USF Libraries
USF Digital Collections

Splicing systems for studying signaling to the spliceosome

MISSING IMAGE

Material Information

Title:
Splicing systems for studying signaling to the spliceosome
Physical Description:
Book
Language:
English
Creator:
Apostolatos, Hercules
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
PKCbeta
PKCdelta
Splicing
SRp40
SC35
Dissertations, Academic -- Molecular Medicine -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Alternative splicing is a major contributing factor to protein diversity. The human genome project validated that there are about 25,000 genes, but over 100,000 proteins. Genes contain numerous exons that are specifically regulated; thus, elucidating alternative splicing mechanisms of pre-mRNAs is an immense undertaking. Two basic tools are used to study this mammoth task. For in vitro studies, usually in vitro transcription followed by splicing assays is used. For in vivo studies, the main technique is the construction of minigenes. These techniques enable one to study the mechanisms/conditions that explain an exon's inclusion or exclusion in the mature mRNA. In this project, studies were focused in the protein kinase C (PKC) family, and specifically in certain exons of PKCβ and PKC genes. The PKCβ gene codes two proteins: PKCβI and PKCβII. The pre-mRNA of PKCβ contains 18 exons. If exon-17 (exon-βII) is included in the spliced transcript, protein PKCβII is expressed. If exon-βII is skipped (excluded), protein PKCβI is expressed. Previous and current results indicate that insulin treatment not only favors exon-βII inclusion, but also regulates 3'-UTR size in mature mRNA. We identified up to five different PKCβII mRNAs that differ only in the 3'-UTR size (all five mature transcripts express the same PKCβII protein). PKCβII is required for glucose uptake in skeletal muscle and adipocytes. Additional studies revealed that inclusion of exon-βII involves SRp40 in its phosphorylated form. Small interfering RNA (siRNA) knockdown of Akt2 and Clk1 further revealed that SRp40 was phosphorylated by Akt2/Clk1, and that Akt2 phosphorylates Clk1. The knockdown of Clk1 or SRp40 down-regulated glucose uptake. The PKC gene contains 18 exons. The standard size of exon-10 is 97-bases, and when included in the mature transcript, PKCI is expressed. Exon-10 has an additional 5'-splice site that extends the exon size to 190-bases. When this extended size is included in the mature transcript, PKCVIII is expressed which has a profound effect in the fate of the cell by blocking apoptosis. Our results reveal that all-trans retinoic acid regulates the inclusion of exon-10 extended size. Moreover, the inclusion involves SC35 (SRp30b). Finally, we elucidated the position of the SC35 cis-element.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Hercules Apostolatos.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003367
usfldc handle - e14.3367
System ID:
SFS0027683:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003367
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Apostolatos, Hercules.
0 245
Splicing systems for studying signaling to the spliceosome
h [electronic resource] /
by Hercules Apostolatos.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Alternative splicing is a major contributing factor to protein diversity. The human genome project validated that there are about 25,000 genes, but over 100,000 proteins. Genes contain numerous exons that are specifically regulated; thus, elucidating alternative splicing mechanisms of pre-mRNAs is an immense undertaking. Two basic tools are used to study this mammoth task. For in vitro studies, usually in vitro transcription followed by splicing assays is used. For in vivo studies, the main technique is the construction of minigenes. These techniques enable one to study the mechanisms/conditions that explain an exon's inclusion or exclusion in the mature mRNA. In this project, studies were focused in the protein kinase C (PKC) family, and specifically in certain exons of PKCβ and PKC genes. The PKCβ gene codes two proteins: PKCβI and PKCβII. The pre-mRNA of PKCβ contains 18 exons. If exon-17 (exon-βII) is included in the spliced transcript, protein PKCβII is expressed. If exon-βII is skipped (excluded), protein PKCβI is expressed. Previous and current results indicate that insulin treatment not only favors exon-βII inclusion, but also regulates 3'-UTR size in mature mRNA. We identified up to five different PKCβII mRNAs that differ only in the 3'-UTR size (all five mature transcripts express the same PKCβII protein). PKCβII is required for glucose uptake in skeletal muscle and adipocytes. Additional studies revealed that inclusion of exon-βII involves SRp40 in its phosphorylated form. Small interfering RNA (siRNA) knockdown of Akt2 and Clk1 further revealed that SRp40 was phosphorylated by Akt2/Clk1, and that Akt2 phosphorylates Clk1. The knockdown of Clk1 or SRp40 down-regulated glucose uptake. The PKC gene contains 18 exons. The standard size of exon-10 is 97-bases, and when included in the mature transcript, PKCI is expressed. Exon-10 has an additional 5'-splice site that extends the exon size to 190-bases. When this extended size is included in the mature transcript, PKCVIII is expressed which has a profound effect in the fate of the cell by blocking apoptosis. Our results reveal that all-trans retinoic acid regulates the inclusion of exon-10 extended size. Moreover, the inclusion involves SC35 (SRp30b). Finally, we elucidated the position of the SC35 cis-element.
590
Advisor: Denise R. Cooper, Ph.D.
653
PKCbeta
PKCdelta
Splicing
SRp40
SC35
690
Dissertations, Academic
z USF
x Molecular Medicine
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3367



PAGE 1

Splicing Systems for Studying S ignaling to the S pliceosome by Hercules S. Apostolatos A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Co Major Professor: Denise R. Cooper Ph.D. C o Major Professor: Niketa A. Patel Ph.D. Robert J. Deschenes, Ph.D. Duane C. Eichler, Ph.D. R K ennedy Keller Ph.D. J in Q. C heng Ph.D. Date of Approval: April 8 20 1 0 Keywords: PKC P KC Splicing, SRp40, SC35 Copyright 20 1 0, Hercules S. Apostolatos

PAGE 2

DEDICATION I dedicate this dissertation t o my children Helen Angelic Apostolatos, Andre Hercules Apostolatos, Adrian Nicholas Apostolatos, and Christopher Alexander Apostolatos. My wish is that this dissertation inspires them to reach rewarding goals in their lives, and that one of their goals is in the medical sciences I also dedicate this dissertation to my grandchildren Raymond III Mariano Javan Micah and Jericho Asher I hope this dissertation serves not only as an inspiration, but also as a challenge. I hope my children and grandchildren a re inspired to pursue challenging goals, b ut above all, I hope all of them have a happy and rewarding life.

PAGE 3

ACKNOWLEDGEMENTS There are several distinguished persons that enabled me to complete this odyssey First and foremost is my major professor a nd mentor Dr. Denise R. Cooper followed by my co major professor and co mentor Dr. Niketa Patel Also, the present and past Cooper/Patel lab m embers starting with Kun Jiang Ph D /MD Tomar Ghansah Ph D David Chapel Ph.D., Pengfei Li Ph D Eden Kleiman Ph D Karen Davidowitz C o r b in Ph.D., J ames Watson Gay Carter and Andre H. Apostolatos I also want to acknowledge and thank the remaining members of my committee : Dr. Duane Eichler, Dr. Robert J. Deschenes, Dr. Robert K. Keller, and Dr. Jin Q. Cheng. Ne xt are the faculty and staff of th e Molecular Medicine Department; few: Dr. Andreas Seyfang Dana Cole Helen Chen Duncan, and Andrew Conniff Special thanks to Dr. Charles E. Chalfant for agreeing to be my outside chair and taking the time to read my dissertation Going down the list I want to thank Dr. William Gower at the VA Medical Center for the u se of his lab equipment and also t hanks to his lab staff Abdel Alli Ph.D. and Deborah Houyou Also thanks to Dr. George Blanck and his l ab, Dr. Michael Barber and his lab Kathy Zahn Pascual Bidot MD Andrea Moor PhD and Quentin McAfee Last but not least, I appreciate the funding sources that enabled me to do this research. They are the National Institute of Health and the Department of Veterans Affairs

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES ................................ ................................ ................................ ............. vi LIST OF FIGURES ................................ ................................ ................................ .......... vii ABBREVIATIONS ................................ ................................ ................................ ............ x ABSTRACT ................................ ................................ ................................ ...................... xv INTRODUCTION ................................ ................................ ................................ .............. 1 Project Ov erview ................................ ................................ ................................ ............ 1 Best friend of protein diversity ................................ ................................ ....................... 2 Brief Introduction to SR proteins ................................ ................................ .................... 3 Splicing sites, branch point, pyrimidine tract ................................ ................................ 5 ................................ ................... 6 Capping o ................................ ................................ ................................ .. 7 ................................ ................................ ..................... 8 Multiple poly(A) signals ................................ ................................ ............................. 9 Splicing in simple terms ................................ ................................ ............................ 11 The two main steps of splicing ................................ ................................ ................. 12 snRNAs and snRNPs ................................ ................................ ................................ 13 Splicing Mechanism ................................ ................................ ................................ .. 14 Multiple isoforms of mature mRNA ................................ ................................ ............. 16 Multiple starts/stops of transcription ................................ ................................ ........ 17 Exon Skipping ................................ ................................ ................................ ........... 17

PAGE 5

ii Mutually Exclusive Exons ................................ ................................ ........................ 18 e ................................ ................................ ................................ ... 19 Competing 5' or 3' Splice Sites ................................ ................................ ................. 19 Transport to the cytosol ................................ ................................ ................................ 21 Translation in the cytosol ................................ ................................ .............................. 24 Protein expression regulated by the isoform used ................................ ........................ 25 ................................ ................................ .................. 26 Background on Insulin ................................ ................................ ................................ .. 28 Protein Kinase C in Signaling ................................ ................................ ....................... 29 Splicing of PKC ................................ ................................ ................................ .......... 32 Splicing of PKC ................................ ................................ ................................ .......... 32 SRp40 effect on splicing of PKC ................................ ................................ ............... 38 PI3 kinase pathway activated by factors other than insulin ................................ ......... 39 Background on Retinoic Acid ................................ ................................ ....................... 40 Splicing of PKC and PKC involves com ................................ 40 Functions of PKC in various species ................................ ................................ .......... 43 Splicing of PKC in humans ................................ ................................ ........................ 44 Splicing Vectors ................................ ................................ ................................ ............ 46 Splicing Vector pSPL3 ................................ ................................ ................................ 47 Splicing Vector pSPL3 ................................ ................................ ................................ 47 In Vitro Transcription/Splicing Strategies ................................ ................................ .... 50 PKC Activation ................................ ................................ ................................ ............. 54 PKC Inhibitors ................................ ................................ ................................ .............. 55

PAGE 6

iii RACK mechanism ................................ ................................ ................................ ........ 56 EXPERIMENTAL PROCEDURES ................................ ................................ ................. 57 Materials ................................ ................................ ................................ ....................... 57 Cell Culture ................................ ................................ ................................ ................... 58 Tissues ................................ ................................ ................................ .......................... 59 Expression of myc SRp40 in L6 Cells ................................ ................................ ......... 60 Cloning minigenes 18, 19, 20, and 22 in pSPL3 for PKC ................................ .......... 60 Modified Ligation Protocol ................................ ................................ .......................... 63 Construction of pSPL3 PKC minigenes ................................ ................................ ..... 65 Overexpression/Minigene Transient Transfection ................................ ........................ 69 RNA Isolation ................................ ................................ ................................ ............... 70 Reverse Transcription reactions ................................ ................................ .................... 73 PCR 74 In Vitro Transcription Templat es ................................ ................................ .................. 76 In Vitro Transcription ................................ ................................ ................................ ... 80 Splicing Assays ................................ ................................ ................................ ............. 82 siRNA Knockdo wn ................................ ................................ ................................ ....... 82 Silver Staining ................................ ................................ ................................ ............... 83 Agarose Gels ................................ ................................ ................................ ................. 83 Western Blot Analysis ................................ ................................ ................................ .. 84 Co immunoprecipitation ................................ ................................ ............................... 85 Real time PCR ................................ ................................ ................................ .............. 85 RESULTS ................................ ................................ ................................ ......................... 86

PAGE 7

iv Insulin Regulated PKCII Exon Splicing in Hepatocytes, 3T3 Adipocytes, and Hepatoma Cells [81]* ................................ ................................ ....................... 86 Development of an Insulin Regulated H eterologous Minigene [81] ............................ 87 Insulin Regulated PKC II Minigene in Multiple Target Tissues [81] ......................... 90 Insulin Activated PKCII 5' Splice Sites [81] ................................ ............................. 91 Insulin Signals via PI3 Kinase to Regulate PKCII Minigene [81] ............................. 93 Akt2 Is a Downstream Kinase Regulating PKCII Exon Splice Site Selection [81] ... 93 Clk/Sty Cot ransfection Regulated PKCII Exon Splice Site Selection [81] ................ 95 Binding of SRp40 Is Essential for Insulin Regulated Splice Site Activation [81] ....... 95 Consecutive Deletion of the 5' Intronic Sequences in PKCII Minigene Reveals Multiple Regulatory Effects [81] ................................ ................................ ...... 97 Transfection of cells with constitutively active Akt2 kinase mimics insulin induced splicing of PKC ................................ ................................ .................. 100 Akt2 Kinase Phosphorylated SRp40 in Vivo [94] ................................ ...................... 101 SRp40 Is an Akt2 Substrate [94] ................................ ................................ ................ 103 Mutation of Akt2 Phosphorylation Site in SRp40 Attenuated PKC II Exon Inclusion [94] ................................ ................................ ................................ .. 105 Fibroblasts from Akt2( / ) Mice Splice the PKC II Exon Inefficientl y [94] ............. 105 Akt2 Kinase Association with SRp40 Is Regulated by Insulin [94] ........................... 107 Fibroblasts from Akt2 ( / ) Mice Do Not Phosphory late SRp40 in Vivo [94] ........... 108 Muscle Tissues from Akt2( / ) Mice Expressed Less PKC II mRNA [94] ............... 110 HeLa cell and HEK 293 cell nuclear extracts splice exon II to I in vitro .............. 111 In Vitro Splicing of exon II t o I utilizes SSI and SSII ................................ ............ 113 ................................ .................. 115

PAGE 8

v Phosphorylation of Clk/Sty by Akt [41] ................................ ................................ ..... 118 ) .............. 121 Retinoic Acid regulates the expression of PKC VIII in neuronal cells ..................... 122 Expression of PKC VIII in various tissues also regulated by RA ............................. 123 alternative splicing ................................ ................................ .......................... 124 SC35 mimics RA ................................ ....... 125 SC35 knockdow ................................ 128 Antisense oligonucleotides indicate a role of SC35 cis splicing ................................ ................................ ................................ ............ 129 Construction of a heterologous pSPL3 responsive to RA ................................ ................................ ............................. 131 splicing minigene ................................ ................................ ................. 133 Deletion analysis of the pSPL3 ................................ ........................ 135 Mutation of SC35 binding site on the heterologous pSPL3 P ................................ ........................... 136 DISCUSSION ................................ ................................ ................................ ................. 138 REFERENCES ................................ ................................ ................................ ............... 150 ABOUT THE AUTHOR ................................ ................................ ................... END PAGE

PAGE 9

vi LIST OF TABLES Table 1. PKC Isoform Tissue/Cell Expression ................................ ................................ 27 Table 2. PKC Is oform Size ................................ ................................ ............................... 28 Table 3. Summary of PKC spliced variants ................................ ................................ .... 37 Table 4. PKC Isoform Activators ................................ ................................ ..................... 54 Table 5. PKC Inhibitors ................................ ................................ ................................ ... 55 Table 6. LY379196 Inhibitor IC 50 Spectrum ................................ ................................ .... 56 Table 7. Summary of deletion series pSPL3 constructs ................................ ................... 63 Table 8. Primer list for PKC minigenes ................................ ................................ .......... 66 Table 9. Content of each PKC minigene ................................ ................................ ........ 67 Table 10. Summary of in vitro transcription PCR DNA templates ................................ .. 77 Table 11. Primer list for betaII and betaI PCR fragments ................................ ................ 79

PAGE 10

vii LIST OF FIGURES Figure 1. 38,016 Shades o f DSCAM ................................ ................................ .................. 2 Figure 2. Spliceosome Assembly on Regulated and Unregulated Splice Sites .................. 4 Figure 3. Intron Exon boundaries and consen sus sequences ................................ .............. 5 ................................ ................................ .......................... 7 Figure 5. Polyadenylation ................................ ................................ ................................ ... 8 Figure 6. Overview of transcription and splicing ................................ ............................. 11 Figure 7. Splicing mechanism ................................ ................................ ........................... 15 Figure 8. Transport of Eukaryo tic RNAs through the nuclear pore ................................ 23 Figure 9. Protein Kinase C Isoforms ................................ ................................ ................. 26 Figure 10. PKC Isoforms in Insulin Responsive Tissue s ................................ ................. 30 Figure 11. PKC pre mRNA variants ................................ ................................ .............. 32 Figure 12. PKC I Isoform ................................ ................................ ................................ 33 Figure 13. PKC II Isoform Utilizing the first poly A signal ................................ ........... 34 Figure 14. PKC II Isoform Utilizing the last poly .............. 35 Figure 15. PKC II Isoform Utilizing the last poly A signal a ................... 36 Figure 16. The PKC II six spliced variants ................................ ................................ ...... 37 Figure 17. The two splice variants of PKC ................................ ................................ ..... 44 Figure 18. Vector pSPL3, its components, and the main spliced product. ....................... 47 Figure 19. Vector pSPL3 with an insert and the expected main spliced pro ducts. ........... 48

PAGE 11

viii Figure 20. The main components of the SD Intron SA region of vector pSPL3. ............ 49 Figure 21. The pSPL3 18,19,20,22 minigen e structures. ................................ ................. 61 Figure 22. Insulin Regulated Endogenous Alternative Splicing of the C Terminus of PKC pre mRNA. ................................ ................................ .......................... 87 Figure 23. Insulin Regulated PKCII Splicing Minigene. ................................ ............... 88 Figure 24. The pSPL3 32 Minigene was Regulated by Insulin in Various Cell Types. .. 90 Figure 25. 3' Intronic Sequences Are Not Involved in Insulin Regulated 5' Splice Site Selection. ................................ ................................ ................................ ....... 92 Figure 26. 5' Splice Site Selection in pSPL3 17 Minigene Is Regulated by PI3 Kinase Pathw ay. ................................ ................................ ................................ ......... 94 Figure 27. SRp40 Binding and Phosphorylation Affect PKCII 5' Splice Site Selection ................................ ................................ ................................ ........ 96 Figure 28. Consecutive Deletions of PKCII Minigene Reveal Multiple Regulatory Effects ................................ ................................ ................................ ............ 98 Figure 29. Constitutively active Akt2 kinase mimics insulin induced endogenous ................................ ................................ ........................... 101 Figure 30. Akt2 kinase phosphorylates SRp40 in vivo ................................ ................... 102 Figure 31. SRp40 Is an Akt2 Substrate ................................ ................................ ........... 104 F igure 32. Akt2 Phosphorylation Site in SRp40 regulates PKC II exon inclusion ....... 106 Figure 33. Co immunoprecipitation of Akt2 and SRp40 ................................ ................ 107 Figure 34. Mouse fibroblasts from Akt2( / ) cells do not phosphorylate SRp40 in vivo upon insulin treatment ................................ ................................ ................. 109 Figure 35. Real time quantitative PCR shows decreased PKC II mRNA levels in Akt2( / ) cells. ................................ ................................ .............................. 110 Figure 36. In vitro splicing of exon betaII to exon betaI ................................ ................ 112

PAGE 12

ix Figure 37. In Vitro Splicing of exon II to I can utilize SSI and SSII ......................... 113 ................................ .... 115 Figure 39. Cells overexpressing Clk/Sty increased exon 17 ( II exon) inclusion ........ 117 Figure 40. Clk/Sty and Akt2 siRNA block splicing of heterologous minigene .............. 118 Figure 41. Transiently expressed Clk/Sty was phosp horylated by Akt2 ........................ 119 Figure 42. Endogenous Clk/Sty was phosphorylated by Akt2 during insulin signaling 120 Figure 43. Alternati ve splicing of human PKC gene ................................ .................... 121 Figure 44. Retinoic Acid regulates the expression of PKC VIII ................................ ... 122 Figure 45. Expression of PK C VIII in human fetal tissues ................................ ............ 124 Figure 46. Detection of SR proteins involved in RA .. 125 Figure 47. .............................. 126 dependent manner ............. 127 ................................ ..... 128 Figure 50. Analysis of putative cis elements and antisense oligonucleotides (ASO) .... 130 ............. 132 Figure 52. Co utilization of 5' splice site II. ................................ ................................ ....... 134 Figure 53. Deletion analysis of minigene demonstrates role of SC35 cis element on RA ..................... 135 ...... 137 Figure 55. Signaling linkage between PI3K, Akt2, Clk/Sty, SR prot pre mRNA alternative splicing [41] ................................ ............................ 144

PAGE 13

x A BBREVIATIONS Minimum essential medium alpha AS160 Akt substrate of 160kDa ASM Acid sphingomyelinase aPKC Atypical PKC Ca 2+ Calcium C a MK Calcium/calmodul in dependent protein kinase CAPP Ceramide activated protein phosphatase cDNA Complementary DNA C/EBP CAAT/enhancer binding proteins CIP4 Cdc42 interacting protein 4 Clk1 CDC like kinase 1 cPKC Classical PKC CTD C terminal domain CTE C termi nal extension DAG Diacylglycerol DBD DNA binding domain DGK Diacylglycerol kinase DMEM Dulbecco s modified eagle medium DOC2B Double C2 like domains, beta DR1 Direct repeat 1

PAGE 14

xi dT Temperature differential ER Endoplasmic reticulum ERK Extracellular signal related kinase ESE Exon splicing enhancer ESS Exon splicing silencer Fe 2+ Ferrous i ron FFA Free fatty acid FOXO1 Forkhead box O1 GAP GTPase activating protein GLUT4 Glucose transporter 4 GS Glycogen synthase GSK3 Glycogen synthase kinase 3 GSV GLUT4 storage vesicle hnRNP Heterogeneous nuclear RNP HSL Hormone sensitive lip ase IGF Insulin like growth factor IL Interleukin IFN Interferon IP 3 Inositol triphosphate IR Insulin receptor IRAP Insulin responsive aminopeptidase IRM Insulin responsive motif ISE Intronic splicing enhancer

PAGE 15

xii ISGT Insulin stimulated gluc ose transport ISR2 Insulin substrate receptor 2 ISS Intronic splicing silencer LBD Ligand binding domain LPA Lysophosphatidic acid MAPK Mitogen activated protein kinase MEK MAP kinase kinase mRNA Messenger RNA Myo1c Myosin 1c NCoR Nuclear repressor co repressor NF Nuclear factor nPKC Novel PKC NO Nitric oxide NDM Nonsense mediated decay PA Phosphatidic acid PAP Phosphatidic acid phosphorylase PC Phosphatidyl choline PDGF Platelet derived growth factor PDK1 3 phosphoinositide dependent prot ein kinase 1 Peroxisome proliferator PI3K Phosphoinositide 3 kinase PICK1 Protein interacting with C kinase 1 PIKfyve Phosphoinositide kinase for five position containing a fyve finger

PAGE 16

xiii PIP 2 Phosphatidyli nositol (4,5) biphosphate PI(3)P Phosphatidylinositol 3 phosphate PIP 3 Phosphatidylinositol (3,4,5) triphosphate PKA Protein kinase A PKC Protein kinase C PKD Protein kinase D PKM Protein kinase M PLA Phospholipase A PLC Phospholipase C PL D Phospholipase D PM Plasma membrane PMA Phorbol 12 myristate 13 acetate PP1 Type 1 phosphatase Peroxisome proliferator PPRE PR GSC Perinuclear reticular GLUT4 storage compartment PRAS40 Proline rich Akt substrate 40 kDa PTB Phosphotyrosine binding PTPase Protein tyrosine phosphatases PTEN Phosphatase and tensin homolog PYR Polypyrimidine tract RabGDI Rab GDP dissociation inhibitor RACK Receptor for activated C kinase 1

PAGE 17

xiv Rheb Ras homolog enriched in brain RNAPII RNA polymerase II RRM RNA recognition motif RS Arginine/serine RUVBL 2 RuvB like protein 2 SH2 or SH3 Src homology SHIP2 SH2 containing 5 inositol phosphatase siRNA Small interfering RNA SMS Sphingomyelin synthase snRNP Small nuclear ribonucloprotein SRC Steroid receptor co activator STICKS Substrates t hat interact with C kinase T2DM Diabetes mellitus type 2 T m Melting Temperature

PAGE 18

xv SPLICING SYSTEMS FOR STUDYING SIGNALING T O THE SPLICEOSOME Hercules S. Apostolatos ABSTRACT Alternative splicing is a major contributi ng factor to protein diversity. T he human genome project validated that there are about 25,000 genes, but over 100,000 proteins. G enes contain numerous exons that are specifically regulated; thus, elucidating alternative splicing mechanisms of pre mRNAs is an immense undertaking T wo basic tools are used to study this mammoth task. For in vitro studies, usually in vitro transcription followed by splicing assays is used For in vivo studies, the main technique is the construction of minigenes. Th ese techniqu e s enable one to study the mechanism s /conditions that explain he mature mRNA In this project studies were focused in the protein kinase C ( PKC ) family and s pecifically in certain exons of PKC and PKC genes. The PKC gene codes two proteins : PKC I and PKC II. The pre mRNA of PKC contains 18 exons If exon 17 (exon II ) is included in the spliced transcript, protein PKC II is expressed. If exon II is skipped (excluded ) protein PKC I is expressed. Previous and curre nt results indicate that insulin treatment not only favors exon II inclusion UTR size in mature mRNA We identified up to five different PKC II mRNAs that differ only in the UTR size ( all five mature transcripts express the same PKC II protein) PKC II is re qu ired for glucose uptake in skeletal muscle and adipocytes. Additional studies revealed that inclusion of exon II involves SRp40 in its

PAGE 19

xvi phosphorylated form Small interfering RNA ( siRNA ) knockdown of Akt2 and Clk1 further rev ealed that SRp40 was phosphorylated by Akt2 / Clk1 and that Akt2 phosphorylate s Clk1 The knockdown of Clk1 or SRp40 do wn regulated glucose uptake. The PKC gene contains 1 8 exons. The standard size of exon 10 is 97 bases, and when included in the matur e transcript, PKC I is expressed. Exon 10 has an additional splice site that extends the exon size to 190 bases. When this extended size is included in the mature transcript, PKC VIII is expressed which has a profound effect in the fate of the cell by b lock ing apoptosis Our results reveal that all trans retinoic acid regulates the inclusion of exon 10 extended size. Moreover, the inclusion involves SC35 ( SRp30b ) Finally, we elucidated the position of the SC35 cis element.

PAGE 20

1 INTRODUCTION Project O verview Protein diversity depends on several aspect s, but alternative splicing is by far the main factor [1, 2] Protein diversity is very obvious but how it is implemented is not. Using the protein diversity observed in cells as a yardstick, when the human genome project was completed, most people were surprised on the low number of total genes found [3] Since alternative splicing is the main cause of protein diversity, one needs to build tools to find out how alternative splicing is regulated. S ince a gene is comprised of numerous exons and introns [4] one is forced to focus on how a single exon is included or exc luded in the mature transcript. It is at his junction that in vitro studies and minigenes [5] enter as methods to tackle this endeavor. In vitro transcription followed by splicing assays provides the first springboard towards this undertaking. Similarly, a splicing vector provides the platform for an exon of interest (and optionally its fla nking intronic sequences) to be studied. The typical splicing vector comes with a pair of exons and a functionally excisable intron between them This platform enables one to insert an exon of interest and study the conditions under which the inserted exon is included or excluded in the final mature vector transcript [5] Because the mature vector transcript usually represents fractional sequence s of two or more genes, this is why the constructs built are called minigenes, or heterologous minigenes.

PAGE 21

2 The exons and their related intronic sequences studied in this project are alternatively spli ced variants from the PKC family of proteins. Specifically, we studied exons and their related intronic sequences from PKC and PKC serine/ threonine kinases which phosphorylate either serine or threonine residues. Best friend of protein diversity The flow of biological information is from DNA to RNA to protein. In higher organisms, before and/or after DNA transcription stops there are additional processes terminus cleavage near the poly(A) signal, and synthesis of the poly(A) tail (up to 200 bases). The resulting transcript is referred to as p re mRNA. Through alternative splicing, different mRNA isoform s are pieced together by joining exons in various permutations. Figu r e 1 38,016 Shades of DSCAM The DSCAM gene produces splicing isoforms of about 7.8 kb comprised of 24 exons (mi ddle drawing). Exons 4, 6, 9, and 17 are encoded as arrays of mutually exclusive alternative exons. Each mRNA will contain one of 12 possible alternatives for exon 4 (in red), one of 48 for exon 6 (blue), one of 33 for exon 9 (green) and one of 2 for exon 17 (yellow). In the final protein product (bottom), the colors depict the regions exons 4, 6, 9, and 17 can alter. If all possible combinations of single exons 4, 6, 9, and 17 are used, the DSCAM gene can produce 38,0 16 different mRNAs and proteins [4]

PAGE 22

3 The main factor in protein diversity is alternative splicing, which allows a relatively small number of genes to produce several fo ld number of isoforms that lead to different proteins as figure 1 indicates in the Drosophila DSCAM protein [6] Recent estimates indicate that the percent of human genes employing alternative splicing is as high as 76 % [7] Alternative splicing is a major regulatory process, and more often than not it is tissue specific, cell cycle specific, and cell differentiation specific. Alternative splicing is so complex and difficult t o study that many aspects are not yet understood. Brief Introduction to SR proteins The role of serine arginine rich ( SR ) proteins is to regulate the selection of splice sites in eukaryotic pre mRNA transcripts [8] The term SR indicates that these proteins contain long serine/arginine re peats SR proteins not only regulate splice site util ization during alternative splicing, but they are also needed for constitutive splicing where the same splice sites are selected all the time [9] As figure 2 demonstrates, exons and introns provide binding sites ( cis elements) for SR proteins. However, these binding sites may be blocked by other proteins whose function is to repress spliceosome assembly [10] Sometimes these repressors are themselves SR proteins. As a result, the binding of an SR protein near a splice site does not always enhance the selection of that splice site for utilization. Thus, the final selection is the result of a tug of war between SR proteins and repressors near and far away from a prospective splice site. An exonic cis element that enhances splicing is referred to as ESE (exon splicing enhancer) and an ISE is an intronic splicing enhancer [11] Similarly, if a binding site represses or silences the utilization of a splice site, the cis elements are

PAGE 23

4 referred to as ESS an d ISS. Some studies indicate that the result of this tag of war is closely related to the ratio between the competing proteins bound to the ESE, ESS, ISE, and ISS elements. The SR proteins besides having an Arginine/serine ( RS ) domain in order to interact with other p roteins also have an RNA recognition motif (RRM) in order to bind to RNA [9] Phosphorylation of the RS domain at serine residues activates interaction Figu r e 2 Spliceosome Assembly on Regulated and Unregulated Splice Sites A pre mRN A (top) is spliced according to where the spliceosome assembles and defines its introns ing of these initial components and the assembly of the early spliceosome complexes is thought to define the intron to be excised. In later steps, the full spliceosome forms and catalyzes the cleavage and ligation reactions at the earlier defined splice si tes. The spliceosome can assemble between exon 1 and exon 3 to excise a single large intron and form mRNA 1. Alternatively, two spliceosomes can excise two smaller introns, thus including a new exon in the mRNA (mRNA 2). These outcomes can be determined by negative regulatory proteins (red) that either prevent U1 or U2 binding at particular sites (as shown), or block spliceosome assembly after U1 or U2 binding. Regulatory proteins can also act positively (blue) to enhance spliceosome assembly at sites that are otherwise recognized poorly. Most systems of alternative splicing seem to be controlled by multiple regulatory proteins that may exert both positive and negative control. Splicing patterns can also be affected by other factors, including RNA secondary structure and transcription rate [4]

PAGE 24

5 with other proteins (which also includes oth er SR proteins). Each SR protein loosely adheres to a consensus sequence for its RRM domain making difficult to predict cis elements Splicing si tes branch point, pyrimidine tract There are certain terms in splicing that may not be intuitively associat ed with the proper regions involved. The boundary between an exon and an intron is referred to as a exon). Figure 3 depicts the various regions involved the consensus sequence of each region and the frequency of occurrence of each consensus base The four regions of primary importance are the poly pyrimidine tract (also known as pyrimidine rich region) the branch [13] Figu r e 3 Intron Exon boundaries and consensus sequences The consensus shown in brackets means either or. The frequency of occurrence of each base or group of close to 100 pyrimidine tract is downstream of the branch point [12]

PAGE 25

6 Regions of secondary importance are binding sites for SR proteins, binding sites for repressor proteins, and sequences that result in secondary structure s. The poly 15 bases long. Further upstream from the poly pyrimidine tract is the branch point, and it [14] An intron may con tain more than one branch point, a nd the branch point utilized may be as far as 400 to 500 bases ( C A G G ) and the last two intronic bases are invariably AG lice site consensus sequence is nine bases (A/C A G G T A/G A G T), and the first two intronic bases are invariably GT Thus most introns start with GT and end with AG Interestingly most exons start with a G and end wit h a G and most exon exon ligation sites have the consensus sequence A/C A G G The path to intron excision (Pandora B ox Odyssey ) The path to translatable RNA is different in pro karyotic cells compared to eukaryotic cells. In the former, ribosomes can process mRNA for translation even while the transcript is still being transcribed. On the other hand, mRNA in eukaryotes is first transcribed in the nucleus and after additional processing is transported to the cytoplasm for translation. The initial transcript referred to as pre mRNA un dergoes several modification s in the nucleus before it is export ed to the cytoplasm. The four main

PAGE 26

7 Ca pping Capping involves the addition of a 7 methylguanosine at the mRNA GTP is reverse d mRN A [15] T his action After the reverse oriented GTP is attached, a methyl group is added to the reversed guanosine and also to the neighboring one or two nucleotides [16] When eventually the processed mRNA is transported to the the mRNA align properly with the ribosome for translati on Figu r e 4 The left side The a sterisks indicat e the positions in the two neighbori ng nucleotides that additional methylations may be observed [17]

PAGE 27

8 Polyadenylation Almost all eukaryotic cells produce p o lyadenylated mRNA. Sometimes transcription continues far downstream of the point of adenylation. During or at the end of transcription, sequen ces that are recognized as polyadenylation signals are processed for cleavage [18] The most common conserved sequence found near a polyadenylation site in mammalian cells is AAUAAA which may occur more than once at different points of the tran script. Other sequences near the poly(A) signal serve as binding sites for proteins that act as enhancers or repressors and decide if the transcript is cleaved or not near that Figu r e 5 Polyadenylation The poly(A) signal consensus sequence AAUAAA is usually about 10 and 30 nucleotides upstream of the site where polyadenylation takes place. Downstream of this site CA may be present along with 10 20 nucleotides identified as a GU rich region. All these regions serv e as binding sites to the proteins that mediate cleavage and synth esis of the poly(A) tail [17]

PAGE 28

9 poly(A) sig nal. In mammalian cells the transcript is cleaved about 10 to 30 bases downstream of the poly(A) signal. Some of the proteins involved in the recognition of the poly(A) signal and the subsequent cleavage may be associated to the RNA polymerase II (RNAPII) Cleavage is implemented by an RNA endonuclease and the polyadenylation function is performed by a poly A polymerase that may add downstream of the cleavage site transcript. Multiple poly(A) signals As it was indicated earlier, more than one poly(A) signal may be present in the pre mRNA transcript. two poly(A) signals exist downstream of the last exon. Since th e region downstream of UTR (untranslated region), the two poly(A) signals with micro RNA binding that can influence the rate of translat ion, by regulating the size RNA binding sites by Now, explore the case where the additional poly(A) signal may be before the last exon. In thi s scenario, if cleavage occurs at this poly(A) site, or at both poly(A) site s then the pre mRNA transcript will be divided into two or t hree pieces. In this scenario the transcript upstream of the first cleavage will be polyadenylated and the other one or two pieces downstream of the first cleavage will be degraded. This process, indirectly, regulates the exclusion of one or more exons from the final transcript. In a

PAGE 29

10 second scenario, cleavage occurs at both poly(A) signals, but adenylation occurs only in t he cleavage of the second poly(A) signal. This scenario provides the possibility for trans splicing which involves the joining of exons from different transcripts. The cleavage of the transcript between exons in the pre mRNA results in two independent tran scripts and affords the assembly of two spliceosomes at the same time. This shifts the tug of war among the competing splicing factors including enhancers and repressors and could result in the inclusion or exclusion of an exon from the final transcript wh ere the outcome would have been different if a single transcript is involved. The scenarios describe d above more often than not occur all at the same time resulting in several spliced variants, and it is usually the ratio between the spliced variants that regulates the fate or final translation rate of each isoform. are also involved in RNA stability [19] tail are subject to tagging that leads to degradation. The length of the poly(A) tail also plays a role in the rate or initiation of translation, and it is more frequent during early development. In one instance, in cells that serve as eggs, m RNA s with short poly(A) tails (about 30 to 50 bases) are not been translated and not degraded either. If the egg is f ertilized, this triggers the lengthening of the poly(A) tails which results in translation [20] In this scenario the egg has processed the transcript fully except for the proper length of the poly(A) tail. This enables the egg to reduce the enormous transcription and s plicing load that is needed right after fertilization.

PAGE 30

11 Splicing in simple terms So far we have covered capping, cleavage near a poly(A) signal, and polyadenylation. By far, t he most complex and highly regulated process is the excision of introns and the joining of exons in what is called splicing which is further defined as constitutive and alternative splicing. Figu r e 6 Overview of transcription and splicing The promoter provides a binding site for the RNA polymerase to synthesize a primary transcrip t. After further processing, the pre mRNA undergoes splicing where the introns are excised and the exons are joined [21]

PAGE 31

12 The importance of splicing and some aspects were described previously in brief. Here we will cover in detail the various aspects of the mechanism of splicing. In simplistic terms, a gene is comprised of exons and introns, and after transcription, the introns are excised and the exons are joined together. Introns were discover ed in 1977 a nd ever since the mechanism of splicing is becoming more and more complex. Box. In the early studies, pre mRNA splicing was studied through in vitro systems where pre mRNA transcripts were synthesized in a tube reaction. The pre mRNA was isolated and then treated with mammalian nuclear extracts. The splicing assays yielded spliced products that were Nuclease Protection A ssays) and more recently through RT PCR. The in vitro systems allow th e investigator to focus on a specific Exon Intron Exon sequence and investigate the conditions, the proteins, and the steps that result in spliced products. During the infancy of splicing studies, to achieve the same results through transfection of vectors in mammalian cells would have been very difficult if not un at tainable. The two main steps of splicing The first st udies established that splicing can be divided into two steps. In the he free intron end is covalently attached to an adenine within the intron resulting in a loop. The adenine in question is the main consensus base in the sequence described earl i er as the branch point. Unlike the bonds formed between nucleotides in the tran script, the bond formed between

PAGE 32

13 hydr o xyl group of the adenine neighboring nucleotide) The other step involves cleav followed by the covalent joining second cleavage releases the intron completely. The looped intron with a free end is called a lariat which is eventually li nearized and then degraded. The remaining transcript keeps going through the same two steps until all the introns have been excised. snRNAs and snRNPs Th rough the se initial studies, the consensus sequences of the the splice site, the branch point, and the poly pyrimidine tract were elucidated. A picture emerged where the introns in the pre mRNA have distinct elements that direct their excision. At this point the question was if there is a single enzyme like the RNA polymerase in transcription that in a processive manner drives the excision of the introns. Well, the results revealed otherwise. Splicing involves several single proteins, a group of proteins, and RNA that eventually form a large com plex identified as the spliceosome. So far five RNA molecules have been identified as been part of the spliceosome where th e ir sizes very from 50 to 200 bases. They are designated as small nuclear RNAs (snRNAs) and are given the names U1, U2, U4, U5, and U 6. Before becoming part of the spliceosome the snRNAs associate with several proteins forming an identifiable complex referred to as snRNP (small nuclear ribonucleoprotein particle). Here is where the terminology gets a bit complicated. Each of the U1, U2 and U5 snRNAs forms a distinct complex with proteins that bears the same name In other words, there is a U1, U2, and U5 snRNA, and also a U1, U2, and U5 snRNP. The U4 and U6 snRNA s also form

PAGE 33

14 individual snRNPs, but quickly associate with each other and f orm a single snRNP complex identified as U4/U6 Splicing Mechanism To summarize, there are five snRNAs that form f ive snRNPs. There is no U3 snRNA or snRNP. The U4 and U6 snRNPs can associate and build a single snRNP. N ow splice site and binds to it. The binding involves hybridization of the pre site consensus sequence with the U1 snRNA that is part of the U1 snRNP. In a similar manner the U2 snRNP bind s to the branch point Here the U2 snRNA attempts to base pair with the branch point consensus sequence. As the U2 binds to the branch point, the U1 snRNP that is alre Th e n the U5 snRNP binds to the and the poly pyrimidine tract In all three instances, a degree of wobbling is tolerated that allows degenerate base pairing At this point we have accounted for three of the four snRNPs. The last snRNP identifie d as U4/U6 binds to the other three snRNPs already bound to the pre mRNA, and this completes the assembly of the splice o some. As it was indicated earlier, splicing involves two main steps. To mediate the first step that includes the cleavage of the transc 4 /U 6 snRNP now splits into two snRNPs. The U6 snRNP binds to U1 snRNP and dislodges it f rom the area This is referred to as rearrangement of the RNA RNA base pai ring of the snRNAs with the pre mRNA transcript. The rearrangement allows proteins associated with the spliceosome and

PAGE 34

15 through the use of ATP to facilitate the first transesterification reaction that involves the adenine at the branch point. This reactio Figu r e 7 Splicing mechanism In brief, snRNP completing the sp liceosome. Rearrangement follows where U4/U6 splits, U1 gets exons complet es transesterification #2. Finally, the spliceosome disassociates, the snRNPs are recycled, and the lariat is linearized and then degraded [12]

PAGE 35

16 intron away. Then again, proteins associated with the spliceosome and through the use of ATP facilitate the second transesterification reaction that involves cleavage of the intron of the intron, and now the spliceosome starts to dissociate into the individual snRNP s U1, U2, U4, U5, and U6. The snRNPs are recycled for the next assembly of the spliceosome and the U4 and U6 snRNPs associate again to form a single snRNP (U4/U6) The excised intron that now has the shape of a lariat is first cleaved at the adenine base t o make it a linear molecule which is further processed for degradation. Multiple isoforms of mature mRNA There are f ive basic ways that a gene can produce different isoforms and/or spliced variants. o both a mature mRNA and the resulting protein. However, there are instances where two or more mature mRNAs can result in the same protein. In this scenario, I refer to the mature mRNAs as spliced variants and the resultant protein as isoform. This is the case of the PKC gene where there can be seven different mature mRNAs (spliced variants) but six of the seven are translated to the same protein PKC II (isoform), and the seventh mature mRNA is translated to the PKC I protein (isoform) The first method that yields diff erent isoforms/spliced variants is by manipulating the start and/or the end of transcription. The other four are dependent on the size of intron excision and are identified as 2 ) Exon Skipping, 3 ) Mutually Exclusive Exons, 4 ) Splice / Don't Splice and 5 ) Competing 5' or 3' Splice Sites [22]

PAGE 36

17 Multiple start s /stops of transcription T his method of generating different mature mRNAs depends on two aspects. In the first aspect, a gene may have more than one transcription the transcript. Transcriptions that start further upstream usually introduce a new start codon that alters the start of translation and also terminus. In the second aspect, a gene may include more than one p oly A signal. In this scenario, additional binding sequences near the poly(A) signal determine the utilization fate of a given poly(A) signal. For example, different tissues, by regulating the expression of the protein factors that bind near a poly(A) sign al, can determine which poly(A) signal is utilized. The case of multiple poly(A) signals was covered in more detail previously. Exon Skipping exon seven is sometimes included i n the spliced product and sometimes is skipped (not included in the spliced product.) In this alternative splicing mechanism, the skipped exon is excised with the neighboring introns That is, the intron upstream of the skipped exon, the skipped exon, and the intron downstream of the skipped exon, all together, behave as a single intron. Exon skipping can occur not only at non successive exons, but also at consecutive exons in what would be called multiple exon skipping In the example above, if exon one a nd ten are always in the spliced product and the other exons can be skipped; then the following possibilities exist. One product with all exons, eight products with a single exon skipped (2 through 9). If two consecutive exons are skipped, that could be 2 3, 3 4, 4 5, 5 6, 6 7, 7 8, and 8 9 which is 7 combinations. If 3 consecutive exons are skipped, that could be 2 3 4, 3 4 5, 4 5 6, 5 6 7, 6 7 8, and 7 8 9 which is 6

PAGE 37

18 combinations. One can see the pattern that for 8 skippable consecutive exons, the combin ations are 1 for all exons included, and 8+7+6+5+4+3+2+1 which is 1 and 36 or 37 total combinations. Thus, for X skippable exons, the formula is one plus the summation of ( X +1 n ) in the range of n=1 to X. Because of its high potential, exon skipping can fu nction as an on/off switch to regulate different aspects of cellular processes. Mutually Exclusive Exons In this alternative splicing mechanism, two specific exons cannot both be present in the mature mRNA. In broad terms, for any two exons A and B that fit this pattern of splicing, either A is included and B is skipped, or A is skipped and B is included. Because only one of the two exons will be in the spliced product, this pattern use as an ex ample a gene with 5 exons where exon 1 and exon 5 are always part of the mature mRNA If exon 2 and exon 3 are mutually exclusive and exon 4 is skippable, then only four permutations are possible: 1 2 4 5, 1 2 5, 1 3 4 5, and 1 3 5. On the other hand, if e xons 2 3, 4 were all skippable then seven permutations are possible: 1 2 3 4 5, 1 3 4 5, 1 2 4 5, 1 2 3 5, 1 4 5, 1 2 5, and 1 5. manual transmission or automatic transmission. You can least one to drive the car. Just as a race driver will not have any success using an automatic transmission, the mutually exclusive pattern confers the right domain to a protein to be successful in a certain environment

PAGE 38

19 Spl In constitutive splicing, introns are excised and are not part of the mature mRNA. In this pattern of alternative splicing, an intron plays two roles. In the first role, the intron behaves as an excisable intron. In the second role, the in tron is retained in the mature mRNA. In the second scenario there are four possibilities. The first possibility is that the upstream exon contains a stop codon, and as a result, the intron will not be part of the translation. In the second possibility the upstream exon does not contain a stop codon, and as a result the intron becomes part of the coding region. If the intronic sequence includes a stop codon, then translation will end at that spot. If the intronic sequence does not include a stop codon, then two more scenarios are possible. The entire intronic sequence will be translated and the translation will continue in the downstream exon(s) without a frame shift. The last possibility is that the downstream exon(s) will be translated with a frame shift. If a gene has three introns of dual roles, then one would expect three additional spliced products. Thus, this alternative splicing pattern adds one spliced product for each retained intron. However, if more than one intron is retained in the spliced produ ct, and if no stop codons exist in the retained introns or introduced due to frameshift on downstream exon(s)/retained intron(s) then the number of total spliced products can increase by more than the number of retainable introns. Competing 5' or 3' Spli ce Sites This pattern of alternative splicing is akin to a certain sequence having dual roles. In a similar manner where an intron can be excised or retained, here only a portion of the intron is excised and a portion of the intron is retained. The nomencl ature can be confusing in this situation. The boundary between an exon and an intron is identified as a

PAGE 39

20 site. In most situations the boundaries are unique and intractable. Some introns however, may include one or more intron is 200 bases, and that 51 bases downstream intronic bases are retained. The second splice site may be labeled as a distal splice site, a cryptic splice site, a latent splice site, or simply an additional splice site. In the PKC gene, the intron between exon II and exon I ha gene, the intron between exon 10 and exon 11 has one additional splice site. One could view the excision of a lesser intronic sequence e intron as the extension of the upstream exon. In a similar manner of competing of the intron lice site is utilized, then no intronic sequence is retained. If the become part of the spliced product. Again, one could view the excision of a lesser intronic sequen The utilization of a n additional downstream spliced product, but may not result in a new protein. This is the case in PKC and PKC where in PKC the a however, all spliced products result in the same translatable protein because the upstream

PAGE 40

21 exon contains a stop codon. In contrast, in PKC result s not only in a new spliced product, but also in a new protein (PKC VIII). Even though each alternative splicing pattern has been described separately, it is understood that more than one splicing pattern and/or all them can be observed in a single gene. Thus, one can see quickly in how many ways and to what extend alternative splicing can increase protein diversity. One should expect that some genes, in some tissues/species may exhibit exotic patterns of alternative splicing that have or have not yet been odyssey most likely, has not reached Ithaca yet. Transport to the cytosol The mature mRNA has to pass a few more hurdles before it get s translated. An isoform may be degraded in the nucleus before it reaches the cytosol. It also needs a transporter protein to get passage to the cytosol. Once in the cytosol, it may be subjected to degradation before and after translation In an average mammalian cell, while RNA is synthesized and processed in the nucleus [23] the percent o f RNA in the nucleus compared to the entire cell is only about 14% Some RNA s such as snRNAs and snoRNAs that are involved in the proc essing of the other RNA molecules are found mainly in the nucleus and represent about 2.8% of total RNA. However, some of these molecules do go to the cytoplasm to complex with various proteins, but then come back to the nucleus for their functi on. Most of the mRNAs at any given moment are found in the cytosol.

PAGE 41

22 The nuclear membrane is speckled with nuclear pores that play a role in facilitating the trafficking of proteins and RNAs in and out of the nucleus [24] Because almost all mammalian mRNAs are very long, diffusion through the nuclear pore is not feasible. Thus, the passage through the nuclea r pore is a process that requires energy; usually involving conversion of GTP to GDP. Besides GTP, other important characters involved in the process are the protein s Ran and karyopherins The latter are receptor proteins that are divided into exportins an d importins So far about 20 human karyopherins have been identified, where each is involved in the transport of a different type of RNA molecule. While some RNAs associate with karyopherins directly, it appears that some RNAs have binding sites not for ka ryopherins but for other proteins which then associate with karyopherins [25, 26] This region provides cis acting elements that interact with trans acting proteins that facilitate transport to the cytosol and sometimes also localization in the cytosol [27] The PKC II protein may be derived from up to six different splice d variants. The difference b etween those splice d var We speculate that variable RNA activity and also binding sites for proteins that regulate transport to the cytosol. When the e RNA sites, but also be transported to the cytosol faster than its cousin spliced variant of SSI.

PAGE 42

23 After synthesis of the poly(A) tail, another protein that plays the role of quality control [28] sets in motion the transport pathway The transport mech anism uti lizes additional proteins in the cytosol if needed, to deliver the mRNAs in their defined region of the cell. As an example, the mRNAs of cytosolic proteins that are slated for mitochondrial functions are delivered at the surface of these organelles. Figu r e 8 Transport of Eukaryot ic RNAs through the nuclear pore In eukaryotes, rRNAs, tRNAs and mRNAs are transported from the nucleus to the cytoplasm, where these molecules carry out their cellular functions. At least some of the snRNAs and snoRNAs are also transported to the cytoplas m, where they are coated with proteins before returning to the nucleus to carry out their roles in RNA processing [17]

PAGE 43

24 T ranslation in the cytosol The mature mRNA has now finally made it to the cytosol. As it was indicated earlier, o nce in the cytosol, it may be subjected to degradation before and after translation In addition to that, during translation the rate of transla tion may be sped up or slowed down. For translation to start, the mRNA has to come in contact with ribosomes. Most eukaryotic mRNA s are divided into three regions The 5 ), the translated region that begins with a start codon (m ainly ATG ) and ends with a stop codon, and the 3 ). The untranslated regions which include the provide recognition sites and binding sites for proteins associated with the ribosomes to facilitate the formation of the mRNA Ribosome complex and stabilize the translation process. Ribosomes provide the platform where the mRNA is decoded three nucleotides at a time to synthesize the prescribed polypeptide Ribosomes are complexes assembled by proteins a nd ribosomal RNAs. They are quite large and contain two subunits. The e ukaryot ic ribosome contains a 60S subunit and a 40S subunit ; where the latter is smaller than the former. The function of the ribosomal RNAs in the ribosome is to facilitate catalysis w hile the proteins simply hold the complex together and enhance the rate of catalysis. Each triplet of nucleotides is decoded by a tRNA molecule. The amino acid prescribed by the triplet nucleotide is recruited by a specific tRNA. The prescribed amino acid is first covalently attached to its corresponding tRNA, and then it is transferred to the growing poly peptide. The translation process appears to start with the 40S subunit recogniz ing the

PAGE 44

25 with the ribosome. The 40S subunit start codon (mainly AUG). However, preference is given to the AUG that is flanked by the f ollowing consensus sequence: GCCPuCC AUG G. This sequence is also known as the Kozak sequence where the two bases flanking AUG are the most important [29] After this initiation step, the downstream decodi ng continues where each triplet nucleotide prescribes the amino acid to be incorporated next. The polypeptide keeps growing until a stop codon is encountered at which point translation stops and the polypeptide is released from the ribosome. The ribosome i s recycled to start another round of translation. Protein expression regulated by the isoform used The re are several levels of regulation that can participate in the rate of protein diversity and rate of expression. Those related to the isoform used are d escribed here. By regulating the transcription start, the start of translation can be regulated as well. Several proteins can participate in deciding where transcription starts. A gene may contain more than one poly(A) signal, and thus the end of the trans cription may lead to an isoform that affect the mRNA degradation rate by mak ing the transcript unstable or by providing sites for tagging. Alternative splicing can produce different spliced isoforms that lead to different protein isoforms, or different spliced isoforms that lead to the same protein.

PAGE 45

26 Overview of Kinases and PKC A kinase is an enzyme that catalyses the phosphorylation of an acceptor molecule. A protein kinase is a kinase that phosphorylates the hydroxyl group of a serine, threonine or tyrosine. Prot ein kinases are classified as: a) Serine/threonine protein kin ases which phosphorylate either ser ine or threonine residues, and b) Protein Tyrosine kinases (PTKs ) which phosphorylate tyrosine residues Protein kinase C (PKC) is a family of 12 or more related isozymes that are serine/threonine kinases and are divi ded into three groups C The cPKC group includes cPKC cPKC I, cPKC II, and cPKC regulatory d omain and a catalytic domain (see figure 9). The regulatory domain of terminus, a binding site for phosphatidylserine (PS), a binding site that interacts with diacylglycerol (DAG) or phorbol esters, and a binding site for Ca2+. The ca talytic domain includes the C terminus, an ATP binding site, and a substrate binding site. Figu r e 9 Protein Kinase C Isoforms Schematic diagram of the di ffe rent categories of PKC isoforms. The isoforms in the star like symbols are those expressed in insulin responsive cells [30]

PAGE 46

27 (see T able 1 ) but each isoform displays different substrate specificity and cofactor activation. Table 1 PKC Isoform Tissue/Cell Expression In this project the cell lines used mostly were skeletal muscle. PKC isoform Cell /Tissue Brain + + + + + + ? + ? ? ? Central Nervous Tissue + + + + + + + + + + Heart + + + + + + + + + ? Small Intestine ? ? ? + ? ? ? ? + ? Ki dney + + + + + ? + ? ? + Liver + + + + + ? + + + ? Airways Smooth Muscle + + + + + + + + + + Lung + + + + + + + + + + Neutrophil + + + + ? ? + ? ? ? Monocyte + + + + + + + + Macrophage + + + + + + + + Eosinophile + + + + + + + Platelet + + + + + ? + + ? ? T Lymphocyte + + + + + + + ? ? ? B Lymphocyte + + + + + + + ? ? ? Vascular Smooth Muscle + + + + + + ? ? + ? Retina + + + + + ? + ? ? ? Spleen + + + + + + ? ? + ? Testis + + + + + ? + ? + ? Ovary + + + + + ? + ? + ? Pancreas + + + ? + ? ? ? + ? Thymus + + + ? ? ? ? ? ? Fibroblast + + + + + ? + ? ? + Skeletal muscle + + + + + + + + + + Adipocyte + + + + + + + + + + +

PAGE 47

28 2 ). The regulatory domain is connected to the catalytic domain through a region which is subject to proteolysis by calpain I and II and by capspase 3. Cleavage at that region results in an active ca talytic fragment. Table 2 PKC Isoform Size (L) Amino Acids 672 671 673 697 673 737 683 707 592 586 Kilo Daltons 76 .8 76 .8 76 .9 78 .4 77 .5 83 .5 7 8.0 81 .6 67 .7 67 2 Background on Insulin Insulin is s ynthesi zed and released by the cells of the pancreas. Glucose is the primary stimulant to secretion. Insulin can function as a growth factor for many cells, and can also initiate multiple signaling pathways that result in glucose uptake, glucose metabolism, and expression of liver and adipocyte enzymes. The insulin receptor is an RTK, and acts via a Ras dependent/independent pathway, that mediates the signal through an insulin receptor substrate (IRS). Most cases have shown affected patients to have mutations in the insulin receptor (IR) subunit. Such mutations impair insulin signaling by decreasing IR expression on the cell surface and/or IR affinity for insulin (strength of insulin attachment). The lack of insulin to store glucose causes the blood levels to e levate. E xcess glucose reacts with hemoglobin to form excessive amounts of glycosylated hemoglobin and reflect the long term elevated blood glucose. Eventually these can crosslink and seriously impair the oxygen carrying ability of the red blood cells.

PAGE 48

29 Protein Kinase C in Signaling The PKC family members affect many cellular functions including apoptosis, cell proliferation, cell differentiation, and transcriptional activation [31] The c are Ca++ dependent and can be activated by diacylglycerol, and phospholipid Through alternative splicing, the PKC gene codes two proteins identified as PKC I and PKC II. The alternative splicing that generates these two isoforms takes place at C terminal exon. The pre mRNA of PKC contains 18 exons. If exon 17 (exon II) is included in the spliced transcript, protei n PKC II is expressed. If exon II is skipped (excluded), protein PKC I is expressed It should be pointed out that when exon II is included, exon I is included as well. However, exon II which is 216 bases long precedes exon I which is 150 bases long and within exon a STOP codon exists that of isoform PKC II Thus, the remainder of exon II, the entire exon I in this case they all b ecome PKC ( see Fig ures 1 1 12 ). Since in exon II there are 156 bases upstream of the stop codon, and since exon I is 150 bases, the variable C terminus size of these two isoforms is 52 and 50 amino acids respectively. And, as a result, their ove rall size differs by two amino acids only [32, 33] Both PKC I and PKC II have been detected endogenously in c ells growing in normal media of 5.5 mM glucose concentration [34] The role of PKC II appears to be more diverse than its sister isoform. Besides PKC II being involved in glucose uptake [35] and cellular proliferation [36, 37] it has also been connected to a ttenuation of DNA synthesis, and through protein protein i nteractions, it is involved in the regulat ion of the insulin receptor [38]

PAGE 49

30 At the mRNA phase, t he PKC II mRNA exhibits distinctive features not observed in PKC I such as a n instability element that renders the PKC I I mRNA unstable in the presence of high glucose concentrations which can down regulate the PKC II mRNA hal f life and indirectly reduce its protein leve l [39, 40] The insulin signalin pathway regulates the PKC alternative splicing. The insulin receptor is part of the tyrosine kinase family There are two insulin r eceptor isoforms and each is subunits where these subunits are linked by disulphide bonds. There are several insulin receptor subtrates (IRS) that interact with the insulin receptor (see figure 10) ; however, in glucose metabolism IRS 1 and IRS 2 are the most important. These substrates become phosphorylated upon binding to t he insulin receptor and then interact with downstream elements in the insulin transduction pathway. Figu r e 10 PKC Isoforms in Insulin Responsive Tissues Summary of PKC isoforms with their known substrates in insulin responsive tissues. T he documented relations of isoform substrate interactions for the various isoforms are: PKC IRS( 1); PKC II IR, PKB(Akt), MARCKS, GLUT4 transporter; PKC IR, IRS 1, PKB; PKC PKB, GSK3; PKC IRS 1; (PKC glucose transporter) [30]

PAGE 50

31 One of these elements is the PI3 kin a se which is considered the main mediator Phosphoinositide 3 kinase s ( PI3Ks ) are signal transducer proteins that phosphorylate the carbon 3 hydroxyl group of the inositol group of phosphatidylinositol. The regulatory domain of a PI3K has six subunits and the catalytic domain, also known a p110, has four subunits. In the model proposed in this project, the regulatory subunit p85 and/or the catalytic domain p110 are involved in the insulin signalin pathway that regulates the splicing of exon 2 in PKC Once activated, a PI3 K launches a complex phosphorylation c ascade that may involv e t he phospholipids Phosphatidylinositol (4,5) biphosphate ( PIP 2 ) and/or Phosphatidylinositol (3,4,5) triphosphate ( PIP 3 ) PDK1 ( phosphoinositide dependent kinase 1), PKB ( protein kinase B) and Clk/Sty. PKB is also known as Akt.

PAGE 51

32 Splicing of PKC As it was indicated earlier, the PKC gene consists of 18 exons. The last three exons are identified as C4, betaII, and betaI. The intronic sequence between exon betaII and exon betaI is around 6,000 bases depending o n the species involved Exon betaII is 216 bases long, and exon betaI exon betaI, and there is also a stop codon within exon betaII. Th e latter stop codon is end of exon betaII. Since exon betaII is 216 Figu r e 11 PKC pre mRNA variants The PKC gene consists of four constant regions and five variable regions. The constant region C4 and the variable region V5 are shown in more detail. Because the PKC gene contains two poly(A) signals, after transcripti on two pre mRNA variants are possible. II C4 I PAS PAS C4 II (A) n C4 II I (A) n Transcription/Adenylation V1 N C1 C1 C V5 C2 V2 C3 V3 V4 C4

PAGE 52

33 that the rest 60 bases are Within the intron downstream of exon betaII there are Also besides the main poly(A) signal downstream of exon betaI, there is an additional poly(A) signal downstream of exon betaII Thus, the PKC gene can generate two pre mRNA transcripts ( see Figure 11 ). If the first poly(A) signal is utilized, then the pre mRNA generated is spli ced into one mRNA variant which codes for PKC II. If the main (second) poly(A) signal is utilized, then the pre mRNA generated can be spliced into s ix possible spliced variants Using the alternative splicing pattern of exon skipping, when exon betaII is s kipped, then the spliced variant generated is translated to protein PKC I If exon betaII is included, then there are five possible spliced variants. The shortest of the five spliced variants is hich results in the shortest Figu r e 12 PKC I Isoform There is only one PKC I splic ed variant that results in the PKC I protein. The PKC I spliced variant is generated when exon betaII is skipped during splicing. The splicing event ligates exonC4 to exon betaI. Splicing C4 II I (A) n I C4 (A) n

PAGE 53

34 sites that are downstream from the conventional betaII exon boundary. The conventional identified as SSII, SSIII, SSIV, and SSV. T o summarize, the PKC gene generates two pre mRNA variants. The first pre mRNA variant is generated through utilization of the first poly A signal, and it is spliced into a single spliced variant The second pre mRNA variant is generated through the utilization of the second (main) poly A signal, and it can be spliced into six different spliced variants. Protein PKC I arises from the translat ion of a single spliced variant which occurs when the main (s econd) poly(A) signal is utilized, and during splicing, exon betaII is sk ipped. Protein PKC II may be translated from six different spliced variants (mRNAs). One spliced variant arises when the first poly A signal is utilized. The Figu r e 13 PKC II Isoform Utilizing the first poly A signal The PKC gene contains two poly A signals. When the first poly A signal is utilized, there is only one possible spliced variant which is translated into the PKC II protein. The s not include exon II C4 I PAS PAS C4 II (A) n Transcription/Adenylation Splicing II (A) n C4

PAGE 54

35 other five spliced varian ts arise when the main (second) poly A signal is utilized, and during splicing exon variant. In all, the PKC gene can potentially generate seven different spliced variants. The most likely scenario is that all spliced variants are generated all the time; however the ratio of each spliced variant fluctuates depending on the cellular processes the cell is trying to carry out. The first PKC pre mRNA generates one splice variant for PK C II The second PKC pre mRNA can generate six spliced variants; one for PKC I, and five for PKC II. Thus, the PKC gene generates two pre mRNA variants, a total of seven spliced variants, of which one translates to PKC I protein and all the other six translate to PKC II protein. A s it was indicated earlier, exon betaII contains a stop codon; thus, all the spliced Figu r e 14 PKC II Isoform Utilizing the last poly A signal and the The diagram depicts splicing of the second PKC pre mRNA variant into one of the five possible spliced variants. Exon C4 ligates to exon betaII, and exon betaII utilizing the betaI. The region downst ream of the stop codon within exon Splicing C4 I A (Y) n AG GU (A) n II I II C4 (A) n

PAGE 55

36 variants for PKC II are translated to the same protein. The main difference in the PKC The PKC II sub regions The stop codon inside the betaII exon and the subsequent 57 downstream bases (60 bases total) make up the first sub region This sub region is present i n all six PKC II spliced variants. The second sub region sub region is present in all five PKC II spliced variants that arise from the second PKC pre mRNA, and it is absent in the PKC II spliced variant tha t arises from the first PKC pre mRNA. The third sub region is a section of the intronic sequence downstream of exon betaII. The length of this section varies in each PKC II spliced variant. Table 3 summarizes the sub region Figu r e 15 PKC II Isoform Utilizing the last poly A signal and the The diagram depicts splic ing of the second PKC pre mRNA variant into one of the five possible spliced variants. Exon C4 ligates to exon betaII, and exon betaII by utilizing the UTR area com pared to the spliced variant utilizing SSI. A (Y) n AG GU GU (A) n II C4 I Splicing I II C4 (A) n

PAGE 56

37 Table 3 Summary of PKC spliced variants Isoform Pre mRNA Poly A Signal Spliced Variants PKC I II Last 1 PKC II I First 1 II Last 5 PKC II Spliced Variant Pre mRNA lice Site Exon II Exon I PKC II SV 1A I N/A 60 b (450 b) NO PKC II SV 2A II SSI 60 b Zero b YES PKC II SV 2B II SSII 60 b (97 b) YES PKC II SV 2C II SSIII 60 b (136 b) YES PKC II SV 2D II SSIV 60 b (368 b) YES PKC II SV 2E II SSV 60 b (707 b) YES Figu r e 16 The PKC II six spliced variants The diagram depicts the two PKC pre mRNA variants, and the six PKC II spliced variants. All six spliced variants get translated to the same PKC II protein. The main difference between the s (A) n II C4 (A) n II C4 I II C4 (A) n I II C4 (A) n II C4 I (A) n II C4 I (A) n II C4 I (A) n C4 II I (A) n Splicing Splicing

PAGE 57

38 SRp40 effect on splicing of PKC At this point we have shown that the PKC gene can generate two pre mRNAs, and on the second pre mRNA, through alternative splicing, it can generate six different spliced varia nts. One spliced variant is generated through skipping of exon betaII that results in protein PKC I. The other five spliced variants are generated when exon betaII is included For three of these spliced variants, i nsulin i nitiates the switch from exon bet aII skipping to inclusion of exon betaII. The response occurs within 15 minutes after insulin treatment. treatment affects the ratio of the three spliced variants (not in all cell lines ). In general, the short time treatment favors the spliced variant with SSI, and the longer time favors the spliced variant with SSII. Insulin accomplishes the inclusion of exon betaII via phosphorylation of SRp40. This involves the phosphatidylinositol 3 kinase pathway and Akt2 kinase. Insulin binds to the insulin receptor which activates an insulin response substrate (IRS1 4). The signal is then transmitted to PI3 K which further activates PDK1 2. Final l y, this phosphorylates Akt2 which then phosphorylate s SRp40. The phosphorylated form of SRp40 can n ow bind to intronic and/or exonic binding site(s) and facilitate the exon b eta II inclusion. SRp40 has more than one phosphorylation site. If insulin treatment is continued, this may result in SRp40 having mul tiple site s phosphorylated. This could alter the binding preference of SRp40 at the intronic /exonic One can speculate that it is possible for all seven spliced variants to exist all the time in some kind of an equilibrium ratio among them As conditions change, this could

PAGE 58

39 shift the equilibrium and as a result a certain spliced variant becomes the favorite product while a particular spliced variant may be reduced by ten fold, a hundred fold, and so on. P I3 kinase pathway activated by factors other than insulin The PI3 kinase pathway includes three classes of Phosphoinositide 3 kinases (PI 3Ks) The family of these proteins is involved in several cellular functions including differentiation, metabolism, an d survival PI3Ks are intracellular signal transducer s that phosphorylat e the carbon 3 hydroxyl group of the inositol ring of phosphatidylinositol PI3Ks transmit and amplify signals from different receptors by producing phospholipid second messengers that in turn activat e downstream targets. In insulin activation, PI3Ks interact with IRS 1/2 and eventually activate the PKB/Akt component of the pathway. In our model, Akt2 phosphorylates SRp40 directly, or it phosphorylates Clk/Sty that in turn phosphorylate s SRp40 [41] The phosphorylated SRp40 mediates the inclusion of exon II which results in PKC II. We hypothesize that PKC II is involved in the translocation of GLUT 4 to the cell membrane resulting in glucose uptake in skeletal muscle cells and adipocytes As it was indicated above, PI3Ks transmit and amplify signals from different receptors In other studies it has been shown that th e downstream PKB /Akt component can transmit survival signals into cells [42 44] that protect cells from apoptosis It has been reported that activation of PI3K also occurs by retinoic acid ( RA ). In this novel mech a p85 regulatory subunit It appears that RAR forms a stable complex with p85 PI3K that may eventually lead to activation of PKB/Akt component In our study we show that the splicing of PKC is

PAGE 59

40 effected by RA, and that the splice variant produced mediates the survival of the cell by protecting the cell against apoptosis. Furthermore, we show that the splicing is facilitated by the SR protein SC3 5 (SRp30b). Background on Retinoic Acid Retinoic acid (RA) has 2 forms ; the all trans RA which is the active metabolite of Vitamin A and the cis RA. Retino ic acid binds to two receptors: t he retinoic acid receptor (RAR) and the retinoid X receptor (RXR) where both are subdivided into , and An RAR heterodimerizes with RXR forming a dimer that binds to retinoic acid response elements (RAREs). I n the absence of ligand, the RAR/RXR dimer also complexes with co repressor proteins. In the presence of RA, the dimer changes conformation, the co repressor dissociates, and then co activator proteins bind to the dimer. This results in up regulation of transcription of the target gene In this project, our results indicate that RA regulates the inclusion of exon 10 extended size of PKC resulting in human PKC VIII (mouse PKC II) Furthermore, the inclusion is mediated by the SR protein SC 35 (SRp30b). Splicing of PKC and PKC Protein kinase C (PKC) I and II are alternatively spliced products of PKC pre mRNA. Insulin regulates the inclusion of PKCII exon and promotes the switch of the PKCII isoform from the I isoform via alternative splicing [32] Among other functions, PKCII has a distinct physiological role in glucose uptake [35] The insulin regulation of PKC II occurs within 15 min of insulin treatment. This mechanism of rapid

PAGE 60

41 response in alternative splicing is distinct from other hormonally regulated systems that have been described [45 47] P revious work on the spl icing of PKC II was mainly on endogenous products. In this project, through the construction of functional heterologous minigene s, we show that insulin regulated the inclusion of PKCII exon and activated additional 5' splice site s in distinct cell types such as skeletal muscle, vascular smooth muscle, pre adipocytes, embryonic fibroblasts, and hepatoma cells. We also demonstrate that the splicing of th e heterologous minigene s was regulated by phosphorylation in vivo by a PI3 kinase pathway via Akt2 kinase The in vitro splicing assays demonstrated that exon II can utilize identified the essential intronic sequence involved in SRp40 binding to the pre mRNA The project continued in identifying how SRp40 was phosphorylated. Previous studies had shown that Akt2 or PKB regulate alternative splicing [4, 48] We produced biochemical and genetic evidence that Akt2 kinase phosphorylates SRp40 in vivo and in vitro We showed that i n mice immortalized fibrobla sts lacking Akt2 [49] SRp40 phosphorylation is not regulated by insulin, and that PKC II levels are low compared with cells from wild type mice. The study did not exclude phosphorylation of SRp40 by another kinase. The Clk kinases participate in a network of regulatory phosphorylation mechanisms that enable SR proteins to control RNA splic ing in response to phosphorylation [50 53] SR proteins, within their Arg/Ser domains, contain the highest number of Akt consensus motifs found in proteins [49] Since Clk/St y contains two Akt consensus motifs, Arg Xaa Arg Xaa Xaa (Ser/Thr), we hypothesized that its activity

PAGE 61

42 might be regulated by insulin Our results support the proposed mechanism that Akt2 phosphorylates Clk/Sty and that Akt2 and Clk/Sty can phosphorylate SRp 40. (GenBank Accession No. DQ516383). Sequencing and computational analysis of the an alt mRNA exon 10 [54] Thus, at this point it was established that exon I (exon 17) of PKC and exon tain conditions. In PKC it is through insulin, and in PKC it is through RA. W e demonstrated that RA dramatically increased the expression of As in PKC we constructed heterologous minigenes to identify if any SR proteins are involved. Our results indicate that the SR protein SC35 mediates the splicing of and we identified the sequence in the pre mRNA that SC35 binds. In this project we have shown that the construction of heterologous minigenes and in vitro splicing assays can be successfully employed to elucidate the splicing mechanism of alternatively spliced genes. We have further used the minigenes to identify/verify substrates of Akt2 and Clk/Sty, and to advance the knowledge of the insulin pat hway. We have left something for the future: the elucidation of SC35 phosphorylation pathway. One scenario is where RA activates PI3K as described earlier, which in turn activates Akt2/Clk, and which finally phosphorylates SC35. In another scenario, SC35 m ay be directly or indirectly up regulated by RA through transcriptional up regulation. The SC35 C35 may include

PAGE 62

43 Functions of PKC in various species The alternative splicing of in humans results in I and VIII. The that is cleaved by caspases is cleaved by caspase 3 [55] VIII in hum ans and ice are not cleaved by caspase 3. In this project we show that VIII splicing is regulated by RA. We also have preliminary data (not shown) that II in mice may also be regulated by RA Most PKCs are activated by phorbol ester. How ever, in rats, displays weak or slow phorbol ester activation [56] V, VI, and VII have unique characteristics. First, they are all expressed in mice only. Secondly, they are missing the fi rst portion of the pseudosubstrate region (V1 and C2 domains). Thirdly, they are only expressed in testis. PKC has many substrates, and as a result it is involved in cellular processes with diverse biological activity To name a few, the eu karyotic elongation factor 1 1 ) [57] It is involved in the regulation of the mammalian target of rapamycin ( mTOR ) [58] It regulates quite a few transcription factor s (p300, Sp1, NF Stat1, and Stat3 ) [59 62] As it has been shown in this project and other studies it also plays a role in cell survival and apoptosis. While PKC VIII is a pro survival isoform, other isoforms ar e pro apoptotic. For example, Rad9 upon becoming p hosphorylat ed by binds to Bcl 2 thereby inhibiting it, which in turn promotes apoptosis [63] Most recently caspase 3, a key mediator of apoptosis, was shown t o associate and be 3 promotes its apoptotic activity in vivo and in vitro [64] reduced etoposide induced cat

PAGE 63

44 increased caspase 3 suppressor p53 at Ser46, inducing cell death [65] Splicing of PKC in humans T he PKC gene in humans contains 18 exons. The hinge region that is subject to caspase cleavage is at the junction of exon 10 and exon 11. The standard size of exon 10 is 97 bases that results in the PKC I isoform. However, exon 10 has a compe ting Figu r e 17 The two splice variants of PKC The schematic depicts the two PKC mRNA variants. The PKC VIII utilizes the second e depicted with the region between exon 10 and exon 11 identified as 8. The hinge region is at the junction of exon 10 and exon 11. The extra 93 bases are translated into 31 amino acids that disrupt the cleavage site for caspace 3. The utilization of SSII is regulated by RA and mediated by SC35.

PAGE 64

45 ( SSII ) is regulated by RA and the u tilization of SSII is mediated by SC35. When SSII is utilized, PKC VIII is expressed which has a profound effect in the fate of the cell The additional 31 amino acids disrupt the recognition sequence for caspase and as a result it blocks apoptosis. Figure 17 shows a schematic of the PKC domains, and for clarity, the hinge region is shown longer. T he schematic is focusing on the splicing of exons 9 to 11 and it depicts where exons 9 to 11 approximately lie. When SSI is utilized the resulting mRNA is translated in to protein PKC When SSII is utilized, the result ing mRNA is translated into protein VIII. The additional 93 bases that resu include the binding site for SC35.

PAGE 65

46 Splicing Vectors Splicing vectors provide a platform for focus ing on a single exon either with or without flanking intronic sequence(s), or even on a part of an exon. A splicing vector contains a basic structure of Exon Intron Exon where in the synthesized transcript the intron is excised and a const it utive spliced product of the two exons is produced. The standard structure of a splicing vector includes a promoter upstream of the Exon Intron 3 Exon a it may be an exon from a common gene. is identified as a s plice donor (SD). Th e intron is a fully functional intron that includes a branch point, a poly pyrimidine tract, exon from a common gene. This second exon is identified as a splice acceptor (SA). Finally, a pol y(A) signal sequence follows that may be preceded by an optional stop codon. A multiple cloning site (MCS) is usually with in the intron (generally ) In another design the MCS sequence is placed at the beginn ing of the SA region. Without an insert, t he splicing vector is used as a control vector producing the so called constitutive spliced product (SD SA) The insert usually contains the exon of interest and its flanking intronic sequences. Upstream of the exo n about 50 or more bases are needed to ensure the intronic sequence between the exon of interest and SA will be excised. Downstream of the inserted exon only 6 bases are needed to maintain the splice site. The spliced products are detected by using unique primers that bind at the SD and SA regions. The PCR results can reveal if the exon is skipped during splicing or if it becomes part of a spliced product.

PAGE 66

47 Splicing Vector pSPL3 One of the splicing vectors used i n this project is vector pSPL3 described in Figure 1 8 The Ampr gene enables selection and vector amplification in bacteria. The SD and SA regions behave as exons. When the vector is transfected in to mammalian cells, t ranscription starts after the SV40 promoter. The SV40 Late Poly(A) Signal (LPAS) appends a poly(A) tail to the transcript. During splicing, the intron is excised resulting in a singl e spliced product. The intron be tween SD and SA includes a multiple cloning site so that a foreign sequence can be inserted. The insert is usually an exon with part of its flanking intronic Figu r e 1 8 Vector pSPL3, its components, and the main spliced product. The pSPL3 vector contains a splice donor (SD) and a splice acce ptor (SA) sequences that operate as exons and a fully functional intron between them. Transcription starts after the SV40 promoter and ends at the LPAS (late poly(A) signal). The transcript results in a single const it utively spliced product. 351 2396 SV40 LPAS Intron 168 Ampr gene SV40 prmtr SD (Splice Donor) SA (Splice Acceptor) 351 2396 Intron 168 SD (Splice Donor) SA (Splice Acceptor) AAAAAAAAAAAAAA 351 SD (Splice Donor) 168 SA (Splice Acceptor) AAAAAAAAAAAAAA Transcription Splicing

PAGE 67

48 sequences. Thus, when an exon is inserted, more than one spliced product is expected. The main add itional spliced product is the exon inclusion as shown in Figure 19 When mammalian cells are transfected with a pSPL3 vector that includes an insert, the cells are harvested after 2 to 4 days and the RNA is extracted. This is followed by an RT (reverse transcription) reaction and then by PCR. Using u nique primers that bind in the SD and SA regions the PCR bands will include the spliced product with and without the inserted exon. The spliced product that i ncludes the exon of interest (Exon X) may be enhanced or repressed by changing the components of the medium such as insulin, by over expressing a splicing factor or other protein involved in splicing, or by knocking down through siRNA the activity of a spl icing factor or other protein involved in splicing. Figu r e 19 Vector pSPL3 with an insert and the expected main spliced product s Here an exon and part of its flanking introns (shown in blue) is inserted at the MCS (multiple cloning site ) of vector pSPL3. The construct produces a transcript that after splicing can produce two possible spliced products. 351 SD (Splice Donor) 168 SA (Splice Acceptor) AAAAAAAAAAAAAA Transcription Splicing 351 SV40 LPAS 168 SV40 prmtr SD (Splice Donor) SA (Splice Acceptor) Exon X 351 168 SD (Splic e Donor) SA (Splice Acceptor) AAAAAAAAAAAAAA Exon X 351 SD (Splice Donor) 168 SA (Splice Acceptor) AAAAAAAAAAAAAA Exon X

PAGE 68

49 The pSPL3 vector sequence was obtained from Invitrogen. Here we describe the sequences that make up the SD Intron SA region. The Tat protein is a product of HIV 1. The genomic sequence of the Tat gene is two exons and one intron as shown in Figure 20 As the diagram indicates, p art of the Tat gene sequence and with some modifications became the backbone of the SD Intron SA structure of the pSPL3 vector. About 300 bases downstream in the Tat Intron, the MCS (multiple cloning site) was inserted. Then, exons 1 to 3 of the rabbit beta globin sequence were used. Exon 1 (127 bases) and exon 2 (220 bases) are us ed in the SD section, and exon 3 (83 b p ) is used in the SA section. Finally, a stop codon was inserted near the end of beta globin exon 2, and at the end of beta globin exon 3. Th is completes the SD Intron SA structure as shown in Figure 20 The first stop codon truncates the translation of all spliced products. Figu r e 2 0 The main components of the SD Intron SA r egion of vector pSPL3 The SD structure contains exon 1 (127 bp), exon 2 (220 bp) of the rabbit beta globin, and the last 4 bases of the Tat exon 1. Then the full Tat intron with an MCS region follows. The SA structure contains the first 82 bases of Tat e xon 2 and the rabbit beta globin exon 3 (83 bp). 215 87 Tat Exon 1 Tat Exon 2 Tat Intron 2334 4 82 Tat Intron 2334 4 82 2031 83 MCS 220 127 299 66 3 351 168 SD (Splice Donor) SA (Splice Acceptor) Intron 2396

PAGE 69

50 At the point of insertion of the MCS region four bases of the Tat Intron were removed, thus the net intronic sequence that includes the MCS region is 2396 bp. The tat intron not only is long, but it also contains cryptic splice sites that may become active under certain conditions. To test and/or avoid interference by the cryptic splice sites in certain conditions, two modified vectors were constructed by deleting two different lengths from the intro nic sequence between the MCS and the SA region. From the original 2031 bp o ne modified pSPL3 vector had 776 bp removed, and the other had 1650 bp removed. In Vitro Transcription /Splicing Strategies In this project, in vitro transcription was employed to synthesize RNA transcripts that served as pre mRNA in splicing assays. The three common phage RNA polymerases used in the lab are T7, SP6, and T3. In this project T7 was used mainly, and in a few experiments SP6 was used. In this section, the different str ategies used are described in constructing DNA templates for in vitro transcription. The first goal was to demonstrate that exon betaII splices to exon betaI in vitro utilized in in vitro splicing. In vitro transcription involves a DNA template with the appropriate promoter (in this case T7 or SP6), the corresponding RNA polymerase, and nucleotides. When the transcription reaction reaches completion, it cannot be used as is in a splicing assay ; it must be cleaned up and purified However, the reaction at this point still contains the DNA template At this step the DNA template poses no problem, but it

PAGE 70

51 could interfere with subsequent downstream reactions after the splici ng assays Thus, it is preferable to digest the DNA template before the clean up step. However, there are still other aspects to be considered The transcription reaction only synthesizes RNA. A deterrent to RNA degradation, and possibly a factor in quicke r or more efficient splicing, mRNA transcripts. However, a cap analog is used because it is less expensive but just as effec tive. Since the cap analog is not used as a regular nucleotide during transcription, both reactions can be carr ied out at the same time in the same tube. Still, t o give transcription a head start, the transcription reaction was started and incubated for 60 minutes. Then the reagents for the capping reaction were added and the incubation was continued for an additional 60 minutes. After two hours of transcription (which includes up to 60 minutes capping), the reaction is treated with DNAse for 30 minutes to remove the DNA template. Then the reaction is cleaned up and purified. T he phage RNA polymerases are not as processive as the DNA polymerases used in PCR reactions such as taq. They tend to fall off the DNA template, especially if the transcript being synt hesized exhibits strong secondary structure. Thus, the reaction may contain more products than the transcript of interest. To ensure accurate results, the transcription/digestion reaction must be run on a n agarose formaldefyde gel and the band of interest is then excised and then gel purified. Since most of the transcription reactions include one radio labeled nucleotide each step requires special handling and equipment which results in slowing down the process. Also, because the radiolabeled nucleotide is

PAGE 71

52 the limiting nucleotide, this can result in premature termination of transcription which in return will affect the total yield of the desired transcript. Given that the DNA template must be digested after each transcription reaction, preparation of purifi ed DNA template is another concern. The DNA template must have a double stranded promoter, and it may be a PCR fragment or a plasmid. If it is a PCR of the DNA template a nd falls off. If the DNA template is a plasmid, then the plasmid may need to be linearized. The T7 RNA polymerase recognizes a sequence for transcription termination. Some plasmids conta in this sequence and as a result linearization may not be needed. Howe ver, since plasmids are usually amplified in bacteria that produce coiled and supercoiled species, and since the reaction is carried at 37 to 55 degrees Celsius the promoter/terminator may not be exposed, and as a result transcription may never start, it may not terminate at the expected spot, and it may be very slow Thus, most of the time the plasmids are digested at the point where transcription is expected to stop, and they are purified before t h ey are used as templates. Also, the digestion site that d etermines where transcription will terminate is just as important. Because overhangs interfere with transcription efficiency, it is preferable that the plasmid is linearized with a blunt enzyme If such a site is not available, then during or after digesti on, the plasmid can be blunted by treating it with a nuclease that trims overhangs. Because of the concerns described thus far, a strategy was developed to optimize the process. First, over 90% of the experiments were conducted with no radiolabeled nucl eotide, and as a result, no limiting nucleotide concentration was necessary. Second,

PAGE 72

53 the concentration of all nucleotides was increased by 25% and the reaction time was increased from 60 minutes to two hours. This allowed for more product to be synthesized Third, the reaction volume was scaled up from 20ul to 50ul. Fourth, to eliminate as much as possible any secondary structure activity the reaction was run from 42 to 55 degrees Celsius depending on the transcript been synthesized. Lastly, the reaction wa s supplemented with inorganic pyrophosphatase to ensure no premature termination due to accumulation of phosphate. At th e end of the reaction (transcription, capping, and Dnase digestion) a 5ul aliquot was prepared for gel loading. The sample was mixed wi th forma mide loading dye, heated at 7 5 degrees Celsius for 5 minutes and then snapped cooled on ice for 5 minutes before loaded on the gel. The gel was a 1.4% agarose including ethidium bromide and 20% urea The purpose of running only 5ul of the reaction was to ensure that only one transcript was synthesized. The gel was visualized on a UV trans illuminator and a picture was taken. Once this was ascertained, the running of the gel was stopped, and the remainder of the in vitro transcription reaction was pu rified using a spin column. If the visualization indicated more than one band, then the rest of the reaction was prepared and loaded on the same gel, was run again, and the band of interest was excised and gel purified. Because most of the time only one tr anscript was visualized, purified and capped pre mRNA product was prepared within four hours and was ready for a splicing assay. If more than one band was observed and the rest of the sample had to be run on the gel and then gel purified, six hours were ne eded. When the same procedures were carried out with a radiolabeled nucleotide, it would take from two to three days, and the yield was

PAGE 73

54 less. This strategy allowed for several experiments to be carried out quickly and at the same time make optimizations be fore repeating the experiment with a radiolabeled nucleotide. Most of the splicing assays were also carried out without a radiolabeled nucleotide. The splicing reactions were cleaned up and concentrated using a spin column, and an aliquot of about 50% to 7 5% of the product was prepared for loading and r a n on a gel as described above in the in vitro transcription samples. The remaining reaction product was used for reverse transcription reactions either with oligo dT if applicable, or with specific reverse p rimers. This was followed by PCR and gel running to verify the results obtained. Some PCR products were digested with specific enzymes and/or sent for sequencing to further verify the results PKC A ctivation All PKCs have a regulatory domain and a catal ytic domain (see figure 9) The C2 region in the regulatory domain in most PKCs facilitates interaction with anchoring proteins. The later are identified as RACKs (receptors for activated C kinase). After translation, the PKCs remain in the cytosol and th ey are unphosphorylated Several activators facilitate translocation of the PKCs to the plasma membrane (PM) [66] T able 3 lists the most common activators [67 75] (activation var ies in species and cell/tissue). Table 4 PKC Isoform A ctivators (L) PS + + + + + + + + + + Ca 2+ + + + + DAG + + + + + + + + FFA + + + + + + ? + + + LysoPC + + + + + + ? + + +

PAGE 74

55 It should be noted that in the absence of PS, PKC activation can be mediated by t yrosine phosphorylation. Hydrogen peroxide can induce tyrosine phosphorylation in [76] PKC I nhibitors Table 5 PKC Inhibitors Drug Class Admin Specificity Status Phorbol 12 myristate 13 acetate ( PMA ) Ph orbol ester Intra venous Non specific PKC activator: phase I trial in haematological malignancy Tamoxifen Non steroidal anti estrogen Oral selective Bisindoylmal eimide Indoloc arbazole Oral Used in treatment of diabetic retinopathy LY317615 (enzasautaurin) Indoloc arbazole Oral Potentiates treatment with gemcitabine, 5FU, cisplatin or radiotherapy PKCs are attractive targets for therapeutic intervention given their various cellular roles. However, the plethora of interacting p roteins and many secondary messenger systems coupled with cellular and tissue specific variability for each PKC isozyme renders specific drug targeting difficult. The above table (Table 5) from Twelves et al. represents a partial list of the PKC inhibitor s in use today [77] : An inhibitor not l isted above is Ruboxistaurin (LY333531) which is a macrocyclic bisindolymaleimide drug developed by Eli Lilly being tested for use as therapy in diabetic macular oedema and other diabetic angiopathies, including diabetic

PAGE 75

56 retinopathy, diabetic peripheral ne uropathy and diabetic nephropathy [78] It is a competitive reversible i [79] An analog of this inhibitor, namely LY379196 was used extensively in our lab in studies relating to glucose uptake. The following table (Table 6) represents the IC 50 spectrum for LY379196 [80] which shows that and I respond to the lowest M concentrations. Table 6 LY379196 Inhibitor IC 50 S pectrum Enzyme IC 50 0.6 0.05 0.03 0.6 PKC 0. 7 PKC 5 48 0.3 Cyclic AMP Kinase >100 Ca 2+ calmodulin Kinase 5 Casein Kinase >100 Src Tyrosine Kinase 4.4 RACK mechanism Recent research has been focused on a model that is based upon PKC interactions with RACKs. The data suggest that RACKs are anchoring proteins that act akin to scaffolds in order to localize individual PKCs to specific membrane regions. Each PKC isoform responds to a distinctive RACK that may be cell specific and responsible for subcellular localization I n this model, a RACK binds selectively to an activated PKC and translocates the PKC to a specific membrane compartment. The model suggests that each PKC isoform contains both a RACK binding sequence and a sequence that mimics the PKC binding site on the re spective RACK

PAGE 76

57 EXPERIMENTAL PROCEDURES Materials Tissue culture medium was purchased from Invitrogen. Fetal bovine serum was purchased from Atlanta Biologicals (Norcross, GA). Porcine insulin was obtained from Sigma. Reagents for polyacrylamide gel e lectrophoresis were from BioRad. SRp75 polyclonal antibody was raised in rabbits to the synthetic peptide NH2 (GC)KDHAEDKLQNNDSAGKAK COOH (residues 119 136), SRp30b/SC35 antibody to the synthetic peptide NH2 CRRVGDVYIPRDRYTKE COOH (residues 38 53), and SR p55 antibody to the synthetic peptide NH2 CGERVIVEHARGPRRDRD COOH (residues 61 78) by Bio Synthesis, Inc. (Louisville,TX). Antibodies were characterized alongside unreactive preimmune antisera and were shown to recognize rat, mouse and human cell line prot eins. Antibody to the phospho epitope of all SR proteins (mAb104) was obtained from hybridoma cells (CRL 2067; ATCC). Anti phospho Akt (Ser473 and Akt antibody) and anti Akt substrate antibody were from Cell Signaling (Beverly, MA). Anti Clk/Sty antibody was kindly provided by Dr. James Manley, Columbia University, NY, NY. ECL reagents were from Pierce. Taq Platinum polymerase was from Perkin Src kinase inhibitor, Type 1 phosphatase ( PP1 ) were purchased from Calbiochem. All other chemicals and reagents were purchased from the usual vendors. PP1 is pre

PAGE 77

58 incubated with cells for 30 min prior to addition of insulin. LY294002 and PP1 were pre incubated with cells for 30 min prior to addition of insulin. Cell Culture Mouse 3T3 L1 preadipocytes obtained from American Type Tissue Culture repository, ATCC (Manassas, VA) were maintained and passaged as preconfluent cultures in DMEM high glucose 4.5g/L (Invitrogen, Carlsbad, CA) w ith 10% newborn calf serum (Sigma Aldrich, St. Louis, MO) at 37 o C and 10% CO 2 Once confluent, cells were differentiated (day 0) in DMEM high glucose with 10% fetal bovine serum (Atlas am e thasone (Sigma), and 0.5mM isobutyl 1 methylxanthine (Sigma). On day 2, media was replaced with DMEM high glucose, 10% FBS, and bovine insulin. Day 4 and afterwards, cells were cultured in DMEM high glucose plus 10% FBS. Media was changed every two d ays. Prior to insulin treatment for glucose uptake or other assay 4 hour serum starvation was accomplished by using DMEM high glucose without FBS. L6 rat skeletal myoblasts (obtained from Dr. Amira Klip, The Hospital for Sick Children, Toronto, Canada) w o C and 5% CO 2 When the myoblasts reached about 5 0% to 70% confluency, the media was changed to This enables the m yoblasts to fuse into myotubes During both phases, the media was changed e very two days. To slow the confluency of the cells during myotube formation, sometimes 1 % FBS was used. The cells were used for transfection while in myotube formation and at about 70% to 80% confluency. Serum starvation was accomplished by using

PAGE 78

59 Rat aortic vascular smooth muscle cells (A10, ATCC CRL 1476) were grown in DMEM low glucose with 10% FBS at 37 o C and 5% CO 2 Once confluency was reached, cell synchronization was achieved by serum deprivation (with 0.5% FBS) for 48 ho urs. HeLa cells (ATCC CCL 2) were grown in MEM (Invitrogen) with 10% FBS until confluent at 37 o C and 5% CO 2 Serum starvation was achieved by incubation with MEM (no serum) for 6 hours. The immortalized murine fibroblasts were derived as described (46) an supplemented with 15% fetal calf serum, 2 mM L glutamine, and penicillin streptomycin (1mg/ml) and kept at 37 C in a humidified 5% CO2, 95% air atmosphere. The Ntera2 human teratocarci noma cell line (NT2/D1 cells) is maintained in DMEM, 10% fetal bovine serum (FBS) with fresh medium every 3 days. The cells are Primary human neuronal cells were obtained from Dr. Sanchez Ramos. (James A. Haley Veter ans Hospital, Tampa, FL). The cells were cultured in Dr. Sanchez laboratory. Tissues Akt2 null mouse tissues were provided by Dr. Morris J. Birnbaum (Howard Hughes Medical Institute, Department of Medicine, University of Pennsylvania School of Med icine, Philadelphia, PA). Akt2 null and wild type tissues were obtained from 24 week old male animals raised at the Chemerie Mouse Facility at University of Pennsylvania, an AALAC accredited facility. Akt2 null mice were impaired in the ability

PAGE 79

60 of insulin to lower blood glucose because of defects in the action of the hormone on liver and skeletal muscle (25). Expression of myc SRp40 in L6 Cells The cDNA construct encoding myc SRp40 was transfected into L6 myotubes (100 mM dishes) as described using Lipofec tin (24). Post transfection (36 h), the cells were serum starved for 24 h in 0.5 ml of ice cold lysis buffer, centrifuged at 4 C for 30 min at 26,000 X g, and the myc fusion proteins were purified by protein A agarose using c myc antibody (Santa Cruz). Th e blot was probed with SRp40 antibody. Cloning minigenes 18, 19, 20, and 22 in pSPL3 for PKC L6 cells were grown in 1X alphaMEM with 10% FBS until they were about 50% to 60% confluent. Then they were switched to 1X alphaMEM with 2% FBS. The cells were gr own additionally for 2 to 3 days until they reached 100% confluency at which point they were harvested. Using a Qiagen kit for Genomic DNA Extraction and as template to p The same forward primer with sequence CAGGAAGTCATCAGGAATAT was used for all the constructs. The betaII exon is 216 bases. The forward primer starts binding at the 70 th base of the bet a II exon. Thus, all the PCR fragments include the subseque nt 146 downstream bases of exon betaII (147 total) Before insertion into the pSPL3 vector the PCR fragments we re digested with EcoRI, reducing the net size inserted in the vector. After ligation into the vector, only 1 19 bases match ed the betaII

PAGE 80

61 exon. Thu s, all inserts contain a truncated betaII exon that is missing 9 7 bases from its Figure 2 1 depicts the betaII exon, the partial betaII exon sequence used in the insert, and how it is ligated into vector PSPL3. Because the insert lacks flanking upstream intronic sequence of the betaII exon and because at the point of insertion in the PSPL3 vector (EcoRI site at the MCS region), Figu r e 2 1 The p SPL3 18,19,20,22 mini gene structures The p SPL3 vector has an EcoRI site within the MCS region, and an NheI site 1119 bases upstream of the SA region. The vector was cut with EcoRI and NheI. The inserts contain a truncated betaII exon, and varying lengths of downstream intron ic sequence. Under insulin treatment, the SD region, the subsequent 310 bases of intronic sequence, and the following 122 bases of exon betaII behave as a single exon (shown in yellow green) and splice to SA. With no insulin treatment, the 122 bases of exo n betaII are skipped and become part of the intron allowing the original SD to splice to SA 216 150 Exon betaII Exon betaI Intron 5934 147 PCR fragments Intron 20 400 20 400 310 119 351 168 SD (S plice Donor) SA (Splice Acceptor) 1119 20 400 780 168 New Extended SD SA (Splice Acceptor) 1119 780 New Extended SD 168 SA (Splice Acceptor) 20 400 310 119 351 168 SD (Splice Donor) SA (Splice Acceptor) 1119 351 168 SD (Splice Donor) SA (Splice Acceptor) Intron 2031 299 66 351 168 SD (Splice Donor) SA (Splice Acceptor) MCS

PAGE 81

62 there is no branch point and poly pyrimidine tract available upstream of the tru n cated betaII exon. Thus, the exon betaII sequence has dual roles. When there is no insulin treatment, because exon betaII is subject to exon skipping, the betaII exo nic sequence becomes part of the surrounding intronic sequence, and thus it is excised during splicing as part of the intron between SD and SA. Hence, the predominant spliced product expected is the SD SA product. Under insulin treatment, the SD region of the PSPL3 vector, the subsequent 310 intronic bases, and the following 1 19 bases of exon betaII make up a new SD region (SD*) that behaves as a single exon Thus, the predominant spliced product expected is the SD* SA product. The first exon betaII can also As it was indicated earlier, there is no bran c h point and no poly pyrimidine tract upstream of the truncated betaII ex on. Thus, no excision is possible between the SD region and exon tilized Depending on the ins ert, there Construct pSPL3 18 has the longest intronic sequence downstream of the first exon while pSPL3 22 has the shortest intronic sequence. Table 6 summarizes pertinent information f or the deletion series of pSPL3 constructs. The forward primer is 20 bases long and all 20 bases bind in the beta II exon. However, in the PCR fragments synthesized, downstream of the primer sequence there is an EcoRI site. As it was indicated earlier, the pSPL3 vector is digested with EcoRI and NheI. Thus, when the PCR fragments are digested with EcoRI, an overhang is generated that matches

PAGE 82

63 the vector overhang. The reverse primers have either XbaI or NheI sequences. However, when the PCR fragments are diges ted with the corresponding enzyme, the same overhang is generated in all the PCR fragments. The difference is that in the two PCR fragments that have the NheI sequence when ligated to the vector the NheI site is restored while in the others two PCR fragm ents the NheI site is not restored Table 7 Summary of deletion series pSPL3 constructs Construct(s) PCR fragment size Net Insert Si ze Exon II truncated size Size pSPL3 18 719 683 119 564 pSPL3 19 543 507 119 388 pS PL3 20 524 44 6 119 3 2 7 pSPL3 22 189 1 50 119 3 1 Forward primer Overhang All CAGGAAGTCATCAGGAATAT None Reverse primer pSPL3 18 CG T CTAG A CTATGAGAGGAAGTGCTTTT XbaI pSPL3 19 TC T CTAG A AGGGCAAAGCAGCCATATACT XbaI pSPL3 20 GCCATATA G CTA G C TCAAGCCAAGCTCCCAGCCG NheI pSPL3 22 CACG G A G CTAG C TT GG CA AT G GAAAAG G AAAA NheI Modified Ligation Protocol In the construction of pSPL3 18 and pSPL3 19, the PCR fragments generated we re digested with EcoRI and XbaI. At completion, t he reaction was cleaned up using kit ( Zymo Research, CA). The main reason these two fragments contain an XbaI site at downstream of exon betaII. However, the overhang generated by XbaI matches the NheI overhang. The pSPL3 vector was digested with EcoRI and NheI. This generates two fragments of 964 and 5067 bases long. Upon completion, the reaction was loaded on a 1.2% aga rose gel to

PAGE 83

64 isolate the fragments, and subsequently excise a gel slice for the 5067 bp band. The gel slice was then gel purified using the QiaQuick Gel Extraction kit (Qiagen). In the ligation reaction, the vector has an EcoRI and a NheI overhang while th e PCR fragment has an EcoRI and an XbaI overhang. When the insert is ligated to the vector, the EcoRI site is restored, but the NheI site is not (and neither is the XbaI site). When two enzymes, for example XbaI and NheI, recognize different sequences, but generate the same overhang; the ligated products include three species. In our example, one species is a dimmer of two PCR fragments that restore the XbaI site. The other species is a dimmer of two vector fragment s that restore the NheI site. The third sp ecies is a hybrid of the vector fragment and the PCR fragment (the desired product) ; however, this species generates a sequence that is not recognized by either enzyme. This may pose an advantage or disadvantage in analyzing the ligated product. The ligati on reaction was used to transform E. Coli cells and grow them in LB agar plates with ampicilin. Individual clones were picked and grown in LB broth containing ampicilin. The culture was pelleted, the cells were lysed, and purified plasmid was obtained usin g the GeneJet Plasmid Miniprep kit (Fermentas, MD). The miniprep product was then analyzed by restriction digest and the reaction was loaded on a 1.0% agarose gel stained with ethidium bromide to visualize the bands in a trans illuminator After confirmati on that the construct contained the correct insert and in the proper orientation, the miniprep product was sen t for sequencing. The restriction digest analysis and the sequencing results were analyzed using the GeneTool software (Genetool, Canada)

PAGE 84

65 Constr uction of pSPL3 PKC minigenes In the PKC minigenes, no splicing event was expected between SD and exon II. This is because the SD region, the subsequent 310 bases of vector intronic sequence, and the inserted 1 22 bases of exon betaII all behave as a single exon The splic ing event was the excision of the intron between exon II and SA (see figure 2 1 ) In the pSPL3 PKC minigenes, two splicing events take place : one between SD and exon 10, and one between exon 10 and SA. Exon 10 was inserted with both upstream and downstrea m intronic sequence s To ensure and/or test if the length of the upstream intronic sequence is a factor in the splicing event between SD and exon 10, two sets of constructs were built. One set includes only 56 intronic bases ( part of intron 9) upstream of exon 10 and the other set includes 117 intronic bases. The 56 bases version might be missing a functional branch point, while the 117 bases version might have more than one branch point. The pSPL3 vector was digested with BamHI (in the MCS region ) and Nhe I (about 930 bases downstream of BamHI) within the tat intronic sequence This removes about 930 bases which is mostly tat intronic sequence and includes one or more cryptic splice sites. The pSPL3 vector contains t he SV40 promoter and polyadenylation sign al that allow for enhanced expression in NT2 cells. However, the remaining intronic sequence between the NheI site and SA is still quite long (1119 bases) and includes splice site sequences that referred to as ) interfere with the minigene splicing an additional sequence of 879 bases of the tat intronic sequence was deleted from the two sets. This resulted in four sets of minigenes.

PAGE 85

66 The additional sequence deleted between the NheI site and SA was as follows. As it was indicated earlier, the size of the tat intronic sequence between NheI and SA is 1119 bases. After the deletion, the retained tat intronic sequence include d 158 bases upstream of SA and 81 bases downstream of NheI. The 158 bases upstream of SA included at least one functional branch point, and pyrimidine tract. The primers to amplify the genomic PKC from NT2 cells were designed using the Gene Tool Software (Bio Tools Incorporated, Canada) Table 8 Primer list for PKC minigenes Set Forward primer Overhang 1a and 1b CTT T GATC A TGGGAGTTCTGATAATGGTC BcLI 2a and 2b T GG T GATC A CCCCTGTTGTCTCCTCTTGG BcLI Set 1 a Set 2 a Reverse primer f 371 f 432 cct A CTAG T atcggggtctcagtctacac BcuI f 321 f 382 GGG A CTAG T TGGGGGAAGGGGCCTCAGAG BcuI f 274 f 335 cag A CTAG T tggttccttccatgtctcac BcuI f 234 f 295 agg A CTAG T agtcccctttctttggcctc BcuI f 217 f 278 ttc A CTAG T ctcagg gggaataaaaaccg BcuI Sets 1a and 1b Forward primer For all 10 constructs tag G GATC C gggcaagtttgtggaattgg B amH I Reverse primer For all 10 constructs act T GATC A tacaatttctgggtcccctc Bc L I The two forward primers include d the BclI site that match es the overhang of BamHI in the vector (shown in blue color, see Table 8 ) The five reverse primers included the BcuI site that matches the overhang of the NheI site in the vector Following amplification of the product, it was ligated into the diges ted pSPL3 vector. The overhangs of the selected restriction enzymes can hybridize and this enabled cloning of the PCR product in the proper orientation. To increase the efficiency and number of positive clones, the ligation reaction was digested with the a bove restriction enzymes which cleave any dimers produced by the ligation reaction. The product was verified by

PAGE 86

67 restriction digestion and sequencing. The primers used to generate pSPL3 minigene sets are listed in Table 8 The names of the minigenes we re derived from the size of the insert. The insert size in Table 8 is depicted as f xxx where xxx is the size. Thus, minigene pSPL3 3 7 1 contains a PCR insert of 371 bases where the first 6 bases represen t intron 9, the next 97 bases represent exon 10, the next 200 bases represent intron ligation site. pSPL3 432 differs from pSPL3 3 7 1 only in the intronic sequence upstream of exon 10. In the first minigene the sequ ence is 117 bases while in the second it is 56 bases. Table 9 shows what size of each region is included in each minigene. Table 9 Content of each PKC minigene Minigene Intron 9 Exon 10 Intron 10 Delta 8 Region SC35 site SSII siz e f 371 56 97 200 93 8 9 f 321 56 97 150 93 8 9 f 274 56 97 103 93 8 9 f 234 56 97 63 63 8 0 f 217 56 97 46 46 1 0 f 432 117 97 200 93 8 9 f 382 117 97 150 93 8 9 f 335 117 97 103 93 8 9 f 295 117 97 63 63 8 0 f 278 117 97 46 46 1 0 Again, the difference between the two sets of minigenes is the size of the intronic sequence upstream of exon 10. In the second set the upstream intronic sequence is increased from 56 bases to 117 bases. In each set intron 10 is truncated progressively from 200 bases down to 46 bases. This affects the size of the delta 8 region, the availability of the SC35 binding site, and the availability of SSII. Minigenes f 234 and f

PAGE 87

68 335 contain 103 bases of intron 10. The delta 8 region is 93 bases, thus, there are only 10 bases downstream of the delta 8 region. SSII occupies 3 bases of the delta 8 region and 6 bases of the remaining 10 bases of intron 10. Thus, there are only 4 bases downstream of SSII that are part of the insert. Minigenes f 234 and f 295 retain the SC35 bindin g site, but remove the SSII splice site. The construction of these two minigenes is to test if the availability of the SC35 binding site would have prompted for cryptic splice site (in the vector tat intronic sequence) to be utilize d. Mini genes f 217 and f 278 have both the SSII and the SC35 binding site removed. The construction of these two minigenes is to test if the treatment with RA mediates more than just the binding of SC35 to the predicted sequence in the transcript. SSII may be uti lized because not only SC35 binds to the predicted sequence but also because another cryptic splice sites would have produced a spliced product that doe not include SS I. The excision of the intronic sequence between exon 10 and SA. The minigene fragments were ligated into the digested pSPL3 vector through a modified ligation reaction described below. The ligated products were transformed into bacteria using JM109 cell s ( Zymo Research ). All the minigenes were verified by two comprehensive restriction digestion patterns. All minigenes in sets 1a and 2a, and one minigene in sets 1b and 2 b were sequenc ed and the results verified the expected constructs.

PAGE 88

69 Overexpression/Minigene Transient Transfection Transient transfection was accomplished using Trans IT LT1 transfection reagent (Mirus Bio Corporation, Madison, WI) according to manufacture r s protocol. Briefly, L6 cells were cultured in 6 well pl ates until 60 75% confluent. A master mix was prepared with serum and Trans IT LT1transfection reagent The mix was let to stand in the hood at room temperature for 10 min. Then individual tubes were prepared with master mix and DNA so that 10 solution contained 3 0 Trans IT LT1transfection The tubes were let to stand in the hood at room temperature for 10 min. Before transfection the wells were aspirated and repl enished with fresh 2.5ml of 2% FBS aMEM. Then the transfection mixture ( Trans IT LT1 Reagent DNA complex ) was added to cells and incubated for 48 72 hours Six hours before harvesting, the media was changed as follows: For the wells that no serum starvat ion was applicable, the wells were aspirated and replenished with fresh 2.5ml of 2% FBS aMEM. For the wells that serum starvation was applicable, the wells were aspirated and replenished with fresh 2.5ml of 0% FBS aMEM. At 15, 20, 30, 40, 60, and 90 minute s before harvesting the applicable wells were treated with an insulin solution freshly prepared After harvesting, the cells were lysed, and processed for RNA extraction. The RNA product was quantitated, and reverse transcription was performed to obtain cD NA using either oligo dT or specific reverse primers that bound to pSPL3 at the run on 1.0% or 1.2% agarose gels stained with ethidium bromide and the bands were visualized an d photographed in a UV trans illuminator Alternately, the PCR products

PAGE 89

70 were run on 6 .0% PAGE gels and then processed for silver staining. The blots were scanned and analyzed densitometrically. RNA Isolation RNA was extracted not only from lysates, but al so from in vitro transcription reactions and splicing assay reactions Several methods were used to isolate RNA The first method used was using an RNA isolation reagent (a phenol g uanidium based RN A BE E (Tel Testt, Inc.). In these protocols the cells/lysate or reaction is mixed with the reagent and chloroform and centrifuged to separate the mixture into three phases. The aqueous upper phase that contains mainly RNA is separated, and the RNA is prec ipitated with isopropopanol. The yields obtained and purity achieved were rather mediocre compared to the other methods used. The protocols were modified several times, and some improvement was observed, but in the end, this method alone never reached the expected goals established. The next method tried was the use of kits that use filter spin columns. Kits from the following six companies were used/ tested: Invitrogen, Sigma, Zymo Reasearch, Ambion, Qiagen, and Marligen. For isolating RNA from cells, each kit came with its own lysis reagent (also called lysis buffer) The lysate was passed through the filter spin column washed, and then the RNA was eluted either with water or elution buffer. The main improvement achieved was consistency of RNA yield from o ne well to the next that was very difficult to achieve with the previous method described. The second improvement was purity of the RNA product. The cost per microgram of RNA isolated, however, increased from four to ten fold compared to the previous metho d. For in vitro

PAGE 90

71 transcription reactions Because no lysis buffer is needed, th is clean up kit ha s fewer steps (and is less expensive). The clean up kit come s with a buffer that is used to dilute the transcription reaction and enhance the binding of RNA to the column. It also comes with a wash buffer to wash the column before elution. The Zymo Research kit offer s a lot of flexibility. This allowed us to test each component and step of the protocol and make general and specific modifications. Th e optimization s in the long run saved time and improved considerably the yield and the purity of the RNA isolated. In i solating RNA from either a lysate or an in vitro transcription reaction, the need arises to d igest any DNA present in the sample. Most digestion. In all the kits tried for RNA Isolation or just clean up, the on column DNA digestion was tried also. The concentration and purity of the RNA product obtained was measured with the Thermo Scientific instrument NanoDrop 1000. The results indicated that all kits were relatively similar with the Ambion and Invitrogen kit s resulting in a bit higher yields. The previous two methods isolate total RNA. The next method used isolates mRN A directly from lysates or in vitro transcription reactions. It can also be used to isolate mRNA from previously isolated total RNA. The kits used use either magnetic beads with attached oligo columns with attached oligo magnetic beads, the lysate or reaction is mixed with the magnetic beads and this allows hybridization of mRNA to the oligo incubation, the beads are separated from the rest of the mixture through a magnet and washed. The beads are then re suspended in elution buffer and heated to separate the

PAGE 91

72 mRNA from the beads. The beads are then removed from the solution with a magnet, and the mRNA solution is transferred to a clean tube. The last method is the most exp ensive, but the most promising. Since usually mRNA is about 10% of the total RNA, the concentration of the RNA product obtained with this method is much lower. This method can be cost effective in 100mm plates because the beads can be used several times fo r the same sample. In 6cm wells, the cost increases by four to five fold. Some companies now are offering just lysis buffer for RNA isolation. The magnetic beads with attached oligo anticipate that in time either the cost of the beads with attached oligo down, or that one can obtain the beads alone and use an inexpensive kit to attach the oligo In this scenario, one can attach not only an oligo dT, but any specific oligo and fish out f rom a mixture any RNA mo l ecule of interest. For in vitro transcription reactions and splicing assay reactions the Zymo Research kit was used mostly to obtain purified RNA. For RNA isolation from cells, in about 5% of all the experiments the Tri Reagent wa s used, and in about 35 % of all the experiments the RNA BEE was used. A filter spin column kit was used for ab out 50% of all the experiments, and magnetic beads were used for about 3 % of all the experiments. In the rest 7% of the experiments, a combination of methods was used. For example, the cells were lysed with RNA BEE, but then the Zymo Reasearch RNA clean up kit was used to extract the RNA. RNA quantitation was performed using the Thermo Scientific instrument NanoDrop 1000, or the Eppendorf instrument Biophotometer. The most protocol modifications were implemented in the first method described above with RNA BEE. One of the problem s encountered was the foggy separation of the

PAGE 92

73 middle layer and the upper acqueous phase after mixing the lysate with RNA BE E and centrifuging Another problem was contamination of the RNA product with phenol. And a third problem was a low value of A260/A280 indicating high DNA presence This was resolved to some extend by modifying the protocol as follows. In the original prot ocol, for a well of a 6 well plate, 500ul of RNA BEE and 100ul of chloroform were used. After centrifugation the upper aqueous layer was transferred to a fresh tube. Then the RNA was precipitated with isopropanol. In the modified protocol, before centrifug ation 200ul of 2M NaAc were added additionally. After centrifugation, only 80% of the upper phase was transferred to a fresh tube. To the left over three phases, 200ul of 2M NaAc were added, the tube was mixed and centrifuged again. Then 80% of the upper a queous phase was transferred to the same tube with the previous upper aqueous phase. This modification made the separation between the middle layer and the upper phase sharper and minimized the contamination of the transferred phase with phenol and DNA. B efore the precipitation step, besides isopropanol, 50ul of a solution that contained NaCl and Glycerol was added. The solution was prepared with 950ul 2M NaCl and 50ul glycerol. This modification helped the precipitate to form faster, it increased the fina l yield of RNA slightly, and it kept most of any remaining phenol and DNA in the solution. Reverse Transcription reactions After RNA isolation from cells, reverse transcription was performed to synthesize first strand cDNA. Most of the reactions were perf ormed using oligo dT. However, in some occasions specific reverse primers were used. The need to use specific primers was

PAGE 93

74 because the target mRNA molecule sought was in very low concentration. The specific RT reaction synthesizes cDNA only for the transcri pt of interest. In a regular RT reaction, each transcript used for cDNA is digested after the synthesis. In the specific RT reaction, probably over 99% of the transcripts are not processed. To ensure that the unprocessed transcripts do not interfere with t he next reaction, after completion, the specific RT reaction was treated with Rnase. In RNA isolated from in vitro transcription reactions and splicing assay reactions, most of the RT reactions were performed with a specific primer. The reason here is beca use there was only one transcript involved in each reaction, and because most of the transcripts synthesized did not have a poly(A) tails The first strand cDNA synthesized was used in PCR reactions primarily to synthesize DNA for sequencing purposes. And secondarily to verify the products observed in RNA gels. Three different RT kits were used in this project from the following manufacturers: Qiagen, Epicentre, and Invitrogen. PCR ed with the same conditions. In all PCR reacti o ns the Biometra T3 thermocycler was used. In instances where the concentration of the template of interest was in a very low concentration, then the PCR thermocycler program was divided into two stages. In the first stage about one third to one fourth of the total cycles would be performed in stringent conditions by raising the annealing temperature close to the melting temperature (T m ) of the primers. This was done to ensure that only the template of interest was amplified. Then in the second stage, the conditions were relaxed since by then enough

PAGE 94

75 product had been synthesized to compete effectively with any other templates that would cause the primers to miss bind If a PCR reaction showed bands that were not e xpected, and the two stage PCR remedy did not eliminate those bands, then another condition was added to the PCR program. This was accomplished by using the parameter dT (Temperature differential ) available in the thermocycler used. The number of cycles in the first stage was increased, the annealing temperature was raised above the T m of the primers, and the value for the dT parameter was set from 0.1 to 0.5. This parameter decreases the annealing temperature with each cycle by the value set for dT. For example, if the highest T m of the primers is say 65 degrees Celsius the initial annealing temperature would be set to 66 degrees Celsius 0.2, then with each cycle the annealing temperature will be lowered by 0.2 degrees Thus, in the second cycle it would be 65.8, in the third 65.6, in the fourth 65.4 and so on. In the fifteenth cycle it would be 63.2 degrees Celsius This technique is even more stringent and it enables the first stage to select only the template of interest. Again, when continuing with the second stage enough product has been synthesized to compete effectively with other templates that facilitate miss binding In some samples the template of interest was so low that, even with t he modifications described above, the amplified product was not enough to be detected. In these instances, a nested PCR was performed. In this protocol, the first PCR performed amplifies more than one template The n the first PCR is used as a template for the subsequent PCR. In the second PCR appropriate primers are used that target a specific amplified template.

PAGE 95

76 Another modification of the PCR protocol employed was when the two primers used in a PCR had a wide difference between the ir melting temperatures. For example, if the T m degrees Celsius and the Tm say 69 degrees Celsius then the 13 degre e difference could pose a problem. If the annealing temperature was set close to 69, the primer with the T m of 59 may never bind. If the annealing temperature was set close to 56, then the primer with the T m of 69 may produce many miss bindings that would result in several byproducts. In this situation the first stage is performed in two separate tubes; one f or each primer, and with a specific annealing temperature for each primer. Then the tubes were combined and the PCR continue d with the second stage. In Vitro Transcription Templates Several DNA templates were constructed for in vitro transcription. The in itial or early templates w ere PCR fragments. The later templates w ere linearized plasmids. The templates were given the names FH2 FH3, FH4, FH5, FH6, and FH7. For each template, for example FH2, there were several variations. These were indicated as FH2a, FH2b, FH2c, and so on. Each template was testing the splicing of exon betaII to exon betaI. length of intronic sequence upstream of exon betaI that included the poly pyrimidine tract and a branch point, and a varying length of the intronic sequence downstream of exon betaII. This last sites. Table 5 summarizes the construction of the templates. FH2 is the largest template and includes the most

PAGE 96

77 Table 10 Summary of in vitro transcription PCR DNA templates DNA Template sequence size Splice sites included Splice site present Splice products expected FH2 1169 4 SSV 5 FH3 684 3 SSIV 4 FH4 351 2 SSIII 3 FH 5 121 1 SSII 2 FH6 81 0 SSI 1 FH7 2 0 SSI 1 Variation Sequence of betaII exon Exon betaII exon betaI Exon betaI a 49 0 181 188 92 0 All the above templates are the ligation of two PCR fragments. The first fra gment represents exon betaII and its varying downstream intronic sequence, and the second fragment represents exon betaI with an upstream intronic sequence of fixed length For the second fragment only one pair of primers was used. For the first fragment, the same forward primer was used for all constructs, but a different reverse primer for each construct. The PCR fragments were lifted from a pSPORT2 vector that contained part of the PKC genomic sequence and the T7 promoter The insert with the partial PKC genomic sequence was inserted at the PstI and NotI sites of the pSPORT2 MCS region. It has been stated earlier that exon betaII is 216 bases. The PKC genomic insert mentioned above starts at first 35 bases of exon betaII are not present. As a result, the insert contains 181 bases of exon betaII, the intron between exon betaII and exon betaI, exon betaI, and 498 bases

PAGE 97

78 d ownstream of exon betaI. The complete T7 promoter sequence is 23 bases long as TAATACGACTCACTATA G G G AGA he minimum sequence required for transcription is 19 bases long (shown underlined), and transcription starts at the base shown in bold in betaII betaI construct contains the first 21 bases of the T7 promoter and then the insert starting with the 181 bases of exon betaII To lift the betaII exon, a forw ard primer was designed that binds at the T7 promoter. To accommodate future insertion of the fragments generated into the pTnT vector, the forward primer contains the KpnI site (see Table 6) Six reverse primers were designed; one for each fragment. To fa cilitate ligation of each betaII fragment to the betaI fragment, each reverse primer contains the BamHI site. The forward primer for the betaI fragment also contains the BamHI site, and it copies 188 intronic bases upstream of exon betaI. This intronic se quence contains the poly pyrimidine tract and the branch point. The reverse primer for the betaI fragment binds on exon betaI and copies the fir s t 77 bases of exon betaI. T hus, the betaI fragment is the same for all templates and it includes the f i rst 77 b ases of exon b e taI and 188 bases of the intron upstream of exon betaI. T o accommodate future insertion of the templates in a vector, the betaI fragment reverse primer contains the SacI site. Also for future considerations, right after the 77 base of exon b etaI the primer contains the StuI site to facilitate blunt linearization of the vector construct. Six PCR reactions were carried out to generate the six different betaII fragments, and one PCR to generate the betaI fragment. The PCR reactions were cleaned up and then digested with BamHI. The digestion reactions were cleaned up and the betaI fragment

PAGE 98

79 was ligated to each betaII fragment in six ligation reactions. The ligations were used as PCR templates to synthesize the transcription DNA templates. Six PCR r eactions were carried out using as forward primer the same one used for the betaII fragment, and using as reverse primer the same one used as reverse primer in the betaI fragment. The reactions were cleaned up and used for in vitro transcription reactions, and as PCR templates for amplification each time more transcription DNA templates were needed. Table 11 Primer list for betaII and betaI PCR fragments PCR Fragment Forward primer Overhang All betaII GCC G GTAC C TAATACGACTCACT ATAGGG KpnI Reverse primer FH2.betaII AAG G GATC C TCGTTCGTTCGTTCTTCTCT BamHI FH3.betaII CCA G GATC C TCTAAGAACAGTGCCAAATG BamHI FH4.betaII AAG G GATC C GCCGGGAAGGTGGAAGAATG BamHI FH5.betaII ATT G GATC C CCTCGAAGATGGCTCCAAAC BamHI FH6.be taII ATT G GATC C CTGAAACATGGCCACTCTAG BamHI FH7.betaII AAA G GATC C CATGATAGCTGTTGAGCTTG BamHI PCR Fragment Forward primer Overhang betaI TCC G GATC C CGCCCCAAAGCCAGCATATA BamHI Reverse primer AAG G AGCT C AGG CCT AGTTTGTCAGTGGGAGTCAG T SacI {StuI} The FHx PCR products were run on an agarose gel to verify the sizes. They were also digested with BamHI and run on an agarose gel to verify the ligated products. Finally, they were also sent for sequencing to verify the complete content of each te mplate. The sequencin g results verified the expected template constructs. T he six templates were later modified and inserted into vector pTnT. Because exons betaII and betaI were partially copied in each of the transcription templates, there was a possibil ity that an ESE or even an ESS was present in the sequences not present in the templates. Thus, the modification included the entire length of exon betaII and exon betaI. The procedure was repeated as before where six PCR products were synthesized

PAGE 99

80 for the betaII fragment, and one for the betaI fragment. The two fragments were ligated as before, and the ligated fragment was inserted into vector pTnT that contains a T7 promoter and a poly(A) tract. The vector constructs were amplified, checked with digestion for proper size, and later sequenced. The vector constructs were linearized and purified before use for in vitro transcription. In Vitro Transcription Several kits were used for in vitro transcription (IVT) reactions and several modifications were implem ented. We used two types of kits from Ambion, two types from Epicentre, one type from Promega, and one type from Fermentas. We also carried out several IVT reactions where the components of a reaction were obtained separately from different companies. Beca use most of the reactions did not use a radiolabeled nucleotide, and because we carried several reactions at a time due to the many templates involved, with each round of reactions we used one tube specifically for optimization. This afforded us to compare results and make modifications. The first optimization was to increase the incubation temperature from 37 degrees Celsius to 42 and go as high as 55 depending on the template. The second optimization was to include in the reaction inorganic pyrophosphatas e. None of the kits used included this reagent. During transcription, the RNA polymerase generates PPi (pyrophosphate) as it synthesizes the transcript using the nucleotides. The accumulation of PPi can slow down or inhibit the transcript synthesis. The py rophosphatase catalyzes PPi to single phosphates. We found the addition of pyrophosph a tase to be useful in reactions extended beyond 60 minutes. Some kits use Rnase inhibitors in the reaction while others use

PAGE 100

81 Dithiothreitol (DTT) We used the Fermentas rib onuclease inhibitor ( Ribolock ) which contains 8mM DTT in the storage solution Because DTT at high temperatures can cleave the di sulfide bonds found in Rnases, and because it stabilizes polymerases, considering that the reactions are ran at higher tempera tures, we included DTT in the reactions at a final concentration of 20mM. Some in vitro transcription reactions were followed by the capping enzyme r e action, or after half way through the in vitro transcription reaction the capping reaction was started and ran concurrently with the transcription reaction in the same tube until the end of the transcription reaction time Some transcription reactions did not include capping. At the en d of the transcription reaction DNAse treatment was followed for about 30 t o 60 min. We used Ambion, Zymo Research, Stratagene, and Fermentas DNase with its corresponding buffer. An aliquot of each reaction was run on a modified 1.4% gel F or example, for a 36 ml gel volume, we l Ethidium Bromide so lution ( 0.08 g/ l), 725 agarose. Before loading, the aliquot was mixed with Fermentas 2X loading buffer, heated at 75 degrees Celsius for 10 min, and then snap cooled by placing the sample on ice for 3 minutes. The gel was visualized on a UV trans illuminator for accuracy and integrity of the transcript. If more than one band was observed, then the entire reaction would be run on the same gel, the band of interest would be excised and later gel purified using a Zymo Research kit. If only one band was observed, and if the band matched the expected size, t hen the reaction was cleaned up and concentrated using a Zymo Research spin column of 5 g, 25 g, or 35 g capacity. The spin columns were eluted either with water

PAGE 101

82 or Ambion RSS (RNA Storage Solution). The elution products were stored at 20 degrees Celsius before used i n splicing reactions. The same procedure was used if the reaction included a labeled nucleotide. Splicing Assays The splicing assays were carried out with nuclear extracts from Proteinone Inc. We used HeLa, S 100, and K 293 extracts. We used the supplied buffers and followed We incubated the reaction at room temperature between 30 to 60 min. Every splicing reaction was then cleaned and concentrated using a Zymo R esearch spin column as described previously. About 50% to 75% of the product was prepared for loading and ran on a gel as describ ed previously. RT and PCR reactions were carried as described under the headings of RT and PCR The spliced products were verified through digestion and sequencing of the PCR products. siRNA K nockdown L6 skeletal muscle cells were grown in 6 well plates. Cells were ready for transfection at 60 75% confluency. In one Neo FX Transfection Reagent (Applied Biosystems/Ambion, Austin, TX) was mixed bes were mixed and incubated 10 minutes. siPORT Neo FX serum) was added to a final volume of 2.5mL. After 6 8 hours, media was replaced with M.

PAGE 102

83 NT2 cells were grown in 6 well plates. Cells were ready for transfection at 60 75% confluency. Mix preparations were the same as in L6 cells. T wo siRNAs that target separate areas were used to knockdown expression of SC35. SC35 siRNAs along with its scrambled control were purchased from Ambion (I Ds: 12628 and 12444) and siRNA transfection kit. These are validated for specificity to eliminate off target gene effects. Silver Staining 6% polyacrylamide (using 40% Acrylamide/Bis cat# 1610146 from Bio Rad Laboratories, He rcules, CA) gel was prepared. Samples were run on gel and put in 10% ethanol (Fisher) for 3 minutes. The ethanol was replaced with 1% nitric acid (Fisher) for 3 minutes. Gel was then rinsed three times with water and soaked in 0.1% silver nitrate (Sigma ) for 10 minutes. After a quick wash with water, gel was developed using 6% sodium carbonate (Fisher) with 0.2% formaldehyde 37% solution (Fisher). Reaction was terminated with addition of 10N glacial acetic acid (Fisher). Agarose G el s Different conc entrations of agarose gels were prepared. Mostly 1 .0 % 1.2% and 1.4% agarose gel s were prepared (Fisher Scientific, Agarose Molecular Biology Grade cat# BP1356) Most gels were made with ethidium bromide to detect nucleic acids Some gels were made withou t ethidium bromide, but they were stained subsequently with ethidium bromide

PAGE 103

84 Western Blot Analysis Cell lysates were combined with 2X Laemmli Buffer (Bio Rad Laboratories ) with additional SDS up to 8%. Lysates were subjected to 10% SDS polyacrylamide g el electrophoresis (SDS PAGE). Gel proteins were electrophoretically transferred to Hybond C Extra nitrocellulose membranes (Amersham, Piscataway, NJ). Membranes were blocked with Tris buffered saline (Bio Rad), 0.05% Tween 20 (Bio Rad) containing 5% no nfat dried milk, and then incubated with primary and secondary antibodies. The only e Rad) was used for the blocking (3%), primary (1%) and secondary (1%). Detection was performed using SuperSignal West Pico Chemiluminescent substrate (Pierce Biotechnology, Rockford, IL). Antibo dies used are as follows: 19, PKC C 16, Akt1/2/3 H 136, pAkt1/2/3 Thr308 GLUT4 sc1608 OR Serine 2481 ( Peroxisome proliferator ) PU.1 9G7 pAkt Ser473 #4058 Adiponectin C45B10 (Cell Signaling, Boston, MA), GLUT4 C Terminus 07 actin A5441 anti flag M2 (Sigma (GC) EGFSFVNSEFLKPEVKS COOH) SRp40 (NH2 (GC) EVTFADAHRPKLNE COOH) and SRp55 NH2 (GC) GERVIVEHARGPRRDRD COOH) w ere raised by BioSynthesis Inc. (Lewisville, TX) and purified using Nab Protein A Plus Spin Kit (Pierce #89948) Film bands wer e quantified using UnScan software (Silk Scientific, Orem, UT).

PAGE 104

85 Co i mmunoprecipitation L6 myotubes, COS7 cell pellets or mouse tissue samples were harvested with Cell Lysis Buffer (Cell Signaling #9803) with added protease inhibitors (Sigma Fast Protease Magnetic Beads #S1425S (New England Biolabs, NEB, Ipswich, MA) for 1 hour 4 o C with rotation. This step eliminate d non specific binding of protein to magnetic beads. Lysate was separated from beads using Magnetic Separation Rack (#S1506S, NEB). A nti Clk/Sty polyclonal antibody (sc 210, Santa Cruz) or anti Akt2 antibody (sc 7936, Santa Cruz) was incubated with pre cleared lysate O/N 4 o C with rotation. Lysates were now incuba o C. Magnetic field was applied to separate beads from unbound lysate. Beads were washed three times with cell Rad) with DTT was added to the beads. Samples wer e boiled for 10 minutes and loaded onto a 10% SDS PAGE gel. Real t ime PCR Real Time PCR reactions were performed using TaqMan Universal PCR MasterMix (Applied Biosystems (AB) Inc., Foster City, CA, #4304437) according to manufacturer s protocol. Vic lab actin was the endogenous control (AB, GGAGATTCAGCCACCTTATAAACCA GGTGGATGGCGGGTGAAAA labeled probe TTCGCCCACAAGCTT Time PCR was analyzed on the ABI PRISM 7900HT Sequence Detection System (AB).

PAGE 105

86 RESULTS Insulin Regulated PKCII Exon Splicing in Hepatocytes, 3T3 Adipocytes, and Hepatoma Cells [81] Our previous work demonstrated that insulin regulated the inclusion of exon betaII, and also activated additional 5' splice sites in PKCII mRNA [82] Here we wanted to repeat some of the experiments and expand th e study to other cell lines, and modify some of the treatments. As before, i nsulin regulated PKCII exon inclusion in L6 cells and activated an additional 5' splice site in a time dependent manner. Alternative splicing of the PKC gene was further studied in other cell types to evaluate whether insulin regulated endogenous PKCII expression in other insulin dependent target tissues. Insulin promoted exon inclusion of PKCII mRNA using splice site I in primary rat hepatocytes and 3T3 L1 adipocytes (Fig. 22 B and C). Even though most data shown are for 30 min insulin treatment, we conducted experiments where we tested for 15 min, 45 min, 60 min, and 90 min. longer times to be activated. The P I3 kinase inhibitor LY294002 blocked insulin stimulated exon inclusion in 3T3 L1 adipocytes (Fig. 22 C). In the human hepatoma HepG2 cells, insulin activated additional upstream PKCII 5' splice site (Fig. 22 D) similar to L6 cells. However, it was difficult to reproduce endogenous exon inclusion in vascular smooth muscle cells (data not shown). The results presented here contributed to other projects / studies besides my dissertation proj ect. For the results that have already been published, the heading includes the reference of the publication

PAGE 106

87 Development of an Insulin Regulated Heterologous Minigene [81] To dissect the mechanism of regulation of PKCII alternativ e splicing by insulin, a PKCII heterologous minigene was constructed to identify insulin responsive cis elements in vivo in eukaryotes (Fig. 2 3 A). Because the splice variants detected in vivo in L6 and HepG2 cells appeared to use alternative 5' splice sit es, it was postulated that the Figu r e 2 2 Insulin Regulated Endogenous Alternative Splicing of the C Terminus of PKC pre mRNA A, Inclusion of PKCII exon 17 generates PKCII mRNA. A STOP cod on within exon betaII hinders the translation of the PKCI exon. Total RNA was isolated from either (B) primary rat hepatocytes, (C) 3T3 L1 adipocytes, or (D) Hepatoma HepG2 cells. RNA (2 g) was used in the RT PCR analysis using primers for the last commo n, C4, domain (exon 16) and antisense primer to the PKCI exon (indicated by arrows). The PCR product size was 187 bp for PKCI and 404 bp (splice site I) or 539 bp (splice site II) for PKCII. Primers for actin were used for normalization. The experimen ts were repeated two to three times for each cell type and similar results were obtained.

PAGE 107

88 elements involved in regulation of exon inclusion and splice site selection would reside within the PKCII exon and its flanking 3' and 5' intronic sequences. Figu r e 23 Insulin Regulated PKCII Splicing Minigene A A het erologous splicing minigene was constructed by inserting the PKCII genomic fragment (exon 17) into a multicloning site in between the SD and SA in pSL3. Putative cis elements were identified by inspection of the sequence and are indicated relative to one another. PT, Pyrimidine tract; AURE, AU rich Element; ISE, intronic splicing enhancer; CAG/GTG, splice site. B Two sets of primers were used in the amplification of splice products. Primers SD SA amplified three products: 263 bp when PKCII exon was not i ncluded; 479 bp (I) when PKCII exon was spliced using splice site I; 614 bp (II) when PKCII exon was spliced using splice site II. Primers II SA amplified two products: 352 bp (I) when PKCII exon was spliced using splice site I; 487 bp (II) when PKCII exon was spliced using splice site II. C The pSPL3 32 minigene was transiently transfected into L6 cells. Cells either had no insulin treatment (I0) or were treated with insulin for 30 min (I30). Total RNA was extracted and RT PCR was performed using pri mers corresponding to either SD SA or II SA. D The PCR products were verified by Southern blot analysis using PKCII specific probe as described. Labeled probe hybridized to PCR products as predicted.

PAGE 108

89 Hence, the 216 bp PKCII exon and 4 50 bp upstream a nd 948 bp downstream flanking intronic sequences were cloned into the pSPL3 vector between the splice site donor and the splice site acceptor exons. To determine whether the pSPL3 32 minigene could mimic RNA processing and splice site selection as observe d for endogenous PKCII mRNA, the pSPL3 32 minigene was transiently transfected into rat skeletal muscle (L6) cells. Insulin responsive inclusion of the PKCII exon and activation of another upstream splice site was demonstrated in L6 cells using two sets of primers. Primers to splice site donor (SD) and splice site acceptor (SA) amplified three products: 263 bp amplifying SD SA showing constitutive minigene splicing; 479 bp (I) when PKCII exon was included using splice site I; and 614 bp (II) when PKCII exon was included using splice site II. Primers within the PKCII exon and SA amplified two products: 352 bp (I) when PKCII exon was included using splice site I; and 487 bp (II) when PKCII exon was included using splice site II (Fig. 2 3 B). When cells we re not treated with insulin, only constitutive splicing of the minigene is observed using primers SD SA whereas no product is detected using primers II SA as the PKCII exon is skipped (Fig. 2 3 C). Both sets of primers detect products resulting from activa tion of splice sites I and II after insulin treatment. Hence, this minigene contained all the necessary sequences to promote insulin regulated PKCII exon inclu sion and splice site selection.

PAGE 109

90 Insulin Regulated PKC II Minigene in Multiple Target Tissues [81] Hormonally responsive alternative splicing of endogenous PKCII mRNA is readily detected in differentiated skeletal muscle cells such as L6 cells [35] However, in rat vascular smooth muscle A10 cells, insulin induced endogenous splicing of PKCII isoform was not readily detected. This is presumably due to the complex transcriptional and posttranscriptional regulation of PKCII mRNA [83] To further test the model in other insulin responsive cel ls, the pSPL3 32 minigene was transiently transfected into the rat vascular smooth muscle A10 cells, Figu r e 2 4 The pSPL3 32 M inigene w as Regulated by Insulin in Various Cell Types Cells either had no insulin treatment (I 0 ) or were treated with insulin for 15 min (I 15 ), 30 min (I 30 ), or 60 min (I 60 ). RT PCR was performed using primers for II SA to detect activation of splice s ites I and II by insulin. actin levels were equivocal between the treatments. Each experiment was repeated two to four times with similar results to establish activation of splice sites I and II.

PAGE 110

91 human hepatoma cell line, HepG2 cells, 3T3 pre adipocytes, and murine embryonic fibroblasts. Insulin regulated PKCII exon inclusion and splice site activa tion of the pSPL3 32 minigene in each cell lin e (Fig. 24 ). Additionally, splice site II was activated in all cell types by insulin in a time dependent manner similar to that detected in L6 cells. Interestingly, different cells show distinct responses to in sulin treatment. L6 skeletal muscle cells show a preference to utilizing splice site II after 15 min of insulin stimulation whereas in A10 vascular smooth muscle cells, insulin stimulation for 15 min promoted the use of splice site I. Both cell types utili ze splice sites I and II with longer insulin treatment. HepG2 hepatomas predominantly use splice site II whereas 3T3 L1 preadipocytes utilize splice site I with longer (30 60 min) insulin treatments. Also, 3T3 L1 preadipocytes and the embryonic fibroblasts show constitutive PKCII exon inclusion using splice site I without insulin stimulation. Hence five distinct cell types (i.e. skeletal muscle, vascular smooth muscle cells, hepatoma cells, preadipocytes, and embryonic fibroblasts) demonstrate PKCII exon splice site activation regulated by insulin within a short time of the stimulation, although the use of splice sites I and II are cell and time dependent. Insulin Activated PKCII 5' Splice Sites [81] To determ ine whether the 3' intron was involved in insulin regulated 5' splice site selection, the 3' flanking intron and a portion of the PKCII exon including the 3' splice site were deleted from the pSPL3 32 minigene. A new 3' splice site that the exon can utili ze was introduced in the cloning process as described in Materials and Methods. This truncated minigene, pSPL3 17, containing 108 bp of the exon and the intronic sequences

PAGE 111

92 fla nking the 5' splice site (Fig. 25 A) was transfected into L6 and A10 cells. Insuli n still regulated the 5' splice site selection of the PKCII exon (Fig. 25 B) in the pSPL3 17 minigene in a time dependent manner in both the cell types. This suggests that the elements around the 3' splice site and its flanking intron were not required fo r activation of the 5' splice site in vivo by insulin. Figu r e 2 5 3' Intronic Sequences Are Not Involved in Insulin Regulated 5' Splice Site Selection A The pSPL3 17 minigene contains 108 bp of the II exon and approximately 1200 bp of 5' intronic s equence. SSI, Splice site I (ATG/GTG); SSII, splice site II (CAG/GTG). B pSPL3 17 minigene was transiently transfected into L6 skeletal muscle and A10 vascular smooth muscle cells. Cells either had no insulin treatment (I0) or were treated with insulin fo r 15 min (I15), 30 min (I30), or 60 min (I60). RT PCR was performed using primers for SD SA. Insulin activated splice sites I and II in both cell types. The experiment was repeated five times with similar results in both cell types. The graph shows percent maximal II exon inclusion using either splice site I or II, assuming utilization of splice sites I and II as 100% after 60 min of insulin treatment

PAGE 112

93 Insulin Signals via PI3 Kinase to Regulate PKCII Minigene [81] Our previous work [84] and stud ies in 3T3 L1 adipocytes (Fig. 22 A) indicated that a PI3 kinase dependent pathway was involved in the in vivo regulation of alternative splicing of PKCII mRNA by insulin. Because pSP L3 17 contained all the cis elements required for insulin stimulated activation of 5' splice sites, this minigene was transiently transfected into L6 cells. To determine whether the splicing of the minigene was also regulated via a PI3 kinase pathway, PI3 kinase inhibitors, LY294002 (100 nM) or Wortmannin (100 nM), were added 30 min before addition of insulin for 30 min. Moreover, pSPL3 17 was cotransfected with p85, the dominant negative mutant of the regulatory subunit of PI3 kinase [85, 86] which lacks the binding site for the p110 catalytic subunit, thereby inhibiting the association of PI3 kinase with insulin receptor substrate 1. Results show inhibition of PKCII splice site activation, hence demonstrating that splice site selection of the PKCII minigene was also regulated via the PI3 kinase pathway (Fig. 26 A and B). Akt2 Is a Downstream Kinase Regulating PKCII Exon Splice Site Selection [81] The role of Akt kinas e has been implicated in insulin action because it is activated by PI3 kinase [87] Also, SR proteins contain the consensus sequence RXRXXS recognized by Akt kinase. They have been shown to be potential substrates i n vitro [88] for Akt kinase. Further, data from our laboratory demonstrate Akt2 kinase phosphorylated SRp40 in vivo To identify the intermediary kinases involved in the phosphorylation cascade, the minigene pSPL3 1 7 was cotransfected with constitutively active Akt2 kinase (CA Akt2) into the L6 skeletal cells. CA Akt2 kinase mimicked the

PAGE 113

94 action of insulin (Fig. 26 C) by promoting exon inclusion and activating the additional 5' splice site in the minigene. Figu r e 26 5' Splice Site Selection in pSPL3 17 Minigene Is Regulated by PI3 Kinase Pathway Insulin (100 nM) was added for 30 min (I30) or cells had no insulin treatment (I0). A, The PI3 kinase inhibitor, LY294002, was added for 30 min before total RNA isolation; or (B) The PI3 kinase inhibitor, wortmannin, was added 30 min before total RNA isolation. The dominant negative subunit of PI3 kinase, p85 DN, was cotransfected with pSPL3 17. C, Constitutively active Akt2 kinase or (D) Clk/Sty was cotransfected with pSPL 3 17. Total RNA was isolated and RT PCR was performed using primers for II SA in panels A and D. Actin was used as an internal control. RT PCR was performed using primers for SD SA in panels B and C. The graph shows percent maximal II exon inclusion us ing either splice site I or II, assuming utilization of splice sites I and II as 100% after 30 min of insulin treatment. The experiments were repeated at least four times each

PAGE 114

95 Clk/Sty Cotransfection Regulated PKCII Exon Splice Site Selection [81] The Clk/Sty protein kinase interacts with RNA binding proteins and, in particular, phosphorylates the SR family of splicing factors [52] Mammalian Clk/Sty was shown to phosphory late SR splicing factors in a physiologically relevant manner. It was suggested that the Clk kinase family could act as a link between signal transduction and regulated splicing [89] [90] Hence, the minigene pSPL3 17 was cotransfected with Clk/ Sty in L6 cells. Clk/Sty also a ctivated 5' splice sites (Fig. 26 D), suggesting that several kinases could play a role with insulin activating multiple signaling pathways involved in splice site selection. Binding of SRp40 Is Essential for Insulin Regu lated Splice Site Activation [81] It was established that the phosphorylation of SRp40 was a key step in the regulation of splice site selection and exon inclusion by insulin [84] 28). However, binding of SRp40 to the pre mRNA may be exclusive of its phosphorylation and function in PKCII splicing. To further elucidate the role of SRp40 in splice site selection, its RNA binding site, TGGGAGCTTGGCTTAGA, in the downstream i ntron flanking the PKCII exon { which has a 2 bp mismatch with the sequence predicted by SELEX [91] } was replaced with AGC GAATCATTGAATCC in the pSPL3 32 minigene. This sequence replacement ablated the insulin stimulated exon inclusion and splice site ac tivation in the minigene (Fig. 27 A). This emphasizes the requirement of SRp40 binding to its site on the pre mRNA in addition to its phosphorylation by an upstream kinase in insulin regulated PKCII 5' splice site selection.

PAGE 115

96 Figu r e 27 SRp40 Binding and Phosphorylation Affect PKCII 5' Splice Site Selection A, The SRp40 binding site in the 5' intronic sequence was replaced with AGCCGAATCATTGAATCC in the pSPL3 32 minigene. Both the pSPL3 32 and mutated pSPL3 32* minigenes were transiently transfected into L6 cells. Insulin was added for 30 min (I30) or 60 min (I60), or cells were not treated with insulin (I0). RT PCR was perf ormed using primers for SD SA. The experiment was repeated five times with similar results. The graphs shows percent maximal II exon inclusion using either splice site I or II, assuming utilization of splice sites I and II as 100% after 60 min of insulin treatment in the pSPL3 32 minigene. The experiments were repeated at least three times with similar results. B, The pSPL3 32 minigene was cotransfected into L6 cells along with increasing amounts (0.8 1.6 g) of SRp40. Insulin (100 nM) was added 30 min bef ore total RNA isolation. RT PCR was performed using primers to SD SA. Actin was used as an internal control. The experiment was repeated four times with similar results. C, The pSPL3 32 minigene was cotransfected into L6 cells along with either SRp40 or constitutively active Akt2 kinase (CA Akt2). Insulin (100 nM) was added 30 min before total RNA isolation. Actin was used as an internal control. RT PCR was performed using primers to II SA. The experiment was repeated thrice to ensure reproducible resu lts.

PAGE 116

97 Overexpression of SR factors has also been shown to enhance exon inclusion [92] Although we hypothesize that phosphorylation of SRp40 regulates its RNA binding activity, ov erexpression should mimic, to an extent, insulin effects. Increasing amounts of SRp40 (0.8 1.6 g/35 mm plate) were cotransfected with pSPL3 32 to observe its influence on splice site selection. Results indicate that although cotransfection of 0.8 g SRp40 activated splice sites I and II (compared with no insulin treatment), addition of insulin leading to phosphorylation of SRp40 enhanced splice site activation to 100% (Fig. 27 B). Cotransfection with 1.6 g SRp40 (per 35 mm plate) activat ed splice sites I a nd II (Fig. 27 B) although amounts higher than 2.4 g of SRp40 per 35 mm plate suppressed splicing (data not shown). Further, the constitutively active form of Akt2 kinase, CA Akt2, was cotransfected along with pSPL3 32 and SRp40 (0.8 g/35 mm plate) in L6 cells. It mimicked insulin induce d splice site activation (Fig. 27 C). This provides a link to the downstream kinase cascade leading to the splice site selection in PKCII mRNA. Consecutive Deletion of the 5' Intronic Sequences in PKCII Minigene Reveal s Multiple Regulatory Effects [81] The contribution of the downstream intronic sequence for activating splice sites I and II was important but unknown. Hence, consecutive deletions were performed on the minigene pSP L3 17 to truncate the 5' intron and elucidate the importance of other putative elements on the 5' splice site selection (Fig. 28 A). GA rich intronic splicing enhancers, present at the 5' end of introns, have been implicated in promoting exon inclusion [93] To determine whether these sequences played a role in PKCII exon

PAGE 117

98 inclusion and splice site select ion, the minigene pSPL3 18 was truncated after the AU rich element, thereby eliminating the GA rich splicing enhancers and then transfected into A10 cells. The pSPL3 18 minigene still demonstrated regulated PKC II splice site selection (Fig. 28 B) with act ivation of splice sites I and II, suggesting no involvement of these putative distal intronic splicing enhancers in insulin action Figu r e 28 Consecutive Deletions of PKCII Minigene Reveal Multiple Regulatory Effects A, Schematic shows the consecutive d eletions of putative cis elements in the 5' intronic sequence of II exon. B, The truncated minigene pSPL3 18 was transiently transfected into A10 cells. Insulin was added for 30 min (I30) or 60 min (I60) or cells were not treated with insulin (I0). Total RNA was isolated and RT PCR was performed using primers to II SA. C, The truncated minigenes pSPL3 19, pSPL3 20, and pSPL3 22 were transiently transfected into A10 cells. Insulin was added for 30 min (I30) or 60 min (I60), or cells were not treated with i nsulin (I0). Total RNA was isolated and RT PCR was performed using primers to II SA. Actin was used as an internal control. The experiments were repeated at least two times to ensure reproducible effects of insulin.

PAGE 118

99 Further deletion of an additional 177 nucleotides, eliminating the AU rich element sequence but maintaining the SRp40 binding site in pSPL3 19 minigene, also preserved insulin regulated activation of splice sites (Fig. 28 B). Interestingly, however, splice site II was activated only after 60 m in of insulin treatment. It could be hypothesized that the AU rich element was involved in secondary structure formation facilitating splice site selection. Also, the splicing factor hnRNP A1 binding site is downstre am of the SRp40 site (see Fig. 28 A). Thi s may suggest that elimination of the AU rich element may have enabled hnRNPA1 to bind to an intronic splicing silencer, thereby decreasing the utilization of splice site II. Further studies are indicated to clarify the role of hnRNP A1. Minigene pSPL3 20 truncated at the SRp40 site, destroying a portion of it, showed splice site I activation within 30 min; however, splice site II was not used even at 60 min (Fig. 28 B). This indicates that SRp40 is a key factor in early insulin regulation of splice site se lection of PKCII exon and is essential for splice site II activation. The removal of the SRp40 binding site and the proximal sequences in minigene pSPL3 22 to a minimum of 39 nucleotides of the 5' intronic sequences resulted in only 20% utilization of spl ice site I even at 60 min after insulin treatment. This emphasizes the importance of cis elements flanking the 5' splice site in PKCII exon inclusion and 5' splice s ite selection by insulin (Fig. 28 B).

PAGE 119

100 Transfection of cells with constitutively active Akt2 kinase mimics insulin induced splicing of PKC [94] Insulin stimulated inclusion of the exon specifying the C terminal V5 region of PKC II [32, 82] and ins ulin regula ted splicing of the II exon involved phosphorylation of SRp40 by a PI 3 kinase dependent signaling pathway [84] It has been shown that the physiological responses of insulin such as glucose uptake and Glut4 transl ocation are preferentially mediated by Akt2 kinase [95] We hypothesized that insulin activation of Akt would also result in the increased phosphorylation of SRp40 because SR proteins are potential in vitro substrat es for Akt [49] and SRp40 overexpression increased glucose uptake [84] To demonstrate this relationship, skeletal muscle (L6) cells were either treated with insulin for 30 min or left untreated (control), or cells were transiently transfected with constitutively active (CA) Akt2 cDNA construct [96] Simultaneously, separate wells were transiently transfected with SRp40. The endogenous splicing of PKC II in cells with CA Akt2 was compared with insulin treated cells and to cells transfected with SRp40 cDNA where inclusion of the II exon was detected without insulin treatment as reported earlier [84] In cells tr ansiently transfected with constitutively active Akt2, PKC II exon inclusion was detected without insulin treatment (Fig. 29 ), suggesting that Akt2 kinase acted downstream of PI 3 kinase.

PAGE 120

101 Akt2 Kinase Phosphorylated SRp40 in Vivo [94] We previously found increased phosphorylation of SRp40 by a P I 3 kinase dependent pathway following insulin treatment [84] although the specificity of the Figu r e 29 Constitutively active Akt2 kinase mimics insulin indu ced endogenous splicing A the figure depicts alternative splicing of PKC II mRNA regulated by insulin. Upon insulin treatment, SRp40 is phosphorylated which then mediates PKC II exon inclusion to produce mature PKC II mRNA. B L6 cells were transf ected with CA Akt2 or SRp40 and treated with insulin for 30 min. Total RNA was isolated, and RTPCR was performed using sense primers for C4 and antisense primer for IV5. 5% of products were resolved on 6% PAGE gels and detected by silver staining. The exp eriments were repeated thrice to ensure reproducibility. Splicing efficiency was quantified by densitometric scanning of the silver stained gels from three experiments and represented on the graph. An arbitrary value of 100% splicing efficiency is attached to I exon in the control (I 0 ) sample and 100% II splicing efficiency in the insulin treated (I 30 ) sample. ,.

PAGE 121

102 kinases involved and the phosphorylation sites were not identified. We asked whether a downstream effecter such as Akt k inase was phosphorylating serine residue(s) in the SR domain of the SR protein. Figu r e 30 Akt2 kina se phosphorylates SRp40 in vivo L6 cells were transfected with pcDNA3 alone or myc Akt2/pcDNA3. Following serum starvation in phosphate labeled for 6 h in medium containing [ 32 P]orthophosphate (0.5 mCi), treated with insulin for 30 min, lysed, and immunoprecipitated with anti SRp40 antibody. Top panel, immunoprecipitations were separated by S DS PAGE and examined by phosphorus imaging. The graph depicts densitometric analysis of the blot and indicates fold increase of phosphorylated SRp40 under the above conditions. Bottom panel, the blot was immunoprobed with antibodies to SRp40 and Akt2 kinas e. The experiments were repeated three times with similar results. IB, immunoblot.

PAGE 122

103 Recent studies from other laboratories demonstrated that Akt could phosphorylate SR proteins in vitro [49] However, the in vivo ev idence linking a hormone signaling pathway to the phosphorylation of a specific SR protein resulting in regulation of a splicing event was lacking. To demonstrate that Akt2 kinase phosphorylates SRp40, L6 myotubes that had been transfected with CA myc Akt2 or treated with insulin were labeled with [ 32 P]orthophosphate prior to immunoprecipitation with SRp40 antibody. Following SDS PAGE separation of immunoprecipitates, the autoradiogram revealed that SRp40 in the basal state was phosphorylated. CA HA Akt2 tr ansfection increased its phosphorylation 2.5 fold compared with the empty vector control. Insulin treatment of cells transfected with the empty vector resulted in a 3 fold increase in SRp40 phosphorylation (Fig. 30 ). SRp40 Is an Akt2 Substrat e [94] Akt2 regulates PKC II exon in clusion as shown above in Fig. 29 Also, phosphorylation of SRp40 via insulin and its downstream kinases is essential for PKC II exon inclusion [84] F urther, protein sequence analysis revealed a consensus Akt2 phosphorylation sequence (RXRXXS) at Ser residue 86. Hence, to examine whether Akt2 phosphorylated SRp40 in vitro an Akt kinase assay was performed. L6 cells were transfected with either myc SRp4 0 or HA Akt2 CA. Following immunoprecipitation with Myc antibody and HA antibody, respectively, the assay was performed in the kinase reaction buffer for 30 min in the presence of [ 32 P]ATP. The samples were separated on SDS PAGE and analyzed by phosphorus imaging (Bio Rad). The results indicated that

PAGE 123

104 Akt2 phosphorylated SRp40 (Fig. 3 1 a). Further, when Ser 86 was mutated to alanine (SRp40*), the mutation abolished Akt phosphorylation of SRp40. The constructs were validated in separate experiments (Fig. 3 1 b) using anti Myc and anti SRp40 antibodies. Figu r e 31 SRp40 Is an Akt2 Substrate a, in vitro Akt2 kinase assay. Constitutively active Akt2 kinase immunoprecipitates were incubat ed with 10 mCi of [ 32 P]ATP (ICN Biomedicals) and myc SRp40 (or mutated myc SRp40*) immunoprecipitates for 30 min in 25 ml of kinase buffer (20 mM HEPES, 10 mM MgCl2, 10 mM MnCl2, 1 mM dithiothreitol, 5 mM ATP) at 25 C. The reactions were terminated using Laemmli SDS sampl e buffer. The proteins were separated on 12.5% SDS PAGE, and phosphorylation was visualized by phosphorus imaging (Bio Rad). The experiments were repeated five times with similar results. b, the myc SRp40 construct was validated in separate experiments. Th e construct was transfected into L6 cells, and the lysate was immunoprecipitated with using antimyc antibody. The SRp40 antibody was then used for detection. In a separate experiment performed simultaneously, the lysate was immunoprecipitated with SRp40 an tibody, and anti myc was used for detection. Lane 1, mock transfection; lane 2, insulin at 0 min; lane 3, insulin at 30 min. IP, immunoprecipitation; IB, immunoblot.

PAGE 124

105 Mutation of Akt2 Phosphorylation Site in SRp40 Attenuated PKC II Exon Inclusion [94] We surmised that phosphorylation at Ser 86 was a key regulatory factor in splice site selection. A heterologous minigene pSPL3 32 [81] was developed to study insulin regulation of in vivo splice site selection of PKC II exon. In this system, SD splices on to SA constitutively, but inclusion of PKC II exon and activation of its splice sites occurs only upon insulin treatment. The mutated SRp40, SRp40*, was co transfected in L6 cells with the splicing minigene pSPL3 II and treated with insulin for 30 min. RT PCR was performed using primers for SD and SA such that inclusion of PKC II exon as well as activation of the splice sites could be observed. Cells transfected with mutated SRp40 showed decreased PKC II 5 splice si te activation and exon inclusion in the presence of insulin (Fig. 32 a). The endogenous SRp40 may have been responsible for some residual splicing. This confirmed a role for Akt2 phosphorylation of Ser 86 in SRp40 as a key regulatory mechanism in splice site selecti on. Fibroblasts from Akt2( / ) Mice Splice the PKC II Exon Inefficiently [94] To evaluate the role of Akt2 kinase in exon inclusion, pSPL3 II minigene was transiently transfected into f ibroblasts from Akt2( / ) m ice cells or ( + / + ) cells. Insulin treatment of cells for 30 min resulted in activation of splice sites I and II in wild type ( + / + ) cells, whereas the Akt2 deficient ( / ) cells did not show PKC II exon inclusion (Fig. 32 b). This provided direct genetic evidence that Akt2 mediated PKC II splice site selectio n.

PAGE 125

106 Figu r e 32 A kt2 Phosphorylation Site in SRp40 regulates PKC II exon inclusion a, mutation of Akt2 phosphorylation site on SRp40 attenuates PKC II exon inclusion. The PKC II exon i s cloned between the splice donor and splice acceptor of pSPL3 to genera te the pSPL3 II splicing minigene (11). L6 cells were co transfected with the heterologous splicing minigene pSPL3 II alone or along with the mutated SRp40* and treated with insulin (100 nM) for 30 min. Total RNA was isolated and RT PCR performed using s ense primers for SD (5 TCTCAGTCACCTGGACAACC 3 ) and antisense primer for SA (5 CCACACCAGCCACCACCTTCT 3 ). 5% of products were resolved on 6% PAGE gels and detected by silver staining. PKC II exon inclusion and splice sites I and II activation occurs upon insulin treatment in L6 cells transfected with pSPL3 II (control), whereas those co transfected with pSPL3 II and the mutated SRp40 (SRp40*) showed decreased exon inclusion. Constitutive splicing of SD to SA was observed in all of the samples. The resul ts represent two separate experiments performed with similar results. b, fibroblasts from Akt2( / ) mice show defective PKC I I minigene splicing. Immortalized mouse fibroblasts derived from wild type ( + / + ) or Akt2 deficient ( / ) mice were transfected with the PKC II splicing minigene. Total RNA was isolated, and RT PCR was performed using sense primers for SD and antisense primer for SA. 5% of products were resolved on 6% PAGE gels and detected by silver staining. Constitutive splicing of SD to SA occurs i n both cell types. PKC II exon inclusion and splice site activation occurs upon insulin treatment in Akt2( + / + ) cells. SSI, splice site I; SSII, splice site II. The results are representative of two experiments with similar results.

PAGE 126

107 Akt2 Kinase Associati on with SRp40 Is Regulated by Insulin [94] Although recent reports have indicated nuclear targeting of Akt kinase [97] our studies did not examine shuttling of Akt2 kinase or SRp40. We examined SRp40 i mmunoprecipitates for the presence of Akt2 kinase. SRp40 was immunoprecipitated from L6 whole cell lysates using SRp40 specific antibody. Western analysis was then performed on SRp40 immunoprecipitates using Akt2 antibodies. En dogenous Akt2 was present in the SRp40 immunoprecipitates but not in the control nonspecific IgG immunoprecipitates (Fig. 33 a). Figu r e 33 Co immunoprecipitation of Akt2 and SRp40 a, L6 whole cell lysates were immunoprecipitated with SRp40 antibody as de scribed and separated by SDS PAGE, and endogenous Akt2 was detected with anti Akt2 antibody. Control using nonspecific IgG and protein G agarose beads (IgG) showed no interaction. L6 lysates prior to SRp40 immunoprecipitation is shown in the bottom panel. b and c, in a separate experiment, L6 lysates were immunoprecipitated using Akt2 antibody, separated by SDS PAGE, and detected by Western blotting using SRp40 antibody (b) or ASF/SF2 antibody (c). Control using nonspecific IgG and protein G agarose beads ( IgG) showed no interaction. L6 lysates prior to Akt2 immunoprecipitation is shown in the bottom panel. The experiments were repeated thrice with similar results. IP immunoprecipitation ; IB, immunoblot.

PAGE 127

108 To confirm specific interaction of SRp40 with Akt2 ki nase, we performed reverse immunoprecipitation of Akt2 followed by Western analysis using SRp40 specific antibodies. SRp40 was detected in the Akt2 immunoprecipitates but was absent from the control nonspecific IgG immunoprecipitates (Fig. 33 b). Both exper iments demonstrated that the association was further enhanced upon insulin treatment for 30 min. This association confirms their enzyme substrate interaction following insulin treatmen t. Because all SR proteins have an RS domain and hence are potential sub strates of Akt2 kinase, we performed Western blot analysis using ASF/SF2 antibody on the Akt2 immunoprecipitates (Fig. 33 c). As expected, Akt2 associates with ASF/SF2, but this association is not enhanced by insulin treatment. This leads us to suggest that even though Akt2 kinase has the potential to phosphorylate the SR proteins, insulin regulates the Akt2 mediated phosphorylation only of specific SR proteins such as SRp40. Fibroblasts from Akt2 ( / ) Mice Do Not Phosphorylate SRp40 in Vivo [94] In humans, mutation in AKT2 is linked to severe insulin resistance and type 2 diabetes mellitus [98] Further, because the loss of Akt2 in mice is linked to the development of ty pe 2 diabetes and a reduction in insulin dependent glucose uptake [99, 100] we hypothesized that cells from these animals would be defective in insulin dependent phosphorylation of SRp40 and alternative splicing of PKC II when compared with wild type cells. Immortalized fibroblasts from wild type (+/+) or Akt2 deficient ( / ) mice were treated with insulin for 15 or 30 min or treated with vehicle (0 min), and cell lysates were separated on SDS PAGE. It was then anal yzed with mAb104 antibody, which detects the phosphoepitope of SR proteins, anti SRp40 antibody, or anti PKC II

PAGE 128

109 antibody. As seen in Fig. 34 insulin treatment increased the phosphorylation of SRp40 in wild type (+/+) cells, whereas the Akt2 deficient ( / ) cells did not show increased phosphorylation with insulin stimulation. The levels of SRp40 remained unaltered in both cell types. In Akt2( / ) cells, PKC II levels were less than one half of the levels noted in (+/+) cells. In Akt(+/+) cells, the PKC II levels represent the synthesis of new enzyme at 30 min as reported earlier for other cell types [82, 101] This provided genetic evidence that Akt2 deficiency resulted in a lack of increased phosphorylation of SRp4 0 following insulin treatment and resulted in reduced PKC II protein levels. Figu r e 3 4 Mouse fibroblasts from Akt2( / ) cells do not phosphorylate SRp40 in vivo upon insulin treatment Mouse embryonic fibroblasts derived from wild type (+/+) or Akt2 deficient ( / ) mice were treated with insulin for 0 (control), 15, or 30 min as indicated. a, cell lysates were separated on 12.5% SDS PAGE and analyzed with mAb104 antibody, which detects phospho epitopes of SR proteins. Akt2 deficient ( / ) samples do not show increase in phosphorylation of SRp40 upon insulin treat ment. b, the levels of SRp40 in the above samples remain unchanged in both the wild type (+/+) or Akt2( / ) cells upon insulin treatment. c, PKC II increased upon insulin treatment in wild type Akt2(+/+) cells, whereas Akt2 deficient ( / ) cells show decreased PKC II expression that remains unchanged upon insulin treatment. The experiments were repeated thrice to ensure reproducibility. Ab, antibo dy.

PAGE 129

110 Muscle Tissues from Akt2( / ) Mice Expressed Less PKC II mRNA [94] Gastrocnemius muscle tissues from 16 week old Akt2(+/+) and ( / ) mice [49] were examined for levels o f PKC I and PKC II mRNA by real time quantitative PCR. Results indicated a 54% decrease in the expression of PKC II in Akt2( / ) samples (Fig. 35 ), whereas PKC I mRNA levels remained unchanged in both (+/+) and ( / ) tissues, indicating a defect in exon in clusion. This is consistent with the 2 fold difference in proteins noted in fibroblasts. (Curves for the statistical analysis of the quantitative real time PCR using the (2 Ct ) method are not shown). Figu r e 35 Real time quantitative PCR shows decreased PKC II mRNA levels in Akt2( / ) cells. Gastrocnemius muscle tissues (n=4) from Akt2(+/+) and ( / ) mice were examined for levels of PKC I and PKC II mRNA by real time quantitative PCR. All of the measurements were made in triplicate. Results indi cated a 54% decrease in the expression of PKC II in Akt2( / ) samples.

PAGE 130

111 HeLa cell and HEK 293 cell nuclear extracts splice exon II to I in vitro Hormonally responsive splicing of PKC II by insulin in its target cells provides an efficient means of switching the expression of beta isoforms. Alternative pre mRNA splicing events are controlled by cis acting elements within the transcript. SR proteins interact with trans acting enhancers /silencers and regulate splice site utilization. Our in vivo experi ments identified SR p40 as the mediator of splice site selection via its phosphorylation by PI3 kinase regulated pathways [84] T h e minimum boundaries of RNA required for insulin responsive splicing were defined in a series of heterologous minigenes. Next, corresponding DNA templates for in vitro splicing were constructed using the minimum intronic sequences that supported in vivo splicing. The templates were used to synthesize transcripts that were labeled with 32 P a nd the labeled transcripts were used in splicing assays with HeLa and HEK 293 cell nuclear extracts. All templates represent the same pattern which is E xon I ntron E xon The sizes of the exons remain constant in all the templates while the size of the intro n varies. The upstream exon is always 201 bases long and represents exon betaII. The downstream exon is always 94 bases long and represents exon betaI. Thus, if the intron is fully excised it makes a spliced product of 295 bases. Here we show th e data from template FH 6 that generates a transcript of 573 bases with an intronic length of 278 bases. The 27 8 bases intron is a composite chimeric intron of the actual intron (~5,200 bases long) between exons betaII and betaI. All the composite chimeric introns con tain the same length (188 bases) of the intronic sequence upstream of exon betaI. What varies in each template is the intronic sequence downstream of exon betaII. Since t he FH 6 composite chimeric intron is 27 8 bases, and since the exon betaI upstream intro nic sequence is 188 bases, the varying

PAGE 131

112 intronic sequence downstream of exon betaII is 90 bases. The data in figure 36 show that exon betaII splices to exon betaI as expected. It appears that the ligation step of the two exons is not very efficient and it r esults in single exon products. Exon betaI appears shifted indicating that the particle holding exon betaI for the ligation step may be covalently attached to it. The data imply that b oth nuclear preparations supported spliceosome assembly as shown by nat ive non denaturing electrophoresis. Figu r e 36 In vitro splicing of exon betaII to exon betaI The FH 6 template represents a fused construct of exon betaII plus 9 0 bases of its downstream intronic sequence and exon betaI plus 188 bases of its upstream intr onic sequence. Besides the expected spliced product of 295 bases, t he splicing reaction generates single exons due to incompletion of the ligation step. The excised lariat runs a bit lower than its size because of its cyclic structure. The results indicate that HeLa and HEK 293 cell nuclear extracts have all the splicing factors needed to splice exon betaII to exon betaI. M: Molecular weight marker.

PAGE 132

113 In Vitro Splicing of exon II to I utilizes SSI and SSII In vivo we observed the utilization exon betaII when the cells were treated with insulin. We were wondering if the additional i n vitro Here we show the data from template FH4 that generates a transcript of 843 bases with an intronic length of 548 bases. T he FH4 composite chimeric intron contains a Figu r e 37 In Vitro Splicing of exon II to I can utilize SSI and SSII The FH4 template represents a fused construct of exon betaII plus 360 bases of its downstream intronic sequence and exon betaI plus 188 bases of its upstream intronic sequenc splice sites. The results indicate that HeLa and HEK 293 cell nuclear extracts have all the splicing factors needed to utilize SSI and SSII as been observed in vivo under insulin regulation.

PAGE 133

114 varying intronic sequence downstream of exon betaII of 360 bases. The FH4 tem plate 37 show that both SSI and SSII are utilized in vitro just as it has been observed in vivo under the regulation of insulin. The data imply that the nuclear extracts contain the necessary splicing factors to utilize both splice sites as it was observed in vivo The splicing reactions were always cleaned up with a spin column to purify the RNA products from all other components Then, most of the purified product was run on a non denaturing acrylamide gel. The remaining of the product was sometimes used in RT lice site SSII is utilized in in vitro o SSV in template FH2. Template FH2 is the longest template and it generates a transcript of 1661 bases that includes a composite chimeric intron of 1366 bases. As a result, the varying intronic sequence downstream of exon betaII is 1169 bases. The produc ts of in vitro transcription experiments and splicing assay s were used in RT PCR. In addition to running the PCR products on agarose gels to visualize the expected bands, we selected the best gels to excise the bands observed for gel purification. The gel purified PCR fragments were used in digestion reaction s to verify the content of the PCR fragment s In most gel purified products we measured the DNA concentration. We selected the best purified products and sent them for sequencing The sequencing results matched and verified the expected sequence s

PAGE 134

115 [41] mRNA. The last common exon of the C4 domain (exo codon within the a nuclear splicing factor [94] Figu r e 38 S terminal alternative exons. Ar rows indicate the mRNA. The primer set allows for simultaneous detection on). After serum starvation for 6 h, differentiated L6 myotubes were treated with TG003 (10 M) for 60 min prior to insulin addition (10 nM, 30 min). DMSO actin was amplified as an internal control. Clk/Sty inhibitor blocked insulin

PAGE 135

116 The notion that Clk/Sty might be involved in the insulin response was suggested mRNA requires phosphorylation of SR proteins [82] and Clk/Sty influences the activity of SR proteins [89, 102, 103] Our previous studies using a PKCII splicing minigene demonstrated that II exon inclusion is regulated by insulin and minigene exon inclusion was mimicked by Clk/Sty overexpression [81, 82, 84, 104] Here, the selective Clk/Sty inhibitor, TG003, was used to block its activity in L6 myot ubes to establish a role for the kinase in insulin action. TG003, a benzothiazole kinase inhibitor that targets Clk/Sty, is capable of suppressing dissociation of nuclear speckles, altering splicing patterns, and rescues embryonic defects induced by excess ive Clk activity [44] DMSO, the solvent control, did not affect PKC [44] also did not affect splicing (data not 38 ). This suggested that Clk/Sty was involved in the spl icing signal cascade. Cells overexpressing Clk/Sty increased exon 17 ( II exon) inclusion (Figure 3 9 ) and PKCII protein expression was also elevated in a ma nner similar to that of insulin When cells overexpressing Clk/Sty were treated with LY294002, a n inhibitor known to block Akt2 activation and Akt2 mediated exon inclusion [102] II exon inclusion was blocked sugg esting that Akt2 was acting upstream of Clk/Sty. exon and its flanking intronic sequences. To confirm the specificity of the Clk/Sty inhibitor, Clk/Sty and Akt2 siRNA were used to lower intracellular kinase levels in combinatio n and alone in the presence of insulin. Insulin induced inclusion of the

PAGE 136

117 >75% in the presence of either kinase siRNA alone (Figure 40 ). ith Clk/Sty also regulated by insulin [81] Only one protein is translated as there is a stop codon upstream of the first spl ice site. The longer mRNA is predicted to be more stable since it would not be subject to degradation [84] The inhibition of Clk/Sty and Akt2 blocked alternative exon inclusion and not merely splicing, since SD SA splicing (vector splice sites) was not affected. The possibility of Akt2 regulating Clk/Sty was examined since LY294002 blocked Clk induced II exon inclusion. Figu r e 39 Cells overexpressing Clk/S ty increased exon 17 ( II exon) inclusion Clk/Sty L6 myotubes were transfected with Clk/Sty cDNA expressing construct for 36 h and treated with insulin (10 nM, 30 min) in the prese nce or absence of LY294002 (10 M, 30 PCR as described in Figure 38. Cell lysates from duplicate plates were analyzed for protein levels PA GE. The graph is representative of multiple RT PCR analysis. Percent splicing efficiency is calculated as a ratio of

PAGE 137

118 Phospho rylation of Clk/Sty by Akt [41] Both serine and tyrosine phosphorylation of Clk/Sty are required for its full activation [89, 102, 103] However, the kinases regulating its a ctivity have not been identified. The possible phosphorylation and activation of Clk/Sty by PI3K/Akt2 and Src tyrosine kinases was examined in COS7 cells. COS7 cells are easily transfected and insulin signaling pathways have been demonstrated for them [105] COS7 cells were co transfected with Akt2 and Clk/Sty prior to treatment with LY294002 or PP1 (an inhibitor of Src kinases), and then stimulated with insulin. Clk/Sty immunoprecipitates were Figu r e 40 Clk/Sty and Akt2 siRNA block splicing of heterologous minigene L6 myotubes were co transfected with pSPL3 17 minigene Clk/Sty and/or Akt2 siRNA serum starvation, cells were treated with insulin (10 nM, 30 min). Total RNA was to the splice site donor SA: constitutive splicing of pSPL3 splicing vector which also serves as an internal control.

PAGE 138

119 analyzed by immunobl ot using an antibody that specifically detects phosphorylation of serines in the Akt substrate motif and with another antibody which detects phosphorylated tyrosine residues. Insulin stimulated both Akt motif serine and tyrosine phosphorylation of Clk/Sty (Figure 4 1 panels a and b), and the insulin stimulated phosphorylation was suppressed by the PI3K inhibito r, LY294002, and by the Src kinase inhibitor, PP1, respectively. Insulin is required to activate transfected Akt2 as in the absence of insulin, there is no Figu r e 41 Transiently expressed Clk/Sty was phosphorylated by Akt2 COS7 cell s were transiently transfected with Clk/Sty, Akt2 or pcDNA3 control vector constructs for 36 h with lipofectamine. After serum starvation for 6 h, cells were stimulated by insulin (10 nM, 30 min) and whole cell lysates were immunoprecipitated with anti Clk /Sty (IP: Clk1). The phosphorylation of tyrosine residues and Akt substrate serine residues on Clk/Sty was analyzed by Western blot using anti phospho tyrosine or anti phospho Akt substrate antibodies (top panels a and b). Whole cell lysates run on gels w ere probed for Clk1, Ha Akt2 and Actin (lower panels c d and e).

PAGE 139

120 phosphorylation of Clk (Figure 44 panels a b). It is also noted that there may be cross talk betwe en Akt and Src kinases since the Src inhibitor PP1 blocked phosphorylation on Akt motifs and LY294002 blocked phospho tyrosine phosphorylation. Insulin is known to activate Src in skeletal muscle [106] Hence, Clk /Sty was a substrate for Akt in vivo and insulin coordinated both serine and tyrosine phosphorylation of Clk/Sty. Since the Clk an tibody in Figure 41 immunoprecipitated both endogenous Clk/Sty as well as overexpressed Clk, we then examined whether endogenous Clk/Sty was phosphorylated on its Akt substrate motifs in L6 myotubes. Increased phosphorylation of endogenous Clk/Sty immunopr ecipitates was detected by the Akt substrate antibody and phosphorylation was blocked by LY294002 (Figure 4 2). Clk/Sty was a substrate for insulin activated Akt signaling in both transfected COS7 cells and in cultured L6 myotubes. Figu r e 42 Endogenous Clk/Sty was phosphorylated by Akt2 during insulin signaling L6 myotubes were serum starved, insulin stimulated, and lys ed (WCL); Clk/Sty was immunoprecipitated and analyzed for phosphorylation of Akt substrate serine residues as in figure 41 (lower panels). Phosphorylation of Akt induced by insulin was confirmed with phospho Akt 473 antibody (top panel).

PAGE 140

121 plice Site II switch in another PKC isoform (PKC ) We have seen that in the PKC gene, insulin regulates the inclusion of exon of exon betaII to the Here we demonstrate that the switch from the the 5 SSII of a specific exon occurs also on another isoform ( PKC ), of the PKC family and that the effector is not insulin but retinoic acid. Furthermore, the splicing factor involved in the alternative splicing was SC35 (SRp30b). We indicated earlier that the PKC gene contains 18 exons. In humans, t he standard size of exon 10 is 97 bases, and when included in the mature transcript, PKC I is expressed. Exon splice site (SSII) that extends its size by 93 Figu r e 4 3 Alternative splicing of human PKC g ene mRNA results in the by 93 bp in the V3 hinge region. All and intron lengths are indicated in the figure. SSI: 5' splice site I; SSII: 5' splice site II.

PAGE 141

122 bases for a total of 190 bases. When this extended si ze is included in the mature transcript, PKC 3 pre mRNA the 93 additional nucleotides result in 31 additional amino acids such that their inclusion disrupt the caspase 3 recognition sequence in the hinge region of Retinoic Acid regulates the expression of PKC VIII in neuronal cells Our previous st udy pro survival apoptosis. Further, we demonstrated that RA (24h) significantly increased the expression of [54] Figu r e 4 4 Retinoic Acid regulates the expression of PKC VIII PCR such that they span the exon exon boundaries. (b) Primary human neuronal cells from hippocampus were treated wit extracted and real time RTPCR analysis using SYBR green was performed in triplicates following 24 hours of RA treatment; ***, p<0.0001 (by two test).

PAGE 142

123 Here, we sought to extend our findings in primary neuronal cells derived from the adult hippocampus to demonstrate the expression p attern of RA. Total RNA was extracted from these primary neuronal cells treated with or without RA (24h). We performed quantitative, two step real time RT PCR using Syber (SYBR) Green technology [107 109] S YBR green method allows each transcript to be measured independently by using primer pairs that will amplify only that transcript. The primers were Figure 44 a Each transcript was normalized to the endogenous control, glyceraldehyde 3 phosphate dehydrogenase (GAPDH) to obtain absolute quantification. Here w e demonstrate d remain ed constant in the primary neuronal cells (Figure 4 4 b ). E xpression of PKC VIII in various tissues also regulated by RA Next, to establish the tissue tissue specific cDNAs (from Origene) were used in the RT PCR reaction using PK C VIII specific primers to determine its expression pattern. Our earlier studies in igure 45 ) compa red to other tissues tested (fetal testis, kidney, heart and spleen). These experiments demonstrate that adult and fetal brain.

PAGE 143

124 alternative splicing Alternative splicing is regulated by recruiting trans factors such as nuclear serine arginine rich (SR) proteins that bind to exonic or intronic splicing enhancers (ESE, ISE) on the pre mRNA. Hence, the elucidation of trans factors involved in RA mediated s were treated with or without RA (24 hours) and whole cell lysates were analyzed by western blot analysis using mAb104 antibody that simultaneously detects the phosphoepitopes on all SR proteins. Our results indicated that upon RA treatment, an SR protein at ~30kDa increased in expression (F igure 46 ). The family of SR splicing proteins includes SF2/ASF and SC35 whose molecular weight is about ~30 kDA (SF2/ASF is also known as SFRS1 or SRp30a, and SC35 is also known as SFRS2 or SRp30b ). Both of these F igure 45 Expression of PKC VIII in human fetal tissues Human fetal tissue spe specific primers as shown in schematic. (i) Spleen (ii) kidney (iii) heart (iv) testis (v) brain. 5% of products were separated on PAGE and detected by silver nitrate staining. Graph indicates ensitometric units normalized to GAPDH and is representative of mean SEM in 3 separate experiments.

PAGE 144

125 protei ns have been shown to function as splicing enhancers [110] Hence, antibodies specific to these individual SR proteins were used next. We observed an increase in SC35 res ponse to RA while SF2/ASF expression remained relatively constant (F igure 46 ). SC35 mimics RA expression levels, SC35 plasmid (from Orig ene) was transiently transfected into NT2 cells. SF2/ASF plasmid was used as a control and transfected in a separate well. Total RNA was extracted and RT PCR performed using human F igure 47 a ). An increase in levels in cells over expressing SC35 was observed (F igure 47 b ) while SF2/ASF transfected cells remained constant. GAPDH levels remained constant in all samples. In separate experiments, 2 F2/ASF was F igure 46 Detection of SR proteins involved in RA NT2 cells were treated with all 24 hours and western blot analysis was performed on whole cell lysates using (a) mAb104 antibody which detects all SR proteins and (b) specific antibodies as indicated in figure. Molecular weights are indicated (kDa). Gels are representative of three separate experiments and result s

PAGE 145

126 transfected in NT2 cells and western blot analysis was performed using antibodies as indicated in F igure 47 c. SC35 but not with over expression of SF2/ASF. F igure 47 SC35 and not SF2/ASF promote (a) Schematic of primer positions used in PCR amplification. These primers detect and RT PCR was separated by PAGE and silver stained for visualization. Graph represents percent exon les and is representative of mean SEM in three experiments. (c) Whole cell lysates were was performed using specific antibodies as indicated in the figure. The experi ments were repeated 3 times with similar results.

PAGE 146

127 To further determine the role of SC35, were transfected into NT2 cells to determine whether increased in direct proportion with increasin g amounts of SC35. Whole cell lysates were collected and western blot analysis was carried out using antibodies for and GAPDH (internal control). As seen in Figure 4 8 increase with increasing doses of SC35 comparable seen with RA treatment. F igure 48 dependent manner Increasing amounts of SC35 ( 0 Wester n blot analysis was performed on whole cell lysates using antibodies as indicated within the figure. Graph represents four experiments densitometric units normalized to GAPDH as mean SEM...

PAGE 147

128 SC35 knockdown dire siRNA specific for SC35 were transfected in increasing amounts (0 to 150 nM) into NT2 and 12444) along with its scrambled control, were used to validate specificity and eliminate off target knockdowns. Results indicated similar data with either SC35 siRNAs. Whole cell lysates were collected and western blot analysis was carried out using ntrol). As seen in Figure 49 representative of four individual experiments performed with either SC35 siRNA. The F igure 49 Increasing amounts of SC3 5 siRNA (0 to 150 nM) were transfected into NT2 cells. Scrambled siRNA was used as a control. Post transfection, cells were treated with or was performed using antibodies as indicated. Graph represents four experiments performed separately and expressed as mean SEM of densitometric units.

PAGE 148

129 above data confirms the involvement of nuclear SR splicing fact or SC35 in RA mediated Antisense oligonucleotides indicate a role of SC35 cis splicing Previous studies identified consensus sequences [87] for several cis elements present either in the exonic or intronic sequences of pre mRNA. These consensus sequences serve as a guideline to dissect and analyze putative cis elements in alternative splicing of pre mRNA. We combined a web [111] and also manually checked for published consensus sequences of cis mRNA to predict putative enhancer and silencer elements (Figure 50a) that could recruit trans To focus on identifying the cis elements involved in RA mediated oligonucleotides (ASO) (synthesized by Isis Pharmaceuticals, San Die go, CA) which are 2' methoxyethyl modified, RNAse H resistant were used. These ASOs inhibit binding of transfactors to their cis elements without disrupting the splicing event or degrading the mRNA [112, 113] We tr ansfected a series of 20mer ASOs which were designed according to predicted sites as depicted in f igure 50 a such that they sequentially spanned mRNA. Total RNA was isolated from ASO transfected and RA treated cells and RT PCR was performed. Only the ASO 81 transfection showed a did not affect the igure 50 b) shown here represent three experiments performed individually using the scrambled ASO as control, ASO 81

PAGE 149

130 ose proximity to ASO 81. F igure 50 Analysis of putative cis elements and an tisense oligonucleotides (ASO) (a) Schematic of ASOs relative to putative cis flanking 3' and 5' intronic 11 sequence. ASO ctrl: scrambled co ntrol ASO. SC35: SR SF2/ASF: SR protein SFRS1; SRp55: SR protein SFRS6; PTB: Pyrimidine tract binding protein; SSI: 5' splice site I; SSII: 5' splice site II. (b) ASOs were transfected into NT2 Gel represents experiments conducted with scrambled ASO, ASO 81 (corresponding to SC35 binding site) and ASO 80 which is in close proximity as ind icated in the lanes. Total RNA was extracted and RT (schematic shown in figure 44a ). 5% products were separated on PAGE and detected by alized to GAPDH and is representative of mean SEM in 3 separate experiments.

PAGE 150

131 These results demonstrated that ASO 81 inhibited RA alternative splicing. ASO 81 corresponded to the SC35 binding site as identified by ESE finder and further determined by its consensus sequence ggccaaag. This indicated the position of SC35 cis element mRNA. Construction of a heterologous pSPL3 splicing minigene which is responsive to RA Splicing minigenes are advantageous to identify cis el ements on the pre mRNA involved in regulated alternative splicing. Further, minigenes aid to correlate the binding of specific SR proteins to individual splicing events. Hence, to dissect the mechanism of RA ve splicing and analyze factors heterologous minigene was developed. Since the splice sites as determined previously [54] exon 10 was cloned in the multiple cloning site (MCS) between the splice donor (SD) and splice acceptor (SA) exons of pSPL3, a vector developed to study splicing events [114] as described in the methods section (schematic shown in F igure 51 response element (RARE) in its promoter regio n. The resulting minigene pSPL3 was confirmed using restriction digestion and sequencing. Minigene pSPL3 transfected into NT2 cells, cells were treated with RA (24h) and RT PCR performed on

PAGE 151

132 total RNA using SD SA primers. The empty vector pSPL 3 with the same modifications used for cloning the minigene, was transfected simultaneously in a separate well. The predicted products using SD SA primers are shown (F igure 51 b). RA increased inigene thereby F igure 51 mRNA exon 10 and flanking introns cloned into pSPL3 splicing vector between the splice donor (SD) and splice acceptor (SA) exons. position of primers used in RT PCR analysis. (b) After overnight transfection of pSPL3 L3 empty vector as control, NT2 cells were treated with or PCR performed using primers as described above. 5% of the products were separated by PAGE and silver stained for visualization. Expected pro ducts are SD SA: constitutive splicing; SSI: inclusion calculated as SS II/(SS II + SSI) X 100 in control and RA (24h) samples and is representative of three experim ents performed separately.

PAGE 152

133 SC35 promote d splicing minigene

PAGE 153

134 Next, we sought to determine if SC35 could increase the utilization of 5' splice mediated transfected along with th e pSPL3 transfected with pSPL3 PCR was performed on total RNA using exon 10 (sense) and SA (antisense) primers as shown (F igure 52 ). SC35 promoted thereby mimicking RA F igure 52 Co utilization of 5' splice site II. transfected along with the pSPL3 PCR performed using SD and SA primers as described in figure 7. 5% of the products were separated by PAGE and silver stai ned for visualization. SD SA: constitutive splicing; SSI: Usage of 5' splice site I; SSII: Usage of 5' splice site II. Graph represents percent exon inclusion calculated as SS II/(SS II + SSI) X 100 and is representative of three experiments performed sepa rately.

PAGE 154

135 Deletion analysis of the pSPL3 Figu r e 5 3 Deletion analysis of minigene demonstrates role of SC35 cis element on RA m mRNA exon 10 and deletions of the 5' intronic s equences which were cloned into pSPL3 vector. (b) Schematic of arrows indicating the position of primers on the minige nes. (c) The truncated minigenes were transfected into NT2 cells. After overnight transfection, NT2 cells were treated with or without RA for 24 h. Total RNA was extracted and RT exon 10 sense and SA antisense as d epicted in figure. 5% of the products were separated by PAGE and silver stained for visualization. SSI: Usage of 5' splice site I; SSII: Usage of 5' splice site II. Graphs represent percent exon inclusion calculated as SS II/(SS II + SSI) X 100 and is repr esentative of three experiments performed separately.

PAGE 155

136 To determine if any additional cis elements influencing RA 10 was splice site and the minimum defining sequences (the branch point and pyrimidine tract) were maintained in all constructs (Figure 5 3 a). The resulting minigenes were transfected experiments (Figure 5 3 b, c) demonstrated that RA was selection upon deletion of the intronic sequences containing the SC35 cis element. This influencing RA mRNA. This further demonstrates the involvement of SC35 in RA Mutation of SC35 binding site on the heterologous pSPL3 disrupt ed To establish that the b inding of SC35 to its cis mRNA was cis element was carried out. The SC35 site identified by its consensus sequence and ASO binding (figures 5 4 a,b) was mutated within t he pSPL3 mutated pSPL3 and RT PCR was performed on total RN exon 10 (sense) and SA in the pSPL3 4 a, b). This verified the interaction of

PAGE 156

137 ctivation and confirmed that RA mediates its Figu r e 5 4 ( a) Schematic indicating the position of the SC35 cis el splicing minigene. Arrows indicate the position of primers used in PCR analysis. (b) ne in separate for 24 h. Total RNA was extracted and RT exon 10 sense and SA antisense as shown in figure 9. 5% of the products were se parated by PAGE and silver stained for visualization. SSI: Usage of 5' splice site I; SSII: Usage of 5' splice site II. Graph represents percent exon inclusion calculated as SS II/(SS II + SSI) X 100 and is representative of three experiments performed sep arately.

PAGE 157

138 D ISCUSSION In this study w e focused on two PKC genes, namely PKC and PKC and we showed that the splicing of PKC is regulated by insulin and mediated by SRp40, while the splicing of PKC is regulated by retinoic acid and mediated by SRp30b. W hile SR proteins play a key role in alternative splicing, the SR proteins are also linked to pathways regulated by hormonal or metabolic stimuli Studies have shown that alternative splicing is sometimes tissue specific or developmentally specific [115] Since alternative splicing can be regulated by a signal transduction pat hway some splice variants can become excellent targets for gene therapy [116] The alternative splicing of the PKC gene is unique in that exon II in its downs tream intronic sequence contains cis element that interacts with SRp40, but we hypothesize that there are more cis elements that may interact with one or more SR proteins (including SRp40). By using hetero logous minigene s, we were able to show that insulin regulates the inclusion of exon II and the sites in five distinct cell types: skeletal muscle, vascular smooth muscle cells, hepatoma cells, pre adipocytes and fibrobl asts. In addition to verifying the insulin regulation of the PKC gene, t he d e letion series of the heterologous minigene s pSPL3 18, 19, 20 and 22 pinpointed the locus of the cis element involved in the alternative splicing of SSI and SSII of PKC II. Using additional methods, we showed that insulin regulates those splice sites through mediation

PAGE 158

139 with SRp40 Through in vitro transcription and splicing assays we identified up to four II. We have left the task of e lucidat ing the binding mechanisms and/or any cis SSIII, SSIV and SSV for the future. Our studies also showed that the insulin regulated splice site selection is facilitated via the PI3 kinase phosphoryla tion pathway route of the insulin s ignal transduction pathway In our model, Akt2 and Clk/Sty become phosphorylated via the PI3 kinase pathway which in turn phosphorylates SR proteins that mediate splice site utilization. The phosphorylation of SR proteins by Akt2 and Clk/Sty highlight s the importance of phosphorylation cascades in alternative splicing. Unlike the classical models of developmental and tissue specific alternative splicing the insulin regulation of the PKC II alternative splicing introduces a novel approach for regulated splicing In this scenario, in cell lines/tissues expressing the insulin receptor, a hormone whose levels change dramatically in response to glucose is shown to regulate exon inclusion For endogenous alternative splicing, ou r lab had shown that i nsulin addition to skeletal muscle cells results in the rapid post transcriptional processing of the PKC pre mRNA transcript resulting in the inclusion of an exon that encodes PKC II mRNA [32] The expression of PKC II in skeletal muscle cells has also shown to result in increased glucose transport activity [35, 82] In attempting to elucidat e the signaling pathway associate d w ith alternative splicing of PKC II, we employed first the overexpress ion of SRp40 Previous studies had shown that SRp40 was the phosphorylation state of the protein rather than its cellu lar levels was the crucial

PAGE 159

140 factor in its function [84] Since PI3 kinase modulated the phosphorylation state of SRp40 we hypothesized that Akt could act as an SR kinase We further conjectured that insulin modulati on of the Akt phosphorylation activity was responsible for regulating exon inclusion (perhaps in part if not fully) Transfection of cells with a tagged Akt2 adenovirus construct allowed for the identification of phosphorylated SRp40 in cells endogenously labeled with [ 32 P]orthophosphate. This protein is highly phosphorylated in its endogenous state, and the overexpression of Akt2 resulted in a 2.5 fold increase in the incorporation of 32 P into the immunoprecipitated protein. Insulin, an activator of Akt2 a nd other potential SR kinases, increased its phosphorylation by 3 fold. Insulin may also increase the phosphorylation of SRp40 via kinases such as PKC in addition to Akt. PKC is another potential SR kinase that is modulated during insulin signaling by a PI 3 kinase dependent mechanism. Further, SR kinases such as Clk/Sty may also phosphorylate SRp40 [52, 117] independent of Akt2 kinase. The phosphorylation of SR proteins most likely facilitates their recruitment to n uclear speckles where they are likely to interact with other spliceosomal proteins [118] Although it has not been directly tested, the current view is that a ll Akt/PKB isoforms are thought to have similar substrate specificity. Akt2 expression is the highest in insulin responsive tissues, including liver, brown fat, and skeletal muscle, sugges ting its importance in insulin signaling. The involvement of insulin activated Akt isozymes in mRNA splicing is predicted because SR proteins contain multiple Akt phosphorylation consensus sequences, RXRXX(S/T) [119] within their C terminal RS domain. SR proteins are optimal substrates for Akt in vitro when solid phase phosphorylation

PAGE 160

141 screening identified several spliceosomal proteins [49] Some of these proteins have more than 20 possible Akt phosphorylation motifs in their protein sequences. The present study demonstrated that Akt2 phosphorylated a specific site within SRp40. Mutation of this site further attenuat ed PKC II exon inclusion and splice site activation. The precise role of SRp40 has not been defined in insulin regulated splice site selection, but antisense oligonucleotides that block the interaction of the SR protein with the RNA binding domain demonstr ated its requirement for insulin action in L6 myotubes because the antisense also blocked insulin effects on glucose uptake [84] and overexpression of the protein, also shown here, mimicked insulin effects on splic ing of PKC II mRNA. In fibroblasts derived from Akt2( / ) mice, phosphorylation of SRp40, splicing of PKC II and insulin induced increases were not detected. Muscle tissue from Akt2( / ) mice also expressed lower levels of PKC II mRNA, whereas PKC I level s remained unchanged. These tissues are also insulin resistant [120] Hence the phosphorylation state of SR proteins may be important in the development of type 2 diabetes. It is interesting that muscle tissues from diabetic patients was shown to express lower levels of splicing factors, many of which are alternatively spliced [121] In this study we have been able to link Akt2 activation by a hormone, such as insulin, to a specific SR protein that regulates the splicing of an mRNA variant with functional consequences in the action of the hormone. Our study provides a means of relating Akt to nuclear functions that sustain insulin signaling pathways post transcriptional ly. It had been previously shown that Clk/Sty is a dual specificity kinase that mostly phosphorylate s the serine residues of SR protein splicing factors [50, 51, 89, 102, 103, 122] The degree to which Clk/Sty phosp horylates the RS domain of SR proteins alters

PAGE 161

142 their activity and sub cellular localization [89, 102, 103] Therefore, we sought to elucidate the mechanism by which Clk/Sty itself is regulated. Examination of Clk/Sty protein disclosed prominent phosphorylations on both serine/threonine and tyrosine residues [50] leading us to question whether it is regulated by any other serine/threonine kinase in addition to autophosphorylati on. In this study, we determined that Clk/Sty was regulated by a PI3K/Akt2 kinase pathway in vivo based on a number of criteria. Our results showed that Akt2 and Clk/Sty kinases were significant for insulin ier work indicated that over [81] In the present study w e found that insulin splicing was inhibi ted by Clk/Sty and Akt2 siRNA as well as by TG003, a specific Clk/Sty inhibitor, which further indicated that Clk/Sty was involved in insulin signaling. Because Clk1 stimulated splicing was blocked by LY294002 this suggest ed that an upstream kinase was probably involved in the process. Additional work by the Cooper lab related to this study identified SRp75, SRp55 and SRp30b/SC35 as Clk/Sty substrates using various criteria including siRNA in addition to a specific Clk inhibitor to differentiate Clk phos phorylation from Akt phosphorylation in immunoprecipitated SR proteins. That study also revealed that insulin induced Clk/Sty mediated regulation of SR proteins was distinct from serum induced Clk/Sty regulation. In our study, t o ascertain if Akt2 and Clk/ Sty regulation of phosphorylation and resulting activation of SR splicing factors was a universal phenomenon, we showed that SR proteins are also substrates for Akt2 regulated Clk/Sty activation. It was also show n that the also involved

PAGE 162

143 in the regulation of SRp75 phosphorylation induced by serum, and there was also a requirement for PI3K/Akt2 in Clk/Sty phosphorylation of SRp30b/SC35 where SRp30b/SC35 appeared to be a less preferred substrate for Clk/Sty during insulin activ ation but a more robust substrate with serum conditions. The combined studies indicated that insulin regulation of splicing was best demonstrated following serum starvation and that the results suggest that this serum pathway wa s distinct from the one utilized by insulin. In our model w e surmised that Akt2 phosphorylated Clk/Sty, activating Clk/Sty stimulation. Furthermore, our observations that SR protein phosphorylation depends on PI3K are supported by a recent finding that SRp55, SRp40 and SC35 phosphorylation was decreased by wortmannin, another inhibitor of PI3K, in anti IgM receptor induced splicing of BPV 1 pre mRNAs in an ASF/SF2 depleted B cell line DT40 [123] At this juncture we further hypothesize d that the PI3K/Akt2 pathway may regulate different kinases involved in SR protein phosphorylation and splicing complexes such as PKC or SRPK, since in sulin initiated pathway is distinctive from the one utilized by serum in regulating SR proteins. Other studies have shown that Akt modulates gene expression via regulation of gene transcription by phosphorylating CREB and forkhead transcription factors [124, 125] In contrast the role(s) and the control of signaling by Akt in splicing regulation had not been clearly characterize d. Multiple Akt substrate consensus motifs exist in the C terminal Arg/Ser domains of al l the SR proteins [49, 94, 126] Our combined studies revealed t hat Akt phosphorylates these consensus sequences in multiple SR proteins

PAGE 163

144 (SRp75, SRp55 and SRp30b). A recent report has provided both in vivo and in vi tro evidence for Akt mediated modification of SR proteins SF2/ASF and 9G8 by direct phosphorylation [126] Akt associates with and phosphorylates YB 1, a n RNA binding protein involved in regulation of mRNA transcrip tion, splicing and translation [127] Thus far we have provided biochemical and genetic evidence showing that Akt2 also phosphorylates Clk/Sty, and have identifi ed a new role played by Akt2: regulation of alternative splicing and gene expression via simultaneously modulating Clk/Sty kinases and specific SR splicing factors. Identification of such a dual regulation demonstrated a new category of controlling pre mRN A splicing and gene expression initiated by extracellular signaling. Our combined studies suggest that multiple stimuli regulate SR proteins through the PI3K/Akt2 signaling pathway As summarized in Figure 55 the signaling linkage F igure 55 pre mRNA alternative splicing [41] Proposed dual role of Akt2 and Clk/Sty in mediating insulin induced pre mRNA splicing and gene expression via networked phosphorylation of SR proteins

PAGE 164

145 implies that PI3K/Akt2 is pivotal in mediating pre mRNA splicing and gene expression through inducing a sophisticated phosphorylation network that acts on Clk/Sty and SR proteins. Whether other SR protein kinases such as SRPK2 [42, 128] function similarly under Akt2 regulation is under investigation. The hierarchy of SR protein phosphorylation sites is also questioned. Clk and Akt are both nuclear kinases and whether Clk primes SR proteins for Akt phosphorylation is currently unknown. Pr evious alterations in glucose uptake in multiple systems [32, 35, 95, 129, 130] variants differ in their binding to F stimulated actin rearrangements [131] Since tissues from Akt2 null mice with early stages of type 2 diabetes had impaired Clk/Sty activat ion, reduced SR protein predisposition for Type 2 diabetes, in the signaling pathways of insulin actio n. It was indicated earlier that the Patel lab had recently identified a new splice that this human splice variant is generated by utilization of an alternative downstream 5' sp mRNA exon 10 [54] Thus far it was established that exon I (exon 17) of PKC and exon under certain conditions. We showed that in P KC the regulation is under insulin and mediated through SRp40, while in PKC the regulation is through RA and mediated through SRp30b (SC35).

PAGE 165

146 Vitamin A, an important micro nutrient and its active metabolite all trans retinoic acid (RA) influence a br oad range of physiological and pathological processes both in embryonic central nervous system ( CNS ) as well as in the mature brain. It is well established that RA directly affects transcription of genes. Here we demonstrat ed that RA also regulates alterna tive splicing of genes. An important mechanism of regulating gene expression is alternative splicing which expands the coding capacity of a single gene to produce different proteins with distinct functions [132] It is now established that close to 76 % of human genes undergo alternative splicing and encode for at least two isofo rms. Divergence observed in gene expression due to alternative splicing may be tissue specific [133, 134] developmentally regulated [135, 136] or hormonally regulated [84, 137] During constitutive exon splicing, a dynamic process involving the spliceosome assembly joins the 5 and 3 splice sites that define the exon intron boundary by the interplay of small nuclear riboproteins (snRNPs) and other associate d proteins with the pre mRNA sequences [138] Alternative splicing can occur through various mechanisms such as exon skipping, exon inclusion, alternative 3 splice site usage, alternative 5 splice site usage, or alternative polyadenylation site usage. The spliceosome catalyzes the pre mRNA splicing reaction within a large multicomponent ribonucleoprotein complex. This complex comprises of small nuclear RNAs ( snRNAs) and associated proteins (such as SR proteins). The information present in the canonical splicing signals that define exon intron boundaries is not sufficient for correct assembly of the spliceosome for pre mRNA splicing. Additional signals exist in the pre mRNA as auxiliary cis elements that recruit trans acting factors to promote splicing. The regulation of alternative splicing is often the

PAGE 166

147 result of dynamic antagonism between trans acting factors binding to these cis elements [1 11] Defective alternative splicing causes a large number of diseases [116, 139, 140] Exonic or intronic splicing enhancers (ESE, ISE) often bind the serine arginine rich nuclear factors SR proteins to promote the choice of splice sites in the pre mRNA. SR proteins belong to the class of proteins associated with small nuclear RNAs called the snRNPs. Members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family and polypyrimidine tract binding protein (P TB) bind to exon/intron splicing silencers (ESS, ISS) to function as splicing repressors. Further, specific cellular stimuli can favor the binding of certain trans factors over others, thereby changing the splicing pattern. Hence, the elucidation of the tr ans factors involved in alternative splicing is of critical importance. SC35 also known as SFRS2 or SRp30b, is a member of the nuclear s erine arginine r ich (SR) splicing proteins family and functions as a splicing enhancer [141] SC35 has an N terminal RNA recognition motif (RRM) domain and a C terminal arginine/serine rich (RS) domain. The RRM domain interacts and bin ds to the target pre mRNA while the RS domain is highly phosphorylated and suggested to be the protein interaction region. SC35 along with other splicing factors, kinases and phosphatases reside in the splicing factor compartments within the nucleoplasm. S C35 has been shown to be involved in pathways that regulate genomic stability and cell proliferation during mammalian organogenesis [142] It plays a role in T cell development and alternative splicing of CD45 [143] SC35 is involved in aberran t splicing of tau exon 10 in [144] as well as in splicing of neuronal acetylcholinesterase mRNA [145] Our data demonstrated that SC35 enhance d the splicing of a pro survival protein, possible that the phosphorylation state of SC35 may further

PAGE 167

148 mRNA though inhibitors of several signaling pathways did not affect RA Phosphorylation of SR proteins may result in their di fferential distribution to alternate sites. Splicing factors are phosphorylated on their RS domain and the phosphorylation state (hypo or hyper ) may also affect splice site selection. RA treatment alters expression of genes associated with early stages of neuronal differentiation [146] Neurogenesis in the adult brain came to limelight in the early 1990s. The birt h of new neurons, outgrowth of neurites and formation of synapses are documented in the adult CNS. RA regulates neural development as well as its plasticity and promotes neurogenesis and increases survival [147] Alternative pre mRNA splicing in neurons is now considered to be a central phenomenon in development, evolution and survival of neurons [148] Previously we demonstrated that RA regulates alternative splicing of pro and anti [149] RA also changes the splicing pattern of the co activator CaAA as well as of the delta isoform of CaM kinase in P19 embryonal carcinoma stem cells during RA induced differentiation [150, 151] However, t he mechan ism of RA induced alternative splicing of genes has not yet been elucidated. We demonstrate here that the splicing factor, SC35 plays a crucial role in signals and regulates gen e expression thereby increasing the expression of the pro neurodegenerative diseases. To our knowledge, this is the first report elucidating the mechanisms of altern ative splicing regulated by RA.

PAGE 168

149 We have shown that the splicing of PKC is regulated by insulin while the splicing of PKC is regulated by RA. Even though the regulation may involve the same or different signaling pathway, the final splice variants are med iated by SR proteins; SRp40 in PKC and SRp30b in PKC Both genes display alternative splicing that The construction of heterologous minigenes and the deletion series of these minigenes is a unique tool that enabled us to demonstrate and/or verify the alternative splicing patterns involved and enabled us to elucidate and/or verify the cis elements interacting with the mediating SR proteins. The in vitro studies corroborated the minigene studies and provided further evid ence in the alternative splicing patterns involved.

PAGE 169

150 REFERENCES 1. Vihma, H., P. Pruunsild, and T. Timmusk, Alternative splicing and expression of human and mouse NFAT genes. Genomics, 2008. 92 (5): p. 279 91. 2. House, A.E. and K.W. L ynch, Regulation of alternative splicing: more than just the ABCs. J Biol Chem, 2008. 283 (3): p. 1217 21. 3. Clamp, M., et al., Distinguishing protein coding and noncoding genes in the human genome. Proc Natl Acad Sci U S A, 2007. 104 (49): p. 19428 33. 4. Black, D.L., Protein diversity from alternative splicing: a challenge for bioinformatics and post genome biology. Cell, 2000. 103 (3): p. 367 70. 5. Cooper, T.A., Use of minigene systems to dissect alternative splicing elements. Methods, 2005. 37 (4): p. 331 40. 6. Schmucker, D., et al., Drosophila Dscam is an axon guidance receptor exhibiting extraordinary molecular diversity. Cell, 2000. 101 (6): p. 671 84. 7. Johnson, J.M., et al., Genome wide survey of human alternative pre mRNA splicing with exon junction microarrays. Science, 2003. 302 (5653): p. 2141 4. 8. Graveley, B.R., Sorting out the complexity of SR protein functions. RNA, 2000. 6 (9): p. 1197 211. 9. Shepard, P.J. and K.J. Hertel, The SR protein family. Genome Biol, 2009. 10 (10): p. 242. 10. Stoltzfu s, C.M. and J.M. Madsen, Role of viral splicing elements and cellular RNA binding proteins in regulation of HIV 1 alternative RNA splicing. Curr HIV Res, 2006. 4 (1): p. 43 55. 11. Churbanov, A., et al., Method of predicting splice sites based on signal int eractions. Biol Direct, 2006. 1 : p. 10. 12. Lodish, H.F., Molecular cell biology 4th ed. 2000, New York: W.H. Freeman. xxxvi, 1084, G 17, I 36 p. General Collection 2002 A 790; Internet Electronic link: see Bookshelf via NCBI. 13. Romfo, C.M. and J.A. Wise, Both the polypyrimidine tract and the 3' splice site function prior to the first step of splicing in fission yeast. Nucleic Acids Res, 1997. 25 (22): p. 4658 65. 14. Singh, R., RNA protein interactions that regulate pre mRNA splicing. Gene Ex pr, 2002. 10 (1 2): p. 79 92.

PAGE 170

151 15. Cooper, G.M., The cell : a molecular approach 2nd ed. 2000, Washington, D.C.: ASM Press ; Sinauer Associates. xxiv, 689 p. General Collection 2000 I 914; Internet Electronic link: NCBI Bookshelf: http://www.ncbi.nlm.nih.gov/books/ 16. Proudfoot, N., Connecting transcription to messenger RNA processing. Trends Biochem Sci, 2000. 25 (6): p. 290 3. 17. Brown, T.A., Genomes 2nd ed. 2002, Oxford New York: Wiley Liss. xxvii, 57 2 p. General Collection 2002 J 744; Internet Electronic link: NCBI Bookshelf. 18. Guo, Z. and F. Sherman, 3' end forming signals of yeast mRNA. Trends Biochem Sci, 1996. 21 (12): p. 477 81. 19. Barreau, C., L. Paillard, and H.B. Osborne, AU rich elements an d associated factors: are there unifying principles? Nucleic Acids Res, 2005. 33 (22): p. 7138 50. 20. Radford, H.E., H.A. Meijer, and C.H. de Moor, Translational control by cytoplasmic polyadenylation in Xenopus oocytes. Biochim Biophys Acta, 2008. 1779 (4) : p. 217 29. 21. Strachan, T. and A.P. Read, Human molecular genetics 2 2nd ed. 1999, New York: Wiley Liss. xxiii, 576 p. General Collection 2000 C 080; Internet Electronic link: see Bookshelf via NCBI. 22. McKeown, M., Alternative mRNA splicing. Annu Rev Cell Biol, 1992. 8 : p. 133 55. 23. Alberts, B., Molecular biology of the cell 4th ed. 2002, New York: Garland Science. xxxiv, 1463, [86] p. General Collection 2002 H 410, Internet Electronic link: see Bookshelf via NCBI. 24. Wente, S.R., Gatekeepers of t he nucleus. Science, 2000. 288 (5470): p. 1374 7. 25. Nigg, E.A., Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature, 1997. 386 (6627): p. 779 87. 26. Weis, K., Importins and exportins: how to get in and out of the nucleus. Trends Bioche m Sci, 1998. 23 (5): p. 185 9. 27. Snee, M., et al., RNA trafficking and stabilization elements associate with multiple brain proteins. J Cell Sci, 2002. 115 (Pt 23): p. 4661 9. 28. Keys, R.A. and M.R. Green, Gene expression. The odd coupling. Nature, 2001. 413 (6856): p. 583, 585. 29. Kozak, M., Interpreting cDNA sequences: some insights from studies on translation. Mamm Genome, 1996. 7 (8): p. 563 74. 30. Sampson, S.R. and D.R. Cooper, Specific protein kinase C isoforms as transducers and modulators of insuli n signaling. Mol Genet Metab, 2006. 89 (1 2): p. 32 47. 31. Nishizuka, Y., Studies and prospectives of the protein kinase c family for cellular regulation. Cancer, 1989. 63 (10): p. 1892 903. 32. Chalfant, C.E., et al., Regulation of alternative splicing of protein kinase C beta by insulin. J Biol Chem, 1995. 270 (22): p. 13326 32.

PAGE 171

152 33. Ono, Y., et al., Expression and properties of two types of protein kinase C: alternative splicing from a single gene. Science, 1987. 236 (4805): p. 1116 20. 34. Ono, Y., et al., Cloning of rat brain protein kinase C complementary DNA. FEBS Lett, 1986. 203 (2): p. 111 5. 35. Chalfant, C.E., et al., A carboxy terminal deletion mutant of protein kinase C beta II inhibits insulin stimulated 2 deoxyglucose uptake in L6 rat skeletal musc le cells. Mol Endocrinol, 1996. 10 (10): p. 1273 81. 36. Yamamoto, M., et al., The roles of protein kinase C beta I and beta II in vascular smooth muscle cell proliferation. Exp Cell Res, 1998. 240 (2): p. 349 58. 37. Yamamoto, M., et al., Acute glucose indu ced downregulation of PKC betaII accelerates cultured VSMC proliferation. Am J Physiol Cell Physiol, 2000. 279 (3): p. C587 95. 38. Pillay, T.S., et al., Regulation of the insulin receptor by protein kinase C isoenzymes: preferential interaction with beta i soenzymes and interaction with the catalytic domain of betaII. Cell Signal, 2004. 16 (1): p. 97 104. 39. Du, K., et al., HRS/SRp40 mediated inclusion of the fibronectin EIIIB exon, a possible cause of increased EIIIB expression in proliferating liver. Mol C ell Biol, 1997. 17 (7): p. 4096 104. 40. Stamm, S., et al., Regulation of the neuron specific exon of clathrin light chain B. Brain Res Mol Brain Res, 1999. 64 (1): p. 108 18. 41. Jiang, K., et al., Akt2 regulation of Cdc2 like kinases (Clk/Sty), serine/argi nine rich (SR) protein phosphorylation, and insulin induced alternative splicing of PKCbetaII messenger ribonucleic acid. Endocrinology, 2009. 150 (5): p. 2087 97. 42. Umehara, H., et al., Effect of cisplatin treatment on speckled distribution of a serine/a rginine rich nuclear protein CROP/Luc7A. Biochem Biophys Res Commun, 2003. 301 (2): p. 324 9. 43. Roth, M.B., C. Murphy, and J.G. Gall, A monoclonal antibody that recognizes a phosphorylated epitope stains lampbrush chromosome loops and small granules in th e amphibian germinal vesicle. J Cell Biol, 1990. 111 (6 Pt 1): p. 2217 23. 44. Hagiwara, M., Alternative splicing: a new drug target of the post genome era. Biochim Biophys Acta, 2005. 1754 (1 2): p. 324 31. 45. Kosaki, A., J. Nelson, and N.J. Webster, Ident ification of intron and exon sequences involved in alternative splicing of insulin receptor pre mRNA. J Biol Chem, 1998. 273 (17): p. 10331 7. 46. Shifrin, V.I. and B.G. Neel, Growth factor inducible alternative splicing of nontransmembrane phosphotyrosine phosphatase PTP 1B pre mRNA. J Biol Chem, 1993. 268 (34): p. 25376 84. 47. Cote, G.J., et al., Sequence requirements for regulated RNA splicing of the human fibroblast growth factor receptor 1 alpha exon. J Biol Chem, 1997. 272 (2): p. 1054 60.

PAGE 172

153 48. Collins, F.S., M. Morgan, and A. Patrinos, The Human Genome Project: lessons from large scale biology. Science, 2003. 300 (5617): p. 286 90. 49. Obata, T., et al., Peptide and protein library screening defines optimal substrate motifs for AKT/PKB. J Biol Chem, 2000. 275 (46): p. 36108 15. 50. Lee, K., et al., Activity and autophosphorylation of LAMMER protein kinases. J Biol Chem, 1996. 271 (44): p. 27299 303. 51. Nayler, O., S. Stamm, and A. Ullrich, Characterization and comparison of four serine and arginine rich (S R) protein kinases. Biochem J, 1997. 326 ( Pt 3) : p. 693 700. 52. Colwill, K., et al., The Clk/Sty protein kinase phosphorylates SR splicing factors and regulates their intranuclear distribution. EMBO J, 1996. 15 (2): p. 265 75. 53. Hanes, J., et al., Chara cterization by cDNA cloning of two new human protein kinases. Evidence by sequence comparison of a new family of mammalian protein kinases. J Mol Biol, 1994. 244 (5): p. 665 72. 54. Jiang, K., et al., Identification of a novel antiapoptotic human protein ki nase C delta isoform, PKCdeltaVIII in NT2 cells. Biochemistry, 2008. 47 (2): p. 787 97. 55. Sakurai, Y., et al., Novel protein kinase C delta isoform insensitive to caspase 3. Biol Pharm Bull, 2001. 24 (9): p. 973 7. 56. Ueyama, T., et al., cDNA cloning of a n alternative splicing variant of protein kinase C delta (PKC deltaIII), a new truncated form of PKCdelta, in rats. Biochem Biophys Res Commun, 2000. 269 (2): p. 557 63. 57. Kielbassa, K., et al., Protein kinase C delta specific phosphorylation of the elong ation factor eEF alpha and an eEF 1 alpha peptide at threonine 431. J Biol Chem, 1995. 270 (11): p. 6156 62. 58. Kumar, V., et al., Functional interaction between RAFT1/FRAP/mTOR and protein kinase cdelta in the regulation of cap dependent initiation of tra nslation. EMBO J, 2000. 19 (5): p. 1087 97. 59. Novotny Diermayr, V., et al., Protein kinase C delta associates with the interleukin 6 receptor subunit glycoprotein (gp) 130 via Stat3 and enhances Stat3 gp130 interaction. J Biol Chem, 2002. 277 (51): p. 4913 4 42. 60. Yuan, L.W., J.W. Soh, and I.B. Weinstein, Inhibition of histone acetyltransferase function of p300 by PKCdelta. Biochim Biophys Acta, 2002. 1592 (2): p. 205 11. 61. Liu, J., et al., NF kappaB is required for UV induced JNK activation via induction of PKCdelta. Mol Cell, 2006. 21 (4): p. 467 80. 62. Gorelik, G., et al., Impaired T cell protein kinase C delta activation decreases ERK pathway signaling in idiopathic and hydralazine induced lupus. J Immunol, 2007. 179 (8): p. 5553 63. 63. Yoshida, K., et al., Protein kinase Cdelta is responsible for constitutive and DNA damage induced phosphorylation of Rad9. EMBO J, 2003. 22 (6): p. 1431 41. 64. Voss, O.H., et al., Regulation of monocyte apoptosis by the protein kinase Cdelta dependent phosphorylation of caspase 3. J Biol Chem, 2005. 280 (17): p. 17371 9.

PAGE 173

154 65. Yoshida, K., H. Liu, and Y. Miki, Protein kinase C delta regulates Ser46 phosphorylation of p53 tumor suppressor in the apoptotic response to DNA damage. J Biol Chem, 2006. 281 (9): p. 5734 40. 66. Shir ai, Y. and N. Saito, Activation mechanisms of protein kinase C: maturation, catalytic activation, and targeting. J Biochem, 2002. 132 (5): p. 663 8. 67. Nishizuka, Y., Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C Science, 1992. 258 (5082): p. 607 14. 68. Newton, A.C., Protein kinase C: structural and spatial regulation by phosphorylation, cofactors, and macromolecular interactions. Chem Rev, 2001. 101 (8): p. 2353 64. 69. Dey, D., et al., Involvement of novel PKC i soforms in FFA induced defects in insulin signaling. Mol Cell Endocrinol, 2006. 246 (1 2): p. 60 4. 70. Eitel, K., et al., Protein kinase C delta activation and translocation to the nucleus are required for fatty acid induced apoptosis of insulin secreting cells. Diabetes, 2003. 52 (4): p. 991 7. 71. Lin, W.W., S.H. Chang, and S.M. Wang, Roles of atypical protein kinase C in lysophosphatidic acid induced type II adenylyl cyclase activation in RAW 264.7 macrophages. Br J Pharmacol, 1999. 128 (6): p. 1189 98. 72 Seewald, S., et al., Lysophosphatidic acid stimulates protein kinase C isoforms alpha, beta, epsilon, and zeta in a pertussis toxin sensitive pathway in vascular smooth muscle cells. Am J Hypertens, 1999. 12 (5): p. 532 7. 73. Scott, G.A., M. Arioka, and S.E. Jacobs, Lysophosphatidylcholine mediates melanocyte dendricity through PKCzeta activation. J Invest Dermatol, 2007. 127 (3): p. 668 75. 74. Chaudhuri, P., et al., Protein kinase Cdelta dependent phosphorylation of syndecan 4 regulates cell migration. C irc Res, 2005. 97 (7): p. 674 81. 75. Pulinilkunnil, T., et al., Palmitoyl lysophosphatidylcholine mediated mobilization of LPL to the coronary luminal surface requires PKC activation. J Mol Cell Cardiol, 2004. 37 (5): p. 931 8. 76. Konishi, H., et al., Acti vation of protein kinase C by tyrosine phosphorylation in response to H2O2. Proc Natl Acad Sci U S A, 1997. 94 (21): p. 11233 7. 77. Mackay, H.J. and C.J. Twelves, Targeting the protein kinase C family: are we there yet? Nat Rev Cancer, 2007. 7 (7): p. 554 6 2. 78. Ruboxistaurin: LY 333531. Drugs R D, 2007. 8 (3): p. 193 9. 79. Ishii, H., et al., Amelioration of vascular dysfunctions in diabetic rats by an oral PKC beta inhibitor. Science, 1996. 272 (5262): p. 728 31. 80. Sone, H., B.K. Deo, and A.K. Kumagai, En hancement of glucose transport by vascular endothelial growth factor in retinal endothelial cells. Invest Ophthalmol Vis Sci, 2000. 41 (7): p. 1876 84.

PAGE 174

155 81. Patel, N.A., et al., Insulin regulates protein kinase CbetaII alternative splicing in multiple target tissues: development of a hormonally responsive heterologous minigene. Mol Endocrinol, 2004. 18 (4): p. 899 911. 82. Chalfant, C.E., et al., Insulin regulates protein kinase CbetaII expression through enhanced exon inclusion in L6 skeletal muscle cells. A novel mechanism of insulin and insulin like growth factor i induced 5' splice site selection. J Biol Chem, 1998. 273 (2): p. 910 6. 83. Patel, N.A., et al., Acute hyperglycemia regulates transcription and posttranscriptional stability of PKCbetaII mRNA in vascular smooth muscle cells. FASEB J, 1999. 13 (1): p. 103 13. 84. Patel, N.A., et al., Insulin regulates alternative splicing of protein kinase C beta II through a phosphatidylinositol 3 kinase dependent pathway involving the nuclear serine/arginine rich splicing factor, SRp40, in skeletal muscle cells. J Biol Chem, 2001. 276 (25): p. 22648 54. 85. Sakaue, H., et al., Phosphoinositide 3 kinase is required for insulin induced but not for growth hormone or hyperosmolarity induced glucose uptake in 3T3 L1 adi pocytes. Mol Endocrinol, 1997. 11 (10): p. 1552 62. 86. Hara, K., et al., 1 Phosphatidylinositol 3 kinase activity is required for insulin stimulated glucose transport but not for RAS activation in CHO cells. Proc Natl Acad Sci U S A, 1994. 91 (16): p. 7415 9. 87. Dan, H.C., et al., Phosphatidylinositol 3 kinase/Akt pathway regulates tuberous sclerosis tumor suppressor complex by phosphorylation of tuberin. J Biol Chem, 2002. 277 (38): p. 35364 70. 88. Katome, T., et al., Use of RNA interference mediated gene silencing and adenoviral overexpression to elucidate the roles of AKT/protein kinase B isoforms in insulin actions. J Biol Chem, 2003. 278 (30): p. 28312 23. 89. Prasad, J., et al., The protein kinase Clk/Sty directly modulates SR protein activity: both hyp er and hypophosphorylation inhibit splicing. Mol Cell Biol, 1999. 19 (10): p. 6991 7000. 90. Duncan, P.I., et al., In vivo regulation of alternative pre mRNA splicing by the Clk1 protein kinase. Mol Cell Biol, 1997. 17 (10): p. 5996 6001. 91. Tacke, R., Y. Chen, and J.L. Manley, Sequence specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40 specific splicing enhancer. Proc Natl Acad Sci U S A, 1997. 94 (4): p. 1148 53. 92. Smith, P.J., et al., An exonic splicing enhanc er in human IGF I pre mRNA mediates recognition of alternative exon 5 by the serine arginine protein splicing factor 2/alternative splicing factor. Endocrinology, 2002. 143 (1): p. 146 54. 93. Ramchatesingh, J., et al., A subset of SR proteins activates spl icing of the cardiac troponin T alternative exon by direct interactions with an exonic enhancer. Mol Cell Biol, 1995. 15 (9): p. 4898 907. 94. Patel, N.A., et al., Molecular and genetic studies imply Akt mediated signaling promotes protein kinase CbetaII al ternative splicing via phosphorylation of

PAGE 175

156 serine/arginine rich splicing factor SRp40. J Biol Chem, 2005. 280 (14): p. 14302 9. 95. Cooper, D.R., et al., Ectopic expression of protein kinase CbetaII, delta, and epsilon, but not betaI or zeta, provide for insulin stimulation of glucose uptake in NIH 3T3 cells. Arch Biochem Biophys, 1999. 372 (1): p. 69 79. 96. Cheng, J.Q., et al., Amplification of AKT2 in human pancreatic cells and inhibition of AKT2 expression and tumorigenicity by antisense RNA. Proc Natl Acad Sci U S A, 1996. 93 (8): p. 3636 41. 97. Shiraishi, I., et al., Nuclear targeting of Akt enhances kinase activity and survival of cardiomyocytes. Circ Res, 2004. 94 (7): p. 884 91. 98. George, S., et al., A family with severe insulin resistance and dia betes due to a mutation in AKT2. Science, 2004. 304 (5675): p. 1325 8. 99. Cho, H., et al., Akt1/PKBalpha is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J Biol Chem, 2001. 276 (42): p. 38349 52. 100. Bae, S.S., et al., Isoform specific regulation of insulin dependent glucose uptake by Akt/protein kinase B. J Biol Chem, 2003. 278 (49): p. 49530 6. 101. Cooper, D.R., et al., Insulin increases membrane and cytosolic protein kinase C activity in BC3H 1 myocytes. J Bio l Chem, 1987. 262 (8): p. 3633 9. 102. Prasad, J. and J.L. Manley, Regulation and substrate specificity of the SR protein kinase Clk/Sty. Mol Cell Biol, 2003. 23 (12): p. 4139 49. 103. Lai, M.C., R.I. Lin, and W.Y. Tarn, Differential effects of hyperphosphor ylation on splicing factor SRp55. Biochem J, 2003. 371 (Pt 3): p. 937 45. 104. Patel, N.A., et al., Phosphoinositide 3 kinase mediates protein kinase C beta II mRNA destabilization in rat A10 smooth muscle cell cultures exposed to high glucose. Arch Biochem Biophys, 2002. 403 (1): p. 111 20. 105. Perrotti, N., et al., Activation of serum and glucocorticoid induced protein kinase (Sgk) by cyclic AMP and insulin. J Biol Chem, 2001. 276 (12): p. 9406 12. 106. Rosenzweig, T., et al., Src tyrosine kinase regulates insulin induced activation of protein kinase C (PKC) delta in skeletal muscle. Cell Signal, 2004. 16 (11): p. 1299 308. 107. Misiuta, I.E., et al., The transcription factor Nurr1 in human NT2 cells and hNT neurons. Brain Res Dev Brain Res, 2003. 145 (1): p. 107 15. 108. Cross, T.G., et al., Serine/threonine protein kinases and apoptosis. Exp Cell Res, 2000. 256 (1): p. 34 41. 109. Nishizuka, Y., Studies and perspectives of protein kinase C. Science, 1986. 233 (4761): p. 305 12. 110. Emoto, Y., et al., Proteoly tic activation of protein kinase C delta by an ICE like protease in apoptotic cells. EMBO J, 1995. 14 (24): p. 6148 56. 111. Kohtz, J.D., et al., Protein protein interactions and 5' splice site recognition in mammalian mRNA precursors. Nature, 1994. 368 (646 7): p. 119 24.

PAGE 176

157 112. Anantharam, V., et al., Caspase 3 dependent proteolytic cleavage of protein kinase Cdelta is essential for oxidative stress mediated dopaminergic cell death after exposure to methylcyclopentadienyl manganese tricarbonyl. J Neurosci, 200 2. 22 (5): p. 1738 51. 113. Reyland, M.E., et al., Protein kinase C delta is essential for etoposide induced apoptosis in salivary gland acinar cells. J Biol Chem, 1999. 274 (27): p. 19115 23. 114. Denning, M.F., et al., Caspase activation and disruption of mitochondrial membrane potential during UV radiation induced apoptosis of human keratinocytes requires activation of protein kinase C. Cell Death Differ, 2002. 9 (1): p. 40 52. 115. Ladd, A.N. and T.A. Cooper, Finding signals that regulate alternative splic ing in the post genomic era. Genome Biol, 2002. 3 (11): p. reviews0008. 116. Stamm, S., Signals and their transduction pathways regulating alternative splicing: a new dimension of the human genome. Hum Mol Genet, 2002. 11 (20): p. 2409 16. 117. Moeslein, F.M ., M.P. Myers, and G.E. Landreth, The CLK family kinases, CLK1 and CLK2, phosphorylate and activate the tyrosine phosphatase, PTP 1B. J Biol Chem, 1999. 274 (38): p. 26697 704. 118. Gui, J.F., W.S. Lane, and X.D. Fu, A serine kinase regulates intracellular localization of splicing factors in the cell cycle. Nature, 1994. 369 (6482): p. 678 82. 119. Chan, T.O., S.E. Rittenhouse, and P.N. Tsichlis, AKT/PKB and other D3 phosphoinositide regulated kinases: kinase activation by phosphoinositide dependent phosphory lation. Annu Rev Biochem, 1999. 68 : p. 965 1014. 120. Cho, H., et al., Insulin resistance and a diabetes mellitus like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science, 2001. 292 (5522): p. 1728 31. 121. Patti, M.E., Gene expression in h umans with diabetes and prediabetes: what have we learned about diabetes pathophysiology? Curr Opin Clin Nutr Metab Care, 2004. 7 (4): p. 383 90. 122. Howell, B.W., et al., STY, a tyrosine phosphorylating enzyme with sequence homology to serine/threonine ki nases. Mol Cell Biol, 1991. 11 (1): p. 568 72. 123. Liu, X., et al., Exonic splicing enhancer dependent selection of the bovine papillomavirus type 1 nucleotide 3225 3' splice site can be rescued in a cell lacking splicing factor ASF/SF2 through activation of the phosphatidylinositol 3 kinase/Akt pathway. J Virol, 2003. 77 (3): p. 2105 15. 124. Paradis, S. and G. Ruvkun, Caenorhabditis elegans Akt/PKB transduces insulin receptor like signals from AGE 1 PI3 kinase to the DAF 16 transcription factor. Genes Dev, 1998. 12 (16): p. 2488 98. 125. Du, K. and M. Montminy, CREB is a regulatory target for the protein kinase Akt/PKB. J Biol Chem, 1998. 273 (49): p. 32377 9.

PAGE 177

158 126. Blaustein, M., et al., Concerted regulation of nuclear and cytoplasmic activities of SR protein s by AKT. Nat Struct Mol Biol, 2005. 12 (12): p. 1037 44. 127. Evdokimova, V., et al., Akt mediated YB 1 phosphorylation activates translation of silent mRNA species. Mol Cell Biol, 2006. 26 (1): p. 277 92. 128. Mastaitis, J.W., et al., Acute induction of ge ne expression in brain and liver by insulin induced hypoglycemia. Diabetes, 2005. 54 (4): p. 952 8. 129. Kawano, Y., et al., Changes in glucose transport and protein kinase Cbeta(2) in rat skeletal muscle induced by hyperglycaemia. Diabetologia, 1999. 42 (9) : p. 1071 9. 130. Cortright, R.N., et al., Protein kinase C modulates insulin action in human skeletal muscle. Am J Physiol Endocrinol Metab, 2000. 278 (3): p. E553 62. 131. Blobe, G.C., et al., Protein kinase C beta II specifically binds to and is activate d by F actin. J Biol Chem, 1996. 271 (26): p. 15823 30. 132. Hastings, M.L. and A.R. Krainer, Pre mRNA splicing in the new millennium. Curr Opin Cell Biol, 2001. 13 (3): p. 302 9. 133. Hiroyuki Kawahigashi, Y.H., Akira Asano, Masahiko Nakamura, A cis acting regulatory element that affects the alternative splicing of a muscle specific exon in the mouse NCAM gene. BBA, 1998. 1397 : p. 305 315. 134. Libri, D., A. Piseri, and M.Y. Fiszman, Tissue specific splicing in vivo of the beta tropomyosin gene: dependence o n an RNA secondary structure. Science, 1991. 252 : p. 1842 1845. 135. A. F. Muro, A.I., F. E. Baralle, Regulation of the fibronectin EDA exon alternative splicing. Cooperative role of exonic enhancer element and the 5' splicing site. FEBS Letters, 1998. 437 : p. 137 141. 136. Du, K., et al., HRS/SRp40 mediated inclusion of the fibronectin E111B exon, a Possible cause of increased EIIIB expression in proliferating liver. MCB, 1997. 17 : p. 4096 4104. 137. Chalfant, C.E., et al., Regulation of alternative splici ng of protein kinase Cbeta by insulin. Journal of Biological Chemistry, 1995. 270 : p. 13326 13332. 138. Zhou, Z., et al., Comprehensive proteomic analysis of the human spliceosome. Nature, 2002. 419 : p. 182 185. 139. D'Souza, I. and G.D. Schellenberg, Regu lation of tau isoform expression and dementia. Biochim Biophys Acta, 2005. 1739 (2 3): p. 104 15. 140. Khoo, B., S.A. Akker, and S.L. Chew, Putting some spine into alternative splicing. Trends in Biotechnology, 2003. 21 (8): p. 328 330. 141. Liu, H.X., et al ., Exonic splicing enhancer motif recognized by human SC35 under splicing conditions. Mol Cell Biol, 2000. 20 (3): p. 1063 71. 142. Xiao, R., et al., Splicing Regulator SC35 Is Essential for Genomic Stability and Cell Proliferation during Mammalian Organoge nesis. Mol Cell Biol, 2007. 143. Wang, H.Y., et al., SC35 plays a role in T cell maturation and alternative splicing of CD45. Mol Cell, 2001. 7 (2): p. 331 342.

PAGE 178

159 144. Hernandez, F., et al., Glycogen synthase kinase 3 plays a crucial role in tau exon 10 splic ing and intranuclear distribution of SC35. Implications for Alzheimer's disease. J Biol Chem, 2004. 279 (5): p. 3801 6. 145. Meshorer, E., et al., SC35 promotes sustainable stress induced alternative splicing of neuronal acetylcholinesterase mRNA. Mol Psych iatry, 2005. 10 : p. 985 997. 146. Spinella, M.J., et al., Retinoid Target Gene Activation during Induced Tumor Cell Differentiation: Human Embryonal Carcinoma as a Model. J. Nutr., 2003. 133 (1): p. 273S 276. 147. McCaffery, P., J. Zhang, and J.E. Crandall, Retinoic acid signaling and function in the adult hippocampus. J. NeuroBiol, 2006. 66 : p. 780 791. 148. Lee, C.J. and K. Irizarry, Alternative splicing in the nervous system: an emerging source of diversity and regulation. Biol Psychiatry, 2003. 54 (8): p. 771 6. 149. Jiang, K., et al., Identification of a Novel Antiapoptotic Human Protein Kinase C delta Isoform, PKCdeltaVIII in NT2 Cells. Biochemistry, 2008. 47 (2): p. 787 797. 150. Yang, Z.Z., et al., Switched alternative splicing of oncogene CoAA during e mbryonal carcinoma stem cell differentiation. Nuc Acids Res, 2007. 35 (6): p. 1919 1932. 151. Donai, H., et al., Induction and alternative splicing of delta isoform of Ca(+2)/calmodulin dependent protein kinase II during neural differentiation of P19 embryo nal carcinoma cells and brain development. Brain Res Mol Brain Res, 2000. 85 (1 2): p. 189 199.

PAGE 179

A BOUT THE AUTHOR Hercules S. Apostolatos received his Bachelor s degree in 2000 from York College of CUNY (City University of New York) with a sum cum la u d honor and a GPA of 3.84 He fulfilled all the requirements for a triple major: Mathematics, Biology, and Chemistry. He also pursued a certificate in Computer Science from New York University As an undergraduate, h e worked in research projects in Dr. Davi lab ( Chemistry Department USF) He entered the Ph.D program in fall 2001 and began working with Dr. Denise Cooper in the Department of Molecular Medicine (formerly Biochemistry and Molecular Biology) in spring of 200 2 He presented his resear ch at several conferences ( RNA Diabetes CLAS and Endocrine Society ). He was awarded an Endocrine Society Travel Award and Fellow Workshop in 200 7 He submitted his first author paper in JBC a nd was also co author of three other high impact publication s during his tenure as a Ph.D candidate.