USF Libraries
USF Digital Collections

A potential tumor suppressive role of sirt1 in cancer

MISSING IMAGE

Material Information

Title:
A potential tumor suppressive role of sirt1 in cancer
Physical Description:
Book
Language:
English
Creator:
Kabra, Neha
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Sirtuin
Histone deacetylase
Sir2
Cell proliferation
Colon cancer
Dissertations, Academic -- Cancer Biology -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: The NAD-dependent deacetylase SIRT1 regulates several factors involved in stress response and cell survival but its function in cancer is largely unknown. Research suggests that SIRT1 influences several transcription factors and molecules that are important components of pathways often deregulated in cancer. Our experiments have shown that SIRT1 knock down by short hairpin RNA accelerates tumor xenograft formation by HCT116 colon cancer cells, whereas SIRT1 overexpression inhibits tumor formation. We have also found that, pharmacological inhibition of SIRT1 stimulates cell proliferation under conditions of growth factor deprivation suggesting a tumor suppressive function of SIRT1. Paradoxically, SIRT1 inhibition sensitizes the same cells to apoptosis by chemotherapeutic drugs. Immunohistochemical staining of a colon tumor microarray revealed high SIRT1 expression levels in normal colon mucosa and benign adenomas. SIRT1 overexpression was observed in nearly 25 percent of stage one or two or three colorectal adenocarcinomas but rarely found in advanced stage four tumors. Furthermore, about 30 percent of carcinomas showed lower than normal SIRT1 expression. These results suggest a pleiotropic effect of SIRT1 in cancer, i.e., anti-proliferative as well as anti-apoptotic. Further experiments along these lines and examination of a larger patient cohort could provide a rationale for the use of SIRT1 activators and inhibitors in the prevention and treatment of cancer.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Neha Kabra.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003373
usfldc handle - e14.3373
System ID:
SFS0027689:00001


This item is only available as the following downloads:


Full Text

PAGE 1

A Potential Tumor Suppressive Role of SIRT1 in Cancer by Neha Kabra A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cancer Biology College of Arts and Sciences Universi ty of South Florida Major Professor: Jiandong Chen, Ph.D. Alvaro Monteiro, Ph.D. Kenneth Wright, Ph.D. Douglas Cress, Ph.D. Date of Approval: March 4, 2010 Keywords: Histone deacetylase, Sir2, EX 527, cell proliferation, colon cancer Copyrig ht 2010 Neha Kabra

PAGE 2

Acknowledgements I would like to thank my mentor, Dr. Jiandong Chen, for guiding me throughout my doctoral work. I will always be grateful for the time and effort he has spent training me. I have been very fortunate to be a part of his lab as a graduate student. I would also like to thank my committee members Dr. Kenneth Wright, Dr. Douglas Cress and Dr. Alvaro Monteiro for their invaluable suggestions and support. I would like to thank Dr. James Manfredi for taking time to be my Outside Chairperson for the dissertation defense. I also extend thanks to my friends and lab mates Lihong Chen, Brittany Cross, Zhenyu Li, Qian Cheng, Hong Zheng, Baozong Li, Xiaolong Li, Cynthia Lebron and Daniele Gilkes. I would like to thank Cathy Gaff ney for efficiently coordinating the dissertation defense and graduation process. I cannot thank the Cancer Biology Program enough for not only did they give me the opportunity to study at one of the best Cancer Research Institutes in the nation but also because it is through this program that I met my class mate, best friend and husband Nicholas Woods. I am extremely thankful to my parents, Rita and Suresh Kabra who have always motivated and encouraged me and supported me in my decision to come to this country to earn my Ph. D. I am also very fortunate to have a wonderful set of parents in law, Judy and David Woods, who have loved me as their daughter since the day I met them. I specially want to thank my husband, Nicholas for being a constant source of lov e and support and for always believing in me. I could not have done this without him. Finally, I want to thank my 16 month old son, Nikhil who has been a shining source of happiness and laughter at the end of each day.

PAGE 3

i Table of Contents List of Fi gures ......................................................................................................................... v List of Abbreviations ............................................................................................................ vii i Abstract .................................................................................................................................. x Chapter One Introduction ...................................................................................................... 1 Cancer ....................................................................................................................... 1 Carcinogenesis .......................................................................................................... 2 Tumor Promotion and Tumor Suppression ................................................................. 3 Histone Deacetylases ................................................................................................ 5 Classific ation and Function of Histone Deacetylases ................................................. 6 Class I and II Histone Deacetylas es ............................................................... 6 Class I Histone Deacetylases .............................................................. 7 HDAC1 .................................................................................... 7 HDAC2 .................................................................................... 8 HDAC3 .................................................................................... 8 HDAC8 .................................................................................... 8 Class II Histone Deacetylases ............................................................. 9 HDAC4 .................................................................................... 9 HDAC5 .................................................................................... 9 HDAC7 .................................................................................. 10 HDAC9 .................................................................................. 10 HDAC6 .................................................................................. 11 HDAC10 ................................................................................ 12

PAGE 4

ii Class I II Hi stone Deacetylases (Sirtuins) ...................................................... 12 SIRT1 .................................................................................... 15 SI RT2 .................................................................................... 16 SIRT3 .................................................................................... 17 SIRT4 .................................................................................... 18 SIRT5 .................................................................................... 18 SIRT6 .................................................................................... 18 SIRT7 .................................................................................... 19 Class IV Histone Deacetylases (HDAC11) .................................................... 19 Pharmacological Inhibitors and Activators of HDACs ............................................... 20 Inhi bitors of HDAC Class I and II .................................................................. 21 Inhibitors of HDAC Class III (Sirtu ins) ........................................................... 22 Activators of Sirtuins ..................................................................................... 24 SIRT1 ....................................................................................................................... 25 Structure of SIRT1 ........................................................................................ 25 SIRT1 in Aging and Metabolism ................................................................... 27 SIRT1 and Cancer ................................................................................................... 31 SIRT1 Functions as a Histone Modifier and Gene Silencer .......................... 32 SIRT1 Deacetylates and R egulates NonHistone Proteins ........................... 33 Pro Apo ptotic Pr oteins Deacetylated by SIRT1 ................................. 33 Anti Apoptotic P roteins Deacetylated by SIRT1 ................................ 36 SIRT1 in DNA Damage Repair .......................................................... 37 SIRT1 in Cellular Senescence .......................................................... 39 SIRT1 in Autophagy .......................................................................... 39 Mouse Models of SIRT1 ........................................................................................... 40 Regulation of SIRT1 ................................................................................................. 41

PAGE 5

iii Transcriptional Re gulation of SIRT1 ............................................................. 42 Posttransc riptional Regulation of SIRT1 ....................................................... 44 Posttranslational Regulation of SIRT1 .......................................................... 45 SIRT1 Expression in Canc er: Reports and Controversies ........................................ 47 Chapter Two Materials and Methods ................................................................................... 52 Cell Lines ................................................................................................................. 52 Plasmids and Reagents ........................................................................................... 53 Transfecti ons ........................................................................................................... 54 Calcium Phos phate Transfections ................................................................ 54 Lipofectamine Transfections ......................................................................... 54 Western Blotting ....................................................................................................... 54 Immunoprecipitation Assay ...................................................................................... 55 Quantitation of DNA Synthesis ................................................................................. 56 Colony Formation Assay .......................................................................................... 56 Growth Assay ........................................................................................................... 57 Reporter Assay ........................................................................................................ 57 Ce ll Cycle and Apoptosis Assay s ............................................................................. 57 Cell Cycle Ana lysis ....................................................................................... 57 TUNEL Assay ............................................................................................... 58 Immunohistochemical Staining ................................................................................. 59 Animal Experiments ................................................................................................. 60 Tumor Xenograft Experiments ...................................................................... 60 Animal Breeding ........................................................................................... 60 Generation of MEFs ..................................................................................... 63 Chapter Three Results ......................................................................................................... 64 SIRT1 Knock Down Promotes Gr owth of Colon Tumor X enograft ............................ 64

PAGE 6

iv SIRT1 Overexpression Suppresses the Gr owth of Colon Tumor Xenograft ............. 68 Inactivation of SIRT1 Stimul ates Tumor Cell Proliferation ........................................ 71 SIRT 1 Inhibits Cell Proliferation ................................................................................ 80 Inhibition of SIRT1 Sensitizes Tumor Cel ls to Chemotherapeutic Agents ................. 8 5 SIRT1 is Expressed at High Levels in Normal Colon and Benign Lesions ................ 90 SIRT1 is Under or Overexpressed in Advanced Colon Carcinomas ........................ 95 Chapter Four Dis cussion and Future Direction .................................................................... 98 References ........................................................................................................................ 107 About the Author ....................................................................................................... End Page

PAGE 7

v List of Figures Figure 1: Classi fication of HDAC Class I and II .................................................................... 6 Figure 2: Class III HDACs (Sirtuins) .................................................................................. 13 Figure 3: Structure of SIRT1 C atalytic C ore ...................................................................... 27 Figure 4: Functions of SIRT1 ............................................................................................. 32 Figure 5: Regulation of SIRT1 ........................................................................................... 42 Figure 6: Endogenous SIRT1 E xpression L imit s T umorigenicity ....................................... 64 Figure 7: SIRT1 K nock D own P romotes T umorigenicity .................................................... 65 Figure 8: Low SIRT1 Levels are Maintained in Tumors A rising from SIRT1 K nock D own C ell L ines .................................................................................. 66 Figure 9: Knock Down of SIRT1 Increases T umorigenicity ................................................ 67 Figure 10: Knock D own of SIRT1 I ncreases T umorigenicity in L ung C ancer C ell L ine ............................................................................................ 68 Figure 11: Generation of HCT116 Inducible SIRT1 Cell L ines ............................................. 69 Figure 12: SIRT1 Overexpression Suppresses the Growth of C olon Tumor X enograft ............................................................................................. 70 Figure 13: Doxycycline I nduces SIRT1 E xpression in T umor X eno graft A ssays .................. 71 Figure 14: Inhibition of SIRT1 S timulates C ell P roliferation upon N utrient D eprivation (Growth A ssay) ............................................................... 72 Figure 15: Inhibition of SIRT1 D oes N ot A ffect C ell P roliferation in N ormal G rowth C onditions (Growth A ssay) ..................................................... 73 Fig ure 16: Inhibition of SIRT1 S timulates C ell P roliferation U pon N utrient D eprivation ......................................................................................... 74

PAGE 8

vi Figure 17: Inhibition of SIRT1 D oes N ot A ffect C ell P roliferation in N ormal G rowth C onditions .............................................................................. 75 Figure 18: Inhibition of SIRT1 S timulates C ell P roliferation in D i fferent C ell L ines. .............. 76 Figure 19: Expression of Sirt1 in MEFs ............................................................................... 77 Figure 20: Absence of Sirt1 S timulates C ell P roliferation ..................................................... 78 Figure 21: Increased C ell P roliferation is a R esult of Sirt1 I nhibition .................................... 79 Figure 22: SIRT1 Inhibits C ell P roliferation (Colony F ormation A ssay) ................................ 80 Figure 23: Inhibition of C ell P roliferation by SIRT1 (FACS A nalysis) ................................... 81 Figure 24: SIRT1 Inhibition is Associated with Increased RB P hosphorylation .................... 82 Figure 25: SIRT1 Inhibits E2F1Mediated Activation of C yclin D3 P romoter ........................ 83 Figu re 26: SIRT1 D eacetylates E2F1 .................................................................................. 84 Figure 27: SIRT1 Inhibits Cell P roliferation via E2F1 ........................................................... 85 Figure 28: Inhibition of SIRT1 I ncreases S ensitivity to C hemotherapy ................................. 86 Figure 29: Inhibition of SIRT1 by EX 527 I ncreases S ensitivity to C hemotherapy ............... 87 Figure 30: Inhibition of SIRT1 P romotes C ell D eath in R esponse to C hemotherapy ............ 88 Figure 31: Inhibition of SIRT1 I ncreases A poptotic R esponse to DNA D amage .................. 89 Figure 32: Characterization of SIRT1 A ntibody ................................................................... 90 Figure 33: Characterization of SIRT1 A ntibody for I mmunohistochemistry .......................... 91 Figure 34: SIRT1 is E xpressed at H igh L evels in P roliferating C olon E pithelium ................. 92 Figure 35: SIRT1 is E xpressed at High Levels in A denomatous Colon E pithelium .............. 93 Figure 36: Sirt1 E xpression in the I ntestinal L esions of ApcMinFigure 37: SIRT1 E xpression is H eterogenous in A denocarcinomas ................................... 95 M ous e ................................. 94 Figure 38: SIRT1 E xpression is H eterogenous in A denocarcinomas (Pie Representation) ....................................................................................... 96 Figure 39: Effect of Sirt1 H eterozygous G enotype on P olyp F ormation ............................. 101 Figure 40: Effect of S irt1 H eterozygous G enotype on L ung T umor

PAGE 9

vii N odules F ormation ........................................................................................ 103 Figure 41: Lung Tum or N odules S tained for Sirt1 .............................................................. 104 Figure 42: Comparison of S urvival P robability B etween K rasLA2 M ice that are W ild T y pe or H eterozygous for Sirt1 ............................................... 105

PAGE 10

viii List of Abbreviations APC Adenomatous Polyposis Coli ATG Autophagy related CBP CREB binding protein CDK Cyclin dependent kinases ChIP Chromatin Immunoprecipitation CK 2 Casein Kinase 2 CR Calorie Restriction CREB cAMP response element binding protein DMSO Dimethyl Sulfoxide E2F1 E2F transcription Factor 1 FHL2 Four and a half LIM domains protein 2 FOXO Forkhead box O GFP Green Fluorescent Protein HAT Histone Acetyltransferase HDAC Histone deacetylase LOH Loss of Heterozygosity MAPK MitogenActivated Pr otein Kinase MEF Mouse Embryonic Fibroblast NAD+ Nicotinamide adenine dinucleotide NES Nuclear export signal N uclear factor kappa light chainenhancer of activated B cells NLS Nuclear Localization Signal

PAGE 11

ix PEPCK Phosphoenolpyruvate carboxykinase PGC PPAR gamma coactivator 1 alpha pRB Phosphorylated Retinoblastoma protein RB Retinoblastoma rDNA ribosomal DNA ROS Reactive Oxygen Species shRNA short hairpin RNA Sir2 Silent Information Regulator 2 SUMO 1 Small ubiquitin related modifier 1 UV Ultraviolet light

PAGE 12

x A Potential Tumor Suppressive Role of SIRT1 in Cancer Neha Kabra ABSTRACT The NAD d ependent deacetylase SIRT1 regulates several factors involved in stress response and cell survival but its function in cancer is largely unknown. Research suggests that SIRT1 influences several transcription factors and molecules that are important components of pathways often deregulated in cancer. Our experiments have shown that SIRT1 knock down by short hairpin RNA accelerates tumor xenograft formation by HCT116 colon cancer cells, whereas SIRT1 overexpression inhibits tumor formation. We have also found that, pharmacological inhibition of SIRT1 stimulates cell proliferation under conditions of growth factor deprivation suggesting a tumor suppressive function of SIRT1. Paradoxically, SIRT1 inhibition sensitizes the same ce lls to apoptosis by chemotherapeutic drugs. Immunohistochemical staining of a colon tumor microarray revealed high SIRT1 expression levels in normal colon mucosa and benign adenomas. SIRT1 overexpression was observed in nearly 25% of stage I/II/III colorectal adenocarcinomas but rarely found in advanced stage IV tumors. Furthermore, about 30% of carcinomas showed lower than normal SIRT1 expression. These results suggest a pleiotropic effect of SIRT1 in cancer, i.e., anti proliferative as well as anti apoptotic. Further experiments along these lines and examination of a larger patient cohor t could provide a rationale for the use of SIRT1 activators and inhibitors in the prevention and treatment of cancer.

PAGE 13

1 Chapter One Introduction Cancer The earliest evidence of cancer was discovered in Egypt in 1600 B.C and it was described as a disease that had no cure. Hippocrates, a Greek physician known as the Father of Medicine, used the terms carcinos and carcinoma t o describe the appearance of cancer These early physicians were able to crudely diagnose cancers but only after the development of refined autopsy methods in the 17thCancer is the second leading cause of death in economically developed countries (following heart diseases ) According to the statistics obtained by the U.S National Cancer Institutes, 1 in 2 men in the United States have a lifetime risk of developing cancer while this risk is 1 in 3 for women. Lung cancer has the highest mortality rate in both men and women followed by b reast cancer in women and p rostate cancer in men (American Cancer Society 2009). These statistics e mphasize the need for continued development and progress in the field of cancer research. century leading to the advanced understanding of anatomy and physiology did the origi n and progression of cancer become clear. We now find ourselves in the fortunate position of understanding a portion of the molecular mechanisms that regulate cancer initiation and progression. This knowledge has led to the development of modern cancer therapies that effectively treat many cancers. However, treatment options remain l imited and deaths attributed to cancer are still a major cause of mortality throughout the world. To fully combat cancer, continued research into the molecular causes and novel therapies must be completed. A task which seems to become more tangible with each passing day as new technologies for this research becomes available.

PAGE 14

2 Carcinogenesis Carcinogenesis can be defined as the c reation or production of cancer. While cells in a body undergo a tightly regulated cycle of generation, division and death, cancer cells typically evade cell death and are capable of constant multiplication and expansion. They develop traits which are comm only identified as the hallmarks of cancer, namely, self sufficiency in growth signals and insensitivity to growthinhibitory signals, evasion of apoptosis, sustained replicative potential and angiogenesis as well as tissue invasion and metastasis (Hanahan and Weinberg, 2000) It has been shown that cancer arises from a single unregulated and genetically unstable cell which divides to form a population of its clones. These clones undergo expansion and acc umulate genetic mutations providing a platform for Darwinian selection leading to neoplastic progression of cancer cells best suited for the microenvironment in which they exist (Barrett et al., 1999; Nowell, 1976) In most cases, cellular transformation is a result of activation of oncogenes or suppression of tumor suppressor genes. Cellular oncogenes, also called protooncogenes, are normal genes required for important functions in the cell. These genes however, ca n be transformed in to oncogenes by retro viruses resulting in abnormal cellular proliferation (Cooper, 1982; Haber and Stewart, 1985) On the other hand, tumor suppressor genes or anti oncogenes limit cellular trans formation. These genes encode proteins that inhibit cell cycle progression, promote DNA damage repair and bring about cell death in the event of mutations or stress (Comings, 1973; Sherr, 2004) Knudsons twohit h ypothesis holds true for most tumor suppressor genes wherein two mutational events are required for carci nogenesis. Both alleles of the tumor suppressor gene are required to be lost, mutated or inactivated for manifestation of cancer (Knudson, 1971) Carcinogenesis is a multistage process that develops through three phases: Initiation, promotion and progression (Pitot and Dragan, 1991) Initiation involves an irreversible change in the cell which is generally an insult to the DNA of the cell Chemicals such as aromatic

PAGE 15

3 hydrocarbons, radiation (ionizing and ultraviolet) or biological agents such as retroviruses can act as carcinogens to initiate cancer. These carcinogens can cause multiple mutations in the DNA of the cells such that the DNA repair machinery is impaired. As a result, cell cycle check points are deregulated and the cell divides and proliferates despite the mutations. Tumor P romotion involves the proliferation and expansion of the mutant and geneti cally unstable cell and accumulation of further mutations with each round of cell division such that the resulting population of cells is capable of surviving in normally unsuitable cellular environments (Cahill et al., 1999) The Progression step comprises of tumor cells that have attained malignant properties, invasiveness and metastatic capabilities. Of n ote is the fact that mutations that occur during the process of carcinogenesis do not just involve the genetic alteration (deletion, translocation, point mutation, duplication or amplification) of oncogenes or tumor suppressor genes, but can also be epigenetic changes such as modifications of gene promoters by acetylation/ deacetylation or methylation/demethylation (Feinberg et al., 2002; Feinberg and Tycko, 2004) Considering the complexity of cancer, it is of utmos t importance to investigate the genes that are invol ved in its manifestation and the molecular mechanisms which explain their deregulation. Only then can we hope to find the cure. Tumor Promotion and Tumor S uppression As mentioned above, oncogenes and tum or suppressor genes play a major role in tumorigenesis. Proto oncogenes undergo mutation and activation to behave as oncogenes that facilitate tumor formation. Mutations in protooncogenes can cause overexpression of its protein product due to deregulation of tran scription or gene amplification. Mutations can also be such that the protein product has increased stabil ity or increased activity. Post translational modifications of the protein such as phosphorylation can contribute to its stability and constitut ive expression which may lead to enhanced cell cycle progression and proliferation. Alterations in tissue specific expression profiles can also cause the gene to behave as an

PAGE 16

4 oncogene. Some examples of oncogenic protein products include R AS, S RC, M YC R AS is a small GTPase switch that is active when bound to GTP and inactive when bound to GDP (Milburn et al., 1990) R AS regulates signal transduction of several pathways, the most extensively studied being the Mitogen Activated Protein Kinase (MAPK) pathway, which affects cellular processes involved in transformation such as cell proliferation, migration, adhesion, apoptosis, etc. Overexpression of a constitutively active mutant R AS deregulates the signal transduction pathways and promotes invasion and metastasis. Thus, activating R AS mutations are found in several types of cancers (Bos, 1989) On the other hand, tumor suppressor genes function as anti oncogenes. Tumor suppressor genes function to repress cell cycle progression and cell division. Upon DNA damage, they facilitate repair but initiate apoptosis upon excessive damage. R B and p53 are two promin ent tumor suppressors They commonly exhibit inactivating mutations and LOH in the manifestation of most cancers (Knudson, 1971) p53 is a transcription factor encoded by the TP53 gene (Lane, 1992; Lane and Crawford, 1979; Matlashewski et al., 1984) It is maintained at low levels in the cell but upon DNA damage or stress it gets activated to transcriptionally induce a variety of genes involved in cell cycle check points or cell death such as WAF1/CIP1 and BAX (Giono and Manfredi, 2006; Miyashita and Reed, 1995; Waldm an et al., 1995) R B is a cell cycle inhibitin g protein that is modified post translationally to regulate its activation. In its hypophosphorylated state (between M to G1), R B is considered active as it efficiently binds to E2F1/DP1 and inhibits their tran scriptional function (Helin et al., 1992) As the cell t ransitions from G1 to S phase, R B is hyperphosphorylated by cyclins and CDK proteins such that it is inactivated and dissociates from the E2F1/DP1 complex thereby allowing transcription of genes that have functional roles in cell cycle progression and division. R B remains hyperphosphorylated throughout S, G2 and M phases (Fattaey et al., 1993) It has also been shown that Rb E2F1 complex recruits Histone

PAGE 17

5 Deacetylases (HDACs) to the promoters of E2F1 target genes to silence their transcription (Lai et al., 1999) The details and aspects of tumor promoti on and suppression remain elusive and much research is needed in this field. With advances in biological research, new genes are being constantly discovered and analyzed for their potential role in tumorigenesis. Histone D eace tylases Histone deacetylases, HDACs, are enzymes that can remove the acetyl moiety from the epsilon amino group of lysine residues on histones. Their function is opposite to that of Histone acetyltransferases (HATs) that transfer acetyl group to the lysine residues Histones are positively charged proteins that bind tightly to the negatively charged DNA and promote DNA condensation and superc oiling. Acetylation of lysine residues allows for neutralization of the positively char ged histones such that the DN A histone interaction is partially relaxed. This relaxed feature marks an actively transcribing region where transcription factors and other proteins can bind to the DNA. Contrary to HATs, HDACs increase the positive charge on histones by removing the acet yl group from the lysine residues thereby facilitating tighter interaction of histones and DNA and prevent ing transcription. Histone DNA and Histone protein interactions are generally influenced by a combination of histone modifications such as methylation, phosphorylation, ubiquitination and acetylation that together constitute the Histone Code (Jenuwein and Allis, 2001; Strahl and Allis, 2000) Acety lated Lys 9 on h istone H3; acetylated Lys 16 on histone H4 and met hylated lys 4 on h istone H4 together are associated with transcriptionally active DNA. In the late 90s HATs were found to acetylate a few nonhistone proteins suggesting that HATs and HDACs were not exclusive to histone modification (Gu and Roeder, 1997) At present, a number of transcription factors are known to be regulated by HDACs and HATs and their importance in cancer is becoming more evident each day

PAGE 18

6 Classification and Function of Histone Deacetylases Based on their homology to yeast histone deacetylases, human histone deacetylases have been classified into four groups: Class I which includes HDAC1, 2, 3 and 8 which are similar to yeast RPD3; Clas s II which includes HDAC4, 5, 6, 7, 9 and 10 which are similar to yeast HDA1; Class III which are also called sirtuins have seven family members ( SIRT1 7) and are homologous to yeast Sir2 gene and Class IV which includes HDAC11 that has features similar t o Class I and Class II (Glozak and Seto, 2007; Gregoretti et al., 2004) Class I and II share sequence similarity and are call ed the classical HDAC enzymes (Figure 1) They require Zn2+ for their catalytic activity. Sirtuins do not share any sequence similarity with the classical HDACs and require NAD+ to carry out the enzymatic reaction. Class I and II Histone D eacetylases Fig1: Classification of HDAC Class I and II The Bars depict the length of the protein. The catalytic domain is shown in blue and NLS is shown in black (de Ruijter et al., 2003)

PAGE 19

7 Class I Histone D eacetylases. These include HDAC1, 2, 3 and 8. Members of this class contain an N terminal deacetylase domain and a C terminal tail. HDAC1 was the first histone deacetylase to be identified and subsequently characterized (Taunton et al., 1996) It has an N terminal deacetylase domain and a C terminal tail which contains tandem CK 2 phophorylation sites as well as a sumoylation motif (Sengupta and Seto, 2004) Phosphorylation of HDAC1 has been shown to enhance its deacetylase function and mutation of these phosphorylation sites impairs its enzymatic activity as well as inhibits its ability to form complexes with other co repressors (Pflum et al., 2001) HDAC1 and 2 are usually a part of protein complexes that are recruited to the DNA by DNA binding proteins and these protein complexes enhance the enzymatic activity of HDACs Three such complexes have been identified, namely, Sin3 (Grzenda et al., 2009) NuRD (Denslow and Wade, 2007) and CoREST (Grozinger and Schreiber, 2002; You et al., 2001) which mediate chromatin modification and transcription repression by deacetylation and methylation and hence play a significant role in maintaining cell cycle progression, genomic stability and homeostasis Besides these multiprotein complexes, HDAC1 has been shown to associate with retinoblastoma protein (R B ) and inhibit cell cycle progression (Luo et al., 1998) DNMT1 or DNA Methyltransferase1 has also been shown to associate with HDAC1, RB and E2F1 in a complex that represses transcription from E2F1 target genes (Rob ertson et al., 2000) How ever, disruption of both HDAC1 alleles results in embryonic lethality due to proliferation defects. Cyclin dependent kinase inhibitors p21 and p27 are upregulated in HDAC1deficient embryos resulting in reduced cellular proliferat ion and histones H3 and H4 are hyperacetylated thereby causing changes in other histone modifications (Lagger et al., 2002) HDAC1 has also been shown to be upregulat ed in prostate cancer with concomitant decrease i n p21 levels thereby promoting cellular proliferation (Halkidou et al., 2004) HDAC1 itself can be regulated by posttranslational modifications such as sumoylation by SUMO 1 and

PAGE 20

8 according to one s tudy, this modifica tion can enhance the transcriptional repression function of HDAC1 (David et al., 2002) HDAC2 bears a large sequence similarity with HDAC1 and is pre sent in many protein complexes with HDAC1. It has been found to interact with YY1 and promote transcriptional repression (Yang et al., 1996) It has also been shown to interact with DNA Methyltransferase DNMT1 to bri ng about transcriptional repression (Rountree et al., 2000) HDAC2 can negatively regulate the transcriptional function of NF(Ashburner et al., 2001) It is also overexpressed in the polyp stage of colorectal carcinoma (Huang et al., 2005) and this elevated expression is induced upon loss of the Adenomatous Polyposis Coli ( APC ) gene (Zhu et al., 2004) Similar to HDAC1, decrease in HDAC2 levels correlate with increased p21 levels and apoptosis (Huang et al., 2005) HDAC3 was identified and cloned based on sequence similarities to HDAC1 and 2 (Yang et al., 1997) Similar to HDAC2 it bind to YY1 and acts as a tran scriptional repressor However, unlike HDAC1 and 2 which are localized in the nucleus, HDAC3 contains both nuclear import and export sequence s and therefore, can be localized in the nucleus as well as the cytoplasm (Takami and Nakayama, 2000; Yang et al., 2002) HDAC3 has also been shown to form a stable complex with nuclear hormone receptor corepressor, N C oR. The HDAC3 N C oR interaction enhances the repressive activity of N C oR and the deacetylase activity of HDAC3 by promoting a more favorable conformation of the latter (Wen et al., 2000) HDAC8 the fourth member of Class I HDACs was cloned and characterized based on sequence similarity to the other Class I his tone deacetylases. It is sub nuclear in localization and the gene encoding this HDAC is located on the X chromosome (Buggy et al., 2000; Hu et al., 2000; Van den Wyngaert et al., 2000) HDAC8 is phosphorylated by pr otein kinase A (PKA) and this phosphorylation inhibits the deacetylase activity of HDAC8 thereby resulting in hyperacetylated histones H3 and H4 (Lee et al., 2004; Yang and Seto, 2008) CREB, which is an important activator of genes involved in metabolism and survival is activated upon

PAGE 21

9 phosphorylation. It has been found that HDAC8 can form a complex with CREB and PP1, a dephosphatase enzyme to bring about inactivation of CREB transcriptional function. Hence, HDAC plays an important role in transcription regulation (Gao et al., 2009) Knock down of HDAC8 by siRNA inhibits growth of lung colon and cervical cancer cell lines suggesting that this histone deacetylase contributes to tumor cell proliferation (Vannini et al., 2004) Class II Histone D eacetylases. These are homologous to yeast HDA1 or H istone Deacetylase1 and are furth er classified in to two groups: Class IIa which includes HDAC4, 5, 7 and 9 and Class IIb which includes HDAC6 and 10. The Class IIa HDACs have an extended N terminus which contains sites for 14 3 3 and myocyte enhancer facto r2 (MEF2) binding. The MEF 2 binding motif is conserved from C. elegans to mammals (Yang and Gregoire, 2005) HDAC4 is the founding member of the Class II Histone deacetylases. Unlike the Class I HDACs which are primarily nuclear, H DAC4 can shuttle between the nucleus and cytoplasm through active nuclear export. In the nucleus, HDAC4 can associate with MEF2A and repress its transcriptional activation thereby repressing skeletal myogenesis (Misk a et al., 1999) Differential localization of HDAC4 may be a way to regulate the deacetylase effect of this enzyme. HDAC4 has an N terminal nuclear import sequence and C terminal nuclear export motif It binds to 14 3 3 which facilitates its cytoplasmic localization (Wang et al., 2000; Wang and Yang, 2001) Fur t hermore, ERK1/2 have been shown to associate with HDAC4 in a complex and subsequently phosphorylate HDAC4 (Zhou et al ., 2000b) thereby placing this histone deacetylase in the MAPK pathway Expression of oncogenic RAS is associated with increased nuclear HDAC4 and decreased MEF2mediated transcription. HDAC5 was identified as a deacetylase that was involved in chromatin modeling during cell differentiation (Verdel and Khochbin, 1999) Similar to HDAC4, HDAC5 can shuttle between nucleus and cytoplasm. It interacts with 143 3 and this interaction facilitates its cytoplasm ic

PAGE 22

10 localization which is thought to regulate its enzymatic effect (Grozinger and Schreiber, 2000) HDAC5 can also interact with MEF2 and inhibit its transcriptional function ( Lemercier et al., 2000) However, this interaction and repression of MEF2 activity is independent of HDAC5 deacetylase activity. The N terminal non deacetylase domain of HDAC5 is responsible for this repression despite the presence of a fully functional deacetylase domain. It is hypothesized that the repressive function of HDAC5 on MEF2 may be through the recruitment of other HDACs such as HDAC4 and HDAC3 (Grozinger et al., 1999) HDAC7 was identified and characterized based on sequence similarities with HDAC4 and 5 (Fischle et al., 2001) It has a deacetylase domain in the C terminal half and an NLS sequence in the N terminal half of the protein. The enzymatic activity of HDAC7 is dependent on its interaction with HDAC3 HDAC7 does not directly bind to HDAC3 but the two HDACs are recruited by the corepressors SMRT and N CoR (Fischle et al., 2001) HDAC7 can also shuttle between nucleus and cytoplasm but only nuclear HDAC7 is associated with enzymatic activity (Fischle et al., 2001) Calmodulin Kinase I or C AM K I has been shown to phosphorylate HDAC7. Phosphorylated HDAC7 interacts with 143 3 which facilitates its cytoplasmic localization and stabilization (Li et al., 2004) HADC9 was cloned and characterized based on sequence similarity to HDAC4 and the other Class IIa histone deacetylases (Zhou et al., 2001) It has splice variants 9a, 9b and 9c (or Histone deacetylase related protein, HDRP) HDAC9a and 9b lack the nuclear localization sequence and have the deacet ylase domain in the N terminal half of the protein while 9c or HDRP ( also called MITR, MEF2interacting transcription repressor ) lacks the deacetylase domain altogether but retains the NLS sequence (de Ruijter et al., 2003) HDRP can form a complex with HDAC1 and HDAC3 to compens ate for the lack of its deacetylase domain (Zhou et al., 2000a) It can associate with corepressor CtBP and the other HDACs to repress MEF2 activity (Zhang et al., 2001) Int erestingly, HDAC9 gene promoter contains sites for MEF2 binding and it has been found that MEF2 can transcriptionally activate HDAC9 during muscle

PAGE 23

11 cell differentiation thereby suggesting the existence of a negative feedback loop between HDAC9 and MEF2 (Haberland et al., 2007) Class IIb consists of HDAC6 and HDAC10. These two HDACs resemble each other but show lesser similarity with the Class IIa HDACs. HDAC6 is unique because it contains two tandem catalytic domains (Grozinger et al., 1999; Verdel and Khochbin, 1999) It was also identified as the first HDAC that was actively maintained in the cytoplasm but was capable of nuclear localization (Verdel et al., 2000) A strong nuclear export signal is located N terminal to the first catalytic domain which prevents the accumulation of this protein in the nucleus. This HDAC also contains a tetradecapeptide repeat domain C terminal to the second catalytic domain. This set of eight repeats, named SE14, display acetyl microtubule targeting ability as well as form a unique structure which is required for leptomycinB resistant cytoplasmic localization of HDAC6 (Bertos et al., 2004) The presence of NES and SE14 ens ure the cytoplasmic anchorage of HDAC6. Cterminal to the SE14 repeats is another domain unique to HDAC6. This is a cysteine and hi stidine rich domain named ZnF UBP which is present in several ubiquitinspecific proteases. This domain allows HDAC6 to bind to monoand poly ubiquitin chains (Boyault et al., 2006; SeigneurinBerny et al., 2001) The highaffinity binding of HDAC6 to ubiquitin interferes with the effective proteasomal degradation of the ubiquitinated proteins. p97/VCP can bind to HDAC6 and dissociate it from the ubiquitin complex thereby allowing the ubiquitinated proteins to be pr ocessed further (Boyault et al., 2006) While there is no evidence of histone deacetylation by HDAC6 in vivo a few nonhistone substrates of HDAC6 have been discovered. HDAC6 has been shown to deacetylate alphatubulin in assembled microtubules (Hubbert et al., 2002; Matsuyama et al., 2002) Since proteins like kinesin1 require acetylated alphatubulin to transport proteins such as JIP1 (Reed et al., 2006) HDAC6 interferes with this transport by destabilizing the microtubules. Besides alphatubulin, HDAC6 deacetylates the molecular chaperone Hsp90 and facilitates the assembly of protein complexes involved in cell signaling

PAGE 24

12 (Kovacs et al., 2005) In the absence o f HDAC6, Hsp90 becomes hyperacetylated, dissociates from its co chaperone and loses its ability to form the chaperone complex. Despite its cytoplasmic localization, HDAC6 can be localized to the nucleus in certain cases and act as deacetylase on nuclear targets. It is recruited by R UNX 2 from the cytoplasm to the promoter of WAF1/CIP1 to encode p21 protein in differentiating osteobalsts (Westendorf et al., 2002) thereby regulating tissuespecific gene expression. HDAC10 was identified based on sequence similarity with HDAC6 (Fischer et al., 2002; Guardiola and Yao, 2002) It contains two catalytic domains as well but the C terminal catalytic domain is nonfunctional HDAC10 has been found to be localized in the nucleus as well as the cytoplasm and has alternatively spliced variants (Fischer et al., 2002; Guardiola and Yao, 2002; Kao et al., 2002) It has also been found to interact with HD AC2 and SMRT complexes suggesting a role in promotion of transcriptional repression (Fischer et al., 2002) Class III Histone D eacetylases (Sirtuins) Sirtuins are homologous to the proteins encoded by the yeast SI R genes and t his class of histone deacetylases is significantly different from Class I and II in their structure, enzymatic activity, localization and function (Figure 2)

PAGE 25

13 Fig 2: Class III HDACs (Sirtuins). Mammals have seven sirtuins, SIRT1 7. All have an NAD+ dependent catalytic core domain that may act preferentially as a monoADP ribosyl transferase (ART) and/or NAD+ dependent deacetylase (DAC). Additional N terminal and/or C terminal sequences of variable length may flank this core domain. The seven sirtuins show different cellular localization (Michan and Sinclair, 2007) The yeast Sir2 gene was discovered as a suppressor of recombination between copies of tandem repeated rDNA (Gottlieb and Esposito, 1989) Sir2 was also found to silence genes near the telomeres in S. cerevisiae (Aparicio et al., 1991) Later, it was elucidated that the silencing of the mating type loci and telomeres was associated with hypoacetylation of the histones at the epsilonamino group of N terminal lysine residues and that overexpression of Sir2 was res ponsible for histone deacetylation in vivo (Braunstein et al., 1993) The discovery of Sir2 homologs in various organisms, from bacteria to humans, suggested that it belongs to an evolutionarily conserved family of genes. Studies with bacterial homolog CobB indicated that Sir2 may possess NAD + dependent monoADP ribosyltransferase activity (Tsang and Esc alanteSemerena, 1998) By 1999, five

PAGE 26

14 human cDNA homologous to yeast Sir2 had been discovered and it was experimentally established that these sirtuins can metabolize NAD + and function via monoADP ribosylation of proteins (Frye, 1999) It was also shown that Sir2 catalyzed the deacetylation reaction of an acetylated lysine residue by utilizing NAD + and producing nicotinamide, deacetylated lysine and 1O acetyl ADP ribose as the end products (Tanner et al., 2000) Therefore, Sir2 coupled two enzymatic reactions; deacetylation and NAD+ metabolism. In this regard, members of Sir2 family, sirtuins differ from the other two classes of HDACs. The other classes of HDACs require Zn2+A number of studies have sugges ted a role for sirtuins in aging. In yeast, presence of ERCs (Extra chromosomal Circles) accelerates aging (Sinclair and Guarente, 1997) These ERCs are a result of recombi nation between rDNA repeats. Amplification of ERCs titrates the replication machinery from genomic DNA as a result of which accumulating ERCs shorten the life span of yeast cells (Sinclair and Guarente, 1997) It was found that Sir2 could i nduce transcriptional silencing at the rDNA locus (Fritze et al., 1997) and introduction of an extra copy of Sir2 could increase the yeast lifespan up to 30% by suppressing rDNA recombination (Kaeberlein et al., 1999) Eventually, Sir2mediated increase in lifespan was also reported in C. elegans (Tissenbaum and Guarente, 2001) followed by Drosophila (Rogina and Helfand, 2004) Increased life span upon calorie restriction (CR) has been demonstrated in a variety of organisms from yeast to mammals. Sir2 was found to play a role in increasing lifespan upon CR in yeast. In Sir2 deleted genotypes, CR did not increase lifespan in yeast or Drosophila suggesting the importance of Sir2 in CR mediated longevity (Lin et al., 2000; Rogina and Helfand, 2004) It was proposed that CR promoted respiration instead of fermentation which increased the NAD+/NADH ratio by decreasing NADH levels thereby stimulating the activity of Sir2 (Lin et al., 2002) However, recent studies have shown that calorie restriction can reduce the frequency of rDNA recombination and increase yeast lifespan independently of Sir2for their catalytic function while sirtuins require NAD +

PAGE 27

15 mediated rDNA silencing (Riesen and Morgan, 2009) T he importance of human sirtuins in me diating CRinduced longevity is currently being evaluated. The mammalian sirtuin family consists of seven members from SIRT1 7 Each sirtuin has a conserved 275 amino acid catalytic core domain and unique N and C terminal sequences as well as different cellular localizations (Fig ure 2). The biological functions of these sirtuins are still being elucidated since this is a r elatively new field of research. S IR T1: The first member of human sirtuins. I t is the clo sest homolog of yeast Sir2 gene (Frye, 2000) and perhaps the most investigated of all sirtuins. It is localized in the nucleus and functions as an NAD + dependent histone as well as protein deacetylase. Knock out experiments in mice have shown that Sirt1 is important for embryonic development. It was found that t he severity of the phenotype of Sirt1 null mice depended on the genetic background of the mice but in most cases, the loss of S irt 1 was embryonic lethal However, a very small proportion of S irt 1 null mice were born viable but failed to survive more than a few months beyond birth (Cheng et al., 2003; McBurney et al., 2003) These viable mice had obv ious phenotypic abnormalities including smaller size, sterility and eye and heart development defects. SIRT1 has been shown to deacetylate histone H3 lys9 h istone H4 lys16 and h istone H1 lys26 (Vaquero et al., 2004) thereby facilitating chromatin condensation and compaction leading to transcription repression. Some of the earliest studies on SIRT1 as a protein deacetylase were done with the transcription factor p 53 where i t was shown that SIRT1 could deacetylate and inhibit the transcriptional function of p53 (Langley et al., 2002; Luo et al., 2001; Vaziri et al., 2001) Since p53 is a well known tumor suppressor, its inhibition by SIRT1 categorized SIRT1 as an oncogene. R ecent research however, has shown that while SIRT1 deacetylates p53, there is no biological outcome of this deacetylation (Kamel et al., 2006; Solomon et al., 2006) Besides p53, SIRT1 has also been shown to influence several different

PAGE 28

16 biological pathways by deacetylating and regulating various transcription factors such as the forkhead family or FOXO (Motta et al., 2004) Ku7 0 (Cohen et al., 2004a) (Yeung et al., 2004) E2F1 (Wang et al., 2006) NBS1 (Yuan and Seto, 2007) to name a few. Importantly, SIRT1 also influences m et abolic pathways by regulating key proteins such as (Picard et al., 2004) and PGC (Nemoto et al., 2005) By doing so, SIRT1 plays a significant role in mitochondrial biogenesis and metabolism suc h as fat mobilization upon calorie restriction. SIRT1 has also been shown to play an important role in insulin signaling pathway (Kloting and Bluher, 2005) SIRT1 levels were found to be low in insulin resistant cells and overexpressing SIRT1 improved insulin sensitivity. This aspect of SIRT1 function could prove to be useful in managing type 2 diabetes (Sun et al. 2007) The function and regulation of SIRT1 has been described in detail later in this Introduction section. S IR T2: Unlike SIRT1 S IR T2 is cytoplasmic in its localization (Perrod et al., 2001) It possesses mono ADP ribosyl transferase as well as NAD+ dependent deacetylase activity. It tubulin thereby affecting the biological function of microtubules in the cell. S IR T2 can associate with HDAC6 in a complex or work independently to deacetylate tubulin (North et al., 2003) This enhances microtubule stability and cell motility S IR T2 also interacts with the homeobox transcription factor HOXA10 thereby suggesting a role in mammalian development although the exact effect of this interaction on the function of either of these proteins is not clear (Bae et al., 2004) It has also been shown that S IR T2 overexpression leads to a prolonged mitotic phase of the cell cycle and decrease in S IR T2 protein levels is essential for mitotic exit in the cell cycle (Dryden et al., 2003) However, the molecular mechanism by which S IR T2 regulates the cell cycle is not understood very well A ccording to a recent report, S IR T2 can localize to the nuclei during the G2/M phase of the cell cycle and deacetylate histone H4 lys16 (Vaquero et al., 2006) This is thought to facilitate the condensation of chromosomes during the mitotic phase ( Inoue et al.,

PAGE 29

17 2007) Research has also shown that similar to S IR T1, S IR T2 can regulate FOXO3a by deacetylation upon stress and calorie restriction. Deac etylation by S IR T2 promotes DNA binding by FOXO and induces the transcription of FOXO target genes to e xpress proteins such as p27kip1 manganese superoxide dism utase and proapoptotic B IM As a result, S IR T2 is instrumental in decreasing ROS in the cell as well as promoting apoptosis upon stress (Wang et al., 2007) Hence, even though S IR T2 is cytosolic, it retains its deacetylase activity and can regulate important cellular processe s. S IR T3: Similar to S IR T2, S IR T3 exhibits ADP ribosyl transferase as well as NAD+ dependent deacetylase activity. It localizes to the mitochondria due to the presence of a unique N terminal mitochondrial localization sequence (Onyango et al., 2002) Further investigation showed that S IR T3 is in fact localized to the inner mitochondrial membrane and its levels are higher in brown adipose tissues as compared to the white adipose tissues. Interestingly, levels of S IR T3 mRNA increase in response to calorie restriction and environmental temperature stress in brown adipose tissues of rodents suggesting a role in adaptive thermogenesis (Shi et al., 2005) In the mitochondria, S IR T3 promotes the expression of the master metabolic regulator PGC 1 uncoupling protein UCP1 and ATP synthetase thereby activating mitochondrial genes respiration and oxygen consumption (Shi et al., 2005) A recent report suggested that S IR T3 is a mitochondrial as well as nuclear sirtuin. It normally resides in the nucleus where it deacetylates histo ne H4 lys16 and to some extent histone H3 lys9 such that it is capable of inhibiting gene transcription but localizes to the mitochondria upon stress signals such as UV or etoposide. I t is hypothesized that the nuclear exit of S IR T3 upon stress may be required for the rapid activation of nuclear genes that are needed to respond to the stress (Scher et al., 2007) Interestingly, one study sh owed a functional polym orphism of S IR T3 which was associated with longer lifespan in humans, thereby making this the only sirtuin directly linked to human longevity (Bellizzi et al., 2005)

PAGE 30

18 S IR T4: S IR T4 is also a mitochondrial localized sirtuin (Michishita et al., 2005) It functions as an ADP ribosyl transferase instead of a histone deacetylase (Ahuja et al., 2007) Its expression in pancreas has been found to be intensely associated with insulin secretion (Haigis et al., 2006) S IR T4 utiliz es NAD+ for ADP ribosylation of glutamate dehydrogenase (GDH) an enzyme that converts glutamate to ketoglutarate in the mitocho ndria of cells ADP ribosylation represses the enzymatic activity of GDH thereby inhibiting glutamate metabolism which is required to generate ATP (Haigis et al., 2006) S ince ATP promotes insulin secretion, S IR cells in response to glutamate. S IR T5: S IR T5 is a mitochondrial deacetylase (Michishita et al., 2005) and is extensiv ely expressed in a number of tissues (Frye, 1999) Recently, it has been shown that S IR T5 can deacetylate natively acetylated cyctochrome c present in the mitochondrial inter membrane space which can affect its role in respiration or formation of the apoptosome (Schlicker et al., 2008) Besides cytochrome c the limited knowledge of S IR T5 functions also includes its deacetylation of CPS1 (carbamoyl phosphate synthatase 1) whi ch is an import ant enzyme in the urea cycle for ammonia detoxification (Nakagawa et al., 2009) S IR T5 upregulates CPS1. This is especially important during fasting when elevated NAD + levels promote amino acid catabolism and increased blood ammonia level s. Therefore, S IR T5 plays an important role in ammonia detoxification. S IR T6: Similar to S IR T1, S IR T6 is a nuclear enzyme which exhibits ADP ribosyl transferase activity (Liszt et al., 2005) It is highly associated with heterochromatic regions in the nucleus (Michishita et al., 2005) S IR T6 has been shown to be involved in Base Excision Repair (BER) and its loss leads to age associated degenerative processes (Mostoslavsky et al.,

PAGE 31

19 2006) Recent reports show that S IR T6 levels increase upon nutrient deprivation and this increase is due to stabilization of the protein. Also, p53 positively regulates the levels of S IR T6 under normal condit ions but not under stress conditions (Kanfi et al., 2008b) S IR T6 has been shown to deacetylate histone H3 lys9 at telomeric regions thereby propagating a stabilized chromatin state at the telomeres. Loss of S IR T6 results in telomeric fusion and premature senescence (Michishita et al., 2008) S IR T6 may als o contribute to the maintenance of genomic stability by deacetylating H3 lys56 at the telomeres (Michishita et al., 2009; Yang et al., 2009) Moreover, S IR T6 has been shown to interact with the rel A subunit silencing of transcription of genes involved in apoptosis and cellular senescence (Kawahara et al., 2009) The role of S IR T6 as an important regulator of cellular processes is becoming more evident with ongoing research. S IR T7: The last member of the sirtuin family, S IR T7 is nucleolar in its localization (Frye, 2000; Michishita et al., 2005 ) It is a relatively newly discovered sirtuin whose biological functions are not completely understood. It has been found that S IR T7 is a component of the RNA polymerase I transcriptional machinery and it stimulates Pol I transcription. The exact substra te of S IR T7 in this pol I complex is not known. Neither ADP ribosyl transferase nor deacetylase activity of S IR T7 is known. Therefore, it utilizes NAD + to activate the Pol I machinery by some unique mechanism that is yet to be discovered (Ford et al., 2006) Class IV Histone Deacetylases (HDAC11) HDAC11 is the only member of this class of histone deacetylases. It w as discovered based on sequence similarity to both class I and II HDACs in the core catalytic domain (Gao et al., 2002) I t is localized in the nucleus and only expresse d in some tissues which suggest s that it may have tissue specific functions. Interestingly, it has been found to be overexpressed in some cancer cell lines and therefore

PAGE 32

20 its role in tumorigenesis is being investigated. It is commonly found in protein complexes that contain HDAC6 (Gao et al., 2002) HDAC11 specifically associates with C DT 1 which is a replication licensing factor. It deacetylat es C DT 1 at lysine residues thereby facilitating ubiquitinylation and degradation of the latter. Thus, HDAC11 regulates the s tability of CDT 1 (Glozak and Seto, 2009) Recently, a role for HDAC11 in immune activation has been demonstrated. HDAC11 is expressed in Antigen Presenting C ells (APCs) and funct ions to negatively regulate the expression of IL10 while inducing inflammatory APCs which can prime nave T cells and restore responsiveness of tolerant T cells (Villagra et al., 2009) Since HDAC11 is a newly disc overed histone deacetylase, a comprehensive list of its biological functions is still in the making. Pharmacological Inhibitors and A ctivators of HDACs Considering the large number of cellular processes that are regulated by histone deacetylases, it is ev ident that their deregulation will be detrimental to the cell. These HDACs function as lysine deacetylases since they deacetylate histone as well as nonhistone proteins (Xu et al., 2007) resulting in alteration of transcription, gene regulation, protein modification, DNA repair and cell division. Deregulation of HDACs can either lead to cellular apoptosis or cellular transformation and it is for the latter that HDAC inhibitors have been extensively investigated. Cellular transformation generally involves the repression of tumor suppressor genes, cell cycle inhibitors and apoptosis inducers and many of these repressive effects are due to recruitment of HDACs. Therefore, HDAC inhibitors are an important aspect of cancer therapy and management. Research has shown that o f the 18 HDACs that have been discovered, none of them are redundant in their biological respons ibilities. However, they have a certain degree of similarity in their core domains that allow us to group them into three major classes. As mentioned previously, class I and II HDACs require Zn+ for their enzymatic activity while class III HDACs

PAGE 33

21 require NA D+. These common features have allowed for the design of some effective HDAC inhibitors. The exact mechanism of HDACi induced death of transformed cells is complex and not very well understood but several of these compounds are in clinical trials due to t heir effectiveness in inhibiting transformed cell proliferation and the relative resistance of normal cells to their toxic effects. I nhibitors of HDAC Class I and II. Sodium butyrate was the first histone deacetylase inhibitor (HDACi) to be discovered. It was found that tumor cells treated with sodium butyrate exhibited an increase in acetylation of histone H3 and H4 (Boffa et al., 1978; Candido et al., 1978) It was also found that the acetylated DNA was more acces sible for attack by DNAse I (Boffa et al., 1978; Vidali et al., 1978) The molecular mechanism of action of this inhibitor is not clearly defined although its effects on several biological pathways have been descri bed. Due to its function as a histone deacetylase inhibitor (Sealy and Chalkley, 1978) this compound has been shown to activate the transcription of p21, a major cyclin/cdk suppressor, thereby leading to cell cycle arrest (Chen et al., 2004) as well as upregulate the transcription of various genes involved in the proapoptotic machinery of the cell (Pajak et al., 2007) Sodium butyrate was followed by the discovery of Trichost atin A (TSA) and Trapoxin. Both agents could effectively inhibit histone deacetylases and induce differentiation and cell cycle arrest (Van Lint et al., 1996; Yoshida et al., 1995) Trapoxin increased the histone H3 and H4 acetylation levels in the WAF1/CIP1 promoter thereby inducing p21 protein expression. Increase in p21 protein levels resulted in a decrease in R B phosphorylation levels thereby causing G1 and G2 cell cycle arrest in certain cancer cell lines (Sambucetti et al., 1999) Vorinost at (SAHA) is structurally similar to TSA and is a pan inhibitor of Class I and II HDACs (Marks and Breslow, 2007; Richon et al., 1998) The mech anism of action of SAHA is complex and not completely understood. It has been shown that SAHA can bind to its ligands with sufficient strength so as to induce the accumulation of acetylated histones and alter gene

PAGE 34

22 trans cription and expression of proteins t hat are involved in proliferation, migration and apoptosis in transformed cells resulting in cell death (Richon et al., 1998) At the same time, this binding of SAHA to its ligand is rapidly reversible thereby allow ing for some deacetylation to occur. This rapid reversibility does not make SAHA the most potent HDACi but strong enough to induce transformed cell death with minimum toxicity to normal cells. SAHA has been used successfully in culture and animal models to inhibit t ransformed cell growth with negligible toxicity Normal cells are tenfold more resistant to SAHA as compared to transformed cells which makes it an attracti ve candidate for cancer therapy (Ungerstedt et al ., 2005) At present, SAHA is being used in clinical trials and has shown promise in the treatment of solid and hematological malignancies with very few side effects (Marks and Breslow, 2007) Besides SAHA, other HDAC inhibitors include Dispeptide, Valproic Acid, PDX101 etc which are effective against Class I and II HDACs and are being tested as potential drugs for clinical trials (Dokmanovic et al., 2007) In hibitors of HDAC Class III (Sirtuins) As mentioned earlier, Class III HDACs are unique and different from the other two classes of HDACs. They require NAD+ for their enzymatic activity and deacetylate the substrate along with metabolism of NAD + to release nicotinamide, O acetyl ADP ribose and the deacetylated substrate. The deacetylation reaction involves an enzymeADP ribose intermediate (Landry et al., 2000) K nowledge of the biological roles of sirtuins is not comprehensive and current research is elaborating the list of interacting proteins and pathways for this class of HDACs Of the sirtuins, SIRT1 is the most extensively investigated HDAC. Its function in connection with cancer, cardiac diseases and neurodegenerati ve disorders is being extensively studied. Inhibitors of SIRT1 and other sir tuins provide us with an important means to study their role in human diseases. Nicotinamide is the earliest known and most obvious inhibitor of the deacetylase enzymatic reaction. It drives the ADP ribosylation reaction backward towards the acetyl lysine and NAD+

PAGE 35

23 thereby inhibiting the enzymatic reaction mediated by S IRT1 ( Jackson et al., 2003) Analogues of NAD+ have also been developed such as carba NAD+ which is a non hydrolysable competitive inhibitor of S IRT1 (Landry et al., 2000) Splitomicin was discovered as a Sir2 inhibitor in yeast when it was found that this drug could inhibit the silencing of mating t ype locus, telomeres and rDNA recombination (Bedalov et al., 2001) Next, Sirtinol was discovered by reverse genetics as an inhibitor of yeast and human Sir2 deacetylase activity (Grozinger et al., 2001) It was later shown that Sirtinol could induce cellular senescence in breast cancer and lung cancer cell lines. This senescence was accompanied with impaired activation of MAPK pathways thereby suggesting an anticancer role fo r this drug (Ota et al., 2006) Cambinol, a SIRT1 and S IR T2 deacetylase inhibitor was identified and found to be competitive with the peptide and not NAD + It was shown to have anti tumor activity in BCL6 mediated Burkitt lymphoma Treatment of Burkitt lymphoma with Cambinol resulted in apoptosis which was associated with hyperacetylation of BCL6 and p53. Since acetylation inactivates BCL6 but activates p53 transcriptional function, Cambinol exhibited antitumor properties (Heltweg et al., 2006) Moreover, Cambinol was successful in inhibiting tumor growth in mouse xenograft experiments. Based on highthroughput screening, indoles were discovered as potent S IR T1 inhibitors. Th is class of inhibitors was specific for S IR T1 over any other sirtuin and its mode of action was different from any other inhibitors known so far. These inhibitors bound to the enzyme after the substrate and NAD + had already been bound and nicotinamide had been released but the release of the deacetylated product and O acetyl ADP ribose was inhibited (Napper et al., 2005) Later, the effect of a specific indole EX 527 was investigated in detail and found to be highly specific against S IR T1 in nanomolar amounts. It was found that while inhibition of S IR T1 deacetylase activity by EX 527 promoted an increase in p53 acetylation at lys 382, there was no effect on viability or p53 controlled gene expression in cells treated w ith etoposide (Solomon et al., 2006)

PAGE 36

24 Very recently, another set of S IR T1 and S IR T2 inhibitors were identified based on yeast genetics and biochemical assays called tenovins (Lain et al., 2008) A cell based assay was carried out to identify compounds that could activate p53 and its downstream target genes and tenovins were discovered from the compound library. These tenovins were found to decrease tumor growth in xenograft experiments and capable of inhibiting S IR T1, S IR T2 and to some extent S IR T3 deacetylase activity. Activators of Sirtuins. Resveratrol, a polyphenol found in grape and grape products, was found to activate yeast Sir2 and human S IR T1. It was found to lower the Michaelis constant of S IR T1 for both the acetylated substrate and NAD + thereby promoting the deacetylase activity of SIRT1 and increasing cell survival by stimulating SIRT1 dependent deacetylation of p53 (Howitz et al., 2003) It was suggested that resveratrol could mimic calorie restriction conditions and potentially increase longevity in yeast However, in light of recent research, the role of resveratrol as a S IR T1 activator is controversial specifically because of its ability to promote SIRT1 activity in a single in vitro ass ay but non reproducible effects in cells (Borra et al., 2005; Kaeberlein et al., 2005) Recently small molecule activators of SIRT1 were identified that were structurally unrelated to resveratrol and exhibited alm ost 1,000 fold more potency than resveratrol. These compounds were shown to function by binding to the SIRT1 enzyme peptide substrate complex at an allosteric site aminoterminal to the catalytic domain and lower ing the Michaelis constant for acetylated substrates. Among them, SRT1720 was the compound of choice and it was shown that administration of this activator could im prove insulin sensitivity and increase mitochondrial capacity in obese mice (Milne et al., 2007) As a result, these activators were proposed to have therapeutic effects in the management of type 2 diabetes. Interestingly, a very recent report tested the specificity of resveratrol and the SRT compounds against SIRT1

PAGE 37

25 and found them to be functional only in Fluorescence based assays where the peptide substrate of SIRT1 was covalently attached to a fluorophore. It was discovered that these compounds could directly bind to the fluorophore peptide substrates and increase the affinity of the peptide for SI RT1 Neither t he SRT compounds nor resveratrol were able to activate SIRT1 when native full length acetylated p53 peptide lacking the fluorophore was used as a substrate (Pacholec et al., 2010) These findings re iterate the doubts concerning the ability of resveratrol t o specifically activate SIRT1 since previous results from Borra et al., have suggested that SIRT1 activation by resveratrol with a coumarin labeled peptide occurs due to conformational change induced by resveratrol near the coumarin binding site in SIRT1 The conformational change creates a binding pocket for the coumarin group which enhances the binding of the coumarin labeled peptide to SIRT1 and resveratrol is unable to activate SIRT1 in the absence of the coumarin label (Borra et al., 2005) SIRT1 Among the seven sirtuins, SIRT1 is the closest human homolog of yeast Sir2 gene. While Sir2 has been implicated in promoting longevity upon calorie restriction in lower organisms, the role of SIRT1 on this matter is quite unknown. But the potential for its involvement as a promoter of longevity makes it an attractive molec ule to investigate. In the past decade, a number of SIRT1 functions have been discovered and its role in aging, diabetes and cancer has been studied extensively. Structure of SIRT1 The S IR T1 gene is located on chromosome 10q21 and encodes a 747 amino acid long protein. It consists of eight exons and the protein is localized in the nucleus. Characteristic of this class, SIRT1 requires NAD+ for its enz ymatic activity which is subsequently metabolized to produce nicotinamide along with the deacetylated product and O acetyl ADP ribose. The catalytic domain of SIRT1 that spans from 244 to 498 amino acids is

PAGE 38

26 evolutionarily conserved and consists of two sub domains. The large subdomain resembles a Rossmann fold and the small subdomain is composed of a helical module and a zinc binding module (Figure 3) The interface between the two subdomains creates a large grove that consists of the active site where NA D+ and the acetylated substrate bind (Huhtiniemi et al., 2006) While the mechanism of deacetylation of substrate has been resolved, it has been reported that SIRT1 shows no substrate specificity in vitro The amino acids proximal to the acetylated lysine do not show any consensus sequences among the SIRT1 substrates (Blander et al., 2005) Unpublished work from our lab as wel l as reports from other labs have shown that the SI RT1 protein consists of about 13 sites that can be potentially phosphorylated (Sasaki et al., 2008) These phosphorylation sites are distributed all along the protein and the biological function of phosphorylated SIRT1 is yet to be determined. Thr 530 and ser 540 have been shown to be phosphorylated by cyclinB/cdk1 complex and CK2 has been found to phosphorylate ser 659 and ser 661 on SIRT1 (Sasaki et al., 2008; Zschoernig and Mahlknecht, 2009) There is also evidence that lys734 on SIRT1 can be sumoylated and this modification enhances the deacetylase activity of SIRT1 (Yang et al., 2007) SIRT1 deacetylates histone H3 lys 9, histone H4 lys 16 and histone H1 lys 26 and promotes the formation of facul tative heterochromatin (Vaquero et al., 2004) It also acts as a nonhistone protein deacety lase (Wojcik et al., 2009) The biological effect s of SIR T1 mediated deacetylation and modulation of histone and non histone substrates has been observed in aging, metabolism and cancer, as described below.

PAGE 39

27 Fig 3: Structure of SIR T1 Catalytic C ore. The interface between the two subdomains is represented by the dash line and that is where the active site of S IR T1 is located (Huhtiniemi et al., 2006) SIRT1 in A ging and M etabolism The role of SIRT1 in promoting longevity upon calorie restriction (CR) is well known in lower organisms (Gottlieb and Esposito, 1989; Lin et al., 2 000; Tissenbaum and Guarente, 2001) Therefore, investigation of its role in human ag ing is currently under evaluation. With the discovery of the SIRT1 activator r esveratrol, a polyphenol found in red wine, the function of this HD AC as an anti aging molec ule gained more interest and detailed research (Hall, 2003; Howitz et al., 2003) Restrictions in calorie intake have been linked to increase in life span in a number of studies (Guarente, 2000; Roth et al., 1999; Weindruch et al., 1986) However, the effect of calorie restriction on human longevity is currently not fully understood. On the question of mechanism, several theories have been put forth to explain the relationship between calorie restriction and aging. Metabolic changes have been presented as an important player in this relation. According to recent research, CR activates SIRT1 and SIRT1 in turn, regulates proteins that are involved in metabolism and promotion of aging. Upon calorie restriction, the rate of respiration increases which leads to

PAGE 40

28 an in increased rate of re oxidation of NADH to generate NAD + The increase in the ratio of NAD+ /NADH, mai n ly due to a decrease in NADH levels, may be responsible for increas ed SIRT1 activity (Lin et al., 2002) It has also been shown that PNC1 (pyrazinamidase/ nicotinamidase 1) can extend life span upon calorie restriction via SIRT1 activation. PNC1 encodes an enzyme that deaminates ni cotinamide and lowers its levels by converting it into nicotinic acid. Since nicotinamide is a known inhibitor of the enzymatic activity of SIRT1 decrease in its levels facilitates the activation of SIRT1 (Anderson et al., 2003) It has been reported that upon nutrient withdrawal, F OXO 3a interacts with p53 and binds to SIRT1 promoter thereby upregulating the transcription of SIRT1 Knockdown of FOXO3a or p53 inhibited the induction of SIR T1 upon starvation (Nemoto et al., 2004) Other reports have stated that SIRT1 protein levels increase upon calorie restriction but this increase is due to increased stability of the protein rather than increased transcription from the SIRT1 g ene (Kanfi et al., 2008a) Recently, it was reported that SIRT1 induction upon CR was tissue specific (Chen et al., 2008) SIRT1 levels we re higher in WAT (white adipose tissues) and muscles of calorie restricted mice as compared to ad libitum mice but lower in the liver of CR mice. WAT is the principal fat storage tissue and reduction in the storage of fat leads to increased lifespan in mam mals. T he ratio of NAD + /NADH was found to be higher in the WAT and muscles of CR mice but low in the liver which may be responsible for the variable extent of SIRT1 induction in different tissues. SIRT1 mediates the effect of calorie restriction by regulat ing a number of proteins involved in different metabolic pathways. SIRT1 has been shown to deacetylate and negatively regulate Peroxisome prolif erator activated receptor gamma 2 (PPAR 2), a key transcription factor that reg ulates the maintenance and differentiation of adipocytes and promotes adipogenesis (Picard et al., 2004; Tontonoz et al., 1994) SIRT1 acts as a co 2 and has been found on the prom oter of the PPA 2 target gene, aP2 2, SIRT1 prevents the accumulation of fat and pr omotes fat mobilization in WAT. Interestingly, in mice, SIRT1 was found to be recruited

PAGE 41

29 2 DNA binding sites in WAT only after fasting i ndicating that the mobilization of fat was a result of CR mediated by SIRT1 (Picard et al., 2004) SIRT1 has been shown to control the gluconeogenic pathway in liver in response to calorie restr iction by modulating a key tr anscriptional coactivator PGC (Rodgers et al., 2005) SIRT1 interacts with PGC and deacetylates it thereby activating the transcriptional function of PGC in the liver as evidenced by the induction of gluconeogenic genes that express proteins such as PEPCK and glucose 6 phosphatase (G6Pase) While SIRT1 regulates gluconeogeneis in liver via deacetylation of PGC mitochondrial biogenesis by deacetylating and activating PGC activity results in resistance to diet induced obesity (Lagouge et al., 2006) Upon low glucose availability (nutrient limitation), SIRT1 has been shown to induce mitochondrial fatty acid oxidation in skeletal muscles by deacetylating PGC genes (Gerhart Hines et al., 2007) Limiting levels of glucose induce SIRT1 by increasing NAD+ lev els and SIRT1 maintains the bioenergetic state of the cell by switching from glucose to fatty acid metabolism These reports suggest that SIRT1 regulates metabolism and homeostasis in response to CR in a tissuespecific manner The transcription factor STA T3 has been shown to suppress PGC neogenesis. It has been reported that STAT3 phosphorylation and acetylation levels are low in the liver upon fasting and treatment with the SIRT1 inhibitor EX 527 brings back the lev els of modified STAT3. In Sirt 1 knockout MEFs, STAT3 acetylation and phosphorylation levels are constitutively high suggesting that STAT3 is regulated by SIRT1 STAT3 and SIRT1 form a complex and SIRT1 deacetylates STAT3 thereby suppressing the inhibitory effect of STAT3 on gluconeogenesis while activating PGC PEPCK and G6Pase (Nie et al., 2009) A mouse model overexpressing Sirt 1 in pancreas was generated by a research group that suggested that SIRT1 insulin secretion in response to glucose. These mice, call ed the BESTO mice ( be ta cell -

PAGE 42

30 specific S ir t 1 o verexpressing ) expressed reduced levels of UCP2, an uncoupling protein that inhibits insulin, and increased ATP levels (Moynihan et al., 2005) Following studies demonst rated that S IR T1 could repress the transcription of UCP2 by directly binding to the UCP2 promoter (Bordone et al., 2006) However, 1824 months old BESTO mice lost their phenotype of glucose sensitivity and insulin secretion due to age associated decline in synthesis of NAD + and loss of Sirt 1 activity. Restoring NAD+ revived the glucose tolerant (Ramsey et al., 2008) Sirt 1 overexpressing transgenic mice also showed decreas ed levels of NFB, a proinflammatory transcription factor that is deacetylated and inhibited by SIRT 1 This inactivation of NF k B prevents cytokine(Lee et al., 2009) It has also been shown that induction of S IR T1 upon CR imparts protection to cells from stress induced death by deacetylating Ku70 which in turn sequesters B AX in the cytoplasm and prevents apoptosis by inhibiting its localization to the mitochondria (Cohen et al., 2004b) Therefore, S IR T1 promotes longer survival of cells. Considering the beneficial effects of S IR T1 upregulation on metabolism, activators of S IR T1 are being extensively researched and developed. As m e ntioned earlier, r esveratrol, a polyphenolic metabolite found in grapes and grape products has been shown to extend lifespan in lower organisms. In mamm als, it has been reported that r esveratrol can activate S IR T1 to enhance mitochondrial biogenesis by deacetylating and acti vating PGC muscles and brown adipose tissues (Lagouge et al., 2006) It has also been reported that r esveratrol can change the physiology of older mice fed on a highcalorie die t to that of a mouse fed on norm al diet and increase the survival age of these mice by increasing insulin sensitivity, decreasing IGF1 levels and increasing PGC general health of the animals (Baur et al., 2006) Small molecule activators of S IR T1 are being developed to specifically and significantly enhance the activity of S IR T1 and this includes the recent ly published report on SRT1720 (Milne et al., 2007) As mentioned

PAGE 43

31 pr eviously, this small molecule activator is a 1000 fold more potent than resveratrol and when used in diet induced obe se mice, it is able to improve glucose homeostasis and insulin sensitivity in liver, fat and muscle. The activator is able to mimic the pos itive effects of calorie restriction on metabolism and homeostasis. However, as stated in the last section, recent reports have questioned the specificity of resveratrol and SRT compounds against S IR T1 and have shown their ability to interact with a number of different proteins (Borra et al., 2005; Pacholec et al., 2010) Hence, their effect on longevity and glucose homeostasis may not be specifically via activation of SIR T1. The importance of SIR T1 in affecting major metabolic pathways has led us to investigate its role, if any, in tumorigenesis. The majority of cancers show a direct correlation between incidence and age Cancer has also been shown to be an outcome of deregul ated metabolism. Therefore, investigati on o f the role of S IR T1 in cancer will undoubtedly provide insight into the molecular mechanisms of S IR T1 and may provide new clinical targets for the prevention and treatment of this dise ase The following sections will follow the effect of S IR T1 on major transcriptional and translational signals and attempt to identify its function in cancer. S IR T1 and Cancer Histone deacetylases are better known as lysine deacetylases due to their ability to deacetylate histone as well as nonhistone proteins. S IR T1 is know n to have a number of histone and nonhistone protein substrates and by modifying them via deacetylation, S IR T1 plays an essential role in the regulation of key signaling pathways (Figure 4) It is now well established that cancer is a result of deregulati on of many of these pathways and the function of S IR T1 in manipulating proteins involved in these pathways is an active area of investigation.

PAGE 44

32 Fig 4: Functions of S IR T1. S IR T1 regulates various transcription factors (only few depicted in the diagram ) involved in senescence, apoptosis and cell cycle progression. It also regulates gene silencing and heterochromatin formation by epigenetically regulating histones (Kim and Um, 2008) S IR T1 Functions as a Histone Modifier and Gene S ilencer SIRT1 was discovered as a histone deacetylase and hence, its primary function as a histone modifier is well documented. SIRT1 has been shown to deacetylate lys9 of histone H3, lys 16 of histone H4 and lys 26 of histone H1 (Vaquero et al., 2004) Deacetylation of the above mentioned residues is a mark of condensed and genetically inactive DNA. SIRT1 also promotes methylation of histone H3 lys 9 and loss of methylation on histone H3 lys 79 which is interestingly, also a mark of repressed DNA (Vaquero et al., 2004) Such modifications in the promoters of genes results in silencing of transcription. Besides modifying the histones directly, SIRT1 has also been shown to deacetylate SUV39H1 and enhance its methylt ransferase function to promote tri -

PAGE 45

33 methylation of histone H3 lys 9 thereby promoting condensation of chromatin (Vaquero et al., 2007) Recently, it was shown that SIRT1 form ed a complex with SUV39H1 and Nucleomethyli n (NML) upon low nutrient availability and this complex could bind t o histone H3 lys 9 in the rDNA locus resulting in deacetylation of histone H3 and dimethylation of lys 9 ultimately repressing rRNA transcription. This silencing mechanism protects the cells from energy deprivationdependent apoptosis (Murayama et al., 2008) p300/CBP are histone acetyltransferases (HAT) that are involved in acetylating histones and activating transcription. These HATs need to be acety lated themselves to be functional. SIRT1 was found to deacetylate these HATs and facilitate their SUMOylation thereby indirectly promoting hypoacetylation of histones (Bouras et al., 2005) With regards to cancer, deacetylation and methylation of histones in the promoters of tumor suppressor genes can lead to loss of expression of tumor suppressor proteins thereby making the cell susceptible to transformation. On the other hand, suppression of oncogene expression by g ene silencing may support the role of SIRT1 as a tumor suppressor gene. SIRT1 D eacetylates and R egulates N onH istone P roteins. A number of transcription factors, repair proteins and signaling factors have been found to be substrates of SIRT1 With ongoi ng research the list of non histone substrates of SIRT1 is ever growing. It is interesting to note that SIRT1 regulates proapoptotic as well as anti apoptotic proteins and this complicates the designation of SIRT1 as an oncogene or tumor suppressor gene in cancer. Pro A poptotic Proteins D eacetylated by SIRT1 P53 was among the first non histone substrates of SIRT1 to be discovered. It was sh own that SIRT1 could deacetylate p53, inhibit its transcriptional function and prevent cellular senescence and apoptosis induced upon stress and DNA damage (Luo et al., 2001; Smith, 2002; Vaziri et al., 2001) In this regard, SIRT1 was considered an oncogenic factor due to its ability to inhibit the proapoptotic

PAGE 46

34 funct ions of p53 In subsequent years research showed that while SIRT1 deacetylated p53, there was no biological outcome of this deacetylation in terms of expression of p53 target genes or cell survival in response to stress (Kame l et al., 2006; Solomon et al., 2006) Studies in mouse models also demonstrated that there was no difference in the phenotype of mice that were genetically null for Sirt1 or null for both Sirt 1 and p53 and neither was there a difference in the response of the two genotypes to radiation induced apoptosis (Kamel et al., 2006) Another research group reported that embryonic fibroblast cells from Sirt 1 null mice exhibited hyperacetylated p53 a fter DNA damage but this was not accompanied with increased p21 levels or DNA damage sensitivity (Cheng et al., 2003) These results question the oncogenic role of S IR T1 in cancer. SIRT1 has been shown to deacetylate FOXO proteins. FOXO 3a is an acetylated protein in a normal cell and this acetylation increase s in response to stress such as exposu re to hydrogen peroxide or growth factor deprivation. SIRT1 interacts with F OXO 3a upon oxidative stress and deacetylates it. As a result, S IR T1 modulates the transcriptional function of FOXO 3a. F OXO 3a transcriptionally regulates a variety of genes that express proteins involved in DNA repair ( GADD45 ), cell cycle arrest ( p27 ) and apoptosis ( Fas ligand, B IM ). The effect of SIRT1 on FOXO 3a can either promote cell cycle arrest and DNA repair or inhibit FOXO 3a dependent apoptosis in response to oxidative stress depending on the tissuespecific expression of the F OXO3a target genes (Brunet et al., 2004; Motta et al., 2004) Similarly, F OXO 4, another member of the FOXO family is deacetylated by S IR T1. It was reported that u pon oxidative stress, acetylation of F OXO 4 by CBP inhibits its transcriptional function and deacetylation by SIRT1 rescues this inhibition (Motta et al., 2004; van der Horst et al., 2004) In prostate cancer cells, F OXO 1 a member of the FOXO family of proteins, is deacetylated and inhibited by SIRT1 via interaction with FHL2 (Four and a half LIM 2) F OXO1 is known to interact with the insulin response sequences in IGFBP1 gene promoter and transcriptionally

PAGE 47

35 activate the gene but co expression of FHL2 inhibits the activity of F OXO 1. It was reported that FHL2 enhances the interaction of SIRT1 and FOXO 1 to facilitate deacetylation of F OXO 1 and inhibit F OXO 1 mediated apoptosis (Mott a et al., 2004; Yang et al., 2005) SIRT1 has also been shown to deacetylate and inhibit the transcriptional function of E2F1. E2F1 has the unique property of behaving as a tumor suppressor gene as well as an oncogene depending on the degree to which it i s expressed and in the context of the cell cycle before or after DNA damage (Crosby and Almasan, 2004; Yamasaki, 1999) Knocking down SIRT1 has been shown to stimulate the transcriptional and apoptotic functions of E2F1 after treatment with DNA damaging drug etoposide. E2F1 on the other hand can transcriptionally induce the expression of SIRT1 thereby forming a negative feed back loop (Wang et al., 2006) A recent report suggests that SIRT1 acetyltransferase PCAF and E2F1 are all recruited to the promoter of the E2F1 target p73. Upon increase in intracell ular NAD+ levels, SIRT1 negatively regulates the acetylation and stability of PCAF as well as deacetylates E2F1 to inhibit the transcription of p73 (Pediconi et al., 2009) It has also been shown that similar to p53, SIRT1 can bind to p73 and deacetylate it thereby negatively regulating the pro apoptotic transcriptional function of p73 (Dai et al., 2007) Retinoblastoma ( R B ) is a well known tumor suppressor gene that regulate s cell cycle through its interaction with the E2F family of transcription factors (Harbour and Dean, 2000; Zhu, 2005) The function of R B is modulated by post translational modifications such as phosphorylation and acetylation. R B is hypophosphorylated and active during the quiescent stage of the cell cycle and hyperphosphorylated and inactivated during active cycling of the cell. Most cancers favor the hyperphosphorylated form of R B in order to maintain deregulated cell proliferation. It has been shown that active R B is generally hypophosphorylated and

PAGE 48

36 acetylated in the cell SIRT1 can deacetylate R B and this deacetylation is associated with hyperphosphorylation of R B Hence, S IR T1 promotes cell cycle progression by negatively regulating R B (Wong and Weber, 2007) Anti A poptotic Proteins D eacetylated by SIRT1 regulates genes involved in cell cycle, adhesion, angiogenesis and apoptosis. a heterodimer consisting of two subunits p50 and p65/RelA. It was shown that SIRT1 could interact with the p65/RelA subunit and deacetylate lys 310 on this subunit. This deacetylation SIRT1 was also found on the BIRC3 which encodes the anti apoptotic protein cIAP2 The presence of SirT1 delayed BIRC3 promoter thereby blocking mediated transcription and facilitating apoptosis (Yeung et al., 2004) Androgen receptor (AR) is a DNA binding transcript ion factor that governs cellular differentiation and proliferation in response to androgens in prostate cancer. AR activity is regulated by the hormone Dihydrotestosterone (DHT). DHT enhances co activators such as p300 and SRC and reduc es co repressors suc h as NCoR, HD A and Smad association with AR. It was found that SIRT1 could associate with AR in vitro and in vivo and repress its transcriptional activity by deacetylating AR. Hence, SIRT1 can inhibit the tumorigenic phenotype of prostate cancer cells that are dependent on DHT and AR for proliferation (Fu et al., 2006) catenin is a key component of the Wnt signaling pathway that regulates embryogenesis and is frequently deregulated in cancers. In the absence of the W catenin is constituti vely phosphorylated by GSK 3 and degraded. Upon W nt binding to its rec eptor, GSKcatenin which results in the stabilization and translocation

PAGE 49

37 catenin to the nucleus where it functions as a transcription factor to drive the expression of important genes such as CCND1 ( cyclin D1 ) caten in has been found to be constit utively activated in a majority of colon cancers. By overexpressing S IR T1 in the intestines of transgenic mice, it was shown that S IR catenin. S IR catenin and reduc e its nuclear expression thereby inhibiting cell catenin (Firestein et al., 2008) cMYC belongs to a family of transcription factors that bind to the E box sequences on the promoters of genes such as lactate dehydrogenase A ( LDHA ) TERT etc., and activate transcription by recruiting histone acetyltransferases. c MYC is often deregulated in cancers in response to oncogenic stimulation. It was shown that S IR T1 could deacetyl ate c MYC protein at lys 323 and decrease the stability of the protein. This in turn, decreased the expression of c MYC target genes. In xenograft experiments, overexpression of S IRT 1 inhibited tumorigenesis of myc3 cells that were injected in nude mice suggesting the tumor suppressive role of S IR T1. Interestingly, c MYC was found to transcriptionally activate S IR T1 by binding to the E box sequences in the S IR T1 promoter thereby forming a negative feed back loop with S IR T1 (Yuan et al., 2009) As mentioned previously, SIR T1 can deacetylate and inhibit the transcriptional function of E2F1 (Wang et al., 2006) Under certain conditions, overexpression of E2F1 promotes cell proliferation and tumorigenesis and by deacetylating E2F1, SirT1 can rescue the oncogenic phenotype of E2F1. S IRT1 in DNA Damage Repair It has been hypothesized that SIRT1 can affect DNA damage repair by modifying the chromatin structure at the sit e of damage. An increase in nicotinamide at the site of damage due to activation of PARP (NADdependent enzyme) can

PAGE 50

38 result in the temporary inactivation of SIRT1 at the DNA damage site thereby allowing for the deacetylated chromatin to decondense and grant access to repair enzymes (Kruszewski and Szumiel, 2005) Ku70 is a well known DNA damage repair factor that is involved in repairing double strand breaks in the DNA cause d by ionizing radiations, physiological oxidation reactions, chemotherapeutic drugs, etc. It has been reported that upon acute stress, K u70 is acetylated at lys 539 and lys 542 by CBP/PCAF acetyltransferases and this acetylation is responsible for disrupting the association of Ku 70 with the proapoptotic factor BAX. As a result B AX localizes to the mitochondria to bring about apoptosis (Cohen et al., 2004a) It was shown that upon calorie restriction, SIRT1 was induced and it deacetylated K u70. Upon deacetylation, Ku70 associated with B AX and sequestered it in the cytoplasm thereby preventing its localization to the mitochondria and preventing apoptosis. Hence, by regulating the DNA repair protein K u70, SIRT1 was shown t o promote cell survival (Cohen et al., 2004b) The MRN (MRE11 RAD50 NBS1) is a DNA repair complex that localizes to DNA strand breaks and activates the DNA damage checkpoints for repair. NBS1 is the regulatory subunit of the M R N complex and it is phosphorylated by ATM kinase upon DNA damage. This phosphorylation is important for sensing of damage by the MRN complex and efficient repair response. p300 and PCAF acetyltransferases were reported to acetylate NBS1 and ac etylation of NBS1 inhibited its phosphorylation. Of all the histone deacetylases, only SIRT1 was found to deacetylate NBS1. Hypoacetylated NBS1 could be phosphorylated at ser 343 in response to ionizing radiation to mediate DNA repair (Yuan and Seto, 2007) Hence, SIRT1 was found to promote DNA damage repair by positively regulating NBS1.

PAGE 51

39 SIRT1 and Cellular S enescence. Mouse embryonic fibroblasts (MEFs) harvested form m ice that were genetically null for Sir t 1 exhibited different properties as compared to wild type fibroblasts. It was found that after a few passages, wild type MEFs underwent growth arrest while Sir t 1 null MEFs continued to proliferate. Adding back Sir t 1 c aused the MEFs to behave similar to the wild type MEFs. Interestingly, adding back deacetylase mutant of Sir t 1 did not re vert the null phenotype to wild type suggesting that Sir t 1 deacetylase activity was important for reversal of the enhanced proliferation of the null phenotype. It was also shown that p19ARF levels accumulated in MEFs over several passages but the accumulation was significantly less in the Sir t 1 null MEFs. It was also shown that knock down of S IR T1 in human primary fibroblasts could extend their replicative lifespan. However, SIRT1 has no t been shown to deacetylate p19ARF or the histones on its promoter. The targets of SIRT1 that influence replicative senescence have not been identified (Chua et al., 2005) SIRT1 in Autophagy Autophagy is a regulated mechanism used to degrade organelles and proteins in order to maintain homeostasis and normal development of the cell. It is known to be induced upon nutrient withdrawal to shut down nonessential proce sses and conserve energy for the essential pathways required for cellular survival. Under extreme stress, however, autophagy functions as another mode of cell death besides apoptosis, necrosis and senescence. A TG genes play an important role in mediating autophagy via formation of autophagosomes. Several ATG genes are known and it has been shown that SIRT1 can form a molecular complex with A TG 5, 7 and 8 and deacetylate them (Lee et al., 2008; Salminen and Kaarniranta, 2009) Sirt 1 null mice exhibited hyperacetylation of the ATG proteins and these mice were unable to induce autophagy in the event of starvation. Accumulation of defective organelles and misfolded proteins were observed i n the tissues of the Sirt 1 null m ice. Transient overexpression of Sir t 1 induced autophagy in cells despite the presence of nutrients while the deacetylase mutant of Sir t 1 was unable to do so indicating the importance

PAGE 52

40 of the deacetylase activity of Sir t 1. All in all, the above results demonstrated that upon calorie restriction, Sir t 1 was induced which in turn upregulated the basal levels of autophagy in the cell to conserve energy and maintain survival of the cell upon stress (Lee et al., 2008; Salmin en and Kaarniranta, 2009) Mouse Models of S IR T1 In 2003, a Sirt1 null mouse model was generated by Cheng et al., to study the role of S IR T 1 in normal growth and development. By genetargeting, mice were generated that expressed either a mutant Sirt1 pro tein that lacked part of the catalytic domain or did not express Sirt1 at all. It was observed that both mice exhibited the same phenotype. Only 10% of the Sirt1 null mice were obtained due to a high rate of post natal lethality for this genotype. The survi ving Sirt1 null mice were smaller than the control littermates with very low sperm counts, cardiac defects and eye abnormalities. Of note was the observation that upon DNA damage by UV radiation or adriamycin, p53 was hyperacetylated in the Sirt1 null MEFs as compared to the control MEFs but the hyperacetylation was not accompanied by an increase in the total levels of p53 or phosphorylated levels of p53 nor was there any difference in the levels of p21 protein as compared to control MEFs. There was no diff erence in sensitivity to ionizing radiation between the Sirt1 null and wild type MEFs. However, thymocytes from Sirt1 null mice were found to be more sensitive to ionizing radiation in a p53 dependent manner as compared to those from the wild type control mice (Cheng et al., 2003) Ano ther Sirt1 transgenic mouse was developed recently by Wang et al., to study the function of SIRT 1 in tumorigenesis. Sirt1 null mice were generated by deleting exons 5 and 6 from the Sirt1 gene resulting in loss of Sirt1 protein expression. The postnatal mortality of the Sirt1 null mice was higher than that observed in the mouse model generated by Cheng et al., most likely due to the difference in the mouse strain. Chromosomal abnormalities and incomplete chromosomal condensation was observed in the Sirt1 de ficient cells as was a lack in

PAGE 53

41 heterochromatin formation. The cells exhibited abnormalities in cell cycle check points at low Sirt1 deficient cells also exhibited to ionizing radiation indicating impaired DNA damage repair. Transfection of Sirt1 in these Sirt1 null cells resulted in the formation of almost equal Sirt1 / ;p53/ mice were generated and it was found that abse nce of p53 could not rescue the phenotype associated with Sirt1 deficiency suggesting that Sirt1 null phenotypes are not caused by p53 activation. It was also found that Sirt1 +/ ;p53+/ mice developed spontaneous tumors and the tumor incidences were much higher than t hose observed in Sirt1 +/ or p53+/ mice. The tumors from the double heterozygous mice had severe chromosomal abnormalities and while most of the tumors exhibited LOH for p53, majority of them retained one allele of Sirt1 suggesting that S IR T1 may function as a haploid tumor suppressor gene (Wang et al., 2008a) Regulation of SIRT1 SIRT1 is regulated at transcriptional, post transcriptional and posttranslational levels. While the functions of SIRT1 have been extensively studied and described, there is a lack of comprehensive information on its regulation. A few proteins have been reported to modulate the expression and function of SIRT1 as stated below.

PAGE 54

42 Fig 5: Regulation of SIRT1 SIRT1 gene expression is modula ted at both transcriptional and posttranscriptional levels, and its deacetylase activity is modulated through proteinprotein interaction and sumoylation at its three protein domains (Liu et al., 2009) Transcriptional R egulation of SIRT1 The earliest reports on S IR T1 regulation involved F OXO 3a and p53 (Nemoto et al., 2004) It was shown that upon nutrient deprivation, S IR T1 mRNA as well as protein levels were induced up to four fold and this induction was associated with nuclear translocation of the transcription factor FOXO 3a. Knock down of F OXO 3a abrogated the induction of S IR T1 expression levels w hereas constitutive activation of FOXO 3a resulted in activation of S IR T1 promoter despite the presence of nutrients. It was further shown that the S IR T1 promoter contained two p53 binding sites and mutation of either one of them reduced the stimulatory eff ect of nutrient deprivation on S IR T1. FOXO 3a and p53 were found to interact with each other upon nutrient withdrawal and FOXO3a stimulated S IR T1 mRNA expression via p53 binding sites on the S IR T1 promoter (Nemoto et al., 2004) E 2F1 has been shown to induce S IR T1 gene transcription. As mentioned earlier, E2F1 forms a negative feed back loop with S IR T1. S IR T1 deacetylates and inhibits E2F1 transcriptional function while E2F1 can bind to S IR T1 promoter at around 65 bp upstream of the ATG sequence and induce S IR T1 gene expression. The E2F1/R B pathway is frequently deregulated during oncogenic transformation and increased activation of E2F1 leads to

PAGE 55

43 increase in S IR T1 expression in cancer. It was also shown that DNA damag e induced by drugs such as etoposide resulted in stabilization of E2F1 and was associated with enhanced expression of S IR T1 mRNA and protein levels. Hence, high S IR T1 levels may be an outcome of transformation rather than its cause (Wang et al., 2006) HIC1 or Hypermethylated in Cancer 1 is a transcriptional repressor that is frequently silenced in cancer by epigenetic modifications. It has been shown to interact with p53 and function as a tumor suppressor gene that can induce cell death upon DNA damage. HIC1 has a POZ domain that allows for proteinprotein interaction and it is through this domai n that it can interact with S IR T1. In HIC1 null cells, S IR T1 levels were elevated. It has been shown that HIC1 can interact with S IR T1 protein and HIC1 S IR T1 complex can be recruited to the S IR T1 promoter to repress the transcription of S IR T1 (Chen et al., 2005) As a result of transcriptional repression of SI R T1, p53 is acetylated and stabilized to induce cell death upon DNA damage. With age, the HIC1 promoter undergoes hypermethylation and epigenetic silencing of g ene expression resulting in upregulation of S IR T1 expression, deacetylation of p53 and resistance to DNA damageinduced cell death. Hence, S IR T1 promotes cell survival as well as the risk of transformation. HIC1 has also been shown to interact with CtBP, a transcriptional corepressor, to downregulate S IR T1 gene expression. Upon stress that increas es the NAD + /NADH ratio, CtBP undergoes certain posttranslational modifications and its interaction with the prolinerich domain of HIC1 decreases. Due to this decr eased association, HIC1 is unable to repress S IR T1 gene transcription effectively and S IR T1 expression is induced (Zhang et al., 2007) The oncogene c MYC has also been found to transcriptionally regulate S IR T1 (not shown in Figure 5). c MYC forms a negative feedback loop with S IR T1 wherein S IR T1 deacetylates c MYC protein and decreases its stability while c MYC binds to the S IR T1 promoter and

PAGE 56

44 induces its transcription (Yuan et al., 2009) The S IR T1 promoter was found to contain three potential c MYC binding regions (E Box 1, 2 and 3). By ChIP analysis, it was found that c MYC localized to the E box ( E1) on the S IR T1 promoter and enhanced S IR T1 transcription. Upon oncogenic transformation, deregulation and overexpression of c MYC is often observed and this can lead to increase in SIR T1 levels in cancers. Increase in S IR T1 levels can, in turn, deacetylate and destabilize c MYC thereby preventing the transcription of c MYC target genes such as TERT However, the tumor suppressive qualities of S IR T1 may be relevant only if the tumor has not become addicted to S IR T1 due to its anti apoptotic functions (as d escribed in the earlier sections ). Breast Cancer AssociatedGene 1 or BRCA1 is a well known tumor suppressor gene which is frequently mutated in familial breast cancers. This gene plays an essential role in several important biological pathways involving DNA damage repair, cell cycle progression, apoptosis, etc. Recently, this gene has been shown to regulate the expression of S IR T1. It was noted that tumors exhibiting low levels of functional BRCA1 also had low levels of S IR T1 but higher levels of Survivin an anti apoptotic molecule. BRCA1 was found to transcriptionally upregulate S IR T1 Further experiments show ed that overexpression of S IR T1 in BRCA1 mutant cancers could inhibit tumor formation by inhibiting cell proliferation. Interestingly, this inhibit ion of cell proliferation by S IR T1 was only seen in BRCA1 mutant cell lines and not BRCA1 wild type cells lines. It was also shown that S IR T1 could bind to the promoter of Survivin and promote methylation of histone H3 lys 9 thereby inhibiting the transcription of Survivin. Therefore, BRCA1 was found to downregulate Survivin via regulation of S IR T1 (Wang et al., 2008b) Posttranscriptional R egulation of S IR T1 The RNA binding protein HuR is the only protein that has been shown to regulate S IR T1 at the posttranscriptional level. It binds to the 3

PAGE 57

45 untranslated region of the S IR T1 mRNA and stabilizes the transcript which leads to increased S IR T1 protein expression (Abdelmohsen et al., 2007) In human diploid fibroblast cells, HuR levels decrease upon senescence and this is associated with lower S IR T1 levels. Further, it has been shown that upon oxidative stress, HuR is phosphorylated by the check point kinase, CHK 2, and this modif ication causes HuR to dissociate from S IR T1. As a result, S IR T1 mRNA degrades and S IR T1 prote in expression is downregulated thereby sensitizing the cells to oxidative stress. Hence, HuR downregulates SIRT1 expression by affecting the stability of SIRT1 mRNA after oxidative damage. Posttranslational R egulation of S IR T1 The Active Regulator of S IR T1, AROS was identified from a yeast twohybrid screen using S IR T1 as bait. AROS was found to bind to the N terminal sequence o f S IR T1 and enhance SIRT1 mediated deacetylation of p53. By promoting p53 deacetylation, AROS downregulated p53 transcriptional function as concluded from p53 dependent B AX luciferase and p21 luciferase reporter assays. Furthermore, SIRT1 inhibitors such as nicotinamide abrogated AROS and S IRT1 induced p53 inactivation. Depletion of AROS resulted in hyperacetylated p53 and increase in p21 levels. It was also found that cells stably expressing AROS were resistant to DNA damage caused by drugs such as etoposide. This was due to the promotion of SIRT1 deacetylase activity which leads to downregulation of p53 transcriptional function and loss of expression of p53 target genes that promote cell death in response to stress and DNA damage (Kim et al., 2007; Ve rdin, 2007) Deleted in Breast Cancer 1 or DBC1 is a gene that is frequently lost in breast cancer due to its location on chromosome 8p21 which shows LOH in breast cancer. I ts function in the cell is relatively unknown. Recently, it was shown that DBC1 c ould bind to SIRT1 and inhibit its deacetylase activity (Kim et al., 2008; Zhao et al., 2008) The leucine zipper motif (LZ) of

PAGE 58

46 DBC1 was found to bind to the N terminal domain of SIRT1 and this association negativel y regulated the deacetylase activity of SIRT1 Also, DBC1 was able to rescue SIRT1 mediated deacetylation of p53 by abrogating the SIRT1 p53 interaction (Zhao et al., 2008) It has also been shown that DBC1 can abrogate the SIRT1 SUV39H1 complex thereby affecting histone methylation and heterochromatin formation (Li et al., 2009) Recent research has shown that the SIRT1 protein is sumoylated. SUMO (small ubiquitin related modifiers) molecules can tether to lysine residues of proteins similar to ubiquitin molecules but instead of targeting the sumoylated molecule for degradation, this modification plays a role in genomic stability and transcriptional silencing (Muller et al., 2004; Verger et al., 2003) Su moylation is reversible and SENP1 functions as a sumospecific protease to reverse the modification (Bailey and O'Hare, 2004) SIRT1 was found to be sumoylated at lys 734 and this increased its deacetylase activity. SENP1 was found to desumoylate SIRT1 and downregulate its deacety l a se activity. Stress inducing agents such as UV radiation or hydrogen peroxide, increased the interaction of SENP1 with SIRT1 thereby promoting the desumoylation and inactivation of the anti apoptotic function of SIRT1 Therefore, SENP1 was shown to regulate cell death in response to stress by activating p53 and its target genes via inhibition of SIRT1 activity (Yang et al., 2007) Thirteen phosphorylation sites have been identified on the SIRT1 protein by Mass spectrometry (Sasaki et al., 2008) It has been shown that cyclin B/cdk1 can form a complex with SIRT1 and phosphorylate thr 530 and s er 540. P hosphorylation at these sites can increase SIRT1 activity in mitotic cells. Dephosp horylation of SIRT1 inhibits its deacetylase activity and fails to rescue the proliferation defects in Sirt1 null MEFs. However, the molecular targets that are affected by SIRT1 phosphorylation are still to be determined. Another report suggests that SIRT1 can be phosphorylated by CK2 at serine residues 154, 649, 651, 683

PAGE 59

47 upon DNA damage Phosphorylation of SIRT1 by CK2 increases its deacetylase activity by increasing its substrate binding affinity (Kang et al., 2009) SIRT1 Expression in Cancer: Reports and C ontroversies The earliest reports of SIRT1 as a non histone deacetylase involved p53. It was shown that deacetylation of p53 by SIRT1 inhibited its transcriptional function and hence, SIRT1 was considered an oncogene (Luo et al., 2001; Smith, 2002; Vaziri et al., 2001) The role of SIRT1 since then has been studied in detail and a number of SIRT1 functions have been brought to light. While some r eports have deemed SIRT1 as an oncogene based on its function and expression pattern in tumors (Huffman et al., 2007; Stunkel et al., 2007) other reports have provided evidence for a tumor suppressive function of S IRT1 (Firestein et al., 2008; Wang et al., 2008a) The importance of p53 acetylation in its stabilization and transcriptional function has been questioned. While some researchers have shown that acetylation of p53 m ediated by p300/CBP in response to DNA damage enhances sequence specific DNA binding (Lill et al., 1997; Olsson et al., 2007; Sakaguchi et al., 1998) others have shown that enhancement of p53 function is independent of its acetylation status (Espinosa and Emerson, 2001) In light of the above conclusions, the significance of p53 acetylation is controversial and so is the functional effect of SIRT1 me diated p53 deacetylation. Besides p53, SIRT1 has been shown to regulate proteins that participate in various pro apoptotic and anti apoptotic pathways. To date the controversies regarding the exact role of SIRT1 in cancer have not been resolved and further research will be required to reach a conclusion. Stunkel et al., compared the levels of SIRT1 in cancer cell lines with normal cells and found that SIRT1 was overexpressed in almost all the cancer cell lines that were tested. When stained with anti SIRT1 antibody, HeLa and SW620 cell lines exhibited cytoplasmic localization of SIRT1 Staining of a colon tumor microarray (TMA) also revealed cytoplasmic localization of SIRT1 in the tumor as well as normal colon tissues (Stunkel et al., 2007) This

PAGE 60

48 result was unexpected since the nuclear localization of SIRT1 i s a well established fact and further investigation of this expression pattern will reveal its significance. Another research group identified two nuclear import and two export sequences on SIRT1 protein and found that SIRT1 could shuttle between the nucleus and cytoplasm in C2C12 myoblast cells (Tanno et al., 2007) SIRT1 was nuclear in undifferentiated C2C12 and localized to the cytoplasm upon differentiation. Nuclear SIRT1 was found to protect the cells against oxidative damage induced cell death but the function of cytoplasmic SIRT1 is yet to be determined. It was hypot hesized that the cytoplasmic localization of SIRT1 is a mode of regulation such that removal of SIRT1 from the nucleus allows for acetylation and activation of certain nuclear substrates of SIRT1 To study the role of SIRT1 in cancer, Huffman, et al., developed a prostate cancer mouse model called TRAMP (Transgenic adenocarcinoma of mouse prostate) (Huffman et al., 2007) Sirt 1 levels were found to be elevated in prostate adenocarcinomas in these mice. Simultaneously, HIC1 levels were downregulated leading the authors to suggest that lower levels of HIC1 ex pression were responsible for the observed increase in SIRT1 Levels of acetylated lys 9 on histone H3 were also reduced in these cancers. Upon staining prostate tumor biopsies, it was found that SIRT1 expression was high in the cancer cells as compared to the normal surrounding cells. Based on the association of elevated SIRT1 levels with advanced prostate cancer the authors summarized that SIRT1 functions as an oncogene and may serve as a potential target for prostate cancer therapy. However, this model does not provide conclusive evidence for SIRT1 as a cause of prostate cancer. It merely shows an association between high SIRT1 expression and prostate cancer Recently, a research group generated a Sir t 1 null mouse model to determine the role of SIRT1 in t umorigenesis (Wang et al., 2008a) They discovered that cell s obtained from Sirt1 / embryos exhibited incomplete chromosome condensation and chromosome instability. These cells also demonstrated cell cycle abnormal ities and impaired DNA damage repair as compared to Sirt1+/+ cells. Furthermore, it was discovered that Sirt1+/ ;p53+/ mice were

PAGE 61

49 more prone to development of spontaneous tumors as compared to Sirt1+/ or p53+/ mice. These observations led the authors to suggest that SIRT1 may function as a tumor suppressor. They then analyzed a set of clinical tissues to study the levels of SIRT1 expression in tumors and found that SIRT1 levels were lower than normal in glioblastoma, bladder carcinoma, prostate carcinoma and certain ovarian cancers This expression pattern in the different tumors along with observations from the Sirt1 null mice led the authors to suggest that SIRT1 has a tumor suppressive function. To study the effect of SIRT1 on tumor formati on and growt h in colon, the A pcM in colon cancer mouse model was bred to a Sirt1 transgenic mouse to obtain progenies that overexpress Sirt 1 Polyp formation in Sirt1 overexpressing m ice w as compared to control A pcM in mic e. As observed by Firestein, et al., Sirt 1 overexpression was associated with few er adenomas in the colon of A pcM inMost recently, the McBurney lab generated a transgenic mouse model for Sirt 1 null genotype. Most of these transgenic mice grew to adulthood probably due to their outbred background and were used to test whether SIRT1 inhibits or promotes the development of cancer (Boily et al., 2009) To study the effect of SIRT 1 on skin carcinogenesis, DMBA was applied to the skin to initiate cancer and TPA to promote the cancer in wild type and Sir t 1 null mice. No difference in tumor formation was observed between the two genotypes but interesting ly, treatment with resveratrol could reduce the tumors in both groups although to a lower extent in Sir t 1 null genotypes suggesting a SIRT1 dependent as well as independent anti tumorigenic role of resveratrol. Upon crossing Sir t 1 transgenic mice with A pc mice suggesting a tumor suppressive role for Sirt 1 .It was shown that Sirt 1 catenin. Indeed, in a colon TMA, the nuclear localization of SIRT1 was associated with a catenin suggesting that SIRT1 cateni n by nuclear exclusion besides deacetylating and inhibiting its transcriptional function (Firestein et al., 2008) M in mice to study

PAGE 62

50 the effect of S ir t 1 in colon cancer, it was found that the number of polyps that developed in the A pcM in; Sirt1+/+ and A pcM in; Sir t 1 / mice were almost the same but the ApcMinThe above observat ions concerning the role of SIRT1 in cancer are conflicting at best. Ongoing research is still attempting to answer whether SIRT1 is a tumor promoter or tumor suppressor gene Our investigation on this subject has provided more clues towards determining the role of SIRT1 in tum o r igenesis. Our studies mainly focus on the role of SirT1 in colon cancer. Colon cancer is the third most common cancer in men and women in the United States. It is the second leading cancer killer bu t as many as 60% deaths from this cancer can be prevented by regular screening tests of individuals 50 years of age and older (Centers for disease control and prevention, 2009). Adenomatous polyps in the colon represent the benign form of this cancer It i s followed by adenomas with highgrade dysplasia and then invasive cancer. Stages I and II of the invasive cancer are confined within the walls of the colon. Further metastasis to the lymphnodes qualifies as stage III of colon cancer and metastasis to dist ant sites is considered stage IV (Markowitz and Bertagnolli, 2009) Stages I to III are curable by surgery and chemotherapy but stage IV disease remains incurable (Markowitz and Bertagnolli, 2009) 5 F luorouracil ( 5 FU ) is one of most commonly used drug s for the treatment of colon cancer. It is a nucleoside analog that blocks thymidylate synthase enzyme thereby inhibiting thymine nucleotide synthesis and preventing DNA replication. The vitamin Leucovorin is often admini stered with 5 FU to improve its efficacy as a therapeutic drug (Segal and Saltz, 2009) Camptothecin or CPT, a topoisomerase I inhibitor, was also found to be an effective agent against colon cancer although, a derivative of CPT called Irinotecan is more commonly used (Conti et al., 1996; Hsiang et al., 1985) Some ; Sir t 1 / mice had smaller sized polyps. All in all, work by this research group concluded that S IRT1 at its endogenous expression level, does not modulate susceptibility to tumor formation but is essential for resveratrol mediated chemoprotection and that the S IR T1 gene expression may have to be induced to a certain level for it to function as a tum or suppressor.

PAGE 63

51 therapeutic regimens also involve a combination of I rinotecan and 5 FU as a more effective method of treatment (Douillard et al., 2000; Saltz et al., 2000) While early detection and newer drugs are helpful in reducing the number of deaths, morbidity and mortality due to colon cancer is sti ll distressingly high and there is a constant need for identification of new markers and development of drugs against new targets to combat this disease. Our experiments with SIRT1 have shown an interesting behavior of this protein in colon cancer. We hav e observed that SIRT1 inhibits proliferation of colon cancer cells and inhibiting SIRT1 by shRNA promotes tumor growth in xenograft experiments. Interestingly, inhibition of SIRT1 also sensitizes the cells to chemotherapy. Upon examination of a colon tumor microarray, SIRT1 was found to be highly expressed in normal colon mucosa and benign adenomas but its expression was low in a subset of malignant adenocarcinomas. Our results therefore, suggest a context dependent tumor suppressive function of SIRT1 in co lon cancer where SIRT1 inhibits tumor initiation and growth but augments cell death upon treatment with DNA damaging d rugs Further studies in this direction will allow us to understand the importance of S IR T1 activators and inhibitors in the treatment of colon cancer.

PAGE 64

52 Chapter Two Materials and Methods Cell L ines HCT116 (kindly provided by Dr. Bert Vogelstein), U2OS, A549 and 293T cells were maintained in Dulbeccos modified Eagles Medium (DMEM) with 10% fetal bovine serum (FBS) E2F1 null and w ild type MEF cells lines were provided by Dr. Jack Pledger and S irt 1 null and wild type cell lines were generated by crossing Sir t 1 heterozygous mice and generating MEFs from 13dpc embryos (protocol described in later sections). S IR T1 knock down in HCT116 cells was accomplished by using RNAi technology. A doublestranded oligonucleotide (5 GATCCCG TTGGATGATATGACA CTG TTCAAGAGA CAGTGTCATATCATCCAAC TTTTTTGGAAA S IR T1 target sequence underlined) was cloned into the pSuperiorRetroPuro vector (OligoEngine). The plasmid was packaged into retrovirus by transfecting the amphotropic packaging cell line LA (a kind gift from Dr. Peiqing Sun, the Scripps Institute) Retrovirus containing supernatant from the transfected LA cells was used to infect HCT116 cells. The infected cells were selected in 0.51g/ml puromycin for 10 to 14 days and the drug resistant colonies were pooled for analysis. Virus expressing scrambled shRNA (5 GATCCC GCCGTCGTCGATAAGCAATAT TTGATATCCG ATATTGCTTATCGACGACGGC TTTTTTA ) was also generated and used to infect HCT116 cells that served as control. Another set of SIRT1 knock down HCT116 cell lines were generated using S IR T1 shRNA in pSM2 vector (Openbiosystems shRNA library from Molecular Biology Core, H. Lee Moffitt Cancer Center). LA cells were used to generate virus expressing S IR T1 siRNA and scrambled siRNA and these virus were used to infect HCT116 cells. Puromycin resistant colonies were pooled at

PAGE 65

53 the end of two weeks and analyzed for SIRT1 knock down. SIR T1 knock down in A549 cells was obtained by the same protocol as described for HCT116 cells. For the generation of tetracyclineinducible S IR T1 cell lines, a lentiviral system was used. Lentivirus vector expressing S IR T1 was generated using the ViraPowerTM T RExTM system following ins tructions from the manufacturer (Invitrogen) HCT116 were first infected with the T REX regulator lentivirus and selected with 4 g/ml blasticidin. This was followed by infection with the S IR T1 lentivirus and selection with 300 g/ml Zeocin to obtain a pool of colonies S IR T1 overexpression was obtained upon induction with 1g/ml tetracycline. Plasmids and Reagents Human S IR T1 plasmid was kindly provided by Dr. Wei Gu. The S IR T1 nuclear import mutant was generated by site directed mutagenesis (K35E) in the putati ve NLS sequence RKRPRR. The deacetylase dead mutant was generated by sitedirected mutagenesis (H363A) in the catalytic domain of S IR T1. HA tagged E2F1 plasmid was provided by Dr. Doug las Cress and HA tagged CBP was provided by Dr. Hua Lu. S IR T1 monoclonal antibody 10E4, used for immunohistochemical staining was generated in the lab against the C terminal domain of SIRT1 SIRT1 polyclonal antibody was purchased from Upstate Biotechnology. Monoclonal anti E2F1 antibody (KH 95) was purchased from Santa Cruz B iotechnologies and antibodies against pR B and R B were purchased from Cell Signaling and Santa Cruz Biotechnology respectively. Polyclonal Antibody against E2F1 AcK117 was raised against acetylated E2F1 peptide HPG(AcK117)GVKSPG and affinity purified. Anti HA antibody was purchased from Covance. The SIRT1 inhibitor EX 527 was purc hased from Tocris Bioscience. 5 FU (5 Flu o rouracil) and CPT (Camptothecin) were purchased from Sigma and used at the indicated concentrations. Methyl -3 H thymidine was purchased from Amersham Biosciences for proliferation assays.

PAGE 66

54 Transfections Calcium Phosphate T ransfections. 293T cells were used to perform calcium phosphate transfections because of their high transfection efficiency. To study the effect of SIR T1 on E2F1 acetylation, 293T cells were grown to almost 90% confluency in 10cm tissue culture dishes. A mixture of E2F1, S IR T1 and CBP (CREB binding protein) plasmids were made to 40g and combined with 400l water and 125mM calcium chloride. This mixture was added dropwise to 500l of HEPES ( 0.28 M NaCl, 0.05 M HEPES, 1.5mM CaCl2) while bubbling. After bubbling, the entire mixture (almost 1ml) was added to the plate of 293T and incubated for 16h18h at 37 transfected 293T were re fed with fresh medium and pl ates were incubated for another 24h before harvesting. Lipofectamine T ransfections For transfection of cells in 6 well plates (colony formation assay) or 24well plates (luciferase assay), Lipofectamine 2000 was used ( Invitrogen). Cells were grown to 60% confluency in DMEM with 10% FBS but no antibiotics. For each transfection, required plasmids were mixed up to 1g (including carrier DNA and GFP) and combined with 50l OPTIMEM (reduced serum medium). To this plasmid mix, 1l of Lipofectamine 2000 combined with 50l of OPTIMEM was added and the entire mixture (almost 100l) was added to one well of the plate. After incubation for 1824h, the cells were either lysed for luciferase assay or re fed with complete medium containing 750g/ml G418 for selection and colony formation assay. Western Blotting Western Blotting was done for protein analysis. Cells were harvested in Phosphate Buffer Saline (PBS) and centrifuged for 5 6min at 650 g at 4 (50mM Tris HCl pH 8.0, 5mM EDTA, 150mM NaCl, 0.5% NP40, 1mM PMSF, and protease inh ibitors) and centrifuged for 10 min at 14,000 rpm at 4 C. The supernantant was transferred

PAGE 67

55 to a clean tube and protein conc entration was determined using Bradford reagent. 2030g protein was fractionated by SDS PAGE and transferred to Immobilon P filters (Millipore). The filter was blocked in PBS containing 5% non fat dry milk and 0.1% Tween20 for 30 60min at room temperatur e. Then the filter was incubated with primary antibody diluted in blocking solution to an appr opriate concentration for 2h to overnight at 4 three times i n PBS with 0.1% Tween20 for 10 min each before incubating in secondary antibody. The secondary antibody HRP IgG goat anti mouse or HRP IgG goat anti rabbit was diluted in blocking solution and applied to the filter for 2h at room temperature. Following the secondary antibody, fil ter was washed five times for 6 min each with PBS and 0.1% Tween20 and developed using either ECL plus reagent (Amersham) or Supersignal (Pierce) Human S IR T1 was detected using 10E4 (monoclonal) at 1:40 dilution. Acetylated E2F1 was detected with Ack117 (polyclonal; generated in the lab) at 1:1, 000 dilution, E2F1 was detected with E2F1 KH 95 (Santa Cruz Biotechnology) at 1:3,500 dilution, phospho R B ser 795 was detected w ith pRB 795 polyclonal antibody ( cell signaling ) at 1:1, 000 dilution, total RB was detected with IF8 antibody (Santa Cruz Biotechnology) at 1:3,000 dilution. Immunoprecipitation Assay For immunoprecipitation assays, cells were harvested in PBS and ce ntrifu ged at 4 6 min at 650 g. The pellet was lysed in lysis buffer (50mM Tris HCl pH 8.0 5mM EDTA, 150mM NaCl, 0.5% NP40, 1mM PMSF, and protease inhibitors), centrifuged for 10 min at 14,000 rpm at 4 C and the supernatant was transferred to a clean micr ofuge tube The supernatant was immunoprecipitated using 1g of E2F1KH95 antibody and 40l of sepharose Protein A slurry at 4 4 5 times with lysis buffer, boiled in SDS sample buffer, fractionated by SDS PAGE and analyzed by Western blot.

PAGE 68

56 Quantitation of DNA S ynthesis HCT116 cells were cultured in 24 well plates and EX 527 was added at the indicated concentrations for 18h. 5Ci of Methyl 3 H thymidine was then added for 1h to label the DNA. The ce lls were lysed in 0.2ml Lysis Buffer [2%SDS, 10mM EDTA pH 8.0] per well and incubated at 75 seconds. 170l of the cell lysate was applied to S/P glass fiber filters (Baxter) arranged over a sheet of aluminum foil. The f ilters were incubated in ice cold 10% tr icholoroacetic acid for 510 min and then transferred to a vacuum manifold. The filters were washed with 10ml ice cold 5% trichloroacetic acid followed by 5ml of 95% ethanol. The filters were then allowed to dry and s uspended in 2ml scintillation mixture and the counts read on a liquid scintillation counter. Each sample was treated at least in triplicates or as the indicated n values and the difference between each treatment was determined by calculating the p values using two tailed s tudents t test. p values less than 0.05 were considered significant. Colony Formation A ssay To study the effect of constitutive overexpression of S IR T1 on colony formation, HCT116 cells were plated at 50% confluency in a 6well plate. Each well was transfected with 1g of one of the following plasmids: pcDNA3 vector, pcDNA3S IR T1, pcDNA3 S IRT1 H363A deacetylase dead mutant or pcDNA3S IR T1 K35E cytoplasmic mutant using Lipofectamine 2000. 24h after transfection, the media was changed and 750g/ml G418 was added to the wells. The drug was constantly maintained in the wells and the colonies that were formed at the end of two weeks were visualized by staining with crystal violet. To study the effect of 5 FU on colony formation, 100 HCT116 ce lls each (control and SirT1 knockdown or EX 527 treated and untreated) were plated in 6well plates. 24h after plating, the cells were subjected to different doses of 5 FU as indicated. 24h after treatment with 5 FU the cells were washed and refed with f resh medium to allow for cells to recover and form

PAGE 69

57 colonies that are resistant to 5 FU At the end of two weeks, the colonies that were formed were visualized by staining with crystal violet. Growth Assay To study the effect of EX 527 on proliferation of cells, 500 HCT116 cells were seeded in 6c m plates in triplicates for indicated doses of EX 527. Enough plates were prepared to study the growth over a period of 7 8 days. Three plates were harvested every 24h for each dose and cells were counted using a hemocytometer. A growth curve was plotted and standard deviation was calculated using the values obtained from the triplicate samples. Reporter Assay 80,000 HCT116 cells were seeded in 24well plates and transfected with 10ng cyclin D3luc reporter plasmid, 1ng GFP, 200ng carrier DNA (salmon sperm), 5ng E2F1, 10ng CMV LacZ, 20 or 40ng S IR T1 and 20 or 40ng S IR T1 H363A mutant as indicated. Each transfection was done in quadrupl icates. Lipofectamine 2000 was used to perform the transfections and after 2430h, the cells were lysed and the luciferase and Betagalactosidase expression was measured. A graph was plotted that represented the luciferase values normalized with the betagalactosidase values. Cell Cycle and Apoptosis A ssays Cell Cycle A nalysis. HCT116 c ells were seeded to 90% confluency in 6c m plates and transfected with 0.5g vector alone or 0.5g S IR T1 using Lipofectamine 2000 reagent. 24h after transfection, cells were treated w ith 100 ng/ml nocodazole for 18 h, and harvested by trypsinization. The pel let was washed twice with PBS and resuspended in 1ml PBS and fixed by adding 2ml ice cold ethanol while slowly vortexing. Ethanol fixed cells were stored at 20 for a minimum of 24h and then washed with PBS. The cells were then stained with primary

PAGE 70

58 anti S IR T1 antibody (10E4) for 3 h, and secondary antimouse fluorescein isothiocyanate (FITC) for 1 h with rotation at room temperature Subsequently, the cells were stained with 50g/ml propidium iodide (PI) and analyzed by fluorescence activated cell sorting (F ACS) Fluorescein isothiocyanate positive cells were analyzed for cell cycle distribution. To study the effect of EX 527 and camptothecin (CPT), HCT116 cells were treated with the indicated doses of the drugs for 18h and harvested and fixed in ethanol. They were then stained with 50g/ml PI and analyzed for apoptotic sub2N population. TUNEL A ssay The In Situ Cell Death Detection kit from Roche Applied Science was used to perform a TUNEL assay to study the response of HCT116 cells to 5 FU and EX 527. HCT 116 cells were seeded in 10c m plates and treated with the drugs at indicated doses for 18h. Trypsin was used to harvest the cells and washed in PBS at least three times. The pellet of cells were resuspended in PBS and counted to adjust to 3 X 107 cells/ml in 100l PBS. While slowly vortexing, 100l of freshly prepared fixation solution (2% methanol free formaldehyde in PBS pH7.4) was added to the cell suspension and the mix was incubated on ice for 15 min. The suspension was centrifuged at 300 g for 10 min at 4 finally resuspended in 0.5ml PBS. To this, 5ml of ice cold 70% ethanol was added and incubated overnight. Next day, cells were washed twice with PBS and resuspended in 50l TUNEL reaction mixture (50l of TdT or Terminal deoxynucleotidyl Transferase with 450l F dUTP label solution as suppled with the kit). At the same time, a negative control was prepared in which the TUNEL reaction mix only consisted of label solution and a positive control in which the fixed cells had been treated with microco ccal nuclease or DNase I for 10min at room temperat ure to induce DNA strand breaks. The positive control was also resuspended in 50l of TUNEL reaction mix. All samples were incubated for 1h at 37 humidified incubator in dark. Cells were washed twice with PBS and resuspended in 1ml of PBS and analyz ed by FACS for green fluorescence positive cells.

PAGE 71

59 Immunohistochemical S taining For TMA staining, t he Colon Tumor Microarray was developed from patient samples collected at the Moffitt Cancer Center, Tampa, FL. This tissue micro array includes over 100 colo n tumor tissue samples and normal colon tissues. The tissue micro array was stained for S IR T1 using the 10E4 monoclonal antibody by the Histopathology Core at the Moffitt Cancer Center. T he tissue microarray slide was processed using a Ventana Discovery XT automated system (Ventana Medical Systems) as per the manufacturers protocol with proprietary reagents. Slides were deparaffinized on the automated system with EZ Prep solution (Ventana). Heat induced antigen retrieval method was performed using Cell Conditioning Solution (Ventana). The 10E4 hybridoma supernatant was used at 1:150 dilution in Dako antibody diluent and incubated for 60min. The Ventana Universal Sec ondary Antibody was used for 32 min at 37 C. The detection system used was the Ventana DABMap kit. Slides were counterstained with hematoxylin and scanned by the Analytical Microscopy Core. The S IR T1 staining level of each tumor tissue sample and the normal control tissues was examined by three i ndividuals and scored from 0 to 3 based on the intensity of the stain. For Staining A pcM in Mouse T issue S lides i ntestines were harvested from the desired genotypes and fixed in 10% buffered formalin overnight followed by paraffin embedding and sectioning. The tissue slides were deparaffinized by subjecting to three changes of xylene for 10min each followed by rehydration using decreasing gradient of ethanol (100%; 95%; 70%; 50%; 30%; water). Slides were incubated in freshly prepared Sodium citrate buffer (10mM sodium citrate, 0.05% Tween20, pH 6.0) for 30m in at 95 C and then cooled for 20min at room temperature. Then slides were washed in two changes of 1X PBS and incubated in 0.3% H2O2 for 15min at room temperature to quench endogenous peroxidase activit y followed by three washes with 1X PBS. The ABC staining system for Rabbit antibody (Santa Cruz Biotechnology) was used for staining. Briefly, the tissue sections were blocked in 1.5%

PAGE 72

60 Normal Goat Serum for 1h followed by incubation in primary antibody, pol yclonal anti Sir2 antibody (Upstate # 07131) at 1:500 dilution for 16h at 4 and incubated in biotinylated s econdary antibody for 30 min at room temperature followed by incubation with the AB enzyme reagent and developed in DAB chromogen. Animal Experiments All experimental procedures involving animals were approved by the Institutional Animal Care and Use C ommittee (IACUC) of the University of South Florida. Tumor Xenograft E xperiments. For the tumor xenograft assays, 7 to 8 weeks old AthymicNCr nu female mice were inoculated subcutaneously on both flanks with 8 X 106 HCT116 control or S IR T1 siRNA cells. To study the effect of S IR T1 overexpression, 8 X 106 HCT116 control or lenti S IR T1 cell were injected on both flanks of the nude mice and S IR T1 expression was induced by feeding the mice with a diet containing 500mg/kg doxycycline to induce the lentiviral expression of S IR T1.Tumors were measured every two days with digital calipers and the tumor volumes were calculated using the formula [(average of two diameters)/2]3 0.5236. Paired students t test was used for statistical analysis and calculation of the p value where p<0.05 was considered a significant value for difference between tumor volumes. The tumor xenograft assay performed with A549 S IR T1 siRNA and control cell lines followed the sam e protocol as described above for the HCT116 cells. Animal B reeding. A pcM in mouse was purchased from The Jackson Laboratory as a male C57Bl/6J heterozygous for the M in mutation in the Apc M in mutation indicates a point mutation in one all ele of the Apc gene such that codon 850 is converted from a leucine to a STOP codon and the resulting protein is truncated. The heterozygous genotype was propagated by breeding with wildtype C57Bl/6 females and a colony was established.

PAGE 73

61 A pcM in null mice w ere not viable. The A pcM in heterozygous mice develop spontaneous intestinal polyps by 60 days of age upon losing the wild type allele of the Apc gene thereby mimicking the mutation that causes Familial Adenomatous Polyposis (FAP) in humans. Genotyping was done using primers that recognize the mutant allele of the Apc gene. Min Forward primer: 5 TGA GAA AGA CAG AAG TTA 3 and Min Reverse primer : 5 TTC CAC TTT GGC ATA AGG C 3. PCR conditions: 94 min; 35 cycles of 94 1min, 72 fo r 30s; followed by 72 min. The amplified mutant allele appears at 340 bp. The Sirt 1 heterozygous mice in 129sv background were kindly provided by Dr. Fred Alt and Dr. Toren Finkel In these heterozygous mice, one allele of the Sirt 1 gene contains a targeted LoxP pgk NeoR selection cassette the presence of which reduces the total Sirt 1 protein level in heterozygous MEFs as observed by Western blotting with anti Sir2 antibody. Genotyping for these mice were done using three primers in the same PCR reaction to simultaneously detect the mutant allele (800 bp) and the wild type allele (500bp) of Sirt 1. Forward Primer KO F 5 CTTGCACTTCAAGGGACCAA 3 and two reverse primers SKO R1 5 GTATACCCACCACATCTGAG 3 and SKO R2 5 CTACCACTCCTGGCTACCAA 3. PCR condit ions: 95 min; 35 cycles of 95 or 90s; followed by 72 min. To study the effect of Sirt 1 on polyp formation in A pcM in mice, Sirt 1 heterozygous mice were bred with A pcM in mice and the progenies were genotyped. A pcM in progenies that were wi ld type or heterozygous for Sirt 1 were selected and sacrificed at 6 months of age and the intestines were harvested and fixed in formalin. This was followed by paraffin embedding, sectioning and H&E staining. Polyps were counted and noted. The difference in the number of polyps between the two genotypes was calculated by using s tudents t test where p<0.05 is significant.

PAGE 74

62 To study the effect of S IR T1 on lung tumorigenesis, a lung tumor mouse model was purchased from the Mouse Repos itory (Mouse Models of Human Cancers Consortium). The K rasLA2 mouse strain (Johnson et al., 2001) contains a latent K ras allele that can be activated by spontaneous mitotic recombi nation resulting in an active K ras G12D mutant allele. As a result, mice heterozygous for this all ele develop tumors mainly in the lungs and their mean survival age is around 200 days. Male K ras mutant was obtained and bred to female C57Bl/6 mice and a colony was established. Mice were genotyped by using three primers in the same PCR reaction. One comm on forward primer was used and two reverse primers that could recognize either the wild type allele or the mutant allele (K001 forward: 5 TGCACAGCTTAGTGAGACCC 3; K002 reverse wild type: GACTGCTCTCTTTCACCTCC 3; K003 reverse mutant: 5 GGAGCAAAGCTGCTATTGGC 3). For the experiment, Sirt 1 het erozygous mice were bred with K rasLA2 heterozygous mice and the K ras LA2 progenies that were wild type or heterozygous for Sir t1 were selected ( K ras G12D ;Sirt 1+/+ or K ras G12D ; Sir t 1+/ ). PCR condit ions: 94 ; 35 cycles of 94 for 1min, 60 72 To study the effect of Sirt 1 on lung tumor nodule formation, 12 mice from each genotype were sacrificed at 20 weeks of age. The lungs were harvested and nodules on all five lobes were counted. The lungs were then insufflated and fixed in formalin and paraffin embedded sectioned and stained for Sirt 1 levels using anti Sir2 antibody. The difference between the numbers of tumor nodules from the two genotypes were calculated using the students t test where p<0.05 is significant. To study the effect of Sirt1 on survival of the K rasLA2 mice, 36 Kras G12D ;Sirt1+/+ and 24 Kras G12D ;Sirt1+/ were observed and their date s of birth and death were recorded. A KaplanMeier Curve was plotted and the statistical significance of survival between the two groups was tested by calculation of p value using the chi square test.

PAGE 75

63 Generation of MEFs To generate Sirt1 wild type, Sirt1 heterozygous and Sirt 1 homozygous null MEFs, Sirt 1 he terozygous male was bred to Sirt 1 heterozygous female and embryos were harvested. The protocol was modified from Boris Greber. Pregnant females were sacrificed at 13dp c by cervical dislocation and the oviducts (left and right) were removed and rinsed w ith 70% ethanol. Then the oviducts were washed twice with PBS to remove any traces of ethanol. Working in a sterile environment, embryos were removed one at a time from the oviduct and placed in different petri dishes to avoid cross contamination. Each embryo was separated from the surrounding membrane and the placenta and minced such that it was pipettable. Using a small amount of trypsin, each embryo was transferred to a separate microfuge tube and placed in a mix er/shaker at 600 800 rpm for 30min at 37 allow the contents to break up. The contents of the microf uge tube were then mixed with 5ml of complete medium (DMEM+10% FBS) and the debris was allowed to settle. Supernatant was transferred to a separate tube and spun to obtain a cell pell et. The cell pellet was resuspended in culture medium and plated in a culture dish followed by overnight incubation at 37 the cells were frozen as Passage P0 and the other half were collected for Western analysis to detect the expression of Sirt 1.

PAGE 76

64 Chapter Three Results SIRT 1 K nock Down P romotes Growth of Colon Tumor X enograft Previous research and results have suggested that S IR T1 exhibits pleiotropic functions in cell culture experiments, i.e., anti apoptotic as well as anti proliferative. To further test the role of endogenous S IR T1 in tumor formation, HCT116 colon carcinoma cells were stably infected with retrovirus vector (pSuperior) expressing control or S IR T1 shRNA. Polyclonal cell lines were generated from pooled colonies and confirmed for the knock down of S IR T1 (Figure 6) To test their ability to form tumors in xenograft assay, cells were inoculated subcutaneously on the dorsal flanks of athymic nude mice. Each animal received both control and knock down cell lines to facilitate comparison under similar conditions (Figure 6). Figure 6: Endogenous S IR T1 Expression Limits T umorigenicity. A retrovirus vector pSuperior expressing control or S IR T1 shR NA (SIRT1 shRNA1) was used to infect HCT116 cells, and the colonies were pooled to generate a polyclonal SIR T1 knock down cell line. The expression of S IR T1 in the control and knock down cells was determined by Western blot. Cells were injected subcutaneously in the dorsal flanks of athymic nude mice, and tumor formation in a representative animal is shown.

PAGE 77

65 The results showed that tumors formed from S IR T1 knock down cells were 2 to 3 fold larger than control cells inoculated in the same animal ( n = 10, p = 0. 0007 using s tudents t test where p < 0.05 is significant ) (Fi gure 7). Figure 7: S IR T1 Knock Down P romotes T umorigenicity Tumors arising from the S IR T1 control and knock down cell lines were measured after 14 21 days and their volumes were calculated ( n = 10, p = 0.0007 as calculated using paired s tudents t test where p < 0.05 is statistically significant). To ensure that the tumors arising from the S IRT1 knock down cell line had maintained low S IR T1 levels, tumors from five random mice were harvested, ho mogenized and lysed in Lysis Buffer. The expression of S IR T1 in these tumors was test ed by Western Analysis (Figure 8 )

PAGE 78

66 Figure 8: Low S IR T1 Levels are M aintained in Tumors A rising from S IR T1 Knock Down Cell L ines: Five mice were randomly selected and t he tumors from each flank were harvested, homogenized and lysed. S IR T1 levels were detected using anti Sir2 antibody (Upstate Biotech) To rule out off target effects of S IR T1 shRNA 1 a separate pair of HCT116 control and knock down cell lines was generat ed using completely different control shRNA and S IR T1 shRNA sequences and expression vectors obtained from the OpenBiosystems shRNA library. The xenograft experiment was repeated and it was observed that S IR T1 knock down cells form ed significantly larger t umors than control cells ( n = 13, p = 0.01 using s tudents t test, where p < 0.05 is significant (Figure 9a and 9 b) thereby confirming the results obtained from SIRT1 shRNA1 Together, t hese results suggest that endogenous SIR T1 in HCT116 cells inhibits the g rowth of tumor xenografts.

PAGE 79

67 Figure 9: Knock D own of SIR T1 Increases T umorigenicity. (a) pSM2SIRT1 shRNA2 vector was used to generate a second HCT116 knock down cell line. S IR T1 knock down efficiency was compared to cells with pSuperior S irT1 shRNA1 by wes tern blot. (b) HCT116 S IR T1 knock down and control cells were injected subcutaneously in the dorsal flanks of athymic nude mice and tumor volumes were measured. Tumors formed from S IR T1 knock down cells were larger than those from control cells ( n=13 and p=0.01).

PAGE 80

68 T he role of S IR T1 in suppressing tumor growth was not limited to colon tumors. A xenograft assay using A549 lung tumor cells with S IR T1 knock down also resulted in accelerated tumor growth (Figure 10). Figure 10: Knock D own of S IR T1 I ncreases T umorigenicity in Lung Cancer Cell L ine. Eight million A549 control and S IRT 1 knock down cells were injected subcutaneously in the dorsal flank s of athymic nude mice and tumor volumes were measured after 14 21 days Tumors formed by S IR T1 knock down cells were larger t han those from control cells ( n=9 and p =0.003 ). SIR T1 O verexpression S uppresses the Growth of Colon T umor X enograft The above results suggest that expression of endogenous S IR T1 partially suppresses tumor formation. To further test this hypothesis, HCT116 cells were stably infected with a tetracyclineinducible lentivirus vector expressing S IR T1. In this cell line, S IR T1 expression could be induced to almost 4 fold above endogenous level by 1g/ml tetracycline (Fig ure 11).

PAGE 81

69 Figure 11: Gener ation of HCT116 Inducible S IR T1 Cell Lines. HCT116 cells were infected with a tetracyclineinducible lentivirus vector expressing S IR T1 or control vector S IR T1 expression was induced by 1g/ml Tetracycline within 24h. The levels of S IR T1 were detected by Western blot. To test the effect of SIRT1 overexpression on tumor growth, nude mice were injected on either side of their flanks with lenti vector and lenti SIRT1 infected HCT116 cells These mice were kept on a diet containing doxycycline to induce SIRT 1 expression. The results showed that, in contrast to the phenotype of SIRT1 knock down, overexpression of SIRT1 significantly reduced the tumorigenicity of HCT116 cells (Fig ure 12). It is noteworthy that in a significant fraction of cases (8 of 14), HCT11 6 lenti SIRT1 cells gave rise to extremely small or no tumors. This suggests that, besides inhibiting cell proliferation, overexpression of SIRT1 may suppress the initial establishment of tumors in this setting.

PAGE 82

70 Figure 12: S IR T1 Overexpression S upp re sses the Growth of Colon Tumor X enograft: A thymic nude mice were injected on the dorsal flanks with eight million HCT116 lenti vector and HCT116 lenti S IR T1 cells The mice were continuously fed with chow containing doxycycline (500 mg/kg). Tumors were measured and the graph indicates the tumor volumes generated by the control versus the S IR T1 overexpressing cell line ( n = 14, p = 0.02 as calculated with paired s tudents t tes t ). To ensure that SIRT1 was being induced from the Lentivirus by doxycycline, pairs of tumors from four random mice were harvested, homogenized and lysed in Lysis Buff er and SIRT1 levels were tested by Western Analysis (Figure 13 ). SIRT1 overexpression was found to be almost four fold in the tumors arising from the Lenti SIRT1 cell line as compared to the tumors arising from the Lenti vector cell line.

PAGE 83

71 F igure 13: Doxycycline I nduces S IR T1 E xpression in Tumor Xenograft A ssays. Mice were continuously fed with chow containing doxycycline at a concentration of 500mg/kg Four mice were rando mly selected and the tumors w ere harvested and lysed. S IR T1 induction was detected by Western analysis using anti Sir2 antibody. Inactivation of SIR T1 S timulates T umor C ell P roliferation To further test whether physiological levels of endogenous S IR T1 pl ays a role in regulating cell proliferation, cells were treated with S IR T1 specific inhibitor EX 527. This compound has significantly improved potency and specificity against S IR T1 as compared to nicotinamide (Solomon et al., 2006) When HCT116 cells were cultured in 0.1% serum, addition of EX 527 caused a 90% increase in cell number after 7 days (Fig ure14 ).

PAGE 84

72 Figure 14: Inhibition of S IR T1 Stimulates Cell P roliferation upon Nutrient D eprivation (Growth A ssay) HCT116 cells cultured in 0.1% serum were maintained in different concentrations of S IR T1 specific inhibitor EX 527, and cell number was determined at the indicated time points. Error bars represent mean + S.D. ( n = 3 ). In the presence of 10% serum, EX 527 did not change cell number in long term culture ( Fig ure15). This result s hows that, upon growth factor deprivation, S IR T1 functions as a significant regulator of cell proliferation.

PAGE 85

73 Figure 15: Inhibition of S IR T1 Does Not A ffect Cell P roliferation in Normal Growth C onditions (Growth A ssay) HCT116 cells cultured in 10% ser u m were maintained in different concentrations of EX 527 and cell number was determined at indicated time points. DNA replication was analyzed by [3H] thymidine incorporation assay to accurately measure changes in cell proliferation rate. The results show ed that treatment with EX 527 stimulated DNA replication by up to 30% in low serum (Figure 16).

PAGE 86

74 Figure 16: Inhibition of S IR T1 Stimulates Cell P roliferation upon Nutrient D eprivation. HCT116 cells cultured in 0.1% serum were treated with EX 527 for 18h DNA replication was measured by [3H] thymidine incorporation assay. Error bars represent mean + S.D. ( n = 14) and p = 0.03 as calculated with s tudents t test where p < 0.05 is statistically significant. Despite the moderate magnitude of enhancement, the growt h stimulating effect of EX 527 was statistically significant ( p =0.03 using s tudents t test) and highly reproducible in replicate assays. The moderate but sustained increase in cell proliferation is likely responsible for the large increase in cell population. However, w hen cells were cultured in 10% serum that supports optimal growth, EX527 treatment did not stimulate further DNA synthesis thereby underlining the importance of S IR T1 as a growth regulator in stress ed conditions (Figure 17).

PAGE 87

75 Figure 17: Inhibition of S IR T1 Does Not A ffect Cell P roliferation in Normal Growth C onditions. HCT116 cells cultured in 10% serum were treated with S IR T1 specific inhibitor EX 527 for 18h. DNA replication was measured by [3H] thymidine incorporation assay. Actinomyc in D, a known inhibitor of cell proliferation was used as a control. Error bars represent mean S D (n=6) p=0.38 between 2M EX 527 treated cells and control cells suggesting no significant difference Importantly, inhibition of S IR T1 also stimulated the proliferation of A549 (lung tumor) and U2OS (osteosarcoma) cells suggesting that its growthsuppressive effect is not limited to colon cancer cells (Figure 18a and b)

PAGE 88

76 Figure 18: Inhibition of S IR T1 Stimulates Cell Proliferation in Different Cell L in es. A549 and U2OS cells cultured in 0.1% serum were treated with EX 527 for 18h. DNA replication was measured by [3H] thymidine incorporation assay. Error bars represent mean S.D. (n=6). p=0.005 for figure 18a and p=0.02 for figure 18b suggest ing a significant increase in proliferation of cells treated with EX 527 as compared to control cells. To demonstrate that the growthstimulatory effect of EX 527 is due to inhibition of S IR T1, mouse embryonic fibr oblasts (MEFs) derived from Sirt1 null mice were analyzed. Initial experiments revealed that late passage Sirt 1 null and wild type MEFs were significantly different in their proliferation rate and morphology thereby making them unsuitable for such

PAGE 89

77 analysis. Therefore, we generated low passage (P4) Sirt 1 / and Sirt 1+/+ MEFs from littermate embryos obtained by breeding Sirt 1 +/ mice (described in Materials and Methods). Figure 19: E xpression of Sir t 1 in MEFs. Sir t 1 heterozygous mice were bred and the embryos were harvested 13dpc to generate MEFs from littermates. Sir t 1 levels were determined by Western Blotting using anti Sir2 antibody (Upstate Biotechnology). Figure demonstrates the absence of Sir t 1 expression in Sir t1 / MEFs and reduced expression in Sir t1+/ MEFs as compared to the SirT1 +/+ MEFs. Early passage Sir t 1 / MEFs clearly showed more robust growth in culture, and a significantly higher rate of DNA synthesis ( 150%) when compared with Sir t 1+/+ MEF (Figure 20).

PAGE 90

78 Figure 20: Absence of Si r t 1 S timulates Cell P roliferation. E arly passage (P4) MEFs from Sir t 1 +/+ and Sir t 1 / mouse embryos were tested for DNA synthesis rate by [3H] thymidine incorporation. An identical number of cells from each genotype were plated prior to 18h culture in 1% s erum and 1h metabolic labeling. Error bars represent mean + S.D. ( n = 6) p = 0.00001 T reatment with EX 527 also induced a statistically significant 30% increase in DNA synthesis in Sir t 1+/+ MEF ( Figure 21a). Importantly, no growth stimulation by EX 527 was observed in the Sir t1 null MEF (Figure 21b) These results demonstrate that S IRT 1 is a suppressor of cell proliferation and that the growthpromoting activity of EX 527 c ompound is due to specific inhibition of its intended target S IR T1.

PAGE 91

79 Figure 21 : Increased Cell Proliferation is a R esult of Sir t 1 I nhibition. Early passage (P4) MEFs from Sir t 1+/+ and Sir t 1 / mouse embryos were test ed for DNA synthesis rate by [3H] thymidine incorporation. Identical numbers of cells from each genotype were plated prior to 18h culture in 1% serum and 1h metabolic labeling. Error bars represent mean S D (n=12). p=0.017 in figure 21a which indicates a significant increase in proliferation of Sirt1+/+ MEFs cells treated with 2M EX 527 as compared to control. However, no stimulation of proliferation is obs erved in the Sir t 1 / cell line when treated with EX 527 as observed in figure 21b

PAGE 92

80 S IR T1 I nhibits C ell P roliferation To further test the potential of S IR T1 in suppressing cell proliferation, HCT116 cells were used in a colony formation assay. Expression of S IR T1 from pcDNA3 vector significantly reduced the number of G418resistant colonies formed after transfection (Fig ure 22) In contrast, S IR T1 NLS mutant (K35E) that failed to enter the nucleus, or deacety lase inactive mutant (H363A) did not suppress colony formation. Additionally, i mmunofluorescence staining of pooled HCT116 G418 resistant colonies obtained from stably transfecting S IR T1 failed to detect S IR T1 overexpression (data not shown) suggesting tha t continuous overexpression of SIRT1 is detrimental to cell survival. Figure 22: S IR T1 Inhibits Cell P roliferation (Colony Formation A ssay) HCT116 cells were seeded in a 6 well plate and transfected with either pcDNA3 vector, S IR T1, S IR T1 K35E NLS mutan t, or S IR T1 H363A deacetylase mutant. Transfected cells were subjected to selection with 750g/ml G418, and the colonies were stained with Crystal Violet after 2 weeks. Fluorescence activated cell sorting analysis of HCT116 cel ls transiently transfected w ith SIR T1 showed that S IR T1 overexpression induced efficient G1 cell cycle arrest ( Figure 23 ) which is consistent with the lack of outgrowth of S IR T1 overexpressing cells after long term culture.

PAGE 93

81 Figure 23: Inhibition of Cell P roliferation by S IR T1 (FACS Analysis) HCT116 cells were transfected with S IR T1 for 24h, treated with nocodazole for 18h, and stai ned using SIR T1 antibody. S IR T1 negative cells (Gate R1 in the upper left panel and cell cycle distribution in the lower left panel) and S IR T1 positive cells (Gate R2 in the upper right panel and cell cycle distribution in the lower right panel) were analyzed. S IR T1 mediated regulation of cell proliferation is expected to be associated with changes in cell cycle machinery. To this end, hyper phosphorylation at ser 795 residue on the retinoblastoma protein ( RB ) was reproducibly detected after EX 527 treatment of serum starved HCT116 cells suggesting a cell cycle inhibitory effect of SIRT1 (Fig ure 24 ). In contrast, cells cultured in 10% serum al ready exhibited higher basal phosphorylation at ser -

PAGE 94

82 795 residue that was not stimulated any further by EX 527 (Fig ure 24). These results further confirm that S IR T1 in tumor cells may act as a suppressor of cell proliferation during stress. Figure 24: S I R T 1 Inhibition is Associated with I ncreased R B P hosphorylation. HCT116 cells treated with 2 M EX 527 were analyzed for phosphorylation level of R B at ser 795 by Western blot (anti phospho serine 795, Cell Signaling) followed by reprobing with R B antibody (IF8, Santa Cruz Biotechnology) Among the various S IR T1 substrates, E2F1 is a likely mediator of the growth suppressive effect of S IR T1. Previous results from our laboratory have shown that S IR T1 binds to E2F1 and inhibits its transcriptional activity. It was shown that cell cycle arrest caused by overexpression of S IR T1 could be rescued by co expressing E2F1 (Wang et al., 2006) We confirmed that in a reporter assay, expression of S IR T1 inhibited E2F1mediated activation of cyclin D3 promoter in a deacetylase dependent fashion (Figure 25).

PAGE 95

83 Figure 25: S IR T1 Inhibits E2F1Mediated A ctivation of Cyclin D3 P romoter H1299 cells were transiently transfected with cyclin D3 promoter luciferase, E2F1, S IR T1, and S IR T1 H363A mutant. Promoter activity was measured by luciferase assay and normalized to cotransfected CMV lacZ level. Error bars represent mean + S.D. ( n = 4). Using an E2F1 K117 acetylationspecific antibody generated in our laboratory (refer to Materials and Methods) we found that E2F1 acetylation induced by the coactivator CREB binding protein (CBP) was strongly inhibited by S IR T 1 The S IR T1 H 363A catalytic mutant was partially defective for E2F1 deacetylation in this assay, possibly due to residual activity when expressed at high levels (Fig ure 26)

PAGE 96

84 Figure 26: S IR T1 D eacetylates E2F1. 293T cells were transiently transfected with E2F1, H A tagged CBP ( CREB binding protein) and S IR T1. E2F1 was immunoprecipitated and probed with anti Ac K117 antibody to determine E2F1 acetylation levels The membrane was reprobed for E2F1 and S IR T1 expression levels. Furthermore, the ability of EX 527 to stimu late cell proliferation in wild type MEFs was not observed in E2F1/ MEFs (Fig ure 27). These results, together with our recent finding of SIR T1 E2F1 interaction, suggest that the mechanism of cell cycle regulation by S IR T1 is in part through inhibiti on of E2F1.

PAGE 97

85 Figure 27: S IR T1 I nhibits Cell P roliferation via E2F1. W ild type and E2F1 / MEFs were cultured for 18h in 1% serum and 2M EX 527. DNA replication was measured by [3H] thymidine incorporation assay. Error bars represent mean + S.D. ( n = 8) For wild type MEF cells, p = 0.0 2 indicating significant difference in proliferation after treatment. For E2F1/ MEFs, p = 0.7, indicating no effect by EX 527 treatment. Inhibition of S IR T1 Sensitizes T umor Cells to C hemotherapeutic A gents Many studies have implicated a role of S IR T1 in promoting cell survival after stress or chemotherapy. To test whether S IR T1 can exert protection against DNA damaging agents in the same HCT116 cells where it has anti proliferative function, cells with S IR T1 knock down wer e treated with 5 FU which is frequently used in colon cancer chemotherapy. S IR T1 knock down clearly reduced long term cell viability after drug treatment in a colony formation assay (Fig ure 28 ).

PAGE 98

86 Figure 28: Inhibition of S IR T1 I ncreases S ensitivity to C hemotherapy. HCT116 control and S IR T1 shRNA cell lines were treated with different concentrations of 5 FU for 24 h. Cells were incubated in drugfree medium for 15 days at the end of which colonies were stained with Crystal Violet. HCT116 cells were trea ted with the S IR T1 inhibitor EX 527 (2M) and subjected t o different concentrations of 5 FU It was observed that similar to S IR T1 knock down, treatment with the S IR T1 inhibitor also reduced long ter m viability after exposure to 5 FU (Figure 29).

PAGE 99

87 Figure 29: Inhibition of S IR T1 by EX 527 I ncreases S ensitivity to C hemotherapy H CT116 cells were treated with 2M EX 527 and different concentrations of 5 FU for 24 h. Cells were incubated in drug free medium for 15 days at the end of which colonies were stained with Crystal Violet Besides Colony formation assays, sensitivity to chemotherapy was also measured in short term TUNEL assays. It was observed that EX527 enhanced ( almost 100%) the abi lity of low concentrations of 5 FU to induce apoptosis (10 M Figure 30 ) but had no further benefit with higher concentrations of 5 FU (50M, data not shown)

PAGE 100

88 Figure 30: Inhibition of SIR T1 Promotes Cell Death in R esponse to C hemotherapy. HCT116 cells were treated with 2M EX 527 and 10M 5 FU for 18 h and analyzed by TUNEL staining and fluorescenceactivated cell sorting for the presence of apoptotic cells. EX 527 treatment also significantly enhanced the level of apoptosis in HCT116 cells induced by another colon cancer drug C amptothecin (CPT) as observed by the sub 2N population in a Fluorescence Activated Cell Sorting analysis (Figure 31).

PAGE 101

89 Figure 31: Inhibition of S IR T1 Increases Apoptotic Response to DNA D amage. HCT116 cells were treated with EX 527 and C amptothecin (CPT) at indicated amounts for 18h and analyzed by FACS for the presence of apoptotic sub2N population. The raw data is represented by the curves that have not been filled in and the percent age of apoptosis is indicated in each case. These results suggest that, under acu te stress or upon DNA damage, S IR T1 expression provides a survival advantage to the cells Because rapidly proliferating cells are often more sensitive to DNA damageinduced apoptosis, the growthinhibitory activity of S IR T1 may be partly responsible for i ts anti apoptotic function.

PAGE 102

90 S IR T1 i s E xpressed at H igh L evels in N ormal C olon and B enign L esions To investigate the role of S IR T1 in human cancer development, we developed and characterized a monoclonal antibody 10E4 against the C terminal domain of human S IR T1. The antibody is highly specific for S IR T1, detects a single band on Western blot, and shows no reactivity to other cellular proteins (Figure 32). Figure 32: Characterization of S IR T1 A ntibody. Detection of a single p rotein band by S IR T1 monoclonal antibody 10E4, in a W estern blot. Identical amounts of protein from different cell lines were loaded in each lane. In an immunohistochemical analysis, 10E4 detects differential nuclear staining in control cells and SIRT1 kn ock down cells thereby demonstrating its ability to reveal the differences in S IR T1 expression level s (Figure 33).

PAGE 103

91 Figure 33: Characterization of S IR T1 A ntibody for I mmunohistochemistry Immunohistochemical staining (IHC) of H1299 control and S IR T1 knock down cells using 10E4 monoclonal antibody. When normal human colon tissue samples were stained with 10E4, the results showed that normal colon epithelial cells expressed significant levels of nuclear S IR T1 at the base of the crypt where m aximum cell prol iferation occurs ( black arrows ), and the expression level gradually decreases as cells migrate towards the lumen ( white arrows ) (Fig ure 34). Therefore, S IR T1 level in normal colon epithelium correlates with active cell proliferation.

PAGE 104

92 Figure 34: SIR T1 is E xpre ssed at High Levels in P roliferating Colon E pithelium. N ormal human colon mucosa was stained for S IR T1 with 10E4 monoclonal antibody. The black arrow indicates the base of the crypt where most cell proliferation occurs; the white arrow indicates cells that have migrated towards the lumen When benign adenomas (polyps) were stained with 10E4 and examined, nuclear S IR T1 was detected at high levels in all cells with adenomatous morphology (Fig ure 35, black arrows ), but the expression was not high in the lumens of the adjacent normal mucosa ( white arrows ). This pattern was observed in all 26 adenomas that were examined, suggesting that S IR T1 is overexpressed in 100% of adenomas.

PAGE 105

93 Figure 35: S IR T1 is E xpressed at H ig h Levels in A denomatous Colon E pithelium. H uman colon adenomas were stained for S IR T1 with 10E4. The black arrows indicate hyperplastic areas with dense nuclei and high levels of S IR T1 expression; white arrows indicate areas of normal mucosa with low levels of S IR T1 To test whether high S IR T1 expression is the cause or an effect of tumorigenesis, the intestines of ApcMin mice were stained for S IR T1. ApcMin mice are heterozygous for codon 850 nonsense mutation in the Apc tumor suppressor gene As a result of this mutation, the ApcMin mice develop intestinal adenomas by 120 days of age (Moser et al., 1990) The ApcMin adenomas develop after losing t he remaining Apc allele and, thus, are similar to most human colon adenomas (Luongo et al., 1994) Our results show ed that S IR T1 level s were high in the hyperplastic ApcMin polyps, similar to proliferating cells near the base of the crypt in human colon epithelium (Figure 36).

PAGE 106

94 Figure 36: S irt 1 Expression in the Intestinal Lesions of ApcMin M ouse. Intestinal sections of 120 day old ApcMin mice were stained for S irt 1 using a polyclonal antibody against the N terminus of mouse Sir t1 (upper panel) C orresponding tissue areas we re also stained with H&E for morphological comparison (lower panel) High Sir t 1 expression was maintained in the adenomatous component (black arrows) as compared to cells of the adjacent normal mucosa (white arrows). T hese results s uggest that S IR T1 is ex pressed at high levels in proliferating cells of the colon and intest inal epithelium and remains up regulated when cells undergo initial transformation. Because the ApcMin polyps are in itiated due to loss of the wild type Apc allele, increase in S IR T1 expression is most likely a secondary result of transformation and not an active cause of tumor initiation.

PAGE 107

95 S IRT1 i s Under or O verexpressed i n Advanced C olon C arcinomas To determine SIR T1 expression pattern in colon tumors, the 10E4 antibody was used to stain a tissue micro array containing samples of normal colonic mucosa ( n = 11), and of colon tumors (n = 88) collected at the Moffitt Cancer Center. Staining showed that SIR T1 was predominantly nuclear. When graded semi quantitatively on a scale of 0 to 3 (0 = ne gative, 1= low, 2 = high, and 3 = overexpression), S IR T1 level at the base of the normal crypt and adenomas was ranked as score 2 (high). S IR T1 staining significantly more intense than adenomas was ranked as score 3 (Figure 37). Figure 37: S IR T1 Expressi on is Heterogenous in A denocarcinomas. Human colon tumor tissue array was stained for S IR T1 using 10E4. I ntensity of S IR T1 stain in different tumors ranged from 0 (no stain) to 3 (overexpression).

PAGE 108

96 As mentioned previously, S IR T1 expression was found to be u niformly high (score 2) in all benign adenomas. However, colonic adenocarcinomas show ed a heterogeneous pattern of S IR T1 levels, ranging from score 0 to 3. Although almost 25% of stage I III carcinomas showed an intense (score 3) nuclear staining for S IR T1 almost 30% tumors showed reduced levels of S IR T1 as compared to normal crypt and adenomas. Interestingly, only a very small subset of stage IV tumors (associated with poor 5 year survival) exhibited S IR T1 overexpression (score 3) as compared to the lower grade tumors (I III) (Figure 38). Figure 38: S IR T1 Expression is Heterogenous in A denocarcinomas (Pie Representation). P ie representation of S IR T1 levels correlated with stage of cancer. S IR T1 level is moderate to high (level 2) in normal colonic muco sa and most adenomas. Tumors of different adenocarcinoma stages exhibit variable expression pattern of S IR T1. While some tumors overexpress S IR T1 (level 3 in black ), some others downregulate S IR T1 (level 0 in orange or level 1 in green). Level 3 express ion is infrequent in stage IV tumors.

PAGE 109

97 Our interpretation of the heterogeneous SIR T1 expression profile is that high SIR T1 expression is an intrinsic response to cell proliferation in untransformed mucosa and premalignant adenomas. During further progres sion, S IR T1 expression is silenced in a subset of tumors to facilitate tumor growth, whereas some low grade tumors may overexpress S IR T1 to benefit from its anti apoptotic effects. The fact that S IR T1 overexpression is rare in high grade (stage IV) tumors suggests that the growthinhibitory activity of S IR T1 becomes a ratelimiting factor for progression to this stage.

PAGE 110

98 Chapter Four Discussion and Future Direction The above experiments using cultured cell lines and xenograft models demonstrate that SIRT1 has properties of a growth suppressor. Knock down of SIRT1 increases the rate of tumor growth by enhancing cell proliferation, whereas overexpression of SIRT1 reduces tumor initiation and growth in nude mice. Furthermore, pharmacolog ical inhibition of SIRT1 increases the rate of cell proliferation in culture. Interestingly, inhibition of SIRT1 also sensitizes cells to chemotherapeutic drugs. Together, these results suggest that SIRT1 functions as a context dependent tumor suppressor w here inhibition of SIRT1 promotes tumor initiation and growth but can also promote cell death upon treatment with chemotherapeutic agents presumably due to the increased sensitivity of these rapidly dividing cells to DNA damaging agents. SIRT1 has a well e stablished anti apoptotic function which has led to the presumption that it acts as an oncogene. However, a recent study showed that transgenic mice overexpressing Sirt 1 reduced the development of neoplasia in the intestine caused by ApcMinIt is noteworthy that our results regarding the anti proliferati ve and anti tu morigenic properties of SIRT1 contradict many published studies that show an anti apoptotic function of S IRT 1. According to these published studies, tumor cell s undergo apoptosis or growth arrest after mutation sugges ting a tumor suppressive role of Sirt 1 (Firestein et al., 2008) Another study demonstrated that Sirt 1+/ mice showed increased tumor incidence when crossed to a p53+/ background (Wang et al., 2008a) These genetic m odels strongly suggest that SIRT 1 has properties of a tumor suppressor and our results lend further support to this function of SIRT 1.

PAGE 111

99 transient knock down of S IR T1 or treatment with S IR T1 inhibitors such as sirtinol, splitomycin, and cambinol (Ford et al., 2005; Heltweg et al., 2006; Ota et al., 2006) According to our results, inhibition of SIRT1 promotes cell proliferation thereby sensitizing these cells to DNA damageinduced apoptosis. A possible explanation for the discrepancies between the studies might be that, in the studies published by other research groups t umor cells treated with S IRT1 sh RNA may be sensiti zed to apoptosis due to additional transfection associated stress. Furthermore, the off target toxicity of the first generation small molecule S IR T1 inhibitors could be responsible for the cell death or growth arrest responses that they observed. In fact, recent development of the nanomolar S IR T1 inhibitor EX 527 demonstrated that specific inhibition of S IR T1 alone does not cause apoptosis in tumor cell lines (Solomon et al., 2006) Several studies have suggested that S IR T1 may act as an oncogene based on the correlation of higher than normal expression levels of S IR T1 in certain tumors compared to normal tissue (Hida et al., 2007; Huffman et al., 2007; Stunkel et al., 2007) O ur analysis of the S IR T1 expression profile in colon cancer suggests that S IR T1 levels are variable in different stages of tumors. Such a staining pattern can be interpreted as S IR T1 having both oncogenic and t umor suppressive properties which is consistent with the pleiotropic effects of S IR T1, i.e. anti apoptotic and growth suppressive depending on cellular context. Indeed, our results may suggest that a subset of tumors downregulate S IR T1 to obtain a proliferation advantage, whereas some could increase S IR T1 expression to benefit from its anti apoptotic function. However, interpretation of the tumor stai ning results is subjective and should not be taken as definitive evidence. Staining the tumor microarray for levels of ki 67 (a proliferation marker) and active caspase (apoptotic marker) would allow us to c orrelate SIRT1 expression level s with these cellular responses. However, it is important to consider that the level of SIRT1 may not entirely represent the enzymatic function of this protein. As mentioned in the Introduction section of this dissertation, DBC1 has been found to be an important inhibitor o f SIRT1

PAGE 112

100 deacetylase activity (Kim et al., 2008; Zhao et al., 2008) This implies that overexpression of DBC1 may inhibit SIRT1 activity regardless of SIRT1 expression level. Considering this, examination of the levels of DBC1 in tumor microarrays would enable us to determine the functionality of SIRT1 in tumors of different stages based on this aspect of its regulation. Although the mechanism by which S IR T1 inhibits cell proliferation remains to be further investigat ed, previous studies from our lab and those presented in this report suggest that inhibition of E2F1 is partly responsible for th is observed effect S IR T1 interacts with E2F1, inhibits E2F1 acetylation, and is recruited by E2F1 to target promoters (Wang et al., 2006) When expressed at high levels, S IR T1 is a potent inducer of G1 arrest. Our resul ts show that inhibition of S IR T1 results in RB hyper phosphorylation. This may be a result of E2F1 activation, which can induce cyclinD/cdk4 activity and promote R B phosphorylation. Our results show that inhibition of S IR T1 promotes cell proliferation but also sensitizes the cells to apoptosis in res ponse to DNA damaging agents presumably because cells that proliferate rapidly are more sensitive to DNA damage. In such cases, expression of S IR T1 imparts a survival advantage to the cells. Therefore, it is plausible that both activators and inhibitors of S IR T1 could have therapeutic potential as anti tumor agents depending on the stage of cancer when treatment is adminstered A simple scenario is that S IR T1 activators may impart cancer preventative effects by enhancing the growthinhibitory effect of S IR T1 in benign tumors. Its effect on advanced stage tumors may be heterogeneous, depending on whether a tumor has evolved to rely on S IR T1 for survival. However, when tumors are being treated with chemotherapy, S I R T1 inhibitors may be useful for enhancing apoptotic response. E xamination of a large patient cohort is needed to determine the association between S IR T1 expression and clinical parameters such as survival and treatment response, which would be critical fo r the application of S IR T1 targeted drugs To further our investigation on the function of S IR T1, we used the ApcMin mouse genetic model for colon cancer As described in the Materials and Methods section, A pcM in mice were

PAGE 113

101 bred to Sir t 1+/ mice. The result ing progenies were genetically screened to obtain A pcM in; Sir t 1+/+ and A pcM in ; Sir t 1+/ mice in o rder to study the effect of Sirt 1 gene dosage on polyp formation. 100% of these mice developed polyps by 6 months of age. As demonstrated in Figure 39, no signif icant difference was observed in the number of polyps fo rmed between the two genotypes. Figure 39: Effect of Sir t 1 Heterozygous Genotype on Polyp Formation. A pcM in mice were bred to Sirt 1+/ mice and the number of polyps were compared between A pcM in; Si rt 1+/+ and A pcM in ; Sirt 1+/ genotypes. Error bars represent mean + S.D ( n=12 ) and p=0.323 as calc ulated from a two tailed s tudents t test. Our hypothesis is that the heterozygous status of Sirt 1 gene may not be sufficient to show an effect on polyp format ion in this colon cancer mouse strain. Alternatively, loss of one functional allele of Sirt 1 in the germline may have triggered additional cellular alterations such that the effect of low Sirt 1 dosage may have been compensated for and no effect was visible on polyp formation in the intestines.

PAGE 114

102 Interestingly, a recent publication showed that introduction of A pcM in gene in a different Sirt 1 knockout mouse strain did not affect the number of polyps for med when compared to A pcM in gene introduced in a Sirt 1 wild type background (Boily et al., 2009) However, they did notic e an elevated expression of Sirt 1 in the polyps of the A pcM in mice as compared to the adjacent normal villi. In contrast, overexpression of Sirt 1 has been shown to inhibit intestinal polyp formation in A pcM in In addition to the colon cancer model we also investig ated the effect of S IR T1 gene dosage on lung tumorigenesis using a Kras mouse lung cancer model. The K rasLA2 mouse was obtained from the Mouse Repository (Mouse Models of Human Cancers Consortium). This mouse strain contains a latent K ras allele that can be activated by spontaneous mitotic recombination resulting in an active Kras G12D mutant allele (Johnson et al., 2001) As a result, mice heterozygous for this allele develop tumors and their mean survival age is around 200 days. Tumors mainly develop in the lungs of these mice thereby making them a suitable lung cancer model. Our studies with this model were mainly focused on two points: to determine the effect of S IR T1 on lung tumor nodule formation and to determine the effect of S IR T1 on survival of K rasLA2 mice. K rasLA2 mi ce were bred with Sirt 1+/ mice and the K ras G12D ; Sir t 1+/+ and K ras G12D ; Sirt 1+/ genotypes were selected. These mice were sacrificed at 20 weeks of age and the tumor nodules in the lung were counted. As shown in figure 40, there was no significant differenc e in the number of lung tumor nodules formed between the two genotypes. catenin (Firestein et al., 2008) While Boily et al ,. were unable to explain the reasons for this discrepancy, it could simply be a re sult of the different genetic backgrounds of the mouse strains that were used to perform these experiments. These observations further add to the complex nature and function of S IR T1 in tumorigenesis.

PAGE 115

103 Figure 40 : Effect of Sirt 1 Heterozygous Genotype on Lung Tumor Nodules Formation. K rasLA2 mice were bred to Sirt 1+/ mice and the indicated genotypes were sacrificed at 20 weeks of age. Number of tumor nodules were compared between K ras G12D ; Sir t 1+/+ and K ras G12D ; Sir t 1+/ genotypes. Error bars represent mean + S.D ( n=12 ) and p=0.104 as calculated from a twotailed s tudents t test. The lungs from the above set of mice were harvested, fixed and sectioned followed by staining for Sirt 1 levels. As expected, the tumor nodules from K ras G12D ; Sirt 1+/ mous e lungs had reduced nuclear Sirt 1 staining as compared to the Kras G12D ; Sirt 1+/+ lungs (Figure 41)

PAGE 116

104 Figure 41: Lung Tumor N o dules S tained for Sirt 1. Lungs from Kras G12D ; Sirt 1+/+ and Kras G12D ; Sirt 1+/ mice were harvested at 20 weeks, fixed in formalin, sectioned and H&E stained (top panel) Simultaneous sections from each block were stained for Sirt1 ( bottom panel) using the ant i sir2 antibody and the rabbit ABC staining system (Santa Cruz Biotech.). To study the effect of Sir t 1 on survival of the K rasLA2 mouse strain, we were able to maintain 36 mice of Kras G12D ;Sir t 1+/+ genotype and 24 mice of the Kras G12D ;Sir t 1+/ genotype f or analysis. The date of birth and death for each mouse was recorded and the Kaplan Meier curve was plotted. As determined by the curve, we observed no significant difference in the survival probability between the two genotypes (p=0.37) (Figure 42) This observation leads us to suggest that partial expression of Sir t 1 from one functional allele is not sufficient to affect lung tumorigenesis or mortality in this mouse model. Also, the aggressive nature of tumor formation in this mouse strain due to the Kras mutation may not allow the subtle differences between the Sir t 1+/+ and Sir t 1+/ genotypes to surface.

PAGE 117

105 Figure 42: Comparison of S ur vival P robability between K rasL A2 M ice that are Wild Type or Heterozygous for S ir t 1. P ink (1) refers to K ras G12D ;Sir t 1+/+ genotype and yellow (2) refers to Kras G12D ;Sir t 1+/ genotype. The chi square test with degree of freedom=1 was calculated as 0.801 and p=0.37. The above observations suggest a complex role for SIRT1 and much research is needed to fully un ravel the involvement of S IRT 1 in cancer. F uture research will involve the elucidation of the function of S IR T1. Lung tumor nodules from Kras G12D ;Sir t 1+/+ and Kras G12D ;Sir t 1+/ mice will be used to develop cell lines Since the Kras model was used to study only the effect of SIRT1 on tumor nodule development and overall survival, establishment of cell lines will allow us to manipulate the conditions of growth for a nalysis of the response of lung tumor cells to different types of stress and to determine if S IRT1 affects any of these responses. Our future plans also involve using the EX 527 S IR T1 specific inhibitor in vivo in the lung cance r model to effectively inhibit the deacetylase function of S IR T1. This may prove to be a better method for studying the ef fect of S IR T1 in lung carcinogenesis since the inhibitor will be able to achieve nearly complete inhibition of SIRT1 activity as compared to the partial inhibition

PAGE 118

106 obtained from a SIRT1 heterozygous state. This may potentially provide a proof of concept fo r the use of SIRT1 inhibitor in cancer treatment. Additionally, determination of SIRT1 levels in a lung tumor microarray constructed from patient samples with more information in terms of age of patient, stage of cancer and type of therapy will be benefici al in correlating SIRT1 with patient prognosis.

PAGE 119

107 References Abdelmohsen, K., Pullmann, R., Jr., Lal, A., Kim, H. H., Galban, S., Yang, X., Blethrow, J. D., Walker, M., Shubert, J., Gillespie, D. A. et al. (2007) Phosphorylation of HuR by Chk2 regulates SIRT1 expression. Mol Cell 25, 543557. Ahuja, N., Schwer, B., Carobbio, S., Waltregny, D., North, B. J., Castronovo, V., Maechler, P., and Verdin, E. (2007). Regulation of insulin secretion by SIRT4, a mitochond rial ADP ribosyltransferase. J Biol Chem 282, 3358333592. Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., and Sinclair, D. A. (2003). Nicotinamide and PNC1 govern lifespan extension by calorie restriction in Saccharomyces cerevisiae. Nature 423, 181 185. Aparicio, O. M., Billington, B. L., and Gottschling, D. E. (1991). Modifiers of position effect are shared between telomeric and silent mating type loci in S. cerevisiae. Cell 66, 1279 1287. Ashburner, B. P., Westerheide, S. D., and Baldwi n, A. S., Jr. (2001). The p65 (RelA) subunit of NF kappaB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol 21, 70657077. Bae, N. S., Swanson, M. J., Vassilev, A., and Howard, B. H. (2004). Human histone deacetylase SIRT2 interacts with the homeobox transcription factor HOXA10. J Biochem 135, 695700. Bailey, D., and O'Hare, P. (2004). Characterization of the localization and proteolytic activity of the SUMO specific protease, SENP1. J Biol Chem 279 692 703. Barrett, M. T., Sanchez, C. A., Prevo, L. J., Wong, D. J., Galipeau, P. C., Paulson, T. G., Rabinovitch, P. S., and Reid, B. J. (1999). Evolution of neoplastic cell lineages in Barrett oesophagus. Nat Genet 22, 106 109. Baur, J. A., Pearson, K. J., Price, N. L., Jamieson, H. A., Lerin, C., Kalra, A., Prabhu, V. V., Allard, J. S., Lopez Lluch, G., Lewis, K. et al. (2006). Resveratrol improves health and survival of mice on a highcalorie diet. Nature 444 337 342. Bedalov, A., Gatbonton, T., Irvine, W. P., Gottschling, D. E., and Simon, J. A. (2001). Identification of a small molecule inhibitor of Sir2p. Proc Natl Acad Sci U S A 98, 1511315118. Bellizzi, D., Rose, G., Cavalcante, P., Covello, G., Dato, S., De Rango, F., Greco, V., Maggiolini, M., Feraco, E., Mari, V. et al. (2005). A novel VNTR enhancer within the SIRT3 gene, a human homologue of SIR2, is associated with survival at oldest ages. Genomics 85, 258263.

PAGE 120

108 Bertos, N. R., Gilquin, B., Chan, G. K., Yen, T. J., Khochbin, S., and Yang, X. J. (2004). Role of the tetradecapeptide repeat domain of human histone deacetylase 6 in cytoplasmic retention. J Biol Chem 279 48246 48254. Blander, G., Olejnik, J., KrzymanskaOlejnik, E., McDonagh, T., Haigis, M., Yaffe, M. B., and Guarente, L. (2005). SIRT1 shows no substrate specificity in vitro. J Biol Chem 280, 97809785. Boffa, L. C., Vidali, G., Mann, R. S., and Allfrey, V. G. (1978). Suppression of histone deacetylation in vivo and in vitro by sodium butyrate. J Biol Chem 253 33643366. Boily, G., He, X. H., Pearce, B., Jardine, K., and McBurney, M. W. (2009). SirT1 null mice develop tumors at normal rates but are poorly protected by resveratrol. Oncogene 28, 28822893. Bordone, L., Motta, M. C., Picard, F., Robinso n, A., Jhala, U. S., Apfeld, J., McDonagh, T., Lemieux, M., McBurney, M., Szilvasi, A. et al. (2006). Sirt1 regulates insulin secretion by repressing UCP2 in pancreatic beta cells. PLoS Biol 4 e31. Borra, M. T., Smith, B. C., and Denu, J. M. (2005). Mec hanism of human SIRT1 activation by resveratrol. J Biol Chem 280, 17187 17195. Bos, J. L. (1989). ras oncogenes in human cancer: a review. Cancer Res 49, 4682 4689. Bouras, T., Fu, M., Sauve, A. A., Wang, F., Quong, A. A., Perkins, N. D., Hay, R. T., Gu, W., and Pestell, R. G. (2005). SIRT1 deacetylation and repression of p300 involves lysine residues 1020/1024 within the cell cycle regulatory domain 1. J Biol Chem 280, 10264 10276. Boyault, C., Gilquin, B., Zhang, Y., Rybin, V., Garman, E., Meyer Klauck e, W., Matthias, P., Muller, C. W., and Khochbin, S. (2006). HDAC6p97/VCP controlled polyubiquitin chain turnover. EMBO J 25 33573366. Braunstein, M., Rose, A. B., Holmes, S. G., Allis, C. D., and Broach, J. R. (1993). Transcriptional silencing in yeas t is associated with reduced nucleosome acetylation. Genes Dev 7 592604. Brunet, A., Sweeney, L. B., Sturgill, J. F., Chua, K. F., Greer, P. L., Lin, Y., Tran, H., Ross, S. E., Mostoslavsky, R., Cohen, H. Y., et al. (2004). Stress dependent regulation o f FOXO transcription factors by the SIRT1 deacetylase. Science 303, 20112015. Buggy, J. J., Sideris, M. L., Mak, P., Lorimer, D. D., McIntosh, B., and Clark, J. M. (2000). Cloning and characterization of a novel human histone deacetylase, HDAC8. Biochem J 350 Pt 1 199 205. Cahill, D. P., Kinzler, K. W., Vogelstein, B., and Lengauer, C. (1999). Genetic instability and darwinian selection in tumours. Trends Cell Biol 9 M57 60. Candido, E. P., Reeves, R., and Davie, J. R. (1978). Sodium butyrate inhibits histone deacetylation in cultured cells. Cell 14, 105 113.

PAGE 121

109 Chen, D., Bruno, J., Easlon, E., Lin, S. J., Cheng, H. L., Alt, F. W., and Guarente, L. (2008). Tissue specific regulation of SIRT1 by calorie restriction. Genes Dev 22 17531757. Chen, W. Y., Wang, D. H., Yen, R. C., Luo, J., Gu, W., and Baylin, S. B. (2005). Tumor suppressor HIC1 directly regulates SIRT1 to modulate p53dependent DNA damage responses. Cell 123, 437 448. Chen, Y. X., Fang, J. Y., Zhu, H. Y., Lu, R., Cheng, Z. H., and Qiu, D. K (2004). Histone acetylation regulates p21WAF1 expression in human colon cancer cell lines. World J Gastroenterol 10 2643 2646. Cheng, H. L., Mostoslavsky, R., Saito, S., Manis, J. P., Gu, Y., Patel, P., Bronson, R., Appella, E., Alt, F. W., and Chua, K F. (2003). Developmental defects and p53 hyperacetylation in Sir2 homolog (SIRT1) deficient mice. Proc Natl Acad Sci U S A 100, 1079410799. Chua, K. F., Mostoslavsky, R., Lombard, D. B., Pang, W. W., Saito, S., Franco, S., Kaushal, D., Cheng, H. L., Fi scher, M. R., Stokes, N., et al. (2005). Mammalian SIRT1 limits replicative life span in response to chronic genotoxic stress. Cell Metab 2 67 76. Cohen, H. Y., Lavu, S., Bitterman, K. J., Hekking, B., Imahiyerobo, T. A., Miller, C., Frye, R., Ploegh, H. Kessler, B. M., and Sinclair, D. A. (2004a). Acetylation of the C terminus of Ku70 by CBP and PCAF controls Bax mediated apoptosis. Mol Cell 13, 627638. Cohen, H. Y., Miller, C., Bitterman, K. J., Wall, N. R., Hekking, B., Kessler, B., Howitz, K. T., G orospe, M., de Cabo, R., and Sinclair, D. A. (2004b). Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science 305 390392. Comings, D. E. (1973). A general theory of carcinogenesis. Proc Natl Acad Sci U S A 70, 3324 3328. Conti, J. A., Kemeny, N. E., Saltz, L. B., Huang, Y., Tong, W. P., Chou, T. C., Sun, M., Pulliam, S., and Gonzalez, C. (1996). Irinotecan is an active agent in untreated patients with metastatic colorectal cancer. J Clin Oncol 14 709 715. Cooper G. M. (1982). Cellular transforming genes. Science 217, 801806. Crosby, M. E., and Almasan, A. (2004). Opposing roles of E2Fs in cell proliferation and death. Cancer Biol Ther 3 1208 1211. Dai, J. M., Wang, Z. Y., Sun, D. C., Lin, R. X., and Wang, S. Q. (2007). SIRT1 interacts with p73 and suppresses p73 dependent transcriptional activity. J Cell Physiol 210, 161 166. David, G., Neptune, M. A., and DePinho, R. A. (2002). SUMO 1 modification of histone deacetylase 1 (HDAC1) modulates its biological ac tivities. J Biol Chem 277 23658 23663. de Ruijter, A. J., van Gennip, A. H., Caron, H. N., Kemp, S., and van Kuilenburg, A. B. (2003). Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem J 370, 737 749.

PAGE 122

110 Denslow, S. A., a nd Wade, P. A. (2007). The human Mi 2/NuRD complex and gene regulation. Oncogene 26 5433 5438. Dokmanovic, M., Clarke, C., and Marks, P. A. (2007). Histone deacetylase inhibitors: overview and perspectives. Mol Cancer Res 5 981 989. Douillard, J. Y., Cunningham, D., Roth, A. D., Navarro, M., James, R. D., Karasek, P., Jandik, P., Iveson, T., Carmichael, J., Alakl, M., et al. (2000). Irinotecan combined with fluorouracil compared with fluorouracil alone as first line treatment for metastatic colorectal c ancer: a multicentre randomised trial. Lancet 355 1041 1047. Dryden, S. C., Nahhas, F. A., Nowak, J. E., Goustin, A. S., and Tainsky, M. A. (2003). Role for human SIRT2 NAD dependent deacetylase activity in control of mitotic exit in the cell cycle. Mol Cell Biol 23, 31733185. Espinosa, J. M., and Emerson, B. M. (2001). Transcriptional regulation by p53 through intrinsic DNA/chromatin binding and sitedirected cofactor recruitment. Mol Cell 8 5769. Fattaey, A., Helin, K., and Harlow, E. (1993). Trans criptional inhibition by the retinoblastoma protein. Philos Trans R Soc Lond B Biol Sci 340, 333336. Feinberg, A. P., Cui, H., and Ohlsson, R. (2002). DNA methylation and genomic imprinting: insights from cancer into epigenetic mechanisms. Semin Cancer B iol 12, 389 398. Feinberg, A. P., and Tycko, B. (2004). The history of cancer epigenetics. Nat Rev Cancer 4 143153. Firestein, R., Blander, G., Michan, S., Oberdoerffer, P., Ogino, S., Campbell, J., Bhimavarapu, A., Luikenhuis, S., de Cabo, R., Fuchs, C. et al. (2008). The SIRT1 deacetylase suppresses intestinal tumorigenesis and colon cancer growth. PLoS One 3 e2020. Fischer, D. D., Cai, R., Bhatia, U., Asselbergs, F. A., Song, C., Terry, R., Trogani, N., Widmer, R., Atadja, P., and Cohen, D. (2002) Isolation and characterization of a novel class II histone deacetylase, HDAC10. J Biol Chem 277 6656 6666. Fischle, W., Dequiedt, F., Fillion, M., Hendzel, M. J., Voelter, W., and Verdin, E. (2001). Human HDAC7 histone deacetylase activity is associated with HDAC3 in vivo. J Biol Chem 276, 35826 35835. Ford, E., Voit, R., Liszt, G., Magin, C., Grummt, I., and Guarente, L. (2006). Mammalian Sir2 homolog SIRT7 is an activator of RNA polymerase I transcription. Genes Dev 20, 10751080. Ford, J., Jiang, M ., and Milner, J. (2005). Cancer specific functions of SIRT1 enable human epithelial cancer cell growth and survival. Cancer Res 65 10457 10463. Fritze, C. E., Verschueren, K., Strich, R., and Easton Esposito, R. (1997). Direct evidence for SIR2 modulati on of chromatin structure in yeast rDNA. EMBO J 16, 64956509.

PAGE 123

111 Frye, R. A. (1999). Characterization of five human cDNAs with homology to the yeast SIR2 gene: Sir2like proteins (sirtuins) metabolize NAD and may have protein ADP ribosyltransferase activity Biochem Biophys Res Commun 260, 273279. Frye, R. A. (2000). Phylogenetic classification of prokaryotic and eukaryotic Sir2like proteins. Biochem Biophys Res Commun 273, 793798. Fu, M., Liu, M., Sauve, A. A., Jiao, X., Zhang, X., Wu, X., Powell, M. J ., Yang, T., Gu, W., Avantaggiati, M. L. et al. (2006). Hormonal control of androgen receptor function through SIRT1. Mol Cell Biol 26, 81228135. Gao, J., Siddoway, B., Huang, Q., and Xia, H. (2009). Inactivation of CREB mediated gene transcription by H DAC8 bound protein phosphatase. Biochem Biophys Res Commun 379 1 5. Gao, L., Cueto, M. A., Asselbergs, F., and Atadja, P. (2002). Cloning and functional characterization of HDAC11, a novel member of the human histone deacetylase family. J Biol Chem 277 25748 25755. Gerhart Hines, Z., Rodgers, J. T., Bare, O., Lerin, C., Kim, S. H., Mostoslavsky, R., Alt, F. W., Wu, Z., and Puigserver, P. (2007). Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC 1alpha. EMBO J 26 1913 1923. Giono, L. E., and Manfredi, J. J. (2006). The p53 tumor suppressor participates in multiple cell cycle checkpoints. J Cell Physiol 209, 1320. Glozak, M. A., and Seto, E. (2007). Histone deacetylases and cancer. Oncogene 26 54205432. Gl ozak, M. A., and Seto, E. (2009). Acetylation/deacetylation modulates the stability of DNA replication licensing factor Cdt1. J Biol Chem 284 11446 11453. Gottlieb, S., and Esposito, R. E. (1989). A new role for a yeast transcriptional silencer gene, SIR 2, in regulation of recombination in ribosomal DNA. Cell 56, 771 776. Gregoretti, I. V., Lee, Y. M., and Goodson, H. V. (2004). Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis. J Mol Biol 338, 1731. Grozinger, C. M., Chao, E. D., Blackwell, H. E., Moazed, D., and Schreiber, S. L. (2001). Identification of a class of small molecule inhibitors of the sirtuin family of NAD dependent deacetylases by phenotypic screening. J Biol Chem 276 38837 38843. G rozinger, C. M., Hassig, C. A., and Schreiber, S. L. (1999). Three proteins define a class of human histone deacetylases related to yeast Hda1p. Proc Natl Acad Sci U S A 96, 48684873. Grozinger, C. M., and Schreiber, S. L. (2000). Regulation of histone deacetylase 4 and 5 and transcriptional activity by 143 3 dependent cellular localization. Proc Natl Acad Sci U S A 97, 78357840.

PAGE 124

112 Grozinger, C. M., and Schreiber, S. L. (2002). Deacetylase enzymes: biological functions and the use of small molecule inhibitors. Chem Biol 9 3 16. Grzenda, A., Lomberk, G., Zhang, J. S., and Urrutia, R. (2009). Sin3: master scaffold and transcriptional corepressor. Biochim Biophys Acta 1789, 443450. Gu, W., and Roeder, R. G. (1997). Activation of p53 sequence specific DNA binding by acetylation of the p53 C terminal domain. Cell 90 595606. Guardiola, A. R., and Yao, T. P. (2002). Molecular cloning and characterization of a novel histone deacetylase HDAC10. J Biol Chem 277 33503356. Guarente, L. (2000). Sir2 links chromatin silencing, metabolism, and aging. Genes Dev 14, 10211026. Haber, M., and Stewart, B. W. (1985). Oncogenes. A possible role for cancer genes in human malignant disease. Med J Aust 142, 402406. Haberland, M., Arnold, M. A., McAnally, J., Phan, D., Kim, Y., and Olson, E. N. (2007). Regulation of HDAC9 gene expression by MEF2 establishes a negativefeedback loop in the transcriptional circuitry of muscle differentiation. Mol Cell Biol 27, 518525. Haigis, M. C., Mostoslavsky, R., Haigis, K. M., Fahie K., Christodoulou, D. C., Murphy, A. J., Valenzuela, D. M., Yancopoulos, G. D., Karow, M., Blander, G. et al. (2006). SIRT4 inhibits glutamate dehydrogenase and opposes the effects of calorie restriction in pancreatic beta cells. Cell 126, 941 954. Halkidou, K., Gaughan, L., Cook, S., Leung, H. Y., Neal, D. E., and Robson, C. N. (2004). Upregulation and nuclear recruitment of HDAC1 in hormone refractory prostate cancer. Prostate 59 177 189. Hall, S. S. (2003). Longevity research. In vino vitalis? Compounds activate lifeextending genes. Science 301, 1165. Hanahan, D., and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100 57 70. Harbour, J. W., and Dean, D. C. (2000). The Rb/E2F pathway: expanding roles and emerging paradigms. Genes Dev 14 2 393 2409. Helin, K., Lees, J. A., Vidal, M., Dyson, N., Harlow, E., and Fattaey, A. (1992). A cDNA encoding a pRB binding protein with properties of the transcription factor E2F. Cell 70, 337 350. Heltweg, B., Gatbonton, T., Schuler, A. D., Posakony, J., Li, H., Goehle, S., Kollipara, R., Depinho, R. A., Gu, Y., Simon, J. A., and Bedalov, A. (2006). Antitumor activity of a small molecule inhibitor of human silent information regulator 2 enzymes. Cancer Res 66, 43684377. Hida, Y., Kubo, Y., Murao, K., an d Arase, S. (2007). Strong expression of a longevity related protein, SIRT1, in Bowen's disease. Arch Dermatol Res 299, 103106.

PAGE 125

113 Howitz, K. T., Bitterman, K. J., Cohen, H. Y., Lamming, D. W., Lavu, S., Wood, J. G., Zipkin, R. E., Chung, P., Kisielewski, A ., Zhang, L. L. et al. (2003). Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 425 191196. Hsiang, Y. H., Hertzberg, R., Hecht, S., and Liu, L. F. (1985). Camptothecin induces proteinlinked DNA breaks via mammali an DNA topoisomerase I. J Biol Chem 260 14873 14878. Hu, E., Chen, Z., Fredrickson, T., Zhu, Y., Kirkpatrick, R., Zhang, G. F., Johanson, K., Sung, C. M., Liu, R., and Winkler, J. (2000). Cloning and characterization of a novel human class I histone deace tylase that functions as a transcription repressor. J Biol Chem 275, 15254 15264. Huang, B. H., Laban, M., Leung, C. H., Lee, L., Lee, C. K., SaltoTellez, M., Raju, G. C., and Hooi, S. C. (2005). Inhibition of histone deacetylase 2 increases apoptosis and p21Cip1/WAF1 expression, independent of histone deacetylase 1. Cell Death Differ 12, 395 404. Hubbert, C., Guardiola, A., Shao, R., Kawaguchi, Y., Ito, A., Nixon, A., Yoshida, M., Wang, X. F., and Yao, T. P. (2002). HDAC6 is a microtubuleassociated deacetylase. Nature 417, 455 458. Huffman, D. M., Grizzle, W. E., Bamman, M. M., Kim, J. S., Eltoum, I. A., Elgavish, A., and Nagy, T. R. (2007). SIRT1 is significantly elevated in mouse and human prostate cancer. Cancer Res 67, 66126618. Huhtiniemi, T., W ittekindt, C., Laitinen, T., Leppanen, J., Salminen, A., Poso, A., and LahtelaKakkonen, M. (2006). Comparative and pharmacophore model for deacetylase SIRT1. J Comput Aided Mol Des 20, 589 599. Inoue, T., Hiratsuka, M., Osaki, M., and Oshimura, M. (2007) The molecular biology of mammalian SIRT proteins: SIRT2 in cell cycle regulation. Cell Cycle 6 10111018. Jackson, M. D., Schmidt, M. T., Oppenheimer, N. J., and Denu, J. M. (2003). Mechanism of nicotinamide inhibition and transglycosidation by Sir2 hi stone/protein deacetylases. J Biol Chem 278 50985 50998. Jenuwein, T., and Allis, C. D. (2001). Translating the histone code. Science 293, 10741080. Johnson, L., Mercer, K., Greenbaum, D., Bronson, R. T., Crowley, D., Tuveson, D. A., and Jacks, T. (2001). Somatic activation of the K ras oncogene causes early onset lung cancer in mice. Nature 410, 1111 1116. Kaeberlein, M., McDonagh, T., Heltweg, B., Hixon, J., Westman, E. A., Caldwell, S. D., Napper, A., Curtis, R., DiStefano, P. S., Fields, S. et al. (2005). Substratespecific activation of sirtuins by resveratrol. J Biol Chem 280, 17038 17045. Kaeberlein, M., McVey, M., and Guarente, L. (1999). The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechani sms. Genes Dev 13, 25702580. Kamel, C., Abrol, M., Jardine, K., He, X., and McBurney, M. W. (2006). SirT1 fails to affect p53mediated biological functions. Aging Cell 5 81 88.

PAGE 126

114 Kanfi, Y., Peshti, V., Gozlan, Y. M., Rathaus, M., Gil, R., and Cohen, H. Y (2008a). Regulation of SIRT1 protein levels by nutrient availability. FEBS Lett 582, 24172423. Kanfi, Y., Shalman, R., Peshti, V., Pilosof, S. N., Gozlan, Y. M., Pearson, K. J., Lerrer, B., Moazed, D., Marine, J. C., de Cabo, R., and Cohen, H. Y. (2008b). Regulation of SIRT6 protein levels by nutrient availability. FEBS Lett 582 543 548. Kang, H., Jung, J. W., Kim, M. K., and Chung, J. H. (2009). CK2 is the regulator of SIRT1 substratebinding affinity, deacetylase activity and cellular response to DN A damage. PLoS One 4 e6611. Kao, H. Y., Lee, C. H., Komarov, A., Han, C. C., and Evans, R. M. (2002). Isolation and characterization of mammalian HDAC10, a novel histone deacetylase. J Biol Chem 277, 187193. Kawahara, T. L., Michishita, E., Adler, A. S ., Damian, M., Berber, E., Lin, M., McCord, R. A., Ongaigui, K. C., Boxer, L. D., Chang, H. Y., and Chua, K. F. (2009). SIRT6 links histone H3 lysine 9 deacetylation to NFkappaB dependent gene expression and organismal life span. Cell 136, 6274. Kim, E. J., Kho, J. H., Kang, M. R., and Um, S. J. (2007). Active regulator of SIRT1 cooperates with SIRT1 and facilitates suppression of p53 activity. Mol Cell 28, 277290. Kim, E. J., and Um, S. J. (2008). SIRT1: roles in aging and cancer. BMB Rep 41, 751 756. Kim, J. E., Chen, J., and Lou, Z. (2008). DBC1 is a negative regulator of SIRT1. Nature 451 583586. Kloting, N., and Bluher, M. (2005). Extended longevity and insulin signaling in adipose tissue. Exp Gerontol 40 878883. Knudson, A. G., Jr. (1971). Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A 68, 820823. Kovacs, J. J., Murphy, P. J., Gaillard, S., Zhao, X., Wu, J. T., Nicchitta, C. V., Yoshida, M., Toft, D. O., Pratt, W. B., and Yao, T. P. (2005). HDAC6 regulat es Hsp90 acetylation and chaperonedependent activation of glucocorticoid receptor. Mol Cell 18, 601607. Kruszewski, M., and Szumiel, I. (2005). Sirtuins (histone deacetylases III) in the cellular response to DNA damage-facts and hypotheses. DNA Repair (Amst) 4 13061313. Lagger, G., O'Carroll, D., Rembold, M., Khier, H., Tischler, J., Weitzer, G., Schuettengruber, B., Hauser, C., Brunmeir, R., Jenuwein, T., and Seiser, C. (2002). Essential function of histone deacetylase 1 in proliferation control and CDK inhibitor repression. EMBO J 21, 2672 2681. Lagouge, M., Argmann, C., Gerhart Hines, Z., Meziane, H., Lerin, C., Daussin, F., Messadeq, N., Milne, J., Lambert, P., Elliott, P. et al. (2006). Resveratrol improves mitochondrial function and protects a gainst metabolic disease by activating SIRT1 and PGC 1alpha. Cell 127, 11091122.

PAGE 127

115 Lai, A., Lee, J. M., Yang, W. M., DeCaprio, J. A., Kaelin, W. G., Jr., Seto, E., and Branton, P. E. (1999). RBP1 recruits both histone deacetylase dependent and independent repression activities to retinoblastoma family proteins. Mol Cell Biol 19, 66326641. Lain, S., Hollick, J. J., Campbell, J., Staples, O. D., Higgins, M., Aoubala, M., McCarthy, A., Appleyard, V., Murray, K. E., Baker, L., et al. (2008). Discovery, in viv o activity, and mechanism of action of a small molecule p53 activator. Cancer Cell 13, 454 463. Landry, J., Slama, J. T., and Sternglanz, R. (2000). Role of NAD(+) in the deacetylase activity of the SIR2like proteins. Biochem Biophys Res Commun 278, 685690. Lane, D. P. (1992). Cancer. p53, guardian of the genome. Nature 358 15 16. Lane, D. P., and Crawford, L. V. (1979). T antigen is bound to a host protein in SV40transformed cells. Nature 278, 261263. Langley, E., Pearson, M., Faretta, M., Bauer, U. M., Frye, R. A., Minucci, S., Pelicci, P. G., and Kouzarides, T. (2002). Human SIR2 deacetylates p53 and antagonizes PML/p53induced cellular senescence. EMBO J 21, 23832396. Lee, H., Rezai Zadeh, N., and Seto, E. (2004). Negative regulation of histone deacetylase 8 activity by cyclic AMP dependent protein kinase A. Mol Cell Biol 24, 765773. Lee, I. H., Cao, L., Mostoslavsky, R., Lombard, D. B., Liu, J., Bruns, N. E., Tsokos, M., Alt, F. W., and Finkel, T. (2008). A role for the NAD dependent deacety lase Sirt1 in the regulation of autophagy. Proc Natl Acad Sci U S A 105, 33743379. Lee, J. H., Song, M. Y., Song, E. K., Kim, E. K., Moon, W. S., Han, M. K., Park, J. W., Kwon, K. B., and Park, B. H. (2009). Overexpression of SIRT1 protects pancreatic beta cells against cytokine toxicity by suppressing the nuclear factor kappaB signaling pathway. Diabetes 58 344351. Lemercier, C., Verdel, A., Galloo, B., Curtet, S., Brocard, M. P., and Khochbin, S. (2000). mHDA1/HDAC5 histone deacetylase interacts with and represses MEF2A transcriptional activity. J Biol Chem 275 15594 15599. Li, X., Song, S., Liu, Y., Ko, S. H., and Kao, H. Y. (2004). Phosphorylation of the histone deacetylase 7 modulates its stability and association with 143 3 proteins. J Biol Chem 279 3420134208. Li, Z., Chen, L., Kabra, N., Wang, C., Fang, J., and Chen, J. (2009). Inhibition of SUV39H1 methyltransferase activity by DBC1. J Biol Chem 284, 10361 10366. Lill, N. L., Grossman, S. R., Ginsberg, D., DeCaprio, J., and Livingston, D. M. (1997). Binding and modulation of p53 by p300/CBP coactivators. Nature 387 823827. Lin, S. J., Defossez, P. A., and Guarente, L. (2000). Requirement of NAD and SIR2 for life span extension by calorie restriction in Saccharomyces cerevisiae. Science 289, 21262128.

PAGE 128

116 Lin, S. J., Kaeberlein, M., Andalis, A. A., Sturtz, L. A., Defossez, P. A., Culotta, V. C., Fink, G. R., and Guarente, L. (2002). Calorie restriction extends Saccharomyces cerevisiae lifespan by increasing respiration. Nature 418, 344 348. Liszt, G., Ford, E., Kurtev, M., and Guarente, L. (2005). Mouse Sir2 homolog SIRT6 is a nuclear ADP ribosyltransferase. J Biol Chem 280, 2131321320. Liu, T., Liu, P. Y., and Marshall, G. M. (2009). The critical role of the class III histone deacetylase SIRT1 in cancer. Cancer Res 69 17021705. Luo, J., Nikolaev, A. Y., Imai, S., Chen, D., Su, F., Shiloh, A., Guarente, L., and Gu, W. (2001). Negative control of p53 by Sir2alpha promotes cell survival under stress. Cell 107, 137148. Luo, R. X., Postigo A. A., and Dean, D. C. (1998). Rb interacts with histone deacetylase to repress transcription. Cell 92, 463 473. Luongo, C., Moser, A. R., Gledhill, S., and Dove, W. F. (1994). Loss of Apc+ in intestinal adenomas from Min mice. Cancer Res 54, 59475952. Markowitz, S. D., and Bertagnolli, M. M. (2009). Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med 361, 2449 2460. Marks, P. A., and Breslow, R. (2007). Dimethyl sulfoxide to vorinostat: development of this histone deacetyl ase inhibitor as an anticancer drug. Nat Biotechnol 25 84 90. Matlashewski, G., Lamb, P., Pim, D., Peacock, J., Crawford, L., and Benchimol, S. (1984). Isolation and characterization of a human p53 cDNA clone: expression of the human p53 gene. EMBO J 3 32573262. Matsuyama, A., Shimazu, T., Sumida, Y., Saito, A., Yoshimatsu, Y., SeigneurinBerny, D., Osada, H., Komatsu, Y., Nishino, N., Khochbin, S. et al. (2002). In vivo destabilization of dynamic microtubules by HDAC6mediated deacetylation. EMBO J 2 1 68206831. McBurney, M. W., Yang, X., Jardine, K., Hixon, M., Boekelheide, K., Webb, J. R., Lansdorp, P. M., and Lemieux, M. (2003). The mammalian SIR2alpha protein has a role in embryogenesis and gametogenesis. Mol Cell Biol 23, 38 54. Michan, S., and Sinclair, D. (2007). Sirtuins in mammals: insights into their biological function. Biochem J 404, 1 13. Michishita, E., McCord, R. A., Berber, E., Kioi, M., Padilla Nash, H., Damian, M., Cheung, P., Kusumoto, R., Kawahara, T. L., Barrett, J. C. et al. (2008). SIRT6 is a histone H3 lysine 9 deacetylase that modulates telomeric chromatin. Nature 452 492 496. Michishita, E., McCord, R. A., Boxer, L. D., Barber, M. F., Hong, T., Gozani, O., and Chua, K. F. (2009). Cell cycledependent deacetylation of tel omeric histone H3 lysine K56 by human SIRT6. Cell Cycle 8 26642666. Michishita, E., Park, J. Y., Burneskis, J. M., Barrett, J. C., and Horikawa, I. (2005). Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT prot eins. Mol Biol Cell 16, 46234635.

PAGE 129

117 Milburn, M. V., Tong, L., deVos, A. M., Brunger, A., Yamaizumi, Z., Nishimura, S., and Kim, S. H. (1990). Molecular switch for signal transduction: structural differences between active and inactive forms of protooncogenic ras proteins. Science 247, 939945. Milne, J. C., Lambert, P. D., Schenk, S., Carney, D. P., Smith, J. J., Gagne, D. J., Jin, L., Boss, O., Perni, R. B., Vu, C. B., et al. (2007). Small molecule activators of SIRT1 as therapeutics for the treatment of t ype 2 diabetes. Nature 450 712 716. Miska, E. A., Karlsson, C., Langley, E., Nielsen, S. J., Pines, J., and Kouzarides, T. (1999). HDAC4 deacetylase associates with and represses the MEF2 transcription factor. EMBO J 18, 5099 5107. Miyashita, T., and Reed, J. C. (1995). Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293299. Moser, A. R., Pitot, H. C., and Dove, W. F. (1990). A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. S cience 247, 322324. Mostoslavsky, R., Chua, K. F., Lombard, D. B., Pang, W. W., Fischer, M. R., Gellon, L., Liu, P., Mostoslavsky, G., Franco, S., Murphy, M. M. et al. (2006). Genomic instability and aging like phenotype in the absence of mammalian SIRT 6. Cell 124, 315329. Motta, M. C., Divecha, N., Lemieux, M., Kamel, C., Chen, D., Gu, W., Bultsma, Y., McBurney, M., and Guarente, L. (2004). Mammalian SIRT1 represses forkhead transcription factors. Cell 116, 551 563. Moynihan, K. A., Grimm, A. A., Plu eger, M. M., Bernal Mizrachi, E., Ford, E., Cras Meneur, C., Permutt, M. A., and Imai, S. (2005). Increased dosage of mammalian Sir2 in pancreatic beta cells enhances glucose stimulated insulin secretion in mice. Cell Metab 2 105117. Muller, S., Ledl, A ., and Schmidt, D. (2004). SUMO: a regulator of gene expression and genome integrity. Oncogene 23, 19982008. Murayama, A., Ohmori, K., Fujimura, A., Minami, H., Yasuzawa Tanaka, K., Kuroda, T., Oie, S., Daitoku, H., Okuwaki, M., Nagata, K. et al. (2008) Epigenetic control of rDNA loci in response to intracellular energy status. Cell 133, 627639. Nakagawa, T., Lomb, D. J., Haigis, M. C., and Guarente, L. (2009). SIRT5 Deacetylates carbamoyl phosphate synthetase 1 and regulates the urea cycle. Cell 137, 560570. Napper, A. D., Hixon, J., McDonagh, T., Keavey, K., Pons, J. F., Barker, J., Yau, W. T., Amouzegh, P., Flegg, A., Hamelin, E. et al. (2005). Discovery of indoles as potent and selective inhibitors of the deacetylase SIRT1. J Med Chem 48, 80458 054. Nemoto, S., Fergusson, M. M., and Finkel, T. (2004). Nutrient availability regulates SIRT1 through a forkhead dependent pathway. Science 306, 2105 2108. Nemoto, S., Fergusson, M. M., and Finkel, T. (2005). SIRT1 functionally interacts with the metabolic regulator and transcriptional coactivator PGC 1{alpha}. J Biol Chem 280, 1645616460.

PAGE 130

118 Nie, Y., Erion, D. M., Yuan, Z., Dietrich, M., Shulman, G. I., Horvath, T. L., and Gao, Q. (2009). STAT3 inhibition of gluconeogenesis is downregulated by SirT1. Nat Cell Biol 11, 492500. North, B. J., Marshall, B. L., Borra, M. T., Denu, J. M., and Verdin, E. (2003). The human Sir2 ortholog, SIRT2, is an NAD+ dependent tubulin deacetylase. Mol Cell 11, 437444. Nowell, P. C. (1976). The clonal evolution of tumor c ell populations. Science 194, 23 28. Olsson, A., Manzl, C., Strasser, A., and Villunger, A. (2007). How important are post translational modifications in p53 for selectivity in target gene transcription and tumour suppression? Cell Death Differ 14 1561 1 575. Onyango, P., Celic, I., McCaffery, J. M., Boeke, J. D., and Feinberg, A. P. (2002). SIRT3, a human SIR2 homologue, is an NAD dependent deacetylase localized to mitochondria. Proc Natl Acad Sci U S A 99 1365313658. Ota, H., Tokunaga, E., Chang, K., Hikasa, M., Iijima, K., Eto, M., Kozaki, K., Akishita, M., Ouchi, Y., and Kaneki, M. (2006). Sirt1 inhibitor, Sirtinol, induces senescence like growth arrest with attenuated Ras MAPK signaling in human cancer cells. Oncogene 25, 176185. Pacholec, M., Chr unyk, B. A., Cunningham, D., Flynn, D., Griffith, D. A., Griffor, M., Loulakis, P., Pabst, B., Qiu, X., Stockman, B., et al. (2010). SRT1720, SRT2183, SRT1460, and resveratrol are not direct activators of SIRT1. J Biol Chem. Pajak, B., Orzechowski, A., an d Gajkowska, B. (2007). Molecular basis of sodium butyratedependent proapoptotic activity in cancer cells. Adv Med Sci 52, 83 88. Pediconi, N., Guerrieri, F., Vossio, S., Bruno, T., Belloni, L., Schinzari, V., Scisciani, C., Fanciulli, M., and Levrero, M (2009). hSirT1 dependent regulation of the PCAFE2F1p73 apoptotic pathway in response to DNA damage. Mol Cell Biol 29, 19891998. Perrod, S., Cockell, M. M., Laroche, T., Renauld, H., Ducrest, A. L., Bonnard, C., and Gasser, S. M. (2001). A cytosolic N AD dependent deacetylase, Hst2p, can modulate nucleolar and telomeric silencing in yeast. EMBO J 20 197 209. Pflum, M. K., Tong, J. K., Lane, W. S., and Schreiber, S. L. (2001). Histone deacetylase 1 phosphorylation promotes enzymatic activity and complex formation. J Biol Chem 276, 4773347741. Picard, F., Kurtev, M., Chung, N., Topark Ngarm, A., Senawong, T., Machado De Oliveira, R., Leid, M., McBurney, M. W., and Guarente, L. (2004). Sirt1 promotes fat mobilization in white adipocytes by repressing PP AR gamma. Nature 429 771 776. Pitot, H. C., and Dragan, Y. P. (1991). Facts and theories concerning the mechanisms of carcinogenesis. FASEB J 5 22802286. Ramsey, K M., Mills, K. F., Satoh, A., and Imai, S. (2008). Age associated loss of Sirt1 mediated enhancement of glucose stimulated insulin secretion in beta cell specific Sirt1 overexpressing (BESTO) mice. Aging Cell 7 78 88.

PAGE 131

119 Reed, N. A., Cai, D., Blasius, T. L ., Jih, G. T., Meyhofer, E., Gaertig, J., and Verhey, K. J. (2006). Microtubule acetylation promotes kinesin1 binding and transport. Curr Biol 16, 21662172. Richon, V. M., Emiliani, S., Verdin, E., Webb, Y., Breslow, R., Rifkind, R. A., and Marks, P. A. (1998). A class of hybrid polar inducers of transformed cell differentiation inhibits histone deacetylases. Proc Natl Acad Sci U S A 95, 3003 3007. Riesen, M., and Morgan, A. (2009). Calorie restriction reduces rDNA recombination independently of rDNA sil encing. Aging Cell 8 624 632. Robertson, K. D., AitSi Ali, S., Yokochi, T., Wade, P. A., Jones, P. L., and Wolffe, A. P. (2000). DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2F responsive promoters. Nat Genet 25 338 3 42. Rodgers, J. T., Lerin, C., Haas, W., Gygi, S. P., Spiegelman, B. M., and Puigserver, P. (2005). Nutrient control of glucose homeostasis through a complex of PGC 1alpha and SIRT1. Nature 434, 113118. Rogina, B., and Helfand, S. L. (2004). Sir2 mediat es longevity in the fly through a pathway related to calorie restriction. Proc Natl Acad Sci U S A 101 15998 16003. Roth, G. S., Ingram, D. K., and Lane, M. A. (1999). Calorie restriction in primates: will it work and how will we know? J Am Geriatr Soc 4 7 896903. Rountree, M. R., Bachman, K. E., and Baylin, S. B. (2000). DNMT1 binds HDAC2 and a new co repressor, DMAP1, to form a complex at replication foci. Nat Genet 25, 269277. Sakaguchi, K., Herrera, J. E., Saito, S., Miki, T., Bustin, M., Vassilev A., Anderson, C. W., and Appella, E. (1998). DNA damage activates p53 through a phosphorylationacetylation cascade. Genes Dev 12, 28312841. Salminen, A., and Kaarniranta, K. (2009). SIRT1: regulation of longevity via autophagy. Cell Signal 21, 13561360. Saltz, L. B., Cox, J. V., Blanke, C., Rosen, L. S., Fehrenbacher, L., Moore, M. J., Maroun, J. A., Ackland, S. P., Locker, P. K., Pirotta, N., et al. (2000). Irinotecan plus fluorouracil and leucovorin for metastatic colorectal cancer. Irinotecan Study Group. N Engl J Med 343, 905914. Sambucetti, L. C., Fischer, D. D., Zabludoff, S., Kwon, P. O., Chamberlin, H., Trogani, N., Xu, H., and Cohen, D. (1999). Histone deacetylase inhibition selectively alters the activity and expression of cell cycle proteins leading to specific chromatin acetylation and antiproliferative effects. J Biol Chem 274 3494034947. Sasaki, T., Maier, B., Koclega, K. D., Chruszcz, M., Gluba, W., Stukenberg, P. T., Minor, W., and Scrable, H. (2008). Phosphorylation regulates SIRT 1 function. PLoS One 3 e4020. Scher, M. B., Vaquero, A., and Reinberg, D. (2007). SirT3 is a nuclear NAD+ dependent histone deacetylase that translocates to the mitochondria upon cellular stress. Genes Dev 21, 920928.

PAGE 132

120 Schlicker, C., Gertz, M., Papatheodorou, P., Kachholz, B., Becker, C. F., and Steegborn, C. (2008). Substrates and regulation mechanisms for the human mitochondrial sirtuins Sirt3 and Sirt5. J Mol Biol 382, 790 801. Sealy, L., and Chalkley, R. (1978). The effect of sodium butyrate on histo ne modification. Cell 14, 115 121. Segal, N. H., and Saltz, L. B. (2009). Evolving treatment of advanced colon cancer. Annu Rev Med 60, 207219. SeigneurinBerny, D., Verdel, A., Curtet, S., Lemercier, C., Garin, J., Rousseaux, S., and Khochbin, S. (2001 ). Identification of components of the murine histone deacetylase 6 complex: link between acetylation and ubiquitination signaling pathways. Mol Cell Biol 21, 80358044. Sengupta, N., and Seto, E. (2004). Regulation of histone deacetylase activities. J Cell Biochem 93, 57 67. Sherr, C. J. (2004). Principles of tumor suppression. Cell 116, 235246. Shi, T., Wang, F., Stieren, E., and Tong, Q. (2005). SIRT3, a mitochondrial sirtuin deacetylase, regulates mitochondrial function and thermogenesis in brown adipocytes. J Biol Chem 280 13560 13567. Sinclair, D. A., and Guarente, L. (1997). Extrachromosomal rDNA circles -a cause of aging in yeast. Cell 91, 10331042. Smith, J. (2002). Human Sir2 and the 'silencing' of p53 activity. Trends Cell Biol 12, 404 406. Solomon, J. M., Pasupuleti, R., Xu, L., McDonagh, T., Curtis, R., DiStefano, P. S., and Huber, L. J. (2006). Inhibition of SIRT1 catalytic activity increases p53 acetylation but does not alter cell survival following DNA damage. Mol Cell Biol 26, 28 38. Strahl, B. D., and Allis, C. D. (2000). The language of covalent histone modifications. Nature 403, 41 45. Stunkel, W., Peh, B. K., Tan, Y. C., Nayagam, V. M., Wang, X., Salto Tellez, M., Ni, B., Entzeroth, M., and Wood, J. (2007). Function of the SIRT1 protein deacetylase in cancer. Biotechnol J 2 1360 1368. Sun, C., Zhang, F., Ge, X., Yan, T., Chen, X., Shi, X., and Zhai, Q. (2007). SIRT1 improves insulin sensitivity under insulinresistant conditions by repressing PTP1B. Cell Metab 6 307319. Takami, Y., and Nakayama, T. (2000). N terminal region, C terminal region, nuclear export signal, and deacetylation activity of histone deacetylase 3 are essential for the viability of the DT40 chicken B cell line. J Biol Chem 275, 16191 16201. Tanner, K. G., Landry, J., Sternglanz, R., and Denu, J. M. (2000). Silent information regulator 2 family of NADdependent histone/protein deacetylases generates a unique product, 1O acetyl ADP ribose. Proc Natl Acad Sci U S A 97 1417814182.

PAGE 133

121 Tanno, M., Sakamoto, J., Miura, T., Shimamoto, K., and Horio, Y. (2007). Nucleocytoplasmic shuttling of the NAD+ dependent histone deacetylase SIRT1. J Biol Chem 282, 6823 6832. Taunton, J., Hassig, C. A., and Schreiber, S. L. (1996). A mammalian histone deacetylase related to the yeast transcriptional regulator Rpd3p. Science 272 408411. Tissenbaum, H. A., and Guarente, L. (2001). Increased dosage of a sir 2 gene extends lifespan in Caenorhabditis elegans. Nature 410 227 230. Tontonoz, P., Hu, E., and Spiegelman, B. M. (1994). Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipidactivated transcription factor. Cell 79, 11471156. Tsang, A. W., and EscalanteSemerena, J. C. (1998). CobB, a new member of the SIR2 family of eucaryotic regulatory proteins, is required to compensate for the lack of nicotinate mononucleotide:5,6dimethylbenzimidazole phosphoribosyltransferase activity in cobT mutants during cobalamin biosynthesis in Salmonella typhimurium LT2. J Biol Chem 273, 3178831794. Ungerstedt, J. S., Sowa, Y ., Xu, W. S., Shao, Y., Dokmanovic, M., Perez, G., Ngo, L., Holmgren, A., Jiang, X., and Marks, P. A. (2005). Role of thioredoxin in the response of normal and transformed cells to histone deacetylase inhibitors. Proc Natl Acad Sci U S A 102, 673678. Van den Wyngaert, I., de Vries, W., Kremer, A., Neefs, J., Verhasselt, P., Luyten, W. H., and Kass, S. U. (2000). Cloning and characterization of human histone deacetylase 8. FEBS Lett 478, 77 83. van der Horst, A., Tertoolen, L. G., de Vries Smits, L. M., F rye, R. A., Medema, R. H., and Burgering, B. M. (2004). FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2(SIRT1). J Biol Chem 279 2887328879. Van Lint, C., Emiliani, S., and Verdin, E. (1996). The expression of a s mall fraction of cellular genes is changed in response to histone hyperacetylation. Gene Expr 5 245 253. Vannini, A., Volpari, C., Filocamo, G., Casavola, E. C., Brunetti, M., Renzoni, D., Chakravarty, P., Paolini, C., De Francesco, R., Gallinari, P. et al. (2004). Crystal structure of a eukaryotic zinc dependent histone deacetylase, human HDAC8, complexed with a hydroxamic acid inhibitor. Proc Natl Acad Sci U S A 101 15064 15069. Vaquero, A., Scher, M., Erdjument Bromage, H., Tempst, P., Serrano, L., and Reinberg, D. (2007). SIRT1 regulates the histone methyl transferase SUV39H1 during heterochromatin formation. Nature 450 440 444. Vaquero, A., Scher, M., Lee, D., Erdjument Bromage, H., Tempst, P., and Reinberg, D. (2004). Human SirT1 interacts with histone H1 and promotes formation of facultative heterochromatin. Mol Cell 16, 93105. Vaquero, A., Scher, M. B., Lee, D. H., Sutton, A., Cheng, H. L., Alt, F. W., Serrano, L., Sternglanz, R., and Reinberg, D. (2006). SirT2 is a histone deacetylase with preference for histone H4 Lys 16 during mitosis. Genes Dev 20, 12561261.

PAGE 134

122 Vaziri, H., Dessain, S. K., Ng Eaton, E., Imai, S. I., Frye, R. A., Pandita, T. K., Guarente, L., and Weinberg, R. A. (2001). hSIR2(SIRT1) functions as an NAD dependent p53 deacetylase. Cell 107, 149159. Verdel, A., Curtet, S., Brocard, M. P., Rousseaux, S., Lemercier, C., Yoshida, M., and Khochbin, S. (2000). Active maintenance of mHDA2/mHDAC6 histonedeacetylase in the cytoplasm. Curr Biol 10, 747749. Verdel, A., and Khochbin, S (1999). Identification of a new family of higher eukaryotic histone deacetylases. Coordinate expression of differentiationdependent chromatin modifiers. J Biol Chem 274 2440 2445. Verdin, E. (2007). AROuSing SIRT1: identification of a novel endogenous SIRT1 activator. Mol Cell 28, 354356. Verger, A., Perdomo, J., and Crossley, M. (2003). Modification with SUMO. A role in transcriptional regulation. EMBO Rep 4 137 142. Vidali, G., Boffa, L. C., Bradbury, E. M., and Allfrey, V. G. (1978). Butyrate su ppression of histone deacetylation leads to accumulation of multiacetylated forms of histones H3 and H4 and increased DNase I sensitivity of the associated DNA sequences. Proc Natl Acad Sci U S A 75, 22392243. Villagra, A., Cheng, F., Wang, H. W., Suarez I., Glozak, M., Maurin, M., Nguyen, D., Wright, K. L., Atadja, P. W., Bhalla, K. et al. (2009). The histone deacetylase HDAC11 regulates the expression of interleukin 10 and immune tolerance. Nat Immunol 10 92 100. Waldman, T., Kinzler, K. W., and Vog elstein, B. (1995). p21 is necessary for the p53mediated G1 arrest in human cancer cells. Cancer Res 55, 51875190. Wang, A. H., Kruhlak, M. J., Wu, J., Bertos, N. R., Vezmar, M., Posner, B. I., BazettJones, D. P., and Yang, X. J. (2000). Regulation of histone deacetylase 4 by binding of 14 3 3 proteins. Mol Cell Biol 20, 69046912. Wang, A. H., and Yang, X. J. (2001). Histone deacetylase 4 possesses intrinsic nuclear import and export signals. Mol Cell Biol 21, 59926005. Wang, C., Chen, L., Hou, X., Li, Z., Kabra, N., Ma, Y., Nemoto, S., Finkel, T., Gu, W., Cress, W. D., and Chen, J. (2006). Interactions between E2F1 and SirT1 regulate apoptotic response to DNA damage. Nat Cell Biol 8 1025 1031. Wang, F., Nguyen, M., Qin, F. X., and Tong, Q. (2007). SIRT2 deacetylates FOXO3a in response to oxidative stress and caloric restriction. Aging Cell 6 505514. Wang, R. H., Sengupta, K., Li, C., Kim, H. S., Cao, L., Xiao, C., Kim, S., Xu, X., Zheng, Y., Chilton, B. et al. (2008a). Impaired DNA damage response, genome instability, and tumorigenesis in SIRT1 mutant mice. Cancer Cell 14, 312 323. Wang, R. H., Zheng, Y., Kim, H. S., Xu, X., Cao, L., Luhasen, T., Lee, M. H., Xiao, C., Vassilopoulos, A., Chen, W. et al. (2008b). Interplay among BRCA1, SIRT1, and Survivin during BRCA1associated tumorigenesis. Mol Cell 32, 11 20.

PAGE 135

123 Weindruch, R., Walford, R. L., Fligiel, S., and Guthrie, D. (1986). The retardation of aging in mice by dietary restriction: longevity, cancer, immunity and lifetime energy intake. J Nu tr 116, 641654. Wen, Y. D., Perissi, V., Staszewski, L. M., Yang, W. M., Krones, A., Glass, C. K., Rosenfeld, M. G., and Seto, E. (2000). The histone deacetylase 3 complex contains nuclear receptor corepressors. Proc Natl Acad Sci U S A 97, 7202 7207. W estendorf, J. J., Zaidi, S. K., Cascino, J. E., Kahler, R., van Wijnen, A. J., Lian, J. B., Yoshida, M., Stein, G. S., and Li, X. (2002). Runx2 (Cbfa1, AML3) interacts with histone deacetylase 6 and represses the p21(CIP1/WAF1) promoter. Mol Cell Biol 22, 7982 7992. Wojcik, M., Mac Marcjanek, K., and Wozniak, L. A. (2009). Physiological and pathophysiological functions of SIRT1. Mini Rev Med Chem 9 386 394. Wong, S., and Weber, J. D. (2007). Deacetylation of the retinoblastoma tumour suppressor protein by SIRT1. Biochem J 407, 451460. Xu, W. S., Parmigiani, R. B., and Marks, P. A. (2007). Histone deacetylase inhibitors: molecular mechanisms of action. Oncogene 26 55415552. Yamasaki, L. (1999). Balancing proliferation and apoptosis in vivo: the Goldi locks theory of E2F/DP action. Biochim Biophys Acta 1423, M9 15. Yang, B., Zwaans, B. M., Eckersdorff, M., and Lombard, D. B. (2009). The sirtuin SIRT6 deacetylates H3 K56Ac in vivo to promote genomic stability. Cell Cycle 8 26622663. Yang, W. M., Inouye, C., Zeng, Y., Bearss, D., and Seto, E. (1996). Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proc Natl Acad Sci U S A 93 1284512850. Yang, W. M., Tsai, S. C., Wen, Y. D., Fe jer, G., and Seto, E. (2002). Functional domains of histone deacetylase 3. J Biol Chem 277, 94479454. Yang, W. M., Yao, Y. L., Sun, J. M., Davie, J. R., and Seto, E. (1997). Isolation and characterization of cDNAs corresponding to an additional member of the human histone deacetylase gene family. J Biol Chem 272, 28001 28007. Yang, X. J., and Gregoire, S. (2005). Class II histone deacetylases: from sequence to function, regulation, and clinical implication. Mol Cell Biol 25, 28732884. Yang, X. J., and Seto, E. (2008). The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men. Nat Rev Mol Cell Biol 9 206218. Yang, Y., Fu, W., Chen, J., Olashaw, N., Zhang, X., Nicosia, S. V., Bhalla, K., and Bai, W. (2007). SIRT1 sumoylation regulates its deacetylase activity and cellular response to genotoxic stress. Nat Cell Biol 9 12531262. Yang, Y., Hou, H., Haller, E. M., Nicosia, S. V., and Bai, W. (2005). Suppression of FOXO1 activity by FHL2 through SIRT1 mediated deacetylation. EMB O J 24 1021 1032.

PAGE 136

124 Yeung, F., Hoberg, J. E., Ramsey, C. S., Keller, M. D., Jones, D. R., Frye, R. A., and Mayo, M. W. (2004). Modulation of NFkappaB dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J 23, 23692380. Yoshida, M., Horinouchi, S., and Beppu, T. (1995). Trichostatin A and trapoxin: novel chemical probes for the role of histone acetylation in chromatin structure and function. Bioessays 17, 423430. You, A., Tong, J. K., Grozinger, C. M., and Schreiber, S. L. (2001). CoR EST is an integral component of the CoREST human histone deacetylase complex. Proc Natl Acad Sci U S A 98, 1454 1458. Yuan, J., Minter Dykhouse, K., and Lou, Z. (2009). A c Myc SIRT1 feedback loop regulates cell growth and transformation. J Cell Biol 185, 203 211. Yuan, Z., and Seto, E. (2007). A functional link between SIRT1 deacetylase and NBS1 in DNA damage response. Cell Cycle 6 2869 2871. Zhang, C. L., McKinsey, T. A., Lu, J. R., and Olson, E. N. (2001). Association of COOH terminal binding protei n (CtBP) and MEF2interacting transcription repressor (MITR) contributes to transcriptional repression of the MEF2 transcription factor. J Biol Chem 276, 3539. Zhang, Q., Wang, S. Y., Fleuriel, C., Leprince, D., Rocheleau, J. V., Piston, D. W., and Goodm an, R. H. (2007). Metabolic regulation of SIRT1 transcription via a HIC1:CtBP corepressor complex. Proc Natl Acad Sci U S A 104 829 833. Zhang, X., Ozawa, Y., Lee, H., Wen, Y. D., Tan, T. H., Wadzinski, B. E., and Seto, E. (2005). Histone deacetylase 3 ( HDAC3) activity is regulated by interaction with protein serine/threonine phosphatase 4. Genes Dev 19, 827839. Zhao, W., Kruse, J. P., Tang, Y., Jung, S. Y., Qin, J., and Gu, W. (2008). Negative regulation of the deacetylase SIRT1 by DBC1. Nature 451 587 590. Zhou, X., Marks, P. A., Rifkind, R. A., and Richon, V. M. (2001). Cloning and characterization of a histone deacetylase, HDAC9. Proc Natl Acad Sci U S A 98, 1057210577. Zhou, X., Richon, V. M., Rifkind, R. A., and Marks, P. A. (2000a). Identifica tion of a transcriptional repressor related to the noncatalytic domain of histone deacetylases 4 and 5. Proc Natl Acad Sci U S A 97, 10561061. Zhou, X., Richon, V. M., Wang, A. H., Yang, X. J., Rifkind, R. A., and Marks, P. A. (2000b). Histone deacetylas e 4 associates with extracellular signal regulated kinases 1 and 2, and its cellular localization is regulated by oncogenic Ras. Proc Natl Acad Sci U S A 97, 14329 14333. Zhu, L. (2005). Tumour suppressor retinoblastoma protein Rb: a transcriptional regul ator. Eur J Cancer 41, 24152427.

PAGE 137

125 Zhu, P., Martin, E., Mengwasser, J., Schlag, P., Janssen, K. P., and Gottlicher, M. (2004). Induction of HDAC2 expression upon loss of APC in colorectal tumorigenesis. Cancer Cell 5 455463. Zschoernig, B., and Mahlknec ht, U. (2009). Carboxy terminal phosphorylation of SIRT1 by protein kinase CK2. Biochem Biophys Res Commun 381, 372377.

PAGE 138

About the Author Neha Kabra attended the University of Delhi, India from 19992002 where she received her Bachelor of Science degree in Microbiology. She then joined the Genetics program at the University of Delhi where she earned her Master of Science degree in 2004. During this time she also worked as a summer intern in the lab of Dr. Veronica Rodriguez at the TATA Institute of Fundamental Research, Bombay, where she gained valuable experience in researching fly genetics. She also passed the CSIR UGC National Eligibility Test for Lectureship in Life Sciences, India. In August 2004, she was accepted in the Cancer Biology Ph.D. program at the H. Lee Moffitt Cancer Center and Research Institute. Here she joined the lab of Dr. Jiandong Chen and completed her d issertation work in the field of Sirtuins. Her work aimed at studying the role of SIRT1 in cancer.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003373
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Kabra, Neha.
0 245
A potential tumor suppressive role of sirt1 in cancer
h [electronic resource] /
by Neha Kabra.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: The NAD-dependent deacetylase SIRT1 regulates several factors involved in stress response and cell survival but its function in cancer is largely unknown. Research suggests that SIRT1 influences several transcription factors and molecules that are important components of pathways often deregulated in cancer. Our experiments have shown that SIRT1 knock down by short hairpin RNA accelerates tumor xenograft formation by HCT116 colon cancer cells, whereas SIRT1 overexpression inhibits tumor formation. We have also found that, pharmacological inhibition of SIRT1 stimulates cell proliferation under conditions of growth factor deprivation suggesting a tumor suppressive function of SIRT1. Paradoxically, SIRT1 inhibition sensitizes the same cells to apoptosis by chemotherapeutic drugs. Immunohistochemical staining of a colon tumor microarray revealed high SIRT1 expression levels in normal colon mucosa and benign adenomas. SIRT1 overexpression was observed in nearly 25 percent of stage one or two or three colorectal adenocarcinomas but rarely found in advanced stage four tumors. Furthermore, about 30 percent of carcinomas showed lower than normal SIRT1 expression. These results suggest a pleiotropic effect of SIRT1 in cancer, i.e., anti-proliferative as well as anti-apoptotic. Further experiments along these lines and examination of a larger patient cohort could provide a rationale for the use of SIRT1 activators and inhibitors in the prevention and treatment of cancer.
590
Advisor: Jiandong Chen, Ph.D.
653
Sirtuin
Histone deacetylase
Sir2
Cell proliferation
Colon cancer
690
Dissertations, Academic
z USF
x Cancer Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3373