USF Libraries
USF Digital Collections

Biosynthesis of fatty acid amides

MISSING IMAGE

Material Information

Title:
Biosynthesis of fatty acid amides
Physical Description:
Book
Language:
English
Creator:
Farrell, Emma
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Oleamide
Metabolism
N-acylglycine
N-acylethanolamine
Primary fatty acid amide
N-acylamide
Peptidylglycine alpha-amidating monooxygenase
Lipidomics
Dissertations, Academic -- Chemistry -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Primary fatty acid amides (PFAMs) and N-acylglycines (NAGs) are important signaling molecules in the mammalian nervous system, binding to many drug receptors and demonstrating control over sleep, locomotor activity, angiogenesis, vasodilatation, gap junction communication, and many other processes. Oleamide is the best-studied of the PFAMs, while the in vivo activity of the others is largely unstudied. Even less is known about the NAGs, as their discovery as novel compounds is much more recent due to low endogenous levels. Herein is described extraction and quantification techniques for PFAMs and NAGs in cultured cells and media using solvent extraction combined with solid phase extraction (PFAM) or thin layer chromatography (NAG), followed by gas chromatography-mass spectroscopy to isolate and quantify these lipid metabolites. The assays were used to examine the endogenous amounts of a panel of PFAMs as well as the conversion of corresponding free fatty acids (FFAs) to PFAMs over time in several cell lines. The cell lines demonstrated the ability to convert all FFAs, including a non-natural FFA, and an ethanolamine to the corresponding PFAM. Different patterns of relative amounts of endogenous and FFA-derived PFAMs were observed in the cell lines tested. Essential to identifying therapeutic targets for the many disorders associated with PFAM signaling is understanding the mechanism(s) of PFAM and NAG biosynthesis. Enzyme expression studies were conducted to determine potential metabolic enzymes in the model cell lines in an attempt to understand the mechanism(s) of PFAM biosynthesis. It was found that two of the cell lines which show distinct metabolisms of PFAMs also demonstrate unique enzyme expression patterns, and candidate enzymes proposed to perform PFAM and NAG metabolism are described. RNAi knockdown studies revealed further information about the metabolism of PFAMs and calls into question the recently proposed involvement of cytochrome c. Isotopic labeling studies showed there are two pathways for PFAM formation. A novel enzyme is likely to be involved in formation of NAGs from acyl-CoA intermediates.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Emma Farrell.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003307
usfldc handle - e14.3307
System ID:
SFS0027623:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003307
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Farrell, Emma.
0 245
Biosynthesis of fatty acid amides
h [electronic resource] /
by Emma Farrell.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Primary fatty acid amides (PFAMs) and N-acylglycines (NAGs) are important signaling molecules in the mammalian nervous system, binding to many drug receptors and demonstrating control over sleep, locomotor activity, angiogenesis, vasodilatation, gap junction communication, and many other processes. Oleamide is the best-studied of the PFAMs, while the in vivo activity of the others is largely unstudied. Even less is known about the NAGs, as their discovery as novel compounds is much more recent due to low endogenous levels. Herein is described extraction and quantification techniques for PFAMs and NAGs in cultured cells and media using solvent extraction combined with solid phase extraction (PFAM) or thin layer chromatography (NAG), followed by gas chromatography-mass spectroscopy to isolate and quantify these lipid metabolites. The assays were used to examine the endogenous amounts of a panel of PFAMs as well as the conversion of corresponding free fatty acids (FFAs) to PFAMs over time in several cell lines. The cell lines demonstrated the ability to convert all FFAs, including a non-natural FFA, and an ethanolamine to the corresponding PFAM. Different patterns of relative amounts of endogenous and FFA-derived PFAMs were observed in the cell lines tested. Essential to identifying therapeutic targets for the many disorders associated with PFAM signaling is understanding the mechanism(s) of PFAM and NAG biosynthesis. Enzyme expression studies were conducted to determine potential metabolic enzymes in the model cell lines in an attempt to understand the mechanism(s) of PFAM biosynthesis. It was found that two of the cell lines which show distinct metabolisms of PFAMs also demonstrate unique enzyme expression patterns, and candidate enzymes proposed to perform PFAM and NAG metabolism are described. RNAi knockdown studies revealed further information about the metabolism of PFAMs and calls into question the recently proposed involvement of cytochrome c. Isotopic labeling studies showed there are two pathways for PFAM formation. A novel enzyme is likely to be involved in formation of NAGs from acyl-CoA intermediates.
590
Advisor: David J. Merkler, Ph.D
653
Oleamide
Metabolism
N-acylglycine
N-acylethanolamine
Primary fatty acid amide
N-acylamide
Peptidylglycine alpha-amidating monooxygenase
Lipidomics
690
Dissertations, Academic
z USF
x Chemistry
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3307



PAGE 1

Bi osynthesis of Fatty Acid Amides By Emma K. Farrell A dissertation submitted in partial fulfillment Of the requirements for the degree of Doctor of Philosophy Department of Chemistry College of Arts and Sciences University of South Florida Co Major Professor: David J. Merkler, Ph.D Co Major Professor: James R. Garey, Ph.D Michael J. Barber, D Phil. Robert L. Potter, Ph.D Date of Approval: April 5, 2010 Keywords: oleamide, metabolism, N acylglycine, N acylethanolamine, primary fatty acid amide, N acylamide, peptidylglycine amidating monooxygenase lipidomics Copyright 2010, Emma K. Farrell

PAGE 2

Dedication This work is dedicated to my family and the many who have contributed to it along the way.

PAGE 3

Acknowledgements No project of this size could be expected to be completed without the help of many others along the way. In roughly chronological order, I would like to thank these hard working, careful scholars who have donated their time and expertise in the name of sci ence. I would like to thank Ryan Aaron Matthews who showed me how to run Western Blots Terry Campbell who showed me how to do RT PCR. Jacob Shafer, who was an excellent labmate and whose ear I often had as well as his organic and computer expertise. Edward William Lowe, for helping with computer difficulties and being an excellent labmate. Dr. James R. Garey for many invaluable suggestions and endless patience. Sumit Handa, who took over ordering, provided SDS PAGE gels, and was an excellent labmate. Zhenming An, who was an excellent labmate and fixed various things around the lab as needed. Tamanna Sultana, though we never spoke. Her extraction work was the foundation of much of mine. The tech support at Shimadzu for their hours of assistance. Yudan Chen who was a wonderful technician and helped with cell and media extractions, solid phase extraction, cell culture, making fatty acid emulsions with BSA, organizing the lab, and various other things. Lamar Galloway, who synthesized N acylglycines and d id chromatography. Jian Kang Chen whom I never met but sent us N 18 TG 2 cells when ours were depleted. Milena Ivkovic who was an excellent labmate did some of the RT PCR work, and whose ear I also often had Felipe Cameroamortegui, who helped with cell and media extractions and chromatography. Muna Barazanji, who helped with cell and media extractions, chromatography, cell culture, prep TLC development, and various other jobs, and was a pleasure to talk with Kristen Amidei who helped with cell and media e xtractions, solid phase extractions, cell culture and whom I know has a bright future ahead of her in the laboratory. Mitchell Johnson for his correspondence about the N acylglycines. My committee for inspiring me to do my best. And finally, m y family for their continued support.

PAGE 4

i Table of Contents: . v i vi i i List of Equat . x v xv i Abstract . x x Chapter 1: Literature Review: Fatty Acid Amides Biosynthesis, Degradation, and 1 1.1 N 3 1.2 N 7 1.3 N 9 1.4 15 1.5 19 1.6 24 1.7 25 34 2.1 Background of N Acylglycine and Prim ary Fatty Acid Amide Isolation . 34 2.1.1 38 2.1.2 Samp 38 2.1.3 Sample 40 2.1.4 Other Co 42 2.1.5 Oleamide Producin 43 2.2 44 2.2.1 44 2.2.2 Standard Syn 45 2.2.3 47 2.2.4 Oleic Acid 47 2.2.5 48

PAGE 5

ii 2.2.6 48 2.2.7 Solid Phase E 49 2.2.8 50 2.2.9 51 2.2.10 GC 51 2.2.11 Contamination Controls .. 52 2.2.12 Data Analysis 52 2.3 53 2.3.1 GC MS of S tandard S 53 2.3.2 60 2.3.3 64 2.3.4 N Acylglycine Assay De 73 2.4 78 2.5 80 Chapter 3: Metabolic Profiling of Primary Fatty Acid Amides in SCP and N 18 TG 2 c 84 3.1 Review: Primary Fatty Ac 84 3.2 93 3.3 95 3.3.1 95 3.3.2 Standard 96 3.3.3 Fatty Acid 97 3.3.4 98 3.3.5 Metabolite 99 3.3.6 99 3.3.7 Sample Der 100 3 .3.8 GC 100 3.3.9 101 3.3.10 Data 102 3.4 Result 107 3.4.1 GC MS of FFA Incub 107

PAGE 6

iii 3.4.2 Quantitative Analysis of PFAMs in N 18 TG 2 1 11 3.4.3 Quantitative Analysis 115 3.4.4 Comparison of SCP and N 18 TG 2 121 3.5 Contro 124 3.6 Discuss 127 3.7 Conclus ion 132 3.8 132 Chapter 4: Amide Processing Enzyme Expression in Oleamide 137 4.1 Location and Biological Significance of Primary Fatty Acid Amides and N Acylglycines 137 4.2 139 4.2.1 Anabolic Route to the NAGs I: Glycination of a Free Fatty 142 4.2.2 Anabolic Route II: N 149 4.2.3 Degradation 152 4.2.4 153 4.3 158 4.4 159 4.4.1 159 4.4.2 160 4.4.3 160 4.4.4 Western 161 4.4.5 RT 162 4.5 Result 163 4.5.1 RT 163 4.5.2 166 4.5.3 169 4.6 174 4.7 175 183 5.1 Intro 183

PAGE 7

iv 5.2 184 5.2.1 185 5.2.2 Metabolite 185 5.2.3 186 5.2.4 186 5.2.5 GC 186 5.2.6 187 5.3 189 5.3.1 Materials 189 5.3.2 190 5.3.3 190 5.3.4 191 5.3.5 191 5.4 192 5.4.1 193 5.4.2 1 94 5.5 198 5.5.1 199 5.5.2 199 5.6 Interrogation of the N Acylglycine Biosynthetic Pathways through 202 5.6.1 Materi 204 5.6.2 20 7 5.7 Con 213 5.8 Ref .. 217 219 Appendix A: Synthesis of a Novel N Ac 22 0 Appendix B: GC MS of Synthesi .. 236 GC MS o 236 GC MS o f NAGs .. 244 GC 24 9

PAGE 8

v Appendix C: GC MS of M 25 1 GC MS of Palmitoleic Acid Incub 252 GC MS of Palmitic Acid Incu 256 GC MS of Elaidic Acid 260 GC MS of Tidecanoic Acid Inc 266 GC MS of Tidecanoylethanolamine I 270 Appendix D: Primer Sequ 274 Appendix E: In Vitro Cyt 276 End Page

PAGE 9

vi List of Tables: Table 1 1: The Structures of the Fatty Acid Amides 1 Table 1 2: Acyl Chains Found on the Fatty Acid Amides 2 Table 1 3: Degradation of N Acyldopamines 9 Table 1 4: Mammalian N Fatty Acylamino Acids 11 Table 1 5: Formation of N Acylamino Acids 13 Table 1 6: Receptors Identified for the Mammalian Bioactive Fatty Acid Amides 21 Table 1 7: Disorders Associated with Amide Binding Receptors 24 T able 2 1: Summary of N Acylglycine Analysis from Mammalian Sources 36 Table 2 2: Summary of Primary Fatty Acid Amide Analysis from Mammalian Sources 37 Table 2 3: Endogenous Levels of Oleamide in Cells and Media 79 Table 3 1: Quantification and Location of Endogenous Mammalian PFAMs 85 Table 3 2: Occurrence and Role of PFAMs in Mammals 87 Table 3 3: Relative Activity of PFAMs on Various Targets 90 Table 3 4: Fatty Acids Used for Incubation 9 8 Table 3 5: Selected ions for Integration of Amides and Nitriles 103 Table 3 6: PFAMs in Cells and Media 120 Table 3 7: Relative Substrate Specificity of FAAH 130 Table 3 8: Kine tic Data for FAAH 130 Table 4 1: Occurrence and Role of Endogenous Long Chain PFAMs and NAGs in Mammals 138 Table 4 2: In Vitro Substrate Preferences of Purified ACSL Isoforms 143 Table 4 3: Subcel lular Localization of Putative Biosynthetic Enzymes 148 Table 4 3: Degradative Reactions for N Acylglycines 153 Table 4 4: Proposed Alternate Paths for Primary Fatty Acid Amide Biosynthesis 154 Table 4 6: Molecular Weights of Western Blot Bands: Detected and Published 169 Table 4 7: Summary of Expression Data 170

PAGE 10

vii Table 4 8: NAG Synthesizing Enzymes in N 18 TG 2 Cells 175 Table 5 1: Oleamide in HAEC Cells 187 Table 5 2: Frag ments Used for Isotopic Ratio Assignment 210 Table A: Primer List, Predicted Fragment Size, and Successful PCR Experiments 27 4 Table B: Percent Conversion of Oleoyl CoA to Oleamide by Cyt C 27 9

PAGE 11

viii List of Figures: Figure 1 1: Biosynthetic Pathways for N Acylethanolamines 5 Figure 1 2: Biosynthesis of N Acylphosphatidylethanolamine 6 Figure 1 3: Biosynthesis of N Acyldopamine 8 Figure 1 4: Proposed PFAM Biosynthetic Reactions 17 Figure 1 5: Proposed Biosynthetic and Degradative Pathways for PFAMs, NAGs, and NAEs 19 Figure 2 1: Extraction of PFAMs for Analysis by GC MS 49 Figure 2 2: Extraction of NA Gs for Analysis by GC MS 51 Figure 2 3: Mechanism for the Derivitization of Amides with BSTFA 54 Figure 2 4: GC MS of Oleonitrile and Oleamide TMS from Oleamide BSTFA R eaction 55 Figure 2 5: GC MS of N Oleoylglycine Derivitized with BSTFA 56 Figure 2 6: McLafferty Rearrangements for Acyl Amides 57 Figure 2 7: 13 C 18 Oleamide TMS Mass Spectrum 58 Figure 2 8: N 13 C 18 Oleoylglycine Mass S pectra 59 Figure 2 9: GC MS of HdG 60 Figure 2 10: GC MS of N 18 TG 2 Cells Incubated with 13 C 18 Oleic Acid Showing 13 C 18 Oleamide TMS 61 Figure 2 11: GC MS of N 18 TG 2 Conditioned Media Incubated with 13 C 18 Oleic Acid Showing 13 C 18 Oleamide 62 Figure 2 12: GC MS of N 18 T G 2 Incubated with 13 C 18 Oleic Acid Showing 13 C 18 Oleoylglycine TMS 63 Figure 2 13 : GC MS of N 18 TG 2 Conditioned Media Incubated with 13 C 18 Oleic Acid Showing 13 C 18 Oleoylglycine TMS 64 Figure 2 14: GC MS HEK 293 Cell Extract after Incubation with OA for 12h, Showing Oleonitrile 66 Figure 2 15: GC MS of HEK 293 Conditioned Media Extract after Incubation with

PAGE 12

ix OA for 24h, Showin g Oleonitrile 67 Figure 2 16: GC MS of N 18 TG 2 Cell Extract after Incubation with OA for 12h, Showing Oleonitrile 68 Figure 2 17: GC MS of N 18 TG 2 Conditioned Media Extract after Incubation with OA for 48h, Showing Oleonitrile 69 Figure 2 18 : GC MS of SCP cell Extract after Incubation with OA for 48h, Showing Oleamide TMS 70 Figure 2 19: GC MS of SCP Conditioned Media Extract after Incubation with OA for 24h, Showing Oleonitr ile 71 Figure 2 20: Oleamide Production in SCP, N 18 TG 2 and HEK 293 Cells after Oleic Acid Incubation 72 Figure 2 21: Integration of NOG under Various Reaction Conditions 74 Figure 2 22: Recovery of NAGs on Various TLC Plates 75 Figure 2 23: Determination of Best Prewashing Solvent for TLC 75 Figure 2 24: Recovery of HdG from Spiked N 18 TG 2 Media 76 Figure 2 25: Recovery of HdG from Spiked SCP Cells 77 Figure 2 26: Extraction Efficiency of NAGs 78 Figure 3 1: Formation of NAG and PFAM by Two Metabolic Pathways 94 Figure 3 2: GC of experimental and spiked samples 101 Figure 3 3: Fragmentation Patterns for Long Chain Acyl Nitr iles 104 Figure 3 4: Fragmentation Patterns of PFAM TMS Compounds 105 Figure 3 5: MIC Analysis of a GC Peak 106 Figure 3 6: GC MS of N 18 TG 2 Incubated with LOA for 12 Hours, Showing Linoleonitrile 108 Figure 3 7: GC MS of N 18 TG 2 Conditioned Media Incubated with LOA for 48 Hours, Showing Linoleonitrile .. 109 Figure 3 8: GC MS of SCP Cells Incubated with LOA for 48 Hours, Showing Linoleamide TMS 110 Figure 3 9: GC MS of SCP Conditioned Media Incubated with LOA for 48 Hours, Showing Linoleamide TMS .. 111 Figure 3 10: Quantification of PFAMs isolated from N 18 TG 2 cells and media 112

PAGE 13

x Figure 3 11: Endogenous PFAMs in N 18 TG 2 Cells .. 1 1 4 Figure 3 12: Primary Fatty Acid Amides Produced in N 18 TG2 Cells Incubated with Various Fatty Acids 1 14 Figure 3 13 : Quantification of PFAMs isolated from SCP cells and media, and B lanks 116 Figure 3 14: Endogenous PFAMs in SCP Cells 11 8 Figure 3 15: Primary Fatty Acid Amides Produced in SCP Cells Incubated with Various Fatty Acids 118 Figure 3 16: Endogenous PFAMs in SCP and N 18 TG 2 Cells 121 Figure 3 17: Comparison of PFAMs in SCP and N 18 TG 2 Cells 122 Figure 3 18 : N 18 TG 2 M edia I ncubated with M etabolites with or without P revious E xposure to C ells 125 Figure 3 19: N 18 TG 2 Incubated with BSA and Normal Cells 126 Figure 3 20: SCP Incubated with BSA and Normal Cells 126 Figure 3 21: Extraction Efficiency for PFAMs 127 Figure 3 22: Kinetic Data for PAM and Various N Acylglycines 129 Figure 3 23: Tridecanamide in SCP and N 18 TG 2 Cells after TDA and TDEA Incubations 13 1 Figure 4 1: Proposed Biosynthetic and Cataboic Pathways for NAGs and PFAMs 140 Figure 4 2: Two Pathways of Formation for NAGs 150 Figure 4 3: Hypothesized Oleam ide Synthesome 156 Figure 4 4: In vitro and In Vivo Evidence for Amide Metabolism 158 Figure 4 5: PCR in Human Kidney 163 Figure 4 6: N 18 TG 2 RT PCR for ACSL4 163 Figure 4 7: N 18 TG2 cDNA with Nested PAM P rimers 163 Figure 4 8: PCR for FAAH 164 Figure 4 9: PCR in Human Whole Brain and Liver cDNA 164 Figure 4 10: SCP PCR for PAM 164 Figure 4 11: AlDH3A2 Human B rain, Liver and Kidney PCR 165 Figure 4 12: SCP ADH3 PCR 165 Figure 4 13 : Cytochrome C PCR 165

PAGE 14

xi Figure 4 14: Standard Curve for a MW Ladder in SDS PAGE 166 Figure 4 15: FACL3 Western Blots .. 167 Figure 4 16: FACL5 Western Blots .. 167 Figure 4 17: FACL6 Western Blots .. 167 Figure 4 18 : PAM (S 16) Western Blot 168 Figure 4 19: FAAH (V 17) Western Blot 168 Figure 4 20: Metabolic Diagram of Expression Data for SCP and N 18 TG 2 Cells 172 Figure 5 1: Amount of Oleamide in HAEC Cells 18 8 Figure 5 2: RNAi Optimization with GAPDH 192 Figure 5 3: PAM Knockdown by siRNA in N 18 TG 2 Cells 194 Figure 5 4: 13 C 18 N Oleoylglycine in N 18 TG2 Cells Incubated with 13 C 18 Oleic Acid and PAM siRNA 195 Figure 5 5: Quantification of 13 C 18 N Oleoylglycine in N 18 TG 2 cells with and without RNAi for PAM 196 Figure 5 6: Oleamide and N Oleoylglycine in N 18 TG 2 cells with and without PAM RNAi 197 Figure 5 7: Putative Role of Cyt C in PFAM Biosynthesis .. 198 Figure 5 8: Cytochrome C Knockdown by siRNA 200 Figure 5 9: N 18 TG 2 Incubated with Oleic Acid and Cytochrome C siRNA 201 Figure 5 10: Elucidation of the Biosynthesis of a PFAM from Two Distinct Pathways 203 Figure 5 11: TLC of Oleoyl Chloride Reaction 204 Figure 5 12: GC MS of 3 13 C 1 15 N Oleoylethanolamine 206 Figure 5 13 : Oleamide in N 18 TG 2 Incubated with Labeled Oleoylethanolamine 207 Figure 5 14: GC MS of Labeled Oleonitrile from N 18 TG 2 Cell Extract 208 Figure 5 15: Background Levels in N 18 TG 2 Conditioned Media and Cell Samples 211 Figure 5 16: Isotope Ratios of Oleamide in N 18 TG 2 after Incubation with Labeled N Oleoylethanolamine 212 Figure 5 17: NAG and PFAM Biosynthesis in N 18 TG 2 Cells 2 14 Figure A: GC MS of N Oleoylglycine Derivitized with BSTFA 22 2 Figure B: Fragmentation Scheme for Di TMS NAGs 223

PAGE 15

xii Figure C: Fragmentation Scheme for Mono TMS NAGs 224 Figure D: Fragmentation Scheme for Enyli minoacetate Derivatives of NAGs 225 Figure E: Fragmentation Patterns for Enyliminoacetate Derivatives of N Acylglycines 227 Figure F: GC MS of Enyliminoacetate Derivative of NOG and Fragmentation 228 Figure G: GC MS of Enyliminoacetate Derivative of NLG and Fragmentation 229 Figure H: GC MS of Enyliminoacetate Derivative of NPOG and Fragmentation 230 Figure I: GC MS of Enyliminoacetate Derivative of NPG and Fragmentation 231 Figure J: GC MS of Enyliminoacetate Derivative of HdG and Fragmentation 232 Figure K: Proposed Reaction Mechanism for the Formation of an Enyliminoacetate Derivative of NAGs .. 234 Figure L: Resonance of Enyliminoacetate Derivative of NAG 235 Figure M: GC MS of 13 C 18 Oleamide .. 237 Figure N: GC MS of Oleamide 238 Figure O: GC MS of Tridecanamide 239 Figure P: GC MS of Palmitamide 240 Figure Q: GC MS of Palmitoleamide 241 Figure R: GC MS of Elaidamide .. 242 Figure S: GC MS of Linoleamide 243 Figure T: GC MS of 13 C 18 N Oleoylglycine 245 Figure U: GC MS of N Palmitoylglycine 246 Figu re V: GC MS of N Palmitoleoylglycine 247 Figure W: GC MS of N Linoleoylglycine 248 Figure X: GC MS of N Elaidoylglycine 249 Figure Y: GC MS of N Tridecanoylethanolamine 2 50 Figure Z: GC MS of N 18 TG 2 Cell Extract after Incubation with POA for 12h, Showing Palmitoleamide TMS 25 2 Figure AA: GC MS of N 18 TG 2 Media Extract after Incubation with POA for 12h, Showing Palmitoleamide TMS and Interference from OA 25 3 Figure BB: GC MS of SCP Cell Extract after Incubation with POA for 48h, Showing Palmitoleamide TMS .. 254

PAGE 16

xiii Figure CC: GC MS of SCP Media Extract after Incubation with POA for 48h, Showing Palmitoleonitrile 255 Figure DD: GC MS of N 18 TG 2 Cell Extract after Incubation with PA for 24h, Showing Palmitonitrile 257 Figure EE: GC MS of N 18 TG 2 Media Extract after Incubation with PA for 48h, Showing Palmitoleamide TMS 258 Figure FF: GC MS of SCP Cell Extract after Incubation with PA for 48h, Showing Palmitonitrile 259 Figure GG: GC MS of SCP Media Extract after Incubation with PA for 24h, Showing Palmitonitrile 260 Figure HH : GC MS of N 18 TG 2 Cell Extract after Incubation with EA for 48h, Showing Elaidamide TMS 262 Figure II: GC MS of N 18 TG 2 Media Extract after Incubation with EA for 48h, Showing Elaidonitrile 263 Figure JJ: GC MS of SCP Cell Extract after Incubation with EA for 24h, Showing Elaidamide TMS 264 Figure KK: GC MS of SCP Media Extract after Incubation with EA for 24h, Showing Elaidonitrile 265 Figure LL: G C MS of N 18 TG 2 Cell Extract after Incubation with TDA for 48h, Showing Tridecanamide TMS .. 266 Figure MM: GC MS of N 18 TG 2 Media Extract after Incubation with TDA for 48h, Showing Tridecanamide TMS .. 267 Figure NN: GC M S of SCP Cell Extract after Incubation with TDA for 12h, Showing Tridecanamide TMS 268 Figure OO: GC MS of SCP Media Extract after Incubation with TDA for 24h, Showing Tridecanamide TMS 269 Figure PP: GC MS of N 18 TG 2 Cell Extract after Incubation with TDEA for 48h, Showing Tridecanamide TMS 270 Figure QQ: GC MS of N 18 TG 2 Media Extract after Incubation with TDEA for 12h, Showing Tridecanamide TMS 271 Figure RR: GC MS of SCP Cell Extract after Incubation with TDEA for 24h,

PAGE 17

xiv Showing Tridecanamide TMS .. 272 Figure SS: GC MS of SCP Media Extract after Incubation with TDEA for 48h, Showing Tridecanamide TMS .. 273 Figure TT: Absorption Spectra for Cytochrome C and Cysteine with Ellman's Reagent .. 277 Figure UU: Cytochrome C assay for Oleamide Formation 278 Figure VV: Cytochrome C Assay for CoA Release with Various Acyl CoA s 279

PAGE 18

xv List of Equations: Equation 1 1: Hydrolysis of an N Acylethanolamine 7 Equation 1 2: Hydrolysis of a PFAM by FAAH 16 Equation 2 1: Synthesis of Acyl Chloride from a Fatty Acid 45 Equation 2 2: Synthesis of 13 C 18 Oleamide from the Acyl Chloride 45 Equation 2 3: Synthesis of HdG from Acyl Chloride 47 Equation 3 1: Synthesis of Acyl Chloride from a Fatty Acid 96 Equation 3 2: Synthesis of PFAM from Acyl Chloride 96 Equation 3 3: Synthesis of 3 13 C, 15 N Oleoylethanolamine ... 97 Equation 4 1: Amidation of an N Acylglycine by PAM 141 Equation 4 2: Fatty Acyl CoA Lygase Reaction .. 142 Equation 4 3: Formation of N Acylglycine by ACG NAT 143 Equation 4 4: NMT Glycination Reaction 144 Equation 4 5: BAAT Glycination Reaction 145 Equation 4 6: Cyt C Mediated Formation of N Acylglycine 146 Equation 4 7: Sequential Oxidation of an N Acylethanolamine by ADH or ADH and AlDH 149 Equation 5 1: Synthesis of 3 13 C, 15 N Oleoylethanolamine .. 205 Equation 5 2: Calculations for the Ratios of Singly and Doubly Labeled Oleonitrile 210 Equation A: Derivitizations with BSTFA .. 220 Equation B: Assay for CoA Release by Cytochrome C 27 6

PAGE 19

xvi List of Abbreviations : 2 AG 2 Arachidonoyl glycerol 5 HT 5 Hydroxytryptamine (Serotonin) Abdh4 Hydrolase 4 ACBP Acyl CoA binding protein ACGNAT Acyl CoA:glycine N acyltransferase ACS Acyl CoA synthetase ACSL Long chain acyl CoA synthetase ASC Ascorbic acid AT Amino transferase BAAT Bile acid:amino acid transferase BSA Bovine serum albumin BSTFA N,O Bis(trimethylsilyl)trifluoroacetamide CB Cannabinoid receptor CI Chemical ionization CNS Central nervous system COMT Catechol O methyltransferase COX 2 Cyclooxygenase 2 CP Choroid plexus CSF Cerebrospinal fluid CYP45F Cytochrome P450 cyt c Cytochrome c DBM monooxygenase DCM Dichloromethane DMEM Dulbecco's Modified Eagle's Medium DMSO Dimethylsulfoxide DNA Deoxyribonucleic acid dsRNA double stranded RNA EA Elaidic acid EDTA Ethylenediaminetetraacetic acid EGTA Ethylene bis(oxyethylenenitrilo)tetraacetic acid EI Electron impact EMEM Eagle's minimum essential medium erg Ether go go related gene ESI Electrospray ionization

PAGE 20

xvii FAAH Fatty acid amide hydrolase FBS Fetal bovine sesrum FFA Free fatty acid G3P Glyercol 3 phosphate GABA Gamma aminobutyric acid GC MS Gas chromatography mass spectroscopy GP NAE Glycerophospho N acylethanolamine GPR G protein coupled receptor HAEC Human aortic endothelial cells HdA Heptadecanoic acid, D33 deuterated HdG N Heptadecanoylglycine, deuterated with 33 deuteriums HEK 293 Human embryonic epithelial kidney cells (ATCC# CRL 1573) HETE Hydroxyeicosatetraenoic acid HPLC High performance liquid chromatography HPTLC High performance thin layer chromatography IE Ion exchange lc Long chain LC MS Liquid chromatography mass spectroscopy LO Lipoxygenase LOA Linoleic acid LPA Lysophosphatic acid LysoNAPE Lyso N acylphosphatidylethanolamine LysoPLC/D Lysophospholipase C/D m/z Mass to charge ratio MALDI Matrix assisted laser desorption ionization MGL Monoacylglycerol lipase MIC Multiple ion chromatogram MS Mass spectrum MS/MS Tandem mass spectroscopy MW Molecular weight NAA N Acylamino acid NAAA N acylethanolamine hydrolyzing acid amidase NADA N fatty acyldopamine NAE N Acylethanolamine NAG N Acylglycine NAPE N acylphosphatidyl ethanolamine NAPE PLD N acylphosphatidyl ethanolamine specific phospholipase D NEG N Elaidoylglycine NFDM Nonfat dry milk NGF Nerve growth factor NLG N linoleoylglycine

PAGE 21

xviii NMR Nuclear Magnetic Resonance NMT N myristoyltransferase NOE N oleoylethanolamine NOG N oleoylglycine NP Normal phase NPG N palmitoylglycine NPOG N Palmitoleoylglycine OA Oleic acid PA Palmitic acid PA Phosphatidic acid PAM Peptidyl glycine alpha amidating monooxygenase PBS Phosphate buffered saline PCR Polymerase chain reaction PDEase Phosphodiesterase PFAM Primary fatty acid amide PG Prostaglandin Pi Phosphate PLA2 Phospholipase A2 PLC Phospholipase C PLD Phospholipase D PMSF Phenylmethylsulfonyl fluoride pNAE phospho N acylethanolamine POA Palmitoleic acid PPAR Peroxisome proliferator activated receptor Ptase phosphatase rbf Round bottom flask RISC RNA induced silencing complex RNA Ribonucleic acid RNAi Ribonucleic acid interference RP Reverse phase RT Reverse transcription SCP Sheep choroid plexus cells SDA Semidehydroascorbic acid SDS PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis SIM Single ion monitoring siRNA small interfering RNA SOD Superoxide dismutase SPE Solid phase extraction t BDMS tert butyl dimethylsilyl ether TBS T Tris buffered saline (25mM Tris, 140mM NaCl), 0.5% Tween 20 TDA Tridecanoic acid

PAGE 22

xix TDEA N Tridecanoylethanolamine TIC Total ion chromatogram TLC Thin layer chromatography Tris Tris(hydroxymethyl)aminomethane TRP Transient receptor potential ion channel TRPM Transient receptor potential channels of melastatin TRPV Transient receptor potential vanilloid type 1 UV Ultraviolet

PAGE 23

xx Biosynthesis of Fatty Acid Amides Emma K. Farrell ABSTRACT Primary fatty acid amides (PFAMs) and N acylglycines (NAGs) are important signaling molecules in the mammalian nervous system, binding to many drug receptors and demonstratin g control over sleep, locomotor activity angiogenesis, vasodilatation, gap junction communication, and many other processes. Oleamide is the best studied of the PFAMs, while the in vivo activity of the others is largely unstudied. Even less is known about the NAGs, as t heir discovery as novel compounds is much more recent due to low endogenous levels. Herein is described extraction and quantification techniques for PFAMs and NAGs in cultured cells and media using solvent extraction combined with solid phase extraction (P FAM) or thin layer chromatography (NAG), followed by gas chromatography mass spectroscopy to isolate and quantify these lipid metabolites. The assays were used to examine the endogenous amounts of a panel of PFAMs as well as the conversion of corresponding free fatty acids (FFAs) to PFAMs over time in several cell lines The cell lines demonstrated the ability to convert all FFAs, including a non natural FFA, and an ethanolamine to the corresponding PFAM. D ifferent pattern s of relative amounts of e ndogenous and FFA derived PFAMs were observed in the cell lines tested. Essential to identifying therapeutic targets for the many disorders associated with PFAM signaling is understanding the mechanism (s) of PFAM and NAG biosynthesis. E nzyme expression studies were conducted to determine potential metabolic enzymes in the model cell lines in an attempt to understand t he mechanism(s) of PFAM biosynthesis It was found that two of the cell lines which show distinct metabolisms of PFAMs als o demonstrate unique enzyme expression patterns and candidate enzymes proposed to

PAGE 24

xxi perform PFAM and NAG metabolism are described. RNAi knockdown studies revealed further informatio n about the metabolism of PFAMs and calls into question the recently propose d involvement of cytochrome c. I sotopic labeling studies showed there are two pathways for PFAM formation. A novel enzyme is likely to be involved in formation of NAGs from acyl CoA intermedia tes.

PAGE 25

1 1 Literature Review: Fatty Acid Amides Biosynthesis, Degradation, and Pharmacological Significance The identification of two biologically active fatty acid amides, N arachidonoylethanolami n e (anandamide) and oleamide, has generated a great deal of excitement and stimulated considerable research. However, anandamide and oleamide are merely the best known and best understood members of a much larger family of biologically occurring fatty acid amides. In this review, the fatty acid amides that have bee n isolated from mammalian sources will be outlined what is known about how these molecules are made and degraded in vivo will be discussed and their potential for the developme nt of novel therapeutics will be highlighted. Relative to NAEs, much less is currently known about the NAAs, the NADAs and the PFAMs, except that they are found in biological systems (see refs 6,61,62 for earlier reviews). The fatty acid amide bond has long been recognized in nature, being important in the structure of the ceramide s 65 and the sphingolipids 71 The first non sp h ingosine based fatty acid amide isolated from a natural source was N palmitoylethanolamine from egg yolk in 1957 90 Interest in the N acylethanolamines (NAEs) dramatically increased upon Table 1 1 : The Structures of the Fatty Acid Amides Fatty Acid Amide Structure NAE NADA NAA a PFAM a R 2 represents the functional groups that define the different amino acids R 1 represents various acyl chains (see Table 2).

PAGE 26

2 the identification of N arachidonoylethanolamine (anandamide) as an endo genous ligand for the cannabinoid receptors in the mammalian brain 94 It i s now known that a family of NAEs is found in the brain and in other tissues 8,95 In addition to the NAEs, other classes of fatty acid amides have been characterized including the N acylamino acids (NAAs) 96 the N acyldopamines (N A DAs) 103 and the primary fatty acid amides (PFAMs) 104,105 Table 1 1 shows the structure of the amides and Table 1 2 shows some of the common ly found acyl groups a Table 1 2 : Acyl Chains Found on the Fatty Acid Amides Name Carbon skeleton Structure of R 1 Arachidonic 20:4( 5,8,11,14 ) Erucic 22:1( 13 ) Palmitoleic 16:1 ( 9 ) Linoleic 18:2( 9,12 ) Linolenic 18:3( 9,12,15 ) Oleic 18:1( 9 ) Elaidic a 18:1 ( trans 9 ) Palmitic 16:0 Stearic 18:0 The arrow points to carbon 2 in the fatty acid chain. R 1 is the acyl group from Table 1 1 a This acyl chain originates from a dietary source.

PAGE 27

3 1.1 N Acylethanolamines A series of long chain NAEs have been identified in the mammalian brain, the most abundant being N palmitoyl N stearoyl and N oleoylethanolamine 61,95 each are anandamide, N linoleoyl N lin olenoyl N dihomo linolenoyl and N docosatetraenoylethanolamine 61 In addition to the brain, the NAEs are widespread in the peripheral tissues 95,109 A anandamide is the best understood NAE. The function o f anandamide in mammals is mediated largely by its binding to the CB 1 receptor s ( K d = ~80 nM ) 4,110 Anandamide is also known to bind to CB 2 recepto rs (K d = ~500 nM) 4 peroxisome proliferator activated receptors (PPAR K d = 20 M and PPAR K d = 10 M ) 5 to the transient receptor potential (TRP) vanilloid type 1 (TRPV1) channels ( K d ~ 2 M ) 6 and the transient receptor potential channels of melastatin type 8 (TRPM8) (K d ~ 1 M) 7 It is unclear how much the binding of anandamide to the non CB 1 receptors contributes to its total activity in vivo A nandamide is involved in the regulation of body temperature, locomotion, feeding and the perception of pain, anxiety and fear 29,30,122 124 The functions of the ot her known mammalian NAEs are not as well established as anandamide, even though ananadamide represents only 1 10 % of brain NAEs 61,95 With the exception of N dihomo linolenoyl and N docosatetraenoylethanolamine, the other NAEs do not bind to the CB 1 and CB 2 receptors 6,125,126 N Oleoylethanolamine binds to PPAR and PPAR functioning to inhibit feeding behavior 5,126 as well as the TRPV1 receptor 8 and the G protein coupled receptor, GPR119 46 S tearoylethanolamine binds to specific, non CB 1 and CB 2 receptors and yet exhibits activities similar to anandamide 127 N Palmitoylethanolamine is neuroprotective and also modulates pain and inflammation 128 The anti inflammatory effect of N palmitoylethanolamine is mediated by its binding to PPAR 128 Ryberg et al 54 recently found that N p almitoylethanolamine is a ligand for the orphan GPR55 receptor I t has been suggested that at least some of the activities of N palmitoylethanolamine, N oleoylethanolamine and N stearoylethanolamine result from

PAGE 28

4 d because the other NAEs compete with anandamide for enzymatic degradation 125 The most widely accepted biosynthetic pathway for NAEs involves the cleavage of N acylphosphatidylethanolamine (NAPE) to the corresponding NAE and phosphatidic acid (PA) by NAPE specif ic phospholipase D (NAPE PLD) (reaction 1 in Figure 1 1 ) 130,131 NAPE is produced by the N acylation of pho sphatidylethanolamine in a reaction catalyzed by a calcium activated transacylase ( Figure 1 2 ) 130 Recent evidence suggests that there ar e other PLD independent pathways for NAE biosynthesis 10,67 One alternative pathway involves the phospholipase C mediated cleavage of NAPE to yield a phospho NAE (pNAE) which is then cleaved by a phosphatase to yield the NAE and inorganic phosphate (reactions 6 and 7 in Figure 1 1 ). Another alternative pathway involves sequential hydrolysis of the O acyl chains of NAPE to produce free fatty acids and glycerophospho NAE (GP NAE) (reactions 2 and 4 in Figure 1 1 ). Simon and Cravatt 10 have found that a serine hydrolase, / hydrolase 4 (Abh4), can catalyze both O deacylation steps required to convert NAPE to GP NAE. Phosphodiesterase cleavage of GP NAE will yield the NAE and glycerol 3 phosphate (reaction 5 in Figure 1 1 ). Other possible routes to the NAEs are direct hydrolysis o f lysoNAPE (reaction 3 in Figure 1 1 ) or the 2 step conversion of GP NAE to the NAE via phospho NAE (reactions 8 and 7 in Figure 1 1 ). The PLD independent pathways for NAE biosynthesis are produce these important bioactive lipid amides that a 62,67 Future work will determine how these three pathways function to supply the required NAE levels. For completeness, one last NAE synthe tic strategy must be mentioned. There is data going back more than 40 years, showing that the NAEs can be produced in vitro from ethanolamine and fre e fatty acids (FFAs) in brain microsomes to form NAPEs in a reaction that did not require ATP or CoA SH 132 The authors hypothesize that the FFAs are taken into proteins and then exchanged to acceptor molecules (ethanolamines or phosphatidylethanolamines, in this case). However, in vivo significan ce of this chemistry is unclear.

PAGE 29

5 Figure 1 1 : Biosynthetic P athways for N A cylethanolamines The enzymes catalyzing the individual reactions are in the shaded boxes and the numbers that refer to reactions in the text are in bold blue The reader is referred to Simon and Cravatt 10 and Liu et al. 67 for greater details on NAE biosynthesis. Abdh4, hydrola se 4; G3P, glyercol 3 phosphate; GP NAE, glycerophospho NAE; L PA, lysophosphatic acid; LysoNAPE, lyso N acylphosphatidylethanolamine; LysoPLC/D, lysophospholipase C/D; NAE, N acylethanolamine; NAPE, N acylphosphatidylethanolamine; NAPE PLD, NAPE specific p hospholipase D; PA, phosphatidic acid; PDEase, phosphodiesterase; P i phosphate; PLA 2 phopholipase A2; PLC, phopholipase C; pNAE, phospho NAE; PTase, phosphatase (most probably tyrosine phosphatase, PTPN22 or inositol phosphatase, SHIP1, in vivo).

PAGE 30

6 NAE degradation is by hydrolysis to fatty acid and ethanolamine (see Equation 1 1 ) Three enzymes are known to catalyze this reaction : two fatty acid amide hydrolases (FAAH 1 and FAAH 2) 133 and N acylethanolamine hydrolyzing acid amidase (NAAA) 134 FAAH 1 and FAAH 2 both hydrolyze NAEs, but have different acyl group specificities (see Chapter 4 for more information) Note that FAAH inhibitors have been targeted as potential analgesics 135 137 Figure 1 2 : Biosynthesis of N A cylphosphatidylethanolamine Biosynthesis of N acylphosphatidylethanolamine (NAPE). See text for more details.

PAGE 31

7 1.2 N Acyldopamines A relatively small number of long chain N fatty acyldopamines (NADAs) have been isolated and characterized from mammalian systems including N palmitoyl N stearoyl N oleoyl and N arachidonoyldopamine 1,63 A ll of these NADAs are found in the mammalian brain with the highest concentrations in the striatum, hippocampus and cerebellum 1 N Arachidonoyldopamine and N oleoyldopamine were first identified as capsaicin like endovanilloids that bound tightly to the TRPV1 receptor 1,6,63 As a consequence of their binding to the TRPV1 receptors, both of these N fatty acyl dop a mines stimulate d calcium influx in HEK 293 cells over expressing either rat or human TRPV1 and pro duce d hyperalgesi a in rats 1,63 N Arachidonoyldopamine also binds tightly to the CB 1 receptor (K d = 25 0 500 nM) 63,138 and a non CB 1 /CB 2 G protein receptor (G PR ) in the aorta 64 Other endogenous N fatty acyldopamines include N palm itoyldopamine and N stearoyldopamine both of which bind with to the TRPV1 or CB 1 receptors with relatively low affinity ( K d values >5 M ) 63 Th e biological role(s) fulfilled by N palmitoyldopamine and N stearoyldopamine are unclear, but there is evidence that both enhance the activity of N arachidonoyldopamine via the entourage effect 139 In addition to the long chain N fatty acyldopamines, N acetyldopamine is a known metabolite in mammals The function of N acetyldopamine is unclear, but it has been shown to inhibit mammalian sepiapterin reductase (an enzyme in the tetrahydrobiopterin biosynthetic pathway) with a K i = 400 nM 140 There has been little work on the pathways for the biosynthesis and degradation of the N acyldopamines. N Acetyldopamine is produced by the acetyl CoA dependent N acetylation of dopamine 141 and has been found in the urine, kidney and liver 141,142 It has Equation 1 1 : Hydrolysis of an N Acylethanolamine

PAGE 32

8 been proposed that the long chain N acyldopamines are made in vivo in a similar fashion with the acyl donors being the corresponding acyl CoA thioesters 1 Alternatively, the N acyldopamines could be produced by the tyrosine hydroxylase mediated oxidation of N acyltyrosines met abolites that were identified in mammals just this year (see Table 1 4 ). Huang et al 1 provide data in support of both biosynthetic pathways as inhibition of hydroxylase reduced formation of a NADA like com pound from tyrosine. Skimob et al also show the increased formation of N arachidonoyldopamine during the incubation of arachidonic acid and tyrosine as compared to the incubation of arachidonic acid and dopamine. 143 Evidence suggests a decarboxylation pr eceding oxidation ( Figure 1 3 ) Degradation of the NADAs is thought to occur by FAAH catalyzed hydroly sis to the fatty acid and dopamine 1 or O methylation by catechol O methyltransferase (COM T ) 1 N Acetyldopamine can serve as a s ubstrate for tyrosinase ; thus, the long chain N acyldopamine s could also be oxidized to a quinone by this enzyme 32 N Acetylnoradrenaline is a known human metabolite 66 suggesting that N acetyldopamine and the longer chain N acyldopamines could serve as substrates for dopamine monooxygenase (DBM) ( Table 1 3 ) Figure 1 3 : Biosynthesis of N A cyldopamine Proposed biosynthesis of NADAs. Enzyme 1 is unknown. Enzyme 2 is tyrosine hydroxylase (a.k.a. monophenol monooxygenase).

PAGE 33

9 1.3 N Acylamino acids Mammalian N acylamino acids have a long history tracing their discovery to the conjugation of glycine to benzoate to form N benzoylglycine ( hippur ate ) in the 1 840s (see Caldwell et al 96 and reference cited therein) N Acetyl conjugates for all 20 of the common amino acids have been identified in mammals. In addition, the N acetyl conjugates of other amino acids, including alan ine, allo isoleucine, aminobutyric acid, GABA, 2 aminooctanoic acid citrulline and N acetyllysine have also been characterized from mammalian sources 3,92,93,98,129,144 153 With the excepti on of N acetylglutamate which serves as an allosteric activator of carbamoyl phosphate synthetase I 68 the N acetylamino acid conjugates are trace metabolites that function in the excretion/detoxification of abnormally high levels of a particular amino acid. Similarly, a set of N isovaleroylamino acids have been identified fr om patients suffering from isovaleric acidemia, with N isovaleroylglycine being the most abundant metabolite 93,100,152,154,155 T he function of these N isovaleroylamino acids is also in excretion; one patient suffering from isovaleric academia was excreting 1.7 grams of N isovaleroylglycine per day 156 Glycination is essential in the synthe sis of bile acids 157,158 and metabolism of short chain fatty acids 159 and small molecule xenobiotics 107,160 N Conjugation of fatty acids to amino acids forming the long chain N fatty acylglycines is known, but is relatively uncommon in mammals and a comprehens ive listing of the known long chain NAGs isolated from mammalian sources can be found in Chapter 4 The most common Table 1 3 : Degradation of N Acyldopamines Enzyme Reaction Ref FAAH NADA + H 2 O FFA + dopamine 1 COMT NADA + S adenosyl L methionine S adenosyl L homocysteine + N acyl 3 methoxytyramine 1 tyrosinase NADA + O 2 H 2 O + N acyldopamine quinone 32 DBM NADA + ascorba te + O 2 dehydroascorbate + H 2 O + N acylnoradrenaline 66 Abbreviations: COMT, catechol O monooxygenase; FAAH, fatty acid amide hydrolase; FFA, fre e fatty acid; NADA, N acyldopamine

PAGE 34

10 mammalian N fatty acyl amino acids are conjugates of glycine, glutamine and taurine ( Table 1 4 ) Many of the N acylamino acids were discovered in the last 1 3 years, thanks to improvements in separation techniques and more sensitive mass spectrometry equipment. (See Chapter 2 for a dis cussion of these innovations and more details on metabolite analysis.) Like the shorter chain N acetyl and N isovaleroyl amino acids, th e major function of these longer chain amino acid conjugates appears to be in the detoxification and excretion of xenobi otic carboxylates 96 Glycine conjugation is particularly important in detoxification and elimination as a careful analysis of the metabolism of most xenobiotic carboxylate s reveals at least a trace of the corresponding N acylglycine conjugate 161 In fact, t he list of N acylglycines shown in Table 1 4 is incom plete as glycine conjugates of many other carboxylates also have been r e ported 159,161

PAGE 35

11 Table 1 4 : Mammalian N Fatty Acylamino Acids a Amino Acid b N Acyl Group Refs Alanine A rachidonoyl Oleoyl, Palmitoyl, Stearoyl 2,3 Aminobutyric acid A rachidonoyl Docosahexaenoyl, Oleoyl, Palmitoyl, Stearoyl 2,3 Arginine Stearoyl 3 Asparagine Oleoyl 3 Glutamic Acid Arachidonoyl, Docosahexaenoyl, Oleoyl, Palmitoyl, Stearoyl, Citryl P henylacetyl 3,91 93 Glutamine Arachidonoyl, Docosahexaenoyl, Oleoyl, Palmitoyl, Phenylacetyl and ot her a rylacetyls, 4 P henylbutyryl Stearoyl 3,91,93 Glycine c A rachidonoyl, B enzoyl, B utyryl, B ile acids, D ecanoyl, H exanoyl, I sobutyryl, 2 M ethylbutyryl, 3 M ethylcrotonyl, O ctanoyl, P henylacetyl and other arylacetyls, Palmitoyl, P ropionyl, S uberyl, T iglyl 2,74,93,96 101 Histidine Arachidonoyl, Docosahexaenoyl, Oleoyl, Palmitoyl 3 ( Iso ) leucine Arachidonoyl, Lact yl, Oleoyl, Palmitoyl 3,106 Leucine Lactyl 106 Methionine Oleoyl, Palmitoyl, Stearoyl 3 Phenylalanine Docosahexaenoyl, Oleoyl, Palmitoyl, Stearoyl, Succinoyl 3,112 Proline Oleoyl, Palmitoyl, Stearoyl 3 Pyroglutamic acid Phenylacetyl 98 Serine A rachidonoyl Palmitoyl, Stearoyl 3,120 Taurine Bile acids, P henylacetyl and other arylacetyls, long chain, saturaturated acyl groups from C16:0 C26:0 d l ong chain, monounsaturated acyl groups from C18:1 C24:1 d Linoleoyl 3,96,99,121 Threonine Oleoyl, Palmitoyl 3 Tryptophan Oleoyl, Palmitoyl, Stearoyl 3 Tyrosine Oleoyl, Palmitoyl, Stearoyl 3 Valine Lactyl Linoleoyl, Palmitoyl, Stearoyl 106 a N Acetyl and N isovaleroylamino acids were not included in this table. b Amino acids not commonly found in proteins are italicized. c Included here most of the more common N acylglycine conjugates known. Many others have been identified as metabolites in various organic acid acidemias or in the detoxification of a xenobiotic carboxylate. d Included in the family of long chain fatty acyl groups found N conjugated to taurine were odd numbered acyl chains including C21:0, C21:1, C23:0, C23:1, C25:0, and C25:1. N Tricosanoyltaurine was found to be one of the more abundant N acyltaurines in mous e brain 129

PAGE 36

12 Amino acid N fatty acyl conjugation may function primarily in excretion/detoxification; however, this chemistry does serve other roles in mammals Bile acid conju gation to glycine or taur ine increases bile acid solubili ty, renders the bile acids impermeable to cell membranes and is essential to proper liver function 162 In addition, citrylglutamate may have a role in spermatogenesis 92 and in the differentiation of lens epithelial cells into fiber cells 163 Most intriguing are the emerging roles of the long chain N fatty acylamino acids. Milman et al 120 isolated and characterized N arachidonoyl L serine from bovine brain and showed that thi s novel N fatty acylserine had vasodilatory properties The Merkler lab has proposed that the N fatty acylglycines are biosynthetic precursors to the PF AMs, being oxidatively cleaved to the corresponding PFAM and glyoxylate in a reaction catalyzed by peptidylglycine amidating monooxygenase (PAM) 164 Recent evidence suggests that the N fatty acylglycines may serve as more than simple PFAM pathway intermediates and may have independent functions as lipid messengers : N oleoylglycine regulates body temperature and locomotion 165 N arachidonoyltaurine activates TRPV1 and TRPV4 calcium channels of the kidney 72 N arachidonoylglycine is an endogenous ligand for the orphan GPR18 receptor, 73 and N palmitoylglycine inhibi ts nociception and induces transient calcium influx. 74 Similar to prostaglandins 166 and endocannabinoids, 22 the actions of fatty acyl glycines are likely to be mediated through G protein coupled receptors, as has been recently reported for N arachidonoyl glycine. 73 For a more thorough list of endogenous long chain mammalian signaling NAGs and their known function, see Chapter 4. N A rachidonoyl aminobutyric acid is analgesic 2 and N arachidonoylglycine is analgesic, and inhibits FAAH 167 and the GLYT2a glycine transporter 102 The function (s) served by N arachidonoylalani ne is currently not understood. Another set of N acyl amino acid conjugates that warrant some discussion are related to the conjugation of fatty acids to either the amino group of an N terminal glycine residue or to the amino group of internal lysine residue. The most common N terminal acyl group found in eukaryotes is myristic acid, but other fatty acids, including lauric, ( cis 5 ) tetradecaenoic ( physeteric ) ( cis cis 5 8 ) tetradecadienic and palmitic acid s have been identified as N terminal fat ty acids 113,168,169 Mammalian proteins decorated via an amide linkage

PAGE 37

13 between the amino group of an internal lysine and myristic acid 170 or palmitic acid 171 have been identified Proteolytic degradation of N terminal or acyl lysyl lipidated proteins could release the corresponding N acylglycine or N acyllysine, but there are no reports showing that such metabolites have been detected in mammals. One biosynthetic route to the N acylamino acids utilizes an acyl CoA thioester as the acyl group don or ( Table 1 5 ) Enzymes known to catalyze this reaction include N acetylglutamate synthase (a.k.a. amino acid N acetyltransferase) 68 bile acid coenzyme A:amino a cid N ac yltransferase (BAAT) 99 acyl CoA:glycine N acyltra nsferase (ACGNAT) 107 a peroxisomal acyl CoA:amino acid N acyltransferase (ACNAT1) 108 and acyl CoA: L glutamine N acyltransferase 111 T hese enzymatic reactions are summarized in Table 1 5 N Terminal acylation is catalyzed by N myristoyl transferase (NMT) an enzyme which strongly prefers myristoyl CoA as a substrate and only transfers the acyl group to the amino moiety of an N terminal glycine. Glycine and the amino moiety of other N terminal amino acids are not NMT subst rates 113 Evidence suggests that myristoyl Co A or palmitoyl CoA are also the acyl donors for the acylation of amino group of internal lysine residues 169 Table 1 5 : Formation of N Acylamino Acids Enzyme Product Ref + N + N Acetylglutamate synthase N Acetylglutamate 68 Bile acid coenzyme A:ami no acid N acyltransferase Bile acyl glycine and taurine 99 Acyl CoA:gl ycine N acyltransferase Short and brainched chain N acylglycines 107 Peroxisomal acyl CoA:amino acid N acyltransferase N Acyltaurines 108 Acyl CoA:L glutamine N acyltransferase N Acylglutamines 111 N Myristoyltransferase N Myristoylated proteins 113 Cytochrome C Long chain N acylamino acids 114 116 + 2 + N + 2 + 2 + Alcohol/aldehyde dehydrogenase Short and medium chain N acylglycines 1 10,117 119

PAGE 38

14 The data regarding the biosynthesis of the long chain N fa tty acylglycines is not clear. N conjugation of fatty acids to glycine via a fatty acyl CoA thioester is an attract ive possibility. The availabl e evidence strongly suggests that ACGNAT does not catalyze this reaction in vivo : l ong chain acyl CoA thioesters are not ACGNAT substrates 107 and ACGNAT is found primarily in the liver and kidney 107 while the PFAMs have been isolated from the brain 105 ACGNAT is not likely involved i n the biosynthesis of other N fatty acylamino acids as amino acids other than glycine are very poor ACGNAT substrates 172 Othe r possible candidates that might catalyze this reaction in vivo include BAAT, which will produce N fatty acylglycines at a low rate relative to the bile acid conjugates 173 or cyt o chrome c 115,174 The recent report that cytochrome c can catalyz e the formation of N oleoylglycine and N arachidonoyl glycine serine, alanine and aminobutyric acid from the corresponding CoA thioester in a reaction stimulated by H 2 O 2 is very intriguing 114 116,174 but the in vi tro significance is unclear There is also evidence for lcNAG formation vi a the NAD + dependent oxidation of the NAEs by the sequential actions of a fatty alcohol dehydrogenase (ADH) or an ADH followed by a fatty aldehyde dehydrogenase (AlDH) ( Table 1 5 bottom) Deuterium labeled N arachidonoylethanolamine (D 4 on the ethanolamine) incubated in RAW264.7 and C6 glioma cells is converted to D 2 labeled N arachidonoylglycine (see Chapter 4 for more in depth discussion) 110,117,175 The catabolic fates of the N acylamino acids are not well defined. FAAH will hydrolyze the N acyltaurines and N arac hidonoylglycine to the corresponding fatty acid and amino acid 2,133 but the other N acylamino acids are not degraded by FAAH 167 N palmitoylglycine is up regulated in FAAH knockout mice, 74 and increased levels of N oleoylglycine and N stearoylglycine were observed after injection with a FAAH inhibitor, 176 but N docosahexaenoylglycine and N linoleoylglycine were not increased under these conditions. The Merkler lab has shown that N acylglycines are biosynthetic precursors to the PFAMs usin g purified PAM 164 and in PAM expressing neuroblastoma N 1 8 TG 2 cells 177 Marnett and co workers have found that the N arachidonoylamino acids are substrates for lipoxygenase (LO ) and cyclooxygenase 2 (COX 2 ) in vitro 178,179 pointing either to a mechanism for the inactivation of the N arachidonoylamino acids or for the formation of other bioactive, oxidized amino acid conjugates. Some NAAs,

PAGE 39

15 including long chain NAGs, have also been shown to be substrates for cytochrome P450BM 3, a bacterial monooxygenase similar to eukaryotic P450s, resulting in 3 hydroxylated NAAs. 180,181 Much work is needed to better define the pathways of biosynthesis and degradation for the N acylamino acids. 1.4 Primary Fatty Acid Amides Arafat et al 104 first isolated and characterized five PFAMs (palmitamide, palmitoleamide, oleamide, elaidamide and linoleamide) from luteal phase plasma in 1989. Because the function of the PFAMs was initially unknown, int erest in these molecules was modest until Cravatt et al 105 isolated oleamide and erucamide from the cerebrospinal fluid (CSF) of cat, rat and human and further demonstrated that the intraperitoneal injection of nanomole quantities of oleamide induced physiological sleep in rats Research concerning oleamide has progressed rapidly since this first report and, in addition to its role in regulating the sleep/wake cycle, this PFAM has been shown to block gap junction communication in glial cells and between dendritic and T cells t o regulate memory processes, to decrease body tem perature and locomotor activity to stimulate Ca 2+ release to modulate depre ssant drug receptors in the CNS and to allosterically activate the GABA A receptor s and specific serotonin receptor subtypes ( see refs. 87,182,183 and Chapter 3 for reviews ) T he mode of action of the hypothermic response may be by modulation of the 5 HT receptors since they modulate thermoregulation in the hypothalamus and GABA A receptors, which also regulate thermal control in the hypothalamus GABA A knockout mice are no longer induced to sleep but retain hypothermia after oleamide injection. 85 Thus, oleamide produces these activities through separate systems. Like oleamide, other members of the PFAM are bioactive: linoleamide increases Ca 2+ flux 184 and inhibits the erg (ether go go related gene) current in pituitary cells 185 erucamide stimulates an giogenesis 186 and regulates fluid imbalance 187 and elaidamide may function as an endogenous inhibitor of epoxide hydrolase 188 For a more thorough and detailed description of the functions of endogenous PFAMs, see Chapter 3.

PAGE 40

16 The PFAMs are degrade d by fatty acid amide hydrolase being hydrolyzed to the fatty acid and ammonia ( Equation 1 2 ) 8,167 One of the key unanswered questions regarding the PFAMs is how these novel brain lipid amides are p roduced in the body A number of reactions have been proposed to account for PFAM production. Sugiura et al 189 found that FAAH catalyzed the in vitro production of oleamide from oleic acid and NH 3 ( Equation 1 2 backwards) This reaction is unlikely to occur in vivo because the K M for ammonia was high ( 65 mM ) and the pH optimum for oleamide synthesis was > 9 Mouse neuroblastoma N 18 TG 2 cells secrete [1 14 C] oleamide when cultured in the presence of [1 14 C] oleic acid 177,190 T hus, these cells must contain the enzymatic machinery required for oleamide biosynthesis. Oleamide production in the N 18 TG 2 cells increases upon the inhibition of FAAH providing further evidence against a role for this enzyme in PFAM production in vivo Bisogno et al 190 proposed that PFAMs were pro d uced by phospholipid aminolysis However, incubation of [ 14 C] oleic acid containing phospholipids with NH 4 OH in the presence of N 18 TG 2 cell homogenates did not result in the formation of [ 14 C] oleamide. Equation 1 2 : Hydrolysis of a PFAM by FAAH

PAGE 41

17 Currently, there are two proposed pathways for the biosynthesis of the long chain PFAMs that h ave some experimental support ( Figure 1 4 ) One is the direct amidation of fatty acyl CoA thioesters by ammonia as catalyzed by cytochrome c 191,192 The PFAM synthesizing activity of cy t c yields a number of PFAMs, exhibits Michealis Menton kinetics with a K M value for oleoyl CoA of 21 M and a pH optimum of 7.5, and is stimulated by H 2 O 2 The optimal concentrations for H 2 O 2 (2 mM) and NH 3 (125 mM) aggregated to provide the necessary ingredients for oleamide synthesis 192 (see Chapter 4 for more details). A second proposed pathway for PFAM biosynthesis involves the PAM mediated cleavage of N fatty acylglycines 165,178 The Merkler laboratory has shown that PAM is expressed in the oleamide synthesizing N 18 TG 2 cells and further demonstrated that pharmacological inhibition of PAM in N 18 TG 2 cells results in the accumulation of N oleoylglycine 177,193 A melding of the two proposed pathways could also lead to PFAMs: Figure 1 4 : Proposed PFAM Biosynthetic Reactions Synthesis of primary fatty acid amides through the actions of cytochrome c and PAM. ASC, ascorbate; SDA, semidehydroascorbic acid

PAGE 42

18 first the cytochrome c mediated production of the N fatty acylgl ycine ( Figure 1 4 cyt c reaction with glycine instead of ammonia) followed by PAM oxidation to the corresponding PFAM. As discussed by Mueller and Driscoll 174 there may be more than one pathway for the i n vivo production of the PFAMs, consistent with the fact that there are a number of pathways known for the in vivo production of the NAEs ( Figure 1 1 ) These are the m ost likely routes for PFAM biosynthesis, but a more detailed analysis can be found in Chapter 4. Outlined below in Figure 1 5 are potential pathways for the biosynthesis of the PFAMs that metabolically link together the PFAMs to the N fa tty acylglycines and the NAEs. The potential conversion of one class of fatty acid amide to another only adds another fascinating dimension to t his family of bioactive compounds.

PAGE 43

19 1.5 Pharmacological Importance of the Fatty Acid Amides Because of the broad functions exhibited by the various members of the fatty acid amide family, a wide range of indications could benefit from a fatty acid amide targeted Figure 1 5 : Proposed Biosynthetic and Degradative Pathways for PFAMs, NAGs, and NAEs The enzymes catalyzing the individual reactions are in the boxes and the fatty acyl group is R PFAM and NAG biosynthesis. ACGNAT, acyl CoA:glycine N acyltransferase; ACS, acyl CoA synthetase; ADH, alcohol dehydrog enase; AlDH, aldehyde dehydrogenase; ASC, ascorbic acid; BAAT, bile acid:amino acid transferase; Cyt c, cytochrome c; CYP45F, cytochrome P450BM3; FAAH, fatty acid amide hydrolase; NAE, N acylethanolamine; NAG, N amidatin g monooxygenase; PFAM, primary fatty acid amide; SDA, semidehydroascorbic acid.

PAGE 44

20 drug, including cancer, cardiovascular disease, inflammation, pain, drug addi c tion, e ating disorders, anxiety, ganglial motor disorders, and depression (see refs. 6,24,62,194,195 for recent reviews). Potential drug targets include the enzymes involved in fatty acid amide biosynthesis and degradation 196,197 transporters responsible for m o ving the fatty acid amides across the cell membranes 195 a nd analogs of the fatty acid amides themselves as agonists or antagonists for their respective receptors ( Table 1 6 ) 6,24,198 Although the role of oleamide as an endocannabinoid is a topic of debate, 88 the vasodilatory actions of oleamide were attenuated in the presence of certain cannabinoid and TRPV1 receptor antagonists, 199 indicating that oleamide induced vasorelaxation is mediated, in part, by CB1 and non CB1 cann a binoid receptors as well as TRPV1 receptors. Endocannabinoids such as anandamide and 2 arachidonoyl glycerol (2 AG) are released in response to pathogenic even ts and activate cannabinoid receptors that in turn activate signaling pathways linked to neuronal repair and maintenance as well as neuroprotective responses. 24 Indeed, the endocannabinoid system is currently being investigated as potential targets in treating inflammatory neurodegenerative diseases, 14,18,20 14 17,20 multiple sclerosis 20 and amyotrophic lateral sc lerosis. 20

PAGE 45

21 Table 1 6 : Receptors Identified for the Mammalian Bioactive Fatty Acid Amides a A. N Acylethanolamines NAE Receptors(s) Reference Anandamide CB 1 CB 2 PPAR PPAR TRPV1, and TRPM8 4 8 N Dihomo linolenoylethanolamine CB 1 and CB 2 9 5Z,8Z,11Z Eicosatrienoylethanolamine CB 1 and CB 2 9 N Oleoylethanolamine PPAR PPAR TRPV1, and GPR119 5,8,46 N Palmitoylethanolamine PPAR GPR55 5,54 N Linolenoylethanolamine TRPV1 {Movahed, 2005 #29} 8 N Linoleoylethanolamine TRPV1 8 B. N Acyldopamines NDA Receptors(s) Reference N Arachidonoyldopamine CB 1 TRPV1, and non CB 1 /CB 2 GPCR 1,63,64 N Oleoyldopamine PPAR PPAR and TRPV1 1,63 C. N Acylamino acids b,c NAA Receptors(s) Reference N Arachidonoyltaurine TRPV1 and TRPV4 72 N Arachidonoylglycine c GPR18 GPR92 73 75 D. Primary Fatty Aid Amides PFAM Receptors(s) Reference Oleamide GABA A 5 HT 1A 5 HT 2A 5 HT 2C and 5 HT 7 CB 1 d 76 89 a In some cases, the indicated fatty acid amide has not been demonstrated to bind to the listed target by direct binding, but instead has been shown to be an agonist or antagonist to the target using a reporter assay. Details are in the citations listed. b While N acetylglutamate is not formally a fatty acid amide, this N acylamino acid binds a protein target as it is an allosteric activator of carbamoylphosphate synthetase I. c Fatty acid conjugation to amino acids serves largely in the detoxification and excretion of xenobiotic carboxylates. Thus, many of the N acylamino acids are likely to bind to a membrane bound transporter. For example, Wiles et al 102 have recently shown that N arachidonoylglycine inhibits the GLYT2a glycine transporter. d T he role of oleamide as an endocannabinoid is under debate, as the amount necessary for CB 1 binding is high. Oleamide is known to inhibit antagonist and agonist binding to these receptors, however. 88

PAGE 46

22 Inhibiting th e de activation of endocannabinoids by FAAH, monoacylglycerol lipase (MGL) and the anandamide transport system have been the subject of studies designed to enhance endogenous repair signaling (see ref 12,19 for recent review s ). FAAH inhibition might serve as a therapeutic strategy for treatment of pain, inflammation, spasticity, some types of cancer, and cardiovascular and psychiatric diseases, 19 and the most widely used FAAH inhibitor, URB597, is demonstrated to function without toxicity in preclinical safety studies in rats and monk e y s. 200 It has been suggested that unlike receptor agonists, which activate receptors everywhere at approximately the same time and might cause opposing effects on the progress or symptoms of certain disorde rs, selective FAAH (and MGL) inhibitors prolong the thereby exhibiting higher therapeutic efficacy with less unwanted effects. 12 It is also pointed out, however, than non endocannabinoid FAAH substrates would simila rly have prolonged activity, which may or may not produce the desired effect. Anandamide and 2 AG have been shown to inhibit cancer cell proliferation by acting at CB receptors, as these receptors mediate cell proliferation. 201 FAAH inhibitors are therefore potentially useful as anticancer agents as well As discussed in earlier sections, some FAAH substrates such as oleamide, palmitoleamide, N palmitoleoylethanolamine, and N oleoylethanolamine are thought to increase the action of other endocannabinoids (i.e. anandamide) by the entourage effect. 125 Because the role of MGL as a 2 AG hydroly zing enzyme was only recently established, the therapeutic significance of this enzyme remains to be clarified, and specific inhibitors remain to be designed. 19 As detailed by Felder et al 195 the potential existence of specific transporters for anandamide and the other fatty acid amides is controversial, but accumulating evidence suggests that the simpl e passive diffusion of the these hydrophobic compounds across the membrane driven by FAAH hydrolysis is insufficient to account for published anandamide uptake data. The inhibition of PFAM producing PAM is shown to have anti inflammatory effects to prevent edema and during the three phases of adjuvant induced polyarthritis in rats. 202 The mechanism is thought to act by way of reducing endogenous levels of substance P and calcitonin gene related

PAGE 47

23 peptide, although several endogenous PFAMs have rec ently been shown to influence inflammation as well (see Chapter 3). Recent evidence has indicated that cannabinoid receptor antagonists can reduce the self administration of several commonly addictive drugs The mechanism of this is currently unknown but p roposed to be based on such antagonists blocking the effects of endocannabinoids. 203 The recruitment of such cannabinoid antagonists during increased dopamine neur al activity has been shown to ameliorate cravings of several addictive drugs, including marijuana, 204 opiates, 28,205 alcohol, 206,207 and tobacco 26,208 In addition to reports of PFAMs binding to well known receptor systems such as serotonin and GABA receptors ( Table 1 6 ) some of the first reports of oleamide function were in the inhibition of gap junction communication. 209 212 Although this ability of oleamide to interfer e with intercellular communication via gap junctions has been demonstrated in a variety of cell systems, 210,213 222 it is unknown whether the PF AM acts as an allosteric effector of the gap junction proteins or via specific oleamide/PFAM receptors. Regardless, this modulation of gap junction communication has important implications in cell death. Normal gap junction communication is essential for e lectrical and chemical syncytium and provides for the delivery of nutrients and growth factors, and for removal of excess metabolites and toxins 223 226 Inhibition of this communication by oleamide may preserve cells during apoptotic waves such as occurs during ischemia and stroke, 227 229 and myocardial infarction. 230 In primary hippocampal cultures, olea mide was shown to reduce the spread of apoptosis in response to metabolic depression, 231 and in cerebellar granule cells it a cted similarly during K + depravation. 232 The number of diseases (and thus pharmacological targets) associated with acyl amides and thei r receptors is large. Some of these disorders are outlined in Table 1 7 The fatty acid amides represent an exciting opportunity for the development o f new drugs for the treatment of disease. T he potential for fatty acid amide targeted therapeutic s is high.

PAGE 48

24 1.6 Conclusion Fatty acid amides are a large family of structurally diverse molecules found in humans and other or ganisms. Because many of these molecules have been shown to be bioactive, particularly in cell signaling, analogs of the fatty acid amides could prove useful as agonists or antagonists for their respective receptors and a better understanding of how they are synth esized and metabolized will lead to better treatments T he enzymes involved in the biosynthes is and degradation of the various fatty acid amides many of which are still poorly defined, provide an exciting opportunity for the de velopment of new drugs to tr eat sleep disorders, anxiety, depression, cardiovascular disease, and neurodegenerative diseases. Table 1 7 : Disorders Associated with Amide Binding Receptors Receptor Category Pain Cardiovascular Disease Eating Disorder / Obesity Inflammation Addiction Motor Diseases Anxiety Sleep Disorder D epression / Bipolar Disorder Cognition/ Memory Refs CB 11 31 PPAR 15,33 42 TRP V 13,15,43 45 GABA 47 53 5 HT a b 16,55 60 5 HT, 5 aminobutyric acid receptor; PPAR, peroxisome proliferator activated receptor; TRPV, transient receptor potential vanilloid type. a There is a possible connection between serotonin and valvular heart disease. 69 b Trial data has been inconsistent regarding 5 70

PAGE 49

25 1.7 References (1) Huang, S. M.; Bisogno, T.; Trevisani, M.; Al Hayani, A.; De Petrocellis, L.; Fezza, F.; Tognetto, M.; Petros, T. J.; Krey, J. F.; Chu, C. J.; Miller, J. D.; Davies, S. N.; Geppetti, P.; Walker, J. M.; Di Marzo, V. Proc Natl Acad Sci U S A 2002 99 8400. (2) Huang, S. M.; Bisogno, T.; Petros, T. J.; Chang, S. Y.; Zavitsanos, P. A.; Zipkin, R. E.; Sivakumar, R.; Coop, A.; Maeda, D. Y.; De Petrocellis, L.; Burstein, S.; Di Marzo, V.; Walker, J. M. J Biol Chem 2001 276 42639. (3) Tan, B.; O'Dell, D. K.; Yu, Y. W.; Monn, M. F.; Hughes, H. V.; Burstein, S.; Walker, J. M. J Lipid Res 2010 51 112. (4) Palmer, S. L.; Thakur, G. A.; Makriyannis, A. Chem Phys Lipids 2002 121 3. (5) O'Sullivan, S. E. Br J Pharmacol 2007 152 576. (6) Starowicz, K.; Nigam, S.; D i Marzo, V. Pharmacol Ther 2007 114 13. (7) De Petrocellis, L.; Starowicz, K.; Moriello, A. S.; Vivese, M.; Orlando, P.; Di Marzo, V. Exp Cell Res 2007 313 1911. (8) Movahed, P.; Jonsson, B. A.; Birnir, B.; Wingstrand, J. A.; Jorgensen, T. D.; Ermund A.; Sterner, O.; Zygmunt, P. M.; Hogestatt, E. D. J Biol Chem 2005 280 38496. (9) Felder, C. C.; Joyce, K. E.; Briley, E. M.; Mansouri, J.; Mackie, K.; Blond, O.; Lai, Y.; Ma, A. L.; Mitchell, R. L. Mol Pharmacol 1995 48 443. (10) Simon, G. M.; Cra vatt, B. F. J Biol Chem 2006 281 26465. (11) Ligresti, A.; Petrosino, S.; Di Marzo, V. Curr Opin Chem Biol 2009 13 321. (12) Petrosino, S.; Ligresti, A.; Di Marzo, V. Curr Opin Chem Biol 2009 13 309. (13) Pazos, M. R.; Sagredo, O.; Fernandez Ruiz, J. Curr Pharm Des 2008 14 2317. (14) Fernandez Ruiz, J. Br J Pharmacol 2009 156 1029. (15) Borrelli, F.; Izzo, A. A. Best Pract Res Clin Endocrinol Metab 2009 23 33. (16) Balfour, D. J. Handb Exp Pharmacol 2009 209. (17) Koppel, J.; Davies, P. J Alzheimers Dis 2008 15 495. (18) Di Filippo, M.; Picconi, B.; Tozzi, A.; Ghiglieri, V.; Rossi, A.; Calabresi, P. Curr Pharm Des 2008 14 2337. (19) Saario, S. M.; Laitinen, J. T. Basic Clin Pharmacol Toxicol 2007 101 287. (20) Centonze, D.; Finazzi Agro, A.; Bernardi, G.; Maccarrone, M. Trends Pharmacol Sci 2007 28 180. (21) Mulder, A. M.; Cravatt, B. F. Biochemistry 2006 45 11267. (22) Mackie, K. Annu Rev Pharmacol Toxicol 2006 46 101. (2 3) Bradshaw, H. B.; Rimmerman, N.; Krey, J. F.; Walker, J. M. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006 291 R349. (24) Bahr, B. A.; Karanian, D. A.; Makanji, S. S.; Makriyannis, A. Expert Opin Investig Drugs 2006 15 351. (25) Witkin, J. M.; Tzavara, E. T.; Nomikos, G. G. Behav Pharmacol 2005 16 315. (26) Le Foll, B.; Goldberg, S. R. J Pharmacol Exp Ther 2005 312 875. (27) Lange, J. H.; Kruse, C. G. Drug Discov Today 2005 10 693. (28) De Vries, T. J.; Homberg, J. R.; Bi nnekade, R.; Raaso, H.; Schoffelmeer, A. N. Psychopharmacology (Berl) 2003 168 164.

PAGE 50

26 (29) Marsicano, G.; Wotjak, C. T.; Azad, S. C.; Bisogno, T.; Rammes, G.; Cascio, M. G.; Hermann, H.; Tang, J.; Hofmann, C.; Zieglgansberger, W.; Di Marzo, V.; Lutz, B. N ature 2002 418 530. (30) Walker, J. M.; Huang, S. M.; Strangman, N. M.; Tsou, K.; Sanudo Pena, M. C. Proc Natl Acad Sci U S A 1999 96 12198. (31) Murillo Rodriguez, E. Prog Neuropsychopharmacol Biol Psychiatry 2008 32 1420. (32) Borovansky, J.; Ed ge, R.; Land, E. J.; Navaratnam, S.; Pavel, S.; Ramsden, C. A.; Riley, P. A.; Smit, N. P. Pigment Cell Res 2006 19 170. (33) Schteingart, D. E. Expert Opin Emerg Drugs 2009 14 661. (34) Cheatham, W. W. Am J Clin Nutr 2010 91 262S. (35) Higgins, L. S.; Depaoli, A. M. Am J Clin Nutr 2010 91 267S. (36) Kovacs, T. Neuropsychopharmacol Hung 2009 11 27. (37) Belvisi, M. G.; Mitchell, J. A. Br J Pharmacol 2009 158 994. (38) Giaginis, C.; Giagini, A.; Theocharis, S. Pharmacol Res 2009 60 160. (39) Maeda, T.; Kishioka, S. Int Rev Neurobiol 2009 85 165. (40) Li, S.; Lin, J. D. J Appl Physiol 2009 107 1959. (41) Martin, H. Mutat Res 2009 669 1. (42) Fruchart, J. C. Atherosclerosis 2009 205 1. (43) Wang, D. H. Curr Opin Cardiol 2008 23 356. (44) Pal, M.; Angaru, S.; Kodimuthali, A.; Dhingra, N. Curr Pharm Des 2009 15 1008. (45) Salazar, H.; Jara Oseguera, A.; Rosenbaum, T. Rev Neurol 2009 48 357. (46) Overton, H. A.; Babbs, A. J.; Doel, S. M.; Fyfe, M. C.; Gardner, L. S.; Griffin, G.; Jackson, H. C.; Procter, M. J.; Rasamison, C. M.; Tang Christensen, M.; Widdowson, P. S.; Williams, G. M.; Reynet, C. Cell Metab 2006 3 167. (47) D'Hulst, C.; Atack, J. R.; Kooy, R. F. Drug Discov Today 2009 14 866. (48) Charych, E. I.; Liu, F.; Moss, S. J.; Brandon, N. J. Neuropharmacology 2009 57 481. (49) Boeckxstaens, G. E. Expert Opin Emerg Drugs 2009 14 481. (50) Sullivan, S. S.; Guilleminault, C. Expert O pin Emerg Drugs 2009 14 411. (51) Munro, G.; Ahring, P. K.; Mirza, N. R. Trends Pharmacol Sci 2009 30 453. (52) Maccioni, P.; Colombo, G. Alcohol 2009 43 555. (53) Maccioni, P.; Carai, M. A.; Kaupmann, K.; Guery, S.; Froestl, W.; Leite Morris, K. A.; Gessa, G. L.; Colombo, G. Alcohol Clin Exp Res 2009 33 1749. (54) Ryberg, E.; Larsson, N.; Sjogren, S.; Hjorth, S.; Hermansson, N. O.; Leonova, J.; Elebring, T.; Nilsson, K.; Drmota, T.; Greasley, P. J. Br J Pharmacol 2007 152 1092. (55) Hedlund, P. B. Psychopharmacology (Berl) 2009 206 345. (56) Abbas, A. I.; Hedlund, P. B.; Huang, X. P.; Tran, T. B.; Meltzer, H. Y.; Roth, B. L. Psychopharmacology (Berl) 2009 205 119. (57) Landolt, H. P.; Wehrle, R. Eur J Neurosci 2009 29 1795. (58) Savitz, J.; Lucki, I.; Drevets, W. C. Prog Neurobiol 2009 88 17. (59) Marston, O. J.; Heisler, L. K. Neuropsychopharmacology 2009 34 252. (60) Sanger, G. J. Trends Pharmacol Sci 2008 29 465. (61) Mechoulam, R.; Fride, E.; Di Marzo, V. Eur J Pharma col 1998 359 1.

PAGE 51

27 (62) Di Marzo, V.; Bisogno, T.; De Petrocellis, L. Chem Biol 2007 14 741. (63) Chu, C. J.; Huang, S. M.; De Petrocellis, L.; Bisogno, T.; Ewing, S. A.; Miller, J. D.; Zipkin, R. E.; Daddario, N.; Appendino, G.; Di Marzo, V.; Walker, J M. J Biol Chem 2003 278 13633. (64) O'Sullivan, S. E.; Kendall, D. A.; Randall, M. D. Eur J Pharmacol 2005 507 211. (65) Thudichum, J. L. W. Chemical Constitution of the Brain ; Archon Books, 1962. (66) Herrlich, P.; Sekeris, C. E. Hoppe Seylers Z Physiol Chem 1964 339 249. (67) Liu, J.; Wang, L.; Harvey White, J.; Huang, B. X.; Kim, H. Y.; Luquet, S.; Palmiter, R. D.; Krystal, G.; Rai, R.; Mahadevan, A.; Razdan, R. K.; Kunos, G. Neuropharmacology 2008 54 1. (68) Caldovic, L.; Lopez, G. Y.; Haskins, N.; Panglao, M.; Shi, D.; Morizono, H.; Tuchman, M. Mol Genet Metab 2006 87 226. (69) Rothman, R. B.; Baumann, M. H. Expert Opin Drug Saf 2009 8 317. (70) Poewe, W. Neurology 2009 72 S65. (71) Levene, P. A. J. Biol. Chem. 1916 24 69. (72) Saghatelian, A.; McKinney, M. K.; Bandell, M.; Patapoutian, A.; Cravatt, B. F. Biochemistry 2006 45 9007. (73) Kohno, M.; Hasegawa, H.; Inoue, A.; Muraoka, M.; Miyazaki, T.; Oka, K.; Yasukawa, M. Biochem Biophys Res Commu n 2006 347 827. (74) Rimmerman, N., Bradshaw, HB, Hughes, HV, Chen, JS, Hu, SS, McHugh, D, Vefring, E, Jahnsen, JA, Thompson, EL, Masuda, K, Cravatt, BF, Burstein, S, Vasko, MR, Prieto, AL, O'Dell, DK, Walker, JM. Molecular Pharmacology 2008 74 213. (75) Bradshaw, H. B.; Lee, S. H.; McHugh, D. Prostaglandins Other Lipid Mediat 2009 89 131. (76) Verdon, B.; Zheng, J.; Nicholson, R. A.; Ganelli, C. R.; Lees, G. Br J Pharmacol 2000 129 283. (77) Huidobro Toro, J. P.; Harris, R. A. Proc Natl Acad Sc i U S A 1996 93 8078. (78) Thomas, E. A.; Carson, M. J.; Neal, M. J.; Sutcliffe, J. G. Proc Natl Acad Sci U S A 1997 94 14115. (79) Boger, D. L.; Henriksen, S. J.; Cravatt, B. F. Curr Pharm Des 1998 4 303. (80) Hedlund, P. B.; Carson, M. J.; Sutcliffe, J. G.; Thomas, E. A. Biochem Pharmacol 1999 58 1807. (81) Alberts, G. L.; Chio, C. L.; Im, W. B. Mol Pharmacol 2001 60 1349. (82) Lees, G.; Edwards, M. D.; Hassoni, A. A.; Ganellin, C. R.; Galanakis, D. Br J Pharmacol 1998 124 873. (83) Fedorova, I.; Hashimoto, A.; Fecik, R. A.; Hedrick, M. P.; Hanus, L. O.; Boger, D. L.; Rice, K. C.; Basile, A. S. J Pharmacol Exp Ther 2001 299 332. (84) Yost, C. S.; Hampson, A. J.; Leonoudakis, D.; Koblin, D. D.; Bornhe im, L. M.; Gray, A. T. Anesth. Analg. 1998 86 1294. (85) Laposky, A. D.; Homanics, G. E.; Basile, A.; Mendelson, W. B. Neuroreport 2001 12 4143. (86) Coyne, L.; Lees, G.; Nicholson, R. A.; Zheng, J.; Neufield, K. D. Br J Pharmacol 2002 135 1977. ( 87) Hiley, C. R.; Hoi, P. M. Cardiovasc Drug Rev 2007 25 46.

PAGE 52

28 (88) Fowler, C. J. Br J Pharmacol 2004 141 195. (89) Cheer, J. F.; Cadogan, A. K.; Marsden, C. A.; Fone, K. C.; Kendall, D. A. Neuropharmacology 1999 38 533. (90) Kuehl, K. A., Jr. et al. J. Amer. Chem Soc. 1957 79 5577. (91) Comte, B.; Kasumov, T.; Pierce, B. A.; Puchowicz, M. A.; Scott, M. E.; Dahms, W.; Kerr, D.; Nissim, I.; Brunengraber, H. J Mass Spectrom 2002 37 581. (92) Miyake, M.; Kume, S.; Kakimoto, Y. Biochim Biophys Acta 1982 719 495. (93) Divry, P.; Vianey Liaud, C.; Cotte, J. Biomed Environ Mass Spectrom 1987 14 663. (94) Devane, W. A.; Hanus, L.; Breuer, A.; Pertwee, R. G.; Stevenson, L. A.; Griffin, G.; Gibson, D.; Mandelbaum, A.; Etinger, A.; Mechoulam, R. Science 1992 258 1946. (95) Koga, D.; Santa, T.; Fukushima, T.; Homma, H.; Imai, K. J Chromatogr B Biomed Sci Appl 1997 690 7. (96) Caldwell, J. e. a. In Extrahepatic Metabolism of Drugs and Other Compounds ; Gram, T. E., Ed.; Spectrum Publications: 1980, p 453. (97) Gregersen, N.; Kolvraa, S.; Rasmussen, K.; Mortensen, P. B.; Divry, P.; David, M.; Hobolth, N. Clin Chim Acta 1983 132 181. (98) Liebich, H. M.; Forst, C. J Chromatogr 1990 525 1. (99) Falany, C. N.; Johnson, M. R.; Barnes, S.; Diasio, R. B. J Biol Chem 1994 269 19375. (100) Ito, T.; Kidouchi, K.; Sugiyama, N.; Kajita, M.; Chiba, T.; Niwa, T.; Wada, Y. J Chromatogr B Biomed Appl 1995 670 317. (101) Lin, H. M.; Edmunds, S. I.; Helsby, N. A.; Ferguson, L. R.; Rowan, D. D. J Proteome Res 2009 8 2045. (102) Wiles, A. L.; Pearlman, R. J.; Rosvall, M.; Aubrey, K. R.; Vandenberg, R. J. J Neurochem 2006 99 781. (103) Walker, J. M.; Krey, J. F.; Chen, J. S.; Vefring, E.; Jahnsen, J. A.; Bradshaw, H.; Huang, S. M. Prostaglandins Other Lipid Mediat 2005 77 35. (104) Arafat, E. S.; Trimble, J. W.; Andersen, R. N.; Dass, C.; Desiderio, D. M. Life Sci 1989 45 1679. (10 5) Cravatt, B. F.; Prospero Garcia, O.; Siuzdak, G.; Gilula, N. B.; Henriksen, S. J.; Boger, D. L.; Lerner, R. A. Science 1995 268 1506. (106) Hagenfeldt, L.; Naglo, A. S. Clin Chim Acta 1987 169 77. (107) Kelley, M.; Vessey, D. A. J Biochem Toxicol 1994 9 153. (108) Reilly, S. J.; O'Shea, E. M.; Andersson, U.; O'Byrne, J.; Alexson, S. E.; Hunt, M. C. FASEB J 2007 21 99. (109) Huang, J. K.; Jan, C. R. Life Sci 2001 68 997. (110) Ivkovic, M.; Lowe, E. W.; Merkler, D. J. in press 2010 (111) W ebster, L. T.; Siddiqui, U. A.; Lucas, S. V.; Strong, J. M.; Mieyal, J. J. J Biol Chem 1976 251 3352. (112) Grupe, A.; Spiteller, G. J Chromatogr 1981 226 301. (113) Rajala, R. V.; Datla, R. S.; Moyana, T. N.; Kakkar, R.; Carlsen, S. A.; Sharma, R. K. Mol Cell Biochem 2000 204 135. (114) McCue, J. M.; Driscoll, W. J.; Mueller, G. P. Prostaglandins Other Lipid Mediat 2009 90 42.

PAGE 53

29 (115) McCue, J. M.; Driscoll, W. J. ; Mueller, G. P. Biochem Biophys Res Commun 2008 365 322. (116) Mueller, G. P.; Driscoll, W. J. Journal of Biological Chemistry 2007 282 22364. (117) Aneetha, H.; O'Dell, D. K.; Tan, B.; Walker, J. M.; Hurley, T. D. Bioorg Med Chem Lett 2009 19 237 (118) Estey, T.; Piatigorsky, J.; Lassen, N.; Vasiliou, V. Exp Eye Res 2007 84 3. (119) Yin, S. J.; Chou, C. F.; Lai, C. L.; Lee, S. L.; Han, C. L. Chem Biol Interact 2003 143 144 219. (120) Milman, G.; Maor, Y.; Abu Lafi, S.; Horowitz, M.; Gallil y, R.; Batkai, S.; Mo, F. M.; Offertaler, L.; Pacher, P.; Kunos, G.; Mechoulam, R. Proc Natl Acad Sci U S A 2006 103 2428. (121) Saghatelian, A.; Trauger, S. A.; Want, E. J.; Hawkins, E. G.; Siuzdak, G.; Cravatt, B. F. Biochemistry 2004 43 14332. (122) Williams, C. M. a. K., T.C. Psychopharmacology 1999 143 315. (123) Cravatt, B. F.; Demarest, K.; Patricelli, M. P.; Bracey, M. H.; Giang, D. K.; Martin, B. R.; Lichtman, A. H. Proc Natl Acad Sci U S A 2001 98 9371. (124) Kathura, S. e. a. Nat. Med 2003 9 76. (125) Lambert, D. M.; Di Marzo, V. Curr Med Chem 1999 6 757. (126) Fu, J.; Gaetani, S.; Oveisi, F.; Lo Verme, J.; Serrano, A.; Rodriguez De Fonseca, F.; Rosengarth, A.; Luecke, H.; Di Giacomo, B.; Tarzia, G.; Piomelli, D. Nature 2003 425 90. (127) Maccarrone, M.; Cartoni, A.; Parolaro, D.; Margonelli, A.; Massi, P.; Bari, M.; Battista, N.; Finazzi Agro, A. Mol Cell Neurosci 2002 21 126. (128) LoVerme, J. e. a. Mol. Pharm 2005 67 15. (129) Strandholm, J. J.; Buist, N. R.; Kennaw ay, N. G.; Curtis, H. T. Biochim Biophys Acta 1971 244 214. (130) Schmid, H. H.; Berdyshev, E. V. Prostaglandins Leukot Essent Fatty Acids 2002 66 363. (131) Sugiura, T.; Kondo, S.; Sukagawa, A.; Tonegawa, T.; Nakane, S.; Yamashita, A.; Ishima, Y.; W aku, K. Eur J Biochem 1996 240 53. (132) Bachur, N. R.; Udenfriend, S. J Biol Chem 1966 241 1308. (133) Wei, B. Q.; Mikkelsen, T. S.; McKinney, M. K.; Lander, E. S.; Cravatt, B. F. J Biol Chem 2006 281 36569. (134) Tsuboi, K.; Takezaki, N.; Ueda, N. Chem Biodivers 2007 4 1914. (135) Maccarrone, M. Curr Pharm Des 2006 12 759. (136) Sit, S. Y.; Conway, C.; Bertekap, R.; Xie, K.; Bourin, C.; Burris, K.; Deng, H. Bioorg Med Chem Lett 2007 17 3287. (137) Wallace, V. C.; Segerdahl, A. R.; Lambert, D. M.; Vandevoorde, S.; Blackbeard, J.; Pheby, T.; Hasnie, F.; Rice, A. S. Br J Pharmacol 2007 151 1117. (138) Bisogno, T.; Melck, D.; Bobrov, M.; Gretskaya, N. M.; Bezuglov, V. V.; De Petrocellis, L.; Di Marzo V. Biochem J 2000 351 Pt 3 817. (139) De Petrocellis, L.; Chu, C. J.; Moriello, A. S.; Kellner, J. C.; Walker, J. M.; Di Marzo, V. Br J Pharmacol 2004 143 251. (140) Smith, G. R. e. a. J. Biol. Chem. 1992 267 5599. (141) Goldstein, M.; Musacchio J. M. Biochim Biophys Acta 1962 58 607. (142) Tyce, G. M. Biochem Pharmacol 1971 20 3447.

PAGE 54

30 (143) Akimov, M. G.; Gretskaia, N. M.; Shevchenko, K. V.; Shevchenko, V. P.; Miasoedov, N. F.; Bobrov, M.; Bezuglov, V. V. Bioorg Khim 2007 33 648. (144) G oldstein, F. B. Biochim Biophys Acta 1963 71 204. (145) Wadman, S. K.; De Bree, P. K.; Van der Heiden, C.; Van Sprang, F. J. Clin Chim Acta 1971 31 215. (146) Auditore, J. V.; Wade, L. H. Neuropharmacology 1972 11 385. (147) Seiler, N.; Al Therib, M. J. Biochem J 1974 144 29. (148) Heiden, C. V. D. e. a. J. Inher. Metab. Dis. 1978 1 89. (149) Lehnert, W.; Werle, E. Clin Chim Acta 1988 172 123. (150) Sugahara, K.; Zhang, J.; Kodama, H. J Chromatogr B Biomed Appl 1994 657 15. (151) Hiramatsu, M. Mol. Cell. Biochem 2003 244 57. (152) Loots, D. T.; Erasmus, E.; Mienie, L. J. Clin Chem 2005 51 1510. (153) Gerlo, E.; Van Coster, R.; Lissens, W.; Winckelmans, G.; De Meirleir, L.; Wevers, R. Anal Chim Acta 2006 571 191. (154) Lehnert, W. Clin Chim Acta 1981 116 249. (155) Lehnert, W. Clin Chim Acta 1983 134 207. (156) Tanaka, K.; Isselbacher, K. J. J Biol Chem 1967 242 2966. (157) Kase, B. F.; Prydz, K.; Bjorkhem, I.; Pedersen, J. I. Biochem Biophys Res Commun 1986 138 167. (158) Kase, B. F.; Bjorkhem, I. J Biol Chem 1989 264 9220. (159) Bonafe, L.; Troxler, H.; Kuster, T.; Heizmann, C. W.; Chamoles, N. A.; Burlina, A. B.; Blau, N. Mol Genet Metab 2000 69 302. (160) Mawal, Y. R.; Qureshi, I. A. B iochem Biophys Res Commun 1994 205 1373. (161) Knights, K. M.; Sykes, M. J.; Miners, J. O. Expert Opin Drug Metab Toxicol 2007 3 159. (162) Trottier, J.; Milkiewicz, P.; Kaeding, J.; Verreault, M.; Barbier, O. Mol Pharm 2006 3 212. (163) Tsumori, M.; Asakura, M.; Narahara, M.; Ogawa, T.; Nakae, M.; Nakagawa, S.; Kawai, Y.; Morino, H.; Hama, T.; Miyake, M. Exp Eye Res 1995 61 403. (164) Wilcox, B. J.; Ritenour Rodgers, K. J.; Asser, A. S.; Baumgart, L. E.; Baumgart, M. A.; Boger, D. L.; DeBlassio J. L.; deLong, M. A.; Glufke, U.; Henz, M. E.; King, L., 3rd; Merkler, K. A.; Patterson, J. E.; Robleski, J. J.; Vederas, J. C.; Merkler, D. J. Biochemistry 1999 38 3235. (165) Chaturvedi, S.; Driscoll, W. J.; Elliot, B. M.; Faraday, M. M.; Grunberg, N. E.; Mueller, G. P. Prostaglandins Other Lipid Mediat 2006 81 136. (166) Hata, A. N.; Breyer, R. M. Pharmacol Ther 2004 103 147. (167) Grazia Cascio, M.; Minassi, A.; Ligresti, A.; Appendino, G.; Burstein, S.; Di Marzo, V. Biochem Biophys Res Commu n 2004 314 192. (168) Neubert, T. A.; Johnson, R. S.; Hurley, J. B.; Walsh, K. A. J Biol Chem 1992 267 18274. (169) Kleuss, C.; Krause, E. EMBO J 2003 22 826. (170) Stevenson, F. T.; Bursten, S. L.; Fanton, C.; Locksley, R. M.; Lovett, D. H. Proc Natl Acad Sci U S A 1993 90 7245. (171) Sachon, E.; Nielsen, P. F.; Jensen, O. N. J Mass Spectrom 2007 42 724. (172) van der Westhuizen, F. H. e. a. J. Biochem. Mol. Toxicol 2000 14 102.

PAGE 55

31 (173) O'Byrne, J.; Hunt, M. C.; Rai, D. K.; Saeki, M.; Alexs on, S. E. J Biol Chem 2003 278 34237. (174) Mueller, G. P.; Driscoll, W. J. J Biol Chem 2007 282 22364. (175) Burstein, S. H.; Rossetti, R. G.; Yagen, B.; Zurier, R. B. Prostaglandins Other Lipid Mediat 2000 61 29. (176) Bradshaw, H. B.; Rimmerman, N.; Hu, S. S.; Burstein, S.; Walker, J. M. Vitam Horm 2009 81 191. (177) Merkler, D. J.; Chew, G. H.; Gee, A. J.; Merkler, K. A.; Sorondo, J. P.; Johnson, M. E. Biochemistry 2004 43 12667. (178) Prusakiewicz, J. J.; Kingsl ey, P. J.; Kozak, K. R.; Marnett, L. J. Biochem Biophys Res Commun 2002 296 612. (179) Prusakiewicz, J. J.; Turman, M. V.; Vila, A.; Ball, H. L.; Al Mestarihi, A. H.; Di Marzo, V.; Marnett, L. J. Arch Biochem Biophys 2007 464 260. (180) Hedge, A., Haines, DC, Bondlela M, Chen, B, Schaffer, N, Tomchick, DR, Machius, M, Nguyen, H, Chowdhary, PK, Stewart, L, Lopez, C, Peterson, JA. Biochemistry 2007 46 14010. (181) Haines, D., Tomchick, DR, Machius M, Peterson, JA. Biochemistry 2001 40 13456. (182) Mendelson, W. B.; Basile, A. S. Neuropsychopharmacology 2001 25 S36. (183) Elgueta, R.; Tobar, J. A.; Shoji, K. F.; De Calisto, J.; Kalergis, A. M.; Bono, M. R.; Rosemblatt, M.; Saez, J. C. J Immunol 2009 183 277. (184) Lo, Y. K.; Tang, K. Y.; Chang, W. N.; Lu, C. H.; Cheng, J. S.; Lee, K. C.; Chou, K. J.; Liu, C. P.; Chen, W. C.; Su, W.; Law, Y. P.; Jan, C. R. Biochem Pharmacol 2001 62 1363. (185) Liu, Y. C.; Wu, S. N. Eur J Pharmacol 2003 458 37. (186) Wakamatsu, K.; Masaki, T.; Itoh, F.; Kondo, K.; Sudo, K. Biochem Biophys Res Commun 1990 168 423. (187) Hamberger, A.; Stenhagen, G. Neurochem Res 2003 28 177. (188) Morisseau, C.; Newman, J. W.; Dowdy, D. L.; Goodrow, M. H.; Hammock, B. D. Chem Res Toxicol 2001 14 409. (18 9) Sugiura, T.; Kondo, S.; Kodaka, T.; Tonegawa, T.; Nakane, S.; Yamashita, A.; Ishima, Y.; Waku, K. Biochem Mol Biol Int 1996 40 931. (190) Bisogno, T.; Sepe, N.; De Petrocellis, L.; Mechoulam, R.; Di Marzo, V. Biochem Biophys Res Commun 1997 239 473. (191) Driscoll, W. J.; Chaturvedi, S.; Mueller, G. P. J Biol Chem 2007 282 22353. (192) Mueller, G. P.; Driscoll, W. J. Vitam Horm 2009 81 55. (193) Ritenour Rodgers, K. J.; Driscoll, W. J.; Merkler, K. A.; Merkler, D. J.; Mueller, G. P. Bioche m Biophys Res Commun 2000 267 521. (194) Karanian, D. A.; Bahr, B. A. Curr Mol Med 2006 6 677. (195) Felder, C. C.; Dickason Chesterfield, A. K.; Moore, S. A. Mol Interv 2006 6 149. (196) Labar, G.; Michaux, C. Chem Biodivers 2007 4 1882. (197) Jhaveri, M. D.; Richardson, D.; Chapman, V. Br J Pharmacol 2007 152 624. (198) Mahadevan, A.; Razdan, R. K. AAPS J 2005 7 E496. (199) Sudhahar, V.; Shaw, S.; Imig, J. D. Eur J Pharmacol 2009 607 143.

PAGE 56

32 (200) Piomelli, D.; Tarzia, G.; Duranti, A.; T ontini, A.; Mor, M.; Compton, T. R.; Dasse, O.; Monaghan, E. P.; Parrott, J. A.; Putman, D. CNS Drug Rev 2006 12 21. (201) Ligresti, A.; Bisogno, T.; Matias, I.; De Petrocellis, L.; Cascio, M. G.; Cosenza, V.; D'Argenio, G.; Scaglione, G.; Bifulco, M.; Sorrentini, I.; Di Marzo, V. Gastroenterology 2003 125 677. (202) Bauer, J. D.; Sunman, J. A.; Foster, M. S.; Thompson, J. R.; Ogonowski, A. A.; Cutler, S. J.; May, S. W.; Pollock, S. H. J Pharmacol Exp Ther 2007 320 1171. (203) Lupica, C. R.; Riegel, A. C. Neuropharmacology 2005 48 1105. (204) Huestis, M. A.; Gorelick, D. A.; Heishman, S. J.; Preston, K. L.; Nelson, R. A.; Moolchan, E. T.; Frank, R. A. Arch Gen Psychiatry 2001 58 322. (205) Chaperon, F.; Soubrie, P.; Puech, A. J.; Thiebot, M. H. Psychopharmacology (Berl) 1998 135 324. (206 ) Arnone, M.; Maruani, J.; Chaperon, F.; Thiebot, M. H.; Poncelet, M.; Soubrie, P.; Le Fur, G. Psychopharmacology (Berl) 1997 132 104. (207) Colombo, G.; Agabio, R.; Fa, M.; Guano, L.; Lobina, C.; Loche, A.; Reali, R.; Gessa, G. L. Alcohol Alcohol 1998 33 126. (208) Cohen, C.; Perrault, G.; Voltz, C.; Steinberg, R.; Soubrie, P. Behav Pharmacol 2002 13 451. (209) Huang, G. Y.; Cooper, E. S.; Waldo, K.; Kirby, M. L.; Gilula, N. B.; Lo, C. W. J Cell Biol 1998 143 1725. (210) Boger, D. L.; Patterson J. E.; Guan, X.; Cravatt, B. F.; Lerner, R. A.; Gilula, N. B. Proc Natl Acad Sci U S A 1998 95 4810. (211) Guan, X. J.; Cravatt, B. F.; Ehring, C. R.; Hall, J. E.; Boger, D. L.; Lerner, R. A.; Gilula, N. B. J. Cell Biol. 1997 139 1785. (212) Lerner, R. A. Proc Natl Acad Sci U S A 1997 94 13375. (213) Coleman, A. M.; Sengelaub, D. R. J Comp Neurol 2002 454 34. (214) Bannerman, P.; Nichols, W.; Puhalla, S.; Oliver, T.; Berman, M.; Pleasure, D. J Neurosci Res 2000 61 605. (215) Schweitze r, J. S.; Wang, H.; Xiong, Z. Q.; Stringer, J. L. J Neurophysiol 2000 84 927. (216) Boitano, S.; Evans, W. H. Am J Physiol Lung Cell Mol Physiol 2000 279 L623. (217) Nagasawa, K.; Chiba, H.; Fujita, H.; Kojima, T.; Saito, T.; Endo, T.; Sawada, N. J C ell Physiol 2006 208 123. (218) Schiller, P. C.; D'Ippolito, G.; Brambilla, R.; Roos, B. A.; Howard, G. A. J Biol Chem 2001 276 14133. (219) Ransjo, M.; Sahli, J.; Lie, A. Biochem Biophys Res Commun 2003 303 1179. (220) Decrouy, X.; Gasc, J. M.; P ointis, G.; Segretain, D. J Cell Physiol 2004 200 146. (221) Gilleron, J.; Nebout, M.; Scarabelli, L.; Senegas Balas, F.; Palmero, S.; Segretain, D.; Pointis, G. J Cell Physiol 2006 209 153. (222) Subauste, M. C.; List, B.; Guan, X.; Hahn, K. M.; Ler ner, R.; Gilula, N. B. J Biol Chem 2001 276 49164. (223) Bernstein, S. A.; Morley, G. E. Adv Cardiol 2006 42 71. (224) Sohl, G.; Maxeiner, S.; Willecke, K. Nat. Rev. Neurosci. 2005 6 191. (225) Theis, M.; Sohl, G.; Eiberger, J.; Willecke, K. Trends Neurosci 2005 28 188. (226) van Veen, T. A.; van Rijen, H. V.; Jongsma, H. J. Adv Cardiol 2006 42 18.

PAGE 57

33 (227) Cotrina, M. L.; Kang, J.; Lin, J. H.; Bueno, E.; Hansen, T. W.; He, L.; Liu, Y.; Nedergaard, M. J Neurosci 1998 18 2520. (228) Lin, J. H.; Weigel, H.; Cotrina, M. L.; Liu, S.; Bueno, E.; Hansen, A. J.; Hansen, T. W.; Goldman, S.; Nedergaard, M. Nat Neurosci 1998 1 494. (229) Rawanduzy, A.; Hansen, A.; Hansen, T. W.; Nedergaard, M. J Neurosurg 1997 87 916. (230) Miura, T.; Ohnuma, Y.; Kuno, A.; Tanno, M.; Ichikawa, Y.; Nakamura, Y.; Yano, T.; Miki, T.; Sakamoto, J.; Shimamoto, K. Am J Physiol Heart Circ Physiol 2004 286 H214. (231) Nodin, C.; Nilsson, M.; Blomstrand, F. J Neurochem 2005 94 1111. (232) Yang, J. Y.; Abe, K.; Xu, N. J.; Matsuki, N.; Wu, C. F. Neurosci. Lett. 2002 328 165.

PAGE 58

34 2 Development of Quantitative Assays for Long Chain Acyl Amides 2.1 Background of N A cylglycine and P rimary F atty A cid A mide I solation In 1957 the first (non sphingosine based) fatty acid amide was isolated as N palmitoylethanolamine a natural anti inflammatory agent from egg yolk soybeans and peanuts 2 Interest in the N acylethanolamines (NAEs) grew after evidence showed that N a rach idonoylethanolamine (anandamide) was an endogenous ligand for cannabinoid receptors after they were shown to attenuate the electrically evoked twitch response in M us musculus vas deferens. 3 Although N arachidonoylethanolamine has been studied at length, the identification and characterization of other lipid signaling molecules has lagged behind peptides and pol ar signaling molecules due to the nonpolar nature of lipids. Not only are they hydrophobic, thus making isolation by traditional methods difficult, but they are in low abundance and in constant chemical flux, often quickly being metabolized to other specie s. Relative to the NAEs, less is known about long chain primary fatty acid amides (PFAMs) and even less about the N acylglycines (NAGs), more recently discovered members of this group of mammalian signaling molecules. T he current literature for extraction and identification of NAGs a nd PFAMs from mammalian sources is s ummarize d in Table 2 1 and Table 2 2 in short chain NAGs as excretion products that accumulate due to aciduria s and other inborn errors of metabolism, little work has been done toward extra cting NAGs as mammalian metabolites until very recently ( Table 2 1 ) T he signaling NAGs are present in much lower abundance than

PAGE 59

35 found as excretion products in aciduria patients, making their isolation difficult until the advent of sensitive analytical instrumentation combined with efficient extraction techniques. For completeness, a few o f the urinary NAG studies have been included in Table 2 1 Renewed interest in isolating PFAMs from mammalian sources arose in the ed physiological sleep in rats. 12 A survey of the techniques used to isolate PFAMs is presented in Table 2 2 Much of the PFAM research has focused on oleamide, likely becaus e it has a known physiological function (see Chapters 3 for a review of PFAM function).

PAGE 60

36 Table 2 1 : Summary of N A cylglycine A nalysis from M ammalian S ources Initial purification method Detection method Detection limit Endogenous amount NAG source NAG(s) identified Ref LC MS none LC/MS 6 nmol 1 9 mmol/mol creatinine Human urine v arious short chain NAGs 5 none ESI MS/MS Not reported 0.2 4760 mmol/mol creatinine c Human urine v arious short chain NAGs 6 SPE SPE (IE, RP, NP) LC QqTOF, MRM 150 fmol, 100 attomol 0.26 to 333 pmol/g b Rat tissues N palmitoyl, N stearoyl, N oleoyl, N linoleoyl, N docosa hexaenoyl 7 9 SPE (IE, RP) LC QqTOF, MRM Not reported; <500fmol 6 1612 pmol/g a Rat tissues N palmitoyl 10 SPE (IE, RP) LC QqTOF Not reported 1 140 pmol/g b Rat tissues and bovine brain N arach idonoyl 11 Prep TLC NP TLC LC/MS Not reported ~50 pmol/g b Rat brain GC MS NP TLC GC MS 1.5 nmol ~45pmol/10 7 cells N 18 TG 2 cells N oleoyl this disser tation NP HPTLC GC MS Not quantified N 18 TG 2 cells n ot identified 14 None GC MS 0.2 nmol 15 0.024 299 mmol/mol creatinine c Human urine v arious short chain NAGs 15 22 Abbreviations: ESI MS/MS, electrospray ionization tandem MS; GC MS, gas chroma tography mass spectrometry; HPTLC, high performance TLC; IE, ion exchange; LC/MS, liquid chromatography/ MS ; LC QqTOF, liquid chromatography hybrid quadrupole time of flight MS ; MRM, multiple reaction monitoring on a HPLC triple quadru pole MS; MS, mass spec trometry; MS/MS, tandem mass spectrometry; NP, normal phase ; prep TLC, preparatory TLC; RP, reversed phase; SPE, solid phase extraction ; TLC, thin layer chromatography The left hand columns summarize the purification (far left) and detection methods (righ t) across the studies shown. a Quantity is amount per gram dry tissue. b Quantity is amount per gram wet tissue. c Amount varied based on type of inborn error of metabolism or normal phenotype.

PAGE 61

37 Table 2 2 : Summary of Primary Fatty Acid Amide A nalysis from M ammalian S ources Initial purification method Detection method Detection limit Endogen ous amount PFAM source PFAM(s) identified Ref LC MS HPLC (HPLC) ~3.5 nmol 255 660 ng/g a Squirrel brain ole 1 HPLC ESI MS, MS/MS, and MS 3 Not reported; <0.2 pmol 0.1 5 pmol/100 l Cat CSF ole 4 SPE /TLC HPLC, SPE and TLC ESI MS, MS/MS, MS 3 IR, NMR, GC MS, and ozonolysis Not reported N ot reported Cat CSF ole, eruc 12 Solvent extraction only ESI MS Not reported Not reported N 18 TG 2 cells ole 13 (HPLC) GC MS GC MS TLC TLC, HPLC GC MS 0.1 nmol 55 pmol/10 7 cells N 18 TG 2 cells ole 23 SPE, HPTLC GC MS 1.8 nmol 1.4 28 g/g Rabit brain, heart p almit, stear,ole 14 SPE SPE GC MS Not reported 0.5 12 ng/g pig e ruc 28 SPE GC MS 0.5 nmol 112 6042 pmol/10 7 cells N 18 TG 2 and SCP cells p almitole, palmit, ole, linole This disser tation Solvent extraction only GC MS 0.28 fmol 9.9 44 ng/m l Rat CSF and serum ole 29 Solvent extraction only GC MS Not reported 2 32 g/ml Human leutal phase plasma palmitole, palmit, ole, elaid, linole 45 Abbreviations: G C MS, gas chromatography mass spectrometry; ESI MS, electrospray ionization MS; HPLC, high performance liquid chromatography; HPTLC, high performance TL C ; IR, infrared analysis; LC/MS, liquid chromatography/ MS ; MS, mass spectrometry; MS/MS and MS 3 tandem mass spectrometry; NMR, nuclear magnetic resonance; SPE, solid phase extraction ; TLC, thin layer chromatography The left hand columns summarize the purification (far left) and d etection methods (right) across the studies shown. a Quantity is amount per gram dry tissue

PAGE 62

38 2.1.1 Lipid E xtraction Although short chain NAGs are present in certain u rine samples and can be analyzed without extraction, the long chain NAGs and PFAMs are generally in much lower abundance and require more extensive extraction techniques to remove them from the tissues and cells in which they are found. Commonly used extractions are based on those of Folch 24 and Bligh, 25 and variations thereof. Usually a 20 fold volume of chloroform:methanol (2:1) or methanol is added to the tissue or cell pellet prior to homogenization, and a small volume of water or brine is added to the supernatant to separate lipids from remaining non lipid contamin ants that remain in the upper, aqueous phase. The lower phase, which contains lipid molecules including NAGs and PFAMs is then reduced in volume before initial sample preparation 2.1.2 Sample Preparation Older methods of long chain fatty acid related molecules required purification to homogeneity prior to structural analysis by MS or NMR 26 27 a problem which is compounded by the low abundance of lipid signaling molecules such as PFAMs and NAGs. Modern instrumentation can characterize individual lipid components in a more complex, less pu rified sample Initial purification is typically done using either preparatory thin layer chromatography ( TLC ) or solid phase extraction (SPE) after solvent extraction (see Table 2 1 and Table 2 2 for examples) Greater specificity can be achieved using column chromatography (ion exc hange or normal phase) or TLC as the characteristic functional groups (i.e. glycine and primary amide ) interact with the solid matrix and samples can be separated based on t hose functional groups. Reverse phases are useful for separating compounds based on their acyl chain lengths. 2.1.2.1 Solid Phase Extraction Normal phase (NP), reversed phase (RP) and ion exchange (IE) chromatography columns have all been used for initial sample purification before MS analysis of NAGs PFAMs, and other related lipids (see Table 2 1 and Table 2 2 ) There are several things to consider when attempting to purify a lipid sample by SPE. The different solid matrices

PAGE 63

39 can be used to separate the PFAMs and NAGs from different metabolites depe nding on the desired outcome Crude extract s can often contain cholesterols, triacylglycerols, squa lenes and other nonpolar lipids, which can be removed by using an ion exchange or normal phase column. When put in acidic conditions, PFAMs gain a positive c harge ( NH 3 + ) and NAGs gain one ( NH 2 + ) or two (=O + H) positive charges and become good candidates for ion exchange. Reverse phase columns are useful for separating compounds of different acyl chain length. Silica matrix material varies from manufacturer to manufacturer and even from lot to lot, and the sample purification by SPE should be optimized with a solution of standards. The analytes can become difficult to recover if they bind too tightly with the column material or are in low abundance. All of these SPE techniques have been put to use by the Bradshaw/Walker group for partial purification of NAGs 7 1 1 as well as by many others for selective extraction of different lipid classes. 30 36 C ompounds that contain similar polarities such as PFAMs, NAGs monoacyl glycerols, and N acylethanolamines can be difficult to separate on SPE. This may be overcome in the later MS a nalyses if sufficiently sensitive instruments are available but TLC is another option that m a y offer a better pre analysis separation in these cases. 2.1.2.2 Thin Layer Chromatography TLC has long been used to separate lipid samples from crude extract 37 44 (see ref 41 for a review). TLC can purify samples to a greater extent in one step relative to SPE, although amine b ased diffusion of the PFAMs and NAGs spreads the amide TLC spot more widely than for other lipid classes. High performance thin layer chromatography (HPTLC) plates use smaller particle size (~15m), which gives rise to less spot spread and higher resolutio n, ameliorating the diffusion caused by the amino group. Because NP silica gel is polar, PFAMs and particularly the NAGs will not move far from the baseline of the TLC plate and as plates are developed the more non polar lipids will travel away from th ese amides While providing a means to rapidly remove most contaminants at once, TLC can also provide a quick profile of all the types of compounds present in a sample. Larger amounts of lipids can be visualized under UV light, while smaller quantities c an be

PAGE 64

40 visualized using a dye such as potassium permanganate (KMnO 4 ) which is used to visualize as little as 1nmol NAG or PFAM KMnO 4 is oxidative, so standards are run in tandem with test plates and position of the target spot is estimated based on the dyed standard before scraping into desorption solvent. It is important to remove silica and binding agent(s) before the next analytical step to avoid clogging the analytical instrumentation or da mpening the signal with excess background noise. A fine syringe filter can remove most of the silica, and careful use of dry solvents can minimize silica solubility. The Merkler and Johnson groups have had some success with desorbing into anhydrous isoprop anol ( this dissertation and ref. 14 ) ; however, certain binding agents can deteriorate GC column material over time. Careful selection of TLC plates or in house production of the plates will avoid this problem. 2.1.3 Sample Detection Nuclear magnetic resonance ( NMR ) although useful for complete atom assignment, is not useful for most PFAM and NAG analyses because of the limited quantities of purified materials obtain from mammalian sources and inability to purify samples to homogeneity Even when using large animals and large tissue samples the pmol/g tissue quantities do not provide enough material for 13C NMR which requires mg quantities 3 More sensitive techniques are required Analysis via mass spectroscopy provides excellent sensitivity and u nambiguous assignment of compound can be achieved by mass fragmentation pattern and retention time comparisons to known standards. The two main methods used are GC MS and LC MS. 2.1.3.1 Gas Chromatography Mass Spectro metry Gas chromatography mass spectrometry ( G C MS ) is an excellent system for the rapid separation and detection of metabolites E ven with crude preparations the GC MS spectrum can be mined for characteristic fragment ions to be quantified, or only those mass to charge ratios ( m/z ) of interest can b e monitored (see section 2.2.12 ) One advantage of GC over LC is its higher peak capacity due to l onger column length. N onpolar (95 100% dimethylpolysiloxane) columns provide a separation by chain length. Because the typical ionization potential used in most electron ionization systems is 70

PAGE 65

41 eV, much higher than the potential required to ionize organic molecules, fragment i ons are observed in much greater abundance than M ions. However, identification by retention time and fragmentation pattern still allows unambiguous assignment of structure. If a standard is unavailable and determination of molecular weight is desired, c hemical ionization (CI) can be used. A protonated molecular ion is formed through a two step reaction in which a reagent gas is bombarded with electrons to ionize it and then the activated gas is allowed to react with the analyte molecule, forming an intac t, ionized compound for mass detection. Although underivitized NAGs and PFAMs can be seen when in abundance in GC analysis, the amounts of NAGs and PFAMs extracted from a natural source are not sufficiently abundant to allow production of robust standard curves within useful ranges for metabolite analysis without derivitization. Typically N,O b is(trimethylsilyl)trifluoroacetamide (BSTFA) 19,46 48 tert butyl dimethylsilyl ether (t BDMS) 49 or methylation 50,51 are used for volatilization, which greatly increase s sensitivity over non volatilized compounds. 2.1.3.2 High Pressure Liquid Chromatography Mass Spect rometry HP LC MS /MS has been the method of choice for identifying long chain NAGs and PFAMs over the last 3 5 years. Both HPLC MS/MS and GC MS allow for virtually unambiguous structure assignment ( whe n synthetic standards are available ) due to both fragmentation pattern anal ysis and retention times. HPLC MS/MS often can provide more accurate masses (<10 ppm) than GC MS (~100 ppm), allowing identification to a higher degree of confidence and with fewer fragment peaks. These methods, in addition to requiring less material, also eliminate the need for pure sample. A modestly purified sample (via SPE) can be further separated on the LC column, and tandem MS can further isolate compounds of interest if their intact molecular weights are known. Tandem mass spectrometers can include triple quadrupole, ion trap, and quadrupole/time of flight to isolate fragments of specific mass to charge ratio (m/z) prior to final fragmentation for unambiguous identification. 26 Sensitivity can be increased further by using a smaller LC column, as the increase in sensitivity is the square of the proportion of the column diameters 26 Although Tan et al. do not report a 1600 fold increase in sensitivity when

PAGE 66

42 moving from a 4.1 mm to a 75 m diameter column as theoretically predicted they did find novel compounds w ith less than 250 fmol of a fatty acyl amide when using a nano HPLC QqTOF, and 100 attomol in the multiple reaction monitoring (MRM) scan on a triple quadrupole MS for quantification of known compounds. 9 Tan et. al. have developed an algorithm designed to assist with the intensive data analysis required to process the roughly 1000 spectra generated from each MS/MS run from crude brain extract. The algorithm searches each MS scan for predicte d ions from the masses of acyl groups plus amino acids and other small endogenous amines. Candidate MS/MS must also contain the masses of the acyl and the amino fragments. They recently have used this method to identify 11 novel acyl amino acids in rat tis sue homogenates. 8 2.1.4 Other C onsiderations Unambiguous assignment of unsaturated acyl chains can pose a problem in some samples. Separation of cis/trans isomers is not ideal on a nonpolar matrix such as the dimethylpolysiloxane GC column that is commonly used for lipid analysis, but a highly polar bis(cyanopropyl) polysiloxane phase has been shown to provide this separation. 52 A recent review article describes Ag + HPLC, Ag + TLC, RP HPLC and high speed counter current chromatography methods for separating cis/trans isomers of fatty acid methyl esters before MS analysis, 53 and could be adopted to fatty acid amides. Retention times of metabolites can vary due to co eluting comp ounds, general sample purity, column deterioration, and changes and general maintenance in chromatography apparatus for both LC and GC MS. 8 Retention times are therefore best estimated by running extracts spiked with putative target compou nds directly after analysis of unspiked sample rat her than running pure NAGs or standards at a later time. This is not always possible when searching for novel metabolites but putative metabolites can be synthesized after the fact. The synthesis of NAGs both for analyte validation and for u se as an intern al standard is typically done by the reaction of glycine ethyl ester with the desired acid chloride followed by deprotection of the glycine in base. 54 Primary fatty acid amides are synthesized by amidation of the acyl chloride. 55 (See section 2.2.2 )

PAGE 67

43 Internal standards should be added before sample analysis at different steps. A deuterated lipid of similar chain length to the analyte(s) of interest is preferred as it will give similar st andard curves for quantitative analysis and have similar retention times but remain distinct from any endogenously found amides An internal standard should be added before sample extraction, purification and analysis to determine efficiency of metabolite recovery. Additionally, instrument performance can vary from day to day and from run to run and therefore an internal standard of known amount should be included with each GC MS or LC MS/MS run if quantitative analysis is desired. The advent of modern a nalytical tandem MS/MS instruments has greatly increased our ability to quickly analyze metabolites of low abundance and to s earch for novel NAGs and PFAMs ( as well as other related lipids ) Careful selection of extraction solvents, purification matrices, and analytical separation columns allow for the identification and quantification of low abundant NAGs and PFAMs from complex lipid mixtures. In this chapter, quantitative assays for PFAMs and NAGs are presented, along with some metabolism data for the co nversion of oleic acid to oleamide. PFAM purification on NP SPE and identification by GC MS proved to be a robust method for the quantification of these metabolites. NAGs were found to be more easily separated and recovered on TLC before identification by GC MS. These methods were put to use in standard solutions, spiked cell and media extracts, and in some model cell lines after incubati on with free fatty acids (FFAs). 2.1.5 Oleamide P roducing C ell S election T he successful isolation of fatty acid amides from mam malian sources to date is summarized in Table 2 2 In selecting a cell line for isolation of oleamide, mouse neuroblastoma N 18 TG 2 was an ideal choice because these cells express PAM 56 and are known to produce oleamide and N oleoylglycine 1 3,23 These cells could therefore serve as a model for validation of extraction methods. In order to gain a more thorough perspective about long chain PFAM metabolism, two additional cell lines were examined for the production of oleamide from exogenously added oleic acid: sheep choroid plexus ( SCP ) and human epithelial kidney ( HEK 293 ) cells. These cell lines were chosen because of their potential to synthesize oleamide.

PAGE 68

44 Liver and kidney cells have the highest expression of the short and medium chain acyl CoA processing enzyme ACGNAT 57 62 and therefore may have a greater potential to process long chain acyl CoA s NAGs and PFAMs as well SCP cells were chosen because this tissue type is known to secrete molecules into CSF where PFAMs have been found. 63 65 2.2 Materials and Methods 2.2.1 Materials Fetal b ovine s erum (FBS) was from Atlanta Biologicals (Lawrenceville, GA) Donor e quine s erum was from Thermo Scientific (Waltham, MA) DMEM, EMEM and penicillin/streptomycin were from Mediatech Cellgro (Manassas, VA) Mouse neuroblastoma N 18 TG 2 cells were from DSMZ (Deutsche Sammlung von Mikrooganism und Zellkuturen GmBH). SCP and HEK 293 cells were from American Type Cult ure Collection ( Manassas, VA) Primers were from IDT DNA. MicroPoly(A) Pure TM mRNA purification kit and RETROscript Reverse Transcription kit were from Ambion (Austin, TX) QIA Quick gel extraction kit w as from Qiagen (Valencia, CA) PVDF membra ne was from Millipore ( Billerica, MA) Tween 20, oleic acid and 13 C 18 oleic aci d were from Sigma Aldrich (St. Louis, MO) PAM (S 16) and FAAH (V 17) antibod i es were from Santa Cruz Biotech, Inc (Santa Cruz, CA) FACL5 (N term), FACL3 (center), FACL6 (center) antibodi es were from Abgent ( San Diego, CA) Goat anti rabbit and donkey anti goat secondary antibodies conjugated with horse radish peroxidase were from ICN Biomedical (Solon, OH) SuperSignal chemiluminescent detection system was from Pierce (Rockford, IL) BSTF A and silica were from Sup elco (St. Louis, MO) Deuterated D 33 h eptadecanoi c acid was from C / D / N isotopes (Pointe Claire, Quebec) All other reagents and cell culture supplies were of the highest quality available from commercial suppliers.

PAGE 69

45 2.2.2 Standard Synthesis 2.2.2.1 Acyl Chloride S ynthesis The free fatty acid (FFA) and thionyl chloride were combined in a 1:2 molar ratio neat under nitrogen while stirring ( Equation 2 1 ) The reaction was allowed to proceed under reflux for 30 minutes at 50 o C in a heating mantle Excess unreacted thionyl chloride was removed by heating or under vacuum until the solution no l onger produced gas. 2.2.2.2 13 C 18 O leamide S ynthesis 13 C 18 O leamide was synthesized for use as a standard following a procedure similar to Fong et. al 55 U ndistilled acyl chloride was added dropwise to ice cold concentrated NH 4 OH (29% NH 3 ) in a ratio of 1:6 acyl chloride: NH 4 OH (v/v) (see Equation 2 2 ) The reaction was allowed to continue until the precipitation of 13 C 18 oleamide visibly ceased Excess NH 4 OH was removed from the oleamide crystals by washing with H 2 O in a Bchner funnel. T he sample was allowed to dry and stored at 20 o C flushed under nitrogen. Equation 2 2 : Synthesis of 13 C 18 Oleamide from the Acyl Chloride Equation 2 1 : Synthesis of Acyl Chloride from a Fatty Acid

PAGE 70

46 2.2.2.3 Acylglycine S ynthesis Heptadecanoylglycine, D 33 (HdG) and 13 C 18 N oleoylglycine were synthesized for use as standards using the procedure slightly modified from Goujard et.al 54 ( Equation 2 3 ) Glycine ethyl ester hydrochloride and triethylamine were slurried together in a 1:2 molar ratio in a small volume of dichlorometh ane (DCM) The acyl chloride was taken up in a small volume of DCM and added dropwise to the slurry in a ratio of 1 mmol chloride:10 mmol glycine ethyl ester. The reaction was allowed to proceed with stirring, at room temperature for 24 hours. Acidified water (pH ~2) was added to the reaction (1:1 ratio of acidifi ed water to reaction solvent), along with additional DCM (2:1 ratio of new DCM to reaction solvent). The solution was taken into a separatory funnel and washed twice with H 2 O and once with saturated NaCl solution. The organic phase was dried over anhydrou s sodium sulfate and then taken to an oil in vacuuo The glycine ethyl ester was deprotected by stirring with excess NaOH (~2:1 molar ratio of amide:NaOH) in meth anol/water 90:10 (v/v) for 24 h ours. The reaction was quenched with HCl (pH ~2) and placed in a separatory funnel with ethy l acetate. The reaction was washed twice with H 2 O and once with saturated NaCl solution. The organic phase was dried over anhydrous sodium sulfate and taken to a white powder in vacuuo The product was allowed to dry, flushed w ith nitrogen and stored at 20 o C.

PAGE 71

47 2.2.3 Isotope Metabolism Studies Prior to development of a quantitative PFAM assay, N 18 TG 2 cells were incubated with 13 C 18 oleic acid (O A) to determine whether the se cells would produce 13 C 18 oleamide from the exogenously added 13 C 18 OA. In these preliminary incubations, 0 2 mM fatty acid was added directly to the cell media without a BSA carrier. Cells were incubated for 48 hours with 13 C 1 8 oleic acid and then collected for PFAM analysis. Metabolite extraction was performed as described in Section 2.2.6 but no solid phase extractio n (SPE) was performed. Samples were injected directly onto the GC MS after derivitization with BSTFA and analyzed for 13 C 18 oleamide and oleonitrile by comparing with chemically synthesized standards 2.2.4 Oleic Acid BSA mixture BSA was used as a carrier for OA in aqueous media because of the low solubility of the long chain fatty acid in water OA was dissolved in ethanol, converted to the sodium salt with excess NaOH, dried under vacuum and dissolved in phosphate buffered saline ( PBS ) to make a 2 5 mM solution. The s ample was then heated Equation 2 3 : Synthesis of HdG from Acyl Chloride Synthesis of HdG from heptadecanoyl chloride. The chloride is glycinated with glycine ethyl ester, followed by base hydrolysis of the ethy l group and quenching with HCl.

PAGE 72

48 in 49 o C water bath for 5 minutes before adding 2.5 mM BSA. The s ample was stirred at room temperature for 4 hours, sterile filtered, and stored at 20 o C. 2.2.5 Cell Culture and Fatty Acid Incubation All cells were grown in 225 cm 2 culture dishes. N 18 TG 2 cells were grown in DMEM supplemented with 100 M 6 thioguanine. SCP and HEK 293 cells were grown in EMEM (SCP were supplemented with 100 M sodium pyruvate) SCP and N 18 TG 2 media had 10% FBS and HEK 293 had 10% hor se serum All cells were g r own with 100 I.U./ml penic illin, 1.0mg/ml streptomycin and incubated at 37 o C with 5% CO 2 according to supplier instructions. Cultures were g r own to 80% 90% confluency, and culture medium removed and replaced with media containing 0.5% FBS or horse serum and 2.5 mM fatty acid/0.25 mM BSA mixture. After 12, 24, or 48 hour incubation, media was collected, cells washed with PBS and trypsi nized. An aliquot was tak en for counting and determination of cell viability on a hemacytometer wi th trypan blue. Cells were centrifuged the supernatant removed, and the pellet stored at 80 o C. Spent media was centrifuged to remove any cells and the supernatant also stored at 80 o C. 2.2.6 Metabolite Extraction Metabolites were extracted from cells similar to Sultana and Johnson 46 M ethanol (4 ml) was added to cell pellets and samples were sonic ated for 15 minutes at room temperature. Samples were centrifuged at 5000 rpm for 10 min, and the supernatant separated from the pellet, dried under N 2 in a warm water bath at 40 o C. The pellet was re extracted with 4 m l 1:1:0.1 (v/v/v) chloroform:methanol: water, sonicated for 10 min, vortexed for 2 min and centrifuged 10 min at 5000 rpm. Supernatant from this step was added to the dried supernatant from the previous step and dried under N 2 at 40 o C. The pellet was re extracted with 4.8 m l chloroform:methanol 2:1 (v/v) and 800 L 0.5 M KCl/0.08 M H 3 PO 4 sonicated 2 min, vortexed 2 min, and centrifuged 10 min at 5000 rpm. The lower lipid phase was added to the dried supernatant from the previous steps and dried under N 2 at 40 o C. These steps are summarized in Figure 2 1

PAGE 73

49 Metabolite extraction from conditioned media was performed on all the media collected from the flasks (~45 ml per T 225 cm 2 flask). Extractions were done with 15 ml c hloroform:methanol 2:1 (two times) followed by two extractions with 15 m l chloroform:methanol 2:1 plus 2.4 ml 0.5 M KCl/0.08 M H 3 PO 4 No sonication was performed, and precipitated protein layers that resulted from sovlent addition were condensed by centrifugation for 30 45 min at 5000 rpm. Organic lipid phases were also combined and dried under N 2 at 40 o C. 2.2.7 Solid Phase Extraction Solid phase extraction ( SPE ) was run for PFAM purification. Silica columns were run as described by Sultana and Johnson 46 Each column contained 0.5 g silica Dried lipid extract samples were taken up in 100 L n hexane and added to silica co lumns after rinsing with n hexane. The mobile phase was ru n as follows: 4 m l n hexane, 1 m l 99:1 Figure 2 1 : Extraction of PFAMs for Analysis by GC MS. General schematic for the extraction and characterization of PFAMs from cells.

PAGE 74

50 hexane:acetic acid, 1 m l 90:10 hexane:ethyl acetate, 1 m l 80:20 hexane:ethyl acetate, 1 m l 70:30 hexane:ethyl acetate, 1.5 m l 2:1 chloroform:isopropanol, 0.5 m l methanol. The last two fractions were combined and dried down under N 2 at 45 o C. A n internal standard, 3 nmol D 33 heptadecanoic acid was added and dried before derivitization. 2.2.8 Thin Layer Chromatography TLC was used for NAG purification. Dried lipid ex tracts were applied to a 10 cm EMD (Gibbstown, NJ) analytical NP TLC plate that had been prewashed with chloroform:acetone 1:1. After spotting the sample onto the TLC plate with both ethyl acetate and ethanol, c hloroform:methanol:acetic acid 95:5:1 was use d to run up to 5.5 cm. The plate was dried and placed in th e second running solvent, hexan es:diethyl ether:acetone 60:40:5 and run up to 8 cm. After drying, the final solvent, hexanes:diethyl ether 97:3, was run up to 9.5 cm. N O leolglycine and HdG standard s w ere run alongside the cell extract on a separate plate and visualized using KMnO 4 to test for position of the NAG s The appropriate area was scraped from the experimental TLC plate containing cell extract and collected into anhydrous isopropanol before water bath sonication for 5 minutes. After initial sonication, the sample was centrifuged to pellet the silica. The supernatant liquid was transferred into a syringe filtered with a 0.22 m syringe filter and set to dry under nitrogen at 40 50 o C The silica was subjected to another round of sonication in anhydrous isopropanol, centrifugation and syringe filtering before adding to the previous supernatant. S ample p reparation for analysis of NAGs is summarized in Figure 2 2 The syringe filter has to be rinsed with isopropanol before running the sample through it to remove the slip additive oleamide. Although oleamide is not the metabolite of interest while performing the TLC purification, there was enough oleamide present to interfere with subsequent analyses. This finding of oleamide in such abundance in the syringe filter may help explain the 8 order of magnitude difference between the endogenous amount of oleamide reported in N 18 TG 2 cells by this study (119 pmol/10 7 cells) and Bisogno (55pmol/10 7 cells) (23) Bisogno, T.; Sepe, N.; De Petrocellis, L.; Mechoulam, R.; Di Marzo, V. Biochem Biophys Res Commun 1997 239 473. and by Sultana (16.67 pmol/cell). (14) Sultana, T. Doctoral Dissertation, Duquesne University, 2005.

PAGE 75

51 2.2.9 Sample D erivitization Trimethylsilylation was achieved using BSTFA. Samples were flushed with dry N 2 100 L BSTFA added, and the sample allowed to react at 55 60 o C for 1 hour before analysis by GC MS. T he reaction scheme of BSTFA with amides to form trimethylsilyl derivatives, nitriles, and enyliminoacetate derivativ es (from NAGs) is shown in Figure 2 3 2.2.10 GC MS All analyses were performed using a Shimadzu QP 5000 GC MS. Separations were achieved on a J & W Scientific (Folsom, CA) DB 5 column (0.25 mm x 30 m). The GC temperature program was 55 150 o C at 40 o C/min, hold at 150 o C for 3.6 min, ramp at 10 o C/min to 300 o C, and hold for 1 min. The transfer line was held at 280 o C and the Figure 2 2 : Extraction of NAGs for Analysis by GC MS General schematic for the extraction and characterization of NAGs from cells. For more details see text.

PAGE 76

52 injection port at 250 o C throughout the separation. Helium was used as the carrier gas, at a flow rate of 0.9 m l /min. The mass range was 35 700 amu. After running two aliquots of the experimental sample through the GC MS, the remaining sample was dried down, spiked with oleamide, re derivitized with BSTFA, and re run on the GC MS to validate sample retention times 2.2.11 Contamination Controls As controls, all glassware and plasticware were treated with solvents as described for the cell and media samples and were subjected to sonication, solid phase extraction, and derivitization to test for contaminating plasticizers 66 Integration of the GC trace was taken over the same time integral as standard amides and for the same set of ions. An averaged number of cells was used to calculate blank amount of amide per cell. Unspent media was also subjected to extraction to check for existing amides. No significant amount of oleamide was found in any of these samples compared to cells and conditioned media samples (data not shown). 2.2.12 Data Analysis Total ion chromatograms (TIC) were taken to more clearly determine the identities of species present in the sample. Post run, a set of selected ions unique to oleamide and oleonitrile was overlaid and integrated so that effects of any co elu ting compounds could be minimized. These unique ion sets were 83, 97, 110, 122, 136, 150, 164, 190, 206, 220, 234 and 263 for oleonitrile and 59, 86, 112, 116, 122, 126, 128, 131, 136, 140, 144, 154, 158, 170, 184, 186, 198, 200, 226, 238, 264, 281, 338 a nd 353 for oleamide TMS. Standards were integrated in the same way for production of a standard curve. Heptadecanoic Acid, D 33 (HdA), was spiked into each sample as an internal standard to test for performance of the instrument. The amides and nitriles of interest were integrated along with the HdA, both compared to their standard curves, and a correction factor determined based on the integration of HdA compared to its standard curve was used to adjust the amount of amide. Each sample was run on the GC MS

PAGE 77

53 twice, and each incubation run at least twice to provide replicates. T tests were performed using GraphPad. 2.3 Results 2.3.1 GC MS of S tandard S pectra Throughout these experiments BSTFA was used to volatilize the lipids and the BSTFA derivitization is shown in Figure 2 3 A When derivitizing a primary amide with BSTFA, a side reaction is observed in which a nitrile is formed as can be seen in the GC MS of oleamide in Figure 2 4 There is precedence for this type of reaction, and a suggested mechanism based on that proposed by Ichiyama involving L chloropropionic acid as the electrophile 67 is shown in Figure 2 3 B. U pon derivitization of NAGs, an enyliminoacetate product was also found in addition to the mono and bi trimethylsilyl (TMS) products ( Figure 2 5 ) The proposed formation of this enyliminoacetate can be found in Figure 2 3 C, and more information regarding the elucidation of this structure is in Appendix A.

PAGE 78

54 Figure 2 3 : Mechanism for the Derivitization of Amides with BSTFA Panel A shows the addition of a trimethylsilyl group to an elect ronegative atom previously boun d to a hydrogen. Panel B shows the competing reaction where a nitrile is for med from a primary amide. Panel C shows an enyliminoacetate product from derivitization with an NAG. For more details on enyliminoacetate identification see Appendix A.

PAGE 79

55 Figure 2 4 : GC MS of Oleonitrile and Oleamide TMS from Oleamide BSTFA reaction Panel A (top) shows the entire GC spectrum for this oleamide sample, with a zoom in of the oleonitrile and oleamide TMS peaks (bottom) Pa nel B shows the annotated MS of the oleonitrile mass spectrum. Panel C shows the annotated MS of the oleamide TMS mass spectrum.

PAGE 80

56 Figure 2 5 : GC MS of N Oleoylglycine Derivitized with BSTFA Y axes are intensity. Panel A shows the whole GC chromatogram (top) and closeup of NOG peaks (bottom). Panel B shows the MS spectrum for the enyliminoacetate derivative. Panel B shows the MS of NOG with two TMS groups attached. Panel D shows mono derivitized NOG.

PAGE 81

57 One of the most common reactions for carboxylated acyl chains is the McLafferty rearrangement. T he McLafferty rearrangement and resulting fragments from oleamide and the mono and bi derivitized NOG molecules is shown in Figure 2 6 Additional fragmentation schemes for these compounds can be found in Appendices A and B. 13 C 18 O leamide, 13 C 18 N oleoylglycine, and deuterated D 33 N heptadecanoylglycine were synthesized for use as standards for these analyses. The MS spectra for these samples are shown in Figure 2 7 and Figure 2 9 Figure 2 6 : McLafferty Rearrangements for Acyl Amides The common McLafferty rearrangements for acyl amides are shown here for a primary amide (A), mono derivitized NAG (B) and di derivitized NAG (C). The m/z shown are for an oleoyl a cyl chain. Additional fragmentation schemes are shown in Appendices A and B.

PAGE 82

58 Figure 2 7 : 13 C 18 O leamide TMS M ass S pectrum The top panel (A) shows 13 C 18 oleamide TMS. Panel B shows 13 C 18 oleonitrile.

PAGE 83

59 Figure 2 8 : N 13 C 18 O leoylglycine Mass Sspectra The top panel (A) shows the enyliminoacetate derivative of 13 C 18 NOG (see App endix A). Panel B shows 13 C 18 NOG TMS. Panel C shows 13 C 18 NOG (TMS) 2

PAGE 84

60 2.3.2 Isotope M etabolism S tudies In order to determine whether exogenously added OA was directly converted t o oleamide, i ncubations were performed with isotopically labeled 13 C 18 OA in N 18 TG 2 cells These experiments would help determine whether OA is a direct metabolic precursor to NOG and oleamide depending on whether the carbon backbone remained intact. These initial extractions were performed similar to Merkler et. al 13 and did not include an initial sample purification before application to GC MS. The cells were incubated with 0.2 mM 13 C 18 oleic acid (sans BSA lipid carrier see Section 2.2.4 ), the cells and conditioned media collected after 48 hours incubation before lipid analysis. The GC MS of 13 C 18 oleamide extracted from the cells and derivitized with BSTFA is shown in Figure 2 10 and the spectrum of underivitized 13 C 18 oleamide from the conditioned media is included in Figure 2 11 The GC MS spectrum Figure 2 9 : GC MS of HdG Panel A shows the MS of the enyliminoacetate derivative of HdG.Panel B shows the MS of HdG TMS. No HdG (TMS) 2 was observed. For more information on the enyliminoacetate derivative, see Appendix A.

PAGE 85

61 of 13 C 18 NOG isolated from cells and conditioned media and derivitized with BSTFA are shown in Figure 2 12 Figure 2 13 respectively. These results strongly suggest that the chain of custody of the carbon atoms is directly from OA to NO G and oleamide. Figure 2 10 : GC MS of N 18 TG 2 Cells Incubated wi th 13 C 18 Oleic Acid Showing 13 C 18 Oleamide TMS Panel A shows the GC over the entire timecourse (top) and a closeup of the 13 C 18 oleamide TMS spectrum (bottom). Panel B shows the annotated MS for 13 C 18 oleamide TMS.

PAGE 86

62 Figure 2 11 : GC MS of N 18 TG 2 Conditioned Media Incubated with 13 C 18 Oleic Acid Showing 13 C 18 Oleamide Panel A shows the GC over the entire timecourse (top) and a closeup of the 13 C 18 oleamide spectrum (bottom). Panel B shows the annotated MS for 13 C 18 oleamide.

PAGE 87

63 Figure 2 12 : GC MS of N 18 TG 2 Incubated with 13 C 18 Oleic Acid Showing 13 C 18 Oleoylglycine TMS Panel A shows the GC over the entire timecourse (top) and a closeup of the 13 C 18 NOG TMS peak (bottom). The peak at 20.19 minutes is 13 C 18 NOG (TMS) 2 Panel B shows the annotated MS for 13 C 18 NOG TMS.

PAGE 88

64 2.3.3 Quantitative PFAM A ssay D evelopment Initial isotopic metabolism studies provided qualitative results but not robust reproducible quantitative PFAM analysis. In or der to improve the quantification of PFAM s an extracti on step was added prior to derivitization with BSTFA and analysis by GC MS. This solid phase extraction on normal phase silica provided an excellent way to remove many interfering compounds such as cholesterols, triacylglycerols, squalenes and other nonpol ar lipids. While this extraction was not able to remove all the fatty acids due to the large amount incubated with the cells (2.5 mM), sufficient quantities were removed Figure 2 13 : GC MS of N 18 TG 2 Conditioned Media Incubated with 13 C 18 Oleic Acid Showing 13 C 18 Oleoylglycine TMS Panel A shows the GC over the entire timecourse (top) a nd a closeup of the 13 C 18 NOG TMS peak (bottom). The peak at 20.18 minutes is 13 C 18 NOG (TMS) 2 Panel B shows the annotated MS for 13 C 18 NOG TMS.

PAGE 89

65 to prevent saturation of the detector on the GC MS, essential to preserving the life o f the detector system and in removing enough interference to allow the detection of smaller PFAM peaks. Extraction efficiency experiments were run for oleamide and other PFAMs, and a detailed description of the analysis can be found in Chapter 3. Extraction efficiency for oleamide from cells was 81% 7% and in media was 94% 9% (ave rage standard deviatio n ). 2.3.3.1 O leic A cid Time C ourse I ncubat ions Once it was established that the N 18 TG 2 cell line is capable of converting OA directly to oleamide and the quantitative assay had been demonstrated with spiked samples (data not shown) the next step was to quantify the endogenous amount of oleamide in all three model cell lines and to demonstrate the rate of conversion from OA to oleamide over time in each of them. (For a discussion on the selection of model cell lines see section 2.1.5 .) All three model cell lines were found to contain endogenous amounts of oleamide, and quantified in normally growing cells without incubation with OA. A ll three cell lines also showed an increase in oleamide level after incubation with OA over time. GC MS spectra showing oleamide or oleonitrile can be found in Figure 2 14 through Figure 2 19

PAGE 90

66 Figure 2 14 : GC MS HEK 29 3 Cell Extract after Incubation with OA for 12h, S howing O leonitrile GC MS of HEK 293 cell extract after incubation with OA for 12 h ours. Panel A shows the whole GC and a close up of the peak of interest. Panel B shows the MS of the indicated GC peak (oleonitrile) Panel C shows the library database MS for oleonitrile Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section. The cells had been incubated wi th 2.5 mM OA in 0.25 mM BSA for 12 hour s in this case before extraction.

PAGE 91

67 Figure 2 15 : GC MS of HEK 293 Conditioned Media Extract after Incubation with OA for 24 h, S howing O leonit rile GC MS of HEK 293 media extract after incubation with OA for 24 h ours Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (oleonitrile). Panel C shows the library database MS for oleonitrile. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section. The cells had been incubated with 2.5 mM OA in 0.25 mM BSA for 24 hours in this case before extraction.

PAGE 92

68 Figure 2 16 : GC MS of N 18 TG 2 C e ll Extract after Incubation with OA for 12h, S howing O leonitrile GC MS of N 18 TG 2 cell extract after incubation with OA for 12 h ours. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (oleonitrile) Panel C shows the library database MS for oleonitrile Panel D shows the difference between panels B and C. The cells were extract ed as described in the methods section. The cells had been incubated with 2.5 mM OA in 0.25 mM BSA for 12 hours in this case before extraction.

PAGE 93

69 Figure 2 17 : GC MS of N 18 TG 2 Conditioned Media Extract after Incubation with OA for 48h, S howing O leonitrile GC MS of N 18 TG 2 media extract after incubation with OA for 48 h ours. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (oleonitrile) Panel C shows the library database MS for oleonitrile Panel D shows the difference between panels B and C. The cells were extract ed as described in the methods section. The cells had been incubated wi th 2.5 mM OA in 0.25 mM BSA for 48 hours in this case before extraction.

PAGE 94

70 Figure 2 18 : GC MS of SCP cell Extract after Incubation with OA for 48h, Showing Oleamide TMS GC MS of SCP cell extract after incubation with OA for 48 h ours. Panel A shows the whole GC and zoom in of the peak of interest. Panel B show s the MS of the indicated GC peak (oleamide TMS) Panel C shows the library database MS for oleamide TMS Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section. The cells had been incubated with 2 .5 mM OA in 0.25 mM BSA for 48 hours in this case before extraction.

PAGE 95

71 Figure 2 19 : GC MS of SCP Conditioned M edia Extract after Incubation with OA for 24h, S howing Oleonitrile GC MS of SCP media extract after incubation with OA for 24 h ours. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (oleonitrile) Panel C shows the library da tabase MS for oleonitrile Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section. The cells had been incubated wi th 2.5 mM OA in 0.25 mM BSA for 24 hours in this case before extraction.

PAGE 96

72 The amount of oleamide found in the conditioned media was similar to that found in the cells for all three cell lines at all time points ( Figure 2 20 ). This could mean that these molecules may be in equilibrium with no specific transport protein to move them against a concentration gradient. Due to the high incubation concentration of OA (2.5 mM), there was no observed tailing off of oleamide production in the SCP and N 18 TG 2 cells. The HEK 293 cells, however, did not show a significant increase in oleamide production after the first 12 hours ( Figure 2 20 ). Another finding was that the SCP cells showed significantly higher amounts of oleamide (p<0.001 vs both N 18 TG 2 and HEK 293 cell data). Figure 2 20 : Oleamide Production in SCP, N 18 TG 2 and HEK 293 Cells after Oleic Acid Incubation For incubation conditions, see materials and methods section. Top panel shows the amount of oleamide found in all three cell lines and media extracts. Bottom panel is close up showing N 18 TG 2 and HEK 293 only. Error bars shown are standard deviation. 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 20000 0h 12h 24h 48h pmol oleamide per 10 7 cells SCP cells SCP media N18TG2 cells N18TG2 media HEK cells HEK media 0 500 1000 1500 2000 2500 3000 0h 12h 24h 48h pmol oleamide per 10 7 cells N18TG2 cells N18TG2 media HEK cells HEK media

PAGE 97

73 N 18 TG 2 cells had similar endogenous levels of oleamid e as the HEK 293 cells, but showed much higher amounts of oleamide after incubation with oleic acid. It is possible that HEK 293 cells are either less capable of taking up oleic acid from its BSA carrier is less able to convert OA to oleamide, or that the se cells process ole amide back into OA through the action of FAAH more quickly than do N 18 TG 2 2.3.4 N A cylglycine A ssay D evelopment Initial experiments with separating NAGs via the same SPE method as was used for the primary amide resulted in recovery rates of approximately 35% in the 30 nmol NAG range, and samples below about 10 nmol were not recovered from the SPE columns at all As a consequence of these findings, TLC was explored as a different method of NAG isolation. In addition, the BSTFA derivitization was optimized because the standard curve for NAGs had a lower slope than for PFAMs and FFAs. 2.3.4.1 Optimization of NAG D erivitization Because NAGs form four different reaction products: NAG O TMS, NAG N TMS, NAG (TMS) 2 and an enyliminoacetate derivative (see Figure 2 3 and Figure 2 5 ) that make up t hree distinct peaks on the GC spectrum (NAG O TMS and NAG N TMS co elute), the lower limit of detection for these molecules is higher than for molecules that generate fewer products This is due to a minimal amount of the compound necessary to overcome th e background in order to form an integrable GC peak. Therefore, it was necessary to optimize the BSTFA derivitization of NAGs in order to reach the lowest limit of detection for these compounds. O ptimization of the reaction of BSTFA with NOG is shown in Figure 2 21 The optimal reaction conditions of those tested were 60 o C for one hour in neat BSTFA PFAMs were found to have the same amount of derivitized products after 30 and 60 m inutes of reaction time under these conditions (data not shown), but for consistency the reaction times were made the same for all species throughout all ensuing experiments.

PAGE 98

74 Once reaction conditions were optimized, running conditions on TLC were optimized. Different TLC plates were tested ( Figure 2 22 ) and different prewashing solvents tried ( Figure 2 23 ), among other conditions. The best combination was found to be NP analytical TLC plates from EMD (Preparatory plates showed too much background interference from binder; data not shown), prewashed with chloroform:acetone 1:1. Finally, th ese conditions were used to show separation of HdG in N 18 TG 2 media ( Figure 2 24 ) and SCP cell extracts ( Figure 2 25 ) that were spiked with 15nmol HdG prior to solvent extraction, TL C purification and GC MS analysis Figure 2 21 : Integration of NOG u nder V arious R eaction C onditions Different reaction conditions were tested for NOG derivitization with BSTFA. Left panel shows the integration of each of the 3 NOG species. Right panel shows the species added together. The amount derivitized was 2 nmol NOG. Reaction conditions were in neat BSTFA, BSTFA in toluene, BSTFA spiked with TCMS, and BSTFA spiked with potassi um acetate. Times and temperatures are indicated in the legends. 0.E+00 1.E+08 2.E+08 3.E+08 4.E+08 5.E+08 6.E+08 Integration BSTFA, 60min 60o toluene, 30 min 60o toluene, 10 min 60o BSTFA 10 min 95o TCMS, 20min 60o K+acetate, 20min 60o 0.E+00 2.E+08 4.E+08 6.E+08 8.E+08 1.E+09 Enylimino NOG TMS NOG (TMS) 2 acetate

PAGE 99

75 Figure 2 23 : Determination of Best Prewashing Solvent for TLC GC chromatogram of HdG run on TLC plates prewashed with various solvents. The vertical line passes through HdG TMS and the left peak at 20.25 minutes is the enyliminoacetate derivative. Prewashing solvents were isopropanol (black) ether:acetic acid 99:1 (pink), chloroform: acetone 1:1 (blue) and none (brown). The recovery was not si gnificantly improved, but background levels were lowered. Chloroform:acetone 1:1 showed the greatest decrease in background while maintaining the highest signal. Figure 2 22 : Recovery of NAGs on Various TLC Plates GC chromatogram of 5 nmol HdG run on different normal phase TLC plates. The vertical line passes through the enyli minoacetate derivative of HdG T he peaks around 21 minutes are HdG TMS. Plates were EMD brand (black; good recovery and low background), Dynamic with a thin plastic backing (pink; decent recovery but higher background), Dynamic with a normal glass backing ( below the y axis of this graph ; low background but poor recovery) and Watman (brown; low background but mediocre recovery). Percent recoveries are shown in the bar graph on the right. The EMD plate showed the best recovery with the lowest background. 0% 20% 40% 60% 80% 100% 120% HdG NOG Dynamic (normal) Dynamic (plastic backed) Watman EMD

PAGE 100

76 Figure 2 24 : Recovery of HdG from Spiked N 18 TG 2 Media N 18 TG 2 conditioned media was spiked with 15 nmol HdG before running the NAG extraction and quantification assay. For a scheme of the successful NAG assay, see section 2.1.2.2 of methods. Panel A shows the full GC (top) and closeup of HdG TMS (bottom). Panel B shows the MS of the GC peak indicated with a vertical li ne. Panel C shows the database MS for HdG TMS from the synthesized standard. Panel D shows the difference between panels B and C.

PAGE 101

77 Figure 2 25 : Recovery of HdG from Spiked SCP Cells SCP cells were spiked with 15 nmol HdG before running the NAG extraction and quantification assay. For a scheme of the successful NAG assay, see section 2.1.2.2 of methods. Panel A shows the full GC (top) and closeup of HdG TMS (bottom). Panel B shows the MS of the GC peak indicated with a vertical line. Panel C shows the database MS for HdG TMS from the synthesized standard. Panel D shows the difference between panels B and C.

PAGE 102

78 2.3.4.2 Extraction Efficiency for NAGs To test the robustness of our NAG extraction method, NOG and HdG were subjected to the extraction procedure. Percent recoveries were 86 % 18% and 91 % 16 %, respectively ( Figure 2 26 ). 2.4 Discussion Metabolite analysis revealed the presence of endogenous oleamide in all three cell lines tested: HEK 293, N 18 TG 2 and SCP. Oleamide was also detected in conditioned Figure 2 26 : Extraction Efficiency of NAGs Extraction efficiency experiments were performed the same way as experimental samples ( Figure 2 2 ). NAGs were dried down, extraction solvents added before sonication. Organic layers were combined and dried down. TLC was performed and a second plate run in tandem that was dyed to determine NAG position. Spots were scraped into anhydrous isoprop anol, sonicated, centrifuged and the supernatant filtered in a 0.22m syringe filter. The silica was re sonicated, spun and filtered. Isopropanol supernatants were combined, spiked with HdA internal standard and dried down before derivitization wit h BSTFA and analysis on GC MS. The error bars are standard deviation from multiple extractions. 0% 20% 40% 60% 80% 100% 120% Heptadecanoyglycine Oleoylglycine

PAGE 103

79 media ( Table 2 3 ). Finding similar levels of oleamide in cell and conditioned media sample s throughout all cell lines means that these molecules may be in equilibrium with no specific transport protein to move them against a concentration gradient. In addition, the production of oleamide increased after incubation with oleic acid. The previousl y reported amount of oleamide in N 18 TG 2 cells (55 pmol/10 7 cells) 23 is in fair agreement with measurements reported here ( 119 pmol/10 7 cells). H owever the amount reported by Sultana was much higher (16.67 pmol/cell) 14 and may be due to contamination to slip additives ( see footnote on p. 34 ) We have taken precautions to minimize and test for these slip additives and detailed procedures and discussion of this can be found in Chapter 3 SCP cells had approximately 45 50 times as much endogenous oleamide as the other two cell li nes and at least 10 times as much lines after incubation with OA This is consistent with the knowledge that choroid plexus produce s cerebrospinal fluid, 68 and PFAMs have been found in CSF. 4,64,65 In light of the expressio n results in which the oleamide degrading FAAH was not found in SCP cells, the ability of the choroid plexus to harbor and excrete these molecules in higher concentration is commensurate with the lack of detectable FAAH expression (see Chapter 4 for expres sion results and further discussion) N 18 TG 2 cells had similar endogenous levels of oleamide as the HEK 293 cells, but showed much higher amounts of oleamide after incubation with OA ( Figure 2 20 ) It is possible that HEK 293 express less fatty acid transport proteins, but a nother possibility is that these cells might be able to process the amide back into its Table 2 3 : Endogenous Levels of Oleamide in Cells and Media Cell line Endogenous oleamide SCP cells 6367 media 4087 N 18 TG 2 cells 119 media 208 HEK cells 154 media 122 Values are average pmol/10 7 cells Endogenous amount refers to oleamide extracted, purified and quantified from cells and media under normal growing conditions without OA.

PAGE 104

80 corresponding fatty acid through the action of FAAH more quickly than is N 18 TG 2 a possibility made more likely based on the observed increase in oleamide from 0 to 12 hours. A high level of hydrolysis would prevent accumulation of oleamide, as is seen in the HEK 293 samples. This is consistent with the role the kidney plays in detoxification. A TLC separation method fo r NAGs was developed because the SPE method successfully employed to identify PFAMs proved unsuitable for the small amounts of NAGs extracted from cultured cells. The TLC media performed well a s a way to separate trace NAGs in spiked cell and media samples for identification with recovery rates of 79% (HdG) and 84% (NOG data not shown ). Although liquid chromatography hybrid quadrupole time of flight MS has greater sensitivity and can handle a more complex sample, GC MS is less expensive and more widely available than the LC QqTOF and related instruments. No recoverable endogenous amounts were found with the number of cells that were tested for these experiments. For successful use of this assay on a cell sample, refer to Chapter 5. The extraction efficiencies of both the PFAM and NAG assays were fairly high (82 101%), and the limits of detection 1.5 nmol for NAGs and 0.5 nmol for oleamide These assays were used to demonstrate the conversion of OA to oleamide in the three model cell lines and recover NAG s from spiked cell and conditioned media extracts. 2.5 References (1) Stewart, J. M.; Boudreau, N. M.; Blakely, J. A.; Storey, K. B. J. Therm. Biol. 2002 27 309. (2) Kuehl, K. A., Jr. et al. J. Amer. Chem Soc. 1957 79 5577. (3) Devane, W. A.; Hanus, L.; Breuer, A.; Pertwee, R. G.; Stevenson, L. A.; Griffin, G.; Gibson, D.; Mandelbaum, A.; Etinger, A.; Mechoulam, R. Science 1992 258 1946. (4) Lerner, R. A.; Siuzda k, G.; Prospero Garcia, O.; Henriksen, S. J.; Boger, D. L.; Cravatt, B. F. Proc Natl Acad Sci U S A 1994 91 9505. (5) Ito, T.; Kidouchi, K.; Sugiyama, N.; Kajita, M.; Chiba, T.; Niwa, T.; Wada, Y. J Chromatogr B Biomed Appl 1995 670 317. (6) Bonafe, L.; Troxler, H.; Kuster, T.; Heizmann, C. W.; Chamoles, N. A.; Burlina, A. B.; Blau, N. Mol Genet Metab 2000 69 302. (7) Bradshaw, H. B.; Rimmerman, N.; Hu, S. S.; Burstein, S.; Walker, J. M. Vitam Horm 2009 81 191.

PAGE 105

81 (8) Tan, B.; William Yu, Y .; Francesca Monn, M.; Velocity Hughes, H.; O'Dell, D. K.; Michael Walker, J. Journal of Chromatography B 2009 877 2890. (9) Tan, B.; Bradshaw, H. B.; Rimmerman, N.; Srinivasan, H.; Yu, Y. W.; Krey, J. F.; Monn, M. F.; Chen, J. S.; Hu, S. S.; Pickens, S R.; Walker, J. M. AAPS J 2006 8 E461. (10) Rimmerman, N., Bradshaw, HB, Hughes, HV, Chen, JS, Hu, SS, McHugh, D, Vefring, E, Jahnsen, JA, Thompson, EL, Masuda, K, Cravatt, BF, Burstein, S, Vasko, MR, Prieto, AL, O'Dell, DK, Walker, JM. Molecular Pharm acology 2008 74 213. (11) Huang, S. M.; Bisogno, T.; Petros, T. J.; Chang, S. Y.; Zavitsanos, P. A.; Zipkin, R. E.; Sivakumar, R.; Coop, A.; Maeda, D. Y.; De Petrocellis, L.; Burstein, S.; Di Marzo, V.; Walker, J. M. J Biol Chem 2001 276 42639. (12) Cravatt, B. F.; Prospero Garcia, O.; Siuzdak, G.; Gilula, N. B.; Henriksen, S. J.; Boger, D. L.; Lerner, R. A. Science 1995 268 1506. (13) Merkler, D. J.; Chew, G. H.; Gee, A. J.; Merkler, K. A.; Sorondo, J. P.; Johnson, M. E. Biochemistry 2004 43 126 67. (14) Sultana, T. Doctoral Dissertation, Duquesne University, 2005. (15) Costa, C. G.; Guerand, W. S.; Struys, E. A.; Holwerda, U.; ten Brink, H. J.; Tavares de Almeida, I.; Duran, M.; Jakobs, C. J Pharm Biomed Anal 2000 21 1215. (16) Carter, S. M. ; Midgley, J. M.; Watson, D. G.; Logan, R. W. J Pharm Biomed Anal 1991 9 969. (17) Kimura, M.; Yamaguchi, S. J Chromatogr B Biomed Sci Appl 1999 731 105. (18) Rinaldo, P.; O'Shea, J. J.; Welch, R. D.; Tanaka, K. Prog Clin Biol Res 1990 321 411. (19) Bennett, M. J.; Ragni, M. C.; Ostfeld, R. J.; Santer, R.; Schmidt Sommerfeld, E. Ann Clin Biochem 1994 31 ( Pt 1) 72. (20) Divry P Fau Vianey Liaud, C.; Vianey Liaud C Fau Cotte, J.; Cotte, J.; Liebich Hm Fau Forst, C.; Forst, C.; Ito T Fau Kidouchi, K.; Kidouchi K Fau Sugiyama, N.; Sugiyama N Fau Kajita, M.; Kajita M Fau Chiba, T.; Chiba T Fau Niwa, T.; Niwa T Fau Wada, Y.; Wada, Y.; Gregersen N Fau Kolvraa, S.; Kolvraa S Fau Rasmussen, K.; Rasmussen K Fau Mortensen, P. B.; Mortensen Pb Fau Divry, P.; Divry P Fau David, M.; David M Fau Hobolth, N.; Hobolth, N.; Bonafe L Fau Troxler, H.; Troxler H Fau Kuster, T.; Kuster T Fau Heizmann, C. W.; Heizmann Cw Fau Chamoles, N. A.; Chamoles Na Fau Burlina, A. B.; Burl ina Ab Fau Blau, N.; Blau, N. (21) Liebich, H. M.; Forst, C. J Chromatogr 1990 525 1. (22) Pasikanti, K. K.; Ho, P. C.; Chan, E. C. Rapid Commun Mass Spectrom 2008 22 2984. (23) Bisogno, T.; Sepe, N.; De Petrocellis, L.; Mechoulam, R.; Di Marzo, V Biochem Biophys Res Commun 1997 239 473. (24) Folch, J.; Lees, M.; Sloane Stanley, G. H. J Biol Chem 1957 226 497. (25) Bligh, E. G.; Dyer, W. J. Can J Biochem Physiol 1959 37 911. (26) Walker, J. M.; Krey, J. F.; Chen, J. S.; Vefring, E.; Jahns en, J. A.; Bradshaw, H.; Huang, S. M. Prostaglandins Other Lipid Mediat 2005 77 35. (27) Hiley, C. R.; Hoi, P. M. Cardiovasc Drug Rev 2007 25 46.

PAGE 106

82 (28) Hamberger, A.; Stenhagen, G. Neurochem Res 2003 28 177. (29) Hanus, L. O.; Fales, H. M.; Spande, T. F.; Basile, A. S. Anal Biochem 1999 270 159. (30) Blunk, H. C.; Steinhart, H. Z Lebensm Unters Forsch 1990 190 123. (31) Saunders, R. D.; Horrocks, L. A. Anal Biochem 1984 143 71. (32) Janero, D. R.; Burghard t, C. J Chromatogr 1990 526 11. (33) Juaneda, P.; Rocquelin, G. Lipids 1985 20 40. (34) Hamilton, J. G.; Comai, K. J Lipid Res 1984 25 1142. (35) Hamilton, J. G.; Comai, K. Lipids 1988 23 1146. (36) Wang, S. T.; Peter, F. J Chromatogr 1983 276 249. (37) Bitman, J.; Wood, L.; Hamosh, M.; Hamosh, P.; Mehta, N. R. Am J Clin Nutr 1983 38 300. (38) White, T.; Bursten, S.; Federighi, D.; Lewis, R. A.; Nudelman, E. Anal Biochem 1998 258 109. (39) Poorthuis, B. J.; Yazaki, P. J.; Hostetler, K. Y. J Lipid Res 1976 17 433. (40) Entezami, A. A.; Venables, B. J.; Daugherty, K. E. J Chromatogr 1987 387 323. (41) Touchstone, J. C. J Chromatogr B Biomed Appl 1995 671 169. (42) Dreyfus, H.; Guerold, B.; Freysz, L.; Hicks, D. Anal Biochem 1997 249 67. (43) Lee, C. S.; Kim, Y. G.; Joo, H. S.; Kim, B. G. J Mass Spectrom 2004 39 514. (44) Ivleva, V. B.; Elkin, Y. N.; Budnik, B. A.; Moyer, S. C.; O'Connor, P. B.; Costello, C. E. Anal Chem 2004 76 6484. (45) Arafat, E. S.; Trimble, J. W.; And ersen, R. N.; Dass, C.; Desiderio, D. M. Life Sci 1989 45 1679. (46) Sultana, T.; Johnson, M. E. J Chromatogr A 2006 1101 278. (47) Bennett, M. J.; Powell, S.; Swartling, D. J.; Gibson, K. M. Clin Chem 1994 40 1879. (48) Black, D. A.; Clark, G. D. ; Haver, V. M.; Garbin, J. A.; Saxon, A. J. J Anal Toxicol 1994 18 185. (49) Tsukamoto, H.; Hishinuma, T.; Mikkaichi, T.; Nakamura, H.; Yamazaki, T.; Tomioka, Y.; Mizugaki, M. J Chromatogr B Analyt Technol Biomed Life Sci 2002 774 205. (50) Murphy, R C. In Mass Spectrometry of Lipids: Handbook of Lipids ; Snyder, F., Ed.; Plenum Press: New York, NY, 1993, p 189. (51) Park, S. J.; Park, C. W.; Kim, S. J.; Kim, J. K.; Kim, Y. R.; Park, K. A.; Kim, J. O.; Ha, Y. L. J Agric Food Chem 2002 50 989. (52) Sanchez Avila, N.; Mata Granados, J. M.; Ruiz Jimenez, J.; Luque de Castro, M. D. J Chromatogr A 2009 1216 6864. (53) Delmonte, P.; Kia, A. R.; Hu, Q.; Rader, J. I. J AOAC Int 2009 92 1310. (54) Goujard, L.; Figueroa, M. C.; Villeneuve, P. Biotechnol Lett 2004 26 1211. (55) Fong, C.; Wells, D.; Krodkiewska, I.; Hartley, P. G.; Drummond, C. J. Chemistry of Materials 2006 18 594. (56) Ritenour Rodgers, K. J.; Driscoll, W. J.; Merkler, K. A.; Merkler, D. J.; Mueller, G. P. Biochem Biophys Res Commun 2000 267 521. (57) Hutt, A. J. a. C., J. In Conjugation Reactions in Drug Metabolism ; Mulder, G. J., Ed.; Taylor & Francis, Ltd: London, 1990.

PAGE 107

83 (58) Killenberg, P. G.; Davidson, E. D.; Webster, L. T., Jr. Mol Pharmacol 1971 7 260. (59) Ga tley, S. J.; Sherratt, H. S. Biochem J 1977 166 39. (60) James, M. O.; Bend, J. R. Biochem J 1978 172 285. (61) Mawal, Y. R.; Qureshi, I. A. Biochem Mol Biol Int 1994 34 595. (62) Mawal, Y.; Paradis, K.; Qureshi, I. A. J Pediatr 1997 130 1003. (63) Lerner, R. A.; Siuzdak, G.; Prosperogarcia, O.; Henriksen, S. J.; Boger, D. L.; Cravatt, B. F. Proc. Natl. Acad. Sci. U. S. A. 1994 91 9505. (64) Cravatt, B. F., Lerner, R.A. and Boger, D.L. In J Am Chem Soc 1996; Vol. 118, p 580. (65) Boger, D. L .; Henriksen, S. J.; Cravatt, B. F. Curr Pharm Des 1998 4 303. (66) McDonald, G. R.; Hudson, A. L.; Dunn, S. M.; You, H.; Baker, G. B.; Whittal, R. M.; Martin, J. W.; Jha, A.; Edmondson, D. E.; Holt, A. Science 2008 322 917. (67) Ichiyama, S.; Kuriha ra, T.; Li, Y. F.; Kogure, Y.; Tsunasawa, S.; Esaki, N. J Biol Chem 2000 275 40804. (68) Engelhardt, B.; Sorokin, L. Semin Immunopathol 2009

PAGE 108

84 3 Metabolic Profiling of Primary Fatty Acid Amides in SCP and N 18 TG 2 cells 3.1 Review: Primary Fatty Acid Amides as S ignaling M olecules The first five primary fatty acid amides (PFAMs) to be isolated from a mammalian source were found 1989 in luteal phase plasma by Arafat et a l : palmitamide, palmitoleamide, oleamide, elaidamide and linoleamide. 5 At the time of their discovery, the biological function of the mammalian PFAMs was unknown. Several years later oleamide was discovered to accumulate in the CSF of sleep deprived cats and was misnamed cerebrodiene. 17 Soon after, oleamide was correctly identified in other studies where it was shown to accumulate in the CSF during sleep deprivation and induce physiological sleep and hypomotility in mammals 15,18 22 In addition, brain oleamide levels in the ground squirrel were found to be ~2.5 fold higher in hibernating animals relative to that found in non hibernating animals 23 Since these initial reports, more than 300 papers have been published about oleamide and other mammalian PFAMs The purpose of this review is to summarize what is known about the mammalian endogenous PFAMs, including both in vitro and in vivo studies An overview of PFAMs isolated from mammalian sources and endogenous amounts is given in Table 3 1

PAGE 109

85 Due to the early understanding o leamide has become the model PFAM and has been studied far more extensivel y than any of the other PFAMs. Oleamide has been found to modulate gap junction communication in glial cells 15,27 tracheal epithelial cells, 45 seminiferous tubule cells, 46 and fibroblasts, 47 modulat e memory processes, 30 increase food intake, 48 depress body temperature and locomotor Table 3 1 : Quantification and Location of Endogenous Mammalian PFAMs PFAM Organism Location in Organism Amount Ref Myristamide (C14:0) Human Meibomian secretion a Not reported 6 Palmitamide (C16:0) Human Meibomian secretion a Not reported 6 Plasma 13.8 nmol / ml 5 Rabbit Brain 11.4 25.6 nmol /g 13 Heart 5.7 6.8 nmol /g 13 Palmitoleamide ( C16:1 cis 9 ) Human Plasma 15.6 nmol /ml 5 Stearamide (C18:0) Human Meibomian secretion a Not reported 6 Plasma Not reported 25 Rabbit Brain 12.4 15.6 nmol /g 13 Heart 5.0 7.1 nmol /g 13 Elaidamide (C18:1 trans 9 ) Human Plasma 13.1 nmol /ml 5 Oleamide (C18:1 cis 9 ) Cat CSF 10 50 n mol/ m l 17,18 Human Plasma 5 Mouse N 18 TG 2 cells 55 n mol/10 10 cells 68,69 Rabbit Brain 82 99 nmol /g 13 Heart 16 26.6 nmol /g 13 Rat CSF 0.16 n mol /ml 71 Plasma 0.035 nmol /ml 71 Squirrel Brain 0.91 2.3 nmol /g 23 Linoleamide ( C18:2 cis,cis 9,12 ) Human Plasma 7.8 nmol /ml 5 Eicosenoamide ( C20:1 cis 13 ) Rabbit Brain Trace (<1.8nmol) 13 Erucamide ( C22:1 cis 13 ) Human Meibomian secretion a Not reported 6 Mouse Dorsal air sac Not reported 56 Pig Plasma 0.011 nmol /g 55 Lung 0.043 n mol /g 55 Kidney 0.0089 n mol /g 55 Liver 0.0036 n mol /g 55 Brain 0.0018 nmol /g 55 Rat Corneal micropocket Not reported 56 a The validity of this work is under debate. While the MS of meibomian secretions show several PFAMs in the Nichols paper, other commonly observed compounds, including cholesterol esters and wax esters, were not present. 7,72 In addition, other studies examining the lipid content of meibomian gland secretions did not find PFAMs. 73

PAGE 110

86 activity, 25,31,32,49 act as an analgesic, 49 reduce anxiety, 49 and stimulate Ca 2+ release 32 One of its most potent effects is as a vasorelaxant, with an EC 50 of 1.2 M. 50 The targets on which oleamide act have been found to include depressant drug receptors 35,37,49 and it has been found to act as an allosteric activator for serotonin (5 HT) receptor subtypes (5 HT 1A 5 HT 2A 5 HT 2C and 5 HT 7 ) 8,9,29,57,58 and for the GABA A receptor 34 36,49,59,60 In addition to these neurotransmitter type targets, oleamide has been shown to bind to CB 1 cannabinoid receptors directly, 61 indicating that its cannabinoid like actions may not be as was initially hypothesized 62 The entourage effect arises when one compound increases the effect of anot her compound by inhibiting its inactivation (in this case, as a competitor for degradation by FAAH hydrolysis or cellular uptake against other cannabinoids such as anandamide ). T he exact meaning of these data is under debate, as the concentrations required for cannabinoid binding may not be in the physiological range 43,63 Regardless of its role as an endogenous cannabinoid, oleamide does appear to have cannabinomimetic effects by increasing the amount of available anandamide through the entourage effect. 64,65 A n investigation showed that both oleamide and anandamide impaired memory in FAAH knockout mice, 51 indicating that oleamide act s independently of an effect on this enzyme. N O leoylglycine (NOG) was recently found to have oleamide like effects without affecting the amount of oleamide in blood plasma levels of rats. 66 T he amount of NOG required to produce a maximum hypothermic response was half the amount of oleamide required to produce the same response. In addition, oleamide induced vasorelaxation was not affected by the presence of FAAH inhibitors. 67 The implications of these findings are unclear A lthough oleamide has served as the model PFAM for analysis a s a CNS signaling molecule and much has been uncovered about its physiological action, it is not necessarily the most abundant n or the most metabolically active PFAM. Ma ny of the effects of other PFAM molecules have been found to be similar to those evoked by activation of the cannabinoid receptor systems, which include hypothermia, hypoactivity, analgesia, and catalepsy. 70 T he known function of PFAMs that have been isolated from

PAGE 111

87 mammalian sources to date is summarized in Table 3 2 many of whose function(s) have mainly been stu died in vitro A recent article by Nichols et al. indicate d the presence of several PFAMs from hu man meibomian grand secretions. 6 The validity of these findings is under debate While the MS of meibomian secretions show several PFAMs in the Nichols paper, other commonly observed compounds, including cholesterol este rs and wax esters, were not Table 3 2 : Occurrence and Role of PFAMs in Mammals Compound Structure Organism Known Significance Ref Myristamide (C14:0) Human Unknown 6 Palmitamide (C16:0) Human, Rabbit Mouse a Sheep a Unknown, modestly attenuates seizures in mice, modest FAAH inhibitor 5,6,11 13 Palmitoleamide ( C16:1 cis 9 ) Human Mouse a Sheep a Gap junction communication, serotonin receptor binding 5,10 Stearamide (C18:0) H uman, Rabbit Unknown 6 13,25 Elaidamide (C18:1 trans 9 ) Human Less active than oleamide, but induces sleep, inhibits epoxide hydrolase and phospholipase A 2 5,18,24, 26 O leamide (C18:1 cis 9 ) Human Mouse, Rabbit, Rat, Squirrel Sheep a Sleep, memory, thermal and locomotor regulation, gap junction communication, Ca 2+ flux, vasodilatation, hunger, anxiety, serotonin receptor binding, erg current inhibition 5,6,13,1 5,17,18, 21 23,25,27 52 Linoleamide ( C18:2 cis,cis 9,12 ) Human, Rabbit Mouse a Sheep a Sleep and Ca 2+ flux regulation, erg current inhibition, epoxide hydrolase and phospholipase A 2 inhibition, gap junction communication, FAAH substrate, serotonin receptor binding 1,10,13 15,20,24 ,26,53 Eicosenoamide ( C20:1 cis 13 ) Rabbit Unknown 13 Erucamide (C22:1 cis 13 ) Cat, Cow, Human, Rat, Pig, Mouse Fluid balance, angiogenesis 6,54 56 a Demonstrated in this study for N 18 TG 2 (mouse) or SCP (sheep) and not in previous studies.

PAGE 112

88 present. 72 In addition, other studies examining the lipid content of meibomian gland secretions did not find PFAMs. 73 Although oleamide erucamide and stearamide are known slip additive s 74 added to lubricate plastics during manufacturing, the other PFAMs found in this study have not been reported as plasticizers one of whi ch is myristamide (C14:0) 6 This is the first report of myristamide from a mammalian source and its function, other than its potential to promote tear film stability and in maintaining a smooth refractive surface of the eye in meibomian secretions is completely unknown I t does show some antibacterial properties 75 and has been demonstrated as a substrate for fatty acid amide hydrolase (FAAH) in vitro 2,14 Palmitamide (C16:0) was also reported in human meibomian gland secretions, 6 but other studies confirm its presence as a mammalian PFAM in human leutal phase plasma in ten of sixteen female subjects 5 and in rabbit brain and heart 13 (see Table 3 1 ). Again, these are the only reports of palmitamide in mammals and its role is mostly speculative S tud ies showed that p almitamide is a modest inhibitor of Fatty Acid Amide Hydrolase (FAAH) in vitro 2,7,12 and modestly attenuates seizures in mice 11 but more work is necessary to explore its potential role as a mammalian signaling molecule. Palmitoleamide ( C16:1 cis 9 ) has only been repo rted in one study as an endogenous compound and its in vivo role remains mostly unexplored. 5 An in vitro study showed that pa lmitoleamide is able to block gap junction communication in mouse glial cells as well as oleamide does 15 and can potentiate the 5 HT 1A serotonin receptor after incubation with serotonin almost as well as can oleamide 10 ( Table 3 3 ). These roles are not surprising given the known function of oleamide in binding to 5 HT receptors and in blocking gap juncti on communication. Oleamide and palmitoleamide differ by only two carbons in acyl chain length, and further studies may demonstrate addi tional similarities in function. Elaidamide ( C18 :1 trans 9 ) while only different from oleamide as a trans isomer at the double bond, does not have as much biological activity as oleamide Because of its close structural relationship to oleamide, it has been used in many studies to demonstrate specificity of receptors and enzymes for the cis isomer oleamide and an overv iew of oleamide activity as compared to other PFAMs (where numerical values were available)

PAGE 113

89 is given in Table 3 3 Elaidamide does not attenuate gap junction communica tion in mouse glial cells as oleamide does, 15,27 and elaidamide does not serve as an effective binder for 5 HT 1A or 5 HT 7 receptor s as palmitoleamide (5 HT 1A only), linoleamide, and oleamide do 8 10 Elaidamide does not modulate GABA evoked current and is unable to modulate voltage gated Na + channels as oleamide does. 35 T wo enzymatic studies have shown function for elaidamide : it was found to be a potent inhibitor of both human and rat microsomal epoxide hydrolase through s imultaneous competitive and noncompetitive inhibition 24 and it is also an excellent inhibitor of phospholipase A 2 26 Cravatt et.al showed that elaidamide can induce sleep, but only half as long as was observed for oleamide (1 hour as opposed to 2 for a 10 mg dose in rat) 18 even though elaidamide was not found to be an agonist for CB 1 receptors transfected into HEK 293T cells. 76 This action may be due to binding to GABA receptor(s). Elaidamide was found t o inhibit binding to a voltage gated Na + channel of an agonist, but not nearly effectively as was oleamide. 37 Similar ly, elaidamide was found to inhibit repetitive firing of rat embryonic cultured cortical pyramidal cells, but oleamide was 3 times as effective at doing so. 35 E laidamide is biologically active but not nearly to the extent as is its cis isomer Given the fact that the trans fatty acids are not naturally found except in some dairy products and in the meat of ruminan ts, 77 the lowered biological activity of elaidamide is concomitant with the fact that the enzymes evolved alongside the cis iso mer almost exclusively. There has been only one report of elaidamide as an endogenous mammalian PFAM, 5 and it is likely to h ave come from a dietary source.

PAGE 114

90 Stearamide (octadecanamide C18:0 ) has been found in human blood plasma 25 and in rabbit brain and heart 13 but no true in vivo bioactivity has yet been identified; it has mostly been studied in tandem with oleamide to compare the alk yl chain with its unsaturated bioactive cousin much the way elaidamide has been studied as a trans isomer Table 3 3 : Relative Activity of PFAMs on Various Targets Target Oleamide (C18:1 cis 9 ) Elaidamide (C18:1 trans 9 ) Stearamide (C18:0) Linoleamide (C18:2 cis,cis 9,12 ) Myristamide (C14:0) Palmitamide (C16:0) Palmitoleamide (C16:1 cis 9 ) Eicosenoamide (C20:1 cis 13 ) Erucamide (C22:1 cis 13 ) Ref 5 HT potentiation 5 HT 7 1 0.86 0.91 8 5 HT 2C 1 6.67 17.3 9 5 HT 1A 1 0.2 0.32 0.96 0.88 10 5 HT 2A 1 0 0 0.44 0.16 0.32 0.16 10 erg inhibition 1 1 24 FAAH activity 1 c 1.54 1 1 d 0.33 0.14 2 1 e 0.93 0.47 7 GABAA potentiation 1 0 35 Gap junction inhibition a 1 0 0 1 1 0 0 15 mEH inhibition 1 0.98 0.063 1.56 24 PLA2 inhibition b 1 0.5 0.5 26 Sleep induction (time of sleep) 1 0.5 18 SRF inhibition 1 0.33 35 Relative activity. Activity values for oleamide are set to 1 and activities of other compound s displayed as relative to oleamide activity. Negat ive values are for negative potentiation (receptor inhibition). Abbreviations: 5 HT, 5 hydroxytryptamine; erg ether go go related gene; mEH, microsomal epoxide hydrolase; PLA 2 phospholipase A 2 ; SRF, sustained repetitive firing (subsequent to a primary action potential) of pyramidal cells. a Values shown are for study with 50 M PFAM. 20 and 100 M studies were also done. 15 b Values shown are for porcine pancreatic PLA 2 26 c from mouse N 18 TG 2 cells d rat recombinant e human recombinant

PAGE 115

91 of oleamide Stearamide is not as active as oleamide on 5 HT receptors, 10 and even shows the opposite effect on 5 HT 2C receptors to decrease rather than increase the efficacy of receptor activation 9 ( Table 3 3 ). It also does not attenuate gap junction communication in mouse glial cells 15,27 and is 15 times less effective than oleamide as a microsomal epoxide hydrolase inhibitor. 24,78 Stearamide did not produce a decrease in core body temperature after intraperitoneal admin i stration to rats as did oleamide and N oleoylglycine. 66 The activity of stearamide relative to other PFAMs is also included in Table 3 3 Elaidamide is mildly biologically active, but stearamide even less so. Aside from oleamide, linoleamide ( C1 8 : 2 cis ,cis 9 ,12 ) is the most studied endogenous PFAM, and is found to have many of the same activities as oleamide ( Table 3 3 ) It inhibits microsomal epoxide hydrolase as well as oleamide does 24 and inhibits gap junction communication in glial cells almost as well as does oleamide. 15 Linoleamide was found to induce calcium release from the endoplasmic reticulum of renal tubular cells. 20 Both oleamide and linoleamide were found to block the erg ( ether go go related gene) current equally well in rat pituitary cells. 53 Linoleamide is an excellent competitive inhibi tor for phospholipase A 2 as is oleamide, 26 but linoleamide is a be tter inhibitor and substrate for FAAH than is oleamide. 1,14 It was found to potentiate the 5 HT 1A receptor nearly as well as oleamide, but for the 5 HT 2A receptor it demonstrated only 44% of 10 It is interesting that one fewer double bond (stearamide) results in very little biological function, while one greater double bond (linoleamide) does not result in significant change in biological function compared to that of oleamide. The least well known of the endogenously isolated PFAMs is eicose n oamide (C20:1 cis 1 3 ), which was observed in trace amounts in rabbit brain. 13 Eicosenoamide has shown some potentiation of 5 HT receptors, 8,10 but i t does not inhibit gap junction communication by glial cells. 15 Interestingly, the 11 isomer is an excellent inhibitor. Erucamide (C22:1 cis 13 ) does not have a significant effect on the binding affinity of 5 HT 7 receptors to 5 hydroxytryptamine 8 and does not inhibit gap junction communication as oleamide does. 15 It does, however, have its own biological function and has been found in many places 55,56 ( Table 3 1 ), including porcine blood plasma,

PAGE 116

92 where it was found to regulate fluid volumes in various organs. 55 The major bovine mesentery angiogenic lipi d was identified as erucamide, and 2 g was found to induce angiogenesis. 56 Mitchell et al showed that a sustained release of erucamide from a polymer matrix has a dose dependent angiogenic effect on skeletal muscle regeneration afte r an injury 54 and it is speculated that this control of water content combined with repair of circulation may have a synergistic effec t on the regenerative process. 55 Although many PFAMs have been known for two decades, little is known about their action in vivo except for oleamide. What is known, however, points to an interesting role fo r these molecules in signaling and demonstrates that PFAMs can belong to this class of bioactive molecules known as lipid messengers. The biosynthetic and catabolic mechanisms of these long chain PFAMs are discussed briefly in Chapter 1 and at length in Chapter 4. It has already been shown that N 18 TG 2 cells contain oleamide 69 and convert oleic acid to oleamide 68,69 results which were confirmed and expanded by quantifying over a time course in Chapter 2. These kinds of studies on PFAM metabolism have not been expanded to any of the other acyl groups beyond (18:1 cis 9 ) Since some of these PFAMs have been found in mammalian sources, it is likely that endogenous amounts of PFAMs other than oleamide could be found in N 18 TG 2 cells There are many additional questions that might be answered through studi es of other PFAMs : are other FFAs converted to their corresponding amides? Can non natural FFAs b e converted to their amides? Do the cells secrete other PFAMs? Do the cell s convert certain FFAs more quickly or in more abundance than others, and is there a recognizable trend in chain length degree of unsaturation or cis/trans isomers ? Does the fingerprint of PFAM formation follow the enzyme substrate kinetics of the proposed biosynthetic and hydrolyzing enzymes? Are the related compounds, N acylethanolamines (NAEs) converted to PFAMs? Is there a difference in any of these trends in different cell lines? In addition to N 18 TG 2 cells, which are known to contain all the enzymatic machinery to convert oleic acid directly to oleamide, 68,69 ,Chapter 2 the sheep choroid plexus (SCP) cells were chosen. SCP cells had approximately 45 times more endogenous oleamide than was found in th e other two cell lines, N 18 TG 2 and HEK 293. In addition,

PAGE 117

93 after incubation with oleic acid, SCP cells still had at least 10 times as much oleamide as the other two cell lines. In this study, we examine d the metabolism of a panel of fatty acids to their res pective PFAMs in N 18 TG 2 and SCP cells. The FFAs chosen correspond to endogenously found PFAMs: palmitic acid (PA), palmitoleic acid (POA ) elaidic acid (EA), and linoleic acid (LOA). Data from the oleic acid (OA) incubations presented in Chapter 2 is includ ed he rein for discussion purposes In addition, two non natural PFAM precursors were studied: tridecanoic acid (TDA) and tridecanoylethanolamine (TDEA) (see Section 3.2 ) Some PFAMs, particularly oleamide and erucamide, have been found as slip additives in polyethylenes 74,79,80 plasticizers whose presence has brought under debate the finding of PFAMs in m eibomian secretions 72 A recent article demonstrated the extraction of erucamide from pipette tips by DMSO 79 This must be taken into consideration when reviewing older literature and when preparing to perform PFAM extracts. Car e has been taken to test for the presence of these slip additives in this study (see Section Error! Reference source not found. ). 3.2 Formation of PFAM s from T wo D istinct P athways: FFA and NAE The formation of PFAMs from an N acylglycine (NAG) through the action of amidating monooxygenase (PAM) has been studied in vitro with kinetic constants comparable to peptide precursor substrates. 4,81 In addition, chemical inhibition of PAM by trans 4 phenyl 3 butenoic acid in N 18 TG 2 cell cultur e resulted in the accumulation of N oleoylglycine when these cells were grown in the presence of oleic acid 68 (see also Chapter 5). The formation of the NAGs, however, is much more controversial. There have been two main pathways proposed, as seen in Figure 3 1 More details on the biosynthetic mechanism(s) including an in depth discussion of potential enzymes, are discussed in Chapter 4.

PAGE 118

94 Activation of a fatty acid through the formation of a coenzyme A (CoA) intermediate is one obvious and much hypothesized possibility for acyl chain activaction before glycination 4,68,81,82 There are several acyl CoA synthetases k nown to perform this fundamental metabolic chemistry, 83,84 and several candidates to perform glycination of an acyl CoA, including acyl CoA:gly cine N acyltransferase 85,86 bile acid CoA:amino acid N acyltransferase, 87 and cytochrome c. 88,89 The glycination pathway is shown in purple in Figure 3 1 Figure 3 1 : Formation of NAG and PFAM by Two Metabolic Pathways The purple arrow s show one pathway w ith successive CoA ylation and g lycination of the FFA ; The brown arrow s show successive oxidation of an NAE to form the NAG The NAG is converted to a PFAM by PAM The two pathways are joined by the action FAAH, which is able convert the NAE into a FFA. More details, including a discussion of potentia l metabolic enzymes, are in Chapter 4. Abbreviations: FFA, free fatty acid; FAAH, fatty acid amide hydrolase; NAE, N acylethanolamine; NAG, N amidating monooxygenase; PFAM, primary fatty acid amide

PAGE 119

95 Sequential oxidation of an N acylethanolamine (NAE) is another hypothesized mechanism for NAG biosynthesis, and is indicated in brown in Figure 3 1 In cellulo work has demonstrated the oxidation of NAEs to NAGs in RAW 264.7, C6 glioma and Chang liver cells 90,91 Ivkovic et al. showed that an a lcohol dehydrogenase, ADH3, is capable of oxidizing an NAE to its acylglycinal, 92 which could then be oxidized to the NAG by an aldehyde dehydrogenase, and Aneetha et al. showed that ADH7 is capable of oxidizing an NAE fully to a NAG in vitro 93 See Chapter 4 for more information on NAE oxidation to NAGs. These pathways are not mutually exclusive; Bradshaw et al. showed that an NAE could be converted to its corresponding NAG either through successive oxidation or through a glycine conjugation (both purple and brown pathways, Figure 3 1 ) in one cell line 90 In this study, we examined the metabolism o f two exogenous acyl compounds, TDEA and TDA, to compare the rates of conversion to tridecanamide in both the SCP and N 18 TG 2 cells and gain some kinetic insight into the competing metabolisms in these two cell lines 3.3 Materials and Methods 3.3.1 Materials Elaidic and palmitoleic acids were from Fisher (Pittsburgh, PA) Linoleic and palmitic ac ids, 6 thioguanine and fatty acid free BSA were from Sigma (St. Louis, MO) FBS was from Atlanta Biologicals (Lawrenceville, GA) Penicillin/streptomycin, EMEM and DMEM were from Mediatech Cellgro (Manassas, VA) BSTFA and silica were from Supelco (St. Louis, MO) Mouse neuroblastoma N 18 TG 2 cells were from DSMZ (Deutsche Sammlung von Mikrooganism und Zellkuturen GmBH). SCP cells were from A merican T ype C ulture C ollection ( Manassas, VA) Heptadecanoic acid, D 33 was from C / D / N isotopes (Pointe Clair e, Quebec)

PAGE 120

96 3.3.2 Standard Synthesis 3.3.2.1 Acyl Chloride S ynthesis The free fatty acid (FFA) and thionyl chloride were combined neat in a 1:2 molar ratio under nitrogen while stirring ( Equation 3 1 ). The reaction was allowed to proceed under reflux at 50 o C for 30 minutes. Excess unreacted thionyl chloride was removed by heating or under vacuum until the solution no longer produced gas. 3.3.2.2 PFAM S ynthesis For use as a standard, a series of PFAMs were synthesized. Commercial ly available a cyl chlorides were used or, where not available, synthesized as above. T he PFAM was prepared similar to Fong et. al 94 The undistilled acy l chloride was added dropwise to ice cold concentrated NH 4 OH (29% NH 3 ) while stirring and in a ratio of 2.5 ml acyl chloride:15 ml NH 4 OH (se e Equation 3 2 ). Precipitation was allowed to go to completion. Excess NH 4 OH was removed by filtering with cold water. The sample was allowed to dry and stored at 20 o C flushed under nitrogen. For GC MS of synthesized PFAMs, see Appendix B Equation 3 2 : Synthesis of PFAM from Acyl Chloride Equation 3 1 : Synthesis of Acyl Chloride from a Fatty Acid

PAGE 121

97 3.3.2.3 TDEA Synthesis Tridecanoyl chloride was synthesized as in Section 3.3.2.1 The N tridecanoylethanolamine (TDEA) was synthesiz ed as shown in Equation 3 3 as follows: triethylamine base, acetonitrile, and ethanolamine were combined in a 1.5:1:1 ratio (vol) flushed under nitrogen, and left stirring under nitrogen at room temperature. The acyl c hloride taken up in a small volume of acetonitrile and added dropwise to the ethanolamine mixture and left to stir overnight at room temperature. The N acylethanolamine reaction was taken to a yellow solid in vacuuo dissolved in a small volume warm ethan ol, an d recrystalized by adding cold H 2 O. The crystallization was allowed to continue on ice for approximately 30 min, then the solid was filtered in Buchner fu nnel and washed with ice cold H 2 O The product was allowed to dry, flushed with nitrogen and sto red at 20 o C. For a GC MS of the synthesized TDEA, see Appendix B. 3.3.3 Fatty Acid BSA M ixture Fatty acids were dissolved in ethanol and saponified with excess NaOH (~2x molar concentration) dried under vacuum and dissolved in phosphate buffered saline ( PBS ) to make a 25 mM solution. Sample was then heated in 49 o C water bath for 5 minutes before adding 2.5 mM BSA. Sample was stirred at room temperature for 4 hours, sterile filtered, and stored at 20 o C. The fatty acids that were used are listed in BSA forms globules above 50 0 C that make the solution impossible to sterile filter through a 0.22 m filter Equation 3 3 : Synthesis of 3 13 C, 15 N Oleoylethanolamine

PAGE 122

98 Table 3 4 An N acylethanolamine, tridecanoylethanolamine (TDEA) solution was made similarly, but an additional sonication step was added prior to additi on of BSA. 3.3.4 Cell Culture and Fatty Acid Incubation All cells were grown in 225 cm 2 culture dishes. N 18 TG 2 cells were grown in DMEM supplemented with 100 M 6 thioguanine. SCP cells were grown in EMEM supplemented with 100 M sodium pyruvate Both cell types were gown with 100 I.U./ ml penicillin, 1.0mg/ ml streptomycin and 10% FBS at 37 o C and 5% CO 2 Cultures w ere g r own to 75 90% confluency, culture medium removed and cells washed with PBS. After washing, the culture medium was replaced with media containing 0.5% FBS and 10% fatty acid BSA mixture for a final concentration of 2.5 mM fatty acid in 0.25 mM BSA Three T 225 cm 2 flasks were used for each time point, for a total of 12 flasks for each experiment. After 0, 12, 24, or 48 hour incubation, media was collected, cells washed with PBS and trypsonized. An aliquot was taken for counting on a hemacytometer with trypan blue. Cells were centrifuged and the pellet and conditioned media stored at 80 o C. Zero hour samples were collected without addition of fatty acid B SA mixture or 0.5% FBS media but collected in 10% FBS media under normal grow ing conditions. These cells and the conditioned media were also stored at 80 o C. Several controls were run with incubation for 48 hours in media containing 0.5% FBS and 0.25 mM BSA (see section Error! Reference source not found. ). Table 3 4 : Fatty Acids Used for Incubation Fatty Acid Tridecanoic Acid (TDA) C13:0 Palmitic Acid (PA) C16:0 Palmitoleic Acid (POA) C16:1 ( cis 9 ) Linoleic Acid (LOA) C18:2 ( cis,cis 9,12 ) Oleic Acid (OA) C18:1 ( cis 9 ) Elaidic Acid (EA) C18:1 ( trans 9 )

PAGE 123

99 3.3.5 Metabolite Extraction Metabolites were extracted from cells similar to Sultana and Johnson (2006) 95 4 ml methanol was added to cell pellets and samples were sonicated for 15 minutes at room temperature. Samples were centrifuged at 5000 rpm for 10 min, and the supernatant separated from the pellet, dried under N 2 in a warm water bath a t 40 50 o C. The pellet was re extracted with 4 m l 1:1:0.1 (v/v/v) chloroform:methanol:water, sonicated for 10 min, vortexed 2 min and centrifuged 10 min at 5000 rpm. Supernatant from this step was added to the dried supernatant from the previous step and dr ied under N 2 at 40 50 o C. The pellet was re extracted with 4.8 m l chloroform:methanol 2:1 (v/v) and 800 l 0.5 M KCl/0.08 M H 3 PO 4 sonicated 2 min, vortexed 2 min, and centrifuged 10 min at 5000 rpm. The lower lipid phase was added to the dried supernatant from the previous steps and dried under N 2 at 40 50 o C. Metabolite extraction from conditioned media was similar. After spinning down to remove any cells, the entire volume of media collected from three flasks (~135 ml) was subjected to solvent extraction. The first two extractions were with 15 ml chloroform:methanol 2:1 and the second two extractions with 15 ml chloroform:methanol 2:1 and 2.4 ml 0.5 M KCl/0.08 M H 3 PO 4 No sonication was performed, and protein layers were condensed by centrifugation for 30 45 min at 10, 000 rpm. Organic lipid phases were also combined and dried under N 2 at 40 50 o C or in vacuuo 3.3.6 Solid Phase Extraction Silica columns (0.5 g) were washed with n hexane and run essentially as described by Sultana and Johnson 95 L ipid extract s were taken up in 100 L n hexane and added to washed silica columns The mobile phase was r un without positive pressure as follows: 4 ml n hexane, 1 ml 99:1 hexane:acetic acid, 1 ml 90:10 hexane:ethyl acetate, 1 ml 80:20 hexane:ethyl acetate, 1 ml 70:30 hexane:ethyl acetate, 1.5 ml 2:1 chloroform:isopropanol, 0.5 ml methanol. The last two fractions were combined and dried down under N 2 at 40 50 o C A n internal standard, heptadecanoic acid D 33 (3 nmol) was added and dried before derivitization.

PAGE 124

100 3.3.7 Sample D erivitization Trimethylsilylation was achieved using 100L BSTFA (N,O bis(trimethylsilyl)trifluoroacetamide). Samples were flushed with dry N 2 BSTFA added, flushed briefly again, and allowed to react at 55 60 o C for 1 hour before running on GC MS. 3.3.8 GC MS All separations were performed using a Shimadzu QP 5000 GC MS. Separations were achieved on a J & W Scientific (Folsom, CA) DB 5 column (0.25 mm x 30 m) in splitless mode The GC temperature program was 55 150 o C at 40 o C/min, hold at 150 o C for 3.6 min, ramp at 10 o C/min to 300 o C, and hold for 1 min. The transfer line was held at 280 o C and the injection port at 250 o C throughout the separation. Hel ium was used as the carrier gas, at a flow rate of 0.9 ml /min. The mass range was 35 450 amu with a scan speed of 2000. The solvent cut time was set to 7 min. Samples were injected twice; 33.3% of the sample volume, followed by 50% of the remaining sampl e volume, such that 1 nmol internal sample was in each sample run. After running a set of experimental sample s through the GC MS (0, 12, 24 and 48 hours, each injected twice) one of the 24 or 48 hour samples was dried down, spiked with the PFAM of interest re dried down, re derivitized with BSTFA, and re run on the GC MS to validate sample retention times Figure 3 2 shows an overlay of an experimental and a s piked sample.

PAGE 125

101 3.3.9 Controls Solvents were run through all the same glassware and plasticware as cell and media samples and were subjected to sonication, solid phase extraction, and derivitization to test for contaminating plasticizers. 74 Integration of the GC trace was taken over the same time integral as standard amides and for the same set of ions ( Table 3 5 ) An averaged number of cells was used to calculate blank amount of amide per cell in the blank samples (see equation below) Unspent media was also subjected to extraction to check for existing amides. / = amide extracted from cel ls ( amide in blank ) # cells In addition to unspent media and glass/plasticware, conditioned media and unspent media were incubated with various metabolites and tested to see if PFAMs accumulated over time without any cells present Unspent media was incubated with either OA, NOG or NOE at 37 o C for 48h. After incubation with N 18 TG 2 cells for 48h (sans metabolites), conditioned media was sterile filtered with a 0.45 m filter to remove Figure 3 2 : GC of experimental and spiked samples Panel A shows the GC over the entire time range for both the unspiked (black) and tridecanamide spiked (pink) sample. Panel B shows a TIC c loseup of tridedcanamide TMS. Panel C shows the same spectrum as B but with the experimental sample spiked with 5nmol tridecanamide overlaid in pink

PAGE 126

102 any cells. The conditioned media was then incubated with OA, NOG or NOE in BSA at 37 o C for an additional 48h. Extraction for PFAM analysis was carried out as normal. Finally, to test for the change in oleamide production over time without the presence of any metabolites (FFAs, NAEs or NAGs) SCP and N 18 TG 2 cells were incub ated for 48h with media containing 0.5% FBS and 0.25 mM BSA but no long chain fatty acyl metabolite Cells and conditioned media were both collected and subjected to PFAM analysis as normal (Sections 3.3.5 3.3.8 ) 3.3.10 Data Analysis Total ion chromatograms (TIC) were taken to more clearly determine the identities of species presen t in the sample. Post run, a set of selected ions unique to the amides and nitriles under examination was overlaid and integrated so that effects of any co eluting compounds could be minimized. These unique ion sets are based on electron impact (EI) fragme ntation of the PFAMs and nitriles and can be found in Table 3 5 Fragmentations for nitriles ( Figure 3 3 ) and PFAM TMS ( Figure 3 4 ) are also given below.

PAGE 127

103 Table 3 5 : Selected ions for Integration of Amides and Nitriles Compound Retention Time (min) Heptadecanoic Adic, D 33 (HdA) 119, 135, 149, 360, 375 15.1 Tridecanonitrile 82, 97, 110, 124, 138, 147, 152, 166, 170, 188, 192, 195 9 Tridecanamide 93, 100, 128, 131, 158, 170, 186, 200, 213, 270, 285 13.4 Palmitoleonitrile 122, 136, 150, 164, 178, 192, 206, 235 12.66 Palmitoleamide 59, 116, 128, 131, 144, 184, 198, 200, 240, 253, 310, 325 16.07 Palmitonitrile a 69, 110, 124, 138, 152, 166, 180, 194, 208, 237 12.9 Linoleonitrile b 95, 109, 120, 134, 148, 162, 176, 261 14.8 Linoleamide 59, 67, 81, 91, 95, 109, 116, 119, 121, 128, 131, 135, 144, 147, 149, 336, 352, 279 15.98 Oleo/elaido nitrile 83, 97, 110, 122, 136, 150, 164, 190, 206, 220, 234, 263 14.9 Ole/elaid amide 59, 86, 112, 116, 122, 126, 128, 131, 136, 140, 144, 154, 158, 170, 184, 186, 198, 200, 226, 238, 264, 281, 338, 353 16.05 The retention times listed here for each PFAM is the for the TMS derivative as opp osed to the underivitized amide These retention times were all accurate for the GC MS through February 2009, at which point some major repairs were done to the machine. After the repairs, all retention times were shifted about 2 minutes earlier. a Palmitam ide TMS was not integrated due to the coelution of large amounts of oleic acid TMS and octadecanoic acid TMS that interfered with even the selected ion integration. Amounts of palmitamide were determined based on the palmitonitrile only, using standard cur ves of palmitonitrile only b Linoleamide TMS was not integrated for a similar reason as for palmitamide TMS, and only linoleonitrile was integrated, using standard curves of linoleonitrile only.

PAGE 128

104 Figure 3 3 : Fragmentation Patterns for Long Chain Acyl Nitriles Shown here are some of the most common fragments for electron impact ionization of the long chain acylnitriles that result from derivitization of a long chain PFAM with BSTFA. Not all the fragments from Table 3 5 are shown here.

PAGE 129

105 Figure 3 4 : Fragmentation Patterns of PFAM TMS Compounds Shown here are some of the most common fragments for electron impact ionization of PFAM TMS compounds. Not all the fragments from Table 3 5 are shown here.

PAGE 130

106 Integration of samples was based on the summation of their selected ion chromatograms to reduce interference from any co eluting contaminants. Figure 3 5 shows how this analysis was performed. The examination of a specific multiple ion chromatogram (MIC) composed of a set of selected ions allows the accurate integration of compounds even with the presence of coeluting substances, and has literature prece dence. 95 There is a certain danger that isotopic peaks of coeluting compounds may contribute to the integration of the compound of interest, which is why care is taken to run blanks for all cell and media samples, both as solvents unexposed to any cell or media and media exposed to no cells. Figure 3 5 : MIC Analysis of a GC Peak GC spectrum of tridecanamide TMS in SCP cells. Panel A shows the TIC. Panel B shows the m/z 131 overlaid in pink on the TIC. Panel C shows the selected characteristic m/z ions for tridecanamide TMS overlaid in colors over the TIC (black). Panel D shows the M IC, the summation of the individual selected ions. The horizontal red line indicates the integrated area. The y axis is relative intensity and all graphs are plotted on the same scale. Note that in panel D the background peaks have diminished.

PAGE 131

107 Heptadecanoic Acid, D 33 (HdA), was added to each sample as an internal standard to test the performance of the instrument The amides and nitriles of interest were integrated along with the HdA, both compared to their standard curves, and a correction factor determined based on the integration of HdA compared to its standard curve was used to adjust the amount of amide. Once the area under an amide peak was used to determine the number of nmol PFAM it was divided by the number of cells worth of extract injected (i.e. if 1/3 of the sample was injected, the nmol amide was divided by 1/3 the total number of cells counted for th at sample). For media samples, the nmol amide was divided by the cell count from the cell sample taken from the same flasks rather than dividing by volume of media, so that the amount of amide secreted per cell could be estimated. Each extraction sample w as run on the GC MS twice, and each incubation run at least twice to provide replicates. T tests were run using GraphPad. 3.4 Results 3.4.1 GC MS of FFA I ncubated C ells and M edia All FFAs in both cell lines were found to be converted to the corresponding PFAM For brevity, only a panel of GC MS from cells incubated with linoleic acid is shown in this chapter ( Figure 3 6 through Figure 3 9 ) with one representative time point for each sample. GC MS for cells and conditioned media after incubation with each FFA and TDEA can be found in Appendix C Due to a large amount of interfering background in the range of 17.5 20 minutes in the conditioned media containing linoleic acid the amount of amide was calculated using the nitrile only, plotted against a standard curve of linoleonitrile from the lino leamide derivitization reaction. Similarly, oleic acid and octadecanoic acid co eluted with palmitamide TMS, so only palmitonitrile was integrated and compared to a standard curve of palmitonitrile only.

PAGE 132

108 Figure 3 6 : GC MS of N 18 TG 2 Incubated with LOA for 12 Hours Showing Linoleonitrile GC MS of N 18 TG 2 cell extract after incubation with L OA for 12 h ours, showing linoleonitrile. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (linoleonitrile) Panel C shows the library database MS for linoleonitrile Panel D shows the difference between panels B and C. The cells were e xtracted as described in the methods section. The cells had been incubated with 2.5 mM L OA in 0.25 mM BSA for 12 hours in this case before extraction

PAGE 133

109 Figure 3 7 : GC MS of N 18 TG 2 Conditioned Media Incubated with LOA for 48 Hours Showing Linoleonitrile GC MS of N 18 TG 2 media extract after incubation with L OA for 48 h ours, showing linoleonitrile. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (linoleonitrile) Panel C shows the library database MS for linoleonitrile Panel D shows the difference between pan els B and C. The cells were extracted as described in the methods section. The cells had been incubated with 2.5mM L OA in 0.25mM BSA for 48 hours in this case before extraction.

PAGE 134

110 Figure 3 8 : GC MS of SCP Cells Incubated with LOA for 48 Hours Showing Linoleamide TMS GC MS of SCP cell extract after incubation with L OA for 48 h ours, showing linoleamide TMS. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (linoleamide TMS) Panel C shows the library database MS for linoleamide TMS Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section. The cells had been incubated with 2.5 mM L OA in 0.25 mM BSA for 48 hours in this case before extraction.

PAGE 135

111 3.4.2 Quantitative Analysis of PFAMs in N 18 TG 2 C ells Each PFAM, including the non natural tridecanamide, was found in both N 18 TG 2 cells and conditioned media. In most cases, the amount of PFAM found in the conditioned media was very similar to the amount of PFAM found in the cells themselves ( Figure 3 10 ). Figure 3 9 : GC MS of SCP Conditioned Media Incubated with LOA for 48 Hours Showing Linoleamide TMS GC MS of SCP media extract after incubation with L OA for 48 h ours, showing linoleamide TMS. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (linoleamide TMS) Panel C shows the library database MS for linoleamide TMS Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section. The cells had been incubated with 2.5 mM L OA in 0.25 mM BSA for 48 hours in this case before extraction.

PAGE 136

112 Figure 3 10 : Quantifica tion of PFAMs isolated from N 18 TG 2 cells and media Continued on the next page. 0.E+00 5.E+02 1.E+03 2.E+03 2.E+03 0h 12h 24h 48h pmol amide per 10 7 cells TDA 0.E+00 5.E+02 1.E+03 2.E+03 2.E+03 0h 12h 24h 48h pmol amide per 10 7 cells TDEA 0.E+00 5.E+03 1.E+04 2.E+04 2.E+04 0h 12h 24h 48h pmol amide per 10 7 cells POA 0.E+00 2.E+04 4.E+04 6.E+04 8.E+04 1.E+05 1.E+05 0h 12h 24h 48h pmol amide per 10 7 cells PA

PAGE 137

11 3 Blanks showed little interference of PFAMs in unspent media and of slip additives in polyethylene N 18 TG 2 m edia blanks were approximately 1 22% of experimental amounts found in conditioned media except for linoleamide, which was Figure 3 10 : Quantifica tion of PFAMs isolated from N 18 TG 2 cells and media In each graph cells are shown in blue, media in green unspent media in pink and solvent blank in orange (left to right) Samples were incubated for 0, 12, 24 or 48 h ours with corresponding fatty acid BSA mixture. Error bars are standard deviation. 0.E+00 5.E+02 1.E+03 2.E+03 2.E+03 3.E+03 3.E+03 0h 12h 24h 48h pmol amide per 10 7 cells OA 0.E+00 2.E+03 4.E+03 6.E+03 8.E+03 1.E+04 1.E+04 1.E+04 0h 12h 24h 48h pmol amide per 10 7 cells EA 0.E+00 5.E+02 1.E+03 2.E+03 2.E+03 0h 12h 24h 48h pmol amide per 10 7 cells LOA

PAGE 138

114 44%. Solvent blanks were even lower: between 0.5 8% of cell sample amounts, except for background interfere nce in the region of tride can ami d e which gave background levels of 17 18% of experimental levels. Figure 3 12 : Primary F atty A cid A mides P roduced in N 18 TG 2 C ells I ncubated with V arious F atty A cids Comparison of PFAMs found in N 18 TG 2 cells after incubation with various FFAs and one NAE. Only cell data are shown here. Media data are available in Table 3 6 and Figure 3 10 0 5,000 10,000 15,000 20,000 25,000 30,000 0h 12h 24h 48h pmol amide per 10 7 cells tridecanamide, from tridecanoylethanolamine tridecanamide, from tridecanoic acid linoleamide oleamide elaidamide palmitoleamide palmitamide Figure 3 11 : Endogenous PFAMs in N 18 TG 2 Cells The amount of PFAMs found in normally growing N 18 TG 2 cells without incubation with a FFA is shown here. Error bars are standar d deviation 360 940 112 119 0 200 400 600 800 1000 1200 pmol per 10 7 cells palmitoleamide palmitamide linoleamide oleamide

PAGE 139

115 Endogenous amides are quantified in Figure 3 11 and the amounts of amides found in N 18 TG 2 cells and conditioned media after 0, 12, 24 or 48 h ours incubation with the corresponding fatty acids are co graphed in Figure 3 12 and in Table 3 6 In terms of endogenously found amides, palmitamide was by far the most abundant, fo llowed by palmitoleamide, ole amide and linoleamide. Palmitamide was the most abundant PFAM after incubation with its corresponding FFA (0.25 mM) in N 18 TG 2 cells Aside from TDA, which is not a natural FFA and whose corresponding PFAM was foun d in very low amounts, PA was the only saturated FFA used for this experiment. Palmitoleamide was the next most abundant PFAM, followed by elaidamide, oleamide, linoleamide, and tridecanamide. Based on these findings, N 18 TG 2 cells appear to convert 16 carb on chain FFAs to their PFAMs in greater abundance than 18 carbon chain or perhaps the hydrolysis of the 18 carbon PFAMs occurs preferentially E laidamide was found in greater abundance than oleamide, but only after 48 hours. Trans fatty acids are not norma lly found in appreciable amounts in nature. 77 Most of the incubations revealed a linear increase in PFAM over time, but a much greater amount of elaidamide production was seen in the 48 compared to the 12 and 24 hour samples. 3.4.3 Quantitati ve Analysis of PFAMs in SCP C ells Each PFAM, including the non n atural tridecanamide, was found in both SCP cells and conditioned media. In most cases, the amount of PFAM found in the conditioned media was very similar to the amount of PFAM found in the cells themselves ( Figure 3 13 ).

PAGE 140

116 Figure 3 13 : Quantification of PFAMs isolated from SCP cells and media and blanks Continued on the next page. 0.E+00 1.E+03 2.E+03 3.E+03 4.E+03 5.E+03 6.E+03 0h 12h 24h 48h pmol amide per 10 7 cells TDA 0.E+00 2.E+03 4.E+03 6.E+03 8.E+03 1.E+04 1.E+04 1.E+04 0h 12h 24h 48h pmol amide per 10 7 cells TDEA 0.E+00 2.E+03 4.E+03 6.E+03 8.E+03 1.E+04 0h 12h 24h 48h pmol amide per 10 7 cells POA 0.E+00 5.E+03 1.E+04 2.E+04 2.E+04 3.E+04 3.E+04 4.E+04 4.E+04 0h 12h 24h 48h pmol amide per 10 7 cells PA

PAGE 141

117 Controls showed even less interference of PFAMs in SCP samples than was found in N 18 TG 2 samples. SCP media blanks were approximately 1 6% of experimental amounts found in conditioned media Solvent blanks were between 1 4% of cell sample amounts, except for POA, which was 11% of the experimental value. Figure 3 13 : Quantification of PFAMs isolated from SCP cells and media and blanks In each graph cells are shown in blue, media in green unspent media in pink and solvent blank in orange (left to right) Samples were incubated for 0, 12, 24 or 48 h ours with corresponding fatty acid BSA mixture. Error bars are standard deviation. 0.E+00 5.E+03 1.E+04 2.E+04 2.E+04 0h 12h 24h 48h pmol amide per 10 7 cells OA 0.E+00 2.E+04 4.E+04 6.E+04 8.E+04 1.E+05 1.E+05 1.E+05 2.E+05 0h 12h 24h 48h pmol amide per 10 7 cells EA 0.E+00 2.E+04 4.E+04 6.E+04 8.E+04 1.E+05 0h 12h 24h 48h pmol amide per 10 7 cells LOA

PAGE 142

118 Endogenous PFAMs are quantified in Figure 3 14 and t he amounts of amides found in SCP cells and conditioned media after 0, 12, 24 or 48 h ours incubation with Figure 3 15 : Primary F atty A cid A mides P roduced in SCP C el ls Incubated with Various Fatty A cids Comparison graph of PFAMs found in SCP cells after incubation with various FFAs and one NAE. Note that only cell data are show n here. Media data are available in Table 3 6 and Figure 3 13 0 5,000 10,000 15,000 20,000 25,000 30,000 35,000 40,000 45,000 0h 12h 24h 48h pmol amide per 10 7 cells tridecanamide, from tridecanoic acid tridecanamide, from tridecanoylethanolamine palmitoleamide palmitamide linoleamide oleamide elaidamide Figure 3 14 : Endogenous PFAMs in SCP Cells The amount of PFAMs found in normally growing SCP cells without incubation with a FFA is shown here. Error bars are standar d deviation 524 1237 366 6402 0 2000 4000 6000 8000 10000 pmol per 10 7 cells palmitoleamide palmitamide linoleamide oleamide

PAGE 143

119 corresponding fatty acids are co graphed in Figure 3 15 and in Table 3 6 SCP cells had a different profile of endogenously found amides than did N 18 TG 2 Ol eamide was much more abundant than any other endogenous PFAM, fo llowed by palmitamide, palmitoleamide, and linoleamide. Again, there was a much greater abundance of PFAMs in SCP cells than in N 18 TG 2 cells as was found for oleamide in Chapter 2 In SCP cells as in N 18 TG 2 elaidamide was found in greater amounts than oleamide, but the punctuated result after 48 h ours in N 18 TG 2 is replaced here with a more gradual increase in PFAM. Palmitamide and linoleamide, however, show a more punctuated production w ith a significant increase in amount after 48 h ours Linoleamide was again the least abundant PFAM endogenously, and again tridecanamide was synthesized the least quickly.

PAGE 144

120 Table 3 6 : PFAMs in Cells and Med ia SCP cells SCP media SCP unspent media N 18 TG 2 cells N 18 TG 2 media N 18 TG 2 unspent media TDA 12h 2033 308 2239 922 143 102 10 284 225 29 24h 2653 747 3228 1245 211 261 120 503 162 48 48h 2289 314 5132 426 291 750 317 1276 367 134 TDEA 12h 1082 277 2029 1387 144 68 256 213 24h 2680 360 7529 1601 283 158 450 37 48h 6637 1483 10301 1074 573 271 995 488 POA 407 48 291 96 0 342 110 806 573 3 12h 2004 363 3844 348 0 1021 769 1919 1635 14 24h 3076 1837 5375 2083 0 5847 8549 22 48h 2926 1580 7911 759 0 8301 1276 15136 63 PA 1162 208 857 442 0 928 253 5821 136 0 12h 3696 792 5297 1419 0 6150 1779 2232 1038 50 24h 4533 1637 6351 739 0 8692 3662 20585 8187 80 48h 33044 3012 24699 8429 0 21369 6710 74273 27305 225 OA 6367 2276 4087 1852 85 119 53 208 156 27 12h 6807 5699 3735 179 823 272 783 320 93 24h 9819 2943 16579 2054 265 2057 709 1391 203 151 48h 9960 5802 13170 3873 352 2137 424 1734 134 423 EA 6367 2276 4087 1852 119 53 208 156 12h 12255 3147 17458 735 198 1656 199 24h 20944 51432 18539 1401 322 1915 585 48h 21251 7156 126822 19489 6686 2194 10791 736 LOA 249 180 151 217 34 102 60 34 27 11 12h 4024 1341 6968 1752 253 348 161 391 44 100 24h 5208 726 25559 8107 394 298 118 405 105 162 48h 29336 10433 53650 29800 497 1258 372 853 268 454 Amount of PFAMs found in cell and media samples endogenously and after incubation for 12, 24 or 48 hours with the corresponding FFA. Endogenous amount is listed without a time. Values are pmol/10 7 cells standard deviation. Samples have blanks subtracted from them : solvent blank for the cell samples, and unspent media blank for the media samples The TDA/TDEA samples already have the 0h integration (negative control) subtracted from them. 9 PFAM is assumed to be oleamide. 16

PAGE 145

121 3.4.4 Comparison of SCP and N 18 TG 2 PFAM Production In every case except with palmitoleamide more of the PFAM was found in SCP cells than in N 18 TG 2 after incubation with FFA ( Figure 3 16 and Figure 3 17 ) although nearly equal amounts of palmitamide were found in the two ce ll lines. In fact, there was 23 times as much linoleamide in SCP than in N 18 TG 2 cells after 48 hours incubation with LOA, but only 3 times as much elaidamide ( Table 3 6 ) so th e amount of variation The much higher amount of endogenous oleamide in SCP cells ( 54 times compared to N 18 TG 2 levels) that was discovered in Chapter 2 did not hold true for other endogenous PFAM levels ( Figure 3 16 ) Other endogenous PFAMs ranged from just 1.2 times higher (palmitoleamide) to 2.4 times higher (linoleamide) in the SCP as compare d to N 18 TG 2 cells. Figure 3 16 : Endogenous PFAMs in SCP and N 18 TG 2 Cells The amount of endogenous amides in N 18 TG 2 (left) and SCP cells (right). Cells were grown in normal growth media with 10% FBS until 80 95% confluent, collected and extracted as described in the methods section. Quantification was done by GC MS. 360 940 112 119 524 1237 366 6402 0 1000 2000 3000 4000 5000 6000 7000 8000 pmol per 10 7 cells palmitoleamide palmitamide linoleamide oleamide N 18 TG 2 | SCP

PAGE 146

122 Figure 3 17 : Comparison of PFAMs in SCP and N 18 TG 2 Cells Continued on the next page. 0.E+00 1.E+03 2.E+03 3.E+03 4.E+03 5.E+03 6.E+03 0h 12h 24h 48h pmol amide per 10 7 cells TDA 0.E+00 2.E+03 4.E+03 6.E+03 8.E+03 1.E+04 1.E+04 1.E+04 0h 12h 24h 48h pmol amide per 10 7 cells TDEA 0.E+00 5.E+03 1.E+04 2.E+04 2.E+04 0h 12h 24h 48h pmol amide per 10 7 cells POA 0.E+00 2.E+04 4.E+04 6.E+04 8.E+04 1.E+05 1.E+05 0h 12h 24h 48h pmol amide per 10 7 cells PA

PAGE 147

123 Figure 3 17 : Comparison of PFAMs in SCP and N 18 TG 2 Cells The amount of amides in SCP cells (brown) and media (blue), and in N 18 TG 2 cells (purple) and media (green) plotted side by side here for comparison purposes. Cells were grown in media containing 0.5% FBS, 0.25 mM BSA and 2.5 mM FFA for 0, 12 24 or 48 hours, collected and extracted as described in the methods sect ion. Quantification was done by GC MS. 0.E+00 5.E+03 1.E+04 2.E+04 2.E+04 0h 12h 24h 48h pmol amide per 10 7 cells OA 0.E+00 2.E+04 4.E+04 6.E+04 8.E+04 1.E+05 1.E+05 1.E+05 2.E+05 0h 12h 24h 48h pmol amide per 10 7 cells EA 0.E+00 2.E+04 4.E+04 6.E+04 8.E+04 1.E+05 0h 12h 24h 48h pmol amide per 10 7 cells LOA

PAGE 148

124 3.5 Controls In addition to the solvent blanks and unspent media controls (se e sections 3.4.2 and 3.4.3 ) controls were run to test for the formation of PFAMs in unspent media and in spent media upon incub ation with various metabolites A recent report by Mueller and Driscoll 52 identified oleamide synthesizing activity in FBS, a component used in culture media in these experiments. In the Mueller and Driscoll experiments, incubation with oleoyl CoA and ammonia or glycine and resulted in the formation of oleamide or N oleoylglycine, respectively. To test for oleamide forming activity in the media used in these experiments, both conditioned and unspent media were incubated for 48 hours with various oleoy l metabolites. Th e se results are summarized in Figure 3 18 and show no detectable difference between the amount of oleamide found in unspent media and media (spent or unspent) incubated with one of the metabolites. This shows that there is no PFAM forming metabolism occurring in the media with NOG, OA and NOE as precursors, and that the cells are not excreting enzymes capable of metabolizing these ac yl amides.

PAGE 149

125 To test for the change in oleamide production in the cells without the presence of oleic acid or other oleoyl metabolites (but in the presence of all other components), both N 18 TG 2 and SCP cells were incubated for 48h with media containing 0.5% FBS and 0.25 mM BSA carrier. There was no detectable difference between the amount of oleamide serum media ( Figure 3 19 Fi gure 3 20 ). This shows that the incubation conditions (0.5% FBS and 0.25 mM BSA) have no measurab le effect on PFAM production in the absence of the FFA. Figure 3 18 : N 18 TG 2 M edia I ncubated with M etabolites with or without P revious E xposure to C ells Media containing 0.5% FBS was incubated with OA, NOE or NOG for 48 hours. Half of the samples were conditioned media (48 hours of cell exposure) with any cells removed by sterile filtration. Each sample was repeated. Error bars are standard deviation. Conditioned media and extracted cells after 48 hours incubation with OA are also shown on the le ft for comparison. Abbreviations: NOE, N oleoylethanolamine; NOG, N oleoylglycine; OA, oleic acid 0 500 1000 1500 2000 2500 pmol amide per 10 7 cells N18TG2 cells with OA N18TG2 media with OA spent media with OA spent media with NOE spent media with NOG unspent media with OA unspent media with NOE unspent media with NOG unspent media blank

PAGE 150

126 Fi gure 3 20 : S CP Incubated with BSA and Normal Cells Amount of oleamide in cells and media extracted after incubation with BSA alone, under s were incubated as normal for 48h and extracted as described in sections 3.3.5 3.3.8 0 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000 pmol amide per 10 7 cells SCP cells with BSA 48h SCP media with BSA 48h SCP cells 0h SCP media 0h unspent media 48h blank 48h Figure 3 19 : N 18 TG 2 I ncubated with BSA and Normal Cells Amount of oleamide in cells and media extracted after incubation with BSA alone, under incubated as normal for 48 hours and extracted as described in sections 3.3.5 3.3.8 0 100 200 300 400 500 600 pmol amide per 10 7 cells N18TG2 cells with BSA 48h N18TG2 media with BSA 48h N18TG2 cells 0h N18TG2 media 0h unspent media 48h blank 48h

PAGE 151

127 To test the robustness of this extraction method, cells and media were spiked with each PFAM and subjected to the standard ex traction procedure. Percent recoveries ranged from 82 101% ( Figure 3 21 ). 3.6 Discussion This is the first known report of the conversion of FFAs other than oleic acid to their respective PFAM in N 18 TG 2 cells. Although oleamide is the best studied PFAM, it is only one of many PFAMs that are known to be produced by this cell line and other tissue types. In addition, this is the first report of the PFAMs being found both endogenously and upon incubation wi th a FFA in SCP cells. Figure 3 21 : Extraction Efficiency for PFAMs N 18 TG 2 cells and media were spiked with 5 nmol of each amide and subjected to the normal solvent extraction, SPE, and derivitization for GC MS. PFAM peaks were integrated using a set of characteristic ions as in Table 3 5 and compared to a standard curve. Error bars are standard deviation. 0% 20% 40% 60% 80% 100% 120% cell extract media extract

PAGE 152

128 In comparing the two cell lines, there are several obvious differences. Aside from the finding that SCP cells ha d more of each PFAM except palmitoleamide, the pattern of PFAM abundance differs between these two cell lines in terms of amount of each PFAM species N 18 TG 2 cells showed a higher turnover of 16 carbon fatty acids to primary amides than did SCP cells and there was no discernable pattern of PFAM abundance in SCP cells relating to acyl chain length of degree of saturation To qualify, the amount of corresponding PFAMs found in SCP cells was approximately PA LOA > EA > OA > POA > TDEA > TDA whereas in N 18 TG 2 it was PA > POA >EA > TDEA after 48 hours of incubation time Oleamide was the most abundant of the five PFAMs found in meibomian secretions, 6 but still t he unexpected findings that oleamide is far more abundant than the other SCP endogenous PFAMs, and that conversion of most FFAs to their corresponding PFAM occurs in much greater amounts in the SCP cells bodes further investigation. I t was not possible to detect the difference between the cis / trans isomers oleamide and elaidamide due to the impurities in the complex cellular lipid extract and the endogenous 18:1 amide found is reported here as oleamide because oleamide has been reported in N 1 8 TG 2 cells and various other sources 43,68,69,96 while elaidamide has only been fou nd in human plasma to date 5 Trans fatty acids are not found in appreciable amounts in higher organisms aside from some in d airy fat and in the meat of ruminants, whose stomachs contain bacterial isomerases capable of performing this conversion 77 (Th e elaidamide found in human leutal phase plasma 5 likely came from a dietary source as do most trans fatty acids 16 ) It is interesting, therefore, that both N 18 TG 2 and SCP cells had greater amounts of elaidamide than oleamide after incubation with EA and OA, respectively amidating monooxygenase (PAM) with various NAGs as substrates is shown in Figure 3 22 The presence of low endogenous amounts o f linoleamide may be partially accounted for by the lower V max /K M of the doubly unsaturated N linoleoylglycine. However, once LOA incubation began, SCP cells showed a much higher amount of linoleamide. This may reflect a low availability of endogenous LOA The N 18 TG 2 cells, however, maintained a lower amount of linoleamide

PAGE 153

129 per cell than other PFAMs after incubation with the corresponding FFA This could reflect any number of possibilities: N 18 TG 2 may express fewer FFA transport proteins that are specifical ly able to transport the doubly unsaturated FFA across cell membranes LOA may be preferentially shuttled to a different metabolic route, or the different species may show different substrate specificities for any of the metabolic enzymes, including PAM, a cyl CoA synthetase(s), cytochrome c, and FAAH. Although the degradative enzyme, FAAH, has been studied extensively, 97,98 there is not a great deal known about substrate PFAMs with less than 18 carbons. Report ed kinetic constants vary, but l inoleamide is likely a better substrate than oleamide ( Table 3 8 Table 3 7 ). This helps explain why linoleamide was found in lower abundance in N 18 TG 2 cells, since FA AH was not found to be expressed in SCP (see Chapter 4). Based on the other PFAM data in N 18 TG 2 cells, 16 carbon PFAMs can be predicted to be worse substrates for FAAH than 18 since those 16 carbon PFAMs were found in greater abundance P almitamide was fo und to be a worse FAAH substrate than oleamide in vitro 2,7 (see Table 3 7 ) Lower degrees of unsaturation may also be favorable against FAAH degradation because, in the N 18 TG 2 trend, the unsaturated PFAM was most abundant, followed by the mono unsaturated species a nd finally the bi unsaturated linoleamide, which was found in lowest abundance. FAAH hydrolyzes NAEs more 200 220 240 260 280 300 320 340 360 380 400 11 13 15 17 19 Vmax/KM number of carbons 12:0 14:0 18:1 9 18:2 9,12 Acyl Chain Km (M) Vmax (mol/minmg) V/K Lauroyl 110 12.3 220 Myristoyl 71 9.2 260 Palmitoyl No data available Palmitoleoyl Linoleoyl 69 9.2 270 Oleoyl 94 17.7 380 Figure 3 22 : Kine tic Data for PAM and Various N A cylglycines Kinetic data for PFAMs as PAM substrates in tabular (left) and graphical (right) forms. Information is from Wilcox et.al. 4 Identification of each PFAM is noted below its point on the graph. These data are for rat PAM.

PAGE 154

130 slowly with decreasing numbers of double bonds. 99 It is interesting that oleamide is a better substrate for FAAH than is myristamide 2,7 ( Table 3 7 ) but tridecanamide is in far lower abundance than oleamide and any of the other PFAMs. No enzymatic assays have been done for FAAH with the substrate elaidamide to 18 TG 2 thus far have completely mirrored FAAH substrate preference, one might predict that elaidamide is a poorer FAAH substrate than oleamide. This would explain why elaidamide was found in greater abundance than oleamide even though EA is not a naturally occurring FFA. In addition to testing for the conversion of endogenously found FFAs to their respective amides, a non natural FFA and its corresponding NAE was also incubated with the cells to test for its conversion to a PFAM in an attempt to determine no t only whether a non natural acyl chain (aside from elaidic acid) could be converted to its primary amide, but also to gain some insight into the mode of formation of PFAMs (see Figure 3 1 ) This is the first report of conversion of an NAE to PFAM in these cell l i nes as well as the first report of non natural fatty acid and ethanolamines being converted to Table 3 8 : Kinetic Data for FAAH Acyl Chain Km (M) Vmax (mol/min mg) V/K Source ref Linoleoyl 6.8 1448 213 N 18 TG 2 1 8.3 3317 400 Rat brain 3 Oleoyl 9 941 105 N 18 TG 2 1 14 340 243 N 18 TG 2 1 enzymatic activity is from a 10,000xg pellet enzymatic activity is from the microsomal fraction Table 3 7 : Relative Substrate Specificity of FAAH FAAH source : N 18 TG 2 1 Rat recom b inant 2 Human recombinant 7 Anandamide 100 100 100 Linoleamide 64 Oleamide 42 73 70 Palmitamide 10 33 Myristamide 24 65 The activity of anandamide is taken to be 100%, and the activity of the other substrates compared to anandamide. Data taken from 14,15

PAGE 155

131 their corresponding PFAM Although both cell lines were able t o perform this conversion, the rates of conversion were much lower than those found for natural FFAs ( Figure 3 12 Figure 3 15 ) and the patterns of metabolic flow through were not the same in the N 18 TG 2 and SCP cell s ( Figure 3 23 ) N 18 TG 2 cells metaboli zed TDA and TDEA with equal discrimination, whereas SCP cells preferred the TDEA substrate to the TDA. Bradshaw et al found that incubation of labeled N arachidonoy l D 4 ethanolamine prod uced labeled N aracyidonoylglycine in both RAW 264.7 and C6 glioma ce lls indicating the oxidative formation of NAG In addition, the unlabeled N arachidonoylglycine was found in C6 glioma cells, indicating they also hydrolyze the NAE to its FFA for glycination. Upon addition of a FAAH inhibitor, the NAG was no longer formed in the glioma cells, suggesting that the preferential mode of action of NAG formation is hydrolysis of the NAE to its FFA in the glioma, but not in the RAW 264.7 cells. 90 The Bradshaw data and the findings herein demonstrate that not only is there more than one way to produce a Figure 3 23 : Tridecanamide in SCP and N 18 TG 2 Cells after TDA and TDEA Incubations. The rate of conversion of TDEA is steeper than the rate of conversion of TDA in SCP cells. In N 18 TG 2 cells, however, there is no discernable difference in substrate conversion. 0 3000 6000 9000 12000 15000 18000 12h 24h 48h 12h 24h 48h pmol per 10 7 cells SCP media cells TDA | TDEA 0 500 1000 1500 2000 2500 3000 12h 24h 48h 12h 24h 48h N 18 TG 2 TDA | TDEA

PAGE 156

132 NAG, but that the mode o f NAG production can vary from cell line to cell line (and likely tissue type to tissue type). This bodes further exploration to determine if there are differences in expression of the metabolizing enzymes in these cell lines and in Chapter 4 it is determ ined that FAAH is not expressed in SCP cells and an alcohol dehydrogenase was found in SCP, but not N 18 TG 2 cells These and other differences in enzyme expression have many implications for the metabolism of FFAs and NAEs in these cell lines ( for more dis cussion see Chapter 4). 3.7 Conclusion The assay for PFAM quantification in cells and media that was developed in Chapter 2 was used here to show the conversion of a panel of long chain fatty acids to their corresponding amides in two model cell lines: SCP a nd N 18 TG 2 cells. In addition to five endogenously found FFAs, two non natural, odd chain compounds were found to be converted to their corresponding PFAM in both cell lines and their respective conditioned media. The amount of endogenous PFAMs was much hi gher in the SCP cells, particularly for oleamide. After incubation with a fatty acid, the profile of PFAMs was different between the two cell lines. The PFAM profile in N 18 TG 2 cells mirrors the known substrate specificity for FAAH, with the PFAMs having th e lowest V max / K M being in greatest abundance and those with the most favorable kinetic data being in least. In addition to the differing profile of PFAMs after FFA incubation, SCP and N 18 TG 2 cells showed different usage of TDA and TDEA. While N 18 TG 2 cells used both at the same rate to form tridecanamide, SCP showed a preference for ethanolamine metabolism Once again, the long chain fatty acid amide metabolism is shown to differ in different cell lines. These findings bode further exploration, and an investigation into their enzyme expression may yield some answers to these discrepancies. 3.8 References (1) Maurelli, S.; Bisogno, T.; De Petrocellis, L.; Di Luccia, A.; Marino, G.; Di Marzo, V. FEBS Lett 1995 377 82.

PAGE 157

133 (2) Cravatt, B. F .; Giang, D. K.; Mayfield, S. P.; Boger, D. L.; Lerner, R. A.; Gilula, N. B. Nature 1996 384 83. (3) van der Stelt, M.; Paoletti, A. M.; Maccarrone, M.; Nieuwenhuizen, W. F.; Bagetta, G.; Veldink, G. A.; Finazzi Agro, A.; Vliegenthart, J. F. FEBS Lett 1 997 415 313. (4) Wilcox, B. J.; Ritenour Rodgers, K. J.; Asser, A. S.; Baumgart, L. E.; Baumgart, M. A.; Boger, D. L.; DeBlassio, J. L.; deLong, M. A.; Glufke, U.; Henz, M. E.; King, L., 3rd; Merkler, K. A.; Patterson, J. E.; Robleski, J. J.; Vederas, J C.; Merkler, D. J. Biochemistry 1999 38 3235. (5) Arafat, E. S.; Trimble, J. W.; Andersen, R. N.; Dass, C.; Desiderio, D. M. Life Sci 1989 45 1679. (6) Nichols, K. K.; Ham, B. M.; Nichols, J. J.; Ziegler, C.; Green Church, K. B. Invest Ophthalmol V is Sci 2007 48 34. (7) Giang, D. K.; Cravatt, B. F. Proc Natl Acad Sci U S A 1997 94 2238. (8) Hedlund, P. B.; Carson, M. J.; Sutcliffe, J. G.; Thomas, E. A. Biochem Pharmacol 1999 58 1807. (9) Huidobro Toro, J. P.; Harris, R. A. Proc Natl Acad Sci U S A 1996 93 8078. (10) Boger, D. L.; Patterson, J. E.; Jin, Q. Proc Natl Acad Sci U S A 1998 95 4102. (11) Lambert, D. M.; Vandevoorde, S.; Diependaele, G.; Govaerts, S. J.; Robert, A. R. Epilepsia 2001 42 321. (12) Vandevoorde, S.; Jonsson, K. O.; Fowler, C. J.; Lambert, D. M. J Med Chem 2003 46 1440. (13) Sultana, T. Doctoral Dissertation, Duquesne University, 2005. (14) Ueda, N.; Puffenbarger, R. A.; Yamamoto, S.; Deutsch, D. G. Chem Phys Lipids 2000 108 107. (15) Boger, D. L.; Patt erson, J. E.; Guan, X.; Cravatt, B. F.; Lerner, R. A.; Gilula, N. B. Proc Natl Acad Sci U S A 1998 95 4810. (16) Sommerfeld, M. Prog Lipid Res 1983 22 221. (17) Lerner, R. A.; Siuzdak, G.; Prospero Garcia, O.; Henriksen, S. J.; Boger, D. L.; Cravatt, B. F. Proc Natl Acad Sci U S A 1994 91 9505. (18) Cravatt, B. F.; Prospero Garcia, O.; Siuzdak, G.; Gilula, N. B.; Henriksen, S. J.; Boger, D. L.; Lerner, R. A. Science 1995 268 1506. (19) Cravatt, B. F.; Lerner, R. A.; Boger, D. L. J. Am. Chem. Soc 1996 118 580. (20) Huang, J. K.; Jan, C. R. Life Sci 2001 68 997. (21) Basile, A. S.; Hanus, L.; Mendelson, W. B. Neuroreport 1999 10 947. (22) Herrera Solis, A.; Vasquez, K. G.; Prospero Garcia, O. Pharmacol Biochem Behav 2010 (23) Stewart, J. M.; Boudreau, N. M.; Blakely, J. A.; Storey, K. B. J. Therm. Biol. 2002 27 309. (24) Morisseau, C.; Newman, J. W.; Dowdy, D. L.; Goodrow, M. H.; Hammock, B. D. Chem Res Toxicol 2001 14 409. (25) Tao, X.; Liu, Y.; Wang, Y.; Qiu, Y.; Lin, J .; Zhao, A.; Su, M.; Jia, W. Anal Bioanal Chem 2008 391 2881.

PAGE 158

134 (26) Jain, M. K.; Ghomashchi, F.; Yu, B. Z.; Bayburt, T.; Murphy, D.; Houck, D.; Brownell, J.; Reid, J. C.; Solowiej, J. E.; Wong, S. M.; et al. J Med Chem 1992 35 3584. (27) Guan, X. J.; Cravatt, B. F.; Ehring, C. R.; Hall, J. E.; Boger, D. L.; Lerner, R. A.; Gilula, N. B. J. Cell Biol. 1997 139 1785. (28) Cravatt, B. F., Lerner, R.A. and Boger, D.L. In J Am Chem Soc 1996; Vol. 118, p 580. (29) Boger, D. L.; Henriksen, S. J.; Cravatt, B. F. Curr Pharm Des 1998 4 303. (30) Murillo Rodriguez, E.; Giordano, M.; Cabeza, R.; Henriksen, S. J.; Diaz, M. M.; Navarro, L.; Prospero Garcia, O. Neurosci. Lett. 2001 313 61. (31) Huitron Resendiz, S.; Gombart, L.; Cravatt, B. F.; Henriksen, S. J. Exp. Neurol. 2001 172 235. (32) Lo, Y. K.; Tang, K. Y.; Chang, W. N.; Lu, C. H.; Cheng, J. S.; Lee, K. C.; Chou, K. J.; Liu, C. P.; Chen, W. C.; Su, W.; Law, Y. P.; Jan, C. R. Biochem Pharmacol 2001 62 1363. (33) Yost, C. S.; Hampson, A. J.; Leonoudakis, D.; Koblin, D. D.; Bornheim, L. M.; Gray, A. T. Anesth Analg 1998 86 1294. (34) Lees, G.; Edwards, M. D.; Hassoni, A. A.; Ganellin, C. R.; Galanakis, D. Br J Pharmacol 1998 124 873. (35) Verdon, B.; Zheng, J. ; Nicholson, R. A.; Ganelli, C. R.; Lees, G. Br J Pharmacol 2000 129 283. (36) Laposky, A. D.; Homanics, G. E.; Basile, A.; Mendelson, W. B. Neuroreport 2001 12 4143. (37) Nicholson, R. A.; Zheng, J.; Ganellin, C. R.; Verdon, B.; Lees, G. Anesthesiology 2001 94 120. (38) Langstein, J.; Hofstadter, F.; Schwarz, H. Res. Immunol. 1996 147 389. (39) Bisogno, T.; Katayama, K.; Melck, D.; Ueda, N.; De Petrocellis, L.; Yamamoto, S.; Di Marzo, V. Eur. J. Biochem. 1998 254 634. (40) Lee, D. W.; Sung, M. W.; Park, S. W.; Seong, W. J.; Roh, J. L.; Park, B.; Heo, D. S.; Kim, K. H. Anticancer Res. 2002 22 2089. (41) Yang, J. Y.; Abe, K.; Xu, N. J.; Matsuki, N.; Wu, C. F. Neurosci. Lett. 2002 328 165. (42) Driscoll, W. J.; Mueller, S. A.; E ipper, B. A.; Mueller, G. P. Mol Pharmacol 1999 55 1067. (43) Hiley, C. R.; Hoi, P. M. Cardiovasc Drug Rev 2007 25 46. (44) Huang, S. M.; Bisogno, T.; Petros, T. J.; Chang, S. Y.; Zavitsanos, P. A.; Zipkin, R. E.; Sivakumar, R.; Coop, A.; Maeda, D. Y.; De Petrocellis, L.; Burstein, S.; Di Marzo, V.; Walker, J. M. J Biol Chem 2001 276 42639. (45) Boitano, S.; Evans, W. H. Am J Physiol Lung Cell Mol Physiol 2000 279 L623. (46) Decrouy, X.; Gasc, J. M.; Pointis, G.; Segretain, D. J Cell Physiol 2004 200 146. (47) Ehrlich, H. P.; Sun, B.; Saggers, G. C.; Kromath, F. J Cell Biochem 2006 98 735. (48) Martinez Gonzalez, D.; Bonilla Jaime, H.; Morales Otal, A.; Henriksen, S. J.; Velazquez Moctezuma, J.; Prospero Garcia, O. Neurosci Lett 2004 364 1. (49) Fedorova, I.; Hashimoto, A.; Fecik, R. A.; Hedrick, M. P.; Hanus, L. O.; Boger, D. L.; Rice, K. C.; Basile, A. S. J Pharm acol Exp Ther 2001 299 332.

PAGE 159

135 (50) Hoi, P. M.; Hiley, C. R. Br J Pharmacol 2006 147 560. (51) Varvel, S. A.; Cravatt, B. F.; Engram, A. E.; Lichtman, A. H. J Pharmacol Exp Ther 2006 317 251. (52) Mueller, G. P.; Driscoll, W. J. Vitam Horm 2009 81 55. (53) Liu, Y. C.; Wu, S. N. Eur J Pharmacol 2003 458 37. (54) Mitchell, C. A.; Davies, M. J.; Grounds, M. D.; McGeachie, J. K.; Crawford, G. J.; Hong, Y.; Chirila, T. V. J Biomater Appl 1996 10 230. (55) Hamberger, A.; Stenhagen, G. Neurochem Res 2003 28 177. (56) Wakamatsu, K.; Masaki, T.; Itoh, F.; Kondo, K.; Sudo, K. Biochem Biophys Res Commun 1990 168 423. (57) Thomas, E. A.; Carson, M. J.; Neal, M. J.; Sutcliffe, J. G. Proc Natl Acad Sci U S A 1997 94 14115. (58) Alberts, G. L.; Chio C. L.; Im, W. B. Mol Pharmacol 2001 60 1349. (59) Yost, C. S.; Hampson, A. J.; Leonoudakis, D.; Koblin, D. D.; Bornheim, L. M.; Gray, A. T. Anesth. Analg. 1998 86 1294. (60) Coyne, L.; Lees, G.; Nicholson, R. A.; Zheng, J.; Neufield, K. D. Br J Pha rmacol 2002 135 1977. (61) Cheer, J. F.; Cadogan, A. K.; Marsden, C. A.; Fone, K. C.; Kendall, D. A. Neuropharmacology 1999 38 533. (62) Lambert, D. M.; Di Marzo, V. Curr Med Chem 1999 6 757. (63) Fowler, C. J. Br J Pharmacol 2004 141 195. (64) Mechoulam, R.; Fride, E.; Hanus, L.; Sheskin, T.; Bisogno, T.; Di Marzo, V.; Bayewitch, M.; Vogel, Z. Nature 1997 389 25. (65) Hillard, C. J.; Edgemond, W. S.; Jarrahian, A.; Campbell, W. B. J Neurochem 1997 69 631. (66) Chaturvedi, S.; Driscoll, W. J.; Elliot, B. M.; Faraday, M. M.; Grunberg, N. E.; Mueller, G. P. Prostaglandins Other Lipid Mediat 2006 81 136. (67) Sudhahar, V.; Shaw, S.; Imig, J. D. Eur J Pharmacol 2009 607 143. (68) Merkler, D. J.; Chew, G. H.; Ge e, A. J.; Merkler, K. A.; Sorondo, J. P.; Johnson, M. E. Biochemistry 2004 43 12667. (69) Bisogno, T.; Sepe, N.; De Petrocellis, L.; Mechoulam, R.; Di Marzo, V. Biochem Biophys Res Commun 1997 239 473. (70) Chaperon, F.; Thiebot, M. H. Crit Rev Neuro biol 1999 13 243. (71) Hanus, L. O.; Fales, H. M.; Spande, T. F.; Basile, A. S. Anal Biochem 1999 270 159. (72) Butovich, I. A. Prog Retin Eye Res 2009 28 483. (73) Butovich, I. A.; Uchiyama, E.; Di Pascuale, M. A.; McCulley, J. P. Lipids 2007 42 765. (74) McDonald, G. R.; Hudson, A. L.; Dunn, S. M.; You, H.; Baker, G. B.; Whittal, R. M.; Martin, J. W.; Jha, A.; Edmondson, D. E.; Holt, A. Science 2008 322 917. (75) Narasimhan, B.; Mourya, V.; Dhake, A. Bioorg Med Chem Lett 2006 16 3023. (76) Leggett, J. D.; Aspley, S.; Beckett, S. R.; D'Antona, A. M.; Kendall, D. A. Br J Pharmacol 2004 141 253. (77) Ascherio, A.; Willett, W. C. Am J Clin Nutr 1997 66 1006S.

PAGE 160

136 (78) Morisseau, C.; Newman, J. W.; Wheelock, C. E.; Hill Iii, T.; Morin, D.; Buckpitt, A. R.; Hammock, B. D. Chem Res Toxicol 2008 21 951. (79) Watson, J.; Greenough, E. B.; Leet, J. E.; Ford, M. J.; Drexler, D. M.; Belcastro, J. V.; Herbst, J. J.; Chatterjee, M.; Banks, M. J Biomol Screen 2009 14 566. (80) Garrido Lpez, . ; Esquiu, V.; Tena, M. T. Journal of Chromatography A 2006 1124 51. (81) Merkler, D. J.; Merkler, K. A.; Stern, W.; Fleming, F. F. Arch Biochem Biophys 1996 330 430. (82) Farrell, E. K.; Merkler, D. J. Drug Discov Today 2008 13 558. (83) Watkins, P. A. J Biol Chem 2008 283 1773. (84) Coleman, R. A.; Lewin, T. M.; Van Horn, C. G.; Gonzalez Baro, M. R. J Nutr 2002 132 2123. (85) Kelley, M.; Vessey, D. A. J Biochem Toxicol 1994 9 153. (86) Gregersen, N.; Kolvraa, S.; Mortensen, P. B. Biochem Med Metab Biol 1986 35 210. (87) O'Byrne, J.; Hunt, M. C.; Rai, D. K.; Saeki, M.; Alexson, S. E. J Biol Chem 2003 278 34237. (88) McCue, J. M.; Driscoll, W. J.; Mueller, G. P. Biochem Biophys Res Commun 2008 365 322. (89) Mueller, G. P.; Driscoll, W. J. J Biol Chem 2007 282 22364. (90) Bradshaw, H. B.; Rimmerman, N.; Hu, S. S.; Benton, V. M.; Stuart, J. M.; Masuda, K.; Cravatt, B. F.; O'Dell, D. K.; Walker, J. M. BMC Biochem 2009 10 14. (91) Burstein, S. H.; Rossetti, R. G.; Yagen, B.; Zurier, R. B. Prostaglandins Other Lipid Mediat 2000 61 29. (92) Ivkovic, M.; Lowe, E. W.; Merkler, D. J. in press 2010 (93) Aneetha, H.; O'Dell, D. K.; Tan, B.; Walker, J. M.; Hurley, T. D. Bioorg Med Chem Lett 2009 19 237. (94) Fong, C.; Wells, D.; Krodkiewska, I.; Hartley, P. G.; Drummond, C. J. Chemistry of Materials 2006 18 594. (95) Sultana, T.; Johnson, M. E. J Chromatogr A 2006 1101 278. (96) Wei, B. Q.; Mikkelsen, T. S.; McKinney, M. K.; La nder, E. S.; Cravatt, B. F. J Biol Chem 2006 281 36569. (97) Willoughby, K. A.; Moore, S. F.; Martin, B. R.; Ellis, E. F. J Pharmacol Exp Ther 1997 282 243. (98) McKinney, M. K.; Cravatt, B. F. Annu Rev Biochem 2005 74 411. (99) Desarnaud, F.; Cadas, H.; Piomelli, D. J Biol Chem 1995 270 6030.

PAGE 161

137 4 Amide Processing Enzyme Expression in Oleamide Producing Cells 4.1 Location and Biological Significance of Primary Fatty Acid Amides and N Acylglycines P rimary fatty acid amides (PFAMs) and N acylglycines (NAG s) are important bioactive lipids found across many species PFAMs have been shown to be responsible for various effects in the central nervous system, including induction of sleep 71 74 stimulation of Ca 2+ release 79,92 inhibition of the erg current in pituitary cells 93 and activation of specific sero tonin receptor subtypes 97 99 and the GABA A receptor. 80 83 ( F or a complete review of endogenous PFAM s see Chapter 3.) L ess is known about the NAG s, but a recent sur ge of interest in these molecules and the development of better separations and more sensitive mass spectrometry instruments has allowed for the identification of many more N acylamino acids than were known just a few years ago 100 103 N C onjugation of long chain fatty acids to glycine is a known method of detoxification and elimination, although recently N oleoylglycine has been shown to have bioactivity as it serve s in regulation of body temperature and locomotion. 104 Other long chain N acylglycines have also been reported to have additional function. For example, N arachidonoylglycine is an endogenous ligand for the orphan GPR18 receptor 108 is analgesic, 20 inhibits FAAH 20 and the GLYT2a glycine transporter 109 A summary of known mammalian long chain PFAM and NAG metabolites can be found in Table 4 1

PAGE 162

138 Table 4 1 : Occurrence and R ole of Endogenous Long C hain PFAMs and N AGs in M ammals Class Compound Organism Known Significance Ref PFAM Myristamide (C14:0) Human Unknown 56 Palmitamide ( C 16:0) Human Mouse Unknown, modestly attenuates seizures in mice, modest FAAH inhibitor 56,58 (this dissertation) Palmitoleamide ( C 16:1 cis 9 ) Human, Rabbit Mouse Gap junction communication, serotonin receptor binding 58,60 (this dissertation) Stearamide ( C 18:0) Human, Rabbit Unknown 56 60 Elaidamide ( C 18:1 trans 9 ) Human Less active than oleamide, but induces sleep, inhibits epoxide hydrolase and phospholipase A 2 58 70 Oleamide ( C 18:1 cis 9 ) Hu man Mouse, Rabbit Rat, Squirrel Sleep, memory, thermal and locomotor regulation, gap junction communication, Ca 2+ flux, vasodilatation, hunger, anxiety, serotonin receptor binding, erg current inhibition 23,58,71 87 58,60,88 91 (this dissertation) Linoleamide ( C 18:2 cis 9 ,12 ) Human, Rabbit Mouse Sleep and Ca 2+ flux regulation, erg current inhibition, epoxide hydrolase and phospholipase A 2 inhibition, gap junction communication, FAAH substrate, serotonin receptor binding 92,93 56 60 (this dissertation) Eicosenamide ( C20:1 cis 13 ) Rabbit Unknown 28,60 Erucamide (C22:1 cis 0 13 ) Cat, Cow, Human, Rat Fluid balance, angiogenesis 56,105 107 N AG N palmitoylglycine (C16:0) Rat Sensory neuronal signaling, antinociception, Ca 2+ influx 17,101 N stearoylglycine (C18:0) Mouse, Rat Unknown 102 N oleoylglycine ( C 18: 1 cis 9 ) Mouse, Rat Temperature and locomotion control 88,101,102, 104 (this dissertation) N linoleoylglycine (18: 2 cis 9 ,12 ) Rat Anti inflammatory 101,102,110 N arachidonylglycine (20:4 cis 5,8,11,14 ) Cow, Rat Antinociceptive and inflammatory suppression, control of T cells proliferation, suppression of IL secretion, reduction rectal carcinoma growth, Ca 2+ and insulin release, GLYT2a inhibition 3,110 114 N docosahexaenoylglycine (22:6 cis 4,7,10,13,16,19 ) Rat Anti inflammatory 102,110

PAGE 163

139 4.2 PFAM and NAG Biosynthesis The pathway (s) for PFAM and NAG biosynthesis are currently under study in several laboratories, including the Bradshaw (formerly Walker), Merkler, and Mueller groups The consensus is that there are two main routes to NAG biosynthesis although the regulation of each route, the prevalence of each route in different cell and tissue types and the exact enzymes involved are still under investigation. One of the proposed biosynthetic mechanisms is the activation of a long chai n free fatty acid (FFA) to an intermediate, the coenzyme A (CoA ) thioester being a likely candidate, followed by glycination to form the NAG 28 A second proposed route for NAG biosynthesis involves sequential oxidation of an N acylethanolamine ( NAE ) first to the N a cylglycinal and then to the NAG 3,25 The route(s) to PFAM biosynthesis are better understood. The primary proposed mechanism of PFAM biosynthesis is by oxidative cleavage of the NAG by the amidating monooxygenase (PAM). 1,28 Another mechanism for which recent in vitro studies have given some evidence involves the direct amidation of an acyl CoA with ammonia. 11,55 The current proposed pathways for the synthesis and degradation of the NAGs and PFAMs is shown in Figure 4 1

PAGE 164

140 Considerable evidence has been gathered to support the action of p eptidylglycine am i dating monooxygenase (PAM, EC 1.14.17.3 ) in converting the NAGs to PFAMs PAM is a bifunctional enzyme composed of peptidylglycine h ydroxylating monooxygenase (PHM, EC 1.14.17.3) that catalyzes the stereospecific hydroxylation of the carbon of glycine extended substrates. The se cond functional unit of PAM Figure 4 1 : Proposed B iosynthetic and Cataboic Pathways for NAGs and PFAMs The enzymes catalyzing the individual reactions are in the boxes and the fatty acyl group is R 24 and Merkler et al 28,29 for recent reviews Abbreviations: ACS, Acyl Co A synthetase; ASC, ascorbic acid; ADH, alcohol dehydrogenase; AlDH, aldehyde dehydrogenase; CYP4F, cytochrome P450; Cyt c, cytochrome c; FFA, free fatty acid; lcACGNAT, a novel long chain acyl CoA:glycine N acyltransferase; NAE, N acylethanolamine; NAG, N acylglycine; PAM, peptidylglycine amidating monooxygenase ; PFAM, primary fatty acid amide; SDA, semidehydroascorbic acid

PAGE 165

141 is p eptidyl amidating lyase (PAL, EC 4.2.3.5), which releases glyoxyla hydroxylated acyl or peptidyl glycine to form a PFAM or an amidated pe ptide ( Equation 4 1 ). PAM is expressed in neuroendocrine tissues where it is known to amidate peptide messengers from their glycine extended precursors. 48,115 In vitro studies have shown that many non peptides are PAM substrates, an d that V max /K M for NAGs are comparable to those for peptide substrates 1 8 The equations for the stepwise transformation are shown below in Equation 4 1 . C hemical inhibition of PAM by trans 4 phenyl 3 butenoic acid in the PAM expressing N 18 TG 2 cell s 28,116 resulted in the accumulation of N oleoylglycine when these cells were grown in the presence of oleic acid 28 The main area of debate for this metabolic network has been in the formation of NAGs. Bradshaw et al. and Burnstein et al. demonstrated the conversion of NAEs to NAGs in three cell lines, 3,25 and Merkler et al. demonstrated the conversion of 14 C oleic acid to a 14 C compound with the sa me retention time as N oleoylglycine. 28 These experiments demonstrate not only that NAGs are cellular metabolites but that they can be synthesized from two distinct precursors: Equation 4 1 : Amidation of an N Acylglycine by PAM

PAGE 166

142 NAEs and FFAs. These two distinct metabolic precursors also indicate two distinct biosynt hetic mechanisms : oxidation of an NAE and glycination of an activated intermediate, such as acyl CoA. 4.2.1 Anabolic Route to the NAGs I: Glycination of a Free Fatty Acid The ATP dependent formation of acyl CoA from fatty acids via acyl CoA l i gase ( ACS, a.k.a. acyl CoA synthetase, EC 6.2.1.x ) is a well established reaction that is found throughout the evolutionary tree, from Achaea to complex eukaryotes 59,117,118 O verexpression in hepatic cells results in an increase in the amount of cellular long chain acyl CoAs. 119 A ll the common fatty acyl CoAs are known mammalian metabolites, including palmitoyl, palmitoleoyl, stearoyl, oleoyl, linoleoyl and arachidonoyl CoA. 120,121 This two step reaction is diagrammed in Equation 4 2 Exactly which ACS isozyme is responsible for the CoA ylation of particular FFAs in vivo has not been resolved completely but much in vitro evidence has been amassed. The very long chain ACSs, known both as ASCVL s and SLC27As (for solute carrier family 27A), metabolize fatty acids of 1 8 26 carbons in length, and the long chain ACSs, known as ACSLs, metabolize fatty acids of 12 2 2 carbons in length. 59,118 Relative f atty acid preference for ACSL isoform s 1 and 3 6 is summarized in Table 4 2 (Isoform 2 was fou nd to be the same as isoform 1.) Equation 4 2 : Fatty Acyl CoA Lygase Reaction

PAGE 167

143 Acyl CoA:glycine N acyltransferase ( ACGNAT a.k.a. GAT, GLYAT E C 2.3.1.13 ) is one possible glycination enzyme found in the liver, kidney and brain. 13,122,123 There are two isoforms of this enzyme; isoform b is composed of the first 163 amino acids residues of isoform a although kinetic studies have not been done to distinguish substrate preferenc e between the two isomers The ACGNAT rea ction is shown in Equation 4 3 and proceeds via a ping pong mechanism. 124 ACGNAT is known to form short chain and branched chain N acylglycines from the corresponding acyl CoA thioesters 122,125 However, ACGNAT is not likely to be the enzyme responsible for long chain NAG formation because The V max /K M for acyl CoAs dramatically decreases as the length of the ac yl chain increases 40,122,126,127 L ong chain acyl CoA thoesters are not ACGNAT substrates 125 with decanoyl CoA being the longest acyl CoA substrate accepted by mammalian ACGNAT. 128,129 The Merkler laboratory verified these results using purified bovine liver ACGNAT. After a 4 hour incubation with high concentrations of ACGNAT, there was approximately 4% conversion of oleoyl CoA to N oleoylglycine (unpublished data), condit ions under which benzoyl CoA or butanoyl CoA were completely converted to their respective NAG in less than 30 seconds. In addition, incubation of bovine liver ACGNAT PAM with Equation 4 3 : Formation of N Acylglycine by ACGNAT Table 4 2 : In Vitro Substrate Preferences of Purified ACSL Isoforms Isoform Fatty acid preference ACSL1 16:0 16:1 18:1 18:2 > 14:0 18:0 18:3 20:4 > 20:5 >> 20:0 22:0 22:6 24:0 ACSL3 ACSL4 ACSL5 ACSL6 This table is taken from Soupene and Kuypers (2008). 59

PAGE 168

144 octanoyl CoA glycine and ascorbate yielded the formation of octanamide and gl yoxylate, but a similar experiment using oleoyl CoA in place of octanoyl CoA yielded neither oleamide nor glyoxylate 126 Based on the se data from the Merkler lab combined with the previous literature, ACGNAT is very unlikely to be the in vivo enzyme responsible for long chain NAG production. Two more enzymes that perform related chemistry have been proposed to transfer a glycine to an acyl CoA: one that normally transfers myristoyl groups onto proteins and one that transfers amino acids to bile acids. N M yristoyltransferase (NMT, EC 2.3.1.97) is responsible for the N terminal acylation of p roteins and has a strong preference for myristoyl CoA and an absolute requirement for an N terminal glycine residue ( Equation 4 4 ) Although palmitoyl CoA is a reasonable inhibitor 130 free glycine and proteins with an N terminal other than glycine are not substrates. 131 B ile acid CoA:amino acid N acyltransferase (BAAT, a.k.a. BACAT EC 2.3.1.65) catalyzes the conjugation of glycine or taurine to bile acid CoA thioesters, and may also catalyze NAG biosynthesis in vivo. yrne et al. showed that BAAT could conjugate glycine to fatty acyl CoA thioesters in vitro H owever, V max /K M values were relatively low compared to the bile acid CoA thioesters with the values for the fatty acyl CoAs being only 20% of th at reported for bile acids and there was competing thioesterase activity that resulted in FFA formation even in the presence of glycine. 40 While the in Equation 4 4 : NMT Glycination Reaction

PAGE 169

145 vitro data does support a role for BAAT in the biosynthesis of certain saturated long chain (C 16 C 20:0 ) and very long chain (C 22 C 26:0 ) NAGs the specific activity of BAAT actually decreases for oleoyl CoA when glycine is added as a co substrate an d the specific activity for unsaturated acyl CoAs was a fourth to a th ird of that for saturated acyl CoAs 90 Therefore, if BAAT is an in vivo NAG biosynthesizing enzyme, it would likely function in limited capacity to form only the long chain unsaturated NAGs. The BAAT g lycination reaction is shown in Equation 4 5 The Mueller group has shown that cyto chrome c (cyt c ) is capable of glycin e conjugation in vitro 24,132 A range of N fatty acylamino acids have been sy nthesized from the cognate acyl CoA thioesters and amino acids in the presence of H 2 O 2 including N oleoylglycine, N palmitoylglycine, N stearoylglycine and N arachidonylglycine 10,132 T he optimal pH for these cyt c reactions is 7.5, it displays Michaelis Mentin kinetics with respect to oleoyl CoA, 11 and the K M values are reasonable (~50 M for glycine, 200 900 M for the other amino acids 30 M for oleoyl CoA ) I nhibition studies revealed a preference for acyl chains of 16 carbons or greater. 55,133 This corresponds with previous studies that have demonstrated c yt c to have binding affinity for long chain fatty acyl CoA thioesters, alth ough the acyl CoAs bound less tightly than did FFAs 134 The colocalization of PAM and cyt c in secretory granules 48,50 is also an interesting factor lending creed to the possibility of cyt c mediated NAG biosynthesis ( Table 4 3 ) The proposed reaction is shown in Equation 4 6 Equation 4 5 : BAAT Glycination Reaction O ther amino acids are also used by this enzyme (see text).

PAGE 170

146 The finding the cyt c will catalyze the conjugation of several other oleoylamino acids (and N arachidonoylglycine) as well as anandamide and several PFAMs 11,55,132 could indicate that this chemistry is an artifact of the redox behavior of cyt c and that it may or may not be the in vivo enzyme regulating the biosynthesis of NAGs. The aminolysis of acyl CoAs in the presence of ammonia occurs non enzymatically at pH 9 and above without H 2 O 2 It is possible that H 2 O 2 causes the reduction of Fe 3+ in cyt c, making it a better nucleophile to attack the carboxyl of acyl CoA and inc rease the already high leaving potential of coenzyme A such that glycine or another nucleophile could more easily displace it to form the NAG. In fact, anandamide is formed spontaneously in the presence of arachidonoyl CoA and ethanolamine, and the inclusi on of H 2 O 2 further increased the yield of anandamide Addition of cyt c to this mixture actually reduced the amount of anandamide formed. 10 Heating of the cyt c containing enzyme extract to 95 o C was shown to increase the amount of product made. 11 Incubation with different proteolytic enzymes, chymotrypsin, endoproteinase glu C and elasta se, did not decrease enzymatic act ivity. I ncubation with trypsin and thermolysin was shown to increase enzymatic activity even after 30 minutes of incubation, although the commercially available cyt c also displayed resistance to proteolysis and heat denaturation. 11 These treatments may be remo ving proteins that form inactivating complexes with cyt c or acyl CoAs. Although the optimal pH for these reactions was shown to be 7.5, t he other conditions under which the se reactions were demonstrated are not biologically favorable. Optimal conditions were 100 M oleoyl CoA, 300 mM glycine and 2 mM H 2 O 2 24 and Equation 4 6 : Cyt C Mediated Formation of N Acylglycine Amino acids other than glycine are also substrates. 10

PAGE 171

147 even under these conditions the maximum percent conversion to N oleoylglycine was <15%. 55 Because of this requirement of such high concentrations of ammonia and hydrogen peroxide, and the fact that cyt c co purifies with superoxide dismutase (SOD) and fatty acyl CoA binding protein (ACBP) proposed ( Figure 4 3 in Section 4.2.4 ) for the synthesis of PFAMs. This model may or may not be adaptable to the formation of NAGs if the amino transferase (AT) could also be a glycyl or aminoacyl transferase. More in vivo or in cellulo work is required to determine the exact significance of cyt c in terms of NAG formation. The subcellular localization of cyt c and other putative NAG biosynthetic enzymes is shown in Table 4 3

PAGE 172

148 Table 4 3 : S ubcellular L ocalization of Putative Biosynthetic E nzymes Enzyme Reported Subcellular Localization Ref Acyl CoA:glycine N acyltransferase (ACGNAT) cytoplasm mitochondrion 13,14 Long Chain Fatty Acyl CoA Ligase a (ACSL, all isoforms) cytoplasm cytosol endoplasmic reticulum membrane (mitochondria associated) mitochondrion peroxisome 22,31 33 Bile Acid CoA:amino acid N acyltransferase (BAAT) cytosol peroxisome 40,41 N Myristoyltransferase (NMT) cytosol membrane (minor location) mitochondrion (minor location) 42 44 Fatty acid amide hydrolase (FAAH 1) b, c, d, e membrane 46,47 amidating monooxygenase (PAM) secretory granule cytoplasm membrane (integral) 48,49 Cytochrome C (Cyt c) mitochondrion f secretory granule 50,51 Alcohol dehydrogenase (ADH, all long chain isoforms) g cytosol membrane (outer) 52,53 A ldehyde dehydrogenase (AlDH, all long chain isoforms) h microsome 61 Cytochrome P450 (CYP4F) microsome 66 a Some studies show that different isoforms display different subcellular localizations. For example, ACS1 was identified in endoplasmic reticulum, mitochondria associated membrane and cytosol but not in mitochondria. 22 In the same study, ACS4 was found primarily in the mitochondria associated membrane and in the mitochondrial membrane but not the endoplasmic re ticulum. b There are reports of NMT in cytosol but these were done in Helicobacter pylori and Arabidopsis thaliana 6 7,68 C FAAH 2 was shown to be located extracellularly. 69 d NAAA was located in the peroxisome. 46 e Although both FAAH isoforms possess transmembrane domains, FAAH 1 has its catalytic domain facing the cytoplasm and FAAH 2 the luminal compartment. 47 f During apoptosis, cytochrome c leaves the mitochondria. 51 g Mus musculus lactate dehydrogenase was found extracellularly. 94 h Studies in various yeast isoforms reveal other subcellular localization, including membrane, microbody, microsome, mitochondrion and peroxisome 95,96

PAGE 173

149 4.2.2 Anabolic Route II: N Acylethanolamine Oxidation While it is clear that NAGs are produced in vivo (or in cellulo ) from glycine and fatty acids or acyl CoAs, it is also likely that there is more than one biosynthetic route to NAG formation, j ust as there is more than one biosynthetic route for the NAEs 135 In particular, a second metabolic pathway leading to the NAGs has been proposed : the oxidation of NAEs to NAGs by eith e r an alcohol dehydrogenase alone or the sequential actions of an alcohol dehydrogenase and an aldehyde dehydrogenase ( Equation 4 7 ). It is possible that both NAG biosynthetic pathways operate either in tandem or one may be the favored biosynthetic route in specific cells, tissues, and disease states. The first evidence for the NAE dependent pathway came in 2000 when Burstein et al showed that anandamide is converted t o N arachidonoylglycine in cultured li v er cells and conditioned media 3 More recently, Bradshaw et al. showed the conversion of deuterated anandamide to N aracyidonoylglycine in both RAW 264.7 and C6 glioma cells 25 ( Figure 4 2 NAE oxidation pathway). T hese two cell lines seem to have different types of metabolisms. In addition to the labeled N arachidonoylglycine, the unlabeled Equation 4 7 : Sequential Oxidation of an N Acylethanolamine by ADH or ADH and AlDH The first reaction would be done by an alcohol dehydrogenase. The second reaction would be done by either an alcohol dehydrogenase or an aldehyde dehydrogenase.

PAGE 174

150 product was also found in the C6 glioma (but not RAW 264.7) cells, and upon addition of a FAAH inhibitor, URB 597, the unlabeled NAG was no longer formed in the glioma cells, suggesting that the glioma cells also hydrolyze NAE to its FFA for glycination ( Figure 4 2 glycination pathway) This metabolism was not observed in the RAW 264.7 cells, which only made the NAG through the oxidative pathway and generated the deuterated NAG demonstrating that not only is th ere more than one way to make a NAG but that different cell types show different metabolic profiles. The specific dehydrogenase enzymes responsible for these oxidations have not been determined An alcohol dehydrogenase (ADH) would be responsible for the first oxidation of the NAE to an N acylglycinal (top reaction, Equation 4 7 ). The second ox idation invol ving conversion of an N acylglycinal to the NAG ( bottom reaction Equation 4 7 ) may either be catalyzed by an aldehyde dehydrogenase (AlDH), or and ADH, as s ome ADHs are known to oxidize NAE s and N acylglycinal s 136 Very recently, Figure 4 2 : Two Pathways of Formation for NAGs Work of Bradshaw demonstrates both pathways are at work in C6 glioma cells. Both deuterated and undeuterated N arachidonoylglycine were observed after incubation with D 4 NAE. Upon inhibition of FAAH, only D 2 NAG was observed. 25 The glycination pathway is abbreviated here as an unknown. The authors suggest dire ct glycination of the FFA but their data does not rule out the activation of the FFA to a CoA or similar intermediate. Abreviations: ADH, alcohol dehydrogenase; AlDH, aldehyde dehydrogenase; D 2 /D 4 NAG, deuterated N acylglycine; FAAH, fatty acid amide hydrol ase; NAG, N acylglycine

PAGE 175

151 Aneetha et al. demonstrated the NAD + dependent oxidation of N arachidonoylethanolamine (a.k.a. anandamide ) with purified human ADH 4 (a.k.a. ADH 7, EC 1.1.1.1) in vitro and showed that the unstable N arachidonoylglycinal was then dismutated to the NAG. 137 Another compelling reason to examine this isozyme is that ADH4 was found in the cornea, 138 whe re PFAMs have been found in meibomian gland secretions. 56 Ivkovic et al. demonstrated that a panel of NAE s were substrates for bovine ADH 3 with the V max /K M increasing as the acyl chain increased in length 14 1 Despite this trend, the best NAE substrates exhibited a V max /K M value that was >5% of the values obtained for alcohol substrates. This group determined that ADH3 did not catalyze aldehyde dismutation, meaning that the product was the N acylglycinal, not the NAG In sum, the work of Aneetha et al. and Ivkovic et al validate that the NAEs can serve as substrates for ADH, but it seems unlikely that either enzyme has a role in NAG biosynthesis in vivo although solubility issues only allowed for study of NAEs up to 12 carbons in length A potential role for aldehyde dehydrogenase to catalyze reaction 2 in Equation 4 7 remains unexplored While enzymes i nvolved in NAE oxidation in vivo remain to be definitively identified, work from Burstein and Bradshaw demonstrate that this chemistry does occur in cultured cells. 25,102 The aldehyde dehydrogenases (AlDH) in this study were selected based on their affinity to bind long chain substrates. AlDH3A1 (E.C. 1.2.1.14) is selective for medium to long chain alde hydes. 142 Additionally, AlDH3A1 is found in large abundance in the mammalian cornea (5 50% of water soluble protein depending on spe cies), 143 alongside ADH4, and several PFAMs have been found in meibomian 1 gland secretions. 56 AlDH3A2 (E.C. 1.2.1.48) is k nown to have activity towards saturated and unsaturated aliphatic aldehydes ranging from 6 24 carbons in length, with NAD + as a cofactor. 61 The validity of this work is under debate. While the MS of meibomian secretions show several PFAMs in the Nichols paper, other commonly observed compounds, including cholesterol esters and wax esters, were not present. (139) Butovich, I. A. Prog Retin Eye Res 2009 28 483. In addition, other studies examining the lipid content of meibomian gland secretions did not find PFAMs. (140) Butovich, I. A.; Uchiyama, E.; Di Pascuale, M. A.; McCulley, J. P. Lipids 2007 42 765.

PAGE 176

152 4.2.3 Degradation of Amides F atty acid amide hydrolase (FAAH, EC 3.5.1.4) a n integral membrane enzyme capable of hydrolyzing PFAMs, NAGs and NAEs has been well characterized both in vivo and in vitro 15 21 ( see Figure 4 1 bottom right). Cravatt et.al. used an oleyl trifluoromethylketone column to perform affinity chromatography on rat liver homogenate. Once isolated, they cloned the cDNA for the enzyme, and expression in Chinese hamster ovary (CHO) cells resulted in high levels of hydrolysis, both of oleamide and anandamide, thus proving that this enzyme was responsible for their degradation in cellulo 18 Orthologs were soon identified for human, 15 mouse, 15 and pig. 144 In fact, a FAAH knockout study showed 50 to 100 fold reductions in the hydrolysis rates for anandamide and other fatty acid amides in mice indicating that FAAH is the primary enzyme responsible for their hydrolysis in vivo. 21 Pharmacological blockade of FAAH activity also led to highly elevated levels of endogenous PFAMs, 21,145 147 leading to PFAM associated analgesia, 21,145,148 lowered anxiety, 145 and decreased inflammation. 147,149 This enzyme adds another dimension to the possible control and route to NAG and PFAM biosynthesis and degradation There are two known isoforms of FAAH FAAH 1 and FAAH 2 that show distinct expression patterns. 47 Though the two human isoforms share only 20% sequence identity 47 the murid and human FAAH 1 orthologues share >80% sequence identity, 15 indicating that it is well conserved FAAH 1 and 2 show similar rates of hydrolysis for PFAMs and similar inhibitor sensitivity profiles, but FAAH 2 exhibits greater activity with NAEs and N acyltaurines. 47 The catalytic domain of FAAH 1 is predicted to reside on the cytoplasmic side, whereas that of FAAH 2 is predicted to be oriented in the luminal compartment of the cell by computer modeling and detergent sensitivity experiments. 47 FAAH 2 has been identified in primates, marsupials elephants, and more distantly relat ed vertebrates but not in mouse, rat sheep, dogs, cows or pigs and it is believed that there may have been multiple independent losses of the ancient FAAH 2 gene during mammalian evolution 47 Incidentally, t he FAAH isoform for which we probed in N 18 TG 2 and SCP cells in this study is FAAH 1

PAGE 177

153 In addition to degradation by FAAH, there are several other known possibilities to increase the hydrophilicity of these molecules for uri nary excretion and other purposes Cycl o oxygenase 2 (COX 2 EC 1.14.99.1 ) 62,63 lipoxygenase (LO EC 1.13.11.12 ) 62 A bacterial cytochrome P450 (P450BM 3, a.k.a. CYP102A1) has recently been shown to monooxygenate the acyl chain of N palmitoylglycine and other N palmitoylamino acids. 65 This enzyme is widely studied due to its similarity to mammalian P450s, and the expression of mammalian cytochrome P450 (CYP4F, EC 1.14.13.30) was examined. NAGs contain a peptide bond, and therefore could be susceptible to proteolytic degradation as well 54 These degradative reactions are summarized in Table 4 4 4.2.4 Alternate Proposed Metabolism In addition to the metabolism described above, a number of less well supported hypotheses for PFAM b iosynthesis have been propose d (recently reviewed in ref ere nce s 55,135 ) and are summarized in Table 4 5 T he direct amidation of oleic acid by ammonia catalyzed by either FAAH working in reverse or by a glutamine synthetase lik e enzyme has been proposed by more Table 4 4 : Degradative Reactions for N Acylglycines Enzyme Reaction ref PAM NAG + ASC + O 2 PFAM + SDA + H 2 O + glyoxylate 1 8 FAAH a NAG/PFAM + H 2 O FFA + glycine/NH 3 15 21 Protease NAG + H 2 O FFA + glycine 54 LO NAG + O 2 HETE Gly s (oxidized NAGs) 62 COX 2 b NAG + AH 2 + 2O 2 A + H 2 O + PGH 2 Gly and HETE Gly (oxidized NAGs) 62,63 CY P4 F b,c NAG + AH 2 + O 2 A + H 2 O + ( 3 monohydroxylated NAGs ) 65 Degradative reactions for NAGs. a This has only been shown for certain NAGs. b AH 2 represents an electron acceptor such as NAD + c The coenzyme used here is NADP + because reactions were performed in vitro with bacterial CYP450BM 3 which used NADP + This bacterial P450 is used as a model of mammalian flavoprotein reductase utilizing class II P450s, and the mammalian P450 would presumably use NAD +.

PAGE 178

154 than one group. 23,57 Monocarboxylates like fatty acids are not substrates for either glutamine synthetase 150 or asparagine synthetase 151 T he conversion of oleic acid to oleamide by rat brain microsomes is inhibited by both glutamine and ATP Mg 2+ 57 data arguing against a glutamine synthetase like synthesis of oleamide and the other PFAMs. The direct amidation of a FFA by the action of FAAH working in reverse was demonstrated in vitro 16,57 However, o leamide production in the N 18 TG 2 cells increases upon the inhibition or inactivation of FAAH, 16,57 and FAAH knockout mice were found to have increased levels of N palmitoylglycine, 17 provid ing evidence against a role for this enzyme for PFAM production in vivo In addition, the conditions used to achieve these amidations were not biological: 50 mM ammonia and an optimal pH above 9. 16,57 Another proposed mechanism for oleamide biosynthesis is by aminolysis of phosopholipids 16 or catabolism of sphingomyelin. 73 There is no current eviden ce for sphingomyelin catabolism to a PFAM. 55 Incubation of [ 14 C] oleic acid containing phosphol ipids with NH 4 OH in the presence of N 18 TG 2 cell homogenates did not result in the formation of [ 14 C] oleamide arguing against phospholipid aminolysis as a route to the formation of intracellular oleamide. 16 Mueller and Driscoll (2009) recently report ed oleamide synthesizing activity in fetal bovine serum (FBS). 55 Th CoA and ammonia to form oleamide, or oleoyl CoA and glycine to form N oleoylglycine. The 65 kDa enzyme is reported to be inactivated by normal enzyme denaturing conditions ( heat, solvent, Table 4 5 : Proposed Alternate Paths for Primary Fatty Acid Amide Biosynthesis Proposed Amidation Reaction ref Cytochrome c Acyl CoA + NH 3 + H 2 O 2 + 2H + PFAM + CoA SH + 2H 2 O 11,12 Gln Synthase FFA + ATP + Gln PFAM + ADP + P i + Glu 23 FAAH (in reverse) FFA + NH 3 PFAM + H 2 O 57 Aminolysis Phospholipid + NH 3 PFAM + Lyso Phospholipid 16,35, 36 Catabolism Sphingomyelin PFAM + phosphosphingo choline or ethanolamine 64 Serum synthase Acyl CoA + NH 3 (or gly) PFAM (or NAG)+ H 2 O 55 NAG synthase 1. FFA + gly NAG + H 2 O 2. NAG PFAM via PAM reaction 25

PAGE 179

155 trypsinization) and hydrogen peroxide, whereas cyt c is not inactivated under these conditions. 55 Acyl c oenzyme A is not the only activated intermediate possible. Other possible activated fatty acids for attack by glycine could include a fatty ac yl adenylate similar to the amino acid adenylates involved in charging tRNAs or in the biosynthesis of mycothiol Long chain acyl adenylates are not known, but this does not rule out a potential role for them as activated intermediates. Another possibility could be a fatty acid thioester linked to a cysteine in a carrier protein, similar to intermediates observed in fatty acid biosynthesis Bradshaw et al recently proposed direct glycination of the fatty acid through a nucleophilic attack of the glycyl amino group at the carboxylate of the fatty acid by an unknown NAG synthase. 25 Direct glycination seems chemically unreasonable at biological pH since the amino group would be protonated and thus would be a poor nucleophile to attack the carboxyl One solution could be a decrease in the pK a of the ami no group of the attacking glycine in the active site of the putative NAG synthetase. However, there is no direct evidence for such a novel NAG synthetase. Although the data presented from the Bradshaw group do not rule out such a unique chemistry, it also does not rule out the presence of an activated intermediate such as an acyl CoA. Recent evidence has b een given to show cyt c is responsible for the formation of oleamide as well as N oleoylglycine from oleoyl CoA in the presence of H 2 O 2 in vitro. 11,24,132 Cyt c was first identified as the oleamide synthesizing enzyme in rat liver and kidney extracts. 11 The c yt c reaction has a pH optimum of 7.5, and altho stimulated greatly by the presence of H 2 O 2 it can proceed at a low rate in the absence of H 2 O 2 and has a K M of 2 1 M for oleoyl CoA with NH 3 Radiolabel studies showed that other long chain acyl CoAs could inhibit the formation of 14 C oleamide from 14 C oleoyl CoA, showing that other long chain acyl CoAs could be substrates for cyt c.

PAGE 180

156 However, the in vivo significance of these findings is unclear. C ells lacking both somatic and testicular forms of cyt c failed to upregulate oleamide biosynthesis during apoptosis as expected. 55 Upon protein p urification, t he oleamide synthesizing activity remained after heat denaturation and exposure to proteolytic enzymes, and maximal conversion under optimal conditions was only 39.5%. The turnover rate is also very slow: 1 s 1 in optimal conditions. 11 Neither ammo nia nor H 2 O 2 demonstrate d saturating kinetics, and became inhibitory above their optimal concentrations. 11 Again, t he optimum amounts of H 2 O 2 ( 2 mM) and ammonia ( 1 25 mM) are not in biological range, a finding that has 55 in which cyt c, SOD ACBP and an AT would together act to house these high concentrations of substrates or keep them Figure 4 3 : Hypothesized Oleamide Synthesome Conceptual diagram of oleamide synthesome proposed by Mueller and Driscoll 55 ACBP, Acyl CoA binding protein; AT, ami no transferase; cyt c, cytochrome c; SOD, superoxide dismutase. ACBP orients the acyl CoA so that the thioester is in proximity to the oxidized Fe 3+ which would then become reduced to Fe 2+ AT would provide the amide nitrogen for nucleophilic attack at th e acyl CoA thioester. SOD provides H 2 O 2 necessary to reoxidize the heme. Similar to the diagram in Mueller and Driscoll, 55 but here curved arrows represent electron flow.

PAGE 181

157 in a configuration to lower the optimal concentrations necessary (shown in Figure 4 3 ) Driscoll et al. has co purified an ACBP and SOD with cyt c from rat kidney, providing support for such a synthesome. 11 In this hypothetical oleamide synthesome SOD would produce H 2 O 2 the ACBP would orient they acyl CoA for action by cyt c, and the AT would generate the amide nitrogen, possibly from arginine or glutamine, although the amino transferase has not yet been identified. 55 The studies presented above provide for several hypotheses regarding the biosynthesis of NAGs and PFAMs. A summary of the evidence gathered in vivo and in vit ro/in cellulo is shown in Figure 4 4 Most notably, there is likely more than one biosynthetic mechanism for the formation of NAGs in vivo : oxidation of an NAE and glycination of a FFA. Enzyme expression studies in NAG and PFAM producing cells should shed some light into which enzymes may be involved in their metabolism. In this study we examined the expression of putative NA G and PFAM biosynthetic enz ymes, including ACGNAT, ACSL3 6, BAAT, NMT, FAAH 1, PAM, cyt c, ADH3 4, AlDH3A1 2 and CYP4F.

PAGE 182

158 4.3 Model Cell Systems N 18 TG 2 cells are an excellent model system for PFAM biosynthesis. When cultured with 14 C oleic acid, they produce 14 C oleamide and 14 C oleoylglycine. 28 These cells must, therefore, contain all the necessary e nzymatic machinery to produce PFAMs from FFAs In order to gain a more thorough perspective about long chain PFAM metabolism, two additional cell lines were examined: SCP and HEK 293 cells both of Figure 4 4 : In vitro and I n V ivo Evidence for Amide Metabolism Summary of the current in vitro/in cellulo and in vitro evidence for NAG and PFAM metabolism. Where there was evidence both in vitro and in vivo/cellulo it is shown in green. For more details and specific references, see text.

PAGE 183

159 which were shown to produce oleamide after inc ubation with oleic acid (Chapter 2) S everal PFAMs have been found in the cerebrospinal fluid (CSF), 7 2 74 another reason to suggest that the CSF producing choroid plexus cells are a good candidate for the study of PFAM biosynthesis Glycination is a common method to facilitate urinary detoxification of acyl compounds 152 160 (see also C hapters 1 and 2 ) explaining why these cells have been included in our studies In addition, SCP and N 18 TG 2 cells were shown to produce PFAMs from a variety of FFAs and from an NAE (Chapter 3), making them good candidates for analysis since they must both contain th e enzymatic machinery for both the FFA PFAM conversion and the NAE PFAM conversion In addition to the PFAM producing cell lines, commercially available human cDNA was used for PCR analysis. Liver and kidney cells exhibit the highest expression levels of the short and medium chain acyl CoA processing enzyme ACGNAT 161 166 and were chosen not only to serve as positive control for expression of that enzyme but also for their potential to process long chain acyl CoAs. Liver is also known to express BAAT. 40 Since several PFAMs have been found in the cerebrospinal fluid (CSF), 72 74 whole brain c DNA was also used as another positive control to find any proteins that may be expressed in SCP cells. 4.4 Materials and Methods 4.4.1 Materials Fetal b ovine s erum (FBS) was from Atlanta Biologicals (Lawrenceville, GA) Donor e quine s erum was from Thermo Scientific (Waltham, MA) DMEM, EMEM and penicillin/streptomycin were from Mediatech Cellgro (Manassas, VA) Mou se neuroblastoma N 18 TG 2 cells were from DSMZ (Deutsche Sammlung von Mikrooganism und Zellkuturen GmBH). SCP and HEK 293 cells were from American Type Culture Collection ( Manassas, VA) Primers were from Integrated DNA Technologies (Coralville, IA) MicroPoly(A) Pure mRNA purification kit and RETROscript Reverse Transcription kit were from Ambion (Austin, TX). First s trand human cDNA was from Origene (Rockville, MD) QIA Quick gel extraction kit was from Qiagen (Valencia, CA) PVDF membrane was from M illipore ( Billerica, MA) Tween 20 protease inhibitor

PAGE 184

160 cocktail (P8340) and Bradford reagent w ere from Sigma Aldrich (St. Louis, MO) PAM (S 16) and FAAH (V 17) antibodes and their blocking peptides we re from Santa Cruz Biotech, Inc. (Santa Cruz, CA). FACL 5 (N term), FACL3 (center), and FACL6 (center) antibodies (against ACSL proteins) and their corresponding blocking peptides were from Abgent ( San Diego, CA) Goat anti rabbit and donkey anti goat secondary antibodies conjugated with horse radish peroxidase were from ICN Biomedical (Solon, OH) The SuperSignal chemiluminescent detection system was from Pierce (Rockford, IL) All other reagents and cell culture supplies were of the highest quality available from commercial suppliers. 4.4.2 Cell Culture All cells were grown in 225 cm 2 culture dishes. N 18 TG 2 cells were grown in DMEM supplemented with 100 M 6 thioguanine. SCP and HE K 293 cells were grown in EMEM. All cell types were g r own wi th 100 I.U./ml penicillin, 1.0 mg/m l streptomycin and 10% FBS (SCP and N 18 TG 2 ) or horse serum (HEK 293) at 37 o C and 5% CO 2 according to supplier instructions. Cultures were gown to 80% confluency, cells washed with PBS and tryps i nized. Cells were collected by centrifugation rinsed with PBS, and re pelleted before r emoval of sup ernatant and lysis 4.4.3 Protein Sample Preparation Cell pellets were taken up in lysis buffer containing 20 mM Tris HCl (pH 7.4), 2 mM MgCl 2 1 mM EDTA, 1 mM EGTA, 150 mM NaCl, 1% (v/v) Triton X 100, and 1% (v/v) of a commercially available protease inhibitor cocktail. After incubation at 4 o for 10 minutes, samples were sonicated on ice with a microprobe sonicator for 5 minutes. Samples were then centrifuged and the protein concentration of the supernatant was determined via a Bradford assay using BSA as the instructions. Samples were then diluted to 1 2 mg/ml with running buffer containing 5% mercaptoethanol and boiled for 5 minutes before storing at 20 o C. From Sigma Aldrich (P8340). Contained 4 (2 aminoethyl)benzenesulfonyl fluoride, pepstatin A, E 64, bestatin, leupeptin and aprotinin.

PAGE 185

161 4.4.4 Western Blotting Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) gels were run with 10 % (resolving) and 4% ( stacking ) acrylamide at 17 0 V until the dye front ran off the bottom of the gel (40 70 min) Gels were electroblotted to a PVDF membrane at 80 V for 1 hour and membranes were soaked for 1 hour i n a blocking solution ( Tris buffered saline [ TBS ] con taining 5% nonfat dry milk (NFDM) and 0.5 % Tween 20 (TBS T)), and incubated overnight at 4 o C in the presence of one of the following antib odies: PAM (S 16), FAAH (V 17) FACL5 (N term), FACL3 (c enter), or FACL6 (center) in TBS T with 1% NFDM Antibodies were not commercially available for all enzymes of interest. Western blots were run for all available antibodies. After incubation, the membrane was washed 5 times with TBS T and then incubated for 1 hour with goat anti rabbit or donkey anti goat conjugated with horse radish peroxidase ( diluted 1:10,000) in TBS T with 3% NFDM at room temperature A final set of 5 rinses was performed in TBS T before visuali zi ng antibody antigen complexes using the SuperSignal chemiluminescent detection system on radiographic film. A molecular weight ladder was loaded to a lane on each SDS PAGE gel Initial studies were with an unlabeled ladder, Bio Rad (Hercules, CA) prestained standards, cat# 161 0318, and had to be drawn manually from the PVDF membrane to the film after exposure. Later studies utilized a commercial set of molecular weight standards ( MagicMark TM XP from Invitrogen Carlsbad CA ) and contained an IgG binding site, allowing direct visualization wi th downstream immunodetection. Bands were measured from an origin to make a standard curve and the unknown molecular weight assigned based on that standard curve. One such example of a standard curve is shown in Figure 4 14 Blocking experiments were also performed with each antibody to verify that the proteins being detected were specific for the antibodies being used. Antibodies were incubated with 50x molar excess of blocking peptide for 2 .5 hours at 36 o C with agitation, followed by 2 24 hours at 4 o C in a total volume of 500 l in PBS before continuing with normal Western blot procedure. For FACL5, several bands disappeared in the N 18 TG 2

PAGE 186

162 and SCP samples, leaving behind the bands of appropriate MW for ACSL5. This indicated the location of the true band for ACSL5 and showed that it was being expressed in the cells, as it outcompeted the blocking peptide for FACL5 antibody. The HEK 293 cells did not show reduction of band number but had fewer bands after original incubation with FACL5 antibody. The bands disappeared for the remaining blocking experiments, but all previously detected bands had been the correct MW. 4.4.5 RT PCR and Sequencing Cell sa mples (N 18 TG 2 and SCP) were isolated from culture (one T 75cm 2 flask of ~90% confluency) lysed, and their mRNA isolated using the MicroPoly(A) Pure TM mRNA purification kit. The mRNA sample was then reverse transcribed into cDNA using the RETROscript Reve rse Transcription kit. Human cDNA from liver, kidney and whole brain was used as commercially available. PCR p rimers were designed based on of available sequences from GenBank, and a list of primers used can be found in Appendix D. Typical PCR conditions w ere an initial 3 min denaturation at 95 o C, followed by 25 45 cycles of denaturation at 95 o C (1 min), annealing at 45 o C (1 min) and elongation at 72 o C (1 min) with a final elongation cycle of 7 min at 72 o C. The PCR produ ct was gel purified using a QIA Quick gel extraction kit, and the product sequenced on a Beckman sequencer or sent out for sequence verification at Moffitt Cancer Research Center. Primers were designed from the available sequences using the OligoPerfect TM primer designer from Invitrogen. Man y sequences for sheep are unknown and primers were designed from multiple sequence alignments of other mammalian sequences from regions of high homology Upon verifying sequenced results, Basic Local Alignment Search Tool ( BLAST ) results for multiple relat ed species with a similarity score of 96% were considered positive results for sheep.

PAGE 187

163 4.5 Results 4.5.1 RT PCR Gels The results of RT PCR and PCR are shown below. For all of these samples, bands were subjected to sequencing for verification. BLAST hits of the sequencing results were used to confirm the identity of the putative mRNA sequence. A summary of these results can be found in Table 4 7 and Figure 4 20 1 2 3 4 5 Figure 4 7 : N 18 TG 2 cDNA with Nested PAM primers N ested primers were used to detect the expression of PAM. No band was expected after the first round of PCR. Figure 4 6 : N 18 TG 2 RT PCR for ACSL4 Band on left shows N 18 TG 2 cDNA wit h ACSL4 primers (268 bp) 1 2 3 4 5 6 7 8 Lane 1: neg control 2: ACGNAT (119 bp) 3: ACSL 3 (292 bp) 4: ACSL 5 6 (205 bp) 5: BAAT (197 bp) 6: FAAH (334 bp) 7: PAM (194 bp) 8: MW ladder 400 300 200 100 300 2 00 Lanes 1&2: PAM set 1 primers 3: PAM set 2 primers (nested) (431 bp) 4: PAM set 2 primers, negative control 5. MW ladder 600 500 400 300 2 00 Figure 4 5 : PCR in Human K idney Both ACGNAT bands were sequenced and both were matches to ACGNAT. There are two isomers of ACGNAT and the bands are expected to come from the two isomers.

PAGE 188

164 Figure 4 10 : SCP PCR for PAM SCP cDNA with PAM2 primer (nested) (431 bp) 1 2 3 4 5 6 7 9 10 11 12 13 14 Figure 4 9 : PCR in H uman W hole B rain and L iver cDNA *Note that band is wrong size in lane 13 BLAST search of the sequencing results showed no significant similarity to database sequences 2 3 4 5 Figure 4 8 : PCR for FAAH 400 300 2 00 Lane 1: SCP cDNA (no band) 2: human whole brain cDNA 3: human kidney cDNA 4. human liver cDNA 5: MW ladder All l anes with FAAH primers, and produce bands with 276 bp Lane 1: brain + ACGNAT (119 bp) 2: brain + A CSL 3 (292 bp) 3: brain + ACSL 5 6 (205 bp) 4: brain + BAAT (197 bp) 5: brain + FAAH (334 bp) 6: brain + PAM (194 bp) 7: MW ladder (100 1000 bp) 9: liver + ACGNAT (119 bp) 10: liver + ACSL 3 (292 bp) 11: liver + ACSL 5 6 (205 bp) 12: liver + BAAT (197 bp) 13: liver + FAAH (334 bp)* 14: liver + PAM (194 bp) 1000 800 700 600 500 400 300 400 300 200 100

PAGE 189

165 The PCR for ACGNAT in human kidney revealed two PCR bands ( Figure 4 5 ) both of which were sequenced and both of which were positive matches to human ACGNAT after BLAST analysis. There are two isozymes of ACGNAT, consistent with the finding of two bands. No other ACGNAT PCR revealed two distinct bands. Another anomalous finding was that a band appeared as a product of PCR with human liver cDNA and FAAH primers that was smaller than the expected size ( Figure 4 9 ). Sequencing and BLAST analysis revealed no significant similarity to database sequences. No positive result could be obtained for FAAH in SCP cells. Four different primer sets were designed and tested, each with no positive results. PAM was found in every sample tested, as were each ACS isoform and cyt c, as would be expected. In cases where enzyme expression could not be found in the SCP and N 18 TG 2 model cell lines, human cDNA acted as a means to test the efficacy of the system for detection of those enzymes. ACGNAT, BAAT and AlDH3A2 were all found in the human cDNA but not the model cell lines. CYP4F was not found in SCP cells which may reflect a low abundance or Human (157bp) SCP Liver Brain Kidney N 18 TG 2 (192bp) (177bp) Figure 4 13 : Cytochrome C PCR The expected band sizes are shown above in parentheses. Figure 4 12 : SCP ADH3 PCR SCP with ADH3 primer (323 bp) Kidney Brain Liver Figure 4 11 : AlDH3A2 Human Brain, Liver and Kidney PCR Human DNA with AlDH3A2 primers (324 bp)

PAGE 190

166 expression of a different isoform(s) in those cells, as there are many There were three enzymes whose mRNA could not be detected in any samples: ADH4, AlDH3A1 and NMT (although NMT was only tested in SCP and N 18 TG 2 cDNA). However, other isoforms of ADH and AlDH were detected. Table 4 7 provides a summary of PCR results. 4.5.2 Western Blots Sample Western blots are shown below. Not all enzymes had commercially available antibodies, and Western blots wer e performed for all available antibodies. A summary of these results can be found in Table 4 7 and Figure 4 20 A sample graph for determination of molecular weight from a protein ladder is shown in Figure 4 14 . Figure 4 14 : Standard Curve for a MW Ladder in SDS PAGE y = 0.8925x + 2.1485 R = 0.9808 1.2 1.4 1.6 1.8 2 0.2 0.4 0.6 0.8 1 log MW rf value

PAGE 191

167 HEK 293 N 18 TG 2 SCP 5 g 5 g 5 g 10 g Figure 4 17 : FACL6 Western Blots Western blot for N 18 TG 2 HEK 293 and SCP cells with FACL6 antibody against ACSL6. The amount of protein loaded is listed at the top of each well. Published MW for ACSL6 include 75 kDa (human K562 cells) 30 78 kDa (human erethrocytes) 26,27 A cross reacting protein around 55 kDa (PC12 cells) was also reported 29 HEK 293 N 18 TG 2 SCP 5 g 5 g 5 g 10 g Figure 4 16 : FACL5 Western Blots Western blo t for N 18 TG 2 HEK 293 and SCP cells with FACL5 antibody against ACSL5. The amount of protein loaded is listed at the top of each well. Published MW for ACSL5 include 73, 74.5 and 76 kDa (rat liver) 22,37 N 18 TG 2 HEK 293 N 18 TG 2 22.5g 5g 15g 5g 15g 5g 15g Figure 4 15 : FACL3 Western Blots Western blot for N 18 TG 2 and HEK 293 cells with FACL3 antibody against ACSL3 The amount of protein loaded is listed at the top of each well Published MW for ACSL3 include 79 80 kDa, 73kDa, and 64 kDa 9 (from rat and mouse brain and human liver). The N 18 TG 2 sample on the left was lysed with a protease inhibitor cocktail with dithiothreitol, PMSF, Na 3 VO 4 and aproprotinin instea d of the cocktail from Sigma. 83 74 43 64 75 73 78 57

PAGE 192

168 The Western blot bands detected matched literature reported molecular weights fairly well (see Table 4 6 and ca ptions of Figure 4 15 Figure 4 19 ). Although th e molecular weights in this study that are displayed in Table 4 6 are derived from measuring the distance traveled over the length of the gel and plott ing this ratio against a standard curve, inconsistencies in the gel and interference from overabundant protein in a single well can change the position of the band, as seen in Figure 4 15 In this case, the two different lanes containing HEK 293 proteins show different molecular weights due to iple wells were usually run with different amounts of protein from the same source. In each Western blot sample, the molecular band patterns across the three species were very similar, with the exception of PAM. There are many splice variants of PAM, and HEK 293 N 18 TG 2 SCP 10ug 5ug 10ug 15ug 20ug 25ug 10ug 15ug Figure 4 19 : FAAH (V 17) Western Blot Western blot for N 18 TG 2 HEK 293 and SCP cells with an antibody against FAAH. The amount of protein loaded is listed at the top of each well. FAAH (V 17) was the name of the antibody from Santa Cruz Biotech, Inc. Published MW for FAAH include s 60 kDa (mouse uterus rat COS 7 cells ) 38,39 These samples were lysed with a different protease inhibitor cocktail than listed in the methods. This cocktail contained dithiothre itol, PMSF, Na 3 VO 4 and aproprotinin. SCP N 18 TG 2 HEK 293 10 g 5g 5g 5g Figure 4 18 : PAM (S 16) Western Blot Western blot for N 18 TG 2 HEK 293 and SCP cells with PAM (S 16) antibody against PAM. The amount of protein loaded is listed at the top of each well. PAM (S 16) was the name of the antibody from Santa Cruz Biotech, Inc. Published MW for PAM include 80, 84 86 and 110 kDa (rat tissues) 34 36 PAM 1 from mouse AtT 20 cells is 120 kDa. 37 There are many splice variants of PAM. 37,45 124 85 79 5 7 59

PAGE 193

169 different tissues display different isoform expression 37,45 Expression data gathered through Western blotting matched that gathered via RT PCR. 4.5.3 Summary U sing RT PCR ( or PCR ) and DNA sequencing supplemented and verified by W estern Blot analysis where possible the expression of several purported PFAM biosynthetic enzymes was assayed in a series of cells and cDNA libraries, including the N 18 TG 2 SCP and HEK 293 cells and in cDNA libraries from human liver, kidney, and whole brain cDNA. These expression data for all DNA sources are summarized in Table 4 7 and a visual representat ion of how these data fit with amide metabolism in N 18 TG 2 and SCP cells is shown in Figure 4 20 Not all enzymes had commercially available Table 4 6 : Molecular Weights of Western Blot Bands : Detected and Published Enzyme MW detected Published MW Ref ACSL3 83 83 79 79 79 9 74 74 73 73 73 64 64 64 64 ACSL5 75 75 75 76 74.5 22 73 7 3 73 73 ACSL6 a 78 78 78 78 26,27 57 57 57 55 55 PAM 124 120 34 36 85 84 86 79 79 80 FAAH 59 57 60 60 38,39 Abbreviations: ACSL, long chain acyl CoA synthetase; FAAH, fatty acid amidating monooxygenase Color key: mouse ; sheep ; human ; rat ; monkey The tissue/cell source of each published MW is given in the caption below the corresponding Western blot figure. a A cross reacting 55kDa protein was reported to bind to anti ACSL6 antibodies

PAGE 194

170 antibodies, and where it wa s possible to perform both a Western Blot and RT PCR, the results were in good agreement with each other. Cyt c was found in all cell lines, as would be expected due to its important role in oxidative phosphorylation. The presence of ACSL(3 6) PAM, and FAAH, and not BAAT, ACGNAT or NMT in the oleamide producing N 18 TG 2 cell s supports the hypothesis that cyt c or an enzyme yet to be discovered catalyzes N fatty acylglycine Table 4 7 : Summary of E xpression D ata N 18 TG 2 SCP HEK 293 Liver Brain Enzyme PCR WB PCR WB PCR WB PCR PCR Acyl CoA:glycine N acyltransferase (ACGNAT) P P P+ P+ P Long Chain Fatty Acyl CoA Ligase 3 (ACSL3) W+ W+ P+ W+ P+ P+ Long Chain Fatty Acyl CoA Ligase 4 (ACSL4) P+ P+ Long Chain Fatty Acyl CoA Ligase 5 (ACSL5) W+ W+ P+ W+ P+ Long Chain Fatty Acyl CoA Ligase 6 (ACSL6) W+ W+ P+ W+ P+ Bile Acid CoA:amino acid N acyl transferase (BAAT) P P P P+ P N Myristoyltransferase (NMT) P P Fatty acid amide hydrolase (FAAH 1) P+ W+ P W P+ W+ P+ P+ Peptidylglycine amidating monooxygenase ( PAM ) P+ W+ P+ W+ P+ W+ P+ P+ Cytochrome C (Cyt c) P+ P+ P+ P+ P+ Alcohol dehydrogenase 4 (ADH4) P P P P P Alcohol dehydrogenase 3 (ADH3) P P+ P+ P+ P+ Aldehyde dehydrogenase 3A1 (AlDH3A1) P P P P P Aldehyde dehydrogenase 3A2 (AlDH3A2) P P P+ P+ P+ Cytochrome P450 (CYP4F) P+ P P+ P+ P+ P+/ expression was/was not found by (RT )PCR; W+/ expression was/was not found by Western Blot For human kidney samples, the cDNA was used for PCR and HEK 293 cells were used for Western blotting. PCR and Western blot results agree. At least one positive result was obtained for each enzyme except AlDH3A1 and NMT.

PAGE 195

171 production by the proposed glycination route in vivo Control experiments showing the expression of ACGNAT and BAAT in liver and ACGNAT in kidney are cons istent with literature reports 40,125,128,129 and demonstrate the ability to find those enzymes at least in those cells. The expression of metabolic processing enzymes as found in these studies may contribute to the small amounts of NAGs isolated throughout tissue and c ell types, 17,101 103,111 since any NAG formed would be quickly metabolized by PAM, FAAH or CYP4F, or any of the other processing enzymes not probed for in this study ( Table 4 4 ). No ADH4 expression was found in any cells, but those tissues probed are not known to contain ADH4, which is characteristically expressed in epithelial tissues of the aerodigestive tract and a few other tissues 167 The lack of expression of the specific ADH and AlD H enzymes for which we probed denotes that either other ADH and possibly AlDHs may be responsible for NAE oxidation in N 18 TG 2 cells, or that glycination of the FFA is the only pathway for NAG formation in these cells (aside from possible direct amidation of acyl CoA by cyt c, or some unknown possibility)

PAGE 196

172 The expression of ADH3 alongside PAM, ACS L and cyt c in the SCP cells shows that there are multiple possible mechanisms to synthesize NAGs in these cells, and confirms that the metabolic network may be more complicated than a linear scheme ( refer to Figure 4 1 Figure 4 20 ). SCP cells may be able to synthesize NAGs both through glycination of th e FFA and oxidation of an NAE. FAAH had previously been found in N 18 TG 2 cells, 168,169 and those findings were confirmed in this report. FAAH 1 was also found in human liver, kidney and brain, 47,170 findings which were also replicated here. SCP cells had approximately 45 times as much endogenous oleamide and at le ast 10 times as much after incubation with oleic acid (see Figure 4 20 : Metabolic Diagram of Expression Data for SCP and N 18 TG 2 Cells Overview of expression data in SCP (pink) and N 18 TG 2 (orange) expression data as it relates to the proposed metabolic pathways.

PAGE 197

173 C hapters 2 and 3) The lack of detectable levels of FAAH expression in SCP cells is commensurate with the higher levels of PFAM that were detected in previous chapters, and makes sense given the kn own role of choroid plexus in producing CSF 171 where PFAMs have been found 72 74,172 The literature precedence for FAAH expression is mixed W hile there has been a noted lack of FAAH expression in mouse choroid plexus (CP) 173 FAAH has been found in rat CP. 173 Since o leamide has been found in rat plasma (35 56nM) 89,172 and rat cerebrospinal fluid (156nM) 172 e nzymologic studies may reveal the affinity of r at FAAH or for the active oleoyl amide in rats to be primarily N oleoylglycine, since it can act independently of oleamide 104 The possibility that different mammalian FAAH shows d ifferent substrate specificity may have some precedence. A lthough human and rat FAAHs share 82% amino acid identity, they demonstrate distinguishable enzymological properties. 15 Rat FAAH shows a much lower rate of hydrolysis of myristamide and palmitamide than does human FAAH; human FAAH hydrolyzes these substrates about three times faster. 15 N arachidonoylglycine is a much more potent inhibitor of rat FAAH than of human or mouse, and N arachidonoylalanine is a much more potent inhibitor of human and rat FAAH than of m ouse. 20 The level o f each PFAM found in Chapter 3 after incubation with the corresponding FFA in N 18 TG 2 cells was inversely proportional to substrate preference for FAAH, but this pattern was not observed in SCP With no FAAH to put pressure on the degradation of these PFAMs the SCP cells showed a different profile. This difference in PFAM fingerprint, along with the large difference in PFAM amount in the two cell lines, demonstrates the importance of FAAH in determining endogenous levels of PFAMs One of the central questi ons in NAG biosynthesis is that of the prevalence of the two competing pathways hypothesized: NAE oxidation of FFA glycination ( Figure 4 2 ) In Chapter 3 it was shown that SCP and N 18 TG 2 cells show different affinities for FFA s and NAE s in converting them to the PFAM. N 18 TG 2 cells were indiscriminant with respect to the formation of tridecanamide from its two metabolic precursors: N tridecanoylethanolamine (TDEA) and tridecanoic acid (TDA) SCP cells however, were able to convert TDEA to the corresponding PFAM at a higher rate than for the FFA. One

PAGE 198

174 possibility is the differential expression of discriminating fatty acyl amide transport proteins in the two cell lines. The expression data presented here provides a hypothesis. N 18 TG 2 likely metabolized TDEA to TDA by way of FAAH before conversion to tridecanamide. This may explain why TDA and TDEA w ere equal metabolic substrates in N 18 TG 2 in terms of PFAM formation as the acyl chains would all proceed through the same metabolic pathway, and the action of FAAH would not impede this metabolism due to its high turnover rate 15 Another NAE hydrolyzing enzyme, N acylethano lamine hydrolyzing acid amidase ( NAAA ) may also hydrolyze TDEA to its corresponding FFA. 46 The expression of NAAA was not examined. SCP cells were shown to express ADH3. While AD H3 is not known to perform the N acylglycinal NAG reaction, it could be responsible for the synthesis of the aldehyde intermediate and an unidentified enzyme could finish the oxidation to an NAG. Studies have also shown that this dismutation of the relat ively unstable long chain aldehyde intermediate to its NAG can proceed at low rates non enzymatically. 141 Therefore, it is hypothesized that sequential oxidation of an NAE is the preferred metabolic route in SCP cells. HEK 293 cells were used for the Western blot expression studies, but commercially available human whole kidney cDNA was used for PCR. A ll the enzymes found in the whole human kidney cDNA were also found in HEK 293 cells even though HEK 293 contained only epithelial cells of the kidney. 4.6 Conclusions The expression data presented here helps confirm several hypotheses diagrammed in Figure 4 1 Sequential oxidation of an N AE is a possible alternate route to the synthesis of N acylglycines since dehydrogenases were found to be expressed in oleamide producing SCP cells cells that also showed a differential pattern of FFA and NAE conversion to PFAMs than N 18 TG 2 cells Perhaps the most significant finding was in regards to putative enzymes in volved in the acyl CoA NAG reaction. Cyt c or a novel enzyme is likely to be i nvolved in conversion from acyl CoA to the NAG intermediate since no other CoA:glycine transferring candidate enzymes were found in

PAGE 199

175 the N 18 TG 2 cells ( Figure 4 20 and Table 4 8 ) M ore analysis is required to determine the exact in vivo role of cyt c and regulatory mechanisms of this pathway. 4.7 References (1) Wilcox, B. J.; Ritenour Rodgers, K. J.; Asser, A. S.; Baumgart, L. E.; Baumgart, M. A.; Boger, D. L.; DeBlassio, J. L.; deLong, M. A.; Glufke, U.; Henz, M. E.; King, L., 3rd; Merkler, K. A.; Patterson, J. E.; Robleski, J. J.; Vederas, J. C.; Merkler, D. J. Biochemistry 1999 38 3235. (2) DeBlassio, J. L.; deLong, M. A.; Glufke, U.; Kulathila, R.; Merkler, K. A.; Vederas, J. C.; Merkler, D. J. Arch Biochem Biophys 2000 383 46. (3) Burstein, S. H.; Rossetti, R. G.; Yagen, B.; Zurier, R. B. Prostaglandins O ther Lipid Mediat 2000 61 29. (4) Sorondo, J. P., University of South Florida, 2002. (5) King, L., 3rd; Barnes, S.; Glufke, U.; Henz, M. E.; Kirk, M.; Merkler, K. A.; Vederas, J. C.; Wilcox, B. J.; Merkler, D. J. Arch Biochem Biophys 2000 374 107. (6) McIntyre, N. R.; Lowe, E. W., Jr.; Chew, G. H.; Owen, T. C.; Merkler, D. J. FEBS Lett 2006 580 521. (7) Miller, L. A.; Baumgart, L. E.; Chew, G. H.; deLong, M. A.; Galloway, L. C.; Jung, K. W.; Merkler, K. A.; Nagle, A. S.; Poore, D. D.; Yoon, C. H.; Mer kler, D. J. Arch Biochem Biophys 2003 412 3. (8) Merkler, D. J.; Merkler, K. A.; Stern, W.; Fleming, F. F. Arch Biochem Biophys 1996 330 430. (9) Li, J.; Sheng, Y.; Tang, P. Z.; Tsai Morris, C. H.; Dufau, M. L. J Steroid Biochem Mol Biol 2006 98 207. (10) McCue, J. M.; Driscoll, W. J.; Mueller, G. P. Prostaglandins Other Lipid Mediat 2009 90 42. (11) Driscoll, W. J.; Chaturvedi, S.; Mueller, G. P. J Biol Chem 2007 282 22353. (12) Sung, Y. K.; Park, M. K.; Hong, S. H.; Hwang, S. Y.; Kwack, M. H.; Kim, J. C.; Kim, M. K. Exp Mol Med 2007 39 477. Table 4 8 : NAG Synthesizing Enzymes in N 18 TG 2 Cells Enzyme Reaction Catalyzed Expressed in N 18 TG 2 ACGNAT R CO S CoA + Gly R CO NH CH 2 COOH + CoA SH No Cyt C R CO S CoA + Gly R CO NH CH 2 COOH + CoA SH Yes NMT Myristoyl CoA + Gly Peptide Myristoyl Gly Peptide + CoA SH No BAAT Bile Acyl CO S CoA + Gly Bile Acyl CO NH CH 2 COOH + CoA SH No ADH3 R CO NH CH 2 CH 2 OH + NAD + R CO NH CH 2 CHO + NADH No ADH4 R CO NH CH 2 CH 2 OH + NAD + R CO NH CH 2 CHO + NADH No FAlDH3A1 R CO NH CH 2 CHO + NAD + R CO NH CH 2 COOH + NADH No FAlDH3A2 R CO NH CH 2 CHO + NAD + R CO NH CH 2 COOH + NADH No

PAGE 200

176 (13) Kolvraa, S.; Gregersen, N. Biochem Med Metab Biol 1986 36 98. (14) Zhang, H. X.; Lang, Q. Y.; Li, J.; Zhong, Z. M.; Xie, F.; Ye, G. M.; Wan, B.; Yu, L. International Journal of Molecular Sciences 2007 8 433. (15) Giang, D. K.; Cravatt, B. F. Proc Natl Acad Sci U S A 1997 94 2238. (16) Bisogno, T.; Sepe, N.; De Petroce llis, L.; Mechoulam, R.; Di Marzo, V. Biochem Biophys Res Commun 1997 239 473. (17) Rimmerman, N., Bradshaw, HB, Hughes, HV, Chen, JS, Hu, SS, McHugh, D, Vefring, E, Jahnsen, JA, Thompson, EL, Masuda, K, Cravatt, BF, Burstein, S, Vasko, MR, Prieto, AL, O 'Dell, DK, Walker, JM. Molecular Pharmacology 2008 74 213. (18) Cravatt, B. F.; Giang, D. K.; Mayfield, S. P.; Boger, D. L.; Lerner, R. A.; Gilula, N. B. Nature 1996 384 83. (19) Movahed, P.; Jonsson, B. A.; Birnir, B.; Wingstrand, J. A.; Jorgensen, T. D.; Ermund, A.; Sterner, O.; Zygmunt, P. M.; Hogestatt, E. D. J Biol Chem 2005 280 38496. (20) Grazia Cascio, M.; Minassi, A.; Ligresti, A.; Appendino, G.; Burstein, S.; Di Marzo, V. Biochem Biophys Res Commun 2004 314 192. (21) Cravatt, B. F.; Demare st, K.; Patricelli, M. P.; Bracey, M. H.; Giang, D. K.; Martin, B. R.; Lichtman, A. H. Proc Natl Acad Sci U S A 2001 98 9371. (22) Lewin, T. M.; Kim, J. H.; Granger, D. A.; Vance, J. E.; Coleman, R. A. J Biol Chem 2001 276 24674. (23) Bisogno, T.; Kata yama, K.; Melck, D.; Ueda, N.; De Petrocellis, L.; Yamamoto, S.; Di Marzo, V. Eur. J. Biochem. 1998 254 634. (24) Mueller, G. P.; Driscoll, W. J. J Biol Chem 2007 282 22364. (25) Bradshaw, H. B.; Rimmerman, N.; Hu, S. S.; Benton, V. M.; Stuart, J. M.; Masuda, K.; Cravatt, B. F.; O'Dell, D. K.; Walker, J. M. BMC Biochem 2009 10 14. (26) Malhotra, K. T.; Malhotra, K.; Lubin, B. H.; Kuypers, F. A. Biochem J 1999 344 Pt 1 135. (27) Oldham, C. D.; Li, C.; Feng, J.; Scott, R. O.; Wang, W. Z.; Moore, A. B. ; Girard, P. R.; Huang, J.; Caldwell, R. B.; Caldwell, R. W.; May, S. W. Am J Physiol 1997 273 C1908. (28) Merkler, D. J.; Chew, G. H.; Gee, A. J.; Merkler, K. A.; Sorondo, J. P.; Johnson, M. E. Biochemistry 2004 43 12667. (29) Marszalek, J. R.; Kitidis, C.; Dirusso, C. C.; Lodish, H. F. J Biol Chem 2005 280 10817. (30) Soupene, E.; Kuypers, F. A. BMC Mol Biol 2006 7 21. (31) Tang, P. Z.; Tsai Morris, C. H.; Dufau, M. L. Proc Natl Acad Sci U S A 2001 98 6581. (32) Milger, K .; Herrmann, T.; Becker, C.; Gotthardt, D.; Zickwolf, J.; Ehehalt, R.; Watkins, P. A.; Stremmel, W.; Fullekrug, J. J Cell Sci 2006 119 4678. (33) Jia, Z.; Moulson, C. L.; Pei, Z.; Miner, J. H.; Watkins, P. A. J Biol Chem 2007 282 20573. (34) Hu, H. M.; Thorn, N. A. FEBS Lett 1993 324 331. (35) el Meskini, R.; Delfino, C.; Boudouresque, F.; Hery, M.; Oliver, C.; Ouafik, L. Endocrinology 1997 138 379.

PAGE 201

177 (36) Girard, B.; Ouafik, L.; Boudouresque, F. Cell Tissue Res 1999 298 489. (37) Eipper, B. A.; Blo omquist, B. T.; Husten, E. J.; Milgram, S. L.; Mains, R. E. Ann N Y Acad Sci 1993 680 147. (38) Paria, B. C.; Zhao, X.; Wang, J.; Das, S. K.; Dey, S. K. Biology of Reproduction 1999 60 1151. (39) Tsou, K.; Nogueron, M. I.; Muthian, S.; Sanudo Pena, M. C.; Hillard, C. J.; Deutsch, D. G.; Walker, J. M. Neurosci Lett 1998 254 137. (40) O'Byrne, J.; Hunt, M. C.; Rai, D. K.; Saeki, M.; Alexson, S. E. J Biol Chem 2003 278 34237. (41) Pellicoro, A.; v an den Heuvel, F. A.; Geuken, M.; Moshage, H.; Jansen, P. L.; Faber, K. N. Hepatology 2007 45 340. (42) McIlhinney, R. A.; McGlone, K. J Neurochem 1990 54 110. (43) McIlhinney, R. A.; McGlone, K. Exp Cell Res 1996 223 348. (44) Raju, R. V.; Kakkar, R.; Datla, R. S.; Radhi, J.; Sharma, R. K. Exp Cell Res 1998 241 23. (45) Eipper, B. A.; Milgram, S. L.; Husten, E. J.; Yun, H. Y.; Mains, R. E. Protein Sci 1993 2 489. (46) Tsuboi, K.; Takezaki, N.; Ueda, N. Chem Biodivers 2007 4 1914. (47) Wei, B. Q.; Mikkelsen, T. S.; McKinney, M. K.; Lander, E. S.; Cravatt, B. F. J Biol Chem 2006 281 36569. (48) Eipper, B. A.; Stoffers, D. A.; Mains, R. E. Annu Rev Neurosci 1992 15 57. (49) Oyarce, A. M.; Eipper, B. A. J Neurochem 1993 60 1105. (50) Soltys, B. J.; Andrews, D. W.; Jemmerson, R.; Gupta, R. S. Cell Biol Int 2001 25 331. (51) Liu, X.; Kim, C. N.; Yang, J.; Jemmerson, R.; Wang, X. Cell 1996 86 147. (52) Cheung, C.; Smith, C. K.; Hoog, J. O.; Hotchkiss, S. A. Biochem Biophy s Res Commun 1999 261 100. (53) Haddock, B. A.; Yates, D. W.; Garland, P. B. Biochem J 1970 119 565. (54) Bunting, J. W.; Chu, S. S. Biochim Biophys Acta 1978 524 393. (55) Mueller, G. P.; Driscoll, W. J. Vitam Horm 2009 81 55. (56) Nichols, K. K.; Ham, B. M.; Nichols, J. J.; Ziegler, C.; Green Church, K. B. Invest Ophthalmol Vis Sci 2007 48 34. (57) Sugiura, T.; Kondo, S.; Kodaka, T.; Tonegawa, T.; Nakane, S.; Yamashita, A.; Ishima, Y.; Waku, K. Biochem Mol Biol Int 1996 40 931. (58) Arafat, E. S.; Trimble, J. W.; Andersen, R. N.; Dass, C.; Desiderio, D. M. Life Sci 1989 45 1679. (59) Soupene, E.; Kuypers, F. A. Exp Biol Med (Maywood) 2008 233 507. (60) Sultana, T. Doctoral Dissertation, Duquesne University, 2005. (61) Kelson, T. L.; Secor McVoy, J. R.; Rizzo, W. B. Biochim Biophys Acta 1997 1335 99. (62) Prusakiewicz, J. J.; Turman, M. V.; Vila, A.; Ball, H. L.; Al Mestarihi, A. H.; Di Marzo, V.; Marnett, L. J. Arch Biochem Biophys 2007 464 260. (63) Prusakiewicz, J J.; Kingsley, P. J.; Kozak, K. R.; Marnett, L. J. Biochem Biophys Res Commun 2002 296 612. (64) Lerner, R. A.; Siuzdak, G.; Prosperogarcia, O.; Henriksen, S. J.; Boger, D. L.; Cravatt, B. F. Proc. Natl. Acad. Sci. U. S. A. 1994 91 9505.

PAGE 202

178 (65) Haines, D., Tomchick, DR, Machius M, Peterson, JA. Biochemistry 2001 40 13456. (66) Soberman, R. J.; Okita, R. T.; Fitzsimmons, B.; Rokach, J.; Spur, B.; Austen, K. F. J Biol Chem 1987 262 12421. (67) Skouloubris, S.; Labigne, A.; De Reuse, H. Mol Microbiol 1997 25 989. (68) Pollmann, S.; Neu, D.; Lehmann, T.; Berkowitz, O.; Schafer, T.; Weiler, E. W. Planta 2006 224 1241. (69) Sutherland, P. J.; Tobin, A. E.; Rutherford, C. L.; Price, N. P. J Biol Chem 1998 273 4459. (70) Morisseau, C.; Newman, J. W.; Dowdy, D. L.; Goodrow, M. H.; Hammock, B. D. Chem Res Toxicol 2001 14 409. (71) Cravatt, B. F.; Prospero Garcia, O.; Siuzdak, G.; Gilula, N. B.; Henriksen, S. J.; Boger, D. L.; Lerner, R. A. Science 1995 268 1506. (72) Cravatt, B. F., Lerner, R.A. and Boger, D.L. In J Am Chem Soc 1996; Vol. 118, p 580. (73) Lerner, R. A.; Siuzdak, G.; Prospero Garcia, O.; Henriksen, S. J.; Boger, D. L.; Cravatt, B. F. Proc Natl Acad Sci U S A 1994 91 9505. (74) Boger, D. L.; Henriksen, S. J.; Cravatt, B. F. Curr Pharm Des 1998 4 303. (75) Guan, X. J.; Cravatt, B. F.; Ehring, C. R.; Hall, J. E.; Boger, D. L.; Lerner, R. A.; Gilula, N. B. J. Cell Biol. 1997 139 1785. (76) Murillo Rodriguez, E.; Giordano, M.; Cabeza, R.; Henriksen, S. J.; Diaz, M. M.; Navarro, L.; Pro spero Garcia, O. Neurosci. Lett. 2001 313 61. (77) Basile, A. S.; Hanus, L.; Mendelson, W. B. Neuroreport 1999 10 947. (78) Huitron Resendiz, S.; Gombart, L.; Cravatt, B. F.; Henriksen, S. J. Exp. Neurol. 2001 172 235. (79) Lo, Y. K.; Tang, K. Y.; Chang, W. N.; Lu, C. H.; Cheng, J. S.; Lee, K. C.; Chou, K. J.; Liu, C. P.; Chen, W. C.; Su, W.; Law, Y. P.; Jan, C. R. Biochem Pharmacol 2001 62 1363. (80) Yost, C. S.; Hampson, A. J.; Leonoudakis, D.; Koblin, D. D.; Bornheim, L. M.; Gray, A. T. Anesth Analg 1998 86 1294. (81) Lees, G.; Edwards, M. D.; Hassoni, A. A.; Ganellin, C. R.; Galanakis, D. Br J Pharmacol 1998 124 873. (82) Verdon, B.; Zheng, J.; Nicholson, R. A.; Ganelli, C. R.; Lees, G. Br J Pharmacol 2000 129 283. (83) Laposky, A. D.; Homanics, G. E.; Basile, A.; Mendelson, W. B. Neuroreport 2001 12 4143. (84) Nicholson, R. A.; Zheng, J.; Ganellin, C. R.; Verdon, B.; Lees, G. Anesthesiology 2001 94 120. (85) Langstein, J.; Hofstadter, F.; Schwarz, H. Res. Immun ol. 1996 147 389. (86) Lee, D. W.; Sung, M. W.; Park, S. W.; Seong, W. J.; Roh, J. L.; Park, B.; Heo, D. S.; Kim, K. H. Anticancer Res. 2002 22 2089. (87) Yang, J. Y.; Abe, K.; Xu, N. J.; Matsuki, N.; Wu, C. F. Neurosci. Lett. 2002 328 165. (88) Stew art, J. M.; Boudreau, N. M.; Blakely, J. A.; Storey, K. B. J. Therm. Biol. 2002 27 309.

PAGE 203

179 (89) Driscoll, W. J.; Mueller, S. A.; Eipper, B. A.; Mueller, G. P. Mol Pharmacol 1999 55 1067. (90) Hiley, C. R.; Hoi, P. M. Cardiovasc Drug Rev 2007 25 46. (91) Boger, D. L.; Patterson, J. E.; Guan, X.; Cravatt, B. F.; Lerner, R. A.; Gilula, N. B. Proc Natl Acad Sci U S A 1998 95 4810. (92) Huang, J. K.; Jan, C. R. Life Sci 2001 68 997. (93) Liu, Y. C.; Wu, S. N. Eur J Pharmacol 2003 458 37. (94) Fontaine, F. R.; Dunlop, R. A.; Petersen, D. R.; Burcham, P. C. Chemical Research in Toxicology 2002 15 1051. (95) Jenkins, R. O.; Cartledge, T. G.; Lloyd, D. J. Gen. Microbiol. 1983 129 1171. (96) Ueda, M.; Tanaka, A. Method Enzymol. 1990 188 176. (97) Huidobro Toro, J. P.; Harris, R. A. Proc Natl Acad Sci U S A 1996 93 8078. (98) Thomas, E. A.; Carson, M. J.; Neal, M. J.; Sutcliffe, J. G. Proc Natl Acad Sci U S A 1997 94 14115. (99) Hedlund, P. B.; Carson, M. J.; Sutcliffe, J. G.; Thomas, E. A. Biochem Pharmacol 1999 58 1807. (100) Tan, B.; O'Dell, D. K.; Yu, Y. W.; Monn, M. F.; Hughes, H. V.; Burstein, S.; Walker, J. M. J Lipid Res 2010 51 112. (101) Tan, B.; William Yu, Y.; Francesca Monn, M.; Velocity Hughes, H.; O'Dell, D. K.; Michael Wa lker, J. Journal of Chromatography B 2009 877 2890. (102) Bradshaw, H. B.; Rimmerman, N.; Hu, S. S.; Burstein, S.; Walker, J. M. Vitam Horm 2009 81 191. (103) Tan, B.; Bradshaw, H. B.; Rimmerman, N.; Srinivasan, H.; Yu, Y. W.; Krey, J. F.; Monn, M. F.; Chen, J. S.; Hu, S. S.; Pickens, S. R.; Walker, J. M. AAPS J 2006 8 E461. (104) Chaturvedi, S.; Driscoll, W. J.; Elliot, B. M.; Faraday, M. M.; Grunberg, N. E.; Mueller, G. P. Prostaglandins Other Lipid Mediat 2006 81 136. (105) Mitchell, C. A.; Davie s, M. J.; Grounds, M. D.; McGeachie, J. K.; Crawford, G. J.; Hong, Y.; Chirila, T. V. J Biomater Appl 1996 10 230. (106) Hamberger, A.; Stenhagen, G. Neurochem Res 2003 28 177. (107) Wakamatsu, K.; Masaki, T.; Itoh, F.; Kondo, K.; Sudo, K. Biochem Biop hys Res Commun 1990 168 423. (108) Kohno, M.; Hasegawa, H.; Inoue, A.; Muraoka, M.; Miyazaki, T.; Oka, K.; Yasukawa, M. Biochem Biophys Res Commun 2006 347 827. (109) Wiles, A. L.; Pearlman, R. J.; Rosvall, M.; Aubrey, K. R.; Vandenberg, R. J. J Neurochem 2006 99 781. (110) Burstein, S. H.; Adams, J. K.; Bradshaw, H. B.; Fraioli, C.; Rossetti, R. G.; Salmonsen, R. A.; Shaw, J. W.; Walker, J. M.; Zipkin, R. E.; Zurier, R. B. Bioorg Med Chem 2007 15 3345. (111) Huang, S. M.; Bisogno, T.; Petros, T. J.; Chang, S. Y.; Zavitsanos, P. A.; Zipkin, R. E.; Sivakumar, R.; Coop, A.; Maeda, D. Y.; De Petrocellis, L.; Burstein, S.; Di Marzo, V.; Walker, J. M. J Biol Chem 2001 276 42639. (112) Succar, R.; Mitchell, V. A.; Vaughan, C. W. Mol Pain 2007 3 2 4. (113) Vuong, L. A.; Mitchell, V. A.; Vaughan, C. W. Neuropharmacology 2008 54 189.

PAGE 204

180 (114) Bradshaw, H. B.; Rimmerman, N.; Krey, J. F.; Walker, J. M. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006 291 R349. (115) Eipper, B. A.; Mains, R. E.; Glemb otski, C. C. Proc Natl Acad Sci U S A 1983 80 5144. (116) Ritenour Rodgers, K. J.; Driscoll, W. J.; Merkler, K. A.; Merkler, D. J.; Mueller, G. P. Biochem Biophys Res Commun 2000 267 521. (117) Waku, K. Biochim Biophys Acta 1992 1124 101. (118) Watki ns, P. A. J Biol Chem 2008 283 1773. (119) Parkes, H. A.; Preston, E.; Wilks, D.; Ballesteros, M.; Carpenter, L.; Wood, L.; Kraegen, E. W.; Furler, S. M.; Cooney, G. J. Am J Physiol Endocrinol Metab 2006 291 E737. (120) Woldegiorgis, G.; Spennetta, T.; Corkey, B. E.; Williamson, J. R.; Shrago, E. Anal Biochem 1985 150 8. (121) Deutsch, J.; Grange, E.; Rapoport, S. I.; Purdon, A. D. Anal. Biochem. 1994 220 321. (122) Mawal, Y. R.; Qureshi, I. A. Biochem Biophys Res Commun 1994 205 1373. (123) Asaoka, K. Int J Biochem 1991 23 429. (124) Nandi, D. L.; Lucas, S. V.; Webster, L. T., Jr. J Biol Chem 1979 254 7230. (125) Kelley, M.; Vessey, D. A. J Biochem Toxicol 1994 9 153. (126) Ritenour Rodgers, K. J., Dusquesne, 1999. (127) Bartlett, K.; Gompertz, D. Biochemical Medicine 1974 10 15. (128) Gregersen, N.; Kolvraa, S.; Mortensen, P. B. Biochem Med Metab Biol 1986 35 210. (129) Kelley, M.; Vessey, D. A. J Biochem Toxicol 1993 8 63. (130) Glover, C. J.; Goddard, C.; Felsted, R. L. Biochem J 1988 250 485. (131) Rajala, R. V.; Datla, R. S.; Moyana, T. N.; Kakkar, R.; Carlsen, S. A.; Sharma, R. K. Mol Cell Biochem 2000 204 135. (132) McCue, J. M.; Driscoll, W. J.; Mueller, G. P. Biochem Biophys Res Commun 2008 365 322. (13 3) Mueller, G. P.; Driscoll, W. J. Journal of Biological Chemistry 2007 282 22364. (134) Stewart, J. M.; Blakely, J. A.; Johnson, M. D. Biochem Cell Biol 2000 78 675. (135) Farrell, E. K.; Merkler, D. J. Drug Discov Today 2008 13 558. (136) Henehan, G. T.; Oppenheimer, N. J. Biochemistry 1993 32 735. (137) Aneetha, H.; O'Dell, D. K.; Tan, B.; Walker, J. M.; Hurley, T. D. Bioorg Med Chem Lett 2009 19 237. (138) Downes, J. E.; VandeBerg, J. L.; Hubbard, G. B.; Holmes, R. S. Cornea 1992 11 560. (13 9) Butovich, I. A. Prog Retin Eye Res 2009 28 483. (140) Butovich, I. A.; Uchiyama, E.; Di Pascuale, M. A.; McCulley, J. P. Lipids 2007 42 765. (141) Ivkovic, M.; Lowe, E. W.; Merkler, D. J. in press 2010 (142) Bains, J.; Boulanger, M. J. J Mol Biol 2008 379 597. (143) Estey, T.; Piatigorsky, J.; Lassen, N.; Vasiliou, V. Exp Eye Res 2007 84 3. (144) Goparaju, S. K.; Kurahashi, Y.; Suzuki, H.; Ueda, N.; Yamamoto, S. Biochim Biophys Acta 1999 1441 77.

PAGE 205

181 (145) Kathuria, S.; Gaetani, S.; Fegley, D.; V alino, F.; Duranti, A.; Tontini, A.; Mor, M.; Tarzia, G.; La Rana, G.; Calignano, A.; Giustino, A.; Tattoli, M.; Palmery, M.; Cuomo, V.; Piomelli, D. Nat Med 2003 9 76. (146) Lichtman, A. H.; Leung, D.; Shelton, C. C.; Saghatelian, A.; Hardouin, C.; Boge r, D. L.; Cravatt, B. F. J Pharmacol Exp Ther 2004 311 441. (147) Cravatt, B. F.; Saghatelian, A.; Hawkins, E. G.; Clement, A. B.; Bracey, M. H.; Lichtman, A. H. Proc Natl Acad Sci U S A 2004 101 10821. (148) Lichtman, A. H.; Shelton, C. C.; Advani, T. ; Cravatt, B. F. Pain 2004 109 319. (149) Holt, S.; Comelli, F.; Costa, B.; Fowler, C. J. Br J Pharmacol 2005 146 467. (150) Meister, A. Adv Enzymol Relat Areas Mol Biol 1968 31 183. (151) Horowitz, B.; Meister, A. J Biol Chem 1972 247 6708. (152) Ito, T.; Kidouchi, K.; Sugiyama, N.; Kajita, M.; Chiba, T.; Niwa, T.; Wada, Y. J Chromatogr B Biomed Appl 1995 670 317. (153) Bonafe, L.; Troxler, H.; Kuster, T.; Heizmann, C. W.; Chamoles, N. A.; Burlina, A. B.; Blau, N. Mol Genet Metab 2000 69 302. ( 154) Carter, S. M.; Midgley, J. M.; Watson, D. G.; Logan, R. W. J Pharm Biomed Anal 1991 9 969. (155) Costa, C. G.; Guerand, W. S.; Struys, E. A.; Holwerda, U.; ten Brink, H. J.; Tavares de Almeida, I.; Duran, M.; Jakobs, C. J Pharm Biomed Anal 2000 21 1215. (156) Kimura, M.; Yamaguchi, S. J Chromatogr B Biomed Sci Appl 1999 731 105. (157) Rinaldo, P.; O'Shea, J. J.; Welch, R. D.; Tanaka, K. Prog Clin Biol Res 1990 321 411. (158) Bennett, M. J.; Ragni, M. C.; Ostfeld, R. J.; Santer, R.; Schmidt Somm erfeld, E. Ann Clin Biochem 1994 31 ( Pt 1) 72. (159) Divry P Fau Vianey Liaud, C.; Vianey Liaud C Fau Cotte, J.; Cotte, J.; Liebich Hm Fau Forst, C.; Forst, C.; Ito T Fau Kidouchi, K.; Kidouchi K Fau Sugiyama, N.; Sugiyama N Fau Kajita, M.; Kajita M Fau Chiba, T.; Chiba T Fau Niwa, T.; Niwa T Fau Wada, Y.; Wada, Y.; Gregersen N Fau Kolvraa, S.; Kolvraa S Fau Rasmussen, K.; Rasmussen K Fau Mortensen, P. B.; Mortensen Pb Fau Divry, P.; Divry P Fau David, M.; David M Fau Hobolt h, N.; Hobolth, N.; Bonafe L Fau Troxler, H.; Troxler H Fau Kuster, T.; Kuster T Fau Heizmann, C. W.; Heizmann Cw Fau Chamoles, N. A.; Chamoles Na Fau Burlina, A. B.; Burlina Ab Fau Blau, N.; Blau, N. (160) Liebich, H. M.; Forst, C. J Chromatog r 1990 525 1. (161) Hutt, A. J. a. C., J. In Conjugation Reactions in Drug Metabolism ; Mulder, G. J., Ed.; Taylor & Francis, Ltd: London, 1990. (162) Killenberg, P. G.; Davidson, E. D.; Webster, L. T., Jr. Mol Pharmacol 1971 7 260. (163) Gatley, S. J.; Sherratt, H. S. Biochem J 1977 166 39. (164) James, M. O.; Bend, J. R. Biochem J 1978 172 285. (165) Mawal, Y. R.; Qureshi, I. A. Biochem Mol Biol Int 1994 34 595. (166) Mawal, Y.; Paradis, K.; Qureshi, I. A. J Pediatr 1997 130 1003. (167) Yin, S. J.; Chou, C. F.; Lai, C. L.; Lee, S. L.; Han, C. L. Chem Biol Interact 2003 143 144 219.

PAGE 206

182 (168) Maurelli, S.; Bisogno, T.; De Petrocellis, L.; Di Luccia, A.; Marino, G.; Di Marzo, V. FEBS Lett 1995 377 82. (169) Deutsch, D. G.; Chin, S. A. Biochem Phar macol 1993 46 791. (170) Bisogno, T.; De Petrocellis, L.; Di Marzo, V. Curr Pharm Des 2002 8 533. (171) Engelhardt, B.; Sorokin, L. Semin Immunopathol 2009 (172) Hanus, L. O.; Fales, H. M.; Spande, T. F.; Basile, A. S. Anal Biochem 1999 270 159. (173) Egertova, M.; Michael, G. J.; Cravatt, B. F.; Elphick, M. R. J Chem Neuroanat 2004 28 171.

PAGE 207

183 5 Metabolic E lucidation of PFAM and NAG Biosynthetic Pathways 5.1 Introduction The findings in Chapters 2 4 provide new information regarding the biosynthesis of NAGs and PFAM s in model cell lines. Both N acylethanolamines (NAEs) and free fatty acids (FFA) can serve as precursors for the formation of primary fatty acid amides (PFAMs), and although the list of candidate enzymes involved in these pathways has been narrowed, their identities are still unclear Enzyme expression assays provided no alcohol dehydrogenase (ADH) candidate in the N 18 TG 2 cells, and the only putative glycination enzyme found was cytochrome c (cyt c), which one would expect to find in every cell line performing oxidative phosphorylati on. Herein the role of cyt c in PFAM formation is investigated We also examine the kinetics and mechanism of PFAM formation from NAE and FFA precursors using isotope labeling. In addition, we examine further the roles of fatty acid amide hydrolase (FAAH) in an additional model cell line, aortic endothelium, to further our understanding of not only the degradative enzyme but also the potential role of PFAMs in the cardiovascular system. Additionally amidating monoox ygenase (PAM) with specific RNAi targeting combined with isotopic labeling to explicitly define its role in PFAM biosynthesis.

PAGE 208

184 5.2 Primary Fatty Acid Amides and FAAH in Aortic Endothelial Cells amidating monooxygenase (PAM) is widely distributed throughout the body, and has been found in the cardiovascular system in cardiac ventricles, 5 blood, 6 atria, 5 and aortic endothelium. 7 amidating peptide biosynthetic enzymes, prohormone co nvertase 1 and 2 and carboxypeptidase E, are also found in the atria. 8 11 These enzymes, including PAM, are known to play important roles in regulating amidated peptides in th e cardiovascular system 7,12,13 but amidated acyl chains (PFAMs) have only been isolated from whole rabbit heart, 14 so the individual tissue component(s) responsible for PFAM biosynthesis are unknown 15 although PFAMs have been found in human 16 and rat 17,18 plasma and rat cerebrospinal fluid. 17 It has been suggested that these molecules are rapidly degraded by fatty acid amide hydrolase (FAAH), making their isolation difficult. FAAH has been established as the enzyme responsible for hydrolyzing oleamide and other primary fatty acid amides (PFAMs) and N acylethanolamines (NAEs) in vitro and in other cell systems. 19 FAAH has been well characterized in two endothelial cell lines: rat kidney 20 and human umbilical vein. 21 Although FAAH 2 has been found in primate heart, FAAH 2 is not a murid enzyme and t o date there has been no evidence for PFAM hydrolysis via FAAH in the heart where PAM has been found 15,22 Phenylmethylsulfonyl fluoride (PMSF) is a known FAAH inhibitor 15 and it has been used to prevent anandamide degradation in rat brain membrane samples. 23 In this study, we attempt to determine whether oleamide can be isolated from human aortic endothelial cells (HAEC) endogenously, and whether FAAH is a ctively degrading oleamide in these cells to better understand the role of oleamide and other PFAMs in the cardiovascular system. Aortic endothelial cells were chosen because of their role in vasorelaxation, 24 where anandamide regulated vasodilation is endothelium dependent 25

PAGE 209

185 5.2.1 Materials and Methods 5.2.1.1 Materials HAEC cells and e ndothelial c ell b asal m edium with growth supplements were from Lonza (Walkersville, MD) O leic acid (OA) was from Sigma Aldrich (St. Louis, MO) BSTFA and silica were from Suppelco (St. Louis, MO) All other reagents and cell culture supplies were of the highest quality available from commercial suppliers. 5.2.1.2 Cell Culture and Fatty Acid Incubation Cells were g rown in 75 cm 2 culture dishes at 37 o C and 5% CO 2 according to Cultures were g r own to 75 90% confluency and 200 M oleic acid was added alone or in combination with either 1% dimeth ylsulfoxide ( DMSO ) or 100 M p henylmethylsulfonyl fluoride ( PMSF ) Note that BSA was not used as a carrier protein for OA PMSF (100 M) was added to fla s ks containing OA for the last hour of incubation (except for the flask already containing PMSF ). (F or a sample list see Table 5 1 ) Cells were then co llected by scraping, centrifuged the conditioned media decanted, and the resulting cell pellet and conditioned media stored at 80 o C. Cells were too small to count on the available microscopes so a cell volume was taken instead. Cell count was estimated based on the assumptions of cell density being 1 g/ml and the weight of a human cell being 10 9 g. 4 5.2.2 Metabolite Extraction Metabolites were extracted from cells using protocols similar to Sultana and Johnson 26 M ethanol (10 ml) was added to the cell pellets and samples were sonicated for 15 minutes at room temperature. Samples were c en trifuged at 5000 rpm for 10 min and the supernatant decanted and dried under N 2 in a warm water bath at 40 50 o C. The pellet was re extracted with 4 ml 1:1:0.1 (v/v/v) chloroform:methanol:water, sonicated for 10 min, vortexed 2 min and centrifuged 10 min at 5000 rpm. The s upernatant from this step was added to the supernatant from the previous step and continued drying under N 2 at 40 50 o C. The pellet was re extracted with 4.8 ml chloroform:methanol 2:1 (v/v) and 800 L

PAGE 210

186 0.5 M KCl/0.08 M H 3 PO 4 sonicated 2 min, vortexed 2 min, and centrifuged 10 min at 5000 rpm. The lower lipid phase was added to the supernatant s from the previous steps and taken to dryness under N 2 at 40 50 o C. Metabolite extraction from conditioned media was carried out similarly. The ent ire media contents of each experimental flask were centrifuged to pellet any cells and the supernatant submitted to solvent extraction. The first two extractions were with 15 ml chloroform:methanol 2:1 and the second two extractions with 15 ml chloroform:m ethanol 2:1 and 2.4 ml 0.5 M KCl/0.08 M H 3 PO 4 No sonication was performed, and protein layers were condensed by centrifugation for 30 45 min at 10,000 rpm. Organic lipid phases were also combined and dried under N 2 at 40 50 o C. 5.2.3 Solid Phase Extraction Silic a columns (0.5g) were washed with n hexane and run essentially as described by Sultana and Johnson 26 Lipid extracts were taken up in 10 0 L n hexane and added to washed silica columns. The mobile phase was run without positive pressure as follows: 4 ml n hexane, 1 ml 99:1 hexane:acetic acid, 1 ml 90:10 hexane:ethyl acetate, 1 ml 80:20 hexane:ethyl acetate, 1 ml 70:30 hexane:ethyl acetate 1.5 ml 2:1 chloroform:isopropanol, 0.5 ml methanol. The last two fractions were combined and dried down under N 2 at 40 50 o C. 5.2.4 Sample Derivitization Trimethylsilylation was achieved using 100 L BSTFA (N,O bis(trimethylsilyl)trifluoroacetamide). Samples were flushed with dry N 2 BSTFA added, flushed briefly again, and allowed to react at 55 60 o C for 1 hour More nitrogen was flushed to reduce the sample volume, and the entire sample was injected onto the GC MS. 5.2.5 GC MS All separations were performed using a Shimadzu QP 5000 GC MS. Separations were achieved on a J & W Scientific DB 5 column (0.25 mm x 30 m) in splitless mode

PAGE 211

187 The GC temperature program was 55 150 o C at 40 o C/min, hold at 150 o C for 3.6 min, ramp at 10 o C/min to 300 o C, and hold for 1 min. The tran sfer line was held at 280 o C and the injection port at 250 o C throughout the separation. Helium was used as the carrier gas, at a flow rate of 0.9 ml/min. The mass range was 35 7 50 amu with a scan speed of 2000. The solvent cut time was set to 5 min. 5.2.6 Resul ts The amount of oleamide in each HAEC cell and conditioned media sample was successfully determined and can be found in Table 5 1 The amount of oleamide found after 24 and 48 hours of incubation with OA (and no BSA vehicle) was approximately the same, but both values were much higher than that observed in the normal cell sample. An interesting note is that incubation for 48 hours with OA and a delivery vehicle, DMSO resulted in an even greater amount of oleamide per cell than did inhibition of FAAH. Table 5 1 : Oleamide in HAEC Cells Incubation Conditions Oleamide in C ells O leamide in M edia Total 48h 1% DMSO + OA 11 6 2 15 227 24h OA 11 2 52 63 2 48h PMSF + OA 10 1 10 1 11 1 48h OA 2 5 61 63. 5 normal 1 2 0 1 2 Values are average pmol oleamide per 10 7 cells Cell count was estimated based on cell volume and an estimated cell weight of 10 9 g. 4

PAGE 212

188 Inhibition of FAAH by PMSF has resulted in a marked increase in oleamide production after 48 hours as compared to cells incubated with OA and no FAAH inhibitor ( Figure 5 1 ), indicating that FAAH or another protease targeted by PMSF contributes to the degr adation of oleamide or one of its precursors. Another possibility is that a protease that would normally hydrolyze N oleoylgl ycine is being targeted by PMSF, although a protease responsible for this hydroly sis has not yet been identified (see Chapter 4). T he finding of oleamide in endothelial cells is consistent with their function in control of vasodilatation, as oleamide is a potent vasorelaxant 24 and indicates that PFAMs may have a function in the cardiovascular system. Another function of endothelial cells is in angiogenesis, and erucamide is known to play a role in blood vessel growth. 27 28 It would not be unexpected to find erucamide and other PFAMs in this tissue type. Although PMSF is a known FAAH inhibitor, it and many other chemical inhibitors are not necessarily specific to the enzymes of interest. The development of RNA interference (RNAi) allows for direct targeting of the enzyme of interest by taking advantage of the natural defense system of the cell against double stranded bacterial Figure 5 1 : Amount of Oleamide in HAEC Cells Oleamide extracted from HAEC cells after incubation with OA. Cell count was estimated based on cell volume and an estimat ed cell weight of 10 9 g. 4 48h OA + 48h PMSF 48h OA normal 0 2 4 6 8 10 12 14 pmol oleamide per 10 7 cells

PAGE 213

189 RNA, and is used herein to explore the functions of two other potential PFAM forming enzymes: PAM and cytochrome c. 5.3 siRNA optimization When double stranded RNA (dsRNA) is detected in a eukaryotic cell containing this defense system, the enzyme Dicer cleaves long dsRNA into shorter fragments of dsRNA about 20 25 nucleotides in length. Many modern RNAi experiments start by incubating with these shorter dsRNA pieces delivered by some vehicle through the media. One of the strands of these small interfering RNA (siRNA) pieces is then bound to an endonuclease containing RNA induced silencing complex (RISC) to act as a template to search for complimentary mRNA within the cell. Once a complimentary mRNA sequence is detected by the RISC complex it is cleaved by the Argonaute portion of the complex, preventing its translation and effectively knocking down expression of that gene. In order to use siRNA for gene silencing, experimental conditions had to be optimized for the N 18 TG 2 cells. Typical m ethods of siRNA delivery include transfection reagents and, for more problematic samples, electroporation. Exact structures of transfection reagents are proprietary, but most are lipid or amine based. Electroporation is used in samples for which s tandard transfection method s are problematic. 29 Two transfection reagents were used in this study. 5.3.1 Materials and Methods 5.3.1.1 Materials Transfection was done with Silencer siRNA tr ansfection II optimization kit from Ambion (Austin, TX) containing both siPORT TM NeoFX TM and siPORT TM Amine transfection reagents, GAPDH siRNA and scrambled siRNA. DMEM and penicillin/streptomycin were from Mediatech Cellgro (Manassas, VA) Fetal bovine serum (FBS) was from A tlanta Biologicals (Lawrenceville, GA) Mouse neuroblastoma N 18 TG 2 cells were from DSMZ (Deutsche Sammlung von Mikrooganism und Zellkuturen

PAGE 214

190 GmBH). PVDF membrane s w ere from Millipore ( Billerica, MA) Tween 20 protease inhibitor cocktail (P8340) and Bradford reagent were from Sigma Aldrich (St. Louis, MO) GAPDH (FL 335) antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) Goat anti rabbit secondary an tibody conjugated with horse radish peroxidase was from ICN Biomedical (Solon, OH) SuperSignal chemiluminescent detection system wa s from Pierce (Rockford, IL) All other reagents and cell culture supplies were of the highest quality available from commercial suppliers. 5.3.2 Cell Culture During normal growth, N 18 TG 2 cells were grown in DMEM supplemented with 100 M 6 thioguanine, 100 I.U ./ml penicillin, 1.0 mg/m l streptomycin and 10% FBS at 37 o C and 5% CO 2 according to supplier instructions. During RNAi optimization experiments, 2.5x10 4 cells were incubated in each well of a 6 well plate; DMEM + pen/strep (normal media with no FBS) was us ed ( instead of OPTI MEM I media as suggested by the manufacturer The concentration of each siRNA was used as suggested by the manufacturer, and two different delivery reagents: siPORT Amine and siPORT NeoFX, were used After 72 hours incubation, cells were collected by scraping, centrifuged in a sterile 1.5 ml Eppendorf tube, rinsed with PBS, and re pelleted before removal of supernatant and cell lysi s 5.3.3 Protein Sample Preparatio n Cell samples were resuspended in lysis buffer containing 20 mM Tris HCl (pH 7.4), 2 mM MgCl 2 1 mM EDTA, 1 mM EGTA, 150 mM NaCl, 1% Triton X 100, and 1% of a commercially available protease inhibitor cocktail. After incubation at 4 o for 10 minutes, sam ples were sonicated on ice with a microprobe sonicator for 5 minutes. Samples were then centrifuged and the protein content of the supernatant determined by Bradford assay. The supernatant was diluted to 1 3 mg/ml with running buffer containing merca ptoethanol and boiled for 5 minutes before storing at 20 o C. From Sigma Aldrich (P8340). Contained 4 (2 aminoethyl)benzenesulfonyl fluoride, pepstatin A, E 64, bestatin, leupeptin and aprotinin.

PAGE 215

191 5.3.4 Western Blotting Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) gels were run with 10% (resolving) and 4% ( stacking ) acrylamide at 170 V until the dye front ran off the bottom of the gel Gels were electroblotted to a PVDF membrane at 80 V for 1 hour and membranes were soaked for 1 hour i n a blocking solution (Tris buffered saline, TBS containing 5% nonfat dry milk ( NFDM) and 0.5% Tween 20 (TBS T)) and incubated overnight at 4 o C in the presence of the antibody (diluted 1:500) in TBS T with 1% NFDM. After incubation, the membrane was washed 5 times with TBS T, and then incubated for 1 hour with goat anti rabbit conjugated with horse radish peroxidase (diluted 1:10,000) in TBS T with 3% NFDM at room temperature. A final set of 5 rinses was performed in TBS T before visuali zi ng antibody antigen complexes using the SuperSignal chemiluminescent detection system (Pierce, Rockford, IL) on r adiographic film. 5.3.5 Results GAPDH knockdown was observed in N 18 TG 2 cells incubated with siRNA in the siPORT TM Amine, but not the siPORT TM NeoFX TM transfection reagent, as seen in Figure 5 2 Published MW for GAPDH (37 kDa) is similar to that found here. 1 3 In addition to the successful demonstration of siPORT TM Amine as a transfection reagent for N 18 TG 2 cells, the demonstration that no knockdown occurred after incubation with scrambled siRNA indicates no off target effects in this system.

PAGE 216

192 5.4 PAM knock down studies One of the criticisms of PFAM metabolic elucidation is that, while pharmacological inhibitors have been used to target PAM in vitro 30,31 and in cellulo, 32 these inhibitors lack specificity and high e fficacy. 33,34 Inhibition of PAM by trans 4 phenyl 3 butenoic acid ( PBA ) after injection was very short lived, with serum PHM activity being restored after just 24 hours. 34 In addition to targeting PAM, 1 mM PBA was also shown to inhibit cyclooxygenase 2 activity by 82% 35 which may cause undesired off target effects in cellulo Although pharmacological inhibitors have been used to demonstrate the accumulation o f 14 C N Oleoylglycine after incubation with 14 C oleic acid, 32 strongly suggesting that PAM is involved in converting N oleoylglycine to oleamide, an experiment designed to specifically target PAM is required to determine the extent of its in celluo significance i n this pathway. There are more specific and effective pharmacological inhibitors of PAM 35 but the most effective and specific inhibitor by modern standards is targeted siRNA. Another layer of specificity is added by the use of a la beled substrate: 13 C 18 oleic acid. I ncubation with labeled OA and with successful PAM knockdown using the NAG assay method developed in Chapter 2 would represent Figure 5 2 : RNAi Optimization with GAPDH Western blot of N 18 TG 2 cells after GAPDH RNAi or nonsense RNAi (negative control) with two different transfection reagents: siPORT Amine or siPORT NeoFX. Published MW for GAPDH is similar to that found here. 1 3 36 kD a

PAGE 217

193 definitive proof of a role played by PAM in this biochemistry in cellulo if the corresponding labeled NAG could be isolated from the cells in appreciable amounts. 5.4.1 Materials and Methods Tri FECT a TM RNAi kit containing three anti PAM siRNA was a gift from Integrated DNA Technologies (Coralville, IA) The siPORT TM Amine transfection agent was from Ap plied Biosystems (Foster City, CA) PAM (S 16) antibody was from Santa Cruz Biotechnologies, Inc (Santa Cruz, CA) D onkey anti goat secondary antibodies conjugated with horse radish peroxidase was from ICN Biomedical (Solon, OH) BSTFA and silica were from Supelco (St. Louis, MO) Heptadecanoic acid, D 33 was from C/D/N isotopes (Pointe Claire, Quebec) Fatty acid free bovine serum albumin (BSA) and 13 C 18 oleic acid were from Sigma Aldrich (St. Louis, MO) The remaining materials are as described in Section 5.3.1.1 The siRNA time course was run as described in Section 5.3.1 b ut with 24 and 48 hour incubations to determine optimal siRNA incubation time. 13 C 18 N O leoylglycine and N heptadecanoylglycine, D 33 (HdG) w ere synthesized as described in Chapter 2, Section 2.2.2.3. The fatty acid BSA mixture was made as described in Chapter 3, Section 3.3.3. Based on time course study results, t he cells were incubated for 56 hours with siRNA 13 C 18 oleic acid in 0.25 mM BSA. Growing and collection co nditions of N 18 TG 2 cells are described in Chapter 2, Section 2.2.5. After collection, cells were extracted as described in Section 2.2.6 A n aliquot of cell extract was removed for oleamide analysis and metabolites were separated via SPE as described in Section 2.2.7. The remaining sample was run on prep TLC as described in Section 2.2.8 for N oleoylglycine analysis Before prep TLC and after solvent extraction samples were spiked with 15 nmol HdG. GC MS was run as described in Section 2.2. 10 including running a spiked sample after two aliquots of the original sample were run.

PAGE 218

194 5.4.2 Results Two of the siRNA tested in the timecourse study knockdown for PAM in the N 18 TG 2 cells ( Figure 5 3 ) effects over 48 hours so it was used in subsequent experiments. The time course studies show that the siRNA mediated knockdown for PAM lasts for at least 48 hours with this sequence covering the entire time of the incubation with fatty acid. A fter 24 h ours there is less PAM than there is after 48 h ours with the siRNA, as the cell slowly returns to its normal metabolism. This means that any lingering PAM shoul d interfere minimally with this experiment when OA is added to the culture medium ( Figure 5 3 ) Once it was determined which siRNA produced the best knockdown results, followed by 2.5 mM 13 C 18 oleic acid in 0.25 mM BSA 8 hours later for a total incubation time of 56 hours T he average viability after 48 hours of PAM siRNA was 54% An aliquot of each sample was removed for oleamide quantification, and the remaining sample used for N oleoylglycine (NOG) quantification. Normal samples were run alongside as negative controls. The results of the prep TLC isolation and GC/MS are shown in Figure 5 4 and the quantified amount s of N oleoylglycine are shown in Figure 5 5 Figure 5 3 : PAM Knockdown by siRNA in N 18 TG 2 Cells The Western blot shows the amount of PAM in N 18 TG 2 cells after incubation with various siRNA for 24 and 48 hours.

PAGE 219

195 Figure 5 4 : 13 C 18 N Oleoylglycine in N 18 TG 2 Cells Incubated with 13 C 18 Oleic Acid and PAM siRNA Pa nel A shows the GC of N 18 TG 2 cell extract over the whole time scale (top) and a close up of the 13 C 18 N oleoylglycine TMS (bottom). Panel B shows the MS of 13 C 18 N oleoylglycine TMS, and panel C shows the fragmentation of this molecule. Note that 13 C 18 N Oleoylglycine is N Oleoylglycine 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20 13 C 18 There are no 13 C on the glycine portion of the molecule. C

PAGE 220

196 The amount of N oleoylglycine found in the PAM knock down N 18 TG 2 cells was higher than expected at 7510 ( 697) pmol/10 7 cells, compared to the normal cells with 50 ( 29) pmol/10 7 cells ( Figure 5 5 ) This is the first quantitative measurement of endogenous N oleoylglycine in N 18 TG 2 cells. A prior experiment showed an accumulation of a peak with the same retention time as N oleoylglycine with the addition of a PAM inhibitor, PBA, 32 but that peak was neithe r verified nor quantified, and an endogenous amount was not determined In comparing the amount of N oleoylglycine (NOG) to oleamide found after incub ation with oleic acid (OA), there is much more NOG than oleamide found when PAM expression is suppressed ( Figure 5 6 ). The average amount of oleamide (both labeled and unlabeled) found in these cells after 56 hours of PAM siRNA and 48 h ours of 2.5 mM 13 C 18 OA incubation was 7.5 pmol/10 7 cells, much smaller than the normal endogenous amount of 119 pmol/10 7 cells in the absence of OA The s e data explicitly define PAM as the in cellulo enzyme responsible for the oxidative cleavage of NOG to oleamide The amount of oleamide found after 0, 12, 24, and 48 hour inc ubations with OA sans PAM siRNA from Chapter 2 is shown here in Figure 5 6 for comparison alongside the NOG quantification. The amount of NOG isolated after PAM knockdown and OA incubation (7510 pmol/10 7 cells) is much higher than the amount of oleamide isolated Figure 5 5 : Quantification of 13 C 18 N Oleoylglycine in N 18 TG 2 cells with and without RNAi for PAM The green bar shows NOG in normal cells, and the purple bar in PAM knockdown cells after incubation with 13 C 18 OA 0 1000 2000 3000 4000 5000 6000 7000 8000 9000 pmol per 10 7 cells normal PAM 56h, 13C OA 48h

PAGE 221

197 after OA incubation (2250 pmol/10 7 cells). This may indicate other fates of NOG beyond amidation by PAM. Indeed, a recent study revealed that N OG can function independently of oleamide; oleamide like effects were observed after injection of NOG but serum levels of oleamide did not increase. 36 Another possibility is that t he greater amount of NOG may indicate simply that oleamide is a better substrate for FAAH than NOG. Despite the higher level of NOG found after PAM knockdown a nd OA incubation, the endogenous amount of NOG found was lower than endogenous oleamide. The low levels of endogenous NOG reported here may partially explain the lack of literature in this field until more recently (see Chapter 2). The advent of more sensi tive analytical techniques was required to identify compounds of such low abundance. In addition to quantifying NOG after PAM knockdown and OA incubation the amount of oleamide was also quantified. Figure 5 6 : Oleamide and N Oleoylglycine in N 18 TG 2 cells with and without PAM RNAi The left graph shows oleamide isolated from N 18 TG 2 cells and media incubated with OA over a time course (red and blue). Co graphed is labeled NOG and oleamide isolated after 56 hours incubation with anti PAM siRNA (turquoise and orange), as well as the endogenous amount of NOG (light blue). The graph on t he right is a close up of endogenous levels of oleamide and NOG, as well as oleamide after knockdown of PAM and incubation with OA. 0 1000 2000 3000 4000 5000 6000 7000 8000 9000 0h 12h 24h 48h pmol per 10 7 cells oleamide in media oleamide in cells 13C18 NOG, 56h PAM oleamide, 56h PAM NOG in cells 119 50 8 0 20 40 60 80 100 120 140 160 180 endogenous oleamide endogenous N oleoylglycine oleamide after 56h PAM knockdown

PAGE 222

198 5.5 Cytochrome C Knock down Studies Several recent articles by the Mueller group have implicated cytochrome c (cyt c) in the biosynthesis of oleamide. In vitro studies have shown the formation of oleamide and N oleoylglycine upon incubation of oleoyl CoA with cyt c and either ammonia or glyc ine, respectively. 37 39 In addition, it was found to be expressed in oleamide producing N 18 TG 2 cells whereas other potential NAG forming enzymes were not (Chapter 4). T he potential role of cyt c in PFAM biosynthesis is elaborated in Figure 5 7 Due to its co purification with a superoxide dismutase (SOD) and fatty acyl CoA ACBP would orient an incoming acyl CoA so that its thioester is proximal to the heme of cyt c. SOD would provide the H 2 O 2 that was observed to increase catalytic activity. The oleamide and N oleoylglycine forming activity of cyt c increases in the presence of H 2 O 2 although some activ ity is observed without the peroxide. The reported optimal level of H 2 O 2 for these reactions is very high (2 mM H 2 O 2 ). Base levels of cyt c activity were explored sans H 2 O 2 and found to be 5.4% conversion at best with 0.5 mg/ml cyt c, 5 mM NH 3 and 1 mM ole oyl CoA after 75 minutes of incubation time (see Appendix E). Other acyl CoAs were not found to be cyt c substrates under these conditions ( data in Appendix E). If cyt c is involved in PFAM biosynthesis it is likely to use H 2 O 2 or some other means of reoxi dizing its Fe 2+ Figure 5 7 : Putative Role of Cyt C in PFAM Biosynthesis 1 = Acyl CoA synthetase (ACS) 2 = unknown enzyme or cytochrome c (cyt c) 3 = Peptidylglycine amidating monooxygenase (PAM)

PAGE 223

199 To best study the role of cyt c in vivo/in cellulo its removal by RNAi is the most targeted approach to isolate its role in PFAM biosynthesis. In these experiments, N 18 TG 2 cells were incubated with cyt c siRNA and oleic acid (OA) to dete rmine the effect of cyt c knockdown on oleamide biosynthesis as compared to our standard incubation with OA from Chapter 2. 5.5.1 Materials and Methods Silencer Select Pre designed siRNA against mouse somatic cytochrome c and siPORT TM Amine transfection agent were from Applied Biosystems. Mouse anti c ytochrome c and goat anti mouse HRP antibodies w ere from ZYMED Laboratories (San Francisco, CA) BSTFA and silica were from Sup elco (St. Louis, MO) Heptadecanoic acid, D 33 was from C/D/N isotopes (Pointe Claire, Quebec) Fatty acid free bovine serum albumin (BSA) and oleic acid were from Sigma Aldrich (St. Louis, MO) The remaining materials are as described in Section 5.3.1.1 The siRNA timecourse was run as described in Section 5.4.1 The fatty acid BSA mixture was made as described in Chapter 3, Section 3.3.3. The cells were incubated for with 12, 24 or 48 of those hours with 2.5 mM OA in 0.25 mM BSA. Growing and collection conditions for N 18 TG 2 cells are described in Chapter 2, Section 2.2.5. After collection, cells were extrac ted as described in Section 2.2.6 and metabolites separated via SPE as described in Section 2.2.7. GC MS was run as described in Section 2.2.10, including running a spiked sample after two aliquots of the original sample were run. Samples were analyzed as described in Chapter 3, Section 3.3.11. 5.5.2 Results The results of cyt c knock down studies are shown in Figure 5 8 Two different siRNA sequences were used, and both showed equal effectiveness at knocking down expression of cyt c.

PAGE 224

200 The timecourse studies show that the siRNA me diat ed knockdown of cyt c l asts for at least 48 hours, covering the entire time of the incubation with fatty acid. Before the 48 hour time period, existing cyt c may still be present, and this may be reflected in the oleamide timecourse extraction, but the 48 hour samples show almost complete knockdown of the enzyme ( Figure 5 8 ). One concern with using RNAi against cyt c is the toxicity to the cells, given its central role in oxidative phosphorylation. After 24 hours incubation with cyt c siRNA, the average viability of the N 18 TG 2 cells was 88 %. After 56 hours it was still 61% comparable to what was observed in the PAM knockdown studies. To compare the amount of oleamide made in N 18 TG 2 cells with and without cyt c knockdown, the same incubation was performed as in Chapter 2 in which the cells were incubated for 0, 12, 24 or 48 hours with 2.5 mM OA in 0.25 mM BSA under the same conditions, except that each flask was also in cubated for 56 hours with cyt c siRNA The results of this incubation are shown in Figure 5 9 (top). For comparison, these results are plot ted alongside the normal OA incubation results as well ( Figure 5 9 bottom). Figure 5 8 : Cytochrome C Knockdown by siRNA Western blot showing the successful knockdown of cyt c by two different

PAGE 225

201 There no significant difference between N 18 TG 2 cell incubated with OA and cyt c siRNA and the same cells without cyt c siRNA ( p = 0.6941, Figure 5 9 ). T he 48 hour time point shows more oleamide per cell in the cyt c knockdown cells than in the normal cells. A recent publication by Mue l ler and Driscoll 40 presents the concern of off target oleamide knockdown that may be due to dramatic adaptive shifts in whole cell physiology caused by the knockdown of cyt c. However, experimental observations reveal more, not less, oleamide. These findings argue against t he role of cyt c in oleamide biosynthesis in vivo although it is possible that other cell lines show different metabolism and use cyt c as it has been shown in vitro 40 as has also been suggested by Mueller and co workers A Figure 5 9 : N 18 TG 2 I ncubated with O leic A cid and Cyt ochrome C siRNA Cells were incubated with OA for the times indicated and cyt c siRNA for 56 hours (top). The bottom graph shows the normal cells incubated with OA and no cyt c knockdown co graphed with the cyt c knockdown samples. 0 1000 2000 3000 4000 5000 6000 7000 0h 12h 24h 48h pmol/10 7 cells cells media unspent media blank 0 1000 2000 3000 4000 5000 6000 7000 0h 12h 24h 48h pmol/10 7 cells cells with OA media with OA cells with OA, cyt c knockdown media with OA, cyt c knockdown

PAGE 226

202 similar experiment on additional cell lines would determine whether cyt c plays this role in other cell lines. 5.6 Interrogation of the N A cylglycine Biosynthetic P athways through Isotopically Labeled Precursors Two main pathways have been proposed for N acylglycine (NAG) biosynthesis: sequential oxidation of an N acylethanolamine (NAE) and glycination of the free fatty acid (FFA) through an activated intermediate (see the introduction to Chapter 4 for more details). Evidence presented in Chapter 3 has demonstrated that N 18 TG 2 c ells are capable of converting N t ridecanoylethanolamine (TDEA) into tridecanamide, but it is unknown whe ther the TDEA is oxidized to N tridecanoylglycine or hydrolyzed to tridecanoic acid (TDA) before glycination. Strategic use of 15 N and 13 C isotope labels would all ow for the elucidation of th ese different biosynthetic possibilities, as outlined in Figure 5 10 The appearance of one or two isotopic labels in the final oleamide product would provide key insight into the mechanism of NAG formation.

PAGE 227

203 Figure 5 10 : Elucidation of the Biosynthesis of a PFAM from Two Distinct Pathways Two competing pathways for N acylglycine biosynthesis. Oxidation of N acylethanolamine is shown in brown and FFA glycination in purple 13 C is shown in green and 15 N is shown in red. ASC, ascorbate; SDA, semihydroascorbate Enzymes: 1. Fatty acid amide hydrolase, 2. An alcohol dehydrogenase, 3. An aldehyde dehydrogenase, 4. Acyl CoA synthetase, 5. Unknown, 6. amidating monooxygenase

PAGE 228

204 5.6.1 Materials and Methods Heptadecanoic acid, D 33 and 1 13 C Potassium oleate w ere from C/D/N isotopes (Pointe Claire, Quebec) Fatty acid free bovine serum albumin (BSA), oleic acid and 15 N Ethanolamine were from Sigma Aldrich (St. Louis, MO) The remaining materials are as described in Section 5.3.1.1 The fatty acid BSA mixture was made as described in Chapter 3, Section 3.3.3. The cells were incubated for 0, 12, 24 or 48 hours with 0.4 mM 3 13 C, 15 N oleoylethanolamine in 0. 4 mM BSA. Growing and collection conditions are described in Chapter 2, Sect ion 2.2.5. After collection, cells were extracted as described in Section 2.2.6 and metabolites separated via SPE as described in Section 2.2.7. GC MS was run as described in Section 2.2.10, including running a spiked sample after two aliquots of the orig inal sample were run. Samples were analyzed as described in Chapter 3, Section 3.3.11. 5.6.1.1 Synthesis of L abeled N O leoylethanolamine 1 13 C O leoyl chloride was synthesized as shown in Equation 5 1 as follows: 2 g potas sium oleate was suspended in approximately 50 ml dichloromethane as a slurry. T hionyl chloride ( 1.8 ml) was added dropwise under nitrogen while stirring at 50 o C under reflux. The oleate dissolved upon addition of SOCl 2 The solution was allowed to react under reflux at 50 o C for 1 hour. TLC was performed after 60 minutes. The normal phase TLC was run in chloroform:methanol 98:2 and stained with potassium permanganate solution ( Figure 5 11 ). The acid chloride in DCM was added to a separatory funnel with approximately 75 ml H 2 O to wash. After collecting the bottom organic layer, the pH of the aqueous layer was approximately 0.55. A second wash was performed with approx imately 0.5 g sodium bicarbonate in the water. The pH of the aqueous layer was approximately 2.7. A Figure 5 11 : TLC of Oleoyl Chloride Reaction Oleoyl chloride Oleic acid Reaction after 60 min

PAGE 229

205 third wash was performed with approximately 0.5 g sodium bicarbonate again in the water, after which the aqueous layer had a pH of approximately 8.2. A four th wash was performed without bicarbonate and the aqueous layer had a pH of 6.6. The organic DCM layer was then poured over MgSO 4 to dry, deca nted into a round bottom flask and taken to a yellow oil in vacuuo The N oleoylethanolamine was synthesized as shown in Equation 5 1 (bottom) as follows: 15 ml triethylamine base, 10 m l acetonitrile, and 0.5 ml 15 N ethanolamine were combined in a 50 ml round bottom flask flu shed with N 2 and left stirring under N 2 at room temperature. The volume of the acyl chloride was reduced to approximately 2 ml in vacuuo and then diluted to 10 ml with acetonitrile. This acyl chloride mixture was added dropwise to the ethanolamine mixture and left to stir overnight at room temperature. The resulting crude N acylethanolamine was taken to a yellow solid in vacuuo dissolved in approximately 25 m l warm ethanol, and recrystalized by adding cold H 2 O. The crystallization proceeded on ice for approximately 30 min, and the solid filtered in a B chner funnel and washed with ice cold H 2 O. A white flaky, shiny solid (0.118 g) was obtained (5.8% yield) and was 94% pure by GC MS analysis ( Figure 5 12 ). Equation 5 1 : Synthesis of 3 13 C, 15 N Oleoylethanolamine The isotopic labels are shown in color ( 13 C green and 15 N red )

PAGE 230

206 Figure 5 12 : GC MS of 3 13 C 1 15 N Oleoylethanolamine GC MS of 3 13 C, 15 N oleoylethanolamine over entire timecourse (panel A) and zoom in of the appropriate peak (B). The MS of the indicated GC peak is shown in panel C. The peak at 15.3 minutes is doubly derivitized N oleoylethanolamine (TMS) 2 (MS not shown). 3 13 C, 15 N Oleoylethanolamine TMS 3 13 C, 15 N Oleoyl ethanolamine (TMS) 2

PAGE 231

207 5.6.2 Results The quantification of oleamide in the N 18 TG 2 cells incubated with labeled NOE over time is shown in Figure 5 13 (top). For reference, the results of incubation with OA and with TDEA are also shown ( Figure 5 13 bot tom left and right, respectively) A sample GC MS of one of the cell extractions is shown in Figure 5 14 Figure 5 13 : Oleamide in N 18 TG 2 Incubated with Labeled Oleoylethanolamine Oleamide isolated from N 18 TG 2 cells after incubation with labeled N oleoylethanolamine (top). These data are also plotted alongside oleamide isolated from conditioned N 18 TG 2 media incubated with OA (bottom left) and cells incubated with TDEA (bottom right) for comparison. NOE, 13 C, 15 N oleoylethanolamine. 0.E+00 5.E+02 1.E+03 2.E+03 2.E+03 3.E+03 0h 12h 24h 48h pmol amide per 10 7 cells cells with NOE media with NOE 0.E+00 5.E+02 1.E+03 2.E+03 2.E+03 3.E+03 0h 12h 24h 48h pmol amide per 10 7 cells media with NOE media with OA 0.E+00 2.E+02 4.E+02 6.E+02 8.E+02 1.E+03 1.E+03 0h 12h 24h 48h cells with NOE cells with TDEA

PAGE 232

208 Figure 5 14 : GC MS of Labeled Oleonitrile from N 18 TG 2 Cell Extract GC MS of N 18 TG 2 cell extract after incubation with 13 C, 15 N oleoylethanolamine for 48 h ours, showing oleonitrile. Panel A shows the whole GC (top) and zoom in of the oleonitrile peak (bottom) Panel B shows the MS of the indicated GC peak (oleonitrile) Panel C shows the library database MS for unlabeled oleonitrile Panel D shows the difference between panels B and C. Note that in the cell extracted oleonitrile, there are more isotopic peaks in the fra gments containing the labeled carbon and/or nitrogen.

PAGE 233

209 There was more oleamide isolated in the conditioned media than in the cells, something not observed in any of the incubations with FFAs and TDEA as the amounts isolated in cells and conditioned media were very similar The significance of this is unclear. The amount of oleamide found in the conditioned media after incubation with NOE is comparable to that found in the conditioned media after incubation with OA ( Figure 5 13 bottom left). The amount of oleamide found in the cells after incubation with NOE is comparable with the amount of tridecanamide found in the cells after incubation with TDEA ( Figure 5 13 bottom right). O leonitrile derived from the reaction of BSTFA with oleamide isolated from N 18 TG 2 cells after incubation with 3 13 C, 15 N oleoylethanolamine is shown in Figure 5 14 The MS for the oleonitrile derived from cell extracted oleamide (panel B) shows many more isotopic peaks than the library MS for unlabeled oleonitrile (panel C). Averaged spectra were taken over the time interval in which oleonitrile could be found, and averaged background spectra were subtracted from the oleonitrile spectra. Shown in Figure 5 15 is overlaid as selected ion traces in color T he oleonitrile peaks are shown with a vertical line through them, and the background spectra were taken from the left where no other significant peaks could be found. Much greater background noise was observed for m/z 123 in the conditioned media ( Figure 5 15 panel A) than in the cell extract, making this subtraction necessary. Along with the 122, 123 and 124 set two other isotopic sets were examined and are shown in Table 5 2 The relative intensity of each m/z peak for each unlabeled (122, 136 and 164), singly labeled (123, 137 and 165) and doubly labeled (124, 138 and 166) were used in the ratios shown in Eq uation 5 2 A graphical representation of those ratios is shown in Figure 5 16

PAGE 234

210 Table 5 2 : Fragments Used for Isotopic Ratio Assignment m/z structure 122 123 124 136 136 138 164 165 166 13 12 = ( 123 + 137 + 165 ) ( 122 + 136 + 164 ) 15 13 12 = ( 124 + 138 + 166 ) ( 122 + 136 + 164 ) 15 13 13 = ( 124 + 138 + 166 ) ( 123 + 137 + 165 ) Eq uation 5 2 : Calculations for the Ratios of Singly and Doubly Labeled Oleonitrile. Oleonitrile is a direct reaction product of derivitization of oleamide with BSTFA. The intensities ( i ) of each isotopic pea k were added to obtain a relative intensity of each isotopic contributor.

PAGE 235

211 Figure 5 15 : Background Levels in N 18 TG 2 Conditioned Media and Cell Samples GC of N 18 TG 2 media (A) and cells (B) after incubation with 3 13 C, 15 N oleoylethanolamine. for unlabeled oleonitrile, 123 for a singly labeled oleonitrile, and 124 for the doubly labeled oleonitrile. The background is much higher for m/z 123 in the me dia sample, necessitating a subtraction of the background spectra from the oleonitrile spectra before assignment of isotopic ratios.

PAGE 236

212 The fact that there is much greater labeled product in the samples incubated with labeled NOE (turquoise and orange bars in Figure 5 16 ) indicates t hat the labeling comes from conversion of the labeled NOE to oleamide and not co eluting contamination. In addition, the incorporation of the label seems t o reach a saturation point between 0 12 hours, as the ratio of labeled to unlabeled compound stays steady from 12 48 hours. The ratio of doubly to singly labeled oleamide is approximately 0.99 0.04 in the cells and 1.09 0.09 in the media, indicating t hat there is an equal amount of singly and doubly labeled oleamide present. This implies that the ethanolamine has an equal likelihood of being oxidized to the NAG and being hydrolyzed to the FFA before glycination; that there is more than one biosyntheti c mechanism for NAGs in the N 18 TG 2 cells and that they are likely to be acting at roughly equal rates. Figure 5 16 : Isotope Ratios of Oleamide in N 18 TG 2 after Incubation with Labeled N Oleoylethanolamine The purple bars represent the ratio of doubly labeled ole amide to singly labeled oleamide, and were calculated by taking the intensities of (124 + 138 + 166) divided by the intensities of (123 + 137 + 165), and the other two ratios calculated similarly Turquoise bars represent the ratio of singly labeled oleamide to unlabeled and t he orange bars represent the ratio of doubly labeled olea mide to unlabeled. The error bars shown are 5% error. 0 0.5 1 1.5 2 2.5 3 3.5 4 0h 12h 24h 48h cells 0h 12h 24h 48h media

PAGE 237

213 5.7 Conclusions A PFAM, oleamide, has been isolated from human aortic endothelial cells. Incubation with a FAAH inhibitor results in a great increase in the amount of oleamide found after incubation with OA ( Figure 5 1 ) Therefore, FAAH is likely at work in the cardiovascular system, or at least in endothelial cell s. Although FAAH has been found in endothelial cells of other organs (kidney 20 and umbilical vein 21 ), there is no previous evidence for its action in the heart. 15,22 The finding of PFAMs in these cells is the first report of its kind and suggests an important role in vasoregulation and angiogenesis is played by these molecules in the cardiovascular system A n overview of the findings detailed in this thesis regarding NAG and PFAM metabolism is summarized in Figure 5 17 The quantitative NAG assay described in Chapter 2 was successfully demonstrated here in N 18 TG 2 cells to measure endogenous levels of NOG and labeled 13 C 18 NOG after incubation with 13 C 18 OA and PAM siRNA. This is explicit proof of the involvement of PAM in PFAM biosynthesis in cellulo as the siRNA targets PAM specifically and its knockdown leads to large intercellular levels of NOG and very small levels of oleamide even when incubating with OA. Maintaining PAM levels at normal concentrations results in the finding of very low cellular NOG levels ( Figure 5 5 ) In addition, incubation with PAM siRNA results in very low cellular oleamide levels ( Figure 5 6 ) The amount of NOG produced upon PAM knockdown was lower than the amount of oleamide found with normal PAM levels. This could mean that NOG has other metabolic fates, or simply that it is a poor FAAH substrate relative to oleamide.

PAGE 238

214 Figure 5 17 : NAG and PFAM Biosynthesis in N 18 TG 2 Cells Overview of what is now known about biosynthesis of NAGs and PFAMs in N 18 TG 2 cells. Double arrows represent metabolic flow from one metabolite to another. Single arrows are known enzymatic reactions. The NAE to NAG double arrow is dashed because the NAG wa s not isolated itself but the corresponding PFAM was isolated. Isotopic labeling implies oxidation to the NAG before oxidative cleavage to the PFAM. Abbreviations: ACS, acyl CoA synthetase; ADH, alcohol dehydrogenase; AlDH, aldehyde dehydrogenase; CYP4F, cytochrome P450; EA, elaidic acid; FAAH, fatty acid amide hydrolase; LOA, linoleic acid; NAE, N acylethanolamine; NAG, N acylglycine; NOE, N amidating monooxygenase; PFAM, primary fatty acid amide; POA, palmitoleic acid; TDA, tridecanoic acid; TDEA, N tridecanoylethanolamine.

PAGE 239

215 After incubation with 13 C, 15 N oleoylethanolamine, both 13 C, 15 N oleamide and 13 C olea mide were found in N 18 TG 2 cells ( Figure 5 13 ) in roughly equal proportion ( Figure 5 16 ) This indicates that not only are both pathways at work to synthesize NOG (oxidation of NOE and glycination of OA), but that both pathways may be functioning with equal discrimination This is in agreement with recent work by Bradshaw et al. who show that N arachidonoylglycine is formed by two distinct pathways in C6 glimoa cells. 41 In their case, however, hydrolysis of the NAE followed by glycination was the preferred mode of NAG biosynthesis as the amounts of unlabeled NAG produced were much higher (see Chapter 3 for more details of the Bradshaw experiments). Because oxidation of NOE is occurring and ADH3, ADH4, AlDH3A1 and AlDH3A2 were not found to be expressed in N 18 TG 2 cells (Chapter 4) other ADH isoform(s) are likely responsible for NAE o xidation in vivo Indeed, ADH3 and ADH4 did not have particularly favorable kinetics for formation of the acylaldehyde 42 or NAG 43 although the in vitro nature of the studies did not allow for analysis of long chain NAEs in the aqueous solutions used. Further studies of ADH5 and ADH6 are required, as these two ADHs are poorly investigated to date. The levels of oleamide found after incubation with cyt c siRNA and OA were not significantly lower than that found in the absence of cyt siRNA ( Figure 5 9 ). Although it is possible that other cells show a different mechanism for oleamide biosynthesis via cyt c, cy t c is not likely to play a role in direct PFAM biosynthesis in N 18 TG 2 cells, either by glycination or amidation of oleoyl CoA Because there is no other candidate for NAG biosynthesis, as they have been ruled out by the expression studies in Chapter 4 and other enzymologic studies and because the isotopic labeling studies indicate that both pathways are at work in the ce l ls, it may be concluded that an unknown enzyme is responsible for in vivo NAG biosynthesis: an undiscovered long chain specific glycine N acyltransferase. These findings do not rule out the activation of the FFAs to another intermediate, such as an acyl adenylate similar to the amino acid adenylates involved in activating tRNAs, or a fatty acid thioester linked to a cysteine in a carrier p rotein, similar to intermediates observed in fatty acid biosynthesis.

PAGE 240

216 Although there is now a much better understanding of how PFAMs are synthesized and in what amounts there is much still to be explored. The activities of ADH5 and ADH6 need to be investigated for their ability to convert long chain NAEs to aldehydes and potentially NAGs, as ADH4 is capable of doing for shorter chain NAEs. 43 If these are incapable of the dismutation, aldehyde dehydrogenases (AlDHs) should be investigated Although the long chain specific AlDHs were not found in N 18 TG 2 cells (Chapter 4), other AlDHs c ould be candidates. Rabbit ADH was shown to oxidize dodecanal (K M = 20 M) in the presence of NAD + and demonstrated a preference for longer chain aldehydes. 44 Rat liver mitochrondrial AlDH also oxidized dodecanal. 45 Longer chain aldehydes have not been reported as AlDH substrates, either because they were not found to be substrates or, more likely because of solubility issues preventing their analyses 42 The existence of an unknown glycination enzyme poses the greatest challenge to elucidating this pathway. Initial attempts to locate this enzyme usin g bioinformatic tools to mine the mouse genome for ACGNAT, NMT and BAAT like regions of DNA have yielded no novel expressed mRNA (data not shown) Several studies are underway in the Merkler laboratory to ident ify this enzyme, including a Co A ylomics appr oach in which a biotinylated Co A was developed to probe for novel Co A binding proteins. These long chain amide signaling molecules show much potential for therapeutic targeting, as discussed in detail in Chapter 1. The diverse set of receptors which they t arget provide a broad spectrum for pharmacological treatment and elucidating PFAM and NAG biosynthesis will provide excellent targets for a huge range of disorders, including anxiety, depression, sleep disorders, and many motor and neurodegenerative disea ses. If a long chain specific N acyltransferase is identified, as the work in this dissertation would suggest, it could provide a specific target for regulating the metabolism of these molecules while avoiding broader effects seen by targeting enzymes such more than one biosynthetic scheme adds another dimension to the potential regulation and biosynthesis of these molecules. The field of lipidomics is a growing one that has broadened our view of the molecular world, and although the pharmacologic actions of oleamide have been appreciated for 15 years most of these lipid signaling molecules

PAGE 241

217 were unknown even 3 5 years ago. Evidence demonstrated in this dissertation represents a signif icant contribution to understanding the biosynthetic mechanisms of these unique and difficult molecules to which aqueous chemistry has been aspiring for 15 years. 5.8 References (1) Tong, Q.; Zheng, L.; Kang, Q.; Dodd, O. J.; Langer, J.; Li B.; Wang, D.; Li, D. FEBS Lett 2006 580 2207. (2) Tong, Q.; Zheng, L.; Dodd o, J.; Langer, J.; Wang, D.; Li, D. Am J Respir Cell Mol Biol 2006 34 28. (3) Rosinha, G. M.; Myioshi, A.; Azevedo, V.; Splitter, G. A.; Oliveira, S. C. J Med Microbiol 2002 51 661. (4) Brazma, A.; Parkinson, H.; Schlitt, T.; Shojatalab, M.; European Bioinformatics Institute: 2001; Vol. 2010, p A brief introduction to molecular biology with emphasis on genomics and bioinformatics. It is intended for scientists. (5) Eipper, B. A.; May, V.; Braas, K. M. J Biol Chem 1988 263 8371. (6) Wand, G. S.; Ney, R. L.; Baylin, S.; Eipper, B.; Mains, R. E. Metabolism 1985 34 1044. (7) Oldham, C. D.; Li, C.; Feng, J.; Scott, R. O.; Wang, W. Z.; Moore, A. B.; Girard, P. R.; Huang, J.; C aldwell, R. B.; Caldwell, R. W.; May, S. W. Am J Physiol 1997 273 C1908. (8) Fricker, L. D.; Adelman, J. P.; Douglass, J.; Thompson, R. C.; von Strandmann, R. P.; Hutton, J. Mol Endocrinol 1989 3 666. (9) Beaubien, G.; Schafer, M. K.; Weihe, E.; Dong, W.; Chretien, M.; Seidah, N. G.; Day, R. Cell Tissue Res 1995 279 539. (10) Zheng, M.; Streck, R. D.; Scott, R. E.; Seidah, N. G.; Pintar, J. E. J Neurosci 1994 14 4656. (11) Zhang, J.; Zheng, M.; Eipper, B. A.; Pintar, J. E. Dev Biol 1997 192 375. ( 12) Yoshihara, F.; Horio, T.; Nishikimi, T.; Matsuo, H.; Kangawa, K. Eur J Pharmacol 2002 436 1. (13) Okosi, A.; Brar, B. K.; Chan, M.; D'Souza, L.; Smith, E.; Stephanou, A.; Latchman, D. S.; Chowdrey, H. S.; Knight, R. A. Neuropeptides 1998 32 167. (14) Sultana, T. Doctoral Dissertation, Duquesne University, 2005. (15) Hiley, C. R.; Hoi, P. M. Cardiovasc Drug Rev 2007 25 46. (16) Arafat, E. S.; Trimble, J. W.; Andersen, R. N.; Dass, C.; Desiderio, D. M. Life Sci 1989 45 1679. (17) Hanus, L. O.; F ales, H. M.; Spande, T. F.; Basile, A. S. Anal Biochem 1999 270 159. (18) Driscoll, W. J.; Mueller, S. A.; Eipper, B. A.; Mueller, G. P. Mol Pharmacol 1999 55 1067. (19) Cravatt, B. F.; Giang, D. K.; Mayfield, S. P.; Boger, D. L.; Lerner, R. A.; Gilula N. B. Nature 1996 384 83.

PAGE 242

218 (20) Deutsch, D. G.; Goligorsky, M. S.; Schmid, P. C.; Krebsbach, R. J.; Schmid, H. H.; Das, S. K.; Dey, S. K.; Arreaza, G.; Thorup, C.; Stefano, G.; Moore, L. C. J Clin Invest 1997 100 1538. (21) Maccarrone, M.; Bari, M.; L orenzon, T.; Bisogno, T.; Di Marzo, V.; Finazzi Agro, A. J Biol Chem 2000 275 13484. (22) Giang, D. K.; Cravatt, B. F. Proc Natl Acad Sci U S A 1997 94 2238. (23) Childers, S. R.; Sexton, T.; Roy, M. B. Biochem Pharmacol 1994 47 711. (24) Hoi, P. M.; Hiley, C. R. Br J Pharmacol 2006 147 560. (25) Offertaler, L.; Mo, F. M.; Batkai, S.; Liu, J.; Begg, M.; Razdan, R. K.; Martin, B. R.; Bukoski, R. D.; Kunos, G. Mol Pharmacol 2003 63 699. (26) Sultana, T.; Johnson, M. E. J Chromatogr A 2006 1101 278. (27) Wakamatsu, K.; Masaki, T.; Itoh, F.; Kondo, K.; Sudo, K. Biochem Biophys Res Commun 1990 168 423. (28) Mitchell, C. A.; Davies, M. J.; Grounds, M. D.; McGeachie, J. K.; Crawford, G. J.; Hong, Y.; Chirila, T. V. J Biomater Appl 1996 10 230. (2 9) In RNA Interference Overview ; Applied Biosystems/Ambion: Foster City, CA, 2010; Vol. 2010. (30) Driscoll, W. J.; Konig, S.; Fales, H. M.; Pannell, L. K.; Eipper, B. A.; Mueller, G. P. Biochemistry 2000 39 8007. (31) Mains, R. E.; Park, L. P.; Eipper, B. A. J Biol Chem 1986 261 11938. (32) Merkler, D. J.; Chew, G. H.; Gee, A. J.; Merkler, K. A.; Sorondo, J. P.; Johnson, M. E. Biochemistry 2004 43 12667. (33) Mueller, G. P.; Husten, E. J.; Mains, R. E.; Eipper, B. A Mol Pharmacol 1993 44 972. (34) Mueller, G. P.; Driscoll, W. J.; Eipper, B. A. J Pharmacol Exp Ther 1999 290 1331. (35) Bauer, J. D.; Sunman, J. A.; Foster, M. S.; Thompson, J. R.; Ogonowski, A. A.; Cutler, S. J.; May, S. W.; Pollock, S. H. J Pharmac ol Exp Ther 2007 320 1171. (36) Chaturvedi, S.; Driscoll, W. J.; Elliot, B. M.; Faraday, M. M.; Grunberg, N. E.; Mueller, G. P. Prostaglandins Other Lipid Mediat 2006 81 136. (37) McCue, J. M.; Driscoll, W. J.; Mueller, G. P. Biochem Biophys Res Commun 2008 365 322. (38) Mueller, G. P.; Driscoll, W. J. J Biol Chem 2007 282 22364. (39) McCue, J. M.; Driscoll, W. J.; Mueller, G. P. Prostaglandins Other Lipid Mediat 2009 90 42. (40) Mueller, G. P.; Driscoll, W. J. Vitam Horm 2009 81 55. (41) Bradsh aw, H. B.; Rimmerman, N.; Hu, S. S.; Benton, V. M.; Stuart, J. M.; Masuda, K.; Cravatt, B. F.; O'Dell, D. K.; Walker, J. M. BMC Biochem 2009 10 14. (42) Ivkovic, M.; Lowe, E. W.; Merkler, D. J. in press 2010 (43) Aneetha, H.; O'Dell, D. K.; Tan, B.; Wal ker, J. M.; Hurley, T. D. Bioorg Med Chem Lett 2009 19 237. (44) Ichihara, K.; Noda, Y.; Tanaka, C.; Kusunose, M. Biochim Biophys Acta 1986 878 419. (45) Jeng, J. J.; Weiner, H. Arch. Biochem. Biophys. 1991 289 214.

PAGE 243

219 Appendices

PAGE 244

220 Appendix A: Synthesis of a N ovel N A cylglycine D erivative Silylation is the most widely used derivitization for GC analysis, and N,O bis(trimethylsilyl)trifluoroacetamide (BSTFA) one of the more common silylating agents. Derivitization with BSTFA results in trimethylsilylation of reactive groups of compounds in the following preference : alcohol > phenol > carboxylic acid > amine > amide Each active hydrogen is replaced with a trimethylsilyl (TMS) group ( Equation A top) where In addition, the formation of a nitrile is observed when the compound being derivitized is a primary fatty acid amide (PFAM) ( Equation A bottom). Upon derivitization of an N acylglycine (NAG), one would expect to see three products: NOG TMS 2, NOG (N TMS) and NOG (O TMS), the last two of which would Equation A : Derivitizations with BSTFA Formation of TMS derivative of a compound containing an activated hydrogen (top) and formation of a nitrile from a primary amide (bottom). Both are derivitizations with BSTFA.

PAGE 245

Appendix A: (Continued) 221 co elute. However, a fourth compound is observed under normal derivitization conditions, as shown in Figure A From the MS, a structure was hypothesized to be an Figure B Figure C show the fragmentation scheme for mono and di TMS NAGs. Figure D shows the structure of the proposed N oleoylglycine enyliminoacetate derivative and its fragmentation scheme.

PAGE 246

Appendix A: (Continued) 222 Figure A : GC MS of N Oleoylglycine Derivitized with BSTFA product. Panel A shows the whole GC chromatogram (top) and closeup of NOG peaks (bottom). Panel B shows the MS spectrum for the enyliminoacetate derivative. Panel B shows the MS of NOG with two TMS groups attached. Panel D shows mono derivitized NOG.

PAGE 247

Appendix A: (Continued) 223 Figure B : Fragmentation Scheme for Di TMS NAGs

PAGE 248

Appendix A: (Continued) 224 Figure C : F ragmentation S cheme for Mono TMS NAGs

PAGE 249

Appendix A: (Continued) 225 In order to verify the structure of this enyliminoacetate, a series of NAGs were synthesized and derivitized with BSTFA, including the linoleoyl palmitoyl palmitoleoyl and deuterated heptadecanoyl (D 33 ) glycines. A detailed description of NAG synthesis can be found in Chapter 2, Section 2.2.2.3. GC MS conditions can be found in Section 2.2.10. Figure D : Fragmentation Scheme for Enyliminoacetate Derivatives of NAGs

PAGE 250

Appendix A: (Continued) 226 If the predicted structure is correct, the fragmenta tion of each additional NAG derivative could be predicted, as shown in Figure E Figure F through Figure J show the resulting GC MS of the synthesized NAGs, the MS of each enylim inoacetate derivative, and the fragmentation pattern that matches the pr edicted fragmentation pattern. (For MS of NAG TMS and NAG (TMS) 2 derivatives, see Appendix B .)

PAGE 251

Appendix A: (Continued) 227 Figure E : Fragmentation Patterns for Enyliminoacetate Derivatives of N Acylglycines Fragmentation patterns predicted for enyliminoacetate derivatives of each NAG synthesized.

PAGE 252

Appendix A: (Continued) 228 Figure F : GC MS of Enyliminoacetate Derivative of NOG and Fragmentation GC of the enyliminoacetate derivative of N O leoylglycine (top), it MS (middle), and fragmentation (bottom)

PAGE 253

Appendix A: (Continued) 229 Figure G : GC MS of Enyliminoacetate Derivative of NLG and Fragmentation GC of the enylimi noacetate derivative of N linoleoylglycine (top), it MS (middle), and fragmentation (bottom)

PAGE 254

Appendix A: (Continued) 230 Figure H : GC MS of Enyliminoacetate Derivative of NPOG and Fragmentation GC of the enylimi noacetate derivative of N palmitoleoylglycine (top), it MS (middle), and fragmentation (bottom)

PAGE 255

Appendix A: (Continued) 231 Figure I : GC MS of Enyliminoacetate Derivative of NPG and Fragmentation GC of the enylimi noacetate derivative of N palmitoylglycine (top), it MS (middle), and fragmentation (bottom)

PAGE 256

Appendix A: (Continued) 232 A predicted reaction mechanism is given in Figure K and is based on the formation of a nitrile like intermediate as has been seen for primary amides ( Equation A ). Of the reactive groups, the amide is the least reactive, and the additional steric hindrance of the glycine makes this reaction even slower than for a primary amide The reaction Figure J : GC MS of Enyliminoacetate Derivative of HdG and Fragmentation GC of the enylimi noacetate derivative of N heptadecanoylglycine, D 33 (top), it MS (middle), and fragmentation (bottom)

PAGE 257

Appendix A: (Continued) 233 proceeds w ith a nucleophilic attack upon the silicon atom of the TMS donor, followed by the protonation of the derivitized oxygen from its neighboring amine or HCl available from the reaction mixture. The electrons are then drawn up towards the positively charged ox ygen, forming a transient nitrile and causing the TMS group to leave. This mechanism is similar to one reported by Ichiyama involving a primary amide and L chloropropionic acid as the electrophile 1 and would mark the end of the reaction for a primary amide to form a nitrile. In this case, the nitrile formed is less stable because the nitrogen is also connected to glycine leaving a positive charge on the nitrogen The hydrogen is highly acidic in this transition sta te and is readily abstracted, leaving behind electrons that then form a di imino intermediate. The iminoacetate the energetically favorable structure with resonance stabilization. The re sonance structures are shown in Figure L

PAGE 258

Appendix A: (Continued) 234 Figure K : Proposed Reaction Mechanism for the Formation of an Enyliminoacetate Derivative of NAGs

PAGE 259

Appendix A: (Continued) 235 Reference (1) Ichiyama, S.; Kurihara, T.; Li, Y. F.; Kogure, Y.; Tsunasawa, S.; Esaki, N. J Biol Chem 2000, 275 40804. Figure L : Resonance of Enyliminoacetate Derivative of NAG

PAGE 260

236 Appendix B: GC MS of Synthesized Standards Throughout these experiments standards had to be synthesized where not commercially available both for the formation of standard curves and for entry into the library database for compound verification in cell and media extracts. The GC MS of these standar ds are shown below. GC MS of PFAMs Primary fatty acid amides (PFAMs) were synthesized as described in Chapter 2 Section 2.2.2.2. Where commercially available, acyl chlorides were used. Where they were not available, acyl chlorides were synthesized from fatty acids as described in Chapter 2, Section 2.2.2.1. The primary product of derivitization with BSTFA was an acyl nitrile, although the amide TMS was also observed.

PAGE 261

Appendix B : (Continued) 237 Figure M : GC MS of 13 C 18 Oleamide Panel A shows the GC of U 13 C 18 oleamide. The nitrile spans from 14.5 15.3 minutes. The large peak from 16.1 17 is the fatty acid. The PFAM TMS is around 18 minutes. Panel B shows the annotated MS of U 13 C 18 oleamide TMS. Panel C shows the annotated MS of U 13 C 18 oleonitrile.

PAGE 262

Appendix B : (Continued) 238 Figure N : GC MS of Oleamide Panel A shows the GC of oleamide (top) with a close up of oleonitrile and oleamide TMS peaks (bottom) The unlabeled peak is underivitized oleamide Panel B s hows the annotated oleonitrile MS. Panel C shows the annotated oleamide TMS MS.

PAGE 263

Appendix B : (Continued) 239 Figure O : GC MS of Tridecanamide Panel A shows the GC of tridecanamide. Overlaid on the tridecanamide TMS close up is the SIM for m/z 131 a characteristic m/z for PFAM TMS resulting from a McLafferty rearrangement The peak had been split into two but both had MS for tridecanamide TMS. Contamination at the source caused the GC spectrum to show increased conta minants as the temperature increased (top right). Panel B shows the MS of tridecanamide TMS

PAGE 264

Appendix B : (Continued) 240 Figure P : GC MS of Palmitamide GC MS of synthesized palmitamide. Panel A shows the GC chromatogram over entire time period (top) and a close up of the palmitonitrile peak (bottom). Palmitamide TMS is at retention time 16.25 minutes. Panel B shows the MS of palmitonitrile. Panel C shows the MS of palmitamide TMS

PAGE 265

Appendix B : (Continued) 241 Figure Q : GC MS of Palmitoleamide GC MS of synthesized palmitoleamide. Panel A shows the GC chromatogram over entire time period (top) and a close up of the palmitoleonitrile peak (bottom). Palmitoleamide TMS is at retention time 16.1 minutes. Panel B shows the MS of palmitoleonitrile. Panel C sho ws the MS of palmitoleamide TMS

PAGE 266

Appendix B : (Continued) 242 Figure R : GC MS of Elaidamide GC MS of synthesized elaidamide. Panel A shows GC chromatogram over entire time period (top) and a close up of the elaidonitrile peak (bottom). Elaidamide TMS is at ret ention time 17.8 minutes. Panel B shows the MS of elaidonitrile. Panel C shows the MS of elaidamide TMS.

PAGE 267

Appendix B : (Continued) 243 Figure S : GC MS of Linoleamide GC MS of synthesized linoleamide. Panel A shows GC chromatogram over entire time period (top) and a close up of the linoleonitrile peak (bottom). Linoleamide TMS is at retention time 17.7 minutes. Panel B shows the MS of linoleonitrile. Panel C shows the MS of linoleamide TMS.

PAGE 268

Appendix B : (Continued) 244 GC MS of NAGs N acylglycines (NAGs) were synthesized as described in Chapter 2, Section 2.2.2.3. Where commercially available, acyl chlorides were used. Where they were not available, acyl chlorides were synthesized from fatty acids as described in Chapter 2, Section 2.2 .2.1. The primary product of derivitization with BSTFA under normal derivitization conditions (60 min 60 o C) was the enyliminoacetate derivative, followed by NAG TMS. If abundant enough NAG was present, the NAG (TMS) 2 was also observed.

PAGE 269

Appendix B : (Continued) 245 Figure T : GC MS of 13 C 18 N Oleoylglycine Panel A shows the GC spectrum of 13 C 18 N oleoylglycine. Left peak at 18.8min is the enyliminoacetate. Peak from 20 21 min is 13 C 18 N oleoylglycine TMS. There is less enyliminoacetate in this reaction mixture because the rea ction was only allowed to proceed 15 minutes instead of the normal 60. Panels B D show MS from the large peak from 20 21 min with fragments annotated.

PAGE 270

Appendix B : (Continued) 246 Figure U : GC MS of N Palmitoylglycine Panel A shows the GC of N palmitoylglycine TMS. The mono derivitized NPG has a retention time of 20.6 minutes and its MS is shown in panel B. Panel C shows the MS for di TMS NP G (retention time 20.2 minutes). Panel D shows the MS for the enyliminoacetate derivative of NPG (retention time 17.3 minutes ).

PAGE 271

Appendix B : (Continued) 247 Figure V : GC MS of N Palmitoleoylglycine Panel A shows the GC of N palmitoleoylglycine TMS. The mono derivitized NPOG has a retention time of 19.2 minutes and its MS is shown in panel B. Panel C shows the MS for di TMS NPOG (retention time 18.85 minutes). Panel D shows the MS for the enyliminoace tate derivative of NPOG (retention time 17.2 minutes ).

PAGE 272

Appendix B : (Continued) 248 Figure W : GC MS of N Linoleoylglycine Panel A shows the GC of N linoleoylglycine TMS. The mono derivitized NLG has a retention tim e of 19.3 minutes and its MS is shown in panel B. Panel C shows the MS for di TMS NLG (retention time 19.05 minutes). Panel D shows the MS for the enyliminoacetate derivative of NLG (retention time 17.4 minutes).

PAGE 273

Appendix B : (Continued) 249 GC MS of NAEs N acylethanolamines (NAEs) were synthesized as described in Chapter 3, Section 3.3.2.3 The primary product of derivitization with BSTFA was a mono TMS derivative, but d i TMS product was also observed. Figure X : GC MS of N Elaidoylglycine Panel A shows the GC of N elaidoylglycine TMS. The mono derivitized NEG has a retention time of 20.6 minutes and its MS is shown in panel B. Panel C shows the MS for the enylimi noacetate derivative of NEG (retention time 18.8 minutes).

PAGE 274

Appendix B : (Continued) 250 Figure Y : GC MS of N Tridecanoylethanolamine Panel A shows the GC of N tridecanoylethanolamine (TDEA). The peak indicated with a vertical line is for mono derivitized TDEA and its MS is shown in panel B. The peak at 15.9 minutes is for bi derivitized TDEA and its MS is shown in panel C.

PAGE 275

251 Appendix C: GC MS of Mammalian Cells The results of incubations of each fatty acid and N tridecanoylethanolamine in SCP and N 18 TG 2 cells and media are shown below. For brevity, only one timepoint example from each cell and media incubated with each fatty acid or TDEA is shown. Many of the MS shown below are the TIC s (full range of m/z), but for integration purposes only the select ions specific to each acyl nitrile and/or PFAM TMS were used (see Chapter 3, Section 3.3.10 for more information). Both nitriles and PFAM TMS were observed products, and both samples showing nitriles and PFAM TMSs are shown below.

PAGE 276

Appendix C : (Continued) 252 GC MS of P almitoleic A cid I ncubated C ells O ver T ime Figure Z : GC MS of N 18 TG 2 Cell Extract after Incubation with P OA for 12h, Showing Palmitoleamide TMS GC MS of N 18 TG 2 cell extract after incubation with POA for 12h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (palmitoleamide TMS). Panel C shows the library database MS for palmitoleamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM POA in 0.25mM BSA for 12 hours in this case before extraction.

PAGE 277

Appendix C : (Continued) 253 Figure AA : GC MS of N 18 TG 2 Media Extract after Incubation with P OA for 12h, Showing Palmitoleamide TMS and I nterference from OA GC MS of N 18 TG 2 media extract after incubation with POA for 12h. Panel A shows the whole GC and zoom in of the peak of interest. The palmitoleamide TMS peak is buried within the OA peak. Panel B shows the MS of the indicated GC peak (palmitoleamide TMS). Panel C shows th e library database MS for palmitoleamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM OA in 0.25mM BSA for 12 hours in this case before extraction.

PAGE 278

Appendix C : (Continued) 254 Figure BB : GC MS of SCP Cell Extract after Incubation with POA for 48 h, Showing Palmitoleamide TMS GC MS of SCP cell extract after incubation with POA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (palmitoleamide TMS). Panel C shows the library database MS for palmitoleamide TMS. Panel D shows the difference between panels B and C. The cells were e xtracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM POA in 0.25mM BSA for 48 hours in this case before extraction.

PAGE 279

Appendix C : (Continued) 255 Figure CC : G C MS of SCP Media Extract after Incubation with P OA for 48 h, Showing Palmitoleonitrile GC MS of SCP media extract after incubation with POA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (pal mitoleonitrile). Panel C shows the library database MS for palmitoleonitrile. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM POA in 0.2 5mM BSA for 48 hours in this case before extraction.

PAGE 280

Appendix C : (Continued) 256 GC MS of P almitic A cid I ncubated C ells O ver T ime For data analysis, only the palmitonitrile was integrated and plotted against a corresp onding standard curve in which only the palmitonitrile was integrated. This was due to the interference of oleic acid and octadecanoic acid TMS esters co eluting with palmitamide TMS in both cell and media samples. One sample is shown with palmitamide TMS where resolution was slightly better ( Figure )

PAGE 281

Appendix C : (Continued) 257 Figure DD : GC MS of N 18 TG 2 Cell Extract after Incubation with P A for 24 h, Showing P almitonitrile GC MS of N 18 TG 2 cell extract after incubation with PA for 24h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (palmitonitrile). Panel C shows the library database MS for palmitoni trile. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM PA in 0.25mM BSA for 24 hours in this case before extraction.

PAGE 282

Appendix C : (Continued) 258 Figure EE : GC MS of N 18 TG 2 Media Extract after Incubation with P A for 48 h, Showing Palmitoleamide TMS GC MS of N 18 TG 2 media extract after incubation with PA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. The single ion trace m/z 131, characteristic for derivitized amides, is shown overlaid in red. Panel B shows the MS of the indicated GC peak (p almitamide TMS). Panel C shows the library database MS for palmitamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM PA in 0.25mM BSA for 48 hours i n this case before extraction.

PAGE 283

Appendix C : (Continued) 259 Figure FF : GC MS of SCP Cell Extract after Incubation with P A for 48 h, Showing P almitonitrile GC MS of SCP cell extract after incubation with PA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak ( palmitonitrile ). Panel C shows the library database MS for palmi tonitrile Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM PA in 0.25mM BSA for 48 hours in this case before extraction.

PAGE 284

Appendix C : (Continued) 260 GC MS of E laidic A cid I ncubated C ells O ver T ime Unambiguous assignment of unsaturated acyl chains can pose a problem in some samples. Separation of cis/trans isomers is not ideal on a nonpolar matrix such as the Figure GG : GC MS of SCP Media Extract after Incubation with P A for 24 h, Showing P almitonitrile GC MS of SCP media extract after incubation with PA for 24 h. Panel A shows the whole GC and zoom in of the peak of interest Panel B shows the MS of th e indicate d GC peak (palmitonitrile ). Panel C shows the library database MS for palmitonitrile Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM PA in 0.25mM BSA for 24 hours in this case before extraction.

PAGE 285

Appendix C : (Continued) 261 dimethylpolysiloxane GC column that is commonly used for lipid analysis. 1 A highly polar bis(cyanopropyl) polysiloxane phase has been shown to provide this separation but was not available for these analyses to determine whether the complex lipid extract would be separable on such a column The assumption is made that any 18:1 fatty acid amide found after incubation with elaidic aci d is elaidamide.

PAGE 286

Appendix C : (Continued) 262 Figure HH : GC MS of N 18 TG 2 Cell Extract after Incubation with EA for 48 h, Showing Elaidamide TMS GC MS of N 18 TG 2 cell extract after incubation with EA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (elaidamide TMS). Panel C shows the library database MS for elaidamide TMS. Panel D shows the diff erence between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM EA in 0.25mM BSA for 48 hours in this case before extraction.

PAGE 287

Appendix C : (Continued) 263 Figure II : GC MS of N 18 TG 2 Media Extract after Incubation with E A for 48 h, Showing E laidonitrile GC MS of N 18 TG 2 media extract after incubation with EA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (elaidonitrile). Panel C shows the library database MS for elaidonitrile. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had be en incubated with 2.5mM EA in 0.25mM BSA for 48 hours in this case before extraction.

PAGE 288

Appendix C : (Continued) 264 Figure JJ : GC MS of SCP Cell Extract after Incubation with E A for 24 h, Showing E laidamide TMS GC MS of SCP cell extract after incubation with EA for 24h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (elaidamide TMS). Panel C shows the library database MS for elaidamide TMS. Panel D sh ows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM EA in 0.25mM BSA for 48 hours i n this case before extraction.

PAGE 289

Appendix C : (Continued) 265 Figure KK : GC MS of SCP Media Extract after Incubation with E A for 24 h, Showing E laidonitrile GC MS of SCP media extract after incubation with EA for 24h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (elaidonitrile). Panel C shows the library database MS for elaidonitrile. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cell s had been incubated with 2.5mM EA in 0.25mM BSA for 24 hours in this case before extraction.

PAGE 290

Appendix C : (Continued) 266 GC MS of T idecanoic A cid I ncubated C ells O ver T ime Figure LL : GC MS of N 18 TG 2 Cell Extract after Incubation with TDA for 48 h, Showing T ridecanamide TMS GC MS of N 18 TG 2 cell extract after incubation with TDA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (tridecanamide TMS). Panel C shows the library database MS for tridecanamide TMS. Panel D shows t he difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM TDA in 0.25mM BSA for 48 hours i n this case before extraction.

PAGE 291

Appendix C : (Continued) 267 Figure MM : GC MS of N 18 TG 2 Media Extract after Incubation with TDA for 48 h, Showing T ridecanamide TMS GC MS of N 18 TG 2 media extract after incubation with TDA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (tridecanamide TMS). Panel C shows the library database MS for tridecanamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM TDA in 0.25mM BSA for 48 hours i n this case before extraction.

PAGE 292

Appendix C : (Continued) 268 Figure NN : GC MS of SCP Cell Extract after Incubation with TDA for 12 h, Showing T ridecanamide TMS GC MS of SCP cell extract after incubation with TDA for 12h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (tridecanamide TMS). Panel C shows the library database MS for tridecanamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in C hapter 3. The cells had been incubated with 2.5mM TDA in 0.25mM BSA for 12 hours i n this case before extraction.

PAGE 293

Appendix C : (Continued) 269 Figure OO : GC MS of SCP Media Extract after Incubation with TDA for 24 h, Showing T ridecanamide TMS GC MS of SCP media extract after incubation with TDA for 24h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (tridecanamide TMS). Panel C shows the library databa se MS for tridecanamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM TDA in 0.25mM BSA for 24 hours in this case before extracti on.

PAGE 294

Appendix C : (Continued) 270 GC MS of T idecanoylethanolamine I ncubated C ells O ver T ime Figure PP : GC MS of N 18 TG 2 Cell Extract after Incubation with TDEA for 48 h, Showing T ridecanamide TMS GC MS of N 18 TG 2 cell extract after incubation with TDEA for 48h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (tridecanamide TMS). Panel C shows the library database MS for tridecanamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM TDEA in 0.25mM BSA for 48 hours i n this case before extraction.

PAGE 295

Appendix C : (Continued) 271 Figure QQ : GC MS of N 18 TG 2 Media Extract after Incubation with TDEA for 12 h, Showing T ridecanamide TMS GC MS of N 18 TG 2 media extract after incubation with TDEA for 12h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (tridecanamide TMS). Panel C shows the library database MS for tridecanamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in Chapter 3. The cells had been incubated with 2.5mM TDEA in 0.25mM BSA for 12 hours in this case before extraction.

PAGE 296

Appendix C : (Continued) 272 Figure RR : GC MS of SCP Cell Extract after Incubation with TDEA for 24 h, Showing T ridecanamide TMS GC MS of SCP cell extract after incubation with TDEA for 24h. Panel A shows the whole GC and zoom in of the peak of interest. Panel B shows the MS of the indicated GC peak (tridecanamide TMS). Panel C shows the library database MS for tridecanamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods section in C hapter 3. The cells had been incubated with 2.5mM TDEA in 0.25mM BSA for 24 hours i n this case before extraction.

PAGE 297

Appendix C : (Continued) 273 Reference (1) Sanchez Avila, N.; Mata Granados, J. M.; Ruiz Jimenez, J.; Luque de Castro, M. D. J Chromatogr A 2009, 1216 6864. Figure SS : GC MS of SCP Media Extract after Incubation with TDEA for 48h, Showing Tridecanamide TMS GC MS of SCP media extract after incubation with TDEA for 48h. Panel A shows the whole GC and zoom in of the pe ak of interest. Panel B shows the MS of the indicated GC peak (tridecanamide TMS). Panel C shows the library database MS for tridecanamide TMS. Panel D shows the difference between panels B and C. The cells were extracted as described in the methods sectio n in Chapter 3. The cells had been incubated with 2.5mM TDEA in 0.25mM BSA for 48 hours i n this case before extraction.

PAGE 298

274 Appendix D: Primer Sequences The primers used in Chapter 4 for RT PCR expression studies are shown in Table A N ot all sequences were known for sheep and so those primers are based on multiple sequence alignments of those from closely related species. The FAAH isoforms probed were all FAAH 1, as that is the only isoform expressed in mice and sheep. 1 Table A : Primer List, Predicted Fragment Size, and Successful PCR Experiments Primer target sequence Expected fragment size (bp) Target DNA ACGNAT: sense GTGGACAAGTGGCCTGATTT ACGNAT: antisense CAGTTTTGGGGATCTTTGGA 119 human kidney, liver acyl CoA synthetase 4: sense CACCATTGCCATTTTCTGTG acyl CoA synthetase 4: antisense GCCTTCAGTTTGCTTTCCAG 268 N 18 TG 2 SCP acyl CoA synthetase 3: sense TGTGCGACAGCTTTGTTTTC h acyl CoA synthetase 3: antisense CTGGGGTGTGGCTTATCAGT 292 human brain, kidney, liver acyl CoA synthetase 5 and 6: sense TTCGAAGAAGCCCTGAAAGA h acyl CoA synthetase 5 and 6: antisense AGAAATCAGCCACCACGTTC 205 human brain, kidney BAAT: sense TGGCCTTGGCTTACCATAAC BAAT: antisense CGTGGCTGTGACTTGCTTTA 197 human liver FAAH: sense CATGTCACTCTCCTGCTCCA FAAH: antisense AGCCAGGGCTACACAGAGAA 230 N 18 TG 2 FAAH: sense AAGCAACATACCCCATGCTC FAAH: antisense GTTTTGCGGTACACCTCGAT 276 human brain, kidney FAAH: sense GCAGCGCTTCCGGCT FAAH: antisense TAGAGCAGGCCCTGCC 228 human brain, kidney, liver PAM1: sense CACTGGATATTCGCATGC PAM1: antisense ACTAGATGTGCCGCCGAT (nested) PAM2: sense GACACTGTCCACCATATG PAM2: antisense CCTAAATGGTGAGTATG 431 N 18 TG 2 SCP PAM: sense TTGCTCTTTGCAGTGAATGG PAM: antisense CACACGGTGTTGGTATGAGC 194 human brain, kidney, liver Cytochrome c: sense GTCAGGCCCCTGGATACTCT Cytochrome c: antisense TCTGCCCTTTCTTCCTTCTTC 157 Human brain, kidney, liver Cytochrome c: sense CCAAATCTCCACGGTCTGTT Cytochrome c: antisense GTCTGCCCTTTCTCCCTTCT 192 N 18 TG 2 Cytochrome c: sense 2 CCAAACCTCCATGGTCT Cytochrome c: antisense 2 CTTCTTCTTAATGCC 177 SCP

PAGE 299

Appendix D : (Continued) 275 ADH3: sense TGATGGCACCACCAGATTTA ADH3: antisense ACAGCCCATGATGACTGACA 262 Human brain, kidney, liver ADH3: sense AGTTGGGGTTGTGGAGAGTG ADH3: antisense AAAATCCACAGCCGATCAAG 320 N 18 TG 2 ADH3: sense 2 GCTGCTGTTAAAACTG ADH3: antisense 2 CTGGTCCCATAGTTCAT 323 SCP ALDH 3A2: sense GGGAGGGAAAAGTCCATGTT ALDH 3A2: antisense GTTGGGGCTATGTAGCGTGT 324 Human brain, kidney, liver CYP4F12: sense GGAGCTCAGTGCCCTTGTAG CYP4F12: antisense GCCTCCAAACATGAAGGTGT 310 Human brain, kidney, liver CYP4F17: sense ACCAGCCCTTCCTGTACCTT CYP4F17: antisense GCCTCCAAACATGAAGGTGT 278 N 18 TG 2 Reference (1) Wei, B. Q.; Mikkelsen, T. S.; McKinney, M. K.; Lander, E. S.; Cravatt, B. F. J Biol Chem 2006, 281 36569.

PAGE 300

About the Author Emma Katherine Farrell received her B.A. in Biology with a minor in Chemistry from the University of Missouri St. Louis, where she also taught as an undergraduate teaching assistant and received an award for her work She made the transition from biology to biochemistry for her graduate studies at the University of South Florida. Emma wrote and was awarded two grants for her work on fatty acid amide biosynthesis through the USF Thrust Life Sciences Program administered by the Fl orida Center of Excellence for Biomolecular Identification and Targeted Therapeutics. In addition to six other travel awards Emma received full suppor t to attend the 2009 Education w ithout B orders conference in Dubai, UAE as a delegate. Emma presented her work at 8 meetings co chaired the student led Castle Conference and mentored four undergraduate students during her time at USF.