babini, E., et al., Alternative splicing and interaction with diand polyvalent cations control the dynamic range of acid-sensing ion channel 1 (ASIC1). J Biol Chem, 2002. 277(44): p. 41597-603. 302. Rosen, E.D. and B.M. Spiegelman, Molecular regulation of adipogenesis. Annu Rev Cell Dev Biol, 2000. 16: p. 145-71. 303. Rajala, M.W. and P.E. Scherer, Minireview: The adipocyte--at the crossroads of energy homeostasis, inflammation, and atherosclerosis. Endocrinology, 2003. 144(9): p. 3765-73. 304. Jones, B.H., et al., Upregulation of adipocyte me tabolism by agouti protein: possible paracrine actions in yellow mouse obesity. Am J Physiol, 1996. 270(1 Pt 1): p. E192-6. 305. Kopelman, P.G., Obesity as a medical problem. Nature, 2000. 404(6778): p. 63543. 306. MacDougald, O.A. and S. Mandrup, Adipogenesis: forces that tip the scales. Trends Endocrinol Metab, 2002. 13(1): p. 5-11. 307. Spiegelman, B.M., et al., PPAR gamma and the control of adipogenesis. Biochimie, 1997. 79(2-3): p. 111-2. 308. Michalik, L. and W. Wahli, Peroxisome proliferator-ac tivated receptors: three isotypes for a multitude of functions. Curr Opin Biotechnol, 1999. 10(6): p. 56470. 309. El-Jack, A.K., et al., Reconstitution of insulin-sensitive glucose transport in fibroblasts requires expression of both PPARgamma and C/EBPalpha. J Biol Chem, 1999. 274(12): p. 7946-51. 310. Cohen, P., Protein kinases--the major drug targ ets of the twenty-first century? Nat Rev Drug Discov, 2002. 1(4): p. 309-15. 311. Slice, L.W. and S.S. Taylor, Expression of the catalytic subunit of cAMPdependent protein kinase in Escherichia coli. J Biol Chem, 1989. 264(35): p. 20940-6. 312. Alto, N., et al., Intracellular targeting of protein kinases and phosphatases. Diabetes, 2002. 51 Suppl 3 : p. S385-8. 313. Scott, J.D., Cyclic nucleotide-dependent protein kinases. Pharmacol Ther, 1991. 50(1): p. 123-45. 314. Faux, M.C. and J.D. Scott, Molecular glue: kinase anchoring and scaffold proteins. Cell, 1996. 85(1): p. 9-12.

PAGE 247

315. Li, Q. and G.D. Zhu, Targeting serine/threonine protein kinase B/Akt and cellcycle checkpoint kinases for treating cancer. Curr Top Med Chem, 2002. 2(9): p. 939-71. 316. van den Heuvel, A.P., et al., Binding of protein kinase B to the plakin family member periplakin. J Cell Sci, 2002. 115(Pt 20): p. 3957-66. 317. Uchiyama, T., et al., Role of Akt signaling in mitochondrial survival pathway triggered by hypoxic preconditioning. Circulation, 2004. 109(24): p. 3042-9. 318. Hirai, K., et al., PI3K inhibition in neonatal ra t brain slices during and after hypoxia reduces phospho-Akt and incr eases cytosolic cytochrome c and apoptosis. Brain Res Mol Brain Res, 2004. 124(1): p. 51-61. 319. Dempsey, E.C., et al., Protein kinase C isozymes and the regulation of diverse cell responses. Am J Physiol Lung Cell Mol Physiol, 2000. 279(3): p. L429-38. 320. Gould, C.M. and A.C. Newton, The life and death of protein kinase C. Curr Drug Targets, 2008. 9(8): p. 614-25. 321. Newton, A.C., Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm. Biochem J, 2003. 370(Pt 2): p. 361-71. 322. Ebnet, K., Organization of multiprotein comp lexes at cell-cell junctions. Histochem Cell Biol, 2008. 130(1): p. 1-20. 323. Denker, B.M. and S.K. Nigam, Molecular structure and assembly of the tight junction. Am J Physiol, 1998. 274(1 Pt 2): p. F1-9. 324. Mese, G., G. Richard, and T.W. White, Gap junctions: basic structure and function. J Invest Dermatol, 2007. 127 (11): p. 2516-24. 325. Green, K.J. and J.C. Jones, Desmosomes and hemidesmosomes: structure and function of molecular components. Faseb J, 1996. 10(8): p. 871-81. 326. Collins, J.E., et al., Cloning and sequence analysis of desmosomal glycoproteins 2 and 3 (desmocollins): cadherin-like desmosomal adhesion molecules with heterogeneous cytoplasmic domains. J Cell Biol, 1991. 113(2): p. 381-91. 327. Schafer, S., P.J. Koch, and W.W. Franke, Identification of the ubiquitous human desmoglein, Dsg2, and the exp ression catalogue of the desmoglein subfamily of desmosomal cadherins. Exp Cell Res, 1994. 211(2): p. 391-9. 328. Koch, P.J., et al., Complexity and expression pa tterns of the desmosomal cadherins. Proc Natl Acad Sci U S A, 1992. 89(1): p. 353-7. 329. Herrmann, H. and U. Aebi, Intermediate filaments: molecular structure, assembly mechanism, and integration into functiona lly distinct intra cellular Scaffolds. Annu Rev Biochem 2004. 73: p. 749-89. 330. Rudini, N. and E. Dejana, Adherens junctions. Curr Biol, 2008. 18(23): p. R10802. 331. Geiger, B., et al., The molecular basis for the assembly and modulation of adherens-type junctions. Cell Differ Dev, 1990. 32(3): p. 343-53. 332. Nagafuchi, A., Molecular architecture of adherens junctions. Curr Opin Cell Biol, 2001. 13(5): p. 600-3. 333. Shin, K., V.C. Fogg, and B. Margolis, Tight junctions and cell polarity. Annu Rev Cell Dev Biol, 2006. 22: p. 207-35. 334. Haskins, J., et al., ZO-3, a novel member of the MAGUK protein family found at the tight junction, interacts with ZO-1 and occludin. J Cell Biol, 1998. 141(1): p. 199-208.

PAGE 248

335. Jesaitis, L.A. and D.A. Goodenough, Molecular characterization and tissue distribution of ZO-2, a tight junction protein homologous to ZO-1 and the Drosophila discs-large tumor suppressor protein. J Cell Biol, 1994. 124(6): p. 949-61. 336. Gumbiner, B., T. Lowenkopf, and D. Apatira, Identification of a 160-kDa polypeptide that binds to th e tight junction protein ZO-1. Proc Natl Acad Sci U S A, 1991. 88(8): p. 3460-4. 337. Beatch, M., et al., The tight junction protein ZO-2 contains three PDZ (PSD95/Discs-Large/ZO-1) domains and an alternatively spliced region. J Biol Chem, 1996. 271(42): p. 25723-6. 338. Cordenonsi, M., et al., Cingulin contains globular and coiled-coil domains and interacts with ZO-1, ZO-2, ZO-3, and myosin. J Cell Biol, 1999. 147(7): p. 156982. 339. Yamamoto, T., et al., The Ras target AF-6 interacts with ZO-1 and serves as a peripheral component of tight junctions in epithelial cells. J Cell Biol, 1997. 139(3): p. 785-95. 340. Mattagajasingh, S.N., et al., Characterization of the in teraction between protein 4.1R and ZO-2. A possible link between the tight junction and the actin cytoskeleton. J Biol Chem, 2000. 275 (39): p. 30573-85. 341. Kobayashi, I., et al., RGM1, a cell line derived from normal gastric mucosa of rat. In vitro Cell Dev Biol Anim, 1996. 32 (5): p. 259-61. 342. Osada, T., et al., Effect of mechanical strain on gastric cellular migration and proliferation during mucosal healing: role of Rho dependent and Rac dependent cytoskeletal reorganisation. Gut, 1999. 45(4): p. 508-15. 343. Green, H. and O. Kehinde, An established preadi pose cell line and its differentiation in culture. II. Fact ors affecting the adipose conversion. Cell, 1975. 5(1): p. 19-27. 344. Green, H. and O. Kehinde, Spontaneous heritable changes leading to increased adipose conversion in 3T3 cells. Cell, 1976. 7(1): p. 105-13. 345. Green, H. and M. Meuth, An established pre-adip ose cell line and its differentiation in culture. Cell, 1974. 3(2): p. 127-33. 346. Kohn, A.D., et al., Expression of a constitutively active Akt Ser/Thr kinase in 3T3L1 adipocytes stimulates glucose uptake and glucose transporter 4 translocation. J Biol Chem, 1996. 271(49): p. 31372-8. 347. Rubin, C.S., et al., Development of hormone receptors and hormonal responsiveness in vitro. Insulin recep tors and insulin sensitivity in the preadipocyte and adipocyte forms of 3T3-L1 cells. J Biol Chem, 1978. 253 (20): p. 7570-8. 348. Yablonka-Reuveni, Z., B. Christ, and J.M. Benson, Transitions in cell organization and in expression of contractile and extra cellular matrix proteins during development of chicken aortic smooth muscle: evidence for a complex spatial and temporal differentiation program. Anat Embryol (Berl), 1998. 197(6): p. 421-37. 349. Fisher, S.A. and M. Ikebe, Developmental and tissue distribution of expression of nonmuscle and smooth muscle isoforms of myosin light chain kinase. Biochem Biophys Res Commun, 1995. 217(2): p. 696-703.

PAGE 249

350. Ross, S.A., G.H. Fick, and L. Alima, Factors influencing the estimation of the albumin excretion rate in s ubjects with diabetes mellitus. Clin Invest Med, 1997. 20(3): p. 152-61. 351. Dyson, M.R., et al., Production of soluble mammalian proteins in Escherichia coli: identification of prot ein features that correlat e with successful expression. BMC Biotechnol, 2004. 4: p. 32. 352. Mercado-Pimentel, M.E., N.C. Jordan, and G.O. Aisemberg, Affinity purification of GST fusion proteins for immunohistochemical studies of gene expression. Protein Expr Purif, 2002. 26(2): p. 260-5. 353. Zhan, Y., X. Song, and G.W. Zhou, Structural analysis of regulatory protein domains using GST-fusion proteins. Gene, 2001. 281(1-2): p. 1-9. 354. Chatton, B., et al., Eukaryotic GST fusion vector for the study of protein-protein associations in vivo: application to interaction of ATFa with Jun and Fos. Biotechniques, 1995. 18(1): p. 142-5. 355. Braun, P., et al., Proteome-scale purification of human proteins from bacteria. Proc Natl Acad Sci U S A, 2002. 99(5): p. 2654-9. 356. Eshaghi, S., et al., An efficient strategy for highthroughput expression screening of recombinant integral membrane proteins. Protein Sci, 2005. 14(3): p. 676-83. 357. Wilkinson, D.L. and R.G. Harrison, Predicting the solubility of recombinant proteins in Escherichia coli. Biotechnology (N Y), 1991. 9(5): p. 443-8. 358. Baneyx, F., Recombinant protein expression in Escherichia coli. Curr Opin Biotechnol, 1999. 10(5): p. 411-21. 359. Hammarstrom, M., et al., Rapid screening for improved solubility of small human proteins produced as fusion proteins in Escherichia coli. Protein Sci, 2002. 11(2): p. 313-21. 360. Shi, P.Y., N. Maizels, and A.M. Weiner, Recovery of soluble, active recombinant protein from inclusion bodies. Biotechniques, 1997. 23(6): p. 1036-8. 361. Youssoufian, H., Immunoaffinity purification of antibodies against GST fusion proteins. Biotechniques, 1998. 24(2): p. 198-200, 202. 362. Carrio, M.M. and A. Villaverde, Protein aggregation as bacterial inclusion bodies is reversible. FEBS Lett, 2001. 489(1): p. 29-33. 363. Garcia-Fruitos, E., A. Aris, and A. Villaverde, Localization of functional polypeptides in bacterial inclusion bodies. Appl Environ Microbiol, 2007. 73(1): p. 289-94. 364. Mukhopadhyay, A., Inclusion bodies and purification of proteins in biologically active forms. Adv Biochem Eng Biotechnol, 1997. 56: p. 61-109. 365. Kiefer, H., K. Maier, and R. Vogel, Refolding of G-protein-coupled receptors from inclusion bodies produced in Escherichia coli. Biochem Soc Trans, 1999. 27(6): p. 908-12. 366. Frangioni, J.V. and B.G. Neel, Solubilization and purifica tion of enzymatically active glutathione S-transfer ase (pGEX) fusion proteins. Anal Biochem, 1993. 210(1): p. 179-87. 367. Schrodel, A. and A. de Marco, Characterization of the aggregates formed during recombinant protein expression in bacteria. BMC Biochem, 2005. 6: p. 10. 368. Wagner, S., et al., Consequences of membrane protein overexpression in Escherichia coli. Mol Cell Proteomics, 2007. 6(9): p. 1527-50.

PAGE 250

369. Fujishige, K., et al., Localization of clearance recep tor in rat lung and trachea: association with chondr ogenic differentiation. Am J Physiol, 1998. 274(3 Pt 1): p. L425-31. 370. Pedro, L., et al., Characterization of the phosphor ylation state of natriuretic peptide receptor-C. Mol Cell Biochem, 1998. 178 (1-2): p. 95-101. 371. Alli, A., and Gower, W.R., Jr., Characterization of a polyclonal antibody against the cytoplasmic domain of the C-ty pe natriuretic peptide receptor. J Clin Ligand Assay, 2009. 31: p. 3-7. 372. Cen, B., et al., Direct and differential interactio n of beta-arrestins with the intracellular domains of different opioid receptors. Mol Pharmacol, 2001. 59(4): p. 758-64. 373. Gudermann, T., B. Nurnberg, and G. Schultz, Receptors and G proteins as primary components of transmembrane signal transduction. Part 1. G-proteincoupled receptors: structure and function. J Mol Med, 1995. 73(2): p. 51-63. 374. Haase, H., et al., Ahnak is critical for cardiac Ca(V)1.2 calcium channel function and its beta-adrenergic regulation. Faseb J, 2005. 19(14): p. 1969-77. 375. Yanagisawa, M., et al., A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature, 1988. 332(6163): p. 411-5. 376. Iwamuro, Y., et al., Activation of three types of voltage-independent Ca2+ channel in A7r5 cells by endothelin-1 as revealed by a novel Ca2+ channel blocker LOE 908. Br J Pharmacol, 1999. 126(5): p. 1107-14. 377. Danthuluri, N.R. and T.A. Brock, Endothelin receptor-coupling mechanisms in vascular smooth muscle: a role for protein kinase C. J Pharmacol Exp Ther, 1990. 254(2): p. 393-9. 378. Ntambi, J.M. and T. Takova, Role of Ca2+ in the early stages of murine adipocyte differentiation as eviden ced by calcium mobilizing agents. Differentiation, 1996. 60(3): p. 151-8. 379. Jensen, B., et al., High extracellular calcium atte nuates adipogenesis in 3T3-L1 preadipocytes. Exp Cell Res, 2004. 301(2): p. 280-92. 380. Wu, Z., et al., Cross-regulation of C/EBP al pha and PPAR gamma controls the transcriptional pathway of adi pogenesis and insulin sensitivity. Mol Cell, 1999. 3(2): p. 151-8. 381. Gregoire, F.M., Adipocyte differentiation: from fibroblast to endocrine cell. Exp Biol Med (Maywood), 2001. 226(11): p. 997-1002. 382. Huang, S., V.M. Maher, and J.J. McCormick, Extracellular Ca2+ stimulates the activation of mitogen-activated prot ein kinase and cell growth in human fibroblasts. Biochem J, 1995. 310 ( Pt 3) : p. 881-5. 383. Molostvov, G., et al., Extracellular calcium-sensi ng receptor mediated signalling is involved in human vascular smooth muscle cell proliferation and apoptosis. Cell Physiol Biochem, 2008. 22(5-6): p. 413-22. 384. Kwak, J.O., et al., The extracellular calcium sensing receptor is expressed in mouse mesangial cells and m odulates cell proliferation. Exp Mol Med, 2005. 37(5): p. 457-65. 385. Yamaguchi, T., et al., Mouse osteoblastic cell line (MC3T3-E1) expresses extracellular calcium (Ca2+o)-sensi ng receptor and its agonists stimulate

PAGE 251

chemotaxis and proliferation of MC3T3-E1 cells. J Bone Miner Res, 1998. 13(10): p. 1530-8. 386. Shi, H., et al., Role of intracellular calcium in human adipocyte differentiation. Physiol Genomics, 2000. 3(2): p. 75-82. 387. Xue, B., et al., The agouti gene product inhibits li polysis in human adipocytes via a Ca2+-dependent mechanism. Faseb J, 1998. 12(13): p. 1391-6. 388. Sanders, K.M., Invited review: mechanisms of calcium handling in smooth muscles. J Appl Physiol, 2001. 91(3): p. 1438-49. 389. Walsh, M.P., Regulation of vascular smooth muscle tone. Can J Physiol Pharmacol, 1994. 72(8): p. 919-36. 390. Somlyo, A.P. and A.V. Somlyo, Signal transduction by G-proteins, rho-kinase and protein phosphatase to smooth muscle and nonmuscle myosin II. J Physiol, 2000. 522 Pt 2: p. 177-85. 391. Somlyo, A.P. and A.V. Somlyo, Signal transduction and regulation in smooth muscle. Nature, 1994. 372 (6503): p. 231-6. 392. Bohr, D.F., A.F. Dominiczak, and R.C. Webb, Pathophysiology of the vasculature in hypertension. Hypertension, 1991. 18(5 Suppl): p. III69-75. 393. Mohri, M., et al., Angina pectoris caused by coronary microvascular spasm. Lancet, 1998. 351(9110): p. 1165-9. 394. Mulvany, M.J. and C. Aalkjaer, Structure and function of small arteries. Physiol Rev, 1990. 70(4): p. 921-61. 395. Mendelsohn, M.E., In hypertension, the kidney is not always the heart of the matter. J Clin Invest, 2005. 115(4): p. 840-4. 396. Takahashi, A., et al., Measurement of intracellular calcium. Physiol Rev, 1999. 79(4): p. 1089-125. 397. Parker, I. and Y. Yao, Regenerative release of calciu m from functionally discrete subcellular stores by inositol trisphosphate. Proc Biol Sci, 1991. 246(1317): p. 269-74. 398. Bootman, M., et al., Imaging the hierarchical Ca2+ signalling system in HeLa cells. J Physiol, 1997. 499 ( Pt 2): p. 307-14. 399. Nelson, M.T., et al., Relaxation of arterial smooth muscle by calcium sparks. Science, 1995. 270(5236): p. 633-7. 400. Klein, M.G., et al., Two mechanisms of quantized calcium release in skeletal muscle. Nature, 1996. 379 (6564): p. 455-8. 401. Harkins, A.B., N. Kurebayashi, and S.M. Baylor, Resting myoplasmic free calcium in frog skeleta l muscle fibers estimated with fluo-3. Biophys J, 1993. 65(2): p. 865-81. 402. Zou, H., et al., Using total fluorescence increase (signal mass) to determine the Ca2+ current underlying localized Ca2+ events. J Gen Physiol, 2004. 124(3): p. 259-72. 403. Chung, C.T., S.L. Niemela, and R.H. Miller, One-step preparation of competent Escherichia coli: transformation and stor age of bacterial cells in the same solution. Proc Natl Acad Sci U S A, 1989. 86(7): p. 2172-5. 404. Neuberger, G., G. Schneid er, and F. Eisenhaber, pkaPS: prediction of protein kinase A phosphorylation sites with the si mplified kinase-substrate binding model. Biol Direct, 2007. 2: p. 1.

PAGE 252

405. Chrambach, A. and D. Rodbard, Polyacrylamide gel electrophoresis. Science, 1971. 172(982): p. 440-51. 406. Hedrick, J.L. and A.J. Smith, Size and charge isomer separation and estimation of molecular weights of proteins by disc gel electrophoresis. Arch Biochem Biophys, 1968. 126(1): p. 155-64. 407. Lemmon, M.A. and J. Schlessinger, Regulation of signal transduction and signal diversity by receptor oligomerization. Trends Biochem Sci, 1994. 19(11): p. 45963. 408. Heldin, C.H., Dimerization of cell surface receptors in signal transduction. Cell, 1995. 80(2): p. 213-23. 409. Fenrick, R., N. McNicoll, and A. De Lean, Glycosylation is critical for natriuretic peptide receptor-B function. Mol Cell Biochem, 1996. 165(2): p. 103-9. 410. Lowe, D.G. and B.M. Fendly, Human natriuretic peptide receptor-A guanylyl cyclase. Hormone cross-linking and anti body reactivity distinguish receptor glycoforms. J Biol Chem, 1992. 267(30): p. 21691-7. 411. Heim, J.M., S. Singh, and R. Gerzer, Effect of glycosyl ation on cloned ANFsensitive guanylyl cyclase. Life Sci, 1996. 59(4): p. PL61-8. 412. McGuffin, L.J., K. Bryson, and D.T. Jones, The PSIPRED protein structure prediction server. Bioinformatics, 2000. 16(4): p. 404-5. 413. Jones, D.T., Protein secondary structure pred iction based on position-specific scoring matrices. J Mol Biol, 1999. 292(2): p. 195-202. 414. Cuff, J.A. and G.J. Barton, Application of multiple sequen ce alignment profiles to improve protein secondary structure prediction. Proteins, 2000. 40(3): p. 502-11. 415. Rost, B., C. Sander, and R. Schneider, PHD--an automatic mail server for protein secondary structure prediction. Comput Appl Biosci, 1994. 10 (1): p. 53-60. 416. Montgomerie, S., et al., PROTEUS2: a web server fo r comprehensive protein structure prediction and structure-based annotation. Nucleic Acids Res, 2008. 36(Web Server issue): p. W202-9. 417. Montgomerie, S., et al., Improving the accuracy of protein secondary structure prediction using structural alignment. BMC Bioinformatics, 2006. 7: p. 301. 418. Kennelly, P.J. and E.G. Krebs, Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases. J Biol Chem, 1991. 266(24): p. 15555-8. 419. Zhou, H., and Murthy, K. S, PKG-induced desensitiz ation of the singletransmembrane NPR-C receptor is medi ated by phosphorylation of a single threonine residue in the intracellular domain (Abstract). Gastroenterology, 2002. 122. 420. Traweger, A., et al., The tight junction protein ZO-2 localizes to the nucleus and interacts with the heterogeneous nuclea r ribonucleoprotein scaffold attachment factor-B. J Biol Chem, 2003. 278(4): p. 2692-700. 421. Shtivelman, E. and J.M. Bishop, The human gene AHNAK encodes a large phosphoprotein located prim arily in the nucleus. J Cell Biol, 1993. 120 (3): p. 625-30. 422. Blikslager, A.T., et al., Restoration of barrier func tion in injured intestinal mucosa. Physiol Rev, 2007. 87(2): p. 545-64.

PAGE 253

Appendices

PAGE 254

Appendix A: EMBOSS alignment needle program results of AHANK1 and AHNAK2

PAGE 256

EMBOSS alignment needle program results of AHANK1 (top) and AHNAK2 (bottom). The % identity, which represents the percentage of identical matches between the two sequences over the reported aligned region was 1908/6955 (27.4%); the %similarity, which represents the percentage of matches between the two sequences over the reported aligned region where the scoring matrix value is greater or equal to 0.0 was 2916/6955 (41.9%)

PAGE 257

Appendix B: reverse and forward se quence for pACT-NPRC and pBIND-NPRC LNPRCPACT+T3 AGGCCTTAGTTATTCAGGTACCTGCGGCCGCTCTAGAGTCGACCGTTTCATTGATGTCTTTCAACCCGTCTATCTCCT TAAAGAATCTCAGGCAGAAAAAAAAAAGTGGGGGGCTTCCT TTAAGCTACTGAAAAATGGGATCTGATGGAATCTTCC CGTAATTCCCGATGTTTTCCAAGGTTACTTTCTTCTTGCTGGGTTCGCCTCTCAATGGTTATTCTGTATTTCTTCCTGAA AAAGTAGAAGGCCATTAGCAAGCCAGCTCCTAGTAAAGCCCCCACGACAATTCCTGTCACTGCCGATTC TTCTAGGC CACATGATTTGCAGGGAGAGCTGTTTGTATGCTCTACAATTCGGTTTTCA TCTATTCTCAGTT TTAAAGGGCCCCAAG GATATTTGACATTCGGCCGCATTTCAAAACGACCTTC TTTTCCAAAATAATCACCAATAACCTCCTGGGTGCCCGCCT CCACATCAGTCATGGCAATCACAGAG AAATCCCCATATCGGTCT CCGTTGGCATCTATGGACACCTGCCCGGCGATA CCTTCAAATGTTCTGTTCCAAGTCTGCTGT ATAATTTTCCCTCCATCCTTTTTGCTG TAACCAGCTCTGAGTACTTCATG TAGAGCCAAGACGTAGAGGAGGATGGCATCGTGGAATCC TTCAACAAACATGTTAACGT AATCCTCCATATTGAGCC CTTGTTTCTCAACTGAACTT TTCACCTCCATGGAAAACTTCTCAAACTCAGGT TTCACTGTCCTCAGTAGAGTGACTGT CTGGAGGGACGAGTATGCTTGCTTAGCTTCAAAGTCGTGTTTGTCTCCTCTCTTCCATGAGCCATCTCCATAGGAAGA GCTGTTGAAGAGCTCAATGTTGAAGAAGCGTAGTCTCCACTGGTCATGCCATGCCTGTGCGCCACCAGCATGATGCT CCGGATGGTGTCACTGCTCGCACACATGATCACCACTCTCTCACT LNPRCPACT+T7 AGCTGAGCAGCCTCCTGAAGATGAAGCTACTGTCTTCT ATCGAACAAGCATGCCCAAAAAAGAAGAGAAAGGTAGAT GAATTCCCGGGGATCTCGACGGCCCCCCCGACCGATGT CAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGAC GTGGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTCCG GGATCGCCAGGGATCCGTCGACTTGACGCGTTGATATCGAATTCCTGCAGGTCGACCGGGGGCAGAAGGGCGAGT CGGCGGCGGCGAGGGCAAGCTCTTTCTTGCGGCACGATG CCGTCTCTGCTGGTGCTCACTTTCTCCCCGTGCGTAC TACTCGGCTGGGCGTTGCTGGCCGGCGGCACCGGTGGCGGTGGCGTTGGCGGCGGCGGCGGTGGCGCGGGCATA GGCGGCGGACGCCAGGAGAGAGAG GCGCTGCCGCCACAGAAGATCGAGGTGCTGGTGTTACTGCCCCAGGATGAC TCGTACTTGTTTTCACTCACCCGGGTGCGGCCGGCCATCGAGTATGCTCTGCGCAGCGTGGAGGGCAACGGGACTG GGAGGCGGCTTCTGCCGCCGGGCAC TCGCTTCCAGGTGGCTTACGAGGATTCAGACTGTGGGAACCGTGCGCTCTT CAGCTTGGTGGACCGCGTGGCGGCGGCGCGGGGCGCCAAGCCAGACCTTATCCTGGGGCCAGTGTGCGAGTATG CAGCAGCGCCAGTGGCCCGGCTTGCATCGCACTGGGAC CTGCCCATGCTGTCGGCTGGGGCGCTGGCCGCTGGCT TCCAGCACAAGGACTCTGAGTACTCGCACCTCACGCGCGTGGCGCCCGCCTACGCCAAGATGGGCGAGATGATGCT CGCCCTGTTCCGCCACCACCACTGGAGCCGCGC TGCACTGGTCTACAGCGACGACAGCTGAC LNPRCPPBIND+T3 AGGCCTTAGTTATTCAGGTACCTGCGGCCGCTCTAGAGTCGACCGTTTCATTGATGTCTTTCAACCCGTCTATCTCCT TAAAGAATCTCAGGCAGAAAAAAAAAAGTGGGGGGCTTCCT TTAAGCTACTGAAAAATGGGATCTGATGGAATCTTCC CGTAATTCCCGATGTTTTCCAAGGTTACTTTCTTCTTGCTGGGTTCGCCTCTCAATGGTTATTCTGTATTTCTTCCTGAA AAAGTAGAAGGCCATTAGCAAGCCAGCTCCTAGTAAAGCCCCCACGACAATTCCTGTCACTGCCGATTC TTCTAGGC CACATGATTTGCAGGGAGAGCTGTTTGTATGCTCTACAATTCGGTTTTCA TCTATTCTCAGTT TTAAAGGGCCCCAAG GATATTTGACATTCGGCCGCATTTCAAAACGACCTTC TTTTCCAAAATAATCACCAATAACCTCCTGGGTGCCCGCCT CCACATCAGTCATGGCAATCACAGAG AAATCCCCATATCGGTCT CCGTTGGCATCTATGGACACCTGCCCGGCGATA CCTTCAAATGTTCTGTTCCAAGTCTGCTGT ATAATTTTCCCTCCATCCTTTTTGCTG TAACCAGCTCTGAGTACTTCATG TAGAGCCAAGACGTAGAGGAGGATGGCATCGTGGAATCC TTCAACAAACATGTTAACGT AATCCTCCATATTGAGCC CTTGTTTCTCAACTGAACTT TTCACCTCCATGGAAAACTTCTCAAACTCAGGT TTCACTGTCCTCAGTAGAGTGACTGT CTGGAGGGACGAGTATGCTTGCTTAGCTTCAAAGTCGTGTTTGTCTCCTCTCTTCCATGAGCCATCTCCATAGGAAGA GCTGTTGAAGAGCTCAATGTTGAAGAAGCGTAGTCTCCACTGGTCATGCCATGCCTGTGCGCCACCAGCATGATGCT CCGGATGGTGTCACTGCTCGCACACATGATCACCA CTCTCTCACTGGCCTGGATATTGCGCACGAT LNPRCPPBIND+T7 GCTGAGCAGCCTCCTGAAAGATGAAGCTACTGTCTTC TATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCA AGTGCTCCAAAGAAAAACCGAAG TGCGCCAAGTGTCTGAAGAACAACTG GGAGTGTCGCTACTCTCCCAAAACCAAA AGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAAT CAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGAT TTTTCCTCGAGAAGACCTTGAC ATGATTTTGAAAATGGAT TCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTG TACAAGATAATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACATTGAGAC AGCATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTATCGCCGGAA TTCCCGGGGATCCGTCGACTTGACGCGTTGATATCGAATTCCTGCAGGTCGACCGGGGGCAGAAGGGCGAGTCGG CGGCGGCGAGGGCAAGCTCTTTCTTGCGGCACGATGCCGTCTCTGCTGGTGCTCACTTTCTCCCCGTGCGTACTAC TCGGCTGGGCGTTGCTGGCCGGCGGCACCGGTGGCGGTGGCGTTGGCGGCGGCGGCGGTGGCGCGGGCATAGG CGGCGGACGCCAGGAGAGA GAGGCGCTGCCGCCACAGAAGATCGAG GTGCTGGTGTTACTGCCCCAGGATGACTC GTACTTGTTTTCACTCACCCGGGTGCGGCCGGCCATCGAGTATGCTCTGCGCAGCGTGGAGGGCAACGGGACTGG GAGGC GGCTTCTGCCGCCGGGCACTCGCTTCCAGGTG GCTTACGAGGATTCAGACTGTGGGAACCGTGCGCTCTTC AGCTTGGTGGACCGCGTGGCGGCGGCGCGGGGCGCCAAGCCAGACCTTATCCTGGGGCCAGTGTGCGAGT

PAGE 258

Appendix C: sequence for pACT-arrestin and pBIND-arrestin BAR-PACT+VP16 ACGCGTTGATATCATCTAGAATGGGCGACAAAGGGACA CGAGTGTTCAAGAAGGCAAGCCCCAATGGAAAGCTCAC CGTCTACCTGGGAAAGCGGGACTTTGTGGACCACATTGACCTGGTGGACCCCGTGGATGGCGTGGTCCTGGTGGAT CCTGAGTATCTCAAAGAAAGGCGAGTCT ACGTGACACTGACCTGCGCCTTCCGGTATGGCCGGGAAGACCTGGATG TCTTGGGTCTGACTTTTCGCAAAGACCTGTTTGTGGCT AACGTGCAGTCCTTCCCACCGGCCCCTGAGGACAAGAAG CCACTGACTCGGCTACAAGAGCGACTCATCAAGAAGCTGGGCGAGCATGCCTACCCCTTCACCTTTGAGATCCCGC CAAACCTTCCGTGCTCAGTCACATTGCAACCTGGGCCTGAGGAC BAR-PBIND+GAL4 TGACGCGTTGATATCATCTAGAATGGGCGACAAAGGG ACACGAGTGTTCAAGAAGGC AAGCCCCAATGGAAAGCTCA CCGTCTACCTGGGAAAGCGGGACTTTGTGGACCACATT GACCTGGTGGACCCCGTGGATGGCGTGGTCCTGGTGGA TCCTGAGTATCTCAAAGAAAGGCGAGTCTACGTGACAC TGACCTGCGCC TTCCGGTATGGCCGGGAAGACCTGGAT GTCTTGGGTCTGACTTTTCGCAAAGACCTGTTTGTGGCT AACGTGCAGTCCTTCCCACCGGCCCCTGAGGACAAGAA GCCACTGACTCGGCTACAAGAGCGACTCATCAAGAAGCTGGGCGAGCATGCCTACCCCTTCACCTTTGAGATCCCG CCAAACCTTCCGTGCTCAGTCACATTGCAACCTGGGCCTG Appendix D: reverse and forward sequence for pBIND-AHNAK1 PZF187PBIND+T3 GGCTTAGTTATTCAGGTACCTGCGG CCGCCCACTCTTTCTTTGTGGAAACTG ACAGCTCCACCTCGGGAAGCTGGAT GCCAACCTTATTCCCACTGTCATTGCTAGAAGAGGAGGAC AGTCGGGACTTCTTAGAGGCCAGGGACACCCCACTCC CCTGTAACTTGCCTGTCTCATCATCGCTCCCAGTCACCTCATAATGACCTTTGCTCTTTGACCCCAATCCACCAAAGG TACCGAATTTCAGCTTCCCGTGTTTCCCTTTAACTTTCCCACCTTCCAGAGA CACTTCCCCACCTTCAAACTCCAGCGT CCCCGTCGGGGTGGAAGGTCCAGAGAACTCTCTTTCATCA CTGAATGAATTTGAGCGGTGCCGTGGCTTCTTACTTT TAAATAAGGAGAATTTGCCTTTCGGTG AAGAGGCTTCGGCCTCTGCCTCTCC TTCCAGAGAGCCCAGGCTGGCCTTT GAACTTTTCAGGTCACCTTTGGACCCAGAAATTGATGC TTCTGGTGAGCCAGTGACACCACCTTTCCCTTTAGGTTTG GAAAAATTAAACTTGGGCATTTTGATCTTGGACTTTTTCAG TTTGACTTCAGACTCTTCCCA CTCGCCGTCTCCAGCAC CAGCTTGGATGCTGGCCTCTGCTTTAGGGAAGTGAAC ATCCACCCCCATTTCTCTGCCAACCAGCTCACGGCCAGAG AAGGTAAATTTGGGGATCTTCATTTTAGGGAATGTTACTTTTCCAGATCCACTTTCCAAGTGACCTTGAGGCCCAGAC ACACTCAGCCCAGGAGCCTGGAGTCCA ATCTGACCTCCTTTCACACCTCCTT CCACCTTTGGTCCTGAGAAATGAAG GCCCCAGCAAACTT PZF187PBIND+T7 GCTGAGCAGCCTCCTGAAAGATGAAGCTACTGTCTTC TATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCA AGTGCTCCAAAGAAAAACCGAAG TGCGCCAAGTGTCTGAAGAACAACTG GGAGTGTCGCTACTCTCCCAAAACCAAA AGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAAT CAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGAT TTTTCCTCGAGAAGACCTTGAC ATGATTTTGAAAATGGAT TCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTG TACAAGATAATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACATTGAGAC AGCATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTATCGCCGGAA TTCCCGGGGATCCGTCGACTTGACGCGTTGATATCGAATTCCTGCAGGTCGACCGGGGGCAGAAGGGCGAGTCGG CGGCGGCGAGGGCAAGCTCTTTCTTGCGGCACGATGCCGTCTCTGCTGGTGCTCACTTTCTCCCCGTGCGTACTAC TCGGCTGGGCGTTGCTGGCCGGCGGCACCGGTGGCGGTGGCGTTGGCGGCGGCGGCGGTGGCGCGGGCATAGG CGGCGGACGCCAGGAGAGA GAGGCGCTGCCGCCACAGAAGATCGAG GTGCTGGTGTTACTGCCCCAGGATGACTC GTACTTGTTTTCACTCACCCGGGTGCGGCCGGCCATCGAGTATGCTCTGCGCAGCGTGGAGGGCAACGGGACTGG GAGGCGGCTTCTGCCGCCGGGCACTCGCTTCCAGGTG GCTTACGAGGATTCAGACTGTGGGAACCGTGCGCTCTTC AGCTTGGTGGACCGCGTGGCGGCGGCGCGGGGCGCCAAGCCAGACCTTATCCTGGGGCCAGTGTGCGAGT

PAGE 259

Appendix E: reverse and forward sequence for AHNAK1 construct 2 PZ21+M13FORWARD AATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCG ATAAGCTTGATATCGAATTCCGTGCAAGTCCACATCAG GCATGGAGATCTTGGGGGCCTTGATATTCATCTCTGGC ATCTTGAACTTGGGGCCCTTCAGCTTTCCTTCAGGTCCTT CAATATTCACATCTGGAACTTCAACACCCACCTTGGGTCCT GAGATGTCCACATCAGCCTTGGGCAGGTTCACATCCA CTTCTGGGCCCTCTGCTTTGAAGCCAGGCATGCTGAACTT GGGCATTTTCATCTTGGGCATCTTCAGGTGCCAGTCT GGGCCTTGAACCTCCACATCTGGGACATCAATGTCCATTTTGGCACTTTTAAGTTCAACATCAGGAACTTTAATCTCAC TTTCAACCTTTGGCATTGTGACATCATATTCTCCCTTTACGTTAGGGCCTTTCAGATGTAAGTCCACATCAGGCATGGA GATCTTGGGGACTTTGATGTTCATCTC AGGCATCTTAAACTTGGGCCCTTTC AATTTCCCTTCTGGT TCCTCAATGCTC ACATCAGGAGCAGTAACATCTATCTTGGGCCCGGAAATGTCCACATCAGCCTTGGGCA GGTTCACATCCACTTCTGG GCCCTCTGCTTTGAACCCTGGCACACTGAATTTGGGCATTTTCATCTTGGGCATCTTCAAGTGCCAGTCTGGGCCATG AACATCCACATCTGGGGCATCAATGTCCACTTTTGGGCCTTTGAGTTCTCCTTCCAGCTTTGGTACAGTTACATCATAC TCTCCCTTCACCTTTGTACCTTTCACGTGCAAATCTACATCAGGCATGGAGATCTTTGGTGTCTTGACACTCATATCAG GCAGCTTAACATCGGGGCCTTTAAGTTTTCCCCCCAGACCC TCCAAGTTGACATCTGGG GCTTCCACATTGACCTTG GGCCCTGAAATACTGATATCTCCTTTGGGTAGAGTCATATGAACATCTGGACCTTCCCCTTTGGCTCCTGGAGTGCTG AACGTGGGCATTTTCATCTTGGGCAT pZ21+M13REVERSE AACAAAAGCTGGAGCTCCACCGCGGTGG CGGCCGCTCTAGAACTAGTGGATC CCCCGGGCTGCAGGAATTCCGCT GAAGTCGGAAGATGGAGTGGAAGGAGACCTCGGGGAGACCCAGAGCCGTACCATCACAGTGACCAGAAGGGTCAC GGCCTACACTGTGGATGTGACTGGCCGGGAAGGAGCCAAGGACATAGACATCAGTAGCCCTGAATTCAAGATCAAG ATTCCAAGACATGAACTGACTGAAATCT CCAATGTGGATGTGGAG ACCCAGTCTGGGAAGAC CGTGATCAGACTGCC CTCGGGCTCGGGGGCAGCCTCTCCGACAGGCTCTGCTGT GGATATCCGAGCAGGGGC CATTTCTGCTTCAGGACCA GAGCTCCAAGGTGCTGGCCACTCGAAG CTCCAGGTCACCATGCCTGGGATAAAGGTGGGAGGCTCAGGTGTCAATG TCAATGCAAAGGGCTTGGACTTGGGTGGCAGAGGAGGGGTCCAAGTTCCAGCAGTGGACATTTCATCTTCTCTTGGG GGTAGGGCAGTAGAGGTACAGGGCCCATCTCTGGAGA GTGGTGATCATGGCAAAATTAAATTTCCCACCATGAAAGT GCCGAAATTTGGTGTCTCAACAGGGCGTGAGGGCCAGA CACCAAAGGCAGGGCTGAGGG TTTCTGCACCTGAAGTC TCTGTGGGGCACAAGGGCGGCAAGCCAGGCTTGACTAT CCAAGCCCCTCAGCTGGAAGTCAGTGTGCCCTCTGCCA ATATTGAGGGCCTTGAGGGGAAGCTGAAGGGCCCCCAAA TCACTGGGCCATCACTTGAGGGTGACCTAGGCCTGAA AGGTGCCAAGCCACAGGGGCACATTGGGGTGGATGCCTC TGCTCCCCAAATTGGGGGTAGCATCACTGGCCCCAGT GTGGAAGTTCAGGCCCCTGA CATTGATGTTCAGGGGCCTGGGAGCAAAC TGAATGTGCCCAAGATGAAAGTCCCCA AGTTCTCTGTATCAGGTGCAAAGGGAGAGGAAA CTGGGATTGATGTGACACTGCCTACAGGTG

PAGE 260

Appendix F: Construction of pACT and pBIND AHNAK1 fusion proteins

PAGE 261

Appendix G: Construction of pGEX4T3NPRC Appendix H: Sequence for rat GST-NPRC RNPR-C+PGEX-3 ATCGTCAGTCAGTCACGATGCGGCCGCTCGAGTCGACCCGGGAATTCTCCAAGAACACCCTTTCTGTTCCATTGATG TCTGTCCTTCAACTATCTCTTTAAGGA ATCTCAAGCAGACAAAGCAAGGGGGGCATTTCTTTTAAGCCACCGAAAAAT GTGATCTGATGGAATCTTCCCGCAGCTCTCGATGTTTCCCAATGTTGCTTTCTTCTTGGTGATTTCGCCTCTCAATGGT TATTCTGTATTTCTTCCTGAAAAAGTAGAAGGCCATTAGCAAACCAGCACCTAGTAGGGCCCCCACAACAATTCCTGT CACTGCTGATTCTTCTAGGCCACATGATTTGCAAGGAGAGCTGTTGGTGTGCTCCACAATTCTGGTTTCATCTATTCT CAATTTCAAAGAGCCCCAAGGATATTTG ACATTGGATCGCATTTTGAACCGGC CTTCTTTTCCAAAG TAATCACCAATG ACCTCCTGGGTACCTGCTTCTGTATCAGTCATGGCAACCA CAGAGAAGTCTCCATACCGATCCCCATTAGCATCTATG GACACCTGCCCGGCGATACCTTCAAAT GTCCTGTTCCAAGTCTGCTGGATGAT TTTCCCCCCATCCTTCTTGCTGTAG CCAGCTCTGAGCACTTCATGCAAAGCCAGAACGTAGAGGA GGATGGCATCATGGAAGCCTTCAACGAACATGTTCAC GTAATCCTCCTCATTGAGCCCTTGTTTCTCAACAGAACTTTTCACCTCCATGGAAAACTTCTCAAACTCAGGCTTCGCG GTCCTCAGCAGGGTGACTGTTTGGAGGGATGAGTAAGCTTGCTTAGCTTCAAAGTCGTGTTTGTCCCCTCTCTTCCAC GAGCCATCTCCGTAAGAAGAACTGTT GAAGAGTTCAATGTTGAAGAAAGCATAGTCTCCACTGGTCATGCCGTGTCT GTGCACCGCCAACATGATTCTCCGAATGGTGTCACCAC

PAGE 262

Appendix I. Primers used with the Qu ikChange site-directed mutagenesis kit CGG GCT GCA GGA ATT CCG CTT GCT GGC AAC AGG ATG CGG TCC 5GGC TGC AGG AGA CG C GT T G GC TGG CAA CAG GAT GCG -3 5CGC ATC CTG TTG CCA GCC AAC GCG TCT CCT GCA GCC -3 Appendix J: Site-directe d mutagenesis reaction Volume ( L) Reagent 39.5 L Water 5 L 10X reaction buffer 1.25 L Diluted primer #1 1.25 L Diluted primer #2 1 L Diluted DNA 1 L dNPT mix 50 L Reagents were added sequentia lly in the order listed.

PAGE 263

Appendix K: Cycling parameters fo r site-directed muta genesis reaction # of Cycles Temperature Time 1 95 C 30 sec 16 95 C 55 C 68 C 30 sec 1 min 14 min 4 C Hold Appendix L: Ligation reaction for co nstruction of pACT and pBIND AHNAK1 Vector DEPC H20 T4 DNA ligase 10X buffer Insert Ligase 5 L pACTAHNAK1 2 L 2 L 10 L pzdouble 1 L 5 L pBINDAHNAK1 2 L 2 L 10 L pzdouble 1 L Appendix M: Restriction digest reaction for verification of pACT and pBIND AHNAK1 Sample 10X reaction buffer 100X BSA DEPC H20 Enzyme 5 L pACTAHNAK1 2.5 L 0.3 L 15.2 L 0.75 L NOT1 0.75 L Mlu1 5 L pBINDAHNAK1 2.5 L 0.3 L 15.2 L 0.75 L NOT1 0.75 L Mlu1

PAGE 264

Appendix N: Reactions and parameters fo r the subcloning of rat NPRC into pGEX4T3 Restriction Digestion of rNPRC: Sample 10X Buffer H 100X BSA DEPC H 2 O Enzyme 5 L rNPRC (5g/L) 10 L 1 L 79 L 5 L EcoR1 30 L pGEX4T3 (0.54 g/L) 10 L 1 L 54 L 5 L EcoR1 Gel Electrophoresis Sample TBE LB 1 L rNPRC (0.5 g/L) 9 L 2 L 2.5 L rNPRC digest 7.5 L 2 L 1 L pGEX4T3 9 L 2 L 2.5 L pGEX4T3 digest 7.5 L 2 L 5 L ladder 5 L 2 L Samples were heated for 15 minutes for 65 C before load the gel for electrophoresis Dephosphorylation of pGEX4T3 vector digest: A 100 L reaction was set up as follows: 10 L 10X NEB3 49 L DEPC H2O 1 L CIP The reaction incubated for 1hr at 37 C in a thermocycler

PAGE 265

Ligation Reaction: Vector H 2 0 10X Buffer Ligase Insert 2 L pGEX4T2 15 L 2 L 1 L none 2L pGEX4T2 14 L 2 L 1 L 1 L rNPRC 3 L pGEX4T2 13L 2 L 1 L 1 L rNPRC Samples were ligated overnight at 16 C in a thermocycler The purity and concentration of the ligati on was estimated by gel electrophoresis 1-5 L the ligation was transformed into competent cells Appendix O: Transfection reagents used for delivery of plasmid DNA or siRNA Transfection Reagent Application Cell type Lipofectamine Transfection of plasmid DNA Adherent/suspension cell lines Lipofectamine 2000 Transfection of plasmid DNA Adherent/suspension cell lines FuGENE Transfection of plasmid DNA Adherent/suspension cell lines FuGENE HD Transfection of plasmid DNA Adherent/suspension cell lines Dharmafect1 Transfection of siRNA Adherent Dharmafect3 Transfection of siRNA Adherent

PAGE 266

Appendix P: Relevant publications Articles in peer reviewed scholarly journals: 1. Alli, A. A. and Gower, W. R., Jr. (2009) The C type natriuretic peptide receptor tethers AHNAK1 at the plasma membrane to po tentiate arachidonic acid induced calcium mobilization. Am J Physiol Cell Physiol, in press 2. Alli, A. A. and Gower, W.R., Jr. (2009) Char acterization of a polyclonal antibody against the Cytoplasmic domain of the C-type natriuretic peptide receptor. J Clin Ligand Assay 31, 3-7 Manuscripts submitted for publication: 1. Alli, A.A. and Gower, W.R. Jr. Molecular a pproaches to examine the phosphorylation state of the C type natr iuretic peptide receptor Manuscripts in preparation: 1. Alli, A.A. et al. Expression of AHNAK1 in surface epithelial cells of the stomach and its role in maintaining gastric ep ithelial permeability barrier properties P resentations, proceedings, and published abstracts: A bdel A. Alli, Drew A. Rideout, Gay M Carter, a nd William R. Gower, Jr. (2009) AHNAK expression and subcellula r localization in gastric surface epithelial cells The FASEB Journal.

PAGE 267

Experimental Biology (ASBMB); New Orleans, LA. Abdel A. Alli, Gay M Carter, and William R. Gowe r, Jr. (2009) Expression and localization of natriuretic peptide rece ptor types A and C in human stomach The FASEB Journal. Experimental Biology (APS); New Orleans, LA. Abdel A. Alli and William R. Gower, Jr. (2009) Association between NPRC and AHNAK1 may regulate arachidonic aci d dependent intracellular Ca2+ mobilization in human AoSMCs. Weinstein Cardiovascular Development Conference; San Francisco, CA. Abdel A. Alli and William R. Gower, Jr. 2008. Novel methodology for obtaining recombinant proteins from bacterial inclusi on bodies: advantages and applications. CLAS 34th International Meeting; Coral Springs Ma rriot & Golf, Coral Springs, FL. Abdel A. Alli and William R. Gower, Jr. 2008. The C type natriuretic peptide receptor may activate phospholipase C indepe ndently of G proteins thro ugh its association with AHNAK. CLAS 34th International Meeting; Coral Springs Marriot & Golf, Coral Springs, FL. Abdel A. Alli and William R. Gower, Jr. 2008. Th e association between the C type

PAGE 268

natriuretic peptide receptor and AHNAK may rev eal novel roles for na triuretic peptides in human vascular smooth muscle cells. 2nd Annual Cardiovascular Symposium ; Tampa, FL. Abdel A Alli and William R Gower (2008) The C t ype natriuretic peptide receptor associates with AHNAK in human aort ic vascular smooth muscle cells The FASEB Journal. 22:1046.5 Experimental Biology (ASBMB); San Diego, CA. Abdel A. Alli, Barrett Z. McCormick, and William R. Gower, Jr. 2007. Characterization of a Novel Polyclonal Anti body Against the C-type Natriu retic Peptide Receptor. The American Society for Cell Biology ; Washington, DC. Abdel A. Alli and William R. Gower, Jr. 2007. Effi cient recovery of correctly folded GST fusion proteins from b acterial inclusion bodies. 1st Annual Department of Molecular Medicine Graduate Rese arch in Progress Symposium Brooksville, FL. Abdel A. Alli, Dayami Lopez, and William R. Gowe r, Jr. 2007. C type natriuretic peptide receptor associates with AHNAK in A-10 vascular smooth muscle cells. 1st Annual Cardiovascular Symposium ; Tampa, FL. Abdel A. Alli, Gay M. Carter, Eric Thomas, William R. Gower, Jr. 2007. Expression,

PAGE 269

purification, and characterization of a func tional C type natriuretic peptide receptor fusion protein. Experimental Biology (ASBMB); Washington, DC. Abdel A. Alli, Dayami Lopez, and William R. Gower, Jr. 2007. Novel association between NPRC and AHNAK in the stomach. Digestive Disease Week (AGA); Washington, DC. Abdel A. Alli, Dayami Lopez, Kun Jiang, Gay M. Carter, Saras Arasu, Kristen Diehl, and William R. Gower, Jr. 2007. Novel In vitro association between C-type natriuretic peptide receptor and beta-arrestins. Endocrine Society ; Toronto, Canada.

PAGE 270

About the Author Abdel A. Alli received a Bachelor’s of Science Degree in Biology, cum laude, from the University of South Florida, College of Arts and Sciences in the Fall of 2003. He then graduated with a Master’s of Public Health Degree in Tropical Health/Communicable Diseases and a Graduate Certificate in Infection Control from the University of South Florida, College of Public Health in the Fall of 2004. He then earned a Master’s of Science Degree in Medical Scienc es from the University of South Florida, College of medicine in the Spring of 2009. During his tenor as a doctoral student Abdel earned an American Heart Association predoctoral fellowship and severa l awards for his research, including the Golden Bull award, distinguished Gradua te Student Achievement award, and the Excellence in Research Award. Abdel has co authored several peer reviewed journal articles and has earned several travel aw ards to present his research at various National/International sc ientific meetings.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2009 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003292
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Alli, Abdel.
0 245
Characterization of nprc and its binding partners
h [electronic resource] /
by Abdel Alli.
260
[Tampa, Fla] :
b University of South Florida,
2009.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2009.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: The C type natriuretic peptide receptor (NPRC), also known as NPR3 is a widely expressed single transmembrane-spanning protein. NPRC functions as a homodimer at the cell surface for the metabolic clearance of a broad range of natriuretic peptides from circulation. The intracellular domain of NPRC is coupled to inhibitory G proteins and is involved in mediating signal transduction. In order to further elucidate the role of NPRC in signal transduction, a proteomic approach was taken to identify putative protein binding partners for NPRC in different cell-types. An interrogation of the molecular association between NPRC and its identified protein binding partner(s) was carried out in different cell types to identify the specific interacting domains. The physiological role of the association between NPRC and its protein binding partner(s) were investigated in situ. Furthermore, NPRC is subject to post translation modifications, including glycosylation and phosphorylation. Although evidence suggests NPRC is phosphorylated on serine residues, the specific amino acid residues that are phosphorylated and the kinases responsible for their phosphorylation has yet to be determined. A recombinant GST-NPRC fusion protein, polyclonal NPRC antibody, kinase prediction algorithm, and several phosphospecific and substrate motif antibodies were utilized to characterize the phosphorylation state of NPRC in vitro.
590
Advisor: William R. Gower, Jr., Ph.D.
653
AHNAK1
Arrestins
Calcium
Phospholipase C
Phosphorylation
690
Dissertations, Academic
z USF
x Molecular Medicine
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3292